RU2391409C1 - METHOD OF DECTING PASTEURELLA AND/OR Pseudomonas Aeruginosa bacteria - Google Patents

Abstract

FIELD: chemistry; biochemistry. ^ SUBSTANCE: invention relates to veterinary microbiology and biotechnology and specifically to methods of determining genomic DNA of bacteria. Proposed method of determining genomic DNA of Pasteurella and/or P.aeruginosa bacteria involves collection of samples and analysing the biomaterial via a polymerase chain reaction simultaneously with two pairs of primers. Further, the polymerase chain reaction products which are specific for Pasteurella and P.aeruginosa are separated through eletrophoresis. ^ EFFECT: invention enables detection of Pasteurella and/or Paeruginosa bacteria. ^ 3 tbl, 4 ex

Description

The invention relates to veterinary microbiology and biotechnology, and in particular to methods for determining the genomic deoxyribonucleic acid (DNA) of microorganisms.

 Microorganisms of the genus Pasteurella, for example, Pasteurella multocida, Pasteurella galisepticum, Pasteurella haemolyticum, are often localized in the respiratory system of poultry and animals. The occurrence of pseudomonosis caused by Pseudomonas aeruginosa is also often accompanied by pathology of the respiratory system, therefore, on the one hand, there is a need for differential diagnosis of pasteurellosis and pseudomonosis, on the other hand, it is necessary to control the carriage of these infections by examining biomaterial samples from the respiratory system. Thus, the development of more affordable sufficiently accurate methods of molecular diagnostics is relevant.

A known method for detecting Pseudomonas aeruginosa DNA using a polymerase chain reaction (Theodore Spilker, Tom Coenye, Peter Vandamme, and John J. LiPuma PCR-Based Assay for Differentiation of Pseudomonas aeruginosa from Other Pseudomonas Species Recovered from Cystic Fibrosis Patients / Journal of Clinical Micro May 2004, p.2074-2079, Vol. 42, No.5). For the reaction, primers PA-SS-F GGGGGATCTTCGGACCTCA, PA-SS-R TCCTTAGAGTGCCCACCCG are used, the amplification program consists of the following steps: 95 ° C - 40 sec; 58 ° С - 40 sec; 72 ° С - 40 sec (30 cycles).

However, this method does not simultaneously detect the genomic DNA of pasteurells, and is also claimed by the authors as a way of direct detection of Pseudomonas aeruginosa in people with fibrous cystitis. Thus, this method is not adapted for the study of the organism of birds.

The closest in technical essence to the claimed and taken as a prototype is a method based on multiplex polymerase chain reaction (PCR). (Henrik Christensen, Magne Bisgaard, Jesper Larsen, and John Elmerdahl Olsen PCR-Detection of Hemophilus paragallinarum, Hemophilus somnus, Mannheimia (Pasteurella) hemolytica, Mannheimia spp., Pasteurella trehalosi, and Pasteurella trehalosi, and biological Microdials pathogens. Vol. 216 p. 259-273). In this method, it is possible to simultaneously detect the genomic DNA of several types of microorganisms. The disadvantage of this method is the inability to determine the genomic DNA of P.aeruginosa simultaneously with the detection of microorganisms of the genus Pasteurella.

The technical task of the proposed solution is the simultaneous identification of microorganisms of the genus Pasteurella and Pseudomonas aeruginosa using oligonucleotide primers that allow for PCR in duplex mode.

The stated technical problem is solved in that in a method for detecting microorganisms of the genus Pasteurella and / or Pseudomonas aeruginosa, comprising selecting biomaterial from internal organs, examining the genomic DNA of microorganisms of the genus Pasteurella and Pseudomonas aeruginosa in a polymerase chain reaction using two pairs of primers, according to the invention, To detect the presence in the biological material of microorganisms of the Pasteurella genus, oligonucleotide primers are used, complementary regions of the 16 S gene of the ribosomal RNA of microorganisms of the Pasteurella genus, having the following nucleotide composition: 5'-TGCCATAAGATGAGCCCCCAAGT-3 ', 5'-GCCCTTTACGCCCAGTTA-3', and to determine the presence of Pseudomonas aeruginosa biological material, synthetic oligonucleotide primers complementary to the putative protein nucleotide nucleotide nucleotide nucleotide nucleotide nucleotide nucleotide nucleotide nucleotide nucleotide nucleotide composition are used: 5'-GCTATCCCCCCTGGTTCCATT-3 'and 5'-GACATCTCCATAGGGACCGC-3, the PCR products are separated by horizontal electrophoresis in 2% agarose, PCR results are taken into account by visualizing the ethidium bromide stained PCR product in ultraviolet light; in the presence of genomic DNA of microorganisms of the Pasteurella genus in the studied biomaterial, an amplicon of 360 bp is formed, and in the presence of genomic DNA of Pseudomonas aeruginosa 283 bp

The method is as follows.

Material: samples of pathological material of farm animals or poultry.

Material sampling: samples of internal organs (e.g., liver) are taken by any method suitable for subsequent PCR formulation.

In the traditional way, DNA is isolated.

For PCR, the reaction is carried out according to the following temperature conditions (table 1):

Table 1 stage temperature, ° С number of cycles time min one 2 3 four one 95 one pause 2 95 one 3 3 95 40 0.5 63 40 0.5 72 40 0.5

The reaction uses primers with the following nucleotide sequences:

5'-TGCCATAAGATGAGCCCAAGT-3 ',

5'-GCCCTTTACGCCCAGTTA-3 '

5'-GCTATCCCCCTGGTTCCATT-3 '

5'-GACATCTCCATAGGGACCGC-3.

PCR products are separated by horizontal electrophoresis in 2% agarose. PCR results are taken into account by visualizing an ethidium bromide-stained PNR product (amplicon) in ultraviolet light. In the case of a positive reaction to P. aeruginosa, a 283 bp DNA fragment appears in electrophoresis, and in the case of a positive reaction to microorganisms of the Pasteurella genus, the amplicon is 360 bp in size.

Examples are provided to illustrate the method.

Example 1. For the study, material was selected from 10 birds that died with signs of pneumonia (lungs).

Genomic DNA was isolated by a standard silico-sorption method.

PCR was performed in a final volume of 25 μl containing 67 mM Tris-HCl (pH 8.9), 16 mM ammonium sulfate; 2.4 mM MgCl ₂ ; 0.01% Tween 20; 0.2 mM dNTP; 0.5 μM solutions of oligonucleotide primers, 5'-TGCCATAAGATGAGCCCAAGT-3 ', 5'-GCCCTTTACGCCCAGTTA-3', 5'-GCTATCCCCCTGGTTCCATT-3, 5'-GACATCTCCATAGGGACCGC-3. 1ED Taq polymerase and 5 μl of the test sample. In addition to samples, reactions were set with obviously positive and negative controls.

Search for primers was carried out using the programs "Vektor NTI Suit", "Pimer premier 5.0". The specificity of the interaction is modeled using the Blast program based on the nucleotide sequences of various types of microorganisms presented in the GenBank database (http://www.ncbi.nlm.nih.gov/Genbank/GenbankSearch.html). To exclude competitive inhibition of the reaction by primers and amplicons, additional attention was paid to the selection of primers that do not form heteroduplexes, which have similar annealing temperatures and form amplicons that differ in length by at least 20 bp. and not more than 100 bp

The reaction was carried out on a Tertsik thermocycler with initial denaturation at 95 ° C for 1 min, then for 45 cycles with denaturation at 95 ° C for 30 sec, annealing at 63 ° C for 30 sec, and synthesis at 72 ° C for 30 sec.

NDP products were separated by horizontal electrophoresis in 2% agarose. PCR results were taken into account by visualizing ethidium bromide stained PCR product (amplicon) in ultraviolet light. A DNA fragment of 283 bp was detected in the samples, which made it possible to establish the fact of infection of P. aeruginosa chickens.

Example 2. In order to confirm the specificity of the PCR used, this reaction was performed with the genomic DNA of various microorganisms and viruses that may be present in the bird organism (Table 2).

table 2 Sample number DNA sample PCR result Presence of amplicon 283 bp long Presence of amplicon 360 bp long one. 2. 3. four. one P. aerugenosa field isolate + - 2 R. vulgaris field isolate - - 3 R. vulgaris field isolate - - four Positive control of P. aerugenosa from the Biocom kit + 5 Bird biomaterial - - 6 Bird biomaterial - - 7 E. coli ATCC 25922 - - 8 Poultry Genomic DNA - - 9 Poultry Genomic DNA - - 10 Poultry Genomic DNA - - eleven Listeria monocitogenes - - 12 Poultry Genomic DNA - - 13 lersinia - - fourteen E. coli - - fifteen Seratia marcescens - - 16 S. aureus - - 17 Pasteurella - + eighteen A mixture of microorganisms Pasteurella multocida and P. aerugenosa + + 19 Negative control (TE buffer) - -

Thus, in the given example, sufficient specificity of the reaction proposed by us is visible.

Example 3. To assess the sensitivity of the method, a series of ten-fold dilutions of bacterial suspensions of P aeruginosa and P. multocida was carried out with an initial concentration of 1 * 10 ⁶ CFU / ml. After that, with each dilution, PCR was performed using the proposed method and PCR are given as an analog and prototype (table 3).

Table 3. The concentration of Pasteurella multocida in the sample, CFU / ml The concentration of Pseudomonas aeruginosa in the sample, CFU / ml The presence of R. multocida according to the results of PCR claimed in our method The presence of P. aeruginosa according to the results of PCR claimed in our method one 2 3 four 1000 1000 Positively Positively one hundred one hundred Positively Positively 10 10 Positively Positively one one Negatively Negatively 0 0 Negatively Negatively

Example 4. The use of the proposed method for controlling the dynamics of infection with microorganisms of the genus Pasteurella in birds of different ages showed that in dysfunctional herds, a 20% level of infection is reached by 10 days of age. However, the manifestation of the clinical signs of the disease is detected by day 50 in the laying hen and by day 40 in broiler chickens. As our studies show, with pasteurellosis there is a pronounced age-related manifestation of the disease, i.e. young animals do not get sick when infected with pasteurellosis. A study of pasturella infection of a clinically healthy bird showed that infection remains within 10% from 10 to 50 days.

Thus, the claimed method allows more accurately and at an earlier time to assess the infection of poultry and animals with microorganisms of the group Pasteurella and P.aeruginosa.

Claims (1)

A method for detecting microorganisms of the genus Pasteurella and / or Pseudomonas aeruginosa, comprising selecting biomaterial from internal organs, examining the presence of genomic DNA of microorganisms of the Pasteurella and Pseudomonas aeruginosa group in the polymerase chain reaction, simultaneously with two pairs of primers, characterized in that for detecting the presence in the biological material microorganisms of the genus Pasteurella use oligonucleotide primers complementary to the 16 S gene of the ribosomal RNA of microorganisms of the genus Pasteurella having the following nucleotide composition: 5'-TGCCATAAGATGAGCCCAAGT-3 ' , 5'-GCCCTTTACGCCCAGTTA-3 ', and to determine the presence of Pseudomonas aeruginosa in the biological material, synthetic oligonucleotide primers complementary to the putative protein Pseudomonas aeruginosa gene having the following nucleotide composition are used: 5'-GCTATCCCCCTGCGCGTGCTGCGTGCTGCTGCGTGCTGCGTGCTGCGTGCGTGCTGCGTGCTGCGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTTCCCTTombuntuntlectron. 3, PCR products are separated by horizontal electrophoresis in 2% agarose, PCR results are taken into account by visualizing the ethidium bromide stained PCR product in ultraviolet light; in the presence of genomic DNA of microorganisms of the Pasteurella genus in the studied biomaterial, an amplicon of 360 bp is formed and in the presence of genomic DNA Pseudomonas aeruginosa 283 bp