RU2378379C1 - Use of membrane pyrophosphotase gene of bacterium rhodospirillum rubrum for changing plant properties - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: membrane pyrophosphatase gene of bacterium Rhodospirillum rubrum is introduced in a plant genome that enables synthesis of the related protein in plant cells. Particularly, there are designed transgene tobacco plants expressing a membrane H+ -pyrophosphatase gene from bacterium Rhodospirillum rubrum. As a result of transformation, when grown in vivo, the transgene plants exceed the reference length of root system and the reference weight of leaves. The average number of seed capsule of the transgene plants is more than in the reference, while the average amount and weight of seed material of the transgene plants is more as well. The chlorophyll content in leaves of the transgene plants exceeds that of the reference plants. The transgene plants considerably overtake the reference plants in growth.

EFFECT: plants with improved economic-valued indicators, such as accelerated growth, higher length and weight of the roots, increased weight of the leaves, improved biological efficiency and plant resistance to salinisation.

7 cl, 13 dwg, 6 tbl, 9 ex

Description

Application area

The invention relates to biotechnology and can be used to directionally change the properties of plants. A method is proposed for creating transgenic plants with improved economically valuable properties as a result of the expression of the membrane pyrophosphatase gene of the bacterium Rhodospirillum rubrum in their cells.

One of the main reasons for reducing crop yields is the impact of various stress factors, such as low and high temperatures, salinity, lack of moisture in the soil, etc. The strength of the stress effect on plants can be judged by the intensity of their growth under stress, biomass growth, biological productivity, and these indicators are inversely proportional to the strength of the effect. In almost all cases, the growth functions of plants are strongly inhibited, their morphology changes, which is associated with significant violations of biochemical, physiological and genetic mechanisms.

Most agricultural plants are extremely sensitive to salinization, which causes significant yield losses due to this factor. According to the United Nations Environment Program, approximately 70% of the world's agricultural land is subject to salinization. In the Russian Federation, saline soils account for 27.7 million hectares (14.8%) of agricultural land, including 12.4 million hectares (11%) of arable land. In some years, due to soil salinization and uneven distribution of precipitation, especially during the formation of generative organs, crop yields are reduced to 30-60%. In this regard, the creation of cultivated plant varieties with improved economically valuable traits and resistant to soil salinization by genetic engineering methods is one of the urgent tasks of modern biotechnology.

The solution to this problem involves both studying the mechanisms of adaptation of certain plants to such factors, and identifying genes whose products play a key role in the formation of resistance. Transferring such genes by genetic engineering methods to other plants, it is possible to create new varieties of important crops that are highly resistant to stress.

State of the art

One of the main endogenous factors affecting the growth, morphology, regeneration and development of plants are phytohormones, which are increasingly used in modern crop production. One of these growth regulators is indolylacetic acid (IAA) - the auxin phytohormone produced by the growing tops (apexes) of stems, roots and moving into the cell extension zone, enhancing the growth of stems, leaves and roots. The current understanding of the mechanism of action of IAA is based on the induction of an increase in the degree of extensibility of cell walls, increased respiration, and the synthesis of protein and nucleic acids. Of great importance is the phenomenon of apical dominance of IAA in shoots and its role in the mechanisms that provide a coordinated effect on the integrity of the whole plant. Many physiological and morphological processes that occur both in the aboveground organs and in the root system depend on the functional activity of the shoot tip [1].

The mechanism of polar auxin transport is that IAA penetrates passively with H ⁺ ions into the apical end of the cell, and is actively secreted through the cell membrane in the basal end. It was established that in the plasmalemma, auxin induces the work of the H ⁺ pump, as a result of which the matrix of cell walls is acidified. This leads to increased activity of acid hydrolases and softening of cell walls, which is a necessary condition for cell growth by stretching.

An increase in the concentration of H + in the apoplast increases the rate of protonation of IAA, which leads to increased transport of auxin through the plant cell, causing the effect of elongation of plant organs. In this case, there is a direct relationship between the growth of axial organs by extension and the generation of the difference in electric potential on the cell membrane.

Recently, in a number of studies, a scheme was proposed for the effect of proton pumps on the transport of indolylacetic acid (IAA) - phytohormone (auxin), in particular, it was shown that by overexpression of the A. thaliana AVP1 gene encoding the vacuolar H ⁺ pyrophosphatase, the H ⁺ -ATPase activity increased , carrier proteins of IAA and, accordingly, increased transport of IAA through the plant cell [2]. From this point of view, it seems logical that transgenic A.thaliana plants with overexpression of the AVP1 gene had a more developed root system, more rosette leaves, and a larger leaf surface compared to the parent unmodified forms.

At present, it has also been established that increased expression of various proton pumps (P-type ATPases, vacuolar H ⁺ -ATPases and H ⁺ pyrophosphatases) increases the availability of protons for the H ⁺ / Na ⁺ antiporter and enhances the process of active removal of Na ⁺ ions from the cytoplasm , which increases the level of salt tolerance of plants [3, 4, 5]. For example, expression of the AVP1 gene encoding the vacuolar H ⁺ pyrophosphatase of Arabidopsis thaliana in yeast that does not contain its own membrane pyrophosphatase increases the salt tolerance of salt-sensitive mutant yeast [6], and the introduction of the same gene in A. thaliana results in drought and salt tolerant plants [5].

However, it should be noted that studies conducted in this direction are mainly focused on changing the properties of plants by increasing the expression of either their own pyrophosphatase gene or the homologous gene of another plant.

The main disadvantage of this approach is the ability to activate post-transcriptional gene silencing directed against the expressed gene. In many cases, this phenomenon leads to the fact that the resulting transgenic plants synthesize not more but less of the target protein than unmodified ones (examples are given in [7, 8, 9, 10, 11]), and activation of post-transcriptional gene silencing occurs at various stages of plant development in an unpredictable way. Accordingly, plants modified by the introduction of the plant pyrophosphatase gene, in the case of the development of post-transcriptional gene silencing, will have not increased, but reduced salt tolerance.

According to the creators of the present invention, an approach consisting in the use of functional analogues is promising in terms of overcoming this drawback and, accordingly, developing more reliable and efficient methods for producing transgenic plants with increased resistance to salinization and concomitant improvement of other beneficial properties (see above). vacuolar H ⁺ pyrophosphatase of plants of bacterial origin. The existence of such analogues is reported, for example, in [12]. Firstly, there is every reason to believe that the use of bacterial genes to obtain transgenic plants should significantly reduce the likelihood of activation of post-transcriptional gene silencing and other plant development disorders due to deviations in the expression level of its own genes from the natural one. Secondly, the use of bacterial membrane pyrophosphatase genes allows one to count on an additional increase in the efficiency of the pyrophosphate-dependent H ⁺ transport due to the possibility of incorporating the expressed enzyme not only into the vacuole membrane, but also into the external cell membrane, which should result in the removal of sodium ions from the cell to the outside into the extracellular space. In addition, the use of bacterial sources to obtain (clone?) Genes is technologically preferable.

To date, the proposed by the authors of the present invention approach to solving the problem of obtaining transgenic plants with improved economically valuable properties has not been applied.

Disclosure of invention

When creating the present invention, the task was to develop a reliable and effective way to improve economically valuable traits of plants and / or increase salt tolerance. This method consists in incorporating a gene of membrane H ⁺ pyrophosphatase of prokaryotic origin into the plant genome, in particular from the bacterium Rhodospirillum rubrum.

The result of the invention is the production of transgenic plants (in one of the specific embodiments - tobacco plants) expressing the gene of the membrane H ⁺ pyrophosphatase Rhodospirillum rubrum, which have accelerated plant growth. At the same time, the obtained transgenic plants show an increase in the level of salt tolerance and others, known for cases of using plant pyrophosphatases, positive changes in economically valuable traits, namely, increased biological productivity, an increase in the length and weight of the root system, as well as leaf mass.

However, in contrast to the previously described methods of accelerating growth, increasing biological productivity, increasing the length and weight of the root system, as well as the mass of leaves, increasing the salt tolerance of plants based on the expression of genes of vacuolar pyrophosphatases of plants, the method according to the invention allows not only reversibly localizing sodium ions in vacuoles , but to lower the total sodium content in the plant due to its elimination from the cell (see example 10), which results in a more pronounced and stable effect. In addition, in the implementation of the present invention, there were no cases of obtaining abnormal results (inhibition of growth processes, decreased bio-productivity and salt tolerance against the background of expression of the included gene) due to activation of post-translational gene silencing, which also indicates the higher reliability and effectiveness of the proposed method in comparison with well-known analogues. Obviously, these advantages are achieved through the use of a membrane pyrophosphatase gene of bacterial rather than plant origin.

The proposed method for improving economic useful properties and increasing salt tolerance, based on the use of the Rhodospirillum rubrum membrane H ⁺ pyrophosphatase gene, includes the following steps: a) constructing a vector for the expression of the target gene, b) transforming the plant material with the indicated vector and growing plants, c) molecular biological analysis of plants for the presence of the introduced gene and the level of expression of the encoded enzyme; and d) analysis of phenotypic traits of transgenic plants (growth and development obegov and root systems, bio-productivity, salt tolerance level).

Various types of plants can be used as starting forms in the method of the invention for transformation. In a specific embodiment, the results of which are given in the experimental part of the description, tobacco plants (Nicotiana tabacum) were used.

The membrane pyrophosphatase gene Rhodospirillum rubrum (SEQ ID No. AF 044912) can be isolated from the genome of this bacterium, in particular, obtained by PCR using primers PR1 (5'-ATGGCTGGCATCTATCTTTTTCG) and PR2 (5'-TTAGTGGGCCACCCAC. The vector constructs for the transfer of the Rhodospirillum rubrum membrane H ⁺ pyrophosphatase gene into plant cells are selected depending on the chosen form of the plant and the method of its genetic transformation. Examples of some plasmid constructs that can be used in the method of the invention are shown in Table 2.

To introduce a gene into plant cells in the proposed method, essentially any known methods are applicable: agrobacterial transformation; microparticle bombardment; the use of virus-based vectors; direct introduction of genes into plant protoplasts; microinjection; electroporation. In the proposed embodiment for the production of transgenic tobacco plants, the best results were obtained using agrobacterial transformation, which was carried out, as well as subsequent plant growth, according to the standard method (see example 2). Of the three plants grown in vivo and taken for transformation, 120 primary transformants were obtained, of which, according to molecular biological analysis, 25 contained the bacterial pyrophosphatase gene, the expression level of which varied.

Moreover, the results of a study of the growth and development of shoots and root system, bio productivity, and also salt tolerance of transgenic plants showed that the plants with the highest level of expression of the Rhodospirillum rubrum H ⁺ pyrophosphatase gene show the best indicators of changes in these properties.

Thus, the present invention relates to a) a method for producing a transgenic plant with improved economically valuable properties (in particular, accelerated growth, increased length and weight of the root system and greater mass of leaves, increased resistance to salinization), carried out by introducing exogenous pyrophosphatase gene, characterized in that the membrane pyrophosphatase gene of the bacterium Rhodospirillum rubrum is used as a transforming agent, b) a transgenic plant obtained by this method, possessing improved economically valuable properties (accelerated growth, and / or increased length and mass of the root system, and / or greater mass of leaves, and / or increased biological productivity, and / or increased resistance to salinization); c) a cell of a transgenic plant that contains the membrane pyrophosphatase gene of the bacterium Rhodospirillum rubrum and produces an enzyme encoded by the named gene, and d) the offspring of the obtained transgenic plant, which has preserved the gene of the membrane pyrophosphatase of the bacterium Rhodospirillum rubrum and phenotypic characters determined by the named gene.

Brief Description of the Drawings

Figure 1 - scheme of the transfer of the bar gene with the terminator from plasmid pBIBar in pUC19.

Figure 2 - PCR amplification of the Pnos promoter and the creation in the pUC19 vector of the expression cassette nosP-bar-nosT.

Figure 3 is a diagram of the replacement of the cassette nosP-nptII-nosT with nosP-bar-nosT in the vector pBIBar.

Figure 4 - scheme of the cloning of the gene H ⁺ -pyrophosphatase R.rubrum from the plasmid pET22RPP in the resulting vector pNR.

Figure 5 - results of electrophoretic analysis of PCR amplification products for the presence of a portion of the BAR gene (BARATF and BARATR primers) of 350 bp.

M is a marker; -c - PCR for DNA of the original variety; + k - PCR on plasmid DNA Samsun NN; 0 - sample without a matrix; 1-12 - PCR for DNA of the primary transformants.

6 - the results of electrophoretic analysis of PCR amplification products for the presence of part of the RPP gene (SB1 RPP11) of 300 bp

M is a marker; - k - PCR for DNA of the original variety; + k - PCR on plasmid DNA Samsun NN; 0 - sample without a matrix; 1-12 - PCR for DNA of the primary transformants.

Fig.7 - the results of electrophoretic analysis of PCR amplification products for the presence of part of the RPP gene (NOSR-RPP12) of 490 bp

M is a marker; -c - PCR for DNA of the original variety; + k - PCR on plasmid DNA Samsun NN; 0 - sample without a matrix; 1-12 - PCR for DNA of the primary transformants.

Fig. 8 shows the results of a Western blot analysis of control and transgenic tobacco plants.

1, 2 - plants of the original cultivar Samsun NN; 3-6 - transgenic tobacco plants (lines RPP08, RPP12, RPP04 and RPP06, respectively).

Fig.9 - the content of chlorophyll in the leaves of the control (light gray) and transgenic (dark gray) tobacco plants.

Figure 10 - the germination of the seed of the control (left) and transgenic (right) tobacco lines on MS-environment with a sodium chloride content of 150 mm

11 - the effect of 125 mm sodium chloride on the growth and development of control (1-3) and transgenic (4-10) tobacco plants.

Figure 12 shows the effect of 250 mM sodium chloride on the growth and development of control (1-3) and transgenic (4-10) tobacco plants.

Fig. 13 shows the level of sodium accumulation in the tissues of the control (light gray) and transgenic (dark gray) tobacco lines grown on MS medium with different contents of sodium chloride.

The implementation of the invention

The following are specific examples of the invention, which cannot be construed as limiting its scope.

Example 1. Construction of a vector for the expression of the target gene.

To obtain a recombinant binary vector, the plasmid pBIBar was used. This plasmid contains two expression cassettes: the first carries the bar gene, which encodes the synthesis of phosphinotricin acetyl transferase, which determines the herbicide resistance of bialophos, which is controlled by the 358 promoter of cauliflower mosaic virus and the nosT of the nopalin synthetase gene terminator. The second contains the nptII kanamycin resistance gene, which encodes the synthesis of aminoglycoside-3'-phosphotransferase under the control of the nosP promoter and nosT terminator.

At the first stage, the BAR gene with the terminator from plasmid pBIBar was transferred to the vector pUC19. Plasmids pUC19 and pBIBar were digested with restriction enzymes BamHI and EcoRI. After isolation of the necessary DNA fragments from the agarose gel, ligation and transformation of E. coli strain DH10B with selection of transformants for ampicillin resistance, the plasmid pUC19B-T containing the bar-posT insert was obtained (Fig. 1).

The nosP-bar-nosT cassette was constructed as part of the pUC19 plasmid. PCR amplification of the nosP promoter was performed. Then, the desired DNA fragment containing nosP (361 bp in size) was isolated from an agarose gel, treated with HindIII and BglII endonucleases, and ligated with the pUC19 vector digested with HindIII and BamHI enzymes. The obtained subsidized mixture transformed strain DH10B with selection of transformants for ampicillin resistance. As a result, the pUCP-B-T plasmid containing the nosP-bar-nosT expression cassette was selected (FIG. 2). The correctness of amplification and cloning procedures was confirmed by sequencing the nosP promoter.

The nosP-bar-nosT cassette is cloned as part of the pBIBar vector. Plasmid pUCP-B-T was treated with PmeI and NdeI endonucleases. After isolation from the agarose gel, the desired DNA fragment was ligated with the plasmid pBIBar treated with PmeI and VspI. The resulting product was transformed with E. coli strain DH10B with selection of transformants for resistance to kanamycin. As a result of restriction analysis of plasmid DNA isolated from transformant clones, the pNR plasmid was selected (FIG. 3).

At the final stage, the R.rubrum H ⁺ pyrophosphotase gene was cloned from the plasmid pET22RPP into the resulting pNR vector. PET-RPP DNA was treated with an XhoI endonuclease and sticky ends were built up using a Klenov fragment. The resulting preparation was treated with restriction enzyme XbaI. A DNA fragment carrying the H ⁺ pyrophosphatase gene was isolated from an agarose gel and ligated with the pBI-NR vector treated with endonuclease Ec1136II and XbaI. The E. coli strain DH10B was transformed with the obtained ligase mixture with selection of transformants for ampicillin resistance. As a result of restriction analysis of plasmid DNA isolated from transformant clones, the pNR-RPP plasmid containing the Rhodospirillum rubrum H ⁺ pyrophosphatase gene was selected. (figure 4). The correctness of the procedure for cloning the pyrophosphatase of Rhodospirillum rubrum in the vector pBI-NR was confirmed by sequencing of the insert.

Plasmid pNRRPP was transferred to the Agrobacterium tumefaciens GV3101 strain by three parent conjugation [13].

Table 1
Bacterial strains used in the work Strain name Genotype Origin E.coli: DH10B F ', ara, D139 Δ (ara leu), Δ1acX74, galK, galU, deoR, endA1, recA1, merA, nupG, Δ (m22, hsd, RMS, mcrBC) [fourteen] Agrobacterium tumefaciens GV3101

table 2
Plasmids used in the work The name of the plasmid Genotype Origin pUC19 Ap ^r [fifteen] pBIBar Km ^r , nosP-nptII-nosT, 35SP-bar-nosT [16] pUCB-T Ap ^r , bar- nosT Real work pUCP-B-T (sac +) Ap ^r , nosP-bar- nosT Real work pUCP-B-T Ap ^r , nosP-bar- nosT Real work pNR Km ^r , nosP-bar-nosT, 35SP-bar-nosT Real work pET-RPP Ap ^R , RPP [17] pBI-NR Kn ^r , nosP-bar-nosT, 35SP-bar-nosT Real work pNR-RPP Km ^r , nosP-bar-nosT, 35SP-RPP-nosT Real work

Synthetic oligonucleotides, Pnos1 (CCCAAGCTTGTTTAAACTGAAGCCGGGA) and Pnos2 (GAAGATCTCGATCCAGATCCGGTGCA) were used to perform PCR amplification of the nosP promoter.

All DNA manipulations are subcloning into plasmid vectors, PCR amplification, sequencing, ligation, etc. carried out according to standard methods [18].

Example 2. The creation of transgenic tobacco plants.

To create transgenic tobacco plants expressing the H ⁺ pyrophosphatase gene, the method of agrobacterial transformation was used. Plants of Nicotiana tabacum cultivar Samsun NN grown in vitro were transformed according to standard methods [19]. In the course of transformation experiments, 120 primary transformants were obtained that were selected on a medium containing a selective agent phosphinotricin - 5 mg / L.

Example 3. Molecular biological analysis of the obtained primary transformants.

Molecular biological analysis included PCR analysis for the presence of part of the BAR gene and parts of the RPP gene, as well as determination of the expression level by Western blot.

PCR analysis

For PCR analysis of the plant genome for the presence of part of the BAR gene, primers were used:

BarAtF: 5 'ggc gga cat gcc ggc ggt ctg cac with

BarAtR: 5 'cag ccc gat gac agc gac cac gct with

Conditions for PCR: hot start: 1 cycle - 95 ° C - 1 min; 40 cycles: 95 ° С - 30 sec, 65 ° С - 30 sec, 72 ° С - 30 sec.

The data of electrophoretic analysis of PCR amplification products showed the presence of a portion of the 350 bp BAR gene. in 32 transformants (Fig. 5). These transformants were selected for further work.

For PCR analysis of the genome of these plants for the presence of parts of the RPP gene, two pairs of primers were selected and used:

SB1: cca cta tcc tcc gca aga ccc ttc s

RPP11: gac ggc gat gtt ctt gta ctg acg a

PCR conditions:

40 cycles (95 ° C - 30 sec; 68 ° C - 30 sec; 72 ° C - 30 sec) and final polymerization - 7 minutes.

RPP12: saa gaa gta cat cga aga cg

NOS-R: tta tcc tag ttt gcg cgc ta

PCR conditions:

40 cycles (95 ° C - 30 sec; 55 ° C - 30 sec; 72 ° C - 30 sec) and final polymerization - 7 minutes.

The data of electrophoretic analysis of PCR amplification products showed the presence of parts of the RPP gene in size: Sb1-RPP11 - 300 bp (Fig.6) and NOSR-RPP12 - 490 bp 25 transformants (Fig.7).

PCR analysis was performed using a DNA amplifier ("Techne Genius").

The composition of the reaction mixture for PCR:

- Primers - 2 μl each;

- 10X buffer-2 μl;

- 10X dNTP-2 μl;

- Taq polymerase - 1 unit;

- DNA matrix - 1 μl;

- H ₂ O - 11 μl.

As a matrix, isolated genomic DNA samples were used.

DNA isolation was carried out as follows. 20-100 mg of plant tissue (fragments of leaf blades) were ground in a homogenizer in 120 μl of buffer I (50 mM Tris HCl, pH8.0; 10 mM EDTA; 50 μg / ml pancreatic RNase, preheated for 30 minutes in a boiling water bath) until obtaining a homogeneous suspension. Then, 125 μl of lysis buffer II (0.2 M NaOH; 1% Na dodecyl sulfate) was added to the homogenate. The resulting mixture was processed in a shaker for 2 minutes at room temperature, transferred to tubes, which were placed in a thermostat and incubated at 65 ° C for 45 minutes. At the end of the incubation, the lysate was cooled to a temperature of 20-25 ° C and 125 μl of neutralizing solution III (2.5 mM acetate K, pH 4.5) was added to each tube. The contents of the tubes were thoroughly mixed on a shaker and centrifuged at 14,000 rpm for 10 minutes. The supernatant was transferred to new microcentrifuge tubes containing 500 μl of Wizard MaxiPreps resin and DNA was further isolated according to the Promega recommendations for the Wizard Preps kit.

For centrifugation, a benchtop microcentrifuge (Eppendorf 5415C) was used with a maximum rotor speed of 14,000 rpm. Thermostating of the samples was carried out in a dry thermostat ("Thermo 28-23"). The analysis of PCR products was carried out by agarose gel electrophoresis at an electric field of 6 V / cm followed by staining of the gels with ethidium bromide (the concentration of the staining solution was 1 μg / ml in water, the staining time was 20 minutes at room temperature) and the resulting picture was photographed in ultraviolet wavelength - 260-280 nm) with a digital camera. Digitized information was processed using the Adobe Photoshop 7.0 package.

The conclusion about the incorporation of a foreign gene into the plant genome was made on the basis of the appearance of a PCR product with the expected size (depending on the specific primers used).

Western blot analysis

The expression level of the Rhodospirillum rubrum H ⁺ pyrophosphatase gene in transgenic tobacco plants of the TO generation was determined using Western blot analysis.

To isolate protein preparations, the leaves of transgenic tobacco plants were homogenized in buffer (0.4 M sucrose, 50 mM Tris pH 8.0, 10 mM KCl, 5 mM MgCl ₂ , 10% glycerol, 10 mM mercaptoethanol). The resulting solution was centrifuged 5000 g - 10 min, the precipitate was discarded. The protein concentration in the supernatant was determined by Bradford.

When conducting electrophoretic analysis in polyacrylamide gel, 100 μg of total protein isolated from 25 transgenic plants and a control non-transgenic tobacco plant were applied to each lane.

The analysis revealed a difference in the level of expression of the H ⁺ pyrophosphatase gene in the analyzed transformants (Fig. 8).

Western blot analysis and related procedures were performed following the instructions of the manufacturers of membranes and detection systems (Amersham).

Example 4. Obtaining seed of transgenic tobacco plants - generation T1.

Transgenic tobacco plants with different levels of Rhodospirillum rubrum (T0) H ⁺ pyrophosphatase gene expression, selected according to the results of Western blot analysis, were adapted to in vivo conditions and cultured to obtain seed. Plants formed inflorescences on day 45-50. Since tobacco is a self-pollinating crop, crosses between different lines of transgenic T0 tobacco plants were excluded. From each plant received seed material - generation T1.

Example 5. The study of the effect of gene expression of the membrane H ⁺ pyrophosphatase Rhodospirillum rubrum on the growth and development of shoots and root system of plants.

To study the effect of Rhodospirillum rubrum membrane H ⁺ pyrophosphatase gene expression on the growth and development of shoots and root system, control and transgenic tobacco plants were grown in vivo.

Some plants aged 6–7 true leaves were evaluated by the following parameters: root length, root mass, leaf mass, ratio of the mass of the root system to the mass of leaves.

Comparison of control and transgenic tobacco plants expressing the R.rubrum membrane H ⁺ pyrophosphatase gene showed that transgenic plants exceed the control system by 2 times the length of the root system, 2.9 times the weight of the root system, and 2 times the weight of the leaves ( table 3).

Table 3
Comparison of the growth and development of shoots and root system of control and transgenic plants L root length mm Mk Root mass, mg Ml Leaf mass, mg Mk / ml Control plants 74.8 11.2 203.3 0,0518 Transgenic plants 150.2 32.6 409.3 0,0772

The remaining plants were grown in vivo to produce seed — T2 generation. Observation of plants showed that the number of leaves in transgenic plants is 1.3 times greater than in the control. The distance between internodes in transgenic plants decreases closer to the inflorescence in comparison with the control. It was also noted that the beginning of the flowering phase in transgenic plants occurs 7-8 days earlier than in control plants.

The data obtained indicate that the expression of the Rhodospirillum rubrum H ⁺ pyrophosphatase gene stimulates shoot growth and root system development in transgenic plants.

Example 6. The study of the effect of gene expression of the membrane H ⁺ pyrophosphatase Rhodospirillum rubrum on the biological productivity of plants.

Comparison of the obtained seed material - generation T2 (see Example 5) showed that the number of seed bolls on transgenic plants is 1.9 times more than the control ones, the weight and quantity of seed collected from transgenic plants is 1.5 times more respectively (table 4).

Table 4
Comparison of the mass and quantity of seed obtained from control and transgenic plants Number of seed boxes, pcs Mass of seeds, g Number of seeds, pcs Control plants 39 4.4 81000 Transgenic plants 76 6.8 125000

The table shows the average values for the control and transgenic plants.

The data obtained may indicate that the expression of the H ⁺ pyrophosphatase gene has a stimulating effect on the biological productivity of the plant.

Example 7. Determination of the chlorophyll content in the leaves of transgenic plants expressing the gene of the membrane H ⁺ pyrophosphatase Rhodospirillum rubrum.

The chlorophyll content in the leaves of the control and transgenic plants was determined by the standard method [20].

The content of chlorophyll was determined at the beginning of flowering, when its level reaches its maximum value. 10 samples were taken from each plant. Samples were taken from the 9th to the 18th leaf (from bottom to top), thus we excluded from the sample the lowest old leaves - with a very low level of chlorophyll and the uppermost young leaves - whose chlorophyll level is very high. Experience has shown that the leaves of transgenic plants contain 1.8 times more chlorophyll than control plants (Table 5, Fig. 9).

Table 5
Comparison of the content of chlorophyll in the leaves of control and transgenic plants Mg chlorophyll per gram of leaf Control plants 1.18 Transgenic plants 2.09

The table shows the average values for the control and transgenic plants.

Example 8. Determination of the effect of various concentrations of sodium chloride on the growth and development of control and transgenic plants expressing the Rhodospirillum rubrum H ⁺ pyrophosphatase gene.

To determine the effect of sodium chloride on the growth and development of plants, we tested control and transgenic plants, previously grown on MS medium without adding salt to obtain 3-4 true leaves, and then transplanted into tubes with a nutrient medium containing various concentrations of sodium chloride in range from 0 to 250 mm (step 25 mm). The assessment was carried out according to morphological characters (growth, development of shoots and root system, the intensity of leaf color, the appearance of necrosis, etc.).

Experience has shown that differences in morphological characters between control and transgenic plants were weakly manifested at concentrations from 25 mM to 100 mM NaCl. A significant difference in the growth and development of transgenic and control plants was observed at a concentration of 125 mM or higher (Fig. 10), and at a concentration of 250 mM NaCl, complete death of the control plants was observed (Fig. 11).

Example 9. Determining the level of sodium accumulation in the tissues of control and transgenic tobacco plants expressing the Rhodospirillum rubrum H ⁺ pyrophosphatase gene.

The sodium content in plant tissues was determined using a plasma photometer. For analysis, we used leaf tissue samples of control and transgenic plants grown on a nutrient medium with various concentrations of sodium chloride in the range from 0 to 250 mm (step 25 mm).

To obtain samples, the aerial part of the control and transgenic plants was dried for 72 hours at a temperature of 65 ° C to constant weight. After homogenization of the dry leaves, extraction was carried out with a 1 M HCl solution for 1 hour (based on: 50 mg of fresh leaves - 1 ml of 1 M HCl). After centrifugation, the collected supernatant was used for analysis.

Analysis of the samples showed that the sodium content in the leaves of transgenic and control plants does not significantly differ when plants are grown on media with NaCl concentrations from 0 to 175 mM (Table 6).

Table 6
The amount of sodium in mg per 1 g of dry matter The concentration of NaCl, mm Control plants Transgenic plants 0 1.17 0.28 25 1.21 1.09 fifty 1.40 1,56 75 2.06 1.95 one hundred 2.17 2.28 125 2.61 2,38 150 2,58 2.45 175 2.76 2.63 200 4.71 2.86 250 plant death 2.78

However, at a NaCl concentration of 200 mM, when almost complete growth inhibition of the control plants was observed, the sodium concentration in the leaves of the control plants increased 1.7 times compared to transgenic plants (Fig. 12).

Bibliographic data

1. Field V.V. // Phytohormones. L .: Publishing house of Leningrad University, 1982.

2. Jisheng Li, Haibing Yang, Wendy Ann Peer, Gregory Richter, Joshua Blakeslee, 3 Anindita Bandyopadhyay, Boosaree Titapiwantakun, Soledad Undurraga, Mariya Khodakovskaya, Elizabeth L. Richards, Beth Krizek, Angus S. Murphy, Simon Gaxola. // Arabidopsis H-PPase AVP1 Regulates Auxin-Mediated Organ Development, Science, 2005, v. 310. p. 121.

3. Zhang H-X., Blumwald E. // Transgenic salt-tolerant tomato plants accumulate salt in foliage but not in fruit. Nature Biotechnology, 2001, vol. 19, p. 765-768.

4. Apse M.P., Aharon G.S., Sneddon W.A., Blumwald E. // Salt tolerance conferred by overexpression of avacuolar Na + / H + antiport in Arabidopsis. Science, 1999, vol. 285, p.1256-1258.

5. Gaxiola R, Li J, Undurraga S, Dang LM, Alien GJ, Alper SL, Fink GR. // Drought-and salt-tolerant plants result from overexpression of the AVP1 H + pump. Proceedings of the National Academy of Sciences of the USA 98, 2001, 11444 ± 11449.

6. R.A. Gaxiola, R. Rao, A. Sherman, P. Grisafi, S. L. Alper, G. R. Fink, The Arabidopsis thaliana proton transporters, AtNhxl and Avpl, can function in cation detoxification in yeast. // Proc. Natl. Acad. Sci. USA 96, 1999, 1480-1485.

7. Matzke, M., Matzke, A.J., and Kooter, J.M. // RNA: Guiding gene silencing. Science 293, 2001, 1080-1083.

8. Vance, V., and Vaucheret, H. // RNA silencing in plants-Defense and counterdefense. Science 292, 2001, 2277-2280.

9. Voinnet, O. // RNA silencing as a plant immune system against viruses. Trends Genet 17, 2001, 449-459.

10. Waterhouse, P.M., Wang, M.B., and Lough, T. // Gene silencing as an adaptive defense against viruses. Nature 411, 2001, 834-842.

11. Baulcombe, D. // RNA silencing. Curr. Biol. 12, 2002, R82-R84.

12. Drozdowicz YM, Rea PA // Vacuolar H ⁺ pyrophosphatases: from the evolutionary backwaters into the mainstream. // Trends of Plant Science, 2001, vol. 6, p. 1360-1385.

13. Van Haute E., et al., // EMBO J., 1983, V.2, P.411-418.

14. Grant SGN., Jessee J., Bloom FR., And Hanahan D. // PNAS 87, 1990, 4645-4649.

15. Yanisch-perron, C., Vieira, J., and Messing, J. // Gene 33, 1985, 103-119.

16. Padegimas, L. // Abstract of dissertation for the degree of candidate of chemical sciences. Moscow, 1993.

17. Baltscheffsky M, Nadanaciva S, Schultz A. // Biochim Biophys Acta. May 27; 1364 (3): 301-6, 1998.

18. Sambrook, J., Fritsch E.F., and Maniatis, T. // Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989.

19. Draper J., Scott R., Walden R. // In Sat: Genetic Engineering of Plants. Moscow: Mir, 1991, 119-130.

20. Amon D.I. // Plant Physiology, 1949, V.24, 1-6.

List of abbreviations

AVP1 - gene vacuolar H ⁺ pyrophosphatase Arabidopsis thaliana

RPP - Rhodospirillum rubrum membrane H ⁺ pyrophosphatase gene

Bar is a gene encoding phosphinotricin acetyltransferase and

providing herbicide resistance based on L-phosphinotricin

H ⁺ -ATPase - adenosine triphosphate-dependent proton pump

IAA (IAA) - Indolyl-3-Acetic Acid

NaCl - Sodium Chloride

Na ⁺ - sodium ion

H ⁺ - proton

PCR - polymerase chain reaction

MS Environment - Muraashige and Scoog Culture Media

mcg - micrograms

mg - milligram

μl - microliter

rpm - revolutions per minute

V / cm - volt per centimeter

t - temperature

l - liter

ml - milliliter

° C - degrees Celsius

Claims (7)

1. A method of obtaining a transgenic plant with accelerated growth, and / or increased length and mass of the root system, and / or a larger mass of leaves, and / or an increased content of chlorophyll, and / or a reduced content of sodium ions in tissues, consisting in introducing into the plant genome gene membrane H ⁺ -transporting pyrophosphatase bacteria Rhodospirillum rubrum. 2. The method according to claim 1, characterized in that the introduction of the gene is carried out by the method of agrobacterial transformation. 3. The method according to claim 1 or 2, characterized in that it is used to obtain plants with accelerated growth compared to the corresponding unmodified plant. 4. The method according to claim 1 or 2, characterized in that it is used to obtain plants with increased length and weight of the root system compared to the corresponding unmodified plant. 5. The method according to claim 1 or 2, characterized in that it is used to obtain a plant with a larger leaf mass and a higher chlorophyll content compared to the corresponding unmodified plant. 6. A transgenic plant obtained by the method according to claim 1, which has improved economically valuable properties. 7. The plant cell according to claim 6, which contains the membrane pyrophosphatase gene of the bacterium Rhodospirillum rubrum and produces an enzyme encoded by the named gene.

Images