RU2376376C2 - INTEGRATIVE VECTOR Random-URA3-RPT FOR SERIAL INTRODUCTION OF MULTIPLE COPIES OF GENETIC ELEMENTS IN YEAST Yarrowia lipolytica - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: new integrative vector Random-URA3-RPT was produced for serial increase of copies in strains of yeast Yarrowia lipolytica.

EFFECT: optimised production of various ferments and carbonic acids by increase of copies number in genome of any necessary genetic elements that influence their biosynthesis.

4 dwg, 1 tbl, 4 ex

Description

The invention relates to the microbiological industry and can be used to increase the productivity of the yeast Yarrowia lipolytica for the target product.

Yeast of the genus Yarrowia is an important biotechnological producer of a number of carboxylic acids and enzymes. Moreover, one of the important and effective methods for increasing protein production, along with the use of strong promoters, is to increase the number of copies of the structural gene in protein producer strains.

The most common way to increase the number of copies of genes in yeast strains is to use a vector containing a region that has multiple homology in the genome of the recipient strain and a defective selective marker, i.e. selective marker having a reduced level of expression. As a region having multiple homology in the genome, both rDNA ribosomal genes (US 5786212) and transposon fragments (US 5629203, US 6582951) are used. As defective markers, as a rule, genes are used that complement auxotrophy on nitrogen bases and amino acids LEU2, TRP1 or URA3 and have a deleted promoter part, which leads to a decrease in their activity (US 6090574, US 6004776, US 5786212, US 6582951).

One of the drawbacks of the method based on the use of sequences repeating in the genome is the formation of tandem repeats upon integration. When the structural gene is efficiently expressed, tandem repeats can be cleaved by the mechanism of homologous recombination, which leads to strain instability.

For Y.lipolytica culture, a solution to this problem was proposed in US Pat. No. 6,582,951, where strains that did not contain Zeta transposon repeats were used for transformation, which reduced the efficiency of the transformation, but made it possible to obtain stable multi-copy transformants.

The disadvantages of the closest analogue include the limitation of the maximum number of copies and the inability to reuse the marker. In addition, when a large number of copies are inserted at one time, taking into account the influence of the so-called “position effect” in eukaryotes, it is quite likely that some copies are embedded in the unsuccessful, “silent” part of the genome, which is confirmed by the inconsistency between the number of copies and the expression level of transformants obtained by this method .

The objective of the invention is to design an integrative vector for multi-copy transformation of Y.lipolytica strains, which allows the strain to be transformed with any necessary number of copies with repeated use of a selective marker, to control the increase in production when each copy is added and does not form tandem repeats.

The problem was solved by constructing a vector representing a PCR product in which the URA3 Y.lipolytica gene, limited by direct repeats of at least 100 bp in length, is used as a selective marker, and random sequences of at least 18 bp, with at least one of the sides between the direct repeat and the integration site contains a polylinker.

The use of PCR amplification from a matrix plasmid as a vector during transformation, which is limited by random sequence sections on both flanks, makes it possible to increase the number of potential insertion sites. Random sequences at the ends of the vector molecule also prevent re-embedding of the construct in the previous copy. The use of the URA3 marker is due to the possibility of counter-selection on the toxic 5-FOA analogue, which allows the marker to be cut in direct repeats and used repeatedly for the introduction of each subsequent copy of the vector.

It is this combination of vector elements that makes it possible to sequentially transform a strain of one copy of the vector an unlimited number of times, which in turn allows you to control the successful incorporation of each copy to increase the production of the target gene and sequentially bring the number of copies to the point where the effect of increasing their number is observed .

To evaluate the effectiveness of the proposed multi-copy transformation vector, the derived matrix plasmid pR-hp4d-lip2 based on the vector pUC19 was constructed. The plasmid contains an expression cassette with the LIP2 gene encoding Y.lipolytica lipase, under the control of the synthetic hp4d promoter and with its own terminator. Based on this plasmid, the example describes the construction of a transformant containing two copies of the LIP2 Y.lipolytica gene in the genome under the regulation of the hp4d promoter and producing a lipase of up to 1150 u / ml for 10 days of fermentation in a liquid medium in rocking flasks.

The invention is illustrated by the following drawings:

Figure 1. Scheme for obtaining the base matrix plasmid pUC19-URA3-RPT.

Figure 2. Scheme for obtaining the matrix plasmid pR-hp4d-lip2.

Figure 3. The scheme of the matrix plasmid pR-hp4d-lip2 for sequential introduction of copies and the mechanism of cutting marker URA3.

Figure 4. Cup test for lipase activity of transformants carrying one copy of pR-hp4d-lip2. Polf - negative control.

Example 1: Obtaining a base matrix plasmid pUC19-URA3-RPT

For selection and further excision of the URA3 selective marker, a construct containing the URA3 gene bounded on both sides by direct repeats is obtained (Figure 1). A 1972 bp DNA fragment encoding the amino acid sequence, promoter and terminator region of the Y. lipolytica URA3 gene, was obtained by PCR using Pfu polymerase (Fermentas Inc.) and primers: ATCGATCGACAAAGGCCTG (URA3-F) and GAGTATACCTGTAC -R). The total genomic DNA of the Polf Y.lipolytica strain (ATCC MYA-2613) obtained by the method described in Kaiser et., Al. (1994) Methods in Yeast Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. A 593 bp DNA fragment encoding a repeat sequence (Repeat) was obtained by PCR using Pfu polymerase (Fermentas Inc.) and primers: AAGGATCCCATTTATCAGGGTTATTGTCTC (RPT-F) and TATATTCTAGAGCTAGCACTGGCCGTCGTTT (RPT). The template for PCR is the plasmid pUC19.

The two amplified DNA fragments obtained are purified after electrophoresis on a 1% agarose gel by DNA extraction (Kit # K0513, Fermentas Inc.).

0.5 μg of the URA3 DNA fragment obtained after amplification is ligated with 0.2 μg of pUC19 vector DNA treated with Ec1136II restriction endonuclease and transformed into E. coli XL1 (Blue). Clones containing the required 1972 bp amplified DNA insert were selected on plates for ampicillin resistance and a standard test for the absence of β-galactosidase activity. Plasmid DNA isolated from the obtained clones was checked by restriction analysis and sequenced (standard primers M13 / pUC 17-mer, M13 / pUC reverse 17-mer). The resulting plasmid size 4658 N. p. named pUC19-URA3.

0.5 μg of the Repeat DNA fragment obtained after amplification was treated with restriction endonucleases NheI and BamHI, then ligated with 0.2 μg of pUC19-URA3 vector treated with XbaI and BamHI Ec1136II restriction enzymes and transformed into E. coli XL1 (Blue). The resulting 5232 bp plasmid was named pUC19-URA3-RPT.

Example 2: Obtaining a matrix plasmid for expression of the gene of LIP2 Y.lipolytica pR-hp4d-lip2

0.4 μg of the fragment obtained after processing the pMH-LIP2 vector with restriction endonucleases XmaJI and NheI are ligated with 0.2 μg of DNA of the pUC19-URA3-RPT vector treated with restriction endonucleases NheI and XbaI, and then they are transformed into E. coli XL1 (Blue ) The resulting plasmid of 6906 bp in size contains the LIP2 Y.lipolytica gene encoding a lipase under the regulation of the hp4d promoter and is called pR-hp4d-lip2 (Figure 2).

Example 3: Obtaining the vector R-hp4d-lip2, its introduction into strain Polf Y.lipolytica and analysis of production

The vector R-hp4d-lip2 is obtained by PCR amplification from the matrix plasmid pR-hp4d-lip2 using primers: 5'-N ₂₀ GTTGAATACTCATACTCTTCC (Random-F) and 5'-N ₂₀ AGCACTACTAGACGCGTGCCATTCGATCGCATGCTG (on Random-R) the 'end contain a random sequence of 20 nucleotides in length (Figure 3)

Transformation of the strain Polf Y.lipolytica is carried out by the lithium method (Current Genetic, 1989, vol 16, pp. 253-260) using 300 ng of purified PCR product.

Transformants are selected by complementing uracil auxotrophy on minimal YNB medium (Himedia) with the addition of glucose (2 wt.%) And leucine (0.01 wt.%).

The lipase activity of 32 transformants was initially evaluated in a cup test with tributyrate in clear zones. The test uses minimal YNB medium with the addition of glucose (5 wt.%), Tributyrate (2 wt.%) And leucine (0.02 wt.%). As a control, Polf Y.lipolytica strain with complemented uracil auxotrophicity was taken. From the test results it is seen that part of the transformants has a secreted lipase production level comparable to the control (Figure 4), which can be explained by the homologous incorporation of the vector.

Transformants that showed the largest ratio of the diameter of the zone to the diameter of the colony on plates with tributyrate were checked for the presence of PCR-integrated transformants with chromosomes of the transformants using the primers AAGGATCCCATTTATCAGGGTTATTGTCTC and CCTAGGCCATTCGATCGCATGCTG. The resulting fragment length of 4800 N. p. corresponds to the length of the full vector, which indicates the passage of non-homologous integration of the vector over a random sequence of 20 n.p.

Fermentation of clones that showed the largest ratio of zone diameter to colony diameter on tributerate plates was carried out in YNB minimal medium supplemented with olive oil (5 wt.%), Glucose (5 wt.%) And leucine (0.02 wt.%) flasks (750 ml) with a working volume of 50 ml. As a control, a Polf Y.lipolytica strain with complement auxotrophy for uracil and leucine, as well as a wild strain W29 (CLIB 89), a precursor of Polf strain, is used. Fermentation is continued for 10 days, samples are taken every 24 hours. Lipase activity is measured by a method based on the hydrolysis of p-nitrophenyl butyrate to form butyrate and p-nitrophenol (Appl. Microbiol. Biotechnol., 2003, vol. 63, pp.136-142). A unit of lipase activity corresponds to the amount of enzyme that releases 1 μmol of p-nitrophenol per minute in 1 ml of working solution.

The results presented in the table indicate the successful expression of the introduced lipase gene.

Lipase activity of clones with a single copy of the LIP2 lipase gene under the hp4d hybrid promoter Clone number LA, units / ml 3 day fermentation 5 day fermentation 10 day fermentation one 163.6 497 144.7 2 97.4 144 177.3 3 183.8 353.5 607.8 four 144.2 382.3 422.2 5 67.4 135.2 233.2 Polf × leu ⁺ × ura ⁺ 13,4 0 0 W29 61.5 8.95 0

Example 4: Preparation and analysis of transformants containing two copies of the LIP2 gene under the control of the hp4d hybrid promoter

To obtain a clone with a URA3 marker cut in direct repeats, the minimal medium selection method with 5-FOA is used (Mol. Gen. Genet. 1984, vol.197, pp.345-346). The recombination frequency in direct repeats is about 10 ^-4 . The introduction of a second copy of the lipase gene is carried out by re-transformation of the obtained strain by PCR product R-hp4d-lip2. Transformation, selection of the best transformants in a cup test and their fermentation in a liquid medium is carried out, as in example 3.

The maximum lipase activity of the Y. lipolityca strain containing two copies of the lip2 lipase gene under the control of the hp4d hybrid promoter reaches 1150 units / ml for 10 days of fermentation, which is two times the maximum activity of the transformant with one copy of the gene. This suggests that the lipase activity of Y. lipolityca increases in proportion to the increase in the number of copies of the lipase gene.

Thus, the significant advantages of the claimed vector include the absence of restrictions on increasing its copies in the genome, the possibility of further use of the marker and the ability to track the increase in production when each subsequent copy of the structural gene is inserted, which avoids the negative impact of the “position effect”.

Claims (1)

Random-URA3-RPT integrative vector for the sequential introduction of multiple copies of genetic elements into Yarrowia lipolytica yeast, which is a PCR product in which the URA3 Y. lipolytica gene is used as a selective marker, limited to direct repeats of at least 100 bp in length, and at the edges of the molecule, random sequences of at least 18 bp in length were used as integration sites, with at least one of the sides containing a polylinker between the direct repeat and the integration site.

Images