RU2439157C2 - GENETIC CONSTRUCTION FOR OBTAINING STABLE TRANSFORMANTS OF FUNGI OF GENUS Rhizopus - Google Patents
GENETIC CONSTRUCTION FOR OBTAINING STABLE TRANSFORMANTS OF FUNGI OF GENUS Rhizopus Download PDFInfo
- Publication number
- RU2439157C2 RU2439157C2 RU2009123244/10A RU2009123244A RU2439157C2 RU 2439157 C2 RU2439157 C2 RU 2439157C2 RU 2009123244/10 A RU2009123244/10 A RU 2009123244/10A RU 2009123244 A RU2009123244 A RU 2009123244A RU 2439157 C2 RU2439157 C2 RU 2439157C2
- Authority
- RU
- Russia
- Prior art keywords
- dna
- plasmid
- transformants
- fungi
- seq1
- Prior art date
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Изобретение относится к микробиологической промышленности и может быть использовано для увеличения продуктивности грибов Rhizopus oryzae по целевому продукту.The invention relates to the microbiological industry and can be used to increase the productivity of Rhizopus oryzae fungi for the target product.
Мицелиальные грибы рода Rhizopus, относящиеся к семейству Мукоровых, являются важным биотехнологическим продуцентом ряда карбоновых кислот и ферментов, среди которых можно выделить ферменты: липазу и амилазу, а также кислоты: молочную и фумаровую [Biosci Biotechnol Biochem, 67 (8): 1725-1731, 2003; Can J Microbiol, 30: 126-128, 1984].Mycelial fungi of the genus Rhizopus, belonging to the Mukorov family, are an important biotechnological producer of a number of carboxylic acids and enzymes, among which are enzymes: lipase and amylase, as well as acids: lactic and fumaric [Biosci Biotechnol Biochem, 67 (8): 1725-1731 , 2003; Can J Microbiol, 30: 126-128, 1984].
Одним из основных подходов к увеличению продуктивности штаммов являются методы генной инженерии, когда в микроорганизм в составе соответствующего экспрессионного вектора вводят дополнительные копии структурного гена, кодирующего целевой продукт. Однако необходимым условием для осуществления подобной генетической модификации является принципиальная возможность получения митотически стабильных трансформантов, что затруднительно как для грибов рода Rhizopus, так и для мукоровых грибов в целом (Mol Gen Genomics, 268: 397-406, 2002;).One of the main approaches to increasing the productivity of strains is genetic engineering methods, when additional copies of the structural gene encoding the target product are introduced into the microorganism as part of the corresponding expression vector. However, a prerequisite for the implementation of such a genetic modification is the fundamental possibility of obtaining mitotically stable transformants, which is difficult for fungi of the genus Rhizopus and for mucinous fungi in general (Mol Gen Genomics, 268: 397-406, 2002;).
ОпределенияDefinitions
1. Трансформант считается митотически стабильным (далее: стабильный трансформант), если при прохождении споруляции он не теряет введенный генетический материал. Величина митотической стабильности определяется отношением числа потомков трансформантов, сохранивших введенный генетический материал после споруляции, к общему числу полученных потомков и рассчитывается как отношение числа колоний, выросших на селективной среде, к числу колоний, выросших на неселективной среде, выраженное в процентах.1. A transformant is considered to be mitotically stable (hereinafter: stable transformant), if during passage of sporulation he does not lose the introduced genetic material. The value of mitotic stability is determined by the ratio of the number of descendants of transformants that retained the introduced genetic material after sporulation to the total number of descendants obtained and is calculated as the ratio of the number of colonies grown on selective medium to the number of colonies grown on non-selective medium, expressed as a percentage.
2. Ген pyrG - ген, кодирующий фермент оротидин-5′-фосфатдекарбоксилазу. Фермент принимает участие в синтезе урацила и его недостаточность ведет к ауксотрофности по урацилу. Ауксотрофность по урацилу может быть компенсирована добавлением в среду урацила или уридина.2. The pyrG gene is a gene encoding the orotidine 5′-phosphate decarboxylase enzyme. The enzyme takes part in the synthesis of uracil and its insufficiency leads to uracil auxotrophy. Uracil auxotrophy can be compensated by adding uracil or uridine to the medium.
3. Автономно реплицирующийся конкатамер - не встроенная в хромосому полимерная кольцевая или линейная структура, содержащая большое число копий плазмиды.3. An autonomously replicating concatemer is a polymer ring or linear structure not embedded in the chromosome that contains a large number of copies of the plasmid.
4. Геномные повторы (повторяющиеся геномные последовательности) - последовательности, представленные в геноме в некотором количестве копий, имеющих высокую гомологию между собой.4. Genomic repeats (repetitive genomic sequences) - sequences presented in the genome in a certain number of copies that have high homology among themselves.
5. Тандемные повторы - повторы, расположенные друг за другом в прямой ориентации.5. Tandem repeats - repeats located one after another in a direct orientation.
6. Гомокарион - организм, в котором все ядра несут одинаковую генетическую информацию.6. Homocaryon - an organism in which all nuclei carry the same genetic information.
7. Интегративный трансформант - трансформант, у которого введенный генетический материал интегрирован в состав генома.7. Integrative transformant - a transformant in which the introduced genetic material is integrated into the genome.
8. Грибы вида Rhizopus oryzae - грибы рода Rhizopus, отнесенные к виду oryzae по классификации М. A.A.Schipper A revision of the genus Rhizopus Studies in Mycology, No.25 1 June 1984.8. Fungi of the species Rhizopus oryzae - fungi of the genus Rhizopus, classified as oryzae according to the classification of M. A. A. Schipper A revision of the genus Rhizopus Studies in Mycology, No.25 1 June 1984.
В качестве возможных причин низкой эффективности встраивания чужеродной ДНК в геном Rhizopus приводят (Mol Gen Genomics, 268: 397-406, 2002; Mol Gen Genomics, 271: 499-510, 2004), в частности, низкую частоту гомологичной рекомбинации или наличие модифицированных оснований в собственной ДНК, позволяющих отличать ее от гетерологичной.Possible reasons for the low efficiency of insertion of foreign DNA into the Rhizopus genome are (Mol Gen Genomics, 268: 397-406, 2002; Mol Gen Genomics, 271: 499-510, 2004), in particular, the low frequency of homologous recombination or the presence of modified bases in their own DNA, allowing to distinguish it from heterologous.
Число работ, описывающих успешные эксперименты по стабильной трансформации грибов рода Rhizopus, довольно ограничено, при этом до настоящего времени не известна эффективная система трансформации и векторов, позволяющих воспроизводимо получать интегративные трансформанты.The number of works describing successful experiments on stable transformation of fungi of the genus Rhizopus is rather limited, while up to now, an effective system of transformation and vectors that reproduce integrative transformants are not known.
В работе (Mol Gen Genomics, 271: 499-510, 2004) для введения ДНК в протопласты Rhizopus oryzae использована система агробактериальной трансформации, в результате которой у всех полученных стабильных трансформантов в хромосому интегрировала лишь последовательность маркера, но не вектора, то есть система оказалась не пригодной для клонирования рекомбинантной ДНК.In (Mol Gen Genomics, 271: 499-510, 2004), an agrobacterial transformation system was used to introduce DNA into the protoplasts of Rhizopus oryzae, as a result of which, for all the obtained stable transformants, only the marker sequence, but not the vector, was integrated into the chromosome, i.e. the system turned out to be not suitable for cloning recombinant DNA.
В работе (Curr Genet, 45: 302-310, 2004) приведена система трансформации, где штамм грибов Rhizopus oryzae, содержащий в качестве селективного маркера мутантный ген pyrG, трансформирован плазмидой, включающей тот же селективный маркер - инактивированный ген pyrG, но содержащий мутацию, локализованную в другой части гена. Предполагалось, что в результате рекомбинации в области ДНК, расположенной между этими мутациями, будет получен стабильный интегративный трансформант с одной активной и одной неактивной копией маркера. Однако большая часть полученных трансформантов содержала автономно реплицирующийся конкатамер с исправленной копией гена pyrG и, следовательно, была нестабильна.Curr Genet, 45: 302-310, 2004) presents a transformation system where the strain of fungi Rhizopus oryzae, containing the mutant pyrG gene as a selective marker, is transformed with a plasmid containing the same selective marker, the inactivated pyrG gene, but containing the mutation, localized in another part of the gene. It was assumed that as a result of recombination in the region of DNA located between these mutations, a stable integrative transformant with one active and one inactive copy of the marker will be obtained. However, most of the obtained transformants contained an autonomously replicating concamer with a corrected copy of the pyrG gene and, therefore, was unstable.
Задача заявляемого изобретения состоит в создании генетической конструкции для получения стабильных трансформантов грибов Rhizopus oryzae.The task of the invention is to create a genetic construct to obtain stable transformants of the fungi Rhizopus oryzae.
Поставленная задача решена путем разработки генетической конструкции, содержащей селективный генетический маркер и нуклеотидную последовательность, содержащую последовательность, приведенную в списке последовательностей под номером SEQ ID NO:1 или SEQ ID NO:2, или последовательность, гомологичную одной из указанных не менее чем на 85%.The problem is solved by developing a genetic construct containing a selective genetic marker and a nucleotide sequence containing the sequence shown in the list of sequences under the number SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence homologous to one of these not less than 85% .
Кроме указанных элементов, конструкция, как правило, содержит генетические элементы, необходимые для ее поддержания и распространения в других организмах, в частности в Escherichia coli (E.coli).In addition to these elements, the design, as a rule, contains the genetic elements necessary for its maintenance and distribution in other organisms, in particular in Escherichia coli (E. coli).
Дополнительно, заявляемая генетическая конструкция может содержать генетические элементы, обеспечивающие экспрессию гетерологичных генов либо повышение или снижение уровня экспрессии гомологичных генов.Additionally, the claimed genetic construct may contain genetic elements that allow expression of heterologous genes or increase or decrease the level of expression of homologous genes.
Известно, что последовательности, имеющие большое число гомологичных копий в геноме, используют в составе вектора для получения многокопийных интегративных трансформантов при работе с аскомицетовыми дрожжами и грибами. При этом как рибосомальные гены rDNA (US 5786212, US 609057), так и фрагменты транспозонов (US 5629203, US 6582951) используют с целью увеличения числа копий вектора в геноме, а следовательно, для увеличения уровня экспрессии встроенного в вектор целевого гена.It is known that sequences having a large number of homologous copies in the genome are used as part of a vector to obtain multi-copy integrative transformants when working with ascomycetal yeast and fungi. Moreover, both the rDNA ribosomal genes (US 5786212, US 609057) and transposon fragments (US 5629203, US 6582951) are used to increase the number of copies of the vector in the genome, and therefore, to increase the expression level of the target gene inserted into the vector.
При решении поставленной задачи мы предположили, что использование при трансформации в составе генетической конструкции фрагмента ДНК с геномной последовательностью, имеющей в геноме большое число высокогомологичных копий, может повысить вероятность возникновения рекомбинационного комплекса и, как следствие, обеспечить встраивание конструкции в геном реципиента, а следовательно, возникновение стабильных интегративных трансформантов.In solving this problem, we suggested that the use of a DNA fragment with a genomic sequence that has a large number of highly homologous copies in the structure of a genetic construct during transformation can increase the likelihood of a recombination complex and, as a result, ensure that the construct is embedded in the recipient’s genome, and therefore the emergence of stable integrative transformants.
Принципиальным отличием заявляемого изобретения является то, что повторяющиеся генетические элементы используют не для увеличения числа копий вектора в геноме, а для получения стабильных трансформантов, в отличие от нестабильных трансформантов, как правило, образующихся в процессе трансформации грибов Rhizopus oryzae.The fundamental difference of the claimed invention is that the repeating genetic elements are used not to increase the number of copies of the vector in the genome, but to obtain stable transformants, in contrast to unstable transformants, which are usually formed during the transformation of Rhizopus oryzae fungi.
Для иллюстрации изобретения и получения митотически стабильных трансформантов в качестве генетического маркера использован ген pyrG, а в качестве повторяющейсяся геномной последовательности - последовательность SEQ1, указанная в перечне последовательностей под номером SEQ ID NO:1, и последовательность SEQ2, указанная в перечне последовательностей под номером SEQ ID NO:2.To illustrate the invention and obtain mitotically stable transformants, the pyrG gene was used as a genetic marker, and the sequence SEQ1 shown in the sequence list under the number SEQ ID NO: 1 and the sequence SEQ2 indicated in the sequence list under the number SEQ ID were used as the repeating genomic sequence NO: 2.
Последовательность SEQ1 в геноме штамма Rhizopus oryzae RA 99-880 (http://www.broad.mit.edu/annotation/fungi/fgi/) имеет 26 гомологичных участков, степень ее гомологии к которым варьирует от 96% до 97%. Последовательность SEQ2 в этом геноме имеет более 100 гомологичных участков, степень гомологии с которыми варьирует от 94% до 96%.The SEQ1 sequence in the genome of the strain Rhizopus oryzae RA 99-880 (http://www.broad.mit.edu/annotation/fungi/fgi/) has 26 homologous regions, the degree of homology to which varies from 96% to 97%. The SEQ2 sequence in this genome has more than 100 homologous regions, the degree of homology with which varies from 94% to 96%.
Последовательность SEQ1 длиной 2053 п.н. представляет собой фрагмент открытой рамки считывания ретротранспозона, а последовательность SEQ2 имеет длину 575 п.н. и, возможно, также представляет собой фрагмент мобильного элемента, хотя соответствующей рамки считывания вблизи этого элемента в предварительном исследовании не обнаружено.The sequence of SEQ1 with a length of 2053 bp represents a fragment of the open reading frame of a retrotransposon, and the SEQ2 sequence has a length of 575 bp and, possibly, also represents a fragment of a mobile element, although the corresponding reading frame near this element was not found in the preliminary study.
Изобретение проиллюстрировано следующими фигурами:The invention is illustrated by the following figures:
Фиг.1. Схема плазмиды pPyrG-SEQ1.Figure 1. Scheme of the plasmid pPyrG-SEQ1.
Фиг.2. Схема плазмиды pPyrG-SEQ2.Figure 2. Scheme of plasmid pPyrG-SEQ2.
Фиг.3. Гибридизация по Саузерну геномной ДНК трансформантов плазмидами pPyrG-SEQ1 и pPyrG-SEQ2.Figure 3. Southern hybridization of genomic DNA of transformants with plasmids pPyrG-SEQ1 and pPyrG-SEQ2.
Фиг.4. Гибридизация по Саузерну геномной ДНК трансформантов плазмидой pPyrG-SEQ1 после десяти раундов споруляции на неселективной среде.Figure 4. Southern hybridization of the genomic DNA of the transformants with the plasmid pPyrG-SEQ1 after ten rounds of sporulation in a non-selective medium.
Фиг.5. Гибридизация по Саузерну геномной ДНК ряда штаммов рода Rhizopus с последовательностью SEQ1 в качестве зонда.Figure 5. Southern hybridization of the genomic DNA of a number of strains of the genus Rhizopus with the sequence SEQ1 as a probe.
Фиг.6. Гибридизация по Саузерну геномной ДНК ряда штаммов рода Rhizopus с последовательностью SEQ2 в качестве зонда.6. Southern hybridization of the genomic DNA of a number of strains of the genus Rhizopus with the sequence SEQ2 as a probe.
Пример 1: Получение плазмиды pPyrGExample 1: Obtaining plasmid pPyrG
Фрагмент ДНК размером 2268 п.н., кодирующий аминокислотную последовательность, промоторную и терминаторную области гена pyrG Rhizopus oryzae, получают при помощи ПЦР с использованием Pfu-полимеразы (Fermentas Inc.) и праймеров: CCCGGGGAATTCTTCTTTTAGGTTAAAAACTC (PyrG225-F) и GGATCCGAATTCCAAAGCTTTTCATATATTG (PyrG225-R) (все используемые в работе праймеры синтезированы фирмой «Синтол», Москва).A DNA fragment of 2268 bp, encoding the amino acid sequence, promoter and terminator region of the gene pyrG Rhizopus oryzae, prepared by PCR using Pfu-Polymerase (Fermentas Inc.), and primers: CCCGGGGAATTCTTCTTTTAGGTTAAAAACTC (PyrG225-F) and GGATCCGAATTCCAAAGCTTTTCATATATTG (PyrG225- R) (all primers used in the work were synthesized by Syntol, Moscow).
В качестве матрицы для ПЦР используют геномную ДНК штамма Rhizopus oryzae NRRL 395, полученную по методу, описанному в (Molecular cloning: a laboratory manual (2nd edn). Cold Spring Harbor Laboratory Press, 1989).The genomic DNA of the strain Rhizopus oryzae
Полученный фрагмент амплифицированной ДНК очищают после электрофореза в 1% агарозном геле методом экстракции ДНК (Kit #K0513, Fermentas Inc.).The resulting amplified DNA fragment was purified after electrophoresis on a 1% agarose gel by DNA extraction (Kit # K0513, Fermentas Inc.).
0,5 мкг полученной ДНК лигируют с 0,2 мкг ДНК вектора pUC19 (Fermentas Inc.), обработанного эндонуклеазой рестрикции SmaI, и трансформируют в Е.coli XL 1-Blue. Клоны, содержащие необходимую вставку амплифицированной ДНК размером 2268 п.н., отбирают на чашках по устойчивости к ампициллину и стандартному тесту на отсутствие активности β-галактозидазы. Плазмидную ДНК, выделенную из полученных клонов, проверяют методом рестрикционного анализа.0.5 μg of the obtained DNA is ligated with 0.2 μg of pUC19 vector DNA (Fermentas Inc.) treated with SmaI restriction endonuclease and transformed into E. coli XL 1-Blue. Clones containing the required 2268 bp amplified DNA insert were selected on plates for ampicillin resistance and a standard test for the absence of β-galactosidase activity. Plasmid DNA isolated from the obtained clones is checked by restriction analysis.
Полученная плазмида размером 4954 п.н. названа pPyrG.The resulting plasmid size 4954 bp named pPyrG.
Пример 2: Получение плазмиды pPyrG-SEQ1Example 2: Obtaining plasmid pPyrG-SEQ1
Фрагмент ДНК размером 2065 п.н., содержащий последовательность SEQ1, получают при помощи ПЦР с использованием Pfu-полимеразы и праймеров: GCTAGCGTTGAAACGTCTTACTGCTGC (HF-1) и GCTAGCTGCTTGAATCTCATAATGTTGG (HR-1). В качестве матрицы для ПЦР используют геномную ДНК штамма Rhizopus oryzae NRRL 395.A 2065 bp DNA fragment containing the sequence SEQ1 was obtained by PCR using Pfu polymerase and primers: GCTAGCGTTGAAACGTCTTACTGCTGC (HF-1) and GCTAGCTGCTTGAATCTCATAATGTTGG (HR-1). The genomic DNA of the strain
Полученный фрагмент амплифицированной ДНК очищают после электрофореза в 1% агарозном геле методом экстракции ДНК.The obtained amplified DNA fragment was purified after electrophoresis on a 1% agarose gel by DNA extraction.
0,5 мкг полученной ДНК лигируют с 0,2 мкг ДНК вектора pUC19, обработанного эндонуклеазой рестрикции Ecl136II и трансформируют в Е.coli XL1-Blue. Клоны, содержащие необходимую вставку амплифицированной ДНК размером 2065 п.н., отбирают на чашках по устойчивости к ампициллину и стандартному тесту на отсутствие активности β-галактозидазы. Плазмидную ДНК, выделенную из полученных клонов, анализируют методом рестрикции. Последовательность SEQ1, входящую в состав плазмиды, секвенируют.0.5 μg of the obtained DNA is ligated with 0.2 μg of DNA of the pUC19 vector treated with the restriction endonuclease Ecl136II and transformed into E. coli XL1-Blue. Clones containing the required 2065 bp amplified DNA insert are selected on plates for ampicillin resistance and a standard test for the absence of β-galactosidase activity. Plasmid DNA isolated from the obtained clones is analyzed by restriction method. The sequence of SEQ1, which is part of the plasmid, is sequenced.
Полученная плазмида размером 4751 п.н. названа pUC-SEQ1.The resulting plasmid size 4751 bp named pUC-SEQ1.
0,4 мкг фрагмента ДНК SEQ1 размером 2059 п.н., полученного после обработки плазмиды pUC-SEQ1 эндонуклеазой NheI и очистки после электрофореза в 1% агарозном геле, лигируют с 0,2 мкг ДНК плазмиды pPyrG, обработанной эндонуклеазой рестрикции XbaI и щелочной фосфатазой CIAP (Fermentas Inc.). Лигазную смесь далее трансформируют в Е.coli XL1-Blue. Плазмидную ДНК, выделенную из полученных клонов, проверяют рестрикционным анализом.0.4 μg of a 2059 bp SEQ1 DNA fragment obtained after processing of the pUC-SEQ1 plasmid with NheI endonuclease and purification after electrophoresis on a 1% agarose gel, ligated with 0.2 μg of pPyrG plasmid DNA treated with XbaI restriction endonuclease and alkaline phosphatase CIAP (Fermentas Inc.). The ligase mixture is further transformed into E. coli XL1-Blue. Plasmid DNA isolated from the obtained clones was checked by restriction analysis.
Полученная плазмида содержит ген pyrG Rhizopus oryzae и последовательность SEQ1, имеет размер 7013 п.н. и названа pPyrG-SEQ1 (фиг.1).The resulting plasmid contains the pyrG gene of Rhizopus oryzae and the sequence SEQ1, has a size of 7013 bp and named pPyrG-SEQ1 (FIG. 1).
Пример 3: Получение плазмиды pPyrG-SEQ2Example 3: Obtaining plasmid pPyrG-SEQ2
Фрагмент ДНК размером 589 п.н., содержащий последовательность SEQ2, получают при помощи ПЦР с использованием Pfu-полимеразы и праймеров: TGAGCTCTGTTGTAGAACAGAGTCTGAT (ZF-1) и TGAGCTCTGTTATGTTCTGGTAAAGTAAAAG (ZR-1). В качестве матрицы для ПЦР используют геномную ДНК штамма Rhizopus oryzae NRRL 395.A 589 bp DNA fragment containing the SEQ2 sequence was obtained by PCR using Pfu polymerase and primers: TGAGCTCTGTTGTAGAACAGAGTCTGAT (ZF-1) and TGAGCTCTGTTATGTTCTGGTAAAGTAAAAG (ZR-1). The genomic DNA of the strain
Полученный фрагмент амплифицированной ДНК очищают после электрофореза в 1% агарозном геле методом экстракции ДНК и обрабатывают эндонуклеазой рестрикции SacI.The obtained amplified DNA fragment was purified after electrophoresis on a 1% agarose gel by DNA extraction and treated with SacI restriction endonuclease.
0,5 мкг полученной ДНК лигируют с 0,2 мкг ДНК вектора pUC19, также обработанного эндонуклеазой рестрикции SacI, и трансформируют в Е.coli XL1-Blue. Клоны, содержащие необходимую вставку амплифицированной ДНК размером 581 п.н., отбирают на чашках по устойчивости к ампициллину и стандартному тесту на отсутствие активности β-галактозидазы. Плазмидную ДНК, выделенную из полученных клонов, анализируют методом рестрикции. Последовательность SEQ2, входящую в состав плазмиды, секвенируют.0.5 μg of the obtained DNA is ligated with 0.2 μg of pUC19 vector DNA, also treated with SacI restriction endonuclease, and transformed into E. coli XL1-Blue. Clones containing the required 581 bp amplified DNA insert were selected on plates for ampicillin resistance and a standard test for the absence of β-galactosidase activity. Plasmid DNA isolated from the obtained clones is analyzed by restriction method. The sequence of SEQ2, which is part of the plasmid, is sequenced.
Полученная плазмида размером 3267 п.н. названа pUC-SEQ2.The resulting plasmid 3267 bp in size named pUC-SEQ2.
0,4 мкг фрагмента ДНК SEQ2 размером 581 п.н., полученного после обработки плазмиды pUC-SEQ2 эндонуклеазой SacI и очистки после электрофореза в 1% агарозном геле, лигируют с 0,2 мкг ДНК плазмиды pPyrG, обработанной эндонуклеазой рестрикции SacI и щелочной фосфатазой CIAP. Лигазную смесь далее трансформируют в Е.coli XL1-Blue. Плазмидную ДНК, выделенную из полученных клонов, анализируют методом рестрикции.0.4 μg of a 581 bp SEQ2 DNA fragment obtained after processing of the pUC-SEQ2 plasmid with SacI endonuclease and purification after electrophoresis on a 1% agarose gel, ligated with 0.2 μg of pPyrG plasmid DNA treated with SacI restriction endonuclease and alkaline phosphatase CIAP The ligase mixture is further transformed into E. coli XL1-Blue. Plasmid DNA isolated from the obtained clones is analyzed by restriction method.
Полученная плазмида содержит ген pyrG гриба Rhizopus oryzae и последовательность SEQ2, имеет размер 5535 п.н. и названа pPyrG-SEQ2 (фиг.2).The resulting plasmid contains the pyrG gene of the fungus Rhizopus oryzae and the sequence SEQ2, has a size of 5535 bp and named pPyrG-SEQ2 (FIG. 2).
Пример 4. Трансформация штамма Rhizopus oryzae PYR-17 плазмидой pPyrG-SEQ1, отбор стабильных клоновExample 4. Transformation of the strain Rhizopus oryzae PYR-17 with plasmid pPyrG-SEQ1, selection of stable clones
Для трансформации используют штамм Rhizopus oryzae PYR-17, полученный из штамма Rhizopus oryzae NRRL 395 путем химического мутагенеза и последующей селекци на среде с 5-фтороротовой кислотой, и содержащий мутацию в гене pyrG (Mol Gen Genomics, 268: 397-406, 2002).For transformation, the strain Rhizopus oryzae PYR-17, obtained from the strain
Трансформацию спор штамма Rhizopus oryzae PYR-17 проводят методом бомбардировки микрочастицами (Mol Genet Genomics, 268: 397-406, 2002). В качестве трансформирующей ДНК используют кольцевую ДНК плазмид pPyrG-SEQ1. В качестве контроля используют кольцевую ДНК плазмиды pPyrG. Здесь и далее культивирование штаммов рода Rhizopus осуществляют при 30°С.Transformation of spores of the strain Rhizopus oryzae PYR-17 is carried out by microparticle bombardment (Mol Genet Genomics, 268: 397-406, 2002). As the transforming DNA, the circular DNA of plasmids pPyrG-SEQ1 is used. As control, the circular DNA of plasmid pPyrG is used. Hereinafter, the cultivation of strains of the genus Rhizopus is carried out at 30 ° C.
Селекцию трансформантов ведут по комплементации ауксотрофности по урацилу на агаризованной минимальной среде RZ (Appl Environ Microbiol, 66 (6): 2343-2348, 2000) с добавлением глюкозы (2 мас.%).Transformants are selected by complementing uracil auxotrophy on agarized minimal RZ medium (Appl Environ Microbiol, 66 (6): 2343-2348, 2000) with the addition of glucose (2 wt.%).
Трансформанты инкубируют 5-7 дней до полной споруляции.Transformants are incubated 5-7 days until complete sporulation.
Смесь спор трансформантов с каждой чашки в различных разведениях повторно высевают на среду RZ с добавлением глюкозы (2 мас.%) и Triton-Х100 (0,01 мас.%). Процедуру споруляции и последующего высева повторяют еще 2 раза с целью получения гомокариотичной культуры. На заключительном этапе селекции суспензию спор высевают в большом разведении. Отбор стабильных трансформантов осуществляют по более крупному размеру колоний (т.к. нестабильные трансформанты обладают меньшей скоростью роста). Выбранные крупные клоны, значительно превосходящие остальные в размере, пересевают на неселективную среду PDA (Himedia) с добавлением уридина (0,05 мас.%). Для получения независимых трансформантов споры, полученные с одной чашки после трансформации, используют для получения только одного трансформанта.A mixture of transformant spores from each dish in different dilutions was re-plated on RZ medium supplemented with glucose (2 wt.%) And Triton-X100 (0.01 wt.%). The sporulation and subsequent seeding procedure is repeated 2 more times in order to obtain a homocaryotic culture. At the final stage of selection, the spore suspension is sown in large dilution. The selection of stable transformants is carried out according to the larger size of the colonies (because unstable transformants have a lower growth rate). Selected large clones, significantly superior to the others in size, are subcultured onto non-selective PDA medium (Himedia) with the addition of uridine (0.05 wt.%). To obtain independent transformants, spores obtained from one cup after transformation are used to obtain only one transformant.
После споруляции на неселективной среде подтверждают митотическую стабильность трансформантов.After sporulation on a non-selective medium, mitotic stability of the transformants is confirmed.
Для подтверждения митотической стабильности полученного трансформанта сравнивают количество колоний, выросших при высеве образованных им спор на минимальную среду RZ с добавлением Triton-X100 (0,01 мас.%) и глюкозы (2 мас.%), с количеством колоний, выросших на той же среде, но дополнительно содержащей уридин (0,05 мас.%).To confirm the mitotic stability of the obtained transformant, the number of colonies grown by plating the spores formed by them on the minimal RZ medium with the addition of Triton-X100 (0.01 wt.%) And glucose (2 wt.%) Is compared with the number of colonies grown on the same medium, but additionally containing uridine (0.05 wt.%).
Полученные результаты показали, что для всех исследованных трансформантов число клонов, выросших в течение 2-х суток на среде с уридином (неселективной среде) и на среде без уридина (селективной среде), отличалось незначительно, что свидетельствует о стабильности проанализированных трансформантов.The results showed that for all studied transformants, the number of clones that grew within 2 days on a medium with uridine (non-selective medium) and on a medium without uridine (selective medium) did not differ significantly, which indicates the stability of the analyzed transformants.
В качестве контроля для трансформации использована плазмида pPyrG, не содержащая повторяющихся генетических элементов.Plasmid pPyrG, which does not contain repetitive genetic elements, was used as a control for transformation.
В серии контрольных экспериментов крупных колоний не обнаружено, а типичные, медленно растущие трансформанты образуют после споруляции в селективных условиях незначительное количество прототрофных колоний, что свидетельствует об их нестабильности.In a series of control experiments, large colonies were not found, and typical, slowly growing transformants form, after sporulation under selective conditions, an insignificant number of prototrophic colonies, which indicates their instability.
Пример 5: Определение стабильности трансформантов с плазмидой pPyrG-SEQ1 методом гибридизацииExample 5: Determination of the stability of transformants with plasmid pPyrG-SEQ1 by hybridization
Для выделения геномной ДНК выращивают биомассу трех независимых трансформантов Т1-1, Т1-2 и Т1-3, полученных при введении плазмиды pPyrG-SEQ1 в штамм реципиента Rhizopus oryzae PYR-17, засевая спорами жидкую среду YPD следующего состава (мас.%): пептон - 0,5; дрожжевой экстракт - 0,3; глюкоза - 2; вода - остальное, с добавлением Tween-80 - 0,1 мас.%.To isolate genomic DNA, the biomass of three independent transformants T1-1, T1-2, and T1-3 is grown by introducing the plasmid pPyrG-SEQ1 into the strain of the recipient Rhizopus oryzae PYR-17, inoculating with YPD liquid medium of the following composition (wt.%): peptone - 0.5; yeast extract - 0.3; glucose - 2; water - the rest, with the addition of Tween-80 - 0.1 wt.%.
Геномную ДНК трансформантов и штамма-реципиента обрабатывают эндонуклеазой рестрикции Eco88I, сайт узнавания которой является уникальным для используемой плазмиды (фиг.1). После электрофоретического разделения в агарозном геле образцы используют для гибридизации по Саузерну (Molecular cloning: a laboratory manual (2nd edn). Cold Spring Harbor Laboratory Press, 1989).The genomic DNA of the transformants and the recipient strain is treated with an Eco88I restriction endonuclease, the recognition site of which is unique to the plasmid used (FIG. 1). After agarose gel electrophoretic separation, the samples were used for Southern hybridization (Molecular cloning: a laboratory manual (2nd edn). Cold Spring Harbor Laboratory Press, 1989).
В качестве зонда используют фрагмент ДНК длиной 718 п.н., представляющий собой часть промоторной области гена pyrG. Для его получения 0,5 мкг ДНК плазмиды pPyrG обрабатывают эндонуклеазой рестрикции EcoRI. Необходимый фрагмент выделяют после электрофореза в 1% агарозном геле методом экстракции ДНК.A 718 bp DNA fragment, which is a part of the promoter region of the pyrG gene, is used as a probe. To obtain it, 0.5 μg of pPyrG plasmid DNA is treated with an EcoRI restriction endonuclease. The required fragment is isolated after electrophoresis in 1% agarose gel by DNA extraction.
На фиг.3 отображены результаты гибридизации геномной ДНК трансформантов T1-1, T1-2 и Т1-3, а также штамма реципиента (PYR-17). Для контроля величины фрагментов ДНК при электрофорезе использован молекулярный маркер GeneRuler 1 kb DNA ladder (Fermentas) (обозначен MW Std, размеры фрагментов указаны слева) и λ/EcoRI маркер (Fermentas) (обозначен λ/EcoRI, размер фрагмента указан справа). Из результатов гибридизации следует, что помимо хромосомальной копии гена pyrG (полоса около 4 т.п.н.), присутствующей у реципиента, у трансформантов наблюдается большое число дополнительных копий, основная масса которых представлена полосой в районе 7 т.п.н., что соответствует плазмиде pPyrG-SEQ1.Figure 3 shows the results of hybridization of the genomic DNA of transformants T1-1, T1-2 and T1-3, as well as the recipient strain (PYR-17). To control the size of DNA fragments during electrophoresis, the
Возможным объяснением наличия этих копий может быть как образование тандемных повторов при интеграции, так и наличие дополнительных копий вектора вне хромосомы в виде конкатамера.A possible explanation for the presence of these copies can be both the formation of tandem repeats during integration, and the presence of additional copies of the vector outside the chromosome in the form of a concatemer.
Таким образом, исходя из полученных результатов нельзя однозначно сделать вывод о том, встроилась ли плазмида в состав хромосомы в виде тандемных копий или часть копий присутствует в виде конкатамера.Thus, based on the results obtained, it cannot be unambiguously concluded that the plasmid was integrated into the chromosome in the form of tandem copies or whether some of the copies are present in the form of a concatemer.
Так как в случае автономной репликации конкатамер должен быстро теряться в ходе роста при интенсивном делении ядер, поведение ДНК плазмиды pPyrG-SEQ1 у трансформантов Т1-1 и Т1-2 изучено дополнительно через десять поколений споруляции в неселективных условиях.Since in the case of autonomous replication the concatamer should quickly lose during growth with intensive nuclear fission, the behavior of the DNA of the plasmid pPyrG-SEQ1 in the T1-1 and T1-2 transformants was studied additionally after ten generations of sporulation under non-selective conditions.
Споры трансформантов Т1-1 и Т1-2 высевают на неселективную среду PDA с добавлением уридина и Triton-X100. Отбирают по три отдельных клона каждого из трансформантов и наращивают их до стадии споруляции на чашках со средой PDA с добавлением уридина. Полученные в шести независимых экспериментах споры снова рассевают на PDA с добавлением уридина и Triton-X100. Далее в каждом эксперименте отбирают по одному клону и операцию повторяют еще девять раз. В последнем эксперименте полученные споры используют для выделения геномной ДНК и гибридизации по Саузерну аналогично тому, как описано выше. Результаты гибридизации отображены на фиг.4.Spores of transformants T1-1 and T1-2 are plated on non-selective PDA medium supplemented with uridine and Triton-X100. Three separate clones of each of the transformants were selected and expanded to the sporulation stage on plates with PDA medium supplemented with uridine. The spores obtained in six independent experiments are again scattered on PDA with the addition of uridine and Triton-X100. Then, in each experiment, one clone is selected and the operation is repeated nine more times. In a final experiment, the resulting spores are used to isolate genomic DNA and Southern hybridization in the same way as described above. The hybridization results are shown in FIG.
Из результатов видно, что потомки трансформантов Т1-1 и Т1-2, названые Т1-1-1, T1-1-2, T1-1-3 и T1-2-1, T1-2-2, T1-2-3, соответственно, содержат характерный набор фрагментов ДНК, схожий с таковым у исходных трансформантов, при этом основная доля фрагментов имеет размер около 7 т.п.н., что соответствует немодифицированной плазмиде. Таким образом, полученные результаты говорят в пользу многокопийного тандемного типа встраивания плазмиды pPyrG-SEQ1 и подтверждают стабильность трансформантов.The results show that the descendants of the transformants T1-1 and T1-2, named T1-1-1, T1-1-2, T1-1-3 and T1-2-1, T1-2-2, T1-2- 3, respectively, contain a characteristic set of DNA fragments similar to that of the initial transformants, with the majority of fragments having a size of about 7 kb, which corresponds to an unmodified plasmid. Thus, the obtained results speak in favor of a multi-copy tandem type of insertion of the plasmid pPyrG-SEQ1 and confirm the stability of the transformants.
Пример 6. Трансформация штамма Rhizopus oryzae PYR-17 плазмидой pPyrG-SEQ2, отбор стабильных клоновExample 6. Transformation of the strain Rhizopus oryzae PYR-17 with plasmid pPyrG-SEQ2, selection of stable clones
Трансформацию штамма Rhizopus oryzae PYR-17 плазмидой pPyrG-SEQ2 и отбор стабильных клонов осуществляют по примеру 4. В качестве трансформирующей ДНК используют кольцевую ДНК плазмиды pPyrG-SEQ2.Transformation of the strain Rhizopus oryzae PYR-17 with the plasmid pPyrG-SEQ2 and selection of stable clones is carried out as in Example 4. As the transforming DNA, the circular DNA of the plasmid pPyrG-SEQ2 is used.
Гибридизацию полученных трансформантов Т2-1, Т2-2 и Т2-3 осуществляют по примеру 5. Геномную ДНК обрабатывают эндонуклеазой рестрикции Eco88I, сайт узнавания которой является уникальным для данной плазмиды (фиг.2).Hybridization of the obtained transformants T2-1, T2-2 and T2-3 is carried out according to example 5. Genomic DNA is treated with restriction endonuclease Eco88I, the recognition site of which is unique to this plasmid (figure 2).
Из результатов, приведенных на фиг.3, видно, что для трансформантов Т2-1, Т2-2 и Т2-3 полоса, соответствующая по размеру геномной копии гена pyrG (4 т.п.н.), отсутствует, и можно заключить, что интеграции произошла в геномный локус pyrG. При этом появление полос, соответствующих размерам 2,5; 5,5 и 7,5 т.п.н., и их интенсивность говорят о наличии 2; 4 и 1 копий плазмиды, интегрировавшихся в геном трансформантов Т2-1, Т2-2 и Т2-3 соответственно. Факт интегративного встраивания плазмиды свидетельствует о стабильности трансформантов Т2-1, Т2-2 и Т2-3.From the results shown in figure 3, it is seen that for the transformants T2-1, T2-2 and T2-3, the band corresponding to the size of the genomic copy of the pyrG gene (4 kb) is absent, and we can conclude that integration has occurred at the pyrG genomic locus. In this case, the appearance of strips corresponding to sizes 2.5; 5.5 and 7.5 kb, and their intensity indicates the presence of 2; 4 and 1 copies of the plasmid integrated into the genome of transformants T2-1, T2-2 and T2-3, respectively. The fact of integrative insertion of the plasmid indicates the stability of the transformants T2-1, T2-2 and T2-3.
Пример 7. Выявление повторяющихся геномных последовательностей SEQ1 и SEQ2 у штаммов рода RhizopusExample 7. Identification of duplicate genomic sequences of SEQ1 and SEQ2 in strains of the genus Rhizopus
Геномную ДНК семи штаммов Rhizopus oryzae и одного штамма Rhizopus oligosporus (таблица), полученную по примеру 5, обрабатывают эндонуклеазой рестрикции ScaI, сайт узнавания которой отсутствует в повторяющихся геномных последовательностях SEQ1 и SEQ2.The genomic DNA of seven strains of Rhizopus oryzae and one strain of Rhizopus oligosporus (table) obtained in Example 5 is treated with a ScaI restriction endonuclease, the recognition site of which is not found in the repeating genomic sequences SEQ1 and SEQ2.
Полученные образцы ДНК далее используют для гибридизации по Саузерну. Используемые в качестве зондов фрагменты ДНК, содержащие последовательности SEQ1 и SEQ2, получают методом ПЦР по примерам 2 и 3 соответственно.The obtained DNA samples are then used for Southern hybridization. The DNA fragments used as probes containing the sequences SEQ1 and SEQ2 were obtained by PCR according to Examples 2 and 3, respectively.
На фиг.5 и фиг.6 приведены результаты гибридизации геномной ДНК восьми штаммов (таблица) с последовательностями SEQ1 и SEQ2 в качестве зондов соответственно (при этом каждая копия повторяющейся в геноме последовательности проявляется в качестве отдельной полосы).Figures 5 and 6 show the results of hybridization of the genomic DNA of eight strains (table) with the sequences SEQ1 and SEQ2 as probes, respectively (each copy of the sequence repeating in the genome appears as a separate band).
Наблюдающиеся для всех штаммов Rhizopus oryzae многочисленные полосы показывют, что последовательности SEQ1 и SEQ2 имеют большое число повторов во всех исследованных штаммах Rhizopus oryzae. В штамме Rhizopus oligosporus NRRL 2710 гомология к последовательности SEQ2 отсутствует и наблюдается лишь ограниченная гомология к последовательности SEQ1.Numerous bands observed for all strains of Rhizopus oryzae show that the sequences SEQ1 and SEQ2 have a large number of repeats in all the studied strains of Rhizopus oryzae. In the strain
Наличие описанных повторяющихся в геноме последовательностей во всех исследованных штаммах Rhizopus oryzae позволяет использовать генетическую конструкцию, полученную на основе последовательности, повторяющейся в геноме одного штамма, для стабильной интегративной трансформации широкого круга реципиентов этого вида.The presence of the described repeating sequences in the genome in all the studied strains of Rhizopus oryzae allows using the genetic construct obtained on the basis of the sequence repeating in the genome of one strain for stable integrative transformation of a wide range of recipients of this species.
Таким образом, заявленная генетическая конструкция позволяет получить митотически стабильные трансформанты грибов вида Rhizopus oryzae, причем генетическая конструкция, полученная на основе последовательности, повторяющейся в геноме одного штамма, может быть использована также для стабильной интегративной трансформации широкого круга реципиентов этого вида.Thus, the claimed genetic construct allows to obtain mitotically stable transformants of fungi of the species Rhizopus oryzae, moreover, the genetic construct obtained on the basis of a sequence repeating in the genome of one strain can also be used for stable integrative transformation of a wide range of recipients of this species.
Важно также отметить, что заявленная конструкция может быть использована, в том числе, для получения штаммов с более высоким уровнем продукции того или иного целевого продукта. Для этого в описанную генетическую конструкцию должны быть добавлены элементы, обеспечивающие повышение или снижение уровня экспрессии выбранных генов или экспрессию гетерологичных генов. Например, для повышения продукции молочной кислоты в конструкцию pPyrG-SEQ1 может быть добавлен ген Rhizopus oryzae ldhA под гомологичным промотором pgk2.It is also important to note that the claimed design can be used, including, to obtain strains with a higher level of production of a particular target product. To this end, elements must be added to the described genetic construct to increase or decrease the expression level of the selected genes or to express heterologous genes. For example, to increase the production of lactic acid, the Rhizopus oryzae ldhA gene can be added to the pPyrG-SEQ1 construct under the homologous pgk2 promoter.
Claims (2)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2009123244/10A RU2439157C2 (en) | 2009-06-18 | 2009-06-18 | GENETIC CONSTRUCTION FOR OBTAINING STABLE TRANSFORMANTS OF FUNGI OF GENUS Rhizopus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2009123244/10A RU2439157C2 (en) | 2009-06-18 | 2009-06-18 | GENETIC CONSTRUCTION FOR OBTAINING STABLE TRANSFORMANTS OF FUNGI OF GENUS Rhizopus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| RU2009123244A RU2009123244A (en) | 2010-12-27 |
| RU2439157C2 true RU2439157C2 (en) | 2012-01-10 |
Family
ID=44055290
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2009123244/10A RU2439157C2 (en) | 2009-06-18 | 2009-06-18 | GENETIC CONSTRUCTION FOR OBTAINING STABLE TRANSFORMANTS OF FUNGI OF GENUS Rhizopus |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2439157C2 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116622526B (en) * | 2023-07-20 | 2023-10-10 | 苏陀科技(北京)有限公司 | Rhizopus oryzae strain and application thereof in mycelium protein production |
-
2009
- 2009-06-18 RU RU2009123244/10A patent/RU2439157C2/en active
Non-Patent Citations (1)
| Title |
|---|
| MICHIELSE C.B. et al. Development of a system for integrative and stable transformation of the zygomycete Rhizopus oryzae by Agrobacterium-mediated DNA transfer, Mol Gen Genomics, 2004, Vol.271, p.p.499-510. * |
Also Published As
| Publication number | Publication date |
|---|---|
| RU2009123244A (en) | 2010-12-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DK0979294T3 (en) | Gene conversion AS A TOOL FOR CONSTRUCTION OF RECOMBINANT INDUSTRIAL filamentous fungi | |
| EP3180425B1 (en) | Genetic targeting in non-conventional yeast using an rna-guided endonuclease | |
| Michielse et al. | Agrobacterium-mediated transformation leads to improved gene replacement efficiency in Aspergillus awamori | |
| EP0635574A1 (en) | Selection marker gene free recombinant strains, a method for obtaining them and the use of these strains | |
| JP7473137B2 (en) | A novel strain of Pseudozyma antarctica | |
| Mizutani et al. | Detailed analysis of targeted gene mutations caused by the Platinum-Fungal TALENs in Aspergillus oryzae RIB40 strain and a ligD disruptant | |
| EP2938727B1 (en) | Genes/genetic elements associated with mating impairment in trichoderma reesei qm6a and its derivatives and process for their identification | |
| EP1666601B1 (en) | Transformant having an increased frequency of homologous recombination | |
| US6534315B1 (en) | Yeast transformation cassette | |
| Ikushima et al. | Efficient gene disruption in the high-ploidy yeast Candida utilis using the Cre-loxP system | |
| JP6599583B1 (en) | Multigene disrupted Aspergillus microorganism and method for producing the same | |
| RU2439157C2 (en) | GENETIC CONSTRUCTION FOR OBTAINING STABLE TRANSFORMANTS OF FUNGI OF GENUS Rhizopus | |
| JP2004524817A (en) | Genetically modified cells containing no drug resistance marker and method for producing the same | |
| EP1414979B1 (en) | Vector for site-specific integration of heterologous dna sequences into the rdna sites of methylotrophic yeasts | |
| US7001751B1 (en) | PyrF gene and the utilization thereof | |
| JP3585840B2 (en) | Expression system for protein production | |
| JP5565992B2 (en) | Transformation method of yeast Candida utilis | |
| JP6274502B2 (en) | Method for obtaining a uracil-requiring strain of Cryptococcus having an increased frequency of homologous recombination | |
| JP2018046838A (en) | Marker gene | |
| JP5367300B2 (en) | Genes involved in conidia formation of Aspergillus and methods for increasing the conidia formation ability of Aspergillus oryzae | |
| JP4330452B2 (en) | Selectable marker gene | |
| EP4269575A1 (en) | Atp-prt variant with reduced feedback inhibition by histidine, and histidine-producing strain expressing same | |
| EP4269574A1 (en) | Atp-prt variant with reduced feedback inhibition by histidine, and histidine-producing strain expressing same | |
| EP0815241B1 (en) | Identification and cloning of a mobile transposon from aspergillus | |
| EP1539926A1 (en) | Myrothecium sp. transformation and expression system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PC43 | Official registration of the transfer of the exclusive right without contract for inventions |
Effective date: 20170327 |
|
| PD4A | Correction of name of patent owner |