RU2353656C2 - Method of finding proneness to high-altitude pulmonary edema - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention refers to medicine, exactly to diagnostics, namely to method of finding proneness to high-altitude pulmonary edema (HAPE) in a person. Method involves polymorphism identification in a gene of induced nitrogen oxide synthase in said person where polymorphism is in position 142 SEQ ID NO:1. Nucleotide A observed in the specified position indicates proneness to HAPE. The invention ensures method of finding proneness to HAPE, finding the linked allelic gene iNOS and HAPE, producing new primers and detector of amplification containing new single nucleotide polymorphism SNP, as well as correlation analysis of allelic genes between inhabitants of plains and HAPE patients.

EFFECT: development of effective method of finding proneness to high-altitude pulmonary edema (HAPE) in a person.

4 cl, 7 ex, 5 dwg, 4 tbl

Description

FIELD OF THE INVENTION

The present invention relates to a method for determining a predisposition to high altitude pulmonary edema (HAPE). In particular, it relates to allelic variants of the iNOS gene (inducible nitric oxide synthase), for which a relationship with a predisposition to HAPE has been found.

State of the art

High altitude pulmonary edema (HAPE) is a form of non-cardiagenic pulmonary edema that develops in approximately 10% of randomly selected climbers within 24 hours after a quick climb to a height above 4000 meters. A similar phenomenon was found in a plain inhabitant who rose to a height of more than 3,000 m for various business reasons. A higher incidence rate, about 60%, has been shown for subjects who are predisposed to HAPE, as documented in previously identified cases of the occurrence of the disease (Houston CS et. Al. 1960, Bartsch P et. Al. 1997, 1990). HAPE can be effectively prevented by prophylactic use of vasodilators or by slow lifting. However, it remains the most common cause of death associated with high altitude exposure during a military sports trip or mountain climbing (Hackett PH et. Al. 1990). Himalayan climbers had a mortality rate of 50% if immediate treatment with oxygen support or rapid descent is not possible (Lobenhoffer HP et. Al. 1982). The apparent difference in the clinical picture and the severity of the disease between racial and ethnic groups, together with family characteristics, indicate the existence of a reliable hereditary predisposition to the disease.

Although knowledge of the factors that influence the development of HAPE is still incomplete, there is experimental evidence that excessively enhanced hypoxic pulmonary vasoconstriction (HPV) plays an important role in this (Scherrer U et. Al. 1996). Excessive increases in pulmonary arterial pressure have been demonstrated by invasive and non-invasive high altitude measurements in people with HAPE. Uneven vasoconstriction in the capillaries sometimes leads to “capillary leakage”, followed by the formation of edema (Bartsch P et. Al. 1991). People susceptible to the disease show an increased reaction from the pulmonary vessels, even during short-term exposure to the highlands. The underlying pathophysiological mechanism of such excessively enhanced HPV is still unknown. However, there is evidence that endogenous vasodilator nitric oxide (NO) modulates vascular reactivity (Palmer RMJ et. Al. 1987). The regulation of vascular tone by nitric oxide is attributed to the action of intermediate products of the cGMP-dependent pathway (Bellamy TC et. Al. 2002).

The following studies highlight the involvement of nitric oxide in HAPE.

Nitric oxide exerts its effect mainly through an improvement in the ventilation / perfusion ratio and a decrease in the alveolar-capillary difference in the partial pressure of oxygen by increasing the saturation of arterial blood with oxygen (Scherrer U et. Al. 1996). However, in healthy volunteers, the administration of an antagonist of the synthesis of nitric oxide N ^G- monomethyl-L-arginine (L-NMMA) during hypoxia increased pulmonary artery pressure and vascular resistance, which resembled the effects described in HAPE. Because of this, nitric oxide has been used as an inhalation therapy for the treatment of individuals affected by HAPE (Anand IS et. Al. 1998).

Phosphodiesterase 5 is the key enzyme responsible for hydrolysis of cGMP in the lungs. For phosphodiesterase 5 inhibitors, the ability to suppress hypoxia-induced pulmonary hypertension has been found (Goldstein I et. Al. 1998). Hypoxia decreases the amount of expired nitric oxide in climbers exposed to HAPE, indicating a reduction in nitric oxide production in such cases (Busch et. Al. 2001). Such a violation of the mechanism of the synthesis of nitric oxide, leading to a low level of nitric oxide, can be considered as underlying the pathogenesis of HAPE. Nitric oxide is synthesized by the three isoenzymes nNOS (neuronal nitric oxide synthase, NOS1), iNOS (induced nitric oxide synthase NOS2) and eNOS (endothelial nitric oxide synthase NOS3) (Mishel T et. Al. 1997). The expression of NOS1 and NOS3 is not regulated, while NOS2 is expressed after induction. In addition, eNOS (endothelial nitric oxide synthase) is the most likely link whose defect is believed to occur with HAPE, while iNOS (induced nitric oxide synthase) induction seems to be necessary for the immediate restoration of the total nitric oxide reserve (Xia Y et. al. 1998). Moreover, robust cell signaling mechanisms tend to replenish induced genes for immediate early physiological responses. It can be assumed that a violation in iNOS that does not allow its activation may prevent the restoration of reduced levels of nitric oxide in individuals who are prone to HAPE due to hypoxia.

Disruption in iNOS can occur at the genetic level in patients with HAPE. In a large number of cases, a violation of the expression of these genes by polymorphisms in the gene sequence was found (Qadar Pasha MA et. Al. 2001). Therefore, it is always possible that polymorphism in the iNOS gene can disrupt its expression and provoke a disease.

Accepted HAPE Treatments

1. Nitric oxide therapy: Nitric oxide has been used as an inhalation therapy for the treatment of HAPE. It exerts its effect mainly through an improvement in the ventilation / perfusion ratio and a decrease in the alveolar-arterial difference in the partial pressure of oxygen by an increase in arterial oxygen saturation.

Nitric oxide caused an improvement in arterial oxygenation in subjects with HAPE, which was accompanied by a change in blood flow in the lungs from the edematous segments and to the non-edematous segments, which leads to aligned / homogeneous vasoconstriction in all capillaries. (Scherrer et. Al., Anand et. Al. 1998).

2. Rapid descent: The rapid descent of patients with HAPE not only prevents deterioration, but also positively affects the pathogenesis of the disease (Hackett et. Al. 2001).

3. Portable air chambers (PACs): PACs in the form of small cylinders filled with oxygen are often used as inhalation therapy for HAPE (Hackett et. Al. 2001).

4. Genetic predisposition: only one study in this context suggests that hereditary variability of the endothelial nitric oxide synthase (eNOS) gene and angiotensin converting enzyme (ACE) gene can predispose an individual to HAPE (Droma Y et. Al. 2002). The results are as follows:

The control The patients Glu298 Asp (eNOS) 9.8% 25.6% B / A (eNOS) 6.9% 32.2% I / D (ACE) four% 22%

Limitations of Available HAPE Therapy

1. Patients with HAPE did not show a uniform response to nitric oxide inhalation. Moreover, the required concentration of nitric oxide varies with the severity of the disease. Sometimes inadequate inhalation leads to hypotension or even to septic shock in patients.

2. Immediate descent of patients with HAPE often remains impossible due to severe weather and difficult terrain (Anand IS et. Al. 1998, Hackett et. Al. 2001).

3. Transporting PACs is often not feasible due to congestion problems. Improving the conditions of the disease is often temporary because discontinuing use of the camera will worsen the patient's condition (Hackett et. Al. 2001).

4. The described HAPE polymorphism is not specific, but has been shown to be associated with disorders such as diabetes, coronary artery disease, hypertension and myocardial infarction when high blood pressure is observed (Monti LD et. Al., Via M et. al. 2003). The described frequency difference between the alleles is similar to other diseases. Therefore, the possibility of an allelic contribution to the disease may be due to other pathophysiological processes, such as hypertension, which causes an increase in HAPE. Moreover, the study does not include the indigenous inhabitants of the highlands, the population living quietly in those conditions where the disease occurs.

The novelty of the invention is to provide a new method for detecting a predisposition to HAPE.

In another aspect, the novelty is to identify a new marker region of the iNOS gene.

In a further aspect, the novelty is the production of a new SNP in the iNOS gene.

In another aspect, the novelty is to identify the association of allelic variants of the iNOS gene with HAPE.

Another novelty is the provision of new primers and amplification sensors that contain a new single nucleotide polymorphism (SNP).

Objectives of the invention

The main objective of the invention is to provide a method for identifying a predisposition to HAPE, which eliminates the limitations described above.

Another challenge is to provide new SNPs in the iNOS gene.

Another objective is to obtain new primers and amplification sensors that contain new SNPs.

The next task is to perform a correlation analysis of allelic variants between the inhabitants of the plain and patients with HAPE, so that this relationship with the disease can be noted.

Disclosure of invention

The present invention relates to a method for detecting a predisposition to HAPE. In particular, it relates to allelic variants of the iNOS gene, which is associated with a predisposition to HAPE. Violation of the mechanism of the synthesis of nitric oxide leads to a low level of nitric oxide, described as responsible for the pathogenesis of HAPE. Responsibility for nitric oxide production has been shown for the iNOS gene, while nitric oxide production inhibitors increase the severity of HAPE. The present invention includes a method for detecting a predisposition to HAPE in the form of a new allelic variant of the iNOS gene in the disclosed marker region, which showed a negative relationship with predisposition to HAPE in the population.

Brief Description of the Drawings

FIG. 1 is a schematic representation of the localization of the inducible nitric oxide synthase gene iNOS: 17 cenq ^11.2 . The vertical lines indicate exon regions (nucleotide sequence ID No. NT_010799 from Gene bank).

In FIG. 2 shows a sequence file of a homozygous individual with AA.

In FIG. 3 shows a sequence file of a homozygous individual with GG.

In FIG. 4 shows a sequence file of a heterozygous individual with AG.

In FIG. 5 shows a sequence file of a heterozygous individual with TC.

Other and further aspects, features and advantages of the present invention will become apparent from the further description of a preferred embodiment of the invention disclosed. Alternative embodiments of the invention may be presented by those skilled in the art. All such alternative embodiments of the invention are within the scope of this invention.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to methods for detecting a predisposition to HAPE. In particular, it relates to allelic variants of the iNOS gene, for which a relationship with a predisposition to HAPE has been found.

I. Identification of the marker region on the iNOS gene

Considering the important functions of nitric oxide in high altitude conditions, iNOS, the inducible nitric oxide synthase gene has been selected as the appropriate gene for research.

II. The choice of research objects

Clinical severity of HAPE was assessed by the Acute Mountain Altitude Sickness (AMS) system of Lake Louis. Briefly, five symptoms were evaluated in patients: headache, gastrointestinal disturbances, fatigue, weakness, or both, dizziness, impaired mental ability, or both, and sleep disturbances. Changes in mental status, ataxia, and peripheral edema were also evaluated. Each of these symptoms was rated between 0 and 3. A rating of 0 meant no symptoms; 1 - mild symptoms, 2 - moderate symptoms and 3 - severe symptoms. The HAPE score was the sum of all 8 symptoms, and the patient was described using a HAPE score> 6 (Anand et. Al. 1998). Plains dwellers (LLs) were subjects who, only after introduction to the highlands at least three times, did not reveal any of the above symptoms. Indigenous Highlands (HA) have been permanent residents of the Highlands since ancient times.

III. Extraction of genomic DNA from white blood cells

Genomic DNA was extracted from the blood using salting out method. Red blood cell lysis in the presence of salt was followed by treatment with a lysis of the nucleus buffer (NLB). Proteins were precipitated and DNA extraction was achieved in ethanol (Miller SA et. Al. 1988).

IV. Identification of allelic variants of the iNOS gene

The new polymorphism according to the invention.

As a first step of the present invention, the applicants carried out PCR amplification of the iNOS gene marker region using self-developed oligonucleotide primers (Gene bank access number NT_010799). Sequencing of purified PCR products revealed a new single nucleotide polymorphism in intron 7 of the human iNOS gene. Therefore, it was obvious that a previously unknown allele or subtype of the iNOS human gene exists.

The present invention includes a sequence of allelic variants of the human iNOS gene containing the subsequent new single nucleotide polymorphism compared to the human iNOS gene sequence in the database.

For example, the nucleotide sequence of allelic variants of the iNOS human gene (SEQ ID NO: 1) having a polymorphic region shown in Table 1 may be -

5'CAGCGGAGTGATGGCAAGCACGACTTCCGGGTGTGGAATGCTCAGCTCATCCGCTATGCTGGCTACCAGATGCCAGATGGCAGCATCAGAGGGGACCCGCCAACGTGGAATTCACTCAGGTACCCGGCCCAGCCTCAG

A * / G CCGGCCATTGGGGCGGGGGAGCCCCGTGGTGAGCGAGTGACAGAGTGGAGCCCAGAGGAGACACGCAGCCCGGGCTTACAGACTCACAGGGCCCGTCTTGTTCCCCAGCTGTGCATC3 '

In the above sequence, SNP * is shown in bold.

Table 1 Modified Plot Major change Mutation type 19480 A / g Transition

V. Associative analysis of the disease

SNP analysis in 42 highland indigenous people, 39 people in the HAPE control group and 18 HAPE patients found three genotypes named AA, AG and GG. The distribution of alleles is summarized in table 2.

table 2 Objects of study A G HAPE Control Group (n = 39) 0.35 0.65 patients with HAPE (n = 18) 0.58 0.42 Indigenous Highlands (n = 42) 0.18 0.82

The frequency of the G allele was found in the following order: highland indigenous people> HAPE control group> HAPE subjects. Biostatistical analysis showed a reliable association of the G allele with high altitude adaptation and the A allele with the disease, as indicated in table 3.

In this document, the odds ratio (OR) and 95% confidence interval were used as a measure of the strength of the link between the genotype combination and the disease. A value of P <0.05 was accepted as statistically significant.

Table 3 Type of communication Value
χ ² P value Odds ratio 95% CI (confidence interval) Relative risk HAPE patients and the HAPE control group 10.63 0.001 2.56 1.45-4.54 1.66 (1.21-2.27) HAPE patients and indigenous highlands 33.96 <0.001 6.29 3.30-12.01 3.22 (2.05-5.06) HAPE control group and indigenous highlands 7.42 0.006 - - -

Nitric oxide synthase for its nitric oxide synthesis reaction needs oxygen, which acts as a reaction cofactor. Oxygen binds the oxygenase domain in iNOS and promotes the synthesis of nitric oxide. Under conditions of hypoxia, a lack of oxygen can lead to a decrease in the production of nitric oxide, and any modification in the oxygenase domain that changes the activity of the enzyme so that it does not need oxygen or needs less oxygen can help normalize the production of nitric oxide. Nitric oxide improves hemoglobin oxygenation, and normal nitric oxide production can improve the mechanisms of acclimatization action, therefore, any violation in the oxygenase domain may be favorable for nitric oxide production. In the present invention, the new SNP found in intron 7 is presented next to the oxygenase domain of the NOS2 gene, which connects exon 7 to exon 16. It is very possible that SNPs found in a non-random distribution of nearby SNPs contribute to the final effect on nitric oxide production the NOS2 genome.

VI. Diagnostic kits

The invention further includes diagnostic kits containing one or more allelic specific oligonucleotides, as described in SEQ ID 2 and 3. Often, kits contain one or more pairs of allele-specific oligonucleotides that hybridize with different forms of polymorphism. In some kits, allele-specific oligonucleotides are immobilized on a substrate. For example, such a substrate may include allele-specific nucleotide probes to detect at least the polymorphism shown in Table 1. Optional additional components in the kit include, for example, restriction enzymes, reverse transcriptase or polymerase, triphosphate nucleoside substrate, agents used for labeling (for example, an avidin enzyme conjugate and an enzyme substrate and chromogen if the labeling is biotin), and suitable buffers for reverse transcription, PCR, or hybridization reactions. Typically, the kit also contains instructions for executing the method.

VII. Nucleic Acid Vectors

Variant genes can be expressed in an expression vector in which the variant gene is operably linked to a natural or other promoter. Typically, the promoter is a eukaryotic promoter for expression in a mammalian cell. Transcription regulatory sequences typically include a heterologous promoter and, if necessary, an enhancer gene that is recognized by the host. The selection of a suitable promoter, for example, trp, lac, phage promoters, glycolytic enzyme promoters and tRNA promoters, depends on the selected host. Commercially available expression vectors can also be used. Suitable host cells include bacteria, such as E. coli, yeast, mycelial fungi, insect cells, mammalian cells, usually immortal, for example, mouse, CHO, human and monkey cell lines and their derivatives. Preferred host cells are able to process variant gene products to create suitable mature polypeptides.

The invention further relates to transgenic animals other than humans, capable of expressing an exogenous variant gene or having reached the formation of a transgene in which the cloned variant gene is inactivated by the introduction of a positive marker of choice. The transgene is then introduced into the embryonic stem cell, where it undergoes homologous recombination with the endogenous variant gene. Preferred animals are mouse and other rodents. Such animals provide applicable drug screening systems.

Thus, the main embodiment of the present invention relates to a method for detecting a predisposition to high altitude pulmonary edema (HAPE), said method comprising the following steps:

(a) selection of test subjects by monitoring the symptoms associated with alpine pulmonary edema,

(b) isolation of the genomic DNA from the leukocytes from the studied objects by conventional methods,

(c) amplification of the intron 7 of the human iNOS gene SEQ ID No. 1 by developing and synthesizing the Forward and Reverse oligopeptide primers of SEQ ID No. 2 and SEQ ID No. 3, respectively,

(d) identifying a numerically new single nucleotide polymorphism (SNP) by comparing with an already existing human iNOS gene sequence,

(e) screening a population of highland indigenous people (HA indigenous people), plain native inhabitants (HAPE control group) and plain residents of HAPE patients for single nucleotide polymorphism using the primers described above, SEQ ID No. 2 (direct primer) and SEQ ID No. 3 (reverse primer),

(f) counting the sequences of AA, AG and GG genotypes in populations according to stage (e) to establish a relationship of genotypes with alpine pulmonary edema, and

(g) prediction and statistical analysis of differences in the distribution of allelic variants (AA, AG, and GG genotypes) in populations where the GG genotype at 19,480 positions indicates a low risk of high altitude pulmonary edema, and the AA genotype at 19,480 positions indicates a high risk of disease.

Another embodiment of the present invention relates to oligonucleotide primers capable of amplifying intron 7 of a human iNOS gene, selected from the group including

(a) 5'CAG CGG AGT GAT GGC AAG CAC GAC 3 '(SEQ ID No. 2), which is a direct primer, and

(b) 5'GAT GCA CAG CTG GGG AAC AAG ACG 3 '(SEQ ID No. 3), which is a reverse primer.

Another embodiment of the present invention relates to oligonucleotide primers containing one or more polymorphic regions selected from the group including

(a) 5'CAG CGG AGT GAT GGC AAG CAC GAC 3 '(SEQ ID No. 2), which is a direct primer, and

(b) 5'GAT GCA CAG CTG GGG AAC AAG ACG 3 '(SEQ ID No. 3), which is a reverse primer.

Further, other embodiments of the present invention relate to allelic variants, where allelic variants of the iNOS gene have AA, AG and GG genotypes.

The diagnostic kit for detecting SNP genotypes that indicate a predisposition to high altitude pulmonary edema (HAPE) contains the following primers and samples:

(a) 5'CAG CGG AGT GAT GGC AAG CAC GAC 3 '(SEQ ID No. 2), which is a direct primer, and

(b) 5'GAT GCA CAG CTG GGG AAC AAG ACG 3 '(SEQ ID No. 3), which is a reverse primer.

Another embodiment of the present invention relates to primers suitable for amplification of an iNOS gene region containing one or more polymorphic regions, said primers include:

(a) 5'CAG CGG AGT GAT GGC AAG CAC GAC 3 '(SEQ ID No. 2), which is a direct primer, and

(b) SEQ ID3: 5'GAT GCA CAG CTG GGG AAC AAG ACG 3 '(SEQ ID No. 3), which is a reverse primer.

Another embodiment of the present invention relates to nucleic acid vectors containing allelic variants of the iNOS gene.

The following examples are provided to illustrate the present invention and should not be construed as limiting the scope of the present invention.

Examples

Example 1

Token Gene Identification:

Taking into account the important functions of nitric oxide in high altitude conditions, iNOS, the induced nitric oxide synthase, was chosen as a candidate gene for research.

Example 2

The choice of research objects:

Clinical severity of HAPE was assessed by the Acute Mountain Altitude Sickness (AMS) system of Lake Louis. Briefly, five symptoms were evaluated in patients: headache, gastrointestinal disturbances, fatigue, weakness, or both, dizziness, impaired mental ability, or both, and sleep disturbances. Mental changes, ataxia, and peripheral edema were also evaluated. Each of these symptoms was rated between 0 and 3. A rating of 0 meant no symptoms, 1 for mild symptoms, 2 for moderate symptoms, and 3 for severe symptoms. The HAPE score was the sum of all 8 symptoms, and the patient was described using a HAPE score> 6 (Anand et. Al. 1998). Plains dwellers (LLs) were objects that only after entering the highlands at least three times did not reveal any of the above symptoms. Indigenous Highlands (HA) have been permanent residents of HA since ancient times.

Example 3

Extraction of genomic DNA from white blood cells:

Genomic DNA was extracted from the blood using salting out method. Red blood cell lysis in the presence of salt was followed by treatment with a lysis of the nucleus buffer (NLB). Proteins were precipitated and DNA was extracted from peripheral blood leukocytes using a modification of the salting out procedure. DNA concentration was determined by measuring the optical density of the sample at a wavelength of 260 nm (Miller SA et. Al. 1988).

Example 4

Identification of allelic variants of the iNOS gene:

The example describes the identification of allelic variants of the iNOS gene by PCR and sequencing using the specific oligonucleotide primers of the invention. DNA was then amplified by polymerase chain reaction using oligonucleotide primers:

(a) 5'CAG CGG AGT GAT GGC AAG CAC GAC 3 '(SEQ ID No. 2) and

(b) 5'GAT GCA CAG CTG GGG AAC AAG ACG 3 '(SEQ ID No. 3).

The polymerase chain reaction was carried out using the following conditions:

step 1 94єС for 4 min,

step 2 94єС for 30 seconds,

step 3 62.5 ° C for 30 seconds,

step 4 72єС for 45 seconds,

step 5 34 times step 2,

step 6 72 ° C for 10 minutes

PCR was performed on a Perkin Elmer GeneAmp PCR System 9600. This reaction synthesized a 258bp DNA fragment by electrophoresis on a 2% agarose gel. The PCR product was purified from protection by excision from the agarose gel using an Amersham Pharmacia gel extraction kit (Amersham), and both sections of the PCR products were directly sorted using a chemical analysis paint terminator in an ABI Prism 377 automatic DNA sequencer. The PCR product was identical to the human iNOS gene sequence except for the new single base pair change mentioned in Table 1.

Example 5

The nucleotide sequence of allelic variants of the iNOS gene:

The nucleotide sequence in allelic iNOS variants was obtained using the method described in example 1 -

5'CAG CGG AGT GAT GGC AAG CAC GAC TTC CGG GTG TGG AAT GCT CAG CTC ATC CGC TAT GCT GGC TAC CAG ATG CCA GAT GGC AGC ATC AGA GGG GAC CCT GCC AAC GTG GAA TTC ACT CAG GTA CCC GGC CCA GCC TCA GCC A * G CC GGC CAT TGG GGC GGG GAG CCC CGT GGT GAG CGA GTG ACA GAG TGG AGC CCA GAG GAG ACA CGC AGC CCG GGC TTA CAG ACT CAC AGG GCC CGT CTT GTT CCC CAG CTG TGC ATC3 '.

In the described sequence, SNP * is shown in bold.

Example 6

The G allele is associated with adaptation, and the A allele is associated with the disease:

The method described in example 4 was applied to a series of DNA samples obtained from the indigenous inhabitants of the highlands, the control group HAPE and patients with HAPE. A highly reliable association of the G allele with high altitude adaptation and the A allele with the disease was traced. The results are summarized in table 4.

Table 4 Type of communication Value
χ ² P value Odds ratio 95% CI (confidence interval) Relative frequency HAPE patients and the HAPE control group 10.63 0.001 2.56 1.45-4.54 1.66 (1.21-2.27) HAPE patients and indigenous highlands 33.96 <0.001 6.29 3.30-12.01 3.22 (2.05-5.06) HAPE control group and indigenous highlands 7.42 0.006 - - -

Thus, people with the GG genotype have a low risk, and those with the AA genotype have a high risk of HAPE, which can also be expected for other populations.

Example 7

Nucleic acid vectors containing iNOS sequence variants:

Vectors and host cells transformed with allelic variants of the iNOS gene containing one or more polymorphic regions, as shown in table 1, can be prepared, for example, as described in detail below.

Variant genes can be expressed in an expression vector in which the variant gene is operably linked to a natural or other promoter. Typically, the promoter is a eukaryotic promoter for expression in a mammalian cell. Transcription regulatory sequences typically include a heterologous promoter and, if necessary, an enhancer gene that is recognized by the host. The selection of a suitable promoter, for example, trp, lac, phage, glycolytic enzymes and tRNA, depends on the host selected. Commercially available expression vectors may also be used. Suitable host cells include bacteria such as E. coli, yeast, mycelial fungi, insect cells, mammalian cells, usually immortal, for example, mouse, CHO, human and monkey cell lines and derivatives thereof. Preferred host cells are able to process variant gene products to create suitable mature polypeptides.

Advantages of the Present Invention

The present invention adds the following points to the treatment of HAPE.

1. The inducible nitric oxide synthase gene as a new marker for HAPE studies.

2. New sequences of primers responsible for amplification of PCR products containing new SNPs.

3. New SNPs (19480 A / G) that can be used in further link studies.

4. Reliable relationship of the wild-type allele (A) with the disease (tables 2 and 3).

5. Reliable relationship of the mutant allele (G) with adaptation (tables 2 and 3).

6. A significant difference between the sequence of alleles in relation to the indigenous inhabitants of the highlands and the control group HAPE (tables 2 and 3).

7. The presence of the G allele predisposes the individual to a reduced chance of developing the disease.

8. This can help individuals decide to visit the highlands based on various reasons.

The sequence below is information for SEQ ID Nos. 1, 2 and 3.

Sequence listing

Main information

Applicant: CSIR

The name of the invention: A method for detecting a predisposition to highland pulmonary edema

Sequence Number: 03

Correspondent address: Institute of genonics and integrative biology, CSIR, Delhi University Campus, Mall Road-110007, India.

Phone: + 91-19-27666156 Fax: + 91-11-27667471

Sequence Information ID NO: 1

1. Characteristics of the sequence:

1. Length: 258 bp

2. Type: DNA

5'CAG CGG AGT GAT GGC AAG CAC GAC TTC CGG GTG TGG AAT GCT CAG CTC ATC CGC TAT GCT GGC TAC CAG ATG CCA GAT GGC AGC ATC AGA GGG GAC CCT GCC AAC GTG GAA TTC ACT CAG GTA CCC GGC CCA GCC TCA GCC A * G CC GGC CAT TGG GGC GGG GAG CCC CGT GGT GAG CGA GTG ACA GAG TGG AGC CCA GAG GAG ACA CGC AGC CCG GGC TTA CAG ACT CAC AGG GCC CGT CTT GTT CCC CAG CTG TGC ATC3 '.

3. Organism: Homo sapiens (human)

4. Direct source: PCR (PCR)

5. Name / Key: Token Area

6. Sequence ID # 1

Sequence Information ID NO: 2

Sequence Characteristics:

1. Length: 24 bp

Type: DNA

5'CAG CGG AGT GAT GGC AAG CAC GAC 3 '

Organism: Artificial sequence

Direct Source: Synthetic

Name / Key: Synthetic Oligopeptide

Sequence ID # 2

Sequence Information ID NO: 3

Sequence Characteristics:

Length: 24 bp

Type: DNA

5'GAT GCA CAG CTG GGG AAC AAG ACG 3 '

Organism: Artificial sequence

Direct Source: Synthetic

Name / Key: Synthetic Oligopeptide

Sequence ID # 3

List of references

Claims (4)

1. A method for detecting a predisposition to high altitude pulmonary edema (HAPE) in a subject, comprising identifying a polymorphism in the inducible nitric oxide synthase gene in said subject, where the polymorphism is at position 142 of SEQ ID NO: 1, wherein the presence of nucleotide A indicates a predisposition to HAPA in the specified position. 2. The method according to claim 1, where the subject is a human. 3. An isolated polynucleotide for detecting a predisposition to high altitude pulmonary edema (HAPE) in humans, wherein said polynucleotide is selected from the group consisting of a direct primer comprising the sequence of SEQ ID No. 2 and a reverse primer comprising the sequence of SEQ ID No. 3. 4. A kit for identifying a predisposition to high altitude pulmonary edema (HAPE) in humans, comprising a pair of primers designed to amplify an iNOS gene region containing one or more polymorphic regions, where these primers include:
(a) 5'CAG CGG AGT GAT GGC AAG CAC GAC 3 '(SEQ ID No. 2), which is a direct primer, and
(b) 5'GAT GCA CAG CTG GGG AAC AAG ACG 3 '(SEQ ID No. 3), which is a reverse primer.

Images