RU2351120C1 - Method of obtaining transgenic corn plants - Google Patents

Abstract

FIELD: genetic engineering.

SUBSTANCE: invention can be used in corn selection in creating new sorts and hybrids by means of genetic engendering, in works on insertional mutagenesis, separating and cloning of corn genes. Generative organs of corn are processed with suspension of cells of strain Agrobacterium tumefaciens with activated vir-genes. As generative organs, blooming female gametophyte is used. Before processing said suspension is mixed with substances inert with respect to strain cells and characterised by osmotic potential exceeding osmotic potential of suspension for obtaining isotonic solution. As such substances sucrose and/or glycerin are used. After procession with suspension generative organs are pollinated with pollen of fertile plants. In gametophyte pistil filaments are used, which are cut at height of 1-2 cm from corncob before processing with suspension. Processing is carried out by means of pipette into the depth of cut part of pistil filaments. Pollination is performed with pollen preliminary collected into packet, which is applied onto cut of pistil filaments with fingers or shaken onto it.

EFFECT: method allows to reduce term of obtaining transgenic corn plant and increase yield of final product, preserving high obtaining frequency.

5 cl, 1 dwg

Description

The invention relates to agriculture and biotechnology and can be used in the selection of maize when creating new varieties and hybrids using genetic engineering, in insertion mutagenesis, isolation and cloning of maize genes.

A known method of producing transgenic corn plants using genetic markers, used in genetic engineering in higher plants to select transgenic plants, in which the nptII gene, which encodes the neomycin-phosphotransferase enzyme, which determines resistance to kanamycin. To select transgenic plants carrying the nptII gene from the seeds collected from transforming plants, embryos are extracted and grown on a nutrient medium with kanamycin (Danilova S.A. Optimization of the agrobacterial method of transformation of corn. Abstract. Diss. Cand. Biol. Sciences. M., 2001). In this case, the seedlings carrying and expressing the nptII gene have a green phenotype, while the seedlings that do not carry this gene become albino and die.

This method, which allows one to select kanamycin-resistant transformants with the nptII gene from certain species of dicotyledonous and monocotyledonous plants, has, however, two significant drawbacks: the high complexity, limiting the volume of the analyzed material, the duration of contact of the embryos with kanamycin during cultivation on a kanamycin-containing medium As a result, the development of even kanamycin-resistant transformants is disrupted.

Closest to the claimed is a method for producing transgenic corn plants based on agrobacterial transformation of immature maize embryos in an in vitro culture (Zhao Z.-Y., Cai T., Tagliani L. et al. Agrobacterium-mediated sorghum transformation // Plant Mol. Biol ., 2000, v.44, pp.789-798), according to which immature maize embryos are placed for 5 min in a suspension of agrobacterial cells (density 0.5-1.0 × 10 ⁹ cells / ml) in an inoculation medium containing mineral salts and vitamins according to MS, casein hydrolyzate (1.0 g / l), 2,4-D (1.5 mg / l), glucose (36 g / l), sucrose (68.5 g / l), acetosyringone (100 µM), pic why they are transferred for 3 days to co-cultivation medium, which differs from the initial concentration of 2,4-D increased to 2.0 mg / l, reduced to 20 and 10 g / l, respectively, the concentrations of sucrose and glucose, the addition of L-proline (0.7 g / l), ascorbic acid (10 mg / l), MES (0.5 g / l) and agar (8 g / l). Then the embryos are transferred for 4 days to a medium without acetosyringone, but with the addition of the antibiotic carbenicillin (100 mg / l) to inhibit the growth of agrobacteria. Then, to induce embryogenic callus, the embryos are transferred to a medium that differs from the previous one by the absence of glucose and a reduced concentration of 2,4-D (up to 1.5 mg / L) and the addition of the selective agent phosphinotricin (5 mg / L), the resistance gene to which (bar) was present in the T-DNA of the used agrobacterial strain, and cultured for 2 weeks. The surviving (stable) callus is transferred to a medium of the same composition with an increased level of phosphinotricin (10 mg / l) and transplanted every 2 weeks. To develop embryoids, callus is transplanted onto a medium that differs from the previous kinetin addition (0.5 mg / L) and then onto a shoot formation medium that differs from the previous one by the absence of 2,4-D, sucrose concentration increased to 60 g / L, and kinetin replaced by zeatin (0.5 mg / l), with the addition of indolyl, 3 acetic acid (IAA) (1 mg / l), abscisic acid (ABA) (0.1 μM) and thidiazuron (0.1 mg / l). The shoots are transferred to the rooting medium - 1/2 Murashige-Skoog (MS), (nitrile, 3 acetic acid (NU K) (0.5 mg / l), indole 3 benzene acid (IBA) (0.5 mg / l), sucrose ( 20 g / l), agar (7 g / l), and then on a medium of the same composition, but without IAA and IBC.The plants using molecular genetics analyze the presence of an insert of a fragment of foreign DNA (T-DNA) in their genome agrobacteria). This method allows to achieve a stable transformation frequency of up to 10.1% based on the number of inoculated embryos.

The disadvantages of this method are the high complexity and duration of the process of obtaining transgenic plants. In addition, the use of an in vitro culture system, firstly, can lead to somaclonal variants among transforming plants, and secondly, restricts the use of this method, since not all maize samples (breeding-value lines and hybrids) produce well-growing embryogenic callus with high regenerative ability, or their explants producing embryogenic callus, necrotic as a result of co-cultivation with agrobacterial cells.

The objective of the invention is to provide a faster and more efficient method for producing transgenic corn plants with a high yield of the final product while maintaining a high frequency of their production.

The technical result is a reduction in the production time of a transgenic corn plant, a decrease in the frequency of occurrence of chimeric plants, an expansion of the variety of varieties, lines of corn, which in practice can be transformed.

The object is achieved in that in a method for producing transgenic corn plants, comprising treating the generative organs of corn with a suspension of Agrobacterium tumefaciens strain cells with activated vir genes, according to the invention, the generative organs of corn after polishing a suspension of Agrobacterium tumefaciens strain cells are pollinated with fertile plants, flowering female gametophyte of corn is used as the generative organs of corn, and before treatment, a suspension of cells of the Agrobacterium tumefaciens strain with activated vir genes are mixed with substances that are inert to the cells of the strain and characterized by an osmotic potential exceeding the osmotic potential of the suspension to produce an isotonic solution.

As substances that are inert with respect to the cells of the strain and characterized by an osmotic potential exceeding the osmotic potential of the suspension, sucrose and / or glycerin is used. Moreover, to obtain an isotonic solution, sucrose or glycerol is added to a suspension of cells with a concentration of 1 × 10 ⁶ -1 × 10 ⁸ cells / ml to a final concentration of 0.5-1 M.

In addition, in the flowering female gametophyte of the corn, the pistil threads of the flowering female gametophyte are used, which are cut at a height of 1-2 cm from the cob before treatment with a suspension of cells of the Agrobacterium tumefaciens strain, and the treatment is carried out using a pipette into the depth of the cut part of the pistillate threads at the exit of the cob. Pollination is carried out with pollen previously collected in a bag by applying it to a section of pistil filaments with your fingers or by shaking.

The invention is illustrated in the drawing, where the photo shows a PCR analysis of DNA from seedlings of corn transformed in planta, where the numbers 1-8 indicate the paths: 1 - DNA from an untransformed plant (negative control); 2 - molecular weight marker (Fermentas, Latvia), fragment size starting from the top: 3000, 2000, 1500, 1200, 1031, 900, 800, 700, 600, 500 bp; 3-8 test seedlings whose seeds germinated without delay on kanamycin.

Technical solutions with the identified set of features are not found in the prior art. In particular, no solutions are known regarding methods for producing transgenic maize plants, in which a flowering female gametophyte of a monocotyledonous plant is used as an object of genetic transformation, which is first treated with a suspension of Agrobacterium tumefaciens strain cells with activated vir genes and then pollinated with pollen from fertile plants. It is also unknown to use the pollination of flowering female gametophyte with pollen of fertile plants, which is carried out immediately after they are treated with a suspension of Agrobacterium tumefaciens cells in a special solution, the suspension of cells of the strain Agrobacterium tumefaciens is treated directly with pistil filaments of a flowering female gametophyte by pipetting inside a cut 1-2 pipette from the cob of pistil filaments.

The proposed method is carried out as follows: a parchment package isolates the flowering female gametophyte in corn and the pistil filament of the flowering female gametophyte before treatment with a suspension of cells of the strain Agrobacterium tumefaciens is cut at a height of 1-2 cm from the cob, and treatment with a suspension of cells of Agrobacterium tumefaciens is carried out using depth of cut part of pistil filaments. Pollination is carried out with pollen previously collected in a bag by applying it to the cut of pistil filaments with your fingers or by shaking.

To identify transgenic plants, seeds collected from cobs treated with an agrobacterial suspension and untreated (control) cobs of the initial line plants were sterilized with a 5% chloramine solution (15 min), intensively washed in running water, soaked in distilled water (24 hours) , re-sterilized in a laminar box with a 5% solution of chloramine and without washing was laid out on an agar medium containing kanamycin (200 mg / l), and after the appearance of roots, it was transferred to the soil after 2-5 days into vessels, where it was germinated for e 2-3 weeks.

Female flowers (as part of monoecious or dioecious, dioecious) plants are isolated with parchment insulators before flowering. To process the flowers, a suspension of Agrobacterium tumefaciens cells with a cell density of 1 × 10 ⁷ cells / ml, to which acetosyringon is added, is used. Female flowers of a plant after treatment with an agrobacterial suspension by spraying from a spray gun pollinate corn pollen by shaking from natural anthers and again isolate or leave open until ripening, if there is no requirement to eliminate cross-pollination. Seeds are collected from treated plants, germinated and seedlings carrying the marker gene are selected on kanamycin medium. For this purpose, the seeds were sterilized with a 5% solution of chloramine (15 min), intensively washed in running water, soaked in distilled water (24 hours), re-sterilized in a laminar box with a 5% solution of chloramine and laid out on an agar medium without washing containing nystatin, and after swelling and nibbling of the embryo and the appearance of roots, were transferred to high glass vessels with an agarized (0.4% agar) medium containing kanamycin 200 μg / ml, where they were germinated under cotton plugs for 2-3 weeks, then seedlings taken for analysis the presence of T-DNA insertions.

Kanamycin-resistant seedlings (green seedlings) took a fragment (1-2 cm, 100 mg) of the tissue of the upper part of the leaf and using the PCR (polymerase chain reaction) method, the presence of the DNA sequence of the transferred gene was checked using untreated and surface-sterilized plants. Seedlings carrying the marker gene DNA fragment ("PCR +" seedlings), which are transgenic plants, are selected.

The inventive method was implemented on plants of the corn line AT-3. Plants of the same line served as pollen donors. Transgenosis was performed using Agrobacterium tumefaciens, using strain GV3101, with plasmid pTd33, in which there was a selective marker gene nptII, which determined resistance to kanamycin. A cell suspension of these agrobacterial strains was grown on a rocking chair on CIB nutrient medium (Fullner KJ, Stephenens KM, Nester EW An essential virulence protein of Agrobacterium tumefaciens, VirB4, requires an intact mononucleotide binding domain to function in transfer of T-DNA. // Mol. Gen. Genet. 1994. V. 245. P. 704-715) to a density of 1 × 10 ⁷ cells / ml at room temperature. Upon reaching the required density, acetosyringone (200 aM) was added to the suspension, and either directly used in the transgenosis experiment or placed in a refrigerator (t ° = 4-7 ° C) for use over the next 2-3 days.

Before flowering, the cobs were isolated with parchment insulators. As an object of genetic transformation, a flowering female gametophyte of a monocotyledonous plant was used, the pistillate strands of which were located at the exit of the cob threads, were cut 1-2 cm from the cob and treated with a suspension of Agrobacterium tumefaciens strain cells with activated vir genes in a solution of sucrose or glycerol by introducing 0.1-1, 0 ml of the suspension with a pipette or syringe into the depth of the cut part of the pistillate filaments, and then pollen fertile plants previously collected in a bag by shaking for an hour Nia from the package or on a finger cut pollen tubes. To identify transgenic plants, seeds collected from cobs treated with an agrobacterial suspension and untreated (control) cobs of the initial line plants were sterilized with a 5% chloramine solution (15 min), intensively washed in running water, soaked in distilled water (24 hours) , re-sterilized in a laminar box with a 5% solution of chloramine and without washing was planted on agar medium (1/2 MS) containing kanamycin (200 mg / l) and grown for 2-3 weeks.

The transgenic nature of the obtained green plants was confirmed using the PCR method (see drawing). DNA was isolated from leaf fragments of selected plants according to generally accepted methods (Maniatis T., Frisch., Sambrook J. Molecular cloning. Laboratory manual. M .: Mir, 1984). The reaction was carried out with oligonucleotide primers specific for the 250 bp nptII gene fragment: ACAGACAATCGGCTGCTCTGATG and GGCAGGAGCAAGGTGAGATGACA. The reaction products were separated by agarose gel electrophoresis; phage λ DNA was used as a molecular weight marker. The plasmid pTd33 was used as a positive control.

Moreover, in order to avoid contamination (contamination) of plant samples from agrobacteria, leaf fragments were laid out on the surface of agar bacteria medium with kanamycin 200 μg / ml and incubated in an incubator at 28 ° C for 3-5 days.

The result of DNA analysis showed that in a number of studied samples, the total DNA of the plant contains a sequence of about 500 bp, characteristic of the nptII gene. Based on the number of germinated grains, the frequency of adult transformed plants obtained from them was more than 40%.

Thus, the above data show that the inventive method allows to obtain transgenic plants with a high frequency with a significant decrease in the complexity and simplification of the technology for producing transgenic plants (processing, incubation, maturation, testing for insertion of T-DNA).

The proposed method allows: 1) to obtain transgenic plants, bypassing the in vitro culture system, which speeds up and simplifies the procedure for producing transgenic corn plants, 2) to avoid the occurrence of somaclonal variation; 3) to avoid the chimericity of transformants resulting from their development from multicellular meristems containing both transformed and non-transformed cells; 3) use for transformation almost all known varieties and lines of corn, because there are no restrictions on genotypes capable of forming a well-growing embryogenic callus.

Claims (5)

1. A method of producing transgenic corn plants, comprising treating the generative organs of corn with a suspension of Agrobacterium tumefaciens strain cells with activated vir genes, characterized in that the generative organs of corn after polishing with a suspension of cells of the Agrobacterium tumefaciens strain are pollinated with pollen from fertile plants, while organs of maize use flowering female gametophyte of maize, and before treatment, a suspension of cells of the Agrobacterium tumefaciens strain with activated vir genes is mixed with substances that are They are inert with respect to the cells of the strain and characterized by an osmotic potential that exceeds the osmotic potential of the suspension to produce an isotonic solution. 2. The method according to claim 1, characterized in that as substances that are inert with respect to the cells of the strain and characterized by an osmotic potential greater than the osmotic potential of the suspension, sucrose and / or glycerin is used. 3. The method according to claim 2, characterized in that to obtain an isotonic solution to the cell suspension with a concentration of 10 × 10 ⁶ -10 × 10 ⁸ cells / ml add sucrose or glycerin to a final concentration of 0.5-1 M. 4. The method according to claim 1, characterized in that the flowering female gametophyte of corn uses pestle filaments of a flowering female gametophyte, which are cut at a height of 1-2 cm from the cob before treatment with a suspension of cells of the strain Agrobacterium tumefaciens, and the treatment is carried out using a pipette in depth cut parts of pistil filaments. 5. The method according to claim 4, characterized in that the pollination is carried out with pollen previously collected in a bag by applying it to a section of pistil filaments with your fingers or by shaking.

Images