RU2322508C1 - Method for analysis of unknown sequence of single-stranded nucleic acids - Google Patents

Abstract

FIELD: molecular biology, biochemistry.

SUBSTANCE: method for analysis of sequence of single-stranded nucleic acid is analyzed by sequenation of products of its amplification. For amplification of nucleic acid primers showing specificity to double-stranded adaptors is used, and method involves preliminary the ligation reaction of these adaptors with analyzed nucleic acid. The ligation reaction is carried out in the concentration of analyzed nucleic acid 0.3-3.0 pg/mcl. Use of the invention allows analyzing unknown sequences of single-stranded nucleic acid in their low concentration. Invention can be used for analysis of nucleic acid.

EFFECT: improved method of analysis.

2 tbl, 3 ex

Description

The invention relates to the field of molecular biology, namely to the development of a method for the analysis of unknown sequences of single-stranded nucleic acids.

The development of a method for the analysis of unknown nucleic acid (NK) sequences with a low concentration in a sample is an urgent task in molecular biology, since such a method is necessary for cloning short NK fragments, small interfering RNAs and miRNAs.

A known method of analysis of unknown sequences of single-stranded nucleic acids by ligation of adapters - oligonucleotides with a known primary sequence using the T4 enzyme RNA ligase [Tessier DC, Brousseau R, T. Vernet, Anal Biochem., 1986, v.158, p.171-178 ], which is used for ligation of single-stranded substrates.

The disadvantages of this method are its limited functionality, since its implementation is possible provided that the studied nucleic acid with an unknown sequence must not contain 5'-terminal phosphate, and the sample must also contain NK in a high concentration of 20 to 60 pg / μl . At a lower concentration of the investigated NC, the yield of the ligation product is significantly reduced.

A known method for the analysis of single-stranded short RNA with an unknown sequence, based on the polyadenization of RNA using poly- (A) RNA polymerase, followed by synthesis of the cDNA chain using a poly- (T) primer. Next, the poly (G) sequence is added to the obtained cDNA chain from the 3′-end using a specific deoxynucleotidyl transferase, and then NK fragments are amplified with the participation of poly (T) and poly (C) primers, followed by cloning and sequencing [Wang JF, Zhou H, Chen YQ, Nucleic Acids Res., 2004, v. 32, p. 1688-1695].

The disadvantages of this method are:

- the test sample must contain the analyzed nucleic acid sequence in high concentration;

- additional enzymatic reactions reduce the yield of the product;

- poly (A) RNA polymerase and specific deoxynucleotidyl transferase are rare and expensive enzymes, which leads to a rise in the cost of the method.

The ligase reaction carried out by T4 enzymes with DNA ligase or T4 RNA ligase is the basis of the standard approach used for the analysis of NK sequences, which consists of adapting oligonucleotides with the known primary sequence to the 3 ′ and 5 ′ ends of the studied nucleic acid. However, in the case of low concentrations of the unknown NK sequence, the use of these enzymes does not allow ligation of the unknown sequence of the studied NK with adapters - oligonucleotides with a known primary sequence.

The closest to the claimed method, the prototype is a method for analyzing unknown sequences of fragments of single-stranded nucleic acids [Edwards JB, Delort J, Mallet J Nucleic Acids Res., 1991, v.19, p.5227-5232], including:

- cDNA synthesis from an RNA matrix (100-10 ng) using a primer to a known sequence of the 3'-region of an RNA matrix using a revertase [Rhyner TA, Biguet NF, Berrard S, Borbely AA, Mallet J., J. Neurosci Res., 1986, v.16, p. 167-181];

- synthesis of an adapter phosphorylated at the 5′-end and 3′-end bearing a dideoxynucleotide using terminal transferase, followed by isolation of the modified adapter from the reaction mixture;

- ligation of the phosphorylated adapter to the synthesized cDNA in a buffer containing 50 mM Tris-HCl buffer (pH = 8.0), 10 mM MgCl ₂ , 10 μg / ml BSA, 25% polyethylene glycol and 20 μM ATP, with the addition of 1/10 part from the obtained cDNA and 0.5 μl of a phosphorylated adapter with a concentration of 5 ng / μl, followed by the addition of 10 Unit T4 RNA ligase and incubation of the reaction mixture for 24-48 hours at 22 ° C.

The ligation product, consisting of the studied NK and adapters, amplified by PCR using primers complementary to the adapters, followed by cloned and sequenced sequences of the studied NK.

The disadvantages of this method are the need to use high concentrations of the studied nucleic acid, the use of rare reagents and expensive enzymes, such as dideoxynucleotide triphosphate and terminal transferase, the long duration of the ligation stage and the limited method for obtaining a copy of cDNA only for extended RNA molecules with a known primary sequence.

An object of the invention is to increase the efficiency of ligation of nucleic acids and their components of various sizes in conditions with a low concentration of NK in solution and the cheaper method.

The technical task is achieved by the proposed method, which consists in the following successive stages:

1) phosphorylation of the 5′-end of the unknown sequence of the investigated NK using T4-polynucleotide kinase, followed by isolation of phosphorylated NK from polyacrylamide or agarose gel.

2) ligation of the 3′-end of the studied NK with the 5′-terminal phosphate of a short oligonucleotide (3′-terminal adapter), which is part of the duplex. In the duplex, the short oligonucleotide is complementary to the 5′-terminal region of the long, and the free (3′-terminal) part of the long oligonucleotide is a randomized sequence of 4-6 bases. The sequence of a short and complementary fragment of a long oligonucleotide contains recognition sites for restriction endonucleases, and the 3 ′ ends of both oligonucleotides are blocked by protective groups.

An unknown sequence of the studied NK at a concentration of 0.3-3 pg / μl and duplex oligonucleotides at a concentration of 10-50 pg / μl in T4 DNA ligase buffer are used for ligation, then 20 Units T4 DNA ligases are added. The reaction mixture with a volume of 20 μl is incubated for 8-10 hours at 11-13 ° C, the efficiency of the ligation reaction is 90%.

3) Ligation of the 5′-end of the investigated NK containing from the 3′-end of the adapter with a short oligonucleotide (5′-end adapter), which is part of the duplex. In the duplex, the short oligonucleotide is complementary to the 3′-terminal region of the long, and the free (5′-terminal) part of the long oligonucleotide is a randomized sequence of 4-6 bases. The sequence of a short and complementary fragment of a long oligonucleotide contains recognition sites for restriction endonucleases, and the 3 ′ end of the long oligonucleotide is blocked by a protective group.

To ligate the adapter to the 5′-end of the studied NK containing the adapter from the 3′-end, use a reaction mixture similar to that used in stage 2 of the method and add duplex oligonucleotides at a concentration of 10-50 pg / μl, then add 18 Units T4 DNA ligases . The reaction mixture is incubated for 10-14 hours at 11-13 ° C, the efficiency of the ligation reaction is 80%.

4) Isolation of a ligation product consisting of a test nucleic acid flanked by adapters at the 5′- and 3′-ends.

5) Amplification of the unknown unknown nucleic acid sequence flanked by adapters at the 5′- and 3′-ends using polymerase chain reaction (PCR) using specific primers complementary to the 5′- and 3′-terminal adapters.

In the case of analysis of unknown single-stranded RNA sequences, the 5′-end of the unknown sequence of the studied RNA is phosphorylated using T4 polynucleotide kinase, but cDNA synthesis is additionally performed from the RNA matrix using a primer complementary to the 3′-terminal adapter using revertase.

The method allows to generate using PCR, clone and sequence unknown sequences of single-stranded nucleic acids in a low concentration of 0.3-3 pg / μl. The ligation efficiency at two stages is 90% and 80%, which ensures the production of the studied nucleic acids flanked by adapters with an efficiency of 60-70%. The resulting ligation product, consisting of an unknown nucleic acid sequence flanked by adapters at the 5′- and 3′-ends, can be amplified by PCR for subsequent study.

The defining hallmarks of the proposed method, compared with the prototype, are:

1. Before the ligation step, the DNA (or its components) is phosphorylated at the 5′-end using T4 polynucleotide kinase, which allows the adapters to be ligated at the 5′-end of the studied DNA.

2. For ligation of single-stranded NK, double-stranded, mutually complementary oligonucleotides are used that contain recognition sites for restriction endonucleases, in which one oligonucleotide is longer than the other by a fragment of 4-6 nucleotides from the 5'- or 3'-end, and this fragment is a randomized sequence of bases. Under the reaction conditions, the end portion of the studied nucleic acid interacts with its complementary sequence, which is present in the randomized sequence of the long oligonucleotide, and the nucleic acid ends converge, which is necessary for efficient ligation.

3. For ligation of single-stranded NK with an unknown sequence, T4 DNA ligase is used, which allows to increase the ligation efficiency compared to using T4 RNA ligase, as well as reduce the cost of the method.

4. As adapters for ligation, duplexes of oligonucleotides with a single-stranded randomized fragment at the 3 ′ and 5 ′ ends of the oligonucleotides are used. Single-stranded randomized fragment oligonucleotides and a phosphorylated short oligonucleotide are 3 ′ terminated with diethylene glycol, amino spacer or other protective group. The introduction of protective groups at the 3'-ends of the oligonucleotides included in duplexes allows to increase the efficiency of ligation.

5. Experimentally selected optimal ligation regimen, namely: ligation is carried out at a concentration of the investigated NK equal to 0.3-3 pg / μl, in the presence of 18-20 Units T4 DNA ligases at 11-13 ° C for 8-14 hours , which allows efficient ligation of NKs with an unknown sequence in a sample with a low concentration.

To exclude the stage of isolation of the ligation product from the reaction mixture, duplexes can be used in which an oligonucleotide with a randomized fragment is shorter than 15 nucleotides, and the durability of the duplex is provided by a tandem oligonucleotide that is complementary to the adapter.

Increasing the efficiency of the ligase reaction allows you to analyze an unknown sequence of nucleic acids, the concentration of which is 0.3-3 pg / μl.

The invention is illustrated by the following examples of specific performance of the method.

Example 1

Analysis of the unknown sequence of deoxyribo-oligonucleotide.

Ligation at the 3′-end of the studied deoxyribo-oligonucleotide X with the 5′-end phosphorylated short oligonucleotide 1 from the duplex consisting of mutually complementary oligonucleotides 1 and 2:

To oligonucleotide X at a concentration of 0.5 pg / μl in Tris-EDTA buffer (pH = 7.5) was added a duplex consisting of oligonucleotides 1 and 2 at a concentration of 30 pg / μl in Tris-EDTA buffer (pH = 7.5) then ligation buffer (40 mM Tris-HCl (pH = 7.8), 10 mM MgCl ₂ , 10 mM dithiothreit, 5 mM ATP) and 18 Units T4 DNA ligases were added, the volume of the reaction mixture was 20 μl. The mixture was incubated for 10 hours at 11 ° C, then the reaction product was used for ligation at the 5′-end of the test oligonucleotide X with a flanking adapter at the 3′-end.

Ligation of the oligonucleotide X phosphorylated at the 5′-end of the test oligonucleotide X with the flanking adapter at the 3′-end of the short oligonucleotide 3 of the duplex consisting of mutually complementary oligonucleotides 3 and 4:

To oligonucleotide X with a flanking adapter at the 3′-end at a concentration of 0.5 pg / μl in Tris-EDTA buffer (pH = 7.5), duplex of oligonucleotides 3 and 4 at a concentration of 40 pg / μl in Tris-EDTA buffer was added ( pH = 7.5), then ligation buffer (40 mM Tris-HCl (pH = 7.8), 10 mM MgCl ₂ , 10 mM dithiothreit, 5 mM ATP) and 20 Units T4 DNA ligases, volume of the reaction mixture were added was 25 μl. The mixture was incubated for 14 hours at 11 ° C, then the ligation product was isolated by electroelution from a polyacrylamide gel.

The ligation product was obtained by PCR with specific primers 1 and 2, then the primary sequence of oligonucleotide X was determined by sequencing.

The sequence of oligonucleotides used in example 1 are shown in table 1:

designation sequence oligonucleotide X 5′pATTCGATCGGTATACCC3 ′ oligonucleotide 1 5′pACGTAGTAGTGGGAAGAAGGATCCAGGdeg3 ′ oligonucleotide 2 5′CCTGGATCCTTCTTCCCACTACTACGTNNNNNdeg3 ′ oligonucleotide 3 5′TTCGAATTCTACCTCGCGCGATCTAC3 ′ oligonucleotide 4 5′NNNNNGTAGATCGCGCGAGGTAGAATTCGAAdeg3 ′ primer 1 5′CCTGGATCCTTCTTCCCACTA3 ′ primer 2 5′TTCGAATTCTACCTCGCGCG3 ′ deg - diethylene glycol as a protective group.

This example illustrates that the developed method can be used to analyze a fragment of a single-stranded nucleic acid with an unknown sequence.

Example 2

Analysis of the unknown sequence of single-stranded RNA.

For ligation of the adapter to the 3′-end of the test RNA, RNA was used at a concentration of 3 pg / μl and duplex mutually complementary oligonucleotides 1 and 2, as in Example 1, at a concentration of 50 pg / μl in 15 μl of T4 DNA ligase buffer, 18 Units were added T4 DNA ligase. After incubating the reaction mixture for 8 hours at 13 ° C, the ligation product was isolated and used as a template for cDNA synthesis using revertase according to the protocol described in [Chandler DP, Wagnon CA, Bolton H Jr., Appl Environ Microbiol; 1998, v.64, p.669-677.]. Then, an adapter was ligated to the 3 ′ end of the synthesized cDNA, consisting of duplexes of mutually complementary oligonucleotides, 5′pGTAGATCGCGCGAGGTAGAATTCGAAdeg3 ′ and 5′TTCGAATTCTACCTCGCGCGATCTACNNNNNdeg3 ′. Using the amplification of the fragment containing the studied NK, a sufficient amount of the NK sample was obtained using primers complementary to the adapters. A NK fragment was inserted into the pBluescript II plasmid, followed by sequencing of the obtained clones in a known manner [Wang JF, Zhou H, Chen YQ, Luo QJ, Qu LH, Nucleic Acids Res., 2004, v. 32, p. 1688-1695].

Example 3

Analysis of an unknown single stranded DNA sequence.

Ligation of the adapters to the ends of single-stranded DNA was carried out under conditions analogous to example 1, except that DNA (300 nucleotides) was taken at a concentration of 1.5 pg / μl and duplexes were used at a concentration of 50 pg / μl, consisting of three oligonucleotides: an adapter and an oligonucleotide with a randomized fragment and a tandem oligonucleotide that provides durability of the duplex. When using such a duplex structure, the ligation product does not need to be isolated from the reaction mixture. This product was then produced using NDP with specific primers 1 and 2, then the primary sequence of single-stranded DNA was determined by sequencing.

The sequence of oligonucleotides used in example 3 are shown in table 2:

designation sequence 3′-end adapter 5′pACGTAGTAGTGGGAAGAAGGATCCAGam3 ′ randomized fragment oligonucleotide 5′CTACTACGTNNNNNam3 ′ tandem oligonucleotide 5′atSTTSTSTSSSaat3 ′ 5′-end adapter 5′TTCGAATTCTACCTCGCGCGATCTAC3 ′ randomized fragment oligonucleotide 5′NNNNNGTAGATCGCGam3 ′ tandem oligonucleotide 5′amCGAGGTAGAATTCGAAam3 ′ primer 1 5′CCTGGATCCTTCTTCCCACTA3 ′ primer 2 5′TTCGAATTCTACCTCGCGCG3 ′ am is diaminoheptane as a protecting group.

Using the proposed method will allow, in comparison with the prototype:

- increase the efficiency of the ligase reaction in samples containing nucleic acid at a concentration of 0.3-3 pg / μl;

- expand the scope of T4 DNA ligase for ligation of single-stranded nucleic acids;

- ligate adapter oligonucleotides to NK of various sizes;

- reduce the cost of the method of analysis of single-stranded NK.

Claims (1)

A method for analyzing the primary structure of single-stranded nucleic acids with unknown nucleotide sequences, including ligation of the studied single-stranded nucleic acid with adapters, amplification of the ligation product using a polymerase chain reaction (PCR) using primers complementary to these adapters, and amplicon sequencing, characterized in that adapters use a double-stranded oligonucleotide with a single-stranded randomized protrusion of 4-6 nucleotides at the 3'-end e, in which both chains at the 3′-end contain a protective group, (adapter 1) and a double-stranded oligonucleotide with a single-chain randomized protrusion of 4-6 nucleotides at the 5′-end, in which the chain with a randomized 5′-end at 3′- the end contains a protective group, (adapter 2), before ligation, the 5′-end of the adapter 1 short chain and the 5′-end of the studied nucleic acid are phosphorylated with T4 polynucleotide kinase, the ligation reaction is carried out at a concentration of the analyzed nucleic acid equal to 0.3-3 , 0 pg / μl in the presence of 18-20 Units T4 DNA ligases at 11-13 ° C for 8-14 hours