RU2809771C2 - Compositions and methods of improving library enrichment - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: following is provided: a hybridization buffer that includes dextran sulfate, human Cot-1 DNA, formamide, KH₂PO₄-K₂HPO₄, NaCl, TWEEN 20, and improved adapter blockers. The invention also relates to a method and a set for obtaining an enriched library containing a collection of nucleic acid members.

EFFECT: invention provides improved efficiency of nucleic acid selection before sequencing.

9 cl, 31 dwg, 11 tbl, 9 ex

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority under 35 USC § 119(e) to provisional U.S. Patent Application No. 62/764753, filed August 15, 2018, the entire contents of which are incorporated herein by reference.

SUMMARY OF THE INVENTION

[0002] Despite rapid advances in next-generation sequencing (NGS) throughput, classical library generation and enrichment methods are time-consuming and can result in a throughput-limiting bottleneck. The present invention relates to compositions comprising a blocker and/or hybridization buffer, methods of using these compositions, and methods for improving the efficiency of nucleic acid selection prior to sequencing.

[0003] In one aspect, the present invention provides a hybridization buffer comprising a crowding agent and at least one of human Cot-1 DNA, a destabilizer, a salt, and a blocker.

[0004] In another aspect, the present invention relates to a method including the use of a hybridization buffer. The present invention also relates to a kit comprising a hybridization buffer.

[0005] In a further aspect, the present invention relates to a blocker comprising an oligonucleotide, wherein the blocker is capable of binding to an adapter. The adapter includes a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI). The blocker region capable of binding to the index region and/or UMI of the adapter includes: at least three thymine bases or universal bases and at least one non-universal base.

[0006] In another aspect, the present invention relates to a blocker comprising two unlinked oligonucleotides. The blocker is capable of binding to at least a portion of the adapter, where the adapter comprises a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI). Unbound oligonucleotides include bases that do not match the index region and/or UMI of the adapter.

[0007] The present invention also relates to a method comprising the use of blockers described herein and to a kit comprising blockers described herein.

[0008] In a further aspect, the present invention relates to a method comprising contacting a library with a blocker in the presence of a hybridization buffer; and bringing the library into contact with a probe, where the probe hybridizes to a region of interest in the library member. The method does not include amplifying the library members using PCR prior to sequencing the library members.

[0009] As used herein, the term “nucleic acid” is intended to be consistent with its use in the art and includes naturally occurring nucleic acids or functional analogs thereof. Particularly useful functional analogs are those capable of hybridizing with a nucleic acid in a sequence-specific manner or capable of being used as a template for replication of a specific nucleotide sequence. Natural nucleic acids typically have a backbone containing phosphodiester bonds. A similar structure may have an alternative backbone linkage including any of a variety of linkages known in the art. Naturally occurring nucleic acids typically have the sugar deoxyribose (such as found in deoxyribonucleic acid (DNA)) or the sugar ribose (such as found in ribonucleic acid (RNA)). The nucleic acid may contain any of a variety of analogues of these sugar groups known in the art. The nucleic acid may include natural or non-natural bases. In this regard, the naturally occurring deoxyribonucleic acid may have one or more bases selected from the group consisting of adenine, thymine, cytosine or guanine, and the ribonucleic acid may have one or more bases selected from the group consisting of uracil, adenine, cytosine or guanine. Useful non-natural bases that can be included in a nucleic acid are known in the art. The term "target", when used with reference to a nucleic acid, is intended as a semantic identifier for the nucleic acid in the context of the method or composition described herein, and does not necessarily limit the structure or function of the nucleic acid beyond what is expressly otherwise stated.

[0010] As used herein, the term " _Tm " refers to the temperature at which half the DNA strands of a sample are in a double-stranded state and half of the DNA strands of a sample are in a random helical state.

[0011] As used herein, the term "adapter" and its derivatives (eg, universal adapter, non-targeting adapter, etc.) generally refer to any linear, single-stranded oligonucleotide that can be ligated to a nucleic acid molecule of the present invention. In some embodiments, the adapter is substantially non-complementary to the 3' end or 5' end of any target sequence present in the sample. In some embodiments, suitable adapter lengths range from 10-100 nucleotides, 12-60 nucleotides, and 15-50 nucleotides. Typically, the adapter may include any combination of nucleotides and/or nucleic acids. In some aspects, the adapter may include one or more leaving groups at one or more locations. In another aspect, the adapter may include a sequence that is substantially identical to, or substantially complementary to, at least a portion of a primer, such as a universal primer. In some embodiments, the adapter may include an index or tag to facilitate downstream error correction, identification, or sequencing.

[0012] As used herein, the term “universal sequence” refers to a sequence region that is common to two or more nucleic acid molecules, for example, target adapter molecules, where the molecules also have sequence regions that are different from each other. A universal sequence that is present in various members of a collection of molecules may allow the binding of a variety of different nucleic acids using a population of universal binding nucleic acids that are complementary to a portion of the universal sequence, such as the binding site of a universal extension primer. Non-limiting examples of universal extension primer binding sites include sequences that are identical or complementary to primers P5 and P7. Likewise, a universal sequence present in various members of a collection of molecules may allow the replication or amplification of many different nucleic acids using a population of universal primers that are complementary to a portion of the universal sequence, eg, a universal primer binding site. Thus, the universal binding nucleic acid or universal primer includes a sequence that can specifically hybridize to the universal sequence. Target nucleic acid molecules can be modified to attach universal adapters, for example, at one or both ends of various target sequences, as described herein.

[0013] The terms "P5" and "P7" may be used to refer to amplification primers, such as universal primer extension primers. The terms "P5'" (P5-prime) and "P7'" (P7-prime) refer to primers complementary to P5 and P7, respectively. It is understood that any suitable amplification primers can be used in the methods presented herein, and that the use of P5 and P7 are exemplary embodiments only. The use of amplification primers such as P5 and P7 in flow cells is known in the art, as illustrated by the disclosures in WO 2007/010251, WO 2006/064199, WO 2005/065814, WO 2015/106941, WO 1998/044151 and WO 2000/018957. For example, any suitable forward amplification primer, either immobilized or in solution, may be useful in the methods presented herein for hybridization to a complementary sequence and amplification of the sequence. Likewise, any suitable reverse amplification primer, either immobilized or in solution, may be useful in the methods presented herein for hybridization to a complementary sequence and sequence amplification. One skilled in the art will understand how to design and use primer sequences that are useful for binding and amplifying nucleic acids as described herein.

[0014] As used herein, "amplify", "amplification" or "amplification reaction" and their derivatives generally refer to any action or process by which at least a portion of a nucleic acid molecule is replicated or copied into at least one additional nucleic acid molecule. The additional nucleic acid molecule optionally includes a sequence that is substantially identical to or substantially complementary to at least some portion of the template nucleic acid molecule. The template nucleic acid molecule may be single-stranded or double-stranded, and the additional nucleic acid molecule may independently be single-stranded or double-stranded. Amplification optionally involves linear or exponential replication of a nucleic acid molecule. In some embodiments, such amplification can be carried out using isothermal conditions; in other embodiments, such amplification may involve thermal cycling. In some embodiments, the amplification is a multiplex amplification that involves simultaneous amplification of multiple target sequences in a single amplification reaction. In some embodiments, “amplification” includes amplification of at least some of the DNA and RNA-based nucleic acids, alone or in combination. The amplification reaction may involve any of the amplification methods known to one skilled in the art. In some embodiments, the amplification reaction comprises a polymerase chain reaction (PCR).

[0015] As used herein, “amplification conditions” and their derivatives generally refer to conditions suitable for amplifying one or more nucleic acid sequences. Such amplification may be linear or exponential. In some embodiments, the amplification conditions may include isothermal conditions, or alternatively, may include thermal cycling conditions, or a combination of isothermal conditions and thermal cycling conditions. In some embodiments, conditions suitable for amplifying one or more nucleic acid sequences include polymerase chain reaction (PCR) conditions. Generally, amplification conditions refer to a reaction mixture sufficient to amplify nucleic acids, such as one or more target sequences, or to amplify an amplified target sequence ligated to one or more adapters, such as an adapter ligated amplified target sequence. Typically, the amplification conditions include a catalyst for amplification or for nucleic acid synthesis, such as a polymerase; a primer having some degree of complementarity with the nucleic acid to be amplified; and nucleotides such as deoxyribonucleotide triphosphates (dNTPs) to promote primer extension following hybridization with a nucleic acid. Amplification conditions may require hybridization or annealing of the primer to the nucleic acid, primer extension, and a denaturation step in which the extended primer is separated from the nucleic acid sequence being amplified. Typically, but not necessarily, amplification conditions may include thermal cycling; in some embodiments, the amplification conditions include multiple cycles where the steps of hybridization, extension, and separation are repeated. Typically, amplification conditions include cations such as Mg ²⁺ or Mn ²⁺ and may also include various ionic strength modifiers.

[0016] As used herein, the term “polymerase chain reaction” (“PCR”) refers to the method as described in U.S. Patent No. 4683195 and 4683202, which describe a method for increasing the concentration of a polynucleotide fragment of interest in a mixture of genomic DNA without cloning or purification. This method of amplifying a polynucleotide of interest consists of introducing a large excess of two oligonucleotide primers into a DNA mixture containing the desired polynucleotide of interest, followed by a series of thermal cycling in the presence of DNA polymerase. The two primers are complementary to their respective strands of the double-stranded polynucleotide of interest. The mixture is first denatured at a higher temperature, and then the primers are hybridized to complementary sequences within the polynucleotide molecule of interest. After hybridization, the primers are extended using polymerase to produce a new pair of complementary strands. The steps of denaturation, primer hybridization, and polymerase extension can be repeated numerous times (referred to as thermal cycling) to obtain a high concentration of the amplified fragment of the desired polynucleotide of interest. The length of the amplified fragment of the desired polynucleotide of interest (amplicon) is determined by the relative positions of the primers with respect to each other, and thus this length is a controllable parameter. Due to the repetition of this process, the method is referred to as "polymerase chain reaction" (hereinafter referred to as "PCR"). Because the desired amplified fragments of the polynucleotide of interest become the predominant nucleic acid sequences (with respect to concentration) in the mixture, they are referred to as “PCR amplified.” In a modification of the method discussed above, target nucleic acid molecules can be amplified by PCR using a variety of different primer pairs, in some cases, one or more primer pairs per target nucleic acid molecule of interest, thereby forming a multiplex PCR reaction.

[0017] As defined herein, “multiplex amplification” refers to the simultaneous amplification of two or more target sequences in a sample. In some embodiments, multiplex amplification is carried out such that some or all of the target sequences are amplified in a single reaction vessel. The “multiplicity” or “plexity” of a given multiplex amplification generally refers to the number of different specific target sequences amplified during that single multiplex amplification. It is also possible to detect amplified target sequences by several different methods (e.g., gel electrophoresis followed by densitometry, quantitation using a bioanalyzer or qPCR, hybridization with a labeled probe; incorporation of biotinylated primers followed by detection with an avidin-enzyme conjugate; 32P incorporation -labeled deoxynucleotide triphosphates into the amplified target sequence).

[0018] As used herein, the term “primer” and its derivatives generally refers to any polynucleotide that can hybridize to a target sequence of interest. Typically, the primer functions as a substrate onto which nucleotides can be polymerized by a polymerase; in some embodiments, however, a primer may become incorporated into a synthesized nucleic acid strand and provide a site with which another primer can hybridize to prime the synthesis of a new strand that is complementary to the synthesized nucleic acid molecule. The primer may consist of any combination of nucleotides or their analogues. In some embodiments, the primer is a single-stranded oligonucleotide or polynucleotide. The terms "polynucleotide" and "oligonucleotide" are used interchangeably herein to refer to the polymeric form of nucleotides of any length and may include ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. The terms should be understood to include, as equivalents, either DNA or RNA analogues consisting of nucleotide analogues, and to apply to single-stranded (such as sense or antisense) and double-stranded polynucleotides. This term, within the scope of the invention, also includes cDNA, that is, complementary DNA or a copy of DNA obtained from an RNA template, for example, under the action of reverse transcriptase. This term refers only to the primary structure of the molecule. Thus, the term includes three-, double- and single-stranded deoxyribonucleic acid (“DNA”), as well as three-, double- and single-stranded ribonucleic acid (“RNA”).

[0019] As used herein, the terms “ligation,” “ligation,” and derivatives thereof generally refer to a method of covalently linking two or more molecules, for example, covalently linking two or more nucleic acid molecules to each other. In some embodiments, ligation involves joining nicks between adjacent nucleic acid nucleotides. In some embodiments, ligation involves forming a covalent bond between the end of a first and the end of a second nucleic acid molecule. In some embodiments, ligation may involve forming a covalent bond between the 5'-phosphate group of one nucleic acid and the 3'-hydroxyl group of the second nucleic acid, thereby producing a ligated nucleic acid molecule. In some embodiments, the target sequence can be ligated to an adapter to produce an adapter-target sequence. One skilled in the art will recognize that the ligation reaction may not result in the binding of all molecules present in the reaction.

[0020] As used herein, "ligase" and its derivatives generally refer to any means for catalyzing the ligation of two substrate molecules. In some embodiments, the ligase includes an enzyme capable of catalyzing the joining of nicks between adjacent nucleic acid nucleotides. In some embodiments, the ligase includes an enzyme capable of catalyzing a covalent bond between the 5'-phosphate of one nucleic acid molecule with the 3'-hydroxyl of another nucleic acid molecule, thereby forming a ligated nucleic acid molecule. Suitable ligases may include, but are not limited to, T4 DNA ligase, T4 RNA ligase, thermostable T4 DNA ligase, and E. coli DNA ligase.

[0021] The term "flow cell" as used herein refers to a chamber containing a solid surface through which one or more liquid reactants can flow. Examples of flow cells and associated fluidic systems and detection platforms that can be readily used in the methods herein are described, for example, in Bentley et al ., Nature 456:53-59 (2008); WO 04/018497; WO 91/06678; WO 07/123744; US Patent No. 7057026; US Patent No. 7211414; US Patent No. 7315019; US Patent No. 7329492; US Patent No. 7405281; and US Patent Publication No. 2008/0108082.

[0022] As used herein, the term “library” refers to a collection of members. In one embodiment, the library includes a collection of nucleic acid members, for example, a collection of whole genome, subgenomic fragments, cDNA, cDNA fragments, RNA, RNA fragments, or a combination thereof. In some embodiments, some or all of the library members include an off-target adapter sequence. The adapter sequence may be located at one or both ends. The adapter sequence can be used, for example, in a sequencing method (eg, an NGS method), for amplification, for reverse transcription, or for cloning into a vector.

[0023] “Member” or “library member” or other similar term, as used herein, refers to a nucleic acid molecule, such as DNA, RNA, or a combination thereof, that is a member of a library. Typically, the member is a DNA molecule, such as genomic DNA or cDNA. The member may be fragmented, for example by shear or enzyme-prepared, genomic DNA. Members include sequence from the subject and may also include sequence not derived from the subject, for example, a non-target sequence such as an adapter sequence, a primer sequence and/or other sequences allowing identification, such as an index.

[0024] As used herein, an “index” (also referred to as an “index region” or “index adapter”) refers to a nucleic acid tag that can be used to identify a sample or source of nucleic acid material. When nucleic acid samples are obtained from multiple sources, the nucleic acids in each nucleic acid sample can be labeled with different nucleic acid tags so that the source of the sample can be identified. Any suitable index or set of indexes may be used, as is known in the art and as illustrated by the descriptions of US Patent No. 8053192, PCT Publications No. WO 05/068656 and US Patent Publication No. 2013/0274117. In some embodiments, the index may include a six-base index 1 sequence (i7), an eight-base index 1 sequence (i7), an eight-base index 2 sequence (i5), a ten-base index 1 sequence (i7), or an index sequence 2 of ten bases (i5) from Illumina, Inc. (San Diego, CA).

[0025] As used herein, the term “unique molecular identifier” or “UMI” or “barcode” refers to a molecular tag that can be attached to a nucleic acid molecule. When incorporated into a nucleic acid molecule, UMI can be used to correct for subsequent amplification bias by directly counting unique molecular identifiers (UMIs) sequenced after amplification.

[0026] As used herein, the term “tagmentation” refers to the modification of DNA by a transposomal complex containing the enzyme transposase in complex with adapters containing a double-stranded recognition sequence (hybridized transposon terminal sequences). Tagmentation leads to simultaneous DNA fragmentation and ligation of adapters with the 5′ ends of both strands of duplex fragments. After purification to remove the transposase enzyme, gap filling, and ligation, a fully double-stranded product is obtained. Additional sequences can be added to the ends of the adapter fragments, for example, by PCR, ligation, or any other suitable method known to one skilled in the art. See, for example, US Patent Publication No. 2017/0044525.

[0027] The term “and/or” means one or more of the listed elements, or a combination of any two or more of the listed elements.

[0028] The expressions “preferred” and “preferably” refer to embodiments of the invention in which certain benefits can be obtained under certain conditions. However, other embodiments may also be preferred, under the same or different conditions. Moreover, the listing of one or more preferred embodiments does not imply that other embodiments are not applicable and is not intended to exclude other embodiments from the scope of the invention.

[0029] The term “comprises” and variations thereof are not intended to be limiting when these terms appear in the specification and claims.

[0030] It is understood that whenever embodiments are described herein using the expression “include,” “includes,” or “including,” etc., otherwise similar embodiments described with respect to “consisting of" and/or "consisting mainly of" are also presented. The term "consisting of" is limited to what follows the phrase "consisting of". That is, “consisting of” shows that the listed elements are necessary or obligatory, and that other elements cannot be present. The term "consisting essentially of" indicates that any elements listed after this phrase are included, and that elements other than those listed may be included, provided those elements do not interfere with or contribute to the activity or action specified in the description for the listed items.

[0031] Unless otherwise indicated, the singular forms and “at least one” are used interchangeably to mean one or more than one.

[0032] As used herein, the term "each", when used in relation to a collection of objects, is intended to identify an individual term in the collection, but does not necessarily refer to every term in the collection unless the context clearly requires otherwise.

[0033] Numeric range enumerations by endpoint include all numbers included in the range (e.g., 1-5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.) .

[0034] For any method described herein that includes discrete steps, the steps can be carried out in any practical order. And, if necessary, any combination of two or more steps can be carried out simultaneously.

[0035] The above summary of the present invention is not intended to describe every disclosed embodiment or every embodiment of the present invention. The following description provides more specific examples of illustrative embodiments. At several places throughout the application, guidance is provided through a list of examples that can be used in various combinations. In each case, the list listed serves only as a representative group and should not be interpreted as an exclusive list.

[0036] Reference throughout this specification to “one embodiment,” “an embodiment,” “specific embodiments,” or “certain embodiments,” etc. means that a particular feature, configuration, composition, or characteristic , described in connection with the embodiment are included in at least one embodiment of the present invention. Thus, the appearance of such phrases in various places throughout this description does not necessarily refer to the same embodiment of the present invention. In addition, specific features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more embodiments.

[0037] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, etc., used in the description and claims are to be understood as modified in all cases by the term “about.” Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending on the desired properties that the present invention is attempting to achieve. At the very least, and not in an attempt to limit the doctrine of equivalent scope of claims, each numerical parameter should at least be considered in light of the number of significant figures given and using normal rounding techniques.

[0038] All headings are provided for the convenience of the reader and should not be used to limit the meaning of the text following the heading unless otherwise noted.

[0039] Although the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values indicated in the specific examples are given as accurately as possible. All numerical values, however, by their nature contain a range that inevitably results from the standard deviation found in their respective test measurements.

BRIEF DESCRIPTION OF THE DRAWINGS

[0040] FIG. 1A - FIG. 1B are diagrams showing an exemplary embodiment of hybrid coupling during enrichment and comparative off-target coupling. FIG. 1A. The probe includes a region designed to hybridize to a region of interest in the target genome and a ligand that allows subsequent binding of the probe (eg, a biotin moiety). Once hybridization is complete and a DNA-template-probe hybrid is formed, coupling agents (i.e., a component having affinity for the probe, including, for example, a streptavidin-coated magnetic bead) are used to bind the probe hybridizing to the target DNA, removing the target from the pool oligonucleotides. FIG. 1B. Unwanted or off-target oligonucleotides can be isolated during hybrid binding due to interactions between terminal adapter sequences in target sequences and adapter sequences in off-target library drug products.

[0041]On FIG. 2 shows an exemplary mechanism by which blockers prevent hybridization of adapter sequences and prevent off-target binding.

[0042]On FIG. 3A - FIG. 3I shows diagrams of exemplary blockers. FIG. 3A. Diagram of NEXTERA blockers with bases complementary to the 8- or 10-base adapter index region. FIG. 3B. Diagram of NEXTERA blockers modified with 8 or 10 deoxyinosine bases in the blocker region corresponding to the adapter index region. FIG. 3C. Diagram of TRUSEQ blockers modified to use 6, 8, or 10 deoxyinosine bases in the blocker region corresponding to the adapter index region. FIG. 3D. Diagram of NEXTERA and TRUSEQ blockers with 6 or 8 thymine bases in the blocker region corresponding to the adapter index region. FIG. 3E. Diagram of split NEXTERA blockers comprising a component corresponding to the region 5' of an 8- or 10-base index region and a component corresponding to the region 3' of the index region. These constructs do not include any bases corresponding to the index region of the adapter (indicated by omitting 8 or 10 bases corresponding to the index region). FIG. 3F. Diagram of split TRUSEQ blockers comprising a component corresponding to a region 5' of an 8- or 10-base index region and a component corresponding to a region 3' of an index region. These constructs do not include any bases corresponding to the index region of the adapter (indicated by omitting 8 or 10 bases corresponding to the index region). FIG. 3G. Diagram of NEXTERA blockers matching only part of the adapter region 3' from the index region. FIG. 3H. Diagram of TRUSEQ blockers pairing only with part of the adapter region 3' from the index region. FIG. 3I. Diagram of Nextera or TRUSEQ blockers matching only part of the adapter region 5' from the index region (eg, p5 or p7 sequence).

[0043] FIG. 4 is a plot of read-augmented enrichment results (a measure of the amount of target DNA bound) obtained using blockers as described in Example 2.

[0044]On FIG. 5 shows a diagram of blockers comprising a modified G (+G) or random (A, T, G or C) (N) nucleotide at the fifth position of the portion of the blocker sequence corresponding to the index sequence as described in Example 3.

[0045]On FIG. 6A - FIG. 6B shows blocker designs and results as described in Example 4. FIG. 6A is a diagram of various blocker designs comprising (1) a pair of split blockers with a first sequence complementary to the 25-30 member region 5' of the index region, and a second sequence complementary to the 34-35 member region 3' of the index region, (2 ) a blocker that pairs only with the 3' part of the adapter ("Internal" blocker), (3) a blocker that pairs only with the 5' part of the adapter ("External" blocker), and (4) a short (8 nucleotide) blocker corresponding index area (“Short of 8 n.”). In FIG. 6B shows readthrough enrichment results achieved using XGEN blocking oligonucleotides (Integrated DNA Technologies, Coralville, IA), split blockers, or blockers that bind only part of the adapter.

[0046]On FIG. 7A - FIG. 7F shows results using an improved hybridization buffer including dextran sulfate as described in Example 5. FIG. 7A shows read-augmented enrichment results achieved using different concentrations of dextran sulfate in the hybridization buffer. In FIG. 7B shows read-augmented enrichment results achieved using 100 μl hybridization and four different probe panels and three different buffer conditions (IDT hybridization buffer, unenhanced Illumina hybridization buffer, and enhanced Illumina hybridization buffer). In FIG. 7C shows read-augmented enrichment results and coverage uniformity results for all four probe panels at various hybridization incubation times, both in the presence and absence of an additional temperature ramping step. The dashed black line in the left panel shows the result of hybridization in buffer without dextran sulfate. Three groups of sequencing results are shown, including NOVASEQ (FIG. 7D), NEXTSEQ (FIG. 7E), and ISEQ (FIG. 7F) (percentage of identified reads (PF) for NOVASEQ and NEXTSEQ, and percentage (%) index for ISEQ) and associated coefficients of variation (CV) for reactions using dextran sulfate hybridization buffer and a library volume of 30 μl.

[0047] In FIG. 8A - FIG. 8C shows the results of the hybridization assays described in Example 6. FIG. 8A shows the results of read-augmented enrichment using modified blockers, increasing wash temperature, and/or crowding agent (dextran sulfate) in the hybridization buffer. In FIG. 8B shows the read-augmented enrichment results achieved using the methods described in Example 6 for nine probe panels using the enhanced XGEN blocker hybridization buffer, compared to the results for the IDT exome panel using the XGEN LOCKDOWN IDT kit method. In FIG. 8C shows detection of somatic variants by a single hybridization enrichment method using a 12 gene, 535 probe panel to enrich libraries derived from the HD701 Horizon Discover quantitative multiplex (QM) DNA standard.

[0048] In FIG. 9A - FIG. 9D shows exemplary process flow diagrams. eBBN stands for bead-based tagmentation using bead-associated transposome complexes; H stands for hybridization; C stands for binding; W denotes wash; E stands for elution; PCR stands for PCR amplification; S stands for sequencing; Q stands for quantification; SpVac stands for concentration in a Speed Vacuum centrifuge. In FIG. 9A is a diagram of an exemplary hybrid binding process flow showing the production of a library using a bead-based tagmentation method; any suitable library preparation method may be used prior to enrichment. Notably, only one cycle of hybridization and binding is included. In FIG. 9B is a diagram of an exemplary hybrid bonding process. In FIG. 9C shows an exemplary flow diagram for non-PCR hybrid coupling. In FIG. 9D is a flow diagram of an exemplary process flow for non-PCR hybrid coupling with shortened hybridization time.

[0049] In FIG. 10 shows read-augmented enrichment results achieved using BN001 and BN002 (unmodified blockers); BX003 and BX007 (modified G-lock blockers); BN007 and BN008 (blockers modified with BNA and deoxyinosine); BN005 and BN006 (BNK and modified sequence-specific blockers); or BN023, BN024, BN025 and BN026 (separated blockers modified using ZNA), as described in Example 8.

[0050] In FIG. 11 shows read-augmented enrichment results achieved using BN001 and BN002 (unmodified blockers) or BN023, BN024, BN025 and BN026 (modified using LNA-split blockers) when the corresponding adapter includes an 8-nucleotide index or a 10-nucleotide index, as described in example 9.

DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0051] The present invention relates to compositions including a blocker and/or hybridization buffer, and methods for improving the efficiency of nucleic acid selection prior to sequencing, including methods of using these compositions and methods including hybrid coupling.

Enrichment via hybrid coupling

[0052] A variety of methods can be used to enrich desired sequences from a complex pool of nucleic acids. These methods include polymerase chain reaction (PCR), molecular invertible probes (MIPs), or sequence linking through hybrid formation (“hybrid linking”). See, for example, Mamanova et al. , Nat. Methods 7:111-118 (2010)); Publication of US Patent No. 2014/0031240; and US Patent Publication No. 2017/0114404.

[0053] Next generation sequencing (NGS) typically uses a hybrid linkage enrichment method. The resulting pool of templates for NGS - the library - is denatured by heating and mixed with a pool of binding oligonucleotide probes (“probes”). The probes are designed to hybridize to regions of interest in the target genome and are typically 60-200 bases in length, and are further modified to contain a ligand to allow subsequent binding of related probes. A common binding method involves a biotin group (or groups) on the probes. Once hybridization is complete to form DNA-template-probe hybrids, binding is carried out with a component having affinity only for the probe, as shown in one embodiment in FIG. 1A. For example, streptavidin-coated magnetic beads can be used to bind the biotin moiety of biotinylated probes that hybridize to desired DNA targets from a library. Washing removes unbound nucleic acids, reducing the complexity of the retained material. The retained material is then eluted from the magnetic beads and introduced into the automated sequencing method.

[0054] Although hybridization of DNA to probes may be extremely specific, unwanted sequences remain in an enriched pool after completion of the hybridization process. The largest fraction of these unwanted sequences is present due to unwanted hybridization events between library members that do not have complementarity with the probes and library members that do have complementarity (ie, the target library member). Two types of sequences lead to unwanted hybridization during hybrid coupling methods: (1) DNA elements with a high content of repetitive sequences found in endogenous genomic DNA; and (2) terminal adapter sequences designed in each of the library members.

[0055] Repeated endogenous DNA elements, such as an Alu sequence or a long interspersed nuclear repeat (LINE) sequence, present in one DNA fragment in a complex pool can hybridize with another similar element present in another unrelated DNA fragment. These fragments, which may originally originate from very different locations in the genome, become linked during the process of hybridization in the hybrid linkage method. If one of these DNA fragments is a desired fragment containing a binding site for a probe, the unwanted fragment may bind together with the desired fragment. This class of off-target library members can be reduced by adding excess repeat elements to the hybridization buffer in the hybridization reaction. Most commonly, human Cot-1 DNA (which binds Alu, LINE, and other repeat regions in the target, and blocks the ability of NGS templates to interact with each other on this basis) is added to the hybridization buffer.

[0056] Non-specific (also referred to as non-target) library members may also bind due to interactions between terminal adapter sequences in individual library members. Typically, library members include a sequence fragment from a gene of interest, such as a sequencing fragment. If the member is targeted, the sequence from the gene of interest forms a duplex with the binding probe. Target sequences may include, for example, an exon or intron (or fragment thereof), a coding region or non-coding region, an enhancer, an untranslated region, a specific SNP, etc. Typically, library members also include one or more non-target sequences. These non-target sequences typically do not include the target sequence of interest, but do include, for example, an adapter. Because a pool of library members will typically contain at least some identical terminal adapter sequences, the adapter sequences are present in very high effective concentration(s) in the hybridization solution. Therefore, library members containing off-target sequences can hybridize to associated target sequences via portions of the adapter sequences attached to them, thereby resulting in linking off-target sequences together with target library members (e.g., through concatenation or "daisy chaining" of sequences linked together ), as shown in one embodiment in FIG. 1B. Since the hybridized target sequence includes a binding site for the probe, the entire garland can bind. Thus, binding of one desired fragment may take with it a large number of undesired fragments, reducing the overall enrichment efficiency for the desired fragment.

[0057] In some aspects, the present invention provides methods and compositions for minimizing the selection of off-target nucleic acid through hybrid coupling.

Oligonucleotide blocker

[0058] In one aspect, the present invention relates to a "blocker oligonucleotide" (also referred to herein as a "blocker") and a method of preventing selection of a non-target nucleic acid during hybrid binding by using a blocker for binding (e.g., duplex formation) with at least part of the adapter sequence. When used as shown in one embodiment of FIG. 2, binding of a blocker to an adapter sequence prevents interactions between adapter sequences in off-target library drug products—including, for example, the formation of concatenated strands—that could result in the release of unwanted library members during hybrid binding.

[0059] In some embodiments, at least two blockers can be used, with a first blocker linking (eg, duplexing) to a first adapter sequence, and a second blocker linking (eg, duplexing) to a second adapter sequence. In some embodiments, the first adapter sequence may be at the 5' end of the library member and the second adapter sequence may be at the 3' end of the library member. In some embodiments, a variety of different blockers can be used.

[0060] In some embodiments, the blocking oligonucleotide forms a duplex with an adapter sequence of at least 1, at least 2, at least 5, at least 10, at least 20, at least 50, at least 100, or at least 200 library members, and the resulting duplex has a T _m greater than the T _m of the duplex formed by the adapter sequence with a background nucleic acid, including, for example, a sequence complementary to the adapter.

[0061] In some embodiments, the blocker-adapter complex has a higher T _m than the adapter-adapter complex. This increased T _m means that the blocker-adapter complex is more likely to form before the adapter-adapter complex, which may prevent off-target binding (eg, by preventing daisy chain formation). In some embodiments, the T _m of the blocker-adapter oligonucleotide duplex is at least 1.5°C, at least 2°C, at least 3°C, at least 4°C, at least 5°C, at least 10°C, at least 15°C, at least 20°C, or at least 25°C greater than the T _m of the adapter duplex with its exact complementary sequence. In some embodiments, the T _m of the blocker-adapter oligonucleotide duplex is at most 2°C, at most 3°C, at most 4°C, at most 5°C, at most 10°C, at most 15°C, at most 20°C, at most 25°C, or at most 30°C greater than the T _m of the adapter duplex with its exact complementary sequence.

[0062] In some embodiments, the blocking oligonucleotide has a binding rate to the adapter sequence of at least 1, at least 2, at least 5, at least 10, at least 20, at least 50, at least 100 , or at least 200 library members, exceeding the rate of binding of the adapter sequence to a background nucleic acid, including, for example, a sequence complementary to the adapter. In some embodiments, the binding rate is at least 2 times faster, at least 4 times faster, at least 6 times faster, at least 8 times faster, or at least 10 times faster. In some embodiments, the binding rate is at most 4 times faster, at most 6 times faster, at most 8 times faster, at most 10 times faster, or at most 12 times faster.

[0063] In some embodiments, the blocking oligonucleotide has a dissociation rate from the adapter sequence of at least 1, at least 2, at least 5, at least 10, at least 20, at least 50, at least 100 or at least 200 library members less than the rate of dissociation of the adapter sequence from the background nucleic acid, including, for example, a sequence complementary to the adapter. In some embodiments, the dissociation rate is at least 2 times slower, at least 4 times slower, at least 6 times slower, at least 8 times slower, or at least 10 times slower lower. In some embodiments, the binding rate is at most 4 times slower, at most 6 times slower, at most 8 times slower, at most 10 times slower, or at most 12 times slower.

[0064] In some embodiments, the duplex formed between the blocking oligonucleotide and the adapter sequence is at least 1, at least 2, at least 5, at least 10, at least 20, at least 50, at least 100, or at least 200 library members, longer than the duplex formed between the adapter sequence and its complementary sequence, including, for example, the duplex between the Watson and Crick strands of a double-stranded adapter. In some embodiments, the duplex between the blocking oligonucleotide and the adapter sequence is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least at least 7, at least 8, at least 9, at least 10, at least 15, or at least 20 nucleotides longer than the duplex formed between the adapter sequence and its complementary sequence.

[0065] In some embodiments, the blocker preferably includes a modification that increases the T _m of the blocker, compared to an oligonucleotide having the same sequence as the blocker that does not include the modification. For example, in some embodiments, the blocker may be an "increased _Tm oligonucleotide", which is an oligonucleotide that includes at least one modified group that provides an increased melting temperature value for the nucleic acid duplex that includes, as a hybridization partner , this oligonucleotide, as compared to a nucleic acid duplex which includes, as a hybridization partner, an oligonucleotide having an identical composition of nucleic bases and unmodified groups. An "increased _Tm oligonucleotide" is further described in US Patent Publication No. 2014/0031240.

[0066] In some embodiments, the blocker includes one or more non-natural nucleotides. In some embodiments, a duplex formed between a blocking oligonucleotide having non-natural nucleotides and an adapter sequence of at least 1, at least 2, at least 5, at least 10, at least 20, at least 50, at least 100 or at least 200 library members, has a parameter value related to the binding interaction (e.g., affinity, binding rate, inverse dissociation rate, or T _m ) value greater than the value for the non-target nucleic acid sequence and the background nucleic acid, for example, other complementary non-target nucleic acid sequences.

[0067] In some embodiments, the blocker includes a modified base. Any suitable modified base can be included in the blocker. In some embodiments, the modification preferably includes a T _m -increasing modification, that is, a modification that increases the T _m of a blocker-adapter complex comprising the modified base compared to the T _m of a blocker-adapter complex that has the same sequence but does not include modified base. Such T _m -increasing modification may include, for example, a DNA or RNA oligonucleotide modified to bind regions of low GC content; cross-linked oligonucleotide; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; locked nucleic acid (LNA); bridged nucleic acid (also referred to as bicyclic nucleic acid or BNA); tricyclic nucleic acid; peptide nucleic acid (PNA); C5-modified pyrimidine base; propynylpyrimidine; morpholino; phosphoramidite; 5'-pyrene cap; etc. In some embodiments, the LNA includes a ribose group from a nucleotide modified with an additional bridge connecting a 2′-oxygen and a 4′-carbon. Exemplary BNCs are described, for example, in US Patent No. 7399845, US Patent No. 7427672, US Patent No. 7547684, US Patent No. 7696345, US Patent No. 7741457, US Patent No. 8022193, US Patent No. 8268980, US Patent No. 8278425, US Patent No. 8278426, US Patent No. 8846637, US Patent No. 8846639 and US Patent No. 9546368. In some embodiments, the NBRs may include a conformationally ethyl-limited nucleic acid from Ionis Pharmaceuticals (Carlsbad, CA) or a 2'-O,4'-aminoethylene bridged nucleic acid from Biosynthesis, Inc. (Lewisville, TX). In some embodiments, the PNA includes repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. In some embodiments, the tricyclic nucleic acid includes a tricyclic nucleic acid described, for example, in US Pat. No. 9221864. Exemplary phosphoramidites include 1-[5'-O-(4,4'-dimethoxytrityl)-β-D-2'-deoxyribofuranosyl]-9-(2-trifluoroacetamidoethoxy)-1,3-diaza-2-oxophenoxazine, 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite (AP-dC-CE phosphoramidite), 5'-dimethoxytrityluridine,2'-O-methyl,3'-[(2-cyanoethyl)- (N,N-diisopropyl)]-phosphoramidite (2'-OMe-U-CE phosphoramidite), 5'-dimethoxytrityl-N-acetyl-5-methylcytidine,2'-O-methyl,3'-[(2-cyanoethyl )-(N,N-diisopropyl)]-phosphoramidite (2'-OMe-5-Me-C-CE phosphoramidite), 5'-dimethoxytrityl-N-acetylcytidine,2'-O-methyl,3'-[(2 -cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (2'-OMe-Ac-C-CE-phosphoramidite), etc.

[0068] In some embodiments, a modification that increases the T _m of a blocker relative to an oligonucleotide having the same sequence as the blocker that does not include the modification may include a non-base modification. Such modification may include, for example, a minor groove binder (MGB), spermine, G-fixer, or Uaq anthraquinone cap.

[0069] In some embodiments, the blocking oligonucleotide has a length of at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100 nucleotides. In some embodiments, the blocking oligonucleotide is at most 45, at most 50, at most 55, at most 60, at most 70, at most 80, at most 90, at most 100, at most 150, or at most 200 nucleotides in length.

[0070] In some embodiments, the blocking oligonucleotide may include a variety of modifications that increase the T _m of the blocker. In some embodiments, the preferred amount of modification is that amount that provides an increase in the optimal T _m value under stringent conditions (0.1×SSC) (“optimal increased T _m value”) of at least about 1.4°C for a DNA duplex containing the modification(s) as one complementary strand. In some embodiments, a preferred number of modifications in a blocking oligonucleotide with an increased T _m provides the T _m of the blocker-adapter oligonucleotide duplex by at least 1.5°C, by at least 2°C, by at least 3°C, by at least 4°C, at least 5°C, at least 10°C, at least 15°C, at least 20°C or at least 25°C more than T _m adapter duplex with its exact complementary sequence. In some embodiments, a preferred number of modifications in a blocking oligonucleotide with an increased T _m provides the T _m of the blocker-adapter oligonucleotide duplex by at most 2°C, at most by 3°C, at most by 4°C, at most by 5°C , at most 10°C, at most 15°C, at most 20°C, at most 25°C, or at most 30°C greater than the T _m of the adapter duplex with its exactly complementary sequence.

[0071] In some embodiments, the blocking oligonucleotide may include modifications of at least 2 percent, at least 5%, at least 10%, at least 20%, at least 30%, at least 40 %, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the bases in the blocking oligonucleotide. In some embodiments, the blocking oligonucleotide may include modifications of at most 5%, at most 10%, at most 20%, at most 30%, at most 40%, at most 50%, at most 60%, at most 70%, at most 80%, at most 90%, or at most 100% of the bases in the blocking oligonucleotide.

[0072] In some embodiments, a blocker modification may be included in a particular pattern. For example, the modified base can be included every 2 bases (see, for example, Table 2A, BN021 and BN022), every 3 bases (see, for example, Table 2A, BN035 and BN036), every 4 bases, or every 5 bases, or some combination thereof (see, for example, Table 2A, BN036). In some embodiments, each base in the blocker may be modified (see, for example, Table 2A, BN027 and BN028). In some embodiments, guanine - which has a higher affinity than other nucleotides when modified - may be preferably modified. For example, in some embodiments, a form of LNA or NNA guanine may be included in the blocker.

[0073] In some embodiments, the blocker may include a terminal modification. For example, the blocker may include a 3'-terminal group that prevents the blocker from being accessible to serve as a primer for DNA synthesis. Such a 3'-terminal group may include, for example, 3'-dC, 2',3'-ddC (also referred to herein as 3ddc), inverted dT, 3' spacer C3 (also referred to herein as 3SpC3) etc.

[0074] The blocker can bind (eg, form a duplex) with any suitable adapter sequence (including any part thereof). Within the scope of the invention, a portion of the blocker sequence that binds (eg, forms a duplex) to a portion of the adapter sequence is referred to as the portion of the blocker sequence that “matches” the portion of the adapter sequence. In some embodiments, the corresponding sequence may be exactly complementary to the adapter sequence. In some embodiments, however, at most 1, at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, or at most 10 bases in the appropriate sequence may not be complementary.

[0075] In some illustrative embodiments, a blocker may bind to an adapter as shown in Table 1. (Adapter sequences are shown in Table 1A and additional component sequence information is shown in Table 1B.) In some illustrative embodiments, a blocker may bind to an adapter incorporating the sequence described in the Illumina adapter sequences (available on the World Wide Web at support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences-1000000002694-07 .pdf

[0076] In some embodiments, the blocker binds to an adapter, where the adapter includes a universal sequence including, for example, a universal adapter and/or a universal primer sequence. In some embodiments, the universal primer sequence may include P5, P7, P5' and/or P7'. In some embodiments, the universal primer sequence may include a V2.A14.METS sequence, a V2.B15.METS sequence, a sequence complementary to V2.A14.METS, and/or a sequence complementary to V2.B15.METS. For example, BN001, as shown in Table 2A, includes P5 and the sequence V2.A14.METS; BN002, as shown in Table 2A, includes P7 and the sequence V2.B15.METS; BN003, as shown in Table 2A, includes P5' and the reverse complementary sequence to V2.A14.METS; BN004, as shown in Table 2A, includes P7' and the reverse complementary sequence to V2.B15.METS.

[0077]In some sequencing applications, it is desirable that library members include at least one index and/or UMI sequence. Thus, in some embodiments, the blocker is associated with an adapter, where the adapter includes at least one of an index and a UMI. In US Patent Publication No. 2014/0031240 describes "three methods that can be used to prepare blocking oligonucleotides" for adapters including an index (where US Patent Publication No. 2014/0031240 refers to the "barcode domain"): "1) synthesize a series of blockers that precisely match each adapter, 2) synthesize one blocker with an N-member domain to pair with the adapter barcode domain, or 3) synthesize one blocker with a universal base domain to pair with the adapter barcode domain.” Since each distinct index and/or UMI has a unique sequence, a fully complementary blocker, as in Method 1, is a sequence that includes an exact complementary match to each index and/or UMI sequence present (see FIG. 3A). However, if multiple individual indexes and/or UMIs are used, inclusion of a blocker having an exact complementary match requires tens or hundreds of unique blockers for multiplex amplification, a method that is not cost effective.

[0078] In some aspects, the present invention relates to blockers for adapters including an index and/or including a UMI, and methods of using such blockers, for example,

a blocker that includes thymine in the blocker region corresponding to the index and/or UMI (FIG. 3D and Example 2);

a blocker that includes universal bases and at least one non-universal base (FIG. 5 and Example 3); or a blocker that does not include an index region (including, for example, a “split blocker” or a blocker that pairs with only part of the adapter) (FIG. 3E-FIG. 3I, FIG. 6A, and Examples 4, 8, and 9).

[0079] In some embodiments, the blocker includes at least one of the sequences from Table 2A, Table 2B, Table 2C, or Table 3. In some embodiments, the sequences from Table 2A can be used following a tagmentation method (eg, NEXTERA) to library acquisition (Illumina, Inc., San Diego, CA). In some embodiments, the sequences from Table 2B can be used following ligation-based library production and/or TRUSEQ production (Illumina, Inc., San Diego, CA). In some embodiments, sequences from Table 2C can be used following a tagmentation method (eg, NEXTERA) to produce a library (Illumina, Inc., San Diego, CA). In some embodiments, if the sequence from Table 2 includes an NBR-modified nucleic acid, the NBR-modified nucleic acid may include a 2'-O,4'-aminoethylene-bridged nucleic acid from Biosynthesis, Inc. (Lewisville, TX). In some embodiments, if the sequence of Table 2 includes an LNA-modified nucleic acid, the LNA-modified nucleic acid may include an LNA-containing oligonucleotide from Qiagen (Hilden, Germany). Additional information about the sequence components from Table 2A, Table 2B, and Table 2C can be found in Table 1B and Table 2D.

[0080] In another aspect, the present invention provides a kit that includes a blocking oligonucleotide. The blocking oligonucleotide may include a blocker as described herein. In some embodiments, the blocking oligonucleotide is a plurality of blocking oligonucleotides. The kit may further include one or more of: a hybridization buffer, a probe, a probe panel, and a flow cell. The hybridization buffer may include a hybridization buffer as described elsewhere herein. In some embodiments, the probe(s) are as described elsewhere herein. In some embodiments, components may be provided in separate containers. For example, a blocking oligonucleotide may be provided in a first container and another component, such as a hybridization buffer or probe or panel of probes, may be provided in another container(s). Alternatively, the blocking oligonucleotide and hybridization buffer may be provided in a first container, and the probe or panel of probes may be provided in another container(s).

Table 1A - Exemplary adapter sequences

SEQ ID NO Reference No. Oligonucleotide name Subsequence 1 TN001 NEXTERA 8 n. adapter - i5 5'- AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 2 TN002 NEXTERA 8 n. adapter - i7 5'- CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3 TN003 NEXTERA 10 n. adapter - i5 5'- AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 4 TN004 NEXTERA 10 n. adapter - i7 5'- CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 5 TN005 NEXTERA short adapter - i5 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGT 6 TN006 NEXTERA short adapter - i7 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC 7 TN007 NEXTERA adapter nrUMI - i5 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTNNNNNNT 8 TN008 NEXTERA adapter nrUMI - i7 /5-phospho/NNNNNNCTGTCTCTTATACACATCTCCGAGCCCACGAGAC 9 TL001 TRUSEQ universal adapter - i5 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT 10 TL002 TRUSEQ 6 n. adapter - i7 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG eleven TL003 TRUSEQ 8 n. adapter - i5 5'- AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT 12 TL004 TRUSEQ 8 n. adapter - i7 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG 13 TL005 TRUSEQ 10 n. adapter - i5 5'- AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT 14 TL006 TRUSEQ 10 n. adapter - i7 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG 15 TL007 TRUSEQ short adapter - i5 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT 16 TL008 TRUSEQ short adapter - i7 /5-phospho/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC 17 TL009 TRUSEQ adapter nrUMI - i5 5'- ACACTCTTTCCCTACACGACGCTCTTCGATCTTNNNNNNT 18 TL010 TRUSEQ adapter nrUMI-i5 /5-phospho/NNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Table 1B

SEQ ID NO Description Subsequence 19 p5 sequence AATGATACGGCGACCACCCGA 20 p7 sequence TCGTATGCCGTCTTCTGCTTG 21 Sequence reverse complementary to P7 (P7') CAAGCAGAAGACGGCATACGA 22 TRUSEQ i7 adapter area GATCGGAAGAGCACACGTCTGAACTCCAGTCAC 23 TRUSEQ i5 adapter area ACACTCTTTCCCTACACGACGCTCTTCCGATC 24 Sequence V2.A14.METS TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 25 Sequence V2.B15.METS GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG Index sequence (8 or 10 nucleotides) [i7] or [i5] 26 N-member domain (mixture of 25% each of A, T, C, G) (e.g. UMI) NNNNNN 5' phosphorylation /5-phospho/

Table 2A - Exemplary Blocker Sequences

SEQ ID NO Reference No Oligonucleotide name Subsequence 27 BN001 NEXTERA blocker 1 i5 5'- AATGATACGGCGACCACCGAGATCTACACTTTTTTTTTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG/3ddC/-3' 28 BN002 NEXTERA blocker 2 i7 5'- CAAGCAGAAGACGGCATACGAGATTTTTTTGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG/3ddC/-3' 29 BN003 Primer C NRCBLK1 5'- GCT GTC TCT TAT ACA CAT CTG ACG CTG CCG ACG ATT TTT TTT GTG TAG ATC TCG GTG GTC GCC GTA TCA TT thirty BN004 Primer C NRCBLK2 5'- GCT GTC TCT TAT ACA CAT CTC CGA GCC CAC GAG ACT TTT TTT TAT CTC GTA TGC CGT CTT CTG CTT G 31 BN005 TiS517 with index sequence base pairing example 5' -AATGATACGGCGACCAC+CGAGA+TCTA+CACG+CGTA+AGATCG+TCGG+CAGCG+TCAGATG+TGTATAA+GAGACAG/3SpC3/ 32 BN006 TiS701 with an example of index sequence base pairing 5' - CAAGCAGAAGA+CGGCA+TACGAGATT+CGCCTTAG+TCT+CGTGGGC+TCGGAGA+TGTGTATAA+GAGACAG/3SpC3/ 33 BN007 TiBNK7 5' - AATGATACGGCGACCAC+CGAGA+TCT+ACA+C/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+TCG+TCG+GCA+GCG+TCAGATG+TGTATAA+GAGA+CAG/3SpC3/ 34 BN008 TiBNK8 5' - CAAGCAGAAGA+CGGCA+TACGAGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+GTC+TCG+TGGGC+TCGG+AGA+TGTG+TATAA+GAGA+CAG/3SpC3/ 35 BN009 TiZNK7 5' - AATGATACGGCGACCAC+CGAGA+TCT+ACA+C/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+TCG+TCG+GCA+GCG+TCAGATG+TGTATAA+GAGA+CAG/3SpC3/ 36 BN010 TiZNK8 5' - CAAGCAGAAGA+CGGCA+TACGAGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+GTC+TCG+TGGGC+TCGG+AGA+TGTG+TATAA+GAGA+CAG/3SpC3/ 37 BN011 TiBNK11 5' - AATGATACGGCGACCAC+CGAGA+TCT+ACA+C/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI//ideoxyI/+TCG+TCG+GCA+GCG+TCAGATG+TGTATAA+GAGA+CAG/3SpC3/ 38 BN012 TiBNK12 5' - CAAGCAGAAGA+CGGCA+TACGAGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/+GTC+TCG+TGGGC+TCGG+AGA +TGTG+TATAA+GAGA+CAG/3SpC3/ 39 BN013 TiBNK15G 5' - AATGATACGGCGACCAC+CGAGA+TCT+ACA+C/ideoxyI//ideoxyI//ideoxyI//ideoxyI/+G/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/+TCG+TCG+GCA+GCG+ TCAGATG+TGTA+TAA+GAGA+CAG/3SpC3/ 40 BN014 TiBNK16G 5' - CAAGCAGAAGA+CGGCA+TACGAGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI/+G/ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI/+GTC+TCG+TGGGC+TCGG+AGA+TGTG+TA+TAA+GAGA+CAG/3SpC3/ 41 BN015 TiBNK15N 5' - AATGATACGGCGACCAC+CGAGA+TCT+ACA+C/ideoxyI//ideoxyI//ideoxyI//ideoxyI/N/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/+TCG+TCG+GCA+GCG+TCAGATG +TGTA+TAA+GAGA+CAG/3SpC3/ 42 BN016 TiBNK16N 5' - CAAGCAGAAGA+CGGCA+TACGAGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI/N/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/+GTC+TCG+TGGGC+TCGG+AGA+TGTG +TA+TAA+GAGA+CAG/3SpC3/ 43 BN017 TiZNK11 5' - AATGATACGGCGACCAC+CGAGA+TCT+ACA+C/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI//ideoxyI/+TCG+TCG+GCA+GCG+TCAGATG+TGTATAA+GAGA+CAG/3SpC3/ 44 BN018 TiZNK12 5'- CAAGCAGAAGA+CGGCA+TACGAGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/+GTC+TCG+TGGGC+TCGG+AGA +TGTG+TATAA+GAGA+CAG/3SpC3/ 45 BN019 TiZNK15G 5'- AATGATACGGCGACCAC+CGAGA+TCT+ACA+C/ideoxyI//ideoxyI//ideoxyI//ideoxyI/+G/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/+TCG+TCG+GCA+GCG+ TCAGATG+TGTA+TAA+GAGA+CAG/3SpC3/ 46 BN020 TiZNK16G 5' - CAAGCAGAAGA+CGGCA+TACGAGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI/+G/ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI/+GTC+TCG+TGGGC+TCGG+AGA+TGTG+TA+TAA+GAGA+CAG/3SpC3/ 47 BN021 TiZNK15N 5' - AATGATACGGCGACCAC+CGAGA+TCT+ACA+C/ideoxyI//ideoxyI//ideoxyI//ideoxyI/N/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/+TCG+TCG+GCA+GCG+TCAGATG +TGTA+TAA+GAGA+CAG/3SpC3/ 48 BN022 TiZNK16N 5' - CAAGCAGAAGA+CGGCA+TACGAGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI/N/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/+GTC+TCG+TGGGC+TCGG+AGA+TGTG +TA+TAA+GAGA+CAG/3SpC3/ 49 BN023 P5ZNK 5' - AATGA+TAC+GGC+GAC+CAC+CGA+GAT+CTA+CAC/3SpC3/ 50 BN024 P7ZNK 5' - CAAGC+AGA+AGA+CGG+CAT+ACG+A+GA+T/3SpC3/ 51 BN025 TiZNKS1 5' - TCGTC+GGC+AGC+GTC+AGA+TGT+GTA+TAA+GAG+ACA+G/3SpC3/ 52 BN026 TiZNKS2 5' - GTCT+CGT+GGGC+TCG+GAG+ATG+TGT+ATAA+GAG+ACA+G/3SpC3/ 53 BN027 TiZNK17 5' - GGCGAC+CAC+CGAGA+TCT+ACA+C/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+TCG+TCG+GCA+GCG+TCA+GATG+TG/3SpC3/ 54 BN028 TiZNK18 5' - GGCA+TAC+GAGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+GTC+TCG+TGG+GC+TCGG+AGA+TGTG+TATAA+GAG/3SpC3/ 55 BN029 P5BNK-completely 5' - +A+A+T+G+A+T+A+C+G+G+C+G+A+C+C+A+C+C+G+A+G+A+T+ C+T+A+C+A+C/3SpC3/ 56 BN030 P7BNK-completely 5' - +C+A+A+G+C+A+G+A+A+G+A+C+G+G+C+A+T+A+C+G+A+G+A+ T/3SpC3/ 57 BN031 TiBNKS1-completely 5' - +T+C+G+T+C+G+G+C+A+G+C+G+T+C+A+G+A+T+G+T+G+T+A+ T+A+A+G+A+G+A+C+A+G/3SpC3/ 58 BN032 TiBNKS2-completely 5' - +G+T+C+T+C+G+T+G+G+G+C+T+C+G+G+A+G+A+T+G+T+G+T+ A+T+A+A+G+A+G+A+C+A+G/3SpC3/ 59 BN033 P5BNK-half 5' - AA+TG+AT+AC+GG+CG+AC+CA+CC+GA+GA+TC+TA+CA+C/3SpC3/ 60 BN034 P7BNK-half 5' - C+AA+GC+AG+AA+GA+CG+GC+AT+A+C+G+A+G+A+T/3SpC3/ 61 BN035 TiBNKS1-half 5' - TC+GT+CG+GC+AG+CG+TC+AG+AT+GT+GT+AT+AA+GA+GA+CA+G/3SpC3/ 62 BN036 TiBNKS2-half 5' - G+TC+TC+GT+GG+GC+TC+GG+AG+AT+GT+GT+AT+AA+GA+GA+CA+G/3SpC3/ 63 BN037 P5BNK-Alt 5' - A+AT+GA+TA+CG+GC+GA+CC+AC+CG+AG+AT+CT+AC+A+C/3SpC3/ 64 BN038 P7BNK-Alt 5' - +CA+AG+CA+GA+AG+AC+GG+CA+T+A+C+G+A+G+A+T/3SpC3/ 65 BN039 TiBNKS1-Alt 5' - T+CG+TC+GG+CA+GC+GT+CA+GA+TG+TG+TA+TA+AG+AG+AC+A+G/3SpC3/ 66 BN040 TiBNKS2-Alt 5' - +GT+CT+CG+TG+GG+CT+CG+GA+GA+TG+TG+TA+TA+AG+AG+AC+A+G/3SpC3/ 67 BN041 TiBNK3 5' - AATGATACGGCGACCACCCGAGA+TCTACACTTTTTTTTTCG+TCGG+CAGCG+TCAGATG+TGTATAA+GAGACAG/3ddC/ 68 BN042 TiBNK4 5' - 5'CAAGCAGAAGACGGCA+TACGAGATTTTTTTTTG+TCT+CGTGGGC+TCGGAGATG+TGTATAA+GAGACAG/3ddC/ 69 BN043 TiBNK1 5' - AATGATACGGCGACCACCGAGAT+CTACACTTTTTTTTT+CGTCGGCAGCGTCAGATGTGTATAAGAGA+CAG/3ddC/ 70 BN044 TiBNK2 5' - CAAGCAGAAGACGGCATACGAGATTTTTTTTTGT+CTCGTGGGCT+CGGAGATGTGTATAAGAGA+CAG/3ddC/

Table 2B - Exemplary Blocker Sequences

SEQ ID NO Reference No Oligonucleotide name Subsequence 71 BL001 Blocker 1 CT3 i7 5'- CAAGCAGAAGACGGCATACGAGATTTTTTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC/3ddC/ 72 BL002 Blocker 2 CT3 i5 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC/3ddC/ 73 BL003 TSLTZNK13 5'- AATGATACGGCGACCAC+CGA+GAT+CTA+CAC+TCT+TTC+CCT+ACA+CGA+CGC+TCT+TCC+GAT+C/3ddC/ 74 BL004 TSLTZNK14 5'- CAAGCAGAAGACGG+CAT+ACG+AGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+GTG+ACT+GGA+GTT+CAG+ACG+TGT+GCT+CTTCCG+ATC/3ddC/ 75 BL005 TSHTZNK13 5'- AATGATACGGCGACCAC+CGA+GAT+CTA+CAC/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
ACAC+TCT+TTC+CCT+ACA+CGA+CGC+TCT+TCC+GAT+C/3ddC/ 76 BL006 TSHTZNK14 5'- CAAGCAGAAGACGG+CAT+ACG+AGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+GTG+ACT+GGA+GTT+CAG+ACG+TGTGCT+CTT+CCG+ATC/3ddC/ 77 BL007 TSHTZNK15 5'- AATGATACGGCGACCAC+CGA+GAT+CTA+CAC/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI//ideoxyI/ACAC+TCT+TTC+CCT+ACA+CGA+CGC+TCT+TCC+GAT+C/3ddC/ 78 BL008 TSHTZNK16 5'- CAAGCAGAAGACGG+CAT+ACG+AGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI/+GTG+ACT+GGA+GTT+CAG+ACG+TGTGCT+CTT+CCG+ATC/3ddC/ 79 BL009 TSHTЗНК15G 5'- AATGATACGGCGACCAC+CGA+GAT+CTA+CAC/ideoxyI//ideoxyI//ideoxyI//ideoxyI/+G/ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI/ACAC+TCT+TTC+CCT+ACA+CGA+CGC+TCT+TCC+GAT+C/3ddC/ 80 BL010 TSHTЗНК16G 5'- CAAGCAGAAGACGG+CAT+ACG+AGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI/+G/ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI/+GTG+ACT+GGA+GTT+CAG+ACG+TGTGCT+CTT+CCG+ATC/3ddC/ 81 BL011 TSHTЗНК15N 5'- AATGATACGGCGACCAC+CGA+GAT+CTA+CAC/ideoxyI//ideoxyI//ideoxyI//ideoxyI/N/ideoxyI//ideoxyI//ideoxyI/
/ideoxyI//ideoxyI/ACAC+TCT+TTC+CCT+ACA+CGA+CGC+TCT+TCC+GAT+C/3ddC/ 82 BL012 TSHTЗНК16N 5'- CAAGCAGAAGACGG+CAT+ACG+AGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI/N/ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI/+GTG+ACT+GGA+GTT+CAG+ACG+TGTGCT+CTT+CCG+ATC/3ddC/ 83 BL013 TSLTBNK13 5'- AATGATACGGCGACCAC+CGA+GAT+CTA+CAC+TCT+TTC+CCT+ACA+CGA+CGC+TCT+TCC+GAT+C/3ddC/ 84 BL014 TSLTBNK14 5'- CAAGCAGAAGACGG+CAT+ACG+AGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+GTG+ACT+GGA+GTT+CAG+ACG+TGTGCT+CTT+CCG+ATC/3ddC/ 85 BL015 TSHTBNK13 5'- AATGATACGGCGACCAC+CGA+GAT+CTA+CAC/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI/ACAC+TCT+TTC+CCT+ACA+CGA+CGC+TCT+TCC+GAT+C/3ddC/ 86 BL016 TSHTBNK14 5'- CAAGCAGAAGACGG+CAT+ACG+AGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+GTG+ACT+GGA+GTT+CAG+ACG+TGTGCT+CTT+CCG+ATC/3ddC/ 87 BL017 TSHTBNK15 5'- AATGATACGGCGACCAC+CGA+GAT+CTA+CAC/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI//ideoxyI//ideoxyI/ACAC+TCT+TTC+CCT+ACA+CGA+CGC+TCT+TCC+GAT+C/3ddC/ 88 BL018 TSHTBNK16 5'- CAAGCAGAAGACGG+CAT+ACG+AGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
/ideoxyI//ideoxyI/+GTG+ACT+GGA+GTT+CAG+ACG+TGTGCT+CTT+CCG+ATC/3ddC/

Table 2C - Exemplary Blocker Sequences

SEQ ID NO Reference No Oligonucleotide name Subsequence 89 BX001 NEXTERA blocker 1_2X 5' - AATGATAXGGCGACCACCGAGATCTACACTTTTTTTTTCGTCGGCAGCGTCAGATGTGTATAAGAGAxAG/3ddC/ 90 BX002 NEXTERA blocker 1_3X 5' - AATGATAXGGCGACCACCGAGATXTACACTTTTTTTTTCGTCGGCAGCGTCAGATGTGTATAAGAGAXAG/3ddC/ 91 BX003 NEXTERA blocker 1_2Xalt 5' - AATGATACGGCGACCACCGAGATXTACACTTTTTTTTTCGTCGGCAGCGTCAGATGTGTATAAGAGAxAG/3ddC/ 92 BX004 NEXTERA blocker 1_3Xalt 5' - AATGATACGGCGACCACCGAGATXTACACTTTTTTTTTTXGTCGGCAGCGTCAGATGTGTATAAGAGAxAG/3ddC/ 93 BX005 NEXTERA blocker 2_2X 5' - CAAGXAGAAGACGGCATACGAGATTTTTTTTTGTCTCGTGGGCTCGGAGATGTGTATAAGAGAXAG/3ddC/ 94 BX006 NEXTERA blocker 2_3X 5' - CAAGXAGAAGACGGCATAXGAGATTTTTTTTTGTCTCGTGGGCTCGGAGATGTGTATAAGAGAXAG/3ddC/ 95 BX007 NEXTERA blocker 2_2Xalt 5' - CAAGCAGAAGACGGCATACGAGATTTTTTTTTGTXTCGTGGGCTCGGAGATGTGTATAAGAGAXAG/3ddC/ 96 BX008 NEXTERA blocker 2_3Xalt 5' - CAAGCAGAAGACGGCATACGAGATTTTTTTTTGTXTCGTGGGCTXGGGAGATGTGTATAAGAGAXAG/3ddC/ 97 BX009 NEXTERA blocker 1_5X4Y 5' - AATGATAXGGCGAXCACCGAGATXTACACTTTTTTTTTCGTCGGXAGCGTCAGAYGYGYAYAAGAGAXAG/3ddC/-3' 98 BX010 NEXTERA blocker 2_5X4Y 5' - CAAGXAGAAGAXGGCATAXGAGATTTTTTTTTGTCTCGTGGGXTCGGAGAYGYGYAYAAGAGAXAG/3ddC/-3' 99 BX011 NEXTERA blocker 1_5X4Y-external 5' - AATGATAXGGCGAXCACCGAGATXTACAC 100 BX012 NEXTERA blocker 1_5X4Y-internal 5' - TCGTCGGXAGCGTCAGAYGYGYAYAAGAGAXAG/3ddC/-3' 101 BX013 NEXTERA blocker 2_5X4Y-external 5' - CAAGXAGAAGAXGGCATAXGAGAT 102 BX014 NEXTERA blocker2_5X4Y-internal 5' - GTCTCGTGGGXTCGGAGAYGYGYAYAAGAGAXAG/3ddC/-3'

Table 2D

Thymine bases at index position in oligonucleotides (8 nucleotides) TTTTTTTT (SEQ ID NO: 103) /ideoxyI/ 2'-deoxyinosine /3ddC/ 2',3'-dideoxycytosine /3SpC3/ 3' spacer C3 LNA- or BNA-modified base (as indicated in the “Oligonucleotide Name” column of Table 2A) +A +C +T or +G AP-dC-CE-phosphoramidite X 2'-Ome-U-CE-phosphoramidite Y

Blocker with thymine

[0081] In some embodiments, the blocker may include at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases in a blocker region corresponding to the index region of the adapter and/or UMI of the adapter (eg, a blocker region that binds to the index region and/or UMI of the adapter).

[0082] In some embodiments, the blocker region corresponding to the adapter index region and/or UMI of the adapter (eg, which binds to the adapter index region and/or UMI) includes as many thymine bases as the number of bases in the adapter index region and/or or UMI adapter.

[0083] In some embodiments, the blocker includes at least one sequence from Table 2A, Table 2B, Table 2C, or Table 3. Some exemplary embodiments of such a blocker are described in Example 2.

Blocker with universal bases and at least one non-universal base

[0084] In some embodiments, the blocker may include universal bases and at least one non-universal base in the blocker region corresponding to the index region. As used herein, a "universal base" is a modified nucleic acid base that hybridizes to at least two of the common bases (e.g., deoxyadenosine (A), deoxythymidine (T), deoxycytidine (C), deoxyguanosine (G), and uridine (U) )). In some embodiments, the universal base hybridizes with any of the common bases. As used herein, a "non-universal base" is a nucleobase (including, in some embodiments, a modified nucleobase) that hybridizes only in a traditional Watson-Crick base pair interaction (e.g., deoxyadenosine (A)-deoxythymidine (T) or deoxyguanosine (G) - deoxycytidine (C)).

[0085] In some embodiments, at least one non-universal base may be included in every third base of the blocker sequence corresponding to the index region. In some embodiments, at least one non-universal base may be located in the third and/or fifth positions (from the 5' end) of the blocker sequence corresponding to the index region. In some embodiments, at least one non-universal base may be located in the second and/or fourth positions of the blocker sequence corresponding to the index region. In some embodiments, the at least one non-universal base includes a modified guanine. In some embodiments, the modified guanine may be LNA-modified or BNK-modified. In some embodiments, the at least one non-universal base includes a random (A, T, G, or C) nucleotide.

[0086] Without intending to be bound by theory, it is believed that the inclusion of a modified guanine or random nucleotide, in addition to the universal bases in the blocker region corresponding to the index region (as shown in one embodiment in FIG. 5), improves the affinity of the blocker for the member libraries. Some illustrative embodiments of such a blocker are described in Example 3.

[0087] The universal base may include any known universal base. In some embodiments, the universal base used in the index region may include, for example, 2'-deoxyinosine, 2'-deoxynebularine, 3-nitropyrrole-2'-deoxynucleoside, or 5-nitroindole-2'-deoxynucleoside. In some embodiments, a combination of universal bases can be used in the index region.

[0088] The modified guanine may be guanine modified in any suitable manner, including, for example, LNA-modified guanine, NBR-modified guanine, etc. In some embodiments, the modified guanine is preferably an LNA-modified guanine.

[0089] In some embodiments, the blocker includes at least one sequence from Table 2A, Table 2B, Table 2C, or Table 4.

Split blockers

[0090] In some embodiments, the blocker may include at least two unbound oligonucleotides, where the unbound oligonucleotides include bases that do not match the index region and/or UMI of the adapter (e.g., include bases that do not bind the index region and/or UMI of the adapter ), or include bases that only partially correspond to the index region and/or UMI of the adapter (eg, include bases that associate only with part of the index region and/or UMI of the adapter). In some embodiments, the blocker includes four unlinked oligonucleotides.

[0091] In some embodiments, at least two unrelated oligonucleotides hybridize to the same strand of the target sequence. In some embodiments, at least a portion of the blocker corresponds to the 5' end of the adapter and at least a portion of the blocker corresponds to the 3' end of the same adapter. In some embodiments, including, for example, the case where the blocker includes four unlinked oligonucleotides, two unlinked oligonucleotides can hybridize to the same strand of a first target sequence, and two unlinked oligonucleotides can hybridize to the same strand of a second target sequence . Exemplary embodiments of such blockers are shown in FIG. 3E-FIG. 3I and FIG. 6A, and are described in Examples 4, 8 and 9.

[0092] In some embodiments, at least a portion of the blocker corresponds to a universal extension primer. In some embodiments, at least a portion of the blocker corresponds to P5, P7, P5' and/or P7'. In some embodiments, at least a portion of the blocker corresponds to V2.A14.METS, V2.B15.METS, a sequence complementary to V2.A14.METS, and/or a sequence complementary to V2.B15.METS.

[0093] In some embodiments, the blocker may include the same number of bases as the adapter, excluding the portion of the adapter containing the index region and/or UMI bases of the adapter. In some embodiments, the blocker may include one base less, two bases less, three bases less, four bases less, or five bases less than the number of bases comprising part of the adapter, excluding the index region and/or UMI bases of the adapter.

[0094] In some embodiments, a blocker comprising more bases may be preferred including, for example, the case where increased enrichment efficiency is desired. In some embodiments, a blocker comprising fewer bases may be preferred, including, for example, where blocker cost, purity, and/or synthesis yield are a factor.

[0095] In some embodiments, at most five blocker bases, at most four blocker bases, at most three blocker bases, at most two blocker bases, only one blocker base, or no blocker bases may be paired with the adapter index region and/or UMI adapter.

[0096] In some embodiments, the blocker includes at least one sequence (or portion of a sequence) from Table 2A, Table 2B, Table 2C, or Table 5. In some embodiments, the blocker includes at least one of BN023, BN024, BN025 and BN026 from Table 2A. In some embodiments, the blocker includes BN023 and BN025 from Table 2A. In some embodiments, the blocker includes BN024 and BN026 from Table 2A.

Hybridization Buffer

[0097] In another aspect, the present invention relates to a hybridization buffer including a crowding agent and methods of using this hybridization buffer. As used herein, a “crowding agent” includes a compound that allows, enhances or alleviates molecular crowding. In some embodiments, the crowding effect agent includes an inert macromolecule used at a concentration that alters the DNA-protein interaction. “Hybridization buffer” is defined as any buffer in which a nucleotide-probe hybrid can be formed as part of a hybrid binding assay.

[0098] In some embodiments, the crowding agent may include at least one of dextran, dextran sulfate, polyethylene glycol (PEG), Ficoll, glycerin, betaine, etc. Dextran and dextran sulfate may include high molecular weight dextran (eg, dextran having a molecular weight of at least 500,000 Da) and/or low molecular weight dextran (eg, dextran having a molecular weight of at most 10,000 Da, at most 50,000 Da, or at most 100,000 Da). In some embodiments, the crowding agent preferably includes dextran sulfate.

[0099] In some embodiments, the crowding agent may be included in the hybridization buffer in an amount of at least 0.5% weight/volume (w/v), at least 1% (w/v) .), at least 1.5% (w/v), at least 2% (w/v), at least 3% (w/v) or at least 4% ( w/v). In some embodiments, the crowding agent may be included in the hybridization buffer in an amount of at most 1% (w/v), at most 1.5% (w/v), at most 2% ( w/v), at most 3% (w/v), at most 4% (w/v), at most 5% (w/v), at most 6% (w/v). /vol.), at most 8% (wt./vol.) or at most 10% (wt./vol.).

[00100] As described in some embodiments in Example 5 (see, e.g., FIGS. 7D-7F), inclusion of a crowding agent (e.g., dextran sulfate) in the hybridization buffer may, in some embodiments, allow reduced hybridization time and/or hybridization at higher volumes (eg, higher dilution of target oligonucleotide) of hybridization buffer than hybridization buffer in the absence of a crowding agent. For example, inclusion of dextran sulfate in the hybridization buffer may be capable of reducing the hybridization time from overnight to approximately 80 minutes at one temperature or 60 minutes with an additional temperature ramping step.

[00101] In some embodiments, inclusion of a crowding agent may improve enrichment specificity. For example, one embodiment is shown in Example 5 (see FIG. 8A), where enrichment specificity was increased from 45% to 80-95%. In some embodiments, the improvement in enrichment specificity due to the inclusion of a crowding effect agent may be more pronounced with shorter incubation times.

[00102] In some embodiments, the inclusion of a crowding agent in the hybridization buffer allows the enrichment reaction to proceed more quickly at a lower concentration of DNA (including, for example, in a larger relative volume of the hybridization buffer). This increase can be used to facilitate “volume pooling” and/or eliminate the sample concentration step. In general, to achieve a rapid hybridization reaction, it is necessary to use a high concentration of DNA obtained from a library preparation and a high concentration of probes and thus, in some embodiments, a correspondingly small volume of hybridization buffer (eg, less than 20 μl). Achieving such a small volume requires a sample concentration step after library preparation (which increases the time and cost of the overall analysis). With the inclusion of a crowding agent in the hybridization buffer, enrichment reactions can be achieved more quickly, at a lower DNA concentration and/or probe concentration (and, in some embodiments, at a higher volume). In some embodiments, the inclusion of a crowding agent in the hybridization buffer allows the combination of multiple library drug samples without the need for a concentration step prior to hybridization. In some embodiments, samples obtained from different library preparations can be pooled by volume, as further described herein, allowing multiplex enrichment. The “multiplicity” or “plexity” of a given multiplex enrichment refers to the number of different library drugs that are combined prior to enrichment (e.g., hybridization and binding). In some embodiments, the multiplex enrichment multiplicity may be at most 2-plex, at most 4-plex, at most 6-plex, at most 12-plex, at most 24-plex, at most 48-plex, at most 96-plex. plex, or higher.

[00103] In some embodiments, the hybridization buffer including a crowding agent further includes at least one of human Cot-1 DNA, a destabilizer, a salt, and a blocker. In some embodiments, the hybridization buffer components, such as Cot-1 DNA and blocker, are kept separate from the hybridization buffer components, including the destabilizer and the crowding agent, until the hybridization reaction is performed.

[00104] In some embodiments, the hybridization buffer may include human Cot-1 DNA in an amount of at least 0.05 mg/ml, at least 0.1 mg/ml, at least 0.2 mg/ml, or at least 0.3 mg/ml. In some embodiments, the hybridization buffer may include human Cot-1 DNA in an amount of at most 0.1 mg/ml, at most 0.2 mg/ml, at most 0.3 mg/ml, or at most 0.5 mg/ml. In some embodiments, the hybridization buffer may preferably include human Cot-1 DNA in an amount of 0.2 mg/ml.

[00105] In some embodiments, the hybridization buffer may include a destabilizer. In some embodiments, the destabilizer may include formamide and/or urea. In some embodiments, the hybridization buffer may include at least 1% (v:v), at least 5% (v:v), or at least 10% (v:v) formamide. In some embodiments, the hybridization buffer may include at most 5% (v:v), at most 10% (v:v), or at most 15% (v:v) formamide. In some embodiments, the hybridization buffer may include at least 1 M urea, at least 2 M urea, or at least 4 M urea. In some embodiments, the hybridization buffer may include at most 2 M urea, at most 4 M urea, or at most 6 M urea. In some embodiments, the hybridization buffer may preferably include 10% formamide.

[00106] In some embodiments, the hybridization buffer may include a buffer. Any suitable buffer can be used. In some embodiments, the buffer may include a phosphate, including, for example, potassium phosphate or sodium phosphate; Tris-HCl; piperazine-N, N′-bis(2-ethanesulfonic acid) (PIPES); piperazine-N,N'- bis (3-propanesulfonic acid) (PIPPS); 2-(N-morpholino)ethanesulfonic acid (MES); (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (HEPES), etc. In some embodiments, the hybridization buffer may include at least 40 mM, at least 50 mM, at least 55 mM, at least 60 mM, at least 65 mM, or at least 70 mM phosphate. In some embodiments, the hybridization buffer may include at most 50 mM, at most 55 mM, at most 60 mM, at most 65 mM, at most 70 mM, at most 75 mM, or at most 80 mM phosphate. In some embodiments, the phosphate-containing buffer may include monobasic dihydrogen phosphate and/or dibasic monohydrogen phosphate. In some embodiments, the phosphate buffer may include KH ₂ PO ₄ - K ₂ HPO. In some embodiments, the hybridization buffer may preferably include 66.6 mM KH ₂ PO ₄ - K ₂ HPO ₄ .

[00107] In some embodiments, the hybridization buffer may include a salt. Any suitable salt may be included. In some embodiments, the salt may be, for example, NaCl, or sodium citrate (eg, trisodium citrate), etc. In some embodiments, the hybridization buffer may include at least 0.1 M, at least 0.2 M, at least 0.3 M, at least 0.4 M, at least 0.5 M, at least 0.6 M, at least 0.7 M, at least 0.8 M, at least 0.9 M or at least 1 M salt. In some embodiments, the hybridization buffer may include at most 0.2 M, at most 0.3 M, at most 0.4 M, at most 0.5 M, at most 0.6 M, at most 0.7 M, at most 0.8 M, at most 0.9 M, at most 1 M, at most 2 M, at most 3 M or at most 4 M salt. In some embodiments, the hybridization buffer may preferably include 0.8 M NaCl.

[00108] In some embodiments, the hybridization buffer may include a detergent, including, for example, an anionic detergent (e.g., sodium dodecyl sulfate, a sulfonic acid salt, an alcohol sulfate, an alkyl benzene sulfonate, a phosphoric ester, or a carboxylic acid salt), a nonionic detergent (for example, , polyoxyethylene or glycosidic detergent such as Tween, Triton or Brij detergent), cationic detergent (eg cationic quaternary ammonium surfactant) or zwitterionic detergent (eg CHAPS). In some embodiments, the detergent is an anionic detergent. In some embodiments, the detergent is a nonionic detergent. In some embodiments, the detergent is TWEEN 20, TWEEN 80, sodium dodecyl sulfate (SDS), etc. In some embodiments, the detergent may be at least 0.001% volume/volume (v/v), at least 0.01% (v/v), at least 0.05% (v/v). v/v), at least 0.1% (v/v), at least 1% (v/v), or at least 5% (v/v) hybridization buffer. In some embodiments, the detergent may be at most 0.01% (v/v), at most 0.05% (v/v), at most 0.1% (v/v), at most 1% (v/v), at most 5% (v/v) or at most 10% (v/v) hybridization buffer. In some embodiments, the hybridization buffer may preferably include 0.04% (v/v) TWEEN 20.

[00109] For example, in some embodiments, the hybridization buffer may include 0.5% - 10% dextran sulfate, 0.05 mg/ml - 0.5 mg/ml human Cot-1 DNA, 1% - 15% (vol ./vol.) formamide, 40 mM - 80 mM KH ₂ PO ₄ - K ₂ HPO ₄ , 0.1 M - 4 M NaCl, and 0.001% - 10% (v/v) Tween 20. In some embodiments implementation, the hybridization buffer may include (eg, in the final reaction) 1.5% dextran sulfate, 0.2 mg/ml Cot-1, 10% (v/v) formamide, 66.6 mM KH ₂ PO ₄ - K ₂ HPO ₄ , 0.8 M NaCl and 0.04% (v/v) TWEEN 20.

[00110] In some embodiments, the hybridization buffer may include a blocker. In some embodiments, the blocker is as described elsewhere herein. In some embodiments, the blocker is present at a concentration of at least 0.001 mM, at least 0.005 mM, at least 0.01 mM, at least 0.05 mM, or at least 0.1 mM. In some embodiments, the blocker is present at a concentration of at most 0.01 mM, at most 0.05 mM, at most 0.1 mM, at most 0.2 mM, or at most 0.5 mM.

[00111] In another aspect, the present invention provides a kit that includes a hybridization buffer, for example, as described herein. In one embodiment, the kit further includes at least one of a blocker and a probe. In embodiments, the components are presented in separate containers. For example, a hybridization buffer may be provided in a first container and another component, such as a blocker or probe, may be provided in another container(s). In some embodiments, the blocker and/or probe are as described elsewhere herein.

Hybrid binding

[00112] In a further aspect, the present invention relates to a hybrid coupling method. In some embodiments, the method includes steps including hybridizing probes to library members and binding the probes. In some embodiments, the method further includes pooling the libraries prior to probe hybridization. In some embodiments, the method further includes amplifying the associated sequences after binding. In some embodiments, the method can be used in combination with a blocking oligonucleotide, as described herein. In some embodiments, the method may include using a hybridization buffer including a crowding agent as described herein.

Library pooling

[00113] In some embodiments, samples obtained from different library preparations are combined prior to hybridization. In some embodiments, each library to be combined preferably includes sequences with index regions that can be distinguished from sequence index regions in any other library to be combined.

[00114] In some embodiments, samples obtained from different library preparations can be pooled by volume, allowing multiplex enrichment. The “multiplicity” or “plexity” of a given multiplex enrichment refers to the number of different library drugs that are combined prior to enrichment (e.g., hybridization and binding). In some embodiments, the multiplex enrichment multiplicity may be at most 2-plex, at most 4-plex, at most 6-plex, at most 12-plex, at most 24-plex, at most 48-plex, at most 96-plex. plex or higher.

[00115] In some embodiments, the sample obtained from the library preparation is obtained by a tagmentation reaction. See , for example, US Patent No. 9574226. In some embodiments, the sample obtained from the library preparation is obtained from the NEXTERA library preparation (Illumina, Inc., San Diego, CA). In some embodiments, the library drug can be added directly to the hybridization reaction.

[00116] In some embodiments, the DNA concentration of each sample obtained from the library preparation subject to pooling may be at least 0.1 ng/μl, at least 0.3 ng/μl, at least 0.4 ng /µl, at least 0.5 ng/µl, at least 1 ng/µl, at least 2 ng/µl, at least 4 ng/µl, at least 6 ng/µl, at least 8 ng /µl, at least 10 ng/µl, at least 12 ng/µl, at least 20 ng/µl, at least 50 ng/µl, at least 60 ng/µl, at least 100 ng/µl or at least 200 ng/μl. In some embodiments, the DNA concentration of each sample obtained from the library preparation being pooled may be at most 0.4 ng/μL, at most 0.5 ng/μL, at most 1 ng/μL, at most 2 ng/μL µL, at most 4 ng/µL, at most 6 ng/µL, at most 8 ng/µL, at most 10 ng/µL, at most 12 ng/µL, at most 15 ng/µL, at most 20 ng/µL , at most 50 ng/μL, at most 100 ng/μL, at most 120 ng/μL, at most 200 ng/μL, at most 300 ng/μL, or at most 400 ng/μL. For example, in some embodiments, the DNA concentration of each sample obtained from a library preparation may be in the range of 0.3 ng/μl - 400 ng/μl. For example, in some embodiments, the DNA concentration of each sample obtained from a library preparation may be in the range of 0.1 ng/μl - 120 ng/μl. For example, in some embodiments, the DNA concentration of a combination of samples obtained from library preparations may range from 0.1 ng/μL to 120 ng/μL (eg, in 100 μL). For example, in some embodiments, the DNA concentration of each sample obtained from a library preparation may be in the range of 0.5 ng/μl - 12 ng/μl. In some embodiments, the DNA concentration of the combination of samples obtained from library preparations may be in the range of 0.5 ng/μl - 12 ng/μl (eg, in 100 μl). For example, in some embodiments, the DNA concentration of each sample obtained from a library preparation may be in the range of 0.5 ng/μl - 120 ng/μl. In some embodiments, the DNA concentration of the combination of samples obtained from library preparations may be in the range of 0.5 ng/μl - 120 ng/μl (eg, in 100 μl).

[00117] In some embodiments, at least 1 μL, at least 2 μL, at least 3 μL, at least 5 μL, at least 10 μL, at least 15 μL, at least 20 µl or at least 25 µl of each sample obtained from the library preparation. In some embodiments, at most 2 μL, at most 3 μL, at most 5 μL, at most 10 μL, at most 15 μL, at most 20 μL, at most 25 μL, at most 30 μL, at most 40 μL can be combined. or at most 50 µl of each sample obtained from the library preparation.

[00118] In some embodiments, at least 10 ng, at least 15 ng, at least 25 ng, at least 50 ng, at least 100 ng, at least 200 ng, at least 500 can be combined ng, at least 1000 ng, or at least 5000 ng of DNA from each library preparation. In some embodiments, at most 15 ng, at most 25 ng, at most 50 ng, at most 100 ng, at most 200 ng, at most 500 ng, at most 1000 ng, at most 5000 ng, at most 10000 can be combined ng or at most 12,000 ng of DNA from each library preparation. For example, in some embodiments, 10 ng to 12,000 ng of DNA from each library preparation may be pooled.

Probe hybridization

[00119] In some aspects, the hybrid binding method includes bringing a library into contact with a probe, where the probe hybridizes to a region of interest in the library member. The region of interest is separate from the adapter region and includes the genomic material of interest. The probe includes a ligand that allows subsequent binding of the probe. In some embodiments, the ligand preferably includes a biotin moiety.

[00120] The library is brought into contact with a probe in the presence of a hybridization buffer. In some embodiments, the hybridization buffer may include a crowding agent as described herein. In some embodiments, the hybridization buffer may include a blocker, as described herein.

[00121] In some embodiments, the hybrid coupling method includes a thermal denaturation step. For example, a hybridization mixture comprising library members, blockers, and a probe in a hybridization buffer can be heated to at least 90°C, at least 92°C, or at least 95°C. In some embodiments, the hybridization mixture can be heated to at most 92°C, at most 95°C, at most 97°C, or at most 100°C. In some embodiments, the hybridization mixture preferably further includes Cot-1 DNA. In some embodiments, the hybridization buffer may include a blocker prior to addition to the hybridization mixture; in some embodiments, the blocker can be added to the hybridization mixture independently of the hybridization buffer.

[00122] In some embodiments, the DNA concentration in the hybridization mixture (e.g., final hybridization reaction) may be at least 0.1 ng/μl, at least 0.3 ng/μl, at least 0.4 ng /µl, at least 0.5 ng/µl, at least 1 ng/µl, at least 2 ng/µl, at least 4 ng/µl, at least 6 ng/µl, at least 8 ng /µl, at least 10 ng/µl, at least 12 ng/µl, at least 15 ng/µl, at least 20 ng/µl, at least 50 ng/µl, at least 75 ng/µl , at least 100 ng/μl, at least 120 ng/μl, at least 150 ng/μl, at least 200 ng/μl. In some embodiments, the DNA concentration in the hybridization mixture (e.g., final hybridization reaction) may be at most 0.3 ng/μL, at most 0.4 ng/μL, at most 0.5 ng/μL, at most 1 ng/µL, at most 2 ng/µL, at most 4 ng/µL, at most 6 ng/µL, at most 8 ng/µL, at most 10 ng/µL, at most 12 ng/µL, at most 15 ng /µl, at most 20 ng/µl, at most 50 ng/µl, at most 75 ng/µl, at most 100 ng/µl, at most 120 ng/µl, at most 150 ng/µl, at most 200 ng/ µl or at most 500 ng/µl. For example, in some embodiments, the concentration of DNA in the hybridization mixture (eg, the final hybridization reaction) may be in the range of 0.1 ng/μl - 120 ng/μl.

[00123] In some embodiments, the method may include using a hybridization mixture volume of at most 150 μL, at most 140 μL, at most 130 μL, at most 120 μL, at most 110 μL, at most 100 μL, at most 90 μL , at most 80 µl, at most 70 µl, at most 60 µl or at most 50 µl. In some embodiments, the method may include using a volume of the hybridization mixture of at least 10 μl, at least 20 μl, at least 30 μl, at least 40 μl, at least 50 μl, at least 60 μl, or at least 70 µl

[00124] In some embodiments, the hybridization mixture can be heated at a rate of at least 1°C/minute, at least 1.5°C/minute, at least 2°C/minute, at least 2.5 °C/minute, at least 3°C/minute or at least 5°C/minute. In some embodiments, the hybridization mixture can be heated at a rate of at most 1.5°C/minute, at most 2°C/minute, at most 2.5°C/minute, at most 3°C/minute, at most 5°C/minute or at most 10°C/minute. In some embodiments, the hybridization mixture can be maintained at the thermal denaturation temperature for at least 1 minute, at least 2 minutes, at least 5 minutes, at least 10 minutes, or at least 20 minutes. In some embodiments, the hybridization mixture may be maintained at the thermal denaturation temperature for at most 2 minutes, at most 5 minutes, at most 10 minutes, at most 20 minutes, or longer.

[00125] After the thermal denaturation step, the hybrid coupling method involves cooling the hybridization mixture. As the hybridization mixture cools from the temperature of the thermal denaturation step to the hybridization temperature, probe:target hybrids (ie, probe:library member hybrids) can form.

[00126] In some embodiments, the hybridization temperature may be at least 50°C, at least 55°C, at least 56°C, at least 57°C, at least 58°C, at least 59°C, at least 60°C, at least 61°C, at least 62°C, at least 63°C, at least 64°C, at least 65°C or at least 70 °C. In some embodiments, the hybridization temperature may be at most 56°C, at most 58°C, at most 60°C, at most 61°C, at most 62°C, at most 63°C, at most 64°C , at most 65°C or at most 70°C. In some embodiments, hybridization may involve a linear decrease in temperature from the denaturation temperature to the hybridization temperature. In some embodiments, the temperature ramp may include a rate of at least -5°C/minute, at least -2°C/minute, at least -1°C/minute, at least -0.5°C /minute or at least -0.2°C/minute.

[00127] In some embodiments, the method may include maintaining the library in contact with the probe and/or maintaining the hybridization mixture at the hybridization temperature for at most 3 days, at most 2 days, at most 24 hours, at most 20 hours, at most at most 16 hours, at most 12 hours, at most 6 hours, at most 3 hours, at most 2 hours, at most 90 minutes, at most 1 hour or at most 30 minutes. In some embodiments, the method may include maintaining the library in contact with the probe and/or maintaining the hybridization mixture at the hybridization temperature for at least 30 minutes, at least 45 minutes, at least 1 hour, at least 90 minutes, at least 2 hours, at least 3 hours, at least 6 hours, at least 12 hours, at least 16 hours, at least 20 hours or at least 24 hours. In some embodiments, including the case where the blocker T _m is higher than the adapter T _m , blocker:adapter hybrids may be formed before the adapter:adapter hybrids are formed, thereby preventing the formation of daisy chains or concatenation of adapter:adapter hybrids.

Binding

[00128] In some aspects, the hybrid binding method includes binding a probe after it has hybridized to a library member using binding means. The probe can be coupled by any suitable means. For example, when the probe includes a biotin group, the probe can be coupled using a streptavidin bead, including, for example, a streptavidin-coated magnetic bead. In some embodiments, the probe may include FITC, and the binding means may include an anti-FITC antibody. In some embodiments, the probe may include a hapten, and the binding means may include a molecule (eg, an antibody) that binds the hapten. Other coupling means may be used, such as isotachophoresis, size exclusion chromatography, liquid chromatography, magnetic means, and the like.

[00129] In some embodiments, including for example the case where the coupling agents include a streptavidin-coated bead, the method may include preparing a coupling mixture comprising a probe (including, for example, a probe:target hybrid) and coupling agents.

[00130] In some embodiments, the method may include maintaining the binding mixture at the binding temperature. In some embodiments, the binding temperature may be at least 50°C, at least 55°C, at least 56°C, at least 57°C, at least 58°C, at least 59°C , at least 60°C, at least 61°C, at least 62°C, at least 63°C, at least 64°C, at least 65°C or at least 70°C. In some embodiments, the binding temperature may be at most 56°C, at most 58°C, at most 60°C, at most 61°C, at most 62°C, at most 63°C, at most 64°C , at most 65°C or at most 70°C. In some embodiments, the binding mixture can be maintained at the binding temperature for at least 2 minutes, at least 5 minutes, at least 10 minutes, or at least 15 minutes. In some embodiments, the binding mixture can be maintained at the binding temperature for at most 5 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 30 minutes, at most 45 minutes, or longer. In some embodiments, and/or shake-stir may be added every 5 or 10 minutes.

[00131] In some embodiments, the method may further include washing the associated probe (the associated probe may include, for example, a probe:target hybrid and/or associated library members). In some embodiments, the associated probe may be washed at least once, at least twice, at least three times, or more. In some embodiments, the associated probe may be washed at most once, at most twice, at most three times, or at most five times.

[00132] In some embodiments, washing bound library members may involve heating the bound probe in wash buffer to wash temperature. In some embodiments, the wash buffer may include a detergent. Any suitable buffer may be used, including, for example, Tris-HCl; piperazine-N, N′-bis(2-ethanesulfonic acid) (PIPES); piperazine-N,N'- bis (3-propanesulfonic acid) (PIPPS); 2-(N-morpholino)ethanesulfonic acid (MES); (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (HEPES), etc. Any suitable detergent may be used, including, for example, TWEEN 20, TWEEN 80, sodium dodecyl sulfate (SDS), etc. In some embodiments, the wash buffer may include a compound designed to reduce secondary structure formation in GC-rich regions, including, for example, betaine. In some embodiments, the wash buffer may include an iron chelating agent, including, for example, deferoxamine mesylate, EGTA, EDTA, etc.

[00133] The wash temperature may be at least 20°C, at least 23°C, at least 25°C, at least 30°C, at least 35°C, at least 40°C, according to at least 45°C, at least 50°C, at least 55°C, at least 56°C, at least 57°C, at least 58°C, at least 59°C, at least at least 60°C, at least 61°C, at least 62°C, at least 63°C, at least 64°C, at least 65°C or at least 70°C. In some embodiments, the wash temperature may be at most 30°C, at most 35°C, at most 40°C, at most 45°C, at most 50°C, at most 55°C, at most 56°C , at most 60°C, at most 61°C, at most 62°C, at most 63°C, at most 64°C, at most 65°C or at most 70°C.

[00134] In some embodiments, the method may further include eluting bound library members from the coupling means and/or the probe. For example, bound library members can be eluted from a streptavidin bead and/or a biotinylated probe. In embodiments where the streptavidin bead includes a magnetic streptavidin bead, elution may involve the use of a magnet. In some embodiments, elution may involve the use of a strong base, including, for example, NaOH, KOH, Ca(OH) ₂ , etc.

[00135] In some embodiments, solid carriers can be used as coupling agents, including, for example, solid carriers containing streptavidin. In some embodiments, the coupling agents may be washed under progressively stringent conditions at a temperature below the estimated probe:target T _m value and/or above the adapter T _m value.

[00136] In some embodiments, bound library members can be eluted from a ligand (eg, eluted from a biotinylated probe) or coupling agents (eg, eluted from a streptavidin bead) and introduced directly into the flow cell.

[00137] In some embodiments, at least 60 femtomoles, at least 80 femtomoles, at least 90 femtomoles, at least 100 femtomoles, or at least 150 femtomoles of DNA can be eluted. In some embodiments, at most 150 femtomoles, at most 500 femtomoles, at most 1 picomole, at most 2 picomoles, or at most 3 picomoles of DNA can be eluted. For example, in some embodiments, 100 femtomoles to 2 picomoles of DNA can be eluted.

[00138] In some embodiments, eluted library members can be introduced into the flow cell in a volume of less than 100 μL, in a volume of less than 90 μL, in a volume of less than 80 μL, in a volume of less than 70 μL, or in a volume of less than 60 µl In some embodiments, bound library members can be introduced into the flow cell in a volume of approximately 55 μl.

[00139] In some embodiments, after elution, the eluant may have a DNA concentration of at least 1.1 picomolar (pM), at least 1.2 pM, at least 1.3 pM, at least 10 pM, or at least 100 pM. In some embodiments, the eluant may have a DNA concentration of at most 100 pM, at most 200 pM, at most 250 pM, or at most 300 pM. For example, in some embodiments, the eluant may have a DNA concentration in the range of 1.3 pM - 250 pM. In some embodiments, the eluant can be added to the flow cell without further dilution and/or without changing the DNA concentration.

Amplification

[00140] In another aspect, the present invention relates to a method that includes amplifying library members using PCR after hybrid linking, but before sequencing the linked library members. Alternatively, the present invention provides a method that does not include subjecting the linked library member to post-hybrid linkage amplification conditions before sequencing the library members (eg, does not involve subjecting the linked library members to a PCR step to amplify the linked library members before sequencing the library members). Methods for sequencing linked library members typically involve amplifying the library members (eg, using a PCR step) before sequencing the library members.

[00141] The amount of DNA bound during hybridization and hybrid binding may be too low to be directly quantified by either fluorimetric or analytical methods (eg, by Bioanalyzer). Library amplification allows quantification and quality control of the process.

[00142] In addition, it is typical to dilute a sample that has been amplified using PCR after hybrid coupling and before sequencing. For example, for a typical quantitation, a sample obtained using the NEXTERA Rapid Capture kit from Illumina, Inc., after PCR is in the mid-nanomolar range, while sequencing concentrations are in the low picomolar range. Thus, several orders of magnitude more molecules are obtained by amplification of bound library members than are needed for sequencing.

[00143] In some embodiments, the present invention relates to a method for sequencing linked library members after hybrid linking. Such a method may involve directly introducing bound library members and/or eluted library members into the flow cell (e.g., using a flow cell direct loading device as described, for example, in U.S. Provisional Patent Application No. 62/564466, filed September 28, 2017 G.).

[00144] In some embodiments, the method may further include sequencing linked library members after hybrid linking.

IMPLEMENTATION OPTIONS

Exemplary Blocker Embodiments

[00145] 1. A blocker containing an oligonucleotide;

wherein the blocker is capable of binding to an adapter, wherein the adapter comprises a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI);

and wherein the blocker region capable of communicating with the index region and/or UMI of the adapter comprises:

at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases; or

universal bases and at least one non-universal base.

[00146] 2. The blocker of blocker embodiment 1, wherein the region of the blocker capable of binding to the index region or UMI of the adapter contains as many thymine bases as the number of bases in the index region and/or UMI of the adapter.

[00147] 3. The blocker of embodiment blocker 1, wherein the at least one non-universal base is located in a region of the blocker sequence corresponding to the index region and/or UMI, and where the non-universal base is at the third position or the fifth position, or both blocker sequence, relative to the 5' end of the index region.

[00148] 4. The blocker of Blocker Embodiment 1 or Blocker Embodiment 3, wherein at least one non-universal base contains a modified guanine.

[00149] 5. The blocker of any one of blocker embodiments 1, 3, or 4, wherein at least one non-universal base contains a random nucleotide.

[00150] 6. A blocker from any one of blocker embodiments 1, 3, 4, or 5, wherein the universal base contains 2'-deoxyinosine, 2'-deoxynebularin, 3-nitropyrrole-2'-deoxynucleoside, or 5-nitroindole-2'- deoxynucleoside.

[00151] 7. A blocker from any of the preceding blocker embodiments, wherein the universal primer sequence comprises at least one of P5, P7, P5', P7', V2.A14.METS, V2.B15.METS, a sequence complementary to V2 .A14.METS, and a sequence complementary to V2.B15.METS.

[00152] 8. A blocker as in any of the preceding blocker embodiments, where the blocker includes a modification that increases the T _m of the blocker relative to the same blocker that does not include the modification.

[00153] 9. A blocker from any of the preceding embodiments of a blocker, wherein the blocker comprises at least one of a DNA or RNA oligonucleotide modified to bind regions of low GC content; cross-linked oligonucleotide; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; locked nucleic acid (LNA); bridging nucleic acid (BNA); tricyclic nucleic acid; peptide nucleic acid (PNA); C5-modified pyrimidine base; propynylpyrimidine; morpholino; phosphoramidite; and a 5'-pyrene cap.

[00154] 10. A blocker as in any of the preceding blocker embodiments, wherein the blocker comprises a modified base in each base, at least every 2 bases, at least every 3 bases, at least every 4 bases, or at least every 4 bases every 5 bases.

[00155] 11. A blocker as in any of the preceding embodiments of a blocker, wherein the blocker contains a 3'-terminal group that prevents the blocker from being available to serve as a primer for DNA synthesis.

[00156] 12. The blocker of embodiment blocker 11, wherein the 3' end group contains a 3′-dC, 2′,3′-ddC, an inverted dT, or a 3′ C3 spacer.

[00157] 13. A blocker from any of the preceding blocker embodiments, where the blocker comprises a sequence from Table 2A, Table 2B, Table 2C, or Table 3.

[00158] 14. A kit containing a blocker from any of the preceding blocker embodiments.

Exemplary Embodiments of a Split Blocker

[00159] 1. A blocker containing two unlinked oligonucleotides;

wherein the blocker is capable of binding to at least a portion of the adapter, wherein the adapter comprises a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI);

and where the unlinked oligonucleotides contain bases that do not correspond to the index region and/or UMI of the adapter.

[00160] 2. The blocker of the split blocker embodiment 1, where the unlinked oligonucleotides do not contain bases corresponding to the index region and/or UMI of the adapter.

[00161] 3. A blocker from any of the preceding embodiments of a split blocker, wherein the universal primer sequence includes at least one of P5, P7, P5', P7', V2.A14.METS, V2.B15.METS, a sequence complementary to V2.A14.METS, and sequences complementary to V2.B15.METS.

[00162] 4. A blocker as in any of the preceding embodiments of a split blocker, where the blocker includes a modification that increases the T _m of the blocker relative to the same blocker that does not include the modification.

[00163] 5. A blocker from any of the preceding embodiments of a split blocker, wherein the blocker comprises at least one of a DNA or RNA oligonucleotide modified to bind regions of low GC content; cross-linked oligonucleotide; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; locked nucleic acid (LNA); bridging nucleic acid (BNA); tricyclic nucleic acid; peptide nucleic acid (PNA); C5-modified pyrimidine base; propynylpyrimidine; morpholino; phosphoramidite; and a 5'-pyrene cap.

[00164] 6. A blocker as in any of the preceding embodiments of a split blocker, wherein the blocker comprises a modified base in each base, at least every 2 bases, at least every 3 bases, at least every 4 bases, or at least at least every 5 bases.

[00165] 7. A blocker as in any of the preceding embodiments of a split blocker, wherein the blocker contains a 3'-terminal group that prevents the blocker from being available to serve as a primer for DNA synthesis.

[00166] 8. A blocker from the split blocker embodiment 11, wherein the 3′ end moiety contains a 3′-dC, 2′,3′-ddC, an inverted dT, or a 3′ C3 spacer.

[00167] 9. A blocker from any of the preceding split blocker embodiments, where the blocker comprises a sequence from Table 2A, Table 2B, Table 2C, or Table 3.

[00168] 10. A blocker from any of the preceding embodiments of a split blocker, where the blocker comprises at least one of BN023, BN024, BN027 and BN028 from Table 2A.

[00169] 11. A kit comprising a blocker from any of the preceding embodiments of a split blocker.

Exemplary Hybridization Buffer Embodiments

[00170] 1. A hybridization buffer containing a crowding agent.

[00171] 2. The hybridization buffer of Hybridization Buffer Embodiment 1, wherein the crowding agent contains at least one of dextran, dextran sulfate, polyethylene glycol (PEG), Ficoll, glycerol, and betaine.

[00172] 3. A hybridization buffer from any of the preceding embodiments of a hybridization buffer, wherein the crowding agent is included in the hybridization buffer in an amount of at least 0.5%, at least 1%, at least 1 .5%, at least 2%, at least 3% or at least 4%.

[00173] 4. The hybridization buffer of any of the preceding embodiments of the hybridization buffer, wherein the crowding agent is included in the hybridization buffer in an amount of at most 1%, at most 1.5%, at most 2%, at most at most 3%, at most 4%, at most 5%, at most 6%, at most 8% or at most 10%.

[00174] 5. A hybridization buffer from any of the preceding embodiments of a hybridization buffer, wherein the hybridization buffer contains at least one of human Cot-1 DNA, a destabilizer, a salt, and a blocker.

[00175] 6. The hybridization buffer of Hybridization Buffer Embodiment 5, wherein the hybridization buffer contains Cot-1 DNA in an amount of at least 0.05 mg/ml, at least 0.1 mg/ml, at least 0.2 mg/ml or at least 0.3 mg/ml.

[00176] 7. The hybridization buffer of Hybridization Buffer Embodiment 5 or 6, wherein the hybridization buffer contains Cot-1 DNA in an amount of at most 0.1 mg/ml, at most 0.2 mg/ml, at most 0 .3 mg/ml or at most 0.5 mg/ml.

[00177] 8. The hybridization buffer from any one of hybridization buffer embodiments 5-7, wherein the destabilizer is at least 1% (v/v), at least 5% (v/v), or at least 10% (v/v) hybridization buffer.

[00178] 9. The hybridization buffer from any one of hybridization buffer embodiments 5-8, wherein the destabilizer is at most 5% (v/v), at most 10% (v/v), or at most 15 % (v/v) hybridization buffer.

[00179] 10. Hybridization buffer from any one of hybridization buffer embodiments 5-9, wherein the destabilizer contains formamide.

[00180] 11. The hybridization buffer from any one of hybridization buffer embodiments 5-10, wherein the hybridization buffer contains at least 0.1 M, at least 0.2 M, at least 0.3 M, at least 0.4 M, at least 0.5 M, at least 0.6 M, at least 0.7 M, at least 0.8 M, at least 0.9 M or at least 1 M salt.

[00181] 12. The hybridization buffer from any one of hybridization buffer embodiments 5-11, wherein the hybridization buffer contains at most 0.2 M, at most 0.3 M, at most 0.4 M, at most 0. 5 M, at most 0.6 M, at most 0.7 M, at most 0.8 M, at most 0.9 M, at most 1 M, at most 2 M, at most 3 M, or at most 4 M salt.

[00182] 13. Hybridization buffer from any one of hybridization buffer embodiments 5-11, wherein the salt contains NaCl.

[00183] 14. The hybridization buffer of any of the preceding embodiments of the hybridization buffer, wherein the hybridization buffer contains phosphate.

[00184] 15. The hybridization buffer of hybridization buffer embodiment 14, wherein the hybridization buffer contains at least 40 mM, at least 50 mM, at least 55 mM, at least 60 mM, at least 65 mM or at least 70 mM phosphate.

[00185] 16. The hybridization buffer of hybridization buffer embodiments 14 or 15, wherein the hybridization buffer contains at most 50 mM, at most 55 mM, at most 60 mM, at most 65 mM, at most 70 mM, at most 75 mM, or at most 80 mM phosphate.

[00186] 17. Hybridization buffer from any one of hybridization buffer embodiments 14-16, wherein the phosphate contains KH ₂ PO ₄ - K ₂ HPO ₄ .

[00187] 18. The hybridization buffer of any of the preceding embodiments of the hybridization buffer, wherein the hybridization buffer contains a detergent.

[00188] 19. The hybridization buffer of embodiment of hybridization buffer 18, wherein the hybridization buffer contains at least 0.001% (v/v), at least 0.01% (v/v), of at least 0.05% (v/v), at least 0.1% (v/v), at least 1% (v/v) or at least 5% (v/v) /vol.) detergent.

[00189] 20. Hybridization buffer from embodiment of hybridization buffer 18 or 19, wherein the hybridization buffer contains at most 0.01% (v/v), at most 0.05% (v/v) , at most 0.1% (v/v), at most 1% (v/v), at most 5% (v/v) or at most 10% (v/v) detergent.

[00190] 21. Hybridization buffer from any one of embodiments of hybridization buffer 18-20, wherein the detergent contains TWEEN 20.

[00191] 22. The hybridization buffer from any of the preceding embodiments of the hybridization buffer, wherein the hybridization buffer comprises

0.5% - 10% dextran sulfate,

0.05 mg/ml - 0.5 mg/ml human Cot-1 DNA,

1% - 15% (v/v) formamide,

40 mM - 80 mM KH ₂ PO ₄ - K ₂ HPO ₄ ,

0.1 M - 4 M NaCl, and

0.001% - 10% (v/v) Tween 20.

[00192] 23. The hybridization buffer from any of the preceding embodiments of the hybridization buffer, wherein the hybridization buffer comprises

1.5% dextran sulfate,

0.2 mg/ml human Cot-1 DNA,

10% (v/v) formamide,

66.6 mM KH ₂ PO ₄ - K ₂ HPO ₄ ,

0.2 mM advanced adapter blockers, (0.1 mM per adapter)

0.8 M NaCl, and

0.04% (v/v) Tween 20.

[00193] 24. The hybridization buffer of any of the preceding embodiments of the hybridization buffer, wherein the hybridization buffer contains a blocker.

[00194] 25. Hybridization buffer from embodiment of hybridization buffer 24, wherein the blocker contains an oligonucleotide with an increased T _m .

[00195] 26. The hybridization buffer of an embodiment of hybridization buffer 24 or 25, wherein the blocker contains a plurality of modifications that increase T _m .

[00196] 27. The hybridization buffer of embodiment hybridization buffer 26, wherein the plurality of modifications that increase the T _m of the blocker comprise at least one of a cross-linked oligonucleotide; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; locked nucleic acid (LNA); bridging nucleic acid (BNA); tricyclic nucleic acid; peptide nucleic acid (PNA); C5-modified pyrimidine base; propynylpyrimidine; morpholino; phosphoramidite; and a 5'-pyrene cap.

[00197] 28. The hybridization buffer of any of the preceding embodiments of the hybridization buffer, wherein the hybridization buffer contains a blocker,

where the blocker contains an oligonucleotide;

wherein the blocker is capable of binding to an adapter, wherein the adapter comprises a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI);

and wherein the blocker region capable of communicating with the index region and/or UMI of the adapter comprises:

at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases; or

universal bases and at least one non-universal base.

[00198] 29. The hybridization buffer of any of the preceding embodiments of the hybridization buffer, wherein the hybridization buffer contains a blocker,

where the blocker contains two unrelated oligonucleotides;

wherein the blocker is capable of binding to at least a portion of the adapter, wherein the adapter comprises a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI);

and where the unlinked oligonucleotides contain bases that do not correspond to the adapter index region and/or UMI of the adapter.

[00199] 30. The hybridization buffer of embodiments of hybridization buffer 28 or 29, wherein the blocker contains a plurality of modifications that increase T _m .

[00200] 31. A kit comprising a hybridization buffer from any of the preceding hybridization buffer embodiments.

Exemplary Methods for Using a Hybridization Buffer (Embodiments of Methods for Using the Buffer)

[00201] 1. A method comprising using a hybridization buffer containing a crowding agent for hybrid binding.

[00202] 2. The method of the Buffer 1 Methods Embodiment, wherein the crowding agent contains at least one of dextran, dextran sulfate, polyethylene glycol (PEG), Ficoll, glycerol and betaine.

[00203] 3. The method of any of the preceding embodiments of the methods of using a buffer, wherein the crowding agent is included in the hybridization buffer in an amount of at least 0.5% (w/v), at least 1% (w/v), at least 1.5% (w/v), at least 2% (w/v), at least 3% (w/v) or at least 4% (w/v).

[00204] 4. The method of any of the preceding embodiments of the methods of using a buffer, wherein the crowding effect agent is included in the hybridization buffer in an amount of at most 1% (w/v), at most 1.5% (w/v) ./vol.), at most 2% (w/v), at most 3% (w/v), at most 4% (w/v), at most 5% (w/v) vol.), at most 6% (w/v), at most 8% (w/v) or at most 10% (w/v).

[00205] 5. The method of any of the preceding embodiments of the methods of using a buffer, wherein the hybridization buffer contains at least one of human Cot-1 DNA, a destabilizer, and a salt.

[00206] 6. The method of an embodiment of methods using buffer 5, wherein the hybridization buffer contains human Cot-1 DNA in an amount of at least 0.05 mg/ml, at least 0.1 mg/ml, at least 0 .2 mg/ml or at least 0.3 mg/ml.

[00207] 7. The method of an embodiment of methods using buffer 5 or 6, wherein the hybridization buffer contains human Cot-1 DNA in an amount of at most 0.1 mg/ml, at most 0.2 mg/ml, at most 0. 3 mg/ml or at most 0.5 mg/ml.

[00208] 8. The method of any one of the embodiments of the methods of using buffer 5-7, wherein the destabilizer is at least 1% (v/v), at least 5% (v/v), or at least 10% (v/v) hybridization buffer.

[00209] 9. The method of any one of the embodiments of the methods of using buffer 5-8, wherein the destabilizer is at most 5% (v/v), at most 10% (v/v), or at most 15% ( v/v) hybridization buffer.

[00210] 10. The method of any of the embodiments of the methods of using buffer 5-9, where the destabilizer contains formamide.

[00211] 11. The method of any one of the embodiments of the methods of using buffer 5-10, wherein the hybridization buffer contains at least 0.1 M, at least 0.2 M, at least 0.3 M, at least 0.4 M, at least 0.5 M, at least 0.6 M, at least 0.7 M, at least 0.8 M, at least 0.9 M or at least 1 M salt.

[00212] 12. The method of any one of the embodiments of methods using buffer 5-11, wherein the hybridization buffer contains at most 0.2 M, at most 0.3 M, at most 0.4 M, at most 0.5 M , at most 0.6 M, at most 0.7 M, at most 0.8 M, at most 0.9 M, at most 1 M, at most 2 M, at most 3 M or at most 4 M salt.

[00213] 13. The method of any of the embodiments of the methods of using buffer 5-12, where the salt contains NaCl.

[00214] 14. The method of any of the preceding embodiments of the methods of using a buffer, wherein the hybridization buffer contains phosphate.

[00215] 15. The method of an embodiment of methods using buffer 14, wherein the hybridization buffer contains at least 40 mM, at least 50 mM, at least 55 mM, at least 60 mM, at least 65 mM, or at least 70 mM phosphate.

[00216] 16. A method of embodiments of methods using buffer 14 or 15, wherein the hybridization buffer contains at most 50 mM, at most 55 mM, at most 60 mM, at most 65 mM, at most 70 mM, at most 75 mM or at most 80 mM phosphate.

[00217] 17. The method of any one of the embodiments of methods using buffer 14-16, wherein the phosphate contains KH ₂ PO ₄ - K ₂ HPO ₄ .

[00218] 18. The method of any of the preceding embodiments of the methods of using a buffer, wherein the hybridization buffer contains a detergent.

[00219] 19. The method of an embodiment of methods using buffer 17, wherein the hybridization buffer contains at least 0.001% (v/v), at least 0.01% (v/v), at least 0.05% (v/v), at least 0.1% (v/v), at least 1% (v/v) or at least 5% (v/v) .) detergent.

[00220] 20. The method of an embodiment of methods using buffer 18 or 19, wherein the hybridization buffer contains at most 0.01% (v/v), at most 0.05% (v/v), at most at most 0.1% (v/v), at most 1% (v/v), at most 5% (v/v) or at most 10% (v/v) detergent.

[00221] 21. The method of any one of the embodiments of the methods of using buffer 18-20, wherein the hybridization buffer contains TWEEN 20.

[00222] 22. The method of any of the preceding embodiments of methods for using a buffer, wherein the hybridization buffer comprises:

0.5% - 10% dextran sulfate,

0.05 mg/ml - 0.5 mg/ml Cot-1,

1% - 15% (v/v) formamide,

40 mM - 80 mM KH ₂ PO ₄ - K ₂ HPO ₄ ,

0.1 M - 4 M NaCl and

0.001% - 10% (v/v) TWEEN 20.

[00223] 23. The method of any of the preceding embodiments of methods for using a buffer, wherein the hybridization buffer comprises:

1.5% dextran sulfate,

0.2 mg/ml Cot-1,

10% (v/v) formamide,

66.6 mM KH ₂ PO ₄ - K ₂ HPO ₄ ,

0.8 M NaCl and

0.04% (v/v) TWEEN 20.

[00224] 24. The method of any of the preceding embodiments of methods for using a buffer, wherein the hybridization buffer contains a blocker.

[00225] 25. The method of an embodiment of methods using buffer 24, wherein the blocker is present at a concentration of at least 0.001 mM, at least 0.005 mM, at least 0.01 mM, at least 0.05 mM, or at least 0.1 mM.

[00226] 26. The method of an embodiment of methods using buffer 24 or 25, wherein the blocker is present in a concentration of at most 0.01 mM, at most 0.05 mM, at most 0.1 mM, at most 0.2 mM, or at most 0.5 mM.

[00227] 27. The method of any of the preceding embodiments of the methods of using a buffer, wherein the method includes preparing a hybridization buffer from a first composition containing human Cot-1 DNA and a blocker, and a second composition containing formamide and dextran sulfate.

[00228] 28. The method of any of the preceding embodiments of methods for using a buffer, wherein the method includes contacting the library with a hybridization buffer, wherein the hybridization buffer contains a blocker.

[00229] 29. The method of embodiment of Buffer Methods 28, wherein the method includes combining samples from at least two library preparations before contacting the library with a blocker in the presence of a hybridization buffer.

[00230] 30. The method of an embodiment of methods using buffer 29, wherein at least 1 μl, at least 2 μl, at least 3 μl, at least 5 μl, at least 10 μl, at least 15 are combined µl or at least 20 µl of sample obtained from each library preparation.

[00231] 31. The method of an embodiment of methods using buffer 29 or 30, where at most 2 μL, at most 3 μL, at most 5 μL, at most 10 μL, at most 15 μL, at most 20 μL, at most are combined 25 µl, at most 30 µl, at most 40 µl, or at most 50 µl of sample obtained from each library preparation.

[00232] 32. The method of any one of the embodiments of methods using buffer 29-31, wherein at least 10 ng, at least 15 ng, at least 25 ng, at least 50 ng, at least 100 ng are combined, at least 200 ng, at least 500 ng, at least 1000 ng, or at least 5000 ng of DNA from each library preparation.

[00233] 33. The method of any one of the embodiments of the methods of using buffer 29-32, wherein at most 15 ng, at most 25 ng, at most 50 ng, at most 100 ng, at most 200 ng, at most 500 ng are combined, at most 1000 ng, at most 5000 ng, at most 10,000 ng, or at most 12,000 ng of DNA from each library preparation.

[00234] 34. The method of any one of the embodiments of the methods of using buffer 29-33, wherein the DNA concentration of each sample obtained from the library preparation subject to pooling is at least 0.1 ng/μl, at least 0.3 ng /µl, at least 0.4 ng/µl, at least 0.5 ng/µl, at least 1 ng/µl, at least 2 ng/µl, at least 4 ng/µl, at least 6 ng/µl, at least 8 ng/µl, at least 10 ng/µl, at least 12 ng/µl, at least 20 ng/µl, at least 50 ng/µl, at least 60 ng /μl, at least 100 ng/μl or at least 200 ng/μl.

[00235] 35. The method of any one of the embodiments of the methods using buffer 29-34, wherein the DNA concentration of each sample obtained from the library preparation subject to pooling is at most 0.4 ng/μl, at most 0.5 ng/μl , at most 1 ng/µl, at most 2 ng/µl, at most 4 ng/µl, at most 6 ng/µl, at most 8 ng/µl, at most 10 ng/µl, at most 12 ng/µl, at most 15 ng/µl, at most 20 ng/µl, at most 50 ng/µl, at most 100 ng/µl, at most 120 ng/µl, at most 200 ng/µl, at most 300 ng/µl or at most greater than 400 ng/µl.

[00236] 36. The method of any one of the embodiments of the methods using buffer 29-35, where the DNA concentration after combining library preparations is in the range of 0.3 ng/μl - 400 ng/μl.

[00237] 37. The method of any one of the embodiments of methods using buffer 29-36, where the method further includes contacting library members with a probe, where the probe hybridizes to a region of interest in the library member, and where the probe contains a ligand.

[00238] 38. The method of an embodiment of the methods using buffer 37, where the ligand contains a biotin group.

[00239] 39. The method of any one of the buffer methods embodiments 29-38, wherein the method includes preparing a hybridization mixture containing library members, a hybridization buffer (wherein the hybridization buffer contains a blocker), and a probe.

[00240] 40. The method of the embodiment of methods using buffer 39, wherein the hybridization mixture further contains human Cot-1 DNA.

[00241] 42. The method of an embodiment of methods using buffer 39 or 40, where the method includes using a volume of hybridization mixture of at most 150 μl, at most 140 μl, at most 130 μl, at most 120 μl, at most 110 μl, at most at most 100 μl, at most 90 μl, at most 80 μl, at most 70 μl, at most 60 μl or at most 50 μl.

[00242] 42. The method of any one of the embodiments of the methods of using buffer 39-41, where the method includes using a volume of the hybridization mixture of at least 10 μl, at least 20 μl, at least 30 μl, at least 40 μl, at least 50 μl, at least 60 μl or at least 70 μl.

[00243] 43. The method of any one of the embodiments of the methods of using buffer 39-42, wherein the concentration of DNA in the hybridization mixture is at least 0.1 ng/μl, at least 0.3 ng/μl, at least 0 .4 ng/µl, at least 0.5 ng/µl, at least 1 ng/µl, at least 2 ng/µl, at least 4 ng/µl, at least 6 ng/µl, at least at least 8 ng/µl, at least 10 ng/µl, at least 12 ng/µl, at least 15 ng/µl, at least 20 ng/µl, at least 50 ng/µl, at least 75 ng/µl, at least 100 ng/µl, at least 120 ng/µl, at least 150 ng/µl, at least 200 ng/µl.

[00244] 44. The method of any one of the embodiments of the methods of using buffer 39-43, wherein the concentration of DNA in the hybridization mixture is at most 0.3 ng/μl, at most 0.4 ng/μl, at most 0.5 ng /µl, at most 1 ng/µl, at most 2 ng/µl, at most 4 ng/µl, at most 6 ng/µl, at most 8 ng/µl, at most 10 ng/µl, at most 12 ng/ µL, at most 15 ng/µL, at most 20 ng/µL, at most 50 ng/µL, at most 75 ng/µL, at most 100 ng/µL, at most 120 ng/µL, at most 150 ng/µL , at most 200 ng/µl or at most 500 ng/µl.

[00245] 45. The method of any one of the embodiments of methods using buffer 37-44, wherein the library is in contact with the probe for at most 3 days, at most 2 days, at most 24 hours, at most 20 hours, at most 16 hours, at most 12 hours, at most 6 hours, at most 3 hours, at most 2 hours, at most 90 minutes, at most 1 hour or at most 30 minutes.

[00246] 46. The method of any one of the embodiments of methods using buffer 37-45, wherein the library is in contact with the probe for at least 30 minutes, at least 45 minutes, at least 1 hour, at least 90 minutes , at least 2 hours, at least 3 hours, at least 6 hours, at least 12 hours, at least 16 hours, at least 20 hours or at least 24 hours.

[00247] 47. The method of any one of the embodiments of the methods of using buffer 39-46, where the method includes maintaining the hybridization mixture at a hybridization temperature, and wherein the hybridization temperature is at least 50°C, at least 55°C, at least at least 56°C, at least 57°C, at least 58°C, at least 59°C, at least 60°C, at least 61°C, at least 62°C, at least 63°C, at least 64°C, at least 65°C or at least 70°C.

[00248] 48. The method of any one of the embodiments of the methods of using buffer 39-47, where the method includes maintaining the hybridization mixture at a hybridization temperature, and where the hybridization temperature is at most 56°C, at most 58°C, at most 60° C, at most 61°C, at most 62°C, at most 63°C, at most 64°C, at most 65°C or at most 70°C.

[00249] 49. The method of any one of the embodiments of the methods of using buffer 39-48, where the method includes maintaining the hybridization mixture at the hybridization temperature for at most 3 days, at most 2 days, at most 24 hours, at most 20 hours, at most 16 hours, at most 12 hours, at most 6 hours, at most 3 hours, at most 2 hours, at most 90 minutes, at most 1 hour or at most 30 minutes.

[00250] 50. The method of any one of the embodiments of the methods of using buffer 39-49, where the method includes maintaining the hybridization mixture at the hybridization temperature for at least 30 minutes, at least 45 minutes, at least 1 hour, at least at least 90 minutes, at least 2 hours, at least 3 hours, at least 6 hours, at least 12 hours, at least 16 hours, at least 20 hours or at least 24 hours.

[00251] 51. The method of any one of the embodiments of the methods of using buffer 37-50, where the method further includes binding the probe after hybridizing it with the binding agent.

[00252] 52. The method of the embodiment of methods using buffer 51, where probe binding involves the use of a streptavidin bead.

[00253] 53. The method of any one of the embodiments of methods using buffer 37-52, where the method includes preparing a binding mixture including a probe and a binding agent.

[00254] 54. The method of an embodiment of methods using buffer 53, where the method includes maintaining the binding mixture at a binding temperature of at least 50°C, at least 55°C, at least 56°C, at least 57° C, at least 58°C, at least 59°C, at least 60°C, at least 61°C, at least 62°C, at least 63°C, at least 64°C , at least 65°C or at least 70°C.

[00255] 55. The method of an embodiment of methods using buffer 53 or 54, where the method includes maintaining the binding mixture at a binding temperature of at most 56°C, at most 58°C, at most 60°C, at most 61°C, at most 62°C, at most 63°C, at most 64°C, at most 65°C or at most 70°C.

[00256] 56. The method of any one of the embodiments of buffer methods 53-55, wherein the method comprises maintaining the binding mixture at the binding temperature for at least 2 minutes, at least 5 minutes, at least 10 minutes, or at least at least 15 minutes.

[00257] 57. The method of any one of the embodiments of the buffer methods 53-56, wherein the method includes maintaining the binding mixture at the binding temperature for at most 5 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 30 minutes or at most 45 minutes.

[00258] 58. The method of any one of the embodiments of methods using buffer 53-57, where the method includes washing the associated probe.

[00259] 59. The method of any one of the embodiments of the buffer methods 53-58, wherein the method further comprises eluting bound library members from the coupling means into an eluant.

[00260] 60. The method of any one of the embodiments of the buffer methods 53-59, where the method further includes eluting bound library members from the probe into the eluant.

[00261] 61. A method of an embodiment of methods using buffer 60, wherein at least 60 femtomoles, at least 80 femtomoles, at least 90 femtomoles, at least 100 femtomoles, or at least 150 femtomoles of DNA are eluted.

[00262] 62. The method of an embodiment of the methods of using buffer 60 or 61, wherein at most 150 femtomoles, at most 500 femtomoles, at most 1 picomole, at most 2 picomoles, or at most 3 picomoles DNA is eluted.

[00263] 63. The method of any one of the embodiments of the methods using buffer 60-62, wherein the concentration of DNA in the eluant is at least 1.1 pM, at least 1.2 pM, at least 1.3 pM, at least at least 10 pM or at least 100 pM.

[00264] 64. The method of any one of the embodiments of methods using buffer 60-63, wherein the concentration of DNA in the eluant is at most 100 pM, at most 200 pM, at most 250 pM, or at most 300 pM.

[00265] 65. The method of any one of the embodiments of the methods using buffer 60-64, wherein the concentration of DNA in the eluant is in the range of 1.3 pM-250 pM.

[00266] 66. The method of any one of the embodiments of methods using buffer 37-65, where the method further includes sequencing members of the library.

[00267] 67. The method of an embodiment of methods using buffer 66, where the method includes amplifying library members before sequencing the library members.

[00268] 68. The method of an embodiment of methods using buffer 66, where the method does not include amplifying library members before sequencing the library members.

[00269] 69. The method of any one of the embodiments of the methods using buffer 24-68, where the blocker contains an oligonucleotide with an increased T _m .

[00270] 70. The method of any one of the embodiments of methods using buffer 24-69, where the blocker contains a plurality of modifications that increase T _m .

[00271] 71. The method of an embodiment of methods using buffer 70, wherein the plurality of modifications that increase the T _m of the blocker comprises at least one of a cross-linked oligonucleotide; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; locked nucleic acid (LNA); bridging nucleic acid (BNA); tricyclic nucleic acid; peptide nucleic acid (PNA); C5-modified pyrimidine base; propynylpyrimidine; morpholino; phosphoramidite; and a 5'-pyrene cap.

[00272] 72. The method of any one of the embodiments of the methods of using buffer 24-71, wherein the blocker contains an oligonucleotide;

wherein the blocker is capable of binding to an adapter, wherein the adapter comprises a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI);

and wherein the blocker region capable of communicating with the index region and/or UMI of the adapter comprises:

at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases; or

universal bases and at least one non-universal base.

[00273] 73. The method of any one of the embodiments of the methods of using buffer 24-72, where the blocker contains two unlinked oligonucleotides;

wherein the blocker is capable of binding to at least a portion of the adapter, wherein the adapter comprises a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI);

and where the unlinked oligonucleotides contain bases that do not correspond to the adapter index region and/or UMI of the adapter.

Exemplary Non-PCR Hybrid Linking Methods (Binding Method Embodiments)

[00274] 1. A method comprising

contacting the library with a blocker in the presence of a hybridization buffer;

and bringing the library into contact with a probe, where the probe hybridizes to a region of interest in the library member;

wherein the method does not include amplifying the library members using PCR prior to sequencing the library members.

[00275] 2. The method of Linking Method Embodiment 1, wherein the probe further contains a ligand, and wherein the library members are eluted from the ligand before sequencing the library members.

[00276] 3. The method of the binding method embodiment 2, where the ligand contains biotin.

[00277] 4. The method of any one of embodiments of binding method 2 or 3, comprising adding library members to the flow cell after elution from the ligand.

[00278] 5. The method of any one of the binding method embodiments 1-4, wherein the method further comprises binding the probe after hybridizing it with the binding agent.

[00279] 6. The method of coupling method embodiment 5, wherein the coupling agent contains streptavidin.

[00280] 7. The method of any one of binding method embodiments 5 or 6, comprising introducing library members into the flow cell after elution from the binding agents.

[00281] 8. The method of coupling method embodiment 4 or 7, comprising introducing library members into the flow cell in a volume of less than 100 μl, in a volume of less than 90 μl, in a volume of less than 80 μl, in a volume of less than 70 μl, or in a volume of less than 60 µl.

[00282] 9. The method of coupling method embodiment 4 or 7, comprising adding library members to the flow cell at a concentration of at least 1.1 pM, at least 1.2 pM, at least 1.3 pM, at least at least 10 pM or at least 100 pM.

[00283] 10. The method of coupling method embodiment 4, 7, or 9, comprising adding library members to the flow cell at a concentration of at most 100 pM, at most 200 pM, at most 250 pM, or at most 300 pM.

[00284] 11. The method of any one of embodiments of Linking Method 4, or 7-10, comprising introducing library members into the flow cell using a device for directly loading the flow cell.

[00285] 12. The method of any of the preceding embodiments of the binding method, wherein the hybridization buffer contains a crowding agent.

[00286] 13. The method of the coupling method embodiment 12, wherein the hybridization buffer contains

0.5% - 10% dextran sulfate,

0.05 mg/ml - 0.5 mg/ml human Cot-1 DNA,

1% - 15% (v/v) formamide,

40 mM - 80 mM KH ₂ PO ₄ - K ₂ HPO ₄ ,

0.1 M - 4 M NaCl, and

0.001% - 10% (v/v) Tween 20.

[00287] 14. The method of any of the preceding embodiments of the binding method, wherein the blocker contains an oligonucleotide with an increased T _m .

[00288] 15. The method of any of the preceding embodiments of the binding method, wherein the blocker contains a plurality of modifications that increase T _m .

[00289] 16. The method of binding method embodiment 15, wherein the plurality of modifications that increase the T _m of the blocker include at least one of a cross-linked oligonucleotide; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; locked nucleic acid (LNA); bridging nucleic acid (BNA); tricyclic nucleic acid; peptide nucleic acid (PNA); C5-modified pyrimidine base; propynylpyrimidine; morpholino; phosphoramidite; and a 5'-pyrene cap.

[00290] 17. The method of any of the preceding embodiments of the binding method, wherein the blocker comprises an oligonucleotide;

wherein the blocker is capable of binding to an adapter, wherein the adapter comprises a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI);

and wherein the blocker region capable of communicating with the index region and/or UMI of the adapter comprises:

at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases; or

universal bases and at least one non-universal base.

[00291] 18. The method of any of the preceding embodiments of the binding method, wherein the blocker contains two unlinked oligonucleotides;

wherein the blocker is capable of binding to at least a portion of the adapter, wherein the adapter comprises a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI);

and where the unlinked oligonucleotides contain bases that do not correspond to the adapter index region and/or UMI of the adapter.

[00292] The present invention is illustrated by the following examples. It is to be understood that the specific examples, materials, quantities and methods are to be interpreted broadly within the scope and scope of the invention as set forth herein.

Embodiments

[00293] The following numbered paragraphs represent embodiments as described herein, although the embodiments listed herein are not limiting.

[00294] Item 1. A hybridization buffer containing a crowding agent and at least one of human Cot-1 DNA, a destabilizer, a salt, and a blocker.

[00295] Claim 2. The hybridization buffer of claim 1, wherein the crowding agent comprises at least one of dextran, dextran sulfate, polyethylene glycol (PEG), Ficoll, glycerol and betaine.

[00296] Claim 3. Hybridization buffer according to any one of the preceding claims, wherein the hybridization buffer contains: 0.5% - 10% dextran sulfate, 0.05 mg/ml - 0.5 mg/ml Cot-1, 1% - 15% (v/v) formamide, 40 mM - 80 mM KH ₂ PO ₄ - K ₂ HPO ₄ , 0.1 M - 4 M NaCl and 0.001% - 10% (v/v) TWEEN 20.

[00297] Claim 4. The hybridization buffer according to any of the preceding claims, wherein the blocker contains a plurality of modifications that increase T _m .

[00298] Claim 5. A method comprising using a hybridization buffer according to any of the preceding claims.

[00299] Item 6. The method of item 5, comprising preparing a hybridization mixture containing library members, a hybridization buffer, human Cot-1 DNA, a blocker, and a probe.

[00300] Item 7. The method of item 6, wherein the hybridization mixture contains samples from at least two library preparations, where at least 10 ng, at least 25 ng, at least 50 ng, at least 100 ng are combined , at least 200 ng or at least 500 ng of DNA from each library preparation.

[00301] Item 8. The method according to item 6 or item 7, where the concentration of DNA in the hybridization mixture is in the range of 0.1 ng/μl - 120 ng/μl.

[00302] Claim 9. The method of any one of clauses 6-8, wherein the method includes: bringing library members into contact with a probe, where the probe hybridizes to a region of interest in the library member, and where the probe contains a ligand, binding the probe after it has hybridized to a binding agent, and eluting the bound library members from the binding agents into an eluant where the eluant DNA concentration is in the range of 1.3 pM - 250 pM.

[00303] Claim 10. The method of any one of clauses 6-9, where the method further includes sequencing the library members, and where the method does not include amplifying the library members before sequencing the library members.

[00304] Clause 11. The method of claim 10, wherein the method includes introducing members of the library into the flow cell using a device for directly loading the flow cell.

[00305] Clause 12. Blocker containing oligonucleotide; wherein the blocker is capable of binding to an adapter, wherein the adapter comprises a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI); and wherein the blocker region capable of binding to the index region and/or UMI of the adapter comprises: at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases; or universal bases and at least one non-universal base.

[00306] Clause 13. A blocker containing two unlinked oligonucleotides; wherein the blocker is capable of binding to at least a portion of the adapter, wherein the adapter comprises a universal primer sequence and at least one of an index region or a unique molecular identifier (UMI); and where the unlinked oligonucleotides contain bases that do not correspond to the index region and/or UMI of the adapter.

[00307] Clause 14. The blocker of claim 12 or 13, wherein the universal primer sequence contains at least one of P5, P7, P5', P7', V2.A14.METS, V2.B15.METS, a sequence complementary to V2. A14.METS, and a sequence complementary to V2.B15.METS.

[00308] Claim 15. The blocker according to any one of claims 12-14, where the blocker contains a modification that increases the T _m of the blocker relative to the same blocker that does not include the modification.

[00309] Claim 16. The blocker according to any one of claims 12-15, where the blocker contains at least one of a DNA or RNA oligonucleotide modified to bind regions of low GC content; cross-linked oligonucleotide; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; locked nucleic acid (LNA); bridging nucleic acid (BNA); tricyclic nucleic acid; peptide nucleic acid (PNA); C5-modified pyrimidine base; propynylpyrimidine; morpholino; phosphoramidite; and a 5'-pyrene cap.

[00310] Clause 17. A method comprising contacting the library with a blocker in the presence of a hybridization buffer; and bringing the library into contact with a probe, where the probe hybridizes to a region of interest in the library member; wherein the method does not include amplifying the library members using PCR prior to sequencing the library members.

[00311] Clause 18. The method of claim 17, wherein the method comprises adding library members to the flow cell at a concentration of at least 1.1 pM, at least 1.2 pM, at least 1.3 pM, at least 10 pM, or at least 100 pM and in a concentration of at most 100 pM, at most 200 pM, at most 250 pM or at most 300 pM.

[00312] Clause 19. The method of claim 17 or 18, wherein the blocker contains a plurality of modifications that increase T _m .

[00313] Clause 20. The method of any one of clauses 17-19, wherein the hybridization buffer contains a crowding agent.

[00314] Item 21. The method of any one of items 17-20, wherein the hybridization buffer contains 0.5% - 10% dextran sulfate, 0.05 mg/ml - 0.5 mg/ml human Cot-1 DNA, 1% - 15% (v/v) formamide, 40 mM - 80 mM KH ₂ PO ₄ - K ₂ HPO ₄ , 0.1 M - 4 M NaCl and 0.001% - 10% (v/v) Tween 20 .

[00315] Clause 22. The method of any one of clauses 17-21, comprising introducing library members into the flow cell using a device for directly loading the flow cell.

[00316] Item 23. A kit containing the hybridization buffer of any one of items 1-4.

[00317] Item 24. A kit containing the blocker according to any of items 12-16.

EXAMPLES

Example 1 - Hybridization and Linking

Hybridization

[00318] The crude hybridization buffer includes the following components/final concentrations in a 100 μL hybridization reaction: Human Cot-1 0.2 mg/mL, Formamide 10% (v/v), KH ₂ PO ₄ - K ₂ HPO ₄ 66.6 mM, NaCl 0.8 M, TWEEN 20 0.04% (v/v).

[00319] The advanced hybridization buffer includes the following components/final concentrations in a 100 μL hybridization reaction: dextran sulfate 1.5% (w/v), human Cot-1 0.2 mg/mL, formamide 10% (v/v). /v), KH ₂ PO ₄ - K ₂ HPO ₄ 66.6 mM, NaCl 0.8 M, TWEEN 20 0.04% (v/v).

[00320] In each case, 100 μl of the final reaction mixture also contains: probes (at least 500 probes and at most 500,000 probes) at a concentration of 125 pM per probe (at a total probe concentration of at least 30 nM), and DNA samples at most 30 µl (50 ng - 6 µg). If enabled, blockers are present at 0.2 mM.

[00321] The hybridization reaction is carried out in a thermal cycler or HYBEX system with precise temperature control. After denaturation at 95°C for 5 minutes, the hybridization reaction is incubated at 58°C or 62°C for 90 minutes (total hybridization time approximately (~) 100 minutes) or at most 24 hours. A ramp at 2°C per minute from 95°C to 58°C or 62°C (additional 20 minutes) may be followed by incubation at 58°C or 62°C, depending on probe design. (For experiments described herein, samples are incubated at 62°C.).

Binding

[00322] Target DNA is bound using 250 μl of streptavidin SMB beads (streptavidin magnetic beads, Illumina, Inc., San Diego, CA) for each 100 μl hybridization reaction at the hybridization incubation temperature (e.g., 62°C if the hybridization reaction is incubate at 62°C for 90 minutes) for 15 minutes. The target DNA is then washed at the same temperature (e.g., 62°C) for 5 minutes for a total of 4 times using EEW wash buffer (Advanced Enrichment Wash Buffer, Illumina, Inc., San Diego, CA (Tris-HCL, deferoxamine mesylate (DFO), betaine and TWEEN 20)). Target DNA was eluted using fresh denaturation solution (0.1% (v/v) TWEEN 20 (EE1) and 2 N NaOH (HP3)), neutralized using ET2 (Target Elution Buffer 2, Illumina, Inc. , San Diego, CA (Tris-base, Tris-acetate)), and further amplified using a primer mixture (PPC; a primer set with sequencing adapters, including 5 μM primers P5 and P7, Illumina, Inc.) and an improved mixture for PCR (EPM) (Illumina, Inc., San Diego, CA), and purified using 0.9x solid-phase reversible immobilization (SPRI) beads.

Example 2 - Blockers Including Thymine

[00323]This example describes blockers that include thymine in the blocker region that corresponds to the index and/or UMI (see FIG. 3D).

[00324] Using the blockers from Table 3, hybridization and coupling were performed as described in Example 1 using the improved hybridization buffer and 0.2 mM blocker. The resulting bound DNAs were sequenced and read enrichment was calculated using Enrichment v3.0 BASESPACE App (Illumina, Inc., San Diego, CA).

[00325] Blockers that include a stretch of T at index sequence positions require at least 8 or 10 modified nucleotides in the blocker region that does not match the index to achieve high target DNA binding (as measured by read-augmented enrichment).

[00326]For oligonucleotides with sequence complementary to the index region required fewer modified nucleotides (8 nucleotides and 10 nucleotides were tested) and showed higher enrichment with complemented reads. The results are shown in FIG. 4. Given the same number of modifications (8 or 10 nucleotides) in blockers, blockers with sequence complementary to the index region (last column) show higher enrichment with padded reads than blockers with a stretch of T in the index region (labeled " 10 mod. with (T)8" in FIG. 4).

Table 3

SEQ ID NO Name Description Sequences Modification 104 NEXTERA Blocker 1 (15016424) i5 Illumina NEXTERA blocker i5 5'- AATGATACGGCGACCACCGAGATCTACACTTTTTTTTTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG/ 3ddC/ without mod. 105 NEXTERA Blocker 2 (15016425) i7 Illumina NEXTERA blocker i7 5'- CAAGCAGAAGACGGCATACGAGATTTTTTTTTGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG/3ddC/ without mod. 106 TiBNK1 NEXTERA blocker 1_3XCG 5' - AATGATACGGCGACCACCGAGAT+CTACACTTTTTTTTT+CGTCGGCAGCGTCAGATGTGTATAAGAGA+C AG/3ddC/ 3 mod. 107 TiBNK2 NEXTERA blocker 2_3XCG 5' - CAAGCAGAAGACGGCATACGAGATTTTTTTTTGT+CTCGTGGGCT+CGGAGATGTGTATAAGAGA+CAG/ 3ddC/ 3 mod. 108 TiBNK3 NEXTERA blocker 1_6XCG 5' - AATGATACGGCGACCACCCGAGA+TCTACACTTTTTTTTTCG+TCGG+CAGCG+TCAGATG+TGTATAA+G AGACAG/3ddC/-3' 6 mod. 109 TiBNK4 NEXTERA blocker 2_6XCG 5' - CAAGCAGAAGACGGCA+TACGAGATTTTTTTTTG+TCT+CGTGGGC+TCGGAGATG+TGTATAA+G AGACAG/3ddC/-3' 6 mod. 110 TiBNK5 NEXTERA blocker 1_10XCG 5' - AATGATA+CGGCGA+CCAC+CGAGA+TCTA+CACTTTTTTTTTCG+TCGG+CAGCG+TCAGATG+TGTATA A+GAGACAG spacer C3-3' 10 mod. 111 TiBNK6 NEXTERA blocker 2_10XCG 5' - CAAG+CAGAAGA+CGGCA+TACGA+GATTTTTTTTTG+TCT+CGTGGGC+TCGG+AGATG+TGTATAA+G AGACAG spacer C3-3' 10 mod. 112 TiS517 C-specific blocker 517 5' - AATGATACGGCGACCAC+CGAGA+TCTA+CACG+CGTA+AGATCG+TCGG+CAGCG+TCAGATG+T GTATAA+GAGACAG spacer C3-3' 10 mod. 113 TiS701 C-specific blocker701 5' - CAAGCAGAAGA+CGGCA+TACGAGATT+CGCCTTAG+TCT+CGTGGGC+TCGGAGA+TGTGTATAA+G AGACAG spacer C3-3' 8 mod.

Table 4

SEQ ID NO Name Description Sequences Modification 114 BL007 TSHTЗНК15G 5'- AATGATACGGCGACCAC+CGA+GAT+CTA+CAC/ideoxyI//ideoxyI//ideoxyI//ideoxyI/+G/ ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/ACAC+TCT+TTC+CCT+ACA +CGA+CGC+TCT+TCC+GAT+C/3ddC/ G mod. in the index 115 BL008 TSHTЗНК16G 5'- CAAGCAGAAGACGG+CAT+ACG+AGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI/+G/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/+GTG+ACT+GGA+GTT+ CAG+ACG+TGTGCT+CTT+CCG+ATC/3ddC/ G mod. in the index 116 BL009 TSHTЗНК15N 5'- AATGATACGGCGACCAC+CGA+GAT+CTA+CAC/ideoxyI//ideoxyI//ideoxyI//ideoxyI/N/ideoxyI// ideoxyI//ideoxyI//ideoxyI//ideoxyI/ACAC+TCT+TTC+CCT+ACA+ CGA+CGC+TCT+TCC+GAT+C/3ddC/ N in index 117 BL010 TSHTЗНК16N 5'- CAAGCAGAAGACGG+CAT+ACG+AGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI/N/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/+GTG+ACT+GGA+GTT+CAG +ACG+TGTGCT+CTT+CCG+ATC/3ddC/ N in index

Table 5

SEQ ID NO Name Description Sequences Modification 118 BN023 P5ZNK 5'- AATGA+TAC+GGC+GAC+CAC+CGA+GAT+CTA+CAC/3SpC3/ 8 mod. 119 BN024 P7ZNK 5'- CAAGC+AGA+AGA+CGG+CAT+ACG+A+GA+T/3SpC3/ 8 mod. 120 BN025 TiZNKS1 5'- TCGTC+GGC+AGC+GTC+AGA+TGT+GTA+TAA+GAG+ACA+G/3SpC3/ 10 mod. 121 BN026 TiZNKS2 5'- GTCT+CGT+GGGC+TCG+GAG+ATG+TGT+ATAA+GAG+ACA+G/3SpC3/ 10 mod. 122 BN027 TiZNK17 5' - GGCGAC+CAC+CGAGA+TCT+ACA+C/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+TCG+TCG+GCA+GCG+TCA+GATG+TG/3SpC3/ 123 BN028 TiZNK18 5' - GGCA+TAC+GAGA+T/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/
+GTC+TCG+TGG+GC+TCGG+AGA+TGTG+TATAA+GAG/3SpC3/

Example 3 - Blockers Including Universal Bases and Modified Bases

[00327] Using 0.2 mM blockers from Table 4 in the improved hybridization buffer, hybridization and coupling were carried out as described in Example 1. As shown in Table 4, the blocker region corresponding to the index region includes universal bases (deoxyinosine) and LNA-modified guanine or random nucleotide.

[00328] Without intending to be bound by theory, it is believed that the inclusion of a modified G or random nucleotide at every third base of the blocker sequence corresponding to the index region (e.g., at the third and/or fifth positions (from the 5' end) of the blocker sequence is appropriate index region, as shown in one embodiment of FIG.5, or at the second and/or fourth positions of the blocker sequence corresponding to the index region), improves the affinity of the blocker for the library member.

Example 4 - Separated Blockers

[00329] This example shows that split LNA blockers work well with a library including an 8-nucleotide index.

[00330] Using the blockers from Table 5, hybridization and coupling are carried out as described in Example 1 using the improved hybridization buffer. As shown in Table 5, the blockers TiZNKS1 (BN025), TiZNKS2 (BN026), P5ZNK (BN023) and P7ZNK (BN024) do not include a region corresponding to the index region. Each of P5ZNA (BN023) and P7ZNA (BN024) includes 8 ZNA-modified bases. Each of TiZNKS1 (BN025) and TiZNKS2 (BN026) includes 10 ZNK-modified bases. Each of TiSNA17 (BN027) and TiSNA18 (BN028) includes universal bases (deoxyinosine) in a blocker region corresponding to the index region, but includes truncated blocker regions corresponding to other adapter regions.

[00331] The resulting bound DNAs are sequenced and read enrichment is calculated using the Enrichment v3.0 BASESPACE App (Illumina, Inc., San Diego, CA). The blocker circuit is shown in FIG. 6A and FIG. 3E - FIG. 3I; the results are shown in FIG. 6B. Sample “divided into 4 fragments.” contains TiSNKS1 (BN025), TiSNKS2 (BN026), P5SNKS (BN023) and P7SNKS (BN024) from table 5; the “internal” sample contains TiZNKS1 (BN025) and TiZNKS2 (BN026) in Table 5; the “outer” sample contains P5SNA (BN023 and P7SNA (BN024) in Table 5; the short 8-nt sample includes TiSNA17 (BN027) and TiSNA18 (BN028) in Table 5. Two-part blockers (“split blockers”) including BN023 , BN024, BN025, and BN026, function as well as XGEN blocking oligonucleotides (Integrated DNA Technologies, Coralville, IA) as measured by read-augmented enrichment; experiments using a blocker that blocks only part of the adapter do not function as well.

Example 5 - Hybridization Buffer

[00332] This example shows comparisons of target binding using an unimproved hybridization buffer and an enhanced hybridization buffer.

[00333] Hybridization and coupling were performed as described in Example 1 using XGEN blocking oligonucleotides (Integrated DNA Technologies, Coralville, IA) and an advanced hybridization buffer containing the concentrations of dextran sulfate indicated in FIG. 7A. The resulting bound DNAs were sequenced and read enrichment was calculated using Enrichment v3.0 BASESPACE App (Illumina, Inc., San Diego, CA). The results are shown in FIG. 7A. The inclusion of dextran sulfate allows rapid hybridization (60 minutes - 90 minutes) in a large volume (100 μl) of hybridization buffer.

[00334] Enrichment using a 100 μl volume of hybridization buffer is assessed using four different panels of probes: Coding Exome Oligos (CEX) (Illumina, Inc., San Diego, CA), IDT Exome Research Panel ( exome IDT) (Integrated DNA Technologies, Coralville, IA), TRUSIGHT Cancer Panel (Illumina, Inc., San Diego, CA), and TRUSIGHT One Sequencing Panel (TSO) (Illumina, Inc., San Diego, CA). Hybridization was tested in three hybridization buffers: IDT buffer from the XGEN LOCKDOWN kit (Integrated DNA Technologies, Coralville, IA) and hybridization buffer in the presence and absence of dextran sulfate as described in Example 1. The results are shown in FIG. 7B. The enhanced hybridization buffer provides similar or better target results than the IDT buffer for all four probe panels (ranging from 4000 to 450,000 probes).

[00335] Two key enrichment metrics (read-augmented enrichment and coverage uniformity) for four panels (CEX, IDT exome, cancer, and TSO) are obtained at different hybridization incubation times, both in the presence and absence of an additional temperature ramping step using Illumina's advanced hybridization buffer with IDT xGen blockers. The results are shown in FIG. 7C. The dashed black line in the left panel indicates the result of hybridization in buffer without dextran sulfate.

[00336] In three experiments, 12-plex library inputs were pooled in volume to a total of 30 μl and enriched using Illumina Advanced IDT XGEN Blocker Hybridization Buffer. Samples are analyzed in various sequencers from Illumina, Inc. (NOVASEQ, NEXTSEQ and ISEQ). A sample concentration step is not required. The results are shown in FIG. 7D-7F. The results show that when using an improved hybridization buffer including dextran sulfate, at most 30 μl of samples can be provided for the hybridization reaction (eg, one sample of 15 μl or a 12-plex reaction of 2.5 μl each). The use of an advanced hybridization buffer allows enrichment of a maximum of 12 samples in a single reaction without the need for a speed vacuum, spin column, or SPRI beads to further reduce the pool volume.

Example 6 - Improved Adapters + Improved Hybridization Buffer

[00337] The enrichment efficiency of the IDT exome panel (Cat # 1056114, Integrated DNA Technologies, Coralville, IA) is tested using: (1) IDT buffer (17 μl) from the XGEN LOCKDOWN kit (Integrated DNA Technologies, Coralville, IA); (2) unimproved hybridization buffer with unimproved adapter blockers (NEXTERA blocker 1 i5 (BN001) and NEXTERA blocker 2 i7 (BN002) in Table 2) in a small (11 μl) reaction volume (TiE0); (3) unimproved hybridization buffer with advanced adapter blockers (XGEN blockers) in a small (11 μl) reaction volume (TiE3); (4) unimproved hybridization buffer with advanced adapter blockers (XGEN blockers) in a large (100 μl) reaction volume (TiE4); and (5) advanced hybridization buffer with advanced adapter blockers (XGEN blockers) in a large (100 μl) reaction volume (TiE9). The results are shown in FIG. 8A and show that enrichment efficiency is improved by using modified blockers, increasing the wash temperature, and/or a crowding agent (dextran sulfate) in the hybridization buffer.

[00338]Enrichment efficiency (as measured using read-augmented enrichment) was assessed for nine panels of probes using an IDT enrichment assay (catalog No. 1080584, Integrated DNA Technologies, Coralville, IA), and an Illumina enrichment assay with enhanced hybridization buffer. High readout enrichment is achieved in 100 µL reaction volumes with different probe panels (from 5004 to 50,000 probes). Probe panels include: (1) XGEN Exome Research Panel (exome IDT) (catalog no. 1056114, Integrated DNA Technologies, Coralville, IA); (2) Twist Human Core Exome Panel (Twist Bioscience, Inc., catalog no. 100254); (3) a panel of Coding Exome Oligos (CEX) (catalog no. 15034575, Illumina, Inc., San Diego, CA); (4) TruSight One panel (Illumina Inc, San Diego, CA, part no. FC-141-1007; probe part no. 15046658); (5) TruSight One Expanded panel (Illumina, Inc San Diego, catalog No. FC-141-2007; probe - catalog No. 20015656); (6) TruSight Cancer Panel (Illumina, Inc., San Diego, CA, catalog no. FC-121-0202; probe catalog no. 15035642); (7) TruSight Cardio panel (Illumina, Inc., San Diego, CA, catalog No. FC-141-1010; probe - catalog no. 15069654); (8) TruSight RNA Fusion Panel (Illumina Inc, San Diego, CA, catalog no. 20000906); (9) ready-made pool of DNA probes for cancer research Oncology DNA Probes Master Pool (OPD1) (Illumina, Inc., catalog No. OP-101-1004; probe - catalog No. 20001565). The results are shown in FIG. 8B. The white bar (column 1) shows the performance of the IDT exome panel in the IDT lockdown enrichment workflow producing the NEXTERA Rapid Capture library (Illumina, Inc., San Diego, CA). Gray bars show panel performance using the Illumina enrichment assay with enhanced hybridization buffer and IDT xGEN adapter blockers. Black horizontal lines show comparative results obtained using the respective panels using the Twist enrichment assay (Twist Bioscience, Inc.) (column 3), Nextera Rapid Capture library acquisition (columns 4-8), or the TruSight Tumor 170 workflow using the panel OPD1 (column 10). The performance of each panel in the Illumina enrichment assay with enhanced hybridization buffer was assessed in at least three independent experiments; Error bars indicate standard deviation.

[00339] Somatic variants are detected through a single hybridization enrichment method using advanced hybridization buffer and XGEN blockers for a panel of 12 genes, 535 probe enrichment libraries derived from the Horizon Discover HD701 quantitative multiplex (QM) DNA standard. The data presented in FIG. 8C show the expected variant frequency (x-axis) versus the detected variant frequency (y-axis). Each panel in FIG. 8C represents different concentrations of high-affinity adapter blockers (IDT XGEN adapter blockers, 0.1x (0.02 mM) and 0.5x (0.1 mM), and a negative control (no high-affinity adapter blockers). Each point represents somatic variant detection , colored by read depth. The dashed red line represents the predicted exact correlation between known variant frequencies and the detected variant frequencies. The blue and gray shading represents the line of best fit and 95% confidence interval, respectively, for the detected variant frequencies compared to the known variant frequencies. The expected variant frequency (x-axis) correlates with the known (identified) variant frequency (y-axis) for IDT XGEN adapter blockers (0.1X (0.02 mM), 0.5X (0.1 mM)), but not correlates with the negative control (without high-affinity adapter blockers)).

Example 7A - Non-PCR Hybrid Linking Using TRUSEQ Libraries with Ligated Adapters

[00340] This example shows a non-PCR hybrid coupling.

[00341] Hybridization is performed using XGEN LOCKDOWN reagents (Integrated DNA Technologies, Coralville, IA), according to package instructions, with the following modifications. Target DNA was prepared using the TRUSEQ adapter ligation method and bound using 100 μl of Dynabeads M-270 streptavidin (Integrated DNA Technologies, Coralville, IA). Hybridization is only incubated for 30 minutes instead of the recommended 4 hours. Then follow the following protocol:

1. Incubate with 10 μl of 0.1 N NaOH, denature the bound library from the probes and release it into solution.

2. Remove the bound library solution from the beads (using a magnet) and neutralize using 10 µl of 200 mM Tris.HCl pH 7.0.

3. (Optional) Add denatured PhiX Control v3 (Illumina, Inc., San Diego, CA) to the sample, at most 7.5 µl of resuspension buffer (RSB) (Illumina, Inc., San Diego, CA).

4. Add 27.5 µl 2x HT1 (hybridization buffer, Illumina, Inc., San Diego, CA)

[00342] The resulting sample (in 55 μl of 1x HT1 buffer) is added directly to the flow cell using a pipette or using a flow cell loading device as described, for example, in US Provisional Patent Application No. 62/564466, filed September 28, 2017. The results are shown in Table 6A. The control (column 1) is analyzed using the same conditions as in non-PCR methods, except that PCR is performed after binding. Initial attempts at non-PCR enrichment are shown in column 2 and show that too few reads resulted in failure to achieve acceptable levels of exome coverage. Only achieved ~18x average target coverage while the target is to exceed ~50x. For the second attempt (column 3), a direct flow cell loading device was used and it was shown that increased DNA input to the hybridization improved the sequencing yield for the non-PCR enrichment method to ~140x, much more than the ~40x target. Reducing the sampling rate for the non-PCR method to 70 million reads (column 4) results in performance similar to (or even superior to) the control.

Example 7B - PCR-Free Hybrid Linking Using NEXTERA Bead-Based Libraries Improves Exome Quality for Short Hybridization Times

[00343] A controlled experiment is conducted using conditions similar to Example 7A, but using libraries prepared using the bead tagmentation library method and using appropriate blocking oligonucleotides. In this experiment, both hybridization duration and PCR amplification are variables. The recommended 4-hour post-binding PCR hybridization reaction (~7.5 hours total, see IDT XGEN protocol) with sequencing using the NextSeq device without direct loading of the flow cell is used as a control (a diagram of this workflow is shown in FIG. 9B ), and compared with two conditions using only 30 min hybridizations (in the presence and absence of post-binding PCR) and with direct flow cell loading (FIG. 9C). Shortening the duration of hybridization and eliminating PCR allows the enrichment method to be carried out in only ~2 hours. A diagram of this process with shortened hybridization time and without PCR is shown in FIG. 9D.

[00344] The results are shown in Table 6B. For all data, reduce the sampling frequency to ~23 million clusters. In the first column (control), the data shows good exome quality, but with a long processing time of ~7.5 hours. When hybridization is shortened by 30 minutes, the protocol duration is reduced to a total of ~4 hours (column 2); however, the number of duplicates during PCR increases compared to the control. Increasing the number of duplicates in PCR also reduces library diversity and corresponding coverage by ~20x. When PCR is removed from the 30-minute workflow (column 3), the number of PCR duplicates is significantly reduced and diversity increases to levels above the control, with a much shorter workflow (2 hours vs. 7.5 hours). This example highlights that PCR omission can improve the quality of hybridization binding reactions by minimizing template duplication during PCR.

Table 6A

Control Without PCR Without PCR+direct loading Without PCR+direct loading Total processing time 4 hours 2 hours 17 minutes 2 hours 17 minutes 2 hours 17 minutes Readings 70000000 17090392 132402247 70026594 Reducing data sampling rate Yes No No Yes Augmented Enrichment 88% 85% 86% 86% Coverage uniformity (Pct > 0.2*average) 99% 98% 99% 99% Average target coverage 76.6 17.9 140.3 81.7 Average target coverage (after deduplication) 60.9 15.8 98.3 64.1 SNV in target 26585 21354 26758 26629 Indels in the target 2082 1078 2638 2348

Table 6B

Hybridization 4 hours Hybridization 30 min Hybridization 30 min (without PCR) Duration of hybridization 4 hours 30 min 30 min PCR after enrichment YES YES No General enrichment TAT 7.5 hour 4 hours 2 hours Augmented Enrichment 92.42±1% 87.03±0.35% 84.72±0.76% Uniformity 98.76±0.14% 98.67±0.04% 98.44±0.13% % duplicates 9.015±0.69% 16.04±0.52% 6.02±0.42% HS library size 102789918±11527768 50909151±1527235 141515722±7601326 Average Area Coverage Depth 45.4±1.13 39±0.14 42.2±0 Target coverage at 20x 89.98±0.91% 85.04±0.22% 87.40±0.77% SNV detection 95.91±2.74% 97.26±0.0% 97.59±0.24% SNV accuracy 99.63±0.05% 99.4±0.05% 99.38±0.01% Identification of indels 80.87 ±5.82% 82.91±0.68% 85.68±0.08% Indels accuracy 91.92%±0.94% 91.01±0.83% 94.49±0.01%

Example 8 - Blocker Comparisons

[00345] Using 0.2 mM blockers BN001 and BN002; BX003 and BX007; BN007 and BN008; BN005 and BN006; or BN023, BN024, BN025 and BN026 (as described in Table 2A) in an improved hybridization buffer, hybridization and coupling are carried out as described in Example 1. "Unmodified" blockers BN001 and BN002 include thymine bases in the blocker regions corresponding to the adapter index region , and bases complementary to the adapter in blocker regions corresponding to the non-index region of the adapter; blockers BN001 and BN002 include unmodified bases and include a 3'-ddC terminal group. Blockers BX003 and BX007 are modified variants of BN001 and BN002, each having two AP-dC-CE-phosphoramidite (G-clamp) substitutions in the blocker regions corresponding to the non-index region of the adapter. Blockers BN007 and BN008 are modified versions of BN001 and BN002 with universal bases (deoxyinosine) in the blocker region corresponding to the index region of the adapter, and BNK-modified bases in the blocker regions corresponding to the non-index region of the adapter. Blockers BN023 and BN025 are modified versions of the BN001 regions that correspond to the non-index region of the adapter and include LNA-modified bases; blockers also include the 3′ spacer C3 instead of the 3′ ddC. Blockers BN024 and BN026 are modified versions of the BN002 regions that correspond to the non-index region of the adapter and include LNA-modified bases; blockers also include the 3′ spacer C3 instead of the 3′ ddC.

[00346] The resulting bound DNAs are sequenced and read-augmented enrichment, a measure of the amount of bound target DNA, is calculated. The results are shown in FIG. 10 and show that various modifications of the “unmodified” blockers improve enrichment with complementary reads in hybridization assays.

Example 9 - Split Blocker Comparisons

[00347] Using 0.2 mM BN001 and BN002; or BN023, BN024, BN025, and BN026 (as described in Table 2A) in an improved hybridization buffer, hybridization and coupling are carried out as described in Example 1. The appropriate adapter includes an 8-nucleotide index or a 10-nucleotide index. The resulting bound DNAs are sequenced and read enrichment is calculated. The results are shown in FIG. 11 and show that the use of "split blockers" (ie, blockers that do not include bases corresponding to the adapter index region) allows the same blockers to be used with adapters having different index sequences and index lengths. These results indicate that split blockers can be used in situations where the accumulation of changes in index design may be unfavorable.

[00348] The complete contents of all patents, patent applications and publications, and electronically available material (including, for example, nucleotide sequences filed, for example, in GenBank and RefSeq, and amino acid sequences filed, for example, in SwissProt, PIR, PRF , PDB, and translations of annotated coding regions in GenBank and RefSeq) cited herein are incorporated herein by reference. In the event that there is any inconsistency between the description of this application and the description(s) of any document the contents of which are incorporated herein by reference, the present description shall control. The foregoing detailed description and examples are provided for clarity of understanding only. No unnecessary restrictions are to be understood from this. The invention is not limited to the exact details shown and described, but instead, changes obvious to one skilled in the art may be included in the invention as defined by the claims.

--->

LIST OF SEQUENCES

<110> ILLUMINA, INC.

ILLUMINA CAMBRIDGE LIMITED

SLATTER, Andrew F., et al.

<120> COMPOSITIONS AND METHODS FOR IMPROVING LIBRARY ENRICHMENT

<130> 01243-0009-00PCT

<150> US 62/764753

<151> 2018-08-15

<160> 123

<170> PatentIn version 3.5

<210> 1

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TN001, Nextera 8 n. adapter - i5

<220>

<221> undefined sign

<222> (30)..(37)

<223> n represents a, c, g or t

<400> 1

aatgatacgg cgaccaccga gatctacacn nnnnnnntcg tcggcagcgt cagatgtgta 60

taagagacag 70

<210> 2

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TN002, Nextera 8 n. adapter - i7

<220>

<221> undefined sign

<222> (25)..(32)

<223> n represents a, c, g or t

<400> 2

caagcagaag acggcatacg agatnnnnnn nngtctcgtg ggctcggaga tgtgtataag 60

agacag 66

<210> 3

<211> 72

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TN003, Nextera 10 n. adapter - i5

<220>

<221> undefined sign

<222> (30)..(39)

<223> n represents a, c, g or t

<400> 3

aatgatacgg cgaccaccga gatctacacn nnnnnnnnnt cgtcggcagc gtcagatgtg 60

tataagac ag 72

<210> 4

<211> 68

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TN004, Nextera 10 n. adapter - i7

<220>

<221> undefined sign

<222> (25)..(34)

<223> n represents a, c, g or t

<400> 4

caagcagaag acggcatacg agatnnnnnn nnnngtctcg tgggctcgga gatgtgtata 60

agagacag 68

<210> 5

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TN005, Nextera short adapter - i5

<400> 5

tcgtcggcag cgtcagatgt gtataagaga cagt 34

<210> 6

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TN006, Nextera short adapter - i7

<400> 6

ctgtctctta tacacatctc cgagcccacg agac 34

<210> 7

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TN007, Nextera nrUMI adapter - i5

<220>

<221> undefined sign

<222> (35)..(40)

<223> n represents a, c, g or t

<400> 7

tcgtcggcag cgtcagatgt gtataagaga cagtnnnnnn t 41

<210> 8

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TN008, Nextera nrUMI adapter - i7

<220>

<221> undefined sign

<222> (1)..(6)

<223> n represents a, c, g or t

<400> 8

nnnnnnctgt ctcttataca catctccgag cccacgagac 40

<210> 9

<211> 58

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TL001, TruSeq universal adapter - i5

<400> 9

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58

<210> 10

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TL002, TruSeq 6 n. adapter - i7

<220>

<221> undefined sign

<222> (34)..(39)

<223> n represents a, c, g or t

<400> 10

gatcggaaga gcacacgtct gaactccagt cacnnnnnna tctcgtatgc cgtcttctgc 60

ttg 63

<210> 11

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TL003, TruSeq 8 n. adapter - i5

<220>

<221> undefined sign

<222> (30)..(37)

<223> n represents a, c, g or t

<400> 11

aatgatacgg cgaccaccga gatctacacn nnnnnnnaca ctctttccct acacgacgct 60

cttccgatct 70

<210> 12

<211> 65

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TL004, TruSeq 8 n. adapter - i7

<220>

<221> undefined sign

<222> (34)..(41)

<223> n represents a, c, g or t

<400> 12

gatcggaaga gcacacgtct gaactccagt cacnnnnnnn natctcgtat gccgtcttct 60

gcttg 65

<210> 13

<211> 72

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TL005, TruSeq 10 n. adapter - i5

<220>

<221> undefined sign

<222> (30)..(39)

<223> n represents a, c, g or t

<400> 13

aatgatacgg cgaccaccga gatctacacn nnnnnnnnna cactctttcc ctacacgacg 60

ctcttccgat ct 72

<210> 14

<211> 67

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TL006, TruSeq 10 n. adapter - i7

<220>

<221> undefined sign

<222> (34)..(43)

<223> n represents a, c, g or t

<400> 14

gatcggaaga gcacacgtct gaactccagt cacnnnnnnn nnnatctcgt atgccgtctt 60

ctgcttg 67

<210> 15

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TL007, TruSeq short adapter - i5

<400> 15

acactctttc cctacacgac gctcttccga tct 33

<210> 16

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TL008, TruSeq short adapter - i7

<400> 16

gatcggaaga gcacacgtct gaactccagt cac 33

<210> 17

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TL009, TruSeq nrUMI adapter - i5

<220>

<221> undefined sign

<222> (34)..(39)

<223> n represents a, c, g or t

<400> 17

acactctttc cctacacgac gctcttccga tctnnnnnnt 40

<210> 18

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TL010, TruSeq nrUMI adapter -i5

<220>

<221> undefined sign

<222> (1)..(6)

<223> n represents a, c, g or t

<400> 18

nnnnnnagat cggaagagca cacgtctgaa ctccagtcac 40

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: p5 sequence

<400> 19

aatgatacgg cgaccaccga 20

<210> 20

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: p7 sequence

<400> 20

tcgtatgccg tcttctgctt g 21

<210> 21

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: sequence reverse complementary to P7 (P7')

<400> 21

caagcagaag acggcatacg a 21

<210> 22

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TruSeq i7 adapter region

<400> 22

gatcggaaga gcacacgtct gaactccagt cac 33

<210> 23

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TruSeq adapter region i5

<400> 23

acactctttc cctacacgac gctcttccga tc 32

<210> 24

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: sequence V2.A14.METS

<400> 24

tcgtcggcag cgtcagatgt gtataagaga cag 33

<210> 25

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: sequence V2.B15.METS

<400> 25

gtctcgtggg ctcggagatg tgtataagag acag 34

<210> 26

<211> 6

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: N-member domain (e.g. UMI)

<220>

<221> undefined sign

<222> (1)..(6)

<223>n is a mixture of 25 percent each of A, T, C or G

<400> 26

nnnnnn 6

<210> 27

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN001, Nextera Blocker 1 i5

<400> 27

aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60

taagagacag 70

<210> 28

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN002, Nextera Blocker 2 i7

<400> 28

caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60

agacag 66

<210> 29

<211> 71

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN003, Primer C NRCBLK1

<400> 29

gctgtctctt atacacatct gacgctgccg acgatttttt ttgtgtagat ctcggtggtc 60

gccgtatcatt 71

<210> 30

<211> 67

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN004, Primer C NRCBLK2

<400> 30

gctgtctctt atacacatct ccgagcccac gagacttttt tttatctcgt atgccgtctt 60

ctgcttg 67

<210> 31

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN005, TiS517 with index sequence base pairing example

<400> 31

aatgatacgg cgaccaccga gatctacacg cgtaagatcg tcggcagcgt cagatgtgta 60

taagagacag 70

<210> 32

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN006, TiS701 with index sequence base pairing example

<400> 32

caagcagaag acggcatacg agattcgcct tagtctcgtg ggctcggaga tgtgtataag 60

agacag 66

<210> 33

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN007, TiBNK7

<400> 33

aatgatacgg cgaccaccga gatctacact cgtcggcagc gtcagatgtg tataagac 60

ag 62

<210> 34

<211> 58

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN008, TiBNK8

<400> 34

caagcagaag acggcatacg agatgtctcg tgggctcgga gatgtgtata agagacag 58

<210> 35

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN009, TiZNK7

<400> 35

aatgatacgg cgaccaccga gatctacact cgtcggcagc gtcagatgtg tataagac 60

ag 62

<210> 36

<211> 58

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN010, TiZNK8

<400> 36

caagcagaag acggcatacg agatgtctcg tgggctcgga gatgtgtata agagacag 58

<210> 37

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN011, TiBNK11

<400> 37

aatgatacgg cgaccaccga gatctacact cgtcggcagc gtcagatgtg tataagac 60

ag 62

<210> 38

<211> 58

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN012, TiBNK12

<400> 38

caagcagaag acggcatacg agatgtctcg tgggctcgga gatgtgtata agagacag 58

<210> 39

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN013, TiBNK15G

<400> 39

aatgatacgg cgaccaccga gatctacacg tcgtcggcag cgtcagatgt gtataagaga 60

cag 63

<210> 40

<211> 59

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN014, TiBNK16G

<400> 40

caagcagaag acggcatacg agatggtctc gtgggctcgg agatgtgtat aagagacag 59

<210> 41

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN015, TiBNK15N

<220>

<221> undefined sign

<222> (30)..(30)

<223> n represents a, c, g or t

<400> 41

aatgatacgg cgaccaccga gatctacacn tcgtcggcag cgtcagatgt gtataagaga 60

cag 63

<210> 42

<211> 59

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN016, TiBNK16N

<220>

<221> undefined sign

<222> (25)..(25)

<223> n represents a, c, g or t

<400> 42

caagcagaag acggcatacg agatngtctc gtgggctcgg agatgtgtat aagagacag 59

<210> 43

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN017, TiZNK11

<400> 43

aatgatacgg cgaccaccga gatctacact cgtcggcagc gtcagatgtg tataagac 60

ag 62

<210> 44

<211> 58

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN018, TiZNK12

<400> 44

caagcagaag acggcatacg agatgtctcg tgggctcgga gatgtgtata agagacag 58

<210> 45

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN019, TiZNK15G

<400> 45

aatgatacgg cgaccaccga gatctacacg tcgtcggcag cgtcagatgt gtataagaga 60

cag 63

<210> 46

<211> 59

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN020, TiZNK16G

<400> 46

caagcagaag acggcatacg agatggtctc gtgggctcgg agatgtgtat aagagacag 59

<210> 47

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN021, TiZNK15N

<220>

<221> undefined sign

<222> (30)..(30)

<223> n represents a, c, g or t

<400> 47

aatgatacgg cgaccaccga gatctacacn tcgtcggcag cgtcagatgt gtataagaga 60

cag 63

<210> 48

<211> 59

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN022, TiZNK16N

<220>

<221> undefined sign

<222> (25)..(25)

<223> n represents a, c, g or t

<400> 48

caagcagaag acggcatacg agatngtctc gtgggctcgg agatgtgtat aagagacag 59

<210> 49

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN023, P5ZNK

<400> 49

aatgatacgg cgaccaccga gatctacac 29

<210> 50

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN024, P7ZNK

<400> 50

caagcagaag acggcatacg agat 24

<210> 51

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN025, TiZNKS1

<400> 51

tcgtcggcag cgtcagatgt gtataagaga cag 33

<210> 52

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN026, TiZNKS2

<400> 52

gtctcgtggg ctcggagatg tgtataagag acag 34

<210> 53

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN027, TiZNK17

<400> 53

ggcgaccacc gagatctaca ctcgtcggca gcgtcagatg tg 42

<210> 54

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN028, TiZNK18

<400> 54

ggcatacgag atgtctcgtg ggctcggaga tgtgtataag ag 42

<210> 55

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN029, P5BNK-full

<400> 55

aatgatacgg cgaccaccga gatctacac 29

<210> 56

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN030, P7BNK-complete

<400> 56

caagcagaag acggcatacg agat 24

<210> 57

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN031, TiBNKS1-completely

<400> 57

tcgtcggcag cgtcagatgt gtataagaga cag 33

<210> 58

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN032, TiBNKS2-completely

<400> 58

gtctcgtggg ctcggagatg tgtataagag acag 34

<210> 59

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN033, P5BNC-half

<400> 59

aatgatacgg cgaccaccga gatctacac 29

<210> 60

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN034, P7BNC-half

<400> 60

caagcagaag acggcatacg agat 24

<210> 61

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN035, TiBNKS1-half

<400> 61

tcgtcggcag cgtcagatgt gtataagaga cag 33

<210> 62

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN036, TiBNKS2-half

<400> 62

gtctcgtggg ctcggagatg tgtataagag acag 34

<210> 63

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN037, P5BNK-Alt

<400> 63

aatgatacgg cgaccaccga gatctacac 29

<210> 64

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN038, P7BNK-Alt

<400> 64

caagcagaag acggcatacg agat 24

<210> 65

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN039, TiBNKS1-Alt

<400> 65

tcgtcggcag cgtcagatgt gtataagaga cag 33

<210> 66

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN040, TiBNKS2-Alt

<400> 66

gtctcgtggg ctcggagatg tgtataagag acag 34

<210> 67

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN041, TiBNK3

<400> 67

aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60

taagagacag 70

<210> 68

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN042, TiBNK4

<400> 68

caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60

agacag 66

<210> 69

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN043, TiBNK1

<400> 69

aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60

taagagacag 70

<210> 70

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN044, TiBNK2

<400> 70

caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60

agacag 66

<210> 71

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL001, CT3 Blocker 1 i7

<400> 71

caagcagaag acggcatacg agattttttt gtgactggag ttcagacgtg tgctcttccg 60

atc 63

<210> 72

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL002, CT3 Blocker 2 i5

<400> 72

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatc 57

<210> 73

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL003, TSLTZNK13

<400> 73

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatc 57

<210> 74

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL004, TSLTЗНК14

<400> 74

caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57

<210> 75

<211> 61

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL005, TSHTЗНК13

<400> 75

aatgatacgg cgaccaccga gatctacaca cactctttcc ctacacgacg ctcttccgat 60

c 61

<210> 76

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL006, TSHTЗНК14

<400> 76

caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57

<210> 77

<211> 61

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL007, TSHTЗНК15

<400> 77

aatgatacgg cgaccaccga gatctacaca cactctttcc ctacacgacg ctcttccgat 60

c 61

<210> 78

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL008, TSHTЗНК16

<400> 78

caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57

<210> 79

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL009, TSHTЗНК15G

<400> 79

aatgatacgg cgaccaccga gatctacacg acactctttc cctacacgac gctcttccga 60

tc 62

<210> 80

<211> 58

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL010, TSHTЗНК16G

<400> 80

caagcagaag acggcatacg agatggtgac tggagttcag acgtgtgctc ttccgatc 58

<210> 81

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL011, TSHTЗНК15N

<220>

<221> undefined sign

<222> (30)..(30)

<223> n represents a, c, g or t

<400> 81

aatgatacgg cgaccaccga gatctacacn acactctttc cctacacgac gctcttccga 60

tc 62

<210> 82

<211> 58

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL012, TSHTЗНК16N

<220>

<221> undefined sign

<222> (25)..(25)

<223> n represents a, c, g or t

<400> 82

caagcagaag acggcatacg agatngtgac tggagttcag acgtgtgctc ttccgatc 58

<210> 83

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL013, TSLTBNK13

<400> 83

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatc 57

<210> 84

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL014, TSLTBNK14

<400> 84

caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57

<210> 85

<211> 61

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL015, TSHTBNK13

<400> 85

aatgatacgg cgaccaccga gatctacaca cactctttcc ctacacgacg ctcttccgat 60

c 61

<210> 86

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL016, TSHTBNK14

<400> 86

caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57

<210> 87

<211> 61

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL017, TSHTBNK15

<400> 87

aatgatacgg cgaccaccga gatctacaca cactctttcc ctacacgacg ctcttccgat 60

c 61

<210> 88

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL018, TSHTBNK16

<400> 88

caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57

<210> 89

<211> 68

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX001, Nextera Blocker 1_2X

<400> 89

aatgataggc gaccaccgag atctacactt tttttttcgt cggcagcgtc agatgtgtat 60

aagagaag 68

<210> 90

<211> 67

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX002, Nextera Blocker 1_3X

<400> 90

aatgataggc gaccaccgag attacacttt ttttttcgtc ggcagcgtca gatgtgtata 60

agagaag 67

<210> 91

<211> 68

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX003, Nextera Blocker 1_2Xalt

<400> 91

aatgatacgg cgaccaccga gattacactt tttttttcgt cggcagcgtc agatgtgtat 60

aagagaag 68

<210> 92

<211> 67

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX004, Nextera Blocker 1_3Xalt

<400> 92

aatgatacgg cgaccaccga gattacactt tttttttgtc ggcagcgtca gatgtgtata 60

agagaag 67

<210> 93

<211> 64

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX005, Nextera Blocker 2_2X

<400> 93

caagagaaga cggcatacga gatttttttt tgtctcgtgg gctcggagat gtgtataaga 60

gaag 64

<210> 94

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX006, Nextera Blocker 2_3X

<400> 94

caagagaaga cggcatagag attttttttt gtctcgtggg ctcggagatg tgtataagag 60

aag 63

<210> 95

<211> 64

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX007, Nextera Blocker 2_2Xalt

<400> 95

caagcagaag acggcatacg agattttttt ttgttcgtgg gctcggagat gtgtataaga 60

gaag 64

<210> 96

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX008, Nextera Blocker 2_3Xalt

<400> 96

caagcagaag acggcatacg agattttttt ttgttcgtgg gctggagatg tgtataagag 60

aag 63

<210> 97

<211> 61

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX009, Nextera Blocker 1_5X4Y

<400> 97

aatgataggc gacaccgaga ttacactttt tttttcgtcg gagcgtcaga ggaaagagaa 60

g 61

<210> 98

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX010, Nextera Blocker 2_5X4Y

<400> 98

caagagaaga ggcatagaga tttttttttg tctcgtgggt cggagaggaa agagaag 57

<210> 99

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX011, Nextera Blocker 1_5X4Y-external

<400> 99

aatgataggc gacaccgaga ttacac 26

<210> 100

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX012, Nextera Blocker 1_5X4Y-internal

<400> 100

tcgtcggagc gtcagaggaa agagaag 27

<210> 101

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX013, Nextera Blocker 2_5X4Y-external

<400> 101

caagagaaga ggcatagaga t 21

<210> 102

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BX014, Nextera Blocker 2_5X4Y-internal

<400> 102

gtctcgtggg tcggagagga aagagaag 28

<210> 103

<211> 8

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: Thymine bases at index position in oligonucleotides

<400> 103

tttttttt 8

<210> 104

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: Nextera Blocker 1 (15016424) i5, Illumina Nextera Blocker i5

<400> 104

aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60

taagagacag 70

<210> 105

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: Nextera Blocker 2 (15016425) i7, Illumina Nextera Blocker i7

<400> 105

caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60

agacag 66

<210> 106

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TiBNK1, Nextera Blocker 1_3XCG

<400> 106

aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60

taagagacag 70

<210> 107

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TiBNK2, Nextera Blocker 2_3XCG

<400> 107

caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60

agacag 66

<210> 108

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TiBNK3, Nextera Blocker 1_6XCG

<400> 108

aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60

taagagacag 70

<210> 109

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TiBNK4, Nextera Blocker 2_6XCG

<400> 109

caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60

agacag 66

<210> 110

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TiBNK5, Nextera Blocker 1_10XCG

<400> 110

aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60

taagagacag 70

<210> 111

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TiBNK6, Nextera Blocker 2_10XCG

<400> 111

caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60

agacag 66

<210> 112

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TiS517, C-specific blocker 517

<400> 112

aatgatacgg cgaccaccga gatctacacg cgtaagatcg tcggcagcgt cagatgtgta 60

taagagacag 70

<210> 113

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: TiS701, C-specific blocker 701

<400> 113

caagcagaag acggcatacg agattcgcct tagtctcgtg ggctcggaga tgtgtataag 60

agacag 66

<210> 114

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL007, TSHTЗНК15G

<400> 114

aatgatacgg cgaccaccga gatctacacg acactctttc cctacacgac gctcttccga 60

tc 62

<210> 115

<211> 58

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL008, TSHTЗНК16G

<400> 115

caagcagaag acggcatacg agatggtgac tggagttcag acgtgtgctc ttccgatc 58

<210> 116

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL009, TSHTЗНК15N

<220>

<221> undefined sign

<222> (30)..(30)

<223> n represents a, c, g or t

<400> 116

aatgatacgg cgaccaccga gatctacacn acactctttc cctacacgac gctcttccga 60

tc 62

<210> 117

<211> 58

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BL010, TSHTЗНК16N

<220>

<221> undefined sign

<222> (25)..(25)

<223> n represents a, c, g or t

<400> 117

caagcagaag acggcatacg agatngtgac tggagttcag acgtgtgctc ttccgatc 58

<210> 118

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN023, P5ZNK

<400> 118

aatgatacgg cgaccaccga gatctacac 29

<210> 119

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN024, P7ZNK

<400> 119

caagcagaag acggcatacg agat 24

<210> 120

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN025, TiZNKS1

<400> 120

tcgtcggcag cgtcagatgt gtataagaga cag 33

<210> 121

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN026, TiZNKS2

<400> 121

gtctcgtggg ctcggagatg tgtataagag acag 34

<210> 122

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN027, TiZNK17

<400> 122

ggcgaccacc gagatctaca ctcgtcggca gcgtcagatg tg 42

<210> 123

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic: BN028, TiZNK18

<400> 123

ggcatacgag atgtctcgtg ggctcggaga tgtgtataag ag 42

<---

Claims (18)

1. Hybridization buffer containing: 1.5% (w/v) dextran sulfate, 0.2 mg/ml human Cot-1 DNA, 10% (v/v) formamide, 66.6 mM KH ₂ PO ₄ - K ₂ HPO ₄ , 0.8 M NaCl, 0.04% (v/v) TWEEN 20, and improved adapter blockers. 2. A method for producing an enriched library containing a collection of nucleic acid members, comprising preparing a hybridization mixture containing the library members, a hybridization buffer according to claim 1, and a probe to obtain the hybridization mixture, under conditions suitable for hybridizing the probe to the region of interest in a library member where the probe contains a ligand. 3. The method according to claim 2, including: binding the probe after it has been hybridized using a binding agent, and eluting the bound library members from the binding means into an eluant containing the enriched library members, where the DNA concentration in the eluant is in the range of 1.3-250 pM. 4. The method according to claim 2 or 3, where the hybridization mixture contains samples from at least two library preparations, where at least 10 ng, at least 25 ng, at least 50 ng, at least 100 ng are combined, at least 200 ng or at least 500 ng of DNA from each library preparation. 5. Method according to any one of paragraphs. 2-4, where the DNA concentration in the hybridization mixture is in the range of 0.1-120 ng/μl. 6. Method according to any one of paragraphs. 2-5, comprising sequencing enriched library members, and wherein the method does not include amplifying the library members before linking the library members. 7. The method of claim 6, wherein the sequencing is carried out in a flow cell, and the method includes adding enriched library members to the flow cell at a concentration of at least 1.1 pM, at least 1.2 pM, at least 1.3 pM , at least 10 pM or at least 100 pM, and at a concentration of at most 100 pM, at most 200 pM, at most 250 pM or at most 300 pM. 8. The method of claim 7, comprising introducing the enriched library members into the flow cell using a device for directly loading the flow cell. 9. A kit for obtaining an enriched library containing a collection of nucleic acid members, which contains the hybridization buffer according to claim 1 and instructions for use.