RU2295954C2 - Microparticles for delivery of heterologous nucleic acids - Google Patents

Abstract

FIELD: medicine, organic chemistry, biochemistry, pharmacy.

SUBSTANCE: invention relates to microparticles with adsorbing surface and methods for preparing such particles and methods for their using. Microparticles comprise polymer, for example, poly-(α-hydroxyacid) and they are formed by using cationic, anionic and nonionic detergents, and microparticles as submicron emulsions and oil-drop emulsion containing oil and emulsifying agent able for metabolic processes. Surface of microparticles adsorbs polypeptides, such as antigens, and nucleic acids, for example, ELVIS vectors and other vector constructions comprising heterologous nucleotide sequences encoding biologically active macromolecules, such as polypeptides, antigens and adjuvants. Also, invention describes using microparticle-containing compositions used in producing medicinal agents. The advantage of invention involves the development of medicinal agent carriers of enhanced effectiveness.

EFFECT: improved and valuable properties of microparticles.

53 cl, 21 tbl, 19 ex

Description

Technical area

The present invention generally relates to pharmaceutical compositions. In particular, the invention relates to polymer microparticles or submicron emulsions having adsorption surfaces on which biologically active agents, in particular nucleic acids, such as plasmid DNA, Eukaryotic Layered Vector Initiation Systems; ELVIS vectors, or constructs of RNA vectors, to methods for producing such microparticles and submicron emulsions and to methods for their use, including the induction of an immune response, vaccines and the delivery of heterologous cleotide sequences in eukaryotic cells and animals.

BACKGROUND

Particle-based carriers were used to achieve controlled parenteral drug delivery. Such carriers are designed to maintain an active agent in the delivery system for a long period of time. Examples of particulate carriers include those derived from polymethylmethacrylate polymers, as well as microparticles derived from poly (lactides) (see, for example, US Pat. No. 3,773,919), poly (lactide glycolides) known as PLG (see, for example, US patent No. 4767628), and polyethylene glycol known as PEG (see, for example, US patent No. 5648095).

Polymethyl methacrylate polymers are not subject to degradation, while PLG particles are degraded under biological conditions due to random non-enzymatic hydrolysis of ester bonds to lactic and glycolic acids, which are excreted by the usual metabolic pathways.

For example, US Pat. No. 5,648,095 describes the use of microspheres with encapsulated pharmaceuticals as drug delivery systems for nasal, oral and pulmonary delivery.

Slow release preparations containing various polypeptide growth factors are also described. See, for example, International Publication No. WO 94/12158, US patent 5134122 and International Publication No. WO 96/37216.

Fattal et al., Journal of Controlled Release 53: 137-143 (1998), describe nanoparticles derived from polyalkyl cyanoacrylates (PACA) containing adsorbed oligonucleotides.

Particle-based carriers, such as microparticles, have also been used with adsorbed or trapped antigens in an attempt to elicit an adequate immune response. Such carriers represent the immune system multiple copies of the selected antigen and contribute to the capture and retention of antigens in the regional lymph nodes. These particles can be phagocytosed by macrophages and can enhance the presentation of antigen by the release of cytokines. The co-pending patent application No. 09/015652, filed on January 29, 1998, owned by the present applicant, describes the use of microparticles with an adsorbed or encapsulated antigen to stimulate a cell-mediated immune response, as well as methods for producing such microparticles.

In the joint application for the grant of patent No. 09/015652, for example, a method of forming microparticles is described, which involves combining a polymer with an organic solvent followed by the addition of an emulsion stabilizer such as polyvinyl alcohol (PVA), after which the organic solvent is evaporated, thereby forming microparticles . The surface of the microparticles contains a polymer and a stabilizer. Then, macromolecules such as ELVIS vectors, other nucleotides (DNA or RNA), polypeptides and antigens can be adsorbed onto these surfaces.

Adjuvants are compounds capable of enhancing the immune response to antigens. Adjuvants can enhance both humoral and cellular immunity. However, in the fight against certain pathogenic microorganisms, it is preferable to stimulate cellular immunity, in particular Th1 cells. In many cases, the currently used adjuvants do not induce an adequate Th1 cell response and / or are characterized by harmful side effects.

Currently, the only adjuvant permitted in the United States for human use are aluminum salts (alum). These adjuvants are used in some vaccines, including hepatitis B, diphtheria, polio, rabies, and flu vaccines, but are not to be used in others. So, it was reported that alum did not improve the effectiveness of vaccines against pertussis and typhoid fever and provided only a slight effect in vaccines against adenoviruses. In addition, problems arose such as the induction of granulomas at the injection site and the variation of alum preparations from batch to batch.

It was shown that microparticles from subject to degradation in biological conditions and biocompatible polymers known as poly (lactide-glycolides) (PLG), were effective carriers for a certain amount of antigens. In addition, PLG microparticles can control the rate of release of captured antigens and, thus, have the potential for use in single-dose vaccines. Moreover, it was shown that the introduction of polymers subject to degradation under biological conditions with captured antigens induces a powerful immune response in some experimental animals. O'Hagan et al., Advanced Drug Deliv. Rev., 1998, 32,225-246 and Singh et al., Advanced Drug Deliv. Rev., 1998, 34, 285-304, descriptions of these publications are incorporated by reference in their entirety.

It was shown that an emulsion containing squalene, sorbitan trioleate (Span85 ™) and polysorbate 80 (Tween 80 ™) microfluidized with the formation of microdrops of the same size, i.e. MF59 also induced a potent immune response. MF59 preparations, as shown, induce the formation of antibody titers 5 to> 100 times larger than those obtained with adjuvants based on aluminum salts. MF59 has been shown to enhance the immune response to antigens from many sources, including, for example, herpes simplex virus (HSV), human immunodeficiency virus (HIV), influenza virus, hepatitis C virus (HCV), cytomegalovirus (CMV), hepatitis B virus ( HBV), human papillomavirus (HPV) and the causative agent of malaria. Ott et al., Vaccine Design: The Subunit and Adjuvant Approach, 1995, M. F. Powell and M. J. Newman, Eds., Plenum Press, New York, p. 277-296; Singh et al., Vaccine, 1998,16,1822-1827; Ott et al., Vaccine, 1995,13,1557-1562; O'Hagan et al., Mol. Medicine Today, 1997, February, 69-75; and Taquina et al., J Infect. Dis., 1996,174, 1168-75, descriptions of these publications are incorporated herein by reference in their entirety. An MF59-based adjuvant enhances the immunogenicity of subunit antigens, although the safety and tolerance profile of alum-based adjuvants is maintained. Van Nest et al., Vaccines 92.1992, Cold Spring Harbor Laboratory Press, 57-62; and Valensi et al., J. Immunol., 1994,153,4029-39; descriptions of these publications are incorporated by reference in their entirety. MF59 is further described in co-filed US Patent Application No. 08/434512, filed May 4, 1995, assigned to the assignee of the present invention, the disclosure of which is incorporated by reference in its entirety. In animal studies, it was not found that MF59 is genotoxic, teratogenic and also did not cause sensitization. It turned out that the mechanism of action of MF59 depends on the generation of a powerful response of CD4 + T cells, i.e. from the response of Th2 cells. However, adjuvants based on MF59 weakly, if at all stimulate, Th1 cell responses or cytotoxic T lymphocyte (CTL) responses.

It has been demonstrated that oligonucleotides containing CpG motifs, when mixed with an antigen, induce a potent immune response of Th1 cells. Roman et al., Nat. Med., 1997,3,849-854; Weiner et al., Proc. Natl. Acad. Sci. USA 1997,94,10833-10837; Davis et al., J. Immunol., 1998,160,870-876; Chu et al., J. Exp. Med., 1997,186,1623-1631; Lipford et al., Eur. J. Immunol., 1997.27, 2340-2344; and Moldoveanu et al., Vaccine, 1988, 16, 1216-1224, descriptions of these publications are incorporated herein by reference in their entirety. Unmethylated CpG dinucleotides are relatively common in bacterial DNA, but are poorly represented and methylated in vertebrate DNA. Bird, Trends Genet, 1987, 3, 342-347. Bacterial DNA or synthetic oligonucleotides containing unmethylated CpG motifs are known to also induce an immune response, including, for example, B cell proliferation, secretion of immunoglobulin-6, and apoptosis resistance. Krieg et al., Nature, 1995, 374, 546-549; Klinman et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 2879-2883; Ballas et al., J. Immunol., 1996, 157, 1840-1845; Cowdery et al., J. Immunol., 1996, 156, 4570-4575; Halpern et al., Cell. Immunol., 1996,167,72-78; Yamamoto et al., Jpn. J Cancer Res., 1988,79,866-873; Stacey et al., J. Immunol., 1996, 157, 2116-2122; Messina et al., J. Immunol., 1991, 147, 1759-1764; Yi et al., J. Immunol., 1996, 157, 4918-4925; Yi et al., J. Immunol., 1996, 157, 5394-5402; Yi et al., J. Immunol., 1998, 160, 4755-4761; and Yi et al., J. Immunol., 1998, 160, 5898-5906; PCT Publication WO 96/02555; PCT Publication WO 98/16247; PCT Publication WO 98/18810; PCT Publication WO 98/40100; PCT Publication WO 98/55495; PCT Publication WO 98/37919; and PCT Publication WO 98/52581, descriptions of these publications are incorporated herein by reference in their entirety.

It is also shown that emulsions based on cationic lipids can be used as carriers for genes. See, for example, Yi et al., Proc. Int'l. Symp Control Rel. Bioact. Mater. 24: 653-654 (1997); Kim et al., Proc. Int'l. Symp Control Rel. Bioact. Mater., 25: 344-345 (1998); Kim et al., Proc. Int'l. Symp Control Rel. Bioact. Mater., 26; # 5438 (1999). Initially, it was shown that cationic submicron emulsions, which are only a recently used approach for pharmaceutical delivery, have carrier activity against low molecular weight drugs (Elbaz et al. 1993 Int. J. Pharm. 96 R1-R6). The use of a charged surface to stabilize the binding and protection of serum oligonucleotides has been demonstrated for both low molecular weight oligomers (Teixera et al (1999) Pharm Res 16 30-36) and plasmid DNA (Yi et al. (2000) Pharm Res 17 314320.) Shown that DOTAP-based emulsions enhance in vitro and in vivo transfection (Kim et al., supra).

Thus, an adjuvant is required that stimulates the response of Th1 cells, which may have prophylactic and therapeutic applications. Such a response may be useful, for example, in the treatment of viral infections, as well as in the immunization of subjects susceptible to viral infections.

US Pat. Nos. 5,814,482 and 6,015,686 describe Eukaryotic Layered Vector Initiation Systems (ELVIS vectors), in particular those that originate from and are constructed from alphavirus genomes (such as the Sindbis virus) that are used, among others. methods of use, for stimulating the immune response to an antigen, for methods of inhibiting pathogenic agents and for delivering heterologous nucleotide sequences to eukaryotic cells and to animals.

In the joint International application PCT / US99 / 17308 and the application for the grant of US patent 09/715902 describes methods for producing microparticles with adsorbed macromolecules, such as pharmaceuticals, polynucleotide, polypeptide, protein, hormone, enzyme, mediator of transcription or translation, an intermediate product of the metabolic pathway , immunomodulator, antigen, adjuvant, or combinations thereof, and the like.

In the joint application for the grant of International patent PCT / USOO / 03331 describes methods for producing submicron emulsions with adsorbed macromolecules, such as pharmaceuticals, polynucleotide, polypeptide, protein, hormone, enzyme, mediator of transcription or translation, an intermediate product of the metabolic pathway, immunomodulator, antigen, adjuvant or combinations thereof, and the like.

SUMMARY OF THE INVENTION

The authors of the present invention have found that the effectiveness of various methods of using nucleic acids, in particular, vector constructs capable of expressing a nucleic acid sequence, and, more specifically, vector constructs comprising a heterologous nucleic acid sequence encoding an antigen, such as pCMV vectors , vectors, ELVIS, or vector RNA constructs, can be enhanced by adsorption of these vector constructs on polymer microparticles or submicrons emulsions with adsorption surfaces, which facilitates the introduction of vector constructs and heterologous nucleic acid sequences included in vector constructs into animal cells.

As disclosed in the International Patent Application PCT / US99 / 17308 described above, a method of forming microparticles with adsorption surfaces capable of adsorbing a wide variety of macromolecules has been invented. In one embodiment, these microparticles consist of both a polymer and a detergent. The microparticles of the invention adsorb such macromolecules more efficiently than other currently available microparticles.

In some embodiments of the present invention, microparticles derived from a polymer such as poly- (α-hydroxyacid), polyhydroxybutyric acid, polycaprolactone, polyorthoester, polyanhydride, polyalkylcyanoacrylate, polycyanoacrylate and the like are used, and they are formed with the participation of detergents such as cationic, anionic and non-ionic detergents, and these detergents can be used in combination. The authors of the present invention found that these microparticles contribute to improved adsorption of vector constructs (for example, ELVIS vectors, vector RNA constructs), as well as viral antigens and provide a higher immune response.

As disclosed in the International Patent Application PCT / US00 / 03331 described above, a microparticle preparation was invented containing oil-drop submicron emulsions with ionic surfactants. Such compositions readily adsorb macromolecules such as DNA, protein, and other antigenic molecules. In some embodiments of the present invention, microparticles are used which are derived from an oil-drop emulsion, preferably comprising a metabolizable oil and an emulsifying agent, which are preferably present in the form of an oil-in-water emulsion containing oil droplets substantially all of which are less than 1 micron in diameter. preferably less than 250 nm. Preferably, the composition exists in the absence of any polyoxypropylene-polyoxyethylene block copolymers. The oil is preferably an animal oil, an unsaturated hydrocarbon, a terpenoid, for example, such as squalene, or vegetable oil. The composition preferably includes in volume from 0.5 to 20% oil in an aqueous medium. The emulsifying agent is preferably a non-ionic detergent, such as a polyoxyethylene sorbitan mono-, di- or tri-ester, or a sorbitan mono-, di- or tri-ester. Preferably, the composition includes by weight from about 0.01 to 5% emulsifying agent.

Thus, in some embodiments, the particle-related portion of the composition of the invention is an adsorbed surface microparticle, wherein the microparticle includes a polymer selected from the group consisting of poly- (α-hydroxy acid), polyhydroxybutyric acid, polycaprolactone, polyorthoester, polyanhydride and polycyanoacrylate.

In another embodiment, the particle portion of the composition according to the invention is represented by a submicron emulsion comprising an oil-drop emulsion formulated with an ionic detergent.

In other embodiments, the microparticle further includes vector constructs capable of expressing a nucleic acid sequence, for example, selected from an ELVIS vector or vector RNA construct adsorbed on the surface of the microparticles, the vector construct comprising a heterologous nucleotide sequence encoding a polypeptide, protein, hormone, enzyme , mediator of transcription or translation, metabolic pathway intermediate, immunomodulator, antigen, adjuvant, or a combination thereof AI and the like.

In other embodiments, the invention provides a microparticle composition comprising a nucleic acid, preferably vector constructs capable of expressing a nucleic acid sequence, such as a pCMV vector, an ELVIS vector, or a vector RNA construct adsorbed on microparticles of the invention, and a pharmaceutically acceptable excipient .

In other implementations, this invention relates to a method for producing microparticles with adsorbed nucleic acid, preferably with vector constructs capable of expressing a nucleic acid sequence, such as an ELVIS vector or vector RNA construct, the method comprising:

(a) combining a polymer solution containing a polymer selected from the group consisting of poly- (α-hydroxy acid), polyhydroxybutyric acid, polycaprolactone, polyorthoester, polyanhydride and polycyanoacrylate, where the polymer is present in a concentration of from about 1% to 30% , in an organic solvent, with an anionic, cationic or nonionic detergent, where the detergent is present in a ratio between detergent and polymer of 0.001 to 10 (w / w) to form a detergent / polymer mixture;

(b) dispersing a detergent / polymer mixture;

(c) removing the organic solvent;

(d) microparticle formation;

(f) adsorption of an ELVIS vector or vector RNA construct on the surface of a microparticle, where the ELVIS vector or vector RNA construct contains a heterologous nucleotide sequence encoding a polypeptide, protein, hormone, enzyme, transcription or translation mediator, metabolic pathway intermediate, immunomodulator, antigen adjuvant, or combinations thereof and the like.

Preferably, the polymer / detergent mixture is emulsified to form an emulsion before removal of the organic solvent.

In other implementations, the invention relates to the above methods. More preferably, a microparticle composition is produced that also includes a pharmaceutically acceptable excipient.

In other implementations, the present invention relates to a method for delivering a heterologous nucleotide sequence related to a vertebrate subject, which comprises administering to the vertebrate subject any of the compositions described above.

In further embodiments, the present invention relates to a method for inducing a vertebrate-related cellular immune response comprising administering to the vertebrate-related subject a therapeutically effective amount of a selected heterologous nucleic acid sequence adsorbed on microparticles of the invention.

In other implementations, the present invention relates to a method of immunization, comprising administering to a vertebrate subject a therapeutically effective amount of any of the microparticle compositions described above. This composition may optionally contain unbound macromolecules and may also optionally contain adjuvants, including aluminum salts such as aluminum phosphate, or an oligonucleotide containing at least one CpG motif.

In some preferred embodiments, the microparticles are formed from poly- (α-hydroxyacids), more preferably from poly- (D, L-lactide-glycolide), and most preferably from poly- (D, L-lactide-glycolide).

Each of the non-limiting examples of the previously described adsorption microparticles may also optionally contain macromolecules trapped within them or in free solution. Thus, the present invention relates to a variety of combinations in which nucleic acid molecules are adsorbed on microparticles and other nucleic acid molecules are captured or adsorbed. Moreover, the microparticles according to the invention may contain adsorbed more than one type of nucleic acid, as well as other adsorbed antigenic macromolecules. In addition, the microparticles may contain trapped within themselves various types of nucleic acids and / or other antigenic macromolecules.

In other preferred embodiments, the microparticles are prepared as submicron emulsions as described above.

The present invention also relates to immunogenic compositions comprising an immunostimulatory amount of nucleic acid (e.g., a vector construct capable of expressing a nucleic acid sequence, such as a selected ELVIS vector or RNA vector construct, where the heterologous part of the nucleotide sequence of an ELVIS vector or vector RNA- constructs can encode antigen), and an immunostimulatory amount of the adjuvant composition described herein. In some embodiments of the invention, the immunogenic composition comprises a CpG oligonucleotide in combination with adsorbed nucleic acid microparticles. The adsorbed macromolecule, as such, is preferably an ELVIS vector or vector RNA construct encoding an antigenic polypeptide.

In some preferred embodiments of the invention, the antigenic polypeptide is derived from a virus, such as, for example, hepatitis C virus (HCV), hepatitis B virus (HBV), herpes simplex virus (HSV), human immunodeficiency virus (HIV), cytomegalovirus (CMV), virus flu (flu) and rabies virus. Preferably, the antigenic polypeptide is selected from the group consisting of glycoprotein gD HSV, glycoprotein gp120 HIV, glycoprotein gp140 HIV, p55 gag and polypeptides from regions pol and tat HIV. In other preferred embodiments, the antigenic polypeptide is derived from a bacterium, such as, for example, cholera, diphtheria, tetanus, streptococcus (e.g., streptococcus B), pertussis, Neisseria meningitidis (e.g., meningitis B), Neisseria gonorrhoeae, Helicobacter pylus Hayl influenza. In other preferred embodiments of the invention, the antigenic polypeptide is derived, for example, from a parasite such as a malaria parasite.

Adjuvant compositions may include, for example, aluminum salts. Alternatively, adjuvant compositions may contain an oligonucleotide containing at least one CpG motif. The adjuvant composition may also contain an optional component, which will lead to the formation of a positively charged emulsion. The oligonucleotide preferably includes at least one phosphorothioacid bond or a peptide nucleic acid bond. In a preferred embodiment of the invention, the oligonucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-28. In other preferred embodiments of the invention, the oligonucleotide contains a CpG motif flanked by two purine residues directly in the 5'-direction from the motif, and two pyrimidine residues directly in the 3'-direction from it. In other preferred embodiments of the invention, the oligonucleotide includes a nucleotide sequence selected from the group consisting of SEQ ID NO: 19-28. Most preferred is SEQ ID NO: 28. In some preferred embodiments of the invention, the adjuvant composition further includes a separate immunostimulating agent, which is preferably selected from the group consisting of alum, a component of the bacterial cell wall and muramyl peptide. The adjuvant composition, as such, may be in the form of a second microparticle. The second microparticle may contain a variety of nucleic acids and / or antigenic polypeptides, or other antigenic macromolecules, adsorbed and / or captured. In addition, the immunogenic compositions of the invention may include free nucleic acid in solution.

The present invention also relates to methods of stimulating an immune response in a host animal, comprising administering to the animal an immunogenic composition described herein in an amount effective to elicit an immune response. The host animal is preferably a mammal, more preferably a rhesus monkey and even more preferably a human.

The present invention also relates to methods for immunizing an animal host against a viral, bacterial or parasitic infection, comprising administering to the animal an immunogenic composition described herein in an amount effective to induce a protective response. The host animal is preferably a mammal, more preferably a rhesus monkey, and even more preferably a human.

The present invention also relates to methods for increasing a Th1 immune response, or a CTL response, or lymphoproliferation, or cytokine production in an animal host, comprising administering to an animal an immunogenic composition described herein in an amount effective to induce a Th1 immune response or CTL response, or lymphoproliferation, or cytokine production. The animal is preferably a mammal, more preferably a rhesus monkey, and even more preferably a human.

The present invention also relates to methods for inducing an immune response in a host animal, wherein the animal is first administered microparticle-adsorbed macromolecules containing a heterologous nucleic acid sequence encoding a first antigen (e.g., plasmid DNA, such as pCMV or ELVIS vector, or vector RNA- construct), in an amount effective to induce an immune response. Subsequently, the second antigen is administered to the animal.

The first antigen and the second antigen in these embodiments may be the same or different and, preferably, are the same. Preferred antigens include bacterial and viral antigens, such as HIV antigens (e.g. gp120, gp140, gp160, p24gag or p55gag), hepatitis C virus antigens, influenza A antigens, meningitis B bacterial antigens, and streptococcus B. bacterial antigens. Second antigen preferably adsorbed onto the microparticles described herein or administered together with an adjuvant such as MF59. The specified macromolecule can also, if required, be administered together with an adjuvant. In some preferred embodiments, the macromolecule is administered two or three times before administration of a second antigen, which can also be administered two or more times.

According to one particular embodiment, (1) a macromolecule is administered: (a) during initial administration, (b) in a period of 1 to 8 weeks after initial administration, and (c) in a period of time from 4 to 32 weeks after initial administration, and (2) a second antigen is administered: (a) in a period of time from 8 to 50 weeks after initial administration and (b) in a period of time from 8 to 100 weeks after initial administration.

The delivery of microparticle compositions according to the invention can be accomplished by any of the known methods, including direct injection (for example, subcutaneously, intraperitoneally, intravenously or intramuscularly), and such delivery can also be enhanced by the use of electroporation (see, for example, US patent application 09/499023, description which is incorporated herein by reference in its entirety). Electroporation is the action of cells with short-term electrical impulses to enhance the permeability of cell membranes, thus facilitating the uptake of DNA into cells. Recently, it was found that exposure to tissue in vivo by an electric field significantly enhances DNA uptake and gene expression (Mathiesen, I., 1999, Gene Therapy 6: 508). Examples of tissues subjected to in vivo electroporation are skin, liver, tumors, and muscles. For the use of DNA vaccines, Widera et al. showed that in vivo electroporation significantly enhances the effect of DNA vaccines in mice, guinea pigs and rabbits (Widera, G., et al., 2000, J. Immunol. 164: 4635).

The ELVIS vectors of the above embodiments are generally DNA molecules containing a promoter that functions in a eukaryotic cell, a cDNA sequence whose transcription product is a vector RNA construct (e.g., vector RNA replicon of alphavirus), and a 3'-terminator region. Vector RNA constructs preferably include an RNA genome from picornavirus, togavirus, flavivirus, coronavirus, paramyxovirus, yellow fever virus or alphavirus (e.g., Sindbis virus, Semlica virus, Venezuelan equine encephalitis virus or Ross virus) or preferably, the alphavirus genome, modified by replacing one or more structural protein genes with selected heterologous nucleic acid sequences encoding the gene product of interest. The vector RNA constructs of the invention are obtained primarily by in vitro transcription from a DNA template.

These and other aspects and embodiments of the present invention will be well understood by those of ordinary skill in the art in light of the description herein.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 presents the DNA sequence (SEQ ID NO: 63) encoding the modified p55gag HIV-1 polypeptide.

Figure 2 presents the DNA sequence (SEQ ID NO: 64) encoding the modified p55gag HIV-1 polypeptide.

Figure 3 presents the DNA sequence (SEQ ID NO: 65) encoding a modified HIV-1 enveloped polypeptide.

4 shows a DNA sequence (SEQ ID NO: 66) encoding a modified HIV-1 enveloped polypeptide.

Figure 5 presents the DNA sequence (SEQ ID NO: 67) encoding the modified p55gag HIV-1 polypeptide.

Figure 6 presents the DNA sequence (SEQ ID NO: 68) encoding the modified p55gag HIV-1 polypeptide.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is based on the unexpected discovery that microparticles with adsorbed nucleic acid molecules, preferably vector constructs capable of expressing a nucleic acid sequence, and more preferably vector constructs comprising a heterologous nucleic acid sequence encoding an antigen, such as pCMV vectors, vectors ELVIS or vector RNA constructs elicit an enhanced immune response. In addition, a combination of microparticles with adsorbed nucleic acid molecules (e.g., microparticles with adsorbed pCMV vectors, ELVIS vectors or RNA vector constructs) and adjuvants can be used to induce an enhanced immune response.

The present invention is also based on the unexpected discovery that vector constructs containing antigen encoding nucleic acid sequences, such as pCMV vectors, ELVIS vectors, or RNA vector constructs, in combination with subsequent administration of the antigen, elicit an enhanced immune response.

In the practical implementation of the present invention, conventional methods of chemistry, polymer chemistry, biochemistry, molecular biology, immunology and pharmacology are used, which are within the scope of this field, unless otherwise specified. Such methods are fully covered in the literature. See, for example, Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.); Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell, eds., 1986, Blackwell Scientific Publications); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Handbook of Surface and Colloidal Chemistry (Birdi, KS., Ed, CRC Press, 1997) and Seymour / Carraher's Polymer Chemistry (4th edition, Marcel Dekker Inc., 1996).

All publications, patents and patent applications cited herein, whether listed above or below, are incorporated by reference in their entireties.

Used in this description and the attached claims, the singular include references to the plural, unless the context clearly indicates otherwise. So, for example, the term "microparticle" refers to one or more microparticles, and the like.

A. Definitions

In describing the present invention, the following terms are used, and they mean the following definitions.

Unless otherwise indicated, all percentages and ratios are given here based on mass.

As used herein, the term “microparticle” refers to a particle constituting from about 10 nm to 150 μm in diameter, more preferably from about 200 nm to 30 μm in diameter, and most preferably from about 500 nm to 10 μm in diameter. Preferably, the microparticles are characterized by a diameter that allows for parenteral administration and introduction into the mucous membranes without occlusion of needles and capillaries.

The size of the microparticles is easily determined by methods well known in the art, such as photon correlation microscopy, laser diffractometry, and / or scanning electron microscopy. The term “particle” can also be used to denote a microparticle as defined above.

The polymer microparticles used here are formed from materials that are sterilized, biodegradable, and non-toxic. Such materials include, but are not limited to, poly- (α-hydroxy acid), polyhydroxybutyric acid, polycaprolactone, polyorthoester, polyanhydride, PACA, and polycyanoacrylate. Preferably, the microparticles for use according to the invention are polymer microparticles derived from poly- (α-hydroxy acids), in particular from poly (lactide) (“PLA”) or a copolymer of D, L-lactide and glycolide or glycolic acid, such as poly - (D, L-lactide-glycolide) ("PLG" or "PLGA"), or a copolymer of D, L-lactide and capronolactone. Polymeric microparticles can be derived from any of a variety of polymeric starting materials having different molecular weights and, in the case of copolymers such as PLG, different lactide: glycolide ratios, and their selection can be largely a matter of choice, partially depending on the co-introduced macromolecule. These parameters are discussed more fully below. Alternatively, the microparticles of the invention are included in submicron emulsions.

The expression “drip oil emulsion” as used herein refers to an emulsion comprising a metabolizing oil or an emulsifying agent. As used herein, the term “submicron emulsion” refers to an oil droplet emulsion according to the invention containing droplets ranging in size from about 10 nm to about 1000 nm.

As used herein, the term “microparticle” may refer to a polymer microparticle described herein or a submicron emulsion composition described herein.

The term “detergent” as used herein includes surfactants, dispersing agents, suspending agents, and emulsion stabilizers. Anionic detergents include, but are not limited to, SDS (sodium dodecyl sulfate), SLS (sodium lauryl sulfate), DSS (disulfosuccinate), sulfated fatty alcohols, and the like. Cationic detergents include, but are not limited to, cetrimide (cetyltrimethylammonium bromide, or “CTAB”), benzalkonium chloride, DDA (dimethyldioctodecylammonium bromide), DOTAP (dioleyl-3-trimethylaminopropane) and the like. Non-ionic detergents include, but are not limited to, PVA, povidone (also known as polyvinylpyrrolidone or PVP), sorbitan esters, polysorbates, polyoxyethylene glycol monoesters, polyoxyethylene alkyl phenols, poloxamers and the like.

As used herein, the term "electrokinetic potential" refers to the electric potential that exists between the interface of solids and liquids, i.e. potential between the diffuse layer of ions surrounding a charged colloidal particle. The electrokinetic potential can be calculated from the electrophoretic mobility, i.e. of the speeds at which colloidal particles move between charged electrodes placed in contact with the substance to be measured, using methods well known in the art.

As used herein, the term “macromolecule” without limitation refers to a pharmaceutical agent, polynucleotide, polypeptide, hormone, enzyme, metabolic pathway intermediate, immunomodulator, antigen, adjuvant, or combinations thereof. Specific macromolecules for use according to the invention are described in more detail below.

The term "pharmaceutical agent" refers to biologically active compounds, such as antibiotics, antiviral agents, growth factors, hormones and the like, described in more detail below.

The term “adjuvant” refers to any substance that promotes or modulates the effect of a pharmaceutical, including but not limited to adjuvants that enhance the immune response to a antigen or make it more diverse.

A “polynucleotide” is a nucleic acid polymer that typically encodes a biologically active (eg, immunogenic or therapeutic) protein or polypeptide. Depending on the nature of the polypeptide encoded by the polynucleotide, the polynucleotide may include only 10 nucleotides, for example, in the case where the polynucleotide encodes an antigen. Moreover, a “polynucleotide” can include both double and single stranded sequences, and refers as non-limiting examples to cDNA from viral, prokaryotic or eukaryotic mRNA, genomic RNA sequences and viral DNA (eg, from RNA and DNA viruses, and retroviruses) or prokaryotic DNA, and especially to synthetic DNA sequences. The term also refers to sequences containing any of the known basic analogues of DNA and RNA. The term also includes modifications to the native sequence, such as deletions, additions and substitutions (mostly conservative in nature), preferably such that the nucleic acid molecule encodes a therapeutic or antigenic protein. These modifications may be intentional, such as carried out by site-specific mutagenesis, or may be random, such as carried out due to mutations of hosts producing antigen.

The terms "polypeptide" and "protein" refer to a polymer of amino acid residues and are not limited to the minimum product length. Thus, peptides, oligopetides, dimers, multimers and the like are included in this definition. This definition covers both full-sized proteins and their fragments. These terms also include modifications, such as deletions, additions and substitutions (generally conservative in nature), preferably such that the protein retains the ability to elicit an immune response or therapeutic effect in relation to the subject to which the protein is administered.

By “antigen” is meant a molecule containing one or more epitopes capable of stimulating the host’s immune system to produce a cell antigen specific immune antigen, where the antigen is provided according to the invention, or a humoral antibody response. The antigen may be able to elicit a cellular or humoral response alone or when present in combination with another molecule. Typically, an epitope includes about 3-15 amino acids, preferably about 5-15 amino acids, and more preferably about 7-15 amino acids. Epitopes of a particular protein can be identified using any number of epitope mapping methods well known in the art. See, for example, Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996) Humana Press, Totowa, New Jersey. For example, linear epitopes can be determined by simultaneous solid-phase synthesis of a large number of peptides, and these peptides must correspond to parts of the protein molecule, and by the interaction of these peptides with antibodies, despite the fact that the peptides are bound to substrates. Such methods are well known in the art and are described, for example, in US Pat. No. 4,708,871; Geysen et al. (1984) Proc. Natl. Acad. Sci. USA 81: 3998-4002; Geysen et al. (1986) Molec. Immunol. 23: 709-715, which are incorporated by reference in their entirety in this publication. Similarly, conformational epitopes are easily identified by determining the spatial conformation of amino acids, such as, for example, by X-ray crystallography and two-dimensional nuclear magnetic resonance. See, for example, Epitope Mapping Protocols.

As used herein, the term “antigen” means as subunit antigens, i.e. antigens that are separated and isolated from the whole organism with which this antigen is associated in nature, as well as killed, attenuated or inactivated bacteria, viruses and parasites, or other microbes. Antibodies, such as anti-idiotypic antibodies or fragments thereof, and synthetic peptide mimotopes that can mimic an antigen or antigenic determinant also fall within the definition of antigen used herein. Similarly, an oligonucleotide or polynucleotide that expresses an in vivo therapeutic or immunogenic protein, or an antigenic determinant, as in gene therapy and nucleic acid immunization applications, is also included herein in the definition of antigen.

In addition, for the purposes of the present invention, antigens can be derived from any known viruses, bacteria, parasites and fungi, as well as from various tumor antigens. Moreover, for the purposes of the present invention, “antigen” refers to a protein that contains native sequence modifications, such as deletions, additions and substitutions (generally conservative in nature), provided that the protein retains the ability to elicit an immune response. These modifications may be intentional, such as carried out by site-specific mutagenesis, or may be random, such as carried out due to mutations of hosts producing antigen.

An “immunological response” and an “immune response” to an antigen or composition is the development in a subject of a humoral and / or cellular immune response to molecules present in the composition of interest. For the purposes of the present invention, a “humoral immune response” refers to an immune response mediated by antibody molecules, while a “cellular immune response” is that mediated by T-lymphocytes and / or other white blood cells. One important aspect of cellular immunity includes the antigen-specific response of cytotoxic T cells (“CTL”). CTLs are specific for peptide antigens that are presented in association with proteins encoded by major histocompatibility complex (MHC) and expressed on the cell surface. CTLs promote the induction and development of intracellular destruction of intracellular microbes, or the lysis of cells infected with such microbes. Another aspect of cellular immunity includes the antigen-specific response of helper T cells. Helper T cells help stimulate the functioning of non-specific effector cells and direct their activity against cells expressing peptide antigens in association with MHC molecules on their surface. A “cellular immune response” also refers to the production of cytokines, chemokines and other such molecules produced by activated T cells and / or other white blood cells, including those derived from CD4 + or CD8 + T cells.

A composition, such as an immunogenic composition or a vaccine that elicits a cellular immune response, can serve to sensitize a vertebrate subject by presenting the antigen in association with MHC molecules on the cell surface. The cell-mediated immune response is directed to, or close to, cells presenting antigen on their surface. In addition, antigen-specific T lymphocytes can be formed to provide future protection for the immunized host.

The ability of a particular antigen or composition to stimulate a cell-mediated immune response can be determined by several analysis methods, such as methods for analyzing lymphoproliferation (activation of lymphocytes), methods for analyzing CTL cytotoxic cells, by determining, in a sensitized subject, T lymphocytes specific for a given antigen, or by measuring cytokine production by T cells in response to repeated stimulation with antigen. Such assay methods are well known in the art. See, for example, Erickson et al., J. Immunol. (1993) 151: 4189-4199; Doe et al., Eur. J. Immunol. (1994) 24: 2369-2376, and the following examples.

Thus, the term “immune response” as used herein may be one of the responses that stimulate CTL production and / or production or activation of helper T cells. An antigen of interest may also elicit an antibody-mediated immune response. Therefore, the immune response may include one or more of the following effects: production of antibodies by B cells and / or activation of suppressor T cells and / or γδ-T cells specific for the antigen or antigens present in the composition or vaccine of interest . These reactions can help neutralize infection and / or mediate complement-antibody interaction or antibody-dependent cellular cytotoxicity (ADCC) to protect the immunized host. Such reactions can be determined using standard methods of immunological analysis and methods of analysis of neutralization, well known in this field.

A composition containing a selected antigen adsorbed on a microparticle exhibits “increased immunogenicity” when it has the ability to elicit a more potent immune response compared to an immune response that is elicited by an equivalent amount of antigen when delivered without association with the microparticle. Thus, the composition may exhibit "increased immunogenicity" because the antigen becomes more immunogenic due to adsorption on the microparticle or because a lower dose of antigen is required to achieve an immune response in the subject to which it is administered. Such increased immunogenicity can be determined by administering to the animal a microparticle / antigen composition and antigenic controls and comparing antibody titers in these two cases using standard assay methods such as radioimmunoassay and ELISA methods well known in the art.

As used herein, the terms “effective amount” or “pharmaceutically effective amount” of a composition refers to a non-toxic amount of the composition, but sufficient to provide the desired response, such as an immune response, and the corresponding therapeutic effect, or, in the case of delivery of a therapeutic protein, to an amount sufficient to effective treatment of the subject, as defined below. As will be shown below, the exact amount required varies from subject to subject, depending on the species, age, and basic living conditions of the subject, the severity of the condition to be treated, and the particular macromolecule of interest, route of administration, and the like. A suitable “effective amount” in any individual case can be determined by routine experimentation by an ordinary person skilled in the art.

By “vertebrate subject” is meant any member of the chordate subtype, including, without limitation, mammals such as cattle, sheep, pigs, goats, horses and humans; domestic animals such as dogs and cats; and birds, including domestic, wild and game birds, such as bisexual chickens, turkeys and other chicken birds. This term does not mean a specific age. Thus, it is understood that the term encompasses both adult and newborn animals.

By “pharmaceutically acceptable” or “pharmacologically acceptable” is meant a material that is not suitable in a biological or other sense, i.e. this material can be administered to a subject as part of a microparticle preparation without causing any undesirable biological effects to it or without adverse interaction with any other component of the composition of which it is included.

The term "filler" refers to substances that are usually provided with finished dosage forms, and includes carriers, binders, disintegrants, fillers (solvents), lubricants, slip agents (flow agents), sealants, colorants, sweeteners, preservatives, suspending / dispersing agents, film formers / coatings, flavoring agents and printing inks.

By “physiological pH” or “pH within physiological limits” is meant a pH in the approximate range of 7.2 to 8.0 inclusive, usually in the approximate range of 7.2 to 7.6 inclusive.

The term “treatment” as used herein (including variations thereof, for example, “treat” or “treated”) refers to any of the following: (i) the prevention of infection or reinfection, as in the case of a traditional vaccine, (ii) reduction or elimination symptoms, (iii) a substantial or complete elimination of the pathogen in question or disorder. Treatment can be carried out prophylactically (before infection) or therapeutically (after infection).

The expression "nucleic acid" as used herein refers to DNA, RNA, or chimeric molecules formed therefrom.

As used herein, the term “oligonucleotide containing at least one CpG motif” refers to a polynucleotide comprising at least one CpG dinucleotide. Oligonucleotides containing at least one CpG motif may include multiple CpG motifs. These oligonucleotides are also known in the art as “CpG oligonucleotides”. The term “CpG motif” as used herein refers to the dinucleotide portion of an oligonucleotide that includes a cytosine nucleotide followed by a guanosine nucleotide. Instead of cytosine, 5-methylcytosine can also be used.

The term “alphavirus vector RNA replicon”, “vector RNA replicon”, “vector RNA replicon” and “replicon” as used herein refers to an RNA molecule capable of directing its own amplification or self-replication in vivo within a target cell. Alphavirus-derived vector RNA replicon should contain the following ordered elements: 5'-terminal viral sequences required at the cis position for replication (also referred to as 5'-CSE), which upon expression encode biologically active non-structural alphavirus proteins (e.g. nsP1, nsP2, nsP3, nsP4), the 3'-terminal viral sequences required at the cis position for replication (also designated as 3'-CSE), and the polyadenylate site. Vector RNA replicon of alphavirus origin may also contain a viral subgenomic promoter of the “fusion region”, a sequence of one or more genes of structural proteins or parts thereof, an external nucleic acid molecule (s) of sufficient size to ensure the production of a viable virus, and also the heterologous sequence (s) to be expressed.

The term “eukaryotic multilevel vector initiation system”, “ELVIS” or “ELVIS vector” as used herein refers to a construct that is capable of directing the expression of the sequence (s) of the gene (s) of interest. The eukaryotic multilevel vector initiation system should contain a 5'-terminal promoter capable of initiating in vivo (i.e., within the cell) synthesis of RNA with cDNA, and a viral vector sequence capable of directing its own replication in the eukaryotic cell and also expressing the heterologous sequence. In preferred embodiments, the vector nucleic acid sequence is an alphavirus-derived sequence and consists of a 5'-terminal sequence capable of initiating transcription of alphavirus RNA (also referred to as 5'-CSE), as well as sequences which, when expressed, encode biologically active non-structural alphavirus proteins ( for example, nsP1, nsP2, nsP3, nsP4), and recognition sequences for alphavirus RNA polymerase (also referred to as 3'-CSE). In addition, the vector sequence may include a viral subgenomic promoter of the “fusion region”, a sequence of one or more genes of structural proteins or parts thereof, an external nucleic acid molecule (s) of sufficient size to ensure the production of a viable virus to be expression expression (s) heterologous sequence (s), one or more restriction sites for insertion of heterologous sequences, as well as a polyadenylation sequence. The eukaryotic multilevel vector initiation system may also contain splicing recognition sequences, a sequence of the catalytic ribozyme involved in processing, an export signal from the nucleus, and a transcription termination sequence.

"Alphavirus vector construct" refers to a construct capable of directing the expression of a sequence or gene of interest. Such vector constructs mainly include a 5'-terminal sequence capable of initiating transcription of alphavirus RNA (also referred to as 5'-CSE), as well as sequences that, when expressed, encode biologically active non-structural alphavirus proteins (e.g., nsP1, nsP2, nsP3 , nsP4), an alphavirus RNA polymerase recognition sequence (also referred to as 3'-CSE) and a polyadenylate site. In addition, the vector sequence may comprise a viral subgenomic promoter of the “fusion region”, a sequence of one or more genes of structural proteins or parts thereof, an external nucleic acid molecule (s) of sufficient size to ensure the production of a viable virus, 5'- terminal promoter capable of initiating viral DNA synthesis with cDNA in vitro or in vivo, the heterologous sequence to be expressed, one or more restriction sites for insertion of the heterologous sequence th.

The expression "vector construct" as used herein refers primarily to any construct capable of directing the expression of the nucleic acid sequence (s) of interest or gene (s) of interest. A vector construct typically includes a transcriptional promoter / enhancer or element (s) that determines the locus (s), or other elements that control gene expression in other ways, such as alternative splicing, export of RNA from the nucleus, post-translational modification of information-carrying RNA or post-translational protein modification. In addition, a vector construct typically includes a sequence that upon transcription appears to be functionally linked to the sequence (s) of interest (s) or gene (s) of interest (s), and functions as a transcription initiation sequence. The vector construct may also optionally include a signal that directs polyadenylation, a marker for selection, as well as one or more restriction sites to insert heterologous sequences and a translation termination sequence. In addition, if a vector construct is placed in a retrovirus, this vector construct may include a packaging signal, long terminal repeats (LTRs), and plus and minus strand primer binding sites corresponding to the retrovirus used (if they are not present initially). Examples of vector constructs include ELVIS vectors that contain cDNA complementary to vector RNA constructs, wind RNA constructs as such, alphavirus vector constructs, CMV vector constructs, and the like.

One of the specific types of vector constructs is a "plasmid", which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. Specific plasmids described below include pCMV and pSINCP.

In certain embodiments of the present invention, compositions and methods are provided that provide treatment that includes prophylactic and / or therapeutic immunization of an animal host against viral, fungal, mycoplasma, bacterial and protozoan infections, as well as against tumors. The methods of the invention can be used for induction in a mammal, preferably in humans, prophylactic and / or therapeutic immunity. The methods of the invention may also be practiced on non-human mammals, including mammals used in biomedical research.

B. Basic methods

1. Polymer microparticles with adsorbed macromolecules

Polymeric microparticles, including microparticles based on PLA and PLG, effectively adsorb biologically active macromolecules. Moreover, these microparticles adsorb a wide variety of molecules, including charged and / or bulk macromolecules. Thus, the macromolecule / microparticles used according to the invention can be used as a delivery system for the delivery of biologically active components for the treatment, prevention and / or diagnosis of a wide range of diseases.

A wide range of macromolecules can be delivered in association with microparticles, including but not limited to pharmaceuticals such as antibiotics and antivirals, non-steroidal anti-inflammatory drugs, analgesics, vasodilators, cardiovascular drugs, psychotropic drugs, antipsychotics, antidepressants, anti-depressants parkinsonism, beta-blockers, calcium channel blockers, bradykinin inhibitors, ACE inhibitors, vasodilators, and prolactin inhibitors, steroids, hormone antagonists, antihistamines, serotonin antagonists, heparin, chemotherapeutic agents, antitumor agents, and growth factors, including but not limited to PDGF, EGF, KGF, IGF-1 and IGF-2, FGF, polynucleotides, encoding therapeutic or immunogenic proteins, immunogenic proteins and their epitopes for use in vaccines, hormones including peptide hormones such as insulin, proinsulin, growth hormone, GHRH, LHRH, EGF, somatostatin, SNX-111, BNP, insulinotropin, ANP, FSH , LH, PSH and hCG, gonad steroid hormones (androgens, estrogens and progesterone), thyroid-stimulating hormone, inhibin, cholecystokinin, ACTH, CRF, dynorphins, endorphins, endothelin, fragments of fibronectin, galanin, gastrin, insulinotropin, glucagon, fragments of GTP-binding proteins, gukinin, mastinin, laninar, maganin, lanin, laninar, laninar, laninina, laninina, laninina, laninina, laninarina, luminin, dermaseptin, systemic, neuromedins, neurotensin, pancreastatin, pancreatic polypeptide, substance P, secretin, thymosin, and the like, enzymes, transcription and translation mediators, metabolic pathway intermediates, immunomodulators, such as bout of various cytokines, including interleukin-1, interleukin-2, interleukin-3, interleukin-4 and gamma-interferon, antigens, and adjuvants.

In some preferred embodiments of the invention, the macromolecule is a nucleic acid, more preferably a vector construct, such as an ELVIS vector, or a vector RNA construct. One of the particular advantages of the present invention is the ability of microparticles with an adsorbed ELVIS vector to generate a cell-mediated immune response in a vertebrate subject.

Furthermore, in addition to the normal antibody response, the systems described herein can, for example, provide for the association of expressed antigens with class I MHC molecules, so that a cellular immune response to an in vivo antigen of interest can be developed that stimulates CTL production, which subsequently allows the antigen to be recognized. Moreover, these methods can cause an antigen-specific response of helper T cells. Thus, the methods of the invention will find use in any macromolecule to which a cellular and / or humoral immune response is required, preferably antigens derived from pathogenic viruses capable of inducing antibody production, T cell helper epitopes and T cell cytotoxic epitopes. Such antigens include, but are not limited to, antigens encoded by human and animal viruses, and may correspond to both structural and non-structural proteins.

The microparticles according to the invention, in particular, can be used to immunize against intracellular viruses, which usually cause a weak immune response. For example, the present invention will find application in stimulating an immune response against a wide range of proteins of the herpesvirus family, including proteins derived from herpes simplex virus (HSV) types 1 and 2, such as glycopoteins gB, gD and gH from HSV-1 and HSV-2, antigens derived from chickenpox virus (VZV), Epstein-Barr virus (EBV) and cytomegalovirus (CMV), including gB and gH from CMV; and antigens originating from other human herpes viruses, such as HHV6 and HHV7. (See, e.g., Chee et al., Cytomegaloviruses (J. K McDougall, ed., Springer-Verlag 1990) pp. 125-169, for a review of coding proteins for cytomegalovirus contents; McGeoch et al., J. Gen. Virol. ( 1988) 69: 1531-1574, for discussing various proteins encoded by HSV-1; US Pat. No. 5,171,568 for a review of gB and gD proteins from HSV-1 and HSV-2 and their genes encoding them; Baer et al., Nature (1984) 310: 207-211, for identifying coding protein sequences in the EBV genome; and Davison and Scott, J. Gen. Virol. (1986) 67: 1759-1816, for a review of VZV.)

Hepatitis A virus antigens, including hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis delta virus (HDV), hepatitis E virus (HEV) and hepatitis G virus (HGV), also can be conventionally applied according to the methods described herein. For example, the HCV genome sequence is known, as are the methods for producing this sequence. See, for example, International Publication No. WO 89/04669; WO 90/11089; and WO 90/14436. The HCV genome encodes several viral proteins, including E1 (also known as E) and E2 (also known as E2 / NSI) and the N-terminal nucleocapsid protein (called "core") (see, Houghton et al., Hepatology (1991) 14: 381-388, for discussion of HCV proteins, including E1 and E2). Each of these proteins, as well as their antigenic fragments, will find application in the present composition and methods.

Similarly, a δ-antigen sequence from HDV is known (see, for example, US Pat. No. 5,378,814), and this antigen can usually be used in the present compositions and methods. In addition, antigens derived from HBV, such as core antigen, surface antigen SAg, as well as surface sequences pre-S1 and pre-S2 (previously called pre-S), as well as combinations of the above sequences, such as SAg / pre-S1, SAg / pre-S2, SAg / pre-S1 / pre-S2, and pre-S1 / pre-S2. See, for example, "HBV Vaccines-from the laboratory to license: a case study", Mackett, M. and Williamson, J. D., Human Vaccines and Vaccination, pp. 159-176, to discuss the structure of HBV; and US patent No. 4722840, 5098704, 5324513, incorporated into the description in full by reference; Beames et al., J. Virol. (1995) 69: 6833-6838, Birnbaum et al., J. Virol. (1990) 64: 3319-3330; and Zhou et al., J. Virol. (1991) 65: 5457-5464.

The claimed compositions and methods will also find use of antigens derived from other viruses, such as, but not limited to, proteins from the Picornaviridae family (for example, poliomyelitis viruses, etc.); Caliciviridae; Togaviridae (e.g., rubella virus, tropical fever virus, etc.); Flaviviridae; Coronaviridae; Reoviridae; Birnaviridae; Rhabdoviridae (e.g., rabies virus, etc.); Filoviridae; Paramyxoviridae (e.g., mumps virus, measles virus, respiratory syncytial virus, etc.); Orthomyxoviridae (e.g., influenza virus types A, B and C, etc.); Bunyaviridae; Arenaviridae; Retroviradae (e.g., HTLV-I; HTLV-II; HIV-1 (also known as HTLV-III, LAV, ARV, hTLR, etc ..)), among others including, but not limited to, antigens from HIV _IIIb isolates , HIV _SF2 , HIV _LAV , HIV _LAI , HIV _MN ; HIV-1 _CM235 , HIV-1 _US4 ; HIV-2; Monkey immunodeficiency virus (SIV). In addition, antigens can also be derived from human papillomavirus (HPV) and tick-borne encephalitis viruses. See, for example, Virology, 3rd Edition (WK Joklik ed. 1988); Fundamental Virology, 2nd Edition (BN Fields and DM Knipe, eds. 1991), for describing data and other viruses.

More specifically, envelope proteins gp120 or gp140 are known and described for any of these HIV isolates, including representatives of various HIV genetic subtypes (see, for example, Myers et al., Los Alamos Database, Los Alamos National Laboratory, Los Alamos, New Mexico (1992 ); Myers et al., Human Retroviruses and Aids, 1990, Los Alamos, New Mexico: Los Alamos National Laboratory; and Modrow et al., J. Virol. (1987) 61: 570-578, for comparing shell sequences of different isolates HIV), and antigens derived from these isolates will find use in the present methods. Moreover, this invention is equally applicable to other immunogenic proteins originating from any of various HIV isolates, including any of various envelope proteins, such as gp160 and gp41, gag antigens, such as p24gag and p55gag, as well as proteins derived from regions pol and tat. Any of these proteins and antigens may also be modified for use in accordance with the invention. For example, in FIG. 1, 2, 5, and 6 show the DNA sequences encoding the modified gag antigens (SEQ ID NOs: 63.64.67 and 68), and in FIG. 3 and 4 show DNA sequences encoding modified enveloped antigens (SEQ ID NO: 65 and 66).

Another example of a virus for which the present invention is particularly applicable is the influenza virus. Specifically, influenza A virus HA and NA envelope proteins are of particular interest for the induction of an immune response. Many subtypes of influenza A virus HA have been identified (Kawaoka et al., Virology (1990) 179: 759-767; Webster et al., "Antigenic variation among type A influenza viruses," p. 127-168. In: P. Palese and DW Kingsbury (ed.), Genetics of influenza viruses Springer-Verlag, New York). Thus, proteins derived from any of these isolates can also be used in the compositions and methods described herein.

The compositions and methods described herein will also find use with numerous bacterial antigens, such as antigens derived from organisms that cause diphtheria, cholera, tuberculosis, tetanus, pertussis, meningitis and other pathological conditions, including but not limited to Bordetella pertussis, Neisseria meningitides (A, B , C, Y), Neisseria gonorrhoeae, Helicobacter pylori and Haemophilus influenza, Haemophilus influenza type B (HIB), Helicobacter pylori, and combinations thereof. Examples of antigens from Neisseria meningitides B are those described in the following patent applications co-owned by the present applicant: PCT / US99 / 09346; PCT IB98 / 01665; and PCT IB99 / 00103. Examples of parasitic antigens include antigens originating from organisms that cause malaria and Lyme disease.

Additional antigens for use according to the invention, some of which are also listed elsewhere in this description, include the following examples (links are given immediately below):

a protein antigen from N. meningitidis serogroup B, such as in links 1 to 7 below;

- preparation of outer membrane vesicles (OMV) from N. meningitidis serogroup B, such as described below in references 8, 9, 10, 11, etc .;

a saccharide antigen from N. meningitidis serogroup A, C, W135 and / or Y, such as the oligosaccharide described in link 12 below for serogroup C (see also link 13);

- saccharide antigen from Streptococcus pneumoniae [for example, references 14,15,16];

- antigen from N. gonorrhoeae [for example, references 1,2,3];

- an antigen from Chlamydia pneumoniae [for example, references 17, 18, 19, 20, 21, 22, 23];

- antigen from Chlamydia trachomatis [for example, 24];

- an antigen from hepatitis A virus, such as an inactivated virus [eg, refs. 25, 26];

- an antigen from hepatitis B virus, such as surface and / or core antigens [eg, ref. 26.27];

- antigen from hepatitis C virus [for example, ref. 28];

an antigen from Bordetella pertussis, such as pertussis holotoxin (PT) and filament hemagglutinin (FHA) from B. pertussis, optionally also in combination with pertactin and / or agglutinogens 2 and 3 [eg, refs. 29 and 30];

- diphtheria antigen, such as diphtheria toxoid [for example, chapter 3 of reference 31], for example, a CRM ₁₉₇ mutant [for example, reference 32];

- tetanus antigen, such as tetanus toxoid [for example, chapter 4 of ref. 31];

a protein antigen from Helicobacter pylori, such as CagA [for example, reference 33], VacA [for example, reference 33], NAP [for example, reference 34], HopX [for example, reference 35], HopY [for example, reference 35] and / or urease;

- saccharide antigen from Haemophilus influenzae B [for example, ref. 13];

- antigen from Porphyramonas gingivalis [eg, ref. 36];

- polio (s) antigen (s) [for example, refs. 37.38], such as IPV or OPV;

- rabies virus antigen (s) [eg, reference 39], such as lyophilized inactivated virus [eg, reference 40, Rabavert ™);

- antigens of measles, mumps and / or rubella [for example, chapters 9, 10 and 11 of reference 31];

- influenza antigen (s) [for example, chapter 19 of ref. 31], such as hemagglutinin and / or neuraminidase surface proteins;

- antigen from Moraxella catarrhalis [eg, ref. 41];

- antigen from Streptococcus agalactiae (group B streptococcus) [for example, ref. 42.43];

- antigen from Streptococcus pyogenes (group A streptococcus) [for example, refs. 43,44,45];

- antigen from Staphylococcus aureus [for example, reference 46];

- compositions comprising one or more of these antigens.

When using a polysaccharide or carbohydrate antigen, it is preferably conjugated to a carrier protein to enhance immunogenicity [for example, references 47 to 56]. Preferred carrier proteins are bacterial toxins or toxoids, such as diphtheria or tetanus toxoids. Particularly preferred is diphtheria toxoid CRM ₁₉₇ . Other suitable carrier proteins include the outer membrane protein of N. meningitidis [eg, link 57], synthetic peptides [eg, links 58, 59], heat shock proteins [eg, link 60], proteins of the pertussis pathogen [eg, links 61 , 62], protein D from H. Influenzae [for example, reference 63], toxin A or B from C. difficile [for example, reference 64], etc. When the mixture contains polysaccharides capsules of serogroups A and C, it is preferable when the ratio (mass./mass.) Of the MenA polysaccharide: MenC polysaccharide exceeds 1 (for example, 2: 1, 3: 1, 4: 1, 5: 1, 10: 1 or higher). Polysaccharides from other serogroups of N. meningitidis can be conjugated to the same or different carrier proteins.

Any conjugation reaction, where necessary, with any suitable linker may be used.

Toxic protein antigens, if necessary, can be detoxified (eg, detoxification of pertussis toxin with chemical and / or ... means [ref. 30].

If diphtheria antigen is included in the composition, it is also preferable to include tetanus antigen and pertussis antigen. Similarly, when a tetanus antigen is included, the inclusion of diphtheria and pertussis antigen is also preferred. Similarly, when the pertussis antigen is turned on, the inclusion of diphtheria and tetanus antigen is also preferable.

It is readily understood that the present invention can be used to deliver various macromolecules, thereby treating, preventing and / or diagnosing a large number of diseases. In some embodiments, the macromolecule / microparticle compositions of the invention can be used for site-specific targeted delivery. For example, the intravenous administration of macromolecule / microparticle compositions can be used for targeted delivery to the lungs, liver, spleen, circulating blood or bone marrow.

The adsorption of macromolecules on the surface of the adsorbent microparticles (or submicron emulsions according to the invention) occurs by any binding-interaction mechanism, including, but not limited to, the formation of ionic bonds, hydrogen bonds, covalent bonds, van der Waals interactions, physical capture and binding due to hydrophilic / hydrophobic interactions. Conventional specialists in this field can easily select detergents suitable for the particular type of macromolecule to be adsorbed.

For example, the production of microparticles in the presence of charged detergents, such as anionic and cationic detergents, can result in microparticles with a surface having a total negative or total positive charge that can adsorb a variety of molecules. For example, microparticles obtained in the presence of anionic detergents such as sodium dodecyl sulfate (SDS), i.e. SDS-PLG microparticles adsorb positively charged antigens, such as proteins. Similarly, microparticles obtained in the presence of cationic detergents such as hexadecyltrimethylammonium bromide (CTAB), i.e. CTAB-PLG microparticles adsorb negatively charged antigens, such as DNA. In the case where the macromolecules to be adsorbed contain regions with a positive and negative charge, cationic, antionic, nonionic or zwitterionic detergents may be suitable.

The biodegradable microparticle polymers used according to the invention are readily available commercially, for example from Boehringer Ingelheim, Germany, and Birmingham Polymers, Inc., Birmingham, Alabama. For example, polymers that can be used here to form microparticles include homopolymers, copolymers and polymer blends derived from the following compounds: polyhydroxybutyric acid (also known as polyhydroxybutyrate); polyhydroxyvaleric acid (also known as polyhydroxyvalerianate); polyglycolic acid (PGA) (also known as polyglyolide); polylactic acid (PLA) (also known as polylactide); polydioxanone; polycaprolactone; polyorthoester; and polyanhydride. More preferred are poly- (α-hydroxy acids) such as poly- (L-lactide), poly- (D, L-lactide) (both hereinafter referred to as “PLA”), poly (hydroxybutyrate), copolymers D, L- lactide and glycolide such as poly- (D, L-lactide-glycolide) (referred to herein as “PLG” or “PLGA”) or a copolymer of D, L-lactide and caprolactone. Particularly preferred polymers for use herein are PLA and PLG. These polymers are available in various molecular weights, and a suitable molecular weight for this determination will be readily determined by one skilled in the art. For example, for PLA, the order of suitable molecular weights will be from about 2000 to 5000. For PLG, suitable molecular weights will generally vary from about 10,000 to 200,000, preferably from about 15,000 to 150,000.

If a copolymer such as PLG is used to form microparticles, various lactide: glycolide ratios will be used here, and this ratio is largely a matter of choice, partially dependent on the co-introduced macromolecule and the required rate of degradation. For example, a 50:50 PLG polymer containing 50% D, L-lactide, and 50% glycolide will provide rapid resorption of the copolymer, while a 75:25 PLG degrades more slowly and 85:15 and 90:10 even slower due to higher levels lactide component. It is easy to understand that a suitable lactide: glycolide ratio is readily determined by one skilled in the art, for example, based on the nature of the antigen and the particular disease. Moreover, in embodiments of the present invention where antigens or adjuvants are captured by microparticles, a mixture of microparticles with various lactide: glycolide ratios will find use in order to achieve the desired release kinetics of the given macromolecule and to provide both a primary and secondary immune response. The degradation rate of microparticles according to the invention can also be controlled by factors such as the molecular weight of the polymer and its crystallinity. PLG copolymers with various lactide: glycolide and molecular weight ratios are readily available commercially from several sources, including Boehringer Ingelheim, Germany, and Birmingham Polymers, Inc., Birmingham, Alabama. These polymers can also be synthesized by simple polycondensation of the lactic acid component using methods well known in the art, such as those described by Tabata et al., J. Biomed. Mater. Res. (1988) 22: 837-858.

Preferred polymer poly- (D, L-lactide-glycolides), where applicable, are those having a lactide: glycolide molar ratio ranging from 30:70 to 70:30, more preferably from 40:60 to 60:40, and a molecular weight ranging from 10,000 to 100,000 daltons, more preferably from 30,000 daltons to 70,000 daltons.

Polymeric microparticles are prepared using any of several methods well known in the art. For example, in some embodiments, dual emulsion / solvent evaporation methods such as those described in US Pat. No. 3,523,907 and Ogawa et al., Chem. Pharm. Bull. (1988) 36: 1095-1103. These methods include the formation of a primary emulsion consisting of drops of a polymer solution, which is subsequently mixed with a continuous aqueous phase containing a particle stabilizer / surfactant.

Alternatively, evaporation of a water-in-oil-in-water solvent (w / m / v) can be used to form microparticles, as described by O'Hagan et al., Vaccine (1993) 11: 965-969, in PCT / US99 / 17308 (WO 00/06123) issued by O'Hagan et al. And Jeffery et al., Pharm Res. (1993) 10: 362. In this method, a particular polymer is usually combined with an organic solvent such as ethyl acetate, dimethyl chloride (also called methylene chloride and dichloromethane), acetonitrile, acetone, chloroform and the like. The polymer is provided in a solution concentration in an organic solvent of about 1-30%, preferably about 2-15%, more preferably about 3-10%, and most preferably 4-6%. The polymer solution is then combined with an aqueous solution and emulsified to form an m / v emulsion. The aqueous solution may, for example, be deionized water, saline or a buffer solution, such as phosphate buffered saline (PBS) or a buffer solution of sodium citrate / ethylenediamino acetic acid (sodium citrate / ETDA). Preferably, the volume ratio of the polymer solution and the aqueous solution varies from about 5: 1 to 20: 1, more preferably about 10: 1. Emulsification is carried out using any equipment suitable for this task, and it is usually a high shear device, such as, for example, a homogenizer.

The volume of the emulsion m / v. then preferably, but not necessarily combined with a large volume of an aqueous solution, preferably containing a cationic, anionic or non-ionic detergent. The volumetric ratio of an aqueous solution and emulsion m / v. usually varies from about 2: 1 to 10: 1, most usually about 4: 1. Examples of anionic, cationic and nonionic detergents suitable for carrying out the invention are listed above and include SDS, CTAB and PVA, respectively. Particular macromolecules may be better adsorbed onto microparticles containing combinations of stabilizers and / or detergents, for example, a combination of PVA and DOTAP. Moreover, in some cases, it may be necessary to add detergents to the above organic solution. When a non-ionic detergent, such as PVA, is used as an emulsion stabilizer, it is usually provided in solution with a concentration of about 2-15%, more usually about 4-10%. When using a cationic or anionic detergent, it is usually provided in solution with a concentration of about 0.05-5%, more usually about 0.25-1%. Basically, the mass ratio of detergent to polymer is used in the approximate range from 0.00001: 1 to 0.5: 1, more preferably in the approximate range from 0.0001: 1 to 0.5: 1, more preferably in the approximate range from 0.001: 1 to 0.5: 1, and even more preferably in the approximate range of 0.005: 1 to 0.5: 1.

Then the mixture is homogenized with the formation of a stable double emulsion v / m / v. Then the organic solvents are evaporated. You can control the parameters of the drug to obtain microparticles from small ones, on the order of 0.05 microns (50 nm), to larger ones, 50 microns in size or even larger. See, for example, Jeffery et al., Pharm. Res. (1993) 10: 362-368; McGee et al., J Microencap. (1996). For example, a decrease in mixing leads to the formation of larger microparticles, as well as an increase in the volume of the internal phase. Small particles are produced at small volumes of the aqueous phase and with high concentrations of emulsion stabilizers.

Further information can be found in U.S. Patent Application No. Attorney Docket Nos. PP 16502.002, entitled “Microparticles with Adsorbed Macromolecules”, filed September 28, 2001

You can control the parameters of the drug to obtain microparticles from small ones, on the order of 0.05 microns (50 nm), to larger ones, 50 microns in size or even larger. See, for example, Jeffery et al., Pharm. Res. (1993) 10: 362-368; McGee et al., J Microencap. (1996). For example, a decrease in mixing leads to the formation of larger microparticles, as well as an increase in the volume of the internal phase. Small particles are produced at small volumes of the aqueous phase and with high concentrations of emulsion stabilizers.

Microparticles can also be formed using spray-drying and coacervation, as described, for example, Thomasin et al., J. Controlled Release (1996) 41: 131; U.S. Patent No. 2,800,457; Masters, K (1976) Spray Drying 2nd Ed. Wiley, New York; using air suspension coating methods such as pan coating and Wurster coating described by Hall et al., (1980) The "Wurster Process" in Controlled Release Technologies: Methods, Theory, and Applications (AF Kydonieus, ed. ), Vol. 2, pp. 133-154 CRC Press, Boca Raton, Florida and Deasy, P. B., Crit. Rev. Ther. Drug Carrier Syst. (1988) S (2): 99-139; and using ion hardening, as described, for example, Lim et al., Science (1980) 210: 908-910.

Particle size can be determined, for example, by laser light scattering, using, for example, a spectrometer including a helium-neon laser. Basically, the determination of particle size takes place at room temperature and includes multiple analyzes of a given sample (for example, 5-10 times) to obtain an average particle size. Particle size is also easily determined using scanning electron microscopy (SEM).

Alternative embodiments of the present invention utilize microparticle formulations comprising a submicron emulsion, which preferably includes an ionic surfactant. In particular, MF59 or other compounds may be used as the main oil-containing submicron emulsion, while ionic surfactants may include, but are not limited to, dioleyl-3-trimethylammonium propane (DOTAP), dioleyl-sn-glycero-3-ethylphosphocholine ( DEPC) and dioleylphosphatidic acid (DPA), all of which are soluble in squalene. Estimated ionic emulsions can be obtained by dissolving each of these detergents in squalene / 10% Span 85 at concentrations ranging from 4 to 52 mg / ml squalene. Squalene / surfactant mixtures can be emulsified in 0.5% Tween 80 / H ₂ O at a ratio of 5 ml squalene / 100 ml H ₂ O. A pre-emulsion can be formed by homogenization in a Silverson homogenizer (5 minutes, 5000 vol. / min), and the final emulsion can be obtained by microfluidization (~ 10,000 psi, 5 cycles, Microfluidizer 110S). Further discussion regarding submicron emulsions can be found below.

After receiving the microparticles can be stored lyophilized for future use. Typically, to adsorb macromolecules onto microparticles, the microparticle preparation is simply mixed with the macromolecule of interest, and the resulting preparation can be lyophilized again before use. In general, the macromolecules are added to the microparticles to obtain microparticles with adsorbed macromolecules in a weight ratio of macromolecules to microparticles of about 0.0001: 1 to 0.25: 1, preferably from 0.001: 1 to 0.1, more preferably from 0, 01 to 0.05. The content of macromolecules in the microparticles can be determined by standard methods.

As indicated above, macromolecules for use according to the invention include proteins, preferably antigenic molecules and nucleic acids, preferably vector constructs capable of expressing a nucleic acid sequence, such as CMV-based vectors, ELVIS vectors, or RNA vector constructs.

The polymer microparticles according to the invention can contain trapped or encapsulated macromolecules inside them, and also contain macromolecules adsorbed on them. For example, a person skilled in the art can, according to the invention, obtain microparticles containing encapsulated adjuvants with the ELVIS vector adsorbed on them, or microparticles containing encapsulated antigen with an RNA vector structure adsorbed on them. This invention relates to various combinations of nucleic acid molecules adsorbed on microparticles and trapped inside them, together with other nucleic acids, as well as other molecules. In some preferred embodiments, the microparticles of the invention comprise ELVIS vectors or RNA vector constructs adsorbed thereon.

In addition, any implementation of the microparticles according to the invention can be delivered in combination with electroporation.

The produced microparticles with adsorbed macromolecules and / or submicron emulsion microparticles are formulated with any desired adjuvants into pharmaceutical compositions including vaccines to treat prophylaxis and diagnosis of a variety of disorders, as described above. Compositions generally include one or more pharmaceutically acceptable excipients. For example, carriers such as water, saline, glycerin, polyethylene glycol, hyaluronic acid, ethanol, etc. can be used. Other excipients, such as wetting or emulsifying agents, biological buffering agents, and the like, may be present in such carriers.

Biological buffer solution can be almost any solution that is pharmaceutically acceptable and provides the desired pH of the drug, i.e. pH physiological limits. Examples of buffer solutions include saline, phosphate-saline buffer, Tris-saline buffer, Hanks saline buffer and the like. Other excipients known in the art may also be introduced into the final dosage form, including binders, disintegrants, fillers (solvents), lubricants, glidants (flow enhancers), compression agents, colorants, sweeteners, preservatives, suspending / dispersing agents, film formers / coatings, flavors and printing inks.

The compositions of the invention include a therapeutically effective amount of one or more macromolecules of interest. That is, the compositions include an amount of macromolecule / microparticle that will elicit a response in the subject sufficient to prevent, reduce, eliminate, or diagnose symptoms. The exact amount must be changed depending on the subject to be treated; the severity of the condition to be treated; in the case of an immune response, from the ability of the subject's immune system to synthesize antibodies; the degree of protection required and the particular antigen chosen and the method of its administration, as well as other factors. A suitable effective amount can easily be determined by a person skilled in the art. Thus, a therapeutically effective amount falls within a relatively wide range, which can be determined by routine trials.

For example, for the purposes of the present invention, when the molecule is a polynucleotide, the effective dose usually varies from about 1 ng to 10 mg, more preferably from about 10 ng to 1 mg, and most preferably from about 100 μg to 1 mg delivered macromolecule per dose; in the case where the molecule is an antigen, the effective dose usually varies from about 1 μg to 100 mg, more preferably from about 10 μg to 1 mg, and most preferably from about 50 μg to 1 mg of the delivered macromolecule per dose.

After preparation, the compositions of the invention can be administered parenterally, for example by injection. Compositions can be injected subcutaneously, intraperitoneally, intravenously or intramuscularly. Other routes of administration include nasal administration, mucosal administration, rectal, vaginal, oral and pulmonary administration, suppositories, and transdermal or transdermal administration. Dosage treatment may be a single dose regimen or a multiple dose regimen. In a multiple-dose regimen, the initial course of administration can be carried out in 1-10 divided doses, followed by other doses that are administered at the following time intervals, chosen to maintain and / or enhance the response to therapy, for example, a second dose is administered after 1-4 months, and, if required, the subsequent dose (s) are administered after a few months.

In particular embodiments of the invention, a series of one or more injections of a vector construct (which includes a heterologous nucleic acid sequence encoding an antigen) is followed by a series of one or more injections of antigen (also referred to herein as “maintenance injections”). As a specific example, a vector construct can be administered by three injections: (a) at the time of first administration, (b) at time 1-8 weeks after the first administration, (c) at time 4-32 weeks after first administration, then how an antigen can be administered by two injections: (a) at a time point 8-50 weeks after the first injection, (b) at a time point 8-100 weeks after the first injection.

The dosage regimen may also be, at least in part, determined by the needs of the subject and may depend on the decision of the practitioner.

Moreover, if disease prevention is required, microparticles with adsorbed vector constructs are mainly administered before the primary infection by the pathogenic microorganism of interest. If treatment of the disease is required (and not its prevention), for example, reduction of symptoms or relapses, microparticles with adsorbed vector constructs are mainly administered after the primary infection.

2. Oil-drop emulsions

In other implementations of the present invention, an oil-drop emulsion (in particular, a submicron emulsion) is prepared comprising a metabolizable oil and an emulsifying agent. Molecules, such as an oligonucleotide comprising at least one CpG motif, can be combined with an oil-drop emulsion to form an adjuvant.

The oil-drop emulsion preferably includes a metabolizable oil and an emulsifying agent, where the oil and emulsifying agent are present in the form of an oil-in-water emulsion containing oil droplets substantially all of which are less than one micrometer in diameter. Submicron emulsions with droplets of this preferred size range unexpectedly have an advantage over other emulsions containing oil and emulsifying agents in which the oil droplets are substantially larger than those of the present invention. In preferred embodiments, the emulsion is positively charged as a result of the presence of a cationic detergent that has been used as an emulsifying agent, or, alternatively, contains a cationic detergent in addition to the emulsifying agent. This promotes the adsorption of nucleotide antigenic molecules such as CpG oligonucleotides or vector constructs. Alternatively, the use of anionic detergents promotes the adsorption of molecules such as proteins.

Although the individual components of the submicron emulsion compositions of the invention are generally known, such compositions are not combined in the same manner. Accordingly, the individual components, although described below both in general and in some detail for preferred embodiments, are well known in the art and the terms used here, such as metabolizable oil, emulsifying agent, immunostimulating agent, muramyl peptide and lipophilic muramyl peptide, sufficiently known to indicate these compounds to those skilled in the art without further description.

One component of these compositions is a metabolizable, non-toxic oil, preferably consisting of about 6-30 carbon atoms, including but not limited to alkanes, alkenes, alkynes and their corresponding acids and alcohols, their ethers and esters, and mixtures thereof. The oil may be any vegetable oil, fish oil, animal oil or synthetically obtained oil that can be metabolized in the host animal to which an adjuvant will be administered and which is not toxic to the subject. The host animal is usually a mammal, and preferably a human. The use according to the invention of mineral oil and similar toxic oil products of oil distillation is expressly excluded.

The oil component of the invention may also be any long chain alkane, alkene or alkine, or an acid or alcohol derivative thereof, whether it is a free acid, a salt thereof or an ester such as a mono-, di- or triester, including triglycerides or esters 1,2-propanediol or similar polyhydroxy alcohols. Alcohols can be acylated using an amino or polyfunctional acid, for example, acetic acid, propionic acid, citric acid and the like. Ethers, derivatives of long chain alcohols that are oils and that meet other criteria set forth here, can also be used.

An individual alkane, alkene or alkynyl group and alcohols and acids derived from it may typically contain from about 6 to about 30 carbon atoms. This group may be characterized by a linear or branched chain structure. It can be fully saturated or contain one or more double or triple bonds. In the case of the use of oils based on polymers of esters or ethers, the restriction regarding about 6-30 carbons applies to the individual group of fatty acid or fatty alcohol, and not to the total number of carbon atoms.

Any metabolizable oil can be used here, especially from an animal, fish or plant. It is essential that this oil is metabolized by the host organism to which it is administered, otherwise the oil component may cause abscesses, granulomas or even carcinomas, or (when used in veterinary practice) may cause the oil of vaccinated birds and animals to become unacceptable human food due to the harmful effects of non-metabolized oil on the consumer.

For a detailed description of such submicron emulsions, see International Publication No. WO 90/14837 and International Patent Application PCT / US00 / 03331 belonging to the present applicant.

The oily component of these adjuvants and immunogenic compositions may be present in an amount of about 0.5% to 20% by volume, but preferably not more than 15%, especially in an amount of about 1% to 12%. Most preferably, about 1% to 4% oil is used.

The aqueous portion of these submicron emulsion compositions is preferably a salt buffer, or, more preferably, impurity free water. Since these compositions are intended for parenteral use, it is preferable to formulate buffer solutions used as immunogenic compositions so that the salt content, i.e. osmolarity will be essentially the same as in normal physiological fluids to prevent swelling after administration or rapid absorption of the composition resulting from different concentrations of ions in the composition and physiological fluids. It is also preferable to make the saline solution buffered to maintain a pH value compatible with normal physiological conditions. Also, in some cases, it may be necessary to maintain the pH at a specific level to ensure the stability of certain components of the composition, such as glycopeptides.

Any pharmaceutically acceptable buffer may be used, but phosphate buffers are preferred. Other suitable buffers, such as acetate, tris, bicarbonate, carbonate, and the like, may be used as a substitute for phosphate buffers. The pH of the aqueous component is preferably about 6.0-8.0.

However, at the beginning of the preparation of the submicron emulsion, the preferred aqueous component of the emulsion is uncontaminated water. An increase in salt concentration leads to difficulties in achieving the required small droplet size. Upon receipt of the final immunogenic composition from the adjuvant, the antigenic material may be added to a buffer of suitable osmolarity to provide the desired immunogenic composition.

The amount of water component used in these compositions is necessary to bring to a unit volume of the composition. That is, an amount of an aqueous component sufficient to form 100% is mixed with the other components listed above to increase the volume of the compositions.

In the pharmaceutical fields, a substantial amount of emulsifying and suspending agents are generally used. These include naturally occurring materials such as tree resins, vegetable protein, sugar based polymers such as alginates and cellulose, and the like. Some oxypolymers or polymers containing hydroxide or other hydrophilic substituents on the carbon skeleton have the effect of surfactants, for example povidone, polyvinyl alcohol and mono- and polyfunctional glycol ether-based compounds. Compounds derived from long chain fatty acids form the third significant group of emulsifying and suspending agents that can be used according to the invention. Any of the aforementioned surfactants may be used provided that they are not toxic.

Specific examples of suitable emulsifying agents (also referred to as surfactants and detergents) that can be used according to the invention are described in PCT / USOO / 0331 belonging to the present applicant. Surfactants are mainly divided into four main types: anionic, cationic, zwitterionic and nonionic. Non-limiting examples of anionic detergents include alginic acid, caprylic acid, cholic acid, 1-decanesulfonic acid, deoxycholic acid, 1-dodecansulfonic acid, N-lauroyl sarcosine and taurocholic acid, and the like. Cationic detergents include, but are not limited to, cetrimide (cetyltrimethylammonium bromide or CTAB), benzalkonium chloride, dimetildioktodetsilammoniya (DDA) bromide, DOTAP, dodecyltrimethylammonium bromide, benzildimetilgeksadetsilammoniya chloride, cetylpyridinium chloride, metilbenzetoniya chloride, and 4-pikolindodetsilsulfat and the like. Non-limiting examples of zwitterionic detergents include 3 - [(3-cholamidopropyl) dimethylammonium] -1-propanesulfonate (commonly abbreviated as CHAPS), 3 - [(cholamidopropyl) dimethylammonium] -2-hydroxy-1-propanesulfonate (mainly referred to as CHAPSO ), N-dodecyl-N, N-dimethyl-3-ammonium-1-propanesulfonate and lyso-α-phosphatidylcholine, and the like. Non-limiting examples of nonionic detergents include decanoyl-N-methylglucamide, diethylene glycol monopentyl ether, n-dodecyl-β-D-glucopyranoside, condensation products of ethylene oxide with fatty alcohols (for example, commercially available under the trade name Lubrol), polyoxyethylene fatty acid esters (particularly, C ₁₂ -C ₂₀ fatty acids), polyoxyethylene sorbitan fatty acid esters (e.g., commercially available under the trade name Tween), and sorbitan fatty acid esters (e.g., commercially available under the trade is called aniem Span), and the like.

A particularly useful group of surfactants are sorbitan-based nonionic surfactants, such as the commercially available SPAN ^® or ARLACEL ^® , usually with a letter or number designation, designed to distinguish between different mono-, di- or tri-ester substituted sorbitans. A related group of surfactants includes polyoxyethylene sorbitan monoesters and polyoxyethylene sorbitan triesters commercially available under the TWEEN ^® brand name. To ensure stability of the emulsion, TWEEN surfactants can be combined with related surfactants based on sorbitan monoesters or triesters.

The size of oil droplets can vary due to changes in the ratio of detergent to oil (increasing the ratio reduces the size of the drop, working pressure (increasing the working pressure decreases the size of the drop), temperature (increasing temperature decreases the size of the drop) and by adding an amphipathic immunostimulant (adding such means reduces droplet size.) The actual droplet size varies depending on the specific detergent, oil and immunostimulant (if any) and depending on the specific The selected dropping conditions can be confirmed by droplet size using commercial size measurement equipment such as the commercial Sub-Micron Particle Analyzer (Model N4MD) manufactured by Coulter Corporation, and these parameters can be changed according to the guidelines set out above until essentially all droplets will be less than 1 micrometer in diameter, preferably less than 0.8 micrometers in diameter, and most preferably less than 0.5 micrometers in diameter. “Essentially all drops” means at least about 80% (by quantity), preferably at least about 90%, more preferably at least about 95%, and most preferably at least about 98 % The particle size distribution is usually Gaussian, so that their average diameter is smaller than the specified limits.

A preferred oil droplet emulsion is MF59. MF59 can be obtained by the procedures described, for example, by Ott et al., Vaccine Design: The Subunit And Adjuvant Approach, 1995, M. F. Powell and M. J. Newman, Eds., Plenum Press, New York, p. 277-296; Singh et al., Vaccine, 1998,16,1822-1827; Ott et al, Vaccine, 1995,13,1557-1562; and Valensi et al., J. Immunol., 1994, 153, 4029-39, descriptions of these publications are incorporated herein by reference in their entirety.

Other oil-drop emulsions include, for example, SAF containing 10% squalene, 0.4% Tween 80, 5% pluron blocked polymer L121 and thr-MDP, microfluidized to form a submicron emulsion, or processed on a vortex-type device to form an emulsion with larger particles, and the Ribi ^® adjuvant system (RAS), (Ribi Immunochem, Hamilton, Montana) containing 2% squalene, 0.2% Tween 80 and one or more components of the bacterial cell wall from the group consisting of monophosphoryl lipid A (MPL), trehalose dimicolate (TDM), and cytoskel cell wall (CWS), preferably MPL + CWS (Detox ™) (for further discussion of submicron oil-in-water emulsions suitable for use here, see patent application No. 09/015736, filed on January 29, 1998).

After the preparation of microparticles according to the invention, of a polymer type or a type of submicron emulsion, macromolecules such as polypeptides and vector constructs can be adsorbed on them, as discussed previously. Microparticles based on a submicron emulsion according to the invention may also contain macromolecules captured or encapsulated inside them, and also contain macromolecules adsorbed on them. Thus, for example, one skilled in the art can, according to the invention, obtain microparticles containing encapsulated adjuvants with the ELVIS vector adsorbed on them, or microparticles containing encapsulated antigen and a vector RNA construct adsorbed on them. This invention relates to various combinations of nucleic acid macromolecules adsorbed on microparticles and trapped inside them, with other nucleic acids, as well as other antigenic molecules. Preferably, the microparticles according to the invention contain ELVIS vectors adsorbed onto them or wind RNA constructs. In addition, any implementation of the microparticles according to the invention can be delivered in combination with electroporation.

3. Vectors of ELVIS

ELVIS vectors are eukaryotic multilevel vector initiation systems, which are mainly described in US patents 5814482 and 6015686, cited above, as well as in International Patent Applications WO 97/38087 and WO 99/18226. In one embodiment, the ELVIS vector originates from the genome of the alphavirus, more preferably Sindbis virus (SIN), Forest Semliki virus (SFV), Venezuelan equine encephalitis virus (VEE), or Ross River virus (RRV). Alphavirus is an RNA virus of approximately 11-12 kb in length containing a 5'-terminal cap and a 3'-terminal polyadenylate tail. A mature infectious virus consists of genomic RNA surrounded by a nucleocapsid and enveloped proteins. Alphavirus infection of host cells occurs as a receptor-mediated event, culminating in the release of genomic RNA into the cytoplasm. During the replication of the virus, virus-encoded envelope glycoproteins E1 and E2 are synthesized and inserted into the host cell membrane, through which daughter virions break down and release from the host cell.

Replication of the viral genome begins with the genomic RNA chain, which serves as a template for the synthesis of a complementary RNA minus strand. The minus strand of RNA then serves as a template for full-length genomic RNA and for internally initiated subgenomic RNA with plus strand. Non-structural proteins are translated from the genomic chain, while structural proteins are translated from the subgenomic chain. All viral genes are first expressed as polyproteins, then undergo post-translational processing by proteolytic cleavage to form individual proteins.

Alphavirus vector replicon can be formed by substituting some parts of the viral genome (for example, structural protein genes) with a selected heterologous nucleic acid sequence. Thus, in some embodiments, the alphavirus replicon may include a 5'-terminal sequence capable of initiating transcription of the alphavirus, a nucleotide sequence encoding non-structural proteins of the alphavirus, an alphavirus promoter of the fusion region, an alphavirus RNA polymerase recognition site, and a 3'-terminal polyadenylate region. In addition, the alphavirus vector construct may contain an alphavirus vector replicon in the form of a copy of cDNA. Such vector constructs typically include a 5'-terminal promoter capable of initiating RNA synthesis with cDNA, which is located upstream and is functionally associated with vector cDNA, such that vector RNA replicon is formed upon such transcription. The vector construct may contain a 3'-terminal sequence that controls transcription termination. A heterologous nucleic acid sequence may be present upstream or downstream from the fusion viral region.

The advantage of using the ELVIS vector is based on the RNA virus replication mechanism, which ensures the delivery of heterologous nucleotide sequences of interest by applying a two-layer approach (for example, based on the alphavirus vector construction described above). In general, the ELVIS vector is a multi-level expression system capable of amplifying a certain amount of RNA encoding a gene product of interest because the first layer initiates transcription of the second layer. So, a typical ELVIS vector includes a 5'-terminal promoter capable of initiating RNA synthesis with cDNA, cDNA, a complementary construct capable of autonomous replication in the cell, and this construct is also capable of expressing a heterologous nucleic acid sequence and 3'-sequence, controlling transcription termination. A construct capable of autonomous replication and expression of a selected nucleic acid sequence may be an alphavirus vector construct. Thus, the alphavirus vector RNA construct is transcribed from the first layer of the ELVIS DNA vector, with which the expression of the selected heterologous nucleic acid sequence is achieved.

Alphavirus-based ELVIS vector can initially be constructed by obtaining cDNA complementary to the alphavirus genome. The cDNA corresponding to genomic RNA is then deleted by sequences encoding one or more structural viral proteins, which can then be replaced by heterologous DNA encoding the gene product of interest, which thus prevents the assembly of the mature virus and ensures amplification of the heterologous sequence. The modified cDNA containing the heterologous sequence is then inserted into the first layer of the ELVIS vector. After introduction into the cell and nucleus, the ELVIS vector is transcribed, and the resulting mRNA molecules, which are self-replicating RNA vectors, begin to replicate and translate the polypeptides, including the heterologous gene of interest.

Although a conventional alphavirus vector construct derived from the Sindbis virus is preferred, other types of alphaviruses can easily be used according to the concept presented here. Alternatively, vectors originating from any RNA virus can be involved, especially viruses with plus strand.

The construction of the ELVIS vector is generally described in US Pat. Nos. 5,814,482 and 6,015,686. Briefly, RNAs are derived from an RNA virus, while cDNAs are synthesized by PCR amplification using suitable primers for specific genes or portions of the RNA virus, these primers being necessary may also contain additional restriction sites. The cDNA fragments are then cloned into a plasmid and transformed with them into a suitable host, such as E. coli. Positive colonies are grown to purify the plasmid and then the plasmids are combined in the desired ELVIS vector with a portion containing heterologous DNA, such as a reporter gene (e.g., GFP) or the desired gene encoding the antigen. Example 3 below describes a specific preferred ELVIS vector (pSINCP) used according to the invention.

4. Vector RNA constructs and pCMV vector constructs

In other implementations of the present invention, a vector RNA construct or an RNA-based replicon vector is applied directly without requiring DNA to be introduced into the cell and transport to the nucleus where transcription is to occur. By using an RNA vector for direct delivery to the cytoplasm of the host cell, autonomous replication and translation of the heterologous nucleic acid sequence is effective. In this embodiment, a vector RNA construct or an RNA-based replicon vector is obtained by in vitro transcription of a DNA-based vector construct. Preferably, the RNA vector RNA construct or RNA vector replicon is derived from the alphavirus genome, more preferably Sindbis virus (SIN), Forest Semliki virus (SFV), Venezuelan equine encephalitis virus (VEE), or Ross River virus (RRV). In other implementations, the vector RNA construct is derived from a virus other than alphavirus. Preferably, such viruses used to create derivatives of vector RNA constructs are plus-strand RNA viruses and, more preferably, they are picornaviruses, flaviviruses, rubiviruses or coronaviruses. Compositions and methods for transcribing vitro alphavirus-based RNA vectors are described in detail elsewhere (see US Pat. No. 5,842,723 and Polo et al., 1999, PNAS 96: 4598-603). The RNA vector is then adsorbed onto a microparticle according to the invention for delivery, as described in detail here. Although a preferred alphavirus RNA vector from SIN, SFV, VEE or RRV is preferred, they can be easily replaced by other types of alphaviruses.

In another embodiment of the present invention, pCMV vector constructs are used. Such vector constructs are well known in the art. A particularly preferred pCMV vector contains an immediate early CMV enhancer / promoter and a bovine growth hormone terminator. It is described in detail by Chapman, B. S., et al. 1991. "Effect of intron A from human cytomegalovirus (Towne) immediate-early gene on heterologous expression in mammalian cells." Nucleic Acids Res. 19: 3979-86.

5. Adjuvants

Adjuvants may optionally be used to enhance the effectiveness of pharmaceutical compositions, with Th1 stimulating adjuvants being particularly preferred. Adjuvants can be administered simultaneously with the microparticles according to the invention, for example, in the same composition or in different compositions. Alternatively, an adjuvant may be administered before or after administration of the microparticle compositions of the invention. In another embodiment, an adjuvant, such as an immunological adjuvant, can be encapsulated in a microparticle. Adjuvants, like any other macromolecule, can be encapsulated in microparticles using any of several methods known in the art. See, for example, US patent No. 3523907; Ogawa et al., Chem Pharm. Bull. (1988) 36: 1095-1103; O'Hagan et al., Vaccine (1993) 11: 965-969 and Jefferey et al., Pharm. Res. (1993) 10: 362. Alternatively, adjuvants can be adsorbed onto a microparticle as described above for any macromolecule. Alternatively, adjuvants may include oil-drop emulsions according to the invention.

Immunological adjuvants include, but are not limited to: (1) aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc .; (2) other preparations of an oil-in-water emulsion (with the addition of other specific immunostimulatory agents, such as muramyl peptides (see below) or components of a bacterial cell wall, with or without them), such as, for example, (a) MF59 (International Publication No. W090 / 14837; chapter 10 in Vaccine design: the subunit an adjuvant approach, eds. Powell & Newman, Plenum Press 1995) containing 5% squalene, 0.5% Tween 80, and 0.5% Span 85 (optionally containing various amounts MTP-PE (see below), although this is not required), compiled in the form of submicron particles using a microfluidizer, such as a microfluidizer mode 110Y spruce (Microfluidics, Newton, Mass.), (b) SAF containing 10% squalene, 0.4% Tween 80, 5% pluron blocked polymer L121 and thr-MDP (see below) microfluidized to form a submicron emulsion or processed on a vortex-type device with the formation of an emulsion with larger particles, (c) Ribi ^® adjuvant system (RAS), (Ribi Immunochem, Hamilton, Montana) containing 2% squalene, 0.2% Tween 80 and one or more bacterial cell components walls from the group consisting of monophosphoryl lipid A (MPL), trehalose dimicolate (TDM) and cell wall cytoskeleton APIS (CWS), preferably MPL + CWS (Detox ™) (for a further discussion of suitable submicron for use herein are oil in water emulsions refer belonging to the applicant for a patent application № 09/015736, filed January 29, 1998.); (3) saponin adjuvants may be used, such as Quil A or QS21 (e.g., Stimulon ™ (Cambridge Bioscience, Worcester, Mass.)) Or particles derived therefrom, such as ISCOM (immunostimulatory complexes), and ISCOM data may not contain additional detergents for example WO00 / 07621; (4) Freund's complete adjuvant (CFA) and Freund's incomplete adjuvant (IFA); (5) cytokines such as interleukins (e.g., IL-1, IL-2, IL-4, IL5, IL-6, IL-7, IL-12 (W099 / 44636), etc.), interferons (e.g. gamma interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), etc .; (6) monophosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL), for example GB-2220221, EP-A-0689454, optionally in the complete absence of alum when used with pneumococcus polysaccharides, for example WO00 / 56358; (7) combinations of 3dMPL, for example with QS21 and / or oil-in-water emulsions, for example EP-A-0835318, EP-A0735898, EP-A-0761231; (8) oligonucleotides including CpG motifs (Roman et al., Nat. Med., 1997,3,849-854; Weiner et al., PNAS USA, 1997,94,10833-10837; Davis et al., J. Immunol 1988,160,870-876; Chu et al., J. Exp. Med., 1997,186,1623-1631; Lipford et al., Eur. J. Immunol. 1997,27,23440-2344; Moldoveanu et al., Vaccine, 1988, 16,1216-1224, Krieg et al., Nature, 1995,374,546-549; Klinman et al., PNAS USA, 1996.93.2879-2883: Ballas et al., J. Immunol., 1996 , 157.1840-1845; Cowdery et al., J. Immunol., 1996,156,4570-4575; Halpern et al., Cell. Immunol., 1996,167,72-78; Yamamoto et al., Jpn. J. Cancer Res., 1988, 79,866-873; Stacey et al., J Immunol, 1996,157,2116-2122; Messina et al., J. Immunol., 1991,147,1759-1764; Yi et al. , J. Immunol., 1996,157,4918-4925; Yi et al., J. Immunol., 1996,157,5394-5402; Yi et al., J. Immunol., 1998,160,4755-4761; and Yi et al., J: Immunol., 1998,160,5898-5906; International patent applications W096 / 02555, W098 / 16247, W098 / 18810, W098 / 40100, W098 / 55495, W098 / 37919 and W098 / 52581), i.e. containing at least one CG dinucleotide, optionally using 5-methylcytosine instead of cytosine; (9) polyoxyethylene ether or ester, for example W099 / 52549; (10) a surfactant comprising a polyoxyethylene sorbitan ester in combination with octoxynol (WO01 / 21207) or a surfactant comprising a polyoxyethylene alkyl ether or ester in combination with at least one additional non-ionic surfactant a substance such as oxoxynol (WO01 / 21152); (11) saponin and an immunostimulatory oligonucleotide (e.g., CpG oligonucleotide) (WO00 / 62800); (12) an immunostimulant and a particle of a metal salt, for example WO00 / 23105; (13) saponin and an oil in water emulsion, for example W099 / 11241; (14) saponin (e.g. QS21) + 3dMPL + IL-12 (optional, plus sterol), e.g. W098 / 57659; (15) detoxified mutants of a bacterial ADP-ribosylating toxin, such as cholera toxin (CT), pertussis toxin (PT) and heat-labile toxin E. coli (LT), especially LT-K63 (in which lysine at position 63 replaces the amino acid characteristic of wild-type), LT-R72 (in which arginine at position 72 replaces the wild-type amino acid), CT-S109 (in which serine at position 109 replaces the wild-type amino acid) and PT-K9 / G129 (in which lysine at position 9 replaces the wild-type amino acid, and glycine is substituted in polo enii 129) (see, e.g., International Publication Nos W093 / 13202 and W092 / 19265)..; (16) other substances that act as immunostimulatory agents that enhance the effectiveness of the composition. Alum (especially aluminum phosphate and / or hydroxide) and MF59 are preferred.

Muramyl peptides include, but are not limited to, N-acetylmuramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetylnormuramyl-L-alanyl-D-isoglutamine (nor-MDP), N acetylmuramyl-L-alanyl-D -isoglutaminyl-L-alanine-2- (1 ', 2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy) ethylamine (MTP-PE), etc.

For further examples of adjuvants, see Vaccine Design, The Subunit and the Adjuvant Approach, Powell, M. F. and Newman, M. J, eds., Plenum Press, 1995.

Thus, an optional additional component of the compositions according to the invention is an adjuvant, such as aluminum salts or an oligonucleotide containing at least one CpG motif. The term “CpG motif” as used herein refers to the dinucleotide portion of an oligonucleotide that includes a cytosine nucleotide followed by a guanosine nucleotide. Such oligonucleotides can also be obtained by conventional oligonucleotide synthesis, well known to the person skilled in the art. Preferably, the oligonucleotides according to the invention include a modified skeleton, for example, based on phosphorothioacid or peptide nucleic acid, to ensure the resistance of the oligonucleotide to nucleases. Modified skeletons are well known to those skilled in the art. Preferred peptide nucleic acids are described in detail in US Pat. Nos. 5,821,060, 5,789,573, 5,736,392 and 5,721,102, Japanese Patent No. 10231290, European Patent No. 839828 and PCT Publication No. WO 98/42735, WO 98/42876, WO 98/36098, WO 98/27105 , WO 98/20162, WO 98/16550, WO 98/15648, WO 98/04571, WO 97/41150, WO 97/39024 and WO 97/38013, descriptions of these publications are incorporated herein by reference in their entirety.

The oligonucleotide preferably includes from about 6 to 100 nucleotides, more preferably from about 8 to 50 nucleotides, most preferably from about 10 to 40 nucleotides. In addition, the oligonucleotides of the invention may include substitutions of sugar groups and nitrogen base groups. Preferred oligonucleotides, for example, are described by Krieg et al., Proc. Natl. Acad. Sci. USA, 1998,95,12631-12636, Klinman et al., Proc. Natl. Acad. Sci. USA, 1996.93.2879-2883, Weiner et al., Proc. Natl. Acad. Sci. USA 1997,94,10833-10837, Chu et al., J. Exp. Med., 1997,186,1623-1631, Brazolot-Millan et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15553-15558, Ballas et al., J. Immunol., 1996,157,1840-1845, Cowdery et al., J. Immunol., 1996,156,4570-4575, Halpern et al. , Cell. Immunol., 1996, 167, 72-78, Yamamoto et al., Jpn. J. Cancer Res., 1988.79,866-873, Stacey et al., J. Immunol., 1996,157,2116-2122, Messina et al., J. Immunol., 1991,147,1759-1764, Yi et al., J. Immunol., 1996,157,4918-4925, Yi et al., J. Immunol., 1996,157,5394-5402, Yi et al., J. Immunol., 1998, 160, 4755- 4761, Roman et al., Nat. Med., 1997,3,849-854, Davis et al., J. Immunol., 1998,160, 870-876, Lipford et al., Eur. J. Immunol., 1997,27,2340-2344, Moldoveanu et al., Vaccine, 1988,16,1216-1224, Yi et al., J. Immunol., 1998,160,5898-5906, in PCT Publication WO 96/02555, PCT Publication WO 98/16247, PCT Publication WO 98/18810, PCT Publication WO 98/40100, PCT Publication WO 98/55495, PCT Publication WO 98/37919 and PCT Publication WO 98/52581, descriptions of these publications are included the description is fully by reference. It should also be understood that the oligonucleotides of the invention may include at least one CpG motif, but may also contain many CpG motifs.

Preferred oligonucleotides include nucleotide sequences, for example, such as tccatgacgttcctgacgtt (SEQ ID NO: 1), ataatcgacgttcaagcaag (SEQ ID NO: 2), ggggtcaacgttgagggggg (SEQ ID NO: 3), SEQ ID NO: 3), tctcccagcgtgcgggggggg SEQ ID NO: 5), tccatgtcgttcctgatgct (SEQ ID NO: 6), tccatgacgttcctgatgct (SEQ ID NO: 7), gctagacgttagcgt (SEQ ID NO: 8), atcgactctcgagcgttctc (SEQ ID NO: 9), gagggac ), gctagatgttagcgt (SEQ ID NO: 11), tcaacgtt (SEQ ID NO: 12), gcaacgtt (SEQ ID NO: 13), tcgacgtc (SEQ ID NO: 14), tcagcgct (SEQ ID NO: 15), tcaacgct (SEQ ID NO: 15) ID NO: 16), tcatcgat (SEQ ID NO: 17), tcttcgaa (SEQ ID NO: 18), tgactgtgaacgttcgagatga (SEQ ID NO: 19), tgactgtgaacgttagcgatga (SEQ ID NO: 20), tgactgtgaacgttagagcgga (SE) , gtttgcgcaacgttgttgccat (SEQ ID NO: 22), atggcaacaacgttgcgcaaac (SEQ ID NO: 23), cattggaaaacgttctttcgggg (SE Q ID NO: 24), ccccgaagaacgttttccaatg (SEQ ID NO: 25), attgacgtcaat (SEQ ID NO: 26), ctttccattgacgtcaatgggt (SEQ ID NO: 27), and tccatacgttcctgacgtt (SEQ ID NO: 28). In preferred embodiments of the invention, the oligonucleotide contains a CpG motif flanked by two purines on the 5'-side of the motif and two pyrimidines on the 3'-side of the motif. However, it should be understood that any oligonucleotide containing a CpG motif can be used according to the invention, provided that the oligonucleotide in combination with the microparticle compositions described herein induces an increase in stimulation of Th1 lymphocytes.

6. Antigens

The present invention also relates to immunogenic compositions comprising the microparticles described above with adsorbed macromolecules, preferably with vector constructs encoding antigens and / or a single antigen. Typically, an antigen stimulates the proliferation of T-lymphocytes, preferably Th1 lymphocytes, through antigen receptors and can interact with lymphocytes, initiating a set of reactions, which is referred to as cell-mediated immunity. Thus, an antigen can induce a CTL response and / or a humoral response and can induce cytokine production.

The epitope lies within the scope of this definition of antigen. An epitope is a part of an antigenic molecule or antigenic complex that determines immunological specificity. Typically, an epitope is a peptide or polysaccharide in naturally occurring antigens. In artificial antigens, it can be a low molecular weight substance, such as an arsanilic acid derivative. The epitope specifically interacts in vivo or in vitro with homologous antibodies or T-lymphocytes. Alternative identifiers are antigenic determinants, antigenic structural groups, and haptenic groups.

In preferred embodiments of the invention, the antigenic substance is derived from a virus, such as, for example, human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV), herpes simplex virus (HSV), cytomegalovirus (CMV), virus flu (flu) and rabies virus. Preferably, the antigenic substance is selected from the group consisting of glycoprotein gD from HSV, glycoprotein gp120 from HIV, p55 gag from HIV, and polypeptides from the pol and tat regions of HIV. In other preferred embodiments of the invention, the antigenic substance is derived from a bacterium, such as, for example, Helicobacter pylori, Haemophilus influenza, causative agents of cholera, diphtheria, tetanus, Neisseria meningitidis, the causative agent of pertussis. In other preferred embodiments of the invention, the antigenic substance is derived from a parasite, for example, such as a malaria parasite. In another preferred embodiment of the present invention, the antigen is adsorbed on the surface of a microparticle according to the invention.

Antigens may be produced by methods known in the art, or may be ordered from commercial sources. Antigens within the scope of this invention include whole inactivated viral particles, isolated viral proteins and protein subunits, whole cells and bacteria, cell membranes and cell wall proteins, and the like. Some preferred antigens are described below.

Herpes simplex virus (HSV) rgD2 is a recombinant protein produced in genetically engineered Chinese hamster ovary cells. In this protein, the normal anchor region is shortened, which leads to the secretion of the glycosylated protein in the tissue culture medium. gD2 can be purified in CHO medium to a purity of more than 90%. env-2-3 human immunodeficiency virus (HIV) is a recombinant form of HIV envelope protein produced in genetically engineered Saccharomyces cerevisae. This protein is a whole gp120 protein region from HIV, but is not glycosylated and denatured when purified from yeast. HIV gp120 is a fully glycosylated secreted form of gp120 produced in CHO cells in a manner similar to that described above for gD2. Additional HSV antigens suitable for use in immunogenic compositions are described in PCT Publications WO 85/04587 and WO 88/02634, descriptions of these publications are incorporated herein by reference in their entirety. Particularly preferred are mixtures of gB and gD antigens, which are shortened surface proteins lacking anchor regions.

Additional HIV antigens, applications in immunogenic compositions, are described in the application for the grant of US patent No. 490858, filed March 9, 1990, and in the published application for the grant of European patent No. 181150 (May 14, 1986), as well as in applications for the grant U.S. Patent No. 60/168471; 09/475515; 09/475504 and 09/610313, descriptions of these publications are incorporated by reference in their entireties.

Cytomegalovirus antigens suitable for use in immunogenic compositions are described in US Pat. No. 4,689,225, U.S. Patent Application No. 367363, filed June 16, 1989, and PCT Publication WO 89/07143, the disclosures of which are incorporated by reference in their entirety.

Hepatitis C virus antigens suitable for use in immunogenic compositions are described in PCT / US88 / 04125, published European Patent Application Publication No. 318216 (May 31, 1989), Japanese Patent Application Publication No. 1-500565, issued November 18, 1988 ., in Canadian Patent Application 583561 and EPO 388232, descriptions of these publications are incorporated herein by reference in their entirety. Another set of HCV antigens is described in the application for the grant of European patent 90 / 302866.0, filed March 16, 1990, and in the application for the grant of US patent No. 456637, filed December 21, 1989, and in PCT / US90 / 01348, the description of these publications fully incorporated by reference.

The immunogenic compositions of the invention can be used to immunize birds and mammals against diseases and infections, including but not limited to cholera, diphtheria, tetanus, pertussis, influenza, measles, meningitis, mumps, plague, polio, rabies, Rocky Mountain spotted fever, rubella, smallpox, typhoid fever, typhus, feline leukemia virus and yellow fever.

Some immunogenic compositions of the invention may include an effective amount of antigen. For example, they may contain an amount of antigen that, in combination with an adjuvant, will stimulate the subject to produce a specific and sufficient immune response, so that the subject will be protected from subsequent exposure to the virus, bacteria, fungus, mycoplasma or parasite.

In other implementations, a composition comprising an antigen is used to support an immune response to a previously introduced vector construct, which preferably includes a heterologous nucleic acid sequence encoding that antigen. More preferably, the antigen is associated with the microparticles described herein (e.g., adsorbed on them) and / or the antigen is administered together with an adjuvant.

The appointment of a single dose for manipulating any and every antigen that can be used according to the invention is excluded. An effective amount of antigen is a function of its inherent activity and purity and is determined empirically by an ordinary person skilled in the art through routine experimentation. It is contemplated that the adjuvant compositions of the invention can be used in conjunction with immunogenic compositions of whole cells and viruses, as well as purified antigens or protein subunits, or peptide immunogenic compositions obtained by recombinant DNA methods or synthetically.

When an antigen is provided together with an emulsion due to the stability of the adjuvant composition of the invention, the antigen and emulsion can usually be mixed by simple shaking. Suitable immunogenic compositions are readily prepared by other methods, such as rapidly passing a mixture of adjuvant and antigen solution or suspension through a small opening (such as a hypodermic needle).

Immunogenic compositions according to the invention include from about 1 nanogram to 1000 micrograms of nucleic acid, preferably DNA, for example, such as CpG oligonucleotides. In some preferred embodiments, the immunogenic compositions comprise from about 10 nanograms to 800 micrograms of nucleic acid. In some preferred embodiments, the immunogenic compositions comprise from about 0.1 to 500 micrograms of nucleic acid. In some preferred embodiments, the immunogenic compositions comprise from about 1 microgram to 10 milligrams of nucleic acid. In some preferred embodiments, the immunogenic compositions comprise from about 250 micrograms to 1 milligram of nucleic acid. In some preferred embodiments, the immunogenic compositions comprise from about 500 micrograms to 1 milligram of nucleic acid. One of skill in the art can readily formulate an immunogenic composition comprising any desired amount of nucleic acid. Immunogenic compositions according to the invention are provided in sterile form and in the absence of flammable substances. These immunogenic compositions may conventionally be administered in dosage units and may be prepared by any of the methods well known in the pharmaceutical art, for example those described in Remington's Pharmaceutical Sciences (Mack Pub. Co., Easton, PA, 1980), the disclosure of which is fully incorporated. as a reference.

The present invention also relates to methods of stimulating an immune response in a host animal, comprising administering to the animal one or more of the immunogenic compositions described above in an amount effective to elicit an immune response. The host animal is preferably a mammal, more preferably a human. Preferred routes of administration include, but are not limited to, the intramuscular, intraperitoneal, intradermal, subcutaneous, intravenous, intraarterial, intraocular, and oral routes, as well as transdermally or by inhalation or suppository. Most preferred routes of administration include intramuscular, intraperitoneal, intradermal and subcutaneous injection.

In some embodiments of the present invention, the immunogenic compositions are administered to a host animal using needleless injection devices that are well known and publicly available. A person of ordinary skill in the art, following the directions given here, can use needleless injection devices to deliver immunogenic compositions to cells or subjects. In addition, embodiments of the invention may be delivered in conjunction with electroporation.

The present invention also relates to methods of immunizing an animal host against a viral, bacterial or parasitic infection, comprising administering to the animal one or more of the immunogenic compositions described above in an amount effective to induce a protective response. The host animal is preferably a mammal, more preferably a human. Preferred routes of administration are as described above. Although prophylactic or therapeutic treatment of an animal host can be directed to any pathogenic microorganism, preferred pathogenic microorganisms, including but not limited to viral, bacterial and parasitic pathogenic microorganisms, are described above.

The present invention also relates to methods for inducing an immune response in a host animal, comprising administering to the animal one or more of the immunogenic compositions described above in an amount effective to induce an immune response. The host animal is preferably a mammal, more preferably a human. Preferred routes of administration are as described above. Specialist in this field are well known types of immune response and methods for measuring them.

The present invention relates to the use of polymer microparticles or submicron emulsion microparticles with adsorbed macromolecules for their induction of an immune response alone or in combination with other macromolecules. This means that the present invention relates to microparticles with an adsorbed nucleic acid, submicron emulsions with an adsorbed nucleic acid or immunostimulating molecule, and to a combination of microparticles with an adsorbed nucleic acid together with submicron emulsions with an adsorbed nucleic acid or immunostimulating molecule. Electroporation can be used to improve nucleic acid delivery.

As demonstrated in the following examples, polymer microparticles with adsorbed macromolecules according to the invention elicit a powerful immune response. In addition, the submicron emulsion microparticles of the invention also elicit a potent immune response. Therefore, the combination of microparticles according to the invention with adsorbed macromolecules is a powerful means for inducing an immune response.

All references cited herein are incorporated by reference in their entirety.

C. Experimental

The following are examples of specific implementations for carrying out the present invention. Examples are provided for illustrative purposes only and are in no way intended to limit the scope of the present invention. Modifications are known to those skilled in the art that are within the scope of the present invention.

To ensure accuracy with respect to the values used (for example, quantity, temperature, etc.), great efforts have been expended, but nevertheless, some experimental errors and deviations must be corrected.

Example 1

Obtaining polymer microparticles with adsorbed nucleic acid

Microparticles of PLG-CTAB were obtained using a modified evaporation process. Briefly, microparticles were obtained by emulsification of 10 ml of 5% wt./about. a solution of the polymer in methylene chloride with 1 ml of TE buffer at high speed using an IKA homogenizer. The primary emulsion was then added to 50 ml of distilled water containing cetyltrimethylammonium bromide (CTAB) (0.5% w / v). This led to the formation of a water-oil-water emulsion, which was stirred at 6000 rpm for 12 hours at room temperature, allowing methylene chloride to evaporate. The resulting microparticles were washed twice with distilled water by centrifugation at 10000 g and freeze-drying.

For a typical batch of 100 mg DNA adsorbing microparticles, 100 mg of PLG-CTAB cationic microparticles were added to a glass vessel and resuspended in 5 ml of a 200 μg / ml DNA solution (e.g., plasmid pCMV or pSINP containing gp140 or p55gag) in TE buffer. The suspension was mixed on a Vortex-type device for one minute to uniformly disperse the microparticles in the DNA solution. The vessel was kept overnight on a shaker (slow speed) at 4 ° C for adsorption. The next day, the microparticles were centrifuged for 10 minutes at 8000 rpm on a Beckman centrifuge, after which the supernatant was collected for DNA quantification. The pellet was washed once in 1X TE buffer by resuspension, stirred with a spatula and centrifuged for 10 minutes at 8000 rpm. The final precipitate was resuspended in a minimal amount of deionized water (approximately 2 ml) by stirring with a spatula and freeze dried for 24 hours on a freeze dryer with a work surface (Labconco).

The supernatant was analyzed for DNA content by measuring absorbance at 260 nm. The amount of DNA absorbed on the microparticles was calculated by subtracting the amount of DNA in the supernatant from the total amount of added DNA (1 mg per 10 mg of particles). The total load was estimated by dissolving 5 mg of the final composition in a solution of 0.5 M NaOH / 1% SDS and measuring the absorbance of the pure solution after hydrolysis at 260 nm.

Example 2

Obtaining submicron emulsion microparticles with adsorbed nucleic acid

Submicron emulsions formed from MF59 and DOTAP were obtained by placing DOTAP (in chloroform) in a beaker, allowing it to evaporate up to 200 μl. To obtain a homogeneous base for the final emulsion, Tween (0.5% w / w), squalene (5% w / w) and Span (0.5% w / w) were added and 10 mm samples were homogenized at 10K rpm for 1 minute in an Omni homogenizer. This base was passed 5 times through a Microfludizer M110S homogenizer (Microfluidics Co., Newton, MA) at a pressure of ~ 800 psi. The electrokinetic potential of the emulsion, which is a measure of the total surface charge, was measured on a Coulter DELSA 440 SX Zetasizer meter and found to be approximately +55 mV.

DNA (or 1 mg of HIV-1 gp140 DNA or 0.5 mg of p55 gag DNA present in pCMV or pSINCP) was adsorbed on a submicron emulsion by incubation overnight at 4 ° C.

Example 3

Obtaining ELVIS vectors and other vector designs for adsorption on microparticles

As a typical example, alphavirus-based ELVIS vectors and replicon vectors were constructed using the Sindbis virus. It is understood that the following can easily be applied by a person skilled in the art to derivatives of vectors based on any alphavirus. About 10 ⁷ BHK-21 cells were infected with the SINBchiron SINBchiron strain of Sindbis virus (deposit ATCC VR-2643, April 13, 1999) with a multiplicity of infection of 1 PFU / cell. 24 hours after infection, after the development of a cytopathic effect, total RNA was isolated from cells using TRIzol reagent (GIBCO / BRL) according to the manufacturer's instructions. After purification, viral RNA was dissolved in water purified from nucleases, divided into aliquots and stored at -80 ° C for subsequent use in cDNA cloning.

The cDNA synthesis was performed by PCR amplification using the set of primers shown below (for each primer, the numbering of nucleotides in Sindbis is indicated):

Pairs of primers 1-5 were used for cloning genes of structural viral proteins, while pairs 6-14 for genes of non-structural viral proteins. Oligonucleotides in pairs 1-5 contained additional sequences representing recognition sites with restriction enzymes EcoRI and HindIII and not present in the Sindbis virus subgenomic RNA. Oligonucleotides 6-14 contained sites for SacI and XhoI, not represented in the full genome of previously sequenced Sindbis virus strains (these sites are underlined).

Each reverse transcription (RT) reaction was performed in a volume of 50 μl using the SuperscriptII enzyme (GIBCO / BRL) according to the manufacturer's instructions. Reaction mixtures containing RNA equivalents of 10 ⁶ cells and 50 pmol of each primer are shown below.

Mixture 1: primers 1, 3 and 5

Mixture 2: primers 2 and 4

Mixture 3: primers 6, 9 and 12

Mixture 4: primers 8, 11 and 14

The reaction mixtures after RT were frozen and subsequently used for amplification by PCR. PCR reactions were performed using Vent DNA polymerase (NEB) as recommended by the manufacturer. Every 50 μl of the PCR sample contained 3 μl of the RT mixture described above and 50 pmol of primers. A total of 14 reactions were performed (Table 1).

Table 1 Fragment number Primers RT reaction number fragment length (mon.) one 1 and 1,1 one 1128 2 2 and 2.1 2 800 3 3 and 3.1 one 789 four 4 and 4.1 2 644 5 5 and 5.1 one 670 6 6 and 6.1 3 962 7 7 and 7.1 3 666 8 8 and 8.1 four 1107 9 9 and 9.1 3 638 10 10 and 10.1 3 912 eleven 11 and 11.1 four 743 12 12 and 12.1 3 870 12 13 and 13.1 3 1034 fourteen 14 and 14.1 four 1088

PCR reactions for fragments 1-5 were carried out under the following conditions: 12 cycles consisting of 30 seconds at 95 ° C, 30 seconds at 56 ° C and 90 seconds at 74 ° C. For fragments 6-14, the number of cycles was increased from 12 to 15. Small aliquots of each reaction mixture were analyzed by agarose gel electrophoresis to confirm the presence of fragments of the expected length. Using phenol-chloroform from the rest of the mixture, DNA fragments were extracted, which were purified using ethanol.

For cloning, fragments 1-5 were digested with HindIII and EcoRI and then ligated into the plasmid pRS2 (pUC19 with an additional restriction site in polylinker) treated with the same enzymes. Fragments 6-14 were digested with SacI and XhoI and ligated into the same plasmid pRS2 treated with SacI and XhoI. All recombinant plasmids were transformed into E. coli XL-1 Blue strain (Stratagene, La Jolla, California).

In addition, cDNA clones representing the subgenomic promoter region and the 3'-untranslated region were also obtained using the following primer pairs:

Positive clones for each transformation were expanded using the QIAGEN kit according to the manufacturer's instructions for plasmid purification. Fragments designated as p1-p14, respectively, were then assembled into suitable vector configurations.

The construction of an eukaryotic multilevel vector initiation system (ELVIS) and an alphavirus vector construct for transcription of an in vitro RNA vector replicon was performed using p1-p14 clones and fragments of the subgenomic and 3'-terminal regions of the Sindbis virus, as described below. The ApaI-MscI fragment containing the SP6 RNA polymerase promoter and the start of the Sindbis virus genomic RNA was ligated with the MscI-XhoI fragment of fragment 14 cloned into the plasmid pRS2 cleaved with ApaI-XhoI. The resulting plasmid was designated as p15. Next, the SacI-EcoRI fragment of the p8 fragment, the EcoRI-NsiI fragment of the p7 fragment and the NsiI-XhoI fragment of the p6 fragment were ligated into the pRS2 plasmid cleaved by SacI-XhoI. The resulting plasmid was designated as p16. Next, the SacI-MunI fragment of the p12 fragment, the MunI-NheI fragment of the p11 fragment and the NheI-XhoI fragment of the p10 fragment were ligated into the pRS2 plasmid cleaved by SacI-XhoI. The resulting plasmid was designated as p17. The ApaI-ApaLI fragment of the p15 fragment and the ApaLI-XhoI fragment of the pl3 fragment were then ligated into the pRS2 plasmid cleaved with ApaI-XhoI, resulting in the plasmid designated p18. Next, the ApaI-NsiI fragment of the p18 fragment and the NsiI-XhoI fragment of the pl7 fragment were together ligated into the pRS2 plasmid cleaved by ApaI-XhoI. The resulting plasmid was designated as p19. In conclusion, the ApaI-AvrII fragment of the pl9 fragment, the AvrII-SalGI fragment of the p9 fragment, and the SaIGI-BamHI fragment of the pl6 fragment were ligated together into a pre-engineered and GFP reporter expressing Sindbis-based replicon vector (see Dubensky et al., J. Virol. 70: 508-519, 1996; Polo et al., 1999, ibid., And US Pat. No. 5,843,723), which were digested with ApaI-BamHI to remove existing non-structural protein genes. The resulting Sindbis-based vector construct containing SINDCchiron-derived sequences and also encoding a GFP reporter was designated as SINCR-GFP (also known as DCSP6SINgfp). The preparation of RNA replicons of this reporter construct, as well as Sindbis vector constructs expressing other heterologous sequences (for example, antigens described in this description below), was performed by linearizing DNA using PmeI and subsequent transcription in vitro using bacteriophage SP6 polymerase as described previously (Polo et al., ibid., Dubensky et al., ibid.).

Similarly, the aforementioned Sindbis virus sequences (see US Pat. Nos. 5,814,482 and 6,015,686) were used to assemble an alphavirus-based multi-level eukaryotic vector initiation system in which the transcription of self-amplifying vector RNA occurs from the eukaryotic promoter (e.g., directly from the RNA polymerase II promoter) eukaryotic cells transfected with ELVIS plasmid DNA. The ELVIS DNA plasmid, which also expresses the GFP reporter, was constructed by replacing the Sindbis virus-derived sequences in this ELVIS vector with the corresponding SINGR-GFP sequence described above. Starting with the previously described ELVIS vector pSIN1.5 (Hariharan et al., J Virol. 72: 950-958, 1998), to obtain an intermediate construct known as ELVIS1.5CB, the plasmid backbone was modified by replacing it with pCMVLink (zur Megede et al., J. Virol. 74: 2628-2635, 2000) using the two SacI sites found in each plasmid. Next, one of the two SacI sites (located near the 3'-end of the SIN) was removed from ELVIS1.5CB by partial digestion with SacI, blunt ends using T4 DNA polymerase and ligation to the modified portion of the 5me-GTTTAAAC-3 PmeI linker sequence '. The adjusted plasmid without the SacI target region was designated as ELVIS1.5Cbd1Sac. This intermediate plasmid was then prepared to insert new genes for non-structural SIN proteins by cleavage of SacI and XhoI. The corresponding non-structural genes were obtained by PCR amplification of the SINCR-GFP region using 5'CCTATGAGCTCGTTTAGTGAACCGTATTGACGGCGTAGTACACAC oligonucleotide primers (SEQ ID NO: 61) and 5'CCTATCTCGAGGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT SINCP-Not. At the final stage, one of the two NotI sites present in the construct was eliminated by partial cleavage and completion with a Klenov fragment in order to leave only one NotI site in the polylinker. The newly constructed ELVIS vector was designated as SINCP (or pSINCP).

Insertions of heterologous sequences (e.g., encoding gene antigens) into SINCR or SINCP alphavirus vectors were predominantly done by cleavage with XhoI / NotI or XhoI / XbaI, followed by ligation of the desired DNA fragment, also at the XhoI / NotI or XhoI / XbaI ends. Alternatively, in order to enable a larger number of insertions, these regions can be turned into blunt ends, and other regions of the multilinear can be used (or other heterologous sequences replaced). For example, genes encoding p55gag (strain SF2) and gpl40 env (strain SF162) are inserted into these vectors. More specifically, the codon-optimized p55gagmod HIV sequence (see US patent application 09/475515; zur Megede et al., Ibid.) Was inserted using vector cleavage by XhoI / XbaI and ligation into the p55gagmod fragment obtained using cleavage by SalI / XbaI. The resulting vector was designated as SINCR-p55gag or SINCP-p55gag. Similarly, codon-optimized HIV gpl40 sequences (described in Example 10 and Barnett et al., 2001. J. Virol. 75: 5526-40) were inserted into both plasmids: SINCR and SINCP to obtain SINCR-gpl40 and SINCP-gpl40 constructs . The preparation of the ELVIS DNA plasmid (pSINCR) and replicons of RNA vectors transcribed in vitro from SINCR plasmids was obtained as described in other examples.

Example 4

Immunization of rhesus macaques with pCMV or pSINCP plasmid antigen using microparticles or submicron emulsions

M59 PLG-polymer microparticles and submicron emulsions were prepared as described above in Examples 1 or 2. Microparticles and submicron emulsions were prepared to analyze the various effects of immunizing rhesus monkeys with a plasmid vector construct, pCMV-gp140 or pCMV-p55gag (see Applicant's application for the grant of US patent 09/475515) on microparticles or in a submicron emulsion, as well as comparing the effect of using plasmids ELVIS, pSINCP-gp140 or pSINCP-p55gag, constructed as described above. Six groups of animals were immunized with the following various preparations:

For group 1, pCMV-gp140 and pCMV-p55gag without microparticles or submicron emulsions were used.

For group 2, pCMV-gp140 and pCMV-p55gag adsorbed on PLG / CTAB microparticles were used.

For group 3, pCMV-gp140 and pCMV-p55gag adsorbed on a submicron emulsion MF59-DOTAP were used.

For group 4, pSINCP-gp140 and pSINCP-p55gag without microparticles or submicron emulsions were used.

For group 5, pSINCP-gp140 and pSINCP-p55gag adsorbed on PLG / CTAB microparticles were used.

For the 6th group, the control, neither antigens, nor microparticles, nor submicron emulsions were used.

In each group of animals, 5 rhesus monkeys (only 4 in group 6) were immunized with a sufficient amount of material, so that the dosage of the vector with gp140 DNA was 1.0 mg for each animal, and the dosage of the vector with p55gag DNA was 0.5 mg for each, excluding control where nothing was entered. Animals were immunized a second time four weeks after the first immunization and a third time 14 weeks after (wp) the first immunization. At 2 (2wp1), 6 (2wp2), 11-12 (7wp2) and 16 (2wp3) weeks, serum was analyzed. The IM TA immunization procedure was used. After immunization, anti-p55gag and anti-gp140 IgG titers were measured in plasma and the results of these measurements are shown in Tables 2 and 3 as geometric mean titers.

table 2
Serum anti-p55gag IgG titer (geometric mean) Group DNA shape 2wp1 2wp2 7wp2 2wp3 one PCMV in saline 7 19 19 118 2 PCMV adsorbed on PLG / CTAB particles 490 10770 4360 1637 3 PCMV adsorbed on emulsion MF59 / DOTAP 142 5702 1480 3536 four pSINCP in saline 8 7 8 45 5 pSINCP adsorbed on PLG / CTAB particles 728 19256 3426 856 6 Absent 12 9 8 7 Table 3
Serum anti-gp140 IgG titer (geometric mean) Group DNA shape 2wp1 2wp2 7wp2 2wp3 one pCMV in saline 5 517 81 2460 2 pCMV adsorbed on PLG / CTAB particles 5 2762 5290 1913 3 pCMV adsorbed on emulsion MF59 / DOTAP 5 564 112 4823 four pSINCP in saline 8 48 twenty 70 5 pSINCP adsorbed on PLG / CTAB particles fifteen 11289 4266 1002 6 No 12 fourteen eleven eleven

The same groups of animals that were formed for the previous animals were analyzed for the induction of a CTL response. Effector-to-target ratios (E: T) ranged from about 4: 1 to 100: 1. The CTL results are shown in Tables 4 and 5 below. The “responding” is Rhesus monkey, characterized by specific target lysis in 10% or more% of cases with two or more consecutive E: T ratios.

Table 4
Number of responders (p55gag) Group DNA shape 2wp1 2wp2 7wp2 2wp3 one pCMV in saline 0 four one four 2 pCMV adsorbed on PLG / CTAB particles 3 3 2 3 3 pCMV adsorbed on emulsion MF59 / DOTAP 0 one one 0 four pSINCP in saline 0 one 0 0 5 pSINCP adsorbed on PLG / CTAB particles 0 3 one one 6 No 0 0 0 0 Table 5
Number of responders (gp140) Group DNA shape 2wp1 2wp2 7wp2 2wp3 one PCMV in saline 0 0 0 0 2 pCMV adsorbed on PLG / CTAB particles 0 0 0 0 3 pCMV adsorbed on emulsion MF59 / DOTAP 0 0 0 0 four pSINCP, in saline 0 0 0 one 5 pSINCP adsorbed on particles of PLG / CTAB 0 one 0 one 6 No 0 0 0 0

The same animals were analyzed for lymphocyte proliferation. Using this assay, the specific proliferation of T cells in vitro is measured in response to repeated stimulation with an antigen. Peripheral blood mononuclear cells (PBMCs) of rhesus monkeys were purified from whole heparinized blood by centrifugation in ficoll-hypak gradients. PBMCs were cultured in an amount of 2x10 ⁵ per well in flat-bottomed microtiter plates in the presence or absence of 3 microgram / ml purified p55gag recombinant protein. Six parallel cultures for each state were initiated. After 4 days, thymidine with tritium ( ³ [H] TdR) (1 microcurie per well) was added to the culture. The cultures were incubated overnight and harvested the next day. Cells were placed on micro glass fiber filters. The filters were exposed to scintillation fluid and counted in a liquid scintillation counter. For each state for 6 parallels, the inclusion of ³ [H] TdR was calculated, measured as the average of bills per minute (cpm). The results are shown in Table 6. The geometric mean stimulation index (GMSI) is calculated as the counts per minute (cpm) of p55gag-stimulated cells divided by the cpm of unstimulated cells, and thus, the more GMSI was, the more positive the result.

Table 6
Gmsi Group DNA shape 2wp1 2wp2 7wp2 2wp3 one PCMV in saline 2.6 5.1 3.0 3.2 2 pCMV adsorbed on PLG / CTAB particles 6.6 15.4 5.9 4.6 3 pCMV adsorbed on
Emulsions MF59 / DOTAP 9.1 29.5 13.6 10.5 four pSINCP in saline 7.5 6.6 4.1 4.3 5 pSINCP adsorbed on PLG / CTAB particles 10,4 13.8 5,4 4.4 6 No 1.4 1,5 1.3 1,2

The same animals were analyzed for intracellular cytokine production. Using this assay, the specific production of cytokines by T cells in vitro is measured in response to a short re-stimulation of the antigen. Peripheral Blood Mononuclear Cells (PBMC) Rhesus monkeys were purified from whole heparinized blood by Ficoll-Hypaque gradient centrifugation. Aliquots of 1x10 ⁶ PBMC in the presence of a co-stimulatory anti-CD28 monoclonal antibody were stimulated with a combination of synthetic overlapping peptides spanning the gag (or env) protein sequence. Brefeldin A was added to allow the accumulation of newly synthesized cytokines in cells. After incubation overnight, PBMCs were stained with commercially available, fluorescently labeled monoclonal antibodies to establish the presence of intracellular interferon γ (IFN-γ), tumor necrosis factor α (TNF-α) and cellular surface markers of CD4 and CD8. Stained cell samples were analyzed on a flow cytometer to obtain data for approximately 50,000-100,000 PBMCs. The frequency of cytokine producing cells was determined for each sample using commercially available software. The results for gp140 and p55gag are shown in tables 7 and 8, respectively. The tables show the number of responding animals, where responders were defined as animals, with more than 100 CD4 cells per 100,000 expressing TNF-α and IFN-γ, measured by intracellular staining.

Table 7
Individuals responding with cytokines on gp140 Group DNA shape 2wp1 7wp2 2wp3 one PCMV in saline one 0 0 2 PCMV adsorbed on PLG / CTAB particles one 2 0 3 PCMV adsorbed on emulsion MF59 / DOTAP 0 0 0 four pSINCP in saline 0 0 0 5 pSINCP adsorbed on PLG / CTAB particles 0 one 0 6 No 0 0 0 Table 8
Individuals responding with cytokines on p55gag Group DNA shape 2wp1 7wp2 2wp3 one PCMV in saline 0 0 0 2 PCMV adsorbed on PLG / CTAB particles 2 one 0 3 PCMV adsorbed on emulsion MF59 / DOTAP 0 0 0 four pSINCP in saline 0 0 0 5 pSINCP adsorbed on PLG / CTAB particles one one 0 6 Absent 0 0 0

Example 5

Vector RNA Constructs

Vector RNA constructs (e.g., replicons) can be adsorbed onto microparticles to deliver heterologous nucleic acid sequences to animal cells. A vector RNA construct typically contains viral RNA, with a region of genomic RNA (for example, a structural protein gene) replaced by a selected heterologous sequence derived from a DNA sequence encoding a gene of interest to a product. Typical examples of vector RNA constructs include, but are not limited to, alphavirus RNA vectors (see, for example, US Pat. No. 5,843,723, PCT publication WO 99/18226 and Polo et al., 1999, PNAS 96: 4598-4603), picornavirus RNA vectors (see, for example, US patent 6156538 and Vignuzzi et al., 2001, J Gen Virol. 82: 1737-47), flaviviral RNA vectors (see, for example, Varnavski et al. 1999, Virology 255: 366-75) and rubivirus RNA vectors (Pugachev et al., 2000, J Virol. 74: 10811-5). Vector RNA constructs for use in the present invention can generally be obtained from plasmid cDNA constructs as a source of starting material through standard in vitro transcription processes (see references above). Like plasmid DNA, these RNA vector constructs can then be adsorbed onto the microparticles of the invention, as described in the examples here. For example, vector RNA constructs are adsorbed onto microparticles by incubation of 100 mg of cationic microparticles in a 1 mg / ml DNA solution for 6 hours at 4 ° C. Then the microparticles are separated by centrifugation, the precipitate is washed with TE buffer and the microparticles are freeze dried. The preparation and delivery of vector RNA constructs compiled with PLG is similar to that described for DNA, using for delivery, for example, at least 1 μg, 10 μg, 100 μg or 1000 μg of the prepared RNA vector construct.

Example 6

Mouse adjuvants

To analyze the action of the aluminum phosphate adjuvant (alum) in mice, an experiment was performed on these animals. Polymeric microparticles were prepared as described above with pCMV-p55gag adsorbed on or without them. 10 micrograms of DNA, either free or adsorbed on PLG microparticles, was administered to groups of 6 CB6 F1 mice at 0 and 6 weeks with or without alum. The results, as the geometric mean of antibody titers, are shown in table 9.

Table 9
Anti-p55gag serum IgG titer (geometric mean / standard error) Group DNA shape 2wp1 2wp2 7wp2 2wp3 one pCMV in saline 28 149 6238 5274 2 pCMV adsorbed on PLG particles 5022 21992 346856 171301 3 pCMV in saline plus alum 1536 3039 195070 92438

Example 7

Electroporation with microparticles, ELVIS vectors and RNA vector constructs

In combination with polymer microparticles or microparticles of submicron emulsions prepared together with any of the nucleic acids described above, such as plasmid DNA, ELVIS vectors, and RNA vector constructs, electroporation can be used.

Example 8

Induction of the immune response in rhesus monkeys with primary and supportive immunizations

An experiment was performed to determine the effect of priming by DNA and to maintain the protein adsorbed on PLG microparticles. In more detail, PLG-SDS microparticles were prepared as described above and in International Patent Application PCT / US99 / 17308 belonging to this applicant, and purified recombinant p55gag protein was adsorbed onto them. A group of animals was immunized with 1 mg pCMV-p55gag. The animals were again immunized after 4 and then after 8 weeks. The animals were maintained for 41 weeks with p55gag protein adsorbed on PLG microparticles. The results are shown in Table 10, which shows the antibody titer in responding individuals, the induction of proliferation of helper T cells (average stimulation index of responding individuals) and CTL induction (number of responding individuals based on more than 10% lysis in two or more consecutive E ratios: T). Results for the first columns were measured at 14 weeks after 3 priming and for the second columns at 2 weeks after maintenance. The number in brackets means the number of responding individuals with a total of 4 animals.

Table 10 Vaccine Antibody titer Lymphocyte proliferation (SI) CTL Start maintaining Start maintaining Start maintaining Start maintaining pCMV-p55gag PLG /
p55gag 44 (1) 1777 (4) 2.5 (2) 21.8 (4) four four

Example 9

Induction of neutralizing antibodies

Rhesus macaque from Example 5 above was tested for the inhibition of two different strains of HIV-1 (SF2 and SF162) using stock solutions of the virus growing on PBMC and a T-cell assay based on CCR5 + / CXCR4 + / CD4 +. Used serum at a dilution of 1:20. For each animal, the serum inhibitory activity before immunization was subtracted from the results. The results for each of the five animals in each group are shown in table 11.

Table 11
Percent inhibition Group DNA shape HIV-1 _SF2 HIV-1 _SF162 2wp2 2wp3 2wp2 2wp3 one pCMV in saline 0
0
0
0
0 0
0
8
0
0 0
0
0
0
0 0
17
0
12
52 2 PCMV adsorbed on PLG / CTAB particles 58
0
0
72
48 40
41
0
79
61 3
6
0
0
eleven 0
0
0
0
10 3 PCMV adsorbed on emulsion M59 / DOTAP 0
0
76
81
fifteen one hundred
0
one hundred
one hundred
93 0
0
3
0
0 0
0
four
0
0 four pSINCP in saline 0
0
0
0
0 0
0
0
0
0 0
0
12
0
16 0
0
one
0
0 5 PSINCP adsorbed on PLG / CTAB particles 73
43
91
69
91 fifty
0
0
0
23 19
29th
four
32
not available 0
0
0
6
0

Example 10

Obtaining plasmids

Plasmids encoding HIV-1 p55gag and gp140 driven by the human cytomegalovirus (CMV) promoter were grown in Escherichia coli DH5α strain, purified by Qiagen Endofree Plasmid Giga kit (Qiagen, Inc.) and resuspended in 0.9% sodium chloride solution (Abbott Laboratories, North Chicago, Ill.) The pCMV vector used contains the immediate early enhancer / promoter CMV and the bovine growth hormone terminator and is described in detail elsewhere (Chapman, BS, et aL 1991. "Effect of intron A from human cytomegalovirus (Towne) immediate-early gene on heterologous expression in mammalian cells. "Nucleic Acids Res. 19: 3979-86). The HIV gag DNA plasmid vaccine (pCMVgag) contains a synthetically engineered p55gag gene derived from the HIV-1 SF2 strain as previously described (zur Megede, J., et al. 2000. "Increased expression and immunogenicity of sequence-modified human immunodeficiency virus type 1 gag gene. "J Virol. 74: 2628-35), with codons reflecting the frequency of codon use in mammals. The HIV env DNA plasmid vaccine (pCMVgp140) consists of the signal sequence of the human tissue plasminogen activator (tPA) and gp140 from HIV strain SF162 strain-1, with codons optimized for high-level expression in mammalian cells (Barnett, SW, et. 2001. "The ability of an oligomeric human immunodeficiency virus type 1 (HIV-1) envelope antigen to elicit neutralizing antibodies against primary HIV-1 isolates is improved following partial deletion of the second hypervariable region." J Virol. 75: 5526-40). The SINCP plasmid vector with any of p55gag or gp140env is described in Example 3.

Example 11

Protein Production

The gp160env.SF162 protein and cDNA sequences are published by Cheng-Mayer, C., M. Quiroga, J. W. Tung, D. Dina, and J. A. Levy. 1990. "Viral determinants of human immunodeficiency virus type 1 T-cell or macrophage tropism, cytopathogenicity, and CD4 antigen modulation." J Virol. 64: 4390-8. These sequences can be found using Genbank's inventory number M65024. Recombinant protein g140.SF162 (dV2) from HIV-1 was expressed in Chinese hamster ovary cells and purified as previously described (Barnett, S. W., ET. 2001. J Virol. 75: 5526-40). The recombinant p55gag protein from HIV-1.SF2 was expressed in yeast and purified by cation exchange chromatography (Chiron Corporation, Emeryville, CA). The p55gag cDNA sequence from HIV-1 SF2 strain (Genbank accession number K02007) was cloned into a ubiquitin expression vector, resulting in the addition of glycine and arginine at the N-terminus of the wild-type sequence. The recombinant p55gag protein was extracted from the yeast cell pellet using 50 mM phosphoric acid, 6 M urea, pH 7.9, followed by ion-exchange (cationic) chromatography with S-fractogel. P55gag elution was performed in a linear NaCl gradient (peak at 0.4 M NaCl). Estimated purification by SDS-PAGE was 90%.

Example 12

Poly (lactide-glycolide) -PLG-microparticles with adsorbed DNA

Polymer PLG (RG505) was obtained from Boehringer Ingelheim. Cationic microparticles were prepared using a modified solvent evaporation process. Briefly, microparticles were obtained by emulsification of 10 ml of 5% wt./about. a solution of the polymer in methylene chloride with 1 ml of phosphate-buffered saline (PBS) at high speed using an IKA homogenizer. The primary emulsion was then added to 50 ml of distilled water containing cetyltrimethylammonium bromide (CTAB) (0.5% w / v), resulting in the formation of a water-in-oil-in-water emulsion, which was stirred at 6000 rpm ./min 12 hours at room temperature allowing methylene chloride to evaporate. The resulting microparticles were washed twice with distilled water by centrifugation at 10000 g and drying by freeze-drying. The plasmid DNA from Example 11 was adsorbed on microparticles by incubation of 100 mg of cationic microparticles in 5 ml of 200 micrograms / ml DNA solution for 6 hours at 4 ° C. The microparticles were then separated by centrifugation, the precipitate was washed with TE buffer (Tris-EDTA), and the microparticles were freeze dried.

Example 13

Adsorbed PLG Microparticles

Empty particles were obtained by a solvent evaporation method. Briefly, microparticles were obtained by homogenizing 10 ml of 6% w / v. a solution of the polymer in methylene chloride with 40 ml of distilled water containing SDS (1% w / v) at high speed using a 10 mm sample. The result was an oil in water emulsion, which was stirred at 1000 rpm for 12 hours at room temperature, which allowed methylene chloride to evaporate. The resulting microparticles were filtered through 38 μm filters, washed 3 times in distilled water and dried by freezing. The size distribution of microparticles was determined using a particle size analyzer (Master sizer, Malvern Instruments, UK).

50 mg of SDS lyophilized empty particles were incubated with 0.5 mg of the p55gag protein of Example 12 in 10 ml of 25 mM pH 9 borate buffer with 6M urea. The particles were left on a laboratory stirrer for 5 hours at room temperature. The microparticles were separated from the incubation medium by centrifugation, the SDS pellet was washed once in a borate buffer with 6M urea, and then three times with distilled water, and then dried by freezing.

The level of loading of the protein adsorbed on microparticles was determined by dissolving 10 mg of microparticles in 2 ml of a solution of 5% SDS - 0.2 M sodium hydroxide at room temperature. Protein concentration was measured by BCA protein analysis (Pierce, Rockford, Illinois). The electrokinetic potential for both empty and adsorbed microparticles was measured using a Malvern Zeta analyzer (Malvern Instruments, UK).

Example 14

Obtaining protein with adjuvant MF59

The recombinant HIV g140.SF162 (dV2) protein from Example 12 was combined with the MF59 adjuvant as previously described (Barnett, S. W., et. 2001. J Virol. 75: 5526-40).

Example 15

Immunization

Rhesus males and females were housed at the Southern Research Institute (Frederick, MD).

Plasmid DNA was immunized at weeks 0, 4, and 14. Rhesus macaques were injected intramuscularly in an amount of 0.5 mg pCMVgag from Example 11 (in saline, as part of PLG / CTAB microparticles as described in Example 13, or as part of MF59 / DOTAP as described in Example 2) and 1.0 mg pCMVenv from example 11 (in saline or in the composition with PLG / CTAB microparticles, as described in example 13) in 4 different sections for each animal (0.25 mg pCMVgag in the right shoulder and right thigh, 0, 5 mg pCMVenv in the left shoulder and left thigh). Alternatively, rhesus macaques were injected intramuscularly in an amount of 0.5 mg of pSINCPgag from Example 11 (in saline or in conjunction with PLG / CTAB microparticles, as described in Example 13) and 1.0 mg of pSINCPenv from Example 11 (in saline or in the composition with PLG / CTAB microparticles, as described in example 13) in four different sections for each animal.

Rhesus monkey was maintained by intramuscular injection in an amount of 0.2 mg of recombinant protein p55gag / on PLG microparticles from example 14 at week 29 and 0.1 mg of recombinant protein gp140env (dV2) / with the adjuvant MF59 from example 15 at week 38.

Example 16

Antibody Reactions

At various times after immunization, heparinized blood was collected from the anesthetized animals and plasma was separated by centrifugation. Anti-HIV gag and env antibodies were measured by enzyme-linked immunosorbent assay (ELISA) as described below. The microtiter plate wells were coated with recombinant p55gag protein from HIV-1.SF2 or recombinant gp140env protein from HIV-1.SF162 dissolved in PBS at a concentration of 5 micrograms / ml in a volume of 50 microliters per well and incubated overnight at 4 ° C . The plates were washed 6 times with wash buffer (PBS, 0.3% Tween 20) and blocked at 37 ° C for 1 hour with 200 microliters of blocking buffer (PBS, 0.3% Tween 20, 5% goat serum) per well. Test samples were diluted 1:25 and then serially diluted three times in blocking buffer. The blocking solution was removed and then the plates were incubated for 1 hour at room temperature with 70 microliters of each plasma dilution per well. After washing six times, the plates were incubated for 1 hour at 37 ° C with horseradish peroxidase conjugated anti-IgG antibodies (1: 8000 dilution). After washing 6 times, the plates were developed for 15 minutes with TMB substrate. The reaction was stopped by 2n. NaCl and measured the optical density (OD) at a wavelength of 450 nm. The titer was counted as the reciprocal of the dilution at which an OD of _{450 nm of} 0.5 was achieved.

Table 12
Anti-gag antibody titers in rhesus monkeys Time ⁽¹⁾ Before 2 weeks
after
1st 2 weeks after the 2nd 7 weeks after the 2nd 2 weeks after the 3rd 6 weeks after the 3rd 10 weeks after the 3rd 13 weeks after the 3rd 2 weeks after protein ⁽⁴⁾ Plasmid DNA Composition A week 0 2 6 eleven 16 twenty 24 27 31 pCMV-p55gag saline solution Geom.
average ⁽²⁾ 5 6 19 19 118 66 91 41 1684 LL ⁽³⁾ 5 5 8 8 68 32 60 22 955 UL ⁽³⁾ 5 8 42 41 206 133 138 78 2971 pCMV-p55gag PLG / CTAB Geom.
average 6 490 10770 4360 1637 550 349 286 9968 LL 5 302 6672 2325 970 340 190 188 7370 UL 8 795 17384 8179 2762 890 642 435 13484 pCMV-p55gag MF59 / DOTAP Geom.
average 7 142 5702 1479 3536 1481 1183 854 2126 LL 5 35 2275 577 1158 535 478 235 468 UL 9 568 14293 3786 10797 4098 2931 3103 9664 pSINCP-p55gag saline solution Geom.
average 6 8 7 8 45 24 42 32 1003 LL 5 5 5 5 eighteen 13 23 fourteen 386 UL 8 eleven eleven 13 114 46 78 72 2606 pSINCP-p55gag PLG / CTAB Geom.
average 8 728 19256 3427 856 489 648 678 23543 LL 6 635 10711 2259 596 331 431 396 13750 UL eleven 835 34619 5199 1229 723 975 1194 40312 nothing Geom.
average 9 12 9 8 7 7 8 8 7 LL 6 7 5 5 5 5 5 5 5 UL 13 19 16 fourteen 9 eleven fourteen fourteen 9 ⁽¹⁾ regarding immunization with plasmids carried out at weeks 0, 4 and 14
^{(2) The} geometric mean of the group
⁽³⁾ Group arithmetic means and standard errors calculated after log transformation of titles. LL = antilog (arithmetic mean - standard error). UL = antilog (arithmetic mean + standard error).
⁽⁴⁾ Recombinant p55gag protein adsorbed onto anionic PLG microparticles introduced at week 29.

Table 13
Plasma anti-env antibody titers in rhesus monkeys Time ⁽¹⁾ Before 2 weeks after 1st 2 weeks after the 2nd 7 weeks after the 2nd 2 weeks after the 3rd 6 weeks after the 3rd 10 weeks after the 3rd 13 weeks after the 3rd 17 weeks after the 3rd 23 weeks after the 3rd 2 weeks after protein 8 weeks after protein ⁽⁴⁾ Plasmid DNA Composition A week 0 2 6 eleven 16 twenty 24 27 31 37 40 46 pCMV-gp140env Saline solution Geom.
average ⁽²⁾ 5 5 589 81 2460 342 thirty 26 24 13 35807 17962 LL ⁽³⁾ 5 5 273 32 1703 227 10 9 9 5 28151 14079 UL ⁽³⁾ 5 5 1272 202 3555 515 94 72 69 31 45544 22824 pCMV-gp140env PLG / CTAB Geom.
average 6 5 3200 5290 1913 236 261 43 42 29th 27939 13992 LL 5 5 1306 2430 879 87 201 eighteen 17 13 18016 9019 UL 8 5 7841 11515 4163 640 338 105 101 64 43329 21707 pCMV-gp140env MF59 / DOTAP Geom.
average 7 5 659 112 4823 589 258 223 171 121 5698 3301 LL 5 5 176 51 2125 169 90 79 64 48 972 645 UL 9 5 2461 248 10946 2052 742 630 451 304 33409 16903 pSINCP-gp140env Saline solution Geom.
average 6 5 44 twenty 70 36 12 12 fourteen 12 15294 7660 LL 5 5 12 8 13 10 5 5 5 5 7853 3931 UL 8 5 168 49 366 127 31 thirty 37 31 29787 14926 pSINCP-gp140env PLG / CTAB Geom.
average 8 fifteen 8735 4266 1002 228 twenty 33 eighteen fifteen 33801 16921 LL 6 8 5015 2817 656 152 8 fifteen 8 8 27002 13521 UL eleven thirty 15214 6459 1531 341 46 74 38 31 42313 21175 Nothing Nothing Geom.
average 9 12 eleven eleven eleven eleven eleven eleven 10 13 12 12 LL 6 5 5 5 5 5 5 5 5 5 5 5 UL 13 28 23 25 26 24 22 25 22 32 29th thirty ⁽¹⁾ Regarding immunization with plasmids carried out at weeks 0, 4 and 14
^{(2) The} geometric mean of the group
⁽³⁾ Group arithmetic means and standard errors calculated after log transformation of titles. LL = antilog (arithmetic mean - standard error). UL = antilog (arithmetic mean + standard error).
⁽⁴⁾ Recombinant oligomeric protein gp140env (ΔV2) / MF59 adjuvant, administered at 38 weeks.

Example 17

Cytotoxic T lymphocyte reactions (CTL)

A pool of 51 synthetic peptides with a length of 20 amino acids (aa), with an overlap of 10 aa and spanning p55gag, and a pool of 66 synthetic peptides with a length of 20 amino acids (aa), with an overlap of 10 aa and spanning gp140, were obtained. Peripheral blood mononuclear cells (PBMCs) of rhesus monkeys were separated from heparinized blood by centrifugation using ficoll-hypak gradients (Pharmacia Biotech, Piscataway, NJ). PBMCs were cultured for 8 days in 24-well plates in an amount of 3x10 ⁶ per well in 1.5 ml of AIM-V / RPMI 1640 (50:50) culture medium (Gibco-BRL, Grand Island, NY) supplemented with 10% fetal bovine serum. Gag specific CTLs were stimulated by adding a gag peptide pool, and env specific CTLs were stimulated by adding an env peptide pool. Recombinant human interleukin-7 (IL-7; 15 ng / ml; R&D Systems, Minneapolis, Minn.) Was added to the cultures. Human recombinant IL-2 (20 international units / ml; Proleukin; Chiron) was added on days 1, 3 and 6. Stable rhesus monkey B-lymphoblast cell lines were obtained by exposing the PBMC to a culture supernatant containing papio herpes virus from S594 cell line (Falk, L., et al. 1976. Properties of a baboon lymphotropic herpesvirus related to Epstein-Barr virus. Int J Cancer. 18: 798-807. Rabin, H., et al. 1976. Virological studies of baboon (Papio hamadryas) lymphoma: isolation and characterization of foamyviruses. J Med Primatol. 5: 13-22.) In the presence of cyclosporin A (Sigma, St. Louis, MO). Autologous B-LCLs were infected with recombinant vaccinia virus (rVV) encoding gag-pol from HIV-1.SF2 (rVVgag-pol) or gpl60env from HIV-1.SF162 (rVVgpl60env) (PFU: cell ratio was 10) and competitively labeled by Na [ ⁵¹ Cr] ₂ O ₄ (NEN, Boston, MA) in an amount of 25 microcuries per 1x10 ⁶ B-LCL. After overnight culture at 37 ° C., infected rVVs and ⁵¹ Cr labeled B-LCLs were washed and then added (2500 per round bottom well) to duplicate wells containing triplicate serial dilutions of cultured PBMCs. Then, 10 ⁵ per well of unlabelled, uninfected B-LCL was added to inhibit non-specific cytolysis. After 4 hours of incubation at 37 ° C, 50 microliters of culture supernatants were collected, placed in LumaPlates (Packard, Meiden, CT) and radioactivity (counts per minute (cpm)) was counted using a Microbeta 1450 liquid scintillation counter (Wallac, Gaithersburg, MD) ⁵¹ Cr released from lysed targets was normalized using the formula:% specific release ⁵¹ Cr = 100% x (experimental average number of counts / min -SR) / (MR - SR), where SR = average number of counts / min of one target, and MR = average counts / min of targets exposed to the Triton X-100. Animals were defined as having a positive, p55gag-specific response if, during two subsequent dilutions of the pool-stimulated gag PBMC peptides, the lysis of those infected with rVVgag-pol B-LCL was superior to the lysis of those infected with rVVgp160env B-LCL by at least 10%, and if two subsequent dilutions cultured PBMCs the lysis of infected with rVVgag-pol B-LCL by pool-stimulated gag peptides PBMC was superior to lysis of infected by rVVgag-pol B-LCL by pool-stimulated peptides of env PBMC by at least 10%. Animals were defined as having a positive, specific to gp160 response if, during two subsequent dilutions of the pool-stimulated env PBMC peptides, the lysis of those infected with rVVgp160env B-LCL was superior to the lysis of those infected with rVVgag-pol B-LCL by at least 10%, and if two subsequent dilutions cultured PBMCs the lysis of infected with rVVgp160env B-LCL by pool-stimulated peptides env PBMC was superior to lysis of infected by rVVgp160env B-LCL by pool-stimulated gag peptides PBMC by at least 10%.

Table 14
Gag-specific CTL Induction of p55gag-specific CTL through vaccines
The number of positive animals per group (n = 5) Week -2 2 6 eleven 16 twenty 24 Vaccine time: until 2wp1st 2wp2nd 7wp2nd 2wp3rd 6wp3rd 10wp3rd pSINCP 0 0 one 0 0 0 PSINCP / PLG 0 0 3 one one 0 pCMV 0 0 four one four 3 one PCMV / PLG 0 3 3 2 3 one one PCMV / MF59 0 0 one one 0 0 no 0 0 0 0 0 0 Table 15
Env-specific CTL Induction of gp140env-specific CTL through vaccines
The number of positive animals per group (n = 5) Week -2 2 6 eleven 16 twenty 24 Vaccine time: until 2wp1st 2wp2nd 7wp2nd 2wp3rd 6wp3rd 10wp3rd pSINCP 0 0 0 0 one 0 PSINCP / PLG 0 0 one 0 one 0 pCMV 0 0 0 0 0 one one PCMV / PLG 0 0 0 0 0 0 0 PCMV / MF59 0 0 0 0 0 0 no 0 0 0 0 0 0

Example 18

Lymphocyte Proliferation Assay (LPA)

2x10 ⁵ PBMC rhesus monkeys per well were cultured in the presence or absence of recombinant p55gag protein or a pool of synthetic env peptides. Six parallel wells were set for each culture condition. After a 4-day incubation, cultures were labeled with [ ³ H] TdR overnight at 1 microcurie / well. The incorporation of [ ³ H] TdR into cells was determined by counting fluid scintillations (BetaPlate, Wallac, Gaithersburg, MD). The stimulation index (SI) was calculated as SI = average cpm (stimulation by gag or env) / average cpm (no stimulation).

Table 16
Stimulation indices of anti-gag proliferation of rhesus monkey lymphocytes Time ⁽¹⁾ Before 2 weeks after 1st 2 weeks after the 2nd 7 weeks after the 2nd 2 weeks after the 3rd 6 weeks after the 3rd 10 weeks after the 3rd 13 weeks after the 3rd 2 weeks after protein ⁽⁴⁾ 8 weeks after protein 11 weeks after protein 17 weeks after protein Plasmid DNA Delivery A week 0 2 6 eleven 16 twenty 24 27 31 37 40 46 pCMV-p55gag Saline solution Geom.
average ⁽²⁾ one 3 5 3 3 2 5 2 7 9 four 2 LL ⁽³⁾ one 2 four 2 3 2 3 2 four 6 2 2 UL ⁽³⁾ one 3 7 four four 3 6 3 eleven 13 7 3 pCMV- p55gag PLG / CTAB Geom.
average 2 7 fifteen 6 5 5 four 2 8 7 5 four LL one 3 7 3 3 3 2 2 four 3 2 2 UL 2 16 34 12 7 8 8 four 17 fifteen eleven 8 pCMV- p55gag MF59 / DOTAP Geom.
average one 9 thirty fourteen eleven 10 9 eleven 19 10 8 5 LL one 5 13 7 6 6 5 6 9 four four 3 UL one eighteen 65 27 17 fifteen fifteen 21 42 25 fourteen 7 pSINCP- p55gag Saline solution Geom.
average one 8 6 four four 6 6 3 eleven 6 6 5 LL one four 3 2 3 3 3 2 6 four 3 3 UL one fifteen 13 8 6 10 12 four 17 9 12 8 pSINCP- p55gag PLG / CTAB Geom.
average one 10 fourteen 5 four 6 7 6 13 6 5 6 LL one 7 9 four 3 four four four 10 5 3 four UL one fifteen 21 7 6 9 12 eleven 16 7 8 9 nothing Nothing Geom.
average one one 2 one one one 2 one 2 one one one LL one one one one one one one one 2 one one one UL 2 2 2 2 one one 2 one 3 one one one ⁽¹⁾ Regarding immunization with plasmids carried out at weeks 0, 4 and 14
^{(2) The} geometric mean of the group
⁽³⁾ Group arithmetic means and standard errors calculated after log transformation of titles. LL = antilog (arithmetic mean - standard error). UL = antilog (arithmetic mean + standard error).
⁽⁴⁾ Recombinant p55gag protein adsorbed onto anionic PLG microparticles introduced at week 29.

Table 17
Stimulation indices of anti-env proliferation of lymphocytes of rhesus monkeys Time ⁽¹⁾ Before 2 weeks after 1st 2 weeks after the 2nd 7 weeks after the 2nd 2 weeks after the 3rd 6 weeks after the 3rd 10 weeks after the 3rd 13 weeks after the 3rd 17 weeks after the 3rd 23 weeks after the 3rd 2 weeks after protein 8 weeks after protein ⁽⁴⁾ Plasmid DNA Delivery A week 0 2 6 eleven 16 twenty 24 27 31 37 40 46 pCMV-gp140env Saline solution Geom.
average ⁽²⁾ four four 3 four four four four 22 9 LL ⁽³⁾ 3 3 2 3 3 2 2 12 6 UL ⁽³⁾ 6 6 four 5 6 6 5 40 fifteen pCMV-gp140env PLG / CTAB Geom.
average 5 2 3 3 2 3 2 fifteen 8 LL 3 2 2 2 one 2 2 8 four UL 9 3 four four 2 5 3 31 16 pCMV-gp140env MF59 / DOTAP Geom.
average 6 5 5 5 7 7 four eighteen 12 LL four four four 3 5 5 3 13 9 UL 9 7 7 7 10 10 6 25 16 pSINCP-gp140env Saline solution Geom.
average 9 6 7 8 5 5 four 41 23 LL 5 four four 5 3 3 3 23 12 UL fifteen 9 12 fourteen 9 8 6 74 45 pSINCP-gp140env PLG / CTAB Geom.
average 10 3 four 6 6 four 3 34 26 LL 7 3 3 four 3 3 2 19 fifteen UL fifteen four 6 10 9 6 four 62 47 nothing Nothing Geom.
average 2 2 one 2 one 2 one one one LL one one one one one 2 one one one UL 3 2 one 2 one 3 one one one ⁽¹⁾ Regarding immunization with plasmids carried out at weeks 0, 4 and 14
^{(2) The} geometric mean of the group
⁽³⁾ Group arithmetic means and standard errors calculated after log transformation of titles. LL = antilog (arithmetic mean - standard error). UL = antilog (arithmetic mean + standard error).
⁽⁴⁾ Recombinant oligomeric protein gp140env (ΔV2) / MF59 adjuvant, administered at 38 weeks.
⁽⁵⁾ no values: no analysis was performed.

Example 19

Intracellular cytokine immunofluorescence and flow cytometry

Rhesus PBMCs (1x10 ⁶ per well) were cultured in the presence or absence of brefeldin A (Pharmingen, San Diego, CA), anti-CD28 monoclonal antibodies (mAb) (Pharmingen) and in the absence or presence of gag or env peptide pools. Duplicate wells were prepared for each stimulation condition. The next day, the cells were stained with conjugated with chlorophyll protein Peridinin (PerCP) anti-CD8 mAb and conjugated with allophycocyanin (APC) anti-CD4 mAb (Becton Dickinson, San Jose, CA), fixed, destroyed membranes (Cytofix / Cytoperm, Pharmingen) and stained with fluorescein isothiocyanate (FITC) conjugated mAb against tumor necrosis factor α (TNF-α) and phycoerythrin (PE) conjugated anti-interferon γ (IFN-γ) mAb (Pharmingen). Stained cell samples were analyzed using a FACSCalibur ™ flow cytometer and CellQuest ™ software (Becton Dickinson). For T-cell subclasses CD4 + 8- and CD8 + 4-, the fraction of cells positively stained for IFN-γ and TNF-α was calculated. The number of gag or env-specific cells was calculated by subtracting the average fraction of IFN-γ / TNF-α found in unstimulated control wells from the middle fraction of IFN-γ / TNF-α found in stimulated gag or env wells.

For this subclass of T cells (CD4 + 8- or CD8 + 4-) and antigen (gag or env), the response was designated as positive if the fraction of antigen-specific cells was at least 0.1%.

Table 18
Gag-specific IFN-γ ⁺ / TNF-α ⁺ CD4 + T cells P55gag-specific vaccine induction IFN-γ ⁺ / TNF-α ⁺ CD4 +
T cells
The number of positive animals per group (n = 5) * Before After
1st After
2nd After
3rd After protein pSINCP 0 0 0 0 one PSINCP / PLG 0 0 2 0 0 pCMV 0 0 0 0 0 PCMV / PLG 0 0 2 0 one PCMV / MF59 0 0 0 0 0 No 0 0 0 0 0 * Positive: frequency ≥ 0.1% Table 19
Env-specific IFN-γ ⁺ / TNF-α ⁺ CD4 + T cells Gp140env-specific IFN-γ ⁺ / TNF-α ⁺ CD4 + T cell vaccine induction
The number of positive animals per group (n = 5) * Before After
1st After
2nd After
3rd After protein pSINCP 0 0 0 0 3 PSINCP / PLG 0 0 one 0 3 pCMV 0 0 one 0 2 PCMV / PLG 0 0 2 0 3 PCMV / MF59 0 0 0 0 0 No 0 0 0 0 0 * Positive: frequency ≥ 0.1% Table 20
Gag-specific IFN-γ ⁺ / TNF-α ⁺ CD8 + T cells Vaccine Induction of p55gag-Specific IFN-γ ⁺ / TNF-α ⁺ CD8 + T Cells
The number of positive animals per group (n = 5) * Before After
1st After
2nd After
3rd After protein pSINCP 0 0 0 0 0 PSINCP / PLG 0 0 0 0 0 pCMV 0 0 0 one 0 PCMV / PLG 0 0 one 0 0 PCMV / MF59 0 0 0 0 0 No 0 0 0 0 0 * Positive: frequency ≥ 0.1%

Table 21
Env-specific IFN-γ ⁺ / TNF-α ⁺ CD8 + T cells Gp140env-specific IFN-γ ⁺ / TNF-α ⁺ CD8 + T cell specific vaccine induction
The number of positive animals per group (n = 5) * Before After
1st After
2nd After
3rd After protein pSINCP 0 0 0 one 0 PSINCP / PLG 0 0 0 0 0 pCMV 0 0 0 0 0 PCMV / PLG 0 0 0 0 0 PCMV / MF59 0 0 0 0 0 No 0 0 0 0 0 * Positive: frequency ≥ 0.1%

Although preferred embodiments of the present invention have been described in detail, it should be understood that obvious variations can be made without departing from the spirit and scope of the invention as defined by the appended claims.

References

Claims (53)

1. A method of producing a microparticle having an adsorbing surface on which a vector construct capable of expressing a selected heterologous nucleic acid sequence is adsorbed, wherein said method comprises the steps of (a) emulsifying a mixture of a polymer solution and a detergent to form an emulsion, wherein the polymer solution contains a polymer of poly (α-hydroxy acid) present in an organic solvent in a concentration of from about 1% to about 30%, and where the detergent is present in the mixture in relation to the mass of detergent to the mass of the polymer, comprising from about 0.00001: 1 and up to about 0.5: 1; (b) removing the organic solvent from the emulsion to form said microparticle; and (c) adsorbing the vector construct on the surface of the microparticle, wherein said vector construct is selected from the group consisting of an ELVIS vector and a vector RNA construct, and said vector construct contains a heterologous nucleic acid sequence. 2. The method according to claim 1, where the heterologous nucleic acid sequence encodes a representative selected from the group consisting of a pharmaceutical agent, a polypeptide, a hormone, an enzyme, a transcription or translation mediator, a metabolic pathway intermediate, an immunomodulator, an antigen and an adjuvant. 3. The method of claim 2, wherein the heterologous nucleic acid sequence encodes an antigen selected from the group consisting of gp120 from HIV, gp140 from HIV, p24gag from HIV, p55gag from HIV, and influenza A hemagglutinin antigen A. 4. The method according to any one of the preceding paragraphs, where the specified heterologous nucleic acid sequence encodes a gag polypeptide from HIV and includes a sequence characterized by at least 90% identity with respect to the sequence selected from the group consisting of nucleotides 844-903 from SEQ ID NO: 63, nucleotides 841-900 from SEQ ID NO: 64, nucleotides 1213-1353 from SEQ ID NO: 67 and nucleotides 82-1512 from SEQ ID NO: 68. 5. The method according to any one of claims 1 to 3, wherein said heterologous nucleic acid sequence encodes an HIV envelope polypeptide and includes a sequence characterized by at least 90% identity with respect to a sequence selected from the group consisting of 1513 nucleotides -2547 from SEQ ID NO: 65 and nucleotides 1210-1353 from SEQ ID NO: 66. 6. The microparticle obtained by the method according to any one of the preceding paragraphs. 7. A microparticle having an adsorbing surface on which a vector construct is adsorbed capable of expressing a selected heterologous nucleic acid sequence comprising a microparticle selected from the group consisting of (a) a polymer microparticle containing (i) a polymer of poly (α-hydroxy acid ) and detergent; and (b) a submicron emulsion comprising (i) a metabolizable oil; and (ii) one or more emulsifying agents; and a vector construct adsorbed on the surface of the microparticles, where the vector construct is selected from the group consisting of an ELVIS vector and a vector RNA construct, and said vector construct contains a heterologous nucleic acid sequence. 8. The microparticle according to claim 7, where the selected microparticle is a submicron emulsion, and (a) the oil is a terpenoid, and (b) one or more emulsifying agents include one or more nonionic detergents and one or more cationic detergents. 9. The microparticle of claim 8, where the oil is squalene, and one or more emulsifying agents include polyoxyethylene sorbitan fatty acid ester, sorbitan fatty acid ester and DOTAP. 10. The microparticles according to claim 7, where the specified polymer microparticle is selected as the specified microparticles. 11. The microparticle of claim 10, where the polymer microparticle contains a poly- (α-hydroxy acid) selected from the group consisting of poly- (L-lactide), poly- (D, L-lactide) and poly- (D, L -lactide-co-glycolide). 12. The microparticles of claim 10 or 11, further comprising an additional biologically active micromolecule trapped inside the microparticle, where the additional biologically active macromolecule is a member selected from the group consisting of polynucleotide, polynucleoside, pharmaceutical, polypeptide, hormone, enzyme, transcription mediator or translation, an intermediate product of the metabolic pathway, immunomodulator, antigen and adjuvant. 13. The microparticles according to any one of paragraphs.10-12, where the specified vector design is an ELVIS vector. 14. The microparticle of claim 13, wherein said ELVIS vector contains a cDNA complementary to a vector RNA construct derived from a member selected from the group consisting of alphavirus, picornavirus, togavirus, flavivirus, coronavirus, paramyxovirus and yellow fever virus. 15. Microparticles according to any one of claims 10-12, wherein said vector construct is a vector RNA construct derived from a member selected from the group consisting of alphavirus, picornavirus, togavirus, flavivirus, coronavirus, paramyxovirus and yellow fever virus. 16. The microparticle according to 14 or 15, wherein said vector construction is derived from an alphavirus selected from the group consisting of Sindbis virus, Semlica forest virus, Venezuelan equine encephalitis virus or Ross River virus. 17. The microparticle according to claim 13 or 14, wherein said heterologous nucleic acid sequence encodes a representative selected from the group consisting of a pharmaceutical agent, a polypeptide, a hormone, an enzyme, a transcription or translation mediator, an intermediate product of the metabolic pathway, an immunomodulator, antigen and adjuvant. 18. The microparticles of claim 17, wherein said heterologous nucleic acid sequence encodes an antigen selected from the group consisting of gp120 from HIV, gp140 from HIV, p24gag from HIV, p55gag from HIV, and influenza A hemagglutinin antigen A. 19. The microparticle of claim 18, wherein said heterologous nucleic acid sequence encodes an HIV gag colpeptide and includes a sequence characterized by at least 90% identity with respect to a sequence selected from the group consisting of nucleotides 844-903 of SEQ ID NO: 63, nucleotides 841-900 of SEQ ID NO: 64, nucleotides 1213-1353 of SEQ ID NO: 67 and nucleotides 82-1512 of SEQ ID NO: 68. 20. The microparticle of claim 18, wherein said heterologous nucleic acid sequence encodes an HIV envelope polypeptide and includes a sequence characterized by at least 90% identity with respect to a sequence selected from the group consisting of nucleotides 1513-2547 from SEQ ID NO: 65 and nucleotides 1210-1353 of SEQ ID NO: 66. 21. The microparticle of claim 13, wherein said vector construction is a vector selected from the group consisting of pSINCP-gp140 and pSINCP-p55gag ELVIS vectors. 22. The microparticle according to any one of claims 10-21, further comprising at least one additional biologically active macromolecule adsorbed on the surface of the microparticle, where the specified additional biologically active macromolecule is at least one representative selected from the group consisting of a polypeptide, polynucleotide , polynucleoside, antigen, pharmaceutical, hormone, enzyme, mediator of transcription or translation, metabolic pathway intermediate, immunomodulator and adju guy. 23. The microparticle according to item 22, where the additional biologically active macromolecule is an antigen selected from the group consisting of gp120 from HIV, gp140 from HIV, p24gag from HIV, p55gag from HIV and the hemagglutinin antigen of influenza A virus, polynucleotide that encodes gp140 from HIV, or adjuvant. 24. The microparticle according to item 23, where the additional biologically active macromolecule is an adjuvant, which is an aluminum salt. 25. A microparticle composition comprising a microparticle according to any one of claims 7-24 and a pharmaceutically acceptable excipient. 26. The microparticle composition of claim 25, further comprising an adjuvant. 27. The microparticle composition of claim 26, wherein the adjuvant is (a) a member selected from the group consisting of a CpG oligonucleotide, or (b) an aluminum salt that is aluminum phosphate. 28. The microparticle composition according to any one of paragraphs.25-27 for use in order to induce or increase the immune response in a vertebrate host. 29. The microparticle composition according to any one of paragraphs.25-27 for use with the goal of delivering a therapeutically effective amount of a macromolecule to the spinal host. 30. The microparticle composition according to any one of paragraphs.25-27 for use in the treatment of a disease or as a vaccine. 31. The microparticle composition according to any one of paragraphs 28-29, where the specified vertebral host is a human. 32. The use of an adsorbed vector construct in the manufacture of a medicament for enhancing an immune response in a vertebrate host, where (a) the vector construct contains a heterologous nucleic acid sequence encoding a first antigen in an amount effective to elicit an immune response; (b) the vector structure is adsorbed on microparticles containing (i) a polymer of poly- (α-hydroxyacids) and (ii) a detergent; (c) the drug is used with a second antigen, which serves to enhance the immunological response in the vertebrate host; and (d) the first antigen and the second antigen may be the same or different. 33. The use of an adsorbed vector construct and a second antigen in the manufacture of a medicament for increasing the immune response in a vertebrate host, where (a) the vector construct contains a heterologous nucleic acid sequence encoding a first antigen in an amount effective to elicit an immune response; (b) the vector structure is adsorbed on microparticles containing (i) a polymer of poly- (α-hydroxyacids) and (ii) a detergent; (c) the second antigen is used after the adsorbed vector construct and serves to enhance the immune response in the vertebrate host; and (d) the first antigen and the second antigen may be the same or different. 34. The application of claim 32 or 33, wherein the adsorbed vector construct is selected from plasmid DNA and a vector RNA construct. 35. The application of clause 34, where the plasmid DNA is an ELVIS vector. 36. The application of clause 35, where the ELVIS vector contains a cDNA complementary to a vector RNA construct derived from a member selected from the group consisting of alphavirus, picornavirus, togavirus, flavivirus, coronavirus, paramyxovirus and yellow fever virus. 37. The application of clause 36, where the alphavirus is selected from the group consisting of Sindbis virus, Semlica forest virus, Venezuelan equine encephalitis virus or Ross River virus. 38. The application of clause 34, where the plasmid DNA includes a CMV promoter / enhancer. 39. The use according to any one of claims 32-38, wherein the first and second antigens are selected from the group consisting of HIV antigens, hepatitis C virus antigens, and influenza A antigens. 40. The application of claim 39, wherein the first and second antigens are selected from the group consisting of gp120, gp140, gp160, p24gag and p55gag HIV antigens. 41. The use according to any one of claims 32-40, wherein the second antigen is adsorbed on microparticles containing (i) a poly- (α-hydroxy acid) polymer, and (ii) a detergent. 42. The use according to any one of claims 32-41, wherein the adsorbed vector construct and / or second antigen is used with an adjuvant. 43. The use of claim 42, wherein the adjuvant is MF59. 44. The use according to any one of claims 32-43, wherein the polymer comprises a poly- (α-hydroxy acid) selected from the group consisting of poly- (L-lactide), poly- (D, L-lactide) and poly- ( D, L-lactide-co-glycolide), and wherein the detergent includes a cationic detergent selected from CTAB, benzalkonium chloride, DDA and DOTAP. 45. The use according to any one of paragraphs.32-44, where the vector structure can be entered twice or more times before the introduction of the second antigen. 46. The application of item 45, where the second antigen can also be entered twice or more times. 47. The application of claim 46, wherein the vector construct can be administered (a) during the initial administration, (b) after a period of time in the range of 1-8 weeks after the initial administration, and (c) after a period of time in the range of 4- 32 weeks after the initial administration, and where the second antigen can be administered (a) after a period of time in the range of 8-50 weeks after the initial administration and (b) after a period of time in the range of 8-100 weeks after the initial administration. 48. The use according to any one of paragraphs.32-47, where the vertebral host is a mammal selected from rhesus monkey and human. 49. The use according to any one of claims 32-48, wherein the vector construct and the second antigen can be administered subcutaneously, intraperitoneally, intradermally, intravenously or intramuscularly. 50. The application of clause 32, where the specified immune response includes a Th1 or CTL immune response. 51. The application of clause 32, where the specified immune response is induced against a viral, bacterial or parasitic infection. 52. The use of the microparticle composition of claim 25 in the manufacture of a medicament for (a) immunizing a vertebrate host against a viral, bacterial or parasitic infection, (b) inducing a Th1 or CTL immune response in the vertebrate host, or (c) reducing the level of infection in a vertebrate host having a viral, bacterial or parasitic infection. 53. The application of claim 52, wherein said vertebrate host is a human.

Images