RU2283128C1 - Method for production of protein preparation belonging to stress genus and hsp70 protein preparation obtained by said method - Google Patents

Abstract

FIELD: molecular biopharmacology.

SUBSTANCE: method for production of stress protein (heat shock protein) preparations includes such protein gene expression in E.coli cells followed by isolation, refolding and purification. Gene expression is carried out in structure of vector cDNA containing T7 promoter, kanamycin resistance gene, replicative pUC ori origin, and gene encoding lac-inductor. Vector DNA is cultured in structure of E.coli cells BL21 in nutrient medium with addition of kanamycin (100 mug/ml) and glucose (0.2 %) up to turbidity level of 0.5-0.6 OD600. Then 0.02mM isopropyl beta-D-thiogalactoside is added into medium and culturing is carried out for 1-3 h to accumulate finish product. Target product is purified by anion exchange chromatography. In said method vector DNA encoding proteins: HSP 100-200; HSP 100; HSP 90; Lon; HSP 70; HSP 60; TF 55; HSP 40; FKBPl cyclophylin; HSP 2-30; ClpP; GrpE; HSP 10, etc. of any gene are used. Invention also related to stress protein (heat shock protein) preparation obtained by abovementioned method. Protein represents recombinant HSP protein having molecular weight of about 70 kDa, which is isolated after incubation of E.coli cells in growth medium LB for 12 h at 37°C with addition of kanamycin (100 mug/ml) and glucose (0.2 %) up to turbidity level of 0.5-0.6 OD600, wherein transformed cell contains pBSH2-HSP70 plasmide DNA, carrying cDNA of heat shock protein gene, whish has size of 5118 n.p. and represents pBSH2 promoter containing T7 promoter, kanamycin resistance gene, replicative pUC ori origin, and gene encoding lac-inductor. Finished protein product has purity of at least 98 %.

EFFECT: stress proteins of high activity and high purity.

8 cl, 5 ex, 5 dwg

Description

The invention relates to the field of molecular biopharmacology, and in particular to the creation of a method for producing a protein preparation from the stress family and a protein preparation from this family (heat shock protein HSP70) obtained by the developed method. The obtained preparations of proteins from the stress family, for example, heat shock proteins, can serve as the basis for the creation of prophylactic, therapeutic and diagnostic agents for various diseases associated with metabolic disorders of these proteins.

Proteins from the stress family, such as heat shock proteins (HSP), are multifunctional proteins whose metabolism in the cells of living organisms is impaired in response to adverse conditions. Intracellular level of stress proteins (including HSP) increases under conditions of heat stress, acidosis, hypoxia or hyperoxia, energy depletion of the cell, as well as viral and microbial infections [1]. The main functions of HSP proteins are to increase cellular thermotolerance, participate in renaturation and maintain the integrity of the structure of cellular proteins, participate in the degradation of proteins with impaired structure, participate in the processes of association-dissociation of proteins, as well as their translocation through the membranes of intracellular compartments and organelles [2, 3] . The most important functions of HSP proteins are their ability to improve the presentation of antigen on the surface of dendritic cells and macrophages, as well as their ability to act as carriers of immunogenic peptides [4, 5, 6, as well as RF patent 2229307]. One of the most important representatives of HSP proteins are proteins of the HSP 70 family. Currently, more than 10 representatives of HSP 70 eukaryotes are known [7]. Yeast (Kar 2, Ssa 1-4) and bacterial (DnaK) HSP proteins are also described. The structure and functions of the HSP 70 are currently being actively studied. The molecular weight of HSP 70 is ~ 70 kDa; the amino-terminal part of the molecule contains a conserved ATPase domain (44 kDa), and a substrate-binding domain (~ 25 kDa) is located in the carboxyterminal part of the molecule, which ensures strong interaction of the chaperone with polypeptides. Unlike most other stressful proteins, HSPs function as monomers and are capable of binding large peptide fragments. Providing an effective source of highly purified HSP 70 is one of the important tasks that arise when creating modern vaccine-like drugs. In this regard, there is a need to develop and use new technologies to obtain such proteins and obtain target products with a minimum amount of impurities. As the main component of the new drugs, it is most preferable to use HSP 70 from Mycobacterium tuberculosis, since this protein induces the most powerful stimulation of the cellular immunological response to the associated antigenic peptides.

A number of researchers have developed producers for the production of recombinant analogues of heat shock proteins HSP 70 [US Pat. US No. 6,524,825; 5,919,620].

Work is also known in the field of creating antitumor drugs based on hybrid, fused and other HSP proteins. For example, in the published application for the invention of the Russian Federation No. 2003101965/14, publ. 2004, a method for treating diseases associated with human papillomavirus (warts, cervical and rectal cancer, etc.) is described using a composition comprising a fusion protein comprising mycobacterial heat shock protein (HSP 65 or HSP 70 from Mycobacterium bovis) and palilloma virus protein. Treatment can be carried out either by introducing a recombinant fusion protein to a subject, or by introducing a nucleic acid encoding a fusion protein contained in a viral vector.

The closest in technical essence is the development, which describes the recombinant DNA and its producer strain E. coli, which are able to provide recombinant mycobacterial HSP 70 in the form of a conjugate with protein p24 of the human immunodeficiency virus. According to the known method, the expression of HSP 70 is carried out in the form of a chimeric protein with p24 [8].

However, in this work, a narrow problem was solved - obtaining a chimeric protein with certain properties, which cannot serve as a component for other vaccine preparations.

The technical task of the present invention is to develop a universal method for producing protein from the family of stress in preparative quantities and highly purified for use in vaccine-like preparations.

The technical problem is achieved in that a method for producing a protein preparation from the stress family (heat shock protein) by expressing a gene of such a protein in E. coli cells with subsequent isolation, refolding and purification, characterized in that the gene expression is carried out as part of a vector cDNA containing The T7 promoter, kanamycin resistance gene, pUC ori replicative origin, and the lac inducer gene, vector DNA are cultured as E. coli BL21 cells in culture medium supplemented with kanamycin (100 μg / ml) and glucose (0.2%) to at the turbidity level is 0.5-0.6 OD ₆₀₀ , 0.2 mM isopropyl beta-D-thiogalactoside (IPTG) is added to the medium and continued to be cultured for 1-3 hours until the final product accumulates, and the final product is purified by anion exchange chromatography. The method uses vector cDNA of any gene encoding a protein from the family of stress proteins: HSP 100-200; HSP 100; HSP 90; Lon; HSP 70; HSP 60; TF 55; HSP 40; FKBP; cyclophilin; HPS 20-30; CIpP; GrpE; HSP 10; ubiquitin; calnexin. DNA of a gene from the family of stress proteins is operably inserted into the vector between the restriction enzyme sites of WatH I and Hind III. Moreover, the built-in cDNA of each of the proteins used can be modified by a leader sequence encoding 6 histidine residues. The developed method can be, in particular, used to obtain a drug from the family of stressful proteins - heat shock protein HSP70.

The invention is illustrated by some examples.

Example 1. Obtaining a protein product from the family of stress - protein HSP 40.

An inventive task is to provide a high yield and simplify the procedure for obtaining biologically active HSP 40.

To solve this problem, a recombinant plasmid DNA pBSH2-HSP40 was developed that encodes the synthesis of HSP 40, which consists of the following elements: cDNA of the HSP 40 gene under the control of the T7 promoter, kanamycin resistance gene, replicative origin pUC ori, gene encoding the lac inducer, and sequences necessary for the successful start of protein translation in E. coli cells.

As an expression system, we have taken the system used in pET vectors. Our pBSH2-HSP40 vector carries the HSP40 protein gene under the control of the T7 promoter, which can be transcribed only by T7 RNA polymerase. The T7 polymerase gene must be located in the bacterial genome of the strain under the control of the lac promoter, for example, as in strain BL21. Those. transcription of target genes under the control of the T7 promoter is possible only after the induction of the lac promoter with isopropyl beta-D-thiogalactoside (IPTG). The vector contains a copy of the lac I gene encoding the lac repressor. The lac operator is located between the T7 promoter and the coding part of the HSP 40 gene. The lac repressor suppresses basal protein expression in the absence of an IPTG inducer. The binding of the inducer to the repressor molecule disrupts its interaction with the operator site, making it possible to land RNA polymerase on this site with subsequent transcription.

This vector can also be used to express other recombinant proteins.

Recombinant plasmid DNA may contain a sequence encoding 6 histidine residues and an enterokinase recognition site linked to the HSP 40 gene (recombinant plasmid DNA pBSH2-His6HSP40).

Plasmid DNA is used in a method for producing HSP40 by expressing its gene as a part of recombinant DNA in E. coli, the difference of which is that expression is carried out in the recombinant plasmid pBSH2-HSP40 or pBSH2-His6HSP40 in a growth medium until its turbidity is 0.4-0, 6 OD, after which 0.1-0.3 mM IPTG, an inducer of the lac promoter, is added and expression is continued under the control of the induced lac promoter of the recombinant plasmid.

Directly related to this invention is a description of the methods and methods by which HSP 40, which is contained as the main component in the intracellular bodies of expression systems - bacterial cells, can be converted into a soluble state, then purified and returned to its native structure by refolding, which allows its biological activity.

After the stage of renaturation (refolding) purification of the target product obtained in plasmid DNA pBSH2-HSP40, carried out by the method of affinity chromatography on a column with ATP-agarose. Additional purification of the target product is carried out using anion exchange chromatography using the FPLC system. Purification of the target product obtained in plasmid DNA pBSH2-His6HSP40, carried out in one step by cation exchange chromatography on an agarose carrier.

The use of the leader sequence encoding six histidine residues in the pBSH2-His6HSP40 construct allows for reliable expression of the HSP 40 fused to it, the absence of point substitutions necessary in such cases for adaptation to the host cell protein biosynthesis apparatus, and simplification of the final isolation and purification of the fused protein. The presence of the histidine sequence does not interfere with the correct renaturation of the mature protein.

The described method can be used to obtain other proteins of the stress family by culturing E. coli cells, using the vector cDNA of the corresponding gene encoding the resulting protein from the stress family: HSP 100-200; HSP 100; HSP 90; Lon; HSP 70; HSP 60; TF 55; HSP 40; FKBP; cyclophilin; HPS 20-30; ClpP; GrpE; HSP 10; ubiquitin; calnexin. The vector cDNA of a gene from the family of stress proteins is operably inserted into the vector between the restriction enzyme sites BamH I and Hind III.

Another technical objective of the present invention is the development of a protein preparation HSP70 obtained by our method, more highly purified, simplified and affordable way.

The technical problem is solved by the fact that a stress protein preparation (heat shock protein HSP70) was developed, which is a recombinant HSP protein with M.m. about 70 kDa obtained by the claimed method from plasmid vector-transformed E. coli host cells, followed by isolation, refolding and purification, characterized in that the preparation was isolated after incubation of E. coli BL21 (D3) cells on LB growth medium for 12 h at 37 ° C with the addition of kanamycin (100 μg / ml) and glucose (0.2%) to a turbidity level of 0.5-0.6 OD ₆₀₀ , while the transformed cell contains plasmid DNA pBSH2-HSP70 carrying the heat shock protein gene cDNA HSP70, which is characterized by a size of 5118 bp and it is a pBSH2 vector containing the T7 promoter, the kanamycin resistance gene, the replicative pUC ori origin, the gene encoding the lac inducer, and the final protein preparation is not less than 98% pure. The built-in recombinant plasmid DNA pBSH2-HSP70 can additionally be modified with a leader sequence encoding 6 histidine residues. When using the recombinant plasmid pBSH2-HSP70, the final product is purified by affinity chromatography on an ATP-agarose column, followed by purification by anion exchange chromatography. When using the recombinant plasmid pBSH2-HSP70 with a leader sequence encoding 6 histidine residues, purification is carried out in one step by cation exchange chromatography on an agarose support. The preparation and properties of the drug are described in more detail in the examples.

Example 2. Cloning of the HSP 70 gene.

A cDNA library of M. tuberculosis genes was used as the source of the HSP 70 gene. The HSP 70 gene of M. tuberculosis was isolated by amplification using the following primers:

HSP70-BamH 5 '

GGATCC ATGGCTCGTGCGGTCGGGATCGACCTCGGGACCACCA

HSPTO-Hind 5 '

ACA AAGCTT ATTATCACTTGGCCTCCCGGCCGTCGTCGACCAC

His6HSP70-Bam 5 '

ACA GGATCC ATGCATCATCATCACCATCATGATGATGATAAAGCTCGTGCGGTCG

GGATCGACCTCGGGACCACCA

The His6HSP-BamH 5 ′ primer is designed to synthesize the HSP 70 gene with a 6-His leader sequence and an enterokinase recognition epitope.

The underlined sequences introduce the Bam HI and Hind III restriction sites for cloning into a vector for sequencing the HSP70 gene sequence.

The fragment was digested with BamHI - + - Hind III restriction enzymes and cloned between the BamHI and Hind III sites of the pBS + vector.

The fragment synthesized using primers HSP-70_HIND and 6-HIS HSP70 BAMN contains a leader sequence encoding 6-His and an epitope of recognition by enterokinase. It was treated with restriction enzymes HIND3 and BAMHI, and cloned into the pBS + vector, between the restriction sites HIND3 and BAMHI. The resulting clones were analyzed using an automatic sequencer.

The following nucleotide sequence was obtained corresponding to the HSP 70 gene (FIG. 1). The sequence was inserted at the restriction sites of WatH I and Hind III into the pBSH vector. The resulting vector was called pBSH2-HSP70 (pBSH2-His6HSP70, in the case of 6-His) (figure 2).

Induction of HSP70 synthesis was evaluated in 10 ml of IPTG-induced cultures (growing to OD ₆₀₀ 0.5, introducing IPTG to 0.2 mM, then 3 hours at 37 ° C on a shaker). The expected protein production is verified by SDS-PAGE.

For expression of recombinant proteins, E. coli strain BL21 (DE3) was used.

Example 3. Synthesis of HSP 70 in E. coli strains.

The synthesis level of HSP 70 was determined in an E. coli strain containing plasmids pBSH2-HSP70 or pBSH2-His6HSP70. An E. coli strain with recombinant plasmid pBSH2 not carrying the HSP 70 gene was used as a control. E. coli cells of strain BL21 (DE3) were transformed with pBSH2-HSP70 plasmid or pBSH2-His6HSP70 plasmid and grown for 12 h at 37 ° C in LB medium supplemented with kanamycin (100 μg / ml) and glucose (0.2%). Then the culture was diluted 25 times with fresh LB medium with kanamycin and grown for 2-3 hours to a density of OD ₆₀₀ = 0.5, then IPTG was added to a final concentration of 0.2 mM to induce HSP 70 synthesis. Another 3 hours were grown, the culture was centrifuged at 5 thousand vol. / min for 10 min, the supernatant was discarded.

As follows from the data presented in figure 3, E. coli cells containing the plasmids pBSH2-HSP70 and pBSH2-His6HSP70 support the expression of HSP 70. Figure 3 presents the results of electrophoretic separation of proteins of total cell lysates of E. coli strains in SDS- Page

where: 1 - molecular weight markers;

2 - strain E. coli BL21 (DE3), not carrying the plasmid pBSH2-HSP70 or pBSH2-His6HSP70;

3 - E. coli strain containing the recombinant plasmid pBSH2-HSP70;

4 - E. coli strain containing the recombinant plasmid pBSH2-His6HSP70.

Example 4. Purification of the HSP 70 preparation from E. coli cells containing the plasmid pBSH2-HSP70.

The cell pellet obtained from an E. coli culture was resuspended in ultrasound treatment buffer (50 mM Tris-HCl, pH 8.0, 20 mM EDTA), after which lysozyme was added to a final concentration of 50 μg / ml and incubated in this buffer on ice in within 30 minutes Then the lysozyme-treated cells were subjected to ultrasound using an ultrasonic disintegrator for 1 min at 0 ° C. The resulting suspension was centrifuged for 5 minutes at 10,000 rpm. Then, the washing procedure for inclusion bodies was carried out. For this, the precipitate was resuspended in a buffer containing 20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 0.1 M NaCl, 0.5% Nonidet P40, and was subjected to ultrasound as described above, followed by centrifugation (10000 rpm, 5 min ) The washing procedure for inclusion bodies was repeated two more times. The obtained preparation Taurus inclusion HSP 70 was solubilized in a buffer containing 10 mm Tris-HCl, 10 mm EDTA, 5M guanidine chloride. The target protein was renaturated by sequential dialysis of the preparation against a solubilization buffer containing guanidine chloride in decreasing concentrations: 2 M, 1 M, 0.5 M, 0.25 M. The last stage of dialysis was carried out against a buffer containing 100 mM Tris-HCl, pH 7.5.100 mM MgCl ₂ , 0.5 M EDTA.

Next, affinity chromatography was performed on a column with ATP agarose (Sigma), equilibrated with buffer containing 100 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 0.1 M NaCl, 0.1% Nonidet P40.

After applying the preparation, the column was washed with equilibration buffer containing 0.5 M NaCl, and then with the same buffer containing 100 mM NaCl and 5 mM ATP. Protein elution was performed with a column balancing buffer containing 30 mM ATP. Fractions were analyzed by SDS electrophoresis. The fractions containing the target protein were combined and dialyzed against a buffer containing 20 mM Tris-HCl, pH 8.0, 1 mM MgCl ₂ . Further protein purification was carried out using moderate pressure chromatography (FPLC) on a MonoQ HR 5/50 anion exchange column (Pharmacia), equilibrated with buffer containing 20 mM Tris-HCl, pH 8.0, 2 mM MgCl ₂ . After applying the preparation, the column was washed with the same buffer, additionally containing 50 mM NaCl. The target protein was eluted with a linear NaCl gradient (50-500 mM) in the same buffer. The elution profile of HSP 70 from the MonoQ column is shown in FIG. The presence of the target protein in the fractions and the degree of its purity were determined using SDS electrophoresis. Fractions containing the target protein were combined, dialyzed against PBS and stored at -70 ° C. After the final purification step, a high purity protein was obtained (see FIG. 5). The protein yield was ~ 10 mg of HSP 70 protein from 1 L of cell culture.

Example 5. Purification of the HSP 70 preparation from E. coli cells containing the plasmid pBSH2-His6HSP70.

The stages of cell disintegration and refolding of HSP 70 were carried out as described in Example 3. Purification of the target product obtained in plasmid DNA pBSH2-His6HSP70 was carried out by cation exchange chromatography on an agarose carrier. A column filled with IDA agarose sorbent (volume about 1 ml) was equilibrated with a solution of nickel (II) sulfate, then with a buffer containing 10 mM Tris-HCl, pH 8.0, 6 M urea, 400 mM NaCl, 10 mM 2-mercaptoethanol, 5 mM imidazole. The supernatant obtained after refolding, as described earlier in this section, was applied to the column, washed with the last 5 volumes of the same buffer, then with 10 volumes of buffer containing 10 mM Tris-HCl, pH 8.0, 6 M urea, 400 mM NaCl, 10 mM 2-mercaptoethanol, 20 mM imidazole. Elution was performed with a buffer containing 10 mM Tris-HCl, pH 8.0, 2 M urea, 400 mM NaCl, 10 mM 2-mercaptoethanol, 300 mM imidazole. The presence in the fractions of the target protein and its degree of purity was determined using SDS-electrophoresis (see figure 5). Fractions containing HSP 70 were combined and dialyzed against PBS and stored at -70 ° C.

The production level of HSP 70 in E. coli cells transformed with the pBSH2-HSP70 plasmid was about 20 mg / L culture.

Example 6. Electrophoretic analysis of the final preparations of HSP 70 from M. tuberculosis.

Figure 5 presents the data of electrophoretic analysis of recombinant HSP 70 in a 12% polyacrylamide gel in the presence of 0.1% sodium dodecyl sulfate:

1 - molecular weight markers;

2 - preparation of HSP 70 from a strain with plasmid pBSH2-HSP70 after the final stage of purification;

3 - preparation of HSP 70 from a strain with plasmid pBSH2-His6HSP70 after the final stage of purification.

Figure 5 shows that both drugs are almost homogeneous proteins (purity more than 98%) with a molecular weight corresponding to the natural HSP 70.

Thus, a convenient, affordable universal method for producing recombinant preparations of a protein of the stress family was developed and a protein preparation HSP70, highly purified, which can be a component in the manufacture of vaccine-like immunogenic complex preparations, is obtained.

Literature

1. Kregel K.C., J. Appl. Physiol. 92: 2177-2186, 2002.

2. Mizzen L.A. and Welch W.J., J. Cell Biol. 106: 1105-1116, 1988.

3. Schlessinger M.J., J. Biol. Chem. 265: 12111-12114, 1990.

4. Gaston J. S. H., Clin. Exp. Immunol. 127: 1-3, 2002.

5. Khlebodarova T.M., Genetika 38: 437-452, 2002.

6. Lussow A.R. et al., Eur. J. Immunol. 21: 2297-2302, 1991.

7. Bernelli-Zazzera A. et al., Ann. N.Y. Acad. Sci. 663: 120-124, 1992.

8. Suzue K. and Young R.A., J. Immmunol. 156: 873-879, 1996.

Claims (8)

1. A method of obtaining a protein of a family of stress family by expressing a gene of such a protein in E. coli cells, followed by isolation, refolding, and purification, characterized in that the gene is expressed as a vector cDNA containing the T7 promoter, kanamycin resistance gene, replicative pUC origin ori, and the lac inducer encoding gene, vector DNA is cultured in E. coli BL21 cells in a culture medium supplemented with kanamycin (100 μg / ml) and glucose (0.2%) to a turbidity level of 0.5-0.6 OD ₆₀₀ in medium was added 0.2 mM isopropyl-beta-D-tiogalakto id (IPTG) and continued to be cultured for 1-3 hours prior to storage of the final product and the final product purification is carried out by anion exchange chromatography. 2. The method of obtaining the drug according to claim 1, characterized in that they use vector cDNA of the corresponding gene encoding the resulting protein from the family of stress proteins: HSP 100-200; HSP 100; HSP 90; Lon; HSP70; HSP 60; TF55; HSP 40; FKBP; cyclophilin: HPS 20-30; CIpP; GrpE; HSP 10; ubiquitin; calnexin. 3. The method of obtaining the drug according to claim 1 or 2, characterized in that the integrated cDNA of each of the used proteins can be modified by a leader sequence encoding 6 histidine residues. 4. The method of obtaining the drug according to claim 1, characterized in that the method is used to obtain a protein preparation from the family of stress - heat shock protein HSP70. 5. The preparation of the HSP70 protein from the stress family, which is a recombinant HSP heat shock protein with M.m. about 70 kDa obtained by culturing E. coli host cells transformed with a plasmid vector, followed by isolation, refolding, and purification of the final protein, characterized in that the preparation was isolated after culturing E. coli BL21 (D3) cells on LB growth medium for 12 h at 37 ° C with the addition of kanamycin (100 μg / ml) and glucose (0.2%) to a turbidity level of 0.5-0.6 OD ₆₀₀ , while the transformed cell contains plasmid DNA pBSH2-HSP70 carrying the heat shock protein gene cDNA HSP70, which is characterized by a size of 5118 bp and it is a pBSH2 vector containing the T7 promoter, the kanamycin resistance gene, the replicative pUC ori origin, the gene encoding the lac inducer, and the final protein preparation is not less than 98% pure. 6. The preparation of heat shock protein according to claim 5, characterized in that the built-in recombinant plasmid DNA pBSH2-HSP70 is further modified by a leader sequence encoding 6 histidine residues. 7. The drug according to claim 5, characterized in that when using the recombinant plasmid pBSH2-HSP70, the final product was purified by affinity chromatography on a column with ATP agarose, followed by purification by anion exchange chromatography. 8. The drug according to claim 6, characterized in that the purification is carried out in one stage by cation exchange chromatography on an agarose carrier.

Images