RU2273645C2 - Obesity polypeptide (ob) (variants), its analogue (variants), and fused protein (variants), nucleic acid isolated molecule, dna molecule, cloning recombinant vector, expression recombinant vector, pharmaceutical composition, monoclonal and polyclonal antibody - Google Patents

Abstract

FIELD: biotechnology, molecular biology, medicine.

SUBSTANCE: invention discloses amino acid sequences of human obesity polypeptide (OB) two isoforms possessing capacity for modulation of animal body mass, their signal peptide-containing precursors and analogues. Polypeptide isoforms are prepared as result of insertions, deletions and amino acid changes that retain activity typical for nonmodified forms of OB-polypeptides, and polyclonal and monoclonal antibodies interaction specifically with new agents modulating the body mass value also. Invention describes DNA sequences encoding these polypeptides and their analogues, vector structures comprising these sequences used for preparing recombinant forms of OB-polypeptides. Invention proposes using new polypeptides and their analogues as an active component in pharmaceutical compositions. Using this invention can promote to solving the problem for providing medicine, veterinary science and animal husbandry with effective agent used for decreasing the body mass value. Invention can be used in medicine for diagnosis and treatment of pathological states associated with disturbance of regulation of human body mass, and in animal husbandry and veterinary science.

EFFECT: valuable biological, medicinal and veterinary properties of polypeptide.

23 cl, 71 dwg, 12 tbl, 17 ex

Description

FIELD OF THE INVENTION

The present invention generally relates to controlling the weight of mammals, including animals and humans, and more specifically to reagents that are identified here as weight modulators, as well as the diagnostic and therapeutic use of modulators.

BACKGROUND OF THE INVENTION BACKGROUND OF THE INVENTION

Obesity is seen as excess body fat in relation to lean body mass and is associated with many important physiological and medical disorders, including hypertension, high blood lipids, type II diabetes, or insulin-independent diabetes mellitus (NIDDM). In the United States, NIDDM affects 6–10 million people, including 18% of the population aged about 65 (Harris et al., Int. J. Obes., 11: 275-283 (1987)). About 45% of men and 70% of women with NIDDM suffer from obesity, and the severity of their disease is significantly reduced or eliminated with weight loss (Harris, Diabetes Care, 14 (3): 639-648 (1991)). As described below, both NIDDM and obesity are strictly inherited despite the fact that the genes for predisposition to these diseases have not yet been identified. The molecular genetic processes underlying these metabolic disorders constitute an important, poorly understood problem.

The assimilation, storage and use of energy of nutrients form a complex homeostatic system that ensures the survival of multicellular organisms. Among terrestrial mammals, the storage of large amounts of metabolic “fuel” in the form of triglycerides in adipose tissue is a critical factor in survival in the face of food shortages. The need to maintain a certain level of energy reserves without constantly changing the size and shape of the body requires achieving a given balance between energy consumption and consumption. However, the molecular mechanisms that regulate energy balance remain unexplored. Obtaining molecules that transmit information about nutritional components and control energy balance is a key point in understanding the mechanisms of regulating body weight, which are so important for the development of diseases and maintaining health.

The degree of obesity of an individual is largely genetically determined. A study of the correspondence of body weight and obesity in monozygous and dizygotic twins and their biological parents suggests that the degree of inheritance of obesity (0.4-0.8) exceeds the corresponding values for other disorders, the development of which (as is generally accepted) involves a significant genetic component, for example schizophrenia, alcoholism and atherosclerosis (StunKard et al., N. Engl. J. Med., 322: 1483-1487 (1990)). Family similarities in energy expenditure levels have also been reported (Bogardus et al., Diabetes, 35: 1-5 (1986)). Genetic analysis in geographically limited populations suggests that a relatively small number of genes may account for 35-50% of the variation in body composition (Moll et al. Am. J. Hum. Genet., 49: 1243-1255 (1991)). However, not one of the genes responsible for obesity in the population as a whole has been mapped to any chromosomal locus.

Rodent obesity models include seven explicit mutations in individual genes. The most studied mutations associated with obesity in mice are mutations in the ob (obesity) and db (diabetes) genes. When functioning on the same genetic background, the ob and db genes lead to the appearance of metabolically and behaviorally indistinguishable phenotypes, suggesting that these genes can function in a similar physiological way (Coleman et al., Diabetologia, 14: 141-148, 1978). Mice homozygous for two mutations are characterized by hyperphagicity and hypometabolism, which leads to the obesity phenotype detected at the age of one month. The weight of these animals is stabilized at the level of 60-70 g (in comparison with 30-35 g in control animals). Ob and db animals exhibit a huge number of other hormonal and metabolic disorders that in some way interfere with the identification of a primary defect caused by a mutation (Bray et ai, Am. J. din. Nuir., 50: 891-902 (1989)).

Each of the rodent obesity patterns is characterized by changes in carbohydrate metabolism, reminiscent of type II diabetes in humans. In some cases, the severity of diabetes depends in part on the background inherent in this line of mice (Leiter, Endocrinology, 124: 912-922 (1989)). Both ob and db C57BL / Ks congenic mice develop severe diabetes with b-cell necrosis and islet atrophy, leading to relative insulinopenia. In contrast, ob and db C57BL / 6J congenic mice are characterized by transient insulin-resistant diabetes, which is fully compensated by the b-cell hypertrophy characteristic of human type II diabetes.

The phenotype ob and db of mice, when compared with obesity in humans, manifests itself in a different way than the development of diabetes. Mutant mice eat more and spend less energy than control animals (just like obese people). This phenotype practically coincides with the phenotype of animals with disorders of the ventromedial hypothalamus. This suggests that both mutations are capable of interacting with the ability to appropriately combine or respond to information about the nutritional components within the central nervous system. This hypothesis is supported by the results of experiments on parabiosis (Coleman, Diabetologia, 9: 294-298 (1973)), from which it follows that ob mice are defective in the circulating factor of saturation, and db mice are resistant to the effects of ob factor (possibly beyond ob-defect count). These experiments suggest that obesity in mutant mice may result from various defects in the afferent loop and / or integrated center of the feedback mechanism that controls body composition.

Using molecular and classical genetic markers, ob and db genes are mapped to proximal chromosome 6 and middle chromosome 4, respectively (Bahary et al., Proc. Natl. Acad. Sci. USA, 87: 8642-8646 (1990); Friedman et al. Genomics 11: 1054-1062 (1991)). In both cases, mutations are mapped in regions of the mouse genome similar to those of humans, suggesting that if human analogues of ob and db exist, they are more likely to be mapped to human chromosomes 7q and 1p, respectively. Defects in the db gene can lead to obesity in other mammals: in genetic fusions between Zucker fa / fa rats and Brown Norway + / + rats, the fa mutation (rat chromosome 5) is flanked by the same locus that flanks the mouse db gene (Truett et al ., Proc. Natl. Acad. Sci. USA, 88: 7806-7809 (1991)).

Since numerous factors affect body weight, it is almost impossible to predict which factors and, more importantly, which homeostatic mechanisms primarily determine body weight. Thus, the fundamental problem underlying the present invention relates to the production of modulators of body weight, which provide control of obesity and fat content in mammals.

SUMMARY OF THE INVENTION

In accordance with the present invention, the problem of controlling obesity and fat content in animals, especially mammals, is solved by producing obesity (OB) polypeptides and nucleic acid molecules encoding said polypeptides. The present invention relates primarily to isolated polypeptides useful for modulation, i.e., control and regulation of body weight and obesity, as well as to nucleic acids encoding these polypeptides, which not only provide the possibility of obtaining recombinant OB polypeptides, but also themselves self can be used to modulate body weight.

The obesity polypeptides (OB) according to the present invention having from about 145 to about 167 amino acids are capable of modulating the body weight of animals, especially mammals, and include allelic variants or analogs, including fragments having similar biological activity. Polypeptides can be obtained recombinantly or as a result of chemical synthesis. Preferred OB polypeptides include compounds having the amino acid sequences of SEQ ID NOS: 2, 4, 5, or 6 or their allelic variants or analogs, including fragments.

Immunogenic fragments of OB polypeptides according to this invention include: Val-Pro-Ile-Gln-Lys-Val-Gln-Asp-Asp-Thr-Lhs-Thr-Leu-Ile-Lys-Thr (SEQ ID NO: 18); Leu-His-Pro-Ile-Leu-Ser-Leu-Ser-Lys-Met-Asp-GIn-Thr-Leu-Ala (SEQ ID NO: 19); Ser-Lys-Ser-Cys-Ser-Leu-Pro-Gln-Thr-Ser-Gly-Leu-Gln-Lys-Pro-Glu-Ser-Leu-Asp (SEQ ID NO: 20); and Ser-Arg-Leu-Gln-Gly-Ser-Leu-Gln-Asp-Ile-Leu-Gln-Gln-Leu-Asp-Val-Ser-Pro-Glu-Cys (SEQ ID NO: 21). Analogues of the human OB polypeptide have the amino acid sequences of SEQ ID NOS: 4 and 6, with one or more amino acids at positions 53, 56, 71, 85, 89, 92, 95, 98, 110, 118, 121, 122, 126, 127, 128, 129, 132, 157, 159, 163 and 166 (in accordance with the sequence numbering of SEQ ID NO: 4) are substituted with other amino acids, such as divergent amino acids of the mouse OB polypeptide, in accordance with SEQ ID NO: 2 or alanine. These analogs also include the following: (a) the serine residue at position 53 is substituted with glycerin, alanine, valine, cysteine, methionine or threonine; (b) the serine residue at position 98 is substituted with glycine, alanine, valine, cysteine, methionine or threonine; and (c) the arginine residue at position 92 is substituted with asparagine, lysine, histidine, glutamine, glutamic acid, aspartic acid, serine, threonine, methionine or cysteine. An analogue of the OB polypeptide in accordance with the invention is preferably 83% or more homologous in amino acid sequence to the OB polypeptide with the amino acid sequence of SEQ ID NO: 2, 4, 5 or 6. Additional analogs of the human OB polypeptide in accordance with this invention have the amino acid sequences of SEQ ID NOS : 4 and 6, wherein: (a) one or more aspartic acid residues is substituted with glutamic acid; (b) one or more isoleucine residues substituted with leucine; (c) one or more glycine or valine residues are substituted with alanine; (d) one or more arginine residues substituted with histidine; (e) one or more tyrosine or phenylalanine residues substituted with tryptophan; (e) one or more residues in positions 121-128 (in accordance with the sequence numbering SEQ ID NO: 4) substituted with glycine or alanine; and (g) one or more residues in positions 54-60 or 118-166 (in accordance with by the sequence of SEQ ID NO: 4) substituted with lysine, glutamic acid, cysteine or proline. Preferred truncated analogues of human OB polypeptides according to the present invention include the following compounds (in accordance with the sequence numbering of SEQ ID NO: 4): (a) one or more residues at positions 121-128 are deleted; (b) residues 1-116 are deleted; (c) residues 1-21 and 54-167 are deleted; (c) residues 1-21 and 54-167 are deleted; (d) residues 1-60 and 117-167 are deleted; (e) residues 1-60 are deleted; (f) residues 1-53 are deleted and (g) an analogue in accordance with (a) while residues 1-21 are deleted. OB polypeptides and ob polypeptide analogs prepared according to the present invention having lost 21 amino acids of a signal sequence (e.g., amino acids 1-21 of SEQ ID NO: 4) may have an N-terminal amino acid or an amino acid sequence such as (1) methionine, ( 2) glycine-serine-histidine-methionine sequence (SEQ ID NO: 38), (3) methionine-glycine-serine-serine-gastidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine -proline-arginine-glycine-serine-histidine-methionine follower ness (SEQ ID NO: 98), (4) leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 26), (5) glutamic acid-alanine-glutamic acid- alanine sequence (SEQ ID NO: 27), (6) leucine-glutamic acid-lysine-arginine sequence (SEQ ID NO: 28), (7) methionine-glycine-serine-serine-histiline-histidine-histidine-histidine-histidine -histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-proline sequence (SEQ ID NO: 99) and (8) glycine-serine-proline sequence vegetation.

Derivatives of the OB polypeptide according to the invention have one or more attached chemical groups, including water-soluble polymers such as polyethylene glycol. Derivatives obtained using polyethylene glycol can be mono-, di-, tri- or tetrapaginated, for example, monopagirovannye at the N-terminal portion.

Preferred N-terminal portioned derivatives of the ob polypeptides of the present invention include OB polypeptides containing amino acid residues 22-167 of SEQ ID NO: 4 or residues 22-166 of SEQ ID NO: 6 and optionally containing (pegylated) methionine in position 21.

The isolated nucleic acid molecules obtained according to the present invention encode an OB polypeptide, an allelic variant or analogue, including fragments, as described above. Particularly important DNA molecules for use in order to ensure safe expression of the OB polypeptide have biological activity that modulates the body weight of mammals and are selected from the group including: (a) DNA molecules with sequences of SEQ ID NO: 1 and 3 or fragments thereof, ( b) DNA molecules capable of hybridizing with DNA molecules defined in (a) or with their fragments, and (c) DNA molecules that determine the expression of the amino acid sequence encoded by any of the above DNA molecules. Examples of such molecules are genomic DNA molecules with sequences SEQ ID NOS: 22 and 24. Preferred DNA molecules according to the present invention encode a polypeptide having the following amino acid sequence: (a) SEQ ID NO: 2, (b) amino acids 22- 167 of the sequence SEQ ID NO: 2, (c) SEQ ID NO: 4, (d) amino acids 22-167 of the sequence SEQ ID NO: 4, (d) SEQ ID NO: 5, (e) amino acids 22-166 of the sequence SEQ ID NO: 5, (g) SEQ ID NO: 6, and (h) amino acids 22-166 of the sequence SEQ ID NO: 6. In addition, these DNA molecules encode polypeptides having the N-terminal amino acid or amino acid sequence shown previously. For example, a preferred DNA molecule has a sequence represented as a protein coding sequence of SEQ ID NO: 3, and in particular a sequence encoding amino acids 22-167.

In addition, the invention relates to detectable label nucleic acids that hybridize with the claimed nucleic acids. Such nucleic acids, in particular, hybridize to a non-coding region of an OB nucleic acid selected from the group consisting of an intron, a 5'-non-coding region and a 3'-non-coding region. The present invention also relates to oligonucleotyl primers for amplification of human genomic DNA encoding an ob polypeptide, for example, oligonucleotyls 29-32 of the sequence SEQ ID NOS: 29.

The vectors claimed in accordance with the present invention comprise a DNA molecule prepared in accordance with the invention as described above, and are preferably expression vectors comprising a DNA molecule operably linked to an expression control sequence. Unicellular host cells in accordance with the invention are transformed or transfected with DNA molecules or vectors described above. Preferred host cells include bacteria, yeast, mammalian cells, plant cells, insect cells and human cells in tissue culture. For example, such host cells are selected from the group consisting of E. Coli, Pseudomonas, Bacillus, Streptomyces, yeast, CHO-, R1.1-, BW-, LM-, COS 1-, COS7-, BSC1-, BSC40-, BMT10 and Sf9 cells. Preferred yeast hosts are Saccharomyces, Pichia, Candida, Hansenula and Torulopsis. The subject of the invention is also mammalian cells containing a DNA sequence encoding an ob polypeptide and modified in vitro to facilitate increased expression of an ob polypeptide by homologous recombination, in which the expression regulatory sequence is inserted in functional proximity to the sequence encoding an ob polypeptide. The expression control sequence may be the corresponding sequence for the ob polypeptide or not and is able to replace the mutant regulatory sequence of the ob polypeptide in the cell.

The present invention also relates to methods for producing an ob polypeptide, including: (a) culturing a cell as described above under conditions providing expression of an ob polypeptide, and (b) isolating an expressed polypeptide. This procedure may be accompanied by the following steps: (c) chromatography of the polypeptide on a Ni-chelating column and (g) purification of the polypeptide by gel filtration. In a preferred embodiment, after step (c) and before step (d), the ob polypeptide is chromatographed on a strong cation exchange column.

The present invention also relates to labeled and unlabeled monoclinal and polyclonal antibodies specific for the claimed ob polypeptides and immortal cell lines producing monoclonal antibodies in accordance with the invention. Obtaining antibodies according to the present invention includes the following stages: (a) conjugation of the ob polypeptide with a carrier protein, (b) immunization of the animal host with the conjugate "ob polypeptide fragment / carrier protein" obtained in stage (a) and mixed with an adjuvant , and (c) isolating the antibody from the immunized host animal.

The invention relates to methods for determining the presence of an OB polypeptide in a sample, comprising: (a) contacting a sample, preferably containing an OB polypeptide, with an antibody (preferably bound to a solid support) that specifically binds to an OB polypeptide under conditions allowing the formation of reaction complexes containing the antibody and OB polypeptide, and (b) the detection of the formation of reaction complexes containing the antibody and the ob polypeptide in the sample, while the detection of the formation of reaction complexes stvuet the presence of OB polypeptide in the sample. Accordingly, the invention relates to methods for assessing in vitro the level of an OB polypeptide in a biological sample, comprising: (a) detecting the formation of reaction complexes in the biological sample in accordance with the method described above, and (b) assessing the number of reaction complexes formed that corresponds to the level of the OB polypeptide in a biological sample. When a disease associated with an increased or decreased level of an OB polypeptide according to the invention is detected or diagnosed, the level is assessed as described above, and the detected value is compared with the level of the OB polypeptide in healthy individuals or in that individual at an earlier time. An increase in the level of OB polypeptide compared to a normal or previous level indicates the presence of a disease associated with an increased level of an OB polypeptide, and a decrease in the level of an OB polypeptide compared to normal indicates a disease associated with a decreased level of an OB polypeptide. Accordingly, the scope of the invention includes methods for monitoring in vitro therapeutic treatment of a disease of a mammal associated with an increased or decreased level of OB polypeptide, comprising assessing the level of OB polypeptide (as described above) in a series of biological samples obtained at different time points from a mammal undergoing the indicated therapeutic treatment .

The pharmaceutical compositions prepared according to the present invention contain the OB polypeptide described above and a pharmaceutically acceptable carrier and are used in the implementation of therapeutic methods to reduce the body weight of an animal. Additional pharmaceutical compositions obtained according to the present invention for use in implementing therapeutic methods to increase the body weight of an animal comprise an antagonist of an OB polypeptide, preferably selected from the group consisting of: an antibody that binds to and neutralizes the OB polypeptide, a fragment of the ob polypeptide, which binds to the OB polypeptide receptor, but does not activate it, and a small antagonist molecule of the OB polypeptide. In addition, the invention relates to corresponding cosmetic compositions that improve the appearance of the body, to reduce or increase the body weight of the individual, which are used in cosmetic procedures that improve the appearance of the body of the individual. Such cosmetic compositions are used in a quantitative dose sufficient to simulate an individual's body weight to a predetermined level.

The invention also relates to the use of nucleic acid molecules obtained according to the present invention, as well as antisense nucleic acid molecules capable of hybridizing with a nucleic acid encoding the claimed OB polypeptide, for the preparation of a medicament that modifies the animal’s body weight (for example, for gene therapy). In addition, the invention relates to the use of an OB polypeptide or an appropriate antagonist for the manufacture of a medicament that modifies the body weight of an animal. The medicaments thus obtained can be used to modify the body weight of a mammal during the treatment of a disease selected from the group consisting of diabetes, high blood pressure and high cholesterol. Such a modification is part of the combination therapy of this disease with the help of appropriate medications. The above medications may be useful in therapeutic methods by the intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, nasal, oral or pulmonary routes.

The information provided in the present description shows that the OB polypeptides obtained according to this invention, in this form, are initially secreted from mammalian adipocytes and function like hormones.

The above examples show that the OB polypeptide, alternatively designated as “leptin”, circulates in the blood plasma of mice, rats and humans. Leptin is absent in the blood plasma of ob / ob mice and is found in ten-fold concentrations in the blood plasma of db / db mice and in twenty-fold concentrations in the blood plasma of rats fa / fa. Moreover, daily injections of recombinant leptin significantly reduce the body weight of ob / ob mice, significantly affect the body weight of wild-type mice and have no effect on db / db mice.

In addition, the ob polypeptide of one animal species is biologically active in the animal organism of another species. In particular, the OB polypeptide is active in mice.

First of all, the modulators of the invention include nucleic acid molecules, including recombinant DNA molecules (e.g., cDNA, or a vector containing cDNA, or isolated genomic DNA) or cloned genes (i.e., isolated genomic DNA) or variants thereof, based on the degeneracy of the genetic code that encode polypeptides that are modulators of body weight control, as described below, or conservative variants or fragments of such polypeptides, in particular fragments of the polypeptide s that have lost the signal peptide (alternatively referred to herein as mature OB polypeptides). These polypeptides have the amino acid sequences shown in FIG. 1A-E (SEQ ID NO: 2), FIG. 3 (SEQ ID NO: 4), FIG. 5 (SEQ ID NO: 5) and FIG. 6 (SEQ ID NO: 6). In a particular embodiment, amino acid sequences are obtained for human and mouse ob polypeptides. Both polypeptides are found in a form that has lost glutamine at position 49, which may result from abnormal splicing of mRNA. OB polypeptides of various animal species may have a high degree of homology. As shown in FIG. 4, human and mouse OB polypeptides have more than 80% homology.

Nucleic acid molecules, recombinant DNA molecules or cloned genes may have nucleotide sequences or may be complementary to the DNA coding sequences shown in FIG. 1A-E (SEQ ID NO: 1) and FIG. 2A and B (SEQ ID NO: 3). In particular, such DNA molecules can be cDNA molecules or genomic DNA isolated from chromosomes. Nucleic acids obtained in accordance with the invention may also correspond to 5'- and 3'-flanking DNA sequences and intron DNA sequences. In this regard, the present invention also relates to the identification of a nucleic acid having a nucleotide sequence selected from the group consisting of sequences in FIG. 1A-E (SEQ ID NO: 1) and FIG. 2A and B (SEQ ID NO: 3), as well as their variants obtained taking into account the degeneracy of the genetic code, allelic variants and similar related molecules.

In accordance with the present invention, the nucleic acid molecules can be DNA and RNA, including their synthetic variants having a phosphate or phosphate analog, for example, thiophosphate bonds. Moreover, these molecules can be either single-stranded or double-stranded.

The invention also relates to nucleic acid molecules used as molecular probes or primers for amplification by polymerase chain reaction (PCR), i.e. natural or synthetic oligonucleotides having a sequence corresponding to a portion of the sequences shown in FIG. 1A-E (SEQ ID NO: 1), FIG. 2A and B (SEQ ID NO: 3) and FIG. 20A-C (SEQ ID NO: 22), or 5'- and 3'-flanking sequences of coding sequences or intron sequences of genomic DNA. In particular, the invention relates to a nucleic acid molecule having at least about 10 nucleotides, while the nucleic acid molecule sequence corresponds to a nucleotide sequence of the same number of nucleotides in the nucleotide sequences shown in FIG. 1A-E (SEQ ID NO: 1), FIG. 2A and B (SEQ ID NO: 3) and FIG. 20A-C (SEQ ID NO: 22) or a sequence complementary to the one indicated. More preferably, the nucleic acid molecule sequence has at least 15 nucleotides. Most preferably, the nucleic acid sequence has at least 20 nucleotides. In one embodiment of the invention, when the oligonucleotide is used as a sample, it contains a detectable label, for example a radionuclide (such as ³² P) or enzyme.

The invention further relates to a cloning vector containing the claimed nucleic acids encoding an ob polypeptide, as well as to an expression vector active in bacteria, insects or mammalian cells, containing the claimed nucleic acids, as well as an expression vector active in bacteria, insects or mammalian cells containing the claimed nucleic acids encoding an ob polypeptide operably linked to an expression control sequence. Accordingly, the invention relates to a host cell, for example, a bacterial, yeast, insect or mammalian cell, transfected or transformed with a suitable expression vector, as well as to the use of the above constructs for producing modulators according to the invention.

The invention also relates to antibodies that bind to the ob polypeptide. Such antibodies can be prepared against a full-length polypeptide or antigenic fragments thereof. In one case, such antibodies inhibit the functional activity of the ob polypeptide. Alternatively, antibodies can be used to determine the level of circulating ob polypeptide in blood plasma or serum. In addition, antibodies specific for any region of the OB polypeptide, in particular monoclonal antibodies, can be used as “structural” samples of this polypeptide.

All of the compounds described above can be considered as modulators of body weight and fat content and, thus, can be used in various ways, as described above. In particular, the invention can find diagnostic and therapeutic applications, as well as be used in agriculture. The basis of such applications is the use of the modulators described above, including nucleic acid molecules and peptides. Moreover, modulation of body weight implies the use of specific therapeutic approaches in such a way that obesity or, on the contrary, cachexia, reflecting unwanted disorders in the body, can be corrected using one or more modulators obtained according to the present invention.

Thus, the invention relates to a method for modulating the body weight of mammals, comprising controlling the expression of a protein encoded by a nucleic acid having a nucleotide sequence selected from the group including the sequence shown in FIG. 1A-E (SEQ ID NO: 1), FIG. 2A and B (SEQ ID NO: 3), as well as their allelic variants and variants derived from the degeneracy of the genetic code. Such a control may be effective by introducing the claimed nucleotides during gene therapy into the fat cells of a patient or any host to control or reduce obesity. In contrast, the preparation and use of antagonists of these nucleotides, such as antisense molecules, may be useful in eliminating disorders including excessive weight loss, such as anorexia nervosa, cancer or AIDS, for which treatment is being carried out. These antagonists can be introduced in a similar manner to nucleotides directly in fat cells to achieve desired changes.

Accordingly, proteins determined using FIG. 1A-E, 3, 5 and 6 (SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6), their conservative variants, active fragments and related small molecules can be obtained for direct therapeutic uses for reducing or controlling excess fat or body weight. Antibodies and other antagonists of these proteins, for example, fragments thereof, can be obtained and similarly applied to achieve the opposite effect. In this regard, the invention relates to pharmaceutical compositions containing the claimed polypeptide OB or, alternatively, its antagonist in a mixture with a pharmaceutically acceptable carrier or excipient.

In addition, the OB polypeptide obtained according to the invention can be used to provide cosmetic effects, for example, improving the appearance of the body by reducing body fat. The polypeptide OB can be used independently or in combination with other cosmetic techniques, for example, surgical, to achieve the desired results.

Diagnostic applications of these nucleotides and corresponding peptides also involve the use of nucleic acids to identify possible mutations or allelic variants of these compounds in order to expand the range of active nucleotide molecules useful in diagnosis and therapy. In particular, homozygous and heterozygous nucleotide mutations can be quantified and more accurately indicate any violation, identifying the possible degree of risk of individuals associated with obesity. More specifically, heterozygous mutations are currently considered to be associated with mild or moderate obesity, while homozygous mutations are associated with more severe and severe obesity. Appropriate DNA testing can be carried out using the above compounds as level markers to obtain an accurate long-term prognosis of certain trends, so that it is possible to predict changes in the diet and other individual habits of the individual or the nature of the immediate therapeutic intervention to eliminate the given disorders.

The diagnostic use of the present invention includes methods for determining the presence and level of the claimed modulators in cell samples or biological extracts (or samples) obtained from the respective individuals, so that the content of nucleic acids (genomic DNA or mRNA) and / or protein in such test samples can be determined . Taking into account that the increased activity of the nucleic acid and the presence of the corresponding protein reflects the body's ability to inhibit obesity, a doctor analyzing the results of such studies of a patient suffering from obesity will be able to conclude that the cause of obesity is more likely to be dysfunction, rather than the presence or increased activity nucleic acid obtained according to this invention. In contrast, lower levels of nucleic acid and / or expressed protein suggest that these levels may be elevated to treat this type of obesity, and an appropriate therapeutic system must be used.

In addition, the nucleotides shown in FIGS. 1A-E and 2A and B refer to cDNA, which, as briefly indicated above, is used to determine the corresponding RNA. Similarly, recombinant proteins corresponding to the polypeptides in FIGS. 1A-E and 3 are prepared and properly labeled for use, for example, in radioimmunoassays to determine the content of OB polypeptide in blood plasma or to determine the level of OB receptor in tissues, say, in the tissues of the hypothalamus. Further, the invention relates not only to the identification of nucleotides and corresponding proteins, but also to the identification of receptors of these compounds. In this context, the polypeptides shown in Fig.1A-E, 3, 5 and / or 6, can be obtained and used to screen the appropriate expression library for the allocation of active receptors. Then the receptors can be cloned and used alone or in combination with a ligand to select small molecules capable of exhibiting similar activity with respect to modulators.

The invention also relates to pharmaceutical compositions containing some of these modulators, preferably polypeptides with the sequences represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, as well as corresponding antibodies, small molecules agonists and antagonists or active fragments in a form suitable for various modes of administration with the necessary therapy. Such receptors may include pharmaceutically acceptable carriers or other adjuvants and be used in an effective dose, which is determined by a specialist in each case.

In accordance with the foregoing, the most important object of the present invention are modulators of body weight obtained in purified form, which have certain characteristics and properties that allow you to control and change the degree of obesity and fat content in mammals.

Other objects of the present invention relate to methods for determining and identifying weight control modulators, as indicated herein, for the purpose of efficiently diagnosing and monitoring pathological conditions when variations in the level of such modulators are, or may be, predictions for the future.

The invention also provides a method and an appropriate analytical system for screening compounds, for example, drugs, reagents, etc., which have the potential to mimic or inhibit the activity of the modulators obtained according to this invention in mammals.

Another object of the invention is a method of influencing mammals to control body weight and fat content and / or a method of treating certain pathophysiological conditions for which abnormal body weight (increased or decreased) is a characteristic feature.

The invention also relates to genetic constructs for use in gene therapeutic methods and / or pharmaceutical compositions for appropriate therapeutic methods that contain or are based on one or more modulators, a binding agent or reagent capable of controlling the formation of modulators or mimicking or counteracting their activity.

Other objects and advantages of the present invention for a person skilled in the art obviously follow from the above description, which is supported by references to the corresponding figures.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 (AE). The nucleotide sequence (SEQ ID NO: 1) and the derived amino acid sequence (SEQ ID NO: 2) corresponding to the mouse OB cDNA are shown. 39 bases of the leader sequence at the 5'-terminal site are connected to the predicted 167 amino acids of the open reading frame and about 3.7 kδ-untranslated sequence at the 3'-terminal site. (In the preliminary filed application of the series No. 08/347563 of 11/30/94 and the application of the series No. 08/438, 431 of 05/10/95, an additional 58 bases of the 5'-non-coding sequence were identified as a cloning artifact. This artifact did not affect the coding region, 39 bases 5'-non-coding region, shown here in Fig. 1, and 3'-non-coding region of the gene). A total of about 2500 bases of the 3'-untranslated sequence is shown. Analysis of the predicted protein sequence using the SigSeq computer program reveals the presence of a signal sequence (underlined). The microheterogeneity of the cDNA is manifested in such a way that approximately 70% of the cDNA has a glutamine codon at position 49 and 30% of the cDNA does not have such a colon (see FIGS. 5 and 6, below). This amino acid is underlined because it is an arginine codon mutated in ob / ob C57BL / GJ mice (1J mouse).

FIG. 2. (A and B). The nucleotide sequence (SEQ ID NO: 3) of human OB cDNA is shown. Nucleotides are numbered from 1 to 701 with a start site at nucleotide position 46 and a termination nucleotide at position 550.

FIG. 3. The complete predicted amino acid sequence (SEQ ID NO: 4) of the human OB gene corresponding to the nucleotide sequence of Figs. 2A and B is shown. The amino acids are numbered 1 to 167. The signal sequence cleavage site is located after amino acid 21 (Ala) so that the mature protein represented by amino acids 22 (Val) -167 (Cys).

FIG. 4. The predicted amino acid sequences of the mouse (SEQ ID NO: 2) and human (SEQ ID NO: 4) are compared. The predicted amino acid sequence of human OB has high homology with mouse. Conservative areas are indicated by a dotted line, and non-conservative areas are indicated by an asterisk. The variable glutamine codon is underlined; this is the position of the nonsense mutation in the sequence of C57BL / 6J ob / ob (1J) mice. At the amino acid level, 83% identity is observed, despite the fact that only 8 substitutions are found between valine at codon position 22 (“immediate” downstream position with respect to the signal sequence) and cysteine at position 117.

FIG. 5. A full-length amino acid sequence (SEQ ID NO: 5) is shown corresponding to the mouse OB gene shown in FIG. 3, but has lost glutamine at position 49. The amino acids are numbered 1 to 166. The signal sequence cleavage site is located after amino acid 21 (Ala) (and therefore, to deleted glutamine at position 49) so that the mature protein is represented by amino acids 22 (Val) -166 (Cys).

FIG. 6. Shown is the full-sized predicted amino acid sequence (SEQ ID NO: 6) corresponding to the human OB gene shown in FIG. 4, but lost glutamine at position 49. The amino acids are numbered from 1 to 166. The signal sequence cleavage site is located after amino acid 21 (Ala ) (and therefore, to the deleted glutamine at position 49) so that the mature protein is represented by amino acid 22 (Val) -166 (Cys).

FIG. 7. (A). Physical map of the location of ob in the chromosome of the mouse and YAC- and P1-cloning maps. “M” and “N” mean restriction sites for the endonucleases Mul I and Not I. The numbers correspond to individual animals recombinant in the ob region when counting 1606 meioses. Met, Pax-4, D6R ck 39, D6R ck 13, and CPA denote the positions of the ob region that bind to DNA samples. YACs were isolated with D6R ck 13 and Pax-4 as probes and the ends were restored using PCR (vectorette PCR) and / or end-saving plasmids and in turn used to isolate new YACs. (AT). YAC result set. One of the YACs, namely Y902A0925, is chimeric. Each of the samples that was used for genotyping of recombinant animals is enclosed in brackets. (6) corresponds to YAC 107; (5) corresponds to M16 (+) (or M16 (p LUS)); (4) corresponds to adu (+); (3) corresponds to aad (p ICL); (2) corresponds to 53 (p ICL); and (1) corresponds to 53 (+). (FROM). The P1 set of bacteriophage clones P1 was isolated using selective samples based on YAC ends. The ob gene was isolated from the P1 clone using the YAC YB6S2F12 distal end probe (end probe (4)) (alternatively referred to herein as adu (+)).

FIG. 8. Shown is a photograph obtained by staining with ethidium bromide 192 independent isolates in an experiment to “capture” the fourth exon, which was amplified by PCR and characterized.

FIG. 9. Shown is a photograph obtained by staining with ethidium bromide PCR-amplified clones, presumably bearing ob. Each of the 7 clones in which no artifact was detected was re-amplified by PCR and gel electrophoresed in 1% TBE agarose and stained with ethidium bromide. Size markers (the leftmost line not indicated by a number) is commercially available (“step” is 1 kb). Line 1-clone 1D12 containing the "HIV sequence". Line 2-clone 1F1, clone outside the ob-section. Line 3-clone 1H3. Line 4-clone 2B2, which is identical to 1F1. Line 5 is a clone of 2G7 that contains ob exon. Line 6-clone 2G11, which is identical to 1F1. Line 7 is a clone of 2H1 that does not contain an insert.

FIG. 10. The sequence of clone 2G7 (SEQ ID NO: 7) is shown, which contains an exon encoding a portion of the OB gene. The primer sequences that were used to amplify this exon are outlined in the figure (SEQ ID NO: 8 and 9).

FIG. 11. (A). Reverse transcriptional PCR analysis of mRNA of various tissues of the same mouse with 2G7 primers and actin primers. PT-PCR reactions were performed using 100 ng of total RNA, which was transcribed to form the first cDNA strand using oligo dT primer. PCR amplification was performed for 35 cycles. In each cycle, denaturation was carried out at 94 ° C for 1 sec; hybridization at 55 ° C for 1 sec; chain elongation at 72 ° C for 2 sec and self-extension at 72 ° C for 1 sec. RT-PCR products were run on a 2% low melting agarose gel in 1xTBE buffer. (AT). Northern blot of mRNA from various organs of the mouse obtained using a 2G7 probe labeled in PCR. Ten μg of total RNA from each tissue was subjected to formaldehyde agarose gel electrophoresis. The sample was hybridized at 65 ° C in a Rapid Hybe system (Amersham). Auto-holographic signals were clearly detected after 1 hour of exposure; The experimental results are shown 24 hours after exposure.

FIG. 12. (A). The results of staining with ethidium bromide RNA from fat cells (white adipose tissue) of each of these mouse lines subjected to the RT-PCR reaction are presented. Total RNA (100 ng) for each sample was reverse transcribed using oligo dT and reverse transcriptase and the resulting single stranded cDNA was amplified in PCR with 2G7 primers (lower bands) or actin primers (upper bands). Both 2G7 and active primers were included in the same PCR reaction. The products were dispersed in 1% TBE agarose gel. (AT). Northern analysis corresponding to (A). Ten μg of fat cell RNA (white adipose tissue) of each animal line was treated with a PCR-labeled 2G7 probe, as in FIG. 11B (see above). A clear approximately 20-fold increase in the level of 2G7 mRNA was detected in the RNA fraction from the white adipose tissue of C57BL / 6J ob / ob mice (line 1J) compared with the studied animals. In the RT-PCR and Northern experiments, no signal was detected in 2G7 RNA from SM / CKc- + ^Dac ob ²¹ / ob ²¹ (2J) mouse cells even after a 2-week exposure. Showing the results of a 24-hour exposure. The same filter was hybridized with an actin sample (lower portion of the panel).

FIG. 13. Northern analysis of additional 2J animals and control animals, which indicates the absence of ob mRNA in 2J animals. Northern analysis is shown in FIGS. 11 and 12. In this case, the control RNA is ap 2, a specific transcript of fat cells. No significant differences in the density of ap 2-bands were found.

FIG. 14. The DNA sequences of C57BL / 6J (normal) and C57BL / 6J ob / ob (1J) mice are compared in the region of a point mutation, resulting in the insertion of a stop codon of an immature sequence (nonsense mutation) in the cDNA of the mutant line. Ob / ob mice have a C → T mutation that “replaces” the arginine residue at position 105. This substitution is shown, as follows from the results of automatic DNA sequencing. RT-PCR is carried out using fatty cell RNA from both mouse lines (+ / - + and ob / ob) using 5 ′ and 3′-untranslated primers. PCR reaction products were purified by gel electrophoresis and directly sequenced manually and using an Applied Biosystems, Inc. automatic sequencer. 373A using primers corresponding to both strands of the coding sequence.

FIG. 15. (A). Southern blot of genomic DNA of each indicated mouse line. About 5 μg of DNA (genomic DNA of the liver, kidney, or spleen) was digested with the indicated restriction enzymes. Then, the DNA was subjected to electrophoresis on a 1% TBE agarose gel and was treated with a PCR-labeled 2G7 probe. Restriction cleavage of Bgl II is associated with an increase in size to about 9 kb (the largest size) of the Bgl II DNA fragment SM / Ckc- + ^Dac ob ²¹ / ob ²¹ (2J). RFLPs are not detected with any restriction enzyme. Preliminary restriction mapping of genomic DNA shows that the polymorphic Bgl II site is located in the upstream position (approximately 7 kb) relative to the transcriptional start site. None of the other enzymes studied “went beyond” the mRNA start site. (AT). Segregation of Bgl II polymorphism in the SM / Ckc- + ^Dac ob ²¹ / ob ^{21 line} . Six obese mice and five non-obese mice, descendants of the same generation of coisogenic animals SM / Ckc- + ^Dac ob ²¹ / ob ²¹ (2J), were genotyped by counting Bgl II polymorphism, as shown in Fig. (A). All animals with phenotypic obesity were homozygous for bulpey alleles of the polymorphic Bgl P fragment. DNA in the control “line” was obtained from the unrelated mouse SM / Ckc- + ^Dac + / +, separately obtained from the colony SM / Ckc- + ^Dac ob ²¹ / ob ²¹ .

FIG. 16. Southern blot of digested EcoRl genomic DNA of the listed animal lines using OB cDNA as a probe (ie, zoo blot). Hybridization signals were detected in each sample obtained from the vertebral, even after hybridization under moderately strong conditions. Cat DNA in this experiment was slightly degraded. Restricted DNA was gel dispersed in 1% TBE agarose and transferred to a membrane for interaction with samples. The filter was hybridized at 65 ° C and washed twice with 2xSSC / 0.2% SDS at 65 ° C for twenty minutes and exposed for 3 days with a film of (Kodak / Rochester, N. Y.) X-OMAT.

FIG. 17. The plot of the cloning expression vector pET-15b (Novagen) (SEQ ID NOs: 11 and 12) is shown.

FIG. 18. The results of a study of the eluate from a N-column (His-binding resin) for recombinant mature mouse ob fused to His-tag (A) and mature human OB fused to His-tag (B) are shown. Bacteria were transformed with the vectors pETM9 and pETH14, respectively. Upon induction of 1 mM IPTG under optimal conditions, transformed bacteria are capable of producing 100-300 μg / ml of fused OB protein, primarily in inclusion bodies. Inclusion bodies were solubilized with 6M guanidine-HCl or urea, and the fusion protein (contained in the supernatant) was layered on His-binding Ni-column resin in 10 ml of 1x urea binding buffer. The column was eluted stepwise with 5 ml aliquots of 20 mM, 60 mM and 300 mM imidazole and finally a cleaning buffer. Aliquots were then analyzed for the presence of the OB fusion polypeptide in a 15% acrylamide gel. Each line contains the equivalent of 100 μl of bacterial extract.

FIG. 19. (A). In vitro translation of OB RNA. Human OB cDNA was subcloned into the pGEM vector. The plasmid was linearized and the (+) RNA strand was synthesized using Sp6 polymerase. Synthesized in vitro RNA was translated in the presence or absence of microsomal pancreatic membranes of a dog. After in vitro translation, approximately 18 kDa primary translation product was detected. The addition of microsomal membranes to the reaction mixture led to the appearance of a second translation product of approximately 2 kDa less than the first translation product. The size of the translational product of interleukin RNA 1a, which lost the coding region of the signal sequence, did not change with the addition of microsomal membranes. These data indicate the presence of a functional signal sequence. (AT). In vitro translation in the presence and absence of proteinase K. Proteinase treatment leads to complete proteolysis of 18-kDa of the first translation product, while 16-kDa does not have a processed form of proteinase. Permeabilization of microsomes with 0.1% TRITON-X100 gives this form sensitivity to proteinase. The results indicate that the product was broadcast in the lumen of the microsome.

FIG. 20. (AE). The sequence of the human OB gene (SEQ ID NO: 22 and 24). (F). Schematic structure of the mouse gene OB. (G). Schematic structure of the human OB gene. In Fig. (F) and (G), the start and stop codons are underlined. There is no evidence in favor of homology of the first intron of the mouse gene and the first intron of the human gene, but this is not excluded.

FIG. 21. Schematic illustration of one of the cloning techniques to achieve recombinant expression of OM in Pichia yeast. (BUT). Expression vector OB with the signal sequence of the a-pairing factor. (AT). A schematic representation of the structure of a recombinant fusion protein comprising the amino acid sequence of SEQ ID NO: 26 with the Xho I site and putative KEX-2 and STE-13 cleavage sites and N-terminal additional amino acids located after KEX-2 (SEQ ID NO: 27 ) (FROM). An alternative strategy for obtaining mature OB includes obtaining a construct with the amino acid sequence corresponding to the Xho I cleavage site and the KEX-2 cleavage site in an immediate upstream position compared to the mature polypeptide sequence (SEQ ID NO: 28).

FIG. 22. Alternative expression strategy when using Pichia. (BUT). The expression vector of fused OB with His-tag borrowed from the pET expression system under the control of the factor a-pairing signal sequence (SEQ ID NO: 33). (AT). Schematic representation of the structure of a recombinant OB fusion protein containing His-megabyte, which includes the signal sequence of the α-mating factor sequence, putative KEX-2 and STE-13 cleavage sites, His-tag and thrombin cleavage site, which leads to OB with three additional N-terminal amino acid residues.

FIG. 23. (A). PAGE analysis of mouse OB expression (in microheterogeneous form, i.e., containing and not containing Gln 49) in transformed Pichia yeast cells. The expected band of about 16 kDa is visualized in the culture fluid of transformed yeast cells (second and third lines), but not in the culture fluid of untransformed yeast cells (first line). (AT). PAGE analysis of partially purified (on carboxyl cellulose) OB polypeptide (weak ion-exchange column). On fractions 3 and 4 obtained from the column, a band of about 16 kDa is clearly visible. Fractions elute with 250 mM NaCl. Line 1-applied sample; line 2-passage flow; lines of 3-5 fractions eluted with 250 mM NaCl.

FIG. 24. The circulation of OM protein in mouse plasma is shown. (BUT). Immunoprecipitates from mouse blood 0.5 ml of mouse blood plasma was preliminarily clarified on unconjugated sepharose and incubated overnight with immuno-purified anti-OB antibodies conjugated with 4B Sepharose granules. The immunoprecipitate was separated in a 15% SDS-PAGE gel, transferred and subjected to Western blotting with anti-OB antibodies. Protein migrated in the area of the pier. masses of about 16 kDa, as well as mature mouse ob protein expressed in yeast cells. The protein was absent in the blood plasma of C57BL / 6J ob / ob mice and was found to be tenfold in the blood plasma of C57BLB / Ks db / db mice compared to wild-type animals. It is assumed that mouse db are distinguished by overproduction of the OB protein, having secondary resistance to its effects. (AT). Increased OB levels in obese rats. Rats are obese due to a recessive mutation in chromosome 5. Genetic data suggest a defect in the same gene that mutated in db mice. The blood plasma of obese rats and non-obese single litters was immunoprecipitated and examined in Western blotting. In mutant animals, a twenty-fold increase in the circulating level of the OB polypeptide was detected. (FROM). The amount of OB protein in mouse plasma. An increased amount of recombinant mouse protein was added to 100 1 ob mouse plasma and immunoprecipitated. The signal intensity on Western blots was compared with that in 100 1 plasma of wild-type mice. A linear increase in signal intensity was observed with an increase in the amount of recombinant protein, indicating that immunoprecipitation was carried out under conditions of excess antibodies. Similar signals were observed in the plasma sample from wild-type animals and in the sample with 2 ng of recombinant protein, revealing a circulating level in mouse plasma in the amount of about 20 ng / ml. (D) OB protein in adipose tissue extracts. Mouse adipose tissue cytoplasmic extracts were obtained from db and wild type animals. Western blots show increased levels of 16 kDa protein in extracts obtained from db mice.

FIG. 25. Shown are the variations in the levels of circulating OB protein in human blood plasma. (BUT). Western blots of human blood plasma. Plasma samples were obtained from six non-obese volunteers. Immunoprecipitation and Western blotting revealed the presence of an immunoreactive 16 kDa protein, identical in size to the recombinant human protein of 146 amino acids, which is expressed in yeast cells. In each of the six samples, different levels of protein are detected. (AT). ELISA (linked enzyme immunoassay) ob person. Microtiter panels were coated with immuno-purified antibodies to human OB. Known amounts of recombinant protein were added to the panels and detected using immuno-purified biotinylated anti-ob antibodies. To obtain a standard curve, absorbance was set aside at 414 nm against known OB concentrations. The resulting standard curve indicates that the method is capable of detecting 1 ng / ml or more of human OB protein. (FROM). The amount of OB protein in human plasma. ELISA was performed using 100 1 blood plasma from six non-obese volunteers and the standards used in the study of panel B. The protein OB levels ranged from 2 ng / ml in HP1 to 15 ng / ml in HP6. The indicated data correlate with the results of Western blotting of panel A.

FIG. 26. The formation of intramolecular and intermolecular disulfide bonds in the OM protein has been shown. (BUT). Western blotting in restorative and non-restorative conditions. Western blotting of human and mouse blood plasma was repeated with and without the addition of reducing agents to the sample buffer. When b-mercaptoethanol was excluded from the sample buffer, immunoprecipitate from plasma db migrated in the area of a pronounced mole. masses of 16 kDa and 32 kDa. The addition of b-mercaptoethanol to the buffer led to the disappearance of mobility in the region of 32 kDa (see Fig. 24). The indicated result was reproduced when mouse protein was expressed in Pichia pastoris yeast cells. In this case, the mouse protein migrated at the dimer position. Under reducing conditions, the purified recombinant mouse protein migrated in the region of an explicit mole. mass of 16 kDa, indicating that the molecular form of 32 kDa is formed as a result of the formation of one or two intermolecular disulfide bonds. The human protein expressed in vivo and in the cells of the yeast Pichia pastoris migrates in the mol. masses of 16 kDa in both reducing and non-reducing conditions (results not shown). (AT). A human protein expressed in yeast contains an intermolecular disulfide bond. Secreted proteins generally accept the necessary conformation when expressed in the Pichia pastoris yeast cell system. The 146 amino acid mature human protein is expressed in Pichia pastoris cells and purified from the culture medium by a two-step method including IMAC and gel filtration. The purified recombinant protein is subjected to mass spectrometry before and after bromine cleavage. Bromocyan cleaves the protein at the carboxyl terminal portion of the methionine residue. The molecular weight of the recombinant "yeast" protein is 16.024 ± 3 Da (calculated mol. Mass is 16.024 Da). Bromocyan acts on three methionine residues in the protein sequence at positions 75, 89 and 157. The resulting fragments with a measured mass of 8435.6 Da correspond to amino acids 90-157 and 158-167 connected by a disulfide bond between cys-117 and cys-167 (calculated molar mass is 8434.5 Yes). N. D. means "not determined."

FIG. 27. Obtained biologically active recombinant protein. The nucleotide sequence corresponding to the 145 amino acid sequence of the mature mouse OB protein was cloned into the pET 15b expression vector. The pET vector contains an insert from the polyhistidine sequence (His tag) in the upstream position relative to the cloned sequence, allowing efficient purification using Immobilized Metal Affinity Chromatography (IMAC). Recombinant bacterial protein was initially isolated from the insoluble membrane fraction after bacterial lysis. The membrane fraction was solubilized with guanidine chloride and layered on an IMAC column. The protein was eluted with stepwise increasing concentrations of imidazole (as shown in the Figure). The structure of the eluted protein was restored and treated with thrombin to remove His-tag, as described below. The final soluble protein yield was 45 ng / ml bacterial culture.

FIG. 28. The biological effect of the OM protein is shown. The temporary course of food intake (panels A-C) and body weight parameters (panels D-F). Groups of ten animals received daily peritoneal injections of protein OB at a dose of 5 mg / kg / day (filled squares), daily injections of PBS (filled circles) or did not receive injections (filled triangles). The “treated” groups included C57Bl / 6J ob / ob mice (panels A and D), db / db C57Bl / Ks mice (panels B and E) and CBA / J + / + mice (panels C and F). Food intake was recorded daily, and body weight was determined at intervals of 3-4 days. (The body weight scale in grams of wild-type mice differs from that of ob and db mice). Food intake of ob mice that received protein decreased after the first injection and stabilized after the fourth day at about 40%, as can be seen in the diagram corresponding to this group (who received the injection) (p <0.001). The body weight of these animals decreased on average by 13 g / day and stabilized after three weeks to a level corresponding to approximately 60% of the initial (p <0.0001). No protein effect was seen in db mice. A small but important effect on body weight was observed in CBA / J mice at two earlier time points (p <0.02). The standard error of each measurement is shown by an arrow and the statistical significance of the results is shown in Table 1.

FIG. 29. The results of the “pair feeding” experiment of mice are presented. (BUT). A group of four C57Bl / 6J ob / ob mice was fed an amount equivalent to that consumed by a group of ob mice receiving recombinant protein. The weight loss of animals of both groups was determined after five, eight and twelve days. Mice restricted in food lost less (dashed arrows) in weight than ob mice that received protein (solid arrow) (p <0.02). The results obtained indicate that the weight-decreasing effect of the OM protein depends on both the amount of food consumed and the energy expenditure. (AT). Photograph of the "processed" mouse ob. Two C57BL / 6J ob / ob mice are shown. The left mouse received PBS and weighs 65g, i.e. has initial weight. The right mouse received daily injections of recombinant protein OB. The initial weight of this animal was also 65 g, and after a three-week injection of protein was reduced to 38 g. (FROM). Liver of “treated” and “untreated” ob mice (C57BL / 6J ob / ob mice). The liver of an animal treated with PBS has the obvious appearance of the liver of an obese animal and weighs 5.04 g. The liver of the mouse that received the recombinant protein ob has a “normal” appearance and weighs 2.23g.

FIG. 30. In situ hybridization of adipose tissue of mouse ob. The sense and antisense RNA ob was labeled in vitro with Sp6 and T7 polymerase and digoxygenin. Labeled RNA was hybridized with paraffin-embedded sections of adipose tissue from adipose lumps of the epididymis of eight-week old C57BL / KS mice (wild type) and C57BL / Ks db / db mice (db mice). In the figure, fat droplets are visible as unpainted vacuoles inside the cells. The cytoplasm has the appearance of a thin rim along the periphery of the cells and is indistinguishable from the cell membrane. Hybridization with all adipocytes in the field of view was detected in sections of tissue from wild-type animals only using an antisense test, and significantly increased levels can be seen in tissue sections of db / db animals.

FIG. 31. It was shown that RNA OB is expressed in adipocytes in vivo and in vitro. The total fraction of RNA (10 μg) from several different sources is subjected to electrophoresis and blotting and hybridizes with an ob sample. First of all, differences in buoyancy of cells after collagenase treatment are used to purify alipocytes. Ob RNA is found only in the alipocyte fraction. Line S is the stromovascular fraction, line A is the alipocyte fraction. Moreover, OB RNA is not expressed in undifferentiated 3T3-442 preadipocytes (U line). Differentiated adipocytes of the same cell line express clearly detectable levels of OB mRNA (line D).

FIG. 32. It has been shown that OB RNAs are expressed in all adipose tissue depots that were tested for expression of ob RNA. In inguinal fat cells, RNA is expressed at a slightly lower level, although variability in signal level is detected in various experiments (Figure 31A). Lines (1) (2) (3) (4) respectively indicate the fatty lumps of the appendages of the testis and inguinal region, as well as the abdominal and parametric fatty lumps. In brown adipose tissue, a low level of OB RNA is also expressed (Figure 31B). The level of OB expression in brown adipose tissue does not change with a fat content of one week at 4 ° C, while the expression of brown specific adipose tissue UCP RNA (it is known that its expression is induced by cold) increases five-fold.

FIG. 33. The expression of OB RNA in db / db and mice treated with gold thioglucose is shown. The total RNA fraction from the parametric fat lumps of the “treated” with gold thioglucose (GTG) and db / db mice was subjected to electrophoresis and Northern blotting. A single dose of GTG is known to cause obesity through specific hypothalamic lesions. (BUT). One month old CBA female mice were injected with GTG (0.2 mg / kg) with a resulting increase of up to more than 20 g in the “treated” animals compared to the control (<5 g). (AT). Hybridization of db / db OB-RNA probes and GTG-treated mice showed a twenty-fold increase in ob RNA content relative to control RNA (actin or GAPDH).

FIG. 34. The results of Northern blotting of human RNA. Northern blots containing 10 mg of total RNA from human adipose tissue (FAT, panel A) and 2 mg of polyA + RNA from other human tissues (panel B) were hybridized with samples based on human ob or human β-actin, as shown. When using total RNA of adipose tissue, an intense signal was detected in the region corresponding to approximately 4.5 kb. Hybridization of polyA + RNA produces detectable signals in the tissue of the heart (HE) and placenta (PL), while OB RNA is not detected in the brain (BR), lungs (LU), liver (LI), skeletal mice (SK), kidney (KI) and pancreas (RA). In each case, the time of the autoradiographic exposure is indicated. The origin of low molecular weight chains in the fraction of placental RNA is unknown (alternative splicing, RNA degradation, etc.).

FIG. 35. A YAC kit (contig) is shown containing the human OB gene and 8 microsatellite markers. A YAC-based STS map of a region of chromosome 7 including the human OB gene is shown, as predicted by SEGMAP / Version 3.29 (Green et al., PCR Methods Applic., 1: 77-90 (1991)). The top shows 19 uniquely located STSs (see Table 3). Eight microsatellite-specific STSs are marked with asterisks (see Table 4). STSs corresponding to the Pax 4 and OB genes are also shown, as are the predicted centromere (CEN) and 7q-telomere (TEL) positions with respect to the contig. Each of the 43 YAC clones is marked with a horizontal arrow, their designations are shown on the left, and the established YAC size (in kb, determined by pulse electrophoresis in gel) is enclosed in brackets. The presence of STS in YAC is indicated by a solid circle in the corresponding position. When the STS corresponds to the end insert YAC, the desired circle is enclosed in a square; both the square and the circle are placed on top (near the designation STS) and in the end region YAC from which this STS is obtained. For 5 YACs at the bottom of the diagram (below the horizontal dashed line), the presence of one or more STSs assumed to be based on the established order of STS (as shown by testing individual YACs using the corresponding STS-specific PCR analysis performed at least twice) is not detected. These YACs are indicated by open circles in their respective positions. Most YACs were isolated from a hybrid human / hamster cell library (Green et al., Genomics, 25: 170-183 (1995)); Original designations of YACs data are given. The remaining YACs were isolated from the common human genomic library; their initial position in the library is given in Table. 3. The designations of the three YACs (yWSS691, yWSS999, yWSS2935), which are mapped to 7q31.3 using FISH analysis, are outlined in rectangles. The contig is presented in “non-calculated” form when the YAC dimensions were not used to estimate clone overlap or spatial location of the STS, and all STSs are therefore shown to be equally spaced from each other. In “calculated” form, when the sizes of the YACs were used to estimate the relative distance separating each pair of neighboring STSs, as well as the degree of overlap of the clones, the total contig of the YACs appears to be about 2 Mb.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to the discovery of a protein called the ob polypeptide or leptin, nucleic acids encoding a protein, including variants based on the degeneracy of the genetic code, for example, including optimal codons for expression of the polypeptide in a given system, and this polypeptide has the ability to participate in controlling body weight of mammals. Nucleic acids have sequences corresponding to the human and mouse OB polypeptide, which plays a major role in the regulation of body weight and obesity. The information provided here shows that the polypeptide product of the claimed nucleic acid is secreted by the cells expressing it, and the polypeptide functions as a hormone. Additional experimental evidence suggests that the OB polypeptide is extremely effective in treating obesity in mice with a mutation in the ob gene. In addition, high single or medium constant doses of OB polypeptide reduce the weight of normal (wild type) mice.

Moreover, the Examples given here show that the OB polypeptide, also called leptin, circulates in the blood of mice, rats and humans. Leptin is not detected in the blood plasma of ob / ob mice and is detected in more than tenfold concentrations in the blood plasma of db / db mice and in more than twenty times the concentration in fa / fa rats. Daily injections of recombinant leptin significantly reduce the body weight of ob / ob mice, significantly affect the body weight of wild-type mice, and do not affect db / db mice.

The OB polypeptide of an animal species is active against other species. In particular, the OB polypeptide is active in mice.

First of all, the invention is directed to the identification of compounds that function as modulators of mammalian body weight. In particular, the invention relates to the isolation, purification and sequencing of certain nucleic acids corresponding to the human and mouse OB gene or its coding region, as well as to polypeptides encoded by these nucleic acids. Thus, the invention includes the detection of nucleic acids having the nucleotyl sequences shown in FIGS. 1A-E (SEQ ID NO: 1) and FIGS. 2A-B (SEQ ID NO: 3), as well as their variants derived from degeneracy genetic code, alleles and fragments with the ability to modulate body weight and obesity. The correspondence of nucleic acids to the OB gene indicates their significant contribution to the development of conditions, for example, obesity, as well as other dysfunctions and disorders for which deviations in body weight are of particular importance. The invention also relates to a protein expressed using these nucleic acids, and in particular to the proteins shown in FIGS. 1A-E (SEQ ID NO: 2), FIG. 3 (SEQ ID NO: 4), FIG. 5 (SEQ ID NO: 5) and FIG. 6 (SEQ ID NO: 6), as well as their conservative variants, active fragments and related small molecules.

As noted earlier, peptides modulating body weight or binding partners or other ligands or agents exhibiting antagonistic properties, mimicking the activity of these modulators, or controlling their formation, can be included in pharmacological compositions containing a suitable carrier in an effective amount for administration to a patient in various ways deviating from normal body weight or obese as such or due to other disorders, such as AIDS and cancer, for the purpose of treating . Various methods of administration can be used, for example, oral, nasal or other forms of administration through the mucous membranes, parenteral (subcutaneous, intravenous and intraperitoneal), the use of catheters, etc. The average doses of introduced factors and their subunits can vary and, in particular, based on recommendations and the instructions of qualified doctors and veterinarians.

Accordingly, analysis systems can be obtained for screening potential drugs effective to mimic or counteract the activity of weight modulators. The weight modulator can be introduced into the test system, and the test drug can be introduced into the culture medium, and the culture medium is then examined for any changes in cell activity due to both the addition of the drug itself and quantitative doses of the known weight modulator.

As noted earlier, molecular cloning of the OB gene has led to the identification of a specific class of compounds that function at the molecular level, modulating the body weight of mammals. The discovery of modulators according to the invention is important for the diagnosis and treatment of diseases associated with eating disorders, such as obesity, cancer-related weight loss, and the treatment of diseases associated with obesity, such as heart disease, hypertension and type II diabetes . In addition, there may be potential agricultural uses of the gene product in cases where the body weight of domestic animals should be modulated. Finally, since one or more of the modulators of the invention are secreted molecules, they can be used for biological purposes to isolate an appropriate receptor based on an expression cloning technique. The discussion regarding the OB gene confirms the possibility of using a whole class of modulators that are part of the present invention and allows for the existence of various interpretations within the scope of the invention.

As noted above, the functional activity of the OB polypeptide can be evaluated by obtaining an experimental model of transgenic animals. The ob gene is used in complementation studies in transgenic mice. Transgenic vectors, including viral vectors or cosmid clones (or phage clones) corresponding to the locus of the wild-type candidate candidate gene, can be constructed using the ob gene. Cosmids can be introduced into transgenic mice using known techniques (Jaenisch, Science, 240: 1468-1474 (1988)). The constructs are also introduced into fertilized eggs obtained by crossing F1 animals obtained from crossing mice C57BL / 6J ob / ob and DBA. These crosses require the use of animal ovarian transplants C57BL / 6J ob / ob to obtain generation F1. DBA / 2J mice are used as a “partner” because they have a non-agouti color, which is important when using ovarian transplants. Genotyping of the ob locus in cosmic transgenic animals can be carried out by typing animals with tightly coupled RFLPs or microsatellites that are polymorphic in the original mouse lines. Complementation will occur when a particular construct reports to genetically obese animals F2 (as detected by the RFLP analysis) "non-obesity" and "non-diabetic." Under these conditions, the final proof of complementation will require that animals of the ob / ob or db / db phenotype carrying the transgene mate with ob / ob or db / db animals carrying ovarian transplants. In this cross, all N2 animals that do not have a transgene will suffer from obesity and insulin-independent diabetes, while animals carrying a transgene will be of normal weight with a normal concentration of glucose and insulin in the blood plasma. From a genetic point of view, the transgene functions as a suppressor of the mutation. Alternatively, OB genes can be tested by studying the corresponding phenotypic effects when these genes are expressed in antisense orientation in wild-type animals. In this case, the expression of the wild-type allele is suppressed, which leads to a mutant phenotype. The formation of an RNA · RNA duplex (antisense / sense) prevents the normal functioning of mRNA, leading to partial or complete elimination of the effect of the wild-type gene. This technology has been used to inhibit TA synthesis in tissue culture and to obtain the phenotype of the Kruppel mutation in Drosophila and Shivever mutations in mice (Izant et al., Cell, 36: 1007-1015 (1984); Green et al., Annu. Rev. Biochem. 55: 569-597 (1986); Katsuki et al., Science, 241: 593-595 (1988)). An important advantage of this approach is that only a small portion of the gene is necessary for the manifestation of effective inhibition of the expression of all mRNA. The antisense transgene is placed under the control of its own promoter or other promoter expressed in cells of the appropriate type and located in the upstream position of the SV40 polyA site. The specified transgene is used to obtain transgenic mice. Ovarian transplants can be inoculated with transgenic mice to determine if ob heterozygotes are more sensitive to antisense construct effects.

Elucidation of the biological function of the OB gene product (polypeptide or OB protein) is important for identifying small molecules of agonists and antagonists that affect its activity.

The following are examples of some of the definitions used in this description.

The concept of “body weight modulator”, “modulator”, “modulators” and any variants of these concepts that are not specifically listed here can be used interchangeably, and in the present description and formula, primarily, nucleotides and protein compounds are designated. The latter include homogeneous and complex proteins. More specifically, the above concepts refer to nucleotides and DNA having the sequences described herein shown in FIGS. 1A-E (SEQ ID NO: 1) and FIGS. 2A and B (SEQ ID NO: 3). In addition, these concepts include proteins with the amino acid sequence described herein shown in FIGS. 1A-E (SEQ ID NO: 2) and FIG. 3 (SEQ ID NO: 4) as having the activity of the compounds described in the description and formula. Accordingly, these concepts include nucleotides having substantially equivalent or altered activity, including homologous analogs and allelic variants. Further, these concepts refer to proteins having substantially equivalent or altered activity, in particular, proteins modified by site-directed mutagenesis or subjected to unexpected mutations in host organisms producing modulators.

A composition containing “A” (where “A” is a homogeneous protein, DNA molecule, vector, recombinant host cell, etc.) is practically free of “B” (where “B” includes one or more contaminating proteins, DNA - molecules, vectors, etc., but does not apply to racemic forms A), when at least about 75% by weight of proteins, DNA, vectors (depending on the type of compounds to which A and B belong) in the composition represents A. Preferably "A" contains at least about 90% by weight of A + B in the composition, most preferably p at least 99% by weight. It is also desirable that the composition, which is substantially free of contaminating impurities, contains only compounds of a certain mass having activity or properties of the compounds of interest.

OB polypeptides

The terms “protein” (natural polypeptide) and “polypeptide” are used interchangeably herein with respect to the product of the ob gene and its variants. The terms “mature protein” or “mature polypeptide” refer to an OB gene product with a deleted signal sequence or fusion protein.

As noted above, specific ob polypeptides of the invention include compounds having the amino acid sequences shown herein, for example, the amino acid sequences of SEQ ID NO: 2, 4, 5, b, etc. The claimed ob polypeptides also include biologically active fragments, analogs and derivatives of polypeptides modified with amino acid substitutions. The term "biologically active" means that the polypeptide exhibits a specific effect that includes (but is not necessarily limited to) specific binding, for example, to a receptor, antibody, or other recognition molecule; activation of transduction signaling pathways at the molecular level; and / or induction (or inhibition by antagonists) of physiological effects mediated by the native in vivo ob polypeptide. OB polypetides, including fragments, analogs and derivatives, can be obtained synthetically, for example, using well-known methods of solid-phase and liquid-phase peptide synthesis. The use of solid phase techniques is preferred. Alternatively, the claimed OB polypeptides can be obtained using well-known genetic engineering techniques, as described below. In addition, the OB polypeptides can be purified, for example, by the immunoaffinity method, from a biological fluid, such as (but not limited to) plasma, serum, urine, preferably plasma, serum or urine of a person and more preferably an individual in whose body overexpression of the polypeptide is detected, for example, an obese person who develops as a result of an OB receptor mutation or a mutation leading to an accumulation of excess fat.

Fragments of the OB polypeptide

In a particular embodiment, natural fragments of the OB polypeptide may be important. In the polypeptide sequence there are numerous sites that are sites of proteolytic cleavage, for example, arginine residues. It is possible that a full-sized polypeptide can be cleaved at one or more of these sites with the formation of biologically active fragments. Such biologically active fragments may be agonists or antagonists of the functional activity of the OB polypeptide to reduce body weight.

Analogues of OB polypeptide

The present invention relates to the production of analogues of the peptide OB, which are characterized by the biological activity of the OB polypeptide, for example, binding to a specific binding partner of the ob peptide, for example, an OB receptor. In one case, the analogue is an agonist of OB activity, i.e. its functions are similar to the functions of the ob polypeptide. Preferably, the OB agonist is more effective than the native protein. For example, an OB analog agonist can bind an OB receptor with higher affinity or have a longer in vivo half-life or exhibit both of these properties. However, the scope of the present invention includes agonist analogues of the peptide OB, which are less effective than the native protein. In another case, the analogue is an antagonist of OB activity. For example, the OB analogue, which binds the OB receptor but does not induce signal transduction, is able to competitively inhibit the binding of the native OB to the receptor, thereby reducing the activity of the OB in vivo. Such an antagonist analogue of OB may also exhibit properties different from the peptide ob, for example, have a longer (shorter) in-vivo half-life, stronger (or less strong) binding affinity for the OB receptor, or both of these properties.

In one embodiment, the OB peptide analog is an OB peptide modified with amino acid substitutions at positions that are not necessary for structure and function. For example, since the OB peptide is known to be biologically active in mice, substituting divergent amino acid residues in the human sequence compared to the mouse amino acid sequence will yield useful analogs of the OB peptide. For example, the serine residue at position 53 or 98 or both positions (see the unprocessed peptide sequence in Figure 4), human sequences can be replaced, for example, with glycine, alanine, valine, cysteine, methionine or threonine. Similarly, the arginine residue at position 92 (Figure 4) may be substituted, for example, with asparagine, lysine, histidine, glutamine, glutamic acid, aspartic acid, serine, threonine, methionine or cysteine. In accordance with FIG. 4, other amino acids in the human OB peptide that are likely to be substituted are the following: histidine at position 118, tryptophan at position 121, alanine at position 122, glutamic acid at position 126, threonine at position 127, leucine at position 128, glycine at position 132, glycine at position 139, tryptophan at position 159, and glycine at position 166. Alternatively, one or more residues may be substituted at positions 121-128 (as shown in FIG. 4), for example, glycine or alanine or some of these attacks, with the exception of serine at position 123 or leucine at position 125. In addition, the analogue of the OB polypeptide, preferably a human polypeptide, is a truncated form of the polypeptide. For example, it is shown that glutamine at position 49 is not necessary and can be deleted. Similarly, some or all divergent amino acid residues at positions 121-128 can be deleted. The invention also relates to an OB analogue having a minimum amino acid sequence necessary for the implementation of biological activity. This can be easily determined, for example, by testing the activity of the OB fragments for the ability to bind to the antibodies specific for OB, to inhibit the activity of the native OB polypeptide or to act as agonists of the activity of the native OB peptide. In addition, the invention relates to a truncated OB polypeptide having a loop structure formed by a disulfide bond that forms between cysteine residues at positions 117 and 167 (as shown in FIG. 4). The truncated analog can correspond to amino acids at positions 22 (a possible cleavage site of the signal sequence from the peptide) to 53 (the amino acid residue immediately preceding the portion of the mobile loop detected by limited proteolysis followed by mass spectrometry of the OB polypeptide; see Cohen et al., Protein Science, 4: 1088 (1995)). Otherwise, the truncated analog corresponds to amino acids at positions from 61 (the residue immediately following the portion of the mobile loop, as determined by the limited proteolysis / mass spectrometric analysis of the OB polypeptide) to 116 (the residue immediately preceding the first cysteine residue). In another embodiment, the truncated analogue corresponds to amino acids at positions 61-167.

Further, one or more residues of the intended movable loop at positions 54-60 may be substituted. For example, one or more residues may be substituted with lysine, glutamic acid or cysteine (preferably lysine) for cross-linking, for example, with a polymer, since a mobile loop structure is a preferred protein modification site. Alternatively, residues at the positions on the mobile loop can be replaced by amino acid residues that are more resistant to proteolysis, but do not allow the existence of a mobile structure, for example, one or more prolines. The invention also relates to analogues of the OB polypeptide, in which further amino acid substitutions can be made, giving the modified polypeptides greater resistance to degradation, for example, proteolytic cleavage.

It is clear to the person skilled in the art that the above fragment sizes are approximate and can be added or deleted from one to five amino acids in each or both of the root sites or in the inner region of the polypeptide or fragment of the truncated analogs, except that in the loop connected by a disulfide bond cysteine residues should be preserved.

It was found that the mouse OB peptide contains 50% α-helices, and the human OB polypeptide contains about 60% α-helices (the circular dichroism method of recombinant peptides under similar conditions). Accordingly, in another embodiment, the amino acid residues can be substituted to form OB analogues of the polypeptide having enhanced ability to form, for example, more stable α-helical structures. For example, an α-helical structure is preferred when Glu, Ala, Leu, His, and Trp are used as substituents of the amino acid residues of the native OB polypeptide. It is also preferable to use conservative amino acid substitutions, for example, aspartic acid at positions 29, 30, 44, 61, 76, 100 and / or 106 (as shown in FIG. 4) with glutamic acid (Glu); substitution of isoleucine for leucine; replacing glycine or valine or any divergent amino acid with alanine (for example, the serine at position 53 of the human OB polypeptide is replaced with alanine); substitution of arginine or lysine for histidine; and substitution of tyrosine and / or phenylalanine for tryptophan. An increase in the stability of the α-helical structure can contribute to the production of the OM analogue with a higher activity, increased binding ability, or longer half-life. In one embodiment of the invention, the ability to helix the portion of the OB peptide corresponding to amino acid residues 22-53 is increased. In another case, the ability to form spirals or the stability of the portion of the peptide corresponding to amino acids 61-116 is increased. In yet another embodiment of the invention, the ability to form spirals of a loop structure with a disulfide bond corresponding to amino acids 117-167 is increased. The invention also relates to OA analogues having an increased ability to form α-helices or stability, which characterizes more than one of the above domains. In addition, truncated polypeptide analogs of OM containing amino acid residues forming structures, for example, helices, were obtained to compensate for the ability of polypeptide fragments to lose a stable structure.

Analogs, for example fragments, can be obtained by cleaving peptide modulators with pepsin. Other analogues, say, muteins, can be obtained by standard site-directed mutagenesis of sequences encoding peptide weight modulators. Analogs exhibiting the activity of weight modulators, such as small molecules that function as promoters or inhibitors, can be identified by known in vivo and / or in vitro methods.

Small analog molecules and peptidomimetics of the OB polypeptide

The ob structure of the polypeptide, preferably human OB polypeptide, can be studied by various methods known in the art. The protein sequence can be characterized by hydrophilicity (see, for example, Norr et al., Proc. Natl. Acad. Sci. USA, 78: 3824 (1981)). The hydrophilicity profile can be used to identify hydrophilic and hydrophobic regions of the OM polypeptide, which can be used to identify areas directed to the external environment. In addition, a secondary structure analysis can be performed (see, for example, Chou et al., Biochem., 13: 222 (1974)) to identify regions of the OB polypeptide having a specific secondary structure. Manipulations with a predicted or defined structure, including a predicted secondary structure, can be performed using known programs on floppy disks.

Recognizing the existence of numerous sources of recombinant OM polypeptide, the present invention allows to quantify the structure of the polypeptide. In particular, there is a sufficient amount of material for the implementation of nuclear magnetic resonance (NMR), infrared (IR), Raman and ultraviolet (UV), spectroscopic analysis, in particular based on circular dichroism (CD). NMR analysis is a very effective structural analysis of molecules in solution, i.e. in an environment as close as possible to the natural environment of the molecules (Marion et al., Biochem. Biophys. Res. Comm., 113: 967-974 (1983); Bar et al., J. Magn. Reson., 65: 335-360 (1983); Kimura et ai, Natl. Acad. Sci. USA, 77: 1681-1685 (1980)). Other structural analysis methods may be used. They include, for example, crystallography using x-rays, but are not limited to (Engston, Biochem. Exp. Bid., 11: 7-13 (1974)).

In yet another embodiment, an analog of an OB polypeptide can be tested for the ability to cross-interact with an antibody specific for a native OB polypeptide or fragments thereof. The degree of cross-reactivity allows us to judge the structural homology or similarity of proteins or the accessibility of sites corresponding to regions of the polypeptide that cause the formation of antibodies specific to the fragments.

Screening of analogue OB

Numerous screening methods for polypeptide analogs are known. Various libraries of chemical compounds are available. Accordingly, the present invention relates to screening such libraries, for example libraries of synthetic compounds obtained over years of research, libraries of natural compounds and mixed libraries, as described in detail below, to identify analogues of the OB polypeptide. In one case, the invention includes screening such libraries for the selection of compounds that bind antibodies to the OB polypeptide, preferably antibodies to the human ob polypeptide. In another case, since an OB receptor has been identified (see below), any known screening method can be used to identify OB receptor agonists or antagonists. The invention also relates to screening small ligand molecules, or analogs of ligands, or mimetics, as well as screening for natural ligands that bind an OB receptor in vivo, or representing its agonists or antagonists.

Knowledge of the primary sequence of the receptor and the degree of similarity of this sequence with proteins of known function can play a decisive role in identifying protein agonists or antagonists. Identification and screening of antagonists can be supplemented by studying the structural properties of the protein, for example, using x-ray crystallography, neutron diffraction, spectrometry based on nuclear magnetic resonance and other methods for studying the structure of proteins. These methods provide the rational design or identification of agonists or antagonists.

Another approach uses recombinant bacteriophages to obtain large libraries. Using the phage method (Scott et al., Science, 249: 386-390 (1990); Cwirla et al., Proc. Natl. Acad. Sci. USA, 87: 6378-6382 (1990); Devlin et al ., Science, 249: 404-406 (1990)) can be obtained large libraries (10 ⁶ -10 ⁸ chemical "entities"). You can use direct chemical methods, examples of which are the Heisen method (Geysen et al., Molecular Immunology, 23: 709-715 (1986); Geysen et al., J. Immunologic Method, 102: 259-274 (1987)) and the newly developed Fedor method (Fodor et al., Science, 251: 767-733 (1991)). Describes numerous methods of producing a mixture of peptides that can be tested as agonists or antagonists (Furka et al, 14 ^th International Congress of Biochemistry, Volume 5, Abstract FR: 013 (1988); Furka, Int J. Peptide Protein Res, 37... : 487-493 (1991); Houghton (U.S. Patent No. 4,631,211, issued in December 1986); and Rutter et al., (U.S. Patent No. 5010175, issued April 23, 1991)).

Another embodiment of the invention involves the use of synthetic libraries that screen for the presence of OB receptor ligands in accordance with this invention (Needeles et al., Proc. Natl. Acad. Sci. USA, 90: 10700-10704 (1993); Lam et al ., PCT Published Application 92/00252; all sources of information are incorporated herein by reference). Using these libraries, receptor antagonists can be detected using cells expressing the receptor without directly cloning the OB receptor.

Alternatively, a study of the binding of a soluble ligand to cells expressing recombinant forms of the ligand binding domain of the OB receptor can be carried out. Soluble ligands can be obtained by known methods, as a recombinant or synthetic OB polypeptide.

Screening can be performed using recombinant cells that express the OB receptor or, alternatively, using a purified receptor protein, for example, obtained recombinantly, as described above. For example, the ability of a labeled, soluble, or solubilized OB receptor, including a ligand-binding portion of a molecule, to bind a ligand can be used to screen libraries as described in the above links.

Derivatives of OB polypeptides

In general, a protein (here the term “protein” encompasses the term “polypeptide” unless otherwise indicated) may be modified by attachment of one or more chemical groups. Chemically modified derivatives can be used intraarterially, intraperitoneally, intramuscularly, subcutaneously, intravenously, oral, nasal, rectal, sublingual, pulmonary, intradermal, as well as in the form of applications and other ways. It has been found that chemical modification of biologically active proteins provides them with additional benefits under certain conditions, for example, an increase in the stability and circulation time of a therapeutically active protein and an increase in its immunogenicity. See US Patent No. 4,179,337, Davis et al., Issued December 18, 1979. For a review, see Abuchowski et a., "Soluble Polymer / Enzyme Derivatives" in Prince. Enzymes as Medicines, pp 367-383, under. Ed. Holzenberg and Roberts, Wiley-Interscience, New York, NY, (1981). A review article on fusion proteins and modified proteins is published by Francis, Focus on Growth Factors, 3: 4-10 (1992).

Chemical groups for modification

Chemical groups (compounds) used to modify proteins may include water-soluble polymers. The selected polymer must be water soluble so that the protein to which it is attached does not precipitate in an aqueous medium, for example physiological. In the case of therapeutic use of the final product, the polymer is preferably pharmaceutically acceptable. A person skilled in the art can choose a polymer, taking into account the possibility of using the polymer / protein conjugate for therapeutic purposes, depending on the dose administered, circulation time, resistance to proteolysis and other factors. For the claimed proteins and polypeptides, the methods described herein may be used.

Polymer molecules

The water-soluble polymer may be selected from the group consisting of, for example, polyethylene glycol, ethylene glycol / propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1,3-dioxolane, poly-1, 3, 6-trioxane malimer copolymer polyamino acids (homopolymers or selective copolymers), polypropylene glycol homopolymers of dextran or poly (n-vinylpyrrolidone) polyethylene glycol, copolymers of propylene oxide / ethylene oxide, polyoxyethylene polyols and polyvinyl alcohol . Polyethylene glycol propionaldehyde can have certain advantages because it is stable in water.

The polymer can have any molecular weight and can be either branched or unbranched. For polyethylene glycol, the preferred molecular weight is about 2-100 kDa (the term "about" means that the molecular weight of some molecules in the polyethylene glycol preparations may be more or less than that indicated). A compound of another mole may be used. weight depending on the desired therapeutic goals (for example, the duration of the elimination period, the nature of the action, if the biological activity is known, ease of handling, degree of presence or loss of antigenicity and other known effects of polyethylene glycol on a therapeutically active protein or its analogue).

Polymer / protein ratio

The number of attached polymer molecules can vary, and a specialist in this field of research can establish the relationship of effect and function. You can get mono-, da-, tri-, tetra-derivatives or derivatives of a different order based on the same or different chemical compounds (for example, polymers, such as polyethylene glycol of different molar masses). The ratio of polymer molecules to protein (or peptide) can vary, as well as their concentration in the reaction mixture. In general, the optimal ratio (from the point of view of reaction efficiency, when an excess of unreacted protein or polymer is not formed) can be determined depending on facts such as the desired degree of derivatization (for example, mono-, li-, tri-, etc. ), they say. the mass of the selected polymer, whether it is branched or linear, and the reaction conditions.

Attaching chemical groups to a protein

Polyethylene glycol molecules (or other chemical groups) should be attached to the protein without significantly changing the functional or antigenic domains of the protein. Specialists are aware of methods for attaching various molecules to proteins (see, for example, EP No. 0401384 (PEG binding to G-CSF); Malik et al., Exp. Hematol., 20: 1028-1035 (1992) (GM-CSF PEGING with using tresyl chloride)). Sources of information are hereby incorporated by reference. For example, polyethylene glycol can be covalently linked to amino acid residues via a reactive group, such as a free amino or carboxyl group. Reactive groups must bind the activated polyethylene glycol molecule. Amino acid residues having a free amino group include lysine residues and N-terminal amino acid residues, and having a free carboxyl group include residues of aspartic acid, glutamic acid and a C-terminal amino acid residue. Sulfhydryl groups can be used as a reactive group for attaching polyethylene glycol molecules. Preferred for therapeutic purposes is the attachment to an amino group, for example, an N-terminal or lysine group. Attachment to amino acid residues important for receptor binding may be undesirable if receptor binding is contemplated.

Proteins chemically modified at the N-terminal site

It may be desirable to obtain a chemically modified protein at the N-terminal site. When using polyethylene glycol as an example, various polyethylene glycol molecules can be selected (based on the molecular weight of PEG, degree of branching, etc.), the ratio of PEG molecules to protein (or peptide) molecules in the reaction mixture, the type of PEGing reaction, and the method for obtaining the specified modified at the N-terminal portion of the protein. A method for producing a N-terminally pegylated compound (i.e., isolating this type of molecule from a mixture with other mono-PEG-coated molecules, if necessary) may involve purifying the N-terminal PEG-tagged substance from the mixture of PEG-coated proteins of their molecules. Selective chemical modification at the N-terminal site can be carried out by reductive alkylation based on the different reactivity of various types of primary amino groups (lysine as opposed to N-terminal amino acids) that can mediate the modification of a particular protein. Under suitable reaction conditions, an almost selective modification of the protein at the N-terminal site is achieved using a polymer comprising a carbonyl group. For example, it is possible to selectively PEG a protein at the N-terminal site by conducting a reaction at a certain pH value that provides differences in pK between the epsilon-amino groups of lysine residues and the α-amino group of the N-terminal portion of the protein. Due to such selective modification, the addition of a water-soluble polymer to a protein is controlled: conjugation with the polymer occurs predominantly at the N-terminal portion of the protein and no significant modification of other reactive groups such as lysine amino groups of the side chain occurs. When using reductive alkylation, the water-soluble polymer may be of the type indicated above and contain one reactive aldehyde group for protein coupling. Polyethylene glycol propionic aldehyde containing one reactive aldehyde group may be used.

Nucleic Acids Associated with OB Polypeptide

As indicated above, the present invention relates to nucleic acids encoding ob polypeptides, including non-coding sequences 5 ', 3' and intron sequences of the OB gene. Thus, in accordance with the present invention, known techniques of molecular biology, microbiology and recombinant DNA can be used. Such techniques are described in detail in the literature. See, for example, Sambrook et al., Molecular Cloning: Laboratory Manual, ^2nd Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989); Glover ed, DNA Planning: A Practical Guide. Volume I and II, Oligonucleotide Synthesis, Oxford University Press (1984); Hames et al., Eds., Nucleic Acid Hybridization, Springer-Veriag (1985); Hames et al., Eds., Transcription and Translation, Oxford University Press (1984); Freshney ed., Animal Tissue Culture, Oxford University Press (1984); Immobilized Cells and Enzymes, IRL Press (1986); Perbai, A Practical Guide to Molecular Cloning, Wiley, New York (1984). Of particular relevance to the present invention are methods for isolating, cloning, sequencing, analyzing and describing a gene or nucleic acid based on the well-known polymerase chain reaction.

“Replicon” means any genetic element (eg, plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e. capable of replication under its own control.

A “vector” is a replicon, such as a plasmid, phage or cosmid, that contains a foreign DNA fragment that can replicate as part of a vector.

“Cassette” means a DNA fragment that can be inserted into a vector at specific restriction sites. A DNA fragment encodes a given polypeptide, and the cassette and restriction sites are designed to allow integration of the cassette into a suitable open reading frame for transcription and translation.

“Heterologous” DNA refers to DNA that is not initially present in the cell, or chromosomal region of the cell. Preferably, the heterologous DNA includes a gene foreign to the cell:

A cell is “transfected” with exogenous or heterologous DNA when that DNA is introduced into the cell. A cell is “transformed” by exogenous or heterologous DNA when exposure to such DNA changes the phenotype of the cell. Preferably, the transforming DNA is integrated (covalently linked) with the chromosomal DNA within the cell genome.

"Kton" means a population of cells formed from a single cell or a common precursor as a result of mitosis.

“Nucleic acid molecule” means a helical polymer form of a phosphate ester of ribonucleosides (adenosine, guanosine, uriline or cytidine for RNA molecules) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, disoxythymidine or deoxycytidine for one or two molecules). The formation of double-stranded DNA-DNA, DNA-RNA, and RNA-RNA helices is possible. The term "nucleic acid molecule", in particular a DNA or RNA molecule, refers only to the primary or secondary structure of the molecule and does not include any tertiary or quaternary form. Thus, this concept means double-stranded DNA, inter alia, linear or circular DNA molecules (e.g., restriction fragments), plasmids and chromosomes. When discussing the structure of specific double-stranded DNA molecules, sequences can be described in accordance with standard requirements for indicating sequences only in the 5'-3 'direction along a non-transcribed DNA strand (i.e., a strand having a homologous sequence with respect to mRNA). "Recombinant DNA molecule" means a DNA molecule that has been subjected to molecular biological manipulations.

A nucleic acid molecule is “hybridizable” with another nucleic acid molecule, for example, cDNA, genomic DNA or RNA, when a single-stranded nucleic acid molecule is capable of annealing with another nucleic acid molecule under suitable conditions, i.e. at certain values of temperature and ionic strength of the solution (see Sambrook et al., 1989, supra). Conditions of temperature and ionic strength determine the "rigidity"("rigor") of hybridization. For preliminary screening of homologous nucleic acids, low stringency conditions corresponding to T _m 55 ° C, for example, 5x SSC, 0.1% SDS, 0.25% milk and the absence of formamide, can be used; or 30% formamide, 5x SSC, 0.5% SDS. Hybridization conditions of medium severity correspond to a higher T _m , for example, 40% formamide with 5x or 6xSSC. Hybridization conditions of high stringency correspond to the highest T _m , for example, 50% formamide, 5x or 6x SSC. For hybridization, it is necessary that two nucleic acid molecules contain complementary sequences, and despite the stringency of the hybridization conditions, the possibility of nucleotide matching is ensured. Suitable hybridization conditions for nucleic acids depend on the length of the nucleic acids and the degree of complementarity, which is well known in the art. A greater degree of similarity or homology between two nucleotide sequences requires more stringent hybridization conditions (T _m values). The relative stability (in accordance with the increase in T _m ) of nucleic acid hybrids increases in the following order: RNA: RNA, DNA: RNA, DNA: DNA. For hybrids having a length of more than 100 nucleotides, the correct ratio of T _m must be obtained (see Sambrook et al., 1989, supra, 9.50-0.51). For hybridization of shorter nucleic acids, i.e. oligonucleotides, the position of the matching nucleotides becomes more important and the length of the oligonucleotide determines its specificity (see Sambrook et al., 1989, supra, 11.7-11.8). A preferred minimum nucleic acid length for hybridization is at least about 10 nucleotides, more preferably at least about 15 nucleotides, even more preferably at least about 20 nucleotides.

"Homologous recombination" means the insertion of a foreign DNA sequence of a vector into the chromosome. Preferably, the vector has a specific chromosomal site for homologous recombination. For specific homologous recombination, the vector must contain sufficiently long sections of homology with chromosome sequences to ensure complementary binding and integration of the vector into the chromosome. Longer regions of homology and a greater degree of sequence similarity can increase the efficiency of homologous recombination.

A “coding sequence” DNA is a double-stranded DNA sequence that is transcribed and translated to form a polypeptide in an in vitro or in vivo cell under the control of an appropriate regular sequence. The boundaries of the coding sequence are determined by the start codon at the 5 '(amino) -terminal region and the stop codon at the 3' (carboxy) -terminal region. The coding sequence can be (but not limited to) prokaryotic sequences, cDNAs of eukaryotic mRNAs, genomic DNA sequences of eukaryotic DNA (e.g., mammals), and even synthetic DNA sequences. If the coding sequence is intended for expression in a eukaryotic cell, it is necessary that a polyadenylation and transcription signal is localized at the 3'-terminal portion.

Isolation of coding OBs and flanking sequences

The nucleic acids of the invention also encode the peptides of FIG. 1A-D (SEQ ID NO: 2), FIG. 3 (SEQ ID NO: 4), FIG. 5 (SEQ ID NO: 5), FIG. 6 (SEQ ID NO: 6). Accordingly, since specific DNA related to the ob gene is isolated and sequenced, any animal cell can serve as a potential source of nucleic acid for molecular cloning of a gene encoding the peptides obtained according to the present invention. DNA can be obtained by known methods from cloned DNA (e.g., a DNA library), by chemical synthesis, by cloning cDNA, by cloning genomic DNA or fragments thereof, or by purification from an appropriate cell (See, e.g., Sambrook et al., 1989, supra ; Glover, 1985, supra). Clones derived from genomic DNA may contain intron and regulatory DNA regions in addition to coding regions; derived from cDNAs do not contain intron sequences. Regardless of the source, the gene should be cloned in a suitable vector to "accumulate" in sufficient quantities.

In molecular cloning of a gene from genomic DNA, genomic DNA should be amplified using primers selected from cDNA sequences. Alternatively, DNA fragments are obtained, some of which encode the desired gene. DNA can be cleaved at specific sites using various restriction enzymes. In addition, you can use DNase together with manganese to fragment the DNA, or the DNA can be destroyed by physical methods, for example using ultrasound. Linear DNA fragments can then be separated in size by known methods, including (but not limited to) agarose and polyacrylamide gel electrophoresis and column chromatography.

After obtaining the DNA fragments, the identification of a specific DNA fragment containing the desired ob gene or ob-like gene can be accomplished in numerous ways. For example, if an ob gene or an ob-like gene or specific RNA or fragment thereof is available in such a quantity that it can be purified and tagged, DNA fragments can be screened by hybridization of nucleic acids with a labeled probe (Benton et al., Science, 196: 180 (1977); Grunstein et al., Proc. Natl. Acad. Sci., USA, 72: 3961 (1975)). The present invention provides for the availability of such nucleic samples that can be obtained appropriately based on the specific sequences described herein, for example, a hybridizable sample having a nucleotide sequence corresponding to at least 10, preferably 15 nucleotides of the sequences shown in FIGS. 1A-E, can be obtained. (SEQ ID NO: 1) or FIGS. 2A and B (SEQ ID NO: 3). Preferably, a fragment is selected that is a unique peptide modulator according to this invention. DNA fragments that are essentially homologous to the sample will hybridize with it. As noted above, the higher the degree of homology, the more stringent hybridization conditions are required. In one case, weak stringency hybridization conditions are used to identify a homologous modulator peptide. However, preferably, and as experimentally shown by the inventors, a nucleic acid encoding a modulator peptide according to the present invention will hybridize with a nucleic acid having a nucleotide sequence such as that shown in FIGS. 1A-E (SEQ ID NO: 1) or FIG. 2A and B (SEQ ID NO: 3), or with a fragment thereof under medium stringency conditions. More preferably, such a nucleic acid hybridizes under high stringency conditions.

Alternatively, the presence of a gene can be determined by methods based on the physical, chemical or immunological properties of the expressed product. For example, among cDNA clones or DNA clones that selectively hybridize with the corresponding mRNAs, those that produce the desired protein, for example, having similar or identical electrophoretic mobility, isoelectric focusing parameters, proteolytic cleavage map, tyrosine phosphatase activity or antigenic properties, can be selected, characteristic of modulatory peptides. For example, antibodies obtained according to the present invention can be used to screen homologues of modulator peptides from other sources.

A gene encoding a modulator peptide according to the invention can also be identified by selection of mRNA, i.e. nucleic acid hybridization after in vitro translation. In this case, fragments are used to isolate complementary mRNAs by hybridization. Such DNA fragments may correspond to available purified DNA modulator. To identify mRNA and, therefore, complementary DNA fragments containing the desired sequences, immunoprecipitation analysis or functional analysis (for example, determination of tyrosine phosphate activity) is used in vitro translated products of isolated mRNAs. In addition, specific mRNAs can be selected by adsorption of polysomes isolated from cells using immobilized antibodies that specifically bind to a modulator peptide.

Radioactively labeled cDNA of a modulator peptide can be synthesized using selected mRNA (upon polysome adsorption) as a template. Radiolabeled mRNA or cDNA can also be used as a probe to identify homologous DNA fragments of a modulator peptide among other genomic DNA fragments.

As noted above, DNA sequences encoding the weight modulator peptides can be obtained synthetically, rather than cloned. The DNA sequence can be constructed using appropriate codons of amino acid sequences of peptide weight modulators. In general, preferred codons can be selected if the sequence is to be used for expression. The complete sequence is constructed using overlapping oligonucleotides obtained by standard methods and combined into a complete coding sequence. See, for example, Edge, Nature, 292: 756 (1981); Nambair et ai, Science, 223: 1299 (1984); Jay et al., J. Biol. Chem., 259: 6311 (1984).

Synthetic DNA sequences can be used to properly construct genes that will express analogs of weight modulators, as described above. Alternatively, DNA-coding analogues can be obtained by site-directed mutagenesis of native OB genes or cDNA, and such analogues can be directly used for the corresponding synthesis of polypeptides.

The primary method for site-directed incorporation of unnatural amino acids into proteins is described by Noren et al., Science, 244: 182-188 (1989). This method can be used to obtain analogues of the ob polypeptide containing unnatural amino acids.

Non-coding nucleic acids

The present invention relates to the production of antisense nucleotides and ribozymes that can be used to regulate the expression of protein modulators of weight at a translation level. This approach involves the use of antisense nucleic acid and ribozymes to block the translation of a specific mRNA both by “masking” such mRNA with an antisense nucleic acid and by cleaving it with a ribozyme.

Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule (See, Weintraub, ScL Am., 262: 40-46 (1990); Marcus-Sekura, Anal. Biochem., 172: 289-295 (1988)). In the cell, they hybridize with mRNA, forming a double-stranded molecule. A cell cannot translate mRNA in double-stranded form. Thus, antisense nucleic acids interfere with the expression of mRNA to form a protein. Oligomers of about fifteen nucleotides in length and molecules that hybridize with the AUG initiation codon are particularly effective because they are easily synthesized and are likely to cause fewer problems than larger molecules when introduced into cells producing peptide weight modulators. Antisense molecules have been used to inhibit the expression of many genes in vitro (Marcus-Sekura, 1988, supra; Hambor et al., Y. Exp. Med. 168: 1237-1245 (1988)).

Ribozymes are RNA molecules capable of specifically cleaving other single-stranded RNA molecules similarly to restriction DNA endonucleases. Ribozymes were discovered based on the observation that some mRNAs are able to cut their own introns. By modifying the nucleotide sequence of such RNAs, researchers were able to construct molecules that recognize specific nucleotide sequences in an RNA molecule and cleave them (Cech, J. Am. Med. Assoc., 260: 3030-3034 (1988)). Since such molecules are specific for certain sequences, only mRNAs containing these specific sequences are inactivated. Researchers have identified two types of ribozymes: the Tetrahynema type and the hammer head type. Tetrahynema ribozymes recognize four-base sequences, and hammerhead ribozymes recognize 11-18 base sequences. Longer recognizable sequences are most likely to be present in mRNA targets. Therefore, hammerhead type ribozymes have preference over Tetrahynema type ribozymes for inactivation of specific mRNAs, and 18 base recognition sequences have an advantage over shorter recognition sequences.

The DNA sequences described here can thus be used to produce antisense molecules and ribozymes for mRNAs of protein weight modulators and their ligands, thereby inhibiting ob gene expression and leading to weight gain and obesity.

In another case, according to the invention, short oligonucleotides complementary to coding and complementary chains (nucleic acid OB, or non-coding 5 ′, 3 ′ regions of the OB gene, or internal / intron) regions of the coding region can be obtained. Such nucleic acids can be used as probes, for example, as directly labeled oligonucleotide probes, or as primers for polymerase chain reaction, to assess the presence of mutations in the ob gene or the level of expression of OB mRNA. Preferably, the non-coding nucleic amino acids obtained according to the present invention are derived from the human OB gene.

In another embodiment of the invention, non-coding nucleic acids are used for homologous recombination in order to integrate the amplified gene and / or other regulatory sequences in the immediate vicinity of the OB gene, for example, to obtain a higher degree of expression of the OB polypeptide or to “overlap” the mutation in the regulatory sequences of the ob gene which interferes with desired levels of expression of the OB polypeptide (See WO 91/06666 published May 16, 1991 by Skoultchi; WO 91/09955 published th July 11, 1991 Chappel; see also application WO 90/14092, published November 29, 1990 Kucheriapati and CampbelP)...

Obtaining OB polypeptide: expression and synthesis

Transcriptional and translational control sequences are regulatory DNA sequences, such as promoters, enhancers, terminators, and the like, which allow expression of a coding sequence in a host cell. In eukaryotic cells, control sequences are polyadenylation signals.

The coding sequence is “under control” of transcriptional or translational control sequences in the cell when RNA polymerase transcribes the coding sequence to form mRNA, which is then spliced and translated to form the protein encoded by this sequence.

A “signal sequence” is included in the initial region of the coding sequence of a protein to be expressed on a cell surface. This sequence encodes a signal peptide, N-terminal to the mature polypeptide, which directs the movement of the polypeptide in the host cell. The term “translocation signal sequence” is also used here to mean a signal sequence of a given type. Translocation signal sequences can be detected in combination with various native proteins of eukaryotes and prokaryotes and are often functionally active in both of these classes of organisms. The DNA sequence is “operably linked” to an expression control sequence when the sequence controls and regulates the transcription and translation of the DNA sequence. The term “functionally linked” means the presence of a suitable start signal (for example, an ATG codon) before the DNA sequence to be expressed, and the ability to “maintain” an open reading frame for expression of the DNA sequence under the control of the corresponding sequence and the formation of the desired product encoded by DNA -sequence. If the gene to be inserted into the recombinant DNA molecule does not contain a suitable start signal, such a start signal can be integrated into the gene at the 5'-upstream position with respect to the open reading frame.

A “promoter sequence” is a regulatory region of DNA capable of binding RNA polymerase in a cell and initiating transcription in the downstream direction with respect to the coding sequence (3 ′ direction). For the purposes of the present invention, the promoter sequence is linked at its 3'-end to the transcription initiation site and extends in the upstream direction (5'-direction) and includes the minimum number of bases or elements necessary for transcription initiation at levels exceeding the background value. Within the promoter sequence, there is a transcription initiation site (suitably identified, for example, by S1 nuclease mapping) and protein-binding domains (consensus sequences) responsible for binding of RNA polymerase.

Another aspect of the present invention is the expression of the DNA sequences described in the present invention. As is well known in the art, DNA sequences can be expressed by functional linking with an expression control sequence as part of a suitable expression vector and using it to transform the corresponding unicellular host.

Such functional linking of the DNA sequence obtained according to the present invention with an expression control sequence, of course, implies the inclusion of the ATG initiator codon (if it is not already part of the sequence) in the upstream position with respect to the open reading frame in the indicated DNA sequence.

A wide variety of host-expression vector combinations can be used to express the DNA sequence of the invention. Useful expression vectors, for example, may consist of chromosomal segments, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV 40 and known bacterial plasmids, for example, E. coli colE1 pCR1 pBR322, pMB9, pUC plasmids or pUC plasmids, for example, pGEX vectors, pET, pmal-c, pFLAG vectors and others, E. coli plasmid derivatives plasmids such as RP4, phage DNAs, for example, numerous derivatives of phage λ, for example NM989, and other phage DNAs, for example M13, and filamentous single-stranded phage DNAs, yeast plasmids, such as 2μ plasmid or its derivatives, eukaryotic cell vectors, such like vectors, insect and mammalian cells, vectors, by irradiated by combining plasmid and phage DNAs, such as plasmids containing phage DNA or other expression control sequences, etc. In a preferred embodiment, the expression of ob is achieved in methylotrophic yeast, for example Pichia pastoris (see, international application WO 90/03431, published April 5, 1990. Brierly et al .; international application WO 90/10697, published September 20, 1990. Siegel et al.). In a specific embodiment of the invention (see below), the expressed vector is designed to express ob under the control of the signal sequence of the α-mating factor.

In these vectors for the expression of the claimed DNA sequences uses any of the well-known sequences that control the expression, which performs its function if it is functionally linked to a given DNA sequence. Such expression control sequences include, for example, early or late promoters of SV40, CMV, vaccine virus, polyoma or adenovirus virus, lac system, trp system, TAC system, TRC system, LTR system, main operator and promoter plots of phage λ, controlling sections of the envelope protein fd, promoter of 3-phosphoglycerate kinase or other glycolytic enzymes, promoters of acid phosphatase (e.g. Pho 5), AOX1 promoter of methylotrophic yeast, promoters of α-mating yeast factors and other sequences that are understood able to control the expression of genes of prokaryotic or eukaryotic cells or viruses or various combinations of these promoters.

Various unicellular host cells are used to express the DNA sequences obtained according to the present invention. Such hosts include eukaryotic and prokaryotic organisms, for example, strains of E. coli, Pseudomonas, Bacillus, Streptomyces; fungi, in particular yeast {Saccharomyces and methylotrophic yeast such as Pichia, Candida, Hansenula and Torulopsis); animal cells such as CHO, R1-1, B-W and LM, African green monkey kidney cells (e.g. cos1, cos7, BSC1, BSC40 and BMT10), insect cells (e.g. Sf9) and human and plant cells in tissue culture.

It should be understood that not all vectors, expression control sequences, and host organisms will equally efficiently express the DNA sequences obtained according to the invention. In addition, not all organisms are equally suitable for applying the same expression system to them. However, a person skilled in the art can select suitable vectors, expression control sequences, and host organisms to provide the necessary expression without departing from the scope of the invention. For example, when choosing a vector, it is necessary to take into account the properties of the host organism, since the vector must function in its cells. It is also necessary to take into account the number of copies of the vector, the ability to control the specified number of copies, and the ability to express any other proteins encoded by the vector, for example, marker antibiotics.

When choosing a sequence that controls expression, normally it is necessary to take into account various factors. These include, for example, the relative length of the sequence, the effectiveness of its action, compatibility with a particular DNA sequence or gene, which are subject to expression, especially taking into account the possible secondary structure. Suitable unicellular host organisms are selected based on their compatibility with the selected vector, secretory activity, ability to properly twist proteins, enzymatic activity, product host toxicity encoded for the DNA sequence to be expressed, and ease of purification of the expression products.

Taking into account the above and other factors, a person skilled in the art is able to construct various “vector / sequence controlling expression, host-organism” systems with the help of which the expression of the desired DNA sequences obtained according to the present invention will be ensured in a fermentation or large-scale animal culture tissue.

In a particular embodiment, the OB fusion protein may be expressed. This protein contains at least a functionally active region of a non-OB protein coupled through a peptide bond to at least a functionally active region of an OB polypeptide. Non-ob sequences can be attached from the amino-terminal or carboxy-terminal region of the OB sequences. More preferably, in order to ensure stable expression of the proteolytically inactive fusion protein, non-OBs are linked via a peptide bond to the amino-terminal portion of the OB protein. A recombinant DNA molecule encoding such a fusion protein comprises a sequence encoding at least a functionally active region of a non-OB protein, connected in the reading frame to an OB encoding sequence, and preferably encoding a cleavage site with a specific protease, for example, thrombin or factor Xa, preferably in at the junction of the OB, not the OB. The fusion protein can be expressed in Escherichia coli or P. pastoris.

In carrying out a specific embodiment of the invention (see below), vectors for expressing human and mouse ob genes (with or without a codon for gln-49) are obtained in a bacterial or yeast expression system (Pichia) to form fusion proteins. The ob gene is obtained using PCR and new primers. It is advisable to use the PCR technique, since the probability of the inclusion of a point mutation in this case increases. A plasmid containing a histidine tag (His-tag) and a proteolytic cleavage site are used. The presence of histidine allows the selective selection of recombinant proteins on a Ni-chelating column or by affinity purification. The proteolytic cleavage site, see above, namely the thrombin cleavage site, is designed so that treatment with a protease, for example thrombin, releases a full-sized mature (i.e., lost signal sequence) OB polypeptide.

Alternatively, the pGEX vector can be obtained (Smith et ai, Gene 67: 31-40 (1988)). The composition of this vector includes cDNA of glutathione S-transferase of Schistosoma japonicum, connected to a given sequence. Bacterial proteins are harvested, and recombinant proteins can be quickly purified by affinity chromatography on a reducing glutathione column. The GST carrier is then removed from the fusion proteins by cleavage with site-specific proteases. After cleavage, the carrier and undigested fusion protein can be removed by absorption on glutathione agarose. When using this system, difficulties arise when the protein is insoluble in the aquatic environment.

The expression of recombinant proteins in bacterial systems can lead to incorrect twisting of the expressed protein, which requires restoration of its structure. A recombinant protein can be “twisted” either before or after cleavage to form a functionally active OB polypeptide. The OB polypeptide can be reduced by the following steps: (1) incubating the protein in a denaturing buffer containing a reducing agent, and (2) incubating the protein in a buffer containing an oxidizing agent and preferably containing a protein stabilizing agent or a chaotropic agent, or both of these compounds. A pair of oxidizing and reducing agents may be used, which includes, but is not limited to, reduced glutanion / glutanion disulfide, cystine / cysteine, cysteamine / cysteamine, and 2-mercaptoethonol / 2-hydroxyethyl disulfide. In the particular case, the fusion protein can be solubilized in a denaturant, for example urea, before being placed in a reducing buffer. In a preferred case, the protein is also purified, for example, by ion exchange or Ni-chelating chromatography before being placed in a reduction buffer. Denaturing agents include (but are not limited to) urea and guanidine — HCl. The recombinant protein is then diluted at least 10 times, more preferably 100 times, in an oxidizing buffer containing an oxidizing agent, such as (but not limited to) 0.1 M Tris-HCl, pH 8.0, 1 mM EDTA, 0.15 M NaCl, 0.3 M oxidized glutathione. The fusion protein is then incubated in the range of about 1-24 hours, preferably in the range of about 2-16 hours at room temperature in an oxidizing buffer. The oxidizing buffer may contain a protein stabilizing agent, for example, sugar, alcohol or ammonium sulfate. The oxidizing buffer may also contain a low concentration chaotropic agent to destabilize the “wrong” intermolecular interactions and thus contribute to the “right” twisting. Suitable chaotropic agents include, but are not limited to, detergent, polyol, α-arginine, guanidine-HCl, and polyethylene glycol (PEG). It is important to use a sufficiently low concentration of the chaotropic agent to avoid protein denaturation. The protein with the restored structure can be concentrated at least 10 times, more preferably up to the amount in which it is introduced into the oxidizing buffer.

Bacterial fermentation processes can result in unwanted endotoxin levels in recombinant protein preparations. The invention provides for the removal of such endotoxins, for example, when using endotoxin-specific antibodies or other substances that bind endotoxin. The presence of endotoxin is detected by standard methods, for example, using E-TOXATE reagents (Sigma, St. Louis, Missouri) or using biological analysis.

In addition to the above, the inventors propose using a system based on baculovirus, mammalian cells or yeast for expression of the ob protein. For example, the following vectors are used in the baculovirus expression system: non-fusion transfer vectors (not limited to) pVL 941 (Bam HI - cloning site; Summers), pVL 1393 (Bam HI, Sma I, Xba I, Not I, Xma III, Bgl I and Pst I-cloning sites; Invitrogen), pVL 1392 (Bgl II, Pst II, Not I, Xma III, EcoR I, Xba I, Sma I and Bam III-cloning sites; Summers and Invitrogen) and pBlue Bac III ( Bam HI, Bgl II, Pst I, Nco I, and Hind III are cloning sites with possible screening of the white / blue recombinant; Invitrogen) and pAC 700 fusion transfer vectors (not limited to these) (Bam HI and Kpn I are cloning sites in which the recognition site Bam HI starts with an initiator codon; Summers), pAC 701 and pAC 702 (similar to pAC 700 with different reading frames), pAC 360 (Wat HI is a 360 base pair cloning site located in the downstream position with respect to the polyhedrin initiator codon ; Invitrogen (195)) and pBlueBacHis A, B, C (three different base frames with Bam HI, Bgl II, Pst I, Nco I and Hind III-cloning sites, N-terminal peptide for ProBond - purification and possible screening of recombinant plaques "White / blue"; Invitrogen (220)).

The expression vectors in mammalian cells according to the present invention include vectors with inducible promoters, such as the dihydrofolate reductase (DHFR) promoter, for example, any expression vector in combination with a DHFR expression vector or a DHFR / methotrexate co-amplification vector such as pED (Pst I, Sal I, Sba I, Sma I, and Eco RI are cloning sites in combination with a vector expressing the cloned gene and DHFR; see Kaufman, Current Protocols in Molecular Biology, 16.12 (1991)). Alternatively, glutamine synthetase / methionine sulfoximine co-amplification vector, for example, pEE14 (Hind III, Xba I, Sma I, Sba I, Eco RI and Bcl I- cloning sites with expression of the cloned gene and glutamine synthase; Celltech) can be used. Alternatively, a vector that directs episomal expression under the control of the Epstein-Barr virus (EBV) can be used, for example pREP4 (Bam HI, Sfi I, Xho I, Not I, Nhe I, Hind III, Nhe I, Pvu II and Kpn I - site cloning, constitutive RSV-LTR promoter, selective marker of hygromycin; Invitrogen), pCEP4 (Bam HI, Sfi I, Xho I, Not, Nhe I, Hind III, Nhe I, Hind III, Nhe I, Pvu II and Kpn I - cloning sites, constitutive immediately early hCMV gene, selective merger of hygromycin; Invitrogen), pMEP4 (Kpn I, Pvu I, Nhe I, Hind III, Not I, Xho I, Sfi I, Bam HI - cloning sites, inducible promoter of the metallothionein gene IIα, selective marker gi romicin; Invitrogen), pREPS (Bam HI, Xho I, Not I, Hind III, Nhe I and Kpn I- cloning sites, RSV-LTR promoter, histilinol selective marker; Invitrogen), pREP9 (Kpn I, Nhe I, Hind III , Not I, Xho I, Sfi I and Bam HI - cloning sites, RSV-LTR promoter, G418 selectable marker, Invitrogen) and pEBVHis (RSV-LTR promoter, selective hygromycin marker, N-terminal peptide for purification on ProBond resin and enterokinase cleavage; Invitrogen). Selected vectors for expressing proteins in mammalian cells in the practice of the invention include pRc / CMV (Hind III, Bst XI, Not I, Sba I and Ara I - cloning sites, selective marker G418; Invitrogen), pRc / RCV (Hind III, Spe I, Bst I, Xba I — cloning sites, G418 selective marker; Invitrogen) and others. Vaccine-based expression vectors (Kaufman, 1991, supra) for the implementation of the present invention include (without limitation) pSC11 (Sma I - cloning site, TK and β-gal selective markers), pM J601 {Sal I, Sma I, Alf I, Nar I, Bsp MII, Bam HI, Ara I, Nhe I, Sac II, Kpn I and Hind III - cloning Sites TK and β-gal selective markers) and pTKgpt F1S (Eco RI, Pst I, Sal I, Acc I, Hind II, Sba I, Bam HI and Hpa - cloning sites, selective TK or XPRT markers).

In accordance with the invention, yeast systems can be used to express OB polypeptide. For example, a pYES2 non-fusion vector (Xba I, Sph I, Not I, Gst XI, Eco RI, Bst XI, Bam HI, Sac I, Kpn I and Hind III-cloning sites; Invitrogen) or a pYESHis fusion vector A, B, C (Xba I, Sph I, Sho I, Not I, Bst XI, Eco RI, Bam I, Sac I, Kpm I and Hind III - cloning sites, N-terminal peptide for purification on ProBond resin and digestion with enterokinase; Invitrogen) or both of these vectors.

It should be noted that the peptide analogues of the weight modulator can be obtained using nucleic sequences included in the scope of the present invention.

In addition to the recombinant expression of the OB polypeptide, the present invention relates to the production of OB polypeptide and its fragments using well-known and highly developed methods of solid-phase peptide synthesis. In this case, the strategies of the protective groups Boc and Fmos are used, as well as others. Various techniques for “twisting” and oxidizing cysteine side chains to form a disulfide bond are well known in the art.

Antibodies to OB polypeptide

In accordance with the invention, the OB polypeptide obtained by recombinant means or by chemical synthesis, its fragments, analogues or other derivatives, including fusion proteins, can be used as an immunogen to produce antibodies that recognize OB polypeptides. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain antibodies, Fab fragments, and Fab-expressing libraries.

A molecule is “antigenic” if it is capable of specific interaction with an antigen-recognizing molecule of the immune system, such as an immunoglobulin (antibody) or T-cell antigen receptor. The antigenic polypeptide contains at least about 5 and preferably at least about 10 amino acids. The antigenic region of a molecule can be that region that is immunodominant for an antibody or T cell recognition receptor, or that region that is used to generate antibodies to a molecule by connecting the antigenic region to a carrier molecule for immunization. The antigenic molecule does not have to be immunogenic in itself, i.e. capable of eliciting an immune response without binding to a carrier.

An “antibody” is any immunoglobulin that binds to a specific epitope. This concept refers to polyclonal, monoclonal, and chimeric antibodies (the latter are described in detail in US Pat. Nos. 4,816,397 and 4,816,567), as well as antigen binding fragments of antibodies, including Fab, F (ab ') ₂ and F _v (including single chain antibodies). In accordance with the foregoing, the term "antibody molecule" refers here to both an intact immunoglobulin molecule and an immunologically active region of an immunoglobulin molecule containing an antibody binding site. An antibody binding site is a structural site of an antibody molecule, consisting of the variable and hypervariable regions of the light and heavy chains, which specifically binds the antigen. Examples of immunoglobulin molecules are intact immunoglobulin molecules, essentially intact immunoglobulin molecules and sections of immunoglobulin molecules containing a paratope, including structures known from the prior art such as Fab, Fab ', F (ab'') ₂ and F _(v) , which are preferred used in the therapeutic methods described herein.

Fab and F (ab ') ₂ - sections of antibody molecules are obtained by proteolytic cleavage by papain and pepsin, respectively, of practically intact antibodies by well-known methods. See, for example, US Patent No. 4342566, Theofilopolous et al. Fab'-sites of antibodies are also well known and are formed from F (ab ') ₂ -sites after the restoration of disulfide bonds connecting the two regions of the heavy chain with mercaptoethanol and after alkylation of the obtained mercaptan protein with a chemical reagent, for example, iodoacetamide. The use of intact antibody molecules is preferred.

The term "monoclonal antibody" means an antibody with an antigen-binding region of only one type, capable of interacting with a particular antigen. Thus, a monoclonal antibody usually exhibits a certain affinity for any antigen with which it interacts. A monoclonal antibody may contain more than one antigen-binding site, each of which is immunospecific to a particular antigen (an example is a bispecific (chimeric) monoclonal antibody).

The term “adjuvant” means a compound or mixture of compounds that enhance the immune response to an antigen. An adjuvant can serve as a tissue depot that slowly releases antigen, and an activator of the lymphoid system that non-specifically enhances the immune response (Hood et al., In. Immunology, p. 384, Second Ed., Benjamin / Cummings, Menio Park, California (1984)) . Often, priming with a single antigen without an adjuvant may not provide the generation of a humoral or cellular immune response. Adjuvants include (but are not limited to) Freund's complete adjuvant, Freund's incomplete adjuvant, saponin, mineral gels, such as aluminum hydroxide, surfactants, such as lysoleticin, fluorine polyols, polyanions, peptides, oils or hydrocarbon emulsions, mollusk hemocyanins, mollusk fissure dinitrophenol and adjuvants based on mycobacteria, for example BCG (Calmette-Guerin bacilli) and Corynebacterium parvum. Advantageously, the adjuvant is pharmaceutically acceptable.

Various well-known methods are used to obtain polyclonal antibodies to the OB polypeptide, its fragment, analog or derivative. In order to obtain antibodies, various animals are immunized by injection of the OB of the polypeptide or its derivative (for example, a fragment or fusion protein), including (without limitation indicated) rabbits, mice, rats, sheep, goats, etc. In one case, the OB polypeptide or fragment may be conjugated to an immunogenic carrier, for example bovine serum albumin (BSA) or fissurella mollusk hemocyanin (KLH). To enhance the immunological response depending on the host animal, various adjuvants can be used, which include (but are not limited to) Freund's adjuvants, mineral gels, such as aluminum hydroxide, surfactants, such as lysolecithin, fluorine polyols, polyanions, peptides, oil emulsions, fissurella mollusk hemocyanin, dinitrophenol and mycobacterium-based adjuvants, e.g. BCG (Calrnette-Guerin bacilli) and Corynebacterium parvum.

To obtain monoclonal antibodies directed to the OB polypeptide or derivative, any methods associated with the cultivation of immortal cell lines can be used. These techniques include, but are not limited to, the hybridoma technology originally developed by Kohler et al.), Nature, 256; 495-497 (1975), triomeric technology, hybridoma technology based on human B-cells (Kozbor et al., Immunology Today, 4: 72 (1983)) and hybridoma technology for producing human monoclonal antibodies based on the Epstein-Barr virus (Cole et al., in Monoclonal Antibodies and Cancer Therapy, pp. 77-96, Alan R. Liss, Inc., (1985)). Immortal antibody-producing cells can be obtained not only by fusion, but, for example, by direct transformation of B lymphocytes oncogenic DNA or transfection with Epstein-Barr virus. See, for example, M. Schreier et al., Hybridoma Techniques (1980); Hammerling et al., "Monoclonal Antibodies and T-cell Hybridomas" (1981); Kermet et al., "Monoclonal Antibodies" (1980); see also US patent No. 4451570; 4,466,917; 4,472,500; 4,491,632 and 4,493,890.

In addition, monoclonal antibodies can be obtained using sterile animals (newly developed technology; PCT / US 90/02545). In accordance with the invention, human antibodies can be used that are obtained using human hybridomas (Cote et al., Proc. Natl. Acad. Sci. USA, 80: 2026-2030 (1983)) or as a result of the transformation of human B cells Epstein-Barr virus in vitro (Cole et al., 1985, see above). In fact, in accordance with the invention, a technique developed to produce “chimeric antibodies” can be used (Morrison et al., J. Bacteriol. 159-870 (1984); Neuberger et al., Nature, 312: 604-608 (1984 ); Takeda et al., Nature, 314: 452-454 (1985)). It involves splicing the genes of mouse antibodies specific for the ob polypeptide, together with the genes of a human antibody possessing the desired type of biological activity. Such antibodies are also included in the scope of the present invention. Such human or “humanized” chimeric antibodies are preferred for use in the treatment of human diseases or any disorders (described above), since human antibodies or “humanized” antibodies cause significantly less allergenic immune responses than xenogenic antibodies.

According to the invention, the techniques used to produce single chain antibodies (US Patent No. 4,946,778) can be used to produce single chain antibodies specific for the OB polypeptide. In an additional embodiment of the invention, techniques used to obtain Fab expression libraries (Huse et al., Science, 246: 1275-1281 (1989)) can be used to quickly and efficiently identify monoclonal Fab fragments of a given specificity for the ob polypeptide, as well as their derivatives or analogues.

Using known techniques, antibody fragments containing an idiotype of an antibody molecule can be obtained. For example, such fragments include (but are not limited to) F (ab ') 2 fragments, which are obtained by cleaving the antibody molecule with pepsin; Fab'-fragments, which can be obtained by reducing the disulfide bridges of the F (ab ') ₂ -fragment, and Fab-fragments, which can be obtained by treating the antibody molecule with papain and a reducing agent.

When antibodies are produced, antibodies of the desired specificity can be screened using any of the known methods, for example, by radioimmunological analysis, ELISA (enzyme-linked immunosorbent assay), sandwich immunoassay, immunoradiometric analysis, diffuse precipitation gel, immunodiffusion analysis , in situ immunoassay (when using, for example, colloidal gold, enzyme or radioisotope labels), Western blotting, precipitation, agglutination analysis (e.g. lysis of agglutination in a gel, hemagglutination analysis), complement binding reactions, immunofluorescence analysis, analysis using protein A, immunoelectrophoretic analysis, etc. In one case, antibody binding is detected by detecting a label on the first antibody. In another case, the first antibody is detected by binding to the second antibody or some reagent. Moreover, a second antibody can be linked to the label. Numerous techniques are known to detect binding in an immunological assay, which are included within the scope of the present invention. For example, to select antibodies that recognize a specific epitope on an OB polypeptide, hybridomas can be obtained for a product that binds to an OB fragment of a polypeptide containing the epitope. To select an antibody specific for the OB polypeptide and obtained from a particular animal species, the results of positive binding to the OB polypeptide expressed by cells of the same animal species or isolated from these cells can be used.

The antibodies described above can be used in methods to detect the activity or to establish the localization of the OM polypeptide, for example, in Western blotting, in situ study of the OM polypeptide, determining its level in the corresponding biological samples, etc. In a specific embodiment, antibodies that are agonists or antagonists of OB activity can be obtained. Such antibodies can be tested using the methods described above to identify ligands.

In yet another embodiment of the invention, antibodies are obtained by immunizing rabbits with synthetic peptides with a sequence predicted based on peptide sequencing, or recombinant proteins obtained using bacterial expression vectors. The selection of synthetic peptides is carried out after careful analysis of the predicted protein structure, as described above. In particular, peptide sequences are selected between possible cleavage sites. Synthetic peptides are conjugated to a carrier, such as fissurella mollusk hemocyanin (KLH) or BSA, via carbodiimide, and are used to immunize rabbits with Freund's adjuvant. To obtain a recombinant protein for expression of the polypeptide, a pGEX vector can be used (Smith et al., 1988, see above). Alternatively, only hydrophilic domains can be used to produce the fusion protein. Expressed protein is obtained in a certain amount and is used to immunize rabbits in Freund's adjuvant.

In another embodiment, a recombinant OB polypeptide is used to immunize chickens, and antibodies to the OB polypeptide are isolated from egg yolk, for example, by affinity purification on an OB column. Preferably, the chickens used for immunization have the status of "free from specific parasites" (SPF).

In another case, antibodies to leptin are obtained in ob / ob mice that have lost circulating OB protein, and it is expected that they are capable of generating an antibody response to the OB polypeptide because they are not tolerant to it, as well as in wild-type mice. The spleen cells of these animals are fused with myeloma cells to produce hybridomas and monoclonal antibodies.

Recombinant OB polypeptide can be used to immunize rabbits, and polyclonal antibodies are purified using immunological immunoassay methods before further use. Purified antibodies are especially useful for semi-quantitative analysis, in particular for detecting the presence of circulating OB polypeptide in serum or plasma.

Panels of monoclonal antibodies prepared against modulator peptides can be screened for various properties, i.e. isotypic, epitope-specific, affinity, etc. Of particular interest are monoclonal antibodies that neutralize the activity of modulatory peptides. Such antibodies can be easily identified in studies of the activity of weight modulators. High affinity antibodies are also used for immunoaffinity purification of a native or recombinant modulator.

Preferably, the antimodulatory antibody used in the diagnostic or therapeutic methods of the present invention is an affinity purified polyclonal antibody. More preferably, the antibody is monoclonal (mAb). In addition, it is preferred that the anti-modulator antibody molecules are used as Fab, Fab ′, F (ab ′) ₂ , or F _(v) fragments of whole antibody molecules.

Diagnostic use

The present invention also relates to various forms of diagnostic use, including methods for determining conditions and / or stimuli that affect the development of body weight disorders or obesity by determining their ability to influence activity mediated by the claimed weight modulators. As noted previously, peptide weight modulators can be used to produce antibodies to them using various known methods, and such antibodies can then be isolated and used in tests to detect transcriptional activity in the expected target cells. Alternatively, the nucleic acids obtained according to the present invention can be used in diagnostics.

Antibody-Based Diagnostics

As suggested above, the diagnostic method of the present invention involves the analysis of a cell sample or medium in a study involving the use of an effective amount of a modulator protein antagonist, such as an antimodulatory antibody, preferably an affinity purified polyclonal antibody, and more preferably a mAb. In addition, it is preferred that the antimodulator antibody molecules used are Fab, Fab ′, F (ab ′) _2, or F _(v) fragments of whole antibody molecules. As discussed above, patients with whom this method can be successfully applied suffer from cancer, AIDS, obesity or other disorders, when abnormal body weight is a characteristic factor. Methods for isolating a modulator and inducing antimodulatory antibodies for the analysis of target cells are well known in the art. In addition, antibodies (polyclonal and monoclonal) and drugs that modulate the formation or activity of weight control modulators and other recognized factors and / or their subunits can be used in various diagnostic methods and, for example, can be used to determine and / or evaluate conditions when violations of body weight develop or the likelihood of their development is likely. Modulatory peptides or their active fragments can be used to obtain polyclonal and monoclonal antibodies to them in various cell media using known methods, such as hybridoma technology based on the fusion of mouse spleen lymphocytes and myeloma cells. These techniques are described in detail below. Similarly, small molecules that mimic or antagonize the activity of receptor-recognized factors obtained according to this invention can be detected or synthesized and used in diagnostic and / or therapeutic methods. The presence of weight modulators in cells can be determined using routine immunological procedures used for such determinations. A large number of these techniques are known. It is especially advisable to use three such techniques in which a receptor recognition factor labeled with a detectable label, an ab ₁ antibody labeled with a detectable label, or an Ab ₂ antibody labeled with a detectable label are used. The techniques can be summarized in the form of the following equations, where the asterisks indicate the label, and “WM” means the weight modulator:

a. WM * + Ab ₁ = WM * Ab ₁

at. WM + Ab ₁ * = WMAb ₁ *

C. WM + Ab ₁ + Ab ₂ * = Ab ₁ WMAb ₂ *

The methods used here and their application are similar to those known from the prior art and, accordingly, can be used within the scope of the present invention. A "competitive" method, Method A, is described in US Pat. Nos. 3654090 and 3850752. Method B corresponds to the well-known competitive analysis. Method C, a “sandwich” method, is described in US Patent RE 31006 and 4016043. Other approaches are also known, such as the “double” antibody method (“DASP” method).

In each case, weight modulators form complexes with one or more antibodies or binding partners, and one of the components of the complex is associated with a detectable label. The formation of the complex and, if necessary, its amount can be established by known methods involving the identification of labels.

As can be seen from the above, a characteristic property of Ab ₂ is its ability to interact with Ab ₁ . This is because Ab ₁ obtained from one mammalian species was used as an antigen in relation to another species to produce Ab ₂ . For example, Ab ₂ can be obtained from a goat using rabbit antibodies as antigen. Therefore, Ab ₂ is a goat antibody directed against rabbit antibodies. For the purposes of the description and the formula, Ab ₁ can be used as a first antibody or an antibody directed to a weight modulator, and Ab ₂ is a second or anti-Ab ₁ antibody.

Labels that are most often used in these methods are radioactive elements, enzymes, chemicals that fluoresce when exposed to ultraviolet light, etc.

Known fluorescent compounds may be used as labels. These include, for example, fluorescein, rhodamine and airamine. The most commonly used anti-rabbit goat antibodies conjugated to fluorescein via isothiopianate.

Weight modulators or binding agents may also be labeled with a radioactive element or enzyme. A radioactive label can be detected by any quantitative technique. The isotope can be selected from the group consisting of ³ H, ¹⁴ C, ³² P, ³⁵ S, ³⁶ Cl, ⁵¹ Cr, ⁵⁷ Co, ⁵⁸ Co, ⁵⁹ Fe, ⁹⁰ Y, ¹²⁵ I, ¹³¹ I and ¹⁸⁶ Re.

Enzymatic labels can also be used that are detected by colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric methods. The enzyme is conjugated to the selected molecule by reaction with binding molecules such as carbodiimides, diisocyanates, glutaraldehyde, etc. Many known enzymes can be used in this reaction. It is preferable to use peroxidase, β-glucuronidase, β-D-glucosidase, β-D-galactosidase, urease, glucose oxidase in combination with peroxidase and alkaline phosphatase. Alternative labeled reagents and methods are described, for example, in US Patents 3654090, 3850752 and 4016043.

In another embodiment of the invention, diagnostic kits can be obtained for use by doctors to determine the presence or absence of a predetermined transcriptional activity or a predetermined activity in the expected target cells. According to the testing methods described above, one type of kit contains at least a labeled weight modulator or a binding reagent, for example, an antibody specific to it, and instructions that depend on the method selected, for example, “competitive”, “sandwich”, “DASP” etc. Kits may also contain additional reagents, for example, buffers, stabilizers, etc.

Accordingly, a diagnostic kit can be obtained for detecting transcriptional activity in cells or the ability of cells to a predetermined transcriptional activity, which contains:

(a) a predetermined amount of at least one immunochemically-labeled component, obtained by directly or indirectly attaching a body weight modulator or binding a specific agent (partner) to a detectable label;

(b) other reagents;

(c) instructions for using this kit.

The diagnostic kit may also contain:

(a) a known amount of a weight modulator, as described above (or a binding reagent, partner), bound to the solid phase to form an immunosorbent or, alternatively, bound to a suitable label, or numerous such end products, etc. (or their connecting partners);

(b) if necessary, other reagents;

(c) instructions for using the specified diagnostic kit.

In another embodiment, the diagnostic kit can be obtained and used for the above purposes in accordance with the prescribed methodology (for example, "competitive", "sandwich", "double antibodies", etc.) and contains:

(a) a labeled component, which is obtained by combining a weight modulator with a detectable label;

(b) one or more additional immunochemical reagents, of which at least one reagent is a ligand or an immobilized ligand, wherein the ligand is selected from the group consisting of:

(i) a ligand capable of binding to the labeled component (a);

(ii) a ligand capable of binding to the binding partner of the labeled component;

(in) a ligand capable of binding to at least one component (s) in order to be detected;

(iv) a ligand capable of binding to at least one binding partner of at least one of the components to be detected,

and

(a) instructions for using the methodology to determine and / or identify one or more components of an immunological reaction between a weight modulator and its specific binding partner.

Nucleic Acid Diagnostics

As shown in the examples below, the nucleic acids obtained according to the present invention can be used to detect abnormalities associated with OB defects of a polypeptide that lead to phenotypic obesity. For example, nucleic acid-based samples (say, in Northern blotting or RT-PCR analysis) can be used to detect whether the obesity phenotype is associated with loss of expression of OB mRNA, or expression of non-functional OB mRNA, for example, as in db / db mice (when deficiency results from loss of the OB receptor) or when mutations result in nontranscribed mRNA. Moreover, the diagnostic methods claimed according to the present invention and based on the use of nucleic acids can be used in conjunction with methods based on the use of antibodies to better understand the molecular mechanisms of the development of phenotypes of obesity and anorexia.

As described here, cDNA clones that have recently been isolated are sequenced. This allows you to determine the complete sequence of the human gene (see Figa-C; SEQ ID NO: 22). The DNA sequences of the introns of the human OB gene were obtained (Fig. 20), and they were used to obtain PCR primers to amplify the coding sequence of the OS gene from human genomic DNA so as to identify mutations or allelic variants of the OB gene. All procedures were carried out in accordance with the methods described in detail above. Specific PCR primers for amplification of human OB genomic DNA are described in the corresponding example below.

The current hypothesis is that heterozygous mutations in the ob gene can be associated with mild / moderate obesity, while homozygous mutations can be associated with various diagnostic tests for obesity based on DNA sequences. If this is the case, then it will be possible to identify people at risk of developing obesity and to use drugs and / or change the lifestyle of such people before the body weight increases significantly.

Alternatively, the presence of microsatellites that segregate with mutant forms of the human OB gene may be useful for diagnosis. Various PCR primers, including those based on the nucleotide sequence shown in FIGS. 20A-C, can also be used for these purposes.

The OB gene can also be used to determine the RNA and protein it encodes for malnutrition. When identifying a specific case of such violations, it is very important to know whether the OB RNA and / or the protein encoded by it is unregulated or subjected to downward regulation. Thus, if a person with obesity has elevated levels of OB, the problem is most likely a down regulation of OB. When the OB is reduced, it is likely that inadequately low OB levels can lead to obesity (regardless of whether there is a defect in the OB gene). In contrast, if a cancer or AIDS patient who has lost weight has elevated OB levels, it can be concluded that an inadequately high expression of OB is responsible for weight loss.

Cloned human cDNA can be used to determine human OB RNA levels. In addition, a recombinant human protein can be obtained and used for immunological analysis to determine the fat content and, possibly, the levels of OB protein in blood plasma.

Therapeutic application

The polypeptides, nucleic acids and antibodies obtained according to the invention have significant therapeutic potential. Preferably, a therapeutically effective amount of such an agent is used in conjunction with a pharmaceutically acceptable carrier, diluent or excipient.

The term "pharmaceutically acceptable" refers to compounds and compositions that are physiologically inert and usually do not cause allergic and similar adverse reactions, for example, disorders of the stomach, dizziness, etc. when administered to humans. Preferably, the term “pharmaceutically acceptable”, as used herein, is that which is approved by an official agency of the federal or state government or listed on the United States Pharmacopeia or other officially registered Pharmacopoeia for use in animals and, more preferably, in humans. The term “carrier” refers to a diluent, adjuvant, excipient, or “carrier,” with which the desired compound is used. Such pharmaceutical carriers can be sterile liquids, such as water and oil, including petroleum, animal, vegetable or synthetic origin, for example soybean oil, mineral oil, sesame oil, peanut oil, etc. Water or saline solvents, aqueous dextrose and glycerol solutions are preferably used as carriers, in particular for injectable solutions. Suitable pharmaceutical carriers are described by Martin, Remington's Pharmaceutical Science, 18 ^th Ed., Mack Publishing Co., Easton, PA, (1990).

The term “therapeutically effective amount” as used herein means an amount sufficient to reduce at least about 15%, preferably at least 50%, more preferably at least 90%, and most preferably to prevent a clinically significant deficiency of activity, functioning and response in the host body. Alternatively, a therapeutically effective amount is sufficient to improve a clinically significant condition. The introduction of recombinant OM polypeptide leads to weight loss, in particular, reduction of adipose tissue. OB polypeptide can be obtained using standard bacterial expression vectors and / or expression vectors in mammalian cells, synthetically or purified from plasma or serum, as described below. Alternatively, increased expression of the native OB polypeptide can be induced by homologous recombination, as described above.

A decrease in the activity of the OB polypeptide (when using antagonists, inhibitors, neutralizing antibodies, or antisense molecules) should lead to weight gain, which may be desirable to correct the weight loss associated with cancer, AIDS, or anorexia nervosa. Modulation of OM activity may be useful for reducing body weight (by increasing OM activity) or increasing body weight (by decreasing OM activity).

Polypeptide Based Therapeutic Use

In the simplest case, the OB gene determines the body weight of mammals, in particular, humans and mice. The OB gene product and correspondingly related molecules appear to be part of the signaling pathway through which adipose tissue interacts with the brain and other organs. It is believed that the OB polypeptide is a signal molecule, i.e. hormone.

The polypeptide OB gene, its functionally active fragment or antagonist, can be administered orally or parenterally, preferably parenterally. Since metabolic homeostasis is an ongoing process, it is preferred that the release of the appropriate modulator is controlled. For example, a polypeptide can be administered by intravenous infusion, an implantable osmotic pump, liposomes, a transdermal route, or other method. In one case, a pump can be used (Longer et al., Eds., Medical Application of Controlled Release, CRC Pres., Boca Raton, Florida (1974); Sefton, CRC Crit. Ref. Biomed. Eng., 14: 201 ( 1987); Buchwald et al., Surgery 88: 507 (1980); Saudek et al., N. Engl. J. Med. 321: 575 (1989)). Alternatively, polymeric materials may be used (Langer, 1974, see above; Sefton, 1987, see above; Smolen et al., Eds., Controlled Drug Bioavailability, Drug Product Design and Performance, Wiley, New York (1984) ; Ranger et al., Macromol. Sci Rev. Macromol. Chem., 23: 61 (1983); see also Levy et al., Science, 228: 190 (1985); During et al., Ann Neurol., 25 : 351 (1989); Howard et al., J. Neurosurg, 71: 105 (1989)). In addition, a drug-controlling system can be placed in close proximity to a therapeutic target, i.e. brain, so as to regulate only the systemic dose (see, for example, Goodson, in Medical Applications of Controlled Release, vol. 2 pp. 115-138 (1984)). Other release control systems are discussed in review by Langer, Science, 249: 1527-1533 (1990). Alternatively, the therapeutic compound may be used in a capsule (vesicle), in particular a liposome (see Langer, 1990, supra; Treat et al., In Liposomes in the Therapy of Infectious Disease and Cancer, Lopes-Berestein and Fidler (eds. ), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., Pp. 317-327; see ibid.). In yet another embodiment, recombinant cells that are transformed with the OB gene and express high levels of the polypeptide can be transplanted into a subject that needs an ob polypeptide. Preferably, autologous cells that are transformed with OB are transplanted in order to avoid rejection; alternatively, the technique can be used to screen non-autologous cells that produce soluble factors using a polymer matrix that prevents immune recognition and rejection.

The polypeptide OB can be used intravenously, intraarterially, intraperitoneally, intramuscularly or subcutaneously. Alternatively, an properly-dosed OB polypeptide may be administered by nasal or oral route. Constant maintenance of OM can be achieved by administering a therapeutically effective dose (i.e., a dose effective to induce metabolic changes in a subject) at appropriate time intervals, for example, daily, every 12 hours, etc. These parameters depend on the severity of the disease to be treated, other factors, for example, modifications to the diet used, patient weight, age, gender, etc., which is determined in accordance with normal medical practice by a specialist in this field.

Pharmaceutical Compositions

Another aspect of the invention relates to pharmaceutical compositions. Such pharmaceutical compositions may be administered by injection, by oral route, pulmonary, nasal, or some other. In general, the pharmaceutical compositions provided by the invention comprise effective amounts of the protein or its derivatives obtained according to the invention in combination with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and / or carriers. Such compositions include diluents based on various buffers (e.g. Tris-HCl, acetate, phosphate), pH and ionic strength, additives such as detergents and solubilizing agents (e.g. Tween 80, Polysorbate 80), antioxidants (e.g. ascorbic acid, sodium metabisulfate), preservatives (e.g., Thimersol, benzene alcohol) and excipients (e.g., lactose, mannitol). In some cases, pharmaceutical compositions are included in polymeric materials such as polylactic acid, polyglycolic acid, etc., or in liposomes. Hyaluronic acid may be used. Such compositions may affect the physical condition, stability, in vivo release rate and in vivo clearance rate of the claimed proteins and their derivatives. See, for example, Martin, Remington's Pharmaceutical Sciences, 18 ^th Ed. (1990, Mack Publishing Co., Easton, PA 18042), pp. 1435-1712. The work is given here as a reference. Compositions can be prepared in liquid form, in the form of a dry powder, for example, in lyophilized form.

Oral administration

The present invention provides the use of compositions prepared in dosage and packaged form, by oral route, which is generally described in the book. Martin, Remington's Pharmaceutical Sciences, 18 ^th Ed. (1990, Mack Publishing Co., Easton, PA 18042), chapter 89, which is incorporated herein by reference. Dosage solid forms include tablets, capsules, pills, lozenges, granules, balls, etc. In addition, proteininoid or liposomal encapsulation can be used to package and dispense the composition (e.g., US Pat. No. 4,925,673 discloses proteinoid microspheres). Liposome encapsulation can be used, and liposomes are constructed using various polymers (see, for example, US Patent No. 5,013556). A description of possible solid dosage forms for therapeutic use is given by Marshall in vol. Modem Pharmaceutics, Chapter 10, Banker and Phodes ed., (1979); this book is provided here as a reference. In General, the formulation of the drug may include protein (or chemically modified protein) and inert ingredients that protect the active principle of the drug from exposure to the microenvironment of the stomach and ensure the release of biologically active material in the small intestine.

In a particular embodiment of the invention, dosage forms of the above-described protein derivatives for oral administration are prepared. The protein can be chemically modified so that the oral administration of the derivative is effective. In general, chemical modification involves the attachment of at least one group to a protein or peptide molecule, when this group provides inhibition of proteolysis and the entry of the drug into the bloodstream from the stomach or intestines. In addition, it is desirable that there is increased protein stability and increased circulation time in the body. Examples of such groups include polyethylene glycol, ethylene glycol and propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone and polyproline. Abuchowski et ai, 1981, see above; Newmark et al., J. Appl. Biochem., 4: 185-189 (1982). Other polymers that can be used include poly-1,3-dioxolane and poly-1, 3, 6-thioxoxane. As noted above, the use of polyethylene glycol is preferred for therapeutic use. For a protein (or derivative thereof), the release region may be the stomach, small intestine (duodenum, jejunum, ileum) or large intestine. One of skill in the art can select a form of the drug that will not dissolve in the stomach, and the drug will be released in the duodenum or in another part of the intestine. Preferably, the release is not accompanied by undesirable effects of the microenvironment of the stomach, which is achieved by protecting the protein (or its derivative) or by providing the release of biologically active material “outside” the stomach, say, in the small intestine.

To ensure complete resistance to the gastric microenvironment, it is necessary to have an insoluble coating, at least at pH 5.0. Examples of the most common inert ingredients that are used for enteric coating are cellulose acetate trimellitate (CAT), hydroxypropyl methylcellulose phthalate (HPMC), HPMC 50, HPMC 55, polyvinyl acetate phthalate (PVAP), Eudragit L30D, Aquateric acetal, phthalate, Eudragit S and Shellac. These coatings can be used as mixed films.

The coating or mixture of coatings can be used in the manufacture of tablets that are not intended to be protected from the effects of the stomach environment. It can be sugar coatings or coatings that provide easier swallowing. Capsules may have a hard shell (e.g., gelatin) to deliver a dry form of the drug, i.e. powder; in the case of a liquid form, a soft gelatin shell may be used. The shell of the tablets may consist of thick starch or other “food” materials. For pills, lozenges, molded tablets or powders, “moisturizing” technologies can be applied.

Therapeutic preparations can be included in the packaging in the form of granules or pills with a particle size of about 1 mm. The drug for administration with capsules can be used in the form of a powder, weakly compressed tampons. The medicine can be obtained by compression. The composition of dosage forms may include color, flavoring and providing a different smell of additives. For example, a protein (or its derivative) can be packaged (for example, as a part of liposomes or by inclusion in microspheres) and then introduced into the composition of a food product, say, a cooling drink containing carriers of color, smell and taste. You can increase or decrease the amount of the drug administered with an inert material. Such diluents may contain carbohydrates, especially mannitol, α-lactose, anhydrous lactose, sucrose, modified dextrans and starch. Certain inorganic salts may be included as fillers, including calcium triphosphate, magnesium carbonate and sodium chloride. Commercial solvents are known such as Fast-Flo, Emdex, STA-Rx 1500, Emcompress and Avicell.

Solid dosage forms may include disintegrants. As disintegrants, starch can be used (without limitation), including commercial starch-based disintegrator, Explotab, as well as sodium starch glycolate, Amberlite, sodium carboxymethyl cellulose, ultramilopectin, sodium alginate, gelatin, orange peel, carboxylic acid and bentonite. Disintegrants also include insoluble cation exchange resins. Powdered sticky substances can be used as disintegrants and binders, which include agar, karaya and tragacan. Alginic acid and its salt can also be used as disintegrants. Binding compounds can be used to formulate a therapeutic agent in the form of a solid tablet and include materials derived from natural products such as tragacan, starch and gelatin. Other binding components include methyl cellulose (MS), ethyl cellulose (ES) and carboxymethyl cellulose (CMC). For the granulation of therapeutic drugs, alcohol solutions of polyvinylpyrrolidone (PVP) and hydroxypropyl methylcellulose (HPMC) can be used.

To prevent the destruction of the therapeutic drug during molding, compounds that prevent friction can be included in its composition. Lubricants can be used in the composition of the layer between the therapeutic start and the inert shell, which include (without limitation) stearic acid, including its calcium and magnesium salt, polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils and waxes. Soluble lubricants, such as sodium lauryl sulfate, magnesium lauryl sulfate, polyethylene glycol of various mol. masses and Carbowax 4000 and 6000.

Special compounds are used to improve the fluidity of the drug during the packaging process and to facilitate compression. These include starch, talc, pyrogenic silica and hydrated silicoaluminate.

Surfactants can be used as a “moisturizing” agent to ensure the solubility of the therapeutic agent in the aquatic environment. Surfactants include anionic detergents such as sodium laurisulfate, sodium dioctyl sulfosuccinate and sodium dioctyl sulfonate, and cationic detergents such as benzalkonium chloride or benzetholium chloride. The list of possible non-ionic detergents that may be part of the therapeutic drug as surfactants includes lauromacrogol 400, polyoxyl 40 stearate, hydrogenated polyoxyethylene castor oil 10, 50 and 60, glylerol monostearate, polysorbate 40, 60, 65 and 80, sucrose fatty acid ester methyl methyl cellulose and carboxymethyl cellulose. These surfactants can be included in the composition of the drug based on a protein or its derivative both individually and in a mixture in various ratios.

To facilitate the capture of the protein (or its derivative), additives, for example fatty acids, in particular oleic, linolinic, can be used.

It is advisable to control the release of the drug. The drug can be included in an inert matrix, which provides release due to diffusion and leaching mechanisms, i.e. the resin. Slowly disintegrating matrices may be included in the preparation. Another form of controlled release of a therapeutic agent is based on the Oros therapeutic system (Alza Corp.)., I.e. the medicine is enclosed in a semipermeable membrane, which allows water to enter and “squeeze” the medicine through a specific small hole formed due to osmotic effects. Some enteric coatings also provide a release effect. In the process of obtaining the finished form of the drug, other coatings can be used. These include various sugars that can be prepared in a special form. The therapeutic drug can be used as a film-coated tablet; The materials used in this case are divided into two groups. The first includes non-energy materials, which include methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, methyl hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, sodium carboxymethyl cellulose, Providen and polyethylene glycols. The second group includes enteric materials, which include the well-known phthalic acid esters.

A mixture of materials may be used to provide an optimal coating film. Such a film can be obtained using a special form, in the form of a compressed or liquid shell.

Pulmonary use

The invention provides pulmonary use of the claimed protein (or its derivatives). A protein (or its derivative) penetrates the lungs of mammals when inhaled and passes through the pulmonary epithelium lining the bloodstream. Many works are devoted to this problem. For example, Adjei et al .. Pharmaceutical Research, 7 (6): 565-569 (1990); Adjei et al., International Journal of Pharmaceutics, 63: 135-144 (1990) (leuprolide acetate); Braquet et al., Journal of Cardiovascular Pharmacology, 13 (suppl. 5): 143-146 (1989) (endothelin-1); Hubbard et al. Annals of Internal Medicine, 3 (3): 206-212 (1989) (αl-antitrypsin); Smith et al., J. Clin. Invest., 84: 1145-1146 (1989) (αl proteinase); Oswem et al., “Aerosolization of Proteins”. Achievement of the second symposium on the use of drugs through the lungs. Keystone, Colorado, (March 1990) (recombinant human growth hormone); Debs et al., J. Immunol., 140: 3482-3488 (1988) and Platz et al., U.S. Patent No. 5,284,656 (granulocyte colony stimulating factor). Various mechanical devices for the pulmonary use of therapeutic products are included within the scope of the present invention, including nebulizers, devices with respirable dose counters, devices for inhaling powdered preparations that are similar to those known in the art. Some commercially available devices suitable for practicing the invention include an Ultravent atomizer manufactured by Mallinckrodt, Inc., St. Louis, Missouri; Acorn II nebulizer manufactured by Marquest Medical Product, Englewood, Colorado; a respiratory dose meter manufactured by Glaxo Inc., Research Triangle Park, North Colorado; and a powder inhalation apparatus manufactured by Fisons Corp., Bedford, Massachusetts.

All such devices require the use of certain types of drugs suitable for the administration of a protein (or its derivative). Typically, each type of preparation corresponds to the device used and may include a suitable “push” material in addition to the usual diluents, adjuvants and / or carriers used in therapy. In addition, it is possible to use liposomes, microcapsules or microspheres, inclusion complexes or other types of carriers. Depending on the method of chemical modification or the type of device, a chemically modified protein can be prepared in various pharmacological forms.

Pharmacological forms for use in a nebulizer, both jet and ultrasound, typically include protein (or a derivative thereof) dissolved in water at a concentration of 0.1-25 mg of biologically active protein in 1 ml of solution. The pharmacological form may also include a buffer and simple sugar (for example, to stabilize protein and regulate osmotic pressure), and for use in a nebulizer, also a surfactant to reduce or prevent induced surface protein aggregation caused by solution atomization during aerosol formation.

Pharmacological forms for use in devices with a respirable dose counter basically contain a metered powder including protein (or its derivative) suspended in a “push” material with the addition of surfactant. The “repelling” material can in principle be any suitable for this purpose, such as chlorofluorocarbon, hydrochlorofluorocarbon, hydrofluorocarbon or hydrocarbon, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol and 1, 1, 1, 1, 2-tetrafluoroethane or combinations thereof. Suitable surfactants include sorbitan trioleate and soya lecithin. Can be used as a surfactant and oleic acid.

Pharmacological forms for dispensing from a powder inhalation device contain a metered dry powder comprising protein (or a derivative thereof), and may contain a bulking agent such as lactose, sorbitol, sucrose or mannitol in amounts that allow the powder to be ejected from the device, for example, 50- 90% (by weight) of the total weight of the drug. Most preferably, the protein (or its derivative) is prepared in the form of particles with an average size of less than 10 microns (microns), most preferably 0.5-5 microns for the most effective "delivery" to the distal lungs.

Nasal application

Nasal use of a protein (or derivative thereof) is also encompassed by the present invention. Nasal administration allows the protein to enter the bloodstream immediately after the administration of the therapeutic product into the nose without the need to deposit the product in the lungs. Pharmacological forms for nasal drug delivery include those that contain dextran or cyclodextran.

Methods of treatment, methods for producing medication

Another aspect of the invention relates to methods for treating and receiving a medicament. The conditions modulated or facilitated by the administration of the claimed compounds are indicated above.

Dosage

For all of the above molecules, the above information should be considered taking into account the appropriate doses for the treatment of various conditions in different types of patients, and a specialist in this field of knowledge, depending on the medical indications, age and health of the patient, can choose the right dose. In general, for injection or infusion, the dose is 0.01 μg - 10 mg of biologically active protein in relation to 1 kg of body weight (calculation is made on the mass of protein as such without chemical modification). The dose may vary depending on the half-life in the circulating blood stream of the protein or its derivative, whether the polypeptide is administered in a single dose or continuous infusion, as well as on the pharmacological dose.

Use with other compounds

For the treatment of obesity, the claimed protein (or its derivative) can be used in combination with one or more pharmaceuticals used to treat other clinical disorders accompanying obesity, such as those used to treat diabetes (insulin), high blood pressure, high cholesterol and other adverse conditions associated with obesity. In addition, appetite suppressant drugs, i.e. amphetamines. The use may be simultaneous (for example, administration of a mixture of the claimed protein and insulin) or may be in seriatim.

Nucleic Acid Treatment

The OB gene can be introduced into human fat cells during gene therapy of obesity. Such therapy is expected to reduce body weight. In contrast, the introduction of antisense constructs into human fat cells should reduce the level of active OM polypeptide and increase the degree of obesity.

In one case, a gene encoding an OB polypeptide is introduced in vivo into a viral vector. Such vectors include attenuated or defective DNA viruses, such as (but not limited to) herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV) and the like. Defective viruses that have completely or practically lost viral genes are preferred. Defective viruses are not infectious after being introduced into the cell. The use of defective viruses is accompanied by their introduction into a specific, special area of the cell, while the virus does not infect other cells. Adipose tissue is a special target. Examples of specific vectors include, but are not limited to, a vector based on defective herpesvirus 1 (HSV1) (Kaplitt et al., Molec. Cell. Neurosci., 1: 320-330 (1991)), an attenuated adenovirus vector, such as a vector described by Stratford-Perricaudet et al., J. Clin. Invest., 90: 626-630 (1992) and a vector based on a defective adeno-associated virus (Samulski et al., J. Virol., 61: 3096-3101 (1987); Samulski et al., J. Virol., 63: 3822-3828 (1989)).

Alternatively, the gene may be inserted into a retroviral vector, for example, as described by Andersen et al., US Patent No. 5,399,346; Mann et al., Cell, 33: 153 (1983); Temin et al., U.S. Patent No. 4,650,764; Temin et al., U.S. Patent No. 4,980,289; Markowitz et al., J. Virol., 62: 1120 (1988); Temin et al., US Patent No. 5,224,263; International Published Application No. 95/07358 of March 16, 1995, Dougherty et al., And Kuo et al., Blood, 82: 845 (1993).

Alternatively, the vector can be introduced in vivo by lipofection. The use of liposomes for encapsulation and in vitro nucleic acid transfers has increased over the past decade. To correct the difficulties and dangers associated with liposome-mediated cell transfection, synthetic cationic lipids have been developed to produce liposomes to transfect in vivo the marker coding gene (Felgner et al., Proc. Natl. Acad. Sci., USA, 84: 7413- 7417 (1987); see Mackey et al., Proc. Natl. Acad. Sci., USA, 85: 8027-8031 (1988)). The use of cationic lipids can provide encapsulation of negatively charged nucleic acids and fusion with negatively charged cell membranes (Felgner et al; Science, 337-388 (1989)). The use of lipofection for introducing exogenous genes into specific organs in vivo has various advantages. The molecular targeting of liposomes to specific cells is one of them. Obviously, targeted transfection of a particular cell is extremely important in the case of tissue with a heterozygous cell population, such as the pancreas, liver, kidney, and brain. To ensure targeting, lipids can be chemically linked to other molecules (see Mackey et al., 1988, supra). Targeted peptides, such as hormones or neurotransmitters, proteins, such as antibodies, or non-peptide molecules, can be chemically coupled to liposomes.

In addition, it is possible to introduce the vector in vivo as “naked” plasmid DNA. Naked DNA vectors for gene therapy can be introduced into target host cells by known methods, for example, transfection, electroporation, microinjection, transduction, cell fusion, using DEAE-dextran, calcium phosphate precipitation, using a gene gun or transporter DNA vectors (see, for example, Wu et al., J. Biol. Chem., 267: 963-967 (1992) ;, Wu et al., J. Biol. Chem., 267: 14621-14624 (1988 ); Hartmut et al., Canadian Patent Application No. 2,201,311, filed March 15, 1990).

Agricultural use

The OB gene can be isolated from domestic animal cells, followed by obtaining the corresponding OB polypeptide. In a special case (see below), a sample constructed on the basis of the mouse OB gene hybridizes with the corresponding homologous coding sequences of a large number of animal species. As discussed above in the description of methods of treating humans, recombinant proteins that can be used in relation to domestic animals can also be obtained. The introduction of the polypeptide can contribute to the production of linear meat animals, for example cows, sheep, pigs, poultry, etc. The use of OB analogues of the polypeptide is preferred, although the invention provides the use of anti-analogues of the polypeptide. Since the OB polypeptide contains approximately 160 amino acid residues, it cannot be highly immunogenic. Thus, administration of a non-autologous polypeptide may not provide an immune response.

Alternatively, the introduction of cloned genes into transgenic domestic animals is capable of providing a potential reduction in body weight and obesity due to overexpression of the OM transgene. The simplest way to achieve this is to target the transgene OB into adipose tissue using an own or other adipose tissue specific promoter.

In contrast to the above, in other cases, it may be desirable to increase the weight of adipose tissue, for example, upon receipt of meat (Kobe beef) or fatty liver for special dishes (foie gras). This can be achieved by targeting the antisense OM transgene to adipose tissue or by using a gene “knockout” technique. Alternatively, when it is necessary to increase the percentage of adipose tissue relative to total body weight, an inhibitor or antagonist of the OB polypeptide can be used. Such antagonists or inhibitors include, but are not limited to, antibodies that interact with the polypeptide and fragments of the polypeptide that bind but do not activate the OB receptor, i.e. antagonists of OB polypeptide.

Cosmetic use

OB polypeptide is essential for cosmetic use other than health care. In particular, since the O B polypeptides obtained according to the invention, including their derivatives and analog agonists, are used to modulate the amount and quality of fat deposits in animals, they can be successfully used to reduce unsightly deposits of fatty tissue in humans, for example, in the abdomen, hips, necks, chins, which are not considered obesity in the full sense of the word, but nonetheless worsen the appearance of the individual. It is believed that a decrease in the amount of adipose tissue can be achieved, in particular, by a decrease in appetite, i.e. a decrease in the amount of food consumed or an increase in overall metabolism, as well as both. Thus, the OB polypeptide, its derivatives or agonists can be introduced to the individual to provide cosmetic changes in the deposits of adipose tissue due to the modulation of fat depots or reduce appetite, both due to both. In addition, the claimed compositions and methods can be used in combination with various procedures, such as plastic surgery that improves the appearance of the body (for example, liposuction or laser surgery to reduce body weight by suctioning or removing adipose tissue), physical exercises (especially running and special training), low-fat diet, hypnosis, biological methods, etc., which can be applied by anyone who wants to try to reduce the percentage of adipose tissue and improve their appearance.

In accordance with the foregoing, the invention relates to a method for effectively cosmetic modulation of adipose tissue in an individual, comprising the use of a modulating amount of an OB polypeptide or an agonist analogue or derivative thereof in relation to an individual who wants to improve the appearance of his body through cosmetic modulation of adipose tissue. In particular, modulation of adipose tissue is a consequence of appetite suppression. Preferably, the modulation of adipose tissue consists in its reduction.

On the other hand, the invention relates to a method for providing effective cosmetic loss of adipose tissue, comprising a procedure for changing the appearance of a body and the use of an amount of OM modulating adipose tissue of a polypeptide or its derivative or analog agonist in relation to an individual who wishes to improve the appearance of the body due to cosmetic modulation of adipose tissue.

OB receptor

The study of small molecules of agonists and antagonists of OB factor can be significantly accelerated by the release of the corresponding receptor. This can be achieved by obtaining the active OB of the polypeptide and its use for screening the expression library in accordance with standard methods. Receptor binding in the expression library can be tested using a recombinant polypeptide obtained by bacterial or other expression vectors, and taking into account its effects in a short time and with constant use of the expression library in relation to the cells or by directly determining the binding of the OB polypeptide in the cells.

It is currently believed that the OB receptor appears to be localized in the hypothalamus and possibly in the liver. CDNA libraries from these tissues can be obtained in conventional expression cloning vectors. Such cDNA clones can be introduced into COS cells and the resulting transformants are screened using an active ligand to identify COS cells expressing the OB receptor. Positive clones are isolated to isolate the cloned receptor. The cloned receptor can then be used in combination with an OB ligand (presumably a hormone) to obtain the necessary components for the screening of small molecules of modulators of OM. An assay system that can be used in accordance with the present invention is known as a receptor assay technique. In this case, the research material is suitably labeled and then certain cell colonies are inoculated with a predetermined amount of labeled and unlabeled material, and then the amount of labeled material bound to the cell receptors is determined. The experiment determines the difference in affinity between the labeled and unlabeled material.

Accordingly, a certain amount of purified weight modulator can be radiolabeled and coupled, for example, with antibodies or other inhibitors, and then binding studies are carried out. Prepare media with different amounts of labeled and unlabeled free weight modulator, into which cell samples are placed, followed by incubation. The resulting cell monolayer is washed, solubilized and counted in a γ-counter for the time required to obtain a standard deviation of <5%. The data are then analyzed using the Scatchard method and summarize the observations and conclusions in accordance with the activity of the material. All of the above is an example and illustration of the methodology for the study of the receptor, in particular, when the cellular binding activity of the studied material can serve as a differentiating property. In turn, receptor testing can be especially useful in identifying specific receptors of the claimed modulators, such as the db receptor.

Another research method provided by the claimed invention is known as “cis / trans” analysis. In short, it uses two genetic constructs, one of which is usually a plasmid that constantly expresses a receptor of interest when transfected into a suitable cell line, and the second is a plasmid that expresses a marker, such as luciferase, under the control of a receptor / ligand complex. Thus, for example, if it is necessary to study compounds for their ability to be a ligand for a specific receptor, one of the plasmids is designed in such a way that it expresses the receptor in the selected cell line, while the second plasmid will contain a promoter linked to the luciferase gene into which a gene encoding an element, possibly reacting to a receptor. If the test compound is a receptor agonist, the ligand will bind to the complex with the receptor and the resulting complex will attach a reacting element and initiate transcription of the luciferase gene. Then, chemiluminescence is detected photometrically and a dose-response curve is constructed and compared with that for known ligands. The above technique is described in detail in US Patent No. 4981784 and PCT International Application No. WO 88/03168, which any specialist can contact.

After identification of recombinants expressing the gene sequence of the OB receptor, the OB receptor can be analyzed. This is ensured by a study based on the physical or functional properties of the OM receptor, including radioactive labeling of the receptor followed by gel electrophoresis, immunoassay, ligand binding, etc. Moreover, antibodies to the ob receptor can be obtained.

The structure of the OB receptor can be analyzed by various methods known from the state of the art. It is preferable to determine the structure of various domains, especially the OB of the binding site. Structural analysis can be carried out by determining the similarity of the sequence with other known protein sequences, in particular hormones and protein receptors. The degree of similarity (homology) can serve as a basis for predicting the structure and function of the OB of the receptor or its domain. In a special case, sequence comparison can be performed by analyzing sequences from a gene bank, for example, using the FASTA and FASTP programs (Pearson et al., Proa. Natl. Acad. Sci., USA, 85: 2444-48 (1988)).

The protein sequence can be further characterized by hydrophilicity studies (see, for example, Norr et al., 1981, supra). The hydrophilicity profile can be used to identify the hydrophobic and hydrophilic regions of the OB receptor protein, which in turn will make it possible to identify extracytoplasmic, membrane-binding and intracytoplasmic regions.

The analysis of the secondary structure can be carried out (see, for example, Chou et al., 1974, above) to identify regions of the OB receptor having a specific secondary structure.

Various well-known computer programs can be used to predict the secondary structure, open reading frames, translation mechanisms, actions, structures, etc.

By providing a source of recombinant OB of the polypeptide and isolation of the OB receptor (i.e., the db gene product), the present invention reveals the structural determination of the active conformation of the OB polypeptide and OB receptor or their domains. In particular, sufficient material is available for nuclear magnetic resonance (NMR), infrared (IR), Raman and ultraviolet (UV), especially based on circular dichroism (CD) spectroscopic analysis. In particular, NMR provides a very accurate structural analysis of molecules in solution, which maximally matches their natural environment (Marion et al., 1983, supra; Bar et al., 1985, supra; Kimura et al., 1983, supra;). Other structural analysis methods may also be used. These include, in particular (without limitation indicated), X-ray crystallography (Engsiom, 1974, supra).

More preferably, co-crystals of the OB polypeptide and the OB receptor can be studied. An analysis of joint crystals allows one to obtain detailed information on binding, which, in turn, serves to construct a model of ligand agonists and antagonists. Computer simulation can also be used, especially in combination with NMR or X-ray crystallography (Fletlerick et al., Eds., Computer Graphics and Molecular Modeling, in Current Communications in Molecular Biology, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1986 )).

Identification and isolation of the gene encoding the OB receptor according to the invention provides expression of the receptor in larger quantities than can be isolated from natural sources, and in addition, its expression in indicator cells that are specifically adapted to detect receptor activity after transfection or transformation of cells. Accordingly, in addition to revealing the structure of agonists and antagonists based on the structure of the OB polypeptide, the invention provides an alternative way of identifying specific OB receptor ligands using various screening methods known in the art.

The invention can be better understood using the Examples below, which are given here to illustrate it, and not to limit it.

EXAMPLES

The following describes the method used to identify the genetic material that is the subject of the invention. It includes four successive stages; A) Genetic mapping, B) Physical mapping, C) Isolation of candidate genes, and D) Identification of mutations. Considering that the mouse gene was isolated (stage D), the human homologous gene was identified, and both genes and possible proteins were characterized. The stages are described in more detail below.

A. Genetic mapping

The ob mutation was segregated in genetic crosses, and standard linkage analysis was used to determine the position of the mutation associated with RFLPs (restriction fragment length polymorphism). The data allowed the OB gene to be placed in about 5 cm — the interval on the proximal region of mouse chromosome 6 (5 cm — this is the genetic distance corresponding to 5 explicit genetic crossovers (resulting from crossing over) per 100 animals. For genetic mapping, data were used on 771 informative meiosis, which were obtained by Friedman. et al., (1991, supra). The genetic locus that was mapped for OM has been described previously. The two closest RELPs described have been identified using samples obtained on Peninsula oncogenes carboxypeptidase and met.

The genetic resolution of the experiments described above was inadequate to the clone ob, mainly because none of the genetic markers were closely related to it. Additional samples were identified and extended genetic crosses were identified to identify closely related RELPs. A method known as chromosomal microdissection (Bahary et al., Mammalian Genome, 4: 511-515 (1993)) was used to isolate random DNA regions from the proximal region of mouse chromosome 6. Individual cloned samples were tested for close association with ob. Based on these experiments, a D6Rck 13 sample, also designated psd 3, was taken and used for further analysis due to its genetic proximity to OB.

This test was used to genotype the descendants of ob 835 from interspecific and interspecific crosses, which showed that D6Rck 13 is not recombinant in all 835 animals, as reported by Bahary et al. In the case of physical mapping, a new polymorphic marker was identified from the cosmid subclone originating from YAC 53A6. This new marker was located between D6Rck 13 and the OB gene and was used to genotype an additional 771 informative meiosis in interspecific crossbreeding and reverse crossbreeding. One animal, # 167, was identified as carrying a recombinant crossover between ob and D6Rck 39. These studies indicate that D6Rck 39 / D6Rck 13 is located at about 0.06 cM from ob. An additional Pax 4 sample was identified at a distance of 0.12 cM proximal to ob. Pax 4 was recombinant in two animals, # 111 and # 420. Pax 4 is a pseudogen that is pre-mapped on the proximal region of chromosome 6 of the mouse of Gruss et al (Gruss et aL, Genomics, 11: 424-434 (1991)). Based on this, it was shown that the OB gene is located in about 0.2 cM interval between Pax 4 and D6Rck 13. This led to attempts to clone interpositional DNA to isolate OB.

B. Physical mapping

DNA cloning in this range involves the use of artificial yeast chromosomes (YACs) and a relatively new cloning vector that allows clones of adjacent DNA sequences longer than one million base pairs.

Artificial yeast chromosomes were isolated using D6Rck 13 and Pax 4. Purified DNA samples were prepared and used to isolate the corresponding YACs. These YACs (# 8, # 16, # 107, and # 24) were isolated and described in detail, and based on the data obtained, it was concluded that YAC 16 is a YAC that extends more distally, i.e. as close to ob. Then, the key end of YAC # 16 was obtained, and it was shown that it is closer to ob than Pax 4. This end is designated 16M (+). This conclusion was made on the grounds that this test was not recombinant in animal # 420 (like Pax 4). The end was sequenced and used in PCR analysis. PCR analysis was used to screen the YAC library. Four positive clones were isolated. Subsequent characterization of these YACs by rescue, restriction mapping, pulse gel electrophoresis and Southern blotting, along with genetic crosses, showed that two of these YACs, adu and aad, are most important for subsequent studies. YAC aad is a 550 kb non-chimeric YAC that extends most distally. Therefore, the distal end of this YAC, aad (pICL) is used for complete physical mapping. YAC adu is 370 kb non-chimeric YAC and its distal end, adu (+) is non-recombinant in all ob offspring during genetic crosses, including animals # 111 and # 167. This suggests that the OB gene is in this YAC.

To continue physical mapping based on isolation of other YACs and Pl clones, PCR analysis of the indicated two ends aad (pICL) and adu (+) is used. Important P1 clones isolated for this attempt include 498, 499, 500 (these clones were isolated using a sample obtained from aad (pICL)) and 322, 323 and 324 (these clones were isolated using a sample from adu (+) )

In the interval, YACs isolated by D6Rck 13 (53A6, 25A8, 25A9, 25A10) were characterized. Studies have shown that 53A6 extends most proximal to the aad YAC. The size of the gap between 53A6 and aad was determined, and it is about 70 kb. The key end 53A6, 53 (pICL) was then used to screen the three available YAC libraries and the P1 library. The critical P1 clone overlapped with the P1 clones isolated by aad (pICL) as described above and, therefore, was used to “close” the gap between 53 (pICL) and aad (pICL). As a result, a whole contig was cloned containing YACs and P1 clones, about 2.5 million bp in size. in length and overlapping Pax 4, 16M (+), adu (pICL), 53 (pICL), DGR6K 39 and D6Rck 13. By carefully mapping the recombination sites in animals # 111 and # 167, it was shown that the OM is in the 400 kb interval . In order to provide a working DNA source for isolating the OM gene, a plot of about 500 kb covering this non-recombinant region was isolated in 24 P1 clones. These P1 clones, including 322 and 323, which later turned out to be useful clones, were used for exon mapping. A physical map of the region of the chromosome carrying the OB is shown in Fig. 7A. 7B shows a contig of YAC. 7C shows a P1 contig.

C. Isolation of candidate genes

The method that was used to isolate the genes in this interval is exon capture. This method uses a commercial vector to identify exogenous DNA (i.e., coding sequences) by selecting a functional splice acceptor and donor sequences in the genomic DNA introduced into the test DNA construct. DNA from these P1 clones is cloned and subcloned into an exon capture vector. These clones are short inserts cloned in the BlueScript vector. Each clone is amplified in PCR using PCR primers corresponding to plasmid sequences that flank the insert. PCR amplification is carried out in bacteria carrying the plasmid. Reactions are carried out using a Biomer robot. PCR products were subjected to electrophoresis on a 1% agarose gel in TBE buffer containing ethidium bromide. The exon capture technique is modified to eliminate E. Coli DNA contamination from P1 clones and screen for excess exon artifacts that exceed 80-90% of the possible captured exons. The exon capture vector includes HIV sequences; a short segment of the indicated vector sequences correspond to this artifact.

An exon capture experiment is carried out using various P1 clones. The exon capture products are then amplified in PCR, selected and sequenced. The sequences of possible exons are compared with those available in the gene bank using the Blast computer program. About 15 exons are selected for further study in PT-PCR, Northern blotting and zoo-blotting for the presence of the corresponding RNA or conserved sequences. Seven of the 15 possible exons, 325-2, 323-9, 322-5, D1-F7, 1H and 2G7, were found to encode an RNA transcript. 325-2 is a specific testis gene; 323-8 and 323-9 are most likely two exons of the same gene, expressed mainly in the brain and kidneys. IN3 and 322-5 correspond to two transcripts detected in the brain at a low level. D1-F7 is an exon from a pre-cloned gene of gynosin monophosphate dehydrogenase, which is expressed everywhere. None of these genes appears to encode OB. 2G7, which is an OB exon, is discussed below.

After three unsuccessful attempts at exon capture of the OB gene, another attempt was made based on combining DNA from all P1 clones of the critical OB region. These clones included clones 258, 259, 322, 323, 324, 325, 498, 499, 500, 653, 654 and others. Then, P1 clones 258, 260, 322, 498, and 499 were subcloned into the exon capture vector, and then various plates with bacterial clones were obtained, each of which contained a possible exon. Approximately 192 clones obtained corresponded to possible OB genes. As noted above, a corresponding artifact was observed, consisting in the fact that many isolates contained two trapped exons originating from the vector. Thus, clones were identified both by size and by hybridization of DNA samples corresponding to this artifact with the corresponding bands in the Southern blot gel. In this way, 185 out of 192 clones were excluded from further consideration. The exclusion of artifacts on the basis of one size was impossible, since ultimately it would lead to the exclusion of an exon corresponding to OM.

Thus, for further research, out of 192 exons, seven were selected. Matrices were obtained for sequencing data of seven exons and sequencing was performed. Sequences of seven exons were analyzed and found that seven exons are identical and one is a clear artifact. In particular, clone 1D12 contained an HIV sequence, i.e. artifact strip. Three left exons were selected for further analysis, namely 1F1, 2G7 and 1H3. 1F1 was eliminated because it was mapped outside the critical area. For 1H3 and 2G7, PCR primers were selected and synthesized.

The sequence of exon 2G7 was determined, which is shown in FIG. 10 (SEQ ID NO: 7). PCR primers for 2G7 were selected and synthesized. Plots of the sequence corresponding to the PCR primers are underlined. The structure of the primers is shown below:

5 'CCA GGG CAG GAA AAT GTG (T _m = 60.0 ° C) (SEQ ID NO: 8)

3 'CAT CCT GGA CTT TCT GGA TAG G (T _m = 60.0 ° C) (SEQ ID NO: 9)

These primers amplified genomic DNA under the following PCR conditions: 25-30 cycles at 55 ° C annealing for 2 ′; elongation at 72 ° C for 2 '; denaturation at 94 ° C for 1 ′ in standard PCR buffer. These primers were also used to obtain a labeled sample for incorporation of ³² P-dCTP into the PCR reaction with a corresponding decrease in the amount of cold dCTP.

PT-PCR was performed using various tissue RNAs and it was found that 207 is expressed exclusively in white adipose tissue compared to all the tissues studied (Fig. 11A). Then, ³² P-labeled 267 hybridized to the Northern blot of tissue RNA (Fig. 11B) and it was shown that the corresponding RNA is expressed at a high level in adipose tissue, but is not expressed or is expressed at a very low level in all other tissues (where signals can be the result of adipose tissue contamination of preparations of other tissues). 10 μg of total RNA from each tissue was subjected to formaldehyde agarose gel electrophoresis. The sample was hybridized with a blot at 63 ° C in a standard hybridization buffer, Papid Hybe (Amersham). The size of the RNA was approximately 4.9 kb. From this point of view, 2G7 is a real candidate for the role of the OB gene and is subject to further analysis.

D. Identification of mutations

To confirm that 2G7 encodes the OB gene, it is necessary to show the difference in expression levels of the DNA sequence of this gene in mutant animals compared with wild-type animals. Two separate mutations of the ob gene are available for study, namely C57BL / 6J ob / ob (1J) and Ckc / Smj ob / ob (2J). These mutations were later designated 1J and 2J, respectively. (Informal nomenclature is used to indicate the studied mouse lines. In the description and figures, C57BL / 6J means C57BL / 6J + / +; Ckc / Smj means SM / Crc- + ^Dac - + / +; Ckc / Smj ob / ob means SM / Crc - + ^Dac -ob ²¹ / ob ²¹ ;). RNA was obtained from adipose tissue of 1J, 2J mice and control animals. The total RNA of each sample was treated with DNAse and then transcribed back using oligo-dT as a primer and reverse transcriptase. The resulting single stranded cDNA was amplified in PCR using 207 primers (conditions described above) for the lower band and using commercially available actin primers for the upper band. RT-PCR products were dispersed on a 1% agarose TBE gel, which was then stained with bromide etiquette (Fig. 12A). Using RT-PCR, it was found that while 2G7 mRNA is expressed in 1J and all other control animals, it was completely lost in 2J mice. No signal was detected after 30 amplification cycles. This experiment directly indicates that 2G7 corresponds to the exon of the OB gene.

Since the 2J mutation is relatively recent and maintained as a coisogenic strain, this is the first significant evidence that 2G7 is an exon of the OB gene. The mutation is most likely localized in the promoter region, which leads to a general disruption of mRNA synthesis. The presence of a signal in 1J mice in this RT-PCR experiment suggests that 1J animals should carry a point mutation that does not significantly alter the size of the RNA sample. In addition, 2G7 mRNA was not detected when testing RT-PCR in four additional 2J animals.

The result is consistent with the Northern blot (Figv). RNA is obtained from the fat cells of each strain (C57BL / 6J, 1J, CKC / smj and 2J). Ten μg of said RNA was subjected to electrophoresis and blotting. The blot is tested with a 207 probe labeled with PCR by amplification of the material, i.e. bands in FIG. 11, using ³² P-dCTP in a PCR reaction. Actin serves as a control of the amount of applied RNA. The actin signal was extremely similar in all samples. There is no OB signal in the brain, since mRNA is specific for fat cells.

Northern analysis confirms that 2G7 specific RNA is absent in 2J mice. RNA ob is absent in CKC / smj ob / ob mice because the gene is broken in this mutant strain of obese animals so that RNA does not form. In addition, the level of 2G7 RNA is increased by about 10-20 times, in animals 1J and in animals db / db fat. These results are consistent with the hypothesis that OM encodes a circulating hormone or responds to the generation of a signal from fat cells that modulates body weight. The results also support the conclusion that 2G7 is an OB gene, and predict that 1J mice have a point mutation, possibly a nonsense mutation leading to premature translation termination.

Northern blots were replicated using RNA preparations from the fat cells of four different 2J animals (FIG. 13). In this study, ap 2 is a specific transcript of adipose tissue that was used as a control in much the same way as actin in Fig. 12B. There were no significant variations in the density of the ap 2 band. Ap 2 was labeled by constructing PCR primers for the published ap 2 sequence. The RT-PCR adipose cell RNA products were radioactively labeled using the same technique as for PCR labeling. This study shows the presence of OB mRNA in normal homozygous and heterozygous animals and its absence in 2J mutant animals.

A mutation was identified in 1J mice. The mutation consists in changing the base C to T, which leads to the replacement of arginine with a clear premature stop codon of amino acid 108 and, in all probability, is a 1J mutation (Fig. 14) despite the high level of expression of mRNA ob (see Fig. 12 and 13, C57BL / 6J ob / ob line).

Then, based on Southern blots, it was concluded that the 2J mutation is the result of a detectable DNA change at the 5'-end of the OB, which seems to completely disrupt RNA expression. The real nature of this possible permutation has yet to be established.

Genomic Southern DNA blotting of CKC / smj mice (CM / Ckc- + ^Dac ) and C57BL / 6J was performed using four different restriction endonucleases to determine if the ob mutant is unique in its set of fragments (Fig. 15A). About 10 μg of DNA (obtained from the genomic DNA of the liver, kidney, or spleen) was treated with the indicated restriction enzyme. DNA was subjected to electrophoresis on a 1% agarose TBE gel. Then, the DNA was transferred to the Imobilon membrane and hybridized with a PCR-labeled 2G7 probe. The key band was the uppermost band in the Bgl II digest of CKC / smj ob / ob DNA (SM / Ckc- + ^Dac ob ² / ob ² ). The indicated strip had the highest mole. weight compared to another strain, indicating a mutation in the strain.

FIG. 15B shows the Bgl II Surern blot of a genomic DNA digest of descendants of ob ²¹ / + x ob ²¹ / + crosses. Some DNA samples have only one upper band, some others only have a lower band, and a certain number of samples have both bands. Animals in which only the upper band is found have a full degree of obesity, i.e. ob ²¹ / ob ²¹ . These data indicate that the polymorphism (i.e. mutation) shown in Fig. 15A is, in the genetic sense, segregated.

EXAMPLE 1: Cloning of cDNA and sequence determination of OB

Using a PCR-labeled 207 probe, 50 mouse cDNA clones were isolated from the λgt 11 cDNA library in fatty mouse cells (Clonetech 5'-STRETCH cDNA from fatty lumps of Swiss mouse testes, # ML3005b) and 30 cross-hybridized human cDNA clones from library of λgt 10 cDNA in human fat cells (Clonetech 5'-STRETCH cDNA from abdomain, # HL1108a). Libraries were screened using the plaque transfer method. Appropriate filters were denatured in an autoclave manner. Filters were hybridized in duplicate with a PCR-labeled 2G7 probe (Rapid Hybe buffer, 65 ° C, overnight). After 2-4 h of prehybridization, the filters were washed with 2xSSC, 2% SDS, twice for 30 min at 65 ° C and exposed on an X-ray film. Positive duplicates were purified using plaques. Plaque-purified phage were amplified in PCR using commercially available vector primers, for example, λgt 10 and λgt 11. PCR reaction products corresponded to a cDNA insert for each phage with a small amount of vector sequence at each end. The bands were purified by gel electrophoresis and sequenced using an ABI automatic sequencer and vector primers as samples for DNA polymerase.

The obtained sequencing data is then checked using manual sequencing "from base to base" to correct errors in a computer program. After the sequence has been clarified, primers corresponding to the downstream position are synthesized and used to continue sequencing. Such experiments are repeated until each available cDNA clone is sequenced and synthesized in the contig. An order of about 3,000 bp is determined. from the 5'end of mRNA. One of the cDNA clones continues to the 5'-end of the mRNA, since its sequence is identical to that of the 5'RACE adipose tissue RNA product (data not shown).

Sequencing results show that there are 167 amino acids in the open reading frame (Figure 1). The consensus sequence for initiating Kozak translation includes three alenosine bases at the upstream position with respect to ATG. Two classes of cDNA were found that are characterized by the inclusion of a single glutamine codon. This residue is detected in the “immediate” position 3 'in relation to the splice acceptor 207-exon. Since the CAG codon of glutamine includes a possible AG splicing acceptor sequence, there appears to be a “slippage” in the splicing acceptor site with an apparent 3 bp deletion. in a full set of cDNA, as shown below.

The designation “ag” in the above sequences refers to the sequence of the intron in the upstream position with respect to the glutamine codon, and A G represents a possible alternative splicing site. This glutamine residue is located in a highly conserved region of the molecule and its significance for biological activity is still unknown.

A possible N-terminal signal sequence has been identified whose cleavage site is predicted to be carboxyterminal with respect to the alanine residue at position 21 of the amino acid sequence. A possible signal sequence was obtained using the von Heijne computer algorithmic method. Using this technique, the most likely signal sequence was identified in the polypeptide-coding region corresponding to amino acids 1-23 with the sequence

MCWRPLCRFLWLWSYLSYVQA ↑ VP (SEQ ID NO: 10),

in which the arrow shows a possible cleavage site of the signal sequence. The remaining amino acid sequence is highly hydrophilic and does not have any significant structural features or membrane domains other than the N-terminal signal sequence. The authors did not find consensus sequences for N-linked glycosylation or dibasic amino acid sequences indicating possible cleavage in the predicted processed protein (Sabatini et al., The metabolic basis of inherited disease, pp. 177-223, C. V. Scriver et al. , eds .. Mc Graw-Hill, New York). Base search data using Blast and Block did not identify any homologous sequences.

RNA from human adipose tissue was analyzed by Northern blotting and RNA types corresponding to the size of the mouse ob gene were detected. Sequencing and analysis of cDNA clones showed that the human OB gene also encodes a 167 amino acid polypeptide (FIGS. 2A and B and FIG. 3). Two classes of human cDNA were found, containing and not containing deletions in three base pairs (Figure 6). Human and mouse ob genes are highly homologous in the predicted coding region, but have only 30% homology in the 3 'and 5' untranslated regions. The N-terminal signal sequence is also present in the human OB polypeptide. A comparison of the sequences of the human and mouse OB polypeptide shows that the two molecules have more than 83% identity at the amino acid level (Figure 4). The N-terminal region of mature human and mouse proteins also exhibits a high degree of homology with only 6 conserved and three non-conservative amino acid substitutions among the 100 N-terminal amino acid residues.

Genomic DNA was isolated from mouse, rat, rabbit, cat, field vole, cow, sheep, pig, human, chicken, eel and Drosophila cells and digested with EcoR I. The resulting fragments were subjected to electrophoresis on 1% TBE gel. Then, the DNA was transferred onto an imobidone membrane and tested with a 2G7 PCR-labeled probe. The filter was hybridized at 65 ° C and washed with 2xSSC, 0.2% SDS at 65 ° C twice for twenty minutes for each washing procedure, i.e. the buffer was changed twice. These data indicate that the OS gene is conserved among vertebrates (Fig. 16). In this regard, it is noteworthy that more than 2 signals were detected in the eel DNA (which is fish).

In general, known factors suggest that body weight and obesity are physiologically controlled. Seven years ago, attempts were made to identify two key components of this system: the OB and DB genes. As shown in this example, the OB gene is now identified as a specific adipose tissue gene that plays a key role in regulating body weight. The product of this gene, which is most likely a secreted hormone, will have important applications in the diagnosis and treatment of nutritional disorders in humans and animals.

EXAMPLE 2: Expression of OM in bacteria

cDNA encoding human and mouse ob was cloned in the pET-15b expression vector (Novagen). This vector contains a T7 promoter in conjunction with a lac operator and expresses a fusion protein containing a tag (His-tag) and a thrombin cleavage site at the “immediately upstream” position with respect to the coding sequence insertion site (FIG. 17) (SEQ ID NO : 11 and 12).

Human and mouse cDNAs were modified so that alanine at the end of the signal sequence was converted to the Nde 1 site with the formation of a separate sequence in the 3'-site. Insertion of the Nde 1 site was carried out using new PCR primers:

five primary mouse primers

Mnde-5 '

CTTATGTTCA TATGGTGCCG ATCCAGAAAG TC (SEQ ID NO: 13)

three primary mouse primers

Mnde-3 '

TSSSTSTASA TATGTCTTGG GAGCCTGGTG GC (SEQ ID NO: 14)

five primary human primers

Hnde-5 '

TCTATGTCCA TATGGTGCCG ATCCAAAAAG TC (SEQ ID NO: 15)

three primary human primers

Hnde-3 '

TTCCTTCCCA TATGGTACTC CTTGCAGGAA GA (SEQ ID NO: 16)

The primers contained mismatched in the middle of 6 base pairs that introduce Nde I restriction sites at each end of the PCR fragment. A phage carrying human or mouse cDNA was PCR amplified using these primers. The PCR product was digested with Nde I and subjected to gel electrophoresis on a 1% gel of low melting agarose. The purified gel strips were subcloned into a pET vector. The resulting plasmids were sequenced in order to show that mutations are not introduced during the cloning stage of the PCR amplification. Human and mouse cDNA constructs encoding and having lost glutamine 49 were obtained. In particular, the pET 15b constructs containing the human and mouse OB coding sequence (except for the signal sequence) fused to His-tag were obtained by PCR-cloning. The constructs were sequenced to ensure that the PCR amplification step did not erroneously insert sequences into the coding region of the OB gene.

Two plasmid constructs, pETM9 and pETH14, were selected to transform the bacterial expression host. Upon induction of 1 mM IPTG under optimal conditions, transformed bacteria were able to produce 100-300 μg / ml of OM fusion protein. The bulk of OM fusion protein was found in inclusion bodies. After solubilization with 6M guanidine-HCl or urea, the fusion protein was purified on a His-binding (Ni-chelating) resin column. The purification conditions of the OM fusion protein on the column (binding, washing and elution) were established experimentally. The OM fusion protein binds to the resin at 5 mM imidazole / 6M guanidine-HCl and remains bound to the resin at 20 mM imidazole / 6M guanidine-HCl. The protein can be eluted from the column at 60 mM imidazole / 6M guanidine (Fig. 18A, B). The purified human and mouse ob fusion proteins are then dialyzed in PBS to remove guanidine-HCl from the preparation and used to produce polyclonal antibodies.

To test the biological activity of the fusion proteins, “straightening” conditions for the purified protein were used. Initially, the fusion protein was dialyzed in a 1 M guanidine solution, followed by dilution with a 0.4 M arginine solution. His-tag was then removed from the fusion proteins prior to biological function testing. Tag removal was performed by treating the thrombin fusion protein from human placenta. In addition, the coding sequences of the human and mouse OB gene except for the signal sequence were inserted into the pET12c vector using the PCR cloning method. These constructs can direct synthesized OM fusion proteins into the periplasmic space of the bacterial host cell. The OB fusion protein isolated from the periplasmic space needs only simple gel filtration in order to be purified from other proteins of the host cell and not undergo denaturation in this process.

EXAMPLE 3: Obtaining antibodies to the OB polypeptide

In addition, when using a recombinant protein to generate polyclonal antibodies, 4 peptide sequences from the predicted mouse OB sequence were identified using the GCG Package software. Four carboxy-terminal peptide fragments are listed below:

(SEO ID NO: IS):

Val-Pro-Ile-Gln-Lys-Val-Gln-Asp-Thr-Lys-Thr-Leu-Ile-Lys-Thr

(SEO ID NO: 19):

Leu-His-Pro-Ile-Leu-Ser-Leu-Ser-Lys-Met-Asp-Gln-Thr-Leu-Ala

(SEO ID NO: 20):

Ser-Lys-Ser-Cys-Ser-Leu-Pro-Gln-Thr-Ser-Gly-Lys-Pro-Glu-Ser-Leu-Asp

(SEO ID NO: 21):

Ser-Arg-Leu-Gln-Gly-Ser-Leu-Gln-Asp-Ile-Leu-Gln-Gln-Leu-Asp-Val-Ser-Pro-Glu-Cys

These peptides were conjugated to KLH, and the resulting conjugates were used to immunize rabbits by standard methods. Then, polyclonal serum specific for each polypeptide was obtained.

EXAMPLE 4: Translocation of OB polypeptide in vitro

To detect the functional signal sequence of human cDNA, which includes a full open reading frame, was subcloned into the pGEM vector. Only human cDNA was used in this experiment, since suitable mouse subclones were not obtained. The positive band of human ob RNA was transcribed using Sp6 polymerase and included in the in vitro translation reaction both in the presence and in the absence of microsomal membrane of the dog’s pancreas. The primary translation product migrated with an explicit mole. weighing about 18 kDa, which is consistent with what was predicted based on the cDNA sequence. The inclusion of microsomal membranes in the reaction inhibits extremely intense translation - about 5 times. Nevertheless, about 50-70% of the primary OM translation product is truncated by about 2 kDa in the presence of a membrane preparation. This suggests the functionality of the signal sequence (Figa). The size of the primary translation product of interleukin -1α RNA, which does not encode the signal sequence, did not change when microsomal membranes were introduced into the reaction. To determine the possible translocation of the OB protein, in vitro translation products were treated with proteinase K. Protease treatment led to the complete proteolysis of 18-kDa of the primary translation product, while the processing of the enzyme did not affect the 16-kDa processed form. This indicates that this form is transposed into the lumen by a macro (Fig.19B). The data obtained are compatible with the hypothesis that OM is a secreted molecule.

After cleavage of the signal sequence, two cysteine residues remain in the predicted protein, confirming the possibility of the formation of a disulfide bond, which is characteristic of other secreted polypeptides (Shen et al., Science, 224: 168-171, 1984).

EXAMPLE 5: Characterization of the gene OB

To establish the relationship between obesity and genetic changes in the OB gene in humans, the sequence of the human OB gene was determined (Fig. 20A-C) (SEQ ID NO: 22 and 24). Specific primers from the human coding sequence were used to screen the human P1 library. Three different P1 clones were obtained, then they were expanded and amplified in PCR using primers flanking the splicing site between the second and first coding exons. An entire plot of an intron of about 2 kb in size was amplified and partially sequenced (Fig. 20A and as shown in SEQ ID NOs: 22 and 24).

The structure of the human and mouse genes was characterized using PCR studies and other known techniques. It was found that the mouse OB gene contains three exons, the first and second of which are considered the coding sequence (Fig.20D). The coding region of the human OB gene revealed a similar structure, but the human gene lost the 5'-exon and intron (Fig. 20E).

Two sets of primers were obtained from intron sequences of the human gene (FIG. 20A-C). The primer sequences are shown below (F and R mean forward and reverse primers, respectively):

NEW 1gF 5'-CCCAAGAAGCCCATCCTG-3 '(SEQ ID NO: 29)

NEW 1gR 5'-GACTATCTGGGTCCAGTGCC-3 '(SEQ ID NO: 30)

NEW 2gF 5'-CCACATGCTGAGCACTTGTT-3 '(SEQ ID NO: 31)

NEW 2gR 5'-CTTCAATCCTGGAGATACCTGG-3 '(SEQ ID NO: 32)

DNA samples were obtained from various sources, and these primer sets were used to amplify human genomic DNA from cells of some obese people. PCR products were gel gel electrophoresed by low melting agarose and the bands were cut and digested with agarase. Sequences were obtained using an ABI 3 73 A DNA sequencer and a Taq terminator dideoxide kit (ABI, Perkin-Elmer). To date, one point mutation of the ob gene has been found in one sample. It is in the first exon and does not alter the amino acid sequence. Preliminary evidence suggests that the insertion sequence may be in the first exon of the ob gene of another sample. For easier “reading” of sequences to detect mutations, various automatic sequencing methods can be used using Sequenase instead of Taq DNA polymerase.

EXAMPLE 6: Expression of OB in yeast

After positional cloning of an OB, it becomes important to determine the physiological mechanism by which the OB protein reduces food intake and body weight. The first step in this direction is the recombinant production of a functional protein using an expression system. A yeast expression system was selected in addition to a successful bacterial expression system. The yeast system has certain advantages for the expression of OB. Most importantly, biologically active eukaryotic proteins are most likely to be obtained in this system. The OB polypeptide is secreted by mammalian cells. Protein secretion is very similar in all eukaryotes, and this means that the secretory apparatus of yeast is closer to the secretory apparatus of mammals than bacterial. In particular, modifications of the OB protein observed in mammalian cells will also be observed during expression and secretion in yeast. In addition, as the secretion occurs, protein is twisted, and therefore passing ob through the yeast secretory apparatus will lead to the formation of a more correctly twisted protein with native biological activity. This is important for OB, since two cysteine residues can form a disulfide bridge. In contrast to the secretory pathways, the restorative environment of the cell cytoplasm prevents the formation of disulfide bonds, and therefore, it is necessary for the OB to pass through the secretory path so that the disulfide bond forms in vivo. Other advantages are associated with the ease and speed of manipulation of yeast, the availability of vectors and strains, and extensive experience in using yeast recombinant technology.

The Pichia pastoris expression system was chosen for four reasons: (1) it has the highest level of expression of the heterologous protein compared to other yeast systems such as S. cerevisiae; (2) protein glycolization is more similar to the mammalian glycosylation system in P. pastoris as compared to S. cerevisiae (although glycolization sites were not found in ob by computer search, glycosylation can occur at unidentified sites); (3) P. pastoris secrete a very small amount of proteins, and therefore it is much easier to purify the expressed foreign protein in this case; and (4) vectors and yeast strains are commercially available (Invitrogen). Two strategies for preparing vectors for expression in yeast are shown in FIGS. 21 and 22.

The selected vector is pP1C9. This vector contains the cloning site in the “immediately downstream” position with respect to the preprocoding sequence of the α-pairing factor, which secrets the protein encoded by the cloned gene at the cloning site through secretory pathways. Another important property of the vector is the presence of the HIS 4 gene, which allows selection of the absorption of the vector when using a yeast strain grown on histiline-deficient medium after transformation of the yeast by the vector. The cloning strategy is as follows: OS PCR cDNAs are amplified using a 5'-primer containing the OB sequence at the 3'-end, immediately after the predicted peptide cleavage site of the leader sequence and at the sequence closest to the 5'-end, complementary to 3 '-end portion of the sequence of the α-factor pairing vector. The 5'-primer also contains an Xho I site. The 3'-primer, as shown, has a sequence at the 3'-end that is complementary to the last few amino acids OB, and an Eco RI site at the 5'-end. After PCR amplification, the PCR product is digested with Xho I and Eco RI and cloned into the same pP1C.9 enzyme digested. After cloning human and mouse OB cDNA with both glutamine column 49 and without it, individual clones are isolated for all four constructs and sequenced to confirm that the constructs were cloned in the correct orientation and with the correct frame, and at the PCR amplification stage mutations arose. After identification of the clones with a correctly oriented sequence, they transform P. pasioris strain GS 115, which is auxotrophen by histidine.

For two constructs containing OM, transformed yeast clones are screened for protein expression. Dot blot hybridization of DNA and column hybridization were performed in order to confirm the content of OM in transformed yeast. Both methods reveal the presence of an OB sequence in transformed cells and its absence in non-transformed ones. Moreover, transformed yeast secrete 16-kDa protein into the culture medium, while non-transformed yeast does not secrete a protein of the indicated size (Fig. 23A). This is the predicted OM size. It was shown that individual clones for both mouse constructs have high expression of OM and an adequate procedure for purification of ob to a state of homogeneity is currently being developed. In one case, the OB is purified by cation exchange column chromatography (FIG. 23B); preliminary data indicate that cation exchange chromatography under stringent conditions can be used. However, after cation exchange chromatography, a possible ob product is lost. This means the presence of protease in the sample.

One approach to solve this problem is to obtain ob-His-tag fusion proteins for expression in yeast (Figure 22). Further research shows that OBs without His-tag are strongly bound to the Ni-chelating column. Purification of the OB of the polypeptide on such a column, followed by gel filtration, yields the product with a purity sufficient for mass spectral analysis. The specified analysis shows that pier. the weight of the expression protein is identical to that expected. This confirms the successful expression of OM in Pichia cells.

However, Ni chelation / gel filtration does not produce OB polypeptide in a sufficiently purified form. Additional small molecules are present. This means that proteolytically active fractions from the Ni-chelating column are contained in a free volume. Accordingly, a three-step purification procedure is used: Ni-chelation, cation exchange chromatography (removal of small contaminating molecules) and gel filtration.

Assessing the expression level by staining Coomassie blue SDS-PAGE gel reveals a polypeptide amount of about 10 mg / L when the yeast is grown in shaker bottles. These levels are expected when using fermentation systems, and the authors hope to get large amounts of protein in this way. In relation to constructs containing human OBs, transformed yeast clones containing a large number of copies of the OB gene have been identified, and it is expected that they express OB protein. Once antibodies are obtained, they will be used to identify secreted 16-kDa protein.

EXAMPLE 7: High Level Expression of OB Fusion Protein in Bacteria

Obtaining frozen starting preparations:

40 μg of a dextrose stock solution (0.4 g / mg, filter sterilization), 10 μg of an ampicillin stock solution (200 mg / ml) and 5 μg of a stock solution of chloramphenicol are added to each of two 4-ml aliquots of M9ZB sterilized medium without a carbon source ( 34 mg / ml in ethanol). Single colonies of E. coli with cloned human and mouse OB1 DNA in Novagen pET-14b vector were used to inoculate the medium. The tubes are incubated overnight at 37 ° C.

0.5 ml of overnight cultures are used to inoculate 50 ml of M9ZB medium with dextrose, ampicillin and chloramphenicol. The cultures were incubated at 30 ° C and absorbance was measured periodically at 600 nm (A ₆₀₀ ). At A _600, about 1-1.2 175 ml aliquots of the cultures are mixed with 25 μl of 60% glycerol in 2 ml Eppendorf tubes, quickly frozen in liquid nitrogen and stored at -80 ° C.

Cultivation:

50 ml of M9ZB medium with 0.5 ml of 40% dextrose, 125 μl of the stock solution of ampicillin and 50 μl of the stock solution of chloramphenicol are inoculated with 1 ml of frozen culture and incubated at 30 ° C. At A ₆₀₀ 1-1.2, 10 ml of culture is used to inoculate each of the four 2-liter vials with 500 ml of M9ZB medium containing dextrose, ampicillin and chloramphenicol. The cultures are incubated at 30 ° C. until A _{600 of} about 1-1.2 is obtained by induction of IPTG at a final concentration of 0.5 mM. The cultures are incubated overnight. Cells are harvested by centrifugation at 4000 rpm for 20 minutes. This expression system leads to the release of recombinant OM polypeptide with a high percentage of total protein in terms of g / l of the culture medium of E. coli.

Cell lysis and resuspension of inclusion bodies

The cell paste is resuspended in a minimum volume of 20 mM HEPES, pH 7.2, 10% glycerol, 0.1 M KCl, 5 mM MgCl ₂ , 1% aprotinin, 1 mM PMSF, 5 μg / ml leupeptin and 50 μg / ml DNase I. The suspension is frozen three times and thawed with liquid nitrogen and lukewarm water. Lysed cells are centrifuged at 18,000 rpm for 30 minutes and resuspended in 20 mM HEPES, pH 7.5, 0.1 NaCl. The suspension is sonicated and Triton X100 is added to a final concentration of 2%. The suspension is then centrifuged for 15 minutes at 18,000 rpm. After these two cycles, the drug is washed three times with Triton. Finally, the precipitate was dissolved in 6M GdHCl (guanidine-HCl), 20 mM HEPES, pH 7.5, by sonication for further purification.

Protein OB is purified in an untwisted state by affinity chromatography with immobilized metal ions (IMAC). The solution was applied to a 40 ml Pharmacia column with a chelating rapidly flowing serophase loaded with 50 mM NiSO ₄ in 5 column volumes and equilibrated with 6 M GdHCl, 20 mM HEPES, pH 7.5. The column was washed with 6M GdHCl, 30 mM imidazole, 20 mM HEPES, pH 7.5. Then the protein is eluted with the same buffer containing 0.2 M imidazole. The untwisted protein in 6M GdHCl was stored at 4 ° C after adding sodium acetate (NaAc) to 10 mM and the pH was adjusted to about 4.5 with acetic acid.

Restore structure and protein purification

A 6M GdHCl solution containing 100 mg of protein was treated with 67 μl of 1M dithiothreitol (DTT) and diluted to 67 ml with 6M GdHCl, 10 mM NaAc, pH 4.5. The mixture was stirred at room temperature for 1 hour. Then the mixture was diluted in 4 l of 20% glycerol, 2.5 mm CaCl ₂ , 20 mm Tris, pH 8.4, with stirring. After appropriate mixing, the solution was left at room temperature for 8 hours without further stirring. Then add 2000 units. purified bovine thrombin (from thrombostat, product of Parke-Davis) and the solution is gently mixed. After 2.5 hours, 2000 units were again added. thrombin, and histidine tag cleavage is continued for more than 3 hours. Cleavage is stopped by the addition of PMSF to a final concentration of 0.1 mM. The solution is filtered and stored at 4 ° C.

The digested protein is further purified on an IMAC column as described above, equilibrated with 1 M KCl, 20% glycerol, 20 mM HEPES, pH 8.4. After applying the protein solution, it is washed with the same buffer and the digested protein is eluted with 1M KCl, 20% glycerol, 40 mM imidazole, 20 mM HEPES, pH 8.4. Undigested protein is eluted with 0.2 M imidazole.

The purified protein is concentrated, treated with 50-100 mm EDTA, 10 mm potassium ferricyanide (to complete insufficient oxidation) and subjected to gel filtration on a column with superdex 75 16/60. The product yield during the implementation of this procedure is 50% of the initial.

The purified expressed protein can be characterized by various methods. The physical characteristic is based on dynamic light scattering to determine the homogeneity of the drug and the proper degree of twisting. Data based on light scattering indicates that the human OB polypeptide is predominantly or exclusively expressed in the form of a monomer, while mouse OB polypeptide can be detected in the form of a dimer and monomer.

Ellman's reagent study and mass spectroscopic analysis show that cysteine residues form a disulfide bond in the protein. Such an oxidized form of the polypeptide is administered to animals, as described below, to determine biological activity.

To determine the structural geometry of the protein, the circular dichroism (CD) method is used. The CD spectrum in physiological buffer (pH about 8, ionic strength approximately corresponds to physiological) shows that human OB polypeptide has about 60% α-helical structure and about 40% selective ring structure. Using SD spectroscopy, it was shown that the mouse OB polypeptide has about 50% α-helical structure and 50% selective ring structure. Limited proteolysis carried out after mass spectrometric analysis (Cohen et al., 1995, see above) is carried out to identify proteolysis sensitive polypeptide regions. This method shows the presence of a mobile loop structure of amino acid residues 54-60 (as shown in Figure 4). It is likely that this moving loop connects two domains of a certain 2 ⁰ structure, i.e. α-helix.

The biological activity of the purified protein is determined (as described further in the Examples) by administering it to an unweighted and obese rodent using an osmotic pump (e.g., an ALZET osmotic pump from Alza Corporation, Palo Alto, CA) or intraperitoneally with daily pills for at least a two-week period. followed by observation of effects on nutritional behavior and body weight.

EXAMPLE 8: Effect of OB polypeptide (leptin) on weight loss

The gene product of the mouse OB locus plays an important role in the regulation of body weight. This example shows that OB protein circulates in the blood plasma of mice, rats and humans. The circulating form of the protein in all three species has an identical mole. weight determined in SDS-PAGE for the predicted amino acid sequence without signal sequence. This suggests that the in vivo protein is not processed after cleavage of the signal sequence. The OB protein is not detected in the blood plasma of C57 / B16J ob / ob mice and is detected at a tenfold concentration in the blood plasma of db / db mice and at a twenty-fold concentration in the blood plasma of rats fa / fa in relation to the control. The data presented suggest that these mutant obese animals are resistant to the effects of OM. Seven-fold differences in the levels of OM protein in the blood plasma of obese individuals were observed within a group of six people. Daily injections of recombinant mouse OB protein significantly reduce the body weight of ob / ob mice, significantly affect the body weight of wild-type mice and do not affect db / db mice. These data suggest that the gene product of the OB gene locus performs an endocrine function in order to regulate body weight.

Materials and methods

Rabbits were immunized with a recombinant protein in Freund's adjuvant (HRP, Inc). Immune-purified antibodies to mouse OB are obtained by passing serum through a column of 4B Sepharose conjugated to a recombinant protein, as described by Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor, NY (1988). Immunoprecipitation of mouse blood plasma is carried out as follows: 0.5 ml of blood plasma of a mouse, rat, and human, containing approximately 2.5 mM EDTA, is preliminarily purified on unconjugated Sepharose 4 V at room temperature with shaking for 2 hours. Sepharose is removed by extrusion and 50 ml 50% is added liquid conjugated to an antibody of sepharose containing an affinity-purified antibody at a concentration of 1 mg / ml of sepharose. Then add 1/2 ml of 2xRIPA buffer to ensure the following final binding conditions: 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% deoxycholate and 0.025% sodium azide. The reaction is carried out overnight at 4 ° C with shaking. Antibody-conjugated sepharose is washed 8 times with RIPA buffer, then washed three times with PBS and electrophoresed in 15% SDS-PAGE. Proteins are transferred to nitrocellulose and Western blotting is carried out with a biotinylated immuno-purified antibody against a recombinant protein. The second antibody is HRP-streptavidin, and ECL is used to detect the reaction.

For the quantitative determination of OM in mouse blood serum, increasing amounts of recombinant restored-structure mouse OB protein (0.01; 0.1; 0.5; 2.0; 15.0 ng) are added to 100 μl of C57BL / 6J ob / ob blood plasma and the serum is incubated at 4 ° С for 3 hours with protein A sepharose conjugated to an antibody. After intensive washing with buffer A (10 mM sodium phosphate buffer, pH 7.4; 100 mM NaCl; 1% Triton X-100, 5 mM EDTA, 1 mM PMSF), the samples are resuspended in sample buffer, layered on 15% SDS- PAGE and transferred to a nitrocellulose membrane. Western blotting is carried out using an immuno-purified biotinylated anti-amino terminal antibody as a first antibody and HRP-streptavidin as a second antibody, followed by ECL detection. Cytoplasmic extracts are prepared by homogenizing adipose tissue in NDS buffer (10 mM Tris, pH 7.5, 10 mM NaCl, 60 mM ICCI, 10 mM spermine, 0.5 mM spermidine, 14 mM β-mercaptoethanol, 0.5 mM EGTA, 2 mM EDTA, 0.5% NP-40) and the cores are removed by centrifugation at 700 d.

Immunoprecipitation is carried out as described above, except that immuno-purified antibodies to human OB are used. For ELISA, 100 ml of a 1 mg / ml solution of immuno-purified anti-human OB antibody was dissolved in borate-buffered PBS and placed overnight in microtiter plates (Coming cat. # 2595) at 4 ° C. Then the tablets are washed 4 times with borate saline containing 0.05% Tween-20, and the excess liquid is removed. The plates are blocked by incubation for 2 hours at room temperature, adding 240 ml of borate physiological buffer containing 0.3% gelatin to each well, and then washed and dried. Known amounts of the unwound human OB protein or blood plasma samples in a volume of 100 ml are incubated in separate wells overnight at 4 ° C. After washing, the plates are incubated with the addition of 100 ml of biotinylated immuno-purified antibody to human OB protein (0.1 mg / ml in gelatin-borate buffer solution) for 4 h at room temperature. After washing, horseradish peroxidase (HRP) conjugated with streptavidin (0.1 mg / ml in borate buffer, 0.3% gelatin) was added to the tablets. A substrate for HRP (ABTS, 0.3 mg / ml and H ₂ O ₂ , 0.01% in citric acid) is used to detect the reaction, and O. D. is measured at 414 nM to quantify the bound antibody.

The coding sequences of the mouse and human OB gene are PCR amplified from plasmids containing the OB cDNA sequences and subcloned into plasmid pPIC.9 (Invitrogen). 5'-human primer has the structure

5 'GTATCTCTCGAGAAAAGAGTGCCCATCCAAAAAGTCCAAG 3'

(SEQ ID NO: 34),

3'-primer has the structure

5 'GCGCGAATTCTCAGCACCCAGGGCCTGAGGTC 3'

(SEQ ID NO: 35).

The mouse 5'-primer has the structure

5 'GTATCTCTCGAGAAAAGAGTGCCTATCCAGAAAGTCCAGG 3'

(SEQ ID NO: 36) and

3'-primer has the structure

5 'GCGCGAATTCTCAGCATTCAGGGCCACACC 3'

(SEQ ID NO: 37).

The human and mouse 5'-primer contains the Xho I site at the 5'-end, and the pIPIC9 vector contains the coding sequence for the last 4 amino acids of the α-pairing factor signal sequence. This vector directs the secretion of heterologously expressed gene products from the cell to the culture medium. The 5 'PCR primer also includes the first 19 nucleotides of the open reading frame of the OB gene after the signal sequence cleavage site before the amino acid alanine at position 21. The 3'-primer contains the EcoR I site at the 5'-end, which is located immediately (immediately) after sequences complementary to a possible stop codon OB. PCR conditions were as follows: denaturation for 1 min at 94 ° C, annealing for 1 min at 55 ° C, and elongation for 2.5 min at 72 ° C. Few PCR cycles (15 cycles) and strictly reading PFU polymerase (Stratagene) were used to limit the number of PCR-generated mutations. PCR products were treated with Xho I and EcoR I and cloned into a similarly digested pP1C.9 vector. All constructs were sequenced in two strands to ensure no PCR-generated mutations. Clones were transfected into Pichia pastoris (His) cells by spheroplasting and selected on histidine-deficient media. About 200 human and mouse clones were screened for high-pot embedding by colony hybridization assay. High-drinker clones were then analyzed for OB expression, initially stained with Coomassie blue, which showed the presence of a new 16-kDa protein in the culture medium of transformed yeast. The 16-kDa band was an OB, as was detected using antibodies to the OB protein obtained in the bacterial expression system. The recombinant proteins were then purified using the two-step purification method described below. Mass spectrometry and cyanogen bromide treatment were performed as described by Beavis et al., Proc. Natl. Acad. Sci. USA 87: 6873-6877 (1990).

The complete coding sequence of the OB of the human and mouse OB genes, which is C-terminal to the signal sequence, was subcloned into the expression vector pET15b (Novagen) and expressed at a high level in Escherichia coli (BL21 (DE3) plYsS) using E7 RNA polymerase systems (Studier et al., Melh. Enzymology, 185: 80-89 (1990)). Cells were grown at 30 ° C until 0.7 was absorbed at 595 nM, 0.5 mM isopropyl-β-D-thiogalactopyranosides were induced overnight and then harvested by low speed centrifugation. Lysis was carried out by three cycles of freezing and thawing and DNA was digested with DNase. Membrane extraction was carried out when the preparation was sonicated and solubilized with a detergent, the resulting precipitate of inclusion bodies was dissolved in 6M guanidine - HCl, 20 mM HEPES, pH 8.4. Recombinant OB proteins were purified under denaturing conditions by IMAC using a Ni-ion affinity column and washing with increasing amounts of imidazole. The purified denatured OB protein was stored in 6 M guanidine - HCl, 10 mM sodium acetate (NaAc), pH 5, and reduced with 2 mM DTT at room temperature for 1 h. Denaturation was carried out by diluting the recovered protein in 20% glycerol, 5 mM CaCl ₂ , 5 mM NaAc, pH 5 with mixing and incubation at room temperature for 8-12 hours. After denaturation, the pH was adjusted to 8.4 by adding Tris to 10 mM and the hexahistidine tag was removed by thrombin digestion. The digested renatured protein was re-purified by IMAC to separate from thrombin and undigested fusion protein. The digested renatured protein was eluted from the Ni-anion of the affinity column with 40 mM imidazole, while thrombin and the undigested fusion protein were eluted with 0.2 mM imidazole. The product was then concentrated, treated with 100 mM EDTA and 10 mM potassium ferricyanide, and then purified by gel filtration using Pharmacia Superdex on column 75 16/60.

Ellman's study was performed as described by Ellman, Biochem. Biophis., 82 70: 77 (1959). Ellman's reagent was obtained by dissolving 39.6 mg of 5.5'-dithiobis (2-nitrobenzene acid) (DTNB) in 10 ml of 0.05 M phosphate, pH 8. A calibration curve was constructed with a concentration dispersion of 10-120 mm free sulfhydryl (using 1 mm initial solution of reduced DTT ) at 412 nM. Each study was performed using 0.02 ml of Ellman's reagent and a total volume of the reaction mixture of 0.5 ml. The determined extinction coefficient was 12974 M ^-1 cm ^-1 for the free sulfhydryl group (correlation coefficient 0.99987), which is within 5% error compared to the previously detected value of 13600 M ^-1 cm ^-1 .

50 ml of gel-filtered protein at a concentration of 2 mg / ml, corresponding to a concentration of free sulfhydryl of about 24 mM in the final reaction mixture, was investigated by the Ellman method. In the final solution, the absorption at A ₄₁₂ is about 0.02, suggesting that two cysteine residues in the protein are oxidized to form cystine or that their free sulfhydryl groups are completely immersed in the inaccessible core of the twisted protein. Similar results were obtained when carrying out the same study on an untwisted protein in the presence of 6M guanidine - HCl.

The mice were individually kept in a pathogen-free environment and accustomed to a diet containing 35% (weight by weight) laboratory rodent food 5001 (PMP Feeds, Inc.), 5.9% (weight by weight) starch flour pudding (General Foods) and 59.1% of water, whose energy value is 1.30 kcal / g. The food is sterilized by autoclaving and packaged in 60 mm plastic cups, which are fixed to the surface of 100 mm Petri dishes. Starchy pudding gives the paste a consistency in food, which makes it difficult for animals to scatter it around the cage. A fresh serving of food is placed in a cage every morning, and the previous serving is cleaned and weighed. The difference in weight of the next and previous servings is the amount of daily food intake by animals. The effect of recombinant protein on food intake and body weight was determined in three strains of mice: C57BL / 6J ob / ob, C57Bl / Ks db / db and CBA / J + / +, purchased from Jackson Laboratory. Thirty mice of each strain were divided into groups of 10 animals. One group of each strain was injected daily intraperitoneally (i. P.) With a promoted bacterial ob protein with a restored structural dose of 5 mg / g / day in 300 μl of PBS. The second group received i. R. injections of the same volume of PBS. These control animals received injections of PBS dialyzed recombinant protein. PBS was purified from endotoxin using an Acticlean ETOX column. The third group of animals did not receive injections. Food intake was recorded daily, and body weight was recorded regularly at intervals of 3.5 weeks. For the paired experiment, food intake in a separate group of ob mice coincided with the daily value that was determined for ob mice receiving protein.

results

OB protein circulates in human, mouse and rat plasma

Recombinant OB protein is obtained using pET 15b bacterial expression vector (Novagen) and by cloning in Pichia pastoris cells, a yeast expression system that secretes recombinant proteins directly into the culture medium. The ob protein expressed in yeast comprises 146 amino acids from the carboxy-terminal region with respect to the signal sequence. Rabbits are immunized with bacterial proteins (HRP, Inc.). Antibodies are purified on a column with an antigen (Research Genetics) and used for immunoprecipitation and Western blotting of protein from blood plasma and adipose tissue.

Protein OM from the blood plasma of the mouse migrates with an explicit mole. weighing 16 kDa in SDS-PAGE. Electrophoretic mobility is identical to that of the recombinant OB protein secreted by yeast after removal of the signal sequence (Fig.24A). The protein is not detected in the blood plasma of C57BL / 6J ob / ob mice that have a nonsense mutation at codon 105. In some antisera, the polypeptide chain with the deleted residue at position 105, predicted based on the cDNA sequence, cannot be identified.

In the blood plasma of db / db mice, a ten-fold level of OM was detected compared to the control (Fig. 24A). Immunoprecipitation of the blood plasma of wild-type rats and fa / fa reveals a twenty-fold increase in the level of protein OB in mutant animals compared with wild-type animals (Figv). The db mutation leads to an obesity phenotype identical to that observed in ob mice (Bahary et al., 1990, supra). Fatty rats become obese as a result of a recessive mutation in a gene homologous to db (Truett et al., 1991, supra). To determine the quantitative level of OB in mouse plasma, increasing amounts of recombinant protein are added to the serum and immunoprecipitation is carried out (Fig.24C). A linear increase in signal intensity on Western blots corresponds to an increase in the amount of recombinant protein. A comparison of the signal intensity of the native protein in mouse blood plasma with the control shows that the level of circulating OM protein in wild-type animals is about 20 ng / ml. These data demonstrate that immunoprecipitation and Western blotting were performed under conditions of excess antibodies. Increased levels of protein OB were also found in protein extracts of adipose tissue of db / db mice compared to control (Fig.24D). As expected for the secreted protein, adipose tissue protein is secreted as part of the membrane fraction (data not shown).

Blood plasma samples of six non-obese individuals with a body mass index of less than 25 (BMI = weight / height) were immunoprecipitated using immunopurified antibodies to human protein. Immunoprecipitated material migrates with electrophoretic mobility identical to that characteristic of a 146 amino acid protein expressed in yeast. Within six samples, the signal intensity varies significantly (Figa). Densitometry of autographs reveals approximately five-fold differences in protein levels in individuals HP1 and HP6 with average values in other subjects. Enzyme-linked immunoassay (ELISA) was performed using an immuno-purified antibody and a restored bacterial protein as a standard (see below). The resulting standard curve is shown in Figv. In this test method, plasma protein OB levels in six samples varied between 2-15 ng / ml (Fig. 25C). The level of protein OB in the blood plasma of an individual HP6 went beyond the linear range in immunoassay and amounted to ≥15 ng / ml. The indicated quantitative differences correlated with the obtained Western blotting methods.

Preliminary evidence suggests that leptin can circulate, at least in part, as a complex with another protein or proteins. The conclusion is based on the heterogeneity of the shape of the titration curve for serum compared to the recombinant standard. Analysis of a large amount of leptin immunocleaned on a column with rabbit antibodies to OV by HPLC gel filtration under denaturing and non-denaturing conditions followed by ELISA and SDS-PAGE suggests that the OB polypeptide is a high molecular weight complex. However, these data remain preliminary. The protein that binds the OB polypeptide, if it exists at all, has not yet been characterized.

Structural Features of OM Protein

Since the protein OB has two cysteine residues, it can form intra- and intermolecular disulfide bonds under oxidizing conditions in vivo. Western blotting is repeated in the absence or addition of reducing agents to the buffer image. In both cases, the OM protein in human serum migrates as a monomer (data not shown). Under non-reducing conditions, a protein immunoprecipitated from the serum of db mice was detected at positions corresponding to both a 16 kDa monomer and a dimer of mol. weighing about 32 kDa (Figa). The band corresponding to the connection with a large mol. weight, disappeared in restoring conditions. This suggests that the mouse OB protein fraction circulates as a compound with a large mol. weight due to the formation of intermolecular disulfide bonds. About 80% of the mouse OB protein circulates as 16 kDa protein and 20% as 32 kDa protein.

The same molecular forms are detected when human and mouse proteins are expressed in Pichia pastoris yeast (Abrams et al., Immunol. Rev.,: 5-24 (1992)). In these DNA studies, the sequence corresponding to 146 amino acids of the mature OB protein was cloned in the downstream position relative to the signal sequence of the α-pairing yeast factor in pPIC.9 vector (Invitrogen). The protein was purified from the medium of yeast strains expressing human and mouse proteins and subjected to electrophoresis under reducing and non-reducing conditions (Fig. 26A). Mouse protein was expressed in yeast mainly as a dimer under non-reducing conditions and only as a monomer in the presence of reducing agents. The recombinant human protein migrated at the monomer position under both conditions (data not shown).

The purified human protein expressed in Pichia cells has a mole. mass 16.024 ± 3 Yes, as determined by mass spectrometry (Beavis, 1990, see above). These data are consistent with the value of mol. mass calculated on the basis of the amino acid sequence of a protein containing one intramolecular disulfide bridge (16.024 Da). Mass spectrometric analysis with matrix-mediated laser desorption for cyanogen bromide-cleaved protein products shows that cysteines 117 and 167 are connected via an intramolecular disulfide bond (Fig. 26B). Cyanogen bromide cleaves the carboxy-terminal region at methionine residues.

Obtaining and characterization of a bioactive recombinant protein

Mouse OB protein is expressed in E. coli using plasmid pET 15b as an insoluble fusion protein of 20 amino acid residues with an N-terminal hexa-histidine tag containing a thrombin cleavage site. Bacterial inclusion bodies are solubilized with guanidine-HCl and purified under denaturing conditions using immobilized metal ion affinity chromatography (IMAC) (FIG. 27). The purified denatured fusion protein is reduced, diluted and re-formed in the aqueous medium at room temperature. After thrombin cleavage, the renatured mouse OB protein containing four additional N-terminal residues (Gly-Ser-His-Met; SEQ ID NO: 38) is re-purified by IMAC to> 98% homogeneity, as confirmed by SDS-PAGE and mass spectrometry . Mass spectrometry with matrix-mediated laser desorption reveals a mass value of 16.414 ± 3 Da (predicted mass is 16.415 Da). SDS-PAGE in reducing and non-reducing conditions, shows the presence of bands with one explicit mol. mass, namely 16 kDa (data not shown).

Dynamic light scattering using a Molecular Size DP801 detector (Protein Solutions, Inc.) shows that the renatured mouse OB protein is mainly monomeric with small aggregates of a higher order. The protein is treated with EDTA and chemically oxidized. Then higher molecular weight structures are removed by gel filtration. Further dynamic light scattering shows that purified, renatured recombinant mouse OB protein has monodisperse properties. After dialysis (PBS), the bacterial endotoxin is removed using an Acticlean ETOX column (Sterogene Bioseparations, Inc.). The final protein yield is 45 mg / ml.

Ellman's analysis is applied to purified, reduced recombinant mouse OB protein to determine its oxidation state (Ellman, 1959, see above). The renatured protein and untwisted with 6M guanidine - HCl detects <0.5% free sulfhydryl, indicating that the monomer product contains an intramolecular disulfide bond. This is confirmed by mass spectrometry of the products of the cleavage of the bacterial protein with the restored structure using cyanogen bromide (data not shown).

Bioactivity of OB protein.

Purified, renatured recombinant mouse OB protein daily by intraperitoneal injection at a dose of 5 mg / kg / day is administered to mice divided into groups of 10 animals, namely C57BL / 6J ob / ob (16 weeks), C57BL / Ks db / db (12 weeks ) and CBA / J + / + (8 weeks). A similar number of animals receive PBS by daily injection. PBS used for control injections is obtained from dialysate after protein balancing. Ten additional animals of the three strains do not receive injections. The food intake of individual animals is monitored daily and the weight of the animals is recorded at intervals of 3-4 days. General information regarding food intake and body weight of each animal from 9 groups of mice is shown in FIGS. 28A-F, and the statistical significance of these data is illustrated in Table 1. The food intake of C57BL / 6J ob / ob mice injected with the protein was significantly reduced after the first injection and continued to decrease until the fifth day, when it stabilized at a level equivalent to about 40% of the food intake by animals treated with PBS injections (p <0.001). Animals treated with PBS did not lose weight over a study period of more than 3 weeks. Protein-fed C57BL / 6J ob / ob mice lost about 10% of their weight after 5 days (p <0.001). These animals continued to lose weight after three weeks, when the ob weight of the animals receiving the protein decreased to about 60% of the initial weight (p <0.001). A separate group of ob mice was used in paired feeding experiments with ob animals that received protein. The data of Fig. 29B show that animals in paired nutrition experiments lost significantly less weight than animals treated with recombinant protein (p <0.02). Photographs of two mice that received injections of the protein or vehicle show a huge difference in the appearance of the animals as a result of the introduction of the protein (Figv). To determine the further effects of the protein, autopsy of two mice in each animal group was performed. A thorough examination of ob mice treated with protein revealed a significant decrease in fat content, as well as liver size. The liver of ob mice treated with PBS injections weighed 5.04 g and 5.02 g, as opposed to 2.23 g and 2.03 g, the weight of the liver of animals treated with recombinant protein. Compared with the pale obese liver of mice ob, the liver of ob mice that received protein had a darker color characteristic of a normal organ (Fig. 29C). Histological sections of the liver show that the "untreated" animals had an obese liver, which was not characteristic of animals that received protein (data not shown).

In contrast to ob mice, there were no significant differences in body weight or food intake in C57BL / Ks db / db mice, both protein and control animals receiving vehicle (Fig. 28A-F, Table 1). Mice in all three db / db groups lost 2-5g in weight during the experiment period. The average glucose in the blood of db mice was measured using a glucometer; it was> 500 mg / dl in all mice, suggesting that in these animals diabetes developed a second time compared to obesity. Injection of db mice was discontinued after two weeks.

In wild-type animals, a slight but significant decrease in body weight was observed after administration of the recombinant protein (Fig. 28A-F, Table 1). 5 days after protein injection, mice lost an average of 0.5 g, while control mice added 0.4 g (p <0.02). At two subsequent time points, the animals treated with the protein weighed significantly less than the mice that received the daily injections of PBS. The significance of weight changes decreased at later time points. In animals that lost weight, food intake was significantly different from control animals. PBS injections had a small but significant effect on food intake and body weight in ob, db, and wild-type animals compared to non-injected mice (p <0.05).

Discussion

The assumption of the endocrine function of the protein product of the locus OB was first made by Coleman, who showed that the body weight of ob / ob mice decreases after a parabiotic compound with normal or db mice (Coleman et al., 1978, supra). The results above support this hypothesis, since they show that the OB protein circulates in the bloodstream, and injections of the recombinant protein reduce body weight. The molecular weight of the product encoded by the OB gene is approximately 16 kDa, which is equivalent to the amino acid sequence of 146 amino acids, which is carboxy-terminal with respect to the signal sequence. The recombinant OB protein is not modified upon expression in Pichia pastoris cells. The expression of mammalian genes in Pichia mainly leads to the formation of the correct protein structure (Cregg et al., Bio / Technology, 11: 905-914 (1993)). These data suggest that the OB protein is not glycosylated and does not undergo post-translational processing in vivo. They do not exclude the possibility that the OB protein is non-covalently bound to itself or to other proteins in blood plasma or adipose tissue. Despite the fact that proteolytic cleavage of the protein is not excluded, the forms of protein OB with a lower mole. weight is not detected in any antiserum when tested with four antibodies to the peptide.

Protein OB has two cysteine residues and circulates as a monomer in humans and as a diamer in mice. An intramolecular disulfide bond, typical of secreted molecules, is detected when a human protein is expressed in Pichia pastoris yeast, suggesting that it is in vivo in the same form. This assumption is confirmed by the biological activity of a recombinant bacterial protein in which an intramolecular disulfide bond has been detected. Mouse OB protein can be detected in blood plasma both as a monomer and as a dimer. Monomer and dimer are detected by expression of the OB protein in yeast; this shows that the predisposition of the mouse protein to form a dimer is the result of differences in its primary sequence with respect to the human protein. While it is obvious that the monomer has biological activity, the functional activity of the dimer is unknown.

The effect of OB protein on food intake and body weight in ob mice is extremely significant. Three weeks later, ob mice receiving daily injections of recombinant protein lose 40% of their weight and consume 40% less food compared to control animals. Moreover, the weight of the ob-treated animals is not restored even after the experiment. The results of the experiment on paired nutrition indicate that weight loss occurs as a result of exposure to protein OM both on food intake and energy consumption. Thus, a separate group of ob animals whose calorie intake was limited compared to ob mice receiving protein, more significantly lost weight than animals receiving protein. A decrease in food intake by ob / ob mice to a lower level than in wild-type animals during the day when the animals received OB protein indicates that ob / ob mice are especially sensitive to the effects of this protein. In fact, the OB receptor may undergo increased regulation in these animals. The consumption of food by “treated” ob mice became relatively constant after five days of “treatment”. If this effect of the protein reaches a stable high level, then it can be assumed that the protein has a relatively long half-life (The Pharmacological Basis of Therapeutics pp. 19-45, Goodman and Ceilman, eds., Pergamon Press, New York, 1990). This conclusion is consistent with the data of the experiment on parabiosis (Coleman et al., 1978, see above; Weigle, Int. J. Olesity, 12: 567-578 (1988)).

The effect of the recombinant protein on the body weight of wild-type mice was negligible, but statistically significant during the first two weeks of the experiment. While the difference in weight between wild-type animals fed protein and PBS was detected at later time points, the statistical significance of the data dropped significantly after three weeks. Early weight loss was not considered related to differences in food intake. The determination of food intake was probably not accurate enough to detect a reduced result based on a 1 g difference in body weight during the experiment. These observations are different from those of preliminary experiments in which wild-type rodents were parabiotically combined with db mice, fa rats, rats with impaired hypothalamic function, and rats obese as a result of a high-calorie diet (Coleman et al., 1978, see above; Harris et al., 1987, supra; Harris et al., “Physiological and Metabolic Changes in Parabiotic Partners Among Obese Rats,” Hormones, Thermogenesis and Obesity, Lardy and Staatman, eds., Elsevier Science Publishing Co., New York (1989); Harvey, J. Physiol., 145: 336-352 (1959)). In each case, wild-type animals acquired anorexia and lost a lot of weight. Since the levels of protein OB increased in db mice and rat fa and the level of RNA OB increased in mice with impaired hypothalamic function, it seems likely that wild-type mice can respond to OM when it circulates in plasma in a sufficiently high concentration. These data are consistent with the assumption that the levels of the introduced protein are lower than endogenous and lead to the establishment of a constant weight at a level slightly lower than normal. Quantifying the circulating levels of OM protein in “treated” animals can help solve the problem. At a time when it was not yet possible to determine the protein content in the body of the mouse using immunological analysis, immunoprecipitation suggested that the levels of circulating OB protein were not significantly increased in wild-type mice that received the protein.

The lower protein exposure in wild-type mice and the lack of response in db mice makes it unlikely that protein administration has a nonspecific or reverse effect. All db mice lost a small amount in weight during the “treatment” regardless of whether they received ob protein or not. The db animals suffered from severe hyperglycemia, and weight loss was probably the result of diabetes, not experiment. C57Bl / Ks db / db mice often developed diabetes and started to lose a little weight when their age approached the age of the animals used in the experiment (Coleman et al., 1978, supra). C57BL / 6J ob / ob mice of similar age did not develop significant hyperglycelia. Apparently, these phenotypic differences were the result of genetic differences between the C57Bl / 6J and C57Bl / Ks strains carrying mutations (Coleman et al., 1978, see above).

The inability to detect a truncated protein of 105 amino acids predicted based on the cDNA sequence of the OB gene in C57Bl / 6J mice suggests that the mutant protein is degraded or not translated. However, the possibility that the specified protein cannot be determined in the serum used cannot be ruled out. The observed ten-fold increase in ob protein levels in db mice compared to wild-type animals may indicate that the ob protein is oversupplied when resistance to its effects is observed. These data correlate with the study of OB mRNA. As noted, preliminary experiments have shown that mutations in the db and db genes that map to homologous regions of the chromosomes lead to overproduction of plasma factor, which reduces body weight (Truett et al., 1991, see above; Coleman et al., 1978 , see above; Hervey, 1959, see above). In both cases, it could be assumed that mutant animals are resistant to the effects of protein OB. This possibility is based on the observation that the OB protein does not affect body weight or food intake when administered to db mice.

Obesity in humans may be associated with increased levels of OM protein in the blood plasma of those individuals who are relatively insensitive to the hormone. On the other hand, a decreased expression of OB can also lead to obesity, in which “normal” (ie, inappropriately low) protein levels can be detected. Thus, levels of OB protein in human plasma can be a marker of various forms of obesity. In a small group of non-obese individuals with BMI <25, nanogram amounts of OB protein are detected by ELISA. It is significant that the revealed differences in OB concentrations allow us to suggest that the level of expression and / or sensitivity to the protein may play a role in the regulation of body weight.

The site of action of the OB protein is unknown. Protein affects food intake and energy expenditure. This is consistent with clinical observations showing that both of these systems regulate body weight (Leibel et al., N. Engl. J. Med., 332: 621-628 (1995); Keesey et al. "Metabolic maintenance of body weight at a certain level ", in the book of the Association for Research in Nervous and Mental Diseal, pp. 87-96, Stun Kard and Stellar, eds., Raven Press, New York (1984)). It is likely that the hypothalamus is in the “downstream” position with respect to the pathway of organic matter, which controls body weight, although direct exposure to various organs is possible.

EXAMPLE 9: Increased expression of RNA OB in mouse adipocytes with impaired hypothalamic function and mutations at the db locus

The product of the recently cloned mouse obesity gene (OB) plays an important role in the regulation of adipose tissue. OB RNA is specifically expressed by mouse adipocytes of various types of adipose tissue in vivo, including brown adipose tissue. It is also expressed in cultured 3T3-442A preadipocyte cells that have been induced to differentiate. Mice with damage to the hypothalamic function, as well as mice mutant at the db locus, express twenty times higher levels of OB RNA in adipose tissue. These data suggest that the db gene and hypothalamus are in the downstream position relative to the OB gene and the pathway of OB, which regulates the amount of adipose tissue, and are consistent with preliminary experiments, according to which the db locus encodes the OB receptor. In db / db mice and animals with hypothalamic lesions, quantitative differences in the level of OM RNA expression correlate with the lipid content in adipocytes. Molecules that regulate the level of expression of the OB gene in adipocytes are likely to play an important role in determining body weight, since they are molecules that mediate the effects of OB on its site of action.

Materials and methods

In situ hybridization.

White adipose tissue of identical abdominal sections of wild-type (Wt) and db mice was simultaneously “treated” according to the modified method described by Pichardson et al., Growth, Development and Aging, 56: 149-157 (1992). In short, tissues were fixed for 2 hours at 4 ° C. Then they were dehydrated by successive placement in ethanol of increasing concentration (from 10% to 100%) for 5 min in each solution at 4 ° C. Further tissue incubation in xylene (1 h) and paraffin (2 h) was carried out at 65 ° C. Paraffin-embedded adipose tissue Wt and db / db were cut and placed on glass slides. Then the sections were heated at 65 ° C for 1 h, treated with xylene and sequentially carried out through ethanol solutions at a concentration of from 100% to 50% (3 min each) at room temperature. The antisense RNA sample of the OB gene was synthesized in vitro by transcription of the linearized coding sequence of the OB gene at the upstream position with respect to the Sp6 RNA polymerase promoter. In situ hybridization was carried out in exact accordance with the method of Schaeren-Wiemers et al., Histochemistry, 100: 431-440 (1993).

Getting RNA and cell culture.

Total RNA and Northern blots were obtained as described. Stromal vascular cells and adipocytes were obtained according to the Rodbell method, and RNA from both fractions was obtained according to Dani et al., Moll. Cell. Endocrinol., 63: 199-208 (1989); Rodbell, J. Biol. Chem., 239: 375-380 (19). After subcloning, 3T3-F 442 cells were grown in Dulbecco's modified Eagle's medium containing 10% fetal blood serum (standard medium) (Dani et al., “Molecular Biology Techniques for Studying Adipocyte Differentiation”, in Obesity in Europe, vol. 88, pp. 371-376, Bjontorp and Rossner, Eds., John Libley Company Ltd., London, England (1989)). At the monolayer stage, cells were transferred to standard medium supplemented with 2 nM triiodothyronine (T3) and 17 nM insulin. After 12 days, RNA was obtained as described above.

Gold Thioglucose (GTG) treatment.

Female CBA / J mice of two months of age were given a single intraperitoneal injection of gold thioglucose (Sigma Catalog No. A0632) at a dose of 0.2 mg / g in physiological saline. Mice were weighed one month after “treatment”. RNA was isolated from the adipose tissue of those animals in which the weight increased by more than 20 g after administration of GTG.

results

As recently discovered, the OB gene is expressed in adipose tissue (Zhang et al., Nature, 372: 425-432 (1994)). Since adipose tissue consists of cells of many tops, including adipocytes, preadipocytes, fibroblasts, and vascular cells, in situ hybridization is carried out on sections of fatty lumps of the epididymis of normal animals with antisense OM riboprobes and sense OM riboprobes (Richardson et al., 1992, see above ; Wasserman, “The Concept of Adipose Tissue as an Organ,” in the book by Ed. Rodahl, Issekutz, “Fat as Tissue,” pp. 22-92, Me Graw Hill, New York (1964)). When using the antisense test, positive signals were detected in all slice adipocytes (Fet. 30 - Wt mark). No signals were detected when the antisense sample was hybridized with sections of the brain (data not shown). The degree of hybridization of the antisense test with adipose tissue sections of C57BL / Ks db / db mice was significantly increased, confirming the specificity of expression of RNA OB in adipocytes and showing a significant increase in the level of OB RNA per adipocyte in these animals (Fig. 30 - db / db mark) . Mutant mice at the db locus suffered from massive obesity as part of a syndrome phenotypically identical to that observed in C57BL / 6J ob / ob mice (Bahary et al., 1990, supra).

OB RNA is not synthesized in stromal cells of adipose tissue, separated from adipocytes. As expected, cells in the adipocyte fraction expressed OB RNA, as shown by Northern blotting (Figure 31). Similar results were obtained using RT-PCR (data not shown). These data confirm the conclusion that only in adipocytes is expressed the OB gene. The results obtained using circulating adipocytes support this conclusion. In these experiments, 3T3-F442A cells were cultured under conditions leading to lipid assimilation, which is part of the cell program for adipocyte differentiation. OB RNA was not expressed either in exponentially growing cells or in 3T3-F442A preadipocytes in a monolayer state in which early markers are expressed, while differentiation of these cells into adipocytes leads to the expression of detectable OB RNA levels (Fig. 31) (Dani et al., J. Biol. Chem., 264: 10119-10125 (1989)). The level of OM RNA is extremely sensitive to cultivation conditions, since mRNA was not detected in the late stages, when the cells after the monolayer stage were not exposed to insulin.

Hybridization studies have shown that RNA OB is expressed in vivo in several different fat depots, for example, in the epididymis, as well as in parametric, abdominal, perineal and inguinal fatty lumps (Fig. 32A). The exact level of OM RNA expression in each fat depot varied slightly; in inguinal and parametric fat lumps, it was slightly lower. OB RNA was also expressed in brown adipose tissue, although the expression level here was 50 times lower compared to other adipose tissue depots. These quantitative differences correlated with predefined size differences among cells of various fat depots (Johnson et al., J. Lipid Res., 13: 2-11 (1972)). The amount of OM RNA in brown adipose tissue was independent of cold exposure (Fig. 32B). In this experiment, the level of RNA of unbound OB protein (UCP) increased in brown adipose tissue after cold exposure, while the level of ob RNA did not change (Jacobsson et al., J. Biol. Chem., 260: 16250-16254 (1985) ) Taken together, these data confirm that all adipocytes are capable of producing OB RNA, and demonstrate different levels of expression in various fat depots. The data obtained support the suggestion that the level of encoded protein correlates with the total amount of adipose tissue.

The level of OB RNA in db / db mice and mice with dysfunction of the hypothalamus was measured during the experiment. Damage to the ventromedial hypothalamus (VMH) led to obesity as a component of a syndrome similar to that observed in ob / ob and db / db mice (Bray et al., Metabolism, 24: 99-117 (1975)). Parabiosis experiments suggest that such damage leads to overexpression of a blood-forming factor that suppresses food intake and body weight (Hervey, 1959, see above). Similar results are observed when mutants of the db locus mouse parabiotically combine with normal mice. This suggests that the OB receptor may be encoded by the db locus (Coleman et al., 1978, see above). Thus, obesity resulting from VMH lesions and mutations at the db locus may be due to resistance to the action of the OB protein. If so, then a secondary increase in OM levels in adipose tissue can be predicted.

Damage to the hypothalamus was induced in female CBA mice by the administration of chemically pure gold thioglucose (GTG) Debons et al., Fed. Proc. 36: 143-147 (1977). The administration of GTG resulted in specific damage to the hypothalamus, especially in the ventromedial hypothalamus (VMH), followed by the development of obesity over several weeks. Typically, a single intraperitoneal injection of GTG at a dose of 0.2 mg / g body weight led to the development of obesity for 4 weeks. One month old female CBA / J mice (20-25g) were injected with GTG, and the subsequent weight gain of the “treated” and control animals is shown in Table. 2. RNA was obtained from the adipose tissue of db / db mice and animals treated with GTG, gaining more than 20 g of weight. Northern blotting showed a twenty-fold increase in the level of RNA OB in two-month-old db / db mice and mice treated with GTG, compared to normal animals (Fig. 33).

table 2 Weight gain in mice injected with GTG control (n = 41) GTG (n = 93) <1g 41.0 (100%) 4.0 (4%) 10g-20g 0.0 (0%) 15.0 (16%) > 20g 0.0 (0%) 74.0 (80%)

Two month old female CBA / J mice were injected with GTG (Sigma A0632) intraperitoneally in saline at a dose of 2.0 mg / g. The body weight of the control and experimental animals was recorded before and one month after injection. Animals were kept five in a cage and fed to satiety. The weight gain one month after GTG injection is shown in Table 2. Animals with a weight gain of more than 20 g. One month after injection were selected for further studies.

Discussion

The product of the OB gene circulates in human and mouse blood plasma and can act as a regulator of the amount of adipose tissue. Further studies of the regulation of expression and the mechanism of action of OM will be of great practical importance for a better understanding of the physiological ways of regulating body weight.

The above examples show that the product of the OB gene is expressed exclusively by adipocytes in all adipose tissue depots. This result is consistent with the ability of the protein product of the OB gene to correspond to lipid stores in the body. Moreover, OM RNA undergoes twenty-fold increased regulation in db mice and mice with impaired hypothalamus. In such animals, the actual increase in the level of OM RNA per cell was most likely even higher than twenty-fold, since the adipocyte size in these animals was increased by about 5 times (Fig. 30) (Debons et al., 1977, see above) . These results suggest that the db gene and hypothalamus are in the downstream position relative to the OB in a pathway that controls body weight and is consistent with the assumption that the OB receptor is encoded by the db locus (Coleman et al., Diabeiologia 14: 141- 148 (1978)). Molecular cloning of the OB receptor and / or db gene will solve this problem. An increase in OB RNA level in db / db mice and treated with GTG also suggests that the OB gene product in fat cells has a non-cellular autonomous function (Ashwell et ai, Proc. R. Soc. Land., 195: 343-353 (1977); Ashwell et al., Diabetologia 15: 465-470). Thus, if the encoded protein acts directly on fat cells, inhibiting their growth and differentiation, then overexpression of the wild-type OB gene in mice treated with GTG should lead to phenotypic thinness.

The most cautious explanation of the data presented is that the OB protein functions as an endocrine signaling molecule that is secreted by adipocytes and acts, directly or indirectly, on the hypothalamus. Direct effects on the hypothalamus require that existing mechanisms allow the passage of the OB gene product through the blood-brain barrier. Mechanisms involving the perioventricular organ and / or specific transporters allow the brain to be exposed to molecules of a size encoded by the OB gene (Johnson et al., FASEB J., 1: 678-686 (1983); Baura et al., J. din. Invest., 92: 1824-1830 (1993); Pardridge, Endocrine Reviews, 7: 314-330 (1986)). However, this hypothesis should be interpreted with caution until a mechanism is identified by which the protein is able to cross the blood-brain barrier. Moreover, it is necessary to evaluate the possible effects on other target organs.

The signal (s) of fat cells responsible for the quantitative differences in the level of expression of the OB gene is still unknown, but they correlate with differences in the size of adipocytes. The adipocytes of db / db mice are five times greater than in normal animal cells, and their lipid content per cell is 1.0 μg (Johnson et al., 1972, see above). Preliminary evidence indicates that lipid content and / or size is an important parameter in determining body weight (Faust et al., Am. J. Physiol., 235: 279-286 (1978); Faust et al., Science, 197: 393-396 (1977)). It is likely that each fat cell expresses a low level of RNA OB, which further increases in proportion to the size of the cell. In addition, it is possible that the cell size is not such a significant parameter, but simply coincides with the intracellular signal, which increases the expression of the OB gene in adipocytes of db / db mice and with VMH damage. In any case, the components of the signal transduction pathway that regulate the synthesis of OM RNA most likely play an important role in determining body weight. The influence of the environment and genes that reduce the level of OM expression leads to an increase in body weight, as well as factors that reduce sensitivity to the encoded protein. The specific molecules that control the level of expression of the OB gene are still unknown. It is also necessary to clarify the mechanisms of gene control, which lead to a quantitative difference in the level of RNA RH, and the nature of the regulatory elements of the RH gene. The identification of molecules that regulate the expression of the OB gene in adipocytes, and those that mediate the effects of the protein on its site (s) of action, will contribute to a deeper understanding of the physiological mechanisms that regulate body weight.

EXAMPLE 10: The nature of RNA expression and mapping at the physiological, cytogenetic and genetic levels of chromosome 7

OB RNA is expressed at a high level in human adipose tissue and at a significantly low level in the placenta and heart. The human OB gene is mapped in the contig of a large artificial yeast chromosome (YAC), which originates from chromosome 7Q 31.3. To further determine the relative localization of the gene based on comparative mapping of human and mouse genes, in this experiment 8 identified microsatellite markers were identified in close physical proximity to the human OB gene. Since mutations in mouse OBs can lead to a syndrome that closely resembles pathological obesity in humans, these genetic markers correspond to important tools for studying the possible role of the OB gene in the development of inherited forms of obesity in humans.

Materials and methods

Northern blotting

RNA is obtained from adipose tissue using the method of Chirgwin et al., Biochem., 18: 5294-5299 (1979). Northern blotting, radioactive labeling and hybridization are carried out as described previously (Zhang et al., 1994, see above). Northern polyA ⁺ RNA blots (human MTN, human MTN II, human fetal MTN II) were obtained from CLONETECH (Palo Alto, CA), as well as the PCR primers used to generate the human radiolabeled acgin assay.

Implementation of STS

Specific PCR sequence analysis with target sites (STS) is performed and optimized exactly as previously described (Green et al., PCR Methods Applic., 1991; Green et al., Genomics, 11: 548-564 (1991); Green, “Physical mapping of human chromosomes: generation of a chromosome-specific sequence with target sites”, in the book Methods in Molecular Genetics Vol. 1, Analysis of Genes and Chromosomes (Part A), pp. 192-210, edited by Adolph., Academic Press, Inc., San Diego (1993); Green et al., Hum. Mol. Genet., 3: 489-501 (1994)). Each STS is denoted by the prefix "sWSS" for a unique number. Details of the 19 received STSs are given in Table. 3 with additional information (e.g., PCR reaction conditions, complete DNA sequence) derived from a gene protein and / or genomic database (GDB). For microsatellite-specific STSs, the oligonucleotide primers used in the PCR analysis (Table 3) corresponded to those used in the genotypic analysis (Table 4) or determined (most often using the OSP computer program) (Hiller et al. , PCR Meiods Applic., 1: 124-128 (1991)) using a DNA sequence available from a gene bank. In Tab. Figure 3 shows STSs in the YAC contig containing the human OB gene.

In the YAC contig containing the human OB gene, 19 STSs specific for chromosome 7 were mapped. All of them are shown in FIG. 35. In each case, the designations “sWSS”, the corresponding well-known names, the GDB locus name, the sequence of PCR primers, the size of the STS and the GDB identification number are given. The sources of STSs were: end of YAC (isolated end insert of YAC) (Green, 1993, see above), lambda clone (selective, chromosome-specific 7 lambda clone) (Green et al., 1991, see above; Green, 1993 , see above), a genetic marker (microsatellite marker, see Table 2) (Green et al., 1994, see above), YAC insert (randomly selected segment of the YAC insert) and gene (gene-specific STS). Note that for some genotypic marker-specific STSs, the PCR primers used to identify YACs (shown in this table) are different from those used for genotypic analysis (Table 4), since the detection of YACs containing a genetic marker does not require amplification polymorphic sequence in itself. All of these PCR studies were carried out at an annealing temperature of 55 ° C with the exception of sWSS494, sWSS883, sWSS1529 and sWSS2619 (50 ° C), sWSS999 and sWSS1174 (60 ° C) and sWSSSOS (65 ° C). Further details of STS-specific PCR analysis can be found in GDB.

FIG. 35 shows eight microsatellite markers mapped to the YAC contig containing the human OB gene. In each case, marker designations (indicated as a well-known name in Table 3), type of microsatellite structure (tetranucleotype, tetra-repeat or (CA) _n repeat), GDB locus name, primer sequences used for genotypic analysis based on PCR primer sequences and GDB identification numbers. Additional details regarding PCR analysis and polymorphisms can be found in GDB.

The structure of the (9.5-specific human STS (sWW2619) was determined using the DNA sequence obtained from the 3'-untranslated cDNA region. The Pax4-specific human STS (sWSS808) was prepared as follows: Oligonucleotide primers specific for the mouse Pax4 gene (GGCTGTGTGAGCAAGATCC (SEQ ID NO: 63) (GGGAGCCTTTGTCCTGGGTACAAAG) (SEQ ID NO: 93) (Walther et al., 1991, Genomics 11: 424-434) (1991) was used to amplify a 204 bp fragment of a human genomic DNA (product is the same size as that obtained from mouse genomic DNA.) The indicated PCR analysis is not suitable for identifying YACs, since a similar product (200 bp) was also amplified from yeast DNA, however, DNA sequence analysis of the PCR product obtained from human DNA revealed substitutions at 20 positions among the analyzed 156 bases (data not shown). using a human-specific sequence, a new primer (TTGCCAGGCAAAGAGGGCTGGAC) (SEQ ID NO: 64) was obtained, which was used with the first of the above Pax4-specific primers (see Tab. 3). The resulting PCR analysis of the Pax4-specific human gene did not amplify a significant product from yeast DNA and was therefore used to identify the corresponding YACs.

Table 3 STS Designation Famous Name Locus Source PCR Primers Size (bp) SEQ ID No. GDB ID No. sWSS1734 D7S2185 Yac end CAAGACAAATGAGATAAGG
AGAGTTACAGCTTTACAG 72 39
40 G00-455-235 sWSS494 D7S2016 Lambda clone STAAASASSTTTSSATTSS
TTATATTSASTTTTSSSSSTSTS 112 41
42 G00-334-404 sWSS883 UT528 D7S1498 Genetic marker TGCAGTAAGCTGTGATTGAG
GTGCAGCTTTAATTGTGAGC 490 43
44 G00-455-262 sWSS2359 AFMa065zg9 D7S1873 Genetic marker AGTGTTGTGTTTCTCCTG
AAAGGGGATGTGATAAGTG 142 45
46 G00-455-247 sWSS2336 AFMa125wh1 D7S1874 Genetic marker GGTGTTACGTTTAGTTAC
GGAATAATGAGAGAAGATTG 112 47
48 G00-455-244 sWSS1218 AFM309yf1 D7S680 Genetic marker GCTCAACTGACAGAAAAC
GACTATGTAAAAGAAATGCC 154 49
fifty G00-307-733 sWSS1402 D7S1916 Yac end AAAGGGCTTCTAATCTAC
CCTTCCAACTTCTTTGAC 137 51
52 G00-344-044 sWSS999 D7S1674 YAC insert TAAACCCCCTTTCTGTTC
TTGCATAATAGTCACACCC 105 53
54 G00-334-839 sWSS1751 D7S2186 Yac end CCAAAATCAGAATTGTCAGAAG
AAACCGAAGTTCAGATACAG 186 55
56 G00-455-238 sWSS1174 AFM218xf10 D7S514 Genetic marker AATATCTGACATTGGCAC
TTAGACCTGAGAAAAGAG 144 57
58 G00-307-700 sWSS2061 D7S2185 Yac end GTTGCACAATACAAAATCC
CTTCCATTAGTGTCTTATAG 200 59
60 G00-455-241

Continuation of table 3 STS Designation Famous Name Locus Source PCR primers Size (bp) SEQ ID No. GDB ID No. sWSS2588 D7S2187 Yac end ATSASTASASASSTAATS
SSATTSTASATTTSSASS 117 61
62 G00-455-253 sWSS808 Rah-4 Pax-4 Gene GGCTGTGTGAGCAAGATCCTAGGA
TTGCCAGGCAAAGAGGGCTGGAC 153 63
64 G00-455-259 sWSS1392 AFM206xc1 D7S635 Genetic marker CTCAGGTATGTCTTTATC
TGTCTCTGCATTCTTTTC 75 65
66 G00-307-815 sWSS1148 AFM199xh12 D7S504 Genetic marker GACACATACAAACACAAG
ATTGAGTTGAGTGTAGTAG 60 67
68 G00-307-652 sWSS1529 D7S1943 Yac end CAGGGATTTCTAATTGTC
AAAAGATGGAGGCTTTTG 116 69
70 G00-334-119 sWSS2619 OV OB Gene CGTTAAGGGAAGGAACTCTGG
TGGCTTAGAGGAGTCAGGGA 106 71
72 G00-455-256 sWSS404 D7S1956 Lambda clone ACCAGGGTCAATACAAAG
TAATGTGTCCTTCTTGCC 122 73
74 G00-334-251 sWSS2367 AFMa345wc9 D7S1875 Genetic marker CAATCCTGGCTTCATTTG
AAGGTGGGTAGGATGCTA 81 75
76 G00-455-250

Table 4
microsatellite markers in the UAS contig containing the human ov gene Marker designation Type of Locus Primers SEQ ID No. GDB ID No. UT528 Tetra D7S1498 TGCAGTAAGCTGTGATTGAG
GTGCAGCTTTAATTGTGAGC 77
78 G00-312-446 AFMa065zg9 (CA) _n D7S1873 AGCTTCAAGACTTTNAGCCT
GGTCAGCAGCACTGTGATT 79
80 G00-437-253 AFMa125wh1 (CA) _n D7S1874 TCACCTTGAGATTCCATCC
AACACCGTGGTCTTATCAAA 81
82 G00-437-263 AFM309yf10 (CA) _n D7S680 CATCCAAGTTGGCAGTTTTT
AGATGCTGAATTCCCAGACA 83
84 G00-200-283 AFM218xf10 (CA) _n D7S514 TGGGCAACACAGCAAA
TGCAGTTAGTGCCAATGTCA 85
86 G00-188-404 AFM206xc1 (CA) _n D7S635 CCAGGCCATGTGGAAC
AGTTCTTGGCTTGCGTCAGT 87
88 G00-199-240 AFM199xh12 (CA) _n D7S504 TCTGATTGCTGGCTGC
GCGCGTGTGTATGTGAG 89
90 G00-188-280 AFMa345wc9 (CA) _n D7S1875 AGCTCTTGGCAAACTCACAT
GCCTAAGGGAATGAGACACA 91
92 G00-437-259

Identification of YACs by PCR Based Screening

Most of the YACs shown in FIG. 35 were obtained from a collection of clones highly enriched in human chromosome 7 DNA (YAC source of chromosome 7) (Green et al., 1975, supra); using a PCR-based screening strategy (Green et al., 1995, supra; Greena et al., Proc. Nail. Acad. ScL USA, 87: 1213-1217 (1990)). In several cases, clones were isolated by PCR-based screening (Green et al., 1990, supra) of available human genomic YAC libraries constructed in CEPH (Dausset et al., Behring Inst. Mitt., 91: 13-20 (1992 ); Albertsen et al., Proc. Natl. Acad. Sci. USA, 87: 4256-4260 (1990)) or ICI (Anand et al., Nucl. Acids Res., 17: 3425-3433 (1989); Anand et al., Nucl. Acids Res. 18: 1951-1956 (1990)). Each YAC was identified by “yWSS” in front of a unique number.

Results and discussions

The study of tissue expression of the human OB gene using Northern blot showed that RNA of OB is expressed at a high level in human adipose tissue and at significantly lower levels in the placenta and heart (Fig. 34). The size of the RNA (approximately 4.5 kb) of the human and mouse was similar, as well as in each tissue where it was expressed. In these studies, a five-fold increase in signals of 10 μg of RNA from total adipose tissue was observed compared with 2 μg of polyA ⁺ placental RNA. A five-fold decrease in signal was observed in polyA ⁺ RNA from the heart compared with the placenta. According to estimates, the level of RNA RV is approximately 250 times lower in the placenta than in adipose tissue. In this experiment, RNA R was not detected in any other test tissue, including the brain, lungs, liver, skeletal muscle, kidneys, and pancreas. Additional experiments did not reveal OB RNA in the spleen, thymus, prostate, testes, ovaries, small intestine, large intestine, peripheral blood leukocytes, fetal brain, liver, or kidneys (data not shown). It is possible that OM is expressed at an undetectable level (by Northern blotting) in these tissues or other tissues that have not been studied. The observed expression pattern in human tissues is somewhat different from the expression pattern in mouse tissues, in which RNA OM was determined almost exclusively in adipose tissue.

Comparative mapping of the OB gene region in the human and mouse genomes.

The mouse OB gene is located on proximal chromosome 6 in a region homologous to the region of human chromosome 7q. Genes within the indicated segment include (from the proximal to the distal) Met proto-oncogen, regulator of transmembrane conductivity of pistotic fibrosis (Cfrr), paired box-containing gene 4 (Pax4), OB and carboxypeptidase A (CPA) (Zhang et al., 1994, see above; Friedman et al., 1991, see above). In mice, genetic mapping was used to demonstrate that Pax4 is closely related to ob (Walther et al., Supra; Zhang et al., 1994, supra). The physical distance between OB and Pax4 was found to be approximately one megabase (Mb) (Zhang et al., 1994, see above). Based on these comparative mapping experiments, it was expected that the human OB gene is located between Pax4 and CPA on chromosome 7q. Moreover, since CFTR (Heng et al., Cell Genet., 62: 108-109 (1993)) and Pax4 (Tamura et al., Cytogenet. Cell Genet., 66: 132-134 (1994)) were mapped by fluorescence with in situ hybridization (FISH) at 7q31.3 and 7q32, respectively, it is most likely that the cytogenetic localization of the human OB gene will “adjoin” the 7q31.3-q32 border.

Mapping of the OB gene on human chromosome 7

STS (sWSS2619), an amplifying small segment of the 3′-untranslated region of the human OB gene, was used to screen a set of YAC clones highly enriched in human chromosome 7 DNA (Green et al., 1995a, Genomics 25: 170-183), and 9 were identified YACs (yWSS691, yWSS1332, yWSS1998, yWSS2087, yWSS3319, yWSS3512, yWSS4875, yWSS4970 and yWSS5004). To confirm the fact that these YACs contain an authentic human OB gene, two additional experiments were performed. First, each of the YACs was tested in a second PCR analysis specific for human OB, and all YACs found a positive result (data not shown). Secondly, the yeast DNA from each clone was digested with EcoRI and analyzed by hybridization after transfer to the gel using a sample from human OB cDNA. In all cases, one hybridization band was observed that had the same size in the YACs and P1 clone containing the human OB gene (data not shown).

When using the SEGMAP computer program (Green and Green, 1991, see above) vs. other data obtained based on YACs containing STS and relating to chromosome 7 (Green et al., 1991, see above; Green et al., 1994, see above; Green et al., 1995, see above), was found that the human OB gene is within the YAC-contig shown in Fig. 35. This contig contains 43 overlapping YACs and 19 unique ordered STSs. For more information on each of the 19 STSs, see Table. 3. In addition to the OB-specific STS, the contig also contains STS (sWSS808) specific for the human Pax4 gene (Tamura et al. 1994, see above; Stapleton et al., 1993, Nature Genet. 3: 292-298), 7 STSs derived from YACs specific for chromosome 7, 2 STSs derived from lambda clones specific for chromosome 7, and, importantly, 8 microsatellite specific STSs. Additional information about these 8 genetic markers, including the sequence of primers used for genotypic analysis, are given in Table. 2. Note that there is redundancy of YACs-based compounds within the contig {ie there are 2 or more YACs connecting each adjacent pair of STSs), which is strong evidence in favor of the relative order of STSs shown in Fig. 35.

As shown in FIG. 35, the predicted orientation of the YAC contig containing the human OB gene is such that sWSS1734 is the most centromeric STS {i.e. closest to CFTR), while sWSS2367 represent the most telomeric STS (i.e. closest to CPA). This orientation is mainly based on comparative mapping data, which places Pax4 proximal and OB distal to the synthetic block in human and mouse DNA (Zhang et al., 1994, see above). The OB gene is mapped near the telomeric end of the contig based on the location of the OB-specific STS (sWSS2619).

While the contig shown in FIG. 35 was derived using SEGMAP without considering YAC sizes (when STSs were equally spaced), similar data analysis using SEGMAP taking YAC sizes into account indicates that the overall size the area covered by the contig is just 2 Mb (data not shown). Thus, while all 8 microsatellite-specific STSs (Table 4) are within the genomic interval of about 2 Mb, the 3 closest to the telomeric end of the contig STSs (sWSS1392, sWSS1148, sWSS2367) are especially closely related to the OB gene itself by itself (possibly within an interval of about 500 kb). In fact, all 3 of the above STS are in at least one of the YACs containing the human OB gene. Note that the interval between Pax4 (sWSS808) and ob (sWSS2619) of a person was estimated at approximately 400 kb, while this plot in the mouse has a predicted length of approximately 1 Mb (Zhang et al., 1994, see above). Finally, 3 YACs within the contig (sWSS691, sWSS999 and SWSS2935) were also analyzed by the FISH method, and it was found that each of them hybridizes exclusively with 7q31.3. One of these YACs (sWSS691) contains an OB-specific STS, while the other 2 clones contain a Pax4-specific STS. Recent results are generally consistent with preliminary cytogenetic mapping of human Pax4 to 7q32 (Tamura et al., 1994, supra). Based on these data, the human OB gene can be in cytogenetic relationship with 7q31.3.

EXAMPLE 11: A human OB polypeptide exhibits biological activity in mice.

Intraperitoneal injection of ob / ob mice into groups of 10 animals was performed by recombinant (obtained in bacteria) human and mouse OB polypeptide (10 μg / g / day) or physiological saline. After 4 days, the group of animals receiving saline added 0.3 g in weight. The group of animals receiving mouse OB lost 3.2 g in weight. The group receiving human OB lost 2 g in weight (p <0.01 compared with animals receiving saline). These groups of animals were also examined for food intake. The data of this experiment are shown in Table 5; information about body weight is given in Table. 6.

Table 5 Food intake per day (g) ob / ob of mice treated with OB polypeptide (value ± standard. Off) Injectable drug Day 0 Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 Day 7 Saline 13.4 ± 2.6 12.8 12.8 13.1 14.0 12.3 12.4 8.3 Mouse ov 14.9 3.7 4.4 5.1 8.9 8.1 8.7 3.5 Human OB 14.3 10.3 8.7 7.0 8.9 5.3 3.8 13.0

Table 6 Body weight and change in body weight of ob / ob mice treated with OB polypeptide (value ± STD off) Injectable drug Body Weight Day 0 Body Weight Day 4 Change in percent (Days 0-4) Body Weight Day 6 Percentage Change (Days 0-6) Fiz. solution 39.9 ± 1.8 40.7 ± 1.6 0.8 ± 0.5 41.1 ± 2.2 1.2 ± 1.1 Mouse ov 39.5 ± 2.1 36.2 ± 2.0 -3.3 ± 1.2 36.3 ± 2.2 -3.1 ± 1.2 Human OB 39.5 ± 2.0 37.6 ± 1.7 -2.0 ± 1.0 36.1 ± 1.3 -3.5 ± 1.3

The data presented show that human OM has biological activity in the body of mice.

EXAMPLE 12: High doses of OM affect wild-type mice

Wild-type mice (C57BL6J ±?) Were intraperitoneally injected with recombinant mouse OB at a dose of 10 μg / g / day, and the animal body weight was determined every four days. The research results are shown in Table 7.

Table 7 Body weight (g) in normal mice treated with OB Injectable drug Day 0 Day 4 Day 8 Day 12 Day 16 Saline 22.6 ± 1.4 22.2 ± 1.2 22.5 ± 1.3 23 22.5 Mouse ov 22.4 ± 1.5 20.6 ± 1.5 20.8 ± 1.3 20.8 21.8

The above data show that OM affects the body weight of wild-type animals of wild-type animals in the same way as ob / ob mice, which are obese, although to a lesser extent.

EXAMPLE 13: Introduction of OB polypeptide by continuous infusion using a pump

This example shows that continuous infusion of the OB polypeptide leads to weight loss in normal mice. Normal (non-obese) mice received the mouse ob polypeptide through an osmotic infusion pump. The dose was 0.5 mg protein per 1 kg of body weight per day, resulted in the loss of body weight in 4.62% (± 1.34%) relative to the weight of the base line on ^the 6 ^th day of infusion.

Materials and methods

Animals

In the experiment, wild-type animals (+ / +) C57B16 were used. Animals were kept alone at home. The age of the mice at the initial time point was 8 weeks, and the weight of the animals stabilized. For each experiment, 10 animals were used (carrier and protein).

Determination of food intake and weight

The mice were given special food for rodents (PMI Feeds, Inc.) in the form of a powder (Allen town Caging and Equipment), which makes it possible to more accurately determine the amount of food consumed compared to commonly used top dressing. The body weight of animals was measured at the same time (2 hours a day) every day for 6 days. The weight of animals on the day preceding the infusion was taken as the baseline.

Mouse OB Cloning

Cloning of mouse OB DNA for expression in E. coli was carried out as follows. The DNA sequence derived from the published peptide sequence (Zhang et ai, 1994, see above, i.e., Example 1, see above) was back-translated using the optimal E. coli codons. Terminal cloning sites were Xba I - Bam. Hi. A ribosomal binding enhancer and a strong ribosomal binding site were placed in front of the coding region. The duplex DNA sequence was synthesized using standard methods. The corresponding clones were selected by detecting the expression of the recombinant protein and the presence of a given DNA sequence of the OB in the resident plasmid. Amino acid sequence (and DNA sequence) has the following structure:

Expression vector and host strain

To obtain the protein, the plasmid expression vector pCFM1656, American Type Culture Collection (ATCC) No. 69576 was used. The above DNA was ligated into the expression vector pCFM1656, which was linearized by Xba I and Bam HI. Then, E. coli cells, the FM5 host strain, were transformed with the vector. E. coli FM5 cells were obtained by Amgen Inc., Thousand OaKs, CA, from strain E. coli K-12 (Bachmann et al., Bacterial Rev., 40: 116-167 (1976)) and contain an integrated lambda phage repressor gene , I ₈₅₇ (Sussman et al., C. R. Acad. ScL, 254: 1517-1579 (1962)). The preparation of the vector, the transformation of cells and the selection of colonies is carried out by standard methods, for example, as described by Sambrook et al., 1989, see above. Host cells are grown in LB medium.

The introduction of a protein or carrier

The recombinant mouse OB polypeptide is used in these studies, typically in these studies, typically in a concentration of about 0.9 mg / ml phosphate buffer solution, pH 7.4. The amino acid sequence (cDNA sequence) of the polypeptide is shown just above. A protein or carrier (phosphate buffered saline, pH 7.4) is administered by infusion from an osmotic pump. Alzet osmotic mini-pumps (Alza, Palo Alto, CA, model No. 1007D) surgically implant each mouse into a subcutaneous pocket in a subcutaneous pocket. The pumps are calibrated to inject 0.5 ml of protein / kg body weight / day. Control animals were injected with phosphate buffered saline (pH 7.4) using an osmotic mini-pump.

Fermentation process. To obtain protein using a three-phase fermentation technique, known as the “dosing and sorting process."

Dosing and sorting. Sources of nitrogen and phosphate are sterilized (by raising the temperature to 122 ° C for 35 minutes, 18-20 psi) in a fermentation vessel (Biolafitte, 12 L). After cooling, carbon, magnesium, vitamins and trace amounts of metals are aseptically added. After overnight cultivation (16 hours or more) of bacteria producing the recombinant mouse protein, 500 ml of culture (in LB broth) is added to the fermenter.

Top dressing I. After reaching an OD ₆₀₀ value of 4.0-6.0, top dressing I is added to the cultures. Glucose is added in a limited amount to control the growth rate (μ). Automatically, a system (called a distribution control system) is programmed to control the growth rate at a level of 0.15 hr ^-1 regenerations.

Top dressing I. When OD ₆₀₀ reaches 30, the temperature is slowly increased to 42 ° C and top dressing I is replaced by top dressing II, described below. Then, fermentation is continued for 10 hours with a sample taken every 2 hours. After 10 hours, the contents of the fermenter are cooled below 20 ° C and collected by centrifugation.

The composition of the medium:

The main environment:

10 g / l yeast extract 5.25 g / l (NH ₄ ) ₂ SO ₄ 3.5 g / l K ₂ HPO ₄ 4.0 g / l KN ₂ PO ₄ 5.0 g / l Glucose 1.0 g / l MgSO ₄ · 7H ₂ O 2.0 ml / l Vitamin Solution 2.1 ml / l Trace metal solution 1.0 ml / l Defoamer P2000

Top dressing II:

50 g / l Bacto tryptone 50 g / l Yeast extract 450 g / l Glucose 8.75 g / l MgSO ₄ · 7H ₂ O 10 ml / l Vitamin Solution 10 ml / l Trace metal solution

Top dressing II:

200 g / l Bacto tryptone 100 g / l Yeast extract 110 g / l Glucose

Vitamin solution (basic medium, top dressing 1): 0.5 g of biotin, 0.4 g of folic acid and 4.2 g of riboflavin are dissolved in 450 ml of H ₂ O and 3 ml of 10 N. NaOH and diluted to 500 ml of H ₂ O. Fourteen grams of pyridoxine-HCl and 61 g of niacin are dissolved in 150 ml of H ₂ O and 50 ml of 10 N. NaOH and adjusted to 250 ml of H ₂ O. Fifty-four grams of pantothenic acid was diluted in 200 ml of H ₂ O and adjusted to 250 ml. Three solutions are combined and brought to 10 l of the total volume.

Trace metal solution (basic medium, top dressing I):

Ferric Chloride (FeCl ₃ · 6H ₂ O): 27 g / L

Zinc Chloride (ZnCl ₂ · 4H ₂ O): 2 g / l

Cobalt chloride (CoCl ₂ · 6H ₂ O): 2 g / l

Sodium Molybdate (NaMoO ₄ · 2H ₂ O): 2 g / L

Calcium Chloride (CaCl ₂ · 2H ₂ O): 1 g / l

Chalk sulfate (CuSO ₄ · 5H ₂ O): 1.9 g / l

Boric acid (H ₃ BO ₃ ): 0.5 g / l

Manganese Chchoride (MnCl ₂ · 4H ₂ O): 1.6 g / l

Dihydrated sodium citrate: 73 g / l.

Purification of mouse OB polypeptide

The cleaning was carried out as follows (unless otherwise indicated, all steps are carried out at 4 ° C):

1. Cell paste. E. coli cell paste is suspended in a 5-fold volume of 7 mM EDTA, pH 7.0. The cells in EDTA are then destroyed by double passage through a liquid microhomogenizer. The destroyed cells are centrifuged at 4.2 k rpm for 1 h in a Beckman JB-6 centrifuge, rotor J5-4.2.

2. Launch Taurus inclusion # 1. The supernatant from the homogenate obtained above is removed and the pellet is resuspended in a 5-fold volume of 7 mM EDTA, pH 7.0, and homogenized. The mixture is centrifuged as described in step 1.

3. Laundering Taurus inclusion # 2. The supernatant of the culture obtained above is removed, the pellet is resuspended in a ten-fold volume of 20 mM Tris, pH 8.5, 10 mM DTT and 1% deoxycholate and homogenized. The resulting mixture was centrifuged as described in step 1.

4. Launch Taurus inclusion # 3. The supernatant of the culture obtained above is removed, the precipitate is resuspended in ten times the volume of distilled water and homogenized. The resulting mixture was centrifuged as described in step 1.

5. Restoration of the structure. The precipitate was treated with 15 volumes of 10 mM HEPES, pH 8.5, 1% sodium sarcosine (N-lauryl sarcosine) at room temperature. After 60 minutes, the solution was added to 60 mM copper sulfate, and then the solution was stirred overnight.

6. Removal of sarcosine. The reconstituting mixture was diluted with 5 volumes of 10 mM Tris buffer, pH 7.5, and centrifuged as described in step 1. The supernatant was collected and combined with stirring for 1 h with Dowex 1-X4 resin, 20-50 mesh, chloride form (with a total volume of diluted reducing mixture). This mixture was applied to a column and the eluate was collected. Sarcosine removal is performed using HPLC.

7. Acid precipitates. The eluate obtained in the previous step is collected, the pH is adjusted to 5.5 and the mixture is incubated for 30 minutes at room temperature. The resulting mixture was centrifuged as described in step 1.

8. Cation exchange chromatography. The pH of the supernatant obtained in the previous step is adjusted to 4.2 and the preparation is layered onto a column with rapidly flowing SM serophase. Use a salt gradient in twenty column volumes at 20 mM NaOAC, pH 4.2, O M-1.0 M NaCl.

9. HIC chromatography. Peak fractions obtained in the previous step using CM serophase (control of ultraviolet radiation) are added to 0.2 M ammonium sulfate. An inverse salt gradient in a 20-fold column volume was obtained at 5 mM NaOAc, pH 4.2, 0.4 M-0 M (NH ₄ ) ₂ SO ₄ . The drug is concentrated and diafiltered in PBS.

results

Below are the percent differences between the weight of C57BL6J mice (8 weeks old) and baseline.

Table 8 Weight Loss with Continuous Infusion Howl (days) Carrier (PBS) Recombin OV polypeptide Days 1-2 3.24 ± 1.13 1.68 ± 1.4 3-4 days 4.3 ± 0.97 -2.12 ± 0.79 Days 5-6 4.64 ± 0.96 -4.62 ± 1.3

As can be seen, by the end of the 6th day of continuous infusion, animals that received the OB polypeptide lost more than 4% of their body weight compared to the baseline. This is significantly faster weight loss than that observed with intraperitoneal injection. A weight loss of only 2.6-3.0% is observed by the end of the 32 days of the injection period in normal wild-type mice (daily intraperitoneal injections of recombinant mouse OB polypeptide at a dose of 10 mg / kg) and does not exceed more than 4% at any time point in the injection period (data not shown). The results indicate that continuous infusion at a dose reduced by 20 times (0.5 mg / kg as opposed to 10 mg / kg) provides more significant weight loss in a shorter period. The results presented here are specifically reliable, for example, 4.62% with p <0.0001.

EXAMPLE 14: Cloning and expression of an analogue of a recombinant human OB polypeptide

This example relates to compositions and methods for producing an analogue of a recombinant human polypeptide OB.

The human OB DNA sequence is obtained using mouse OB DNA as described in Example 13, replacing the site between the Mlu I and Bam HI sites of duplex DNA (obtained from synthetic oligonucleotides), which contains 20 codon substitutions. The codons of arginine in the mature mouse protein at position 35 and the leucine codon in the mature mouse protein at position 74 are not changed. The Mlu I site in the sequence below is indicated by a solid line at the top. Said DNA was inserted into pCFM 1656 vector (ASTT No. 69576) in the same manner as the recombinant mouse protein, as previously indicated.

Fermentation

Fermentation of the aforementioned host cells to obtain a recombinant human OB polypeptide is carried out under the same conditions and using the same components as described above to obtain a recombinant mouse polypeptide. In the final preparation, the yield (g / l), the degree of preliminary purification of recombinant human OM and the content of bacterial protein impurities are analyzed, and the effectiveness of bacterial expression is evaluated.

Table 9 Analysis of the expression of the human OB polypeptide Time point OD ₆₀₀ nm Yield (g / l) Expression (mg / OD · L) Ind. + 2h 47 1.91 41 Ind. + 4h 79 9.48 120 Ind. + 6h 95 01/13 137 Ind. + 8h 94 13.24 141 Ind. + 10h 98 14.65 149

Abbreviations: Ind. + ... h means hours after induction of protein expression, as described in Example 13 for recombinant mouse protein using plasmid pCFM 1656. OD is the optical density measured by spectrophotometry (mg / unit OD / l) mg / OD / l - the degree of expression in mg of protein per unit of OD per liter.

Purification of recombinant human ob polypeptide

The recombinant human protein can be purified using the same methods as the recombinant mouse protein, as described above in Example 13. To obtain the recombinant human OB polypeptide, stage 8 is carried out by adjusting the pH of the supernatant (stage 7) to pH 5.0 and applying to the column with fast flowing SM-serophase. A salt gradient in a 20-fold column volume is obtained at 20 mM NaOAC, pH 5.5, 0 M-0.5 M NaCl. Stage 9 is carried out by diluting with water four times the combined fractions with CM-Sepharose and adjusting the pH to 7.5. This mixture was placed in 0.7 M (NH ₄ ) ₂ SO ₄ . An inverse salt gradient in a twenty-fold column volume was obtained at 5 mM NaOAc, pH 5.5, 0.2 M-0 M (NH ₄ ) ₂ SO ₄ . Except as indicated, the remaining steps are carried out as described above.

EXAMPLE 15: Study dose-response

Additional studies show that there is a dose-dependent response to the continuous administration of protein OB. In this experiment, wild-type mice (CD-1, non-obese and weighing 35-40 g, were introduced with recombinant mouse OB protein using methods similar to those described in Examples 12 and 13. The results of the studies are shown below (same as% weight loss compared to baseline).

Table 10 Dose-dependent response to continuous protein administration DOSE TIME % WEIGHT LOSS 0.3 mg / kg / day Day 2 3.5% 1 mg / kg / day Day 2 7.5% 1 mg / kg / laziness Day 4 fourteen%

As you can see, increasing the dose from 0.03 mg / kg / day to 1 mg / kg / day leads to weight loss from 3.5% to 7.5%. It is also noteworthy that on the fourteenth day, a dose of 1 mg / kg / day leads to 14% reduction in body weight.

EXAMPLE 16: Effects of leptin on the body composition of ob / ob mice

16-week-old C57BL / 6J ob / ob mice were injected with mouse leptin at a concentration of 5 μg / kg / day or vehicle for 33 days. Control animals do not receive anything. In a second ob / ob experiment, mice of 7 weeks of age were injected with mouse leptin or vehicle for 12 days. Then the animals are killed and their total body weight, body composition, insulin and glucose levels are evaluated. Research data are given in Table. eleven.

Table 11 Body weight, body composition, glucose and insulin levels of the studied animals Group 16 week old mice 7 week old mice; leptin, 5 mcg / g / day leptin 10 mcg / g / day A drug Mouse leptin Carrier The control Human leptin Mouse leptin Carrier Total body weight 31.90 ± 2.8 64.10 ± 4.5 67.50 ± 6.2 31.00 ± 1.3 33.40 ± 2.4 42.70 ± 1.5 Fat Total% 9.10 ± 1.7 38.30 ± 4.0 40.87 ± 6.1 28.40 ± 3.4 59.70 ± 2.1 60.34 ± 3.7 Low fat. the mouse. weight Total Qty (g) 6.80 ± 1.0 7.60 ± 0.4 7.73 ± 0.5 % 21.30 ± 1.7 11.90 ± 1.2 11.57 ± 1.6 Water Total amount (g) 16.00 ± 0.8 18.20 ± 0.7 18.90 ± 1.0 % 50.30 ± 4.2 28.40 ± 1.0 28.10 ± 2.2 Insulin <2.0 <2.0 <2.0 <2.0 <2.0 <2.0 (UIU / ml) Glucose (mg / dl) 170.0 ± 20.9 337 ± 30.3 317.5 ± 51.0 258.3 ± 26.8 320.0 ± 44.9 789.0 ± 152.1

Body composition data shows that leptin affects three components: the amount of fat, the mass of fat-free muscle tissue, and water mass. Leptin significantly reduces the mass of adipose tissue and has a marginal effect on the mass of fat-free muscle tissue. However, in the latter case, the result is statistically unreliable.

A comparison of glucose and insulin levels in animals treated with leptin and controls shows that leptin lowers blood sugar and insulin levels and thereby relieves these symptoms of diabetes.

EXAMPLE 17: Effect of high doses of leptin on wild-type mice

Non-obese control mice ob / ob (C57BL / 6J + /?) Were injected intraperitoneally once per day with 10 μg / g of mouse or carrier leptin (PBS), and food intake and body weight were determined over two weeks. There is a significant decrease in body weight starting from day 4, and a significant decrease in food intake from the first week. However, after one week, food intake levels become indistinguishable in both groups of animals. Animals are euthanized at the end of the second week and body composition is examined. The results of the analysis of body composition are given in Table. 12. Data show a decrease in adipose tissue in animals treated with leptin, as opposed to animals treated with PBS.

The second experiment shows the effect of mouse leptin injections on wild-type animals (C57BL / 6J) (twice daily, intraperitoneally, 12.5 μg / g). There is a significant decrease in body weight and food intake associated with daily double injections of the polypeptide. For this experiment, animals were placed in metabolic chambers. Powdered Purine # 5001 consistency was used. The specified diet differs from that used previously, which had the consistency of a pudding with water. Since the food that was fed to animals in metabolic chambers has a higher caloric value, the amount of food consumed when using two diets was different.

The following links are relevant to this description and especially to experimental procedures and discussion.

Bahary et al., Genomics, 11: 33-47 (1991)

Bahary et al., Genomics, 13: 761-769 (1992)

Bahary et al .. Molecular mapping of mouse chromosomes 4 and 6: Use of flow-sorted Robertsonian chromosome (1991)

Blank et al., Mammalian Genome, 1: s51-s78 (1991)

Bogardus et al., Annals of the New York Academy of Sciences, 630: 100-115 (1991)

Friedman et al., Mammalian Genome, 1: 130-144 (1991)

Harris, FASEB J., 4: 3310-3318 (1990)

Jacobwitz et al., N. Engl. J. Med., 315: 96-100 (1986).

Kessey, in Obesity, pp. 144-166, StunKard ed., Philadelphia, W. B. Sauders Co. (1980).

Kessey et al., Ann. Rev. Psychol., 37: 109-133.22 (1986).

Leibel et al., “Genetic Diversity and Nutrition in Obesity: Approaches to the Molecular Genetics of Obesity,” in vol. Genetic Variations and Nutrition, pp. 90-101.1, Simpoulos and Childs eds., S. Kargen, Basel (1990).

Siegel et al., Cytogenet. Cell Genet., 61 (3): 184-185 (1992).

The present invention can be implemented in various ways within its scope and taking into account the necessary features. The description is given to illustrate all aspects of the invention and does not limit it. The scope of the invention is supported by the claimed claims, which implies possible equivalent changes, also included in the scope of claims.

Various sources of information are given in the description by reference.

The invention is characterized by the following formula, corresponding to the description with available sources of information and source materials. However, on 9 August 1995, applicants deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD, 20852-1178, US A. in accordance with the requirements of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the purposes of the patent procedure for the following objects: plasmid pETM9 E. coli M9, registration number 69880; plasmid pETM9 E. coli M9, registration number 69879.

Table 12
Body composition and weight of wild-type mice / + /? / Group C57BL / 6J Body weight Fat Total % Fat-free muscle mass % Water Total % Protein one 17.3 0.30 1.71% 5.00 28.93% 12.00 69.36% 2 20.5 2.39 11.65% 5.41 26.40% 12.70 61.95% 3 16.9 0.34 1.99% 4.76 28.19% 11.80 69.82% four 18.3 0.84 4.62% 5.16 28.17% 12.30 67.21% 5 17.7 0.44 2.51% 4.96 28.00% 12.30 69.49% 6 18.7 2.56 13.72% 4.84 25.86% 11.30 60.43% 7 15.7 0.37 2.38% 4.53 28.83% 10.80 68.79% 8 16.4 0.29 1.79% 4.51 27.48% 11.60 70.73% 9 16.5 0.83 5.05% 4.67 28.29% 11.00 66.67% 10 14.9 10.40 69.80% Average std. 17.3 0.93 5.04% 4.87 27.79% 11.62 67.43% 1.6 0.90 4.52% 0.30 1.05% 0.74 3.52% Carriers eleven 18.8 1.30 6.93% 5.00 26.58% 12.50 66.49% 12 17.6 2.17 12.34% 4.53 25.73% 10.90 61.93% 13 18.0 2.29 12.74% 4.61 25.59% 11:10 61.67% fourteen 19.6 3.79 19.34% 4.61 23.52% 11.20 57.14% fifteen 18.6 2.35 12.65% 4.75 25.52% 11.50 61.83% 16 17.3 1.96 11.32% 4.54 26.25% 10.80 62.43% 17 19.3 1.38 7.12% 5.02 26.04% 12.90 66.84% eighteen 20.6 4.16 20.19% 4.94 23.98% 11.50 55.83% 19 17.7 1.08 6.13% 4.72 26.64% 11.90 67.23% twenty 19.5 12.30 63.08% Average std. 18.7 2.28 12.09% 4.75 25.54% 11.66 62.45% 1.1 1.07 5.08% 0.20 1.10% 0.72 3.83%

Claims (26)

1. The obesity polypeptide (OB), consisting of the amino acid sequence of the mature polypeptide and the amino acid sequence of the signal peptide represented by SEQ ID No. 4 or SEQ ID No. 6. 2. An analogue of the OB polypeptide described in claim 1, having an amino acid sequence of at least 83% homologous to the amino acid sequence represented by SEQ ID No. 4 or SEQ ID No. 6. 3. The obesity polypeptide (OB), capable of modulating the body weight of the animal, which is characterized by the amino acid sequence of SEQ ID No. 4 or SEQ ID No. 6, devoid of the signal peptide sequence at position 1-21. 4. An analogue of the OB polypeptide described in claim 3, having an amino acid sequence of at least 83% homologous to the amino acid sequence represented by SEQ ID No. 4 or SEQ ID No. 6, devoid of the signal peptide sequence at position 1-21. 5. An analogue of the OB polypeptide described in claim 3, in which at least one amino acid in a position selected from the group consisting of positions 53, 56, 71, 85, 89, 92, 95, 98, 110, 118, 121, 122, 126, 127, 128, 129, 132, 139, 157, 159, 163 and 166 (in accordance with the sequence numbering SEQ ID No. 4) is replaced by another amino acid and which at the same time retains the ability to modulate the body weight of the animal. 6. The analogue of the polypeptide according to claim 5, in which the divergent amino acid is replaced by a mouse OB polypeptide with the sequence represented by SEQ ID No. 2 or SEQ ID No. 5. 7. The analog of the polypeptide according to claim 5, in which the substitution for alanine. 8. The analog of the polypeptide according to claim 5, selected from the group including polypeptides in which (a) the serine residue at position 53 is replaced by glycine, alanine, valine, cysteine, methionine or threonine and / or (b) the serine residue at position 98 is replaced by glycine, alanine, valine, cysteine, methionine or threonine and / or (c) the arginine residue at position 92 is replaced by asparagine, lysine, histidine, glutamine, glutamic acid, aspartic acid, serine, threonine, methionine or cysteine. 9. An analogue of the OB polypeptide described in claim 3, selected from the group comprising polypeptides in which at least (a) one residue of aspartic acid is replaced with glutamic acid, (b) one isoleucine residue is replaced by leucine, (c) one glycine or valine residue is replaced by alanine, (d) one arginine residue is replaced by histidine, (e) one tyrosine or phenylalanine residue is replaced by tryptophan, (e) one residue in positions 121-128 (in accordance with the sequence numbering of SEQ ID No. 4) is replaced by glycine or alanine, (g) one residue in positions 54-60 or 117-167 (in accordance with the sequence numbering SEQ ID No. 4) is replaced by lysine, glutamine, glutamic acid, cysteine or proline, which at the same time retains the ability to modulate the body weight of the animal. 10. A fusion protein consisting of an OB polypeptide or its analogue according to any one of claims 3, 5-9 and an auxiliary amino acid sequence linked to its N-terminal residue selected from the group consisting of SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 99 and the sequence of glycine-serine-proline. 11. A fusion protein consisting of an analogue of an OB polypeptide according to claim 4 and an auxiliary amino acid sequence linked to its N-terminal residue selected from the group consisting of methionine, SEQ ID No. 38, SEQ ID No. 98, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 99, SEQ ID No. 26 or the sequence glycine-serine-proline. 12. A human analogue of an OB polypeptide capable of modulating an animal’s body weight, comprising the amino acid sequence of SEQ ID No. 4 or SEQ ID No. 6 with a deletion of amino acid residues according to SEQ ID No. 4 selected from the group including (a) at least one residue in provisions 121-128, (b) residues 1-60, (c) residues 1-53, (d) an analogue in accordance with (a), in which residues 1-21 are deleted, and (e) an analogue according to (b) to (d) having an N-terminal amino acid or amino acid sequence selected from the group including (1) methionine, (2) the glycine-serine-histidine-methionine sequence (SEQ ID NO: 38), (3) methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-histidine-methionine sequence (SEQ ID NO: 98) (4) leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 26), (5) glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 27), (6) leucine-glutamic acid-lysine-arginine sequence (SEQ ID NO: 28), (7) methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-proline sequence (SEQ ID NO: 99) , and (8) glycine-serine-proline sequence. 13. An analogue of an OB polypeptide capable of modulating an animal’s body weight, comprising the amino acid sequence of SEQ ID No. 2 or SEQ ID No. 5 with a deletion of amino acid residues in accordance with the numbering of the sequence of SEQ ID No. 4 selected from the group including (a) at least one residue in provisions 121-128, (b) residues 1-60, (c) residues 1-53, (d) an analogue in accordance with (a), in which residues 1-21 are deleted, and (e) an analogue according to (b) to (d) having an N-terminal amino acid or amino acid sequence selected from the group including (1) methionine, (2) the glycine-serine-histidine-methionine sequence (SEQ ID NO: 28), (3) methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-histidine-methionine sequence (SEQ ID NO: 98) (4) leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 26), (5) glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 27), (6) leucine-glutamic acid-lysine-arginine sequence (SEQ ID NO: 28), (7) methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-proline sequence (SEQ ID NO: 99) and (8) glycine-serine-proline sequence. 14. The OB polypeptide described in claim 3, which is modified by attaching to it at least one water-soluble polymer selected from the group consisting of polyethylene glycol, ethylene glycol / propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinylpyrrolidone , 3-dioxolane, poly-1,3,6-trioxane, ethylene / maleic anhydride copolymer, polyamino acids (homopolymers and / or optional copolymers), polypropylene glycol homopolymers, dextran, poly (n-vinylpyrrolidone) polyethylene glyco s, copolymers of propylene oxide / ethylene oxide, polyoxyethylated polyols, polyvinyl alcohol and polyethylene glycol propionaldehyde. 15. An isolated nucleic acid molecule encoding an OB polypeptide or its analogue and characterized by a nucleotide sequence that, in accordance with the genetic code, determines the amino acid sequence of an OB polypeptide according to any one of claims 1 to 9. 16. A DNA molecule designed to express an OB polypeptide having the ability to modulate an animal’s body weight, selected from the group consisting of (a) a DNA molecule with the sequence of SEQ ID No. 3 and (b) a DNA molecule that hybridizes with (a) under medium stringency conditions using 40% formamide with 5x or 6xSSC. 17. A recombinant cloning vector containing an OB polypeptide encoding a DNA molecule according to claim 15 or 16. 18. A recombinant expression vector containing an OB polypeptide encoding a DNA molecule according to claim 15 or 16, which is operably linked to sequences that control the expression of the polypeptide. 19. A pharmaceutical composition for reducing an animal’s body weight, comprising, as an active principle, a polypeptide having the ability to modulate body weight and a pharmaceutically acceptable carrier, characterized in that it contains an effective concentration of an OB polypeptide according to any one of claims 3 to 9 or 14. 20. A monoclonal antibody that specifically interacts with an OB polypeptide obtained by using an OB polypeptide or analogue thereof according to any one of claims 1 to 9, 12-14. 21. The antibody according to claim 20, labeled with a detectable label. 22. A polyclonal antibody that specifically interacts with an OB polypeptide obtained by using an OB polypeptide or analogue thereof according to any one of claims 1 to 9, 12-14. 23. The antibody according to item 22, labeled with a detectable label. Convention Priority: 1. PP.1-9, 14-19, the sign of "glycine-serine-proline" in PP.10 and 11; subparagraphs a, b, c, d and d (1) in paragraphs 12 and 13; PP.20-23, in addition to using the OB polypeptide according to subparagraphs d (2) - (7) of PP.12 and 13 - from 08.17.1994 (US 08/292, 345). 2. Clause 10 in part of SEQ ID NOS: 26, 27 and 28; claim 11 in part of SEQ ID NOS: 26, 27, 28 and 38; paragraphs 12 and 13 in terms of subparagraphs d (2, 4, 5, 6); paragraphs 20-23 regarding the use of OB under subparagraphs d (2, 4, 5, 6) of paragraphs 12 and 13 - from 11/30/1994 (US 08/347, 563). 3. A.10 in part of SEQ ID NO: 99; claim 11 in part of SEQ ID NOS: 98 and 99; paragraphs 12 and 13 in terms of subparagraphs d (3) and (7); paragraphs 20-23 regarding the use of OB under subparagraphs d (3) and (7) of paragraphs 12 and 13 - from 10.05.1995 (US 08/438, 431).

Images