RU2261723C2 - Silent anti-cd28-antibody and their applying - Google Patents

Abstract

FIELD: medicine, therapeutic immunology, pharmacy.

SUBSTANCE: invention proposes developed methods for preparing silent anti-CD28-antibodies. Method for preparing antibodies involves culturing the a host-cell under suitable conditions followed by isolation of expressed antibodies. Also, invention describes a pharmaceutical composition, expressing vector, antibodies and a method for treatment of organ-transplant or tissue patient rejection. Invention provides expanding assortment of agents designated for prophylaxis of transplant rejection.

EFFECT: improved preparing and treatment methods, valuable medicinal properties of antibodies.

25 cl, 3 tbl, 20 dwg, 21 ex

Description

FIELD OF THE INVENTION

This invention relates to anti-CD28 antibodies defective in mitogenic activity, and their uses.

BACKGROUND OF THE INVENTION

Immune reactions, in particular organ transplant rejection, are mainly attributed to the activation of T-lymphocytes. This T-cell activation is induced by a signal from antigen-presenting cells (APC). The signal from APC includes a first signal mediated by a T-cell receptor (TCR) and a second signal (co-stimulatory signal) mediated by costimulatory molecules. The first signal comes from the main histocompatibility complex (MHC), where APC represents the T cell antigen through TCR. The second signal is mediated by several costimulatory molecules, examples of which include B7 (B7-1 (CD80) and B7-2 (CD86)), known as ligands for APC and CD28, CTLA-4, etc. as receptors on T cells. Ligand B7 is a glycoprotein belonging to the superfamily of immunoglobulins and expressed in B cells, etc., which belong to the group of antigen-presenting cells. Both CD28 and CTLA-4, which recognize B7 as a common ligand, are transmembrane glycoproteins belonging to the superfamily of immunoglobulins. Thus, T-cell activation is regulated by the simultaneous transmission of the first signal through TCR and the second signal, for example, from B7 and CD28 / CTLA-4. The signal from B7 to CD28 is known to stimulate, while the signal from B7 to CTLA-4 inhibits T cell activation [Waterhouse et al., Science, 270: 985-988 (1995)].

To date, attempts have been made to block the B7-CD28 signal by introducing CTLA-4Ig, anti-B7-1 antibodies / anti-B7-2 antibodies, anti-CD28 antibodies or the like to induce immunosuppression or tolerance. For example, CTLA-4Ig binds to B7, thereby disrupting the interaction between B7 and CD28, and, as a result, blocks the signal from CD28 with the manifestation of immunosuppressive activity. However, since the interaction between B7 and CTLA-4 is also inhibited at the same time, the signal from CTLA-4, which negatively affects the activation of T cells, is also suppressed in such a way that the desired tolerance is not achieved [Kirk et al., Proc. Natl. Acad. Sci. USA 94: 8789-8794 (1997)]. Anti-B7 antibodies were also prepared and reported to inhibit T cell activation, but, as with CTLA-4Ig, they also suppress CTLA-4 signal. In an in vitro experiment, it was found that anti-CD28 antibodies have a mitogenic effect on T cells, and the combination of stimulation under the influence of these antibodies and anti-CD3 antibodies promotes the growth and activation of T cells and enhances the production of cytokines [WO 90 / 05541, Eur. J. Immunology, 16, 1289-1296 (1986), etc.] In addition, mitogenic stimulation of the CD28 receptor for T cells with anti-CD28 antibodies, stimulated in vivo, led to the generation of a T-activating signal, similar to the second signal from B7 to CD28 [Yin et al., J. Immunology, 163: 4328-4334 (1999)]. These T-activating functions suggest that anti-CD28 antibodies can be used as immunopotentiators in the treatment of malignant tumors and AIDS (WO 90/05541).

SUMMARY OF THE INVENTION

Anti-CD28 antibodies obtained by conventional methods exhibit a mitogenic effect on T cells. Although this mitogenic activity is not fully understood, it is believed that a possible cause is the binding of the Fc region of the anti-CD28 antibody to the Fc receptor of the antigen presenting cell [Cole et al., J. Immunology, 36: 159 (1997)] . Therefore, using genetic engineering technology, the authors introduced mutations into the binding site of the Fc receptor of anti-CD28 antibodies to modify the antibodies so that they do not have mitogenic activity. The authors of the present invention have received one such antibody, TN228 IgG2M3, in which IgG2M3 has two amino acid changes in the IgG gene. In addition, the authors showed that the obtained silent anti-CD28 antibodies do not have mitogenic activity, which is extremely applicable for the induction of T-cell tolerance.

Therefore, the present invention relates to anti-CD28 antibodies lacking mitogenic activity (subsequently relates to silent anti-CD28 antibodies), and methods for suppressing immune responses, especially transplant rejection, and inducing immunotolerance using these antibodies.

The object of the present invention are silent anti-CD28 antibodies, where the anti-CD28 antibodies can be chimeric antibodies and / or humanized antibodies. The variable regions of anti-CD28 antibodies may include the amino acid sequences represented by SEQ ID NOs: 2, 4, 7, and 9, and polynucleotides encoding such amino acid sequences. For example, such polynucleotides include SEQ ID NO: 1, 3, 6, and 8.

Another object of the present invention are vectors and host cells comprising polynucleotides that encode anti-CD28 antibodies.

Another object of the present invention are methods for producing silent anti-CD28 antibodies by culturing a host cell comprising polynucleotides that encode anti-CD28 antibodies under conditions providing expression of the polynucleotide and isolating the gene products produced.

Another object of the present invention is a pharmaceutical composition comprising one or more silent anti-CD28 antibodies, preferably mixed with one or more pharmaceutically acceptable ingredients.

Silent anti-CD28 antibodies are useful for inducing T-cell tolerance, immunosuppression, and as a prophylactic / therapeutic drug against organ or tissue transplant rejection. Therefore, the present invention relates to methods for inducing T-cell tolerance, immunosuppression and prophylactic or therapeutic therapy in rejecting an organ or tissue transplant by administering one or more silent anti-CD28 antibodies to a mammal. Preferably, such silent anti-CD28 antibodies are administered in the form of the pharmaceutical composition described herein, and it may include additional suitable drugs / pharmaceuticals.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Plasmid constructs for expression of ChTN228 antibodies.

The TN228 murine antibody V _L and V _H genes were designed as miniexons flanked by XbaI sites. The V _L gene sequence was included in the pVk expression vector, and the V _H gene sequence was included in the pVg2M3 expression vector.

Figure 2. Nucleotide sequences and deduced amino acid sequences of the light chain of ChTN228 in mini-exons. Peptide signal sequences are shown in italics. CDRs are underlined. A mature light chain begins with an aspartic acid residue (bold). Untranslated and intron sequences are given in lower case. (SEQ ID NO: 1 and 2).

Figure 3. Nucleotide sequences and deduced amino acid sequences of the variable regions of the heavy chain of ChTN228 in mini-exons. Peptide signal sequences are shown in italics. CDRs are underlined. The mature heavy chain begins with the remainder of glutamine (bold). Untranslated and intron sequences are shown in lower case (SEQ ID NO: 3 and 4).

Figure 4. Competitive analysis. P815 / CD28 cells ^were incubated with 25 Ng MuTN228-FITC and double serial dilutions of ChTN228 or MuTN228, as described. P815 / CD28 ⁺ cells were also incubated with MuTN228-FITC alone, without any competitor. We plotted the dependence of the average fluorescence on the concentration of the competitor.

Figure 5. The inhibitory effect of TN228-IgG2m3 on human primary MLR (1). Separately presented is the inhibition in percent of primary MLR for four individuals.

6. The inhibitory effect of TN228-IgG2m3 on human primary MLR (2). Separately presented is the inhibition in percent of primary MLR for four individuals.

7. The effect of TN228-IgG2m3 on secondary MLR.

Data for two volunteers are presented separately.

Absorption of [ ³ H] -thymidine in secondary MLR is expressed as a percentage of decays per minute with stimulation of only Raji in primary MLR, taken as 100. TN228-IgG2m3: 0.1 μg / ml.

Fig. 8. Plasmid constructs for expression of HuTN228 antibodies. V _L and V _{H of} humanized TN228 were designed as miniexons flanked by XbaI sites. The V _L gene sequence was included in the pVk expression vector, and the V _H gene sequence was included in the pVg2M3 expression vector.

Fig.9. Nucleotide sequences and deduced amino acid sequences of the variable regions of the heavy chain of HuTN228 in mini-exons. Peptide signal sequences are shown in italics. CDRs are underlined. The mature heavy chain begins with a glutamine residue (bold) (SEQ ID NO: 6 and 7).

Figure 10. Nucleotide sequences and deduced amino acid sequences of the variable regions of the light chain of HuTN228 in mini-exons. Peptide signal sequences are shown in italics. CDRs are underlined. The mature light chain begins with an aspartic acid residue (bold) (SEQ ID NO: 8 and 9).

11. Competitive analysis using FACS. In a competitive analysis with flow cytometry, the binding of FITC-labeled MuTN228 to P815 / CD28 ⁺ cells was determined in the presence of various amounts of competitive antibodies MuTN228 or HuTN228, as described in the examples.

Fig. 12. Competitive analysis using ELISA. In a competitive assay using ELISA, the binding of biotinylated MuTN228 to sCD28-Fc was determined in the presence of various amounts of competitive MuTN228 or HuTN228 antibodies, as described in the examples.

Fig.13. Competitive analysis using I-125. In a competitive assay using ¹²⁵ I-labeled antibodies, binding of ¹²⁵ I-labeled MuTN228 to P815 / CD28 ⁺ cells was determined in the presence of various amounts of competitive MuTN228 or HuTN228 antibodies, as described in the examples.

Fig.14. Plasmid constructs for expression of antibodies PV1-IgG3. V _L and V _H PV1 were designed as mini-exons flanked by XbaI sites. The V _L gene sequence was included in the pMVk.rg.dE expression vector, and the V _H gene sequence was included in the pMVg3.D.Tt expression vector. Then two plasmids were recombined to obtain one plasmid coexpressing the heavy and light chains of PV1-IgG3.

Figa. CDNA sequences and deduced amino acid sequences of the light chain and heavy chain in mini-exons. CDRs are underlined. The mature light chain begins with an aspartic acid residue (underlined twice) at position 20 (SEQ ID NO: 10 and 11).

Figv. CDNA sequences and deduced amino acid sequences of the variable regions of PV1 in mini-exons. CDRs are underlined. The mature heavy chain begins with glutamine (underlined twice) at position 20 (SEQ ID NO: 12 and 13).

Fig.16. Analysis of PV-1-IgG3 by gel chromatography using HPLC as described in the Methods section. Protein was determined by absorption at 280 nm.

Fig.17. SDS-PAGE analysis of the mouse control isotype IgG3 (lane 1), PV1 (lane 2) and PV1-IgG3 (lane 3). The proteins in photograph A passed under non-reducing conditions, and in photograph B under reducing conditions. MM stands for molecular weight markers. Numbers represent MM standards in kDa.

Fig. 18. EL4 cells were stained with PV1 (A), 37.51 (B) or PV1-IgG3 (C) and analyzed by flow cytometry. Secondary antibodies used were: FITC-labeled donkey donkey antibodies against IgG (H + L) of the Armenian hamster for PV1, FITC-labeled donkey antibodies against IgG of the golden hamster for 37.51 and FITC-labeled goat antibodies against mouse kappa chain for PV1-IgG3. In the plots, the solid line represents cells stained with secondary antibodies only. In the plots, the dashed line represents cells stained with both primary and secondary antibodies, as described in the Methods section. The mouse control IgG3 isotype did not stain EL4 cells (data not shown).

Fig.19. (A). Excess PV1 or PV1-IgG3 competes with R-PE-labeled PV1 for binding to EL4 cells. The thin solid line in the flow cytometry histogram represents cells without any staining, the solid solid line represents cells stained with R-PE-PV1 only, the thin dashed line represents cells stained with R-PE-FV1 and excess unlabeled PV1, and a thin double intermittent the line is cells stained with R-PE-PV1 and an excess of unlabeled PV1-IgG3. Excess mouse control IgG3 isotype did not affect the binding of R-PE-PV1 to EL4 cells (data not shown). (IN). An excess of 145.2C11 or 145.2C11-IgG3 competes with R-PE-labeled 145.2C11 for binding to EL4. The thin solid line represents cells without any staining, the thick solid line represents cells stained with R-PE-145.2C11 only, the thick dashed line represents cells stained with R-PE-145.2C11 and an excess of unlabeled 145.2C11, and the thin double dashed line - cells stained with R-PE-145.2C11 and an excess of unlabeled 145.2C11-IgG3. (FROM). Excess PV1 competes with PV1-IgG3 for binding to EL4 cells. EL4 cells were stained with PV1-IgG3 with and without excess PV1. Cells were washed and stained with murine IgG3-specific, FITC-labeled donkey antibodies against mouse IgG3 (H + L). The thin solid line represents cells stained with secondary antibodies only, the solid solid line represents cells stained with PV1-IgG3 and secondary antibodies, and the thin dashed line represents cells stained with PV1-IgG3 and excess PV1 and secondary antibodies.

Fig.20. Mouse splenocytes stained with PV1-IgG3 and 145.2C11. Cells were stained with control mouse isotype IgG3 (A) or PVl-IgG3 (B), contrast stained with R-PE-labeled goat anti-mouse IgG3 antibodies and FITC-labeled 145.2C11, and analyzed by two-color flow cytometry as described in the section "Materials and methods." Cells were analyzed only in the lymphocyte window. PV1-IgG3-positive cells were in the upper squares, and CD3-positive cells were in the right side squares. The number in each square represents the percentage of cells in that particular square.

DETAILED DESCRIPTION OF THE INVENTION

In the context of the present invention, the term “silent anti-CD28 antibodies" means any anti-CD28 antibodies defective in mitogenic activity. More specifically, these antibodies, which specifically bind to CD28 receptor antigens on the surface of T cells and do not stimulate the growth or activation of T cells upon combined stimulation with anti-CD3 antibodies.

Silent anti-CD28 antibodies can be constructed based on anti-CD28 antibodies or an anti-CD28 antibody-producing hybridoma by mutation or modification of agonistic anti-CD28 antibodies by genetic engineering or chemical modification. For example, by choosing to use genetic engineering technology, the binding affinity of anti-CD28 antibodies for Fc receptors can be reduced or eliminated by introducing a mutation in the amino acid sequence of the Fc domain of antibodies. For example, silent anti-CD28 antibodies can be obtained by isolating cDNA from hybridoma cells capable of producing monoclonal anti-CD28 antibodies and introducing mutation (s) into the region of the sequence corresponding to the Fc domain, which plays an important role in binding to the Fc receptor (WO 88/07089). The mutation site is not particularly limited, provided that binding to Fc receptors can be inhibited. Thus, in the case of a class of IgG antibodies, for example, amino acid residues of the H chain 234, 235, 236, 237, 318, 320 and 322 are preferred, and silent anti-CD28 antibodies can be constructed by replacing at least one of these amino acids to another amino acid.

The source of such silent anti-CD28 antibodies can be judiciously selected according to the target animal that uses the antibodies. For example, non-human moclonal antibodies contain amino acid sequences that show antigenicity in humans over a very wide spectrum. Many studies have shown that the patient’s immune response to foreign antibodies after the introduction of antibodies is very strong, and the introduction of antibodies can cause the patient a serious condition or lead to the loss of therapeutic applicability of antibodies. Therefore, it is recommended to replace the Fc region in such a way as to make the antibodies more homologous to the target animal being treated, to replace the frame regions of the variable regions, or to use antibodies obtained from a transgenic animal to which the antibody gene of the target animal has been introduced. For example, when antibodies are intended to be administered to humans, it is possible to use chimeric antibodies (EP 125023) with a substituted Fc region, humanized antibodies with a replaced framework (EP 0239400, EP 045126) or human antibodies (EP 546073, WO 97/07671) obtained from a transgenic animal to which a human antibody gene has been introduced. Mitogenic activity of antibodies can be reduced or eliminated by introducing mutations into these antibodies by genetic engineering methods, such as those described above, or by chemical modification.

As specific examples of anti-CD28 antibodies having silent Fc regions, it is possible to mention not only the antibodies described in the Examples section below, but also antibodies synthetically synthesized using the constant region gene from the target animal and variable polynucleotides regions based on the amino acid sequences of the variable regions represented in SEQ ID NO: 2 and 4 or SEQ ID NO: 7 and 9. Examples of such polynucleotides are those with the sequences SEQ ID NO: 1, 3, 6, and 8.

More specific examples of the present invention are HuTN228 and MuTN228, their Fab fragments, their F (ab) ' ₂ fragments, their derivatives, etc.

As is apparent to those skilled in the art, as a result of the degeneracy of the triplet code, almost any amino acid can be represented by more than one triplet codon in the coding nucleotide sequence. In addition, changes in a pair of minor bases can lead to a change (conservative substitution) of the encoded amino acid sequence without a significant change in the biological activity of the gene product. Thus, the nucleic acid sequence encoding the protein or peptide disclosed herein can be slightly modified (for example, by replacing the nucleotide in the triplet codon), and it will still encode the corresponding gene product with the same amino acid sequence.

The term “expression vector” refers to a polynucleotide that encodes a peptide of the invention and contains the sequences necessary for its expression in a selected host cell. Typically, expression vectors include a promoter and a transcription terminator, or provide conditions for insertion adjacent to the endogenous promoter. Typically, expression vectors are plasmids, further comprising a replicon and one or more selectable markers. However, alternatively, expression vectors can be viral recombinants designed to infect the host, or integrating vectors designed to integrate into a preferred site within the host genome. Examples of expression vectors are disclosed in Molecular Cloning: A Laboratory Manual, Second Edition, Sambrook, Fritsch, and Maniatis, Cold Spring Harbor Laboratory Press, 1989.

Suitable host cells for the expression of silent anti-CD28 antibodies include prokaryotes, yeast, archaebacteria and eukaryotic cells. Appropriate cloning and expression vectors are well known in the art for the use of such hosts as bacteria, fungi, yeast, and mammalian cells, for example those described by Pouwels et al., Cloning Vectors: A Laboratory Manual, Elsevier, New York (1985). Preferably, the cells are mammalian cells. The vector may be a plasmid vector, a single or double stranded phage vector, or a viral vector with a single or double stranded RNA or DNA. Such vectors can be introduced into cells as polynucleotides, preferably DNA, by well known methods for introducing DNA or RNA into cells. Vectors, in the case of phage and viral vectors, can also be preferably introduced into cells as a packaged or encapsulated virus by well-known methods of infection and transduction. Viral vectors may be replication competent or replication defective. In the latter case, as a rule, the multiplication of the virus will take place only in the corresponding host cells. Cell-free translation systems can also be used to produce proteins using RNA derived from real DNA constructs.

Silent anti-CD28 antibodies / proteins can be isolated by isolation / purification methods used for proteins well known in the field of protein chemistry. More specifically, mention may be made, for example, of extraction, recrystallization, salting out with ammonium sulfate, sodium sulfate, etc., centrifugation, dialysis, ultrafiltration, adsorption chromatography, ion exchange chromatography, hydrophobic chromatography, normal phase chromatography, reverse phase chromatography, gel filtration, gel permeation chromatography, affinity chromatography, electrophoresis, countercurrent distribution, etc. and their combinations.

According to the present invention, purified antibodies can be obtained using recombinant expression systems described above. The method includes culturing a host cell transformed with an expression vector containing a DNA sequence that encodes a protein under conditions that sufficiently promote protein expression. The protein is then isolated from the culture medium or cell extracts depending on the expression system used. As is known to those skilled in the art, methods for isolating a recombinant protein will vary depending on factors such as the type of host cell used and whether or not the recombinant protein is secreted into the culture medium.

Silent anti-CD28 antibodies when included in the pharmaceutical composition can be used for (a) rejection of transplantation after transplantation of organs or tissues such as the heart, kidneys, liver, bone marrow, skin, cornea, lungs, pancreas, small intestine, muscles, nerves, etc .; (b) transplant versus host reactions in bone marrow transplantation; (c) autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, severe pseudo-paralytic myasthenia gravis, type I diabetes, etc., and (d) immune diseases such as asthma, atopic dermatitis, etc.

While it is expected that silent anti-CD28 antibodies can suppress immune responses and transplant rejection and induce immunotolerance on their own, they can also be used in combination with other drugs. Among other drugs that are suitable for combination with silent anti-CD28 antibodies are various immunosuppressants such as rapamycin, deoxyspergaulin, anti-CD40 antibodies, anti-CD40L antibodies, prograf, cyclosporin A, anti-IL-2- antibodies, anti-IL-2 receptor antibody, anti-IL-12 antibodies, anti-IL-12 receptor antibodies and MMF. Rapamycin, in particular, inhibits the transmission of a signal related to the growth of T cells among signals from the IL-2 receptor, but does not inhibit the transmission of a signal related to apoptosis, so it is expected that its use in combination with a specific signal inhibitor CD28 .

Silent anti-CD28 antibodies of the invention can be administered orally or parenterally, preferably intravenously, intramuscularly or subcutaneously.

The silent anti-CD28 antibodies of this invention can be prepared in the form of a solution or lyophilized powder and, where necessary, can be included in the composition together with pharmaceutically acceptable additives such as a filler, diluent, stabilizer, isotonic agent and buffer. Preferred additives include sugar such as maltose, a surfactant such as polysorbate, an amino acid such as glycine, a protein such as human serum albumin, and a salt such as sodium chloride.

You can also choose a dosage form in the form of injection preparations (solutions, suspensions, emulsions, solids for dissolution before use, etc.), tablets, capsules, granules, powders, liquids, inclusions in liposomes, ointments, gels, powders for external applications, sprays, inhalation powders, eye drops, eye ointments, suppositories, pessaries and the like, depending on the route of administration, and the peptide of the present invention can accordingly be incorporated into the composition. Composition is mainly described in Chapter 25.2 of Comprehensive Medical Chemistry, Volume 5, Editor Hansch et al., Pergamon Press, 1990.

The dose of the pharmaceutical composition of this invention depends, among other variables, on the particular composition, the type of disease to which the treatment or prophylaxis is directed, the route of administration, the age and condition of the patient and the duration of treatment. However, in the case of intravenous, intramuscular or subcutaneous administration, 0.01-100 mg / kg, preferably 0.1-10 mg / kg per day, may be administered to an adult.

When the silent anti-CD28 antibodies of this invention are used to suppress transplant rejection or induce immunotolerance during organ or tissue transplantation, the composition can be administered at a dose of about 1 mg / kg / day immediately before transplantation, immediately after transplantation and at 3, 7, 12, 18, 25, 35, 45 and 60 days after transplantation by intravenous, intramuscular or subcutaneous injection. The frequency and dose of administration can be adequately increased or decreased by monitoring the progress of the rejection reaction after transplantation.

While the interval between administrations depends, among other factors, on the route of administration used and the condition of the patient, not only continuous administration, but also intermittent administration is possible. So, since the silent anti-CD28 antibodies of this invention are antibodies, they provide continuous action such that intermittent administration can provide the expected effect. With regard to the treatment period, if the state of tolerance is reached, then this tolerance can be maintained even if the use of silent anti-CD28 antibodies is stopped. In this regard, these silent anti-CD28 antibodies are undoubtedly more effective than the immunosuppressive effects of other immunosuppressants, the effect of which decreases after cessation of administration.

EXAMPLES

Having mainly described the present invention, it can be understood in more detail by referring to some specific examples, which are given here for illustrative purposes only and are not intended to limit it, unless otherwise indicated. The following examples are carried out using conventional methods that are well known and common to specialists in this field, otherwise some of them are described in detail.

Example 1. Sequencing of the amino acid sequence of murine antibodies against human CD28

A hybridoma producing antibodies against human CD28 (clone: TN228, mouse IgGI kappa chain) was kindly provided by Dr. Yagita (Juntendo University School of Medicine, Japan). About 0.2 mg of the isolated anti-human CD28 antibody (TN228) was recovered in 0.64 M guanidine-HCl, 0.28 M Tris-HCl, pH 8.5, 0.055 M DT7 for 90 minutes at 60 ° C (in the atmosphere argon), carboxymethylated by adding iodoacetic acid to 0.13 M for 45 minutes at room temperature (in the dark) followed by the addition of DTr to 0.32 M (to stop the carboxymethylation reaction) and immediately exchanged for 0.1 M buffer sodium phosphate, 0.002 M EDTA, pH 8.0 using a PD-10 column (catalog # 17-0851-01, Amersham Pharmacia Biotech, Uppsala, Sweden). The eluate was adjusted to 0.005 M DTT, 0.02% glycerol, and one third of the solution (approximately 0.35 ml) was transferred to a separate tube for N-terminal heavy chain release. The sample was digested with 1800 μE pyroglutamate aminopeptidase (catalog # 7334, Takara Shuzo Co., Ltd., Tokyo, Japan) for 24 hours at 45 ° C. The N-terminal sequences of the light and heavy chains from the deblocked sample were determined in 20 cycles of automatic Edman cleavage and PTH analysis on a Model 241 protein sequencer (Hewlett Packard, Palo Alto, CA). PTH derivatives were analyzed on a Hypersil ODS C18 column. Sequencer and HPLC analysis was performed following the manufacturer's instructions using reagents, solvents and columns obtained from Hewlett Packard.

The results of N-terminal sequencing of released pyroglutamate aminopeptidase TN228 were as follows:

balance number amino acid balance number amino acid balance number amino acid balance number amino acid 1 D, Q 6 Q, E eleven L 16 G, q 2 1, v 7 s 12 A, v 17 Q, S 3 V, q 8 P, g thirteen V, A eighteen R, L 4 L nine A, P 14 S, P 19 A, s 5 T, K 10 S g fifteen L, S twenty T i

Example 2. Cloning of cDNA variable region

TN228 light and heavy chain V region cDNA was cloned from hybridoma cells by an anchor polymerase chain reaction (PCR) according to the method described by Co et al. (With MS, NM Avadalovic, P. C. Caron, MV Avadalovic, DA Scheinberg and C. Queen, 1992. Chimeric and humanized antibodies with specificity for the CD33 antigen, J. Immunol., 148: 1149-1154). Amplification was performed with cDNA using 3′-primers that hybridized respectively to the C regions of the mouse kappa and gamma chains, and 5′-primers that hybridized to the added G-tail of the cDNA. For PCR of the V _L gene, the 3'-primer had the sequence (SEQ ID NO: 14):

5 'TATAGAGCTCAAGCTTGGATGGTGGGAAGATGGATACAGTTGGTGC 3'

with the remnants of 17-46, hybridized with a mouse C _K -oblastyo. For the PCR of the V _H gene, the 3 ′ primers had degenerate sequences (SEQ ID NO: 15, 16 and 17):

with residues 17-50 hybridized to the mouse C _H 1 IgG gene. Non-hybridized sequences in two groups of primers included restriction sites used for cloning. V _L and V _H cDNA were subcloned into the TOPOII Blunt vector (Invitrogen, Inc., Carlsbad, Calif.) for sequence determination.

Several light and heavy chain clones were sequenced from two independent PCR reactions. Two unique sequences were established for the light chain that were homologous to the variable regions of the murine light chain. One V _L gene sequence was non-functional due to a frameshift mutation, and it was identified as an unproductive allele. Another sequence of the V _L gene was typical of the functional gene of the variable region of the mouse kappa chain. A unique sequence was identified for the heavy chain gene that was homologous to the variable region gene of a typical murine heavy chain. These nucleotide sequences and their deduced amino acid sequences of the variable region are presented in figure 2 and figure 3.

Example 3. Construction and expression of chimeric TN228-IgG2M3

Ways

The V _L and V _H TN228 genes were converted by PCR into mini-exon segments flanked with XbaI saigas as described by He et al. (He XY, Z. Xu, J. Melrose, A. Mullowney, M. Vasquez, C. Queen, V. Vexler, C. Klingbeil, MS Co and EL Berg, 1998, Humanization and pharmacokinetics of a monoclonal antibody with specificity for both E- and P-selectin, J. Immunol., 160: 1029-1035), and were subcloned into expression plasmids of the light chain and heavy chain (FIG. 1). Each mini-exon included a signal peptide sequence, a gene sequence of a mature variable region, and a cut out donor sequence obtained from the gene of the most homologous mouse J chain. Similar excised donor sequences were used to splicen an exon of a V region gene with a constant region gene of a human antibody. Each miniexon was sequenced after it was cloned in an expression vector to ensure that the sequence was correct and there were no errors in PCR. Exons of constant region genes in plasmids expressing light and heavy chains were also confirmed by sequencing.

As used herein, ChTN228 relates to chimeric antibodies, including murine TN228 variable regions V _L and V _H , human heavy chain IgG2M3 constant region, and human kappa chain constant region for light chain. The heavy chain constant region was modified (Cole MS, C. Anasetti and JY Tso, 1997, Human IgG2 variants of chimeric anti-CD3 are nonmitogenic to T cells, J. Immunol., 159: 3613-3621) from the germline human genomic fragment 2, and the light chain was obtained from the germline human genomic fragment K. Both genes of the heavy and light chains are under the control of the early promoter and enhancer of human cytomegalovirus. The heavy chain gene is regulated by a transcription terminator derived from the human complement gene C2 (Ashfield R., P. Enriquez-Harris and NJ Proudfoot, 1991, Transcriptional termination between the closely linked human complement genes C2 and factor B: common termination factor for C2 and c -myc? EMBO J., 10: 4197-4207). Selective gpt light chain marker gene (Mulligan RC and P. Berg, 1981, Selection for animal cells that express the Escherichia coli gene coding for xanthine-guanine phosphoribosyltransferase, Proc. Natl. Acad. Sci. USA, 78: 2072-2076) and the dhfr heavy chain marker marker gene (Simonsen S.C. and AD Levinson, 1983, Isolation and expression of an altered mouse dihydrofolate reductase cDNA, Proc. Natl. Acad. Sci. USA, 80: 2495-2499) are controlled early promoter from SV40. For the expression of chimeric TN228, transfection into COS-7 cells (monkey kidney cell line) was performed using lipofectamine (catalog # 13964-013, GIBCO BRL). Depleted media from transient transfectants were analyzed for human IgG2M3 production by ELISA using specific goat antibodies against the human IgG gamma chain as capture reagent and HRP-labeled goat antibodies against human kappa chain as a development reagent. Depleted media was also tested for the ability of ChTN228 to bind to P815 / CD28 ⁺ cells (stably transfected cell with CD28 to P815 (murine mastocytoma)) by indirect immunofluorescence staining and analyzed by flow cytometry. To obtain a stable cell line, chimeric expression plasmids were transfused into the Sp2 / 0 mouse myeloma cell line by electroporation and gpt expression transfectants were selected. Depleted media from stable transfectants were analyzed by ELISA, as in the case of transient transfection.

results

The cloned V _L and V _H genes were converted to mini-exons by PCR (FIGS. 2 and 3) and subcloned into vectors expressing light and heavy chains, as described above and shown in FIG. 1.

Temporary transfection of COS-7 cells: chimeric expression vectors were temporarily transfected into the COS-7 monkey kidney cell line to produce TN228 ⁺ chimeric antibodies. The depleted medium from transfected cells was tested by ELISA for the production of chimeric IgG2M3 antibodies and flow cytometry for binding to P815 / CD28 ⁺ cells. In both tests, the depleted medium gave a positive reaction. The yield of chimeric antibodies as a result of transient transfection was ~ 0.9 μg / ml. ChTN228 antibodies from the transient supernatant bind to P815 / CD28 ⁺ cells depending on concentration (data not shown).

Stable transfection of Sp2 / 0 cells: chimeric expression vectors were transfected into Sp2 / 0 cells to obtain a stable cell line. Depleted media from several transfectants was tested for the production of chimeric TN228 antibodies and for binding to P815 / CD28 ⁺ cells, as is the case with transient transfectants. Most transfectants tested positive in both tests. One transfectant with higher antibody productivity was selected and propagated in 5 L of serum-free medium. ChTN228 was isolated from 5 L of depleted medium by affinity chromatography. The yield of isolated antibodies was ~ 25 mg.

Example 4. Purification of ChTN228 Chimeric Antibody Protein

One of the transfectants with high ChTN228 expression after stable transfection (clone 7H) was cultured in 5 L of serum-free medium for GIBCO hybridomas (catalog% 12045-076, GIBCO BRL). The depleted culture supernatant was collected when cell viability reached 10% or lower, concentrated to 500 ml and applied to a 5 ml protein A-Sepharose column using a Pharmacia Pl pump (2-3 ml / min). The column was washed with PBS before eluting the antibodies with 0.1 M glycine, 0.1 M NaCl, pH 2.7. The eluted protein was dialyzed against 3 shifts of 2 L PBS each and then desalted on a PD-10 column equilibrated with PBS containing an additional 0.1 M NaCl. The desalted protein solution was filtered through a 0.2 μm filter before storage at 4 ° C.

Example 5. Determination of the purity of gel-HPLC and SDS-PAGE

(каталог # 08541, TosoHaas, Montgomeryville, MD), соединенных последовательно. Подвижной фазой служила смесь 200 мМ фосфата калия/150 мМ хлорида калия при рН 6,9, и скорость потока равнялась 1,00 мл/минуту. Элюат с колонки контролировали спектрофотометрически при 220 нм и 280 нм. Объем введения составлял 50 мкл (50 мкг) пробы ChTN228.Gel-HPLC was performed using a Perkin Elmer HPLC system consisting of a PE ISS 200 Advanced LC Sample processor, a PE Series 410 Bio LC pump, a PE 235C diode detector, and a Nelson 600 Series LINK PE. Perkin Elmer Turbochrom Navigator, Version 4.1 software was used to control the autosampler, pump, and detector, as well as to receive, store, and process data. Separation was achieved using two TosoHaas TSK-GEL G3000SWXL gel-HPLC columns, 7.8 mm × 300 mm in size, with a particle size of 5 μm and a pore size of 250

(catalog # 08541, TosoHaas, Montgomeryville, MD) connected in series. The mobile phase was a mixture of 200 mM potassium phosphate / 150 mM potassium chloride at pH 6.9, and the flow rate was 1.00 ml / min. The column eluate was monitored spectrophotometrically at 220 nm and 280 nm. The volume of administration was 50 μl (50 μg) of the ChTN228 sample.

SDS-PAGE was performed by the usual method in a gradient 4-20% gel (catalog # EC6025, Novex, San Diego, CA).

The purity of the isolated ChTN228 was analyzed by gel-HPLC and SDS-PAGE. According to the results of this analysis, the protein was 96.5% monomer; its mobility corresponded to a protein with a molecular weight of ~ 160 kDa. Analysis of MuTN228, the control isotype MuFd79 (mouse IgGI), ChTN228 and the control isotype HuEP5C7 (human IgG2M3) using non-reducing SDS-PAGE also indicated that all four antibodies had a molecular weight of about 150-160 kDa. As a result of the analysis of the same four proteins under reducing conditions, it was shown that all four antibodies included a heavy chain with a molecular weight of about 50 kDa and a light chain with a molecular weight of about 25 kDa.

Example 6. Competitive analysis

Ways

Titration was performed using serial two-fold dilutions of MuTN228-FITC antibodies, starting at a concentration of 250 ng / test. P815 / CD28 ⁺ cells (5 × 10 ⁵ cells / test) were incubated with FITC-labeled antibodies for 1 hour on ice, washed with PBS and analyzed by flow cytometry. For competitive analysis, 25 ng MuTN228-FITC and serial two-fold dilutions of competitive antibodies ChTN228 or MuTN228, starting at a concentration of 800 ng / test, were added to P815 / CD28 ⁺ cells (5 × 10 ⁵ cells / test). As a control, P815 / CD28 ⁺ cells (5 × 10 ⁵ cells / test) were incubated with 25 ng of MuTN228-FITC alone (i.e., without competitor). Antibodies of the control isotype HuEP5C7 and MuFd79 (800 ng / test) were also tested as competitors. Cells were incubated with a mixture of antibodies in a final volume of 150 μl for 1 hour on ice (in the dark), then washed and analyzed by flow cytometry.

results

The specificity of binding of antibodies MuTN228 and ChTN228 was compared in a competitive analysis using flow cytometry, as described in the section "Methods". Different amounts of unlabeled MuTN228 or ChTN228 were mixed with 25 ng of FITC-labeled MuTN228 antibodies and incubated with P815 / CD28 ⁺ cells. Both MuTN228 and ChTN228 competed with MuTN228-FITC depending on the concentration, which indicates that the binding of both antibodies is specific for the CD28 antigen (Figure 4). Antibodies of the control isotype MuFd79 and HuEP5C7 did not compete with MuTN228-FITC, which indicates that the antibodies MuTN228 and ChTN228 recognize the CD28 antigen through specific V-region interactions.

Example 7. Chimeric antibodies against human CD28 with reduced affinity for human FR inhibit the primary reaction of a mixed culture of lymphocytes. Cell preparation

Mononuclear cells from human peripheral blood (PBMC) were obtained from normal healthy volunteers by density gradient centrifugation using ficollapac plus (Amersham Pharmacia Biotech, Tokyo, Japan). Human blood was diluted with an equal volume of RPMI1640 medium and applied to ficoll-pack plus. After centrifugation for 30 minutes at room temperature, the PBMCs were collected and washed with RPMI1640 medium. Then, PBMCs were suspended in medium (RPMI1640 containing 2.5% AB human serum, 2-mercaptoethanol and antibiotics) and applied to a nylon fiber column (Wako junyaku, Osaka, Japan). After 1 hour of incubation at 37 ° C in an atmosphere with 5% CO _2, T cells were eluted with a warm medium.

Human B cell lines (Raji and JY) were used as stimulating cells in a mixed lymphocyte culture reaction. These cells were irradiated with X-rays (2000R) before use.

Primary reaction of mixed lymphocyte culture (1st MLR)

Isolated human T cells (1 × 10 ⁵ cells / well) and X-ray-treated Raji cells (1 × 10 ⁵ cells / well) were placed in a 96-well flat-bottom microplate. Antibodies were added to the culture medium and the cells were incubated for 7 days. All cultures were labeled over the past 6 hours with [ ³ H] -thymidine at a rate of 10 kBq / well (Amersham Pharmacia biotech). Cells were harvested and the incorporated radioactivity was determined on a liquid scintillation counter.

The effect of TN228-IgG2m3 (ChTN228) on primary MLR is shown in FIGS. 5 and 6. The original anti-human CD28 antibodies TN228 (MuTN228) did not inhibit primary MLR, however, chimeric TN228-IgG2m3 antibodies inhibited it in a dose-dependent manner. Therefore, the conversion of the Fc region of anti-human CD28 antibodies to that with reduced affinity for human Fc R converts antibodies to antagonistic T cell proliferation.

Chimeric antibodies against human CD28, which had a reduced affinity for human Fc R, reduced the low T cell reactivity in the secondary reaction of a mixed lymphocyte culture.

Secondary reaction of mixed lymphocyte culture (2nd MLR)

Isolated human T cells (1 × 10 ⁵ cells / well) and X-ray-treated Raji cells (1 × 10 ⁵ cells / well) were placed in 96-well flat-bottom microplates. Antibodies were added to the culture medium and the cells were incubated. After 5 days, the cells were harvested, washed with fresh medium. Cells were suspended in fresh medium and cultured for 8 days. Cells were re-stimulated with X-ray treated Raji or JY cells. After another 7 days of cultivation, cells were incubated with [ ³ H] -thymidine at a rate of 10 kBq / well for 6 hours. Cells were collected and radioactivity was determined on a liquid scintillation counter.

TN228-IgG2m3 inhibited primary MLR (FIGS. 5 and 6). Applicants then examined the effect of these antibodies on secondary MLR. Antibodies were introduced into the primary MLR culture, then the antibodies were isolated from the culture supernatant. After culturing in an antibody-free medium, the cells were re-stimulated with the same stimulating cells (Raji) or a stimulator of the third group (JY). The proliferation of cells treated with TN228-IgG2m3 in primary MLR was reduced compared to untreated cells. However, both types of cells proliferated almost to the same extent with a stimulator of the third group (JY) (Fig. 7). This result indicates that antibodies against human CD28 with reduced affinity for human FcR can induce T cell activity through alo-antigenic stimulation.

Example 8. Construction of variable regions of humanized TN228

MuTN228 V region sequences were analyzed by computer simulation. Based on the search for sequence homology to the Kabat antibody sequence database (8. Johnson G. and T. T. Wu, 2000, Kabat database and its applications: 30 years after the first variability plot, Nucleic Acids Res., 28: 214-218 ), selected IC4 (Manheimmer-Lory A., JB Katz, M. Pillinger, C. Ghossein, A. Smith, B. Diamond, 1991, Molecular characteristics of antibodies bearing an anti-DNA-associated idiotype, J. Exp. Med . 174: 1639-1652) to provide a framework region for the variable regions of the heavy and light chains of humanized TN228. The humanized TN228 heavy chain variable domain had 65 residues from 85 frame region residues that were identical to those of the murine TN228 heavy chain frame region, or else the sequence identity was 76%. The humanized TN228 light chain variable domain had 56 residues from 80 framework region residues that were identical to those of murine TN228 light chain framework region, or else the sequence identity was 70%.

We used computer programs ABMOD and ENCAD (Levitt M., 1983, Molecular dynamics of native protein, I. Computer simulations of trajectories, J. Mol. Biol., 168: 595-620) to construct a molecular model of the variable domain TN228, which was used for the location of amino acids in the framework region of murine TN228, which are close enough to CDR for potential interaction with them. To construct the variable regions of the heavy and light chains of humanized TN228, murine TN228 heavy chain CDRs were inserted into the framework regions of the human heavy chain IC4, and murine TN228 light chain CDRs were inserted into the framework regions of the human IC4 light chain. In the positions of the framework region, where, according to the computer model, close contact with CDR could be assumed, amino acids from murine antibodies were replaced by amino acids of the original human framework region. For humanized TN228, this was done at residues 27, 29, 30, 48, 67, 71, and 78 of the heavy chain. No replacements were made for the light chain (i.e., direct insertion of CDRs from MuTN228 into the IC4 framework region was performed). In addition, residues of the framework region, which only in rare cases were in their positions in the database of human antibodies, were replaced by human coordinated amino acids in these positions. For humanized TN228, this was done at residues 23, 40, 73, 83, and 85 of the heavy chain and at residues 69 and 77 of the light chain. The amino acid sequences of the variable regions of the heavy and light chains of humanized TN228 are shown in FIGS. 9 and 10.

Example 9. Construction and expression of humanized TN228-IgG2M3

Ways

Upon receipt of the amino acid sequences of the humanized variable regions, as described above, genes were constructed for their coding, including signal peptides, excised donor signals, and corresponding restriction enzyme sites (Fig. 8). The heavy and light chain variable region genes were constructed and amplified using eight overlapping synthetic oligonucleotides ranging in size from about 65 to 80 bases (He XY, Z. Xu, J. Melrose, A. Mullowney, M. Vasquez, C. Queen, V Vexler, C. Klingbeil, MS Co and SL Berg, 1998, Humarnization and pharmacokinetics of a monoclonal antibody with specificity for both E- and P-selectin, J. Immunol., 160: 1029-1035). Oligonucleotides were annealed in pairs and expanded using a Klenov fragment of DNA polymerase I to obtain double-stranded fragments. The resulting fragments were denatured, annealed in pairs, and expanded using a Klenov fragment to obtain two fragments. These fragments were denatured, annealed in pairs, and further expanded to produce a full-sized gene. The resulting product was amplified by polymerase chain reaction (PCR) using Taq polymerase, gel purified, digested with XbaI, gel purified again and subcloned into the XbaI site pVg2M3 for heavy chain expression and pVk for light chain expression. The pVg2M3 vector for the expression of human heavy gamma chain 2 has been previously described (Cole MS, C. Anasetti and JY Tso, 1997, Human IgG2 variants of chimeric anti-CD3 are nonmitogenic to T cells, J. Immunol., 159: 3613-3621 ) and the pVk vector for expression of the human kappa light chain (Co MS, NMAvadalovic, PCCaron, MVAvadalovic, DAScheinberg and C. Queen, 1992, Chimeric and humanized antibodies with specificity for the CD33 antigen, J. Immunol., 148 : 1149-1154).

The sequences of the V regions and exons of the constant regions of the heavy and light chains in the final plasmids were confirmed by nucleotide sequence sequencing. The structures of the final plasmids were generally confirmed by restriction mapping. All DNA manipulations were performed using conventional methods.

In this write-off, HuTN228 refers to humanized antibodies containing the variable regions V _L and V _{H of} humanized TN228, the constant region of human IgG2M3 for the heavy chain and the constant region of the human kappa chain for the light chain. The constant region of the heavy chain has been modified (Cole MS, C. Anasetti and JY Tso, 1997, Human IgG2 variants of chimeric anti-CD3 are nonmitogenic to T cells, J. Immunol., 159: 3613-3621) from the germline human genomic fragment 2 and the light chain was obtained from the germline human genomic fragment K. The early promoter and enhancer of human cytomegalovirus regulate both the heavy and light chain genes. The heavy chain gene is controlled by a transcription terminator derived from the human complement gene C2 (Ashfield, RP Enriquez-Harris and NJ Proudfoot, 1991, Transcriptional Termination between the closely linked human complement genes C2 and factor B: common termination factor for C2 and c- myc? EMBO J., 10: 4197-4207). Selective gpt light chain marker gene (Mulligan RC and P. Berg, 1981, Selection for animal cells that express the Escherichia coli gene coding for xanthine-guanine phosphoribosyltransferase, Proc. Natl. Acad. Sci. USA, 78: 2072-2076) and the dhfr heavy chain marker marker gene (Simonsen S.C. and AD Levinson, 1983, Isolation and expression of an altered mouse dihydrofolate reductase cDNA, Proc. Natl. Acad. Sci. USA, 80: 2495-2499) are controlled early promoter SV40.

For expression of HuTN228, transfection into COS-7 cells (monkey kidney cell line) was performed using lipofectamine 2000 (catalog # 11668-027, Life Technologies). Depleted media from transient transfectants were analyzed for the production of human IgG2M3 antibodies by ELISA using specific goat antibodies against the human IgG gamma chain as capture reagent and HRP-labeled goat antibodies against human Kappa chain as a development reagent. Depleted media were also tested for the ability of HuTN228 to bind to P815 / CD28 ⁺ cells by indirect immunofluorescence staining and analyzed by flow cytometry (data not shown). To obtain a stable cell line, humanized expression plasmids were transfected into the cell line of mouse Sp2 / 0 mouse myeloma by electroporation and transfectants with gpt expression were selected. Depleted media from stable transfectants were analyzed by ELISA, as in the case of transient transfection.

results

Based on the amino acid sequence design of the humanized V region, heavy and light chain V genes were constructed (FIGS. 9 and 10), as described in the Methods section. The heavy and light chain V genes were cloned into pVg2M3 and pVk vectors, respectively, as shown in FIG. Several clones were analyzed by nucleotide sequence sequencing and the correct clones of the heavy and light chain expression vectors were used for transfection. The constant regions of the expression vectors of the heavy and light chains were also subjected to sequencing.

Example 10. Expression of HuTN228

Temporary transfection of COS-7 cells: expression vectors were temporarily transfected into the COS-7 monkey kidney cell line to produce HuTN228 antibodies. The depleted medium from transfected cells was tested by ELISA for the production of humanized gG2M3 antibodies and flow cytometry for binding to P815 / CD28 ⁺ cells (data not shown). The depleted medium gave a positive reaction in both tests. The yield of humanized antibodies as a result of transient transfection was ~ 3.7 μg / ml. HuTN228 antibodies from the transient supernatant bind to P815 / CD28 ⁺ cells depending on concentration (data not shown).

Stable transfection of Sp2 / 0 cells: humanized expression vectors were transfected into Sp2 / 0 cells to obtain a stable cell line. Depleted media from several transfectants was tested for the production of HuTN228 antibodies, as is the case with transient transfectants. One transfectant (clone 4) with higher antibody productivity was selected and propagated in serum-free medium for GIBCO hybridomas. HuTN228 antibodies were isolated from 570 ml of depleted medium by affinity chromatography. The yield of isolated antibodies was ~ 7 mg.

Example 11. Purification of protein

One of the transfectants with high expression of HuTN228 after stable transfection (clone 4) was cultured in 570 ml of serum-free medium for GIBCO hybridomas (catalog # 12045076, Life Technologies). The depleted culture supernatant was collected when cell viability reached 10% or lower, and applied to a 2 ml protein A-Sepharose column. The column was washed with PBS before eluting the antibodies with 0.1 M glycine, 0.1 M Had, pH 2.5. The eluted protein was dialyzed against 3 shifts of 2 L PBS each and then desalted on a PD-10 column equilibrated with PBS containing an additional 0.1 M NaCl. The desalted protein solution was filtered through a 0.2 μm filter before storage at 40 ° C.

Example 12. Determination of the purity of gel-HPLC and SDS-PAGE

Ways

; каталог #08541, TosoHaas, Montgomeryville, MD), соединенных последовательно. Подвижной фазой служила смесь 200 мМ фосфата калия/150 мМ хлорида калия при pH 6,9, и скорость потока равнялась 1,00 мл/минуту. Элюат с колонки контролировали спектрофотометрически при 220 нм и 280 нм. Объем введения составлял 60 мкл (60 мкг) пробы HuTN228.Gel-HPLC was performed using a Perkin Elmer HPLC system consisting of a PE ISS 200 Advanced LC Sample processor, a PE Series 410 Bio LC pump, a PE 235C diode detector, and a Nelson 600 Series LINK PE. Perkin Elmer Turbochrom Navigator, Version 4.1 software was used to control the autosampler, pump, and detector, as well as to receive, store, and process data. Separation was achieved using two TosoHaas TSK-GEL G3000SWXL gel-HPLC columns (size 7.8 mm × 300 mm, particle size 5 μm, and pore size 250

; catalog # 08541, TosoHaas, Montgomeryville, MD) connected in series. The mobile phase was a mixture of 200 mM potassium phosphate / 150 mM potassium chloride at pH 6.9, and the flow rate was 1.00 ml / min. The column eluate was monitored spectrophotometrically at 220 nm and 280 nm. The volume of administration was 60 μl (60 μg) of HuTN228 sample.

SDS-PAGE was carried out in the usual way in a gradient 4-20% gel (catalog # EC6025, Novex, San Diego, CA).

The isotype of the isolated antibodies was confirmed using the ELISA kit for determining the subclass of human IgG (catalog # 99-1000, Zymed Laboratories, South San Francisco, CA), following the manufacturer's recommendations.

results

The purity of the isolated HuTN228 antibodies was analyzed by gel-HPLC and SDS-PAGE. HuTN228 elution chromatogram not shown. According to the results of this analysis, the protein represents ~ 98% monomer and has a mobility corresponding to a protein with a molecular weight of ~ 160 kDa.

Analysis of MuTN228 control isotype MuFd79 (mouse IgG1), HuTN228 and control isotype HuEP5C7 (human IgG2M3) using non-reducing SDS-PAGE also indicated that all four antibodies had a molecular weight of about 150-160 kDa. As a result of the analysis of the same four proteins under reducing conditions, it was shown that all four antibodies included a heavy chain with a molecular weight of about 50 kDa and a light chain with a molecular weight of about 25 kDa.

The determination of the isotype indicated that the isotype of the HuTN228 antibody coincided with the putative IgG2 isotype (data not shown).

Example 13. Competitive analysis using FACS

Ways

Titration was performed using serial two-fold dilutions of MuTN228-FITC antibodies, starting at 250 ng / test. P815 / CD28 ⁺ cells (3 × 10 ⁵ cells / test) were incubated with FITC-labeled antibody for 1 hour on ice in 100 μl of FACS staining buffer (FSB = PBS, 2% FBS, 3% normal mouse serum, 0 , 1% NaN ₃ ), washed with 2 ml of FSB and analyzed by flow cytometry (data not shown).

For competitive analysis, MuTN228-FITC (50 ng / test) in 25 μl FSB was mixed with triplicate serial dilutions of competitive HuTN228 or MuTN228 antibodies (starting at 200 μg / ml) in 25 μl FSB and added to P815 / CD28 ⁺ cells (3 × 10 ⁵ cells / test) in 50 μl FSB. As a control, P815 / CD28 ⁺ cells were incubated with MuTN228-FITC alone (50 ng / test in 50 μl FSB). Antibodies of the control isotype HuEP2C7 (human IgG2M3) and MuFd79 (mouse IgG1) (200 ng / test) in 25 μl FSB were also tested as non-specific competitors. Cells were incubated with a mixture of antibodies in a final volume of 100 μl for 1 hour on ice (in the dark), then washed with 2 ml of FSB and analyzed by flow cytometry. This experiment was repeated three times.

results

The specificity of binding of MuTN228 and HuTN228 antibodies to CD28 molecules on P815 / CD28 ⁺ cells was compared in a competitive analysis using flow cytometry, as described in the Methods section. Typical data are presented in FIG. Both MuTN228 and HuTN228 competed with MuTN228-FITC depending on the concentration, which indicates that the binding of both antibodies is specific for the CD28 antigen. The relative binding of HuTN228 was several times lower compared to MuTN228. Antibodies of the control isotype MuFd79 and HuEP5C7 did not compete with MuTN228-FITC, which indicates that the antibodies MuTN228 and HuTN228 recognize the CD28 antigen through specific V-region interactions.

Example 14. Competitive analysis using ELISA

Ways

A 96-well ELISA plate (Nunc-Iimiuno plate, catalog # 439454, NalgeNunc, Naperville, IL) was coated with sCD28-Fc at 100 μl / well (0.5 ng / ml in PBS) (sCD28-Fc means fusion protein in which the extracellular domains of CD28 were combined with the domains of CH2 and CH3 IgGI) overnight at 4 ° C. The plate was blocked for 30 minutes with 300 μl / well Superblock blocking buffer in the fuel assembly (catalog # 37535, Pierce, Rockford, IL) and washed with 300 μl / well ELISA wash buffer (EWB = PBS, 0.1% Tween -20). In three parallels, a MuTN228-biotin mixture (0.5 μg / ml) was added to 100 μl ELISA buffer (EB = PBS, 1% BSA, 0.1% Tween-20) and three-fold serial dilutions of competitive HuTN228 or MuTN228 antibodies (starting with 100 μg / ml) in 100 μl EB in a final volume of 200 μl / well. Antibodies of the control isotype HuEP5C7 and MuFd79 (100 μg / ml) in 100 μl EB were also tested as non-specific competitors. As a “non-competitive” control, 100 μl of EB was added to 100 μl of MuTN228-biotin (0.5 μg / ml). As a control sample, 200 μl of EB was added to the remaining wells (not containing MuTN228-biotin). The plate was incubated at room temperature for 1.5 hours with shaking. After washing the wells 4 times with EWB at a rate of 300 μl / well, 100 μl / well of streptavidin-HRP (1 μg / ml, catalog # 21124, Pierce) was added to all wells. The plate was incubated at room temperature for 1 hour with shaking. After washing the wells, as described above, 100 μl / well ABTS substrate was added to all wells (catalog # 507602 and 506502, KPL, Gaithersburg, MD). The plate was incubated at room temperature for 5-7 minutes and the absorbance was determined at 415 nm. The experiment was repeated three times.

results

The specificity of the binding of HuTN228 and MuTN228 antibodies to SCD28-Fc was compared in a competitive analysis using ELISA, as described in the Methods section. Typical data are presented in FIG. Both MuTN228 and HuTN228 competed with MuTN228-biotin depending on concentration. Antibodies of the control isotype MuFd79 and HuEP5C7 did not compete with MuTN228-biotin, which indicates that the antibodies MuTN228 and HuTN228 recognize the CD28 antigen through V-region interactions. The IC ₅₀ values for MuTN228 and HuTN228 for all three experiments are presented in Table 2. The relative binding of HuTN228 was on average 2.6 times lower compared to MuTN228.

TABLE 2
Summary Competition Analysis Data Using ELISA IC ₅₀ (μg / ml) Competitor Experience 1 Experience 2 Experience 3 Average Standard deviation MuTN228 0.21 0.20 0.15 0.19 0,03 HuTN228 0.37 0.64 0.48 0.50 0.14

Example 15. Competitive analysis using ¹²⁵ T-labeled antibodies

Ways

The relative binding affinity of the antibodies MuTN228 and HuTN228 was determined by the method of Queen et al. (Quenn C., WPSchneider, HESelick, PW Payne, NF Landolfi, JF Duncan, NMAvdalovic, M. Levitt, RP Junghans, TAWaldmann, 1989, A humanized antibody that binds to the interleukin 2 receptor, Proc. Natl. Acad. Sci., 86: 10029 -10033). Briefly, ~ 10 ng of ¹²⁵ I-labeled MuTN228 in 50 μl of binding buffer (BB = PBS, 2% FBS, 1 μg / ml mouse IgG, 0.1% NaN ₃ ) was mixed in triplicate with triplicate serial dilutions of competitive MuTN228 antibodies or HuTN228 (starting at 400 μg / ml) in 50 μl of explosives, was added to 100 μl of P815 / CD28 ⁺ cells (2.5 × 10 ⁵ cells / test) in incubation tubes (Skatron Macrowell Tube Strips, catalog # 15773, Molecular Devices, Sunnyvale, CA) and incubated for 90 minutes at 4 ° C with gentle shaking. Antibodies of the control isotype HuEP5C7 and MuFd79 (400 μg / ml) in 50 μl of explosives were also tested as non-specific competitors. After incubation, the antibody-cell mixture was transferred to centrifuge tubes (Sarstedt Micro Tubes, catalog # 72.702, Sarstedt, Newton, NC) containing 0.1 ml of a mixture of 80% dibutyl phthalate -20% olive oil, the incubation tubes were washed once with 50 μl BB , and bound and free radioactivity were separated by centrifugation as described (Kuziel WA, SJ Morgan, TC Dawson, S. Griffin, 0. Smithies, K. Ley, N. Maeda, 1997, Severe reduction in leukocyte adhesion and monocyte extravasation in mice deficient in CC chemokine receptor 2, Proc. Natl. Acad. Sci., 94: 12053-12058). This experiment was repeated three times.

results

The relative binding affinities of the MuTN228 and HuTN228 antibodies were compared in a competitive assay using ¹²⁵ I-labeled antibodies, as described in the Methods section. Typical data are presented in FIG. 13. Both MuTN228 and HuTN228 competed with ¹²⁵ I-labeled MuTN228 depending on concentration. The MuFd79 control isotype antibody showed weak but reproducible competition at high concentrations, but the HuEP5C7 control isotype antibodies did not compete with ¹²⁵ I-labeled MuTN228, indicating that HuTN228 antibodies recognize the CD28 antigen through specific V-region interactions. The IC ₅₀ values of MuTN228 and HuTN228 for all three experiments are presented in Table 3. The apparent binding affinity of HuTN228 was about 2.4 times lower compared to MuTN228 antibodies.

TABLE 3
Summary Competitive Analysis Data Using I-125 IC ₅₀ (nM) Competitor Experience 1 Experience 2 Experience 3 Average Standard deviation MuTN228 0.93 1.05 1,02 1.00 0.06 HuTN228 2.65 2.43 2.13 2.40 0.26

Example 16. Sequencing of the amino acid sequence of the antibodies of the hamster against mouse CD28

Ways

Hybridoma and antibodies. A hybridoma producing antibodies of the Armenian hamster against mouse CD28 PV1 was obtained from ATCC (ATCC HB-12352). Purified PV1, R-phycoerythrin (R-PE) -labeled PV1 was obtained from Southern Biotechnology (Birmingham, AL). Golden hamster antibodies against CD28 37.51 were obtained from PharMingen (San Diego, CA). Secondary antibodies donkey fluorescein (FITC) -labeled against Armenian hamster IgG (H + L), donkey FITC-labeled against Golden Hamster IgG (H + L), donkey FITC-labeled against mouse IgG (H + L), donkey R-PE Anti-mouse IgG-F (ab ') ₂ (H + L) was obtained from Jackson ImmunoResearch (West Grove, PA) and goat FITC-labeled anti-mouse kappa chains, goat R-PE-labeled anti-mouse IgG3 and horseradish peroxidase ( HRP) goats vs. mouse kappa chains were obtained from Southerm Biotechnology. Goat antibodies) against mouse IgG3 and mouse control IgG3 isotype FLOPC22 were obtained from Sigma Chemicals (St. Louis, MO). Antibodies of the Armenian hamster against mouse CD3 145.2C11 and its hamster / mouse chimeric variant 145.2C11-IgG3 were obtained in the applicants laboratory. FITC-labeled 145.2C11 was obtained from Boehringer Mannheim (Indianapolis, IN).

Cloning of cDNA variable region. The cDNA of the V region of the light and heavy chains of PV1 was cloned from hybridoma cells by an anchor polymerase chain reaction (PCR) according to the method described by Co et al. (Co MS, NM Avadalovic, P. C. Caron, MV Avadalovic, DA Scheinberg and C. Queen, 1992, J. Inununol., 148: 1149-1154). Amplification was performed with cDNA using 3'-primers that hybridized respectively to the C-regions of the hamster kappa and gamma chains, and 5'-primers that hybridized with the added G-tail of cDNA. For the V _L PCR 3'-primer had the sequence 5 'TATAGAGCTCCACTTCCAGTGCCC (SEQ ID NO: 20) with residues 11-24, hybridized with the hamster C _K -domain. For V _H PCR, the 3'-primers had degenerate sequences (SEQ ID NO: 17, 18 and 19):

with residues 19-50 hybridized with the gene most characteristic of rodents C _H 1 IgG. Non-hybridized sequences in two groups of primers included restriction sites used for cloning. V _L and V _H cDNA were subcloned into pUC19 vector for sequence determination. To avoid errors during PCR, five independent clones of each cDNA were sequenced and only clones were selected with a sequence consistent with the consensus sequence for the expression of chimeric PV1.

results

Cloning of cDNA of the V region of PV1. The cDNA of the V region of the light and heavy chains of PV1 was cloned from hybridoma cells, as described in the "Methods" section. For V _L PCR, only the 3 ′ primer corresponding to the C _{γ region of the} hamster can produce the V _L cDNA product from PV1. On the other hand, the 3′-primer from the C _{γ region of the} hamster did not produce any PCR product. These results indicate that the hybridoma producing PV1 uses a kappa chain for their light chain. Sequenced several clones of the light and heavy chains and found that they contain, respectively, the same V _L and V _H. Limited C _H 1 and C _γ sequence data indicated that the cloned heavy and light chains are not mouse in nature.

Example 17. Construction and expression of chimeric PVl-IgG3

Ways

The V _L and V _H PV1 genes were obtained by PCR in mini-eekon segments flanked with Xbal sites as described (Not XY, Z. Xu, J. Melrose, A. Mullowney, M. Vasquez, C. Queen, V. Vexler, C. Klingbeil, MS Co and EL Berg, 1998, J. Immunol., 160: 1029-1035), and they were individually introduced into plasmids expressing light and heavy chains (Fig. 14). Each mini-exon included a signal peptide sequence, a mature variable region sequence, and a 5'-cut donor sequence derived from the gene of the most homologous mouse J chain. A similar excised donor is used to splicing an exon of a V region gene with a constant region gene of murine antibodies. Each miniexon was again sequenced after it was cloned in an expression vector to ensure that the correct splicing signal was turned on and there were no errors in PCR.

A vector was constructed to express the heavy and light chain genes of the chimeric FV1-IgG3 from a single plasmid. As used herein, PV1-IgG3 refers to chimeric antibodies comprising the variable regions V _L and V _{H of the} PV1 hamster, the constant region of murine IgG3 for the heavy chain, and the constant region of the mouse Kappa chain for the light chain. The expression vector pV1.g3.rg.dE (Fig. 14) was obtained by two-stage cloning similar to that described by Cole et al. (Cole MS, C. Anasetti and JY Tso, 1997, J. Immunol. 159: 3613-3621). The constant region of the heavy chain was obtained from the murine genomic fragment of γ3 and the light chain from the κ fragment. Both heavy and light chain genes are controlled by the early promoter and enhancer of human cytomegalovirus and are separated by a transcription terminator derived from the human complement gene C2 (Ashfield R., P. Enriquez-Harris and NJ Proudfoot, 1991, EMBO J., 10: 4197-4207). The selectable gene marker gpt (Mulligan RC and P. Berg, 1981, Proc. Natl. Acad. Sci. USA, 78: 2072-2076) is regulated by a modified early promoter SV40. To express the chimeric PV1-IgG3, a single plasmid vector was transfected into the NS0 mouse myeloma cell line, and transfectants were selected by gpt expression. Depleted media from transfectants was analyzed for the production of murine IgG3 antibodies by ELISA using a goat anti-mouse IgG3 antibody as a capture reagent and HPR-labeled goat anti-mouse Kappa chain antibodies as a developer. The test is specific for murine IgG3, other murine IgG isotypes give a negative reaction in this analysis.

results

Expression of the chimeric PV1-IgG3. The cloned V _L and V _H genes were converted into mini-exons (Fig. 15B) and included in an expression vector as described in the Materials and Methods section and in Fig. 15B. The expression vector was then transfected into the NS0 mouse myeloma cell line to produce chimeric PV1-IgG3. Depleted media from several transfectants were analyzed by ELISA for the production of murine IgG3 antibodies and FACS for binding to EL4 cells. Most transfectants gave a positive reaction in both tests. One transfectant with high antibody productivity was selected and propagated in 1 L of serum-free medium. PV1-IgG3 was isolated from 1 L of depleted medium by affinity chromatography. The yield was> 10 mg / L.

Example 18. Characterization of isolated chimeric PV1-IgG3 using HPLC and SDS-PAGE

Ways

Protein purification. One of the transfectants with high IgG3 expression (clone # 1) was cultured in 1 L of serum-free medium for Gibco hybridomas. The depleted culture supernatant was collected when the cell viability reached 30% or lower, concentrated to 200 ml and applied to a 5 ml protein A-Sepharose column using a Pharmacia P1 pump (2-3 ml / min). Then the column was washed with PBS containing an additional 0.1 M NaCl (final concentration of NaCl was 0.25 M) before elution of antibodies with 3.5 M MgCl ₂ . Then, the eluted protein was desalted on a PD10 column equilibrated with PBS containing an additional 0.1 M NaCl. The desalted protein solution was filtered through a 0.2 μm filter before storage at 4 ° C. Like all mouse IgG3, PV1-IgG3 at a high concentration (> 1 mg / ml) precipitates in the cold, but again passes into solution when heated at 37 ° C. The antibody remains in solution at room temperature. Apparently, multiple cold deposition cycles do not affect the activity of antibodies to bind to the antigen.

), соединенных последовательно. Подвижной фазой служила смесь 200 мМ фосфата калия/150 мК хлорида калия при рН 6,9, и скорость потока равнялась 1,00 мл/минуту. Элюат с колонки контролировали спектрофотометрически при 220 нм и 280 нм. Объем введения составлял 50 мкл (63,5 мкг) неразбавленной пробы PV1-IgG3. SDS-PAGE проводили обычным способом.Determination of purity by gel-HPLC and SDS-PAGE. Gel-HPLC was performed using a Perkin Elmer HPLC system consisting of a PE ISS 200 Advanced LC Sample processor, a PE Series 410 Bio LC pump, a PE 235C disk detector, and a Nelson 600 Series LINK PE. Perkin Elmer Turbochrom software was used to control the autosampler, pump, and detector. Navigator, Version 4.1, as well as for receiving, storing and processing data. Separation was achieved using two TosoHaas TSK-GEL G3000SWXL gel-HPLC columns (TosoHaas catalog # 08541, 7.8 mm × 300 mm in size, -5 μm particle size and 250 pore size

) connected in series. The mobile phase was a mixture of 200 mM potassium phosphate / 150 mK potassium chloride at pH 6.9, and the flow rate was 1.00 ml / min. The column eluate was monitored spectrophotometrically at 220 nm and 280 nm. The volume of administration was 50 μl (63.5 μg) of undiluted PV1-IgG3 sample. SDS-PAGE was performed in the usual manner.

results

The purity of the isolated PV1-IgG3 was analyzed by gel-HPLC and SDS-PAGE. An HPLC chromatogram of PV1-IgG3 is shown in FIG. 16. According to the results of this analysis, the protein is 99% monomer and has a mobility corresponding to a molecular weight of 150 kDa. Analysis of PV1, PVl-IgG3 and a control isotype using SDS-PAGE under non-reducing conditions also indicated that all three antibodies had a molecular weight of about 150 kDa (Fig. 17A). The small bands visible in FIG. 17A were artifacts by boiling samples in SDS without recovery. They reflect broken disulfide bonds between chains in antibodies. However, as a result of the analysis of the same three proteins under reducing conditions (Fig. 17B), it was shown that PV1, but not PV1-IgG3 or the control isotype, had a heavy chain with a molecular weight slightly above 50 kDa, a molecular weight usually characteristic of IgG. Thus, PV1 hamster antibodies undergo glycosylation of the heavy chain at position Asn ₂₉₇ in C _H 3, or they have an additional glycosylation site at other positions of the heavy chain. As discussed above, this unusual glycosylation pattern can lead to nonspecific binding of PV1 to EL4 cells, possibly as a result of lectin / hydrocarbon interactions.

Example 19

Ways

Flow cytometry. Murine T cell line EL4 cells (2.5 × 10 ⁵ cells / 0.2 ml) were stained with 1 μg / ml PV1, 37.51 or PVl-IgG3 at 4 ° C for 30 minutes, washed with 2 ml of chilled PBS and stained with 20 μl of specific fluorochrome-labeled secondary antibodies (10 μg / ml). After 20 minutes of incubation at 4 ° C in the dark, the cells were washed with PBS and analyzed for FACS (Becton Dickenson, Milpitas, CA).

In a competitive assay, EL4 cells (2.5 × 10 ⁵ cells / 0.2 ml) were stained with 1 μg / ml R-PE-PV1 and 25 μg / ml PV1, PVl-IgG3 or control IgG3 isotype at 4 ° C for 30 minutes in the dark, washed with PBS and analyzed for FACS. A similar competitive analysis was performed using various 145.2C11 variants. In a reverse competitive analysis, EL4 cells (2.5 × 10 ⁵ cells / 0.2 ml) were stained with 1 μg / ml PV1-IgG3 and 25 μg / ml PV1 at 4 ° C for 30 minutes, washed 2 times with PBS, stained with FITC -labelled donkeys against mouse IgG3 (H + L) were washed and assayed for FACS. To control non-specific binding of secondary antibodies to PV1, EL4 cells were stained with excess PV1 without PV1-IgG3 and analyzed.

To stain mouse T cells, BALB / c mouse splenocytes (2.5 × 10 ⁵ cells / 0.2 ml) were stained with 1 μg / ml mouse control isotype IgG3 (FLOPC21) or PV1-IgG3 at 4 ° C for 30 minutes, washed with 2 ml of chilled PBS and stained with 20 μl of FITC-labeled 145.2C11 (10 μg / ml) and 20 μl of R-PE-labeled goat against mouse IgG3 (10 μg / ml). After 20 minutes of incubation at 4 ° C in the dark, the cells were washed with PBS and analyzed for FACS.

results

Characterization of PV1 and PVl-IgG3 by flow cytometry. PV1 was used to stain the CD28-positive EL4 T cell line and analyzed for FACS. The staining pattern indicated that PV1 binds to EL4 cells at two different sites (FIG. 17A). In addition, PV1, as well as several antibodies of the Armenian hamster against mouse T cells (145.2C11, anti-CD3; H57-597, anti-TCR and UC10-4F10-11, anti-CTLA4) also bind non-specifically to the line of CD28-negative NS0 myeloma cells (data not shown). On the other hand, anti-CD28 37.51 golden hamster antibodies bind specifically to only one EL4 cell site (FIG. 17B). It turned out that in addition to binding to CD28, PV1 also binds nonspecifically to other sites, possibly due to a hydrocarbon / pectin interaction. As shown in FIG. 17C, chimeric PV1-IgG3 do not exhibit similar non-specific binding activity. Antibodies bind to EL4 cells similarly to 37.51, and they do not bind to CD28-negative NSO cells (data not shown). Thus, the ability of PV1 to nonspecific binding refers to the constant region of the heavy chain of these specific antibodies, and it is eliminated by chimerization.

To demonstrate that PV1-IgG3 has CD28-specific binding activity, applicants used competitive analysis using FACS. In these experiments, R-PE-labeled PV1 was mixed with an excess (25-fold) of unlabeled PV1, PV1-IgG3 or mouse control IgG3, and the mixture was used to stain EL4 cells. As shown in FIG. 18A, both PV1 and PV1-IgG3, but not a control isotype, prevented the binding of R-PE-labeled PV1 to EL4 cells. Inhibition by PV1-IgG3 was less pronounced than PV1, and the applicants attributed these data to the fact that PV1-IgG3 compete with R-PE-labeled PV1 for CD28 sites, but not for non-specific sites. Similarly, 145.2C11 (Armenian hamster against mouse CD3) and chimeric 145.2C11-IgG3 prevented the binding of R-PE-labeled 145.2C11 to EL4 cells (Fig. 18B), but chimeric antibodies were less effective due to their inability to eliminate non-specific R- binding PE-145.2C11 with cells.

Applicants have also performed reverse competitive analysis using excess (25-fold) PV1 to compete with PV1-IgG3 for binding to EL4 cells. Although PV1-IgG3 was not labeled in this case, it was specifically recognized by donkey FITC-labeled anti-mouse antibodies. The data in FIG. 18C show that inhibition of PV1-IgG3 binding to EL4 cells by an excess of PV1 was almost complete, indicating that PV1 and PV1-IgG3 bind to the same epitope.

Finally, PV1-IgG3 was used to stain mouse splenocytes. PV1-IgG3 coated splenocytes were specifically recognized by secondary R-PE-labeled goat anti-mouse IgG3 antibodies. At the same time, FITC-labeled 145.2C11 was also added to splenocytes to label CD3-positive cells. With bicolor flow cytometry, PV1-IgG3 specifically stained CD3-positive cells, but not CD3-negative cells (Fig. 19B). On the other hand, the mouse control IgG3 isotype did not stain CD3 positive cells (Fig. 19A). Thus, chimeric PV1-IgG3 recognized the antigen that was expressed in murine T cells, antigen-binding activity, which coincides with anti-CD28 antibodies.

Example 20. The induction of arthritis caused by collagen

Ways

Mice were immunized intradermally at the base of the tail with 125 μg bovine CII (Collagen Gijutsu Kenkyukai, Japan) emulsified with an equal volume of CFA (Wako, Japan). Mice underwent booster immunization by intradermal administration of 125 μg bovine CII in CFA on day 21. Mice were treated with anti-CD28 antibodies (PV1-IgG3) at a dose of 1 mg / kg / day by continuous infusion using an osmotic pump for 7 days after the initial immunization. Arthritis development was observed by examining four paws on the 11th day after the second immunization, and inflammation of the four paws was scored from 0 to 3, as described previously (Tada Y., A. Ho, D.-R. Koh, TW Mak, 1996 , J. Immunol., 156: 4520; Tada Y., A. Ho, T. Matsuyama, TW Mak, 1997, J. Exp. Med., 185: 231). The condition of each paw was evaluated in points and the number of points on four paws was summed so that the maximum number of points per mouse was 12. Arthritis was calculated by dividing the total number of points for the experimental mouse by the total number of mice.

results

Mice were immunized with bovine CII and the development of arthritis was observed. On the 11th day after the second immunization, arthritis decreased significantly in mice treated with anti-CD28 antibodies (0.63 ± 0.50) (P <0.01) relative to the control (7.50 ± 0.66) .

Example 21

Ways

Mice animals

BALB / c and C3H female mice were obtained from Charles River Japan, Inc. (Yokohama, Japan). Animals were placed in special, pathogen-free devices in micro-insulated cages with filtered air and free access to feed and water. At the beginning of the experiment, all mice were 6-8 weeks old.

Antibodies

Silent antibodies against mouse CD28 (PV1-IgG3) had the same specificity as that of clone PV1, but did not have high in vitro agonistic activity (Fc → IgG3). Antibodies against mouse CD154 (TRAP1, IgGI) were obtained from 3D PharMingen (San Diego, CA). CTLA4-Ig (CTLA-4 / Fc Chimera) was obtained from Genzyme (Cambridge, MA).

Tail skin transplantation

Full thickness grafts (0.5 cm ² ) from the tail of the donor mouse (BALB / c: H-2d) were transplanted onto the dorsal region of the chest of the recipient mouse (C3H: H-2b) and fixed using a bandage for 7 days. Then, the graft survival was examined visually daily. Rejection was defined as> 80% loss of living epidermal transplanted tissue. Statistical processing was performed using the Dunnett multiple comparison test. P values <0.05 were considered statistically significant.

Treatment

Skin transplant recipients were treated with 10, 50, 250 μg silent against mouse CD28, 250 μg against mouse CD154 and 100 μg CTLA4-Ig, which were administered intraperitoneally on the day of transplantation (day 0) and after surgery on the 3rd and 6th day.

results

The simultaneous blockade of T-cell costimulatory pathways involving CD40 and CD28 by the introduction of silent against mouse CD28 and against mouse CD154 effectively contributed to the survival of the skin allograft in C3H mice. In control mice, transplant rejection occurred on the 9th day. Anti-CD40L mAb only slightly extended the allograft survival period (MST 10 days), but survival rate was significantly improved when combined with CD28, prolonging the average survival time (MST) to 33 days. This strategy was significantly less effective with CTLA4-Ig and against mouse CD40L mAb with an MST value of 12 days.

Example 22. Obtaining Fab and F (ab ') ₂ fragments of anti-CD28 antibodies

Obtaining a Fab fragment of anti-CP28 antibodies

Antibodies against human CD28 (HuTN228) were digested with immobilized ficin (Pierce, USA). Immobilized ficin was activated with 50 mM Tris-HCl buffer, pH 6.8, containing 5 mM EDTA and 11.5 cysteine · HCl, and filled with a column. The antibody solution was applied to the column and incubated at 37 ° C for 2-3 days. The column was washed with PBS and the digested material was concentrated by ultrafiltration. Concentrated cleaved material was applied to a gel filtration column (TSKgel-3000SW × 1, Tosoh, Japan), the appropriate fractions were collected and concentrated by ultrafiltration. The protein concentration was determined by absorbance at 280 nm (absorbance 280 = 1.4 for 1 mg / ml), and the fragment size was confirmed by SDS-PAGE. Obtaining F (ab ') ₂ fragment of anti-CD28 antibodies

The F (ab ') ₂ fragment of anti-human CD28 antibodies was obtained in the same manner as the Fab fragment, except for the cysteine concentration used (1/15 mM) and the incubation period (overnight).

It is understood that in light of the above teachings, numerous modifications and variations of the present invention are possible. Therefore, it must be understood that, within the scope of the appended claims, the practice of the invention may be different than specifically described here.

All applications, patent applications, patents and other documents mentioned above are included in the description in full.

Claims (25)

1. Silent anti-CD28 antibody, defective in mitogenic activity. 2. The antibody according to claim 1, which is a chimeric antibody. 3. The antibody according to claim 1, which is a humanized antibody. 4. The antibody according to claim 1, which contains a variable region containing the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4. 5. The antibody according to claim 1, which contains a variable region containing the amino acid sequence of SEQ ID NO: 2 and SEQ ID NO: 4. 6. The antibody according to claim 1, which contains a variable region containing the amino acid sequence of SEQ ID NO: 7 or SEQ ID NO: 9. 7. The antibody according to claim 1, which contains a variable region containing the amino acid sequence of SEQ ID NO: 7 and SEQ ID NO: 9. 8. The polynucleotide encoding the antibody according to claim 1. 9. The polynucleotide of claim 8, which contains at least one polynucleotide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 6 and SEQ ID NO: 8. 10. An expression vector containing the polynucleotide of claim 8. 11. A method of obtaining a host cell containing the polynucleotide of claim 8, comprising introducing the polynucleotide of claim 8 into the host cell. 12. A method of obtaining a host cell containing the expression vector of claim 10, comprising introducing the expression vector of claim 10 into the host cell. 13. A method for producing a silent anti-CD28 antibody, comprising culturing a host cell obtained in accordance with the method of claim 11, under conditions suitable for expression of the antibody, and isolating the expressed antibody from the culture. 14. A method for producing a silent anti-CD28 antibody, comprising culturing a host cell obtained in accordance with the method of claim 12 under conditions suitable for expression of the antibody, and isolating the expressed antibody from said culture. 15. A method of obtaining a silent anti-CD28 antibody, comprising administering the polynucleotide of claim 8 into a host cell; culturing the host cell under conditions suitable for expression of the antibody; and the selection of the expressed antibodies from the specified culture. 16. The method of claim 15, wherein said polynucleotide comprises at least one polynucleotide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 6, and SEQ ID NO: 8. 17. A method of obtaining a silent anti-CD28 antibody, comprising introducing an expression vector of claim 10 into a host cell; culturing the host cell under conditions suitable for expression of the antibody; and the selection of the expressed antibodies from the specified culture. 18. A pharmaceutical composition comprising the silent anti-CD28 antibody of claim 1 and a pharmaceutically acceptable ingredient. 19. A method for inducing T-cell tolerance in a patient, comprising administering an effective amount of an antibody according to claim 1 for inducing T-cell tolerance in said patient. 20. The method of claim 19, wherein said administration further comprises administering another immunosuppressant. 21. A method for conducting immunosuppression in a patient, comprising administering an effective amount of an antibody according to claim 1 for conducting immunosuppression in said patient. 22. The method of claim 21, wherein said administration further comprises administering another immunosuppressant. 23. A method for treating organ or tissue transplant rejection in a patient, comprising administering an effective amount of an antibody of claim 1 for treating organ or tissue transplant rejection in a patient. 24. The method of claim 23, wherein said administration further comprises administering another immunosuppressant. 25. NiT antibody No. 228, defective in mitogenic activity.

Images