RU2252256C2 - Rad3 polypeptide atr homologues, polynucleutides and related methods and materials - Google Patents

Abstract

FIELD: genetic engineering, in particular genes for cell cycle controlling point.

SUBSTANCE: polynucleotide encoding rad3 polypeptide ATR homologue is cloned into expression vector, having functionality in eucariotic cells. Polypeptide of rad3 polypeptide ATR homologue is obtained by cultivation of eucariotic cell culture, transformed by vector. Monoclonal antibody to rad3 polypeptide ATR homologue is obtained by hybridoma technologies. Polyclonal antibodies are obtained by inoculation of rad3 polypeptide ATR homologue in host animal. Polynucleotide presence in animal tissue sample is detected by contacting of this sample containing DNA or RNA with polynucleotide encoding rad3 polypeptide ATR homologue under hybridization conditions. Polypeptide in biological sample is detected by sample contact with monoclonal or polyclonal antibodies. Substances having anticancer activity are screened on the base of reduced activity of ATR polypeptide on substrate or reduced chelating of ATR homologue in presence of candidate substance. Present invention makes it possible to produce human or S.pombe rad3 polypeptide ATR homologue and is useful in investigation ATR role as gene for cell cycle controlling point in cell culture in vivo or in vitro.

EFFECT: new anticancer substances.

24 cl, 1 dwg

Description

The present invention relates to a class of control point genes that control progress throughout the cell cycle in eukaryotic cells.

BACKGROUND OF THE INVENTION

Cell cycle control is fundamental to the growth and maintenance of eukaryotic organisms, from yeast to mammals. Eukaryotic cells have developed control pathways called “checkpoints” that ensure that individual stages of the cell cycle are completed before the next stage occurs. In response to DNA damage, cell survival increases both due to the direct mechanisms of DNA repair, and due to a slowdown in the progress of the cell cycle in eukaryotic cells. Depending on the position of the cell within the cycle during irradiation, DNA damage in mammalian cells may interfere with (a) the transition from GI to S phase, (b) the progress during S phase, or (c) the transition from G2 to mitosis. It is suggested that such control points should prevent destructive events such as replication of damaged DNA and segregation of fragmented chromosomes during mitosis (Hartwell and Kastan, 1994).

The Schizosaccharomyces pombe Rad3 gene is required for control points that are responsible for DNA damage and block replication. Rad3 is a member of the lipid kinase subclass of kinases, which has regions having a sequence homologous to the lipid kinase domain p110 of the phosphatidylinositol-3 kinase subunit (PI-3). This subclass also includes ATM protein damaged in patients with ataxia-telangiectasia. Cells from patients with ataxia telangiectasia (AT cells) lose their S phase retardation after irradiation and appear to exhibit radio resistance in DNA synthesis (Painter and Young, 1989). AT cells irradiated in S phase accumulate in G2 with lethal damage, probably as a result of the desire to replicate damaged DNA. AT cells irradiated during G2 exhibit a different phenotype: they do not stop mitosis after DNA damage and develop during mitosis with damaged DNA (Beamish and Lavin, 1994). Mutations at the locus to which the ATM gene is mapped thus destroys several control points that are required for an appropriate response to ionizing radiation. These elements of the lipid kinase subclass include:

Tellp (Greenwell et al., 1985), a gene involved in maintaining its own telomere length in Saccharomyces cerevisiae: Esrip: Meclp and the product Drozophila melanogaster mei-41 control point gene (Hari et al., 1995).

Disclosure of invention

We analyzed the S. pombe rad3 gene and found that it has an amino acid sequence of 2386 full-length amino acids, but not of the 1070 amino acids described by Seaton et al., 1992. It is determined that it is a direct homologue of S. cerevisiae Esrip, and that it has the same general structure as the ATM gene. The C-terminal region of the rad3 protein contains the lipid kinase domain, which is required for the function of Rad3. Rad3 has been shown to be capable of self-association. We also determined the protein kinase activity associated with Rad3.

In addition, we found a human homologue to rad3. This gene, which we called ATR (ataxia and rad akin to "ataxia and rad"), exhibits a significantly higher homology to rad3 than it does to the ATM gene.

The human ATR cDNA sequence is presented in Seq.ID No.1. The amino acid sequence of ORFs from nucleotides 80 and 80II is presented in Seq.ID. No.2.

The DNA of the open reading frame (ORF) rad3 is shown as Seq.ID No.3. 2386 amino acid translation of the gene (nucleotides 585-7742 Seq.ID No. 3.) Is shown as Seq.ID No. 4.

Accordingly, in a first aspect, the invention is an ATR protein of Seq.ID No.2 and its homologues, its polypeptide fragments, as well as antibodies capable of binding the ATR protein or its polypeptide fragments. ATR proteins, homologues and fragments thereof are discussed below as polypeptides of the invention.

In another aspect, the present invention is a polynucleotide in substantially isolated form capable of hybridizing selectively with Seq.ID No.1 or with its complement (i.e., the opposite chain). Polynucleotides encoding the polypeptides of the invention are also provided. Such polynucleotides will be considered as the polynucleotide of the invention. Polynucleotides of the invention include Seq.ID Nos 1 DNA and fragments thereof capable of selectively hybridizing with this gene.

In a further aspect, the invention is recombinant vectors carrying a polynucleotide of the invention, including expression vectors, and methods for growing such vectors in a suitable host cell, for example, under conditions under which expression of a protein or polypeptide encoded by the sequence of the invention occurs.

In an additional aspect, the invention provides kits comprising the polynucleotides, polypeptides or antibodies of the invention, and methods for using such kits in the diagnosis of the presence or absence of ATR and its homologues, or variants thereof, including harmful ATR mutants.

The invention also provides assay methods for screening candidate substances for use as compounds for inhibiting or activating ATR activity, or activity of mutated forms of ATR that are deficient in the activity of a control point. The invention also provides assay methods for screening candidate substances for use as compounds for inhibiting interactions between ATRs and other compounds that interact with ATRs, including ATR itself.

In a related aspect, the invention is the polynucleotide sequence of Seq.ID No.3 in substantially isolated form, and the Seq.ID No.4 protein in substantially isolated form, and new variants and fragments thereof.

DETAILED DESCRIPTION OF THE INVENTION

A. Polynucleotides

Polynucleotides of the invention may include DNA or RNA. They can also be polynucleotides that incorporate synthetic or modified nucleotides. A number of different types of modifications to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones, optionally acridine or polylysine chains at the 3 ’and / or 5’ ends of the molecule. For the purposes of the present invention, it should be understood that the Polynucleotides described herein may be modified by any method that is available in the art. Such modifications may be made in order to increase the in vivo activity or lifespan of the polynucleotides of the invention.

Polynucleotides of the invention capable of selectively hybridizing with Seq.ID No.1 DNA will comprise at least 70%, preferably at least 80 or 90%, and more preferably at least 95% homologous to the corresponding DNA Seq.ID No.1 within the region of at least 20, preferably at least 25 or 30, for example at least 40, 60 or 100 or more, adjacent nucleotides.

It should be understood that those skilled in the art can, using known techniques, make nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides of the invention to reflect the use of the codon of any particular host organism in which the polypeptides of the invention are to be expressed.

Any combination of the aforementioned degrees of homology and minimum sizes can be used to determine the polynucleotides of the invention, with more stringent combinations (i.e., higher homology within longer lengths) that are preferred. Thus, for example, a polynucleotide that is at least 80% homologous to within 25 nucleotides, preferably 30 nucleotides, represents one aspect of the invention, as well as a polynucleotide that is 95% homologous to within 40 nucleotides.

The polynucleotides of the invention can be used to produce a primer, for example, a PCR primer, a primer for an alternative amplification reaction, a sample, for example, labeled with a tag detected by standard means using radioactive or non-radioactive tags, or polynucleotides can be cloned in the vectors. Such primers, probes, and other fragments will represent at least 15, preferably at least 20, for example at least 25, 30, or 40 nucleotides in length, and are also encompassed by the named nucleotides of the invention, as used herein .

Polynucleotides, such as DNA polynucleotides and primers according to the invention, can be produced recombinantly, synthetically, or by any other means available to specialists in this field. They can also be cloned by standard techniques.

Basically, primers can be produced synthetically, including the stepwise production of one nucleotide of the desired nucleic acid sequence at a time. Techniques for performing this method using automated methods are readily available in the art.

Longer polynucleotides will be mainly produced using recombinant methods, for example, using PCR (polymerase chain reaction) cloning methods. The cloning method will include the manufacture of a pair of primers (e.g., about 15-30 nucleotides) with an ATR region of the gene that is desirable for cloning, bringing the primers into contact with mRNA or cDNA derived from a human cell (e.g., cell division such as a peripheral white blood cell) blood), performing a polymerase chain reaction under conditions that arise during amplification of a desired region, isolating an amplified fragment (i.e., purifying the reaction mixture on an agarose gel), and isolating amplified DNA. Primers can be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector.

To obtain all or part of the ATR sequence, the techniques described here can be used. Genomic clones containing the ATR gene and its introns and promoter regions, starting with the genomic DNA of human cells, such as liver cells, can also be obtained in a similar way.

Although, basically, the techniques mentioned here are well known in science, reference may be made, in particular, to Sambrook et al. (Molecular Cloning: A Laboratory Manual, 1989).

Polynucleotides that are not 100% homologous to the sequences of the present invention, but fall within the scope of the invention, can be obtained in a number of ways.

Other allelic variants of the human ATR sequence described herein can be obtained, for example, by testing genomic DNA libraries created from a number of representatives, for example, representatives from different populations.

In addition, ATR homologues of other animals, especially mammals (e.g., mice, rats or rabbits), more particularly primates, can be obtained, and such homologs and fragments thereof can mainly be capable of selectively hybridizing with Seq.ID No.1. Such sequences can be obtained by testing cDNA libraries created from separated cells or tissues or genomic DNA libraries from other animal species, and testing such libraries with samples that include all or part of Seq.ID 1 under high stringency conditions (for example, 0.03 M chloride sodium and 0.03 M sodium citrate at a temperature of from about 50 ° C to about 60 ° C).

Allelic variants and species homologues can also be obtained using degenerative PCR, which will use primers designed to target sequences within variants and homologues encoding the stored amino acid sequences. The stored sequences can be predicted by comparing the ATR of the amino acid sequence with the rad3 sequence. Primers will contain one or more degenerate sites and will be used under stringent conditions lower than those used to clone sequences with a single primer sequence relative to known sequences.

Alternatively, such polynucleotides can be obtained by site directed mutagenesis of ATR sequences or their allelic variants. This can be applied where, for example, changes in the silent codon for sequences are required in order to optimize the benefits of the codon for a particular host cell in which the polynucleotide sequence is expressed. Changes to other sequences may be desirable in order to introduce recognizable restriction enzyme sites, or to alter the property or function of the polypeptides encoded by polynucleotides. Further changes may be desirable to represent particular coding changes found in ATRs that give rise to mutant ATR genes that have lost the function of the control point. Samples based on such changes can be used as diagnostic samples to detect such ATR mutants.

The invention further provides double-stranded polynucleotides comprising the polynucleotide of the invention and its complement.

Polynucleotides or primers of the invention may carry a detectable label. Suitable labels include radioisotopes, such as ³² P or ³⁵ S, enzyme labels, or other protein labels, such as biotin. Such labels can be added to the polynucleotides or primers of the invention and can be detected using techniques known per se.

The polynucleotides or primers of the invention or fragments thereof, labeled or unlabeled, can be used by those skilled in the art in nucleic acid experiments to detect or sequence ATR in a human or animal body.

Such detection experiments typically include bringing a human or animal body sample containing DNA or RNA into contact with a sample comprising the polynucleotide or primer of the invention under hybridization conditions and detecting any duplex formed between the sample and the nucleic acid in the sample. Such detection can be achieved by using techniques such as PCR, or by immobilizing the sample on a solid substrate to remove a nucleic acid that does not hybridize with the sample, and then determining the nucleic acid that hybridizes with the sample. Alternatively, a nucleic acid sample can be immobilized on a solid support, and the amount of sample associated with such a support can be determined. Suitable methods for analyzing this and any other formats can be found, for example, in WO 89/03891 and WO 90/13667.

ATR sequencing experiments included contacting a sample of a human or animal body containing a DNA or RNA target with a polynucleotide or primer of the invention under hybridization conditions and sequencing by, for example, terminating a Ganger dideoxy chain (see Sambrook et al .).

Such a method typically includes elongation in the presence of suitable reagents, a primer by synthesis of a strand complementary to the target DNA or target RNA, and selectively terminating the extension reaction with one or more A, C, Q or T / U residue; enabling chain extension and termination reactions; separation according to the size of the elongated products to determine the sequence of nucleotides at which selective termination occurred. Suitable reagents include a DNA polymerase enzyme, dATP, dCTP, dGTP and dTTP deoxynucleotides, a buffer, and ATP. Dideoxynucleotides are used for selective termination.

Tests for detecting or sequencing ATR in a human or animal body can be used to determine the ATR sequences within cells of individual representatives who have, or are thought to have, an altered ATR gene sequence, for example, in cancer cells, including leukemia cells and solid tumors such as tumors of the breast, ovary, lung, colon, pancreas, testicle, liver, brain, muscle and bone tumors.

In addition, the discovery of ATR will reveal the role of this gene in hereditary diseases that will be investigated, in a manner analogous to the method of the ATM gene. Basically, this will include establishing ATR status (for example, using PCR sequence analysis) in cells isolated from patients with diseases that may be associated with damage before cell replication, for example, a hereditary predisposition to cancer, chromosomal rupture, or an unstable phenotype or a renewable damaged sensitive phenotype.

Samples of the invention may traditionally be packaged in the form of a test kit in an appropriate container. In such kits, the sample can bind to a solid support, where the analysis format for which the kit is designed requires such binding. The kit may also contain a suitable reagent for processing the sample, which will be tested by hybridizing the sample with the nucleic acid in the sample, control reagents, instructions, and the like.

The present invention also provides polynucleotides encoding the polypeptides of the invention described below. Due to the fact that such polynucleotides will be suitable as sequences for the recombinant formation of the polypeptides of the invention, it is not necessary for them to be selectively hybridizable with the sequence Seq.ID No.1, although this will usually be desirable. In other words, such polypeptides can be labeled, used and prepared as described above, if desired. The polypeptides of the invention are described below.

Particularly preferred polynucleotides of the invention are those derived from the ATR lipid kinase domain, allelic variants thereof, and species homologs. The lipid kinase domain is represented by nucleotides from 7054 to 8011 Seq.ID No.1. Polynucleotides of the invention that include this domain are particularly preferred. The term "lipid kinase domain" refers to a domain that is homologous to other known lipid kinases, in particular the p110 subunit of PI-3 kinase, as defined by the sequence.

Other preferred polynucleotides of the invention are those that include nucleotides encoding amino acids 181 to 302 Seq.ID No. 2 (nucleotides 620 to 985 Seq.ID No.1), which are believed to be the region of the leucine "zipper" proposed site protein-protein interaction, and amino acids from 1358 to 1366 (nucleotides from 4151 to 4177), which are also preserved.

In an additional aspect, the polynucleotides of the invention include those Seq.ID No. 3 and fragments thereof that are capable of selectively hybridizing to this sequence other than a fragment consisting of nucleotides from 2482 to 6599, in which the following changes were made: deletion of residues 2499, 2501, 2507 and 2509; Insertion C between 5918/5919.

Particularly preferred fragments include those containing a residue from 6826 to 7334 (lipid kinase domain) and a leucine zipper region from 1476 to 1625 and from 2310 to 2357. In addition, a fragment comprising a stored region from 3891 to 3917 is preferred. polypeptides and fragments can be prepared and used as described above.

B. Polypeptides

The polypeptides of the invention include polypeptides essentially in isolated form, which include the sequence represented by Seq ID No.2.

Polypeptides also include variants of such sequences, including naturally occurring allelic variants and synthetic variants that are substantially homologous to said polypeptides. In this context, significant homology is considered as a sequence that has at least 70%, for example, 80% or 90% amino acid homology (identity) within 30 amino acids with the sequence Seq ID No.2, with the exception of the lipid kinase domain and C-terminal part (residues from 2326 to 2644), where significant homology is considered as at least 80% homology, preferably 90% homology (identity) within 50 amino acids.

The polypeptides also include other polypeptides that encode ATR homologues from other species, including animals such as mammals (eg, mice, rats or rabbits), especially primates, and variants thereof as described above.

The polypeptides of the invention also include fragments of the aforementioned full-length polypeptides and their variants, including fragments of the sequence shown as Seq ID No.2.

Preferred fragments include those that include an epitope, especially an epitope. Suitable fragments will be at least about 5, for example, 10, 12, 15 or 20 amino acids in size. The ATR protein polypeptide fragments and its allelic and species variants may contain one or more (e.g., 2, 3, 5, or 10) substitutions, deletions, or inserts, including stored substitutions.

Saved substitutions can be prepared in accordance with the following table, which shows stored substitutions, where the amino acids of the same block in the second column and preferably on the same line in the third column can be replaced by each other:

ALIPHATIC Non-polar Gap ILV Polar Cstm

uncharged Nq Polar DE charged KR AROMATIC Hfwy OTHER Nqde

Embodiments of the polypeptides of the invention may also include polypeptides where one or more specific (i.e., naturally encoded) amino acids are deleted or substituted, or where one or more non-specific amino acids are added: (1) without loss of kinase activity specific to the polypeptides of the invention; or (2) in the absence of kinase activity specific for the polypeptides of the invention; (3) in the absence of the ability to interact with participants or pathway regulators of the cell cycle control point.

Epitopes can be determined by any technical means, such as a peptide scan tool, as described by Geysen et al. Mol. lmmunol., 23; 709-715 (1986).

The polypeptides of the invention may be in substantially isolated form. It should be clear that the polypeptides can be mixed with carriers or diluents that will not affect the intended purpose of the polypeptide, and yet can be considered as substantially isolated. The polypeptide of the invention may also be in substantially purified form, when the polypeptide is more than 90%, for example 95%, 98% or 99% of the polypeptide in the preparation, it is a polypeptide of the invention. The polypeptides of the invention can be modified, for example, by adding histidine residues to facilitate their purification, or by adding a signal sequence to facilitate their release from the cell.

The polypeptides of the invention may be labeled with a detectable label. A detectable label may be any suitable label that allows the detection of a polypeptide. Suitable labels include radioisotopes, for example ¹²⁵ I, enzymes, antibodies, polynucleotides and linkers, such as biotin. The labeled polypeptides of the invention can be used in diagnostic procedures, such as immunoassays, in order to determine the amount of polypeptide in a sample. The polypeptides or labeled polypeptides of the invention can also be used in serological or cell-related immunoassays to determine the immune reactivity to these polypeptides in animals and humans using standard protocols.

The polypeptides or labeled polypeptides of the invention or fragments thereof can also be fixed on the solid phase, for example, on the surface of immunoassay plates or measuring rod.

Such labeled or immobilized polypeptides may be packaged in a suitable container, together with suitable reagents, control formulations, instructions, and the like.

Such polypeptides and kits can be used in methods for detecting antibodies to an ATR protein or its allelic or species variants using immunoassays.

Immunoassay methods are well known in the art and will typically include:

(a) providing a polypeptide comprising an epitope capable of binding with an antibody to said protein;

(b) incubating the biological sample with the specified polypeptide under conditions that allow the formation of an antibody-antigenic complex;

and

(c) determining whether an antibody-antigenic complex containing said polypeptide has formed.

The polypeptides of the invention can be formed either by synthetic means (for example, as described by Geysen et al.), Or recombinantly, as described below.

Particularly preferred polypeptides of the invention include those that extend either within the lipid kinase domain, namely amino acids 2326 to 2644 Seq.ID.2, or sequences substantially homologous to it. Fragments, as defined above, from this area are particularly preferred. The polypeptides and their fragments may contain amino acid shifts as described above, including substitutions at one or more positions 2475, 2480 and 2494, which correspond to the positions of the rad3 substituents described in the examples below. Preferred substitutions include D2475A, N2480K and D2494E.

The polypeptides of the invention can be used in vitro or in vivo in cell culture systems to study the role of ATR as a control point gene. For example, truncated or modified (for example, lipid kinase modified in the domain) ATRs can be introduced into the cell to disrupt the normal functions of the control point that occur in the cell.

The polypeptides of the invention can be introduced into the cell by in situ expression of the polypeptide from a recombinant expression vector (see below). The expression vector optionally carries an inducible promoter to control the expression of the polypeptide.

The use of mammalian host cells is expected to provide such post-translational modifications (e.g., myristolation, glycosylation, truncation, lapidation and tyrosine, serine or threonine phosphorylation) that may be necessary to impart optimal biological activity to the products of recombinant expression of the invention.

Systems of such cell culture in which the polypeptide of the invention is expressed can be used in analysis systems to identify candidate substances that interfere with or enhance the function of a control point in a cell (see below).

In a further aspect, the polypeptides of the invention include a Seq.ID No.4 protein and fragments thereof from a region other than a fragment containing amino acids 713 to 1778. Particularly preferred fragments include those containing residues 2082 to 2386 (lipid kinase domain) and a leucine zipper region from 298 to 347 and from 576 to 591. In addition, a fragment comprising a stored region from 1103 to 1111 is preferred. Such polypeptides and fragments can be prepared and used as described above.

The invention also provides polypeptides substantially homologous to the Seq.ID No.4 protein and its fragments. In this context, significant homology is considered as a sequence that has at least 70%, for example, 80% or 90% amino acid homology (identity) within 30 amino acids with the sequence Seq.ID No.4, with the exception of the lipid kinase domain and the C-terminal portion (residues from 2082 to 2386), where substantial homology is considered to be at least 80%, preferably at least 90% homology (identity) within 50 amino acids.

C. Vectors

Polynucleotides of the invention can be introduced into a recombinant replicable vector. The vector can be used to replicate a nucleic acid in a compatible host cell. Thus, in a further embodiment, the invention is a method for preparing polynucleotides of the invention by introducing a polynucleotide of the invention into a replicable vector, introducing the vector into a compatible host cell and growing the host cell under conditions that result in replication of the vector. The vector may be isolated from the host cell. Suitable host cells are described below in connection with expression vectors.

R. Expression Vectors

Preferably, the polynucleotides of the invention in a vector are capable of binding to a control sequence that is capable of providing expression of the coding sequence by a host cell, i.e. the vector is an expression vector.

The term "operably linked" refers to the overlay of direct mutation and suppressor (juxtaposition), where the described components are in a relationship that allows them to function in the way intended by them. A “capable of binding” control sequence to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.

Such vectors can be transformed in a suitable host cell, as described above, to allow expression of the polypeptide of the invention. Thus, in a further aspect, the invention is a process for preparing the polypeptides of the invention, which comprises culturing a host cell transformed or transfected with an expression vector as described above under conditions that allow the vector to express a coding sequence that encodes polypeptides and isolate the expressed polypeptides.

The vectors may be, for example, a plasmid, a virus, or a phage vector provided initially with replication, optionally a promoter for expression of said polynucleotide, and optionally a promoter regulator. The vectors may contain one or more selectable marker genes, for example, an ampicillin resistant gene in the case of a bacterial plasmid, or a neomycin resistant gene for a mammalian vector. Vectors can be used in vitro, for example, for the preparation of RNA or used for transfection or transformation of a host cell. Vectors can also be adapted for in vivo use, for example, in a gene therapy method.

A further embodiment of the invention provides host cells transformed or transfected with vectors for replication and expression of the polynucleotides of the invention. Cells will be selected so that they are compatible with the specified vector, and can be bacterial, yeast, insect or mammalian cells.

Polynucleotides according to the invention can also be inserted into the vectors described above in an antisense orientation in order to ensure the preparation of antisense RNA. Antisense RNA or other antisense polynucleotides can also be produced by synthetic methods. Such antisense polynucleotides can be used in a method of controlling levels of ATR or variants or species homologs thereof.

Promoters and other expression regulatory signals may be selected to be compatible with the host cell for which the expression vector is being constructed. For example, yeast promoters include S. cerevisiae GAL4 and ADH promoters, S. pombe nmtl and adh promoter. Mammalian promoters include a metallothionein promoter that can be introduced in response to heavy metals such as cadmium. Viral promoters, such as the SV40 large T antigen promoter or adenovirus promoters, may also be used. All of these promoters are readily available in this field.

E. Antibodies

The invention also provides monoclonal or polyclonal antibodies to the polypeptides of the invention or their fragments. The invention further is a process for producing monoclonal or polyclonal antibodies to the polypeptides of the invention. Monoclonal antibodies can be prepared using traditional hybridoma technology using the polypeptides of the invention or their peptide fragments as immunogens. Polyclonal antibodies can also be prepared by conventional means, which include inoculating an animal host, for example, a rat or rabbit, with a polypeptide of the invention or its peptide fragment, and isolating immune serum.

In order to prepare such antibodies, the invention must provide the polypeptides of the invention or fragments thereof haptenized with another polypeptide for use as immunogens in animals or humans.

Preferred antibodies of the invention will be capable of selectively binding a human ATR protein that has an affinity of at least 10-fold, preferably at least a 100-fold, affinity of a rad3 protein. Such antibodies can be obtained by known techniques, for example, selecting ATR regions of a protein with sequences different from the corresponding rad3 regions, preparing peptides containing such sequences, and using such peptides as immunogens. Following the production of antibodies, the binding of these antibodies can be determined. Preferred antibodies of the invention include those that are capable of selectively binding the lipid kinase domain (as defined above) of a human ATR protein. In addition, antibodies that are capable of binding human and yeast lipid kinase domains (S. pombe) by a similar affinity, but not to the ATM domains of the protein family, form the following aspect of the invention. Such antibodies can be grown as opposed to peptides from lipid kinase domains that correspond to regions found to be identical, or substantially identical, in the yeast and human genes.

For the purposes of this invention, the term “antibody”, unless otherwise indicated, includes fragments of an entire antibody that retains its binding activity for the antigen of a tumor target. Such fragments include Fv, F (ab) and F (ab ’) 2 fragments, as well as single chain antibodies. In addition, antibodies and fragments thereof can be humanized antibodies, for example, as described in EP-A-239400.

Antibodies can be used in a method for detecting polypeptides of the invention represented in biological samples by a method that includes:

(a) providing an antibody of the invention;

(b) incubating the biological sample with said antibody under conditions that allow the formation of an antibody-antigen complex; and

(c) determining whether an antibody-antigen complex has been formed comprising said antibody.

Suitable samples include extracts from separated cells, for example, white blood cells or cancer cells, including leukemia cells, and solid tumors such as breast, ovary, lung, colon, pancreas, testis, liver, brain, muscle and bone tumors.

Antibodies of the invention may be coupled to a solid support and / or packaged in kits in an appropriate container along with suitable reagents, controls, instructions, and the like.

F. Assays

The elimination of cell cycle control points is a potential strategy for the development or construction of drugs for anticancer therapy, both a new treatment and partially combined therapy to enhance the specific toxicity of existing chemotherapeutic agents. For example, alkylating agents, such as nitrogen-containing mustard gas, are used as therapeutic agents that damage DNA in relation to rapid cell division, resulting in cell death. The toxicity of such agents can be reduced by DNA repair and control point mechanisms. The elimination of such mechanisms will thus enhance the efficacy of therapeutic compounds designed to damage DNA. Eliminating the ATR control point will be especially useful where the tumor cells have lost another control point or the genes responsible for the damage, as these other genes may be able to complement the loss of ATR function in non-tumor cells, leading to an even greater increase in the effectiveness of the chemotherapeutic agent.

The lipid kinase activity of ATP is the goal in the development of anticancer compounds, since the results presented in the following examples show that a kinase domain is required for ATR function. Thus, the present invention is an analysis method for screening candidate substances for anticancer therapy, which includes:

(a) providing a polypeptide of the invention that retains the activity of a lipid kinase and a substrate for said kinase, under conditions and with reagents such that the kinase activity will affect the substrate;

(b) bringing said polypeptide and substrate into contact with a candidate substance;

(c) measuring the degree of decrease in kinase activity of the polypeptide; and

(d) selecting a candidate substance that provides a decrease in activity.

The analysis can be carried out in vitro, for example, in the wells of a microtiter plate. This format can be easily adapted for automatic use, allowing the use of a large number of candidate substances for screening.

The substrate on which the polypeptide of the invention will act may be a protein or lipid substrate of natural or synthetic origin. Typically, the polypeptide of the invention will phosphorylate the substrate.

Any suitable format can be used by a person skilled in the art from the productive analysis category. Typically, a polypeptide of the invention that retains lipid kinase activity will bind to a solid support in the presence of a substrate and cellular or other components that are usually required for activity. Labeled phosphate and candidate substance will be added to the mixture simultaneously or sequentially one after another. After passing the appropriate reaction time (usually a few minutes, but in any case sufficient for the substrate to phosphorylate in the absence of the candidate substance), the amount of free phosphate is determined, for example, by precipitation of phosphate. Candidate substances that inhibit kinase activity will inhibit the entry of free phosphate into the substrate, and thus the location of free phosphate is an indicator of inhibition.

Other analysis formats may be used by one of skill in the art.

Candidate substances can be used in the initial screening in groups of, for example, 10 compounds per reaction, and compounds of those groups that show inhibition during individual testing.

Suitable candidate substances include peptides, especially from about 5 to 20 amino acids in size, based on the kinase domain sequence, or variants of such peptides in which one or more residues are substituted as described above. Peptides from peptide panels can be used, including statistical sequences or sequences that are modified in composition to maximize the diversity of the peptide panel. In addition, candidate substances include kinase inhibitors, which are small molecules, such as cyclosporin-like and staurosporin-like compounds, or other compounds commercially available in the panels of small molecular inhibitors.

Candidate substances that are active in in vitro screenings, such as those described above, can then be tested in in vivo systems, such as yeast or mammalian cells, that will be exposed to inhibitors and tested for control point activity.

Rad3 has also been shown to have protein kinase activity. Target substrates of the Rad3 protein kinase activity can be identified by introducing test compounds into kinase activity assays. Rad3 protein is resuspended in the kinase buffer and incubated with or without the test compound (e.g. casein, histone H1, or the corresponding substrate peptide). The number of moles of phosphate transferred by the kinase to the test compound is measured by autoradiography or scintillation counting. The transition of phosphate to the test compound is an indication that the test compound is a kinase substrate.

Agents that modulate the activity of Rad3 / ATR lipid kinase or Rad3 protein kinase can be identified by incubating the test compound and Rad3 / ATR immunocleaned from naturally expressing Rad3 / ATR cells, with Rad3 / ATR derived from recombinant prokaryotic or eukaryotic cells expressing the enzyme, or with purified Rad3 / ATR, and then determining the effect of the test compound on Rad3 / ATR activity. The activity of the Rad3 / ATR lipid kinase or of the Rad3 protein kinase domains can be measured by determining moles of ³² P-phosphate transferred by the kinase from gamma- ³² P-ATP or to itself (autophosphorylation) or to an exogenous substrate, such as a lipid or protein. The amount of phosphate introduced into the substrate is measured by scintillation counting or autoradiography. An increase in moles of phosphate transferred to the substrate in the presence of the test compound, compared with moles of phosphate transferred to the substrate in the absence of the test compound, indicates that the test compound is an activator of this kinase activity. Conversely, a decrease in moles of phosphate transferred to the substrate in the presence of the test compound, compared with moles of phosphate transferred to the substrate in the absence of the test compound, indicates that the modulator is an inhibitor of this kinase activity.

In a now preferred analysis, a Rad3 / ATR antibody bound to agarose beads is incubated with a cell lysate prepared from host cells expressing Rad3 / ATR. The granules were washed to remove proteins that bind non-specifically to the granules, and the granules were then resuspended in kinase buffer (such as 25 mM K-HEPES pH 7.7, 50 mM potassium chloride, 10 mM magnesium chloride, 0.1% Nonidet-P-40, 20% glycerol , 1 mM DTT). The reaction is initiated by the addition of 100 μM gamma- ³² P-ATP (4 Ci / mM) and an exogenous substrate, such as a lipid or peptide, and the reaction is carried out at 30 ° C. for 10 minutes. Kinase activity is measured by determining moles of ³² P-phosphate transferred by the kinase either to itself or to the added substrate. In a preferred embodiment, the host cells lack endogenous activity of the Rad3 / ATR kinase. The selectivity of a compound that modulates the activity of the Rad3 / ATR lipid kinase can be evaluated by comparing its activity on Rad3 / ATR with its activity, for example, on other known phosphatidylinositol-3 (PI-3) -related kinases. The combination of recombinant Rad3 / ATR products of the invention with other recombinant PI-3 related kinase products in a series of independent assays provides a system for creating selective Rad3 / ATR kinase activity modulators. Similarly, the selectivity of a compound that modulates the activity of the Rad3 protein kinase can be determined by reference to other kinase protein, for example, DNA dependent protein kinase or ATM.

In addition, the demonstration that the rad mutant rad.D2249E (see examples) can act as a dominant negative mutant indicates inclusion in one or more protein complexes, and such complexes themselves can be targeted for therapeutic introductions. It has been shown, for example, that Rad3 can equally associate and associate with ATR. Therefore, it looks like Rad / ATR functions as multimeric molecules. Mutant yeast rad or ATR human genes, or their derivatives, which also lack Rad / ATR activity, can be introduced into cells to act as dominant negative mutants. Thus, for example, if expression of a dominant negative mutant (e.g., ATR D2475A, N2480K, or D2494E) in tumor cells leads to increased sensitivity to radiation, this indicates that natural ATR still functions and thus acts as a target for therapeutic agents.

Interacting proteins, which include components of complexes of a multimeric protein, including Rad3 or ATR, can be identified by the following assays.

The first assay contemplated by the invention is di-hybrid screening. The di-hybrid system was grown in yeast [Chien et.al., (1991)] and is based on a functional in vivo reconstruction of a transcription factor that activates a reporter gene. Specifically, a polynucleotide encoding protein that interacts with Rad3 / ATR is isolated by: transforming or transfecting the corresponding host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA binding domain and an activating domain; expressing in host cells a first hybrid DNA sequence that encodes the first hybrid of a portion or all of either the DNA binding domain or the activating domain of a transcription factor; expressing in the host cells of the library of the second hybrid DNA sequences encoding the second hybrids of part or all of the alleged Rad3 / ATR binding proteins and DNA binding domain, or an activating domain of a transcription factor that is not introduced into the first hybrid; detecting the binding of a Rad3 / ATR interacting protein to Rad3 / ATR in a particular host cell by detecting the production of a reporter gene product in the host cell; and isolating second fusion DNA sequences encoding an interacting protein from a particular host cell. Now preferred for use in the analysis are the lexA promoter for expressing the reporter gene, the lacZ reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain and host yeast cells.

Other assays for identifying proteins that interact with Rad3 or ATR may include immobilizing the Rad3 / ATR or test protein, detecting a labeled, non-immobilized binding partner, incubating the binding partners together and determining the magnitude of the labeled bond. A linked label indicates that the test protein interacts with Rad3 / ATR.

Another type of assay for identifying Rad3 or ATR interacting proteins involves immobilizing Rad3 / ATR or a fragment thereof onto a solid substrate coated (or impregnated with a fluorescent agent) with a fluorescent agent, labeling the test protein with a compound capable of exciting the fluorescent agent, contacting the immobilized Rad3 / ATR sword with protein, the detection of light by a fluorescent agent and the identification of interacting proteins as test proteins, which leads to the emission of light a fluorescent agent. Alternatively, a putative interacting protein can be immobilized and Rad3 / ATR can be labeled in the assay.

Compounds that modulate the interaction between Rad3 / ATR and other cellular components can be used in cancer treatments. For example, if a particular form of cancer arises from a mutation in a gene other than ATR, such as the p53 gene, an agent that inhibits the transcription or enzymatic activity of ATR and thus the G ₂ cell cycle checkpoint can be used to convert cancer cells more susceptible to chemotherapy or radiation therapy. The therapeutic effect of such an agent actually emphasizes that current radiation therapy or chemotherapy in most cases does not overlap the ability of the p53 mutant of the cancer cell to sense and correct DNA damage resulting from treatment. As a result, a cancer cell can simply repair DNA damage. The modulating agents of the invention may therefore be adjuvants of chemotherapy and radiation therapy, or may themselves be directly active as chemotherapeutic drugs.

Assays for identifying compounds that modulate the interaction of Rad3 / ATR with other proteins may include: transforming or transfecting the respective host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor with a DNA binding domain and an activating domain; the expression in host cells of the first hybrid DNA sequence encoding the first hybrid of part or all of Rad / ATR and the DNA binding domain, or an activating domain of transcription factor; expressing in the host cells a second hybrid DNA sequence encoding part or all of the protein that interacts with Rad3 / ATR and the DNA binding domain, or an activating domain of transcription factor that is not introduced into the first hybrid; assessing the effect of the test compound on the interaction between Rad3 / ATR and the interacting protein by detecting the binding of the interacting protein to Rad3 / ATR in a particular host cell; by measuring the formation of the reporter gene product in the host cell in the presence or absence of the test compound: and the identification of modulating compounds as such test compounds that alter the production of the reporter gene product compared to the production of the reporter gene product in the absence of the modulating compound. Now preferred for use in the analysis are the lEXA promoter for expressing the reporter gene, the lacZ reporter gene, a transcription factor including the lEXA DNA domain and the GAL4 transactivation domain and the host yeast cells.

Another type of assay for identifying compounds that modulate the interaction between Rad3 / ATR and an interacting protein involves immobilizing a Rad3 / ATR or a naturally occurring Rad3 / ATR interacting protein, detecting a labeling immobilized binding partner, incubating the binding partners together and determining the effect of the test compound on the labeled bond where the decrease in the labeled bond in the presence of the test compound compared to the value of the labeled bond in the absence of the test compound The test agent is an inhibitor of the Rad3 / ATR interaction with the protein. In contrast, an increase in binding in the presence of the test compound to the value of the labeled bond in the absence of the compound to be compared indicates that the putative modulator is an activator of the Rad3 / ATR interaction with the protein.

Another method contemplated by the invention for identifying compounds that modulate the binding between Rad3 / ATR and an interacting protein involves immobilizing Rad3 / ATR or a fragment thereof onto a solid support coated with (or impregnated with) a fluorescent agent, labeling the interacting protein with a compound capable of exciting a fluorescent agent contacting immobilized Rad3 / ATR with a labeled interacting protein, in the presence or absence of a test compound, detecting fluorescence of light agent and the identification of modulating compounds as those test compounds that affect light emission by a fluorescent agent, compared to light emission by a fluorescent agent in the absence of a test compound. Alternatively, a Rad3 / ATR interacting protein can be immobilized and Rad3 / ATR can be labeled in the assay.

Rad3 has been shown to interact with ATR. Therefore, the aforementioned assays can also be used to identify compounds that modulate the interaction between Rad3 and ATR where the protein interaction described in the assay methods is either Rad3 or ATR.

It has also been shown that Rad3 binds to itself, suggesting in large part that ATR can also bind to itself. Therefore, the aforementioned assays can also be used to identify compounds that modulate Rad3-Rad3 interactions and ATR-ATR interactions.

Such compounds can be used therapeutically to disrupt ATR-ATR interactions and increase sensitivity to tumor cells in chemotherapy and / or radiotherapy. Thus, the invention is an analysis method for screening candidate substances for anti-cancer therapy, which includes:

(a) (i) incubating the polypeptide of the invention with another polypeptide of the invention, which may be the same or different from the first polypeptide, under conditions that allow the first polypeptide to bind to the second polypeptide to form a complex;

(ii) bringing the complex thus obtained into contact with a candidate substance;

or

(a) incubating the polypeptide of the invention with another polypeptide of the invention, which may be the same or different from the first polypeptide, under conditions that allow the first polypeptide to bind to the second polypeptide to form a complex and in the presence of a candidate substance;

and

(b) determining whether the candidate substance inhibits the binding of the first polypeptide to the second polypeptide and

(c) selecting a candidate substance that inhibits the binding of the first polypeptide to the second polypeptide.

Preferably, the first and second polypeptides can be different from each other. For example, the first polypeptide and the second polypeptide can both be ATR, or both can be Rad3, or one can be ATR and one can be Rad3 or derivatives of either ATR or Rad3 that retain binding activity. When both polypeptides are ATR or Rad3, two distinct forms of ATR / Rad3 will preferably be used in these assays. They may be distinguishable, for example, by labeling any of the polypeptides. Examples of tags include radioactive tags, epitope targets, or other polypeptide targets, such as glutathione-S-transferase. For example, one form of Rad3 can have one form of an epitope target and another form will have a different epitope target, allowing them to be distinguished immunologically, so that the binding of one form to another can be established qualitatively or quantitatively. In a preferred method, the first polypeptide may, for example, be immobilized into agarose granules or onto a solid support, and the second polypeptide may be in free solution. Binding is then determined using the methods described above and are well known to those skilled in the art.

The present invention also contemplates antibody products (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like) and other binding proteins (such as those identified in the assays above) that are specific for the Rad3 protein kinase domain or Rad3 / ATR lipid kinase domains. Binding proteins can be constructed using isolated natural or recombinant enzymes. Binding proteins can be developed using isolated natural or recombinant enzymes. Binding proteins are useful, in turn, for purification of recombinant and naturally occurring enzymes and identification of cells producing such enzymes. Assays for the detection and quantification of proteins in cells and fluids may include determination of a single antibody substance or multiple antibody substances in a sandwich analysis format. Binding proteins are also obviously useful in modulating (i.e. blocking, inhibiting or stimulating) enzyme / substrate or enzyme / regulator interactions.

Rad3 / ATR modulators can affect its kinase activity, its localization in the cell, and / or its interaction with pathway elements of the cell cycle control point. Selective modulators may include, for example, polypeptides or peptides that specifically bind to Rad3 / ATR or Rad3 / ATR nucleic acid and / or other non-peptide compounds (e.g., isolated or synthetic organic molecules) that specifically react with Rad3 / ATR or Rad3 / ATR nucleic acid. Mutant forms of Rad3 / ATR that affect the enzymatic activity or cellular localization of wild-type Rad3 / ATR are also contemplated by the invention.

In addition, combinatorial libraries, peptides and peptide mimetics, certain chemicals, oligonucleotides and natural product libraries can be screened for activity as modulators of Rad3 / ATR kinase activity and Rad3 / ATR interactions in assays, such as those described above.

F. Therapeutic uses.

Modulators of Rad3 / ATR activity, including inhibitors of their lipid kinase and protein kinase activity, can be used in anti-cancer therapy. In particular, they can be used to increase the susceptibility of cancer cells to chemotherapy and / or radiotherapy through their ability to disrupt the regulatory functions of the Rad3 / ATR cell cycle.

Thus, the invention provides the use of compounds that modulate Rad3 / ATR activity, identified by the screening assays described above, in a method of treating cancer. In one embodiment, said compounds are capable of inhibiting rad3 / ATR lipid kinase and / or Rad3 protein kinase activity. In another embodiment, these compounds are capable of inhibiting interactions between ATR and itself and / or between ATR and other interacting proteins, which can, for example, normally form part of a multimeric protein complex.

It should be understood that the term “compound” in this context also refers to candidate substances selected in the above assays.

Typically, the compounds are prepared for clinical administration by mixing them with a pharmaceutically acceptable carrier or diluent. For example, they can be formulated for point, parenteral, intravenous, intramuscular, subcutaneous, intraocular or transdermal administration. Preferably, the compound is used in injectable form. Direct injection into the patient’s tumor is advisable because it makes it possible to concentrate the therapeutic effect at the level of damaged tissues. Therefore, the compound can be mixed with any excipient that is pharmaceutically acceptable for the injectable composition, preferably for direct injection into the area that is being treated. The pharmaceutical carrier or diluent may be, for example, sterile or isotonic solutions.

The dose of the compound used can be adjusted in accordance with various parameters, especially in accordance with the compound used, the age, weight and condition of the patient being treated, the form of administration used, the tumor pathology and the required clinical regimen. As a guide, the amount of compound administered by injection is suitable from 0.01 mg / kg to 30 mg / kg, preferably from 0.1 mg / kg to 10 mg / kg.

Routes of administration and the described doses are intended only as a guide, as one skilled in the art will be able to easily determine the route of administration and dose for any particular patient and condition.

Compounds to be administered may include polypeptides or nucleic acids. Nucleic acids can encode polypeptides or they can encode antisense constructs that inhibit cell gene expression. Nucleic acids can be introduced using, for example, lipofection (lipofection) or using viral vectors. For example, a nucleic acid may form part of a viral vector, such as an adenovirus. When viral vectors are used, in general, the administered dose is between 10 ⁴ and 10 ¹⁴ pfu / ml, preferably 10 ⁶ -10 ¹⁰ pfu / ml. The term pfu (“plaque forming unit”) refers to the inefficiency of the viral solution and is determined by infection of the appropriate cell culture and measuring, usually after 48 hours, the number of plaques of infected cells. Methods for determining pfu titer of a viral solution are well documented in the literature.

Any type of cancer can be treated with these methods, for example, leukemia, and solid tumors such as tumors of the breast, ovary, lung, colon, pancreas, testicle, liver, brain, muscle and bone. Preferably, the tumor has normal ATR function.

The drawing shows the relationship between ATR, rad3, mei-4I, MECI, TELI and ATM /

A. General structures of ATR, Rad3, Mei-4I, Meclp, Tellp and ATM

Designation: open squares - Rad3 domain; hatched squares - kinase domain

B. Dendrogram based on the series of sequences generated by the Clustal method (PAM 250) using DNAstar software, rad3 / ESRI / mei4I / ATR are more related to each other than ATM and TeL1.

The rad3 and ATM sequences are available in the EMBL database.

The following examples illustrate the invention.

Example 1

The rad3 gene of S. pombe is one of six genes unconditionally required for the DNA structure of the control points in S. pombe (AI-Khodairy and Carr; 1992; Al-Khodairy et.al., 1994). A sequence representing part of the rad3 gene has been reported by Seaton et.al., (1992). In an attempt to determine the intron / exxon structure of this gene, we identified subsequent anomalies at both ends 5 ’and 3’. We sequenced the complete gene (see Experimental) and found that rad3 is capable of encoding the 2386 amino acid product. The C-terminal region contains typical coordinated sequences of a subclass of kinases known as lipid kinases, the main member of which is the p110 catalytic subunit of the P13 kinase (Hiles et.al., 1992).

A truncated rad3 clone with the missing amino terminus and kinase region was reported to complement the rad3 :: pR3H1.0 tearing mutant of the rad3 gene (Jimenez et.al., 1992). This tearing mutant does not remove the potential kinase domain. To clarify the role of this domain, we created a null mutant using gene substitution. This mutant contains amino acids 1477-2271 rad3, including a kinase coordinated domain substituted by ura4 ⁺ . This rad3.d strain has identical control point defects and has a radiation / hydroxyurea sensitivity to the rad3.136 mutant (Nasim and Smith, 1975) and the original rad3 :: pR3H1.0 tearing mutant (Jimenez et.al., 1992; Seaton et. al., 1992) (data not shown). We created three separate point mutants in the putative rad3 kinase domain and used them in experiments on gene substitution in constructs of strains with specific kinase zero mutations. All three strains of rad3.D2230A, rad3.N2235K and rad3.D2249E had phenotypes identical to the rad3.d null mutant (data not shown), suggesting that kinase activity is required for Rad3 function. In the light of our findings, an interpretation of the results of Seaton et al. (1992) and Jimenez et al. (1992) is that a partial clone may show intragenic complementation between a plasmid-generated truncated gene and a genomic partial deletion that retains kinase function. Such an interpretation will be consistent with Rad3, acting as a dimer or multimer.

When the kinase null allele rad3.D2249E was moderately over-expressed in wild-type cells under the control of a modified nmtl promoter (Maundrell, 1990), it caused extreme radiation sensitivity, analyzed using tests with UV bands, and acted as a dominant negative mutant (data not flashy). When the same kinase null construct was expressed at a higher level, it inhibited growth (data not shown). A cell study indicates that division continues very slowly, and with a smaller cell size, wild-type cells and cells containing an empty vector divide by about 15 microns, while rad3 and rad3.D2249E super-expressing cells divide by about 11.2 micron (data not shown). In S pombe, this usually indicates an increase in mitosis.

The human rad3 homolog ATR.

To identify the human form of rad3, a combination of methods was applied. Through these approaches, we cloned the fully coding region of the human gene (see materials and methods), which we called ATR (ataxia and rad related). ATR is capable of encoding a 2644 amino acid protein, which is much more closely related to the products of S. pombe rad3, S cerevisiae ESRI (Kato and Ogawa, 1994) and D melanogaster mei-4I genes (Hari et al., 1995) than human ATM and S cerevisiae Tel1 proteins (Savitsky et al., 1995; Greenwell et al., 1995), and is probably the true homologue of rad3. ESR1 is allelic to the mec1 / sad3 control point mutant (Allen et al., 1994; Weinert et al., 1994), which have an equivalent phenotype with respect to rad3. ATR is less closely related to the human ATM gene of the control point, containing the C-terminal putative lipid kinase domain and having a similar overall structure. The series of sequences clearly demonstrate that rad3 / ESR1 (MEC1 / SAD3) / mei-4I / ATR genes are more related to each other than any genes that are related to ATM or TEL1, and that ATM is more homologous to TEL1 (see drawing).

The ATM gene is expressed in a wide variety of tissues ((Savitsky et al ,, 1995). In S. cerevisiae, ESR1 shows a low level of expression in mitotic cells but is rapidly induced during meiosis (Kato and Ogawa, 1994). Using Northern blot analysis, we have demonstrated that ATR is also weakly expressed in many tissues, but that it is more highly expressed in the testis (data not shown). ATR, Rad3 and Esrlp proteins were shown to be more closely related to each other than ATM, the highest ATR expression in testicle is consistent with the observation that Esrlp game has a role in meiotic recombination (Kato and Ogawa, 1994). Using the FISH and PCR assays, we mapped ATR to the 3q22-3q25 chromosome (data not shown). This region is not associated with the known prone cancer syndromes.

In order to further explore the possibility that Rad3 acts as a multimer, we created two separate labeled full-length rad3 constructs in pREP based on inducible vectors. In one case, Rad3 was broadcast with two mus epitope labels in the N termus, while in the other these constructs were replaced by a triple HA epitope label. When both constructs were expressed together into wild-type cells, it became possible to co-precipitate HA labeled Rad3 with a muc specific antibody, and muc labeled Rad 3 with a mu specific antibody (data not shown). This demonstrates that in vivo, the Rad3 protein is capable of self-association and is completely consistent with the complementation data of Jimenez et al. (1992).

Although the ATR gene may not complement the phenotype of rad3 mutants, we examined the ability of ATR to form a protein complex with S.pombe Rad3 by expressing both ATR and mus labeled S.pombe Rad3 in the same yeast cells. Using an anti-ATR antibody (which does not precipitate S. pombe Rad3, see materials and methods), we now have the opportunity to co-precipitate the yeast protein. We were also able to precipitate a human ATR protein with mus-specific antibodies that recognized S. pombe Rad3 (data not shown). These data suggest that human and yeast proteins can form a heterodimeric complex, which confirms the dispute, based on the similarity of the sequence, closely functional relationship between these homologues. Rad3 proteins have associated kinase activity.

Since mutagenesis experiments suggest that the kinase activity of Rad3 proteins in vivo is apparently essential for their function, we investigated this activity further. Using S.pombe Rad3 :: ura4 cells expressing HA targeted S.pombe Rad3, we were able to detect significant protein kinase activity that was accelerated by HA-specific antibodies only when Rad3 was induced, which did not change after irradiation (data not shown) ) This activity, which is specific for Rad3 or co-accelerating kinase, manifests itself to reflect the phosphorylation of Rad3 itself, since a large band above 200RD, which is the phosphorylated part, can be detected using Western blot analysis with anti-HA antibody (data not shown) . Attempts to convincingly identify in vitro substrates such as myelin base protein, RP-A, and some purified proteins with the S. pombe control point have been proven to be unsuccessful. If in vitro IP kinase analysis was performed with cells overexpressing the “kinase-zero” D2249E version of Rad3, the associated kinase activity accelerated by the HA-specific antibody is significantly reduced (data not shown). There are several possible explanations for this. Measured kinase activity can directly reflect Rad3 activity. In this case, the observed residual activity with kinase dead Rad3 may reflect the fact that it is unknown for equivalent D-E mutations in other protein kinases to produce a biologically inert protein with residual in vitro biochemical activity. Alternatively, the kinase activity that allows phosphorylation of Rad3 may be due to associated proteins, and these proteins may interact less efficiently with the D2249E mutant protein.

Discussion

Ways of control points that control the development of the cell cycle after DNA damage or interference in individual events that include the cycle are largely important in maintaining genetic stability and can be considered as pathways that inhibit oncogenesis. Some tumor suppressor genes are closely involved in subsets of control point pathways (reviews by Hartwell and Kastan, 1994), especially those that influence the transition from G1 to S phase and commit to the cell cycle. The convergence of the two yeast model systems for control points clearly indicates that the genes included in these pathways are preserved. This work extends this conservation to metazoan cells and clarifies the relationship between rad3, ESR1 / (MEC1 / SAD3), mei-41, and the ATM gene.

This work demonstrates that the correct sequence of a rad3 gene places its product in the family of protein / lipid kinases related to ATM. Overexpression of a kinase-damaged rad3 mutant in S.pombe induces a dominant negative phenotype, which suggests that Rad3 acts as a component of the protein complex, whose uniformity is necessary for the function of the control point. This is consistent with the observation that rad1, rad9, rad17, rad26, and hus1 deletion mutants all have phenotypes indistinguishable from rad3.d (Sheldrick and Carr, 1993). Unexpectedly, unlike the remaining control point rad genes, a high level of over-expression of either wild-type or mutant rad3 alleles inhibits cell growth and causes mitosis with a reduced cell size, indicating premature entry into mitosis. This “semi-wee” phenotype is not observed in the null mutant and may indicate interference in the second pathway, whose function overlaps with the Rad3 function and acts in mitosis inhibition. The candidate for such a path is the ATM / TEL1 path, which, as shown, has some functions overlapping with the ESR1 (MEC1 / SAD1) path (Morrow et al., 1995).

The ATM structure is most closely related to TelIp, which is involved in maintaining telomere length (Greenwell et al., 1995). However, the ATM function is also related to the function of the Rad3 / Esrlp / mei-41 products. After the initial discovery of the ATM gene and its linkage to the rad3 / ESR1 genes and to TEL1, it is not clear whether the gene, as in many cases of yeast, is duplicated or diverged into yeast, or whether two yeast proteins definitely preserve a subfamily of closely related genes. A significant find of this work is the identification of the human ATR gene, which is more closely related to rad3 / ESR1 / mei-41. This finding defines two structurally distinct related subfamilies with a control point, a subfamily of protein / lipid kinases that persist throughout eukaryotic evolution. Although proteins in these two subfamilies may have some overlapping functions, they probably control various processes. For example, the rad3 sub-family in yeast controls all G1 and G2 DNA damage control points in response to UV and ionizing radiation, and the S phase control point, which prevents mitosis after inhibition of replication (AI-Khodairy and Carr, 1992; Allen et al. 1994; Weinert et al., 1994). In contrast, AT cells have an abnormal response in a narrow DNA region of damaging agents, including ionization radiation, damage by bleomycin and neocarcinostatin, which produce chain breakdown in DNA as a result of a radical attack. The response to UV radiation and most chemical carcinogens is common, as is the response to inhibition of DNA synthesis. It is possible that some or all of the remaining DNA damage control points and the S phase control point are controlled by ATR.

experimental part

Strains, plasmids and medium

Standard genetic procedures, growth conditions, and environment for S. pombe are described in Gutz et al. (1974). S.pombe strain sp011 (ura4.D18, leu1.32 ade6.704 h) have been described previously (Murray et al., 1992). Plasmid pSUB41 was donated by S. Subramani (Seaton et al., 1992).

Cloning in S.pombe rad3

The 4.0 kb Kpn1 fragment was cut from pSUB41 and sequenced in both directions to obtain a 5 ’rad3 sequence. The 3 ’clone was identified from the genomic library (Barbet et al., 1992) by colony hybridization using a 1 kb 3’ sample obtained from the published rad3 sequence and sequenced in both directions. In this way, a complete rad3 gene sequence was made.

Zero and “dead kinase” rad3 mutants

The rad3 construct, in which 794 amino acids between aa1477 and aa2271 (including the kinase domain) was replaced by the ura4 + gene, was created using the methodology described in Barbet et al. (1992). A linear fragment of this construct was used to transform sp011 for uracil prototropy, and a single copy of integration at the rad3 locus was checked using Southern blot analysis. To create a site of specific kinase null mutations, the C-terminal 3.01 kb BamHI-SaI1 fragment of rad3 was mutated either with (A: GTTTTGGCCAGGCGCGCTCCCAAACCCAA, B: TTCATCAAACAATATCTTTT22GAA, or C: DAGA30AATGATA or CTAGTA22GATA or CTAGTAG2 or ATAGA kinase domain. Similar changes were previously used in the analysis of P13 kinase VPS34 S.cerevisiae (Schu et al., 1993). These fragments were then used to transform the rad3 null mutant and replace the gene selected by their ability to grow on FOA containing medium (Grimm et al., 1988). All strains were analyzed using Southern blot analysis. Full-length expression constructs rad3.D2230A were created in pREP1 and pREP41 (Maundrell, 1990) using standard subcloning after Ndel site insertion at ATG and deletion of three internal Ndel sites.

Strip tests for sensitivity to UV radiation

Expression from REP1 (high) and REP41 (intermediate) was induced in the absence of thiamine for 18 hours before plating. The dishes were irradiated with a dose gradient of UV irradiation along the dish from 0 to 300 Jm ^-2 in accordance with the Stratagene Stratalinker sets.

Cloning and expression of ATR

To isolate the appropriate sample to identify cDNA-t corresponding to the human rad3 homolog, degenerate oligonucleotides were designed with respect to the amino acids LGLGDRH (5 'oligo; oDH18) and HVDF [D / N] C (3' oligo; oDH-16) Rad3 / Esrlp. Inosine was introduced into four-fold degeneration positions, and the primers were extended with BamHI (oDH18) and EcoRI (oDH16) to facilitate cloning. Analysis of the DNA sequence of ~ 100 bp PCR product obtained by amplification of peripheral blood leukocyte cDNA showed a significant similarity to MECl / rad3. This sequence was used to synthesize an intact primer (oDH-23; GACGGAGAATTCACCAGTCAAAGAATCAAAGAG) for PCR with an additional disrupted primer (oDH17) constructed with respect to the amino acid sequence KFPP / [I / V] [L / F] Y [Q / E] WF Rad3 / Esrlp. The product 174 bp of this reaction was used directly to screen a microphage cDNA library. Four positive clones (the largest of approximately 3kb) were isolated.

In parallel, a full-length S.pombe rad3, obtained from EMBL of the main data of the human cDNA clone, HSAAADPDG, as a potential rad3 homolog, if allowed a single frame shift for the sequence of 233 bp, was examined using a database. This 233 bp sequence is contained within a 1.6 kb clone obtained from Dr. N. Affara, Human Molecular Research Group, Cambridge University, UK. A complete clone (1.6 kb) was sequenced and lay within the cDNA of clones identified by PCR violation and library screening. To identify the entire gene, RACE PCR experiments were performed on cDNA obtained from placental and thymic mRNA using the instructions provided by the Clontech Marathon Kit. Gene specific primers were obtained from cDNA clones. From these experiments was composed 8239br cDNA sequence with the internal amino acid ORF 2644, 79 bp 5 'non-coding region, 194 bp 3' noncoding region and a poly A ^- tail. Parts of the sequence were determined exclusively by PCR. In order to avoid errors, clones from at least three independent PCR reactions were sequenced in both directions. The 233 bp sequence corresponded to the sequence of nucleotides 6809-7042 (234th in total) Seq.ID No.1, with the exception of a single major deletion at position 6942. This sequence encoded amino acids 2244-2320 Seq.ID No.2.

The insert sequence “1.6 kb” corresponded to nucleotides 5725-7104 (1353 to him) Seq.ID No.1 and encoded amino acids 1892-2340 Seq.ID No.2.

Hybridization Northern Blotting: 1.3kb PCR product was amplified in the presence of ³² P-dCTP using primers 279-3 (TGGATGGATGATGACAGCTGTGTC) and 279-6 (TGTAGTCGCTGCTGCTCAATGTC). A nylon membrane containing 2 μg of size-fractionated polyA + RNA from various sources of human tissue (Clontech Laboratories) was tested as suggested by the manufacturer, except that the final washing was performed at 55 ° C rather than at 50 ° C to reduce the possibility of cross hybridization with related sequences.

ATR mapping

We mapped the ATR gene to chromosome 3 through a combination of fluorescence in situ hybridization and a polymerase chain reaction (PCR) based on assays. FISH analysis using a cDNA clone identified the ATR gene on chromosome 3, at approximately position q22-23. PCR also identified ATR on chromosome 3. Two primers (oATR23: GACGCAGAATTCACCAGTCAAAGAATCAAAGAG and oATR26:

TGGTTTCTGAGAACATTCCCTGA), which amplified the 257 bp fragment of the ATR gene, were used on DNA obtained from hybrids of a human / rodent somatic cell containing various human chromosome panels available from the NIGMS Human Genetic Mutant Cell Repository (Drwinga et al., 1993). PCR with the same primers was used to sub-localize ATR to a specific region on chromosome 3. Matrices for these amplifications consisted of DNA samples from patients with truncations along chromosome 3 (Leach et al., 1994).

Immunoprecipitation (SH) and RAD3 kinase assays

S. pombe rad3 and human ATR genes were cloned into the pREP41 expression vector for complementation studies. In order to tag proteins, versions of these vectors containing N-terminal tag sequences in the frame used either double myc or triple HA tag (Griffiths et al., 1995). Labeled proteins were expressed by growth in a thiamine-free medium (Maundrell, 1990). Yeast cells were lysed in lysis buffer (25 mM TrisCl pH 7.5. 60 mM B-glycerophosphate, 0.1 mM Na ₃ VO ₄ , 1% Triton X-100, 50 mM NaCl, 2 mM EDTA, 50 mM NaF, 1 mM phenylmethylsulfonyl chloride [PMSF ], 5 μg / ml leupeptin, 5 μg / ml aprotin, 1 mm DTT) by adding glass granules, followed by processing in a grinding device for 2 minutes. For IP 300 μg, the complete protein extract was incubated in ice with the appropriate antibody for 30 minutes and the immune complexes were precipitated by mixing with Protein G granules for a further 30 minutes at 4 ° C. For kinase assays, immune complexes were washed 4 times with lysis buffer, once with kinase buffer (25 mM Hepes, pH 7.7; 50 mM KCl, 10 mM MgCl ₂ , 0.1% NP-40 2% glycerol, 1 mM DTT), and incubated in kinase buffer with 10 μM ATP [50 Ci / mmol] for 15 minutes at 30 ° C. Reactions were stopped by the addition of 20 un 2X SDS sample buffer until separation on 6% polyacrylamide gels. Rad3 IP's contained several phosphorylated products, including one that co-migrated with the Rad3 protein itself in Western blot analyzes.

Sources of information

Al-Khodairy, F., and. Carr, A.M. (1992). DNA repair mutants defining G2 checkpoint pathways in Schizosaccharomyces pombe. EMBO J.11, 1343-1350.

Al-Khodairy, F., Fotou, E., Sheldrick. K.S., Griffiths, DJ.F., Lehmann, A.R. and Сarr, A.M. (1994). Identification and characterization of new elements involved in checkpoints and feedback controls in fission yeast Mol. Biol. Cell 5, 147-160.

Allen, J.B., Zhou. Z., Siede. W., Friedberg, B.C. and Elledge. Sj. (1994) The SAD1 / RAD53 protein kinase controls multiple checkpoints and DNA damage-induced transcription in yeast. Genes Dev. 8, 2416-2428.

Barbet, N.C., Muriel, W.J., and Can, A.M. (1992) Versatile shuttle vectors and genomic libraries for use with Schizosaccharomyces pombe. Gene 114, 59-66.

Beamish, H. and Lavin, M.F. (1994) Radiosensitivity in ataxia-telangiectasia: anomalies in radiation-induced cell cycle delay. Int. J. Radiat Biol. 65, 175-184.

Carr, A.M. and Hoekstra, M.F. (1995) The Cellular Responses to DNA Damage. Trends in Cell Biology 5, 32-40.

Chien et al., (1991) Proc. Natl. Acad Sci USA 88, 9578-9582.

Deng, S., Zhang, P., Harper, JW, EIledge. SJ and Lcder. Pj. (1995) Mice lacking p21 ^{CIPl / WAFl} undergo nonmal development, but are defective in Gl checkpoint control. Cell (in press).

Drwinga. H.L., Tojia, L.H., Kim, C.H, Grcene, A.E., and Mulovor, R.A. (1993). NIGMS Human / Rodent Somatic Cell Hybrid Mapping Panels 1 and 2. Genomics 16: 311-314.

El-Deiry. W.S., Tokino, T., Velculescu, V.E., Levy, D.B., Parson, R., Trent. J. M., Lin. D., Mercer, W.E., Kinder, K.W. and Vogelstein, B. (1993) WAF1. a potential mediator of p53 tumor suppression. Cell 75, 817-825.

Enoch, T., Carr, A.M. and Nurse, P. (1992). Fission yeast genes involved in coupling mitosis to completion of DNA-replication. Genes Dev. 6, 2035-2046.

Greenwell. P.W., Kronmal, S.L., Porter. S.E., Gassenhuber. J., Obermaier. B. and Petes, T.D. (1995) TEL I, a gene involved in controlling telomere length in Saccharomyces cerevisiae, is homologous to the human ataxia telangiectasia (ATM) gene. Cell submitted.

Grimm, C., Kholi, J. Murray, J.M. and Maundrell, K. (1988) Genetic engineering of Schizosaccharomyces pombe: a system for gene disruption and replacement using the ura4 gene as a selectable marker. Mol. Gen. Genet 275, 81-86.

Gutz, H., Heslot, H. Leupold, U. and Loprieno, N. (1974). In "Handbook of Genetics", King R.C., Ed., Plenum Press, New York, Vol. 7, 395-446.

Hari, K.L., Santerre, A., Sekelsky, J.J., McKim, K.S., Boyd, J.B, and Hawiey, R.S. (1995) The mei-41 gene of Drosophila melanogaster is functionally homologous to the human ataxia teiangiec Harper, J.W., Adami. G., Wei, N., Kcyomarsi, K. and EIledge, SJ. (1993) The 21 kD Cdk interacting protein Cipl is a potent inhibitor of G1 cyclin dependent kinases. Cell 75, 805.816.

Harwell, L. H., and Kastan. KB. (1994). Cell cycle control and Cancer. Science 266, 1821-1828.

Hiles, LD., Otsu, M., Volinia, S., Fry, MJ, Gout, I., Dhand, R., Panayotou, G., Ruiz-Larrea, F., Thompson, A., Totty, NF, Hsuan, JJ, Courtneidge, SA., Parker. P.J. and Waterfield M.D. (1992) Phospbatidylinositol 3-kinase: structure and expression of the 110kd catalytic subunit. Celt 70, 419-429.

Jimenez, G., Yucel. J., Rowley, R. and Subramani S. (1992) The rad3 + gene of Schizosaccharomyces pombe is involved in multiple checkpoint functions and in DNA repair. Proc Natl. Acad. Sci. USA 87, 4952-4956.

Kato, R. and Ogawa, H. (1994) An essential gene, ESR1, is required for mitotic cell growth, DNA repair and Meiotic recombination in Saccharomyces cerevisiae. Nucleic Acids Res. 22, 3104-3112.

Lamb, J.R., Petit-Frere, C., Broughton, B.C., Lehmann, A.R. and Green, M.H.L. (1989) Inhibition of DNA replication by ionizing radiation is mediated by a trans acting factor. Int. J. Radiat. Biol. 56, 125-130.

Leach, R.J., Chinn, R., Reus, B.E., Hayes, S., Sehantz. L., Dubois, B., Overhauser, J., Ballabio, A., Drabkin, H., Lewis. B.T., Mendgen, G., and Naylor, S.L. (1994) Regional Localization of 188 Sequence Tagged Sites on a Somatic Cell Hybrid Mapping Panel for Human Chromosome 3 Genomics 24, 549-556.

Maundrell, C. (1990). nmtl of fission yeast. A highly transcribed gene completely repressed by thiamine. J. Biol. Chem. 265.10857-10864.

Morrow D.M., Tagle, D.A., Shiloh. Y., Collins F.S. and Hieter, P. (1995) HATlITELl, a Saccharomyces cerevisiae homologue of the human gene mutated in ataxia-telangiectasia, is functionally related to the yeast checkpoint gene MECIIESR1. Cell submitted.

Murray, J.M., Doe, C. Schenk, P. Carr, A.M. Lehmann, A.R. and Watts, F.Z. (1992) Cloning and characterization of the S. pombe rad15 gene, a homologue to the S. cerevisiae RAD3 and human ERCC2 genes Nucleic Acids Res. 20, 2673.2678.

Nasim, A. and Smith, B.P. (1975) Genetic control of radiation sensitivity in Schizosaccharomyces pombe. Genetics 79, 573-582.

Painter, R.B. and Young, B.R. (1980) Radiosensitivity in ataxia - telangiectasia: A new explanation. Proc. Natl. Acad. Sci. USA 77, 7315-7317.

Rowley, R., Subramani. S. and Young, P.G. (1992). Checkpoint controls in Schizosaccharomyces pombe, radl. EMBO J. 11, 1335-1342.

Savitsky. K., Bar-Shira, A., Gilad, S., Rotman. G., Ziv, Y., Vanagaite L., Tagle, DA, Smith, S., Uziel, T., Sfez, S., Ashkenazi, M., Pecker, I., Frydman, M., Harnik, R. , Patanjali, SR, Simmons, A., Clines, GA, Sartiel, A., Gatti, RA, Chessa, L., Sanal, O., Lavine, MF, Jaspers, NGJ, Taylor, MR, Arlett, CF, Miki , T., Weissman. S.M., Lovett, M., Collins, F.S. and Shiloh, Y. (1995). A single ataxia telangiectasia gene with a product similar to PI-3 kinase Science 286, 1749-1753.

Seaton, B. L., Yucel, J., Sunnerhagen P. and Subramani, S. (1992). Isolation and characterization of the Schizosaccharomyces pombe rad3 gene which is involved in the DNA damage and DNA synthesis checkpoints. Gene 119, 83-89.

Schu, P.V., Takegawa, K., Fry, M.J., Stack, J.H., Waterfield. M.D. and Emr, S.D. (1993) Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene essential for protein sorting. Science 260, 88-91.

Sheldrick, K.S. and Carr. A.M. (1993). Feedback controls and G2 checkpoints, fission yeast as a model system. BioEssays 15, 775-782.

Walworth. N., Davey, S. and Beach, D. (1993). Fission yeast chkl protein kinase links the rad checkpoint pathway to cdc2. Nature 363, 368-371.

Weinert, T.A., and Hartwell, L.H. (1988). The RAD9 gene controls the cell cycle response to DNA damage in Saccharomyces cerevisiae. Science 241, 317-322.

Weinert, T.A., Kiser, G.L. Hartwell, L.H. (1994). Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair. Genes Dev. 8, 652-665.

Claims (24)

1. The purified and isolated homologue (ATR) of the human rad3 polypeptide containing the amino acid sequence shown in SEQ ID NO: 2. 2. The purified and isolated polynucleotide encoding the homolog (ATR) of the human rad3 polypeptide having the nucleotide sequence corresponding to the amino acid sequence of the homologue (ATP) of the human rad3 polypeptide according to claim 1. 3. The purified and isolated polynucleotide encoding the homolog (ATR) of the human rad3 polypeptide, wherein the polypeptide is selected from the group consisting of: a) a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 1; and b) a polynucleotide that is at least 70% homologous to the polynucleotide in a) and which selectively hybridizes with the complement of polynucleotide a) under conditions involving a final wash at 55 ° C, and which encodes an ATR homolog having lipid kinase activity . 4. The purified and isolated homologue (ATR) of the human rad3 polypeptide, which is at least 70% homologous to the polypeptide containing the amino acid sequence shown in SEQ ID NO: 2, encoded by the polynucleotide of claim 3, or a fragment thereof, comprising lipid kinase domain, and this homolog has lipid kinase activity. 5. Expression vector of the homologue (ATR) of the human rad3 polypeptide containing the polynucleotide according to claim 3, operably linked to regulatory sequences. 6. A monoclonal antibody to the homologue (ATR) of the human rad3 polypeptide obtained by hybridoma technology using the polypeptide of claim 1 or 4 as immunogens, said antibody being capable of selectively binding to said polypeptide. 7. A polyclonal antibody to the homologue (ATR) of a human rad3 polypeptide obtained by inoculating an animal host with a polypeptide according to claim 1 or 4, wherein the antibody is capable of selectively binding to said polypeptide. 8. A method for detecting the presence of a polynucleotide according to claim 3 in a sample of a human or animal body, comprising the steps of: a) contacting a sample of a human or animal body containing DNA or RNA with a sample containing the polynucleotide according to claim 3 or a fragment thereof under hybridization conditions; b) detecting in the sample any duplex formed between the sample and the nucleic acid. 9. A method for detecting a polypeptide according to claim 4 in a biological sample, comprising the following steps: a) contacting the biological sample with the antibody according to claim 6 or 7 under conditions that allow the formation of an antibody-antigen complex; b) determining whether an antibody-antigen complex containing the antibody has been formed. 10. A test for screening candidate substances as anti-cancer agents, comprising the following steps: a) contacting the ATR polypeptide of claim 4 and a substrate for said polypeptide in the presence or absence of a candidate substance; b) identifying said candidate substance as an anti-cancer agent when detecting reduced activity of an ATR polypeptide on a substrate in the presence of a candidate substance compared to ATR activity in the absence of a candidate substance. 11. A test for screening candidate substances as anti-cancer agents, comprising the steps of: a) contacting the first polypeptide according to claim 4 with a second polypeptide capable of interacting with the ATR homolog, under conditions allowing the formation of a complex between the first and second polypeptides in the presence and absence of a candidate substance; wherein said second polypeptide is identical to or different from the first polypeptide; b) identifying the candidate substance as an anti-cancer agent, wherein reduced formation of complexes between the first polypeptide and the second polypeptide is detected in the presence of the candidate compound compared to complexing in the absence of the candidate substance. 12. The test according to claim 11, characterized in that said first polypeptide may differ from said second polypeptide. 13. The purified and isolated homolog (ATR) of the rad3 S. Pombe polypeptide containing the amino acid sequence shown in SEQ ID NO: 4. 14. The purified and isolated polynucleotide encoding the homolog (ATR) of the rad3 S. Pombe polypeptide having the nucleotide sequence corresponding to the amino acid sequence of the homologue (ATP) of the rad3 S. Pombe polypeptide according to item 13. 15. A purified and isolated polynucleotide encoding a homolog (ATR) of a rad3 S. Pombe polypeptide, said polynucleotide selected from the group consisting of a) a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 3; b) a polynucleotide that is at least 70% homologous to the polynucleotide in a) and which selectively hybridizes with the complement of polynucleotide a) under conditions involving a final wash at 55 ° C, and which encodes an ATR homolog having lipid kinase activity . 16. The purified and isolated homologue (ATR) of the rad3 S. Pombe polypeptide, which is at least 70% homologous to the polypeptide containing the amino acid sequence shown in SEQ ID NO: 4 encoded by the polynucleotide of claim 15, or a fragment thereof, containing a lipid kinase domain, wherein said homolog has lipid kinase activity. 17. Expression vector of the homologue (ATR) of the rad3 S. Pombe polypeptide containing the polynucleotide of claim 15, operably linked to regular sequences. 18. A monoclonal antibody to the homologue (ATR) of a rad3 S. Pombe polypeptide obtained by hybridoma technology using the polypeptide of claim 13 or 16 as immunogens, said antibody being capable of selectively binding to said polypeptide. 19. A polyclonal antibody to the homologue (ATR) of a rad 3 S. Pombe polypeptide obtained by inoculating an animal host with a polypeptide according to claim 13 or 16, wherein the antibody is capable of selectively binding to said polypeptide. 20. The method for detecting the presence of a polynucleotide according to claim 15 in a sample of a human or animal body, comprising the steps of: a) contacting a sample of a human or animal body containing DNA or RNA with a sample containing the polynucleotide of claim 15 or a fragment thereof under hybridization conditions; b) detecting in the sample any duplex formed between the sample and the nucleic acid. 21. The method for detecting the polypeptide according to clause 16 in a biological sample, the following stages: a) contacting the biological sample with an antibody according to claim 18 or 19 under conditions allowing the formation of an antibody-antigen complex; b) determining whether an antibody-antigen complex has been formed containing said antibody. 22. A test for screening candidate substances as anti-cancer agents, comprising the steps of: a) contacting the ATR polypeptide according to clause 16 with a substrate for the specified polypeptide in the presence and in the absence of a candidate substance; b) identifying said candidate substance as an anti-cancer agent when detecting reduced ATR polypeptide activity on a substrate in the presence of a candidate substance compared to ATR activity in the absence of a candidate substance. 23. A test for screening candidate substances as anti-cancer agents, comprising the steps of: a) contacting the first polypeptide according to clause 16 with a second polypeptide capable of interacting with the ATR homolog, under conditions that allow the formation of a complex between the first and second polypeptides, and in the presence and in the absence of a candidate substance, said second polypeptide being identical to or different from the first polypeptide From him; b) identifying a candidate substance as an anti-cancer agent, wherein a reduced complex formation between the first polypeptide and the second polypeptide is detected in the presence of the candidate substance compared to complexing in the absence of the candidate substance. 24. The test according to item 23, wherein the specified first polypeptide may differ from the specified second polypeptide.