RU2248983C1 - Peptide vector, method for its preparing, nucleotide sequence, recombinant plasmid dna and strain escherichia coli b-8389 vkpm for its preparing, method for genetic modification of mammalian and human cells - Google Patents

Abstract

FIELD: genetic and tissue engineering, biotechnology, medicine, agriculture.

SUBSTANCE: invention relates to the development of simple with constructive relation peptide vector (PGE-κ) consisting of polypeptide sequence of epidermal growth factor (EGF) and modified sequence of signal peptide T-antigen SV-40. New vector PGE-κ is able to provide the selective delivery of genetic material in target-cell cytoplasm carrying external receptors to EGF and the following its transport across nuclear membrane. Also, invention proposes a method for preparing peptide vector PGE-κ involving its expression as a fused protein "mutant thioredoxine-linker-vector" and cleavage of product expressed in E. coli in the linker region with specific protease. Invention provides preparing the recombinant strain E. coli B-8389 VKPM as a producer of the fused protein comprising PGE-κ. Proposed vector shows simple structure, absence of toxicity and immunogenicity and these properties provide its usefulness for the directed genetic modification of epithelial, embryonic and tumor cells in vivo.

EFFECT: improved preparing method, valuable medicinal properties of vector, improved genetic modification.

7 cl, 12 dwg, 4 tbl, 16 ex

Description

The group of inventions relates to genetic and tissue engineering and can be used in biotechnology, medicine and agriculture.

Currently, many practical problems associated with changing the properties of a living organism can be solved by the method of genetic modification. Such modification of target cells can be accomplished by ensuring the transport of exogenous genetic material through the cell membrane into the cell cytoplasm, followed by expression of the proteins encoded in the genetic material or with the subsequent interaction of the genetic material with intracellular biopolymers in order to directionally change the metabolism of the modified cells.

The common problem is the delivery of genetic material to certain tissues, organs, overcoming the plasma membrane of target cells and transport to a specific target inside the cell. It should be noted that since any genetic material is a potential mutagen, it is very important to prevent its entry into other cells of the body that do not need transformation.

Therefore, the urgent task remains to search for peptide vectors that are capable of providing selective transport of genetic material into the cytoplasm of target cells, as well as its subsequent transport into their nuclei, protecting genetic material from intracellular degradation, if possible. Of particular practical interest are fast-growing mammalian cells - epithelial, embryonic and tumor. Most of them carry receptors on the surface for a specific protein, epidermal growth factor (EGF). Therefore, transfer vectors of genetic material based on peptide sequences interacting with EGF receptors can be promising in terms of transformation of these cells.

The level of technical condition.

The simplest constructive example of a peptide vector for the genetic transformation of a cell carrying EGF receptors is a complex in which a sequence of epidermal growth factor that provides specific interaction with target cells is covalently linked to a polylysine binding site [1]. Using this vector, targeted delivery of genetic material to a mammalian cell expressing EGF receptors on its surface is carried out. However, the described vector and, accordingly, the method of genetic modification of the cell using it do not provide for the active transport of oligonucleotides into the cell nucleus, which may affect the preservation of exogenous genetic material inside the cell.

A peptide vector is known, comprising a TGF-alpha sequence that specifically interacts with EGF receptors; the domain of yeast transcription factor GAL4 as a DNA-binding region; and the translocation domain of Pseudomonas exotoxin A to protect the genetic material introduced into the cell from destruction in endosomes [2]. Partially solving the problem of the preservation of exogenous material in the cytoplasm, the proposed peptide vector is large and includes two proteins alien to the cell, which, when used in vivo, will result in an immune response. In addition, this vector, as discussed above, is used for the genetic modification of the target cell only in the form of a complex with poly-L-lysine, which has non-specific toxicity. Thus, the use of this vector in vivo seems unpromising.

Given these drawbacks, it seems logical that the peptide vectors improve on target cells of interest, which involves the use of special peptide sequences that combine the ability to bind oligonucleotides and provide their specific transport through the nuclear membrane, the so-called “nuclear localization signals” (NLS). An example of such a peptide is the signal sequence of the T-antigen SV-40. The fundamental possibility of genetic modification of vertebrate cells through targeted transport into the nucleus of exogenous genetic material previously introduced into the cytoplasm of the cell by microinjection has been shown [3]. However, numerous studies in this area have shown that the transport efficiency of a vector using NLS both for binding and for carrying oligonucleotides into the nucleus is doubtful or, in any case, not obvious a priori, since it is reliably known that the “conductive” properties of NLS are sharply weaken as part of a complex with genetic material. In order for such vector systems to have acceptable efficiency, the ratio of the vector to the oligonucleotide should, according to some estimates, be higher than 100: 1 [4], which results in not only an undesirable “load” of the cell with a foreign protein, but also the appearance of peptide-peptide interactions, which also reduce the "transport" activity of the vector.

Morris et al. ([5] - the closest analogue), a method for the genetic modification of human fibroblasts is proposed, which involves the use of a two-component peptide vector MPG, which provides targeted transport of genetic material to the target cell and further to its nucleus and consists of the nuclear localization signal of the large T-antigen SV-40 and peptide gp41 HIV-1. The main disadvantages of this vector and the method with its use include low selectivity with respect to target cells and insufficient efficiency of the transport of genetic material into the nucleus, an acceptable level of which (for the reasons mentioned above) is achieved only with the ratio of MPG peptide: oligonucleotide of at least 20 :1.

In this regard, the main objective of the present invention was the creation of a simple in design, effective peptide vector suitable (non-toxic and non-causing an immune response) for targeted genetic modification in vivo of cells carrying EGF receptors on their surface. In addition, given that the chemical synthesis of polypeptides does not always justify itself economically, as well as the fact that the task of postsynthetic folding remains unresolved, the goal of this work was to develop a genetic engineering method for obtaining significant quantities of such a vector with a properly formed conformation . In this case, the well-known method of expression of a foreign protein in E. coli was taken as a hybrid product in which it was fused with the residue of modified thioredoxin (Glu30His, Gln62His) [6]. Additional His residues allow the fusion protein to be isolated by metal chelate affinity chromatography.

Disclosure of the invention.

Based on the known results of developments in this field of research, it could be assumed that the solution to the problem of creating an effective two-component peptide vector suitable for genetic modification in vivo of cells actively expressing EGF receptors can be found on the way to search for optimal combinations (in terms of the nature of the amino acid sequence and its size) sequences based on NLS and sequences providing specific interaction with receptors of the target cell, Contents which would have a minimum level of non-specific interactions.

Such a combination of the components of the peptide vector was found and represented sequentially interconnected a modified sequence of the SV-40 T-antigen signal, consisting of 11 amino acid residues, and the amino acid sequence of a human epidermal growth factor of 53 amino acid residues. The result was a new peptide vector (of 64 amino acids) with SEQ ID No. 1, called PGE-k, which, when carrying out genetic transformation, ensures targeted delivery of genetic material to cells carrying EGF receptors, and its transport through the cell and nuclear membranes in a molar ratio of 3-10: 1 with an oligonucleotide. Thus, the present invention provides an increase in the selectivity and efficiency of the method of genetic modification of the target cells in question (technical result).

To obtain a new peptide vector, a method has been developed that provides for the expression in E. coli of a chimeric nucleotide sequence (SEQ ID No. 5) encoding a fusion protein (SEQ ID No. 4), consisting of a modified thioredoxin, PGE-k and combining their linker sequence, specifically cleaved enterokinase, as well as the recombinant plasmid (pGEK) and recombinant E. coli strain (BL21 (DE3) / pLysS / pGEK, deposited in VKPM under the number B-8389) necessary for its implementation.

Thus, the present invention includes the following objects.

The first object of the invention is the peptide vector PGE-k, which provides selective transport of exogenous genetic material into a mammalian cell carrying external receptors to the epidermal growth factor, and its subsequent entry into the nucleus of the indicated cell, with the amino acid sequence SEQ ID No. 1 consisting of an amino acid sequence derivative human epidermal growth factor (SEQ ID No. 2), which is the binding site to the external receptors of the named cell, and the signaling sequence of the SV-40 T antigen peptide (SEQ ID No. 3), which is responsible for binding exogenous genetic material and overcoming the nuclear envelope.

The second object of the invention relates to a nucleotide sequence encoding a fusion protein, which consists of a mutant form of thioredoxin (Glu30His, Gln62His), the linker sequence - (Gly-Ser) ₂ -Gly- (Asp) ₄ -Lys-, specifically cleavable by enterokinase, and the sequence peptide vector PGE-k and is characterized by the amino acid sequence of SEQ ID No. 4. Preferably, this nucleotide sequence is represented by SEQ ID No. 5.

The third object of the invention is a recombinant plasmid pGEK for expression of a fusion protein comprising the PGE-k peptide vector, which is characterized in that it has a size of 3691 bp and consists of

- NdeI / AatII fragment of the plasmid pGEMEX-1, having a size of 2347 bp and containing a replication initiation site (Ori) and an ampicillin resistance gene (Bla);

- AatII / HindIII fragment of plasmid pGEMEX-1, having a size of 755 bp and containing a second replication initiation site (f1Ori), and

- the nucleotide sequence of SEQ ID No. 5.

The fourth object of the claimed group is a strain of Escherichia coli VKPM B-8389 containing the plasmid pGEK and which is the producer of a fusion protein comprising the peptide vector PGE-k.

A fifth aspect of the invention relates to a method for producing a peptide vector, comprising:

- cultivation of a recombinant strain of E. coli VKPM B-8389 under conditions providing expression of a fusion protein comprising a peptide vector,

- hydrolysis of the resulting fusion protein with an enterokinase or other protease that recognizes the linker sequence included in it and specifically cleaves the peptide bond following the linker, and

- selection of the target product.

A sixth object of the claimed group is a method for the genetic modification of a mammalian cell carrying external receptors for epidermal growth factor, comprising contacting the named cell with exogenous genetic material in the presence of the PGE-k peptide vector.

Description of the drawings.

Figure 1 presents the physical and genetic map of the new recombinant plasmid pGEK.

Designations: Bla is the ampicillin resistance gene, f1ori is the site of replication of phage f1, T7p, T7t is the T7 polymerase promoter and terminator, and SP6p is the SP6 polymerase promoter.

Figure 2 presents the nucleotide sequence of the genes of thioredoxin (Glu30His, Gln62His), linker and epidermal growth factor, cloned into the plasmid pGEMEX-1 at the restriction sites Ndel (905) * and BamHI (42) *, where

- фрагменты последовательности pGEMEX-1 (Promega);

- fragments of the sequence pGEMEX-1 (Promega);

- последовательность гена тиоредоксина (Glu30His. Gln62His);

- the sequence of the thioredoxin gene (Glu30His. Gln62His);

- последовательность гена линкера состава -(Gly-Ser)₂-Gly-(Asp)₄-Lys-

- linker gene sequence of the composition - (Gly-Ser) ₂ -Gly- (Asp) ₄ -Lys-

- последовательность гена человеческого эпидермального фактора роста.

- the sequence of the human epidermal growth factor gene.

* location of the restriction site for the Promega catalog.

Figure 3 presents the design scheme of the plasmid pGEMEX-1 / Thio-hEGF.

Figure 4 presents the design scheme of the plasmid pGEK.

Figure 5 presents a diagram of the inclusion in the gene sequence of a hybrid protein of the formula SEQ ID No. 4 of the gene of the binding site with the transported exogenous genetic material of the formula SEQ ID No. 2.

Figure 6 presents the scheme of the introduction of point mutations using polymerase chain reaction.

Figure 7 presents the results of electrophoretic fractionation in 15% Tricin-PAAG purified new peptide vector PGE-k of the formula SEQ ID No. 1 in comparison with the recombinant peptide, human epidermal growth factor, where

1 - purified new peptide vector of the formula SEQ ID No. 1,

2 - control: recombinant peptide, human epidermal growth factor.

Fig. 8 shows an HPLC analysis of a purified new peptide vector of the formula SEQ ID No. 1. Diasorb C16T column, 4x250 mm (Elsika, Russia), linear MeCN gradient (5% to 95%, 45 min) in 0.01% aqueous CF ₃ COOH.

Figure 9 presents the mass spectrum (MALDI) of a new peptide vector of the formula SEQ ID No. 1.

Figure 10 presents microphotographs (1 - fluorescence, 2 - inversion) of tumor cells of the A-431 line after 18 hours of incubation with 5'-FITC-labeled phosphotioate oligonucleotide 2009F and with a mixture of it and a new peptide vector of the formula SEQ ID No. 1 in molar ratio 1:10.

Figure 11 presents fluorescence micrographs of tumor cells A-431 on the fifth day of incubation with plasmid pEGFP-N1 and with a mixture of it and a new peptide vector of the formula SEQ ID No. 1 in a molar ratio of 1:25.

12 shows the effect of mixtures of a new peptide vector of the formula SEQ ID No. 1 with AS-TMO-PO and AS-TMO-PS oligonucleotides on the survival of MCF-7 human breast carcinoma cells (5: 1 molar ratio of protein-oligonucleotide).

In adj. 1. The list of the claimed oligodeoxyribonucleotide and amino acid sequences.

In Tab. 1 is a list of synthesized oligonucleotides.

In Tab. Figure 2 shows the effect of the PGE-k vector on the delivery of fluorescein-labeled antisense thioligonucleotide to tumor cells.

In Tab. 3. The effect of the PGE-k vector on the delivery of a reporter plasmid to various tumor cells is shown.

In Tab. 4. shows the change in the cytostatic activity of the antisense AS-TMO and its thio-analog in relation to the culture of tumor cells under the influence of lipofectin and the vector PGE-k.

The following are examples of the invention.

Example 1 describes the chemical synthesis of primers and antisense oligonucleotides, including modified ones, as well as the method of enzymatic 5'-phosphorylation of DNA fragments.

Examples 2-5 describe the cloning of a thioredoxin gene and the preparation of the plasmid pBluescript II / Thio containing this gene. The source of chromosomal DNA was a strain of Escherichia coli TG1.

Cloning was performed using PCR based on a known nucleotide sequence. For amplification of the gene, a pair of Thio5 and Thio3 primers was used (note: synthetic oligodeoxyribonucleotides, hereinafter referred to as “oligonucleotides”; see Table 1), flanking the coding part of the thioredoxin gene with 5 ′ and 3 ’’ ends, respectively, were used. The nucleotide sequence of the primers included restriction sites necessary for subsequent cloning in the expression vector. Thio5 contained the Ndel restriction site, and Thio3 contained the Nael site.

DNA fragments obtained by PCR were fractionated on an agarose gel, isolated from agarose, phosphorylated using T4 phage polynucleotide kinase, subcloned into the pBluescript II SK (-) vector, and the plasmid pBluescript II / Thio was obtained.

In this and other examples, plasmids isolated from clones were sequenced within the insert using the Sanger method.

Example 6 describes, according to FIG. 3, the preparation of the plasmid pGEMEX-1 / hEGF containing the epidermal growth factor gene by subcloning this gene into a commercial plasmid, pGEMEX-1, at the EcoRI and BamHI restriction sites.

Example 7 describes, according to FIG. 3, the construction of the pGEMEX-1 / Thio plasmid containing the thioredoxin gene by cloning the thioredoxin gene from the pBluescript II / Thio plasmid into plasmid pGEMEX-1 at the Ndel and BamHI restriction sites.

Example 8 describes, according to FIG. 3, the preparation and cloning of the plasmid pGEMEX-1 / Thio-hEGF containing the gene of the fusion protein of the formula SEQ ID No. 4. The introduction of the linker was necessary for the targeted hydrolysis of the fusion protein of the formula SEQ ID No. 4 by site (Asp ) ₄ -Lys-Lys.

Example 9 describes the introduction of point mutations, Glu30His and Gln62His, into the thioredoxin gene.

It is known that the replacement of two residues in E. coli thioredoxin (Giu30 → His and Gln62 → His) allows one to isolate it and its derivatives by metal chelate affinity chromatography due to the binding of histidine residues to immobilized Ni ²⁺ or Cu ^{2+ ions} . The introduction of each of the mutations included three PCR according to the General scheme (Fig.6). As a result, the plasmid pHis-EGF containing the gene of the indicated fusion protein was obtained.

Example 10 describes the introduction into the composition of the plasmid pHis-EGF fragment encoding the binding site of the genetic material of the formula SEQ ID No. 2 according to Figure 4, 5. The fragment was introduced using two PCR with the participation of oligonucleotides With LINKER and N-EGF. As a result, the recombinant plasmid pGEK was obtained.

Examples 11, 12 describe the preparation and growth of a strain of Escherichia coli B-8389 VKPM, as well as the isolation of a fusion protein of the formula SEQ ID No. 4 using metal chelate and ion exchange chromatography. Fractions were analyzed by gel electrophoresis.

Example 13 describes the isolation and purification of a peptide vector of the formula SEQ ID No. 1. A fusion protein of the formula SEQ ID No. 4 was digested with a catalytic subunit of enterokinase at the (Asp) ₄ -Lys-Lys site. The resulting PGE-k peptide vector of the formula SEQ ID No. 1 was purified by ion exchange chromatography. The product is characterized by UV and mass spectra (Fig.9), electrophoresis in SDS page and HPLC (Fig.7, 8). A sequence of ten N-terminal amino acids (NH ₂ -Lys-Lys-Lys-Lys-Arg-Lys-Val-Glu-Asp-Pro-) was confirmed by amino acid analysis.

Examples 14-16 describe experiments to determine the effect of the PGE-k peptide vector on the delivery of plasmid DNA (Example 15) and antigens oligonucleotides (Example 14 and 16) to the culture of tumor cells.

The experiments used cell cultures characterized by a different number of surface EGF receptors: HeLa (human cervical carcinoma cells), MCF-7 (human breast adenocarcinoma cells), A431 (human vulvar epidermoid carcinoma cells), KB (human oral carcinoma cells ), K562 (human myeloid leukemia cells).

As a negative control, K562 cells were used, the surface of which practically does not carry EGF receptors, as well as the surface of somatic cells is normal. As a positive control, the results of the delivery of the same genetic constructs into cells by lipofection were considered.

The universality of the peptide vector of the formula SEQ ID No. 1 with respect to the structure of the delivered DNA molecules was confirmed in experiments with various oligonucleotides, including modified ones, and with plasmid DNA.

Examples 14 and 16 describe experiments on the efficient delivery of oligomers F2009 (antisense to the Bc12 gene of an apoptosis inhibitor), AS-TMO-PO (antisense to the RNA component of telomerase) and its phosphorothioate analogue AS-TMO-PS containing instead of bonds O-P (O) -O- bonds OP (S) -O-.

Similar data were obtained for oligonucleotides of a different structure, for example, antisense to the genes C-mus, mdr1, etc.

Example 14 shows experimental data on determining the effect of a peptide vector of the formula SEQ ID No. 1 on the efficiency of delivery to tumor cells A431 and K562 of a phosphorothioate antisense oligonucleotide 2009F bearing a 5'-fluorescein label (FITC) (see Figure 10 and Table 2 ) The properties of phosphorothioate oligonucleotides, in particular, high intracellular stability, allow us to reliably correlate the recorded fluorescence with the intracellular location of the oligomer, and not the products of its hydrolysis. From the data tab. 2 that the use of the peptide vector PGE-k led to a sharp, more than 5-fold, increase in the efficiency of 2009F delivery to A431 cells enriched with EGF receptors. At the same time, this peptide vector not only did not contribute, but even prevented 2009F from entering non-target K562 receptor-deficient cells, protecting them from the action of 2009F, which confirms the selectivity of PGE-k.

Example 15 describes an experiment for the delivery to HeLa and A431 cells of the plasmid pEGFP-N1 (Clontech, USA) containing the green fluorescent protein gene under the nuclear promoter (see Fig. 11, Table 3). Gene expression in such a construct reliably confirms the entry of a plasmid into the cell nucleus.

Delivery of pEGFP-N1 plasmid DNA preparation to HeLa, A431 and K562 culture cells by lipofection in all cases led to the transformation of more than 90% of the treated cells, i.e. such a number of cells expressed a reporter protein. Incubation of the cells of these cultures with a free plasmid did not lead to the formation of transformants. The cultivation of cell cultures under the same conditions, but with the addition of mixtures of pEGFP-N1 plasmid with a peptide vector of the formula SEQ ID No. 1, led to fluorescence of only those cells that carried surface EGF receptors (HeLa and A431). Data Tab. 3 show that the number of transformants depended on the nature of the cell culture and the molar ratio of the components of the mixture and was maximum for A431 culture cells enriched with EGF receptors and zero for K562 receptor-deficient cells.

On the whole, the results reliably indicate the selective delivery of plasmid DNA to the nuclei of cells carrying external receptors for epidermal growth factor.

Example 16 describes the determination of the effect of a peptide vector of the formula SEQ ID No. 1 on the cytostatic activity of AS-TMO-PO and AS-TMO-PS oligonucleotides in relation to the culture of tumor cells of the MCF-7 line. In the considered concentration range (up to 1000 nM), the oligonucleotides did not exhibit cytostatic activity. A fundamental difference in the effect on cell survival was observed upon delivery of oligomers into the cells by lipofection. The phosphorothioate antisense AS-TMO-PS was highly toxic (IC ₅₀ = 109 nM), and the phosphodiester AS-TMO-PO was non-toxic.

Incubation of cells with mixtures of these oligomers with PGE-k protein in a molar ratio of oligonucleotides - PGE-k 1: 5 led to the same IC ₅₀ values equal to 470 nM for both antisenses (see Fig. 12 and Table 4).

The data presented illustrate the ability of the new peptide vector not only to deliver oligonucleotides to target cells, but also to protect them from intracellular degradation. The peptide vector of the formula SEQ ID No. 1 makes it possible to use phosphorothioate antigens oligonucleotides and their natural analogues with equal efficiency.

From the data of Examples 14-16 it follows that the peptide vector PGE-k is inferior in activity to the known transfecting agent, lipofectin, by about 4 times. However, lipofectin acts non-selectively, regardless of the type of cell, and is capable of itself exhibiting a non-selective cytotoxic effect, violating the barrier properties of the outer cell membrane. Therefore, the new peptide vector of the formula SEQ ID No. 1 has an undeniable advantage over lipofectin due to the specificity of its action. In addition, the use of a new peptide vector of the formula SEQ ID No. 1 for the first time makes it possible to use phosphodiester antisense oligonucleotides in the practice of gene therapy instead of toxic and significantly more expensive thio-analogues.

Example 1. Synthesis and phosphorylation of primers.

Oligodeoxyribonucleotides, including primers (see Table 1), were synthesized by the solid-phase amidophosphite method on an AFM 2U automatic DNA synthesizer (Biosset, Russia) using commercial protected amidophosphite derivatives of nucleosides and fluorescein (FITC), nucleoside polymers and other reagents (Glen Research, USA). In the synthesis of the phosphorothioate oligonucleotide, AS-TMO-PS, instead of a standard oxidizing agent containing iodine and water, a 0.05 M solution of 3H-1,2-benzodithiol-3-one-1,1-dioxide (Glen Research, USA) in acetonitrile. The release and cleavage of the bond of the synthesized oligomer with the carrier was carried out by ammonolysis (28% ammonia, 5 hours, 50 ° C). The 5'-dimethoxytrityl derivatives of all oligonucleotides were purified by ion-pair reverse phase HPLC on a Diasorb C16T column, 4 × 250 mm (Elsika, Russia) in a linear MeCN gradient (from 12.5% to 45%, 30 min) at 0 , 1 M aqueous NEt ₃ -AcOH at 50 ° С, 80% aqueous AcOH was released and isolated as lithium salts. The synthesized oligonucleotides were characterized by UV spectrophotometry, laser desorption mass spectroscopy, and were analyzed by HPLC and PAGE.

5'-phosphorylation of oligonucleotides was performed using T4 phage polynucleotide kinase under standard conditions. 10 μl of the reaction mixture contained 20-40 pmoles of oligonucleotide, 1 μl of 10 × PNK buffer (NEB, USA): 500 mM Tris-HCI, 100 mM MgCl ₂ , 50 mM dithiothreitol, 1 mM spermidine, 1 mM EDTA, 2 μl of 5 mM rATP and 10 units of polynucleotide kinase. The reaction mixture was kept at 37 ° С for 1 h, then the enzyme was inactivated for 30 min at 70 ° С.

Example 2. Isolation of plasmid DNA from cells of E. coli strains.

Isolation of plasmid DNA from all E. coli strains was carried out according to the modified Birinboim & Doly method. Cells from 15 ml of overnight culture were pelleted by centrifugation and the pellet was resuspended in 1 ml of buffer (25 mM Tris-HCI, pH 8.0, glucose up to 50 mM, EDTA up to 10 mM, lysozyme up to 4 mg / ml). The cell suspension was incubated for 30 min at room temperature and 2 ml of 0.2 M NaOH containing 1% SDS was added. The mixture was kept in an ice bath for 5 minutes. Then, 1.5 ml of 3 M KOAc, pH 4.8 was added at 0 ° С, held for 30 min, and the precipitate was separated by centrifugation (30 min, 12000 g). 1/3 of a volume of 40% PEG 6000 was added to the supernatant, kept at 4 ° C for 30 minutes. The mixture was centrifuged (10 min, 12000 g), the precipitate was dissolved in 2 ml of buffer solution (20 mM Tris-HCl, 1 mM EDTA, pH 8.0), 4 ml of saturated NH ₄ OAc solution was added, kept for 15 min at 4 ° С . The precipitate was centrifuged (15 min, 12000 g), 4 ml of isopropanol was added to the supernatant, kept for 15 min at 4 ° С and centrifugation was repeated. The precipitate was washed with 70% ethanol and dried in vacuo.

Example 3. Isolation of chromosomal DNA from cells of E. coli strains.

1.5 ml overnight culture of Escherichia coli TG1 cells was centrifuged (12000 g, 3 min). Cells were resuspended in 600 μl of buffer (20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.5% CSN, 100 μg / ml proteinase K), incubated for 1 hour at 37 ° C. 100 μl of 5 M NaCl was added to the suspension, stirred and then 80 μl of 0.7 M NaCl containing 10% cetyltrimethylammonium bromide was added. The suspension was stirred and kept for 1 hour at 65 ° C. Sequentially was extracted with equal volumes of chloroform and a phenol / chloroform mixture, balanced in 0.2 M Tris. The aqueous phase was mixed with 0.6 volume iPrOH. DNA was precipitated by centrifugation (10 s, 12000g), washed with 70% EtOH and dried in a desiccator.

Example 4. Conditions for polymerase chain reactions (PCR).

4.1. Amplifications of the gene encoding thioredoxin.

The reaction mixture contained 10 ng of the chromosomal DNA of E. coli strain TG1 (see Example 3), 0.2 mM of each of dNTP, 1 μM of each of the primers, Thio5 and Thio3, and 1 unit of activity of thermostable Vent polymerase in 50 μl of buffer (20 mm Tris- HCl, pH 8.8, 2 mM MgS0 ₄ , 10 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 0.1% Triton X 100). On top of the reaction mixture was layered 25 μl of mineral oil ("USB", USA). The amplification cycle included DNA denaturation (96 ° C, 1 min), annealing (60 ° C, 1 min) and elongation (74 ° C, 30 s). A total of 35 reaction cycles were carried out on a Techne thermocycler (Germany). PCR products were electrophoretically separated in 1.7% agarose at an electric field of 12 V / cm and a fragment of 333 base pairs was isolated.

4.2. The remaining PCR.

The reaction mixtures contained 100 ng of plasmid DNA, 0.2 mM each of dNTP, 1 μM each of the primers and 1 unit of activity of thermostable Vent polymerase in 50 μl buffer (20 mM Tris-HCl, pH 8.8, 2 mM MgSO ₄ , 10 mM KCl , 10 mM (NH ₄ ) ₂ SO ₄ , 0.1% Triton X 100).

Example 5. Cloning of the thioredoxin gene and obtaining the plasmid pBluescript ll / Thio.

Plasmid pBluescript II SK ^- ("Stratogene", USA) was digested with Smal endonuclease. The hydrolyzate was treated with an equal volume of phenol / chloroform (1: 1), 1/10 volume of a 3 M AcONa solution, pH 6.0, and 3 volumes of ethanol were added to the aqueous phase, kept for 30 min at 4 ° С, centrifuged at 12000 g for 15 min. The precipitate was washed with 70% ethanol, dried, and dissolved in 40 μl of 10 mM Tris-HCI, pH 8.0. 5 μl of 10x CIAP buffer (0.5 M Tris-HCI, 10 mM MgCl ₂ , 1 mM ZnCl ₂ , 10 mM spermidine, pH 9.3), 5 μl phosphatase (0.1 units / μl) were added to the solution and incubated at 37 ° C in within 30 minutes 300 μl of a stop buffer (10 mM Tris-HCI, pH 7.5, 1 mM EDTA, 200 mM NaCl, 0.5% SDS) was added to the reaction mixture, then the solution was treated, the precipitate was precipitated and dried as described above for the hydrolyzate in this Example. 50 ng of the obtained product was mixed with 5 ng of a PCR product of 333 bp obtained in Example 4.1, and 5 units of T4 DNA ligase in 10 μl of 1x buffer (40 mm Tris-HCI, 10 mm MgCl ₂ , 10 mm dithiothreitol, 0, 5 mM ATP, pH 7.8). After incubation of the ligase mixture (16 ° C overnight), cells of strain E. coli XL-1 Blue (Stratogene, USA) were transformed with it at the rate of 10 ng plasmid DNA per 1.5 × 10 ⁷ cells (in 100 μl) and plated Petri dishes with agar medium containing 100 μg / ml ampicillin were incubated overnight at 37 ° C. 3 ml of YT medium (8 g / l tryptone, 5 g / l yeast extract, 5 g / l NaCl) containing 100 μg / ml ampicillin were inoculated in separate colonies and incubated overnight at 37 ° C and 260 vol. / min on a rocking chair "Certomat N"("B. Braun Melsungen", Germany). The plasmid DNA isolated from the transformed cells (as in Example 2) was sequenced within the insert according to the Sanger method using T7 and reverse primers. The constructed plasmid is called pBluescript ll / Thio.

Example 6. Subcloning of the hEGF gene in pGEMEX-1 vector.

Plasmid pGEMEX-1 was sequentially hydrolyzed with restriction enzymes EcoRI and WatHl, treating the hydrolyzate as in Example 5. The resulting product was dephosphorylated and processed as in Example 5. 50 ng of the obtained product was mixed with 5 ng of the hEGF gene [7] and ligated under the conditions of Example 5. Cells of E. coli strain XL-1 Blue were transformed with a ligase mixture under the conditions of Example 5. Cell growth, isolation of the obtained plasmid pGEMEX-1 / hEGF and confirmation of its structure were also carried out according to the procedure of Example 5.

Example 7. Obtaining the plasmid pGEMEX-1 / Thio.

Plasmid pGEMEX-1 was sequentially hydrolyzed with restriction enzymes Aatll and BamHI, treating the hydrolyzate as in Example 5 and isolating the Aatll / BamHI fragment (pGEMEX-1).

Similarly, the NdeI / AatII fragment (pGEMEX-1) was obtained and isolated from the same plasmid by the sequential action of NdeI and AatII restriction enzymes.

From the plasmid pBluescript II / Thio (Example 5) by the action of restriction enzymes NdeI and BamHI, a fragment of NdeII / BamHI (pBluescript II / Thio) was similarly obtained.

Dephosphorylation of the obtained fragments and their joint ligation with the formation of the plasmid pGEMEX-1 / Thio was carried out, as in Example 5.

Example 8. Obtaining plasmids pGEMEX-1 / Thio-hEGF

Plasmid pGEMEX-1 / hEGF (Example 7) was digested with restriction enzymes AatII and EcoRI, and plasmid pGEMEX-1 / Thio was digested with restriction enzymes AatII and TurboNael. Fragments of AatIIEcoRI (pGEMEX-1 / hEGF) and AatII / TurboNael (pGEMEX-1 / Thio) were combined with a linker, duplex of SpE1 and SpE2 oligonucleotides, and ligated as in Example 5. In Example 5, the E. coli strain XL1 was transformed with the reaction mixture. Blue and isolated plasmid DNA from transformants. The resulting plasmids were analyzed by restriction enzymes TurboNael and EcoRI, then the DNA of the selected clones was sequenced by the Sanger method. The resulting vector is called pGEMEX-1 / Thio-hEGF.

Example 9. Obtaining plasmids pHis-hEGF.

9.1.

Under the conditions of Example 4.2 (annealing temperature of the primers 36 ° C), 20 PCR cycles were performed on the plasmid pGEMEX-1 / Thio-hEGF (Example 8) with primers E30R and SP6. PCR products were electrophoretically separated, as in Example 4.1, and a 487 base pair fragment was isolated.

9.2.

PCR on the plasmid pGEMEX-1 / Thio-hEGF with primers E30L and T7 and the separation of PCR products was carried out under the conditions of Example 9.1. A fragment of 178 base pairs was isolated.

PCR 9.3.

The reaction mixture contained 40 ng of PCR product 9.2 and 20 ng of PCR product 9.1. Primers were annealed at 28 ° С for 1 min. A total of 30 cycles of PCR were performed. Other conditions for the PCR - as in Example 9.1. Processing of the reaction mixture and manipulation of the PCR product was carried out as in Example 5.

9.4. Introduction of mutations Glu30His and Gln62His into the gene of thioredoxin E. coli.

According to the scheme (Fig.6) consistently carried out 2 mutations. Under the conditions of Example 9.1, PCR was performed on the DNA from Example 9.3 with mutagenic primers Q62R and Q62L and flanking primers T7 and SP6. The mutation product processed and isolated as in Example 9.1 was subjected to Glu30His mutation with other mutagenic primers, E30L and E30R under PCR conditions and isolation of the mutation product of Example 9.1. The product of the last PCR was digested with restriction enzymes Ndel and HindIII, the resulting DNA fragment 557 base pairs long was isolated and cloned into the pGEMEX-1 vector as described in Example 5. The resulting plasmid was called pHis-hEGF.

Example 10. Obtaining recombinant plasmids pGEK.

10.1.

24 cycles of PCR were performed with a mixture of the plasmid pHis-hEGF (Example 9.4), T7 primer and phosphorylated C-LINKER under the conditions of Example 4.2. Temperature: denaturation of DNA-1 min at 96 ° C, annealing of the primer -1 min at 49 ° C, DNA synthesis -1 min at 74 ° C.

10.2.

Under the same conditions, PCR was performed with a mixture of plasmid pHis-hEGF, primer SP6 and phosphorylated N-EGF.

10.3.

PCR products 10.1 and 10.2 of length 460 and 238 were isolated by electrophoresis, as in Example 4.1, and were hydrolyzed by Clon and Hindlll endonucleases, respectively. Hydrolysis products 278 and 210 bp in length respectively, again isolated by electrophoresis. The plasmid pHis-hEGF was sequentially hydrolyzed with CpoI and HindIII endonucleases and isolated CpoI / HindIII (pHis-hEGF) as in Example 5. CpoI / HindIII (pHis-hEGF) was dephosphorylated under the conditions of Example 5. Dephosphorylated CpoI / HindIII (pHis-hEGF) with hydrolyzed PCR products 10.1 and 10.2, they were ligated, the ligation product was isolated, it was cloned into E. coli XL-1 Blue, transformants were grown and plasmid DNA was isolated from them, as in Example 5. The selected clones were sequenced within the insert using the Sanger method. The resulting expression construct was called the “recombinant plasmid pGEK”.

Example 11. Transformation of the strain Escherichia coli BL21 (DE3) pLysS and growing a new strain of Escherichia coli B-8389 VKPM.

Cells of E. coli strain BL21 (DE3) pLysS (Novagen, Inc., Cat # 69388-3, Madison, New Jersey, 53711, USA) were transformed with pGEK plasmid at the rate of 10 ng pGEK per 1 - 5 × 10 ⁷ cells according to the method of Example 5 to obtain the target new strain of Escherichia coli BL2l (DE3) / pLysS / pGEK (No. B-8389 VKPM). The culture was then plated on Petri dishes with agar medium containing 100 μg / ml ampicillin and 34 μg / ml chloramphenicol, and incubated overnight at 37 ° C. Separate colonies (about 100 pcs.) Were collected with a glass rod and suspended in 100 ml of TB medium (12 g / l tryptone, 24 g / l yeast extract, 0.04% glycerol, 1/10 volume of phosphate buffer (0.17 M KN) ₂ PO ₄ , 0.72 M K ₂ HPO ₄ )). The culture was grown in the presence of 100 μg / ml ampicillin and 34 mg / ml chloramphenicol at 30 ° C and 260 rpm. on a rocking chair "Certomat N"("B. Braun Melsungen", Germany) until the culture reaches an optical density of OD ₅₅₀ = 2.0 p.u. Then, isopropyl-β-D-thiogalactoside was added to a final concentration of 0.05 mM and incubation was continued at 13 ° C and 260 rpm for 24 hours.

The new strain contains 300-400 copies of the recombinant plasmid pGEK, this number is maintained stably for at least 8 generations.

Strain E. coli BL2l (DE3) / pLysS / pGEK synthesizes the TrxA-EGF-NLS fusion protein of the formula SEQ ID No. 4 in an amount of 300 mg per 1 liter of culture fluid at a density corresponding to 4 × 10 ⁹ cells / ml.

Stability: F-, ompT, hsdS _B (r _B -, m _B -), dcm, gal, λ (DE3), plysED, Cm ^R Amp ^R. The concentration of ampicillin is 100 μg / ml, chloramphenicol - 25 μg / ml.

The strain is not zoopatogenic and phytopathogenic.

Example 12. Isolation of a TrxA-EGF-NLS fusion protein of the formula SEQ ID No. 4.

The resulting cell culture of Escherichia coli B-8389 VKPM was centrifuged (2500 g, 1 hour). Cells were resuspended in 50 ml of buffer: 100 mM Tris-HCl + phenylmethylsulfonyl fluoride to 0.1 mM, pH 8.0 and sonicated on a UZDN-2T disintegrator (7-10 times for 30 s at t ° not higher than 10 ° C). An equal volume of 0.3 M NaCl was added and mixed, centrifuged at 9000 g for 1 h. The supernatant was applied to a column (25 × 100 mm, Chelatlng-Sepharose (Ni2 +) (Pharmacia, Sweden)). The column was washed with buffer: 50 mM Tris-HCl, pH 8.0, 0.15 M NaCl, then with buffer: 50 mM Tris-HCl, pH 8.0.1 M NaCl, and again with the previous buffer, each time ensuring the absence of eluate absorption at λ = 280 nm. The obtained target product, a fusion protein of the formula SEQ ID No. 4, was washed with buffer: 50 mM Tris-HCI, pH 8.0, 0.25 M NaCI, 0.1 M imidazole. The eluate was dialyzed (4 ° C, Spectra / Por 10000 membrane): twice against 50 mM Tris-HCl, pH 8.0, 8-12 h, 1 time against buffer: 50 mM Tris-HCl, 1 mM CuSO ₄ , pH 8.0, 24 -36 h and twice against 20 mM Tris-HCl, pH 7.6, 8-12 h. Dialysate was applied to a MonoQ HR10 / 10 column (Pharmacia, Sweden), equilibrated with the last buffer. A fusion protein of the formula SEQ ID No. 4 was washed with a linear NaCI gradient (0.1 M-0.5 M) in the same buffer. Fractions were analyzed by gel electrophoresis and combined those that contained the largest amount of the target fusion protein (molecular weight 20 kDa).

Example 13. Isolation and purification of the peptide vector PGE-k of the formula SEQ ID No. 1.

1/16 volume of enterokinase buffer: 0.5 M Tris-HCI, 0.01 M CaCl ₂ , was added to the obtained fusion protein preparation of the formula SEQ ID No. 4, desalted using an Ultrafree-15 device (Biomax-5K) (Millipore) 1% tween 20, pH 8.0, and enterokinase EKmax ("Invitrogen", USA) at the rate of 1 unit. enzyme per 3 mg of fusion protein, incubated for 20 hours (37 ° C). The hydrolysis products were fractionated on a MonoQ HR10 / 10 column and analyzed (as described in Example 10). The yield of the pure PGE-k peptide vector of the formula SEQ ID No. 1 was 1.8-2.2 mg. m / e [M.w.-H] 7620.8 (Fig. 9).

Example 14. Determination of the effect of the peptide vector PGE-k on the delivery of 5'-fluorescein-labeled thio-oligonucleotide 2009F to tumor cell cultures.

HeLa, MCF-7, A431, and KB tumor cells were cultured in plastic culture bottles (Costar, UK) in DMEM medium (Gibco, USA) containing 10% fetal bovine serum (Gibco) and 50 μg / ml gentamicin (Sigma, USA) at 37 ° C in a humidified atmosphere containing 5% CO ₂ . K562 cells were cultured under the same conditions, but using RPMI 1640 medium (Gibco, USA). Cell cultures were scattered 2 times a week and plated in 12-well plates on coverslips or directly in the wells one day before the experiment.

Transfection of A431 and K562 cells was performed with solutions of the thio-5'-FITS oligonucleotide 2009 F in the presence of various PGE-k. For the preparation of transfection mixtures in the ratios of the components given in Table. 2, a PGE-k solution (40 μM, in 50 mM Tris-HCl, 0.17 M NaCl, pH 8) and a 50 mM 2009 F solution in water were used. In all experiments, the concentration of the oligonucleotide during incubation was 200 nM. After 18 hours, the culture medium was removed, the glass with the cells was washed twice with phosphate-buffered saline (PBS), the cells were fixed with 4% paraformaldehyde in PBS, enclosed in moviol, and fluorescence was examined using a fluorescence microscope. For flow cytofluorimetry (EPICS C cytofluorimeter, Coulter, Germany), after incubation, the cells were removed from plastic using a solution of 0.05% trypsin in Versen's solution (Sigma, USA), washed with PBS and fixed with 2% paraformaldehyde. To excite fluorescence, an argon laser (Coherent, USA) with a wavelength of 488 nm was used. For microphotographs of cells hereinafter, an Nikon inverted microscope (Japan) and an Opton fluorescence microscope (Germany) were used (Figure 10). The results of the experiments are given in Table. 2. They show that the addition of the PGE-k peptide vector to the fluorescein-labeled thio antisense increases the fluorescence intensity of receptor-enriched cells several times and, consequently, increases the amount of thio antisense delivered to the cells. In K562 receptor-deficient cells, in contrast, when PGE-k is added, the fluorescence intensity decreases.

Example 15. Determination of the effect of the peptide vector PGE-k on the delivery of plasmid DNA into tumor cell cultures.

Transfection of HeLa, A431, and K562 cell cultures prepared as described in Example 14 was carried out with solutions of plasmid pEGFP-N1 (Clontech) in water in the presence of various amounts of PGE-k (Table 3). Before transfection, the cells were washed with serum-free DMEM, 2 ml of fresh DMEM was added and incubated for 2 hours. 15 minutes before transfection, the medium was changed to fresh and chlorokine (Sigma) was added at a concentration of 25 μM.

For the preparation of transfection mixtures with the ratio of components shown in Table. 3, we used solutions of the pEGFP-N1 plasmid (78 nM, ~ 220 μg / ml) in water and a solution of the PGE-k peptide vector (40 μM, in 50 mM Tris-HCl 0.17M NaCl, pH8). The mixture did not lose transfection properties, at least for a week. The solutions were added to the cells at the rate of 1 μg plasmid / ml culture for 24 hours, after which the medium was changed to standard DMEM medium and incubated for 24-96 hours. Then, fluorescence of transfected cells was examined, as in Example 14. Transfection of HeLa, A431 and K562 cells with plasmid using lipofectin (InvitroGen, USA) was carried out in accordance with the manufacturer's protocol. The experimental data shown in Table. 3 show that the free plasmid pEGFP-N1 does not transfect tumor cells. In the presence of a peptide vector of the formula SEQ ID No. 1, transfection of only HeLa and A431 receptor-enriched cells occurs.

Example 16. Determination of the effect of the peptide vector PGE-k on the cytostatic activity of AS-TMO-PO and AS-TMO-PS oligonucleotides against tumor cells.

MCF-7 human breast adenocarcinoma cells prepared as described in Example 14 were treated with aqueous solutions: AS-TMO-PO oligonucleotide, AS-TMO-PS oligonucleotide (AS-TMO-PO thio analogue), or mixtures of these oligonucleotides with a new peptide vector PGE-k in molar ratios of 1: 5 in the concentration range of 1 × 10 ^-9 -1 × 10 ^-6 M oligonucleotide. Cells were incubated for 120 hours under the conditions of Example 14. Their survival was determined using the MTT test and evaluated as a percentage of the corresponding blank control. Transfection with oligonucleotides using lipofectin (InvitroGen, USA) was carried out in accordance with the manufacturer's protocol. The values of the indicator of cytostatic activity of IC ₅₀ for these oligonucleotides and their mixtures with the peptide vector PGE-k against tumor cells MCF-7 are shown in Table. 4. The results show that AS-TMO-PO does not show such activity either in free form or in the presence of lipofectin. In the presence of a peptide vector of the formula SEQ ID No. 1, both antisens exhibit approximately the same cytostatic activity.

Literature

1. Cristano R.J., Roth J.A. EGF-targeted nucleic acid delivery // Pat. US No. WO 96/30536, issued October 3, 1996.

2. Fominaya J., Uherek S., Wels W. A chimeric fusion protein containing transforming growth factor-alpha mediates gene transfer via binding to the EGF receptor // Gene Ther. 1998. V.5. No. 4. P.521-30.

3. Collas P., Alestrom P. Nuclear localization signals: a driving force for nuclear transport of plasmid DNA in zebrafish // Biochem. Cell. Biol. 1997. V. 75. P.633-640.

4. Siebenkotten G., Christine R. Cellular transport system for the transfer of a nucleic acid through the nuclear envelope and methods thereof // Pat. US No. WO 00/40742. Issued February 18, 2003.

5. Morris M.C., Vidal P., Chaloin L, Heitz F., Divita G. A new peptide vector for efficient delivery of oligonucleotides into mammalian cells // Nucleic Acids Res. 1997. V.25. No. 14. R. 2730-2736.

6. Lu Zh., DiBlasio-Smith E.A., Grant K.L., Warne N.W., LaVallie E.R., Collins-Racie L.A., Follettie M.T., Williamson M.J., McCoy J.M. Histidine Patch Thioredoxins. Mutant forms of thioredoxin with metal chelating affinity that provide for convenient purifications of thioredoxin fusion proteins // J. Biol. Chem. 1996. V.271. No. 9. P.5059-5065.

7. Eldarov M.A., Kagiyants S.M., Pozmogova G.E., Lutsenko S.V., Severin E.S., Kirpichnikov M.P., Skryabin K.G. The yeast strain S. cerevisiae BKM CR-349D - producer of human epidermal growth factor // RF Patent 1999. No. 21505001 issued June 10, 2000.

Appendix 1. The list of oligodeoxyribonucleotide and amino acid sequences.

SEQ ID No. 1 - amino acid sequence of the claimed peptide vector PGE-k:

NH ₂ -Lys-Lys-Lys-Lys-Arg-Lys-Val-Glu-Asp-Pro-Tyr-Asn-Ser-Asp-Ser-Glu-Cys-Pro-Leu-Ser-His-Asp-Gly-Tyr -Cys-Leu-His-Asp-Gly-Val-Cys-Met-Tyr-lle-Glu-Ala-Leu-Asp-Lys-Tyr-Ala-Cys-Asn-Cys-Val-Val-Gly-Tyr-lle -Gly-Glu-Arg-Cys-Gln-Tyr-Arg-Asp-Leu-Lys-Trp-Trp-Glu-Leu-Arg-COOH

SEQ ID No. 2 - amino acid sequence of the residue of the peptide of human epidermal growth factor:

-Asn-Ser-Asp-Ser-Glu-Cys-Pro-Leu-Ser-His-Asp-Gly-Tyr-Cys-Leu-His-Asp-Gly-Val-Cys-Met-Tyr-lle-Glu-Ala -Leu-Asp-Lys-Tyr-Ala-Cys-Asn-Cys-Val-Val-Gly-Tyr-lle-Gly-Glu-Arg-Cys-Gln-Tyr-Arg-Asp-Leu-Lys-Trp-Trp -Glu-Leu-Arg-COOH

SEQ ID No. 3 - amino acid sequence of the binding site with the transported exogenous genetic material:

NH ₂ -Lys-Lys-Lys-Lys-Arg-Lys-Val-Glu-Asp-Pro-Tyr-

SEQ ID No. 4 - amino acid sequence of the fused protein:

NH ₂ -XY-Lys-Lys-Lys-Lys-Arg-Lys-Val-Glu-Asp-Pro-Tyr-Asn-Ser-Asp-Ser-Glu-Cys-Pro-Leu-Ser-His-Asp-Gly -Tyr-Cys-Leu-His-Asp-Gly-Val-Cys-Met-Tyr-lle-Glu-Ala-Leu-Asp-Lys-Tyr-Ala-Cys-Asn-Cys-Val-Val-Gly-Tyr -lle-Gly-Glu-Arg-Cys-Gln-Tyr-Arg-Asp-Leu-Lys-Trp-Trp-Glu-Leu-Arg-COOH, where "X" is the thioredoxin residue with mutations Glu30His, Gln62His, "Y "- linker - (Gly-Ser) ₂ -Gly- (Asp) ₄ -Lys-

SEQ ID No. 5 is the nucleotide sequence encoding a fusion protein of the formula SEQ ID No. 4:

5'-ATGAGCGATAAAATTATTCACCTGACTGACGACAGTTTTGACACGGATGTACTCAAAGCGGACGGGGCGATCCTCGTCGATTTCTGGGCACACTGGTGCGGTCCGTGCAAAATGATCGCCCCGATTCTGGATGAAATCGCTGACGAATATCAGGGCAAACTGACCGTTGCAAAACTGAACATCGATCATAACCCTGGCACTGCGCCGAAATATGGCATCCGTGGTATCCCGACTCTGCTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGTCAGTTGAAAGAGTTCCTCGACGCTAACCTGGCCGGCTCTGGTTCTGGTGATGACGATGACAAGAAAAAAAAGAAACGTAAAGTTGAGGATCCGTACAATTCTGACTCTGAATGCCCATTGTCTCACGACGGTTACTGCTTGCACGACGGTGTTTGCATGTACATCGAAGCTCTGGACAAATACGCTTGCAACTGCGTTGTTGGTTACATCGGTGAACGTTGCCAATACCGAGATCTGAAATGGTGGGAACTGCGTTGA-3 '

Table 1 List of oligodeoxyribonucleotides used. The name of the oligonucleotide Nucleotide sequence C-linker 5’-CTCAACTTTACGTTTCTTTTTTTTTCTTGTCATCGTCATCACC-3 ' E30l 5'-CACCAGTGTGCCCAGAAATCGAC-3 ' E30r 5'-GGGCACACTGGTGCGGTCCGTG-3 ' N-egf 5'-GATCCGTACAATTCTGACTCTGAATGC-3 ' Q62L 5’-CAGGGTTATGATCGATGTTCAG-3 ' Q62R 5'-CGATCATAACCCTGGCACTG-3 ' SP6 5’-TATTTAGGTGACACTATAG-3 ' SpE1 5'-GGCTCTGGTTCTGGTGATGACGATGACAAG-3 ' SpE2 5’-AATTCTTGTCATCGTCATCACCAGAACCAGAGCC-3 ' T7 5’-TAATACGACTCACTATAGGG-3 ' Thio3 5’-GCCGGCCAGGTTAGCGTCGAGG-3 ' Thio5 5'-CATATGAGCGATAAAATTATTCACC-3 ' AS-TMO-PO 5'-TTAGGGTTAGGGTTAGGGTTAGGG-3 ' AS-TMO-PS Thio-5'-TTAGGGTTAGGGTTAGGGTTAGGG-3 ' 2009F Thio-5'-Fitc-AATCCTCCCCCAGTTCACCC-3 ' table 2 The effect of the PGE-k vector of the formula SEQ ID No. 1 on the delivery of thio-5'-fluorescein-labeled antisense oligonucleotide 2009F to A431 and K562 cells. Cell Line Added Ratio Fluorescence intensity, cu, average % cells Relation to fluorescence intensity. 2009F A431 0 3.83 0.6 2009F 17,2 97.1 PGEk: 2009F 3: 1 47.1 99.8 3.2 PGEk: 2009F 5: 1 64,4 99.9 4,5 PGEk: 2009F 10: 1 73.6 100 5.2 K562 0 5.07 0.25 2009F 54,4 96.8 PGEk: 2009F 10: 1 47.9 95.7 0.87

Table 3 The effect of the PGE-k vector of the formula SEQ ID No. 1 on the delivery of the reporter plasmid pEGFP-N1 to HeLa tumor cells. Added Ratio, % fluorescent cells mol / mol Cell culture Hela A431 K562 PEGFP-N1 Lipofectin 85-90 85-95 85-90 PEGFP-N1 0 0 0 PEGFP-N1: PGE-k 1: 1 0 0 0 PEGFP-N1: PGE-k 1: 8 20-30 25-35 0 PEGFP-N1: PGE-k 1:16 20-30 40-45 0 PEGFP-N1: PGE-k 1:25 40-46 50-56 0 PEGFP-N1: PGE-k 1:32 20-30 40-45 0 PEGFP-N1: PGE-k 1:64 - 5000 0 0 0 Table 4 Determination of the cytostatic activity of oligonucleotides AS-TMO-PO and AS-TMO-PS in relation to the culture of tumor cells of the MCF-7 line. Added IC ₅₀ AS-TMO-PO, nM IC ₅₀ AS-TMO-PS, nM 0 not found (> 1000) not found (> 1000) Lipofectin not found (> 1000) 109 PGE-k, in a molar ratio of oligonucleotide protein of 1: 5 ~ 470 ~ 470

Claims (7)

1. The peptide vector PGE-k, providing selective transport of exogenous genetic material into a living cell, mammals and humans, carrying external receptors for epidermal growth factor, and the subsequent entry of the material into the nucleus of the specified cell, with the amino acid sequence SEQ ID No. 1, consisting of the amino acid the sequence of human epidermal growth factor (SEQ ID No. 2), which is the binding site to the external receptors of the named cell, and a modified signal sequence peptide T-antigen SV-40 (SEQ ID No. 3), which is responsible for the binding of exogenous genetic material and overcoming the nuclear membrane of the specified cell. 2. The nucleotide sequence encoding a fusion protein, which consists of a mutant thioredoxin (Glu30His, Gln62His), a linker sequence - (Gly-Ser) 2-Gly- (Asp) 4-Lys-, specifically cleaved by enterokinase, and the peptide vector according to claim 1, and is characterized by the amino acid sequence of SEQ ID No. 4. 3. The nucleotide sequence according to claim 2, characterized in that it is SEQ ID No. 5. 4. Recombinant plasmid pGEK for expression of a fusion protein comprising the peptide vector according to claim 1, which is characterized in that it has a size of 3691 bp and consists of: - NdeI / AatII fragment of the plasmid pGEMEX-1, having a size of 2347 bp and comprising an Ori replication initiation site and an ampicillin Bla resistance gene; - AatII / HindIII fragment of plasmid pGEMEX-1, having a size of 755 bp and containing flOri, - the nucleotide sequence according to claim 3. 5. The strain Escherichia coli B-8389 VKPM containing the recombinant plasmid pGEK is a producer of a fusion protein comprising a peptide vector that provides selective transport of exogenous genetic material into a mammalian and human cell. 6. A method of obtaining a peptide vector, comprising: - culturing the transgenic strain according to claim 5 under conditions ensuring the expression of a fusion protein comprising a peptide vector; - isolation and subsequent hydrolysis of the fused protein with an enterokinase or other protease that recognizes the linker sequence included in it and specifically cleaves the peptide bond following the linker, and - selection of the target product. 7. A method for the genetic modification of a living mammalian cell and human carrying external receptors for epidermal growth factor, comprising contacting the named cell with exogenous genetic material in the presence of a peptide vector consisting of a sequence that provides selective transport of exogenous genetic material to the target cell and through its cellular a membrane and a derivative of a nuclear localization signal sequence, characterized in that the peptide vector according to claim 1 is used.

Images