RU2244750C2 - Diagnostic basis for detection of mutation of fungal cytochrome b - Google Patents

Abstract

FIELD: biotechnology, genetics.

SUBSTANCE: invention relates to methods used for detecting low frequency mutations occurrence in gene encoding cytochrome b. Method involves isolation of DNA from known fungi for constructing oligonucleotide probe or primer. Then polymerase chain reaction (PCR) is carried out for assay of binding the nucleotide probe with amplicon generated by this reaction, or the presence of amplicon is detected that is generated as result of PCR using indicated primers. Invention provides rapid and precise detection of mutations conferring resistance of fungus against fungicide.

EFFECT: improved diagnostic methods for detecting mutations.

24 cl, 18 dwg, 14 tbl, 18 ex

Description

Field of Invention

This invention relates to a diagnostic method for detecting a cytochrome b mutation in fungi that leads to resistance to strobilurin analogs or compounds in the same cross-resistance group using a method for detecting polymorphism of any (or one) single nucleotide, preferably using a refractory amplification system (sustainable) mutations (ARMS). This invention also relates to specific primers with mutations for use in this method and to diagnostic kits containing these primers. In addition, this invention relates to the identification of a specific mutation in the cytochrome b gene of fungi, which leads to the resistance of fungi containing the specified mutation to strobilurin analogs or compounds in the same cross-resistance group.

BACKGROUND OF THE INVENTION

The widespread use of fungicides in agriculture is a relatively recent phenomenon, and most of the major developments have taken place during the past 40 years. Previously, farmers often ignored or did not recognize the effect that fungal pathogens have on the crop and the quality of their crops. However, these losses are currently unacceptable, and farmers rely on the use of fungicidal chemicals to control fungal diseases. As a result, commercial fungicides have become an important component of general agrochemical practice with worldwide sales of around $ 5.9 billion in 1996, equivalent to 18.9% of the total agrochemical market (Wood Mackenzie, 1997a 'Agcheiu products - The key agrochemical product groups' , in Agrochemical Service, Update of the Products Section, May 1997, 1-74). A large number of fungicides are already available to the farmer; a recent edition of The Pesticide Manual (Tomlin, 1994 10 ^{th Edition, British Crop Protection Council,} Farnham, UK, and the Royal Society of Chemistry, Cambridge, UK) contains 158 different fungicidal active ingredients for use in the present time. Nevertheless, further industrial research aimed at the discovery and development of new compounds is extremely intensive and product control procedures are extremely important in guaranteeing the best and longest performance from the use of fungicides with a specific mode of action and / or belonging to a specific series of compounds. In particular, it is vital to develop strategies to combat resistance when fungicides are introduced with new mechanisms of action (Fungicide Resistance Management: Into The Next Millenium (Russel) 1999, in Pesticide Outlook, October 1999 (213-215).

Strobilurin analogues form the main new series of agricultural fungicides, which are considered the most exciting development on the stage of agricultural fungicides since the discovery of 1,2,4-triazoles in the 1970s.

The fungicidal activity of strobilurin analogues is the result of their ability to inhibit mitochondrial respiration in fungi. More specifically, it was found that these compounds have a new one-site mode of action, exerting their effect on fungi by blocking the ubiquinol complex: cytochrome c-oxidoreductase (cytochrome bc1), thereby reducing the generation of energy-rich ATP in a fungal cell (Becker et al. FEBS Letts. 132: 329-33). This family of inhibitors prevents electron transport at the redox site of ubiquinone Q ₀ on the multimeric cytochrome b protein (Esposti et al. 1993 Biochem. Et Biophys. Acta 243-271). In contrast to many mitochondrial proteins, cytochrome b protein is mitochondria-encoded.

Reports in the literature show that specific amino acid substitutions at the target site of cytochrome b can affect the activity of strobilurin analogues. In-depth studies of mutagenesis were performed on Saccharomyces cerevisiae (hereinafter referred to as S. cerevisiae) (JP Rago et al. 1989 J. Biol. Chem. 264, 14543-14548), mice (Howell et al. 1988 J. Mol. Biol. 203, 607 -618), Chlamydomonas reinhardtii (Bennoun et al. 1991 Genetics 127, 335-343) and Rhodobacter spp (Daldal et al., 1989, EMBO J. 3951-3961). Information related to this problem was also collected from a study of the natural basis for resistance to strobilurin analogues in the sea urchin Paracentrotus lividus (Esposti et al., 1990, FEBS 263, 245-247) and fungi of the family of basidiomycetes Mycena galopoda and Strobilurus tenacellus (Kraiczy et al ., 1996 Eur. J. Biochem. 235, 54-63), which produce natural variants of strobilurin analogues. There are two distinct regions of the cytochrome b gene, where amino acid substitutions have a dramatic effect on the activity of strobilurin analogues. These zones cover amino acid residues 125-148 and 250-295 (based on the numbering system of S. cerevisiae residues). It has been shown more precisely that amino acid substitutions of residues 126, 129, 132, 133, 137, 142, 143, 147, 148, 256, 275 and 295 lead to resistance to strobilurin analogs (Brasseur et al., 1996, Biochim. Biophys Acta, 1275, 61-69 and Esposti et al. (1993), Biochimica et Biophysica Acta, 1143, 243-271).

This invention identifies for the first time the key importance of one of these mutations in the cytochrome b gene of field isolates of important phytopathogenic fungi that show resistance to a strobilurin analog or compound in the same cross-resistance group.

SUMMARY OF THE INVENTION

According to a first aspect of the present invention, the inventors provide a method for detecting a mutation in a fungal nucleic acid, wherein the presence of said mutation causes the appearance of fungal resistance to a strobilurin analog or any other compound in the same cross-resistance group, said method comprising identifying the presence or absence of said mutation in fungal nucleic acid using a method for detecting polymorphism of any (or one) single nucleotide.

In this invention, the authors have now come up with new diagnostic methods for detecting point mutations in the fungal gene of cytochrome b based on methods for detecting a single nucleotide polymorphism, including allele-specific amplification. One skilled in the art will appreciate that there are a large number of analytical procedures that can be used to detect the presence or absence of variant nucleotides at one or more polymorphic positions in accordance with this invention. Typically, detecting allelic variation requires a method for discriminating mutations, optionally an amplification reaction, and optionally a signal generation system. Many current methods for detecting allelic variation are discussed in a review by Nollau et al. Clin. Chem. 43, 1114-1120, 1997 and in standard manuals, e.g., 'Laboratory Protocols for Mutation Detection', Ed. by U. Landegren, Oxford University Press, 1996 and 'PCR' 2 ^nd Edition by Mewton and Graham, BIOS Scientific Publishers limited, 1997. Allele-specific amplification reactions include primer-based methods, including polymerase chain reaction methods ( PCR) and, more specifically, the development of allele-specific polymerase chain reaction (ASPCR) and specifically ARMS (Amplification Refractory Mutagenesis System), where the mutation causes resistance to the strobilurin analogue, and these methods are particularly preferred for use in data methods of the invention. The methods of this invention also include non-discriminatory PCR followed by specific sensing of the generated amplicon (amplification product). These methods are suitable for detecting specific alleles that can confer resistance to any of the strobilurin analogs or any other compound in the same cross-resistance group. Reliable tests have been developed to detect this point mutation in the range of fungal plant pathogens. Compounds can be considered to be in the same group of cross-stability, when the mechanism of resistance to one compound also reports resistance to another compound, even when their methods of action are not the same. The ASPCR method is described in US Pat. No. 5,639,611, and the ARMS method is described in detail in European Patent No. EP 332435.

Other methods for detecting a single polymorphism that can be used to detect mutations include, for example, restriction fragment length polymorphism (RFLP), single chain conformation polymorphism, multiple clonal analysis, allele-specific hybridization of oligonucleotides, primer extension of a single nucleotide (Juvonen et al. (1994) Hum Genet 93 16-20; Huoponen et al., (1994) Hum Mutat 3 29-36; Mashima et al., (1995) Invest Opthelmol. Vision. Sci 36, 1714-20; Howell et al. (1994) Am. J. Hum Genet. 55 203-206; Koyabashi et al. (1994) Am. J. Hum. Genet. 55 206-209; Johns and Neufeld (1993) Am. J. Hum Genet 53 916-920; Chomyn et al. (1992) Proc. Natl. Acad. Sci. USA 89 4221-4225) and Invader ™ method (available from Third Wave Technologies Inc. 502 South Rosa Road, Madison, WI 53719 USA).

Preferred is the use of PCR based detection systems.

According to a preferred embodiment of the first aspect of the present invention, the inventors provide a method for detecting a mutation in a fungal nucleic acid, wherein the presence of said mutation causes the appearance of fungal resistance to a strobilurin analog or any other compound in the same cross-resistance group, the method comprising detecting the presence of an amplicon generated during PCR reaction time, where the specified PNR reaction involves contacting a test sample containing mushroom nuc einovuyu acid with a primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to the presence or absence of said mutation in said nucleic acid.

The detection of the amplicon generated during the PCR reaction may be directly dependent on the extension of the primer specific for the presence of this mutation, i.e. when elongation of a primer depends on the presence of a given mutation and, therefore, an amplicon is generated only when this primer binds and / or lengthens when this mutation is present (as is the case with ARMS technology), in a similar way it can directly depend on lengthening a primer specific for the absence of this mutation, for example, a wild-type sequence, or may be directly related to a PCR lengthening product containing a mutated DNA sequence, i.e. when this detection relates to an amplicon containing a mutated DNA sequence. The first alternative is particularly preferred.

The amplicon can be an amplicon from any PCR cycle and it includes the first product of the extension of an allele-specific primer.

In a further preferred embodiment, the invention provides a method for detecting a mutation in a fungal nucleic acid, wherein the presence of said mutation causes fungal resistance to a strobilurin analog or any other compound in the same cross-resistance group, said method comprising contacting a test sample containing a fungal nucleic acid acid, with a suitable diagnostic primer in the presence of suitable nucleotide triphosphates and an agent for polymerization, that to which this diagnostic primer lengthens either when the indicated mutation is present in the sample, or when a wild-type sequence is present; and detecting the presence or absence of said mutation by the presence or absence of a diagnostic primer extension product.

In a further preferred embodiment, the invention provides a method for detecting a mutation in a fungal nucleic acid, wherein the presence of said mutation causes fungal resistance to a strobilurin analog or any other compound in the same cross-resistance group, said method comprising contacting a test sample containing a fungal nucleic acid acid, with a diagnostic primer for a specific mutation in the presence of suitable nucleotide triphosphates and an agent for limerization, so that this diagnostic primer lengthens when the specified mutation is present in the sample, and detecting the presence or absence of the specified mutation by the presence or absence of an extension product of the diagnostic primer.

According to a particularly preferred embodiment of the first aspect of the invention, the inventors provide a method for detecting a mutation in a fungal nucleic acid, wherein the presence of said mutation causes the appearance of fungal resistance to a strobilurin analog or any other compound in the same cross-resistance group, said method comprising contacting a test sample, containing fungal nucleic acid, with a diagnostic primer for a specific mutation in the presence of suitable nucleotides rifosfatov and an agent for polymerization, such that the diagnostic primer is extended only when the said mutation is present in the sample and detecting the presence or absence of said mutation by the presence or absence of a diagnostic primer extension product.

As used herein, the term diagnostic primer is used to denote a primer that is specifically used to identify the presence or absence of a wild-type mutation or sequence, and the term conventional primer is used to denote a primer that binds to the opposite DNA strand relative to the diagnostic primer and 3 'relative to the region recognized by this diagnostic primer, and which, acting with the specified diagnostic primer, allows the amplification of the area lying between them DNA during PCR. If the diagnostic primer is an ARMS primer, it may have a 3 ’mating defect compared to a mutant sequence or a wild-type sequence.

In this and all subsequent aspects and embodiments of the present invention, it is preferable to detect the extension of the primer extension product using a detection system that is an integral part of either a diagnostic primer or a conventional primer on the opposite chain. This is described in more detail here.

The methods of this invention are particularly suitable for detecting mutations in the mitochondrial gene that encodes a protein that is a target for fungicide, especially for detecting mutations in the fungal cytochrome b gene, where these mutations lead to inhibition of the fungicidal activity of cytochrome b protein, but still allow the implementation of ATP generation and most preferably, where the specified mutation in the fungal gene of cytochrome b leads to one of the following amino acid substitutions: A ₁₂₆ T, F ₁₂₉ L, Y ₁₃₂ C, C ₁₃₃ Y, G ₁₃₇ R / S / E / V, W ₁₄₂ T / K, G ₁₄₃ A, I ₁₄₇ F, T ₁₄₈ M, N ₂₅₆ Y / K / I, I ₂₇₅ F / S / T or L ₂₉₅ F, where the first amino acid is replaced by the second amino acid in the position in the sequence indicated by the number, the presence of which causes the appearance of fungal resistance to strobilurin analogs or any other compound in the same cross-resistance group, and the identification of residues is based on the numbering system of cytochrome residues in S. cerevisiae.

Analogues of strobilurin and compounds in the same cross-resistance group include, for example, azoxystrobin, picoxystrobin, kreoxim methyl, trifloxystrobin, famoxadone and phenamidone.

The inventors found that the position in the nucleic acid of the fungal cytochrome b corresponding to the 143rd codon / amino acid in the sequence of S. cerevisiae cytochrome b is a key determining factor for fungal resistance to strobilurin analogs or any other compound in the same cross-resistance group in the field isolates resistant to strobilurin analogues of phytopathogenic fungi. The methods of the present invention described herein are particularly suitable for detecting a mutation at a position corresponding to residue 143 of Saccharomyces cerevisiae cytochrome b, where the glycine residue is replaced by another amino acid that inhibits the activity of strobilurin analogues or any other compound in the same cross-resistance group and leads to a stable phenotype in fungi carrying the mutant cytochrome b gene, thereby causing the appearance of fungal resistance to analogues of strobilurin or any other compound in the same group e cross-stability.

This method is preferably used to detect a mutation that replaces said glycine residue at a position corresponding to residue 143 of S. cerevisiae cytochrome b with an amino acid selected from the group of arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most preferably Alanine.

In yet another preferred embodiment of the first aspect of the present invention, the inventors provide a method for detecting a mutation in the fungal cytochrome b gene, which leads to the replacement of glycine with alanine at the position corresponding to residue 143 of S. cerevisiae cytochrome b (G ₁₄₃ A), in the encoded protein resulting in thus, to the appearance of fungal resistance to strobilurin analogs or any other compound in the same cross-resistance group, said method comprising identifying the presence or absence of said mutations in fungal nucleic acid using a method for detecting polymorphism of any (or one) single nucleotide.

A mutation in the fungal gene of cytochrome b, leading to the replacement of G ₁₄₃ A in the encoded protein, is usually a replacement of the guanine base with cytosine base in the second position (base) of this codon, and the detection of this single base polymorphism is preferred for all aspects and variants described here inventions.

In yet another preferred embodiment of the first aspect of the present invention, the authors provide a diagnostic method for detecting a mutation in the fungal cytochrome b gene, leading to the replacement of G ₁₄₃ A in the encoded protein, said method comprising detecting the presence of an amplicon generated during the PCR reaction, said PCR the reaction involves contacting a test sample containing fungal nucleic acid with a diagnostic primer in the presence of suitable nucleotide triphosphates and a polymerization agent, where the detection of said amplicon is directly related to the presence or absence of said mutation in said nucleic acid.

In a particularly preferred embodiment of the first aspect of the present invention, the inventors now provide a diagnostic method for detecting a mutation in the fungal gene of cytochrome b leading to the replacement of G ₁₄₃ A in the encoded protein, said method comprising contacting a test sample containing fungal nucleic acid with a diagnostic primer for mutation leading to the replacement of G ₁₄₃ a in the encoded protein, in the presence of appropriate nucleotide triphosphates and an agent for polymerization, such that the diagnostic primer lengthens Xia, when mutation is present in the sample, leading to the replacement of G ₁₄₃ A in the encoded protein; and detecting the presence or absence of said mutation by the presence or absence of a diagnostic primer extension product.

In a further particularly preferred embodiment of the first aspect of the present invention, the authors now provide a diagnostic method for detecting a mutation in the fungal gene of cytochrome b, leading to the replacement of G ₁₄₃ A in the encoded protein, said method comprising contacting a test sample containing fungal nucleic acid with a diagnostic primer for mutation leading to the replacement of G ₁₄₃ a in the encoded protein, in the presence of appropriate nucleotide triphosphates and an agent for polymerization, such that the diagnostic primer udlinyaets Only in the case where the mutation resulting in C ₁₄₃ A replacement in the encoded protein, is present in the sample; and detecting the presence or absence of said mutation by the presence or absence of a diagnostic primer extension product.

As used herein, the term G ₁₄₃ A is used to mean the replacement of a glycine residue with an alanine residue in the fungal cytochrome b sequence at the equivalent position 143 of its codon / amino acid sequence of S. cerevisiae cytochrome b. This nomenclature is used for all other substitutions of residues cited here, i.e. all positions are cited relative to the protein sequence of S. cerevisiae cytochrome b. The gene and protein sequences of S. cerevisiae cytochrome b are available on the EMBL and SWISSPROT databases (see EMBL ACCESSION NO. X84042 and SWISSPROT ACCESSION NO. P00163). One of skill in the art will understand that the exact length and spectrum of equivalent proteins from various species may vary as a result of amino or carboxy terminal and / or one or more internal divisions or insertions. Since the amino acid region containing the residue corresponding to 6143 in S. cerevisiae is quite conservative (Widger et al. Proc. Natl. Acad. Sci. USA 81 (1984) 674-678), it is easy to identify the exact corresponding residue in the newly obtained fungal sequence cytochrome b either by visual examination, or using one of several sequence matching programs, including Megalign or Macaw. Although designated as G ₁₄₃ in this application, due to positional and functional equivalence, the exact position of this glycine in the new cytochrome b may not be the 143rd residue from its amino terminus. A consensus sequence of S. cerevisiae cytochrome b is provided in SWISSPROT ACCESSION NO. P00163 In all aspects and embodiments of the invention described herein, positions in the cytochrome b sequence are preferably defined relative to the S. cerevisiae cytochrome b sequence provided in EMBL ACCESSION NO. X84042. Alternatively, in all aspects and embodiments of the invention described herein, positions in the cytochrome b sequence are preferably defined relative to the consensus sequence of S. cerevisiae cytochrome b provided in SWISSPROT ACCESSION NO. P00163

According to one aspect of the present invention, there is provided a method for diagnosing a single nucleotide polymorphism in a fungal cytochrome b gene, the method comprising determining a fungal nucleic acid sequence at a position corresponding to one or more bases in a triplet encoding an amino acid at a position corresponding to residue 143 of cytochrome b S. cerevisiae, in the protein of cytochrome b, and determination of the state of resistance of these fungi with respect to a strobilurin analog or compound in the same group cross-resistance by polymorphism in the cytochrome b gene.

In all aspects and embodiments of the invention described herein, it is preferred that only one base in a triplet encoding an amino acid at a position corresponding to residue 143 of S. cerevisiae cytochrome b in cytochrome b protein exhibit a mutation, i.e. where there is a single nucleotide polymorphism occurring in only one position and, in addition, it is preferable that the mutation be in the first or second base of this triplet and most preferably it is in the second base of this triplet.

According to a preferred embodiment of this aspect of the present invention, there is provided a method for diagnosing a single nucleotide polymorphism in a cytochrome b fungal gene, the method comprising determining a fungal nucleic acid sequence at a position corresponding to a second base in a triplet encoding an amino acid at a position corresponding to residue 143 of cytochrome b S cerevisiae, in the protein of cytochrome b, and determination of the state of stability of these fungi with respect to the strobilurin analogue or compound in that e cross resistance group itself polymorphism in the gene for cytochrome b.

In an embodiment of the above aspect of the present invention, the diagnostic method described herein is a method in which a single nucleotide polymorphism at a DNA position corresponding to a second base in a triplet encoding an amino acid at a position corresponding to residue 143 of S. cerevisiae cytochrome b in cytochrome b protein, represents the presence of G and / or C.

Table 1
Using codons First position Second position Third position 5’-end FROM G 3’-end G Alanine Glycine U Alanine Glycine FROM Alanine Glycine A Alanine Glycine G

The point mutation of glycine to alanine requires the replacement of G by C in the second base of this codon. Other mutations may also occur in the 3rd position in this codon due to the degeneracy of the genetic code for alanine and glycine (see table 1), but this is easily taken into account when designing a diagnostic primer. The diagnostic primer is preferably an ARMS primer (The concept of ARMS primers is fully described in Newton et al. Nucleic Acid Research 17 (7) 2503-2516 1989). As a result, ARMS primers can be designed to detect the G ₁₄₃ A point mutation, provided only the sequence information of the wild-type cytochrome b gene sensitive to the strobilurin analogue is known. It is not necessary to have a stable isolate available in new fungi of interest originating from the G ₁₄₃ A mutation. Some examples of relevant phytopathogenic fungi are listed in Table 2. This list is not intended to be limiting in any way. A qualified phytopathologist will be able to easily identify those fungi to which the methods of this invention can be applied.

table 2
An example of species in which G ₁₄₃ A can be analyzed Examples of species in which G ₁₄₃ A can be analyzed 1 Plasmopara viticola 2 Erysiphe graminis f.sp. tritici / hordei 3 Rhynchosporium secalis 4 Pyrenophora teres 5 Mycosphaerella graminicola 6 Mycosphaerella fijiensis var. difformis 7 Sphaerotheca fuliginea 8 Uncinula necator nine Colletotrichum graminicola 10 Pythium aphanidermatum eleven Colletotrichum gloeosporioides 12 Oidium lycopersicum thirteen Leveillula taurica 14 Pseudoperonospora cubensis fifteen Alternaria solani 16 Cercospora arachidola 17 Rhizoctonia solani eighteen Venturia inaequalis 19 Magnaporthe grisea twenty Phytophthora infestans 21 Mycosphaerella musicola

The methods of the present invention described herein are particularly applicable in connection with phytopathogenic fungi, in particular with the following types of fungi: Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillocraiorafaola feriola pheraferiola pserafloriola

In an additional aspect, this invention provides a method for detecting fungal resistance to an analogue of strobilurin or any other compound in the same cross-resistance group, said method comprising identifying the presence or absence of a mutation in a fungal nucleic acid, wherein the presence of said mutation causes resistance to a strobilurin analog or any other compound in the same cross-stability group, said method comprising ntifikatsiyu presence or absence of single nucleotide polymorphisms, occurring at a position corresponding to one or several bases in the triplet coding for the amino acid at the position corresponding to residue 143 cytochrome b S. cerevisiae, the protein cytochrome b.

In a further preferred embodiment of this aspect, the invention provides a method for detecting fungal resistance to a strobilurin analog or any other compound in the same cross-resistance group, said method comprising identifying the presence or absence of a mutation in a fungal nucleic acid, wherein the presence of said mutation causes resistance to strobilurin analog or any other compound in the same cross-resistance group, anny method comprising identifying the presence or absence of single nucleotide polymorphisms, occurring at a position corresponding to a second base in the triplet coding for the amino acid at the position corresponding to residue 143 cytochrome b S. cerevisiae, the protein cytochrome b.

In a preferred embodiment of this aspect of the invention, the presence or absence of a single nucleotide polymorphism at a position corresponding to a second base in a triplet encoding an amino acid at a position corresponding to residue 143 of S. cerevisiae cytochrome b in the cytochrome b gene in fungal nucleic acid is identified using detection methods polymorphism of any (or one) single nucleotide.

Further, the present invention provides a fungal DNA sequence encoding all or part of a wild-type cytochrome b protein, said DNA sequence encoding a glycine residue at the position corresponding to residue 143 of S. cerevisiae cytochrome b in a wild-type protein, said sequence being obtained or obtained from a fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctraocola soli

Fungal DNA sequences in accordance with the above aspects of the present invention preferably contain about 30 nucleotides on either or both sides of the position of the DNA corresponding to one or more bases in the triplet, preferably corresponding to the second base in the triplet encoding the amino acid at the position corresponding to residue 143 cytochrome b S. cerevisiae, in the protein, since this degree of nucleic acid provides the specialist with all the information necessary for the construction of the species and mutation specific reagents and / or methods for use in all methods for detecting polymorphism of a single nucleotide. As used herein, a term of about 30 means that this sequence may contain up to 30 nucleotides, for example 5, up to 10, 15, 20 or 25 nucleotides, or may contain more than 30 nucleotides.

As used herein, in connection with all DNA and protein sequences, the term "all or part" is used to mean a DNA sequence or protein sequence or fragment thereof. A DNA or protein fragment may be, for example, 10, 20, 25, 30, 40, 50, 60, 70, 75, 80, 85, 90, or 95% of the length of the entire sequence.

One skilled in the art will appreciate that samples containing both genomic (mitochondrial) DNA and cDNA can be analyzed in accordance with this invention. If the sample contains genomic DNA, intron organization should be considered when using sequence information. Examples of wild-type fungal DNA sequences containing a portion of the wild-type cytochrome b gene sequence in accordance with the above-described aspect of the present invention are provided in Table 3 and these sequences form the following aspect of the present invention.

In table 3, the second base in the triplet encoding the amino acid at the position corresponding to residue 143 of cytochrome b S. cerevisiae, which leads to the replacement of the usual glycine residue with an alternative amino acid, and this replacement reports resistance to strobilurin analogs or to a compound in the same cross-resistance group, in bold and underlined.

This invention also relates to a fungal DNA sequence that detects sequence homology or identity with respect to the indicated DNA sequences in Table 3, and includes, for example, variations in DNA sequences found in different samples or isolates of the same species. These variations may, for example, be the result of using an alternative codon, varying the intron / exon mitochondrial organization, and amino acid substitution.

In a further aspect, the invention provides a fungal DNA sequence encoding all or part of a cytochrome b protein, which, when aligned against the corresponding wild-type DNA sequence encoding a cytochrome b protein, contains, as you can see, a mutation in a single nucleotide polymorphism in a position in the DNA, corresponding to one or more bases in the triplet encoding the amino acid at the position corresponding to residue 143 of S. cerevisiae cytochrome b in this protein, which leads to the replacement of the usual glycine al residue the amino acid, provided that the DNA sequence is not a Mycena galopoda sequence encoding cytochrome b.

In a further preferred embodiment of this aspect, the invention provides a fungal DNA sequence encoding all or part of a cytochrome b protein, which, when aligned against the corresponding wild-type DNA sequence encoding cytochrome b protein, contains, as you can see, a single nucleotide polymorphism mutation at position DNA corresponding to the second base in the triplet encoding the amino acid at the position corresponding to residue 143 of S. cerevisiae cytochrome b in this protein, which leads to the replacement of the usual th glycine residue alternative amino acid, provided that said DNA sequence is not Mycena galopoda sequence encoding a cytochrome b.

The fungal DNA sequence in accordance with the above aspect of the present invention preferably contains about 30 nucleotides on either side or on both sides of the position of the DNA corresponding to one or more bases in the triplet, preferably corresponding to the second base in the triplet encoding the amino acid at the position corresponding to the residue 143 cytochrome b S. cerevisiae, in the protein, since this degree of nucleic acid provides the specialist with all the information necessary to construct the species - and mutation-specific reagents and / or methods for use in all methods of detecting single nucleotide polymorphism. As used herein, a term of about 30 means that this sequence may contain up to 30 nucleotides, for example 5, up to 10, 15, 20 or 25 nucleotides, or may contain more than 30 nucleotides.

Further, this invention provides a fungal DNA sequence encoding all or part of a mutant cytochrome b protein, the presence of a mutation in said DNA reporting resistance to a strobilurin analog or compound in the same cross-resistance group, said mutation taking place at a position in the DNA, corresponding to one or more bases in a triplet encoding an amino acid at a position corresponding to residue 143 of S. cerevisiae cytochrome b in a protein, provided that the DNA sequence is not It wishes to set up a sequence Mysena galopoda, encoding cytochrome b.

In a preferred embodiment of this aspect, the invention also provides a fungal DNA sequence encoding all or part of a mutant cytochrome b protein, the presence of a mutation in said DNA indicating resistance to a strobilurin analog or compound in the same cross-resistance group, said mutation taking place in the position in the DNA corresponding to the second base in the triplet encoding the amino acid at the position corresponding to the residue 143 of S. cerevisiae cytochrome b in the protein, provided that the decree Naya DNA sequence is not Mycena galopoda sequence encoding a cytochrome b.

In the above aspects of the present invention, a mutation occurring at a position in the DNA corresponding to the second base in the triplet encoding the amino acid at the position corresponding to residue 143 of S. cerevisiae cytochrome b in the protein is preferably a substitution of guanine base for cytosine base.

A fungal DNA sequence encoding all or part of a mutant cytochrome b protein, the presence of a mutation in said DNA reporting resistance to a strobilurin analog or compound in the same cross-resistance group, in accordance with the above-described aspects of the present invention, can preferably be obtained or preferably obtained from a fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum, gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillula taurica, Pseudraocriola perei ferriola pomerariola

The invention also encompasses DNA sequences containing all or part of the sequences provided in Table 3, where the residue at the position in the DNA corresponding to the second base in the triplet encoding the amino acid at the position corresponding to the residue 143 of S. cerevisiae cytochrome b in the protein is a cytosine residue (SEQ ID NO: 176 - SEQ ID NO: 196). These sequences are shown below and form the following aspect of the present invention:

The present invention also relates to a fungal DNA sequence that detects homology or sequence identity with respect to said DNA sequence containing said polymorphism, and encompasses, for example, variations in DNA sequences found in different samples of the same species. These variations may, for example, be the result of using an alternative codon, varying the intron / exon mitochondrial organization, and amino acid substitution.

DNA sequences encoding all or a portion of the wild-type or mutant cytochrome b cytochrome b protein, as described herein, are preferably in isolated form.

For example, they are partially purified from any substance with which they are found in nature. This DNA sequence is isolated (obtained) or isolated (obtained) from the fungi described herein.

The invention further provides a computer-readable medium having any of the sequences described and claimed herein stored on it and including all or part of a DNA sequence encoding a mutated cytochrome b protein described herein, or a sequence or part thereof of a mutant cytochrome b protein described herein wherein the presence of the mutation causes the appearance of fungal resistance to a strobilurin analog or to any compound in the same cross-resistance group; the entire DNA sequence or part thereof encoding a mutant cytochrome b protein, or a protein sequence or part thereof of a cytochrome b mutant protein, said protein reporting fungal resistance to a strobilurin analog or compound in the same cross-resistance group from a fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythiuin aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillula taurica, Pseraida riseriomori, or the protein sequence is not a Mycena galopoda sequence encoding cytochrome b; the entire DNA sequence or part thereof encoding a wild-type cytochrome b sequence, or a cytochrome b protein sequence of this type, from a fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctracerola soli or any allele-specific oligonucleotide; allele-specific oligonucleotide probe, allele-specific primer, normal or diagnostic primer described herein.

A computer-readable medium can be used, for example, in homology screening, mapping, haplotyping, genotyping, or any other bioinformative analysis. Any computer-readable medium can be used, such as a CD, tape, floppy disk, hard drive, or computer chip.

The polynucleotide sequences of this invention, or parts thereof, in particular sequences related to the single nucleotide polymorphisms identified here and identifying the single polynucleotide polymorphisms identified here, in particular the G → C substitution in the fungal cytochrome b gene, causing the C ₁₄₃ A substitution in the encoded protein, are a valuable source of information. The use of this source of information is most easily facilitated by storing sequence information in a computer-readable medium and then using this information in standard bioinformatics programs. Polynucleotide sequences of the present invention are applicable, in particular, as components in databases for sequence identity analysis and other search analysis. As used herein, storing sequence information in a computer-readable medium and using in databases on a polynucleotide or polynucleotide sequence of the present invention includes any detectable chemical or physical characteristic of the polynucleotide of the present invention that can be reduced, transformed, or stored in a material medium, such as a computer a disk, preferably in computer readable form. For example, chromatographic scan data or peak data, photographic scan data or peak data, mass spectrographic data, sequencing gel data (or other data).

A computer-based method is also provided for performing sequence identification, said method comprising the steps of providing a polynucleotide sequence containing a polymorphism of the present invention in a computer-readable medium and comparing said polynucleotide sequence containing polymorphism with at least one other polynucleotide or polypeptide sequence to identify identity ( homology), i.e. screening for the presence of this polymorphism.

Further, the present invention provides a fungal protein of cytochrome b, which confers fungal resistance to a strobilurin analog or compound in the same cross-resistance group, wherein in the said protein the usual glycine residue is altered due to the presence of a mutation in the DNA encoding the indicated protein, wherein said mutation takes place at the position in the DNA corresponding to one or more bases in the triplet encoding the amino acid at the position corresponding to residue 143 of S. cerevisiae cytochrome b in the protein, provided that The sequence is not a sequence of cytochrome b Mycena galopoda.

In a preferred embodiment of this aspect, the present invention also provides a cytochrome b fungal protein which confers fungal resistance to a strobilurin analog or compound in the same cross-resistance group, wherein in the said protein the usual glycine residue is altered due to the presence of a mutation in the DNA encoding the protein, this mutation occurs at the position in the DNA corresponding to the second base in the triplet encoding the amino acid at the position corresponding to residue 143 of S. cerevisia cytochrome b e, in a protein, provided that the sequence is not a Mycena galopoda cytochrome b sequence.

The cytochrome b sequence of Mycena galopoda is described by Kraiczy et al. (Eur. J .. Biochem. 235, 54-63 (1996)), and this DNA sequence is in the database EMBL accession No. X87997.

The glycine residue in the protein according to the above aspect of the present invention is preferably replaced by an alternative amino acid, and said substitution results in said fungi showing resistance to the strobilurin analog or any other compound in the same cross-resistance group.

A mutation in accordance with the above-described aspect of the present invention preferably results in the replacement of the indicated glycine residue with an amino acid selected from the group consisting of arginine, serine, cysteine, valine, aspartic acid, glutamic acid, and most preferably alanine.

In a further aspect, the invention provides an antibody capable of recognizing said mutant cytochrome b protein.

In a further aspect, the present invention provides a method for detecting a mutation in a fungal gene of cytochrome b, leading to the replacement of a glycine residue in the encoded protein at a position corresponding to residue 143 of S. cerevisiae cytochrome b, the method comprising identifying the presence and absence of said mutation in a fungal nucleic acid sample where the method for detecting the polymorphism of any (or one) single nucleotide is based on sequence information from about 30 to 90 nucleotides against the course of transcription and / or and in the course of transcription from the position corresponding to one or more bases in the triplet encoding the amino acid at the position corresponding to residue 143 of S. cerevisiae cytochrome b, either in the wild-type protein or in the mutant protein.

In a further preferred embodiment of this aspect, the present invention provides a method for detecting a mutation in the fungal gene of cytochrome b, leading to the replacement of G ₁₄₃ A in the encoded protein, said method comprising identifying the presence and absence of said mutation in a fungal nucleic acid sample, where the method for detecting any polymorphism ( or one) a single nucleotide based on sequence information from about 30 to 90 nucleotides against the course of transcription and / or along the transcription from the position, s corresponding to the second base in the triplet encoding the amino acid at the position corresponding to residue 143 of S. cerevisiae cytochrome b, either in the wild-type protein or in the mutant protein.

In a further preferred embodiment of this aspect, the present invention provides a method for detecting a mutation of guanine to cytosine in the fungal gene of cytochrome b, leading to the replacement of G ₁₄₃ A in the encoded protein, said method comprising identifying the presence and absence of said mutation in a fungal nucleic acid sample, where the detection method polymorphism of any (or one) single nucleotide is based on sequence information from about 30 to 90 nucleotides against the course of transcription and / or along the transcript uu from a position corresponding to a second base in the triplet coding for the amino acid at the position corresponding to residue 143 cytochrome b S. cerevisiae, or in wild-type protein or a mutant protein.

Sequence information according to the above aspect of the present invention is preferably obtained from a fungus selected from the group Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillidaeraola pomerafaola romaola pomeraria viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctraocola soli

As used herein, a term of about 30 means that this sequence may contain up to 30 nucleotides, for example 5, up to 10, 15, 20 or 25 nucleotides, or may contain more than 30 nucleotides. In the above aspects of the invention, it is preferred that the sequence information used is about 30, preferably 30 nucleotides upstream and / or downstream from the position corresponding to the second base of the triplet encoding the amino acid at the position corresponding to residue 143 of cytochrome b S. cerevisiae, either in a wild-type protein or in a mutant protein.

The nucleic acid in accordance with this invention is preferably DNA, a nucleic acid test sample is conveniently a total DNA preparation from a fungal material, a cDNA preparation from a fungal material or the fungal material itself, or plant or seed extracts containing fungal nucleic acid. In this invention, the authors describe the detection of a C ₁₄₃ A mutation using a total DNA preparation, a cDNA preparation, and using the direct use of fungal spore material as a template in these PCRs. It should be understood that the test sample may likewise be a nucleic acid sequence corresponding to the sequence in a given test sample. That is, it can be said that the entire region or part of it in a nucleic acid sample can be first isolated or amplified using any suitable method, such as PCR, before being used in the method of the present invention.

The present invention provides a means for analyzing mutations in the DNA of agricultural field samples, which by their very origin are significantly less well defined compared to a similar situation dealing with human samples. Agricultural field samples are much more difficult to work with, and they are technically more demanding to detect a mutation event that occurs at a low frequency among a very large amount of wild-type DNA and / or extraneous DNA from other organisms present in the field isolate compared to a human sample , which usually contains DNA from only one individual.

Any suitable enzyme for polymerization can be used provided that it does not have the inherent ability to discriminate between normal and mutant matrix sequences to any significant degree. Examples of suitable enzymes include thermostable enzymes that do not have significant 3'-5'-exonuclease activity, for example Taq DNA polymerase, in particular Ampli Taq Gold ™ DNA polymerase (PE Applied Biosystems), a Stoffel fragment or others suitable thus delegated at the N-terminus of Taq (Thermus aquaticus) or Tth (Thermus thermophilus) DNA polymerase modifications.

In a further aspect, the invention provides an allele-specific oligonucleotide capable of binding to all or part of a fungal nucleic acid sequence encoding a wild-type cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillocerioria olio alterna tomorapoola which recognizes a nucleic acid sequence encoding a glycine residue at a position corresponding to residue 143 of S. cerevisiae cytochrome b.

In a preferred embodiment of this aspect of the invention, said fungal nucleic acid sequence is selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum. gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola.

Fungal nucleic acid in accordance with the above aspects of the present invention is preferably DNA.

In a further aspect of the invention, the authors provide an allele-specific oligonucleotide capable of binding to all or part of a fungal nucleic acid sequence encoding all or part of a protein of mutant cytochrome b, said oligonucleotide containing a sequence that recognizes a nucleic acid sequence encoding an amino acid selected from the group of arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most preferably Alanine, at the position corresponding to residue 143 of S. cerevisiae cytochrome b.

In a preferred embodiment of this aspect of the invention, the authors provide an allele-specific oligonucleotide capable of binding to the entire or part of a fungal nucleic acid sequence encoding all or part of a mutant cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. . tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillocerioria olio alterna tomorapoola which recognizes a nucleic acid sequence encoding an amino acid selected from the group of arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most preferably alanine, at the position corresponding to residue 143 of S. cerevisiae cytochrome b.

Fungal nucleic acid in accordance with the above aspects of the present invention is preferably DNA.

In a further aspect, the invention provides an allele-specific oligonucleotide probe capable of detecting a polymorphism of a fungal cytochrome b gene at a position in DNA corresponding to one or more bases in a triplet encoding an amino acid at a position corresponding to residue 143 of S. cerevisiae cytochrome b in a protein.

In a further preferred embodiment of this aspect, the present invention provides an allele-specific oligonucleotide probe capable of detecting a polymorphism of the fungal cytochrome b gene at the position in the DNA corresponding to the second base in the triplet encoding the amino acid at the position corresponding to the residue 143 of S. cerevisiae cytochrome b in the protein.

In the following preferred embodiments of the above aspect of the present invention, said polymorphism is a substitution of a guanine base for a cytosine base, this mutation is in a fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillocraiorafaola feriola pheraferiola pserafloriola

An allele-specific probe preferably has a length of 17-50 nucleotides, more preferably about 17-35 nucleotides, and most preferably about 17-30 nucleotides.

The design of such probes will be apparent to molecular biologists of ordinary skill and may be based on DNA or RNA sequence information. Such probes have any convenient length, for example up to 50 bases, up to 40 bases, more conveniently up to 30 bases, for example 8-25 or 8-15 bases. Typically, such probes will contain base sequences that are fully complementary to the corresponding wild-type locus or variant locus in a given gene. However, if necessary, one or more mating defects can be introduced, provided that this does not unduly affect the discriminatory ability of the given oligonucleotide probe. The probes of the present invention may carry one or more tags to facilitate detection.

Further, this invention provides nucleotide primers that can detect nucleotide polymorphisms in accordance with this invention.

According to another aspect of the present invention, there is provided an allele-specific primer capable of detecting a polymorphism of a cytochrome b gene at a position in DNA corresponding to one or more bases in a triplet encoding an amino acid at a position corresponding to residue 143 of S. cerevisiae cytochrome b in a protein.

According to a preferred embodiment of this aspect of the invention, an allele-specific primer is provided capable of detecting a polymorphism of the cytochrome b gene at the position in the DNA corresponding to the second base in the triplet encoding the amino acid at the position corresponding to the residue 143 of S. cerevisiae cytochrome b in the protein.

In the above aspects, said mutation in the DNA sequence is preferably a mutation of the replacement of guanine base with cytosine base.

In a further aspect, the invention provides an allele-specific primer capable of detecting a fungal DNA sequence encoding a wild-type cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillocerioraola pheraferiola pomeria DNA encoding a glycine residue at a position corresponding to residue 143 of S. cerevisiae cytochrome b.

In a preferred embodiment of this aspect of the invention, said fungal DNA sequence is selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctraola colola sola,

In a further aspect of the invention, the authors provide an allele-specific primer capable of detecting a fungal DNA sequence encoding all or part of a mutant protein of cytochrome b, said allele-specific primer capable of detecting a DNA sequence encoding an amino acid selected from the group arginine, serine, cysteine , valine, aspartic acid, glutamic acid, tryptophan, and most preferably alanine, at the position corresponding to residue 143 of S. cerevisiae cytochrome b.

In a preferred embodiment of this aspect of the invention, the authors provide an allele-specific primer capable of detecting a fungal DNA sequence encoding all or part of a mutant cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis.var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graininicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillocerioraola phiola pheraferiola DNA encoding an amino acid selected from the group of arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most preferably alanine, at the position corresponding to residue 143 of S. cerevisiae cytochrome b.

An allele-specific primer is usually used with a conventional primer in an amplification reaction, such as a PCR reaction, which discriminates between alleles through the selective amplification of one allele at a specific position in the sequence, for example, as used in ARMS analysis.

The authors have now invented primers for the G ₁₄₃ A mutation in the above types of fungi, which have been shown to detect reliably and well-specific mutations. These primers detect the replacement of guanine-cytosine bases at the position in the DNA corresponding to the second base in the triplet encoding the amino acid at the position corresponding to residue 143 of S. cerevisiae cytochrome b in the protein. Allele-specific primers are referred to herein as diagnostic primers. Thus, in a further aspect, the invention provides a diagnostic primer capable of binding to a matrix containing the nucleotide sequence of a mutant fungal cytochrome b, where the final 3'-nucleotide of this primer corresponds to the nucleotide present in said mutant form of the fungal cytochrome b gene, and the presence of said nucleotide causes the appearance of fungal resistance to a strobilurin analog or any other compound in the same cross-resistance group.

The diagnostic primer of the present invention preferably has a length of at least 20 nucleotides, most preferably 26 nucleotides, but it can have a length between 15 and 20 nucleotides.

In a preferred embodiment of the above aspect of the invention, the penultimate nucleotide (-2) of the primer is not the same as that present in the corresponding position in the wild-type cytochrome b sequence.

In a further preferred embodiment, the nucleotide -3 of this primer is not the same as that present in the corresponding position in the wild-type cytochrome b sequence.

Other destabilizing components may be included with nucleotide -2 or -3.

In a further particularly preferred embodiment of the above aspect of the present invention, the authors provide diagnostic primers capable of binding to a matrix containing the mutant type fungal cytochrome b nucleotide sequence, where the final 3'-nucleotide of this primer corresponds to the nucleotide present in the indicated mutant form of the cytochrome b fungal gene, and where up to 10, for example up to 8, 6, 4, 2, 1, the remaining nucleotides can vary relative to the wild-type sequence without significant effect on Features of the diagnostic primer.

In a further particularly preferred embodiment of the above aspect of the present invention, the authors provide diagnostic primers containing the following sequences and their derivatives, where the final nucleotide at the 3'-end is identical to the sequences shown below, and where up to 10, for example, to 8, 6, 4 , 2, 1, the remaining nucleotides can vary without a significant effect on the properties of the diagnostic primer.

Conveniently, the sequence of the diagnostic primer exactly matches the sequences below. Preferably, the ARMS primers in all aspects of the present invention have a length of 26 nucleotides. In most of the primers listed below, the penultimate nucleotide has been modified relative to the wild-type cyt b sequence to destabilize the primer to thereby make it more selective for the desired template, and these primers are particularly preferred in accordance with this invention. It will be apparent to those skilled in the art of primer design that substrates alternative to those discussed above, or in addition to those discussed above, may also vary without adversely affecting the ability of the primer to bind to the template.

As examples, the primers shown in table 4 include:

- ARMS primers for P. teres and V. ineaqualis, which can be effectively applied either to genomic DNA preparations or to biological samples, including fungal isolates, fungal cultures, fungal spores, or infected plant material.

- ARMS primers for S. fulginea, O. lycopersicum, L. taurica, U. necator, Phytophthora infestans, Magnoporthe grisea, R. solani, which can be effective only with cDNA.

- ARMS primers for P. viticola, E. graminis f.sp tritici or hordei, R. secalis, M. graminicola, M. fijiensis var. difformis, C. graminicola, P. aphanidermatum, C. gloesporoides, P. cubensis, C. arachidola, Mycosphaerella musicola and A. solani, which can be used effectively either with genomic DNA preparations, cDNA preparations, or with biological samples, including including fungal isolates, fungal cultures, fungal spores, or infected plant material.

The cDNA material is recommended for species in which the intron / exon organization is currently uncharacterized around a single nucleotide polymorphism of interest (SNP).

To adapt the primers shown in the table for use in a standard ASPCR reaction, the last base at the 3’ end must correspond to a point mutation without destabilizing the introduced base.

Such primers can be prepared using any suitable synthesis method. Examples of such methods can be found in standard manuals, for example, "Protocols For Oligonucleotides And Analogues: Synthesis And Properties;" Methods In Molecular Biology Series; Volume 20; Ed. Sudhir Agrawal, Humana ISBN: 0-89603-247-7; 1993; 1 ^st Edition.

It should be understood that an extension of the diagnostic primer can be designed to indicate the absence of a mutation leading to the replacement of G ₁₄₃ A in the encoded protein. It is preferable to use ARMS primers to detect the absence of a mutation leading to the replacement of G ₁₄₃ A in the encoded protein. Primers designed for this purpose are described here.

Wild-type sequence detection is useful as a control for mutation detection, and it is also necessary when quantification of the wild-type allele and mutant allele in a sample is desired.

Thus, in a further aspect, the present invention provides a diagnostic primer capable of binding to a matrix containing the nucleotide sequence of wild-type fungal cytochrome b, where the final 3'-nucleotide of this primer corresponds to the nucleotide present in the wild-type fungal cytochrome b fungal gene that is sensitive to a strobilurin analog or any other compound in the same cross-resistance group.

In a preferred embodiment of this aspect of the invention, the penultimate nucleotide (-2) of this primer is not the same as that present in the corresponding position in the wild-type cytochrome b sequence.

In a further preferred embodiment, the nucleotide -3 of this primer is not the same as that present in the corresponding position in the wild-type cytochrome b sequence.

Together with nucleotide -2 or -3, other destabilizing components may be included.

The diagnostic primer of the present invention preferably has a length of at least 20 nucleotides, most preferably 26 nucleotides, but it can have a length between 15 and 20 nucleotides. In a further particularly preferred embodiment of the above aspect of the present invention, the authors provide diagnostic primers capable of binding to a matrix containing the nucleotide sequence of wild-type fungal cytochrome b, where the final 3'-nucleotide of this primer corresponds to the nucleotide present in the fungal cytochrome b gene, and where up to 10, for example, up to 8, 6, 4, 2, 1, the remaining nucleotides can vary relative to the wild-type sequence without a significant effect on the properties of the diagnostic prime a.

In a further particularly preferred embodiment of the above aspect of the present invention, the authors provide diagnostic primers containing the following sequences and their derivatives, where the final nucleotide at the 3'-end is identical to the sequences shown below and where up to 10, for example, to 8, 6, 4, 2, 1, the remaining nucleotides can vary without a significant effect on the properties of the diagnostic primer. Conveniently, the sequence of the diagnostic primer exactly matches the sequences below. In most of the primers listed below, the penultimate nucleotide has been modified relative to the wild-type cytochrome b sequence to destabilize the primer to thereby make it more selective for the desired template. It will be apparent to those skilled in the art of primer design that substrates alternative to those discussed above, or in addition to those discussed above, may also vary without adversely affecting the ability of the primer to bind to the template.

To adapt the primers shown in the table for use in a standard ASPCR reaction, the last base at the 3’ end must correspond to the wild-type sequence without destabilizing the introduced base.

The examples described above relate to ARMS primers based on the direct (coding) DNA strand. The use of straight chain DNA ARMS primers is particularly preferred.

ARMS primers can also be based on DNA reverse chain, if desired. Such reverse chain primers are designed according to the same principles described above for forward chain primers, namely these primers can have a length of at least 20 nucleotides, most preferably 26 nucleotides, but they can have a length between 15 and 20 nucleotides, and the final 3 the 'nucleotide of this primer is paired with a relevant matrix, i.e. a mutant or wild-type matrix, and preferably the penultimate residue is optimally modified so that it does not pair with the nucleotide of the relevant matrix. In addition, up to 10, for example, up to 8, 6, 4, 2, 1, the remaining nucleotides in this primer can vary without a significant effect on the properties of the diagnostic primer.

In many situations, it will be convenient to use the diagnostic primer of this invention with an additional amplification primer, referred to herein as a conventional primer, in one or more PCR amplification cycles. A suitable example of this aspect is presented in European patent number EP-B1-0332435. The optional amplification primer is either a forward or reverse conventional primer. For each species, the primer used is the primer indicated below. The primers below are reverse primers.

In the case of longer sequences provided in table 6, the specialist will be able to use this information to design suitable primers.

One skilled in the art will recognize that the usual primer can be any suitable pathogen-specific sequence that recognizes the complementary strand of the cytochrome b gene (or other gene of interest) lying 3 ’from the selective mutated primer.

The size of the PCR amplicon is predominantly 50-400 bp, but can be from 30 to 2500 bp in length. or potentially from 30 to 10,000 bp,

A suitable control primer that is designed against the transcription from position G ₁₄₃ A may be used. It will be apparent to those skilled in the art that the control primer may be any primer that is not specific for amplification of mutation sequences or wild-type sequences. When using these primers together with the corresponding reverse ('normal') primer described above, amplification will occur regardless of whether or not the G ₁₄₃ A point mutation is present.

Table 7
Examples of the design of possible control primers Primer View The sequence of the control primer (5 ’→ 3’) 1 Plasmopara viticola GCCTTGGGGACAAATGAGTTTTTTG (SEQ ID NO 85) 2 Erysiphe graminis f.sp. tritici / hordei GCCATACGGGCAGATGAGCCACTG (SEQ ID NO 86) 3 Rhynchosporium secalis TCCTTATGGACAGATGTCTTTATG (SEQ ID NO 87) 4 Pyrenophora teres ACCCTACGGGCAAATGAGCCTTTGAG (SEQ ID NO 88) 5 Mycosphaerella graminicola TACCTTATGGTCAAATGTCTTTATGA (SEQ ID NO 89) 6 Mycosphaerella fijiensis var. difformis GTTTTACCTTATGGTCAAATGTCTTTATG (SEQ ID NO 90) 7 Sphaerotheca fuliginea TTCCCTTCGGTCAAATGTCGCTCTGG (SEQ ID NO 91) 8 Uncinula necator TACCCTACGGGCAGATGAGCCTATGG (SEQ ID NO 92) nine Colletotrichum graminicola TACCTTACGGACAAATGTCATTATGA (SEQ ID NO 93) 10 Pythium aphanidermatum TACCTTGGGGTCAAATGAGTTTTTTGG (SEQ ID NO 94) eleven Colletotrichum gloeosporioides TACCTTATGGACAAATGTCATTATGA (SEQ ID NO 95) 12 Oidium lycopersicum TACCCTACGGGCAGATCAGCCTGTGG (SEQ ID NO 96) thirteen Leveillula taurica TACCATACGGACAAATGTCATTATGA (SEQ ID NO 97) 14 Pseudoperonospora cubensis TACCTTGGGGACAAATGAGTTTTTTGG (SEQ ID NO 98) fifteen Alternaria solani TTCCTTATGGGCAAATGTCTTTATGA (SEQ ID NO 99) 16 Cercospora arachidola TACCTTATGGACAAATGTCATTATGA (SEQ ID NO 100) 17 Rhizoctonia solani TTCCATACGGGCAAATGTCTCTGTGG (SEQ ID NO 101) eighteen Venturia inaequalis ACGTGTATGGTCAAATGAGCCTATGG (SEQ ID NO 102) 19 Magnaporthe grisea TACCTTATGGACAGATGTCATTATGA (SEQ ID NO 103) twenty Phytophthora infesians TACCTTGGGGACAAATGAGTTTTTTGG (SEQ ID NO 104) 21 Mycosphaerella musicola TACCTTATGGTCAAATGTCTTTATGA (SEQ ID NO 105)

Various methods can be used to detect the presence or absence of extension products of the diagnostic primer and / or amplification products. These methods will be apparent to those skilled in the art of nucleic acid detection procedures. Preferred methods do not require the use of radioactively labeled reagents. Particularly preferred detection methods are methods based on fluorescence detection of the presence and / or absence of extension products of a diagnostic primer. Specific detection methods include gel electrophoresis analysis, detection of the Scorpions ™ product described in PCT application GB 9803521, filed on behalf of Zeneca Limited on November 25, 1998, the disclosures of which are incorporated herein by reference, Tagman product detection ™, for example, described in patents with numbers US A-5487972 and US A-5210015; detection of the Molecular Beacons® product described in WO 9513399 and Raman surface-enhanced resonance spectroscopy (SERRS) described in patent application WO 9705280. Additional preferred detection methods include linear extension of ARMS (ALEX) and PCR with ALEX described in PCT published application number WO 99, 04037. When real-time detection is conveniently used. The use of the Scorpions ™ product detection described in PCT application GB 9803521 and published UK patent application number GB 2338301 is particularly preferred for use in all aspects of the invention described herein. The combination of ARMS and Scorpion technology described herein is particularly preferred for use in all aspects of the invention described herein, and a preferred detection method is fluorescence based detection method. Many of these detection methods are suitable for quantitative work using all of the primers described above. These different PCRs can be performed in different tubes or complexly in one tube. Using such methods, frequency estimates of point mutations present in the background of wild-type molecules can be made.

As exemplified herein, the inventors used DNA strand ABMS primers in combination with DNA reverse strand Scorpion detection as a detection method. Scorpion detection elements preferably include reverse primers shown in Table 6. It will be apparent to those skilled in the art that alternative combinations of ARMS primers and Scorpion detection elements may also be used. For example, a DNA strand primer can be a combination of an ARMS primer and a Scorpion detection system, and this could be used with a conventional DNA reverse chain primer, or a DNA reverse strand primer could be a combination of an ARMS primer with a system Scorpion detection, and this combination could be used with a conventional DNA strand primer.

In most of the examples described here, the Scorpion detection element is on a regular primer. An ARMS primer specific for a given mutation and wild-type sequence is used in combination with a conventional fluorescently labeled primer. These two reactions are carried out in different PCR tubes and fluorescence is emitted when the probe binds to the generated amplicon. Alternatively, a Scorpion element can be placed on ARMS primers. In this case, these two ARMS primers can be labeled with different fluorophores and used together with a common primer (this time unlabeled). These three primers can be included in the same reaction, as the resulting amplicons of the mutant and wild type will lead to different emitted fluorescence.

As described in UK published patent application number GB 2338301, the Scorpion method can be used in a number of different ways, such as an intercalation variant, where the tail of the Scorpion primer carries an intercalated dye that is able to be inserted between the bases of a double-stranded nucleic acid molecule, making it highly fluorescent ; FRET variant, where dyes included in the primer form an electron transfer pair; a variant without a quencher, where the fluorophore is attached to the tail of the Scorpion primer; bimolecular variant, where the fluorophore and quencher can be placed on two separate, but complementary molecules; a variant with a capture probe, where amplicons can be specifically captured and probed using the same non-amplified tail, and a Stem variant, where the primer tail contains self-complementary legs. These options are described in full form in the published patent application of the United Kingdom with the number GB 2338301, the description of which is incorporated herein by reference.

The methods of the invention described herein reliably detect a mutation in a fungal gene, where the presence of said mutation causes fungal resistance to the fungicide, the target protein of which is encoded by the mitochondrial gene, at a detection level in the range of 1 mutated allele per 1,000,000 wild-type alleles - 1 mutated allele per 10,000 wild-type alleles, and preferably in the range of 1 mutated allele per 100,000 wild-type alleles, 1 mutated allele per 10,000 wild-type alleles. The method of the present invention can also detect mutations occurring at a higher frequency, for example 1 mutated allele per 100 wild-type alleles, 1 mutated allele per 10 wild-type alleles, or when only mutated alleles are present. Similarly, the methods of this invention can be used to detect the frequency of occurrence of a wild-type allele in the background of mutated alleles.

The combination of elongation of an allele-specific primer made more sensitive using ARMS technology and the quantitative detection methods used in this invention makes this method an extremely valuable method for detecting fungal mutations occurring at a low frequency.

The detection of alleles present in specific isolates allows the results of phenotypic bioassays to be linked to the DNA profile of the target gene. The discovery of a single point mutation as a mechanism of resistance explains the qualitative nature of this resistance, and confirmation of the sequences of isolates from a single spore confirms the accuracy of screenings in determining the frequencies of stable and sensitive isolates in test samples.

The development of a method for combining allele-specific primer extension, ARMS specificity, and real-time fluorescence detection, exemplified here, with the Scorpion system allows us to analyze more samples for the presence of a resistance mutation than would be possible in a bioassay program. A larger number of samples makes it possible to identify resistance mutations at frequencies of lower percent than could be easily detected by bioanalysis. This allows you to identify resistance in a population before it is apparent from field data. The high-performance nature of this method allows you to take and test samples of wider areas and larger areas than would be possible using bioanalysis. Elongation of an allele-specific primer, such as ARMS associated with real-time fluorescence detection, allows the presence of a resistance gene in a population to be detected before the effects of this gene can be evaluated phenotypically using bioanalysis in heteroplasmic and / or heterocaryotic cells, which reduces sample classification error as sensitive when they carry a low frequency of resistance genotype. The results are obtained much faster through simultaneous reading (real time) in comparison with the expectation of the development of the disease in planta, which allows you to quickly respond to field situations and recommend more quickly provide measures to overcome resistance.

One or more diagnostic primers of the present invention may be suitably packaged with instructions for use in the methods of the present invention and suitable packaging and sold as a kit. These kits will conveniently include one or more of the following components: diagnostic, wild-type, control and normal oligonucleotide primers; suitable nucleotide triphosphates, for example dATP, dCTP, dGTP and dTTP, a suitable polymerase described above, and a buffer solution.

In a further aspect, the invention provides a method for detecting the resistance of a phytopathogenic fungus to a fungicide, said method comprising detecting a mutation in a fungal gene, where the presence of said mutation causes the appearance of fungal resistance to a strobilurin analog or any other compound in the same cross-resistance group, said method provides for the identification of the presence or absence of the indicated mutation in the fungal nucleic acid using the detection method tion polymorphism any (or a) single nucleotide.

In a further embodiment of this aspect, the invention provides a method for detecting the resistance of a phytopathogenic fungus to a fungicide, said method comprising detecting the presence of an amplicon generated during a PCR reaction, said PCR reaction comprising contacting a test sample containing fungal nucleic acid with a diagnostic primer in the presence of suitable nucleotide triphosphates and a polymerization agent, wherein the detection of said amplicon is directly related to the presence or absence of a mutation in said nucleic acid, where the presence of said mutation causes resistance to a fungicide whose target protein is encoded by the mitochondrial gene.

In a preferred embodiment of this aspect, this invention provides a method for detecting the resistance of a phytopathogenic fungus to a fungicide whose target protein is encoded by the mitochondrial gene, comprising contacting a test sample containing fungal nucleic acid with a diagnostic primer for a specific mutation, the presence of which causes resistance to the specified fungicide in the presence of suitable nucleotide triphosphates and a polymerization agent, so that the diagnostic primer is extended to GDSs said mutation is present in the sample; and detecting the presence or absence of said mutation by the presence or absence of a diagnostic primer extension product.

In a further preferred embodiment of this aspect, the present invention provides a method for detecting the resistance of a phytopathogenic fungus to a fungicide whose target protein is encoded by the mitochondrial gene, comprising contacting a test sample containing fungal nucleic acid with a diagnostic primer for a specific mutation, the presence of which causes resistance to the specified fungicide, in the presence of suitable nucleotide triphosphates and a polymerization agent, so that the diagnostic primer only fades when the specified mutation is present in the sample; and detecting the presence or absence of said mutation by the presence or absence of a diagnostic primer extension product.

The methods of the present invention described in the above aspect and variants are particularly suitable for use with phytopathogenic fungal strains, where the presence of a mutation in the cytochrome b gene causes resistance to fungicide and, most preferably, resistance to a strobilurin analog or compound in the same cross-section group stability, and most preferably, where a mutation in the fungal DNA causes the replacement of the glycine residue at the position corresponding to residue 143 of S. cerevisiae cytochrome b, more preferably This is a substitution of G ₁₄₃ A in the encoded protein, and especially where the mutation is the replacement of base G with base C in the second position in the codon, in the position corresponding to residue 143 of S. cerevisiae cytochrome b.

In a further aspect, the present invention provides a method for detecting and quantifying the frequency of a mutation causing resistance of a phytopathogenic fungus to a fungicide whose target protein is encoded by the mitochondrial gene, said method comprising detecting the presence or absence of a mutation in a fungal gene, where the presence of said mutation causes the appearance of a fungal resistance to the specified fungicide, and the specified method provides for the identification and quantification of the presence or absence of said mutation in fungal nucleic acid using a method for detecting polymorphism of any (or one) single nucleotide.

In a further preferred embodiment of this aspect, the present invention provides a method for detecting and quantifying a mutation frequency that causes the resistance of a phytopathogenic fungus to a fungicide whose target protein is encoded by the mitochondrial gene, said method comprising detecting the presence or absence of a mutation in the fungal gene, where the presence of said mutation causes the appearance of fungal resistance to a strobilurin analog or to a cross-stitch compound in the same group livability, and the specified method involves the identification and quantification of the presence or absence of the specified mutation in the fungal nucleic acid using the method for detecting polymorphism of any (or one) single nucleotide.

In a further embodiment of this aspect, this invention provides a method for detecting and quantifying the frequency of a mutation that causes the resistance of a phytopathogenic fungus to a fungicide whose target protein is encoded by the mitochondrial gene, the method comprising detecting the presence of an amplicon generated during a PCR reaction, said PCR being The reaction involves contacting a test sample containing fungal nucleic acid with suitable primers in the presence of a suitable their nucleotide triphosphates and a polymerization agent, wherein the detection of said amplicon is directly related to the presence or absence of a mutation in said nucleic acid, where the presence of said mutation causes resistance to a fungicide whose target protein is encoded by the mitochondrial gene, and the detection and quantification of the relative presence and absence of said mutations in the presence or absence of the amplicon generated during the PCR reaction.

In a preferred embodiment of this aspect, the invention provides a method for detecting and quantifying a mutation frequency that causes the resistance of a phytopathogenic fungus to a fungicide whose target protein is encoded by the mitochondrial gene, comprising contacting a test sample containing fungal nucleic acid with diagnostic primers for detection as presence , and the absence of a specific mutation in the specified nucleic acid, the presence of which causes the appearance of wh oychivosti to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerization, such that the diagnostic primers relating to otstutstviem and the presence of a specific mutation, are elongated when the appropriate fungal matrix is present in the sample; and detecting and quantifying the relative presence and absence of said mutation by the presence or absence of extension products of the diagnostic primer.

In a further preferred embodiment of this aspect, the invention provides a method for detecting and quantifying a mutation frequency that causes the resistance of a phytopathogenic fungus to a fungicide whose target protein is encoded by the mitochondrial gene, comprising contacting a test sample containing fungal nucleic acid with diagnostic primers to detect as the presence or absence of a specific mutation in said nucleic acid, the presence of which causes Adding resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerization, such that the diagnostic primers relating to the absence and the presence of the specific mutation, are elongated in only when the appropriate fungal matrix is present in the sample; and detecting and quantifying the relative presence and absence of said mutation by the presence or absence of extension products of the diagnostic primer.

The methods of the present invention described in the above aspect and variants are particularly suitable for use with phytopathogenic fungal strains, where the presence of a mutation in the cytochrome b gene causes resistance to fungicide and, most preferably, resistance to a strobilurin analog or compound in the same cross-section group stability, and most preferably, where the mutation in the fungal DNA causes the replacement of the glycine residue at the position corresponding to residue 143 of S. cerevisiae cytochrome b, more preferably about the replacement of G ₁₄₃ A in the encoded protein, and especially where the mutation is the replacement of base G with base C in the second position in the codon, in the position corresponding to residue 143 of S. cerevisiae cytochrome b.

In yet another aspect, the present invention provides a method for selecting an active fungicide and optimal levels of its application to a crop, comprising analyzing a sample of a fungus capable of infecting said crop, and detecting and / or quantifying the presence and / or absence of a mutation in a gene from said fungus, where the presence of this mutation may cause resistance to the fungicide, the target protein of which is encoded by the mitochondrial gene, and then the choice of the active fungicide and optima nyh levels of application.

In a particularly preferred embodiment of this aspect of the present invention, the detection method comprises a method for detecting polymorphism of any (or one) single nucleotide, and more preferably comprises contacting a test sample containing fungal nucleic acid with a diagnostic primer for a specific mutation in the presence of suitable nucleotide triphosphates and a polymerization agent, such that this diagnostic primer lengthens when the specified mutation is present in the sample; and detecting the presence or absence of said mutation by the presence or absence of an extension product of the diagnostic primer, and quantification is achieved by contacting a test sample containing fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid, the presence of which causes resistance to a fungicide, the target protein of which is encoded by the mitochondrial gene, in the presence of suitable nucleotide triphosphates and a polymerization agent, so that these diagnostic primers associated with the absence and presence of a specific mutation are extended when a suitable fungal matrix is present in the sample; and detecting and quantifying the relative presence and absence of said mutation by the presence or absence of extension products of diagnostic primers.

In a further particularly preferred embodiment of this aspect of the invention, the detection method comprises contacting a test sample containing fungal nucleic acid with a diagnostic primer for a specific mutation in the presence of suitable nucleotide triphosphates and a polymerization agent, so that this diagnostic primer is extended only when the mutation present in the sample; and detecting the presence or absence of said mutation by the presence or absence of an extension product of the diagnostic primer, and quantification is achieved by contacting a test sample containing fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid, the presence of which causes resistance to a fungicide, the target protein of which is encoded by the mitochondrial gene, in the presence of suitable nucleotide triphosphates and a polymerization agent, so that these diagnostic primers associated with the absence and presence of a specific mutation are lengthened only when a suitable fungal matrix is present in the sample; and detecting and quantifying the relative presence and absence of said mutation by the presence or absence of extension products of diagnostic primers.

The methods of the invention described herein are particularly suitable for use with phytopathogenic fungal strains, where the presence of a mutation in the cytochrome b gene causes resistance to a fungicide and, most preferably, resistance to a strobilurin analog or compound in the same cross-resistance group, and most preferably wherein the mutation in the fungal DNA gives rise to replace a glycine residue at position corresponding to residue 143 cytochrome b S. cerevisiae, more preferably ₁₄₃ C a replacement in the encoded protein And especially where the mutation is a replacement base G to the substrate in the second position in the codon at the position corresponding to residue 143 cytochrome b S. cerevisiae.

In yet another aspect, the invention provides a method for controlling a fungal infection of a crop, comprising applying a fungicide to the crop, wherein said fungicide is selected in accordance with any of the selection methods of the invention described above.

The method of the present invention described above is particularly suitable for use with phytopathogenic fungal strains, where the presence of a mutation in the cytochrome b gene causes resistance to a fungicide and, most preferably, resistance to a strobilurin analog or compound in the same cross-resistance group.

In yet another aspect, the invention provides an assay for detecting fungicidally active compounds, comprising screening these compounds against fungal strains that have been tested for the presence or absence of a mutation causing resistance to a fungicide whose target protein is encoded by the mitochondrial gene, in accordance with the methods of this inventions described herein, and then determining fungicidal activity against said fungal strains.

The methods of the present invention described herein are particularly suitable for use with phytopathogenic fungal strains, where the presence of a mutation in the cytochrome b gene causes resistance to a fungicide and, most preferably, resistance to a strobilurin analog or compound in the same cross-resistance group, and most preferably where a mutation in the fungal DNA causes the replacement of the glycine residue at the position corresponding to residue 143 of S. cerevisiae cytochrome b, more preferably the replacement of G ₁₄₃ A in the encoded protein, and especially where the mutation is the replacement of base G with base C in the second position in the codon, in the position corresponding to residue 143 of S. cerevisiae cytochrome b.

By applying the methods of the present invention described herein, an appropriate rate of application of fungicides and / or a suitable combination of fungicides for application to a given crop can be determined.

The methods of the present invention described herein are particularly suitable for monitoring fungal resistance to a strobilurin analog or compound in the same cross-resistance group in crops such as cereals, fruit and vegetables, such as rapeseed, sunflower, tobacco, sugar beets, cotton, soybeans, corn, wheat, barley, rice, sorghum, tomato, mango, peaches, apple trees, pears, strawberries, bananas, melons, potatoes, carrots, lettuce, cabbage, onions, grapes and lawn grass.

The methods of the present invention described herein are particularly sensitive for determining the low frequencies of mutations in mitochondria-encoded genes, such as the cytochrome b gene, which makes them particularly valuable and commercially important by screening phytopathogenic fungi for resistance to fungicides, where this resistance is a consequence mutations in the mitochondria-encoded gene.

Brief Description of the Drawings

The invention will now be illustrated with reference to the following non-limiting examples and drawings, in which:

Figure 1 shows a schematic representation of the secondary structure of Scorpion primer P. viticola using the MFold Zucker program.

Figure 2a shows a graphical illustration of the PCR amplification of serial dilution of P. viticola mutant DNA against wild-type DNA using a C-specific primer and Scorpion primer (in duplicate). As indicated in the figure, rhombs representing 50% C / G = line 1, rhombs representing 100% G, = line 7, circles representing 10% C, = line 2, circles representing 1% C, = line 3 , circles representing 0.1% C, = line 4, circles representing 0.01% C, = line 5, and circles representing NTC, = line 6.

Figure 2b shows a graph illustrating a complex experiment with P. viticola ARMS primers with two serial dilutions of mutant DNA in the presence of wild-type DNA (in duplicate). As indicated in this figure, the line represented by diamonds shows the results for 1: 100 Gfam, the line represented by triangles shows the results for 1: 500 Gfam, the line represented by circles shows the results for 1: 100 Ctet and the line represented by squares, shows results for 1: 500 Ctet.

Figure 3a shows a graph illustrating total E. graminis DNA amplified with three pairs of primers (specific G / C and control primers) (in duplicate). As shown in this figure, the line represented by diamonds shows the results for the 1/100 standard, the line represented by triangles shows the results for 1/100 Gmix and the line represented by crosses shows the results for 1/100 Cmix.

Figure 3b shows a graph illustrating the amplification of a sensitive isolate of E. graminis with three pairs of primers. As shown in this figure, the line represented by diamonds shows the results for Qmix, 1/100 = line 1, the line represented by squares shows the results for Qmix, 1/1000 = line 2, the line represented by triangles shows the results for Gmix, 1/100 = line 3, the line represented by circles shows the results for Gmix, 1/1000 = line 4, the line represented by crosses shows the results for Cmix, 1/100 = line 5, the line represented by rhombs shows the results for Cmix , 1/1000 = line 6.

Figure 4 shows a graph illustrating the amplification of a stable E. graminis isolate with three pairs of primers. As shown in this figure, the line represented by diamonds shows the results for Qmix, 1/100 = line 1, the line represented by squares shows the results for Qmix, 1/1000 = line 2, the line represented by triangles shows the results for Gmix, 1/100 = line 3, the line represented by rhombs shows the results for Gmix, 1/1000 = line 4, the line represented by crosses shows the results for Cmix, 1/100 = line 5, the line represented by circles, shows the results for Cmix , 1/1000 = line 6.

Figure 5a shows a graph illustrating PCR amplification of a serial dilution of wild type R. secalis plasmid amplified using a pair of wild type specific primers (in duplicate). As shown in this figure, the line represented by rhombs shows the results for the G plasmid 10 ^ 8, the line represented by triangles shows the results for the G plasmid 10 ^ 6, the line represented by squares shows the results for the G plasmid 10 ^ 4 and the line represented by circles shows the results for the G-plasmid 10 ^ 2.

Figure 5b shows a graph illustrating PCR amplification of the highest concentration of wild-type plasmid and mutant plasmid R. secalis amplified using a pair of wild-type specific primers (in duplicate). As can be seen from this figure, the line represented by rhombs shows the results for the G-plasmid 10 ^ 8, and the line represented by triangles shows the results for the C-plasmid 10 ^ 8.

Figure 6a shows a graph illustrating PCR amplification of a serial dilution of a mutant plasmid R. secalis amplified using a pair of mutant-specific primers (in duplicate). As shown in this figure, the line represented by rhombs shows the results for a C-plasmid 10 ^ 8, the line represented by triangles shows the results for a C-plasmid 10 ^ 6, the line represented by squares shows the results for C-plasmid 4 and the line represented by circles shows the results for the C-plasmid 10 ^ 2.

Figure 6b shows a graph illustrating PCR amplification of the highest concentration of wild-type plasmid and mutant plasmid R. secalis, amplified with a pair of mutant-specific primers (in duplicate). As can be seen from this figure, the line represented by rhombs shows the results for the G-plasmid 10 ^ 8, and the line represented by triangles shows the results for the c-plasmid 10 ^ 8.

Figures 7a, b and c show graphs illustrating the PCR amplification of R. secalis DNA and cDNA templates in three dilutions with a pair of G primers (in duplicate). As can be seen from these figures, the line represented by rhombuses shows total DNA, and the line represented by triangles shows cDNA.

Figures 8a, b, and c show graphs illustrating the PCR amplification of R. secalis DNA and cDNA templates in three dilutions with a pair of C primers (in duplicate). As can be seen from these figures, the line represented by rhombuses shows total DNA, and the line represented by triangles shows cDNA.

Figures 9a and b show graphs illustrating the amplification of P. teres isolates P13 and P15 in two dilutions with three pairs of primers (in duplicate). As shown in Figure 9a, diamonds representing S-mix = line 1, triangles representing S-mix 1/10, = line 2, squares representing G-mix, = line 3, circles representing G-mix 1/10 , = line 4, circles representing C-mix = line 5 and squares representing C-mix 1/10, = line 6. In figure 9b, rhombs representing s-mix, = line 1, triangles representing s-mix 1 / 10, = line 2, squares representing g-mix = line 3, circles representing g-mix 1/10, = line 4, circles representing c-mix, = line 5, and squares representing c-mix 1 / 10, = line 6.

DETAILED DESCRIPTION OF THE INVENTION

EXAMPLES

In the first four examples below, the Scorpion ™ system (AstraZeneca Diagnostics) was used as the product detection system. This detection system is fully described in PCT application number PCT GB 9803521, filed on behalf of Zeneca Limited on November 25, 1998, the disclosures of which are incorporated herein by reference. This new detection system uses a tail primer and an integrated signal transmission system. This primer has a matrix-binding region and tail containing a linker and a target-binding region. When used, the target binding region in the tail hybridizes to the complementary sequence in the primer extension product. This target-specific hybridization event is coupled to a signal transmission system in which hybridization results in a detectable change. The detection method of this system provides a number of significant advantages over other systems. Only one kind of primer / detector is required. This provides both increased simplicity and increased specificity based on the easy accessibility of the target binding region for hybridization with the primer extension product. The newly synthesized primer extension product is target-specific, so that the resulting output signal is directly related to the amount of extended primer. It does not depend on additional events of hybridization or enzymatic stages. Intra- and interchain competition for this site of the probe is limited, so that the design of the probe becomes simplified. Since this interaction is single-molecule, the signal transfer reaction is very fast, which makes it possible to increase cycle rates, which is an essential sign for experimental efficiency.

Scorpion primers designed in the examples described below have the following general modifications:

- Hexylene glycol monomer (HEG) as a blocking part of the molecule that is between the matrix binding region of the primer and the tail region, this part of the molecule preventing the polymerase-mediated copying of the tail region of the primer matrix.

- The fluorescent FAM molecule is added to the 5’-end of the primer. FAM is one of the fluorescent molecules that can, for example, be easily detected with a 488 nm laser from the ABI PRISM 7700 (PE Biosystems).

- MR is a non-fluorogenic quencher attached to the remainder of uracil.

Other fluorescent molecules and quenching mechanisms can also be adapted in the design of Scorpion primers and could be suitable for use in this invention.

In Example 4, an intercalating dye was also used as a detection mechanism. Eighteen examples together describe the characterization of partial sequences of the cytochrome b gene from a panel of important wild-type fungal isolates, while examples 1, 2, and 6 also describe the characterization of partial sequences of the cytochrome b gene from fungal isolates that are resistant to strobilurin analogs and other compounds in the same the cross-resistance group itself. These methods are particularly suitable for use with strobilurin analogs, azoxystrobin and picoxystrobin.

EXAMPLE 1

In Example 1, the inventors describe a partial sequence characterization of the Plasmopara viticola cytochrome b gene, a single polynucleotide (SNP) polymorphism characteristic that causes resistance to the strobilurin analog in P. viticola, and a real-time PCR Scorpion assay for monitoring this SNP in P . viticola. An integrated approach to real-time PCR analysis is also described. P. viticola is the causative agent of downy mildew in grapes.

The wild-type P. viticola isolate ES2B, sensitive to the strobilurin analogue, was collected in 1996 in Spain. This isolate has never been selected for the strobilurin analogue. Infected grapevine leaves were picked by hand and stored in a plastic bag and sent to Jealott’s Hill Research Station (Zeneca Agrochemicals). Upon arrival, the leaves were placed in pairs, along with sporulating surfaces without veins, on wet absorbent paper in plastic boxes and incubated for 24-48 hours at 21-24 ° C. Individual lesions were excised from leaves and sporangia suspended in 5 ml of deionized water, then sprayed onto the veined surfaces of 5-6-week-old grape seedlings (var. Ohanez). Freshly inoculated plants were incubated for 24 hours in a humidified chamber (at ambient temperature, relative humidity 100%), then moved to a growing room (day 24 ° C / room temp. 60%; night 18 ° C / room temp. 95%; day length 16 hours, 6000 lux). Plants were returned to the humidified chamber after 6 days for an additional period of 24 hours, after which successful infection was detected as sporulating lesions on the veinless surfaces of the leaves. Subsequent cultivation was carried out as described above, bringing the suspension of sporangia to 5000-10000 sporangia per ml.

The DNA fragment encoding a significant part of the wild-type P. viticola cytochrome b sequence was amplified using primers based on the conserved regions of the cytochrome b Phytophthora megasperma and Ashergillus nidulans (Cytbl2F (5 'TGAACATATTATGAGAGATGT 3') genes (SEQ ID NO: (5'AATTGCATAAAAAGGTAAAAA 3 ') (SEQ ID NO: 107), which reflect the sequence encoding the amino acid region 66-281 of fungal cytochrome b, based on the S. cerevisiae numbering system). DNA was extracted from the strobilurin analog-sensitive isolate using a phenol / chloroform extraction protocol. Sporangia was washed in 30 ml of bidistilled H ₂ O (ddH ₂ O) from six leaves with 90-100% disease damage (originating from artificially inoculated six-week-old grape seedlings). The sporangia suspension was filtered through Miraclots (Calbiochem cat # 475855) and centrifuged at 3600 rpm for 10 minutes at 4 ° C. Then the sporangia was frozen in liquid nitrogen and ground to a fine powder with a pestle and mortar, which were previously cleaned and sterilized by washing with acid and autoclaving. 0.5 ml of lysis buffer (200 mm Tris-Hcl (pH 8.5), 250 mm NaCl, 25 mm EDTA and 0.5% SDS) was added and the suspension was transferred into a sterile 1.5 ml Eppendorf tube with a screw cap. 0.5 ml of a phenol / chloroform mixture, isoamyl alcohol (25: 24: 1) was added immediately and mixed by inverting several times. The tubes were centrifuged for 30 minutes at 14,000 rpm and the aqueous phase was transferred to fresh Eppedorf tubes. Then extraction with phenol / chloroform, isoamyl alcohol was repeated, but this time the tubes were centrifuged at 14,000 rpm for only 15 minutes. After transferring the aqueous phase to a new Eppendorf tube, the last extraction with chloroform was performed. The fungal DNA was then precipitated by adding 0.1 volume of 3 M sodium acetate (pH 5.5) and 0.6 volume of isopropanol. After inverting several times, the tubes were centrifuged at 14,000 rpm for 20 minutes at 4 ° C. Then the DNA pellet was washed twice with 70% ethanol, dried in vacuo and resuspended in 50 μl of ddH ₂ O. The yield and DNA quality were checked by gel electrophoresis and serial dilution (1:10, 1: 100 and 1: 1000) was prepared in ddH ₂ O for use as a matrix material in subsequent PCR. PCR was performed as recommended by the manufacturer of Taq polymerase enzyme (Gibco) in a final reaction volume of 100 μl. Primers were added to the reactions to a final concentration of 1 pmol / μl. 10 μl of each DNA dilution was added to the corresponding PCR. Standard procedures were performed to limit the risk of PCR contamination. 30 cycles (94 ° C for 45 seconds, 42 ° C for 45 seconds and 72 ° C for 1 minute 30 seconds) were performed in a Hybaid Omn-E PCR instrument. The initial stage was also performed at 94 ° C for 3 minutes and the final extension at 72 ° C for 10 minutes. Then the effectiveness of PCR was evaluated by analysis of 18 μl of the reaction mixtures using gel electrophoresis. Then, a sample of 2 μl of PCR products ~ 500 bp cloned in the pCR2.1 TA-PCR cloning vector (Invitrogen Catalog No. K4500-01) and transformed into Escherichia coli cells (competent TOP10 One Shot ™ cells) according to the manufacturer's recommendations. A number of obtained clones were checked for the presence of inserts (inserts) by conducting Wizard minipreps (Promega catalog No. A7100) in accordance with the manufacturer's instructions and restriction analysis using EcoRI. 6 clones with suitable inserts (~ 500 bp) were then sequenced using direct and reverse primers M13 (automatic sequencer ABI377XL). When analyzing the nucleotide sequence data from these studies using relevant bioinformatics software (Seqman, Editseq and Macaw), it was found that the obtained new sequence encodes a new cytochrome b gene with close homology to other known cytochrome b oomycete sequences, such as P. megasperma. The sequence containing 61 nucleotides of the obtained P. viticola segment encoding 30 bp higher upstream and downstream from the second base of the C ₁₄₃ codon (according to the S. cerevisiae amino acid numbering system), can be found in Table 3.

P. viticola-specific primers based on the above assays used in subsequent amplifications of the region of interest of cytochrome b were PLAS17F (5 'AAATAACGGTTGGTTAATTCG 3' (SEQ ID NO: 108) and PLAS15R (5 'TCTTAAAATTGCATAAAAAGG 3' (SEQ ID NO: 108) ), reflecting the amino acid region 73-283 of the fungal cytochrome b according to the S. cerevisiae numbering system.

The strobilurin analog resistant P. viticola isolate was identified at one test site. Infected grape leaves were harvested and processed essentially as described above, although the samples were subcultured as mass populations and not isolated as individual lesions before testing. The test method for confirming resistance to the analogue of strobilurin was (24 hours) spraying on 4-week-old grape seedlings. A series of chemical dilutions was prepared by dissolving 5 mg of the strobilurin analog (the strobilurin analog in the examples here refers to azoxystrobin) (technical material, 97% purity) in 1 ml of acetone and subsequent dilution in deionized water at room temperature to obtain a dose of 10 ppm . (the dose, which, as you know, gives 100% destruction of the base isolate sensitive to the analogue of strobilurin). The non-venous surfaces of the target leaves were sprayed using a DeVilbiss 10 psi spray gun. inch to maximum retention. Control plants were sprayed only with deionized water. Treated plants were allowed to dry in the growing room (conditions as described above) overnight. P. viticola test inoculation was performed at 5000 sporangia per ml and freshly inoculated plants were incubated as described previously. 7 days after inoculation, any potentially stable neoplasm on the treated leaves was isolated and subcultured to provide sufficient material for PCR analysis. This isolate was named T5.

A partial sequence of the cytochrome b gene was amplified with primers PLAS17F and PLAS15R from a stable isolate (T5). Total genomic DNA (nuclear and mitochondrial) from this isolate was extracted using the phenol / chloroform extraction protocol described above. Again, the presence and quality of DNA was checked by gel electrophoresis and suitable aliquots were diluted 1:10 and 1: 100 in ddH ₂ O for PCR studies. Then, 10 μl of each DNA dilution was added to Taq Ready To Go ™ PCR pellets (Amersham Pharmacia Biotech product number 27-9555-01) and adjusted to 25 μl with PLAS17F and PLAS15R primer solutions to a final primer concentration of 1 pmol / μl in every case. Standard procedures were performed to limit the risk of PCR contamination. 30 cycles of 94 ° C for 45 seconds, 52 ° C for 45 seconds and 72 ° C for 1 minute 30 seconds were performed in a Hybaid Omn-E PCR instrument. The initial stage was also performed at 94 ° C for 3 minutes and the final extension at 72 ° C for 10 minutes. These PCRs were performed in duplicate. After analyzing 10 μl of these PCRs using gel electrophoresis on 0.8% TBE-agarose gel, the resulting PCR products are ~ 500 bp. combined before cloning. Then, a sample of 1 μl of the combined PCR products was cloned into the pCR2.1 TA cloning vector (Invitrogen) and transformed into E. coli cells (competent TOP10 One Shot ™ cells) according to the manufacturer's recommendations. A number of obtained clones were checked for the presence of inserts by conducting Wizard minipreps (Promega) in accordance with the manufacturer's instructions and restriction analysis using EcoRI. 10 clones with inserts of the correct size (~ 500 bp) were then sequenced using M13 forward and reverse primers (automatic ABI377XL sequencer).

Analysis of these nucleotide sequences using the relevant bioinformatics software (Seqman, Editseq and Macaw) in all 10 cases revealed a point mutation G → C in the cytochrome b sequence when compared with the wild-type sequence. This point mutation of DNA leads to the only replacement of glycine with alanine at position 143 (according to the S. cerevisiae amino acid coding system).

Various specific P. viticola ARMS primers were designed to detect the presence or absence of a point mutation G ₁₄₃ A:

two direct wild type ARMS primers:

and a control primer designed higher upstream of this point mutation:

STAND: GCCTTGGGGACAAATGAGTTTTTTG (SEQ ID NO: 114)

In all of the above ARMS primers, base -1 (3’s base of the primer sequence) corresponds to the target site of the point mutation. Bases shown in bold differ from the sequence of cytochrome b P.viticola. In all ARMS primers (not in the control primer), the base -20 was changed from base G to base T. This was done to destroy continuously located bases G. In primers G-sp-f-2 and C-sp-f-2 position -2 was changed from base G to base A. In G-sp-f-1, position -3 was changed from base G to base T. In primer C-sp-f-1, base -2 was changed from base G to base C. These changes in the sequence were made to destabilize the primer and make any extension of the primer more specific with respect to guide matrix. Examples in the literature have shown that destabilizing an ARMS primer reduces the risk of erroneously priming an primer on an erroneous matrix (Newton et al., Nucleic Acid Research 17 (7) 2503-2516 1989).

The Scorpion ™ product detection system was used in this case as the detection mechanism, and this detection system was included on the reverse primer. The resulting amplicon was 234 bp in length. with ARMS primers and a length of 235 bp with control primer. The Scorpion primer was designed using Oligo 5 and MFold programs (MFold predicts optimal and suboptimal secondary structures for RNA or DNA molecules using the Zucker energy minimization method (Zucker, M. (1989) Science 244, 48-52; SantaLucia, J J. J. (1998), Proc. Natl. Acad. Sci. USA 95, 1460-1465). The sequence of the Scorpion primer P. viticola was:

The underlined areas are hairpin-forming parts, FAM is a fluorescein dye, MR is a non-fluorogenic quencher attached to a uracil residue, and HEG is a replication blocking hexylene glycol monomer. The sequence in italics is the reverse primer sequence, and the sequence in bold is the Scorpion sequence that binds to the extension product of the reverse primer.

The secondary structure of the loop with the stem of this Scorpion primer can be visualized using the MFold program (see figure 1). It is predicted that it has an energy of -2.2 kcal / mol in its inert form. However, in the presence of an elongation product, the hairpin structure diverges, since the sequence of the Scorpion primer probe binds to this elongation product with a predicted energy of -6.1 cal / mol. This separates the FAM dye from its quencher, causing the emission of fluorescence detected, for example, using the ABI PRISM 7700 instrument. Annealing the Scorpion element to the newly synthesized chain is therefore energetically favorable compared to the configuration of the loop with the Scorpion stem in its inert state.

All primers were synthesized by the Oswell DNA Service (Lab 5005, Medical and Biological Sciences Building, Southhampton). Before use, the primers were diluted to 5 μM in a total volume of 500 μl ddH ₂ O each. The primers were then further diluted to a final concentration of 500 nM in PCR.

In all cases, the AmpliTaq Gold enzyme (Perkin-Elmer / ABI) was included in the reaction mixture at 1 unit / 25 μl of reaction. The reaction mixture also contained 1x buffer (10 mM Tris-Hcl (pH 8, 3), 50 mM KCl, 3.5 mM MgCl ₂ , 0.01% gelatin) and 100 μM dNTP. Amplifications were performed in an ABI PRISM 7700 instrument for continuous monitoring of fluorescence. A preliminary cycle of 95 ° C for 10 minutes was carried out followed by 50 cycles of 95 ° C for 15 seconds and 60 ° C for 45 minutes. Fluorescence was monitored during the annealing step of elongation in all cycles.

Primers were first evaluated for use in such assays using plasmid DNA as a template at various concentrations. This was done to verify the specificity and sensitivity of the primer constructs. A partial sequence of the wild-type cytochrome b gene and the corresponding segment containing the G ₁₄₃ A mutation were cloned into the TA pCR2.1 vector (Invitrogen) for use in this evaluation process. Primers C-sp-f-2 and G-sp-f-2 were more preferable than primers C-sp-f-1 and G-sp-f-1, since PCR in duplicate gave more consistent results and were slightly more specific. In all cases, plasmid DNA was diluted in 1 mg / ml bovine serum albumin (BSA).

The graph shown in Figure 2a illustrates PCR, where dilution of a mutant plasmid against a wild-type matrix was amplified using a C-sp-f-2 ABMS primer. Since dilution of the C plasmid decreases with the wild-type plasmid, fluorescence detection is delayed. In all cases, the final concentration of the plasmid in PCR was 1 × 10 ⁷ molecules / μl. With every 10-fold dilution of the C-plasmid, there is a 3-4 cycle delay in detecting fluorescence. When the C-plasmid is present at only 1 in 10,000 copies in the wild-type plasmid, it is still detected with this specific ARMS primer. The C-sp-f-2 primer is completely specific for its corresponding template, since fluorescence is not detected in a 100% wild-type plasmid probe in this experiment.

We investigated various possible materials that could be used as starting material for stability monitoring analyzes using Scorpion technology. Three different isolates were used in this study. For each of these isolates, sporangia were collected both directly from the diseased grape leaves in the open air and artificially inoculated leaves grown in the greenhouse (as described previously). In both cases, the sporangia were washed off the leaves with ddH ₂ O. Then, the sporangia were collected by centrifugation and kept at -80 ° C until use. Sporangia samples were then resuspended in 1 ml of ddH ₂ O and diluted 1:10 and 1: 100 again in ddH ₂ O. Real-time PCR analyzes were performed as described above, except that bovine serum albumin was also added to each PCR ( 0.25 μg / μl) using 5 μl of each dilution as a matrix. Each dilution was performed in duplicate, with C-sp-f-2, G-sp-f-2 and a control forward primer (each) added with the usual reverse Scorpion primer. The use of sporangia collected from grape leaves grown in a greenhouse as a starting material gave good results with consistent threshold cycle values (Ct). The use of sporangia collected directly from grape leaves in the open air gave poor results, so the following two approaches were used to improve the quality of these data: to reduce inhibition in PCR (field material will contain much more possible impurities compared to leaves grown in a greenhouse plants) and in order to make this DNA more accessible for amplification.

To reduce the effect of inhibitory components on PCR, the concentration of BSA added to the reactions was increased, and Tween-20 detergent was added to PCR. In order to make DNA more accessible for amplification, initial PCR was performed and the PCR product from this reaction was used as a matrix in real-time PCR, spore dilutions were boiled for 10 minutes before being added to real-time PCR to improve cell lysis, and DNA was extracted from a dispute using 3 different protocols (DNA isolation instrument from Genosys Biotechnologies Inc., DNAzol from Helena Biosciences and Qiagen DNeasy plant mini kit). Each method was tested in turn with sporangia or DNA diluted 1:10, 1: 100 and 1: 1000 in ddH ₂ O as a matrix. Each dilution was tested in triplicate with the ARMS primers C-sp-f-2 and G-sp-f-2 and a control primer; all with reverse normal scorpion primer. 5 μl of each matrix was added to the PCR tests and the conditions were essentially the same as described previously, but with the addition of 0.25 μg / μl BSA (when the concentration of BSA was not variable). DNA extracted using DNAzol or Qiagen DNA preps gave good and consistent results.

The frequency of occurrence of alleles G ₁₄₃ and A ₁₄₃ was evaluated in P. viticola isolate collected from a field test (designated 17A). Sporangia were collected in a flush of ddH ₂ O 120 leaves and precipitated by centrifugation. This sample contained approximately 2,400 lesions and 6.4 × 10 ⁷ sporangia. 12 × 10 ⁶ sporangia were stored at -80 ° C for use in DNA extraction. Genomic DNA was extracted using the DNeasy plant Minikit kit (Qiagen catalog No. 69103) and the resulting DNA was diluted 1:10 and 1: 100 in ddH ₂ O for use as a template for real-time PCR analysis. PCR conditions were the same as described above. The obtained cycle thresholds (Ct) were 20 for the G-specific primer and 34 for the C-specific primer, giving the Ct difference of 14 cycles and, therefore, the frequency of occurrence of resistant alleles was approximately 1 in 10,000.

An integrated approach was also evaluated. In this case, the Scorpion detection element was placed on ARMS primers to allow amplification by PCR of the G ₁₄₃ and A ₁₄₃ alleles in the same PCR. The sequences of Scorpion / ARMS primers were as follows:

G ₁₄₃ allele-specific primer:

The details of the Scorpion detection element are the same as described above. A ₁₄₃ allele-specific primer was labeled TET to distinguish between these two amplicons. Used the usual reverse (unlabeled) primer:

Reverse 5’CATAACCAGTCAACAACTTCTTTTCC 3 ’(SEQ ID NO: 121).

The amplicon generated in both cases was 95 bp in length. Scorpion primers were again designed using Oligo 5 and MFold (as described above). The other components of real-time PCR were the same as described above, and only the concentration of primers was varied during the evaluation of this integrated approach. By reducing the final concentration of G FAM Scorpion to 100 nM and maintaining the final concentration of C TET Scorpion and the reverse primer at 500 nM, at least 1: 500 C: G ratios can be reliably detected using plasmid DNA as a template (see Figure 2b).

EXAMPLE 2

In Example 2, the authors describe the characterization of partial sequences of the Erysiphe graminis f.sp. cytochrome b genes. tritici and hordei, a characteristic of SNP that causes resistance to strobilurin analogs or compounds in the same cross-resistance group, and a description of the Scorpion analysis of real-time PCR to monitor this SNP in E. graminis f.sp. tritici and hordei.

Isolates of E. graminis f.sp. tritici and f.sp. hordei (causative agents of powdery mildew of wheat and barley) were collected in Northern France, Germany, Ireland and the United Kingdom of Great Britain and Northern Ireland. The collection was carried out in one of two ways: manual collection of field leaves or sampling of air spores using a car-mounted jet trap for dispute (Burkard Manufacturing Co. Ltd., Rickmansworth, UK).

Wheat leaves infected with sporulating powdery mildew were collected from places where these populations were exposed to strobilurin analogues in multiple trials. Upon returning to the laboratory, the leaves were placed in plastic bags and incubated at 21 ° C overnight. The next day, pustules re-formed spores. All pustules were subcultured by extracting from infected leaves above fresh leaf areas (cv Rapier wheat, 9 days old), placed on filter paper (Whatman No. 1) in 9 cm Petri dishes containing 1.2% agar in water. Freshly inoculated plates were incubated for 7 days and then the resulting colonies were tested for sensitivity to strobilurin analogs.

To extract spores, wheat leaves were cut from 9-day-old plants (cv. Rapier) and placed on 1.8% agar in water in plastic cups and kept at 5 ° C until use.

A jet trap for spores was mounted at the top of the car and this car drove at speeds up to 90 km per hour on predefined roads in each country. Plastic cups containing pieces of leaves were placed at the base of the spore trap column to allow airborne spores to enter the trap and settle on the leaves. Cups were replaced approximately every 80 km. Once a series of leaf pieces were used in a spore trap, they were transferred to square Petri dishes (10 cm ² ) containing 60 ml of 1.8% agar in water and filter paper, and stored at 5 ° C.

Upon returning to Jealott’s Hill, leaves exposed to spores in a spore trap were incubated at a constant temperature (day length 16 hours, light 4-5000 lux, temperature 21 ° C, relative humidity is the same as in the environment). After 5-6 days after being kept in a spore trap, it was possible to see that E. graminis pustules had formed (small yellowing zones of the sheet material with the subsequent appearance of mealy sporulating lesions). They were either subcultured on leaf pieces in 9 cm Petri dishes in the form of “populations” (one population at the sampling stage), or cut out as a single pustule isolate and incubated separately on leaf pieces in 5 cm Petri dishes per 15 ml 1.2% agar in water coated with filter paper. Leaf pieces inoculated with E. graminis populations were incubated for 7 days, after which sporulation was sufficient for inoculation in a phenotypic resistance analysis. Single spore isolates were incubated for 7 days, but subcultured one more time to provide sufficient material for testing. If sporulation was weak, the above process was repeated until a good (60-70%) sporulatory coating of the disease on all leaf pieces was obtained to generate enough conidia for analysis.

Testing and subsequent maintenance of stable isolates was carried out on leaves separated from wheat seedlings, treated 24 hours before inoculation with an aqueous solution of the strobilurin analog at 5 ppm. (the dose that is known to give 100% destruction of strobilurin-sensitive background isolates) and the moisturizing agent Tween 20. The isolates were tested either as mass populations or as isolates of one pustule. Conidia were inoculated dry on the treated leaf pieces. Infected material was incubated in a controlled environment (as described above) for 7 days before evaluation.

Any neoplasm (growth) on pieces of leaves treated with strobilurin analog at 5 ppm was considered as potentially stable. The material from these lesions was additionally subcultured on strobilurin analog-treated leaves to confirm in planta resistance and analyzed using the molecular analysis described in this application. Frequencies of phenotypic resistance of approximately 1 in 100 and higher could be detected by screening of the mass population, and more accurate frequencies were estimated by comparing isolates from a single spore, where the neoplasm on the treated leaves was comparable to the controls (stable), with cups where the treated leaves gave 100% extermination of the disease (sensitive).

Partial sequence of the cytochrome b gene of E. graminis f.sp. tritici were amplified using primers based on conserved regions of the Aspergillus niger and Neurospora crassa cytochrome b genes (Cytb3F (5 'CAGCTTCAGCTTTCTTCT 3') SEQ ID NO: 122) and Cytb9R (5 'ACTTAAAGGTCTAAATTG 3) determine the sequence encoding the amino acid region 86-322 of the fungal cytochrome b based on the S. cerevisiae numbering system). Approximately 500 mg of conidia from the strobilurin analog sensitive isolate that was not selected for the strobilurin analog was collected by extraction directly from leaves with sporulating disease into 1.5 ml Eppendorf tubes. DNA was extracted from this conidial sample using a phenol / chloroform extraction protocol (see above). The presence and quality of DNA was analyzed by gel electrophoresis and serial dilution (1:10, 1: 100 and 1: 1000) was done in ddH ₂ O for use as a matrix material in PCR reactions. PCR was established as recommended by the manufacturer of Taq polymerase enzyme (Gibco) in a final volume of 100 μl and the primers were added to the reactions to a final concentration of 1 pmol / μl. 10 μl of each DNA dilution was added to the corresponding PCR. Careful procedures have been taken to limit the risk of PCR contamination. 30 cycles (94 ° C for 45 seconds, 42 ° C for 45 seconds and 72 ° C for 1 minute 30 seconds) were performed in a HyBaid Omn-E instrument. An initial incubation at 94 ° C. for 3 minutes and a final extension at 72 ° C. for 10 minutes were also performed. Then the effectiveness of PCR was evaluated by analysis of 18 μl of the reaction mixtures by gel electrophoresis. A sample of 2 μl of PCR products ~ 500 bp cloned in the pCR2.1 TA cloning vector (Invitrogen) and transformed into E. coli cells (competent TOP10 One Shot ™ cells) according to the manufacturer's recommendations. A number of obtained clones were checked for the presence of inserts by conducting Wizard minipreps (Promega) in accordance with the manufacturer's instructions and restriction analysis using EcoRI. 6 clones with inserts of the correct size (~ 500 bp) were then sequenced using M13 forward and reverse primers (automatic ABI377XL sequencer). When analyzing the nucleotide sequence data from these studies using relevant bioinformatics software, it was found that the obtained new sequence encodes a new cytochrome b gene with close homology to other known cytochrome b ascomycetous sequences. A segment of 61 nucleotides encoding 30 bases upstream and 30 bases downstream from the second base of the C ₁₄₃ codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

Specific primers for E. graminis designed based on this new sequence were used in subsequent amplifications of the cytochrome b region of interest. These primers were ERY11F (5 ’ATGAACAATTGGTACAGTAAT 3’) (SEQ ID NO: 124) and ERY12R (5 ’GTTAGGTATAGATCTTAATAT 3’) (SEQ ID NO: 125). Together they represent a sequence encoding the amino acid region 114-287 of fungal cytochrome b according to the S. cerevisiae coding system.

A partial sequence of cytochrome b was amplified with primers ERY11F and ERY12R from a population of E. graminis f. sp. tritici resistant to strobilurin analogue. Conidia (~ 200 mg) were suspended in 200 μl of ddH ₂ O and diluted 1:10, 1: 100 and 1: 1000 in ddH ₂ O. 10 μl of each dilution of conidia was added to Taq Ready To Go ™ PCR pellets (Amershara Pharmacia Biotech product number 27-9555-01) and brought up to 25 μl with ERY11F and ERY12R primer solutions to a final primer concentration of 1 pmol / μl. Standard procedures were performed to limit the risk of PCR contamination. 30 cycles of 94 ° C for 45 seconds, 52 ° C for 45 seconds and 72 ° C for 1 minute 30 seconds were performed in a Hybaid Omn-E PCR instrument. The initial stage was also included at 94 ° C for 3 minutes and the final extension at 72 ° C for 10 minutes. All PCR in this case was performed in triplicate. After analyzing 10 μl of these PCRs using gel electrophoresis on 0.8% TBE-agarose gel, the resulting PCR products are ~ 500 bp. combined before cloning. Then, a sample of 2 μl of the combined PCR products was cloned into the pCR2.1 TA cloning vector (Invitrogen) and transformed into E. coli cells (competent TOP10 One Shot ™ cells) according to the manufacturer's recommendations. A number of obtained clones were checked for the presence of inserts (inserts) by conducting Wizard minipreps (Promega) in accordance with the manufacturer's instructions and restriction analysis using EcoRI. 10 clones with inserts of the expected size (~ 500 bp) were then sequenced using forward and reverse primers M13 (automatic sequencer ABI377XL). Analysis of these sequences obtained using suitable bioinformatics software in all 10 cases revealed a point mutation G (C in the cytochrome b sequence when compared with the previously obtained wild type cytochrome b gene sequence E. graminis f.sp. tritici. This point mutation DNA results in a single glycine to alanine substitution at position 143 (according to the S. cerevisiae amino acid coding system).

A partial sequence of the cytochrome b gene was also characterized from two isolates of E. graminis f.sp. hordei. Small samples of conidia (~ 100 mg) were extracted from infected barley leaves (which were obtained as described previously for wheat) into sterile Eppendorf tubes. These conidial samples were stored at -80 ° C until use. Then, each sample was re-suspended in 200 μl of ddH ₂ O, an additional dilution of 1:10 and 1: 100, and 10 μl of each dilution were used as amplification matrices. Partial sequences of the cytochrome b gene were amplified with primers ERY11F and ERY12R. The conditions and components of the PCR were as described previously. Upon analysis by gel electrophoresis, a PCR product of the expected size (~ 500 bp) was detected. This product was cloned into TA pCR2.1 vector and sequenced as previously described. When analyzing the sequence, it was found that the sequence of the cytochrome b gene amplified from E. graminis f.sp. hordei was identical to the sequence from E. graminis f.sp. tritici except 1 bp (replacement of T by A) 379 bp downstream of the second base of the codon G ₁₄₃ . This substitution of bases does not lead to the replacement of the amino acid in the final protein (i.e., it is a silent mutation).

31 different E. graminis isolates were examined using the protocol described above, and in all cases the detected sequence coincided with the G ₁₄₃ A mutation, which is the reason for the resistance to strobilurin analogs in E. graminis f.sp. tritici. The resistance allele A _{143 was} not found in samples of E. graminis f.sp. hordei.

Specific ARMS primers of E. graminis were constructed based on the above information on the point mutation G ₁₄₃ A:

direct ARMS primer based on the wild-type sequence:

and a control primer designed higher upstream of this point mutation:

STAND2: GCCATACGGGCAGATGAGCCACTG (SEQ ID NO: 128)

In both primers G-sp-1 and C-sp-1, base -1 (3'-terminal base) corresponds to the second nucleotide of codon G ₁₄₃ / A ₁₄₃ . Bases in primers that differ from the wild-type E. graminis cytochrome b sequence are indicated in bold. Position -2 was changed from base G to base A. This was done to destabilize the primer, which is normal in ARMS reactions.

The Scorpion ™ product detection system was used in this case as a detection mechanism. Again, the Scorpion primer was designed using Oligo 5 and MFold. (see details in example 1). The sequence of Scorpion primer E. graminis was:

The underlined areas are hairpin-forming parts, FAM is a fluorescein dye, MR is a non-fluorogenic quencher attached to the uracil residue, and HEG is replication-blocking hexylene glycol monomer. The sequence in italics is the reverse primer sequence, and the sequence in bold is the Scorpion sequence that binds to the extension product of the reverse primer.

All primers were synthesized by the Oswell DNA Service. Before use, the primers were diluted to 5 μM in a total volume of 500 μl each. The primers were then further diluted to a final concentration of 500 nM in PCR.

Primers were first evaluated for use in ARMS, Scorpion assays using plasmid DNA and total DNA as template. This was done to verify the specificity and sensitivity of the primer constructs. DNA fragments containing a partial sequence of the wild-type cytochrome b gene and the corresponding sequence containing the G ₁₄₃ A mutation were cloned in TA pCR2.1 vector for use in the evaluation process. Plasmid DNA was always diluted in 1 mg / ml BSA before use as a template in real-time PCR assays. Fungal DNA was extracted for analysis from a control isolate of E. graminis f.sp. tritici sensitive to the strobilurin analogue using a phenol / chloroform extraction method (as described previously). Then a conidial test of E. graminis f.sp. tritici from a strobilurin analogue sensitive isolate from France (F12C) and a conidial test of E. graminis f.sp. tritici from germ-resistant strobilurin from Germany (11-8) was tested using tested primers at two dilutions of conidia. All three fungal isolates came from individual pustules.

In all cases, the AmpliTaq Gold enzyme (Perkin-Elmer, ABI) was included in the reaction mixture at 1 unit / 25 μl of reaction. The reaction mixture also contained 1x buffer (10 mM Tris-Hcl (pH 8.3), 50 mM KCl, 3.5 mM MgCl ₂ , 0.01% gelatin) and 100 μM dNTP. Amplifications were performed in an ABI PRISM 7700 instrument for continuous monitoring of fluorescence. Pre-incubation of 95 ° C for 10 minutes was carried out followed by 50 cycles (95 ° C for 15 seconds and 60 ° C for 45 minutes). Fluorescence was monitored during the annealing / elongation step in all cycles.

When tested against control matrices (plasmids and DNA from a strobilurin-analogue control isolate), E. graminis ARMS / Scorpion primers showed good specificity without evidence of erroneous priming originating from erroneous matrices. Figure 3a shows the amplification of the strobilurin analogue control DNA of E. graminis at a dilution of 1: 100 with three primer mixtures (Stand 2 + Scorpio E. graminis, G-sp-1 + Scorpio E. graminis and C-sp-1 + Scorpio E. graminis). Each reaction was carried out in duplicate. Reactions with control and G-specific primers emit a strong fluorescence signal, while a reaction with a C-specific primer does not show any increase in fluorescence. The control and G-specific ARMS primers recognized the template and bound to it, while the C-specific primer did not bind to the template present in the reaction. In this case, the analysis of the G ₁₄₃ : A ₁₄₃ allele indicates the presence of only the wild-type allele.

Figure 3b illustrates PCR where the French sensitive isolate (F12C) was analyzed with three primer mixtures (Stand 2 + Scorpion E. graminis, G-sp-1 + Scorpion E. graminis and C-sp-1 + Scorpion E. graminis). In each case, ~ 200 mg of conidia was suspended in 200 μl of ddH ₂ O and diluted 1: 100 and 1: 1000 in ddH ₂ O. 5 μl of these dilutions were added to appropriate PCR. Again, when analyzing the reaction with the control and G-specific primers, a strong fluorescence signal is emitted, while the reaction with the C-specific primer does not show any increase in fluorescence. This indicates that only the wild-type allele was detected in this sample. There is a certain delay in the fluorescence produced when using conidia as a template for this reaction, compared to using plasmid DNA as a template. This is caused either by a decrease in copies of molecules that can be used as the matrix present in this reaction, or by inhibitory components present in the conidial sample.

Figure 4 illustrates PCR in which a stable isolate from Germany in two conidial dilutions was amplified using three primer mixtures (Stand 2 + Scorpio E. graminis, G-sp-1 + Scorpio E. graminis and C-sp-1 + Scorpio E. graminis). In this case, reactions with the control and C-specific primers emit strong signals, while the reaction with the G-specific primer does not show any fluorescence. This indicates that only the mutant allele G ₁₄₃ A was detected in this sample.

EXAMPLE 3

In Example 3, the inventors describe a partial sequence characterization of the Rhynchosporium secalis cytochrome b gene and a real-time PCR study in which various R. secalis isolates were screened for the G ₁₄₃ A resistance allele. This is an example in which G ₁₄₃ A analysis was performed in species, which this point mutation has not previously been identified.

Wild-type R. secalis isolates were collected in the United Kingdom and France (see table 8: details for R. secalis isolates). Isolates K1124 and K3327 can be considered as a “background” (collected before strobilurin analogs were used in the field), while other isolates were obtained from test sites that were subjected to several sprinkling with strobilurin analogues for several seasons. Infected barley leaves were picked manually and stored in a plastic bag and sent to Jealott, s Hill Research Station (Zeneca Agrochemicals). Upon arrival at the laboratory, individual lesions were excised from the leaves, surface sterilized in ethanol (30 seconds), followed by washing with 0.1% sodium hypochlorite solution (2 minutes) and then placed on lima agar-beans (see table 9) and incubated during the cycle alternating 12 hours of thermal radiation (365 nm Philips TLD 18W / 08 - Philips Light Ltd., Croydon, UK) / 12 hours without light at a constant temperature of 19 ° C for 4-5 days. Colonies grown from these lesions were subcultured as a suspension of uncounted spores on lima bean agar and incubated as described above for approximately 7 days prior to spore formation. The resulting spores were removed and stored in liquid nitrogen until isolates were used. Recovery of the isolates was achieved by inoculating a spore suspension on lima agar-beans and incubating as described above for approximately 7 days until spore formation.

Table 8
Details regarding isolates of R. secalis Isolate Code Country of origin K1124 United Kingdom K3327 United Kingdom K3274 United Kingdom K3276 United Kingdom K3278 United Kingdom

A partial sequence of the cytochrome b gene was obtained from two isolates of R. secalis (K1124 and K3327). These isolates were grown from a suspension of 100,000 spores per ml, inoculated into a medium with an unfermentable carbon source, shaken at 85 rpm for 21 days at 19 ° C (12 hours light / 12 hours darkness) and the mycelia were collected by filtration through Miraclots and frozen at -20 ° C until use. DNA was obtained from these mycelia using a phenol / chloroform extraction protocol (see Example 1). The yield and quality of DNA was checked by gel electrophoresis and then the initial serial dilutions (1:10, 1: 100 and 1: 1000 in ddH ₂ O) were prepared for use as matrices in PCR amplifications. PCR was performed as described in the previous examples. Either degenerate primers (deg4F (5 'AGGTYTRTAYTRYGGDTCWTA 3') (SEQ ID NO: 131) and deg3R (5 'AGCDATAACWCCTAATAATT 3') (SEQ ID NO: 132) constructed from homologous regions of the cytochrome b fungal genes (defining a sequence encoding amino acid region 100-294 according to the S. cerevisiae coding system), or E. graminis-specific primers ERY11F and ERY12R (details as in Example 2). The band of the expected size (~ 500 bp was amplified using both pairs of primers from each isolate and each PCR product was cloned into TA pCR2.1 vector (Invitrogen). Wizard-minipreps were performed to identify Fiction clones with inserts of the expected size (~ 500 bp) and 5 clones were provided for sequencing from each cloning event using forward and reverse primers M13. When analyzed with suitable bioinformatics software, it was found that a new cytochrome gene sequence was identified b, which was closely related to other sequences of Ascomycetes cytochrome b genes. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

Various specific R. secalis ARMS primers were designed at the location of the point mutation G ₁₄₃ A:

two direct wild type ARMS primers:

control primer designed against the course of transcription from point mutation:

STAND3: TCCTTATGGACAGATGTCTTTATG (SEQ ID NO: 137)

In the ARMS primers, base -1 (base of the 3'-end) corresponds to the second nucleotide of codon C ₁₄₃ / A ₁₄₃ . Bases in primers that differ from the wild-type R. secalis cytochrome b sequence are indicated in bold. Position -2 is changed from base G to base A or T. This is done to destabilize the primer, which is common with ARMS primers.

The Scorpion ™ product detection system was used in this case as the detection mechanism, and again the reverse Scorpion primer was designed using the Oligo 5 and MFold programs (for details, see Example 1). The sequence of Scorpion primer R. secalis was:

(See previous examples for details.)

All primers were synthesized by the Oswell DNA Service. Before use, the primers were diluted to 5 μM in a total volume of 500 μl each. Then the primers were further diluted to a final concentration of 500 nM in PCR.

Again, primers were first evaluated for use in ARMS, Scorpion assays using plasmid DNA as a template at various concentrations. This was done to verify the specificity and sensitivity of the primer constructs. The partial sequence of the wild-type cytochrome b gene and the corresponding sequence containing the G ₁₄₃ A mutation were cloned into TA pCR2.1 vector for use in the verification process. Since this mutation has not yet been detected in R. secalis DNA, the A ₁₄₃ point mutation was included in the sequence using a site-directed mutagenesis strategy: the point mutation was included in the primer design and this primer was used to amplify the region of interest using the wild-type clone as matrices. PCR was established using standard methods as described previously, and 30 cycles (94 ° C for 45 seconds, 56 ° C for 45 seconds and 72 ° C for 1 minute 30 seconds) were performed in a Hybaid PCR device. Omn-e. Initial incubation at 94 ° C for 3 minutes and incubation for final extension at 72 ° C for 10 minutes were also included. PCR product ~ 370 bp cloned into the TA vector pCR2.1 and the resulting clones were sequenced to check for any PCR-induced error before use in this experiment.

It was estimated that undiluted plasmid DNA preparations had concentrations of approximately 2 × 10 ¹¹ molecules per μl. Thus, two initial plasmid preparations were diluted to 2 × 10 ⁷ , 10 ⁵ , 10 ^3, and 10 ¹ molecules / μl in 1 mg / ml BSA and 5 μl aliquots were used from each dilution, which gave ~ 1 × 10 ⁸ , 10 ⁶ , 10 ⁴ and 10 ² plasmid molecules in the corresponding PCR. The conditions and components of the PCR were as described previously. In figure 5a, which shows the serial dilution of the G plasmid detected by the G primer mixture, fluorescence detection was delayed by ~ 4 cycles with each 10-fold dilution of the plasmid. Figure 5b shows the highest concentration of G (wild type (wt)) and C (mutant) cassettes amplified using a mixture of G-sp-2 primer. The G-primer does not detect erroneous priming of the C-matrix until a very late date in this PCR, even though the concentration of the DNA matrix is high (~ 10 ⁸ matrix molecules in the reaction). Thus, a significant delay before the G-erroneous priming event demonstrates that this primer has a good specificity window. The set of C-sp-2 primers also showed good specificity for all specific and non-specific dilutions of the plasmid (figures 6a and 6b). Mixtures of primers G-sp-2 and C-sp-2 were used in subsequent experiments instead of mixtures of primers G-sp-3 and C-sp-3.

The second part of this study was to compare the use of total (genomic) DNA and cDNA as a template for PCR. Total DNA material was obtained from R. secalis isolates using a phenol / chloroform extraction method (as described previously). Total RNA was extracted from 100 mg of ground mycelium using the PNeasy Plant minikit mini-kit (Qiagen catalog No. 74903) according to the manufacturer's recommendations. Then, the first strand cDNA was synthesized with 1 μg of total RNA using RT-PCR with the Advantage RT-PCR kit (Clontech catalog No. K1402-1) in accordance with the manufacturer's recommendations. Pools of total DNA and cDNA were obtained from three isolates (K3278, K3274 and K3276). The pool of total DNA was used as a matrix in 1: 100, 1: 1000 and 1: 10000 dilutions, and cDNA was used as a matrix in undiluted form and in a dilution of 1: 5 and 1:10. In each case, 5 μl of the template was added in the PCR reaction. The real-time PCR conditions described in Examples 1 and 2 were also used here except that in this case 40 cycles of PCR were performed instead of 50. Figures 7a, b and c illustrate the results obtained with total DNA and cDNA templates at three dilutions ( dilution 1: total DNA (1: 100) and cDNA (undiluted); dilution 2: total DNA (1: 1000) and cDNA (1: 5); dilution 3: total DNA (1: 10000) and cDNA (1:10 )) amplified using a mixture of G-primers. Figures 8a, b, and c illustrate total DNA and cDNA matrices amplified using a mixture of C-primers. Using total DNA instead of cDNA as a matrix yielded more sensitive results with earlier threshold cycle values. To provide the best chance of detecting any C mutation, total DNA injection at dilutions of 1:10 and 1: 1000 were selected for subsequent analyzes. Could not detect changes in fluorescence when using a mixture of C-specific primers in this PCR of 40 cycles, which indicates that only the wild-type G ₁₄₃ allele was found in these isolates.

EXAMPLE 4

In Example 4, we describe a partial sequence characterization of the Pyrenophora teres cytochrome b gene and a study in which the detection of resistance allele G ₁₄₃ A was performed on a variety of P. teres isolates. This species is a species in which the mutation G ₁₄₃ A. describing a real-time PCR study using Scorpion detection analysis with genomic DNA preparations of P. teres isolates.

Real-time PCR study using intercalating dye

Wild type isolates of P. teres (the causative agent of net spotting barley) were collected in the United Kingdom and France during 1994, 1996 and 1998 (see table 10 for details of isolates of P. teres). Isolates 1994 and 1996 can be considered “background” (collected prior to the use of strobilurin analogues in the field), and isolates 1998 were obtained from test sites that were subjected to several sprayings with strobilurin analogues for several seasons. Infected barley leaves were picked manually and sent to Jealott’s Hill Research Station (Zeneca Agrochemicals). Upon arrival at the laboratory, the leaves were incubated in a humid environment at 21 ° C for 24-48 hours. Separate lesions were excised from the leaves, surface sterilized in ethanol (30 seconds), followed by washing with 0.1% sodium hypochlorite solution (2 minutes), and then placed on Chinese tea agar-rose (see table 9) and incubated with an alternation of 12 hours thermal radiation, 12 hours without light at a constant temperature of 22 ° C for 4-5 days. All media described in Table 9 were autoclaved at 121 ° C. for 15 minutes at 15 psi. inch. Colonies grown from these lesions were subcultured using a mycelial plug on V8 + streptomycin agar (see Table 9) and incubated as described above for 14 days.

Table 9
Medium Recipes Wednesday: Ingredients: Potato Dextrose Broth: Potato Dextrose (Difco) 24 g Deionized water 1000 ml Lima Agar Beans: Lima Agar Beans (Difco) 23 g Agar No. 3 (Oxoid) 10 g Deionized water 1000 ml Chinese tea agar-rose: Glucose (Oxoid) 10 g Yeast Extract (Oxoid) 2 g Agar No. 3 (Oxoid) 17 g Deionized water 1000 ml After autoclaving, add:
Streptomycin Sulfate (Sigma) 125 mg Chinese Tea Rose (Sigma) 25 mg V8 + streptomycin agar: Juice V8 (Campbells)
Calcium Carbonate (Fisher)
Agar No. 3 (Oxoid)
Deionized water 200 ml
3 g
20 g
800 ml After autoclaving, add: Streptomycin sulfate (Sigma)
200 mg Czapek Dox V8-arap: Juice V8 (Campbells) 200 ml Calcium Carbonate (Fisher) 3 g Czapek Dox-arap (Oxoid) 45.5 g Agar No. 3 (Oxoid) 7 g Deionized water 800 ml Suppliers: Campbells Groceries, Kings Lynn, Norfolk, UK Oxoid, Basingstoke, UK Sigma Chemicals, Poole, UK Difco, Detroit, Michigan, USA Fisher Scientific, Loughborough, UK

The resulting mycelium material and spores were removed and stored in liquid nitrogen until isolates were used. Recovery of the isolates was achieved by plating the stored fungal samples on V8-arap and incubating, as described above, for 14 days until spore formation.

Table 10
Details for isolates of P. teres Isolate Code Year of collection Country of origin K1056 1980 Ireland K1916 1994 United Kingdom K2346 1996 France K2383 1996 United Kingdom K2385 1996 United Kingdom K2390 1996 United Kingdom K2396 1996 United Kingdom K3230 1998 United Kingdom K3237 1998 United Kingdom K3238 1998 United Kingdom K3253 1998 United Kingdom

A partial sequence of cytochrome b was identified from two isolates (K1056 and K1916). The initial wild-type sequence was obtained from a biological sample obtained by inoculating potato-dextrose broth (see table 9) with a suspension of macerated mycelium. The flask was incubated at 85 rpm on an orbital shaker at 12 hours of white light, 12 hours without light at a constant temperature of 19 ° C for 21 days, until enough mycelium material was obtained for the DNA extraction protocol. The mycelium was then collected by filtration through Miraclots and frozen at -20 ° C until use. Total DNA was obtained using a phenol / chloroform extraction protocol (see Example 1). After checking the yield and quality of the DNA, gel dilution was performed by serial electrophoresis (1:10, 1: 100 and 1: 1000 in ddH ₂ O) for use as PCR matrices. Numerous combinations of primers (specific and degenerate) were tested and in most cases did not receive an amplified product. However, a pair of primers that were designed for the conserved sequences of Aspergillus niger and Neurospora crassa cytochrome b (Cytb3F and Cytb9R, see Example 2 for details) did give a PCR product of ~ 500 bp This product was cloned in TA pCR2.1 vector (Invitrogen) and 6 clones were sequenced using forward and reverse M13 primers. When analyzing the results, it was found that this reverse primer correctly bound to the cytochrome b sequence, while the forward primer erroneously primed in the DNA sequence with intron-like characters. P. teres-specific primer (Pt2R: 5 'CTT ACA TST GTA ATA GGT AAT 3'} (SEQ ID NO: 140) was constructed in a new section of the cytochrome b gene and was used with a direct primer that was designed based on the cytochrome gene sequence b Venturia inaequalis (Pt5F: 5 '' TGT TAC TTT AGC AAT GCA CTA 3 ') (SEQ ID NO: 141) on a P. teres cDNA matrix. cDNA was obtained from mycelial samples of these two isolates. Total RNA was extracted from 100 μg of ground mycelium using the PNeasy Plant kit (Qiagen) according to the manufacturer's recommendations The synthesis of the first strand cDNA was carried out with 1 μg total RNA using RT-PCR with the Advantage RT-PCR Clontech kit (as recommended by the manufacturer). 5 μl of the obtained cDNA was then used in PCR. The PCR components and conditions were as described above. PCR product ~ 800 bp amplified for both isolates (corresponding to the sequence encoding the amino acid region 48-310 of fungal cytochrome b according to the S. cerevisiae numbering system). In both cases, the PCR product was cloned in TA pCR2.1 vector (Invitrogen) and 4 clones that contained inserts of the expected size (~ 800 bp) were sequenced using M13 forward and reverse primers for each isolate. Analysis of these sequences revealed that a new sequence of the cytochrome b gene was isolated, which is closely related to other known cytochrome b sequences of ascomycetes. A segment of cDNA of 61 nucleotides encoding 30 bases against the course of transcription and 30 bases in the course of transcription from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in table 3.

Specific ARMS primers of P. teres were designed near the location of the point mutation G ₁₄₃ A:

direct ARMS primer based on the wild-type sequence:

and a control primer designed against the course of transcription from a point mutation:

STAND4: ACCCTACGGGCAAATGAGCCTTTG (SEQ ID NO: 144)

reverse primer was:

UNLS4: TACACCTAAAGGATTTCCTGACCCTGCAA (SEQ ID NO: 145)

Again, in the ARMS primers, base -1 (base of the 3'-end) corresponds to the second nucleotide of codon C ₁₄₃ / A ₁₄₃ . Bases in primers that differ from the wild-type P. teres cytochrome b sequence are indicated in bold. Position -2 is changed from base G to base A or T. This was done to destabilize the primer.

All primers were synthesized by the Oswell DNA Service. Before use, the primers were diluted to 5 μM in a total volume of 500 μl ddH ₂ O each. Then the primers were further diluted to a final concentration of 500 nM in PCR.

In this case, an intercalating dye was used to detect the PCR product. The dye used was the YO-PRO-1 dye (Molecular Probes, Seattle Washington, USA), which binds to double-stranded DNA and emits fluorescence, which can be detected with an ABI Prism 7700 instrument.

Primers were first evaluated for validity using plasmid DNA as a template at various concentrations. This was done to verify the specificity and sensitivity of the primer constructs. A partial sequence of the wild-type P. teres cytochrome b gene and the corresponding sequence containing the G ₁₄₃ A mutation introduced by site-directed mutagenesis were cloned into the TA pCR2.1 vector for use in the verification process (as described in Example 3).

It was estimated that undiluted plasmid DNA preparations had concentrations of approximately 2 × 10 ¹¹ molecules per μl. These two plasmids were diluted to 2 × 10 ⁷ , 10 ⁵ , 10 ³ and 10 ¹ molecules / μl and 5 μl aliquots were used from each dilution, which yielded ~ 1 × 10 ⁸ , 10 ⁶ , 10 ⁴ and 10 ² plasmid molecules in the corresponding PCR (see Example 1 for PCR conditions). The only difference was that YO-PRO-1 was added to the reaction mixture. The generation of the primer dimer product interfered with the signal after cycle 35. This detection method is less sensitive than the Scorpion detection system, since it is more affected by background noise (eg, fluorescence emission from the formation of primer dimer). Nevertheless, it was concluded that valuable information could be obtained from the use of this method, but increased caution should be exercised in interpreting the results.

In the next experiment described above isolates were tested for the presence of allele G ₁₄₃ A. Isolated grown in a medium with non-fermentable carbon source to produce a material for ARMS, Scorpion-analyzes. The initial spore suspension was inoculated (1 ml at 100,000 spores / ml) into conical flasks containing broth. The cultures were incubated on an orbital shaker as previously described, and the resulting mycelia were harvested thereafter for use in preparing cDNA. The cDNA material was obtained (as described previously) from each of the isolates. This was done in order to avoid the design of primers in the complex organization of the intron / exon sequence of P. teres cytochrome b.

All PCR was set as described above and 50 cycles were performed. The only difference was that YO-PRO-1 was added to the reaction mixture. undiluted and diluted 1:10 cDNA was used as template; in all cases, 5 μl of the template was added to the PCR reaction.

Figures 9a and b illustrate the results of PCR amplification of two of the eleven isolates tested in two dilutions, in duplicate with three pairs of primers. In no case were detectable levels of the G ₁₄₃ A allele present in the tested samples detected.

Real-time PCR study using Scorpion detection system

The C ₁₄₃ A diagnostic Scorpion analysis was also constructed based on the genomic organization that was determined for the P. teres cytochrome b gene encoding the amino acid region of interest.

The intron / exon organization near the base of interest was clarified by PCR amplification on genomic DNA preparations with a number of primers designed for the known coding sequence and then for the identified sequences of introns. Taq Extender ™ Additive and the Perfect Match PCR Enhancer PCR amplifier (both from the Stratagene catalog No. 600148 and 600129, respectively) were used according to the manufacturer's instructions to amplify large PCR fragments using many different primer combinations. After the initial incubation at 94 ° C for 3 minutes, 30 cycles were performed (94 ° C for 45 seconds, 52 ° C for 45 seconds and 72 ° C for 3 minutes) on a Hybaid Omn-E instrument. Final incubation at 72 ° C. for 10 minutes was also included. When analyzing PCR products using gel electrophoresis, the PCR product is 2.7 kb. was detected with a pair of primers pter23F (coding region 5 'ACA TAG TAA TAC TGC TTC AGC 3') (SEQ ID NO: 146) - pter 25R (intron region 5 'TAC ATT TGA GGC AAA TAT TTC 3' (SEQ ID NO: 147) and a 7.5 kb PCR product was detected with a pair of pter7F primers (coding region 5'STA CGG GCA AAT GAG CCT TTG 3 ') (SEQ ID NO: 148) - pter6R (coding region 5' CTC TGG AAC TAT CGC TGC AGG 3 ') (SEQ ID NO: 149). These PCR products were cloned in pCR-XL-TOPO vector (Invitrogen Catalog No. K4700-10) according to the manufacturer's instructions and 2 clones for each cloning events sequenced as previously described. it has been found that the second base of codon ₁₄₃ location with G EHO at the 3'-end of exon 36 bp segment of 61 nucleotides encoding 30 bases upstream and 30 bases downstream of the second base of codon ₁₄₃ G (according to a system of numbering amino S. cerevisiae), can be found in Table 3 .

A number of ARMS primers 31 bp and the control primer (for amplification of both the mutant allele and the wild-type allele) was designed on the forward chain, while the usual Scorpion primer was designed on the reverse chain in the intron sequence. The resulting amplicon was 121 bp in length. (with ARMS primers) and a length of 123 bp (with control primer). In this case, the second base of the Gi43 codon is located on exon 36 bp, only 1 bp apart. from a 3’s splicing site. Again Scorpion primer was designed using Oligo 5 and MFold programs (see details in Example 1). The sequence of Scorpion primer P. teres was:

The description of Scorpion primers, the synthesis of primers, and the real-time PCR conditions were the same as described in the previous examples.

In optimizing the Scorpion analysis, a greater variety of primers than in the previous examples was tested for specificity, each with different mating defects on their 3’-end to induce destabilization (in bold), as shown below.

The initial primers were evaluated on a wild-type plasmid matrix and a mutant plasmid matrix at 1 × 10 ⁷ molecules per reaction. Real-time PCR on an ABI Prism 7700 instrument was performed in duplicate for each of the plasmid arrays using both G- and C-specific ARMS primers and a control primer (which amplifies both the mutant allele and the wild-type allele) with the usual reverse Scorpion primer.

As can be seen from table 12, different designs of ARMS primers gave different specificity windows when tested against the mutant plasmid matrix and against the wild-type plasmid matrix.

When compared with other tested primers, PT-G-1 and RT-C-5 gave the widest window of specificity. Therefore, they were selected as the preferred pair of primers for this analysis. The RT-C-5 primer has a Ct value of 16 on the correct matrix and the PT-G-1 primer also has a Ct value of 16 on the correct matrix. The RT-C-5 primer erroneously primes on the error matrix at cycle 34, giving a specificity window of 18 cycles, and the PT-G-1 primer erroneously primes at cycle 32, giving a specificity window of 16 cycles, which is equal to approximately a 10-fold difference in the sensitivity of these two primers.

Table 12
Evaluation of ARMS Primers Primer Ct on the right matrix Ct on the wrong matrix Window of specificity (cycles) PT-G-1 16 32 16 PT-G-2 23 38 fifteen PT-G-3 not a slave. not a slave. not a slave. PT-G-4 32 42 10 PT-G-5 22 36 14 RT-S-1 twenty 34 12 RT-S-2 twenty 34 12 RT-S-3 28 38 10 RT-S-4 34 38 4 RT-S-5 16 34 eighteen C-SP-5 eighteen 34 eighteen

ARMS primers PT-G-1 and RT-C-5 were tested in a plasmid insertion experiment where a mutant plasmid was “introduced” into the background of wild-type plasmids at frequencies of 1: 1, 1:10, 1: 100, 1: 1000, 1 : 10000 and 1: 100000, all in 1 mg / ml BSA. In all cases, the total concentration of the plasmid of each frequency of introduction into the PCR analysis was 1 × 10 ⁷ molecules per reaction. The conditions and components of the real-time PCR reaction were as described previously.

The results obtained are summarized in table 13.

Table 13 CR matrix Ct value RT-S-5 100% C-matrix eighteen 1: 1 19 10:10 22 100: 100 26 1000: 1000 thirty 10000: 10000 34 100000: 10000 36 100% G-matrix 36

Since the C-plasmid reduces the background of the wild-type plasmid, fluorescence detection is delayed. With each 10-fold dilution of the C-plasmid, there is a 4-cycle delay in fluorescence detection. The threshold value of the RT-S-5 cycle on one mutant molecule in the background of 10,000 wild-type molecules can be clearly seen, but at 1: 100,000 it was not distinguishable, since the RT-S-5 primer mistakenly prime from a 100% (G) cassette 100% wild-type, thus masking the lower frequency of C: G. This indicates that in this case, ARMS switching will confidently allow detection of frequencies ≤1: 10000. A number of P. teres samples collected in Cork in Ireland (Ir 5-8, Ir 9-13, Ir 14-17, Ir 18-21, Ir 30-34) were tested using this newly optimized Scorpion-PCR- real time analysis. These groups of 4 or 5 isolates were inoculated onto plates with V8 agar and incubated until sporulation on the obtained colony was achieved.

Mycelia were collected from agar plates in 10 ml of sterile ddH ₂ O. The mycelial suspension was transferred to a 15 ml falcon tube and centrifuged at 3200 rpm for 10 minutes. Water was removed and the mass of mycelium was divided into two sterile Eppendorf tubes. Then the mycelium was besieged by centrifugation at 13000 rpm for 5 minutes. The supernatant was removed with a pipette and one of the mycelial precipitates was used for DNA extraction, the other was stored at -80 ° C until use. DNA extraction was performed using the Qiagen DNeasy Plant Mini Kit protocol to isolate DNA from plant tissue, as described in the manufacturer's protocol. DNA was diluted 10-fold and 100-fold for use in this assay and aliquots of 5 μl of DNA were used in each PCR assay. All isolates were tested with each pair of primers (RT-C-5, PT-G-1 and control primer; each with the usual reverse primer containing the Scorpion detection system) in triplicate and in two dilutions.

The results of screening isolates using a 1:10 dilution of genomic DNA as a matrix are shown in Table 14.

Table 14
Real-time PCR results of R. teres Isolates Threshold Cycle Values FROM G S Ir5-8 (1) - twenty twenty Ir5-8 (2) - 22 22 lr5-8 (3) 34 twenty twenty Ir9-13 (1) - eighteen eighteen lr9-13 (2) - twenty twenty Ir9-13 (3) 36 twenty twenty Ir14-17 (1) 36 eighteen eighteen Ir14-17 (2) - 22 22 Ir14-17 (3) 36 eighteen eighteen Ir18-21 (1) - twenty twenty Ir18-21 (2) - twenty twenty Ir18-21 (3) 34 eighteen eighteen Ir30-34 (1) - twenty twenty Ir30-34 (2) 34 twenty twenty Ir30-34 (3) - 19 19

In most cases, RT-C-5 primer detects a threshold cycle value (Ct) at cycle 34 or later, in which, as shown, erroneous priming on the plasmid matrix occurs. In some cases, the RT-S-5 primer does not detect erroneous priming at all. These results show that there was no evidence of the presence of the G ₁₄₃ A mutation in the studied samples.

EXAMPLE 5

In Example 5, the inventors describe a partial sequence characterization of the Uncinula necator cytochrome b gene. U. necator is the causative agent of powdery mildew of grapes.

Infected grape leaves and fruits were harvested from test sites and commercial vineyards in France and Italy during 1999 and sent to Jealott’s Hill Research Station (Zeneca Agrochemicals). Upon arrival at the laboratory, mycelia and spores were transferred using a small paint brush to fresh, surface-sterilized leaves, separated from 6-7 leaves of seedlings (var. Ohanez). U. necator from each collection site was treated as a separate population.

After receiving in the laboratory, inoculated leaves were placed in a room with a constant temperature of 21 ° C and incubated for 2-3 weeks. Once a sporulating disease was discovered, infected leaves were used to inoculate 3-4 grape seedlings with grape seedlings planted directly in a plastic plant nursery. A pressurized air stream was used to blow conidia from source leaves onto suitable target leaves for up to 40 grape seedlings per isolate. The lid was again placed on a nursery, which was then incubated in a growth room with a controlled environment for 2 weeks. Conidia formed on these plants were collected and frozen at -80 ° C until use.

Total RNA was extracted from 100 mg of ground U. necator spores originating from a single isolate using the Qiagen PNeasy kit (as recommended by the manufacturer). The first strand cDNA was synthesized with 1 μg of total RNA using RT-PCR with the Advantage RT-PCR Clontech kit (according to the manufacturer's recommendations). 5 μl of cDNA was used as template for PCR amplification using ERY 11F (5 'ATGAACAATTGGTACAGTAAT 3') (SEQ ID NO: 163) and ERY 4R (5 'AAATCTGTTAAAGGCATAGCC 3') (SEQ ID NO: 164), which are amino acids 114-309 fungal cytochrome b according to the S. cerevisiae numbering system. The DNA fragment of the expected size (~ 500 bp) was amplified and the PCR product was cloned in TA pCR2.1 vector (Invitrogen) in accordance with the manufacturer's recommendations. Wizard minipreps were performed to identify clones with suitable inserts and 5 clones were provided for sequencing using the forward and reverse M13 primers. When analyzed using the relevant bioinformatics software (Seqman and Macaw), it was found that a new cytochrome b gene sequence was identified that is closely related to other ascomycete cytochrome b sequences. A section of 61 nucleotides of the cDNA sequence encoding 30 bases upstream and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in table 3. Specific U. necator primers were designed for basis of this new sequence for application directly on spore material. The presence of intron sequences in the region of interest was assumed (500 bp around SNP G ₁₄₃ ), as the previous PCR amplification on biological material was not successful. Taq Extender ™ PCR Additive and Perfect Match® PCR Enhancer (both from Stratagene) were used (according to the manufacturer's instructions) to amplify large PCR fragments using many different primer combinations. After the initial incubation at 94 ° C for 3 minutes, 30 cycles of 94 ° C for 45 seconds, 52 ° C for 45 seconds and 72 ° C for 3 minutes were performed on a Hybaid Omn-E instrument. Final incubation at 72 ° C. for 10 minutes was also included. Primer combinations 2F (5 'GTT TTA CCC TAC GGG CAG ATG 34 (SEQ ID NO: 165) - 5R (5'AAA GAA TCT GTT TAA GGT TGC 3') (SEQ ID NO: 166), 2F6R (5 'AAA CCA PCT CAA AGA AAC TCC 3 ′) (SEQ ID NO: 167) and 4F (5 ′ CAT GAA TAG GAC AAG ATA TCG 3 ′) (SEQ ID NO: 168) successfully amplified PCR products in a length range of 1.6 t. bp - 3 kbp These PCR products were cloned in the TA pCR2.1 vector (Invitrogen) and subsequent clones were used for sequencing as described previously. A primer “walk” strategy was used for one clone corresponding to each different PCR products, and sequence analysis of these three clones showed the presence of two introns (1.6 kb and 1.1 kb in length) in these PCR fragments.The second base of codon G ₁₄₃ is located 10 bp upstream from the site intron splicing A segment of 41 nucleotides encoding 10 bases upstream and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

EXAMPLE 6

In Example 6, the authors describe a partial sequence characterization of the Sphaerotheca fuliginea cytochrome b gene and a single base polymorphism that induces resistance to strobilurin analogs and compounds in the same cross-resistance group. S. fuliginea is the causative agent of powdery mildew of pumpkin.

The infected S. fuliginea leaves of the cucumber and melon were collected in the field and the conidia in dry form were inoculated in the laboratory on fresh leaf material (cucumber and melon) using a small paint brush. Monoconidial isolates were subcultured and tested in planta using a 24-hour preventive discriminatory dose analysis (up to doses of 100 ppm, which, as you know, give 100% destruction of wild-type strains). Conidia from putatively stable isolates were removed by suction using a vacuum pump into a suitable container. Part of this sample was analyzed using PCR analysis, and the residue was re-tested to confirm phenotypic resistance.

The RT-PCR strategy was used (as described in Example 3) for ~ 100 mg of a conidial strobilurin analogue-sensitive sample. The resulting cDNA was used as a template in the PCR amplification reaction using primers Ery2F (5 'TCACCTAGAACATTAACATGA 3') (SEQ ID NO: 169) and 4R (5 'AAATCTGTTAAAGGCATAGCC 3') (SEQ ID NO: 170), which are amino acids 108 -309 fungal cytochrome b based on the S. cerevisiae numbering system. Other PCR components and conditions were as previously described. The PCR product of the expected size (~ 600 bp) was detected during gel electrophoresis analysis of these PCR products and this product was then cloned into the TA pCR2.1 vector (Invitrogen) and 5 clones with inserts of the correct size (~ 600 p (n.) were sequenced using the forward and reverse primers M13, as described previously. When analyzed using the relevant bioinformatics software (Seqman and Macaw), it was found that a new cytochrome b gene sequence was identified that is closely related to other ascomycete cytochrome b sequences. Then, specific Sphaerotheca fuliginea specific PCR primers were designed to amplify region G ₁₄₃ from genomic DNA. Primer pairs SF1 (5 'TTCCCTTCGGTCAAATGTCGC 3') (SEQ ID NO: 171) - SF8 (5 'AAACCCCCTCTCAGAGAAACTCC 3') (SEQ ID NO: 172) and SF1 - SF10 (5 'GACCCCGCGCTATCATGTAAG 3') (SEQ ID NO: 17Q) ) used in PCR amplifications using spore samples resuspended in ddH ₂ O as a matrix. PCR components and PCR conditions were as described in the previous examples. PCR products were analyzed by gel electrophoresis and the product was ~ 2 kb. was detected with a pair of primers SF1, 8 and a band of ~ 2.1 kb. was detected with a pair of primers SF1, 10. Both PCR products were cloned in the TA cloning vector pCR2.1 (Invitrogen) and 5 clones were sequenced as previously described. Two clones from both cloning events were fully sequenced using the primer “walk” strategy. When analyzing sequencing data using relevant bioinformatics software, it was found that the intron was 1917 bp. attended 9 bp downstream of the second base of the codon G ₁₄₃ . The cDNA sequence and genomic sequence (taking into account intron and exon organization) of a 37-nucleotide stretch encoding 6 bases upstream and 30 bases downstream from G ₁₄₃ (according to S. cerevisiae numbering system) can be found in table 3.

A partial sequence of the cytochrome b gene was also amplified from conidial strobilurin analog resistant samples. Conidial samples (<50 mg) were resuspended in 200 μl of ddH ₂ O and diluted 1:10, 1: 100 in ddH ₂ O. 10 μl of each dilution was used as template for PCR amplification using SF1, SF8 specific S. fuliginea primers . Taq Extender ™ PCR Additive and Perfect Match® PCR Enhancer (both from Stratagene) were used (according to the manufacturer's instructions) to amplify large PCR fragments. After the initial incubation at 94 ° C for 3 minutes, 30 cycles were performed (94 ° C for 45 seconds, 50 ° C for 45 seconds and 72 ° C for 5 minutes) on a Hybaid Omn-E instrument. Final incubation at 72 ° C. for 10 minutes was also included. PCR products were analyzed by gel electrophoresis and a band of the expected size was found (~ 2 kb). It was cloned in TA pCR2.1 vector (Invitrogen) and 10 clones that had inserts of the expected size were sequenced as described in the previous examples. Analysis of the sequence data using suitable bioinformatics software (Seqman, Editseq and Macaw) revealed a G → C point mutation in the cytochrome b sequence compared to the wild-type sequence in all 10 cases. This point mutation results in the only replacement of glycine with alanine at position 143 (in accordance with the S. cerevisiae amino acid coding system).

EXAMPLE 7

In Example 7, the authors describe a partial sequence characterization of the cytochrome b gene of Mycosphaerella filjiensis var. difformis. M. filjiensis is the causative agent of black banana sigatoka (cercosporosis).

The infected banana leaves were collected in open air and ascospores were inoculated from the leaves directly onto the artificial medium in a Petri dish. Monoascospore isolates were maintained in an artificial medium and prepared for PCR analysis using shake culture in broth medium. The mycelia were collected by filtration through Miraclots and ground to a fine powder using an acid washed and autoclaved sterile pestle and mortar. 100 mg of ground mycelium was used for the extraction of genomic DNA and the synthesis of first strand cDNA (as described in the previous examples). Genomic DNA was diluted 1:10, 1: 100 and 1: 1000 in ddH ₂ O before use as a PCR template. 5 μl of cDNA and 10 μl of each dilution of genomic DNA was used as a template for PCR amplification using a pair of degenerate primers as described in Example 3. The PCR conditions and components were as described in the previous examples. When analyzing PCR products by gel electrophoresis, a band of the expected size (~ 500 bp) was found using cDNA as a template, and a large band (~ 1.6 bp) was found when using genomic as a matrix DNA These two PCR products were cloned in the TA pCR2.1 vector (Invitrogen) and the five obtained clones with the correct size inserts (~ 500 bp and 1.6 kb) were sequenced using forward and reverse M13 primers. When analyzing sequence data using suitable bioinformatics software, it was found that the larger PCR product contains an 1064 bp intron located at a 78 bp distance. downstream of the second base of the codon G ₁₄₃ . In addition to the presence of an intron in the larger PCR product, these DNA sequences were identical. This sequence of the cytochrome b gene was identified as new and it was closely related to other sequences of ascomycetes cytochrome b. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

EXAMPLE 8

In Example 8, the authors describe a partial sequence characterization of the Pseudoperonospora cubensis cytochrome b gene. P. cubensis is the causative agent of downy mildew of pumpkin.

Sporangia were washed from infected leaf material into deionized water. The resulting sporangia suspension was inoculated with a spray gun on a fresh leaf material at a concentration of 10,000 spores per ml. After the development of the disease, a spore suspension sample collected in ddH ₂ O was turned off in a centrifuge to obtain a precipitate and stored at -80 ° C until use. Then, sporangia of P. cubensis were resuspended in 200 μl of ddH ₂ O and diluted 1:10 and 1: 100 in ddH ₂ O. 10 μl of each dilution of sporangia was used as a template for PCR amplification using primers PLAS17F and PLAS15R (for details, see example 1). The conditions and components of the PCR were as described in the previous examples. When analyzing PCR products by gel electrophoresis, a band of the expected size (~ 500 bp) was detected. Then this PCR product was cloned in the TA pCR2.1 vector and the five obtained clones with inserts of the correct size (~ 500 bp) were sequenced using forward and reverse M13 primers. When analyzing sequencing data using suitable bioinformatics software, it was found that a new cytochrome b gene sequence was identified that is closely related to other oomycete cytochrome b sequences. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

EXAMPLE 9

In Example 9, the authors describe a partial sequence characterization of the Mycosphaerella graminicola cytochrome b gene. M. graminicola is the causative agent of spotting wheat leaves.

Infected wheat leaves were collected in the field and incubated in humid conditions to accelerate spore formation. The antennae were removed from the leaves and distributed onto plates with Czapek Dox VS agar (see table 9) and incubated in a controlled medium at 19 ° C for 6 days. Isolates of individual colonies were further subcultured and accumulated using culture in a shake flask in a suitable medium. Mushroom material was removed and stored at -80 ° C until use. The preparation of genomic DNA was carried out, as described in example 1, per 200 mg of ground mycelium. The yield and quality of genomic DNA was checked by gel electrophoresis and diluted 1:10 and 1: 100 in ddH ₂ O. 10 μl of each dilution of sporangia was used as a template for PCR amplification using Cyt3F and Cyt9R primers (see details in Example 2) . The PCR components and conditions were as described in Example 2. The PCR products were analyzed by gel electrophoresis, and a band of the expected size was detected (~ 500 bp). This PCR product was cloned in TA pCR2.1 vector and the five obtained clones with inserts of the correct size were sequenced as described previously. When analyzing sequencing data using suitable bioinformatics software, it was found that this PCR fragment encodes part of a new cytochrome b gene sequence that showed close homology with the cytochrome b sequences of other ascomycetes. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

EXAMPLE 10

In Example 10, the authors describe a partial sequence characterization of the Colletotrichum graminicola cytochrome b gene. C. graminicola is the causative agent of anthracnose in cereals and grasses.

Infected leaf material (sod or “moss”) was collected in the field and the fungal material was removed and subcultured on artificial media. Mushroom material was accumulated using the culture in a shake flask, collected and stored at -80 ° C until use. The preparation of genomic DNA was carried out, as described in example 1, per 200 mg of ground mycelium. The yield and quality of genomic DNA was evaluated by gel electrophoresis and dilutions of 1:10 and 1: 100 in ddH ₂ O were prepared. 10 μl of each dilution was used as a template for PCR amplification using primers deg4F and deg3R (see details in Example 3) . The PCR components and conditions were as described in Example 3. The PCR products were analyzed by gel electrophoresis and a band of the expected size was detected (~ 500 bp). This PCR product was cloned in TA pCR2.1 vector and the five obtained clones with inserts of the correct size were sequenced as described previously. When analyzing sequencing data using suitable bioinformatics software, it was found that a new cytochrome b gene sequence was identified that was closely related to other Ascomycete cytochrome b sequences. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

EXAMPLE 11

In Example 11, the authors describe a partial sequence characterization of the Colletotrichum cytochrome b gene. gloeosporioides. C. gloeosporioides is the causative agent of fruit anthracnose (e.g., pepper, avocado and mango).

Infected plant material (mango or chilli pepper) was collected in open air and the fungal material was removed and subcultured on artificial media. Mycelia were accumulated in culture in a shake flask and collected by filtration through Miraclots. Mycelia were stored at -80 ° C until use. The mycelia were ground using an acid-washed sterile pestle and mortar, and 100 mg was used to obtain genomic DNA and first-strand cDNA synthesis (the procedures are described in the previous examples). 10 μl of each dilution of genomic DNA and 5 μl of undiluted cDNA was used as a template for PCR amplification using primers deg4F and deg3R (details of the primers in example 3). The components and conditions of the PCR were as described in the examples. PCR products were analyzed by gel electrophoresis and bands of the expected size (~ 500 bp) were detected. The PCR product was the same size when using genomic DNA or cDNA as a template, indicating the absence of introns in the amplified DNA region. PCR products were cloned in the TA vector pCR2.1, and the five obtained clones with the correct size inserts for each cloning event were sequenced as described in the previous examples. When analyzing sequencing data using suitable bioinformatics software, it was found that the PCR products were identical in all cases and they encode a new sequence of the cytochrome b gene with close homology relative to other sequences of ascomycetes. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

EXAMPLE 12

In Example 12, the inventors describe a partial sequence characterization of the Oidium lycopersicum cytochrome b gene. O. lycopersicum is the causative agent of powdery mildew of tomato.

The diseased tomato leaves were collected in the field and conidia were subcultured on fresh leaf material by inoculation in dry form in a tower sump. Conidia growing as a result of the infection were removed by aspiration using a vacuum pump into a sterile Eppendorf tube and stored at -80 ° C until use. The synthesis of the first cDNA strand was carried out on RNA isolated from 100 mg of spores as described previously, and 5 μl of this cDNA was used for PCR amplification using Er2-4 primers (details in Example 6). The components and conditions of PCR were as described previously. When analyzing PCR products by gel electrophoresis, a PCR product of the expected size (~ 500 bp) was detected. This PCR product was cloned and five clones containing the insert of the correct size (~ 500 bp) were sequenced as previously described. In an analysis using suitable bioinformatics software, it was found that this PCR fragment encodes a new cytochrome b gene sequence that is closely related to other Ascomycete cytochrome b sequences. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

EXAMPLE 13

In Example 13, we describe a partial sequence characterization of the Leveillula taurica cytochrome b gene. L. taurica is the causative agent of powdery mildew of tomato.

The diseased pepper leaves were collected in the field and conidia were inoculated dry on fresh leaf material on whole plants. Conidia from the resulting infections were removed by aspiration using a vacuum pump into a suitable container and analyzed by PCR. Affected leaves of pepper and tomato were collected in the field and in the greenhouse at Jealott’s Hill, and the infected leaf material was used directly in PCR analysis.

The synthesis of the first cDNA strand was carried out on RNA isolated from 100 mg of spores or diseased plant material, as described previously. When using diseased plant material as starting material, fungal damage was enriched by removing non-diseased plant tissue from the preparation. Aliquots of 5 μl cDNA were used for PCR amplification using Eryll-12 primers (details in Example 2). The components and conditions of PCR were as described previously. When analyzing PCR products by gel electrophoresis, a PCR product of the expected size (~ 500 bp) was detected. This PCR product was cloned and five clones containing the insert of the correct size (~ 500 bp) were sequenced as described previously. When analyzed using suitable bioinformatics software, it was found that this PCR product encodes a new cytochrome b gene sequence that is closely related to other Ascomycete cytochrome b sequences. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

EXAMPLE 14

In Example 14, the inventors describe a partial sequence characterization of the Alternaria solani cytochrome b gene. A. solani is the causative agent of early rot in tomato and potato.

The diseased leaf material (tomato or potato) was collected in the field and the fungal material was removed and subcultured on an artificial medium. Mushroom samples were accumulated in culture in a shaken flask. The culture collection isolates were stored in liquid nitrogen and periodically subcultured on artificial medium or subcultured through live host material before re-storage at -80 ° C. The mycelia grown in a shake flask were triturated using an acid-washed sterile pestle and mortar and 100 mg was used to obtain genomic DNA and first-strand cDNA synthesis (the procedures are the same as described in the previous examples). 10 μl of each dilution of genomic DNA and 5 μl of undiluted cDNA was used as a template for PCR amplification using primers deg4F and deg3R (details in Example 3). The PCR components and conditions were as described in Example 3. The PCR products were analyzed by gel electrophoresis and bands of the expected size (~ 500 bp) were detected. The PCR product was the same size when using genomic DNA or cDNA as a template, indicating the absence of introns in the amplified DNA region. PCR products were cloned in the TA vector pCR2.1 and the five obtained clones with the correct insert sizes for each cloning event were sequenced as described previously. When analyzing the sequencing data using suitable bioinformatics software, it was found that the PCR products were identical in all cases and they encode a new cytochrome b gene sequence that exhibits close homology to other ascomycete sequences. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

A sequence differing only 12 bp from the previously isolated A. solani sequence was also amplified using genomic DNA isolated directly from field infected tomato leaves as a template for PCR amplification using Eryll-12 primers (see above for details). Although this DNA sequence contained 12 nucleotide differences, it did not lead to any difference in amino acid level during translation of these two sequences. A significant difference between the two sequences was the presence of an intron ~ 1.2 kb in size, at a distance of 62 bp. in the course of transcription from the second base in codon G ₁₄₃ . These differences in the organization of intron, exon, and the use of codons are proof that such variations are possible in one form.

EXAMPLE 15

In Example 15, we describe a partial sequence characterization of the Cercospora arachidola cytochrome b gene. C. arachidola is the causative agent of leaf spotted peanuts.

The infected leaf material (peanut) was collected in the field and the fungal material was removed and subcultured on an artificial medium. The cultures were stored in liquid nitrogen until use. Material was removed from storage on agar and the resulting colonies were accumulated in culture in a shake flask and stored at -80 ° C until use. The mycelia were ground using an acid-washed sterile pestle and mortar, and 100 mg was used to obtain genomic DNA and first-strand cDNA synthesis (the procedures are the same as described in the previous examples). 10 μl of each dilution of genomic DNA and 5 μl of undiluted cDNA was used as a template for PCR amplification using primers deg4F and deg3R (details in Example 3). The PCR components and conditions were as described in Example 3. The PCR products were analyzed by gel electrophoresis and bands of the expected size (~ 500 bp) were detected. Again, the PCR product was the same size when using genomic DNA or cDNA as a template, indicating the absence of introns in the amplified DNA region. PCR products were cloned in the TA vector pCR2.1 and the five obtained clones with the correct insert sizes for each cloning event were sequenced as described previously. When analyzing the sequencing data using suitable bioinformatics software, it was found that the PCR products were identical in all cases and they encode a new sequence of the cytochrome b gene, which exhibits close homology to other sequences of the cytochrome b gene. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

EXAMPLE 16

In Example 16, the inventors describe a partial sequence characterization of the Rhizoctonia solani cytochrome b gene. R. solani is the causative agent of root and stem rot or lodging (black leg).

Infected leaf (rice) material was collected in the field and fungal material was removed and subcultured on artificial medium. The cultures were stored in liquid nitrogen until use. Material was removed from storage on agar and the resulting colonies were accumulated in culture in a shake flask and stored at -80 ° C until use. The first strand cDNA was synthesized on RNA isolated from 100 mg of ground mycelia as previously described, and 5 μl was used for PCR amplification using degenerated primers 1F basidiomycetes (5 'WYTRGTAYTAATGATGGCTATHGG 3') (SEQ ID NO: 174) and 1R ( 5 'TCTTARWATWGCATAGAAWGG 3') (SEQ ID NO: 175), which correspond to amino acids 121-283 of the fungal cytochrome b according to the S. cerevisiae numbering system. The components and conditions of PCR were as described previously. When analyzing PCR products by gel electrophoresis, a PCR product of the expected size (~ 500 bp) was detected. This PCR product was cloned and five clones containing the insert of the correct size (~ 500 bp) were sequenced as previously described. When analyzing the sequencing data using suitable bioinformatics software, it was found that this PCR fragment encodes a new sequence of the cytochrome b gene, which reveals close homology with respect to other sequences of basidiomycetes. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

EXAMPLE 17

In Example 17, the inventors describe a partial sequence characterization of the Pythium cytochrome b gene. aphanidermatum. P. aphanidermatum is the causative agent of lodging.

Infected leaf material (sod) was collected in the field and fungal material was removed and subcultured on artificial medium. The cultures were stored in liquid nitrogen until use. Material was removed from storage on agar and the resulting colonies were accumulated in culture in a shake flask and stored at -80 ° C until use. The preparation of genomic DNA was carried out, as described in example 1, for 200 mg of ground mycelia. The resulting genomic DNA was analyzed by gel electrophoresis and the starting preparations were diluted 1:10 and 1: 100 in ddH ₂ O. 10 μl of each dilution was used as a template for PCR amplification using primers PLAS17F and PLAS15R (details in Example 1). The PCR components and conditions were as described in Example 1. The PCR products were analyzed by gel electrophoresis and a strip of the correct size was detected (~ 500 bp). This PCR product was cloned in the Invitrogen pCR2.1 TA vector and five clones containing the correct size inserts were sequenced as previously described. When analyzing the sequencing data using suitable bioinformatics software, it was found that this PCR fragment encodes a new cytochrome b gene sequence that exhibits close homology with other oomycete sequences. A segment of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon 6143 (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

EXAMPLE 18

In Example 18, the inventors describe a partial sequence characterization of the cytochrome b gene of Mycosphaerella musicola. M. musicola is the causative agent of the yellow “sigatoka” banana.

The infected banana leaves were collected in open air and ascospores were inoculated from the leaves directly onto the artificial medium in a Petri dish. Monoascospore isolates were maintained in an artificial medium and prepared for PCR analysis using a culture in a shake flask in a broth medium. The mycelia were collected by filtration through Miraclots and ground to a fine powder using an acid-washed sterile pestle and mortar. 100 mg of ground mycelia was used for DNA extraction and first-strand cDNA synthesis (as described in Example 7). Genomic DNA was diluted 1:10, 1: 100 and 1: 1000 in ddH ₂ O before use as a PCR template. 5 μl of cDNA and 10 μl of each dilution of genomic DNA was used as a template for PCR amplification using a pair of degenerate primers F4, R3 (as described in example 3). The conditions and components of the PCR were the same as described in the previous examples. In the analysis using gel electrophoresis of PCR products, a band of the expected size (~ 500 bp) was detected using both genomic DNA and cDNA as a template. These two products were cloned in the TA vector pCR2.1 and five clones containing inserts of the correct size were sequenced using forward and reverse M13 primers. When analyzing sequencing data using suitable bioinformatics software, it was found that these PCR fragments encodes a new sequence of the cytochrome b gene with close homology to other sequences of the cytochrome b gene of ascomycetes. A section of 61 nucleotides encoding 30 bases upstream of transcription and 30 bases downstream from the second base of codon G ₁₄₃ (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.

Claims (28)

1. A method for detecting the presence or absence of a point mutation (a mutation due to the replacement of a single nucleotide) in the fungal cytochrome b gene encoding the fungal cytochrome b protein, which in the absence of the indicated mutation is sensitive to inhibition by fungicide, and the presence of this mutation confers resistance to inhibition by the indicated fungicide, where this mutation leads to an amino acid substitution selected from the group consisting of: A ₁₂₆ T, F ₁₂₉ L, Y ₁₃₂ C, C ₁₃₃ Y, G ₁₃₇ R / S / E / V, W ₁₄₂ T / K, G ₁₄₃ A, I ₁₄₇ F, T ₁₄₈ M, N ₂₅₆ Y / K / I, L ₂₇₅ F / S / T and L ₂₉₅ F, where the number of special ciphers the position of the first specified amino acid in the wild-type cytochrome b sequence of Saccharomyces cerevisiae, and the first specified amino acid is replaced by the second specified amino acid at the position of the indicated cytochrome b gene of the fungus, which, when aligned with the S. cerevisiae cytochrome b sequence, corresponds to the specified amino acid S. cerevisiae, wherein the specified method involves PCR reactions with the test sample using a pair of primers specific for the cytochrome b gene of the fungus and (i) generating an amplicon and contacting said amplicon with an oligonucleotide probe that is specific for said point mutation, such that binding of the oligonucleotide probe to said amplicon indicates the presence of said mutation, or (ii) detecting the presence of an amplicon, where when one of these primers is specific for a point mutation, the presence of said amplicon indicates the presence of a mutation, and where, when one of these primers is specific for a non-mutant cytochrome b gene, the presence of said amplicon indicates the absence mutations. 2. The method according to p. 1, characterized in that said mutation occurs in the first or second base of a triplet encoding the specified specified amino acid. 3. The method according to p. 2, characterized in that the mutation is due to the presence of a cytosine nucleotide in the second base of the triplet encoding a specified amino acid. 4. The method according to any one of paragraphs. 1-3, characterized in that the fungicide is an analogue of strobulin. 5. The method according to any one of paragraphs. 1-3, characterized in that the fungicide is selected from the group consisting of azoxystrobin, picoxystrobin, kresoxim-methyl, trifloxystrobin, famoxadone and phenamidone. 6. The method according to p. 4 or 5, characterized in that the fungal cytochrome b gene is derived from pathogenic species of plant fungi. 7. The method according to p. 6, characterized in that the pathogenic species of plant fungi are selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillocraiorafaola feriola pheraferiola pserafloriola 8. A method for detecting the presence or absence of a point mutation in a fungal cytochrome b gene coding for a fungal cytochrome b protein, which in the absence of said mutation is sensitive to inhibition by fungicide, and the presence of said mutation confers resistance to inhibition by said fungicide, where said mutation leads to amino acid a substitution selected from the group consisting of: G ₁₄₃ R, G ₁₄₃ S, G ₁₄₃ C, G ₁₄₃ V, G ₁₄₃ D, G ₁₄₃ E, G ₁₄₃ W and G ₁₄₃ A, where the number specifies the position of the first specified amino acid in the sequence cytochr ohm b wild-type Saccharomyces cerevisiae, and the first specified amino acid is replaced by the second specified amino acid at the position of the indicated cytochrome b gene of the fungus, which, when aligned with the sequence of S. cerevisiae cytochrome b, corresponds to the specified amino acid S. cerevisiae, and this method involves PCR reaction with a test -sample using a pair of primers specific for the cytochrome b gene of the fungus and (i) generating an amplicon and contacting said amplicon with an oligonucleotide probe, which is specific for the specified point mutation, so that the binding of the oligonucleotide probe to the specified amplicon indicates the presence of the specified mutation, or (ii) the detection of the presence of the amplicon, where when one of these primers is specific for the point mutation, the presence of the specified amplicon indicates the presence of the mutation, and where, when one of these primers is specific for the non-mutant cytochrome b gene, the presence of said amplicon indicates the absence of a mutation. 9. The method according to p. 8, characterized in that said mutation occurs in the first or second base of a triplet encoding the specified specified amino acid. 10. The method according to p. 9, characterized in that the mutation is due to the presence of a cytosine nucleotide in the second base of the triplet encoding a specified amino acid. 11. The method according to any one of paragraphs. 8-10, characterized in that the fungicide is an analogue of strobulin. 12. The method according to any one of paragraphs. 8-10, characterized in that the fungicide is selected from the group consisting of azoxystrobin, picoxystrobin, kresoxime methyl, trifloxystrobin, famoxadone and phenamidone. 13. The method according to p. 11 or 12, characterized in that the cytochrome b gene of the fungus comes from pathogenic species of plant fungi. 14. The method according to p. 13, characterized in that the pathogenic species of plant fungi are selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillocraiorafaola feriola pheraferiola pserafloriola 15. Isolated DNA for use in the construction of an oligonucleotide probe or primer for use in the method according to any one of claims. 1-3 and 8-10, the sequence of which includes 5 or more nucleotides of the fungal cytochrome b gene, which, when aligned with the S. cerevisiae cytochrome b gene, correspond to 5 or more S. cerevisiae cytochrome b gene nucleotides located on one or both sides of the triplet encoding the 143rd amino acid of the protein is S. cerevisiae cytochrome b, where the indicated isolated DNA encodes the amino acid in the fungal cytochrome b protein, which, when aligned with S. cerevisiae cytochrome b protein, corresponds to the S.cerevisiae cytochrome b protein 143 amino acid , and where, when the specified amino acid in b the fungal cytochrome b tree is glycine, the indicated cytochrome b gene of the fungus comes from a fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora acylocera bicolariis, Alternaria solani, Rhizocola cololaera solani is not glycine, the indicated cytochrome b gene of the fungus does not come from Musa galopoda. 16. The DNA of claim 15, wherein said DNA sequence has a sequence specified by any one of SEQ ID NO: 1-21. 17. The DNA of claim 15, wherein said DNA sequence has a sequence specified by any one of SEQ ID NOS: 176-196. 18. Isolated DNA for use in the construction of an oligonucleotide probe or primer for use in the method according to any one of claims. 1-3 and 8-10, the sequence of which consists of 5 or more nucleotides of the fungal cytochrome b gene, which, when aligned with the S. cerevisiae cytochrome b gene, correspond to 5 or more S. cerevisiae cytochrome b gene nucleotides located on one or both sides of the triplet encoding the 143rd amino acid of the protein is S. cerevisiae cytochrome b, where said isolated DNA encodes the amino acid in the fungal cytochrome b protein, which, when aligned with the S. cerevisiae cytochrome b protein, corresponds to the 143th amino acid of the cytochrome b S. cerevisiae, and where when the specified amino acid in cytochrome b-tree fungus is glycine, said cytochrome b gene is derived from fungus of the fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora acylocera bicolariis, Alternaria solani, Rhizocola cololaera solani is not glycine, the indicated cytochrome b gene of the fungus does not originate from Musa galopoda. 19. The DNA of claim 18, wherein said DNA sequence has a sequence specified by any one of SEQ ID NO: 1-21. 20. The DNA according to claim 18, characterized in that said DNA sequence has a sequence specified by any one of SEQ ID NO: 176-196. 21. The primer for use in the method according to any one of paragraphs. 1-3 and 8-10, which binds to the cytochrome b gene of the fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici / hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia Inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Mycosphaerella musicola and Cercospora arachidola, a portion of said the gene encoding the amino acid in cytochrome b protein, which when aligned with S. cerevisiae cytochrome b protein corresponds to the 143rd amino acid of S. cerevisiae cytochrome b protein. 22. Oligonucleotide probe for use in the method according to any one of paragraphs. 8-10, which binds to the fungal cytochrome b gene, in the region of the indicated gene that encodes the amino acid in cytochrome b protein, which when aligned with S. cerevisiae cytochrome b protein corresponds to the 143rd amino acid of S. cerevisiae cytochrome b protein. 23. A diagnostic kit for use in detecting the presence or absence of a point mutation in a fungal cytochrome b gene according to the method of any one of claims. 1-3 and 8-10, and the specified diagnostic kit contains a primer according to claim 21, dATP, dCTP, dGTP, dTTP, DNA polymerase and buffer solution. 24. The diagnostic kit according to claim 23, characterized in that it further comprises an oligonucleotide probe according to claim 22. Priority on points: 04/30/1999 PP 1-14, 21, 23 - GB9910100.8; 03/13/2000 PP 2-14, 16, 19, 21, 23 - GB0006004.6; 03/31/2000 PP 1-16, 18, 19, 21, 22-24 - GB0007901.2; 04/26/2000 PP 17, 20 - PCT / GB00 / 01620.

Images