RU2244749C2 - Composition for treatment or prophylaxis of infection caused by microorganism neisseria - Google Patents

Abstract

FIELD: biotechnology, medicine, infectious diseases, medicinal microbiology.

SUBSTANCE: invention relates to a composition designated for treatment and prophylaxis of infections caused by Neisseria microorganism that comprises the following components: (a) protein with amino acid sequence similar by 65% and above with the natural Neisseria protein of a single species (the first group of amino acid sequences is given in the text) and/or its fragment consisting of 10 and more amino acids and eliciting antigen properties; (b) the second protein with amino acid sequence similar by 65% and above with the natural Neisseria protein of another species (the second group of amino acid sequences with even numbers is given in the text), and/or its fragment consisting of 10 or more amino acids and eliciting antigen properties; in particular, the second protein represents NspA. The composition comprises additionally adjuvant. The composition is used both a medicinal agent and for manufacturing the medicinal agent. Applying the invention provides enhancing the effectiveness of prophylaxis or treatment due to the universal effect of the composition (vaccine). Invention can be used in medicine for treatment of infections.

EFFECT: valuable medicinal properties of composition.

8 cl, 137 dwg, 5 tbl, 12 ex

Description

Field of Invention

This invention relates to compositions containing combinations of biological molecules from the bacterium Neisseria, in particular N.meningitidis and N..gonorrhoeae.

State of the art

Neisseria meningitidis and Neisseria gonorrhoeae are immobile, gram-negative diplococci that are pathogenic in humans.

Based on the capsular polysaccharide of this organism, 12 serological groups of N. meningitidis were identified. Group A is the pathogen most often underlying the epidemic in sub-Saharan Africa. Serological groups B and C are responsible for the vast majority of cases in the United States and in most developed countries. Serological groups W135 and Y are responsible for the remaining cases in the United States and developed countries.

The meningococcal vaccine currently in use is a tetravalent polysaccharide vaccine consisting of serological groups A, C, Y and W135. However, meningococcus B remains a problem. This polysaccharide approach cannot be used because the menB capsular polysaccharide is a polymer of α (2-8) -linked N-acetylneuraminic acid, which is also present in mammalian tissue. One approach to menB vaccine uses a mixture of outer membrane proteins (OMP). To overcome antigenic variability, polyvalent vaccines have been created containing up to nine different porins [eg, Poolman JT (1992) Development of a meningococcal vaccine. Infect. Agents Dis. 4: 13-28]. Ora and OPC proteins were additional proteins for use in the outer membrane protein vaccines, but none of these approaches could overcome antigenic variability [eg, Ala 'Aldeen & Borriello (1996) The meningococcal transferrin-binding proteins 1 and 2 are both surface exposed and generate bactericidal antibodies capable of killing homologous and heterologous strains. Vaccine 14 (1): 49-53].

Provided that meningococcal disease during non-epidemic periods in a population is usually caused by multiple strains or strain variants [Russel et al. (1998) Abstracts of 11 ^th International pathogenic Neisseria conference, page 281], together with frequent temporary shifts in the prevailing strains, it seems likely that a universal meningococcal B vaccine will require more than one type of antigen.

Description of the invention

The protein and nucleotide sequences of Neisseria are described in the following documents:

- WO 99/24578

- WO 99/36544

- WO 99/57280

- WO 97/28273

- WO 96/29412

- WO 95/03413

- Tettelin et al. (2000) Science 287: 1809-1815

For ease of reference, the sequences described in these documents will be cited in this application in accordance with the following table:

Document Numbering sequences in the original Sequence Numbering in This Application WO 99/24578 SEQ ID NO: 1-892 SEQ ID NO: 1-892 WO 99/36544 SEQ ID NO: 1-90 SEQ ID NO: 893-982 WO 99/57280 SEQ ID NO: 1-3020 SEQ ID NO: 983-4000 WO 97/28273 coding DNA of figure 4 protein of figure 4 coding DNA of figure 9 DNA of figure 13 protein of figure 13 SEQ ID NO: 4003
SEQ ID NO: 4004
SEQ ID NO: 4005
SEQ ID NO: 4006
SEQ ID NO: 4007 WO 96/29412 SEQ ID NO: 1-26 SEQ ID NO: 4008-4033 WO 95/03413 SEQ ID NO: 1-23 SEQ ID NO: 4034-4056 Tettelin et al. (2000) Science 287: 1809-15 NMB0001-2160 (DNA) NMB0001-2160 (encoded proteins) SEQ ID NO: 4057-6216
SEQ ID NO: 6217-8376

The present invention provides compositions comprising a first biological molecule from a Neisseria bacterium and a second biological molecule from a Neisseria bacterium. The term “biological molecule” includes proteins and nucleic acids.

These compositions may also contain additional biological molecules, preferably also from Neisseria, i.e. we can say that these compositions contain two or more biological molecules (for example, 3, 4, 5, 6, 7, 8, etc.), at least two of which are molecules of the bacterium Neisseria (for example, 3, 4, 5, 6, 7, 8, etc.). Such compositions include compositions comprising (i) two or more different Neisseria proteins, (ii) two or more Neisseria nucleic acids, or (iii) a mixture of one or more Neisseria proteins and one or more Neisseria nucleic acids.

In one preferred embodiment, the first and second biological molecules are molecules from different species of Neisseria (for example, one from N.meningitidis and one from N..gonorrhoeae), but they can be from the same species. The biological molecules in these compositions may be from different serological groups or strains of the same species.

The first biological molecule is preferably selected from the group consisting of SEQ ID NO: 1-8376. More preferably, it is selected from the group consisting of SEQ ID NO: 1-4002 and / or SEQ ID NO: 4057-8376. Preferably, it is a purified or isolated biological molecule.

The second biological molecule is preferably selected from the group consisting of SEQ ID NO: 1-8376. More preferably, it is selected from the group consisting of SEQ ID NO: 1-4002 and / or SEQ ID NO: 4057-8376. Preferably, it is a purified or isolated biological molecule.

One or both of the first and second biological molecules may be a Neisseria biological molecule, which is not specifically described here and which may not be identified, described, publicly available biological molecule or purified prior to filing this application.

In particular, this invention provides a composition comprising one or more of the following pairs of first and second biological molecules (listed as SEQ ID NO: - see end of description).

Thus, this invention includes each of 35074500 possible pairs of SEQ ID NO: 1-8376 (1 and 2, 1 and 3, 1 and 4, 1 and 5 ... 1 and 8375, 1 and 8376, 2 and 3, 2 and 4, 2 and 5 ... 2 and 8375, 2 and 8376, 3 and 4 ... 1000 and 1001, 1000 and 1002 ... 1000 and 8376 ... 8374 and 8375, 8374 and 8376, 8375 and 8376 ), although due to their number all of them are not completely listed here.

Details of how molecules having the sequences of SEQ ID NO: 1-4056 can be prepared and used can be found in the corresponding international applications, and there is no need to repeat these details in this application. Similar principles also apply to SEQ ID NO: 4057-8376.

SEQ ID NO: 1-8376 in the compositions of this invention can be supplemented or replaced by molecules containing sequences homologous (i.e., having sequence identity) relative to SEQ ID NO: 1-8376. Depending on the particular sequence, the degree of identity is preferably greater than 50% (e.g., 65%, 80%, 90% or more) and include mutants or allelic variants. The sequence identity between the proteins is preferably determined using the Smith-Waterman homology search algorithm provided in the MPSRCH program (Oxford Molecular), using the affinity gap search with the penalty open gap = 12 and gap extension penalty = 1.

SEQ ID NO: 1-8376 in the compositions of this invention can be supplemented or replaced by molecules containing fragments of SEQ ID NO: 1-8376. Such fragments must contain at least n consecutive monomers from these molecules, and depending on the particular sequence n is equal to either (i) 7 or more for protein molecules (for example, 8, 10, 12, 14, 16, 18, 20 or more ), preferably, for example, this fragment contains an epitope from this sequence, or (ii) 10 or more for nucleic acid molecules (for example, 12, 14, 15, 18, 20, 25, 30, 35, 40 or more).

If this composition contains a protein that exists in various growing (emerging) and mature forms, preferably a mature form of the protein is used. For example, a mature form of NspA protein (SEQ ID NO: 4008-4033; WO 96/29412; Figure 29) without a signal peptide can be used.

In the case of protein molecules, SEQ ID NO: 1-8376 in the compositions of this invention can be supplemented or replaced by an antibody that binds to this protein. This antibody may be monoclonal or polyclonal.

In the case of nucleic acid molecules, SEQ ID NOS: 1-8376 in the compositions of this invention can be supplemented or replaced by a nucleic acid that can hybridize with a Neisseria nucleic acid, preferably under conditions of "high stringency" (for example, 65 ° C in a solution of 0.1 × SSC, 0.5% SDS).

It should be understood that any nucleic acid in these compositions can take various forms (for example, be single-stranded, double-stranded, in the form of vectors, probes, etc.). In addition, the term "nucleic acid" includes DNA and RNA, as well as their analogues, such as analogues containing modified scaffolds, as well as peptide nucleic acids (PNAs), etc.

In some embodiments, the composition comprises molecules from various species of Neisseria, for example, one or more N.meningitidis molecules and one or more N..gonorrhoeae molecules. In some embodiments, this composition may contain molecules from different serological groups and / or strains of the same species, for example, strains A and B of N.meningitidis. Additional options contain mixtures of one or more N.meningitidis molecules from different strains, as well as one or more N..gonorrhoeae molecules.

Many proteins are relatively conserved in various species, serological groups and strains of N.meningitidis and N..gonorrhoeae (for example, SEQ ID NO: 52, 54, 58). PCT / IB00 / 00642 includes a more detailed analysis of the conserved regions in these proteins. To ensure maximum cross-recognition and reactivity between strains, regions of proteins that are conserved in various species, serological groups and Neisseria strains can be used in the compositions of this invention. Thus, the present invention provides proteins that contain amino acid sequence regions that are common in most Neisseria, in particular N.meningitidis and N..gonorrhoeae. Thus, preferably this composition comprises a protein containing a Neisseria protein fragment (preferably a protein from SEQ ID NO: 1-8376 or more preferably SEQ ID NO: 1-4002), said fragment consisting of n consecutive conserved amino acids. Depending on the particular protein, n is 7 or more (for example, 8, 10, 12, 14, 16, 18, 20 or more). This fragment preferably contains an antigenic or immunogenic portion of the Neisseria protein. A “conservative” amino acid is an amino acid that is present in a particular Neisseria protein in at least x% Neisseria (or, preferably, in at least x% of both strains of N. meningitidis and N. gonorrhoeae). The x value may be 50% or more, for example 66%, 75%, 80%, 90%, 95% or even 100% (i.e. this amino acid is found in the protein in question in all Neisseria). To determine whether an amino acid is “conserved” in a particular Neisseria protein, it is necessary to compare this amino acid residue in the sequences of the protein in question from many different Neisseria (“reference populations”). Suitable definitions of “reference populations” can be found in PCT / IB00 / 00642. The amino acid sequences of various Neisseria can be easily compared using computers. Typically, this comparison involves matching a series of sequences using an algorithm such as CLUSTAL [Thompson et al. (1994) Nucleic Acids Res. 22: 4673-4680; Trends Biochem. Sci (1998) 23: 403-405] or preferably PILEUP [part of the GCG Wisconsin package, preferably version 9.0]. Conservative amino acids are easily detected by matching multiple sequences - in the amino acid position under consideration, most of the sequences being compared will contain a specific amino acid. Conservative amino acids can be made more visually visible using a program such as BOXSHADE [available, for example, from NIH, on the Internet], PRETTYBOX [GCG Wisconsin, version 10], or JALVIEW [available on EBI, on the Internet].

Thus, specific compositions in accordance with this invention include compositions containing:

- two or more biological molecules selected from SEQ ID NO: 1-4002;

- one or more biological molecules selected from SEQ ID NO: 1-4002, combined with one or more biological molecules selected from SEQ ID NO: 4003-8376;

one or more biological molecules selected from SEQ ID NOS: 1-4002 combined with an NspA protein (as described in WO 96/29412; see also figure 29 here), preferably in mature form;

one or more biological molecules selected from SEQ ID NO: 1-8376 (preferably SEQ ID NO: 1-4002) combined with transferrin-binding protein A (TbpA) and / or B (TbpB), for example TbpA and TbpB, described in WO 00/25811) (or immunogenic fragments thereof);

- one or more protein fragments selected from SEQ ID NO: 1-4002, and this fragment preferably contains a plot of conservative amino acids;

- a combination of different proteins, and this combination as a whole includes one or more proteins that are recognized by each strain in the reference population, although each individual protein in this combination is not recognized by each strain in the reference population, i.e. each member of the reference combination recognizes at least one protein in the given combination.

The invention also provides compositions of the invention for use as medicaments (for example, as immunogenic compositions or vaccines) or as diagnostic reagents. It also represents the use of these compositions for the manufacture of: (i) a medicament for the treatment or prophylaxis of an infection caused by Neisseria bacteria; (ii) a diagnostic reagent for detecting the presence of Neisseria bacteria or antibodies induced against Neisseria bacteria; and / or (iii) a reagent that can induce the production of antibodies against Neisseria bacteria.

The invention also provides a method of treating a patient, comprising administering to the patient a therapeutically effective amount of a composition in accordance with this invention.

In addition, this invention provides a method for producing a composition in accordance with this invention, comprising the step of combining one or more of SEQ ID NO: 1-8376 with one or more of SEQ ID NO: 1-8376.

Brief Description of Drawings

Figure 1 shows the results of SDS-PAGE electrophoresis for the expression of ORFs 6, 7, 13, 65-1, 72, 73-1, 105-1, 137-1, 143-1 and 147-1. Left tracks show molecular weight markers (set M1).

Figure 2 shows (A) the results of SDS-PAGE electrophoresis for ORF9, (B) the position of the N.meningitidis immunoreactive band in Western blotting with respect to the preparation of outer membrane vesicles N.meningitidis, (C) FACS analysis.

Figure 3 shows the results of SDS-PAGE electrophoresis for the expression of ORFs 2-1, 5-1, 22-1, 132-1 and 4. Left tracks show molecular weight markers (set M1).

Figures 4-28 show a graph of hydrophilicity (upper), antigenic index (middle) and AMPHI plots (lower) for ORF 2, 5, 6, 7, 9, 13a, 15, 22, 23, 27, 28, 32, 65 , 72, 73, 76, 79, 89, 105, 106-1, 132, 137, 138, 143 and 147.

Figure 29 shows the variability of the NspA sequence from different strains of meningococcus B. These sequences can be used as alternatives to NspA WO 96/29412 (SEQ ID NO: 4008-4033).

Figure 30 shows the binding of polyclonal anti-rNspA using indirect fluorescence flow cytometry with encapsulated and unencapsulated menB strains.

Figure 31 shows similar data for the encapsulated strains 8047, CU385, and M986 (31A) and the unencapsulated strains BZ232, MC58, NG3 / 88, and NGB165 (31B).

Figure 32 shows a model of the secondary structure of NspA.

Figure 33 shows a FACS analysis of the unencapsulated strain M7 (37A) and ethanol-treated (to break the capsule) strains 2996, N44776, MC58, 1000, BZ232, BZ133, NG6 / 88, BZ198, NG3 / 88, 297-0, BZ147 and BZ169 (37B) using a tetravalent mixture.

Figure 34 shows the FACS analysis of strain M7 using a pentavalent mixture at dilutions of 1: 400 (34A), 1: 200 (34B) and 1: 100 (34C).

Examples

Example 1. Expression and purification experiments

In ORFs 6, 7, 13, 65-1, 72, 73-1, 105-1, 137-1, 143-1 and 147-1 described in WO 99/24578 were expressed in E. coli and purified as presented in table 1:

Table 1

ORF His hybrid GST hybrid Cleaning MW (kDa) 6 + GST hybrid 23 7 + + GST hybrid 28 thirteen + GST hybrid 10 65-1 + GST hybrid 32 72 + His hybrid 13.5 73-1 + GST hybrid thirteen 105-1 + + His hybrid 32 137-1 + GST hybrid 31 143-1 + + His hybrid 23.5 147-1 - + His hybrid 32

Note: ORF73-1 was expressed as a fragment (amino acids 41-161).

The protocols used to express these ten ORFs were essentially the same as described in WO 99/24578 using the pGEX and pET vectors. Examples of PCR primers used to amplify these ORFs are shown in table 2:

SDS-PAGE electrophoresis results for these ten expressed ORFs are shown in FIG. 1.

An ORF-His hybrid was used to immunize mice. These sera were used in the ELISA assay essentially as described in WO 99/24578, and they gave positive results.

The following proteins were also expressed and purified (results not shown):

ORF Expression of His Hybrid GST Hybrid Expression Expressed as a fragment The position of the amino acid fragment ORF1 (S) - - - 43-1087 ORF1 (β) not def. - - 1051-1457 ORF35-1 - - - ORF41 not def. not def. - 25-619 ORF46 - - - 25-433 ORF61 not def. not def. - 1-575 ORF83-1 - - - 15-313 ORF100-1 not def. - - 21-376 ORF114-1 not def. - - 1-1423 ORF124-1 not def. not def. - ORF131-1 not def. - - 22-135

The following PCR primers were used to amplify these ORFs:

Each of these ORFs may be coupled to one or more of the sequences of SEQ ID NO: 1-8376.

Example 2. Expression and purification of ORF9

ORF9 described in WO 99/24578 was cloned into the pET vector and expressed in E. coli. The purified ORF-His fusion protein was analyzed by SDS-PAGE electrophoresis, as shown in Figure 2A. Mice were immunized with purified ORF9-His and the sera were used for Western blot analysis (Figure 2B), FACS analysis (Figure 2C) and ELISA analysis. The protocols used were essentially the same as those described in WO 99/24578.

These results confirm that ORF9 is a surface-exposed protein. ORF9 is suitable for combination with one or more sequences of SEQ ID NO: 1-8376.

Example 3. Additional expression experiments

Additional expression and purification experiments were carried out in E. coli for ORF 2-1, 5-1, 22-1 and 132-1 described in WO 99/24578, as shown in table 3:

Table 3

RF His hybrid GST hybrid Cleaning MW (kDa) 2-1 + GST hybrid 26 5-1 - + GST hybrid 33 22-1 - + His hybrid 49 132-1 - + GST hybrid 48

The protocols used to express these four ORFs were essentially the same as described in WO 99/24578 using the pGEX and pET vectors. Examples of PCR primers used to amplify these ORFs are shown in table 4:

SDS-PAGE electrophoresis results for these four expressed ORFs are shown in Figure 3.

Each of these ORFs may be combined with one or more of SEQ ID NO: 1-8376.

Example 4. Expression and purification of lipoprotein ORF4

ORF4 is described in WO 99/24578 as containing a lipopeptide signal sequence (LPSS). This full-sized ORF was amplified using the following PCR primers:

ORF4-L (direct) CGCGGATCCCATATGAAAACCTTCTTCAAAACC

ORF4-L (reverse) CCCGCTCGAGTTATTTGGCTGCGCCTTC

The amplified DNA fragment was cloned into the pET21b + vector for expression as His-labeled at the C-terminus of the hybrid. An E. coli logarithmic growth phase culture containing pET21b-orf4-LPSS was induced with 1.0 mM IPTG for 3 hours at 30 ° C., collected by centrifugation for 10 minutes at 8000 g and resuspended in PBS. The suspension was sonicated on ice and Triton X-114 was added to a final concentration of 0.6% (v / v). This material was incubated on ice for 20 minutes, then heated to phase separation (determined by a high degree of turbidity). After centrifugation for 10 min at 10,000 g, the upper aqueous phase was discarded, and the underlying detergent phase was collected without disturbing the bacterial sediment. 13 volumes of 20 mM histidine, 2 mM EDTA, 30 mM NaCl (pH 5.8) were added to the detergent phase. This material was centrifuged for 10 min at 4 ° C and the supernatant was combined in portions at 4 ° C for 30 min with Q Sepharose Fast Flow resin (Pharmacia). The mixture was centrifuged, the supernatant was stored, and the resin was washed with 20 mM histidine, 2 mM EDTA, 30 mM NaCl (pH 5.8), Triton X-100 0.3% (v / v) and eluted with 1 M NaCl in the same the buffer itself. Most of the Orf4 lipoprotein was found in the supernatant obtained after binding. Final purification was performed by chromatography on Hi-TrapTM Q (Pharmacia). After binding, the supernatant was adjusted to pH 7.0 by adding 0.1 M Hcl and applied onto a Hi-TrapTM Q column equilibrated with 50 mM Tris-Hcl (pH 7.0), 2 mM EDTA, 0.3% Triton X-100, 10 mM NaCl. The column was washed with 5.0 ml equilibration buffer and was eluted with a NaCl gradient from 10 mM to 1 M. Two electrophoretically different forms of the protein were eluted. One in the wash solution and the other in a NaCl gradient between 150 mM and 300 mM NaCl. The protein obtained in the wash solution was used to immunize mice. This form of protein is probably a fully processed, lipidated molecule.

Purified 31 kDa lipoprotein is shown in Figure 3. ORF4 is suitable for combination with one or more of SEQ ID NOs: 1-8376.

Example 5. Computer Forecasting

Computer analysis of ORFs 2, 5, 6a, 7, 9, 13a, 15, 22, 23, 27, 28, 32, 65, 72, 73, 76, 79, 89, 105, 106-1, 132, 137, 138, 143 and 147 (as described in WO 99/24578). Figures 4-28 show, for each of these ORFs, a hydrophilicity plot (upper), an antigenic index plot (middle), and an AMPHI assay (lower). The AMPHI program was used to predict T cell epitopes [Gao et al. (1989) J. Immunol. 143: 3007; Roberts et al. (1996) AIDS Res Hum Retrovir 12: 593; Quakyi et al. (1992) Scand. J. Immunol. suppl.11: 9] and it is available in the package Protean DNASTAR, Inc. (1228 South Park Street, Madison, Wisconsin 53715 USA).

Each of these ORFs may be combined with one or more of the sequences of SEQ ID NO: 1-8376.

Example 6. Quadrivalent mixture

A mixture of proteins 919 (WO 99/57280), 225 (WO 99/57280), ORF4 (WO 99/24578, Example 26) and ORF40 (WO 99/36544, Example 1) was prepared and evaluated using ELISA and FACS. ELISA titers against 13 test strains were as follows:

Strain M7 conF 2996 MS58 BZ133 Bz232 H44 / 76 1000 Titer 38176 7892 17216 41488 17945 83990 6575 Strain Bz198 NG6 / 88 BZ169 Bz147 NG3 / 88 297-0 Titer 3329 59275 - - 12877 25640

The FACS results are shown in Figure 33. It is seen that the tetravalent mixture gives excellent results, regardless of the particular menB strain used. In addition, the antiserum induced against this mixture in strain 2996 is bactericidal up to a dilution of 1: 2048.

Example 7. Pentavalent mixture

A protein mixture was prepared ORF4-L (lipidated protein - see example 4 above), ORF37 (WO 99/24578, example 1), ORF40 (WO 99/36544, example 1), 502 (WO 99/52780, pages 687-690 ) and 8 (WO 99/57280, pages 165-167). ELISA titers against 13 test strains were as follows:

Strain M7 conF 2996 MS58 BZ133 Bz232 H44 / 76 1000 Titer - - 25428 - 58300 > 109350 > 109350 Strain Bz198 NG6 / 88 BZ169 Bz147 NG3 / 88 297-0 - Titer 10999 109532 42888 28324 104212 33996 -

The FACS results are shown in Figure 34. Obviously, the pentavalent mixture gives excellent results, regardless of the particular menB strain used. In addition, the antiserum induced against this mixture in strain 2996 is bacteriostatic.

Example 8. Trivalent mixture

Proteins ORF1 (for example, example 77 WO 99/24578; see also WO 99/55873), '287' (for example, figure 21 WO 99/57280; also SEQ ID NO: 3103-3108 therein) and '919' ( for example, Figure 23 of WO 99/57280 and SEQ ID NO: 3069-3074 therein) were combined and Al (OH) _{3 was} added as adjuvant. These proteins were from strain 2996 MenB.

This mixture was also combined with the MenC polysaccharide conjugate antigen [Constantino et al. (1992) Vaccine 10: 691-698]. OMV was used as controls.

The mixture was used in a bactericidal assay against a homologous strain as well as heterologous MenB strains. Captions were as follows:

2996 BZ133 Bz232 1000 MS58 NGH38 Trivalent 2048 2048 4 <4 64 4 + MenC 2048 > 32000 4 128 1024 128 The control 32765 4096 8192 16384 16384 8192

Example 9. Proteins 287, 919 and 953

Proteins 287, 919 and 953 are described in WO 99/57280. These proteins from strain 2996 of the serological group N.meningitidis were expressed and tested in bactericidal analysis for strain 2996 alone and in combinations. OMV from 2996 was used as a positive control.

Antigen 287 919 953 The control Titer 8192 2048 128 65536 Combination 287 + 919 287 + 953 919 + 953 287 + 919 + 953 Titer 32000 8192 8192 8192

Figure 35 shows FACS data for individual antigens and for four combinations.

Obviously, antigen mixtures are more effective than single antigens, and in particular that combinations 919 + 953 give surprisingly good results.

Individual antigens from 2996 and combinations were also tested against strains A, B and C of various serological groups (i.e., heterologous stimulation). The bactericidal titers were as follows:

Antigen Strains of serological group B (MenB) Mena Menc 2996 BZ133 Bz232 MS58 NGH38 F6124 C11 287 8192 > 4096 256 1024 2048 1024 2048 919 2048 - 1024 - - - - 953 128 - - - - - - 287 + 919 32000 > 4096 512 512 1024 512 > 2048 287 + 953 8192 > 4096 1024 512 2048 2048 > 2048 919 + 953 8192 - 8192 - - - - Trivalent 8192 > 2048 256 - 1024 > 2048 > 2048 The control 65536 - 8192 2048 - 2048 32768

Obviously, these antigen mixtures are useful for ensuring cross-activity of strains.

In the second series of experiments, titers for individual antigens were as follows:

Antigen Strains of serological group B (MenB) Mena Menc 2996 BZ133 Bz232 MS58 NGH38 F6124 C11 287 16000 2048 16 512 2048 64 1024 919 16000 - 2048 - - - - 953 2048 - 16 - - - -

These three proteins used in this example were expressed and used in the following forms:

(1) protein 287 was expressed in E. coli as a GST hybrid;

(2) 919 protein was expressed in E. coli without its leader peptide, without its mature N-terminal cysteine and without any hybrid partner (“919-unlabeled”); and

(3) 953 protein was expressed using a histidine tag.

Three immunizations were performed with Freund's adjuvants - the former included CFA, and the latter two included IFA.

Example 10. Additional polyvalent combinations

Additional combinations of antigens were tested in CD1 mice:

Antigens * Adjuvant Facs ELISA Bactericidal activity 919-his + 0rf4-his + 225-his + 0rf40-his Freind +++ + 8192 Orf4-L + Orf37-GST + Orf40-his + 502-his + 8-his Freind +++ + bacteriostatic 919-without mark + 791-his + 792-his Freind +++ + 4096 919-without mark + 287-GST + 953-his Freind +++ + 8192 919-untagged + 281-GST Freind +++ + 32000 287-GST + 953-his Freind +++ + 8192 919-untagged + 953-his Freind +++ + 8192 919-without mark + Orfl-his + 287-GST Al (OH) ₃ +++ + 2048 919-without label + Orfl-his + 287-GST + MenC glycoconjug. Al (OH) ₃ +++ + 2048 Orf-46.1-his + 287-GST Al (OH) ₃ not def. 128

*: "his" refers to the expression and immunization of histidine-labeled protein;

"ORF4-L" refers to the lipidated form of ORF4;

"GST" refers to the expression and immunization of a GST fusion protein;

"919-untagged" means the same as in example 9;

"MenC glycoconjug." denotes the MenC glycoconjugate described in example 8.

Additional combinations of antigens were tested in guinea pigs:

Antigens Adjuvant Facs ELISA Bactericidal activity 919-his + 287-GST + 953-his + Orf46.1-his Freind + + 4096 919-untagged + 287-GST + 953-his Freind + + 4096 287-GST + 953-his Al (OH) ₃ not def. + 256

Obviously, these combinations give excellent immunological results.

Example 11. Combinations of NspA

The NspA protein is described in WO 96/29412 and is presented here as SEQ ID NO: 4008-4033. According to scientific evidence for this protein [Martin et al. (1997) J. Exp. Med. 185 1173-1183] this protein is highly conserved in Neisseria strains (99% cross-reactivity of antibodies against NspA with 250 meningococcal strains A, B and C), and is also an effective defense against dangerous infection by living bacteria. There have been reports that NspA adsorbed on alum elicits a humoral response characteristic of meningococcal bacteria in rabbits and monkeys [Martin et al. (1998) Abstracts of 11 ^th International pathogenic Neisseria conference, page 198]. Based on these data, rNspA (recombinant NspA) is being developed as a vaccine for the prevention of meningococcal disease caused by all serological groups.

However, despite the conservative nature of the sequence, it was unexpectedly found that epitopes of the cell surface rNspA-β are found only in 65% of strains of serological group B and the sensitivity to bactericidal activity of antibodies against NspA is also less than the data of Martin et al. These results contradict those of Martin et al. and suggest that rNspA-based meningococcal B vaccines must be supplemented with additional antigens in order to be effective.

The N.meningitidis strains tested in this example were isolated from patients in different countries over a period of more than 30 years (see table on page 87 of the description in Russian). These strains were selected in such a way that they are representative of widely divergent “clonal” groups, as determined by typing multilocus isoenzymes [Seiler et al. (1996) Mol. Microbiol. 19: 841-856] and / or typing of multilocus sequences [Maiden et al. (1998) PNAS USA 95: 3140-45]. Strain M7, which is derived from the NMB strain, contains a transposon insert that blocks the biosynthesis of the capsular polysaccharide [Stephens et al. (1991) Infect. Immun. 59: 4097-4102], but all other strains are encapsulated.

Based on the nucleotide sequence in Martin et al. (1997), PCR primers were designed and the NspA gene from strain 8047 was amplified. This sequence, including the promoter region, was cloned into the plasmid pSK + (rNspA). Also used was the plasmid pTrc.NspA.1 encoding a protein in which part of the signal sequence was replaced by a polyhistidine tag. Both plasmids were expressed in E. coli strain BL21 (DE3) and these proteins were purified. In E. coli, rNspA is secreted, but does not remain bound to the outer membrane. This protein was partially purified from the culture medium by precipitation with 55% (w / v) ammonium sulfate and it had an approximate molecular weight (MW) of 18.6 kDa, confirmed by Western blotting.

Two forms of NspA (rNspA and denatured histidine-labeled NspA) were injected into six-week-old female CD-1 mice to obtain antisera. Their ability to bind to the surface of N. Meningitidis strain B was determined using flow cytometric detection of indirect fluorescence analysis [Granoff et al. (1998) J. Immmunol. 160: 5028-36]. The results for strains of NMB and M7 (capsule-free NMB mutant) are shown in Figure 30. As expected, the SEAM-3 monoclonal antibody (mAb) for group B polysaccharide [Granoff et al.] Only binds to the encapsulated strain, while being a positive control anti-P1.2 mAb (PorA) binds to both strains. The rNspA-induced antiserum is capable of binding both strains. However, histidine-labeled NspA antisera gave negative results. These antisera were also negative for strains 8047, CU385 and M986 (Figure 31A), but with Western blotting, these antisera gave positive results.

These results suggest that antibodies produced using histidine-labeled NspA recognize epitopes that are present in denatured NspA but not in native NspA found on the cell surface in vivo. In contrast, antibodies obtained against rNspA appear to recognize NspA conformational epitopes.

Flow cytometric analysis was applied to the strains shown in the table on page 87. Figure 31A shows that murine antibodies induced against rNspA bind to the surface of strain 8047 (the strain from which the nspA gene was cloned) and strain CU385, but not M986. Figure 31B shows similar negative results for strains BZ232, MC58, NG3 / 88 and NGP165. However, in all these negative cases, the control anti-capsule mAb was positive.

The table on page 85 summarizes the results of flow cytometry. Although it has been reported that NspA is available on the surface of all tested intact strains of N. Meningitides [Martin et al. (1997) J. Exp. Med. 185 1173-1183; Plante et al. (1999) Infect. Immun. 67: 2855-61], only 11 of the 17 tested strains (65%) interacted with anti-rNspA sera. There was no noticeable relationship between cell surface expression in a particular strain and classification (by serotype, subtype, or electrophoretic type) or association with the year or country of isolation.

In an attempt to explain these differences in reactivity with serums against rNspA, nspA genes were sequenced in five of the six negative strains (BX232, NG3 / 88, NGP165, M135 and M986) and three positive strains (8047, CU385 and NG6 / 88). The sequence for the sixth negative strain (MC58) was already known based on the complete genomic sequence.

The nspA sequences for all ten strains were highly conserved, varying at most 5 nucleotides compared to the prototype sequence according to Martin et al. The most variant protein had only 3 different amino acids (see figure 29). With one exception, all amino acid variants included the same corresponding residues in separate segments of this protein. These included a signal peptide that was not present in the mature protein, and two short segments at the 50 C-terminal residues. These differences do not explain the results obtained with antisera, since there are examples of identical variant sequences in strains that were positive and strains that were negative (comparison of M136 and 8047; NG165 and NG6 / 88; MC58 and CU385).

Since neither the absence of the gene nor the polymorphism explained the results obtained with antisera, we determined the amount of NspA protein in the outer membranes of the five strains (8047, CU385 and NG6 / 88 - all positive for anti-rNspA; M986 and M136 are both negative). Bacterial cell pellets were extracted with lauryl sarcosinate and insoluble outer membrane fractions were analyzed. The 18.6 kDa band was visible for all five strains and it was cross-reactive with anti-His-labeled-NspA according to Western blotting. Thus, differences between strains in nspA expression also failed to explain these results.

The ability of anti-rNspA to bind to the surface of bacterial cells could be affected by the amount of polysaccharide capsule present. Therefore, the amount of capsular polysaccharide produced by 17 test strains was evaluated using an inhibitory ELISA.

Capsular polysaccharide extracts were prepared according to the method described by Corn et al. [J. Infect. Dis. (1993) 167: 356-64]. Individual bacterial clones were grown to OD ₆₂₀ 0.5-0.7 in 7 ml of Mueller-Hinton broth. Bacteria were collected by centrifugation at 5000g for 15 min, washed in 0.6 ml of 10 mM HEPES, pH 8.0, and then resuspended in 0.6 ml of the same buffer containing 10 mM EDTA and incubated at 37 ° C for 1 hour. Cells were besieged at 10,000 g for 1 min and the relative amount of polysaccharide meningococcus B polysaccharide antigen released into the supernatant was determined using an inhibitory ELISA conducted as described by Azmi et al. [Infect. Immun. (1995) 63: 1906-13]. The solid-phase antigen in the ELISA was the meningococcal B-ADH-biotin polysaccharide complex, absorbed on avidin-coated microtiter plates [Granoff et al.]. Reactive for the meningococcus polysaccharide B human LIP paraprotein [Azmi et al.] Was used as the primary antibody (0.2 μg / ml). In the absence of an inhibitor, this antibody concentration was sufficient to obtain OD ~ 0.7-1.0 after 30 minutes of incubation with the substrate [Azmi et al.]. The titer of the polysaccharide released into the supernatant was measured by determining the dilution of the supernatant, which led to 50% inhibition of antibody binding. Controls in this assay included an EDTA extract obtained from strain M7 that does not produce a capsular polysaccharide and purified meningococcus B. the same buffer and volume as the capsule extract. The observed inhibitory activity from this cell pellet was between 0 and 10% of the activity observed in capsule extracts with this pellet, with a higher percentage being precipitated by the cell strains that produce the highest number of capsules.

The results for each strain are shown in Table 5. On average, six negative anti-rNspA strains produced three times as many capsular polysaccharides as eleven positive strains (corresponding inverse geometric mean dilutions of 676 versus 224, p <0.05). This may explain the results obtained with antiserum - it is understood that the presence of large amounts of capsules could interfere with the ability of the anti-rNspA antibody to bind to NspA epitopes that are available in strains with fewer capsules.

The complement dependent bactericidal activity of anti-rNspA antisera was tested using an assay similar to that described by Mandrell et al. [J.Infect. Dis. (1995) 172: 1279-89]. The complement source was human serum from a healthy adult without a detectable anti-capsule antibody to a group B polysaccharide and without internal bactericidal activity against the test strain. Bactericidal serum titers were defined as serum dilution, resulting in a 50% reduction in CFU / ml after 60 min of incubation of bacteria in the reaction mixture, compared with the control CFU / ml at time 0.

Typically, bacteria incubated with a negative control antibody showed a 150-200% increase in CFU / ml during a 60 min incubation. A positive control antibody [anti-capsule IgG2a mAb SEAM12, Granoff et al.] Showed a complement-mediated bactericidal activity against all 17 strains. In contrast, six strains that were negative for anti-rNspA antiserum binding according to flow analysis were stable in the absence of bactericidal or bacteriostatic effects. Ten of the remaining eleven positive strains were either killed by complement and antisera (SWZ107, J351, CU385, NG6 / 88, BZ198, H44 / 76, NMB and 8047), or were inhibited (H355 and S3446), but strain 1000 did not undergo any effect.

The ability of anti-rNspA antisera to impart passive protection against meningococcal B-bacteremia was tested in young rats using the method described by Saukkonen [J. Infect. Dis. (1988) 158: 209-212]. Briefly, 6-7 day old rats were randomly assigned to lactating females. Groups of 5-6 animals were intraperitoneally infected with 100 μl of approximately 5000 CFU of bacteria of N. meningitidis group B. One strain negative for NspA surface epitopes (M986) and one positive strain (8047) were tested, each of which was passaged three times in rat pups. Immediately prior to administration, the bacterial suspension was mixed with various dilutions of the test or control antibody (positive control: anticapsular mAb; negative control: anti-E. coli). 18 hours after infection, blood samples were obtained from the heart. Aliquots were plated on chocolate agar and CFU / ml was determined after incubation overnight at 37 ° C in 5% CO ₂ .

The protective activities of various co-administered antibodies were as follows:

Antibody Processing Rat Dose or Serum Dilution Strain Blood culture Positive / Total CFU / ml (average x 10 ^-3 ) CFU / ml (% of control) Anti-capsule mAB 2 mcg M986 0/6 <1 <1 Anti rNspA 1: 5 M986 6/6 44 ^a 45 Anti rNspA 1:25 M986 6/6 93 ^a 95 Anti-E. coli control 1: 5 M986 6/6 98 ^{a AL = C> -} Anti-capsule mAB 2 mcg 8047 0/5 <1 <1 Anti rNspA 1: 5 8047 1/6 0.2 ^b 2 Anti rNspA 1:25 8047 1/5 0.4 ^b 4 Anti-E. coli control 1: 5 8047 6/6 10 ^{b AL = C> -}

^a p> 0.5, compared with geometric mean CFU / ml of control rats.

^b p <0.001, compared with geometric mean CFU / ml of control rats.

As you can see, a dose of 2 μg per rat positive anticapsule control was protective against both strains. A 1: 5 or 1:25 dilution of the anti-rNspA antiserum protected against bacteremia caused by strain 8047. However, none of the dilutions was effective in preventing M986 bacteremia.

Thus, despite the positive findings of Martin et al., NspA does not appear to be effective in preventing infection of meningococcus B. Approximately one third of the strains had reduced expression on the cell surface of NspA epitopes when grown in vitro, the strains are resistant to inducible anti -NspA complement-mediated bacteriolysis and are resistant to passive immunization with antiserum. These strains produce large amounts of capsular polysaccharide and therefore, as might be expected, have the highest virulence. Thus, the ability of a vaccine containing only NspA to confer broad protective immunity against meningococcus B is doubtful.

Thus, compositions containing NspA [SEQ ID NO: 4008-4033; figure 29], preferably contain additional antigens. Thus, a preferred aspect of the present invention is the combination of an NspA protein with one or more additional Neisseria antigens.

Example 12. NspA Fragments

Figure 32 shows a model of the secondary structure of NspA containing eight transmembrane β-chains and 4 surface-exposed binding loops. This corresponds to the distribution of alternating hydrophobic and hydrophilic amino acids in NspA, which is a characteristic of many β-cylindrical porins [Weiss et al. (1990) FEBS Letts 267: 268-272].

Gray shaded areas in this model indicate segments that are> 40% identical and> 70% identical relative to the encoded amino acid sequences of opacity proteins (Ora) from N.meningitidis, N..gonorrhoeae, N. flavius, N. sicca and N. influenzae identified in the BLAST search for a CDS gene bank. Alternating sequences are predicted amphiphilic β-chains; vertical segments correspond to transmembrane segments; the upper part of the figure corresponds to the surface-exposed segments, designated as loops 1-4.

According to Martin et al., The only significant homology between the decoded amino acid sequence of NspA and the sequences of other proteins is weak homology with the family of opacity proteins (Ora) in two small segments (~ 20 amino acids) near the C-terminus of this protein. However, separate comparisons of the N- and C-ends of NspA with the gene bank revealed a high degree of homology (> 40% identity and> 70% similarity) in the NspA and Ora proteins from N.meningitidis, N..gonorrhoeae, N.flavius, N.sicca and H. influenzae. Ora proteins are believed to be integral membrane proteins that have a topology of eight transmembrane segments and β-cylinders in the membrane similar to the topology of porin [Merker et al. (1997) Mol. Microbiol. 23: 281-293]. The presence of NspA in detergent-insoluble membrane preparations indicates that NspA is localized in the outer membrane, consistent with the Ora-like membrane topology shown in this model. In addition, the NspA segments that are most homologous to the Ora protein segments are possible transmembrane segments shown in the shaded areas of Figure 32.

Neisseria opacity proteins may, in some circumstances, induce a protective antibody. However, the problems associated with the limited availability of opacity protein antibodies in encapsulated bacteria, the variability of amino acid sequences in exposed loop segments, and phase variation in protein expression during clinical infection have limited the ability of Ora to induce protective antibodies [Malorny et al. (1998) J. Infect. Dis. 172: 1279-89]. In contrast, there appears to be little or no variation in sequence on the surface-exposed NspA loops in Figure 32. However, it has recently been reported that a panel of monoclonal antibodies against NspA N.meningitidis that reacted with all the meningococcal strains studied interacted with only a limited number of strains of N.gonorrhoeae, even though the corresponding amino acid sequences in these two species are 92% identical. When comparing the corresponding NspA sequences of meningococcal and gonococcal strains (Figure 29), all the corresponding amino acid differences lead to changes in hydrophilicity or charge and are localized in putative surface exposed binding loops (Figure 32). This finding suggests that the binding loops in NspA, which are highly conserved in N. meningitidis, may be important epitopes for antibodies that bind to native NspA. Thus, these segments of the molecules appear to be of greatest interest in terms of interaction with a protective antibody. However, the putative NspA surface loops are relatively small (10-14 amino acids) compared, for example, with the highly immunogenic outer loops of PorA and Ors (24-45 amino acids). The shorter length of these loops may limit the availability of surface NspA epitopes for binding interactions with a serum antibody, in particular in the presence of a frequently occurring capsular polysaccharide.

Thus, the present invention provides NspA fragments that are exposed on the cell surface in Figure 32, namely SSSKGSAKG, NYKAPSTDFKLY, NRASVDLGGSDSFSQT and NYIGKVNTVKNVRSG, and also presents corresponding fragments from allelic variants of NspA. In addition, the present invention provides a subsequence of these fragments containing 7 or more adjacent amino acids from these fragments. The invention also provides proteins containing these fragments. Nucleic acids encoding this fragment and proteins are also provided.

These NspA fragments, proteins containing these fragments, and nucleic acids can be used in the compositions of this invention, in particular, as substituents for full-size NspA. In an additional aspect, these fragments, proteins and nucleic acids can be used as isolated products, i.e. they should not be necessarily used in combination with other biological molecules.

It should be understood that the invention has been described by way of example only and that modifications may be made while retaining the spirit and scope of the invention.

Table 5.

Reactivity of anti-rNspA polyclonal antisera with native NspA exposed on the surface of live, encapsulated Neisseria meningitidis B bacteria with respect to sensitivity to bacteriolysis and capsule formation

Strains of Meningococcus B Surface Cell Reactivity ^with NspA Bactericidal activity of ^d anti-rNspA (1 / titer) Capsule Polysaccharide Production (1 / titer ± SE) Strain A country Year Serological classification ET complex SWZ107 ^a Switzerland 1980 4: P1.2 104 Positive ≥64 28 ± 4 NG6 / 88 ^a Norway 1988 NT: P1.1 173 Positive 4 115 + 23 CU385 ^b Cuba 1980 4: P1.15 5 Positive 4 116 ± 1 1H5341 Finland 1986 15: P1.7.16 not def. Positive 16 176 ± 61 Bz198 Netherlands 1986 NT: P- 154 Positive ≥64 362 ± 1 NMB USA 1968 2b: P1.2.5 not def. Positive 16 244 ± 20 8047 USA 1978 2b: P1.2 not def. Positive 16 1125 ± 50 H44 / 76 Norway 1976 15: P1.7.16 5 Positive 24 99 ± 16 1000 ^a USSR 1989 NT: P1.5 61 Positive <4 287 ± 12 S3446 ^b USA 1972 14: P1.23.14 11 (A1 cluster) Positive <4 (static = 16) 585 ± 151 H355 ^b Norway 1973 15: P1.15 11 cluster Positive <4 (static = 4) 656 ± 141 BZ232 ^a Netherlands 1964 NT: P1.2 76 Negative <4 1493 ± 18 NG3 / 88 ^a Norway 1988 8: P1.1 A4 cluster Negative <4 498 ± 105 MS58 Great Britain 1985 15: P1.7,16b 5 Negative <4 627 ± 121 M136 ^b USA 1968 11: P1.15 D1 cluster Negative <4 1056 ± 81 M986 ^b USA 1963 2a: P1.5,2 B2 cluster Negative <4 1442 ± 206 NGP165 Norway 1974 NT: P1.2 37 Negative <4 138 ± 6

^a denotes strains that were further characterized by typing multilocus sequences [Maiden, 1998].

^b denotes strains obtained from the collection of Frasch, US FDA. 8047 was obtained from W. Zollinger, Walter Reed Army Institute of Research, Washington, DC MC58 is a strain selected using TIGR for genomic sequencing. J351 was obtained from M. Sarvas, National Public Health Institute, Helsinki, Finland. The remaining strains were taken from the collection described by Seiler et al. [Seller, 1996]. ET data is borrowed from Caugnant et al. [J.Infect. Dis. (1990) 162: 867-874] and Seiler et al.

^c measured by indirect fluorescence flow cytometry using anti-rNspA antisera.

^d dilution of anti-rNspA antisera, which when incubated for 60 min with bacterial cells and a 20% complement of a person gave a ≥50% decrease in CFU / ml compared to this value at time 0. “Static” refers to strains that were inhibited, but not killed in this analysis (≥50%, but <100% survival at 60 min).

^{f A} titer defined as a dilution of capsule extract giving 50% inhibition of antibody binding to the meningococcal B polysaccharide antigen in an ELISA.

Claims (8)

1. A composition for treating or preventing an infection caused by a Neisseria bacterium, comprising a first protein and a second protein derived from Neisseria meningitidis, in which: the first protein includes an amino acid sequence that is 65% or more identical to the sequence of SEQ ID NO: 2182, 2184, 2186 and / or 8348, and / or is a fragment consisting of 10 or more amino acids of SEQ ID NO: 2182, 2184, 2186 and / or 8348 exhibiting antigen properties; and the second protein includes an amino acid sequence that is 65% or more identical to the amino acid sequence selected from the group consisting of SEQ ID NO: 4004, SEQ ID NO: 4006, SEQ ID NO: 4007, SEQ ID NO: 4008-4056, SEQ ID NO: 6217-8347, SEQ ID NO: 8349-8376 and SEQ ID NO: 2-4002 with even numbers, and / or is a fragment consisting of 10 or more amino acids SEQ ID NO: 4004, SEQ ID NO: 4006, SEQ ID NO: 4007, SEQ ID NO: 4008-4056, SEQ ID NO: 6217-8347, SEQ ID NO: 8349-8376, SEQ ID NO: 2-2180 with even numbers and SEQ ID NO: 2188-4002 with even numbers exhibiting antigen properties. 2. The composition according to claim 1, characterized in that the second protein comprises an amino acid sequence that is 65% or more identical to the sequence of SEQ ID NO: 648, 650, 652 or 654, and / or is a fragment consisting of 10 or more amino acids of SEQ ID NO: 648, 650, 652 or 654. 3. The composition according to claim 1, characterized in that the second protein comprises an amino acid sequence that is 65% or more identical to the sequence of SEQ ID NO: 6249, and / or is a fragment consisting of 10 or more amino acids SEQ ID NO: 6249 . 4. The composition according to claim 1, characterized in that the second protein comprises an amino acid sequence that is 65% or more identical to the sequence of SEQ ID NO: 3898, 3900 or 3902, and / or is a fragment consisting of 10 or more amino acids SEQ ID NO: 3898, 3900 or 3902. 5. The composition according to claim 1, characterized in that the second protein is an NspA protein, preferably in mature form. 6. The composition according to claim 1, additionally containing an adjuvant. 7. The composition according to any one of claims 1 to 6, used as a medicine for the treatment or prevention of infection caused by the bacterium Neisseria. 8. The composition according to any one of claims 1 to 6, used for the manufacture of a medicament for the treatment or prophylaxis of an infection caused by the Neisseria bacterium.

Images