MX2008008580A - Pharmaceutical compositions containing protein nma0939 - Google Patents

Abstract

The invention relates to the field of medicine and, in particular, to the development of pharmaceutical compositions containing protein NMA0939. The inventive proteins provide protection against different diseases which may or may not be caused by pathogens. Protein NMA0939 was identified as a component of preparations of outer membrane vesicles ofNeisseria meningitidisand was obtained using recombinant DNA technology. The immunogenicity and protective activity thereof was evaluated in animal models. Owing to the high level of conservation of the gene that codes for protein NMA0939, the compositions that contain same are of high value as an antigen that can induce an immune response with broad reactivity. The inventive compositions are suitable for use in human medicine.

Description

PHARMACEUTICAL COMPOSITIONS CONTAINING THE NMA0939 PROTEIN FIELD OF THE INVENTION The present invention is related to the branch of medicine, particularly with the development of pharmaceutical compositions, of preventive or therapeutic application, which allow an increase in the quality of the immune response against vaccine antigens characteristic of diseases of diverse origin.

BRIEF DESCRIPTION OF THE INVENTION Neisseria meningitidis, a Gram negative diplococcus whose sole host is man, is the causative agent of meningococcal disease. Usually this bacterium is found in the nasopharynx of people who are asymptomatic carriers, being this the most common route for its microbiological isolation. In the world, children under 2 years of age are the population most susceptible to contracting meningococcal meningitis, however, young adolescents and the population of older adults may also be affected.

Meningococcal disease without treatment is fatal in most affected individuals, and vaccination could prevent this situation by preventing even bacterial colonization. Several strategies have been developed with the aim of obtaining a vaccine preparation that meets the necessary requirements to protect the population against this disease. For this, capsular antigens whose immunological specificity has allowed the classification of this microorganism in serogroups have been taken into account. At present, 5 of these serogroups have been defined as responsible for the majority of cases of meningococcal disease in the world. The serogroup A is the main responsible for the epidemics in sub-Saharan Africa. Serogroups B and C are associated to the majority of cases that occur in developed countries. Serogroups Y and W135 are present in most of the remaining cases of the disease and infection prevalent in some regions of the United States, with a marked increase in recent years. Hence, capsular polysaccharides have been studied and evaluated as vaccine candidates. A tetravalent vaccine, based on polysaccharides, that confers protection against serogroups A, C, Y, and W-135 has been licensed in the United States. The antibodies that are generated after vaccination are serogroup-specific (Rosenstein N. et al (2001), Meningococcal disease, N. Engl. J. Med 344: 1378-1388). Serogroup B, unlike the rest, continues to be an important cause of endemic and epidemic meningococcal disease, largely due to the lack of effective vaccines against it. It has been seen that serogroup B polysaccharide has low immunogenicity, in addition to the potential risk that vaccines based on this compound may develop immunotolerance and / or induce autoimmunity due to their structural homology with oligosaccharide chains present in human fetal structures (Finne J et al., (1987) An IgG monoclonal anti- body to group B meningococci cross-reacts with developmentally regulated polysialic acid units of glycoproteins in neural and extraneural tissue J. Immunol 138: 4402-4407). For this reason, the development of vaccines against serogroup B has focused on the use of subcapsular antigens.

Vesicles and outer membrane protein vaccines In the 1970s, the production of external membrane protein (PME) vaccines was based on the elimination of lipopolysaccharide (LPS) from protein preparations using detergents (Frasch CE and Robbins JD (1978) Protection against group B meningococcal disease III Immunogenicity of serotype 2 vaccines and specificity of protection in a guinea pig model J Exp Med 147 (3): 629-44). Then, the PMEs were precipitated to produce aggregates resuspended in sodium chloride. Despite the good results obtained in animal studiesThese vaccines did not induce bactericidal antibodies neither in adults nor in children (Zollinger WD, et al (1978).) Safety and immunogenicity of a Neisseria meningitidis type 2 protein vaccine in animals and humans J. Infecí. Dis 137 (6): 728-39), a result that was attributed to the denaturation of proteins present in the preparation, as a result of precipitation. The next steps in the search for a new candidate were: to design a vaccine that presents proteins in their native conformation forming outer membrane vesicles (VME) (Zollinger WD, et al., 1979) Complex of meningococcal group B polysacchañde and type 2 outer membrane protein immunogenic in man J. Clin. Invest. 63 (5): 836-48; Wang LY and Frasch CE. (1984). Development of a Neisseria meningitidis group B serotype 2b protein vaccine and evaluation of a mouse model. Infecí Immun. 46 (2): 408-14136). The vaccines composed of external membrane vesicles were significantly more immunogenic parenterally than the PME aggregates, and this immunogenicity was initially explained by a greater adsorption to the adjuvant aluminum hydroxide (Wang LY and Frasch CE., 1984) Neisseria meningitidis group B serotype 2b protein vaccine and evaluation in a mouse model: Infecí Immun 46 (2): 408-14136). Several efficacy studies have been carried out using vaccines based on VME, in different formulations. The two most widely studied vaccines were developed in the 1980s, in response to outbreaks of meningococcal disease in Cuba (Sierra GV et al., 1991) Vaccine against group B Neisseria meningitidis: protection trial and mass vaccination results in Cuba. Ann Dis. 14 (2): 195-210) and Norway (Bjune G, et al. (1991), Effect of outer membrane vesicle vaccine against group B meningococcal disease in Norway, Lancet 338 (8775): 1093-6), respectively. The vaccine produced by the Finlay Institute in Cuba (commercially known as VA-MENGOC-BC®) is produced from strain B: 4.7: P1.19,15 and is composed of a VME preparation of said strain and polysaccharide. capsular isolated from serogroup C, adsorbed to aluminum hydroxide (Sierra GV et al 1991. Vaccine against group B Neisseria meningiiidis: protection trial and mass vaccination results in Cuba NIPH Ann Dis. 14 (2): 195-210) r The vaccine contributed to a rapid decline in the epidemic in Cuba (Rodríguez AP, et al., 1999. The epidemiological impact of antimeningococcal B vaccination in Cuba, Mem Insf Oswaldo Cruz, 94 (4): 433-40). The vaccine produced by the National Institute of Public Health of Norway (NIPH) was initially used during a hyperendemic period of the disease caused by a strain belonging to clone ET-5 (B: 15: P1.7,16). This monovalent vaccine was also produced from purified VMEs and adsorbed to aluminum hydroxide (Bjune G, et al., 1991.) Effect of the outer membrane vesicle vaccine against group B meningococcal disease in Norway, Lancet. 338 (8775): 1093 -6). VME vaccines seem to be effective in the presentation of SMEs, arranged in their natural conformation, to allow the generation of bactericidal antibodies, at least in adolescents and adults. The generated antibody responses increased the opsonophagocytosis of the meningococcus. The precise formulation of the vaccines (for example: content of PME, content of LPS and the presence or absence of the adjuvant) has a significant impact on immunogenicity, there being great differences from one producer to another depending on the strain and / or the methodology used (Lehmann AK, et al. (1991) Immunization against serogroup B meningococci, Opsonin response in vaccines as measured by chemíluminescence, APMIS 99 (8): 769-72, Gómez JA, et al. (1998). In the isotypes and bactericidal activity of antibodies agaínst the transferrin-binding proteins of Neisseria meningitidis Vaccine .16 (17): 1633-9; Steeghs L, et al., (1999) Immunogenicity of Outer Membrane Proteins in a Lipopolysaccharide-Deficient Mutant of Neisseria meningitidis: Influence of Adjuvants on the Immune Response, Infect Immun.67 (10): 4988-93). However, the antigenic profile of the isolates obtained from patients changes rapidly and a vaccine covers only a limited number of strains, so it can be ineffective in a few years, if the strains that compose it do not correspond to the existing local epidemic. So far, VME vaccines have been more widely used than any other serogroup B vaccine and are useful in the context of outbreaks of the disease caused by a single strain type. The immunogens responsible for the cross-reactivity induced by this type of preparations have not been fully characterized, and many antigens present in these preparations remain to be identified. Studies conducted with sera from clinical trials of the Finlay Institute and the NIPH suggest that antibodies against the class 1 protein (P1, also called PorA) and Opc (another major PME) (Wedege E, et al. (1998) Immune Responses against Major Outer Membrane Antigens of Neisseria meningitidis in Vaccines and Controls Who Contracted Meningococcal Disease during the Norwegian Serogroup B Protection Trial, Infecí Immun.66 (7): 3223-31), are important mediators of serum bactericidal activity ( fundamentally P1) and in both proteins a marked variability of strain to strain was observed. The P1 protein is an antigen with a significant level of variability, which seems to undergo continuous variation between and during outbreaks (Jelfs J, et al. (2000) .Sequence Variation in the Gene of a Clone of Neisseria meningitidis during Epidemic Spread. Clin Diagn Lab Immunol. 7 (3): 390-5). Bactericidal antibodies are predominantly directed towards this antigen after vaccination and after the disease. However, its variability makes it questionable whether the protection product of immunization with VME vaccines of a single strain (monovalent) is broad spectrum. To solve this problem, a VME vaccine in the Netherlands (RIVM) containing P1 from six different pathogenic isolates was developed (van der Ley P and Poolman JT., 1992) Construction of a multivalent meningococcal vaccine strain based on the class 1 outer membrane protein Infecí Immun. 60 (8): 3156-61; Claassen I, ei al. (nineteen ninety six). Production, characterization and control of a Neisseria meningiíidis hexavalent class 1 outer membrane protein containing vesicle vaccine. Vaccine 14 (10): 1001-8). In this case, the vesicles were extracted from two variants of strain H44 / 76, genetically engineered to express three independent P1 proteins.

The search for a universal antigen Although SMEs can induce a functional immune response against serogroup B, none of the vaccines confers a universal protection, due to the great heterogeneity of the regions exposed on the surface of SMEs. The discrete cross-reactivity induced by VME vaccines has stimulated the search for an external membrane antigen (or a group of antigens), which induces functional antibodies and is present in all strains of the meningococcus. These antigens should be the basis for a truly universal antimeningococcal vaccine, which will eliminate the potential problem of capsular modification in pathogenic strains after vaccination with polysaccharide. Due to the variability of the immunodominant protein P1, its use in a universal vaccine is limited and therefore other major SMPs were considered candidates for a vaccine and many of them are in development. Some of those that have been included are: proteins regulated by iron (TbpA and B, FbpA and FetA), NspA and proteins of class 5 (Opc). TbpB is part of the transferrin binding complex, together with TbpA. Recent work suggests that TbpA plays a more important role in iron binding (Painter M, et al., 1998) Analysis of TbpA and TbpB functionality in detective mutants of Neisseria meningiiidis J Med Microbiol 47 (9): 757- 60) and is a more effective immunogen than TbpB. The NspA protein, a minor PME, highly conserved, has been discovered through a novel technique, which consists of using combinations of PME from different strains to immunize mice (Martin D, et al., 1997) Highiy Conserved Neisseria meningiiidis Surface Protein Confers Protection against Experimental Infection, J Exp Med 185 (7): 1173-83). B cells from immunized mice were used to produce hybridomas, and mAbs were screened for cross-reactivity against multiple strains of meningococcus. As a result, a monoclonal antibody with cross-reactivity was found that recognized a PME of 22 kDa and was designated as NspA. Immunization of mice with NspA induced response of bactericidal antibodies against strains of groups A to C. This protein also protects against lethal meningococcal infection (Martin D, et al., 1997) Highiy Conserved Neisseria meningitidis Surface Protein Confers Protection against Experimental Infection, J Exp Med 185 (7): 1173-83). The comparison of genetically divergent NspA sequences showed that the protein is highly conserved (97% homology) (Cadieux N, ef al. (1999).) Bactericidal and Cross-Protective Activities of a Monoclonal Antibody Directed against Neisseria meningiíidis NspA Outer Membrane Protein Infecí Immun 67 (9): 4955-9).

The presence of NspA was detected by ELISA in 99.2% of the strains evaluated belonging to the serogroups from A to C, using monoclonal antibodies (Martin D, et al., 1997) Highiy Conserved Neisseria meningitidis Surface Protein Confers Protection against Experimental Infection, J Exp Med 185 (7): 1173-83). It has been shown that these monoclonal antibodies show bactericidal activity against numerous strains of meningococcus and are capable of reducing the bacteremia caused by this microorganism in a murine model (Cadieux N, et al. (1999).) Bactericidal and Cross-Protective Activities of a Monoclonal Antibody Directed against Neisseria meningitidis NspA Outer Membrane Protein, Infecí Immun 67 (9): 4955-9). Although these results suggest that NspA is a promising vaccine candidate capable of conferring protection against several serogroups, a mouse polyclonal serum against the recombinant protein was not associated to the surface in 35% of the meningococcal strains of serogroup B, despite of the presence of the nspA gene in these organisms (Moe GR ei al. (1999). Dífferences in Surface Expression of NspA among Neisseria meningiíidis Group B Strains, Infecí Immun 67 (11): 5664-75).

Sequencing of the Neisseria meninqitidis qenome and its impact on vaccine development Sequencing of the genome of MC58, a serogroup B meningococcal strain was published during the year 2000 (Tettelin H, et al., 2000) Complete Genome Sequence of Neisseria meningitidis Serogroup B Strain MC58.Science 287 (5459): 1809-15172), and from Z2491, a serogroup A strain (Parkhill J, et al., (2000) Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491. Nature 404 (6777): 502-6173). The availability of DNA sequences has had a great influence in the investigation of an antimenygococcal vaccine. While the sequencing of the MC58 genome continued its development, Pizza and collaborators began by identifying the open reading frames (ORFs) that, according to the predictions, codified for the proteins exposed on the surface, those bound to membrane and those that are exported. This group of researchers identified 570 ORFs, amplified through the polymer chain reaction and cloned in Escherichia coli, to allow the expression of fusion proteins with histidine tail or glutathione S-transferase (Pizza M, et al. (2000) Identification of Vaccine Candidates Against Serogroup B Meningococcus by Whole-Genome Sequencing, Science 287 (5459): 1816-20). 61% (350) of the selected ORFs were expressed successfully. In most cases, those who could not express themselves had more than one transmembrane hydrophobic domain. The recombinant proteins were purified and used to immunize mice. The sera obtained were evaluated by ELISA, flow cytometry and the bactericidal activity was determined against 2 strains. Subsequently, 7 proteins were selected that were positive in the 3 trials. Vaccine formulations using some of these proteins combined with adjuvants, induced significant titers of bactericidal antibodies against the homologous strain (MC58), but none of them was as high as those induced by a VME vaccine of this same strain (Giulianí MM, ei 2000. Proceedings 12th IPNC, p.22). On the other hand, there is evidence that combinations of these proteins are more immunogenic than each protein separately (Santini L. et al (2000), Proceedings 12th IPNC, p.25). The numerous ORFs excluded in this work, due to the lack of protein expression or to changes in immunological properties, need further investigation. The components of a vaccine should be selected based on the contribution of the antigens in the pathogenesis of N. meningitidis. Antigens alone can be effective vaccine candidates, or alternatively, attenuated mutants can be considered as members of a vaccine. An important problem in the prevention and / or therapy of meningococcal disease is that none of the vaccines available to date confers universal protection, due to the great heterogeneity of the meningococcal antigens that have been used as a vaccine.

DETAILED DESCRIPTION OF THE INVENTION This invention contributes to solving the aforementioned problem by providing pharmaceutical compositions containing a protein whose sequence is highly conserved, even between different genera of pathogenic microorganisms. The technical objective pursued with this invention is precisely the development of compositions capable of elevating and / or expanding the systemic and mucosal immune response of the host against several pathogens, or against a broad spectrum of varieties thereof. The use of the NMA0939 protein in therapeutic or preventive pharmaceutical compositions is reported for the first time. More particularly, the invention relates to pharmaceutical compositions, containing said protein, for preventing or treating any infection caused by a bacterium of the genus Neisseria. In a particular embodiment of the invention, pharmaceutical compositions containing said antigen are useful for the prevention or treatment of diseases caused by N. meningitidis and N. gonorrhoeae, respectively. In another embodiment of the invention, the pharmaceutical compositions containing the protein NMA0939 may also contain one or more antigens of a synthetic, recombinant or natural nature. In a preferred embodiment, the combined pharmaceutical compositions contain polysaccharide antigens, including bacterial polysaccharides. More particularly, the invention relates to the capsular polysaccharides of N. meningitidis. The pharmaceutical composition of the present invention may contain protein-polysaccharide conjugates, whose polysaccharide component corresponds to a bacterial polysaccharide.

In another preferred embodiment, the pharmaceutical compositions containing NMA0939, contain antigens of peptide nature, in order to extend the spectrum of protection thereof. The compositions of the present invention are administered by parenteral route, or by mucosal route, including oral administration. In another embodiment of the invention, the protein N A0939 can be used as an immunopotentiator or carrier of peptides, polysaccharides or other antigens of lower immunogenicity, in order to enhance the immune response against them. Example 11 illustrates that the aforementioned protein is capable of significantly raising the levels of antibodies against a peptide derived from a viral antigen, once both molecules have been conjugated. It is also part of the present invention, that the protective determinants for a given protein antigen are inserted into the NMA0939 protein sequence, in order to induce an increased immune response against them, giving rise to hybrid proteins that are part of the a pharmaceutical composition. In another preferred embodiment, the pharmaceutical compositions of the present invention may contain fragments of the NMA0939 protein, which are capable of generating a protective response against the meningococcus or other bacteria of the Neisseria genus in the host. In a particular embodiment of the invention, the pharmaceutical compositions contain mimotopes or mimetic peptides of the NMA0939 protein, in synthetic form or obtained by recombinant DNA technology. The term "mimotope" means any peptide that is capable of generating antibodies that are combined with the NMA0939 protein, and thereby are capable of producing a protective response against Neisseria. It is also part of the present invention to detect meningococcal disease by using pharmaceutical components containing the NMA0939 protein, or the gene coding therefor, either alone or in combination with other components.

BRIEF DESCRIPTION OF THE FIGURES Figure 1. Vector pM238 used in the cloning and expression of the NMA0939 protein. Figure 2. Final construction obtained from the cloning of the nucleotide sequence corresponding to the nma0939 gene in the vector pM238. Figure 3. Analysis by SDS-PAGE of the fractions obtained in the cell rupture; lane 1, total cells; lane 2, precipitate of rupture; lane 3, rupture supernatant. PM: molecular weight pattern. Figure 4. Analysis of the purity of the different fractions of the purification process of the recombinant protein NMA0939, from the precipitate of rupture, by SDS-PAGE: Lane 1, precipitate of solubilization with 2M urea in carbonate-bicarbonate buffer; lane 2, solubilization supernatant; lane 3, fraction not adsorbed to the purification matrix; lane 4, lower molecular weight contaminant eluting in another chromatographic peak; lane 5, purified protein. PM: molecular weight pattern. Figure 5. Antibody levels (IgG) against the recombinant protein NMA0939, obtained by immunizing mice with the same antigen adjuvanted with Freund's Adjuvant (Freund), Aluminum hydroxide (Alum) or polysaccharide C (PsC) of N. meningitidis, by intraperitoneally. The results obtained in an ELISA-type test are represented, which were expressed as the inverse of the titer, calculated as the dilution of the serum sample where the optical density of the pre-immune serum sample is doubled. Figure 6. Recognition of antigenic determinants present in the PME of N. meningitidis, strain CU385, using sera from mice immunized with the recombinant protein NMA0939 adjuvanted with Freund's Adjuvant (Freund), Aluminum hydroxide (Alum) or polysaccharide C (PsC) intraperitoneally. The results were expressed as the inverse of the titer, calculated as the dilution of the serum where the optical density of the pre-immune serum is doubled. Figure 7. Results of the search for similarity between the gene coding for the protein NMA0939 ("query") and the annotated sequences of the genomes of different serogroups of N. meningitidis ("Sbjct") using the BLAST program.

Figure 8. Recognition of antigens present in 5 strains of N. meningitidis, by sera produced after immunization with the recombinant protein NMA0939 mixed with polysaccharide C of N. meningitidis intraperitoneally. Sera generated after immunization of the protein with other adjuvants had a similar behavior. The results were expressed as the inverse of the titer, calculated as the dilution of the serum where the optical density of the pre-immune serum is doubled. Figures 9A and 9B. Passive protection experiments against meningococcal infection in the infant rat model, using the sera obtained by immunizing with the recombinant protein NMA0939 with Freund's Adjuvant (Freund), with Aluminum hydroxide (Alum) or mixed with the polysaccharide C (PsC) of N Meningitidis. A: Infection with strain CU385, and B: Infection with strain 233 (C: 2a: P1.5). C-: mixture of sera from untreated animals, C +: mouse serum immunized with outer membrane vesicles of N. meningitidis of strain CU385 or 233, as appropriate for the experiment. The symbol * represents a statistically significant difference with respect to the negative control group (C-), in terms of bacteremia levels expressed as colony forming units per milliliter (cfu / ml). Figure 10: Recognition of the recombinant protein NMA0939 and a panel of unrelated antigens, by the mAbs generated (mAbs H10 / 67, 3H3 / 24 and 7D6 / 18). Antigens: P1, class 1 protein of N. meningiíidis strain B: 4: P1.15; P64k, protein from N. meningitidis; T.T, tetanus toxoid; HBsAg, Hepatitis B virus surface antigen. The results are represented as the absorbance (492nm) in an ELISA-type assay. Figure 11. Recognition of the recombinant protein NMA0939 by sera of convalescent patients of meningococcal disease. As a negative control, sera from healthy donors were used. The results are represented as the absorbance (492nm) in an ELISA-type assay. Figure 12. Anti-JY1 peptide antibody titers corresponding to the sera of the animals immunized with the free peptide (JY1), the recombinant protein (NMA0939) and the JY1-NMA0939 conjugate. Figure 13. Antibody levels (IgA) against the recombinant protein NMA0939 present in samples of lung washes of mice immunized intranasally with the protein mixed with polysaccharide C of N. meningitidis (NMA0939 + PsC) or with the protein incorporated in liposomes ( NMA0939_Lip).

EXAMPLES OF REALIZATION EXAMPLE 1 Detection of the NMA0939 protein in preparations of outer membrane vesicles of Neisseria meningitidis, serogroup B In order to study the proteins present in preparations of outer membrane vesicles of N. meningitidis serogroup B (strain CU385, classification B: 4: P1.19,15), a bi-dimensional electrophoresis was performed as described in the literature (Sabounchi -Schutt F, et al. (2000) An immobiline DryStrip application method enabling high-capacity two-dimensional gel electrophoresis Electrophoresis 21: 3649-3656.An enzymatic digestion of proteins extracted from the gel using the enzyme trypsin was then carried out. (Promega, Madison, Wl, EU) Peptides generated during digestion were extracted from the solution using micro columns (ZipTips, Millipore, MA, USA) Prior to the mass spectrometry analysis the peptides were eluted from the microcolumns with 60% acetonitrile and 1% formic acid and immediately the mixture was loaded into nano needles (Protana, Denmark) .The measurements were performed on a spectrometer hybrid mass with quadrupole and flight time (QTof-2 ™, Manchester, United Kingdom), equipped with an ionization source (nanoESI). The mass spectra were acquired in a range of m / z from 400 to 2000 in 0.98 seconds and using 0.02 seconds between each of the sweeps. The acquisition and processing of the data was carried out through the MassLynx program (version 3.5, Micromass). Protein identification based on the ESI-MS spectra was performed using the ProFound program (Zhang W and Chait BT., 2000) ProFound: an expert system for protein identification using mass spectrometric peptide mapping information Anal Chem 72: 2482-2489; http://prowl.rockefeller.edu/cgi-bin/ProFound). The search subscribed to the gene and protein sequences of bacteria contained in the SwissProt databases (http://www.ebi.ac.uk/swissprot/) and NCBI (http://www.ncbi.nlm.nih.gov/), considering the oxidation of methionines, the deamidation and the carboxyamydomethylation of cisterns as possible modifications present. The identification of the proteins based on the MS / MS spectra was carried out through the MASCOT program (Perkins DN, et al., 1999. Probability-based protein identification by searching sequence databases using mass spectrometry data.) Elecirophoresis 20: 3551 -3567 http://www.matrixscience.com/). The search parameters included the modification of cysteines as well as possible oxidations and deamidations. From the analysis of the data obtained from the identification of the proteins present in preparations of outer membrane vesicles, it was selected to sequence a group of peptides. From the sequencing by mass spectrometry of one of them, the existence in serogroup B of a homologue of the protein NMA0939 was verified, which was not identified or predicted from the genomes of serogroup B. This candidate homologous to NMA0939, It is called NMA0939 throughout the entire document.

EXAMPLE 2 Homology analysis of NMA0939 protein with gene products reported in databases For the homology analysis of the NMA0939 protein, a sequence similarity search was performed in the NCBI database using the BLAST program (Altschul SF, et al., 1990. Basic local alignment search tool, J Mol Biol 215 : 403-410; http://www.ncbi.nlm.nih.gov/BLAST/). With this procedure, the corresponding homologous was identified in the case of N. gonorrhoeae and that of serogroup A of N. meningitidis, not so in the case of strain MC58 of serogroup B of this species. However, the modality of a homology search using the nucleotide sequence of the nma0939 gene did show the presence thereof in said strain, which indicates in this case an error of annotation for the corresponding genome. The annotated gene in question corresponds to the ORF nma0939, with homologs also present in N. gonorrhoeae (NGO0306). In serogroup B, the homologue to this protein is encoded in the DNA region between positions 761673 and 762295, located immediately after the nmb0729 gene and before the nmb0730 gene. This is, therefore, the first report of the existence of a homologue of the NMA0939 protein in serogroup B. In other microorganisms, no protein with significant similarity values could be identified, indicating a possible specific genus antigen.

EXAMPLE 3 Cloning and expression of the nma0939 gene, coding for the NMA0939 protein of Neisseria meningitidis, in Escherichia coli To clone and express the nma0939 gene, the vector pM238 was used. Said vector allows cloning using different restriction enzymes, and obtaining high levels of expression of heterologous proteins in the form of inclusion bodies in the cytoplasm of E. coli. The vector pM238 (Figure 1) has the following main elements: tryptophan promoter, sequence corresponding to the N-terminal stabilizing segment of the P64k antigen of N. meningitidis strain CU385 (coding for 47 a.), Sequence coding for a tail of C-terminal histidine, sequence corresponding to the transcription terminator of bacteriophage T4 and sequence corresponding to the gene that confers resistance to ampicillin as selection marker. In addition, this vector allows the selection of recombinants by means of blue or white coloration of the colonies, product of the presence of the lacZ alpha subunit gene. From the nucleotide sequence corresponding to the gene coding for the protein NMA0939 (Example 1), a pair of oligonucleotides (704467U and 704467L) was designed to amplify the segment of said gene without the sequence coding for the signal peptide, using the genomic DNA of strain CU385 (B: 4: P1.19, 15). Xba-I Bql-ll 704467U: 5"GTGGTATCTAGATCTGCCAGCCAGAAACTC '3 (SEQ ID No. 1) 704467L: 5' CAACCCGGGATCCTTCCTTGTCCAAATC 3" BamH-l (SEQ ID No. 2) For the prediction of the signal peptide, the methods described in SignalP World Wide Web server (http://www.cbs.dtu.dk/services/SiqnalP-2.0). Following the amplification of the gene coding for the NMA0939 protein by the polymerase chain reaction (PCR) (Saiki RK, et al., 1988) S First-directed enzymatic amplification of DNA with a thermostable DNA polymerase. : 487-491), using the oligonucleotides 704467U and 704467L, said PCR product was digested, using the enzymes BglII and BamH-l, and cloned in the pM238 vector previously digested in the same manner. The final construction obtained is shown in Figure 2, the recombinant protein NMA0939 was obtained fused to the N-terminal segment of the P64k. Sequencing of the cloned nma0939 gene segment was performed using the automatic sequencer ALFexpressIl (Termo Sequenase ™ Cy ™ 5 Dye Terminator Kit, Amersham Biosciences) and the oligonucleotides 1573 (SEQ ID No. 8) and 6795 (SEQ ID No. 9), which hybridize in the sequence corresponding to the stabilizing segment of P64k and in the transcription terminator of bacterage T4, respectively. The plasmid obtained was named pM NMA0939 for its later use. For the expression of the nma0939 gene, the E. coli strain GC 366 was transformed by the chemical method with the plasmid pM NMA0939 (Figure 2). The expression experiment was carried out in M9 minimal salt medium (Miller JH (1972), Experiments in Molecular Genetics, Cold Spring Harbor Laboratory Press, New York, USA) supplemented with 1% glucose, 1% casein hydrolyzate, extract yeast 0.1%, 0.1 mM CaCl2, 1 mM MgSO4 and 50 μg / mL ampicillin. The cultures were incubated for 12 h at 37 ° C at 250 r.p.m. After this time they were centrifuged and the cell precipitate was broken by ultrasonic disruption (IKA LABORTECHNIK). Supernatant and precipitate fractions obtained were analyzed by means of denaturing electrophoresis in polyacrylamide gels (SDS-PAGE) (Laemmii UK, 1970) Cleavage of structural proteins during the assembly of the head of bacterage (Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis). T4, Nature 277: 680) and staining with Coomassie Brilliant Blue R-250; analyzing the percentage of expression by means of densitometry of the gel (LKB Bromma 2202 Ultrascan laser densitometer, Amersham Pharmacia Bíotech, United Kingdom). The protein NMA0939 was obtained in the precipitate of rupture, representing 20% of the total of the proteins present in this fraction (Figure 3). Samples of the cellular precipitate were solubilized with carbonate-bicarbonate buffer (0.1 M sodium carbonate, 0.1 M sodium hydrogen carbonate) containing dissolved urea at different molarities (2M, 4M, 6M and 8M). When the above-described buffer containing dissolved 2M urea was used, the NMA0939 protein present in the breakage precipitate is solubilized. The supernatant after solubilization was subjected to an affinity chromatography for metal chelates to carry out the purification of the protein of interest and a sample with 80% purity was obtained, as shown in Figure 4. Finally, a dialysis and proceeded to its evaluation in laboratory animals.

EXAMPLE 4 Evaluation of the immune response induced by the NMA0939 protein intraperitoneally To evaluate the immunogenicity of the NMA0939 protein, an immunization scheme was designed in mice, in which the adjuvanted protein was administered with aluminum hydroxide, Freund's adjuvant or polysaccharide C of N. meningiiidis. With these preparations, female Balb / c mice, 8 to 10 weeks of age, were immunized and divided into 3 groups of 8 mice each. Three immunizations were performed intraperitoneally, separated by an interval of 7 days. A control group that received PBS in the first three immunizations was used, but like the rest of the groups received a booster dose with the aluminum hydroxide adjuvanted protein, 45 days after the start of the experiment. The composition of the groups is described in the table: TABLE 1: Groups of Balb / C mice used for immunization The titers of antibodies (IgG) against the recombinant protein and against antigens present in the bacteria were determined by means of an ELISA-type assay, in sera obtained after the booster dose. In Figure 5 the antibody titers of each of the animals against the recombinant protein are shown. From the second inoculation, antibodies capable of recognizing the administered antigen are detected (data not shown), although they were higher after the last inoculation.

Immunological identification was also performed by Western blotting, detecting the recognition of the band corresponding to the protein (data not shown). Sera obtained after immunizing with the recombinant protein recognized antigenic determinants present in a PME preparation of strain CU385. These results are shown in Figure 6. For the statistical analysis, the titers of antibodies obtained were transformed to achieve normal distribution of the values and / or variance homogeneity. In general, the statistical significance of the differences between the groups was analyzed by simple classification variance analysis, followed by the Newman Keuls multiple range test.

EXAMPLE 5 Characterization of the gene coding sequence for the protein NMA0939 in different strains of Neisseria meningitidis and in Neisseria gonorrhoeae To analyze the conservation of the sequence of the gene coding for the NMA0939 protein between different strains, a similarity search was carried out with the genomes of N. meningiíidis (serogroups A and B) and N. gonorrhoeae annotated in the NCBI database ( NC 003116.1.

NC 003112.1. NC 002946). using the BLAST program (Altschul SF, et al (1990), Basic local alignment search tool, J Mol Biol 215: 403-410, http://www.ncbi.nlm.nih.gov/BLAST/). Figure 7 shows the results of the comparison for those sequences that produce a significant alignment in each of the analyzed genomes. Said sequences have 99% identity in serogroup B, 100% identity in serogroup A and 96% in the case of N. gonorrhoeae, with the sequence of the gene coding for the protein NMA0939 obtained (SEQ ID No. 3). Additionally, the nucleotide sequence of the gene in question was determined for 3 Cuban isolates (SEQ ID No. 5-7) belonging to serogroup B (B: 4: P1.19,15) and a sequence alignment was performed using the ClustalX program (http://www.ebi.ac.uk/clustalw/). The results of the alignment show that there is great conservation in the nucleotide sequence of the nma0939 gene between the different strains analyzed and generally in the genus Neisseria. The use of the NMA0939 protein as a vaccine candidate, taking into account the high degree of similarity between the previously mentioned sequences, would allow to generate an effective immune response with a broad spectrum of protection against meningococcal disease, product of the broad reactivity.

EXAMPLE 6 Characterization of the broad-spectrum immune response induced by the immunization of Balb / c mice with the NMA0939 protein In order to evaluate whether immunization with the protein NMA0939 induces a response of wide reactivity with several strains of Neisseria, an ELISA assay was performed in which the polystyrene plates were coated with complete cells of 5 Neisseria strains belonging to different serogroups, serotypes and serosubtypes. The plates were incubated with the mixture of the sera obtained against the protein NMA0939 mixed with different adjuvants, as described in Example 4. Figure 8 shows the recognition of antigens present in strains of serogroups A, B and C of N. meningiiidis, for the sera obtained after immunization with the recombinant protein NMA0939 mixed with the polysaccharide C of N. meningitidis. The sera generated after the inoculation of the protein with the other adjuvants had a similar behavior.

EXAMPLE 7 Protection induced by murine sera generated against protein NMA0939 in the infant rat model To determine the functional activity of the antisera obtained, a passive protection test was performed in the model of meningococcal infection in infant rats. In this test 24 rats of ~ 5 to 6 days of birth were used, divided into groups of 6 animals each. It was determined whether the sera administered by the intraperitoneal route protected the rats from the meningococcal infection caused by strain CU385, inoculated by the same route one hour later. Sera from each group of immunized mice were mixed before being inoculated into infant rats and diluted 1:10 in sterile PBS. Four hours after the challenge, the animals were sacrificed and a count of the viable bacteria in their blood was made. For the interpretation of the results, a single-tail student test was performed, where each group in the study was compared with the negative control (mixture of untreated animal sera). As seen in Figure 9A, the group that received antibodies from the mice that were immunized with the NMA0939 protein mixed with polysaccharide C from N. meningitidis showed significant differences with respect to the negative control, that is, the antibodies were protective in the infant rat model. . The antibodies generated after immunization with the protein mixed with Aluminum Hydroxide were also protective in this model (data not shown). A similar assay was performed infecting the infant rats with strain 233 (C: 2a: P1.5) and the results are shown in Figure 9B, as in the previous experiment being detected as antibodies from mice immunized with the protein adjuvanted with Aluminum hydroxide or polysaccharide C protected rats from meningococcal infection in the model used. Other tests were performed infecting rats with strains H44 / 48 and 120/90, isolated from patients in Cuba, whose serological classification is homologous to that of strain CU385. In addition, a challenge experiment was carried out with strain H44 / 76 (B: 15: P1.7,16) of serogroup B. In all cases antisera from mice immunized with NMA0939 protein adjuvanted with Aluminum Hydroxide or mixed with Polysaccharide C from N. meningiiidis protected the infant rats against meningococcal infection.

EXAMPLE 8 Generation of monoclonal antibodies against the NMA0939 protein, capable of mediating bactericidal activity against Neisseria meninojitidis Aiming to generate specific monoclonal antibodies (mAbs) against the NMA0939 protein, and study their functional capacity to mediate bactericidal activity against homologous and heterologous strains of N. meningitidis, a preparation of the NMA0939 protein with a percent purity of 80% (Example 3) was used in an immunization scheme. The immunization scheme was performed in Balb / c mice (H-2d, female, 5-6 weeks) and had a total of 4 doses distributed as follows: days 0, 15 and 30 of the scheme were inoculated 10 μg of the NMA0939 antigen per mouse (total volume 100 μl), administered subcutaneously, emulsified the first dose with complete Freund's Adjuvant, and the remaining doses with Incomplete Freund's Adjuvant; on day 50, 10 μg of the antigen was administered per mouse in phosphate buffer solution (140 mM NaCl, 270 mM KCI, 1.5 mM KH2PO4, 6.5 mM Na2HPO4 x 2H2O, pH 7.2) intraperitoneally. The extractions were performed on days 0 and 45 of the scheme. Splenocytes from the best-title animal, evaluated by indirect ELISA using the NMA0939 protein in the coating, were fused with the X63 Ag8 653 myeloma cells and the resulting hybridomas were isolated and investigated according to established methods (Gavilondo JV. (1995). Monoclonal Antibodies: Theory and Practice, Elves Scientiae, Havana, Cuba). The reactivity of the antibodies secreted by the hybridomas obtained against the protein NMA0939, as well as its reactivity against a group of unrelated antigens, was evaluated by means of an indirect ELISA using 5 μg / ml of each of the antigens in the coating, and the same concentration of the mAbs to be tested. Figure 10 shows the results obtained in this experiment, in total 3 positive clones were obtained (mAbs H10 / 67, 3H3 / 24 and 7D6 / 18) that specifically recognize the NMA0939 protein, and not the amino acid sequence corresponding to the N-segment. P64k term, nor to the rest of the panel of unrelated antigens tested. To determine the capacity of the mAbs generated against the NMA0939 protein to mediate bactericidal activity against homologous and heterologous strains of N. meningitidis, a bactericidal assay was performed. The bactericidal antibody titer was expressed as the reciprocal of the highest antibody dilution evaluated, capable of killing 50% or more of the bacteria; two of the mAbs generated (3H3 / 24 and 7D6 / 18) had bactericidal titers greater than 1: 128 against the homologous strain B: 4: P1.19.15 and one (H10 / 67) greater than 1: 80. They also had higher than 1: 64 titers against the heterologous strains whose classifications are B: 15: P1.7.16 and C: 2a: P1.5, respectively.

EXAMPLE 9 Characterization of the target regions of the murine immune response against the NMA0939 protein In order to identify the regions within the protein, which are more recognized by the murine antisera generated against the recombinant antigen, an SPOTScan type assay was carried out. A series of overlapping peptides covering the sequence of the protein were synthesized on a cellulose support and the membrane was incubated with a mixture of sera diluted 1: 100. The antigen-antibody reaction was detected by incubation with a murine anti-IgG-alkaline phosphatase conjugate, followed by the addition of a solution containing the Bromo-Chloro-Indolyl-Phosphate substrate. Several common antigenic regions present in the protein were observed, regardless of the preparation that was used in the immunization (data not shown). However, it was observed that in groups immunized with protein adjuvanted with Freund's Adjuvant, a much broader recognition pattern was obtained.

EXAMPLE 10 Recognition of the NMA0939 protein by human sera A battery of human sera from convalescent individuals was used in this study, which was performed in an ELISA-type assay. The plates were coated with the protein NMA0939 obtained by preparative electrophoresis (5 μg / ml). After blocking the plates with 3% skimmed milk powder in PBS with Tween-20, the sera were diluted (1: 50) in the same solution and incubated on the plates. The immunoassay continued as has been widely reported. As a negative control, sera from healthy donors were used. A mixture of sera vaccinated with recombinant vaccine against Hepatitis B (data not shown) was also used as an unrelated control. Figure 11 shows the results obtained with 5 convalescent sera in this test. As shown, the convalescent sera recognized the protein indicating that it is expressed during meningococcal infection and that it is immunogenic.

EXAMPLE 11 Protein NMA0939 as a carrier of a peptide To demonstrate the carrying capacity of the recombinant protein NMA0939, a synthetic peptide of 15 aminoacid residues, derived from the V3 region of the HIV-1 gp120 protein, JY1 isolate, was conjugated thereto. The conjugation was performed by the glutaraldehyde method. The free JY1 peptide, the recombinant protein NMA0939 and the conjugate JY1-NMA0939, was administered to adult mice in a 3-dose scheme, where the immunogens were emulsified with Freund's Adjuvant. Two weeks after the third dose, serum samples were obtained from the immunized animals, which were analyzed by ELISA to determine the levels of anti-peptide antibodies. For this the plates were coated with the free peptide (20μg / ml) and the immunoassay continued as previously described. The results of the experiment (Figure 12) show the carrier capacity of the protein NMA0939, capable of significantly enhancing the antibody response against the JY1 peptide, after its conjugation to it.

EXAMPLE 12 Evaluation of the immune response induced by the NMA0939 protein, mucosally To evaluate the immunogenicity of the NMA0939 protein mucosally, an immunization scheme was designed in mice, in which the protein encapsulated in liposomes or mixed with polysaccharide C of N. meningitidis was adiministered. The liposomes were obtained by the dehydration-rehydration method as previously described (Carménate T, et al (2001).) Recombinant Opc protein from Neisseria meningitidis reconstituted into liposomes elicits opsonic antibodies following immunization Biotechnol Appl. Biochem. 63-69). Balb / c female mice, 8 to 10 weeks of age, were immunized with both preparations, which received 3 doses of 50 μg of the protein intratranasally, separated by an interval of 15 days. To perform an analysis of the response at the mucosal level, IgA antibodies were detected in samples of lung washes of the immunized mice. Figure 13 shows the levels of IgA antibodies detected in the two groups analyzed.

Claims (12)

NOVELTY OF THE INVENTION CLAIMS

1. - A pharmaceutical composition for the prevention or treatment of infections caused by a bacterium of the genus Neisseria characterized in that it comprises the protein NMA0939, identified as SEQ ID NO 4.

2. The pharmaceutical composition according to claim 1, further characterized by the bacterium of the genus Neisseria is Neisseria meningitidis or Neisseria gonorrhoeae.

3. The pharmaceutical composition according to claim 1, further characterized in that it also contains one or more antigens of different nature, obtained by recombinant, synthetic or natural.

4. The pharmaceutical composition according to claim 3, further characterized in that it contains polysaccharide antigens, including bacterial polysaccharides.

5. The pharmaceutical composition according to claim 4, further characterized in that it contains capsular polysaccharides of Neisseria meningiiidis.

6. The pharmaceutical composition according to claim 3, further characterized in that it contains protein-polysaccharide conjugates, in which polysaccharide component is a bacterial polysaccharide.

7. The pharmaceutical composition according to claim 3, further characterized in that it contains peptide antigens.

8. The pharmaceutical composition according to claim 1, further characterized in that it is administered parenterally or mucosally.

9. The pharmaceutical composition according to claim 8, further characterized in that the protein NMA0939 is an adjuvant or a carrier for antigens of various kinds.

10. The pharmaceutical composition according to claim 1, characterized in that it contains peptide fragments or mimetic peptides of the NMA0939 protein antigen. 11.- Diagnostic tool in which the NMA0939 protein identified as SEQ ID NO 4, is used in the detection of meningococcal disease in humans, independently or in conjunction with other components. 12. Diagnostic tool in which the coding gene NMA0939, identified as SEQ ID NO 3, is used in the detection of meningococcal disease in humans, independently or in conjunction with other components.