RU2229517C1 - RECOMBINANT PLASMID DNA pZIFN2α ENCODING SYNTHESIS OF HUMAN ALPHA-2b-INTERFERON AND STRAIN ESCHERICHIA COLI AS PRODUCER OF HUMAN ALPHA-2b-INTERFERON - Google Patents

Abstract

FIELD: biotechnology, molecular biology, protein engineering. SUBSTANCE: invention relates to technology for preparing recombinant proteins and can be used for preparing human recombinant alpha-2b-interferon. Recombinant plasmid DNA pZIFN2α encoding synthesis of human alpha-2b-interferon with the size 3337 base pairs comprises DNA fragment Nde I-Not I with the size 525 base pairs involving nucleotide sequence encoding human alpha-2b-interferon, DNA fragment Not I-Nde I of plasmid pLEX with the size 2812 base pairs. The strain of bacterium Escherichia coli ZIFN2α is a producer of human recombinant alpha-2b-interferon is prepared by transformation of microorganisms Escherichia coli with plasmid pZIFN2α. Invention provides preparing highly productive strain of Escherichia coli ZIFN2α that can be used for industrial synthesis of human alpha-2b-interferon. EFFECT: valuable properties of strain. 3 cl, 3 dwg, 1 tbl, 3 ex

Description

The invention relates to biotechnology, and in particular to a technology for producing recombinant proteins.

Therapeutically significant proteins derived from recombinant DNA technology have been widely used in recent years to treat a wide range of diseases. The most common drugs of this class include, in particular, human alpha interferons.

Known methods for producing human leukocyte interferon from human blood leukocytes with viral induction (ed. St. USSR No. 297296, 1970, class C 12 N 15/00; No. 1366064, 1983; Pat. RF No. 1364343, 1984; No. 1709615, 1990 ; No. 1713591, 1986; No. 2066188, 1993, class C 12 N 15/00).

The main disadvantages of this approach are the complexity and high cost of scaling, the high probability of contamination of the final product by human viruses and the low yield of the final product. Recombinant DNA technology eliminates these limitations. It is important to note that proteins for which post-translational changes (e.g. glycosylation) are not significant can be obtained in prokaryotic systems.

So, it is known that Pseudomonas is used as a recipient to obtain human alpha interferons. Putida (Pat. RF No. 1616143, 1995, class C 12 N 15/21).

The main disadvantage of this recipient is the low productivity and inability to form inclusion bodies. The consequence of this is the complexity and multi-stage process of the selection of the product, as well as its low yield.

On the other hand, widely used producer strains based on E. Coli (US Pat. RF No. 21118366, 1998, C 12 N 15/21, No. 1312962, 1994, C 12 N 15/19, No. 1312961, 1994, C 12 N 15/19) are characterized by insufficiently high (100-300 μg / ml) level of expression of interferon and lack of stability.

The closest (prototype) in the aggregate of essential features to the claimed producer is US Pat. RF №2165455, 2001, class C 12 N 15/21, according to which the recombinant plasmid pSS5 encoding the synthesis of recombinant alpha-2b-interferon under the tryptophan promoter contains the kanamycin resistance gene. According to the prototype, a relatively high (up to 800 μg / ml) expression level is achieved at an optical density of the bacterial culture of 15-16 OE, i.e. approximately 30 μg of the target product per 1 mg of cell mass. One of the significant disadvantages of this strain is, in fact, constitutive synthesis of interferon throughout the entire cultivation process. Indeed, although the gene that controls the synthesis of interferon is under the control of the tryptophan promoter, tryptophan is absent in the culture medium (casein acid hydrolyzate) and the synthesis begins immediately after the inoculum is introduced. This circumstance can lead to an increased level of proteolysis of the final product. Another disadvantage is the low structural stability, which is evident from the need for the entire cultivation process under selective pressure of high concentrations of kanamycin. On the one hand, with the further isolation of the finished product, it will inevitably require control over the residual antibiotic, and on the other hand, constant breeding with the strain is required to maintain the producer’s working capacity. And finally, a high level of expression per unit volume of cultivation at such high optical densities of the culture means a low proportion of the target product in the cellular biomass, and this determines technological effectiveness and, ultimately, the economy of the process as a whole.

The technical problem solved in the present method for producing a recombinant producer strain of alpha-interferon is to create a highly productive stable strain suitable for industrial cultivation.

The problem is solved by creating recombinant plasmid DNA pZIFN2α and strain Escherichia coli ZIFN2α.

Plasmid pZIFN2α (see Fig. 1) has 3337 base pairs (bp) and is characterized by the presence of the following fragments:

NdeI-NotI - a 525 bp DNA fragment comprising the sequence of the semisynthetic human alpha-2b interferon gene;

NotI-NdeI is a 2812 bp pLEX plasmid DNA fragment (P _L Expression Sistems, Cat. No. K450-01, Invitrogen, USA).

Figure 2 (the nucleotide sequence of plasmid pZIFN2α, as well as the amino acid sequence of the recombinant human alpha-2b-interferon protein, aligned with its gene) presents the nucleotide sequence of plasmid pZIFN2α.

The strain Escherichia coli ZIFN2α was obtained by transformation of Escherichia coli GI724 cells with plasmid pZIFN2α using traditional genetic engineering technology.

Strain E. coli ZIFN2α is characterized by the following features:

Cultural and morphological properties:

Gram-negative straight sticks with rounded edges, size 1.1-1.5 × 2.0-3.0 microns, single, spores and capsules do not form.

Cells grow well on simple nutrient media. On an agar medium, the colonies are smooth, round, slightly convex, and the edge is even. In liquid media form a uniform light-scattering suspension.

Cells grow in the temperature range from 8 to 43 ° C, the interval for cultivation is 28-38 ° C, the optimum growth at 37 ° C. The pH range is 5-7.

Catabolize D-glucose and other carbohydrates with the formation of acid and gas, do not ferment lactose.

They do not form H ₂ S, but hydrolyze urea.

Aerobe. The temperature range of growth is 5-40 ° C at optimum pH 6.5-7.5.

Method, conditions for the propagation of the strain:

Cultivation at a temperature of 28-30 ° C for 6-8 hours in a thermostat or on a rocking chair in M9 medium (see: Maniatis T. et al., 1984) containing 2% casein acid hydrolyzate, 1% glucose, 0.5 % yeast extract, 100 μg / ml ampicillin.

Method, storage conditions:

It is stored in a suspension of a 6-8-hour culture with 15% glycerol at minus 70 ° С (± 10 ° С); the shelf life of the strain is 2 years; strain renewal frequency -1 time in 6 months.

Genetic features:

The strain Escherichia coli ZIFN2α is defective in β-galactosidase, contains a cI repressor under the control of the tryptophan promoter (genotype F ^- , λ ^- , laqI ^q , lacPL8, ampC :: P _trp cI, mcrA, mcrB, INV (rnnD-rnnE) and carries pZIFN2α.

Plasmid pZIFN2α contains the Ori ColE1 sequence necessary for replication, the B1a gene controlling ampicillin resistance, and the human interferon 2α gene under the control of the P _L promoter from bacteriophage λ. The size of the plasmid is 3337 bp

Example 1. Obtaining a recombinant plasmid.

The technology for plasmid pZIFN2α includes the following steps:

- obtaining a semi-synthetic alpha interferon gene;

- the construction of a recombinant plasmid pZIFN2α.

Obtaining a semi-synthetic alpha-interferon gene:

For cloning the alpha interferon gene, the direct polymerase chain reaction (PCR) method was used to amplify a DNA fragment from human total genomic placental DNA containing the gene encoding alpha interferon. Two primers were used for amplification: 1 and 2, the nucleotide sequence of which was based on the known primary structure of the human alpha-2b interferon gene (ACCESSION J00207, GenBank NCBI).

1 - 5 'CTCATATGTGTGATCTGCCTCAAACCCAC - 3'

2 - 5 'GTAAGCTTATCATTCCTTACTTCTTAAACT - 3'

This and subsequent PCR reactions were carried out under the following conditions:

10 mM Tris-Hcl pH 8.3, 50 mM KCl, 200 μM each of dNTPs, 200 nM of each of the primers, 100 ng of template DNA and 2.5 units. Taq polymerase.

The amplification process consisted of the following stages: 2 cycles (95 ° С 1 min, 55 ° С 1 min, 72 ° С 1 min) and 35 cycles (95 ° С 10 s, 58 ° С 15 s, 72 ° С 40 s) and incubation at 72 ° C for 2 minutes The resulting 515 bp DNA fragment cloned into the pGEM-T Easy vector (Promega, USA) according to the kit protocol. The structure of the cloned fragment was confirmed by nucleotide sequence determination. As a result, a 3530 bp plasmid pGIFN2α was obtained, in which the DNA of the alpha-2b interferon gene is flanked by the NdeI and NotI restriction sites.

Mutagenesis of the alpha-interferon gene consisted in replacing rare triplets in E. coli encoding the corresponding amino acids by frequently occurring triplets in E. coli encoding the same amino acids. Mutagenesis is carried out by PCR. For DNA amplification, primers 3 and 2 were used:

3 - 5 'CTCATATGTGTGATCTGCCTCAAACCCACAGCCTGGGTAGCC

GTCGTACCTTGATGCTCCTGGCACAGATGCGTCGTATCTCTC - 3 '

2 - 5 'GTAAGCTTATCATTCCTTACTTCTTAAACT - 3'

In the PCR reaction, the DNA of plasmid pGIFN2α was used as a template. The reaction was carried out under the same conditions, but using 2.5 units. LR polymerase. The resulting 515 bp fragment. (Fig. 3 is the sequence of the recombinant human alpha-2b-interferon gene shown in Fig. 2 with flanking restriction sites NdeI and NotI, the initiation (ATG) and terminating (TGA) codons are underlined) were cloned into the pGEM-T Easy vector (Promega, USA) in accordance with the recruitment protocol. The structure of the cloned fragment was confirmed by nucleotide sequence determination. As a result, a plasmid pGZIFN2α of 3530 bp was obtained, in which the DNA of the alpha interferon gene is flanked by the NdeI and NotI restriction sites.

Construction of the recombinant plasmid pZIFN2α:

To obtain the recombinant plasmid pZIFN2α, the plasmid pGZIFN2α was treated with NdeI - NotI restriction enzymes and a 525 bp DNA fragment containing the sequence of the modified alpha interferon gene was cloned into the pLEX plasmid vector (P _L Expression Sistems, Cat. No. K450-01, Invitrogen , USA) treated with the same restriction enzymes. The ligated DNA was transformed with E. coli strain DH10B / R, the cells were plated on LB medium containing 100 μg / ml ampicillin and incubated for 12 hours at 37 ° C. Ampicillin-resistant clones were seeded, plasmid DNA was isolated from them, restriction analysis was performed, and the nucleotide sequence was determined.

As a result, a recombinant plasmid pZIFN2α encoding the synthesis of recombinant human alpha-2-interferon, 3337 bp in size, the circular scheme of which is shown in FIG. 1 (circular scheme of plasmid pZIFN2α).

Example 2. Obtaining a strain of E. coli ZIFN2α - producer of interferon.

The E. coli alpha interferon producing strain ZIFN2α was obtained by transforming E. coli GI724 cells (F ^- , λ ^- , laqI ^q , lacPL8, ampC :: P _trp cI, mcrA, mcrB, INV (rnnD-rnnE) with the recombinant plasmid pZIFN2α followed by selection of recombinant clones in a medium with ampicillin at 30 ° C and quantitative determination of alpha-interferon in cell extracts by enzyme-linked immunosorbent assay (ProCon IF2 test system, Protein circuit LLC, Russia) grown to an optical density of 0.5- 0.7 pu in M9 medium containing 20% casein acid hydrolyzate (Difco, USA), 1% glucose, 100 μg / ml ampicillin at a temperature of 30 ° C. Alpha interferon synthesis was induced by adding tryptophan to a concentration of 100 μg / ml and raising the temperature to 37 ° C. Cultivation was continued until the optical density of the culture medium was 10-12 pu, after which the biomass was separated by centrifugation and subjected to analysis .

Isolated and analyzed 5 random clones showed production levels of 400, 750, 110, 540 and 255 μg of interferon per 1 ml of culture fluid. The most productive clone has been reclone. The resulting subclones were characterized by a stable production level in the range of 700-800 μg / ml and were used to create a cell bank and deposit.

Example 3. Large-scale cultivation of E. coli strain ZIFN2α

Cultivation was carried out in a 10-liter laboratory fermenter in an 8-liter volume of M9 growth medium supplemented with 20% casein acid hydrolyzate (Difco, USA), 1% glucose, and 100 μg / ml ampicillin at a temperature of 30 ° С. The inoculum for inoculation of the fermenter was a nocturnal culture grown on a rocking chair in the same medium. Fermentation was carried out for 9 hours under conditions standard for the cultivation of similar strains of E. Coli. Throughout the cultivation, samples were taken to control the optical density at λ = 460 nm, the level of production of alpha-interferon, the content of ampicillin, the number of viable cells and cells containing the plasmid. The data are given in the table.

As a result of cultivation, 77.7 g of biomass containing 4.4 g of human alpha-2b-interferon was collected. The strain productivity was 56.6 μg / mg biomass. It can be seen from the table that despite the absence of ampicillin completely destroyed by beta-lactamase accumulated in the inoculum in the nutrient medium, there is no noticeable plasmid loss during cultivation, i.e. the strain is quite stable even in the absence of selective pressure.

Claims (2)

1. Recombinant plasmid DNA pZIFN2α encoding the synthesis of human alpha-2b-interferon, 3337 bp, containing an NdeI-NotI DNA fragment of 525 bp, including the nucleotide sequence encoding human alpha-2b-interferon, NotI- NdeI pLEX plasmid DNA fragment 2812 bp in size and having the nucleotide sequence shown in Fig. 2. 2. The bacterial strain Escherichia coli ZIFN2α - transformed with recombinant plasmid DNA according to claim 1 - producer of recombinant human alpha-2b-interferon.

Images