RU2162102C1 - Recombinant plasmid encoding fused protein with human proinsulin (variants) - Google Patents
Recombinant plasmid encoding fused protein with human proinsulin (variants) Download PDFInfo
- Publication number
- RU2162102C1 RU2162102C1 RU99118955/13A RU99118955A RU2162102C1 RU 2162102 C1 RU2162102 C1 RU 2162102C1 RU 99118955/13 A RU99118955/13 A RU 99118955/13A RU 99118955 A RU99118955 A RU 99118955A RU 2162102 C1 RU2162102 C1 RU 2162102C1
- Authority
- RU
- Russia
- Prior art keywords
- gene
- site
- fragment
- human proinsulin
- sites
- Prior art date
Links
Images
Abstract
Description
Изобретение относится к генной инженерии и биотехнологии и может быть использовано для создания лекарственных препаратов человеческого инсулина. The invention relates to genetic engineering and biotechnology and can be used to create drugs for human insulin.
Инсулин синтезируется клетками островков Лангерганса поджелудочной железы в виде предшественника - препроинсулина, состоящего из 110 аминокислотных остатков (а. о.) с молекулярной массой 11981 Да. Первые 24 а. о. сигнального пептида отщепляются в процессе секреции с образованием проинсулина. В дальнейшем проинсулин подвергается ограниченному протеолизу с выщеплением C-пептида (35 а. о.), приводящему к образованию "зрелого" инсулина, состоящему из двух цепей, соединенных двумя дисульфидными связями. Цепь A состоит из 21, а цепь B - из 30 а. о. Аминокислотная последовательность препроинсулина с обозначением его цепей приведена ниже:
MALWMRLLPL LALLALWGPD PAAA FVNQHL CGSHLVEALY LVCGERGFFY TPKTRREAED LQVGQVELGG GPGAGSLQPL ALEGSLQKRG IVEQCCTSIC SLVQLENVCN (Сигнальный пептид: 1 - 24 а. о., B - цепь: 25-54 а. о., C-пептид: 57-87 а. о., A-цепь: 90-110 а. о. Дисульфидные связи: межцепочечные 31-96 и 43-109, внутрицепочечная 95-100 а. о.Insulin is synthesized by the cells of the islets of Langerhans of the pancreas in the form of a precursor - preproinsulin, consisting of 110 amino acid residues (aa) with a molecular weight of 11981 Da. The first 24 a. about. The signal peptide is cleaved during secretion to form proinsulin. Subsequently, proinsulin undergoes limited proteolysis with the cleavage of the C-peptide (35 aa), leading to the formation of "mature" insulin, consisting of two chains connected by two disulfide bonds. Chain A consists of 21, and chain B consists of 30 A. about. The amino acid sequence of preproinsulin with the designation of its chains is given below:
MALWMRLLPL LALLALWGPD PAAA FVNQHL CGSHLVEALY LVCGERGFFY TPKTRREAED LQVGQVELGG GPGAGSLQPL ALEGSLQKRG IVEQCCTSIC SLVQLENVCN (Signal peptide: 1 - 24 a. O.,. chain: 90-110 a.a. disulfide bonds: interchain 31-96 and 43-109, intrachain 95-100 a.o.
Современным способом получения инсулина человека является технология с использованием рекомбинантных ДНК. A modern method of producing human insulin is a technology using recombinant DNA.
Наиболее близким аналогом изобретения является рекомбинантная плазмида pInsR, кодирующая гибридный белок, содержащий проинсулин человека. [Патент RU 2115729]. Эта плазмида сконструирована на основе плазмиды pKK223-3 (фирмы Pharmacia Biotech), имеющей ген β-лактамазы (ампициллинрезистентности) и tac-промотор. После добавления в вреду культивирования индуктора изопропил-β-D-тиогалактопиранозида (ИПТГ) tac-промотор запускает синтез гибридного белка с гена, встроенного между сайтами EcoRI и HindIII. Гибридный белок, кодируемый плазмидой pInsR, состоит из аминокислотной последовательности иммуноглобулинсвязывающего домена белка A Staphylococcus aureus, соединенного через аминокислотный линкер Гли-Сер-Арг с аминокислотной последовательностью проинсулина человека. The closest analogue of the invention is the recombinant plasmid pInsR encoding a fusion protein containing human proinsulin. [Patent RU 2115729]. This plasmid was constructed on the basis of plasmid pKK223-3 (Pharmacia Biotech), which has the β-lactamase gene (ampicillin resistance) and the tac promoter. After adding the isopropyl-β-D-thiogalactopyranoside (IPTG) inducer to the detriment of culturing, the tac promoter starts the synthesis of the fusion protein from the gene inserted between the EcoRI and HindIII sites. The hybrid protein encoded by the plasmid pInsR consists of the amino acid sequence of the immunoglobulin binding domain of Staphylococcus aureus protein A, linked via the Gly-Ser-Arg amino acid linker to the amino acid sequence of human proinsulin.
Недостатком такой системы экспрессии является необходимость использования индуктора ИПТГ, что усложняет технологию и удорожает себестоимость этапа культивирования. Кроме этого, наличие tac-промотора на векторе требует использования специальных штаммов E. coli, имеющих lacIq мутацию и сверхэкспрессирующих lac-репрессор. Такие штаммы типа JM101, JM109 или XLI-Blue не вполне соответствуют требованиям, предъявляемым к штаммам-продуцентам, в частности по стабильности синтезируемых рекомбинантных белков. Более продуктивные штаммы Escherichia coli, например: BL21, не имеют lacIq мутацию, но имеют lon- и ompT-мутации по генам протеаз, что позволяет получать непротеолизированные рекомбинантные белки в больших количествах.The disadvantage of such an expression system is the need to use an IPTG inducer, which complicates the technology and increases the cost of the cultivation stage. In addition, the presence of a tac promoter on a vector requires the use of special strains of E. coli that have a lacI q mutation and overexpress lac repressor. Such strains of the JM101, JM109 or XLI-Blue type do not fully meet the requirements for producer strains, in particular, on the stability of the synthesized recombinant proteins. More productive strains of Escherichia coli, for example: BL21, do not have a lacI q mutation, but have lon- and ompT mutations by protease genes, which makes it possible to obtain non-proteolyzed recombinant proteins in large quantities.
Общим недостатком использования в штаммах-продуцентах плазмид, имеющих только маркер ампициллинрезистентности является недостаточная эффективность селекции. Это связано с тем, что фермент β-лактамаза, расщепляющий ампициллин, является секретируемым белком, то есть через некоторое время культивирования штамма с плазмидой β-лактамаза накапливается в культуральной среде. Это приводит к инактивации как имевшегося в среде, так и добавляемого вновь ампициллина. В результате в ферментере накапливаются клетки штамма, утратившие плазмиду и неспособные синтезировать рекомбинантный белок. A common drawback of using plasmids in producer strains having only an ampicillin resistance marker is the lack of selection efficiency. This is due to the fact that the β-lactamase enzyme that breaks down ampicillin is a secreted protein, that is, after some time of culturing the strain with the plasmid β-lactamase accumulates in the culture medium. This leads to the inactivation of both the medium present and the newly added ampicillin. As a result, strain cells that lose the plasmid and are unable to synthesize the recombinant protein accumulate in the fermenter.
Сущность изобретения заключается в создании рекомбинантных плазмид, содержащих ген для синтеза в клетках Е. coli гибридного белка, составной частью которого является проинсулин человека. Эти рекомбинантные плазмиды отличаются от известных аналогичных плазмид рядом признаков:
1) наличием промоторов, обеспечивающих высокую конститутивную экспрессию гена гибридного белка. Это при прочих равных условиях позволяет избежать добавления в среду культивирования индуктора (в аналоге добавление ИПТГ) синтеза гибридного белка, что упрощает технологию и снижает себестоимость;
2) ген гибридного белка, составной частью которого является проинсулин человека, отличается от известных аналогичных тем, что предшествующая проинсулину человека нуклеотидная последовательность кодирует N-концевой фрагмент фактора некроза опухолей α человека и фрагмент Гли-Глн-Гли-Сер- Гли-Арг. N-концевой фрагмент фактора некроза опухолей α человека стабилизирует гибридный белок и увеличивает его накопление в клетках E. coli в процессе биосинтеза. Фрагмент Гли-Глн-Гли-Гли- Сер-Арг выполняет функцию "шарнирного" мостика, делая гибридный белок двухдоменным: домен фактора некроза опухолей α и домен проинсулина, что позволяет домену проинсулина формировать правильную конформацию, необходимую для биологической активности. Кроме этого, "шарнирный" мостик из глициновых и сериновых аминокислотных остатков делает более доступным аргининовый остаток для ферментативного расщепления гибридного белка трипсиноподобными протеазами. Это увеличивает эффективность технологического этапа превращения проинсулина в "зрелый" инсулин;
3) вариантом гена гибридного белка является дополнительная нуклеотидная последовательность, кодирующая синтез на N-конце гибридного белка (перед последовательностью фрагмента фактора некроза опухолей α) фрагмента, состоящего из семи гистидиновых остатков. (Гис-)7-фрагмент позволит не только проводить очистку гибридного белка методами металлохелатной хроматографии, но удалять примеси фрагмента фактора некроза опухолей α от "зрелого" инсулина после этапа ферментативного расщепления гибридного белка;
4) наличием двух генов устойчивости к антибиотикам ампициллину и аминогликозидам: канамицину, неомицину и G-418. Устойчивость к аминогликозидам обусловливается цитоплазматическим ферментом аминогликозидфосфотрансферазой, который в отличие от β-лактамазы не секретируется в питательную среду при культивировании. Это обеспечивает лучший отбор клеток, сохранивших рекомбинантную плазмиду, и, как следствие, более высокий уровень синтеза гибридного белка и стабильность штамма-продуцента.The invention consists in the creation of recombinant plasmids containing a gene for synthesis in E. coli cells of a hybrid protein, a component of which is human proinsulin. These recombinant plasmids differ from known similar plasmids in a number of ways:
1) the presence of promoters that provide high constitutive expression of the gene of the hybrid protein. This ceteris paribus avoids the addition to the culture medium of the inductor (in analogue, the addition of IPTG) synthesis of a hybrid protein, which simplifies the technology and reduces cost;
2) the hybrid protein gene, of which human proinsulin is an integral part, differs from the known ones in that the nucleotide sequence preceding human proinsulin encodes the N-terminal fragment of human tumor necrosis factor α and the Gly-Gln-Gli-Ser-Gli-Arg fragment. The N-terminal fragment of human tumor necrosis factor α stabilizes the hybrid protein and increases its accumulation in E. coli cells during biosynthesis. The Gly-Gln-Gli-Gli-Ser-Arg fragment serves as a “hinge” bridge, making the hybrid protein two-domain: the domain of tumor necrosis factor α and the proinsulin domain, which allows the proinsulin domain to form the correct conformation necessary for biological activity. In addition, the “hinged” bridge of glycine and serine amino acid residues makes the arginine residue more accessible for enzymatic cleavage of the fusion protein with trypsin-like proteases. This increases the efficiency of the technological stage of conversion of proinsulin into "mature"insulin;
3) a variant of the hybrid protein gene is an additional nucleotide sequence encoding the synthesis at the N-terminus of the hybrid protein (before the sequence of the fragment of tumor necrosis factor α) of a fragment consisting of seven histidine residues. The (Gis-) 7 fragment will allow not only purification of the hybrid protein by metal chelate chromatography, but also removal of impurities of the tumor necrosis factor α fragment from mature insulin after the enzymatic cleavage of the hybrid protein;
4) the presence of two antibiotic resistance genes ampicillin and aminoglycosides: kanamycin, neomycin and G-418. Resistance to aminoglycosides is determined by the cytoplasmic enzyme aminoglycoside phosphotransferase, which, unlike β-lactamase, is not secreted into the culture medium during cultivation. This provides a better selection of cells that have preserved the recombinant plasmid, and, as a result, a higher level of synthesis of the hybrid protein and the stability of the producer strain.
Для создания рекомбинантной плазмиды с промоторами, обеспечивающими высокую конститутивную экспрессию гена гибридного белка (с целью избежать необходимости добавлять индуктор в среду культивирования) и конструирования самого гена гибридного белка была использована плазмида pTNF329 [Шмелев В. А. и др., Молек. Генет. Микроб. Вирусол.- 1995.- N 1.-С. 9-14]. N-концевой фрагмент гена фактора некроза опухолей α человека с предшествующими промоторами A2 и A3 фага T7 и рибосомсвязывающим сайтом был амплифицирован 30 циклами (92oC, 30 сек; 62oC, 45 сек; 72oC, 45 сек) с помощью Tag-полимеразы и праймеров: CAATTGTAGA- CAGCCTGATAAGTCG и GGATCCGCCTTGGCCCTTGAAGAG. Амплифицированный фрагмент размером 0,48 т.п.н. был обработан рестриктазами MunI и BamHI. Фрагмент ДНК, кодирующий проинсулин человека, был амплифицирован 30 циклами (92oC, 30 сек; 65oC, 30 сек; 72oC, 30 сек) с помощью Tag-полимеразы и праймеров: GGATCCCGCTTTGTTAACCAACAC и AAGCTTAGTTGCAATAGTTC. Амплифицированный фрагмент размером 0,27 т.п.н. был обработан рестриктазами HindIII и BamHI. После рестрикции оба амплифицированных фрагмента были смешаны и лигированы с плазмидой pKK223-3, предварительно обработанной рестриктазами EcoRI и HindIII. После трансформации в штамм HB2151 E. coli отобраны рекомбинантные плазмиды, придающие клеткам устойчивость к ампициллину, содержащие вставку фрагмента ДНК размером 0,75 т.п.н. и кодирующие синтез гибридного белка с молекулярной массой 16,8 кДа по данным электрофореза в 15%-ном ПААГ-ДСН.To create a recombinant plasmid with promoters that provide high constitutive expression of the hybrid protein gene (in order to avoid the need to add an inducer to the culture medium) and construct the hybrid protein gene itself, the plasmid pTNF329 was used [Shmelev V.A. et al., Molek. Genet. Microbe. Virusol.- 1995.- N 1.-S. 9-14]. The N-terminal fragment of the human tumor necrosis factor α gene with the previous promoters A2 and A3 of the T7 phage and the ribosome binding site was amplified by 30 cycles (92 ° C, 30 sec; 62 ° C, 45 sec; 72 ° C, 45 sec) using Tag polymerases and primers: CAATTGTAGA- CAGCCTGATAAGTCG and GGATCCGCCTTGGCCCTTGAAGAG. The amplified fragment of 0.48 kbp was treated with restriction enzymes MunI and BamHI. The DNA fragment encoding human proinsulin was amplified for 30 cycles (92 ° C, 30 sec; 65 ° C, 30 sec; 72 ° C, 30 sec) using Tag polymerase and primers: GGATCCCGCTTTTGTTAACCAACAC and AAGCTTAGTTGCAATAGTTC. The amplified fragment of 0.27 kbp was treated with restriction enzymes HindIII and BamHI. After restriction, both amplified fragments were mixed and ligated with plasmid pKK223-3 pretreated with restriction enzymes EcoRI and HindIII. After transformation into E. coli strain HB2151, recombinant plasmids were selected that confer ampicillin resistance to the cells and contain an insert of 0.75 kbp DNA fragment. and encoding the synthesis of a hybrid protein with a molecular weight of 16.8 kDa according to electrophoresis in 15% SDS page-SDS.
Полученная рекомбинантная плазмида pKT-INS характеризуется следующими признаками:
- размер 5,3 т.п.н.,
- содержит вслед за tac-промотором промоторы A2 и A3 фага T7,
- содержит между сайтами рестриктаз ClaI и HindIII ген, кодирующий синтез гибридного белка размером 154 а. о. с молекулярной массой 16,8 кДа, состоящего из N-концевого фрагмента фактора некроза опухолей α, соединенного через пептидный фрагмент Гли-Глн-Гли-Гли-Сер-Арг с аминокислотной последовательностью проинсулина человека,
- имеет характерные сайты рестрикции: EcoRI-сайт, находящийся между промоторами A2 и A3, KpnI-сайт, находящийся между промотором A3 и рибосомсвязывающим сайтом, ClaI-сайт между рибосомсвязывающим сайтом и фрагментом гена фактора некроза опухолей α, BamHI-сайт, находящийся между фрагментами генов фактора некроза опухолей α и проинсулина человека, 2 PstI-сайта в гене проинсулина, HindIII- сайт позади гена проинсулина человека;
- содержит ген гибридного белка с последовательностью N1
Для создания рекомбинантной плазмиды с вариантом гена, кодирующим синтез гибридного белка с семью гистидиновыми остатками на N-конце, плазмидную ДНК pKT-INS обрабатывали рестриктазой ClaI дефосфорилировали и затем лигировали с фосфорилированным олигонуклеотидным дуплексом
CGAATGAGCCACCATCATCACCATCATCA
TTACTCGGTGGTAGTAGTGGTAGTAGTGC.The resulting recombinant plasmid pKT-INS is characterized by the following features:
- size 5.3 kb;
- contains, following the tac promoter, promoters A2 and A3 of the T7 phage,
- contains between the restriction enzyme sites ClaI and HindIII gene encoding the synthesis of a hybrid protein of 154 a. about. with a molecular weight of 16.8 kDa, consisting of the N-terminal fragment of tumor necrosis factor α, connected through the peptide fragment Gli-Gln-Gli-Gli-Ser-Arg with the amino acid sequence of human proinsulin,
- has characteristic restriction sites: the EcoRI site located between the A2 and A3 promoters, the KpnI site located between the A3 promoter and the ribosome binding site, the ClaI site between the ribosome binding site and the fragment of the tumor necrosis factor α gene, the BamHI site located between the fragments tumor necrosis factor α and human proinsulin genes, 2 PstI sites in the proinsulin gene, HindIII site behind the human proinsulin gene;
- contains a gene of a hybrid protein with the sequence N1
To create a recombinant plasmid with a gene variant encoding a fusion protein with seven histidine residues at the N-terminus, pKT-INS plasmid DNA was digested with ClaI restriction enzyme and then ligated with a phosphorylated oligonucleotide duplex
CGAATGAGCCACCATCATCACCATCATCA
TTACTCGGTGGTAGTAGTGGTAGTAGTGC.
После трансформации лигазной смеси в штамм E. coli HB2151 отобраны рекомбинантные клоны, устойчивые к ампициллину и синтезирующие гибридный белок. Плазмидная ДНК из этих клонов была выделена и наличие (Гис-)7-фрагмента было подтверждено отсутствием ClaI-сайта и в ПЦР с праймерами CGAATGAGCCACCATCATCACCATCATCA и CAATTGAAGGGAATAAGGGCGACACG.After transformation of the ligase mixture into E. coli strain HB2151, recombinant ampicillin resistant and synthesizing fusion proteins were selected. Plasmid DNA was isolated from these clones and the presence of a (His) 7 fragment was confirmed by the absence of a ClaI site and in PCR with primers CGAATGAGCCACCATCATCACCATCATCA and CAATTGAAGGGAATAAGGGCGACACG.
Полученная рекомбинантная плазмидная ДНК pKHT-INS, отличается от плазмиды pKT-INS следующими признаками:
- кодирует гибридный белок размером 164 а. о. с молекулярной массой 18,1 кДа, состоящий из N-концевого домена для металлохелатной хроматографии состава (Гис-)7, N-концевого фрагмента фактора некроза опухолей α, соединенного через пептидный фрагмент Гли-Глн-Гли-Гли-Сер-Арг с аминокислотной последовательностью проинсулина человека,
- отсутствует между рибосомсвязывающим сайтом и геном гибридного белка ClaI-сайт, в который интегрирован синтетический фрагмент ДНК, кодирующий (Гис-)7-домен.The resulting recombinant plasmid DNA pKHT-INS differs from plasmid pKT-INS in the following features:
- encodes a hybrid protein of 164 a. about. with a molecular weight of 18.1 kDa, consisting of an N-terminal domain for metal chelate chromatography of the composition of (Gis-) 7 , N-terminal fragment of tumor necrosis factor α, connected through the peptide fragment Gly-Gln-Gli-Gli-Ser-Arg with amino acid human proinsulin sequence
- there is no ClaI site between the ribosome binding site and the gene of the hybrid protein, into which a synthetic DNA fragment encoding the (His) 7 domain is integrated.
- содержит ген гибридного белка с последовательностью N2
Для создания рекомбинантной плазмиды с двумя генами антибиотикорезистентности к ампициллину и канамицину использовали плазмиды pVE10 и pUC4K. Плазмида pVE10 является делеционной производной от pBR322, имеет размер 1,8 тысяч пар нуклеотидов (т.п.н.), уникальные сайты EcoRI, ClaI, PstI и содержит участок начала репликации и ген β-лактамазы [Шмелев В. А. и др., Молек. Генет. Микроб. Вирусол. -1991. -N 10. -С.3-8]. Плазмида pUC4K [GenBank Accession Number X06404] имеет размер около 4 т.п.н. и содержит фрагмент Tn:: 903, фланкированный инвертированными повторами сайтов EcoRI, BamHI, SalI и PstI. В этом фрагменте находится ген аминогликозидфосфотрансферазы, придающий клеткам устойчивость к антибиотикам канамицину, неомицину и G-418. Ген аминогликозидфосфотрансферазы с собственным промотором был амплифицирован 30 циклами (92oC, 30 сек; 60oC, 45 сек; 72oC, 45 сек) с помощью Tag-полимеразы и праймеров: TTCGAACAAAGCCACGTTGTGTCTC и GAATTCCGTCAAGTCAGCGTAATGC. Амплифицированный фрагмент размером 1 т.п.н. был обработан рестриктазами Bsp119I и EcoRI и лигирован с плазмидой pVE10, предварительно обработанной рестриктазами ClaI и EcoRI. После трансформации в штамм E. coli HB2151 отобраны рекомбинантные плазмиды, придающие клеткам устойчивость к ампициллину и канамицину. Полученная плазмида pAK1 имеет размер 2,8 т.п.н., ген β-лактамазы с уникальным сайтом PstI, ген аминогликозидфосфотрансферазы с уникальными сайтами XhoI, ClaI, SmaI, HindIII и уникальный сайт вне генов EcoRI.- contains a hybrid protein gene with the sequence N2
To create a recombinant plasmid with two antibiotic resistance genes for ampicillin and kanamycin, plasmids pVE10 and pUC4K were used. The plasmid pVE10 is a deletion derivative of pBR322, has a size of 1.8 thousand nucleotide pairs (kb), unique EcoRI, ClaI, PstI sites and contains a replication origin and a β-lactamase gene [Shmelev V.A. et al. ., Molek. Genet. Microbe. Virusol. -1991. -N 10.-C.3-8]. Plasmid pUC4K [GenBank Accession Number X06404] has a size of about 4 kb. and contains the Tn :: 903 fragment flanked by inverted repeats of EcoRI, BamHI, SalI, and PstI sites. This fragment contains the aminoglycoside phosphotransferase gene, which gives the cells antibiotic resistance to kanamycin, neomycin and G-418. The aminoglycoside phosphotransferase gene with its own promoter was amplified for 30 cycles (92 ° C, 30 sec; 60 ° C, 45 sec; 72 ° C, 45 sec) using Tag polymerase and primers: TTCGAACAAAGCCACGTTGTGTCTC and GAATTCCGTCAAGTCAGCGTAATGC. The amplified fragment is 1 kb in size. was digested with restriction enzymes Bsp119I and EcoRI and ligated with plasmid pVE10 pretreated with restriction enzymes ClaI and EcoRI. After transformation into E. coli strain HB2151, recombinant plasmids were selected that confer resistance to ampicillin and kanamycin on the cells. The resulting plasmid pAK1 has a size of 2.8 kb, a β-lactamase gene with a unique PstI site, an aminoglycoside phosphotransferase gene with unique XhoI, ClaI, SmaI, HindIII sites and a unique site outside the EcoRI genes.
Для переклонирования в эту плазмиду системы экспрессии с геном гибридного белка из плазмиды pKT-INS фрагмент ДНК был амплифицирован 30 циклами (92oC, 30 сек; 62oC, 45 сек; 72oC, 45 сек) с помощью Tag-полимеразы и праймеров: CAATTGTAGACAGCCTGATAAGTCG и CAATTGAAGGGAATAAGGGCGACACG. Амплифицированный фрагмент размером 1,3 т.п.н. был обработан рестриктазой MunI и лигирован с плазмидой pAK1, предварительно обработанной рестриктазой EcoRI и дефосфорилированной. После трансформации в штамм E. coli HB2151 отобраны клоны рекомбинантной ДНК, придающей клеткам устойчивость к ампициллину и канамицину и содержащей не вырезающуюся вставку в EcoRI-сайт.To clone the expression system with the hybrid protein gene from the pKT-INS plasmid into this plasmid, the DNA fragment was amplified by 30 cycles (92 ° C, 30 sec; 62 ° C, 45 sec; 72 ° C, 45 sec) using Tag polymerase and primers: CAATTGTAGACAGCCTGATAAGTCG and CAATTGAAGGGAATAAGGGCGACACG. The amplified fragment of 1.3 kbp was digested with MunI restriction enzyme and ligated with plasmid pAK1, pretreated with EcoRI restriction enzyme and dephosphorylated. After transformation into E. coli strain HB2151, clones of recombinant DNA were selected that confer resistance to ampicillin and kanamycin on the cells and contain a non-cutting insert at the EcoRI site.
Полученная плазмида pVT-INS характеризуется следующими признаками:
- размер 4,12 т.п.н.;
- придает клеткам устойчивость к антибиотикам ампициллину, канамицину, неомицину и G-418;
- содержит промоторы A2 и A3 фага T7, обеспечивающие конститутивную экспрессию гена гибридного белка;
- содержит между сайтами рестриктаз ClaI и HindIII ген, кодирующий гибридный белок размером 154 а. о. с молекулярной массой 16,8 кДа, состоящий из N-концевого фрагмента фактора некроза опухолей, соединенного через пептидный фрагмент Гли-Глн-Гли-Гли-Сер-Арг с аминокислотной последовательностью проинсулина человека;
- имеет характерные сайты рестрикции:
3PstI-сайта, из которых 1 находится в гене β-лактамазы и 2 - в гене проинсулина;
2ClaI-сайта, из которых 1 находится в гене аминогликозидфосфотрансферазы и 1 - между рибосомсвязывающим сайтом и фрагментом гена фактора некроза опухолей α;
2HindIII-сайта, из которых 1 находится в гене аминогликозидфосфотрансферазы и 1 - позади гена проинсулина человека;
уникальные сайты - XhoI и SmaI, находящиеся в гене аминогликозидфосфотрансферазы,
EcoRI, находящийся между промоторами A2 и A3,
KpnI, находящийся между промотором A3 и рибосомсвязывающим сайтом, BamHI, находящийся между фрагментами генов фактора некроза опухолей α и проинсулина человека;
- содержит ген гибридного белка с последовательностью N1
Для создания рекомбинантной плазмиды с маркерами селекции по ампициллину и канамицину и вариантом гена, кодирующим синтез гибридного белка с семью гистидиновыми остатками на N-конце, плазмидную ДНК pKHT-INS использовали в ПЦР с Tag-полимеразой и праймерами: CAATTGTAGACAGCCTGATAAGTCG и CAATTGAAGGGAATAAGGGCGACACG. Амплифицированный фрагмент размером около 1,3 т.п.н. был обработан рестриктазой MunI и лигирован с плазмидой pAK1, предварительно обработанной рестриктазой EcoRI и дефосфорилированной. После трансформации в штамм E. coli HB2151 отобраны клоны рекомбинантной ДНК, придающей клеткам устойчивость к ампициллину и канамицину и содержащей не вырезающуюся вставку в EcoRI-сайт.The resulting plasmid pVT-INS is characterized by the following features:
- size 4.12 kb;
- gives the cells antibiotic resistance to ampicillin, kanamycin, neomycin and G-418;
- contains promoters A2 and A3 of the T7 phage, providing constitutive expression of the gene of the hybrid protein;
- contains between the restriction enzyme sites ClaI and HindIII a gene encoding a fusion protein of 154 a. about. with a molecular weight of 16.8 kDa, consisting of an N-terminal fragment of tumor necrosis factor connected through a peptide fragment of Gly-Gln-Gli-Gli-Ser-Arg with the amino acid sequence of human proinsulin;
- has characteristic restriction sites:
3PstI site, of which 1 is in the β-lactamase gene and 2 is in the proinsulin gene;
2ClaI site, of which 1 is in the aminoglycoside phosphotransferase gene and 1 is between the ribosome binding site and the fragment of the tumor necrosis factor α gene;
2HindIII site, of which 1 is in the aminoglycoside phosphotransferase gene and 1 is behind the human proinsulin gene;
unique sites - XhoI and SmaI, located in the aminoglycoside phosphotransferase gene,
EcoRI, located between promoters A2 and A3,
KpnI, located between the A3 promoter and the ribosome binding site, BamHI, located between the fragments of the tumor necrosis factor α and human proinsulin genes;
- contains a gene of a hybrid protein with the sequence N1
To create a recombinant plasmid with ampicillin and kanamycin selection markers and a gene variant encoding a fusion protein with seven histidine residues at the N-terminus, pKHT-INS plasmid DNA was used in PCR with Tag polymerase and primers: CAATTGTAGACAGCCTGATAGTCGTCGTC. An amplified fragment of about 1.3 kbp was digested with MunI restriction enzyme and ligated with plasmid pAK1, pretreated with EcoRI restriction enzyme and dephosphorylated. After transformation into E. coli strain HB2151, clones of recombinant DNA were selected that confer resistance to ampicillin and kanamycin on the cells and contain a non-cutting insert at the EcoRI site.
Полученная плазмида pVHT-INS отличается от pVT-INS следующими признаками:
- размер 4,15 т.п.н.;
- содержит между сайтами рестриктаз KpnI и HindIII участок связывания рибосом и ген, кодирующий гибридный белок размером 164 а. о. с молекулярной массой 18,1 кДа, состоящий из (Гис-)7-фрагмента, N-концевого фрагмента фактора некроза опухолей, соединенного через пептидный фрагмент Гли-Глн-Гли-Гли-Сер-Арг с аминокислотной последовательностью проинсулина человека;
- отсутствует ClaI-сайт между рибосомсвязывающим сайтом и геном гибридного белка;
- содержит ген гибридного белка с последовательностью N2.The resulting plasmid pVHT-INS differs from pVT-INS in the following features:
- size 4.15 kb;
- contains between the restriction enzyme sites KpnI and HindIII a ribosome binding site and a gene encoding a 164 a fusion protein. about. with a molecular weight of 18.1 kDa, consisting of a (Gis-) 7 fragment, an N-terminal fragment of tumor necrosis factor connected through a peptide fragment of Gly-Gln-Gli-Gli-Ser-Arg with the amino acid sequence of human proinsulin;
- there is no ClaI site between the ribosome binding site and the gene of the hybrid protein;
- contains the gene of the hybrid protein with the sequence N2.
Полученные плазмиды pKT-INS, pKHT-INS, pVT-INS или pVHT-INS после трансформации в компетентные клетки штаммов E. coli обеспечивают высокий уровень биосинтеза гибридного белка, определяемый электрофорезом в 15%-ном ПААГ-ДСН. Трансформируемым штаммом может быть любой штамм E. coli, соответствующий требованиям к штаммам-продуцентам. Например: штаммы SG20050, имеющий lon-мутацию, или BL21, имеющий lon- и ompT-мутации по генам протеаз, и позволяющие получать непротеолизированные рекомбинантные белки в больших количествах. The obtained plasmids pKT-INS, pKHT-INS, pVT-INS or pVHT-INS after transformation into competent cells of E. coli strains provide a high level of biosynthesis of the hybrid protein, determined by electrophoresis in 15% SDS page-SDS. Transformable strain can be any E. coli strain that meets the requirements for producer strains. For example: SG20050 strains having a lon mutation, or BL21 having lon and ompT mutations in protease genes, and allowing large quantities of non-proteolyzed recombinant proteins to be obtained.
Claims (4)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU99118955/13A RU2162102C1 (en) | 1999-09-08 | 1999-09-08 | Recombinant plasmid encoding fused protein with human proinsulin (variants) |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU99118955/13A RU2162102C1 (en) | 1999-09-08 | 1999-09-08 | Recombinant plasmid encoding fused protein with human proinsulin (variants) |
Publications (1)
Publication Number | Publication Date |
---|---|
RU2162102C1 true RU2162102C1 (en) | 2001-01-20 |
Family
ID=20224571
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
RU99118955/13A RU2162102C1 (en) | 1999-09-08 | 1999-09-08 | Recombinant plasmid encoding fused protein with human proinsulin (variants) |
Country Status (1)
Country | Link |
---|---|
RU (1) | RU2162102C1 (en) |
-
1999
- 1999-09-08 RU RU99118955/13A patent/RU2162102C1/en not_active IP Right Cessation
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP6694409B2 (en) | TNFSF single chain molecule | |
AU779612C (en) | Peptide compounds that bind HER2 | |
KR102022662B1 (en) | Recombinant vector for expressing target protein | |
RU2346047C2 (en) | Chimeric polypeptide - growth hormone receptor antagonist, nucleic acid, expression vector, chimeric polypeptide application (versions), pharmaceutical composition, cell, method of obtaining chimeric polypeptide and method of treatment | |
CN113383015B (en) | Recombinant protein variants | |
EP4015526A1 (en) | Recombinant interleukin-15 analog | |
JP2018050616A (en) | IMPROVED RECOMBINANT FcγRII | |
KR20140019828A (en) | Anticancer fusion protein | |
Canals et al. | Production of engineered human pancreatic ribonucleases, solving expression and purification problems, and enhancing thermostability | |
JP2016518855A (en) | Fusion protease | |
RU2162102C1 (en) | Recombinant plasmid encoding fused protein with human proinsulin (variants) | |
KR20210010366A (en) | Fusion tag for preparing glucagon-like peptide-1 or analogues | |
US20100035804A1 (en) | Polypeptide antagonist | |
KR102064810B1 (en) | N-terminal fusion partner for preparing recombinant polypeptide and method of preparing recombinant polypeptide using the same | |
EP3080255A1 (en) | Atypical inteins | |
EP3711772A1 (en) | Recombinant proteins and fusion proteins | |
KR101364864B1 (en) | Expression Vector for Human Erythropoietin and Process for Production of Erythropoietin Using Thereof | |
RU2770490C1 (en) | RECOMBINANT PLASMID DNA pET19b-SurvOL, WHICH PROVIDES SYNTHESIS OF A HYBRID PROTEIN SURVIVIN-OBELIN (SurvOL) AND A HYBRID PROTEIN BOUND BY ANTI-SURVIVIN ANTIBODIES AND POSSESSING BIOLUMINESCENT ACTIVITY | |
AU2004276687B2 (en) | Method of cleaving polypeptide by using OmpT protease mutant | |
US6632638B1 (en) | Enhanced solubility of recombinant proteins using Uracil DNA glycosylase inhibitor | |
KR102009709B1 (en) | Method of preparing human parathyroid hormone 1-84 using fusion polypeptide | |
KR102017540B1 (en) | Method of preparing glucagon like peptide-1 or analogues using fusion polypeptide | |
KR102017542B1 (en) | Method of preparing glucagon like peptide-2 or analogues using fusion polypeptide | |
Brechka et al. | ffl EFFICIENT BACTERIAL EXPRESSION OF TAGLESS RECOMBINANT HUMAN GLUTATHIONE TRANSFERASE P1 AND CHARACTERIZATION OF THE PURIFIED, HIGHLY ACTIVE ENZYME | |
WO2023043473A1 (en) | TGF-β INHIBITOR COMPOSITION AND USE THEREOF |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20030909 |