RU2162102C1 - Recombinant plasmid encoding fused protein with human proinsulin (variants) - Google Patents

Abstract

FIELD: molecular biology, protein engineering, biotechnology. SUBSTANCE: plasmid has promoters providing high constitutive expression of gene encoding the fused protein. Fused protein consists of N-terminal fragment of tumor necrosis α-factor bound through peptide fragment Gly-Gln-Gly-Gly-Ser-Arg with amino acid sequence of human proinsulin. Variant of the fused protein has (Гис-)₇-fragment at N-end for removal of tumor necrosis α-factor after enzymatic cleavage of the fused protein. Plasmid variants have genes determining the resistance to antibiotic ampicillin and aminoglycosides: kanamycin, neomycin and G-418 for the best selection. Invention can be used for development of human insulin drugs. EFFECT: increased level of synthesis of fused protein and stability of strain-producer. 5 cl

Description

 The invention relates to genetic engineering and biotechnology and can be used to create drugs for human insulin.

Insulin is synthesized by the cells of the islets of Langerhans of the pancreas in the form of a precursor - preproinsulin, consisting of 110 amino acid residues (aa) with a molecular weight of 11981 Da. The first 24 a. about. The signal peptide is cleaved during secretion to form proinsulin. Subsequently, proinsulin undergoes limited proteolysis with the cleavage of the C-peptide (35 aa), leading to the formation of "mature" insulin, consisting of two chains connected by two disulfide bonds. Chain A consists of 21, and chain B consists of 30 A. about. The amino acid sequence of preproinsulin with the designation of its chains is given below:
MALWMRLLPL LALLALWGPD PAAA FVNQHL CGSHLVEALY LVCGERGFFY TPKTRREAED LQVGQVELGG GPGAGSLQPL ALEGSLQKRG IVEQCCTSIC SLVQLENVCN (Signal peptide: 1 - 24 a. O.,. chain: 90-110 a.a. disulfide bonds: interchain 31-96 and 43-109, intrachain 95-100 a.o.

 A modern method of producing human insulin is a technology using recombinant DNA.

 The closest analogue of the invention is the recombinant plasmid pInsR encoding a fusion protein containing human proinsulin. [Patent RU 2115729]. This plasmid was constructed on the basis of plasmid pKK223-3 (Pharmacia Biotech), which has the β-lactamase gene (ampicillin resistance) and the tac promoter. After adding the isopropyl-β-D-thiogalactopyranoside (IPTG) inducer to the detriment of culturing, the tac promoter starts the synthesis of the fusion protein from the gene inserted between the EcoRI and HindIII sites. The hybrid protein encoded by the plasmid pInsR consists of the amino acid sequence of the immunoglobulin binding domain of Staphylococcus aureus protein A, linked via the Gly-Ser-Arg amino acid linker to the amino acid sequence of human proinsulin.

The disadvantage of such an expression system is the need to use an IPTG inducer, which complicates the technology and increases the cost of the cultivation stage. In addition, the presence of a tac promoter on a vector requires the use of special strains of E. coli that have a lacI ^q mutation and overexpress lac repressor. Such strains of the JM101, JM109 or XLI-Blue type do not fully meet the requirements for producer strains, in particular, on the stability of the synthesized recombinant proteins. More productive strains of Escherichia coli, for example: BL21, do not have a lacI ^q mutation, but have lon- and ompT mutations by protease genes, which makes it possible to obtain non-proteolyzed recombinant proteins in large quantities.

 A common drawback of using plasmids in producer strains having only an ampicillin resistance marker is the lack of selection efficiency. This is due to the fact that the β-lactamase enzyme that breaks down ampicillin is a secreted protein, that is, after some time of culturing the strain with the plasmid β-lactamase accumulates in the culture medium. This leads to the inactivation of both the medium present and the newly added ampicillin. As a result, strain cells that lose the plasmid and are unable to synthesize the recombinant protein accumulate in the fermenter.

The invention consists in the creation of recombinant plasmids containing a gene for synthesis in E. coli cells of a hybrid protein, a component of which is human proinsulin. These recombinant plasmids differ from known similar plasmids in a number of ways:
1) the presence of promoters that provide high constitutive expression of the gene of the hybrid protein. This ceteris paribus avoids the addition to the culture medium of the inductor (in analogue, the addition of IPTG) synthesis of a hybrid protein, which simplifies the technology and reduces cost;
2) the hybrid protein gene, of which human proinsulin is an integral part, differs from the known ones in that the nucleotide sequence preceding human proinsulin encodes the N-terminal fragment of human tumor necrosis factor α and the Gly-Gln-Gli-Ser-Gli-Arg fragment. The N-terminal fragment of human tumor necrosis factor α stabilizes the hybrid protein and increases its accumulation in E. coli cells during biosynthesis. The Gly-Gln-Gli-Gli-Ser-Arg fragment serves as a “hinge” bridge, making the hybrid protein two-domain: the domain of tumor necrosis factor α and the proinsulin domain, which allows the proinsulin domain to form the correct conformation necessary for biological activity. In addition, the “hinged” bridge of glycine and serine amino acid residues makes the arginine residue more accessible for enzymatic cleavage of the fusion protein with trypsin-like proteases. This increases the efficiency of the technological stage of conversion of proinsulin into "mature"insulin;
3) a variant of the hybrid protein gene is an additional nucleotide sequence encoding the synthesis at the N-terminus of the hybrid protein (before the sequence of the fragment of tumor necrosis factor α) of a fragment consisting of seven histidine residues. The (Gis-) ₇ fragment will allow not only purification of the hybrid protein by metal chelate chromatography, but also removal of impurities of the tumor necrosis factor α fragment from mature insulin after the enzymatic cleavage of the hybrid protein;
4) the presence of two antibiotic resistance genes ampicillin and aminoglycosides: kanamycin, neomycin and G-418. Resistance to aminoglycosides is determined by the cytoplasmic enzyme aminoglycoside phosphotransferase, which, unlike β-lactamase, is not secreted into the culture medium during cultivation. This provides a better selection of cells that have preserved the recombinant plasmid, and, as a result, a higher level of synthesis of the hybrid protein and the stability of the producer strain.

To create a recombinant plasmid with promoters that provide high constitutive expression of the hybrid protein gene (in order to avoid the need to add an inducer to the culture medium) and construct the hybrid protein gene itself, the plasmid pTNF329 was used [Shmelev V.A. et al., Molek. Genet. Microbe. Virusol.- 1995.- N 1.-S. 9-14]. The N-terminal fragment of the human tumor necrosis factor α gene with the previous promoters A2 and A3 of the T7 phage and the ribosome binding site was amplified by 30 cycles (92 ^° C, 30 sec; 62 ^° C, 45 sec; 72 ^° C, 45 sec) using Tag polymerases and primers: CAATTGTAGA- CAGCCTGATAAGTCG and GGATCCGCCTTGGCCCTTGAAGAG. The amplified fragment of 0.48 kbp was treated with restriction enzymes MunI and BamHI. The DNA fragment encoding human proinsulin was amplified for 30 cycles (92 ^° C, 30 sec; 65 ^° C, 30 sec; 72 ^° C, 30 sec) using Tag polymerase and primers: GGATCCCGCTTTTGTTAACCAACAC and AAGCTTAGTTGCAATAGTTC. The amplified fragment of 0.27 kbp was treated with restriction enzymes HindIII and BamHI. After restriction, both amplified fragments were mixed and ligated with plasmid pKK223-3 pretreated with restriction enzymes EcoRI and HindIII. After transformation into E. coli strain HB2151, recombinant plasmids were selected that confer ampicillin resistance to the cells and contain an insert of 0.75 kbp DNA fragment. and encoding the synthesis of a hybrid protein with a molecular weight of 16.8 kDa according to electrophoresis in 15% SDS page-SDS.

The resulting recombinant plasmid pKT-INS is characterized by the following features:
- size 5.3 kb;
- contains, following the tac promoter, promoters A2 and A3 of the T7 phage,
- contains between the restriction enzyme sites ClaI and HindIII gene encoding the synthesis of a hybrid protein of 154 a. about. with a molecular weight of 16.8 kDa, consisting of the N-terminal fragment of tumor necrosis factor α, connected through the peptide fragment Gli-Gln-Gli-Gli-Ser-Arg with the amino acid sequence of human proinsulin,
- has characteristic restriction sites: the EcoRI site located between the A2 and A3 promoters, the KpnI site located between the A3 promoter and the ribosome binding site, the ClaI site between the ribosome binding site and the fragment of the tumor necrosis factor α gene, the BamHI site located between the fragments tumor necrosis factor α and human proinsulin genes, 2 PstI sites in the proinsulin gene, HindIII site behind the human proinsulin gene;
- contains a gene of a hybrid protein with the sequence N1
To create a recombinant plasmid with a gene variant encoding a fusion protein with seven histidine residues at the N-terminus, pKT-INS plasmid DNA was digested with ClaI restriction enzyme and then ligated with a phosphorylated oligonucleotide duplex
CGAATGAGCCACCATCATCACCATCATCA
TTACTCGGTGGTAGTAGTGGTAGTAGTGC.

After transformation of the ligase mixture into E. coli strain HB2151, recombinant ampicillin resistant and synthesizing fusion proteins were selected. Plasmid DNA was isolated from these clones and the presence of a (His) ₇ fragment was confirmed by the absence of a ClaI site and in PCR with primers CGAATGAGCCACCATCATCACCATCATCA and CAATTGAAGGGAATAAGGGCGACACG.

The resulting recombinant plasmid DNA pKHT-INS differs from plasmid pKT-INS in the following features:
- encodes a hybrid protein of 164 a. about. with a molecular weight of 18.1 kDa, consisting of an N-terminal domain for metal chelate chromatography of the composition of (Gis-) ₇ , N-terminal fragment of tumor necrosis factor α, connected through the peptide fragment Gly-Gln-Gli-Gli-Ser-Arg with amino acid human proinsulin sequence
- there is no ClaI site between the ribosome binding site and the gene of the hybrid protein, into which a synthetic DNA fragment encoding the (His) ₇ domain is integrated.

- contains a hybrid protein gene with the sequence N2
To create a recombinant plasmid with two antibiotic resistance genes for ampicillin and kanamycin, plasmids pVE10 and pUC4K were used. The plasmid pVE10 is a deletion derivative of pBR322, has a size of 1.8 thousand nucleotide pairs (kb), unique EcoRI, ClaI, PstI sites and contains a replication origin and a β-lactamase gene [Shmelev V.A. et al. ., Molek. Genet. Microbe. Virusol. -1991. -N 10.-C.3-8]. Plasmid pUC4K [GenBank Accession Number X06404] has a size of about 4 kb. and contains the Tn :: 903 fragment flanked by inverted repeats of EcoRI, BamHI, SalI, and PstI sites. This fragment contains the aminoglycoside phosphotransferase gene, which gives the cells antibiotic resistance to kanamycin, neomycin and G-418. The aminoglycoside phosphotransferase gene with its own promoter was amplified for 30 cycles (92 ^° C, 30 sec; 60 ^° C, 45 sec; 72 ^° C, 45 sec) using Tag polymerase and primers: TTCGAACAAAGCCACGTTGTGTCTC and GAATTCCGTCAAGTCAGCGTAATGC. The amplified fragment is 1 kb in size. was digested with restriction enzymes Bsp119I and EcoRI and ligated with plasmid pVE10 pretreated with restriction enzymes ClaI and EcoRI. After transformation into E. coli strain HB2151, recombinant plasmids were selected that confer resistance to ampicillin and kanamycin on the cells. The resulting plasmid pAK1 has a size of 2.8 kb, a β-lactamase gene with a unique PstI site, an aminoglycoside phosphotransferase gene with unique XhoI, ClaI, SmaI, HindIII sites and a unique site outside the EcoRI genes.

To clone the expression system with the hybrid protein gene from the pKT-INS plasmid into this plasmid, the DNA fragment was amplified by 30 cycles (92 ^° C, 30 sec; 62 ^° C, 45 sec; 72 ^° C, 45 sec) using Tag polymerase and primers: CAATTGTAGACAGCCTGATAAGTCG and CAATTGAAGGGAATAAGGGCGACACG. The amplified fragment of 1.3 kbp was digested with MunI restriction enzyme and ligated with plasmid pAK1, pretreated with EcoRI restriction enzyme and dephosphorylated. After transformation into E. coli strain HB2151, clones of recombinant DNA were selected that confer resistance to ampicillin and kanamycin on the cells and contain a non-cutting insert at the EcoRI site.

The resulting plasmid pVT-INS is characterized by the following features:
- size 4.12 kb;
- gives the cells antibiotic resistance to ampicillin, kanamycin, neomycin and G-418;
- contains promoters A2 and A3 of the T7 phage, providing constitutive expression of the gene of the hybrid protein;
- contains between the restriction enzyme sites ClaI and HindIII a gene encoding a fusion protein of 154 a. about. with a molecular weight of 16.8 kDa, consisting of an N-terminal fragment of tumor necrosis factor connected through a peptide fragment of Gly-Gln-Gli-Gli-Ser-Arg with the amino acid sequence of human proinsulin;
- has characteristic restriction sites:
3PstI site, of which 1 is in the β-lactamase gene and 2 is in the proinsulin gene;
2ClaI site, of which 1 is in the aminoglycoside phosphotransferase gene and 1 is between the ribosome binding site and the fragment of the tumor necrosis factor α gene;
2HindIII site, of which 1 is in the aminoglycoside phosphotransferase gene and 1 is behind the human proinsulin gene;
unique sites - XhoI and SmaI, located in the aminoglycoside phosphotransferase gene,
EcoRI, located between promoters A2 and A3,
KpnI, located between the A3 promoter and the ribosome binding site, BamHI, located between the fragments of the tumor necrosis factor α and human proinsulin genes;
- contains a gene of a hybrid protein with the sequence N1
To create a recombinant plasmid with ampicillin and kanamycin selection markers and a gene variant encoding a fusion protein with seven histidine residues at the N-terminus, pKHT-INS plasmid DNA was used in PCR with Tag polymerase and primers: CAATTGTAGACAGCCTGATAGTCGTCGTC. An amplified fragment of about 1.3 kbp was digested with MunI restriction enzyme and ligated with plasmid pAK1, pretreated with EcoRI restriction enzyme and dephosphorylated. After transformation into E. coli strain HB2151, clones of recombinant DNA were selected that confer resistance to ampicillin and kanamycin on the cells and contain a non-cutting insert at the EcoRI site.

The resulting plasmid pVHT-INS differs from pVT-INS in the following features:
- size 4.15 kb;
- contains between the restriction enzyme sites KpnI and HindIII a ribosome binding site and a gene encoding a 164 a fusion protein. about. with a molecular weight of 18.1 kDa, consisting of a (Gis-) ₇ fragment, an N-terminal fragment of tumor necrosis factor connected through a peptide fragment of Gly-Gln-Gli-Gli-Ser-Arg with the amino acid sequence of human proinsulin;
- there is no ClaI site between the ribosome binding site and the gene of the hybrid protein;
- contains the gene of the hybrid protein with the sequence N2.

 The obtained plasmids pKT-INS, pKHT-INS, pVT-INS or pVHT-INS after transformation into competent cells of E. coli strains provide a high level of biosynthesis of the hybrid protein, determined by electrophoresis in 15% SDS page-SDS. Transformable strain can be any E. coli strain that meets the requirements for producer strains. For example: SG20050 strains having a lon mutation, or BL21 having lon and ompT mutations in protease genes, and allowing large quantities of non-proteolyzed recombinant proteins to be obtained.

Claims (4)

 1. Recombinant plasmid DNA pKT-INS of 5.3 kb, encoding a hybrid protein of 154 a.o. with a molecular weight of 16.8 kDa, consisting of the N-terminal fragment of tumor necrosis factor α, connected through the peptide fragment Gli-Gln-Gli-Gli-Ser-Arg with the amino acid sequence of human proinsulin, characterized by the following properties: constructed on the basis of plasmid pKK223- 3, contains, following the tac promoter, promoters A2 and A3 of the T7 phage, has characteristic restriction sites: EcoR1 site located between the A2 and A3 promoters, the Knl site located between the A3 promoter and the ribosome binding site, the Clal site between the ribosome binding the site and the fragment of the tumor necrosis factor α gene, the BamH1 site located between the fragments of the tumor necrosis factor α and human proinsulin genes, the 2-Pstl site in the proinsulin gene, the Hindlll site behind the human proinsulin gene, contains the Clal and Hindlll gene between the restriction enzyme sites fusion protein with a nucleotide sequence of 1. 2. Recombinant plasmid DNA pKNT-INS encoding a 164 aa fusion protein. with a molecular weight of 18.1 kDa, consisting of the N-terminal domain of composition (Gis-) ₇ , the N-terminal fragment of tumor necrosis factor α, connected through the peptide fragment of Gly-Gln-Gly-Gly-Ser-Arg with the amino acid sequence of human proinsulin characterized by the following properties: constructed on the basis of pKK223-3, contains, following the tac promoter, promoters A2 and A3 of the T7 phage, has characteristic restriction sites: EcoR1 site located between the A2 and A3 promoters, the Knl site located between the A3 promoter and ribosome binding site, BamH1 site, n located between the fragment of the tumor necrosis factor α and human proinsulin genes, the 2-Pstl site in the proinsulin gene, the Hindlll site behind the human proinsulin gene, a synthetic DNA fragment encoding the (Gis) ₇ domain is integrated between the ribosome binding site and the hybrid protein gene contains between the restriction enzyme sites Knl and Hindlll the ribosome binding site and the gene of the hybrid protein with a nucleotide sequence of 2.  3. Recombinant plasmid DNA pVT-INS encoding a fusion protein of 154 a. about. with a molecular weight of 16.8 kDa, consisting of the N-terminal fragment of tumor necrosis factor α, connected through the peptide fragment Gli-Gln-Gli-Gli-Ser-Arg with the amino acid sequence of human proinsulin, characterized by the following properties: constructed on the basis of plasmid pVE10, it has a size of 4.12 kb, gives the cells antibiotic resistance to ampicillin, kanamycin, neomycin and G-418, contains promoters A2 and A3 of the T7 phage that provide constitutive expression of the fusion protein gene, and contains Clal restriction enzyme sites The Hindlll gene encoding a hybrid protein with the amino acid sequence of human proinsulin has characteristic restriction sites: 3 Pstl sites, of which 1 is in the β-lactamase gene and 2 in the proinsulin gene, 2 Clal sites, of which 1 is in the aminoglycoside phosphotransferase gene and 1 - between the ribosome-binding site and the fragment of the tumor necrosis factor gene α, 2 Hindlll sites, of which 1 is in the aminoglycoside phosphotransferase gene and 1 is behind the human proinsulin gene, the unique sites are Xhol and Smal in the aminoglycoside phosphotrans gene ferazy, EcoR1, located between the A2 and A3 promoters, Krnl located between the A3 promoter and ribosomsvyazyvayuschim site, BamHl, located between the gene fragments necrosis factor α and human proinsulin tumors, the fusion protein contains a gene with the sequence 1. 4. Recombinant plasmid DNA pVHT-INS encoding a 164 a fusion protein. about. with a molecular weight of 18.1 kDa, consisting of a (Gis-) ₇ fragment, an N-terminal fragment of tumor necrosis factor α, connected through a peptide fragment of Gly-Gln-Gli-Gli-Ser-Arg with the amino acid sequence of human proinsulin, characterized by properties: it is constructed on the basis of plasmid pVE10, has a size of 4.15 kb, makes cells resistant to antibiotics: ampicillin, kanamycin, neomycin and G-418, contains promoters A2 and A3 of phage T7 that provide the designed expression of the hybrid protein gene contains between sai The restriction enzymes Knl and Hidlll, the ribosome binding site and the gene encoding the hybrid protein, have characteristic restriction sites: 3 Pstl sites, of which 1 is in the β-lactamase gene and 2 in the proinsulin gene, Clal site in the aminoglycoside phosphotransferase gene, 2 Hindlll sites, of which 1 is in the aminoglycoside phosphotransferase gene and 1 is behind the human proinsulin gene, unique sites are Xhol and Smal, located in the aminoglycoside phosphotransferase gene, EcoR1, located between the A2 and A3 promoters, Kpnl, located between the A3 binding site and ribosome , located between fragments of genes of tumor necrosis factor α and human proinsulin genes, contains a hybrid protein gene with sequence 2.

Images