KR102017542B1 - Method of preparing glucagon like peptide-2 or analogues using fusion polypeptide - Google Patents

Method of preparing glucagon like peptide-2 or analogues using fusion polypeptide Download PDF

Info

Publication number
KR102017542B1
KR102017542B1 KR1020190007179A KR20190007179A KR102017542B1 KR 102017542 B1 KR102017542 B1 KR 102017542B1 KR 1020190007179 A KR1020190007179 A KR 1020190007179A KR 20190007179 A KR20190007179 A KR 20190007179A KR 102017542 B1 KR102017542 B1 KR 102017542B1
Authority
KR
South Korea
Prior art keywords
ile
asp
arg
leu
val
Prior art date
Application number
KR1020190007179A
Other languages
Korean (ko)
Other versions
KR20190098690A (en
Inventor
김성건
탁상범
Original Assignee
주식회사 펩진
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 펩진 filed Critical 주식회사 펩진
Publication of KR20190098690A publication Critical patent/KR20190098690A/en
Application granted granted Critical
Publication of KR102017542B1 publication Critical patent/KR102017542B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/605Glucagons
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/06Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/50Fusion polypeptide containing protease site

Abstract

본 발명은 N-말단 융합 파트너와 글루카곤 유사 펩타이드-2 또는 이의 유사체를 포함하는 융합 폴리펩타이드를 이용하여 GLP-2 또는 이의 유사체를 생산하는 방법을 제공한다. 본 발명에 따른 융합 폴리펩타이드는 유전자 재조합 기술로 GLP-2 또는 이의 유사체 생산시 수율을 향상시킬 수 있으며, 숙주세포의 단백질 분해효소로부터 분해를 최소화하여 안정적으로 GLP-2 또는 이의 유사체를 발현시킬 수 있다.The present invention provides a method for producing GLP-2 or an analog thereof using a fusion polypeptide comprising an N-terminal fusion partner and glucagon-like peptide-2 or an analog thereof. The fusion polypeptide according to the present invention can improve the yield in the production of GLP-2 or its analogs by genetic recombination technology, and can stably express GLP-2 or its analogs by minimizing degradation from proteolytic enzymes of host cells. have.

Description

융합 폴리펩타이드를 이용하여 글루카곤 유사 펩타이드-2 또는 이의 유사체를 생산하는 방법{METHOD OF PREPARING GLUCAGON LIKE PEPTIDE-2 OR ANALOGUES USING FUSION POLYPEPTIDE}METHODS OF PREPARING GLUCAGON LIKE PEPTIDE-2 OR ANALOGUES USING FUSION POLYPEPTIDE}

본 발명은 N-말단 융합 파트너와 글루카곤 유사 펩타이드-2(GLP-2) 또는 이의 유사체를 포함하는 융합 폴리펩타이드를 이용하여 GLP-2 또는 이의 유사체를 생산하는 방법에 관한 것이다.The present invention relates to a method for producing GLP-2 or an analog thereof using a fusion polypeptide comprising an N-terminal fusion partner and glucagon-like peptide-2 (GLP-2) or an analog thereof.

GLP-2는 장의 장내분비 L 세포 및 뇌간의 특정 영역에서 프로글루카곤의 번역 후 과정으로부터 방출된 33개 아미노산 펩티드이다. GLP-2는 장샘에서의 줄기세포 증식의 자극 및 융모에 대한 아폽토시스(apoptosis)의 억제를 통해 소장 점막 상피의 유의한 성장을 유도한다. 또한, GLP-2는 위 배출(emptying) 및 위산 분비를 억제하고, 글루코스 수송자의 상향조절을 통해 장 헥소스 수송을 자극하고, 장 혈류를 증가시키는 기능이 있는 것으로 알려져 있다.GLP-2 is a 33 amino acid peptide released from the post-translational process of proglucagon in specific areas of enteroendocrine L cells and brain stem. GLP-2 induces significant growth of small intestinal mucosal epithelium through stimulation of stem cell proliferation in the intestinal gland and inhibition of apoptosis on villi. In addition, GLP-2 is known to have a function of inhibiting gastric emptying and gastric acid secretion, stimulating intestinal hexose transport through upregulation of glucose transporters, and increasing intestinal blood flow.

GLP-2는 에너지 흡수 및 보호, 장 세포 기능의 활성화 등의 특징으로 다양한 장 질환과 장손상의 실험모델에서 치료제로서 유망한 가능성을 보여왔다. 일례로, GLP-2는, 선천적으로 또는 장 절제 수술과 같은 후천적 요인에 따라 소장의 흡수면적 감소로 인하여 영양결핍증이 초래되는 질환인 단장증후군(short bowel syndrome, 이하 SBS)의 치료제로서 각광 받고 있다. GLP-2 has shown promising potential as a therapeutic agent in experimental models of various intestinal diseases and intestinal injuries due to its energy absorption and protection and activation of intestinal cell function. For example, GLP-2 is in the spotlight as a treatment for short bowel syndrome (SBS), a disease in which nutritional deficiency is caused by a reduction in the absorption of the small intestine due to innate or acquired factors such as bowel resection. .

이러한 GLP-2의 유망한 가능성에 따라 GLP-2 또는 이의 기능적 동등물을 생산하기 위한 여러가지 방법이 제시되고 있으며, 최근에는 유전자 재조합 기술을 이용하여 GLP-2 및 이의 유사체를 대량 생산하려는 시도도 이루어지고 있다In view of the promising potential of GLP-2, various methods for producing GLP-2 or functional equivalents thereof have been proposed. Recently, attempts have been made to mass-produce GLP-2 and its analogs using genetic recombination techniques. have

유전자 재조합 기술은 여러 중요한 단백질들의 핵산을 발현벡터에 클로닝하여 재조합 발현벡터를 얻고, 이를 적당한 숙주세포에 형질전환시켜 배양함으로써 타겟 단백질을 생산하는 방법이다. 다만, 숙주세포에 내재된 분해 효소에 의해 타겟 단백질이 분해되어 수율이 낮아지거나, 융합 파트너로 사용하는 펩타이드의 크기가 제조하고자 하는 타겟 단백질의 크기에 비해 너무 커서 수율이 현저히 떨어지는 문제가 있다. Genetic recombination technology is a method of producing a target protein by cloning the nucleic acid of several important proteins to an expression vector to obtain a recombinant expression vector, and transforming it in a suitable host cell. However, the target protein is degraded by the degradation enzyme inherent in the host cell, so that the yield is low, or the size of the peptide used as a fusion partner is too large compared to the size of the target protein to be prepared, so that the yield is significantly reduced.

따라서, 유전자 재조합 기술을 이용하여 상기 GLP-2 또는 이의 유사체를 대량 생산하고자 하는 경우, 해당 폴리펩타이드를 안정적으로 발현시키면서도 생산 수율을 향상시킬 수 있는 융합 파트너를 개발하는 것이 중요하다.Therefore, in the case of mass production of the GLP-2 or its analogues using genetic recombination technology, it is important to develop a fusion partner capable of stably expressing the polypeptide while improving production yield.

이에 본 발명자들은 GLP-2 또는 이의 유사체를 안정적으로 발현시키면서 생산 수율을 향상시킬 수 있는 융합 파트너를 개발하기 위해 연구한 결과, 본 발명에 따른 N-말단 융합 파트너와 GLP-2 또는 이의 유사체를 포함하는 융합 폴리펩타이드를 이용하여 GLP-2 또는 이의 유사체를 생산할 경우, GLP-2 또는 이의 유사체의 생산 수율이 증가하는 것을 확인함으로써 본 발명을 완성하였다.Accordingly, the present inventors have studied to develop a fusion partner capable of stably expressing GLP-2 or an analog thereof and improve the production yield, and thus include an N-terminal fusion partner and GLP-2 or an analog thereof according to the present invention. When the production of GLP-2 or its analogues using the fusion polypeptide, the present invention was completed by confirming that the production yield of GLP-2 or its analogues is increased.

상기 목적을 달성하기 위해, 본 발명의 일 측면은, (a) 하기 일반식 1로 표시되는 아미노산 서열로 이루어진 N-말단 융합 파트너; 글루카곤 유사 펩타이드-2(glucagon like peptide-2; GLP-2) 또는 이의 유사체; 및 상기 N-말단 융합 파트너와, 상기 GLP-2 또는 이의 유사체 사이에 링커를 포함하는 융합 폴리펩타이드를 코딩하는 뉴클레오타이드를 포함하는 발현벡터를 제조하는 단계; (b) 상기 발현벡터를 숙주세포에 형질도입하는 단계; (c) 상기 숙주세포를 배양하는 단계; (d) 상기 숙주세포에서 발현된 융합 폴리펩타이드를 정제하는 단계; 및 (e) 상기 정제된 융합 폴리펩타이드를 절단 효소와 배양하여 GLP-2 또는 이의 유사체를 회수하는 단계를 포함하는 GLP-2 또는 이의 유사체를 생산하는 방법을 제공한다:In order to achieve the above object, one aspect of the present invention, (a) N-terminal fusion partner consisting of the amino acid sequence represented by the general formula (1); Glucagon like peptide-2 (GLP-2) or analogs thereof; And preparing an expression vector comprising a nucleotide encoding a fusion polypeptide comprising a linker between the N-terminal fusion partner and the GLP-2 or an analog thereof; (b) transducing the expression vector into a host cell; (c) culturing the host cell; (d) purifying the fusion polypeptide expressed in the host cell; And (e) culturing the purified fusion polypeptide with a cleavage enzyme to recover GLP-2 or an analog thereof.

[일반식 1][Formula 1]

Met-Xaa1-Xaa2-Xaa3-Xaa4-Xaa5-Xaa6-(Z)n Met-Xaa1-Xaa2-Xaa3-Xaa4-Xaa5-Xaa6- (Z) n

상기 일반식 1에서,In the general formula 1,

Xaa1 내지 Xaa6은, 서로 독립적으로, 이소루신(Ile, I), 글리신(Gly, G), 알라닌(Ala, A), 프롤린(Pro, P), 발린(Val, V), 루신(Leu, L), 메티오닌(Met, M), 페닐알라닌(Phe, F), 티로신(Tyr, Y), 트립토판(Trp, W), 아스파라긴(Asn, N), 세린(Ser, S), 트레오닌(Thr, T), 시스테인(Cys, C), 글루타민(Gln, Q), 아르기닌(Arg, R), 리신(Lys, K), 히스티딘(His, H), 아스팔트산(Asp, D) 및 글루탐산(Glu, E)으로 이루어진 군으로부터 선택되고, Xaa1 to Xaa6, independently of each other, isoleucine (Ile, I), glycine (Gly, G), alanine (Ala, A), proline (Pro, P), valine (Val, V), leucine (Leu, L ), Methionine (Met, M), phenylalanine (Phe, F), tyrosine (Tyr, Y), tryptophan (Trp, W), asparagine (Asn, N), serine (Ser, S), threonine (Thr, T) Cysteine (Cys, C), Glutamine (Gln, Q), Arginine (Arg, R), Lysine (Lys, K), Histidine (His, H), Asphalt acid (Asp, D) and Glutamic acid (Glu, E) Selected from the group consisting of

상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개 내지 36개의 아미노산이고,Z is 1 to 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345,

상기 n은 0 또는 1의 정수이다.N is an integer of 0 or 1.

본 발명에 따른 융합 폴리펩타이드는 기존에 알려진 융합 파트너 대비 작은 분자량을 갖는 신규한 융합 파트너를 포함한다. 이러한, 분자량이 작은 융합 파트너를 이용할 경우, GLP-2 또는 이의 유사체의 생산 수율을 향상시킬 수 있다. 또한, 본 발명에 따른 융합 폴리펩타이드는 숙주세포 내에서 내포체 형태로 발현을 유도함으로써 숙주세포의 단백질 분해효소로부터 분해를 방지하여 안정적으로 GLP-2 또는 이의 유사체를 생산할 수 있는 장점이 있다. 따라서, 종래의 융합 파트너를 사용한 경우보다 안정성 및 수율이 향상된 GLP-2 또는 이의 유사체의 생산 방법을 제공할 수 있다.Fusion polypeptides according to the present invention include novel fusion partners having a lower molecular weight than known fusion partners. Using such low molecular weight fusion partners can improve the production yield of GLP-2 or its analogs. In addition, the fusion polypeptide according to the present invention has the advantage of stably producing GLP-2 or an analog thereof by preventing expression from proteolytic enzymes of the host cell by inducing expression in the inclusion body form in the host cell. Thus, it is possible to provide a method for producing GLP-2 or an analog thereof with improved stability and yield than with conventional fusion partners.

도 1은 재조합 대장균에서 생산된 총 단백질을 SDS-PAGE로 분석한 결과이다(레인 M: 마커 단백질, 레인 1: H6TEV-GLP-2A2G(균주 번호 PG012), 레인 2: PG07-H6TEV-GLP-2A2G(균주 번호 PG013), 레인 3: PG15-H6TEV-GLP-2A2G(균주 번호 PG014), 레인 4: PG22-H6TEV-GLP-2A2G(균주 번호 PG015), 레인 5: PG29-H6TEV-GLP-2A2G(균주 번호 PG016), 레인 6: PG36-H6TEV-GLP-2A2G(균주 번호 PG017), 레인 7: PG43-H6TEV-GLP-2A2G(균주 번호 PG018)).
도 2는 재조합 대장균의 총세포 분획을 가용성 및 불용성 분획으로 분리한 후 SDS-PAGE로 분석한 결과이다(레인 M: 마커 단백질, 레인 S: 가용성 분획, 레인 I: 불용성 분획, 레인 5: PG29-H6TEV-GLP-2A2G(균주 번호 PG016), 레인 6: PG36-H6TEV-GLP-2A2G(균주 번호 PG017), 레인 7: PG43-H6TEV-GLP-2A2G(균주 번호 PG018)).
도 3은 PG43-H6TEV-GLP-2A2G 내 PG43의 2번째 또는 3번째 아미노산 잔기를 이소루신(I), 아스파라긴(N), 아르기닌(R), 아스팔트산(D)으로 치환한 GLP-2A2G 융합 폴리펩타이드의 변이체를 SDS-PAGE로 분석한 후 결과이다.
도 4는 PG43-H6TEV-GLP-2A2G 내 PG43의 4번째 또는 5번째 아미노산 잔기를 이소루신(I), 아스파라긴(N), 아르기닌(R), 아스팔트산(D)으로 치환한 GLP-2A2G 융합 폴리펩타이드의 변이체를 SDS-PAGE로 분석한 후 결과이다.
도 5는 PG43-H6TEV-GLP-2A2G 내 PG43의 6번째 또는 7번째 아미노산 잔기를 이소루신(I), 아스파라긴(N), 아르기닌(R), 아스팔트산(D)으로 치환한 GLP-2A2G 융합 폴리펩타이드의 변이체를 SDS-PAGE로 분석한 후 결과이다.
도 6은 크로마토그래피를 통해 불용성 분획 내의 PG43-H6TEV-GLP-2 융합 폴리펩타이드를 정제한 결과이다(크로마토그램에서 청색, 녹색 선들은 각각 280 nm 파장에서의 흡광도, 용출 완충액의 비율을 나타냄).
도 7은 크로마토그래피를 통해 정제한 PG43-H6TEV-GLP-2 융합 폴리펩타이드를 SDS-PAGE로 분석한 결과이다(레인 M: 마커 단백질, 레인 S: 정제 전 시료, FT: 통과액 분획, 레인 1~5: 용출액 분획). 화살표는 PG43-H6TEV-GLP-2 융합 폴리펩타이드를 나타낸다.
도 8은 TEV 프로테아제를 이용한 정제된 PG43-H6TEV-GLP-2A2G 융합 폴리펩타이드를 절단 후 분획을 SDS-PAGE로 분석한 결과이다(레인 M: 마커 단백질, 레인 C: TEV 프로테아제를 처리하지 않은 시료, 레인 T: TEV 프로테아제를 처리한 시료).
도 9는 본 발명에 따라 정제된 GLP-2A2G의 분자량을 측정한 결과를 나타낸 것이다.
Figure 1 shows the result of SDS-PAGE analysis of the total protein produced in recombinant E. coli (lane M: marker protein, lane 1: H6TEV-GLP-2A2G (strain number PG012), lane 2: PG07-H6TEV-GLP-2A2G) (Strain number PG013), lane 3: PG15-H6TEV-GLP-2A2G (strain number PG014), lane 4: PG22-H6TEV-GLP-2A2G (strain number PG015), lane 5: PG29-H6TEV-GLP-2A2G (strain Number PG016), lane 6: PG36-H6TEV-GLP-2A2G (strain number PG017), lane 7: PG43-H6TEV-GLP-2A2G (strain number PG018).
Figure 2 shows the result of analysis of the total cell fraction of recombinant E. coli into soluble and insoluble fractions and analyzed by SDS-PAGE (lane M: marker protein, lane S: soluble fraction, lane I: insoluble fraction, lane 5: PG29-). H6TEV-GLP-2A2G (Strain No. PG016), Lane 6: PG36-H6TEV-GLP-2A2G (Strain No. PG017), Lane 7: PG43-H6TEV-GLP-2A2G (Strain No. PG018).
3 is a GLP-2A2G fusion poly substituted with isoleucine (I), asparagine (N), arginine (R), and asphalt acid (D) with the second or third amino acid residue of PG43 in PG43-H6TEV-GLP-2A2G. The result of analyzing the variants of the peptides by SDS-PAGE.
4 is a GLP-2A2G fusion poly substituted with isoleucine (I), asparagine (N), arginine (R), and asphalt acid (D) with the fourth or fifth amino acid residue of PG43 in PG43-H6TEV-GLP-2A2G. The result of analyzing the variants of the peptides by SDS-PAGE.
FIG. 5 shows GLP-2A2G fusion poly substituted with isoleucine (I), asparagine (N), arginine (R), and asphalt acid (D) with the sixth or seventh amino acid residue of PG43 in PG43-H6TEV-GLP-2A2G The result of analyzing the variants of the peptides by SDS-PAGE.
FIG. 6 shows the results of purification of the PG43-H6TEV-GLP-2 fusion polypeptide in the insoluble fraction by chromatography (blue and green lines in the chromatogram respectively indicate the absorbance at 280 nm wavelength, the ratio of the elution buffer).
7 is a result of SDS-PAGE analysis of purified PG43-H6TEV-GLP-2 fusion polypeptide by chromatography (lane M: marker protein, lane S: sample before purification, FT: flow-through fraction, lane 1 ˜5: eluent fraction). Arrows indicate PG43-H6TEV-GLP-2 fusion polypeptides.
Figure 8 shows the result of analyzing the fraction by SDS-PAGE after cleavage of purified PG43-H6TEV-GLP-2A2G fusion polypeptide using TEV protease (lane M: marker protein, lane C: sample not treated with TEV protease, Lane T: sample treated with TEV protease).
Figure 9 shows the result of measuring the molecular weight of GLP-2A2G purified according to the present invention.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명의 일 측면은, (a) 하기 일반식 1로 표시되는 아미노산 서열로 이루어진 N-말단 융합 파트너; 글루카곤 유사 펩타이드-2(glucagon like peptide-2; GLP-2) 또는 이의 유사체; 및 상기 N-말단 융합 파트너와, 상기 GLP-2 또는 이의 유사체 사이에 링커를 포함하는 융합 폴리펩타이드를 코딩하는 뉴클레오타이드를 포함하는 발현벡터를 제조하는 단계; (b) 상기 발현벡터를 숙주세포에 형질도입하는 단계; (c) 상기 숙주세포를 배양하는 단계; (d) 상기 숙주세포에서 발현된 융합 폴리펩타이드를 정제하는 단계; 및 (e) 상기 정제된 융합 폴리펩타이드를 절단 효소와 배양하여 GLP-2 또는 이의 유사체를 회수하는 단계를 포함하는 GLP-2 또는 이의 유사체를 생산하는 방법을 제공한다:One aspect of the invention, (a) N-terminal fusion partner consisting of the amino acid sequence represented by the general formula (1); Glucagon like peptide-2 (GLP-2) or analogs thereof; And preparing an expression vector comprising a nucleotide encoding a fusion polypeptide comprising a linker between the N-terminal fusion partner and the GLP-2 or an analog thereof; (b) transducing the expression vector into a host cell; (c) culturing the host cell; (d) purifying the fusion polypeptide expressed in the host cell; And (e) culturing the purified fusion polypeptide with a cleavage enzyme to recover GLP-2 or an analog thereof.

[일반식 1][Formula 1]

Met-Xaa1-Xaa2-Xaa3-Xaa4-Xaa5-Xaa6-(Z)n Met-Xaa1-Xaa2-Xaa3-Xaa4-Xaa5-Xaa6- (Z) n

상기 일반식 1에서,In the general formula 1,

Xaa1 내지 Xaa6은, 서로 독립적으로, 이소루신(Ile, I), 글리신(Gly, G), 알라닌(Ala, A), 프롤린(Pro, P), 발린(Val, V), 루신(Leu, L), 메티오닌(Met, M), 페닐알라닌(Phe, F), 티로신(Tyr, Y), 트립토판(Trp, W), 아스파라긴(Asn, N), 세린(Ser, S), 트레오닌(Thr, T), 시스테인(Cys, C), 글루타민(Gln, Q), 아르기닌(Arg, R), 리신(Lys, K), 히스티딘(His, H), 아스팔트산(Asp, D) 및 글루탐산(Glu, E)으로 이루어진 군으로부터 선택되고, Xaa1 to Xaa6, independently of each other, isoleucine (Ile, I), glycine (Gly, G), alanine (Ala, A), proline (Pro, P), valine (Val, V), leucine (Leu, L ), Methionine (Met, M), phenylalanine (Phe, F), tyrosine (Tyr, Y), tryptophan (Trp, W), asparagine (Asn, N), serine (Ser, S), threonine (Thr, T) Cysteine (Cys, C), Glutamine (Gln, Q), Arginine (Arg, R), Lysine (Lys, K), Histidine (His, H), Asphalt acid (Asp, D) and Glutamic acid (Glu, E) Selected from the group consisting of

상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개 내지 36개의 아미노산이고,Z is 1 to 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345,

상기 n은 0 또는 1의 정수이다.N is an integer of 0 or 1.

먼저, 상기 (a) 단계에서는, 상기 일반식 1로 표시되는 아미노산 서열로 이루어진 N-말단 융합 파트너; 글루카곤 유사 펩타이드-2(glucagon like peptide-2; GLP-2) 또는 이의 유사체; 및 상기 N-말단 융합 파트너와, 상기 GLP-2 또는 이의 유사체 사이에 링커를 포함하는 융합 폴리펩타이드를 코딩하는 뉴클레오타이드를 포함하는 발현벡터를 제조한다.First, in the step (a), N-terminal fusion partner consisting of the amino acid sequence represented by the formula (1); Glucagon like peptide-2 (GLP-2) or analogs thereof; And a nucleotide encoding a fusion polypeptide comprising a linker between the N-terminal fusion partner and the GLP-2 or an analog thereof.

상기 글루카곤 유사 펩타이드-2(GLP-2)는 33개의 아미노산으로 구성된 장 영양성 폴리펩타이드이다. 상기 GLP-2는 위의 운동성, 위산 분비, 장의 헥소오스 수송을 조절하고, 소화관 상피의 장벽 기능을 증진시키는 활성이 있는 호르몬이다. 구체적으로, 상기 GLP-2 폴리펩타이드는 서열번호 151의 아미노산 서열로 이루어질 수 있다. 상기 GLP-2는 서열번호 293으로 표시되는 염기서열에 의해 코딩될 수 있다. The glucagon-like peptide-2 (GLP-2) is an enteric nutritive polypeptide consisting of 33 amino acids. The GLP-2 is a hormone that regulates gastric motility, gastric acid secretion, intestinal hexose transport, and enhances the barrier function of the gut epithelium. Specifically, the GLP-2 polypeptide may be composed of the amino acid sequence of SEQ ID NO: 151. The GLP-2 may be encoded by a nucleotide sequence represented by SEQ ID NO: 293.

또한, GLP-2의 유사체는 상기 GLP-2과 유사한 기능을 갖는 펩타이드이다. 예를 들어, 그 활성이 유지되거나 향상되는 범위 내에서, 천연 GLP-2와 비교하여 아미노산의 치환, 첨가 및/또는 결실에 따른 변이를 갖는 펩타이드일 수 있다. In addition, analogs of GLP-2 are peptides having functions similar to the above GLP-2. For example, it may be a peptide having a variation in substitution, addition and / or deletion of amino acids as compared to native GLP-2, within the range that its activity is maintained or improved.

구체적으로, 테두글루타이드(GLP-2A2G)는 GLP-2의 이의 유사체로서 GLP-2의 2번째 알라닌이 글리신으로 치환(A2G)되어 있는 형태이다. 이와 같이 2번째 아미노산 서열이 치환됨으로써 DPP4의 절단에 내성을 지니게 되어 펩타이드의 안정성 및 효능이 증가된 것으로 확인되었다. GLP-2A2G는 희귀질환인 단장증후군(Short Bowel Syndrome), 화학 요법 유발성 설사(Chemotherapy-Induced Diarrhea) 및 장피 누공(Enterocutaneous Fistula)의 치료제로 사용될 수 있다. 구체적으로, 상기 GLP-2A2G는 서열번호 152의 아미노산 서열로 이루어질 수 있다, 상기 GLP-2A2G는 서열번호 294로 표시되는 염기서열에 의해 코딩될 수 있다.Specifically, tetuglutide (GLP-2A2G) is an analog of GLP-2, in which a second alanine of GLP-2 is substituted with glycine (A2G). As such, the substitution of the second amino acid sequence resulted in resistance to cleavage of DPP4, thereby increasing the stability and efficacy of the peptide. GLP-2A2G can be used for the treatment of rare diseases such as Short Bowel Syndrome, Chemotherapy-Induced Diarrhea and Enterocutaneous Fistula. Specifically, the GLP-2A2G may be composed of the amino acid sequence of SEQ ID NO: 152, the GLP-2A2G may be encoded by the nucleotide sequence represented by SEQ ID NO: 294.

재조합 미생물 시스템을 이용하여 목적 폴리펩타이드를 생산하는 경우, 그 타겟 물질의 물성에 따라 숙주세포 내 효소에 의해 분해될 수 있다. 또한, 목적 폴리펩타이드가 낮은 수준으로 발현될 수 있을 뿐만 아니라 부적절한 단백질 폴딩 등으로 인해 목적 단백질의 수율이 저하될 우려가 있다. When the target polypeptide is produced using a recombinant microbial system, it may be degraded by an enzyme in the host cell according to the properties of the target material. In addition, the target polypeptide may be expressed at a low level, and there is a concern that the yield of the target protein may be lowered due to improper protein folding.

상기 문제점을 해결하기 위해, 융합 파트너를 이용하고 있으나 아직도 개선되어야 할 문제점이 존재한다. 예를 들어, 종래 융합 파트너로 활용되는 MBP (maltose binding protein), 글루타티온 S-전달효소(glutathione-S-transferase), 티오레독신(thioredoxin), SUMO, 유비퀴틴 등은 각각 397, 216, 106, 101, 76 개의 아미노산을 갖는데, 비교적 저분자량의 목적 폴리펩타이드 등을 생산시 수율이 좋지 못한 문제가 있었다.In order to solve the above problem, there is a problem that a fusion partner is used but still needs to be improved. For example, MBP (maltose binding protein), glutathione S-transferase, thiorredoxin, SUMO, ubiquitin, etc., which are conventionally used as fusion partners, are 397, 216, 106, and 101, respectively. Although having 76 amino acids, there was a problem in that the yield was not good when producing a relatively low molecular weight target polypeptide.

이에 반해, 상기 N-말단 융합 파트너는 7개 내지 43개의 아미노산으로 이루어진 분자량이 작은 펩타이드이다. 이를 적용하여 GLP-2 또는 이의 유사체를 생산하는 경우 기존의 융합 파트너들을 활용한 경우보다 향상된 수율로 GLP-2 또는 이의 유사체를 수득할 수 있다. 예를 들어, 재조합 융합 폴리펩타이드에서 GLP-2의 유사체로서 테두글루타이드(GLP-2A2G)의 비율을 아래 표 1에 나타내었다. In contrast, the N-terminal fusion partner is a low molecular weight peptide consisting of 7 to 43 amino acids. When applied to produce GLP-2 or an analog thereof, GLP-2 or an analog thereof can be obtained with improved yield than when utilizing existing fusion partners. For example, the ratio of tedulglutide (GLP-2A2G) as an analog of GLP-2 in recombinant fusion polypeptides is shown in Table 1 below.

융합 파트너Fusion partner 아미노산 개수Amino acid count 분자량 (kDa)Molecular Weight (kDa) GLP-2A2G 비율 (%)*GLP-2A2G Rate (%) * MBP(Maltose binding protein)MBP (Maltose binding protein) 397397 44.244.2 77 글루타티온 S-전달효소Glutathione S-transferase 216216 23.823.8 1313 티오레독신Thioredoxin 106106 11.711.7 2121 SUMOSUMO 101101 11.111.1 2323 유비퀴틴Ubiquitin 7676 8.48.4 2828 서열번호 9, 31, 53, 75, 97 또는 119의 아미노산 서열을 포함하는 N-말단 융합 파트너N-terminal fusion partner comprising the amino acid sequence of SEQ ID NO: 9, 31, 53, 75, 97 or 119 7 - 437-43 0.8 - 4.70.8-4.7 60 - 3660-36

*링커 부분을 포함하여 계산* Calculation including linker part

표 1에 나타난 바와 같이, 종래의 융합 파트너들은 융합 폴리펩타이드에서 GLP-2A2G의 비율이 7% 내지 28%에 그치는 반면, 본 발명에 따른 융합 펩타이드가 융합된 융합 폴리펩타이드에서의 GLP-2A2G의 비율은 36% 내지 60%로 확인되었다. 따라서, 동일한 농도의 융합 폴리펩타이드로부터 얻을 수 있는 목적 GLP-2A2G의 양이 종래 융합 파트너 대비 더 높으므로 최종 생산 수율이 향상될 수 있다.As shown in Table 1, conventional fusion partners have a ratio of GLP-2A2G in the fusion polypeptide of only 7% to 28%, whereas the ratio of GLP-2A2G in the fusion polypeptide to which the fusion peptide according to the present invention is fused. Was found to be 36% to 60%. Thus, the final production yield can be improved because the amount of target GLP-2A2G that can be obtained from the same concentration of fusion polypeptide is higher than that of conventional fusion partners.

또한, 상기 융합 파트너는 융합 폴리펩타이드의 불용성 발현을 유도하여 융합 폴리펩타이드가 불용성 내포체로서 숙주세포 내로 고농도로 축적되게 할 수 있다. 따라서, 대장균(Escherichia coli) 등의 숙주세포 내에서 프로테아제 및 펩티다제에 의해 전부 혹은 일부가 분해 혹은 절단될 우려가 있는 GLP-2 또는 이의 유사체를 고수율로 수득하기 용이한 장점이 있다. In addition, the fusion partner may induce insoluble expression of the fusion polypeptide, causing the fusion polypeptide to accumulate in high concentration into the host cell as an insoluble inclusion body. Therefore, there is an advantage that it is easy to obtain GLP-2 or an analog thereof, which may be degraded or cleaved in whole or in part by proteases and peptidase in host cells such as Escherichia coli .

예를 들어, 상기 N-말단 융합파트너는 하기 일반식 2로 표시되는 아미노산 서열로 이루어진 것일 수 있다. For example, the N-terminal fusion partner may be composed of the amino acid sequence represented by the following formula (2).

[일반식 2][Formula 2]

Met-Xaa1-Ile-Arg-Pro-Leu-His-(Z)n Met-Xaa1-Ile-Arg-Pro-Leu-His- (Z) n

상기 일반식 2에서,In the general formula 2,

Xaa1은 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신, 트립토판, 아스파라긴, 세린, 트레오닌, 시스테인, 글루타민, 아르기닌, 리신, 히스티딘, 아스팔트산 또는 글루탐산이며, Xaa1 is isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine, tryptophan, asparagine, serine, threonine, cysteine, glutamine, arginine, lysine, histidine, asphalt acid or glutamic acid,

상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개 내지 36개의 아미노산이고,Z is 1 to 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345,

상기 n은 0 또는 1의 정수이다.N is an integer of 0 or 1.

또한, 상기 Xaa1은 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신 및 트립토판으로 이루어진 군으로부터 선택될 수 있다. 구체적으로, 상기 Xaa1은 이소루신(Ile, I), 아스파라긴(Asn, N), 아르기닌(Arg, R) 및 아스팔트산(Asp, D)으로 이루어진 군으로부터 선택될 수 있다. In addition, the Xaa1 may be selected from the group consisting of isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine and tryptophan. Specifically, Xaa1 may be selected from the group consisting of isoleucine (Ile, I), asparagine (Asn, N), arginine (Arg, R), and asphalt acid (Asp, D).

상기 n이 O의 정수인 경우, 상기 N-말단 융합 파트너는 7개의 아미노산으로 이루어진 것일 수 있다. 또한, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개, 2개, 3개, 4개, 5개, 6개, 7개, 8개, 9개, 10개, 11개, 12개, 13개, 14개, 15개, 16개, 17개, 18개, 19개, 20개, 21개, 22개, 23개, 24개, 25개, 26개, 27개, 28개, 29개, 30개, 31개, 32개, 33개, 34개, 35개 또는 36개의 아미노산일 수 있다. 구체적으로, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 8개, 15개, 22개, 29개 또는 36개의 아미노산일 수 있다.When n is an integer of 0, the N-terminal fusion partner may be composed of seven amino acids. In addition, when n is an integer of 1, Z is 1, 2, 3, 4, 5, 6, 7 starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345. , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 Dog, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 amino acids. Specifically, when n is an integer of 1, Z may be 8, 15, 22, 29, or 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345.

일 구체예로, 상기 일반식 2로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 8, 30, 52, 74, 96 또는 118의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 2로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 161, 183, 205, 227, 249 또는 271의 아미노산 서열로 이루어진 것일 수 있다.In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 2 may be composed of the amino acid sequence of SEQ ID NO: 8, 30, 52, 74, 96 or 118. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by Formula 2 may be composed of the amino acid sequence of SEQ ID NO: 161, 183, 205, 227, 249 or 271.

또한, 상기 Xaa1은 아스파라긴, 세린, 트레오닌, 시스테인 및 글루타민으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 2로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 9, 31, 53, 75, 97 또는 119의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 2로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 162, 184, 206, 228, 250 또는 272의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa1 may be selected from the group consisting of asparagine, serine, threonine, cysteine and glutamine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 2 may be composed of the amino acid sequence of SEQ ID NO: 9, 31, 53, 75, 97 or 119. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by Formula 2 may be composed of the amino acid sequence of SEQ ID NO: 162, 184, 206, 228, 250 or 272.

또한, 상기 Xaa1은 아르기닌, 리신 및 히스티딘으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 2로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 10, 32, 54, 76, 98 또는 120의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 2로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 163, 185, 207, 229, 251 또는 273의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa1 may be selected from the group consisting of arginine, lysine and histidine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 2 may be composed of the amino acid sequence of SEQ ID NO: 10, 32, 54, 76, 98 or 120. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by Formula 2 may be composed of the amino acid sequence of SEQ ID NO: 163, 185, 207, 229, 251 or 273.

또한, 상기 Xaa1은 아스팔트산 또는 글루탐산일 수 있다. 일 구체예로, 상기 일반식 2로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 11, 33, 55, 77, 99 또는 121의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 2로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 164, 186, 208, 230, 252 또는 274의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa1 may be asphalt acid or glutamic acid. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 2 may be composed of the amino acid sequence of SEQ ID NO: 11, 33, 55, 77, 99 or 121. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by Formula 2 may be composed of the amino acid sequence of SEQ ID NO: 164, 186, 208, 230, 252 or 274.

또한, 상기 N-말단 융합파트너는 하기 일반식 3으로 표시되는 아미노산 서열로 이루어진 것일 수 있다. In addition, the N-terminal fusion partner may be composed of the amino acid sequence represented by the following general formula (3).

[일반식 3][Formula 3]

Met-Asn-Xaa2-Arg-Pro-Leu-His-(Z)n Met-Asn-Xaa2-Arg-Pro-Leu-His- (Z) n

상기 일반식 3에서,In the general formula 3,

Xaa2는 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신, 트립토판, 아스파라긴, 세린, 트레오닌, 시스테인, 글루타민, 아르기닌, 리신, 히스티딘, 아스팔트산 또는 글루탐산이며, Xaa2 is isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine, tryptophan, asparagine, serine, threonine, cysteine, glutamine, arginine, lysine, histidine, asphalt acid or glutamic acid,

상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개 내지 36개의 아미노산이고,Z is 1 to 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345,

상기 n은 0 또는 1의 정수이다.N is an integer of 0 or 1.

구체적으로, 상기 Xaa2는 이소루신(Ile, I), 아스파라긴(Asn, N), 아르기닌(Arg, R) 및 아스팔트산(Asp, D)으로 이루어진 군으로부터 선택될 수 있다.Specifically, Xaa2 may be selected from the group consisting of isoleucine (Ile, I), asparagine (Asn, N), arginine (Arg, R), and asphalt acid (Asp, D).

상기 n이 O의 정수인 경우, 상기 N-말단 융합 파트너는 7개의 아미노산으로 이루어진 것일 수 있다. 또한, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개, 2개, 3개, 4개, 5개, 6개, 7개, 8개, 9개, 10개, 11개, 12개, 13개, 14개, 15개, 16개, 17개, 18개, 19개, 20개, 21개, 22개, 23개, 24개, 25개, 26개, 27개, 28개, 29개, 30개, 31개, 32개, 33개, 34개, 35개 또는 36개의 아미노산일 수 있다. 구체적으로, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 8개, 15개, 22개, 29개 또는 36개의 아미노산일 수 있다.When n is an integer of 0, the N-terminal fusion partner may be composed of seven amino acids. In addition, when n is an integer of 1, Z is 1, 2, 3, 4, 5, 6, 7 starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345. , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 Dog, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 amino acids. Specifically, when n is an integer of 1, Z may be 8, 15, 22, 29, or 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345.

또한, 상기 Xaa2는 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신 및 트립토판으로 이루어진 군으로부터 선택될 수 있다. In addition, the Xaa2 may be selected from the group consisting of isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine and tryptophan.

일 구체예로, 상기 일반식 3으로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 9, 31, 53, 75, 97 또는 119의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 3으로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 162, 184, 206, 228, 250 또는 272의 아미노산 서열로 이루어진 것일 수 있다.In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 3 may be composed of the amino acid sequence of SEQ ID NO: 9, 31, 53, 75, 97 or 119. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 3 may be composed of the amino acid sequence of SEQ ID NO: 162, 184, 206, 228, 250 or 272.

또한, 상기 Xaa2는 아스파라긴, 세린, 트레오닌, 시스테인 및 글루타민으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 3으로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 12, 34, 56, 78, 100 또는 122의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 3으로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 165, 187, 209, 231, 253 또는 275의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa2 may be selected from the group consisting of asparagine, serine, threonine, cysteine and glutamine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 3 may be composed of the amino acid sequence of SEQ ID NO: 12, 34, 56, 78, 100 or 122. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 3 may be composed of the amino acid sequence of SEQ ID NO: 165, 187, 209, 231, 253 or 275.

또한, 상기 Xaa2는 아르기닌, 리신 및 히스티딘으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 3으로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 13, 35, 57, 79, 101 또는 123의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 3으로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 166, 188, 210, 232, 254 또는 276의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa2 may be selected from the group consisting of arginine, lysine and histidine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 3 may be composed of the amino acid sequence of SEQ ID NO: 13, 35, 57, 79, 101 or 123. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by Formula 3 may be composed of the amino acid sequence of SEQ ID NO: 166, 188, 210, 232, 254 or 276.

또한, 상기 Xaa2는 아스팔트산 또는 글루탐산일 수 있다. 일 구체예로, 상기 일반식 3으로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 14, 36, 58, 80, 102 또는 124의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 3으로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 167, 189, 211, 233, 255 또는 277의 아미노산 서열로 이루어진 것일 수 있다.In addition, Xaa2 may be asphalt acid or glutamic acid. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 3 may be composed of the amino acid sequence of SEQ ID NO: 14, 36, 58, 80, 102 or 124. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by Formula 3 may be composed of the amino acid sequence of SEQ ID NO: 167, 189, 211, 233, 255 or 277.

또한, 상기 N-말단 융합파트너는 하기 일반식 4로 표시되는 아미노산 서열로 이루어진 것일 수 있다. In addition, the N-terminal fusion partner may be composed of the amino acid sequence represented by the general formula (4).

[일반식 4][Formula 4]

Met-Asn-Ile-Xaa3-Pro-Leu-His-(Z)n Met-Asn-Ile-Xaa3-Pro-Leu-His- (Z) n

상기 일반식 4에서,In the general formula 4,

Xaa3은 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신, 트립토판, 아스파라긴, 세린, 트레오닌, 시스테인, 글루타민, 아르기닌, 리신, 히스티딘, 아스팔트산 또는 글루탐산이며, Xaa3 is isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine, tryptophan, asparagine, serine, threonine, cysteine, glutamine, arginine, lysine, histidine, asphalt acid or glutamic acid,

상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개 내지 36개의 아미노산이고,Z is 1 to 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345,

상기 n은 0 또는 1의 정수이다.N is an integer of 0 or 1.

또한, 상기 Xaa3은 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신 및 트립토판으로 이루어진 군으로부터 선택될 수 있다. 구체적으로, 상기 Xaa3은 이소루신(Ile, I), 아스파라긴(Asn, N), 아르기닌(Arg, R) 및 아스팔트산(Asp, D)으로 이루어진 군으로부터 선택될 수 있다.In addition, the Xaa3 may be selected from the group consisting of isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine and tryptophan. Specifically, Xaa3 may be selected from the group consisting of isoleucine (Ile, I), asparagine (Asn, N), arginine (Arg, R), and asphalt acid (Asp, D).

상기 n이 O의 정수인 경우, 상기 N-말단 융합 파트너는 7개의 아미노산으로 이루어진 것일 수 있다. 또한, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개, 2개, 3개, 4개, 5개, 6개, 7개, 8개, 9개, 10개, 11개, 12개, 13개, 14개, 15개, 16개, 17개, 18개, 19개, 20개, 21개, 22개, 23개, 24개, 25개, 26개, 27개, 28개, 29개, 30개, 31개, 32개, 33개, 34개, 35개 또는 36개의 아미노산일 수 있다. 구체적으로, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 8개, 15개, 22개, 29개 또는 36개의 아미노산일 수 있다.When n is an integer of 0, the N-terminal fusion partner may be composed of seven amino acids. In addition, when n is an integer of 1, Z is 1, 2, 3, 4, 5, 6, 7 starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345. , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 Dog, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 amino acids. Specifically, when n is an integer of 1, Z may be 8, 15, 22, 29, or 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345.

일 구체예로, 상기 일반식 4로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 15, 37, 59, 81, 103 또는 125의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 4로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 168, 190, 212, 234, 256 또는 278의 아미노산 서열로 이루어진 것일 수 있다.In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 4 may be composed of the amino acid sequence of SEQ ID NO: 15, 37, 59, 81, 103 or 125. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by Formula 4 may be composed of the amino acid sequence of SEQ ID NO: 168, 190, 212, 234, 256 or 278.

또한, 상기 Xaa3은 아스파라긴, 세린, 트레오닌, 시스테인 및 글루타민으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 4로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 16, 38, 60, 82, 104 또는 126의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 4로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 169, 191, 213, 235, 257 또는 279의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa 3 may be selected from the group consisting of asparagine, serine, threonine, cysteine and glutamine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 4 may be composed of the amino acid sequence of SEQ ID NO: 16, 38, 60, 82, 104 or 126. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 4 may be composed of the amino acid sequence of SEQ ID NO: 169, 191, 213, 235, 257 or 279.

또한, 상기 Xaa3은 아르기닌, 리신 및 히스티딘으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 4로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 9, 31, 53, 75, 97 또는 119의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 4로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 162, 184, 206, 228, 250 또는 272의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa 3 may be selected from the group consisting of arginine, lysine and histidine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 4 may be composed of the amino acid sequence of SEQ ID NO: 9, 31, 53, 75, 97 or 119. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 4 may be composed of the amino acid sequence of SEQ ID NO: 162, 184, 206, 228, 250 or 272.

또한, 상기 Xaa3은 아스팔트산 또는 글루탐산일 수 있다. 일 구체예로, 상기 일반식 4로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 17, 39, 61, 83, 105 또는 127의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 4로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 170, 192, 213, 236, 258 또는 280의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa 3 may be asphalt acid or glutamic acid. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 4 may be composed of the amino acid sequence of SEQ ID NO: 17, 39, 61, 83, 105 or 127. In addition, the fusion polypeptide including the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 4 may be composed of the amino acid sequence of SEQ ID NO: 170, 192, 213, 236, 258 or 280.

또한, 상기 N-말단 융합파트너가 하기 일반식 5로 표시되는 아미노산 서열로 이루어진 것일 수 있다. In addition, the N-terminal fusion partner may be composed of the amino acid sequence represented by the general formula (5).

[일반식 5][Formula 5]

Met-Asn-Ile-Arg-Xaa4-Leu-His-(Z)n Met-Asn-Ile-Arg-Xaa4-Leu-His- (Z) n

상기 일반식 5에서,In the general formula 5,

Xaa4는 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신, 트립토판, 아스파라긴, 세린, 트레오닌, 시스테인, 글루타민, 아르기닌, 리신, 히스티딘, 아스팔트산 또는 글루탐산이며, Xaa4 is isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine, tryptophan, asparagine, serine, threonine, cysteine, glutamine, arginine, lysine, histidine, asphalt acid or glutamic acid,

상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개 내지 36개의 아미노산이고,Z is 1 to 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345,

상기 n은 0 또는 1의 정수이다.N is an integer of 0 or 1.

또한, 상기 Xaa4는 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신 및 트립토판으로 이루어진 군으로부터 선택될 수 있다. 구체적으로, 상기 Xaa4는 이소루신(Ile, I), 아스파라긴(Asn, N), 아르기닌(Arg, R) 및 아스팔트산(Asp, D)으로 이루어진 군으로부터 선택될 수 있다. In addition, the Xaa4 may be selected from the group consisting of isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine and tryptophan. Specifically, Xaa4 may be selected from the group consisting of isoleucine (Ile, I), asparagine (Asn, N), arginine (Arg, R), and asphalt acid (Asp, D).

상기 n이 O의 정수인 경우, 상기 N-말단 융합 파트너는 7개의 아미노산으로 이루어진 것일 수 있다. 또한, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개, 2개, 3개, 4개, 5개, 6개, 7개, 8개, 9개, 10개, 11개, 12개, 13개, 14개, 15개, 16개, 17개, 18개, 19개, 20개, 21개, 22개, 23개, 24개, 25개, 26개, 27개, 28개, 29개, 30개, 31개, 32개, 33개, 34개, 35개 또는 36개의 아미노산일 수 있다. 구체적으로, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 8개, 15개, 22개, 29개 또는 36개의 아미노산일 수 있다.When n is an integer of 0, the N-terminal fusion partner may be composed of seven amino acids. In addition, when n is an integer of 1, Z is 1, 2, 3, 4, 5, 6, 7 starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345. , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 Dog, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 amino acids. Specifically, when n is an integer of 1, Z may be 8, 15, 22, 29, or 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345.

일 구체예로, 상기 일반식 5로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 8, 40, 62, 84, 106 또는 128의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 5로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 171, 193, 215, 237, 259 또는 281의 아미노산 서열로 이루어진 것일 수 있다.In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 5 may be composed of the amino acid sequence of SEQ ID NO: 8, 40, 62, 84, 106 or 128. In addition, the fusion polypeptide including the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 5 may be composed of the amino acid sequence of SEQ ID NO: 171, 193, 215, 237, 259 or 281.

또한, 상기 Xaa4는 아스파라긴, 세린, 트레오닌, 시스테인 및 글루타민으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 5로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 19, 41, 63, 85, 107 또는 129의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 5로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 172, 194, 216, 238, 260 또는 282의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa4 may be selected from the group consisting of asparagine, serine, threonine, cysteine and glutamine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 5 may be composed of the amino acid sequence of SEQ ID NO: 19, 41, 63, 85, 107 or 129. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 5 may be composed of the amino acid sequence of SEQ ID NO: 172, 194, 216, 238, 260 or 282.

또한, 상기 Xaa4는 아르기닌, 리신 및 히스티딘으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 5로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 20, 42, 64, 86, 108 또는 130의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 5로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 173, 195, 217, 239, 261 또는 283의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa4 may be selected from the group consisting of arginine, lysine and histidine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 5 may be composed of the amino acid sequence of SEQ ID NO: 20, 42, 64, 86, 108 or 130. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 5 may be composed of the amino acid sequence of SEQ ID NO: 173, 195, 217, 239, 261 or 283.

또한, 상기 Xaa4는 아스팔트산 또는 글루탐산일 수 있다. 일 구체예로, 상기 일반식 5로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 21, 43, 65, 87, 190 또는 131의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 5로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 174, 196, 218, 240, 262 또는 284의 아미노산 서열로 이루어진 것일 수 있다.In addition, Xaa4 may be asphalt acid or glutamic acid. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 5 may be composed of the amino acid sequence of SEQ ID NO: 21, 43, 65, 87, 190 or 131. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 5 may be composed of the amino acid sequence of SEQ ID NO: 174, 196, 218, 240, 262 or 284.

또한, 상기 N-말단 융합파트너는 하기 일반식 6으로 표시되는 아미노산 서열로 이루어진 것일 수 있다.In addition, the N-terminal fusion partner may be composed of the amino acid sequence represented by the following formula (6).

[일반식 6][Formula 6]

Met-Asn-Ile-Arg-Pro-Xaa5-His-(Z)n Met-Asn-Ile-Arg-Pro-Xaa5-His- (Z) n

상기 일반식 6에서, In the general formula 6,

Xaa5는 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신, 트립토판, 아스파라긴, 세린, 트레오닌, 시스테인, 글루타민, 아르기닌, 리신, 히스티딘, 아스팔트산 또는 글루탐산이며, Xaa5 is isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine, tryptophan, asparagine, serine, threonine, cysteine, glutamine, arginine, lysine, histidine, asphalt acid or glutamic acid,

상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개 내지 36개의 아미노산이고,Z is 1 to 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345,

상기 n은 0 또는 1의 정수이다.N is an integer of 0 or 1.

또한, 상기 Xaa5는 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신 및 트립토판으로 이루어진 군으로부터 선택될 수 있다. 구체적으로, 상기 Xaa5는 이소루신(Ile, I), 아스파라긴(Asn, N), 아르기닌(Arg, R) 및 아스팔트산(Asp, D)으로 이루어진 군으로부터 선택될 수 있다. In addition, the Xaa5 may be selected from the group consisting of isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine and tryptophan. Specifically, Xaa5 may be selected from the group consisting of isoleucine (Ile, I), asparagine (Asn, N), arginine (Arg, R), and asphalt acid (Asp, D).

상기 n이 O의 정수인 경우, 상기 N-말단 융합 파트너는 7개의 아미노산으로 이루어진 것일 수 있다. 또한, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개, 2개, 3개, 4개, 5개, 6개, 7개, 8개, 9개, 10개, 11개, 12개, 13개, 14개, 15개, 16개, 17개, 18개, 19개, 20개, 21개, 22개, 23개, 24개, 25개, 26개, 27개, 28개, 29개, 30개, 31개, 32개, 33개, 34개, 35개 또는 36개의 아미노산일 수 있다. 구체적으로, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 8개, 15개, 22개, 29개 또는 36개의 아미노산일 수 있다.When n is an integer of 0, the N-terminal fusion partner may be composed of seven amino acids. In addition, when n is an integer of 1, Z is 1, 2, 3, 4, 5, 6, 7 starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345. , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 Dog, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 amino acids. Specifically, when n is an integer of 1, Z may be 8, 15, 22, 29, or 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345.

일 구체예로, 상기 일반식 6으로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 22, 44, 66, 88, 110 또는 132의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 6으로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 175, 197, 219, 241, 263 또는 285의 아미노산 서열로 이루어진 것일 수 있다.In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 6 may be composed of the amino acid sequence of SEQ ID NO: 22, 44, 66, 88, 110 or 132. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by Formula 6 may be composed of the amino acid sequence of SEQ ID NO: 175, 197, 219, 241, 263 or 285.

또한, 상기 Xaa5는 아스파라긴, 세린, 트레오닌, 시스테인 및 글루타민으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 6으로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 23, 45, 67, 89, 111 또는 135의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 6으로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 176, 198, 220, 242, 264 또는 286의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa5 may be selected from the group consisting of asparagine, serine, threonine, cysteine and glutamine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 6 may be composed of the amino acid sequence of SEQ ID NO: 23, 45, 67, 89, 111 or 135. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by Formula 6 may be composed of the amino acid sequence of SEQ ID NO: 176, 198, 220, 242, 264 or 286.

또한, 상기 Xaa5는 아르기닌, 리신 및 히스티딘으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 6으로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 24, 46, 68, 90, 112 또는 134의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 6으로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 177, 199, 221, 243, 265 또는 287의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa5 may be selected from the group consisting of arginine, lysine and histidine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 6 may be composed of the amino acid sequence of SEQ ID NO: 24, 46, 68, 90, 112 or 134. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by Formula 6 may be composed of the amino acid sequence of SEQ ID NO: 177, 199, 221, 243, 265 or 287.

또한, 상기 Xaa5는 아스팔트산 또는 글루탐산일 수 있다. 일 구체예로, 상기 일반식 6으로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 25, 47, 69, 91, 113 또는 135의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 6으로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 178, 200, 222, 244, 266 또는 288의 아미노산 서열로 이루어진 것일 수 있다.In addition, Xaa5 may be asphalt acid or glutamic acid. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 6 may be composed of the amino acid sequence of SEQ ID NO: 25, 47, 69, 91, 113 or 135. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by Formula 6 may be composed of the amino acid sequence of SEQ ID NO: 178, 200, 222, 244, 266 or 288.

또한, 상기 N-말단 융합파트너는 하기 일반식 7로 표시되는 아미노산 서열로 이루어진 것일 수 있다. In addition, the N-terminal fusion partner may be composed of the amino acid sequence represented by the following general formula (7).

[일반식 7][Formula 7]

Met-Asn-Ile-Arg-Pro-Leu-Xaa6-(Z)n Met-Asn-Ile-Arg-Pro-Leu-Xaa6- (Z) n

상기 일반식 7에서,In the general formula 7,

Xaa6은 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신, 트립토판, 아스파라긴, 세린, 트레오닌, 시스테인, 글루타민, 아르기닌, 리신, 히스티딘, 아스팔트산 또는 글루탐산이며, Xaa6 is isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine, tryptophan, asparagine, serine, threonine, cysteine, glutamine, arginine, lysine, histidine, asphalt acid or glutamic acid,

상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개 내지 36개의 아미노산이고,Z is 1 to 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345,

상기 n은 0 또는 1의 정수이다.N is an integer of 0 or 1.

또한, 상기 Xaa6은 이소루신, 글리신, 알라닌, 프롤린, 발린, 루신, 메티오닌, 페닐알라닌, 티로신 및 트립토판으로 이루어진 군으로부터 선택될 수 있다. 구체적으로, 상기 Xaa6은 이소루신(Ile, I), 아스파라긴(Asn, N), 아르기닌(Arg, R) 및 아스팔트산(Asp, D)으로 이루어진 군으로부터 선택될 수 있다.In addition, the Xaa6 may be selected from the group consisting of isoleucine, glycine, alanine, proline, valine, leucine, methionine, phenylalanine, tyrosine and tryptophan. Specifically, Xaa6 may be selected from the group consisting of isoleucine (Ile, I), asparagine (Asn, N), arginine (Arg, R), and asphalt acid (Asp, D).

상기 n이 O의 정수인 경우, 상기 N-말단 융합 파트너는 7개의 아미노산으로 이루어진 것일 수 있다. 또한, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 1개, 2개, 3개, 4개, 5개, 6개, 7개, 8개, 9개, 10개, 11개, 12개, 13개, 14개, 15개, 16개, 17개, 18개, 19개, 20개, 21개, 22개, 23개, 24개, 25개, 26개, 27개, 28개, 29개, 30개, 31개, 32개, 33개, 34개, 35개 또는 36개의 아미노산일 수 있다. 구체적으로, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 8개, 15개, 22개, 29개 또는 36개의 아미노산일 수 있다.When n is an integer of 0, the N-terminal fusion partner may be composed of seven amino acids. In addition, when n is an integer of 1, Z is 1, 2, 3, 4, 5, 6, 7 starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345. , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 Dog, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 amino acids. Specifically, when n is an integer of 1, Z may be 8, 15, 22, 29, or 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345.

일 구체예로, 상기 일반식 7로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 26, 48, 70, 92, 114 또는 136의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 7로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 179, 201, 223, 245, 267 또는 289의 아미노산 서열로 이루어진 것일 수 있다.In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 7 may be composed of the amino acid sequence of SEQ ID NO: 26, 48, 70, 92, 114 or 136. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 7 may be composed of the amino acid sequence of SEQ ID NO: 179, 201, 223, 245, 267 or 289.

또한, 상기 Xaa6은 아스파라긴, 세린, 트레오닌, 시스테인 및 글루타민으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 7로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 27, 49, 71, 93, 115 또는 137의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 7로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 180, 202, 224, 246, 268 또는 290의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa6 may be selected from the group consisting of asparagine, serine, threonine, cysteine and glutamine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 7 may be composed of the amino acid sequence of SEQ ID NO: 27, 49, 71, 93, 115 or 137. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 7 may be composed of the amino acid sequence of SEQ ID NO: 180, 202, 224, 246, 268 or 290.

또한, 상기 Xaa6은 아르기닌, 리신 및 히스티딘으로 이루어진 군으로부터 선택될 수 있다. 일 구체예로, 상기 일반식 7로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 28, 50, 72, 94, 116 또는 138의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 7로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 181, 203, 225, 247, 269 또는 291의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa6 may be selected from the group consisting of arginine, lysine and histidine. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 7 may be composed of the amino acid sequence of SEQ ID NO: 28, 50, 72, 94, 116 or 138. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 7 may be composed of the amino acid sequence of SEQ ID NO: 181, 203, 225, 247, 269 or 291.

또한, 상기 Xaa6은 아스팔트산 또는 글루탐산일 수 있다. 일 구체예로, 상기 일반식 7로 표시되는 아미노산 서열로 이루어진 N-말단 융합파트너는 서열번호 29, 51, 73, 95, 117 또는 139의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 일반식 7로 표시되는 아미노산 서열을 포함하는 N-말단 융합 파트너를 포함하는 융합 폴리펩타이드는 서열번호 182, 204, 226, 248, 270 또는 292의 아미노산 서열로 이루어진 것일 수 있다.In addition, the Xaa6 may be asphalt acid or glutamic acid. In one embodiment, the N-terminal fusion partner consisting of the amino acid sequence represented by the general formula 7 may be composed of the amino acid sequence of SEQ ID NO: 29, 51, 73, 95, 117 or 139. In addition, the fusion polypeptide comprising the N-terminal fusion partner comprising the amino acid sequence represented by the general formula 7 may be composed of the amino acid sequence of SEQ ID NO: 182, 204, 226, 248, 270 or 292.

상기 일반식 1 내지 7에 있어서, 상기 n이 O의 정수인 경우, 상기 N-말단 융합 파트너는 7개의 아미노산으로 이루어진 것일 수 있으며, 본 발명에서 7개의 아미노산으로 이루어진 N-말단 융합 파트너를 "PG07"로 명명하였다. 또한, 상기 n이 1의 정수인 경우, 상기 Z는 서열번호 345로 표시되는 아미노산 서열의 1번 위치의 아미노산에서부터 시작하는 8개, 15개, 22개, 29개 또는 36개의 아미노산일 수 있다. 이 경우, 상기 N-말단 융합 파트너는 15개, 22개, 29개, 36개 또는 43개의 아미노산으로 이루어진 것일 수 있으며, 본 발명에서 15개, 22개, 29개, 36개 또는 43개의 아미노산으로 이루어진 N-말단 융합 파트너를 각각 순서대로"PG15", "PG22", "PG29", "PG36", "PG43"으로 명명하였다. In Formulas 1 to 7, wherein n is an integer of 0, the N-terminal fusion partner may be composed of seven amino acids, in the present invention the N-terminal fusion partner consisting of seven amino acids "PG07" Named. In addition, when n is an integer of 1, Z may be 8, 15, 22, 29, or 36 amino acids starting from the amino acid at position 1 of the amino acid sequence represented by SEQ ID NO: 345. In this case, the N-terminal fusion partner may be composed of 15, 22, 29, 36 or 43 amino acids, in the present invention 15, 22, 29, 36 or 43 amino acids The resulting N-terminal fusion partners were named "PG15", "PG22", "PG29", "PG36", and "PG43" in order.

상기 N-말단 융합 파트너는 샤페로닌 10(chaperone 10, GroES proteon)의 N-말단 유도체일 수 있다. 또한, 상기 N-말단 융합 파트너는 7개 내지 43개의 아미노산을 갖는 펩타이드로서, 서열번호 119의 N-말단에서 C-말단으로 7개 내지 43개의 연속적인 아미노산으로 이루어진 것일 수 있다. The N-terminal fusion partner may be an N-terminal derivative of chaperone 10 (GroES proteon). In addition, the N-terminal fusion partner is a peptide having 7 to 43 amino acids, it may be composed of 7 to 43 consecutive amino acids from the N- terminal to the C- terminal of SEQ ID NO: 119.

구체적으로, 상기 N-말단 융합 파트너는 서열번호 8 내지 139 중 어느 하나의 아미노산 서열로 이루어진 것일 수 있다. 상기 융합 파트너의 아미노산 갯수는 목적 폴리펩타이드의 특성에 따라 조절될 수 있다. 예를 들어, 7개, 8개, 9개, 10개, 13개, 15개, 17개, 22개, 25개, 27개, 29개, 30개, 33개, 38개, 40개, 43개 등일 수 있다. 일 구체예로서, 상기 N-말단 융합 파트너는 서열번호 9, 31, 53, 75, 97 또는 119로 표시되는 아미노산 서열로 이루어진 것일 수 있다.Specifically, the N-terminal fusion partner may be composed of any one amino acid sequence of SEQ ID NO: 8 to 139. The number of amino acids of the fusion partner can be adjusted according to the properties of the polypeptide of interest. For example, 7, 8, 9, 10, 13, 15, 17, 22, 25, 27, 29, 30, 33, 38, 40, 43 Dogs and the like. In one embodiment, the N-terminal fusion partner may be composed of the amino acid sequence represented by SEQ ID NO: 9, 31, 53, 75, 97 or 119.

한편, 상기 융합 폴리펩타이드는 융합 파트너와 GLP-2 또는 이의 유사체 사이에 링커를 포함할 수 있으며, 상기 링커는 친화성 태그를 포함할 수 있다.Meanwhile, the fusion polypeptide may comprise a linker between the fusion partner and GLP-2 or an analog thereof, and the linker may comprise an affinity tag.

본원에서 용어 "친화성 태그"는 재조합 융합 폴리펩타타이드 또는 이를 코딩하는 핵산에 도입될 수 있는 펩타이드 또는 핵산 서열로서 다양한 목적으로 사용될 수 있으며, 예를 들어 GLP-2 또는 이의 유사체의 정제 효율을 높이기 위한 것일 수 있다. 본 발명에서 사용될 수 있는 친화성 태그는 당 업계에 공지된 임의의 적합한 물질을 원하는 바에 따라 사용할 수 있다. 예를 들어, 본 발명에 사용되는 친화성 태그는 폴리히스티딘 태그(H6 또는 H10; 서열번호 140 또는 141), 폴리라이신 태그(K6 또는 K10; 서열번호 142 또는 143), 또는 폴리아르기닌 태그(R6 또는 R10; 서열번호 144 또는 145)일 수 있다.As used herein, the term “affinity tag” can be used for a variety of purposes as a peptide or nucleic acid sequence that can be introduced into a recombinant fusion polypeptide or a nucleic acid encoding the same, for example to enhance the purification efficiency of GLP-2 or an analog thereof. It may be for. Affinity tags that can be used in the present invention can be used as desired with any suitable material known in the art. For example, the affinity tag used in the present invention may be a polyhistidine tag (H6 or H10; SEQ ID NO: 140 or 141), a polylysine tag (K6 or K10; SEQ ID NO: 142 or 143), or a polyarginine tag (R6 or R10; SEQ ID NO: 144 or 145).

또한, 상기 링커는 프로테아제 인식서열을 포함할 수 있다. 프로테아제란, 특정 아미노산 서열을 인식하여, 인식한 서열 내의 펩타이드 결합이나 그 서열의 마지막 아미노산과 융합된 폴리펩타이드의 첫번째 아미노산과의 펩타이드 결합을 절단하는 단백질 분해효소이다. 본 발명에 따른 융합 폴리펩타이드는 프로테아제 인식서열을 갖는 링커를 포함함으로써, 최종 단계에서 GLP-2 또는 이의 유사체 정제시 절단효소 인식서열이 포함된 아미노 말단(친화성 태그를 사용한 경우에는 친화성 태그도 포함)과 GLP-2 또는 이의 유사체의 N-말단을 분리시켜 GLP-2 또는 이의 유사체를 회수할 수 있다.In addition, the linker may comprise a protease recognition sequence. A protease is a protease that recognizes a specific amino acid sequence and cleaves a peptide bond in the recognized sequence or a peptide bond with the first amino acid of the polypeptide fused with the last amino acid of the sequence. The fusion polypeptide according to the present invention comprises a linker having a protease recognition sequence, so that, in the final step, an amino terminus (affinity tag in the case of using an affinity tag) containing a cleavage enzyme recognition sequence in purifying GLP-2 or an analog thereof And the N-terminus of GLP-2 or an analog thereof, to recover GLP-2 or an analog thereof.

구체적으로, 상기 프로테아제 인식서열은 담배 식각 바이러스 프로테아제 인식서열, 엔테로키나아제 인식서열, 유비퀴틴 가수분해효소 인식서열, 인자 Xa 인식서열, 퓨린 인식서열 및 이들의 조합으로 이루어진 군으로부터 선택될 수 있다. Specifically, the protease recognition sequence may be selected from the group consisting of tobacco etching virus protease recognition sequence, enterokinase recognition sequence, ubiquitin hydrolase recognition sequence, factor Xa recognition sequence, purine recognition sequence, and combinations thereof.

구체적으로, 상기 프로테아제 인식서열은 담배 식각 바이러스 프로테아제, 엔테로키나아제, 유비퀴틴 가수분해효소, 인자 Xa, 퓨린 및 이들의 조합으로 이루어진 군으로부터 선택되는 인식서열일 수 있다. 예를 들어, 상기 프로테아제 인식서열은 서열번호 146 내지 150의 아미노산 서열 중 어느 하나를 포함할 수 있다. 또한, 상기 융합파트너, 링커 및 GLP-2 또는 이의 유사체를 포함하는 신규한 융합 폴리펩타이드는 서열번호 161 내지 292의 아미노산 서열 중 어느 하나의 아미노산 서열로 이루어진 것일 수 있다. Specifically, the protease recognition sequence may be a recognition sequence selected from the group consisting of tobacco etching virus protease, enterokinase, ubiquitin hydrolase, factor Xa, purine, and combinations thereof. For example, the protease recognition sequence may include any one of the amino acid sequences of SEQ ID NOs: 146 to 150. In addition, the novel fusion polypeptide comprising the fusion partner, linker and GLP-2 or an analog thereof may be composed of any one amino acid sequence of the amino acid sequence of SEQ ID NO: 161 to 292.

본 발명의 다른 측면은, 전술한 융합 폴리펩타이드를 코딩하는 뉴클레오타이드를 제공할 수 있고, 예를 들어, 서열번호 161 내지 292의 아미노산 서열 중 어느 하나를 코딩할 수 있으며, 상기 뉴클레오타이드는 서열번호 296 내지 서열번호 301 중 선택되는 어느 하나의 염기서열로 이루어진 것일 수 있다.Another aspect of the present invention may provide a nucleotide encoding the aforementioned fusion polypeptide, for example, may encode any one of the amino acid sequences of SEQ ID NOs: 161 to 292, wherein the nucleotides are represented by SEQ ID NOs: 296 to It may be composed of any one nucleotide sequence selected from SEQ ID NO: 301.

상기 (b) 단계에서는, (a) 단계에서 제조한 융합 폴리펩타이드를 코딩하는 뉴클레오타이드를 포함하는 발현벡터를 숙주세포에 형질도입 시킨다. In step (b), the host cell is transduced with an expression vector comprising a nucleotide encoding the fusion polypeptide prepared in step (a).

본 발명에서 사용된 용어 "벡터"는 숙주세포에 도입되어 숙주세포 유전체 내로 재조합 및 삽입될 수 있다. 또는, 상기 벡터는 에피좀으로서 자발적으로 복제될 수 있는 뉴클레오타이드 서열을 포함하는 핵산 수단을 의미한다. 상기 벡터는 선형 핵산, 플라스미드, 파지미드, 코스미드, RNA 벡터, 바이러스 벡터 및 이의 유사체들을 포함할 수 있다. 바이러스 벡터의 예로는 레트로바이러스, 아데노바이러스, 및 아데노-관련 바이러스를 포함하나 이에 제한되지 않는다. 또한, 상기 플라스미드는 항생제 내성 유전자와 같은 선별 마커를 포함할 수 있고, 플라스미드를 유지하는 숙주세포는 선택적인 조건하에서 배양될 수 있다. As used herein, the term “vector” may be introduced into a host cell to be recombined and inserted into the host cell genome. Alternatively, the vector refers to a nucleic acid means comprising a nucleotide sequence capable of spontaneously replicating as an episome. The vector may include linear nucleic acids, plasmids, phagemids, cosmids, RNA vectors, viral vectors and analogs thereof. Examples of viral vectors include, but are not limited to, retroviruses, adenoviruses, and adeno-associated viruses. In addition, the plasmid may comprise a selection marker, such as an antibiotic resistance gene, and the host cell holding the plasmid may be cultured under selective conditions.

본 발명에서 사용된 용어 "숙주세포"는 재조합 발현벡터가 도입될 수 있는 원핵세포 또는 진핵세포를 나타낸다. The term "host cell" as used herein refers to prokaryotic or eukaryotic cells into which a recombinant expression vector can be introduced.

본 발명에서 사용된 용어, "형질도입"은, 당업계에 공지된 기술을 사용하여 세포 내로 핵산(예를 들어, 벡터)을 도입하는 것을 의미한다. As used herein, the term “transduction” means the introduction of nucleic acids (eg, vectors) into cells using techniques known in the art.

상기 숙주세포는, 본 발명에 따른 융합 폴리펩타이드를 코딩하는 뉴클레오타이드가 포함되도록 형질전환되어, GLP-2 또는 이의 유사체의 발현 및/또는 분비에 이용될 수 있다. 본 발명에 사용될 수 있는 바람직한 숙주세포는 대장균 세포, 불사의 하이브리도마 세포, NS/0 골수종 세포, 293 세포, 중국 햄스터 난소 세포(CHO cell), HeLa 세포, 인간 양수 유래 세포(CapT cell) 또는 COS 세포를 포함한다. 예를 들어, 본 발명에서 융합 폴리펩타이드를 발현시키는데 사용된 숙주 균주는 대장균 BL21(DE3)이며, 상기 유전자 및 이들의 사용 방법은 당업계에 공지되어 있다.The host cell may be transformed to include a nucleotide encoding the fusion polypeptide according to the present invention and used for expression and / or secretion of GLP-2 or an analog thereof. Preferred host cells that can be used in the present invention are E. coli cells, immortal hybridoma cells, NS / 0 myeloma cells, 293 cells, Chinese hamster ovary cells (CHO cells), HeLa cells, human amniotic fluid-derived cells (CapT cells) or COS cells. For example, the host strain used to express the fusion polypeptide in the present invention is E. coli BL21 (DE3), and the genes and methods of their use are known in the art.

상기 (c) 단계에서는, 본 발명에 따른 융합 폴리펩타이드를 코딩하는 뉴클레오타이드를 갖는 발현벡터를 포함하는 숙주세포를 배양한다.In the step (c), the host cell comprising an expression vector having a nucleotide encoding the fusion polypeptide according to the present invention is cultured.

이때, 상기 숙주세포는 임의의 발효 방식으로 배양될 수 있다, 예를 들어, 회분식, 유가식, 반연속식 및 연속식 발효 방식이 이용될 수 있다. 실시예에서, 발효 배지는 복합 배지 혹은 제한 배지로부터 선택될 수 있다. 특정 실시예에서, 제한 배지가 선택된다. 제한 배지는 낮은 수준의 아미노산, 티아민과 같은 비타민 또는 다른 성분들로 보충될 수 있다. 본 발명의 방법에 유용한 배양 절차 및 무기염 배지의 상세한 설명은 문헌(Riesenberg, Schulz et al. 1991)에 기재되어 있다.At this time, the host cell may be cultured by any fermentation method, for example, batch, fed-batch, semi-continuous and continuous fermentation method may be used. In an embodiment, the fermentation medium may be selected from combination media or restriction media. In certain embodiments, restriction media is selected. Restriction media may be supplemented with low levels of amino acids, vitamins such as thiamine or other ingredients. Detailed descriptions of culture procedures and inorganic salt media useful in the methods of the present invention are described in Riesenberg, Schulz et al. 1991.

예를 들어, 융합 폴리펩타이드의 생산은 발효기 배양에서 달성될 수 있다. 예를 들어, 2 L의 제한 배지를 함유하는 발효기에서 37℃의 온도에서 배양하고, 염산이나 암모니아 첨가를 통해 pH 6.8로 유지할 수 있다. 용존 산소는 교반 속도 및 발효기 내로 공기 유속(air flow rate) 증가, 또는 필요에 따라 순수산소 주입을 통해 과량으로 유지할 수 있다. 발효기 내의 세포를 고농도로 배양하기 위해 세포 배양 동안 포도당 혹은 글리세롤이 포함된 주입 용액(feeding solution)을 배양액에 전달할 수 있다. For example, production of fusion polypeptides can be accomplished in fermentor culture. For example, it can be incubated at a temperature of 37 ° C. in a fermentor containing 2 L of restriction medium and maintained at pH 6.8 through addition of hydrochloric acid or ammonia. Dissolved oxygen can be maintained in excess by increasing the stirring rate and air flow rate into the fermentor, or via pure oxygen injection as needed. In order to cultivate the cells in the fermentor at a high concentration, a feeding solution containing glucose or glycerol may be delivered to the culture during cell culture.

또한, 상기 조건을 유지하다가, 유도를 위한 목표 배양액의 광학 밀도(optical density), 예를 들어, 600 nm 파장에서 특정 값의 광학 밀도(A600)에 도달하면, IPTG를 첨가하여 융합 폴리펩타이드의 발현이 개시될 수 있다. 유도 시 세포의 광학 밀도, IPTG 농도, pH, 온도, 용존 산소 수준, 각각을 변화시켜 최적의 발현 조건을 결정할 수 있다. 또한, 유도 시 세포의 광학 밀도는 A600 30 내지 300의 범위에서 변화시킬 수 있다. IPTG 농도는 0.01 mM 내지 1.0 mM 범위로, pH는 5.5 내지 7.5 범위로, 온도는 15℃ 내지 37℃ 범위로, 그리고 공기 유속은 1 vvm(분당 배지 리터당 공기 리터) 내지 5 vvm 범위로 변화시킬 수 있다. 유도 후 4시간 내지 48시간 후에, 발효기로부터의 배양액을 원심분리하여 세포를 수거하고, 세포 펠렛은 -80℃ 온도에서 냉동할 수 있다. 배양액 시료는 재조합 융합 폴리펩타이드 발현 정도 분석을 위해 SDS-PAGE 등의 방법으로 분석할 수 있다.In addition, when the above conditions are maintained and the optical density of the target culture for induction is reached, for example, at a specific value of optical density (A600) at a wavelength of 600 nm, IPTG is added to express the fusion polypeptide. This may be disclosed. Optimal expression conditions can be determined by varying the optical density, IPTG concentration, pH, temperature, dissolved oxygen level, of each cell upon induction. In addition, the optical density of cells upon induction can be varied in the range of A600 30 to 300. The IPTG concentration can vary from 0.01 mM to 1.0 mM, the pH range from 5.5 to 7.5, the temperature range from 15 ° C. to 37 ° C., and the air flow rate from 1 vvm (liters of air per liter of medium per minute) to 5 vvm. have. After 4 to 48 hours after induction, the cells from the fermentor are centrifuged to harvest the cells and the cell pellet can be frozen at -80 ° C. The culture sample may be analyzed by SDS-PAGE or the like to analyze the expression level of the recombinant fusion polypeptide.

한편, 숙주세포 배양은 15℃ 내지 40℃의 온도 및 약 5.5 내지 약 7.5의 pH 조건에서 행해질 수 있다. Lac 계열 프로모터를 가진 발현 구조물이 사용될 때, 발현은 IPTG를 약 0.01 mM 내지 약 1.0 mM의 최종 농도로 배양물에 첨가하여 유도할 수 있다. On the other hand, the host cell culture may be carried out at a temperature of 15 ℃ to 40 ℃ and pH conditions of about 5.5 to about 7.5. When expression constructs with Lac family promoters are used, expression can be induced by adding IPTG to the culture at a final concentration of about 0.01 mM to about 1.0 mM.

유도제를 첨가한 후, 배양액은 일정 기간, 예를 들어, 약 12시간 동안 배양할 수 있는데, 이 기간에 재조합 단백질이 발현된다. 유도제를 첨가한 후, 배양액은 약 4시간 내지 48시간 동안 배양할 수 있다After addition of the inducing agent, the culture may be incubated for a period of time, for example about 12 hours, during which the recombinant protein is expressed. After addition of the inducing agent, the culture may be incubated for about 4 to 48 hours.

세포 배양액은 원심분리하여 세포가 존재하지 않는 배지(상등액)를 제거하고 세포를 회수할 수 있다. 예를 들어, 세포배양액은 12,000 rpm 조건에서 30분간(4℃) 원심분리하고 상등액을 제거하여 불용성 분획을 얻을 수 있다. 원심분리에 의해 얻은 불용성 분획에 불용성 내포체 형태로 존재하는 재조합 융합 폴리펩타이드의 가용화를 위해 불용성 분획을 요소나 염산구아니딘과 같은 카오트로픽제(chaotropic agent)가 포함된 완충액으로 재현탁할 수 있다. 실시예에서, 세포는 고압 기계적 세포 파쇄 장치(예를 들어, 마이크로플루다이저(Microfluidizer))를 사용하여 파괴한다. 재현탁된 세포는 예를 들어, 초음파 처리를 사용하여 파괴할 수 있다. The cell culture can be centrifuged to remove the medium without the cells (supernatant) and recover the cells. For example, the cell culture solution may be centrifuged at 12,000 rpm for 30 minutes (4 ° C.) and the supernatant removed to obtain an insoluble fraction. Insoluble fractions can be resuspended in buffer containing chaotropic agents such as urea or guanidine hydrochloride for solubilization of recombinant fusion polypeptides present in the form of insoluble inclusion bodies in the insoluble fraction obtained by centrifugation. In an embodiment, the cells are disrupted using a high pressure mechanical cell disruption device (eg, Microfluidizer). Resuspended cells can be disrupted using, for example, sonication.

당업계에 공지된, 세포를 용해시키는데 적합한 임의의 방법을 이용하여 세포 내 축적된 내포체들을 회수할 수 있다. 예를 들어, 실시양태에서, 화학적 및/또는 효소적 세포 용해 시약, 예를 들어, 세포벽 용해 효소(lysozyme) 및 EDTA가 사용될 수 있다. Any method known in the art that is suitable for lysing the cells can be used to recover the accumulated inclusions in the cells. For example, in embodiments, chemical and / or enzymatic cell lysis reagents such as cell wall lysozymes and EDTA can be used.

상기 (d) 단계에서는, 상기 (c)단계에서 배양한 숙주세포에서 발현된 융합 폴리펩타이드를 정제한다. In step (d), the fusion polypeptide expressed in the host cell cultured in step (c) is purified.

이때, 불용성 분획에는 불용성 내포체 형태로 발현된 융합 폴리펩타이드가 주로 존재한다. 불용성 분획에 존재하는 내포체의 가용화는 카오트로픽제가 포함된 변성 조건하에서 수행할 수 있다. 내포체 가용화 조건은, 카오트로픽제가 포함된 완충액의 사용을 포함할 수 있고, 내포체 가용화 완충액은 카오트로픽제로 요소 또는 염산구아니딘, 인산나트륨 또는 트리스 완충액 및 염화나트륨을 포함할 수 있다. 또한, 친화성 크로마토그래피를 고정화된 금속 친화성 크로마토그래피(IMAC)에 의해 수행하는 경우, 내포체 가용화 완충액은 이미다졸을 포함할 수 있다. 실시예에서, 내포체 가용화 완충액은 4 M 내지 10 M의 요소 또는 3 M 내지 8 M의 염산구아니딘을 포함할 수 있다. 또한, 내포체 가용화 완충액은 5 mM 내지 100 mM 인산나트륨 또는 트리스(pH 7 내지 9)를 포함할 수 있다. 내포체 가용화 완충액은 0 M 내지 1 M 염화나트륨을 포함할 수 있다. 또한, IMAC을 위한 내포체 가용화 완충액은 0 mM 내지 50 mM의 이미다졸을 포함할 수 있다. 이때, 내포체 가용화 완충액은, 8 M 요소, 20 mM 트리스, 500 mM 염화나트륨, 50 mM 이미다졸, pH 7.4를 포함하고, 용해된 세포의 원심분리로 얻어진 불용성 분획을 재현탁하여 불용성 분획의 융합 폴리펩타이드의 내포체를 가용화할 수 있다.At this time, the insoluble fraction mainly contains a fusion polypeptide expressed in the form of an insoluble inclusion body. Solubilization of the inclusion bodies present in the insoluble fraction can be carried out under denaturing conditions with chaotropic agents. Inclusion body solubilization conditions may include the use of a buffer containing chaotropic agents, and the inclusion body solubilization buffer may include urea or guanidine hydrochloride, sodium phosphate or tris buffer and sodium chloride as chaotropic agents. In addition, when affinity chromatography is performed by immobilized metal affinity chromatography (IMAC), the inclusion body solubilization buffer may comprise imidazole. In an embodiment, the inclusion body solubilization buffer may comprise 4 M to 10 M urea or 3 M to 8 M guanidine hydrochloride. Inclusion body solubilization buffer may also comprise 5 mM to 100 mM sodium phosphate or tris (pH 7-9). Inclusion body solubilization buffer may comprise 0 M to 1 M sodium chloride. In addition, the inclusion body solubilization buffer for IMAC may comprise 0 mM to 50 mM of imidazole. In this case, the inclusion body solubilization buffer contains 8 M urea, 20 mM Tris, 500 mM sodium chloride, 50 mM imidazole, pH 7.4, and resuspends the insoluble fraction obtained by centrifugation of the lysed cells to fusion poly of the insoluble fraction. Inclusion bodies of peptides can be solubilized.

예를 들어, 내포체 가용화 완충액으로 불용성 분획의 내포체를 가용화 시키는 경우, 2℃ 내지 8℃ 온도에서 약 1시간 내지 6시간 동안 진탕 배양한 후 12,000 rpm (12,000Хg) 조건에서 30분간(4℃) 원심분리하여 불용성 분획에 존재하는 파쇄된 세포 잔해를 제거하고 가용화된 융합 폴리펩타이드가 포함되어 있는 상등액을 얻는다. 상등액은 적층형 필터(depth filter) 및 막 필터로 여과하여 불용성 및 고형 성분을 제거하여 정제용 컬럼에 주입될 수 있도록 한다.For example, when the insoluble fraction of the inclusion body is solubilized with the inclusion body solubilization buffer, shaking culture for 1 hour to 6 hours at a temperature of 2 ° C. to 8 ° C., followed by 30 minutes (1 ° C.) at 12,000 rpm (12,000Хg) Centrifugation to remove crushed cell debris present in the insoluble fraction and obtain a supernatant containing the solubilized fusion polypeptide. The supernatant is filtered through a depth filter and a membrane filter to remove insoluble and solid components so that they can be injected into the purification column.

또한, 불용성 내포체 형태로 발현된 후 가용화된 재조합 융합 폴리펩타이드 또는 목적 폴리펩타이드는 크기 배제, 음이온 또는 양이온 교환, 소수성 상호작용, 또는 친화성 크로마토그래피 방법에 의해 다른 단백질 및 세포 잔해로부터 분리하거나 정제할 수 있다. Furthermore, recombinant fusion polypeptides or target polypeptides that are solubilized after expression in the form of insoluble inclusion bodies are isolated or purified from other protein and cell debris by size exclusion, anion or cation exchange, hydrophobic interaction, or affinity chromatography methods. can do.

예를 들어, 본 발명의 융합 폴리펩타이드는 폴리히스티딘 태그(6-histidine tag)가 포함되어 있으므로 Ni-sepharose FF가 충진되어 있는 HisTrap FF 5 mL 컬럼(GE Healthcare)을 이용하여 정제할 수 있다. 가용화된 재조합 융합 폴리펩타이드는 AKTA pure 25 크로마토그래피 시스템에 장착된 S9 시료 펌프를 이용하여 내포체 가용화 완충액(8 M 요소, 20 mM 트리스, 500 mM 염화나트륨, 50 mM 이미다졸, pH 7.4)으로 평형화된 HisTrap FF 5 mL 컬럼 내로 주입되도록 하고, 내포체 가용화 완충액으로 세척 후 용출 완충액(8 M 요소, 20 mM 트리스, 500 mM 염화나트륨, 500 mM 이미다졸, pH 7.4)의 비율을 100%로 단계적 증가시켜 컬럼에 결합된 융합 폴리펩타이드를 용출시키고 분획을 수집할 수 있다. For example, the fusion polypeptide of the present invention may be purified using a HisTrap FF 5 mL column (GE Healthcare) filled with Ni-sepharose FF because it contains a polyhistidine tag. Solubilized recombinant fusion polypeptides were equilibrated with inclusion body solubilization buffer (8 M urea, 20 mM Tris, 500 mM sodium chloride, 50 mM imidazole, pH 7.4) using an S9 sample pump mounted on an AKTA pure 25 chromatography system. The column was injected into a HisTrap FF 5 mL column and washed with the inclusion body solubilization buffer followed by stepwise increase of the ratio of elution buffer (8 M urea, 20 mM Tris, 500 mM sodium chloride, 500 mM imidazole, pH 7.4) to 100%. The fusion polypeptide bound to can be eluted and fractions collected.

한편, 본 발명에 따른 융합 폴리펩타이드는, 융합 파트너와 목적 폴리펩타이드인 GLP-2 또는 이의 유사체 등이 서로 상이한 등전점을 가짐으로써 목적 폴리펩타이드를 고순도로 용이하게 정제될 수 있다. 단백질의 등전점(isoelectric point, pI)은 단백질이 순 전하를 띠지 않는 pH로, 단백질은 이의 등전점에 따라 분리될 수 있다.On the other hand, the fusion polypeptide according to the present invention can be easily purified in high purity by having a fusion partner and the target polypeptide GLP-2 or an analog thereof and the like is different from each other. The isoelectric point (pI) of a protein is a pH at which the protein does not carry a net charge, and the protein can be separated according to its isoelectric point.

예를 들어, 본 발명의 서열번호 8 내지 139의 아미노산 서열을 갖는 N-말단 융합 파트너의 pI 값은 9.5 내지 10.5일 수 있다. 구체적으로, 서열번호 9, 31, 53, 75, 97 또는 119의 아미노산 서열을 갖는 N-말단 융합 파트너의 pI값은 각각 9.52, 11.72, 10.27, 10.27, 10.43, 10.42일 수 있다. For example, the pI value of an N-terminal fusion partner having the amino acid sequence of SEQ ID NOs: 8-139 may be 9.5-10.5. Specifically, the pI value of the N-terminal fusion partner having the amino acid sequence of SEQ ID NO: 9, 31, 53, 75, 97 or 119 may be 9.52, 11.72, 10.27, 10.27, 10.43, 10.42, respectively.

또한, 상기 각각의 N-말단 융합파트너 C-말단에 정제용 태그(서열번호 140) 및 담배 식각 바이러스 프로테아제 인식서열(서열번호 146)이 융합된 서열번호 154 내지 159의 아미노산 서열을 갖는 융합 펩타이드의 pI 값은 각각 7.06, 10.27, 9.52, 9.52, 9.82, 9.30이며, GLP-2 또는 GLP-2A2G의 pI 값은 4.17이다. 즉, GLP-2 또는 이의 유사체의 pI 값과 N-말단 융합 파트너 및 이를 포함하는 융합 펩타이드들의 pI 값은 실질적으로 상이하다. 따라서, 이온 교환 크로마토그래피, 등전점 침전법 등의 방법을 이용하여 융합 펩타이드로부터 목적 GLP-2 또는 이의 유사체의 정제를 이온 교환 크로마토그래피, 등전점 침전법 등의 방법을 이용하여 용이하게 할 수 있다.In addition, each of the N-terminal fusion partner C- terminal of the fusion peptide having the amino acid sequence of SEQ ID NOs. The pI values are 7.06, 10.27, 9.52, 9.52, 9.82 and 9.30, respectively, and the pI value of GLP-2 or GLP-2A2G is 4.17. That is, the pI value of GLP-2 or an analog thereof and the pI value of the N-terminal fusion partner and fusion peptides comprising the same are substantially different. Therefore, purification of the target GLP-2 or its analogs from the fusion peptide can be facilitated using methods such as ion exchange chromatography, isoelectric point precipitation and the like using methods such as ion exchange chromatography and isoelectric point precipitation.

상기 (e) 단계에서는, 전술한 방법으로 정제된 융합 폴리펩타이드를 절단 효소와 배양하여 GLP-2 또는 이의 유사체(GLP-2A2G)를 회수한다. In step (e), the fusion polypeptide purified by the above-described method is incubated with a cleavage enzyme to recover GLP-2 or an analog thereof (GLP-2A2G).

이때, 융합 폴리펩타이드는 절단효소에 의해 적합하게 절단될 수 있어, GLP-2 또는 GLP-2A2G를 적합한 형태로 유리시킬 수 있다. 정제된 융합 폴리펩타이드 분획에는 8 M의 요소가 첨가되어 있으므로 절단효소의 변성을 막기 위해 희석 완충액(20 mM 트리스, pH 7.4)를 이용하여 요소 농도가 1 M이 되도록 희석하는 것이 바람직하다. 융합 폴리펩타이드는 정제 후 요소 농도가 1 M이 되도록 희석되어 20 mM 트리스, pH 7.4, 1 M 요소, 62.5 mM 염화나트륨, 62.5 mM 이미다졸을 함유하는 완충액에 존재할 수 있다. 재조합 융합 폴리펩타이드는 절단효소와 반응하여 친화성 태그 및 절단효소 인식 서열이 포함된 아미노 말단 융합 파트너와 GLP-2 또는 GLP-2A2G로 절단된다. 프로테아제 절단 방법은 당업계에 공지되고 제조사의 지시서를 포함한 문헌에 기재된 임의의 적합한 방법이 이용될 수 있다. 바람직하게는, 정제 후 요소 농도가 1 M이 되도록 희석된 융합 폴리펩타이드에 TEV 프로테아제를 최종 농도가 500 nM이 되도록 첨가하고 실온에서 6시간 이상 절단 반응이 진행될 수 있도록 한다. 예를 들어, TEV 프로테아제에 의해 재조합 융합 폴리펩타이드는 약 60% 내지 약 100%가 절단된다. At this time, the fusion polypeptide may be suitably cleaved by a cleavage enzyme, thereby releasing GLP-2 or GLP-2A2G into a suitable form. Since 8 M of urea is added to the purified fusion polypeptide fraction, it is preferable to dilute to 1 M using dilution buffer (20 mM Tris, pH 7.4) to prevent denaturation of the cleavage enzyme. The fusion polypeptide may be diluted to a urea concentration of 1 M after purification and present in a buffer containing 20 mM Tris, pH 7.4, 1 M urea, 62.5 mM sodium chloride, 62.5 mM imidazole. Recombinant fusion polypeptides are cleaved with GLP-2 or GLP-2A2G with an amino terminal fusion partner containing an affinity tag and a cleavage recognition sequence in response to the cleavage enzyme. Protease cleavage methods can be any suitable method known in the art and described in the literature, including manufacturer's instructions. Preferably, after purification, TEV protease is added to a fusion polypeptide diluted to 1 M to a final concentration of 500 nM and the cleavage reaction can proceed for at least 6 hours at room temperature. For example, the TEV protease cleaves from about 60% to about 100% of the recombinant fusion polypeptide.

재조합 융합 폴리펩타이드, GLP-2 또는 GLP-2A2G의 수율은 당업자에게 공지된 방법, 예를 들어, SDS-PAGE(sodium dodecyl sulfate - polyacrylamide gel electrophoresis) 또는 웨스턴 블롯(Western blot) 분석에 의해 결정할 수 있다. SDS-PAGE로 전기영동된 겔(gel)은 염색(staining), 탈색(destaining), 디지털 영상화 과정을 거쳐 재조합 융합 폴리펩타이드, GLP-2 또는 GLP-2A2G의 대략적인 정량 및 정성 분석이 가능하다.Yields of the recombinant fusion polypeptide, GLP-2 or GLP-2A2G can be determined by methods known to those skilled in the art, for example, by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) or Western blot analysis. . Gels electrophoresed with SDS-PAGE undergo staining, destaining and digital imaging to allow for quantitative and qualitative analysis of recombinant fusion polypeptides, GLP-2 or GLP-2A2G.

또한, 정제된 융합 폴리펩타이드, GLP-2 또는 GLP-2A2G의 농도는 당업계에 공지되고 문헌에 기재된 방법에 의한 흡광도 분광법으로 결정될 수 있다. In addition, the concentration of the purified fusion polypeptide, GLP-2 or GLP-2A2G, can be determined by absorbance spectroscopy by methods known in the art and described in the literature.

정제된 융합 폴리펩타이드, GLP-2 또는 GLP-2A2G의 수율 또는 순도를 결정하기 위한 웨스턴 블롯 분석은 SDS-PAGE 겔 상에서 분리된 단백질을 니트로셀룰로오스 막으로 이동시키고, GLP-2 또는 GLP-2A2G에 특이적인 항체를 이용하는 당업계에 공지된 적합한 방법에 따라 수행될 수 있다. 실시예에서, GLP-2 또는 GLP-2A2G의 순도를 측정하기 위한 방법 중 하나로 ELISA(enzyme-linked immunosorbent assay)방법을 이용할 수 있다.Western blot analysis to determine the yield or purity of the purified fusion polypeptide, GLP-2 or GLP-2A2G, transfers proteins isolated on SDS-PAGE gels to nitrocellulose membranes and is specific for GLP-2 or GLP-2A2G. It can be carried out according to a suitable method known in the art using a specific antibody. In an embodiment, an enzyme-linked immunosorbent assay (ELISA) method may be used as one of methods for measuring purity of GLP-2 or GLP-2A2G.

정제된 융합 폴리펩타이드, GLP-2 또는 GLP-2A2G의 수율은 배양액의 부피당 정제된 융합 폴리펩타이드 또는 목적 폴리펩타이드의 양(예를 들어, g 또는 mg의 단백질/리터의 배양액 부피), 융합 폴리펩타이드의 백분율(예를 들어, 재조합 융합 폴리펩타이드의 양/전체 세포 단백질(total cell protein)의 양), 및 건조 균체량(dry cell weight)에 대한 백분율 또는 비율을 포함한다. 본원에 기재된 폴리펩타이드의 수율의 척도는 완전한 형태로 발현된 해당 폴리펩타이드의 양을 기준으로 한다.Yields of purified fusion polypeptides, GLP-2 or GLP-2A2G can be determined by the amount of purified fusion polypeptide or desired polypeptide per volume of culture (eg, culture volume of g / mg protein / liter), fusion polypeptide Percentages (eg, amount of recombinant fusion polypeptide / total cell protein), and percentages or ratios to dry cell weight. The measure of yield of a polypeptide described herein is based on the amount of polypeptide of interest expressed in its complete form.

수율이 배양액 부피에 대한 정제된 융합 폴리펩타이드, GLP-2 또는 GLP-2A2G의 양으로 표현되는 경우, 배양된 세포 밀도 혹은 세포 농도가 수율을 결정하는데 고려될 수 있다. When yield is expressed as the amount of purified fusion polypeptide, GLP-2 or GLP-2A2G relative to the culture volume, the cultured cell density or cell concentration can be considered in determining the yield.

이와 같이, 본 발명의 일 구체예는 상기 일반식 1로 표시되는 아미노산 서열로 이루어진 융합 파트너를 포함하는 융합 폴리펩타이드를 이용하여 GLP-2 또는 GLP-2A2G를 수득한다. 이를 통해, GLP-2 또는 GLP-2A2G가 세포 내에서 효소에 의해 분해되거나, 부적절한 폴딩이 발생하는 등의 문제점을 최소화하여 고수율 특성을 갖는 대량 생산 방법을 제공할 수 있다. 구체적인 생산 방법의 일 예시는 실시예를 통해 설명하기로 한다.As such, one embodiment of the present invention obtains GLP-2 or GLP-2A2G using a fusion polypeptide comprising a fusion partner consisting of the amino acid sequence represented by the general formula (1). Through this, GLP-2 or GLP-2A2G can be provided in a mass production method having high yield characteristics by minimizing problems such as degradation by enzymes in the cell or inappropriate folding occurs. An example of the specific production method will be described by way of examples.

이하, 본 발명을 하기 실시예에 의하여 더욱 상세하게 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 범위가 이들만으로 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited thereto.

실시예 1. 테두글루타이드(GLP-2A2G) 융합 폴리펩타이드 제조 및 생산Example 1 Preparation and Production of Teduglutide (GLP-2A2G) Fusion Polypeptide

실시예 1.1. GLP-2A2G 융합 폴리펩타이드 발현 플라스미드의 제작Example 1.1. Construction of GLP-2A2G Fusion Polypeptide Expression Plasmids

GLP-2A2G 융합 폴리펩타이드에 대한 유전자는 overlap extension polymerase chain reaction (OE-PCR) 방법을 이용하여 합성하였다. 이때, 상기 GLP-2A2G 융합 폴리펩타이드는 아미노 말단 융합 파트너로서 PG07(서열번호 9), PG15(서열번호 31), PG22(서열번호 53), PG29(서열번호 75), PG36(서열번호 97) 및 PG43(서열번호 119) 중 하나와 6 히스티딘 태그(서열번호 140), TEV 프로테아제 인식서열(서열번호 146) 및 GLP-2A2G 의 아미노산 서열(서열번호 151)이 포함되어 있다.Genes for the GLP-2A2G fusion polypeptide were synthesized using the overlap extension polymerase chain reaction (OE-PCR) method. In this case, the GLP-2A2G fusion polypeptide is PG07 (SEQ ID NO: 9), PG15 (SEQ ID NO: 31), PG22 (SEQ ID NO: 53), PG29 (SEQ ID NO: 75), PG36 (SEQ ID NO: 97) and the amino terminal fusion partner. One of PG43 (SEQ ID NO: 119) and 6 histidine tag (SEQ ID NO: 140), TEV protease recognition sequence (SEQ ID NO: 146), and the amino acid sequence of GLP-2A2G (SEQ ID NO: 151) are included.

대조군으로서 사용된 GLP-2A2G 융합 폴리펩타이드(H6TEV-GLP-2A2G)는 아미노 말단 융합 파트너가 포함되어 있지 않고, 6 히스티딘 태그(서열번호 140), TEV 프로테아제 인식서열(서열번호 146) 및 GLP-2A2G의 아미노산 서열(서열번호 152)이 포함되어 있다. 각 융합 폴리펩타이드의 유전자는 제한 효소 NdeI, NcoI 및 XhoI의 인식서열과 1개의 종결 코돈을 포함한다. 상기 GLP-2A2G 융합 폴리펩타이드를 코딩하는 뉴클레오타이드 서열은 각각 서열번호 296 내지 301에 해당하며, 대조군은 서열번호 295에 해당한다.The GLP-2A2G fusion polypeptide (H6TEV-GLP-2A2G) used as a control did not contain an amino terminal fusion partner, 6 histidine tags (SEQ ID NO: 140), TEV protease recognition sequence (SEQ ID NO: 146), and GLP-2A2G Amino acid sequence of SEQ ID NO: 152 is included. The gene of each fusion polypeptide contains the recognition sequences of the restriction enzymes NdeI, NcoI and XhoI and one stop codon. The nucleotide sequences encoding the GLP-2A2G fusion polypeptides correspond to SEQ ID NOs: 296 to 301, respectively, and the control corresponds to SEQ ID NO: 295.

아래 표 2에 기재한 GLP-2A2G 융합 폴리펩타이드 발현 플라스미드 pSGK520, pSGK521, pSGK522, pSGK547, pSGK548, pSGK549 및 pSGK523을 제작하기 위해서, OE-PCR로 합성된 GLP-2A2G 융합 폴리펩타이드 유전자 단편을 NdeI 및 XhoI 제한 효소를 이용하여 절단하고, T7 프로모터, lac 작동자 및 LacI 유전자를 포함하여 IPTG에 의한 발현 조절이 가능한 발현벡터 pET26b에 클로닝하였다. To construct the GLP-2A2G fusion polypeptide expression plasmids pSGK520, pSGK521, pSGK522, pSGK547, pSGK548, pSGK549 and pSGK523 described in Table 2 below, GLP-2A2G fusion polypeptide gene fragments synthesized with OE-PCR were synthesized with NdeI and XhoI. Restriction enzymes were cleaved and cloned into expression vector pET26b capable of expression regulation by IPTG, including the T7 promoter, lac effector and LacI gene.

균주Strain 숙주세포Host cell 플라스미드Plasmid 재조합 융합 폴리펩타이드Recombinant fusion polypeptides PG012PG012 E. coli BL21(DE3) E. coli BL21 (DE3) pSGK520pSGK520 H6TEV-GLP-2A2GH6TEV-GLP-2A2G PG013PG013 E. coli BL21(DE3) E. coli BL21 (DE3) pSGK521pSGK521 PG07-H6TEV-GLP-2A2GPG07-H6TEV-GLP-2A2G PG014PG014 E. coli BL21(DE3) E. coli BL21 (DE3) pSGK522pSGK522 PG15-H6TEV-GLP-2A2GPG15-H6TEV-GLP-2A2G PG015PG015 E. coli BL21(DE3) E. coli BL21 (DE3) pSGK547pSGK547 PG22-H6TEV-GLP-2A2GPG22-H6TEV-GLP-2A2G PG016PG016 E. coli BL21(DE3) E. coli BL21 (DE3) pSGK548pSGK548 PG29-H6TEV-GLP-2A2GPG29-H6TEV-GLP-2A2G PG017PG017 E. coli BL21(DE3) E. coli BL21 (DE3) pSGK549pSGK549 PG36-H6TEV-GLP-2A2GPG36-H6TEV-GLP-2A2G PG018PG018 E. coli BL21(DE3) E. coli BL21 (DE3) pSGK523pSGK523 PG43-H6TEV-GLP-2A2GPG43-H6TEV-GLP-2A2G

제작된 GLP-2A2G 융합 폴리펩타이드 발현 플라스미드들은 DNA 염기서열 확인을 통해 정확한 클로닝 여부를 확인하였다. 제작된 GLP-2A2G 융합 폴리펩타이드 발현 플라스미드들을 이용하여 염화칼슘을 이용한 화학적인 방법으로 대장균 BL21(DE3) 세포에 형질전환하였다. GLP-2A2G 융합 폴리펩타이드의 발현 플라스미드들이 형질도입된 대장균들은 카나마이신(kanamycin)이 50 ㎍/㎖의 농도로 포함된 LB 고체배지에서 콜로니를 형성하였다. 형질전환된 대장균들은 각각 카나마이신이 50 ㎍/㎖의 농도로 존재하는 LB 액체 배지에 배양한 후, 50% 글리세롤을 배양액과 동일한 부피로 첨가하여 세포 농축액(cell stock)을 만들고, 이를 -80℃ 온도의 냉동고에 보관하였다.The prepared GLP-2A2G fusion polypeptide expression plasmids were confirmed for correct cloning through DNA sequencing. The produced GLP-2A2G fusion polypeptide expression plasmids were transformed into E. coli BL21 (DE3) cells by chemical method using calcium chloride. E. coli transfected with expression plasmids of GLP-2A2G fusion polypeptides formed colonies in LB solid medium containing kanamycin at a concentration of 50 μg / ml. The transformed E. coli were each cultured in LB liquid medium containing kanamycin at a concentration of 50 μg / ml, and then 50% glycerol was added in the same volume as the culture to make a cell stock, which was then -80 ° C. Stored in freezer.

실시예 1.2. 형질전환된 세포의 배양 및 GLP-2A2G의 발현Example 1.2. Culture of Transformed Cells and Expression of GLP-2A2G

-80℃ 온도에서 보관된 GLP-2A2G 융합 폴리펩타이드의 발현 플라스미드들이 형질전환된 대장균의 세포 농축액을 실온에서 녹인 후 50 ㎕를 카나마이신이 50 ug/mL의 농도로 존재하는 LB 액체 배지 5 ㎖이 포함된 시험관에 첨가하여 37℃ 온도의 진탕배양기에서 12시간 동안 종균 배양하였다. 종균 배양된 대장균 2 ㎖을 카나마이신이 50 ㎍/㎖의 농도로 존재하는 LB 액체 배지 200 ㎖이 포함된 플라스크에 첨가하여 37℃ 온도의 진탕배양기에서 배양하였다. 배양 약 3시간 후 세포의 광학밀도(OD600)가 약 1.0이 되었을 때 IPTG를 최종 농도 0.1 mM이 되도록 첨가하여 GLP-2A2G 융합 폴리펩타이드의 발현을 유도하였다. 발현 유도 4시간 후에 광학 밀도를 측정하여 세포의 광학 밀도를 측정하였다.Expression plasmids of GLP-2A2G fusion polypeptides stored at −80 ° C. were dissolved in the cell concentrate of transformed E. coli at room temperature, and then 50 μl of 5 ml of LB liquid medium containing kanamycin at a concentration of 50 ug / mL. The seed was added to the test tube and cultured for 12 hours in a shaker at 37 ° C. Spawn cultured 2 ml of E. coli was added to a flask containing 200 ml of LB liquid medium containing kanamycin at a concentration of 50 μg / ml and cultured in a shaker at 37 ° C. After about 3 hours of culture, when the optical density (OD600) of the cell was about 1.0, IPTG was added to a final concentration of 0.1 mM to induce the expression of the GLP-2A2G fusion polypeptide. 4 hours after expression induction, the optical density was measured to determine the optical density of the cells.

실시예 1.3. 발현 수준 비교 분석을 위한 시료의 제조Example 1.3. Preparation of Samples for Comparative Expression Level Analysis

발현 유도가 된 세포의 광학밀도가 10.0이 되도록 세포를 농축하고 50 mM 인산 나트륨, pH 7.2 완충액으로 재현탁시킨 후 초음파 세포 파쇄기(ultrasonic processor, Cole-Parmer)를 이용하여 세포를 파쇄하였다. 파쇄된 세포는 총 세포 분획으로 표지하였다. 세포 파쇄액은 12,000×g, 4℃ 온도에서 15분간 원심분리하였다. 상등액을 회수하고 가용성 분획으로 표지하였다. 불용성 분획은 500 ㎕의 50 mM 인산 나트륨, pH 7.2 완충액으로 초음파 세포 파쇄기를 이용하여 재현탁하고 불용성 분획으로 표지하였다.Cells were concentrated so that the expression-induced cells had an optical density of 10.0, resuspended in 50 mM sodium phosphate, pH 7.2 buffer, and disrupted by using an ultrasonic processor (Collet-Parmer). Crushed cells were labeled with the total cell fraction. Cell lysate was centrifuged at 12,000 × g and 4 ° C. for 15 minutes. The supernatant was recovered and labeled with soluble fraction. The insoluble fraction was resuspended using an ultrasonic cell crusher with 500 μl of 50 mM sodium phosphate, pH 7.2 buffer and labeled with the insoluble fraction.

실시예 1.4. SDS-PAGE 분석을 통한 생산된 GLP-2A2G의 확인Example 1.4. Identification of GLP-2A2G Produced by SDS-PAGE Analysis

50 ㎕의 총 세포, 가용성 및 불용성 분획을 각각 50 ㎕의 2배 농축된 SDS 시료 완충액(SDS sample buffer 2× concentrate, Sigma)에 혼합한 후, 95℃ 온도에서 5분간 가열하여 각 시료의 단백질이 변성될 수 있도록 하였다. 시료 내 변성된 단백질들은 16% SDS-PAGE 겔(gel) 및 TANK 완충액을 이용하여 분자량 크기에 따라 겔 내에서 분리될 수 있도록 하였다. SDS-PAGE 후 겔을 쿠마시 블루(Coomassie blue) R-250이 포함된 염색 완충액으로 염색한 후, 탈색 완충액으로 탈색하여 염색된 단백질만 보일 수 있도록 하였다. 그 결과를 도 1 및 도 2에 나타내었다. 50 μl of total cells, soluble and insoluble fractions were respectively mixed in 50 μl of 2 × concentrated SDS sample buffer (SDS sample buffer 2 × concentration, Sigma), and then heated at 95 ° C. for 5 minutes to obtain protein of each sample. It can be denatured. Denatured proteins in the samples were allowed to separate in the gel by molecular weight size using 16% SDS-PAGE gel and TANK buffer. After SDS-PAGE, the gel was stained with staining buffer containing Coomassie blue R-250, and then stained with destaining buffer so that only the stained protein was visible. The results are shown in FIGS. 1 and 2.

도 1을 참조하면, 대조군인 서열번호 1의 아미노산 서열을 포함하는 융합 파트너가 포함되지 않은 H6TEV-GLP-2A2G(5.5 kDa의 분자량)의 밴드는 SDS-PAGE 젤에서 검출되지 않아 발현 후 세포내 단백질 분해효소에 의해 분해된 것으로 보인다. Referring to FIG. 1, a band of H6TEV-GLP-2A2G (molecular weight of 5.5 kDa) without a fusion partner comprising the amino acid sequence of SEQ ID NO: 1 as a control was not detected in the SDS-PAGE gel and thus the intracellular protein after expression. It seems to have been degraded by the enzyme.

아미노 말단 융합 파트너인 PG07, PG15, PG22, PG29, PG36 및 PG43이 융합된 GLP-2A2G 융합 폴리펩타이드인 PG07-H6TEV-GLP-2A2G(6.5 kDa의 분자량), PG15-H6TEV-GLP-2A2G(7.5 kDa의 분자량), PG22-H6TEV-GLP-2A2G(7.5 kDa의 분자량), PG29-H6TEV-GLP-2A2G(8.3 kDa의 분자량), PG36-H6TEV-GLP-2A2G(9.5 kDa의 분자량) 및 PG43-H6TEV-GLP-2A2G(12.1 kDa의 분자량) 중 SDS-PAGE 분석을 통해 발현 확인이 된 것은 PG22-H6TEV-GLP-2A2G, PG29-H6TEV-GLP-2A2G, PG36-H6TEV-GLP-2A2G 및 PG43-H6TEV-GLP-2A2G이었다.PG07-H6TEV-GLP-2A2G (molecular weight of 6.5 kDa), PG15-H6TEV-GLP-2A2G (7.5 kDa), GLP-2A2G fusion polypeptide fused with amino terminal fusion partners PG07, PG15, PG22, PG29, PG36 and PG43 Molecular weight), PG22-H6TEV-GLP-2A2G (molecular weight of 7.5 kDa), PG29-H6TEV-GLP-2A2G (molecular weight of 8.3 kDa), PG36-H6TEV-GLP-2A2G (molecular weight of 9.5 kDa) and PG43-H6TEV- Expression of GLP-2A2G (molecular weight of 12.1 kDa) was confirmed by SDS-PAGE analysis of PG22-H6TEV-GLP-2A2G, PG29-H6TEV-GLP-2A2G, PG36-H6TEV-GLP-2A2G and PG43-H6TEV-GLP -2A2G.

덴시토미터 분석을 통해 PG07, PG15, PG22, PG29, PG36 및 PG43 중 PG43의 융합에 의한 PG43-H6TEV-GLP-2A2G의 발현 수준이 모든 GLP-2A2G 융합 폴리펩타이드 중 가장 높은 것으로 확인되었다 Densitometer analysis confirmed that the expression level of PG43-H6TEV-GLP-2A2G by fusion of PG43 among PG07, PG15, PG22, PG29, PG36 and PG43 was the highest among all GLP-2A2G fusion polypeptides.

또한, 도 2를 참조하면, 발현이 확인된 모든 GLP-2A2G 융합 폴리펩타이드들은 가용성 분획에서는 관찰되지 않고 모두 불용성 분획에서 나타나는 것을 알 수 있다(레인 1: H6TEV-GLP-2A2G(균주 번호 PG012), 레인 2: PG07-H6TEV-GLP-2A2G(균주 번호 PG013), 레인 3: PG15-H6TEV-GLP-2A2G(균주 번호 PG014) 및 레인 4: PG22-H6TEV-GLP-2A2G(균주 번호 PG015)의 경우 목적 펩타이드가 발현되지 않아 가용성 테스트를 수행하지 않았음).In addition, referring to FIG. 2, it can be seen that all GLP-2A2G fusion polypeptides whose expression is confirmed are not observed in the soluble fraction but appear in the insoluble fraction (lane 1: H6TEV-GLP-2A2G (strain number PG012), Lane 2: PG07-H6TEV-GLP-2A2G (strain number PG013), lane 3: PG15-H6TEV-GLP-2A2G (strain number PG014) and lane 4: PG22-H6TEV-GLP-2A2G (strain number PG015) No peptide was expressed and no solubility test was performed).

참고로, 실시예에서 사용한 폴리펩타이드의 분자량, 등전점, 평균소수성 및 몰 흡광 계수를 아래 표 3에 나타내었다. 몰 흡광 계수는 Expasy의 ProtParam Tool(http://web.expasy.org/protparam/)로 계산되었다.For reference, the molecular weight, isoelectric point, average hydrophobicity and molar extinction coefficient of the polypeptide used in the examples are shown in Table 3 below. The molar extinction coefficient was calculated with Expasy's ProtParam Tool (http://web.expasy.org/protparam/).

폴리펩타이드 단백질 명칭Polypeptide Protein Name 분자량 (Da)Molecular Weight (Da) 등전점 (pI)Isoelectric point (pI) 평균소수성
(GRAVY)
Average hydrophobicity
(GRAVY)
몰흡광계수Molar absorption coefficient
PG07PG07 880.08880.08 9.529.52 -0.371-0.371 -- PG15PG15 1875.311875.31 11.7211.72 -0.667-0.667 -- PG22PG22 2620.112620.11 10.2710.27 -0.745-0.745 -- PG29PG29 3217.823217.82 10.2710.27 -0.200-0.200 -- PG36PG36 3834.503834.50 10.4310.43 -0.183-0.183 -- PG43PG43 4559.354559.35 10.4210.42 -0.023-0.023 -- H6H6 840.86840.86 7.217.21 -3.200-3.200 -- H10H10 1389.431389.43 7.357.35 -3.200-3.200 -- K6K6 787.06787.06 10.7010.70 -3.900-3.900 -- K10K10 1299.761299.76 10.9510.95 -3.900-3.900 -- R6R6 955.14955.14 12.7012.70 -4.500-4.500 -- R10R10 1579.891579.89 12.9512.95 -4.500-4.500 -- Tobacco etch virus (TEV) proteaseTobacco etch virus (TEV) protease 812.88812.88 4.004.00 -0.867-0.867 14901490 EnterokinaseEnterokinase 606.54606.54 3.773.77 -3.580-3.580 -- Ubiquitin carboxyl-terminal hydrolaseUbiquitin carboxyl-terminal hydrolase 557.65557.65 12.0012.00 -1.200-1.200 -- Glucagon-like peptide-1 (GLP-2)Glucagon-like peptide-1 (GLP-2) 3766.153766.15 4.174.17 -0.282-0.282 55005500 GLP-2A2G (테두글루타이드, GLP-2A2G)GLP-2A2G (Tedulglutide, GLP-2A2G) 3752.133752.13 4.174.17 -0.348-0.348 55005500 H6TEVH6TEV 1766.921766.92 6.566.56 -1.731-1.731 14901490 PG07-H6TEVPG07-H6TEV 2781.112781.11 7.067.06 -1.405-1.405 69906990 PG15-H6TEVPG15-H6TEV 3776.353776.35 10.2710.27 -1.272-1.272 69906990 PG22-H6TEVPG22-H6TEV 4521.154521.15 9.529.52 -1.203-1.203 69906990 PG29-H6TEVPG29-H6TEV 5118.865118.86 9.529.52 -0.760-0.760 69906990 PG36-H6TEVPG36-H6TEV 5735.535735.53 9.829.82 -0.670-0.670 69906990 PG43-H6TEVPG43-H6TEV 8361.438361.43 9.309.30 -0.772-0.772 1398013980 H6TEV-GLP-2A2GH6TEV-GLP-2A2G 5501.035501.03 5.645.64 -0.739-0.739 69906990 PG07-H6TEV-GLP-2A2GPG07-H6TEV-GLP-2A2G 6515.236515.23 5.995.99 -0.759-0.759 1249012490 PG15-H6TEV-GLP-2A2GPG15-H6TEV-GLP-2A2G 7510.467510.46 6.696.69 -0.781-0.781 1249012490 PG22-H6TEV-GLP-2A2GPG22-H6TEV-GLP-2A2G 8255.268255.26 6.426.42 -0.794-0.794 1249012490 PG29-H6TEV-GLP-2A2GPG29-H6TEV-GLP-2A2G 8852.978852.97 6.426.42 -0.582-0.582 1249012490 PG36-H6TEV-GLP-2A2GPG36-H6TEV-GLP-2A2G 9469.659469.65 6.696.69 -0.542-0.542 1249012490 PG43-H6TEV-GLP-2A2GPG43-H6TEV-GLP-2A2G 12095.5412095.54 6.696.69 -0.637-0.637 1948019480

실시예 1.5. N-말단 융합 파트너의 아미노산 치환에 의한 GLP-2A2G 융합 폴리펩타이드의 발현 수준 변화Example 1.5. Changes in the expression level of GLP-2A2G fusion polypeptides by amino acid substitutions of N-terminal fusion partners

PG43-H6TEV-GLP-2A2G 내 PG43의 2번부터 7번까지 6개의 아미노산 잔기의 변화가 GLP-2A2G 융합 폴리펩타이드의 발현 수준에 미치는 영향을 알아보기 위해 각각의 아미노산 잔기를 이소루신, 아스파라긴, 아르기닌, 아스팔트산으로 치환한 총 22개의 GLP-2A2G 융합 폴리펩타이드의 변이체를 제작하여 PG43-H6TEV-GLP-2A2G와의 세포 내 발현수준을 비교하였다. To determine the effect of 6 amino acid residue changes from PG43 2 to 7 in PG43-H6TEV-GLP-2A2G on the expression level of the GLP-2A2G fusion polypeptide, each amino acid residue was assigned to isoleucine, asparagine, and arginine. A total of 22 variants of GLP-2A2G fusion polypeptides substituted with asphalt acid were prepared and compared with PG43-H6TEV-GLP-2A2G.

구체적으로, GLP-2A2G 융합 폴리펩타이드의 변이체 발현을 위한 플라스미드 DNA는 위치 지정 돌연변이(site-directed mutagenesis) 방법을 이용하여 제작하였다. 위치 지정 돌연변이를 위한 주형(template)은 PG43-H6TEV-GLP-2A2G 발현 플라스미드인 pSGK523을 사용하였다. 프라이머는 각각의 변이체의 아미노산 치환부위의 염기서열이 변경된 정방향(forward) 및 역방향(reverse)의 단일가닥 DNA 올리고머를 이용하였다. 실험에 사용된 프라이머는 하기 표 4에 나타내었다. Specifically, plasmid DNA for variant expression of the GLP-2A2G fusion polypeptide was constructed using a site-directed mutagenesis method. As template for the positional mutation, pSGK523, which is a PG43-H6TEV-GLP-2A2G expression plasmid, was used. The primers used forward and reverse single-stranded DNA oligomers in which the nucleotide sequence of the amino acid substitution site of each variant was changed. Primers used in the experiments are shown in Table 4 below.

No.No. PG43 mutantsPG43 mutants Oligomer sequenceOligomer sequence 서열번호SEQ ID NO: 1One PG43-N2IPG43-N2I F-primerF-primer GGAGATATACATATGATTATTCGTCCATTGCATGGAGATATACATATG ATT ATTCGTCCATTGCAT 서열번호 303 SEQ ID NO: 303 R-primerR-primer ATGCAATGGACGAATAATCATATGTATATCTCCATGCAATGGACGAAT AAT CATATGTATATCTCC 서열번호 304SEQ ID NO: 304 22 PG43-N2NPG43-N2N F-primerF-primer -- R-primerR-primer -- 33 PG43-N2RPG43-N2R F-primerF-primer GGAGATATACATATGCGCATTCGTCCATTGCATGGAGATATACATATG CGC ATTCGTCCATTGCAT 서열번호 305SEQ ID NO: 305 R-primerR-primer ATGCAATGGACGAATGCGCATATGTATATCTCCATGCAATGGACGAAT GCG CATATGTATATCTCC 서열번호 306SEQ ID NO: 306 44 PG43-N2DPG43-N2D F-primerF-primer GGAGATATACATATGGATATTCGTCCATTGCATGGAGATATACATATG GAT ATTCGTCCATTGCAT 서열번호 307SEQ ID NO: 307 R-primerR-primer ATGCAATGGACGAATATCCATATGTATATCTCCATGCAATGGACGAAT ATC CATATGTATATCTCC 서열번호 308SEQ ID NO: 308 55 PG43-I3IPG43-I3I F-primerF-primer -- R-primerR-primer -- 66 PG43-I3NPG43-I3N F-primerF-primer GATATACATATGAATAACCGTCCATTGCATGATGATATACATATGAAT AAC CGTCCATTGCATGAT 서열번호 309SEQ ID NO: 309 R-primerR-primer ATCATGCAATGGACGGTTATTCATATGTATATCATCATGCAATGGACG GTT ATTCATATGTATATC 서열번호 310SEQ ID NO: 310 77 PG43-I3RPG43-I3R F-primerF-primer GATATACATATGAATCGCCGTCCATTGCATGATGATATACATATGAAT CGC CGTCCATTGCATGAT 서열번호 311SEQ ID NO: 311 R-primerR-primer ATCATGCAATGGACGGCGATTCATATGTATATCATCATGCAATGGACG GCG ATTCATATGTATATC 서열번호 312SEQ ID NO: 312 88 PG43-I3DPG43-I3D F-primerF-primer GATATACATATGAATGATCGTCCATTGCATGATGATATACATATGAAT GAT CGTCCATTGCATGAT 서열번호 313SEQ ID NO: 313 R-primerR-primer ATCATGCAATGGACGATCATTCATATGTATATCATCATGCAATGGACG ATC ATTCATATGTATATC 서열번호 314SEQ ID NO: 314 99 PG43-R4IPG43-R4I F-primerF-primer ATACATATGAATATTATTCCATTGCATGATCGCATACATATGAATATT ATT CCATTGCATGATCGC 서열번호 315SEQ ID NO: 315 R-primerR-primer GCGATCATGCAATGGAATAATATTCATATGTATGCGATCATGCAATGG AAT AATATTCATATGTAT 서열번호 316SEQ ID NO: 316 1010 PG43-R4NPG43-R4N F-primerF-primer ATACATATGAATATTAACCCATTGCATGATCGCATACATATGAATATT AAC CCATTGCATGATCGC 서열번호 317SEQ ID NO: 317 R-primerR-primer GCGATCATGCAATGGGTTAATATTCATATGTATGCGATCATGCAATGG GTT AATATTCATATGTAT 서열번호 318SEQ ID NO: 318 1111 PG43-R4RPG43-R4R F-primerF-primer -- R-primerR-primer -- 1212 PG43-R4DPG43-R4D F-primerF-primer ATACATATGAATATTGATCCATTGCATGATCGCATACATATGAATATT GAT CCATTGCATGATCGC 서열번호 318SEQ ID NO: 318 R-primerR-primer GCGATCATGCAATGGATCAATATTCATATGTATGCGATCATGCAATGG ATC AATATTCATATGTAT 서열번호 320SEQ ID NO: 320 1313 PG43-P5IPG43-P5I F-primerF-primer CATATGAATATTCGTATTTTGCATGATCGCGTGCATATGAATATTCGT ATT TTGCATGATCGCGTG 서열번호 321SEQ ID NO: 321 R-primerR-primer CACGCGATCATGCAAAATACGAATATTCATATGCACGCGATCATGCAA AAT ACGAATATTCATATG 서열번호 322SEQ ID NO: 322 1414 PG43-P5NPG43-P5N F-primerF-primer CATATGAATATTCGTAACTTGCATGATCGCGTGCATATGAATATTCGT AAC TTGCATGATCGCGTG 서열번호 323SEQ ID NO: 323 R-primerR-primer CACGCGATCATGCAAGTTACGAATATTCATATGCACGCGATCATGCAA GTT ACGAATATTCATATG 서열번호 324SEQ ID NO: 324 1515 PG43-P5RPG43-P5R F-primerF-primer CATATGAATATTCGTCGCTTGCATGATCGCGTGCATATGAATATTCGT CGC TTGCATGATCGCGTG 서열번호 325SEQ ID NO: 325 R-primerR-primer CACGCGATCATGCAAGCGACGAATATTCATATGCACGCGATCATGCAA GCG ACGAATATTCATATG 서열번호 326SEQ ID NO: 326 1616 PG43-P5DPG43-P5D F-primerF-primer CATATGAATATTCGTGATTTGCATGATCGCGTGCATATGAATATTCGT GAT TTGCATGATCGCGTG 서열번호 327SEQ ID NO: 327 R-primerR-primer CACGCGATCATGCAAATCACGAATATTCATATGCACGCGATCATGCAA ATC ACGAATATTCATATG 서열번호 328SEQ ID NO: 328 1717 PG43-L6IPG43-L6I F-primerF-primer ATGAATATTCGTCCAATTCATGATCGCGTGATCATGAATATTCGTCCA ATT CATGATCGCGTGATC 서열번호 329SEQ ID NO: 329 R-primerR-primer GATCACGCGATCATGAATTGGACGAATATTCATGATCACGCGATCATG AAT TGGACGAATATTCAT 서열번호 330SEQ ID NO: 330 1818 PG43-L6NPG43-L6N F-primerF-primer ATGAATATTCGTCCAAACCATGATCGCGTGATCATGAATATTCGTCCA AAC CATGATCGCGTGATC 서열번호 331SEQ ID NO: 331 R-primerR-primer GATCACGCGATCATGGTTTGGACGAATATTCATGATCACGCGATCATG GTT TGGACGAATATTCAT 서열번호 332SEQ ID NO: 332 1919 PG43-L6RPG43-L6R F-primerF-primer ATGAATATTCGTCCACGCCATGATCGCGTGATCATGAATATTCGTCCA CGC CATGATCGCGTGATC 서열번호 333SEQ ID NO: 333 R-primerR-primer GATCACGCGATCATGGCGTGGACGAATATTCATGATCACGCGATCATG GCG TGGACGAATATTCAT 서열번호 334SEQ ID NO: 334 2020 PG43-L6DPG43-L6D F-primerF-primer ATGAATATTCGTCCAGATCATGATCGCGTGATCATGAATATTCGTCCA GAT CATGATCGCGTGATC 서열번호 335SEQ ID NO: 335 R-primerR-primer GATCACGCGATCATGATCTGGACGAATATTCATGATCACGCGATCATG ATC TGGACGAATATTCAT 서열번호 336SEQ ID NO: 336 2121 PG43-H7IPG43-H7I F-primerF-primer AATATTCGTCCATTGATTGATCGCGTGATCGTCAATATTCGTCCATTG ATT GATCGCGTGATCGTC 서열번호 337SEQ ID NO: 337 R-primerR-primer GACGATCACGCGATCAATCAATGGACGAATATTGACGATCACGCGATC AAT CAATGGACGAATATT 서열번호 338SEQ ID NO: 338 2222 PG43-H7NPG43-H7N F-primerF-primer AATATTCGTCCATTGAACGATCGCGTGATCGTCAATATTCGTCCATTG AAC GATCGCGTGATCGTC 서열번호 339SEQ ID NO: 339 R-primerR-primer GACGATCACGCGATCGTTCAATGGACGAATATTGACGATCACGCGATC GTT CAATGGACGAATATT 서열번호 340SEQ ID NO: 340 2323 PG43-H7RPG43-H7R F-primerF-primer AATATTCGTCCATTGCGCGATCGCGTGATCGTCAATATTCGTCCATTG CGC GATCGCGTGATCGTC 서열번호 341SEQ ID NO: 341 R-primerR-primer GACGATCACGCGATCGCGCAATGGACGAATATTGACGATCACGCGATC GCG CAATGGACGAATATT 서열번호 342SEQ ID NO: 342 2424 PG43-H7DPG43-H7D F-primerF-primer AATATTCGTCCATTGGATGATCGCGTGATCGTCAATATTCGTCCATTG GAT GATCGCGTGATCGTC 서열번호 343SEQ ID NO: 343 R-primerR-primer GACGATCACGCGATCATCCAATGGACGAATATTGACGATCACGCGATC ATC CAATGGACGAATATT 서열번호 344SEQ ID NO: 344

각각의 변이체에 대한 위치 지정 돌연변이 후 얻어진 발현 플라스미드들은 DNA 염기서열 확인을 통해 정확한 클로닝 여부를 확인하였다. Expression plasmids obtained after the positional mutations for each variant were confirmed for correct cloning through DNA sequencing.

제작된 GLP-2A2G 융합 폴리펩타이드의 변이체 발현 플라스미드들을 이용하여 염화칼슘을 이용한 화학적인 방법으로 대장균 BL21(DE3) 세포를 형질전환하였다. GLP-2A2G 융합 폴리펩타이드의 발현 플라스미드들이 형질전환된 대장균들은 카나마이신(kanamycin)이 50 ㎍/㎖의 농도로 포함된 LB 고체배지에서 콜로니를 형성하였다. 형질전환된 대장균들은 각각 카나마이신이 50 ㎍/㎖의 농도로 존재하는 LB 액체 배지에 배양한 후, 50% 글리세롤을 배양액과 동일한 부피로 첨가하여 세포 농축액를 만들고, 이를 -80℃ 온도의 냉동고에 보관하였다.E. coli BL21 (DE3) cells were transformed by chemical method using calcium chloride using the mutant expression plasmids of the prepared GLP-2A2G fusion polypeptide. E. coli transformed with the expression plasmids of the GLP-2A2G fusion polypeptide formed colonies in LB solid medium containing kanamycin at a concentration of 50 μg / ml. The transformed Escherichia coli were each cultured in LB liquid medium containing kanamycin at a concentration of 50 μg / ml, and then 50% glycerol was added in the same volume as the culture to make a cell concentrate, which was stored in a freezer at -80 ° C. .

-80℃ 온도에서 보관된 GLP-2A2G융합 폴리펩타이드의 변이체 발현 플라스미드들이 형질전환된 대장균의 세포 농축액을 실온에서 녹인 후, 50 ㎕를 카나마이신이 50 ㎍/㎖의 농도로 존재하는 LB 액체 배지 5 ㎖이 포함된 시험관에 첨가하여 37℃ 온도의 진탕배양기에서 12시간 동안 종균 배양하였다. 종균 배양된 대장균 2 ㎖은 카나마이신이 50 ㎍/㎖의 농도로 존재하는 LB 액체 배지 200 ㎖이 포함된 플라스크에 첨가하여 37℃ 온도의 진탕배양기에서 배양하였다. 배양 약 3시간 후 세포의 광학밀도(OD600)가 약 1.0이 되었을 때, IPTG의 최종 농도가 0.1 mM이 되도록 첨가하여 GLP-2A2G 융합 폴리펩타이드의 발현을 유도하였다. 발현 유도 4시간 후에 광학 밀도를 측정하여 세포의 광학 밀도를 측정하였다.Variant expression plasmids of GLP-2A2G fusion polypeptides stored at −80 ° C. were dissolved in the cell concentrate of transformed Escherichia coli at room temperature, and then 50 μl of 5 ml LB liquid medium containing kanamycin at a concentration of 50 μg / ml. It was added to the test tube containing this was incubated for 12 hours in a shaker at 37 ℃ temperature. 2 ml of spawn cultured E. coli was added to a flask containing 200 ml of LB liquid medium containing kanamycin at a concentration of 50 µg / ml and cultured in a shaker at 37 ° C. When the optical density (OD600) of the cell was about 1.0 after 3 hours of incubation, the final concentration of IPTG was added to 0.1 mM to induce the expression of the GLP-2A2G fusion polypeptide. 4 hours after expression induction, the optical density was measured to determine the optical density of the cells.

발현 유도가 된 세포의 광학밀도가 10.0이 되도록 세포를 농축하고 50 mM 인산 나트륨, pH 7.2 완충액으로 재현탁시킨 후 초음파 세포 파쇄기(ultrasonic processor, Cole-Parmer)를 이용하여 세포를 파쇄하였다. 파쇄된 세포는 총 세포 분획으로 표지하였다. 세포 파쇄액은 12,000×g, 4℃ 온도에서 15분간 원심분리하였다. 상등액을 회수하고 가용성 분획으로 표지하였다. 불용성 분획은 500 ㎕의 50 mM 인산 나트륨, pH 7.2 완충액으로 초음파 세포 파쇄기를 이용하여 재현탁하고 불용성 분획으로 표지하였다.Cells were concentrated so that the expression-induced cells had an optical density of 10.0, resuspended in 50 mM sodium phosphate, pH 7.2 buffer, and disrupted by using an ultrasonic processor (Collet-Parmer). Crushed cells were labeled with the total cell fraction. Cell lysate was centrifuged at 12,000 × g and 4 ° C. for 15 minutes. The supernatant was recovered and labeled with soluble fraction. The insoluble fraction was resuspended using an ultrasonic cell crusher with 500 μl of 50 mM sodium phosphate, pH 7.2 buffer and labeled with the insoluble fraction.

50 ㎕의 총 세포, 가용성 및 불용성 분획을 각각 50 ㎕의 2배 농축된 SDS 시료 완충액(SDS sample buffer 2× concentrate, Sigma)에 혼합한 후, 95℃ 온도에서 5분간 가열하여 각 시료의 단백질이 변성될 수 있도록 하였다. 시료 내 변성된 단백질들은 16% SDS-PAGE 겔 및 TANK 완충액을 이용하여 분자량 크기에 따라 겔 내에서 분리될 수 있도록 하였다. SDS-PAGE 후 겔을 쿠마시 블루(Coomassie blue) R-250이 포함된 염색 완충액으로 염색한 후, 탈색 완충액으로 탈색하여 염색된 단백질만 보일 수 있도록 하였다. 50 μl of total cells, soluble and insoluble fractions were respectively mixed in 50 μl of 2 × concentrated SDS sample buffer (SDS sample buffer 2 × concentration, Sigma), and then heated at 95 ° C. for 5 minutes to obtain protein of each sample. It can be denatured. Denatured proteins in the samples were allowed to separate in the gel by molecular weight size using a 16% SDS-PAGE gel and TANK buffer. After SDS-PAGE, the gel was stained with staining buffer containing Coomassie blue R-250, and then stained with destaining buffer so that only the stained protein was visible.

도 3 내지 도 5에 나타난 바와 같이, 대조군인 PG43-H6TEV-GLP-2A2G의 발현 수준과 비교하여 PG43-H6TEV-GLP-2A2G 내 PG43의 2번부터 7번까지 6개의 아미노산 잔기의 변화에 의해 발현 수준이 변화된 변이체들을 SDS-PAGE 젤 및 덴시토미터 분석을 통해 확인하였다. PG43의 2번부터 7번까지 6개의 아미노산 잔기의 변화는 GLP-2A2G 융합 폴리펩타이드의 발현 수준을 크게 향상시키지 못하고 5번째 잔기가 아르기닌으로 치환된 변이주와 7번째 잔기가 아르기닌으로 치환된 변이주는 대조군 대비 50% 이하로 발현 수준이 감소되었다. As shown in Fig. 3 to 5, expression by the change of 6 amino acid residues from 2 to 7 of PG43 in PG43-H6TEV-GLP-2A2G compared to the expression level of the control group PG43-H6TEV-GLP-2A2G Variants with altered levels were identified through SDS-PAGE gel and densitometry analysis. Changes in six amino acid residues from 2 to 7 of PG43 did not significantly improve the expression level of the GLP-2A2G fusion polypeptide, but a control strain in which the fifth residue was substituted with arginine and the seventh residue was substituted with arginine The expression level was reduced by 50% or less.

실시예 2. GLP-2A2G 융합 폴리펩타이드의 회수 및 정제Example 2. Recovery and Purification of GLP-2A2G Fusion Polypeptides

실시예 2.1. 세포 파쇄 및 불용성 내포체 회수Example 2.1. Cell disruption and insoluble inclusions recovery

플라스크 규모에서 발현된 세포의 냉동된 세포 펠렛을 50 ㎖의 50 mM 인산 나트륨, pH 7.2 완충액을 첨가하여 해동하였다. 재현탁된 세포는 초음파 세포 파쇄기(ultrasonic processor, Cole-Parmer)를 이용하여 파쇄하였다. 용해된 세포는 12,000 rpm (12,000Хg)에서 30분간 원심분리하고 상등액을 제거하여 재조합 융합 폴리펩타이드가 포함된 불용성 내포체 분획을 회수하였다.Frozen cell pellets of cells expressed at the flask scale were thawed by adding 50 ml of 50 mM sodium phosphate, pH 7.2 buffer. Resuspended cells were disrupted using an ultrasonic cell crusher (Collet-Parmer). The lysed cells were centrifuged at 12,000 rpm (12,000Хg) for 30 minutes and the supernatant was removed to recover the insoluble inclusion body fraction containing the recombinant fusion polypeptide.

실시예 2.2. 불용성 내포체 가용화Example 2.2. Insoluble Inclusion Solubilization

회수된 불용성 내포체 분획에 20 ㎖의 내포체 가용화 완충액(8 M 요소, 20 mM 트리스, 500 mM 염화나트륨, 50 mM 이미다졸, pH 7.4)을 첨가하고 25℃ 온도에서 4시간 동안 진탕배양하여 불용성 분획 내 내포체 형태의 재조합 융합 폴리펩타이드가 가용화될 수 있도록 하였다. 가용화된 불용성 분획 시료는 12,000Хg에서 30분간 원심분리하고 상등액을 (0.45/0.2 ㎛) 막필터를 통해 여과하였다.To the recovered insoluble inclusion body fraction, 20 ml of the inclusion body solubilization buffer (8 M urea, 20 mM Tris, 500 mM sodium chloride, 50 mM imidazole, pH 7.4) were added and the insoluble fraction was shaken at 25 ° C. for 4 hours. Recombinant fusion polypeptides in endothelial form were allowed to be solubilized. The solubilized insoluble fraction sample was centrifuged at 12,000Хg for 30 minutes and the supernatant was filtered through a membrane filter (0.45 / 0.2 μm).

실시예 2.3. GLP-2A2G 융합 폴리펩타이드 정제Example 2.3. GLP-2A2G Fusion Polypeptide Purification

7개 GLP-2A2G 융합 폴리펩타이드 중 가장 발현 수준이 높은 PG43-H6TEV-GLP-2A2G를 정제하였다. 먼저, 가용화된 불용성 분획 내의 GLP-2A2G 융합 폴리펩타이드의 정제를 위하여 S9 시료 펌프(Sample pump S9) 및 F9-C 분획 수집기(Fraction collector F9-C)이 장착된 AKTA pure 25 크로마토그라피 시스템(GE Healthcare)을 이용하였다. 가용화된 불용성 분획 시료는 내포체 가용화 완충액(8 M 요소, 20 mM 트리스, 500 mM 염화나트륨, 50 mM 이미다졸, pH 7.4)으로 미리 평형화된 HisTrap FF 1 ㎖ 컬럼(GE Healthcare)에 주입하였다. The highest expression level of PG43-H6TEV-GLP-2A2G among 7 GLP-2A2G fusion polypeptides was purified. First, AKTA pure 25 chromatography system equipped with S9 sample pump (S9) and F9-C fraction collector (Fraction collector F9-C) for purification of GLP-2A2G fusion polypeptide in solubilized insoluble fraction (GE Healthcare) ) Was used. Solubilized insoluble fraction samples were injected into a HisTrap FF 1 mL column (GE Healthcare) previously equilibrated with inclusion body solubilization buffer (8 M urea, 20 mM Tris, 500 mM sodium chloride, 50 mM imidazole, pH 7.4).

주입이 완료된 후 컬럼은 5배 컬럼 부피의 평형 완충액으로 세척하고, 5배 컬럼 부피의 용출 완충액(8 M 요소, 20 mM 트리스, 500 mM 염화나트륨, 500 mM 이미다졸, pH 7.4)을 단계적으로 100%가 되도록 증가시켜 컬럼의 수지에 결합되어 있는 GLP-2A2G 융합 폴리펩타이드를 용출하였다. 용출 후 얻어진 분획의 결과를 각각 도면에 나타내었다(도 6 및 도 7). 컬럼에 주입된 가용화된 불용성 분획 시료 내의 GLP-2A2G 융합 폴리펩타이드는 대부분 컬럼 내 수지에 결합 후 용출되어 95% 이상의 순도를 보였다.After the injection is complete, the column is washed with a 5-fold column volume of equilibration buffer and 100% stepwise addition of 5-fold column volume of elution buffer (8 M urea, 20 mM Tris, 500 mM sodium chloride, 500 mM imidazole, pH 7.4). GLP-2A2G fusion polypeptide bound to the resin of the column was eluted by increasing to. The results of the fractions obtained after elution are shown in the figures, respectively (FIGS. 6 and 7). Most of the GLP-2A2G fusion polypeptide in the solubilized insoluble fraction sample injected into the column was eluted after binding to the resin in the column, and showed more than 95% purity.

실시예 3. 프로테아제 처리를 통한 링커 서열 절단  Example 3. Linker Sequence Cleavage Through Protease Treatment

약 5 ㎖의 정제된 GLP-2A2G 융합 폴리펩타이드의 분획을 합친 후 140 ㎖의 희석 완충액(20 mM 트리스, pH 7.4)을 첨가하여 요소 농도가 1 M이 되도록 희석하였다. 희석된 재조합 융합 폴리펩타이드에 TEV 프로테아제를 최종 농도가 500 nM이 되도록 첨가하고 실온에서 12시간 동안 절단 반응이 진행될 수 있도록 하였다.The fractions of about 5 ml of purified GLP-2A2G fusion polypeptide were combined and diluted to 1 M by adding 140 ml of dilution buffer (20 mM Tris, pH 7.4). TEV protease was added to the diluted recombinant fusion polypeptide to a final concentration of 500 nM and the cleavage reaction was allowed to proceed for 12 hours at room temperature.

TEV 프로테아제에 의한 절단 여부를 확인하기 위해, 절단 후 SDS-PAGE 분석을 수행하여 그 결과를 도면에 나타내었다(도 8). TEV 프로테아제에 의한 GLP-2A2G 융합 폴리펩타이드(PG43-H6TEV-GLP-2A2G)의 절단 전, 후를 SDS-PAGE로 분석해 본 결과, 12.1 kDa의 GLP-2A2G 융합 폴리펩타이드는 거의 100%의 수율로 아미노 말단 융합 펩타이드와 6 히스티딘 태그 및 TEV 프로테아제 인식서열 융합체인 PG43-H6TEV와 목적 폴리펩타이드인 GLP-2A2G로 절단되는 것을 확인하였다.In order to confirm the cleavage by the TEV protease, SDS-PAGE analysis was performed after cleavage and the results are shown in the figure (FIG. 8). SDS-PAGE analysis of before and after cleavage of the GLP-2A2G fusion polypeptide (PG43-H6TEV-GLP-2A2G) by TEV protease showed that the 12.1 kDa GLP-2A2G fusion polypeptide was nearly 100% amino in yield. It was confirmed that the terminal fusion peptide and the 6 histidine tag and TEV protease recognition sequence fusion PG43-H6TEV and the target polypeptide GLP-2A2G.

실시예 4. 절단 후의 GLP-2A2G 의 분자량 분석Example 4. Molecular Weight Analysis of GLP-2A2G After Cleavage

완전한 형태의 GLP-2A2G 융합 폴리펩타이드(PG43-H6TEV-GLP-2A2G)의 발현 유무, TEV 프로테아제에 의한 정확한 절단 및 절단 후 얻어진 GLP-2A2G의 변형(modification) 유무를 확인해보기 위해 MALTI-TOF MS를 이용한 분자량 분석을 실시하였다. 본 발명에 따라 수득된 GLP-2A2G의 분자량을 측정한 결과를 도면에 나타내었다. MALTI-TOF MS was used to confirm the expression of the complete form of GLP-2A2G fusion polypeptide (PG43-H6TEV-GLP-2A2G), and the modification of GLP-2A2G obtained after accurate cleavage and cleavage by TEV protease. The molecular weight analysis used was performed. The result of measuring the molecular weight of GLP-2A2G obtained according to the present invention is shown in the figure.

도 9를 참고하면, PG43-H6TEV-GLP-2A2G로부터 수득된 GLP-2A2G의 분자량은 3753.10 Da으로 측정되어 이론적인 분자량인 3752.13 Da과 오차범위 이내에서 일치하였으므로 대장균 내에서 단백질 분해효소(proteolytic enzyme)에 의한 아미노 혹은 카르복시 말단의 부분적인 절단이나 분해 없이 완전한 형태로 발현된 것을 확인할 수 있었다. Referring to FIG. 9, the molecular weight of GLP-2A2G obtained from PG43-H6TEV-GLP-2A2G was measured to be 3753.10 Da, which coincided with the theoretical molecular weight of 3752.13 Da within an error range, thereby proteolytic enzyme in E. coli. It was confirmed that the complete form was expressed without partial cleavage or degradation of amino or carboxy terminus by.

따라서 TEV 프로테아제는 PG43-H6TEV-GLP-2A2G 내 인식서열인 ENLFQ 서열을 인식하고 마지막 아미노산인 Q(글루타민)와 GLP-2A2G의 첫번째 아미노산인 H(히스티딘) 사이의 펩타이드 결합을 정확하게 절단하는 것으로 판단된다.Therefore, the TEV protease recognizes the ENLFQ sequence, which is the recognition sequence in PG43-H6TEV-GLP-2A2G, and precisely cleaves the peptide bond between Q (glutamine), the last amino acid, and H (histidine), the first amino acid of GLP-2A2G. .

<110> PEPGENE INC. <120> METHOD OF PREPARING GLUCAGON LIKE PEPTIDE-2 OR ANALOGUES USING FUSION POLYPEPTIDE <130> FPD201809-0086 <150> KR 10-2018-0018278 <151> 2018-02-14 <160> 345 <170> KoPatentIn 3.0 <210> 1 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 1 Met Xaa Xaa Xaa Xaa Xaa Xaa 1 5 <210> 2 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 2 Met Xaa Ile Arg Pro Leu His 1 5 <210> 3 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 3 Met Asn Xaa Arg Pro Leu His 1 5 <210> 4 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 4 Met Asn Ile Xaa Pro Leu His 1 5 <210> 5 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 5 Met Asn Ile Arg Xaa Leu His 1 5 <210> 6 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 6 Met Asn Ile Arg Pro Xaa His 1 5 <210> 7 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 7 Met Asn Ile Arg Pro Leu Xaa 1 5 <210> 8 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 8 Met Ile Ile Arg Pro Leu His 1 5 <210> 9 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 9 Met Asn Ile Arg Pro Leu His 1 5 <210> 10 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 10 Met Arg Ile Arg Pro Leu His 1 5 <210> 11 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 11 Met Asp Ile Arg Pro Leu His 1 5 <210> 12 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 12 Met Asn Asn Arg Pro Leu His 1 5 <210> 13 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 13 Met Asn Arg Arg Pro Leu His 1 5 <210> 14 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 14 Met Asn Asp Arg Pro Leu His 1 5 <210> 15 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 15 Met Asn Ile Ile Pro Leu His 1 5 <210> 16 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 16 Met Asn Ile Asn Pro Leu His 1 5 <210> 17 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 17 Met Asn Ile Asp Pro Leu His 1 5 <210> 18 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 18 Met Asn Ile Arg Ile Leu His 1 5 <210> 19 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 19 Met Asn Ile Arg Asn Leu His 1 5 <210> 20 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 20 Met Asn Ile Arg Arg Leu His 1 5 <210> 21 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 21 Met Asn Ile Arg Asp Leu His 1 5 <210> 22 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 22 Met Asn Ile Arg Pro Ile His 1 5 <210> 23 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 23 Met Asn Ile Arg Pro Asn His 1 5 <210> 24 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 24 Met Asn Ile Arg Pro Arg His 1 5 <210> 25 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 25 Met Asn Ile Arg Pro Asp His 1 5 <210> 26 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 26 Met Asn Ile Arg Pro Leu Ile 1 5 <210> 27 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 27 Met Asn Ile Arg Pro Leu Asn 1 5 <210> 28 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 28 Met Asn Ile Arg Pro Leu Arg 1 5 <210> 29 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 29 Met Asn Ile Arg Pro Leu Asp 1 5 <210> 30 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 30 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 31 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 31 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 32 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 32 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 33 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 33 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 34 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 34 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 35 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 35 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 36 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 36 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 37 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 37 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 38 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 38 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 39 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 39 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 40 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 40 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 41 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 41 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 42 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 42 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 43 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 43 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 44 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 44 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 45 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 45 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 46 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 46 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 47 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 47 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 48 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 48 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 49 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 49 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 50 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 50 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 51 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 51 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys 1 5 10 15 <210> 52 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 52 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 53 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 53 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 54 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 54 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 55 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 55 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 56 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 56 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 57 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 57 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 58 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 58 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 59 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 59 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 60 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 60 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 61 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 61 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 62 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 62 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 63 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 63 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 64 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 64 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 65 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 65 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 66 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 66 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 67 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 67 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 68 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 68 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 69 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 69 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 70 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 70 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 71 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 71 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 72 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 72 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 73 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 73 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala 20 <210> 74 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 74 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 75 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 75 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 76 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 76 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 77 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 77 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 78 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 78 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 79 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 79 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 80 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 80 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 81 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 81 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 82 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 82 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 83 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 83 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 84 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 84 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 85 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 85 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 86 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 86 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 87 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 87 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 88 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 88 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 89 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 89 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 90 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 90 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 91 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 91 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 92 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 92 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 93 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 93 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 94 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 94 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 95 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 95 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly 20 25 <210> 96 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 96 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 97 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 97 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 98 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 98 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 99 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 99 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 100 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 100 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 101 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 101 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 102 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 102 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 103 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 103 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 104 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 104 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 105 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 105 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 106 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 106 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 107 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 107 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 108 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 108 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 109 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 109 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 110 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 110 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 111 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 111 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 112 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 112 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 113 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 113 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 114 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 114 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 115 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 115 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 116 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 116 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 117 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 117 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr 35 <210> 118 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 118 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 119 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 119 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 120 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 120 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 121 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 121 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 122 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 122 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 123 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 123 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 124 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 124 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 125 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 125 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 126 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 126 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 127 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 127 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 128 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 128 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 129 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 129 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 130 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 130 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 131 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 131 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 132 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 132 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 133 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 133 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 134 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 134 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 135 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 135 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 136 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 136 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 137 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 137 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 138 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 138 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 139 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 139 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val 35 40 <210> 140 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for H6 <400> 140 His His His His His His 1 5 <210> 141 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for H10 <400> 141 His His His His His His His His His His 1 5 10 <210> 142 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for K6 <400> 142 Lys Lys Lys Lys Lys Lys 1 5 <210> 143 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for K10 <400> 143 Lys Lys Lys Lys Lys Lys Lys Lys Lys Lys 1 5 10 <210> 144 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for R6 <400> 144 Arg Arg Arg Arg Arg Arg 1 5 <210> 145 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for R10 <400> 145 Arg Arg Arg Arg Arg Arg Arg Arg Arg Arg 1 5 10 <210> 146 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for Tobacco etch virus (TEV) protease <400> 146 Glu Asn Leu Tyr Phe Gln 1 5 <210> 147 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for Enterokinase <400> 147 Asp Asp Asp Asp Lys 1 5 <210> 148 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for Ubiquitin carboxyl-terminal hydrolase <400> 148 Arg Leu Arg Gly Gly 1 5 <210> 149 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for Factor Xa <400> 149 Ile Glu Gly Arg 1 <210> 150 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for Furin <400> 150 Arg Lys Arg Arg 1 <210> 151 <211> 33 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for GLP-2 <400> 151 His Ala Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn 1 5 10 15 Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr 20 25 30 Asp <210> 152 <211> 33 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for GLP-2A2G <400> 152 His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn 1 5 10 15 Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr 20 25 30 Asp <210> 153 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for H6TEV <400> 153 Met His His His His His His Glu Asn Leu Tyr Phe Gln 1 5 10 <210> 154 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV <400> 154 Met Asn Ile Arg Pro Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln 20 <210> 155 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV <400> 155 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln 20 25 <210> 156 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV <400> 156 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln 35 <210> 157 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV <400> 157 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln 35 40 <210> 158 <211> 50 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV <400> 158 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln 50 <210> 159 <211> 57 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV <400> 159 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln 50 55 <210> 160 <211> 46 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for H6TEV-GLP-2A2G <400> 160 Met His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 1 5 10 15 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 20 25 30 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 35 40 45 <210> 161 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 161 Met Ile Ile Arg Pro Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 162 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 162 Met Asn Ile Arg Pro Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 163 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 163 Met Arg Ile Arg Pro Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 164 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 164 Met Asp Ile Arg Pro Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 165 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 165 Met Asn Asn Arg Pro Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 166 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 166 Met Asn Arg Arg Pro Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 167 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 167 Met Asn Asp Arg Pro Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 168 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 168 Met Asn Ile Ile Pro Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 169 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 169 Met Asn Ile Asn Pro Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 170 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 170 Met Asn Ile Asp Pro Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 171 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 171 Met Asn Ile Arg Ile Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 172 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 172 Met Asn Ile Arg Asn Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 173 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 173 Met Asn Ile Arg Arg Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 174 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 174 Met Asn Ile Arg Asp Leu His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 175 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 175 Met Asn Ile Arg Pro Ile His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 176 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 176 Met Asn Ile Arg Pro Asn His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 177 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 177 Met Asn Ile Arg Pro Arg His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 178 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 178 Met Asn Ile Arg Pro Asp His Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 179 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 179 Met Asn Ile Arg Pro Leu Ile Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 180 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 180 Met Asn Ile Arg Pro Leu Asn Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 181 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 181 Met Asn Ile Arg Pro Leu Arg Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 182 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 182 Met Asn Ile Arg Pro Leu Asp Pro Trp His His His His His His Glu 1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn 20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile 35 40 45 Gln Thr Lys Ile Thr Asp 50 <210> 183 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 183 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 184 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 184 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 185 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 185 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 186 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 186 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 187 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 187 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 188 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 188 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 189 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 189 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 190 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 190 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 191 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 191 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 192 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 192 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 193 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 193 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 194 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 194 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 195 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 195 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 196 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 196 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 197 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 197 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 198 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 198 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 199 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 199 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 200 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 200 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 201 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 201 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 202 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 202 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 203 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 203 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 204 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 204 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Pro 1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp 20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala 35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 50 55 60 <210> 205 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 205 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 206 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 206 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 207 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 207 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 208 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 208 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 209 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 209 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 210 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 210 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 211 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 211 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 212 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 212 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 213 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 213 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 214 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 214 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 215 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 215 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 216 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 216 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 217 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 217 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 218 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 218 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 219 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 219 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 220 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 220 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 221 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 221 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 222 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 222 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 223 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 223 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 224 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 224 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 225 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 225 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 226 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 226 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn 20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr 35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln 50 55 60 Thr Lys Ile Thr Asp 65 <210> 227 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 227 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 228 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 228 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 229 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 229 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 230 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 230 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 231 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 231 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 232 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 232 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 233 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 233 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 234 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 234 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 235 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 235 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 236 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 236 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 237 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 237 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 238 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 238 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 239 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 239 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 240 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 240 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 241 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 241 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 242 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 242 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 243 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 243 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 244 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 244 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 245 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 245 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 246 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 246 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 247 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 247 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 248 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 248 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His 20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser 35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp 50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 65 70 75 <210> 249 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 249 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 250 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 250 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 251 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 251 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 252 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 252 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 253 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 253 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 254 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 254 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 255 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 255 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 256 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 256 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 257 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 257 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 258 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 258 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 259 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 259 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 260 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 260 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 261 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 261 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 262 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 262 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 263 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 263 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 264 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 264 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 265 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 265 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 266 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 266 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 267 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 267 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 268 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 268 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 269 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 269 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 270 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 270 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Pro Trp His His His His His His Glu Asn Leu Tyr 35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu 50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys 65 70 75 80 Ile Thr Asp <210> 271 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 271 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 272 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 272 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 273 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 273 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 274 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 274 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 275 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 275 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 276 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 276 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 277 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 277 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 278 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 278 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 279 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 279 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 280 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 280 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 281 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 281 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 282 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 282 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 283 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 283 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 284 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 284 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 285 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 285 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 286 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 286 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 287 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 287 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 288 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 288 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 289 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 289 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 290 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 290 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 291 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 291 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 292 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 292 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu 1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala 20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His 35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp 85 90 <210> 293 <211> 102 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for GLP-2 <400> 293 catgcggatg gcagctttag cgatgaaatg aacaccattc tggataacct ggcggcgcgc 60 gattttatta actggctgat tcagaccaaa attaccgatt aa 102 <210> 294 <211> 102 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for GLP-2A2G <400> 294 catggcgatg gcagctttag cgatgaaatg aacaccattc tggataacct ggcggcgcgc 60 gattttatta actggctgat tcagaccaaa attaccgatt aa 102 <210> 295 <211> 141 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for H6TEV-GLP-2A2G <400> 295 atgcatcatc atcaccacca cgaaaacctg tatttccagc atggcgatgg cagctttagc 60 gatgaaatga acaccattct ggataacctg gcggcgcgcg attttattaa ctggctgatt 120 cagaccaaaa ttaccgatta a 141 <210> 296 <211> 165 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG07-H6TEV-GLP-2A2G <400> 296 atgaatattc gtccattgca tccatggcat catcatcacc accacgaaaa cctgtatttc 60 cagcatggcg atggcagctt tagcgatgaa atgaacacca ttctggataa cctggcggcg 120 cgcgatttta ttaactggct gattcagacc aaaattaccg attaa 165 <210> 297 <211> 189 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG15-H6TEV-GLP-2A2G <400> 297 atgaatattc gtccattgca tgatcgcgtg atcgtcaagc gtaaaccatg gcatcatcat 60 caccaccacg aaaacctgta tttccagcat ggcgatggca gctttagcga tgaaatgaac 120 accattctgg ataacctggc ggcgcgcgat tttattaact ggctgattca gaccaaaatt 180 accgattaa 189 <210> 298 <211> 210 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG22-H6TEV-GLP-2A2G <400> 298 atgaatattc gtccattgca tgatcgcgtg atcgtcaagc gtaaagaagt tgaaactaaa 60 tctgctccat ggcatcatca tcaccaccac gaaaacctgt atttccagca tggcgatggc 120 agctttagcg atgaaatgaa caccattctg gataacctgg cggcgcgcga ttttattaac 180 tggctgattc agaccaaaat taccgattaa 210 <210> 299 <211> 231 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG29-H6TEV-GLP-2A2G <400> 299 atgaatattc gtccattgca tgatcgcgtg atcgtcaagc gtaaagaagt tgaaactaaa 60 tctgctggcg gcatcgttct gaccggccca tggcatcatc atcaccacca cgaaaacctg 120 tatttccagc atggcgatgg cagctttagc gatgaaatga acaccattct ggataacctg 180 gcggcgcgcg attttattaa ctggctgatt cagaccaaaa ttaccgatta a 231 <210> 300 <211> 252 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG36-H6TEV-GLP-2A2G <400> 300 atgaatattc gtccattgca tgatcgcgtg atcgtcaagc gtaaagaagt tgaaactaaa 60 tctgctggcg gcatcgttct gaccggctct gcagcggcta aatccacccc atggcatcat 120 catcaccacc acgaaaacct gtatttccag catggcgatg gcagctttag cgatgaaatg 180 aacaccattc tggataacct ggcggcgcgc gattttatta actggctgat tcagaccaaa 240 attaccgatt aa 252 <210> 301 <211> 273 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG43-H6TEV-GLP-2A2G <400> 301 atgaatattc gtccattgca tgatcgcgtg atcgtcaagc gtaaagaagt tgaaactaaa 60 tctgctggcg gcatcgttct gaccggctct gcagcggcta aatccacccg cggcgaagtg 120 ctggctgtcc catggcatca tcatcaccac cacgaaaacc tgtatttcca gcatggcgat 180 ggcagcttta gcgatgaaat gaacaccatt ctggataacc tggcggcgcg cgattttatt 240 aactggctga ttcagaccaa aattaccgat taa 273 <210> 302 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner PG15(2-7) <400> 302 Met Asp Arg Val Ile Val Lys Arg Lys 1 5 <210> 303 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for PG43-N2I <400> 303 ggagatatac atatgattat tcgtccattg cat 33 <210> 304 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for PG43-N2I <400> 304 atgcaatgga cgaataatca tatgtatatc tcc 33 <210> 305 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-N2R <400> 305 ggagatatac atatgcgcat tcgtccattg cat 33 <210> 306 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-N2R <400> 306 atgcaatgga cgaatgcgca tatgtatatc tcc 33 <210> 307 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-N2D <400> 307 ggagatatac atatggatat tcgtccattg cat 33 <210> 308 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-N2D <400> 308 atgcaatgga cgaatatcca tatgtatatc tcc 33 <210> 309 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-I3N <400> 309 gatatacata tgaataaccg tccattgcat gat 33 <210> 310 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-I3N <400> 310 atcatgcaat ggacggttat tcatatgtat atc 33 <210> 311 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-I3R <400> 311 gatatacata tgaatcgccg tccattgcat gat 33 <210> 312 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-I3R <400> 312 atcatgcaat ggacggcgat tcatatgtat atc 33 <210> 313 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-I3D <400> 313 gatatacata tgaatgatcg tccattgcat gat 33 <210> 314 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-I3D <400> 314 atcatgcaat ggacgatcat tcatatgtat atc 33 <210> 315 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-R4I <400> 315 atacatatga atattattcc attgcatgat cgc 33 <210> 316 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-R4I <400> 316 gcgatcatgc aatggaataa tattcatatg tat 33 <210> 317 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-R4N <400> 317 atacatatga atattaaccc attgcatgat cgc 33 <210> 318 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-R4N <400> 318 gcgatcatgc aatgggttaa tattcatatg tat 33 <210> 319 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-R4D <400> 319 atacatatga atattgatcc attgcatgat cgc 33 <210> 320 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-R4D <400> 320 gcgatcatgc aatggatcaa tattcatatg tat 33 <210> 321 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-P5I <400> 321 catatgaata ttcgtatttt gcatgatcgc gtg 33 <210> 322 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-P5I <400> 322 cacgcgatca tgcaaaatac gaatattcat atg 33 <210> 323 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-P5N <400> 323 catatgaata ttcgtaactt gcatgatcgc gtg 33 <210> 324 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-P5N <400> 324 cacgcgatca tgcaagttac gaatattcat atg 33 <210> 325 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-P5R <400> 325 catatgaata ttcgtcgctt gcatgatcgc gtg 33 <210> 326 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-P5R <400> 326 cacgcgatca tgcaagcgac gaatattcat atg 33 <210> 327 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-P5D <400> 327 catatgaata ttcgtgattt gcatgatcgc gtg 33 <210> 328 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-P5D <400> 328 cacgcgatca tgcaaatcac gaatattcat atg 33 <210> 329 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-L6I <400> 329 atgaatattc gtccaattca tgatcgcgtg atc 33 <210> 330 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-L6I <400> 330 gatcacgcga tcatgaattg gacgaatatt cat 33 <210> 331 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-L6N <400> 331 atgaatattc gtccaaacca tgatcgcgtg atc 33 <210> 332 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-L6N <400> 332 gatcacgcga tcatggtttg gacgaatatt cat 33 <210> 333 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-L6R <400> 333 atgaatattc gtccacgcca tgatcgcgtg atc 33 <210> 334 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-L6R <400> 334 gatcacgcga tcatggcgtg gacgaatatt cat 33 <210> 335 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-L6D <400> 335 atgaatattc gtccagatca tgatcgcgtg atc 33 <210> 336 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-L6D <400> 336 gatcacgcga tcatgatctg gacgaatatt cat 33 <210> 337 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-H7I <400> 337 aatattcgtc cattgattga tcgcgtgatc gtc 33 <210> 338 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-H7I <400> 338 gacgatcacg cgatcaatca atggacgaat att 33 <210> 339 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-H7N <400> 339 aatattcgtc cattgaacga tcgcgtgatc gtc 33 <210> 340 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-H7N <400> 340 gacgatcacg cgatcgttca atggacgaat att 33 <210> 341 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-H7R <400> 341 aatattcgtc cattgcgcga tcgcgtgatc gtc 33 <210> 342 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-H7R <400> 342 gacgatcacg cgatcgcgca atggacgaat att 33 <210> 343 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-H7D <400> 343 aatattcgtc cattggatga tcgcgtgatc gtc 33 <210> 344 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-H7D <400> 344 gacgatcacg cgatcatcca atggacgaat att 33 <210> 345 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for 8-43 aa fragment of N-terminal fusion partner (PG43) <400> 345 Asp Arg Val Ile Val Lys Arg Lys Glu Val Glu Thr Lys Ser Ala Gly 1 5 10 15 Gly Ile Val Leu Thr Gly Ser Ala Ala Ala Lys Ser Thr Arg Gly Glu 20 25 30 Val Leu Ala Val 35 <110> PEPGENE INC. <120> METHOD OF PREPARING GLUCAGON LIKE PEPTIDE-2 OR ANALOGUES USING          FUSION POLYPEPTIDE <130> FPD201809-0086 <150> KR 10-2018-0018278 <151> 2018-02-14 <160> 345 <170> KoPatentIn 3.0 <210> 1 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 1 Met Xaa Xaa Xaa Xaa Xaa Xaa   1 5 <210> 2 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 2 Met Xaa Ile Arg Pro Leu His   1 5 <210> 3 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 3 Met Asn Xaa Arg Pro Leu His   1 5 <210> 4 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 4 Met Asn Ile Xaa Pro Leu His   1 5 <210> 5 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 5 Met Asn Ile Arg Xaa Leu His   1 5 <210> 6 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 6 Met Asn Ile Arg Pro Xaa His   1 5 <210> 7 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner <400> 7 Met Asn Ile Arg Pro Leu Xaa   1 5 <210> 8 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 8 Met Ile Ile Arg Pro Leu His   1 5 <210> 9 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 9 Met Asn Ile Arg Pro Leu His   1 5 <210> 10 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 10 Met Arg Ile Arg Pro Leu His   1 5 <210> 11 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 11 Met Asp Ile Arg Pro Leu His   1 5 <210> 12 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 12 Met Asn Asn Arg Pro Leu His   1 5 <210> 13 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 13 Met Asn Arg Arg Pro Leu His   1 5 <210> 14 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 14 Met Asn Asp Arg Pro Leu His   1 5 <210> 15 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 15 Met Asn Ile Ile Pro Leu His   1 5 <210> 16 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 16 Met Asn Ile Asn Pro Leu His   1 5 <210> 17 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 17 Met Asn Ile Asp Pro Leu His   1 5 <210> 18 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 18 Met Asn Ile Arg Ile Leu His   1 5 <210> 19 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 19 Met Asn Ile Arg Asn Leu His   1 5 <210> 20 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 20 Met Asn Ile Arg Arg Leu His   1 5 <210> 21 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 21 Met Asn Ile Arg Asp Leu His   1 5 <210> 22 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 22 Met Asn Ile Arg Pro Ile His   1 5 <210> 23 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 23 Met Asn Ile Arg Pro Asn His   1 5 <210> 24 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 24 Met Asn Ile Arg Pro Arg His   1 5 <210> 25 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 25 Met Asn Ile Arg Pro Asp His   1 5 <210> 26 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 26 Met Asn Ile Arg Pro Leu Ile   1 5 <210> 27 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 27 Met Asn Ile Arg Pro Leu Asn   1 5 <210> 28 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 28 Met Asn Ile Arg Pro Leu Arg   1 5 <210> 29 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG07) <400> 29 Met Asn Ile Arg Pro Leu Asp   1 5 <210> 30 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 30 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 31 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 31 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 32 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 32 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 33 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 33 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 34 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 34 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 35 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 35 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 36 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 36 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 37 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 37 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 38 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 38 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 39 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 39 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 40 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 40 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 41 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 41 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 42 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 42 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 43 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 43 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 44 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 44 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 45 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 45 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 46 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 46 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 47 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 47 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 48 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 48 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 49 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 49 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 50 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 50 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 51 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG15) <400> 51 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys   1 5 10 15 <210> 52 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 52 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 53 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 53 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 54 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 54 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 55 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 55 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 56 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 56 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 57 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 57 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 58 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 58 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 59 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 59 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 60 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 60 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 61 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 61 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 62 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 62 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 63 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 63 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 64 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 64 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 65 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 65 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 66 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 66 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 67 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 67 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 68 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 68 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 69 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 69 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 70 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 70 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 71 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 71 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 72 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 72 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 73 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG22) <400> 73 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala              20 <210> 74 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 74 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 75 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 75 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 76 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 76 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 77 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 77 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 78 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 78 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 79 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 79 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 80 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 80 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 81 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 81 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 82 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 82 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 83 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 83 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 84 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 84 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 85 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 85 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 86 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 86 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 87 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 87 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 88 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 88 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 89 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 89 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 90 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 90 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 91 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 91 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 92 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 92 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 93 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 93 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 94 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 94 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 95 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG29) <400> 95 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly              20 25 <210> 96 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 96 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 97 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 97 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 98 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 98 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 99 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 99 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 100 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 100 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 101 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 101 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 102 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 102 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 103 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 103 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 104 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 104 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 105 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 105 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 106 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 106 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 107 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 107 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 108 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 108 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 109 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 109 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 110 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 110 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 111 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 111 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 112 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 112 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 113 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 113 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 114 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 114 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 115 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 115 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 116 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 116 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 117 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG36) <400> 117 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr          35 <210> 118 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 118 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 119 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 119 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 120 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 120 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 121 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 121 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 122 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 122 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 123 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 123 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 124 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 124 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 125 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 125 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 126 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 126 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 127 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 127 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 128 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 128 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 129 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 129 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 130 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 130 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 131 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 131 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 132 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 132 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 133 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <133> 133 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 134 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 134 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 135 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 135 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 136 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 136 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 137 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 137 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 138 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 138 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <139> <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner (PG43) <400> 139 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val          35 40 <210> 140 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for H6 <400> 140 His His His His His His   1 5 <210> 141 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for H10 <400> 141 His His His His His His His His His His   1 5 10 <210> 142 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for K6 <400> 142 Lys Lys Lys Lys Lys Lys Lys   1 5 <210> 143 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for K10 <400> 143 Lys Lys Lys Lys Lys Lys Lys Lys Lys Lys Lys   1 5 10 <210> 144 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for R6 <400> 144 Arg Arg Arg Arg Arg Arg   1 5 <210> 145 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for R10 <400> 145 Arg Arg Arg Arg Arg Arg Arg Arg Arg Arg Arg   1 5 10 <210> 146 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for Tobacco etch virus (TEV) protease <400> 146 Glu Asn Leu Tyr Phe Gln   1 5 <210> 147 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for Enterokinase <400> 147 Asp Asp Asp Asp Lys   1 5 <210> 148 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for Ubiquitin carboxyl-terminal hydrolase <400> 148 Arg Leu Arg Gly Gly   1 5 <210> 149 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for Factor Xa <400> 149 Ile Glu Gly Arg   One <210> 150 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for Furin <400> 150 Arg Lys Arg Arg   One <210> 151 <211> 33 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for GLP-2 <400> 151 His Ala Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn   1 5 10 15 Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr              20 25 30 Asp     <210> 152 <211> 33 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for GLP-2A2G <400> 152 His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn   1 5 10 15 Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr              20 25 30 Asp     <210> 153 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for H6TEV <400> 153 Met His His His His His His Glu Asn Leu Tyr Phe Gln   1 5 10 <210> 154 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV <400> 154 Met Asn Ile Arg Pro Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln              20 <210> 155 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV <400> 155 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln              20 25 <210> 156 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV <400> 156 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln          35 <210> 157 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV <400> 157 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln          35 40 <210> 158 <211> 50 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV <400> 158 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln      50 <210> 159 <211> 57 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV <400> 159 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln      50 55 <210> 160 <211> 46 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for H6TEV-GLP-2A2G <400> 160 Met His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp   1 5 10 15 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala              20 25 30 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp          35 40 45 <210> 161 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 161 Met Ile Ile Arg Pro Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 162 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 162 Met Asn Ile Arg Pro Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 163 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 163 Met Arg Ile Arg Pro Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 164 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 164 Met Asp Ile Arg Pro Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 165 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 165 Met Asn Asn Arg Pro Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 166 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 166 Met Asn Arg Arg Pro Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 167 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 167 Met Asn Asp Arg Pro Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 168 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 168 Met Asn Ile Ile Pro Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 169 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 169 Met Asn Ile Asn Pro Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 170 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 170 Met Asn Ile Asp Pro Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 171 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 171 Met Asn Ile Arg Ile Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 172 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 172 Met Asn Ile Arg Asn Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 173 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 173 Met Asn Ile Arg Arg Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 174 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 174 Met Asn Ile Arg Asp Leu His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <175> 175 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 175 Met Asn Ile Arg Pro Ile His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 176 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 176 Met Asn Ile Arg Pro Asn His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 177 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 177 Met Asn Ile Arg Pro Arg His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 178 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 178 Met Asn Ile Arg Pro Asp His Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 179 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 179 Met Asn Ile Arg Pro Leu Ile Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 180 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 180 Met Asn Ile Arg Pro Leu Asn Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 181 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 181 Met Asn Ile Arg Pro Leu Arg Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 182 <211> 54 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG07-H6TEV-GLP-2A2G <400> 182 Met Asn Ile Arg Pro Leu Asp Pro Trp His His His His His His Glu   1 5 10 15 Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn              20 25 30 Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile          35 40 45 Gln Thr Lys Ile Thr Asp      50 <210> 183 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 183 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 184 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 184 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 185 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 185 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 186 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 186 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 187 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 187 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 188 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 188 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 189 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 189 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 190 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 190 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 191 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 191 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 192 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 192 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 193 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 193 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 194 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 194 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 195 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 195 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 196 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 196 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 197 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 197 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 198 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 198 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 199 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 199 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 200 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 200 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 201 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 201 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 202 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 202 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 203 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 203 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 204 <211> 62 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG15-H6TEV-GLP-2A2G <400> 204 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Pro   1 5 10 15 Trp His His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp              20 25 30 Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala          35 40 45 Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp      50 55 60 <210> 205 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 205 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <206> 206 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 206 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 207 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 207 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 208 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 208 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 209 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 209 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 210 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 210 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 211 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 211 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 212 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 212 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 213 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 213 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 214 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 214 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 215 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 215 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 216 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 216 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 217 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 217 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 218 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 218 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 219 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 219 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 220 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 220 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 221 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 221 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 222 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 222 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 223 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 223 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 224 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 224 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 225 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 225 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 226 <211> 69 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG22-H6TEV-GLP-2A2G <400> 226 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Pro Trp His His His His His His Glu Asn              20 25 30 Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr          35 40 45 Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln      50 55 60 Thr Lys Ile Thr Asp  65 <210> 227 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 227 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 228 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 228 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 229 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 229 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 230 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 230 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 231 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 231 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 232 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 232 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 233 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 233 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 234 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 234 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 235 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 235 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 236 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 236 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 237 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 237 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 238 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 238 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 239 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 239 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 240 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 240 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 241 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 241 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 242 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 242 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 243 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 243 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 244 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 244 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 245 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 245 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 246 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 246 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 247 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 247 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 248 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG29-H6TEV-GLP-2A2G <400> 248 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Pro Trp His              20 25 30 His His His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser          35 40 45 Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp      50 55 60 Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp  65 70 75 <210> 249 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 249 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 250 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 250 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 251 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 251 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 252 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 252 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 253 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 253 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 254 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 254 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 255 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 255 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 256 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 256 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 257 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 257 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 258 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 258 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 259 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 259 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 260 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 260 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 261 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 261 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 262 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 262 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 263 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 263 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 264 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 264 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 265 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 265 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 266 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 266 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 267 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 267 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 268 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 268 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 269 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 269 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 270 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG36-H6TEV-GLP-2A2G <400> 270 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Pro Trp His His His His His Glu Asn Leu Tyr          35 40 45 Phe Gln His Gly Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu      50 55 60 Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys  65 70 75 80 Ile Thr Asp             <210> 271 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 271 Met Ile Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 272 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 272 Met Asn Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 273 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 273 Met Arg Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 274 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 274 Met Asp Ile Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 275 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 275 Met Asn Asn Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 276 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 276 Met Asn Arg Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 277 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 277 Met Asn Asp Arg Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 278 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 278 Met Asn Ile Ile Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 279 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 279 Met Asn Ile Asn Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 280 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 280 Met Asn Ile Asp Pro Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 281 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 281 Met Asn Ile Arg Ile Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 282 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 282 Met Asn Ile Arg Asn Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 283 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 283 Met Asn Ile Arg Arg Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 284 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 284 Met Asn Ile Arg Asp Leu His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 285 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 285 Met Asn Ile Arg Pro Ile His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 286 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 286 Met Asn Ile Arg Pro Asn His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 287 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 287 Met Asn Ile Arg Pro Arg His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 288 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 288 Met Asn Ile Arg Pro Asp His Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 289 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 289 Met Asn Ile Arg Pro Leu Ile Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 290 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 290 Met Asn Ile Arg Pro Leu Asn Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 291 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 291 Met Asn Ile Arg Pro Leu Arg Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 292 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for PG43-H6TEV-GLP-2A2G <400> 292 Met Asn Ile Arg Pro Leu Asp Asp Arg Val Ile Val Lys Arg Lys Glu   1 5 10 15 Val Glu Thr Lys Ser Ala Gly Gly Ile Val Leu Thr Gly Ser Ala Ala              20 25 30 Ala Lys Ser Thr Arg Gly Glu Val Leu Ala Val Pro Trp His His His          35 40 45 His His His Glu Asn Leu Tyr Phe Gln His Gly Asp Gly Ser Phe Ser      50 55 60 Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile  65 70 75 80 Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp                  85 90 <210> 293 <211> 102 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for GLP-2 <400> 293 catgcggatg gcagctttag cgatgaaatg aacaccattc tggataacct ggcggcgcgc 60 gattttatta actggctgat tcagaccaaa attaccgatt aa 102 <210> 294 <211> 102 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for GLP-2A2G <400> 294 catggcgatg gcagctttag cgatgaaatg aacaccattc tggataacct ggcggcgcgc 60 gattttatta actggctgat tcagaccaaa attaccgatt aa 102 <210> 295 <211> 141 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for H6TEV-GLP-2A2G <400> 295 atgcatcatc atcaccacca cgaaaacctg tatttccagc atggcgatgg cagctttagc 60 gatgaaatga acaccattct ggataacctg gcggcgcgcg attttattaa ctggctgatt 120 cagaccaaaa ttaccgatta a 141 <210> 296 <211> 165 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG07-H6TEV-GLP-2A2G <400> 296 atgaatattc gtccattgca tccatggcat catcatcacc accacgaaaa cctgtatttc 60 cagcatggcg atggcagctt tagcgatgaa atgaacacca ttctggataa cctggcggcg 120 cgcgatttta ttaactggct gattcagacc aaaattaccg attaa 165 <210> 297 <211> 189 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG15-H6TEV-GLP-2A2G <400> 297 atgaatattc gtccattgca tgatcgcgtg atcgtcaagc gtaaaccatg gcatcatcat 60 caccaccacg aaaacctgta tttccagcat ggcgatggca gctttagcga tgaaatgaac 120 accattctgg ataacctggc ggcgcgcgat tttattaact ggctgattca gaccaaaatt 180 accgattaa 189 <210> 298 <211> 210 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG22-H6TEV-GLP-2A2G <400> 298 atgaatattc gtccattgca tgatcgcgtg atcgtcaagc gtaaagaagt tgaaactaaa 60 tctgctccat ggcatcatca tcaccaccac gaaaacctgt atttccagca tggcgatggc 120 agctttagcg atgaaatgaa caccattctg gataacctgg cggcgcgcga ttttattaac 180 tggctgattc agaccaaaat taccgattaa 210 <210> 299 <211> 231 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG29-H6TEV-GLP-2A2G <400> 299 atgaatattc gtccattgca tgatcgcgtg atcgtcaagc gtaaagaagt tgaaactaaa 60 tctgctggcg gcatcgttct gaccggccca tggcatcatc atcaccacca cgaaaacctg 120 tatttccagc atggcgatgg cagctttagc gatgaaatga acaccattct ggataacctg 180 gcggcgcgcg attttattaa ctggctgatt cagaccaaaa ttaccgatta a 231 <210> 300 <211> 252 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG36-H6TEV-GLP-2A2G <400> 300 atgaatattc gtccattgca tgatcgcgtg atcgtcaagc gtaaagaagt tgaaactaaa 60 tctgctggcg gcatcgttct gaccggctct gcagcggcta aatccacccc atggcatcat 120 catcaccacc acgaaaacct gtatttccag catggcgatg gcagctttag cgatgaaatg 180 aacaccattc tggataacct ggcggcgcgc gattttatta actggctgat tcagaccaaa 240 attaccgatt aa 252 <210> 301 <211> 273 <212> DNA <213> Artificial Sequence <220> <223> nucleotide seqeunce for PG43-H6TEV-GLP-2A2G <400> 301 atgaatattc gtccattgca tgatcgcgtg atcgtcaagc gtaaagaagt tgaaactaaa 60 tctgctggcg gcatcgttct gaccggctct gcagcggcta aatccacccg cggcgaagtg 120 ctggctgtcc catggcatca tcatcaccac cacgaaaacc tgtatttcca gcatggcgat 180 ggcagcttta gcgatgaaat gaacaccatt ctggataacc tggcggcgcg cgattttatt 240 aactggctga ttcagaccaa aattaccgat taa 273 <210> 302 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for N-terminal fusion partner PG15 (2-7) <400> 302 Met Asp Arg Val Ile Val Lys Arg Lys   1 5 <210> 303 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for PG43-N2I <400> 303 ggagatatac atatgattat tcgtccattg cat 33 <210> 304 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for PG43-N2I <400> 304 atgcaatgga cgaataatca tatgtatatc tcc 33 <210> 305 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-N2R <400> 305 ggagatatac atatgcgcat tcgtccattg cat 33 <210> 306 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-N2R <400> 306 atgcaatgga cgaatgcgca tatgtatatc tcc 33 <210> 307 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-N2D <400> 307 ggagatatac atatggatat tcgtccattg cat 33 <210> 308 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-N2D <400> 308 atgcaatgga cgaatatcca tatgtatatc tcc 33 <210> 309 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-I3N <400> 309 gatatacata tgaataaccg tccattgcat gat 33 <210> 310 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-I3N <400> 310 atcatgcaat ggacggttat tcatatgtat atc 33 <210> 311 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-I3R <400> 311 gatatacata tgaatcgccg tccattgcat gat 33 <210> 312 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-I3R <400> 312 atcatgcaat ggacggcgat tcatatgtat atc 33 <210> 313 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-I3D <400> 313 gatatacata tgaatgatcg tccattgcat gat 33 <210> 314 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-I3D <400> 314 atcatgcaat ggacgatcat tcatatgtat atc 33 <210> 315 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-R4I <400> 315 atacatatga atattattcc attgcatgat cgc 33 <210> 316 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-R4I <400> 316 gcgatcatgc aatggaataa tattcatatg tat 33 <210> 317 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-R4N <400> 317 atacatatga atattaaccc attgcatgat cgc 33 <210> 318 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-R4N <400> 318 gcgatcatgc aatgggttaa tattcatatg tat 33 <210> 319 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-R4D <400> 319 atacatatga atattgatcc attgcatgat cgc 33 <210> 320 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-R4D <400> 320 gcgatcatgc aatggatcaa tattcatatg tat 33 <210> 321 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-P5I <400> 321 catatgaata ttcgtatttt gcatgatcgc gtg 33 <210> 322 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-P5I <400> 322 cacgcgatca tgcaaaatac gaatattcat atg 33 <210> 323 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-P5N <400> 323 catatgaata ttcgtaactt gcatgatcgc gtg 33 <210> 324 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-P5N <400> 324 cacgcgatca tgcaagttac gaatattcat atg 33 <210> 325 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-P5R <400> 325 catatgaata ttcgtcgctt gcatgatcgc gtg 33 <210> 326 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-P5R <400> 326 cacgcgatca tgcaagcgac gaatattcat atg 33 <210> 327 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-P5D <400> 327 catatgaata ttcgtgattt gcatgatcgc gtg 33 <210> 328 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-P5D <400> 328 cacgcgatca tgcaaatcac gaatattcat atg 33 <210> 329 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-L6I <400> 329 atgaatattc gtccaattca tgatcgcgtg atc 33 <210> 330 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-L6I <400> 330 gatcacgcga tcatgaattg gacgaatatt cat 33 <210> 331 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-L6N <400> 331 atgaatattc gtccaaacca tgatcgcgtg atc 33 <210> 332 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-L6N <400> 332 gatcacgcga tcatggtttg gacgaatatt cat 33 <210> 333 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-L6R <400> 333 atgaatattc gtccacgcca tgatcgcgtg atc 33 <210> 334 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-L6R <400> 334 gatcacgcga tcatggcgtg gacgaatatt cat 33 <210> 335 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-L6D <400> 335 atgaatattc gtccagatca tgatcgcgtg atc 33 <210> 336 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-L6D <400> 336 gatcacgcga tcatgatctg gacgaatatt cat 33 <210> 337 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-H7I <400> 337 aatattcgtc cattgattga tcgcgtgatc gtc 33 <210> 338 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-H7I <400> 338 gacgatcacg cgatcaatca atggacgaat att 33 <210> 339 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-H7N <400> 339 aatattcgtc cattgaacga tcgcgtgatc gtc 33 <210> 340 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-H7N <400> 340 gacgatcacg cgatcgttca atggacgaat att 33 <210> 341 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-H7R <400> 341 aatattcgtc cattgcgcga tcgcgtgatc gtc 33 <210> 342 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-H7R <400> 342 gacgatcacg cgatcgcgca atggacgaat att 33 <210> 343 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PG43-H7D <400> 343 aatattcgtc cattggatga tcgcgtgatc gtc 33 <210> 344 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PG43-H7D <400> 344 gacgatcacg cgatcatcca atggacgaat att 33 <210> 345 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence for 8-43 aa fragment of N-terminal fusion          partner (PG43) <400> 345 Asp Arg Val Ile Val Lys Arg Lys Glu Val Glu Thr Lys Ser Ala Gly   1 5 10 15 Gly Ile Val Leu Thr Gly Ser Ala Ala Ala Lys Ser Thr Arg Gly Glu              20 25 30 Val Leu Ala Val          35

Claims (14)

(a) 하기 일반식 1로 표시되는 아미노산 서열로 이루어진 N-말단 융합 파트너;
글루카곤 유사 펩타이드-2(glucagon like peptide-2; GLP-2) 또는 이의 유사체; 및
상기 N-말단 융합 파트너와, 상기 GLP-2 또는 이의 유사체 사이에 링커를 포함하는 융합 폴리펩타이드를 코딩하는 뉴클레오타이드를 포함하는 발현벡터를 제조하는 단계;
(b) 상기 발현벡터를 숙주세포에 형질도입하는 단계;
(c) 상기 숙주세포를 배양하는 단계;
(d) 상기 숙주세포에서 발현된 융합 폴리펩타이드를 정제하는 단계; 및
(e) 상기 정제된 융합 폴리펩타이드를 절단 효소와 배양하여 GLP-2 또는 이의 유사체를 회수하는 단계를 포함하는, GLP-2 또는 이의 유사체의 생산방법:
[일반식 1]
Met-Xaa1-Xaa2-Xaa3-Xaa4-Xaa5-Xaa6-(Z)n
상기 일반식 1은 서열번호 119이다.
(a) an N-terminal fusion partner consisting of the amino acid sequence represented by the following general formula (1);
Glucagon like peptide-2 (GLP-2) or analogs thereof; And
Preparing an expression vector comprising a nucleotide encoding a fusion polypeptide comprising a linker between said N-terminal fusion partner and said GLP-2 or an analog thereof;
(b) transducing the expression vector into a host cell;
(c) culturing the host cell;
(d) purifying the fusion polypeptide expressed in the host cell; And
(e) culturing the purified fusion polypeptide with a cleavage enzyme to recover GLP-2 or an analog thereof, the method of producing GLP-2 or an analog thereof:
[Formula 1]
Met-Xaa1-Xaa2-Xaa3-Xaa4-Xaa5-Xaa6- (Z) n
Formula 1 is SEQ ID NO: 119.
삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 제 1항에 있어서,
상기 링커는 친화성 태그를 포함하는 것인, GLP-2 또는 이의 유사체의 생산방법.
The method of claim 1,
Wherein the linker comprises an affinity tag, GLP-2 or an analog thereof.
제 1항에 있어서,
상기 링커는 프로테아제 인식서열을 포함하는 것인, GLP-2 또는 이의 유사체의 생산방법.
The method of claim 1,
Wherein the linker comprises a protease recognition sequence, GLP-2 or a method for producing an analog thereof.
제 10항에 있어서,
상기 프로테아제 인식서열은 담배 식각 바이러스 프로테아제 인식서열, 엔테로키나아제 인식서열, 유비퀴틴 카르복시 말단 가수분해효소 인식서열, 인자 Xa 인식서열, 퓨린 인식서열 및 이들의 조합으로 이루어진 군으로부터 선택되는, GLP-2 또는 이의 유사체의 생산방법.
The method of claim 10,
The protease recognition sequence is selected from the group consisting of tobacco etch virus protease recognition sequence, enterokinase recognition sequence, ubiquitin carboxy terminal hydrolase recognition sequence, factor Xa recognition sequence, purine recognition sequence, and combinations thereof, GLP-2 or its combination Method of production of analogs.
제 1항에 있어서,
상기 GLP-2는 서열번호 151의 아미노산 서열을 포함하는, GLP-2 또는 이의 유사체의 생산방법.
The method of claim 1,
The GLP-2 comprises the amino acid sequence of SEQ ID NO: 151, a method for producing GLP-2 or an analog thereof.
제 1항에 있어서,
상기 GLP-2의 유사체는 서열번호 152의 아미노산 서열을 포함하는, GLP-2 또는 이의 유사체의 생산방법.
The method of claim 1,
The analog of GLP-2 comprises the amino acid sequence of SEQ ID NO: 152, a method for producing GLP-2 or an analog thereof.
제 1항에 있어서,
상기 융합 폴리펩타이드는 서열번호 161 내지 292의 아미노산 서열 중 어느 하나의 아미노산 서열로 이루어진 것인, GLP-2 또는 이의 유사체의 생산방법.
The method of claim 1,
The fusion polypeptide is composed of the amino acid sequence of any one of the amino acid sequence of SEQ ID NO: 161 to 292, GLP-2 or a method for producing an analog thereof.
KR1020190007179A 2018-02-14 2019-01-18 Method of preparing glucagon like peptide-2 or analogues using fusion polypeptide KR102017542B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20180018278 2018-02-14
KR1020180018278 2018-02-14

Publications (2)

Publication Number Publication Date
KR20190098690A KR20190098690A (en) 2019-08-22
KR102017542B1 true KR102017542B1 (en) 2019-09-03

Family

ID=67767121

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190007179A KR102017542B1 (en) 2018-02-14 2019-01-18 Method of preparing glucagon like peptide-2 or analogues using fusion polypeptide

Country Status (1)

Country Link
KR (1) KR102017542B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017536835A (en) * 2014-12-01 2017-12-14 フェネックス インク. Fusion partners for peptide production

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017536835A (en) * 2014-12-01 2017-12-14 フェネックス インク. Fusion partners for peptide production

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JACS. Vol.138:11775-11782 (2016)*

Also Published As

Publication number Publication date
KR20190098690A (en) 2019-08-22

Similar Documents

Publication Publication Date Title
KR102106773B1 (en) Fusion tag for increasing water solubility and expression level of target protein and uses thereof
KR102345011B1 (en) Method for production of glucagon-like peptide-1 or analogues with groes pusion
JP7266325B2 (en) Fusion proteins containing fluorescent protein fragments and uses thereof
Canals et al. Production of engineered human pancreatic ribonucleases, solving expression and purification problems, and enhancing thermostability
KR102064810B1 (en) N-terminal fusion partner for preparing recombinant polypeptide and method of preparing recombinant polypeptide using the same
US11267863B2 (en) N-terminal fusion partner for producing recombinant polypeptide, and method for producing recombinant polypeptide using same
US7771970B2 (en) Process for preparation of polypeptides of interest from fusion polypeptides
KR102017542B1 (en) Method of preparing glucagon like peptide-2 or analogues using fusion polypeptide
CN109136209B (en) Enterokinase light chain mutant and application thereof
US20210230659A1 (en) Leader Sequence for Higher Expression of Recombinant Proteins
KR102017540B1 (en) Method of preparing glucagon like peptide-1 or analogues using fusion polypeptide
KR100368073B1 (en) Preparation of Peptides by Use of Human Glucagon Sequence as a Fusion Expression Partner
KR102009709B1 (en) Method of preparing human parathyroid hormone 1-84 using fusion polypeptide
KR102011291B1 (en) Novel fusion polypeptide and method of preparing human parathyroid hormone 1-34 using the same
US20060286629A1 (en) Processing of Peptides and Proteins
KR102345013B1 (en) Method for production of glucagon-like peptide-2 or analogues with groes pusion
KR102345012B1 (en) Method for production of human parathyroid hormone 1-34 with groes pusion
KR101364864B1 (en) Expression Vector for Human Erythropoietin and Process for Production of Erythropoietin Using Thereof
KR100407792B1 (en) Preparation method of recombinant protein by use of human glucagon-derived peptide analogue as a fusion expression partner
WO2022241831A1 (en) Preparation method for polypeptide
KR20170089583A (en) Method for producing antimicrobial peptide using insoluble fusion protein containing antimicrobial peptide
KR100535265B1 (en) Process for preparation of polypeptides of interest from fusion polypeptides
JP2007514423A (en) Peptide and protein processing
KR20120006002A (en) A preparation method of solubility recombinant protein by use of dihydrofolate reductase as a fusion expression partner
KR20230111871A (en) synthesis method of EGF using E. coli

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant