RU2143491C1 - Polynucleotide sequence (variants), polypeptide (variants), fused protein, pharmaceutical composition, monoclonal antibody, strain of hybrid cultured cells - Google Patents

Abstract

FIELD: molecular biology. SUBSTANCE: invention relates to polypeptide-expressing systems requiring the cleavage of precursor-product, new polypeptide that is able to reduce dichloroindophenol and oxidized glutathione, to DNA encoding this polypeptide, pharmaceutical compositions including this polypeptide, monoclonal antibodies raised to the indicated polypeptide. Polynucleotide sequence encoding fused protein has the structural formula A-B-C where A means the sequence of nucleotides 10-1311 in SEQ ID NO; B means Asn-Cys-Ser-Phe-Gln and C means the sequence encoding polypeptide KM 31-7. Polypeptide KM 31-7 has an amino acid sequence 1-526 in SEQ ID N 12. Pharmaceutical composition has polypeptide KM 31-7 in combination with a pharmaceutically acceptable carrier for its. Monoclonal antibody interacts specifically with polypeptide KM 31-7 and produced by the strain of hybrid cultured cells Mus musculus MKM 150-2 FERM BP-5086 and relates to isotope IgG 1. Invention ensures to obtain the new polypeptide showing reducing activity in vivo and can be used for treatment of patients with diseases induced by oxidative stress. EFFECT: new polypeptide indicated above, valuable curative properties. 11 cl, 14 dwg, 18 ex

Description

 The invention relates to polypeptide-expressing systems requiring cleavage of the precursor product, as well as to the proteases used in these systems. In addition, the present invention relates to a new polypeptide capable of reducing dichloroindolphenol and oxidized glutathione, to DNA encoding the specified new polypeptide, to vectors containing the specified DNA, to host cells transformed by these vectors, and to pharmaceutical compositions containing the specified polypeptide . The present invention also relates to monoclonal antibodies against said polypeptide and to a method for isolating and purifying this polypeptide using said antibodies.

State of the art
Potiviruses are a group of viruses that have a genome of approximately 10,000 bases of single-stranded RNA, and which infect plants, such as plants of the Solanaceae family. The potivirus genome is characterized in that it has an exceptionally long open reading frame (ORF) (Dougherty, WG & Hiebert, E. (1980) Virology 101, 466-474, Allison, R. et. Al. (1986), Virology 154: 9-20). To express individual proteins encoded internally by ORF, the translated polyprotein is digested by two types of proteases, which are also encoded internally (Dougherty, W. G & Carrington, R. et. Al., (1988), Ann. Rev. Phutopath 26: 23-143 )

 Tobacco Engraving Virus (TEV) is a member of the Potivirus family and produces nuclear inclusions that can be stained with trypan blue in infected cells. These nuclear inclusions apparently consist of two types of protein, one of which has been found to be a viral protease designated "nuclear inclusion a" or Nla (J. Virol., 61 2540-2548 (1987)).

 Potivirus proteases, called nuclear inclusion a, recognize and cleave a peptide sequence that includes one of Gln-Cly, Gln-Ser, and Cln-Ala, and which is obviously the hexamer sequence located at the C-terminus of the Nla under consideration polyprotein. This cleavage occurs between the two residues forming the above dimers.

 The complete genomic sequences of TEV and tobacco stem spot virus (TYMV), another member of the potivirus family, were determined, and homologous studies of these sequences revealed that the Nla of these viruses localized in their respective genomes. (Virology 154, 9-20 (1986), Nucleic Acids Res., 14: 5417-5430 (1986)).

 The yellow streaky clover mosaic virus, or CYVV, is also a potivirus. To date, only the gene located at the 3'-end of the CYVV genome has been sequenced, together with the envelope protein that this gene encodes (Uyeda, 1. et al., (1991), Intervirol 32: 234-245). However, until now, the structure of the Nla region of this genome remains undetected, and, in addition, the inclusion of Nla itself has not been isolated.

 The production of exogenous proteins using expression systems can be carried out directly using well-known techniques. However, there are many polypeptides that cannot be readily expressed in exogenous systems. The problem is that these polypeptides cannot be synthesized in large quantities, and the simple introduction of a regulatory element above the specified gene does not lead to the desired result. Alternatively, it may turn out that the post-transcriptional processing necessary for the formation of a mature form of the protein either does not occur at all, or occurs incorrectly.

 For example, the translation of many eukaryotic polypeptides begins with the N-terminal methionine, which is then deleted with the formation of a mature form. In prokaryotes, such processing does not occur, and therefore it was necessary to find an alternative way to achieve expression. One of these methods involves cross-linking the desired exogenous protein, for example, with a maltose-binding protein or glutathione-S-transferase, and then purification of the synthesized hybrid protein followed by its cleavage with a protease, such as factor Xa, enterokinase, or thrombin. The main disadvantage of this laborious method is that it requires two stages of purification, which leads to a significant loss of the final product.

 US Pat. No. 5,162,601 discloses the use of a TEV protease in the synthesis of a polyprotein containing linker sequences between proteins, which is desirable for the synthesis of a polypeptide such as human. tPA. However, this patent only describes the cloning of a multigen encoding said polyprotein into a host cell, but neither the expression nor the purification of the proteolytically cleaved final product are described.

Oxygen for metabolic energy is usually supplied by oxidizing agents present in the environment surrounding the cell. The activated form, in the form of which oxygen is usually consumed, is free radicals such as superoxide (O ₂ ^- ), peroxide (H ₂ O ₂ ), or a hydroxyl radical (OH ^- ), while all of these radicals, after their use, are reduced with the formation of water (H ₂ O). Gaseous oxygen, per se, is a very good oxidizing agent, however, the term “activated oxygen” as used herein refers to oxygen or oxygen-containing molecules having a higher oxidizing potential than atmospheric oxygen. The most effective form of activated oxygen is a free radical, which is a molecule or atom having one or more unpaired electrons.

 Free radicals are usually unstable, and without appropriate control, they can denature lipids, proteins, and nucleic acids. And therefore, although activated oxygen is necessary for life support, it can pose a significant risk to human health, as a result of which its amount in the body must be strictly regulated. Due to its high reactivity, activated oxygen, even in negligible amounts, can cause certain disorders in the body. Therefore, highly active forms of oxygen can even kill a living cell, unless this cell has mechanisms of protection against the indicated damaged effect of oxygen.

 In the environment surrounding the cell, the localization, amount and time of generation of activated oxygen must be carefully balanced in relation to the ability of the cell to neutralize its damaging effect. This ability is usually provided by cell defense mechanisms that use their own antioxidants or antioxidant enzymes for this purpose. In the context of the present description, the term "antioxidant" is used as a generic name for all natural compounds with the ability to prevent or inhibit self-oxidation, for example, lipids. The term "antioxidant enzyme" basically means an enzyme that catalyzes the elimination reaction of activated oxygen, and the term "antioxidant effect" means, respectively, an action aimed at eliminating said activated oxygen.

 An excess of activated oxygen in the body can induce a number of pathological phenomena in the body, similar to those caused by stress, medication, smoking, surgery, organ transplantation, or ischemia, or even a brain or myocardial infarction . By large amounts of oxygen are meant amounts that exceed the level of oxygen that the body's regulatory systems are able to eliminate, and therefore these excess amounts of oxygen have a toxic effect on the body, causing serious disturbances in the vital functions of its cells. This toxic effect, otherwise called oxidative stress, is responsible for the occurrence of many pathological conditions of the body.

 For example, it is believed that one of the causes of atherosclerosis is the production of low density lipoproteins that have been oxidized by activated oxygen (Steinberg, D. (1983), Arterioslerosis 3, 283-301). It is also believed that oxidative stress is directly related to the mechanisms of the occurrence of metabolic disorders and vascular complications of diabetes (Kondo, M. ed., "Approaches from Modern Medicine (4) Free Radicals", Medical View Pub., Pp. 138-146).

 Activated oxygen also causes other pathological conditions and disorders, for example, ischemic disorders (reperfusion injuries, coronary heart disease, cerebral ischemia, ischemic enteritis, etc.), edema, vascular superpermeability, inflammatory diseases, mucosal damage stomach, acute pancreatitis, Crock's disease, ulcerative colitis, liver disease, Paraquat disease, pulmonary emphysema, chemical carcinogenesis, cancer metastases, adult respiratory distress syndrome disseminated intravascular coagulation (DIC), cataracts, retroletal fibroplasia, autoimmune diseases, porphyraemia, hemolysis, erythroblastic (Mediterranean) anemia, Parkinson's disease, Alzheimer's disease, epilepsy, disturbances caused by radiation, ultraviolet radiation disease), frostbite and burns.

 Cells have several internal and external defense mechanisms aimed exclusively at eliminating activated oxygen generated within the body.

 It is known that intracellular protective agents, namely antioxidants and antioxidant enzymes, examples of which are given below, utilize and eliminate activated oxygen. So, for example, catalase is present in the peroxisomes of the cell, which restores and removes hydrogen peroxide. Glutathione peroxidase, present in the cytoplasm and mitochondria, catalyzes the reduction and detoxification of hydrogen peroxide and lipid peroxides in the presence of reduced glutathione. Transferrin, ferritin and lactoferrin, for example, inhibit the generation of activated oxygen by stabilizing iron ions, while ceruloplasmin performs a similar function with respect to copper ions. In addition, in the cytoplasm and mitochondria there is superoxide dismutase, which catalyzes the reduction of superoxides with the formation of hydrogen peroxide, which is then eliminated by catalase. In addition to the above enzymes, vitamins C and E, reduced glutathione and other low molecular weight compounds also have the ability to restore and eliminate activated oxygen.

 On the other hand, agents such as extracellular superoxide dismutase, extracellular glutathione peroxidase, and reduced glutathione are present in the extracellular space, where they have the same functions as their intracellular counterparts described above. However, compared with the situation taking place inside the cell, in the extracellular environment there are much fewer different types of antioxidants and antioxidant enzymes, and, in addition, only a few of them have antioxidant effects.

 Reduced glutathione, the formula of which is presented below, plays a major role in maintaining the recovery state both outside and inside the cell. Glutathione was first discovered in yeast in 1888 by de-Rey-Pailhade, and glutathione got its name after it was isolated as a compound in 1921 by Hopkins.

Глутатион состоит из трех аминокислот: глутаминовой кислоты, цистеина и глицина. Тиоловые группы двух молекул глутатиона могут быть окислены с образованием дисульфидной связи в присутствии активированного кислорода, что приводит к восстановлению указанного активированного кислорода.

Glutathione consists of three amino acids: glutamic acid, cysteine and glycine. The thiol groups of two glutathione molecules can be oxidized to form a disulfide bond in the presence of activated oxygen, which leads to the reduction of said activated oxygen.

 Glutathione is produced mainly in the liver, after which it enters the bloodstream and circulates in the body. In a normal body, glutathione is almost completely present in reduced form. In the case of increased levels of the oxidized form, regeneration of the reduced form occurs due to the action of glutathione reductase in the presence of nicotinamide adenine dinucleotide phosphate (NADP). Thus, reduced glutathione protects the cell membrane from the damaging effects of activated oxygen by reducing said activated oxygen and free radicals. Due to its antioxidant properties, reduced glutathione also has anti-radiation effects and can be used as a therapeutic agent for cataracts. In addition, it has recently been found that in patients with AIDS, systemic levels of reduced glutathione are lowered, which indicates the crucial role of reduced glutathione in the human body. However, under abnormal conditions, the amount of activated oxygen can be so large that virtually all glutathione is present in the oxidized state, and activated oxygen is removed much more slowly than is usually the case under normal conditions.

 A second example of a compound possessing, thanks to its oxidizing properties, various physiological functions, is thioredoxin, which is present both in the intracellular and extracellular spaces. Human thioredoxin (also known as adult T-cell leukemia factor, ADF) was cloned as a factor capable of inducing interleukin-2 (1L-2R) receptors in adult T-cell leukemia cell lines. This factor is a thiol-dependent reductase, which has two cysteine residues in its active center and is capable of reducing activated oxygen and free radicals.

 In addition to inducing 1L-2 receptors, human thioredoxin also has an activity that stimulates the growth of cells of Epstein-Barr virus (EBV) infected B cell strain 3B6, a protective effect against tumor necrosis factor (TNF), derived from monocytic cell line U937, and protective effect against damage to vascular endothelial cells by neutrophils. In addition, due to its regenerative activity within the cell, human thioredoxin acts on the transcription factors NFkB, JUN and FOS, which helps to stimulate DNA-binding activity and thereby increase transcriptional activity. A method is being developed for using human thioredoxin as a protective agent against radiation injuries, and also as a therapeutic agent for treating reperfusion injuries, rheumatoid arthritis and inflammatory diseases, in other words, such injuries and diseases that can be eliminated or reduced by restoring activity specified human thioredoxin.

 As mentioned above, for normal physiological activity of the body it is extremely important that the intracellular and extracellular space is maintained under reducing conditions, which can be achieved by eliminating activated oxygen and free radicals. Obviously, in the intracellular and extracellular space there are many as yet unknown antioxidants and antioxidant enzymes that perform the function of removing activated oxygen and free radicals. Therefore, it would be extremely important to detect these reducing agents capable of regenerating, for example, reduced glutathione. It was fashionable to use such substances for the treatment of various pathological conditions, for example, diseases and disorders described above.

 A brief description of the invention.

 The first objective of the present invention is to obtain a new protease; the nucleotide sequence encoding this protease; a vector containing the DNA sequence encoding the specified protease, and a host cell transformed with the specified vector.

 The second objective of the present invention is to obtain DNA encoding the desired protein, as well as DNA encoding a new protease located above the specified protein, and the nucleotide sequence located between these two DNA sequences, in addition, encodes a peptide cleaved by the specified protease, and all these sequences are in the same open reading frame. In addition, it is an object of the present invention to provide a protein encoded by said DNA, as well as a vector containing said DNA, and an expression system comprising said vector, said vector being capable of autonomous replication in an appropriate host cell, for example, a cell containing the nucleotide sequence necessary for the implementation of autonomous replication.

 Alternatively, the first objective of the present invention is to obtain a nucleotide sequence encoding a new polypeptide having in vivo reducing activity. In addition, it is an object of the present invention to provide such a DNA sequence that encodes a peptide capable of reducing dichloroindophenol and oxidized glutathione.

 Another objective of the present invention is to obtain a recombinant vector containing the above DNA and having the ability to autonomous replication in the host cell, namely in a cell including a base sequence that provides the specified autonomous replication.

 Another objective of the present invention is the production of a microorganism host transformed using the above recombinant vector. In addition, it is an object of the present invention to provide the aforementioned peptide as an expression product of a transformed host cell, as well as to produce monoclonal antibodies against this peptide.

 In this work, we identified and cloned a new CYVV protease (Nla), and, unexpectedly, found that CYVV-Nla can be used as part of a hybrid protein that can be expressed in a host such as E. coli, which allows the production of large quantities the specified hybrid protein, which, in addition, has the ability to self-cleavage with the formation of the desired exogenous product. Moreover, the CYVV-Nla gene can be stably stored and expressed in Esherichia coli, and the expressed Nla product retains its activity as a specific protease activity even if this protein is only a fraction of this hybrid protein.

 In addition, we also found a DNA sequence encoding a new polypeptide capable of reducing dichloroindophenol (also known as dichlorophenolindophenol, 2,6-dichloroindophenol, or 2,6-dichloro-4- (4-hydroxyphenyl) imino-2,5 -cyclohexadiene-1-one), and oxidized glutathione, wherein said polypeptide can be obtained in large quantities using genetic engineering techniques. This polypeptide can be used with particular effectiveness in the treatment of diseases caused or mediated by oxidative stress, or any other diseases caused by activated oxygen, such as atherosclerosis, diabetes, and ischemic conditions (including reperfusion disorders, coronary heart disease, cerebro-ischemia, and ischemic enteritis).

So, for example, in the first aspect of the first embodiment, the present invention relates to a polynucleotide sequence, which, in the direction 5′_ → 3 ′ and in the same open reading frame, includes:
a) a sequence encoding a protein of "nuclear inclusion a" virus of the yellow vein mosaic of clover, or a mutant or variant thereof having the same proteolytic specificity as a protein of "nuclear inclusion a" virus of a yellow vein mosaic of clover, b) a sequence encoding a peptide, recognizable and cleaved by the indicated protein of the “nuclear inclusion a” virus of the yellow vein mosaic of clover, or its mutant or variant, c) at least one sequence encoding a polypeptide.

 The present invention also relates to a sequence encoding a protein of nuclear inclusion a virus of yellow clover mosaic virus, or a mutant or variant thereof having the same proteolytic specificity as said protein of nuclear inclusion a virus of yellow clover mosaic virus.

 In addition, the present invention relates to a vector, in particular to an expression vector containing the sequence as defined above.

 The present invention also relates to a host transformed with a vector as defined above; to an expression system comprising said host and said expression vector, as well as a polypeptide produced by said expression system.

 In a first aspect of an alternative embodiment, the present invention relates to a polynucleotide sequence encoding a polypeptide having an amino acid sequence of amino acids 1-526 of sequence ID N 12, or encoding a mutant or variant of said polypeptide, provided that the polypeptide encoded by said polynucleotide sequence has ability to restore dichloroindophenol and oxidized glutathione.

 In addition, the present invention relates to a vector, in particular to an expression vector containing the sequence as defined above.

 The present invention also relates to a host transformed with a vector as defined above, to an expression system including said host and said expression vector, as well as to a polypeptide produced by said expression system.

 In addition, the present invention relates to the above polypeptide, which can be used for therapeutic purposes, to the use of the specified polypeptide for the treatment and prevention of diseases or conditions caused or mediated by oxidative stress, or any other diseases caused by activated oxygen, as well as a pharmaceutical composition containing the specified polypeptide.

 In addition to the foregoing, the present invention relates to a monoclonal antibody and its equivalents directed against a specified polypeptide, to a method for producing this antibody, as well as to a method for purifying a polypeptide using said antibody.

A brief description of FIG. 1 - 7, 8a, 8b, 9 - 13
The present invention is illustrated in FIG. 1-7, 8a, 8b, 9-13, which are described below.

 In FIG. 1 shows a restriction map of the cDNA of an Nla region isolated from CYVV cDNA.

 In FIG. 2 illustrates the construction of plasmid pKN15 ′ containing the 5′-region of “nuclear inclusion a” (Nla).

 In FIG. 3 illustrates the construction of plasmid pKN151L containing a portion of the 1L-11 gene and the 5'-region of Nla.

 In FIG. 4 shows the primers that were used to produce the 5 ′ 1L DNA fragment and the C1N3 DNA fragment, and into which the 3 ′ end of the Nla gene was crosslinked to the 5 ′ end of the 1L-11 gene.

 In FIG. 5 illustrates the ligation of a C1N3 DNA fragment and a 5'-1L DNA fragment using a polymerase chain reaction.

 In FIG. 6 illustrates the construction of plasmid pK SUN 9.

 In FIG. 7 shows a restriction map of the plasmid PUCKM31-7.

 In FIG. 8a and b illustrate a comparison of the nucleotide sequences of the 3 ′ ends in pUCKM31-7 and pcD-31.

 In FIG. 9 shows a construction diagram of pSR α 31-7.

 In FIG. 10 shows a diagram of the introduction of a histidine hexamer coding sequence into plasmid pUCKM31-7.

 In FIG. 11 shows a design scheme for plasmid pMAL31-7.

 In FIG. 12 illustrates an analysis of dichlorophenol-indophenol-reducing activity.

 In FIG. 13 illustrates the determination of activity directed to the reduction of oxidized glutathione.

DETAILED DESCRIPTION OF THE INVENTION
The following description of the present invention relates mainly to the first embodiment, however, this description can also be attributed to the second embodiment, unless it is clear that this discussion cannot be applied to the specified second embodiment.

 It should be noted that the preferred form of the polynucleotide sequence of the present invention is DNA, and therefore the further description will relate mainly to DNA. However, where necessary, the description also contains indications of RNA. RNA is not the preferred form of the nucleotide sequence for the present invention, since its use is practically limited. For example, mRNA can be expressed in Xenopus societies (claw frogs) or in a system of wheat seedlings lysates, however, none of these expression systems can produce large amounts of fusion protein in a cost-effective way.

 As used herein, the term “peptide” means any molecule containing 2 or more amino acids linked by a peptide bond. This term may mean an oligopeptide, polypeptide or protein. The term "hybrid protein" refers to any single polypeptide obtained by combining two or more different peptide sequences.

 It should also be noted that the preferred sequence of the present invention is a double-stranded sequence; however, the present invention also contemplates the antisense sequence corresponding to the sequence of the present invention. The double-stranded (dc) sequence of the present invention may have one or two “sticky” ends, and in this case, it is not necessary that the antisense and sense strand exactly match each other.

 It is understood that the protein encoded by sequence (a) as defined above cleaves the peptide encoded by sequence (b) as defined above, thereby releasing the polypeptide (s) encoded by sequence (c) as defined above, provided that said sequence of the present invention is expressed in a suitable expression system.

 Cleavage of the fusion protein can take place at any time after translation of sequences (a) and (b) as defined above. In this regard, it should be noted that the polypeptide encoded by the sequence (c) as defined above does not have to be fully translated before cleavage. In practice, however, it has been found that at least some, and sometimes most, of the fusion protein is fully translated before cleavage.

 If sequence (c), as defined above, encodes more than one polypeptide, then in this case it is necessary that encoded cleavable sequences located between each of the encoded polypeptides, except when it is necessary to obtain an unsplit hybrid from a plurality polypeptides.

 If sequence (c), as defined above, encodes more than one polypeptide, then this sequence may be susceptible to attenuation under transcription conditions. Upon attenuation, the transcription of the mRNA sequence of the present invention is terminated before all the mRNA is read, resulting in less polypeptides encoded closer to the 3'-end of the sequence than polypeptides encoded closer to the 5'-end. However, if several polypeptides are not encoded and / or if these polypeptides are not very long, then there are no problems associated with attenuation.

 In general, it is preferred that sequence (c) as defined above encodes only one polypeptide, unless it is necessary to obtain several peptides for sharing, or when it is necessary to obtain a hybrid of several polypeptides. Otherwise, after cleavage, it will be necessary to isolate each individual polypeptide, and this operation can be very time-consuming, and in addition, purification procedures can lead to significant losses of the final product.

 However, if sequence (c) as defined above encodes more than one polypeptide, and if there is a cleavable sequence between each of these encoded polypeptides, then it is not necessary that these cleavable sequences be recognized by CYVV-Nla. All that is required in this case is that the cleavable sequence between the sequence (a) and the 5'-end of the sequence (b) is recognized by the protease encoded by the sequence (a). However, if it is necessary or permissible that the fusion protein undergoes self-cleavage to form several polypeptides, then any other of the cleaved sequences may be a recognized protease encoded by the sequence (a). Moreover, these other sequences can be selected so that they are split in other ways. For example, a fusion protein will be cleaved by its Nla part after transcription to form Nla and a polyprotein, after which Nla can be removed and the polyprotein can be cleaved, for example, by factor Xa or trypsin.

 The cleavable peptide encoded by sequence (b) as defined above (also referred to as the "cleavable sequence" and the "cleavable peptide") may be a sequence that is wholly or partially included in any of the sequences encoded by sequences (a) and (c) ( "Nla" or "protease" and "polypeptide, respectively). Thus, for example, the N-terminus of a cleavable peptide can also be included in the C-terminal sequence of the protease, and the C-terminus of the cleavable peptide can be included in the N-terminal part of the polypeptide. In this case, the cleavable peptide cannot exist independently, and restriction sites for the protease must be designed from the C-terminus of the protease to the N-terminus of the polypeptide.

 A cleavable peptide may also be included only in a portion of either the protease or the polypeptide. In this case, the N-terminus of the cleavable peptide will be included in the C-terminal portion of the protease, and the N-terminus of the polypeptide will either be directly linked to the cleavable sequence, or one or more amino acid residues may be present between the polypeptide and the linker.

 If one or more amino acid residues are present between the cleavable sequence and the protease and / or between the cleaved sequence and the polypeptide, then the number and nature of these residues must be such that these residues do not interfere with the action of the protease. Excess amino acid residues at the N-terminus of the polypeptide are generally undesirable, since these residues must be removed to obtain a mature form of the polypeptide. It is usually preferable if, if possible, and if there are no contraindications, to design a cleavable peptide so that a mature form of the desired protein is formed after cleavage of the fusion protein. However, it is possible to obtain a protein having, for example, Gly, Ser or Ala attached to the N-terminus, which can then be removed, if necessary, using the appropriate aminopeptidase.

 In some cases, it may be preferable between the N-terminus of the polypeptide and the cleavable sequence to encode proline. This will allow, for example, using aminopeptidase P (3.4.11.9) to cleave residues located before the proline, but not after it. And then the proline residue can be removed using proline iminopeptidase to obtain a mature protein. This embodiment of the present invention is preferred.

 Sequence (a) encodes a protease capable of cleaving a fusion protein encoded by the sequence of the present invention. According to the present invention, such a protease is a “nuclear inclusion of a” (Nla) clover yellow mosaic virus or a mutant or variant thereof having the same proteolytic specificity as said clover yellow mosaic virus Nla-protease.

 This prosthesis, namely the "nuclear inclusion a" (Nla) of the yellow clover mosaic virus (CYVV), is encoded by nucleotides 10-1311 of sequence ID N 1 (see below, list of sequences), and the primary Nla sequence is represented by amino acids 4-437 of the sequence ID N 2 (see below, a list of sequences). These sequences are new, and therefore, as well as their mutants and variants, they are included in the scope of the present invention.

 “Nuclear inclusion a” has proteolytic activity that promotes specific hydrolysis of the peptide bond between Gln-Ala, Gln-Gly or Gln-Ser in the peptide substrate. In addition, it was also found that Nla can be cleaved by Gln-Val. Thus, the authors of this application have found that, in contrast to other proteases of the potivirus family, Nla CYVV (hereinafter, unless indicated otherwise, the designation Nla will mean Nla CYVV) can cleave the sequence AsnCys SerPheGlnX, where X represents any amino acid residue, preferably Gly, Ala, Val or Ser, and more preferably Gly, Ala or Ser.

 It should also be noted that peptides comprising the AsnCys SerPheGlnX sequence can be cleaved with an Nla protease, especially if the sequence is sterically exposed to an Nla protease. Thus, the present invention also relates to a system used to produce a polypeptide, wherein a polypeptide precursor comprising an AsnCys SerPheClnX sequence is cleaved by an Nla protease. This system may also include any other processing steps carried out, if necessary, before, after or simultaneously with Nla protease cleavage.

 Although it is generally preferable to use a sequence encoding a natural Nla (sequence ID N 2), however, mutants or variants of Nla may equally well be used in the present invention.

 As indicated above, these mutants or variants must have a specificity similar to that of natural Nla. In accordance with this, this mutant or variant should have a sequence that is mainly homologous to the sequence of amino acids 4-437 in SEQ ID N2, except in those cases where, as is obvious to every specialist, some changes are possible that are not affected by the recognition sequence or do not reduce protease activity is below acceptable levels.

 In general, it can be noted that the activity of this protein depends on certain conserved regions of this molecule, while other regions do not play such an important role and can be virtually or completely superfluous. In accordance with this, as already mentioned above, the present invention includes any variants and mutants that have a specificity similar to that of a natural Nla protease. Said variants or mutants may include, for example, deletions, insertions, additions, inversions, repeats and substitutions (for example, one hydrophilic residue to another hydrophilic residue, but not substitutions such as a highly hydrophobic residue to a strongly hydrophilic residue). Small changes usually do not have a significant effect on the activity of the molecule, unless they fall on the main part of the molecule, and such changes can occur as by-products of genetic manipulations, for example, when constructing extra restriction sites, if necessary.

 Generally speaking, there are usually no good reasons for changing the structure of Nla, except, perhaps, for some very obvious cases. Indeed, most mutations or variations in the amino acid sequence or in the coding sequence result from the isolation of new variants on the natural wild-type virus. Nevertheless, intentional and even random modifications should also be included in the present invention, provided that they possess the necessary specificity and sufficient proteolytic activity.

 Used in the present description, the term "adverse effect" means any effect on the specificity or activity of the protease, leading to a significant decrease in its effectiveness compared to natural Nla (see above), due to a decrease in its activity below the required level.

 In this case, many substitutions, insertions, etc., can be carried out, provided that they do not adversely affect the protease activity. As a rule, a serious adverse effect on protease activity occurs only when the 3-D (tertiary) Nla structure undergoes significant modification.

Used in the present description, the term "mutants" refers to deletions, additions, insertions and substitutions of amino acid residues in the sequence of prostheses, the activity of which is not exposed to adverse effects. Used in the present description, the term "variants" refers to natural Nla CYVV having a sequence similar to the sequence of ID N 2, but nonetheless different from this sequence within the limits expected for this population. The term "variants" includes parallel variants, and peptides from those species that exhibit a similar type of activity and have a related sequence
It should be noted that neither Nla nor the protein related to the second embodiment of the present invention should fully correspond to sequences ID N 2 and 12, respectively. The only thing necessary is that each of these polypeptides possess the desired activity, regardless of whether this polypeptide is any part of the indicated natural sequence, or it is just a mutant or variant of this part of the sequence.

 It is believed that eukaryotic genes, such as the interferon gene, usually exhibit polymorphism (see Nishi T. et al, 1985), J. Biochem 97, 153-159). This polymorphism leads to the fact that in some cases one or more amino acids in the polypeptide are substituted, and in other cases such a substitution is not observed, despite the substitution in the nucleotide sequence.

 Accordingly, it should be noted that the polynucleotide coding sequence can also be modified in any way, provided that such a modification will not adversely affect protease activity. For example, point mutations and other changes can be made with the addition or deletion of restriction sites, for example, for the implementation of certain genetic manipulations / expressions or for more effective implementation of various modifications of the Nla molecule.

 The term “mutant” or “variant”, as used herein, also refers to a polynucleotide sequence that can be designed with the corresponding necessary changes. It should be noted that although mutations or variations of the peptide sequence are always reflected in the coding nucleotide sequence, the converse is not necessarily true. Therefore, it may turn out that significant changes in the nucleotide sequence (see discussion below on the degeneracy of the genetic code) will not have any effect on the peptide sequence. Accordingly, these mutants and nucleotide sequence variants are also included in the scope of the present invention.

 Thus, for example, it was found that a protein obtained by replacing the cysteine codon in the interleukin gene (ID-2) with a serine code is able to nevertheless produce 1L-2 activity (Wang A. et al., (1984), Science 224: 1431 -1433). Therefore, the scope of the present invention encompasses any nucleotide sequence, provided that it encodes a natural or synthetic protein having the corresponding Nla activity.

 The gene encoding the Nla protease of the present invention can be easily obtained by any specialist by reverse engineering based on the sequence of ID N2.

 It should be noted that due to the degeneracy of the genetic code, any specifically constructed sequence will not necessarily be good, or even will not hybridize with any given complementary sequence constructed on the basis of the same peptide. This factor is known to every person skilled in the art, and the degeneracy of any particular sequence is often so obvious that the synthesis of even a very short complementary oligonucleotide sequence in order to use it as a probe for a natural oligonucleotide sequence presents significant difficulties.

 So, for example, the degeneracy of the code can be such that 4 or more codons can correspond to the most frequently occurring amino acids. Therefore, it is obvious from this that the number of possible coding sequences for a given peptide will increase exponentially with the number of residues. Accordingly, it should be noted that the number of possible coding sequences for the Nla of the present invention can be expressed in six-digit digits or even higher-order digits. However, it may be desirable to balance the G + C content in accordance with the expression system in question, and in this case other factors must be taken into account, such as the frequency of occurrence of the codon for the expression system.

 As indicated above, hybridization cannot serve as a reliable indicator of sequence homology, but nevertheless, those sequences whose homology with respect to the sequence ID N 1 is more than 50%, preferably 70%, and more preferably 80% are mostly preferred. However, in any case, the protease, as defined above, must be encoded.

 The present invention also relates to the possible use of a leader sequence encoded "above" from a protease. This sequence facilitates the externalization of the fusion protein from the host cell and its release into the culture supernatant. The externalized fusion protein may then undergo self-cleavage to form a polypeptide. For these signal sequences, any suitable sequence may be used, in particular one that has been specifically prepared for a given expression system.

 The present invention also relates to vectors containing the sequence of the present invention. In accordance with the present invention, the nature of the vector is not critical. Suitable expression vectors and constructs necessary for their preparation can be selected by the person skilled in the art depending on the objectives pursued, for example, cloning or expression.

 Suitable expression vectors are phage or plasmid vectors, both of which are host-specific, although they are often used for other hosts. Other suitable vectors are cosmids and retroviruses or any other carriers that may be specific or nonspecific for a given system. Suitable regulatory sequences, such as a recognition sequence, a promoter, an operator, an inducer, a terminator, and other sequences commonly used to regulate expression, can be easily selected by a person skilled in the art, these sequences can be associated with CYVV or the vector used, or they can occur from any other source. These vectors can be modified or constructed accordingly.

 It should be noted that the sequence ID 2 is a sequence sufficient to encode a complete Nla protease. To facilitate doping, a terminator, promoter, and some other regulatory sequence can be added to the corresponding vector or expression of either of these.

 It should be noted that the DNA fragment encoding the Nla of the present invention, together with any fragment encoding a cleavable sequence, as well as a fragment encoding the polypeptide (s), can be easily inserted into any suitable sector. Ideally, to facilitate insertion, it is desirable to use a vector having appropriate restriction sites, but ligation at the blunt ends can also be carried out, although this can lead to uncertainties regarding the open reading frame and the insertion direction. In such cases, of course, it is desirable to experimentally transform the hosts with a transfected vector in order to select vectors having the desired fragments inserted in the correct direction and in the correct reading frame. To fully guarantee that these fragments will be in the correct reading frame, it is desirable to create an appropriate design from the sequences (a), (b) and (c), which can then be directly inserted into the vector, which will reduce the uncertainty in obtaining the desired expression vector. Suitable vectors can be selected by the person skilled in the art according to the desired expression system.

 A desired protein can be produced, for example, by transforming E. coli obtained by a plasmid, followed by selection of transformants using ampicillin or other suitable means and adding tryptophan or another suitable promoter inducer (such as indolyl acrylic acid). The degree of expression can be evaluated using SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (Laemmli et al., Nature, (1970), 227, pp. 680-685).

 It should also be noted that when using another vector, any other suitable selective marker or markers or an alternative selection method can be used, and / or, if necessary or convenient, any suitable promoter can be used.

 If the hybrid protein needs to be isolated from the host cells, then after cultivation, the transformed cells are collected, disintegrated, for example, by ultrasonic treatment and centrifuged. Cell destruction can also be carried out by enzymatic hydrolysis, for example, using cellulose or by mixing with glass spheres on a shaker, however, an ultrasonic method is more preferable because it does not require the use of additional ingredients. The resulting supernatants can be analyzed for polypeptide activity, and the cleavage products can be evaluated, for example, using DSP-PAGE electrophoresis.

 To obtain the expression product, protein is purified by standard methods.

 The DNA of the present invention can be obtained by isolating the RNA genome from clover yellow mosaic virus (Uyeda, 1. et al., (1975) Ann Phytopath. Soc. Japan 41: 92-203). A suitable source of CYVV is the American Type Culture Collection (ATCC, N PV 123). Yellow clover mosaic virus can be defined as a virus that causes necrosis in Vicia faba.

 Genomic RNA can be obtained from CYVV particles isolated from infected plants, and then double-stranded cDNA can be obtained by reverse transcription of the indicated RNA and using known methods.

To determine whether a given virus is a mutant or variant strain of CYVV, sequence homology can serve as a good indicator. Many types of potiviruses are known to those skilled in the art, and all of them differ in their pathogenicity. The belonging of this virus to the potivirus family can be established on the basis of the serological affinity of the envelope proteins of the virus and the homology of their amino acid sequences. Accordingly, viruses whose amino acid sequences have 90% homology are considered as viruses belonging to the same strain, while viruses whose amino acid sequences have less than 70% homology are considered
as members of different families (Shukla, DD & Ward, CW (1989), Arch, Virol 106: 171-200). Based on the various properties of the CYVV envelope protein used in the present invention (Uyeda, 1, et al. (1991), 32: 234-Intervirol 245), CYVV is considered as an independent member of the potivirus family. Therefore, any virus that detects 90% or more homology of the primary amino acid sequence of the envelope protein, or any virus that is positive for ELISA analysis using anti-CYVV antiserum (for example, ATCC N PVA-123: CYVV antiserum), is considered a virus strain yellow vein mosaic of clover.

 The plants on which CYVV can be cultivated are Phaseolus vulgaris (common beans), Vicia faba (fava beans) and Pisum sativum (sowing peas), of which Vicia faba, Wase-soramme, is preferred.

 A preferred method for purifying viral particles involves homogenizing the leaves of an infected plant and diluting them in an appropriate buffer, followed by extraction with an organic solvent and repeated differential centrifugation with final centrifugation in a sucrose density gradient.

 One way to confirm that a given viral particle belongs to the CYVV species is to analyze the viral particle under an electron microscope. Another way is to inoculate Vicia faba with this viral particle, followed by the observation of developing symptoms.

 Suitable methods for extracting genomic RNA from viral particles are the guanidinium / phenol thiocinate method, the guanidinium / trifluorocesium thiocinate method, and the phenol / SDS method. However, a preferred method is density gradient alkaline sucrose centrifugation (Dougherty, W.G. & Hiebert, E. (1980), Virology 101: 466-474).

 In order to verify whether the resulting RNA actually encodes a protease, this RNA is tested by translation in a cell-free translation system. Autolysis (self-cleavage) can then be detected when RNA encodes more than one protease in a complete translational product by controlling for any change in molecular weight of products collected from lysates. Such control can be carried out, for example, using an antibody against a shell protein.

 If necessary, the production of the translational product can be controlled, for example, for a certain period of time using an antibody against a shell protein, and genomic RNA can be translated by injecting it into Xenopus laevis oocytes (Spur frog) (Gurdon JB (1872), Nature 233: 177-182) either by using rabbit reticulocytes or a wheat seedling lysate system (Schleif. PF & Wensink PC (1981), in Practical Methods in Molecular Biology; Springer-Verlag, NY).

 Single-stranded DNA can be synthesized using the PHK thus obtained as a template and using reverse transcriptase, and double-stranded (dc) cDNA can be synthesized from single-stranded (sc) DNA in accordance with standard procedures. Suitable methods for this purpose are the method using nuclease s1 (Efstratidiatis, A. et. Al. (1976), Cell 7: 279-288: Okayama H. & Berg, P. (1982), Mol. Cell. Biol. 2 : 161-170 et al.), The Land method (Land H. et.al., (1981), Nucleis Acid Res, 9, 2251-2266) and the O.Joon Yoo method (Yoo OJ et al., (1983) , Proc. Natl. Acao. Sci USA 79, 1049-1053). For the purposes of the present invention, it is preferable to use the Gubler-Hoffman method (Gubber, U. & Hoffman, B.J. (1983), Gee 25: 263-269).

 The dzDNA thus obtained can then be introduced into a cloning vector, such as a plasmid or lambda phage, and the resulting recombinant vector can be transformed into a microorganism, such as Escherichia coli. Especially preferred is E. coli DH5 strain. After this, transformants can be selected for their resistance to bactericidal agents, such as tetracycline or ampicillin, using standard techniques.

 The transformation can be carried out, for example, by the Hanahan method (Hanahan, D (1983), J. Mol. Biol. 166: 557-580), which consists in the fact that the recombinant DNA vector is introduced into the cell, which was made previously competent by treatment with chloride calcium, magnesium chloride or rubidium chloride.

 The selection of transformants containing DNA encoding Nla was carried out by the method described below.

(1) Screening using probes
If it is desirable to use wild-type CYVV virus as the source of RNA, then to isolate the corresponding RNA, it is necessary to use a cDNA probe, provided that the amino acid sequence Nla has been previously detected (part of the sequence used may come from any Nla region). In this way, an oligonucleotide corresponding to a specific amino acid sequence is synthesized. Generally speaking, the selected amino acid sequence should contain, as far as possible, the minimum number of degenerations, otherwise it is necessary to produce several probes using, if possible, various codons. In such cases, in addition, the frequency of occurrence of the codon used should be taken into account. Alternatively, multiple nucleotide sequences may be contemplated, and varying nucleotides may be replaced with inosine. The probes can then be labeled with a radioactive isotope, such as ³² P, ³⁵ S, or biotin. After this, transformant strains can be identified by fixing the denatured plasmid DNA on nitrocellulose filters using radiolabeled probes, while positive clones can be detected by autoradiography.

(2) Using PCR Probes
In this method, oligonucleotides corresponding to parts of a known amino acid sequence are synthesized from the sense strand and the antisense strand, and the polymerase chain reaction is carried out (Saiki PK et al. (1988), Science 239, 487-491). These oligonucleotides are used to amplify a DNA fragment encoding Nla. A suitable DNA template is cDNA obtained by reverse transcription of viral genomic RNA, which is known to encode Nla. The thus obtained DNA fragments are labeled, for example, with ³² P, ³⁵ S or biotin, and colonies or plaques are hybridized to select the desired clone.

(3) Screening by exogenous production in an animal cell
This method involves culturing a transformant strain to amplify a gene, and then transfecting this gene into an animal cell (usually using a plasmid having transcriptional competence and containing a transcriptional promoter region, or using a plasmid that can be integrated into the corresponding chromosome), as a result what is the production of the protein encoded by the specified gene. A transformant strain can be selected by evaluating the corresponding activity.

(4) Selection using anti-Nla antibodies
An anti-nuclear inclusion antibody (Nla and Nlo) or an anti-protein antibody produced using an expression vector in the corresponding system is produced from a plant infected with CYVV virus. The desired Nla or the desired strain can then be detected using the antibody or its anti-antibody.

(5) Translational system for selective hybridization
Transforming cDNA was hybridized with mRNA originating from Nla expressing cells and described above and, mRNA bound to cDNA was dissociated and isolated. Isolated mRNA was translated into a protein in the translation system, for example, by injection into Xenopus laevis oocytes or into cell-free systems, such as rabbit reticulocyte lysate or wheat germ lysate. The desired strain was selected by evaluating Nla activity or by detecting Nla with an anti-Nla antibody.

 DNA encoding CYVV-Nla can be obtained from transformed strains by known methods (see Maniatis T. et al, (1982), in the "Molecular cloning A Laboratory Manual" Cold Spring Harbor Laboratory, N.Y.).

 For this, for example, a fraction corresponding to vector DNA is isolated from cells, and a region of DNA encoding the desired protein is cut from the indicated plasmid DNA.

 The determination of the DNA sequence thus obtained can be carried out, for example, by the chemical modification method of Maxam-Gilbert (Maxam A. M & Gilbert, W. (1980), in “Methods in Enzymology 65: 499-276) or by the method of dideoxy termination chains using phage M13 (Messing J. & Vieira, J (1982), Gene 19: 269-276).

 Recently, there is a tendency to use fluorochrome instead of more dangerous radioactive isotopes to determine DNA sequences. In addition, the circuit is currently being dideoxy terminated using computer-controlled robotics. Systems for reading sequences after electrophoresis are also widely used; examples of such systems are the CATALYST 800 (robot for sequencing) and the 373A DNA sequencer (Perkin-Elmer Japan Applied Biosystems). These systems allow the determination of DNA sequences with a high degree of efficiency and reliability.

 The vectors of the present invention can be organized in such a way that they will be expressed in "standard cells", either eukaryotic or prokaryotic. In addition, by introducing the corresponding promoter of the sequence for phenotypic expression into this vector, the desired gene can be expressed in selected host cells.

 Suitable prokaryotic hosts are Escherichia coli and Bacillus subtilis. For phenotypic expression of the corresponding gene, a replicon derived from a species that is compatible with the host can be introduced into the vector. In the case of E. coli, the plasmid may contain a replication initiation site and a promoter sequence, such as lac or Uv5. Preferred are vectors that, based on their phenotypic trait, can impart selectivity to the transformed cell.

 In most cases, Escherichia coli is used as the host, and a particularly preferred host is strain JM 109, derived from strain E. coli K12. Vectors for E. coli are typically selected from the pBP322 or pUC series of plasmids, however, other vectors and strains can be used if necessary. Suitable promoters for E. coli are the lactose promoter (lac), the tryptophan promoter (trp tryptophan-lactose promoter (tac), the lipoprotein promoter (lpp), the lambda (λ) promoter (PL) (from the λ phage), and the Tu- promoter polypeptide chain elongation factor (tufB), however, the present invention is not limited to these promoters.

 Suitable strains of Bacillus subtilis are strain 207-25. Suitable vectors are pT B228 (Ohmura K. et al (1984), J. Biochem 95: 87-93) and others. A suitable promoter is the regulatory sequence of the α-amylase gene of Bacillus subtilis. The signal peptide sequence (from α-amylase) can be used for extracellular secretion.

 If it is necessary to express a hybrid protein in eukaryotic cells, then vertebrate, insect, yeast, plant, and the like cells can be used. Preferred vertebrate cells are COS cells, in particular COS-1 cells (see, for example, Gluzman Y. (1981), Cell 23: 175-182), or Chinese hamster ovary cell line (CHO), in which hydrophosphate-free reductase (Urlaub G & Chasin LA (1980), Proc. Natl. Acad Sci. USA 77, 4216-4220), although the present invention is not limited to these examples.

 As indicated above, COS cells are suitable vertebrate host cells and can be used as an example. Expression vectors containing the SV40 replicon are capable of autonomous replication and are equipped with a transcriptional promoter, a transcriptional terminator, and one or more splicing sites. Expression vectors containing the desired DNA sequence can be used to transform COS cells by various methods, for example, such as the method using DEAE-dextran (Luthman H. & Magnusson G (1983), Nucleic Acids Res. 11, 1295- 1308), calcium phosphate co-precipitation method-DNA (Graham FL & Vander Eb., AJ (1973), and electroporation method (Neumann E. et. Al. (1982) EMBO J. 1, 841-845).

 If CHO cells are used as host cells, it is desirable to use a vector capable of expressing a neo gene reporting G418 resistance. Suitable markers carrying this marker are ppSVneo (Sambrook J. et. Al. (1989), "Molecular Cloning-A Laboratory Manual", Cold Spring Harbor Laboramory), u pSV2-neo (Southern PJ & Berg P. (1982) , J. Mol. Appl. Genet, 1, 327-341).

 Transformants can then be selected for their resistance to G418.

 Selected transformants can then be cultured by standard methods, and in the case of the second embodiment of the present invention, the polypeptide is produced both intracellularly and extracellularly. The culture medium may be selected according to the host cells used. For example, for COS cells, a medium containing blood components, such as fetal calf serum, may be added to a medium such as PRM1-1640 or Dulbecco's modified Eagle medium (DMEM), if necessary.

 If insect cells are to be used, cells derived from Spodoptera frugipedra (Smith G.E. et al. (1983), Mol. Cell. Biol. 3: 2156-2165) can be used for this purpose.

 Suitable yeast are baker's yeast (Saccharomyces cereviside) and fissile yeast (Schizosaccharomyces pomle).

 Suitable plant cells are cells from Nicotiana tabacum. (tobacco) and Oryza sativa (planted rice).

 It should be noted that all of the above hosts are standard host cells, usually used in practice, however, specialists can choose other cells suitable for use as hosts.

 Suitable expression vectors for vertebrate cells are those vectors that contain a promoter located upstream of the expressed gene, together with sites such as an RNA splicing site, a polyadenylation site, and a transcription termination site, and which, if necessary, also contain a site replication initiation. An example of a suitable expression vector is pSV2dnfr, which contains the SV40 early promoter (Subramani S. et al, (1981), Mol. Cell. Biol: 854-864).

 A suitable expression system for insect cells is cultured Spodoptera frugipedra cells. Suitable expression vectors contain, for example, a baculovirus polyhedrin promoter located “above” the expressed gene, together with a polyadenylation site, and also a portion of the AcMNPV genon (Acutographa californica nuclear polyhedrosis virus) necessary for homologous recombination. An example of such a vector is pBacPAK8 (Matuura Y. et al. (1987), J. Gen. Virol 68: 1233-1250).

 Yeast, for example baker's yeast (S. cerevisiae), is usually used for eukaryotic expression. Suitable expression vectors for yeast may contain an alcohol dehydrogenase promoter (Bennetzen JL & Hall BD (1982), J. Biol. Chem. 257: 3018-3025), an acid phosphatase promoter (Miyahara A. et al. (1983). Proc. Natl. Acad. Sci USA, 80, 1-5) or a carboxypeptidase Y promoter (Ichikawa K. et al. (1993), Biosci. Biotech. Biochem. 57: 1686-1690). In this case, a signal peptide sequence from carboxypeptidase Y can be used to secrete into the extracellular space.

 A suitable expression vector for plants is, for example, pB1121 containing the 35S promoter (derived from the early promoter of the cauliflower mosaic virus), the polyadenylation site of the nopalin synthesis gene from Agrobacterium tumefaciens; and Agrobacterium tumefaciens gene transfer site (Jefferson, P. A. et al. (1987), EMBOJ 6: 3901-3907). Such a vector can be introduced into plant cells, for example, by infection of bacteria Agrobacterium tumefaciens and by electroporation.

 Plasmid pKK388-1 (constructed by Clonetech Co.) containing the trc promoter is suitable for use in E. coli. This expression vector is capable of autonomous replication in a strain derived from Escherichia coli strain K12 such as strain JM109. this vector can be easily introduced into E. coli by the well-known methods mentioned above. The strain thus obtained can be inoculated into a medium, for example, a well-known medium such as LB medium, and cultured in this medium for a certain period of time.

 The trc promoter can then be activated by the addition of, for example, isopropyl-β-galactopyranoside (IPTG). After subsequent cultivation, the produced protein can then be extracted from the cells by lysis, for example, using an ultrasound apparatus. If it is necessary to produce a protein having Pro at the N-terminus, then, in this case, it is desirable to use E. coli as a host.

 If necessary, in accordance with the examples accompanying the present description, the fraction containing the desired polypeptide can be isolated from the culture of transformed cells and purified by known methods selected depending on the physical and chemical properties of the polypeptide. Suitable methods for this purpose are precipitating agent treatment, ultrafiltration, various types of chromatography (e.g., molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography and high resolution liquid chromatography (HPLC), dialysis and combined methods.

 In order to ensure that the expressed Nla protein has the desired protease activity, the purified Nla protein can be reacted with a substrate containing a cleavable sequence for the protease, for example, such as the expression product of a gene encoding a fusion protein, including the viral envelope protein (a natural substrate for 1a) together with “nuclear inclusion b” (Nlb) (Dougherty, WG at al. (1988), EMBO J, 7: 1281-1287). Said fusion protein can be isolated from a viral genomic cDNA and inserted into an expression vector. The resulting expression vector is then introduced into an appropriate host cell to produce said fusion protein. The resulting fusion protein can be isolated and purified by standard methods, for example, by precipitation using an appropriate precipitating agent or by chromatography.

 The substrate protein isolated and purified in this way can then be reacted with the indicated protease in an appropriate buffer solution at a suitable temperature to isolate the reaction product. The resulting reaction product may then be subjected to electrophoresis or Western blotting using an anti-coat protein antibody in order to evaluate the protease activity detected by the difference in band mobility. A synthetic oligopeptide containing the corresponding cleavable sequence can also be used in this method.

 The proteolytic activity of the protease of the present invention can also be determined without purification. So, for example, this activity can be determined by attaching the protease gene in a sequence and maintaining the reading frame so that it is located “below” the promoter, for example, the trc promoter, and “above” the cleaved sequence for the protease. If the protease is active in the expression product, then with Western blotting, a band with higher mobility than the fusion protein will be observed.

 By isolating this band from the gel in which cleavage was observed, and by analyzing its amino acid sequence using standard methods, it can be determined whether this protein is cleaved in the desired peptide bond.

 The desired protein can be produced, for example, as a fusion protein together with a protein such as glutathione S-transferase, and the Nla of the present invention can then be used to cleave the linker sequence in vitro. In one alternative method, the desired protein is directly produced in the host cell as a fusion protein together with the specified protease, after which the desired protein is formed by self-cleavage.

 If necessary, using the above procedure, Nla can be easily produced in high yield and with a high degree of purity, and the Nla thus obtained ("nuclear inclusion a") of the present invention can be used as a protease.

 Optionally, using a standard method, for example, the trietherphosphite method (Hunkapiller M. et al. (1984), Nature 310: 105-111), or the method of chemical synthesis of nucleic acids (Grantham P. et al. (1981) Nucleic Acids Res 9 : g43-g74) can be carried out the chemical synthesis of DNA of the present invention. If necessary, partial modification of these nucleotide sequences can be carried out using standard techniques, such as site-specific mutagenesis, using a primer containing a synthetic oligonucleotide encoding the desired modification (Mark DF et al. (1984), Proc. Natl. Acad, Sci. 81: 5662-5666).

Hybridization mentioned above can be established, for example, using a probe labeled with, for example, [α- ³² P] oCTP, by the scattered seed method (Feinberg, AP & Vagelstein in (1983) Anal. Biochem 132: 6-13), or by nick translation (Maniatis T, et al. (1982) in the "Molecular Cloning A Laboratory Manual" of Cold Spring Harbor Laboratort, NY). DNA is fixed on the solid phase in a standard manner, for example, by adsorption on a nitrocellulose membrane or on a nylon membrane, and then heated or subjected to UV radiation. After that, the solid phase is immersed in a pre-hybridization solution containing 6 x SSC, 5% Denhardt solution and 0.1% SDS, and incubated at 55 ^° C. for 4 hours or more. Then, a previously prepared probe is added to the pre-hybridization solution until a final specific activity of 1 x 10 ⁶ cpm / ml is reached, after which the mixture is incubated at 60 ^° C. overnight. After that, the solid phase is washed five times, at room temperature and for 5 minutes, with 6 x SSC, followed by a 20-minute washing at 57 ^° C, and then, in order to determine whether DNA hybridization has occurred or not, autoradiography is performed . It should be noted that the example described above is purely illustrative, and other methods may equally well be used for the purposes of the present invention.

 The desired protein can be obtained either by intracellular direct cleavage, or by extracellular cleavage.

Intracellular direct cleavage method
DNA encoding Nla is coupled to DNA encoding the desired protein via a cleavable sequence, preferably Gln-Gly, Gln-Ser or Gln-Ala. The resulting DNA, which encodes a fusion protein, is inserted into a vector containing a promoter and terminator, and the specified vector is used in the corresponding host cell. As a result, the expressed fusion protein is self-cleaved due to protease activity, thereby forming a peptide in which Gly, Ser or Ala are linked by a peptide bond at the N-terminus of the desired protein. A particularly preferred protein for expression is 1L-11.

 If any residue is to be cleaved from the N-terminus of the obtained protein, this can be done as described above, i.e., for example, aminopeptidase P. can be used to remove the N-terminal Pro-residue.

 In some expression systems, aminopeptidase P is already present. However, if the indicated aminopeptidase P is absent, but it is necessary that the N-terminal amino acid residues are cleaved in situ, then in this case, the expression vector for aminopeptidase P. can be introduced into the host cell. Aminopeptidase P is a known protein, and the gene sequence for this enzyme is readily available to every person skilled in the art.

 If it is necessary to obtain a protein whose N-terminus begins with Pro, then for this it is desirable to extend the cultivation time in order to ensure the action of cellular aminopeptidase P.

 As described above, the N-terminal Pro residue can be removed by the catalytic action of proline iminopeptidase (3.4.11.5) endogenously produced or produced by an exogenous expression vector (this enzyme is a known protein, and the gene sequence for this enzyme is easily accessible to specialists). Alternatively, said proline residue can be removed after isolation from an expression system, such as one where the fusion protein is secreted from the cell.

 Thus, thanks to the present invention, proteins can be produced having any desired N-terminal residue.

 If the sequence of the present invention produces a polypeptide having an N-terminal Ala, then this alanine residue can be removed by the catalytic action of alanine aminopeptidase (3.4.11.14), which is also a known enzyme, and the gene sequence of which is readily available to everyone skilled in the art. The described technique also allows the production of a polypeptide having a freely selected N-terminal residue.

 Then the desired protein can be isolated and purified in accordance with standard methods.

 Extracellular cleavage method.

 Nuclear inclusion of a (Nla) can be produced by introducing the appropriate DNA into a vector, which, in turn, is introduced into a suitable expression system. Nla produced in transformed cells can then be purified by ion exchange chromatography, gel filtration, or reverse phase chromatography. Alternatively, Nla can be produced as a hybrid with another polypeptide, such as glutathione S-transferase or a maltose binding protein, said hybrid protein can be separated and isolated using a glutathione or maltose column, respectively. After cleavage of the purified product with enterokinase or Xa factor, Nla can be purified and used for appropriate purposes.

 Meanwhile, a precursor protein is obtained that contains a Nla recognition sequence (cleavage sequence). It can be present in this region, or this protein can form part of a hybrid protein, for example, with a protein that binds to maltose, or with glutathione-S-transferase connected via a suitable linker (cleavable sequence). The reaction of said precursor with Nla in an appropriate buffer solution facilitates the cleavage of the precursor in vitro. If necessary, the N-terminal amino acid residues can be removed as described above.

 As indicated above, the resulting protein can be isolated and purified by known methods.

 As for the second embodiment of the present invention, the authors believe that the natural reducing peptide has the sequence shown in the list of sequences (see below) as SEQ ID N 12 and consists of 526 amino acids with a Val residue at the N-terminus.

 The authors also believe that the natural DNA encoding this peptide has a nucleotide sequence consisting of nucleotides 70-1647, and shown in the list of sequences as SEQ ID N 11.

 The peptide of the present invention is capable of reducing oxidized glutathione and dichloroindophenol. The description of the indicated peptide provided in this application is rather accurate, but somewhat cumbersome, and therefore, further, the peptide of the present invention will be designated as KM31-7-peptide or protein.

 KM31-7-protein, or its mutant, or variant is produced in the body itself, and therefore the problems associated with the toxicity and / or antigenicity of proteins are practically absent in this case.

 According to a second embodiment of the present invention, it is contemplated that a polypeptide having an amino acid sequence of -23 to 526 (sequence ID 12) is a precursor of a KM31-7 protein. In this regard, it should be noted that the present invention also encompasses said precursor, its mutants, and variants, and a polynucleotide sequence encoding any of these peptides.

 The following discussion relates generally to the second embodiment of the present invention. It should be noted that the procedures described above for CYVV-Nla can also be used to isolate, clone and express the DNA encoding the peptide of the present invention. All possible discrepancies are based on the fact that CY Nla is a plant virus protein, while the peptide of the present invention is a mammalian protein. Below will be described the main stages of obtaining a specific polypeptide produced from mammalian cells by genetic recombination methods.

 mRNA encoding a KM31-7 peptide can be obtained and then transcribed back into dsDNA according to well-known techniques. Any suitable mammalian cell, cell line or tissue can be used as a source of mRNA, however, it is preferable to use the KM-102 cell line derived from stromal cells of the human brain (Harigaya K. & Handa H. (1985), Proc, Natl, Acad Sci, USA 82, 3447-3480).

 Any suitable methods can be used to extract mRNA from mammalian cells, for example, the method using hot phenol guanidine thiocyanate or the guanidine thiocyanate and guanidine hydrochloric acid method, however, the cesium chloride guanidine thiocyanate method is generally preferred.

 Since in most cases the mRNA present in the cytoplasm of eukaryotic cells has, as you know, a 3'-terminal (polyA) sequence, the purification of mammalian mRNA can be carried out by adsorption on a column with oligo (dT) cellulose. The eluted mRNA can then be fractionated by centrifugation in a sucrose density gradient.

 It is possible to verify that mRNA really encodes the desired peptide by translating mRNA in the corresponding system, for example, in the Xenopus laevis oocyte system in the rabbit reticulocyte system or in the system of wheat seedlings (see above).

 Measurement of the reducing activity of the expression product can be carried out in accordance with the following description.

I. Determination of dichloroindophenol-reducing activity
The methodology for this determination is described by Beinert H, in "Methods in Enzymology" (1962), 5, 546.

 A 50 μM dichloroindophenol (Sigma) preparation was prepared using 20 mM phosphate buffer and 0.5 M NaCl (pH 7.8), 1 ml of this preparation was then placed in a cuvette (SARSTEDT, 10x4x445 mm) and then a measurement sample was added. 15 microliters of 1 mM NADPH (NADP) (Boeringer-Mannheim) are made in the same buffer and added to the cuvette at room temperature to initiate the reaction. The reductase activity is then determined by a subsequent decrease in the absorption of oxidized dichloroindophenol at 600 nm or by a subsequent decrease in the absorption of A PH at 340 nm.

 II) Determination of the reduction activity of oxidized glutathione.

 The methodology for this analysis is described by Nakajima T et al. In "New Basic Experimental Methods in Biochemistry (6) - Assay Methods Using Biological Activity", 3-34.

 A preparation of 10 mM oxidized glutathione (Boeringer-Manheim) was prepared using 20 mM phosphate buffer and 0.5 M NaCl (pH 7.8), 15 μl of this preparation was placed in a cuvette (10x4x4 mm) after a sample was placed there measurements. 15 μl of the preparation of 1 mm NADPH receive in the same buffer, and then added to the cuvette at room temperature to initiate the reaction. Glutathione reductase activity can then be determined by a subsequent decrease in absorbance at 340 nm.

 Various methods described above can be used to obtain dsDNA from mRNA. Such methods are the S1 nuclease method, the Land method, and the O.Joo Yoo method (see above), however, in the present work, the authors preferred to use the Okayama-Bero method (Okayama H. & Bero P. (1982), Mol. Cell. Biol. 2, 161-170).

 The dc cDNA thus obtained can then be introduced into the cloning vector, and the resulting recombinant plasmid can be introduced into Escherichia coli as described above.

 A transformant strain containing the desired DNA encoding the peptide of the present invention can be selected by various methods, for example, those described above in connection with the selection of transformants containing Nla-DNA, with appropriate modifications. For example, if a polymerase chain reaction (PCR) is used to obtain a probe, then the corresponding DNA template may be the cDNA described above, or genomic DNA.

 In a second embodiment of the present invention, primary screening can be performed to reduce the number of transformant strains being tested. Such initial screening is possible because the peptide of the present invention relates to cytokines, and its mRNA has an AUUUA element common with cytokine mRNA (Shaw. G. & Kamen P. (1986), Cell 46, 659-667). Thus, a synthetic oligonucleotide probe complementary to the AUUUA element can be used for primary screening. Then, screening can be performed by analyzing the production of exogenous protein in mammalian cells.

 The DNA encoding the peptide can then be excised from the vector and sequenced in accordance with the procedure described above for Nla DNA. And just as described above, the DNA fragment can then be introduced into the corresponding vector and used to transform the prokaryotic or eukaryotic host.

 KM31-7-protein can be used either alone or in combination with one or more drugs to prevent and treat diseases caused or mediated by oxidative stress, or any other diseases caused by activated oxygen. Such diseases or conditions include, but are not limited to, atherosclerosis, diabetes, ischemic disorders (such as reperfusion injuries, coronary heart disease, cerebral ischemia and ischemic enteritis), edema, vascular superpermeability, inflammatory diseases, damage to the gastric mucosa, acute pancreatitis , Crohn’s disease, ulcerative colitis, liver disease, Paraguat disease, pulmonary emphysema, chemical carcinogenesis, cancer metastases, adult respiratory distress syndrome, disseminated intras vascular blood coagulation (DIC), cataract, retroletal fibroplasia, autoimmune diseases, porphyremia, hemolysis, erythroblastic (Mediterranean) anemia, Parkinson's disease, Alzheimer's disease, epilepsy, disorders associated with ultraviolet radiation, irradiation caused by radiation ), frostbite and burns.

 According to a second embodiment of the present invention, the pharmaceutical compositions include a pharmaceutically active amount of a KM31-7 peptide and a pharmaceutically acceptable carrier thereof.

 The compositions of the present invention can be administered orally, for example, in the form of tablets, capsules, granules, powders or syrups, or parenterally in the form of injections, infusions and suppositories. If necessary, other routes of administration may be used.

 If the peptide of the present invention must be administered by injection or infusion, then for this purpose a pyrogen-free preparation of the indicated peptide can be prepared, diluted in a pharmaceutically acceptable aqueous solution suitable for parenteral administration. This preparation of the polypeptide solution must have an appropriate pH, isotonicity and stability, according to the conclusion of a technical examination.

 The dose and form of the drug administered can be easily established by the specialist on the basis of such criteria as the patient’s condition, weight, gender, age and diet, the presence of other infections, the time of administration and other clinically important factors. However, in general, the normal oral dose for an adult is on the order of from about 0.01 mg to about 1000 mg per day. This amount may be administered as a single dose or in divided doses within 24 hours. If the indicated peptide must be administered parenterally, it can be administered subcutaneously, intramuscularly or intravenously in a dose of from about 0.01 mg to about 100 mg.

 To fully characterize the KM31-7 protein, it is very important to produce an antibody to this protein. Such an antibody can be used to analyze the functions of the protein, its quantitative analysis and purification, as well as to assess the distribution of the KM31-7 protein in tissues.

 For this, first, by inoculating laboratory animals with a polypeptide produced by E. coli transformed with pMA 31-7 plasmid, an anti-KM31-7 antibody producing hybridoma was obtained, and then this hybridoma formed by antibody-producing cells and myeloma cells was screened and cloned . Antibodies produced by this hybridoma were capable of recognizing a polypeptide isolated from the cell-free supernatant of COS-1 cells transformed with pSP 31-7 plasmid.

 Thus, the present invention relates to an antibody, preferably a monoclonal antibody, or an equivalent thereof capable of specifically recognizing a KM31-7 protein, or a mutant or variant thereof.

 The antibody of the present invention is directed against the KM31-7 protein, or its mutant, or variant. Moreover, the specified antibody may be polyclonal or monoclonal, although a monoclonal antibody is preferred. The reason for this preference is the uncertainty associated with the use of polyclonal antibodies. Therefore, to obtain reliable results, regardless of whether this antibody is used for therapeutic purposes or for purification of the KM31 protein, it is preferable to use monoclonal antibodies.

 Antibodies of the present invention can be obtained from any suitable animal. However, if this antibody is not derived from humans, then in this case problems may arise associated with the antigenicity of this antibody. Therefore, in order to obtain antibodies closer to human antibodies, the desired antibodies can be constructed. This can be achieved by chemical or genetic modification by methods well known in the art.

 The present invention also contemplates anti-idiotypic antibodies, that is, antibodies whose recognition site recognizes the recognition site of the above monoclonal antibodies. Such anti-idiotypic antibodies can be obtained by administering the parent antibody to a suitable animal. It should be noted that this process can continue virtually indefinitely, where each generation will correspond to either the original or the anti-idiotype. However, if these antibodies are not selected for correct recognition after each generation, then their specificity can be largely lost. These anti-idiotypic antibodies can be used, for example, to analyze a free anti-KM31-7 antibody.

 The present invention also relates to antibody fragments of the present invention capable of recognizing a KM31-7 protein, and to molecules carrying a recognition site of said antibodies. Further, such fragments will be referred to as "equivalents" of the antibodies of the present invention.

 Plasmid pMA 31-7 was used to transform E. coli, and expression products were purified and used to immunize laboratory animals. Spleen cells from immunized animals were used to produce hybridomas by fusing these cells with myeloma cells, resulting in a clone producing monoclonal antibodies against KM31 with high concentration and good stability (this clone was designated MKM150-2 and deposited in the Research Institute of Fermentation of the Office of Industrial Sciences and Technology of Japan (Fermentation Research of the Agency of Industrial Science and Technology, Japan) under the accession number GERM BP-5086). As a result of culturing this clone, monoclonal antibodies against KM31-7 were obtained from the culture supernatant.

 The obtained monoclonal antibodies against KM31-7 immunochemically react with a fusion protein obtained by introducing and expressing pMA131-7 in E. coli. This antibody also immunochemically reacts with a KM31-7 protein derived from the supernatant of mammalian cells transformed with cDNA encoding KM31-7.

The production of monoclonal antibodies was carried out in accordance with the following procedures, including:
(a) purification of the biopolymer used as an antigen,
(b) immunizing mice by injection of antigen and obtaining antibody-producing cells from the spleen for an appropriate period of time by sampling and blood testing,
(c) obtaining myeloma cells,
(d) fusion of spleen cells and myeloma cells,
(e) screening for selection of hybridomas producing the desired antibodies,
(f) obtaining a clone from one cell (cloning),
(g) culturing a hybridoma for large-scale production of a monoclonal antibody or breeding mice infected with a hybridoma, as the case may be,
(h) investigation of the physiological activity of the obtained monoclonal antibody or assessment of its properties as a reagent for labeling.

 The production of monoclonal antibodies against KM31-7 was carried out in accordance with the description below. It should be noted that there is no need to adhere to this description with absolute accuracy, and where appropriate, any suitable procedure can be used. For example, as an antibody-producing cell, other cells can be used instead of spleen cells, and myelomas from other mammals can be used instead of mouse myeloma. The following procedure is the preferred method for producing monoclonal antibodies against KM31-7.

(a) Purification of antigen
A fusion protein obtained by expression of pMAL31-7 in E. coli followed by purification of the expression product is an effective antigen. Expression of E. coli TB-1 transformed with pMAL31-7 plasmid was induced with isopropyl-N-thiogalactopyranoside (IPTG). The expressed fusion protein was then purified by affinity chromatography using an amylose resin column (New England Biolabs). KM31-7-protein purified from serum-free culture supernatant of COS-1 cells transformed with plasmid pSR α 31-7 is also an effective antigen.

(b) Obtaining antibody-producing cells
The purified fusion protein obtained in (a) was mixed with Freund's complete or incomplete adjuvant, or with an adjuvant such as potassium alum, and the resulting vaccine was immunized to laboratory animals. As laboratory animals, it is preferable to use BALB / c mice, since in most cases the murine myelomas used come from BALB / c mice. In addition, these mice were well and thoroughly studied, and their characteristics are described in detail. Moreover, if antibody-producing cells and myeloma are derived from a BALB / c mouse, the resulting hybridoma can be cultured in the abdominal cavity of a BALB / c mouse. Thus, the use of BALB / c mice has significant advantages that make it easy to obtain monoclonal antibodies from ascites without the use of cumbersome and complex procedures. However, it should be mentioned that the present invention is not limited to the use of BALB / c mice.

 Said antigen may be administered in any suitable form, for example, by subcutaneous injection, intraperitoneal injection, percutaneous injection or intramuscular injection, with subcutaneous or intraperitoneal injection being preferred.

 Immunization of mice can be carried out with a single injection or several injections administered at appropriate intervals. A preferred immunization schedule involves administering a first injection of antigen and then re-injection, one or more times, at intervals of 1 to 5 weeks. The effectiveness of subsequent procedures can be increased by regularly analyzing the titer of an antibody to a given antigen in the serum of immunized animals, and animals having a high titer of antibodies can then be used to produce antibody-producing cells. Antibody-producing cells used for subsequent cell fusion are preferably isolated 3-5 days after the final immunization of the animal.

 Various known methods can be used to analyze antibody titers, such as, for example, immunoassay using a radioactive isotope (RIA), enzyme-linked immunosorbent assay (ELISA), a method using fluorescent antibodies, and passive hemagglutination, but RIA and ELISA assays from -for their high sensitivity, speed, accuracy and the ability to automate the process.

 The ELISA immunoassay procedure is as follows. The antigen is adsorbed onto the solid phase, and then the solid phase surface is exposed to a protein that is not related to the antigen, for example, bovine serum albumin (BSA) to block any surface areas on which the antigen was not adsorbed. The solid phase is then washed and treated with a serially diluted sample of the “primary antibody (eg, mouse serum). Any anti-KM31-7 antibody in the sample binds to the antigen. After washing, the“ second ”enzyme-linked anti-mouse antibody is added and left to bind to the bound mouse After washing, an enzyme substrate is added and then the antibody titer can be calculated by determining the degree of color development resulting from decomposition of the substrate.

(c) Obtaining myeloma cells
Mature cells of murine cell lines are preferably used as a source of myeloma cells. Suitable examples of such cell lines are the P3-X63 Ag8-U1 (P3-U1) myeloma cell line, derived from 8-azaguanine-resistant BALB / c mice (Current Topics in Microbiology and Immunology, 81, 1-7 (1978)), P3-NS 1/1-Ag4.1 (NS-1) (European J. Immunology, 6, 511-519 (1976)), SP2 / 0-Ag14 (SP-2) (Nature, 276, 269-270 ( 1978)), P3-X63-Ag8.653 (653) (J. Immunology, 123, 1548-1550 (1978)), and P3-X64-Ag8 (X63) (Nature 256, 495-497 (1975)). These cell lines can be subcultured in suitable media such as 8-azaguanine medium (RPM1-1640 medium containing 8-azaguanine, 1.5 mM glutamine, 5 x 10 ^-5 M 2-mercaptoethanol, 10 μg / ml gentamicin and 10% fetal calf serum), Dulbecco's medium, modified by the method of Claims (IMDM), or modified by the method of Dulbecco's Needle medium (DMEM). When subcultured on a normal medium, also known as full GIT medium (5.5 ml of a MEM solution of non-essential amino acids (NEAA, Gibco), 27.5 ml of CTC109 (Cibco), 6 ml of penicillin-streptomycin solution (Sigma ) and 11 ml of a 200 mM solution of glutamine in 500 ml of GIT medium (Wako Pure Chemical Industry) 3-4 days before cell fusion, the number of cells on the day of fusion increased to at least 2 • 10 ⁷ .

(O) Cell fusion
Antibody-producing cells are plasma cells and their progenitor lymphocytes. They can be obtained
from the corresponding organs of the animal, such as the spleen, lymph nodes, peripheral blood, or any combination thereof. However, spleen cells are commonly used.

 Antibody-producing cells were taken 3 to 5 days after the final immunization in mice with a predefined high titer of antibodies. Then, antibody-producing cells were fused to the myeloma cells obtained as described above in (c). The fusion of spleen cells with myeloma cells was usually carried out using the method of polyethylene glycol, due to the relatively low level of cellular toxicity of this compound and the convenience of its use. The cell fusion procedure was carried out as follows.

The spleen and myeloma cells were thoroughly washed with medium or phosphate-buffered saline (PBS), and then mixed so that the ratio of spleen cells in myeloma cells was approximately 5-10: 1, after which they were precipitated by centrifugation. The supernatant was removed, and the cell cluster was carefully digested, and then, with stirring, a mixed solution of polyethylene glycol (PEG) was added, molecular weight: 1000 - 4000. After a few minutes, the cells were subjected to sedimentation by centrifugation. Then the supernatant was discarded again, the precipitated cells were suspended in an appropriate amount of complete GIT medium containing 5-10 ng / ml of mouse 11-6, and the resulting cell suspension was transferred to the wells of the culture plates. After checking each well for positive cell growth, the medium was replaced with HAT medium (complete GIT medium containing 5-10 ng / ml mouse 11-6, 10 ^-6 - 10 ^-3 M hypoxanthine, 10 ^-8 - 10 ^-7 M aminopterin and 10 ^-6 - 10 ^-4 M thymidine).

(e) Selection of colony hybridomas
The culture plate was incubated in a CO ₂ incubator for 10-14 days at 35-40 ^° C. During this time, every 1-3 days, fresh HAT medium was added in an amount equivalent to half the amount of medium.

 Myeloma cells were derived from an 8-azaguanine-resistant cell line, and myeloma cells, as well as hybridoma cells consisting of only myeloma cells alone, cannot survive in the HAT medium. On the other hand, hybridomas containing antibody-producing cells, that is, hybridomas consisting of antibody-producing cells and myeloma cells, are able to survive on this medium. Hybridomas containing only antibody-producing cells are non-viable, and therefore hybridomas consisting of myeloma cells and antibody-producing cells can be selected by culturing in HAT medium.

 In those wells in which the development of colonies of hybridomas was observed, the HATI medium was replaced by the HT medium (which differed from the HAT medium in that there was no aminopterin in it). Then part of the supernatant was removed, and the titer of antibodies against KM31-7 was evaluated, for example, by ELISA analysis.

 The procedures described above relate to an 8-azaguanine-resistant cell line, however, other cell lines can also be used for the purposes of the present invention, provided that such use allows the selection of hybridomas. It goes without saying that in this case it is also necessary to use a different composition of the medium.

(f) Cloning
Hybridomas screened as described in (e) and analyzed for the production of specific anti-KM31-7 antibodies were transferred to another cloning plate. There are many different cloning methods that can be used for the purposes of the present invention, for example a sieving method (in which hybridomas are analyzed by serial dilution so that each well contains only one hybridoma), soft agar cloning method (in which seeded colonies are grown in soft agar medium), a seeding method (in which a single cell is removed using a micromanipulator) and a cloning method using a cell sorter (in which individual cells are sorted using th cell sorter). The most commonly used serial dilution analysis is its simplicity.

 When performing analysis by serial dilution, cloning is repeated 2 to 4 times for those wells in which the antibody titer continues to be observed. A clone constantly producing an anti-KM31-7 antibody is selected as the target hybridoma.

(g) Preparation of Monoclonal Antibody Using Hybridoma Culture
Hybridomas selected as described in (f) are then cultured in an ordinary medium. Large-scale cultivation is carried out by rotary cultivation either in a large culture vessel or in a centrifuge. Monoclonal antibodies to KM31-7 can be obtained by gel filtration of the cell supernatant, followed by collection and purification of the IgG fraction. In addition, a hybridoma can also be grown in the abdominal cavity of a mouse of the same strain (for example, the aforementioned BALB / c mouse) or, for example, a nude mouse (NU / NU mouse). This method can be very simple if you use a special kit to obtain a monoclonal antibody (for example, MAbTrap GlI of Pharmacia)
(h) Monoclonal Antibody Identification
Determination of the isotype and subclass of the monoclonal antibody obtained in (g) can be carried out in accordance with the following description. As examples of the identification technique that can be used for the purposes of the present invention, the Uhterloni method, the ELISA method and the RIA method can be used. Although Uchterloni’s method is very simple, it has the disadvantage that the monoclonal antibody must be concentrated in it when its concentration is too low.

In the case of using ELISA or RIA, the culture supernatant can be directly exposed to the solid phase on which the antigen was adsorbed. A "second" antibody specific for each type of IgG subclass can then be used to identify the subclass. Alternatively, an isotyping kit can be used (for example, an Amersham kit for isotyping a mouse monoclonal antibody). Quantification of the protein can be carried out by the method of Folin-Lowry (Folin-Lowry), or by measuring the optical density at 280 nm (1.4 (OD ₂₈₀ ) = 1 mg / ml immunoglobulin).

 In the examples below, a monoclonal antibody derived from a hybridoma designated MKM150-2 was evaluated as an isotyl of the IgG class and identified as an antibody belonging to the IgG1 subclass.

 The monoclonal antibody obtained in accordance with the present invention has high specificity for the KM31-7 protein. In addition, since the monoclonal antibody is continuously and in large quantities produced by culturing the above hybridomas, it can be used to isolate and purify the KM31-7 protein, and therefore such isolation and purification of the KM31-7 protein using the specified monoclonal antibody by immune precipitation, where the antigen-antibody reaction used is also part of the present invention.

 The present invention is illustrated by the following examples, which, however, should not be construed as a limitation of the invention. All solutions are aqueous and obtained using deionized water (their quantitative ratios are given in percent (wt./volume), unless otherwise specified). Unless described specifically, they can be found in the Molecular Cloning-A Laboratory Manual (second edition, Sambrook, J. Fritisch, EF & Maniatis (1989), Cold Spring Harbor Laboratory Press). Methods for preparing solutions and other media, if it is not indicated in the examples, they are given in the last chapter of this description under the name “Environment.” The methods mentioned in the examples without a description of their implementation are explained in the previous examples.

A) Starting material for CYVV
Leaves infected with clover yellow mosaic virus and kept frozen (CY isolate N 30: Uyeda, 1 et al., (1975), Ann. Phytopath. Soc. Japan 41: 192-203) were ground with 10 volumes of buffer for inoculation.

 CYVV propagation was carried out using Vicia faba (Wase-Sora mame cultivar) (fodder beans) grown to the second developed leaf. The developed sheet was sprayed with carborundum (400 mesh), and then inoculated with the liquid obtained as described above using a glass spatula. 8-10 days after inoculation, the inoculated sheet was covered with a spotted mosaic. This sheet was removed and used as a source for CYVV.

B) Purification of the virus
Leaves isolated as described in AX were crushed in a special cutting machine containing 3 volumes of extraction buffer. After cutting, the leaves were crushed in a mortar. The resulting preparation was slowly stirred for 1 hour at room temperature using a motor equipped with stainless steel stirring blades. The liquid preparation was then squeezed through a double layer of gauze.

All subsequent procedures were carried out at 4 ^o C.

 The crude liquid was mixed with half the volume of chloroform and the resulting mixture was stirred in a Waring mixer, after which the preparation was centrifuged for 15 minutes at 6000 x g. After centrifugation, the aqueous layer was collected and polyethylene glycol (PEG 6000) was added to this fraction to a final concentration of 4% v / v.

The resulting mixture was stirred on ice for 1 hour, and then left on ice for another hour. The liquid thus obtained was centrifuged for 15 minutes at 6000 x g, and the precipitate was isolated as a virus-containing fraction. This precipitate was suspended in 50 ml of 10 mM phosphate buffer (pH 7.4) containing 0.5 M urea, then mixed with an equal volume of carbon tetrachloride and vigorously stirred for 5 minutes, after which the preparation was centrifuged for 10 minutes at 3000 x g. Then the aqueous phase was subjected to ultracentrifugation at 30,000 rpm for 90 minutes at 4 ^o C, using ² with a Hitachi PP-30 rotor. The resulting precipitate was isolated as a virus-containing fraction.

This precipitate was suspended in 10 mM phosphate buffer containing 1% Triton X100 (pH 7.4), and the suspension was centrifuged for 1 minute at 4 ^° C and at 8000 x g. The obtained supernatant was applied on a graduated column with a sucrose density gradient of 10-40% (40%: 10 ml, 30%: 10 ml, 20%: 10 ml, 10%: 10 ml, and left overnight at 4 ^° C) previously obtained using 10 mM phosphate buffer (pH 7.4). The tube was then coated with a supernatant layer and centrifuged at 23,000 rpm and at 4 ^° C. for 120 minutes in a Hitachi PP 25 rotor.

After centrifugation, sucrose density gradient column tubes were fractionated in a fractionation apparatus (model UA-2 manufactured by ISCO Co) equipped with an OD ₂₆₀ nm detector. Fractions having a sucrose density of about 20 to 30% and adsorbed at an OD of _{260 nm} were collected as virus-containing fractions.

The isolated virus-containing fraction was 2-fold diluted with 10 mM phosphate buffer (pH 7.4), and then centrifuged at 40,000 rpm and at 4 ^° C for 90 minutes using a Hitachi PP-65 rotor. The resulting pellet was resuspended in 10 mM phosphate buffer (pH 7.4), resulting in a purified viral solution.

C) Isolation of viral RNA
CYVV virus genomic RNA, containing approximately 10,000 bases, was polyadenylated at its 3'-end. The combination of length and polyadenylation makes it difficult to extract full-length RNA without any loss if extraction is carried out by the standard method using sodium phenol / dodecyl sulfate or the method using guanidine thiocyanate. Therefore, viral genomic RNA was obtained by centrifugation in an alkaline sucrose density gradient.

500 μl of the virus solution (which contained 2 mg of the virus, as calculated on the basis that 1 mg / ml of the virus has an OD of _{260 nm} = 0.5) was added to 500 μl of the denaturation solution and the resulting mixture was left for 20 minutes at room temperature . After that, the mixture was layered on a test tube column with a density gradient of 0% - 34% sucrose (33.4%: 1.4 ml, 30.4%: 7.6 ml, 27%: 7.0 ml, 23%: 6, 3 ml, 18.7%: 5 ml, 12%: 3.2 ml, 0%: 2.7 ml, and left overnight at 4 ^° C., which was obtained using 1 × SSC. A 1xSSC was also used as a buffer. Then the tubes with the mixture were subjected to ultracentrifugation in a RPS-27 Hitachi rotor at 24,000 rpm and at 15 ^o C for 9 hours. After that, the bottom of the tube was pierced to fractionate sucrose density gradients. The viral genomic RNA fraction was identified by measuring the optical density of each fraction at 260 nm. Sedimentation of viral genomic RNA is carried out at a sucrose concentration of from about 20 to 30%. The genomic RNA yield was approximately 25 μg.

D) Synthesis of viral cDNA
cDNA was synthesized using the genomic RNA obtained as described above in step (C) as a template. The cDNA synthesis was performed using the cDNA Synthesis System Plus (manufactured by Amersham). The resulting cDNA was purified on a Sephadex C50 column (registered trademark, Pharmacia). And using dCTP and terminal deoxynucleotide transferase (Bethesda Research Laboratories), a polyG chain was added to the 5'-end of the purified cDNA. The plasmid preparation pBP322 (Bethesda Research Laboratories) was obtained by digesting the indicated plasmid with the restriction enzyme Pst1 followed by the addition of a 3 'polyG chain from both ends. Then cDNA was added to this preparation, and the resulting mixture was incubated for 5 minutes at 65 ^° C, and then incubated for 2 hours at 57 ^° C. This mixture was gradually cooled to hybridize the cDNA polyG chain with the plasmid polyG chain.

E) Transformation
Strain HB 101 E / coli was transformed using a new plasmid, obtained as described in step (D), using a calcium chloride method. A seed culture of E. coli strain HB 101 was obtained by shaking overnight in liquid B-medium. 0.5 ml of this seed culture was used to inoculate 50 ml of fresh liquid B-medium, and the resulting inoculum was cultured by shaking at 37 ^° C. until an OD of _{550 nm} became 0.5. Bacterial cells were isolated by centrifugation for 5 minutes at 5000 x g and at 4 ^o C, and the resulting pellet was slightly suspended in 25 ml of Tris-calcium buffer and left on ice for 5 minutes. The resulting suspension was again centrifuged at 4000 x g for 4 minutes, and the residue was suspended in 5 ml of Tris-calcium buffer and left for 2 hours on ice to obtain competent cells.

To 200 μl of the obtained competent cells, 100 μl of the new plasmid obtained in stage (D) was added, and the resulting mixture was left on ice for 30 minutes. After this time, the mixture was incubated for 2 minutes at 42 ^° C, after which 1 ml of liquid LB medium was added and the resulting mixture was cultured by shaking at 37 ^° C for another hour. This mixture was then applied to solid LB medium containing 12.5 μg / ml tetracycline hydrochloride and 1.5% agar. Cells were cultured overnight at 37 ^° C. to obtain a cDNA clone library.

F) Obtaining and selection of plasmid pNS 51
The plasmid library of recombinant cDNA was analyzed by alkaline SDS. This method is described in more detail below.

2 ml of liquid LB medium was inoculated with a colony of tetracycline-resistant bacteria that were susceptible to ampicillin and obtained from solid LB culture as described in (E), after which the suspension was cultured while shaking overnight at 37 ^° C. Cells were pelleted by centrifugation at 10,000 x g and suspended in 70 μl of lysis buffer containing 10 μl of lysozyme solution (10 mg / ml). After stirring for 5 seconds to form a suspension, the resulting suspension was left for 5 minutes at room temperature. Thereafter, 160 μl of an alkaline SDS solution was added to the suspension, and the resulting mixture was first mixed by inverting the tubes several times, and then was made up on ice for 5 minutes. To this mixture was added 120 μl of 5 M potassium acetate, and then again left on ice for 5 minutes. After this time, the mixture was centrifuged at 10,000 x g and at 4 ^o C for 5 minutes.

After centrifugation, the supernatant was transferred to a fresh tube and 250 μl of isopropanol was added and then left on ice for 30 minutes. After this time, the mixture was centrifuged again for 5 minutes at 10,000 x g and the resulting precipitate was dissolved in 100 μl of TE buffer (10 mM Tris, 1 mM EDTA (pH 8.0). Then phenol extraction was carried out by adding different amounts of phenol mixture (chloroform) of isoamyl alcohol (25:24: 1) to the mixture obtained above, stirring vigorously, after which the mixture was centrifuged at 10,000 x g and at 4 ^° C for 5 minutes (hereinafter, this whole procedure will be referred to as extraction phenol).

 100 μl of the aqueous layer obtained by centrifugation was mixed with 10 μl of 3 M sodium acetate (pH 5.2) and 250 μl of ethanol, after which the mixture was left on dry ice for 10 minutes and then centrifuged at 10,000 x g in for 5 minutes with the isolation of the nucleic acid fraction (hereinafter, this procedure using the same relative volumes of the supernatant, ethanol and sodium acetate solution will be called "ethanol precipitation").

The resulting precipitate was suspended in 50 ml of RNase A solution (10 μg / ml in TE buffer), and then incubated for 1 hour at 37 ^o C. After that, 30 μl of a solution of polyethylene glycol (2.5 M sodium chloride, 20% polyethylene glycol 8000 ) was added to the incubated suspension and the resulting mixture was left for one hour on ice. After this time, the mixture was centrifuged at 10,000 x g and at 4 ^° C and the DNA fraction was isolated as a precipitate, after which the ethanol precipitation procedure was performed twice and purified plasmid DNA was obtained.

 The purified plasmid DNA was digested with the restriction enzyme PSt 1 and subjected to electrophoresis on a 1% agarose gel using a TBE solution. After electrophoresis, the gel was subjected to Southern blot hybridization (Southern E.M. (1975), J. Mol. Biol. 89: 503-517). In particular, the gel was shaken for 40 minutes in a denaturation solution, and then transferred for 2 hours, while shaking in a neutralization buffer.

After shaking, the gel was transferred onto a polyurethane sponge containing 20 x SSC for transferring DNA to parts of the Hybond-N membrane (Amersham registered trademark) located on the sponge. After transferring the DNA to the membrane, this membrane was shaken for 10 minutes in 1 x SSC, and then dried for 1 hour at 80 ^° C to fix the DNA. After that, the membrane was placed in a pre-hybridization solution (5 ml of formamide, 1 ml of 50 x Denhardt solution, 2.5 ml of 20 x SSC, 100 μl of yeast tRNA (50 mg / ml), 100 μl of 10% SDS and 1.3 ml bidistilled water) and incubated at 50 ^o C for 3 hours.

Viral genomic RNA that was digested with Mg ²⁺ was used as a probe. In particular, to a solution (16 μl) obtained as described in (C) and containing 1 μg of viral RNA, 4 μl of 5x denaturation buffer was added and the resulting mixture was incubated for 3 hours at 37 ^° C. 5 μl of a denatured RNA solution containing 100 ng RNA (calculations were performed on the basis that 1 mg / ml RNA has an OD of ₂₆₀ = 20, precipitated by ethanol precipitation, followed by heating at 70 ^° C for 5 minutes and cooling on ice.

4 μl of 5 x labeling buffer 1 μl of 3.3 mM [ν - ³² P] ATP (0.37 MBq) and 10 μl of bidistilled water were added to the denatured RNA solution. Then, a solution of 20 units was added to the mixture. T4 polynucleotide kinates (supplied by Takara Shuzo) and incubated for 30 minutes at 37 ^° C. Unincorporated [ν - ³² P] ATP was removed by 5-fold ethanol precipitation.

The resulting labeled probe was added to the hybridization solution (5 ml of formamide, 2 ml of 50% dextran sulfate, 200 μl of 50 x Denhardt solution, 2.5 ml of 20 x SSC, 50 μl of yeast tRNA (50 mg / ml), 100 μl of 10% SDS, 1.3 ml bidistilled water) to a final concentration of 5 x 10 ⁵ imp. in min / ml, after which the Hybond-N membrane obtained above was transferred to this solution and subjected to hybridization by incubation overnight at 50 ^° C, followed by washing with shaking, 2 x SSC containing 0.1% sodium dodecyl sulfate ( SDS). This procedure was repeated three times, after which the Hybond-N membrane was washed once again with 0.1 x SSC containing 0.1% SDS for 1 hour at room temperature and with shaking, and then dried.

 Autoradiography showed that the plasmid, which was then designated PNS 51, had an inserted fragment of approximately 6,500 base pairs (bp) that hybridized with viral genomic RNA.

G) Determining the insert sequence pNS51
In order to construct a cDNA restriction map cloned into pNS51, the indicated plasmid was digested with each of the restriction enzymes: BamHI, EcoRI, HindIII, KpnI, NcoI, RstI, SaII, SphI, SacI, SmaI, XhoI, XbaI. The resulting map is shown in figure 1.

 Then, each of the fragments obtained by restriction enzyme digestion with SalI and PstI was inserted into M13 mp19 RF DNA. For this, plasmid pNS 51 was digested with restriction enzymes PStI and SaII, and the digested products were subjected to electrophoresis on 5% polyacrylamide gel using 1 x TBE. After electrophoresis, the gel was stained with 1 μg / ml ethidium bromide so that the bands can be identified by UV radiation. Gel strips containing each DNA strip were cut with a razor and electroeluted using an electroelution device (Amicon) equipped with Centricon-30 (Amicon).

 Then, using a DNA ligation kit (manufactured by Taka a Shuzo), each fragment was inserted into M13 mp19, which was previously restricted with either one SaII enzyme or two PstI and SaII enzymes, and which was treated with alkaline phosphatase.

The resulting recombinant M13mp19-RF-DNA (where the fragments were inserted using T4 DNA ligase) was introduced into E. coli strain JM109 using rubidium chloride. A single colony of strain JM109, which was cultured on M9 minimal agar medium, was inoculated and cultured in liquid SOB medium overnight with shaking. 0.6 ml of the overnight culture was inoculated in 50 ml of fresh liquid SOB medium and cultured at 37 ^° C and with shaking until an OD of _{600 nm} reached 0 _× 5. The cells were then pelleted by centrifugation at 5000 xg and at 4 ^° C for 10 minutes and the pellet was slightly suspended in 25 ml of THB1 buffer, and then left on ice for 20 minutes.

 After this, the suspension was again centrifuged at 3000 x g for 5 minutes, and the residue was suspended in 2 ml of THB2 buffer and left on ice for 20 minutes to obtain competent cells.

After ligation, the recombinant M13 mp19 RF DNA obtained as described above was used in an amount of 1 to 10 μl to mix with 100 μl of competent cells, after which the mixture was left on ice for one hour. After this time, the mixture was incubated at 42 ^° C. for 1.5 minutes, and then 500 μl of liquid SOC medium was added to the mixture, after which the resulting mixture was cultured for 1 hour with shaking and at 37 ^° C.

To the obtained culture, 2 x UT medium containing 0.8% agar, 30 μl of 100 mM IRTG, 10 μl of 10% 5-bromo-4-chloro-3-indolyl-1-galactoside (X-gal) was added with stirring and 100 μl of the indicator bacterium (overnight culture of strain JM109, cultured by shaking in 2 x UT medium at 37 ^° C), and the resulting mixture was poured onto solid 2 • UT medium containing 1.2% agar. After curing, the mixture was cultured overnight at 37 ^° C. Recombinant phages were then detected as white plaques.

Each of the obtained white plaques was inoculated into a liquid 2 x UT medium containing indicator bacteria in an amount of 1/100, and cultured overnight at 37 ^° C and with shaking. After centrifugation for 1 minute at 10,000 x g, the supernatant was frozen or stored at 4 ^° C as a phage solution, and the resulting pellet was processed using the standard procedure to obtain a plasmid with isolation of RF-dsDNA (hereinafter referred to as RF-DNA), which is phase replication intermediate. The presence of the inserted fragment was confirmed by restriction enzyme digestion.

 Thus, 51SS / M13mp19 (i.e., M13mp 19 containing the SaII / SaII fragment, which, in turn, is part of the 51PS5 '/ M13mp19 genome containing the RstI-SaII fragment from the 5'-region of the CYVV-, was obtained genome). RF DNA was purified from phage clones using an alkaline SDS solution and centrifugation in a density gradient of cesium chloride in accordance with standard procedures.

 5 μg of the obtained purified DNA was first digested with BamHI to give a sticky 5'-end, and then digested with KpnI to get a sticky 3'-end. After that, in accordance with the scheme attached to the Erase-a-base system (Promega), an exonuclease was added in order to stepwise deletion of the bases from the sticky 5'-end of each cDNA of the linearized plasmid. Exonuclease treatment was carried out for 10 minutes, and the samples were removed at various time intervals from 1 to 10 minutes. Since the vector has a sticky 3'-end, it is not exposed to exonuclease. Then, various samples obtained in the 1-10 minute time interval were blunted at the ends by treatment with S1 nuclease and ligated into a ring form using T4 DNA ligase.

 The resulting ring recombinant M13mp-19-RG-DNA was introduced into E. coli strain JM 109 by the method using rubidium chloride described above. In accordance with this method, recombinant phages having cDNA inserts of various lengths were obtained as white plaques.

RF DNA was extracted from subclones of the recombinant phage obtained as described above using standard techniques to select clones having inserts of different lengths. The selected clones were separately inoculated into a liquid 2 x UT medium containing the E. coli indicator strain and cultured overnight at 37 ^° C. After this time, 1.5 ml of each culture was centrifuged for 5 minutes at 10,000 x g and at 4 ^o C. 1 ml of the supernatant was transferred to a fresh tube and 250 μl of 20% polyethylene glycol (aqueous solution of 20% polyethylene glycol 8000, 2.5 sodium chloride) was added to this tube with stirring, after which the mixture was left on ice for 30 minutes. Then this mixture was centrifuged for 5 minutes at 10,000 x g and at 4 ^o C, and the resulting precipitate was suspended in 100 μl of TE buffer. Then, by phenol extraction and precipitation with ethanol (as described above), phage genomic single-stranded DNAs (abbreviated ssDNA for short) were isolated from each preparation.

After this, the nucleotide sequencing of each of the obtained subclones was carried out by the method of dideoxy termination of the chain and using the ssDNA as a template. In particular, phage ssDNA was labeled with [α - ³² P] dCTP (220 TBq / mM, Amersham) using a kit containing 7-dease sequenase, version 2.0 of dCTP (manufactured by USB). The resulting reaction product was subjected to electrophoresis on a 5% polyacrylamide gel containing 8 M urea using 1 x TBE buffer. Then the gel was dried, and the nucleotide sequence was determined using autoradiography.

 By analyzing the nucleotide sequence of the 5'-Pst1 SalI fragment and the M-SaII-SaII fragment of PNS51, we were able to determine a total of 3839 bases.

 As a result of studies aimed at determining the open reading frame (hereinafter referred to as ORF) in the sequence obtained above, one reading frame for the polypeptide was found on the (+) - chain of the viral genome. After that, the sequence of the polypeptide encoded in ORF was determined. Studies conducted by comparing this polypeptide sequence with known sequences using the gene bank of sequences (GeneBank), revealed the homology of this polypeptide with TEV-HAT.

 Viruses such as TEV, plum pox (hidden plum mosaic), or poliovirus (animal virus) are known to mature by protease, and that this protease usually cleaves a peptide bond containing Gln-Ala, Gln-Ser or Gln- Gly-bond (Willink J. & Van Kammen A. (1988), Arch. Virol 98: 1-26). As a result of the analysis of the cleavage sites of the envelope protein of the CY - N 30 virus (Uyeda I. et al. (1991), Intervirology 32: 234-245), three cleavable sequences were also detected in the deduced polypeptide sequence. Based on one of these cleavage sites, it was found that the polypeptide extending from Gly at position 4 to Gln at position 437 is a "nuclear inclusion a" derived from CYVV virus.

H) Obtaining a hybrid protein CYVV-Nla / 1L-11
The DNA identified above (see (G)) as a sequence: encoding CYVV-Nla, is tandemly linked, with the preservation of the reading frame, at its 3'-end to DNA encoding interleukin 1L (human IL-11, via a linker sequence encoding Gln-Ala.

The following studies were carried out:
1) whether the “nuclear inclusion a” (Nla) possessing proteolytic activity identified in Section (G) encodes DNA,
2) splits or not the specified protease (i.e. Nla) the desired amino acid sequence,
3) whether Nla has protease activity if it is part of a hybrid protein together with the desired heterocyclic protein, and whether this activity is the same as the activity in a virus-infected cell,
4) whether the heterocyclic protein obtained by cleaving said hybrid protein retains its integrity, structure and function.

 Since the Nla protein itself is produced by cleavage from the viral precursor polypeptide, the Nla cistron does not have an initiating codon. Therefore, it is necessary to add the ATG initiation codon at the 5'-end of the Nla gene. In addition, the 3'-end of the Nla gene must also be attached to the 5'-end of the IL-11 gene while maintaining the reading frame. In order to solve all the problems posed, Nla was modified using the polymerase chain reaction (PCR) using the restriction XhoI site present in the center of the Nla gene.

 PCR primers were prepared to add the ATG initiation codon and recognition site for the NcoI restriction enzyme necessary for cloning at the 5'-end of Nla (Nla5 '). These primers had the following sequences: 5 'GTCCATGGGGAAAAGTAAGAGAACA 3' (hereinafter referred to as NSATG, sequence ID N 3) and 5 'ACTCTGAGACCGTGCTCGAG 3' (hereinafter referred to as NSX1, sequence ID N 4).

0.8 μl dNTR solution (25 mM each of dATA, dTTP, dCTP and dCTP), 10 x Tag buffer (manufactured by Promega) and 1 μg of each of the obtained primers were added to 1 μg of pNS51 plasmid DNA and the resulting mixture was adjusted to 100 μl by adding bidistilled water. Then, 5 units of DNA polymerase in 10 x Tag buffer were added to carry out the polymerase chain reaction. PCR was carried out according to the following scheme: a cycle of 1 min at 92 ^o C, 1 min at 37 ^o C and 2 min at 72 ^o C - was repeated 20 times after one cycle - 1 min, 92 ^o C, 1 min, 37 ^o C and 30 min 72 ^o C.

The obtained amplified DNA was subjected to phenol extraction and ethanol precipitation procedures, followed by electrophoresis on a 5% polyacrylamide gel. Using ethidium bromide staining, one band containing DNA was detected, this band was excised from the gel and electroeluted using a Centreluter (Amicon) electroelution apparatus equipped with Centricon-30 (Amicon). After elution, the eluted DNA fragment was concentrated and isolated by centrifugation at 7500 x g (using Centricon, Amicon) and at 4 ^o C for 45 minutes. The resulting DNA concentrate was then purified by phenol extraction and ethanol precipitation.

 Regardless, 1 μg of plasmid pKK388 (Clonetech, in which the SacI recognition site was replaced by the XhoI recognition site, was digested with restriction enzymes NcoI and XhoI, and then calf intestinal alkaline phosphatase (denoted below CIAR and manufactured by Takara Shuzo) was dephosphorylated. using a Takara Shuzo doping kit) with 100 ng of plasmid pKK388-1, which was also restricted by NcoI and XhoI enzymes and dephosphorylated as described above, resulting in recombinant DNA, which was then cloned into E. coli JM 109. Thus after that, plasmid pKN15 'was obtained, which had an insert located in the normal orientation and located “downstream” from the trc promoter of plasmid pKK388-1 (Fig. 2).

 Plasmid pCD20-2 (Kawashima 1. et. Al., (1991), FEBS L 283: 199-202) contained cDNA encoding the precursor of IL-11 (pre-IL-11) and having a secretion signal sequence. This plasmid was digested with restriction enzymes BamHI and ApaI and the region containing pre-IL-11 and the SV40 promoter was excised. The resulting fragment was ligated to the BamHI and ApaI sites of the pBLUESCRIPT 11 SK + vector, and then again digested with restriction enzymes XhoI and KpnI, resulting in a gene encoding a protein lacking the N-terminus of mature IL-11 (Mat-IL-11).

The resulting Mat-IL-11 fragment (lacking its N-terminus) was integrated using T4 ligase into pKN15 ', which was previously restricted with XnoI and KpnI enzymes and also treated with CIAP. The resulting design was designated pKN141 (figure 3). To ligate a specific sequence at the C-terminus of Nla with a Mat-IL-11 fragment by Ala and preserving the reading frame, four types of PCR primers were synthesized:
5'AGGAAAAGACTTCCTCGACC 3 '
(designated NSX2, sequence ID N 5),
5 'AATTGTTCATTCCAAGCACCTGGGCCACCACCTGGC 3'
(designated NSJ001P, sequence ID N 6),
5 'GCCAGGTGGTGGCCCAGGTGCTTGGAATGAACAATT 3'
(indicated by NSJ002) sequence ID N 7), and
5 'TTGTCAGCACACCTGGGAGCTGTAGAGCTC 3'
(designated ILSAC sequence ID N 8).

The first PCR reaction was performed (using a pair of primers NSX2 and NSJ002N and using pNS51 DNA as a template) to amplify the insertion region encoding the C-terminus of Nla (designated the CN13 region). Then, another PCR reaction was separately carried out (using a pair of primers NSJ001 and 11SAC and using pNS51 as a DNA template) to amplify the insertion region encoding the N-terminus of IL-11 peptide (designated 5 ′ IL region). PCR was carried out according to the following scheme: a cycle of 1 min at 92 ^o C, 1 min at 37 ^o C and 2 min at 72 ^o C was repeated 20 times, and then one cycle / 1 min at 92 ^o C, 1 min at 37 ^o C and 30 min at 72 ^o C. The products obtained by the polymerase chain reaction were extracted with phenol and precipitated with ethanol, and then subjected to electrophoresis on 5% polyacrylamide gel. The gel strip containing the amplified DNA strip was excised and the DNA was separated from the gel by electroelution as described above. The results are shown in FIG. 4.

The two amplified DNA fragments obtained were primer regions NSJ001P and NSJ002N, i.e. The 3'-terminal part of the CIN of the 3-DNA fragment and the 5'-part of the 5'IL-DNA fragment are nucleotide sequences of which showed partial homology. For example, if the polymerase chain reaction is carried out again using primers NSX2 and ILSAC, the homologous regions will hybridize to form hybrid DNA containing both genes, and the homologous region will act as a cross-linking region (Fig. 5). Accordingly, the isolated CIN3 DNA fragment and the 5'II DNA fragment were mixed and PCP was performed again using only NSX2 and ILSAC as primers. PCR was carried out according to the following scheme: first, 10 cycles were performed in the mode: 1 min at 92 ^° C, 1 min at 37 ^° C and 2 min at 72 ^° C, then 20 cycles in the mode: 1 min at 92 ^° C, 1 min at 45 ^o C and 2 min at 72 ^o C, and then one cycle was carried out in the following mode: 1 min at 92 ^o C, 1 min at 55 ^o C and 30 min at 72 ^o C. After phenol treatment and ethanol precipitation, electrophoresis was carried out. 5% polyacrylamide gel, resulting in a CNI3IL DNA fragment in which CNI3 was attached to 5'IL. This method is shown in FIG. 5.

 The CNI3IL DNA fragment was digested with the restriction enzyme XhoI and the resulting fragment, using T4 DNA ligase, was inserted into pKN15 ', which was previously digested with the restriction enzyme XhoI and dephosphorylated by CIAP. The resulting plasmid was cloned into E. coli strain JM 109. To select a clone in which the CNI3IL fragment was inserted in the correct orientation, plasmids were extracted from the obtained clones and PCR was performed using NSX2 and ILSAC primers. In accordance with the system used, only one DNA band was detected from the clone in which this fragment was inserted in the correct orientation. The result was the plasmid pKSUN9, in which Nla and Mat-IL-11 are connected via a cleavable sequence of Gln-Ala with maintaining the reading frame (Fig. 6).

1) Expression of Ala-IL-11 in a bacterial cell
E. coli carrying the plasmid pK 9 (designated KSUN9 strain below) was cultured with shaking and at 37 ^° C. overnight in 5 ml LB medium containing 42 μg / ml ampicillin. Then, 2.5 ml of the resulting KSUN 9 culture was added to 250 ml of fresh LB medium (containing the same amount of ampicillin) and cultured with shaking and at 37 ^° C until an OD of _{600 nm} reached 1.0. After the OD _600nm became 0.1 mM, IPTG was added to a final concentration of 0.1 mM and the resulting mixture was cultured with shaking and at 28 ^° C. for 12 hours.

The second cultivation was carried out in full accordance with the above procedure, except that the last cultivation was carried out at 28 ^° C. for 36 hours or more with an IPTG concentration of 1 mM, resulting in mature IL-11 (which had an N-terminal proline) .

J) Western blotting
Western blotting was performed to determine whether pKSUN 9 is functional in E. coli and also to determine whether the engineered recombinant gene is expressed.

Each of the 12- and 36-hour cultures induced with IPTG was subjected to the subsequent processing described below. To do this, cells were isolated from 2 ml of culture by 5-minute centrifugation at 3000 x g and at 4 ^° C; the resulting centrifugation pellet was suspended in 100 μl of 20 mM sodium borate buffer (adjusted to pH 9.0 using 0.1 N NaOH). The resulting suspension was sonicated using a special apparatus (Handysonic UR-20P manufactured by Tomy Seiko Co.) for 2 minutes at position 8, to disintegrate cells, and then, for 10 minutes, centrifuged at 10,000 x g and at 4 ^° C. The supernatant containing the soluble protein fraction was isolated. 5 μl of this supernatant was electrophoresed on 12% SDS gel according to the Laemmli method (Laemmli (1970) Nature 227, 680 - 685).

After electrophoresis, the gel was shaken for 5 minutes in transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol) and blotted onto a portion of the PVDF membrane (Thans-Blot Transfer Medium - transfer medium made by Bio-Rad Laboratories) by processing at 15 V for 1 hour in a special chamber Trans-Blot-SD-Semi-Dry Transfer Cell (manufactured by Bio-Rad Laboratories). The blotted PVDF membrane was washed in PBS-TW medium for 10 minutes. The PVDF membrane was transferred to PBS-TW medium containing 5% separated milk (manufactured by Snow Brand Milk Products) and allowed to blot for 1 hour at 37 ^° C.

After blotting, the PVDF membrane was washed again in PBS-TW medium, once for 10 minutes and twice for 5 minutes, and then transferred to rabbit serum against IL-11, previously diluted 10,000-fold in PBS-TW, and incubated for 20 minutes at 37 ^o C. After this time, the PVDF membrane was washed again in PBS-TW, once for 10 minutes and 4 times for 5 minutes.

 After this washing, the PVDF membrane was treated with an enhanced chemiluminescence (ECL) production reagent (manufactured by Amersham) and bands that react with the anti-IL-11 antibody were detected by exposing the indicated X-ray film PVDF membrane for a period of 30 seconds to 5 min

 As a result of Western blotting, as described above, signal bands corresponding to molecular weights of about 50 kDa and about 23 kDa were detected from 12-hour and 36-hour cultures. The 23 kDa band had motility substantially similar to that of mature IL-11 used as a control. Thus, it is obvious that the 230-kDa signal band is IL-11, which was cleaved from the Nla / IL-11 fusion protein of the Gln-Ala-linker sequence due to the proteolytic activity of Nla. From this we can conclude that the heavier band (50 kDa) is an unsplit fusion protein.

 Further, a 23 kDa protein obtained from a 12-hour culture will be designated 23 kDa-ON, and a 23-kDa protein obtained from a 36-hour culture will be designated 23-kDa-36hr.

K) Purification of proteins 23 kDa-ON and 23 kDa-hr
The 23 kDa-ON and 23 kDa-36hr proteins were purified to determine the amino acid sequence of their N-ends. In accordance with the procedure described in paragraph (1), received 250 ml of each of the 12-hour and 36-hour cultures. Then, each culture was processed as follows. The culture was centrifuged for 15 minutes at 5000 xg, at 4 ^° C, and the pellet was suspended in 10 ml of 20 mM borate buffer (pH 9.0), and then disintegrated using a French press and an ultrasonic treatment apparatus (both). After centrifugation for 30 minutes at 15,000 x g and at 4 ^° C, the soluble protein fraction was isolated as supernatant.

The resulting soluble protein fraction was subjected to weak ion exchange column chromatography using FPLC (Pharmacia) under the following conditions:
Column: CM Toyopearl Pack 650 M (2.2 x 20 cm, made by Toso)
Elution buffers: A = 10 mM boric acid — sodium hydroxide (pH 9.0), 13 mM potassium chloride, B = 10 mM boric acid — sodium hydroxide (pH 9.0), 13 mM potassium chloride, 400 mM sodium chloride .

 Flow rate: 2.5 ml / min.

Fraction volume: 5 ml per tube
The concentration gradient used (for 120 minutes) was a linear gradient of "eluent A - eluent B"
Then, each eluted fraction was subjected to enzyme-linked immunosorbent assay (ELISA) to identify fractions containing IL-11.

ELISA was carried out as follows. Each well of a 96-well immunoplate (Max oap manufactured by Nunc.) Was loaded with 100 μl of 50 mM sodium carbonate buffer (pH 9.6) containing 1 μg / ml mouse anti-IL-11 monoclonal antibody and then incubated for 1 hour at 37 ^o C. At the end of this time, each well was washed 4 times with PBS-T medium (PBS containing 0.1% Tween 20).

Each of the FPLC fractions obtained as described above was diluted 1: 100 with PBS-T and loaded into wells in aliquots of 100 μl per well. The plates were incubated for 1 hour at 37 ^° C, after which the wells were washed again with PBS-T and 100 μl of rabbit anti-IL-11 IgG diluted with PBS-T to a final concentration of 1 μg / ml was added to each well.

The plate was then incubated for 1 hour at 37 ^° C. and washed with PBS-T, after which 100 μl of alkaline phosphatase-labeled goat anti-rabbit IgG antibody (Gibco Bethesda Research Laboratories), which was 3,000 times diluted in PBS-T, was added to each well. . The plate was again incubated for 1 hour at 37 ^° C. and then washed with PBS-T. Thereafter, 100 μl of alkaline phosphatase substrate solution was added to each well. The plate was incubated at room temperature for another 30 minutes to 1 hour, after which the staining of each well was measured as optical density at 450 nm in order to identify the desired (or necessary) fraction (s).

 The fractions resulting from the FPLC procedure and identified in accordance with the above ELISA as fractions containing a substance that reacts with rabbit anti-IL-11 antibody (fractions NN 19-25) were combined 100-fold concentrated using Centprep-10 (Amicon ) and subjected to SDS electrophoresis in 12% polyacrylamide gel according to the Laemmli method (see above). The gel was then subjected to electro-blotting on a PVDF membrane in accordance with the above procedure for Western blotting, except that Problot membrane (manufactured by Applied Biosystems) was used as the PVDF membrane.

 After blotting, the membrane was thoroughly washed with double-distilled water, Coomassie stained with P-250 brilliant blue, treated with 50% methanol to wash the stain, and the strip containing the protein that reacts with the anti-IL-11 antibody in the Western blot analysis was cut out.

The amino acid sequence of the N-terminus of this protein was analyzed using a protein sequencer (Applied-Biosyntems). As a result of this analysis, it was found that the N-terminal sequence of the band from 23 kDa-ON reacting with an anti-IL-11 antibody is:
Ala-Pro-Gly-Pro-Pro-Pro-Gly- (sequence ID N 9)
This sequence corresponds to a sequence of -1 to +6 amino acid sequence of the mature IL-11 protein. Based on this, it can be concluded that the 23 kDa protein obtained from a 12-hour culture and reacting with an anti-IL-11 antibody is Ala-IL-11. Accordingly, it is apparent that this protein was produced by the proteolytic activity of an Nla protein that cleaves the Nla / IL-11 fusion protein at the Gln-Ala site in a specific cleavable sequence.

In addition, it was found that the N-terminal sequence of the band from 23 kDa-36hr reacting with an anti-IL-11 antibody is:
Pro-Gly-Pro-Pro-Pro-Gly-Pro- (Sequence ID 10)
This sequence corresponds to the amino acid sequence of +1 to +7 mature IL-11 protein. Based on this, the following conclusions were made:
As a result of induction using IPTG, the Nla / IL-11 fusion protein is expressed in E. coli.

As a result of a 12-hour cultivation after induction, the produced Nla / IL-11 hybrid protein is cleaved into a Gln-Ala peptide bond with a specific cleavable
sequences due to the protease activity of Nla.

 After cleavage of the peptide bond with an Nla protein, mature but additional Ala at its N-terminus, IL-11 is produced in E. coli.

 When cultured for another 24 hours after expression of Ala-IL-11, it was found that Ala-IL-11 "matures" to IL-11, in which the Ala-residue present at the N-terminus of Ala-IL-11 is deleted.

 Based on the results, it was concluded that the 23 kDa protein obtained after 36 hours of cultivation is a mature type of IL-11 protein in which the N-terminus is Pro.

 Accordingly, it was found that IL-11 can be produced as a hybrid with Nla protein, and that due to Nla activity, this protein must be cleaved in a specific linker sequence containing Gln-Ala to form Ala-IL-11. Subsequent cultivation leads to the formation of mature IL-11, in which the alanine residue is deleted due to the factor present in E. coli, resulting in the N-terminus becoming Pro.

 In order to ensure that the produced IL-11 and Ala-IL-11 are biologically active, adipogenesis-inhibiting factor activity (AGIF) was determined as an indicator of such activity. The fact that IL-11 has adipogenesis-inhibitory activity has been established previously (Kawashima, 1, et al. (1991), FEBSL. 283: 199-202).

Evaluation of the inhibitory effect on morphological changes from ZTZ-LI cells to adipocytes
The following describes a method for determining AGIF activity used in the present invention. In this method, a ZTZ-L1 cell line of embryonic murine fibroblasts (Green H. & Kehinde (1974), Cell 1: 113-116) taken from ATCC was used. In all cases, these cells were cultured in a mixed humid atmosphere (10 CO ₂ - 90% air) at 37 ^° C and reseeded in medium A. Adipogenic differentiation was induced in accordance with the procedure described by Rubin et al. (Rubin CS et al. ( 1978), J. Biol. Che, 253: 7570-7578).

ZTZ-L1 cells were suspended in medium A to a density of 1.0 x 10 ⁴ cl / ml, seeded in a 48-well microcolony culture plate (0.5 ml / well, manufactured by Coaster), and then cultured. After 3 days of cultivation, the cells reached continuity. Then the medium was replaced with fresh medium A and after culturing for another 2 days, this medium was replaced with adipogenesis-inducing medium (medium B), while 0.5 ml of the test sample was added at the same time. This medium was replaced with fresh medium B with the addition of a fresh sample every two days.

 At various time intervals for different wells, starting from 4 and 7 days after the addition of the first test sample, the depleted medium B in the wells was replaced with adipocyte-supporting medium C.

Фиксацию клеток и окрашивание масляным красным O и гематоксилином осуществляли в соответствии с процедурами, описанными Yoshio Mitomo и Shojiro Takayama в "Lectures on Clinical Testing" Vol. 12, "Pathology" (1982), опуб. Ishiyaku Shuppan
M) Метод определения ингибирующей активности липопротеин-липазы
Определение ингибирующей активности липопротеин-липазы осуществляли в соответствии с методом, описанным Beutler и др. (Beutler B.A. et al. (1985) J. Immunol 135: 3972-3977). Адипогенетически дифференцированные клетки ЗТЗ-L1 получали, как описано в п. (1), за исключением того, что при индуцировании дифференцировки клеток в адипоциты испытуемого образца не добавляли. Вместо этого испытуемый образец добавляли вместе со свежей средой C, после чего клетки культивировали в течение 18 часов. По истечении этого времени среду удаляли, а клетки дважды промывали PBS(-) (фосфатно-буферным раствором, изготавливаемым Nissui Seiyaku), после чего в каждую лунку добавляли 3000 мкл среды D и культивировали еще 1 час. Затем от каждого из супернатантов культуры брали 100-микролитровые аликвоты для измерения активности липопротеинлипазы, которую измеряли в тройном дубликате для каждого образца для получения среднего значения.After culturing in medium C for 2 days, the cells were fixed with 5% formaldehyde and all the fatty particles that were accumulated in the cells and cell nuclei were stained with oil red O and hematoxylin, respectively. The obtained micrographs counted the number of nuclei and the number of cells that contained accumulated stained fatty particles. The adipogenic ratio (AR) was calculated by the following equation:

Cell fixation and staining with oil red O and hematoxylin were carried out in accordance with the procedures described by Yoshio Mitomo and Shojiro Takayama in "Lectures on Clinical Testing" Vol. 12, Pathology (1982), publ. Ishiyaku shuppan
M) Method for determining the inhibitory activity of lipoprotein lipase
Determination of the inhibitory activity of lipoprotein lipase was carried out in accordance with the method described by Beutler et al. (Beutler BA et al. (1985) J. Immunol 135: 3972-3977). Adipogenetically differentiated ZTZ-L1 cells were obtained as described in paragraph (1), except that no cells were added to the adipocytes of the test sample when inducing cell differentiation. Instead, the test sample was added with fresh medium C, after which the cells were cultured for 18 hours. At the end of this time, the medium was removed, and the cells were washed twice with PBS (-) (phosphate-buffered solution manufactured by Nissui Seiyaku), after which 3000 μl of medium D was added to each well and cultured for another 1 hour. Then, 100 microliter aliquots were taken from each of the culture supernatants to measure lipoprotein lipase activity, which was measured in triplicate for each sample to obtain an average value.

Lipoprotein lipase activity (LPL) was measured as described by Nilsson-Ehle & Schotz (Nilsson-Ehle P. & Schotz MC (1976), J. Lipid Res. 17: 536-541). Each aliquot of the supernatant obtained as described above was mixed with an equal volume of substrate solution and left for 120 minutes at 37 ^° C. to carry out the reaction. The reaction was stopped by adding 1.05 ml of 0.1 M potassium carbonate buffer (adjusted to pH 10.5 with 0.1 M potassium borate) and 3.25 ml of a mixture of methanol / chloroform / heptane (141: 125: 100 (v / v) volume)) with vigorous stirring. Then, the resulting mixture was centrifuged for 15 minutes at 3000 x g and at room temperature. After that, the content of ³ H in the aqueous methanol phase was counted using a liquid scintillation counter.

For one unit of LPL activity, one took such activity that generates 1 μM fatty acid per minute. 13 mM three [9.10 (n) - ³ H] glycerol oleate in a substrate solution was prepared by diluting tri- [9.10 (n) - ³ H] glycerol oleate (37.0 GBq / M) (manufactured by Amersham) with triolein (manufactured by Sigma) , followed by purification using column chromatography on silica gel.

 The following examples illustrate an embodiment of the present invention that relates to a glutathione reducing protein.

Example 1
Extraction of Poly (A) ± RNA from KM-102 cells
KM-102 cells were grown in 36 plastic culture dishes with a diameter of 15 cm, in a minimal essential medium modified according to the method of suits (Boeringer Mannheim) and containing 10% fetal bovine serum. After the cells were grown to solidity, phorbol myristyl acetate (PMA) and calcium inophor A23187 (Sigma) were added to final concentrations of 10 ng / ml and 0.2 μM, respectively, and cultivation was carried out at a temperature of 37 ^° C. After 3, 6 and 14 hours, batches of 12 were collected cups and the contents of each cup were separately dissolved in a solution of guanidine thiocyanate, and the liquid phase was collected.

Isolation of Pol (A) ⁺ RNA was carried out mainly as described in the Molecular Cloning A Laboratory Manual [Maniatis, T. et al. (1982) p. 196-198]. A detailed description of this procedure is given below.

 Each isolated liquid phase was separately treated as follows. The fluid was re-collected and poured from the piston into a 10 ml syringe equipped with a 21G syringe needle. A 3-milliliter solution of 5.7 M CsCl - 0.1 M EDTA (pH 7.5) was previously added to the Polyoromar centrifuge tube, selected according to the size of the rotor blade of the RPS40-T centrifuge (Hitachi Koki). The resulting cells were applied on top of the solution contained in the tube until the tube became full.

After 18 hours centrifugation at 3000 rpm and at a temperature of 20 ^o C, the resulting precipitate was suspended in 400 μl of distilled water and precipitated by adding ethanol. The precipitate formed was dissolved in 400 μl of distilled water, and the resulting solution was added while stirring to an equal volume of a mixture of chloroform / 1-butanol (4: 1, v / v), and then the aqueous layer was collected by centrifugation. The precipitated ethanol was again centrifuged once and the resulting precipitate was dissolved in 600 μl of distilled water, whereby the whole RNA was obtained. After 3, 6, and 14 hours, approximately 4.5 mg of whole RNA was obtained from each collected PMA / A23187-stimulated sample.

600 μg of each of the three types of whole RNA obtained by the method described above were pooled and column chromatographed with oligo (dT) cellulose to purify poly (A) ⁺ RNA.

The whole RNA was dissolved in adsorption buffer, and then heated for 5 minutes at 65 ^° C. The resulting solution was applied to a column of oligo (dT) cellulose (Pharmacia type 7) loaded with adsorption buffer, and was eluted with an elution solution, resulting in which was isolated 100 μg of poly (A) ⁺ RNA.

Example 2
Obtaining cDNA library
The cDNA library was obtained by the method described by Okayama Beg.

5 μg poly (A) ⁺ RNA and 24 reverse transcriptase units (Seikagaku Corp.) were allowed to react for one hour at 42 ^° C. in 20 μl reverse transcriptase reaction solution.

After this, the reaction was stopped by adding 2 μl of 0.25 M EDTA and 1 μl of 10% SDS, and then the resulting solution was deproteinized using 20 μl of a mixture of phenol and chloroform (1: 1, v / v). After centrifugation, in order to remove fractions containing protein, 20 μl of 4 M ammonium acetate and 80 μl of ethanol were added to the supernatant, and then the resulting mixture was cooled for 15 minutes at a temperature of -70 ^° C. At the end of this procedure, the precipitate was collected by centrifugation, washed with 75% ethanol and dried under reduced pressure.

The dried precipitate was dissolved in 15 μl of a terminal transferase reaction solution and heated at 37 ^° C. for 3 minutes. After this time, 18 units of terminal deoxynucleotidyl transferase (Pharmacia) were added to the reaction solution and the resulting mixture was allowed to react for 5 minutes. After this, the reaction was stopped by adding 1 μl of 0.25 M EDTA and 0.5 μl of 10% SDS and the resulting solution was deproteinized with a phenol / chloroform mixture (as described above) and then centrifuged to remove fractions containing protein. The supernatant was collected and vigorously mixed with 15 μl and 4 M ammonium acetate and 60 μl ethanol. The mixture thus obtained was cooled at a temperature of −70 ^° C. for 15 minutes, and the precipitate was collected by centrifugation.

The resulting precipitate was dissolved in 10 μl of enzyme restriction buffer, and 2.5 units of the HindIII restriction enzyme were added to this solution, after which the solution was left for 1 hour at 37 ^° C for digestion.

Then the reaction solution was deproteinized with a phenol / chloroform mixture, then it was precipitated with ethanol and the obtained supernatant was cooled for 15 minutes at a temperature of -70 ^° C. The resulting precipitate was collected by centrifugation and dissolved in 10 μl of TE buffer [10 mM Tris-HCl at pH 7 , 5 and 1 mm EDTA]. 1 μl of the resulting solution was added to 10 μl of the reaction solution containing 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 100 mM sodium chloride (NaCl), and 10 ng linker DNA with oligo (dT) tail [pL A -1-HindIII linker with a 3'-oligo (dG) tail, Pharmacia, after which the resulting mixture was heated at a temperature of 65 ^° C. for 5 minutes, and then heated at a temperature of 42 ^° C. for 30 minutes. This reaction mixture was cooled with ice water, followed by the addition of 10 μl of 10x ligase buffer, 78 μl of distilled water and 8 units of T4 DNA ligase. The resulting reaction solution was kept overnight at a temperature of 12 ^o C.

The next day, the reaction mixture was combined with 10 μl of 1 M KCl, ribonuclease H (1 unit), 33 units of DNA polymerase 1, 4 units of T4 DNA ligase, 0.5 μl of dNTP solution (20 mM dATP, 20 mM dCTP, 20 mM dGTP and 20 mM dTTP) and 0.1 μl 50 μg / ml bovine serum albumin (BSA). The mixture thus obtained was heated for one hour at a temperature of 12 ^o C, and then for one hour at a temperature of 25 ^o C. After this time, the reaction solution was diluted five times with distilled water, and then directly used to transform E. coli DH5 using the [Hana Hanahan DD (1983 J. Mol. Biol 166, 557-580], whereby a KM-102 cell cDNA library was obtained.

Example 3
Obtaining an oligonucleotide probe
Based on the AUUUA sequence in the 3'-untranslated region of cytokine mRNA, the oligonucleotide 5'-TAAATAAATAAATAA-3 'was chemically synthesized, consisting of 15 bases (sequence ID 13) and designated as ATT-3. The synthesis was carried out using a 380B automatic DNA synthesizer (Perkin-Elmer Japan Applied Biosystems) in accordance with the instructions attached to the accompanying instructions. This procedure was carried out by the phosphitamide method described by Caruther et al. (Matteucci, MD and Caruthers, MH (1981) J. Am. Chem. Soc. 103, 3185-2191]. After synthesis of the 15-mer, the obtained oligonucleotide was separated from the carrier and the protective groups were removed. Then, the oligonucleotide solution was lyophilized and a powder was obtained, which was dissolved in distilled water and stored at a temperature of -20 ^o C until its use.

Example 4
CDNA library screening
6500 colonies generated from the cDNA library obtained in Example 2 were fixed on a nitrocellulose filter in accordance with the method described by Grunstein & Hogness (Grunstein, M & Hogness, DS (1975) Proc. Acad. Sci USA 72, 3691-3695] The ATT-3 probe obtained in Example 3 was labeled at the 5'-end with ³² P and in accordance with standard procedures (see "Molecular Cloning-A Laborotory Manual") and labeled zones were used for colony hybridization.

Pre-hybridization was carried out at 37 ^° C for 3 hours using the following components: 6 x SSC, 1 x Denhardt's solution, 0.25% SDS, 0.05% sodium pyrophosphate and 100 μg / ml denatured salmon sperm DNA. Then, overnight, at a temperature of 31 ^° C., hybridization was carried out using the following components: 6 x SSC, 1 x Denhardt solution, 17 μg / ml yeast transport RNA, and 0.05% sodium pyrophosphate containing ³² P-labeled ATTT-probe 3.

 The next day, the nitrocellulose filter was washed at a temperature of 2 hours with 6 x SSC-solution containing 0.05% sodium pyrophosphate. After autoradiography, 33 positive clones were identified.

 The plasmid DNA was extracted from positive clones in accordance with standard procedures. Then several clones were randomly selected and their partial cDNA nucleotide sequences were determined using the dideoxy method. These partial sequences were evaluated for homology with the nucleotide sequences recorded in the EMBL or Geneank database using a personal computer, as a result of which it was found that some partial clone sequences detected using ATT-3 had homology with parts of the AIu repeat ( Schmid, CW & Jelinek, WR (1982) Science, 216, 1065-1070).

A DNA fragment containing the AIu repeat sequence was obtained from human genomic DNA and tagged with ³² P using standard procedures. This labeled DNA was used as a probe for colony hybridization using the 33 clones identified above, and it was found that 12 clones had AIu repeats. Then, the length of the cDNA insert of each of the remaining 21 clones was determined, and it was found that the length of the cDNA insert varied from 50 to 3600 bases.

 Mapping of the restriction enzyme was carried out on cDNA inserts from the remaining 21 clones, and partial nucleotide sequences were determined by the method described above. These partial sequences were evaluated for homology (as described above) with nucleotide sequences recorded in the EMB or GenBank database using a personal computer, whereby clones having new sequences were selected.

Example 5
Northern hybridization of clone N 31
One of the clones, namely, clone N 31 (designated pcD-31), had a cDNA insert having about 560 base pairs. According to the procedure described in Example 1, a PST1-Aat1 fragment (292 bp) obtained from the pcD-31 cDNA insert and placed ³² P, served as a probe in the Northern blot procedure using poly (A ) ⁺ RNA obtained from KM-102 cells. This hybridization was used to determine the length of natural mRNA corresponding to the insert of pcD-31 clone.

The Northern hybridization procedure was carried out as follows. 5.5 μg poly (A) ⁺ RNA was obtained from KM-102 cells and then incubated for one hour at a temperature of 50 ^o C in a mixture of 1 M glycosal, 50% dimethyl sulfoxide (DMSO) and 0.01 M disodium bisphosphate (pH 7, 0). After this time, 4 μl of electrophoresis pigment was added to the incubated mixture, which was then subjected to electrophoresis on a 1% agarose gel in 1 x TAE solution.

After electrophoresis, RNA on an agarose gel was transferred and left overnight in a nylon membrane filter (BioPad, Z probe) (using a 20 x SSC) by capillary transfer (see "Molecular Cloning-A Laboratory Manual"). After the transfer procedure, the filter was slightly washed with a 2 x SSC solution, dried with air, and then further dried at a temperature of 80 ^° C for 2 hours to fix mRNA.

The PstI-Aat1 fragment of pcD-31 clone was labeled with ³² P using a standard DNA tagging system (Amersham)
Pre-hybridization was carried out on the filter for 3 hours at a temperature of 37 ^o C in a solution containing 5 x SSCP, 2.5 x Denhardt's solution, 50% formamide, 10 mm disodium bisphosphate (pH 7.0), 0.5% SDS and 100 μg / ml denatured salmon sperm DNA.

Hybridization was then carried out on a filter overnight at 42 ^° C. in a solution containing ³² P-labeled probe, 5 x SSCP, 1 x Denhardt solution, 50% formamide, 10 mM disodium bisphosphate (pH 7.0), 0.1% SDS and 100 μg / ml denatured salmon sperm DNA. The next day, the filter was washed overnight at 37 ^° C. with a solution containing 50% formamide, 5 x SSC and 0.1% SDS, and then washed for 2 hours at the same temperature with a solution containing 40% formamide, 5 x SSC and 0.1% SDS, and finally washed at room temperature for 15 minutes with a 2 x SSC solution. As a result of autoradiography, it was found that the cDNA insert of pcD-31 clone is incomplete and the total length of the corresponding mRNA is 3.9 kb (determined using a calibration curve based on a molecular weight marker).

Example 6
Getting a fresh library for screening for cDNA clone pcD-31
Fresh cDNA library was obtained using cDNA synthesis system (cDNA Synthesis Systems Plus) and cDNA cloning system (λ gt10, adapter method, Amersham
5 μg poly (A) ⁺ RNA was extracted from KM-102 cells (in accordance with the procedure described in Example 1) and 100) reverse transcriptase units were reacted for 40 minutes at 42 ^° C. in 50 μl reverse transcriptase reaction solution . After this time, 20 μl of [α - ³² P] dCTP, 93.5 μl of buffer 4 units of ribonuclease H and 115 units of DNA polymerase 1 (all of which were included in the kit) were added to the reaction solution, which was first incubated at a temperature of 12 ^o C for one hour, and then at a temperature of 22 ^o C for an hour, and finally heated for 10 minutes at a temperature of 70 ^o C. After heating, 10 units of T4 DNA polymerase (included in the kit) was added to the reaction solution, and the resulting the mixture was allowed to react for 10 minutes at a temperature of 37 ^o C.

The reaction mixture was then deproteinized using a phenol / chloroform mixture. The reaction solution was centrifuged and the supernatant was collected and mixed thoroughly with 250 μl of 4 M ammonium acetate and 1 ml of ethanol. The resulting mixture was cooled overnight at a temperature of -20 ^o C, and the precipitate formed was collected by centrifugation. After this, the precipitate was dissolved in 30 μl of sterilized water. 10 μl of the resulting solution was removed and 2 μl of ligase / kinase buffer was added to the mixture. 250 PM EcoRI adapter and 5 units of T4 DNA ligase (all were included in the kit), after which the resulting mixture was incubated overnight at a temperature of 15 ^o C.

 The entire reaction solution was applied to a size fractionation column using an EcoRI adapter removal kit. Then the reaction solution was collected in 120 μl aliquots and each aliquot was mixed with 200 μl of 0.25 x TE buffer. Fractions (10 to 17) were combined and concentrated using butanol to obtain a total volume of 120 μl.

The entire volume of the concentrated product was mixed with 55 μl of sterilized water, 20 μl of ligase / kinase buffer and 40 units of T4-polynucleotide kinase (all of which were included in the solution), after which the resulting mixture was incubated for 30 minutes at 37 ^o C. after this time, the reaction mixture was deproteinized 3 times using a phenol / chloroform mixture, and then precipitated with ethanol and cooled overnight at a temperature of -20 ^o C. The resulting precipitate was collected by centrifugation and dissolved in 10 μl sterilized water, as a result of which a cDNA sample was obtained.

1 μg EcoRI (λ gt10), 1 μl of ligase / kinase buffer and 2.5 units of T4 DNA ligase (all included in the kit) were added to 2 μl of the cDNA sample obtained above and this mixture was incubated overnight at 15 ^o C. A sample containing 4 μl of a cDNA sample was obtained in the same manner. After that, each sample was processed as follows. All of the resulting reaction solution was first added to 10 μl of Extract A (included in the kit, and then the mixture was added to 15 Extract B (included in the kit) and the mixture thus obtained was incubated at 20 ^° C for 20 minutes to effect an in vitro packaging reaction .

At the end of this time, 470 μl of SM buffer was added to the reaction solution and the resulting mixture was stored at 4 ^° C. E. coli strain M514 was treated with magnesium sulfate (10 mM) and infected using the above solution, followed by λ gt-10- cDNA libraries from KM-102 cells.

Example 7
CDNA library screening
2 • 10 ⁵ plaques obtained from the combined cDNA libraries (obtained in Example 6) were fixed on nylon filters (Hyobnd N, Amersham) in accordance with the following procedure.

The infected E. coli obtained in Example 6 were cultured in ten 9 cm-plates containing a solid LB section so that the number of plaques on one plate was from 1 to 2 • 10 ⁴ . After this, the plaques were transferred onto the plate by gently pushing the nylon filter into the plate. An 18G syringe needle was used to puncture the filter and mark the gel at 3 locations for comparison. Then the filter was left for 5-10 minutes at a temperature of 4 ^o C, after which it was cleaned and immersed in an alkaline solution (0.1 N sodium hydroxide and 1.5 M sodium chloride) for 20 seconds. The filter was transferred to a neutral solution [0.2 M Tris-HCl (pH 7.5), 2 x SSCP] for a period of time from 20 seconds to one minute and dried with air at room temperature for 2 hours. Then this filter was dried at a temperature of 80 ^o C for 2 hours.

Example 8
Probe acquisition and hybridization
³² P-labeled probes were constructed from pcD-31 clone (obtained in Example 4) by labeling the pstI-Aat fragment and the EcoT221-Aat1 fragment (223 bp) using a standard DNA labeling system (Multiprime). Hybridization of plaques was carried out on the filter obtained in example 7, using the above probes.

Pre-hybridization was carried out by placing the filter in a bath containing 50% formamide, 5 x SSCP, 2.5 x Denhardt's solution, 0.01 M disodium bisphosphate (pH 7.0), 0.5% SDS, and 100 μg / ml denatured DNA sperm of salmon. The resulting mixture was incubated for 2 hours at a temperature of 37 ^o C.

Hybridization was then carried out by placing the filter in a reaction solution containing ³² P-labeled probes, obtained as described above, also in 50% formamide, 5 x SSCP, 1 x Denhardt solution, 0.01% M disodium bisphosphate (pH 7.0 ), 0.1% SDS and 100 μg / ml denatured salmon sperm DNA, and then the resulting mixture was incubated overnight at 37 ^o C.

 The next day, the filter was washed for three hours at room temperature with a solution containing 50% formamide, 5 x SSC solution, and T, 1% SDS, and then washed for five minutes at room temperature with a 2 x SSC solution. As a result of autoradiography, 80 positive clones were obtained during the initial screening.

 Using clones identified as positive (in each case), the procedures of Examples 7 and 8 were repeated for another three hours (quaternary screening) and finally only 17 positive clones were obtained. CDNA was isolated from each of the 17 clones, and the inserts were excised with EcoR1. The length of each cDNA insert was investigated using agarose gel electrophoresis, after which clone N 31-7 was selected, having a cDNA insert consisting of 3.9 bp and corresponding to the full length of the original mRNA.

Example 9
Restriction mapping of clones N 31-7
Clones N 31-7 were digested with EcoR1 to isolate and purify a 3.9 kb fragment containing a cDNA insert. This fragment was inserted into pUC18 using T4 DNA ligase. α DH5. E. coli was transformed using a new plasmid. Transformed cells were selected as they were resistant to ampicillin, and a clone pUCKM31-7 having a cDNA insert of 3.9 kb was identified by digestion of DNA with EcoRI and the resulting digested DNA was subjected to agarose gel electrophoresis.

 pUCKM31-7 was digested with each restriction enzyme HindIII, SacI, XbaI, SmaI, BgIII, EcoT22I and AatI, or parts thereof. The resulting fragments were subjected to agarose gel electrophoresis, after which the length of each fragment was measured using the λ HindIII / φX174HaeIII marker, used as an indicator. The obtained restriction map is shown in FIG. 7.

Example 10
The definition of the sequence of clone N 31-7
The complete nucleotide sequence of the cDNA insert of plasmid pUCKM-31-7 was determined by the dideoxy method using phage M13. In addition, part of this sequence was analyzed using a 373A DNA sequencer (Perkin Elmer Japan Applied Biosystems). The obtained nucleotide sequence is illustrated in the List of sequences under the number 1D N 11.

 The cUCA insert of plasmid pUCKM-31-7 has a length of 3815 bases and, in addition, obviously has an open reading frame consisting of 549 amino acids, starting with methionine. the poly (A) tail is obviously absent. By comparing the base sequence at the 3'-end of the insert of the plasmid pcD-31 with the sequence of the clone pUCKM-31-7, it was found that the insert of the clone pUCKM-31-7 is missing only part of the poly (A) tail (Fig. 8) and not Moreover.

 The nucleotide databank EMBL and GenBank and the databank NBRF and SWISS-PROT make it possible to compare the sequences of bases and amino acids, respectively. It was found that the closest match is 35.3% homology of this peptide sequence and the sequence of reductase of human glutathione. In accordance with this, it was concluded that the ORF cDNA insert of plasmid pUCKM31-7, obviously, encodes a new polypeptide. This new polypeptide is shown as a sequence in the sequence listing below under ID number 12.

Example 11
Expression and purification of a new polypeptide
Construction of a highly expressing vector and its expression in COS-1 cells.

 Plasmid pUCKM31-7 was digested with the HindIII enzyme, and the 3003 bp fragment containing the cDNA insert was isolated and purified according to standard procedures. The ends of the resulting fragment were blunted using a DNA blunting kit (Takara Shuzo).

Meanwhile, the high expression vector pcDL-SR α 296 [Takabe, Y. et al. (1988) Mol. Cell. Biol. 8, 466-472] were digested with the enzymes PstI and KPnI, and the ends were blunted using a DNA blunting kit. After that, the blunt insert was doped into a blunt plasmid by reaction using T4 DNA ligase. E. coli was transformed using the obtained DNA using the calcium chloride method and the obtained Amp ^R transformants were selected, and the DNA plasmid retained by microorganisms was analyzed.

 In particular, a strain in which the direction of cDNA transcription is identical to the direction of the SR α promoter was selected by digesting the plasmid with the HindIII and BgIII enzymes, followed by agarose gel electrophoresis to isolate 800 bp. fragment and this selected plasmid was designated pUR α 31-7 (Fig. 9). The SRα promoter contains the original SV40 promoter and the HTLV-1 long terminal repeat (LTP) sequence R-U5, and also has promoter activity 10 and 100 times greater than the activity of only one original SV 40 promoter.

 COS-1 cells were transfected with the obtained plasmid pSR α 31-7. Transfection of COS-1 cells was performed by electroporation using a GTE-1 gene introducer (Shimadzu).

COS-1 cells were cultured to a state of semi-continuity over the entire bottom surface of seven 150 cm ³ flasks, each of which contained 25 ml of DMEM (containing 10% fetal calf serum). Then the cultures were harvested and each of them was treated with 3 milliliters of Trypsin-EDTA solution (10 x solution, and then left at room temperature until the cells were separated. Then, 1 ml of inactivated fetal calf serum and 9 ml of fresh trypsin-EDTA solution were added. and the cells were collected by centrifugation.The collected cells were washed twice with PBS (-) - buffer and suspended in PBS (-) - buffer until a density of 6 • 10 ⁷ cells / ml was reached.

 In addition, plasmid DNA was obtained using the cesium chloride method, which was diluted to a concentration of 200 μg / ml in PBS (-) buffer.

 20 μl of each of the aforementioned cell preparations and plasmids were mixed and the resulting mixture was placed in a chamber containing electrodes located at a distance of 2 mm from each other. After this, the mixture was exposed to two pulses of 600 V over a time interval of 1 sec and a duration of 30 μs.

The chamber with the electrodes was cooled at 4 ^° C. for 5 minutes, after which the mixture of cells and DNA inside was mixed with 10 ml of DMEM containing 10% fetal calf serum. This mixture was then transferred to Petri dishes and cultured overnight at 37 ^° C. in 5% CO ₂ atmosphere. The next day, the culture supernatant was discarded, and the cells were washed with serum-free DMEM, suspended in 10 ml of DMEM and cultured for 3 days at 37 ^° C. At the end of this time, the cell supernatant was collected.

 The culture supernatant was also harvested from negative control. The plasmid used for negative control, namely plasmid pcDL-SR α 296, did not contain a cDNA insert, but otherwise it was obtained in the same way as the test culture.

 1 ml of each of the negative and control culture supernatants and the test culture were separately treated as follows. First, the supernatant was treated with trichloroacetic acid (TCA) to precipitate the protein, and the resulting precipitate was collected by centrifugation. This precipitate was washed with ice-cold acetone, dried with air, and then dissolved in SDS-PAGE buffer for a sample containing 2-mercaptoethanol. After that, SDS-PAGE-electrophoresis was carried out on a 12% gel under reducing conditions.

 The bands obtained after electrophoresis were stained with silver using the Daiichi reagent (Daiichi Chemical Detection). Several specific bands (molecular weight about 60,000) from the culture supernatant of the test sample were stained.

 Since the molecular weight of the polypeptide encoded in pSR α 31 is about 60,000, and since, based on their amino acid sequence, it is unlikely that the post-transcriptional modification contributed to the addition of saccharide side chains, it can be concluded that these several specific bands relate to the polypeptide encoded by cDNA pSR α 31-7.

Example 12
Obtaining highly expressing plasmids for COS-1 cells
The following step was carried out in order to ensure that several specific 60 kDa bands identified in Example 11 were similar to the polypeptide encoded by insert SR α 31-7. It would also be desirable to determine the N-terminal amino acid sequence of this polypeptide. Accordingly, a clone was obtained in which six additional His residues were encoded for the C-terminus of the polypeptide encoded by the pSR α 31-7 insert located immediately before the stop codon. Histidine residues have a high affinity for Ni ²⁺ , and therefore, it would be desirable to produce a polypeptide containing histidine hessamer (6 x His), which could be purified using an affinity column loaded with Ni ²⁺ .

The first oligonucleotide, consisting of 66 bases, 5'-CTAGCGCTCTGGGGCAAGCAТCCTCCAGGCTGGCTGCCACCACCACCACCACCACT-GATCTAGACT-3 '(sequence ID N 14) and the complementary chain (66 bases) were synthesized and purified using an Japan Periosystem 39 DNA synthesizer 4 DNA synthesizer. Both oligonucleotide preparations were mixed and incubated for 3 minutes at 70 ^° C, and then an additional 30 minutes were further heated at 37 ^° C for annealing. After that, the ends were phosphorylated using T4 polynucleotide kinase.

 The resulting double-stranded (dc) fragment was ligated into pUCKM31-7 using T4 DNA ligase, wherein said pUCKM31-7 was previously digested with Eco47III. This design is shown in FIG. 10. Using the calcium chloride method and the indicated DNA, DH5 α E. coli was transformed and the resulting transformed strains were selected and screened, resulting in pUCKM31-7His. By analyzing the corresponding base sequence of the indicated pUCKM31-7His into which the fragment was inserted, it was found that there are no deviations in this part of pUCKM31-7His.

 By subcloning the insert of pUCKM31-7His into pcDL-SR α 296, a highly expressing plasmid for COS-1 cells was obtained.

pUCKM31-7His was digested with XbaI and HindIII enzymes, the resulting fragments were purified, and the ends of the fragments were blunted using 1 unit. Klenov fragment and the presence of 2 nM dATP, 2 mm dCTP, 2 mm dGTP, 2 mm dTTP, 50 mm Tris-HCl (pH 7.2), 10 mm MgSO ₄ , 0.1 mm dithiothreitol and 50 μg / ml BSA.

 The high expression vector pcDL-SR α 296 was digested with the enzymes PstI and KpnI and blunted at the ends using a DNA blunting kit. The blunt fragments were then ligated into a blunt plasmid using T4 DNA ligase. The resulting plasmid was used to transform E. coli DH5 α. Transformants were selected and screened. A strain was selected in which the direction of cDNA transcription is identical to the direction of the SR α promoter, and the plasmid of this strain was designated pSR α 31-7His. COS-1 cells were transfected with the obtained plasmid pSR α 31-7His, and serum-free supernatant was obtained in accordance with the procedure described in example 11.

Example 13
Purification and analysis of the N-terminal amino acid sequence
600 ml of the supernatant obtained in Example 12 was dialyzed against 17 volumes of dialysis buffer for 15 hours at 4 ^° C. Then this buffer was replaced with another 17 volumes of dialysis buffer, after which dialysis was continued for another 4 hours at 4 ^° C.

The dialyzed preparation was subjected to affinity chromatography using FPLC (Rapid Liquid Protein Chromatography - Pharmacia) under the following conditions:
Column: 20 ml of resin ProBond ^TM (Invitrogen), loaded in a XK16 / 20 (2.0 x 20cm, Pharmacia)
Elution buffer
A) 20 nM phosphate buffer (pH 7.8) containing 200 mM imidazole, 0.5 M NaCl
B) 20 mM phosphate buffer (pH 7.8) containing 300 mM imidazole, 0.5 M NaCl
Flow rate: 1 ml / min.

Fraction Solution: 5 ml / tube
Elution conditions: after collecting 4 fractions with elution buffer (A), 16 fractions were collected with elution buffer (B) and these fractions were numbered from 1 to 20.

 300 μl of a sample was taken from each of the obtained fractions and each sample was separately treated with TCA, after which the resulting precipitate was subjected to SDS-PAGE electrophoresis using a 12.5% gel under reduction conditions as described above. By staining with silver, three bands were found centered around fraction N 10. The existence of three bands indicated that the pSR α 31-7His insert encodes a polypeptide having 3 sequences of different lengths with different N-terminal sequences.

The remaining fractions 7-14 were concentrated by TCA deposition and the resulting precipitate was subjected to SDS-PAGE electrophoresis using 10% gel under reducing conditions. Then, the protein bands were transferred from a polyacrylamide gel to a polyvinylidene difluoride (PVDF) film (ProBlot ^™ , Applied Biosystems) using a membrane gel transfer device (Marisol, KS-8441) operating at 9 V in the presence of a transfer buffer (0.02 % SDS, 20% methanol, 25 mm Tris-borate (pH 9.5)), for 2.5 hours, at 4 ^o C.

After that, the membrane was stained with 0.2% naphthol navy blue (Sigma), three bands corresponding to previously identified bands were cut out of the membrane, after which the sequence of each of them up to the 6th amino acid from the N-terminus was determined using a gas-phase protein sequencer. The N-end of the strip having the second largest apparent molecular weight (mol. Wt. About 60,000), had the following sequence:
Val-Val-Phe-Val-Lys-Gln (amino acids NN 1-6 of sequence ID N 12).

 These six amino acids corresponded to the first six amino acids of ORF from clone 31-7, and also corresponded to a sequence of six amino acids, starting from 24 amino acids (VAl) from the N-terminus of the polypeptide precursor encoded by the cDNA insert pSR α 31-7H and pSR α 31- 7. Accordingly, a deletion of amino acids 1-23 from the N-terminus of this precursor should result in the release of a mature form of the protein starting from the Val residue.

Example 14
Determination of restorative activity
i) Construction of an expression vector
The polypeptide purified as described in the previous examples could only be obtained in extremely small quantities, since it was expressed from COS-1 cells. Therefore, this polypeptide cannot be used for other purposes, for example, for activity analysis. Accordingly, it would be desirable to find a method for expressing the polypeptide encoded by the pSR α 31-7 cDNA insert in an alternative host, which would allow the polypeptide to be produced in quantities sufficient for purification and analysis. To achieve this goal, the following procedure was carried out.

 pUCKM31-7 was digested with the HindIII enzyme, a 3003 bp fragment containing the cDNA insert was isolated and purified, and the ends were blunted using a DNA blunting kit. Then the fragment was digested with the XbaI enzyme.

The expression vector pMAL-c (Guan, C. et al. (1987) Gene 67, 21-30) was digested with XoaI and StuI, and then the above XbaI-modified HindII fragment was ligated into this restriction plasmid using T4 DNA ligase . The resulting construction is shown in FIG. 11. This construct was then used to transform E. coli EI-1 and the resulting Amp ^P transformants were selected and screened. After that, a strain was selected in which the direction of the cDNA transcription was identical to the direction of the promoter, and the plasmid thus obtained was designated pMAL31-7.

 II) Expression and purification of the hybrid protein.

An E. coli seed culture containing pMAL31-7 was obtained by culturing overnight while shaking at 37 ^° C. in 3 ml LB medium containing 50 μg / ml ampicillin. The next day, 1 ml of inoculum was added to 100 ml of fresh LB culture medium containing 50 μg / ml ampicillin and cultured with shaking and at 37 ^° C until an OD of _{600 nm} reached 0.5. At this stage, IPTG was added to the culture to a final concentration of 0.1 mM, after which the culture broth was cultured with shaking and at 37 ^° C. overnight.

The next day, bacterial cells were isolated from the overnight culture by centrifugation at 6500 rpm and at 4 ^o C for 20 minutes. The resulting pellet was suspended in 10 ml of column buffer, and the cells in this suspension were disintegrated by sonication. Entire cells and cell fragments were removed by centrifugation for 30 minutes at 8800 rpm and at 0 ^o C, after which the soluble protein fraction was isolated as supernatant. 1 ml of this soluble fraction was chromatographed on an amylose resin column (New England Biolabs).

 Chromatography elution buffer was prepared by adding maltose to 10 ml of column buffer to a final concentration of 10 mM.

 A negative control sample was also chromatographed. This negative control was obtained in accordance with the same procedure, except that the pMAL-c vector did not contain any cDNA insert. Then, the reducing activity of the protein in chromatographic samples was analyzed.

iii) Determination of restorative activity
The recovery activity was determined in a cuvette (SARSTEDT, 10 x 4 x 45 mm) using dichlorophenol-indophenol (DCIP) and oxidized glutathione.

a) Determination of reducing activity using DCIP
90.4 μg (as determined using the protein analysis kit (Bio-Rad) from each chromatographic sample obtained in (11) were separately mixed with 1 ml of 50 μM DCIP (Sigma). Then, 15 μl 1 was added to each of the samples mm NADPH (Boehringer-Mannheim) and constantly monitored OD _{600 nm} and OD _{340 nm} The resulting decrease in optical density at both wavelengths is illustrated in Fig. 12, which shows that only pMAL31-7-sample contains a factor that restores DCIP.

b) Determination of reducing activity using oxidized glutathione
15 ml of 10 mM oxidized glutathione (Boerihger-Mannheim) was added to 90.4 μg of each of the chromatographic samples obtained as described in (11) and pre-loaded into separate cuvettes. 15 μl of 1 mM NADPH was added to each cuvette and the absorbance at 340 nm (OD ₃₄₀ ) was monitored over time. The results are shown in FIG. 13, which shows that only the protein from the pMAL31 sample has the ability to reduce oxidized glutathione. According to observations, it was found that if oxidized glutathione is absent, then NADPH is not absorbed, and from this it was concluded that the protein from the pMAL31-7 sample can reduce oxidized glutathione only in the presence of NADPH.

Example 15
Purification and analysis of the N-terminal amino acid sequence
Based on Example 13, it was concluded that COS-1 cells transfected with the pSR α 31-7H insert produce a polypeptide having three types of N-termini.

 In a separate experiment, to obtain a polyclonal antibody preparation against the KM31-7 block, rabbits were immunized using a fusion protein isolated from E. coli transformed with pMAL31-7. Then, Western blotting was performed using this polyclonal antibody, in which these three types of bands were also found in serum-free culture supernatant obtained from COS-1 cells transfected with pSR α 31-7. These results are similar to the results obtained in example 13.

 Accordingly, COS-1 cells were transfected with pSRα 31-7 in order to obtain a large volume of serum-free culture supernatant for purification and analysis of the N-terminal sequence of KM31-7.

 COS-1 cells were transfected with pSR α 31-7 and cultured for 3 days in 150 mm Petri dishes, each containing 30 ml of DMEM. After this time, the culture supernatant was collected and 30 ml of fresh medium was added to each dish, after which cultivation was continued for another 3 days. Then the culture supernatant was again collected. In Example 11, other transfection and culture options were described, but independently 199 cups were cultivated.

The collected supernatants were combined and, after centrifugation, 10 liters of serum-free culture supernatant were collected, which was then dialyzed overnight against 10 mM Tris-HCl (pH 9.0). The resulting dialyzed preparations were subjected to ion exchange chromatography eight times using FPLC (Pharmacia) under the following conditions:
Column: 20 ml DEAE Sepharose for flash chromatography (Pharmacia) loaded in XK16 / 20 (φ 2.0 x 29 cm, Pharmacia)
Elution Buffers:
A) 10 mM Tris-HCl (pH 9.0)
B) 10 mM Tris-HCl (pH 9.0) - 0.5 M NaCl
Flow rate: 1 ml / min.

Fraction Solution: 3 ml / tube
Elution Conditions: Change of elution buffer A to elution buffer B in a linear concentration gradient over 60 minutes.

These fractions, eluted at each NaCl concentration from 0.1 M to 0.4 M, were collected and combined and then dialyzed overnight against dialysis buffer containing 0.1 M Tris-HCl, 5 mM EDTA (pH 7, 6) and 1 mM 2-mercaptoethanol. The dialyzed preparation was subjected to affinity chromatography using 2 ', 5', -ADP-Sepharose 4B (Pharmacia) under the following conditions:
Column: 20 ml of 2 ', 5'-ADP-Sepharose loaded in XK16 / 20 (φ 2.0 x 20 cm, Pharmacia).

A) 0.1 M Tris-HCl, 5 mM EDTA (pH 7.6), 1 mM 2-mercaptoethanol
B) 0.1 M Tris-HCl, 5 mM EDTA (pH 7.6), 1 mM 2-mercaptoethanol, 10 mM NADPH.

 Flow rate: 0.5 ml / min.

Fraction Solution: 2 ml / tube
Elution Conditions: Change elution buffer A to elution buffer B in a linear gradient concentration over 120 minutes.

 100 μl aliquots from each of the obtained fractions were precipitated using TCA, and the precipitates were subjected to DSB-PAGE electrophoresis using 12.5% gel under reducing conditions.

 After electrophoresis, the gel was stained with silver to detect protein bands. Based on fraction N 11, three bands were obtained.

 All other fractions N 11 - N 14 were then concentrated by TCA precipitation and the resulting precipitate was subjected to SDS-PAGE electrophoresis on a 12.5% gel under reduction conditions. After electrophoresis, the protein was transferred from the gel to the Problot PVDF membrane (Applied Biosystems). After transfer of the protein to the membrane, this membrane was stained with 0.2% naphthol blue-black and three protein bands were excised. N-terminal sequence analysis was performed using a gas phase protein sequencer.

It was found that the N-terminus of the band with the smallest molecular weight of the three types seemed to have the Lys-Leu-Leu-Lys-Met sequence. These five amino acids correspond to five amino acids, starting from the 49th amino acid from the N-terminus of the polypeptide sequence encoded by the pSR α 31-7 cDNA insert. In accordance with this, it was concluded that cleavage of the peptide at the 48th residue leads to the formation of a single mature form of the protein starting at the N-terminal
Example 16
Obtaining monoclonal antibodies against protein KM31-7
a) Obtaining antigenic protein
An E. coli seed culture containing pMAL31-7 was obtained by culturing a cell loop in 3 ml of LB medium containing 50 μg / ml of amcipillin, with shaking and at 37 ^° C. overnight. 1 ml of the resulting seed culture was inoculated in 100 ml of fresh LB medium containing 50 μg / ml ampicillin, and cultured with shaking and at 37 ^° C until an OD of _{600 nm} reached 0.5. At this stage, IPTG was added to the culture broth to a final concentration of 0.1 mM, and then cultured and shaken with shaking and at 37 ^° C. overnight.

Cells were isolated from the obtained overnight culture by centrifugation for 20 minutes at 6500 rpm and at 4 ^° C, and the pellet was suspended in 10 ml of column buffer. Cells in the resulting suspension were disintegrated using an ultrasonic disintegrator, and the resulting liquid was centrifuged for 30 minutes at 8000 rpm and at 0 ^° C. The resulting supernatant contained a soluble protein fraction.

 This soluble protein fraction was chromatographed on a 1 ml amylose resin column. Elution was performed using 10 ml of column buffer containing 10 mm maltose. The hybrid protein obtained after chromatography was stored and then used as an antigen.

b) Obtaining spleen cells from immunized mice
2 ml of complete Freund's adjuvant was added to 2 ml of antigen (equivalent to 200 μg), purified as described above in step (a), as an emulsion. This emulsion was dissolved in a 5 ml barrel of a syringe equipped with a glass piston, and then used to immunize 8-week-old male BALB / c mice by subcutaneous injection.

 In subsequent immunization cycles, the procedure was exactly the same as for the first immunization, except that in this case the antigen was administered in incomplete Freund's adjuvant. Immunization was carried out four times, with each injection being done approximately every 2 weeks.

 Starting from the second immunization, immediately after immunization, mice were bled from the venous plexus of the fundus and the serum antibody titer KM31-7 was determined by ELISA.

Solid Phase ELISA Anti-KM31-7 Antibody
150-200 microliters (corresponding to approximately 200 ng of the fusion protein) of serum-free supernatant obtained from COS-1 cells transfected with pSR α / 31-7 were placed in each well of a 96-well ELISA plate (Costar) and used as antigen. The plate was then left overnight at 4 ^° C. to cover the bottom surfaces of the plate wells. The next day, the plate was washed 3 times with 0.1% Tween 20 / phosphate-buffered saline (0.1% Tween 20 / PBS), 0 and 100 μl BSA was added to each well, adjusted to 10 μg / ml with phosphate buffered saline after which the tablet was left for 1 hour at room temperature.

 After this time, the plate was washed three more times with 0.1% Tween 20 / PBS. Then, 30-100 μl of the primary antibody in the form of a serially diluted sample (for example, mouse serum, hybridoma culture supernatant or monoclonal antibody) was added to each well, after which the plate was left for 1 hour at room temperature.

 After this, the plate was again washed three times with 0.1% Tween / PBS, and 100 μl of the “second” antibody was added to each well. The second antibody was obtained as a solution with a 3000-fold dilution of the goat anti-mouse IgG-peroxidase complex (Amersham) or as a solution with a 3000-fold dilution of the goat anti-mouse IgG-alkaline phosphatase complex (B10-RAD). Then this tablet was left for two hours at room temperature.

 After this time, the plate was washed again three times with 0.1% Tween 20 / PBS, and then 100 μl of either a peroxidase substrate solution (B10-RAD, Peroxidase Substrade Kit ABTC) or 10% diethanolamine containing 0.001% steam was added to each well. nitrophenyl phosphate solution. Then the tablet was left for 15-30 minutes at room temperature, after which the antibody titer can be calculated by measuring the optical density at 415 nm using a tablet reader (B10-RAD).

(c) Obtaining mouse myeloma cells
8-Azaguanine-resistant mouse myeloma cells P3-X63-Ag8.653 (653) (ATCC N CPD-1580) were cultured in normal medium (complete GIT medium) to obtain at least 2 • 10 ⁷ cells.

(d) Obtaining hybridoma
1.4 • 10 ⁸ spleen cells of immunized mice obtained after immunization according to the scheme described above in (b) were thoroughly washed with DMEM medium (Nissui Pharmaceutical). The washed cells were mixed with 1.5 × 10 ⁷ mouse P3-X63-Ag8.653 (653) mouse myeloma cells, prepared as described above in step (c), and this mixture was centrifuged for 69 minutes at 800 rpm.

 A group of cells consisting of spleen cells and P3-X63-Ag8.653 cells (653) was collected as a precipitate and disintegrated. A 50% solution of polyethylene glycol 4000 (polyethylene glycol N 4000) and DMEM were preliminarily prepared and this solution was poured into disintegrated cells at a rate of 2 ml / min for 1 min, with stirring. Then, in a similar manner (i.e., for 1 min at a rate of 2 ml / min), DMEM was added to the cell preparation. This procedure was repeated one more time for both the polyethylene solution and the DMEM solution. Finally, 16 ml of DMEM was gradually added over 3 minutes. Then, the resulting cell preparation was centrifuged for 6 minutes at 800 rpm. The resulting supernatant was discarded and then suspended in 35 ml of complete GIT medium containing 5-10 ng / ml of mouse 1D-6.

(e) Screening hybrid
100 μl of the suspension prepared as described above in step (b) was added to each well of a 96-well plate (Sumimoto Bakelite) and then cultured in a 7.0% -CO ₂ incubator at 37 ^° C. 7 days after incubation, 50 μl of HAT medium was added to each well. After another 4 days incubation, an additional 50 μl of HAT medium was added to each well. Then the plate was incubated for another 3 days. After this time, a culture supernatant sample was taken from the wells in which the growth of the colonies of the hybrid cells was observed, and the anti-KM31-7 antibody titer was analyzed using the enzyme-linked immunosorbent assay (ELISA described in paragraph (o)). The sampled medium was immediately replaced with an HT medium.

(f) Cloning
Cloning of cells taken from the wells tested as positive was performed three times by analysis using the limiting dilution method. Clones that showed a consistent antibody titer was observed to be selected for use as hybridoma cell lines producing a monoclonal anti-KM31-7 antibody. In particular, at this stage, ELISA was performed not only as described in (b), but a control ELISA was performed using serum-free culture supernatant obtained from COS-1 cells transfected with pcDL-pSR α 296 to obtain a solid phase . Accordingly, cell lines that are reactive in the case of the first ELISA, but not reactive in the case of the control ELISA, were selected for cloning.

(o) Purification of monoclonal antibody
The culture supernatant from a hybridoma cell line producing an anti-KM37-7 monoclonal antibody was collected, the filter was sterilized with 0.22 μl Millipore filter, and then the antibodies were purified using MabTrap GII (Pharmacia).

(h) Monoclonal Antibody Assay
1) Antigenic specificity of monoclonal antibodies
Through immunoprecipitation using a serum-free culture supernatant obtained from COS-1 cells transfected with pSR α 31-7, it was found that monoclonal antibodies were specific for the KM31-7 protein.

2) Classification of monoclonal antibodies
This test was performed using the mouse monoclonal antibody isotyping kit (Amersham), and as a result of this test, it was found that the antibody belongs to the IgG1 subclass.

Example 17
Isolation and purification of KM31-7 protein using the antigen-antibody reaction
This test was carried out in accordance with the procedure described above in example 16 (h), (1). This test was also repeated using antibodies and serum-free supernatant obtained from COS-1 cells transfected with pcDL-pSR α 296.

 1.4 μg of monoclonal antibody was added to 1.7 ml of each of the serum-free supernatants and left for 1 hour at room temperature to carry out the reaction, followed by centrifugation in 2.2 ml microcentrifuge tubes at 20 rpm. Control was performed using serum-free supernatant obtained from COS-1 cells transfected with pSR α 31-7, but without the addition of a monoclonal antibody.

 30 μl of Fast Flow Protein G Sepharose (Pharmacia), pre-washed with 0.1% Tween 20 / PBS, was added to each tube to absorb the antibody, and then centrifuged for 30 minutes at 20 rpm at room temperature.

 After this time, each mixture was centrifuged for several seconds in a microcentrifuge at 10,000 rpm, after which the supernatant was carefully removed so that this did not entail any segment loss. Then, the pellets were separately washed with 0.1% Tween 20 / PBS, and then subjected to microcentrifugation and washed 5 more times in the same manner.

The resulting sediment was suspended in a SDS-PAGE sample buffer solution containing 10 μl of 2-mercaptoethanol. Each suspension was heated for 2 minutes at 90 ^° C and then subjected to SDS-PAGE electrophoresis using 12.5% gel under reducing conditions. After electrophoresis, the product was transferred from a polyacrylamide gel onto a nitrocellulose film (B10-RAD). Western blotting was performed using the polyclonal anti-KM31-7 antibody described in Example 1 (a), and as a result of this analysis, it was found that the monoclonal anti-KM31 antibody specifically precipitates the KM31 protein from the serum-free culture supernatant CO-1 / pSR α 31 -7.

Example 18
Obtaining CYVV-Nla / KM31-7-hybrid protein
To produce the KM31-7 protein using the CYVV-Nla protease, it is necessary that the 3 ′ end of the Nla gene be ligated with the KM31 protein DNA in the same reading frame. For this, the following two-stage procedure was carried out:
1) Introduction of the 3'-side chain (SmaI-XbaI, 1005 bp) KM31-7-cDNA into pKSUN9
In order to obtain a SmaI-XbaI fragment (1006 bp) containing the 3'-end of KM32-7-cDNA, 7 μg pSR α 31-7 plasmid, DNA was digested with restriction enzymes SmaI and XbaI and the resulting fragment was isolated and purified using GENECLEAN 11 (Funakoshi Japan) using 0.8% agar gel.

 Meanwhile, 5 μg of pKSUN 9 plasmid DNA was similarly digested with SmaI and XbaI enzymes, and the cleaved fragment was dephosphorylated with bovine alkaline phosphatase (alkaline phosphatase E. coli C 75, Takara Shuso, Japan). The resulting dephosphorylated linearized DNA was ligated with the SmaI-XbaI-KM-31 fragment using a ligation kit (Takara Shuso) and the resulting construct was used to transform E. coli strain JM109. Transformants were selected and screened, resulting in a clone pU1a31-7X containing a SmaI-XbaI fragment.

11) Crosslinking of Nla-protease and KM31-7
To cross-link the C-terminal sequence of N1a with the N-terminal sequence of the KM31-7 subtype having a valine N-terminal residue in the same reading frame, four types of PCR primers were constructed using a DNA synthesizer (Perkin-Elmer Japan Applied Biosystems Model 392). These primers had the following sequences:
5 'GGT CAG CAC AAA TTT CCA 3' SEQ 1 N 15 (1)
5 'AAA CAC AAC TTG GAA TGA ACA ATT 3' SEQ 1 N 16 (2)
5 'TCA TTC CAA GTT GTG TTT GTG AAA 3' SEQ 1 N 17 (3)
5 'CAT AGG ATG CTC CAA CAA 3' SEQ 1 N 18 (4)
The first PCR cycle was performed using 1 μg DNA of plasmid pK SUN9 as a template. 100 pM of each of primers (1) and (2) and 1/10 volume of 10 × concentrated reaction buffer solution for Tag polymerase were added successively to the reaction solution, and then 5 units. Tag polymerase (Takara Shuzo). The PCP reaction was carried out according to the following scheme: first, the reaction was carried out at 72 ^° C for 3 minutes, and then 30 cycles were carried out for 1 minute at 94 ^° C, 2 minutes at 55 ^° C and 3 minutes at 72 ^° C, followed by treatment at 72 ^o C for 10 minutes. After the PCR reaction, the amplified DNA product was subjected to electrophoresis on an 8% polyacrylamide gel. Strips of gel containing DNA were identified by staining with ethidium bromide and crushed. Then, 300 μl of elution buffer (0.5 ammonium acetate, 1 mM EDTA, pH 8.0) was added to each of the fragmented strips and incubated overnight at 37 ^° C. After centrifugation, a supernatant containing purified and amplified DNA was obtained.

 Then PCR was carried out again in the same way, except that this time 1 μg of DNA of plasmid p CKM31 was used as a template, and primers (3) and (4) were used as primers, and as a result, purified DNA was obtained as described above .

 The amplified fragment from the first PCR reaction contained a sequence encoding the residues of the N-terminal KM31-7 protein, starting from Val-Val-Phe and further (for 31 bp) and located upstream from the Nla XhoI site. The amplified fragment from the second PCP reaction contained a sequence encoding Asn-Cys-Ser-Phe-Gln- from the C-terminus of Nla and further (for 32 bp) and located "below" from the SmaI site KM31-7- cDNA

 Accordingly, when conducting PCR using both DNA fragments obtained from two PCRs, together with primers (1) to (4), a hybridized strand consisting of 9 bp was obtained. 3 - terminal Nla and 15 bp the sequence encoding the desired end of KM31-7. Thus, it is possible to generate a DNA sequence containing this part as a linker.

 Based on this, a second “round” of PCR was carried out in exactly the same way as the first, after which the resulting amplified fragment was isolated from the gel.

III) Introduction of Nla / KM31-7-DNA into PUla31-7X
5 μg of pUla31-7 X-plasmid DNA obtained in part (1) was digested with XhbI and SmaI enzymes and the obtained DNA was dephosphorylated by treatment with bovine alkaline phosphatase. The PCR product obtained in part (II) was also digested with the enzymes XhoI and SmaI, after which the resulting fragment was ligated with the digested dephosphorylated pNla31-7SX using a ligation kit. The resulting construct was used to transform E. coli strain J M109.

Then, Amp ^R transformants were selected and screened.

 Screening was performed by digestion with the XhoI enzyme followed by electrophoresis. After that, clones having only a band of 8.0 bp were selected. Then the plasmids of the selected clones were digested with the HindIII enzyme and again subjected to electrophoresis. The selected plasmid had a 330 bp band corresponding to the portion of the Nla cDNA insert. This plasmid, designated pNla31-7V, contained the Xho1 and Va1 PCR product.

 Then, the nucleotide sequence of clone pNla31-7V was determined, as a result of which it was found that the sequences encoding Nla and KM31-7 were ligated while maintaining ORF, and the necessary cleavable G1n-Na1 sequence was located between the Nla and KM31-7 protein.

IV) KM31-7 Protein Production
Western blot analysis confirmed that pNla31-7V functions in E. coli and that the KM31-7 protein can be expressed by the engineered recombinant gene.

An E. coli seed culture containing plasmid pNla31-7 was cultured overnight with shaking in 3 ml LB medium containing 50 μg / ml ampicillin. Then, 1 ml of this seed culture was added to 100 ml of fresh LB medium containing 50 μg / ml ampicillin, and cultured at 38 ^° C. and with shaking until the op _{600 nm} reached 1.0. At this stage, 1PTG was added to the culture broth to a final concentration of 1 mM, after which the culture was incubated at 28 ^° C and with shaking for another two nights.

After this time, 1 ml of the culture was transferred to a centrifuge tube and centrifuged at 15,000 rpm for 5 minutes. Then the supernatant was removed, and the pellet was mixed with 300 μl of sterile water and 300 μl of SDS-PAGE buffer solution containing 2-mercaptoethanol to disperse the precipitated cell inclusions. The resulting suspension was heated for 2 minutes at 95 ^o C, and then 10 μl of this suspension was subjected to SDS-PAGE electrophoresis on 8% gel under reducing conditions.

After electrophoresis, the protein was transferred from the gel to the nitrocellulose membrane. This procedure was carried out by combining the gel with a membrane, followed by 2.5-hour incubation at 4 ^° C in the presence of translation buffer (25 mM Tris-HCl, 1.4% glycine and 20% methanol) at 19 V using a device transferring gel to membranes (Marisol Japan).

 Then, the nitrocellulose membrane was washed with 20 ml of PBS-T medium, after which blocking was carried out for 1 hour in 20 ml of PBS-T containing 5% separated milk (Snow, Brand Co., Ltd). After this time, the membrane was washed with two batches of 20 ml PBS-T, and then left for 90 min in 20 ml PBS-T containing 1 μl of 100 x-diluted rabbit Mab serum ("first" antibody) against KM31- in sterile water 7, for the implementation of the reaction. After that, the nitrocellulose film was washed once for 15 minutes and twice for 5 minutes (each time 20 ml of PBS-T).

 The washed membrane was then placed in a bath with a 3000x-diluted and peroxidase-labeled goat anti-rabbit immunoglobulin (IgG) antibody (B10-RAD) in PBS-T (used as the "second" antibody) and left for 1 hour. At the end of this time, the membrane was washed with 20 ml of PBS-T and transferred to an ECI detection reagent bath (Amersham), and bands reacting with anti-KM31-7 antibody were detected by autoradiography.

 Western blotting was performed, and it was found that the molecular weight of the band was about 60,000. This band showed the same mobility as the protein having the second of the largest molecular weights of the three KM31-7 proteins found in the serum-free culture supernatant, obtained by transfection of COS-1 cells with clone pSR α 31-7, used as a control.

Wednesday
x M phosphate buffer
x M Na ₂ HPO ₄ solution was adjusted to the desired pH using x M NaH ₂ PO ₄ solution.

Inoculation buffer
0.1 M Tris-HCl buffer, pH 7.0 0.05 M EDTA, 1% 2-mercaptoethanol.

Extraction buffer
0.1 M Tris-HCl buffer, 0.05 M EDTA, 1% 2-mercaptoethanol, pH 7.0.

Degradation solution
200 mM ammonium carbonate, 2% SDS, 2 mM EDTA, 400 μg / ml bentonite and 20 μg / ml protease K (pH 9.0).

1 x SSc
0.15 m NaCl, 0.015 M trisodium citrate, pH 7.0.

Liquid LB Medium
10 g of Bacto-Tripotone (Difco) 5 g of Bacto-yeast extract (Difco) and 5 g of sodium chloride were adjusted to a volume of 1 L using distilled water.

Tris-Calcium Buffer
10 mM Tris, 50 mM calcium chloride was adjusted to pH 7.4 by the addition of hydrochloric acid.

Lysis buffer
0.17 g of sucrose, 250 μl of 1M Tris-HCl buffer (pH 8.0) and 200 μl of 0.5 - M EDTA (pH 8.0) were brought to a volume of 20 ml using bidistilled water.

Alkaline-SDS solution
0.2 M sodium hydroxide, 1% SDS.

TBE solution
100 mM Tris, 100 mM boric acid, 1 mM EDTA.

Denaturation solution
1.5 M sodium chloride; 0.5 M sodium hydroxide.

Neutralization buffer
0.5 M Tris, 3 M sodium chloride (pH 7.4).

50 x Denhardt Solution
1% polyvinylpyrrolidone, 1% bovine serum albumin and 1% Ficoll 400. This solution was diluted with bidistilled water, respectively, and the desired concentration was obtained.

5x Denaturation Buffer
125 μl of 1 M glycine (pH 9.0), 25 μl of 1 M magnesium chloride and 850 μl of double-distilled water.

5x Labeling Buffer
25 μl of 1 M Tris-HCl buffer (pH 7.9), 5 μl of 1 M magnesium chloride, 2.5 μl of 1 M dithiothreitol and 9.2 μl of double-distilled water.

10 x M9 Saline
0.145 M disodium phosphate, 0.172 M potassium dihydrogen phosphate, 0.187 M ammonium chloride and 0.137 M sodium chloride (pH 7.0).

M9 Minimum Agar
10 ml of 10x M9 saline, 100 μl of 1 M magnesium sulfate, 1 ml of 20% glucose, 50 μl of 1% thiamine hydrochloride salt 1 ml of 0.01 M calcium chloride and 13 ml of bidistilled water, was stirred, sterilized by filtration, and then poured in tablets immediately after adding 50 ml of 3% Bacto-agar.

Liquid SOB
10 g of Bacto-Tryptone, 2.5 g of Bacto-yeast extract, 100 ml of 5 M sodium chloride and 125 μl of 1 M potassium chloride were inoculated and brought to a volume of 500 ml using distilled water. After autoclaving, 5 ml of 1 M magnesium chloride and 5 ml of 1 M magnesium sulfate were added to the mixture.

TFB1 buffer
5 ml of 1 M 2- (N-Morpholino) ethanesulfonic acid (MES) (adjusted to pH 6.2 using 1 n7 HCl), 6.045 g of rubidium chloride, 0.735 g of calcium chloride dihydrate and 4.94 g of manganese chloride tetrahydrate were mixed, adjusted to pH 5.8 using glacial acetic acid, and then the resulting mixture was brought to a volume of 500 ml using bidistilled water and sterilized by filtration.

TFB2 buffer
1 ml of 1 M 2- (N-morpholino) propanesulfonic acid (MOPS), 1.102 g of calcium chloride dihydrate, 0.12 rubidium chloride and 15 ml of glycerol were mixed and adjusted to pH 6.5 using glacial acetic acid, after which the resulting mixture made up to a volume of 100 ml using bidistilled water and sterilized by filtration.

Liquid SOC
5 ml of liquid SOB medium, 90 μl of 20% glucose.

2x ut
16 g of Bacto-Tryptone, 5 g of Bacto-yeast extract and 5 g of sodium chloride were mixed and adjusted to a volume of 1 L using bidistilled water.

PBS-TW-environment
80 mM disodium bisphosphate, 20 mM sodium bisphosphate, 100 mM sodium chloride and 0.1% Tween 20.

TBS-T medium
4 g of sodium chloride, 0.1 g of potassium bisphosphate, 1.45 g of sodium bisphosphate dodecahydride, 0.1 g of potassium chloride, 0.1 g of sodium azide were brought to a volume of 1 liter using bidistilled water (pH 7.4).

Alkaline phosphatase substrate solution
0.01% p-nitrophenyl phosphate was dissolved in a 10% aqueous diethanolamine solution and adjusted to pH 9.8 using hydrochloric acid.

Wednesday A
D MEM (Medium Needle modified by the Dulbecco method and containing 4.5 g / L glucose), 10% inactivated fetal bovine serum (manufactured by Hyclone) and 10 mM HEPES (pH 7.2).

Wednesday B
D MEM (containing 4.5 g / L glucose), 10 mM HEPES (pH 7.2) 3% inactivated fetal bovine serum, 5 μg / ml bovine insulin (manufactured by Sigma) 8 μg / ml d-biotin (manufactured by Sigma) 4 μg / ml pantothenic acid (manufactured by Sigma), 1.0 mM dexamethasone (manufactured by Sigma) and 0.5 mM isobutylmethylxanthine (manufactured by Aldrich).

Wednesday C
G MEM (containing 4.5 g / L glucose), comprising 5% inactivated fetal bovine serum 10 mM HEPES (pH 7.2), and 100 ng / ml bovine insulin.

Wednesday D
D MEM (containing 4.5 g / L glucose), 5% inactivated fetal bovine serum, 10 mM HEPES (pH 7.2) 100 ng / ml bovine insulin and 10 U / ml sodium heparin (manufactured by Novo Industry Co.).

LPL Substrate Solution
13 mM glycerol-tri 9.10 (n) - ³ N oleate (51.8 kVq / μM manufactured by Amersham), 1.3 mg / ml disetaroyl-L-α-phosphatidylcholine (manufactured by Sigma Co.), 20 mg / ml bovine serum albumin (manufactured by Sigma Co.), 135 mM Tris hydrochloride Tris-HCl, pH 8.1, manufactured by Sigma Co., 16.5% (v / v) glycerol and 16.5% (v / v) inactivated fetal bovine serum.

Guanidine Thiocyanate Solution
4 M guanidine thiocyanate, 1% Sarkosyl, 20 mM ethylenediaminetetraacetic acid (EDTA), 25 mM sodium citrate (pH 7.0), 100 mM 2-mercaptoethanol and 0.1% antifoam A (Sigma) reagent.

Adsorption buffer
0.5 m NaCl, 20 mM Tris-HCl (pH 7.5), 1 mM EDTA and 0.1% SDS.

Elution solution
10 mM Tris-HCl (at 7.5), 1 mM EDTA and 0.05% SDS.

Reverse Transcriptase Reaction Solution Example 2
50 ml Tris-HCl (pH 8.3), 8 mM MgCl ₂ , 30 mM KCl, 0.3 mM dithiothreitol, 2 mM dATP, 2 mM dGTP, 2 mM dTTP, 10 μg [α - ³² P] dCTP and 1 4 μg of vector plasmid DNA (pcDV-1 with 3'-oligonucleotide (dT) tail, Pharmacia).

Terminal transferase reaction solution
140 mM potassium cacodilate, 30 mM Tris-HCl (pH 6.8), 1 mM CoCl ₂ , 0.5 mM bitiotreitol, 0.2 μg polynucleotide A, and 100 mM dCTP.

Restriction buffer
50 mM NaCl, 10 mM Tris-HCl (pH 7.5), 10 mM MgCl _2, and 1 mM dithiothreitol.

10-volume ligase buffer
10 mM ATP, 660 mM Tris-HCl (pH 7.5), 66 mM MgCl _2, and 100 mM dithiothreitol.

Electrophoresis pigment
50% glycerol, 0.01 M disodium bisphosphate (pH 7.0) and 0.4% bromophenol blue.

1x TAE
0.014 M Tris-acetate and 0.001 M EDTA
1x SSCP
120 mM NaCl, 15 mM sodium citrate, 13 mM potassium bisphosphate and 1 mM EDTA.

Reverse Transcriptase Reaction Solution of Example 6
1x Buffer for synthesis of the first chain, 5% sodium pyrophosphate, 100 units of ribonuclease inhibitor, 1 mM dATP, 1 mM dGTP, 1 mM dTTP, 0.5 dCTP and 3.75 mg of oligonucleotide primer were obtained using the cDNA Cloning System (Amersham).

SM Buffer
100 mM NaCl, 8 mM MgSO ₄ • 7H ₂ O, 50 mM Tris-HCl (pH 7.5) and 0.01% gelatin.

Analysis buffer
20 mM phosphate buffer (PH 7.8) and 0.5 M NaCl.

Column buffer
10 mM Tris-HCl (pH 7.4), 200 mM NaCl and 1 mM EDTA.

Buffer solution for Tag polymerase reaction
500 mM Tris-HCl (pH 8.3), 500 mM potassium chloride, 15 mM MgCl ₂ , 100 mM dATP, 100 mM dCTP, 100 mM dGTP, 100 mM dTTP and - mg / ml gelatin.

Claims (11)

1. Polynucleotide sequence encoding a fusion protein and characterized by the General structural formula
ABC
where A is a nucleotide sequence of 10-1311 in SEQ ID NO;
B is a sequence encoding a peptide: Asn-Cys-Ser-Phe-Gln;
C represents at least one sequence encoding a target polypeptide.  2. The polynucleotide sequence according to claim 1, characterized in that C is a sequence encoding a KMZ1-7 polypeptide, which includes the sequence of amino acids 1 to 526 in SEQ ID N 12, provided that the polypeptide encoded by the specified polynucleotide sequence has ability to restore dichloroindophenol and oxidized glutathione.  3. The nuclear inclusion polypeptide having the sequence represented by residues 4 to 437 in SEQ ID N 2.  4. The fusion protein encoded by the polynucleotide sequence according to claim 1.  5. The polynucleotide sequence encoding the KMZ1-7 polypeptide, which is an amino acid sequence of 1 to 526 in SEQ ID N 12, provided that the polypeptide encoded by the indicated polynucleotide sequence has the ability to restore dichloroindophenol and oxidized glutathione.  6. The polynucleotide sequence according to claim 5, characterized in that the coding sequence is a nucleotide sequence from 70 to 1647 specified in SEQ ID N 11.  7. The KMZ1-7 polypeptide, which is the sequence of amino acids 1-526 in SEQ ID N 12, encoded by the polynucleotide sequence according to claim 5 or 6.  8. The KMZ1-7 polypeptide, which is the sequence of amino acids 1-526 in SEQ ID N 12, according to claim 7, having the property of reducing oxidized glutathione and dichloroindophenol.  9. A pharmaceutical composition comprising a pharmaceutically active amount of the peptide according to claim 7, in combination with a pharmaceutically acceptable carrier for it.  10. A monoclonal antibody specifically interacting with the KMZ1-7 polypeptide and having the following characteristics: produced by a strain of hybrid cultured cells Mus musculus MKM 150-2 FERM BP-5086; refers to the Ig G1 isotype, can be used to purify the KMZ1-7 polypeptide.  11. The strain of hybrid cultured Mus musculus FERM BP-5086 cells used to produce a monoclonal antibody that specifically interacts with the KMZ1-7 polypeptide. Priority on points:
07/13/94 according to claims 1, 3, 4;
09/13/94 according to claims 2, 5 to 9;
07/13/95 according to paragraphs 10 and 11.

Images