Chemokine Beta-16
The present invention relates to a human CC chemokine protein ( 1 e a cytokine having the first two ot its four cysteine residues adjacent as indicated bv CC ) and to polynucleotides encoding this protein
BACKGROUND OF THE INVENTION
The discovery of IL-8. in 1987, revealed the existence of a novel class of small cytokines. now called chemokines. that are widely studied because of their
to activate leukocytes and their potential role as mediators of inflammation \ number of different human chemokines have been identified after IL-8 by cloning or biochemical purification and amino acid sequencing All have four conserved cvsteines that form characteristic disulfide bonds, a shott amino-terminal and a longer carboxy-terminal sequence Two subfamilies are distinguished by the arrangement of the first two cvsteines. which are either separated by one amino acid (CXC chemokines) or are adjacent (CC chemokines ) Chemokine cDNAs typically encode proteins of 92-99 ammo acids in length that are secreted after cleavage of a leader sequence of 20-25 amino acids Modeling on the basis of the NMR-deπved structure of IL-8 suggests that CXC and CC chemokines are folded in a similar manner
The first human CC chemokine was identified by differential hvbπdization cloning and was termed LD78 (Obaru. K Fukuda. Vt . Maeda. S and Shimada. K ( 1986) J Biochem (Tokyo) 99 885-894) Several cDNA isoforms of a closely related human chemokine. Act-2. were later described (Miller, M D and Krangel, M S ( 1992) Crtt Rev Immunol 12 1 7-46), and two similar proteins, macrophage inflammatory protein l α
(MlP-lα) and MIP-1 , were purified form the culture medium ot popolvsaccharide (LPS)-stιmulated mouse macrophages (Woipe, S D . Davatehs. G Sherrv, B et ai ( 1988) ./ Exp Med 7(5" 570-581 ) On the basis of more than 70% amino acid identitv . the muπne and human proteins are considered as homologs. and the terms human MlP- l α and MIP- 1 are commonly used instead of LD78 and Act-2 The best characterized CC chemokine is monocyte chemotactic protein 1 (MCP-1 ), which was puπfied and cloned from different sources (Miller. M D and Krangel. M S ( 1992) Crtt Rev Immunol 12 1 7-46 Yoshimure, T Robinson, E A Tanaka. S Appella. E and Leonardo. T J ( 1989) J Immunol 142 1956- 1962. Matsushima. K . Larsen. C G . DuBois. G C and Oppenheim. J J ( 1989) ./ Exp Med 169 1485- 1490) Other CC chemokines. 1-309 (Miller. M D . Hata. S . De Waal
Malafvt. R and Krangel. M S ( 1989) ./ Immunol 143 2907-2916). RAN I ES (Schall. T J
Jongstra, J., Dyer, B. J. et ai ( 1988) J Immunol 141. 101 8- 1025) and HC 14 (Chang, H. C. Hsu. F., Freeman, G. J.. Griffin. J.D. and Reinherz. E. L. ( 1989) Int Immunol 7 388-397). were purified or cloned as products of activated T cells. HC l 4. termed MCP-2. was also isolated from osteosarcoma cell cultures (Van Damme. J. Proost. P . Lenaerts. J-P and 5 Opdenakker, G. ( 1992) J Exp Med / "(5:59-65). along with a novel CC chemokine. MCP-
3, which was subsequently cloned and expressed (Minty. A. Chalon. P Guillemot. J. C. et al ( 1993) Eur Cytoktne Net→w -7:99- 1 10, Opdenakker. G. Froyen. G. Fitcn. P.. Proost, P. and Van Damme, J.( 1993) Btoc em Btophys Re.s Co mun ( 1991 ) 535-542) These CC chemokines share a sequence identify with MCP- 1 of between 29 and 71 % (MCP-2 and l o MCP-3 have 62-71 % identity with CP- 1 ).
MCP- 1 , the prototype of the CC chemokine sub-family, is chemotatic for monocytes but not for neutrophils (Yoshimure. T. Robinson. E. A. Tanaka. S. Appella. E. and Leonardo. E. J. ( 1989) J Immunol 772 1956- 1962. Matsushima. K . Larsen. C. G„ DuBois. G. C. and Oppenheim. J. J. ( 1989) ./ Exp .Med. 169- 1485- 1490) and was initially
15 considered to be a counterpart of IL-8 Indeed, monocytes respond to all CC chemokines. as judged from stimulus-dependent [Ca-+]i changes (Miller. M D. and Krangel. M. S. ( 1992) C Rev Immunol. 72: 17-46: Bioschoff. S.C., Kπeger. M Brunner. T. et al ( 1993) Eur J Immunol 25:761 -767; McColl, S. R.. Hachicha. M., Levasseur. S.. Noete. K. and Schall. T. J. ( 1993) J Immunol 75(9:4550-4560) MCP- 1 . MCP-2 and MCP-3 induce
20 monocyte infiltration on intradermal injection into rats and rabbits ( Van Damme, J. Proost.
P.. Lenaerts. J-P. and Opdenakker. G ( 1992) ./ Exp Med / "(5'59-65. Zacha. C O C. Anderson. A. O., Thompson. H. L. et al ( 1990) .7 Exp Med / "/ .2177-2182). and MCP- 1 also elicits in monocytes a respiratory burst (Miller. M. D and Krangel. M. S. ( 1992) Cm Rev Immunol. 72: 17-46) and the expression of B2 integπns (Jiang. Y.. Beller. D. I., Frendl.
25 G. and Graves, D. T. ( 1992) J Immunol. 77.5:2423-2428).
While the view that CXC chemokines act on neutrophils and CC chemokines act on monocytes apparently remains valid, recent studies have revealed that CC chemokines have a much wider range of biological activities since they can also activate some lymphocytes and, in particular, basophil and eosinophil leukocytes. Thus, there is a continuing need m
30 the art for isolating novel CC chemokines.
SUMMAR Y OF THE INVENTION
The present invention provides isolated nucieic acid molecules comprising a polynucleotide encoding a human Chemokine Beta- 16 (Ckβ- 16) polvpeptide having the amino acid sequence in Figure I [SEQ ID NO 2] or the amino acid sequence encoded bv the cDNA clone deposited as ATCC Deposit Number 97688 on August 22. 1996 The nucleotide sequence determined bv sequencing the deposited Ckβ- 16 cDNA clone, which is shown in Figure 1 [SEQ ID NO 1 ] contains an open reading frame encoding a polvpeptide of 94 amino acid residues including an initiation codon at positions 93-95 a predicted leader sequence of about 16 19, or 23 ammo acid residues and a deduced molecular weight of about 10 kDa The ammo acid sequence of the predicted forms of the mature Ckβ- 16 proteιn(s) are shown in Figure 1 and in SEQ ID NO 2 (from amino acid residues 1 -78. 4-78 or 8-78)
Thus, one aspect of the invention provides an isolated nucleic acid molecuie comprising a polynucleotide having a nucleotide sequence selected from the group consisting of (a) a nucleotide sequence encoding the Ckβ- 16 polvpeptide having the complete am o acid sequence in SEQ ID NO 2, (b) a nucleotide sequence encoding the mature Ckβ- 16 polvpeptide having the ammo acid sequence at positions 1 -94 in SEQ ID NO 2, (c) a nucleotide sequence encoding the Ckβ- 16 polvpeptide having the complete amino acid sequence encoded bv the cDNA clone contained in ATCC Deposit No 97688
(d) a nucleotide sequence encoding the mature Ckβ- 16 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No 97688. and (e) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c) or (d) above Preferably, the nucleic acid molecule will encode the mature polvpeptide in SEQ ID 2 or encoded by the above-described deposited cDNA
Further embodiments of the invention include isolated nucieic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%. 96%. 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b). (c), (d) or (e) above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide having a nucleotide sequence identical to a nucleotide sequence in (a), (b), (c). (d) or (e), above The polynucleotide which hybridizes does not h\ bπdιze under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues An additional nucleic acid embodiment of the invention relates to an isolated nucleic acid molecule comprising a polynucleotide which encodes the ammo acid sequence
of an epitope-beaπng portion of a Ckβ- 16 polypeptide having an amino acid sequence in (a), (b), (c) or (d), above
The present invention also relates to recombinant vectors which include the isolated nucleic acid molecules of the present invention and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of Ckβ- 16 polypeptides or peptides by recombinant techniques
The invention further provides an isolated Ckβ- 1 6 polypeptide having amino acid sequence selected from the group consisting of (a) the amino acid sequence of he Ckβ- 16 polypeptide having the complete 94 amino acid sequence including the leader sequence shown in Figure 1 [SEQ ID NO.2], (b) the amino acid sequence ot the mature Ckβ- 16 polypeptide (without the leaders) having the amino acid sequence at positions 1 -78. 4-78 or 8-78 in SEQ ID NO 2, (c) the amino acid sequence of the Ckβ- 16 polypeptide having the complete amino acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No 97688, and (d) the amino acid sequence of the mature Ckβ- 16 polypeptide having the amino acid sequence encoded by the cDNA clone contained in
ATCC Deposit No 97688 The polypeptides of the present invention also include polypeptides having an ammo acid sequence with at least 90% similarity, more preferably at least 95% similarity to those described in (a), (b), (c) or (d) above, as well as polypeptides having an amino acid sequence at least 80% identical, more preferably at least 90% identical, and still more preferably 95%, 96%. 97%. 98% or 99% identical to those above
An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which has the am o acid sequence of an epitope-beaπng portion of a Ckβ- 16 polypeptide having an am o acid sequence described in (a), (b), (c) or (d), above Peptides or polypeptides having the amino acid sequence of an epitope-beaπng portion of a Ckβ- 16 polypeptide of the invention include portions of such polypeptides with at least six or seven, preferably at least nine, and more preferably at least about 30 ammo acids to about 50 ammo acids, although epitope-beaπng polypeptides of any length up to and including the entire amino acid sequence of a polypeptide of the invention described above also arc included in the invention In another embodiment the invention provides an isolated antibody that binds specifically to a Ckβ- 16 polypeptide having an amino acid sequence described in (a), (b), (c) or (d) above
The present inventors have discovered that Ckβ- 16 is expressed in dendretic cells of the lmune system. For a number of immune system disorders, significantly higher or lower levels of Ckβ- 16 gene expression can be detected in immune system tissue or bodily fluids (e.g , serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard Ckβ- 16" gene expression level, l e . the Ckβ- 16
expression level in immune system tissue or bodily fluids from an individual not having the immune system disorder. Immune system tissues refer to. but are not limited to, blood, spleen, thymus, lymph node, liver, lung, skin and any other tissue through which immune cells normally traffic. Thus, the invention provides a diagnostic method useful duπng diagnosis of an immune system disorder, which involves (a) assaying Ckβ- 16 gene expression level in cells or body fluid of that individual; (b) comparing that Ckβ- 16 gene expression level with a standard Ckβ- 16 gene expression level, whereby an increase or decrease in the assayed Ckβ- 16 gene expression level compared to the standard expression level is indicative of an immune system disorder An additional aspect of the invention is related to a method for treatment of an individual tn need of an increased level of Ckβ- 16 activity in the body comprising administering to such an individual a composition comprising an isolated Ckβ- 16 polypeptide of the invention
BRIEF DESCRIPTION OF THE DRA WINGS
Figure 1 shows the nucleotide [SEQ ID NO- 1 ] and deduced amino acid [SEQ ID NO:2] sequences o the complete Ckβ- 16 protein determined by sequencing of the DNA clone contained in ATCC Deposit No. 97688. The protein has a predicted leader sequence of about 16. 19 or 23 amino acid residues (underlined and indicated with arrows) and a deduced molecular weight of about 10 kDa. The amino acid sequence(s) o the predicted mature Ckβ- 16 protein are shown in Figure 1 and in SEQ ID NO:2 (as ammo acid residues 1 , 4 or 8 to residue 78).
Figure 2 shows the regions of similarity between the amino acid sequences of the Ckβ- 16 protein and human chemokine HCC- 1 [SEQ ID NO:3j.
Figure 3 shows an analysis of the Ckβ- 16 protein sequence Alpha regions. Beta regions, turn regions, coil regions, hydrophilicity. hydrophobicity, alpha and beta amphipathic regions, flexible regions, antigenic regions and surface probability
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding the Ckβ- 16 protein having the amino acid sequence shown in Figure 1 [SEQ ID NO:2J which was determined by sequencing a cloned cDNA. Ckβ- 16 is a novel member of the Beta-chemokine subfamily (CC) whose genes are on human chromosome 17 and on mouse chromosome 1 1 (Wilson. S.D . et al . J Exp Med 171 1301 ( 1990) and Modi. W S.. et al . Hum Genet 84 1 85 ( 1990)) The Ckβ- 16 protein of the present invention shares sequence homology with the human chemokine HCC- 1 (Figure 2) [SEQ ID NO:6 ] The nucleotide sequence shown in Figure 1 [SEQ ID NO: l ] was obtained by sequencing the HDQAC81 cDNA clone encoding a Ckβ- 16 polypeptide. which was deposited on August 22. 1996 at the American fype Culture Collection. 12301 Park Lawn Drive. Rockville. Maryland 20852. and given accession number 97688. The deposited clone is contained in the pBluescπpt SK(-) plasmid (Stratagenc. LaJolla. CA)
Nucleic Acid Molecules
Unless otherwise indicated, all nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer ( such as the
Model 373 from Applied Biosystems. Inc.). and ali amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above Therefore, as is known in the an for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99 9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art. As is also known in the art. a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion Unless otherwise indicated, each nucleotide sequence set forth herein is presented as a sequence of deoxyπbonucleotides (abbreviated A. ϋ . C and 1 ). However, by
nucleotide sequence of a nucleic acid molecule or polynucleotide is intended, for a DNA molecule or polynucleotide. a sequence of deoxyπbonucleotides, and for an RNA molecule or polynucleotide, the corresponding sequence of ribonucleotides (A. G, C and U) where each thymidine deoxynucleotide (T) in the specified deoxynucleotide sequence is replaced by the πbonucleotide undine (U) For instance, reference to an RNA molecule having the sequence of SEQ ID NO l set forth using deoxyπbonucleotide abbreviations is intended to indicate an RNA molecule having a sequence in which each deoxynucleotide A. G or C of SEQ ID NO: l has been replaced by the corresponding πbonucleotidc A. G oi C. and each deoxynucleotide T has been replaced by a πbonucleotide U Using the information provided herein, such as the nucleotide sequence in
Figure 1 , a nucleic acid molecule of the present invention encoding a Ckβ- 16 polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material. Illustrative of the invention, the nucleic acid molecule described in Figure 1 [SEQ ID NO l j was discovered in a cDNA library derived from human immune system tissue The determined nucleotide sequence of the Ckβ- 16 cDNA of Figure 1 contains an open reading frame encoding a protein of 94 ammo acid residues with an initiation codon at positions 1 -3 of the nucleotide sequence shown in Figure 1 [SEQ ID NO 1 ]. and a predicted leader sequence of about 16. 19 or 23 amino acid residues, and a deduced molecular weight of about 10 kDa The amino acid sequence of the predicted mature Ckβ- 16 proteins are shown in [SEQ ID NO 2) as 1 -78, 4-78. or 7-78. respectively The Ckβ- 16 protein shown in Figure 1 [SEQ ID NO'2] is about 31 % identical and about 59% similar to HCC- 1 (Figure 2). As one of ordinary skill would appreciate, due to the possibilities ot sequencing errors discussed above, as well as the variability of cleavage sites for leaders in different known proteins, the actual Ckβ- 16 polypeptide encoded by the deposited cDNA comprises about 94 amino acids, but may be anywhere in the range of 89-99 amino acids: and the actual leader sequence of this protein is about 16-23 amino acids, but may be anywhere in the range of about 10 to about 30 amino acids
As indicated, nucleic acid molecules o the present invention may be in the form of RNA, such as mRNA. or in the form of DNA. including, for instance. cDNA and genomic DNA obtained by cloning or produced synthetically The DNA may be double-stranded or single-stranded. Single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand
By "isolated" nucleic acid molecule(s) is intended a nucleic acid molecule. DNA or RNA, which has been removed from its native environment For example, recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention Further examples of isolated DNA molecules include recombinant DNA
molecules maintained in heterologous host ceils or puπfied (partially or substantially) DNA molecules in solution Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention Isolated Nucleic acid molecules according to the present invention further include such molecules produced synthetically Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) with an initiation codon at positions 93-95 of the nucleotide sequence shown in Figure 1 [SEQ ID NO 1 ], DNA molecules comprising the coding sequence for the mature Ckβ- 16 protein shown in Figure 1 (last 71. 75 or 78 amino acids) and SEQ ID NO 2 (residues 1 -78. 4-78. or 7-78). and DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the Ckβ- 16 protein Of course, the genetic code is well known in the art Thus, it would be routine for one skilled in the art to generate the degenerate variants described above
In another aspect, the invention provides isolated nucleic acid molecules encoding the Ckβ- 16 polypeptide having an amino acid sequence encoded bv the cDNA clone contained in the plasmid deposited as ATCC Deposit No 97688 on August 22, 1996. Preferably, this nucleic acid molecule will encode the mature polypeptide encoded by the above-described deposited cDNA clone The invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in Figure I [SEQ ID NO 1 ] or the nucleotide sequence of the Ckβ-16 cDNA contained in the above-described deposited clone, or nucleic acid molecule having a sequence complementary to one ot the above sequences Such isolated molecules, particularly DNA molecules, are useful as probes for gene mapping by in situ hybridization with chromosomes and for detecting expression of the Ckβ-16 gene in human tissue, for instance, by Northern blot analysis As described in detail below, detecting altered Ckβ- 16 gene expression in certain tissues or bodily fluids is indicative of immune system disorders
In addition, the invention provides nucleic acid molecules having nucleotide sequences related to a portion of SEQ ID NO 1 as follow HDPMV37R (SEQ ID NO. 10)
In another aspect, the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clone contained in ATCC Deposit 97688 By "stringent hybridization conditions" is intended overnight incubation at 42°C in a solution comprising 50% formamide, 5\ SSC ( 150 M NaCl. 15mM tπsodium citrate), 50 mM sodium phosphate (pH7 6). 5\ Denhardt's solution. 10% dextran sulfate. and 20 μg/mi denatured, sheared salmon sperm DNA. followed by washing the filters in 0.1 x SSC at about 65°C By
a polynucleotide which hybridizes to a "portion" ot a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt. still more preferably at least about 30 nt. and even more preferably about 30-70 nt of the reference polynucleotide These are useful as diagnostic probes and pπmers as discussed above and in more detail below
Of course, polynucleotides hybridizing to a larger portion of the reference polynucleotide (e.g , the deposited cDNA clone), for instance, a portion 50-750 nt in length, or even to the entire length o the reference polvnucleotide, also useful as probes according to the present invention, as are polynucleotides corresponding to most, if not all. of the nucleotide sequence o the deposited cDNA or the nucleotide sequence as shown in Figure 1
[SEQ ID NO 1 ] By a portion of a polynucleotide ot at least 20 nt in length, for example, is intended 20 or more contiguous nucieotides from the nucleotide sequence of the reference polynucleotide, (e g , the deposited cDNA or the nucleotide sequence as shown in Figure 1 [SEQ ID NO. 1 ]) As indicated, such portions are useful diagnosticaliy either as a probe according to conventional DNA hybridization techniques or as pπmers for amplification of a target sequence by the polymerase chain reaction (PCR), as described, for instance, in Molecular Cloning, A Laboratory Manual. 2nd edition, edited by Sambrook, J . Fπtsch, E F and Maniatis, T . ( 1989), Cold Spring Harbor Laboratory Press, the entire disclosure of which is hereby incoφorated herein by reference Since a Ckβ- 16 cDNA clone has been deposited and its determined nucieotide sequence is provided in Figure 1 [SEQ ID NO 1 ], generating polynucleotides which hybridize to a portion of the Ckβ- 16 cDNA moiecule would be routine to the skilled artisan For example, restriction endonuclease cleavage or shearing by sonication of the Ckβ- 16 cDNA clone could easily be used to generate DNA portions ot various sizes which are polynucleotides that hybridize to a portion of the Ckβ- 16 cDNA moiecule Alternatively, the hybridizing polynucleotides of the present invention could be generated syntheticailv according to known techniques Of course, a polynucleotide which hybridizes only to a poly A sequence (such as the 3 terminal poly(A) tract of the Ckβ- 16 cDNA shown in Figure 1 [SEQ ID NO. l ]), or to a complementary stretch of T (or U) resides, wouid not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule contain a poly (A) stretch or the complement thereof (e.g.. practically any double-stranded cDNA clone)
As indicated, nucieic acid molecules of the present invention which encode the Ckβ- 16 protein polypeptide may include, but are not limited to those encoding the amino acid sequence of the mature polypeptide, by itself; the coding sequence for the mature
poiypeptide and additional sequences such as those encoding the amino acid leader or secretory sequence, such as a pre- or pro- or prepro- protein sequence the coding sequence of the mature polypeptide. with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example but not limited to introns and non-coding 5 and 3 sequences, such as the transcribed non-translated sequences that play a role in transcription. mRNA processing - including splicing and polyadenvlation signals, for example - πbosome binding and stabi tv of mRNA an additional coding sequence which codes tor additional amino acids such as those which provide additional functionalities Thus, the sequence encoding the polv peptide mav be fused to a marker sequence such as a sequence encoding a peptide which facilitates purification ot the fused polypeptide In certain preferred embodiments of this aspect of the invention, the marker ammo acid sequence is a hexa-histidine peptide such as the tag provided in a pQE vector (Qiagen. Inc ). among others, manv of which are commercially available As described in Gent7 et al ( 1989) Proc Nail had Sci LSA 86 821 -824. for instance, hexa-histidine provides for convenient purification of the fusion protein The I IA tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein, which has been described bv Wilson et al , Cell 3" 767 (1984)
The present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs or derivatives ot the Ckβ- 16 protein
Variants may occur naturallv such as a natural alle c v ariant Bv an allelic variant is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism Genes II Lewin. ed Non-naturallv occurring variants mav be produced using art-known mutagenesis techniques Such variants include those produced bv nucleotide substitutions, deletions or additions The substitutions, deletions or additions mav involve one or more nucleotides The variants may be altered in coding or non-coding regions or both Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the Ckβ- 16 protein or portions thereof Also especially preferred in this regard are conservative substitutions Most highly preferred are nucleic acid molecules encoding the mature Ckβ- 16 protein having the amino acid sequence shown in Hgure 1 [SEQ ID NO 2] or the mature Ckβ- 16 amino acid sequence encoded bv the deposited cDNA clone Further embodiments of the invention include isolated nucleic acid molecules compπsing a polvnucleotide having a nucleotide sequence at least 90% identical, and more
preferably at least 95%. 96%, 97%. 98% or 99% identical to (a) a nucleotide sequence encoding the full-length Ckβ- 16 polypeptide having the complete amino acid sequence in SEQ ID N0.2 including the predicted leader sequence, (b) a nucleotide sequence encoding the mature Ckβ-16 polypeptide (full-length polypeptide with the leader removed) having the am o acid sequence shown as 1 -78. 4-78. or 7-78 in SEQ ID NO 2. (c) a nucleotide sequence encoding the full-length Ckβ- 16 polypeptide having the complete ammo acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No 97688. (d) a nucleotide sequence encoding the mature Ckβ- 16 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No 97688. or (e) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c ) or (d)
By "a polynucleotide having a nucleotide sequence at least, for example, 95% identical" to a reference nucleotide sequence encoding a Ckβ- 16 polypeptide is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the Ckβ- 1 polypeptide In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence These mutations of the reference sequence may occur at the 5' or 3 terminal positions ot the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence
As a practical matter, whether any particular nucleic acid moiecule is at least 90%. 95%, 96%, 97%, 98% or 99% identical to. for instance, the nucleotide sequence shown in
Figure 1 or to the nucleotides sequence of the deposited cDNA clone can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group. University Research Park. 575 Science Drive, Madison. WI 5371 1 ) Bestfit uses the local homology algorithm of Smith and Waterman (Advances in Applied Mathematics 2 482-489. 1981 ) to find the best segment of homology between two sequences When using Bestfit or any other sequence alignment program to determine whether a particular sequence is. for instance, 95% identical to a reference sequence according to the present invention, the parameters are set. of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology ot up to 5% of the total number of nucleotides in the reference sequence are allowed
The present application is directed to nucleic acid molecules at least 90%. 95%. 96%. 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1 [SEQ ID NO- 1 ] or to the nucleic acid sequence of the deposited cDNA, irrespective of whether they encode a polypeptide having Ckβ-16 activity This is because, even where a particular nucleic acid molecule does not encode a polypeptide having Ckβ-16 activity, one of skill in the art would still know how to use the nucleic acid moiecule. for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer Uses of the nucleic acid molecules of the present invention that do not encode a polypeptide having Ckβ- 16 activity include, inter alia ( 1 ) isolating the Ckβ- 16 gene or allelic variants thereof in a cDNA library, (2) in situ hybridization (e.g , FISH ) to metaphase chromosomal spreads to provide precise chromosomal location ot the Ckβ- 16 gene as described in Verma et al Human Chromosomes a Manual of Basic Techniques. Pergamon Press, New York ( 1988), and Northern Blot analysis for detecting Ckβ- 16 mRNA expression in specific tissues (e . immune system tissue) Preferred, however, are nucleic acid molecules having sequences at least 90%.
95%o, 96%. 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1 [SEQ ID NO 1 ] or to the nucleic acid sequence of the deposited cDNA which do. in fact, encode a polypeptide having Ckβ-16 protein activity By "a polypeptide having Ckβ- 16 activity" is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the Ckβ- 16 protein of the invention (either the full-length protein or preferably, the mature protein) as measured in a particular biological assay
Like other CC chemokines. Ckβ- 16 exhibits activity on leukocytes including for example monocytes, lymphocytes and neutrophils For this reason Ckβ- 16 is active in directing the proliferation, differentiation and migration of these cell types Such activity is useful for immune enhancement or suppression, myeloprotection, stem cell mobilization, acute and chronic inflammatory control and treatment of leukemia However, unlike other known CC chemokines Ckβ-16 has been shown to be expressed only in a dendritic cell cDNA library and not other cDNA libraries. Therefore, Ckβ-16 is active in modulating the activities of both dendritic cells and the ceils with which dendritic cells interact In addition, Ckβ-16 has effects on the local resident cells in which dendritic cells normally reside such as the skin, thymus. spleen, and lymph node Dendritic cells (DCs) are professional antigen presenting cells which are critical for the proper response of the host and are responsible for primary antigen-specific immune reactions. DCs play a crucial role in the presentation of antigens to both T-lymphocytes and B-lymphocytes to initiate the immune response, including for example, antigen trapping and processing, viral trapping, filtering and processing DCs are normally found in the lvmph node, spleen, thvmu and
skin When found in the skin, DCs are referred to as Langerhans cells Fol cular dendritic cells reside in the germinal centers of the lymph node
Ckβ- 16 regulates the proliferation and maturation of DCs and is monitored in a proliferation/differentiation assay such as those reviewed by Peters et al ( 1996) Immun Today 17 273 and described by Young et al ( 1995) J Exp. Med 182 1 1 1 1 , Caux et al
( 1992) Nature 360 258. Santigo-Schwarz et al ( 1995) Adv Exp Med Biol 378 7 Representative ceil lines could also be employed in such assays Ckβ- 16 also influences the effector function of DCs That is. Ckβ- 16 enhances the capacity of DCs to take up virus, bacteria or other foreign substances, process them and present them to the Ivmphocytes responsible for immune responses Ckβ- 16 also modulates the interaction of DCs with
T-lymphocytes and B-lymphocytes For instance Ckβ- 16 provides a costimulation signal during antigen presentation which directs the responding cell to survive, proliferate, differentiate, secrete additional cvtokines or soluble mediators, or selectively removes the responding cell by inducing apoptosis or other mechanisms ot ceil death Since DCs have been shown to facilitate the transfer of HIV to CD4+ T-lv mphocvtes Ckβ- 16 also influences this ability and prevents infection of lymphocytes by HIV or other viruses mediated through DCs This is also true tor the initial infection of DCs by such viruses
The Ckβ- 16 protein of the present invention also modulates colony formation of bone marrow progenitor cells, as does Human Chemokine HCC- 1 An in vitro colony forming assay for measuring the extent of inhibition of mvcioid progenitor cells is descnbed in Youn et al The Journal of Immunology 1 55 2661 -2667 ( 1995) Bneflv. the assay involves collecting human or mouse bone marrow cells and plating the same on agar. adding one or more growth factors and either ( 1 ) transfected host cell-supernatant containing Ckβ- 16 protein (or a candidate polypeptide) or (2) nontranstected host cell- supernatant control, and measuring the effect on colonv formation by uπne and human
CFU-granulocyte-macrophages (CFU-GM). by human burst-forming unit-erythroid (BFU- E), or by human CFU granulocyte-erythroid-rnacrophage-rnegakaryocyte (CFU-GEMM)
Ckβ- 16 protein modulates immune system cell proliferation and differentiation in a dose-dependent manner in the above-described assays Thus, a polypeptide having Ckβ- 16 protein activity includes polypeptides that also exhibit any of the sameimmune system cell modulating activities in the above-described assays in a dose-dependent manner Although the degree of dose- dependent activity need not be identical to that of the Ckβ- 16 protein, preferably, a polypeptide having Ckβ-16 protein activit will exhibit substantially similar dose-dependence in a given activitv as compared to the Ckβ-16 protein ( i e . the candidate polypeptide will exhibit greater activity or not more than about tenfold less and. preferably , not more than about twofold less activity relative to the reference Ckβ- 16 protein)
Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will immediately recognize that a large number of the nucleic acid molecules having a sequence at least 90%. 95%. 96%. 97%. 98%. or 99% identical to the nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown in Figure 1 [SEQ ID NO 1 j will encode a polypeptide having Ckβ- 16 protein activity In fact, since degenerate variants of these nucleotide sequences all encode the same polvpeptide. this will be clear to the skilled artisan even without performing the above described comparison assay It will be further recognized in the art that, for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having Ckβ- 16 protein activitv This is because the skilled artisan is fully aware of amino acid substitutions that arc either less likely or not likely to significantly effect protein function (e.g , replacing one aliphatic amino acid with a second aliphatic amino acid)
For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie. J U . e t al Deciphering the Message in Protein Sequences Tolerance to Amino Acid Substitutions. .Science 247 1306- 1 10 ( 1990). wherein the authors indicate that there are two main approaches for studying the tolerance of an amino acid sequence to change The first method relies on the process of evolution, in which mutations are either accepted or rejected by natural selection The second approach uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene and selections or screens to identify sequences that maintain functionality As the authors state, these studies have reveaied that proteins are surprisingly tolerant of amino acid substitutions The authors further indicate which ammo acid changes are likely to be permissive at a certain position of the protein. F or example, most buried amino acid residues require nonpolar side chains, whereas few features of surface side chains arc generally conserved Other such phenotypically silent substitutions are described in Bowie.
J.U.. et al supra, and the references cited therein
Vectors and Host Cells
The present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, and the production of Ckβ- 16 polypeptides or portions thereof bv recombinant techniques
Recombinant constructs may be introduced into host cells using well known techniques such as infection, transduction. transfection. transvection. electroporation and transformation. The vector may be. for example, a phage. plasmid. viral or retroviral vector
i".
Retroviral vectors may be replication competent or replication defective In the latter case, viral propagation generally will occur only in complementing host cells
T he polynucleotides may be joined to a vector containing a selectable marker for propagation in a host Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged iipid If the vector is a virus. it may be packaged m vitro using an appropriate packaging cell line and then transduced into host cells
Preferred are vectors comprising cis-acting control regions to the polvnucleotide of interest Appropriate trans-acting factors mav be supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host
In certain preferred embodiments in this regard, the vectors provide for specific expression, which may be inducible and/or cell type-specific Particularly preferred among such vectors are those inducible by environmental factors that are easy to manipulate, such as temperature and nutrient additives Expression vectors useful in the present invention include chromosomal-, episomal- and virus-derived vectors, e g , vectors derived from bacterial plasmids. bacteπophage. yeast episomes. yeast chromosomal elements, viruses such as baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as cosmids and phagemids The DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E colt lac. irp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs. to name a few Other suitable promoters will be known to the skilled artisan The expression constructs will further contain sites for transcription initiation, termination and. in the transcribed region, a πbosome binding site for translation The coding portion of the mature transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately positioned at the end of the poiypeptide to be translated
As indicated, the expression vectors will preferably include at least one selectable marker Such markers include dihydrofolate reductase or neomycin resistance for eukaryotic ceil culture and tetracycline or ampicillm resistance genes for cultuπng in E colt and other bacteria Representative examples of appropriate hosts include bacterial cells, such as E coll. Streptomyces and Salmonella typhtmurium cells, fungal cells, such as yeast cells, insect cells such as Drosophila S2 and Spodoptera Sf9 cells, animal cells such as CHO, COS and Bowes melanoma cells: and plant cells Appropriate culture media and conditions for the above-described host cells are known in the art
Among vectors preferred for use in bacteria include pA2, pQE70. pQE60 and pQE- 9. available from Qiagen. pBS vectors. Phagescπpt vectors. Bluescπpt vectors, pNH8A, pNH l όa, pNH 18A, pNH46A, available from Stratagene. and ptrc99a. p K223-3, pKK233- 3, pDR540, pRJT5 available from Pharmacia Among preferred eukaryotic vectors are pWLNEO, pSV2CA1 , pOG44. pXTl and pSG available from Stratagene, and pSVK3, pBPV, pMSG and pSVL available from Pharmacia Other suitable vectors will be readily apparent to the skilled artisan
Among known bacterial promoters suitable for use in the present invention include the E colt lacl and lac7 promoters, the T3 and T7 promoters, the gpt promoter, the lambda PR and PL promo'ers and the trp promoter Suitable eukaryotic promoters include the
CMV immediate -.arly promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs. such as those of the Rous sarcoma virus (RSV), and metallothionein promoters, such as the mouse metallothιoneιn-I promoter
Introduction of the construct into the host cell can be effected by calcium phosphate transfection. DEAE-dextran mediated transfection. cationic lipid-mediated transfection. electroporation, transduction, infection or other methods Such methods are described in many standard laboratory manuals, such as Davis et al , Basic Methods In Molecular Biology. ( 1986)
Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes may be increased by inserting an enhancer sequence into the vector
Enhancers are cis-acting elements of DNA. usually about from 10 to 300 bp that act to increase transcπptional activity of a promoter in a given host cell-type Examples of enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus eariy promoter enhancer, the polyoma enhancer on the late side ot the replication origin, and adenovirus enhancers
For secretion of the translated protein into the lumen of the endoplasmic reticulum. into the peπplasmic space or into the extracellular environment, appropriate secretion signals may be incoφorated into the expressed polypeptide The signals may be endogenous to the polypeptide or they may be heterologous signals The polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals, but also additional heterologous functional regions Thus, for instance, a region of additional am o acids, particularly charged amino acids, may be added to the N-terminus ot the polypeptide to improve stability and persistence in the host cell, during purification, or during subsequent handling and storage Also, peptide moieties may be added to the polypeptide to facilitate purification
The Ckβ-16 protein can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography. hydrophobic interaction chromatography , affinity chromatograph} , hydroxylapatite chromatography and lectin chromatography Most preferably, high performance liquid chromatography ("HPLC") is employed for purification Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a proka otic or cukarvotic host, including, for example, bacterial, yeast, higher plant insect and mammalian cells Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated In addition, polypeptides of the invention may also include an initial modified mcthionine residue, in some cases as a result of host-mediated processes
Ckβ-16 Polypeptides and Peptides
The invention further provides an isolated Ckβ- 1 6 polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence in Figure 1 [SEQ ID NO 2], or a peptide or polypeptide comprising a portion ot the above polypeptides The terms "peptide" and "ohgopeptide" arc considered synonymous (as is commoniv recognized) and each term can be used interchangeably as the context requires to indicate a chain of at least two amino acids coupled by peptidyl linkages The word polypeptide is used herein for chains containing more than ten amino acid residues All ohgopeptide and polypeptide formulas or sequences herein are written from left to right and in the direction from amino terminus to carboxy terminus
The invention further provides an isolated Ckβ- 16 polypeptide having the amino acid sequence encoded by the deposited cDNA. or the amino acid sequence in SEQ ID NO 2. or a peptide or polypeptide compπsing a portion of the above polypeptides
Variant and Mutant Polypeptides
To improve or alter the characteristics of Ckβ- 16 polypeptides. protein engineering mav be employed Recombinant DNA technology known to those skilled in the art can be used to create novel mutant proteins or muteins including single or
multiple amino acid substitutions, deletions, additions or fusion proteins Such modified polypeptides can show, e g , enhanced activity or increased stability In addition, they may be purified in higher vields and show better solubility than the corresponding natural polypeptide. at least under certain purification and storage conditions
N-Terminal and C-Terminal Deletion Mutants
For instance, tor many proteins, including the extracellular domain of a membrane associated protein or the mature torm(s) of a secreted protein, it is known in the art that one or more amino acids may be deleted from the N-terminus or C-terminus without substantial loss ot biological function I or instance. Ron and colleagues (J Biol Chem 268:2984-2988 ( 1993)) reported modified GF proteins that had heparin binding activity even if 3 8. or 27 N-terminal amino acid residues were missing In the present case, since the protein ot the invention is a member of the chemokine polypeptide family deletions of N-terminal am o acids up to the cysteine at position 17 of SEQ ID NO 2 may retain some biological activity such as receptor binding or modulation ot target cell activities Polypeptides having further N-terminal deletions including the cvsteιne-17 residue in SEQ ID NO 2 would not be expected to retain such biological activities because it is known that this residue in a chemokine-related pol\ peptide is required for forming a disulfide bridge to provide structural stability which is needed for receptor binding and signal transduction
However, even if deletion of one or more amino acids from the N-terminus ol a protein results in modification of loss ot one or more biological functions ot the protein. other biological activities may still be retained Thus, the ability of the shortened protein to induce and/or bind to antibodies which recognize the complete or mature form of the protein generally will be retained when less than the majority of the residues of the complete or mature form ot the protein are removed from the N-terminus Whether a particular polypeptide lacking N-terminal residues of a complete protein retains such immunologic activities can readily be determined b\ routine methods described herein and otherwise known in the art
10
Accordingly, the present invention further provides polypeptides having one or more residues deleted from the amino terminus ot the amino acid sequence of the Ckβ- 16 shown m SEQ ID NO 2. up to the cysteine residue at position number 1 7. and polynucleotides encoding such polypeptides In particular, the present invention provides polypeptides comprising the amino acid sequence of residues n-78 of SEQ
ID NO 2, where n is an integer in the range of - 16 to + 1 7, and 17 is the position of the first residue from the N-termmus of the complete Ckβ-16 polypeptide (shown SEQ ID NO 2) believed to be required for receptor binding activitv of the Ckβ- 16 protein
More particular, the invention provides polynucleotides encoding polypeptides having the amino acid sequence of residues of 16-78. - 15-78. - 14-78.
- 13-78. - 12-78. - 1 1 -78, -10-78. -9-78. -8-78. -7-78. -6-78. -5-78 -4-78. -3-78, -2-78, -1 -78, 1 -78. 2-78. 3-78. 4-78. 5-78. 6-78. 7-78. 8-78, 9-78. 10-78 1 1 -78. 12-78. 13-78. 14-78. 15-78. 16-78. and 17-78 of SEQ ID NO 2 Polynucleotides encoding these polypeptides also are provided Similarly, many examples of biologically functional ('-terminal deletion muteins are known For instance. Interferon gamma shows up to ten times higher activities by deleting 8-10 amino acid residues from the carboxv terminus of the protein (Dobe . et al J Biotechnology 7: 1 9- 16 ( 1988)) In the present case, since the protein of the invention is a member of the chemokine polypeptide family. deletions of C-terminal amino acids up to the cysteine at position 57 of SEQ ID NO 2 may retain some biological activity such as receptor binding or modulation of target cell activities. Polypeptides having further C-terminal deletions including the cysteine residue at position 57 of SEQ ID NO 2 would not be expected to retain such biological activities because it is known that this residue in a chemokine-related polypeptide is required for forming a disulfide bridge to provide structural stability which is needed for receptor binding and signal transduction
However, even if deletion of one or more amino acids from the C-terminus ot a protein results in modification of loss of one or more biological functions of the protein, other biological activities may still be retained Thus, the ability of the shortened protein to induce and/or bind to antibodies which recognize the complete or
mature form of the protein generally will be retained when less than the majority of the residues of the complete or mature form of the protein are removed from the C-terminus Whether a particular polypeptide lacking C-terminal residues of a complete protein retains such lmmunologic activities can readily be determined by routine methods described herein and otherwise known in the art
Accordingly, the present invention further provides polypeptides having one or more residues from the carboxy terminus of the am o acid sequence of the Ckβ- 16 shown in SEQ ID NO 2. up to the cysteine residue at position 57 of SEQ ID NO 2. and polynucleotides encoding such polypeptides In particular, the present invention provides polypeptides having the ammo acid sequence of residues - 16-m o the amino acid sequence in SEQ ID NO 2. where m is any integer in the range of 57 to 78, and residue 57 is the position of the first residue from the C- terminus of the complete Ckβ- 16 polypeptide (shown in SEQ ID NO 2) believed to be required for receptor binding and the initiation of signal transduction of the Ckβ- 16 protein More in particular, the invention provides polynucleotides encoding polypeptides having the amino acid sequence of residues - 16-57, - 16-58. - 16-59, -16-60. - 16-61 , - 16-62, - 16-63. - 16-64. - 16-65. - 16-66. - 16-67. - 16-68. - 16-69, - 16-70. -16-71. - 16-72, -16-73. -16-74. - 16-75. - 16-76. - 16-77. and - 16-78 ot SEQ ID NO 2 Polynucleotides encoding these polypeptides also are provided The invention also provides polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini, which may be described generally as having residues n-m of SEQ ID NO 2, where n and m are integers as described above
Also included are a nucleotide sequence encoding a polypeptide consisting of a portion o the complete Ckβ- 16 amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No 97688, where this portion excludes from 1 to about 32 amino acids from the am o terminus of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No 97688. or from 1 to about 21 amino acids from the carboxy terminus, or any combination of the above amino terminal and carboxy terminal deletions, of the complete amino acid sequence
encoded by the cDNA clone contained in ATCC Deposit No 97688 Polynucleotides encoding ail of the above deletion mutant polypeptide forms also are provided
Other Mutants
In addition to terminal deletion forms of the protein discussed above, it also will be recognized by one of ordinary skill in the art that some amino acid sequences ot the Ckβ- 16 polypeptide can be varied without significant effect of the structure or function of the protein If such differences in sequence are contemplated, it should be remembered that there will be critical areas on the protein which determine activity In general it is possible to replace residues which form the tertiary structure, provided that residues performing a similar function are used In other instances, the type of residue may be completely unimportant if the alteration occurs at a non-critical region of the protein
Thus, the invention further includes variations of the Ckβ- 16 polypeptide which show substantial Ckβ- 16 polypeptide activity or which include regions of Ckβ- 16 protein such as the protein portions discussed below Such mutants include deletions, insertions. inversions, repeats, and type substitutions ( for example, substituting one hvdrophi c residue for another, but not strongly hydrophilic for strongly hydrophobic as a rule) Small changes or such neutral ammo acid substitutions will generally have little effect on activin
1 ypically seen as conservative substitutions are the replacements, one for another. among the aliphatic amino acids Ala. Val. Leu and He. interchange of the hvdroxvi residues Ser and Thr. exchange ol the acidic residues Asp and Glu. substitution between the amide residues Asn and Gin. exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe. 7 yr
As indicated in detail above, further guidance concerning which amino acid changes are likely to be phenotypically silent (i c . are not likelv to have a significant deleterious effect on a function) can be found in Bowie. J U , et al Deciphering the
Message in Protein Sequences Tolerance to Amino Acid Substitutions. Science 24^ 1306-
1310 (1990)
The polypeptides of the present invention are preferably provided in an isolated form, and preferably are substantially puπfied A recombinantiy produced version of the Ckβ- 16 polypeptide can be substantially purified by the one-step method described in Smith and Johnson. Gene 67 31 -40 ( 1988)
The polypeptides of the present invention include the polypeptide encoded by the deposited cDNA including the leader, the mature polypeptide encoded bv the deposited the cDNA minus the leader d e . the mature protein), the polypeptide of SEQ ID NO 2 including the leader, the polypeptide of SEQ ID NO 2 minus the leader, as well as
polypeptides which have at least 90% similarity , more preferably at least 95% similarity, and still more preterably at least 97%. 98% or 99% similarity to those described above Further polypeptides of the present invention include polypeptides at least 80% identical, more preferably at least 90% or 95% identical, still more preferably at least 96%, 97%, 98% or 99%> identical to the polypeptide encoded by the deposited cDNΛ, to the polypeptide of
SEQ ID NO 2. and also include portions ot such polypeptides with at least 30 amino acids and more preferably at least 50 amino acids
By "% similarity" for two polypeptides is intended a similarity score produced bv comparing the amino acid sequences ot the two polypeptides using the Bestfit program (Wisconsin Sequence Analvsis Package, Version 8 for Unix. Genetics Computer Group,
University Research Park 575 Science Drive. Madison. Wl 5371 1 ) and the default settings for determining similarity Bestfit uses the local homology algorithm ol Smith and Waterman (Advances in Applied Mathematics 2 482-489. 1981 ) to find the best segment of similarity between two sequences Bv "a polypeptide having an amino acid sequence at least for example. 95% identical" to a reference amino acid sequence of a Ckβ- 16 polypeptide is intended that the amino acid sequence ot the polypeptide is identical to the reference sequence except that the polypeptide sequence mav include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the Ckβ- 16 polypeptide In other words, to obtain a polypeptide having an ammo acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the ammo acid residues in the reference sequence ma\ be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence These alterations of the reference sequence mav occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions interspersed either individually among residues in the relerence sequence or in one or more contiguous groups within the reference sequence
As a practical matter, whether any particular polypeptide is at least 90%. 95%. 96%. 97%. 98% or 99% identical to. for instance, the amino acid sequence shown in Figure 1 [SEQ ID NO 2] or to the amino acid sequence encoded by deposited cDNA clone can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analvsis Package, Version 8 for Unix, Genetics Computer Group. University Research Park, 575 Science Drive. Madison, Wl 5371 1 ) When using Bestfit or any other sequence alignment program to determine whether a particular sequence is. for instance. 95% identical to a reference sequence according to the present invention, the parameters are set ot course, such that the percentage ot identitv is calculated over the full
length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
As described in detail below, the polypeptides of the present invention can be used to raise polyclonal and monoclonal antibodies, which are useful in diagnostic assays for detecting Ckβ- 16 protein expression as described below or as agonists and antagonists capable of enhancing or inhibiting Ckβ- 16 protein function Further, such polypeptides can be used in the yeast two-hybrid system to capture Ckβ- 16 protein binding proteins which are also candidate agonist and antagonist according to the present invention The veast two hybrid system is described in Fields and Song. Nature 340 245-246 ( 1989) In another aspect, the invention provides a peptide or polypeptide comprising an epitope-beaπng portion of a polypeptide of the invention The epitope of this polypeptide portion is an immunogenic or antigenic epitope ot a polypeptide of the invention An immunogenic epitope is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen These immunogenic epitopes are believed to be confined to a tew loci on the molecule On the other hand, a region of a protein molecule to which an antibody can bind is defined as an antigenic epitope The number of immunogenic epitopes of a protein generally is less than the number ot antigenic epitopes See, for instance, Geysen. H. M , Meloen. R. H. and Barteling, S J ( 1 984) Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid Proc Natl Acad Sci USA 8 1 3998-4002
As to the selection ot peptides or polypeptides bearing an antigenic epitope (l e . that contain a region ot a protein moiecule to which an antibody can bind), it is well known in that art that relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein See, for instance, Sutcliffe, J G., Shinnick. T M . Green. N and Learner, R A ( 1983)
Antibodies that react with predetermined sites on proteins Science 219 660-666 Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e . immunogenic epitopes) nor to the amino or carboxyl terminals Peptides that are extremely hydrophobic and those of six or fewer residues generally are ineffective at inducing antibodies that bind to the mimicked protein, longer, soluble peptides. especially those containing proline residues, usually are effective Sutcliffe et al., supra, at 661 For instance. 18 of 20 peptides designed according to these guidelines, containing 8-39 residues covering 75% of the sequence ot the influenza virus hemagglutinin HA 1 polypeptide chain, induced antibodies that reacted with the HA 1 protein
or intact virus: and 12/12 peptides from the uLV polymerase and 18/18 from the rabies glycoprotein induced antibodies that precipitated the respective proteins
Antigenic epitope-beanng peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention Thus, a high proportion of hybπdomas obtained by fusion of spleen cells from donors immunized with an antigen epitope-beanng peptide generally secrete antibody reactive with the native protein Sutcliffe et al . supra, at 663 I he antibodies raised by antigenic epitope-beanng peptides or polypeptides arc useful to detect the mimicked protein, and antibodies to different peptides may be used for tracking the late of various regions of a protein precursor which undergoes posttranslation processing The peptides and anti-peptide antibodies may be used in a variety of qualitative or quantitative assays for the mimicked protein, for instance in competition assays since it has been shown that even short peptides (e . about 9 ammo acids) can bind and displace the larger peptides in immunoprecipitation assays See, for instance. Wilson. I A . Niman. I I L . Houghten. R A., Cherenson. A. R , Connolly, M L and Lemer, R A ( 1984) T he structure of an antigenic determinant in a protein. Cell 37 767-778 at 777 The anti-peptide antibodies of the invention also are useful for purification of the mimicked protein, for instance, by adsorption chromatography using methods well known in the art
Antigenic epitope-beanng peptides and polypeptides of the invention designed according to the above guidelines preferably contain a sequence of at least seven, more preferably at least nine and most preferably between about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention However, peptides or polypeptides comprising a larger portion of an amino acid sequence of a polypeptide of the invention, containing about 30 to about 50 amino acids, or any length up to and including the entire amino acid sequence of a polypeptide of the invention, also are considered epitope-beaπng peptides or polypeptides of the invention and also are useful for inducing antibodies that react with the mimicked protein Preferably, the amino acid sequence of the epitope-beaπng peptide is selected to provide substantial solubility in aqueous solvents (i.e., the sequence includes relatively hydrophilic residues and highly hydrophobic sequences are preferably avoided), and sequences containing proline residues are particularly preferred.
The epitope-beanng peptides and polypeptides of the invention may be produced by any conventional means for making peptides or polypeptides including recombinant means using nucleic acid molecules of the invention For instance, a short epitope-beanng amino acid sequence may be fused to a larger polypeptide which acts as a carrier duπng recombinant production and purification, as well as during immunization to produce anti-
peptide antibodies Epitope-beanng peptides also mav be synthesized using known methods of chemical synthesis For instance. Houghten has described a simple method for svnthesis of large numbers of peptides. such as 10-20 mg of 248 different 13 residue peptides representing single amino acid variants of a segment of the HA 1 polypeptide which were prepared and characterized (by ELISA-type binding studies) in less than four weeks
Houghten. R A ( 1985) General method tor the rapid solid-phase svnthesis of large numbers of peptides specificity of antigen-antibody interaction at the level of individual amino acids Proc Natl Acad Sci USA 82 513 1 -5 134. This Simultaneous Multiple Peptide Synthesis (SMPS) process is further described in U S Patent No 4 631 21 1 to Houghten et al ( 1986) In this procedure the individual resins for the solid-phase svnthesis of various peptides are contained in separate solvent-permeable packets, enabling the optimal use of the many identical repetitive steps involved in solid-phase methods A completelv manual procedure allows 500- 1000 or more syntheses to be conducted simultaneously 1 loughten et al . supra, at 5134 The major predicted antigenic peptide regions are defined bv Tigure 2
[SEQ ID NO 2] as follows
Amino Acids Antigenicitv
24-34 Stronger
42-49 Weaker
53-61 Stronger
Amino Acids Antigenicitv
71 -85 Stronger
89-94 Weaker
Epitope-beanng peptides and polypeptides of the invention are used to induce antibodies according to methods well known in the art See. for instance Sutcliffe et al , supra, Wilson et al , supra. Chow, M , Yabrov, R . Bittle. J . Hogel. J and Baltimore. D , Proc Natl Acad Sci USA 82 910-914, and Bittle. F J . Fry, C M Rowlands. D J , Brown. F . Bittle. J L . Houghten. R A and Lerner, R A ( 1985) J Gen Virol 66 2347-
2354 Generally, animals may be immunized with free peptide however, anti-peptide antibody titer may be boosted by coupling of the peptide to a macromolecular carrier, such as keyhole limpet hemacyamn (KLH) or tetanus toxoid For instance, peptides containing cysteine may be coupled to carrier using a linker such as m-maleimidobenzoyl-N- hydroxysuccinimide ester (MBS), while other peptides mav be coupled to carrier using a more general linking agent such as glutaraldehvde Animals such as rabbits, rats and mice
are immunized with either free or carrier-coupled peptides. for instance, by intrapeπtoneal and/or lntradermal injection ot emulsions containing about 100 μg peptide or earner protein and Freund s adjuvant Several booster injections may be needed, for instance, at intervals of about two weeks, to provide a useful titer ot anti-peptide antibody which can be detected. for example, by ELISA assay using free peptide adsorbed to a solid surface The titer ot anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art
Immunogenic epitope-beaπng peptides of the invention, i e those parts ot a protein that elicit an antibodv response when the whole protein is the immunogen. are identified according to methods known in the art For instance, Geysen et al . 1984, supra. discloses a procedure for rapid concurrent synthesis on solid supports ot hundreds of peptides of sufficient purity to react in an enzyme-linked immunosorbent assay Interaction of synthesized peptides with antibodies is then easily detected without removing them from the support In this manner a peptide bearing an immunogenic epitope of a desired protein may be identified routinely by one ot ordinary skill in the art For instance, the immunologically important epitope in the coat protein ot foot-and-mouth disease virus was located by Geysen et al with a resolution of seven amino acids by synthesis of an overlapping set of all 208 possible hexapeptides covering the entire 213 amino acid sequence of the protein I hen. a complete replacement set ot peptides in which all 20 amino acids were substituted in turn at every position within the epitope were synthesized, and the particular amino acids conferring specificity for the reaction with antibody were determined T hus, peptide analogs of the epitope-beaπng peptides of the invention can be made routinely by this method U Patent No 4.708.781 to Geysen ( 1987) further describes this method of identifying a peptide bearing an immunogenic epitope of a desired protein
Further still. U S Patent No 5, 194.392 to Geysen ( 1 990) describes a general method of detecting or determining the sequence of monomers (am o acids or other compounds) which is a topological equivalent of the epitope (I e.. a mimotope ) which is complementary to a particular paratope (antigen binding site) of an antibody of interest
More generally, U.S Patent No 4.433.092 to Geysen ( 1989) describes a method of detecting or determining a sequence of monomers which is a topographical equivalent ot a ligand which is complementary to the hgand binding site of a particular receptor of interest Similarly, U S Patent No 5.480.971 to Houghten. R A et al ( 1996) on Peralkylated Ohgopeptide Mixtures discloses linear C -C -alkyl peralkylated oligopeptides and sets and libraries of such peptides. as well as methods for using such ohgopeptide sets and libraries
for determining the sequence of a peralkylated ohgopeptide that preferentially binds to an acceptor molecule of interest Thus, non-peptide analogs of the epitope-beanng peptides of the invention also can be made routinely by these methods
The entire disclosure of each document cited in this section on Polypeptides and Peptides is hereby incoφorated herein by reference
Immune System-Related Disorder Diagnosis
The present inventors have discovered that Ckβ- 16 is expressed in dendritic cells For a number of immune system-related disorders, substantially altered (increased or decreased) levels of Ckβ-16 gene expression can be detected in immune system tissue or other cells or bodilv fluids (e g , sera, plasma, urine, svnovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a standard Ckβ- 16 gene expression level, that is. the Ckβ- 16 expression level in immune system tissues or bodily fluids from an individual not having the immune system disorder Thus, the invention provides a diagnostic method useful during diagnosis of an immune system disorder, which involves measuring the expression level of the gene encoding the Ckβ- 16 protein in immune system tissue or other cells or body fluid from an individual and comparing the measured gene expression level with a standard Ckβ- 16 gene expression level, whereby an increase or decrease in the gene expression level compared to the standard is indicative of an immune system disorder
By individual is intended mammalian individuals, preferably humans Bv measuring the expression level of the gene encoding the Ckβ-16 protein is intended qualitatively or quantitatively measuring or estimating the level of the Ckβ-16 protein or the level of the mRNA encoding the Ckβ- 16 protein in a first biological sample either directly
(e.g., by determining or estimating absolute protein level or mRNA level ) or relatively (e g . by comparing to the Ckβ- 16 protein level or mRNA level in a second biological sample) Preferably, the Ckβ- 16 protein level or mRNA level in the first biological sample is measured or estimated and compared to a standard Ckβ- 16 protein level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the disorder or being determined by averaging levels from a population ot individuals not having a disorder o the immune system As will be appreciated in the art. once a standard Ckβ- 16 protein level or mRNA level is known, it can be used repeatedly as a standard for comparison By "biological sample" is intended any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source which contains Ckβ-16
2S
protein or mRNA As indicated biological samples include bodv fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which contain secreted mature Ckβ- 16 protein, immune system tissue, and other tissue sources found to express Ckβ- 16 or a Ckβ-16 receptor Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art Where the biological sample is to include mRNA a tissue biopsv is the preferred source
Total cellular RNA can be isolated from a biological sample using anv suitable technique such as the single-step guanidinium-thiocvanate-phenol-chloroform method described in Chomczvnski and Sacchi. Anal Biochem 162 156- 1 ^9 ( 1987 ) l evels ot mRNA encoding the Ckβ- 16 protein are then assaved using any appropriate method These include Northern blot analysis S I nuclease mapping the polymerase chain reaction (PCR), reverse transcription in combination with the polymerase chain reaction (RT-PCR) and reverse transcription in combination with the gase chain reaction (RT-LCR)
Northern blot analvsis can be performed as described in Harada et al Cell 63 303-3 12 ( 1990) Briefly total RNA is prepared from a biological sample as described above For the Northern blot the RNA is denatured in an appropriate buffer (such as glyoxal/dimethyl sulfoxide/sodium phosphate buffer), subjected to agarose gel electrophoresis, and transferred onto a nitrocellulose filter After the RNAs have been linked to the filter by a UV linker the filter is prehvbπdized in a solution containing formamide, SSC, Denhardt s solution denatured salmon sperm SDS and sodium phosphate buffer Ckβ- 16 protein cDNA labeled according to anv appropriate method (such as the -'-P-multipπmed DNA labeling svstem (Amersham)) is used as probe After hybridization overnight, the filter is washed and exposed to x-rav film cDNA for use as probe according to the present invention is described in the sections above and will preferably at least 15 bp in length
S I mapping can be performed as described in Fujita et al Cell 49 357-367 ( 1987) To prepare probe DNA for use in S I mapping the sense strand of above-described cDNA is used as a template to synthesize labeled antisense DNA The antisense DNA can then be digested using an appropriate restriction endonucleasc to generate further DNA probes of a desired length Such antisense probes are useful for visualizing protected bands corresponding to the target mRNA (i e . mRNA encoding the Ckβ- 16 protein) Northern blot analysis can be performed as described above
Preferably, levels of mRNA encoding the Ckβ- 16 protein are assayed using the RT-PCR method described in Makino et al Technique 2 295-301 ( 1990) Bv this method the radioactivities of the amp cons in the polvacrvlamide gel bands are nearlv related to the initial concentration of the tareet mRNA Bneflv this method involves addin total
RNA isolated from a biological sample in a reaction mixture containing a RT primer and appropriate buffer After incubating for primer annealing, the mixture can be supplemented with a RT buffer, dNTPs, DTT, RNasc inhibitor and reverse transcπptase After incubation to achieve reverse transcription of the RNA. the RT products are then subject to PCR using labeled pπmers Alternatively, rather than labeling the primers, a labeled dNTP can be included in the PCR reaction mixture PCR amplification can be performed in a DNA thermal cycler according to conventional techniques After a suitable number of rounds to achieve amplification, the PCR reaction mixture is electrophoresed on a polyacrylamide gel After drying the gel. the radioactivity of the appropriate bands (corresponding to the mRNA encoding the Ckβ- 16 protein) is quantified using an imaging analyzer RT and PCR reaction ingredients and conditions, reagent and gel concentrations, and labeling methods are well known in the art Variations on the RT-PCR method will be apparent to the skilled artisan
Any set of oligonucleotide pπmers which will amplify reverse transcribed target mRNA can be used and can be designed as described in the sections above
Assaying Ckβ- 16 protein levels in a biological sample can occur using any art-known method Preferred for assaying Ckβ- 16 protein levels in a biological sample are antibody-based techniques For example, Ckβ-16 protein expression in tissues can be studied with classical immunohistological methods In these, the specific recognition is provided by the primary antibody (polyclonal or monoclonal) but the secondary detection system can utilize fluorescent, enzyme, or other conjugated secondary antibodies As a result, an immunohistological staining of tissue section for pathological examination is obtained Tissues can also be extracted, e.g., with urea and neutral detergent, for the liberation of Ckβ- 16 protein for Western-blot or dot slot assay (Jaikanen. M . et al , ./ Cell Biol 101 976-985 ( 1985)). Jaikanen. U.. et al . J Cell Biol 105 3087-3096 ( 1987)) In this technique, which is based on the use of cationic solid phases, quantitation of Ckβ-16 protein can be accomplished using isolated Ckβ- 16 protein as a standard This technique can also be applied to body fluids. With these samples, a molar concentration of Ckβ- 16 protein will aid to set standard values of Ckβ-16 protein content for different body fluids. like serum, plasma, urine, synovial fluid, spinal fluid, etc The normal appearance of
Ckβ- 16 protein amounts can then be set using values from healthy individuals, which can be compared to those obtained from a test subject.
Other antibody-based methods useful for detecting Ckβ- 16 protein levels include immunoassays. such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA) f or example. Ckβ- 16 protein-specific monoclonal antibodies can be used both as an immunoadsorbent and as an enzyme-labeled probe to detect and quantifv
the Ckβ- 16 protein The amount of Ckβ- 16 protein present in the sample can be calculated by reference to the amount present in a standard preparation using a linear regression computer algorithm. Such an ELISA for detecting a tumor antigen is described in Iacobelh et al Breast Cancer Research and Treatment 11 19-30 ( 1988) In another ELISA assay two distinct specific monoclonal antibodies can be used to detect Ckβ- 16 protein in a body fluid. In this assay, one of the antibodies is used as the immunoadsorbent and the other as the enzyme-labeled probe
The above techniques may be conducted essentially as a "one-step" or "two-step" assay The "one-step" assay involves contacting Ckβ- 16 protein with immobilized antibody and, without washing, contacting the mixture with the labeled antibody The "two-step" assay involves washing before contacting the mixture with the labeled antibody Other conventional methods may also be employed as suitable It is usually desirable to immobilize one component of the assay system on a support, thereby allowing other components of the system to be brought into contact with the component and readily removed from the sample
Suitable enzyme labels include, for example, those from the oxidase group, which catalyze the production of hydrogen peroxide by reacting with substrate Glucose oxidase is particularly preferred as it has good stability and its substrate (glucose) is readily available Activity of an oxidase label may be assayed by measuring the concentration ot hydrogen peroxide formed by the enzvme-labeled antibody/substrate reaction Besides enzymes, other suitable labels include radioisotopes. such as iodine ( ' --'I. - - - I), carbon ( *^C). sulfur (-^S), tritium (-Η). indium ( ■ - -In), and technetium (^mTc), and fluorescent labels, such as fluorescein and rhodamine. and biotin
In addition to assaying Ckβ- 16 protein levels in a biological sample obtained from an individual, Ckβ- 16 protein can also be detected in vivo by imaging Antibody labels or markers for in vivo imaging of Ckβ- 16 protein include those detectable by X-radiography. NMR or ESR. for X-radiography. suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtiy harmful to the subject Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be incoφorated into the antibody by labeling of nutrients tor the relevant hybπdoma
A Ckβ- 16 protein-specific antibody or antibody portion which has been labeled with an appropriate detectable imaging moiety, such as a radioisotope (for example. - ' l. • •---In, 99m c s_ a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenteraily. subcutaneously or lntrapeπtoneall ) into the mammal to be examined for an immune system disorder It will be understood in
the art that the size of the subject and the imaging system used will determine the quantity of imaging moieties needed to produce diagnostic images In the case of a radioisotope moiety, for a human subject, the quantity of radioactivitv injected will normally range from about 5 to 20 miilicuπes of 99mjc p^g ]abeled antibody or antibody portion will then preferentially accumulate at the location of cells which contain Ckβ- 16 protein In vivo tumor imaging is described in S W Burchiel et al . "Immunopharmacokinetics of Radiolabeied Antibodies and Their Portions" (Chapter 13 in Tumor Imaging The Radiochemical Detection of Cancer eds . S W Burchiel and B A RJiodcs Masson Publishing Inc (1982)) Ckβ- 16-proteιn specific antibodies tor use in the present invention can be raised against the intact Ckβ- 16 protein or an antigenic polypeptide portion thereof which may presented together with a carrier protein, such as an albumin, to an animal sy stem (such as rabbit or mouse) or. if it is long enough (at least about 25 amino acids), without a carrier
As used herein, the term "antibody" (Ab) or 'monoclonal antibody" (Vlab) is meant to include intact molecules as well as antibody portions (such as. for example. Fab and
F(ab') portions) which are capable of specifically binding to Ckβ- 16 protein Fab and F(ab') portions lack the Fc portion of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibodv (Wahl el al J Nucl Med 24 3 16-325 ( 1983)) Thus, these portions are preferred I he antibodies of the present invention mav be prepared bv any ot a variety ol methods Tor example, cells expressing the Ckβ- 16 protein or an antigenic portion thereof can be administered to an animal in order to induce the production ot sera containing polyclonal antibodies In a preferred method, a preparation of Ckβ- 16 protein is prepared and purified as described above to render it substantial! v free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera ol greater specific activity
In the most preferred method, the antibodies of the present invention are monoclonal antibodies (or Ckβ- 16 protein binding portions thereof) Such monoclonal antibodies can be prepared using hybπdoma technology (Kohler et al nature 256 495 ( 1975), Kohler et al , Eur J Immunol 6 51 1 ( 1976), Kohler et al Eur J Immunol 6 292
( 1976), Hammerling et al . In Monoclonal Antibodies and T-Cell Hvbndoma . Elsevier. N Y , pp 563-681 ( 1981 )) In general, such procedures involve immunizing an animal (preferably a mouse) with a Ckβ- 16 protein antigen or. more preferably, with a Ckβ-16 protein-expressing cell Suitable cells can be recognized by their capacity to bind antι-Ckβ- 16 protein antibody Such cells may be cultured in any suitable tissue culture medium, however, it is preferable to culture cells in harle's modified Eagle's medium
supplemented with 10% fetal bovine serum (inactivated at about 56_C). and supplemented with about 10 μg/1 of nonessential amino acids, about 1.000 U/ml of penicillin, and about 100 μg/ml of streptomycin The splenocytes ol such mice are extracted and fused with a suitable myeloma cell line Anv suitable myeloma cell line may be employed in accordance 5 with the present invention, however, it is preferable to employ the parent myeloma cell line
(SP O), available from the American Type Culture Collection. Rockville. Maryland After fusion, the resulting hybπdoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al (Gastroenterology 80 225-232 ( 1981 )) The hybπdoma cells obtained through such a selection are then assavcd to identifv l o clones which secrete antibodies capable of binding the Ckβ- 16 antigen
Alternatively, additional antibodies capable of binding to the Ckβ- 16 protein antigen may be produced in a two-step procedure through the use of anti-idiotypic antibodies Such a method makes use of the fact that antibodies arc themselves antigens, and therefore it is possible to obtain an antibody which binds to a second antibody In
15 accordance with this method. Ckβ- 16 protein specific antibodies are used to immunize an animal, preferably a mouse The splenocytes of such an animal are then used to produce hybπdoma cells, and the hybπdoma cells are screened to identify clones which produce an antibody whose ability to bind to the Ckβ- 16 protein-specific antibody can be blocked by the Ckβ- 16 protein antigen Such antibodies comprise anti-idiotypic antibodies to the 0 Ckβ- 16 protein-specific antibody and can be used to immuni/e an animal to induce formation of further Ckβ- 16 protein-specific antibodies
It will be appreciated that Fab and F(ab') and other portions of the antibodies of the present invention may be used according to the methods disclosed herein Such portions are typically produced by proteolytic cleavage, using enzymes such as papain (to produce
25 Fab portions) or pepsin (to produce F(ab') portions) Alternatively, Ckβ- 16 protein-binding portions can be produced through the application of recombinant DNA technology or ι through synthetic chemistry
Where in vivo imaging is used to detect enhanced levels of Ckβ- 16 protein for diagnosis in humans, it may be preferable to use humanized chimeπc monoclonal
30 antibodies Such antibodies can be produced using genetic constructs derived from hybπdoma cells producing the monoclonal antibodies described above Methods for producing chimeπc antibodies are known in the art See. for review Morrison. Science 229 1202 ( 1985), Oi et al BioTechmques 7 214 (1986), Cabilly et al U S Patent No 4,816,567, Taniguchi e. α/ EP 171496, Morrison et al EP 173494. Neuberger el al WO
35 8601533, Robinson et al WO 8702671. Bou anne et al Natwe 312 643 ( 1984)
Neuberger et al Nature 314 268 (1985)
Further suitable labels for the Ckβ- 16 protein-specific antibodies of the present invention arc provided below Examples of suitable enzyme labels include malate dehydrogenase, staphylococcal nuclease. delta-5-steroιd isomera.se. yeast-alcohol dehydrogenase. alpha-glycerol phosphate dehydrogenase. tπose phosphate isomerase, peroxidase. alkaline phosphatase. asparaginase, glucose oxidase beta-galactosidase. πbonuclease. urease. catalase. glucose-6-phosphate dehydrogenase. glucoamvlase. and acetylcho ne esterase
E.xamples of suitable radioisotopic labels include JI I " ' in. ' -^I ' J * I →^-P ^S HC. 5 1 Cr. 5?To -^Co. 59Fe> 75Se. 152P u. 90γ 67Cu 21 7C l 21 1 t. 212Pb. 47Sc - O^Pd. etc " ' in is a preferred isotope where in vivo imaging is used since its avoids the problem ot dehalogenation of the ' -- or * J ' l-labeled monoclonal antibody by the liver In addition, this radionucleotide has a more favorable gamma emission energy for imaging (Perkins et al Eur J Nucl Med 10 296-301 ( 1985), Carasquillo et al J Nucl Med 25 281 -287 ( 1987)) For example, " ' in coupled to monoclonal antibodies with 1 -(P- lsothiocvanatobenzyD-DPT;4. has shown little uptake in non-tumorous tissues, particularly the liver, and therefore enhances specificity ot tumor localization (Esteban et al J Nucl Med 28 861 -870 ( 1987))
Examples of suitable non-radioactive isotopic labels include '
.
52Tr. and
56Fe Examples ot suitable fluorescent labels include an ' -^Eu label, a tluorescein label. an isothiocvanate label, a rhodamine label, a phycoerythπn label, a phveocvanin label, an aliophycocyanin label, an o-phthaldehyde label, and a fluorescamine label
Examples of suitable toxin labels include diphtheria toxin, πcin. and cholera toxin Examples of chemiluminescent labels include a luminai label, an isoluminal label. an aromatic acridinium ester label, an imidazole label, an acridinium salt label, an oxalate ester label, a lucifeπn label, a luciferase label, and an aequoπn label
Examples of nuclear magnetic resonance contrasting agents include heavv metal nuclei such as Gd, Mn. and Fe
Typical techniques for binding the above-described labels to antibodies are provided by Kennedy et al (Clm Chim Ada ~0 1 -31 ( 1976)), and Schurs et al (Clm
Chtm Acla 81 1 -40 ( 1977)) Coupling techniques mentioned in the latter are the glutaraidehyde method, the peπodate method, the dimaleimide method, the m- maieimidobenzyl-N-hydroxy-succinimide ester method, all of which methods are incoφorated by reference herein
Chromosome Assays
The nucleic acid molecules of the present invention are also valuable tor chromosome identification The sequence is specificallv targeted to and can hvbπdize with a particular location on an individual human chromosome Moreover there is a current need for identifying particular sites on the chromosome Few chromosome marking reagents based on actual sequence data (repeat polvmoφhisms) are presentiv available tor marking chromosomal location The mapping ot DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease
In certain preferred embodiments in this regard, the cDNA herein disclosed is used to clone genomic DNA of a Ckβ- 16 protein gene This can be accomplished using a variety of well known techniques and libraries, which generalh are available commercially The genomic DNA then is used for in situ chromosome mapping using well known techniques tor this puφose I ypically in accordance with routine procedures tor chromosome mapping, some tπai and error may be necessarv to identify a genomic probe that gives a good in situ hybridization signal
In some cases, in addition, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNΛ Computer analysis of the 3' untranslated region ot the gene is used to rapidlv select pπmers that do not span more than one exon in the genomic DNA thus complicating the amplification process These primers are then used tor PCR screening of somatic cell hybrids containing individual human chromosomes Only those hvbπds containing the human gene corresponding to the primer will yield an amplified portion PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular
DNA to a particular chromosome Using the present invention with the same oligonucleotide primers, subloca zation can be achieved with panels of portions from specific chromosomes or pools of large genomic clones in an analogous manner Other mapping strategies that can similarlv be used to map to its chromosome include in situ hybridization, prescreenmg with labeled flow-sorted chromosomes and preselection bv hybridization to construct chromosome specific-cDNA libraries
Fluorescence in situ hybridization ( TISFI ) ot a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step This technique can be used with probes from the cDNA as short as 50 or 60 bp For a review of this technique, see Verma et al . Human Chromosomes I Manual Of Basic
Techniques. Pergamon Press. New York ( 1988)
_
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data Such data are found, for example, in V McKusick. Mendelian Inheritance In Man. available online through Johns Hopkins University. Welch Medical Library The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheπtance of physically adjacent genes)
Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals If a mutation is observed in some or all of the affected individuals but not in anv normal individuals, then the mutation is likely to be the causative agent of tϋe disease
With currαit resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes (This assumes 1 megabase mapping resolution and one gene per 20 kb)
Treatment of Immune System-Related Disorders
As noted above, unlike other known CC cvtokines. Ckβ-16 has been found to be expressed in the dendritic cells Therefore. Ckβ- 16 is particularly active in modulating activities such as those described above in relation to the description of a "polypeptide having Ckβ-16 activity" Given the activities modulated by Ckβ-16, it is readily apparent that a substantially altered (increased or decreased) level of expression of Ckβ-16 in an individual compared to the standard or normal level produces pathological conditions such as those described above in relation to diagnosis of immune system-related disorders It will also be appreciated by one of ordinary skill that, since the Ckβ- 16 protein of the invention is translated with a leader peptide suitable for secretion of the mature protein from the cells which express Ckβ- 16, when Ckβ- 16 protein (particularly the mature form) is added from an exogenous source to cells, tissues or the body of an individual, the protein will exert its modulating activities on any of its target cells of that individual Therefore, it will be appreciated that conditions caused by a decrease in the standard or normal level of
"Ckβ- 16 activity" in an individual, particularly disorders of the immune system, can be treated be administration of Ckβ- 16 protein Thus, the invention also provides a method of treatment of an individual in need of an increased level of Ckβ- 16 activitv comprising administering to such an individual a pharmaceutical composition comprising an amount of an isolated Ckβ-16 polypeptide of the invention, particularly a mature form of the Ckβ- 16 protein of the invention, effective to increase the Ckβ- 16 activity level in such an individual
In addition, since the Ckβ-16 protein suppresses myeloid cell growth when administered to an individual, the invention provides methods for suppressing myeloid ceil proliferation in an individual, which involve administering a myelosuppressive amount of Ckβ- 16 either alone or together with one or more chemokines selected from the group consisting of Macrophage Inflammatory Protein- l α (MlP- l α), Macrophage Inflammatory Proteιn-2o (MIP-2α), Platelet Factor 4 (PF4), lnterleukιn-8 (IL-8), Macrophage Chemotactic and Activating Factor (MCAF), and Macrophage Inflammatory Protein- Related Proteιn-2 (MRP-2) The myelosuppressive compositions of the present invention thus provide myeloprotective effects and are useful in conjunction with therapies that have an adverse affect on myeloid cells This is because the myelosuppressive compositions of the present invention place myeloid cells in a slow-cycling state thereby providing protection against cell damage caused by. tor example, radiation therapy or chemotherapy using cell-cycle active drugs, such as cytosine arabinoside and hydroxyurea The myelosuppressive pharmaceutical compositions of the present invention arc also useful in the treatment of leukemia, which causes a hyperproliferative myeloid cell
state Thus, the .mention further provides methods for treating leukemia which involve administering to a leukemia patient a mvelosuppressive amount ot Ckβ- 16 either alone or together with one or more chemokines selected from the group consisting of MlP- l α. MIP-2α. PF4. IL-8. MCAF. and MRP-2 By suppressing myeloid celi proliferation is intended decreasing the cell proliferation of myeloid cells and/or increasing the percentage of mveloid cells in the slow- cycling phase As above, by individual is intended mammalian individuals, preferably humans Preincubation of the myelosuppressive compositions ot the present invention with acetonitπle (ACN) significantly enhances the specific activitv of these chemokines foi suppression of mveloid progenitor cells T hus, preferablv, prior to administration the myelosuppresive compositions of the present invention are pretreated with ACN as described in Broxmeyer H E . et al Ann-Hematol 7/^ 235-46( 1995) and PCT Publication WO 94/13321 , the entire disclosures of which are herebv incoφorated herein by reference The myelosuppressive compositions ot the present invention mav be used in combination with a vaπetv of chemotherapeutic agents including alkvlating agents such as nitrogen mustards, ethvlenimines. methvlmelamtnes. alkv l sulfonates nitrosuoureas. and tnazenes. antimetabolites such as tolic acid analogs, pvπmidine analogs, in particular fluorouracil and cytosine arabinoside. and puπnc analogs, natural products such as vinca alkaloids epipodophv llotoxins. antibiotics, enzvmes and biological response modifiers, and miscellaneous products such as platinum coordination complexes anthracenedione substituted urea such as hydroxvurea. methv! hvdrazine derivatives, and adrenocorticoid suppressant
Chemotherapeutic agents can be administered at known concentrations according to known techniques The myelosuppressive compositions of the present invention can be co- administered with a chemotherapeutic agent, or administered separateK either before or after chemotherapeutic administration
Certain chemokines. such as MIP- 113. MIP-2B and GRO-Alpha. inhibit (at least partially block) the mveloid suppressive affects of the mvelosuppresive compositions of the present invention Thus, in a further embodiment, the invention provides methods for inhibiting mvelosuppression, which involves administering an effective amount of a myelosuppressive inhibitor selected from the group consisting of MIP- I B MIP-2B and GRO-Alpha to a mammal previously exposed to the mvelosuppresive agent Ckβ- 16 either alone or together with one or more ot MIP-1 Alpha. MIP-2 Alpha. PF4 II -8 MCAI and MRP-2
One of ordinary skill will appreciate that effective amounts of the Ckβ- 16 polypeptides for treating an individual in need of an increased level of Ckβ- 16 activity (including amounts of Ckβ- 16 polypeptides effective for myelosuppression with or without myelosuppressive agents or myelosuppressive inhibitors ) can be determined empirically for each condition where administration of Ckβ- 16 is indicated The polvpeptide having
Ckβ- 16 activity my be administered in pharmaceutical compositions in combination with one or more pharmaceutically acceptable excipients It will be understood that, when administered to a human patient, the total daily usage of the pharmaceutical compositions of the present invention will be decided by the attending physician within the scope ot sound medical judgment The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the type and degree of the response to be achieved: the specific composition an other agent, if any. employed: the age, body weight, general health, sex and diet of the patient: the time of administration, route of administration, and rate of excretion of the composition: the duration of the treatment: drugs (such as a chemotherapeutic agent) used in combination or coincidental with the specific composition and like factors well known in the medical arts
For example, satisfactory results arc obtained by oral administration of a polypeptide having Ckβ- 16 activity in dosages on the order of from 0.05 to 10 mg/kg/day. preferably 0 1 to 7 5 mg/kg/day. more preferably 0.1 to 2 mg/kg/day. administered once or. in divided doses. 2 to 4 times per
On administration parenteraily. for example by I v dπp or infusion, dosages on the order of from 0 01 to 5 mg/kg/day. preterablv 0.05 to 1 0 mg/kg/day and more preferably 0.1 to 1.0 mg/kg/day can be used. Suitable daily dosages for patients are thus on the order of from 2.5 to 500 mg p.o., preferably 5 to 250 mg p.o.. more preferably 5 to 100 mg p.o.. or on the order of from 0.5 to 250 mg i.v.. preferably 2.5 to 125 mg i.v. and more preferably 2.5 to 50 mg i.v.
Dosaging may also be arranged in a patient specific manner to provide a predetermined concentration of an Ckβ-16 activity in the blood, as determined by an RIA technique, for instance. Thus patient dosaging may be adjusted to achieve regular on-going trough blood levels, as measured by RIA. on the order of from 50 to 1000 ng/ml. preferably 150 to 500 ng/ml
Pharmaceutical compositions of the invention may be administered orally, rectally. parenteraily. intracistemally. intravaginally. intrapeπtoneally, topically (as by powders, ointments, drops or transdermal patch), bucally. or as an oral or nasal spray By "pharmaceutically acceptable carrier" is meant a non-toxic solid, semisolid or liquid tiller. diluent, encapsulating material or formulation auxiliary of any type The term "parenteral"
as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and lntraarticular injection and infusion
Pharmaceutical compositions of the present invention for parenteral injection can comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions. suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water ethanol. polyols (such as glycerol propylene glycol. polyethvlene glycol. and the like).
lceuulosc and suitable mixtures thereof, vegetable oils (such as olive oil), and iniectable organic esters such as ethyl oleate Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants
The compositions ot the present invention may also contain adjuvants such as preservatives wetting agents emulsifying agents, and dispersing agents Prevention of the action of microorganisms may be ensured by the inclusion ol various antibacterial and antifungal agents, tor example, paraben. chlorobutanol. phenol sorbic acid, and the like It may also be desirable to include isotonic agents such as sugars, sodium chioπde, and the like Prolonged absoφtion of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absoφtion such as aluminum monostearate and gelatin In some cases, in order to prolong the effect of the pharmaceutical composition it is desirable to slow the absoφtion ot the drug from subcutaneous or intramuscular injection This may be accomplished by the use of a liquid suspension of crvstalhne or amoφhous material with poor water solubility The rate of absoφtion of the drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form Alternatively, delayed absoφtion of a parenteraily administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle
Injectable depot forms are made by forming microencapsuled matrices of the drug in biodegradable polymers such as poiylactide-poiyglycoiidc Depending upon the ratio of drug to polymer and the nature of the particular polvmer employed the rate of drug release can be controlled Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydπdes) Depot injectable formulations are also prepared by entrapping the drug in hposomes or rnicroemulsions which are compatible with body tissues
The injectable formulations can be sterilized, for example. b\ filtration through a bacteπal-retaming filter, or by incoφorating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use
Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules In such solid dosage forms, the active compounds are mixed with at least one item pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches. lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as. for example, carboxymethylcerulose. alginates, gelatin, polyvinyipyrro done, sucrose, and acacia, c) humectants such as glycerol. d) disintegrating agents such as agar-agar. calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin. Oabsoφtion accelerators such as quaternary ammonium compounds, g) wetting agents such as. tor example, cetyl alcohol and glycerol monostearate. h)absorbents such as kaolin and bentonite clay, and I) lubricants such as talc, calcium stearate, magnesium stearate. solid polyethylene glycols, sodium lauryl sulfate. and mixtures thereof In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents
Solid compositions ot a similar type may also be employed as fillers in soft and hard filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like
The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art They may optionally contain opacifymg agents and can also be of a composition that they release the active ingredien s) only, or preferentially, in a certain part of the intestinal tract, optionallv in a delayed manner E.xamples ot embedding compositions which can be used include polymeric substances and waxes
The active compounds can also be in micro-encapsulated form, if appropriate with one or more of the above-mentioned excipients Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups and elixirs In addition to the active compounds. the liquid dosage forms may contain inert diluents commonly used in the art such as. for example, water or other solvents, solubihzing agents and emulsifiers such as ethvl alcohol, isoptopyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate. propylene glycol, 1.3-butylene glycol. dimethyl formamide. oils (in particuiar. cottonseed, groundnut. corn, germ, olive, castor, and sesame oils), glycerol. tetrahydrofurturyl alcohol, polyethylene glycols and fatty acid esters of sorbitan. and mixtures thereof
Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents
Suspensions, in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystal ne cellulose, aluminum metahydroxide. bentonitc, agar- agar, and tragacanth. and mixtures thereof The active polypeptide can also be administered in the form ot liposomes As is known in the art. liposomes are generally derived from phosphohpids or other lipid substances Liposomes are formed by mono- or multi-lamellar hydrated liquid crystals that are dispersed in an aqueous medium Anv non-toxic, physiologicallv acceptable and metabohzable lipid capable of forming liposomes can be used The present compositions in hposome form can contain, in addition to the agent or inhibitor, stabilizers, preservatives, excipients, and the like The preferred lipids are the phosphohpids and the phosphatidvl cholates (lecithins), both natural and synthetic Methods to torm liposomes arc known in the art See. for example. Prescott. Ed . Methods in Cell Biology Volume XIV Academic Press. New York. N Y (1 76), p 33 et seq Having generally described the invention, the same will be more readilv understood by reference to the following examples, which are provided by wav ot illustration and are not intended as limiting
EXAMPLES
Example 1: Expression and Purification of Ckβ-16 in E. coli
The DNA sequence encoding the mature Ckβ-16 protein in the deposited cDNA clone was amplified using PCR oligonucleotide primers specific to the amino terminal sequences of the Ckβ-16 protein and to vector sequences 3' to the gene Additional nucleotides containing restriction sites to facilitate cloning were added to the 5' and 3' sequences respectively
T he 5' oligonucleotide primer had the sequence 5' GCGCGCΔCΔI ICTCTGCAGCACATCCACGCAG 3' [SEQ ID NO 4] containing the underlined Aflll restriction site
The 3' primer had the sequence '
GTAGAAGI-1IGAGACAGTCAGGAGTCTGGGGTTTATTAGC 3' [SEQ ID NO 5] containing the underlined Hind III restriction site The restriction sites were convenient to restriction enzyme sites in the bacterial expression vector pDI O (pQE9). which were used for bacterial expression in these
examples. (Qiagen. Inc. 9259 Eton Avenue. Chatsworth. CA. 9131 1 ). fpD 10]pQE9 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a πbosome binding site ("RBS" ). a 6-His tag and restriction enzyme sites. 5 The amplified Ckβ- 16 protein DNA and the vector pQE9 both were digested with
Aflll and Hind III and the digested DNAs were then gated together. Insertion of the Ckβ- 16 protein DNA into the restricted pQE9 vector placed the Ckβ- 16 protein coding region downstream of and operably linked to the vector's IPTG-inducible promoter and ιn- frame with an initiating AUG appropriately positioned for translation of Ckβ- 1 6 protein
10 The ligation mixture was transformed into competent E coli cells using standard procedures. Such procedures are described in Sambrook et al.. MOLECULAR CLONING A LABORA TORY MANUAL. 2nd Ed.; Cold Spring Harbor Laboratory Press. Cold Spring Harbor. N.Y. ( 1989). E. colt strain M 15/rep4. containing multiple copies of the plasmid pREP4, which expresses lac repressor and confers kanamycin resistance ("Kanr"). was used
!5 in carrying out the illustrative example described here This strain, which is only one of many that arc suitable for expressing Ckβ- 16 protein, is available commercially from Qiagen.
Transformants were identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin Plasmid DNA was isolated from resistant colonies and the 0 identity of the cloned DNA was confirmed by restriction analysis
Clones containing the desired constructs were grown overnight ( O/N ) in liquid culture in LB media supplemented with both ampicillin ( 100 μg'irtl ) and kanamycin (25 μg/ml).
The O N culture is used to inoculate a large culture, at a dilution of approximately
25 1 : 100 to 1 :250. The cells are grown to an optical density at 600nm ( "OD600") of between
0.4 and 0.6 Isopropyl-B-D-thiogalactopyranoside ( IPTG ) is then added to a final concentration of 1 mM to induce transcription from lac repressor sensitive promoters, by inactivating the lad repressor. Cells subsequently are incubated further for 3 to 4 hours. Cells then are harvested by centrifugation and disrupted, by standard methods. Inclusion
30 bodies are purified from the disrupted cells using routine collection techniques, and protein is solubilized from the inclusion bodies into 8M urea. The 8M urea solution containing the solubilized protein is passed over a PD- 10 column in 2X phosphate-buffered saline ("PBS"). thereby removing the urea, exchanging the buffer and refolding the protein The protein is purified by a further step of chromatography to remove endotoxm. Then, it is sterile
35 filtered. The sterile filtered protein preparation is stored in 2X PBS at a concentration of 95 μ/ml.
Analysis of the preparation by standard methods of polyacrylamide gel electrophoresis reveals that the preparation contains about 95% monomer Ckβ- 16 protein having the expected molecular weight of approximately 16.7 kDa.
Example 2: Cloning and Expression of Ck$-16 protein in a Baculovirus Expression System
The cDNA sequence encoding the full length Ckβ- 16 protein in the deposited clone is amplified using PCR oligonucleotide pπmers corresponding to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5'
GACCGGATCCGCCATCATGGCCCCACTGAAGATGCTGGCCCTG 3' [SEQ ID NO:6] containing the underlined Bam HI restriction enzyme site. Inserted into an expression vector, as described below, the 5 end of the amplified fragment encoding Ckβ- 16 provides an efficient signal peptide. An efficient signal for initiation of translation in eukaryotic cells, as described by Kozak. M., J Mol. Biol 196: 947-950 ( 1987) is appropriately located in the vector portion of the construct.
The 3' primer has the sequence 5' GTAGGGTACCGAGACAGTCAGGAGTCTGGGGTTAG 3' [SEQ ID NO:7] containing the underlined Asp 718 restriction site.
The amplified fragment is isolated from a 1 % agarose gel using a commercially available kit ("Geneciean." BIO 101 Inc., La Jolla. Ca.). The fragment then is digested with Xbal and again is purified on a 1% agarose gel. This fragment is designated herein F2. The vector pA2-GP is used to express the Ckβ- 16 protein in the baculovirus expression system, using standard methods, as described in Summers et al.. A MANUAL OF METHODS FOR BACULOVIRUS VECTORS AND INSECT CELL CULTURE PROCEDURES. Texas Agricultural Experimental Station Bulletin No. 1555 (1987). This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites. The signal peptide of AcMNPV gp67. including the N-terminal methionine. is located just upstream of a BamHI site. The polvadenvlation site of the simian virus 40 ("SV40") is used for efficient polvadenvlation. For an easy selection of recombinant virus the beta-galactosidase gene from E. coli is inserted in the same orientation as the polyhedrin promoter and is followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked
at both sides by viral sequences for cell-mediated homologous recombination with wild- type viral DNA to generate viable virus that express the cloned polynucleotide
Many other baculovirus vectors could be used in place ot pA2-GP. such as pAc373 pVL941 and pAcIM l provided, as those of skill readily will appreciate that construction provides appropriately located signals for transcription, translation, trafficking and the like, such as an in-frame AUG and a signal peptide, as required Such vectors are described in Luckow et al . Virology 170 31 -39, among others
The plasmid is digested with the restriction enzyme Asp 718 and then is dephosphorylated using calf intestinal phosphatase. using routine procedures known in the art The DNA is then isolated from a 1 % agarose gel using a commercially available kit
("Geneclean" BIO 101 Inc . La Jolla. Ca ) This vector DNA is designated herein V2
Fragment F2 and the dephosphorylated plasmid V2 are gated together with T4 DNA gase. E coli HB 101 cells are transformed with hgation mix and spread on culture plates Bacteria are identified that contain the plasmid with the human Ckβ- 16 gene by digesting DNA from individual colonies using Asp 71 8 and then analyzing the digestion product by gel electrophoresis The sequence of the cioned fragment is confirmed by DNA sequencing This plasmid is designated herein pBacCkβ- 16
5 μg of the plasmid pBacCkβ-16 is co-transfected with 1 0 μg of a commercially available linearized baculovirus DNA ("BaculoGold baculovirus DNA", Pharmingen, San Diego, CA ). using the lipofection method described by Feigner et" al . Proc Natl Acad Sci
USA 84 7413-741 7 ( 1987) l μg ot BaculoGold virus DNA and 5 μg of the plasmid pBacCkβ- 16 are mixed in a sterile well of a microtiter plate containing 50 μl of serum-free Grace's medium (Life Technologies Inc . Gaithersburg, MD) Afterwards 10 μl Lipofectiπ plus 90 μl Grace's medium are added, mixed and incubated for 1 5 minutes at room temperature Then the transfection mixture is added drop-wise to Sf9 insect cells (ATCC
CRL 1 71 1 ) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum The plate is rocked back and forth to mix the newly added solution The plate is then incubated for 5 hours at 27 C After 5 hours the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added The plate is put back into an incubator and cultivation is continued at 27 C for four days
After four days the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, cited above An agarose gel with "Blue Gal" (Life Technologies Inc . Gaithersburg) is used to allow easy identification and isolation of gal- expressing clones, which produce blue-stained plaques (A detailed description of a "plaque
assay" of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc , Gaithersburg, page 9-10)
Four days after serial dilution, the virus is added to the cells After appropriate incubation, blue stained plaques are picked with the tip of an Eppendorf pipette The agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 μl of Grace's medium The agar is removed by a brief centπfugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 ceils seeded in 35 mm dishes. Four days later the supernatants of these culture dishes are harvested and then they are stored at 4 C A clone containing properly inseπed hESSB I. II and III is identified by DNA analysis including restriction mapping and sequencing This is designated herein as V- Ckβ-16
Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS The cells are infected with the recombinant baculovirus V-Ckβ- 16 at a multiplicity of infection ("MOD of about 2 (about 1 to about 3) Six hours later the medium is removed and is replaced with SF900 II medium minus methionme and cysteine (available from Life Technologies Inc., Gaithersburg) 42 hours later. 5 μCi of
and 5 μCi
J^S-cysteιne (available from Amersham) are added The cells are further incubated for 16 hours and then they are harvested by centπfugation. lysed and the labeled proteins are visualized by SDS-PAGE and autoradiography
Example 3: Cloning and Expression in Mammalian Cells
Most of the vectors used for the transient expression of the Ckβ- 16 protein gene sequence in mammalian cells should carry the SV40 origin of replication This allows the replication of the vector to high copy numbers in cells ( e g . COS cells) which express the T antigen required for the initiation of viral DNA synthesis Any other mammalian cell line can also be utilized for this purpose
A typical mammalian expression vector contains the promoter element, which mediates the initiation of transcription ot mRNA. the protein coding sequence, and signals required tor the termination of transcription and polvadenvlation ol the transcript Add;tιonal elements include enhancers. ozak sequences and intervening sequences flank*; ! by donor and acceptor sites for RNA splicing Highly efficient transcription can be achieved with the early and late promoters from SV40. the long terminal repeats (LTRs) from Retroviruses. c g . RSV. HTLVI. HIVI and the early promoter of the cytomegalovirus (CMV) However, cellular signals can also be used (e.g . human actin promoter) Suitable expression vectors for use in practicing the present invention include, for example, \ ectors such as pSV and pMSG (Pharmacia. Uppsala, Sweden), pRSVcat (ATCC 37152). pSV2dhfr (ATCC 37146) and pBC 12MI (ATCC 67109) Mammalian host cells that could be used include, human Hela. 283. H9 and Jurkart cells, mouse NIH3T3 and C 127 cells. Cos 1. Cos 7 and CV 1 . African green monkey cells, quail QO -3 cells, mouse 1 cells and Chinese hamster ovarv cells
Alternatively, the gene can be expressed in stable cell lines that contain the gene integrated into a chromosome The co-transfcction with a selectable marker such as dhfr, gpt, neomycin. hygromycin allows the identification and isolation of the transfected cells
The transfected gene can also be amplified to express large amounts of the encoded protein. The DHFR (dihydrofolate reductase) is a useful marker to develop cell lines that carry several hundred or even several thousand copies of the gene of interest Another useful selection marker is the enzyme glutamine synthase (GS) (Murphy et al . Bioche J 22' 277-279 ( 1991 ), Bebbington el al Bio/Technology 10 169- 175
( 1992)) Using these markers, the mammalian cells are grown in selective medium and the cells with the highest resistance are selected These cell lines contain the amplified gene(s) integrated into a chromosome Chinese hamster ovary (CHO) cells are often used for the production of proteins
The expression vectors pC l and pC4 contain the strong promoter ( LTR) of the Rous Sarcoma Virus (Cullen et al . Molecular and Cellular Biology. 438-447 (March. 1985)) plus a fragment of the CMV-enhancer (Boshart et al Cell 41 521 -530 ( 1985)) Multiple cloning sites, e g , with the restriction enzyme cleavage sites BamHI, Xbal and Asp718. facilitate the cloning of the gene of interest I he vectors contain in addition the 3 intron. the polvadenvlation and termination signal ot the rat preproinsu n gene
Example 3(a): Cloning and Expression in COS Cells The expression plasmid pCkβ- 16HA. is made by cloning a cDNA encoding Ckβ- 16 into the expression vector pcDNAI/Amp (which can be obtained from Invitrogen, Inc )
The expression vector pcDNAI/amp contains ( 1 ) an E coli origin of replication effective for propagation in E colt and other prokaryotic cells. (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells. (3) an SV40 origin ot replication for propagation in eukaryotic cells, (4) a CMV promoter, a polylinker. an SV40 intron. and a polvadenvlation signal arranged so that a cDNA conveniently can be placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polvadenvlation signal by means of restriction sites in the polylinker A DNA fragment encoding the Ckβ-16 protein and an HA tag fused in frame to its
3 end is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al Cell 3~ 767 ( 1984) The fusion of the HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope
The plasmid construction strategy is as follows The Ckβ- 16 cDNA of the deposited clone is amplified using primers that contain convenient restriction sites, much as described above regarding the construction of expression vectors for expression of Ckβ- 16 in E colt. To facilitate detection, purification and characterization of the expressed Ckβ- 16. one of the primers contains a hemagglutinin tag ("HA tag") as described above
Suitable pπmers include the following, which are used in this example The 5 primer, containing the underlined Bam HI restriction site, an AUG start codon and 6 codons of the 5 coding region has the following sequence 5 GACCGGATCCGCCATCATGGCCCCACTGAAGA ΓGΓTGGCCCT 3 (SEQ NO 8)
The 3 primer, containing the underlined Asp 71 8 restriction site, a stop codon. and the hemagglutinin HA tag, has the following sequence
5 GTAGGIiIA££GAGACAGTCAGGAGTCTGGGGTTAG 3' (SEQ ID NC-9)
The PCR amplified DNA fragment and the vector. pcDNAI/Amp, are digested with Hindlll and Xhol and then eated The hgation mixture is transformed into E coli strain SURE (available from Stratagene Cloning Systems. 1 1099 North Torrey Pines Road, La Jolla, CA 92037), and the transformed culture is plated on ampicillin media plates which then are incubated to allow growth ot ampicillin resistant colonies Plasmid DNA is isolated from resistant colonies and examined by restriction analysis and gel sizing for the presence of the Ckβ-16-encodιng fragment
For expression of recombinant Ckβ- 16. COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN. as described, for instance, in Sambrook et al . Molecular Cloning A Laboratory Manual, Cold Spring
Laboratory Press. Cold Spring Harbor. New York ( 1989) Cells arc incubated under conditions for expression of Ckβ- 16 by the vector
Expression of the Ckβ- 16HA fusion protein is detected by radioiabel ng and immunoprecipitation. using methods described in. for example Hariow et al , Antibodies A Laboratory Manual. 2nd Ed . Cold Spring Harbor Laboratory Press. Cold Spring Harbor. New York ( 1988) To this end. two days after transfection. the ceils are labeled by incubation in media containing
for 8 hours The cells and the media are collected, and the cells arc washed and the lysed with detergent-containing R1PA buffer 150 mM NaCl, 1 % NP-40. 0 1 % SDS, 1 % NP-40, 0 5% DOC, 50 mM TRIS. pH 7 5. as described by Wilson et al cited above Proteins are precipitated from the cell lysate and from the culture media using an HA-specific monoclonal antibody The precipitated proteins then arc analyzed by SDS-PAGE gels and autoradiography An expression product ot the expected size is seen in the cell lysate. which is not seen in negative controls
Example 3(b): Cloning and Expression in CHO Cells The vector pC l is used for the expression of Ckβ- 16 protein Plasmid pC l is a derivative of the plasmid pSV2-dhfr [ATCC Accession No 37146] Both plasmids contain the mouse DHFR gene under control of the SV40 early promoter Chinese hamster ovary or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Life Technologies) supplemented with the chemotherapeutic agent methotrexate The amplification of the DHFR genes in cells resistant to methotrexate
(MTX) has been well documented (see. e g . Alt. F W . Kellems. R M . Bertino, J.R , and Schimke. R T . 1978. J Biol Chem 253 1357- 1370. Hamlin. J L and Ma. C
1990, Biochem et Biophvs Ada. 1097 107- 143 Page, M J and Sydenham. M A
1991 , Biotechnology Vol 9 64-68) Cells grown in increasing concentrations of MTX develop resistance to the drug by overproducing the target enzyme. DHFR. as a resuit of amplification of the DHFR gene If a second gene is linked to the DHFR gene it is usually co-amplified and over-expressed It is state of the art to develop cell lines carrying more than 1.000 copies of the genes Subsequently, when the methotrexate is withdrawn, cell lines contain the amplified gene integrated into the chromosome! s) Plasmid pC l contains for the expression of the gene of interest a strong promoter of the long terminal repeat (LTR) of the Rouse Sarcoma Virus (Cullen. et al . Molecular and Cellular Ri-jlogy, March 1985 438-4470) plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al , Cell 41 521 -530. 1985) Downstream of the promoter are the following single restriction enzyme cleavage sites that allow the integration of the genes BamHI,
Pvull, and Nrul Behind these cloning sites the plasmid contains translational stop codons in all three reading frames followed by the 3 intron and the polvadenylation site of the rat preproinsulin gene Other high efficient promoters can also be used for the expression, e.g , the human -actin promoter, the SV40 early or late promoters or the long terminal repeals from other retroviruses, e g . HIV and I ITLVI For the polyadenylation of the mRNA other signals, e g . from the human growth hormone or globin genes can be used as well
Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt. G418 or hygromycin It is advantageous to use more than one selectable marker in the beginning, e g , G41 8 plus methotrexate
T he plasmid pC l is digested with the restriction enzyme BamHI and then dephosphorylated using calf intestinal phosphates by procedures known in the art The vector is then isolated from a 1 % agarose gel The DNA encoding Ckβ- 16. deposited with the ATCC on August 22. 1996. is amplified using PCR oligonucleotide primers corresponding to the 5 and 3 ' sequences of the gene
The 5' primer has the sequence 5'
GACCGGATCCGCCATCATGGCCCCACTGAAGATGCTGGCCCTG 3 " (SEQ ID NO 8) containing the underlined BamH I restriction enzyme site followed by 19 bases of the sequence of Ckβ- 16 of Figure 1 (SEQ ID NO 1 ) Inserted into an expression
vector, as described below, the 5 end of the amplified fragment encoding human Ckβ- 16 provides an efficient signal peptide An efficient signal for initiation ot translation in eukaryotic cells, as described by Kozak. M . J Mol Biol ] 96 947-950 ( 1987) is appropriately located in the vector portion of the construct The 3 primer has the sequence 5
GTAGGGTACCGAGACAGTCAGGAGTCTGGGGTTAG 3 (SEQ ID NO 9) containing the Asp718 restriction followed by nucleotides complementary to the last 16 nucleotides of the Ckβ- 16 coding sequence set out in Figure 1 (SEQ ID NO 1 ). including the stop codon The amplified fragments are isolated from a 1 % agarose gel as described above and then digested with the endonucleases BamHI and Asp71 8 and then puπfied again on a 1 % agarose gel
The isolated fragment and the dephosphorvlated vector arc then gated with 14 DNA ligase E coli HB 101 cells are then transformed and bacteria identified that contained the plasmid pC l inserted in the correct orientation using the restriction enzyme BamHI The sequence of the inserted gene is confirmed by DNA sequencing
Example 4: Gene therapeutic expression of human Chβ-16 protein
Fibroblasts are obtained from a subject bv skin biopsy The resulting tissue is placed in tissue-culture medium and separated into small pieces Small chunks ot the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask The flask is turned upside down, closed tight and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted - the chunks of tissue remain fixed to the bottom of the flask - and fresh media is added (e g . Ham's F 12 media, with 10% TBS, penicillin and streptomycin) The tissue is then incubated at 37°C for approximately one week. At this time, fresh media is added and subsequently changed every several days After an additional two weeks in culture, a monolayer of fibroblasts emerges The monolayer is trypsinized and scaled into larger flasks.
A vector for gene therapy is digested w ith restriction enzymes for cloning a portion to be expressed The digested vector is treated with calf intestinal phosphatase to prevent self-ligation The dephosphorylated. linear vector is fractionated on an agarose gel and purified
s i
Ckβ-16 protein cDNA capable of expressing active Ckβ- 16 protein, is isolated
The ends of the portion are modified, if necessary, for cloning into the vector F or instance, 5 overhanging may be treated with DNA poivmerase to create blunt ends 3 overhanging ends mav be removed using S I nuclease Linkers ma\ be ligated to blunt ends with T4 DNA hgase
Equal quantities of the Molonev muπne leukemia virus linear backbone and the
Ckβ- 16 protein portion are mixed together and joined using T4 DNA hgase The gation mixture is used to transform E call and the bacteria are then plated onto agar-containing kanamycin Kanamycin phenotvpe and restriction analysis confirm that the vector has the properiy inserted gene
Packaging cells are grown in tissue culture to confluent density in Dulbecco's
Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin The vector containing the Ckβ- 16 protein gene is introduced into the packaging cells by standard techniques Infectious viral particles containing the Ckβ-16 protein gene are collected from the packaging cells, which now are called producer cells
Fresh media is added to the producer ceils, and after an appropriate incubation period media is harvested from the plates ot confluent producer cells The media. containing the infectious viral particles, is filtered through a Mil pore filter to remove detached producer cells The filtered media then is used to infect fibroblast cells Media is removed from a sub-confluent plate of fibroblasts and quicklv replaced with the filtered media Polybrene (Aldπch) may be included in the media to facilitate transduction After appropriate incubation, the media is removed and replaced with fresh media If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required If the titer is low. then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his. to select out transduced cells for expansion
Transformed fibroblasts then may be injected into rats, either alone or after having been grown to confluence on microcarner beads, such as cytodex 3 beads 1 he injected fibroblasts produce Ckβ- 16 protein product, and the biological actions of the protein are conveyed to the host
It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and e.xamples
Numerous modifications and variations of the present invention are possible in light of the above teachings and. therefore, are within the scope of the appended claims The disclosures of all patents, patent applications, and publications referred to herein are hereby incoφorated bv reference
SEQUENCE LISTING
(1) GENERAL INFORMATION
(l) APPLICANT EBNER, REINHARD KREIDER, BRENT RUBEN STEVEN M
(ll) TITLE OF INVENTION CHEMOKINE BETA- 16
(ill) NUMBER OF SEQUENCES 10
(IV) CORRESPONDENCE ADDRESS
(A) ADDRESSEE HUMAN GENOME SCIENCES INC
(B) STREET 9410 KEY WEST AVENUE
(C) CITY ROCKVILLE
(D) STATE MD
( E ) COUNTRY USA
(F) ZIP 20850
(v) COMPUTER READABLE FORM
(A) MEDIUM TYPE Floppy disk
(B) COMPUTER IBM PC compatible
(C) OPERATING SYSTEM PC-DOS/MS-DOS
(D) SOFTWARE Patentin Release #1 0 Version #1 30
(vi) CURRENT APPLICATION DATA
(A) APPLICATION NUMBER
(B) FILING DATE August 22, 1997
(C) CLASSIFICATION
(vin) ATTORNEY/AGENT INFORMATION
(A) NAME BENSON, ROBERT H
(B) REGISTRATION NUMBER 30,446
(C) REFERENCE/DOCKET NUMBER PF323PCT
(ix) TELECOMMUNICATION INFORMATION
(A) TELEPHONE 301-309-8504
(B) TELEFAX 301-309-8439
(2) INFORMATION FOR SEQ ID NO 1
(l) SEQUENCE CHARACTERISTICS
(A) LENGTH 463 base pairs
(B) TYPE nucleic acid
(C) STRANDEDNESS single
( D ) TOPOLOGY linear
(n) MOLECULE TYPE DNA (genomic)
(ix) FEATURE
(A) NAME/KEY CDS
(B) LOCATION 93 374
( ix ) FEATURE :
(A) NAME/KEY: sιg_peptιde
(B) LOCATION: 93..159
(ix) FEATURE:
(A) NAME/KEY: mat_peptιde (B) LOCATION: 162..374
(xi ) SEQUENCE DESCRIPTION. SEQ ID NO : 1.
GACGGCTGCG AGAAGACGAC AGAAGGGGAG CAGGGTGTCT CCCTGAGCAG AGGGACTTGC 60
ACACAGAGAC TCCCTCCTGG GCTCCTGGCA CC ATG GCC CCA CTG AAG ATG CTG 113
Met Ala Pro Leu Lys Met Leu -16 -15 -10
GCC CTG GTC ACC CTC CTC CTG GGG GCT TCT CTG CAG CAC ATC CAC GCA 161 Ala Leu Val Thr Leu Leu Leu Gly Ala Ser Leu Gin His He His Ala -5 1 5
GCT CGA GGG ACC AAT GTG GGC CGG GAG TGC TGC CTG GAG TAC TTC AAG 209 Ala Arg Gly Thr Asn Val Gly Arg Glu Cys Cys Leu Glu Tyr Phe Lys 10 15 20
GGA GCC ATT CCC CTT AGA AAG CTG AAG ACG TGG TAC CAG ACA TCT GAG 257 Gly Ala He Pro Leu Arg Lys Leu Lys Thr Trp Tyr Gin Thr Ser Glu 25 30 35
GAC TGC TCC AGG GAT GCC ATC GTT TTT GTA ACT GTG CAG GGC AGG GCC 305 Asp Cys Ser Arg Asp Ala He Val Phe Val Thr Val Gin Gly Arg Ala 40 45 50 55
ATC TGT TCG GAC CCC AAC AAC AAG AGA GTG AAG AAT GCA GTT AAA TAC 353 He Cys Ser Asp Pro Asn Asn Lys Arg Val Lys Asn Ala Val Lys Tyr 60 65 70
CTG CAA AGC CTT GAG AGG TCT TGAAGCCTCC TCACCCCAGA CTCCTGACTG 404
Leu Gin Ser Leu Glu Arg Ser 75
TCTCCCGGGA CTACCTGGGA CCTCCACCGT TGGTGTTAAC GGCCCCAACC TGAGCGCCT 463
(2) INFORMATION FOR SEQ ID NO : :
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 94 amino acids
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(XI ) SEQUENCE DESCRIPTION: SEQ ID NO : 2 ■
Met Ala Pro Leu Lys Met Leu Ala Leu Val Thr Leu Leu Leu Gly Ala -16 -15 -10 -5
Ser Leu Gin His He His Ala Ala Arg Gly Thr Asn Val Gly Arg Glu 1 5 10 15
Cys Cys Leu Glu Tyr Phe Lys Gly Ala He Pro Leu Arg Lys Leu Lys 20 25 30
Thr Trp Tyr Gin Thr Ser Glu Asp Cys Ser Arg Asp Ala He Val Phe 35 40 45
Val Thr Val Gin Gly Arg Ala He Cys Ser Asp Pro A≤n Asn Lys Arg 50 55 60
Val Lys Asn Ala Val Lys Tyr Leu Gin Ser Leu Glu Arg Ser 65 70 75
(2) INFORMATION FOR SEQ ID NO : 3
(l) SEQUENCE CHARACTERISTICS.
(A) LENGTH. 88 amino acids
(C) STRANDEDNESS : single
(D) TOPOLOGY: linear
(n) MOLECULE TYPE: protein
(κi) SEQUENCE DESCRIPTION SEQ ID NO : 3
Val Ala Ala He Pro Phe Phe Leu Leu He Thr He Ala Leu Gly Thr 1 5 10 15
Lys Thr Glu Ser Ser Ser Arg Gly Pro Tyr His Pro Ser Glu Cys Cys 20 25 30
Phe Thr Tyr Thr Thr Tyr Lys He Pro Arg Gin Arg He Met Asp Tyr
35 40 45
Tyr Glu Thr Asn Ser Gin Cys Ser Lys Pro Gly He Val Phe He Thr 50 55 60
Lys Arg Gly His Ser Val Cys Thr Asn Pro Ser Asp Lys Trp Val Gin 65 70 75 80
Asp Tyr He Lys Asp Met Lys Glu 85
(2) INFORMATION FOR SEQ ID NO : 4.
(l) SEQUENCE CHARACTERISTICS. (A) LENGTH: 33 base pairs
(B) TYPE, nucleic acid
(C) STRANDEDNESS single
(D) TOPOLOGY linear
(ul MOLECULE TYPE DNA (genomic)
(XI ) SEQUENCE DESCRIPTION. SEQ ID NO : 4 GCGCGCACAT GTCTCTGCAG CACATCCACG CAG 33
(2) INFORMATION FOR SEQ ID NO : 5
(l) SEQUENCE CHARACTERISTICS.
(A) LENGTH 40 base pairs
(B) TYPE nucleic acid
(C) STRANDEDNESS. single
(D) TOPOLOGY: linear
(u) MOLECULE TYPE: DNA (genomic) (xi ) SEQUENCE DESCRIPTION. SEQ ID NO : 5 GTAGAAGCTT GAGACAGTCA GGAGTCTGGG GTTTATTAGC 40
(2) INFORMATION FOR SEQ ID NO: 6
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH- 43 base pairs
(B) TYPE- nucleic acid
(C) STRANDEDNESS. single
(D) TOPOLOGY: linear
(u) MOLECULE TYPE DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO : 6 GACCGGATCC GCCATCATGG CCCCACTGAA GATGCTGGCC CTG 43
(2) INFORMATION FOR SEQ ID NO : 7 •
(l) SEQUENCE CHARACTERISTICS
(A) LENGTH- 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS. single
(D) TOPOLOGY- linear
(u) MOLECULE TYPE. DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO 7
GTAGGGTACC GAGACAGTCA GGAGTCTGGG GTTAG 35
(2) INFORMATION FOR SEQ ID NO .8 •
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY- linear
(u) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 8 : GACCGGATCC GCCATCATGG CCCCACTGAA GATGCTGGCC CTG 43
(2) INFORMATION FOR SEQ ID NO : 9 ■
(l) SEQUENCE CHARACTERISTICS.
(A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS- single
(D) TOPOLOGY linear
(u) MOLECULE TYPE: DNA (genomic)
( i ) SEQUENCE DESCRIPTION. SEQ ID NO : 9 • GTAGGGTACC GAGACAGTCA GGAGTCTGGG GTTAG 35
(2) INFORMATION FOR SEQ ID NO: 10:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 105 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS. single
(D) TOPOLOGY linear
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:
AGAGGGGACN CTGGCAGCAC CAGAAGAACT CCCTCCTGGG GCTCCTGGCA CCATGGCCCC 60
ACTGAAGATG CTGGCCCTGG NTNACNCTCC TCCTGNGGGC TTCTC 105