RU2139352C1 - Detection of biomolecules - Google Patents

Abstract

FIELD: biochemistry. SUBSTANCE: invention relates to a method of detection of catalytically active ribosime in medium. Detection of catalytically active ribosime can be used as a reporter for the presence of other biomolecules in a sample to be analyzed. Detection can be carried out in the catalytic system where the presence of an active ribosime induces the formation of another an active ribosime by amplifying mechanism by the principle of the positive feedback effect. Invention describes a device used for the realization of methods. Invention ensures to determine the point of treatment directly. EFFECT: simplified reception of the amplification signal. 29 cl, 17 dwg, 3 ex

Description

 The invention relates to a method and kit for detecting the presence of catalytically active ribozymes in a medium. The method and kit of the present invention can be used as part of a method and kit for detecting the presence of specific biomolecules in a test sample.

 Detection of the presence of specific biomolecules, such as DNA or RNA segments, proteins, antigens, antibodies, etc., in a sample is necessary for a variety of experimental, diagnostic and therapeutic purposes. There are a large number of tests to detect protein molecules, such as gel electrophoresis, HPLC, affinity chromatography, and other tests that are performed using an appropriately labeled probe. Although such tests are satisfactory when the detectable protein biomolecule is present in sufficiently large quantities, they are sometimes not sensitive enough to detect small quantities of biomolecules.

 DNA or RNA sequences can be detected using a labeled probe. If the DNA or RNA sequences to be detected are present only in very small quantities, they can be amplified by methods such as LCR (ligase chain reaction), SRP (self-sustaining sequence replication), or PCR (polymerase chain reaction).

 Although amplification methods, such as PCR, had an extremely large impact on basic research, they were slowly transferred to clinical conditions. The primary reason for this is that the need for automation, combined with the clinical conditions for sampling, led to processes that are complex, slow, and expensive. The need to use protein enzymes with their high sensitivity to environmental factors requires strictly controlled conditions in which they must operate. Typically, a clinical sample contains many components that may interfere with the ability of an enzyme to exhibit its catalytic activity. In addition, standard methods used to prepare samples for the isolation of nucleic acids, such as the guanidine thiocyanate method or phenolic extraction, are unsuitable for protein-based enzymatic activity and, therefore, it is necessary to remove the target nucleic acid from the sample preparation.

 Ribozymes are typically RNA molecules having enzyme-like catalytic activities, such as cleavage, splicing, or ligation of nucleic acid sequences. RNA molecules are known substrates for ribozymes, although there are some indications that ribozymes can act on DNA molecules and proteins.

 Natural ribozymes involved in intracellular reactions (cis-acting) catalyze only a single cycle and usually self-modify during the reaction. However, it is possible to construct ribozymes for the trans action in a truly catalytic manner, with a turnover greater than one cycle, and without self-modification. Two different regions can be identified in the ribozyme: the binding region, which gives the ribozyme its specificity due to hybridization with a specific nucleic acid sequence (and, possibly, specific proteins), and the catalytic region, which gives the ribozyme the activity of cleavage, ligation, or splicing. Each class of ribozymes cleaves a different nucleotide sequence using a different mechanism of action. In addition, each class is distinguished by the number of nucleotide bases that are essential for its catalytic activity, and the degree of specificity of the ribozyme and the target sequence (Roberts H. Annual Review of Biochemistry, 61, pp. 641-671, (1992)).

 Recently, it has been proposed to use ribozymes for the treatment of diseases or genetic disorders by cleaving target RNAs, such as viral RNA or messenger RNA, transcribed from genes that must be turned off. This method is proposed as an alternative to blocking RNA transcription using antisense sequences. Due to the catalytic nature of the ribozyme, a single ribozyme molecule cleaves many target RNA molecules and, therefore, therapeutic activity is achieved at relatively lower concentrations than those required for treatment using antisense sequences (WO 96/23569).

 The use of ribozymes for diagnostic purposes was mentioned only occasionally. WO 94/13833 describes a method for detecting nucleic acid molecules in a solution by constructing a specific ribozyme molecule having two regions, one complementary to a detectable nucleic acid and the other complementary to a concomitant target molecule carrying a detectable label. Ribozyme is able to specifically and reversibly bind to both the selected target nucleic acid sequence and the labeled co-target. After binding of both the target and the co-target, the ribozyme undergoes a conformational change, which makes it active and able to cleave the tag from the co-target, after which a free tag can be detected. When a co-target is cleaved, the ribozyme is able to re-bind to the additional co-target with cleavage of the additional label and the additional production of detectable signals.

 Although the authors of WO / 94/13833 called the invention “signal amplification,” the actual effect is not amplification of the amount of ribozymes produced, but rather a purely enzymatic reaction in which a catalytic substance (in this case, a ribozyme) cleaves the substrate (in this case, the co-target ) and then dissociates and cleaves another substrate. This is not a true amplification of the number of active ribozymes involved in the reaction.

 The following is a glossary of specific terms used in the following description and claims. However, this dictionary should not be considered separately and for a complete understanding of the various terms and meanings that these terms have in the context of this invention, the dictionary of special terms should be read along with the rest of the description.

 Ribozyme is a nucleic acid molecule that has enzyme-like catalytic activity. The term "ribozyme" as used in this field of knowledge generally refers to RNA molecules having catalytic activity, although in the context of this invention this term is used to refer to a generally catalytically active (enzyme-like) oligonucleotide. Thus, the ribozyme of the present invention may be an RNA molecule, may be an oligonucleotide containing dNTP or consisting entirely of dNTP, and may also contain various naturally occurring nucleotides, such as IsoG or IsoC 5'-O- (1-thiotriphosphate) nucleosides and 5-O-methyl nucleotides. The ribozyme that can be used in accordance with this invention may consist solely of the nucleic acids described above, or may require a cofactor for its catalytic activity. Ribozymes can have catalytic activity by cleaving, ligating, or splicing (removing) an oligonucleotide sequence, adding groups to oligonucleotides, rearranging nucleic acid sequences, etc.

 The analyzed (tested) biomolecule is a molecule whose presence in the test sample must be determined. It can be an oligonucleotide or a member of a recognition pair, such as a receptor / ligand, antibody / antigen, lectin / glycoprotein, etc. An initiating ribozyme is a ribozyme that initiates a reaction in which more ribozymes are produced, which eventually leads to the generation of a detectable label. When using the method of the present invention to detect biomolecules, the initiating ribozyme is part of the detection system (see below) and serves as a reporter for the presence of the test biomolecule, since only in the presence of the tested biomolecules it either forms or becomes catalytically active. The presence of an active initiating ribozyme activates the catalytic system (see below).

 A detection system is a combination of molecules and reagents that allows the production or activation of a catalytically active initiating ribozyme, which serves as a reporter for the presence of test biomolecules in a test sample. In other words, in the presence of the tested biomolecules, after a reaction or cascade of reactions, a catalytically active initiating ribozyme is ultimately formed. The presence of the initiating ribozyme is confirmed in the catalytic system (see below), where it leads to the formation of more active ribozymes in an amplifying manner (then the ribozymes themselves or the product of their catalytic activity, for example, a free label, is determined at the final stage of the test).

 An inactive ribozyme is a potentially catalytically active ribozyme that cannot exhibit its catalytic activity (cleavage, splicing, ligation, etc.) until it is modified or the conditions in the environment are changed to those in which it becomes active.

 Activation is the conversion of an inactive ribozyme to a catalytically active one through some type of catalytic action (splitting, splicing, ligation, attachment of groups, rearrangement) or by changing external conditions (for example, by adding magnesium ions).

 The inhibitory part of the molecule is the part of the molecule that can sometimes be present in the second complex molecule (see below) and which, if present, makes the initiating ribozyme inactive. The inhibitory effect of the inhibitory part of the molecule can be terminated by its modification or removal from the complex molecule.

 A complex molecule is a molecule that forms part of a detection system in accordance with an embodiment of the invention, referred to herein as an “activation option”. In one method of carrying out the activation variant, a “first complex molecule” is used containing an initiating ribozyme that is a priori catalytically inactive (for example, due to the absence of magnesium ions in the medium), connected to a sequence capable of being cleaved by an active initiating ribozyme, and containing, in addition, a biomolecule recognition (see below). In another method of carrying out the activation variant, a “second complex molecule” is used containing an initiation ribozyme that is a priori catalytically inactive and connected to a sequence capable of cleaving off an active initiation ribozyme, and which also contains a recognition biomolecule (see below). In addition, the second complex molecule contains an inhibitory part of the molecule.

 Recognition biomolecule is a molecule capable of specifically recognizing and binding to a test biomolecule. If the test biomolecule is an oligonucleotide sequence, the recognition biomolecule is a complementary sequence. If the test molecule is a member of a recognition pair (such as an antigen-antibody), then the recognition biomolecule is another member of this pair.

 The first oligonucleotide is an oligonucleotide, usually a DNA molecule, which contains in the direction from 3 ′ to 5 ′: a double-stranded functional promoter, a single-stranded sequence that encodes a sequence complementary to the sequence of initiating ribozymes, a single-stranded sequence identical (with the necessary substitutions of U for T) of the RNA sequence capable of being cleaved by a catalytically active initiating ribozyme and a single chain sequence complementary to the 5'-part of the detected oligonucleot bitstream.

 The second oligonucleotide is an oligonucleotide, usually a DNA molecule, which contains in the direction from 3 ′ to 5 ′: a single-stranded 3 ′ moiety complementary to the detected oligonucleotide sequence, and a trigger oligonucleotide matrix (see below).

 A trigger oligonucleotide matrix is an oligonucleotide sequence that is part of a second oligonucleotide whose transcription product is capable of hybridizing with the reverse promoter construct (see below).

 A trigger oligonucleotide sequence is a transcription product of a trigger oligonucleotide matrix that is capable of hybridizing with the reverse promoter construct (see below) and, after complementing the reverse promoter with a functional promoter, can lead to transcription of the oligonucleotide sequence to which it is attached.

 An oligonucleotide with a nematrix chain is the product of transcription of an oligonucleotide hybrid obtained by hybridization of the analyzed nucleic acid sequence, the first oligonucleotide and the second oligonucleotide, which contains in the direction from 3 'to 5': a trigger oligonucleotide sequence, a sequence complementary to the test sequence, a complementary biomelic sequence initiating ribozyme, and a sequence complementary to the initiating ribozyme.

 Reverse promoter construct is a single-stranded promoter sequence attached to a single-stranded sequence capable of hybridizing with a trigger oligonucleotide sequence. After hybridization with the trigger oligonucleotide sequence and under the action of a suitable DNA polymerase, a functional double-stranded promoter is created that is capable of producing the final oligonucleotide transcript in the presence of a transcription system (see below) (see below).

 The final oligonucleotide transcript is the product of transcription of oligonucleotide hybrids obtained after hybridization of the reverse promoter construct, an oligonucleotide with a non-matrix strand (after the addition of this promoter with suitable DNA polymerase to a double-stranded functional promoter), which contains in the direction from 5 'to 3': the sequence of the initiating ribozyme a sequence capable of being cleaved by an initiating ribozyme, a sequence encoding the complement of a detectable sequence on a tester biomolecule, and the sequence encoding the complement of the trigger oligonucleotide matrix. The initiating ribozyme in this final oligonucleotide transcript can cleave the adjacent sequence, thus being released and giving a free, fully active initiating ribozyme.

 The third oligonucleotide sequence is a nucleic acid sequence complementary to the 5'-part of the detected sequence in the test biomolecule.

 A third compositional molecule is a molecule used in an “assembly variant” of the present invention, which contains a third oligonucleotide sequence linked to a portion of the initiating ribozyme. It also optionally contains a sequence cleaved by the active initiating ribozyme.

 The fourth oligonucleotide sequence is an oligonucleotide sequence complementary to the 3'-part of the detected sequence of the test biomolecule.

 Fourth Compound Molecule — The molecule used in the “assembly variant” of the present invention, which consists of a fourth oligonucleotide sequence coupled to a portion of the initiating ribozyme required to complement the portion present in the third composite molecule to produce a complete catalytically active ribozyme. It also optionally contains a sequence cleaved by the active initiating ribozyme.

 Catalytic system - an ensemble of molecules and reaction mixtures, which in the presence of a catalytically active ribozyme produces a detectable signal. This ensemble of molecules contains a combination of composite molecules, including a ribozyme, which is a priori inactive. In one embodiment, the catalytic system comprises reagents and a combination of a first composite molecule and a second composite molecule (see below), including the first and second ribozyme (inactive), respectively. The first and second ribozymes are a priori inactive and each or both can be activated by a catalytically active initiating ribozyme. The active first ribozyme can activate the inactive molecules of the second ribozyme and the active molecules of the second ribozyme can activate the inactive first ribozyme by amplifying the amount of active ribozyme according to the principle of positive feedback. Alternatively, the first and second ribozymes can be immobilized or spatially separated from each other, and cleavage of one or both of the initiating ribozymes causes them to be released into the medium. Once released, free ribozymes can release immobilized second ribozymes, and free second ribozymes can in turn release free first ribozyme, causing a cascade of self-amplifying reaction that quickly leads to amplification of the number of active ribozymes by the positive feedback method.

 The catalyst system may also include, according to another embodiment, only one type of composite molecules that are immobilized or spatially separated from each other, in the reaction vessel, which are a priori inactive. The initiating ribozyme activates an inactive ribozyme or releases a ribozyme from a composite molecule, and the molecules of the active or released ribozyme then act accordingly, activating inactive or releasing immobilized other ribozymes, then causing a cascade of self-amplifying reaction, which quickly leads to amplification of the number of active ribozymes by the principle of feedback.

 As a result of activation or release of the ribozyme, a detectable signal is produced that indicates the presence of the initiating ribozyme in the medium.

 The first compositional molecule contains a first ribozyme (see below), optionally labeled, connected to a second nucleic acid sequence (see below).

 The second composite molecule contains a second ribozyme (see below), optionally labeled, connected to the first nucleic acid sequence (see below).

 The first nucleic acid sequence is the oligonucleotide sequence, which is part of the second composite molecule and which is the target for the catalytic activity of the first ribozyme (see below). After the catalytic activity of the first ribozyme acts on the first nucleic acid sequence, the second ribozyme (see below) is either released into the medium or becomes catalytically active.

 The second nucleic acid sequence is the oligonucleotide sequence, which is part of the first composite molecule and which is the target for the catalytic activity of the second ribozyme (see below). After the catalytic activity of the second ribozyme acts on the second nucleic acid sequence, the first ribozyme (see below) is either released into the medium or becomes catalytically active.

 The first ribozyme - part of the first composite molecule - is capable of cleaving the first nucleic acid sequence and is identical in its catalytic activity to the initiating ribozyme. It is optionally labeled.

 The second ribozyme, part of the second composite molecule, is capable of cleaving the second nucleic acid sequence and is optionally labeled.

 The third ribozyme is the ribozyme, which can form part of the catalytic system in accordance with its other variant. Third ribozymes are initially inactive. The initiating ribozyme activates the third ribozyme with the manifestation of its catalytic activity against it (as will be explained below) and the activated ribozyme can then activate another third ribozyme in the catalytic system.

 A transcription system is an ensemble of oligonucleotides, nucleotides, RNA polymerase and reagents, which in the presence of an oligonucleotide matrix lead to transcription of the oligonucleotide transcript.

 The fourth ribozyme is a ribozyme that is part of the catalytic system in accordance with its variant and which, after its conversion to a catalytically active ribozyme, can ligate two parts of the fifth ribozyme (see below) with the formation of a catalytically active fifth ribozyme. The fourth ribozyme consists of at least two components that are initially separated and which are ligated together by the fifth ribozyme (when it is catalytically active). After such ligation, the fourth ribozyme becomes catalytically active.

 The fifth ribozyme is the ribozyme, which is part of the catalytic system containing the fourth ribozyme, and which, after its conversion to the catalytically active ribozyme, can ligate together two parts of the fourth ribozyme to form the catalytically active fourth ribozyme. The fifth ribozyme consists of at least two components that are initially separated and which are ligated together by the fourth ribozyme. After such ligation, the fifth ribozyme becomes catalytically active.

 The sixth ribozyme is a specific example of the third ribozyme in which an inactive ribozyme carries an additional nucleic acid sequence and is activated by cleavage or splicing (i.e., deletion) of this sequence.

 The seventh ribozyme is a ribozyme in which the test nucleic acid sequence complements the missing part essential for its catalytic activity and, therefore, becomes catalytically active when combined with the test sequence.

 The present invention provides a method for amplifying a signal based on a ribozyme that is simple to perform, fast, and inexpensive. In contrast to the detection-amplification methods available so far, the method of the present invention is also suitable for testing a point-of-care (POS) testing.

 One of the advantages of the method of this invention is that ribozymes are active under conditions found in a clinical environment, for example, in biological fluids. In addition, as will be shown below, the method of amplification of a signal in accordance with this invention does not require compliance with specific conditions to ensure specificity (strict adherence to specific conditions is a disadvantage of previous methods of amplification of a signal). In addition, ribozymes are functional in various mixtures of sample preparations, for example, in 1M guanidine thiocyanate preparation, as well as in a preparation with saturated phenol, which usually inhibits the functioning of other detection-amplification systems.

 Ribozymes consist of nucleic acid sequences and, therefore, test sequences and probe sequences can be included in the ribozyme molecule. In addition, it is possible to increase the specificity of the amplification method by constructing a ribozyme in such a way that part of the test sequence itself will be necessary for the ribozyme to exhibit its catalytic activity.

 A very potent method, referred to in this area as "in vitro evolution", has been successfully applied to ribozymes to produce a ribozyme with a variety of catalytic activities and specificities. Using such methods, a huge number of potential ribozymes are screened for activity. Ribozymes that exhibit activity are purified for further selection cycles and only the strongest candidates remain after repeated cycles. In traditional amplification methods, after selecting an enzyme, the medium in which the enzyme is to act, i.e. The sample containing medium must be modified to allow the desired enzyme activity to manifest. In the case of a ribozyme, using in vitro evolution, it is possible to select a ribozyme that is highly active in the desired clinical (biological) environment by conducting in vitro evolution in an elective medium that is identical in composition to the clinical sample.

 The present invention provides a sensitive method for detecting a catalytically active ribozyme (referred to herein as “initiating ribozyme”) in a medium. Detecting the presence of a catalytically active initiating ribozyme may itself be a target, although typically a catalytically active initiating ribozyme serves as a reporter for the presence of other biomolecules in the test sample. As soon as the medium containing the active initiating ribozyme is introduced into the catalytic system in accordance with this invention, a cascade of catalytic reactions occurs in it, which leads to exponential amplification of the number of active ribozymes. The catalytic system contains ribozymes that are either inactive or spatially separated from each other, so that they cannot exhibit their catalytic activity; the initiating ribozyme releases or activates the ribozymes of the catalytic system, which in turn release or activate the corresponding further ribozymes of the system. Ribozymes either carry a detectable label, or their catalytic activity causes the formation of a detectable label, which then serves as an indication of the catalytic cascade that occurred in this system.

 According to embodiments of the invention in which the ribozymes are initially immobilized, the presence of free ribozymes in the reaction medium can itself serve as a detectable signal. In another embodiment, each active ribozyme is designed to carry or produce a detectable label, and these labels then serve as a detectable signal.

 According to the method of the present invention, there is a very small false positive signal, that is, a low background level; in addition, the method of the present invention allows the detection of several biomolecules in a single test system.

Thus, this invention provides a method for detecting the presence of a catalytically active initiating ribozyme in a medium, comprising the steps of:
(a) providing a catalyst system comprising:
(aa) ribozymes that are a priori catalytically inactive or spatially restricted in such a way that they cannot exhibit their catalytic activity against their target; while the target of these ribozymes are other ribozymes of the catalytic system and their catalytic activity against such other ribozymes causes:
(i) either the activation of inactive ribozymes,
(ii) either the release of spatially confined ribozymes, allowing them to reach their targets;
moreover, at least some of the ribozymes of this catalytic system are targeted by the catalytic activity of the initiating ribozyme and the catalytic activity of the initiating ribozyme in relation to some of these ribozymes is the activity specified in (i) and (ii) above; and including
(ab) a detectable label having detectable properties, such that the catalytic activity of ribozymes causes a change in detectable properties;
(b) contacting the medium with this catalyst system;
(c) providing conditions for the catalytically active initiating ribozyme and catalytically active ribozymes of the catalytic system to exhibit their catalytic activity, as a result of which the presence of the catalytically active initiating ribozyme leads to a cascade of reactions in which the ribozymes of the catalytic system are activated or released into the medium; and
(d) detecting detectable properties, wherein a change in these properties is an indication of the presence of an active initiating ribozyme in a given environment.

 The most important application of the ribozyme detection method of the present invention is within the scope of a test designed to detect the presence of a biomolecule, such as a specific nucleic acid sequence, a member of a binding pair such as an antibody antigen, sugar lectin, etc., in a biological sample. Such an analysis can conceptually be presented as containing two different components (although these components can be physically incorporated into a single reaction vessel): a detection system and a catalytic system. In such an assay, the presence of the test biomolecule leads to the formation (as described below) of a catalytically active initiating ribozyme in the medium. The catalytically active initiating ribozyme then acts as a reporter molecule in the catalytic system, leading, after a cascade of reactions that amplifies a number of active ribozymes, to the appearance of a detectable label in the reaction medium, as described above. Thus, the appearance of such a detectable label in the environment of the catalytic system indicates the presence of the test biomolecule in the original test biological sample.

 According to this invention, a new use of ribozymes is provided. In the most general sense, a catalytic system containing ribozymes is used to detect the presence of a catalytically active initiating ribozyme in a test medium. Detecting the presence of a catalytically active initiating ribozyme in a test medium may itself be a target, for example, in a method for producing ribozymes called in vitro evolution. In addition, in accordance with a preferred embodiment of the present invention, the catalytically active initiating ribozyme serves as a reporter for the presence of the test biomolecule (other than the initiating ribozyme) in the test biological sample.

 Ribozymes used in accordance with this invention may consist entirely of RNA. Sometimes it is also possible to replace some of the ribonucleotides ("rNTP") in RNA with deoxynucleotides ("dNTP") or some other naturally-occurring or non-naturally occurring nucleotides, such as IsoG or IsoC 5'-O- (1-thiotriphosphate) nucleosides and 5-O-methyl nucleotides. Such a substitution is sometimes desirable, for example, to increase the stability of the ribozyme to RNase present in almost all biological samples. Although this will not be specifically mentioned, each time it is meant that the term "ribozyme" refers to catalytic nucleotides consisting entirely of rNTP, or catalytic oligonucleotides in which some of rNTP has been replaced by dNTP or other nucleotides. The ribozyme may also consist entirely of DNA (Breaker et al., Chemistry and Biology, 1 (4): 223-229, 1994).

 The ribozymes of this invention may contain the nucleic acid sequences described above in combination with a non-nucleic acid molecule, such as a protein, polypeptide, fatty acid, dye, antibiotic or carbohydrate. The non-nucleic acid portion of the complex forming the ribozyme can serve as a cofactor for the catalytic activity of the ribozyme.

 In the future, the term "oligonucleotide" will be used. Oligonucleotides, depending on the context, may be a DNA oligonucleotide (consisting entirely of dNTP) or an RNA oligonucleotide (consisting entirely of rNTP). However, specifically in the case of RNA oligonucleotides, it is sometimes desirable to replace some or all of rNTP with dNTP or other natural and unnatural nucleotides.

 The present invention provides, in its broadest sense, a method for detecting the presence of a catalytically active initiating ribozyme in a test medium. By “catalytically active” is meant a ribozyme capable of carrying out a catalytic reaction, such as cleavage, splicing, ligation, attachment of specific groups, such as phosphate, to molecules, rearrangement of nucleic acid sequences, and the like.

 The catalytic system in accordance with one embodiment of the invention contains two types of ribozymes, which are a priori inactive, but become catalytically active as a result of exposure to catalytic activity. For example, each ribozyme can have a gap or interruption in a part essential for its activity, and, therefore, for its activation, preliminary ligation of this gap or interruption is required. In this case, the catalytic system contains two types of ribozymes, each of which is a priori broken into two components and therefore is initially inactive. An active ribozyme of one species is capable of ligating these two components of the second type of ribozyme, making it active, and an active ribozyme of the second type of ribozyme is capable of ligating two components of the first kind, making it active. This activation is then continued by cross-ligation in an amplifying manner according to the principle of positive feedback.

 The first active ribozyme of one species can be formed by an initiating ribozyme, which is a product of the detection system, in one of two ways.

 According to the first way, some of the ribozymes of the first type are a priori assembled, but cannot dope parts of the ribozymes of the second type, since they are spatially separated from them, for example, as a result of their immobilization using a porous membrane, etc. The initiating ribozyme cleaves the molecules of the immobilized, fully assembled first type of ribozyme, and the free first type of ribozyme then dopes the second type of ribozyme, which in turn alloys members of the first type of ribozyme, which are not a priori assembled, etc.

 According to the second pathway, the initiating ribozyme itself is an alloying ribozyme that dies from its parts at least one species from two ribozymes of the catalytic system, thus initiating a cascade of cross-doping. In this case, there is no need for the spatial separation of the various members of the catalytic system, since until the initiating ribozyme is introduced into the reaction mixture, the catalytic process cannot begin.

 Another example is ribozymes, which have an excess sequence that renders the ribozyme inactive and therefore must be either cleaved or removed by splicing to activate the ribozyme. The next example are ribozymes that require sequence rearrangement or the addition of specific groups for activation. Another example are ribozymes, which require reverse exon splicing, i.e. attaching an intron sequence to a ribozyme.

 One type of ribozyme in its active form can activate inactive ribozymes of the second type, and vice versa, when it has the catalytic properties (doping, cleavage, splicing, arrangement, etc.) necessary to modify another type of ribozyme from an inactive to an active form. These two ribozymes can potentially have the same type of catalytic activity (for example, both are doping ribozymes or both are cleaving ribozymes, etc.) or they can have different types of catalytic activities.

 One or both types of a priori inactive ribozymes are activated by a catalytically active initiating ribozyme. Before the introduction of the initiating ribozyme into the medium, the catalytic system is essentially silent, since there is no catalytic activity. In the presence of such an initiating ribozyme, the cascade of amplification of ribozymes begins, since each active ribozyme generates in turn more active ribozymes by the positive feedback method. Active ribozymes generate a signal that can be detected as described below, and such a signal is indicative of the presence of an initial catalytically active initiating ribozyme in the medium.

 The catalyst system according to another embodiment of the present invention contains two types of composite molecules, each of which contains a ribozyme linked to a cleavable nucleic acid sequence. Ribozyme in one form of composite molecules is capable of cleaving the nucleic acid sequence in another form of composite molecules, so that, in principle, cross-cleavage between the two types of composite molecules is possible, while self-cleavage does not occur. However, before the initiation of the initiating ribozyme in the medium, cross-cleavage does not occur, since these two types of composite molecules are designed in such a way as to prevent interaction between them, while the cleaved ribozymes are able to interact with other composite molecules in the test vessel and continue to release ribozymes in positive feedback environment.

 Prevention of mutual action can be achieved, for example, by immobilization of each type of composite molecules on opposite sides of the reaction vessels; binding of each type of composite molecules to different granules or different colloidal particles having properties, for example, size or other properties, for example, the same electric charge (which repels the granules from each other), which prevent any type of interaction between molecules attached to one of particles, with molecules attached to another particle, by bonding composite molecules to molecular particles having the same electric charge, so that the electric is repelled between these molecular particles will interfere with any interaction between the two composite molecules; by placing each type of composite molecules on different sides of the porous membrane, which does not allow full compositional molecules to pass through it, but allows free passage of the cleaved ribozyme.

 A catalytically active initiating ribozyme, either present in the test medium in advance or produced as a result of the presence of another biomolecule in a biological sample (such as a ribozyme in this case) ("reporter ribozyme"), is capable of cleaving specific nucleic acid present in one or both species composite molecules, thus releasing the ribozymes of the catalytic system. Cleaved ribozymes are able to freely interact in the reaction vessel with ribozymes from another type of composite molecules, which in turn can again cleave ribozymes from the first type of composite molecules, thereby creating a cross-cleavage of ping-pong ribozymes. This cross-cleavage of ribozymes acts on the principle of positive feedback, causing significant amplification of this reaction. Any or both types of ribozymes usually carry detectable tags. Detection of cleaved labels indicates the presence of a catalytically active initiating ribozyme in the reaction mixture. If the initiating ribozyme is a reporter ribozyme, detection of a free label indicates the presence of the test biomolecule in the reaction mixture.

 The catalyst system may contain, in another embodiment, only one type of inactive ribozyme or one type of composite molecule containing a ribozyme and a nucleic acid sequence cleaved by this ribozyme when converted to a free or active form. Similar to the method described above, for one such variant, each individual molecule of this ribozyme is inactive until a catalytically active initiating ribozyme is introduced into the medium; for example, each inactive molecule is in the form of a closed ring, which can be opened by cleavage or splicing of a nucleotide segment by a catalytically active initiating ribozyme. The activated (open) ribozymes then open and activate other such molecules in the form of a closed ring of a given catalytic system.

 Similar to the one described above, for another second embodiment, each one kind of composite molecule may contain a ribozyme located in an orientation that prevents self-cleavage of an adjacent nucleic acid sequence, for example, by placing this sequence directly next to the ribozyme. The fact that there are no intermediate sequences between the ribozyme and the cleaved sequence sterically inhibits cis cleavage. (The cleavage sequence may also have a reversed orientation, and cis cleavage will therefore be impossible). However, the liberated ribozyme may have access to the nucleic acid sequence in the correct orientation and cleave it, releasing more ribozymes into the medium. To prevent spontaneous trans cleavage of unreleased ribozymes, spatial separation can be achieved as described above.

 Detection of the presence of activated ribozymes in the catalytic system can take various forms depending on the type of catalytic activity of the ribozyme. In the case, for example, when the activity is cleavage or splicing, the label can be connected to the part to be cleaved or removed by splicing, and the detection of such a released label is then an indication of the presence of a catalytically active initiating ribozyme in the medium.

 In some cases, activation of the ribozyme leads to a change in the distance between the two regions of the ribozyme, for example, when two remote regions are joined by doping or rearrangement, splicing of the interfering region, or when two initially adjacent regions are separated, for example, by opening a closed ring. In this case, you can attach a fluorescent marker in one area of the ribozyme and a molecular particle, such as rhodamine, which damps the emission of light from the fluorescent marker, in another area of the ribozyme. Rhodamine has a quenching effect on the light emission of the fluorescent label when these two sites are adjacent, and does not have such an effect when the two sites are separated. By monitoring changes in the light emission of the fluorescent label, it can be determined whether these two regions are adjacent (for example, in the case of an inactive ribozyme with a closed ring) or separated (when the ribozyme was opened or activated).

 The label may also be on a substrate that is not bound to the ribozyme and on which the catalytically active ribozyme can exhibit its catalytic activity. For example, a label may be carried by a nucleic acid sequence that is cleaved or removed by splicing as a result of ribozyme activity, whereby the label is released into the medium. Detection in this case will be based on the presence of a free label in the medium.

 Cross ping pong activation by cross cleavage, cross doping, cross splicing, cross rearrangement or alternating cycles of different catalytic actions essentially amplifies the reaction, leading to a signal that indicates in a short time whether a catalytically active initiator was present in the medium ribozyme. While previous amplification-detection methods, such as PCR or LCR, require several hours to complete, the amplification-detection method of the present invention is completed within a much shorter period of time.

 When the catalytically active initiating ribozyme serves as a reporter ribozyme to indicate the presence of other biomolecules, a detection system is required in which the catalytically active initiating ribozyme is formed only in the presence of the analyzed biomolecule. This can be done in one of the following options, referred to herein as an “activation option”, “transcription option”, “assembly option”, and “addition (acquisition) option”.

 According to the activation option, the initiating (reporter) ribozyme is a priori inactive. This lack of activity may result from the absence of magnesium ions, which are necessary for the catalytic activity of the ribozyme in the medium; this may be the result of the presence of an inhibitory moiety in the medium; this may be the result of the presence in the medium of an oligonucleotide that hybridizes with a sequence that must be cleaved either to activate or to release a ribozyme into the system, and this cleavage is not possible while this sequence is double-stranded, etc. In this embodiment, the ribozyme is coupled to a recognition biomolecule, which is capable of specifically recognizing the biomolecule to be determined in the sample and to bind to it. For example, in the case where the test biomolecule is an oligonucleotide sequence, the recognition biomolecule is a complementary sequence; when the test biomolecule is an enzyme, the recognition biomolecule may be a substrate; when the test biomolecule is an antigen, the recognition biomolecule may be an antibody specifically interacting with this antigen, etc.

 The ribozyme coupled to the recognition molecule is then allowed to interact with the test biomolecules, and the unbound ribozymes are then separated and removed by washing. Such a separation can be carried out on the basis of differences in size between complexes of bound ribozymes and test biomolecules and free ribozymes; by preliminary immobilization of the tested biomolecules and the subsequent leaching of free ribozyme molecules; etc. After this separation, the conditions are changed so as to activate the ribozyme, for example, by adding the absent magnesium ions; modification or removal of the inhibitory part to terminate its inhibitory activity; melting a double-stranded non-cleavable sequence to a single-chain cleavable sequence; etc. Only in the presence of the test biomolecule are the ribozymes that are associated with it stored and only these stored ribozymes are activated when the conditions change appropriately.

 You can use the transcription variant of the present invention, in which the test biomolecule is a nucleic acid sequence. The detection phase of this option can be carried out, in General, as described in Israel Patent Application Nos. 105894 and 111857 (and their counterpart PCT Applications Nos. WO / 94/29481 and) with a “trigger oligonucleotide” representing an initiating ribozyme. The detection system of this variant contains two oligonucleotide molecules, the first of which contains a sequence complementary to the 5'-part of the nucleic acid test sequence, and the second contains the sequence complementary to the 3'-parts of the nucleic acid test sequence. The first oligonucleotide molecule contains, against the course of transcription, from a sequence complementary to the test biomolecule, a functional promoter, a sequence encoding a sequence of an initiating ribozyme, and a sequence that is capable of being cleaved by a detecting ribozyme (also essentially a DNA sequence). The second oligonucleotide molecule contains, in the course of transcription from the complementary 3 ′ part of the test sequence, a trigger oligonucleotide matrix, the transcription product of which is capable of triggering transcription of the sequences of initiating ribozymes, as will be explained in detail below.

 If the test biomolecule is not present in the test sample, then the trigger oligonucleotide sequence is not transcribed, since only the presence of the test biomolecule brings together the two molecules necessary to form a suitable matrix of the trigger oligonucleotide sequence; namely, a first oligonucleotide molecule carrying a functional promoter and a second oligonucleotide molecule carrying a trigger oligonucleotide matrix. If the test biomolecules are present, and in the presence of the transcription system, a trigger sequence is formed, which in turn can cause the formation of transcripts containing the initiating ribozyme associated with the sequence cleaved by it. After self-cleavage, these transcripts release a catalytically active initiating ribozyme into the medium.

 According to an assembly variant of the present invention, in cases where the test biomolecule is a nucleic acid sequence, the detection system must comprise a third oligonucleotide comprising a sequence complementary to the 5'-part of the tested nucleic acid sequence and a fourth oligonucleotide including a sequence complementary to the rest , 3'-parts of the tested nucleic acid sequence. Each of these oligonucleotides contains only one part (for example, half) of the ribozyme and both parts together comprise a complete, functionally active ribozyme.

 According to this embodiment, the function of the nucleic acid test sequence is to combine the two oligonucleotides together to form a functionally active initiating ribozyme. Thus, in the presence of a test nucleic acid sequence, a functional initiating ribozyme will be formed in the sample, which can be detected in the catalyst system of this invention.

 In accordance with a variant of addition (acquisition) of the present invention, the detection system contains a seventh oligonucleotide, and the test sequence forms a complex with a seventh oligonucleotide to form a catalytically active initiating ribozyme. For example, the test sequence can form part of the catalytic core (core) of the ribozyme. Thus, in accordance with this option, the ribozyme is a priori incomplete, and only in the presence of the test sequence does it become a complete, catalytically active ribozyme, which can then be detected in the catalytic system.

 The test sequence can complement (complete) the ribozyme with hybridization at its 3'-end with a sequence on one side of the missing part of the ribozyme and hybridization at its 5'-end with the sequence on the other side of the missing part of the ribozyme, thereby adding the missing part and creating a functional initiating ribozyme .

 The test sequence may also be able to complement the missing portion of the ribozyme with “exon reverse splicing,” in which the test sequence is inserted into the ribozyme by appropriate cleavage and doping reactions. This "exon reverse splicing" may be carried out by other ribozymes present in the medium.

 To reduce the background level of the method of the invention and reduce false positive results, two or more variants of the invention can be combined to double guarantee that a catalytically active initiating ribozyme is not formed in the absence of test biomolecules. For example, it is possible to combine the assembly and activation variants of the present invention, as a result of which catalytically active ribozymes will be formed only as a result of two accumulating conditions: the assembly of a full ribozyme from two parts in a mixture without magnesium and after washing out the free incomplete ribozymes of activation of the full ribozyme by adding magnesium ions.

 The ribozymes used in most variants of the detection system of the present invention are, in most cases, universal, i.e. the same ribozyme can be used to detect different analyzed biomolecules, since specificity is acquired by attaching a recognition biomolecule (in the activation variant) or created by the first and second oligonucleotide molecules (in the transcription variant) or the third and fourth oligonucleotide sequences (in the assembly variant). The fifth oligonucleotide in the case of a variant of addition (acquisition) of the present invention should be designed for each specific analyzed nucleic acid, because the sequence recognizing the test sequence is part of the ribozyme itself.

 This invention also provides the reagents necessary for carrying out the above method, as well as a kit containing these reagents.

 The invention will now be described with reference to some non-limiting drawings and examples.

 In the drawings, various symbols are used, which in the context of the present invention have the meanings given at the end of the description.

FIG. 1 shows an embodiment of a catalytic system of the invention comprising two types of composite molecules activated by cross-cleavage;
FIG. 2 (a) and 2 (b) show a catalytic system according to an embodiment of the invention comprising one type of composite molecule activated by cross-cleavage or cross-splicing, where the ribozyme is depicted in the form of a closed ring (Fig. 2 (a)); where the ribozyme needs splicing in order to become active (Fig. 2 (b));
FIG. Figure 3 shows various ways in which composite molecules can be separated from each other: by immobilization at different points in the reaction vessel (3A); binding to large granules (3B); by bonding with charged molecular particles (3C); and placing each type of composite molecule on opposite sides of the porous membrane (3D);
FIG. 4 shows an example of a detection system according to an activation variant of the present invention, in which the ribozyme is activated by the addition of magnesium ions;
FIG. 5 shows another example of a detection system according to an activation variant of the present invention, in which the ribozyme is activated by modifying the inhibitory portion of the molecule;
FIG. 6 shows a detection system in accordance with a transcription variant of the present invention;
FIG. 7 shows a detection system according to an assembly embodiment of the present invention, wherein the recognition sequence of the ribozyme hybridizes with the analyzed nucleic acid sequence (FIG. 7 (a)); or where the open stem-II of the ribozyme hybridizes with the analyzed sequence (Fig. (b));
FIG. 8 shows an example of a catalyst system of the present invention comprising two types of cross-doping activated ribozymes;
FIG. 9 shows another example of a detection system in accordance with an activation option of the present invention, in which a ribozyme is activated by converting a cleavable sequence into a single chain;
FIG. 10 shows the results of cleavage of a detection system containing an open stem II ribozyme of FIG. 7 (b);
FIG. 11 shows the results of cleavage of a catalyst system containing a closed-loop composite molecule of FIG. 2 (b);
FIG. 12 shows the results of ribozyme cleavage in the presence of untreated blood and denaturing agents.

 Catalytic system.

 First, FIG. 1, showing one way of constructing a catalyst system of the present invention. The catalyst system contains two types of composite molecules 10 and 11. Composition molecule 10 contains one type of labeled ribozyme, which will be called ribozyme A (12), associated with the RNA sequence denoted by b (13). Compositional molecule 11 contains another type of labeled ribozyme, which will be called ribozyme B (14), and the RNA sequence a (15). Ribozyme B in molecule 11 is capable of cleaving sequence b in molecule 10, and ribozyme A in molecule 10 is capable of cleaving sequence a in molecule 11. Initially, molecules 10 and 11 are unable to interact, since they are immobilized in different places of the reaction vessel. The initiating ribozyme 16 is also capable of cleaving sequence b in molecule 10.

 If the initiating ribozyme is present in the reaction mixture, sequence b is cleaved to release free ribozyme A (12) into the reaction mixture. Each ribozyme A (12) is able to diffuse in the reaction vessel to split molecule 11, thus releasing free ribozyme B into the reaction mixture (14). The free ribozyme B (14) is again able to migrate through the reaction vessel to cleave molecule 10 to release the free ribozyme A (12) again, and this cycle is repeated again and again according to the principle of positive feedback. Since both ribozymes A and B are labeled, the detection of each or both in the supernatant indicates the presence of initiating ribozyme 16 in the reaction mixture.

The following is an example of molecule 10 containing a hammerhead type 12 ribozyme connected to sequence 13, which is then labeled at the 3'-end with biotin (capital letters: 2'-O-methylated; small letters: RNA)
5'CCA cugauga gGCC GAAA GGCc gaa acGUguc CGU AAA-
The following is an example of a molecule 11 containing another hammerhead type ribozyme 14, which is capable of cleaving the sequence 13 present in the molecule 10. Ribozyme 14 is connected to the sequence 15 cleaved by the ribozyme 12 of the molecule, which is then labeled at its 3'-end with biotin (capital letters : 2'-O-methylated; small letters: RNA)
5'-GAG ACG cugauga gGCC GAAA GGCc gaa acAC guc UGG AAA
Although ribozymes A and B are called different ribozymes and a and b are called different sequences, both ribozymes and both sequences can actually be identical. In this case, self-cleavage in each molecule 10 and 11 is avoided by binding the ribozyme to a sequence attached to it so close that cis cleavage is impossible, while free ribozymes are capable of trans-cleaving composite molecules. This can be done by binding the ribozyme directly next to its potentially cleavable sequence. This is due to the fact that the ribozyme must be located at a distance of several nucleotides from the sequence that it potentially cleaves for effective cleavage. Thus, when the ribozyme in the composite molecule is directly linked directly to the cleavable sequence without gap, cis cleavage is not possible and the sequences can be cleaved only in trans cleavage, which makes possible only trans cleavage.

 Now, FIG. 2 (a), which shows an alternative where only one kind of composite molecules is present in the reaction vessel. The catalytic system contains one type of molecule 17 ', each of which contains the ribozyme C' (18 ') and a cleavable sequence c' (19 '). The molecule 17 'is in the form of a closed ring and, therefore, the ribozyme 18' is initially inactive.

 If the catalytically active initiating ribozyme 16 ′ is present in the medium, it is able to cleave the sequence c ′ and open the ribozyme, making it active. The disclosed ribozyme 18 ′ may in turn reveal additional composite molecules 17 ′ by cleavage, making them active. Detection can be carried out using a fluorescent label (F) and rhodamine (Rd). When they are adjacent, as is the case in a closed molecule, the emission of light from the fluorescent label is extinguished, and when they are separated, as is the case in the sequence of the opened molecule, the emission of light from the fluorescent label becomes stronger.

 Next, FIG. 2 (b), which shows another alternative to a catalytic system containing only one kind of composite molecule. Ribozyme 17 '' has in its central part (cortex) an additional nucleotide sequence of 18 '', which makes the ribozyme inactive. At the end of this extra sequence is a 19 '' blocking group that prevents spontaneous doping of the open end.

 A 16 '' initiating ribozyme that has catalytic splicing activity is capable of cleaving both the 18 '' complementary sequence and the 19 '' blocking group and then doping the free ends to form a functional ribozyme. Then, the functional ribozyme is able to splicing other ribozymes in the reaction medium, causing amplification of the reaction. Detection according to one selection (Option 1) is carried out mainly as described in FIG. 2 (a), but in this case, rhodamine (Rd) and fluorescent group (F) are initially separated and only when ribozyme is activated do they become adjacent, so that the active ribozyme is detected by damping light emission. According to the second detection method (Choice 2), a spliced group containing an additional free sequence 18 ″ and a blocking group 19 ″ carries a detectable label.

The advantage of the method of FIG. 2 (b) consists in a very low background level, since in order for an inactive ribozyme to become spontaneously active (without the presence of an initiating ribozyme), two spontaneous events must take place: spontaneous cleavage (with a probability of 10 ^-6 - / min in 10 mm MgCl ₂ at physiological pH and at a temperature of 37 ^o C) and spontaneous doping (with a probability of 10 ⁷ / min), which gives a very low probability of spontaneous activation (10 ¹³ / min).

 The label attached to any or both of A, B or C ribozymes (FIG. 1) may be any detectable label known in the art, such as a radioactive isotope, a fluorescent label, an enzyme capable of producing a color reaction in the presence of a substrate, and etc.

 FIG. 3 shows the various ways in which two composite molecules 10 and 11 of the first embodiment are placed in such a way as to avoid their interaction with each other, but to make possible the interaction between the free ribozymes 12 and 14 and the composite molecules. It should be understood that the same principles are used for another method of constructing the catalyst system of the present invention, i.e., when only one kind of composite molecule is present, shown in FIG. 2.

 In FIG. 3 (f), molecules 10 and 11 are immobilized on different and separated sides of the reaction vessel 18, while ribozymes 12 and 14 freely diffuse in the reaction mixture.

 FIG. 3 (B) shows molecules 10 and 11, which are immobilized on granules 19, the size of which prevents the interaction between these molecules. However, free ribozymes 12 and 14 are able to freely diffuse in the reaction vessel and interact with immobilized composite molecules.

 FIG. 3 (C) shows another example of the separation of composite molecules, in which composite molecules 10 and 11 are attached to charged molecular particles carrying the same charge 37. Electrical repulsion between the molecular particles connected to them excludes the possibility of interaction between molecules 10 and 11. However, free ribozymes 12 and 14, which are essentially free of charge, are capable of interacting with composite molecules.

 FIG. 3 (D) shows another example of the separation of composite molecules 10 and 11 by placing them on opposite sides of the porous membrane 34, which serves as a sieve, blocking the passage of large molecules 10 and 11, but allowing smaller free ribozymes 12 and 14 to pass through.

 Another way to ensure that the two composite molecules 10 and 11 do not interact with each other is to use blocking molecules that are complementary to the specific sequence and make it double-stranded. According to this method, the composite molecule 10 contains a blocking molecule that makes the cleavable molecule b and part of the catalytic region of ribozyme A double-stranded. In the partially double-stranded composite molecule 10, the ribozyme is inactive due to the fact that its catalytic region is double-stranded. Compositional molecule 11 is blocked in a similar manner. If the initiating ribozyme is present in the reaction mixture, it displaces part of the blocking molecule present on the composite molecule 10, and then the initiating molecule is able to cleave sequence b. After cleavage of the sequence b, ribozyme A also becomes active, since the partially displaced blocking molecule completely disappears from the composite molecule 10, turning its catalytic region into single-stranded and active. Then, the active ribozyme A displaces the blocking molecule of the composite molecule 11 by the method described above, cleaving the sequence a, converting ribozyme B into single-stranded and active. Ribozyme B then activates the composite molecule 10 in a manner similar to the activation of the initiating ribozyme described above, and after this cross-activation of the two composite molecules can occur.

 Next, FIG. 8, which shows another alternative for constructing the catalyst system of the present invention. This catalytic system contains two types of ribozymes 80 and 81, which are active when fully assembled, but inactive when they are separated from their parts 80a, 80b and 81a, 81b, respectively. Complete ribozyme 80 is capable of doping portions of ribozyme 81a and 81b to form a complete and active ribozyme 81. Complete ribozyme 80 is capable of doping portions of ribozyme 80a and 80b to form complete and active ribozyme 80, so that cross-activation occurs through cross-doping.

 The initiating ribozyme 86 or 86 'is capable of creating a complete and active ribozyme 80 either by cleaving the complete but immobilized ribozyme from its location, where it is spatially separated from the parts of the ribozyme 81a and 81b, for example, by one of the methods described in FIG. 3 (Fig. 8, top left), or due to the ability to alloy parts 80a and 80b with the formation of a complete and active ribozyme 80 (Fig. 8, top right).

 Detection system.

 When applying the method of the invention to facilitate the detection of biomolecules other than ribozymes, the invention also includes a detection system capable of producing a catalytically active initiating ribozyme only in the presence of the analyzed molecule.

 FIG. 4 shows one example of an activation option of the present invention. In this example, the analyzed biomolecule is an immobilized nucleic acid sequence A (41), for example, a DNA sequence. The immobilization can be carried out in accordance with any method known in the art, for example, by means of a crosslinking agent or by trapping the analyzed nucleic acid molecule between two porous membranes that allow smaller molecules to pass through. If the molecule to be analyzed is a protein, it can be immobilized on granules carrying suitable capture agents, such as suitable immobilized antibodies directed against areas that are not required for detection, etc. Alternatively, the analyzed biomolecule can be immobilized on a nitrocellulose layer and another protein, such as albumin, must then be applied on nitrocellulose to saturate all vacant spots of the nitrocellulose layer to avoid, in the next step, non-specific adsorption.

 This detection system also contains the first complex molecule 42 containing ribozyme 43 coupled to cleavable sequence c '(44) capable of being cleaved by the active ribozyme, and, in addition, contains sequence a' (45), complementary to the analyzed sequence A (41). Ribozyme 43 does not cleave independently, since molecule 42 is in the reaction medium without magnesium, which excludes the catalytic activity of ribozymes. This can be achieved, for example, by storing complex molecule 42 in a reaction medium with EDTA without magnesium.

Молекулам 41 и 42 дают гибридизоваться с образованием иммобилизованного гибрида 46. Свободные молекулы 42 удаляют промыванием и к иммобилизованному гибриду 46 добавляют ионы магния в концентрации, достаточной для активации рибозимов. В присутствии такой концентрации иона магния рибозим 43 способен отщеплять последовательность с', высвобождаясь в реакционную смесь, оставляя расщепленный гибрид 47 иммобилизованным. Свободный и каталитически активный рибозим 43 может служить в качестве инициирующего рибозима в каталитической системе.An example of a ribozyme 43 coupled to a cleaving sequence with '(44), such as a hammer head (capital letters: 2'-O-methylated; small letters: RNA; underlined: DNA)

Molecules 41 and 42 are allowed to hybridize to form an immobilized hybrid 46. The free molecules 42 are removed by washing and magnesium ions are added to the immobilized hybrid 46 in a concentration sufficient to activate ribozymes. In the presence of such a concentration of magnesium ion, ribozyme 43 is able to cleave sequence c ', being released into the reaction mixture, leaving cleaved hybrid 47 immobilized. The free and catalytically active ribozyme 43 can serve as an initiating ribozyme in the catalytic system.

 FIG. 5 shows another example of an activation option of the present invention. The analyzed biomolecule 51, which contains the nucleic acid sequence A, for example, a DNA sequence, is immobilized as described above. The detection system contains a second complex molecule 52 containing ribozyme 53 connected to sequence c '(54), which can be cleaved by a catalytically active ribozyme, and sequence a' (55), complementary to sequence A of the analyzed biomolecule. This complex molecule also contains an inhibitory portion of molecule 58, which, if present in its unmodified form, inhibits the catalytic activity of ribozyme 53. An example of an inhibitory molecule is a nucleic acid sequence complementary to a ribozyme. In the presence of such a sequence, the ribozyme folds into an inactive three-dimensional form.

 Molecules 51 and 52 are allowed to hybridize to form an immobilized hybrid 56 and free molecules 52 are removed by washing. Modifying substances are added to the separated hybrid 56, which are able to interact with the inhibitory part of molecule 58 and modify it into a non-inhibitory form. For example, if the inhibitory part of the molecule is a nucleic acid sequence that causes folding of the ribozyme, the modifying substance may be a sequence complementary to the inhibitory part of the molecule, which hybridizes with the inhibitory part and blocks it, allowing the ribozyme to reposition into its active form. Alternatively, the modifying agents may be those capable of removing or cleaving the inhibitory portion of the molecule, terminating its inhibitory effect. An active ribozyme capable of cleaving the c ′ sequence is then added to release it from the immobilized cleaved hybrid 57. The catalytically active free ribozyme 53 then serves as an initiating ribozyme in the catalytic system.

 Next, FIG. 9, which shows another example of an activation option of the present invention. Molecule 91 contains an initiating ribozyme 90 sequence coupled to sequence c, cleaved by a ribozyme, and sequences a and b, which are capable of hybridizing with the analyzed biomolecule, which is, for example, molecule 94 of the analyzed DNA sequence. In addition, molecule 91 contains a DNA blocking sequence 92, which contains sequences B and C capable of hybridizing with sequences b and C of molecule 91, respectively, to form a double-stranded structure. The DNA blocking sequence 92 is linked via the linker sequence 93. Ribozyme 90 is not able to cleave the sequence c, since the region of its sequence is double-stranded (due to hybridization with the blocking sequence 92).

 Then the analyzed molecule 94 is introduced into the reaction mixture. If the analyzed biomolecule is complementary to a and b of the molecule 91, then the blocking sequence 92 is displaced by the analyzed molecule 94 to form a hybrid molecule 95. In the hybrid molecule 95, the cleavable sequence c is single-stranded, which allows the ribozyme to cleave it in such a way thus released into the reaction medium in the form of a catalytically active ribozyme 96, which serves as an initiating ribozyme in the catalytic system.

 According to this embodiment, conditions such as temperature, length of the recognition part of the biomolecule b, which is double-stranded, etc., must be carefully selected so that the analyzed molecule is able to displace the blocking molecule 92 only if sequences A and B of the analyzed biomolecules are precisely matched to the recognition sequences a and b.

Next, FIG. 6, which shows a transcription variant of the detection system of the present invention, useful when the biomolecule is a nucleic acid sequence. According to this characteristic embodiment, the exact DNA template, which ultimately leads to transcription of the initiating ribozyme, is assembled from its parts only in the presence of the analyzed nucleic acid sequence. This detection system contains a first oligonucleotide molecule 61, which is mainly DNA, containing in the direction from 3 ′ to 5 ′: a double-stranded promoter, a sequence R coding for a complementary sequence of an initiating ribozyme, a sequence C coding for a sequence cleaved by a catalytically active ribozyme, and a sequence D ₁ , a complementary 5'-part of the analyzed nucleic acid sequence. The detection system further comprises a second oligonucleotide molecule 62, which is mainly DNA, containing in the direction from 3 ′ to 5 ′: a D ₂ sequence complementary to the 3 ′ part of the analyzed nucleic acid sequence, and a trigger oligonucleotide matrix (TRIG). In the presence of the analyzed nucleic acid sequence 63 and under conditions suitable for hybridization, the D ₁ sequence _{of the} molecule 61 and the D ₂ sequence _{of the} molecule 62 hybridize with the D ₁ ′ and D ₂ ′ sequences of the analyzed nucleic acid sequence to form a hybrid 64.

In the presence of a transcription system, a non-matrix oligonucleotide 65 chain is produced, containing in the direction from 3'k 5 ': trigger oligonucleotide sequence trig, sequences d ₂ ' and d ₁ ', sequences c', g ', complementary to cleavable nucleic acid sequences and initiating ribozyme, respectively .

 Reverse promoter construct 66 molecules containing a single-stranded DNA promoter linked to a sequence capable of hybridizing with the TRIG oligonucleotide trigger sequence are added to the reaction mixture. Under suitable conditions, the reverse promoter construct 66 hybridizes to molecule 65 to form a hybrid 66. In the presence of DNA polymerase, the single-stranded promoter is complemented to form a functional double-stranded promoter in hybrid 68.

 Hybrid 68 can serve, in the presence of transcription reagents, as a template for the formation of the final oligonucleotide transcript 69, containing, starting from its 5'-end: an initiation ribozyme sequence r and a cleavable sequence c capable of cleaving this ribozyme.

 Ribozyme r cleaves the cleavable sequence c to release it into the environment in the form of free ribozyme 70. Free ribozyme 70 can serve as a catalytically active initiating ribozyme in the catalytic system.

One method of assembly option is shown in FIG. 7 (a). The detection system contains an analyzed biomolecule 71 containing the nucleic acid sequence A ₁ A ₂ . In addition, the detection system contains a portion of ribozyme 72 comprising an oligonucleotide sequence a ₁ ′, a complementary sequence of A ₁ and another portion of a ribozyme 73 containing an oligonucleotide sequence a ₂ ′, complementary to A ₂ . These parts of ribozyme 72 and 73 together make up the complete ribozyme in the assembly of these two parts.

In the presence of the analyzed molecule 71 in the medium, it can hybridize with a ₁ part of ribozyme 72 and az part of ribozyme 73, bringing these two parts together to form a hybrid 76 functional ribozyme and the analyzed sequence, which can serve as an initiating ribozyme in the catalytic system, for example, as a result of cleavage of molecule 77, which may be necessary to initiate the amplification cascade in the catalytic system.

 Another method of an assembly option of the present invention is shown in FIG. 7 (b).

 A hammerhead type 79 ribozyme was constructed in which stem-11 was shortened so that it had only one complementary nucleotide (represented by one line in Fig. 2b) and the rest of the stem was opened to form shoulders a and b. Ribozyme 79 is able to hybridize with sequence 70 to form stems I and III and then exhibit catalytic activity, for example, cleavage of sequence 70. However, a priori ribozyme 79 is unable to cleave cleavable sequence 70, since its stem-II is open and inactive. The arms a and b of the open central part were designed so that they were complementary to sequences A and B of the analyzed sequence, for example, DNA sequence 80.

 In the presence of the analyzed DNA sequence 80, the shoulders a and b of the stem II of ribozyme 79 hybridize with the analyzed sequence to form a fully double stranded stem II and thus the ribozyme becomes catalytically active and can serve as an initiating ribozyme in the catalytic system, where, for example, cleaved sequence 70 is part of an enzyme in a catalytic system that requires cleavage to activate it.

 Example 1. Detection of the analyzed nucleic acid sequence using an open stem II ribozyme.

 Ribozyme HH8 was dissected into two parts with a loop of stem II. Each of the two halves of the HH8 ribozyme (HH8-3 and HH8-5) has a tail sequence of an additional 17 bases that is different from the other, complementary to the LAMTAR0 of the target DNA molecule. In the presence of this target, the two halves come together and form an active ribozyme. In the LAMTAR0 target, these two sequences, complementary to the ribozyme halves, are continuous. In other LAMTAR molecules (LAMTAR1 - LAMTAR4), these two sequences are separated by 1-4 non-complementary bases, respectively. Ribozyme substrate is SB8-24, which contains a sequence recognized by HH8.

(a) Method:
1. Sequences:
Oligodeoxyribonucleotides were synthesized on an Applied Biosystem 381A DNA synthesizer according to the protocol recommended by the manufacturer. Ampliscribe (Epicenter Technologies) kit was used for all RNA syntheses. [Α ³² -P] UTP [3000 Ci / mmol] was purchased from Rotem Industry Ltd., Israel.

LAMTAR1:

LAMTAR2:

LAMTAR3:

LAMTAR4:

Подчеркнутые - комплементарны половине рибозима;
Жирные - некомплементарная дополнительная последовательность.Target DNA:
LAMTAR0:

LAMTAR1:

LAMTAR2:

LAMTAR3:

LAMTAR4:

Underlined - complementary to half of the ribozyme;
Fatty is a non-complementary extra sequence.

HH8-5 (половина рибозима):

Подчеркнутые - комплементарны мишени.RNA transcripts:
SB-24 (substrate for HH8):
5'GGUCACAAUGUCGGUCGAGUUCCA-3 '
HH8-3 (half ribozyme):

HH8-5 (half ribozyme):

The underlined are complementary to the target.

 2. Getting RNA.

DNA oligonucleotides were synthesized according to (1) above. Oligonucleotides were purified by electrophoresis on a 15% polyacrylamide gel with 7 M urea, viewed in UV and eluted overnight at room temperature in 0.5 M Tris-Cl (pH 7.0), 0.1% SDS and 0.1 mM EDTA . Eluted DNA was precipitated with 0.1 volumes of 3 M sodium acetate and 3 volumes of ethanol, resuspended in 1 mM Tris-Cl (pH 7.0) and 0.1 mM EDTA and stored at -20 ^° C until use. The purified oligonucleotides were annealed with the complementary non-matrix promoter oligonucleotide T7 RNA polymerase (TAA TAG GAC TCA CTA TAG G) at 20 mM each by incubation at 95 ^o C for 15 s and at 70 ^o C, 60 ^o C, 55 ^o C, 50 ^o C, 45 ^° C, 40 ^° C and 37 ^° C for 5 minutes (at each temperature). The transcription reaction mixture (50 ml) contained 2 mg of annealed DNA, 1x reaction buffer, 10 mM dithiothreitol, 2 mM ATP, CTP and GTP, 1 mM UTP, 25 mCi [α ³² P] UTP and 1, mM MgCl ₂ . The mixture was incubated for 1 h at 37 ^o C and then for 5 min at 80 ^o C to deactivate the enzyme. RNA was precipitated as described previously. Transcripts were purified by electrophoresis on a 15% polyacrylamide gel with 7 M urea. The location of RNA was determined autoradiographically and RNA was eluted as described above. Eluted RNA was precipitated as described above, resuspended in 0.1x TEQ and counted in a scintillation counter (Luma LSC).

 3. The cleavage reaction.

Reactions (10 ml) were usually carried out in the presence of 0.5 pmol ribozyme, 50 mM Tris-Cl (pH 7.5), 1 mM EDTA (pH 7.5), 0.05% SDS and 30 mM MgCl ₂ . The reactions were preincubated at 95 ^° C for 1 min to exclude alternative RNA conformations that could have formed during storage at -20 ^° C. The reactions were incubated at 37 ^° C for 1 h and stopped by the addition of a dye solution containing 10 M urea and 10 mM EDTA, and placed on ice. Samples were denatured at 80 ^° C. for 5 minutes and separated on a 15% polyacrylamide gel with 7 M urea.

(b) Results:
Polyacrylamide gel analysis results are shown in FIG. 10. Ribozyme without a target did not produce acceptable cleavage. When the target was added, enhanced cleavage was obtained. The gain was highest in tests with LAMTAR4 ribozymes.

 Example 2. A catalytic system containing a composite molecule in the form of a closed ring.

The SLS-precursor of ribozyme (Rz) is an annular Rz with a 11-bp stem II. The two arms of recognition are connected in tandem with the additional splitting base separating them. Thus, this ribozyme has no activity, but serves as a matrix for active ribozymes. Upon its cleavage, the “opened” ribozyme becomes active (as shown schematically in Fig. 2 (b)). To initiate the catalytic system, an initiating ribozyme must be present. Spontaneous cleavage of RNA occurs at a rate of 1 event per 10 ⁶ molecules per minute in 30 mM MgCl ₂ at 37 ^o C. The ring ribozyme, spontaneously cleaved at the cleavage site, becomes active and is able to serve as a trigger.

(a) Method:
1. Sequences:
Oligodeoxyribonucleotides were synthesized on an Applied Biosystem 381A DNA synthesizer in accordance with the protocol recommended by the manufacturer. Ampliscribe kit (Epicenter Technologies) was used for all RNA synthesis. [α ³² P] UTP [3000 Ci / mmol] was purchased from Rotem Industries Ltd., Israel.

 RNA precursor sequences (SLS) were: 5 'GGU CAG CAG UCG AA [recognition arm I] X [recognition arm III] CUG AUG AGA CUG CUG ACC A 3' (see table).

 2. Getting RNA.

 Obtaining RNA was performed as described in example 1.

 3. The reaction of spontaneous cleavage.

Reactions (10 μl) were usually carried out in the presence of 5 pmol ribozyme precursor (SLS transcripts), 50 mM Tris-Cl (pH 7.5), 1 mM EDTA (pH 7.5), 0.05% SDS and 300 mM MgCl ₂ . The reactions were preincubated at 95 ^° C for 1 min to exclude alternative RNA conformations that could have formed during storage at -20 ^° C. The reactions were incubated at 37 ^° C for 1 h or overnight and stopped by the addition of a dye solution containing 10 M urea and 10 mM EDTA, and placed on ice. Samples were denatured at 80 ^° C. for 5 minutes and electrophoresed on a 15% polyacrylamide gel with 7 M urea.

(b) Results:
The results of this polyacrylamide gel are shown in FIG. 11. A panel of 8 different circular ribozymes was tested for cascading activity. The cascade was initiated by spontaneous cleavage, as described above. As shown in FIG. 1, one of the ribozymes (N 313) showed an active catalytic cascade, leading to amplification by the principle of positive feedback.

 Example 3. Inhibition of ribozyme by blood and various materials used to obtain DNA.

 All amplification methods require a sample preparation step to isolate nucleic acids and to exclude inhibition of reactions by blood components. Some substances, such as SDS, phenol and guanidinium, are used in these production methods. The amplification reaction should be carried out without the need for a sample preparation step. The activity of ribozymes was tested in the presence of blood with and without nucleic acid releasing agents. Both RNA ribozymes and modified ribozymes were tested.

(a) Method:
1. Oligonucleotides:
Oligodeoxyribonucleotides were purchased at the Department of Molecular Biology, Haddassa Hospital, Mount Scopus, Jerusalem. The modified ribozyme was synthesized by RPI, Boulder, Co. For the entire RNA synthesis, the Ampliscribe T7 transcription kit (Epicenter Technologies) was used. [γ- ³² P] ATP [6000 Ci / mmol] and [α ³² P] UTP [3000 Ci / mmol] were purchased from Rotem Industries Ltd., Israel. T7 polynucleotide kinase was purchased from NEB, Beverly, Ma.

Маленькие буквы - рибонуклеотиды;
заглавные буквы - 2'-O-метилированные модификации;
подчеркнутые буквы - дезоксирибонуклеотиды.2. Ribozymes:
DS-LS-RzA3-6: 5 '

Small letters are ribonucleotides;
caps - 2'-O-methylated modifications;
underlined letters are deoxyribonucleotides.

HH8 (RNA transcript):
5 'GGCGACCCUGAUGAGGCCGAAAGGCCGAAACAUUAA 3'.

3. Labeling of the modified ribozyme:
50 pmol of ribozyme, 10 units of T7 polynucleotide kinase and 20 μCi [γ ³² P] ATP were incubated in 1x reaction buffer in a total volume of 10 μl at 25 ^° C for 1 hour. The reaction was stopped by incubation at 60 ^° C for 10 minutes.

4. Getting RNA:
HH8 template DNA oligonucleotide was purified by electrophoresis on a 15% polyacrylamide gel with 7 M urea, viewed in UV and eluted overnight at room temperature in 0.5 M Tris-Cl (pH 7.5), 0.1% SDS and 0 , 1 mM EDTA. The eluted DNA was precipitated with 0.1 volume of 3 M sodium acetate and 3 volumes of ethanol, resuspended in 0.1x TEQ (1 mm Tris-Cl pH 7.0 and 0.1 mm EDTA) and stored at -20 ^° C until use. The purified oligonucleotide was annealed with the complementary non-matrix promoter oligonucleotide T7 RNA polymerase (TAATACGACTCACTATAGO) at 20 μM each by incubation at 95 ^° C for 15 s and at 70 ^° C, 60 ^° C, 55 ^° C, 50 ^° C, 45 ^° C, 40 ^o C and 37 ^o C for 5 min (at each temperature). The transcription reaction mixture (50 μl) contained 2 μM annealed DNA, 1x reaction buffer, 10 mM dithiothreitol, 2 mM ATP, CTP and GTP, 1 mM UTP, 25 mCi [α ³² P] UTP and 1.1 mM MgCl ₂ . The mixture was incubated for 1 h at 37 ^o C and then for 5 min at 80 ^o C to deactivate the enzyme. RNA was precipitated as described above. Transcripts were purified by electrophoresis on a 15% polyacrylamide gel with 7 M urea. The position of the RNA was determined by autoradiography and the RNA was eluted as described above. Eluted RNA was precipitated as described above, resuspended in 0.1x TEQ and counted in a scintillation counter (Luma LSC).

5. The cleavage reaction:
Reactions (10 μl) were usually carried out in the presence of 0.5 pmol of modified ribozyme or HH8, 50 mM Tris-Cl (pH 7.5), 1 mM EDTA (pH 7.5), 0.05% SDS and 30 mM MgCl ₂ . Added 1 μl of whole blood or 0.2 μl of whole blood and an additional component (see Fig. 1). The reactions were incubated at 37 ^o C for 1 h and stopped by the addition of a dye solution containing 10 M urea and 10 mm EDTA, and placed on ice. Samples were denatured at 80 ^° C. for 5 minutes and subjected to electrophoresis on a 15% polyacrylamide gel with 7 M urea.

(b) Results:
These results are shown in FIG. 12, where 0.5 pmol of ribozymes were present in each sample, and 1 μl of blood was mixed with either 10% SDS, or with guanidine isocyanate, or with a phenol / chloroform mixture (1: 1), 1 μl of the processed blood sample was added to the reaction test or just an agent. The results of ribozyme activity were not inhibited by either 1% SDS, nor 0.35 M guanidine, or 5% phenol / chloroform mixture (neither in the presence of blood, nor without it). Untreated blood destroys the RNA portion of ribozymes. These results show one of the advantages of the ribozyme-based detection method of the present invention that denaturing agents used in the preparation of the catalytic sample do not inhibit the catalytic activity of the ribozyme.

Claims (29)

 1. A method for determining the presence of a catalytically active initiating ribozyme in a medium, characterized in that they create a catalytic system containing ribozymes that apriori are catalytically inactive or spatially oriented so that they cannot exhibit their catalytic activity against their target, the quality of which other ribozymes of the catalytic system are used, and the catalytic activity against these other ribozymes causes activation of inactive ribozymes or a twofold reorientation of the ribozymes that allows them to reach their targets, while at least some of the ribozymes of the catalytic system are targets for a similar catalytic activity of the initiating ribozyme, a detecting label having detecting properties, such that the catalytic activity of the ribozymes causes a change in these detecting properties, interact media with a catalytic system while providing conditions allowing a catalytically active initiating ribozyme and catalytically active the obvious ribozymes of the catalytic system to exhibit their catalytic activity, as a result of which the presence of a catalytically active initiating ribozyme leads to a sequence of reactions in which the ribozymes of the catalytic system are activated or released into the medium, and the detecting properties of the label are checked, the change in these properties indicating the presence of an active initiating ribozyme in the environment.  2. The method according to claim 1, characterized in that the medium is tested for the presence of a catalytically ribozyme with a catalytic system containing the first and second ribozymes, each of which is a priori catalytically inactive, and the first ribozyme becomes catalytically active under the influence of catalytic activity the second ribozyme and the second ribozyme becomes catalytically active under the action of the catalytic activity of the first ribozyme on it and at least one of these ribozymes becomes catalytic If they are active by the catalytic activity of the initiating ribozyme, at least one of these ribozymes contains a label that, under the action of the catalytic activity of the other ribozyme, changes their controlled properties, provide the conditions under which the initiating ribozyme and the first and second ribozymes are capable of exhibiting their catalytic activity, and detecting properties are determined, and changes in these properties indicate the presence of an active initiating ribozyme in this medium.  3. The method according to claim 1, characterized in that the medium is tested for the presence of a catalytically active ribozyme with a catalytic system containing a first composite nucleic acid molecule containing a first type ribozyme capable of cleaving the first cleavable nucleic acid sequence connected to the second a cleavable nucleic acid sequence, wherein cleavage of the second sequence releases the first ribozyme from the first composite molecule, the second composition an ionic nucleic acid molecule containing a second ribozyme capable of cleaving a second cleavable nucleic acid sequence coupled to a first cleavable nucleic acid sequence, wherein cleaving the first sequence releases the second ribozyme from the second composite molecule, at least one of the cleavable sequences being cleaved also by the initiating ribozyme, wherein the first and second composite nucleic acid molecules are separated from each other in contact between composite molecules, at least one of the composite molecules carries a detecting label released into the reaction medium after cleavage with a ribozyme contained in another composite molecule, create conditions such that cleavage is such that the first ribozyme is capable of cleaving the first cleavable sequence, the second ribozyme is capable of cleave the second cleavable sequence and the initiating ribozyme is capable of cleaving at least the first or second sequence ty of ribozymes, whereby the cleaved ribozymes migrate between the first and second composite nucleic acid molecules, and the presence of released tags is determined, the presence of the tag in the medium indicating the presence of a catalytically active ribozyme in the given medium.  4. The method according to claim 1, characterized in that the medium is contacted with a catalytic system containing a third ribozyme, which is a priori catalytically inactive, and each molecule of this a priori catalytically inactive third ribozyme becomes active under the action of the catalytic activity of other molecules of catalytically active third ribozymes , a priori catalytically inactive third ribozyme also becomes active under the action of the catalytic activity of the initiating ribozyme, the third ribozyme carried t label, so that under the action of the catalytic activity of another molecule of the third ribozyme, a change in the detecting properties of this label occurs on it, conditions are created that ensure the catalytic activity of the third ribozyme and the initiating ribozyme, the detectable properties are determined, and a change in these properties indicates the presence of an active initiating ribozyme in the environment.  5. The method according to claim 1, characterized in that the medium is reacted with a catalytic system containing a composite nucleic acid molecule containing a labeled ribozyme connected to a cleavable nucleic acid sequence in an orientation or position that prevents the cleavage of this nucleic acid sequence by a ribozyme its presence in the composite molecule, and this nucleic acid sequence is capable of being cleaved by the ribozyme when it is present in free form with by freeing the labeled ribozyme from the composite molecule, the cleavable nucleic acid sequence is also capable of being cleaved by the initiating ribozyme, and the individual composite molecules are separated from each other to avoid contact between them, create conditions that ensure cleavage of the ribozyme and the migration of cleaved ribozymes between the separated composite molecules, and determine the presence released tags, the presence of the released tags in the medium indicating the presence of catal active ribozyme in the medium.  6. The method according to claim 4, characterized in that to detect the presence in the medium of a catalytically active ribozyme having catalytic cleavage activity, the medium is reacted with a catalytic system containing a composite nucleic acid molecule containing a ribozyme that has a cleavable nucleic acid sequence, this composite molecule is in the form of a closed ring and the cleavable nucleic acid sequence is capable of being cleaved by the composite molecule in In the closed form, the cleavable nucleic acid sequence is also capable of being cleaved by the initiating ribozyme, the composite molecule carries a detecting label that changes its detecting properties when the closed composite molecule is opened, create conditions that cleave into the ribozyme migration, and determine the detecting properties, and the change in these properties is indicating the presence of the catalytic activity of ribozyme in the medium.  7. The method according to claim 4, characterized in that to detect the presence in the medium of a catalytically active initiating ribozyme having catalytic splicing activity, the medium is reacted with a catalytic system containing a sixth ribozyme having an additional sequence in the region essential for its catalytic activity nucleic acid insufficient for catalytic activity, making the ribozyme inactive, and splicing an additional nucleic acid sequence makes the sixth Ibozyme is active, the additional nucleic acid sequence can be removed by splicing from the composite molecule under the action of the sixth catalytically active ribozyme, the additional nucleic acid sequence is also able to be removed by splicing by means of a catalytically active detecting label, the sixth ribozyme carries a detecting label that changes its detecting properties when the nucleic acid splices create conditions providing the possibility of joint venture icing ribozyme, and determining the detection properties, and the change in these properties is an indication of the presence of catalytically active ribozyme in the medium.  8. The method according to claim 3, characterized in that the first and second composite nucleic acid molecules are used, immobilized on opposite sides of the porous membrane, blocking their passage through it, but allowing the passage of the first and second ribozymes.  9. The method according to claim 3, characterized in that the first and second composite nucleic acid molecules immobilized on a substrate are used.  10. The method according to claim 5, characterized in that the use of composite molecules, each of which is immobilized on a substrate.  11. The method according to claim 9, characterized in that a granule is used as a substrate.  12. The method according to claim 3, characterized in that the first and second composite nucleic acid molecules are used, which are connected to particles having the same electrical charges.  13. The method according to claim 5, characterized in that the use of composite molecules, each of which is connected to a charged particle, and all molecular particles in the reaction mixture have the same charge.  14. A method for detecting the presence of analyzed biomolecules in a test sample, characterized in that the sample interacts with a detection system under conditions that make possible the formation of a catalytically active initiating ribozyme, essentially only in the presence of the analyzed biomolecules in this sample, and determine the presence of catalytically active ribozyme according to the method of claim 1, wherein its presence indicates the presence of the analyzed biomolecule in this sample.  15. The method according to 14, characterized in that the interaction of the first complex molecule containing the initiating ribozyme and the recognition biomolecule is able to specifically recognize and bind to the analyzed biomolecule, with the test sample under conditions that ensure interaction between the recognition biomolecule and the analyzed biomolecule, with By maintaining the conditions that make the ribozyme catalytically inactive, the unreacted first complex molecules are removed, and the conditions under which the initiating ribozyme with ANOVA active, show the presence of a catalytically active initiation ribozyme in accordance with the method of claim 1, wherein its presence is indicative of the presence biomolecule in the sample being analyzed.  16. The method according to p. 15, characterized in that the interaction of the first complex molecule containing the initiating ribozyme and a recognition biomolecule capable of specifically recognizing and binding to the analyzed biomolecule, the ribozyme being coupled to a cleavable nucleic acid sequence capable of being cleaved by a catalytically active initiating ribozyme, moreover, the cleavage of the cleavable sequence releases a catalytically active initiating ribozyme into the environment, while complex molecules placed in conditions under which the ribozyme is catalytically inactive with the test image under conditions that provide a reaction between the recognition biomolecule and the analyzed biomolecule, while maintaining the conditions that make the ribozyme catalytically inactive, remove the unreacted first complex molecules, provide the conditions under which the initiating ribozyme becomes catalytically active , to cleave the cleavable sequence and release the initiating ribozyme into the environment, and detect Corollary initiating catalytically active ribozyme in accordance with the method of claim 1, wherein its presence is indicative of the presence biomolecule in the sample being analyzed.  17. The method according to p. 15, characterized in that the interaction of a hybrid molecule containing an initiating ribozyme coupled to a cleavable nucleic acid sequence, which is capable, when it is single-stranded, to be cleaved by an initiating ribozyme, and cleavage of this cleaved sequence releases a catalytically active initiating ribozyme into environment, and containing, in addition, a recognition biomolecule capable of specifically recognizing and binding to the analyzed biomolecule, and the cleavable sequence and part of the recognition biomolecule are a priori double-stranded, with the test sample under conditions that allow the displacement of one strand of the double-stranded part of the recognition biomolecule and the cleavable nucleic acid sequence of a substantially exactly compatible analyzed biomolecule, create conditions allowing cleavage of the catalytically active ribozyme and single catalytically active initiating ribozyme in the environment, and about redelyayut initiating presence of catalytically active ribozyme in accordance with the method of claim 1, wherein its presence is indicative of the presence biomolecule in the sample being analyzed.  18. The method according to p. 15, characterized in that the interaction of the second complex molecule containing the initiating ribozyme and a recognition biomolecule capable of specifically recognizing and binding to the analyzed biomolecules, the ribozyme being coupled to a cleavable nucleic acid sequence capable of being cleaved by a catalytically active initiating ribozyme, moreover, the cleavage of this cleavable sequence releases a catalytically active initiating ribozyme in the environment, and also containing ing the inhibitor part of the molecule, capable of inhibiting the catalytic activity of the initiating ribozyme with the test sample under conditions that allow binding between the recognition molecule and the analyzed biomolecule, while maintaining the inhibitory part of the molecule in its inhibitory form, remove unreacted second complex molecules, modify the inhibitory part of the molecule in the reacted second complex molecules so as to eliminate its inhibitory effect and cause cleavage of the cleavable sequence the release of the initiating ribozyme into the environment, and determine the presence of a catalytically active initiating ribozyme in accordance with the method according to claim 1, and its presence indicates the presence of the analyzed biomolecule in the sample.  19. The method according to clause 15, wherein the interaction uses a medium that does not contain magnesium ions, which are added to the reaction medium upon activation of the ribozyme in a concentration sufficient to convert the initiating ribozyme to a catalytically active ribozyme.  20. The method according to 14, characterized in that if the analyzed biomolecule is a nucleic acid sequence, then the sample is interacted with a detection system containing a first oligonucleotide molecule having a double-stranded promoter, a single-stranded oligonucleotide sequence that is essentially DNA that is essentially identical the sequence of the initiating ribozyme, a single-stranded sequence, which is mainly DNA, which is essentially identical to the cleavable sequence a spacer capable of being cleaved by a catalytically active initiating ribozyme, and a single-stranded sequence complementary to the 5'-part of the analyzed nucleic acid sequence, a second oligonucleotide molecule having a single-stranded sequence complementary to the 3'-parts of the analyzed nucleic acid sequence, and further containing a single-stranded triangular nucleic acid matrix can be transcribed to form a trigger oligonucleotide sequence capable of, in in the presence of a reverse promoter construct and DNA polymerase, to initiate a reaction in the transcription system in which the sequence to which it is connected is transcribed, provide conditions that allow hybridization of the first and second oligonucleotide molecules with the analyzed nucleic acid sequence, add a transcription system, under conditions that allow transcription as a result of which the trigger oligonucleotide sequence is transcribed, which, in the presence of a reverse promoter, DNA Limerases and transcription systems under conditions allowing for hybridization, DNA polymerization and transcription leads to transcription of the final oligonucleotide transcript containing the initiating ribozyme, coupled to a cleavable sequence capable of being cleaved by a catalytically active initiating ribozyme, providing conditions allowing the catalytically cleavable cleavage of the cleavable cleavage of the cleavable sequence and thereby releasing it into the environment do, and determine the presence of a catalytically active initiating ribozyme in accordance with method of claim 1, and its presence indicates the presence of the analyzed biomolecule in the sample.  21. The method according to 14, characterized in that if the analyzed biomolecule is a nucleic acid sequence, then the test sample is incubated with a detection system containing a third composition molecule containing a third single-stranded oligonucleotide sequence complementary to the 5'-part of the analyzed nucleic acid sequence, moreover, the third oligonucleotide sequence is connected to a part of the initiating ribozyme, the fourth composition molecule containing four The grated single-stranded oligonucleotide sequence complementary to the rest of the 3'-part of the analyzed nucleic acid sequence, the fourth oligonucleotide sequence being connected to the part of the initiating ribozyme necessary to complement the ribozyme connected to the third oligonucleotide sequence, to create a full hybridization of the third ribozyme, allowing the fourth oligonucleotide sequence with the analyzed sequence nucleic acid and making it possible to assemble a complete initiating ribozyme from its parts, and determine the presence of a catalytically active initiating ribozyme in accordance with the method of claim 1, wherein its presence indicates the presence of the analyzed biomolecule in the sample.  22. The method according to 14, characterized in that if the analyzed biomolecule is a nucleic acid sequence, then the test sample is incubated with a detection system containing a hammer head type ribozyme, in which part of the double-stranded section of stem II is shortened and the rest of the double-stalk II attached to two single-stranded sequences, one of which is complementary to the 3'-end of the analyzed nucleic acid sequence, and the other is complementary to the 5'-end of this sequence ukleinovoy acid, wherein the ribozyme is a priori inactive; and is capable of activation during hybridization of two single-stranded sequences with complementary sequences, create conditions allowing hybridization of the ribozyme with the analyzed nucleic acid sequence, and determine the presence of a catalytically active initiating ribozyme in accordance with method 1, and its presence indicates the presence of the analyzed biomolecule in the sample .  23. The method according to claim 1, characterized in that to detect the presence in the medium of a catalytically active initiating ribozyme having cleavage activity, the medium is contacted with a catalytic system containing a fourth ribozyme capable of ligating parts of the fifth ribozyme coupled to a nucleic acid sequence cleaved initiating ribozyme, and cleavage of this nucleic acid sequence releases the catalytically active fourth ribozyme into the environment, two parts of the heel the second ribozyme, which can be ligated by the fourth ribozyme with the formation of a catalytically active fifth ribozyme, the fifth ribozyme being capable of ligating parts of the fourth ribozyme, two parts of the fourth ribozyme, which can be ligated by the fifth ribozyme, with the formation of the catalytically active fourth ribozyme, and a priori separated from two parts of the fifth ribozyme to avoid contact between them, and at least one of these ribozymes (fourth or fifth) carries met y, which changes its detecting properties upon doping, creates conditions that allow ribozyme cleavage and the migration of the cleaved full fourth molecule to two parts of the fifth ribozyme, provide or support conditions that allow ribozyme ligation, and detect detecting properties, and a change in these properties indicates the presence of initiating ribozyme in the medium.  24. The method according to claim 1, characterized in that to detect the presence in the medium of a catalytically active initiating ribozyme having ligation activity, the medium is contacted with a catalytic system containing two parts of the fifth ribozyme, which can be ligated with the fourth ribozyme to form a catalytically active fifth ribozyme, wherein the fifth ribozyme is a ribozyme capable of ligating parts of the fourth ribozyme, two parts of the fourth ribozyme, which can be ligated by the fifth ribozyme to form m of the catalytically active fourth ribozyme, wherein the fourth ribozyme is capable of ligating parts of the fifth ribozyme, wherein two parts of the fifth ribozyme or two parts of the fourth ribozyme can be ligated with a catalytically active initiating ribozyme, and at least one of these ribozymes (fourth or fifth) a label that changes its detectable properties during ligation, creates conditions that allow ligation of ribozymes, detect detecting properties, and a change in these properties is Azania on the presence of an initiating ribozyme in the medium.  25. A kit for determining the presence of a catalytically active initiating ribozyme in a medium containing a catalytic system comprising test ribozymes that are a priori catalytically inactive or spatially limited so that they cannot exhibit their catalytic activity on their targets, as other ribozymes of this catalytic system are used, and moreover, catalytic activity with respect to such other ribozymes causes activation of inactive test ribozymes or vennuyu reorientation test ribozymes, allowing them to reach their targets, wherein at least a portion of the test ribozyme catalytic system is a target for initiation of the catalytic activity of the ribozyme, a detection label, having a detecting properties, and the catalytic activity test ribozyme causes a change in detection characteristics.  26. The kit according to claim 25, wherein the catalytic system contains the first and second test ribozymes, which are a priori catalytically inactive, the first test ribozyme becoming catalytically active by the catalytic activity of the second test ribozyme, and the second test ribozyme becomes catalytically active by the catalytic activity of the first test ribozyme, at least one of the test ribozymes also becomes catalytically active by the catalytic activity of the initiating ribozyme, p at least one of the test ribozymes carries a label, so that under the effect of the catalytic activity of these other test ribozyme is a change detecting properties of the label.  27. The kit according to claim 25, wherein the catalytic system comprises a first composite nucleic acid molecule containing a first type test ribozyme capable of cleaving a first cleavable nucleic acid sequence coupled to a second cleavable nucleic acid sequence, wherein cleaving the second sequence releases the first a test ribozyme from a first composite molecule, a second composite nucleic acid molecule containing a second test ribozyme of a type capable of degrading heat the second cleavable nucleic acid sequence connected to the first sequence, wherein cleavage of the first sequence releases the second test ribozyme from the second composite molecule, wherein at least one of the cleavable sequences can also be cleaved by the initiating ribozyme, the first composite and second composite nucleic acid molecules are separated from each other to avoid contact between two composite molecules, at least one of the composite molecules carries a detecting label, which is released into the reaction medium after cleavage with ribozyme contained in another composite molecule.  28. The kit according to claim 25, wherein the catalytic system contains a third test ribozyme, which is a priori catalytically inactive, and each molecule of a priori catalytically inactive third test ribozyme becomes active by the catalytic activity of other molecules of catalytically active third test ribozymes, a priori the catalytically inactive third test ribozyme also becomes catalytically active under the action of the catalytic activity of the initiating ribozyme, the third test ribozyme carries the label so Thus, under the influence of the catalytic activity of another molecule of the third ribozyme on it, the detecting properties of this label change.  29. The kit according to claim 25, wherein the catalytic system comprises a composite nucleic acid molecule containing a labeled test ribozyme connected to a cleavable nucleic acid sequence in an orientation or position that interferes with the cleavage of the nucleic acid sequence by the test ribozyme in a composite molecule, moreover, this nucleic acid sequence can be cleaved by the test ribozyme when it is present in free form and thereby release eny test composition of ribozyme molecules, wherein the cleavable sequence of the nucleic acid may be cleaved initiating ribozyme molecule composite are separated from each other to avoid contact therebetween. Priority on points:
02/27/95 according to claims 1 - 16, 18 - 22, 25 - 29;
10.26.95 on PP.17, 23 and 24.

Images