CN1183812A - Detection of biomolecules - Google Patents

Abstract

The present invention concerns a method for detecting the presence of a catalytically active ribozyme in a medium. The detection of the catalytically active ribozyme may be a goal by itself, or the ribozyme may serve as a reporter for the presence of other biomolecules in an assayed sample. The detection is carried out in a catalytic system wherein the presence of the active ribozyme serves to produce other active ribozyme in a positive-feedback amplificatory manner.

Description

The detection method of biomolecules

Technical field that the present invention belongs to

The present invention relates to be used for to detect method and test kit that the ribozyme of medium catalytic activity exists.It is useful that method of the present invention and test kit are used for detecting within the scope in the existence of test sample specific biological molecule at method and test kit.

Background of invention

It is various experiments, diagnosis and needs therepic use that detection specificity biomolecules (as DNA or RNA sequence, protein, antigen, antibody etc.) exists in sample.Many mensuration can be used for detecting the protein biomolecules, as gel electrophoresis figure, HPLC, affinity chromatography and other mensuration of carrying out based on the suitable label probe of use.Such be the gratifying while when being determined at the protein biomolecules that wherein will detect and having enough big quantity, they are also sensitive in inadequately often being enough to feasiblely can to carry out the detection of a small amount of biomolecules.

DNA or RNA sequence can be by the probe in detecting of applying marking.When the DNA that detects or RNA sequence only existed with very little amount, they must be by certain methods such as LCR (ligase chain reaction), SSR (self-sustained sequence replication) or PCR (polymerase chain reaction) amplification.

Though amplification method such as PCR have great influence to fundamental research, they are slowly carrying out the transition to clinical instrumentation.That the first cause of this point is that the needs with the clinical setting bonded automatization of sample have produced is complicated, slowly and expensive processing.The needs of the protein enzyme of environmental factors high susceptibility are made the environment of accurate control necessitate (operating these enzymes therein).Typically, clinical sample comprises many components, but their interferases carry out the ability of its catalytic activity.In addition, be used for specimen preparation and be not suitable for enzymatic activity, thereby must from sample formulation, remove target nucleic acid based on protein with the standard method (extracting) that discharges nucleic acid as guanidine thiocyanic acid or phenol.

Ribozyme has the RNA molecule of class enzymatic catalytic activity typically, this activity normally nucleotide sequence split connect, montage be connected.Although once there was the proof ribozyme can act on dna molecular and protein, the known substrate of ribozyme is the RNA molecule.

The natural nuclear enzyme that participates in intramicellar reaction works with cis, and the only single conversion of catalysis is during reaction carried out self usually and modified.Yet, can be to the operation of ribozyme engineering so that it presses real catalytic way with trans-acting, conversion is not carried out self and is modified greater than one.In ribozyme, can identify two significantly districts: land (making ribozyme have the specificity of hybridizing) and catalytic domain (making ribozyme have cracking, be connected or the montage activity) with specific nucleic acid sequence (also may be specific protein).Every group of ribozyme uses the different different nucleotide sequences of mechanism of action cracking.Can further distinguish (Robert H.Simons, bioid academic year comments, 61,641-671, (1992)) by the degrees of specificity that to its catalytic activity is the number of necessary nucleotide base and ribozyme and target sequence for every group.

In order to treat disease or heredity is not normal, use ribozyme cracking target RNA has been proposed recently, as viral RNA or from messenger RNA(mRNA) from the genetic transcription that should close.This method is as proposing by the alternative method of use antisense sequences with the sealing rna transcription.Because the catalytic property of ribozyme, therefore the many target RNA of single ribozyme molecule cleavable molecule can reach therapeutic activity (WO 96/23569) with the relative lower concentration of the concentration more required than antisense therapy.

Seldom have and mention that ribozyme is used for the purposes of diagnostic purpose.WO94/13833 has described a kind of method that detects solution amplifying nucleic acid molecule, this method is by making the specific ribozyme molecule that (tailoring) has two districts, one of them and nucleic acid array complementation to be detected, another and the common target molecule complementation that has detectable mark.Ribozyme can be specifically and oppositely in conjunction with target nucleic acid sequence of selecting and and the common target of mark.Target and altogether target all in conjunction with the time, ribozyme carries out configuration and changes, this makes it have active and can fall mark from target cracking altogether, detects the free mark then.By the cracking of target altogether, ribozyme can combine with other common target again, and the more mark of cracking also produces more detectable signal.

Although their invention " amplification of signal " of the invention of WO94/13833 person, in fact the ribozyme number of Chan Shenging does not have amplification, and reaction is pure enzymatic reaction, wherein catalytic specie (under the situation of ribozyme) cracking substrate (under the situation that is total to target) dissociates and the another kind of substrate of cracking then.The real amplification of the quantity of participation reactive activity ribozyme takes place.

Nomenclature

Be the nomenclature that is used for following specification sheets and claims below.Yet this nomenclature should not considered discretely, understand various terms and the meaning of these terms in the context of the invention fully, and nomenclature should be read in conjunction with the rest part of this specification sheets.

Ribozyme-the have nucleic acid molecule of class enzymatic catalytic activity.Although common this term in the context of the present invention is used in reference to (zymoid) oligonucleotide of catalytic activity, employed in the art term " ribozyme " refers to have the RNA molecule as catalytic activity.Like this, ribozyme of the present invention can be the RNA molecule, can be the oligonucleotide that comprises dNTPs or form by dNTPs fully, also can comprise the Nucleotide that various non-naturals produce, as IsoG or IsoC 5 '-O-(1-sulfo--guanosine triphosphate) Nucleotide and 5-O-methyl nucleotide.Ribozyme can single-mindedly as mentioned above be made up of nucleic acid used according to the present invention, or its catalytic activity needs cofactor.The catalytic activitys such as rearrangement that ribozyme can have cracking, connection, the montage of oligonucleotide sequence or wipe out (splicing out) (removing), adds group, nucleotide sequence to oligonucleotide sequence.

The molecule of the biomolecules of measuring-in test sample to be detected, exist.It can be oligonucleotide or discern right member, as receptor/ligand, antibody/antigen, Sugar receptors/glycoprotein etc.

The ribozyme of the local initial action of initial ribozyme-produce at more ribozyme finally causes detectable mark to produce.Be used for detection of biological in method of the present invention and divide the period of the day from 11 p.m. to 1 a.m, initial ribozyme is the part of detection system (as follows) and as the reporter molecule of the existence of biomolecules to be measured, because have only said biomolecules to be measured to exist, initial ribozyme just produces or becomes catalytic activity.The existence of active initial ribozyme has activated catalysis system (as follows).

Detection system-initial the ribozyme of catalytic activity is produced or activatory molecule and combination of agents, the reporter molecule that this exists as the biomolecules to be measured in test sample.In other words, when biomolecules to be measured exists, after reaction or reaction cascade, finally produce the initial ribozyme of catalytic activity.In the place that initial ribozyme produces more active ribozyme in the amplification mode, check the existing of initial ribozyme (as follows) in catalysis system (product of ribozyme self or its catalytic activity is as detecting free label in the terminal stage of measuring).

Inactivation ribozyme-potential catalytic activity ribozyme, it is up to being modified or making it become active back its catalytic activity of competence exertion (cracking, montage, connection etc.) therein up to the condition of revising medium.

The change (as the interpolation magnesium ion) of activation-by certain katalysis (cracking, montage, connection, interpolation group, rearrangement) or external conditions makes the ribozyme of inactivation become catalytic activity.

Suppress part-be present in the second complex body molecule (as follows) often and when existing, make the part of nuclei originis enzyme deactivation.The restraining effect that suppresses part can be by modifying it or remove termination from compound molecule.

Compound molecule-formation is according to the molecule of the detection system part of the embodiment of the present invention that is called " activation embodiment " in this article.In a kind of mode of carrying out the activation embodiment, used " first compound molecule ", it comprises as the initial ribozyme of (a priori) that infer, catalysis inactivation (for example, owing to lack magnesium ion in medium) and can and comprise the sequence of discerning biomolecules (as follows) by active nuclei originis enzymatic lysis and is connected.Carry out in the mode of activation embodiment at another kind, used " second compound molecule ", it comprise as initial ribozyme that infer, the catalysis inactivation with can be connected by active nuclei originis enzymatic lysis and the sequence that comprise identification biomolecules (as follows).Second compound molecule also comprises the inhibition part.

Identification biomolecules-can discern or be attached to the molecule on the biomolecules to be measured specifically.When biomolecules to be measured was oligonucleotide sequence, the identification biomolecules was a complementary sequence.In biomolecules to be measured is when discerning right member's (as Ag-Ab), and the identification biomolecules is another right member of this identification.

First oligonucleotide-a kind of oligonucleotide, dna molecular typically, from 3 ' → 5 ' comprising: the single stranded sequence of double-stranded function on, coding and nuclei originis enzyme sequence complementary sequence and (the having necessary U-T replaces) single stranded sequence that can be equal to by the RNA sequence of catalytic activity nuclei originis enzymatic lysis and and the oligonucleotide sequence that will detect 5 '-part complementary single stranded sequence.

Second oligonucleotide-a kind of oligonucleotide, dna molecular typically, from 3 ' → 5 ' comprising: 3 '-part and the oligonucleotide sequence complementary single stranded sequence that will detect and trigger oligonucleotide templates (as follows).

The triggering oligonucleotide templates-be the oligonucleotide sequence of second an oligonucleotide part, its transcription product can be hybridized with reverse (back) promoter construct (as follows).

Trigger the transcription product of oligonucleotide sequence-triggering oligonucleotide templates, can hybridize,, can cause that the oligonucleotide sequence of its connection is transcribed oppositely finishing after the promotor with reverse promoter construct (as follows).

The transcription product of the oligonucleotide heterozygote of non-template chain oligonucleotide-obtain by nucleotide sequence (first oligonucleotide and second oligonucleotide) to be measured hybridization is from 3 ' to 5 ' comprising: trigger oligonucleotide sequence and biomolecules complementary sequence to be measured and can be by the sequence complementary sequence of nuclei originis enzymatic lysis and and initial ribozyme complementary sequence.

Oppositely promoter construct-with can and trigger the single stranded sequence bonded strand promoter sequence that oligonucleotide sequence is hybridized.After hybridizing with the triggering oligonucleotide sequence, the archaeal dna polymerase effect by being fit to can produce functional double stranded promoter, and in the presence of re-reading system (as follows), this promotor can produce final oligonucleotide transcript (as follows).

The transcription product (finishing to two strands after the functional promotor by the archaeal dna polymerase that is fit in promotor) of the oligonucleotide heterozygote of final oligonucleotide transcript-obtain after oppositely promoter construct and non-template chain oligonucleotide hybridization is simultaneously from 5 '-3 ' comprise: nuclei originis enzyme sequence, can be by the sequence of the complementary sequence of the sequence of the complementary sequence of the detection sequence on the sequence of said nuclei originis enzymatic lysis, the coding biomolecules to be measured and coding triggering oligonucleotide templates.Its contiguous sequence of initial ribozyme cleavable at said final oligonucleotide transcript has so just discharged free, complete active initial ribozyme.

The 3rd oligonucleotide sequence-and biomolecules to be measured in the sequence that will detect 5 '-part complementary nucleotide sequence.

The 3rd composition molecule-be used for the molecule of " assembling embodiment " of the present invention, this molecule comprises the 3rd oligonucleotide sequence that is connected with the part of initial ribozyme.It comprises the sequence by active nuclei originis enzymatic lysis also not essentially.

The 4th oligonucleotide sequence-and biomolecules to be measured in the sequence that will detect 3 '-part complementary nucleotide sequence.

The 4th composition molecule-the be used for molecule of " assembling embodiment " of the present invention, this molecule comprises the 4th oligonucleotide sequence that is connected with the part of initial ribozyme, wherein ribozyme need finish be present in the 3rd composition part to obtain catalytic activity ribozyme completely.It comprises the sequence by active nuclei originis enzymatic lysis also not essentially.

The aggregate of catalysis system-molecule and reaction mixture, in the presence of the initial ribozyme of catalytic activity, this aggregate produces detectable signal.This molecular aggregate comprises the combination that contains the composition molecule that is the inactivation ribozyme of inferring.In one embodiment, catalysis system comprises reagent and comprises the combination of the first composition molecule and the second composition molecule (as follows) of first and second ribozymes (inactivation) respectively.First and second ribozymes are the inactivations of inferring, and one of them or both can be by catalytic activity nuclei originis enzyme activations.Active first ribozyme can activate second ribozyme molecule of inactivation, and active second ribozyme can activate first ribozyme of inactivation to cause the amplification of the quantity of active ribozyme with positive feedback mode.In addition, first and second ribozymes can be fixing or spatially be separated from each other, and can cause that by nuclei originis enzymatic lysis one of them or both they are released in the medium.The free ribozyme that discharges can make fixed second freeization of ribozyme (for example by cracking), conversely, free second ribozyme discharges and makes first freeization of ribozyme, has so just caused from the amplified reaction cascade, and it produces the quantity amplification of active ribozyme rapidly with positive feedback mode.

According to another embodiment, catalysis system also can only comprise a kind of composition molecule, and this composition molecule is fixed or is separated from each other in reaction vessel, and perhaps, this composition molecule is the inactivation of inferring.Nuclei originis enzyme activation inactivation ribozyme or discharge ribozyme from the composition molecule, ribozyme active then or that discharge activates immobilized other ribozyme inactivation or free respectively, just caused then that from the amplified reaction cascade it produces the quantity amplification of active ribozyme rapidly with positive feedback mode.

Because the activation or the release of ribozyme have produced detectable signal, signal is indicated the existence of initial ribozyme in medium.

The first composition molecule-comprise first ribozyme (as follows), not essential ground mark also is connected with second nucleotide sequence (as follows).

The second composition molecule-comprise second ribozyme (as follows), not essential ground mark also is connected with first nucleotide sequence (as follows).

First nucleotide sequence-a kind of oligonucleotide sequence, it is the part of the second composition molecule, and is the catalytic activity target of first ribozyme (as follows).After the first ribozyme catalysis activity on first nucleotide sequence, second ribozyme (as follows) is discharged into medium or becomes catalytic activity.

Second nucleotide sequence-a kind of oligonucleotide sequence, it is the part of the first composition molecule, and is the catalytic activity target of second ribozyme (as follows).After the second ribozyme catalysis activity on second nucleotide sequence, first ribozyme (as follows) is discharged into medium or becomes catalytic activity.

The part of first ribozyme-first composition molecule-energy cracking first nucleotide sequence, and its catalytic activity and initial ribozyme are equal to.It is labeled not essentially.

The part of second ribozyme-second composition molecule-energy cracking first nucleotide sequence also is labeled not essentially.

The 3rd ribozyme-can the form ribozyme of the part of catalysis system according to another embodiment.The 3rd ribozyme is inactivation at first.Initial ribozyme works to activate the 3rd ribozyme by its catalytic activity of performance (in the mode that will explain below) on the 3rd ribozyme, and the activatory ribozyme can work with other the 3rd ribozyme in the activating catalytic system then.

The aggregate of re-reading system-oligonucleotide, Nucleotide, RNA polymerase and reagent makes the oligonucleotide transcript transcribe when oligonucleotide templates exists.

The 4th ribozyme-according to its embodiment is the ribozyme of a catalysis system part, this ribozyme so long as catalytic activity just can be in conjunction with two portions of the 5th ribozyme (as follows) the 5th ribozyme with the performance catalytic activity.The 4th ribozyme is made up of two portions at least, and they are isolating at first and link together by the 5th ribozyme (when being catalytic activity).After connect, the 4th ribozyme becomes catalytic activity.

The 5th ribozyme-be comprises the ribozyme of a part of the catalysis system of the 4th ribozyme, this ribozyme so long as catalytic activity just can be in conjunction with two portions of the 4th ribozyme the 4th ribozyme with the performance catalytic activity.The 5th ribozyme is made up of two portions at least, and they are isolating at first and link together by the 4th ribozyme.After connect, the 5th ribozyme becomes catalytic activity.

The specificity example of the 6th ribozyme-the 3rd ribozyme, wherein said inactivation ribozyme carry other nucleotide sequence and the cracking by this sequence or wipe out (promptly removing) activation.

The 7th ribozyme-wherein said determined nucleic acid sequence is finished (complete) ribozyme to the disappearance of its catalytic activity necessity part, and it is in case combine with sequence to be measured and just to become catalytic activity like this.

Summary of the invention

The invention provides a kind of signal amplification method based on ribozyme, this method operation is fairly simple, and cheap fast.Be different from operational up to now detection-amplification method, method of the present invention also is suitable for point-of-care (POC) test.

An advantage of method of the present invention is: ribozyme (as in biological fluid) under the condition that clinical setting is found is active therein.And then, as further showing below,, do not need to observe certain conditions (in the signal-amplification method of prior art, must strictly observe condition) according to signal-amplification method of the present invention in order to ensure specificity.In addition, be functional at various sample formulation mixtures (for example 1M guanidine thiocyanate and in saturated phenol preparation) ribozyme, said preparation mixture suppresses the function of other detection-amplification system usually.

Ribozyme is made up of nucleotide sequence, can be included in mensuration and probe sequence in the ribozyme molecule like this.And the specificity that increases amplification method by engineering operation ribozyme is possible, and the part of sequence self to be measured like this needs ribozyme to bring into play its catalytic activity.

Term can successfully apply to ribozyme has various catalytic activitys and characteristic with generation ribozyme as a kind of otherwise effective technique of " external evolution " in the art.By this technology, the many potential ribozymes of available screening active ingredients.Those show active ribozyme to be used for further selection purifying, after repeating several times, only stay candidate the most efficiently.In traditional amplification technique, after enzyme was selected, the environment of must modifying enzyme operating (medium that promptly comprises medicine) was so that enzyme has suitable activity.Under the situation of ribozyme, in external evolution, be that the ribozyme of high activity is possible by carrying out in its composition selection medium identical that external evolution is chosen in required clinical (biology) medium with clinical sample.

The invention provides a kind of sensitive method that is used for detecting catalytic activity ribozyme (" initial ribozyme " as referred to herein) at medium.Though the initial ribozyme of catalytic activity is as the reporter molecule of other biomolecules existence in the test sample usually, the detection self that the initial ribozyme of catalytic activity exists is a purpose.In case the medium that comprises the initial ribozyme of catalytic activity is imported according to catalysis system of the present invention, just cause the catalyzed reaction cascade, cause the index amplification of active ribozyme quantity thus.The ribozyme that is separated from each other on that catalysis system comprises inactivation or the space is so that they can not bring into play its catalytic activity; Initial ribozyme discharges or the ribozyme of activating catalytic system, and these ribozymes discharge respectively or other ribozyme of activation system conversely.The ribozyme that carries detectable mark or catalytic activity causes producing detectable mark, and this then mark conduct betides the catalysis cascade indication among the system.

According to ribozyme wherein is the embodiment of the present invention of initial fixation, can be used as detectable signal in the existence self of reaction medium middle reaches freestone enzyme.According to another embodiment, make each active ribozyme carry or produce detectable mark, then the detectable signal of these detectable marks.

According to method of the present invention very little false positive signal is arranged, i.e. low noise level, and also method of the present invention can make and detect several biomolecules become possibility in single mensuration system.

Like this, the invention provides a kind of method that is used for detecting in the initial ribozyme existence of medium catalytic activity, the method includes the steps of:

(a) provide catalysis system, this catalysis system comprises:

The catalysis inactivation of (aa) inferring or the space on restrictedly make them can not bring into play the ribozyme of its catalytic activity to target; The target of described ribozyme is other ribozyme of catalysis system, they to the catalytic activity of other ribozyme cause following both one of:

(i) ribozyme of activation inactivation,

(ii) on the Free up Memory restricted ribozyme so that it can contact their target;

At least some ribozyme of catalysis system is the target of nuclei originis enzymatic activity, and initial ribozyme is above-mentioned (i) or (ii) to the catalytic activity of said some ribozyme;

(ab) has the detectable label of detectable character so that the catalytic activity of ribozyme causes the variation of detectability matter;

(b) medium is contacted with said catalysis system;

(c) condition that provides initial ribozyme of the catalytic activity that makes said catalysis system and catalytic activity ribozyme to bring into play its catalytic activity, thus, the cascade that induces reaction of the initial ribozyme of the catalytic activity of existence, wherein the ribozyme of catalysis system is activated or is discharged in the medium;

(d) detect said detectability matter, the variation of said character is the indication that active initial ribozyme exists in said medium.

The main effectiveness of ribozyme detection method of the present invention is within the scope that is designed for the mensuration that the detection of biological molecule exists, and these biomolecules are as: the specific nucleic acid sequence in biological sample, in conjunction with link coupled member such as antibody-antigen, sugar-Sugar receptors etc.Conceptively can think that such mensuration comprises two distinguishing components (although these components can be included in the reaction vessel in fact together): detection system and catalysis system.In such mensuration, the existence of biomolecules to be measured causes that the initial ribozyme of catalytic activity produces according to the following mode that will further describe in medium.The initial ribozyme of catalytic activity produces detectable mark as the reporter molecule of catalysis system in reaction medium as described in usually after the reaction cascade of amplification active ribozyme quantity then.Like this, detectable mark in the medium of catalysis system, occurs and show the existence of biomolecules to be measured in initial biological sample to be measured.

Detailed Description Of The Invention

Make ribozyme have new purposes according to the present invention.On the widest meaning, the catalysis system that comprises ribozyme is used for detecting the existence at the initial ribozyme of testing medium catalytic activity.The detection self that the initial ribozyme of catalytic activity exists in testing medium is a purpose, for example, is preparing in the method for ribozyme by external evolution.In addition, according to an embodiment preferred of the present invention, the reporter molecule that the initial ribozyme of catalytic activity exists as biomolecules to be measured (but not initial ribozyme) in biological sample to be measured.

Can form by RNA fully according to the ribozyme that the present invention is used.Sometimes it also is possible replacing some Nucleotide (" rNTPs ") with some deoxynucleotide (" dNTPs ") or some other Nucleotide (as IsoG or IsoC 5-O-(1-thio triphosphates) Nucleotide and 5-O-methyl nucleotide) natural or that non-natural produces in RNA.Sometimes such replacement is desirable, for example, improves the stability of ribozyme to the rnase that almost all exists in all biological samples.Unless otherwise indicated, term " ribozyme " can be understood as be meant fully the catalysis Nucleotide formed by rNPS or wherein some rNTPs by the catalysis Nucleotide of dNTPs or the replacement of other Nucleotide.Ribozyme also can be formed (Breaker etc., chemistry and biology, 1 (4): 223-9,1994) by DNA fully.

Ribozyme of the present invention can be made up of the nucleotide sequence that non-nucleic acid molecule is compounded to form the above, wherein non-nucleic acid molecule such as protein, polypeptide, lipid acid, dyestuff, microbiotic or carbohydrate.Can be used as the active cofactor of ribozyme catalysis with the non-nucleic acid moiety of ribozyme compound.

Used term " oligonucleotide " below.Depend on context, oligonucleotide can be DNA oligonucleotide (being made up of dNTPs fully) or RNA oligonucleotide (being made up of rNTPs fully).Yet special under the situation of RNA oligonucleotide, it is desirable replacing some or all rNTPs with dNTPs or other Nucleotide natural and that non-natural produces sometimes.

The present invention provides in a broad sense and has been used for detecting the method that exists at the initial ribozyme of test(ing) medium catalytic activity." catalytic activity " refer to carry out catalyzed reaction (as cracking, montage, connection, specificity group (as phosphoric acid salt) be added in the molecule, the rearrangement of nucleotide sequence etc.) ribozyme.

Comprise two kinds of ribozymes according to the catalysis system that carries out embodiment of the present invention, they are the inactivations of inferring, but become catalytic activity as the effect of catalytic activity performance.For example, every kind of ribozyme is at its active necessary jagged or fracture of part.Before breach or fracture connection, need like this its activation.In this case, catalysis system comprises two kinds of ribozymes, and every kind of infer disconnected is two components, and initial like this is inactivation.A kind of active ribozyme connects two components of second kind of ribozyme, makes it have activity like this, and second kind of active ribozyme can connect two components of first kind of ribozyme, makes it have activity thus.Activate by amplifying the mode cross connection then with positive regeeration.

A kind of first catalysis ribozyme can produce with one of two lines by the initial ribozyme as the detection system product.According to article one route, some ribozyme of first kind is inferred be assemble fully but can not connect the part of second ribozyme because they spatially are isolating, for example, as result who is fixed by porous-film etc.The immobilized first kind of ribozyme molecule of assembling fully of nuclei originis enzymatic lysis, free then first kind of ribozyme connects second kind of ribozyme, and the latter connects member's (not assembling that these members infer) of first kind of ribozyme again conversely.

According to the second route, initial ribozyme is self to be the connection ribozyme that connects its part (in two kinds of ribozymes of catalysis system at least a), begins the cross connection cascade like this.In this case, do not need to separate the various members of catalysis system, just begin catalytic process because import reaction mixture up to initial ribozyme from the space.

Another example is the ribozyme with redundancy, and this redundancy makes the ribozyme inactivation, and cracking is wiped out so that the ribozyme activation like this.Another example is to need the sequence rearrangement or add the specificity group so that it has active ribozyme.Another example is the ribozyme that needs contrary exon montage (promptly adding ribozyme is inner sequence).

A kind of ribozyme can activate second kind inactivation ribozyme because it has the catalytic property (connection, cracking, montage, rearrangement etc.) that needs to modify other ribozyme from inactivation to activity form when activity form, vice versa.The catalytic activity (for example, two kinds all is to connect ribozyme or the both is a cracking ribozyme etc.) that two kinds of ribozymes can have same type potentially maybe can have dissimilar catalytic activitys.

One or both inactivation ribozymes of inferring can pass through catalytic activity nuclei originis enzyme activation.Before importing initial ribozyme to medium, catalysis system fundamentally is inoperative, because catalytic activity does not take place.In the presence of so initial ribozyme, beginning ribozyme amplification cascade is because every kind of active ribozyme produces more active ribozyme conversely with positive feedback mode.Active ribozyme produces the detection signal that can produce in the following manner, and such signal has been indicated the existence of the initial ribozyme of catalytic activity in the medium.

Comprise two kinds of combination molecules (composite molecules) according to another catalysis system that is used to implement embodiment of the present invention, every kind comprises the ribozyme that is connected with a kind of nucleotide sequence of cleavable.Nucleotide sequence in other kind of ribozyme cleavable combination molecule in a kind of combination molecule has also been avoided autothermic cracking simultaneously so that the intersection cracking between two kinds of combination molecules is possible in principle.Yet, before importing medium, initial ribozyme do not cause intersecting cracking, because make up the interaction of two kinds of combination molecules between them, the cracked ribozyme can interact with other combination molecule in the test chamber and discharge ribozyme with positive feedback mode in medium simultaneously.

Can stop by the whole bag of tricks to interact, for example, by every kind of combination molecule being fixed on the not ipsilateral of test chamber; By every kind of combination molecule and have stop be adsorbed onto one on the particle molecule and the different little different or different colloidal solids that are adsorbed onto interactional character between the molecule on another particle (for example size or other character, for example identical electric charge (globule is repelled mutually)) be connected; By combination molecule being connected with the part with identical charges so that the electrical charge rejection between the said molecule stops the interaction between any two kinds of combination molecules; By a relative side (porous-film does not allow full combination molecule by its infiltration, but allows the cracked ribozyme freely to pass through) that every kind of combination molecule is placed on porous-film.

Be present in the test(ing) medium of inferring or be present in specific nucleic acid sequence in one or both combination molecules in biological sample, discharge the ribozyme of catalysis system thus as the initial ribozyme cleavable of catalytic activity that another biomolecules (as ribozyme in this case) (reporter molecule of inferring) that exists produces.The cracked ribozyme can freely interact with the ribozyme freedom of other combination molecule in reaction vessel, and conversely, this is the ribozyme of first kind of combination molecule of cleavable again, has produced the cracking of ribozyme " the table tennis formula " intersection thus.Such intersection cracking of ribozyme is with the positive feedback mode effect, the substantial amplification that induces reaction.One of them or two kinds of ribozymes typically have detectable mark.The detection of cracked mark shows have an initial ribozyme of catalytic activity in reaction mixture.At initial ribozyme is report during ribozyme, and the detection of free label shows have biomolecules to be measured in reaction mixture.

According to other embodiment, catalysis system can only comprise a kind of inactivation ribozyme or a kind of comprise ribozyme and when change into free or during activity form by the combination molecule of ribozyme cracked nucleotide sequence.According to the similar mode of the described mode of above embodiment, each molecule of ribozyme was an inactivation before the initial ribozyme of catalytic activity imports medium: for example, the molecule of every kind of inactivation is the loop type of sealing, and this ring can or be wiped out nucleotide chain and open by catalytic activity nuclei originis enzymatic lysis.Then activatory (opening) ribozyme open and the activating catalytic system in the ring molecule of other such sealing.

With with the similar mode of the described mode of second embodiment, every kind of combination molecule can comprise directed localized ribozyme, this ribozyme stops the autothermic cracking (for example, by sequence being placed into the position with the ribozyme next-door neighbour) of contiguous cleavable nucleotide sequence.Between the sequence of ribozyme and cleavable, there is not the true stcarically of intervening sequence to suppress cis cracking (sequence of cleavable also can have contrary direction, and the cis cracking is exactly impossible like this).Yet, the ribozyme of release can with correct direction near and the cracking nucleotide sequence, and then in medium, discharge more ribozyme.In order to prevent the spontaneous cis cracking of non-release ribozyme, guarantee that aforesaid spatial isolation is possible.

The detection that the activation ribozyme exists in catalysis system depends on that the active type of ribozyme catalysis can take various forms.For example, in the active cracking or the place of wiping out, mark can be connected to part cleaved or that wipe out, and the detection of the mark that discharges like this is the indication that the initial ribozyme of catalytic activity exists in medium then.

In some cases, the activation of ribozyme changes the distance between two districts of ribozyme, as the district that distance arranged at two by connecting or reset, wipe out and interleave the place of distinguishing together, or wherein two initial contiguous districts by as the isolating place of opening of Closed loop.In this case, might adsorb fluorescent mark on district of ribozyme and part, fluorescently-labeled light activated Rodamine is gone up in another district as the cancellation ribozyme.Rodamine has quenching effect to fluorescently-labeled optical excitation when both are vicinity, does not then have this effect when both separate.Change by monitoring fluorescently-labeled optical excitation, might determine two districts whether be contiguous (as under the situation of the ring inactivation ribozyme of sealing) or isolating (when ribozyme be opened and the activatory situation under).

Mark also can be the discord ribozyme in conjunction with and also thereon the catalytic activity ribozyme can bring into play on the substrate of its catalytic activity and carry out.For example, mark can carry out on or the nucleotide sequence wiped out cleaved as the result of ribozyme activity, thus mark is released into medium.Detection is the existence by free mark in the medium in this case.

The intersection of " the table tennis formula " activation (whether by intersect cracking, cross connection, crosscut, intersection is reset or the alternative circulation of various katalysis) enlarged reaction in fact, formation shows the indication whether initial catalytic activity ribozyme exists at short notice in medium.Prior art amplification detection method such as PCR or LCR finish need several hrs in, amplification detection method of the present invention was finished in the time of much shorter.

In the place of the initial ribozyme of catalytic activity as the report ribozyme of other biomolecules existence, need such detection system, wherein the initial ribozyme of catalytic activity only produces in the presence of biomolecules to be measured.This can carry out in one of following embodiment, in this article as " activation embodiment ", " transcribing embodiment ", " assembling embodiment " and " finishing embodiment ".

According to the activation embodiment, it is inactivation that initial (reporter molecule) ribozyme is inferred.This inactivation can be the result who lacks magnesium ion in the medium, and magnesium ion needs the catalytic activity of ribozyme; This also can be to have the result who suppresses part in medium; This also can be result of having oligonucleotide in medium (this oligonucleotide and cleavedly be discharged into the hybridization sequences of system with activation or ribozyme, wherein just can not carry out as long as sequence is double-stranded cracking) or the like.According to this embodiment, ribozyme with can be specifically with sample in biomolecules identification to be measured and bonded discern biomolecules and be connected.For example, be the place of oligonucleotide sequence in biomolecules to be measured, the identification biomolecules is a complementary sequence; In biomolecules to be measured is the place of enzyme, and the identification biomolecules can be a substrate; In biomolecules to be measured is antigenic place, and the identification biomolecules can be specifically with the antibody of AI etc.

Make then and discern ribozyme and the bio-molecular interaction to be measured that molecule is connected, then separate and the unconjugated ribozyme of flush away.Such separation can by in conjunction with the difference of the size between the mixture of the mixture of ribozyme and biomolecules to be measured and free ribozyme by the biomolecules fixing to be measured of inferring then dissociate ribozyme molecule etc. of flush away carry out.At said after separating, the change condition for example, is added the magnesium ion that lacks with the activation ribozyme; Suppress part to stop its inhibition activity by modifying or removing; But by sequence into the strand cleavable etc. that double-stranded non-cleavage sequence is unwind.Only when biomolecules to be measured exists, kept the bonded ribozyme, only the ribozyme of these reservations is by suitable condition changing activation.

The embodiment of transcribing of the present invention can be the place use of nucleotide sequence in biomolecules to be measured.The detecting stage of this embodiment usually can as Israel's patent application 105894 and 111857 (its corresponding PCT application WO 94/29481 and _ _ _ _) described carrying out, wherein " triggering oligonucleotide " is said initial ribozyme.The detection system of this embodiment comprises two kinds of oligonucleotide molecules: first kind of 5-part complementary sequence that comprises with nucleotide sequence to be measured, second kind of 3-part complementary sequence that comprises with nucleotide sequence to be measured.First kind of oligonucleotide molecules comprises and the sequence of the upstream of biomolecules complementary sequence to be measured, function on, the initial ribozyme of coding and can be by said detection ribozyme cracked sequence (fundamentally being dna sequence dna).Second oligonucleotide molecules comprises with the downstream of sequence 3-complementary sequence to be measured, triggers oligonucleotide templates, transcription product (can trigger transcribing of nuclei originis enzyme sequence, with detailed explanation hereinafter).

If in test sample, there is not biomolecules to be measured, just do not transcribe the triggering oligonucleotide sequence, need two kinds of molecules contacts of the suitable template of the said triggering oligonucleotide of generation because have only the existence of biomolecules to be measured just can make: promptly carry first oligonucleotide molecules of function on and carry second oligonucleotide molecules that triggers oligonucleotide templates.If biomolecules to be measured exists, when re-reading system exists, produce and trigger sequence, can produce the transcript that comprises with the initial ribozyme that can cleaved sequence be connected conversely.After autothermic cracking, these transcripts are released in the medium of the initial ribozyme of catalytic activity.

According to assembling embodiment of the present invention, in biomolecules to be measured is that the place of nucleotide sequence also is suitable for, and detection system comprises the 3rd oligonucleotide (5-that comprises with determined nucleic acid sequence divides the complementary sequence) and the 4th oligonucleotide sequence (comprising and nucleotide sequence rest part to be measured (3-part) complementary sequence).Every kind of such oligonucleotide also comprises the part (for example, half) of ribozyme, and two portions constitute active ribozyme total length, functional jointly.According to this embodiment, the function of determined nucleic acid sequence is to make this two kinds of oligonucleotide contacts, produces the initial ribozyme of functional activity like this.Like this, when having determined nucleic acid sequence in sample, just produce the initial ribozyme of function, the latter can detect in catalysis system of the present invention.

According to the embodiment of finishing of the present invention, detection system comprises the 7th oligonucleotide, sequence to be measured, the initial ribozyme of production catalytic activity and mixture the 7th oligonucleotide.For example, sequence to be measured can form the part of ribozyme catalysis core.Like this, according to this embodiment, it is incomplete inferring ribozyme, and only in the presence of sequence to be measured, it has just become completely, the catalytic activity ribozyme, and the latter can detect in catalysis system.

Sequence to be measured also can be by finishing ribozyme at its 3-end with one side hybridization of ribozyme disappearance part and by its 5-end and the other side hybridization of ribozyme disappearance part, like this with regard to bridge joint the disappearance part to produce functional initial ribozyme.

Sequence to be measured also can be finished the disappearance part of ribozyme by " contrary exon montage ", wherein said sequence to be measured is inserted in the ribozyme by suitable cracking and ligation.Said " contrary exon montage " can be undertaken by other ribozyme that is present in the medium.

For " noise " level that reduces method of the present invention and reduce false positive results, guarantee that with dual it is possible not producing the initial ribozyme of catalytic activity under the situation that no biomolecules to be measured exists in conjunction with two or more embodiment of the present invention.For example, possible assembling of the present invention and activation embodiment bonded, but the catalytic activity ribozyme only produces as the result of two kinds of accumulation conditions: full ribozyme is from its two-part assembling in the less mixture of magnesium, after the free incomplete ribozyme of flush away, full ribozyme is by adding the magnesium ion activation.

Used ribozyme in most of the cases is general in most of embodiments of detection system of the present invention, be that identical ribozyme can be used for detecting different biomolecules to be measured, because pass through the identification biomolecules (in the activation embodiment) of absorption, or need specificity by first and second oligonucleotide molecules (in transcribing embodiment) or by third and fourth oligonucleotide sequence (in the assembling embodiment).Under the situation of finishing embodiment of the present invention, must make the 5th oligonucleotide to be fit to every specific specificity nucleic acid to be measured, because discern the part that the sequence of sequence to be measured is a ribozyme self.

The present invention also provides the test kit that carries out the required reagent of aforesaid method and comprise said reagent.

Below with reference to some unrestricted drawings and Examples the present invention is described:

Used various symbols in the accompanying drawings, they have following meaning in the context of the present invention:

Straight line (_ _ _ _ _ _)-the DNA chain

Wave-like line (￣ ￣)-RNA chain

A, B, C, etc..-sequence in the dna encoding chain

A, B, C, etc..-sequence in complementary noncoding DNA chain

A, b, c, etc..-RNA sequence

A, b, c, etc.-and a, b, c complementary RNA sequence

Be fixed on the solid support

* detectable mark

Suppress part.

Accompanying drawing is briefly described

Fig. 1 has shown the catalysis system embodiment that comprises two kinds by intersection cracking activatory combination molecule of the present invention;

Fig. 2 (a) and 2 (b) have shown the catalysis system according to embodiment of the present invention, and this system comprises a kind of by intersecting cracking or crosscut activatory combination molecule: wherein said ribozyme is closed circular form (Fig. 2 (a)); Wherein said ribozyme needs montage just to become active (Fig. 2 (b));

Fig. 3 has shown the variety of way that combination molecule can be separated from each other: by being fixed to the obvious site (3A) of reaction vessel; By being connected (3B) with big pearl; By being connected (3C) with charged part; By every kind of combination molecule being placed on the relative side of porous-film;

Fig. 4 has shown the example according to the detection system of activation embodiment of the present invention, and wherein said ribozyme is by adding the magnesium ion activation;

Fig. 5 demonstration is known clearly according to another example of the detection system of activation embodiment of the present invention, and wherein said ribozyme is by suppressing the modification activation of part;

Fig. 6 has shown the detection system of transcribing embodiment according to of the present invention;

Fig. 7 (a) and 7 (b) have shown the detection system according to assembling embodiment of the present invention; The wherein recognition sequence of ribozyme and determined nucleic acid sequence hybridization (Fig. 7 (a)); Or the sequence hybridization to be measured of the stemp-II that opens of ribozyme (figure (b)) wherein;

Fig. 8 has shown the example that comprises two kinds by the catalysis system of cross connection activatory ribozyme of the present invention;

Fig. 9 has shown another example according to the detection system of activation embodiment of the present invention, and wherein said ribozyme is by providing the activation of cleavable single stranded sequence.

Figure 10 has shown that the stem-II that comprises Fig. 7 (b) opens the cracking result of the detection system of ribozyme;

Figure 11 has shown the cracking result of the catalysis system of the Closed loop combination molecule that comprises Fig. 2 (b);

Figure 12 has shown the cracking result of ribozyme in the presence of untreated blood and denaturing agent.

The description of particular

Catalysis system

At first with reference to the Fig. 1 that shows the mode that makes up catalysis system of the present invention.Catalysis system comprises two kinds of combination molecules 10 and 11.Combination molecule 10 comprises the mark ribozyme (this ribozyme is named into ribozyme A (12)) that a class is connected with the RNA sequence of naming to b (13).Combination molecule 11 comprises another kind and names mark ribozyme and RNA sequence a (15) into B (14).The sequence b of ribozyme B energy cracking in molecule 10 in molecule 11, the ribozyme A in molecule 10 can the sequence a of cracking in molecule 11. Initial molecule 10 and 11 can not interact, because each all is fixed on the different loci of reaction vessel.The sequence b of initial ribozyme 16 in also can cracking molecule 10.

If initial ribozyme is present in the reaction mixture, sequence b is cleaved, discharges free ribozyme A (12) to reaction mixture.Free ribozyme A (12) can disperse in reaction vessel with cracking molecule 11, discharges free ribozyme B (14) to reaction mixture like this.Free ribozyme B (14) also can discharge free ribozyme A (12) once more by the reaction vessel migration with cracking molecule 10, and circulation repeats one after another with positive feedback mode.Because ribozyme A and B are labeled, one of them or boths' detection shows have initial ribozyme 16 in reaction mixture in supernatant liquor.

Be the example of molecule 10 that comprises the ribozyme 12 of the tup type that is connected with sequence 13 below, then 3 '-end is with biotin labeling sequence 13:(capitalization: 2 '-O-is methylated; Lowercase: RNA)

5′CCA?cugauga?gGCC?GAAA?GGCc?gaa?acGUguc?CGU?AAA-

Be below comprise can cracking the example of molecule 11 of ribozyme 14 of another kind of tup type of sequence 13 in the molecule 10.Ribozyme 14 with can be connected by ribozyme 12 cracked sequences 15, then the molecule of ribozyme 12 its 3 '-end uses biotin labeling: (capitalization: 2 '-O-is methylated; Lowercase: RNA)

5′-GAG?ACG?cugauga?gGCC?GAAA?GGCc?gaa?acAC?guc?UGG?AAA

Although ribozyme A and B be as different ribozymes, sequence a and b be as different sequences, and two kinds of ribozymes and sequence are actually and are equal to.In this case, the autothermic cracking of molecule 10 or 11 in each can by the adsorbed sequence in ribozyme and it with quite near so that can not be connected with cis mode cracked distance and avoid, and free ribozyme can trans cracking combination molecule.This can by ribozyme with its potentially the sequence of cleavable and then be connected and finish.This be because ribozyme Ying Yuqi potentially the sequence of cleavable separate to produce effective cracking by several Nucleotide.Therefore, when and then the ribozyme in combination molecule directly is connected with the sequence of cleavable, only can be the time with trans cracking, can not be with the cis cracking, sequence only can be by trans cracking.

Fig. 2 (a) referring now to the another kind selection that is presented at the place that only has a kind of combination molecule in the reaction vessel.Catalysis system comprise a kind of molecule 17 ', every kind of sequence C ' (19 ') that comprise ribozyme C ' (18 ') and cleavable.Molecule 17 is with the cyclic form of sealing, and such ribozyme is inactivation at first.

" be present in the medium, if its cleavable sequence c ' also opens ribozyme that it is become is active the initial ribozyme 16 of catalytic activity.Opening ribozyme 18 can open other combination molecule 17 and they are become active by cracking again conversely.Detection can be undertaken by using fluorescent mark (F) and Rodamine (Rd).When both when in the ring of sealing, being adjacent, with regard to cancellation fluorescently-labeled optical excitation, when being isolating in the molecular sequences that they are being opened, fluorescently-labeled optical excitation becomes stronger.

With reference now to demonstration, the Fig. 2 (b) that comprises only a kind of another selection of catalysis system of combination molecule.Ribozyme 17 " has extra nucleotide sequence 18 " in its core area, it makes the ribozyme inactivation.End in extra sequence is a blocking groups 19, and it can not spontaneously connect the end of opening.

Have the extra sequence 18 and the blocking groups 19 of initial ribozyme 16 cleavables of montage catalytic activity, can connect free-end then to produce the function ribozyme.Then, but other ribozyme in the function ribozyme montage reaction medium, and the amplification that induces reaction.Detection according to a kind of selection (selecting 1) is carried out shown in Fig. 1 (a) substantially.But in this case, the Rodamine (Rd) in fluorophor (F) separately, only the activation by ribozyme makes them become contiguous at first, so that active ribozyme can detect by light activated cancellation.According to the second way that detects (selecting 2), the group of wiping out that comprises free additional sequences 18 and blocking groups 19 carries detectable mark.

The advantage of the mode of Fig. 2 (b) is very low " noise " level, because become for the inactivation ribozyme is spontaneous active (in the presence of initial ribozyme, not becoming activity), two spontaneous incidents (occurrences) must take place spontaneous cracking (under the temperature of physiology ph and 37 ℃ in 10mM MgCl with 10 ^-6/ minute probability) and spontaneous connection (with 10 ⁷/ minute probability) produce the spontaneous activation (10 of low-down probability ¹³/ minute).

Be adsorbed onto ribozyme A, the mark (Fig. 1) of B or C one of them or two kinds can be any detectable mark known in the art, as radio isotope, fluorescent mark, can produce the enzyme of color reaction etc. in the presence of substrate.

Fig. 3 has shown variety of way, and two kinds of combination molecules 10 and 11 of wherein having placed said first embodiment interact avoiding, but allow free ribozyme 12 and 14 and combination molecule between interact.Be understood that identical principle applicable to alternate manner to make up catalysis system of the present invention, promptly in Fig. 2, set forth at a kind of combination molecule where.

Molecule 10 and 11 is fixed on the different and isolating site of reaction vessel in Fig. 3 (A), and ribozyme 12 and 14 is dispersed in the reaction mixture freely simultaneously.

Fig. 3 (B) has shown the molecule 10 and 11 that is fixed on the globule 19, and the size of globule has stoped the interaction between the said molecule.Yet free ribozyme 12 and 14 can be dispersed in the reaction mixture and with the combination fixed member freely and interact.

Fig. 3 (C) has shown another example of isolating combination molecule, and wherein combination molecule 10 and 11 is adsorbed on the charged part with identical charges 37.Electricity between the adsorbed part repels has eliminated interactional possibility between molecule 10 and 11.Yet not charged basically free ribozyme 12 and 14 can interact with combination molecule.

Fig. 3 (D) has shown by combination molecule 10 and 11 being placed on as the opposite end of the porous-film 34 of molecular sieve and blocking passing through of macromole 10 and 11 and allow less free ribozyme 12 and 14 by with their another example separately simultaneously.

Guarantee that two kinds of combination molecules 10 and 11 noninteracting another modes are that blocking agent molecule and specific sequence complementation make it become two strands by use blocking agent molecule.In this manner, combination molecule 10 comprises the blocking agent molecule, and it makes the part of the catalytic domain of the sequence B of cleavable and ribozyme A become two strands.In partially double stranded combination molecule 10, because the ribozyme catalysis district is the double-stranded fact, it is not active.Molecule 11 is made up in sealing in a similar fashion.If initial ribozyme is present in the reaction mixture, it demonstrates a part that is present in the blocking agent in the combination molecule 10, then starting molecule cleavable sequence b.In case after molecule b was cleaved, ribozyme had also just had activity,, make its catalytic domain become strand and active because part is replaced the activity that the blocking agent molecule has reduced combination molecule 10 fully.Active ribozyme is to replace the blocking agent molecule of combination molecule 11 with the identical mode of the above then, and the sequence a of cracking cleavable also changes ribozyme b into strand and active.Ribozyme b can carry out the intersection activation of two kinds of combination molecules with that to activate combination molecule 10 with the similar mode of above-described nuclei originis enzyme activation then.

Referring now to the Fig. 8 that shows another selection that makes up catalysis system of the present invention.Catalysis system comprises two kinds of ribozymes 80 and 81, and they are active after assembling fully, but ought be separated into its part 80a, 80b respectively and 81a, 81b are inactivations.Full ribozyme 81 can connect ribozyme part 81a and 81b to produce total length and active ribozyme.Full ribozyme 81 can connect ribozyme part 80a and 80b producing total length and active ribozyme 80, so that can intersect activation by cross connection.

Initial ribozyme 86 or 86 can by from site cracking total length but the fixed ribozyme (wherein it and ribozyme part 81a and 81b are that part is isolating, for example, with one of specified mode in Fig. 3 (left part on Fig. 8)) or by can connection portion 80a and 80b produce total length and active ribozyme 80 with what form total length with active ribozyme 80 (right part on Fig. 8).

Detection system

Be used to help detect the place of the biomolecules of non-ribozyme in method of the present invention, the present invention also comprises a kind of detection system that only can produce the initial ribozyme of catalytic activity when testing molecule exists.

Fig. 4 has shown an example of activation embodiment of the present invention.In this example, biomolecules to be measured is fixed nucleotide sequence A (41), for example, and dna sequence dna.Fixing available any method known in the art is carried out, and for example, is catching nucleic acid molecule to be measured under the help of cross connection agent or between by two porous-films that small molecules is passed through.In biomolecules to be measured is proteinic place, can be fixed to it on the globule that carries suitable trapping agent (as the suitable fixed antibody that instructs the anti-zone that need not detect etc. etc.).In addition, biomolecules to be measured can be fixed on the nitrocellulose filter, and for all empty positions on the saturated film and avoid non-specific absorption at next step, another kind of protein (as albumin) should be administered on the nitrocellulose filter.

Detection system also comprises and contains the sequence c (44) that is connected to cleavable and can also be comprised and sequence A to be measured (41) complementary sequence a (45) by first compound molecule 42 of active ribozyme cracked ribozyme 43.Ribozyme 43 is autothermic cracking not, eliminates in the less reaction mixture of the active magnesium of ribozyme catalysis because molecule 42 remains on.This can pass through, and for example, compound molecule 42 is remained in the less reaction mixture that contains EDTA of magnesium carry out.

The example of ribozyme 43 and the cleavage sequence c (44) of hammerhead shape are connected that (capitalization: 2-O-is methylated; Lowercase: RNA; Emphasize and underscore arranged: DNA) 5- GCAACAGTGGAGGAAAGCCUACguc UGG UACGU CCA cugaugagGCC GAAA GGCc gaa acGUAGU AAA

Make molecule 41 and 42 hybridization to produce fixed heterozygote 46.Flush away free molecule 42 adds the magnesium ion that concentration is enough to activate ribozyme to fixed heterozygote 46.In the presence of the magnesium ion of such concentration, ribozyme 43 cleavable sequence c are discharged into oneself it in the reaction mixture like this and stay fixed cracking heterozygote 47.In catalysis system, ribozyme 43 free and catalytic activity can be used as initial ribozyme.

Fig. 5 has shown another example of activation embodiment of the present invention.Fixing as mentioned above the biomolecules to be measured 51 that comprises nucleotide sequence A (for example dna sequence dna).Detection system comprises second compound molecule 52 that contains the ribozyme 53 that is connected to sequence c (54), and wherein sequence c can be sequence a (55) cracking by catalytic activity ribozyme and the sequence a complementation in biomolecules to be measured.Compound molecule also comprises and suppresses part 58, and it suppresses the catalytic activity of ribozyme 53 when existing with the form of its unmodified.The example that suppresses molecule is a part of complementary nucleotide sequence with ribozyme.In the presence of such sequence, ribozyme is folded into the three dimensional form of inactivation.

Make molecule 51 and 52 hybridization to produce fixed heterozygote 56.Flush away free molecule 52.Add the modification material to isolating heterozygote 56, this modification material can interact with inhibition part 58 and it is modified into non-inhibition form.For example, suppress part be can cause ribozyme folding the place of nucleotide sequence, modify material and can be and suppresses part complementary sequence, it with suppress part hybridization and blocking-up inhibition part, make refolding become its activity form like this.In addition, modifying material can be can remove or cracking suppresses part to stop its inhibiting material.Then active ribozyme cleavage sequence c, like this self is discharged from immobilized cracking heterozygote 57.The free ribozyme 53 of catalytic activity is as the initial ribozyme of catalysis system then.

Fig. 9 referring now to another example that shows activation embodiment of the present invention.Molecule 91 comprises the sequence of initial ribozyme 90, and this sequence is adsorbed onto and can and can hybridizes on (for example being the dna sequence dna to be measured of molecule 94) sequence a and the b with biomolecules to be measured by ribozyme cracked sequence c.Molecule 91 also comprises the blocking agent dna sequence dna 92 that contains sequence B and C, and sequence B and C can be hybridized to produce duplex structure with the sequence b and the c of molecule 91 respectively.Blocking agent dna sequence dna 92 connects via joint sequence 93.Ribozyme 90 can not cleavage sequence c because its sequence area be double-stranded (by with 92 hybridization of blocking agent sequence).

Then testing molecule 94 is imported in the reaction mixture.If a of biomolecules to be measured and molecule 91 and the complementation of b sequence, blocking agent molecule 92 is replaced to produce heterozygote molecule 95 by testing molecule 94 then.In heterozygote molecule 95, cleavage sequence c is a strand, it make ribozyme can cracking it, be released in the reaction mixture as catalytic activity ribozyme 96 like this, this ribozyme 96 in catalysis system as initial ribozyme.

Condition such as temperature according to this embodiment, the length of the part of double-stranded identification biomolecules b etc. must be noted that to be selected so that basically only when biomolecular sequence A to be measured and B preferably are complementary with recognition sequence a and b, testing molecule can be replaced blocking agent molecule 92.

Be applicable to that referring now to demonstration biomolecules is Fig. 6 that transcribes embodiment of the detection system of the present invention of nucleotide sequence.According to this specific embodiment, the correct dna profiling that initial ribozyme is transcribed only assembles from its part in the presence of determined nucleic acid sequence.It fundamentally is first oligonucleotide molecules 61 of DNA that detection system comprises, it from 3 ' → 5 ' comprise; The sequence R of double stranded promoter, the initial ribozyme complementary sequence of coding, coding can be by 5 ' part complementary sequence D of the sequence C of catalytic activity ribozyme cracked sequence and nucleotide sequence to be measured ₁Detection system also comprises it fundamentally being first oligonucleotide molecules 61 of DNA, it from 3 ' → 5 ' comprise: and 3 ' part complementary sequence D of nucleotide sequence to be measured ₂And triggering oligonucleotide templates (TRIG).If determined nucleic acid sequence 63 exists, under suitable hybridization conditions, the sequence D of molecule 61 ₁Sequence D with molecule 62 ₂Respectively with the sequence D of determined nucleic acid sequence ₁' and D ₂' hybridization is to produce heterozygote 64.

In the presence of re-reading system, produce non-template chain oligonucleotide, it from 3 ' → 5 ' comprise: trigger oligonucleotide sequence trig, d ₂' and d ₁' sequence, respectively with the nucleotide sequence and the initial ribozyme complementary sequence c ' r ' of cleavable.

Add the molecule of the sub-construct 66 of reverting starting in reaction mixture, this molecule comprises and can trigger the single stranded DNA promotor that sequence that sequence TRIG hybridizes is connected with oligonucleotide.Under suitable condition, sub-construct 66 of reverting starting and molecule 65 hybridization are to produce heterozygote 67.In the presence of archaeal dna polymerase, synthetic fully (complete) strand promotor is to produce functional double stranded promoter in heterozygote 68.

In the presence of transcript reagent, heterozygote 68 can be used as the template of final oligonucleotide transcription product 69, and it comprises from its 5 ' end: nuclei originis enzyme sequence r and can be by the sequence c of said ribozyme cracked cleavable.

The sequence c of ribozyme r cracking cleavable discharges himself form with free ribozyme in the surrounding medium like this.Free ribozyme 70 can be as the initial ribozyme of catalytic activity in catalysis system.

A kind of mode of assembling embodiment of the present invention shows in Fig. 7 (a).Detection system comprises and contains nucleotide sequence A ₁A ₂Biomolecules to be measured 71.In addition, the detection system part that comprises ribozyme 72 (comprises and sequence A ₁Complementary oligonucleotide sequence a ' ₁) and the part of other ribozyme 73 (comprise and sequence A ₂Complementary oligonucleotide sequence a ₂').If the full ribozyme of the common formation of the part of ribozyme 72 and 73 assembling.

If testing molecule 71 is present in the medium, it can with the part a of ribozyme ₁-72 and a of ribozyme ₂The hybridization of-part makes two portions form function ribozyme-sequence heterozygote 76 to be measured jointly, and it can be as initial ribozyme (for example, by cracking molecule 77) in catalysis system, and wherein cracking may need initial amplification cascade in catalysis system.

The another kind of mode of assembling embodiment of the present invention shows in Fig. 7 (b).

Make up the ribozyme 79 of tup type, wherein stem-II is shortened the remainder (being opened to produce arm a and b) only to have a kind of complementary nucleotide (representing by a line) and stem in Fig. 2 b.Ribozyme 79 energy and sequence 70 hybridization are finished catalytic activity (for example, the cracking of sequence 70) then to form stem I and III.Yet the sequence 70 that the ribozyme 79 of inferring can not the cracking cleavable is because its stem-II is open and inactivation.The arm a and the b of the core of opening with the sequence A and B (as the dna sequence dna 80) complementary of sequence to be measured have been made up.

In the presence of dna sequence dna 80 to be measured, the arm a of stem-II ribozyme 79 and the hybridization of b and sequence to be measured are to produce complete double-stranded stem-II, like this ribozyme just become catalytic activity and as the initial ribozyme in the catalysis system, for example, the sequence 70 of cleavable is to need cracking to reach the part of the enzyme in its active catalysis system.

Embodiment

Embodiment 1: use the ribozyme with open stem-II to detect nucleotide sequence to be measured

Ribozyme HH8 is cut into two portions in the ring of stemp-II.Half every part of two kinds of ribozymes (HH8-3 and HH85) of HH8 has additional 17 the base tailer sequences different with LAMTAR0 DNA target molecule complementary.When target exists, lump together two to form active ribozyme.In the LAMTAR0 target and two kinds of sequences of the two halves complementary of ribozyme are successive.At other LAMTAR molecule (LAMTAR1 is to LAMTAR4), two kinds of sequences are separated by 1 to 4 non-complementary base respectively.The ribozyme substrate is the SB8-24 that comprises by the sequence of HH8 identification.

(a) method:

1. sequence:

The scheme synthetic oligodeoxynucleotidecombination of on the 381A of applying biological system dna synthesizer, recommending according to manufacturer.It is synthetic to use Ampliscribe test kit (Epicenter Technologies) to be used for all RNA, [α ³²P] UTP[3000Ci/mmol] buy from Rotem Industrial Co., Ltd (Israel).

The DNA target:

LAMTAR0：5′GCTCCG AGTCCACCTGCACGCCGACCAGTGCCGTGTTCGGGA?3′

LAMTAR1：5′GCTC CGAGTCCACCTGCACGCT CGACCAGTGCCGTGTTCGGGA?3′

LAMTAR2：5′GCTC CGAGTCCACCTGCACGCTT CGACCAGTGCCGTGTTCGGGA?3′

LAMTAR3：5′GCTC CGAGTCCACCTGCACGCTAT CGACCAGTGCCGTGTTCGGGA?3′

LAMTAR4：5′GCTC CGAGTCCACCTGCACGCTATA ACGACCAGTGCCGTGTTCGGGA?3′

Underscore-and half complementary sequence of ribozyme;

The sequence that black matrix-complementary is other.

The rna transcription thing:

SB-24 (substrate of HH8): 5 ' GGUCACAAUGUCGGUCGAGUUCCA 3 '

HH8-3 (ribozyme half): 5 ' GGCGACCCUGAUGAGGCC GCGUGCAGGUGGACUCG3 '

HH8-5 (ribozyme half): 5 ' G GAACACGGCACUGGUCGGGCCGAAACAUUAA 3 '

Underscore-and target complementary sequence.

2.RNA preparation:

According to above-mentioned (1) synthetic DNA oligonucleotide.By electrophoresis on 15% polyacrylamide 7M urea gel, UV-shadowed and in 0.5M Tris-Cl, 0.1%SDS and 0.1mM EDTA under room temperature the wash-out above-mentioned oligonucleotide of purifying that spends the night.With the DNA of the 3M sodium-acetate of 0.1 volume and 3 volume of ethanol precipitation wash-out, and make it to be suspended in again among 1mM Tris-Cl (pH-7.0) and the 0.1mM EDTA ,-20 ℃ of preservations up to use.By 95 ℃ of incubations 15 seconds and under 70 ℃, 60 ℃, 55 ℃, 50 ℃, 45 ℃, 40 ℃ and 37 ℃ of every kind of temperature incubation made the oligonucleotide of purifying be annealed into the sub-oligonucleotide of 20mM complementary non-template T7 rna polymerase promoter (TAA TAC GAC TCA CTA TAG G) in 5 minutes.Responsive transcription mixture (50ml) comprises 2mg annealed DNA, 1 * reaction buffer, 10mM dithiothreitol (DTT), 2mMATP, CTP and GTP, 1mM UTP, 25mCi[a ³²P] UTP and 1.1mM MgCl ₂Mixture 37 ℃ of following incubations 1 hour and 80 ℃ of following incubations 5 minutes with the enzyme that deactivates.RNA precipitation as described.Transcript is by electrophoresis purifying on 15% polyacrylamide 7M urea gel.RNA is by radioautograph location and wash-out as described.The RNA of wash-out precipitation as described is suspended among 0.1 * TE and counting in flicker plate (Luma LSC) again.

3. scission reaction:

Reaction (10ml) is usually at 0.5pmol ribozyme, 50mM Tris-Cl (pH-7.5), 1mMEDTA (pH-7.5), 0.05%SDS and 30mM MgCl ₂Carry out under existing.In order to eliminate other RNA conformation (it can form) between-20 ℃ of preservation perives, be reflected at 95 ℃ of following preincubation 1 minute.Be reflected at 37 ℃ of following incubations 1 minute and comprise the dyeing solution of 10M urea and 10mM EDTA and place on ice and stop by interpolation.Sample 80 ℃ of following sex change 5 minutes and on 15% polyacrylamide 7M urea gel electrophoresis.

(b) result:

The result of polyacrylamide gel electrophoresis as shown in figure 10.The ribozyme of no target does not produce appreciable cracking.Add and to have caused the cracking that increases behind the target.The amount that increases is maximum in the LAMTAR4 ribozyme of being tested.

Embodiment 2 comprises the catalysis system of Closed loop combination molecule

SLS-precursor ribozyme (Rz) is the annular Rz with long stemp-II of 11 bp.Two identification arms are connected to separate them with extra cracking base in tandem.Therefore this ribozyme non-activity, but as the template of active ribozyme.In case after cleaved, the open to the outside world ribozyme becomes active (showing as Fig. 2 (b) diagram).For must there be initial ribozyme in initial catalysis system.At 37 ℃ of following 30mM MgCl ₂The spontaneous cracking of middle RNA is with per minute per 10 ⁶The speed of individual molecule takes place.Become active and can be used as initiator at the spontaneous cracked of cracking site annular ribozyme.

(a) method

1. sequence:

The scheme synthetic oligodeoxynucleotidecombination of on the 381A of applying biological system dna synthesizer, recommending according to manufacturer.It is synthetic to use Ampliscribe test kit (Epicenter Technologies) to be used for all RNA, [α ³²P] UTP[3000Ci/mmol] buy from Rotem Industrial Co., Ltd (Israel).

The RNA precursor (SLS ' s) sequence is: 5 ' GGU CAG CAG UCG AA[identification arm I] X[identification arm III] CUG AUG AGA CUG CUG ACC A 3 '.

The SLS password	Identification arm I	Identification arm III	Cracking site
				????107	????CGCG	????AAUU	????A/U
????108	????CUAG	????AAUU	????A/U
				????113	????UAUA	????AAUU	????A/U
????115	????UGCA	????AAUU	????A/U

????208	????CUAG	????ACGU	????A/U
				????213	????UAUA	????ACGU	????U
????215	????UGCA	????ACGU	????A/U
				????313	????UAUA	????AGCU	????A/U

2.RNA preparation

The preparation of RNA is carried out as described in above-mentioned embodiment 1.

3. spontaneous scission reaction:

Reaction (10ml) is usually at 0.5pmol ribozyme, 50mM Tris-Cl (pH-7.5), 1mMEDTA (pH-7.5), 0.05%SDS and 30mM MgCl ₂Existence is carried out.In order to eliminate other RNA conformation (it can form) between-20 ℃ of preservation perives, be reflected at 95 ℃ of following preincubation 1 minute.Be reflected at 37 ℃ of following incubations 1 minute and comprise the dyeing solution of 10M urea and 10mM EDTA and place on ice and stop by interpolation.Sample 80 ℃ of following sex change 5 minutes and on 15% polyacrylamide 7M urea gel electrophoresis.

(b) result:

The result of polyacrylamide gel electrophoresis as shown in figure 11.Detect the cascade activity of one group of 8 kinds of different annular ribozyme.Cascade is initial by above-mentioned spontaneous cracking.As shown in Figure 1, a kind of ribozyme (#313) demonstrates the catalysis cascade of working that causes with the positive feedback mode amplification.

EXAMPLE III suppresses ribozyme by blood and the various material that is used for the DNA preparation

All amplification techniques need sample preparation steps to discharge nucleic acid and to eliminate reaction by blood constitutent and suppress.Used different materials at these preparations, as SDS, phenol and guanidinesalt (guanidinium).Not needing to have carried out the amplified reaction of sample preparation steps.Tested in the presence of blood, be with or without the ribozyme activity of nucleic acid releasing agent.Only two kinds of RNA and adorned ribozyme have been detected.

(a) method

1. oligonucleotide:

Oligodeoxynucleotide is bought from the molecular biology unit of Haddassa hospital (Mount Scopus, Jerusalem).The ribozyme of modifying is by RPI, and Boulder company is synthetic.It is synthetic that AmpliscribeT7 transcript reagent box (Epicenter Technologies) is used for all RNA.[γ ³²P] ATP[6000ci/mmol] and [α ³²P] UTP[3000Ci/mmol] buy from Rotem Industrial Co., Ltd (Israel).The T4 polynucleotide kinase is from NEB, Beverly, and Ma buys.

2. ribozyme:

DS-LS-RzA3-6：5′GCAACAGTGGAGGAAAGCCUACgucUGGUACGUCCAcugaugagGCCG?AAAGGCcgaaacGUAGUAAA?3′

Lowercase-ribonucleotide;

Capitalization-2 '-modification of O-methyl;

The underscore capitalization-deoxyribonucleotide.

HH8 (rna transcription thing): 5 ' GGCGACCCUGAUGAGGCCGAAAGGCCGAAACAUUAA 3 '

3. modify the mark of ribozyme:

T4 polynucleotide kinase and 20 μ Ci[γ with 50pmol ribozyme, 10 units ³²P] under 25 ℃ of the ATP with the cumulative volume of 10 μ l incubation 1 hour in the 1X reaction buffer.Reaction by stopping at 60 ℃ of following incubations in 10 minutes.

4.RNA preparation:

By electrophoresis on 15% polyacrylamide 7M urea gel, UV-shadowed and in 0.5MTris-Cl, 0.1%SDS and 0.1mM EDTA under room temperature the wash-out purifying HH8 template DNA oligonucleotide that spends the night.With the DNA of the 3M sodium-acetate of 0.1 volume and 3 volume of ethanol precipitation wash-out, and make it to be suspended in again among the 0.1XTE (1mM Tris-Cl pH-7.0 and 0.1mM EDTA) ,-20 ℃ of preservations up to use.By 95 ℃ of incubations 15 seconds and under 70 ℃, 60 ℃, 55 ℃, 50 ℃, 45 ℃, 40 ℃ and 37 ℃ of every kind of temperature incubation made the oligonucleotide of purifying be annealed into the complementary sub-oligonucleotide of non-template T7 rna polymerase promoter (TAATACGACTCACTATAGG) of 20 μ M in 5 minutes.Responsive transcription mixture (50 μ l) comprises 2mg annealed DNA, 1 * reaction buffer, 10mM dithiothreitol (DTT), 2mM ATP, CTP and GTP, 1mM UTP, 25mCi[a ³²P] UTP and 1.1mM MgCl ₂Mixture 37 ℃ of following incubations 1 hour and 80 ℃ of following incubations 5 minutes so that enzyme deactivate.RNA precipitation as described.Transcript is by electrophoresis purifying on 15% polyacrylamide 7M urea gel.RNA is by radioautograph location and wash-out as described.The RNA of wash-out precipitation as described is suspended among 0.1 * TE and counting in flicker flour (Luma LSC) again.

5. scission reaction:

Ribozyme or HH8,50mM Tris-Cl (pH-7.5), 1mD EDTA (pH-7.5), 0.05%SDS and 30mM MgCl that reaction (10 μ l) is modified at 0.5pmol usually ₂Carry out under existing.Add whole blood and other the component (referring to Fig. 1) of whole blood or the 0.2 μ l of 1 μ l.Be reflected at 37 ℃ of following incubations 1 minute and comprise the dyeing solution of 10M urea and 10mM EDTA and place on ice and stop by interpolation.Sample 80 ℃ of following sex change 5 minutes and on 15% polyacrylamide 7M urea gel electrophoresis.

(b) result:

The result as shown in figure 12, wherein 0.5pmol or ribozyme are present in every kind of sample, and the blood of 1 μ l and 10%SDS 4M guanidine thiocyanate or phenol trichloromethane are mixed at 1: 1, and the blood sample of every kind of processing of 1 μ l or reagent are added in the reaction test respectively.No matter whether blood exists, the result of ribozyme activity is not subjected to 1%SDS, 0.35M guanidine or is suppressed by the phenol trichloromethane.The degraded RNA part of ribozyme of the blood that is untreated.These results show: an advantage of the detection method based on ribozyme of the present invention is, the denaturing agent that uses at preparation catalysis sample does not hinder the catalytic activity of ribozyme.

Claims (25)

1. one kind is used for detecting the method that exists at the initial ribozyme of medium catalytic activity, and the method includes the steps of:

(a) provide catalysis system, this catalysis system comprises:

The catalysis inactivation of (aa) inferring or the space on restrictedly make them can not bring into play the ribozyme of its catalytic activity to target; The target of described ribozyme is other ribozyme of catalysis system, they to the catalytic activity of other ribozyme cause following both one of:

(i) ribozyme of activation inactivation,

(ii) on the Free up Memory restricted ribozyme so that it can contact their target;

At least some ribozyme of catalysis system is the target of nuclei originis enzymatic activity, and initial ribozyme is above-mentioned (i) or (ii) to the catalytic activity of said some ribozyme;

(ab) has the detectable label of detectable character so that the catalytic activity of ribozyme causes the variation of detectability matter;

(b) medium is contacted with said catalysis system;

(c) condition that provides initial ribozyme of the catalytic activity that makes said catalysis system and catalytic activity ribozyme to bring into play its catalytic activity, thus, the cascade that induces reaction of the initial ribozyme of the catalytic activity of existence, wherein the ribozyme of catalysis system is activated or is discharged in the medium;

(d) detect said detectability matter, the variation of said character is the indication that active initial ribozyme exists in said medium.

2. according to the method for claim 1, this method may further comprise the steps:

(a) medium is contacted with catalysis system, this catalysis system comprises:

-the first and second ribozymes, they all are the catalysis inactivations of inferring;

-said first ribozyme becomes catalytic activity based on the catalytic activity of said second ribozyme, and said second ribozyme becomes catalytic activity based on the catalytic activity of said first ribozyme;

-said first or at least a catalytic activity of said second ribozyme based on said initial ribozyme become catalytic activity;

At least a mark that carries of-said first or second ribozyme is so that the change of the detectability matter of said mark occurs based on the catalytic activity of other ribozyme;

(b) provide said initial ribozyme and said first and said second ribozyme can bring into play the condition of their catalytic activity; With

(c) detect said detectability matter, it is the indication that has active initial ribozyme in said medium that said character changes.

3. according to the method for claim 1, this method comprises:

(a) medium is contacted with catalysis system, this catalysis system comprises:

-the first combination nucleic acid molecule, this molecule comprises a kind of first ribozyme of nucleotide sequence of energy cracking first cleavable, it is connected on the nucleotide sequence of second cleavable, and the cracking of said second sequence discharges said first ribozyme from said first combination molecule;

-the second combination nucleic acid molecule, this molecule comprises second ribozyme of the nucleotide sequence of said second cleavable of a kind of energy cracking, it is connected on the nucleotide sequence of first cleavable, and the cracking of said first sequence discharges said second ribozyme from said second combination molecule;

-said first or at least a of sequence of second cleavable can be by said nuclei originis enzymatic lysis;

-said first combination and the said second combination nucleic acid molecule are separated from each other avoiding and contact between two combination molecules;

-said first and said second combination molecule at least a carry detectable mark, said mark is released in the reaction medium after being comprised in ribozyme cracking in other combination molecule;

(b) provide make ribozyme can cracking and make the cracked ribozyme can said first and the said second combination nucleic acid molecule between the condition of moving;

(c) detect the existence of the mark discharged, in medium, exist the mark that is discharged to show and in medium, have the catalytic activity ribozyme.

4. according to the method for claim 1, this method may further comprise the steps:

(a) medium is contacted with catalysis system, this catalysis system comprises that to infer be the 3rd ribozyme of catalysis inactivation;

Every kind of molecule of the 3rd ribozyme of-said catalysis inactivation of inferring becomes active based on the catalytic activity of other molecule of the 3rd ribozyme of catalytic activity;

The 3rd ribozyme of-said catalysis inactivation of inferring also becomes active based on the catalytic activity of said initial ribozyme;

-said the 3rd ribozyme carries mark so that based on the catalytic activity of other the 3rd ribozyme molecule the detectable character of said mark is changed;

(b) provide the condition that said the 3rd ribozyme and said initial ribozyme are brought into play its catalytic activity that is suitable for;

(c) detect said detectability matter, the change of said character is the indication that has active initial ribozyme in said medium;

5. according to the method for claim 1, this method may further comprise the steps:

(a) medium is contacted with catalysis system, this catalysis system comprises:

-a kind of combination nucleic acid molecule, this molecule comprises the mark ribozyme on the nucleotide sequence that is connected to cleavable, connection is carried out with the direction and the position that stop said nucleotide sequence to be present in the combination molecule by said ribozyme cracking, said nucleotide sequence can be discharged said mark ribozyme thus by said ribozyme cracking from said combination molecule when existing with free form;

The nucleotide sequence of-said cleavable also can be by said nuclei originis enzymatic lysis;

-said combination molecule is separated from each other to avoid them to contact therein.

(b) provide the condition of can the cracking ribozyme and allowing the cracked ribozyme between said combination molecule, to move;

(c) detect the existence of the mark discharged, in medium, exist the mark that is discharged to show and in medium, have the catalytic activity ribozyme.

6. according to the method for claim 4, this method detects the existence that has the active catalytic activity ribozyme of cracking and catalyzing in the medium, and this method comprises:

(a) medium and catalysis system are contacted, this catalysis system comprises:

-a kind of combination nucleic acid molecule, this molecule comprises the ribozyme of the nucleotide sequence with cleavable, and said combination molecule is the form of Closed loop, and the nucleotide sequence of said cleavable can be by the combination molecule cracking of opening mode;

The nucleotide sequence of-said cleavable also can be by the nuclei originis enzymatic lysis;

-said combination molecule carries detectable mark, and this mark changes its detectable character based on the opening of combination molecule of sealing;

(b) provide the condition that can make ribozyme cracking and migration;

(c) change of the said detectable character in the said character of detection, it is the indication that has the catalytic activity ribozyme in medium.

7. according to the method for claim 4, this method detects the existence that has the initial ribozyme of catalytic activity of montage catalytic activity in the medium, and this method comprises:

(a) medium is contacted with catalysis system, this catalysis system comprises:

-in the necessary district of its catalytic activity, having the 6th ribozyme of extra nucleotide sequence, said nucleotide sequence makes the ribozyme inactivation;

It is active that the said extra nucleotide sequence of-montage becomes the 6th ribozyme;

-said extra nucleotide sequence can be by said the 6th catalytic activity ribozyme montage from combination molecule;

-said extra nucleotide sequence also can pass through the detectable mark montage of catalytic activity;

-said the 6th ribozyme carries detectable mark, and this detectable mark changes its detectable character based on the montage of extra nucleotide sequence.

(b) provide the condition that makes the ribozyme montage;

(c) change of detection said detectability matter in said character, it is the indication that has the catalytic activity ribozyme in medium.

8. according to the method for claim 3, the wherein said first and second combination nucleic acid molecule are positioned a relative side of porous-film, the passage that this sealing can make the first and second free ribozymes pass through.

9. according to the method for claim 3, the wherein said first and second combination nucleic acid molecule are fixed on the substrate.

10. according to the method for claim 5, wherein every kind of combination molecule is fixed on a kind of substrate.

11. according to the method for claim 9 or 10, wherein said substrate is a globule.

12. according to the method for claim 3, the wherein said first and second combination nucleic acid molecule are connected on the part with identical charges.

13. according to the method for claim 5, wherein every kind of combination molecule is connected on the charged part, all parts in reaction mixture have identical electric charge.

14. one kind is detected the method that biomolecules to be measured exists in test sample, this method may further comprise the steps:

(a) sample only when being present under the condition that the initial ribozyme of catalytic activity is produced, biomolecules to be measured is being contacted with detection system;

(b) detect the existence of the initial ribozyme of catalytic activity according to the arbitrary method of claim 1-5, its existence shows have biomolecules to be measured in sample.

15. according to the method for claim 14, this method comprises:

(a) provide first compound molecule, this molecule comprises ribozyme to be the initial ribozyme under the catalysis inactivation condition and can to discern specifically and in conjunction with said Recognition of Biomolecular biomolecules to be measured;

(b) said first compound molecule is contacted with test sample, the condition of contact be make between said identification biomolecules and the said biomolecules to be measured can in conjunction with and can keep making simultaneously the condition of ribozyme catalysis inactivation;

(c) remove unconjugated first compound molecule;

(d) provide different conditions, it is active wherein the nuclei originis enzyme to be become;

(e) detect the existence of the initial ribozyme of catalytic activity according to the arbitrary method of claim 1-5, its existence shows have biomolecules to be measured in sample.

16. according to the method for claim 15, this method comprises:

(a) provide first compound molecule, this molecule comprises: ribozyme is the initial ribozyme under the catalysis inactivation condition and can discerns specifically and in conjunction with said Recognition of Biomolecular biomolecules to be measured; Said ribozyme is connected to can be by on the nucleotide sequence of the cleavable of the nuclei originis enzymatic lysis of catalytic activation, and the cracking of wherein said cleavable sequence is discharged into the initial ribozyme of catalytic activity in the surrounding medium;

(b) said first compound molecule is contacted with test sample, the condition of contact be make between said identification biomolecules and the said biomolecules to be measured can in conjunction with and can keep making simultaneously the condition of ribozyme catalysis inactivation;

(c) remove unconjugated first compound molecule;

(d) provide different conditions, wherein can make said initial ribozyme become catalytic activity to cause the cracking of said cleavable sequence, so active initial ribozyme is discharged in the surrounding medium;

(e) detect the existence of the initial ribozyme of catalytic activity according to the arbitrary method of claim 1-5, its existence shows have biomolecules to be measured in sample.

17. according to the method for claim 15, this method comprises:

(a) provide the heterozygote molecule, this molecule comprises: the initial ribozyme that is connected with the nucleotide sequence of cleavable, nucleotide sequence wherein can be by the nuclei originis enzymatic lysis when being strand, the cracking of said cleavable sequence is discharged into the initial ribozyme of catalytic activity in the surrounding medium, the heterozygote molecule also comprises can be discerned and in conjunction with said Recognition of Biomolecular biomolecules to be measured, it is double-stranded that the part of said cleavable sequence and said identification biomolecules is inferred specifically;

(b) said heterozygote molecule is contacted with test sample, the condition of contact is can carry out by the displacement of a chain of the double-stranded part of the nucleotide sequence of biomolecules to be measured feasible identification biomolecules of mating fully basically and cleavable;

(c) provide such condition, this condition makes and can thus the initial ribozyme of catalytic activity be discharged in the surrounding medium by the cracking of catalytic activity ribozyme cracking with the sequence that causes the strand cleavable;

(d) detect the existence of the initial ribozyme of catalytic activity according to the arbitrary method of claim 1-5, its existence shows have biomolecules to be measured in sample.

18. according to the method for claim 15, this method comprises:

(a) provide second compound molecule, this molecule comprises: can discern specifically and in conjunction with the initial ribozyme of said biomolecules to be measured and identification biomolecules, said ribozyme with can be connected by the cleavable nucleotide sequence of catalytic activity nuclei originis enzymatic lysis, the cracking of said cleavable sequence is discharged into the initial ribozyme of catalytic activity in the surrounding medium, and said second compound molecule also comprises the inhibition part of the catalytic activity that can suppress said initial ribozyme;

(b) said second compound molecule is contacted with test sample, the condition of contact be make between said identification biomolecules and the said biomolecules to be measured can in conjunction with and suppressing portion is divided keep it to suppress the condition of form;

(c) remove unconjugated second compound molecule;

(d) the inhibition part of modifying said bonded second compound molecule causes thus that to remove its restraining effect the cracking of said cleavable sequence also is discharged into initial ribozyme in the surrounding medium;

(e) detect the existence of the initial ribozyme of catalytic activity according to the arbitrary method of claim 1-5, its existence shows have biomolecules to be measured in sample.

19. according to the method for claim 15, wherein the condition in (a) is essentially no magnesium ion, step (d) comprises with the concentration that is enough to make said initial ribozyme become catalytic activity adds magnesium ion in reaction medium.

20. according to the method for claim 14, wherein said biomolecules to be measured is a nucleotide sequence, said method may further comprise the steps:

(a) sample is contacted with detection system, this detection system comprises:

-the first oligonucleotide molecules, this molecule have double stranded promoter, single stranded oligonucleotide sequence (be DNA in essence, it is identical with the nuclei originis enzyme sequence basically); Be in essence DNA (basically with can be identical) by the cleavable sequence of catalytic activity nuclei originis enzymatic lysis single stranded sequence and and determined nucleic acid sequence 5 '-part complementary single stranded sequence;

-the second oligonucleotide molecules, this molecule have with 3 of determined nucleic acid sequence '-part complementary single stranded sequence, also comprise to be transcribed and trigger oligonucleotide templates to produce the strand that triggers oligonucleotide sequence, said triggering oligonucleotide sequence can trigger reaction in re-reading system in the presence of sub-construct of reverting starting and archaeal dna polymerase, wherein transcribe its adsorbed sequence;

(b) provide and make said first and the condition of said second oligonucleotide molecules and determined nucleic acid sequence hybridization;

(c) add re-reading system feasible transcribing under the condition that to carry out, transcribe the triggering oligonucleotide sequence thus, said triggering oligonucleotide sequence is in the presence of reverting starting, archaeal dna polymerase and the re-reading system and under the condition that can hybridize, DNA polymerization and transcribe final oligonucleotide transcript is transcribed, this transcript comprise and the initial ribozyme that can be connected by the cleavable sequence of catalytic activity nuclei originis enzymatic lysis;

(d) provide the condition that makes based on the said cleavable sequence of said catalytic activity ribozyme cracking, to cause the cracking of said cleavable sequence and will himself be discharged in the surrounding medium;

(e) detect the existence of the initial ribozyme of catalytic activity according to the arbitrary method of claim 1-5, its existence shows have biomolecules to be measured in sample.

21. according to the method for claim 14, wherein said biomolecules to be measured is a nucleotide sequence, this method may further comprise the steps:

(a) test sample and detection system incubation, this detection system comprises:

-Di three combination molecules, this molecule comprise with 5 of determined nucleic acid sequence '-part complementary the 3rd single stranded oligonucleotide sequence, the part of said the 3rd oligonucleotide sequence and initial ribozyme is connected;

-Di four combination molecules, this molecule comprise with determined nucleic acid sequence all the other 3 '-part complementary the 4th single stranded oligonucleotide sequence, the part of said the 4th oligonucleotide sequence and initial ribozyme (need make the ribozyme that is connected with the 3rd oligonucleotide sequence complete) be connected to produce complete initial ribozyme;

(b) provide the condition that makes said third and fourth oligonucleotide sequence and determined nucleic acid sequence hybridization also complete initial ribozyme be assembled from its part;

(c) detect the existence of the initial ribozyme of catalytic activity according to the arbitrary method of claim 1-5, its existence shows have biomolecules to be measured in sample.

22. according to the method for claim 14, wherein said biomolecules to be measured is a nucleotide sequence, this method may further comprise the steps:

(a) test sample and detection system incubation, this detection system comprises:

The ribozyme of-tup type, wherein the double-stranded part of some of stem-II is shortened, and the double-stranded stem-II of wherein said residue is adsorbed onto on two kinds of single stranded sequences, 5 of a kind of and determined nucleic acid sequence '-end is complementary, 3 of another kind of and determined nucleic acid sequence '-the end complementation;

It is inactivation that-said ribozyme is inferred;

The hybridization of-said two kinds of single stranded sequences and complementary sequence makes ribozyme become catalytic activity;

(b) provide the condition that makes said ribozyme and the hybridization of said determined nucleic acid sequence;

(c) detect the existence of the initial ribozyme of catalytic activity according to the arbitrary method of claim 1-5, its existence shows have biomolecules to be measured in sample.

23. according to the method for claim 1, this method is used for detecting the existence that medium has the initial ribozyme of catalytic activity of lytic activity, this method comprises:

(a) medium is contacted with catalysis system, this catalysis system comprises:

-a kind of the 4th ribozyme that can connect the 5th ribozyme part, it with can be connected by the nucleotide sequence of nuclei originis enzymatic lysis, the cracking of said nucleotide sequence is discharged into the 4th ribozyme of catalytic activity in the surrounding medium;

Two portions of-Di five ribozymes, they can be connected the 5th ribozyme that provides catalytic activity by the 4th ribozyme, and said the 5th ribozyme is a kind of ribozyme that can connect the part of the 4th ribozyme;

Two portions of-Di four ribozymes, they can be connected the 4th ribozyme that provides catalytic activity by the 5th ribozyme;

-said the 4th ribozyme putatively is to separate with two portions of the 5th ribozyme avoiding to be in contact with one another;

The-the said the 4th or said the 5th ribozyme at least a carry the mark that changes its detectability matter based on connecting;

(b) provide ribozyme cracking and the feasible condition that can carry out cracked total length the 4th molecule to two portions migration of the 5th ribozyme of making.

(c) condition that provides or keep making the ribozyme connection;

(d) detecting said detectability matter, is the indication that has said initial ribozyme in said medium in the change of said character.

24. according to the method for claim 1, this method detects has the existence that connects the initial ribozyme of active catalytic activity in medium, this method comprises:

(a) medium is contacted with catalysis system, this catalysis system comprises:

Two portions of-Di five ribozymes, they can be connected to produce the 5th ribozyme of catalytic activity by the 4th ribozyme, and said the 5th ribozyme is a kind of ribozyme that can connect the part of the 4th ribozyme;

Two portions of-Di four ribozymes, they can be connected to produce the 4th ribozyme of catalytic activity by the 5th ribozyme, and said the 4th ribozyme is a kind of ribozyme that can connect the part of the 5th ribozyme;

Two portions of-said the 5th ribozyme or two portions of said the 4th ribozyme can be connected by the initial ribozyme of catalytic activity;

The-the said the 4th or said the 5th ribozyme at least a carrying can be based on the mark that connect to change its detectability matter;

(b) provide the condition that makes that ribozyme can connect;

(c) detecting said detectability matter, is the indication that has said initial ribozyme in said medium in the change of said character.

25. be used for the test kit of the arbitrary method of claim 1 to 24.

Images