RU2126447C1 - Method of preparing an attenuated strain of bacterium salmonella and a vaccine - Google Patents

Abstract

FIELD: microbiology, molecular biology, genetic engineering. SUBSTANCE: invention provides preparing the strains of an attenuated bacterium Salmonella containing a promoter nirB operatively bound with DNA sequence encoding a heterological protein of a pathogenic microorganism. Method involves preparing a DNA-constructor containing nirB-promoter operatively bound with DNA-sequence encoding a heterological protein of a pathogenic microorganism, transformation of an attenuated strain of bacterium Salmonella with the indicated DNA-constructor, growing transformed bacteria on suitable nutrient medium and a selection of the end strain. Invention provides also a vaccine against sickness caused by pathogenic microorganism and containing a pharmaceutically acceptable carrier of vehicle, and a strain of an attenuated bacterium Salmonella as an active component obtained by a method indicated in an invention. Vaccine can be used for prophylaxis of both human and animals. EFFECT: improved method of vaccine and strain preparing. 7 cl, 1 tbl, 1 ex, 5 dwg

Description

 The invention relates to a method for producing attenuated strains of Salmonella bacteria capable of producing a heterologous protein, and to vaccines containing these bacteria.

 Virulent strains of Salmonella (Salmonella) can be attenuated through the implementation of certain mutations in the genes necessary for their existence and growth in vivo. Species with attenuated virulence that cause limited and clinically insignificant infections can be considered as potential live vaccines for oral administration against Salmonella infection. So Tu-21a is a weakened variant of Salmonella typhi, preserving mutations in galE and other unknown weakened variants, and is a licensed product in several countries, used as a typhoid vaccine for oral use.

 Recently, genetically determined Salmonella strains that retain certain individual mutants in different genes have been tested as experimental oral vaccines for a number of diseases. For example, it has been shown that Salmonella aro mutants, which have an auxotrophic combination with a number of aromatic compounds, are effective oral vaccines for mice, sheep, cattle, chickens, and more recently, it has been shown in voluntary patients that they can be weakened and immunogenic in relation to the person. Double mutants of Salmonella aro are described in European patent application EP-A-0322237. The double mutants Salmonella cya crp are also effective oral vaccines.

 Along with the fact that Salmonellae species with weakened virulence are full-fledged vaccines against salmonellosis, they can also be considered as carriers or heterologous antigens for the mucosal immune system. This is because Salmonellae can penetrate the body through the oral route and are powerful immunogens that can stimulate systemic and local cellular and antibody responses. Heterologous antigens from bacteria, viruses and parasites can be administered to a patient using Salmonella-based vaccines.

 Some of the potentially most serious barriers to the use of such live vaccines or the delivery of antigens are related to problems in the stability of foreign antigen expression in vivo. The unregulated expression of large amounts of foreign proteins in bacteria based on multiple copy plasmids usually results in a rapid loss of the plasmin or expressed gene in the cells. The problem can be controlled by fermentation by using inducible promoter systems, for example trp or lac, to effect controlled induction of gene expression using appropriate biomass. Obviously, such promoters cannot be induced using exogenous inducers such as PP or IPTG in the case when bacteria develop in the host tissues in the process of self-limited growth after vaccination.

 Instability of plasmids in vivo during vaccination using live bacterial vectors has been reported in a number of studies (Maskell et al., Microb Path, 2, 295-305, 1987; Nakayama et al., Bio / technology, 6, 693-697, 1988, Tait et al., Immunology, 70, 540 - 546, 1990). A number of attempts have been made to solve this problem, including the use of an integration system for the expression of a heterologous antigen from bacterial chromosomes (see Hon et al., Microb Path, 5, 407 - 418, 1988; Stragneli et al., Gene, 88, 57- 63, 1990). However, a similar approach is applicable only for certain antigens, since the level of expression is often quite low (see Maskell et al., 1987). Nakayami et al. describes the use of binding of the main gene to an expression plasmid to stabilize expression in vivo. Although this approach is highly effective, it does not prevent the generation of free plasmid variants, but only gives confidence that they are not saved. Further stable, but unregulated expression of a high level of foreign antigen in the Salmonella strain for the vaccine can slow the growth rate, and therefore has a potential effect on the immunogenicity of a live vaccine.

 The present invention provides a method for producing strains of attenuated Salmonella bacteria containing an nirB promoter operably linked to a DNA sequence encoding a heterologous protein of a pathogenic organism, comprising preparing a DNA construct containing an nirB promoter operably linked to a DNA sequence encoding a heterologous protein of a pathogenic organism, transformation indicated construct of an attenuated strain of Salmonella bacteria, growing transformed bacteria in a suitable nutritionally th environment and selection of the target strain.

 The invention also provides a vaccine against a disease caused by a pathogenic organism, containing a pharmaceutically acceptable carrier or diluent and, as an active ingredient, a strain of attenuated Salmonella bacteria obtained by the method according to the invention.

 Stable expression of a heterologous protein can be carried out in vivo. Salmonella penetrate and grow in eukaryotic cells and give colonies on mucous surfaces.

 Bordetella, Vibrio, Haemophilus, Neisseria Versinia. Alternatively, bacteria with reduced virulence may be a weakened strain of the enterotoxigenic variety Escherichia coli. In particular, the following varieties can be noted: S. typhi for typhoid in humans, S. typhimurium for salmonellosis in some animal species: S. enteritidis for food poisoning in humans, S. choraraesuis for salmonellosis in pigs, Bordetella pertussis case of whooping cough; Haemophilus influenzal for meningitis: Neisseria gonorrhoeal for gonorrhea, and Versinia for food poisoning.

 The weakening of the virulent action of bacteria can be attributed to an irreversible mutation in the genes along the pathway of bacterial biosynthesis through aromatic amino acids. At least 10 genes are included in the synthesis of choriamate, a compound corresponding to the nodal point of the biosynthesis pathway through aromatic amino acids. Some of the elements of this map are located in far-distant parts of the bacterial genome (for example, aro A (5-snolpiruvil sikimat-3-phosphatesynthesis), aro C (chorizmatsynthesis), aro D (3-pehydroquinatenergipratase), and aro E (sicamate hyprogenase). may occur in the genes aro A, aro C, aro D and aro E.

 However, it is preferable if the attenuated bacteria include an irreversible mutation in each of the two discrete genes of the biosynthesis pathway through aromatic amino acids. Such bacteria are described in European application EP-A-0322237. Double aro-type mutants suitable according to the present invention are mutant bacteria aro A, aro C, aro A, aro D and aro A, aro E. However, other bacteria having mutations in other combinations of the aro A, aro C, aro genes D and aro E may also be useful according to the invention. Particularly preferred are Salmonella double aro mutants, for example, S.typhi or S.typhimurium double aro mutants, in particular mutants aro A, aro C, aro A, aro D and aro A, aro E.

 Alternatively, bacteria with attenuated virulence may include irreversible mutations in the gene associated with the regulation of one or more other genes (see European patent application EP-A-0400958). Preferably, the mutation takes place in the omp R gene or in another gene included in the regulation. There are a significant number of other regulatory-related genes that are known to have the ability to provide feedback on stimulation from the environment (see Ronson et al., Cell 49, 579-581).

 A similar type of attenuated bacteria can serve as a guardian of the second mutation in the second gene. Preferably, said second gene is a gene that replicates an enzyme included in a particular biosynthesis pathway, in particular a gene included in a prechorismic stage during biosynthesis through aromatic compounds. Therefore, the second mutation preferably corresponds to the types of the genes aro A, aro C, or aro D.

 Another type of bacteria with attenuated virulence is one for which attenuation occurs when there is an irreversible mutation in the DNA copying bacterium, or associated with the regulation of the expression of copying DNA, for a protein produced in response to environmental influences. Such bacteria are described in patent WO 91/15572. An irreversible mutation may be a deletion, insertion, inversion, or substitution. A mutation in the form of a deletion can be generated using transposon.

Examples of proteins that are obtained as a result of feedback on the environment include proteins that respond to heat (they are obtained by raising the temperature above 42 ^o C), proteins that respond to a decrease in the amount of nutrients (which are obtained as a result of feedback on reduction in the content of essential nutrients, such as phosphates or nitrogen, to a level lower than that required for the survival of microorganisms), proteins that respond to toxic effects (which are obtained as a result of feedback on toxic compounds, such as dyes, acids, or possibly plant exudates), or proteins that respond to metabolic degradation (which result from feedback on fluctuations, for example, in the level of ions affecting the ability of microorganisms to osmoregulation, or in the content of vitamins or cofactors that can cause a cessation of metabolism.

A preferred heat-responsive protein is that copied by the htr A gene (also referred to as dep P). Other proteins are encoded by genes that are known to be involved in external response, such as grp E, gro EL (moPA), dna K, gro ES, lon and dna J. There are also many other proteins encoded by the genes involved in induction in the form of feedback on environmental exposure (see Ronson et al., Cell 49, 579-581). Among them, the ntr B / ntr C E. coli system, which is induced as a response to a decrease in nitrogen content and which positively regulates gln A and nif LA, should be noted (see Buck et al., Nature 320, 374 - 378, 1986; Hirschman et al., Proc. Natl, Acad, Sci, USA 82, 7525, 1985; Nixon et al., Proc, Natl, Acad, Sci, USA 83, 7850 - 7854, 1986; Reitzer and Maganzanik, Cell, 45, 785 . 1986), the phob / phob system of E. coli, which is induced in response to a decrease in phosphate content (Makino et al., J. Mol. Biol. 192, 549 - 556, 1986), cpx A / sfr A E. coli system which is induced upon recall of dyes and other toxic derivatives (see Albin et al. J. Biol. Chem. 261, 4698, 1986; Drury et al., J. Biol. Chem., 260, 4236 - 4272, 1985). A similar system for Rhisobium is dct B / dct D, which gives feedback on 4C-dicarboxylic acids (Ronson et al., J. Bacteriol, 169, 2424, 49, 579-581, 1987). A virulent system of this type has been described for Agrobacterium. It corresponds to the vir A / vir G type and is induced as a response to plant exudates (see Le Roux et al. EMBO. J., 6, 849 - 856, 1987, Stechel and Zambriski, Am. J. Vet. Res, 45, 59 - 66, 1986, Vinens et al., Proc. Natl. Acad. Sci. USA, 83, 8278, 1986). Similarly, the bvg C - bvg A Bordetella pertussis system (formerly known as Vir) regulates the production of a virulent determinant in the form of feedback on fluctuations in the concentration of Mg ^{2+ ion} and nicotinic acid (see Zrico et al., Proc. Natl. Acad. Sci. USA 86, 6671 - 6675).

 For use in the form of a live vaccine, bacteria with attenuated virulence must not revert to a virulent state. The likelihood of such an event during mutation of the opinic DNA sequence can be considered insignificant. However, the risk of a reverse transition, which can occur in the case of bacteria weakened by mutations in each of the two discrete DNA sequences, cannot be neglected. Therefore, the preferred bacteria with attenuated virulence are those that are attenuated by mutation in the DNA sequence encoding a protein that is produced as a response to environmental influences, as well as in the case of mutations in the second DNA sequence.

 The second DNA sequence preferably encodes an enzyme included in the main auxotrophic direction of synthesis or is a sequence whose product controls the regulation of genes that respond to changes in osmosis conditions, for example omp A (Infect and Jmmun 1989, 2136 - 2140). Most preferred is the case when the mutation takes place in the DNA sequence included in the direction of biosynthesis through aromatic amino acids, more specifically, the DNA sequence encoding aro A, aro C, aro D.

 Bacteria with attenuated virulence can be obtained by creating a mutation in the DNA sequence using known methods (see Maniatie, "Laboratory Manual for Molecular Cloning", 1982). Irrevocable mutations can be caused by the introduction of the Ihpho A hybrid transposon, for example, in the S. typhimurium Inpho A strain, it can generate fermentation-active protein cross-links of alkaline phosphatase with periplasmic or membrane proteins. Inpho A transposon carries a gene encoding the ability to withstand the effects of kanamidine. Transpractants are selected so that they have the ability to withstand the effects of kanamycin, with the growth of colonies on the appropriate medium or selection.

 Alternative methods include cloning a DNA sequence in a vector, for example a plasmid or cosmid, and inserting a selective marker gene into the cloned DNA sequence, leading to its deactivation. A plasmid carrying a deactivated DNA sequence and various selective markers can be introduced into the body using known methods (see Maniatie "Laboratory manual for molecular cloning", 1982). It is possible by appropriate selection to identify a mutant for which a deactivated DNA sequence recombines into the chromosome of a microorganism, and a “wild” DNA sequence becomes non-functional in a process known as allelic exchange. In particular, the vector used is preferably unstable in the microorganism and will spontaneously disappear. The mutational DNA sequence from the plasmid and the wild DNA sequence can mutually exchange as a result of the exchange of genotypes. Additional methods include the exclusion of the introduction of foreign DNA into the vaccine strain at the mutation site, as well as the introduction of resistant and antibiotic markers into the strain.

 A heterologous antigen that bacteria with reduced virulence can express may, for example, include the antigenic determinant of the pathogenic organism. The antigen can be obtained from a virus, bacteria, fungi, yeast or parasites. Therefore, a heterologous protein typically comprises an antigenic sequence isolated from a virus, bacterium, fungus, yeast, or parasite. More specifically, the antigenic sequence can be obtained from human immunodeficiency virus (HIV), for example HIV-1 or HIV-2, hepatitis A or B virus, human rhinovirus, for example type 2 or type 14, fever virus (herpes), type 2 polivirus or 3, foot-and-mouth disease virus, influenza virus, hip lesion virus, CD-4 cell surface antigen and Chlamydia trachomatis. The antigen may include an HIV CD-4 receptor binding site, for example HIV-1 or HIV-2. Other suitable antigens include the subunit of heat-labile E. coli toxin B (LT-B), E, coli K-88 antigens, B. pertussis protein P.69, tetanus toxin fragment C and trematon, mycoplasma, roundworm antigens , tapeworms, rabies virus and rotavirus.

 A preferred promoter for regulating the expression of a heterologous protein is the nir B promoter. The nir B promoter has been isolated from E. coli, where it directs the expression of an operon including the nir B nitrite reductase gene (see Jeyermen et al., J. Mol. Biol, 196, 781 - 788, 1987), nirD, nirC, and cys G (see Pickman et al., Eur J. Biochem 191, 315 - 323, 1990). It is regulated by both nitrites and changes in the pressure of oxygen in the environment, becoming active with a lack of oxygen (Cole, Biochem. Biophys. Acta. 162, 356 - 368, 1968). Feedback on anaerobic is transmitted through the FNR block, which acts as a transcriptional activator, and in accordance with the mechanism common to many anaerobic respiratory genes.

As a result of the analysis using selection and mutation, a part of the promoter was isolated, giving feedback only on anaerobiosis, and as a result of comparison with other anaerobically regulated promoters, the state of the FNR binding site was identified (Bell et al., Nucl.Acids Res. 17, 3865 - 3874, 1989; Jeyerman et al., Nucl. Acids. Res. 17, 135 - 1454, 1989). It was also shown that the distance between the putative FNR binding site and the homologous region of –10 is critical (Bell et al., Molec.Microbiol., 4, 1753–1763, 1990). Therefore, it is preferable to use only that part of the nirB promoter that gives feedback only on anaerobiosis. In this description, the term "nir B-promoter" refers to both the promoter itself and a part of its derivative capable of promoting the ecopressing of the copy sequence under anaerobic conditions. The sequence actually used according to the present invention, containing nir B-promoter, has the structure:
AATTCAGGTAAAXXXGATGTACATCAAATGGTACCCCTTGCTGAATCGTTAAGGTAGGCGGTAGGGCC
For transformation in the method according to the invention, you can use any known methods, for example, electrophoresis. In this way, weakened bacteria capable of expressing a protein heterologous with respect to the bacterium are obtained. A culture of bacteria with weakened virulence can be grown under aerobic conditions. In this way, a sufficient amount of a bacterial preparation is prepared to prepare a vaccine with minimal expression of a heterologous protein.

 The DNA gene construct is typically a replicable expression vector comprising an nirB promoter linked to a DNA sequence encoding a heterologous protein. The nir B-promoter can be introduced into an expression vector that already contains a gene encoding a heterologous protein, instead of the existing promoter that regulates protein expression. Naturally, the expression vector must be compatible with attenuated bacteria into which it must be introduced.

 The expression vector should be equipped with appropriate control elements for transcription and translation, including, in addition to the nirB promoter, the site of transcription completion and codons of the beginning and end of translation. An appropriate ribosomal binding site is also contemplated. The vector usually contains the region of origin of replication and, if desired, a special marker gene, for example, the gene responsible for antibiotic resistance. The vector may be a plasmid.

 The vaccine is preferably obtained in lyophilized form, for example, in the form of capsules intended for oral administration. Said capsules may have a food coating, for example, from Udregate-S, Udregate-L, cellulose acetate, cellulose phthalate or hydroxypropyl methylcellulose. Capsules can be used both by themselves and after restoration of the initial state of the lyophilized product before administration, for example, in the form of a suspension. The restoration of the initial state is carried out in a buffer solution at a suitable pH, ensuring the viability of microorganisms. To protect attenuated bacteria and the vaccine from the gastric acidic environment, sodium bicarbonate is preferably administered prior to each administration. Alternatively, the vaccine is formulated for parenteral, topical administration, or for administration through the mammary gland.

The vaccine according to the present invention can be used for the prevention of patients, preferably humans, although it is possible to use it in animals. The occurrence of infection caused by a pathogenic source can thus be prevented by administering an effective dose of the vaccine according to the present invention. Following this, the bacteria express a heterologous protein capable of increasing the level of antibodies to this microorganism. The dosages used depend on various factors, including the height and weight of the patient, the type of vaccine and the nature of the heterologous protein. However, in the case of attenuated S.typhi bacteria, for an adult patient with a body weight of 70 kg, a dosage for oral administration containing 10 ⁹ to 10 ¹⁰ S.typhi microorganisms per dose is preferred.

изолят BRD - 743, --- обозначает отсутствие, а --- -введение ампициллина.The following examples illustrate the invention. In the attached FIG. 1-4 show the ability of S typhimurium isolates to grow in vivo, respectively, in the liver, spleen, lymphatic follicles (Peyer's patches) and mesenteric lymph nodes of BALB / C mice. On the X axis, the number of days after infection is plotted, on the Y axis, the decimal logarithm of the number of surviving microorganisms for each of the organs, on the graph Δ indicates isolate BRD - 509, □ - isolate BRD - 847,

isolate BRD - 743, --- indicates the absence, and --- the introduction of ampicillin.

 In FIG. 5 shows titers of mouse serum against fragment C of tetanus toxin. On the X axis are the types of bacteria used to infect mice; the number of doses is indicated in parentheses. The Y axis indicates the absorbance at 492 nm.

 Example. Getting pTET nir 15.

The expression plasmid pTET nir 15 was obtained from pTET 115 (see Macoff et al. Nucl. Acids. Res. 17, 10191-10202, 1989) by replacing the EcoRI-ApaI region, 1354 base pairs long, containing the lacI gene and tac- promoter for the following pair of oligonucleotides 1 and 2:
oligo - 1 5'-AATTCAGGTAAAXXXGATGTACATCAAATGGTACCCCTTGCTGAATC
oligo - 2 3'-GTCCAXXXAAACTACATGTAGXXXACCATGGGGAACGACTTAG
GTTAAGGTAGGCGGTAGGGCC - 3 '
CATTCCATCCGCCATC - 5 '
Oligonucleotides are synthesized using Pharmacy Gene Assembler; the presence of the obtained plasmid is confirmed by sequencing (see Makoff et al. Bio / Technology 7, 1043-1046, 1989).

 Obtaining SL - 1334 aro A aro D containing pTET nir 15.

 In order to obtain a strain of the Salmonella vaccine that ecopresses tetanus toxin fragment C by controlling the nirB promoter, an intermediate strain, S. typhimuriam LB-5010 (r) (see Bullas and Rio. J.Bact., 156, 471 - 474, 1983) transform pTET nir 15. Colonies expressing fragment C are detected by selection using antibiotics, followed by immunoblotting with serum of tetanus toxin fragment C. The colonies are grown overnight under aerobic conditions on a nitrocellulose filter, after which they are induced by incubation for 4 hours before immunoblotting under anaerobic conditions. A strain stably expressing fragment C is used to obtain plasmid DNA. It is used for electrophoresis transformation of the isolate S.typhimurium SL-1344 aro A aro D, designated BRD-509. The strain stably expressing fragment C (which is checked by immunoblotting in accordance with the method described above) is used for in vivo experiments under the designation BR D - 847.

 Comparison of in vivo kinetics for BRD-743 and BRD-847 in BAL B / C mice.

The ability to grow in vivo or BRD-734 (BRD-509 containing pTET85) and BRD-847 are tested when the drug is administered orally to BAL B / C mice. pTET 85 is obtained from pTET tac 115 (see Makoff et al., Nucl. Acids. Res., 17 10191 - 10202, 1989) as a result of deletion of the EcoRI fragment, 1.2 thousand base pairs long, carrying the lacI gene. As a result, the expression of fragment C in the Salmonella strain occurs. The number of bacteria is determined in the liver, spleen, lymphatic follicles (Payer plaques) and mesenteric lymph nodes. Bacteria isolated from mice are also examined for their ability to grow on ampicillin-containing cultures (as an indicator of the percentage of microorganisms that still retain the expression fragment of plasmid C. The results are shown in Figs. 1–4. Using the same initial amounts of microorganisms (5 • 10 ⁹ ) for infection of mice, it was found that both BRD-743 and BRD-847 are able to penetrate and persist in all studied tissues of mice, however, at a lower level compared to BRD-509. However, an interesting difference is The fact is that the number of ampicillin-resistant microorganisms obtained from mice infected with BRD-743 rapidly decreases, and all isolated microorganisms become sensitive to ampicillin on day 14. This fact suggests that in vivo selection quickly leads to the loss of pTET 85 from the Salmonella vaccine strain In contrast, studies performed in the absence and presence of ampicillin for BRD-847 gave the same results when observing the time of infection. This illustrates the added benefit of pTET 15 in the S. typhimurium vaccine strain obtained from microorganisms with the potential for expression of Fragment C in vivo over a longer period of time, which is a major advantage in terms of immunogenicity.

 Immunization of BAl B / C mice using Salmonella strains containing pTET85 (BRD-743) or pTET nir 15 (BRD-847).

Groups of 20 mice are orally administered from 5 x 10 ⁹ cells of BRD-743, BRD-847, or BRD-509 cultures. On day 25, serum samples were taken from all mice and analyzed by enzyme-linked immunosorbent assay for the presence of tetanus antibodies. All mice infected with BRD-847 showed a measurable amount of antibodies against fragment C after 25 days, while mice infected with BRD-743 or BRD-509 did not (see FIG. 5). On day 25, 10 mice of each group were re-immunized (for groups infected with BRD-743 and BRD-847). The values obtained for mice re-immunized with BRD-847 are significantly higher than for mice re-immunized with BRD-743. Mice re-immunized orally with BRD-509 did not give any significant response to fragment C.

 Control tetanus toxin infection in mice immunized by oral administration of BRD-743 and BRD-847.

Mice are vaccinated orally using BRD-743, BRD-847, and BRD-509, after which they are used to test immunization against control tetanus toxin infection (after administration of one or two doses of the immunizing strain). Groups of 20 mice were given a single oral dose of 5 x 10 ⁹ microorganisms, and groups of 10 mice were challenged on the 25th day after vaccination using 50 50% lethal doses of tetanus toxin (see table 1). Vaccinated BRD-847 mice are fully protected against challenge following a single oral administration of a single dose, whereas vaccinated BRD-743 mice are only partially protected (2 survivors per 10 animals). The remaining groups of 10 mice receive a second dose (5 x 10 ⁹ ) of microorganisms on the 15th day after the start of the test, and are subjected to control infection on the 46th day after the first dose. The newly vaccinated BRD-847 mice are fully protected against challenge, while the BRD-743 vaccinated mice are only partially protected (5 out of 10 surviving). Mice immunized with 1 or 2 doses of BRD-509 completely die after challenge. BRD-847 is effective after a single oral administration of a tetanus toxin vaccine in control mice. For some groups of mice, a tetanus toxin challenge was performed after intravenous administration of 1 or 2 doses of 10 microorganisms of strains BRD-847 and BRD-743. All mice are fully protected against tetanus toxin challenge following administration of 1 and 2 doses of the vaccine strain.

Claims (7)

 1. A method of obtaining an attenuated strain of Salmonella bacteria containing the nirB promoter functionally linked to a DNA sequence encoding a heterologous protein of a pathogenic organism, characterized in that DNA constructs containing a nirB promoter functionally linked to a DNA sequence encoding a heterologous protein of a pathogenic organism, transformation of the attenuated strain of bacteria Salmonella by this design, transformed bacteria are grown in a suitable nutrient medium and the target piece is selected amm.  2. The method according to claim 1, characterized in that the attenuated strain of bacteria Salmonella typhi or Salmonella typhi murium is transformed.  3. The method according to any one of claims 1 and 2, characterized in that they transform the strain of bacteria Salmonella, attenuated using a non-reversing mutation in one or more genes of the mechanism of biosynthesis of aromatic amino acids.  4. The method according to claim 3, characterized in that they transform the strain of bacteria Salmonella, attenuated using a non-reversible mutation in each of the two discrete genes aroA, aroC, aroA aroD or aroA aroE.  5. The method according to claim 1, characterized in that the heterologous protein of the pathogenic organism is a protein of viruses, bacteria, fungi, yeast or parasites.  6. The method according to claim 5, characterized in that the heterologous bacterial protein is a P69 protein from Bordetella pertussus or a tetanus toxin fragment C.  7. A vaccine against a disease caused by a pathogenic organism, containing a pharmaceutically acceptable carrier or diluent and as an active ingredient an attenuated strain of Salmonella bacteria, obtained in accordance with the method according to any one of claims 1 to 6.

Images