RU2107726C1 - Dna fragment corresponding to gene skc-2, method for expressing dna fragment corresponding to gene skc-2, plasmid vector pekg3 providing for expressing dna fragment corresponding to gene skc-2, plasmid vector pes kc-4 providing for expressing dna fragment corresponding to gene skc-2, escherichia coli bacteria strain having plasmid vector pekg3 usable for expressing dna fragment corresponding to gene skc-2, and streptokinase produced in utilizing escherichia coli bacteria strain hsk-m - Google Patents

Abstract

FIELD: microbiology; biological engineering; gene engineering. SUBSTANCE: method involves amplifying given fragment by means of synthetic oligonucleotides SK1, SK2 and SK3 and building-in plasmid vector for transforming competent forms of Escherichia coli bacteria strains or yeast Pichia pastoris. Vectors pEKG3 and PES KC-4 provide expression of the mentioned fragment in Escherichia coli and Pichia pastoris cells, respectively. Competent strain of Escherichia coli bacteria having plasmid vector pECG3 are used for producing streptokinase. Strain cells form colonies of irregular form and creme-like consistency with boundaries as small blades on solid medium. Maximum level of streptokinase expression is achieved in 14 h of culturing. To purify streptokinase, the cells are collected by centrifuging and destroyed with ultrasound. The produced streptokinase has molecular mass of 47000 Da, its amino acid sequence fully coincides with that grown on the base of SKC-2 gene. EFFECT: enhanced reliability of method. 8 cl, 3 dwg

Description

 The invention relates to biotechnology and genetic engineering. In particular, it consists in the development of a method for the isolation and cloning of a new nucleotide sequence encoding streptokinase, as well as in the production of recombinant DNAs that are used to transform various host organisms.

 Streptokinases are plasminogen activators with a mole. weighing about 47 kVA, produced in prokaryotic cells and usually secreted into the culture medium by many hemolytic streptococci.

 The mechanism of the pathogenic effect of streptokinase has not yet been fully elucidated; presumably, it should contribute to the destruction of fibrin coatings around the infection or prevent their formation.

 It is known that when interacting with human plasma plasminogen, staphylococcal streptokinase is able to convert plasminogen into plasmin, which has proteolytic activity and the ability to convert fibrin clots into soluble products.

 In this regard, streptokinase along with urokinase and tissue plasminogen activator is currently used as a thrombolytic agent in the treatment of diseases that are one of the leading causes of death in the world, such as myocardial infarction, pulmonary, arterial or venous thromboembolism, surgical complications and others cases of thrombosis.

 There are chemical-physical and immunological differences, as well as differences in substrate specificity, which indicate molecular heterogeneity of streptokinases of various origins, although they are all very similar in function.

 Along with the low yield of streptokinase when it is obtained from streptococcus and the pathogen nature of the natural host, the disadvantages of enzyme production by this method include the fact that the streptococcus strains used for the industrial production of streptokinase secrete other by-products (deoxyribonuclease, streptolysin or hyaluronidase, proteases) which complicates the process of cleaning it.

 Due to the lack of a suitable method for their genetic processing, it has still not been possible to obtain genetically improved strains of streptococci.

 To eliminate the above disadvantages, attempts have been made to clone various isolated genes encoding streptokinase using prokaryotic and eukaryotic host cells.

 GDR patent N 249493, CIP: 012N15 / 00, describes the cloning and expression of a gene encoding a streptokinase from a group C Streptococcus equisimilis H46A strain using a bacterial cell E. coli as a host cell. At the same time, it was possible to obtain levels of the release of the enzyme in the medium from 0.1 to 1.8 mg / l, depending on the age of the culture.

 Later, the nucleotide sequence corresponding to this gene called SKC (with signal pentyl) was determined, and the primary structure of flanking regions responsible for the control of transcription and translation of this gene was deciphered (Malke, N. et al., 1985).

 The nucleotide sequences of other genes encoding streptokinase and derived from streptococci groups G and A were characterized (Walter, F et al., 1989). In particular, the gene encoding group A streptokinase (SKA gene) obtained from strain 49M Streptococcus piogenes was cloned and expressed in strain JM109. Ecoli and Strqtococcus sanguis Challis 57E strain (Huang, T. et al., 1989). The protein yield thus obtained was 0.64 mg / L and 40 μg / L, respectively. In the case of E. coli, 94% of the obtained protein was in the periplasmic space, and 6% in the cytosol, whereas in the case of S sanguis the whole protein was located outside the cell. However, many clones designed for expression of streptokinase in E. coli were highly unstable.

 Upon receipt in S sanguis, the protein molecule had a molecular weight of about 3000 daltons less than natural streptokinase. In addition, the absence of 32 amino acids from the C-terminus was found in it, which, however, did not affect its biological activity (Huang, T. T. et al., 1989).

 The results showed that the isolated SKC gene is extremely difficult to clone and express in E. coli cells, because the gene product interferes with the normal physiological activity of the host cell. This was confirmed by the texture of cells carrying this gene, and the incomplete transfer of streptokinase to the periplasmic space, and the structural instability of SKC gene carrier plasmids designed for high levels of protein expression, as well as the difficulty of cloning the streptokinase genes of some streptococcus groups in plasmids from E. coli and, finally, unsuccessful attempts to achieve the expression of foreign genes under the control of expression-secretion signals of the SKC gene itself (Muller, J. et al., 1989).

 Recently, Phillips Petroleum (DD 257646, CIP: C 12 N 15/00 and Haggenson, M.J. et al., 1989) achieved expression of streptokinase in Pichia pastoris methylotrophic yeast under the control of regulatory sequences of the alcohol dehydrogenase (ADH) gene. This process, in which continuous fermentation was used, made it possible to obtain streptokinase yields of the order of 77-250 mg per liter of culture medium with an average cell density of 46 g / l.

 The SKC gene was used as expression vectors in the plasmid pMF5, patented by Dr. J.J. Feretti from the University of Oklahoma in the name of the aforementioned company.

 This system is attractive because of its controllability and the simplicity of its suppression by glucose or glycerin and methanol induction. However, its use is limited to host cells of Pichia pastoris.

 The invention aims to obtain a high yield of streptokinase in various host cells by using expression vectors with a new nucleotide sequence corresponding to the sequence of the previously described gene encoding the bioactive streptokinase from the group C strain ATCC-9542 Streptococcus equisimilis. A new isolated gene, named SKC-2, encodes a protein the same molecular weight as the SKC gene. The main characteristic of the DNA sequence of the named gene is its stability in the vectors of E. coli and yeast, as well as the absence of a negative effect of the product on cell growth or its viability, which allows to obtain a higher enzyme yield compared to those described up to now in the literature. At the same time, the product obtained in host cells of both types is streptokinase, which is different from its hitherto known variants and has high biological activity.

 The subject of the invention is a method for producing and expressing a new nucleotide sequence corresponding to the SKC-2 gene, the product of which is a protein with a molecular weight of the order of 47,000 daltons with fibrinolytic activity.

The new gene has the following nucleotide sequence:
1
ATTGCTGGACCTGAGTGGCTGCTAGACCGTCCATCTGTCAACAACAGCCAATTAGTTGGT
AGCG
65
TTGCGGTACTGTTGAGGGGACGAATCAAGACATTAGTCTTAAATTTTTTGAAATTGACCT
Aac
129
ATCACGACCTGCTCATGGAGGAAAGACAGAGCAAGGCTTAAGTCCAAAATCAAAACCATT
TGCT
193
ACTGATAGTGGCGCGATGCCACATAAACTTGAAAAAGCTGACTTACTAAAGGCTATTCAA
GAAC
257
AATTGATCGCTAACGTCCACAGTAACGACGACTACTTTGAGGTCATTGATTTTGCAAGCG
ATGC
321
AACCATTACTGAAACGGCAAGGTCTACTTTGCGACAAAGATGGTTCGGTAACCTTGCCG
385
ACCCAACCTGTCCAAGAATTTTTTGCTAAGCGGACATGTGCGCGTTAGACCATATAAAGAA
AAAC
449
CAATACAAAATCAAGCGAAATCTGTTGATGTGGAATATACTGTACAGTTTACTCCCTTAA
ACCC
513
TGATGACGATTTCAGACCAGGTCTCAAAGATACTAAGCTATTGAAAACACTAGCTATCGG
Tgac
577
ACCATCACATCTCAAGAATTACTAGCTCAAGCACAAAGCATTTTAAACAAAAACCCACCCA
Ggct
641
ATACGATTTATGAACGTGACTCCTCAATCGTCACTCATGACAATGACATTTTCCGTACGA
TTTT
705
ACCAATGGATCAAGAGTTTACTTACCATGTCAAAAATCGGGAACAAGCTTATGAGATCAA
TAAA
769
AAATCTGGTCTGAATGAAGAAATAAACAACACTGACCTGATCTCTGAGAAATATTAAGTC
CTTA
833
AAAAAGGGGAAAAGCCGTATGATCCCTTTGATCGCAGTCACTTGAAACTGTTCACCATCA
Aata
897
CGTTGATGTCAACACCAACGAATTGCTAAAAAGCGAGCAGCTCTTAACAGCTAGCGAACG
TAAC
961
TTAGACTTCAGAGATTTATACGATCCTCGTGATAAGGCTAAACTACTCTACAACAATCTC
Gatg
1025
CTTTTGGTATTATGGACTATACCTTAACTGGAAAAGTAGAGGATAATCACGATGACACCA
ACCG
1089
TATCATAACCCTTTATATGGGCAAGCGACCCGAAGGAGAGAATGCTAGCTATCATTTAGC
CTAT
1153
GATAAAGATCGTTATACCGAAGAAGAACGAGAAGTTTACAGCTACCTGCGTTATACAGGG
ACAC
1217
CTATACCTGATAACCCTAACGACAAATAA
Lsi
A DNA fragment with the indicated sequence is also the subject of the invention. It is obtained from the genome of a group C Streptococcus eguisimilis strain (strain ATCC-9542) by gene amplification using a polymerase chain reaction (PCR), which used three synthetic oligonucleotides named SK1, SK2 and SK3 and having the following sequences:
SK1 5 '... TGGAATTCTATGAAAAATTACTTATCT ... 3'
SK2 5 '... TGGATCCTTATTTGTCGTTAGGGTTATC ... 3'
SK3 5 '..... GGAATTCATGATTGCTGGACCTGAGTGGCTG ... 3'.

 They are an element of novelty in this process. In addition, restriction sites that are not in the gene and which allow cloning directly in the expression vector are located on these seeds. On the other hand, at the 5'-end of SK2 carries the ATG codon, which serves as the starting point for the translation and elimination of the signal peptide. All three oligonucleotides were synthesized based on SKC sequences published by Malke and a group of coauthors in 1985. On this basis, a gene fragment encoding a mature protein and a complete sequence encoding a signal peptide precursor were precisely identified.

 Another novelty of this method is the possibility of expression of the isolated gene in both bacteria and yeast, and in both cases high levels of expression are achieved.

 Recombinant plasmid DNAs including the SKC-2 gene also form the subject of the invention, and especially vectors for the expression of this gene in pEKG3 bacteria (Fig. 1), and in yeast, pPESKC-4 (Fig. 3). In particular, expression in SKC-2 E. coli cells with or without a signal peptide is cloned under the control of the tryptophan promoter and T4 phage transcription terminator. For yeast, the expression vector presented in the application for copyright certificate No. 7/90, (Cu), into which, following the signal peptide of the Sacarosa Invertasa gene (CU C2), the SKC-2 gene, regulated by the promoter of the Pichia pastoris alcohol oxidase gene, was introduced and a termination signal for glyceraldehyde-3-phosphate dehydrogenase (GAPt) of Saccharomyces cerevisiae yeast (for the extracellular expression variant). The HIS3 gene of yeast 8, cerevisiae, was used as a selection marker. This vector was named pPESKC-4.

 The subject of the invention is also recombinant strains obtained by transformation of E. coli strain W3110 with pEKG3 vector and the Pichia pastoris mutant MP-36 presented in the patent application 7/90, pPESKC-4 expression vector, and characterized by high levels of streptokinase expression and high viability (the product does not inhibit cell growth) and resistance.

 The method that is the subject of the invention is characterized by a high level of expression, not previously achieved with respect to this product, as well as a high degree of purity of the enzyme, which allows its use in humans or animals, without resorting to complex and expensive cleaning processes.

 The following examples illustrate, but by no means limit the scope of this invention. In these examples, E. coli and Pichia pastoris are used as host systems. However, the method described in the invention makes it possible to use other eukaryotic and prokaryotic cells as host cells.

Example 1. When cloning the SK gene in order to isolate the genomic DNA of group C Streptococcus eguisimilis, strain ATCC-9542 was used as its source. Streptococcus eguisimilis cells were grown in Brain Hear Infusion Medium (GIBCO). Cultivation was carried out under centrifugation at a speed of 240 rpm for 12 hours at a temperature of 37 ^o C. At this stage, received 5 ml of culture, which was used to obtain the seed for fermentation in a Erlermeyer flask of 300 ml. The contents of the flask were cultured for 12 hours, then the cells were separated by centrifugation at a speed of 3000 rpm and resuspended in 8 ml of a complex solution (4.5 g of glucose, 1.86 EDTA and 1.51 g of Tris HCl in 500 ml of sterile water at pH = 8), after which 80 ml of lysozyme was added at a concentration of 10 mg / ml and incubated for 30 min at a temperature of 37 ^o C. Then, to achieve effective cell rupture (destruction), 500 ml of pronase (Boehringer), 1 ml of 10% was added SDS and 200 ml EDTA 0.5M, pH = 8. The mixture was incubated for 2 hours at 50 ^o C and stirring. Then, phenol, phenol-chloroform, and chloroform were treated sequentially. Genomic DNA was precipitated using absolute (100%) ethanol and 7.5 M NH ₄ Ac. The yield was 100 g per Erlermeyer flask with 300 ml of culture. The presence of a gene encoding streptokinase was confirmed by the Soutern Blot technique (Maniatis et al., 1982).

Example 2. For subcloning in bacteria, 1 g of Streptococcus eguisimilis DNA obtained in Pr 1 was taken and the gene encoding SKC-2 was amplified by PCR. (Randall et al. 1988). Moreover, oligonucleotides SK1 and SK2 were used for cloning a gene with a signal peptide, and oligonucleotides SK2 and SK3 were used for cloning a gene without this peptide. For each reaction, 100 picomoles of each oligonucleotide, 2 units of Tag polymerase (Pelkin-Elmer USA), 200 moles of each dNTP were used. The reaction was carried out in 10 mM MgCl ₂ , 100 mM NaCl, 100 g / ml gelatin. 30 cycles of amplification were performed. In each of them, the mixture was incubated for 1 min at a temperature of 95 ^o C for denaturation, 45 s at a temperature of 52 ^o C for the hybridization of oligonucleotides and 80 s at a temperature of 70 ^o C for propagation. Under these conditions, the amplification efficiency increased by more than 5%.

 For cloning in bacteria (E. coli), a genetic construct was used that was different from that previously proposed for the expression of this product. The tryptophan promoter from E. coli and the termination signal from the bacteriophage T4 were used in this construct.

PCR amplified fragments were digested with BamHI restriction enzyme and attached to the ptrip-Ncol-S1-BamHI vector (Estrada et al., 1988). This construct was introduced into the preparation of competent cells prepared (according to Dagert et al., 1974 and Hanahan et al., 1983) from E. coli strain HBIOI (rB ^m B-), supE ₄₄ , ara-14, gaIK-2, IacVI: proA2, rps120, (str _p , xyI-5, mt1-I, reoAI3, which were characterized by a frequency exceeding 10 ⁷ transformants per microgram of DNA. The resulting colonies were replicated on plates with LB medium (tryptone 10 g / l, yeast extract 5 g / l, sodium chloride 10 g / l) and 50 g / ml ampicillin, after which they were hybridized according to Maniatis et al., 1982. In this case, the fragment obtained as a result of amplification using olimeraznoy chain reaction (PCR) and labeled dATP ₃₂ (Amersham, UK). 4% of the colonies constituted positive clones, which were subjected to restriction analysis and showed the same hydrolysis picture with more than 10 restriction enzymes. In addition, the positive clones were checked by determining the sequence of double-stranded DNA (Sanger et al., 1977), using an oligonucleotide of 17 bases (5 '... ATCATCGAACTAGTTAA ... 3'), which hybridized to the 3'-end of the promoter, which confirmed the presence of the last expected link with the SKC-2 gene.) Selected cells it designated pEKG3 (FIG. 1), was used in the fermentation process in order to characterize the products. The plasmid of the clone pEKG3 was purified using a CsCl gradient and the SKC-2 gene sequence was obtained. In this case, 2 g of the plasmid was always taken and the oligonucleotides given below were used as seeds:
SSK-01 5 '... GAATCAAGACATTAGTC ... 3'
SSK-02 5 '... GTGGCGCGATGCCAC ... 3'
SSK-03 5 '... GCAACCATTACTGATCG ... 3'
SSK-04 5 '... CCAGTACAAAATCAAGC ... 3'
SSK-05 5 '... CTAGCTATCGGTGACAC ... 3'
SSK-06 5 '... CAGAGATCAGGTCAG ... 3'
SSK-07 5 '... GTTAAGAGCTGCTCGC ... 3'
SSK-08 5 '... CCAGTTAAGGTATAGTC ... 3 ⁶
SSK-09 5 '... TCTCGTTCTTCTTCGG ... 3'
The procedure was mainly applied according to Sanger et al., 1977, using dATP32 and S35dATP (Amersham, UK).

 In FIG. Figure 2 compares the amino acid sequence deduced from the nucleotide sequence of the SKC-2 gene and the sequences of the SKC genes (Malke et al., 1986), SKA and SKG (Walter, F et al., 1989).

 Example Z. Several E. coli strains were transformed with plasmid pEKG3: W-3110, JM-101, LE392, MC-1061. The best results were obtained for strain W-3110 (F-supF supEhsdRgalKTrpRmet Black YtonA), and therefore it was selected for large-scale fermentation and gave a steady expression level exceeding 20% of the total cell protein.

 Strain E. coli W3110 Morphological characteristic: bacteria, gram negative, grown on solid medium; colonies of irregular shape, edges in the form of small lobes, creamy consistency.

Recombinant E. coli HSK-M strain. It has the same morphological characteristics. Growth conditions and induction of the trp promoter: E. coli cells for the production of recombinant streptokinase were grown in a 5l fermenter containing 1% casein hydrolyzate (acidic), 0.5% yeast extract, 55 mM glucose, 20 mg tryptophan / l , 8 mM potassium chloride, 18 mM ammonium chloride, 22 mM dibasic potassium phosphate, 16 mM monobasic sodium phosphate, 100 mg ampicillin / L, pH 6.85-7.15. Bacteria were grown at 37 ^° C and 750 rpm for 24 hours. In the first 6 hours of growth, the culture was replenished with 5 times concentrated medium at a constant speed; a maximum yield of 50 g biomass / L culture was obtained after 16 hours. The maximum expression level of recombinant streptokinase (350 mg / L or more) was achieved after 14 hours. To purify the recombinant streptokinase, the cells were precipitated and destroyed by ultrasound. After several washing steps, the partially purified protein preparation was chromatographed on an plasminogen affinity column. To prepare the column, about 6 mg of human plasminogen was bound to 1 ml of cyanogen bromide - activated Sepharose 4B gel (Pharmacia - LKB, Sweden.), According to the manufacturer's recommendations. Plasminogen was added to the resin in 0.1 M NaHCO ₃ , pH 8.3. The column was balanced with 0.01 m Tris-HCl pH 8.0. Immobilized plasminogen was treated with 0.5 mM NPGB (Sigma, St. Louis, MO) in 0.01 M Tris-HCl, pH 8.0 per ml gel. Protein was applied to the column, and the column was washed with a buffer containing 0.01 M Tris-HCl, 1 M NaCl, pH 8.0. The protein eluted from the plasminogen-sepharose column was then skipped at a rate of 400 ml / h. after 100 ml, a column with DEAE-Sephacel (Pharmacia - LKB, Sweden), pre-equilibrated with 0.01 M Tris-HCl, pH 8.5. After washing the column with equilibration buffer, streptokinase was eluted with a 0.1 M NaCl gradient at a rate of 20 ml / h. Well-known methods were used to determine the productivity of the strains: SDS - polyacrylamide gel electrophoresis and Western blot analysis. In a Western blot analysis, purified material was analyzed using a rabbit polyclonal rabbit antiserum against streptokinase (Kabikinase, Kabi Vitrum, Sweden).

 Protein activity was determined by three methods.

a) Casein / plasminogen plate (plate) method. 10 ml of 0.05 M Tris-HCl pH 8.1 / 0.002M NaCl containing 100 mg of agarose (Sigma, USA) and 6 g of human plasminogen (Sigma) were mixed with 1.5 ml of 10%; skim milk (Difco). Wells with a diameter of 2 mm were made in the seams and 4 μl of samples were placed in each of them. The plates were incubated in a humidified chamber at 37 ^° C for 12 hours. Streptokinase activity was calculated from the curve of the dependence of the quadratic diameter of the casein lysis zone on the enzyme content (units / ml) for each sample.

 b) Analysis using a chromogenic substrate (S-2251). An analysis using a chromogenic substrate (S-2251) was used to determine the activity of streptokinase in fermentation culture and purified samples. The method is based on the formation of a stoichiometric complex between streptokinase and plasminogen and provides the detection of such small quantities as 7 international units / ml.

 In vitro blood clot disis method. The method was recommended by the British Pharmacopoeia in 1980 to determine the effectiveness of streptokinase preparations as a medicine. It determines the international unit of streptokinase using the concentration of streptokinase (1V / ml) against the logarithm of thrombus lysis time. The method is used to evaluate the activity of the final product. Determination of activity by the above methods gave similar results.

Example 4. For subcloning of the SKC-2 gene in yeast, the Pichia pastoris MP-O strain was taken as the host cell. Cloning options have been implemented for intracellular and extracellular expression based on plasmids pNAO and pPS7 (Fig. 3) using the sucrose-invertase gene for the signal peptide for extracellular construction. In both cases, the gene was cloned under the control of the promoter of the alcohol oxidase (AO) gene and the termination signal of the glyceraldehyde-3-phosphate dihydrogenase gene of S. cerevisial yeast, as well as the 3'-non-coding AO region, for homologous integration into yeast genome; in addition, a gene encoding histidine-3 was used as a selection marker in his MP-36 strain. For extracellular protein expression, the pPESKC4 vector was obtained by combining the pPS7-Ncol-Sl Nucleasa-Fosfatasa vector with the SKC-2 gene, amplified by polymerase chain reaction (PCR) based on pEKC3 and using the SK2 oligonucleotide, as well as a new seed that hybridizes with the 5'-end of the gene (this eliminates the ATG codon previously introduced into the plasmid for expression in bacteria). The resulting vector was transformed with the MP-36 his strain using the procedure of Gregg I. and coabt., 1985. Positive clones were studied by Southern blot (Maniatis Y cols., 1982). Of the clones with the correct integration, the most productive ones were selected for obtaining and product characteristics. With the extracellular expression of the recombinant streptokinase obtained in P. pastoris, its yield was 2-1-1.2 g per liter of culture medium, and in the case of intracellular expression, more than 1.0 g per liter of culture medium. In an extracellular expression construct, a glycosylated protein with a molecular weight exceeding 67,000 daltons was obtained. Using Western blot, it was found that the molecular weight characteristic of natural streptokinase is obtained by cleaving it with endoglycosidase H. To do this, we took a fraction with a concentration of 1 mg / ml in a solution of sodium citrate 0.05 M, pH = 5.5, and was denatured by adding 808 (final concentration 0.02%) and heating to 100 ^o C for 10 minutes Then the sample was cooled to room temperature and 20 millogunits of endoglycosidase H (Endo H) was added, after which it was kept at 37 ^° C for 16 hours. After that, heating to 100 ^° C was carried out for 5 minutes, then 10 milliunits of Endo H were added, followed by incubation for 12 hours at a temperature of 37 ^o C. The introduction of the drug in a 12.5% polyacrylamide gel and its comparison with the treated sample confirmed the conclusion about the increase in mol. weight due to excessive glycosylation. Streptokinase produced by Pichia pastoris on both constructs retains biological activity and does not lose its affinity for plasminogen.

 Example 5. To verify the biological activity of the SKC-2 gene product, pure recombinant yeast streptokinase obtained in bacteria (see above) was used in studies of acute and subacute toxicology in mice. In this case, satisfactory results were obtained, allowing it to be used for therapeutic purposes in humans and animals. Its in vivo fibrinolytic activity was tested by clinical trials in animals, during which it was possible to dissolve blood clots in the coronary (a. Coronaria) and femoral (a. Femoralis) arteries of dogs in compliance with the blood parameters described in the literature on this type of product. The product of the SKC-2 gene was characterized by specific activity from 50,000 to 100,000 IU / mg, measured by the methods described in example 3.

 Example 6. To verify the amino acid sequence "deduced" from the nucleotide sequence of the SKC-2 gene, the pure product was analyzed using high-resolution liquid chromatography with reverse phase (HPL C-RP) in a C8 column of 4.6 • 250 mm (Baker, VS) using a gradient from 0% buffer B (at 90% buffer A) after 5 min to 90% of buffer B (at 0% buffer A) after 55 min. Buffer A — 0.1% trifluoroacetic acid (TFA) (Pierce, VS) in distilled water, buffer B — 10.5% trifluoroacetic acid in acetonitrile (Lichrosolv, Merck, RFA); flow rate 0.8 ml / min. The amino acid sequence derived from the DNA sequence obtained for the SKC-2 gene was also verified by sequencing on a mass spectrometer using a high-purity protein. For this, the protein was cleaved by various enzymes and their combinations. The following enzymes were used: chymotrypsin, Clu-C enodoproteinase, Lys-Cy enodoproteinase, and trypsin. After mass spectrometric analysis of the peptides by superposition, a map of the amino acid sequence of the protein was compiled, which confirmed that in this case there is a 100% match between the sequence of the SKC-2 gene and the amino acid sequence of the obtained protein.

Description of the sequence SEQ ID NO: 1
Type of sequence: nucleotide and corresponding protein.

 Sequence length: 1245 bp

 Number of chains: one.

 Topology: linear.

 Molecular Type: Genomic DNA.

 Source organism: Str. equisimilis of group C.

 Direct source: ATCC-9542 strain.

 Properties: mature peptide 1-1245 bp

Product properties:
streptokinase gene;
gene product binds human plasminogen;
the gene product is an activator of human plasminogen.

Claims (8)

 1. The DNA fragment corresponding to the gene SKS-2 encoding streptokinase from a bacterial strain of Streptococcus equisimilis group C ATCC 9542, having the structure shown in p. 2. The method of expression of a DNA fragment corresponding to the gene SKS-2 encoding streptokinase from bacteria Streptococcus equisimilis group C ATCC 9542, having the structure according to claim 1, which means that the gene is amplified using synthetic oligonucleotides SK1, SK2 and SK3 of the following structure :
(SK1) 5 'TGGAATTCTATGAAAAATTACTTATCT ... 3'
(SK2) 5 'TGGATCCTTATTTGTCGTTAGGGTTATC ... 3'
(SK3) 5 'GGAATTCATGATTGCTGGACCTGAGTGGCTG ... 3',
clone it, insert it into a plasmid vector, with which competent strains of Escherichia coli bacteria or Pichia pastoris yeast are transformed, transformed strains are grown in culture medium and the expression level of the indicated gene is determined.  3. The method according to claim 2, characterized in that the E. coli strain HSK-M containing the plasmid vector pEKG3 is grown as a transformed strain of bacteria Escherichia coli.  4. The method according to claim 2, characterized in that a P. pastoris strain containing the plasmid vector pESKG4 is grown as a transformed strain of Pichia pastoris yeast. 5. The plasmid vector pEKG3, providing expression of a DNA fragment corresponding to the SKC-2 gene encoding streptokinase from bacteria of the group C of strain ATCC 95242, having the structure of claim 1, in Escherichia coli HSK-M strain cells, characterized by the following features:
- has a size of 3.7 kb;
- contains the tryptophan promoter of E. coli in the Sca I - Cla I fragment;
- contains the specified SKC-2 gene in the Ecor I - Bam HI fragment;
- contains the terminator of the bacteriophage T4 as part of the Bam HI - Hind III fragment;
- contains the gene for resistance to ampicillin;
- has unique restriction sites for endonucleases Cla I, EcoR I, Bam HI, Hind III. 6. Plasmid vector pESKC-4, providing expression of a DNA fragment corresponding to the SKC-2 gene encoding streptokinase from bacteria of Streptococcus equisimilis group C of strain ATCC 9542, having the structure according to claim 1, in cells of the strain Pichia pastoris MSK-M 4, characterized by the following signs:
- has a size of 10.1 kb;
- contains the promoter of the gene for alcohol oxidase (AOX1) as part of EcoRI - Hind III fragment;
- contains the sucrose invertase signal peptide gene (SUC 2);
- contains the specified SKC-2 gene, flanked by untranslated 5'- and 3'-sequences of the AOX 1 gene of Pichia pastoris;
- contains a signal for terminating the glyceraldehyde-3-phosphate dehydrogenase gene of the yeast Saccharomyces cerevisiae;
- contains the histidine gene 3 of the yeast Saccharomyces cerevisiae as a marker for selection;
- contains the gene for resistance to ampicillin;
- has unique restriction sites for endonucleases NCOI, EcoR I.  7. The bacterial strain Escherichia coli HSK-M containing the plasmid vector pEKG3 and used for expression of the SKC-2 gene encoding streptokinase from the bacterial strain of group C of the ATCC 9542 Streptococcus equisimilis having the structure according to claim 1. 8. Streptokinase obtained using the bacterial strain Escherichia coli HSK-M containing the plasmid vector pESG3, providing expression of a DNA fragment corresponding to the SKC-2 gene encoding streptokinase from bacteria Streptococcus equisimilis group C of strain ATCC 9542 having the structure according to claim 1, possessing the following properties:
- they say. m. 47000 Da;
- biological activity of 50,000 - 100,000 IU / mg, determined on agarose-fibrin plates, on a chromogenic substrate and in vitro thrombus lysis method;
- amino acid sequence given on p.  which is 100% identical to the amino acid sequence derived from the SKC-2 gene.

Images