RU2013106976A - Set of synthetic oligonucleotides for amplification and sequencing of ITS1-5.8S-ITS2 VASCULAR PLANTS - Google Patents
Set of synthetic oligonucleotides for amplification and sequencing of ITS1-5.8S-ITS2 VASCULAR PLANTS Download PDFInfo
- Publication number
- RU2013106976A RU2013106976A RU2013106976/10A RU2013106976A RU2013106976A RU 2013106976 A RU2013106976 A RU 2013106976A RU 2013106976/10 A RU2013106976/10 A RU 2013106976/10A RU 2013106976 A RU2013106976 A RU 2013106976A RU 2013106976 A RU2013106976 A RU 2013106976A
- Authority
- RU
- Russia
- Prior art keywords
- its2
- its1
- sequencing
- amplification
- synthetic oligonucleotides
- Prior art date
Links
Abstract
Набор синтетических олигонуклеотидов для амплификации и секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающий проведение полимеразной цепной реакции с помощью универсальных праймеров, отличающийся тем, что в качестве праймеров используются последовательности ДНК со следующим нуклеотидным составом:primer ITS-for CGTAACAAGGTTTCCGTAGprimer ITS-rew GGAATCCTTGTAAGTTTCTTT.A set of synthetic oligonucleotides for amplification and sequencing ITS1-5.8S-ITS2 vascular plants, comprising carrying out a polymerase chain reaction using universal primers, wherein the primers are used as a DNA sequence with the following nucleotide composition: primer ITS-for CGTAACAAGGTTTCCGTAGprimer ITS-rew GGAATCCTTGTAAGTTTCTTT .
Claims (1)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2013106976/10A RU2528063C1 (en) | 2013-02-18 | 2013-02-18 | Set of synthetic oligonucleotides for amplification and sequencing its1-5,8s-its2 of vascular plants |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2013106976/10A RU2528063C1 (en) | 2013-02-18 | 2013-02-18 | Set of synthetic oligonucleotides for amplification and sequencing its1-5,8s-its2 of vascular plants |
Publications (2)
Publication Number | Publication Date |
---|---|
RU2013106976A true RU2013106976A (en) | 2014-08-27 |
RU2528063C1 RU2528063C1 (en) | 2014-09-10 |
Family
ID=51455910
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
RU2013106976/10A RU2528063C1 (en) | 2013-02-18 | 2013-02-18 | Set of synthetic oligonucleotides for amplification and sequencing its1-5,8s-its2 of vascular plants |
Country Status (1)
Country | Link |
---|---|
RU (1) | RU2528063C1 (en) |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2113481C1 (en) * | 1996-08-28 | 1998-06-20 | Институт общей генетики им.Н.И.Вавилова РАН | Method of investigation of structural-functional organization of dna of eucaryotic ribosomal claster |
CN101348833B (en) * | 2008-07-16 | 2010-12-01 | 江苏同源堂生物工程有限公司 | ITS sequence of Tremella aurantiablba Bandoni and Stereum hirsutum and method for identifying golden fungus using the same |
-
2013
- 2013-02-18 RU RU2013106976/10A patent/RU2528063C1/en not_active IP Right Cessation
Also Published As
Publication number | Publication date |
---|---|
RU2528063C1 (en) | 2014-09-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2015081229A3 (en) | Selective amplification of nucleic acid sequences | |
WO2015196128A3 (en) | Alternative nucleic acid molecules and uses thereof | |
WO2015196130A3 (en) | Alternative nucleic acid molecules and uses thereof | |
MX2022007933A (en) | Polymethine compounds and their use as fluorescent labels. | |
EP4303314A3 (en) | Polypeptide tagged nucleotides and use thereof in nucleic acid sequencing by nanopore detection | |
SA516371691B1 (en) | Methods and compositions for dna profiling | |
JP2016526529A5 (en) | ||
EP3252172A3 (en) | Fast hybridization for next generation sequencing target enrichment | |
EP4257596A3 (en) | Coumarin compounds and their uses as fluorescent labels | |
WO2015107425A3 (en) | Chiral design | |
BR112015023398A8 (en) | METHODS TO AMPLIFY NUCLEIC ACIDS | |
MY196912A (en) | Short pendant arm linkers for nucleotides in sequencing applications | |
MX2018014163A (en) | Labeled nucleotide compositions and methods for nucleic acid sequencing. | |
WO2012170907A3 (en) | Polymerization of nucleic acids using proteins having low isoelectric points | |
MY184632A (en) | A method of identifying parentage in freshwater prawn macrobrachium rosenbergii | |
EA201691702A1 (en) | MTI CHEMICAL PROTEINS | |
WO2016172126A3 (en) | Experimentally validated sets of gene specific primers for use in multiplex applications | |
MX370616B (en) | Nucleic Acid Amplification. | |
WO2014136124A3 (en) | Multiplex real time pcr testing kit for the simultaneous detection of hepatitis virus | |
WO2015166354A3 (en) | Dna polymerases from the red sea brine pool organisms | |
RU2013106976A (en) | Set of synthetic oligonucleotides for amplification and sequencing of ITS1-5.8S-ITS2 VASCULAR PLANTS | |
ES2421459A1 (en) | Special polymerase chain reaction primers | |
EP3252168A4 (en) | Pcr primer linked to complementary nucleotide sequence or complementary nucleotide sequence including mis-matched nucleotides and method for amplifying nucleic acid using same | |
ES2671745T3 (en) | Neisseria gonorrhoeae detection | |
WO2014122422A3 (en) | Amplification technique |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20180219 |