RU2013106976A - Set of synthetic oligonucleotides for amplification and sequencing of ITS1-5.8S-ITS2 VASCULAR PLANTS - Google Patents

Set of synthetic oligonucleotides for amplification and sequencing of ITS1-5.8S-ITS2 VASCULAR PLANTS Download PDF

Info

Publication number
RU2013106976A
RU2013106976A RU2013106976/10A RU2013106976A RU2013106976A RU 2013106976 A RU2013106976 A RU 2013106976A RU 2013106976/10 A RU2013106976/10 A RU 2013106976/10A RU 2013106976 A RU2013106976 A RU 2013106976A RU 2013106976 A RU2013106976 A RU 2013106976A
Authority
RU
Russia
Prior art keywords
its2
its1
sequencing
amplification
synthetic oligonucleotides
Prior art date
Application number
RU2013106976/10A
Other languages
Russian (ru)
Other versions
RU2528063C1 (en
Inventor
Максим Геннадьевич Кунев
Ольга Васильевна Уварова
Татьяна Александровна Синицина
Original Assignee
Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Алтайский государственный университет"
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Алтайский государственный университет" filed Critical Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Алтайский государственный университет"
Priority to RU2013106976/10A priority Critical patent/RU2528063C1/en
Publication of RU2013106976A publication Critical patent/RU2013106976A/en
Application granted granted Critical
Publication of RU2528063C1 publication Critical patent/RU2528063C1/en

Links

Abstract

Набор синтетических олигонуклеотидов для амплификации и секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающий проведение полимеразной цепной реакции с помощью универсальных праймеров, отличающийся тем, что в качестве праймеров используются последовательности ДНК со следующим нуклеотидным составом:primer ITS-for CGTAACAAGGTTTCCGTAGprimer ITS-rew GGAATCCTTGTAAGTTTCTTT.A set of synthetic oligonucleotides for amplification and sequencing ITS1-5.8S-ITS2 vascular plants, comprising carrying out a polymerase chain reaction using universal primers, wherein the primers are used as a DNA sequence with the following nucleotide composition: primer ITS-for CGTAACAAGGTTTCCGTAGprimer ITS-rew GGAATCCTTGTAAGTTTCTTT .

Claims (1)

Набор синтетических олигонуклеотидов для амплификации и секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающий проведение полимеразной цепной реакции с помощью универсальных праймеров, отличающийся тем, что в качестве праймеров используются последовательности ДНК со следующим нуклеотидным составом:A set of synthetic oligonucleotides for amplification and sequencing of ITS1-5.8S-ITS2 vascular plants, including the polymerase chain reaction using universal primers, characterized in that DNA sequences with the following nucleotide composition are used as primers: primer ITS-for CGTAACAAGGTTTCCGTAGprimer ITS-for CGTAACAAGGTTTCCGTAG primer ITS-rew GGAATCCTTGTAAGTTTCTTT. primer ITS-rew GGAATCCTTGTAAGTTTCTTT.
RU2013106976/10A 2013-02-18 2013-02-18 Set of synthetic oligonucleotides for amplification and sequencing its1-5,8s-its2 of vascular plants RU2528063C1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
RU2013106976/10A RU2528063C1 (en) 2013-02-18 2013-02-18 Set of synthetic oligonucleotides for amplification and sequencing its1-5,8s-its2 of vascular plants

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
RU2013106976/10A RU2528063C1 (en) 2013-02-18 2013-02-18 Set of synthetic oligonucleotides for amplification and sequencing its1-5,8s-its2 of vascular plants

Publications (2)

Publication Number Publication Date
RU2013106976A true RU2013106976A (en) 2014-08-27
RU2528063C1 RU2528063C1 (en) 2014-09-10

Family

ID=51455910

Family Applications (1)

Application Number Title Priority Date Filing Date
RU2013106976/10A RU2528063C1 (en) 2013-02-18 2013-02-18 Set of synthetic oligonucleotides for amplification and sequencing its1-5,8s-its2 of vascular plants

Country Status (1)

Country Link
RU (1) RU2528063C1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2113481C1 (en) * 1996-08-28 1998-06-20 Институт общей генетики им.Н.И.Вавилова РАН Method of investigation of structural-functional organization of dna of eucaryotic ribosomal claster
CN101348833B (en) * 2008-07-16 2010-12-01 江苏同源堂生物工程有限公司 ITS sequence of Tremella aurantiablba Bandoni and Stereum hirsutum and method for identifying golden fungus using the same

Also Published As

Publication number Publication date
RU2528063C1 (en) 2014-09-10

Similar Documents

Publication Publication Date Title
WO2015081229A3 (en) Selective amplification of nucleic acid sequences
WO2015196128A3 (en) Alternative nucleic acid molecules and uses thereof
WO2015196130A3 (en) Alternative nucleic acid molecules and uses thereof
MX2022007933A (en) Polymethine compounds and their use as fluorescent labels.
EP4303314A3 (en) Polypeptide tagged nucleotides and use thereof in nucleic acid sequencing by nanopore detection
SA516371691B1 (en) Methods and compositions for dna profiling
JP2016526529A5 (en)
EP3252172A3 (en) Fast hybridization for next generation sequencing target enrichment
EP4257596A3 (en) Coumarin compounds and their uses as fluorescent labels
WO2015107425A3 (en) Chiral design
BR112015023398A8 (en) METHODS TO AMPLIFY NUCLEIC ACIDS
MY196912A (en) Short pendant arm linkers for nucleotides in sequencing applications
MX2018014163A (en) Labeled nucleotide compositions and methods for nucleic acid sequencing.
WO2012170907A3 (en) Polymerization of nucleic acids using proteins having low isoelectric points
MY184632A (en) A method of identifying parentage in freshwater prawn macrobrachium rosenbergii
EA201691702A1 (en) MTI CHEMICAL PROTEINS
WO2016172126A3 (en) Experimentally validated sets of gene specific primers for use in multiplex applications
MX370616B (en) Nucleic Acid Amplification.
WO2014136124A3 (en) Multiplex real time pcr testing kit for the simultaneous detection of hepatitis virus
WO2015166354A3 (en) Dna polymerases from the red sea brine pool organisms
RU2013106976A (en) Set of synthetic oligonucleotides for amplification and sequencing of ITS1-5.8S-ITS2 VASCULAR PLANTS
ES2421459A1 (en) Special polymerase chain reaction primers
EP3252168A4 (en) Pcr primer linked to complementary nucleotide sequence or complementary nucleotide sequence including mis-matched nucleotides and method for amplifying nucleic acid using same
ES2671745T3 (en) Neisseria gonorrhoeae detection
WO2014122422A3 (en) Amplification technique

Legal Events

Date Code Title Description
MM4A The patent is invalid due to non-payment of fees

Effective date: 20180219