PT98326B - PROCESSES FOR THE PREPARATION OF ANTIGENES OF CELL SURFACE, CD27, CD53 AND TLISA, AND OF PHARMACEUTICAL COMPOSITIONS UNDERSTANDING THE ANTIGENES - Google Patents

Description

Some commonly used methods are described for example in Maniatis et al. Molecular Clonine: A Laboratorv Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1982).

Once a genomic cDNA library is constructed, it is necessary to isolate from the thousands of host cells the cell containing the particular human gene of interest. Many different methods of isolating target genes from cDNA libraries with variable success have been used. These include for example the use of nucleic acid probes, which are fragments of labeled mRNA having nucleic acid sequences complementary to the target gene's DNA sequence. When this method is applied to cDNA clones of mRNAs abundant in transformed bacterial hosts, colonies that strongly hybridize with the probe likely contain the target DNA sequences. The identity of the clone can then be tested for example by in situ hybridization / selection (Goldberg et al., Methods 68: 206 (1979)) for hybrid translation (Paterson et al., Proceedings of the National Academies of Sciences (1978), 74: 4370 (1977)), or direct DNA sequencing (Maxam and Gilbert, Proceedings of the Natural Academy of Sciences, 74: 560 (1977), Maat and Smith, Nucleic Acids Res., 5: 4537 (1978)). .

However such methods have drawbacks when the aim is to clone mRNAs of relatively low abundance from cDNA libraries. For example, using direct colony hybridization in situ. it is very difficult to detect clones containing cDNA complementary to mRNA species present in the initial library population in an amount less than 1/200. As a result of this a number of methods have been developed for enriching mRNA in the total population (e.g., size fractionation, use of synthetic oligodeoxynucleotides, differential hybridization or immunopurification) and are often 4

mRNAs are cloned. Such methods are described, for example, in Maniatis et al., Molecular Clonidine: A Laboratorv Manual, supra.

Many functional eukaryotic proteins exist initially in the form of precursor molecules which contain leader or signal sequences at their N-terminal ends. These leader sequences bind to the cell membrane and carry the remaining protein through the lipid bilayer, whereupon the signal sequence is cleaved from the protein by a signal-peptidicase enzyme. The protein thus functions only after secretion of the cells (e.g., insulin, serum albumin, antibodies and enzymes from the digestive tract) or after the proteins have been anchored to the outer surface of a cell membrane (e.g., histocompatibility antigens).

Cell surface antigens characteristic of mammalian T lymphocytes are other examples of proteins that are anchored to the cell surface. In mammals, certain bone marrow-derived cells mature to give lymphocytes, which are present in lymphoid organs, including the thymus, spleen, lymph nodes and lymphoid aggregates and also circulate actively through the blood and lymphatic systems. Mature lymphocyte cells can be divided into two populations: thymus dependent (T) lymphocytes and thymus independent lymphocytes (B). T lymphocytes migrate into the thymus where they undergo proliferation and differentiation. During their differentiation process, they express characteristic alloantigens of the cell membrane, including Thy-1, TLA, gv-1, Ly-1, Ly-2, Ly-3 and Ly-5. As they mature, T lymphocytes lose the TLA antigens and some of the Thy-1 antigens and gain histocompatibility antigens, acquiring the membrane conformation typical of circulating T lymphocytes. This is described by 5

for example, by Mota, " Activity of immune Cells " in Bier et al., eds. Fundamental of Immunoloav. 2d Ed., Springer-Verlag, Berlin, pp. 35-62 (1986).

T lymphocytes are indirectly involved in the formation of antibodies and their activities therefore require complex analysis of cellular function, in addition to simple measurement of antibody titer. In part because of this, its importance in the development of immunological competence was not recognized until relatively recently. Mature T lymphocytes synthesize and express a unique pattern of the surface glycoprotein antigens that serve as tags for the identification of different subpopulations of T lymphocytes, including helper T cells, suppressor T cells, and cytotoxic T cells. Each of these subpopulations plays a very important role in regulating the immune system. (Mota, supra).

J

In humans, the functional and phenotypic heterogeneity of T lymphocytes is well accepted. Two major subpopulations are known: effector T cells mediate cellular immunity; and regulatory T cells containing helper and suppressor T lymphocytes. These two subpopulations were defined with heteroantibody, autoantibodies and monoclonal antibodies directed against cell surface antigens. For example, at the outset of its development human lymphoid cells in the thymus express a Til antigen that reacts strongly with a monoclonal antibody designated Cluster of Differentiation 2 (CD2) and reacts lightly with the monoclonal antibody CD5 against Tl cell surface antigen. During maturation, these cells lose Til (CD2) and acquire three new antigens defined by CD4, CD8 and CD1 monoclonal antibodies. With more maturation, the thymocytes cease to express the cell surface antigens reactive with 6 Λ!

I

CD1 monoclonal antibody, express T3 antigen reactive with CD3 monoclonal antibody and then secreted into two subpopulations expressing T4 (CD4) or T8 (CD8) antigen. Immune competence is acquired at this stage, but is not fully developed until the thymic lymphocytes migrate out of the thymus. (Mota, supra.) On the contrary, they express Tl (CD5) and T3 (CD3) antigens. T4 antigen (CD4) is present in about 55-65% of peripheral T lymphocytes, while the T8 (CD8) antigen is expressed in 20-30%. These two subpopulations correspond to helper and suppressor and cytotoxic T cells, respectively.

In addition to providing a convenient means of distinguishing subpopulations of T lymphocytes, these cell surface antigens are important for mature T cell activation and effector function. Activation of T cells involves a complex series of interactions at the cell surface between the T cell and the target cell or stimulator cell in addition to binding to its specific antigen.

For example, CD2, the erythrocyte receptor for human T cells, allows thymocytes and T lymphocytes to adhere to target cells (e.g., erythrocytes) and thymic epithelium. This occurs via a CD2-specific molecular ligand, designated LFA-3, in humans, which is a broadly distributed surface antigen. This phenomenon was employed to detect, test and purify human erythrocyte antibody producing cells and serve as the basis for the E rosette test for the first time described by Zaalberg, Nature 202: 1231 (1964). CD2 / LFA-3 interactions were found to mediate cytolytic conjugation to the target (Shaw et al., Nature 323: 262--264 (1986) and the mixed lymphocyte reaction (Martin et al., J.

Immunol. 131: 180-185 (1983). Anti-CD2 monoclonal antibodies can directly activate peripheral T lymphocytes through an antigen-independent pathway (Meuer et al., Cell 36: 897-906 (1984)), indicating a broader immuno-regulatory role for CD2. The recognition that T lymphocytes are the major effectors of cellular immunity and are also involved as helper or suppressor cells in modulating the immune response has resulted in a significant contribution to the increasing practical application of clinical immunology to medicine. The scope of this application includes defense against infections, prevention of diseases by immunization, organ transplantation, blood banks and treatment of deficiencies of the immune system and a variety of disorders that are mediated by immunological mechanisms. Yet, immunological techniques are often used in a clinical laboratory, such as in the measurement of hormones and drugs. Clinical immunology is described, for example, in Weir, ed., Handbook of experimental Immunology in Four Volumes: Volume 4: Applications of Immunological Methods in Biomedical Sciences. 4a ed., Blackwell Scientific Publications, Oxford (1986); Boguslaski et al., Eds., Clinical Immunochemistry: Principles of Methods and Applications. Little, Brown Co., Boston (1984); Holborow et al. eds., Immunology in Medicine: A Comprehensive Guide to Clinical

Immunoloqy. 2d Ed., Grune & Stratton, London (1983); and Petersdorf et al., eds., Harrisoms Principles of Internal Medicine. 10th ed., McGraw-Hill, New York, pp. 344-391 (1983). Clearly, a more exhaustive comparison of the proteins that mediate the immune system to clinical immunology will be important. The use of mammalian expression libraries to isolate cDNAs encoding for memantine proteins such as those described above offer several advantages. For example, the protein expressed in a mammalian host cell should be functional and must undergo any normal post-translational modification. A protein normally transported through the intracellular membrane system to the cell surface must undergo the complete transport process. A mammalian expression system will also allow the study of intracellular transport mechanisms and the mechanism that inserts and anchors cell surface proteins into membranes.

A mammalian host cell, designated a " COS " cell, is formed by infection of monkey reed cells with a mutant viral vector, designated simian virus 40 (SV40), which has both early and late functional genes but does not possess a functional origin of replication. In COS cells, any foreign DNA cloned into a vector containing the SV40 origin of replication that replicates due to the SV40 T antigen is present in COS cells. The foreign DNA will replicate transiently, regardless of the cellular DNA.

With the exception of a few recent lymphokine cDNAs isolated by expression in COS cells (Wong, GG, et al., Science 228: 810-815 (1985); Lee, F. et al., Proceedings of the National Academic of Sciences. , Yokota, T., et al .. Proceedings of the National Academy of Sciences, USA 83: 5894-5898 (1986); Yang, Y., et al., Cell 47: 3-10 (1986)), however, few cDNAs were generally isolated from mammalian expression libraries. There appear to be two main reasons for this: first, the existing technology (Okayama, H. et al., Mol. Cell Biol. 2: 161-170 (1982)) for the construction of large plasmid libraries is difficult to manipulate and the size of the library rarely approximates those accessible by phage cloning techniques. (Huynh, T. et al .. In: DNA Cloninq Vol. I, A Practical Approach, Glover, D.M. (ed.), IRL Press, Oxford (1985), pp. 49-78). Second, existing vectors are, with the exception of one (Wong, G.G., et al., Science 228: 810-815 (1985)), poorly adapted to high levels of expression, particularly in COS cells. The described successes with lymphokine cDNAs do not imply a general success of the methods used, since these cDNAs are particularly easy to isolate from expression libraries. Lymphokine bioassays are very sensitive (Wong, GC, et al., Science 228: 810-815 (1985), Lee, F. et al., Proceedings of the National Academy of Sciences, USA 83: 2061-2065 (1986) (1986): Yokota, T. et al., Proceedings of the National Academy of Sciences, USA 83: 5894-5898 (1986); Yang, Y. et al., Cell 47: 3-10 (1986)) and mRNAs are typically abundant and short (Wong, GC et al., Science 228: 810-815 (1985); Lee, F., et al., Proceedings of the National Academy of Sciences, USA, 83: 2061-2065 (1986) Yokota, T., et al., Proceedings of the National Academy of Sciences, USA 83: 5894-5898 (1986); Yang, Y., et al., Cell 47: 3-10 (1986)) .

Thus, mammalian host expression is essentially employed as a means of verifying the identity of the protein encoded by a gene isolated by more traditional cloning methods. For example, Stuve et al., J. Virol. S1S2X. * 327-335 (1987), cloned the herpes simplex glycoprotein gB2 gene type II strain 333 by plaque hybridization of the recombinant M13-based phage vectors used to transform competent E. coli JM101. The identity of the protein encoded by the clone thus isolated was verified by transfection of COS mammalian and Chinese hamster ovary (CHO) cells. Expression was demonstrated by immunofluorescence and radioimmunoprecipitation.

Oshima et al. used plaque hybridization to screen a lambda gtll phage cDNA library relative to the gene encoding human placenta beta-glucuronidase. Oshima et al., Proceedings of the National Academv of

Sciences, USA 84: 685-689 (1987). The identity of the isolated cDNA clones was verified by immunoprecipitation of the expressed protein by COS-7 cells transfected with cloned inserts using the SV40 late promoter. Transient expression in mammalian cells was employed as a means of confirming the identity of the genes previously isolated by other screening methods. Gerald et al., Journal of General Virology 67: 2695-2703 (1986). Mackenzie, Journal of Biological Chemistry 261: 14112-14117 (1986); Seif et al. . Gene 43: 1111-1121 (1986); Orkin et al. . Molecular and Cellular Biol., 5 (4): 762-767 (1985). These methods are often ineffective and time consuming and require several rounds of screening to identify full-length or overlapping clones. Earlier screening methods based on the expression of fusion proteins are ineffective and require large amounts of monoclonal antibodies. Such disadvantages are accentuated by the use of ineffective expression vectors which result in levels of expressed protein that are inadequate to allow effective selection.

SUMMARY OF THE INVENTION The present invention relates to a novel method for cloning cDNA encoding cell surface antigens with a method for constructing cDNA libraries with highly efficient expression vectors particularly suited to expression of high levels of expression in host eukaryotic cells and with the isolated nucleotide sequences and their encoded products. The highly effective cloning technique of the present invention is based on the transient expression of antigen in 11

eukaryotic cells and physical selection of antigen expressing cells by adhesion of the cells to an antibody coated substrate, such as a culture dish. The methods of the present invention are useful for the isolation and molecular cloning of any protein that can be expressed and transported to the cell surface membrane of a eukaryotic cell.

The method for cloning cDNA encoding a cell surface antigen of the present invention comprises the preparation of a cDNA library; introduction of this cDNA library into a eukaryotic mammal preferably cells in tissue culture; culturing these cells under conditions allowing the expression of the cell surface antigen; exposing the cells to a first antibody or antibodies directed against the cell surface antigen, thus allowing the formation of a cell surface antigen-first antibody complex; subsequent exposure of the cells to a substrate coated with a second antibody directed against the first antibody, thereby causing cells expressing the cell surface antigen to adhere to the substrate through the formation of a cell surface antigen-first antibody-second antibody complex; and separation of adherent and non-adherent cells.

By the cloning method of the present invention, the isolation and molecular cloning of genes encoding surface antigens such as CDLA, CD1b, CD1c, CD2, CD6, CD7, CD14, CD14, CD16, CD19, CD20, CD22, CD26, CD27, CD27, CD28, CD28, CD33, CD33, CD34, CD34, CD34, CD36, CD37, CD38, CD39, CD40, CD43, CD44, CD53, ICAM, LFA-3, FcRIa, FcRIb, TLISa and Leu8. The nucleotide sequences of the genes cloned by the method of the present invention have determined and identified the amino acid sequences of the encoded proteins. A cloned gene, such as% 12

CD36, CD36, CD22, CD28, CD28, CD28, CD28, CDw32a, CDw32b, CD33, CD34, CD36, CD36, CD37, CD38, CD38, CD39, CD40, CD43, CD44, CD53, ICAM, LFA-3, FcRIa, FcRIb, TLiSa and Leu8 is also an object of the present invention.

Once the gene encoding an antigen according to the method of the present invention is cloned, that gene may be expressed in a prokaryotic or eukaryotic host cell to produce the encoded protein or part thereof in a substantially pure form in a form that does not exist in nature. A further aspect of the present invention is related to substantially pure cell surface antigens, particularly: CD1a, CD1b, CD1c, CD2, CD6, CD6, CD7, CD7, CD14, CD16, CD16, CD19, CD20, CD22, CD26, CD27, CD28, CD31 antigens CD38, CD33, CD34, CD33, CD34, CD33, CD34, CD36, CD37, CD38, CD39, CD40, CD43, CD44, CD53, ICAM, LFA-3, FcRIa, FcRIb, TLiSa and Leu8 and functional analogs thereof. The primary amino acid sequences of the CD3, CD28, CD32, CD32, CD32, CD33, CD34, CD34, CD36, CD36, CD27, CD28, CD28, , CD38, CD39, CD40, CD43, CD44, CD53, ICAM, LFA-3, FcRIa, FcRIb, TLiSa and Leu8 were determined, the invention is therefore also related to the amino acid sequences of those antigens and their functional equivalents and sequences of nucleotides encoding those antigens.

This invention also relates to expression vectors that allow the production of very large mammalian expression libraries and give large amounts of protein in mammalian host cells, resulting in an effective selection. In a particular embodiment of this invention, a cDNA expression vector comprises a suppressor tRNA gene; an SV40 origin; a synthetic transcription unit, comprising a 13 J * promoter,

chimeric fusion protein composed of immediate early potentiating sequences of human cytomegalovirus AD169 fused to HIV LTR -60 to +80 sequences, inserted between the suppressor tRNA gene and the SV40 origin; a synthetic transcription unit comprising a chimeric promoter composed of immediate early potentiating sequences of human cytomegalovirus AD169 fused to HIV LTR -60 to +80 sequences inserted between the suppressor tRNA gene and the SV40 origin; a polyadapter comprising two BstXI sites separated by a substitutable DNA sequence and delimited by XbaI sites; and " splicing " of the small antigen t and polyadenylation of the SV40 early region.

A further aspect of the present invention comprises a synthetic transcription unit for use in a cDNA expression vector comprising a chimeric promoter composed of early human cytomegalovirus AD162 DNA primer fused with HIV LTR -60 to +80 sequences. The small size and particular arrangement of the cDNA expression vector sequences of the present invention allows highly efficient replication in tissue culture mammalian cells, such as COS cells. In addition, this vector employs a polyadapter containing two inverted BstXI sites separated by a small segment of substitutable DNA, which allows the use of a very efficient oligonucleotide-based cDNA insertion strategy.

In another aspect, the present invention comprises a vector having two identical BstI sites in an inverted orientation one to the other, BstXI sites which are separated by a small, replaceable DNA fragment. A further aspect of the invention is a polyadapter as described above.

Another aspect of the invention relates to an oligonucleotide-based cDNA insertion method, characterized by the ligation of synthetic DNA oligonucleotides to the desired cDNA segment to be inserted into a vector, synthetic DNA oligonucleotides giving the same sequences termini of the small fragment of the DNA substitutable polyadapter of the invention and insertion of the resulting cDNA segment plus terminal sequences of synthetic oligonucleotides into the vector polyadapter from which the small fragment of the replaceable DNA was removed.

In the preparation of cDNA libraries according to the present invention, it has been found that many tumors are highly infiltrated by macrophages and lymphocytes and can thus be employed as a source of macrophage or lymphocyte transcription products with good effect instead of the lines of commonly used tumor cells. In a further aspect, the present invention relates to the use of tumor cells, particularly human tumor cells, to prepare cDNA libraries for use in accordance with the methods of the present invention.

A further advantage of the powerful selection system of the present invention is that targeted insertion of the cDNA is not necessary. The method of the present invention results in library construction efficiencies which are in line with those described for phage vectors such as lambda gt10 and lambda gt11, with the additional advantage that the clones generated according to the methods of the present invention are easier to manipulate. The immuno-screening technique of the present invention allows the efficient use of antibodies, which may be mononuclear or polyclonal, in relatively small absolute amounts. The method of the present invention is also fairly rapid. Generally, three or fewer immuno-screening and fishing cycles are required to isolate a target cDNA clone. Thus, the method of the present invention also results in the efficient use of labor and materials when cloning genes encoding cell surface antigens. As described above, this method has been employed to successfully clone genes encoding cell surface antigens associated with mammalian T lymphocytes (eg, CD1a, CD1b, CD1c, CD2, CD6, CD7, CD14, CD14, CD14, CD16, CD19, CD20 antigens CD38, CD39, CD40, CD40, CD44, CD44, CD44, CD33, ICAM, LFA-3, FcRIa, FcRIb, TLiSa and Leu8).

The purified genes and proteins of the present invention are useful for immunodiagnostic and immunotherapeutic applications, including the diagnosis and treatment of infections, diseases, and immune mediated disorders in animals, including humans. They may also be used to identify, isolate and purify other antibodies and antigens. Such diagnostic and therapeutic uses further comprise a further aspect of the present invention. In addition, the substantially pure proteins of the present invention may be prepared as medicaments or pharmaceutical compositions for therapeutic administration. The present invention further relates to such medicaments and compositions.

Brief Description of Drawings

Fiaura 1. Nucleotide sequence of expression vector ΡΪΗ 3

Nucleotides 1-589 are derived from the origin of pMB1 (pBR322 ori); nucleotides 598-799 are derived from the synthetic tyrosine suppressor tRNA gene (supF gene); nucleotides 800-947 are derived from a trace of the ASV LTR fragment (PvuII to Miul); nucleotides 948-1500 are derived from the human cytomegalovirus AD169 enhancer; nucleotides 1501-1650 are derived from HIV TATA and tat responding elements; nucleotides 1651-1716 are derived from the piLNAXN polyadapter (HindIII to Xba); nucleotides 1717-2569 are derived from pSV for " splicing " and polyadenylation signals; nucleotides 2570-2917 are derived from the SV40 origin of replication (PvuII to HindIII); and nucleotides 2918-2922 are derived from piVX, which remains from the RI site of the polyadapter.

Figure 2. Nucleotide sequence of the CD2 cDNA insert Nucleotide numbering is given in parentheses to the right, amino acid numbering on the left. Locations of the potential asparagine-linked sugar addition sites (CHO), as well as the predicted transmembrane sequence, are presented. The amino acid sequence is enumerated from the projected cleavage site of the secretory signal sequence.

Figure 3. CDM8 expression vector restriction map CDM8 vector includes a deletion version of a mutant early region of the polyoma virus selected relative to expression of high efficacy in mouse and monkey cells. Essentially the entire human immunodeficiency promoter region was replaced with the cognate sequences of the cytomegalovirus immediate early promoter and by inclusion of a T7 bacteriophage promoter between the eukaryotic promoter and the cDNA insertion site. The arrows indicate the direction of the transcription.

Figure 4. Nucleotide sequence and corresponding amino acid sequence of the LFA-3 antigen WOP cells transfected with a clone encoding the LFA-3 antigen were detected by amplified and sequenced indirect immunofluorescence. (A) shows the insertion of S74 pairs of bses containing a 237 residue open reading frame starting a methionine codon and ending in a series of hydrophobic residues. The hydrophobic and hydrophilic regions within this open reading frame are shown in (B).

Figure 6. Nucleotide sequence of the vector PÍH3M

There are 7 segments. Residues 1-587 are from the replication origin of pBR322, 588-1182 from the origin of M13, 1183-1384 from the supF gene, 1385-2238 from the cytomegalovirus / human immunodeficiency virus chimeric promoter, 2239-2647 are from 2648-3547 of plasmid pSV2 (" splicing " and polyadenylation signals) and 3548-3900 of the SV40 virus origin.

Figure 7. Nucleotide sequence of the CD28 cDNA

Nucleotide numbering is given in parentheses to the right, amino acid numbering, center and left. The location of the potential asparagine-linked sugar addition sites (CHO) as well as the predicted trans-membrane (TM) sequence are shown. The amino acid sequence is numbered from the projected cleavage site of the secretory signal sequence.

Figure 8.

Nucleotide sequence of the CD7 cDNA insert Nucleotide numbering is given in parentheses to the right. The donor and acceptor sites are indicated by (/). The location of potential asparagine-bound sugar addition sites (CHO) is shown, the potential fatty acid esterification site is denoted by (*) and the specific transmembrane (TM) domain is underlined. The nucleotide sequences potentially involved in the formation of hook structures are denoted by (.). The presumed polyadenylation signal is underlined.

Figure 9. Nucleotide sequence of CDw32 cDNA The number of nucleotides is given in parentheses to the right, center and left amino acid numbering. The locations of the potential asparagine-linked sugar addition sites (CHO) are shown, as well as the transmembrane (TM) sequence. The amino acid sequence is numbered from the projected cleavage site of the secretory signal sequence. Cysteine residues are marked with asterisks.

Figure 10. CD20.4 cDNA sequence

A. Sites of potential N-linked glycosylation are denoted by -CHO-; the hydrophobic regions are marked. The poly (A) + tail site in clone CD20.6 is represented by an asterisk. B. The hydrophobicity profile of the sequence in A.

Fiaura 11.

Sequence of ICAM-1

Complete nucleotide sequence of the ICAM-1 cDNA insert and predicted protein sequence. Nucleotide numbering is on the left, amino acid numbering in the center. The RGE motif at position 128 is underlined, the potential N-linked glycosylation sites are indicated by -CHO- and the trans-membrane domain by -TM-. The amino acid sequence is numbered from the projected cleavage site of the signal peptide. Sequencing was by termination of dideoxy chains (Sanger, F., et al., Proc. Natl. Acad Sci USA 74: 5463-5467 (1977)) using a combination of specific subclones and oligonucleotides.

Figure 12. Figure 13. Figure 15. Figure 16. Figure 17.

CD19 Nucleotide Sequence CD20 Nucleotide Sequence CDw32a Nucleotide Sequence CDw32b Nucleotide Sequence CD40 Nucleotide Sequence.

Detailed Description of the Invention

This invention relates to a novel method for the cloning of cDNA encoding a cell surface antigen and to a method for constructing cDNA libraries. It is also related to particular cDNA expression vectors and their component, nucleotide sequences or genes isolated by the method, substantially pure cell surface antigens encoded by the cDNA segments and methods of 20

use of the isolated nucleotide sequences and encoded products.

In the following description, reference will be made to various methodologies known to those skilled in the art of recombinant genetics. Publications and other materials which describe such methodologies to which reference is made herein are hereby incorporated by reference in their entirety. Papers whose reference is widely used and which describe the general principles of recombinant DNA technology include Darnell, J.E. et al., Molecular Cell Biology. Scientific American Books, Inc., editor, New York, N.Y. (1986); Lewin, B.M., Genes II. John Wiley & Sons, publisher, New York, N-Y. (1985); Old, R.W. et al. Principles of Gene Mania-lation: An Introduction to Genetic Enneineerin. 2nd edition, University of California Press, Berkeley, CA (1981); and Maniatis, T. et al .. Molecular Clonine: A Laboratorv Manual. Cold Spring Harbor, NY (1982).

By " cloning " is meant the use of in vitro recombination techniques to insert a particular gene or other DNA sequence into a vector molecule. In order to successfully clone a desired gene it is necessary to employ methods to obtain DNA fragments, to link the fragments to vector molecules, to introduce the compound DNA molecule into a replicable host cell and to select the clone having the target gene from among recipient host cells.

By, ,, cDNA " is meant complementary DNA or copy produced from an RNA template by the action of an RNA-dependent DNA polymerase (reverse transcriptase). Thus a " cDNA clone " means a double stranded DNA sequence complementary to an RNA molecule of interest, carried in a cloning vehicle. 21

By " cDNA library " is meant a collection of recombinant DNA molecules containing cDNA inserts which together comprise the entire genome of an organism. Such a cDNA library can be prepared by recognized methods described for example in Maniatis et al., Molecular Cloning in Laborator, supra. Generally RNA is first isolated from the cells of an organism in whose genome it is desired to clone a particular gene. Mammalian and particularly human cell lines are preferred for purposes of the present invention. Preferred are the human tumor cell line HPV-ALL and the human lymphoblastoid cell line JY. Alternatively, RNA can be isolated from a tumor cell, derived from an animal tumor and preferably from a human tumor. Thus, a library can be prepared for example from a human adrenal tumor but any tumor can be used.

The immunoselection cloning method of the present invention comprises the preparation of a cDNA library by extraction of total RNA including a particular gene derived from a cell, synthesis of a series of complementary double stranded cDNA fragments from RNA and introduction of these fragments of cDNA in mammalian cells in tissue culture. Mammalian cells are maintained under conditions that allow expression of the protein (i.e., cell surface antigen). The resulting cells are exposed to a first antibody or group of antibodies directed against the cell surface antigen. This results in the formation of a surface antigen-first antibody complex. The complexes are exposed to a substrate which is coated or ligated to a second antibody directed against the first antibody. Cells expressing the cell surface antigen adhere to the substrate (due to the formation of a surface antigen complex 22

cell-first antibody second antibody). Adherent cells are separated from non-adherent cells.

Total RNA Isolation

For the isolation of total RNA the thiocyanate / CsCl method is preferred. More preferred is a guanidinium thiocyanate / LiCl variant of the GusSCN / CsCl method, which has higher capacity and is faster. Briefly, for each ml of the desired mixture, 0.5 g of GuSCN are dissolved in 0.58 ml of 25% LiCl (stock solution filtered through a 0.45 micron filter) and 20 μΐ of mercaptoethanol is added. The cells were pelleted and the pellet dispersed on the walls by shaking, 1 ml of solution was added to 5 x 107 cells. The resulting blend is treated with polytron until the viscosity is lost. For small-scale preparations (less than 1θ8 cells) place 2 ml of the treated mixture in 1.5 ml of 5.7 M CsCl (without RNase, 1.26 g of CsCl added to each ml of 10 mM EDTA pH8), cover with water without RNase and centrifugation at SW55 50K rpm 2 hours. For large-scale preparations, a 25 ml layer and 12 ml CsCl in a SW28 tube, covered and centrifuged at 24K rpm for 8 h. Aspirate the contents carefully with a sterile pasteur pipette attached to a vacuum flask. Once the CsCl interface is passed, a band is scraped around the tube with the tip of the pipette to prevent the layer on the tube wall from descending. The remaining CsCl solution is aspirated. The sediments are resuspended in water (do not try to redissolve). 1/10 vol. NaOAc and 3 vol. of EtOH and the resulting combination is centrifuged. If necessary, the pellet is resuspended in water (e.g., at 70 ° C). Adjust the concentration to 1 mg / ml and freeze. Small RNA (e.g. 5S) does not settle. For small amounts of cells, the volumes are lowered and GuSCN is coated with RNase-free water in the gradient. (precipitation is ineficax when RNA is diluted).

Preparation of RNA polyA +

PolyA + RNA can then be prepared, preferably by the oligo dT selection method. Briefly, a reject polypropylene column is prepared by washing with 5M NaOH and then washing with water without RNase. For each milligram of total RNA, about 0.3 ml (final packed volume) of oligo dT cellulose is used. The oligo dT cellulose is prepared by resuspending about 0.5 ml of dry powder in 1 ml of 0.1M NaOH and transferring it to the column or by infiltration of 0.1 NaOH through a previously used column (the columns can be reused many times). This is washed with several column volumes of RNase-free water until the pH is neutral and equilibrated with 2-3 ml of application buffer. The contents of the column are then removed into a 15 ml sterile tube using 4-6 ml of application buffer. The total RNA is heated at 70øC for 2-3 minutes. LiCl is added from the stock without RNase (to 0.5 M) and is combined with oligo dT cellulose in a 15 ml tube. This is followed by vortexing or stirring for 10 minutes. The result is poured onto a column and washed with 3 ml of application buffer and then with 3 ml of wash buffer. The mRNA is eluted directly into a SW55 tube with 1.5 ml of 2 mM EDTA, 0.1% SDS; the first two or three drops are discarded. The eluted mRNA is precipitated by the addition of 1/10 vol. of NaOAc and the tube filled with EtOH. This is then mixed, cooled for 30 minutes at -20øC and centrifuged at 50K rpm at 5øC for 30 minutes. The mRNA pellet is resuspended in 50-100 μl of water without RNAse. About 5 μΐ is fused at 70øC in MOPS / EDTA / formaldehyde and run on a 1% agarose 1% gel to evaluate the quality.

Synthesis of cDNA

For this purpose cDNA is synthesized. A preferred method of cDNA synthesis is a variant of that described by Gubler and Hoffman (Gene, 25: 263-269 (1982)). This is accomplished as follows: a. First chain. 4 μg of mRNA heated to about 100 ° C in a microtube tube for 30 seconds and heating on ice stopped. The following are added: 20æg of RT1 buffer, 2μ of RNase inhibitor (Boehringer 36u / μ), 1μg of 5μg / ml oligo dT (Collaborative Research), 2.5μg of 20mM dXTPs ( ultrapure), 1 μl of 1 M DTT and 4 μ of RT-LX (Life Science, 24 μ / μ). The resulting combination is incubated at 42 ° C for 40 minutes. It is heated to inactivate (70 ° C 10 minutes). B. Second string. 320 μΐ water without RNase, 80 μΐ RT2 buffer, 5 μΐ DNA polymerase I (Boehringer, SU / μΙ). Incubate at 15 ° C for 1 hr and 22 ° C for 1 hr. Add 20 μl of 0.5M EDTA pH 8.0, extract with phenol and precipitate with EtOH by the addition of 0.5M NaCl, linear polyacrylamide (carrier) to 20 μg / ml and fill the tube with EtOH. Centrifuge 2-3 minutes in a microfuge, remove, vortex to remove the precipitate from the wall of the tube and centrifuge again 1 minute. W. Adapters. Resuspend the precipitated cDNA in 240 μΐ TE (10/1). add 30 μl 10x low saline buffer, 30 μl 10x ligation buffer, 3 μg (2.4 μg) dephosphorylated 12-mer adapter, 2 μg (1.6 μg) dephosphorylated 8-mer adapter and 1 μl μl of T4 DNA ligase (BioLabs, 400 U / μΙ or Boehringer, 1 Weiss unit / ml). Incubate at 15 ° C overnight. Extract phenol chloroform and precipitate with EtOH as above (no extra vehicle required), and resuspend in 100 μl TE. 25

Use of cDNA fragments in expression vectors

For use with the BstXI-based cDNA expression vectors of the invention (see below), the oligonucleotide segments containing terminal sequences corresponding to BstXI sites on the vectors are attached to the desired cDNA fragment to be inserted. The resulting fragments are pooled by fractionation. A preferred method is as follows:

Prepare a solution of 20% KOA, 2mM EDTA / 1æg / ml EtBr and a solution of 5% KOAc, 2mM EDTA, 1æg / ml EtBr. Add 2.6 ml of a KOAc solution to the back chamber of a gradient former. Remove the air bubble from the tube connecting the two chambers allowing the solution to flow into the front chamber and then back to the chamber. Close the passage between the chambers and add 2.5 ml of the 5% solution to the front chamber. If there is liquid in the pipeline of a previous gradient, let the 5% solution run to the end of the tube and then return to the chamber. Place the appliance on a stirring plate, set the stir bar to move as fast as possible, open the tap between the two chambers and then open the outlet tap. Fill a SW55 polyalomer tube from the bottom to the top with the KOAc solution. Prepare a tube to equilibrate and centrifuge the gradient for 3 hours at 50 t rpm at 22 ° C. Collect the gradient fractions, drill the tube with a butterfly infusion system (center tight) near the bottom of the tube and collect three 0.5 ml and 6 ml fractions of 0.25 ml for microtubes (about 22 and 11 drops respectively.). Precipitate the fractions with EtOH by adding linear polyacrylamide at 20æg / ml and filling the tube to completion with EtOH. After cooling the tubes centrifuge them in a microfuge for 3 minutes. Vortex and centrifuge again 1 minute. Wash the pellets with 70% EtOH (centrifuge again). Do not dry completely. Resuspend each of the 0.25 ml fractions in 10 μΐ TE. Run 1 μΐ in a 1% agarose minigel. Assemble the first three fractions and the last six that do not contain material less than 1 Kb.

Suppressor tRNA plasmids can be propagated by known methods. In a preferred method according to the present invention, supF plasmids can be selected from non-suppressor hosts containing a second plasmid, p3, which contains amber mutagenized ampicillin and tetracycline resistance elements (Seed, 1983). Plasmid p3 is derived from PR1, is 57 kb in length and is stably maintained as a single copy episomal. The ampicillin resistance of this plasmid can not be used in strains containing p3. The selection of the tet resistance alone is almost as good as the selection of the amp + tet resistance. However, the appearance of spontaneous mutations in the chromosomal suppressor tRNA has an unavoidable background (frequency of approximately 10-9) in this system. Colonies arising from spontaneous mutations in the suppressor are generally larger than the clones arising from transformation with plasmids. Suppressor plasmids are typically selected in LBcontent amp 12.5 μg / ml and tet at 7.5 μg / ml. For large plasmid preparations M9 medium may be used with casamino acids containing glycerol (0.8%) as carbon source and the bacteria grown to saturation. The vector DNA can be isolated by known methods. The following method is preferred for plasmids derived from 1 liter of saturated cells:

Centrifuge the cells in 1 liter J6 bottles, 4.2K rpm, 25 minutes. Resuspend in 40 ml of 10 mM EDTA pH 8 (beat on a soft surface). Add 80 ml of 0.2M NaOH, 1% SDS, stir until clarified and viscous. Add 40 ml of 5M 27

KOAc, pH 4.7 (2.5M KOAc, 2.5M HOAc) shake not too strongly (until the lumps are 2-3 mm in size). Centrifuge (same tube) 4.2K rpm, 5 minutes. Pour the supernatant through the gas into a 250 ml bottle. Fill the bottle with isopropyl alcohol. Centrifuge at J6, 4.2K rpm, 5 minutes. Decant the bottle, wash gently with 70% EtOH (avoid fragmenting the pellet). Invert the bottle and remove traces of EtOH with absorbent paper. Resuspend in 3.5 ml of 20 mM Tris / EDTA / 10mM. Add 3.75 ml of the resuspended pellet to 4.5 g of CsCl. Add 0.75 ml of 10 mg / ml ethidium bromide, mix. Fill VTÍ80 tubes with the solution. Run at a speed of 80K rpm for 2.5 hours or more. Extract the bands with visible light using a 1 ml syringe and a 20 gauge needle or less. Cut the top of the tube, insert the needle inclined up into the tube at an angle of approximately 30 ° C relative to the tube, (i.e., as sloped as possible). in a position about 3mm below the band with the needle bevel up. After removing the band, place the contents of the tube in lexívia. Place the extracted strips in 13 ml Sarsted tubes Fill the tube to the top with 1M NaCl saturated n-butanol, extract. If a large amount of DNA is obtained, it must be extracted again. Aspirate the butanol to a trap containing 5M NaOH (to destroy the ethidium). Add approximately equal volume of 1M ammonium acetate to the DNA (squirt). Centrifuge at 10K rpm, 5 min. J2-21. Wash the pellet thoroughly with 70% ethanol. Dry with a swab or lyophilizer. The vector may be prepared for cloning by known methods. A preferred method begins with cutting 20 μg of vector in a 200 μ reaction volume with 100 units of BstXI (New York Biolabs), cleaving at 50 ° C overnight in a thermostated water bath (ie, water bath with water circulation). Prepare 2 gradients of 5-20% KOAc in SW55 tubes as described above. Add 100 μl of the digested vector to each of the tubes and run for 3 hours, 50K rpm at 22 ° C. Examine the tube under 300nm UV light. The desired band will migrate 2/3 of the length of the tube. Increased bandwidth migration means that the gradient is more material than due. Remove the band with a 1 ml syringe and 20 gauge needle. Add linear polyacrylamide and precipitate the plasmid by adding 3 volumes of EtOH. Resuspend in 50 μΐ TE. Make links using a constant amount of vector and increasing amounts of cDNAs. Based on these binding assays establish large-scale binding which can be achieved by known methods. Generally the entire cDNA preparation requires 1-2 μg of cut vector.

The adapters may be prepared by known methods, but it is preferred to resuspend the crude adapters at a concentration of 1 μg / μl. add MgSO4 to 10 mM and precipitate by the addition of 5 volumes of EtOH. Wash with 70% EtOH and resuspend in TE at a concentration of 1 μg / μl. To dephosphorylate take 25 μΐ of resuspended adapters, add 3 μ l of 10-dephosphorylation buffer and 20 units of kinase; incubate at 37 ° C overnight. The preparation of the buffers referred to in the description behind the preferred methods according to the present invention will be apparent to those familiar with the area. For convenience the preferred compositions of the buffers are as follows:

Application buffer: 0.5M LiCl, 10mM Tris pH 7.5, 1mM EDTA 0.1% SDS. Wash Buffer: 0.15M LiCl, 10mM Tris pH 7.5, 1mM EDTA 0.1% SDS. Rt1 Buffer: 0.25 M Tris pH 8.8 (8.2 at 42 ° C), 0.25M KCl, 30 mM MgCl 2 · Buffer Rt 2: 0.1M Tris pH 7.5, 25 mM MgCl 2, 0.5M KCl, 0.25 mg / ml BSA, 50 mM DTT. Low Salts 10x: 60 mM Tris pH 7.5, 60 mM MgCl 2, 50 mM NaCl, 2.5 mg / mL BSA, 70 mM MeOH.

Additions of 10x binding: 1 mM ATP, 20 mM DTT, 1 mg / mL BSA, 10 mM

Deoxyphosphorylation buffer 10x: spermidine. 0.5M Tris pH 7.5, 10 mM ATP, 20 mM DTT, 10 mM Spermidine, 1 mg / ml BSA 100 mM MgCl 2.

By " vector " is meant a DNA molecule, derived from a plasmid or bacteriophage, into which DNA fragments may be inserted or cloned. A vector will contain one or more unique restriction sites and may be capable of autonomous replication in a defined host or carrier organism in such a way that the cloned sequence is reproducible. Thus, by " DNA expression vector " is meant any autonomous element capable of replicating in a host independently of the host chromosome after additional DNA sequences have been incorporated into the genome of the autonomous element. Such expression vectors include bacterial plasmids and phages.

However, viral vectors such as those derived from simian virus 40 (SV40) are preferred for purposes of the present invention. SV40 is a papovavirus having a molecular weight of 28 Mdal and contains a circular double stranded DNA molecule having a molecular weight of 3 Mdal, which comprises the entire genome of the virus. The entire nucleotide sequence of this small covalently closed circular DNA molecule was sequenced. Fiers et al., Nature 273: 113-120 (1978); Reddy et al., Science 200: 494-502 (1978). SV40 viral DNA can be obtained in large quantities and the genomic regions responsible for the various viral functions have been precisely located to a physically detailed map of the DNA. Fiers et al. Supra; Reddy et al., Supra. The SV40 viral genome may multiply vegetatively or as an integral part of the cellular chromosomes and there is a great deal of information about the replication and expression of this genome.

Also preferred for purposes of the present invention are a double-stranded bacteriophage cloning vehicle designated M13 having a closed circular DNA genome of approximately 6.5 Kb. One advantage of using M13 as a cloning vehicle is that the phage particles released from infected cells contain single stranded DNA homologous to only one of the two complementary strands of the cloned DNA, which can therefore be used as a template for sequencing analysis of DNA. Further preferred for the purposes of the present invention are the expression vectors designated p1H3, pH3M and CDM8, deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852. pIH3M and CDM8, deposited with the American Type Culture Collection ( ATCC), 12301 Parklawn Drive, Rockville, 31

MD 20852. PiH 3 was deposited with the ATCC on February 24, 1988 and has accession number ATCC 67634. PiH3M was deposited with the ATCC on February 24, 1988 and has the accession number ATCC 67633. CDM8 was deposited with the ATCC in 24 of February 1988 and has the accession number ATCC 67635.

By " tissue culture " it is intended to provide for the maintenance or growth of cells from animal tissues in vitro in order to allow subsequent differentiation and preservation of the cellular architecture or function or both. " Primary tissue cells " are those derived directly from a population consisting of cells of the same type performing the same function in an organism. Treatment of such tissue culture cells with the proteolytic enzyme trypsin, for example, dissociates them into individual primary cell cells that grow well when sown on culture plates at high densities. Cell cultures derived from the multiplication of primary cells in tissue culture are termed " secondary cell cultures ". Most of the secondary cells divide a finite number of times and then die. However, some secondary cells may pass through this " crisis period ", after which they are able to multiply indefinitely to form a " continuous cell line ". Cell lines often contain extra chromosomes and are also usually abnormal in other respects. The immortality of these cells is a feature shared with cancer cells.

Preferred cell lines for use with tissue culture cells according to the present invention include the monkey kidney cell line " COS ". COS cells are those that have been transformed by SV40 DNA containing a region of functional early genes but an origin of defective viral DNA replication. The M6 clone of the COS cells is particularly 32

preferred for use according to the method of the invention. Also preferred for the purposes of the present invention are WOP " mouse cells ", which are NIH 3T3 cells transfected with polyoma DNA with a deletion of the origin. The cDNA can be introduced into the tissue culture host cells of the present invention by any known methods. Transfection can be achieved for example by protoplast fusion, spheroplast fusion or the DEAE dextran method (Sussman et al., Cell Biol. 4: 1641-1643 (1984)). i

If fusion of spheroplasts is employed, a preferred method is the following variant based on Sandri-Goldrin et al. Mol. Cell Biol. 1: 743-752 (1981). Briefly, for example, a series of six fusions requires 100 ml of cells in broth. Grow the cells containing the amplifiable plasmid to OD 600 = 0.5 in LB. Add spectinomycin to 100æg / ml (or chloramphenicol to 150æg / ml). Continue incubation at 37 ° C with shaking for 10-16 hours. (Cells start to lyse with prolonged incubation in medium with spectinomycin or chloramphenicol). Centrifuge 100 ml of the culture (JA14 / GSA rotor, 250 ml bottle) 5 minutes at 10,000 rpm. Decant well, resuspend the pellet in the bottle with 5 ml of cold 20% sucrose, 50 mM Tris-HCl pH 8.0. Incubate on ice 5 minutes. Add 2 ml of 0.25M EDTA pH 8.0, incubate 5 minutes at 37øC (water bath). Place on ice, test the percentage conversion into spheroplasts by microscopy. In a stream, slowly add 20 ml of DME / 10% sucrose / 10 mM cold MgCl 2 (dropwise, ca. 2 drops per second). Remove the medium from the cells seeded the previous day in 6 cm dishes (50% confluence). Add 5 ml of spheroplast suspension to each plate. Place the plates on top of tube supports in a tilting centrifuge. At one time they can be plated. The plates may be stacked on top of each other, but in a stack it is not advisable because the spheroplast layer on the top plate sheds or takes off after centrifugation. Centrifuge at 10000xg 10 min. The force is calculated based on the radius of the bottom plate. Aspirate the fluid from the plates carefully. Pipette 1.5-2 ml of 50% (w / w) PE6 (or PEG 1000) / 50% DME (serum free) onto the center of the plate, if necessary, walk with the tip of the pipette around to ensure that the PEG spreads evenly and radially across the entire plate. After the addition of PEG to the last plate, tilt all plates over their caps so that the PEG solution comes to the bottom. Aspirate the PEG. The thin layer of residual PEG remaining in the cells is sufficient to promote fusion; it is better to remove the PEG layer per wash and better cell viability can be achieved than to leave the bulk of the PEG. After 90 to 120 seconds (PEG 1000) or 120 to 150 seconds (PEG 1450) contact with the PEG solution, pipette 1.5 ml of DME (without serum) to the center of the plate. The PEG layer will be spread radially by the DME. Tilt the plates and inhale. Repeat washing with DMEM. Add 3 ml of DME / 10% serum containing 15 g / g gentamicin sulfate. Incubate for 4-6 hours in an oven. Remove medium and suspension of residual bacteria add more medium and incubate 2-3 days. Extensive washing of the cell layer to remove PEG tends to remove many of the cells without any substantial benefit. If the cells sediment in a second wash with DMEM for a few minutes, most of the spheroplast layer will spontaneously detach; however, it is preferred to rinse quickly and allow the layer to peel off in complete medium at 37øC. The PEG solution can be conveniently prepared by melting a fresh bottle of PEG at 60øC and pouring approximately 50 ml quantities by means of a 50 ml centrifuge tube for pre-weighed bottles. The distributed PEG is stored at 5 ° C in the dark. To reconstitute a fresh bottle, weigh the quantity, merge again and add an equal volume

of DME (without serum). Adjust the pH with 7.5% sodium bicarbonate solution if necessary and sterilize by filtration. The resulting PEG solution can be stored for up to 3 months at room temperature with no detectable adverse consequences. i

The transfected host cells will be cultured according to the invention in order to achieve expression of the protein encoded by the cDNA clone and to increase the absolute numbers of cells available for subsequent immunoscreening. Those familiar with the subject will know methods and means suitable for this purpose, taking into account the type of cells and other variables normally considered. COS cells, for example, can be cultured in Dulbecco's Eagle Modification Medium (DME) supplemented with 10% fetal serum and gentamicin sulfate. Transient expression of transfected cells can usually be expected between 48 and 72 hours post-transfection. However, this time period may vary depending on the type or strain of the host cell used and the conditions of the cell culture, as will be apparent to those skilled in the art.

Immunoprecipitation, transfer and cDNA sequencing of the cloned genes according to the methods of the present invention may be carried out by convenient means known to those skilled in the art. For example, the immunoprecipitation protocol of Clark et al. Leukocvte Τνοΐηα II is preferred. Vol. 155-167 (1986). Southern, Northern or other transfer analysis methods known to those skilled in the art may be employed using hybridization probes prepared by known methods such as Hu et al. (Gene 18: 271-277 (1982)). Sequencing of cDNA can also be achieved by known methods, including the dideoxynucleotide method of Sanger et al., Proc. Natl. Acad. Know. (USAI 74: 543-5467 (1977)).

Antibodies used in accordance with the present invention may be polyclonal or monoclonal. These may be used alone or together with other polyclonal or monoclonal antibodies to effect the immuno-screening of cells expressing the antigen or antigens desired by the methods of the present invention. Methods of preparing antibodies or fragments thereof according to the present invention are well known to those skilled in the art.

Conventional reference works setting out the general principles of immunology include Klein, J., Immunolocrv: The Science of Self-Nonself Discrimination, John Wiley & Sons, ed., New York (1982); Kennett, R. et al. eds., Monoclonal Antibodies, Hybridoma: A New Dimension in Biological Analvsis. Plenum Press, ed., New York (1980); Campbell, A., " Monoclonal Antibody Technology " in Burden, R., et al., eds., Laboratory Techniques in Biochemistry and Molecular Biology. Vol.13, Elsevere, Aditor, Amsterdam (1984). The term " antibody " is intended to include the intact molecule as well as fragments thereof, such as, for example, Fab and F (ab) 2 fragments which are also capable of binding to the antigen. Polyclonal antibody preparations may be derived directly from the blood of the desired animal species upon immunization with the antigen of interest or a fragment thereof using any of the standard protocols known to those skilled in the art. Similarly, the monoclonal antibodies can be prepared using methods known (Kohler et al., Eur. J. Immunol., 6: 292 (1976)). The use of monoclonal antibodies for purposes of the present invention is preferred.

For immuno-screening purposes according to the present invention, tissue culture host cells that have been exposed to antibodies directed against the surface antigen of the target cell are separated from the host cells that do not express the target antigen by delivering the cells on a substrate coated with antibody directed against antibody against the antigen. This technique, called " panning " will be known to those skilled in the art and is described, for example, by Mage et al., J. Immunol. Meth. 15: 47-56 (1977) and Wysocki and Sato, Proc. Natl Acad. Know. USA 75: 2844-2848 (1978). " Panning " according to the methods of the present invention can be carried out as follows: a. Plates coated with antibodies. Bacteriological plaques of 60 mm, Falcon 1007 or equivalent or 10 cm plates such as Fisher 8-757-12 may be used. Affinity-purified sheep anti-mouse antibody (for example CooperBiomedical (Cappell)) was diluted to 10 μg / ml in 50 mM Tris-HCl pH 9.5. Add 3 ml per 6 cm dish or 10 ml per 10 cm dish. Let stand at ca. 1.5 hours, remove to the next plate at 1.5 hours and then to a third plate. Wash the plates 3x with 0.15M NaCl (a wash bottle is convenient for this), incubate with 3 ml of 1 mg / ml BSA in PBS overnight, aspirate and freeze. B. " Panning ". The cells will be in 60 mm plates. Aspirate the medium from the plate, add 2 ml of PBS / 0.5 mM EDTA / 0.02% azide and incubate the plates at 37 ° C for 30 minutes to peel the cells from the plate. Triturate the cells strongly with 37 Λ

a short pasteur pipette and scoop the cells from each plate into a centrifuge tube. Centrifuge 4 min. scoring 2.5 (200 xg) (delay 5 minutes). Resuspend the cells in 0.5-1.0 ml PBS / EDTA / azide / 5% FBS and add the antibodies. Incubate for at least 30 minutes on ice. Add equal volume of PBS / EDTA / -azide, carefully place over 3 ml of PBS / EDTA / azide / 2% Ficoll and centrifuge 4 min. scoring 2.5. Aspirate the supernatant gently. Resuspend the cells in 0.5 ml of PBS / EDTA / azide and add small amounts to antibody-coated plates containing 3 ml of PBS / EDTA / azide / 5% FBS by pipetting through a 100 micron Nylon (Tetko) filter. Add cells at most two 60 mm plates to a 60 mm plate coated with antibody. Allow to stand at room temperature for 1-3 hours, remove excess cells that did not adhere to the plate by gentle washing with PBS / 5% serum or medium. 2 or 3 3 ml washes are generally sufficient. W. Supernatant of Hirt. A preferred variant of the method of Hirt, J. Molec. Biol. 26: 365-369 (1967) is as follows: Add 0.4 ml of 0.6% SDS, 10 mM EDTA to a coated plate containing adherent cells. Allowing to stand for 20 minutes (1 min may be sufficient if there are virtually no cells on the plate). Pipette the viscous mixture into a microtube. Add 0.1 ml of 5M NaCl, mix, place on ice for at least 5 hours. Keeping it as cold as possible seems to improve the quality of Hirt. Centrifuge for 4 min, remove the supernatant carefully, extract with phenol (twice if the first interface is not cleaned), add 10 μg linear polyacrylamide (or other vehicle), fill the tube with EtOH, precipitate and resuspend at 0 , 1 ml. Add 3 volumes of EtOH / NaOAc, precipitate again and resuspend in 0.1 ml. Transform MC106l / p3, preferably using the high-efficiency protocol described below. If the DNA volume exceeds 2% of the amount of competent cells, the transformation efficiency will drop. 5% gives the same number of colonies 2.5% (half efficacy).

For this aspect of the present invention it is preferred to use " blockers " in the incubation medium. Blockers ensure that non-specific proteins, proteases or antibodies present do not bind or destroy the antibodies present on the substrate or the surface of the host cell, to give false positive or false negative results. Selection of the blockers can substantially improve the specificity of the immunoassay step of the present invention. A series of non-specific monoclonal antibodies, for example, of the same class or subclass (isotype) as those used in the immuno-screening step (e.g., IgG1, IgG2A, IgGm, etc.) may be used as a blocker. The concentration of the blockers is important to maintain adequate sensitivity while still inhibiting undesirable interference. Those skilled in the art will recognize that the buffer system used for incubation may be selected to optimize the blocking action and decrease nonspecific binding.

A population of cells to be " panned " relative to those expressing the target cell surface antigen is first detached from its (harvested) tissue culture plate without trypsin. The cells are then exposed to a first antibody, which may be polyclonal or monoclonal, directed against the antigen of interest or against a family of related genes. At this initial stage, a single antibody or a group of antibodies may be used, depending on the nature of the target antigen, its predicted frequency and other variables which will be apparent to those skilled in the art. Target antigens expressed on the surfaces of host cells will form an antigen-antibody complex.

The cells are subsequently placed in close apposition to a substrate, such as a tissue culture dish, filter disc or the like, which has previously been coated with a second antibody or groups of antibodies. This second antibody will be directed against the first antibody and its choice will be a matter decided by the users dictated for example by the animal in which the first antibody was induced. For example, if the first antibody is induced in mice, the second antibody should be directed against mouse immunoglobulins, induced in goats or sheep. Cells expressing the target antigen will adhere to the substrate through the complex formed between the antigen, the first antibody and the second antibody. Adherent cells can then be separated from the non-adherent cells by washing. DNA encoding the target antigen is prepared from adherent cells by known methods, such as that of Hirt, J. Molec. Biol. 26: 365-369 (1967). This DNA can then be used to transform E. coli or other suitable host cells over other cycles of fusion and selection to achieve the desired degree of enrichment.

In the general case, the initial immunostaining cycles will employ a panel of first antibodies directed against an epitope or group of epitopes common to the antigen family to which the target antigen belongs. This will be sufficient to significantly narrow the number of clones for future cycles. Two of these cycles will generally be suitable, but the number of cycles may vary as outlined above. Hereafter a single round of selection is employed employing a single first antibody or a group of first antibodies that recognize only the target antigen. 40

By " substrate " is meant a solid surface to which the antibodies may be bound for immuno-screening in accordance with the present invention. Suitable suitable substrates include glass, polystyrene, polypropylene, dextran, nylon and other materials. Tubes, beads, microtiter plates, bacteriological culture plates and the like made or coated with such materials may be used. Antibodies can be covalently or physically linked to the substrate by known techniques, such as covalent attachment via an araid or ester bond or by adsorption. Those skilled in the art will know of other substrates and methods suitable for immobilizing antibodies or will be able to determine such substrates and methods using no more than routine experimentation.

The choice of tissue culture host cells for use in accordance with the present invention should preferably be such as to avoid the situation where the antibodies used in " panning " recognize determinants in transfected cells. Thus, while COS cells are preferred for the transient expression of certain surface antigens, they are more preferred for murine WOP cells. Of these latter, WOP 3027 cells are even more preferred. WOP cells virtually allow all antibodies to be used since cross-reactions between mouse antibodies and mouse cell surface determinants are rare. The size of the insert of the recombinant DNA molecule should be chosen in order to optimize the probability of obtaining a coding sequence in its entirety. Those familiar with the subject will know of various methods by which a preliminary determination of the optimal insertion size for a given gene can be made.

Construction of vectors and cDNA insertion

Suitable vectors for expression of cDNA in mammalian cells in tissue culture can be constructed by known methods. An expression vector containing the SV40 origin is preferred for purposes of the present invention. The vector may contain either a synthetic or a natural transcript source and the SV40 early region promoter. Even more preferred is a chimeric promoter composed of immediate early potentiating sequences of human cytomegalovirus. Various " power sequences " may also be used with the SV40 vectors. These are described, for example, by Banerji et al., Cell 27: 299-308 (1981); Levinson et al., Nature 295: 568-572 (1982); and Conrad et al., Mol. Cell. Biol. 2: 949-965 (1982). The insertion of cDNA into the vectors of the present invention may occur, for example, by placement of homopolymeric tails with terminal transferase. However, homopolymeric tails located with respect to cDNA inserts may inhibit expression in vitro and in vivo. Thus, it is preferred for purposes of the present invention the use of identical reversed cleavage sites separated by a small segment of replaceable DNA. Such reversed identical cleavage sites, preferably employing the BstXI restraint endonuclease. can be used in parallel with the synthetic cDNA oligonucleotides, giving the same ends of the substitutable segment of the vector. In this way, the cDNA can not bind itself but can bind to the vector. This allows for more efficient use of the cDNA and vector.

Another embodiment of the present invention is the above-described oligonucleotide-based strategy for promoting cDNA insertion into the vector. The piH3M vector of the present invention is 42

and employs the inverted endonuclease sites. This vector may contain an SV40 origin of replication, but a more preferred form contains an origin of M13. This vector, containing the origin of M13, allows high levels of expression in COS cells of coding sequences placed under their control. Also, the small size and particular arrangement of sequences in the plasmid allows for high levels of replication in COS cells.

&Quot; cell surface antigen " is meant any protein that is transported through the intracellular membrane system to the cell surface. Such antigens are normally anchored to the cell surface membrane through a carbonyl terminal domain containing hydrophobic amino acids that remain in the membrane lipid bilayer and exert their biological and antigenic effects therein. Antigens such as those of T lymphocytes are particularly suitable for the cloning of genes by the method of the present invention. However, the cell surface antigens of any cells can be cloned according to the present method. In addition, proteins not normally expressed on the cell surface can be cloned according to the present method for example using cell sorting by fluorescence activation (FACS) to enrich in fixed cells expressing the intracellular antigens.

By " substantially pure " is meant any antigen of the present invention or any gene encoding such antigen which is essentially free of other antigens or genes respectively or other contaminants with which it can normally be found in nature and as such exists in a form not found in nature. &Quot; functional derivative " is meant " fragments ", " variants ", 43

" analogs " or " chemical derivatives " of a molecule. A " fragment " of a molecule, such as any of the antigens of the present invention, is intended to refer to any sub-array of polypeptides of the molecule. A " variant " of such molecules is intended to refer to a natural molecule substantially similar to the entire molecule or to a fragment thereof. An " analog " of the molecule is intended to refer to a molecule substantially similar to the molecule in its entirety or to a fragment thereof.

A fragment, variant, analogue and / or chemical derivative of an antigen is said to be substantially similar to another fragment, variant, analogue, chemical derivative and / or antigen if the amino acid sequence in both molecules is substantially the same, ie , has at least about 50% homology and if both molecules have a similar biological activity. A nucleotide sequence is referred to as " substantially similar " to a further nucleotide sequence if both sequences are substantially equal, ie, the first nucleotide sequence encodes a fragment a fragment, variant, analogue, chemical derivative or antigen having an amino acid sequence with at least about 50% homology to and the fragment, variant, analogue, chemical derivative and / or antigen encoded by the first nucleotide sequence has a biological activity similar to the biological activity of the fragment, variant, analogue, chemical derivative and / or antigen encoded by second nucleotide sequence. Thus, since two molecules have similar activity, they are considered variants because that term is used herein even if one of the molecules has amino acid residues not found in the other, or if the amino acid residue sequence is not identical. As used herein, a molecule is referred to as 44

being a " chemical derivative " of another molecule when it has additional chemical fractions not normally found as part of the molecule. Such fractions may improve the solubility of the molecule, adsorption, biological half-life, etc. The fractions may alternatively decrease the toxicity of the molecule, eliminate or attenuate any undesirable side effects of the molecule, etc. Fractions capable of mediating such effects are described, for example in Remington's Pharmaceutical Sciences. 16th edition,

Mack Publishing Co., Easton, Penn. (1980).

I

Similarly, a " functional derivative " of a gene of any of the antigens of the present invention is intended to include " variants " " variants " or " analogs " of the gene, which may be " substantially similar " in the nucleotide sequence and encoding a molecule having similar activity.

J

An antigen, fragment, variant, analogue and / or chemical derivative is referred to as having " similar biological activity " to another antigen, fragment, variant, analogue and / or chemical derivative if the former possesses biological activity of at least 25% of the latter. Biological activities are those operations, functions or processes that are characteristic of living organisms. Biological activities may also include reproduction, extension or adaptation of living processes to in vitro or non-natural systems, such as the biological activity exhibited when an antigen, fragment, variant, analogue and / or chemical derivative is artificially introduced into a test animal to induce the production of antibodies. An antigen, fragment, variant, analogue and / or chemical derivative may have one or more biological activities, biological activities may be detected or measured by methods or assays which are characteristic of that activity. For a functional derivative 45

has a biological activity similar to that of the antigen, it must have a biological activity of at least 25% of the antigen as measured by an assay characteristic of that activity and known.

Substantially pure antigens which have been expressed by methods of the present invention may be used by immunodiagnostic assay methods well known to those skilled in the art, including radioimmunoassays (EIAs) and enzyme-linked immunosorbent assays (ELISAs). The substantially pure proteins of the present invention in soluble form may be administered alone or in combination with other antigens of the present invention or with other agents, including lymphokines and monokines or drugs, for the treatment of diseases related to the immune system and disorders and disorders in animals, including humans. As examples of such disorders which may benefit from treatment with the substantially pure proteins of the present invention may be referred to immunodeficiency diseases, diseases of the immediate hypersensitivity type, asthma, hypersensitivity pneumonitis, immune complex diseases, vasculitis, systemic lupus erythematosus, rheumatoid arthritis, immunopathogenic renal disorders, acute and chronic inflammation, hemolytic anemias, platelet disorders, plasma and other cell neoplasms, amyloidosis, parasitic diseases, multiple sclerosis, Guillain-Barre syndrome, myopia paralysis acute and subacute diseases, myasthenia gravis, immune endocrinopathies, and rejection of tissue and organ transplantations, all as described in Petersdorf et al., eds., Harrison / s Principles of Internal

Medicine. above. See also Weir, ed., Supra: Boguslaski et al., Eds., Supra; and Holborow et al., eds., supra.

When used in immunotherapy, the antigens of the present invention may or may not be labeled with a therapeutic agent.

Examples of therapeutic agents that can be coupled to the antigens of the invention for immunotherapy are drugs, radioisotopes, lectins, and toxins.

The dosage ranges for the administration of the antigens of the present invention are sufficiently large to produce the immunotherapeutic effect, but not so great in order to cause adverse side effects, such as undesirable cross reactions, anaphylactic reactions and the like. In general, the dosage employed will vary with the patient's age, condition, sex and degree of disease. Contraindications (if any), immune tolerance, and other variables will also affect the appropriate dosage. Administration may be parenterally, by injection or by gradual infusion over time. Administration may also be intravenous, intramuscular, subcutaneous or intradermal.

Preparations for parenteral administration include aqueous or non-aqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents include polypropylene glycol, polyethylene glycol, vegetable oils such as olive oil and injectable organic esters such as ethyl oleate. Aqueous carriers include water, aqueous and alcoholic solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, Ringer's solution or fixed oils. Intravenous vehicles include fluid and nutrient fillers, electrolyte fillers, such as those based on Ringer's destrose and the like. Preservatives and other additives may also be present, such as, for example, antimicrobial agents, anti-oxidants, chelating agents, inert gases and the like. Such preparations and the method and method of making such preparations are known and are described, for example, in Reminaton / s Pharmaceutical Science. 16th ed., Supra.

The antigens of the present invention may also be prepared as medicaments or pharmaceutical compositions comprising the antigens, alone or in combination with other antigens or other agents such as lymphokines, monokines and drugs, medicaments being used for animal therapy, including humans, and related indications with the immune system.

While the antigens of the present invention may be administered alone, it is preferred that they be administered as a pharmaceutical composition. The compositions of the present invention comprise at least one antigen or its pharmaceutically acceptable salt together with one or more acceptable carriers and optionally other therapeutic agents. By " acceptable " it is meant that the agent or carrier is compatible with other ingredients of the composition and are not harmful to the patient. The compositions include those suitable for oral, rectal, nasal, topical (including buccal and sublingual), vaginal or parenteral administration. The compositions conveniently may be presented in unit dosage form and may be prepared by methods well known in the art of pharmacy. Such methods include association of the active ingredient with the carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately associating the active ingredient with liquid carriers or finely divided solid carriers or both and providing the product in a form if necessary.

The orally administered pharmaceutical compositions according to the present invention may be any form

convenient, including capsules, sachets or tablets each containing a predetermined amount of the active ingredient. The powders or granules are also possible, as are solutions or suspensions in aqueous or non-aqueous liquids, or liquid oil-in-water emulsions or liquid water-in-oil emulsions. The active ingredient may also be presented as a bolus, filler or paste.

Having now described the invention, it will be more fully understood by reference to the following examples, which are in no way intended to limit the scope of the invention.

Example I Isolation. Clonaqem Molecular and Structure of

Human CD2 Antibody The pH3 cDNA expression vector

An expression vector for COS cells was constructed from piSV (Little et al., Mol. Biol. Med. 1: 473-488 (1983)) by insertion of a synthetic transcription unit between the suppressor tRNA gene and the origin of SV40. The transcription unit consisted of a chimeric promoter composed of immediate early potentiating sequences of human cytomegalovirus AD169 fused to HIV LTR-67 to +80 sequences. Immediately downstream of the LTR +80 sequence was inserted a polyadapter containing two BstXI sites separated by a 350 bp sequence; the BstXI sites were flanked by XbaI sites. which can also be used for excision of the insert. Downstream of the polyadapter were spliced SV40 small t antigen splice signals and SV40 early region polyadenylation derived from pSV2. The nucleotide sequence of the vector is shown in Figure 1.

Construction of the cDNA library

RNA derived from HPB-ALL cells was prepared by the guanidinium thiocyanate / CsCl method as described above. PolyA + RNA was prepared from the total RNA by oligo dT selection. Maniatis et al. . Molecular Clonidine: A Laboratorv Manual, supra. CDNA was synthesized by the method of Gubler and Hoffman (Gene 25: 263-269 (1982)). BstXI adapters were bound to the cDNA and the reaction products were fractionated by centrifugation through a gradient of 5-20% potassium acetate containing 1 mM EDTA for 3 hours at 50rpm in a SW55 rotor. Fractions of 50

0.5 ml by hand with a syringe or butterfly needle inserted just below the curve of the tube. Individual fractions were precipitated with ethanol after addition of linear polyacrylamide (Strauss and Varshavsky, Cell 37: 889-901 (1984)) to 20 μg / ml. Fractions containing cDNA greater than 700 bp were pooled and ligated to the graded purified and digested BstXI vector piH3.

Bound DNA was used to transform E. coli MC1061 / p3 made competent by the following protocol: The desired strain is seeded onto an LB plate. The next day an isolated colony is inoculated into 20 ml of TYM broth (recipe given below) in a 250 ml flask. Cells were grown to mid-log phase (Οϋροο about 0.2-0.8), poured into a 21-vial containing 100 ml of TYM and shaken vigorously until the cells grew to 0.5-0.9 OD, then diluted back to 500 ml in the same pot. When the cells reached a density of OD600 = 0, the vial was placed in an ice water bath and gently shaken to ensure rapid cooling. When the

The culture was cold, centrifuged at 4.2K rpm for 15 minutes (J6). The supernatant was decanted and the pellet resuspended in about 100 ml of THF (below) by gentle shaking on ice. Then it was again centrifuged in the same flask at 4.2K rpm for 8 minutes (J6). The supernatant was removed and the pellet resuspended in 20 ml of cold TfB II by gentle shaking on ice. Amounts of 0.1 to 0.5 ml were placed in microtubes pre-cooled in liquid nitrogen and stored at -70 ° C. For the transformation, a small amount was removed, thawed at room temperature only to melt and placed on ice. The DNA was added, left on ice 15-30 minutes and incubated at 37øC for 5 minutes (6 minutes for 0.5 ml quantities). Then the suspensions containing DNA were diluted 1:10 in LB and cultured for another 90 minutes before being seeded or application of antibiotic selection. Alternatively, the heat exchange reaction mixture was seeded directly onto antibiotic plates in which a thin layer (4-5 ml) of LB agar was spread without antibiotic immediately before sowing.

Means and Buffers: TYM: 2% Bacto-Tryptone, 0.5% Yeast

Extract, ο, 1M NaCl, 10 mM MgSO 4 (may be added prior to autoclaving). TfB 1:30 mM KOAc, 50 mM MnCl 2, 100 mM KCl, 10 mM CaCl 2, 15% (v / v) glycerol. TfB II: 10 mM Na-MOPS, pH 7.0, 75 mM CaCl2, 10 mM KCl, 15% glycerol.

Retrieval of cDNA clones by " oannina11

Culture plates for bacteriology (Falcon 1007) were prepared for •• panning " by coating with an anti-mouse IgG sheep antibody as described by Wysocki and Sato (Proc Natl Acad Sci USA 75: 2844-2848 (1978)), except the plates are washed with 0.15M NaCl of one bottle washings instead of PBS and the unreacted sites were blocked by overnight incubation in PBS containing 1 mg / ml BSA. The plates were typically prepared in large batches and stored frozen after aspiration of PBS / BSA. In the first round of screening, 24 6-cm plates of confluent COS cells were transfected by fusion of protoplasts according to the method of Sandri-Goldrin et al. Mol. Cell. Biol. Chem., 743-752 (1981). 72 hours post-fusion the cells were detached by incubation in PBS / 1mM EDTA / 0.2% sodium azide at 37Â ° C for 30 minutes. The detached cells were pooled, centrifuged and resuspended in PBS / EDTA / 5% fetal bovine serum containing monoclonal antibodies, generally derived from ascites at a 1: 1000 dilution, but also as commercial reagents at the concentrations suggested by the manufacturers. After 1 hour on ice the cells were diluted 1: 1 with PBS / EDTA / azide containing 2% Ficoll 400. After centrifugation (400xg, 5 minutes) the supernatant was carefully aspirated, the pellet resuspended in a small amount of PBS / EDTA / 5% FBS and the cells distributed by " panning " containing 3 ml of PBS / EDTA / 5% FBS. Plates are then essentially treated as described by Wysocki and Sato, Proc. Natl. Acad. Know. USA 75: 2844-2848 (1978). The episomal DNA was recovered from adherent cells by the Hirt method (J. Mol. Biol. 26: 365-269 (1967)) and used to transform MC1061 / p3.

Cell lines and cell culture COS cell clones M6 were propagated in Dulbecco's modified Eagle medium supplemented with 10% fetal serum and 15æg / ml gentamicin sulfate (DME / 10% calf serum). The cells were distributed the day before transfection by 6 cm to approximately 1: 8 plates from stock plates kept as dense as possible without damaging the cells. The T cell lines were cultured in Dulbecco's Iscove modification medium (IMDM) containing gentamicin as above, and NuSerum (Collaborative Research) or 10% fetal bovine serum.

Transfection of COS cells for immunofluorescence studies 50% confluency COS cells in 6 cm dishes were transfected into a volume of 1.5 ml with a mixture consisting of DME or IMDM medium containing 10% NuSerum (Collaborative Ressearch), 400 μg / ml DEAE dextran, 10 μ cloro chloroquine diphosphate and 1 μg / ml DNA. After 4 hours at 73 ° C (or earlier if the cells look poor), the transfection mixture was removed and the cells were treated with 10% DMSO in PBS for 2 minutes. Sussman and Milman, Cell Biol. 4: 1641-1643 (1984). The cells were then passed again to DME / 10% calf serum for 48 to 72 hours to allow expression.

Immunopretioitations. Northerns and Southerns

T cells were labeled by treatment with lactopexidase, lysed and immunoprecipitated by the method of Clark and Einfeld (Leukocvte Tvpinq II, Vol. II, pp. 155-167 (1986)) using agarose beads with goat anti- Mouse IgG (Cooper Biomedical). COS cells were transfected by the DEAE-dextran method and trypsinized and passed undiluted to fresh plates 24 hours post-transfection. 36 hours later, the cells were peeled off by exposure to PBS / EDTA as above, centrifuged and labeled by the lactoperoxidase method. A clear lysate was prepared as for T-cell immunoprecipitations, except the lysis buffer contained 1 mM PMSF and incubation with the primary antibody was performed for only 2 hours at 4 ° C. Eluted samples were fractionated in 11-25% polyacrylamide discontinuous gels using the Laemmli buffer system (Nature 227: 680-685 (1970)). Northern blot analysis was performed essentially as described (Maniatis et al., Molecular Clonine to Laboratorv Manual (1982)), except that DMSO was omitted from the application buffer, denaturation was performed at 70 ° C for 5 minutes and the gel contained 0 , 6% formaldehyde instead of 6%. The gel was stained in two volumes of water containing 1æg / ml ethidium bromide, photographed and transferred to nylon (GeneScreen, Dupont) in the staining liquid. The transferred RNA was irradiated by exposure to a germicidal lamp through Saran (Church, Proc.

Natl. Acad. Know. USA 8: 1991-1995 (1984)) for 5 minutes at a flow rate of 0.22 mW / cm 2 (measured at 254 nm). Southern blot analysis was performed by alkaline transfer to nylon (GeneScreen, DuPont) as described by Reed and Mann (Nucl. Acids Res. 13: 7207-7221 (1986)). Hybridization probes were prepared by the method of Hu and Messing (Gene 18: 271-277 (1982)), and the blots were prehybridized in SDS / phosphate buffer (Church and Gilbert, Proc. Natl. Acad Sci USA 8: 1991-1995 (1984)) containing 10 micrograms equivalents of phage M13 mpl9 DNA.

Formation of erythrocyte rosettes

Erythrocytes are prepared from whole blood by three centrifugations in PBS. COS cells were transfected into 6 cm plates with CD2 or other surface antigen expression clones by the DEAE method. 48 to 72 hours after transfection the medium was aspirated and 2 ml of PBS / 5% FDS / sodium azide per plate was added, followed by 0.4 ml of the appropriate erythrocyte samples as 20% suspensions in PBS. After 1 hour at room temperature, the non-adherent erythrocytes were washed gently and examined for plaques.

A cDNA encoding CD2 antigenic determinants was isolated as follows: cDNA was preproduced from RNA extracted from human HPB-ALL tumor T cell line and inserted into the SV40 origin pH3 origin expression vector as described above. A cDNA library of about 3 x 10 5 recombinants was constructed and the library was introduced into COS cells by protoplast fusion. Three days later the cells were excised by exposure to EDTA and treated with a set of monoclonal antibodies, including three (0KT11, Leu5b and Coulter Til) directed against CD2 determinants. Antibody treated cells were plated with sheep anti-mouse IgG antibody plates, allowed to bind and separated from the non-adherent cells by gentle washing. This enrichment method is known from the immunology literature (Mage et al., J. Immunol., Methods 15: 47-56 (1977).

The resulting colonies were pooled, fused with COS cells and subjected to a second round of " panning " as 1 previously. On the third turn a fraction of the cells were treated with a mixture of three monoclonal antibodies specific for CD2 and the Hirt supernatant was again prepared and used in E. coli transformation. DNA was preproced from eight of the resulting colonies and used to transfect COS cells. After three days, expression on the surface of the CD2 antigen was detected by indirect immunofluorescence in six of eight transfected plaques. DNA digestion of the corresponding plasmids with restriction enzymes revealed a 1.5 Kb insert in the six isolates.

One of the six clones was prepared in large quantities for further analysis. After transfection of COS cells, indirect immunofluorescence analysis with a partial panel of antibodies provided by the Third International Workshop on Leukocyte Differentiation Antigens showed that all provided antibodies gave positive reactions except for one sample from a sample that also did not react with T lymphocytes activated with phytohemagglutinin. Among the 17 antibodies tested were at least eight distinct groups defined by their different patterns of reactivity with lymphocytes from various primate species. Jonker and Nooij, Leukocvte Tvoina II. Vol. I, p. 373-387 (1986). 56

Analysis of the cDNA sequence

The CD2 cDNA insert was subcloned into M13 mpl9 (Vieira and Messing, Gene 19: 259-268 (1982)). in both orientations and the sequence determined by the dideoxynucleotide method (Figure 2). Sanger et al., Proc. Natl Acad. Know. USA 74: 5463-5467 (1977). An open reading frame was observed extending 360 fold from an ATG satisfying the consensus criterion of Kozak (Microbiol). Rev. 1-47: 45 (1983)) for translation initiation codons (Figure 1). The predicted amino acid sequence evokes an integral membrane protein with a single hydrophobic anchor traversing the membrane ending in a large intracytoplasmic domain. Comparison of the N-terminal amino acid sequence with the signal sequence residue frequency matrix constructed by von Heijne (Nucl. Acids Res. 14: 4683-4690 (1986)) suggests that the mature CD2 peptide is formed by cleavage of a precursor peptide between residues 192 (Ser) and 202 (Lys).

A surprising and unexpected feature of this sequence is the presence of a potential N-glycosylation site very close to the proposed cleavage site. The resulting polypeptide backbone has a predicted molecular weight of 38.9 Kd divided by an external domain of 21.9 Kb and a cytoplasmic domain of 14.6 Kd. Three N-glycosylation sites are present in the extracellular domain. The membrane spanning domain comprises 26 unchanged residues of predominantly hydrophobic character. In the nine residues immediately following are seven basic residues, lysines or arginines. The appearance of predominantly hydrophobic residues followed by basic residues is a typical organizational feature of the transmembrane proteins carrying anchors at the carbonyl end.

Another surprising feature of the transmembrane domain is the appearance of a cis-gli-gli-gli beta motif (Chou and Fasman, Annual Review of Biochemistry 47: 251-276 (1978)), delimited by hydrophobic residues (which are often found delimiting the beta turns). Because only 20 residues arranged in an alpha helix are theoretically required to cross the 3 nm membrane bilayer (Tanford, Science 200: 1012-1018 (1978)) and only 14 hydrophobic residues may allow the insertion and export of a membrane protein integral (Adams and Rose, Cell 41: 1007-1015 (1985)), the CD2 antigen transmembrane segment may contain a fold or a knot. The relatively large size of the cytoplasmic domain leaves open the possibility that CD2 possesses an intrinsic enzymatic activity. The cytoplasmic domain is very rich in proline and contains three sites with a high probability of torsion. Comparison of the amino acid sequence with the NBRF database did not reveal substantial homologies with other proteins. In particular, no homology to the T cell receptor alpha or beta chains, excluding the suggestion that CD2 is a primordial T cell receptor Milanese et al., Science 231: 1118-1122 (1986).

Immediately within the cytoplasmic face of the protein is a segment of basic amino acids followed by a serine residue, a pattern found at the same site in both the EGF receptor and the class I histocompatibility genes and in each case a known site for in vivo phosphorylation (EGF) and in vitro (HLA) by protein kinase C or cyclic AMP-dependent protein kinase, respectively. Hunter et al., Nature 311: 480--482 (1984); Davis and Czech, Proc. Natl. Acad. Know. 82: 1974-1978 (1985); Guild and Strominger, J. Biol. Chem. 259: 9235-9240 and 13504-13510 (1984). A similar site was found in the intracytoplasmic domain of the interleukin 2 receptor and is phosphorylated in vivo by protein kinase C. Lenard et al., Nature 311: 626-631 (1984); Nikaido et al., Nature 311: 631-635 (1984);

Shackelford and Trowbridge, J Biol. Chem. 259: 11706- (1984).

Immunoprecipitation of CD2 antigen expressed by transfected cells

COS cells were transfected with the CD2 expression plasmid and 125χ surface labeled by the lactoperoxidase method 60 hours post-transfection. A cell lysate was prepared and fractions thereof were incubated with either the anti-CD2 monoclonal antibody (OKT11) or a foreign antibody (OKT4; anti-CD4) for 2 hours at 4 ° C. Anti-mur-gain antibody bound to Sepharose was added and after several washing steps the adsorbed proteins were eluted and electrophoresed through an 11.25% polyacrylamide gel along with similarly prepared immunoprecipitates derived from activated T lymphocytes with phytohemagglutinin, the HPB-ALL line cDNA donor or a long-term T cell line generated in this laboratory. Autoradiography demonstrated a prominent band of immuno-reactive material precipitated from COS cells transfected by the anti-CD2 antibody, but not by the control. The calculated average molecular weight for the COS cell derived material was 51 Kd, compared to an average molecular weight of 54 Kd for the T-cell T-cell and B-cell derived material; the antigen derived from HPB-ALL cells has been found to have a molecular weight of about 61

Kd. The differences observed in size were attributed to different glycosylation patterns in the different cell types. A minor band of apparent molecular weight 38 Kd was present in the immunoprecipitated material from COS cells but not from T cells or HPB-ALL cells. The size of these species is in accordance with the predicted molecular weight of the mature, non-glycosylated peptide, 39 Kd. COS-expressing COS cells form rosettes with sheep erythrocytes COS cells transfected with the CD2 expression clone were treated for 1 hour with purified anti-CD2 (IgG, kappa) MT910 antibody (Rieber et al., Leukocyte Tvpinq IIf Vol. I , pp. 233-242 (1986)) at a concentration of 1 μg / ml or with purified MB40.5 (IgG1, kappa; Kawata et al., J. Exp. Med. 160: 633-651 (1984)) in same concentration. MB40.5 recognizes an HLA-ABC monomorphic determinant and cross-reacts with African Green Monkey histocompatibility antigens; it was chosen because it represents an antibody of the same isotype recognizing a surface antigen with approximately the same abundance of the CD2 antigen expressed by the transfected cells. Rats of sheep erythrocytes were observed in the presence of MB40.5, but not in MT910. Inhibition of rosets was also observed with the OKT11 antibody and not with several other control antibodies. Transfected COS cells form rosettes with other animal erythrocytes

In addition to sheep erythrocytes, human T cells form rosettes with erythrocytes of horse, pig, dog, 60

goat and rabbit, but not mouse or rat. Johansen et al., J. Allerav Clin. Immunol. 54: 86-94 (1974); Amiot et al. In A. Bernard et al., Eds. Leucocyte Typinq. Springer, ed., New York, N.Y., pp. 281-293 (1984); Nalet and Fournier, Cell. Immunol. 96, 126-136 (1985). Self-rosettes were also observed between human erythrocytes and human thymocytes (Baxley et al., Clin. Exp. Immunol., 15: 385-393 (1973)). COS cells transfected with the CD2 expression clone were treated with MT910 or with the control antibody, MB40.5 and exposed to erythrocytes of the above species. Rosettes were observed with erythrocytes of horse, pig, dog, goat, sheep, rabbit and humans, but not with mouse or rat erythrocytes. Rosette formation was blocked by pre-treatment of COS cells with MT910, but not with MB40.5. In these experiments, horse erythrocytes were found to form unusually large rosettes; goat erythrocytes formed sparse rosettes, possibly due to their small size being more susceptible to washing. Mouse erythrocytes showed weak spontaneous binding to the culture dish as well as cells pretreated with MT910 and MB40.5, whereas erythrocytes showed no detectable binding of any kind.

Binding of human erythrocytes blocked by the LFA3 antibody

Because it has been suggested from the blocking antibody studies that LFA3 is the target structure for the CD2 antigen (Shaw et al., Nature 323: 262-264 (1986)), the ability of the anti-LFA3 antibody to prevent rosette formation was studied, transfected cells were exposed to human erythrocytes pretreated for 2 hours with anti-LFA3 (IgG1, kappa) as ascites at a dilution of 1: 1000 or at a concentration of 10æg / ml of each one of the four non-agglutinating antibodies of the same isotype directed against human erythrocyte antigens 61

as prevalent or more prevalent than LFA3: G10 / B11 and D10, antigen K14, D6, antigen Wr * 3; and F7 / B9, anti-antigen K. Nichols et al. Vox Sana, in press. The erythrocytes were washed to remove excess LFA3 antibody, but allowed to form rosettes in the presence of control antibodies to ensure against possible loss of power of the desorption blocker antibody. Rosette formation was observed in the presence of the four control antibodies, but not with erythrocytes pretreated with anti - LFA3.

COS cells expressing other T-cell antigens do not form rosettes

A number of clones were isolated by the same expression technique used to clone CD2 and were characterized by varying degrees of antibody reactivity, nucleic acid restriction, and sequence analysis and immunoprecipitation. Representative clones were used to transfect COS cells and analyzed for the ability to sustain rosetting. Clones CDla, CDlb, CDlc, CD4, CD5, CD6, CD6, CD8 and CD28 (Tp44) did not form rosettes with human erythrocytes.

Analysis of RNA Transfers

Equal amounts of total RNA prepared from cell types expressing or not the CD2 antigen were subjected to electrophoresis on denaturing agarose gels and transferred to nylon. Hybridization of the RNA transferred with a chain selective probe (Hu and Messing, Gene 17: 271-277 (1982)) prepared from clone M13 containing a cDNA insert revealed the presence in RNA derived from populations of thymocytes, activated T cell, and senescent T cells. Smaller amounts were found in RNA extracted from the cDNA donor line, HPB-ALL and 62

still less from MOLT4; poorly detectable levels were recorded in HSB-2 RNA. No reactivity was observed with RNA from the Namalwa (Burkitt's lymphoma), U937 (histiocytic leukemia), HuT-78 (adult T cell leukemia), PEER (T-cell leukemia), or Jurkat clone J3R7 (cell leukemia T). The reactivity pattern is in accordance with the known or measured pattern of CD2 antigen expression, which was absent or undetectable in the Namalwa, * 937, HuT-78, J3R7, PEER and HSB-2 cell lines, weakly present in M0LT4, more strongly present in EPB-ALL and more strongly present in activated T cells. It is also known that thymocytes express high levels of the CD2 antigen. Evaluation of the cDNA clone sequence suggested that 1.3 Kb mRNA should arise by the formation of a 3κ distal endpoint relative to the canonical polyadenylation signal AATAAA at position 1085 in the cDNA sequence. To test this notion, HPB ALL-ALL RNA and activated T cells were subjected to Northern blot analysis and hybridized with a complete cDNA probe or with a probe derived from the cDNA moiety

to nucleotide 1131. This latter probe reacted only with the 1.65 Kb species, although the former showed the same pattern of reactivity observed in Figure 5. This result is consistent with the suggested origin for the transcription product of 1.3 Kb.

In both activated T cell and senescent cell RNA preparations, a 0.75 kb transcriptional product was detected which weakly hybridized. At present the origin of this RNA is unknown.

Genomic organization of the CD2 gene

Analysis of Southern blots of placental derived genomic DNA, peripheral blood lymphocytes, T cells, HeLa cells or the tumor lines used in RNA analysis above showed identical BamHI digestion patterns indicating that the rearrangement is not involved in the normal expression of the gene CD2 during development. Similarly, no major genomic change is observed to support the absence of CD2 antigen expression in the examined T cell lines. Restriction analysis of total genomic DNA with a number of other enzymes, as well as preliminary results with an incomplete collection of recombinant phages bearing the CD2 sequence, shows that the gene is divided into at least four exons.

Example II Isolation and Molecular Cloning of Human LFA-3 Antigen The above example shows that cDNAs encoding surface antigens such as CD2 can be isolated by the transient expression system of the present invention in which COS cells transfected with cDNA libraries bind to antibody coated plates (" panned "). Plasmid DNA was recovered from plaque-adherent cells used to transform E. coli and the repeated procedure, generally twice, to isolate the desired clone. While powerful this approach can not be used when the monoclonal antibodies used in " panning " recognize determinants in the transfected cells. This appears to be the case for the anti-LFA3 monoclonal TS2 / 9. However, a similar transient expression system based on cells competent for the replication of the polyoma virus should allow almost all monoclonals to be used since the likelihood of cross-reactivity between murine antibodies and murine cell surface determinants should be generally small.

A new expression vector, CDM8 (Figure 3) was created from the pyH3M COS cell vector described above. The novel vector differs by including a deletioned version of a mutant early region of the selected polyoma virus by the high expression efficiency in both murine and monkey cell cells by substituting substantially the entire promoter region of the human immunodeficiency virus the cognate sequences of the human cytomegalovirus immediate early promoter and by the inclusion of a bacteriophage T7 promoter between the eukaryotic promoter and the cDNA insertion site. Expression in COS cells of chloramphenicol acetyltransferase by all vectors was equivalent.

A library of 1.9 x 10 6 recombinants having insertions greater than 0.8 Kb in the CDM8 vector was prepared from a microgram of poly A + RNA isolated from the human lymphoblastoid cell line JY. The library was introduced into WOP cells (NIH 3T3 cells transfected with deletions of the polyoma origin) by fusion of spheroplasts and subjected to three cycles of " panning " and reintroduction into E. coli as described in Example I.

A clone encoding the LFA-3 antigen was identified by indirect immunofluorescence of transfected, amplified and sequenced WOP cells (Figure 4). Within the 874 bp insert, an open reading frame of 237 residues initiated at the methionine codon almost corresponding to the consensus sequence suggested by Kozak, Microbiol. Rev. 42: 1-45 (1983). The reading grid terminates in a series of hydrophobic residues without the basic anchor residues characteristic of the 65

membranes but sharing characteristics with surface membrane proteins linked to phosphatidylinositol. Characteristics include sets of serine or threonine residues in a hydrophilic region immediately preceding the hydrophobic domain and the presence of serines and threonines in the hydrophobic moiety.

The predicted amino acid sequence from the doclone LFA-3 nucleotide sequence was compared to the NBRF database and no significant homology was found; the most significant homologies were with the envelope protein of HIV. Within the 200 residues comprising the presumed mature protein are 6 N-linked glycosylation sites and 5 residues followed by serine or threonine which often appear in O-glycosylated proteins. Ten cysteine residues appear in the complete sequence, 6 of which are distributed over the last half of the mature protein and of which one is in the hydrophobic domain of the carbonyl end. Although the esterification of thiols from the cysteine to fatty acids is common in integral membrane proteins and may play an alternate role in the membrane anchoring of LFA-3, two examples of cysteine residues are known within or at the margin of the hydrophobic region of proteins bound to phosphatidylinositol.

The predicted sequence suggests that manipulations known to increase erythrocyte adhesion to T cells may have direct physical explanation in the structure of the LFA-3 molecule. Aminoethylisothiouronium bromide, the thiourea additive of bromoethylamine, undergoes spontaneous rearrangement to mercaptoethylguanidine at alkaline pH. The latter also has access to disulfide bonds inaccessible to less chaotropic reducing agents and can thereby reduce and promote the unwinding of the LFA-3 molecule. Similarly, neuraminidase can decrease spatial interference by the many sugar chains in the molecule. Hybridization analysis of RNA and DNA blots showed that the LFA-3 gene does not share closely related sequences in the genome and encodes a single RNA species of about 1 Kb in length. Cell lines expressing large amounts of surface LFA-3 have larger amounts of LFA-3 RNA than those expressing small or undetectable amounts. Radioimmunoprecipitation of the antigen expressed on COS and murine transfected cells shows a broad band of approximately 50 Kd average molecular weight, similar to that found in JY cells.

Example III Isolation and Molecular Clonaqem of CD28 Antigen cDNA

The foregoing examples illustrate the technique based on monoclonal antibodies of the present invention for enrichment in cDNAs encoding surface antigens. In the present invention, there is described a method of constructing expression libraries that allows the enrichment technique to be fully exploited. The method of the present invention for making expression libraries into plasmids is of general use for expression cloning. The antibody selection technique of the present invention has also been applied to isolate a cDNA clone encoding the CD28 antigen. The antigen shares substantial homology with members of the immunoglobulin superfamily and forms a surface dimer structure transfected COS cells similar to the dimer structure found on T lymphocytes.

Preparation of poly (A) + RNA cDNA libraries was prepared from HPB-ALL line of human tumor T cells by oligo (dT) cellulose chromatography of total RNA isolated by the guanidinium thiocyanate method (Chirgwin, JM et al. Biochemistry 18: 294-5299 (1979)).

CDNA was prepared by a protocol based on the method of Gubler and Hoffman (Gubler, U. et al., Gene 25: 263-269 (1989)). 4 μg mRNA was warmed to approximately 100 ° C in a 1.5 ml centrifuge tube for 30 seconds, cooled on ice and the volume adjusted to 70 μΐ with RNase-free water. To this was added 20 .mu.l of

buffer (0.25M Tris pH 8.8 (8.2 at 42 ° C), 0.25M KCl, 30 mM MgCl 2), 2 μM of inhibitors of RNAses (Boehringer 36 μ / μ), 1 μM of 1M DTT , 1 μg of 5 μg / μl oligo dT (Collaborative Research), 2 μg of 25 mM deoxynucleotide triphosphates (US Biochemicals) and 4 μg of reverse transcriptase (Life Sciences, 24 μg / μg). After 40 minutes at 42øC, the reaction was stopped by heating at 70øC for 10 minutes. To this reaction mixture was then added 320 μΐ of RNase-free water, 80 μΐ buffer (0.1M Tris pH 7.5, 25 mM MgCl₂, 0.5M KCl, 0.25 mg / ml BSA and 50 mM DTT) , 25 units of RNaseH (BRL). After 1 hour at 15 ° C and 1 hour at 22 ° C, 20 μΐ of 0.5M EDTA was added, the reaction mixture was phenol extracted, NaCl added to 0.5M, added linear polyacrylamide (vehicle; Strauss, F . et al., Cell 37: 889-901 (1984)) to 20 μg / ml and the tube was filled with ethanol. After centrifugation for 2-3 minutes at 12,000 xg, the tube was removed, vortexed to release the precipitate scattered across the wall of the tube and again centrifuged for 1 minute.

The unpurified oligonucleotides having the sequence CTCTAAAG and CTTTAGAGCACA were dissolved in a concentration of 1 mg / ml, MgSO4 was added to 10 mM and the DNA precipitated by the addition of 5 volumes of EtOH. The pellet was washed with EtOH at 68

70% and resuspended in TE at a concentration of 1mg / ml. 25 μΐ of the resuspended oligonucleotides were phosphorylated by the addition of 3 μl of buffer (0.5 M Tris pH 7.5, 10 mM ATP, 20 mM DTT, spermidine, 1 mg / ml BSA and 10 mM MgCl 2) and 20 units of polynucleotide kinase followed by incubation at 37 ° C overnight.

3 μΐ of the 12-mer oligonucleotides and 2 μΐ of the 8-mer phosphorylated oligonucleotides were added to the cDNA prepared as above in a 300 μ mistura reaction mixture containing 6 mM

I

Tris pH 7.5, 6 mM MgCl 2, 5 mM NaCl, 0.35 mg / ml BSA, 7 mM mercaptoethanol, 0.1 mM ATP, 2 mM DTT, 1 mM spermidine and 400 units of T4 DNA ligase (New England Biolabs) at 15 ° C overnight. 10 μΐ of 0.5 M EDTA was added, the reaction was phenol extracted, precipitated with ethanol, resuspended in a volume of 100 μΐ and placed on a 5 ml gradient of 5-20% potassium acetate in 1 mM EDTA, 1 ml of ethidium bromide. The gradient was centrifuged 3 hours at 50000 rpm (SW55 rotor) and fractionated manually, harvesting three fractions of approximately 0.5 ml followed by six of approximately 0.25 ml in microtubes by means of a butterfly infusion system inserted just below the curve of the tube. Linear polyacrylamide was added to 20 μg / ml, the tubes were filled with ethanol, cooled, centrifuged, vortexed and centrifuged again as above. The precipitate was washed with 70% ethanol, dried and resuspended in ΙΟμΙ. 1 μΐ of the last 6 fractions were run on a gel to determine which fractions to collect and typically material of less than 1 Kb in size was typically discarded. The remaining fractions were pooled and bound to the vector. The complete sequence and derivation of the vector are shown in Figure 5. The vector was prepared for cloning by digestion with BstXI and fractionation in a 5-20% gradient of potassium acetate as described for the cDNA. The proper band 69

was collected with a syringe under 300nm UV light precipitated with ethanol as above. cDNA and vector were titrated on test leads. Generally 1-2 μg of purified vector were used for cDNA derived from 4 μg of poly A + RNA. Binding reactions were composed as described for addition of the backer adapter. Binding reactions were used to transform MC106l / p3 cells made competent as described above. The transformation efficiency for the supercoiled vector was 3-5 x 108 colonies / g.

Recovery and characterization of the CD28 clone " Panning " of the library was performed as described above, using purified antibody (Dupont) at a concentration of 1 μg / ml in the antibody mixture. Methods used for transfection of COS cells, radioimmunoprecipitation, hybridization of RNA and DNA blots and DNA sequencing were all as described above.

To isolate the CD28 cDNA, a large cDNA and plasmid library was constructed in a high expression efficacy vector containing an SV40 origin of replication. A preferred version of the vector containing an M13 origin is shown in Figure 6. Three characteristics of the vector make it particularly suitable for this purpose: (i) the eukaryotic transcription unit allows high expression levels in COS cells of coding sequences placed under their control; (ii) the small size and particular arrangement of the sequences in the plasmid allow high level of replication in COS cells; and (iii) the presence of two identical BstXI sites in inverted orientation and separated by a small, replaceable fragment allows the use of an effective oligonucleotide-based strategy to promote cDNA insertion into the vector. 70

The BstXI cleavage site, CCAN / 5NTGG, creates a fourfold 3f extension spanning from site to site. A

vector in which two identical sites were placed in inverted orientation relative to each other and separated by a short segment of replaceable DNA. BstXI digestion followed by removal of the substitutable segment gave a vector molecule capable of binding to fragments having the same ends of the replaceable segment, but not to itself. In parallel, synthetic cDNA oligonucleotides were employed giving the same ends of the replaceable segment. The cDNA can not then be bound to itself binds to the vector. In this way the cDNA and vector were used as efficiently as possible. Placement of tails with terminal transferase achieves the same end, but with less convenience and less overall effectiveness. In addition, the homopolymer segments located with respect to the cDNA inserts were described as inhibiting in vitro and in vivo expression (YOkota, T., et al., Nucl Acids Res. 14: 1511-1524 (1986); Riedel, H .. EMBO J. 3: 1477-1483 (1985)). Recently

similar approaches have been described based on the use of partially filled restriction sites to favor the insertion of genomic DNAs (Zabarovsky, ER, et al., Gene 42: 119-123 (1986)) and cDNAs (Yang, Y., et al. Cell 47: 3-10 (1986)). These approaches give ends of 2 to 3 complementary bases, which generally bind less efficiently than the 4-base extensions described herein.

While the cloning scheme of the present invention does not result in a directional insertion of the cDNA, the ability to make large libraries readily coupled with a powerful selection process makes directional insertion unnecessary. The library building efficiencies observed according to the present invention, between 0.5 and 2 x 106 recombinants per μg of 71

mRNA, with less than 1% background and an upper insertion size

1 kb, compared favorably to those described for lambda gt10 phage vectors (7-5 x 105æg mRNA) and lambda gtll (1.5 x 106æg mRNA) (Huynh, T., et al., In: DNA Cloninq Vol. I. A

Practice Approach. Glover, D.M. (ed.), IRL Press, Oxford (1985), pp. 49-78); but the resulting clones were easier to handle.

Surface antigen cDNAs can be isolated from these libraries using the enrichment method of the present invention. In this method, the library is introduced into COS cells (for example, by fusion of spheroplasts or protoplasts), where it replicates and expresses its insertions. Cells were collected by trypsin-free detachment, treated with specific monoclonal antibodies against the desired surface antigens, and delivered by antibody coated plates against affinity purified mouse immunoglobulins. Cells expressing the surface antigen adhere and the remaining cells can be removed by washing. A Hirt fraction (Hirt, B., J. Molec. Biol., 26: 365-369 (1967)) was prepared from the adherent cells and the resulting DNA was used to transform E. coli for further cycles of fusion and selection. Typically, after two rounds of selection with monoclonal antibodies that recognize different surface antigens, a single round of selection is performed with a single antibody or set of antibodies recognizing the same antigen.

Isolation of a CD28 cDNA The CD28 cDNA was isolated from a library of approximately 3 x 105 recombinants prepared from cDNA derived from 0.8 gg of poly A + RNA using an earlier version of the protocol described in the Materials and Methods. The library was 72

cloned relative to CD28 (and other surface antigen) cDNA clones by the method described above. After the third transfection, the COS cells were " panned " with antibody 9.3 alone. A Hirt supernatant was prepared from adherent cells and used to transform E. coli. Plasmid DNA was isolated from eight colonies and used to individually transfect COS cell cultures. The presence of the CD28 antigen was detected in three of eight cultures transfected by indirect immunofluorescence. The three plasmid DNAs contained an insertion of approximately 1.5 Kb.

I

Analysis of the cDNA sequence

CD28 cDNA encodes a large open reading frame of 220 residues having typical characteristics of an integral membrane protein (Figure 17). Removal of a predicted N-terminal signal sequence gives a mature 202-residue protein comprising an extracellular domain with five potential N-linked glycosylation sites (Asn-X-Ser / Thr), a membrane-spanning hydrophobic domain of 27 amino acids and a cytoplasmic domain of 41 amino acids. Comparison of the CD28 amino acid sequence with the National Biomedical Research Foundation (Version 10.0) database revealed substantial homology to the variable regions of the immunoglobulin heavy chain in a domain encompassing almost the entire extracellular fraction of CD28. Within this domain two cysteine residues in the Leu- (Ser or Tre) -Cis and Tir- (Tir or Fen) -Cis homology blocks are shared by CD28, CD4, CD8 and variable sequences of heavy and light chains of immunoglobulin and related molecules with approximately the same space (Maddon et al., Annu Rev. Biochem 48: 961-997 (1979)). 73

CD28 cDNA directs the production of a homodimer in transfected COS cells

Immunoprecipitation of CD28 antigen from transfected COS cells was performed using monoclonal antibody 9.3 (Hansen, J.A., et al., Immunoaenetics 10: 247-260 (1980)). the material obtained from COS cells migrated with a molecular weight of 74 Kd under non-reducing conditions and 39 Kd under reducing conditions, a pattern consistent with the formation of homodimers. Under the same conditions activated T cells give bands with molecular weights of 87 and 44 Kd, and HPB-ALL cells give bands of 92 and 50 Kd, under non-reducing and reducing conditions respectively. The variation in molecular weight of the material obtained from different cell types arises due to a result of different patterns of glycosylation characteristic of each of the types. Similar results were observed with other leukocyte surface antigens (Seed et al., Proc Natl Acad Sci USA 87 (1987)). The nucleotide sequence of the CD28 cDNA provides for a mature protein having a molecular weight of 23 Kd, much smaller than observed in these experiments and probably attributed to the use of the N-linked glycosylation sites predicted by the amino acid sequence.

Analysis of RNA Transfers

Equal amounts of total RNA prepared from cell types expressing or not expressing CD28 were subjected to DNA blot analysis as described above. Four bands with molecular weights of 3.7, 3.5, 1.5 and 1.3 Kb were visible in the bands containing thymocyte RNA, senescent T-cell T-cells and PEER and HPB-ALL T cell elucemia cell lines . No bands were detected in the RNA-containing bands prepared from U937 cell lines.

(histiocytic leukemia), HuT-78 (adult T cell leukemia), Jurkata (T cell leukemia), Namalwa (Burkitt's lymphoma), M0LT4 and HSB-2 all do not express CD28. The 1.5 kb transcript product presumably corresponds to the isolated cDNA and the 3.7 and 3.5 Kb species reflect " splicing " incomplete or use of alternative polyadenylation sites. The 1.3 Kb transcription product may terminate in an unconventional polyadenylation signal, since there is no obvious candidate in the sequence.

The CD28 gene is not rearranged

DNA transfer analysis (Seed, et al., Proc. Natl. Acad Sci USA (1987)) of placental derived genomic DNA, peripheral blood lymphocytes, T cells, HeLa cells or tumor lines used in analysis of RNA rearrangements showed identical Dral digestion patterns indicating that the rearrangement is not involved in the normal expression of the CD28 gene during development. Similarly, there do not appear to be large genomic rearrangements that support the absence of expression of the CD28 antigen on the T cell tumor lines examined. It can be deduced from the Dral fragment pattern that the CD28 gene contains at least two introns.

Exemol IV Isolation and Clone Molecular of two Human CD7 Antigen cDNAs The CD7 antibody pool (Palker, et al., Leukocot Tvoing II, Springer-Verlag, New York, 303-313 (1985)) recognized a 40 Kd glycoprotein (gp40) on the surface of peripheral blood T cells and thymocytes. Preliminary studies with anti-CD7 antibodies have shown that CD7 + T cells increase immunoglobulin (Ig) synthesis by B cells (Miroshima et al.

I

al. J. Immunol. 129: 1091-1098 (1982)), suppress Ig synthesis by concanavalin A-stimulated B cells (Haynes et al., Proc Natl Acad Sci USA 76: 5829-5833 (1979)) and are precursors of cytotoxic T cells generated in the culture of mixed lymphocytes (Morishima et al., J. Immunol., 129: 1091-1098 (1982)). In addition, CD7 has been found to be the most reproducible marker for the identification of acute T-cell lymphoblastic leukemia (Link et al., Blood 62: 722-728 (1983)). As such, studies were carried out in which the cytotoxins coupled to the anti-CD7 3A1 antibody were used to purge the bone marrow prior to reinfusion to prevent early relapse in autologous bone marrow transplants or as prophylaxis versus graft vs. host disease in allogeneic bone marrow transplants (Ramakrishnan et al., J. Immunol., 135: 3616-3622 (1985)). Similarly, anti-CD7 antibodies have also been shown to be promising as immunosuppressive agents in the treatment of allograft rejections (Raftery et al., Transo! Proc. 17: 2737-2739 (1985)) which is in accordance with the recent observation that 7G5 anti-CD7 antibody significantly inhibits the primary mixed lymphocyte reaction (Lazarovits et al., Leukocyte Τνοίηα III, Oxford Univ. Press, Oxford (1987)).

At present the physiological role of CD7 is not understood. Anti-CD7 antibodies are known to be non-mitogenic and do not block the T cell response to PHA, or tetanus toxoid (Palker et al., Leukocyte Tvpincr Springer-Verlag, New York, 303-313 (1985) ). Some authors have observed that CD7 expression in thymocytes occurs prior to the establishment of T-cell receptor beta-chain rearrangement (Pittaluga et al., Blood 68: 134-139 (1986)) and point to a possible role of CD7 in this rearrangement and subsequent expression of the T cell receptor. Of course, cloning of the CD7 antigen will facilitate understanding of its role in T cell physiology. Sequencing of 76

nucleotides and preliminary characterization of two cDNAs encoding the CD7 antigen were performed according to the method of the present invention. Taken by the recent suggestion that CD7 may be or be part of the T cell IgM receptor (Andrin et al., Leukocyte Tvoinq III, Oxford Univ. Press, Oxford (1987)), the ability of COS cells expressing CD7 to binding to IgM or to IgM immune complexes. The results do not support the simple notion that CD7 is itself an IgM receptor.

Preparation of a cDNA library and recovery and characterization of CD7 clones The preparation of a cDNA library on HPB-ALL in the expression vector piH3 was performed as described above. " Panning " of the library was performed according to the method of the present invention, using the purified anti-CD7 Leu9 antibody (Bencton Dickinson) and the 7G5 antibody as the ascites fluid was diluted to 1/1000. Methods for cell transfection, radioimprecipitation, hybridization of DNA and RNA blots and DNA sequencing were all already described herein.

Ligation of IgM and IaG by COS cells transfected with CD7 and CDw32

Human IgM, IgG and IgA antibodies, goat anti-human immunoglobulins (anti-Ig (G + M + A)) purified and conjugated to FITC, washed and preserved bovine erythrocytes, and IgG and IgM fractions of rabbit anti-erythrocyte antibodies cattle were purchased from Cooper Biomedical (Malverne, PA). COS cells were transfected by the DEAE-dextran method with cDNAs encoding the surface antigens CD7, CDw32 and CD28. 48 hours after transfection the cells were washed with 77

PBS / 0.5% BSA and incubated with IgM, IgG or IgA antibodies at a concentration of æg / ml at 4øC for 2 hours. Subsequently the cells were washed with PBS / 0.5% BSA and incubated for 30 minutes at 4 ° C with rabbit anti-human immunoglobulin antibodies conjugated to FITC at 4 ° C. After washing the cells were examined with a fluorescence microscope. The experiments were also run in the presence of 0.1% azide with the same results.

The bovine erythrocytes for the roset assays were prepared as described by Ercolani et al., J. Immunol. 127, 2044-2051 (1981). Briefly, a 2% suspension of bovine erythrocytes was washed with PBS / 0.5% BSA and treated with sub-agglutinating amounts of the IgG or IgM fraction of rabbit anti-bovine erythrocyte antibodies at 4 ° C for 1 hour. The erythrocytes were then washed twice with PBS / 0.5% BSA and adjusted to a 2% solution. 2 ml of antibody-coated erythrocytes were plated onto 60 mm plates containing COS cells which were transfected 48 hours earlier with CD7, CD32 or CD28 by the DEAE-dextran method. The plates were then centrifuged at 150xg at 4øC for 15 minutes. After a further 45 minutes of incubation at 4øC, the plates were gently washed 5 times with 5 ml of PBS / 0.5% BSA and the COS cells were examined for rosetting. These experiments were also performed in the presence of 0.1% sodium azide without changing the results.

Formation of T-cell rosettes with erythrocytes coated with antibodies

Peripheral blood lymphocytes were obtained from heparinized blood by centrifugation at 4øC on a 78

Ficoll-Hypaque gradient at 400xg for 30 minutes. Leukocytes at the interface were washed twice with PBS. The leukocytes were adjusted to 10x107 cells / ml in IMDM / 10% Serum

Fetal Bovine (FBS) and incubated in tissue culture plates at 37 ° C for 30 minutes. The non-adherent cells were transferred to new plaques and PHA was added to stimulate proliferation of T lymphocytes. The next day the cells were washed with PBS and placed in fresh IMDM / 10% FBS.

Rosetting trials were performed three days later. Cells were washed with PBS / 0.5% BSA and a suspension of 10 μg of 2% Ig coated erythrocytes prepared as described above added to 10 μg PBS / 0.5% BSA containing 5x106 cells / ml. The blends were plated in 96-well Falcon round-bottomed dishes and centrifuged at 150 xg for 15 minutes at 4 ° C. After an additional 45 min incubation at 4øC the pellets were resuspended with 10 μ PBS / 0.5% BSA and the rosettes counted under phase contrast microscopy. The experiments were performed in the presence and absence of 0.1% sodium azide with no detectable difference.

Isolation of cDNAs encoding the human CD7 antigen

To isolate the CD7 cDNAs a large plasmid library was constructed in the π3 expression vector as described above. The library was introduced into COS cells by fusion of spheroplasts and allowed to replicate and express their insertions. COS cells were harvested by trypsin-free detachment at 72 hours post-transfection, treated with surface antigen-specific monoclonal antibodies to surface antigens thought to be encoded with affinity-purified anti-mouse antibodies as described herein. Under these conditions cells expressing the surface antigen adhere and the remaining cells can be removed by washing.

A Hirt fraction (Hirt, J. Mol. Biol. 26: 365-369 (1967)) was prepared from adherent cells and the resulting DNA was used to transform E. coli for further cycles of fusion and selection. In the third round of selection the detached cells were treated with a mixture of monoclonal antibodies specific for CD7 (765 and Leu9) and a Hirt supernatant was again generated and used to transform E. coli. After transformation of E. coli with the DNA, 8 colonies and the plasmid DNA prepared from them were pooled by an alkaline mini-preparation process (Maniatis, et al., Molecular Cloning: A Laboratory, Cold Spring Harbor, New York 1982)). DNA was prepared from the resulting 8 colonies and used to transfect COS cells. After 3 days the expression on the surface of the CD7 antigen was detected by indirect immunofluorescence in 7 of 8 transfected plaques. Restriction enzyme digestion of the corresponding plasmid DNAs revealed two species. One contained a 1.2 kb insert and the other a 1.3Kb insert.

Analysis of the CD7 cDNA sequence

Both isolates were sequenced by the dideoxynucleotide method. The 1.2 kb cDNA encodes an open reading frame of 240 residues having the typical characteristics of an integral membrane protein. The initial location of the cleavage site of the signal sequence by the von Heijne method. Acids Res. 14: 4683-4690 (1986)) was in residue. However, it was later determined that the homology with the variable regions of the immunoglobulins predicts the mature end at residue 26; this location also conforms to the position of the 80

(I.e.

intron as discussed below in Figure 8. Removal of the predicted N-terminal signal sequence gives a mature protein of 215 residues with a predicted molecular weight of 23 Kd. In the extracellular domain are two N-linked glycosylation sites (Asn-X-Ser-Thr), according to the results of Sutherland et al. (J. Immunol., 133: 327-333 (1984)), which also showed the presence of covalently linked glycans and palmitic acid in the mature protein. In the hydrophobic domain of 27 amino acids traversing the membrane is a single cysteine residue which may be the site of acylation with fatty acids (Rose et al., Proc. Natl Acad Sci USA 81: 2050-2054 (1984); Kaufman et al., J. Biol. Chem. 259: 7230-7238 (1984)). The length of the cytoplasmic domain, 39 residues, is in agreement with the 30-40 amino acids predicted by protease digestion of the CD7 precursor on the fractions of micormsomal membranes with ribosomes (Sutherland et al., J. Immunol. 131: 327-333 ( 1984)). Sequence analysis of the 1.7 Kb clone (Figure 8) revealed the presence of an intron located at 121 bp at the 5 'end. 0

411 bp intron contains stop codons in the three open reading frames and is situated immediately downstream of the secretory signal sequence as is often observed for secreted and surface proteins. Both the 5 'and 3' ends of the intron are in accordance with the consensus sender / acceptor site of " splicing " AAG GTRAGA / ... / YG-nNYAG A (Mount, Nucl Acids Res. 10: 459-472 (1982)). Because the 1.2 and 1.7 Kb clones express the CD7 antigen equally well in COS cells, the intron must be removed in COS cells inefficiently. Comparison of the amino acid sequence with the National Biomedical Research Foundation database revealed substantial homology to the human and mouse immunoglobulin kappa chain and to the gamma receptor variable gamma regions

1

T cells in almost the entire extracellular segment of the molecule. Two cysteine residues shared with approximately equal spaces by the three structures fall into the conserved Ile-Tre-Cys and Tir-X-Cys sequences. In the variable regions of the kappa chain these cysteines form a disulfide bridge. The presence of at least one intracholesterol disulfide bridge in the CD7 structure was previously proposed by Sutherland et al. (J. Immunol. 133: 327-333 (1984)), who observed that CD7 immunoprecipitation gives rise to a band- an apparent molecular weight of 40 Kd under reducing conditions and 38 Kd under non-reducing conditions.

Based on homology with immunoglobulin V regions CD7 is expected to contain a disulfide bond linking Cys 23 and Cys 89. A second disulfide bond, Cys 10 and Cys 117 ligand was proposed based on the structural similarity between CD7 and Thy-1. Extracellular domains of Thy-1 and CD7 have 4 residues of cysteine, in substantially homologous positions. The 4 residues of Thy-1 cysteine are linked at two internal disulfide bridges between Cys 9-111 and Cys 19-85 (Williams et al., Science 216: 696-703 (1982)). In Thy-1, Cys 111 forms an amide bond with the ethanolamine fraction of substituted phosphatidylinositol and is therefore the last residue of the mature molecule (Tse et al., Science 230: 1003-1008 (1985)). In CD7, Cys 117 is followed by four replicates of a sequence whose consensus is Xaa-Pro-Pro-Xaa-Ala-Ser-Ala-Leu-Pro and which is proposed to play the role of a peduncle by projecting the V-like domain off the cell surface.

In addition to the homologies presented in Figure 20 and referred to above, the CD7 extracellular domain has significant homology to both the rat CD8 heterodimer chains (Johnson et al., Nature 323: 74-76 (1986)) and the P0 protein of myelin (Lemke et al., Cell 40: 501-508 (1985)). CD7 drives the production of a 40 Kd protein in transfected COS cells. Immunoprecipitation of CD7 antigen from transfected COS cells was performed as described herein using 7G5 monoclonal antibody (Lazarovits et al., Leukocyte Tvp III, Oxford Univ. Press, The material obtained from COS cells migrated as a broadband with a molecular weight of 40 Kd under reducing conditions under the same conditions. HPB-ALL cells (the cDNA donor line) and activated T cells (Table 2). In both COS and HPB-ALL cells, a weak band with a molecular weight of 30 d d was observed, possibly corresponding to a partially glycosylated precursor (Sutherland, DR, et al. J. Immunol., 133: 327-333 (1984)).

Analysis of RNA Transfers

Equal amounts of total RNA prepared from cell types expressing or not having CD7 were subjected to Northern blot analysis as described herein. A single 1,3 Kb species was visible in the lanes containing thymocytes, activated T cells, resting T cells, and T cell leukemia lines, HuT-78, HPB-ALL, Jurkat J3R7, HSB-2 and PEER. With the exception of the PEER cell line, none of the T cell tumors showed significant overexpression of CD7 transcripts. CD7 RNA was detected in all cells derived from the thymus, but not in RNA from U937 (histiocytic leukemia) and Namalwa (Burkitt's Lymphoma) cells. No band corresponding to the 1.7 Kb cDNA was detected, suggesting that this species is artificially enriched during the cloning or amplification process of the library. 83

»Enrichment during amplification seems unlikely since the 12 Kb cDNA clone propagates as well in E. coli as the 1.7 Kb clone. However, immediately upstream and downstream of the intron insertion site are sequences which may form a disrupted standing and loop structure. Eight of the 10 base pairs of the potential foot are GC pairs, perhaps giving the structure sufficient stability to interfere with the elongation of the first strand of cDNA. The presence of the intron greatly separates the two halves of the foot, potentially eliminating the structure through unfavorable loop entropy and allowing effective synthesis of a first strand. The CD7 gene is not rearranged. Southern blot analysis of genomic DNA derived from placenta, peripheral blood lymphocytes, T cells, HeLa cells or the tumor cell lines used in the analysis of RNA blots showed identical patterns of Dral digestion. Thus, the CD7 gene is not greatly altered during development and the high level of expression in the PEER cell line is not the consequence of substantial genomic rearrangement.

J

COS cells expressing CD7 do not bind to IoM

Human peripheral blood T lymphocytes express IgM antibody receptors (FcRu: Moretta et al., Eur. J. Immunol. 5: 565-569 (1975); McConnell et al., Immunol., 30: 835-837 (1976) )). It has recently been described that CD7 should play a role in IgM binding to T cells (Sandrin et al., Leukocyte

Tnnq III. Oxford Univ. Press, ed., Oxford, England (1987)). L cells, usually CD7 + and FcR11 +, become CD7 + and FcRu + when transfected with a 16 Kb genomic fragment

encoding the CD7 antigen (Sandrin et al., Leukocyte Tvpinq III .. Oxford Ubniversity Press, ed., Oxford, England (1987)). In addition, binding of IgM to CD7-positive cells can be blocked by monoclonal anti-CD7 Hully-m2 antibodies (Thurlow et al., Transolantation 38: 143-147 (1984)) and IgM columns bind a 37 Kd protein derived of radioactively labeled lysates of peripheral blood T lymphocytes (Sandrin et al., Leukocyte Tvpinq III, Oxford Univ. Press, ed., Oxford, England (1987)).

Thus, COS cells expressing CD7 were tested for their ability to bind IgM. IgM receptor activity was assayed by direct binding (Hardin et al., Proc. Natl. Acad Sci USA 76: 912-914 (1979)) or by an assay of rosettes with ox erythrocytes coated with a fraction of IgM from rabbit serum to bovine erythrocytes as described by Ercolani et al., J. Immunol. 127: 2044-2051 (1981)). CD7 expressing cells do not bind to human IgM or form rosettes with erythrocyte coated with IgM. Under the same conditions, COS cells transfected with a cDNA encoding the human IgG CDw32 receptor bind directly to IgG and form rosettes with IgG coated erythrocytes. Erythrocytes coated with IgM or IgG antibodies also adhere to a peripheral lymphocyte fraction as described (Moretta et al., Eur. J. Immunol., 5: 565-569 (1975).

These results do not support the notion that the CD7 antigen is in itself an IgM receptor, although they do not exclude the possibility that COS cells suppress IgM binding activity in some way or that CD7 is part of the receptor. IgM or modified to be. That CD7 is not by itself an IgM receptor is supported by the observation that a number of CD7 + T cell lines are FcRu- (Sandrin et al., Leukocvte

Tvpinq III Oxford Univ. Press, ed., Oxford, England (1987)).

Example V

Isolation and Cloning of Human CDw32 Anticrene Molecular

A cDNA encoding the human CDw32 antigen, a

human receptor for immunoglobulin G (Fc receptor) constant domains was isolated by the method of the present invention, owing to its affinity for its ligand, IgG. The isolated clone sequence is closely related to the murine Fc beta receptor, but completely diverges in the coding moiety from

cytoplasmic domain. The receptor expressed in COS cells showed a preference for IgGi between the IgG subtypes and no affinity for IgM, IgA or IgE.

In order to isolate the Fc receptor clone, cDNA libraries are prepared from tumor cell lines or from a human tumor and COS cells are transfected. After 48 hours, the cells were treated with mouse or human IgG antibodies and allowed to stand on the plates coated with sheep anti-mouse IgG antibodies or with affinity-purified goat anti-human IgG antibodies. After lysis, DNA recovery and transformation of E. coli. the cycle was repeated for two more times. Although no positive clones were isolated from the tumor line libraries, a cDNA clone encoding an Fc receptor was isolated from a library prepared from a human adrenal tumor. It has been discovered that many tumors are highly infiltrated by macrophages and lymphocytes. Thus, tumor RNA may be a good source in general for transcripts of human macrophages.

By indirect immunofluorescence assay, the human receptor expressed on COS cells bound all mouse and human IgGs with relatively low affinity for Î "7M) and a clear discrimination was observed between human antibodies to IgGÎ ± IgM,

Human IgA1, IgA2 and IgE do not bind nor does this occur with murine IgM or IgA. As expected human Fc but not the Fab fragments bound to the transfected cells. Among the monoclonal antibodies presented to the Third International Workshop on Leukocyte Differentiation Antigens, three gave a strong positive immunofluorescence: two (out of two) recognizing the CDw32 determinant of the Fc receptor and one (out of four) recognizing the CD23 determinant IgE in B cells). Monoclonals that recognize the CD16 antigen of the T cell receptor / macrophage Fc gave only a weak immunofluorescence comparable to that shown by the control ascites. Radioimmunoprecipitation of cos cells transfected with Cdw32 antibodies showed the presence of a single 40 Kd species, comparable in size with the recognized antigen on the surface of the CDw32 + HL-60 myeloid line and with the less abundant antigen present on the histiocytic leukemic line U937 . This result reinforces the notion that the receptor alone is CDw32, since the CD16 receptor is described as being substantially larger (60-70 Kd). The nucleotide sequence of the isolated receptor (Figure 9) is highly homologous to that of the members of the newly isolated murine receptor family and more closely related to the murine beta2 receptor by nucleic acid homology. Surprisingly, the murine beta2 receptor is found on B and T lymphocytes and macrophages; in the human system, CDw32 (shown herein as being of the beta2 type) is restricted to macrophages whereas another Fc receptor (CD16) is found lymphocytes and macrophages. The human sequence appears to have diverged from the mouse sequence by inserting approximately 1 Kb of DNA into some bases 3 / to the junction between the transmembrane and cytoplasmic domains. The insertion site junctions do not show 87

obvious relationships with " splicing " acceptor " sequences. Comparison of the human and murine peptide sequences showed that the peptide sequence diverged at the end of the transmembrane domain, before the nucleotide sequence diverged suggesting the existence of a selective pressure favoring the creation of a different cytoplasmic domain.

Analysis of RNA transfers showed that myeloid lines but not lymphocytic cell lines expressed RNA homologous to the CDw32 probe. DNA transfer analysis showed multiple bands consistent with the existence of a small family of multigenes.

Example VI Isolation and Molecular Cloning of Two Clones of cDNA Encoders of Antigen CD20 Specific to Lymphocytes B f Bl, Bp35)

Recent studies suggest that B cell antigen CD20 plays a role in B cell activation. Monoclonal antibodies (mAb) against CD20 induce different cell responses depending on the antibody used and the phase of differentiation or activation of cells B target. Monoclonal antibody 1F5 activates resting B cells by initiating transcription of the Gq phase into the cell cycle phase and induces proliferation of dense tonsil B cells (Clark et al., Proc. Natl. Acad Sci USA 82 : 1766 (1985), Clark and Shu, J. Immunol., 138: 720 (1987)). However, 1F5 does not induce an increase in free cytoplasmic calcium and does not induce proliferation of circulating B cells (Rabinovitch et al., In: Leukocyte Typino III (McMichael, Ed.), 435, Oxford University Press (1987)). . Other anti-CD20 mAbs, such as B1, have been found to block B cell activation (Tedder et al., J. Immunol. 135: 973 (1985)) and both 1F5 and B1 can inhibit differentiation.

of B cells (Golay et al., J. Immunol., 135: 3795 (1985)). It has recently been suggested that phosphorylation and internalization of CD20 may be steps necessary for the entry of B cells into the

Gi of the cell cycle (Valentine, Ed.) # In: Leukocyte Tvpincr III p.440, Oxford University Press (1987)). In the present example, two CD20 cDNA clones were isolated and expressed using the methods of the present invention.

Preparation of the cDNA library and recovery of cDNA clones by " panninq'1

Poly (A) + RNA was prepared from the Burkitt Daudi human cell line by oligo (dT) cellulose chromatography of total RNA isolated by the procedures described herein. The cDNA preparation and the expression library construct were performed as described.

The anti-CD20 antibodies 1F5, 2H7, B1, L27, G28-2, 93-1B3, B-Cl and NU-B2 were purchased from the International Leukocyte Typing Workshop (Valentine et al., In Leukocyte Tvpinq III (McMichael, Ed. ), p440, Oxford University Press (1987)). Purified mAbs were used in a 1: 1000 dilution. We made " panning " according to the present method. In the first round of screening, eight 10 cm plates of 50% confluent COS cells were transfected by the DEAE-Dextran method. Cycles of subsequent scans were performed by spheroplast fusion.

Immunoprecipitation. Seauenciacão. Hibernation of RNA and DNA Transfers

CESS and Daudi B cell lines were metabolically labeled with 35 S-methionine and 35-cysteine for 6 hours at 89

37øC. COS cells transfected by the DEAE-Dextran method were similarly labeled 36 hours postinfection. The labeled cells were incubated with the mAb B1 (Coulter) at 4øC for 1 hour, washed in PBS and lysed with 0.5% NP-40, 0.1% SDS, 0.05% deoxycholate and 1 mM PMSF in PBS. After centrifugation (13000xg, 5 min), the lysate was incubated with S ♦ aureus cells (Calbiochem) for 1 hour at 4 ° C. S. aureus cells were seeded, washed 5 times with 1% NP-40 / PBS, eluted and electrophoresed through 12.5% polyacrylamide gels.

Analysis of DNA and RNA blots and the preparation of hybridization probes were performed as described. Sequencing was done by the method of Sanger et al., Proc. Natl. Acad. Know. USA 74: 5463 (1977)). The nucleotide sequence of the CD20.4 cDNA is shown in Figure 10.

Two cDNA clones carrying 1.5 (CD20.4) and 1.0 Kb (CD20.6) inserts were isolated from a Daudi cell DNA library by " panning " with a panel of mAbs against CD20. COS cells transfected with any of the clones reacted with all members of the apinel of antibodies. Immunoprecipitation of cDNA encoded protein from transfected COS cells showed two 32 and 30 Kd bands reminiscent of the 37 and 35 Kd bands observed in different sub-series and B cell lines (Valentine et al. &Quot; Structure and Function of the B Cell Specific 35-37 KDa CD20 Protein " In: Leukocyte Tvpinq III (McMichael, Ed.), P440, Oxford University Press (1987)). It has been observed by the present inventors that the molecular weights of the surface antigens expressed on COS cells are consistently smaller than their native counterparts. This may be due to differences in glycosylation. 90

Both cDNA clones have the same coding sequence and differ only in the 3 / untranslated region. The insert in clone CD20.6 has a small poly A tail and lacks a consensus polyadenylation signal, whereas the insert in CD20.4 lacks a polyA tail and extends 431 bp beyond the 3 'end in CD20. 6 (Fig. 10A).

Analysis of RNA transfers showed that three transcripts of 3.8, 3.0 and 1.5 Kb were present in B cells but absent from other cell types, according to the known pattern of antibody reactivity (Clark et al. Proc. Natl Acad Sci USA 82: 1766 (1985), Clark et al., J. Immunol., 138: 720 (1987), Tedder et al., J. Immunol 135: 973 (1985); Golay et al., J. Immunol 135: 3795 (1985)). It seems likely that the CD20.6 clone is derived from the 1.5 Kb transcript or possibly from an even smaller, even undetectable, species. Because clone CD20.4 does not have a poly (A) + tail, we can not currently infer its source.

DNA blot analysis showed that the CD20 genomic sequences are not rearranged during development and are not amplified in the observed cell lines. A restriction fragment length polymorphism was observed in a DNA sample obtained from placenta. The amino acid sequence predicted by the cDNA contains 297 residues and has a molecular weight of 33097 daltons. The sequence contains three major hydrophobic segments involving residues 51-103, 117-141 and 183-203 (Fig. 10). Two other notable features are the absence of an amino-terminal signal peptide and the presence of a highly charged carbonyl terminal domain. An anti-CD20 polyclonal antibody that recognized the last carboxyl end residues reacts with lysates from cells expressing CD20 but not with intact cells, suggesting that the carbonyl exteemo of CD20 is located within the cytoplasm. Since there is no amino-terminal signal peptide, it is likely that the amine end is also intracellular and that the first hydrophobic region acts as an inner membrane insertion signal (Zerial et al., EMBO J .: 5: 1543 (1986 )). The first hydrophobic region is composed of 53 residues is therefore long enough to cross the membrane twice if organized as an alpha helix. Because there are two remaining hydrophobic regions, the intracellular location of the carbonyl end requires the first hydrophobic domain to exit the membrane laterally. Alternatively, the carbonyl end antibody can recognize only epitopes exposed by the detergent treatment allowing the carbonyl end to be extra-cellular and forcing the first hydrophobic domain to exit the membrane on the extracellular side. The sequence contains 2 potential N-glycosylation sites (Asn-Xaa-Ser / Thr, where Xaa can not be Pro (Bause, Biochem, J. 209: 331 (1983)) at positions 293, but it is not expected that any one of these is used if located in the intracellular domain of the molecule.The difference in molecular weight between CD20 expressed in COS cells and in B cells is probably due to O-linked glycosylation, although other forms of post-translational modification are not excluded. If the carbonyl end is intracellular, the only extracellular domain would lie between residues 142 and 182. This region is rich in serine and threonine residues that must support N-linked glycosylation. The observation of two species of proteins in COS cells can not be explained by the formation of " splicing " alternating since the cDNA sequence does not contain any promising donor or splicing signals (Shapiro et al., Nucl. Acids Res.15: 7155 (1987)). A difference in the selection of the glycosylation site or in the alternate translational initiation site may

to give rise to the two species observed. The initiation of the first and second ATG gives molecular peaks of 33.1 and 30.8 Kd respectively for the proteins, according to the sizes observed in COS cells. Neither ATG is embedded in the consensus sequence proposed by Kozak fNucl. Acids Res. 12: 857 (1984)). The use of alternate starter sites has been described for various proteins (Kozak, Nucl. Acids Res. 12: 857 (1984)).

Comparison of the peptidic sequence with the sequences of the National Biomedical Research Foundation database did not show significant homology by the FASTP sequence fast alignment algorithm. Because the bulk of the protein appears star-bound to the inside of the membrane and the cell, it seems plausible that it may play a role in transducing signals from other transmembrane proteins into the cellular interior. Consistent with this role is the relatively hydrophilic nature of the hydrophobic regions which must allow for the interactions of the hydrogen bonds with the transmembrane fractions of other proteins.

Example VII Isolation and Molecular Cloning of ICAM. an

LFA-1 Adhesion Ligand

Antigen-specific cell contacts in the immune system are strengthened by non-specific antigen interactions mediated in part by antigens associated with lymphocyte or LFA functions (Springer, TA, et al., Annu Rev. Immunol, 5: 175-194 (1987) )). LFA antigen, a major T cell receptor, B cell and granulocyte (Rothlein, R., et al., Exp. Med, 163: 1132-1149 (1987)) is involved in the formation of cytolytic conjugates, For antibodies to K cells and granulocytes and interactions with helper T cells. LFA-1 was placed in the receptor family of 93

cell surface due to the high similarity of Sequences between LFA-1 and the beta chains of the integrin / Kishimoto, T.K., et al., Cell 48: 681-690 (1987); Hynes, R.O. Cell 48: 549-554 (1987)). The adhesion ligands of the integrin family are glycoproteins carrying the Arg-Gly-Asp (RGD) sequence motif, eg, fibronectin, fibrinogen, vitronectin and von Willebrand factor (Ruoslahti, E., et al., Cell 44, 517 -518 (1987)). )

In this Example, the Intercellular Adhesion Molecule-1 (ICAM-1), a ligand for LFA-1 (Rothlein, R., et al., J. Immunol 137: 1270-1275 (1986); Dustin, ML, et al. al. J. Immunol., 137: 245-254 (1986)), has been cloned according to the methods of the present invention. ICAM does not contain RGD motifs and is instead homologous to the NCAM neural cell adhesion molecule (Cunningham, BA, et al., Science 236: 799-806 (1987); Barthels, D., et al., EMBO J. : 907-914 (1987)). COS cells transfected with the ICAM cDNA clone bind to myeloid cells by a specific interaction that can be blocked by monoclonal antibodies directed against LFA-1 or ICAM-1.

A cDNA library was constructed using RNA prepared from HL60 cells induced with phorbol myristate acetate (PMA). The library was used to transfect COS cells and cells expressing surface antigens were recovered according to the methods of the present invention by " panning " with the anti-ICAM 8F5 and 84H10 monoclonal antibodies (mAbs) (McMitchael, A.J., et al., Leukocyte Tetting III, White Cell Differentiation Anticrens, Oxford University Press (1987)). Episomal DNA was recovered from the cells " panned " and the expression cycle " panning " repeated 2 more times to obtain a cDNA clone designated pICAM-1. 94

COS cells transfected with pICAM-1 gave surface immunofluorescence reactions with three anti-ICAM-1: 8F5 antibodies; 84H10; and RR-1. Immunoprecipitation of COS cells transfected with pICAM-1 with mAb 84H10 gave a 100 Kd molecular weight band. 30). A slightly larger protein of 110 Kd was precipitated from HL60 cells induced for 48 hours with phorbol myristate (PMA), interferon gamma (gamalFN), tumor necrosis factor (TNF), or interleukin-1 beta (IL- 1 beta), but was absent from uninduced cells. The smaller molecular weight of ICAM-1 expressed in COS cells is consistent with the lower molecular weights observed for other surface antigens expressed on COS cells.

Analysis of RNA blots showed two 3.2 Kb and 1.9 Kb species present in HeLa cells stimulated with PMA, IFN gamma, TNF or IL-1 gamma, but absent in non-induced cells. Thus, ICAM-1 expression is regulated by a number of cytokines, apparently at the level of transcription. Similar species are present in B cells (JY and Raji), T cells (Peer and T blasts) and Lymphokine Activated Killer (LAK) cells. The structure of these ICAM-1 transcripts and their relationship to the ICAM-1 cDNA remains to be established. Hybridization of placental derived genomic DNA blots revealed a pattern consistent with a single copy gene.

To investigate whether pICAM-1 encodes a functional deoxygenation molecule, COS cells expressing ICAM-1 were tested for their ability to bind to HL60 cells. After 30 minutes at 37øC in the presence of Mg 2+, HL60 cells strongly adhered to the COS cells expressing ICAM, but not to transfected control cells. The specificity of this adhesion was demonstrated by preincubation of the ICAM-1 expressed COS cells with mAb 84H10. All binding of HL60 was abolished under these conditions. A monoclonal antibody of the same isotype, W6 / 32, which recognizes an HLA-ABC related monomorphic determinant of approximately equal abundance of ICAM-1 in transfected COS cells, had no effect on adhesion. Similarly, preincubation of the HL60 cells with 84H10 or W6 / 32 does not inhibit binding.

To determine if LFA-1 was acting as the receptor for ICAM-1 in this system, HL60 cells were pretreated with antibodies against the LFA-1 beta chain (CD18 (McMichael, AJ et al., Eds. Leukocvte Tvpinq III, White Cell Differentiation Antigens, Oxford University Press (1987)) and then subjected to the binding assay, all adhesion to COS cells expressing ICAM was blocked. The sequence of the CDNA insert of pICAM-1 consists of 1846 nucleotides (Figure 11). Figure 9 shows the sequence of the pUCAM-1 CDNA insert. The predicted peptide sequence of 532 residues has the typical characteristics of a transmembrane protein including a putative signal sequence, which can be cleaved between glycine-25 and asparagine-26 (von Heijne, G. Nucl. Acids Res. 14: 4683-4690 1986)) and a single 25 residue domain and crosses the membrane terminating in a highly charged short cytoplasmic domain. The extracellular domain contains seven potential N-linked glycosylation sites which may adequately explain the size difference between the deglycosylated precursor (55 Kd) and the final product (90-115 Kd) (Dustin, ML, et al., J. Immunol. 137: 245-254 (1986)). The differential use of these putative glycosylation sites may also explain the heterogeneous molecular weight of ICAM-1 observed in 96

different cell types (Dustin, M-L., et al., J. Immunol. 137: 245-254 (1986)). LFA-1 is a member of the integrin family of cellular receptors (Kishimoto, T.K., et al., Cell 48: 681-690 (1987); Hynes, R.O., Cell 48: 549-554 (1987)). The tripeptide motif

Arg-Gly-Asp (RGD) is a common feature of the ligands of this family, eg, fibronectin, fibrinogen, vitronectin and von Willebrand factor and is crucial for receptor-ligand interaction (Ruoslahti, E, et al .. Cell 44: 517-518 (1987)). At the

However, ICAM-1 does not contain RGD motifs, having instead a single RGE sequence at position 152. A search in the database of the National Bioedical Research Foundation (Dayhoff, MO, et al., Methods Enzol., 91: 524-545 (1983)) (NBRF) revealed no significant similarities with other proteins. However, a comparison with a laboratory database containing recently published surface proteins revealed a striking and significant similarity between ICAM-1 and the NCAM-1 neural cell adhesion molecule (Cunningham, BA, et al., Science 236: 799-806 (1987); Barthels, D., et al., EMBO J. 6: 907-914 (1987)). The optimal alignment evaluation obtained using the NBRF program ALIGN has 8 standard deviations above the mean obtained from 500 random permutations of the sequences. The probability of a spontaneous occurrence of an equal or greater evaluation is approximately 10%.

Using a database of known immunoglobulin-related sequences it has been shown that ICAM-1 can be divided into five Ig domains (28-112, 115-206, 217-310, 312-391 and 399-477) each of which significant similarity with other members of the Ig superfamily (Williams, AF, Immunol. Today 8: 298-3-3 (1987)). For example, domain I is similar to CD3 whereas domains IV and V are similar to domains of myelin-associated glycoprotein (Arguint, M., et al. Mol. Cell Biol. 7: 3221-3232 (1987)). All five Ig domains of NCAM align with Ig segments in ICAM and the major contribution to similarity comes from domain II and III of ICAM. Finally, the T cell-specific adhesion molecule CD2 shows orally the same similarity to NCAM as ICAM, but ICAM and CD2 are only poorly related. Thus, some precursor to NCAM is prior to ICAM and CD2. The ability of a functional ICAM-1 cDNA will allow for a better approach to the ICAM-1 / LFA-1 mediated adhesion role in antigen-specific leukocyte function, including T cell-mediated killing, helper T responses, and dependent cells.

Isolation and Molecular Cloning of

CD19 antigens. CD20. CDw32a. CDw32b and CD40 The rapid immuno-selective cloning method of the present invention was applied to isolate and clone the CD19, CD20, CDw32b and CD40 antigens. The CD19 nucleotide sequence is shown in Figure 12. The nucleotide sequence of CD20 is shown in Figure 13. The nucleotide sequence of CDw32a is shown in Figure 15. The nucleotide sequence of CDw32b is shown in Figure 16. The sequence nucleotide of CD40 is shown in Figure 17.

Example IX Cloning. Sequence and Expression of CD36

To isolate a cDNA clone encoding CD36, a human placenta cDNA (Simmons and Seed (1988) Nature 333: 568-570) was transferred to COS cells using DEAE-Dextran as a facilitator (Example I, supra). 48 hours post-transfection at 98

cells were detached from the trypsin-free plates incubated with the anti-CD36 5F1 monoclonal antibodies (Bernstein et al. (1982) J. Immunol 128: 876-881) (Andrews et al. (1984) J. Immunol. 128: 398 -404) were " panned " on plates coated with goat anti-mouse immunoglobulin antibodies. The non-adherent cells were removed by gentle washing, the adherent cells were lysed and the episomal plasmids recovered from the cells were purified and used to transform E. coli. After two similar cycles of enrichment after fusion of spheroplasts, plasmid DNAs recovered from 11 out of 12 randomly chosen colonies direct the appearance of CD36 determinants on transfected COS cells.

Two of the clones were chosen at random for further analysis. Both carry inserts of about 1.9 Kb and exhibited patterns of identical restriction fragments. COS cells transfected with any of these clones reacted with the monoclonal antibodies 5F1 and F13 and with OKM5 (Ortho, Raritan, NJ). Immunoprecipitation of cells transfected with a set of anti-CD36 antibodies revealed the presence of a 83 rd molecule present in transfected COS cells and C32 emelanoma cells and absent from control COS cells (transfected with CD25). A high molecular weight, possibly dimeric, species CD36 was immunoprecipitated from lysates of transfected COS cells but not from the C32 cell lysate. The nucleotide sequence is shown in Table 1. In Table 1, the nucleotide sequence numbering is shown in the left margin at the beginning of each line. The deduced amino acid sequence is presented as a single letter code below the beginning of each triplet of coding nucleotides, with the initiation methionine indicated by the number 1 above the initiation codon. The potential N-linked glycosylation sites in the derived amino acid sequence are underlined by a dashed line. The putative transmembrane domain is doubly underlined. Although two consensus polyadenylation motifs (AATAAA) are found in the cDNA, there is no poly (A) tail and none of the RNA species observed by hybridization of blots is short enough to match polyadenylation at these sites, assuming transcripts are carriers of the same 5 / close end as observed in the clone. The presumed start codon is not the first ATG found in the clone, but the two above are followed closely by termination codons in the same reading frame. The predicted initiator methionine is followed by a short hydrophobic region similar to a secretory signal sequence for which however a clear identification of the cleavage site can not be made. The recent determination of Table 1, the sequence of 36 amino-terminus amino acids (Tandon et al., J. Biol. Chem. 264: 7570-7575 (1989)) indicates that the mature polypeptide begins at the amino acid residue immediately after the initiator methionine.

100 GAAAAATCCTTCTTAGCCATTTTAAAGATAGCTTTCCAATGATTAGACGAATTGATTCTTTCTGTGACTCATCAGTTCCTTTCCTGTAMATTCATGTCTTGCTGTTGATTTGTGAATAA

CD Ο • 1 • • ο • υ • ο • Η * * &lt; Ι Η * &lt; μ- Ο Q Ο &gt; &lt; Μ Η> · < Μ Η U < Η Ο U - < U - &lt; ί1- ι ο α &gt; ι ο Ο ο - < &lt; ΙΟ--Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η---- ο: - &lt; Ζ Η ο Ι- Ο • &lt; (Ι Ι Ι Ι Ι Ι Ι O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O U Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι - <-> <-> <- <<<- <<- <<<- <<- <<-> <-> </ Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η <

Η • &lt; &lt; U &lt; υ ο - < h- < &Lt; U &lt; U &gt; Ο Ο < γ - J J • Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο - ο < - &lt; Η - U. &lt; Η < C3 * &lt; ο - &lt; C3 Ο Η υα L_ V- Ρ Ρ - Ο - < Μ ο &gt; α &gt; t U ο - < Η. Η- ο Μ υ ο • Ο &gt; Ι • ρ * · 3 ° = &lt; Ο -C &lt; ο ο - &lt; &lt; χ μ-> - < ο -C Ο υ ο - < U θ "ο < μ < &gt; - λ Ι Ρ - Λ Ο Ρ * &lt; ο Ρ α. Η-> Μ ri Η ri 04 'Τ <G G0 ri (Ν CO Τ

Η- • μ • • υ Ο J Ο -J ο < C5 α - * Ο - < -U. U X &lt; 5 ο * &lt; Β Β Β Β Β Β Β Β Β Β Β 3α &lt; 3 UJ 1- U. &lt; Ο 5 £ - <U} GT · < Μ 1 = ί υ ο <lt; Η £ -j υ • Ρ * Ο < U Ο μ *> - ο ο ο U Η - μ - U ο &gt; Ρ LL < μ - - U 3 ο υ α. α ο d ui · < μ-μ * ο • KJ • &lt; 5 &quot; μ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ <

I ιι υ ιι Η I! Ρ Η < II μ-II &lt; II Η 11 &lt; II I-II - &lt; II Ο II KJ II ο II ο II -C II | -II Ρ II < II Η II &lt; II ο II &lt; II Η II Ρ II ο II - < II - &lt; II ο II &lt; II ο II &lt; 11 &lt; II · &lt; II U II I-II-II II II II II II II: U! Ε ο t &lt; Ο • ο - &lt; ο Η ο t KJ < • ο I- 3 - ί &lt; - &lt; ο Η - < &lt; - &lt; ο - &lt; ο • ο ο ΙΟ £ - μ-ο < It is unclear whether the only Arg residue preceding the hydrophobic region will be sufficient to allow membrane amino-terminal anchoring. The resulting polypeptide has 471 residues with a predicted molecular weight of approximately 53 Kd. The resulting polypeptide has 471 residues with a predicted molecular weight of approximately 53 Kd. The proposed extracellular domain is followed by 27 predominantly hydrophobic amino acid residues in a transmembrane domain and 6 residues (3 of which are basic) corresponding to an attenuated intracellular domain. The presence of 10 potential N-linked glycosylation sites appears to be sufficient to justify the discrepancy in molecular weight between the predicted polypeptide and the 83 Kd species found by immunoprecipitation. No significant homology was found after comparing the entire sequence with several known protein databases. However, some internal structure is apparent. All cysteine residues in the extracellular domain are confined to a domain defined by residues 937 to 1209 of the nucleotide sequence. Taking the cysteine situation as a guide, the extracellular domain may be divided into three segments in which two domains without cysteine precede and follow the cysteine-rich segment. However, sequence comparisons with these segments do not show any significant relationship with other molecules in the existing databases, nor in particular with thrombospondin. CD36 protein was purified by immunoprecipitation. Since the rapid cloning method with immuno-selection depended on the expression of transfected COS cells it follows that the same cell lines from which CD36 cDNA was cloned would also be used as the source of the expressed protein. C32 melanoma cells, CD36 transfected COS cells, and CD25 transfected COS cells (control) were 102

surface labeled with Na125I and lysed in a phosphate buffered saline solution containing 1 mM phenylmethylsulfonyl fluoride, 0.5% NP40 and 0.1% sodium dodecylsulfate. Anti-CD36 monoclonal antibodies were added and allowed to adsorb to the lysate for 12 hours at 4Â ° C, after which beads coated with mouse anti-mouse immunoglobulin (Cappel) antibodies were mixed, mixed for two hours and washed as described (Clark and Einfeld J. Immunol., 135: 155-1667 (1986)). Higher amounts of protein may also be obtained in purified form from a lysate of COS cells transfected by immunoaffinity column purification. Other antibodies against CD36 may be obtained using the CD36 protein, expressed and / or purified as described, as an immunogen. CD36 has been identified as a binding site for cytoadherence of erythrocytes parasitized with Plasmodium falciarum. by the present inventors and by Ockenhouse, C.D. et al. (1989) Science 243: 1469-1741. Cyto-adhesion of parasitized erythrocytes was observed to be blocked by monoclonal antibodies against CD36. Incubation of infected erythrocytes with COS cells transfected with a CD36 cDNA showed pronounced cyto-adhesion. The ability of erythrocytes parasitized with P. falciparum to escape their elimination into the spleen through adherence to peripheral vascular surfaces is believed to play an important role in the pathogenicity of Falciarum malaria and contribute to the lethal syndrome of cerebral malaria causing occlusion of small vessels in the brain. Therefore, the cDNA and purified protein of the invention are useful to provide sufficient purified CD36 to make therapeutic monoclonal antibodies. 103

Example X Isolation and Cloneaem of Three Clones of cDNA

Macrophage Specific FcRI Encoders

Three independent cDNA clones (designated pl35, p90 and p98 / X2) coding for human Fel were isolated by the rapid immunostaining cloning method of the present invention from a cDNA library expressed on COS cells. (See also Allen, J. M. and Seed B.f. Science 243, 378-381 (1989)). The cDNA library was constructed from polyadenylated RNA obtained from single patient cells to be subjected to extracorporeal interleukin induction therapy. Expression of the three cDNAs in COS cells gave rise to IgG binding of the appropriate affinity and subtype specificity. DNA sequence analysis revealed that cDNAs encode similar type I integral membrane proteins with 3 extracellular immunoglobulin domains. The intracellular domain of p98 / X2 differs from that of the other two cDNAs. A composite sequence of the three cDNAs is shown in Table 2 with the nucleotide differences of the p89 / X2 or p90 clones shown respectively below or above the p35 sequence. 104 Ο &lt; u &lt; μ.

&lt;

Painting

ο ο < μ- ο ο U μ ο · &lt; • &lt; μ- • &lt; X U ο < μ Ο Ο Οο J ο μ μ ο ο &gt; μ u < ο < - ο Ο Cf * "3 ο ο * C7 ο ο < • Η © ο ο cr μ - - < &lt; ο ο ο * <μ μ μ- υ σ> »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» U U U U U U U U U U. U ο μ μ Csi μ UJ Ο _ &gt; ο μ μ < χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ ο ο μ «C μ-j Ο U) Ο μ μ Ο μ- u. μ ο σ ο • ο * μ &gt; οχ ο ο μ 4 μ μ ο ο < ο < &lt; μ »ο < I <&lt; μ 1 ο * Ο &gt; I &lt; Ο • ο Ο ι σ <μ ι μ < ι μ * &lt; I ο Ο U) ο ο 1 < C 1 ο <3 Ui I ο · * < 1 &lt; &lt; I XJ ο cr ο ο μ 4 μ μ. t Ο ο »ο μ O-J © < ο σ 06 μ Ο < ν &gt; u tc ο ο Ο C? «&Lt; ο μ V &gt; Ο < W &gt; - * &lt; Ο < OOUJ «μ © Ο Ο μ © < «Λ Ο < • Οά μ · - < eur-lex.europa.eu eur-lex.europa.eu

&lt; • OCC

© ο &lt; © • ο &lt; &lt; ο μ υ &gt; &lt; © <μU 'υ ο < ο < oui ο © &lt; * υ cr ο UJ ο ο μ ο &gt; μ * &lt; * <χ ο «< &lt; . V ο Ο < &lt; * © Ο μ »<ζ ο · < υϊ μ ο <(Λ · <

J - &lt; ο ui < ι - &lt; I V &gt; &lt; A compound according to claim 1, wherein the compound of formula (I) I Ο I I ο u ο * < μ υ V • μ • ο. - &lt; 19 * &lt; μ * &lt; 0C <χ ο < Ο μ Ο Ο Ο Ο Ο Ο Ο Ο &lt; «<ΧΛ μ ΙΛ Ο U ο μ ο < ο ^ μ &gt; μ μ μ &gt; &lt; χ < υ ο ο ο ο μ ο ο 0. * ΧΛ · ο &gt; ομ &gt; μ Ο ο ου Ο Ο < U) &lt; ο α. (I.e. ο ατ οχ ο Ο ο ο < Ο μ μ ο cr < μ uj μ u. ο ο < μ μ ο μ μ μ μ μ μ μ μ μ μ μ μ. μ U • -C · ο Ο ο μ < ► -! / &Gt; &lt; &lt; μ ο _Ι < * and Ο ο Ο μ μ < ϋ μ < μ O Ur μ μ μ μ ο μ ο ο μ ο Ο Ο Ο &gt; &lt; μ ο ο ο < &lt; ν &gt; &lt; &lt;

- &lt; X υ ο ο σ • μ ν »u ο μ-Ο HW ο ο Ο <μ < ορ - <χ - < ο < μ OUJ UJ © - <lt; -τ- <μ < b-i ο J μ-j OJ ο ο μ μ ο < μ -1 ο ο μ &gt; ι Ο • μ • υ X ο μ x * and μ »HU. · &Lt; ο μ ο < μ < μ OÚ OJ < &lt; ο < &lt; μ UUJ oui σ &gt; μ < μ • σ • ο X μα <ee ΟΧ ο < μ 19 ο μ <w <κ μα »ο μ <μ Ο ο OJ ©« &lt; μ * ο μ ο ο ο μ · <μο <μ · ο> ο ο < μ μ ο μ Ο Ο &gt; ο J υα. ο < μ μ μ ο UJ * <μ - <μ μ < · &Lt; &lt; · &Lt; ο <ζ υ ατ Ο 0 • • ο • ο · < ο < μ ο ο μ &gt; μ-) ο < &lt; 9 &lt; &lt; - &lt; OUJ ou) ο ο ο ο ο μ ο μ ο μ OJ Λ Λ Λ Λ Λ • • • • • • • • • ο ο ο ο ο ο ο &lt; 9 μ ο Ο μ Oft. <μ UJ ο Ο ο ο < μ μ w &lt; χ σ &gt; · &Lt; &lt; 9 ο Ο &lt; &lt; μ • &lt; 0C • u cr © ο μ μ α μ © &gt; οα UJ μ < Ο ο <9 μ ιλ οχ Ο UI < Ο Ο ο μ μ ο < Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο ο - &lt; (<X «<μ ouli ο <3 μ. μ <ο ο_) υο. Ο ο ο μ ο ο Ο &gt; - &lt; ν &gt; V) - &lt; ο ο> ο »ο • ο οα. OR ο X ο ο ο μ μ < Ο < · &Lt; X &lt; X &lt; ο μ ο < μ ο α. μ μ ο μ μ μ μ μ μ μ μ μ μμ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ ο μ μ &lt; ο μ μ ο < UJ μ χλ &lt; Χ Ο Ο - &lt; &lt; μ ο Ο UJ μ u. υο < ο μ < &lt; «C < * μ μ Ο ο Ο μ ο μ μ < XJ &gt; O OUJ μ μ Ο «C U < ο < μ ο ατ < μ ο ο ο μ μο ο ο &gt; μ -J ο - &lt; μ μ μ < Or ο < - &lt; OU) < <ac ο> ο ο μ. 3ΐ ο μ • OJ

· &Gt; - * &lt; © c &lt; * Ο 90 © &lt; &lt; h ο and μ μ * &lt; - &lt; W Ujoor &lt; u μ <7 © Ο O © <ν) <μ © U < O-O &gt; 'KWUCL · &lt; μ μ o u u o < -o-o &lt; © &lt; &lt; &lt; © UJ &gt; or &lt; • or &lt; &lt; u or &lt; OU) μ &lt; 0¾ Ο ο ο μ < «&Lt; · &Lt; OJ < υ &lt; - &lt; Ο ο ο ο ο ο < © «&lt; ο μ «9 Ο o o μ o e» μ-u. μ </> σ> &lt;gt; &gt; &gt; ο ο • ο < οοο ο < - &lt; ο. νσυ ο ο ο μ μ OCLO ο ο < ο • OUU Ο <3 < ο - <χυ ο μ ο ο UOCO ο μ < ο υζ &lt; * &lt; &lt; Ο Ο < &lt; ο ο ο ο ο ο μ »σ · < &lt; &lt;

&lt; C9UIâ "¢ - &lt; © - &lt; 0 · <Χ η μ ο Ο 0C Ο <9 οοο < © &lt; μ OUJU ο μ · < ο ο cr < ο ο μ- - uj < ο ο < &lt; © Cf © &lt; - &lt; · &Lt; «&Lt; • PUIO &lt; &lt; &lt; μ »ο uj ο < ο < μ <&lt; χυ &lt; &lt; &lt; - &lt; ο οτμ ο < &lt; οωμ Ο < - &lt; - &lt; Utf < μ. Ο Ο ο μρ- < * &lt; μ - < &lt; OOUIU &lt; &lt; «« «&Lt; μ w οιι) μ * &lt; ο OUJWO < ο υμ <υ ♦ < ο Ο < &lt; «&Lt; &lt; υ ο ο μ - «&lt; μ υ ο ο < ο · <μ- < - &lt; ο U ο -ς μ- μ- <lt; υ ομ < μ <&lt; ο < u • υμ «< υ ο ο ο · < μ - μ - ο ο • C5 ο - &lt; - &lt; ο ι_ »V Ο μ- ο • υο ο - < u u u u U Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο. &lt; Ο • ο ο ο < ο - ο < &lt; &lt; &lt; &lt; ομ L * Ο μ - - <

105

The dotted line represents ranges and no above or below residues are shown where the sequences are the same. The p90 cDNA has the shorter 5 / untranslated region, 7 additional residues between the polyadenylation motif and the polyA segment, and 2 polymorphisms in the coding region. The p98 / X2 cDNA has the longest untranslated region, 1 polymorphism in the coding sequence, and diverges from the other two cDNAs at residue 1051, making it a complex pattern of upstream sequence repeats. The p98 / X2 clone lacks a polyadenylation site.

The FcRI protein from each of the three clones was purified from respective COS cell lines expressing it by immunoblotting to IgG-agarose. (See Stengelin S. et al., EMB. J. 7: 1053 (1988)). Gel electrophoresis of purified proteins showed a single species of COS p35 and p90 cells, relative molecular weight of 70 Kd. Cells transfected with p98 / X2 expressed a 67 Kd protein. A slightly higher protein of 75 Kd was adsorbed from U937 promonocytes treated with gamma interferon. The smallest molecular weight observed in COS cells is consistent with the reduced weights observed in Table 2 for other surface antigens expressed on COS cells, see e.g., Example IX.

The predicted polypeptide sequences show the typical characteristics of an integral type I membrane protein and include a small hydrophobic signal sequence, a single hydrophobic domain spanning the membrane and a highly charged small cytoplasmic domain (Fig. 4). The extracellular fraction contains six potential N-linked glycosylation sites and six Cys residues distributed among three series of Ig-related C2 domains.

FcRI is a high affinity receptor for the Fc fraction of IgG, usually located on the cell surface of macrophages. The ability to interfere with such binding or to cause its occurrence on other surfaces than macrophages is useful in therapy. For example, an FcRI fusion protein and a receptor ligand will be useful to increase the potency of antibodies in therapy.

Example XI Isolation and Cloneaem of cDNA

T cell TLiSA antigen

A cDNA clone encoding TLiSA was obtained from a human T cell cDNA library transferred to cos cells as described and subject to the rapid immuno-selective cloning method of the invention. A monoclonal ACT-T-SET TLiSAI antibody (T-Cell Sciences Corp., Cambridge, Massachuets) was used to detect transfected COS cells expressing the cloned cDNA by positive indirect immunofluorescence. The positive plasmid contained a 1.7 kb insert. The TLiSA protein was isolated by immunoprecipitation as described supra. Example IX. The protein has a molecular weight of approximately 50 Kd, as measured by gel electrophoresis. The nucleotide sequence of the cDNA was determined by termination of dideoxy chains as described supra. The 1714 residue sequence is shown in Table 3, along with the deduced amino acid sequence presented in a single letter code under the first nucleotide of each coding triplet. The ATG encoding the presumed initiator methionine is followed by a short hydrophobic region consistent with secretory signal sequences, the most likely excision site being 19 residues within the open reading frame. The resulting polypeptide is

not further processed has 317 residues with a predicted molecular weight of about 36 Kd. The proposed extracellular domain is followed by 25 predominantly hydrophobic residues corresponding to the intracellular domain. (Table 3, double underline.) The presence of 9 potential N-linked glycosylation sites (Table 3, single dashed lines) appears sufficient to warrant the discrepancy in molecular weight between the predicted polypeptide and the 50 Kd species found by immunoprecipitation.

I 108

1 GCGGCGAGcfTGCAGrGACCAAGAGGGTGTTGAGGCTAAGAGGCCACGATMACAGGATACGATÀ GTCCTTAACCAACACGCAGATGGGAAGAAGCGTTAGAGCGACCAGCACTCAC ^ -3-1 + 1121 X D * ATCTCAAGAACCAGCCTTTCAAACAGTTTCCAGAGATGGATTATCCTACTTTACTTTTGGCTCTTCTTCATGTATACAGAGCTCTATGTGAAGAGGTGCTTTGGCATACATCAGTTCCCT &gt; W ???????? X 5: &gt; UI ui L) < tc &gt; - &gt; X &lt; _J-I Ι Ο. &gt; or 2 • O • h-tO • < Η 1 • H O • o o O O O 1 u < cd Ç &gt; The Η 1 u o o o δμυ * O &gt; 1 &lt; ) - or &lt; r-t or Η 1 u u < O ! h * o u x H 10 plL < 10 K P o h- o u «&lt; the &lt; μ- &gt; .5 z or &lt; • H • O • ^ * o u < or the d - &lt; or a. μ &gt; &lt; cc the air U or h D o CD or o H - < tO ο σ U U U U U U U U U U U U U U U U U U. &lt; - U. &gt; duj &lt; JX &gt; μ o O Γ0 O • * δ o • u • H o o < -> H tO O> CM ►- O O μ p O «► O O < V- or CD &lt; the n o &gt; P-) OK &lt; h O O h- δ LU Γ · < &lt; &lt; M &lt; M 5z H &gt; O μ P w O O < C, * μ to x * h-L> • • • • • • • • • • • • • • • • • • • • • • • • • • • • < 1 or &lt; to &lt; h-> o o o o Η 1 H. P o < 1 u o u cr 3z 1 < z is the CD o or x - the C3T o) - to t = ^ So * O • h · < • OR • &lt; o o u o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o &lt; H ο σ f-lu o &gt; o o o &gt; The H * o &lt; - Γ * "U H o δΜ ~ 1 o < &lt; w or O < • or • u · < * l · - &lt; 2C &lt; &gt; ocr σ &gt; or 0 1 C3 H · H-X &lt; 3! &lt; The compound of formula (I) 1 l-D O &lt; 2 1 p LL O CL O CL O H O O δ LU O • < to &lt; • or cr H • < M o u l · - u O μ CD &gt; u HW 5 H &lt; M H O &gt; O Ι < or &lt; _ ο u < h- or air or < H tO &lt; H &lt; or &lt; O O μ < &lt; H &lt; 3 &gt; &lt; • The • t &quot; • O * O -, the O o r- -J C Η 1 o &gt; J "^ < to U &lt; 1 o o o - U 1 J o o < M P w * o &gt; &lt; K H? = O P i. o o O O < L &lt; H O O O &lt; Z 1 u Cr O &gt; &lt; X or O < &lt; &lt; * - • μ * * O • o < to P-j &lt; H * or &lt; or the &lt; p O o o o P H * &lt; &lt; Η V) H * U. O &gt; u cr ox < U O o o O - < &lt; Ι o The CL μ> - ο &gt; - &lt; to J- &lt; t C3 < • • • • • • • • • • • • • • • • • • • • • u cr • Ο 0. • hO O O o o o o o o o cd &gt; &lt; x h * = Η ^ &lt; z μ o Ο o σ &gt; cd &lt; or L &gt; or Η H U 1 O LU < H &lt; Η < co &lt; μ < ο or < O o Η ί O LU O < or a &lt; 2 ο &gt; • &lt; • H • or • Ο * < l · - < &lt; &lt; H- &lt; / RTI &gt; the cr u cr < M μ U &lt; Η o O or V < * H CO O X O £ L V CL o cr O O O Ο < h- - &lt; - &lt; &lt; or &lt; 2 &gt; - &gt; X U O H • r κ < • &lt; • o • O fO ο • o < Z &lt; cc < b ~ rthU • O X O < U + Η or 1- * &lt; h- < O O LU * &lt; M h- &gt; &lt; h-P x L &gt; L &gt; o o O ~. ί &lt; The &lt; &Gt; O- μ μ or H * &lt; 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ο or < The I &lt; h- 1 f- - the air ≤ 5 1 - E P ο < - &lt; &lt; 10 &lt; μ < the H-O o o o CD H * to < H &lt; or O • • • P • < • The &lt; h &quot; ο p μ · &lt; M &lt; 10 &lt; P r u o < The H-H or the CD &lt; w μ. 1- CD h o o P CD Pu. o o X 5 o < p or 1 H-) - μ P t. • or • &lt; • r- J o < to · &lt; or - &lt; 3 o - &lt; tj o o · &lt; X h * d § < t p, &lt; or &lt; / RTI &gt; t &lt; μ d &lt; -? 3x H * &lt; f .5 h d • the CD - o P CD o> &lt; z or P &lt; &lt; u &lt; o O o o 5 < u &lt; 1 · U X μ - μ μ or < P P - &lt; o o P o < d o o o < the &gt; μ < * or * &lt; • d o < d μ o o <x P d H o ί < &lt; or - &lt; ο or O < ) or 1 &lt; d μ tz. 1 or μ <H < X μ < H ! w or μ p e · - < • or »&lt; r · X 1 OD or x P ο O 1 o < or μ h-1 or d < &lt; U u 1 1-¾ < X μ μ o o o o CD o o o < r- &lt; K-h-tO O X μ Ο h * o h - < &lt; * &lt; &lt; • The UJ. μ. to • &lt; • μ 5 &lt; or μ ο ocr u <- - tu. P o < · &Lt; u P o o < &lt; p or < &lt; &lt; z P x &lt; H μ CD H- < or &lt; &lt; i- or μ · &lt; o the U-J O X o < or • CD- or &lt; &lt; &lt; Ο < 1- or H &gt; - &lt; &lt; &lt; O o μ o - &lt; or - &lt; &lt; ^ &lt; X &lt; z or μ ί < or &lt; &lt; ο o μ Η o o < X &gt; or Ρ or & < Ρ · &lt; • &lt; • or • the UJ CD Ui> - or the < P μ μ o or P P ο o < ^ X &lt; M P < or H · ί-CD < P μ Ο &gt; &lt; X o o P ο ί < CD μ μ ο or < &lt; ο <H - <x • CD UJ • < · «&Lt; or the &lt; the CD p o d o μ P &lt; X &lt; X μ ο · &lt; &lt; &lt; &lt; ο o o o μ &lt; &lt; X &lt; X &lt; H p &lt; or the P &lt; H &lt; &lt; or &lt; &lt; 2 <z or a μ CD or • p - H · • < • &lt; ί P &lt; d Ο ο &gt; O -J 1 o the CD μ o O 1 μ μ h * j μ * Ρ PlL p x i < 2 o CD o P i o CD μ o 1 o μ ο < ) - &lt; M Jotto &lt; - &lt; &lt; O 1 &lt; or &lt; &lt; • The LU o &gt; 1 o cr o < u P 1 i- < μ • K i- 1 < μ <&lt; z &lt; ) H 1 &lt; z CD -Ο &lt; O 1 μ μ &gt; -1 or &lt; μ o ui < w 1 &lt; h-μ Ρ < -4 * P -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4.

&lt; u u I-5 o O ί ο < or &lt; u or μ

O o cd μ u < &lt; • o u o o o μ < μ • o $ t

t

16β1 GTGTTGGCAAGATGGCTGCCAACTCTTGGCAATTCATACATCCTTGTTTCTGTCTGGTAGAGAGTTTGCTTCTCAAATGGAGCAAACAAATTTGATTATTTTTTCATTCTTAAATAGGCA TLiSA is involved in mediating IL-2-induced T cell differentiation to cytolytic forms. Antibodies against TLiSA are useful for preventing IL-2 stimulated T cell differentiation and for modulating the adverse effects of IL-2 on therapy.

Example XII Isolation and Clone Molecular of cDNA

B-lymphocyte specific CD22 Antigen encoder

To isolate the CD22 cDNA, an expression library was constructed from the Daudi cell line of Burkitt's lymphoma, introduced into COS cells by the DEAE-Dextra method described supra and subjected to three cycles of &quot; panning &quot;; and re-in-troduction in E. coli as described in Seed and Aruffo, Proc. Natl. Acad. Know. USA 84: 8573-8577 (1987). Of 16 plasmids selected after the third cycle, two were positive for CD22 expression by indirect immunofluorescence in COS cells. Of the five sugar related epitopes, A, B, C, D and E, recognized by the anti-CD22 monoclonal antibodies, only the A and D epitopes were expressed in COS cells. Immunoprecipitation of CD22 from transfected COS cells gave a single band corresponding to a molecular weight of 110 Kd, lower than the 135 Kd species obtained from the Burkitt lymphoma Raji cells. The difference in molecular weight may be related to differences in glycosylation. Since the C22 immunogenic epitopes are sugar related, these differences should justify the absence of B, C and E epitopes. Analysis of KNA blots revealed the presence of a major 3 Kb RNA species and 4 species less 110

abundant of 2.6, 2.3, 2.0 and 1.5 Kb in several B cell lines. RNA encoding CD22 was not found in several T cell lines, including peripheral blood T cells, cell leukemia T Jurkat, the HL60 and U937 myeloid leukemia lines and the HepG2 hepatoma.

Hybridization of placental DNA blots gave a simple pattern consistent with a single copy gene. Analysis of the DNA sequence by the dideoxy method described supra showed that the 2107 bp insert encoded a 647 amino acid polypeptide. Nucleotide and amino acid sequences appear in Table 4.

111

Table eh ρ U u 0 0 0 0 Eh £ 0 Eh Eh CO 0> 4! 0 X 0 3 "3 H 0 Eh 0 W Eh 3 EH X 0 0 0 P 0 0 0 α 3 0 3 Eh 0 Eh 0 Oh 0 3 Eh £ 0 Eh 3 g 0 Eh 0 W u 3 _ Eh X 0 Eh Eh (J 3 Eh 3 X 3 0 0 3 Eh 0> 0 3 3 PS 0 3 <J iJ U 3 0 0 0 0 0 Eh 0 3 x 0 Eh 0 α 0 Eh Eh 0 0 Eh OP 0 Eh 0> 0 3 0> 0 EH 3 H 0 0 3 2 0 0 3 H 0 Eh, 0 3 Ej 0 0 0 Eh 0 O h 5 0 3 PS 0 3 0 CU 0 0 Eh X 3 Eh 0 X EH Eh 0 0 0 3 UP Eh 3 υ P 0 3 3 x 0 0 Eh X 0 3 0 W 0 3 0 X 0 0 W Eh 3 0 O 3 0 O h 5 0 0 0 θ 'EH 0 0 0 0 0 ^ 0 ( ¾ 0 0 0 cu Eh ej * 3 0 0 3 1 0 P 0 3 0 w Eh 0 Eh X 0 0 3 X ÊH 0 | h fu 0 0 0 <5 0 0 3 CO 0 PI s 0 3 Eh CO O 0 EH O o 3 0 X Eh 3 0 Pt 0 υ EH X 0 0 0 Q 0 0 u 0 0 Eh 0 X Eh 0 Eh W o Eh EH X Eh 3 <ps 0 0 0 u5 0 Eh 3 X Eh oo 0 Eh "0> 0 3 Eh Cu o 0 0 P 0 Eh 0 w EH Pi i 3 & H 0 3 0 il Eh 3 O h 5 3 Eh 3 X 0 0 3 X o 3 3 H 0 3 Eh co 0 EJ 0 W 0 0 0 X 0 Eh o iq Eh EH 0 0 0 Eh 0 d Eh 0 EH X Eh Eh 0> 0 3 0 CU 0 3 0> Eh Eh 0 X 0 0 0 Q 0 3 Eh d 0 3 3 co 0 0 3 x 0 Eh 0 X 3 ιϋΐ 0 X 0 0 3 g 0 3 3 x 0 Eh Eh 0 U 3 0 W 1¾ 3 0 u 5 0 O 0 w 0 0 0 X 0 0 3 EH Eh 3 Eh 0 3 3 Eh O Eh 0 u 5 0 EH 0 X 0 3 Eh X 0 0 3 H 3 Eh 0 Eh 3 3 co Eh Eh 0 JO Eh 0 Q 3 0 3 H Eh 3 0 &gt; Eh 3 CO 3 0 or 0 0 0 w 0 0 3 Eh < 0 0 0 EH Eh 0 Pt 0 0 Eh £ EH 3 0 v-5 3 EH 3 3 3 Eh X 3 3 0 &gt; 0 0 0 0 0 0 0 3 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 3 PS 0 0 0 θ 'Eh O 0 3 3 3 Eh £ 0 Eh Eh CO 3 0 3 x 0 U 0 0 3 EH 0 3 Eh W 0 3 3 PS 0 3 3 x 0 0 0 Q 0 0 3 x 0 3 3 Eh 3 0 0 EH 3 0 WO 0 Eh X Eh 3 0 W 3 3 Eh CO 0 3 3 x Eh 3 3 0 0 0 Q 0 0 0 a 3 Eh 3 Eh Eh 3 3 Eh EH 0 Eh X 0 Eh 3 x 0 Eh 0 Eh 0 Eh fu 0 3 3 H CJ 0 -Eh 0 0 3 3 x 0 0 3 -0 0 Q 0 3 U 0 0 3 x 3 0 0 w 3 EH 0 CU 0 0 Eh W 3 HHH (M + H) + (M + H) +

0 Eh, U PS Eh 0 3 H o 0 0 iJ Eh 3 0 3 Eh 3 M 0 Eh 0 X 3 3 0 &gt; 0 Eh 3 H 0 0 3 X 3 0 ^ Eh X 0 0 0 3 0 3 0 PS 0 CJ 0 X 0 0 0 W 0 0 X 3 0 o as 0 0 0 0 0 0 Eh 0 0 3 3 Eh 0 Eh 3 X 0 Eh 3 x 0 0 3 gu O 0 &gt; the EH 0 0 0 0 0 3 0 or Eh h Ex 0 Eh £ 0 0 0 X 0 3 0 X 3 Eh 3 PS 0 0 Q 0 3 3 H 0 3 0 &gt; 3 3 0 W 0 Eh 0 X Eh 0 3 X EH 0 0 &gt; 0 0 3 3 3 3 Eh 0 0 Eh Ui Eh 3 Eh X 3 3 3 co 0 3 Ο θ '0 0 OQ 3 0 a Eh 0 3 Eh 3 0 3 X 0 Eh 0 PS 0 0 3 m 0 3 3 H 0 3 0 PS 3 Eh 0 α 0 α 3 X 0 0 3 H Eh EH 3 Eh 0 0 Eh co 0 EH 0 &gt; 3 0 X 0 0 h5 3 Eh 0 Q 0 Eh 3 Eh 0 0 0 &gt; 0 0 Eh X 0 3 3 EH Eh 0 0 3 0 Eh 0 O * 0 0 M £ Eh 3 Eh J 0 0 3 U i 0 3 0 Q 0 0 3 Eh 0 0 Eh X EH 0 Eh 0 0 0 0 0 0 0 Eh W 0 Eh OX Eh 3 Eh 0 O 0 0 &gt; 0 Eh 0 θ '3 0 3 Eh 0 3 0 &gt; 0 3 3 Eh 0 &lt; w 3 X 0 Eh u c * 0 Ex 3 X Eh 3 0> υ 0 0 &gt; 0 0 3 X EH Eh Eh W EH 3 t 3 W 3 0 J 0 EH 3 X 0 3 3 X 0 0 3 H 0 0 0 a 0 0 3 EH 0 0 Eh Ui 0 Eh 3 CO 0 0 X Eh EH 0 u5 0 Eh <3 X Eh 3 3 H 0 Eh 0> 0 0 3 X 0 0 0 &gt; Eh 0 0 X 0 3 0 3 0 0 0 0 Eh 3 3 X 0 0 0 3 Eh 3 Eh X 0 Eh Eh Uh Eh ¾ 0 X 0 EH 0 &gt; 0 0 X 0 3 0 J Eh 3 0 3 0 3 3 X 0 0 3 g 0 3 3 x Eh Eh 0 X 3 3 0 X 0 0 0 &gt; O 0 0 Eh Eh EH 0 0 0 0 0 0 0 0 &gt; 0 0 Eh W Eh ca 3 ui 0 0 0 0 0 0 3 «0 3 Eh Ui Eh 0 Eh Ui 0 0 3 x EH EH 0 3 0 Eh" Eh £ 0 Eh 0 t-5 0 3 3 g 0 Eh 0 h5 0 0 0 X 3 3 0 -q 0 0 Eh £ Eh 0 0 ot 0 0 Eh Ui 0 Eh 0 CU 3 3 3 Eh 3 O 3 W Eh 0 0 θ '0 0 Eh CO 0 Eh 0 CU 0 Eh 0 X 0 3 0 &gt; 0 Eh 0 &gt; 0 0 0 W 0 0 0 &gt; 3 3 Eh O 0 0 EH W 0 0 0 W 0 0 0 0 0 0 3 EH 0 0 Eh Ui 0 EH 3 Eh 0 3 Eh £ Eh 3 Eh X 0 3 0 W Eh Eh 0 W 0 3 0 Q 0 0 0 i-5 3 3 _ 0 Q 3 0 3 co 0 Eh 3 X Eh 0 Eh £ Eh 0 0 1-5 0 3 0 0 0 3 CJ X 0 Eh, 3 X 3 0 3 x CÍ Eh 0 i-5 0 3 0-3 EH 0 i-5 0 0 0 W 0- 0 Sx 0 3 Eh Ui 3 0 Eh 0 0 0 W 0 0 0 0 EH PHH rH rH r- (rH 3 VO CN O CO O O (D VO CO CO σι H

Table 4 (page 2)

0 U A o Eh 3 0 0 1 0 3 Z 0 u 0 3 0 3 3 3 Eh P O EH, 3 CO 0 3 3 Eh 0 0 &amp; O 0 Q 3 EH 0 a 0 3 0 63 0 0 0 3 0 3 0 0 0 h! 0 0 Eh X 3 0 3 0 OQ Ej 0 3 A EH EH Eh tO O 0 0 0 0 0 3 3 3 CO 0 0 3 H Eh 0 0 3 0 0 0 3 EH X 0 Eh 0 Ph 0 3 EH 0 EH EH 0 0 OM 0 3 0 0 0 3 Z 3 3 0 &gt; 0 EH 3 EH, 0 63 0 0 0 3 0 0 0 Q 3 0- 0 U o EH 3 Eh CO 0 3 0 0 3 3 EH. 3 0 Λ 0 0 3 Z EH EH 0 63 0 0 0 Ol 0 0 U Eh Eh 0 0 0 0 0 0 EH 0 0 0 0 0 0 0> 0 3 0 A 0 3 0 J Eh 0 0 0 H CO 0 0 Ol 0 0 0 CU 0 0 0 A 0 3 0 3 3 Eh 0 0 EH 0 EH 0 3 Eh 0 Eh 0 EH O 63 0 0 0 0 0 EH "Eh CG 3 3 EH 3 3 H EH Eh 3 to 0 0 0 * 3 0 0 J 3 Z EH 0 0 EH" 0 iP 0 EH to 0 «3 0 A 0 0 0 ϋ O d 0 rfj 3 Z 0 0 0 w 3 3 3 3 Et tO 3 0 0 0 0 0 0 0 0 0 X 0 0 0 or 3 Eh 0 0 0 0 II 0 0 0 A 0 0 3 3 Eh 3 0 0 0 1 3 0 A 3 Eh Eh EH OQ 0 d Eh X 0 EH 1 0 0 0 0 Eh Eh J 3 0 0 _. 0 3 0 EH 0 0 to 0 0 3 H 3 0 0 P-1 Èh £ Eh 0 0> 3 3 0 0 0 0 Eh * 0 Eh PH b 0 0 A EH 0 i O σ 3 3 0 3 0 0 Eh 0 3 CO 0 0 0 0 1 0 3 3 Z 3 0 Eh 3. 0 3 0 Eh "3 to 0 1 0 0 63 0 0 3 tO 3 13 Z 0 3 ^ 0 h! 0 Eh ^ 1 3 W EH Eh EH to 0 0 O 3 3 64 0 3 0 &gt; 1 0 0 3 a EH 3 0 EH, 3 z 0 0 3 Z EH 1 3 Eh to 0 3 0 α EH U t-9 0 0 3 tO 0 0 i 0 α 0 3 Eh X EH 0 O υ 0 0 3 0 0 3 1 3 Eh, 0 63 EH 0 3 i &lt;! EH CO 0 3 Eh 0 1 0 0 i-3 0 0 3 Eh 0 u c * 0 3 0 0 0 0 Eh 1 1 3 Eh 0 0 3 Eh Eh 3 u ϋ 0 63 0 0 0 &gt; II 0 0 0 A 0 EH 0 0 0 3 0 3 0 0 3 0, 0 A EH EH 3 H EH 3 to 3 EH 3 Z 0 0 ^ 3 Pi ϋ EH 0> 0 5 3 U 3 to EH 3 0 A &lt; 2 0 EH A 0 Eh 3 3 3 EH 0 3 0 α 0 3 0 3 0 0 Eh A 0 0 w 0 Eh 3 Z o 0 3 Z 0 0 3 3 " 5 '3 ri! 0 &gt; 0 0 3 A 0 0 0 A 0 0 3 3 OO * 3 0 _ Eh 0 0 0 __ 3 A 0 3 0 0 3 3 Z 3 3 Eh £ 0 0 Eh £ 3 EH 0 Q 0 0 or 0 0 CX 0 0 0 0 EH 0 0 EH 0 Eh o 0 0 0 3 Λ Eh £ 0 0 _ 3 A 0 3 3 A 0 oo ^ 5 3 0 0 0 Eh 0 A Eh 0 0 Q 0 0 o Eh 0 Q EH 3 3 H 3 Eh 3 Eh 0 Eh Eh jH ri! H 0 Eh Eh X 0 0 _ 0> 0 0 3 to 3 U 3 0 0 Eh 1¾ 0 0 0 A 0 0 Eh 0 0 0 Eh 0 0 O 0 0 3 Eh 0 3 3 Eh 0 3 Et H, Eh CG 0 0 0 3 0 3 3 Z 0 3 3 W 0 U tJ 0 O Eh £ Eh 3 0 Ol 3 3 0 Q 0 EH O 0 (¾ 0 0 0 W 0 3 EH X 0 3 3 Eh O 3 a 0 O 0 0 0 Eh 3 Z 0 0 0 O * Eh Eh 3 A 0 0 3 Eh 0 0 0 h3 Eh 0 0 A 0 0 Eh 0 3 _ 3 CO 0 0 0 A 0 &quot; 5 3 to 0 Eh 3 0 0 3 ZO Eh CO 0 3 _ 3 Z EH 0 Eh A 0 3 0 0 0 Eh EH X 0 0 3 Z 0 EH 0 A Eh 0 0 EH EH 3 g 0 3 3 to 0 0 3 H EH Eh EH 0 3 0> 0 3 0 X EH EH, 3 A 0 0 3 H 0 0 3 z 0 0 0 K 0 3 0 η! II 0 0 0 A 0 Eh 0 | Φ 0 Eh to 0 3 EH X 0 II EH 0 0 3 3 0 3 EH £ 0 0 0 α 0 0 II 0> Eh 0 0 α 3 EH 3 z 0 Eh Eh CO 0 3 0 0 II Eh 3 3 A or 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Eh Eh 0> 0 0 II Eh A 3 3 Eh A 0 3 0 63 0 0 0> 0 Eh Eh 0 II 0 3 0 O 3 3 0 O 0 0 A 0 3 0> 0 II Eh 0 63 0 0 3 0 0 3 CO 0 0 3 Z 0 EH II Eh A 0 EH EH C0 0 0 Eh If 0 Eh 0 0 0 3 3 W II 0 EH 3 B 0 3 3 0 0 J Eh Eh 3 Eh 3 II 0 3 to 0 0 0 0 Eh Eh X 0 0 0> 0 0 II 3 CO 0 3 3 Eh 0 0 E h 6 «Eh 0 ^ 0 A 0 EH 0 3 II 0 EH 0 63 3 0 0 0 0 3 A 0 0 0 J 0 II 3 3 ^ 3 0 3 0 Eh 3 W 0 3 0 A 0 Eh II 0 α 3 0 3 A 0 0 Eh A 0 _ 0 3 S 0 0 0 κ 3 II 0 0 Eh to 0 - Eh 0 0 0 -3 (¾ 0 3 3 Eh 0 II 0 0 A 0 Eh - b 0 3 0 0 0 0 0 W 0 EH II 0 0 EH 0 3 B 0 0 0 O Eh 0 0 3 0 0 3 H || 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, H is 1 to 3;

The initial methionine is followed by 18 predominantly hydrophobic amino acids resembling a secretory signal sequence. The mature protein having a relative molecular weight of 71.1 Kd consists of an extracellular fraction of 491 residues, followed by a 19-residue membrane spanning domain (duplicate underlining) and an intracellular domain of 118 amino acids. Ten potential N-linked glycosylation sites (NXS / T, X is not equal to P) were found in the predicted extracellular domain, as well as a large number of serine and threonine residues which may be O-linked glycan addition sites abundance of potential glycosylation sites and the difference in weight between the predicted protein skeleton and the product precipitated from COS cells and B cell lines suggests that about 50% of the weight of CD22 is given by sugar. The extracellular portion of CD22 consists of five segments having an organization of immunoglobulin-like domains. The small space between cysteines (63 and 64 residues in domains 1 and 2 and 42 residues in domains 3-5) suggests that they fold in the 7-strand structure into two layers of beta sheets characteristic of the constant regions of the immunoglobulins instead of the structure of 9 chains of the variable regions.

Because CD22 has been found to be a highly homologous myelin-associated glycoprotein (MAG), a neuronal cell surface protein that mediates cell-cell contacts during myelogenesis, it has been postulated that CD22 has a role in B cell adhesion. COS cells transfected with CD22 cDNA were contacted with erythrocytes or peripheral blood mononuclear cells and incubated under conditions that minimize nonspecific interaction. Roset formation with erythrocytes and mononuclear cells with CD22 positive COS cells but not with COS cells transfected with an unrelated cDNA clone was observed.

B cell adhesion studies involving monoclonal antibodies have indicated that different epitopes of CD22 may participate in the adhesion of erythrocytes and monocytes and that different ligands can be recognized in each of the cell types. B-cell adhesion studies also suggest that CD22, analogously to adhesion of CD2, CD4, and CD8 from T cells to target cells, can promote recognition by the B cell antigen receptor by enhancing the contacts with antigens. CD22 has previously been implicated in the transmission of synergism signals to the antigen receptor (Pezutto et al., J. Immunol. 138, 98-103 (1987)) and cross-linking of surface IgM produces an intracellular calcium flux in IgM cells ± CD22 + but not in IgM + CD22 "(Pezzuto et al., J.

Immunol. 140: 1791-1795 (1988)). These results suggest that like the T cell ad- dition molecules, CD22 may also participate in the regulation of signal transduction. The ability to interfere with the binding of CD22 positive cells to accessory cells or the ability to cause such binding on non-lymphocyte surfaces may be useful in diagnosis and therapy. For example, a CD22 fusion protein and a receptor ligand attached to a substrate will be useful in detecting the presence of a particular antigen in body fluids. A soluble form of CD22 may have immunomodulatory activity.

Example XIII

Isolation and Clonaqem Molecular of cDNA CD27 Anticrene Encoder Specific of T lymphocytes

A cDNA clone encoding CD27 was obtained from human T lymphocyte cDNA transfected into COS cells and immunoelected by the method of the present invention. RNA was extracted from mononuclear cells derived from one unit of blood after four days of culture in medium containing 1æg / ml phytohemagglutinin (PHA) using guanidinium thiocyanate. Total RNA was selected relative to poly (A). CDNA was cloned and cloned into CDM8, used to transfect COS cells and the CD27 cDNA was immunoelected with the monoclonal antibodies 0KT18a and CLB-9F4 (supplied as described in Seed and Aruffo Proc Natl. Acad Sci USA 84: 3365-3369 (1987)). The vector contained a 1.2 kb cDNA insert. The nucleotide sequence of the cDNA was determined by dideoxynucleotide chain termination as described, supra. The 1203 residue sequence and the deduced amino acid sequence are shown in Table 5.

&gt;

Table Ο Ε υ ο ri ri Ε Ε ICC ο ri ri ri Ο 0 Α Ό & & & Ε w ri υ U υ υ Ε ω ri Ε- < . υ α ο U ο Ω ο Ε ri ο ri Ε Α ο ο Ο Μ U ο ο 0 0 Η Η Η C C C C C Ο Ο Ο Ο Ο Ο Ο Ο Ε 3 U Ε 0 &gt; ο Ε, ri 0 Ο Ο Ο Ο Ο Ο 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό Ό U Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο & & & & & & & & & & & & &. ο α ri ri Α Α Α Α Α 3 Μ Μ 0 0 0 0 0 0 "" 0 0 0 0 0 Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η 0 U U 0 0 0 Et Et Et Et Et Et Et Et Et Et 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Η Η Η Η Η Η Η. u u U ri ri ri ri ri ri ri ri ri ri ri ri α α α α α α ri ri ri ri ri α ri α ri ri. ri Ο Β ο 0 0 Η ω U ο ri ri ri ri ri Et ri ri Α Α Η Η Η 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο ri ri ri R W 0 &lt; 0 ο ri ο ri 3 Ο Ω ri 0 3 ο 3 Ο U ri 0 0 U 3 α α ri ri ri ri ri ri ri ri 0 0 0 0 0 0 0 0 0 0 0 0 & & & & & & & & & & & & & & &. Ο O ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri Μ Μ Μ Μ Μ Μ Μ Μ Μ Μ Μ Μ Μ Μ Μ Μ Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο II CJ Ε W Ο υ Ο Ο II ο ri ri ri ri Α Α ι ι ι ι Ο Ο Ο α u u u II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ι ri ri Ε II ri Ε ri ri II II II "" "" "" "" Α Α Α Α Α Α Α Α Α Α Α Α Α Α Α 0 0 0 0 0 0 0 0 0 0 Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο &gt; II ri Β ΕΕΕ ΕΜ II II 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 υ Ε II Ο Ο II II Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο "" "" Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Α Β Α Α Α Α Α, 1,,,,, ri 1 U U U U U U U 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 I 0 ri Ο Α ο Ε 1 3 κ ο ri ri Η 1 3 Β ri ri ο Ο 1 Ε ri ο II II & Ε Ο Ο ο ri Α ri ri ri ri ri ri 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ri ri ri ri ri ri ri ri ri ri ri ri ri ri α U U U U U U 0 0 0 0 0 0 0 U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U Α ο U U U Ο Ο Ο 3 3 3 3 3 3 3 3 3 3 3 3 U U U U U U U U U U U U U U U U U U U U U U U U U U U W W W W W W W W W W W WU ο Ε Ο ο ri ri CQ Ο Α Α W W W W W W W W W W ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri Ε Ο ri ri Ο ri Ο ri & ri ri ri ri W W W W W ri ri ri ri ri 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 Ο Ο Ο Ο Ο Α Α Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο C Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ ο Ο Ο ο U Α Ο υ Α U U U U U U U U U U U U U U U U---------------------------------------- Ε ri ri ο 3 Ε Ο ο U ri Ε Ο Ε Ε Ε Ε Ε Ε Ε Ε Ε Ε Ε Ε Ε Ε Ο Ο Ο Ο Ο Ο Ο Ο Ο ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri υ ri ο α α ri ri ri ri ri ri ri ri ri U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U ο ο ri ο ο ri ri 3 3 3 3 3 3 ri ri ri ri ri ri ri Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο ri ri ri ri u u ri ri ri ri ri ri ri ri Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri Ε ο ο ο Ο ri ri ri ri ri U U U U ri ri ri ri ri ri U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri. ο Ο Ε 3 < ο, Ε ri ri Ο ri Ο 3 3 3 3 3 3 U U U U U U U U U U U U U U U U U U U U U U U U Ο ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri ri - ο U ο «- - - Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ν Ν Ν Ν Ν Ν Ν Ν Ν Ν Ν Η Η Η Η Η Η Η Η Η Η Η Η Η Η

The initiating methionine is indicated by the number 1 above the initiation codon. The deduced CD27 polypeptide demonstrates the typical characteristics of an integral tipol membrane protein. It begins with a hydrophobic region of twenty amino acids consistent with a secretory signal sequence. This hydrophobic region is followed by a membrane-bound (double-underlined) hydrophobic domain and a 49 amino acid cytoplasmic domain beginning with a positively charged transfer stop sequence. There is no poly tail (A).

The deduced amino acid sequence of CD27 is highly homologous to the CD40 antigen of B lymphocytes and carcinoma, described supra, along its entire length. CD27 is also highly homologous to the nerve cell growth factor receptor (NGFR) in extracellular and transmembrane domains (Stamenkovic et al., EMBO J. 8: 1403-1410 (1989); Johnson et al., Cell 47: 545-554 (1989)). the most conservative structural motivation of these three proteins is the abundance of cysteines or histidines in the extracellular region. These are often found in pairs separated by two or four intervening amino acid residues similar to the arrangement found in proteins that use this structure to bind a zinc ion. The cysteine-rich region and histidines are followed by a membrane proximal domain rich in serine, threonine and proline which has been suggested to be the region in which O-linked biochemically identified glycans are added to NGFR (Johnson et al. (1986), supra , Grob et al., J. Biol. Chem. 260: 8044-8049 (1985)). Immunoprecipitation of COS cells transfected with anti-CD27 antibodies followed by gel electrophoresis revealed the presence of a 110 Kd species when not reduced and a single 55 Kd band in the presence of reducing agent. This indicates that in the

transfected COS cells, CD27 is a disulfide bonded homodimer comprised of 55Kd monomers similar to forms precipitated from T lymphocytes (Bigler et al., J. Immunol 141: 21-28 (1988); Stockinger et al. Leukocyte Tvpinq II, 51: 513-529 (1986); Van Lier et al., Eur. J. Immunol., 18: 811-816 (1987)).

CD27 is a T lymphocyte activation antigen. Its structure suggests that it may function as a receptor for a lymphokine or growth factor. Recognition of CD27 causes T cell proliferation and increases the expression of certain genes required for helper and effector T cell functions. CD27 expression in T cells increases two to five times with phytohemagglutinin (PHA) stimulation or monoclonal antibodies against CD3 and the addition of at least one monoclonal antibody against CD27 can increase PHA stimulated T cell proliferation (Bigler and Chiorazzi, Leukocyte Tppincf II, Vol 1: 503-512 (1986); Van Lier, (1987) ). CD27 positive T cells have been found to aid B cells for IgM synthesis and to secrete 11-2 when properly stimulated (Van Lier et al., Eur. J. Immunol., 18: 811-816 (1988)). .

The ability to interfere with binding of CD27 to T cells positive with antigen presenting cells or the ability to cause such binding to occur on non-lymphocyte surfaces may be useful in diagnostics and therapy. For example, a Cd27 fusion protein and a ligand of receptors attached to a substrate will be useful in detecting the presence of a particular antigen in the body fluids. A soluble CD27 fusion protein will be useful to prevent undesirable T-cell proliferation, for example, in certain autoimmune diseases. 119

Example XIV Isolation and Cloneaem Molecular of Two

CDNA clones Encoders of Leu8 T-lymphocyte Specific Antigens

Two cDNA clones encoding Leu8 determinants were isolated from a human T cell library by the method of the present invention.

The nucleotide sequence of the cDNA was determined by the termination of dideoxynucleotide chains as described supra. DNA sequence analysis (Table 6) shows that the largest insert contains 2350 residues while the smallest contains no 436 residues inside but is the same in the remainder.

I

Painting

3 w &lt; 3 3 W 0 Eh 3 U 0 a 0 3 3 H υ 3 Eh 0 3 3 a 0 υ a 0 0 0 pq 0 3 3 0 Eh S 0 or 0 W 0 Eh S 0 Eh, 3 Eh 0 0 or 0 3 0 P 3 EH 3 0 3 a Ex 0 0> ϋ O 0 3 1 0 0 0 O H 0 EH Eh X 1 0 0 3 0 3 a &lt; 3 EH Eh 0 O H S 0 3 a 0 &gt; ϋ 3 «0 0 0 W 0 0 3 Eh EH" 0 EH 1 0 0 Q o EH J f £ EH 1 Eh a 0 3 Eh 0 rtj 3 H 0 3 (tf 1¾ W (¾ 0 0 H υ 3 a &lt; E 3 3 Eh 0 3 K o 0 H 0 3 Eh 0 H 0 0 3 to Eh a Eh 0 Eh a e 3 0 U 3 0 3 3 3 EH eh m <3 EH 3 a 3 H EH 3 3 H 0 eh υ U 3 3 w 3 3 υ 3 _ EH X 0 0 3 ao 3 a 0 3 3 0 0 0 0 0 3 3 a 3 3 0 0 0 0 3 a EH eh a υ 3 0 0 or 3 a 3 3 a 3 3 3 Eh, Eh X 3 EH 3 au Eh J EH EH 3 H 0 EH U 0 3 H 0 3 υ 3 3 Eh 0 3 3 ao 0 Q 0 0 3 0 0 0 0 3 0 υ 3 0 _ eh a EH 0 υ a 0 3 Pi o EH 0 a 0 3 0 0 0> 0 3 3 3 Eh 0 3 EH 0 W u υ σ 0 Eh 3 H Eh EH o 3 Eh J 3 0 0 o 0 Q EH 0 0 0 <3 Eh 0 3 0 0 EH 3 U 0 0 Q 3 3 EH 0 3 Eh 3 EH 0 Q υ 3 w 3 U 3 H 3 u 0 0 3 Eh 0 0 EH 3 0 0 0 0 0 0 0 ο α EH 3 Eh a 0 EH Eh 3 Eh X 0 0 EH 0 0 B Eh 3 eh a U EH 0 EH 3 Eh X o U | tf 3 3 a 0 3 O 3 OB o 3 3 a 3 3 w 3 3 Eh X 0 O 0 U 0 Q Eh 3 3 0 0 3 3 0 0 HO Eh 3: 0 0 eh ω 3 EH 3 Eh "0 K EH OR 0 0 ® 0 0 0 3 O 0 (¾ 0 0 or 3 3 Eh EH Eh 0 Eh 3 0 Eh Eh Pm 0 0 0 w 0 Eh Pm EH EH 3 co 3 3 3 3 EH Pm 0 3 * 3 EH 0 Q 3 EH 0 H u 3 H EH 0 eh a Eh o 0 0 3 «EH 0 0 EH Eh 0 3 0 3 EH o 3 a EH 0 0 a 0 EH 0 0 3 0 0 Eh j | H o EH 0 Eh EH υ a Eh 0 3 0 0 0 J Eh O 3 Eh, 0 3 EH 0 or 3 _ 0 J 0 -o Eh W 0 3 «- 0 0 H <J Eh Eh 0 Eh < Pi -O 0 &lt; a 3 3 3 a H H H H r H 10 x # M O H CO H 03 n V 0 3 0 0 0 W 3 < 3 Eh 3 ÊH 3 0 0 W O 0 &gt; Eh 3 0 3 3 3 Eh EH 0 0 W 3 0 0 3 Eh 0 EH 0 Eh W 0 D U EH Eh W U Eh X Eh < * H &lt; 0 Eh 0 0 Q 0 Eh Eh 0 0 Eh 0 0 0 0 υ Eh 0 0 EH 0 0 EH EH 0 3 _ 3 a EH 0 1 3 H Eh 3 a 0 0 ua 1 UOJ u 0 (tf Eh 0 O EH The 0 rtj Eh 3 * ca eh a 0 EH 0 Eh Eh 0 H υ o 0 <0 0 Eh t4 Eh 1 0 3 0 0 0 U 0 1 3 E O 3 EH 0 itf EH 0 EH 0 3 O Eh 3 a 0 0 0 3 0 vq 3 Eh O 3 Eh X 0 o 1 0 O 3 3 a EJ 3 3 Eh 1 ξΡ 0 3 3. 0 ω 3 EH 0 3 Eh 3 a 3 0 a 3 h Eh 0 t- eh 0 0 0 0 0 0 3 3 0 0 3 1 eh Eh tn 3 3 a 0 3 1 0> 3 u 0 0 M 3 o 0 Eh 0 3 EH 3 3 Eh 3 3 H 0 0 υ σ Eh 0 to 0 3 Eh W Eh Eh 0 Eh 0 pq 0 0 Eh a 0 3 H 0 0 Eh 0 Eh 0 3 EH, Eh 0 0 0 0 3 EH JU 0 3 W 0 0 w Eh 0 3 Eh 0! P <3 0 3 W 3 EH 1 0 Eh ^ 0 a 0 U eh ao 3 0> 0 EH oaoa 0 q EH 3 eh a 3 0 V Eh 0 0 W υ 3 3 W! Λ Eh 0 EH u 0 W 0 1 0 Q 3 0 0 3 -3 0 0 3 H 0 EH 0 O 3 3 0 0 0 0 0 a 0 3 a 3 3 Eh 0 EH EH 0 0 0 σ 0 0 0> q y> EH 3 EH W 0 Eh a Ex H ο σ <3 0 3 3 <H 3 0 0 a 3 0 a 0 0 EH CQ Eh 3 a 0 Eh ^ Eh W 0 3 0 0 0 0 0 i 0 to 0 0 0 EH 0 Eh a 1 0 0 0 Eh EH 3 W 0 0 0 3 0 eh a 0 a 3 0 3 W 0 Eh 'j x 0 eh 0 3 0 3 1 eh a 1 0 Eh 0 0 O! 1 0 0 1 Eh 0 3 Eh 0 EH O 0 0 0 0 OQ 3 0 B &lt; Ui EH 3 3 0 EH 0 0 0 Eh 3 a 3 Eh W 0 1 Eh Eh a 0 3 1 Eh a 3 EH 0 0 0 O * 0 0 3 a 3 Eh a 0 rtf 0 a 0 3 a 0 0 3 a < EH 3 0 0 to 0 3 H 0 4 0 to 0 0 0 0 0 3 to 0 0 0 0 EH 0 0 < 0 0 0 0 0 0 3 k. O O! EH Eh EH 0 0 3 a 0 3 Eh 0 EH 0 0 Eh X EH 0 EH J Eh EH 0 0 0 < EH EH 3 H EH 3 Eh W 0 3 Eh 0 Eh X 0 - 0 0 Q 3 EH W 0 «a! (EH 0 0 to U O 0 0 0 EH 0 to H H rH H H r H CO VO • tl1 N O CO V IO \ D X CO ω 121)

3 w 1 ri! I 3 1 CJ 1 * 3; 1 O 3 1 u α 1 EH | eh 1 O | the 1 laughs! EH 1 Ex U 1 Eh 1 3 1 Eh 1 Ex 1 CO &gt; 1 3 H 1 O 1 rf! 1 EH 1 υ 1 3 £ 1 U 0 < 1 O) EI 1 Eh 1 o 1 O &gt; 1 1 ri! W 1 Ca 1 I 3 1 r 1 i 2 p I 1 W 1 O 3 1 WUft 1 O 1 υ eh 1 EH 1 t 3 1 tO &gt; 1 g. 1 CJ υ 1 υ λ eh w 1 EH o 1 Eh o t ri! H EH ΕΕ 1 cj υ 1 EH 1 EH fc 3 H 1 CJ 1 3 1 EH 1 o 1 ai ο 1 1 CSJ EH 1 a »a 1 CJ PV bO Ει ω 1 a ' υ 1 3 £ Eh CO 1 EH vo 3 1 3 3 1 EH X o O w EH s * EH 3 T3 15 OO nJ Eh υ EH D EH O θ 'y CO O ri! HO u 3 υ CO w 3 Eh 2 3 H-NMR (DMSO-d6): Î'(CDCl3): Î'::::::::: , Eh 41 3 15 ri 3 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 -

1 or 1 Eh 1 to 1 U (¾ 1 Et 1 3 1 cj 1 15 i 1 1! 1 U i 3 i a 1 3 1 1 1 1 1 1 1 1 1 1 3 1 1 1 CO 1 Et 1 or 1 Eh 1 3 1 EH 1 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Et 1 3 1 1 Eh 1 Eh 1 Eh 1 Eh 3 i 3 1 3 1 3 ai> 3 1 3 1 1 1 1 1 1 EH 1 EH 1 3 1 Eh CO 1 Eh 1 t 5 1 rta 1 U 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 tO to 1 3 1 Et t 3 i υ 1 O i 3 1 Eh 1 <1> 3 M | frf 1 U 1 3 1 tó 1 Et i ri j 1 1 1 4 4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Eh 1 3 1 1 1 1 3 1 eh 1 ri 1 1 1 Eh i 3 1 tO <II 1 U 1 or 1 CO 1 Eh 1 Eh 1 ^ 1 1 1 1 1 1 υ 1 1 3 3 1 3 1 3 1 EhE £ 1 3 i ri 1 1 EH 1 CO i υ 1 Eh 1 Eh 1 ri! 3 1 U 1 υ i 3 1 U Eh II 1 to 1 < 1 3 H II 1 eh 1 Eh 1 EH II 1 o i υ 1 Eh II 1 to 1 u 1 Eh fc. || 1 Eh 1 Eh 1 3 II 1 Eh 1 O 1 υ II 1 U i υ 1 O < II 1 U 1 < 1: 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 EH | 3 1 EH i υ i 1 Et He 1 o 1 EH Μ 1 1 Et l EH 1 U 1 1 3 1 C5 1 Eh 1 1 EH> H 1 EH 1 Eh Pa | 1 3 i and H r H H <N O CO O OJ <M rH rH H

1 Eh Ο to 1 U Et EH 1 Et ΕΗ ι4 to 1 O Ο - Eh 1 Eh Εη n 3 1 Eh Εη fc * ot Eh 1 Et 1 Ει (N 3 1 Et 1 Ο - a! ÉJ 1 Et 3 1 U ι υ EH 1 <3 1 ο 3 1 1 ΕΗ to i υ 1 ΕΗ Et 1 Eh 1 Εη Eh 1 u 1 Ο Eh 1 u 1 <1 ^ 1 ο 3 1 o 1 εη ri * 1 ri * ι υ the 1 Eh ι ο 1 1 EH Γ 1 Et E 1 Eh 1 <3 1 Eh 1 U 3 1 U 3 1 EH I tf Eh * 1 O | ri 1 o 1 Ει 3 1 <1?! 3 «i υ 1 Ει Eh 1 <1 O i υ ι 3 Eh W ι ο 1 ο Eh ι υ 1 t5 U ι 1 Εη 3 Eh 1 rij 1 Ο U ι υ 1 Et 3 ι ο 1 <tO QIU 1 Ο 3 ι υ 1 Et U 1 CJ! 12 3 Et! · 5 ι <1 to 1 15 Et ι υ 1 ο 3 g 1 Ει 1 ri to 1 · · 3 & 3 Et t4 ι υ 1 ο CJ 1 Επ 1 C5 3 1 ri! 1 ο Eh X 1 Εη 1 <1 to 1 Ει ι 3 EH 1 Εη ι 3 υ 1 <1 Ει to ι υ 1 <EH 1 Εη to to to to to to to to to to to to to to to to to to to to to 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 Et 1 Εη ι 3 E 1 2 3 4 1 1 3 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 3 4 5 6 7 8 9 * 5 to &gt; 1 ΕΗ ι to EH 1 Εη 1 Ει Et ι υ O 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 ri ri ri ri ri ri ri ri ri ri ri ri ri ri

uu Et Et H Et Et 3 Et Et H Et Et H Et Et 3 Et Et Et Et Et 3 EtOH Et 3 Et H Et H Et H 3 Et 3 Et 3 H 3 Et 3 H 3 Et 3 ! U 3 Et 3 E &lt; The title compound was prepared from the title compound as a colorless oil, mp 218-221øC. 1H NMR (DMSO-d6):? 3 3 3 CJ 3 3 to 3 3 to CJ 3 EH EH 3 to EH oo 3, U Et EH CO 3 3 DO 3 Eh Ej υ α 0 Eh 3 Eh to to υ Et to 3 EH to O CJ 3 EH E to Eh E to Eh 3 3 EH Eh EH EH 3 CO o υ 3 to 3 υ EH EH EH '3 EH to to EH U 3 3 υ 3 EH 3 3 to EH 3 EH 3 EH 3 EH 3 EH 3 E E E E E E E E E E E E E E E E E E E E E E E 3 E E 3 3 3 3 E E 3 3 E E E EH u Et CJ 3 EH Ex υ 3 υ Et 3 EH to 2 EH to 3 3 Eh EH EH EH UO Eh CJ EH to Eh 3 U EH Et Eh 3 3 to Eh Eh to U Et UU Eh 3 U Et U to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to The title compound was prepared in a similar manner to that of the title compound as a yellow oil. * J to VO tCO CO H H H H

Table 6 (Pag.3) 3 3 ο ΕΗ o EH ΕΗ ο o 4 3 3 EH 0 Ο 3 or 3 ΕΗ ΕΗ 0 EH 3 ΕΗ 3 υ 0 ΕΗ 0 EH υ ΕΗ 3 Ex ο ΕΗ 3 < 3 υ 4 0 3 0 4 3 Ο Εη Eh Eh υ Ο Eh O ΕΗ Ο O υ 3 0 3 4 3 g B Β υ 3 ΕΗ O 4 ΕΗ 3 O 0 Εη 3 Eg or ΕΗ 0 3 0 0 ΕΗ Eg Eg Ο ΕΗ 3 ΕΗ Ej 0 EH Ο 3 EH hH 3 DO H H Εη 0 EH EH Ο ΕΗ 3 υ 3 ΕΗ 0 υ 3 ΕΗ EH 4 E Ε E E 0 3 3 EH 4 ΕΗ 4 O Ο Εη 0 EH 0 Εη 0 0 ΕΗ ΕΗ Eh υ 0 3 3 ο ΕΗ 0 0 ο ΕΗ 3 3 Εη 0 3 0 Ο 4 ΕΗ EH υ υ 0 0 υ υη Εη 4 ο 3 υ 3 ΕΗ υ υ ΕΗ ο υ 0 ΕΗ υ 3 EH υ 0 Εη 0 υ 3 ΕΗ 0 ΕΗ 3 0 3 υ υ 0 Eh ΕΗ ΕΗ υ υ υ 3 ο υ 3 Ex Ej 0 0 3 4 ΕΗ ΕΗ ICC 3 υ Ο 3 3 0 3 0 ο ο ΕΗ EH ΕΗ ο Εη O 4 3 U 3 4 υ ΕΗ 0 0 ΕΗ Εη Eh 4 Ο υ 3 υ ΕΗ 0 0 ΕΗ 3 0 3 ΕΗ υ ΕΗ 3 4 ΕΗ u 0¾ 0 ΕΗ 0 3 Εη ΕΗ Εη O Εη Εη 3 υ | rf 0 3 ο < ΕΗ Eh ΕΗ ΕΗ Ο O ΕΗ ΕΗ 0 3 - ΕΗ ΕΗ Eh Λ - υ 0 Ej ΕΗ 0 4 Ο ΕΗ 3 H γΗ Η γΗ O C0 \ 0 * 3 * O Ο Η Ο] 03 Οί CM οα H 03 n 03

123

The entire longer clone sequence is presented, with the deleted portion of the shorter clone underlined above. The predicted amino acid sequence is shown below the nucleotide sequence. N-linked potential glycosylation sites are designated -CHO- and the proposed transmembrane region for the longer form is doubly underlined.

Hybridization of DNA transfers from the fragmented genome of human T cells showed a pattern consistent with a single copy gene. Hybridization of RNA blots revealed a major 2.4 kb transcript in peripheral blood mononuclear cells, tonsil B cells and various lymphocyte cell lines; and a low-abundance 2.0 kb transcript present in peripheral blood mononuclear cells and HSB-2 leukemic T cell lines.

The protein sequence encoded by the major insert (the conventional form) carries a strongly hydrophobic putative domain that crosses the membrane near its C-terminus, followed by several positively charged residues resembling a cytoplasmic anchor sequence. The protein is closely related to the recently described Mel-14 murine receptor (Lasky et al., Cell 56: 1045-1055 (1989); Sieqelmanet et al., Science 243: 1165-1172 (1989)). The protein encoded by the shorter sequence (a form with anchored phospholipids) carries a weakly hydrophobic C-terminal domain characteristic of surface proteins that are bound to the cell membrane by covalent attachment to a glycan substituted with phosphatidylinositol. 124

V)

TQ1 monoclonal antibodies (Reinherz et al. (1982) J. Immun. 128: 463-468) and Mel-14 (Gallatin et al. (1983) Nature 304: 30-34) were reacted with transfected CO cells with the Leu8 clone. The presence or absence of Leu8 in CD4 + T lymphocytes identifies the suppressor-inducing and helper-inducing subsets of CD4 + T cells. Leu8 is a self-targeting receptor, allowing T cells to adhere to specialized post capillary endothelium from peripheral lymph nodes. The presence or absence of Leu8 classifies the T cell in terms of potential self-targeting and distribution in tissues. Serological studies have indicated that Leu8 is a hallmark of lymphocytes resting on peripheral lymph nodes (Poletti et al., Hum. Pathol. 19: 1001-1007 (1988)). Activation of T cells by phorbol esters plus PHA results in reduced expression of Leu8 and reduced transcripts, with reduction in Leu8 expression being faster than the reduction of Leu8 transcripts. It therefore appears that surface Leu8 is lost more rapidly than predicted by RNA regeneration, possibly by protection of the form bound to phosphatidylinositol (Ferguson & Williams, A. Rev.

Biochem. 57: 285-320 (1988)). Among peripheral T cells, the CD4 + Leu8 subset &quot; provides aid to the synthesis of IgM and IgG by B cells (Reinherz et al., J. Immun. 128: 463-468 (1982);

Gatenby et al., J. Immun. 129: 1997-2000), whereas CD4 + Leu8 cells directly inhibit the mitogen-induced IgG synthesis of cancers (Kanof et al., J. Immun. 139: 49-54 (1987)). It appears therefore that CD4 + Leu8 &quot; cells, activated to provide support for Ig synthesis by B cells, exit the nodules and circulate peripherally to find the antigen presenting cells. 125

The ability to interfere with the binding of Leu8 'T cells to antigen presenting cells or the ability to cause such binding to occur on surfaces other than lymphocytes may be useful in diagnostics and therapy. For example, the level of Leu8 + T cells activated on Leu8 + cells at rest may serve as a measure of the immune response to a particular antigen.

The extracellular domain of the Leu8 transmembrane protein mediating adhesion to specialized endothelial cells from lymph nodes was observed to be specific in its recognition of lectin ligand, sulfated galactosyl ceramide (sulfite). Modification of the specificity of this binding may serve to regulate the self-targeting potential of resting T cells. Soluble forms of LeuSp can act as anti-inflammatory agents by reducing lymphocyte migration.

Example XV Molecular Isolation and Clonaaem of cDNAs

Encoders of Antigens CD44

CD44 is an integral polymorphic membrane protein. Analysis of immunochemical and RNA transfer data supported the existence of two forms of CD44: a form of mesenchyma expressed by hematopoietic cells and an epithelial form weakly expressed by normal epithelium but highly expressed by carcinomas.

To isolate a cDNA clone encoding CD44 (Stamenkovic et al., Cell 56: 1057-1062 (1989)), libraries are prepared from the U937 histiocytic lymphoma cell line, the B lymphoblastoid line JY, the Raji line from Burkitt lymphoma and the KG-1 myeloid leukemia line were transfected

separately in COS cells by the DEAE-Dextran method, described supra. The cells were pooled 48 hours after transfection, incubated with anti-CD44 monoclonal antibodies (Pesandro et al., J. Immunol. 137: 3689-3695 (1986)) and &quot; panned &quot; on plates coated with affinity purified goat anti-mouse antibody. After several washes, the adherent cells were lysed and purified episomal DNA and used to transfect E. coli. After two similar cycles after fusion of spheroplasts, plasmid DNA recovered from three out of eight randomized colonies was found to direct the appearance of hematopoietic CD44 determinants on transfected COS cells.

Two of these three clones, CD44.5 and CD44.8, carry insertions of about 1.4 Kb, while the third, CD44.4, contained an insertion of about 1.7 Kb. COS cells transfected with any of these clones reacted with the anti-CD44 J173, F-10-44-2 (Dalchau et al., Eur. J. Immunol. 10: 745-749 (1980)) monoclonal antibodies and the antibody monoclonal IM7 anti-Pgp-1 (Trowbridge et al., Immunoaenetics 15: 299-312 (1982)). The untransfected cells showed weak reactivity with J173.

The nucleotide sequence of the hematopoietic CD44.5 cDNA (Table 7) consists of 1354 residues terminating in a small 19 base pair poly (A) tail downstream of a CATAAA sequence. 127

EH CD 2 CD 2 or EH Eh X CD CD &gt; 2 2 2 U CD 2 E E,, a a a a a a o o o o o o o o o o o o o o o o o o o o o o o. s 2 Eh "2 s CJ CD CD 0 A 1 2 CD 2 i υ a CD 0" 2 s υ 2 CD CD CD or U CD 2 CD 2 u CD CD H CD u Eh S 0 Eh CD α EH 2 S υ 0 0 &gt; 2 CD CD 2 u u u u u u u u u u u u u u u u u u u 0 0 0 0 0 CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD. U ο Eh If u CD CD 2 CD CD CD CD CD CD EH 0 2 ω EH CD 2 Eh Eh Pm EH 2 o CD EH 2 S 0 2 Eh Pm u Eh 2 W CJ EH α CD CD P m 2 2 2 2 E E E E E E au au au au au au au au au au au au CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD 2 2 C CJ Eh Eh O Eh 2 2 H 0 The CD Eh Eh The CD 2 O k) EH U 2 s CJ 2 υ CD 2 0 EH EH CD QO υ Eh J Eh CD CD Eh CJ U 0 2 CD 2 0 eh CD CD EH CD CD EH CD 2 O 2 CD CD 2 EH EH 2 CD W CD CD CD CD 0 CD CD 2 CD 0 CD CD CD CD EH cj ps CD μ} E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E ) pH pH HH v H e H H CM υ CJ 2 S υ Eh TO EH Eh to Eh Eh υ υ CD &gt; CD 2 EH 2 s EH Eh u 2 2 H u 2 s Eh O P EH 2 Eh 2 EH (M 2 US ν EH O o 2 H IH EH CJ D 2 H Eh CJ CD 2 2 Eh CD Eh Pm Eh CJ «2 EH α CJ ãH u 2 Eh υ ρ <1 CJ EH 1 CJ Pi Eh CD Q 1 2 2 H Ex CD CD CD CD CD EH CD CD 1 2 0 2 1 CD Q EH ^ α EH CD E EH EH E Eh Pm 2 Eh W υ a CJ CJ CD CD CD 2 CD 2 Eh 2 CD CD $ s 2 S CJ CD PO or 2 2 2 CJ Pi Ex Eh N CD 2 H 2 Eh 0 U CJ k1 Eh 2 Eh o Eh Pm O 2 CD Eh CD Q CD υ> 2 CD CD υ υ Eh EH 2 Eh 2 2 H CJ Eh> h υ Eh CD 2 CD & gt CD Eh 2 CD CD EH CD 2 CD EH 2 CD EH 2 CD EH 2 CD Eh 2 CD Eh 2 CD Eh CD 2 CD Q 2 Eh 2 S Eh Pi υ 2 2 CD PO 2 CD CD CD CJ u 2 CD PO Eh 1 CD 2 Eh 2 H 1 2 O CJ OR CJ P &lt; O PE CD 2 2 2 TO Ü EH α CD 1 CD CJ Pi Eh, 1 Eh ϋ Eh CJ κΐ υ The EH EH CD 2 CJ 2 H 2 HHH ΓΊ o CO n · Η Η Η Η Η Η Η Η t t t t a a a a a a a a a a a a a a a a

0 w Eh υ 0 P &lt; Is o * CDi 2 «I u 0 2 ISEiXY2 1 CD PO 2 CD CD Τ-Ϊvo m S H O Q 2 ο κ u Eh II CJ S υ 2 2 H || 2 EH 2 S 0 || Eh EH Pm Eh || CD &gt; 2 u Eh kD II Eh 0 0 2 EH II CJ 2 EH 2 0 II 2 Eh υ 0 0 2 II Eh 2 0 0 0 II CJ 0 Q. Eh Eh II Eh TO 2 0 Eh k1 II Eh 2 0 0 0 II Eh υ a 2 0 II Eh Pm υ 2 0 2 II CJ 2 0 w 0 II CJ 0 Q 2 EH | 2 Eh 2 2 Eh 11 CJ 0 0 α 0 1 2 2 «EH Eh II Eh> h 0 0 0 kI II Eh 0 2 W 0 1 Eh 2 Eh 0 0 1 Eh Pi Eh 0 EH TO 1 CJ 0 0 0 2 | H 0 2 EH 0 2 H Eh 2 0 2 1 CJ 0 0 W 0 1 CJ PM 2 EH 1 Eh íh 0 0 EH k! 1 Eh Eh EH TO 0 1 CD 2 H 0 EH II CD CD 2 2 2 H II 2 oa 0 II CD 2 Pd 2 EH II CD CD 1 0 0 2 H II 2 1 2 0 0 0 II CJ 1 0 Q EH EH II Eh TO 1 2 2 0 a II Eh O 0 Q 0 II CJ 2 Eh 2 0 II 2 Eh 0 0 Eh 5 II CJ CD EH TO 2 CD 2 W 2 2 2 TO 0 2 0 PO CJ 2 0 H 2 9. 0 Q Eh 0 2 TO 0 0 • the eu CD 0 Eh m Eh CD 2 Eh 2 Eh 2 «0 2 2 H EH 0 PO 2 2 2 H EH 2 CD PO 0 2 0 σ Eh 0 0 a 0 CD Eh S Eh 0 2 TO 0 0 0 Pi CJ 0 2 Eh 2 CJ 0 Pi 0 0 Eh TO Eh 0 2 Eh CJ 0 2 Eh 0 υ 2 TO EH 0 Eh to 0 2 2 a CJ 2 0 a 2 CD 0 Q 0 EH CD CD 1 2 0 2 H CJ 1 2 Eh TO Eh 0 1 0 PO 0 0 2 TO 1 0 0 0 Pi CJ 2 0 0 Eh 0 0 Q 0 0 2 W 2 0 0 0 1 0 0 0 0 Eh 1 Eh 0 Pi Eh 0 1 0 &gt; 0 0 Eh W CJ Eh 2 TO O 2 2 H 0 0 0 to 0 _ 0 2 Eh Ex O 0 Pi 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 00 ο '; Ο < rfj «θ '» &lt; <3 Εη * υ LO ο Ο ΚΙ 0 ο Μ ο ο 0 ΕΗ ΕΗ Η Εη ^. . Ο &gt; &lt; &lt; . &lt;κ; 0 ο · &lt; 2 ο Ο < 0 &lt; 0 0 Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ η η η η η η η η η η η η η η η η η η η η η η η η <Λ Λ Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Εη 0 Η Η Η Η * * * * * * * * * * * * * * * * * * * * * * * * η η η η η η η η η η η η η η Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Μ Μ w η w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w <Η η η η η & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & < Ο η η η Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η η Ο Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η ι ι ι ι ι ι ι ι ι Η Η Η Η Η Η Η ι Η Η Η ι ι ι 0 0 0 0 0 0 0 0 Ο Ο Ο Ο Ο < 3 <ιι α α α Εη 0 υ ιι υ 1¾ υ Εη Εη ο <lt <ι 0 <0 Εη Εη ι < 0 Q Εη Εη 5 · ί * <3 < 0 &lt; Η II rfj U Εη ΕΗ 0 ιι 0 U Ρ Εη ΕΗ 0 ι < 0J ΕΗ &lt; &lt; εη υ ι υ U 0 0 Εη ι * 3 3 Η 0 ΕΗ Εη. 1 0 Q &lt; 3 0 0 &gt; 0 0 < $ 11¾ 0 W * d ΕΗ Q 1 Ο ΚΙ &lt; Εη 0 Ο * 3 ο U 0 0 Εη ΕΗ Εη W 0 Εη Εη 1 3 &gt; 0 &lt; 0 υ ρ ι Εη υ 0 Εη Εη 1 0 ΕΗ W &lt; 3 &lt; The coding of the first methionine is embedded in a consensus initiation sequence and followed by 19 predominantly hydrophobic residues resembling a sequence secreting signal peptide. Cleavage of this peptide will yield a mature 341 residue protein with a predicted molecular weight of 37.2 Kd. The extracellular amino-terminal domain of 248 residues is followed by 21 predominantly hydrophobic amino acids corresponding to the predicted (double-underlined) domain and a 72-residue (cytoplasmic) hydrophilic domain. The discrepancy between the predicted weight of the protein backbone and the deglycosylated forms observed in immunoprecipitates suggests that there are many N-linked glycosylation sites listed in Table 7 by a -CHO- and is rich in serine and threonine residues (22% in aggregate). the SG dipeptide forming the minimal binding site of serine-bound chondroitin sulfate on proteins with glyco-protease appears at residues 160, 170, 211 and 238 in the predicted extracellular domain; these potential glycosylation sites are underlined. Hybridization of RNA blots revealed three major pathogens of 1.6, 2.2 and 5.0 Kb in a variety of hematopoietic cell lines, including the CSF lymphoblastoid B line, HUT-102 and HPB-ALL T cell leukemias, lymphokines, tonsil B cells, and U937 histiocytic lymphoma. Immunoprecipitation of CD44 from transfected COS cells reveals that the mesenchymal or hematopoietic form of CD44 is about 80-90 Kd. It has been found that hematopoietic CD44 transfected into a B cell line results in binding of CD44 bearing lymphocytes to rat lymphatic stromal cells in primary culture, indicating that hematopoietic CD44 may play a role in self-targeting 130

(I.e.

of lymphocytes. Hematopoietic CD44 has been shown to be an affinity extracellular matrix receptor for type I and VI collagens (Stamenkovic et al., Cell 56: 1057-1062 (1989)). Hematopoietic CD44 may also play a role in lymphocyte activation. The ability to interfere with hematopoietic CD44 binding to lymph node cells or the ability to cause such binding on other surfaces may be useful in diagnosis and therapy. For example, modification of this binding may serve to regulate the self-targeting potential of lymphocytes. Soluble forms of CD44 may have immunomodulatory activity.

To isolate a cDNA clone encoding the epithelial form of CD44, a cDNA library prepared from the HT29 colon carcinoma line was used to transfect COS cells by the DEAE-Dextran method described supra. The cells were pooled 48 hours after transfection, incubated with anti-CD44 monoclonal antibody F-10-44-2 (Dalchau et al., Eur. J. Immunol., 10: 745-749 (1980)) and &quot; panned &quot; on plates coated with affinity purified goat anti-mouse antibody. After several washes the adherent cells were lysed and the DNAepis-somal purified and used to transform E. coli. After two similar cycles of spheroplast fusion enrichment, as described supra. plasmid DNA recovered from seven out of ten randomly chosen colonies has been found to drive the onset of epithelial CD44 determinants on transfected COS cells. the seven positive clones carry cDNA inserts of about 2.4 Kb. Restriction enzyme analysis of the clone containing the epithelial cDNA insert showed that the coding sequence 131 (Table 8) was enlarged relative to the hemato-poietic CD44 insert by the addition of 496 base pairs. ΕΗ ο 4 Ο Εη Εη &gt; η Ο ο &gt; 2 2 η Ο ((((((((((4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 3 Ο η η 4 4 4 4 U C3 13 Β η η η ϊ ϊ ϊ ϊ Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο 4 4 4 η η η η C3 Ο η η η η Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο 4 4 4 4 4 4 4 4 4 4 4 4 4 4 CO CO CO CO CO CO CO CO Η Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο 2 4 4 4 4 4 4 4 4 4 4 V V 4 4 4 4 4 4 4 (((((((((((((((((((((((((((((((((((((((((( α ο U ο Εη ο υ U Β ΕΗ U CJ υ U C3 ΕΗ ο 4 ω υ υ ο ο ο ΕΗ Εη ο Εη Β Β Β Γ Γ Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο 2 2 2 a Ο ΕΗ U Β U a 4 a υ ΕΗ D 15 2 Εη Β 1 4 υ a U ι u σ U Ο υ Ex ΕΗ ϋ υ 2 Η Εη Ο 4 C5 2 0 ϋ, Εη> η 2 ΕΗ ^ Ο Pi υ υ 0 2 Εη υ α β CJ 2 Εη ΕΗ 2 υ Ex 15 D υ 2 Η ΕΗ Ο Β Ο 2 ο ΕΗ ^ Εη> η Εη, C5 &gt; Ο ΕΗ Β Ο 2 α ΕΗ υ α υ Ο &gt; 2 2 η 2 2 2 2 2 2 2 2 2 2 2 Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Η Η Η Η 2 2 3 Η Η Η 15 15 15 15 15 15 15 15 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 Ο β Ο Η Η (((((((((((((((((((((((((((Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β 2 Εη 2 Ο U Ο Ο pí U U U Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β 2 W ΕΗ ΕΗ υ U 2 Η-Ρ Ρ 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 η η η η η η η η η η η η η η Β ϋ η η 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 ΕΗ FΟ Ο ο 3Η to ο ο ΕΗ Ο Ε Η 2 2 Q 1 2 3 C3 C3 ι α 2 2 2 Εη ΕΗ &gt; C3 Η ΕΗ W ΕΗ Μ Β Ο ο ο 2

1 U-ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Β Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο Ο co • a • ΕΗ ω w ω ο ο 2 ΙΛ 2 υ 15 Β Εη U 2 Εη C3 2 2 Εη Εη Εη ο a (5 CJ υ Εη Εη Εη ω 2 C3 2 Εη Εη 2 m 2 U Εη Β υ υ 2 Εη Εη Εη W 2 2 Εη W Εη Ο ο a Ο 'Εη, 2 Εη Εη 2 CJ Β 2 Ο C3 Q ΕΗ Ο 2 Εη C3 α υ β 2 Εη Ο Β Η ο 4 S 2 2 Εη W Ex C5 υ a υ 2 C5 C5 ο 13 2 a 2 2 C5 U Ο Ω 2 υ 2 Εη, rf 2 2 Εη 2 C3 Β Εη Q 2 Β Εη C3 2 Β ΕΗ υ CJ PS ϋ 2 Εη W Εη 2 15 Ω Εη Ο C3 Ω 2 2 Ο Β C3 2 υ a α ΕΗ C5 Β Εη 'ΕΗ Εη Β 2 2 2 Η ΕΗ 2 2 a 2 2 C3 Β 2 Ο C5 Ω C5 α 2 η 4 Εη υ β Ο 2 Εη Β υ 2 U Β 2 2 C5 Q Ο Ο C3 Ω 2 Εη η C5 C3 2 0 Ο> 2 13 2 Εη C3 2 2 «CJ Η C5 Β 2 C3 Εη Β ΕΗ C3 2 W Εη 2 2« CJ C5 υ a 2 2 Λ C3 C3 2 C3 C5 Q 2 U C5 Ο U υ Εη W Εη U 2 η 2 C3 2 Εη υ υ C5 C5 Ο 2 2 Εη 2 Εη 2 a Εη U 2 Η 2 υ 2 Εη C3 U Εη W υ C3 U Β υ ΕΗ Εη S Εη Εη C3 &gt; υ 2 Εη Β ΕΗ ο 2 a υ 2 υ β 13 C5 Εη 5 2 W Εη Ο Ο 2 C5 2 2 W Εη 2 2 a CJ ο υ σ ο 2 2 Εη ΕΗ (3 C5 Ο Εη Ο 2 a 2 υ Εη W Εη 2 υ β ΕΗ 2 C3 Β C3 2 2 a U 2 2 a Ο 2 CJ Οί Εη C5 Ο Ω Εη C5 2 ω 2 Εη, 2 ω 2 U Ο Β ο υ U Β C3 2 Εη W υ U ο α 2 ΕΗ 2 Εη ο 0 2 0 4 2 2 Εη UU υ σ C5 CJ ~ 2 Εη ο ΕΗ U Β Εη α Ο Β U C3 2 Εη Εη ι ~ 4 γΗ Η Η ^ r OQ Ο C0 νο νο C0 C0 σ \ 133

EH υ &lt; Eh EH EH Eh b CM 3 EH "ta t &gt; Uh huh uh uh Uh uh! laugh Eh EH or υ υ a U Ex ta < Eh to u | t ri! W 3 b EH 3 a ta ta q EH tf rij P-! you look so hot υ Eh Ω Eh EH υ ta ri) Eh 3 υ rij eh < υ 3 Z 3 Eh υ ta ta < I love you! ta ta ta q eh eh, ta ta 1¾ tf rij q eh EH Eh 3 ta ta b ta υ b α 3 u 3 to u 3 υ 3 ta rij υ <3 ri! ta w ta 3 b ta q 3 EH 3 Z Eh CO ri! &lt; EH Ω υ υ ta b o »b Eh υ ta ta EH EH, 3 H 3 EH 3 ca G ω ta b o 3 to υ EH EH t ta ta ta g &Gt; ri) ta Eh to 3 rij EH, ta ta 3 EH O EH Ω EH O b Ω b A U 3 ta < T h u u t h 3 h h h h h h h h h h h h h h h h h h h h h h h EH b tf U EH 3 M C \ J Eh tf Ej 3 ri! H a ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• " EH EH i u a 00 ri! «EH < . U i ta ob 3 _ ta q ta o ukb 3 a ri) ta κ ta ta Ό 3 to EH b Eh 5 U Eh (d ri e o Eh tO <3 eh to <3 1 EH U Çy The w υ 3 ta w ta 3 ta h 3 ta ri! 3 a E h u 3 u r t t u u U U 3 U U 3 U 3 U 3 U 3 U 3 3 3 to 3 EO 3 E o 3 E o 3 E o 3 e o 3 e o 3 e o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o 3 z Eh eh u 3 Eh u Eh O 3 EH ta Eh 3 <Eh Eh ta ta> eh 3 eh 3 eh Eh eh 3 eh e 3 eh 3 eh W 3 u 3 H EH UO Eh tO EH Eh O ta 3 ta α 3 H rih Eh Eh ta Eh ta Eh o! <3 EH ta ta EH b E <t> h Eh ta ta ta EH Eh Eh ta ta EH EH b ta> Eh u ta gt; - Eh tO 3 3 ta - <ta U ta ri ta ta uu ta 3 H <rA Γ-Ϊ rH H 'ί - 03 o ω VD Ο H 03 03 n HH rH rH rH

Eh tO o EH ta ta 3 ta υ υ Eh 3 Eh tO 3 3 3 ta 3 3 Eh 3 Eh * Eh o w ta ta EH EH O 3 ta &gt; 3 EH 3 tf ta ta Eh 3 ta ta o Eh 3 z EH 3 Eh ta Eh 3 Eh Ej ^ 3 H Eh ta> Eh Eh EH E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E δ b q ta EH q Eh Ej t> 3 Eh 3 a E c Eh 3 3 e E 3 3 Z E H e w w e 3 3 EH 3 EH 3 E o E 3 EH Eh Eh eh e b E E E EH to 3 EH q 3 ca Eh 3 zu EH 3 tf ta 3 EH oq, 3 ta 3 tf Eh 3 3 W 3 3 ca ta υ 3 υ 3 Eh Eh ta 3 ta 3 3 q 3 3 u 3 ta hqqqw Ex q 3 3 3 EH EH ta ta ω EH 3 ta ta EH q 3 ca o ca EH 3. ta 3 3 3 Z 3 3 EH uu OO Ex "3 Eh 3 Eh O Ω ta, φ 3 3 Eh 3 3 ta 3 S qq ta ta Eh 3 u EH Eh 3 EH ta Eh tf 3 EH 3 to ta EH 3 3 q 3 υ ca α EH ca ca ca EH EH ta 3 ca EH rij ta Eh Eh 3 tf 3 3 q 3 ca Eh Eh eh eh eh eh Eh 3 eh EH 3 3 ca ca ca q 3 _ 3 Eh ta EH OQ 3 O e 3 e 3 3 e w 3 EH ta w 3 EH O ta υ U H H H H ri · ΓΗ O CO ιη VD VD H Η HH

q EH b EH q Eh q EH b 3 U q 3 3 q ca qb 3 3 Eh EH 3 3 u Ej 3 b EH Eh 3 3 3 qqgq Eh 3 EH Eh EH Eh Eh Et Eh Eq Eq 3 Ex 3 EH b Ej 3 EH b 3 3 3 b Eh Et c3 3 3 3 Eh 3 q Eh Et q ca qq Eh u 3 EH EH 3 3 qq 3 3 Ex qq Eh bqqb ÊH ca q Eh t, ri! b EH q M | rf b Eh 3 Ct EH ta 3 Pl K q EH 3 fd qqq 3 Cj EH qq EH 3 bqq 3 3 b EH 3 EH EH q ÈH 3 q O qq 3 3 EH qbb Eh 3 3 b Eh U EH qb Eh q 3 EH 3 3 q 3 Et ca EH Eh 3 3 EH 3 EH bq EH qqb 3 Et qq EH qb Ej q Eh qb 3 3 Eh q EH Eh bb Eh qbbqb 3 EH EH Eh b EH EH EH EH Et q EH 3 b 3 Ej 3 bqqqbq Eh qq 3 q 3 EH qqqqb ta q EH 3 b EH 3 bbb U 3 b EH 3 U EH b Eh 3 U b EH EH 3 Eh q 3 Eh EH 3 3 3 Eh Eh ca u EH 3 3 Eh bb 3 EH Eh 3 b 3 EH bqq 3 U b 3 3 3 ta UH Eh Eh Eh Eh Eb Eb Eb Eb Eb Eb Eh Eh EH EH Eh Eh Eh EH bq Eh bbb Eh U bb 3 q 3 3 bq Et ca 3 q 3 bob EH b Eh ub Eh 3 3 eq 3 EH b eh b EH EH Eh - 3 Eh Ex 3 b £ h 3 HHHHH OJ O V CO CO cr \ OOHHHO) ΓΜ 03 2241 GCACAAAAAG GGTTTAAACT

Analysis of the DNA sequence showed that the epithelial CD44 cDNA is very similar to the 44.5 cDNA but encodes yet another 165 amino acid extracellular domain, inserted about 140 residues upstream of the transmembrane section shared by both clones. The mature protein will comprise 493 residues. Analysis of RNA transfer revealed that epithelial CD44 transcripts comprise species of 2.2, 2.7 and 5.5 Kb. Epithelial CD44 isolated by immunoprecipitation has revealed that the glycoprotein has about 160 Kd. Transfected B cells expressing epithelial CD44 do not adhere to stromal cells from rat lymph nodes in primary culture as is the case with lymphocytes transfected with hematopoietic CD44. Epithelial CD44 is poorly expressed by carcinomas. It is possible that the function of the epithelial CD44 extracellular matrix receptor is to promote tumor invasion. The ability to interfere with epithelial CD44 binding with extracellular matrices may be useful in therapy and in diagnostics. For example, interference of epithelial CD44 binding to extracellular matrices may decrease the likelihood of metastases in cancer patients. Soluble forms of CD44 may act to prevent auto-targeting of the metastatic cells into the lymph nodes.

Exemolo XVI Isolation and Clonaoem Molecular cDNA

CD53 Antigen encoding CD53, the antigen recognized by the MEM-53 antibodies (Hadam, MR (1989) in Leukocvte Tvoinq IV, Knapp, B. et al. (Eds.) Oxford Univ. and HI36 and 63-5A3, is a glycoprotein widely distributed between cells 135

nucleotides of the hematopoietic lines, but only restricted thereto (Stevanova, I., et al. (1989) in Leukocyte Typinq IV, Knapp, B. et al. (eds.) Oxford Univ. CD53 is expressed by monocytes and macrophages by granulocytes, dendritic cells, osteoclasts and osteoblasts, and by T and B cells of all stages of differentiation.

To obtain a cDNA clone encoding CD53, cDNA libraries constructed from peripheral blood lymphocytes and the HL6o line of promyelocytic tumor cells and used to transfect COS cells by the DEAE-Dextran method described supra. Cells were pooled 48 hours post-transfection, incubated with MEM-53 monoclonal antibodies and &quot; panned &quot; as described in Seed and Aruffo, Proc. Natl. Acad. Know. USA 84: 3365-3369 (1987) and Aruffo and Seed, Proc. Natl. Acad. Know. USA 84: 8573--8577 (1987). After two subsequent enrichment cycles after fusion of spheroplasts, plasmid DNA recovered from isolated colonies was used to transfect COS cells and CD53 expression was evaluated by immunofluorescence.

I

Two out of eight transfectants were positive, each carrying an approximately 1.5 Kb insert. COS cells transfected with both clones reacted with the MEM-53, HT29, HI36 and 63-5A3 antibodies.

To isolate CD53 from peripheral blood lymphocytes and COS cells transfected for comparison, lymphocytes and transfected COS cells were labeled on 125i surface using lactoperoxidase and H 2 O 2 and then lysed in a 50 mM Tris-HCl pH 8 lysis buffer , Containing 1% NP40, 150 mM NaCl, 5 mM MgCl2, 5 mM KCl, 20 mM iodoacetamide and 1 mM phenylmethylsulfonylfluoride. Cells were solubilized at a concentration of 2.5 x 107 cells / ml in lysis buffer for 45

minutes later centrifuged at 12000 g. After pre-clarification with beads of goat anti-mouse immunoglobulin (Cappel, Malvern, PA) antibodies the immunoprecipitations were performed with the monoclonal antibodies MEM53 or 63-5A3 and Protein A-Sepharose CL-4B (Sigma, St. Louis, MO) as described by Schneider et al. (J. Biol. Chem. 257: 10766 (1982)). The immunoprecipitates were eluted in SDS sample buffer and analyzed on 12.5% gels of sodium dodecylsulfate-containing acrylamide.

A broad band of radioactively iodinated protein with a weight between 34 Kd and 42 Kd was obtained from peripheral blood lymphocytes with the MEM-53 or 63-5A3 monoclonal antibodies, comparable to the band obtained from COS cells transfected with CD53, ranging from 36 Kd to 64 Kd. The higher weight in COS cells is atypical since cell surface proteins recovered from transfected COS cells generally have unchanged or lower molecular weight than that found in the cell from which the cDNA clone is derived (Aruffo and Seed, Proc. Natl Acad Sci USA 84: 3365-3369 (1987)). Approximately 15 kg of weight were released from glycoprotein by digestion with F (N-glycanase) endoglycoside, whereas treatment with neuraminidase and O-glycanase had no effect on apparent molecular weight (Hadam, MR (1989) on Leukocvte Tvpinq IV. , B. et al (eds.), Oxford University Press, pp. 674); Stevanova, I., et al. (1989) in Leukocvte Tvpinq IV. Knapp, B. et al. (eds.) Oxford Univ. Press, p. 678). An additional weak band of 20 Kd, possibly non-glycosylated precursor was detected in immunoprecipitates of untransfected COS cells, but was absent from immunoprecipitates of peripheral blood lymphocytes. Hybridization of genomic DNA derived from a PEER T cell line digested with various enzymes revealed a 137

consistent with a single copy gene. Analysis of RNA transfers revealed a single 1.8 kb mRNA derived from myeloid cell lines and from peripheral blood lymphocytes. The level of expression was comparable in the different cell lines except the THP1 cell line, which had little CD53 mRNA. CD53 transcripts are more abundant in peripheral blood lymphocytes than in cultured cell lines, consistent with the expression of the most abundant surface CD53 in these cells.

The nucleotide sequence of the CD53 cDNA was determined by termination of dideoxynucleotide chains as described supra. using synthetic primer oligonucleotides. The CD53 insert sequence consists of 1452 nucleotides (Table 9) and terminates near two AATAAA motifs (underlined).

138)

3 a υ Εη "1 < a i 0 < 0 0 Εη a 1 Eh 1 < 0 Ω o υ ο 0 1 Eh 3 a 0 0 o 0 Εη ^ 1 0 Ω 0 0 o Εη 0 &gt; 1 &lt; Hey, the E- * Εη η! Ex EH 0 to 0 3 to Εη 3. 0 i3 &lt; 0 α Εη 3 a Eh 3 0 rtj u 3 Η 0 0 0 W 3 or U 0 Eh 0 Eh 0 0 Ο II Ο 0 0 < II 0 &lt; '3 Η 0 1 0 3 Eh X II 0 O υ ι ΕΗ _ 3 a &lt; 1 3 Eh 0 II 0 Ω 0 Eh || 3 to 3 Εη U 0 0 &gt; II 0 Eh υ 0 3 a Eh II 0 3 0 I 3 Εη EH II 3 EH 3 0 0 I 0 Eh al 0 O ΕΗ II εη 0 W 0 1 0 3 0 II Ο ι-3 0 EH II 3 to 3 Εη 0 0 < 0 »3 II Eh o 0 0 3 to 0 | o Ej Εη to EH rtj Jg u 3 Η 0 EH 0 31 II o 0 0 3 H 0 II 3 <3 0 0 Ω EH Eh | 0 Q 3 Εη S 0 0 3 H 3 3 ΕΗ Εη Eh W 0 II 0 3 ΕΗ 0 ι-3 0 0 || Eh 10 O Εη 1¾ 0 0 0 3 II 0 0 Ο < 0 0 0 I 3 Eh Εη 3 a 0 Eh I 0 tu υ 0 1-3 ΕΗ EH EH 31 1 0 * υ 0 3 < a 0 1 3 ο Β 0 κ 0 0 | EH X Eh Εη Ω ο 0 ri! Eh 1 Eh ο 0 ΕΗ Eh O 0 1 0 ο 3 w Εη a 0 Eh 1 0 Pi υ 3 a 0 0 0 &gt; 1 0 3 0 Εη 0 0 0 1 3 3 Εη II 0 ι-3 0 3 1 0 «0 Εη a II 0 EH 0 W II 0 0 0 II Εη 0 31 Eh II H 3 Εη II 0 &gt; 0 0 II 3 H 0 Εη a II <! Eh 0 &lt; 1 0 Επ Εη II 0 Eh & H Eh II 0 Ο Εη II 0 0 0 Eh II 3 to 3 Εη a II 0 0 0 31 1 0 Ο 0 II Εη 0 3 0 II rti ο Εη II Εη a EH EH II 0 Q α U Ω II 0 Eh 0 31 II 0 3 0 II 3 0 &gt; 0 II 0 3 ΕΗ II 3 a 3 Eh II 3 EH ο 0 &gt; 0 EH 3 H II 0 U Εη 3 0 &gt; EH II Eh U 3 < a 0 EH 1 0 31 Ο Εη X 0 EH xjj H 1 Et ΕΗ 3 < to 0 II 0 ο 3. . 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 | 3 Εη 1 &lt; H | EH EH II 3 to 10 0 &gt; 3 | 0 1 Eh 0 31 1) EH 3 0 II ΕΗ 1 3 H 0 II 0 Εη Εη _ II 0 »3 1 Eh Eh II 0 I < Ο U (-1 1 0 1 0 0 31 II 0 <Eh 1 Eh to 0 II EH 0 3 0 ι 3 1 0 Eh II 0> Εη 3 to 0 1 0 <H II EH 3 0 3 1 0 0 0 II 3 &lt; ΕΗ Eh X 1 0 Eh II Eh X Εη Εη &gt; 3 0 1 EH Eh a II 0 3 0 Eh 1 0 &gt; 0 II &lt; Ο 0 <H 1 0 EH II 0 W Ο 3 0 1 EH Eh a II EH 3 Εη 0 1 3 H 0 II s 3 0 0 0 1 0 0 || 3 a ο 3 W- Eh 1 Eh Eh W || 0 Εη 0 - Eh 1 0> 0 II EH 0 Εη ~ Eh a 1 Eh EH 1 0 31 rH HH rH Η VO r 03 O Η ω HN n

Eh W H 11 or 3 EH 0 0 0 1) 3 Eh 0 0 0 3 Eh 11 0 EH 3 3 0 Pi 0 li 3 3 3 3 0 Eh II u a 0 0 u 0 3 Η II 0 0 < Eh Eh 0 0 II 3 0 0 EH II 3 to EH 3 Eh O 3 H o 3 = 0 0 Eh W 3 ii 0 Eh = 0 Eh 3 0 II 3 Eh Eh = 3 0 0 0 0 II H s 3 Eh 0 3 0 II 3 3 = 0 3 $ Ex II 3 a 0 3 0 O 3 Η II 0 0 Eh O 0 0) Eh! ' 3 3 0 3 3 II 0 Ω 3 Eh 3 0 Eh X II EH 3 Eh U 0 Pt 0 || EH 3 0 0 0 EH II 3 H o EH 3 0 0 31 11 0 0 0 0 0 0 0 II 3 EH EH 0 EH Eh II ua 0 0 9 Eh fu II 0 3 0 0 3 tO EJ 0 3 0 3 0 * JÍ. EH 0 0 Eh 0 0 3 a 0 0 Eh 3 Eh 0 3 0 0 0 0 0 3 a 0 3 < 0 Eh W 0 EH Eh 0 [HS EH EH 0 Eh Eh Ex 3 Ο Ω EH Eh 0 3 ^ 0 K o 3 Eh 3 0 P Eh υ 0 Eh 0 Eh Eh 3 Eh EH 0 EH 0 Eh a 0 Eh 0 EH 1 3 to 0 EH Eh 0 Eh 1 0 0 0 Ω 0 Eh OO 0 Eh S 3 Eh Eh Eh W 3 Eh 0 0 Eh Eh 3 0 0 EH 0 3 II 0 0 3 1 0 0 31 EH II < 0 0 1 0 0 3 EH II 0 Eh 3 Eh 0 eh a 3 3 0 3 3 0 0 0 3 3 a 3 0 3 0 3 3 0 Eh tO 1 3 0 or Eh 0 3 0 11 0 Eh 0 rt | H 3 Επ 1 Eh 0 < Eh 3 3 a II 0 0 0 0 3 a 0 1 0 EH 0 0 0 0 0 II Eh O 0 EH 0 0 0 1 0 0 3 0 0 3 0 II Eh Eh 0 Eh 0 EH Eh II 0 3 Eh Eh Eh Ω II Eh 0 0 0 Eh X 0 II Eh Eh Eh Eh 0 0 Eh 1 0 3 0 0 0 &gt; II. 3 1 Eh 0 0 1 Eh 0 0 0 o &gt; 1 Eh 3 1 0 3 0 0 O 0 0 W 1 3 0 Eh Eh K 0 0 Eh 1 0 0 3 0 31 0 0 Eh 1 0 EH 0 Eh 1 3 3 Η 1 Eh 0 < Eh 1 0 M 0 1 0 3 0 Eh a 0 Επ 1 Eh 0 0 3 Eh 0 &gt; 1 3 Eh 0 0 9 &gt; Eh 1 0 3 1 Eh to 3 0 1 Eh * 0 U 0 3 Eh 0 1 < EH O 3 3 to 3 1 EH 3 0 0 o &gt; 3 Eh 1 0 (H 0 0 0 0 0> 0 0 Eh Eh 0 «Eh 1 0 Eh Eh 3 H Eh 0 1 0 0 0 0 3 Eh 0 II <0 Eh 0 0 P 0 Hl Eh 0 0 Eh CO 3 Eh Hl <H 0 0 0 0 3 HL 0 3 0 H rH HHHH CO ID NO NO CO in V D X CO co 139

0 0 3 0 0 3 3 0 0 3 3 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ΕΗυυ U U 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 0 Εη = υ <3 0 Επ ΕΗ = | &lt; Γ ΕΗ υ ΕΗ 3 Εη = &lt; q 0 ΕΗ 0 3 3 S ΕΗ Εη υ 0 Εη Ο 0 Eg ΕΗ Εη Εη Ο Εη 3 &lt; 3 3 0 Ε = U 0 ο Εη Εη UU υ <3 3 = Εη -P / £ 0 3 3 ΕΗ s Επ c 3 3 0 υ Εη = ΕΗ o rtj 0 0 ο ΕΗ = 3 o Ο υ ΕΗ ο 3 = 0 3 ΕΗ Ο ο 0 3 0 υ <3 <1 Εη 3 or \ 3 Εη υ 3 0 ΕΗ ICC 0 Εη 3 3 3 3 υ υ 0 0 u U ΕΗ α υ 0 3 Ό cd 0 Ej 0 ΕΗ Εη 0 3 3 3 3 3 Η 3 '3 Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η' '' '' '' '' η η η η η η η η η η 3 <3 <3 <3 <3 <3 <3 <3 <3 <3 <3 <3 <3 <3 <3> η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η Η 3 3 Εη 0 0 Εη Εη 3 0 3 Εη 3 0 ΕΗ Εη 3 <3 3 3 0 Εη 0 Εη 0 Ο 0 0 3 3 Εη <3 0 Εη 3 3 3 Ο Εη 0 ΕΗ Εη Εη 3 Ο Εη 0 0 <3 3 υ 3 3 Ο υ 0 0 0 rfÍ 0 0 0 ΕΗ 3 1¾ <3 3 ΕΗ ΕΗ 0 0 0 3 0 3 Εη ΕΗ υ 0 Εη 3 Ο υ Έη 3 Εη 3 0 3 15 Εη 0 ΕΗ Εη 3 3 0 0 3 Η Η Η Η Η Η 03 Why do not you go ahead and do not

03 LO

H

Non-coding sequence 3 contains three examples of the ATTTA sequence (indicated by the double quotation marks), which has been shown to mediate mRNA instability (Shaw and Kamen, Cell 46: 659 (1986)). An open reading frame starting at residue 74 codes for a protein of 219 amino acids with a predicted molecular weight of 24.340 Kd. The predicted polypeptide is unusual in that it bears four hydrophobic segments (doubly underlined), three of which are in close proximity to the amino terminus of the molecule. The first hydrophobic segment is atypically long for signal sequence or simple transmembrane alpha helix and contains three cysteine residues and one glycine residue located in the medium. Both cysteines and glycine immediately precede the site of the cleavage signal (von Heijne, Nucleic Acids Res. 14: 4683 (1986)), suggesting that the amine end of the mature protein begins in the middle of the first hydrophobic domain. Some support is given to this view in that the size of the ME491 polypeptide backbone, a related type III integral membrane protein, discussed below, is smaller than the predicted size from the cDNA sequence, possibly as a consequence of the excision of a signal peptide. Because there are only two potential sites for addition of N-linked glycan (indicated in Table 9 by the designations -CHO-), located between the third and fourth hydrophobic segments, the carbonyl end lies within the cell, as well as the short hydrophilic fraction between the second and third hydrophobic segments. If the amine end is not processed it should remain intracellular. CD53 is a Type III integral membrane protein related to other membrane proteins: antigen ME491, a melanoma protein whose increased expression is well correlated with tumor progression (Hotta, et al., Cancer Res. 48: 2955 (1988) ); CD37 an extensively glycosylated antigen predominantly expressed on B cells, but not specific for B cell lines / Schwartz et al., J. Immun. 140: 905 (1988); and S5.7 a non-glycosylated antigen widely expressed in cells of the hematopoietic lineage (Pressano et al., Cancer Res. 43: 4812 (1983)). In addition, CD53 is distantly related to E. coli lac Y permease, a type III integral membrane protein that passes lactose to the bacterial cell. CD53 transcripts on peripheral blood lymphocytes increase after mitogenic stimulation by PHA, suggesting that the protein may be involved in the transport of factors essential for cell proliferation.

Among molecules with broad reactivity in the hematopoietic system, CD53 presently gives the broader reactivity as well as the more precise restriction to hematopoietic cells. Anti-CD53 antibodies are a useful tool in the identification of hematopoietic neoplasms and may prove useful in identifying poorly defined cells morphologically, for example in primary spleen or bone marrow cultures.

Equivalents

Those skilled in the art will recognize or be able to determine using no more than routine experimentation many equivalent to the specific embodiments of the invention described herein. Such equivalents are intended to be included within the scope of this invention.

Claims (1)

A method for producing the CD53 protein, which comprises expressing a recombinant nucleotide sequence encoding the CD53 protein. 2. A method according to claim 1, characterized in that the CD53 protein has the amino acid sequence of Table 9: 3 S U II O Ο II CJ Ο CJ II CJ CJ cj II cj Εη II Eh Εη J II 3 X Εη II CJ Εη II cd 3 Η II or υ II cj ο II < ΕΗ CJ II u U II Eh CJ II 3 Εη υ II Eh υ 1 3 CJ 1 3 ο ο 1 CJ Εη 1 3 Ο I 3 Εη CJ 1 cj u 1 υ Εη 1 ο 3 Η 1 ο CJ 1 3 CJ 1 3 Εη &amp; 1 3 Εη 1 3 Εη 1 ο Εη Pu 1 0 υ 1 Εη Εη 1 Ο υ ij CJ υ CJ Εη Εη Εη J Ο U CJ < CJ 3 2: 3 υ 3 Εη 1 υ Εη Pu 1 ο υ II 3 Εη 1 ο Εη fu 1 ΕΗ Εη 1 U Εη II 3 Εη Cu II CJ CJ II CJ ΕΗ II 3 CJ Ω II 3 υ II 3 Εη II C Ο &gt; II υ Ε &lt; II υ 3 II CJ Εη X II Εη Ο II CJ 3 II Εη 3 a II Εη ο II 3 Εη II 3 UJ II 3 Ο II Εη Εη II υ υ Ω II 3 3 ο 3 Εη 3 a 3 cj 3 Εη Εη Εη J 3 Ο CJ CJ CJ 3 ca 3 Εη 3 Ο υ 3 W ΕΗ CJ U Εη - <1 S u cj cj cj e e c c EhO Eh Cu cj u3 EH CJ EHO 3OO Eh ca cj cj U (¾o Eh OJ cj eh Eh Eh Cj Eh Cj Cj CJ CJ CJ Eh Eh Cu α sa3 α a cj H Eh O Eh 3 cj CJ OO Eh ^ Pu HHH 10> 3 S Cj II tr CJ -Μ C · εη, II II á a U Ω II CJ ο II 3 Εη II ο α u ι-5 II 3 Εη 3 CJ CJ W Εη α Εη CJ 3 II Εη X II 3 a 3 II U Εη II 3 α> 11 3 a ΕΗ II 3 ΕΗ II 3 Εη Cu II Ο W υ II CJ ΕΗ II 3 Ο J II 3 Μ ο II α ΕΗ II Εη II Ο Ω II 3 Η II α II ΕΗ II Εη II or II 3 Η II εη ω II U II U II U II ο II Ο 3 II ο ο II ο II CJ II ΕΗ II ΕΗ II ΕΗ Ω II 3 S II υ II ο II ο II CJ II 3 ΕΗ II εη Ο II CJ II ο II Εη II υ II ο> II cj ο II CJ II CJ II 3 II εη "II CJ Μ II U Ω II Εη II U II α II εη II CJ 3 II Εη Cu II ΕΗ II U II ΕΗ II II II II II II II η II η II η II η II II & II &> II Ο II 3 II ΕΗ II Εη II &lt; Η II ο &gt; II Εη II cj II Εη II Εη II 3 Η II 3 S II Ο II Η II ΕΗ II Εη II U II II 3 Η II η II η II η II η II Ο II II II II η II Η II II Ο ι-5 II Εη W II υ II υ II Εη II ο II 3 Η II or ο II CJ II ο II Εη II Εη II Εη Cu II Ο> II CJ II U II ΕΗ II Εη II Εη Cu II 3 Η II Ο II II II α II Εη II Εη Μ II CJ &gt; II Ο II ΕΗ II Η * * * Η Η Η Η Τ Τ Τ Τ Τ 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 cj 3 Eh Eh | υ 3 H 1 U Eh W 3 1 Ο 3 3 CJ 1 UO CJ CJ 1 5 «CJ 3 CJ 1 3 Eh | ο 3 3 Η I ο α (¾ Eh I 3 ΕΗ 3 3 α α Eh XI C3 υ cu CJ 1 3 w CJ Eh Εη CJ O 3 3 CJ CJ o 3 a Eh Eh CJ CJ Eh Cu 3 3 ca Eh CJ Ω O 3 3 U 3 a ο ΕΗ W 3 Eh o CJ α CJ CJ Eh ca 3 Eh £ Eh U »Eh 3 ο 3 3 CJ Ω cj a Eh ΕΗ X EH Eh ΕΗ CJ Eh Cu i 3 ca CJ U (¾ 1 CJ CJ CJ or Eh £ 3 K 3 Eh CJ CJ κ υ u Eh CJ 1 CJ U 3 Εη i cj cj 3 3 Η Ο EH CJ CJ 3 ca υ CJ Éh CJ 3 3 3 3 H Ο Q Eh 3 CJ CJ 3 a U CJ CJ CJ 3 Εη Eh υ U CJ CJ 3 Eh Eh U Eh CJ 1-5 Eh 3 Eh O Eh XO Eh υ α u O o CJ CJ 3 1 Eh CJ% a CJ α 1 Eh CJ O CJ Eh EH a cj cj CJ CJ 3 O CJ CJ 3 Eh 1 3 CJ Eh 1 CJ 3 Eh eh a α O> 3 Eh Eh CJ CJ> 3 Eh ca 3 Eh X CJ 3 O 3 3 a 3 cj CJ CJ CJ EH Eh cj a 3 _ 3 H Eh 3 a O 3 CJ O C E C E C E C C E C C E C C E C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C CO Eh 3 Eh CJ 3 = O u O Eh = O E 3 Eh Eh = Eh = 2 υ Eh 3 a 3 = o 3 O 3 u CJ U Eh u 3 3 3 CJ CJ Q 3 Eh 3 EH 3 Eh U 3 υ O 3 H CJ Eh 3 cg CJ CJ CJ 3 a § EH CJ CJ CJ υ 3 υ u CJ 3 υ 3 Eh CJ CJ Eh CJ CJ CJ Cj Eh 3 o CJ U 3 a υ 3 < CJ Eh Eh u Eh, II CJ Eh Eh CJ Ω II EH Eh U H 11 3 Eh 3 y - 1 CJ Eh CJ 3 Eh II Eh O Eh CJ II Eh CJ Eh Eh || EH CJ Eh υ Ω ii CJ EH U 3 II Eh Eh Eh CJ II Eh Eh 3 CJ 3 II CJ CJ 3 EH II 3 EH II CJ Eh 3 Eh tu II 3 3 CJ CJ II CJ II CJ 3 α CJ á Eh 3 CJ II CJ II CJ II C II C II III C II III C II CJ CJ II CJ C C E C E C E C C E C C C C C C C C C C C C E (E) C (E) C (II) II 3 CJ V. CJ II EH CJ U 3 II CJ 3 CJ CJ W II 3 CJ EH II O CJ 3 EH II CJ E * O 3 Η II Eh CJ 3 CJ II CJ 3 U Eh II Eh υ CJ CJ &gt; II 3 EH CJ EH II CJ 3 CJ II Eh * CJ u Eh Ο II 3 Eh u 3 II Eh 3 (J EH II α J CJ CJ CJ> II cj 3 Eh Eh II CJ Eh EH CJ II CJ CJ CJ CJ Eh U II 3 CJ EH CJ Hl Eh O CJ Eh Hl 3 H CJ CJ 3 H 11 O 3 α H r-1 r-1 Ι Ι T T NO CO HO Γ- * co 00 144 The! Eh I I < 0 Επ EH Eh 0 Eh U EH EH Eh O Eh U Eh 0 0 0 0 < 0 Eh 0 M Eh < 0 U 0 0 &lt; 0 &lt; Eh Eh &lt; Eh Eh Eh 0 Eh Eh Eh U Eh Eh Eh < 0 Eh 0 EH < 0 &lt; 0 Eh U 0 < Eh Eh U < U Eh O < O o u Eh Eh S 0 Eh O O s s u u Eh Eh O Eh 0 < Eh Eh Eh Eh < Eh 0 &lt; Eh 0 Eh 3 Eh EH 0 Eh EH σ'oc. • or σ 3σ • P d o o irf 0 < 2 EH = EH 2 2 0 0 Eh = EH 0 0 0 Eh = 2 O 0 EH 0 2 = 0 ΚΪ EH 0 0 0 2 0 0 2 Eh 2 ictí EH O 2 0 Eh fà 0 Eh 2 2 2 2 2 0 0 0 0 Eh 0 u U 2 0 Ej 0 EH Eh 0 0 2 2 0 2 EH < 2 0 Eh EH 2 0 0 0 Eh 0 Eh < 0 0 EH 2 0 0 Eh 0 0 2 Eh 2 0 0 Eh 2 0 2 Eh 0 0 2 Eh 0 Eh Eh Eh 2 0 2 2 0 Eh 2 Eh U 0 EH 0 < &lt; &lt; 0 EH &lt; 0 Eh Eh 0 0 0 rtj Eh Eh Eh 2 2 0 2 Eh Eh 0 0 0 Eh Eh 0 0 2 Eh 0 0 Ej 0 Eh Eh 0 Eh 2 2 Eh Eh EH 2 0 2 0 0 O 0 0 2 EH Eh O Eh EH 0 0 Eh 2 Eh Eh 0 2 0 (N 0 £ h 0 <2 2 in Eh Eh C 0 Eh O Tf 0 Eh Eh 2 0 2 rH Eh 0 Eh Eh 2 2 2 2 0 Eh ϋ Eh 0 0 0 0 2 Eh <0 Eh 2 Eh 2 2 0 Eh 0 Eh Eh Eh Eh 2 0 Eh 0 Eh 0 <2 0 <0 2 0 0 0 0 0 <2 0 0 0 Eh < 0 2 2 <Eh Eh 0 2 0 0 2 0 2 Eh 2 i Eh 0 0 Eh 2 2 i 0 0 Έη 2 Eh 2 2 i 0 2 OD Eh 0 EH Eh 1 Eh 2 2 0 0 2 2 1 rH (CH2) m -CH (CH2) m -CH (CH3) or their functional derivatives. 3. A process according to claim 1, wherein the recombinant nucleotide sequence comprises the nucleotide sequence of Table 9 or functional derivatives thereof. 4. A process for the production of a pharmaceutical composition comprising the inclusion in said pharmaceutical composition of the substantially pure CD53 protein, the CD53 protein being present in a soluble form or in the form of an acceptable salt. 5. A method according to claim 1, wherein said substantially pure CD53 protein comprises the protein containing the amino acid sequence of Table 9 or its functional derivatives. A process according to claim 4, further comprising adding a pharmaceutical carrier. The method according to claim 4, further comprising adding a therapeutic agent. 8. An immunodiagnostic method, characterized in that it comprises the use of an anti-CD53 antibody or a CD53 nucleotide probe for the detection of cells of the hematopoietic lineage. A method according to claim 8, characterized in that said CD53 nucleotide probe is derived from the nucleotide sequence of Table 9. 146 10. An immunodiagnostic method, comprising the use of an anti-CD53 antibody or a CD53 nucleotide probe for the detection of hematopoietic neoplasms. A method according to claim 10, characterized in that said CD53 nucleotide probe is derived from the nucleotide sequence of Table 9. A method for the detection of antibodies against CD53 protein, characterized in that it comprises the use of the CD53 protein substantially or their functional derivatives in an immunoassay. 13. A method for the morphological identification of ill-defined cells comprising the use of an anti-CD53 antibody or a CD53 nucleotide probe to detect said cells. A method according to claim 13, characterized in that said CD53 nucleotide probe is derived from the nucleotide sequence of Table 9. Method for the production of monoclonal antibodies against the CD53 protein, other than MEM-53, HD77 , HI29, HI36 and 63-5A3, characterized in that the substantially pure 0D53 protein or its functional derivatives are employed in standard methods of producing monoclonal antibodies. 16. A method for producing the TLiSA protein, which comprises expressing a recombinant nucleotide sequence encoding the TLiSA protein. The method according to claim 16, characterized in that the TLiSA protein has the amino acid sequence of Table 3: TABLE 3: TABLE 3: TABLE 3: TABLE 3: d d d d d d d d d d d d d d d d d d d d d d d d d d d t d d 1 = - * -tf> d o 1 b &gt; &lt; - to u u < hto to < S- - &gt; • h- • d • u u < -tf H u cu i -> - d) - u d) _ < d d d U X < All rights reserved. the &gt; p-d • ν • &lt; • 1 J α < &gt; -H5O or d. -> ΙΟ &gt; d d &lt; 5 Δ d d tf &lt; h. M c3 uj < 5 d r- d hUUJ d d < • h - 1 • 1 - 1 •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• i O 1 &lt; d h-1-h * &lt; &lt; | U < 2: i h- d U < d d Ρ) ϋ < d cr d ce h- 1 á d d t &lt; LJ &lt; the -tf H · h · U- d u d d d < d μ-H &gt; · d o - U- d &lt; d-h-LJ U &gt; - or - • &lt; -tf • d LJ U X <i-1 d F d d d d d U U u. - i &lt; 2 &gt; Ι d h- Ο - < &lt; d • d &lt; d LU < z • &lt; O d d h- u < P.J or &gt; d tw d -tf F &lt; d u U-J d cr d < &lt; &lt; or &lt; RTI ID = 0.0 &gt; 2 d • F '&lt; • d • h - O - d - < F &lt; H / O F d &lt; 1). &lt; 1-4 d h- d d < d &lt; ! &lt; F * &quot; d d < Z 1 U F d d < • &lt; O Q "· &lt; 2 tj l · - - <r C h- < d = d Ι < 2 h to - LL ο O &lt; d d -tf d -tf &lt; The d-h-5- &lt; -tf d h -t t t - &lt; • the * b-> - * d &gt; • d F d d d t - d d h - F O d &gt; &lt; cc Î »d λ d- -tf + -tf 1 - &lt; &lt; &lt; d d < d UJ d &lt; d • d • < • 1- • d F b- -tf < P d -> d d - d - d d d d d u 1 to 1 d o d d d 1 d d 1 - tf - &lt; or &lt; 2 i -tf X h- d d i d> - • -tf • - < 1 • d • d < 5 z * -C X &lt; d d < d -tf -tf - - &lt; tf -. d H-d d H H-d Ι J- d d < Ο &gt; d 1- - &lt; t d 1 -> d d - -> b-I) 1 d 1 -c d II n 1 d i d d> 1 &lt; H 1 d -tf -tf> -) 1 1 d 1 d i d t II II Z 1 pu. 1 - &lt; to "tf w ir r- i d · < n d d II z - < z d &lt; K-to) • • • • • • • II II d d · < 1-methoxy-2-methyl-2 d d d d d P_l t d &gt; j &gt; - d II ui - &lt; -tf p II d 2 H> - P u. II d r &gt; d d II | • H o d to d &gt; CSKU ♦ P -j d v_, ♦ d d I &gt; t J d C t P P 1 d d d 1 M 5 Z 1 d p - < II a r - II X • b - d • d • P _j II | 1 d dt - &lt; II II d d d) t z &lt; H * H * tO -tf H II &lt; d d H to tj 5 o d d a! l • d • · < · - &lt; II h-d d il A d u d d d d d d H H n < Ι d 1) &gt; or a Ο &gt; d &lt; ) d-tf c j! H d 1- -tf H -tf Ι d &gt; II d Ο h- II · < • &gt; - * P II &lt; d cr o &gt; P u. 11 H-1-D-U-O-5-H-d-11-d-d-d-d-d- &lt; h-d d H &lt; K &lt; to • d cr • -tf> H •> -> u d · < H h- or &lt; w C &gt; d cr d U d -tf and ~ < to &lt; H - &lt; Z &lt; U H &lt; H- < UJ &gt; oc ♦ d • d • d d d u &gt; H3: &lt; to &lt; H d d < d d < &gt; &lt; X- &lt; X O d K h-d d cr d &gt; -c X d d < - &lt; d * d • d ♦ - d &lt; d σ d UJ d d d - < - &lt; d &gt; u cr d X d -tf or d < Η- or z o &gt; &lt; CO 1 d &gt; 1- d i 1- d d 1 d d d d d d d d d d d d d d d d d d e d · &Lt; 1 - &lt; Z t P - / d u < d d o Ι - < Ι -tf to -tf X Ο d o H- Ι b- Ο < 2 &gt; &lt; 2 • d • &lt; • d -tf> - cr-cr cr < w d &gt; h * · &lt; *. d d -tf KCl. d CL d cr P u. d &lt; d-tf d d &gt; d -tf -tf -tf -tf -tf -tf -tf to d • d • tf> - fH d * d x d UJ ♦> - u d d h -tf &gt; &lt; I-r- U. &lt; Z d O · &lt; 1 -tf - &lt; -CH 2 -CH (CH 2) d &lt; , d d d = 4 Q CS T C0 CO o o E d d μ- < • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • - t. d • -tf • d • d • t; r- tf or d · < d &gt; &lt; tf d tf d t o d d d - < Ι Ο d d fr- tf d h- 7i 1 I- d 1- d < P l · - p 1- V - P u p • • • d • 1- d d d P tf tf < d tf d! = d d 1 = tf Ι Ο d P 3: d tf d d P < t 5 d * d d t t d P * 3 d - d Ι tf o - - tf Ο d tf d d o - &lt; &lt; d H-d-h-d-h-d-h-d-d-d-d-3-d- d tf d u d tf d t t d d t t d d t t d d d d d t t t t t t t t t t t t t t t t t t t t t t t t t t t t tf d H &lt; X · - b - c P d d d d P * d tf - - < (d) tf d o d d t t t t t t t t t t t t t t t t t t t t t - the tf u d d tf d d tf tf I- - < H-d tf d -tf u tf tf H * d - tf d d u x o tf H H J - t • d • d - &lt; d u. H- &gt; &lt; tf P p d d H d P < d tf or d -c z u J- or H d < tf Ι P F "- H Ο d o &gt; d p tf d < P tf h- < • d • d • tf • tf h * - d d H O P - h * tf tf 1 - d d L- < M - - &lt; or t h ' d d - &lt; d Q) -d d> -t tf tf d m »1 · · < tf-tf &lt; &lt; d &gt; -5- &lt; / RTI &gt; • tf • d • u • d - d d tf d < d d 1- tf d tf - &lt; X H d y- K P < &lt; d P P d h- tf · < d d < b t - t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t d d H d d o o H d d d d j h h 1- 1- P α d w -tf 2 d d H * o a d d - - P d d d H- d d K- tf h- CO < tf H t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t tf h- < H &gt; - d U &lt; Ι - ~ tf Ι o d < Z Ο -d Ο d tf d Η-> - d Ι- or d < 1 "or Ι h · • tf H * | - P d Ο < H P h- tf d-d H d Ο tf rH Η H o ts &gt; CS T to CD C ÇN ro T ΙΟ r t · 4 Η Η Η Η Η Η Η -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 V V V V V 5-tfxv < H &gt; d $ X o d u x tf d o < or - &lt; 3 * &lt; u cr < . The invention relates to a process for the preparation of a compound of formula (I): K-1 or the &lt; The compound of claim 1 wherein R 1 and R 2 are as defined above. x tf o < x d - &lt; -tf Z &lt; &gt; H d • I- d &gt; b ~ h ~ < M d V tf vs d u or their functional derivatives. 18. The method of claim 16, wherein the recombinant nucleotide sequence comprises the nucleotide sequence of Table 3 or the functional derivatives thereof. A process for the production of a pharmaceutical composition comprising the inclusion in said pharmaceutical composition of the substantially pure TLiSA protein, the TLiSA protein being present in a soluble form or in the form of an acceptable salt. 20. A method according to claim 19, wherein said substantially pure TLiSA protein comprises the protein containing the amino acid sequence of Table 3 or its functional derivatives. 21. The method of claim 19, further comprising adding a pharmaceutical carrier. 22. A process according to claim 19, further comprising adding a therapeutic agent. 23. A method for the detection of antibodies against the TLiSA protein, characterized in that it comprises the use of the substantially pure TLiSA protein or its functional derivatives in an immunoassay. 24. A method for the production of monoclonal antibodies against the TLiSA protein, other than ACT-T-SET, characterized in that the substantially pure TLiSA protein or its functional derivatives are used in standard methods of producing monoclonal antibodies. 25. A method for inhibiting T-cell differentiation by IL-2, characterized in that the T cells are contacted with antibodies against TLiSA. 26. A method for producing the CD27 protein, which comprises expressing a recombinant nucleotide sequence encoding the CD27 protein. 27. A method according to claim 26, wherein the CD27 protein has the amino acid sequence of Table 5; 151 or u CD < or CD CJ Eh CA CD u CJ CD CD 3 E &lt; &lt; O A CJ Eh υ CD W &lt; CJ CJ CJ A CD U CD < 3 ÊH υ Eh U A CD o O J CD EH Eh 3 z CD CD U J 3 H 3 Eh Eh S U O < X υ O CJ O A α < &lt; Eh 3 Eh Eh < υ z CJ α Eh U W α Eh CD U i-3 EH CJ Eh A Eh CJ Eh CD < Eh Eh α υ < CA Eh Eh 3 O O O CD &gt; 3 s Eh Eh Eh W Eh α < CD &gt; The Eh CD CD Ω Eh EH CJ J CJ PS Eh < U Ω CJ EH CD Eh X Eh Eh Eh Eh U EH υ E < CD &gt; CD CJ &lt; eh O O < CJ A CD EH E1 CD «&lt; CJ &lt; X CJ O EH υ A 3 Eh O Eh t-3 CJ CD Eh < EH U CJ CD CD CJ &gt; U &lt; CD &lt; EH Eh CD U Z EH CD Eh CJ α or Eh W CD CD CJ CJ A CJ Eh «< &lt; Eh CD Eh CJ CD W E EH EH C E CD CD C E CD CD Eh 3 3 Z CD &lt;: &lt; W 3 z U &lt; ο σ CJ Eh < ο σ CJ EH CD CD Q Eh CD O &gt; Eh The CD O &lt; A Eh O O O A u Eh < C A υ EH υ Ω o z U < Eh A CD CD z CJ EH CD Eh CJ < &lt; &lt; H CJ CD CD C CJ Eh «! O A EH CD CD ο σ υ CJ CJ A Eh O CD o 0 < Eh U CD < CA CD Eh CD Eh 3: Eh < H &lt; CA U Eh, U Ω EH CD CD U &gt; 3 EH EH &lt; CD CD CJ EH A CD W EH O < Eh EH Eh CD &lt; CD &lt; CD 3 z CD CD Ω eh α α < ο σ CJ CJ CD ο σ CD CJ < u A EH Eh ^ Eh CA u z Eh CJ < X CJ u O Eh CA υ CD CJ Eh CJ CD < &lt; CA CJ A CJ U u z υ CD CJ Eh W CD CD CD CD < The CD Eh CJ CJ Pí Eh CD CD CD CD U CD U Eh Eh U Eh CJ Eh CJ CJ hí κί £ h CD CJ CJ C U α < CD C &lt; U &lt; CD W U CJ Eh CA o z Eh U < Eh < or &lt; Eh CD CD hhJ CD λ; CD CD 3 A CJ z u Eh B * < A CJ 2 &lt; 3 Z CD u u σ r-t H H CN R H H CN 03 V v V N N IA IA V E X o o o o o o o o o o o o o o o o o o o. Eh CJ 3 CJ A O · CD α α CD Eh CJ < 3 CD Eh CD Eh M CD CD CD 3 Eh O CJ Eh 3 3 CD Eh CD CD CD CD 3 CJ Eh CJ- < υ O O CJ A U CD EH 3 3 CD O < Eh α CD CD &lt; CD Eh CD Eh CD Eh CD Eh Eh CD < CD U CD CJ CJ A CJ CJ 2 CJ < CD 3 CD CD 3 - Eh * C ÇJ Eh CJ-α CD W CD CD CD α a CD EH < CJ 2 CD α 3 CD CD 3 &lt; CJ A CJ 3 O 3 CD M ptíl α α CD o α 3 3 3 Eh o Eh 3 z CD CD CD CD J &lt; CJ Eh CD O EH CD CJ CD 3 O CJ CJ A CD α O < O A C H 3 C H O E h < CJ α CD 3 CD EH X CJ 3 3 3 &lt; CA Eh CJ Eh CJ CJ ri < The α 3 cd α α Eh or Eh CD W or CJ CD CD O < &lt; CJ Eh 3 CD CD CD CD CD CD CD CD CD 3 3 3 EH 3 CJ ο α α Eh α 3 3 z α u Eh CD CJ u Eh Eh CJ 3 U 3 H α O 3 CJ 3 z υ α CJ CD 3 HU O CD CD CD O CJ CJ A α CD CD EH CA CJ Eh CD Eh 3 «J Eh CJ 3 CD 3 CD < H CJ CJ 3 CD &lt; A CJ CJ EH CD CJ EH CJ CD O 3 CD 3 Eh 3 Eh CD Eh EH X O o Eh CD CJ 2 or 3 O Eh CD 3 < tn Eh Eh CD Eh 3 z o O CJ CD CJ CD CD 3 α 3 CJ CD O CD O EH CD E- 3 CD CD 3 EH Eh 3 hj; Eh CJ 3 CD CD W CD CD 3 CD CD CD υ 3 < 3 EH Eh 3 3 CD W Eh CD 3 U cj σ U CD 3 Eh O Eh 3 υ U CD CD α CD 3 3 CJ z CD CD Eh 3 < O II CD Eh CJ CJ Eh Eh II < A α 3 3 CD CJ J II U CJ 3 CD EH CJ II υ 3 CJ CD Eh Eh II OAO 3 3 CD Eh A II CJ u CJ CD CD CD II CD 3 CJ CJ Eh Eh II Eh U α CD 3 O CJ Ω II U CJ 3 CD Eh O II CD - CD u CD υ O II 3 CA - 3 CD CD CD CD CD < II CD CD 3 CD CJ CD II &lt; EH * EH O α 3 r -H H rH r -r rr? CN σ CN The CD »OH» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »» »h h h h h CD 3 CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD EH Eh CD> Eh 3 S CD cd UJ CD CD 3 CJ <CD CD u O cj σ CD Eh 3 Eh CJ CJ 3 CD CJ CU CD Eh U 3 CD cd E E 3 cd CD 3 H CJ EH EH CJ CJ u U iJ CD α o Eh Eh Eh CJ cd EH O Ω Eh 3 O> CD U cd u <U 0, 3 cd 3 z Eh o Eh CJ 3 3 O O CD CD Eh Eh "CD CD Eh CJ CJ> 4 CD CD 3 CD 3 Eh CJ 1¾ CD cj CD EH Eh s Eh 3 inO cd CJ ο α or CD A Eh L ^ Eh Z CD CJ • or <2 cj CD o 3 rt &lt; 5 u Eh S Eh 3 &lt; / RTI &gt; 3 CD 3 v E 3 Eh X CD EH CJ z CJ Eh 3 3 CJ o O 33 cd OA CD CD 3 CD CD 3 A or O < A CD C 3 CD C 3 CD C CD CD CD CD CD 3 CD CD CD CD CD CD CD CD CD CD CD CD CJ CD 3 CD CD Eh CJ cd CD 3 CA CJ 3 CD CD 3 or 3 3 CD Ω 3 U 3 Z α 3 CD CJ 3 u CD u 3 z 3 CD CJ A CD 3 Eh CJ Eh 3 O α CD &gt; CJ α CD 3 O CD CD 3 Eh Eh CJ O U i-3 O CJ CJ A CJ CD CD Eh Eh CD 3 U Eh Cu CD CD 3 Eh 3 H i-1 r- H O H CN 152 or their functional derivatives. 28. The method of claim 26, wherein the recombinant nucleotide sequence comprises the nucleotide sequence of Table 5 or the functional derivatives thereof. A process for the production of a pharmaceutical composition comprising the inclusion in said pharmaceutical composition of the substantially pure CD27 protein, said CD27 protein being present in a soluble form or in the form of an acceptable salt. 30. The method of claim 29, wherein said substantially pure CD27 protein comprises the protein containing the amino acid sequence of Table 5 or the functional derivatives thereof. 31. The process of claim 29, further comprising adding a pharmaceutical carrier. 32. A process according to claim 29, further comprising adding a therapeutic agent. 33. An immunodiagnostic method comprising the use of an anti-CD27 antibody or a CD27 nucleotide probe for the detection of T cells. The method of claim 33, wherein said nucleotide probe of CD27 derived from the nucleotide sequence of Table 5. A method for the detection of antibodies against the CD27 protein, which comprises the use of the substantially pure CD27 protein or its functional derivatives in an immunoassay. 36. A method for the production of monoclonal antibodies against CD27 protein, other than 0KT18a and CLB-9F4, characterized in that the substantially pure CD27 protein or its functional derivatives are used in standard methods of producing monoclonal antibodies. Lisbon, July 15, 1991 RUA VtCTOR CORDON, 10-A 3. »1200 LISBOA