JPH06504186A - CD53 cell surface antigen and its uses - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] CD53 cell surface antigen and its uses The present invention is the subject of co-pending U.S. patent application Ser. No. 160, filed February 25, 1988. No. 416, a continuation-in-part application, co-pending filed July 13, 1989, U.S. Concurrently continuing in 1990, which is a continuation in part of patent application no. 379.076 This is a continuation-in-part of U.S. patent application Ser. No. 498.809, filed March 23.

L and Dan! scenery The basic method in the field of recombinant genetics is to generate two copies of Po’J(A)” mRNA. strand (ds) cDNA and then convert the double-stranded cDNA into a cloning vector. and expression in a suitable host cell. ds for cDNA Molecular cloning methods are described, for example, in Genetic n edited by Williamson. 1neerin, Mo1. Lp, 2. Academic Pres s, New York (1981), Williams' r The Pr separation and Screening of a cDNA C1 one BankJ, Prescott-edited ``Kidan...'', Academ ic Press, New York (1980) Maniatis rR ecombinant DNAJ, and Genetic E of 5telo et al. nnKeiku ■, Vol, 1. p, 15. Plencv+Press, Efstratiadis et al.'s Clo in New York (1979) ning of Double-Stranded No consideration in DNAJ It is.

A considerable number of factors influence the cloning of a particular gene, Strategies for loaning must be chosen carefully. Many cDNA clusters Common loning strategies include whole cells from the cells of the organism of interest. "r cDNA library, which is a collection of cDNA clones derived from mRNA" This includes building the .

Mammalian cells can contain up to 30,000 different mRNA sequences, e.g. The number of loans required to obtain small amounts of mRNA may be even greater.

Different expression vectors include bacteriophage λ, cosmids, and viral vectors. There are known methods for constructing eukaryotic genomic DNA libraries in vectors. Ru. Some of the commonly used methods are e.g. Mo1 of Maniatis et al. ecular C1onin: A Laborator Manual, C o1d Spring Harbor Laboratory Publishing, Co1d Spring Harbor, New York (1982). Ru.

Once the Getum cDNA library has been constructed, it can be It is necessary to isolate the host cells among thousands of host cells. cDNA light Many different methods have been employed to isolate target genes from libraries, and their There are various degrees of success. These methods include, for example, of a nucleic acid probe, which is a labeled +gRNA fragment with a specific nucleic acid sequence. Includes use. This method can be used to transform large numbers of mRNAs in a transformed bacterial host. When applied to DNA clones, colonies that hybridize strongly with the probe are It is expected to contain the target DNA sequence. Identification of clones is then performed, e.g. 5 itu hybridization/selection (Goldberg et al., Method s Enz mol, 68:206 (1979)), hybrid inhibition Translation method (Paterson et al. Ichigo 5 Sciences, 74:4370 (1977)) or directly Sequencing of NA (Maxam and G11bert, Procedurein s of the NationAcadem of 5 sciences, 74:560 (1977), Maat and Smlth.

Nucleic Ac1ds Res, 5:4537 (1978)) will be held.

However, such methods can only extract relatively low-abundance genes from cDNA libraries. It has major drawbacks when the objective is to clone a new mRNA.

For example, when using direct colony hybridization, the initial In the library population, the proportion is less than 1 in 200. It is very difficult to detect clones containing cDNA complementary to lllRNA species. It is. As a result, various methods to increase +5 RNA in total povinylase1 ( For example, size fractionation, use of synthetic oligonucleotides, differential hybridization (or immunopurification) have been developed, often to isolate low-abundance @RNA. It has been used for rowing. Such a method is described, for example, in Maniati, mentioned above. s et al., Moecula Con1: bato Manu Rainbow. Ru.

Many functional eukaryotic proteins have an original leader at their N-terminus. Alternatively, it exists in the form of a precursor molecule containing a signal sequence. These leader sequences binds to the cell membrane, attracts the remaining proteins through the lipid bilayer, and then The signal sequence is cleaved by a signal peptidase enzyme.

Therefore, this protein is released only after it has been secreted from the cell (e.g. insulin , serum albumin, antibodies and gastrointestinal enzymes), or if this protein is attached to cell membranes. function only after being immobilized on the outer surface of the antigen (e.g., histocompatibility antigen).

Cell surface antigens unique to mammalian cells are proteins that are fixed on the cell surface. This is a further example. In mammals, certain cells derived from bone marrow become lymphocytes. Once mature, the lymphocytes are distributed throughout the lymphatic system, including the thymus, pancreas, lymph nodes, and lymphoid aggregates. It is present in tissues and actively circulates through the blood and lymphatic systems. mature phosphorus There are two types of lymphocyte populations: thymus-dependent (T) IJ lymphocytes and thymus-independent (T) lymphocytes. It can be classified as a dependent (B) IJ lymphocyte. The T'J bulb moves into the thymus gland, where it It undergoes differentiated division and proliferation. In the differentiation process they are Thy-1, TLA% Distinct cells including gv-1, Ly-1, t, y-z, Ly-3 and t, y-s Expresses surface membrane alloantigens. As they mature, 1928 bulbs develop TLA antigens. and loses some of the Thy-1 antigen and gains histocompatibility antigen, recirculating 1 A membrane conformation is obtained that weakens the 978 sphere. This can be seen, for example, in Bier Edited by u dam ntals o In ud 5 “Saku 2nd edition, Spring r-Verlag, Berlins pp, 35-62 <1986) M Otal Koyo rActrvity of I@5ane described in Ce1lsJ has been done.

1928 spheres are indirectly involved in the formation of antibodies, and therefore their activity is solely a function of antibody titer. This required a more complex analysis of cell function than measurement. Somewhat due to this, Their importance in the development of immunological responses was not recognized until relatively recently. Ta. Mature 1928 spheres contain T helper cells, T suppressor cells, and T cell disorders. Markers for the identification of different population populations, including harmful cells synthesize and express unique patterns of surface membrane proteins that function as membrane proteins.

Each of these subpopinylation is critical in regulating the immune system (Mota above).

In humans, the functional and phenotypic heterogeneity of 1928 spheres is well recognized. . Two major subpopinilaceans are known: effector T cells; and regulators, including helper and suppressor T lymphocytes. Rater T cells. These two subpovinylation are heteroantisera, autologous determined by antibodies and monoclonal antibodies specific for cell surface antigens . For example, early in development, human lymphoid cells within the thymus are classified as CD classification 2 (CD2). It reacts strongly with a monoclonal antibody called The null antibody expresses an antigen called Tll that is weakly reactive with CD5. maturation process , these cells lose Tl1 (CD2) and are treated with monoclonal anti- The body acquires three new antigens defined by CD4, CD8, and CDI. Ru. As they mature further, these thymocytes react with the monoclonal antibody CDI. It initiates the expression of reactive cell surface antigens and is reactive with monoclonal antibody CD3. 3 antigens and then 2 expressing 74 (CD4) or T8 (CD8) Separate into 1 sub-popinilacean. Immunological response capacity is acquired at this stage, but , are not fully developed until thymic lymphocytes migrate outside the thymus (Mota ). In contrast to the majority of thymocytes, circulating TIJ lymphocytes contain Tl (CD5) and Tl (CD5). 3 (CD3) antigen. T4 (CD4) antigen is present in peripheral 1971 cells approximately. T8 (CD8) antigen is expressed in 20-30%, while present in 55-65%.

These two subpopulation cells are responsible for helper T cells and suppurative cells, respectively. Corresponds to lesser and cytotoxic T cells.

These cell surface antigens are useful for distinguishing between the 1973 bulb subpopulations. In addition to providing a method for activation and effector function of mature T cells, is important. TJi[IIF! Activation of the T cell receptor by its specific antigen In addition to binding to the open cell surface interaction between Twi vesicles and target or stimulated cells, It encompasses a complex process of action.

For example, CD2, the human T cell erythroid receptor, targets thymocytes and 1928 cells. binds to target cells (i.e. red blood cells) and thymic epithelium. This means that LFA- 3, a specific molecular antibody against CD2, a surface antigen widely distributed in humans. Happens through Gund. This phenomenon has long produced antibodies against sheep red blood cells. It has been used for the detection, assay, and purification of human cells; It forms the basis of the exam. This is explained by Zaalberg. It was first described in Te ■ Otori Lil: 1231 (1964). CD2/LFA- 3 interactions are also cytolytic target junctions (Hav et al., Nature 323:2 62-264 (1986)), and mixed lymphocyte reaction (Martin et al. It has been shown that L-engineering m3□lu:1110-185 (1983)) It is. Anti-CD2 monoclonal antibodies directly act through an antigen-independent pathway. can activate peripheral T lymphocytes (Meuer et al., 1L136: [197-90 6 (1984)), indicating a broader immune regulatory role for CD2.

1928 spheres are the main effectors of cell-mediated immunity and also helper cells. Due to the two knowledge that ruin is involved in the regulation of immune response as a suppressor cell, This greatly contributed to the practical application of clinical immunology to medicine.

The scope of this application includes protection against infection, prevention of disease through immune sensitization, organ transplantation, various mechanisms mediated by blood storage and immune system deficiencies and immunological mechanisms). Includes treatment of disease. Additionally, immunological techniques are used to measure hormones and drugs. It is often used in clinical laboratories as it is used regularly. clinical immunology For example, the Weirli collection, o　°　Fo　Vo　uvaes:　Vo　use　　　A　’ati　ns　 o mmunolo’ca Mt ods” wed ca Sc’e c, 4th Ed, Blackwell 5 scientific Pu blications, 0xford (19116) HBoguslaski Edited by C’n’ca m+loc m’st:’c’s Met od a d 'cat' ns, Little, Brown & Co,, B oston (1984); edited by Holborow et al., mmu'M' cine: A Cow eensiv Gui etoCi tea 1m+ 1uoo, 2dEd,, Grune & 5tratton, Lond on (1983): and Petersd.

rf et al m collection, a’son’s’eileso Intna Md’c’ , 10th ed., McGrav-Hill, New York Publishing, pp. 344-391 (19+13). Specifically, the immune system A more complete understanding of the mediating proteins is an important prospect in clinical immunology. .

To isolate cDNA encoding a mammalian protein such as those described above, Using animal expression libraries offers several advantages. example For example, a protein expressed in a mammalian host cell is I! talented and oh Subject to normal post-translation modifications. Normally transported to the cell surface via the endomembrane system. The proteins transported undergo a complete transport process. Mammalian expression systems also support intracellular transport. The mechanism of insertion and anchoring of cell surface proteins into membranes can be studied. make it possible.

“One common mammalian host cell, called the CO phantom cell, is a monkey kidney cell. , infected with a mutated viral vector designated simian virus strain 40 (SV40). It is formed by

This vector has functional early and late genes, but no functional replicating A starting point is missing. In CO5 cells, SV40? Vector containing I origin Any foreign DNA cloned in SV40T is replicated. This is due to the presence of the antigen in Cos cells. This foreign DNA is temporarily transferred to the cell D. nI is produced independently of NA.

A recent lymphokine cDNA isolated by expression in CO3 cells. A (long, G, G, et al., 5science 228:810-815 ( 1985): Lee, F. et al., Proceed'n's o the Nat ional Academ of Sciences USA 83:2061- 2065 (1986) + Yokota, T., et al. the Nat'ona Ac de+n of 5 sciences USA 83:5894-5898 (1986): Yang, Y. et al. 47 :3-10 (19116)), but in general, mammalian expression cDNA is rarely isolated from libraries. The main reason for this There are two reasons for this: First, construction of large plasmid libraries. Current techniques for -S: 161-170 (19a2)) is difficult to learn, and obtained by cloning techniques of phages (Huynh, T., et al., n+ DNACo1nVo, IAPactica r.

ash, Glover, D, M, (ed), IRL Press, 0 xford (1985), pp. 49-78) and the size of the library is approximately Things that don't match at all.

Second, one exception (long, G, G, et al., 5science 7Lw:81 0-815 (1985)), existing vectors are particularly sensitive to CO3 It is not compatible with high level expression in cells. With lymphokine cDNA The reported success of isolation of these cDNAs from expression libraries is particularly ease of use and does not imply general suitability of the method used. do not have. The lymphokine phase is very sensitive ((long, G, G, et al., Lee±a岨2JLi+810-815 (1985): Lee, F, et al. ,Proceedin'soft'aAeaea+oSc'en ces US 83:2061-2065 (1985): Yokota, T. , et al, oceedin's of the Nat'ona AcademSc 'n es US 83:51194-5898 (1986); Yang , Y. et al., Ekl 47+3-10 (1986)), Typically abundant and short (long, G, G, et al.) (1985); Lee, P. et al., tional Ac dem of 5 sciences USA 83:5894-5898 (1986); Yang , Y et al., Ce1l 47:3-10 C1986>).

Therefore, expression in mammalian hosts was previously limited to more conventional or loning methods. Thus, how to confirm the identity of the protein hooded by the isolated gene has been most frequently used only as For example, 5tuve et al., J. Vir. OL, 61 Eng. A: 327-335 (1987), Herpes simplex type II 33 Three strains of E. coli that have the ability to carry the glycoprotein (gB2) gene M13-based recombinant phage vector used to transform JMIOI Cloned by plaque hybridization. In this way you can simply Identification of proteins encoded by isolated clones and by transfection of Chinese hamster ovary (CIIO) cells. confirmed.

Regarding the gene encoding human placental β-glucuronidase, Oshima et al. Plaque for screening phage λgtll cDNA library Hypuridizeta 1 was used.

Oshima et al., Pocedin's of the National Academ o Sc’ences U, S, A, 84:685-689 (1987). Identification of isolated cDNA clones revealed that the SV40 late promoter Transfect CO5-7 cells with inserts cloned using This was confirmed by immunoprecipitation of the expressed protein.

Transient expression in mammalian cells has been previously determined by other screening methods. It has been used as a method to confirm the identity of isolated genes. Gerald et al. , Journal of General VD1 Tono “67:2fi95-2 703 (1986). Mackenzie, Journal of Biolo Teal Chemistry 26:14112-14117 (1986 ); 5eif et al., Gene 43:1111-1121 (1986); 0r kin et al., Mo1ecula and Ce1lular Bm and Seal 62-767 (105). These methods often require full length or over Identifying wrapping clones requires an inefficient, tedious, and expensive screen. It is necessary to repeat the process many times. Screens based on conventional fusion protein expression Leaning methods are inefficient and require large amounts of monoclonal antibodies. this Their shortcomings are compounded by the use of inefficient expression vectors, which This makes the protein expression level unsuitable for efficient selection.

It’s over! And The present invention provides a powerful new method for cloning cDNA encoding cell surface antigens. standard methods, efficient expression vectors, and especially for high-level expression in eukaryotic host cells. Methods for constructing cDNA libraries currently suitable for use, as well as isolated nucleic acids thereof Concerning otide sequences and their encoded products.

The highly efficient loning technique of the present invention enables the transient generation of antigens in eukaryotic cells. the antigen by expression and binding to an antibody-coated substrate such as a culture dish. The method of the present invention is based on the physical selection of expressing cells. Isolation and molecular cloning of any protein that can be transported to the membrane surface of a cell It is useful for

The method for cloning cDNA encoding a cell surface antigen of the present invention includes cDNA preparing a cDNA library; translating this cDNA library into a eukaryotic mammal; Preferably inserted into tissue culture cells, under conditions that allow for expression of cell surface antigens. culturing these cells with cell surface antigen-first antibody complexes. exposure to a first antibody or antibodies specific for the cell surface antigen such that formation of a cell surface antigen occurs. Subsequently, the cell surface antigen-first antibody-Kan2 antibody complex is formed. specific for the first antibody to cause binding to the substrate of cells expressing the surface antigen. Exposure of cells to a substrate coated with a second antibody and unbound cells It includes isolating from cells.

By the cloning method of the present invention, genes encoding the following cell surface antigens can be obtained. Isolation and molecular cloning of the genes was achieved: CD1a, CD1b,... CD1c, CD2, CD6, CD? , CD13, CDI4, CD16, CD1 9, CD20. CD22, CD26, CD27, CD211, CD31, CD w32a, CDv32b% CD33, CD34, CD36, CD37, CD38, CD39, CD40, CD43, CD44, CD53, ICA M, , LFA-3, FcRIa, FeRIb, TLiSa, and Leu 8 antigens. The nucleotide sequence of the gene cloned by the method of the present invention is The amino acid sequence of the protein encoded by it was determined. CD1 a, CD1b, CD1c.

CD2, CD6, CD? , CD13, CD14, CD16, CDI 9, CD2 0, CD22, CD26, CD27, CD28, CD31, CDv32a, C Dw32b%CD33, CD34, CD36, CD37, CD3g, CD39, CD40, CD43, CD44, CD53, IcAM, LFA-3, FcRI a, FcRIb, TLiSa, and Leufl. The cloned genes are also an object of the present invention.

Once a gene encoding an antigen has been cloned according to the method of the invention, it The genes can be expressed in prokaryotic or eukaryotic hosts and are not found in nature. The protein or parts thereof encoded by it in substantially pure form, such as produce parts. Another aspect of the invention provides substantially pure cell surface antigens, especially : CD1a, CD1b, CD1c, CD2, CD7, CD14, CD1 6, CDl9, CD20, CD22, CD27, CD2g, CDv32aSCD v32b% CD33, CD34, CD36, CD37, CD3g, CD40, C D44, CD53, ICAM, LFA-3, FcRla, FeRIb, T Regarding LiSa, and Leu8 antigens and their functional analogs and equivalents. do. CD1a, CD1b, CD1c.

CD2, CD6, CD? , CD13, CD14, CD16, CD19, CD20 , CD22, CD26, CD27, CD2g, CD31, CDv32a , CDw32b, CD33, CD34, CD36, CD37, CD3g, C D39, CD40. CD43, CD44, CD53, ICAM, LFA-3 , FcRIa% FcR1b, TLiSa, and Leu8 antigen primary amino acids The sequence has been determined. Therefore, the present invention also relates to these antigens and their functions. the amino acid sequences of their antigenic equivalents, and the nucleotide sequences encoding these antigens. Also related.

The present invention also allows the generation of very large mammalian expression libraries and production of large amounts of protein in animal host cells, resulting in efficient selection It also relates to highly efficient cDNA expression vectors. Specific implementation of the invention In embodiments, the cDNA expression vector contains a suppressor t RNA gene; SV40 origin: HIV Sitahito fused to the sequence from LTR no 60 to +80 Chimera composed of immediate enhancer sequence of cytomegalovirus AD169 Insert the promoter between the sublcer tRNA gene and the SV40 origin. a synthetic transcription unit containing substitutable NA sequences; a polylinker containing two BstXI sites flanking the a1 site; and a SV Contains 40 small 1 antigen splices as well as an early region polyadenylation signal.

A further aspect of the invention is that the HIvLTR is fused to the sequence from position 160 to position +80. A kit consisting of the human cytomegalovirus AD169 immediate enhancer sequence. Synthetic transcription unit used in cDNA expression vector containing mela promoter include. The small size and specific preparation of the sequences of the cDNA expression vectors of the present invention Nodes are highly efficient complex molecules in host mammalian tissue culture cells such as CO3 cells. make it possible to manufacture products. Additionally, this vector has a short replaceable NA top segment. Using a polylinker containing two oppositely oriented tX1 sites separated by and the use of highly efficient oligonucleotide-based cDNA insertion strategies. enable.

In another aspect, the invention provides two identical... The BstX1 site includes a vector that contains a short substitutable Separated by NA fragments. Another aspect of the invention is the polylinker described above. be.

A further aspect of the invention is to insert a synthetic NA oligonucleotide into the vector. This synthetic oligonucleotide is linked to the desired cDNA. gives a terminal sequence identical to the short, replaceable NA fragment of the bright polylinker. and the resulting CDN with the synthetic NA oligonucleotide terminal sequence. The A segment was preliminarily removed from this vector by a short replaceable NA fragment. oligonucleotides, including insertion into the polylinker of a vector that has been removed. Relating to leotide-based cDNA insertion methods.

When preparing a cDNA library according to the present invention, many tumors have macrophages. cells and lymphocytes are deeply infiltrated, and therefore this tumor is commonly effective transcriptional source of macrophages or lymphocytes instead of tumor cell lines. It has been discovered that it can be effectively used as a base. Accordingly, in other aspects, the invention provides , tumor cells for preparing cDNA libraries used by the methods of the invention. cells, especially human tumor cells.

Another advantage of the powerful selection system of the present invention is that it eliminates the need to orient the cDNA insertion. There is no point. By the method of the present invention, such as λgtlQ and λgtll Library construction efficiencies similar to those described for standard phage vectors Furthermore, the clones obtained according to the method of the present invention are easy to replicate. There are further advantages.

The immunoselection techniques of the invention can also be monoclonal or polyclonal. Allows efficient use of antibodies in relatively low absolute quantities. The method of the invention is extremely Very quick.

Generally, there are three rounds to isolate the target cDNA clone (one is from the Few cycles of immune selection and release are required.

Therefore, the method of the invention involves cloning genes encoding cell surface antigens. Sometimes enabling efficient use of labor and materials. As mentioned above, this method Cell surface antigens associated with mammalian T lymphocytes (e.g. CD1a, CD1b, CD1c, CD2, CD6, CD? , CD13, CDI4, CD16, CD 19, CD20, CD22, CD26, CD27, CD2 [1, CD31, CD w32a, CDw32b% CD33, CD34, CD36, CD37, CD3 8, CD39, CD40. , CD43, CD44, CD53, ICAM, LF A-3, Fc[ila.

The genes encoding FcRIb, TLrSa, and I, eu8 antigens were successfully It is often used as a cloning method.

The purified genes and proteins of the present invention can be used for immunological diagnosis and immunotherapy. These include immune-mediated sensitivities in animals, including humans. diagnosis and treatment of infections, diseases, and abnormalities. These may also be used with other antibodies and It can be used to identify, isolate, and purify antigens. Such diagnostic and Therapeutic uses encompass other aspects of the invention. Furthermore, the substantially pure The protein may be prepared as a drug or pharmaceutical composition for therapeutic administration. obtain. The invention further relates to such agents and compositions.

ward'shiυW bile Figure 1. Nucleotides of vector 013 1 Nucleotide numbers 1-589 are pM Derived from Bl origin (pBR322ori), nucleotide numbers 590-59 7 is derived from 5acl+linker (ACCGCGT), nucleotide number 59 8-799 is derived from the synthetic tyrosine suppressor tRNA gene (supF gene), nucleotide numbers 800-947 are the remainder of the ASW LTR fragment. (Pvulll to Mllul), nucleotide number 948- 1500 is derived from the human cytomegalovirus AD169 enhancer, and Reotide numbers 1501-1650 are FilvTATA and tat response elements Nucleotide numbers 1551-1716 are derived from piLNXAN polyline. It is derived from Carr (U!!! I I I to Xba), and the X cleotide number is 17. 17-2569 is derived from the splice and polyaddition signals from psV, Nucleotide I'2570-2917 is derived from the SV40 origin of replication and is either Q511 or ri figure ■), and nucleotide number 2911! -2922 is derived from polylinker It is derived from piVX, which is the remaining part of the original R1 site.

Figure 2. Nucleotide of CD2 cDN insert 1 nucleotide number in right bracket Amino acid numbers are shown on the left within the arcs. Asparagine-linked hydrocarbon (CHO ) and the predicted transmembrane (TM) sequence are shown. has been done. The amino acid sequence is numbered from the putative cleavage site of the secretion signal sequence. I'm wearing a number.

Figure 3. DM8 solid CDMII vectors allow for highly efficient expression in both mouse and monkey cells. Mutant polyomaviruses selected for this purpose include deletion mutants of the early region. fruit Qualitatively all human immunodeficiency promoter regions cDNA insertions with homologous sequences of time-type promoters and with eukaryotic promoters. This is replaced by insertion of the bacteriophage F promoter between the sites.

Arrows indicate the direction of transcription.

Figure 5. 1 to 3M vector' The direction of transcription is indicated by an arrow. Bs tX I restriction region sandwiching the cloning site The endonuclease site is shown.

Figure 6. There are seven nucleotide I segments of the pjH3M vector. 1 Residues -587 are from the pBR322 origin of replication, and 588-1182 are from the ML3 origin. point-derived, 11113-13114 is derived from 5upF gene, 1385-2238 is derived from 5upF gene, Chimeric cytomegalovirus/human immunodeficiency virus promoter derived, 223 9-2647 is from a replaceable fragment, 264g-3547 is a plasmid derived from pSV2 (splice and polyadenylation signals), and 3541 1-3900 is derived from the SV40 viral origin.

Figure 17. CD40 nucleotide 1 1 bean yu 1 fumiya xri The present invention provides a novel method for cloning cDNA encoding a cell surface antigen, and and methods for constructing cDNA. The present invention also provides specific cDNA expression vectors. components of the vector and the nucleotide sequences isolated by this method. or the substantially pure cell surface gene encoded by its cDNA segment. Methods using antigens and isolated nucleotide sequences and encoded products Regarding.

In the following description, the various methods referred to are those in the art of recombinant genetic engineering. It is well known. Materials presented in publications and other referenced well-known methods is incorporated herein by reference in its entirety. Describes common recombinant DNA techniques. Standard references include: I) Arnell, J. ε, et al. Ce1l Biolo, 5 scientific American Book s, Inc., Publishing, Nev York, N. Y. (1986); Levi n, B, M,, L tanshi■, John Wiley & 5ons Publishing New York, N. Y. (1985): Old, R. W. et al. f Gene Mani ulation: An l t oduction to Genet'cbLyoai■u, 2d edition, Universe City of California Press, Berkeley, CA (191111); and Manfatfs, T. et al. onin: Laborator Manual, Co1d Spring Flabor, NY (1982).

The term "cloning" refers to cloning a specific gene or other DNA sequence into a vector molecule. means the use of recombinant techniques in vitro. of the desired gene How to get DffA fragment for successful lonning, part 7 lags A method of attaching the DNA molecule to a vector molecule, allowing the DNA to replicate the hybrid NA molecule. methods for introducing target genes into host cells that can It is necessary to use a method to select clones with

The term rcDNAJ refers to the action of RNA-dependent DNA polymerase (reverse transcriptase). Therefore, it refers to complementary DNA or co+:’-DNA produced from RNAm type. Taste. Therefore, a "r cDNA clone" is a clone that is complementary to the RNA molecule of interest and refers to a double helix DNA sequence carried within a vector.

4r cDNA Library” is a complete cDNA library containing all the genes of one organism. A refers to a collection of recombinant DNA molecules contained as an insert. Such cDNA Libraries can be prepared using art-recognized methods, such as those described by Maniatis et al. Mo1ecula C1onin: A Lab's 1 phantom l - 11 It may be prepared by the method described. Generally, the first step is to clone a specific gene. RNA is isolated from the cells of an organism whose genome is desired to be isolated. present invention For this purpose, mammalian, especially human cell lines are preferred. even more preferable are the human abscess cell line HPB-ALL and the human lymphoblastoid cell line JY. be Alternatively, RNA can be isolated from tumor cells from animal abscesses, and preferably from human isolated from a tumor.

Libraries can thus be prepared, for example, from human adrenal abscesses, but any tumor Can be used.

The immunoselection cloning method of the present invention extracts total RNA containing a specific gene from cells. Preparing a cDNA library by extracting, complementing the RNA from synthesis of a series of double-stranded cDNA fragments, and these eDNA A fragment is introduced into mammalian cells in tissue culture. mammal cells under conditions that allow expression of proteins (i.e., cell surface antigens). maintained. The obtained cells are treated with a first antibody or antibody primer specific to the cell surface antigen. exposure to a group of As a result, a cell surface antigen-first antibody complex is formed. It will be done.

This complex is coated with or bound to a second antibody specific to the first antibody. expose to quality. Cells expressing cell surface antigens bind to substrates (cell surface antigens - first (because an antibody-second antibody complex occurs). Connected cells are separated from unconnected cells. Separate from the cells.

k” 1 wind for people The guanidine thiocyanate/CsC1 method is preferred for isolation of total RNA. even better Preferably, GuSCN/guanidine thiocyanate/LiC, a modification of the CsC1 method. This method is superior in terms of processing power and speed. To put it simply: , 25% LiCl (0.45 micron film) for 1 ml of the desired mixture. 0.5 g of GuSCN dissolved in 0.58 μl and and 20 μl of mercaptoethanol. Centrifuge the cells and shake the pellet ( 1 s for cells up to %5 x 107 dispersed in wall soil by flicking) Add 1 of solution. The resulting mixture was stirred in a polytron until it became viscous. Shear. For small scale samples (108 cells or less), 1.5 sl of 5.7M CsC1 (RNase-free; pH 8, 1 hM for each 1 sl of EDTA) Add 1.26 g of CsC1) and layer 2 ml of the shear mixture on top of the RNase. Overlay with free water and centrifuge 5w5s at 50k rpm for 2 hours. large scale For the sample, 25i1 was layered on 12 ml of CsC1 in a 5W28 tube. and centrifuge at 24k rpm for 8 hours. Sterilize the contents by connecting them to a vacuum flask Carefully aspirate using a clean Pasteur pipette. Once it passes the CsC1 interface Once done, use the tip of a pipette to scrape up the band around the tube and remove the wall of the tube. Prevent layers from falling. Aspirate the remaining CsC1 solution. Take the pellet in water ( (avoid re-dissolving). 1/10 volume Na0Ac and 3 volumes EtOH and centrifuge the resulting mixture. If necessary, resuspend the pellet in water. (e.g. at 70°). Adjust concentration to 1 mg/ml and freeze. small RNA (For example, 5S) will not fail. For small amounts of cells, reduce the volume and use a gradient. Overlay GuSCN with RNase-free water on the plate (sedimentation dilutes the RNA). (It is inefficient when doing so.)

22 r1 Kae Otori I PolyA" RNA can then be prepared, preferably by the oligo dT selection method. Simply stated, a disposable polypropylene column was washed with 5M NaOH and and then rinsing with RNase-free water. 1mg total each Approximately 0.3 sl of oligo-dT cellulose per RNA (finally pack the bed) ). Oligo dT cellulose was added to 1 sl of 0. IM in NaOH approx. Either resuspend 0.5 sl of the dry powder and transfer it into the column, or transfer it to the previously used column. Prepare by infiltrating the column with O, IN NaOH (column can be reused many times) ). Add several times the column volume of RNase-free water to make the pFI neutral. Wash and rinse with 2-3 sl of loading buffer. Next column bed Remove the sterile lSm1 using 4-6 ml of loading buffer. into the tube. Warm total RNA to 70°C for 2-3 minutes to remove RNase. Add LiC1 to 0.5M from empty stock and add oligo d in a 15ml tube. Combine with T-cellulose. Then vortex or stir for 10 minutes. the product Pour into the column and add 3 sl of loading buffer followed by 31 ml of intermediate wash. Wash with cleaning buffer.

a+ RNA using 1.5 sl of 2mM EDTA, 0.1% SDS, sw Elute directly into the ss tube. Discard the first 2-3 drops.

The eluted mRNA was precipitated by adding 1/10 volume of 3M Na0Ac. and fill the tube with EtOH. This is then mixed and cooled at -20°C for 30 minutes. and centrifuge at 50k 1m for 30 minutes at 5°C. Pour out the EtOH and Air dry the tube. Transfer the mRNA pellet to 50-100 ul RNase-free Resuspend in water. Approximately 5 ul in MOPS/EDTA/formaldehyde at 70°C Lyse on 1% agarose gel without RNase to check quality. Run it with

Q...Kozoku Next, cDNA is synthesized. Preferred methods of cDNA synthesis are Gubler and Hoffman (Eclipse, LL: 263-269 (1982)) It is a variation of the law. The method is carried out as follows: a. First strand. 4ug +* Place the RNA in a microdose tube, heat to approximately 100°C for 30 seconds, and place on ice. Cool it down. Adjust volume to 70 ul with RNase-free water. The following Add: 20ul RTI buffer, 2ul RNase inhibitor ( Boehringar 36u/ul), lul's 5ug/ul oligo dT ( Collaborative Research), 1.5ul of 20mM dXTP’s (ultra pure), lul’s LM DTT, and 4ul’s RT-LX ( Life 5science, 24 u/ul). The resulting mixture was heated at 42°C for 4 Incubate for 0 minutes. Inactivate by heating (70° C. for 10 minutes).

b, second strand. 320 ul RNase-free water, 80 ul RT2 buffer 5 ul of DNA polymerase l (Boehringer, 5 U/ul ), 2u1 RNase H (BRL 2 u/ul). Incubate at 15℃ for 1 hour. Incubate for 1 hour at 22°C. 20ul of 0.5M EDT A, pi (add a, o, extract with phenol, add NaCl to 0.5M) EtOH precipitation with 20% linear polyacrylamide (carrier) g/ml and fill the tube with EtOH. in microwave tube Centrifuge for 2-3 minutes at Mix well and centrifuge for an additional 1 minute.

C. Adapter. Resuspend the precipitated cDNA in 240ul of TE (10/1) do. 30ul of 10x low salt buffer, 30ul of 10x low salt buffer, 3 0 ul of IOX binding reaction adduct, 3 ul (2.4 μg) of kinase treatment 12-m ar adapter, 2 ul (1.6 g) of bovinease-treated 8-mar adapter, and 1u177) T4 DNA ligase (BioLabs, 400u/ul , or Boehringer, I Weiss unit/ml). Ru. Incubate overnight at 15°C. Phenol extracted as above and E tOH precipitation (no extra carrier needed this time) in 100ul of TE resuspend.

1iix1-based cDNA of the present invention of cDNA fragment in vector For use with expression vectors (see below), the Bs tX on the vector A segment of oligonucleotide with a terminal sequence corresponding to one site is inserted into the Ligate to the desired cDNA fragment. Fractionate the obtained fragments pool. A preferred method is carried out as follows: 20% KOA, 2mM EDTA, lug/ml l:thBr solution, and 5% KOAc.

Prepare a 2mM EDTA, tug/ml EthBr solution. 2. f+s Add 20% OAc solution to the back chamber of the small gradient marker. I can do it. Transfer the solution to the front chamber from the tube connecting the two chambers. - Remove air bubbles by tilting back. Passage between chambers Close and add 2.5 ml of 5% solution to the front chamber. If the previous centrifugation Therefore, if there is any liquid left in the tube, pour the 5% solution to the end of the tube and remove it. After that, return it to the chamber. Place the device on a stir plate and turn the stir bar as fast as possible. Set it so that it moves freely, and open the stopcock that connects the two chambers. , then open the front stopcock. KOAc polyaromer-5vss tube Fill from the bottom with solution. Overlay the gradient with 100 μl of the cDNA solution. Ba Prepare a Lance tube and centrifuge the gradient at 50k rpya for 3 hours at 22°C. do. near the bottom of the 5W55 tube to collect fractions from the gradient. Make a hole using a butterfly injection set (remove the 1uer bubble) , three 0.5! II fraction, then six 0.25 ml fractions in a microfuge. Collect in tubes (approximately 2z drops and 11 drops respectively). linear polyacrylamide to 20 μg/ml and fill the tube to the top with EtOH. The further fractions are precipitated with EtOH. After cooling the tube, place it in a microwave for 3 minutes. Centrifuge for minutes. Mix and re-centrifuge for 1 minute.

Rinse the pellet with 70% EtOH (re-centrifuge). Do not dry completely. each Resuspend 0.25 ml aliquot in 10 μm TE. 1% agarose mini gel Pour 1 ul on top. Contains no material smaller than the first 3 fractions and lkb. Pool the last 6 fractions.

Suppressor tRNA plasmids can be propagated by known methods. present invention In a preferred method, the 5upl'' plasmid is a second plasmid. Selected in a non-sublessing host containing p3, this p3 is amber mutated. In addition, ampicillin and tetracycline drug resistance elements (Seed, 1 983). The p3 plasmid is derived from PRI, has a length of 57 kb, and is safe. This is a non-glucobye shrimpsome that is maintained at a constant temperature. This plasmid amplifier Since syrin resistance causes a high rate of loss of function, the amp' plasmid is usually used in p3-containing strains. cannot be used. Even selection for only teuW resistance does not affect amp+tet resistance. As good as your choice. However, naturally occurring chromosomal suppressors Mutation of tRNA is an unavoidable background in this system (approximately 10- 9 frequency 111i:) is presented. Arises from naturally occurring suppressor mutations Colonies are usually larger than those resulting from plasmid transformation. Supplement Surplasmids typically contain 12.5 kg/ml of amp and ? , 51t g Selection is made in LB medium containing tet/ml. For large plasmid preparations In this case, M9 casamino acid medium containing glycerol (08%) was used as a carbon source. bacteria can grow to saturation.

Vector DNA can be isolated using known methods. The method shown below is for saturation of 1 liter Suitable for plasmids obtained from cells.

Cells in a 1 W/T J6 bottle are centrifuged at 4.2 k rpra for 25 minutes.

Resuspend in 40 ml of 101II101II at pH 8 (pat a soft surface (). Add 1lhl of Q, 2M NaOH, 1% SDS until it becomes clear and viscous. 40 ml of 5M KOAc, pH 4,7 (2,5M K Add OAc, 2.5M HOAc) and shake slightly vigorously (until the lumps are 2-3cm thick). until it reaches a certain size). Centrifuge for 5 minutes at 4.2k rpm (in the same container).

Pour the supernatant through a coarse cotton cloth into a 250 ml bottle. bottle of isopropyl alcohol Fill it with Centrifuge the J6 bottle at 4.2k rpm for 5 minutes.

Drain the water from the bottle and rinse gently with 70% EtOH (until the pellets are 7 lug ). Turn the bottle upside down and remove the remaining EtOH with Kimwive. do. Resuspend in 3.5ml Tris base/EDTA2Qd/10mM . Add 3.75 ml of resuspended pellets to 14.5 g of CsC. 0.75m1 Add 10 mg/+1 ethidium bromide and mix. VTfllO tube into solution Fill it with Centrifuge at a speed of 80 rprx for at least 2.5 hours. ll1l syringe and monitor with visible light using a 20 gauge or smaller needle to extract the band. blood Cut the tip of the tube and insert it into the tube about 3+ am below the band with the bevel of the needle facing up. Insert the needle upward at an angle of about 30' to the needle (ie, as shallow as possible). van Pour the contents of the tube into the bleach solution. The extracted band Place in a 13sl 5arsteat tube. IM NaC to the top of the tube Fill with 1 saturated n-butanol and extract. If a very large amount of DNA is obtained Extract again. Aspirate the butanol into a trap containing 5M NaOH (ethyl (to decompose sium). Add approximately equal volume of 1M ammonium acetate to DNA (Skirt bottle). Add approximately 2 volumes of 95% ethanol (skirted bottle). IOK Centrifuge in J2-21 at rpm for 5 minutes. Be careful with pellets 2 <70% ethanol Rinse with water. Dry using a cotton swab or freeze dryer.

Vectors used for cloning can be prepared by known methods.

In a preferred method, 20 Mg of vector is first added to 100 mg of vector in 200 μl of reaction solution. Cut with a unit BstXI CNew York Biolabs) and Cut at 50° C. overnight in a temperature-controlled water bath (ie, circulating water bath). 5 above Make two KOAc 5-20% gradients in a W55 tube. Each chi Add 100 μm of digested vector to the tube and incubate at 50K rp for 3 hours at 22°C. Centrifuge at m. Test the tube under 300 nm UV light. the desired band is It has moved 273 lengths of the tube. The band is dragging forward This means that the gradient is overloaded. 1ml syringe and Remove the band using a 20 gauge needle. Add linear polyacrylamide 3 Precipitate the plasmid by adding a volume of EtOH. 50μl TE resuspend in linked using a constant amount of vector and increasing amounts of cDNA. Let the binding reaction take place.

Based on these trial ligation reactions, large scale ligation reactions are initiated using known methods.

Typically 1-2 Mg of cleaved vector is required for the entire cDNAm product. .

Adapters can be prepared by known methods, but crude adapters can be prepared at a concentration of 1 Mg/μl. resuspend at once, add Mg5Oa to 1 hM, and add 5 volumes of Etol. Preferably, the precipitation is carried out by

Rinse with 70% EtOH and resuspend in TE at a concentration of 1 Mg/μl. Kinase For treatment, take a 25 μm resuspension adapter and add 3 μl of IOX Kinase. Add processing buffer and 20 units of kinase and incubate overnight at 37°C. Bate.

The preparation of buffers in the above preferred method according to the invention will be clear to those skilled in the art. It is. For convenience, a suitable buffer composition is shown below: Loading buffer 1: 0.5M LiC1, 10mM) Lis pH 7.5 , 1mM EDTA 0.1% SDS.

Intermediate wash buffer: 0.15M LiCl, 1011M Tris pH 7.5, IIIM EDTA 0.1% SDS.

Rtl buffer: 0.25M Tris pH 11.8 (8.2 at 42°C), 0.25M MCl, 30mM MgCh, Rt2 buffer y: 0. IM) Lis p■7.5.25mM MgCl2.0.5 MKCl, 0.25mg/it BSA, 50mM DTT.

taX low salt: 6011M011M Trisyl S, 60mM MgCl2.50a+ M NaC1, 25mg/ml BSA, ? hM Me.

iox-linked adduct: 1mM ATP, 20+*M DTT, 1mg/ml BSA, 10mM spermidine, 10X Kinase treatment 7y: 0.5M) Squirrel pH 7, 5, 10mMAT P, 20mM DTT, 1hM spermidine, 1mg/ml BSA 10 0 Peng M MgC+2゜ (Margin below) The term "vector" is derived from a plasmid or bacteriophage, in which DNA segment into which the DIiA fragment can be inserted or cloned means child. A single vector contains one or more unique restriction sites and can be used for cloning. Autonomous in a limited host or vehicle organism where the sequence is reproduced It can be reproduced. Therefore, the term "rDNA expression vector" refers to an autonomous element After the addition or integration of the NA sequence into the genome of It means any element of autonomy that can be replicated at any time. That kind of thing comes from NA Current vectors include modern plasmids and phages.

However, preferred for the purposes of the present invention is the simian virus strain 40 ( SV40)-derived vectors. SV40 is 28M pavovavirus with a molecular weight of dal, and a circular virus with a molecular weight of 3Mdal. double-stranded DNA, which contains the entire genome of the virus. I'm here. The entire circular DNA molecule is closed by this single-stranded small covalent bond. The nucleotide sequence has been determined. Fjers et al. Nature 273:1 13-120 (1978) + Reddy et al., 5science 200:49 4-502 (1978).

SV40 viral DNA is available in large quantities and is associated with various viral functions. Genomic regions are precisely located according to this detailed physical map of DNA.

Fiers et al., Reddy et al., supra. The SV40 viral genome increases asexually. Reproduces during reproduction or as an integral part of a cell's chromosomes, and plays a role in genome reproduction and development. There is currently a wealth of information available.

Also preferred for the purpose of the present invention is a single-chain bacteriophage called M2S. It is an archage cloning vehicle. This M2S is a closed ring DNA genome of approximately 6.5 kb. Has a nom. One advantage of using M2S as a cloning vehicle is , the phage particles released from infected cells are complementary to the cloned DNA. Contains homologous single-stranded DNA on only one side of the main strand, thereby Can be used as a template for DNA sequencing analysis.

Even more preferred for the purposes of the present invention are pil13, piH3M and and CDM8, which are American type culture vectors. Collection (ATCC), 12301 f’arklavn Drive, OI) iH3 deposited in Rockville, MD208S2 is AT Deposited with CC on February 24, 1988, accession number is ATCC67634. .

piH3M was deposited with ATCC on February 24, 1988, and the accession number is ATCC It is 67633. CDM8 was deposited with the ATCC on February 24, 1988 and received The consignment number is ATCC67635.

The term "tissue culture" refers to the further differentiation or differentiation of cell structure and/or function. Maintenance or growth of animal tissue cells in vitro to enable storage and storage means. "Primary tissue cells" are homogeneous cells that perform the same function in one organism. These cells were taken directly from povinylation, which is made up of cells. For example, this Synthetic cells such as these are treated with trypsin, a proteolytic enzyme, to separate individual primary cells. It grows well when separated into fibrous cells and plated at high density in a culture dish. Primary cells in tissue culture Cell cultures resulting from the proliferation of are referred to as "secondary cell cultures." Most quadratic thin The vacuole divides into finite multiples and dies. However, a few secondary cells can go through a "crisis period" after which it can multiply indefinitely, creating a continuous Form a "cell line". Cell lines often contain extra chromosomes and usually other points This is also abnormal. The fact that these cells are permanent is a feature they share with cancer cells. It is a sign.

Cell lines suitable for use as tissue culture cells according to the invention include the cell lines designated rcOsJ. Includes a monkey kidney cell line. cos cells contain functional early gene regions was transformed with SV40 DNA lacking the viral DNA origin. It is a cell. The cos cell clone M6 is particularly suitable for use in the methods of the invention. It is.

Mouse rfOPJ cells are also suitable for the purposes of the present invention, and these cells NIH3T3 cells transfected with origin deletion DNA. cDNA is The host tissue culture cells of the invention are introduced by any method known to those skilled in the art. Tran Spherectomy can be, for example, protoplast fusion, spheroplast fusion, or can be performed by the DEAE dextran method (Sussman et al. ” ■Li: 1641-1643 (1984)).

When performing spheroplast fusion, one preferred method is 5andri-Go ldrin et al., Mo1. Cel old o, l near 43-752 (1981) The following modified method is based on . To put it simply, darkness consists of, for example, six fusions. To obtain one set, 10 hl of cells in broth are required. amplifiable plasmid Cells containing are grown in LB to OD600=05. Spectinomine Add up to too ug/+11 (or add chloramphenicol to 150 (add up to ug/ml).

Continue incubation for to-ts hours with shaking at 37°C.

(Cells were incubated in specti/mycin or chloramphenicol medium. If the water is kept on for a long time, it will begin to dissolve. ) 100+ al of culture. OOOrpm Centrifuge for 5 minutes (JA14/GSA rotor, 250ml bottle). ). Drain well and transfer the pellet to 5 ml of cold 20% sucrose, 50 mM Resuspend in bottle containing Tris-[ICL pFIB,0. 5 on the ice Incubate for minutes. 2*1 cold 0.25M EDTA pFIB, 0 and incubate (water bath) for 5 minutes at 37°C. Place on ice and put under the microscope Examine the conversion rate to spheroplasts. In the flow hood, cool 20μl Gradually add DME/10% sucrose/IQmM MgCh (dropwise , approximately 2 drops per second). Remove the culture medium from the cells plated the previous day in a 6cm dish C5 0% confluence), add 5 ml of spheroplast suspension to each country. dish Place it at the tip of the tubular carrier inside the packet centrifuge to be wiped. Preparation of up to 6 dishes at once is possible. Dishes can be stacked on top of each other, but three-tier stacking is Not recommended as the feroplast layer often ruptures or separates after centrifugation. stomach. Centrifuge for 10 minutes at 1100Ox. The force is based on the turning radius to the bottom plate. Then plan for summer. Carefully aspirate the liquid from the dish a 1.5-2 ml 50% (w/ v) PEG 1450 (or PEG 1000) 150% DME (serum (none) into the center of the plate. If necessary, spread the PEG over the entire plate. Rotate the pipette tip around the pipette to ensure it spreads evenly and radially. Transfer from After adding PEG to the last dish, stand all dishes on their respective lids. so that the PEG solution collects at the bottom. Aspirate the PEG. to promote fusion A thin layer of PEG remaining on the cells is sufficient. The residual layer is washed away with a washcloth. , and cell viability may be better than if PEG clumps were left behind. P From 90 seconds to 120 seconds (PE01000) or from 120 seconds after contact with the EG solution For 150 seconds (PE01450), add 1.5i1 DME (no serum) to the center of the dish. Pipette into the tube. The PEG layer is washed away radially by DMH. tilt the plate and aspirate. Repeat DME wash. Contains 15 Mg/ml gentamicin sulfate. Add 3 ml of DME/10% serum. 4-6 in incubator Incubate for an hour.

Remove the medium and remaining bacterial suspension, add more medium and incubate for 2-3 days. cuvate. If you wash the cell layer too much to remove the PEG, many of the cells will In many cases, no substantial effect can be obtained because of the removal of The second DME wash removes fine particles. If the vesicles are left for a few minutes, most of the spheroplast layer will spontaneously emerge. death It is preferred to simply wash and separate the layers in complete medium at 37°C.

The PEG solution is preferably prepared by dissolving a new bottle of PEG at 60°C and adding 50 ml. Using a centrifuge tube, pour approximately 50a+1 volume into a pre-weighed bottle. It can be prepared from This aliquoted PEG is stored at 5°C in the dark. new bot To prepare the sample, measure the weight of the amount, remelt it, and add the same amount of DME (without serum). Added.

If necessary, adjust the pH with 75% Na bicarbonate solution and sterilize by filtration. Bacteria. The resulting PEG solution has no appreciable harmful consequences. It can be stored for up to 3 months in Murosho.

The protein encoded by the cDNA clone is expressed and used for subsequent immune selection. transfected host cells to increase the absolute number of cells available can be cultured according to the present invention. For suitable methods and media for this purpose , is well known to those skilled in the art, taking into account cell type and other commonly considered variables. be. For example, CO3 cells were treated with 10% calf serum and gentamicin sulfate. can be cultured in Dulbecco's Modified Eagle's Medium (DME) supplemented with Tran Transient expression of infected cells is typically performed 48 to 72 hours post-transfer. can be expected during transfection. However, as is clear to those skilled in the art, This period will vary depending on the host cell type or cell line used and cell culture conditions. obtain.

Immunoprecipitation, plotting, and and cDNA sequencing can be performed by convenient methods well known to those skilled in the art. . For example, C1ark et al., T in I, Vol. II, The immunoprecipitation protocol of pp. 155-167 (1986) is suitable. . The sine method, Northan method, or other plot analysis methods well known to those skilled in the art may be used to determine f Well-known methods such as the method of Lu et al. (Edan 18:271-277 (19g2)) can be used with hybridization probes prepared by. cD NA sequencing was also performed by Sanger et al., Proc. Natl., Acad. ScL剋174:5463-5467 (1977) Nodideoxynucleotides It can be carried out by well-known methods, including methods.

Antibodies used according to the invention may be polyclonal or monoclonal. . These can be used alone or combined with other polyclonal or monoclonal antibodies used as a method of the present invention to produce the desired antibody or antibodies or antigens. Immunoselection of cells expressing . Antibodies or antibodies for use according to the invention Methods of preparing such fragments are well known to those skilled in the art.

Standard references for general principles of immunology include Klein, J., I. mmunolo: T e 5cie ce of 5elf-Nonse f D’serimination, publisher John Wiley & 5on s, New York (19g2); edited by ennett, R, et al., Utsuno no. c Rib L”Decoy 1 Fallen 喡匡扛”■u山城□工1” Top, Dimensio’n 1o lo iea Anal 5ess Publisher Plenum Press.

New York (1980); Caa+pbe11. A,, -Mon oclonal Antibody Technology”, Burden, Edited by R, et al., aborator Tea ni ues in Bioche+ 5ist and Molecular Bio o, Vol, 13, Published There is a company Elsevere, Amsterdam (f9114).

The term "antibody" refers to antibodies capable of binding an antigen, such as Fab and F(ab)2. , is meant to include complete molecules and fragments thereof. polyclonal anti The preparation of the antigen of interest or its After immunization with the fragment, it can be derived directly from the blood of the desired animal pen. similarly , monoclonal antibodies were prepared using well-known methods (Kohler et al., ur. J., mmuno It can be prepared using Roasted: 292 (1976). For the purposes of this invention, The use of monoclonal antibodies is preferred.

For immunoselection according to the invention, target cells are exposed to antibodies specific for surface antigens. Tissue culture host cells are harvested from host cells that do not express the target antigen. Cells are isolated by scattering them onto a substrate coated with body-specific antibodies.

This technique is called "panning" and is well known to those skilled in the art. , for example, Mage et al., J, n++*u o, Meth, li: 47- 56 (1977), and 1Vysocki and 5atOx Poc, N atl, cad, c゛k゛Rek L■:2844-21148　(1978)il 1m is marked and teed.

Panning according to the method of the invention may be performed as follows.

8. Antibody-coated dish. 6hm plate for bacteriology Falcon1007 or similar damage, or 10c+ like Fisher 8-757-12 An o-dish may be used. Sheep anti-mouse affinity purified antibodies (e.g. C ooper BioMedical (Cappell)) in 50 M Tris ■ Dilute to 10 ug/i11 with C1 pH 9.5. 3sl per 6cm plate Add 1011 pieces of radish to a 10cm dish. Leave it for about 1.5 hours, then transfer to another plate. ．． Let stand for 5 hours, then transfer to another plate. Play) 3x 0.15 NaC 1), a washing bottle is convenient for this), lag/ml BSA Incubate overnight in 3 sl of PBS containing PBS, aspirate and freeze again. Ru.

b. Panning. Place the cells in a 1 m dish at 60°C. Aspirate the medium from the dish and add 2 sl of PB S/0.5 sM EDTA/0.02% azide was added and the dish was Incubate for 30 minutes at °C to detach cells from the dish.

Triturate the cells vigorously with a short Pasteur pipette to remove the cells from each cell in the centrifuge tube. Collect. 2.5 (2 (10K g)) and centrifuge for 4 minutes (5 important do). 0.5-1.0 ml PBS/EDTA/Azide 75% FBS 7 luxuries Incubate both for 30 minutes. Add equal volume of PBS/EDTA/Azide and supernatant by PBS/EDTA/Azide 72% FiC of 3i1. aspirate. 0. Remove cells with 5 sl of PBS/EDTA/Azide, Antibody containing sl PBS/EDTA/Azida 15% FBS Pass 100 micron nylon mesh (Tetko) through a plate coated with Add aliquots by pipetting. Benefits from 60+im dishes up to 2m Add the cells to one 60 mm dish coated with antibody. 1-3 hours at room temperature put. Dish with PBS/S% serum or by gentle washing with medium. Remove excess unattached cells. Normally, 3sl should be washed 2 or 3 times. It is sufficient to

C1 old rt supernatant. ) Ijrt, J. Mo1ec. Bio+. 25:36 5-369 (1967) is as follows. 0 ．． 4sl of 0.6% SDS, 10mM EDTA banished plate Add to the top.

Leave for 20 minutes (1 minute is sufficient if there are virtually no cells on the plate). stomach). Pipette the viscous mixture into a centrifuge tube. 0. 1 sl of 5M NaCl Add, mix and place on ice for at least 5 hours. Keep the mixture as cold as possible , the quality of Hirt appears to improve. Centrifuge for 4 minutes and extract the supernatant with phenol. Carefully remove the material (twice if the initial interface is not transparent), then add 10ug of linear Add polyacrylamide (or other vehicle) and fill the tube to the tip with EtOH. However, it was precipitated and O. Resuspend in 1 sl. 3 volumes of EtOH/Nao Add Ac, reprecipitate, and resuspend in 0.1 sl. Preferably after Transform into MC1061/p3 using the high efficiency protocol described above. D.N. If the A volume exceeds 2z of the component cell volume, the efficiency of transformation decreases. 5x However, the number of colonies given is the same as in the case of 2.5% (the efficiency is halved).

This aspect of the invention involves the use of "blockers" in the incubation medium. It is preferable that The blocker blocks the presence of non-specific proteins, protea. cross-linking of the enzyme, or antibody, with antibodies present on the substrate or on the surface of the host cell; or destroy it to ensure that false positive or negative results are avoided. Ru. The selection of blockers substantially improves the specificity of the immunoselection process of the invention. obtain. For example, the same class or subclass used in the immunoselection process ( isotype), a large number of nonspecific monoclonal antibodies (e.g., IgG, Ig G2A, IgGm, etc.) can be used as a blocker.

The concentration of blocker (typically 11-100 u/ul) maintains adequate sensitivity and Moreover, it is important to prevent unnecessary interference.

Additionally, the buffer system used for incubation has a blocking effect. It will be appreciated by those skilled in the art that the It is well known.

The group of cells to be panned for those expressing the target cell surface antigen is first It is separated from the cell culture dish in the absence of trypsin (harvested). Next, The cells can be polyclonal or monoclonal, specific for the antigen in question, or are exposed to a strategy 1 antibody specific for the 7 ami IJ- of the relevant antigen.

In this first step, a single antibody, or a group of antibodies, may be used and selection is made for the target antigen. Depends on the nature, its expected frequency, and other variables obvious to those skilled in the art. host cell Target antigens expressed on the surface form antigen-antibody complexes.

The cells are then placed in a culture dish, filter disc, etc. with a second antibody or antibody. The group is placed in close proximity to a pre-coated substrate. This second antibody specific for the antibody, the selection of which is specified by the animal that produced the antibody in, for example, This is a matter well known to those skilled in the art. For example, if the first antibody is produced in mice, The second antibody is specific for mouse immunoglobulins and is produced in goats or sheep. can be done. Cells expressing the target antigen contain the antigen, the first antibody, and the second antibody. It attaches to the substrate via the complex formed between them. Next, remove the attached cells by washing. can be separated from non-adherent cells. DNA encoding the target antigen, )IiN, J. Molec, Biol, ifi:365-369 (1967). from adherent cells by well-known methods such as the method. This DNA is further fused. into E. colt or other suitable host cells for repeated mating and selection. Transform to obtain the desired degree of concentration.

Typically, the first round of immune selection involves selecting a family of antigens to which the target antigen belongs. A first panel of antibodies specific for an epitope or group of epitopes common to use. This is sufficient to significantly reduce the number of clones for later iterations. Ru. Normally, repeating this twice is sufficient, but if The number of times may vary. This is followed by a single first antibody or antibody that recognizes only the target antigen. may perform a single selection using a first group of antibodies.

"Substrate" means a solid surface to which antibodies can bind for immunoselection according to the invention. Ru. Well-known suitable substrates include glass, polystyrene, polypropylene, and There are strands, nylon, and other materials. formed of such materials or Use coated tubes, beads, microtiter plates, bacteriological culture dishes, etc. Can be used. Antibodies can be bonded covalently or by adsorption through amide or ester bonds. may be covalently or physically attached to the substrate by well known methods. person skilled in the art Many other suitable substrates, and methods of immobilizing antibodies onto them, are It is knowledge. Alternatively, such substrates and methods can be validated using only routine experimentation. obtain.

Selection of host tissue culture cells for use according to the invention preferably involves panning. Antibodies used for recognize antigenic determinants on non-transfected cells This should be done in such a way as to avoid situations where this happens. Therefore, CO3 cells are is suitable for transient expression of surface antigen of mouse WOP. It is a cell. Among the latter, WOP 3027 cells are more preferred. WOP Virtually any antibody can be used in cells. This is a combination of mouse antibodies and mouse This is because cross-reactivity with antigenic determinants on the cell surface is rare.

The insert size of the recombinant DNA molecule maximizes the likelihood of obtaining the entire food sequence. should be selected so that Pre-determine the optimal insert size for a specific gene Various methods by which the determination may be made are known to those skilled in the art.

vector and cDNA Vectors suitable for expression of cDNA in mammalian tissue culture cells are well known in the art. can be constructed by law. An expression vector containing the SV40 origin is an object of the present invention. It is suitable for The vector contains a naturally occurring or synthetic origin of transcription and a 5V May contain a 4G early region promoter. More suitable is human cytomega This is a chimeric promoter consisting of a lovirus immediate promoter sequence. various "Enhancer sequences" can also be used with 5v40 vectors. these are , for example, Banerjl et al., Ce1l p: 299-308 <1981) : Lev: n5on et al. Germany Uxa 2M: 568-572 (1982 ); and Conrad et al., Mo1. Ce11. Biol, i:949- 965 (19+12).

Insertion of cDNA into the vector of the present invention can be carried out, for example, by using terminal transferase. This can occur due to homopolymer tailing. However, cDNA activation at the 5′ site A homopolymer route to the insert inhibits expression in vitro and in vivo. It can be stopped.

Therefore, the same cleavage of the reversed gyrus separated from the segment on the NA can be replaced with a short It is preferred for the purposes of the present invention to use Preferably BstXI restriction Such a reverse identical cleavage site using an endonuclease is cDNA synthesis oligonucleotides to provide the same terminus as the replaceable segment. can be used in parallel with the code. In this method, cDNA cannot bind to itself can be attached to the vector. This makes it possible to use both cDNA and vectors in the most effective way. can be used efficiently.

Another embodiment of the invention provides the above-described efficient method for facilitating insertion of cDNA into a vector. This is an oligonucleotide-based method.

The piH3M vector of the invention is preferred and contains the endonuclease site in reverse orientation. use. Although this vector may contain the SV40 origin of replication, the more preferred form contains the M13 origin. This vector containing the M13 origin is under its control allows high level expression in CO5 cells of coding sequences placed in Also, The small size and specially positioned array of the lasmid allows it to deliver high levels of Reproduction becomes possible.

“Cell surface antigen” refers to a protein that is transported to the cell surface through the intracellular membrane system. Taste. Such antigens usually contain hydrophobic amino acids present in the lipid bilayers of membranes. Anchored to cell surface membranes through acid-containing carboxyl-terminal domains, biological and its effect as an antigen. Antigens such as T-lymphocyte antigens can be used in the present invention. The method is particularly suitable for gene cloning. But all cells cell surface antigens can be cloned according to the present invention. Additionally, the cell surface typically contains For example, proteins that are not expressed are enriched for fixed cells that express intracellular antigens. By using fluorescence-activated cell sorting (FACS) to cultivate Cloning may be permitted.

"Substantially pure" refers to all antigens of the invention or encoding these antigens. refers to all genes, which are essentially each derived from another antigen or gene. or commonly found in nature, and as such not found in nature. Free from other contaminants present in non-contaminated form. "Functional derivatives" are child “fragment,” “variant,” “analog,” or “chemical derivative.” means. A "fragment" of a molecule, such as all of the antigens of the present invention, is a ``fragment'' of a molecule. Ribebutide sabse nod means. Such ``mutants'' of molecules are or a naturally occurring molecule substantially similar to its 7 fragments. molecule An “analog” of a non-naturally occurring molecule that is substantially similar to the entire molecule or a fragment thereof means molecule.

Fragments, variants, analogs, and/or chemical derivatives of antigens and other Fragments, variants, analogs, chemical derivatives, and/or antigens are the amino acid sequences in one molecule are substantially the same, i.e., at least about 50% If there is homology and if both molecules have similar biological activity, They are said to be "substantially the same." A nucleotide sequence and another nucleotide sequence both sequences are substantially the same, i.e. the first nucleotide sequence is the same as the second having at least about 50% homology to that encoded by the nucleotide sequence Fragments, variants, analogs, chemical derivatives, or anti- a fragment encoding the original and also encoded by the first nucleotide sequence; The variant, analog, chemical derivative, and/or antigen is a second nucleotide. fragments, variants, analogs, chemical derivatives, and and/or has a biological activity similar to that of the antigen. It is said that it is the same. Therefore, if two molecules have similar activities, they can be separated. even if one of the children contains additional amino acid residues not found in the other. as used herein, even if the sequences of amino acid residues are not the same. considered to be a variant of In the sense used herein, a molecule usually means "Chemical derivatization" of another molecule when it contains additional chemical moieties that are not part of the molecule. It is said to be the body. These parts are responsible for the solubility, absorption, and biological half-life of the molecule. It can improve the period etc. These moieties reduce the toxicity of the molecule or Side effects may be eliminated or reduced. Regarding the parts that can mediate such effects, For example, eminton's Par■ceutic S'c, 16th ed, Mack Publishing Co, Easto n, Penn, (198G).

Similarly, "functional derivatives" of the genes of all antigens of the present invention are "flag derivatives" of the genes. ``ment'', ``variant'', or ``analogue''; molecules that can be “substantially similar” in sequence and have similar activity. code.

antigens, fragments, variants, analogs, and/or chemical derivatives and other Antigens, fragments, variants, analogs and/or chemical derivatives if the latter has at least about 25% of the biological activity of the latter, then It is said to have a "sexuality". Biological activity is an action or mechanism characteristic of living organisms. function or process. Biological activity also affects antigens, fragments, and variants. , analogs, and/or chemical derivatives induce the production of antibodies. survival processes, such as biological activity exhibited when artificially introduced into objects, including regeneration, extension, or application to in vitro or non-natural systems. I can see it. Antigens, fragments, variants, analogs, and/or chemical derivatives may have one or more biological activities. Biological activity is specific to that activity. can be detected or measured by a method or assay. similar to the biological activity of the antigen For functional derivatives that have biological activity, those that are specific to that activity and can be understood by those skilled in the art contains at least about 25% of the biological activity of the antigen as measured by well-known assays. Must have activity.

Substantially pure antigens expressed by the methods of the invention can be obtained by radioimmunoassay (RIA). ), enzyme-linked immunosorbent assay (EIA), and enzyme-linked immunosorbent assay (ELIS) A) can be used in immunodiagnostic assays well known to those skilled in the art, including A). Main departure Substantially pure proteins of the present invention can be used in soluble form, alone or in other forms of the present invention. antigens, or other agents such as lymphokines and monokines, or drugs for the treatment of immune-related diseases and disorders in animals, including humans, in combination with can be administered.

Examples of deficiencies that may benefit from treatment with substantially pure proteins of the invention. For immunodeficiency diseases, immediate hypersensitivity, asthma, hypersensitivity pneumonitis, immune complex diseases, pulse tubulitis, systemic lupus erythematosus, chronic rheumatoid arthritis, immunopathological kidney disease, acute sexual and chronic inflammation, hemolytic anemia, platelet abnormalities, plasma and other cell neoplasms , amyloidosis, parasitic diseases, multiple sclerosis, Guillain-Barre syndrome, acute and subacute muscle paralysis, myasthenia gravis, immunoendocrine disorders, and tissue and organ transfer. There is a rejection of the plant. All of these are edited by Petersdorf et al. The mouth described in ne’sfntena Med’c’n, supra. 1feir, supra, HBoguslaski et al., supra; and Ilolbor, supra. See also ow et al., eds., supra.

When used in immunotherapy, the antigens of the invention may be labeled with a therapeutic agent, or Cannot be labeled. Examples of therapeutic agents that can be conjugated to antigens of the invention for immunotherapy include include radioisotopes, lectins, and toxins.

The dosage range for administration of the antigens of the present invention is determined to produce the desired immunotherapeutic effect. Although the amount is sufficient, it may cause unwanted side effects such as unnecessary cross-reactions and hypersensitivity reactions. Not many enough to cause it. Generally, the dosage used depends on the patient's age, symptoms, and gender. , and vary depending on the severity of the disease. counterindicat fons) (if present), immune tolerance, and other variables will also determine the appropriate dosage. affect. Administration is by injection or parenterally by gradual perfusion over time. obtain. Administration may also be by intravenous, intraintestinal, intramuscular, subcutaneous, or intradermal injection. It can be.

Preparations for parenteral administration may be prepared in sterile aqueous or non-aqueous solutions or suspensions. , and emulsifiers. Examples of non-aqueous solvents are propylene glycol, poly Ethylene glycol, vegetable oils like olive oil, and ethyl oleate There are injectable organic esters such as Aqueous carriers include water, alcohol solutions and aqueous solutions, emulsions, or suspensions, saline and buffered Contains media. Parenteral injection vehicles include sodium chloride solution, Ringer's Bud dextrose solution, glucose and sodium chloride solution, lactated Ringer's solution, or There is fixed oil. As an intravenous vehicle, based on Ringer's dextrose etc. There are liquid and nutrient replenishers, electrolyte replenishers, etc. For example, antibacterial agents , antioxidants, preservatives and other additives such as inert gases may also be present.

Such preparations, and the manner and methods of making them, are well known, e.g. If Re5into’sPharmaceutical5science, The antigen of the present invention described in 16th ed., supra, also has the antigen Lymphokines, monokines, and may be prepared in combination with other antigens or other agents, such as drugs. medicine The product is used for the treatment of immune-related indications in animals, including humans.

Although the antigens of the invention can be administered alone, they are preferably administered as a pharmaceutical composition. It is. Compositions of the invention contain at least one antigen or a pharmaceutically acceptable salt, together with one or more acceptable carriers and optionally other therapeutic agents. Ru. "Acceptable" means that the drug or carrier is compatible with the other ingredients of the composition or This means that it is harmless to the patient. Compositions include oral, nasal vaginal, topical (buccal) and those suitable for intravaginal or parenteral administration (including sublingually), intravaginally, or parenterally. The composition is , preferably in fixed dosage form, prepared by methods well known in the pharmaceutical art. can be done. Such methods combine the active ingredient with a carrier which constitutes one or more accessory ingredients. Including combining with a. Generally, compositions include the active ingredient in a liquid carrier or uniformly and intimately bonded to a finely divided solid carrier or both. and, if necessary, by shaving the product thus formed. Manufactured.

The orally administered pharmaceutical compositions according to the present invention each contain a certain amount of active ingredient. It may take any suitable form, including capsules, cachets, or tablets. powder or granules can also be used in aqueous or non-aqueous solutions, or oil-in-water emulsions, or water-in-oil Solutions or suspensions in type emulsions are possible as well. The active ingredient is also porous It may be provided as a lozenge, lozenge, or paste.

The present invention has been described above, but the present invention can be further understood by referring to the following examples. be fully understood. These examples do not in any way exceed the scope of the invention. It is not a restriction.

(hereinafter referred to as aftermill) Example ■ Cloning and cloning of human CD2.

cDNA vector-i)+3 Inserting a synthetic transcription unit between the suppressor tRNA gene and the SV40 origin By doing so, pisV (Little et al., 1. B'o, M0 engineering i: 4 A cos cell expression vector was constructed from 73-4811 (1983)).

The transcription unit is a human site fused to the +80 sequence from HIV LTR-67. Chimeric promoter containing immediate encoder sequence of megalovirus AD169 It was composed of Immediately downstream of LTR+80, there is a 350bp staff y-( Insert a polylinker containing two 7'11 sites separated by a stuffer. In order to place a unique rainbow part on the side of the BstX1 part and cut out the insert. It could be used for. On the downstream side of the polylinker, there is a splatter of SV40A antigen. The early region polyadenylation signals from psV2 and psV2 were placed. Baek The nucleotide sequence of the protein is shown in FIG.

c! lA library "-'s As mentioned above, BPB-A RNA was prepared from LL cells. PoIJA from total RNA by oligo-dT selection “RNA was prepared. Maniatis et al. Laborato Manual, above. Gubler and Hoffman (5ml 1-20% potassium acetate containing 1mM EDTA for 3 hours at SOk rpm) The mixture was fractionated by centrifugation through an umum gradient. A fraction of 0.5+wl was added to the curved part of the tube. It was manually retrieved using a syringe or winged needle inserted just above. Linearly Addition of polyacrylamide (Straus S and l/arshavsky, cgJl 37:8119-901 (1984)), then 20ug/ml was precipitated with ethanol. Pool both parts containing cDNA larger than 700bp. and ligated into the gradient-purified BstXl-digested piH3 vector.

Once the ligated DNA has been made reactive using the following protocol, CO MC10 61/p3: The desired strain was plated in a line on an LB plate. next On day one, a single colony was placed in 20 μl of TYM broth (hereinafter referred to as (prescription). Midlog phase (ODsee approx. 0.2 Grow the cells to -0.8) and pour into a 21 flask containing 10 hl of TYM. Stir vigorously until it grows to 0.5-0.90D, then grow again in the same container for 5 Diluted to 00+*1.

When the cells grow to 0Dsas 0.6, place the flask in ice water and cool quickly. Shake gently as shown. When the culture was cooled, at 4.2k rpm Centrifuged for 15 minutes (J6). Pour off the supernatant and shake the pellet gently on ice. The mixture was resuspended in approximately 100 μl of cold TfB I (described below).

Then, in the same bottle, the pellets were spun again at 4.2k rpm for 8 minutes (J6). I was concerned. Pour off the supernatant and shake the pellet gently over water. Resuspend in 20ml cold TfBII. 0.1 to 0.5e177) Separation Place the portion in a pre-frozen micro hikojicove and freeze in liquid nitrogen. The cells were tied and stored at -70'C. To transform, remove the aliquot and just lyse. Thaw at room temperature until thawed and placed on water. Add DNA and stand on water for 15-30 minutes Leave to incubate at 37°C for 5 minutes (6 minutes per 0.5ml aliquot). I did it. Then, dilute the suspension containing DNA 1=10 with LB and transfer it to the plate or were allowed to grow for 90 minutes in peonies subjected to antibiotic selection. Alternatively, heat pulsed traits The transformation mixture was plated directly onto antibiotic-containing plates. This antibiotic-containing The plate was coated with a thin layer (4-5 ml) of antibiotic-free LB agar just before the plate. ) was injected.

Media and buffers: TYM: 2% Baato-T ryptone), 0.5% yeast extract, O, LM NaCl 1,105M Mg5O, (added before autoclaving). TfB I: 30mM OAc, 50xM MnCl2.100mM KCL, 10mM CaCl2.15% (v/v) glycerol o TfB II: 10mM Na-MOPS% pH 7.0.75 MM CaCl 2.10 mM KCl, 15% glycerol.

Panning from the washing bottle instead of mouth PBS of CN clone by annin 0. Wysocki and 5a except that the dishes were washed with ISM NaCl. to (oc, t, ca Sc’, UA 75:2844-2848 ( 197 g)) l: Bacterial culture dish (Falcon 10 07) coated with affinity-purified sheep anti-mouse IgG antibody Prepare for panning by adding 1 mg/ml BS to unreacted sites. The cells were inhibited by incubation overnight in PBS containing A. The plate is usually It was prepared in large batches and stored frozen after aspiration of PBS/BSA. first screenplay In the training, 246c1 dishes containing CO3 cells at 50z confluence were andri-Goldrin et al., Mo, Ce1io, lnia 43-752 (1 The protoplast fusion was transfected by the method of 981). 72 of fusion After hours, cells were washed in PBS/1mM EDTA/0.2% sodium azide. Separation was achieved by incubating for 30 minutes at 37°C. Pool the separated cells. ascites at a 1:1000 dilution, but Cold-containing monoclonal antibodies as commercially available reagents at concentrations suggested by and resuspended in PBS/EDTA/S% fetal bovine serum. Leave it on the water for 1 hour After that, cells were diluted 1:1 with PBS/EDTA/Azide and treated with 2% Fic. Laminated onto lGm1 PBS/EDTA/Azide containing oll400.

After centrifugation (400xg, 5 minutes), carefully aspirate the upper groove and remove a small amount of the pellet. If) PBS/ED DIN A15%0) Resuspend cells in 3 ml of FBS. Distributed into panning plates containing 15% FBS in PBS/EDTA. Then, Wysocki and 5ato, Proc, 1Jat1. CAD, Sci , USA 75:21144-Za4B (1978). The plates were processed so that the Epi7-mu DNA was transferred to Hirt (Mu Mo1 ．． from adherent cells using the method of The cells were collected and transformed into MC1061/p3.

two and two Supplemented with 10% calf soak and 15 ug/ml gentamicin sulfide. Culture CO5 cells in Dulbecco's modified Eagle's medium (DME/10% calf serum). Rho2M6 cells were grown. the density as much as possible without damaging the cells too much. The day before transfecting into 6 cm dishes from stock plates held elevated. , cells were separated at a ratio of approximately 1:8. Gentamicin as above, and 10 % NuSerum (Collaborative Re5search) also 15coves of modified Dulbecco's medium (IMDM) containing either fetal bovine serum. ) T cell lines were expanded in .

50% confluence in a 15717129176cm dish of COS for COS cells were treated with 10% Nuserul (Collaborative R e5earch), 400ug/ml DEAE dextran, 10uM loroquine diphosphate, and DME or [M Transfection was carried out with 1.5 ml cocktail consisting of DM medium. 4 o'clock at 37°C After a period of time (or sooner if the cells appear weak), transfer the transfection Remove the fusilan mixture and treat cells for 2 min in PBS with 10% DMSO. I understood. Sussman and Milman, J 4:1641-1 643 (1984). Cells were then returned to DME/10% calf serum and incubated at 48 It was allowed to develop for 7z hours.

′　Northern　and sign T cells were labeled by lactoperoxidase treatment, lysed, and C1ark and and Einfeld (eukctei [, Vol, Il, pp, 15 5-167 (1986)), a commercially available goat anti-mouse IgG agarose was used. Immunoprecipitation was performed using sub beads (Cooper Biomedical). C O3 cells were transfected by the DEAE dextran method and treated with trypsin. After 24 hours of transfection, transfer to a new plate without dilution. Ta. After 36 hours, cells were detached by exposure to PBS/EDTA as above. , centrifuged and labeled by the lactoperoxidate method. Dissolve/<・Nof The same procedure as for cell immunoprecipitation was carried out except that the A contained PMSF of Ld. Prepare a clear lysate and incubate with the first antibody for 2 hours at 4°C. went. The eluted sample was prepared by Laeuili (Nature227:680-6 85 (1970)) using a discontinuous 11.25% polyamide buffer system. Fractionated on acrylamide gel.

Remove the DMSO from the loading buffer, denature at 70°C for 5 min, and add to the gel. (Man) except that it contained 0.6% formaldehyde instead of 6%. iatis et al., Molecular C1on'n a [, abator M annual (1982)), the Northern plot fraction We conducted an analysis. Stain the gel in 2 volumes of water containing 1 μg/■ of ethidium bromide. , photographed and washed with nylon (GeneScreen, DCIPOI) in staining solution. It metastasized to IO. Transferred RNA was transferred using 5aran Wrap (Church or and G11bert, oc, Natl, cad, Sci.

'Chain base: 1991-1995 (19114>) on exposure to sterile lamps irradiated for 5 minutes at a flux density of 0.22+af/cm2 (measured at 254rv). did. Reed and Mann (Nucl, Ac’ds Res, [Near 2 07-7221 (191116)) 1m As described, Nairo: / (G By alkaline transfer to aneScreen, DuPont), Southern An analysis was conducted. Hybridization probes were prepared using Hu and Messin. M 13　mp197　y-di　10DNA　containing microgram equivalent of SDS/phosphorus Acid buffer (Church and G11bert, Proc, Natl, Acad, Set, USA i:1991-1995 (1984)) The plots were prehybridized.

N Loading Red blood cells were prepared from whole blood by centrifugation three times in PBS. D By the EAE method, CO was added to 6 cm dishes containing CD2 or other surface antigen expressing clones. S cells were transfected. 48 to 72 hours after transfusilane, Aspirate the medium and add 2 ml of PBS/S%FDS/Azide to each plate, then 0.4 ml of the appropriate red blood cell sample was added as a 20% suspension in PBS.

After 1 hour at room temperature, gently wash away any unattached red blood cells and examine the plate. Ta.

cDNA encoding the CD2 antigenic determinant was isolated as follows.

cDNA was extracted from JiNA extracted from the human Til cell tumor line HPB-AI, II. and inserted into the SV40 origin-based expression vector piH3 as described above. I entered. An eDNA library of approximately 3 x 105 recombinants was constructed and this library was introduced into CO3 cells by protoplast fusion method. After 3 days, cells were ED Three monoclonal antibodies against CD2 determinants separated by exposure to TA. (OKTIl, Lau5b and Coulter Tl1) I understood. Cells treated with antibodies were treated with affinity-purified sheep anti-mouse + gG anti- Distribute onto body-coated dishes, allow to adhere, and gently wash unattached cells. It was separated by this. This accumulation method is described in the Immunodo literature (Mage et al., J. I++n uno1. Methods lj-:47-56 (1977)) It is.

The resulting colonies were pooled, fused to CO3 cells, and subjected to a second pass as described above. ning was performed. In the third panning, some of the isolated cells were identified as CD2-specific. Hirt supernatant was regenerated and treated with a mixture of three monoclonal antibodies. Transformed in juxtaposition. DNA was prepared from 8 of the obtained colonies, and CO 8 cells were transfected. After 3 days, 8 transfected plates The surface expression of CD2 antigen was detected by performing indirect immunofluorescence on six of them. Detected. By digesting the corresponding plasmid DNA with restriction enzymes, six A 1.5 kb insert was shown in all isolates.

One of the six clones was rA-produced in large quantities for further analysis.

After transfecting COS cells, the 3rd International Workshop on Leukocyte Differentiation Antigens Results were indirectly analyzed using immunofluorescence using a portion of the antibody panel provided by Kushitatsubu. However, with the exception of one sample that did not react with fetohemagglutinin activity 1973 cells. All of the antibodies provided showed positive reactions.

Of the 17 antibodies tested, at least 8 distinct groups were found in various primates. Jonker and N. ooij, Leukocte T’n Il, V.

1, 1. pp. 373-387 (1986).

d■【Dandankin CD2 cDNA insert, M131p19 ('/1eir a and MessjB, Gene 19:259-268 (19B2>) It was subcloned and sequenced by the dideodinucleotide method (Figure 2).

Sanger et al., Proc, Natl, Acad, Sc', USA 74:54 63-5467 (1977).

The oven reading frame consists of the translation initiation codon Kozak (L (Company) 1hi: 1-47:45 (19113)) satisfies the consensus criteria. It was observed that the ATG triplet extends to 360 residues (Fig. 1).

The predicted amino acid sequence consists of a hydrophobic amino acid sequence that terminates in a fairly large intracytoplasmic domain. Shows membrane proteins integrated into a single membrane extending down to the anchor. N-terminal amino acid sequence And yon He1jne (Nuc, Ac1ds Res, ll:46 83-4690 (1986)) When compared with Rix, the mature CD2 peptide is the 19th (Set) residue and Formed by cleavage of the precursor peptide between the 20th (Lys) residue is suggested.

A surprising and unexpected feature of this sequence is the close proximity of the proposed cleavage site. The presence of potential N-linked glycosylation sites at each location. Obtained polypep The tide backbone has a predicted molecular weight of 3g, 9kd, which is 21.9kb It is divided into an ectodomain of mass and a cytoplasmic domain of 14.6 kd mass. 3 pieces N-linked glycosylation sites are present in the extracellular domain.

The membrane-spanning domain contains 26 invariant residues with a predominantly hydrophobic character. this Subsequently (7 of the 9 residues are basic residues of lysine or arginine.

The appearance of a predominantly hydrophobic residue followed by a basic residue is due to the presence of a carboxyl-terminal residue. This is a common mechanistic feature of transmembrane proteins that act as a linker.

Another surprising feature of transmembrane domains is the presence of hydrophobic residues (often For example, the ays- giy-gty-gty β-turn motif (Chou and Fasman, An ua Rviev o °C'StZ 47:251-276 (197 11)). Theoretically, only 20 cells arranged in an α-helix residues are required to cross the bilayer of a 3n membrane (Tanford, 5c). ience 200:1012-1018 (191B)>, only 14 Because hydrophobic residues are capable of inserting and ejecting integral membrane proteins (Adams and Rose.

Ajiguchi 1007-1015 (1985>), CD2 antigen transmembrane Len segments may include curvatures or kinks.

The larger the size of the cytoplasmic domain, the more likely CD2 has intrinsic enzymatic activity. ability increases. The cytoplasmic domain is very rich in proline and has a high turn probability. Contains 3 parts.

Comparing the amino acid sequence with the NBRF database reveals that the substance is similar to other proteins. No specific homology was shown. In particular, homology with T cell receptor α or β chains was not observed, indicating that CD2 is a primordial T cell receptor. be suggested.

Milanese et al., 5C1enCe231:1118-1122 (1986 ).

Just inside the cytoplasm of proteins, there are basic proteins that end with serine residues. Yes, this pattern is associated with both EGF receptor and class rut compatibility genes. in each case, each protein is found in the same location in both cases. Infection with protein cownase C or cyclic AMP-dependent protein cownase Known sites for phosphorylation in vivo (EGF) or in vitro (HLA) It is. Hunter et al., Nature LLL+480-482 (1911 4): Davis and Czech, Proc, Natl, cad, Sc+ .

112:1974-1978 (1985): Guild and Stromi nger, L"l 剋-parallel" 4ha9: 9235-9240 and 13504 -13510 (19g4). A similar site is found in the interleukin-2 receptor. Found in the cytoplasmic domain and in vivo by protein kinase C. Phosphorylated. Leonard et al., Nature 31 Uni 626-631 (1984); N1ka ido et al., Nature 31 Uni 631-6 35 <1984); 5hackelford and Trowbridge, J, B'o, Chem, ip:11706- (1984).

Transfected CD2 Back I CO3 cells were transfected with CD2 expression plasmid and transfection After 60 hours of reaction, the cells were surface labeled with 1251 using the lactoperoxidase method.

Prepare cell lysates and use monoclonal anti-mouse antibody (0![T11) for each portion. Alternatively, exogenous (0KT4: anti-CD4) antibody was used to incubate in vitro for 2 hours at 4°C. I bet.

Anti-mouse antibody conjugated to Sepharose was added and after several washing steps, the absorbed protein was Elute proteins, phytohemagglutinin activated 1972 spheres, cDNA donor system HPB-ALL, or similarly prepared from this laboratory-generated long-term T cell line. The immunoprecipitates were subjected to electrophoresis on an 11.25% acrylamide gel. Ta.

C transfected with anti-CD2 antibody by autoradiography A clear band of immunoreactive material precipitated from O3 cells was shown, whereas the control It was not shown by the author. Average molecular weight of T-blast and T-cell material 5 Compared to 4kd, the average molecular weight of CO3O3 cells is calculated to be 51kd, and ■PB - Antigen from ALL cells was found to have a molecular weight of approximately 61 kd.

The observed size differences were due to different glycans in different cell types. This was due to the pattern of codylation. Small band with apparent molecular weight of 38kd is present in immunoprecipitated cells from CO3 cells and is present in T cells or HPB-AL It was absent in immunoprecipitates from L cells. This kind of size is due to experimental error , consistent with the expected molecular weight of the mature non-glycosylated peptide of 39 kd. ing.

CO3 containing CD2 was produced using CD2-expressing clones from sheep and rosettes. The transfected CO3 cells were transfected with purified MT910 (IgG, kappa ) Anti-CD2 antibody (R4eber et al., ij Sorae Danji n Ldan, Vol, 1.1 ) l), 233-242 (1986)) at a concentration of lug/ml. time, or purified Ma2O,5 (IgG1.kappa; Avata et al. , L-LLLq:633-651 (19114)) antibody at the same concentration. The mixture was treated at 30°C for 1 hour. Ma2O,5 recognizes monomorphic malignant HLA-ABC determinants. African Green Monkey Tissue Compatibility cross-reacts with sexual antigens. The African green monkey histocompatibility antigen was selected because Approximately the same amount of surface antigen as the CD2 antigen expressed by the infected cells was detected. This is to indicate isotype-matched antibodies. Sheep red blood cell rosette is MB4 05, but not in the presence of MT910.

Inhibition was also observed with the 0KTII antibody and with various other controls. This was not observed with antibodies.

The transfected CoS is Rosé Σ Red blood cells are formed with red blood cells from rabbits and rabbits, but red blood cells from mice or rats are used. It is known that it does not form. Johansen et al., J.A.ler C1 1n, Immunol, 54:86-94 (1974); Ami.

Leucocte T et al., A., Bernard et al., eds.　Spri Nger Publishing, New York, N, Y, pp, 281-293 ( 19g4); Na1et and Fournier, Ce11. Immun ol, 96:126-136 (1985). Between human red blood cells and human thymocytes Autologous rosette formation (Baxley et al., CI', x, Immun mouth: 38S-3 93 (1973)) has also been reported. Transfection with CD2 expressing clone The infected CO3 cells were treated with MT910 or the control antibody M840.5. and exposed to red blood cells from the above species. Rosettes include horses, pigs, dogs, goats, It was observed in sheep, rabbit, and human red blood cells, but not in mice or cavities.

It was not observed in the red blood cells of humans. Rosette formation occurs in transfected was inhibited by pre-treatment of CO3 cells with MT910, whereas Ma2O,5 was not inhibited even by pre-treatment with In these experiments, horse red blood cells They form very dense rosettes, while goat red blood cells form rather sparse rosettes; This is because goat red blood cells are easily washed away due to their small size. It was thought that there would be. Mouse red blood cells were grown in culture dishes and in MT910 and Ma Although spontaneous binding to cells pretreated with 2O,5 was shown to be weak, rat red Blood cells showed no detectable binding to either.

Human, A is according to FA3 Based on antibody inhibition studies, LFA3 has been shown to be a target structure for the CD2 antigen. Sham et al., Nature 323:262-264 (19 86)), we investigated anti-LFA3 anti-A3 anti-A3 anti-A3 anti-LFA3 anti-A3 anti-A3 anti-A3 anti-A3 anti-LFA3 anti-A3 anti-A3 anti-A3 anti-LFA3 anti-A3 anti-A3 anti-A3 anti-A3 anti-LFA 86). Trance The infected cells were treated with anti-LFA3 (as in ascites) at a dilution of 1:1000. IgG1, “ppa), or LFA3: GIO/Bll and oio, anti- 14 antigen, D6, anti-Wr' antigen; and F7/B9, anti-antigen equivalent or against human red blood cell antigens at a concentration of 10 ug/■l each. human red blood cells that had been previously treated with four isotype-matched non-agglutinating antibodies for 2 hours. . N1chols et al., NiLh■, published. Red blood cells are treated with excess LFA3 anti-A3, rosette in the presence of control antibody to prevent loss of antibody inhibitory power due to release. formed. Rosette formation was observed in the presence of all four control antibodies. but not in red blood cells pretreated with anti-LFA3.

CO3 with a T of Antibody reactivity, nucleic acid Characterized to various extents by restriction digestion and sequence analysis, and immunoprecipitation. representative Nari lawns have the ability to transfect CO3 cells and maintain rosette formation. analyzed the power. CDla%CD1b, CD1c.

CD4, CD5, CD6, CD6, CDII and CD28 (Tp44) The cells did not form rosettes with human red blood cells.

■r Otsushi Nijitachioka Equal amounts of total RNA prepared from cell types expressing or lacking the CD2 antigen were Electrophoresis was performed by denaturing the base gel and transferred to nylon. transferred RNA was prepared from the M13 clone containing the CD2 eDNA insert. Trand selection probe (l(U and Messing. Gene 17:27 1-277 (1982)) to activate thymocytes. RANs from sexualized T cell and debilitated T cell populations have significant 1.65 and 1. , a 3 kb transcript was shown to be present. cDNA donor system and I(P [lNA extracted from B-ALL has a relatively small amount of transcripts, and MOLT4 The amount of transcript is even lower in RNA from was recorded in RNA from the ll5B-2 line. Naa + alva (bar) Kit lymphoma), U937 (histological leukemia), HuT-78 (adult T cell leukemia), PEER (T cell leukemia), or Jurkat clone J No reactivity was observed with RNA from the 3R7 (T cell leukemia) line. It was. The pattern of reactivity is similar to the known or measured pattern of CD2 antigen. There is good agreement, which is the result of Namalva, $937, HuT-78, J3 Absent or undetectable in R7, PEER and HSB-2 cell lines , slightly present in MOLT4, more abundant (present) in EPB-ALL However, it was most abundant in activated T cells. Thymocytes also have high levels is known to express the CD2 antigen.

When examining the sequence of the cDNA clone, 1. 3kb RNA is converted into cDNA sequence Another distal to the canonical polyadenylation signal AATAAA at position 1085 in It was suggested that this could be caused by the formation of the 3° end of .

To test this, RNA from HPB-ALL and activated T cells were subjected to Northern blot analysis to detect the complete cDNA probe or nucleonucleotide. Hybridization with a probe obtained from the 3° portion of the cDNA distal to 1131 I lost it. The latter probe is 1.

Although the former reacted only with the 65 kb species, the same reactivity pattern as observed in Figure 5 was observed. showed the tone. This result is consistent with the suggested origin of the 1.3 kb transcript. .

In both activated and debilitated T cell RNAK11 products, approximately 0.75 kb of weak (A hybridizing transcript was detected.Currently, the origin of this RNA is unknown. not present.

C2 genome Placenta, peripheral blood lymphocytes, T cells, HeLa cells, or for RNA analysis of the above Southern blot analysis of genomic DIJA from tumor lines identified The Bam old digestion pattern of It was shown that it is not involved in the normal expression of offspring. Similarly, global genome modification is not the reason that the T cell tumor lines examined did not express the CD2 antigen. Many Restriction analysis of total genomic DNA with several other enzymes and one frame with CD2 sequence. Preliminary results from incomplete assembly of recombinants due to the also shows that it is divided into four exons.

(Margin below) Example IX Cloning of CD36 I and cDN encoding CD36 To isolate A clones, DEAE-DE was used as a promoting factor (Example I, supra). Human placenta cDNA (Simmons and 5eed (1 988) Nature 333:568-570) was transported to cosmm.

48 hours after transfection, remove cells from dishes without trypsin. and monoclonal anti-CD36 antibody 5F1 (Bernstein et al. (1982 ) J.　IIIlmunoL. 128:876-881) (Andrev S et al. (1984) J. Im+l1uno1. L2i:398-404) and Both plates were incubated and coded with a goat anti-mouse immunoglobulin antibody. Washed above. Remove non-adherent cells by gentle washing and lyse adherent cells; Episomal plasmids recovered from cells were purified to obtain ε. coli. transformation into I changed it. After two identical enrichments following spheroplast fusion, randomly selected Plasmid DNA recovered from 11 of the 12 selected colonies controls the appearance of CD36 determinants in transfected CO3 cells. I discovered that there is.

Two of the clones were randomly selected for further analysis. Both approx. had a 1.9 kb insert and showed the same restriction enzyme fragment pattern. . CO3 cells transfected with either of these clones , monoclonal antibodies 5F1 and F13, and OKMS (Ortho. Raritan, NJ). Transfected cells were treated with anti-CD By immunoprecipitation with a pool of 36 antibodies, a 113 kd molecule was isolated. present on transfected CO3 cells and C32 melanoma cells, and control role (CD25 transfected) is absent in CO3 cells. found. A high molecular weight species, probably dimeric CD36, is present in transfected C Immunoprecipitated from os cell lysates but not from C32 cell lysates. Ta. The nucleotide sequence is shown in Table 1. In Table 1, the nucleotide sequence numbers are , shown in the left margin at the beginning of each line. The deduced amino acid sequence is Shown as a single letter code below the first base of the cleotide triblet, starting Thionine is indicated by number 1 above the start codon. N-linkage in the derived amino acid sequence Possible glycosylation sites are underlined with a double dashed line. It's pulling. Estimated transmembrane regions are double underlined. Ru. There are two Fuenscensus polyadenylation (AATAAA) motifs in the cDNA. However, the poly(A) tail is not seen, and the neck of the probuthybridized Some of the RNA species observed by None are short enough to accommodate. This indicates that the transcripts observed in the clones This suggests that it has the same adjacent 5° end as the one shown.

The putative start codon is not the first ATG found in the clone, but the 2 The motif is immediately followed by an in-frame stop codon. Expected start menu Thionin is followed by a short hydrophobic region. The short hydrophobic region contains secretion signals. Although similar to the null sequence, the cleavage site for this cannot be unambiguously identified. Table 1 According to recent determinations using the amino-terminal 36 amino acid sequence (Tandon et al. J. Biol, Chew, 264 Near 5) O-7575 (19119)) The mature polypeptide begins at the amino acid residue immediately following the initiating methionine. This shows that. A single Arg residue in front of the hydrophobic region marks the amino-terminal membrane. It is not clear whether this is sufficient to allow anchoring. The resulting poly The peptide possesses 471 residues and has an estimated molecular mass of approximately 53 kd. It will be done. The proposed extracellular region includes a diaphragm that corresponds to the transmembrane region. 27 residues are hydrophobic and 6 residues correspond to sparse intracellular regions (intracellular 3 are basic). Possible N-linked glycosylation site The presence of 10 sites indicates that the expected polypeptide and immunoprecipitation This is sufficient to explain the discrepancy in molecular mass between the 83 kd species discovered in It seems that there is. Compare the entire sequence to a diverse database of known proteins. No significant homology was detected. However, some internal structures are It was obvious. All cysteine residues in the extracellular region are located at residue 9 of the nucleotide sequence. 37 to 1209. cysteine Using the position as a guide, the extracellular region could be divided into three segments. Said 3 Of the two segments, the two regions that do not have cysteine have system regions before and after them. The company had a segment rich in sales. However, in the current database, this Sequence comparisons using these segments also reveal important relationships to other molecules, especially Nor did it show a significant relationship to tromposbondin.

CD36 protein was purified by immunoprecipitation. Rapid immunoselective cloning method CD36 cD depends on the expression of transfected CO3 cells. The same cell lines from which NA was cloned also showed the amount of protein expressed. This means that it can be used.

C32 melanoma cells, CD36 transfected CO3 cells, and CD25 (control) transfected CO5 cells were incubated with N a I 2S (surface labeled, 1txM phenylmethylsulfonyl fluoride , O, 5% NP-40, and phosphorus containing 0.1% sodium dodecyl sulfate. Dissolved in acid buffered saline solution. Add anti-CD36 monoclonal antibody, Absorbed into lysate for 12 hours at °C. Then goat anti-mouse immunoglobulinbee (Cappel), mix for 2 hours and mix as described (C1ark and and EinreId J, -Sat imuno1.1ff5:155-157 (19 115>). Transfected cells were purified by immunoaffinity column purification. Larger amounts of protein were also obtained in purified form from CO5 cell lysates. It can be done. Other antibodies against CD56 can also be obtained using the CD36 protein. , can be expressed and/or purified as an immunogen as described.

CD36 was developed by the inventors of the present invention and Ockenhouse, C, D, et al. (19 89) Science ■: 1469-1741, Plasmodium falciparum has been identified as the binding site for cell attachment of parasitized red blood cells.

Cell adhesion of parasitized red blood cells is determined by a monoclonal antibody against CD36. has been shown to be prevented. Infected red blood cells are transfected with CD36 cDNA. showed obvious cell attachment when incubated with transfected COS cells. Ta. Plasmodium infection occurs due to the adhesion of red blood cells infested with Plasmodium falciparum to the peripheral vascular bed. The ability to evade rearrangement plays an important role in the pathogenesis of falciparum malaria. However, cerebral malaria is fatal by causing occlusion of small blood vessels in the brain. It is thought that this contributes to the symptoms of cancer. Therefore, the cDNA of the present invention and purified The protein is purified CD36 sufficient to produce therapeutic monoclonal antibodies. is useful for providing

(Margin below) Example cDNA clones to be coded were transformed into CO3 cells as described. The rapid immunoselected cloning clone of the present invention is obtained from a human T cell cDNA library I performed the Gu method. Monoclonal antibody ACT-T-SET TLiSAl (T- Cell 5 Sciences Corp, Cambridge, Mass Express the cloned cDNA by using Detection of transfected CO3 cells by positive indirect immunofluorescence did. The positive plasmid contained a 1.7 kb insert.

TLiSA proteins were purified by immunoprecipitation as described in Example IX above. isolated. As determined by gel electrophoresis, the protein has a mass of approximately 50 kd. It had a molecular mass.

The nucleotide sequence of the cDNA was subjected to the dideoxynucleotide method as described above. Therefore, it was decided. The sequence of the 1714 residues is shown in Table 3. In addition, the predicted amino acid sequence columns with a single character code below the first nucleotide of each coding triplet. Indicated by ATG encoding the putative starting methionine is followed by a secretory sequence. It is followed by a short hydrophobic region that matches the GNAR sequence. Possibility of amputation site The site with the highest value is 19 residues in the reading frame. Obtained polype If not further processed, the peptide possesses 317 residues and The expected molecular mass is 36 kd. The proposed extracellular region includes the intracellular region It is followed by 25 residues, most of which are hydrophobic. (Table 3 Smell are indicated by double underlining. ) Possible N-linked glycosylation site The fact that there are nine sites (indicated by single dashed lines in Table 3) is unexpected. The molecular mass between the polypeptide and the 50 kd species discovered by immunoprecipitation. seems to be sufficient to explain the discrepancy.

TLtSA mediates IL-2-induced differentiation of T cells to the cytolytic form. involved in making Antibodies against TLiSA were stimulated by IL-2 To prevent T cell differentiation and to alleviate the adverse effects of [L-2 in therapy] It is useful for

(Margin below) Example X1ll T7A, -CD27 code CNACD27 code The human T lymphocyte cDNA transferred to COS cells is and immunoselected by the method of the present invention. L ug/ml phytohemagglutin After culturing for 4 days in a medium containing (PHA), guanidium thiocyanate was used. RNA was extracted from mononuclear cells derived from one unit of blood. Total RNA was the polyA selected. Produce cDNA and clone into CDMII CD27 cDNA was transfected into C08w1 cells, and CD27 cDNA was transfected into monochrome cells. local antibodies 0KT111a and CLB-9F4 (Seed and Aruff oc, atl, ead, Sc’, jil:8573-8577 (191 17); and Aruffo and 5eed oe, ca, s’ U il 1:3365-3369 (1987)). Immunoselected. The vector contained a 1.2 kb cDNA insert. The nucleotide sequence of the cDNA was subjected to the dideoxynucleotide method as described above. Therefore, it was decided. The sequence of 1203 residues and the deduced amino acid sequence are shown in Table 5. . The starting methionine is indicated by the number 1 above the start codon. Estimated CD27 polypeptide Figure 1 shows typical features of type ■integral membrane proteins. The estimated CD27 port The repeptide begins with a 20 amino acid hydrophobic region that matches the secretion signal sequence. Ru. This hydrophobic region includes a 171-residue extracellular region and a 20-residue hydrophobic membrane sub-region. ning region (indicated by double underlining), and positively charged transport stops. A 49 amino acid cytoplasmic region begins with the sequence. No poly(A) tail .

The predicted CD27 amino acid sequence is 8978 over the entire length, as shown in Figure 17. It is highly homologous to the bulbar and carcinoma antigen CD40. CD27 also has fine Across the extravesicular and transmembrane regions, receptors for nerve growth factor (N GFR) (Stamenkovic et al., [i:1 403-1410 (1989): Johnson et al., Fallen Shells 47: 545-55 4 (1989)). The most protected structure found in these three proteins The motif is the abundance of cysteine or histidine in the extracellular region.

These are often found in pairs, and said pairs are used in this structure to bind zinc ions. 2 or 4 interfering amino acids similar in configuration to those found in proteins using separated by residues. Areas rich in cysteine and histidine include serine It is followed by a membrane-proximal region rich in threonine, threonine, and proline. Membrane proximity The region was biochemically identified. This is the region where linked glycans are added to NGFR. It has been suggested that (Johnson et al. (1989), HGrob et al., J. 'o, Cti, 260:8044-8049 (1985)).

Transfected cos cells were immunoprecipitated with anti-CD27 antibody, followed by When gel electrophoresis was performed on the gel, it was found that 110 kd was present when it was not reduced. It was revealed that a single 55 kd band exists in the presence of a reducing agent. It was. This indicates that on transfected cos cells, CD27 is a disulfide-linked homodimer that includes a 55kd monomer and is a T-linked homodimer. This indicates that the morphology is similar to that precipitated from lymphocytes. (Bigler La, J,! ma+uno1. ill:21-28 (19811): Sto ckinger et al., Lukocte T in II, Uni 513- 529 (1986); van Lier et al., ur, J. mmuno, [:l111-816 (19g?)).

CD27 is the 1978 bulb activation antigen. Its structure is associated with lymphokines or This suggests that it may function as a receptor for long factor. CD2 The recognition of causes increased expression of specific genes required for the function of C on T cells Expression of D27 was determined by phytohemagglutin (PHA) or anti-CD3 monoclonal Stimulation with antibodies increases 2- to 5-fold, and at least one type of CD27 Addition of monoclonal antibodies can enhance PHA-stimulated proliferation of T cells. (Bigler and Chiorazzi, ukocte Tn II nL”: 503-512 (1986); Van Lier, (1987) ). T cells that are CD27 positive, when moderately stimulated, increase IgM synthesis and IgM synthesis. It has been discovered that it assists B cells in secreting t-2 (VanL Iar et al., Muni-L-Il Aim 1 Eng: 1111-816 (1988)).

the ability to interfere with the binding of CD27-positive T cells by antigen-presenting cells; The ability to induce such binding on surfaces other than lymphoid cells has diagnostic and therapeutic potential. For example, CD27 and a receptor ligand immobilized on a substrate fusion proteins are useful for detecting the presence of specific antigens in body fluids.

Soluble CD27 fusion proteins may be desirable, e.g. in certain autoimmune diseases. It is useful for blocking the proliferation of T cells that do not exist.

(Margin below) Example XVI cDNA encoding CD53 and antibody MEM-5 3 (Hadat M, R, (1989), eucoc te T' IV.

Knapp, B, et al. (ii) 0xford Univ, Press, p , 674), llID77, ll[I29 and old 36, and 63-5A3 By tJ! CD53, an antigen recognized by the hematopoietic lineage (Stevanova , 1. , et al. (1989), on ucocte TI1, Knapp, B. , et al. (eds.) 0xford Univ, Press, p. 6711). A sugar protein that is widely distributed throughout the nucleated cells but is strictly restricted to the nucleated cells. It's a good quality. CD53 is expressed by monocytes and macrophages, granulocytes, dendritic differentiation by cells, osteoclasts and osteoblasts, and by T and B cells. Expressed from all stages.

To obtain cDNA clones encoding CD53, peripheral lymphocytes and anterior bone The medullary carcinoma cell line HL60 was purified by the DEAE-dextran method as described above. CO5 cells were transfected. 48 hours after transfusilane, Cells were pooled and incubated with monoclonal antibody MEM-53, 5eed and Aruffo.

Proc, Nat, Acad, Sci, USA I4:3365-3 369 (1987), and Aruffo and 5eed, Pro, N. atl, cad, Sc', US jl:8s73-8577 (1987) Washed as described. Spheroplast fusion followed by two consecutive After enrichment, the plasmid DNA recovered from a single colony** was 5 cells were transfected, and the expression of CD53 was evaluated by fluorescent antibody method.

Two of the eight transfectants were positive, each containing approximately 1.5 kb of transfectants. It had a cert. transfected with either clone CO3 cells were treated with antibodies MEM-53, old 29, [136, and 63-5A3. I reacted.

For comparison, CD from peripheral lymphocytes and transfected CO3 cells To isolate 53, lymphocytes and transfected CO3 cells were 1251 surface labeling using lactoperoxidase and R202, then 1% NP40.150mM NaCl, 5mM MgCh, 5d KCI, 20mM 1-doacetamide and 1M phenylmethylsulfonylph 50mM Tris-)1cIp[I containing fluoride in 8.0 lysis buffer It was dissolved in Cells were incubated in lysis buffer for 45 min at 2.5 x 107 cells/ It was solubilized at a concentration of 1 liter and then centrifuged at 12,000 g. goat anti maw immunoglobulin beads (Cappel, Malvern, PA). After clarification, 5chneider et al. (1982)), monoclonal antibody MEM53 or 63-5A3 and Protein A-Sepharose CL-48 (Sigma, S Immunoprecipitation was performed using t, Louts, MO). The immunoprecipitate was subjected to SDS assay. 12.5% acrylic solution containing sodium dodecyl sulfate. Analyzed on amide gel.

Broadband radioiodinated proteins ranging in mass from 34 kd to 42 kd with a monoclonal antibody of either MEM-53 or 63-5A3. Obtained from peripheral lymphocytes, it contains CD53 traverses ranging from 36 kd to 46 kd. Comparable to the bands obtained from transfected CO3 cells. in CO3 cells Furthermore, substances with higher molecular weights are generally not included. Because transfer Cell surface proteins recovered from infected CO3 cells are usually isolated from eDNA proteins. exhibit a molecular weight that is different from, or lower than, that found on the cells from which the loan is derived. (Aruffo and 5eed, 1oc, Nat, Aca d, Sc', US 84:3365-3369 (1987). About Ka■ The 15 kd one is caused by endoglycosidase F (N-glycocanase) Released from glycoproteins by digestion. On the other hand, neuraminidase and O-group Processing by licanase also has a negative effect on the apparent molecular weight. (Hadam, M, R, (1989), ucocte'n IV, Knapp, B. et al. (eds.) Oxford Univ, Press, p. 674. ; 5tevanova et al., ucocte T in mouth, napp B, et al. (II) 0xford Univ, Press, p, 67g). moreover , a faint 20 kd band, probably an unglycosylated precursor, detected in immunoprecipitates of transfected cos cells, but not in peripheral lymph It was not detected in the sphere immunoprecipitates.

Genome I) NA from T cell line PEER digested by several enzymes Lot hybridization revealed a pattern consistent with a single copy gene. showed. RNA plot analysis was performed on B, T, and myeloid cell line-derived and terminal A single 1.8 kb mRNA derived from shoot lymphocytes was shown. The level of expression is T F! They were consistent with each other in the different cell lines, except in the PL cell line. THPI cell line had almost no CD53 mRNA. CD53 transcripts were detected in culture. are more abundant in peripheral lymphocytes than in the cell lines in which these This is consistent with the higher surface expression of CD53 in cells of this type.

The nucleotide sequence of CD53 CDNA was synthesized using synthetic oligonucleotides as described above. It was determined by the dideoxynucleotide method using otide primer. CD The sequence of the 53 insert consists of 1452 nucleotides (Table 9), with two Ends near the overlapping AATAAA motif (indicated by double underline). conclude. 3° non-cod sequences are three examples of ATTTA sequences (indicated by quotation marks) The ATTTA sequence has been shown to mediate mRNA instability. (Shav and Kamen, Fall 11 [:659 (1986)).

The oven reading frame starting at residue 74 is a 24,340 kd molecule. Encodes a protein consisting of 219 amino acids with a predicted mass . The predicted polypeptide has a main hydrophobic segment (double underlined). It is common to have four points (shown below), three of which are amino acids in the molecule. Exists near the end. The first hydrophobic segment can be a signal sequence or a simple trans Abnormally long and intermediate to both smembrane alpha helices It contains three cysteine residues and a glycine. Both cysteine and glycine It has been discovered that both signal cleavage sites exist immediately before one signal cleavage site (w on He1jne, Nucleic c’ds, Mouth: 4683 (1 9116)). This means that the amino terminus of the mature protein is the first hydrophobic region. It is implied that it begins in the middle of . This view is based on the following The polypeptide backbone of ME491, a type III integral membrane protein, The size is predicted from the cDNA sequence, probably as a result of signal peptide cleavage. This is supported by the fact that it is smaller than expected. With N-linked glycan A potential addition site is located between the 3rd and east 4th hydrophobic segments. Since there are only two sites (indicated by -CFlO- in Table 9), the carboxyl terminus is , within the cell, and in the short hydrophobic portion between the second and third segments. not present. If the amino/terminus is not processed, it remains in the cell as well. It doesn't crawl.

CD53 is a type IIJI related to three other membrane proteins! ll endogenous data It is protein. Three other membrane proteins, whose increased expression is associated with tumor progression ME491 antigen, a mela/-ma protein correlated with Niji-1Mekko 1i:2955 (1988)), expressed on most of the Bfi cells, CD37, a highly glycosylated antigen but not B cell lineage specific (Schvarts et al., L'11LIJ4+905 (1988), and S5.7, a non-glyphsylated antigen widely expressed on blood lineage cells (PressanO et al., Cancer Res, 43:4812 (198 3)). Furthermore, CD53 is the type that transports lactose to bacterial cells! ! ! It is slightly related to L-1Iac Y permease, which is an integral membrane protein. continue.

Transcripts of CD53 in peripheral lymphocytes increase following mitogenic stimulation with PHA. increase in large quantities. This suggests that type +111 is important for the transport of factors essential for cell proliferation. 1! This suggests that endogenous proteins may be involved.

Among the broadly reactive molecules in the hematopoietic system, CD53 is currently the most broadly reactive. reactivity, and has the strictest restrictions on hematopoietic cells. Anti-CD53 antibody is A useful tool for the identification of hematopoietic neoplasms, cells that are poorly defined morphologically, For example, it may be useful to identify cells in the pancreas or primary cultured cells in bone marrow. That can be proven.

(Margin below) -Middle - to Gate Suga Ma 111ill r+ Middle work i-so Those skilled in the art will readily recognize equivalents to the specific embodiments of the invention described herein. can be recognized or ascertained without more than simple experimentation.

Such equivalents are within the scope of this invention.

1　GGCGTAATCT　GCTGCTrGCA　AACMAAAAAA　CC ACCGCTACCAGCGGTGGT1701 TGCGCCTGCA GG TCGCGGCC nod σCT, Satoshi TCηTGT Hinihiro ACCFIG, 1-2 FIG. 2-2 151 GGCCACCACT TCAAGAACTCTGTAGCACCG CCTACATACCTCGCTCTGCT1301 AGGQAGCAGA CTMATCT GCCGTCATCG ACnCGAAGG ncGAA TccT2301 MGTTGGTGG ACATATrATG mATcAG TG ATAAAGTGTCMGCAT (, ACAFIG, 6-3 3501 TCTAGTrGTG GmGTCCAA ACTCATCAAT GTATCTTATCATGTCTGGATFIG, 6-4 AGAcyacAmcncccxircccvcmcxcnccccicAcx 6-4AGAcyacAαt (60) FIG, 77- 1acAaCAccTccAcAraCAcrcNodMTcrccuiccxc xcxcxrmAcrrccA (1140) FIG, 7-2 FIG. 9-1 FIG. 9-2 =2 =91 = = -1 1, ,GGAGAGTCTGACCACCATGCCACCTCCTC GCCTCCTCT　TCTTCCTCCT1151　ATGGAMCCCGA GCAGcGACGTCCAGGCGG ATαxc<cm mark rccccc 1201 AGCCGCCGGG AGTGGGCCCA GAAGAAGAG G Mα; GGAGGG CTATGAGGM1901 MTGAGCTCT TCCAAAAAAAAAA1 ACAAAAGACAA ACTGCACC CA CTGAACTCCG CAGCTAGCAT CCAAATCAGCF IG, 13-1 1101 ATCTGGCC’rr TGCATGGAGT GACCATAG CT　CCTrCTCTCT　TACATTGAAT1451　! AGAGC ACAAT　GGATCTl　CCCAMTGTCTCAGAATGTA　TG TCCCAGM ACCTGTGGCTGCTTCAAACCAFIG, 15 -1 FIG. 15-2 FIG. 16-1 1701 GGGTCTCAGA GCTGAGCCAA GACCTCCCG G GTCCTCTGCG G-rffrTGTG2151 mGTrATcA GTTTCCAC’rr TFIG, 16-2 1　GCCTCGCTCG　GGCGCCCAGT　GGTCCTGCCG　C CTGGTCTCA CCTCGCCATGFIG, 17 Copy and translation of written amendment) Submission (Article 184-8 of the Patent Law)

Claims (1)

[Claims] 1. Recombinant DNA segment encoding CD53 cell surface antigen or its function sexual derivatives. 2. A recombinant DNA segment containing the nucleotide sequence shown in Table 9 or its Functional derivative. 3. A substantially pure CD53 protein or a functional derivative thereof. 4. Substantially pure protein having the amino acid sequence shown in Table 9 or functional derivatives of. 6. A pharmaceutical composition comprising substantially pure CD53 cell surface antigen, the composition comprising: A pharmaceutical composition in which the surface antigen is present in soluble or acceptable salt form. 7. 7. The pharmaceutical composition of claim 6, further comprising an acceptable carrier. 8. 7. The pharmaceutical composition of claim 6, further comprising a therapeutic agent. 9. substantially pure CD53 cell surface protein, an acceptable carrier, and Immunotherapeutic agents, including therapeutic agents. 10. comprising substantially pure CD53 cell surface antigen in soluble form and means for containing it; , a kit useful for immunodiagnostic assays.