PT591697E - CLONING AND CHARACTERIZATION OF GROWTH HORMONE LIBRARY HORMONE RECEPTOR - Google Patents

Abstract

Growth hormone releasing hormone (GHRH) receptor binding has been characterized using a unique binding assay utilizing iodinated GHRH probes. Photoaffinity GHRH probes have been constructed which allow for photolabeling and characterization of the receptor. In addition, high affinity biotinylated GHRH analogs have been constructed. Solubilization of GHRH-R/GHRH complexes and extraction of specifically bound GHRH using a mild detergent solution, followed by affinity chromotography, leads to a substantially purified GHRH-R isolate. Electrophoretic treatment of the GHRH-R isolate produces GHRH-R of sufficient purity to conduct sequencing of the receptor. Cloning of a gene encoding for polypeptides (protein or fragments thereof) having GHRH-R activity is accomplished using a bacterial host, and the cloned gene is expressed in a mammalian cell line.

Description

DESCRIPTION " Cloning and characterization of the growth hormone releasing hormone receptor "

FIELD OF THE INVENTION The present invention relates to the cloning of a gene encoding a growth hormone releasing hormone receptor or biologically active fragments thereof to a living cell line having recombinant DNA encoding a release of growth hormone or biologically active fragments thereof, and methods for the production of growth hormone releasing hormone receptor and biologically active fragments thereof.

BACKGROUND OF THE INVENTION Growth hormone releasing hormone (GHRH) is secreted by the hypothalamus, and stimulates the release of growth hormone (GH) from the anterior pituitary. GHRH is a member of a family of homologous peptides which includes glucagon, secretin, VIP (vasoactive intestinal peptide), PHI (histidine peptide and isoleucine), PACAP (pituitary adenylate cyclase activating peptide), GIP (inhibitory peptide gastric), and helodermina. GHRH has been the subject of considerable studies, but little is known about the GHRH receptor, GHRH-R, to which GHRH binds in the anterior pituitary to induce GH release. Large scale production of the cloned GHRH receptor would allow the screening of large numbers of GHRH analogs, and would facilitate the development of improved agonists and antagonists in clinical therapy of growth disorders. More specifically, the screening of large numbers of analogs and xenobiotics for GHRH activity could lead to the development of improved agonists for use in clinical therapy of growth hormone deficient children and adult clinical therapy to improve nutrition and to alter body composition (muscle vs. fat). This research, possibly assisted by computer modeling based on the structure of the receptor, could also lead to orally active non-peptidic GHRH agonists that would be especially useful in medical and veterinary practice, for example to develop greater

86 046 ΕΡ 0 591 697 / ΡΤ yield in milk production and higher yields in the production of leaner cattle. Commercial exploitation of drugs that interact with GHRH-R will require a source of a purified form of GHRH-R and suitable binding assays. Isolation and cloning of the GHRH receptor and its expression in vitro will also lead to: (1) In situ hybridization studies to map the distribution of GHRH receptors throughout the body and to examine their potential physiological role outside the pituitary ; this may reveal potential roles for GHRH in the brain, gonads, pancreas, placenta, and intestine where the peptide is thought to be concentrated. (2) Studies of receptor structure involving mutated or chimeric receptors to explore structure / function relationships and second messenger interactions in the search for specifically tailored agonist / antagonist molecules. (3) An understanding of the evolutionary relationship of GHRH-R with other G protein-bound receptors, especially those of the glucagon / secretin / VIP family. (4) Cloning of other members of this subfamily expected to have sequence similarity.

There are several alternative routes towards obtaining clones of functional receptors, such as: A. Purification of the receptor protein to obtain a partial sequence of the protein; this partial sequence of the protein can then be used to prepare probes for DNA screening appropriate to the corresponding nucleotide sequence. B. DNA screening for sequences similar to known receptors believed to be related to the GHRH receptor. C. Searching for DNA which, when expressed as a protein, will yield a GHRH receptor, which would be detected by GHRH binding, biological activity, or by an antibody to the GHRH receptor. It is noted that any method of cloning conceptually requires binding assays as well as functional assays with GHRH and related peptides in order to identify the GHRH receptor and to characterize expressed clones.

EP-A-0576988 discloses the isolation and characterization of the growth hormone releasing hormone receptor.

86 046 ΕΡ 0 591 697 / ΡΤ

Unfortunately, purification of pituitary receptors is very difficult because of the scarcity of tissue, as well as the problems involved in solubilizing the receptors in the active form, and in the development of an efficient purification method. Even though the receptor protein may be isolated, the concentration of the receptor in the pituitary tissue is so low that it is exceptionally difficult to generate a sufficiently large amount of receptor to effect a partial sequencing of the protein sufficient to generate DNA probes for the gene encoding the GHRH-R receptor.

Additionally, since the GHRH-R receptor is believed to be glycosylated, it may not be possible for the bacteria to express the biologically active receptor or fragments thereof.

There is thus a need for GHRH binding assays and for compositions for use therein which will help to characterize and isolate the GHRH receptor. In particular, there is a need for methods that can characterize the pituitary GHRH receptor in terms of the size, glycosylation, solubility and stability of the receptor (GHRH-R) -ligating (GHRH or GHRH analog) receptor complex in order to be able to be developed methods for purifying the receptor protein and identifying receptor clones. There is also a need for purified or partially purified GHRH-R and methods for obtaining the same. For partially purified GHRH-R, it is meant that a GHRH-R isolate is formed with a GHRH-R isolate from most of the organic matrix of the cells of the anterior pituitary. The GHRH-R isolate is of sufficient purity to allow determination of the GHRH-R sequence, it being understood that further purification may be necessary to remove any remaining compounds that could interfere with sequencing, such as G-proteins. Despite this, the GHRH-R isolate of the present invention, produced using the extraction and isolation method of the present invention, contains GHRH-R, preferably at a concentration higher than that at which GHRH-R is naturally present in the anterior pituitary, and isolated from GHRH-R may be further purified, if necessary, using SDS-PAGE to remove any compounds that would interfere with GHRH-R sequencing. Thus, the present invention also includes the production of GHRH-R of sufficient purity to conduct sequencing, or for use in bioassays of GHRH-R binding activity.

86 046 ΕΡ 0 591 697 / ΡΤ 4

There is still a need for a method for the cloning of a gene encoding the GHRH-R or biologically active fragments thereof, and of a purified isolated isolated nucleic acid sequence or nucleic acid sequences encoding a hormone releasing hormone receptor growth and biologically active fragments thereof. There is also a need for a vector, a host cell, or host organisms comprising a nucleic acid sequence encoding a GHRH-R protein or polypeptides.

Historically, it has been difficult for GHRH-R to function since GHRH has a very high non-specific binding (making it difficult to determine whether GHRH or GHRH analogs bind specifically to GHRH-R), and GHRH-R has an extremely low abundance. Non-specific binding of GHRH analogs to glass and plastic utensils has been a major problem in previous work, limiting the accuracy and reproducibility of receptor binding studies. Due to the sticky nature " of the negatively charged GHRH peptide, the use of a simple filtration type binding assay has been impossible. Non-specific counts are so high that they prevent the detection of specific binding. In addition, the commonly used blocking agent, polyethyleneimine, which is used to block nonspecific binding of proteins to glass fiber filters, is positively charged, and will bind non-specific (negatively charged) GHRH analogs. In addition, a soluble receptor preparation with high binding affinity is not available, which would vastly enhance efforts to purify GHRH-R.

Previous studies have characterized the GHRH receptor in relation to its affinity for probes, such as GHRH and related peptides, and binding to G protein. Attempts have also been made to use non-specific chemical crosslinkers to label the GHRH receptor. See, for example, Zysk, et al., &Quot; Cross-Linking of a Growth Hormone Releasing Factor-Binding Protein in Previous Pituitary Cells, " J. Biol. Chem. 261: 1678 (1986), and Velicelebi, et al., &Quot; Covalent Cross-Linking of Growth Hormone Releasing Factor to Pituitary Receptors, " Endocrinology. 118: 1278 (1986). The results of these two studies suggest, respectively, the presence of a 26 kDa GHRH receptor and a 70 kDa GHRH receptor in the anterior pituitary. The discrepancy between the molecular weight found in these two studies emphasizes the difficulties involved in

86 046

Isolation and characterization of GHRH-R, and the need for improved methods and compositions useful for the isolation and characterization of GHRH-R.

GHRH binding to the rat anterior pituitary is believed to be influenced by GTP, which causes the GHRH receptor to reduce its affinity for GHRH (GTP is said to dissociate the G protein and GHRH receptor complex ). The high affinity GHRH-linked state of GHRH is believed to be stabilized by interactions with a guanine nucleotide regulator protein to form a ternary hormone-receptor-G protein complex. GTP has been hypothesized to destabilize the G-receptor protein interactions, resulting in the dissociation of the GHRH / GHRH-R / G-protein complex and the inversion of the independent receptor into a low affinity state, while the released G protein continues to activate its respective second messenger system. See Struthers, et al., &Quot; Nucleotide Regulation of Growth Hormone Releasing Factor Binding to Rat Pituitary Receptors, " Endocrinology, 124: 24-29 (1989).

It has been found that, in ovine and bovine anterior pituitary tissues, GHRH and its analogs are displaced by 500 to 1000-fold lower concentrations of a GHRH analogue, GHRHa (the preparation of which is described later) than VIP or PACAP. This check is complementary to the binding properties found in the human pancreas (a source of secretin and VIP receptors) wherein the ability to stimulate adenylate cyclase in the presence of GTP has an order of secretin potencies > helodermina > PHI > VIP > GHRH (1-27) NH2. Similarly, using 125 I-secretin, the Kd obtained were, for 0.8 nM secretin, 200 nM helodermin, 250 nM PHI. VIP and GHRH (1-29) -NH2 induce only 20% inhibition at 10 μΜ.

At supraphysiological doses, GHRH is known to act on VIP receptors, and in opposition, VIP is a weak GHRH agonist.

Other articles providing background information regarding the isolation and characterization of hormone receptors include: Christopher, et al., "The VIP / PHI / secretin-helodermin / helospectin / GRH Family: Structure-Function Relationship Of The Natural Peptides, Their Precursors And Synthetic Analogs As Tested In vitro On Receptors And Adenylate Cyclase In A Pan Of Tissue Membranes, " in Peptide Hormones As

86 046 ΕΡ 0 591 697 / ΡΤ

Prohormones: Processing, Bioloqical Activitv. Pharmacoloqy. Ed. Jean Martinez, Pub. Ellis Horwood Lim., Chichester, England, 1989, Chichester, England. Laburthe, et al., &Quot; Molecular Analysis of Vasoactive Intestinal Peptide Receptors: A Comparison With Receptors for VIP Related Peptides, " Ann NY Acad. Sci., 527: 296-313 (1988). Frohm, et al., &Quot; Growth Hormone-Releasing Hormone, " Endocr Rev., 7: 223-253 (1986). Seifert, et al., &Quot; Growth Hormone-Releasing Factor Binding Sites In Rat Anterior Pituitary Membrane Homogenates: Modulation By Glucocorticoids, " Endocrinoly. 117: 424-426 (1985). Bilezikjian, et al., &Quot; Desensitization To Growth Hormone-Releasing Factor (GRF) Is Associated With Down-Regulation of GRF-Binding Sites, " Endocrinology. 118: 2045-2052 (1986). Ishihara, et al., &Quot; Functional Expression and Tissue Distribution of a Novel Receptor for Vasoactive Intestinal Polypeptide, " Neuron. 8: 811-819 (1992). Ishihara, et al., &Quot; Molecular Cloning and Expression of a cDNA Encoding the Secretin Receptor, " EMBO J, 10: 1635-1641 (1991). Lin, et al., &Quot; Expression Cloning of an Adenylate Cyclase-Coupled Calcitonin Receptor, " Science. 254: 1022-1024 (1991). Juppner, et al., &Quot; A Protein-Linked Receptor For Parathyroid Hormone and Parathyroid Hormone-Related Peptide, " Science, 254: 1024-1026 (1991). Frohman, et al., &Quot; Tissue Distribution and Molecular Heterogeneity of Human Growth Hormone Releasing Factor in The Transgenic mouse, " Endocrinology, 127: 2149-2156 (1990). Paul et al., &Quot; Characterization of Receptors for Vasoactive Intestinal Peptide Solubilized From the Lung, " .T Biol. Chem., 262: 158-162 (1987). Guijarro et al., &Quot; Solubilization of Active and Stable Receptors for Vasoactive Intestinal Peptide from Rat Liver, " Requlatorv Peptides. 25: 37-50 (1989). Cronin et al., &Quot; Biological Activity of a Growth Hormone Releasing Factor Secreted By a Human Tumor, " Am. J. Physiol., 244 (Endocrinol Metab) E346-E353 (1983). Leong et al., &Quot; Enumeration of Lactotropes and Somatotropes in Cultured Male and Female Pituitary Cells: Evidence in Favor of a Mammosomatotrope Subpopulation, " Endocrinology. 116: 1371-1378 (1985). Munson, et al., &Quot; Ligand: the Versatile Computerized Approach for Characterization of Ligand-Binding Systems, " Anal. Biochem., 107: 220-239 (1980). Wessel, et al., &Quot; A Method for the Quantitative Recovery of Protein in Dilute Solution in the Presence of Detergents and Lipids, " Anal. Biochem., 138: 141-143 (1984). Bagnato et al., &Quot; Gonadotropin-Induced

Expression of Receptors for Growth Hormone Releasing Factor in Cultured Granulosa Cells *, " Endocrinology, 128, 2889-2894 (1991) (compositions studied by Bagnato et al. Have GHRH binding properties that are different from the binding properties of pituitary tissues). All the

86 046 ΕΡ 0 591 697 / ΡΤ 7 articles and other documents mentioned herein are incorporated by reference as if reproduced in their entirety.

Although previous studies have helped to develop a preliminary understanding of the behavior of GHRH-R, there remains a need for a reproducible and reproducible assay for GHRH-R, which will be able to further characterize GHRH-R leading to the purification and cloning of GHRH -R. Such an assay has to overcome the problems of non-specific binding of GHRH and GHRH analogs, and of the low abundance of the GHRH receptor. The iodination and purification of GHRH analogs with a resulting high specific activity allows the enhancement of specific binding to crude anterior pituitary membranes.

Despite the multiplicity of routes that may be tried for GHRH-R receptor cloning and sequencing, substantial obstacles must be overcome regardless of the path followed. An example of such problems is seen in efforts to clone and express the VIP receptor; the initial claims of VIP receptor cloning and expression were repudiated in later publications, and this served to misdirect efforts to clone and express other receptors. See Sreedharan et al., &Quot; Cloning and Expression of the Human Vasoactive Intestinal Peptide Receptor, " Proc. Natl. Acad. Know. USA. 88: 4986-4990, (1990); Cook et al., &Quot; Characterization of the RDC1 Gene Which Encodes the Canine Homolog of a Proposed Human VIP Receptor, " FEBS Lett., 300: 149-152, (1991). Regarding the cloning and expression of GHRH-R, the scant amount of GHRH-R present in mammalian organisms makes it difficult to assemble a sufficient amount of purified receptor to determine sufficient of the amino acid residue sequence to construct GHRH-R specific oligonucleotide probes, R, which can then be used in the screening of a cDNA library. In addition, it is necessary to find a cDNA library containing sufficient GHRH-R genes to obtain a signal strong enough to be distinguishable from homologous genes which may also hybridize to the probe. Finally, expression and cloning, involving repeated screening of transformed cells for expression of a receptor, is not practical for GHRH-R cloning, since the existing techniques are not sensitive enough to be used in early GHRH-R; This is due to non-specific binding and the very small amount of

86 046

Receptor. Thus, there remains a need for a method for the cloning and expression of the gene encoding GHRH-R and its biologically active fragments, as well as a need for a living cell line having recombinant DNA encoding GHRH-R or its biologically fragments assets. There is still a need for research trials using GHRH-R or biologically active fragments thereof to test compounds which may interact with GHRH-R or fragments thereof. Since GRF has to be administered by injection, these assays are critical in the search for compounds that can be administered orally and that interact with the GHRH-R or fragments thereof. These assays are also critical for finding other compounds that interact as GHRH-R agonists or antagonists or fragments thereof. It is therefore a primary object of the present invention to provide a sensitive and reproducible assay for the binding of GHRH to the receptor. It is another object of the present invention to provide reagents for specifically and unambiguously labeling the GHRH receptor. It is yet another object of the present invention to provide a GHRH receptor purification scheme and to obtain a GHRH-R isolate of sufficient purity, or capable of being readily purified to a purity which allows at least partial sequencing of GHRH-R. It is a further object of the present invention to provide purified GHRH-R. It is a further object of the present invention to provide a method for the cloning of a gene encoding GHRH-R or biologically active fragments thereof. It is another object of the present invention to provide a purified, isolated nucleic acid sequence encoding a growth hormone releasing hormone receptor or biologically active fragments thereof. It is yet another object of the present invention to provide a vector comprising a nucleic acid sequence encoding a receptor of the

Or growth hormone releasing hormone, or biologically active fragments thereof. It is a further object of the present invention to provide a living host cell or line of cells comprising a nucleic acid sequence encoding a growth hormone releasing hormone receptor or biologically active fragment thereof. It is further an object of the present invention to provide a pharmaceutical composition comprising GHRH-R or biologically active fragments thereof, and a therapeutic method for administering an effective amount thereof to an organism, to bind to endogenous GHRH, or to elicit antibodies which are bind to the receptor and thus induce or block activity.

In addition, it is a further object of the present invention to provide recombinant GHRH-R sufficient to enable large-scale screening of peptides and xenobiotics for GHRH-R receptor binding ability.

SUMMARY OF THE INVENTION

This and other objects of the present invention are achieved by an improved GHRH binding assay which leads to the characterization and isolation of a crude (isolated) GHRH-R extract. The present invention provides the cloning of the gene encoding a GHRH-R and its biologically active fragments, and provides the amino acid sequences of a GHRH-R and biologically active fragments thereof, as well as probes or oligonucleotide primers which can hybridize to a gene encoding GHRH-R or fragments thereof. The present invention also provides recombinant organisms and their progeny comprising a gene encoding a GHRH-R and its biologically active fragments, said recombinant organism (" transformed ") not being GHRH-R above the background noise level or not containing said gene encoding GHRH-R prior to transformation. GHRH-R on pituitary membranes or on transformed or transfected organisms is characterized by the use of radioiodinated probes formed from GHRH analogs. GHRH analogs (GRFa, GHRHa, or GHRHb) and the like are iodinated in a preferred embodiment using solid phase iodide beads, and the mono-iodinated material is purified by reversed phase HPLC to provide 10 86 046 Î »0 591 697 / ΡΤ essentially free of carrier. Non-specific binding of GHRH analogs to glass and plastic material during delivery and dilution was substantially eliminated using organic solvents. In a preferred embodiment, fifty percent acetonitrile is used for the dilution and delivery of GHRH analogs. Specific binding of GHRH and GHRHa to crude anterior pituitary membrane pellets is increased by the addition of a pore-forming antibiotic. In a preferred embodiment, the antibiotic alameticin (at about 0.05 mg / ml) is combined with homogenized anterior pituitary membrane pellets to increase the specific binding of GHRH.

GHRH analogs containing GTP-sensitive UV-sensitive crosslinking groups (photosensors or photoaffinity probes) which cross-link with the GHRH receptor were demonstrated to be high specific affinity. The probes differ in both the location of the photosensitive group and the length of the spacer arm. Preferred photosensors are formed by coupling the analog of GHRH [His1, Nle27] -GHRH- (1-32) -NH2 to N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOS), or to sulfosuccinimidyl-6- (4 '-azido-2'-nitrophenylamino) -hexanoate (sulfo-SANPAH or SANPAH), followed by iodination and purification. Preferably, the coupling to the ANB-NOS reagent is directed to the lysines at positions 12 or 21; the compound is subsequently iodinated on the tyrosine at position 10, and the product is purified by reversed phase HPLC to form a photostat which will be referred to as 125 I-GHRHa-ANB-NOS. In an alternative embodiment, 125 I-GHRHα-SANPAH photosynthetic is formed in a solvent system of dimethylformamide by coupling SANPAH directed to the N-terminal histidine of GHRHa, reverse phase HPLC purification, tyrosine iodination at position 10 of GHRHa, and HPLC.

It has surprisingly been found that, by use of the aforementioned photoaffinity probes, it is possible to produce a soluble GHRHa complex linked to GHRH-R; the covalently crosslinked complex is readily soluble in a mild detergent solution, preferably containing a zwitterionic detergent compound capable of solubilizing proteins, such as 3 - [(3-cholamidopropyl) dimethylammonio] -1-propane sulfonate (referred to as CHAPS, available from Pierce or ICN Biomedicals, Irvine, Calif.), and that most non-specifically crosslinked contaminants are not soluble in the mild detergent solution. It was then verified that

86 046 ΕΡ 0 591 697 / ΡΤ 11 non-crosslinked complexes were also solubilized under these conditions. Photo-crosslinking was performed after solubilization and proved that the receptor (GHRH-R) and the ligand (GHRH-probe) had formed a stable soluble complex. In a preferred embodiment, this allows removal of up to about 90% of the non-specifically bound GHRH by extraction with a solution containing CHAPS, and the removal of free peptide with charcoal / dextran. This results in a greatly improved GHRH binding assay.

In a further embodiment, a partially purified GHRH isolate is obtained by affinity chromatography by binding to a GHRH function or a GHRH analog having affinity for a compound immobilized on a support. In a preferred embodiment, biotinylated derivatives of GHRHa to GHRH-R are ligated, solubilized, and then immobilized on a streptavidin column; the bound GHRH / GHRH-R complex was found to dissociate at pH 5.0 in a buffer, thereby forming a partially purified GHRH-R isolate, capable of being used to determine the amino acid residue sequence of the GHRH-R, which in a preferred embodiment occurs after further purification of the GHRH-R isolate using SDS-PAGE to remove compounds, such as G proteins, which would interfere with sequencing, and thereby to form purified GHRH-R.

In yet another embodiment, the present invention provides the cloning of a gene encoding a GHRH-R and biologically active fragments thereof.

Preferably, a gene encoding a GHRH-R activity protein or polypeptide is isolated and linked to a DNA vector to form a recombinant DNA; the DNA vector including said gene is capable of replicating in a prokaryotic or eukaryotic cell. The gene encoding a GHRH-R activity-encoding protein or polypeptide is located downstream of a promoter in the vector, and replicates as part of the vector. Recombinant DNA is then incorporated into a host cell, which did not previously contain said gene, to form a transformed or transfected cell line capable of expressing GHRH-R or biologically active fragments thereof.

In a preferred embodiment, a cDNA library prepared from a pituitary tumor secreting growth hormone is screened from a human acromegalic inserted into the λςΐ10 vector under conditions of low stringency with a probe based on rat secretin receptor cDNA, RS-R. Surprisingly, probes based on the rat secretin receptor cDNA will hybridize to at least a portion of the nucleotide sequence encoding a GHRH-R receptor, although clones representing the human secretin receptor will not be found in a significant amount in the library of human acromegalic pituitary tumor, HAP. This surprising finding (eg, higher amounts of DNA encoding proteins or polypeptides with GHRH-R activity than those found in normal pituitary tissue, without substantial competition activity, from secretin or other related receptors) allowed the cloning of a gene encoding a protein or polypeptides having GHRH-R activity. Significant was the surprising finding that the mouse cerebellum contained sufficient secretin receptor to be amplified using PCR to produce the RS-R probe used herein, despite a publication which teaches that the secretin receptor was not detectable in the mouse cerebellum . See Ishihara et al., EMBO. J. .. 10: 1635-1641 (1991).

Preferably, purification by formation of phage plaques hybridizing with the RS-R probe is followed by excision of the cloned gene from 7gt10, and insertion into the plasmid pGEM7Zf (+) which is then used to transform E. coli. The inserted gene is then sequenced by the dideoxy chain termination method after plasmid replication (amplification) in E. coli and purification. A labeled oligonucleotide probe is then prepared from partial sequence (s) resembling the cDNA of the receptor, and is used for high stringency screening of a second acromegalic pituitary tumor cDNA library , In the XBluemid vector, wherein the inserts are contained in the plasmid pBluescript (which is capable of carrying, for cloning purposes, insertions as large as the theoretically provided size of the complete gene encoding GHRH-R). This allowed the cloning and sequencing of the complete GHRH-R. In a preferred embodiment, the gene encoding GHRH-R is inserted into a eukaryotic expression vector, and the GHRH-R is expressed in a mammalian cell line. 86 046 ΕΡ 0 591 697 / ΡΤ 13

Thus, the present invention relates to a substantially pure protein and biologically active fragments thereof having growth hormone releasing hormone (GHRH) receptor activity. The receptor is purified at least 10,000 times with respect to the membrane bound receptor. &Quot; biologically active fragments " are meant natural or synthetic portions of the full length receptor that are capable of binding specific ligands of the receptor, or which are capable of eliciting, in a host animal, GHRH-R specific antisera or a response to a second messenger while still conjugated to a carrier or in an unconjugated form. In a preferred embodiment, the receptor is derived from a human source, but homologous receptors are also derived from vertebrate species such as, but not limited to, fish, poultry, ovine, caprine, bovine, porcine, murine, equine, and felines. The invention is also directed to pharmaceutical compositions comprising an effective amount of the pure receptor or fragments thereof, or proteins and polypeptides having GHRH-R activity in combination with a pharmaceutically acceptable carrier, and provides a method for the therapeutic use of such pharmaceutical compositions. The receptor and receptor fragments (proteins and polypeptides having GHRH-R or immunological ligand binding activity) are useful in screening methods for the identification of GHRH analogs, as well as in the identification of compounds which may act as antagonists of GHRH at the receptor site. They are also useful for creating GHRH-R specific antibodies; these antibodies may, by blocking the receptor site, effectively prevent GHRH binding and thereby block growth. Other antibodies may be used to activate the GHRH-R receptor (e.g., thyroid stimulating antibodies, such as those that cause Graves' Disease). Pharmaceutical compositions containing the receptor or segment fragments may be used to treat disorders that result from, or are associated with, an excess of circulating GHRH. Such compositions may be employed for in vivo administration to bind circulating GHRH, thereby preventing its binding to the endogenous receptor.

In a preferred embodiment, the invention provides an isolated nucleic acid sequence encoding a GHRH receptor, recombinant vectors including said sequence and host cells containing the

The invention also provides a method for the production of a GHRH receptor or biologically active fragments thereof (including proteins and polypeptides having GHRH-R activity).

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a bar graph demonstrating the binding of125 I-GHRHa to crude ovine pituitary membrane pellets. The bars indicate the fraction of the total counts bound to pellets after incubation with probe alone or in the presence of 10nM GHRHa or 50μM GTPyS. Four different cases (sets of bars) are shown. The first case (membrane) shows binding to a crude membrane pellet preparation. The second set (frozen) shows that there is little specific binding in the same membrane preparation after it has been frozen and thawed. The third set (DTT) shows binding to this same preparation (not frozen), but in the presence of 1 mM DTT. The fourth assembly (ala-lavage) shows an improved protocol of the present invention which includes the pore-forming antibiotic alameticin and an additional washing step. Error bars indicate the standard error of the mean, eN = 3 or 4 replicates per point. Figure 2 is a graph used for saturation binding analysis. Dots are given from binding assays performed in the presence of increasing levels of unlabeled GHRHa. Error bars indicate the standard error of the mean. The attached graph shows a representation of the same data and the curve in the Scatchard coordinate system (error base not shown in the appended graph). Figure 3 is an X-ray of an SDS gel demonstrating crosslinking of the receptor's photoaffinity. Cross-linking to crude sheep pituitary membranes is demonstrated with two different photosensors (SANPAH and ANS-NOS), each extracted by two different methods (SDS and CHAPS). The effect of deglycosylation enzymes is also shown in each case. CHAPS extracts show a greatly reduced non-specific binding. Both photosensors mark a 55 kDa band that deviates to 45 kDa after deglycosylation.

Figure 4 is an X-ray of an SDS gel gel as in Figure 3 showing crosslinking of CHAPS extracted ANB-NOS which demonstrates competition for 10 nM GHRH and also shows deglycosylation. Figure 5 is an x-ray of a photo-affinity crosslinking SDS gel as in Figure 4, which includes the effects of GTPγS and also partial deglycosylation with neuraminidase. Figure 6 demonstrates the solubility of GHRHa-GHRH-R complexes that were prepared by allowing radioiodinated GHRHa to bind to crude sheep pituitary membranes either in the presence or absence of unlabeled 10 nM GHRHa. Figure 7 shows photoaffinity crosslinking of soluble complexes produced following the experiment of Figure 6 with ANB-NOS-GHRHa photosensitive, and the detergent-soluble fraction was UV crosslinked after extraction. The two leftmost tracks were extracted with CHAPS and the two tracks to the right were extracted with deoxycholate. Figure 8 demonstrates the stability of CHAPS solubilized dextran and charcoal treated GHRHa-GHRH-R complexes that were exposed to 50 μM GTPγS (± 5 mM Mg ''), 10 nM DTT, or Triton X-100 a 1% for 30 minutes and then further treated with dextran and charcoal to quantitate the amount of dissociation. Figure 9 demonstrates the dissociation of low pH GHRH-GHRH-R complexes being the stability of specific complexes soluble at various pH evaluated as in Figure 8. Additional data indicate that practically complete dissociation at pH 5 or less is obtained. Figure 10 demonstrates SDS-PAGE analysis of the eluate containing purified GHRH-R obtained by affinity chromatography of the biotinylated GHRHb-GHRH-R receptor complex on a streptavidin agarose column. Figure 11 demonstrates the behavior of purified GHRH receptor deglycosylation as seen by mobility on a gel of b

86 046

SDS. Seven samples corresponding to seven lanes were run on the gel. (+) Signals indicate the presence of purified 125β-receptor, photo-crosslinked receptor, N-glycosidase, or 10 nM GRFÎ ±). The leftmost lane illustrates the band produced by iodinated purified receptor, while the adjacent lane shows the band produced by treatment of the purified N-glycosidase iodinated receptor, resulting in a molecular weight of approximately 42 kDa. The third lane from the left illustrates that 10 nM GRFα competed with an iodinated GRF analog capable of cross-linking with the receptor, so that no band was observed. The fourth and fifth lanes illustrate the effect of N-glycosidase on purified iodinated receptor and iodinated photo-crosslinked receptor, respectively. A photo-crosslinked iodinated GHRH analogue to GHRH-R and an iodinated purified receptor are run on lanes 6 and 7, respectively. It should be noted that the photocrosslinked receptor has higher molecular weight, and that the N-glycosidase treated samples have lower molecular weights. Figure 12 is a flowchart of a procedure followed for the preparation of a plasmid useful in the expression of a growth hormone releasing hormone receptor in a mammalian cell line. Figure 13 is a representation of the plasmid pBluescript, illustrating the insertion of HAP, various restriction sites, and other characteristics of the plasmid. Figure 14 is a representation of the CDM8 plasmid illustrating the insertion of PAH, the relative locations of various restriction sites, and other characteristics of the plasmid. Figure 15 is a bar graph demonstrating the binding of 125 I-GHRHa to COS cells transfected with vectors containing AT, or HAP, angiotensin. The bars indicate the total cell bound counts after incubation with 125 I-GHRHa or in the presence of gradually increasing amounts of non-iodinated GRF. Incubation of COS cells with 125 I-GHRHa in the presence of 100 nM VIP had no effect on bound GHRHa counts. Figure 16 shows the binding of iodinated GHRHa to membranes of cells transfected with pCDM8 containing the HAP 7 cDNA or the gene encoding

86 046 ΕΡ 0 591 697 / ΡΤ 17 for the rat angiotensin receptor. Binding is shown in the presence of increasing concentrations of competing peptides. The filled circles represent binding in the presence of non-iodinated GHRH to membranes formed from cells transfected with a gene (HAP 7) encoding a GHRH-R. Squares represent binding in the presence of non-iodinated GHRH to membranes formed from cells transfected with a gene encoding rat angiotensin receptor. The filled triangles represent binding in the presence of PACAP to membranes formed from cells transfected with a gene (HAP 7) encoding a GHRH-R, the blank triangles represent the binding in the presence of VIP, and the white circles represent the binding in the presence of secretin. Each point represents an N of 6 ± the standard error. Non-specific binding was 20-30% of the total counts in COS cell membranes, and 40-60% in crude pituitary membranes. Figure 17 shows the binding of125 I-GHRHa to ovine pituitary in the presence of gradually increasing concentrations of competing peptides. The filled circles represent GHRHa, the filled triangles represent PACAP, and the blank triangles represent VIP. Figure 18 is a hydropathic representation of the amino acid sequence shown as SEQ ID NO: 8; S indicates the putative signal peptide, and 1-7 indicate putative transmembrane transposing helices. Figure 19 is a hydropathic representation of the amino acid sequence shown as SEQ ID NO: 10; S indicates the putative signal peptide, and 1-7 indicate putative transmembrane transposing helices.

DETAILED DESCRIPTION OF THE INVENTION

A comprehensive approach to cloning of the GHRH receptor involves (1) the characterization of the GHRH receptor, (2) the use of knowledge of the characteristics of the GHRH receptor to isolate the GHRH receptor, (3) determination of the receptor peptide sequence (or a portion of the GHRH receptor), (4) determining the DNA sequence that is responsible for producing the GHRH receptor through the use of degenerate oligonucleotide sequences (which may be from receptors that are

86 046 and 591 697 / ΡΤ 18 create homologues to GHRH-R) to screen a cDNA library, and (5) cloning the DNA sequence.

CHARACTERIZATION OF GHRH-R

GHRH binding assay.

In one aspect, the present invention is directed to a reproducible and sensitive assay for the binding of GHRH to the GHRH receptor, which demonstrates GHRH-dependent, reversible, GHRH-specific, high affinity binding. Due to the high non-specific binding of the negatively charged GHRH peptide, the use of a simpler filtration type binding assay has been impossible. With the assay of the present invention, the specific binding (defined as the gamma ray counts, y, produced by binding of 125 I-GHRHa which are removed from homogenized membrane pellets by 10 nM GHRHa) is from 30 to 60% of the total counts bound in crude membrane pellets and up to 90% of the counts after extraction with a mild detergent (eg CHAPS) and charcoal / dextran treatment. A preferred embodiment of the binding assay of the present invention involves many factors, including a moderate solid phase iodination protocol, HPLC purification of carrier free radioligand, an organic solvent system for the quantitative delivery of GHRHa, assays in both plated cells as in reverse hemolytic plaques, to confirm the biological activity of the probe, and the use of about 0.05 mg / ml of alameticin, a pore-forming antibiotic, to increase the specific binding of the radioligand to the anterior pituitary membrane pellets. Alameticin increases specific binding and decreases entrapment counts. A wash decreases the recovered counts but additionally increases the relative amount of specific binding.

A preferred GHRHa analogue for receptor binding studies is [His1, Nle27] -GHRH- (1-32) -NH2 (referred to as GHRHJ). The GHRH analog is a peptide having good GHRH-R binding activity , and differs from the human sequence in length, and has two amino acids, which are altered to facilitate its use as an iodination substrate. A preferred source of GHRHa is Peninsula Laboratories (Belmont, CA).

The preparation of iodinated GHRH analogues of optimal activity and biological activity is carried out by first iodifying the analogues of GHRH

86 046

(Including photosensors) using solid phase iodine beads (such as those available from Pierce), and then the mono-iodinated material is purified to essentially carrier-free by reverse phase HPLC using preferably a Bio-Series Poly F fluorocarbon based (available from MacMod). The quantitative dilution and delivery of GHRH analogs is achieved using organic solvents, preferably 50% acetonitrile in aqueous solution is used as the carrier. In this way, imprecise and non-reproducible dilutions found with aqueous vehicles are avoided.

It has been surprisingly found that a approximately three fold increase in specific binding is obtained compared to the previous methodology when combining a pore-forming antibiotic with crude anterior pituitary membrane pellets (See Struthers, et al. In a preferred embodiment, the addition of about 50 pg / ml of the antibiotic alameticin is used to obtain the optimal specific binding.

Referring to Figure 1, the binding of 125 I-GHRHa probe to crude membrane pellets that had been treated under different conditions is shown. There are four sets of three bars. Each bar in a set indicates the fraction of total counts bound after incubation with iodinated probe. For each set of three bars, the left bar indicates the total counts bound after incubation with iodinated probe alone, without pre-exposure of the membranes to cold GHRH or other compound known to compete with GHRHa or interfere with the binding of GHRHa. The center bar indicates the fraction of total counts bound after incubation with iodinated probe that were added to the incubation together with unlabeled 10 nM GHRHa (which competes for the specific binding sites). The difference between the leftmost bar and the center bar of each set of bars indicates the specific binding of GHRH, which represents the amount of GHRH-R present. The right bar indicates the fraction of total counts bound after incubation with 125 I-probe in the presence of 50 μ GTPyS. As GTPγS is known to cause G-protein dissociation of some receptor complexes resulting in decreased affinity and decreased binding, the decrease in specific binding when using GTPγS is consistent with the presence of GHRH-R-G protein complex.

J

Specific binding is defined as the difference in binding observed with 20 pM of iodinated analogue alone and binding of the analog in the presence of 10 nM non-iodinated GHRHa. Saturation binding, Scatchard analysis; competition studies, and other data discussed herein, show that these high affinity sites are specific binding sites.

Referring to Figure 2, saturation binding studies demonstrate the binding of the GHRH analog [His1, Nle27] -GHRH- (1-32) -NH2 (GHRHa) to a single high affinity site with a Kd of about 160 pM. Some error bars were too small to be shown (N = 6 replicates per point). These data were analyzed with the Ligand computer program, which determines binding constants based on a statistically weighted adjustment of least squares to the ligand binding equation in a non-transformed coordinate system. The program reports a single binding site with a Kd = 150 ± 10 pM and R = 1.5 ± 0.09 pmol / g tissue (best fit value = approximate SEM of the adjustment). Statistical tests support this single binding site model. The dotted line is the theoretical curve generated using these constants in the binding equation. The specific binding of radioligand GHRHa is reduced by up to 65% by 50 μM GTPyS. VIP and PACAP related peptides did not compete at this binding site at concentrations of 100 nanomolar. This binding represents a GHRH-R bound high affinity G protein. It is known that VIP binding to the VIP receptor is sensitive to sulfhydryl reducing agents. This specific binding in the GHRH assay is completely eliminated by preincubation with 1 mM dithiothreitol (DTT, which is known to avoid high affinity binding to related receptors), and thus further supports the conclusion that the GHRH-R receptor is location.

PHOTOAFINITY PROBES

Photoaffinity probes were prepared using photoreactive crosslinking agents; these probes differ in both the location of the photosensitive group and the length of the spacer arm. The probes are capable of binding to GHRH-R in the absence of UV radiation and cross-linking to GHRH-R under the influence of UV radiation. Preferred non-limiting examples of photoaffinity probes and methods for preparing them are as follows:

86 046 ΕΡ 0 591 697 / ΡΤ 21

1) 125l-GHRHa-ANB-NOS Ο 32-amino acid GHRH analog [His / Nle27] -GHRH- (1-32) -NH2 (GHRHa) was coupled to N-5-azido-2-nitrobenzoylisoxysuccinimide reagent (ANB- NOS) directed to lysine 12 or 21 to form GHRHa-ANB-NOS. The GHRHa-ANB-NOS was iodinated using iodine beads to form the radioligand (" photosounder " 125l-GHRHa-ANB-NOS, " hot GHRHa-ANB-NOS " or " hot probe " are available from Pierce, Rockford, IL).

2) 1-GHRHa-SANPAH

In a system of dimethylformamide solvents, the GHRH analogue of N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOS) was coupled to sulfosuccinimidyl-6- ( 4'-azido-2'-nitrophenylamino) hexanoate (sulfo-SANPAH or SANPAH) directed to the N-terminal histidine of GHRHa. The radioiodinated material was then purified to essentially free of the starting peptide by reverse phase HPLC on a Bio-Series Poly F fluorocarbon base (available from Mac-Mod Analytical, Chadds Ford, PA) using a slight gradient of acetonitrile. Binding of photosensors to ovine pituitary membrane pellets was determined by yeast counting and UV-induced crosslinking was examined by autoradiography of sodium dodecylsulfate polyacrylamide (SDS-PAGE) electrophoresis gels. The 125 I-GHRHa-ANB-NOS probe was ligated with an affinity of about 1 nanomole, nM (compared to about 160 picomoles, pM, for GHRHJ. SDS-PAGE revealed a band at about 55 kDa for pituitary (for the 57 kDa bovine pituitary), which was completely eliminated in the presence of 10 nM GHRHa, this band was reduced by more than 50% by 50 μM GTPyS, and was not affected by 100 nM VIP. Figure 3 shows that this 55 kDa specific band is separated from most non-specifically crosslinked material by CHAPS extraction Figure 4 demonstrates the competition with GHRHa 10 nM Figure 5 demonstrates the effect of GTPγS on the crosslinking The treatment of the neuraminidase crosslinked GHRH receptor caused the 55 kDa band to deviate to 50 kDa, which is attributed to the removal of charged terminal sialic acid groups which decrease to 22 86 046 ΕΡ 0 591 697 / ΡΤ mobility n the gel (Figure 5). Treatment of cross-linked GHRH receptor with a purified, protease-free, endoglycosidase F and N-glycosidase F (available from Boehringer Mannheim, Indianapolis, Indiana) gel caused a shift in gel mobility to form a 45 kDa band (shown in Figures 3 and 4); this indicates that the GHRH receptor is an N-linked glycoprotein (common among G-protein bound receptors) and suggests the size of the deglycosylated protein chain. This size is consistent with the structure of VIP and secretin receptors.

Tests with immobilized lectins showed no binding of the cross-linked GHRH receptor to agglutinin from wheat germ, ricin, ligule agglutinin, or concanavalin A. This renders the receptor unusual and offers an approach to the purification and isolation of this receptor from other binding receptors to these lectins. After treatment with neuraminidase and β-galactosidase, the receptor specifically bound the peanut agglutinin, providing an additional approach to the separation and purification of the GHRH receptor.

SOLUBLE GHRH-GHRH-R COMPLEX AND ENHANCED BINDING ASSAY Photoaffinity crosslinking has shown that the covalently coupled receptor-ligand complexes are soluble in a mild detergent solution, preferably in a solution containing CHAPS. Preincubation of GHRH with the receptor, using the conditions of the aforementioned membrane binding assay, allowed extraction with CHAPS and solubilization of an intact receptor-ligand complex even when uncrosslinked. This complex was detected by gamma counting after the detergent extraction of membranes incubated with125 I-GHRHa (GHRHa " warm ") without cross-linking. Figure 6 shows that most of the specific counts observed on the crude membrane were extracted with CHAPS in the form of a specific complex associated with the receptor. The data of Figure 6 were obtained as follows. Radioiodinated GHRHa was allowed to bind to crude sheep pituitary membranes either in the presence or absence of unlabeled 10 nM GHRHa. This was followed by extraction with detergent and centrifugation; the supernatants were treated with charcoal / dextran to separate the bound free GHRHa protein, and the radioiodine of each fraction was counted. The bound GHRHa bound on the blank membrane could thus be followed after treatment with detergent and characterized as: (1) insoluble, (2) soluble and not specifically bound, (3) specifically bound but dissociated from

(4) soluble and specifically bound. As is known from photocrosslinking, most counts not specifically bound were not soluble in CHAPS. Extraction with a detergent blend with deoxycholate solubilized slightly more total counts, but many of these were unstable and were dissociated, and the non-specific counts predominated. Figure 7 shows the results of this photo-crosslinking to confirm that this complex contained the receptor. The membranes were pre-ligated with photoslond (125 I-ANB-NOS-GHRHa) in the dark, extracted with CHAPS, and then UV-crosslinked. This proves that GHRH was still bound to the solubilized receptor. In the CHAPS extract, most of the binding was in the 55 kD receptor band whereas in the case of deoxycholate most of the bands were non-specific. This is in good agreement with the binding studies shown in Figure 6 (although the photosamonds have the highest non-specific binding), and demonstrates that the specific binding of the GHRH analogue in the soluble complexes is at the 55 kDa receptor. Consistent with Figure 6, the complex was much more stable in CHAPS than in deoxycholate. There were also some non-specific bands (One immediately below the 55 kDa receptor band) after photo-crosslinking the CHAPS extract. Figure 8 demonstrates that CHAPS extraction is elevated to an enhanced binding assay with greatly reduced nonspecific counts and increased sensitivity (Compare with Figure 1). This figure also shows that the complex is partially dissociated by 50 μM GTPyS, suggesting that the G proteins are still associated with the solubilized complex in a detergent solution containing CHAPS. Figure 1 shows that 1mM DTT prevented specific binding to GHRH when added. Figure 8 shows only a partial effect of 20 mM DTT after the occurrence of pre-binding. This complex was also quite stable in NaCl up to 1M overnight at 4 ° C, but was completely dissociated by 1% Triton X-100 (surfactant). Note the poor background noise obtained when using CHAPS-soluble samples treated with charcoal and dextran in a binding assay. The pH stability of the soluble receptor-ligand complex is shown in Figure 9. There is a marked transition with the unstable complex at pH 5.5 and below, stable and capable of permutation of bound GHRH with free GHRH between pH 5.5 and 6, and very stable and non-exchangeable at pH 7. The stability of this

The complex gives us both an improved GHRH-R binding assay, and the basis for a novel receptor purification methodology.

ISOLATION AND PURIFICATION OF GHRH-R

Biotinylated GHRH analogs were developed with the aim of purifying the GHRH receptor in the form of a receptor-ligand complex which could be retained on immobilized streptavidin. The first analog tested was [His1, Nle27] -GHRH- (1-32) -NH2 (biotinylated GHRHJ in lysines at positions 12 and / or 21 using the N-hydroxysuccinimide reagent, NHS-LC-Biotin (available from Pierce ) This analog was iodinated on the 10-position tyrosine and resolved into the mono- and dibiotinylated forms on HPLC More than 90% of these products were bound to immobilized streptavidin in 30 minutes The monobiotinylated GHRHa had a receptor binding affinity twice reduced compared to GHRHa while the dibiotinylated had practically no activity The biotin group appears to be in the receptor binding pocket as the binding to streptavidin blocked the binding to the receptor The next analogue tested was [His 1, Nle27, Cys33] -GHRH- (1-33) -NH2 It had a strong tendency to dimerize and none of the species that could displace GHRHa in a competition binding assay was biotinylated.

It has been surprisingly found that [His 1, Nle 27, Biotin-Lys 41] -GHRH- (1-4) -NH 2 (referred to herein as GHRHb) binds to the receptor with an affinity comparable to that of GHRHa (a preferred source for preparation of GHRHb is Nuros Corporation of San Jose, California). To prove that this analogue could be used in the purification of the receptor, it was iodinated, a photosensitive crosslinking group (ANB-NOS) was incorporated, and the compound was purified by HPLC. This GHRH-iodo-biotinyl-photoactivatable, 125I-GHRHb-ANB-NOS, was bound to receptors on crude bovine pituitary membranes. The receptor-ligand complexes were solubilized in CHAPS, extracted with charcoal and dextran to remove free GHRH and bound to immobilized streptavidin.

To test whether streptavidin dislodged the receptor from its complex, UV samples were cross-linked before and after binding to streptavidin and analyzed by autoradiography. This demonstrated that a significant fraction (30%) of the receptor that was available for binding could be retained in streptavidin beads. Stability studies of the complex

(See Figure 9) indicate that a high salinity solution (NaCl 0.5 M) solution of the streptavidin beads followed by a low pH elution (pH 5 ) (preferably using a phosphate buffer solution, acetate, citrate or other suitable buffer) results in a significant purification of the receptor to produce a GHRH-R isolate. The GHRH-R isolate obtained is of sufficient purity to allow GHRH-R sequencing; in a preferred embodiment G proteins and other interfering contaminants are removed by methods such as but not limited to gel electrophoresis to obtain GHRH-R of at least sufficient purity to carry out the sequencing. Figure 10 demonstrates the results of affinity purification of the biotinylated (GHRHb-GHRH-R) receptor complex on a streptavidin agarose column. The agarose beads, having the bound complex, were washed with 0.5 m NaCl to minimize non-specific binding and then the receptor was dissociated from the biotinylated ligand at pH 5.0, and eluted from the column. The eluate was concentrated by centrifugal driven ultrafiltration, and analyzed by SDS-PAGE. A control column was run in parallel and treated in the same manner except that the soluble receptor complexes were pre-ligated to the non-biotinylated GHRHα analog. The GHRHb lane in this silver-stained gel shows bands at 52 and 45 kDa that are not observed on the GHRHa lane. The 52 kDa band corresponds to the expected size for the receptor since the 55 kDa band observed in cross-linking studies includes the covalently bound 3.6 kDa GHRHa peptide. The 45 kDa band is the size reported for the stimulatory G protein, Gs, which is thought to be a subunit of the GHRH receptor complex. Coelution of these two bands and their absence in the control column confirms that highly purified GHRH-R was prepared. The confirmation of GHRH-R is also proved by iodination of the purified protein corresponding to the band produced on an SDS gel having a molecular weight of approximately 52 kDa, and subsequent deglycosylation of this protein with endoglycosidase F, which diverts the band to a protein having a molecular weight of approximately 42 kDa. This shift reflects the same molecular weight decrease for the photoaffinity labeled receptor.

86 046 ΕΡ 0 591 697 / ΡΤ

Referring to Figure 11, SDS gel electrophoresis illustrates the deglycosylation behavior of the purified GHRH receptor. In the leftmost lane, a band corresponding to the purified iodinated receptor, having a molecular weight of approximately 52 kDa (to assist in reading the legend of Figure 11, the (+) plus sign indicates the presence of the compound listed on the left, while the minus sign (-) indicates that the compound on the left is not present). In the second lane, a single band is shown, which reflects a protein having the molecular weight of about 42 kDa; this band resulted from the treatment of iodinated receptor purified with N-glycosidase. The third lane illustrates the competition between 10 nM GHRHa (" GRFa ") and iodinated GHRHa having a photocrosslinking group, which is capable of photocrosslinking the receptor; since no band is observed, it is clear that GHRHa displaces 125 I-GHRH. The fourth lane shows the effect of N-glycosidase on the photo-cross-linked receptor to iodinated GRF. The sample in the fifth lane is identical to the sample in the second lane, and it is noted that the fourth lane shows that the protein producing the lane has a slightly higher molecular weight than the protein in the fifth lane, reflecting the increased molecular weight due to the of photo-crosslinking in the GHRHa receptor complex. The sixth lane shows the highest molecular weight band for photo-crosslinked receptor to iodinated GHRHa. The sample in the seventh lane is identical to the sample in the first lane. Thus, Figure 11 illustrates conclusively that GHRH-R has been purified and isolated. The present invention encompasses proteins and polypeptides produced by any means, either synthetically, recombinantly, or by purification of the native protein, having the GHRH-R activity or fragments thereof (i.e. including vertebrate GHRH-R and its biologically active fragments) . The protein sequence obtained from purified GHRH-R can be used to design oligonucleotide probes which are used to screen cDNA libraries from cells expressing GHRH-R. The probes may also be based on receptors believed to be GHRH-R homologues. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 in the sequence listing presented immediately prior to the claims show, as nonlimiting examples, primers oligonucleotide sequences useful for the formation of probes , through polymerase chain reaction (PCR) methodology; these probes are based on the published rat secretin receptor, RS-R, and are useful for probing a library of

86 046

CDNA containing genes encoding homologous proteins. Hybridization of probes with the library identifies the clone or clones containing homologous genes or portions thereof. The gene or gene fragments are isolated from the clones, the whole gene is reconstructed, and then ligated to an appropriate vector.

In one embodiment, the above-mentioned probes, formed from the primers in SEQ ID NO: 1 to SEQ ID NO: 4 based on the rat secretin receptor cDNA, are used to screen under stringent conditions a cDNA library prepared from an acromegalic human growth hormone secreting pituitary tumor in the Xgt10 vector (such as that available from Clontech, Paio Alto, California, #HL 1097a, randomized and oligo (dt)) (one non-limiting example of low stringency conditions includes a final wash at 42øC with a buffer containing 30 mM NaCl and 0.5% SDS). This type of tumor is thought to be derived monoclonally from pituitary somatotrophs, and is normally responsive to GHRH, indicating the presence of functional GHRH receptors and suggesting that this is an enriched source of GHRH receptor mRNA. See Ikuyama et al., &Quot; Characterization of Growth Hormone-Releasing Hormone Receptor and Pituitary Adenomas from Patients with Acromegaly, " J. Clin. Endocrinol. Metab., 66: 1265-1271 (1988). For specific molecular cloning methods and laboratory techniques see Sambrook et al (" Maniatis, " Molecular Cloning: A Laboratory Manual Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989). information on peptide hormones, protein purification, and cloning of genes include Rosselin, " The Receptors of the VIP Family Peptides (VIP, Secretin, GRF, PHI, PHM, GIP, Glucagon and Oxyntomodulin.) Specificities and Identity, " Peptides 7: Suppl 1, 89-100, (1986); Masu, et al., &Quot; Sequence of Expression of a Metabotropic Glutamate Receptor, Nature, 349: 760-765, (1991); Houamad et al., &Quot; Cloning, Expression, and Gene Structure of a G-Protein-Coupled Glutamate Receptor from Rat Brain, Science 252: 1318-1320, (1991); Tanabe et al., &Quot; A Family of Metabotropic Glutamate Receptors, " Neuron Abou-Samra et al., &Quot; Expression Cloning of a Receptor for Parath. yroid Hormone-Related Peptide from Rat Osteoblast-like Cells: A Single Receptor Stimulates Intracellular Accumulation of Both CAMP and Inositol Trisphosphates and Increases Intracellular Free Calcium, " Proc. Natl. Acad. Know. USA. 89: 2732-2736, (1992); Libert et al., &Quot; Selective Amplification and

86 046 ΕΡ 0 591 697 / ΡΤ

Cloning of Four New Members of the G Protein-Coupled Receptor Family, " Science, 244: 569-572 (1989); McFarland et al., &Quot; Lutropin-Choriogonadotropin Receptor: An Unusual Member of the G Protein-Coupled Receptor Family, " Science, 245: 494-499, (1989); Battey et al., &Quot; Molecular Cloning of the Bombsin / Gastrin-Releasing Peptide Receptor from Swiss Cells, " Proc., Natl. Acad. Know. USA, 88: 395-399, (1991); Hulmes et al., &Quot; Partial Amino Acid Sequence of a Somatostatin Receptor Isolated from Gc, Pituitary Cells, " Biochem. Biophys. Comm. 184: 131-136, (1992); Masu et al., &Quot; cDNA Cloning of Bovine Substance-K Receptor Through Oocyte Expression System, " Nature, London, 329: 836-838, (1987); Spindel et al., &Quot; Cloning and Functional Characterization of a Complementary DNA Encoding the Murine Fibroblast Bombesin / Gastrin-Releasing Peptide Receptor, " Mol. Endocrinol., 4: 1956-1963, (1990); Straub et al., &Quot; Expression Cloning of the cDNA Encoding the Mouse Pituitary Thyrotropin-Releasing Hormone Receptor, " Proc. Natl. Acad. Know. USA. 87: 9514-9518 (1990); Sasaki et al., &Quot; Cloning and Expression of a

Complementary DNA Encoding to Bovine Adrenal Angiotensin II Type-1 Receptor, " Nature, 351: 230-233, (1991); White, et al., &Quot; Expression of Functional Pituitary Somatostatin Receptors in Xenopus Oocytes, " Proc. Natl. Acad. Know. USA. 87: 133-136, (1990); Abou-Samra et al., &Quot; The PTH / PTHrp Receptor Activates Adenylate Cyclase and Phospholipase C Through Two Distinct Molecular Domains, " Endocrine Societv 74th Meetinq. Summary 836, (1992).

Clones obtained from library screening under low stringency conditions were sequenced by the dideoxy chain termination method, and clones were used which included partial sequences similar to the receptor cDNA to produce oligonucleotide probe (s) ) of human acromegalic pituitary, HAP, " HAP probes ". In a non-limiting example, the oligonucleotide sequences in SEQ ID NO: 5 and SEQ ID NO: 6 were hybridized with one another (note that there was a 10 bp overlap), and the Klenow fragment of DNA- polymerase to fill non-annealed sections with radiolabeled nucleotides. These HAP probes, SEQ ID NO: 5 and SEQ ID NO: 6 were then used for high stringency screening of a cDNA library prepared from acromegalic pituitary tumor mRNA that had been completely denatured by methylmercuric hydroxide to optimize the 5 'extension of the cDNAs (available from Clontech, 5' Stretch HL 1097v) 29 86 046 ΕΡ 0 591 697 / ΡΤ (a non-limiting example of high stringency conditions includes a final wash at 65øC with a buffer aqueous solution containing 30 mM NaCl and 0.5% SDS). This cDNA was started with oligo (dt), selected by size (> 500 bp), and cloned in the XBluemid vector. This vector facilitates sequencing since they are insertions in the plasmid pBluescript and need not be subcloned. Search of this library with PAH probe (s) has led to the identification of clones containing a GHRH receptor gene or portions thereof (as defined herein, genes encoding proteins or polypeptides with specific, high affinity GHRH binding activity , as may be determined by the assays of the present invention, are considered to be a GHRH-R gene or portions thereof. SEQ ID NO: 7 provides the 1257 bp nucleotide sequence coding strand of a cDNA encoding the protein having GHRH-R activity, and SEQ ID NO: 9 provides the nucleotide sequence coding strand of 1272 bp of a cDNA encoding the protein having GHRH-R activity; the sequence includes a stop codon, TGA (A represents deoxyadenyl acid, G represents deoxyguanylic acid, C represents deoxycytidylic acid, and T represents deoxythymidylic acid). SEQ ID NO: 8 shows the 418 amino acid residue sequence of a protein having GHRH-R activity, corresponding to the nucleotide sequence of SEQ ID NO: 7. SEQ ID NO: 10 shows the 423 amino acid residue sequence of a protein having GHRH-R activity, corresponding to the nucleotide sequence of SEQ ID NO: 9. The gene included in SEQ ID NO: 7 and SEQ ID NO: 9, or fragments thereof, was isolated from the clones, the complete gene was reconstructed, and then ligated into an expression vector. Unfortunately, E. coli could not be routinely or easily used as the host cell to produce the glycosylated protein. Therefore, it was necessary to find a suitable expression vector in which to insert a GHRH gene to allow expression in a mammalian cell. In a preferred embodiment, the CDM8 expression vector available from Invitrogen of San Diego, California is used and the gene is expressed on COS cells (a monkey cell line transformed with SV40 viral genome containing a viral origin of replication When introduced into COS cells, cDNA inserted into pCDM8 directs the production of mRNAs which are translated into protein). The invention encompasses any and all host cells transformed or transfected with genes encoding GHRH-R or their

86 046

And expression vectors used to achieve this transformation. It is contemplated that transgenic animals may be raised, comprising mutated receptors, sense and antisense mRNAs that alter receptor function in vivo.

Isolation of Subtypes of Non-Human Homologous Receptors

Homologous receptors of other tissue types or of other species may be prepared as follows. CSF libraries prepared from specific tissue or species type mRNA of interest are screened with radiolabeled HAP cDNA and washed under medium stringency conditions (eg, 1xSSC, 0.1% SDS, 55ø W). Plaques that look positive are researched again to verify authenticity. Positive plaques are then used in plasmid retrieval according to techniques known in the art. The recovered plasmids are purified, cut with appropriate restriction enzymes, and analyzed on an agarose gel stained with ethidium bromide. The second gel is transferred to a nitrocellulose filter, probed with labeled HAP, washed sequentially under medium stringency conditions and after high stringency (0.1 x SSC, 0.1% SDS, 65øC), and exposed to an x-ray film. Inserts that hybridize strongly to PAH under high stringency conditions are likely candidates for receptor cDNA. Further confirmation of the identity of these putative receptors may be performed according to the protocols described in the following examples, or according to routine techniques known in the art. Thus, the invention encompasses not only the nucleotide and amino acid sequences shown in the sequence listing but also nucleotide sequences which hybridize under medium or high stringency conditions to the nucleotide sequence encoding the amino acid sequence of SEQ ID NO : 8 or the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10, as well as the biologically active proteins or fragments encoded by them.

Conception and Utility of Research.

The investigations utilize the purified or recombinant receptor in solid phase or liquid phase or in a host cell. The expression in the search is measured by ligand binding, second messenger function, secretion of the product, or by other means. Solid-phase assays may involve the receptor attached to a solid support, chemically or immunologically, together

86 046 ΕΡ 0 591 697 / ΡΤ with or without transduction proteins. Such assays may be linked to a reporter such as an antibody, a biological chemical compound (e.g., biotin), or a binding protein or enzyme, which will express a radioactive, chemical, calorimetric or luminescent signal. Searches involving host cells may employ bacterial cells or higher (e.g., yeast, insect, mammal) cells. Optimal mammalian host cells include GHRH-secreting pituitary tumor cell lines, and cell lines secreting other products in response to stimulation of the transfected GHRH-R.

GHRH-R Therapeutic Utility GHRH-R can be applied to the treatment of clinical growth deficiency in children and adults, can restore normal body strength and composition (muscle vs. fat), and delay or reverse some aspects of aging related to body composition and muscular endurance, can improve sleep control, and can be used to increase growth in domestic cattle, as well as increase lactation in dairy animals, and improve immune functions, control of the appetite, food efficiency and nutrition.

PRODUCTION OF GHRH RECEPTOR ANTIBODIES The technique of hydrophilicity analysis of primary information on sequences has been commonly used to identify both transposing domains of potentially hydrophobic membranes and hydrophilic antigenic sites. Analysis of the GHRH receptor cloned by the Hopp and Woods method, see Figures 18 and 19 (Hopp, TP, and Woods, KR, Proc. Natl. Acad., 78: 3824 (1981)). This is a common property in the family of G protein bound receptors, Wang, H., Lipfert, L., Malbon, C., and Bahouth, B., J. Biol. Chem., 264: 14424 (1989 (EC-1, EC-2, EC-3) and an N-terminus containing sites for asparagine-linked glycosylation. In order to produce antibodies that block or activate the receptor, fragments of extracellular loops, particularly those that do not contain N-glycosylation sites (the carbohydrate may interfere

86 046 ΕΡ Ο 591 697 / ΡΤ stereochemically with antibody binding). However, intracellular loops (ICs) are also useful in the production of antibodies that can be used for solid phase binding of the receptor protein in research and other assays. A recent study of antibodies directed against the three EC loci of the thyrotropin receptor indicates heterogeneity in its biological activities, including the induction of blocking antibodies using the EC-3 back as antigen. See Ohmori, M., et al., Biochem. Biophys. Res. Comm., 174: 399 (1991). Therefore, a large panel of anti-peptide and anti-receptor antibodies is prepared and carefully evaluated in order to determine the epitopes required for the induction of blocking or activating antibodies.

The peptides are produced by conventional solid phase synthesis, cleaved with HF, and purified by HPLC (van Regenmortal, MH, in Svennthetic Peptides as Antigens, Elsevier, New York, pages 41-93 (1988). transgenic immunoglobulin such as keyhole limpet hemocyanin (KLH) or ovalbumin via glutaraldehyde by conventional procedures, and these conjugates are used to immunize mice and rabbits. See Coligan, et al., in Current Protocols in Immunology , Vol. 1, Wiley-Interscience, New York (1991) The animals are given the first immunization of peptide conjugated to Complete Freunds Adjuvant and three weeks later booster immunizations with conjugated peptide are given in Freunds Adjuvant Anti-peptide specific antibodies are detected by binding to the peptide in an ELISA or RIA assay. In cases where the peptides do not adhere to the plastic, and therefore are not treatable by direct assay, then the peptide is conjugated to an unrelated carrier protein which then adheres to the plaque. The specificity of the antibodies is also evaluated by the Western Blotting technique. See Towbin, It., Et al., PNAS USA, 76: 4350 (1979). Specific antibodies are rearranged in a 55 kDa protein in crude membrane preparations, in WGA eluted glycoproteins, or in streptavidin eluates. Membranes from a cell line devoid of receptor serve as a negative control. This procedure also gives information on the degree of cross-reactivity of antibodies to receptor subtypes of other cell lines and tissues (brain, pituitary) and obviates the need for purification of the receptors from each source. It is beneficial to obtain

Both tissue-specific antibodies for physiological studies and cross-reactive antibodies for possible use in purification of the receptor from various tissues using immunoaffinity chromatography.

Monoclonal antibodies to the GHRH receptor are prepared using standard methods. See Harlow, H., and Lane, D., in Antibodies: A Laboratorv Manual. Cold Spring Harbor Lab, New York, pages 139-240 (1988). Antigens used for immunization include (1) KLH-peptide conjugates corresponding to the extracellular regions as described above, (2) purified receptor from ovine or bovine anterior pituitary membranes, (3) purified receptor deglycosylated with neuraminidase or N- glycosidase and repurified by SDS-PAGE and electroelution, (4) purified receptor from recombinant sources such as transfected CHO cells, or baculovirus tested for reactivity to peptide immunogen by ELISA or protein immunogen by Western Blot. Those that have circulating antibodies to the receptor or its peptides are used for the preparation of hybridomas. Briefly, spleen cells are removed and fused in the presence of polyethylene glycol with SP2 / D myeloma cells which are deficient in the hypoxanthine-guanine phosphoribosylaminopterin-thymidine enzyme which selects the true hybrids of both cell types since the spleen cells do not grow in culture. Hybridomas in the supernatant are screened for antibody to the receptor by (1) Western blot of purified receptor or WGA (2) ELISA-eluted glycoproteins using inhibition of binding of radiolabelled ligands to membranes. Hybridomas that are positive are propagated and re cloned either by limiting dilution or grown in soft agar; this ensures its monoclonal nature. Positive clones are used to induce tumors in mice and accumulate the antibody in ascites fluid.

Both monoclonal and polyclonal IgG antibodies are purified by conventional ammonium sulfate precipitation and Protein A chromatography. See Harlow, supra. Antibodies are analyzed for their ability to block or activate radioligand binding to membranes in the standard binding assay described above. 86 046 ΕΡ 0 591 697 / ΡΤ 34

Antibodies which are promising to block or activate ligands are tested in vivo using for example a mouse model, e.g., using permanent venous catheters in mice to monitor GH levels following administration of anti-GHRH receptor antibody. See Miell, J., et al., J. Endocrinol. 131: 75 (1991). Antibodies which exhibit the greatest activity in vivo at this point are examined to define their (if not already determined) epitopes on the receptor. Epitopes represent antigenic fragments of the receptor which, when used as immunogens, induce antibodies having the desired physiological effect of altering levels of GH production.

EXPERIMENTAL METHODS AND EXAMPLES

The following non-limiting examples further demonstrate the improved GHRH binding assay of the present invention, and the method of purifying the GHRH receptor based on the solubilization of an intact GHRH receptor / GHRH complex. The non-limiting examples of gene cloning and protein expression that follow refer to examples of nucleotide and amino acid sequences, SEQ ID NO: 1 to SEQ ID NO: 10. However, it should be understood that the invention is not limited only to such sequences, but also encompasses biologically equivalent sequences. Also contemplated are sequence modifications, such as deletions, insertions, or substitutions in the sequence that produce silent changes in the resulting protein molecule or portions thereof. For example, changes in the gene sequence reflecting the degeneracy of the genetic code, or resulting in the production of a residue or chemically equivalent amino acid residues at a given location in the protein, are contemplated. In particular, the invention contemplates DNA sequences which are sufficiently duplicative of the specifically disclosed sequence so as to allow their hybridization under standard medium to high stringency Southern hybridization conditions, as well as the biologically active proteins so produced. The nucleic acid sequence, or portions thereof, disclosed herein may readily be employed in Southern hybridization procedures to identify and isolate GHRH-R in cells from various species and tissue types; such host cells and derivatives thereof may be used in the recombinant production of all or a portion of a GHRH-R.

86 046 ΕΡ 0 591 697 / ΡΤ

It will be understood that a wide variety of materials other than those specifically mentioned herein may be used for the practice of the invention without undue experimentation.

TESTING OF BINDING ON CRUDE MEMBRANE SKINS

TISSUE PREPARATION

All steps were performed at 4 ° C. Previous frozen pituitary of ovine or bovine (ovine: approximately 1 g / pituitary obtained from Dr. Ian Clarke, Melbourne, Australia; bovine: approximately 2.5 g / pituitary special handling of Pel-Freez, of Rogers, Arkansas) to remove blood, were cleaned to remove connective tissue and homogenized (using a Dounce homogenizer) in 50 mM HEPES buffer, 100 mM NaCl, 10 mM EDTA, 0.1 μg EGTA, pH 7.4 with PMSF 0, 5mM (phenylmethylsulfonyl fluoride), 10æg / ml leupeptin, 10æg / ml pepstatin A, and 200 U / ml aprotinin (units / ml). This buffer is used to remove endogenous GTP that can be bound to G proteins and to restore high affinity binding. The homogenate was centrifuged at the maximum speed of the microcentrifuge and the supernatant was discarded. The top layer (membrane) of the pellet was then carefully resuspended in binding buffer containing 50 mM Tris buffer, 5 mM EGTA, 5 mM MgCl 2, 50 pg / ml alameticin, 30 μg / ml bacitracin and other protease inhibitors as before.

CONNECTION CONDITIONS AND ANALYSIS

1/50 pituitary equivalent was incubated per tube in binding buffer with approximately 100,000 iodinated probe counts in a volume of 500 μl at room temperature for 1 hour. The total counts delivered and the percentage of counts attached to each tube were determined with 3 to 6 replicates per experimental condition. The saturation binding profiles were analyzed with the Ligand computer program which performs a statistically weighted adjustment of least squares to the exact ligand binding equation in untransformed coordinates. Statistical measurements (F-test and cycle-testing) indicated a convincingly good fit for a single-site binding template. A representative saturation binding analysis is shown in Figure 2. 36 86 046 ΕΡ 0 591 697 / ΡΤ

RESULTS Ο treatment of tissue with 10 mM EDTA was essential to allow the removal of endogenous GTP and reveal the high affinity sites dependent on GTP. Initially, nonspecific binding was overwhelming and the wide variety of blocking agents offered no improvement. Slightly better binding signals were observed on membrane fractions purified by sucrose density centrifugation. For consistent results, large batches of crude membrane were prepared from frozen pituitaries and aliquots of this membrane were frozen for further testing. Referring to Figure 1, a large increase in specific binding was noted when the membranes were directly tested after homogenization. One possible mechanism for this freeze-thaw effect is the formation of vesicles that interfere with the assay. Testing for this possibility, the pore-forming antibiotic, alameticin (50 pg / ml) was found to have increased 3 fold the specific binding / total binding ratio, as shown graphically in Figure 1. Most of this increase was due to a drop in non-specific binding, possibly due to the release of trapped probe into vesicles. Further washing of the membrane pellets by centrifugation was included to maximize the specific binding increase over non-specific binding despite loss in the total counts recovered. Computer analysis of saturation binding studies with the Ligand program indicates a single binding site with a Kd = 158 ± 13 pM and that the total number of specific binding sites (RT) is 1.5 ± 0.09 pmol / g tissue (best fit ± approximate standard error of the mean SEM). Since the affinity for GHRHa is commensurate with the biological potency of GHRHa, and because of the specificity for GHRH relative to related peptides (no competition for 100 μM VIP or PACAP) and sensitivity to 50 μM GTPγS and 1.0 mM DTT, this binding indicates the presence of GHRH-R Comparison of 125 I-GHRHα with a commercially available iodinated human GHRH (Amerisham, Arlington Heights , IL) showed much similarity: 125 I-GHRHa showed a slightly better specific binding and somewhat stronger GTP effect.

86 046 ΕΡ 0 591 697 / ΡΤ 37

PHOTOAFINITY PROBE CONNECTION ASSESSMENT

Two different photoaffinity probes were prepared using photoreactive heterobifunctional crosslinking agents available from Pierce as discussed above (Rockford, IL). SANPAH was coupled to the N-terminal histidine GHRHa using a DMF solvent system. ANB-NOS was coupled to GHRHa directed to lysines 12 or 21. Each GHRHa-coupling group product was purified by HPLC, iodinated and freshly purified.

The binding of photosensors to membranes was assessed with a crude membrane binding assay and then further analyzed by electrophoresis on SDS-PAGE to identify the binding sites. The photosensors were incubated in the dark, photolabeled for 10 minutes with a long wave UV lamp (366 nm), and then pellets were formed with the samples. The pellets were counted and then boiled directly into SDS sample buffer (total SDS extracts). Alternatively, the labeled pellets were extracted into a mild detergent solution (5 mM CHAPS), centrifuged, and the concentrated chloroform / methanol supernatants were buffered with SDS buffer (CHAPS extracts). These samples were then subjected to electrophoresis on SDS gels and autoradiographed.

RESULTS The binding assay revealed that both photosondas bound to membrane pellets, and could be completely shifted by 10 nM GHRHa, or partially displaced by 50 μM GTPyS. Both gave non-specific binding greater than Ι-GHRHa. The SDS total extract gels of the affinity-crosslinked pellets showed this non-specific binding in the form of bands unaffected by GHRHa or GTPyS. These non-specific bands differed somewhat from operation to operation and between the two probes (Figure 3). CHAPS nonionic detergent is a weak protein solubilizer; the purification work of the receptor demonstrated the ability of solutions containing CHAPS to solubilize GHRH binding activity. When the crosslinked pellet extracts obtained using a solution containing 5 mM CHAPS were examined on SDS gels, the cross-linking view of the receptor was greatly improved since most of the non-specifically labeled protein was not solubilized. With reference to Figures 3 and 4, a web of

86 046 Ρ 591 697 / ΡΤ 38 55 kD, the labeling of which is greatly effected by GHRHa or GTPyS, is clearly visible with both probes, and represents GHRH-R. These photosensors are invaluable in further characterization, purification and cloning of the GHRH receptor.

DESGLICOSILACÃO

Since it is known that the extracellular portion of most G protein bound membrane receptors contain multiple carbohydrate groups covalently bound to arginine (N-linked) residues, experiments have been performed to confirm that the specifically photolabelled band in the Figures 3 and 4 is a N-linked glycoprotein. The samples were treated with a purified, protease-free mixture of endoglycosidase F and N-glycosidase F.

The photolabeled pellets (extracted using SDS or CHAPS) were slurried in SDS sample buffer, diluted, and incubated overnight at 37øC with 1.25% Nonidet P-40 (a detergent non-ionic also known as NP-40) in 0.5 units of glycosidase or white. These samples were then concentrated through a precipitation protocol with chloroform-methanol (see Wessel, et al., Anal. Biochem., 138: 141-143 (1984)) and electrophoresed on SDS gels.

With reference to Figures 3 and 4, it can be seen that the mobility of the specifically photolabelled band was from about 55 kD to about 45 kD only in the presence of glycosidase. Other bands, visible on the SDS-extracted samples, and considered to be not specifically labeled by the lack of response to GHRHa or GTPyS, are not deglycosylated. This is the first proof that GHRH-R is a glycoprotein, and provides the best estimate of the true size of the protein chain. As shown in Figure 5, treatment of the neuraminidase photolabelled receptor caused a shift in gel mobility to approximately 52 kD. This demonstrates that the receptor has a number of terminal sialic acid groups on its oligosaccharide chains. These sialic acid groups also affect the pl of the receptor, as observed in isoelectric focusing gels, in HPLC hydrophobicity, and also in its lectin binding properties. Deglycosylation is useful in purification strategies and to facilitate proteolytic cleavage of the receptor for sequencing.

86 046 ΕΡ 0 591 697 / ΡΤ 39

SOLUBILIZATION OF RECEPTOR-GHRH COMPLEXES

Pituitary membrane solutions solubilized in solutions containing CHAPS showed only GTP-insensitive (Kd approximately 500 nM) insensitive sites as measured by a charcoal-dextran binding assay (adapted from that developed for VIP by Paul, et al. al., J. Biol. Chem., 262: 158-162 (1987)). Other detergents had even less binding, indicating that GHRH-R was not stable in the face of these treatments. The results of the photoaffinity crosslinking revealed that the covalently coupled receptor-ligand complex is soluble in a solution containing CHAPS. Preincubation of GHRH with the receptor using the conditions of the membrane binding assay of the present invention, followed by extraction with a mild detergent solution, preferably containing CHAPS, revealed solubilization of an intact receptor-ligand complex. This soluble complex was detected by detergent extraction from membranes incubated with125 I-GHRH analog or 125 I-GHRH analog after treatment with 10 nM cold GHRH.

GHRH-R PURIFIED

Biotinylated GHRH analogue was then used to form a soluble GHRHb-GHRH-R complex, and this soluble complex, after extraction using CHAPS, and purification with charcoal-dextran, was run on a streptavidin column. The streptavidin column was then washed with a solution of NaCl, and subsequently a buffer solution with a pH of 5.0 was run on the column to yield a GHRH-R isolate. The GHRH-R isolate can then be further purified by SDS-PAGE. A band appearing at about 52 KDa (corresponding to pure GHRH-R) can be transferred to a standard PVDF membrane. The PVDF membrane with purified GHRH-R can then be digested on the membrane and sequenced to obtain the complete or partial sequence of GHRH-R amino acid residues following standard sequencing methods. The sequence or sequences of amino acid residues obtained from the sequencing step may then be used as a base to form

86 046 ΕΡ 0 591 697 / ΡΤ 40 degenerate probes for use in the cloning of the gene responsible for GHRH-R production.

Thus, an improved methodology for measuring the binding of GHRH analogs to the GHRH receptor on ovine and bovine pituitary membranes (including methods for iodination, purification and delivery of GHRH analogs, and the use of pore-forming antibiotics ). This has led to the development of methods for GHRH-specific, high affinity, GHRH-specific photometry of the GHRH receptor. This labeling of this receptor was not previously achieved. This allows the characterization of the size, glycosylation, solubility and other properties of the receptor. This led to the finding that a mild detergent solution, including compounds such as CHAPS, could extract the bound GHRH-GHRH receptor complex in a stable, soluble form. CHAPS extraction and charcoal / dextran treatment (to bind free GHRH) yields a soluble receptor-ligand complex which is purified from most non-specific GHRH binding, and thus is very useful as a novel GHRH binding assay, with low background noise, with better sensitivity than was previously possible, and also as a starting point for receptor purification. This receptor-ligand complex is relatively stable over salt washes, GHRH exchange and GTP or DTT treatment, but not to decrease pH. A C-terminal biotinylated GHRH analog was invented which, when attached to a soluble GHRH-R complex, allows purification of the GHRH receptor by retention on an immobilized streptavidin column, followed by a salt wash, and elution at pH 5. This purified receptor protein is suitable for the partial sequencing of receptor peptides and this sequence information is valuable for the cloning of the GHRH receptor cDNA.

VECTORS

Non-limiting examples of vectors suitable for use in the practice of the present invention include the vectors shown in Figures 13 and 14. Referring to Figure 13, there is shown the phagemid pBluescript® II KS + pagemid pBluescript is a 2961- bases derived from pUC19. The designation KS indicates that the polylinker is oriented so that the transcription of lacZ proceeds from ρρη I to Sac I. The pBluescript phagemid is available from Stratagene, La Jolla, California. Specific information on pBluescript can be obtained from Stratagene and

86 046 ΕΡ 0 591 697 / ΡΤ 41 is available in published catalogs (such as the Product Catalog " Stratagene 1991 Product Catalog "). Plasmid pBluescript® II is shown containing a 1.6 kbp insert of PAH cDNA (will be defined below), which encodes a GHRH-R. Restriction enzymes that cut before the 5 'end of PAH include Saci, BstX, NotI, XbaI, Smal, PstI, EcoRI. Enzymes that cut at the 3 'end of the HAP cDNA include HindIII, Clal, SalI, XhoI, Apal. Enzymes that cut into the HAP cDNA include NcoI and EcoRI.

Referring to Figure 14, there is shown the CDM8 vector, available from Invitrogen of San Diego, California. PCDM8 is a 4.5 kb multifunctional eukaryotic expression vector developed by B. Seed for cloning and cDNA analysis in E. coli and eukaryotic systems. See Nature 32: 840-842, (1987). The CDM8 plasmid is shown to contain an HAP cDNA insert. The Hind III, NcoI, and XhoI restriction sites shown were not reformed after ligation at the smooth ends of the insert into the plasmid.

It is to be understood that other vectors may be used for the cloning of all or portions of the gene encoding a GHRH-R or biologically active fragments thereof (such as, by way of non-limiting example, an expression vector owned by Merck Company designated pRJB2).

OLIGONUCLEOTYDIC PROBES

In one embodiment, a first probe was produced, based on mouse secretin receptor cDNA. Four oligonucleotides shown in SEQ ID NO: 1 to SEQ ID NO: 4 were synthesized to correspond to portions of the sequence of the chains of the rat secretin receptor sequence disclosed by Ishihara et al., In " Molecular Cloning and Expression of a cDNA Encoding the Secretin Receptor, " EMBO. J. .. 10: 1635-1641 (1991). Two of these oligonucleotides, SEQ ID NO: 1 and SEQ ID NO: 2, were then used in the polymerase chain reaction, PCR, with rat cerebellum cDNA method to amplify the entire coding region of the receptor cDNA rat secretin. PCR was conducted as follows using a thermal cycler: the temperature cycle was 94øF, 55øF, and 72øF for denaturation, primer hybridization, and primer extension, respectively, and the primer cycle of time was approximately 1, 1.5, and 2.5 42 86 046 Ρ 0 591 697 / ΡΤ minutes, respectively, for these temperatures during each cycle. A total of 30 cycles were used. Taq Polymerase was used in standard PCR buffer. Unfortunately, the PCR reaction using the two primer primers (SEQ ID NO: 1 and SEQ ID NO: 2) did not give sufficient amplification. To overcome this problem, a second PCR reaction was performed using a second set of primers, SEQ ID NO: 3 and SEQ ID NO: 4 housed internally in the first set. The product was a " hydrophobic core " of 812 base pairs of the secretin receptor, extending from the first transmembrane segment, to immediately after the seventh transmembrane segment, nucleotides 639-1450 (the secretin receptor, such as certain G protein-bound receptors, GCR, transpose cell membrane, and has multiple transmembrane segments formed by groups of hydrophobic amino acids, and gives rise to a signature of hydropathy such as that of Rhodopsin GCR). Restriction endonuclease mapping with Pst I and Xba I confirmed the identity of this material. The PCR product was purified as a band of an agarose gel by diethylaminoethyl electrophoresis, DEAE, paper, followed by elution with salts and precipitation with ethanol. SEARCH OF LIBRARIES IN LOW RIGOR CONDITIONS The secretin receptor cDNA fragment produced above was then radiolabeled by random priming, and used as a probe to screen for about 1.5x10 6 clones that had been plated from the library of CDNA in λgt10, from human acromegalic pituitary, and raised on nitrocellulose filters. In a preferred embodiment, labeling of probes is conducted using a Prime-a-Gene kit available from Promega of Madison, Wisconsin (Generally, low stringency conditions comprise high ionic strength and / or decreased temperature; high stringency conditions comprise strength ionic strength and / or increased temperature). The filters were washed at 42øC with a buffer containing 30 mM NaCl in sodium dodecylsulfate, 0.5% SDS, prior to autoradiography. Phage that hybridized to the probe were plate-purified, bound in CsCl bands, λgt10 inserts were excised with EcoRIs, subcloned into pGEM7Zf (+) (available from PROMEGA of Madison, Wisconsin), and cultured in E. coli. The inserts cloned into pGEM7Zf (+) were then sequenced by the dideoxy chain termination method of Sanger et al. In " DNA Sequencing with Chain Termination Inhibitors, " Proc. Natl. Acad. Know. USA. 74: 5463-5467 (1977). Several small clones (< 400 bp) and three larger clones were found. Two of these larger (1.0 and 1.1 kb) clones each included partial sequences that resembled the receptor cDNA (HAP sequence), and a non-3 'coding section terminating in a poly A These clones contained identical sequences where they overlapped, but differed in the coding region length spanning 200 bp, and demonstrated two different 3 'polyadenylation sites spaced apart from 300 bp. It was surprisingly found that no clones representing the human secretin receptor were found, which would be readily detected by the rat secretin probe used in the acromegalic tumor library, PAH. [This is particularly significant since GHRH-R is present at extremely low concentrations in the pituitary somatotroph, and the presence of even relatively small amounts of the gene encoding the human secretin receptor in the cDNA library would make it difficult to cloning of GHRH-R by this method]. RESEARCH OF LIBRARIES IN HIGH RIGOR CONDITIONS A labeled 50 bp HAP oligonucleotide probe made from the two complementary 30meros shown in SEQ ID NO: 5 and SEQ ID NO: 6, which overlap in 10 bp; the hybridomas were tagged by the Klenow fragment fill reaction (these mers were prepared based on the library library sequence under low stringency conditions). The 50 bp HAP probe was used to screen the Clontech human HCA 1097a acromegalic cDNA library discussed above, as well as to screen a Clontech 5 'Stretch HL 1097v library especially prepared from acromegalic pituitary tumor mRNA, HAP , which had been completely denatured by methylmercuric hydroxide to optimize the 5 'extension of the cDNAs; this cDNA was started with oligo (dt), selected by sizes (> 500 bp), and cloned in a directed manner in the XBluemid vector. This vector facilitates sequencing since the inserts are contained in plasmid pBluescript and need not be subcloned as would have to be done if using the above vector 7gt10. Both libraries were screened as before, but a final wash under high stringency conditions of the nitrocellulose filter surveys at 65 ° C was used to remove all those less agreed than most closely agreed. A library using the λgt10 vector produced 152 signals that were confirmed by duplicate surveys.

86 046 ΕΡ 0 591 697 / ΡΤ Searching for the second library " 5 'Stretch " with duplicate surveys revealed 64 matching signals, 58 of which were purified by plaque formation; of these, it was suggested by PCR that the 7th, designated HAP 7, contained the region encoding the complete protein for a GHRH-R. More specifically, using PCR primers for the phage vector containing the cloning site and also using primers specific for an HAP sequence, it was possible to measure both the total size of each insert and its length at 5 'of the known PAH sequence , using PCR. The results suggest that the PAH cDNA is abundant in both tumor libraries and that a full length clone has been produced. The HAP 7 phage were cut with the NotI restriction endonuclease to remove the plasmid pBluescript containing the cDNA insert. This plasmid was then used to transform E. coli and the transformed cells were selected for ampicillin resistance; one of the colonies designated Escherichia Coli HAP 7.3, DH5a was deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852, USA, on August 25, 1992, and has been assigned ATCC Accession Number 69058. Figure 12 shows the steps followed to insert the HAP 7.3 cDNA sequence in plasmid pCDM8 for use in transfection of COS cells. This scheme takes advantage of the Ncol restriction site containing the initiation codon (ATG) and the different antibiotic resistance of the plasmids pBluescript® and pCDM8. Sequencing of PAH clones can be performed by the Sanger dideoxy chain termination method using a commercially available kit or an automated DNA sequencer. The nucleotide sequence for the HAP 7.3 cDNA encoding a GHRH-R is shown in SEQ ID NO: 7 and SEQ ID NO: 9, and the corresponding amino acid sequences thereof are shown in SEQ ID NO: 8 and SEQ ID NO: : 10, respectively. A computer search (FASTAst GenBank Release 71) shows that, in addition to secretin family receptors, the GHRH-R sequence has no significant similarity to other known proteins.

86 046 ΕΡ 0 591 697 / ΡΤ

EXPRESSION OF HAP 7.3 cDNA IN A MAMMAL CELL LINE The HAP 7 cDNA contains extended translation open reading frame (ORF) starting with the methionine codon (Met) that conforms to the consensus sequence of initiation codon proposed by Kozak. See " An Analysis of 5'-Noncoding Sequences From 699 Messenger RNAs, Nucleic Acids Res., 15: 8125-8148 (1988). The HAP 7 cDNA contains 80 bp 5 'of this putative start codon, and is devoid of the framed ATG or terminus codon codons. The ORF is extended by 1 269 bp, and thus encodes a protein of 423 amino acids (predicted molecular weight of approximately 45 kDa). The PAH 7.3 cDNA was subcloned into the pCDM8 expression vector taking advantage of the Nco1 endonuclease restriction site containing the putative start codon.

Cos-1 cells were transfected with the vector formed by attaching the pCDM8 and the HAP cDNA, and the Cos-1 cell membranes were prepared 72 hours later. Cos-1 cells were transfected using 10æg of plasmid DNA per 6x10 5 cells in a 100 mm dish using the DEAE-dextran method described by Cullen. See " Use of Eukaryotic Expression Technology and the Functional Analysis of Cloned Genes, " Methods Enzol., 152: 684-704 (1987). Cells from COS cells were transfected with pCDM8 containing a cDNA encoding rat angiotensin II receptor, AT,. Membranes from COS cells transfected with HAP cDNA, but not COS cells transfected with angiotensin receptor cDNA, showed high affinity binding of His1, 125I-Tyr10, Nle27 GHRH (1-29) NH2. With reference to Figures 15 and 16, binding of iodinated GHRH to pCDM8 transfected COS cell membranes containing the HAP 7 cDNA, and binding of iodinated GHRH to membranes transfected with pCDM8 containing a cDNA encoding the receptor of angiotensin II, and this binding is compared to the binding of GHRHa in the presence of various concentrations of competing peptides. Figure 15 is based on a lower number of samples, and due to a high background noise, it appears that 2 nM GRF displaces a greater amount of 125 I-GRF than 10 nM GRF. However, the largest number of samples reflected at each data point in Figure 16 shows a direct correlation between the concentration of added competitor peptide and the decrease of total bound counts of iodinated GRF analog.

86 046

Figure 16 illustrates that PACAP competed for binding with iodinated GHRH, although at much higher concentrations (Ki of approximately 30 nM). Binding of iodinated GHRH was not affected by 100 nM of other peptides, including VIP, secretin, glucagon, calcitonin, galanin, parathyroid hormone, gastrointestinal peptide, PHM, and somatostatin, or a μΜ growth hormone releasing peptide. Since GHRH does not bind to control COS cells transfected with the gene encoding angiotensin, it is clear that GHRH binding in COS cells transfected with pCDM8 containing the HAP 7 cDNA is due to protein expression by the cDNA of HAP 7. In addition, the specific GHRH binding activity demonstrated in Figures 15 and 16 illustrates that the protein produced by expression of the HAP 7 gene has all the binding characteristics of a GHRH-R. Figure 17 shows the binding and displacement of the same GHRH analogue in ovine pituitary membranes. These data gave a KD for the pituitary GHRH binding of 0.2 nM. Comparison with Figure 16 suggests that a site of comparable high affinity is induced in transfected COS cells, but that some of the sites may have lower affinity. This is expected because the abundance of G proteins in transfected cells is probably insufficient to allow complete coupling of the receptor, but this may also be due to some other factors in the COS cell artificial expression system. PACAP, but not VIP, showed a significant displacement of GHRH in sheep pituitary at 500 nM and 1 M.

There is a number of evidences confirming that a GHRH-R gene has been cloned: The molecular weight of the protein encoded by the cloned gene is in close agreement with the results of the photoaffinity cross-linking of the ovine pituitary GHRH receptor, which had a size of about 42 kDa after deglycosylation. The amino acid sequence of the receptor shown as SEQ ID NO: 10 includes 423 amino acid residues. If the first 22 amino acid residues are a signal peptide that is removed by processing in the cell, this leaves a 401 amino acid protein with a molecular weight of approximately 44 kDa, which agrees closely with the size determined in the photoaffinity crosslinking in the studies prior deglycosylation. The sequence of the protein encoded by the cloned gene includes possible membrane transposition domains that exhibit a hydropathy signature of a G protein bound receptor. For example, Figure 18 is a representation of the hydropathy of the amino acid sequence of SEQ ID NO: 8 and Figure 19 is a representation of the hydropathy of the amino acid sequence of SEQ ID NO: 10, both having seven possible transmembrane regions. The graphs are prepared by determining the average of the polarity cycles of 9 amino acid residues; the points below the horizontal centerline reflect polar or hydrophilic portions of the protein, while the portions above the line indicate non-polar or hydrophobic portions of the protein which are likely to serve as transmembrane segments. The following Table 1 illustrates the percent identity of amino acid residues found in sequences of receptors believed to be similar to GHRH-R (eg, VIP and secretin) through a computer matching algorithm known as FASTA . See Pearson et al., Proc. Natl. Acad. Know. USA 85: 2444-2448 (1988)

TABLE I

IDENTITY PERCENTAGE OF AMINO ACIDS FROM PATIENTS SELECTED RECEPTOR PROTEINS 7.3 IN COMPOUND REGION OF SELECTED COMPUTERS VIP Secretina Calcitonin PTH HAP 7.3 47% 42% 35% 28%

Overlap 387 bp 388 bp 262 bp 367 bp

86 046 ΕΡ 0 591 697 / ΡΤ

TABLE II

PERCENTAGE OF AMINO ACID RESIDUES IDENTITY IN RECEPTORS THAT SEEM TO BE SIMILAR TO GHRH-R

TM5, TM6, and TM7 receptor transmembranes PTH SEC VIP HAP CTR 49% 43% 45% 45% PTH 52% 60% 57% SEC 73% 68% VIP 73% Table II demonstrates that the gene cloned from PAH is slightly more similar to the VIP receptor than the secretin receptor, and less similar to the PTH and calcitonin receptors (eg, has significant homology to other G protein bound receptors).

From the foregoing, it is clear that a gene coding for a protein having GHRH-R activity has been cloned and expressed.

Thus, the present invention involves the solubilization, purification, and protein sequencing of a growth hormone releasing hormone receptor and its biologically active fragments, and also involves the cloning of a gene encoding a releasing hormone receptor growth hormone and biologically active fragments thereof. In a preferred embodiment, the receptor nucleotide sequence obtained from a human acromegalic pituitary tumor cDNA library is inserted into a vector, such as, but not limited to, a plasmid pBluescript; this plasmid is used to transform a suitable host cell, such as bacteria into a viable culture; for example, bacteria deposited with the American Type Culture Collection in Rockville, Maryland under Accession No. ATCC 69058. Bacteria deposited with ATCC can be obtained, the nucleotide sequence for a GHRH receptor can be excised from the bacterial plasmid using restriction, for example, but not limited to, XbaI and XhoI, and the nucleotide sequence may be the same.

be used to express the protein in another organism or cell line, such as, but not limited to, COS cells. Thus, transformed bacteria deposited with ATCC (Accession No. 69058) are useful for further cloning of the nucleotide sequence encoding a GHRH receptor, and the nucleotide sequence encoding a GHRH receptor can be used to express the protein , which can be used for the screening of various drugs that interact with G protein-bound receptors, such as GHRH-R, and may also be used for the above-mentioned therapeutic treatments. From the foregoing teachings, it is apparent that many modifications and variations of the present invention are possible. As a non-limiting example, it is contemplated that other GHRH-R complexes in crude pituitary samples can bind to affinity columns so as to produce purified GHRH-R. It is therefore understood that the invention may be practiced in a manner other than that specifically described. (Follow Sequence Listing)

86 046 ΕΡ 0 591 697 / ΡΤ 50

SEQUENCE LISTING

(1) GENERAL INFORMATION (i) APPLICANT: Thorner, Michael O.

Gaylinn, Bruce D.

Lynch, Kevin R.

Harrison, Jeffrey K.

(ii) TITLE OF INVENTION: INSULATION, CHARACTERIZATION, AND PROTEIN SEQUENCE OF GROWTH HORMONE RELEASE HORMONE RECEPTOR AND CLONING OF A GENE CODING TO GROWTH HORMONE RELEASE HORMONE RECEPTOR (iii) NUMBER OF SEQUENCES: 10 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESS: MASON, FENWICK & LAWRENCE (B) STREET: DC (E) COUNTRY: USA (F) ZIP CODE: 20005 (v) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy Disk

(B) COMPUTER: Compatible with IBM PC

(B) DATA PRESENTED: (A) APPLICATION NUMBER: (B) DATE OF SUBMISSION: (A) APPLICATION NUMBER: (B) DATE OF SUBMISSION: C) CLASSIFICATION: (vii) ORDER DATA PREVIOUS: (A) ORDER NUMBER: US 07/902 826 (B) DATE OF PRESENTATION: June 23, 1992

(viii) REPRESENTATIVE / AGENT INFORMATION: (A) NAME: 0'Shaughnessy, Brian P. (B) REGISTRATION NUMBER: 32 747 (C) REFERENCE / DOSSIER NUMBER: 1084 / 81-1365 (ix) INFORMATION FOR TELECOMMUNICATIONS: (A) TELEPHONE: 202-289-1200 (B) TELEFAX: 202-289-6674 (C) TELEX: 248516 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH (S): 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: simple (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: GCAACAGTGG GCGGAGCATG CTCAGC 26 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: GGCGCCTTGC TGCAGCCTCA GATGAT 26 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 pairs of bases

(B) TYPE: nucleic acid (C) STRANDEDNESS: simple (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: AAGGTCATGT ACACTGTAGG CTA 23 (2) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE SEQ ID NO: 4: AGCGGGAACT CTTGAAGGTG CCA 23 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE : nucleic acid (C) STRANDEDNESS: simple (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 30

CCAATACTGA GACTGGGTAT GGAGGCTGCC

(2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: simple ) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: GGAAACTGGA GCCAGCTCAG GGCAGCCTCC (2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1257 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: simple (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: ATGGACCGCC GGATGTGGGG GGCCCACGTC TT CTGCGTGT TGAGCCCGTT ACCGACCGTA 5G TTGGGCCACA TGCACCCAGA ATGTGACTTC ATCACCCAGC 7GAGAGAGGA TGAGAGTGCC 120 TGTCTACAAG CAGCAGAGGA% NACACACTGG GCTGCCCTGC GACCTGGAT. 130 GGGCTGCTGT GCTGGCCAAC GGCAGGCTCT GGCGAGTGGG TCACCCTCCC CTGCCCGGAT 240 TTCTTCTCTC ACTTCAGCTC AGAGTCAGGG GC7GTGAAAC GGGATTGTAC TATCACTGGC 300 TGGTCTGAGC TTACCCTGTG GCCTGCCCTG TGCCTCTGGA gctgctggct 360 i 1 1 1 CrTACTTCTC CACAGTGAAG CCGTGGGCCA TAGCATCTCT ΕΡ 420 86 046 0591697/54 ΡΤ

CATCACCATC CTGGTTGCTC GCTGTTCACC ACTTTTATCC CCACAGGGAC GACACTGACC CGCCTCCCAT TTCGCCACCA WUUW ·

TCAGGAGGCT CCACTGCCCC TCAAGGCGGG AGCTGTGTTC ACTGCAGCTT CICCACTGTT TGACCAACTT CAGCTGGCTG CCTCCCCCAG CTCAAGGAGA TGCTCTTCAC TGGCACGTGG

ATTGTAGCCC TCTTCGTGGC CGGAACTACG TCCACACCCA CTGAAGGATG CTGCCCTTTT CTATGCAAGG TCTCTGTGGC TTGGCAGAAG CCGTCTACCT GCCTTCTGGT GGCTGGTTCT GTGAGCTGCA TACTGGTGGA CTCAATATTA VCWCW1 * L » CACTACATCA (2AACrnm GAGCTGGGAC rGGGGCGGGGGGGGGGGGGGGGGGAGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGAGGA

CGAGGAGATC GCGTGCTGGG GCCCATTGTC CTCTCGGTCG GGTGAGGAAA CTGSAGCCAG CTCCAAGTCG ACACTTTTCC CCTGCCAGAC AATGCTGGCC CCAGGGCTTC ATTG7TGCCA CTCACGGAAG TGGCAGGGCC

W «w <w A

CACCTCCCCC GGGTGAACTT TGGGCTTTTT CTCAGGGCAG CCTCCATACC 'SA CTCACTCATTCCTCTCTCCCCTC CTTCCTCCAAGTCTCCTCCAGAATGACCCTGA GCTTCTGCCA GTGCTGA 430 540 500 550 720 73 G 340 300 = 50 10 2 0 1030 114 0 1200 (2 ) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 418 base pairs (B) TYPE: amino acids (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE: SEQ ID NO: 8:

Met Asp Arg Arg My 5 Tm Gly Ala His goes 10 Phe cys Go Leu Ser 15 Pro Leu Pro Thr Go 20 Leu Gly His Met His 25 Pro Glu Cys Asp Phe 30 Ile Thr Gin Leu Arg 35 Glu Asp Glu Ser Ala 40 Cys Leu Glu Ala Ala 45 Glu Glu Hetro Asn 50 Thr Thr Leu Gly Cys 55 Pro Ala Thr Trp Aso 60 Gly Leu Cys Trp 55 Pro Thr Ala Gly Ser Gly 70 Glu Trp Val Thr 75 Leu Pro Cys Pro ASO 30? He ? H and Ser His Phe ??????????????????????????????????????????????????????????????????????????????????????????????????????????? 12 0 Ila Ila Tyr Thr Vai 135 Gly? Ha Vai Ala Ile mu - * · Ile Lau Go 150

Arg Asn Tyr Go His Thr -Gin Lau 155

Gly Ala goes Phe 130 Lau Lvs Asp Ala Asp His Cys 135 Ser Phe Ser Va 200 3ar His 210 Phe Ala Thr He "mu - 215 Asn vai Tyr 225 Lau Asn • Cvs Lau 220 Lau Ala Ala Phe - | -1 t Irp Lau Vai 245 Lau Ala Thr Gly nv-Trp 2 50 Will be CVS _y s Trp Asp Lau 275 Asp Asp Thr Ser Pro 230 Ila Vai 250 Lau Ser Val Gly Val 255 Asn Arg Ila 305 Lau Vai Arg Lys 310 Lau Glu Gin Ser Gin Tyr Tm Arg 325 Lau Ser Leu Phe Gly Ile 340 His Tyr Ile Ile Glv Lau Gly 355 Ile Arg Leu Pro Leu 360 Gly Phe 370 Ile Vai Ala Ile Leu 375 Thr Glu 335 Ile Ser Arg Lys 390 Trp His

Phe 105? Pro? Pro 110? C? Glu? Glu? Glu Sar Tyr? 125 Pha? Thir His? Ser Sar? 140? Ala Lau Ala Lau Arg 15? Arg Lau His Cys Pro? 150 Phe? Ala Ala 135 Lau? Hs His Ser Asp Asp ISO Thr Lau CVS Lys Val Ser 205 Val Ala Ala Pha Ser Trp Lau Lau 220 Ala Glu Ala 3 ar mu-Sar 22- Pro Sar Sar Arg? - 240 Gly m-Giy Leu Pro Val Lau pH 2 = 0 255 lau 255 Ala Phe Glu Asp Ila 27 0 Ala Cys Tyr Trp Tm Ile Ile 235 Lys Gly Pro Pha Gly Lau Phe 300 Lau Asn Ila Ile Pro Ala Gin 315 Gly Ser Ser Thu 320 Lys Ser 320 Thr Leu Phe Leu Ila 335 Pro Phe 345 Asn Phe Leu Pro Asp 350 Asn Ala Glu Leu Gly Leu Gly 365 Ser Phe Gin Cys Phe Leu Asn 380 Gin Glu Val Arg Gly His Asp 395 Pro Glu Leu Leu Pro 400 56 86 046 ΕΡ 0 591 697 / ΡΤ

Ala Trp Arg Thr Arg Ala Lys Trp Thr Thrro Ser Arg Ser Ala Gin 405 * 410 415

Arg Cys (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1272 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: simple (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: Λ-. ................. ACCAGACCGTA 50 Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ Λ w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w G G w G G G G G G G G G G G G G G GACCTGGGAT j. 3 G GGGCTGCTGT GCTGGCCAAC ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ and in the form of a sugar -CH2 -CH2 -CH2 -CH2 -CH EXAMPLES OF THE INVENTION The invention relates to a method for the preparation of a compound of formula (I). ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^. (2-methoxyphenyl) -benzyl] -benzamide. (2-methoxyphenyl) -1-piperazin-1-one. A V '' TCGACACCCA z ^ zr - sj - - <AW *. TCAAGGCGGG ^ GC ^ G ^ G ^ 111 ^ C ^ vJ w * jaaWua. - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - »·. S3V7N · «550 TTGGCAGAAG &gt; / -Ws / * uÀAU. w. w CTGGCCTCCA CTGAAGGAGA 720 f &gt; JV 'w- · W _ «* V7' GGCTGGTTCT • JSJUW · s» * J TGCTCTTCAC TGGCACGTGG 730 GTGAGCTGCA AACTGGCCTT CGAGGACATC GCGTGCTGGG ACCTGGACGA CACCTCCCCC 340 TACTGGTGGA TCATCAAAGG GCCCATTGTC CTCTCGGTCG GGGTGAACTT TGGGCTTTTT 900 CTCAATATTA TCCGCATCCT GGTGAGGAAA CTGGAGCCAG CTCAGGGCAG CCTCCATACC 950 CAGTCTCAGT ATTGGCGTCT CTCCAAGTCG ACACTTTTCC TGATCCCAC7 CTTTGSAATT 1020 GACTACATCA TCTTCAACTT CCTGCCAGAC AATGCTGGCC TGGGCATCCG CCTCCCCCTG 1030 GAGCTGGGAC TGGGTTCCTT CCAGGGCTTC ATTGTTGCCA TCCTCTACTG CTTCCTCAAC 1140 CAAGAGGTGA GGACTGAGAT CTCACGGAAG TGGCATGGCC ATGACCCTGA GCTTCTGCCA 1200 12 57 86 046 ΕΡ 0591697 / ΡΤ

GCCTGGAGGA CCCGTGCTAA GTGGACCACG CCTTCCCGCT CGGCGGCAAA GGTGCTGACA TCTATGTGCT AG (2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 423 amino acids (B) TYPE: amino acid MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:

Hat: Ace? Arg Arg 5 Gly Al His His 10 Phe Cys Will Be Leu Pro Pro Leu Pro m. Go 20 Leu Glv His Me ~ His 4 2 Pro Glu Cys As? phe 30 Ile • τα, - Gin Leu Arg 5 S Glu As? Glu Ser Ala 40 Cys Leu Gin Ala Ala 45 Glu Glu Heu Pro Asn 50 Tlir Leu t * vxy Cys Pro Ala Ti * 50 Gly Leu Leu Cys Pro · τιν · «Ala Gly Ser 70 Gly Glu Iro Vai mu · Leu Pro Cys Pro As? 30 * Phe Phe Ser His Phe 35 Ser Ser Glu ca. - Gly 90 Ala Lys Arg Aso 95 * Cys TTU - Ile Thr Gly 100 Ir? Ser Glu Pro Phe 105 Pro Pro Tyr Pro Go 110 Ala Cys Pro Vai Pro 115 Leu GiU Leu Leu Ala 120 GiU Glu Glu Ser 125 Phe Ser Thr Val Lys 13 0 Ile Ile Thr Val Gly His Ser Ile Ser 140 Ile Ile Ala Leu Phe 145 Ile Ile Ile Ile Leu Ile Ile Leu Arg Arg 155 Leu His Cys Pro 160 Arg Asn Tyr Ile 165 Thr Gin Leu Phe Thr 170 Thr Phe Ile Leu Lys 175 Ala Glv Ala Val Phe ISO Leu Lys As? Ala Ala 135 Leu Phe His Ser As? 190 As? Thr As? His Cys 195 Ser Phe Ser Thr Go 200 Leu Cys Lys' Will Be 205 Go Ala Ala His His 210 Phe Ala Thr Met 21w Asn Phe Ser Tr? Leu 220 Leu Ala Glu Ala 86 86 046 ΕΡ 0 591 697 / ΡΤ

Go 225 Tyr Leu Asn Cys Leu 220 Leu Aia Ser Thr Ser 22 5 Pro Ser Ser Ar Ar Arg 240 Ala Phe Tm Ti &quot; 3 Leu 245 Leu Aia Giy Tm 250 Giy Leu Pro Val Leu 255 Phe Thr Giy Tir Trp 2 50 Will Be Cys Lys Leu 255 Ala Phe Giu Asp Tle 270 Ala Cys Trp Asp Leu 275 Asp Asp Thr Ser Pro 230 Tyr Trp Trp lie lie 235 Lys Giy Pro lie Vai 290 leu Ser Vai Giy Go 295 Asn Phe Giy Leu Phe 200 Leu Asn. Ile lie λΓ 30 305 lie Leu Vai Arg Lys 210 Leu Giu Pro Aia Gin Giy Ser Leu His Thr 320 Gin Ser Gin Tvr m - *** m, 225 Arg Leu Ser Lys Ser 230 Leu Phe Leu Tle 225 Pro Leu? he Giy phenyl] -hexahydrofuro [2,3-a] Asn Pile Leu Asp 350 Asn Aia! C-iy Leu Giy lie Arg Leu Leu 260 Giu Leu Giy Leu ± 7 3 65 Ser Phe Giy Phe 370 Go to Xa Leu Tvr Cys Phe Leu Asn 330 Gin uiU Val Aro TTU, * 235 Giu lie Ser Arg Lys 3 90 - His Giy His Asp 3 35 Pro Giu Leu Leu Pro 400 Ai to Tm Arg Arg 405 Al to Lys Trp Tiir A 4A * 410 Pro Ser Arg Ser Ala 415 Aia Lys Vai Leu 'Thr Ser Mer Cys 420

Lisbon,? »» 2001

By The University of Virginia Patent Foundation and American Cyanamid Company

THE ATTACHMENT - THE OFFICIAL AGENT-

Eng. ° ANTÓNIO JO & DA DA CUNHA FERREIRA Ag. 0 |. Pr. Ind. Rua das Flores, 74-4.® 1200-195 LISBOA

Claims (12)

A purified and isolated nucleic acid molecule encoding the amino acid sequence of SEQ ID NO: 8. An isolated and purified nucleic acid molecule having the nucleic acid sequence of SEQ ID NO: 7 encoding a growth hormone releasing hormone receptor. A vector comprising a nucleic acid molecule having the sequence of claim 2. A host cell comprising the vector of claim 3. A host cell comprising a nucleic acid molecule having the sequence of claim 2. An isolated and purified nucleic acid molecule encoding a polypeptide having growth hormone releasing hormone receptor biological activity having the amino acid sequence of SEQ ID NO: 8, wherein said activity is the binding of release hormone of growth hormone. An expression vector comprising the nucleic acid molecule of claim 6, wherein said nucleic acid molecule is present in a vector capable of propagating in a prokaryotic or eukaryotic cell. Escherichia coli comprising the expression vector according to claim 7. A monkey cell transformed with SV-40 comprising the expression vector of claim 7. A method of recombinantly producing a growth hormone releasing hormone receptor having the sequence of SEQ ID NO: 8, comprising transfecting the expression vector according to with claim 7 for a host cell, culturing the host cell transfected under conditions permitting receptor expression and receptor recovery. 11. Transfected DH5α cells deposited with the American Type Culture Collection and assigned ATCC Accession Number 69058. A purified and isolated DNA probe for use in screening for nucleic acid molecules encoding polypeptides having growth hormone releasing hormone binding activity selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: NO: 6. Lisbon, AGOL 2001 By The University of Virginia Patent Foundation and American Cyanamid Company m - The OFFICIAL AGENT / Eng. ° ANTÓNIO JOÃO DA CUNHA FERREIRA Ag. Of. Pr. Ind. Rua das Flores, 74-4 ° 1200-195 LISBOA