PT2445928T - Chimeric influenza virus-like particles comprising hemagglutinin - Google Patents

Chimeric influenza virus-like particles comprising hemagglutinin Download PDF

Info

Publication number
PT2445928T
PT2445928T PT107911190T PT10791119T PT2445928T PT 2445928 T PT2445928 T PT 2445928T PT 107911190 T PT107911190 T PT 107911190T PT 10791119 T PT10791119 T PT 10791119T PT 2445928 T PT2445928 T PT 2445928T
Authority
PT
Portugal
Prior art keywords
seq
influenza
chimeric
plant
polypeptide
Prior art date
Application number
PT107911190T
Other languages
Portuguese (pt)
Inventor
Lavoie Pierre-Olivier
Couture Manon
Dargis Michèle
D'aoust Marc-Andre
Vezina Louis-Philippe
Original Assignee
Medicago Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medicago Inc filed Critical Medicago Inc
Publication of PT2445928T publication Critical patent/PT2445928T/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/145—Orthomyxoviridae, e.g. influenza virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5258—Virus-like particles
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16123—Virus like particles [VLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16211—Influenzavirus B, i.e. influenza B virus
    • C12N2760/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16211—Influenzavirus B, i.e. influenza B virus
    • C12N2760/16223—Virus like particles [VLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16211—Influenzavirus B, i.e. influenza B virus
    • C12N2760/16234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Abstract

A method for synthesizing chimeric influenza virus-like particles (VLPs) within a plant or a portion of a plant is provided. The method involves expression of chimeric influenza HA in a plant or a portion of a plant. The invention is also directed towards a VLP comprising chimeric influenza HA protein and plants lipids. The invention is also directed to a nucleic acid encoding chimeric influenza HA as well as vectors. The VLPs may be used to formulate influenza vaccines, or may be used to enrich existing vaccines.

Description

DESCRIÇÃO

PARTÍCULAS QUIMÉRICAS SEMELHANTES A VÍRUS DA GRIPE COMPREENDENDO

HEMAGLUTININA

CAMPO DE INVENÇÃO A presente invenção refere-se a partículas semelhantes a vírus. Mais especificamente, a presente invenção refere-se a partículas semelhantes a vírus compreendendo hemaglutinina da gripe quimérica e a métodos de produção de partículas quiméricas semelhantes a vírus da gripe.

ANTECEDENTES DA INVENÇÃO A gripe é a principal causa de morte em humanos devido a um vírus respiratório e, durante a "temporada de gripe", estima-se que 10 a 20% da população mundial possa estar infetada, levando a 250 a 500 mil mortes por ano. 0 método atual de combate à gripe em humanos é por vacinação anual. A vacina é geralmente uma combinação de várias estirpes que se prevê serem as estirpes dominantes para a próxima temporada de gripe, no entanto, o número de doses de vacina produzidas anualmente não é suficiente para vacinar a população mundial. Por exemplo, Canadá e Estados Unidos obtêm doses de vacina suficientes para imunizar cerca de um terço de sua população, e na Europa, apenas cerca de 17% podem ser vacinados, dada a produção atual - em face de uma pandemia mundial de gripe, esta produção seria insuficiente. Mesmo que a produção anual necessária pudesse de alguma forma ser atendida em um determinado ano, as variedades dominantes mudam de ano para ano, portanto, o armazenamento a baixos tempos de necessidade no ano não é prático. A produção económica e em grande escala de uma vacina eficaz contra a gripe é de interesse significativo para o governo e para a indústria privada. A glicoproteína de superfície da hemaglutinina (HA) da gripe é tanto uma proteína de ligação ao recetor como uma de fusão de membrana. É um trímero de subunidades idênticas, cada uma contendo dois polipéptidos ligados por dissulfeto, HAl e HA2, que são derivados por clivagem proteolítica de um precursor, HAO, que tem uma sequência peptídica sinal no seu terminal N e uma sequência âncora da membrana no seu terminal C. A clivagem para formar HAl e HA2 gera o terminal N do polipéptido menor, HA2, que tem a sequência âncora da membrana no seu terminal C. A clivagem é necessária para a atividade de fusão de membrana, mas não para imunogenicidade. A sequência N-terminal de HA2 é chamada de "peptídeo de fusão" porque a clivagem em sequências hidrofóbicas similares é também necessária para a atividade de outras proteínas de fusão de vírus, in vitro.

Geralmente, a superfície da "cabeça" globular compreende várias alças flexíveis com regiões antigénicas bem caracterizadas e variáveis designadas como locais A, B, C, D e E (revisto em Wiley et al., 1987. Annu. Rev Biochem 56: 365-394). Inserção ou substituição de sequências peptídicas curtas em alguns locais (por exemplo, B e E) para estudos de imunidade foram descritas (Garcia-Sastré et al. 1995. Biologicals 23: 171-178). Fator de crescimento epidérmico (EGF), anticorpo de cadeia única (scFV) e o domínio Fc de IgG, variando em tamanho de 53 a 246 aminoácidos, foram inseridos na extremidade N-terminal de um H7 e as quimeras foram expressas com sucesso (Hatziioannou et al., 1999. Human Gene Therapy 10: 1533-1544). Mais recentemente, 90 e 140 domínios de aminoácidos do antígeno protetor de Bacillus anthracis foram fundidos ao terminal amino de um H3 (Li et al., 2005. J. Virol 79: 10003-1002). Copeland (Copeland et al·., 2005. J. Virol 79: 6459-6471) descreve a expressão da glicoproteína de superfície do HIV gpl20 Env numa haste H3, em que o domínio gpl20 substituiu toda a cabeça globular de HA. Vários produtos recombinantes foram desenvolvidos como candidatos vacinais contra a gripe recombinantes. Estas abordagens centraram-se na expressão, produção e purificação de proteínas HA e NA de gripe tipo A, incluindo a expressão destas proteínas utilizando células de inseto infetadas com baculovírus (Crawford et al, 1999 Vaccine 17: 2265-74; Johansson, 1999 Vaccine 17: 2073-80), vetores virais e construções de vacina de ADN (Olsen et al., Vaccine 15: 1149-56, 1997). A produção de uma estirpe de virus da gripe não infeciosa para fins de vacina é uma forma de evitar a infeção inadvertida. Em alternativa, partículas semelhantes a vírus (VLPs) como substitutos do vírus cultivado foram investigadas. As VLPs imitam a estrutura do capsídeo virai, mas não possuem um genoma e, portanto, não podem replicar ou fornecer um meio para uma infeção secundária. As tecnologias atuais de produção de VLP influenciam a coexpressão de múltiplas proteínas virais, e essa dependência representa uma desvantagem dessas tecnologias, já que no caso de uma epidemia pandémica e anual, o tempo de resposta é crucial para a vacinação. Um sistema de produção de VLP mais simples, por exemplo, aquele que se baseia na expressão de apenas uma ou algumas proteínas virais sem requerer a expressão de proteínas virais não estruturais é desejável para acelerar o desenvolvimento de vacinas. Vírus envelopados podem obter seu envelope lipídico quando 'brotando' para fora da célula infetada e obter a membrana da membrana plasmática, ou a de um organelo interno. Em sistemas celulares de mamíferos ou baculovírus, por exemplo, brotos de gripe da membrana plasmática (Quan et al 2007 J. Virol 81: 3514-3524). Apenas alguns vírus envelopados são conhecidos por infetar plantas (por exemplo, membros dos Tospovirus e Rhabdoviruses). Dos vírus envelopados em plantas conhecidos, são caracterizados por brotamento das membranas internas da célula hospedeira, e não da membrana plasmática. Embora tenha sido produzido um pequeno número de VLPs recombinantes em hospedeiros vegetais, nenhum foi derivado da membrana plasmática, levantando a questão de se as VLPs derivadas da membrana plasmática, incluindo as VLPs da gripe, podem ser produzidas nas plantas. A formação de VLPs, em qualquer sistema, coloca demandas consideráveis na estrutura das proteínas - alterar trechos curtos de sequência que correspondem a alças de superfície selecionadas de uma estrutura globular pode não ter muito efeito na expressão do próprio polipeptídeo, no entanto estudos estruturais faltam demonstrar o efeito de tais alterações na formação de VLPs. A cooperação das várias regiões e estruturas de HA (por exemplo, as sequências de âncora de membrana, as regiões de caule ou tronco do trímero que separa a cabeça globular das membranas) evoluiu com o vírus e pode não ser passível de alterações similares sem perda de Integridade do trímero de HA e formação de VLP. A produção de VLPs HA de gripe foi previamente descrita pelos inventores em WO 2009/009876.

SUMÁRIO DA INVENÇÃO A presente invenção refere-se a partículas semelhantes a vírus. Mais especificamente, a presente invenção refere-se a partículas semelhantes a vírus compreendendo hemaglutinina de gripe quimérica e a métodos de produção de partículas semelhantes a vírus de hemaglutinina da gripe quiméricas. É um objetivo da invenção proporcionar uma partícula semelhante a vírus da gripe quimérica (VLP) melhorada. A presente invenção proporciona um polipéptido que pode ser expresso num hospedeiro vegetal, compreendendo um HA de gripe quimérico compreendendo um domínio do domínio da haste (SDC), um domínio do domínio principal (HDC) e um domínio do domínio transmembranar (TDC) em que: o SDC compreende um Subdomínio F'l, F'2 e F; o HDC compreende um subdomínio RB, El e E2; o TDC compreende um subdomínio TmD e Ctail; em que o subdomínio RB é de um primeiro polipéptido HA de fripe e os subdomínios SDC e EI e E2 são de um segundo polipéptido HA de gripe e, em que o primeiro polipéptido HA de gripe é de gripe Hl ou H5 e o segundo polipéptido HA de gripe é Gripe HI ou H5, e o segundo polipeptídeo de gripe HA é derivado de uma estirpe de gripe diferente do primeiro polipeptídeo de gripe HA. Além disso, o polipéptido pode compreender um péptido sinal. A presente invenção também proporciona um ácido nucleico que codifica o polipéptido compreendendo uma HA de gripe quimérica compreendendo um agregado de domínio de haste (SDC), um agregado de domínio de cabeça (HDC) e um agregado de domínio transmembranar (TDC) em que: a SDC compreende um F'l, Subdomínio F'2 e F; o HDC compreende um subdomínio RB, El e E2; o TDC compreende um subdomínio TmD e Ctail; em que o subdomínio RB é de um primeiro polipéptido HA de gripe e os subdomínios SDC e EI e E2 são de um segundo polipéptido HA de gripe e, em que o primeiro polipéptido HA de gripe é de gripe HI ou H5 e o segundo polipéptido HA de gripe é Gripe HI ou H5, e o segundo polipeptídeo de gripe HA é derivado de uma estirpe de gripe diferente do primeiro polipeptídeo de gripe HA. 0 ácido nucleico pode também codificar o polipéptido que compreende um péptido sinal como definido na reivindicação 2 em adição à SDC, HDC e TDC.

Também proporcionado um modo para produzir partículas semelhantes a vírus da gripe quiméricas (VLPs) numa planta, compreendendo o modo: a) introdução de um ácido nucleico que codifica um HA da gripe quimérico compreendendo um peptídeo de sinal, um cluster de domínio de tronco (SDC), um cluster de domínio de cabeça (HDC) e um cluster de domínio transmembrana (TDC) em que: o SDC compreende um F'l, F Subdomínio 2 e F; o HDC compreende um subdomínio RB, El e E2; o TDC compreende um subdomínio TmD e Ctail; em que o subdomínio RB é de um primeiro polipéptido HA de gripe e os subdomínios SDC e EI e E2 são de um segundo polipéptido HA de gripe e, em que o primeiro polipéptido HA de gripe é de gripe HI ou H5 e o segundo polipéptido HA de gripe é o gripe Hl ou H5, e o segundo polipéptido de HA de gripe é derivado de uma estirpe de gripe diferente do primeiro polipéptido de HA de gripe, na planta, ou porção deste, e b) incubar a planta, ou sua porção, sob condições que permitam a expressão do ácido nucleico, produzindo assim as VLPs. A presente invenção inclui o método descrito acima em que no passo de introdução (passo a), o ácido nucleico é introduzido na planta de um modo transitório. Alternativamente, no passo de introdução (passo a), o ácido nucleico é introduzido na planta e é integrado de forma estável. 0 método pode ainda compreender um passo de: c) colher o hospedeiro e purificar as VLPs. A presente invenção proporciona uma planta, ou porção da mesma, compreendendo uma HA de gripe quimérica, ou uma sequência de nucleótidos que codifica a gripe HA quimérica, a HA de gripe quimérica compreendendo um domínio de domínio tronco (SDC), um domínio de domínio principal (HDC) e uma membrana transmembranar. cluster de domínio (TDC) em que: o SDC compreende um subdominio F'l, F'2 e F; o HDC compreende um subdominio RB, El e E2; o TDC compreende um subdominio TmD e Ctail;em que o subdominio RB é de um primeiro polipéptido HA de gripe e os subdomínios SDC e EI e E2 são de um segundo polipéptido HA de gripe e, em que o primeiro polipéptido HA de gripe é de gripe HI ou H5 e o segundo polipéptido HA de gripe é o gripe Hl ou H5, e o segundo polipéptido de HA de gripe é derivado de uma estirpe de gripe diferente do que o primeiro polipéptido de HA de gripe. A planta, ou porção desta, pode ainda compreender um ácido nucleico compreendendo uma sequência nucleotídica codificando uma ou mais de uma proteína acompanhante operativamente ligada a uma região reguladora ativa numa planta. A uma ou mais de uma proteína de acompanhante pode ser selecionada do grupo compreendendo Hsp40 e Hsp70. A presente invenção refere-se a uma partícula semelhante a vírus (VLP) compreendendo uma HA de gripe quimérica, a HA de gripe quimérica compreendendo um domínio de domínio tronco (SDC), um domínio de domínio principal (HDC) e um domínio de domínio transmembranar (TDC) em que: compreende um subdominio F'l, F'2 e F; o HDC compreende um subdominio RB, El e E2; o TDC compreende um subdominio TmD e Ctail; em que o subdominio RB é de um primeiro polipéptido HA de gripe e os subdomínios SDC e EI e E2 sâo de um segundo polipéptido HA de gripe e, em que o primeiro polipéptido HA de gripe é de gripe HI ou H5 e o segundo polipéptido HA de gripe é Gripe HI ou H5, e o segundo polipeptídeo de gripe HA é derivado de uma estirpe de gripe diferente do primeiro polipeptideo de gripe HA. A VLP pode ainda compreender N-glicanos específicos de plantas, ou N-glicanos modificados.

Uma composição compreendendo uma dose eficaz da VLP como acabado de descrever e um transportador farmaceuticamente aceitável também é proporcionada.

Num aspeto alternativo da presente invenção é proporcionado um método para induzir imunidade a uma infeção por vírus da gripe num indivíduo, compreendendo a administração da VLP ao sujeito. A VLP pode ser administrada a um indivíduo por via oral, intradérmica, intranasal, intramuscular, intraperitoneal, intravenosa ou subcutânea.

As regiões reguladoras que podem ser operativamente ligadas a uma sequência que codifica uma proteína HA quimérica incluem aquelas que são operativas numa célula vegetal, numa célula de inseto ou numa célula de levedura. Tais regiões reguladoras podem incluir uma região reguladora de plastocianina, uma região reguladora de Ribulose 1,5-bisfosfato carboxilase/oxigenase (RuBisCO), proteína de ligao clorofina a/b (CAB) ou ST-LS 1. Outras regiões reguladoras incluem um 5'UTR, 3'UTR ou sequências de terminação. A região reguladora da plastocianina pode ser uma região reguladora da plastocianina de alfafa; as sequências 5'UTR, 3’UTR ou terminator também podem ser sequências de alfafa. A presente divulgação proporciona um polipeptídeo HA de gripe quimérico compreendendo uma primeira gripe e uma segunda gripe, a primeira gripe e a segunda gripe podem ser independentemente selecionadas do grupo compreendendo Hl e H5 ; com a condição de que a primeira gripe e a segunda gripe não sejam do mesmo tipo de gripe, subtipo ou da mesma origem.

De acordo com alguns aspetos da divulgação, o polipéptido HA de gripe quimérico compreende uma sequência peptidica de sinal, a sequência peptidica sinal pode ser selecionada do grupo compreendendo uma sequência peptidica sinal nativa, uma sequência peptidica sinal de PDI de alfafa, uma sequência peptidica sinal H5 de gripe e uma sequência peptidica de sinal Hl da gripe A presente divulgação proporciona um modo para produzir uma VLP contendo hemaglutinina de gripe quimérica (HA) num hospedeiro capaz de produzir uma VLP, incluindo uma planta, inseto ou levedura compreendendo a introdução de um ácido nucleico que codifica uma gripe HA quimérica compreendendo um domínio de domínio (SDC), um cluster de domínio de cabeça (HDC) e um aglomerado de domínios transmembrana (TDC) em que: o SDC compreende um subdomínio F'l, F'2 e F; o HDC compreende um subdomínio RB, El e E2; o TDC compreende um subdomínio TmD e Ctail;em que o subdomínio RB é de um primeiro polipéptido HA de gripe e os subdomlnios SDC e EI e E2 são de um segundo polipéptido HA de gripe e, em que o primeiro polipéptido HA de gripe é de gripe Hl ou H5 e o segundo polipéptido HA de gripe é o influenza HI ou H5, e o segundo polipéptido HA de gripe é derivado de uma estirpe de gripe diferente do primeiro polipéptido HA de gripe , no hospedeiro e incubação do hospedeiro sob condições que permitem a expressão do ácido nucleico, produzindo assim as VLPs. A produção de VLPs em plantas apresenta várias vantagens sobre a produção dessas partículas na cultura de células de insetos. Os lípidos vegetais podem estimular células imunitárias específicas e aumentar a resposta imunitária induzida. As membranas vegetais são feitas de lipídios, fosfatidilcolina (PC) e fosfatidiletanolamina (PE), e também contêm glicoesfingolipídeos que são únicos para as plantas e algumas bactérias e protozoários. Os esfingolípidos são invulgares porque não são ésteres de glicerol como PC ou PE, mas consistem de um amino álcool de cadeia longa que forma uma ligação amida a uma cadeia de ácido gordo contendo mais de 18 carbonos. PC e PE, bem como glicoesfingolipídeos podem se ligar a moléculas CDl expressas por células imunes de mamíferos, tais como células apresentadoras de antígenos (APCs), como células dendríticas e macrófagos e outras células, incluindo linfócitos B e T no timo e fígado. Além disso, para além do potencial efeito adjuvante da presença de lipidos vegetais, a capacidade dos N-glicanos vegetais para facilitar a captura de antigénios de glicoproteína por células apresentadoras de antigénio, pode ser vantajosa da produção de VLPs quiméricas em plantas. Sem querer estar limitado pela teoria, prevê-se que as VLPs quiméricas produzam uma reação imune mais forte do que as VLPs quiméricas produzidas em outros sistemas de fabricação e que a reação imune induzida por essas VLPs quiméricas é mais forte quando comparada à imunológica reação induzida por vacinas vivas inteiras ou atenuadas.

Contrariamente às vacinas feitas de vírus completos, as VLP quiméricas proporcionam a vantagem, uma vez que não são infeciosas, pelo que a contenção biológica restritiva não é um problema tão significativo como seria trabalhar com um vírus infecioso completo e não é necessário para produção. As VLPs quiméricas de plantas proporcionam uma vantagem adicional novamente permitindo que o sistema de expressão seja cultivado em uma estufa ou campo, sendo assim significativamente mais económico e adequado para o aumento de escala.

Adicionalmente, as plantas não compreendem as enzimas envolvidas na sintetização e adição de resíduos de ácido siálico às proteínas. As VLPs podem ser produzidas na ausência de neuraminidase (NA), e não há necessidade de co-expressar NA, ou tratar as células produtoras ou extrair com sialidase (neuraminidase), para garantir a produção de VLP nas plantas.

BREVE DESCRIÇÃO DOS DESENHOS

Estas e outras características da invenção tornar-se-ão mais evidentes a partir da seguinte descrição, na qual é feita referência aos desenhos anexos, em que: A Figura IA mostra um diagrama esquemático dos subdominios de HA. SP: péptido sinal, F'l, F'2 e F: subdominios de fusão; RB: subdominio de ligação ao recetor, El e E2: subdominios de esterase, DTM/CT: subdominios da cauda transmembrana e citoplasmática. A Figura 1B mostra representações esquemáticas de cassetes de expressão à base de plastocianina (números de construção: 774, 540, 660, 690, 691, 696) para a expressão de hemaglutinina HI A/ Brisbane/59/2007 (Hl/Bri), hemaglutinina Hl A/Nova Caledónia/20/99 (Hl/NC) e hemaglutinina H5 A/Indonésia/5/05 (H5/Indo) em formas nativas e quiméricas. Plasto pro: promotor de plastocianina de alfafa, Plasto ter: terminador de plastocianina de alfafa, SP: peptídeo sinal, RB: subdominio de ligação a recetor, E1-RB-E2: subdominios de esterase e de ligação a recetor, TMD/CT: subdominios de cauda transmembrana e citoplasmática: dissulfeto isomerase de proteína de alfafa. A Figura 2 mostra a sequência de aminoácidos dos subdominios indicados de HA quimérico expresso com painel superior, construções 690, 734 (SEQ ID NO: 11), 696 (SEQ ID NO: 112) e painel inferior, 691 (SEQ ID NO: 113. Os aminoácidos 1-92 da SEQ ID NO: 111 é o domínio F'l + EI do H5/Indo; os aminoácidos 93-2 63 são um domínio da cabeça do RB de Hl/ Brisbane e os aminoácidos 2 64-552 são um E2 + Domínio F'2 de H5/Indo. Aminoácidos 1-92 da SEQ ID NO: 112 é o domínio F'l + EI de H5/NC, aminoácidos 93-301 é um domínio de cabeça RB de H5/Indo e amino os ácidos 302-586 são um domínio E2 + F'2 de Hl/NC os aminoácidos 1-42 da SEQ ID NO: 113 são o domínio F'l de H5/Indo; os aminoácidos 43-273 são um El-RB- 0 domínio de cabeça E2 de Hl/Brisbane e os aminoácidos 274-552 é um domínio F'2 de H5/Indo. A Figura 3 mostra a sequência de aminoácidos da região codificadora das construções 690 e 734 (SEQ ID NO: 80) compreendendo um subdominio RB de Hl/Bri, um péptido sinal H5/Indo e um domínio complexo de tronco (SDC) compreendendo subdominios H5/Indo F'l, El, E2, F'2 e F. A Figura 4 mostra a sequência de aminoácidos da região de codificação da construção 691 (SEQ ID NO: 81) compreendendo o complexo do domínio da cabeça Hl/Bri (HDC) que contém El, RB, E2, um péptido sinal H5/Indo e H5/Indo Complexo do domínio tronco (SDC) compreendendo subdomínios H5/Indo F’l, F’2 e F. A Figura 5 mostra a sequência de aminoácidos da região de codificação da construção 696 (SEQ ID NO: 82) compreendendo um subdomínio RB de H5/Indo, um péptido de sinalização PDI e complexo de domínio de haste Hl/NC compreendendo F’l, El, E2 e F'2. A Figura 6 mostra uma análise de imunotransferência da expressão de Hl/Bri na forma nativa, construção 774 (compreendendo Hl/Bri), construção 692 (compreendendo o complexo de domínio de cabeça (HDC) de Hl/Bri) e construção 690 (compreendendo o subgrupo RB domínio de Hl/Bri fundido com o complexo H5/Indo do domínio de tronco (SDC) em plantas. Para cada construção, foram analisados extratos proteicos totais de 3 plantas separadas. Vinte microgramas de proteína foram carregados para cada planta analisada. Anticorpos monoclonais anti-HA (anti-Hl-Brisbane; FII 10-150) A construção 774 expressa Hl/Bri com o péptido de sinal nativo de Hl/Bri: as construções 690, 691 expressam o HA com o péptido de sinal nativo de H5/Indo. A Figura 7 mostra uma análise de imunotransferência da expressão de H5/Indo na forma nativa, construção 660 (compreendendo H5/Indo, ou construção 696 (compreendendo subdomínio Hl/Indo RB fundido com subdomínios Hl/NC SDC, El e E2), foram analisados extratos proteicos totais de 3 plantas separadas, 20 microgramas de proteínas foram carregados para cada planta analisada e o Western blot foi revelado com anticorpos policlonais anti-H5 da Indonésia (ITC IT-003-005V). A construção 660 expressa H5/Indo como seu péptido sinal nativo, a construção 696 expressa o HA quimérico com um péptido sinal de PDI. A Figura 8 mostra uma representação esquemática de cassetes de expressão baseadas em 35SCPMV/HT para a expressão de Hl/ Bri nas formas nativa (construção 732) e quimérica (construções 733 e 734) . Construção 733, compreendendo o péptido de sinal PDI e complexo HDC, SDC e domínio transmembranar (TDC) de Hl/Bri, e construção 734 compreendendo um péptido de sinal H5/Indo, F'l, El, E2, F'2, F, e um RB de Hl/Bri. Promotor 35S pro: CaMV 35S, NOSter: terminador da nopalina sintase, SP: peptídeo sinal, RB: subdomínio de ligação ao recetor, E1-RB-E2: subdomínios de esterase e de ligação ao recetor, TMD/CT: subdomínios da cauda transmembrana e citoplasmática, PDI: dissulfeto isomerase de proteína de alfafa; CPMV-HT: elementos 5' e 3' do sistema de expressão do vírus hipercritível do mosaico do caupi. A Figura 9 mostra a anise de imunotransfercia da expressão de Hl/Bri na forma nativa, construção 732 (compreendendo Hl/ Bri sob o controlo da cassete de expressão baseada em 35SCPMV/HT), construção 733 (compreendendo um péptido de sinal PDI fundido com Hl/Bri; sob o controlo da cassete de expressão com base em 35SCPMV/HT), ou construção 734 compreendendo um subdomínio Hl/Bri RB fundido com um subdomínio H5/Indo SDC, El e E2; sob o controlo da cassete de expressão com base em 35SCPMV/HT). Para cada construção, foram analisados extratos proteicos totais de 3 plantas separadas. Cinco microgramas de proteína foram carregados para cada planta analisada. 0 Western blot foi revelado com anticorpos monoclonais anti-HA (FII 10-150). A Figura 10 mostra a representação esquemática de cassetes de expressão baseadas em 35SCPMV/HT para a expressão de hemaglutininas H3A/Brisbane / 10/2007 HA (H3/Bri) e B/ Flórida/4/2006 HA (B/Flo). A construção 736 compreende H3/ Bri fundido a um péptido sinal da PDI. A construção 737 compreende o H3/Bri fundido com um péptido sinal PDI e um H5/Indo TMD/CT. A construção 739 compreende B/Flo fundida a um péptido sinal PDI. A construção 745 compreende o B/Flo fundido com um péptido sinal PDI e um H5/Indo TMD/ CT. Promotor 35S pro: CaMV 35S, NOSter: terminador da nopalina sintase, SP: peptídeo sinal, RB: subdomínio de ligação ao recetor, E1-RB-E2: subdomínios de esterase e de ligação ao recetor, TMD/CT: subdomínios da cauda transmembrana e citoplasmática, PDI: dissulfeto isomerase de proteína de alfafa; CPMV-HT: elementos 5 'e 3' do sistema de expressão do vírus hipercritível do mosaico do caupi. A Figura 11 mostra a borda de fusão nas construções número 745 e 737. A origem da sequência de HA é indicada por setas com ponta de bala. Os aminoácidos do dominio transmembrana são QILSIYSTVA e são precedidos por aminoácidos que fazem parte do ectodominio. A Figura 12 mostra a sequência de aminoácidos da hemaglutinina H5/H3 quimérica (SEQ ID NO: 83; estrutura 737) compreendendo um peptideo sinal PDI, um ectodominio de H3 A/ Brisbane/10/2007 e um TMD/CT de H5 A/Indonésia/5/2005. A Figura 13 mostra a sequência de aminoácidos da hemaglutinina H5/B quimérica (SEQ ID NO: 84) compreendendo um ectodominio de B/Florida/4/2006 e uma DTM/CT de H5 A/ Indonésia/5/2005 codificada por o quadro de leitura aberto no número de construção 745. A Figura 14 mostra a análise de imunotransferência da expressão de B/Flo na forma nativa, a construção 739 (compreendendo PDI-B/Flo), ou com a construção 745 (compreendendo B/Flo HDC e SDC fundida com um H5/Indo TDC). Para cada construção, foram analisados extratos proteicos totais de 3 plantas separadas. Vinte microgramas de proteína foram carregados para cada planta analisada. 0 Western blot foi revelado com anticorpos policlonais anti-HA B/Florida (NIBSC 07/356). A Figura 15 mostra a análise de imunotransferência da expressão de H3/Bri na forma nativa, construção 736 (compreendendo PDI sp-H3/Bri) ou com a construção 737 (H3/ Bri HDC e SCD fundidos com um H5/Indo TDC). Para cada construção, foram analisados extratos proteicos totais de 3 plantas separadas. Vinte microgramas de proteína foram carregados para cada planta analisada. O Western blot foi revelado com anticorpos policlonais anti-H3 Brisbane (NIBSC 08/124) . A Figura 16 mostra a cromatografia por exclusão de tamanho de extratos proteicos de folhas de plantas infiltradas com o número de construção 745. O teor relativo de proteína das frações de eluição é apresentado para cada fração. A imunodeteção (Western Blot) de hemaglutinina utilizando anticorpos policlonais anti-HAB/Florida (NIBSC 07/356) nas frações 7 a 15 é apresentada sob o gráfico. 0 pico de eluição do Dextrano Azul 2000 é indicado pela seta (fração 8). A Figura 17 mostra a sequência de ácido nucleico (SEQ ID NO: 52) do fragmento sintetizado compreendendo a região codificante H5 completa (A/Indonésia/5/05 (H5N1)) (incluindo o péptido sinal e o codão stop) flanqueada, em 5' por um sitio HindIII e, em 3', por um sitio Saci. A Figura 18 mostra a sequência de ácido nucleico (SEQ ID NO: 53) da construção 660, uma cassete de expressão HA compreendendo um promotor de plastocianina de alfafa e 5'UTR, sequência de codificação de hemaglutinina de H5 forma A/ Indonésia/5/05 (H5N1), alfafa plastocianina 3'UTR e sequências terminadoras. A Figura 19 mostra a sequência de ácido nucleico (SEQ ID NO: 54) da sequência codificadora de Hl do tipo selvagem (A/ New Caledonia/20/99 (HlNl) (GenBank AY289929) sem TmD e Ctail. A Figura 20 mostra a sequência de ácido nucleico (SEQ ID NO: 55) de um fragmento sintetizado compreendendo Hl (A/Nova Caledónia/20/99 (HlNl) sequência codificante sem TmD e Ctail. Na região 5', os últimos nucleótidos são originários de PDI SP e incluem um sítio de restrição BglII e em 3', um local duplo Saci/StuI é encontrado imediatamente a jusante do codão de terminação. A Figura 21 mostra a sequência de ácido nucleico (SEQ ID NO: 56) do fragmento sintetizado compreendendo a sequência de codificação C-ter Hl (A/Nova Caledónia/20/99 (HlNl) incluindo o TmD e Ctail do local Kpnl até ao codão de terminação (flanqueado em 3'por um local duplo Saci/StuI). A Figura 22 mostra a sequência de nucleótidos para ARNm de Medicago sativa para dissulfureto isomerase de proteína. GenBank Z11499 (SEQ ID NO: 57). Os nucleótidos 32-103 codificam o péptido sinal da PDI. A Figura 23 mostra a sequência de nucleótidos para o plasmideo PromPlasto-PDISP-Plasto 3'UTR. A Figura 23A mostra a sequência de nucleótidos para PromPlasto-PDISP (SEQ ID NO: 58). A Figura 23B mostra a sequência nucleotidica de Plasto 3'UTR (SEQ ID NO: 85). 0 péptido sinal da isomerase de dissulfureto de proteína (PDI) está sublinhado. Os locais de restrição BglII (AGATCT) e Saci (GAGCTC) utilizados para clonagem são mostrados em negrito. A Figura 24 mostra a sequência de ácido nucleico (SEQ ID NO: 59; construção 540) da cassete de expressão HA compreendendo promotor de plastocianina de alfafa e 5'UTR, sequência codificadora do péptido sinal da PDI e da forma Hl A/New Caledonia/20/99 (H1N1), plastocianina de alfafa 3'UTR e sequências de terminação. Hl da sequência de codificação A/ Nova Caledónia/20/1999 está sublinhada. A Figura 25 mostra a sequência de ácido nucleico (SEQ ID NO: 60) do fragmento sintetizado compreendendo a região codificante Hl completa (A/Brisbane/59/07 (HlNl)) (incluindo o péptido de sinal e o codão stop) flanqueada, em 5'por sequências de genes de plastocianina de alfafa correspondentes aos primeiros 84 nucleótidos a montante do ATG inicial, começando com um local Drain e, em 3', por um local Saci. A Figura 26 mostra a sequência de ácido nucleico (SEQ ID NO: 61; construção 774) da cassete de expressão HA compreendendo promotor de plastocianina de alfafa e 5'UTR, sequência de codificação de hemaglutinina de Hl forma A/Brisbane/59/07 (HlNl), alfafa, plastocianina 3'UTR e sequências terminadoras. A Figura 27 mostra a sequência de ácido nucleico da cassete de expressão número 828 (SEQ ID NO: 62) , de Pad (a montante do promotor) a Asei (imediatamente a jusante do terminador NOS). negrito. Local de restrição Apal sublinhado e itálico. A Figura 28 mostra a sequência de ácido nucleico (SEQ ID NO: 63; construção 690) de uma cassete de expressão quimérica H5/H1 compreendendo promotor de plastocianina de alfafa e 5'UTR, sequência de codificação de hemaglutinina quimérica, plastocianina de alfafa 3' UTR e sequências de terminação. A sequência de codificação de HA quimérica está sublinhada. A Figura 2 9 mostra a sequência de ácido nucleico (SEQ ID NO: 64; construção 691) de uma cassete de expressão quimérica H5/H1 compreendendo promotor de plastocianina de alfafa e 5'UTR, sequência de codificação de hemaglutinina quimérica, plastocianina de alfafa 3' UTR e sequências de terminação. A sequência de codificação de HA quimérica está sublinhada. A Figura 30 mostra a sequência de ácido nucleico (SEQ ID NO: 65; construção 696) de uma cassete de expressão H1/H5 quimérica compreendendo promotor de plastocianina de alfafa e 5'UTR, sequência de codificação de hemaglutinina quimérica, UTR de plastocianina de alfafa e sequências terminadoras. A sequência de codificação de HA quimérica está sublinhada. A Figura 31 mostra a sequência de ácido nucleico (SEQ ID NO: 66; construção 732) da cassete de expressão HA compreendendo o promotor CaMV 35S, CPMV-HT 5'UTR, sequência de codificação da hemaglutinina de Hl forma A/Brisbane/59/07 (H1N1), CPMV-HT 3'UTR e sequências de terminação NOS. A sequência de codificação de Hl/Bri está sublinhada. A Figura 32 mostra a sequência de ácido nucleico (SEQ ID NO: 67) da sequência de codificação, de ATG para parar, do número de construção intermédio 787. A Figura 33 mostra a sequência de ácido nucleico (SEQ ID NO: 68; construção 733) da cassete de expressão SpPDI Hl/Bri compreendendo o promotor 35M de CaMV, CPMV-HT 5'UTR, sequência codificadora do péptido de sinal da PDI, sequência de codificação de hemaglutinina de sequências A/Brisbane/ 59/07 (H1N1), CPMV-HT 3'UTR e terminação NOS. A sequência de codificação do SpPDI Hl/Bri está sublinhada. A Figura 34 mostra a sequência de ácido nucleico (SEQ ID NO: 69; construção 734) de uma cassete de expressão quimérica H5/H1 compreendendo o promotor CaMV 35S, CPMV-HT 5'UTR, sequência de codificação de hemaglutinina quimérica, CPMV-HT 3' UTR e sequências do terminador NOS. A sequência de codificação do HA quimérico está sublinhada. A Figura 35 mostra a sequência de ácido nucleico (SEQ ID NO: 70) do fragmento sintetizado compreendendo a região codificante H3 completa (A/Brisbane/10/07 (H3N2)) (incluindo o péptido de sinal e o codão stop) flanqueada, em 5'por sequências de genes de plastocianina de alfafa correspondentes aos primeiros 84 nucleótidos a montante do ATG inicial, começando com um local Drain e, em 3', por um local Saci. A Figura 36 mostra a sequência de ácido nucleico (SEQ ID NO: 71; construção 736) da cassete de expressão HA compreendendo o promotor 35M de CaMV, CPMV-HT 5 'UTR, sequência codificadora do péptido sinal da PDI, sequência de codificação de hemaglutinina H3 forma A/Brisbane/10/07 (H2N3), CPMV-HT 3'UTR e sequências de terminação NOS. A sequência de codificação de Sp PDI H3/Bris está sublinhada. A Figura 37 mostra a sequência de ácido nucleico (SEQ ID NO: 72; construção 737) de uma cassete de expressão quimérica H5/H3 compreendendo o promotor 35M de CaMV, CPMV-HT 5'UTR, sequência de codificação de hemaglutinina quimérica, CPMV-HT3'. Sequências terminator UTR e NOS. A sequência de codificação do HA quimérico está sublinhada. A Figura 38 mostra a sequência de ácido nucleico (SEQ ID NO: 73) do fragmento sintetizado compreendendo a região codificante completa de HA (B/Florida/4/06) (incluindo o péptido de sinal e o codão stop) flanqueada, em 5'por alfafa, sequências do gene da plastocianina correspondentes aos primeiros 84 nucleótidos a montante do ATG inicial, começando com um local Drain e, em 3', por um sitio Saci. A Figura 39 mostra a sequência de ácido nucleico (SEQ ID NO: 74; construção 739) da cassete de expressão HA compreendendo o promotor CaMV 35S, CPMV-HT 5'UTR, sequência codificadora do péptido sinal da PDI, sequência de codificação da hemaglutinina de HA forma B/Florida/4/06, CPMV-HT 3'UTR e sequências terminadoras NOS. A sequência de codificação de Sp PDI B/Flo está sublinhada. A Figura 40 mostra a sequência de ácido nucleico (SEQ ID NO: 75; construção 745) de uma cassete de expressão quimérica H5/B compreendendo o promotor CaMV 35S, CPMV-HT 5'UTR, sequência de codificação de hemaglutinina quimérica, CPMV-HT 3' UTR e sequências do terminador NOS. A sequência de codificação do HA quimérico está sublinhada. A Figura 41 mostra a sequência de ácido nucleico que codifica Msjl (SEQ ID NO: 76). A Figura 42 mostra a sequência de ácido nucleico (SEQ ID NO: 77) de uma porção do número de construção R850, de HindIII (no local de clonagem múltipla, a montante do promotor) para EcoRI (imediatamente a jusante do terminador NOS). A sequência de codificação da HSP40 está sublinhada. A Figura 43 mostra a sequência de ácido nucleico (SEQ ID NO: 78) de uma porção do número de construção R860, de HindIII (no local de clonagem múltipla, a montante do promotor) para EcoRI (imediatamente a jusante do terminador NOS). A sequência de codificação da HSP70 está sublinhada. A Figura 44 mostra a sequência de ácido nucleico (SEQ ID NO: 79) de uma porção do número de construção R870, de HindIII (no local de clonagem múltipla, 5 a montante do promotor) para EcoRI (imediatamente a jusante do terminador NOS). A sequência de codificação da HSP40 está em sublinhado em itálico e a sequência de codificação da HSP70 está sublinhada. A) nucleótidos 1-4946; B) nucleótidos 4947-9493. A figura 45 mostra uma representação esquemática do número de construção R472. A Figura 46 mostra o padrão da ponte dissulfureto do tipo A da gripe. 1) Cys4HAl-Cys 137HA2, 2) Cys60HAl-Cys72HAl, 3) Cys94HAl-Cysl43HAl, 4) Cys292HAl-Cys318HAl 5) Cysl44HA2-Cysl48HA2 e 6) Cys52HAl-Cys277HAl. As pontes dissulfureto que diferem entre os subtipos A e B (Figura 47) são indicadas por setas. A numeração da proteína H3 madura foi usada. A Figura 47 mostra o padrão da ponte dissulfureto do tipo HA da gripe. Numeração de ponte: 1) Cys4HAl-Cysl37HA2, 2) Cys60HAl-Cys72HAl, 3) Cys94HAl-Cys 143HA1, 4) Cys292HAl-Cys318HAl 5) Cysl44HA2-Cysl48HA2, 6) Cys52HAl-Cys277HAl, 7) Cys54HAl-Cys57HAl e 8) Cysl78HAl-Cys272HAl As pontes dissulfureto que diferem entre os subtipos A (Figura 46) e B são indicadas por setas. A numeração da proteína H3 madura foi usada. A Figura 48 mostra um diagrama esquemático de junções de fusão de troca de domínio. A Figura 4BA mostra a fusão do subdomínio RB de Hl/Bri, H3/Bri e B/Flo com H5/Indo SDC, e o subdomínio RB de H5/Indo com o domínio de tronco Hl/NC. A Figura 48B mostra a fusão dos subdomínios E1-RB-E2 (HDC) de Hl/Bri, H3/Bri ou B/Flo com H5/Indo SDC, e de H5/Indo HDC sem Hl/NC SDC. A Figura 49A mostra a sequência nucleotídica SEQ ID NO: 86) de Hl A/Califórnia/04/09. A sequência de codificação do péptido de sinal da isomerase de dissulfureto de proteína de alfafa é sublinhada e a sequência de codificação de Hl madura é destacada a negrito. A Figura 4 9B mostra a sequência de aminoácidos (SEQ ID NO: 87) do Hl A / Califórnia / 04/09. 0 péptido sinal isomerase de dissulfureto de proteína de alfafa está sublinhado. A Figura 50 mostra uma análise de imunotransferência da expressão de hemaglutinina H5/B quimérica (número de construção 747; compreendendo B/Flo HDC e SDC fundido com um H5/Indo TDC) após infiltração de AGLl/747 não diluido, co-infiltrado com AGLl/443 (vetor vazio) e co-infiltrado com AGL1/R870 (HSP40/HSP70). Para cada construção, foram analisados extratos proteicos totais de 3 plantas separadas. Vinte microgramas de proteínas foram carregados para cada planta analisada. O Western blot foi revelado com anticorpos policlonais anti-B Florida (NIBSC). A Figura 51A mostra a sequência nucleotídica para a sequência promotora 2X35S (SEQ ID NO: 88). A Figura 51B mostra a sequência de nucleótidos para a construção 747 (SEQ ID NO: 93) de Pad (promotor 35S a montante) para Asei (terminador NOS imediatamente a jusante). A sequência de codificação do HA quimérico está sublinhada. A sequência do promotor 2X35S é indicada em itálico.

DESCRIÇÃO DETALHADA A presente invenção refere-se a partículas semelhantes a vírus. Mais especificamente, a presente invenção refere-se a partículas semelhantes a vírus compreendendo hemaglutinina da gripe quimérica e a métodos de produção de partículas quiméricas semelhantes a vírus da gripe. A descrição que se segue é de uma forma de realização preferida. A presente invenção proporciona um ácido nucleico compreendendo uma sequência nucleotídica que codifica uma hemaglutinina da gripe quimérica (HA) operativamente ligada a uma região reguladora ativa numa planta.

Além disso, a presente invenção fornece um método de produção de partículas semelhantes a vírus (VLPs) em uma planta. 0 método envolve a introdução de um ácido nucleico que codifica um HA gripe quimérico operativamente ligado a uma região reguladora ativa na planta, na planta, ou porção da planta, e incubando a planta ou uma porção da planta sob condições que permitam a expressão de o ácido nucleico, produzindo assim as VLPs. A presente invenção proporciona ainda uma VLP compreendendo uma gripe HA quimérica. A VLP pode ser produzida pelo método como proporcionado pela presente invenção.

Por "proteina quimérica" ou "polipéptido quimérico" entende-se uma proteína ou polipéptido que compreende sequências de aminoácidos de duas ou mais do que duas fontes, por exemplo, mas não limitadas a dois ou mais tipos ou subtipos de gripe, ou gripe de umas diferentes origens, que são fundidas como um único polipeptídeo. A proteína ou polipéptido quimérico pode incluir um péptido sinal que é o mesmo, ou heterólogo, com o restante do polipéptido ou proteína. A proteína quimérica ou polipéptido quimérico pode ser produzida como um transcrito de uma sequência nucleotídica quimérica, e a proteína quimérica ou polipéptido quimérico clivado após a síntese e, como requerido, associado para formar uma proteína multimérica. Assim sendo, uma proteína quimérica ou um polipí^tido quimí^ico tambí^ inclui uma proteica ou polipéptido compreendendo subunidades que estão associadas através de pontes de dissulfureto (isto é, uma proteína multimérica). Por exemplo, um polipéptido quimérico compreendendo sequências de aminoácidos de duas ou mais do que duas fontes podem ser processadas em subunidades, e as subunidades associadas via pontes de dissulfureto para produzir uma proteína quimérica ou polipéptido quimérico (ver Figuras 46 e 47). 0 polipéptido pode ser hemaglutinina (HA), e cada uma das duas ou mais do que duas sequências de aminoácidos que formam o polipéptido podem ser obtidas a partir de HA diferentes para produzir um HA quimérico, ou HA gripe quimérico. Um HA quimérico também pode incluir uma sequência de aminoácidos compreendendo péptido de sinal heterólogo (uma proteína quimérica de HA) que clivado após ou durante a sínttese proteica. Preferencialmente, o polipéptido quimérico, ou o HA de gripe quimérico não ocorre naturalmente. Um ácido nucleico que codifica um polipéptido quimérico pode ser descrito como um "ácido nucleico quimérico", ou uma "sequência nucleotídica quimérica". Uma partícula semelhante a vírus compreendida por HA quimérico pode ser descrita como uma "VLP quimérica". A HA de gripe quimérica de acordo com várias formas de realização da presente invenção pode compreender um complexo de domínio de tronco (SDC) um complexo de domínio de cabeça (HDC) e um complexo de domínio bruusmemfe^ , -|ijgcçi|;;ιde :um adbdt^iiidi:'í|e'; 'IPS* HSÍlÍits......: TDC é de um primeiro tipo de HA de gripe, subtipo ou de uma origem, e um ou maís de um subdomínio de SDC, HDC ou TDC é de um segundo tipo de KA de gripe, subtipo ou de uma segunda origem ou diferente. Como aqui descrito, o "SDC” compreende uri subdomínio F'l, F'2 e F, o "HDC" compreende um subdomínio RB, El e E2, o "TDC" compreende um subdomínio ti® é: cdlllll||Il|ll|lll||l|| -Μ:· O termo "partícula semelhante a um vírus" (VLP) ou "partículas semelhantes a vírus" ou VLPs refere-se a estruturas que se automontam e compreendem proteínas estruturais, tais como proteína HA de gripe ou proteína HA de gripe quimérica. VLPs e VLPs quiméricas são geralmente morfológicas e antigenicamente semelhantes aos viriões produzidos em uma infeção. mas faltam informações genéticas suficientes para replicar e, portanto, não-infeciosas. As VLPs e as VLPs quiméricas podem ser produzidas em células hospedeiras adequadas, incluindo células hospedeiras vegetais. Após a extração da célula hospedeira e após isolamento e purificação adicional sob condições adequadas, as VLP e as VLPs quiméricas podem ser purificadas como estruturas intactas. VLPs quiméricas, ou VLPs, produzidas a partir de proteínas derivadas de gripe, de acordo com a presente invenção, não compreendem proteína Ml. Sabe-se que a proteína Ml se liga ao ARN (Wakefield e Brownlee, 1989} que é um contaminante da preparação de VLP. A presença de ARN índesejado quando se obtém a aprovação reguladora para o produto VLP quimérico, pelo que uma preparação de VLP quimérica sem ARM pode ser vantajosa.

As VLPs quiméricas da presente invenção podem ser produzidas numa célula hospedeira que é caracterizada por não possuir a capacidade de sialilar proteínas, por exemplo, uma célula vegetal. Ver, por exemplo, Gupta et al., 1999. Nucleic Acids Research 27:370-372; Toukach et al.. 2007 . Nucleic Acids :;Késèátéíi 35:D280-D286; Nakahara et al., 2008. Nucleic Acids Research 3 6:D368-D371. As VLPs quiméricas produzidas como aqui descrito não eompreendem tipicamente; neuraminidase (NA). No entanto, a NA pode ser co-expressa com HA se as VLPs compreendendo HA e NA forem desejadas:;),; A invenção também proporciona VLP eompreêndendo HA quimérico que obtêm um envelope: lipidico da membrana plasmática da célula na qual a HA quimérica é expressa. Por exemplo:, se o HA quimérico é expresso num sistema à base de plantas, a VLP resultante pode obter um envelope lipidico a partir da membrana plasmática da célula vegetal.

Geralmente, o termo "lipido" refere-se a moléculas naturalmente solúveis em gordura {lipofiiieasl. Uma VLP quimérica produzida numa planta de acorde com alguns aspetos da invenção pode sor complexada com lidos derivados de plantas. Os lípidos derivados de plantas podem estar na forma de uma bicamada lipídíca e podem ainda compreender um envelope envolvendo a VLP. Os lipidos derivados de plantas podem compreender componentes lipidicos da membrana plasmática da planta onde é produzida a VLP, incluindo fosfolipidos, tri-, di- e monoglicéridos, bem como esteroi solúvel em gordura ou metabolrtos compreendendo ésféráis. Exemplos incluem fosfatidilcolina (PC), fosfatidiletandlámihá |iE), fosfatidilinositoX, fòSfatidilserina, giicoesfingolipideos, fitoéstéréis: ou uma combinação destes. Um lipido derivado de plantas pode alternativamente ser referido como um "lipido vegetal:".:· Exemplos de f itoesteróis incluem: campestero 1, estigmastecai;,: ergosterol, brass iea sterol, del ta—7 - e s ti gmast er o 1, delta-7-avenasterol, daunosterol, sitosterol, 24-metilcolesterol, colesterol ou beta-sitosterol - ver, por exemplo, ||qngpund: ef al., 2004. Como um perito na arte entenderia, a composição lipidica da membrana pllSItiática de uma. célula pode variar com as condições de cultura ou crescimento da célula ou organismo, ou espécie,: -M partir dás quais W célula é obtida. Geralmente, o beta-sitosterol é o fifcéstéroi mais abundante. a composição lipidica da membrana plásíftStXPS de uma célula pode variar com a cultura ou condições de crescimento da célula ou organismo, ou espécie, a partir das quais a célula é obtida. Geralmente, o beta-sitosterol é o fitoesterol mais abundante, a composição lipidica da membrana plasmática de uma célula pode variar com a cultura ou condições de crescimento da célula ou organismo, ou espécie, a partir das quais a célula é obtida. Geralmente, o beta-sitosterol é o fitoesterol mais abundante.

As membranas celulares compreendem geralmente bicamadas lipídicas, bem como proteínas para várias funções. Concentrações localizadas de lipídios particulares podem ser encontradas na bicamada lipidica, conhecida como 'lipid rafts’. Estes microdomínios de jangada lipidica podem ser enriquecidos em esfingolipídeos e esteróis. Sem querer estar limitado pela teoria, jangadas lipídicas podem ter papéis significantes em endo e exocitose, entrada ou saída de vírus ou outros agentes infeciosos, transdução de sinal intercelular, interação com outros componentes estruturais da célula ou organismo, tais como intracelular e matrizes extracelulares. A divulgação inclui VLPs compreendendo HA quimérico, dos quais os subdomínios podem ser obtidos de qualquer tipo, subtipo de vírus gripe que pode infetar humanos, incluindo, por exemplo, tipos ou subtipos Hl e H5. Exemplos não limitantes de tipos ou subtipos Hl ou H5 incluem o subtipo A/Nova Caledónia/20/99 (HlNl) ("Hl/NC"; SEQ ID NO: 56), o subtipo Hl A/Califórnia 04/09 (HlNl). ("Hl/Cal"; SEQ ID NO: 86), e o subtipo A/Indonésia/5/05 (H5N1) ("H5/Indo"), bem como A/Brisbane/59/2007 ("Hl/Bri"). Além disso, o HA quimérico pode compreender um ou mais subdomínios de uma hemaglutinina que é isolada de um ou mais vírus da gripe emergentes ou recentemente identificados. A presente divulgação também diz respeito a virus gripe que infetam outros mamíferos ou animais hospedeiros, por exemplo humanos, primatas, cavalos, porcos, aves, aves aquosas aviárias, aves migratórias, codornízes, patos, gansos, aves, galinhas, camelos, caninos, outros felinos, gatos, tigres, leopardos, civetas, martas, martas de pedra, furões, animais domésticos, gado, ratinhos, ratos, focas, baleias e similares. Alguns virus da gripe podem infetar mais de um animal hospedeiro.

Com referência ao vírus da gripe, o termo "hemaglutinina" ou "HA", tal como aqui utilizado, refere-se a uma glicoproteína estrutural de partículas virais da gripe. A estrutura da hemaglutinina da gripe é bem estudada e demonstra um alto grau de conservação na estrutura secundária, terciária e quaternária. Esta conservação estrutural é observada mesmo que a sequência de aminoácidos possa variar (ver, por exemplo, Skehel e Wiley, 2000 Ann Rev Biochem 69: 531-69; Vaccaro et al 2005; que é aqui incorporado por referência) . As sequências de nucleótidos que codificam para HA são bem conhecidas e estão disponíveis, por exemplo, na Base de Dados de BioDefesa e Saúde Pública (por exemplo, em URL: biohealthbase.org/GSearch/home.do?decorator=Influenza) ou nas bases de dados mantidas pelo National Center for Biotechnology Information (NCBI; por exemplo, na URL: ncbi.nlm.nih. gov/sites/entrez?db=nuccore&cmd=search&term=influenza), ambas aqui incorporadas por referência. O monómero de HA pode ser subdividido em três domínios funcionais -um domínio tronco, ou domínio do domínio tronco (SDC) , um domínio da cabeça globular ou domínio do domínio principal (HDC) e um domínio do domínio transmembranar (TDC). A SDC compreende quatro subdomínios, um péptido de fusão F, F'l e F'2 (este subdomínio pode ser geralmente referido como uma 'espinha dorsal')· O CDT compreende dois subdomínios, a transmembrana (TmD) e uma cauda terminal C (CT). O HDC compreende três subdomínios, domínios esterase vestigial El ' e E2 e um domínio de ligação ao recetor RB. A SDC e a HDC podem ser coletivamente referidas como 'ectodomínio' . Uma publicação de Ha et al. 2002 (EMBO J. 21: 865-875; que é aqui incorporado por referência) ilustra a orientação relativa dos vários subdomínios da SDC e HDC em vários subtipos de gripe, com base em estruturas cristalográficas de raios X. Um diagrama esquemático dos subdomínios relativos aos terminais N e C dos polipéptidos HA1 e HA2 é mostrado na Figura IA. Um alinhamento estrutural anotado de vários subtipos de gripe é fornecido na Figura 1C. A variação de aminoácidos é tolerada em hemaglutininas do virus gripe. Essa variação fornece novas estirpes continuamente identificadas. A infectividade entre as novas estirpes pode variar. Contudo, a formação de trímeros de hemaglutinina, que subsequentemente formam VLPs é mantida. A presente invenção, por conseguinte, proporciona uma sequência de aminoácidos de hemaglutinina compreendendo HA quimérico ou um ácido nucleico que codifica uma sequência de aminoácidos de hemaglutinina quimérica, que forma VLPs numa planta e inclui sequências conhecidas e sequências de HA variantes que podem desenvolver-se. A presente invenção também se refere à utilização de um polipéptido de HA quimérico compreendendo um TDC, SDC e HDC. Por exemplo, a proteína quimérica HA pode ser HAO, ou um HA quimérico clivado compreendendo subdomínios de HA1 e HA2 de dois ou mais tipos de gripe. 0 HAO pode ser expresso e dobrado para formar um trímero, que pode posteriormente ser montado em VLPs. A clivagem de HAO produz polipéptidos HAl e HA2 ligados por uma ponte dissulfureto (ver Figuras 1C, 46 e 47 para ilustração dos padrões da ponte dissulfureto). Para uma partícula de vírus infeciosa, é necessária a clivagem do precursor HAO para desencadear a alteração conformacional de HA2 que liberta o péptido de fusão (no terminal N do polipéptido HA2) e disponibilizá-lo para a fusão das membranas celular e viral. No entanto, as VLPs não são infeciosas e a clivagem do HA em HAl e HA2 não é necessária, por exemplo, para a produção de vacinas. 0 precursor HAO não-clivado também se reúne em trímeros e brota a partir da membrana plasmática para formar nanopartícuias de VLP. 0 polipéptido HAO compreende vários domínios. 0 subdomínio RB do HDC compreende vários laços em regiões antigénicas designadas como sítio AE. Anticorpos que podem neutralizar o vírus da gripe infeciosa são frequentemente direcionados para um ou mais desses locais. Os subdomínios da esterase vestigial (El e E2) podem ter um papel na fusão e podem se ligar ao Ca ++. Os domínios F, F'l e F'2 interagem e cooperam para formar uma haste, elevando a cabeça do trimero HA acima da membrana. Um TmD e CT podem estar envolvidos na ancoragem do HA dobrado a uma membrana. 0 TmD pode ter um papel na afinidade do HA para jangadas lipidicas, enquanto o CT pode ter um papel na secreção de HA, enquanto alguns dos resíduos de cisteína encontrados no subdomínio do CT podem ser palmitoilados. Um péptido sinal (SP) também pode ser encontrado no terminal N do polipéptido HAO. A Figura 2 e as Tabelas 4 e 5 fornecem exemplos das sequências de aminoácidos dos domínios SP, F'l, F'2, El, RB, E2 e F de alguns subtipos do vírus da gripe. 0 processamento de uma sequência de péptido sinal N-terminal (SP) durante a expressão e/ou secreção de hemaglutininas de gripe pode ter um papel no enrolamento do HA. 0 termo "péptido sinal" refere-se geralmente a uma sequência curta (cerca de 5-30 aminoácidos) de aminoácidos, encontrada geralmente no terminal N de um polipéptido de hemaglutinina que pode dirigir a translocação do polipéptido recentemente traduzido para um organelo particular, ou auxiliar no posicionamento de domínios específicos da cadeia polipeptídica em relação a outros. O péptido sinal das hemaglutininas visa a translocação da proteína para o retículo endoplasmático e foi proposto para ajudar no posicionamento do domínio proximal do terminal N em relação a um domínio âncora da membrana do polipéptido hemaglutinina nascente para ajudar na clivagem e dobragem do hemaglutinina madura. A inserção de HA dentro da membrana do retículo endoplasmático (ER) da célula hospedeira, a clivagem do peptídeo sinal e a glicosilação da proteína são eventos co-translacionais. O correto enrolamento de HA requer glicosilação da proteína e formação de, pelo menos, 6 ligações dissulfureto intra-cadeia (ver Figuras 46 e 47) . Na Figura 46, o HA do subtipo A mostra ter 6 pontes dissulfureto conservadas por monómero. Por comparação, o monômero de B HA (Figura 47) tem sete pontes dissulfeto, e cinco dessas pontes dissulfeto têm uma contraparte em A (revisado em Skehel e Wiley, 2000. Ann Rev

Biochem. 69: 531-569; exemplos de estruturas ilustrando pontes dissulfureto intra e intermoleculares e outros aminoácidos conservados e suas posições relativas são descritos, por exemplo, em Gamblin et al 2004, Science 303: 1838-1842; ambos os quais são aqui incorporados por referência). Como um perito na arte perceberia, é importante assegurar que um arranjo semelhante de pontes dissulfureto seja obtido quando se preparam HAs quiméricos.

Um péptido de sinal pode ser nativo para a hemaglutinina, ou um péptido de sinal pode ser heterólogo em relação de sequência primária da hemaglutinina a ser expressa. Um HA quimérico pode compreender um péptido de sinal de um primeiro tipo, subtipo ou estirpe de gripe com o equilíbrio do HA de um ou mais do que um tipo, subtipo ou estirpe de gripe diferente. Por exemplo, as SP nativas dos subtipos HA Hl, H2, H3, H5, H6, H7, H9 ou gripe tipo B podem ser utilizadas para expressar o HA num sistema vegetal. Em algumas formas de realização da invenção, o SP pode ser de um tipo de gripe B, Hl, H3 ou H5; ou do subtipo Hl/Bri, Hl/NC, H5/Indo, H3/ Bri ou B/Flo.

Um SP pode também ser não nativo, por exemplo, de uma proteína estrutural ou hemaglutinina de um vírus que não seja a gripe, ou de um polipéptido vegetal, animal ou bacteriano. Um exemplo não limitativo de um péptido de sinal que pode ser utilizado é o da isomerase de dissulfureto de proteína de alfafa (PDI SP; nucleótidos 32-103 do número de acesso Z11499; SEQ ID NO: 34; Figura 17) possuindo a sequência de aminoácidos: MAKNVAIFGLLFSLLLLVPSQIFAEE (nucleótidos 32-103; SEQ ID NO: 34) A presente invenção proporciona, por conseguinte, uma hemaglutinina de gripe quimérica compreendendo um péptido de sinal nativo, ou não nativo, e ácidos nucleicos que codificam tais hemaglutininas quiméricas. O correto dobramento das hemaglutininas pode ser importante para a estabilidade da proteína, formação de multimeros, formação de VLPs e função do AH (capacidade de hemaglutinato), entre outras caracteristicas das hemaglutininas da gripe. 0 dobramento de uma proteína pode ser influenciado por um ou mais fatores, incluindo, mas não limitado a sequência da proteína, a abundância relativa da proteína, o grau de aglomeração intracelular, a disponibilidade de cofatores que podem se ligar ou ser transitoriamente associados com a proteína dobrada, parcialmente dobrada ou desdobrada, a presença de uma ou mais proteínas acompanhantes ou semelhantes.

As proteínas de choque térmico (Hsp) ou proteínas de stress são exemplos de proteínas acompanhantes, que podem participar em vários processos celulares, incluindo síntese de proteínas, tração intracelular, prevenção de dobragem incorreta, prevenção da agregação de proteínas, montagem e desmontagem de complexos proteicos, dobragem de proteínas e proteína de desagregação. Exemplos de tais proteínas chaperonas incluem, mas não se limitam a, Hsp60, Hsp65, Hsp70, Hsp90, HsplOO, Hsp20-30, HsplO, Hspl00-200, HsplOO, Hsp90, Lon, TF55, FKBPs, ciclofilinas, ClpP, GrpE, ubiquitina, calnexina e isomerases de dissulfureto de protea (ver, por exemplo, Macario, AJL, Cold Spring Harbor Laboratory Res. 25: 59-70, 1995; Parsell, DA e Lindquist, S. Ann. Rev. Genet. 27: 437-496 (1993); Patente US 5232833). Como aqui descrito, as proteínas acompanhantes, por exemplo, mas não limitadas a Hsp40 e Hsp70 podem ser utilizadas para assegurar a dobragem de um HA quimérico.

Exemplos de Hsp70 incluem Hsp72 e Hsc73 de células de mamífero, ADNK de bactérias, particularmente micobactérias tais como Mycobacterium leprae, Mycobacterium tuberculosis e Mycobacterium bovis (tais como Bacille-Calmette Guerin: aqui referidas como Hsp71). ADNK de Escherichia coli, levedura e outros procariontes, e BiP e Grp78 de eucariotas, como A. thaliana (Lin et al. 2001 (Cell Stress and Chaperones 6: 201-208). Urn exemplo particular de uma Hsp70 é a A. thaliana Hsp70 (codificada pelo Genbank ref: AY120747.1). A Hsp70 é capaz de ligar especificamente ATP, bem como polipéptidos e péptidos desdobrados, participando assim no enrolamento e desdobramento de proteínas, bem como na montagem e desmontagem de complexos proteicos.

Exemplos de Hsp40 incluem ADNJ de procariontes como E. coli e micobactérias e HSJ1, HDJ1 e Hsp40 de eucariotas, como a alfafa (Frugis et al., 1999. Plant Molecular Biology 40: 397-408). Um exemplo particular de uma Hsp40 é M. sativa MsJl (AJ000995.1 ou SEQ ID NO: 76). A Hsp40 desempenha um papel como chaperona molecular no dobramento de proteínas, termotolerância e replicação de ADN, entre outras atividades celulares. A Figura 41 mostra a sequência de ácido nucleico que codifica Msj 1 (SEQ ID NO: 76).

Entre as Hsp, a Hsp70 e sua co-chaperona, Hsp40, estão envolvidas na estabilização de polipeptídeos tradutores e recém-sintetizados antes que a síntese esteja completa. Sem querer estar limitado pela teoria, a Hsp40 liga-se às manchas hidrofóbicas de polipéptidos desdobrados (nascentes ou recentemente transferidos), facilitando assim a interação do complexo Hsp70-ATP com o polipéptido. A hidrólise de ATP leva à formação de um complexo estável entre o polipeptídeo, Hsp70 e ADP, e a liberação de Hsp40. A associação do complexo Hsp70-ADP com os fragmentos hidrofóbicos do polipeptídeo impede sua interação com outros fragmentos hidrofóbicos, impedindo o enrolamento incorreto e a formação de agregados com outras proteínas (revisado em Hartl, FU. 1996. Nature 381: 571-579).

Proteínas chaperonas nativas podem ser capazes de facilitar o dobramento correto de baixos níveis de proteína recombinante, mas à medida que os níveis de expressão aumentam, a abundância de chaperonas nativas pode se tornar um fator limitante. Altos níveis de expressão de hemaglutinina nas folhas agroinfiltradas podem levar ao acúmulo de polipeptídeos de hemaglutinina no citosol, e a coexpressão de uma ou mais de uma proteína chaperona, como Hsp70, Hsp40 ou ambas Hsp70 e Hsp40, pode reduzir o nível de desdobramento ou polipii^tidos de hemaglutinina agregados e aumentar o número de polipéptidos que exibem características estruturais terciárias e quaternárias que permitem a hemaglutinação e/ou formação de partículas semelhantes a vírus. SEQ ID NO: 77 é lama sequência de ácido nucleico de uma porção do número de construção R850, de HindIII (no local de clonagem múltipla, a montante do promotor) para EcoRI (imediatamente a jusante do terminador NOS), codificando HSP40 (sublinhado). SEQ ID NO: 78 é uma sequência de ácido nucleico de uma porção do número de construção R860, de HindIII (no local de clonagem múltipla, a montante do promotor) para EcoRI (imediatamente a jusante do terminador NOS) , codificando HSP70 (sublinhado) . SEQ ID NO: 79 é uma sequência de ácido nucleico de uma porção do número de construção R870, de HindIII (no local de clonagem múltipla, 5 a montante do promotor) para EcoRI (imediatamente a jusante do terminador NOS) que codifica HSP40 (sublinhado itálico) e HSP70 (sublinhado). a montante do promotor) para EcoRI (imediatamente a jusante do terminador NOS), codificando HSP70 (sublinhado) . SEQ ID NO: 79 é uma sequência de ácido nucleico de uma porção do número de construção R870, de HindIII (no local de clonagem múltipla, 5 a montante do promotor) para EcoRI (imediatamente a jusante do terminador NOS) que codifica HSP40 (sublinhado itálico) e HSP70 (sublinhado). a montante do promotor) para EcoRI (imediatamente a jusante do terminador NOS), codificando HSP70 (sublinhado). SEQ ID NO: 79 é uma sequência de ácido nucleico de uma porção do número de construção R870, de HindIII (no local de clonagem múltipla, 5 a montante do promotor) para EcoRI (imediatamente a jusante do terminador NOS) que codifica HSP40 (sublinhado itálico) e HSP70 (sublinhado).

Por conseguinte, a presente invenção também proporciona um método para produzir VLPs de gripe quiméricas numa planta, em que um primeiro ácido nucleico codificando um HA de gripe quimérico é co-expresso com um segundo ácido nucleico que codifica um acompanhante. 0 primeiro e segundo ácidos nucleicos podem ser introduzidos na planta no mesmo passo, ou podem ser introduzidos na planta sequencialmente.

As VLPs podem ser avaliadas quanto a estrutura e tamanho, por exemplo, por ensaio de hemaglutinação, microscopia eletrónica ou por cromatografia por exclusão de tamanho.

Para cromatografia por exclusão de tamanho, as proteínas solúveis totais podem ser extraídas do tecido vegetal por homogeneização (Polytron) da amostra de material vegetal triturado congelado em tampão de extração e o material insolúvel removido por centrifugação. Precipitação com PEG também pode ser benéfica. A proteína solúvel é quantificada e o extrato passa através de uma coluna Sephacryl™. 0 Blue Dextrano 2000 pode ser usado como padrão de calibração. Após cromatografia, as frações podem ser analisadas adicionalmente por imunotransferência para determinar o complemento de proteína da fração. A presente invenção também proporciona uma planta compreendendo um ácido nucleico que codifica uma ou mais de uma hemaglutinina da gripe quimérica e um ácido nucleico que codifica uma ou mais de uma das chaperonas. A presente divulgação inclui sequências nucleotidicas: SEQ ID NO: 63 (construção 690; uma cassete de expressão H5/ Hl quimérica compreendendo promotor de plastocianina de alfafa e 5'UTR, sequência de codificação de hemaglutinina quimérica, 3' UTR e sequências terminadoras de plastocianina de alfafa) e a porção sublinhada de SEQ ID NO: 63 codificando SP, F'l, EI de H5/Indo-RB de Hl/Bri-E2, F'2, F, TMD/CT de H5/Indo; SEQ ID NO: 64 (construção 691; uma cassete de expressão quimérica H5/H1 compreendendo promotor de plastocianina de alfafa e 5'UTR, sequência de codificação de hemaglutinina quimérica, UTR de plastocianina de alfafa 3' e sequências de terminador) e a poro sublinhada de SEQ ID NO: 64, codificando SP, F'l, de H5/Indo-El, RB.E2 de Hl/Bri-F’2, F, TMD/CT de H5/Indo; SEQ ID NO: 65 (construção 696; tuna cassete de expressão quimérica H1/H5 compreendendo promotor de plastocianina de alfafa e 5'UTR, sequência de codificação de hemaglutinina quimérica, sequências 3' UTR e terminadora de plastocianina de alfafa) e a poro sublinhada de SEQ ID NO: 65 codificando PDI SP-F'l, El de Hl/NC-RB de H5/lndo-E2, F'2, F, TMD/CT de Hl/NC; SEQ ID NO: 68 (construção 733; a cassete de expressão SpPDI Hl/Bri compreendendo o promotor CaMV 35S, CPMV-HT 5'UTR, sequência codificadora do péptido de sinal da PDI, sequência codificadora da hemaglutinina da forma Hl A/Brisbane/59/07 (HlNl), CPMV-HT 3'UTR e sequências de terminação NOS), e a porção sublinhada de SEQ ID NO: 68, codificando PDI SP-F'l, El, RB, E2, F’2, F, TMD/CT de Hl/BRI; SEQ ID NO: 69 (construção 734; uma cassete de expressão quimérica H5/H1 compreendendo o promotor CaMV 35S, CPMV-HT 5'UTR, sequência codificadora de hemaglutinina quimérica, CPMV-HT 3' UTR e sequências terminadoras NOS). A sequência de codificação de HA quimérico está sublinhada, codificando o mesmo HA quimérico como SEQ ID NO: 63; SEQ ID NO: 71 (construção 736; uma cassete de expressão de HA compreendendo o promotor 35M de CaMV, CPMV-HT 5 'UTR, sequência codificadora do péptido de sinal de PDI, sequência codificadora de hemaglutinina de H3 forma A/Brisbane/10/07 (H2N3), as sequências terminadoras UTR e NOS CPMV-HT), e a porção sublinhada de SEQ ID NO: 71 codificando PDI SP-F'1, El, RB, E2, F’2, F, TMD/CT de H3/Bri; SEQ ID NO: 72 (construção 737; uma cassete de expressão quimérica H5/H3 compreendendo o promotor CaMV 35S, CPMV-HT 5'UTR, sequência de codificação da hemaglutinina quimérica, CPMV-HT 3' UTR e sequências de terminador NOS) e o poro sublinhada da SEQ ID NO: 72 que codifica PDI SP-F'1, El, RB, E2, F'2, F, TMD/CT de H5/Indo; SEQ ID NO: 74 (construção 739; uma cassete de expressão HA compreendendo o promotor CaMV 35S, CPMV-HT 5 'UTR, sequência codificadora do péptido de sinal da PDI, sequência codificadora da hemaglutinina da forma HA B/Florida/4/06, CPMV-HT sequências terminadoras 3'UTR e NOS) e a porção sublinhada da SEQ ID NO: 74 codificando PDI SP-F’l, El, RB, E2, F'2, F, TMD/CT de B/Flo; SEQ ID NO: 75 (construção 734; uma cassete de expressão quimérica H5/B compreendendo o promotor CaMV 35S, CPMV-HT 5'UTR, sequência de codificação hemaglutinina quimérica, CPMV-HT 3' UTR e sequências terminadoras NOS) e o poro sublinhada de SEQ ID NO: 75 que codifica PDI SP-F'1, El, RB, E2, F’2, F de B/Flo-TND/CT de H5/Indo. A presente divulgação também inclui uma sequência nucleotidica que hibrida sob condições de hibridação rigorosas com as pores sublinhadas de qualquer uma das SEQ ID NOs: 63-65, 68, 69 e 71-75. A presente divulgação também inclui uma sequência de nucleótidos que hibrida sob condições de hibridação rigorosas com um complemento das pores sublinhadas de qualquer uma das SEQ ID Nos: 63-65, 68, 69 e 71-75. Estas sequências nucleotídicas que hibridam com as pores sublinhadas de SEQ ID NOs: 63-65, 68, 69 e 71-75, ou um complemento das pores sublinhadas de SEQ ID NOs: 63-65, 68, 69 e 71- 75, codificam uma proteína hemaglutinina quimérica que, quando expressa forma uma VLP quimérica, e a VLP quimérica induz a produção de um anticorpo quando administrada a um indivíduo. Por exemplo, a expressão da sequência nucleotidica dentro de uma célula vegetal forma uma VLP quimérica, e a VLP quimérica pode ser utilizada para produzir um anticorpo que capaz de se ligar a HA, incluindo HA maduro, HAO, HAl ou HA2 de um ou mais tipos ou subtipos de gripe. A VLP quimérica, quando administrada a um sujeito, induz uma resposta imunitária. A hibridação sob condições de hibridação rigorosas conhecida na técnica (ver por exemplo Current Protocols in Molecular Biology, Ausubel et ai., Eds. 1995 e suplementos; Maniatis et al., Em Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, 1982; Sambrook e Russell, em Molecular Cloning: A Laboratory Manual, 3a edição, 2001; cada um dos quais é aqui incorporado por referência). Um exemplo de uma dessas condições de hibridação rigorosas pode ser cerca de 16-20 horas de hibridação em 4 X SSC a 65, seguido por lavagem em 0,1 X SSC a 65 durante uma hora, ou 2 lavagens em 0,1 X SSC a 65? C por 20 ou 30 minutos. Em alternativa, uma condição exemplar de hibridação rigorosa pode ser durante a noite (16-20 horas) em formamida a 50%, 4X SSC a 42°C, seguida por lavagem em 0,1 X SSC a 65°C durante uma hora, ou 2 lavagens em 0,1 X SSC a 65°C cada tampão fosfato aquoso para 20 ou 30 minutos, ou durante a noite (16-20 horas), ou hibridação in Church (7% de SDS; 0,5 M NaPOi tampão pH 7,2; EDTA a 10 mM) a 65° C, com 2 lavagens a 50 em 0,1 X SSC, 0,1% de SDS durante 20 ou 30 minutos cada, ou 2 lavagens a 65 em 2 X SSC, 0,1% de SDS durante 20 ou 30 minutos cada.

Adicionalmente, a presente divulgação inclui sequências nucleotídicas que são caracterizadas como tendo cerca de 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98, 99, 100% ou qualquer quantidade entre elas, identidade de sequência, ou semelhança de sequência, com a sequência nucleotidica que codifica HA quimérica de acordo com as porções sublinhadas de qualquer uma de SEQ ID N°: 63 SEQ ID N°: 64, SEQ ID N°: 65, SEQ ID N°: 68, SEQ ID N°: 69, SEQ ID NO: 71, em que a sequência nucleotidica codifica uma proteína de hemaglutinina que quando expressa forma uma VLP quimérica e que a VLP quimérica induz a produção de um anticorpo. Por exemplo, a expressão da sequência nucleotidica numa célula vegetal forma uma VLP quimérica e a VLP quimérica pode ser utilizada para produzir um anticorpo que capaz de se ligar a HA, incluindo HA madura, HA0, HAl ou HA2. A VLP, quando administrada a um sujeito, induz uma resposta imune.

Uma "resposta imune" geralmente se refere a uma resposta do sistema imune adaptativo. O sistema imune adaptativo geralmente compreende uma resposta humoral e uma resposta mediada por células. A resposta humoral é o aspeto da imunidade que é mediada por anticorpos segregados, produzidos nas células da linhagem de linfócitos B (célula B). Anticorpos segregados se ligam a antígenos na superfície de micróbios invasores (como vírus ou bactérias), que os sinalizam para serem destruídos. A imunidade humoral é geralmente utilizada para referir a produção de anticorpos e os processos que a acompanham, bem como as funções efectoras de anticorpos, incluindo a ativação de células Th2 e produção de citoquinas, geração de células de memória, promoção de fagocitose de opsonina, eliminação de patogénios e semelhantes. Os termos "modular" ou "modulação" ou semelhantes referem-se a um aumento ou diminuição de uma resposta ou parâmetro particular, conforme determinado por qualquer um dos vários ensaios geralmente conhecidos ou utilizados, alguns dos quais são aqui exemplificados.

Uma resposta mediada por células é uma resposta imune que não envolve anticorpos, mas envolve a ativação de macrófagos, células natural killer (NK), linfócitos T citotóxicos específicos de antígeno e a liberação de várias citoquinas em resposta a um antígeno. A imunidade mediada por células é geralmente utilizada para referir alguma ativação de células Th, ativação de células Tc e respostas mediadas por células T. A imunidade mediada por células é de particular importância na resposta a infeções virais.

Por exemplo, a indução de linfócitos T CD8 positivos específicos de antigénio pode ser medida utilizando um ensaio ELISPOT; A estimulação de linfócitos T CD4+ positivos pode ser medida utilizando um ensaio de proliferação. Os títulos de anticorpos anti-gripe podem ser quantificados utilizando um ensaio ELISA; Os isotipos de anticorpos específicos de antígeno ou reativos cruzados também podem ser medidos usando anticorpos anti-isotipo (por exemplo, anti-IgG, IgA, IgE ou IgM) . Os métodos e técnicas para realizar tais ensaios são bem conhecidos na técnica.

Um ensaio de inibição de hemaglutinao (HI ou HAI) também pode ser utilizado para demonstrar a eficácia de anticorpos induzidos por uma vacina, ou composição de vacina compreendendo HA quimérico ou VLP quimérica pode inibir a aglutinação de glóbulos vermelhos (RBC) por HA recombinante. Os títulos de anticorpos inibidores de hemaglutinação de amostras de soro podem ser avaliados por HAI de microtitulação (Aymard et al. 1973). Os eritrócitos de qualquer uma das várias espécies pode ser usada - por exemplo, cavalo, peru, galinha ou semelhantes. Este ensaio fornece informação indireta sobre a montagem do trímero HA na superfície da VLP, confirmando a apresentação adequada de sítios antigênicos em HAs.

Os títulos de reação cruzada de HAI também podem ser usados para demonstrar a eficácia de uma resposta imune a outras estirpes de vírus relacionadas ao subtipo de vacina. Por exemplo, soro de um sujeito imunizado com uma composição de vacina compreendendo uma hemaglutinina quimica compreendendo um HDC de um primeiro tipo ou subtipo de gripe pode ser utilizado num ensaio de HAI com uma segunda estirpe de vírus inteiro ou partículas de vírus e o título de HAI determinado.

Sem querer estar limitado pela teoria, a capacidade de HA de se ligar a RBC de diferentes animais é impulsionada pela afinidade de HA por ácidos siálicos ligados a ligações a2,3 ou oí2,6 e a presença destes ácidos siálicos na superfície de RBC. EH de equinos e aves dos vírus da gripe aglutinam os eritrócitos de todas as várias espécies, incluindo perus, galinhas, patos, porquinhos-da-índia, humanos, ovelhas, cavalos e vacas; considerando que os AH humanos se ligam aos eritrócitos de perus, galinhas, patos, cobaias, seres humanos e ovelhas (Ito T. et al, 1997, Virology, 227; 493-499; Medeiros R et al, 2001. Virology 289: 74-85). A presença ou níveis de citoquinas também podem ser quantificados. Por exemplo, uma resposta de células T auxiliares (Thl/Th2) será caracterizada pela medição de células secretoras de IFN-γ e IL-4 utilizando por ELISA (por exemplo, kits BD Biosciences OptEIA). Podem ser cultivadas células mononucleares do sangue periférico (PBMC) ou esplenócitos obtidos a partir de um sujeito, e o sobrenadante analisado. Os linfócitos T podem também ser quantificados por separação celular ativada por fluorescência (FACS), utilizando marcadores fluorescentes específicos para marcadores e métodos como são conhecidos na técnica.

Um ensaio de microneutralização pode também ser conduzido para caracterizar uma resposta imunitária num indivíduo, ver por exemplo os métodos de Rowe et al., 1973. Os títulos de neutralização de vírus podem ser obtidos de várias maneiras, incluindo: 1) enumeração de placas de lise (ensaio de placa) após fixação de cristal violeta / coloração de células; 2) observação microscópica da lise celular em cultura; 3) ELISA e deteção espectrofotométrica da proteina do vírus NP (correlacionada com a infeção virai das células do hospedeiro) Δ identidade de sequência ou similaridade de sequência pode ser determinada utilizando um programa de comparação de sequências, tal como o fornecido no ADNSIS (por exemplo, utilizando, mas não limitado aos seguintes parâmetros: penalidade GAP 5, #de diagonais superiores 5, penalidade fixa GAP 10, k-tuple 2, gap flutuante 10 e tamanho da janela 5) . No entanto, outros métodos de alinhamento de sequências para comparação são bem conhecidos na arte, por exemplo, os algoritmos de Smith & Waterman (1981, Adv. Appl. Math. 2: 482) Needleman & Wunsch (J. Mol. Biol. 48: 443, 1970) Pearson e Lipman (1988, Proc. Natl. Acad. Sei. USA 85: 2444), e por implementações computadorizadas desses algoritmos (por exemplo, GAP, BESTFIT, FASTA e BLAST (Altschul et al., 1990. J. Mol Biol 215: 403-410), ou por alinhamento manual e inspeção visual. As sequências de ácidos nucleicos ou de aminoácidos podem ser comparadas ou alinhadas e as sequências de consenso podem ser determinadas utilizando qualquer um dos vários pacotes de software conhecidos na técnica, por exemplo MULTALIN (Corpet F., 1988, Nucl. Acids Res., 16 (22), 10881-10890), BLAST, CLUSTAL ou similares; em alternativa as sequências podem ser alinhadas manualmente e semelhanças e diferenças entre as sequências determinadas.

Um fragmento ou porção de uma proteína, proteína de fusão ou polipéptido inclui um péptido ou polipéptido compreendendo um subconjunto do complemento de aminoácidos de uma proteína ou polipéptido particular, desde que o fragmento possa formar uma VLP quimérica quando expressa. O fragmento pode, por exemplo, compreender uma região antigénica, uma região indutora da resposta ao stress ou uma região compreendendo um domínio funcional da proteína ou polipéptido. O fragmento pode também compreender uma região ou domínio comum a proteínas da mesma família geral, ou o fragmento pode incluir sequência de aminoácidos suficiente para identificar especificamente a proteína de comprimento total a partir da qual é derivada.

Por exemplo, um fragmento ou porção pode compreender desde cerca de 60% até cerca de 100%, do comprimento do comprimento total da proteina, ou qualquer quantidade entre eles, desde que o fragmento possa formar uma VLP quimérica quando expressa. Por exemplo, de cerca de 60% a cerca de 100%, de cerca de 70% a cerca de 100%, de cerca de 80% a cerca de 100%, de cerca de 90% a cerca de 100%, de cerca de 95% a cerca de 100% comprimento do comprimento total da proteína, ou qualquer quantidade entre elas. Alternativamente, um fragmento ou porção pode ser de cerca de 150 a cerca de 500 aminoácidos, ou qualquer quantidade entre eles, dependendo do HA quimérico, e desde que o fragmento possa formar uma VLP quimérica quando expressa. Por exemplo, um fragmento pode ser de 150 a cerca de 500 aminoácidos, ou qualquer quantidade entre eles, de cerca de 200 a cerca de 500 aminoácidos, ou qualquer quantidade entre eles, de cerca de 250 a cerca de 500 aminoácidos, ou qualquer quantidade entre, de cerca de 300 a cerca de 500 ou qualquer quantidade entre eles, de cerca de 350 a cerca de 500 aminoácidos, ou qualquer quantidade entre eles, de cerca de 400 a cerca de 500 ou qualquer quantidade entre eles, de cerca de 450 a cerca de 500 ou qualquer quantidade entre elas, dependendo do HA quimérico, e desde que o fragmento possa formar uma VLP quimérica quando expressa. Por exemplo, cerca de 5, 10, 20, 30, 40 ou 50 aminoácidos, ou qualquer quantidade entre os mesmos, podem ser removidos do terminal C, do terminal N ou de ambos os terminais N e C de uma proteína HA quimérica, desde que o fragmento pode formar uma VLP quimérica quando expressa, de cerca de 400 a cerca de 500 ou qualquer quantidade entre elas, de cerca de 450 a cerca de 500 ou qualquer quantidade entre elas, dependendo do HA quimérico, e desde que o fragmento possa formar uma VLP quimérica quando expresso. Por exemplo, cerca de 5, 10, 20, 30, 40 ou 50 aminoácidos, ou qualquer quantidade entre os mesmos, podem ser removidos do terminal C, do terminal N ou de ambos os terminais N e C de uma proteína HA quimérica, desde que o fragmento pode formar uma VLP quimérica quando expressa, de cerca de 400 a cerca de 500 ou qualquer quantidade entre elas, de cerca de 450 a cerca de 500 ou qualquer quantidade entre elas, dependendo do HA quimérico, e desde que o fragmento possa formar uma VLP quimérica quando expresso. Por exemplo, cerca de 5, 10, 20, 30, 40 ou 50 aminoácidos, ou qualquer quantidade entre os mesmos, podem ser removidos do terminal C, do terminal N ou de ambos os terminais N e C de uma proteina HA quimérica, desde que o fragmento pode formar uma VLP quimérica quando expressa. A numeração de aminoácidos em qualquer sequência dada é relativa à sequência particular, no entanto, um especialista pode facilmente determinar a equivalência de um aminoácido particular numa sequência baseada na estrutura e/ou sequência. Por exemplo, se 6 aminoácidos do terminal N fossem removidos, isto mudaria a identidade numérica especifica do aminoácido (por exemplo, em relação ao comprimento total da proteina), mas não alteraria a posição relativa do aminoácido na estrutura. A presente divulgação descreve, mas não está limitada a expressão de um ácido nucleico que codifica um HA quimérico num poro de planta de uma planta, ou uma célula vegetal, e a produção de VLPs de gripe quiméricas da planta, adequadas para produção de vacinas. Exemplos de tais ácidos nucleicos incluem, por exemplo, mas não estão limitados a SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69. A presente divulgação proporciona ainda a expressão de um ácido nucleico que codifica um HA quimérico, por exemplo mas não limitado a SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69 , em uma planta, uma porção de uma planta, ou uma célula vegetal, e produção de candidatos ou reagentes da vacina contra gripe composta de proteínas estruturais recombinantes da gripe que se auto-agrupam em estruturas proteicas macromoleculares homotípicas funcionais e imunogénicas, incluindo partículas de gripe subvirais e gripe quimérica VLP, em células vegetais transformadas.

Por conseguinte, a divulgação proporciona VLPs quiméricas e um modo para a produção de VLPs quiméricas num sistema de expressão de plantas, a partir da expressão de uma única proteína de envelope quimérica. 0 ácido nucleico que codifica o HA quimérico de subtipos de gripe, por exemplo, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, pode ser sintetizado por transcrição reversa e reação em cadeia da polimerase (PCR) usando ARN HA. Como exemplo, o ARN pode ser isolado de Hl/ NC, Hl/Bri ou H5/Indo, ou de células infetadas com estes ou outros tipos ou subtipos de vírus gripe. Para a transcrição reversa e PCR, podem ser utilizados iniciadores oligonucleotídicos específicos para o ARN HA. Adicionalmente, um ácido nucleico codificando uma HA quimérica pode ser sintetizado quimicamente utilizando métodos como seria conhecido de um especialista na técnica. A presente invenção é ainda dirigida a uma construção genética compreendendo um ácido nucleico que codifica uma HA quimérica, como descrito acima, operativamente ligado a um elemento regulador que é operativo numa planta. Exemplos de elementos reguladores operacionais numa célula vegetal e que podem ser utilizados de acordo com a presente invenção incluem, mas não estão limitados a uma região reguladora de plastocianina (US 7125978), ou uma região reguladora da Ribulose 1,5-bisfosfato carboxilase/oxigenase (RuBisCO; US 4962028), proteína de ligação à clorofila a/b (CAB; Leutwiler et al., 1986), ST-LS1 (associada ao complexo do fotossistema II que envolve o oxigénio e descrita por Stockhaus et al.1987, 1989). A construção genética da presente invenção pode também compreender um promotor constitutivo que dirige a expressão de um gene que está operativamente ligado ao promotor ao longo das várias partes de uma planta e continuamente ao longo do desenvolvimento da planta. Um exemplo não limitativo de um promotor constitutivo é aquele associado ao transcrito CaMV 35SOdell et al·., 1985, Nature, 313: 810-81.).

Um exemplo de uma sequência compreendendo uma região reguladora da plastocianina é a sequi^cia 5'para a sequenciada sublinhada que codifica um péptido de sinal da PDI da SEQ ID NO: 58. Um elemento regulador ou região reguladora pode melhorar a tradução de uma sequência nucleotídica à qual está ligada de forma operacional, onde a sequência nucleotídica pode codificar uma proteína ou polipéptido. Outro exemplo de uma região reguladora, o derivado das regiões não traduzidas do vírus do mosaico do caupi (CPMV), que pode ser utilizado para traduzir preferencialmente a sequência de nucleótidos a que está ligada operativamente. Esta região reguladora do CPMV é explorada em um sistema CMPV hiper-traduzível (CPMV-HT; ver, por exemplo, Sainsbury et al, 2008, Plant Physiology 148: 1212-1218; Sainsbury et al., 2008 Plant Biotechnology Journal 6: 82-92).

Por conseguinte, um aspeto da invenção proporciona um ácido nucleico compreendendo uma região reguladora operativamente ligada a uma sequência que codifica uma HA quimérica de gripe. A região reguladora pode ser um elemento regulador de plastocianina, e a gripe HA quimérico pode compreender subdomínios tipos de gripe de H5/Indo, Hl/Bri, Hl/NC, subtipos ou estirpes. As sequências de ácido nucleico compreendendo um elemento regulador de plastocianina e um HA de gripe quimérico são aqui exemplificadas pelas SEQ ID NOs: 63 e 64. As sequências de ácido nucleico compreendendo um elemento regulador 35S e um HA de gripe quimérico s aqui exemplificadas pelas SEQ ID NOs: 68, 69 e 71-75.

Noutro aspeto, a invenção proporciona um ácido nucleico compreendendo uma região reguladora de CPMV e uma HA de gripe quimérica, compreendendo subdomínios dos tipos, subtipos ou estirpes de gripe H5/Indo, Hl/Bri, Hl/NC. As sequências de ácido nucleico compreendendo um elemento regulador de CPMP e um HA quimérico s aqui exemplificadas pelas SEQ ID NOs: 66-69 e 71-75. VLPs de gripe quiméricas produzidas em plantas brotam a partir da membrana plasmática e a composição lipídica das VLPs quiméricas reflete aquela do tipo de tecido celular ou planta da planta do qual elas são produzidas. As VLPs produzidas de acordo com a presente invenção compreendem HA quimérico de dois tipos ou subtipos de gripe, complexados com lípidos derivados de plantas. Os lípidos vegetais podem estimular células imunitárias especificas e aumentar a resposta imunitária induzida. Lípidos de plantas tais como PC (fosfatidilcolina) e PE {fosfatidil etanolamina), bem como glicoesfingolipidos podem ligar-se a moléculas CDl expressas por células imunes de mamíferos tais como células apresentadoras de antígenos (APCs) como células dendríticas e macrófagos e outras células incluindo B e Linfócitos T no timo e fígado (revisto em Tsuji M,. 2006 Cell Mol Life Sci 63: 1889-98). As moléculas de CDl são estruturalmente semelhantes às moléculas do complexo de histocompatibilidade principal (MHC) da classe I e seu papel é apresentar antígenos glicolipídicos às células NKT (células T Natural Killer). Após a ativação, as células NKT ativam as células imunes inatas, como as células NK e as células dendríticas, e também ativam as células imunes adaptativas, como as células B e as células T produtoras de anticorpos.

Os fitosteróis presentes numa VLP de gripe complexada com uma bicamada lipídica, tal como um envelope derivado da membrana plasmática, podem proporcionar uma composição de vacina vantajosa. Sem querer estar limitado pela teoria, as VLPs feitas de plantas, incluindo aquelas compreendendo HA quimérico, complexadas com uma bicamada lipídica, tal como um envelope derivado da membrana plasmática, podem induzir uma reação imune mais forte do que as VLPs feitas em outros sistemas de expressão, ser semelhante à reação imune induzida por vacinas de vírus inteiros vivos ou atenuados.

Por conseguinte, em algumas formas de realização, a invenção proporciona uma VLP compreendendo uma HA quimérica, complexada com uma bicamada lipídica derivada de plantas. Em algumas formas de realização, a bicamada lipídica derivada de plantas pode compreender o envelope da VLP. A VLP produzida dentro de uma planta pode incluir um HA quimérico compreendendo N-glicanos específicos de plantas. Portanto, esta invenção também proporciona uma VLP compreendendo uma HA quimérica tendo N-glicanos específicos da planta.

Além disso, a modificação do N-glicano nas plantas é conhecida (ver, por exemplo, WO 2008/151 440) e HA quimérico tendo N-glicanos modificados pode ser produzido. Pode ser obtido um HA quimérico compreendendo um padrão de glicosilação modificado, por exemplo com N-glicanos fucosilados, xilosilados ou ambos fucosilados e xilosilados, ou pode ser obtido HA quimérico possuindo um padrão de glicosilação modificado, em que a proteina não tem fucosilação, xilosilação ou ambos e compreende galatosilação aumentada. Além disso, a modulação de modificações pós-tradução, por exemplo, a adição de galactose terminal pode resultar numa redução da fucosilação e xilosilação do HA quimérico expresso quando comparado com uma planta de tipo selvagem que expressa HA quimérico.

Por exemplo, o que não deve ser considerado limitante, a síntese de HA quimérico tendo um padrão de glicosilação modificado pode ser conseguido co-expressando a proteina de interesse juntamente com uma sequência nucleotídica codificando beta-1,4galactosiltransferase (GalT), por exemplo, mas não se limitando a GalT de mamífero, ou GalT humano, no entanto, também pode ser utilizado GalT de outras fontes. O domínio catalítico de GalT também pode ser fundido a um domínio CTS (ou seja, cauda citoplasmática, domínio transmembrana, região tronco) da N-acetilglucosaminil transferase (GNTl), para produzir uma enzima híbrida GNTl-GalT, e a enzima híbrida pode ser co-expressa com HA. 0 HA pode também ser co-expresso juntamente com uma sequência nucleotídica codificando N-acetilglucosaminiltransferase III (GnT-III), por exemplo mas não limitada a GnT-III de mamífero ou GnT-III humana, A GnT-III de outras fontes também pode ser usada. Adicionalmente, também pode ser utilizada uma enzima híbrida GNTl-GnT-III, compreendendo o CTS de GNTl fundido com GnT-III.

Portanto, a presente invenção também inclui VLP compreendendo HA quimérico tendo N-glicanos modificados.

Sem querer estar limitado pela teoria, a presença de N-glicanos vegetais num HA quimérico pode estimular a resposta imunitária promovendo a ligação de HA por células apresentadoras de antigénio. A estimulação da resposta imune utilizando a planta N glicano tem sido proposta por Saint-Jore-Dupas et al. (Trends Biotechnol 25: 317-23, 2007) . Além disso, a conformação da VLP pode ser vantajosa para a apresentação do antigénio e aumentar o efeito adjuvante da VLP quando complexada com uma camada lipidica derivada da planta.

Por "região reguladora", "elemento regulador" ou "promotor" entende-se uma porção de ácido nucleico tipicamente, mas nem sempre, a montante da região codificadora de proteína de um gene, que pode ser constituo por ADN ou ARN, ou ambos ADN e ARN. Quando uma região reguladora está ativa, e em associação operativa, ou operativamente ligada, com um gene de interesse, isto pode resultar na expressão do gene de interesse. Um elemento regulador pode ser capaz de mediar a especificidade de órgãos ou controlar a ativação de genes temporais ou de desenvolvimento. Uma "região reguladora" inclui elementos promotores, elementos promotores centrais exibindo uma atividade promotora basal, elementos que são indutiveis em resposta a um estimulo externo, elementos que medeiam a atividade promotora, tais como elementos reguladores negativos ou estimuladores da transcrição. "Região reguladora", como aqui utilizada, tambmém inclui elementos que são ativos após transcrição, por exemplo, elementos reguladores que modulam a expresso génica, tais como intensificadores de tradução e transcrição, repressores de tradução e transcrição, sequências de ativação a montante e determinantes da instabilidade de ARNm. Vários destes últimos elementos podem estar localizados próximo da região de codificação.

No contexto desta divulgação, o termo "elemento regulador" ou "região reguladora" refere-se tipicamente a uma sequência de ADN, normalmente, mas nem sempre, a montante (5') da sequência de codificação de um gene estrutural, que controla a expressão da região codificadora, proporcionando o reconhecimento da polimerase de ARN e/ou outros fatores necessários para a transcrição iniciar num local particular. No entanto, é para ser entendido que outras sequências nucleotidicas, localizadas dentro dos intrões, ou 3'da sequência podem também contribuir para a regulação da expressão de uma região codificadora de interesse. Um exemplo de um elemento regulador que proporciona o reconhecimento da ARN polimerase ou de outros fatores transcricionais para assegurar a iniciação em um local especifico é um elemento promotor. A maioria, mas não todas Os elementos promotores eucarióticos contêm uma caixa TATA, uma sequência de ácidos nucleicos conservada composta por pares de bases de nucleótidos de adenosina e timidina situados habitualmente aproximadamente 25 pares de bases a montante de um local de inicio da transcrição. Um elemento promotor compreende um elemento promotor basal, responsável pela iniciação da transcrição, bem como outros elementos reguladores (como listado acima) que modificam a expressão génica.

Existem vários tipos de regiões reguladoras, incluindo aquelas que são reguladas pelo desenvolvimento, indutíveis ou constitutivas. Uma região reguladora que é regulada pelo desenvolvimento, ou controla a expressão diferencial de um gene sob seu controle, é ativada dentro de certos órgãos ou tecidos de um órgão em momentos específicos durante o desenvolvimento desse órgão ou tecido. No entanto, algumas regiões reguladoras que são reguladas pelo desenvolvimento podem ser preferencialmente ativas dentro de certos órgãos ou tecidos em estágios específicos de desenvolvimento, elas também podem ser ativas de maneira regulada pelo desenvolvimento, ou em nível basal em outros órgãos ou tecidos dentro da planta também. Exemplos de regiões reguladoras específicas do tecido, por exemplo, uma região reguladora específica da vista, incluem o promotor da napina e o promotor da cruciferina (Rask et al.f 1998, J. Plant Physiol. 152: 595-599; Bilodeau et al., 1994, Plant Cell 14: 125-130). Um exemplo de um promotor especifico de folhas inclui o promotor de plastocianina (ver, por exemplo, a SEQ ID NO: 58); US 7125978, que é aqui incorporado por referência).

Uma região reguladora indutível é aquela que é capaz de direta ou indiretamente ativar a transcrição de uma ou mais sequências de ADN ou genes em resposta a um indutor. Na ausência de um indutor, as sequências de ADN ou genes não serão transcritos. Tipicamente, o fator de proteína que se liga especificamente a uma região reguladora indutível para ativar a transcrição pode estar presente em uma forma inativa, que é então direta ou indiretamente convertida para a forma ativa pelo indutor. No entanto, o fator de proteína também pode estar ausente. 0 indutor pode ser um agente químico como uma proteína, metabólito, regulador de crescimento, herbicida ou composto fenólico ou um estresse fisiológico imposto diretamente por calor, frio, sal ou elementos tóxicos ou indiretamente pela ação de um patógeno ou agente causador de doenças, como um virus. Uma célula de planta contendo uma região reguladora indutível pode ser exposta a um indutor aplicando externamente o indutor à célula ou planta tal como por pulverização, rega, aquecimento ou métodos semelhantes. Elementos reguladores indutíveis podem ser derivados de genes vegetais ou não-vegetais (por Gatz, C. e Lenk, IRP, 1998, Trends Plant Sci. 3, 352-358; que é incorporado por referência). Exemplos de potenciais promotores indutíveis incluem, mas não limitados a promotor indutível por tetraciclina (Gatz, C., 1997, Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 89-108; que é incorporado por referência), promotor induzido por esteroides (Aoyama, T. e Chua, NH, 1997, Plant J. 2, 397-404; que é incorporado por referência) e promotor indutível por etanol (Salter, MG, et al·., 1998, Plant Journal 16, 127-132; Caddick, MX, et al·., 1998, Nature Biotech. 16, 177-180, que são incorporados por referência) genes IB6 e CKIl indutíveis pela citoquinina (Brandstatter, I. e Kieber, JJ, 1998, Plant Cell 10, 1009-1019; Kakimoto, T., 1996, Science 274, 982-985; incorporados por referência) e o elemento indutível de auxina, DR5 (Ulmasov, T., et al·., 1997, Plant Cell 9, 1963-1971; que é incorporado por referência).

Uma região reguladora constitutiva dirige a expressão de um gene ao longo das várias partes de uma planta e continuamente durante o desenvolvimento da planta. Exemplos de elementos reguladores constitutivos conhecidos incluem promotores associados com o transcrito CaMV 35S. (Odell et al·., 1985, Nature, 313: 810-812), a actina 1 do arroz (Zhang et al, 1991, Plant Cell, 3: 1155-1165), actina 2 (An et al., 1996, Plant J., 10: 107-121.) ou tms 2 (US 5428147, que é aqui incorporado por referência), e genes do triosefosfato isomerase 1 (Xu et. al., 1994, Plant Physiol. 106: 459-467), o gene da ubiquitina 1 do milho (Cornejo et al, 1993, Plant Mol. Biol. 29: 637-646), os genes da Arabidopsis ubiquitina 1 e 6 (Holtorf et al, 1995, Plant Mol. Biol. 29: 637-646) e o gene do fator de iniciação translacional do tabaco 4A (Mandei et al, 1995 Plant Mol. Biol. 29: 995-1004). O termo "constitutivo", como aqui utilizado, não indica necessariamente que um gene sob o controlo da região reguladora constitutiva é expresso ao mesmo nível em todos os tipos de células, mas que o gene é expresso numa vasta gama de tipos de células, embora a variação abundância é frequentemente observada. Os elementos reguladores constitutivos podem ser acoplados a outras sequências para aumentar ainda mais a transcrição e/ou tradução da sequência nucleotídica à qual estão operativamente ligados. Por exemplo, o sistema CPMV-HT é derivado das regiões não traduzidas do vírus do mosaico de Cowpea (CPMV) e demonstra Lima tradução melhorada da sequência de codificação associada.

Por "nativo" significa-se que o ácido nucleico ou sequência de aminoácidos ocorre naturalmente ou "tipo selvagem".

Por "operacionalmente ligado" entende-se que as sequências particulares, por exemplo, um elemento regulador e uma região codificadora de interesse, interagem direta ou indiretamente para realizar uma função pretendida, tal como mediação ou modulação da expressão gênica. A interação de sequências operativamente ligadas pode, por exemplo, ser mediada por proteínas que interagem com as sequências ligadas operativamente. A sequência nucleotídica da presente invenção pode ser expressa em qualquer hospedeiro vegetal adequado que seja transformado pela sequência nucleotídica ou construções ou vetores da presente invenção. Exemplos de hospedeiros adequados incluem, mas não estão limitados a culturas agrícolas incluindo alfafa, canola, Brassica spp., Milho, Nicotiana spp., Alfafa, batata, ginseng, ervilha, aveia, arroz, soja, trigo, cevada, girassol, algodão, e similar. A construção genética quimérica da presente invenção pode ainda compreender uma região 3 'não traduzida. Uma região 3 'não traduzida refere-se à porção de um gene compreendendo um segmento de ADN que contém um sinal de poliadenilação e quaisquer outros sinais reguladores capazes de efectuar o processamento de ARNm ou a expressão génica. 0 sinal de poliadenilação é normalmente caracterizado por efetuar a adição de pistas de ácido poliadenilico à extremidade 3'do precursor de ARNm. Sinais de poliadenilação são comumente reconhecidos pela presença de homologia com a forma canónica 5 'AATAAA-3', embora variações não sejam incomuns.

Exemplos não limitantes de regiões 3 'adequadas são as regiões não traduzidas transcritas em 3' contendo um sinal de poliadenilação de genes de plasmídeos indutores de tumor (Ti) de Agrobacterium , tais como o gene da nopalina sintase (NOS), genes de plantas tais como a proteina de armazenamento de genes de soja, a pequena subunidade do gene da ribulose-1, 5-bisfosfato carboxilase (ssRUBISCO; US 4962028; que é aqui incorporado por referência), o promotor usado na regulação da expressão de plastocianina, descrito em US 7125978 (que é aqui incorporado por referência).

Uma ou mais das construções genéticas quiméricas da presente invenção também podem incluir outros intensificadores, sejam tradutores ou intensificadores de transcrição, conforme possa ser requerido. Os realçadores podem estar localizados 5' ou 3' para a sequência que está sendo transcrita. As regiões potenciadoras são bem conhecidas dos peritos na arte e podem incluir um codão de iniciação ATG, sequências adjacentes ou semelhantes. O codão de iniciação, se presente, pode estar em fase com o quadro de leitura ("no enquadramento") da sequência de codificação para proporcionar a tradução correta da sequência transcrita.

Para auxiliar na identificação de células vegetais transformadas, as construções desta invenção podem ser ainda manipuladas para incluir marcadores selecionáveis de plantas. Marcadores selecionáveis úteis incluem enzimas que proporcionam resistência a químicos tais como um antibiótico, por exemplo, gentamicina, higromicina, canamicina ou herbicidas tais como fosfinotricina, glifosato, clorossulfurão e semelhantes. De modo semelhante, podem ser utilizadas enzimas que proporcionam a produção de um composto identificável por alteração de cor, tal como GUS (beta-glucuronidase) , ou luminescência, tal como luciferase ou GFP.

Também são considerados parte desta invenção plantas transgénicas, células vegetais ou sementes contendo a construção de genes quiméricos da presente invenção. Métodos de regeneração de plantas inteiras a partir de células vegetais são também conhecidos na técnica. Em geral, as células vegetais transformadas são cultivadas num meio apropriado, o qual pode conter agentes seletivos tais como antibióticos, onde marcadores selecionáveis são utilizados para facilitar a identificação de células vegetais transformadas. Uma vez formadas pelos calos, a formação de rebentos pode ser encorajada empregando as hormonas vegetais apropriadas de acordo com métodos conhecidos e os rebentos transferidos para o meio de enraizamento para regeneração de plantas. As plantas podem então ser usadas para estabelecer gerações repetitivas, a partir de sementes ou usando técnicas de propagação vegetativa. Plantas transgénicas também podem ser geradas sem o uso de culturas de tecidos.

Também consideradas parte desta invenção são plantas transgénicas e árvores contendo a construção génica quimérica compreendendo um ácido nucleico codificando HA ou HAO quimérico recombinante para produção de VLP, de acordo com a presente invenção.

Os elementos reguladores da presente divulgação também podem ser combinados com a região codificante de interesse para expressão dentro de uma gama de organismos hospedeiros que são susceptiveis a transformação ou expressão transiente. Tais organismos incluem, mas não estão limitados a plantas, monocotiledóneas e dicotiledóneas, por exemplo mas não limitadas a milho, plantas de cereais, trigo, cevada, aveia, Nicotiana spp, Brassica spp, soja, feijão, ervilha, alfafa, batata, tomate, ginseng e Arabidopsis. Métodos para transformação estável e regeneração destes organismos são estabelecidos na arte e conhecidos de um especialista na técnica. 0 método de obtenção de plantas transformadas e regeneradas não é critico para a presente invenção.

Por "transformação" entende-se a transferência interespecífica de informação genética (sequência nucleotidica) que se manifesta genotipicamente, fenotipicamente ou ambas. A transferência interespecífica de informação genética de uma construção quimérica para um hospedeiro pode ser hereditária e a transferência de informação genética considerada estável, ou a transferência pode ser transitória e a transferência de informação genética não é hereditária.

Pelo termo "matéria vegetal", entende-se qualquer material derivado de uma planta. A matéria vegetal pode compreender uma planta inteira, tecido, células ou qualquer fração dela. Além disso, a matéria vegetal pode compreender componentes de plantas intracelulares, componentes de plantas extracelulares, extratos líquidos ou sólidos de plantas ou uma combinação destes. Além disso, a matéria vegetal pode compreender plantas, células vegetais, tecido, um extrato líquido ou uma sua combinação, a partir de folhas de plantas, caules, frutos, raízes ou uma sua combinação. A matéria vegetal pode compreender uma planta ou parte dela que não tenha sido submetida a quaisquer etapas de processamento. Uma parte de uma planta pode compreender matéria vegetal. No entanto, também é contemplado que o material vegetal pode ser submetido a etapas de processamento mínimas, conforme definido abaixo, ou a um processamento mais rigoroso, incluindo purificação de proteína parcial ou substancial utilizando técnicas vulgarmente conhecidas na técnica incluindo, mas não se limitando a cromatografia, eletroforese e semelhantes.

Pelo termo "processamento minímo" entende-se a matéria vegetal, por exemplo, uma planta ou sua porção compreendendo uma proteína de interesse que é parcialmente purificada para produzir um extrato vegetal, homogeneizado, fração de homogenato de planta ou semelhantes (isto é, minimamente processados). A purificação parcial pode compreender, mas não está limitada a rutura de estruturas celulares vegetais, criando assim uma composição compreendendo componentes vegetais soleis e componentes vegetais insoleis que podem ser separados, por exemplo, mas não limitados a centrifugação, filtração ou uma sua combinação. A este respeito, as proteínas segregadas no espaço extracelular da folha ou outros tecidos podem ser prontamente obtidas usando vácuo ou extração centrífuga, ou os tecidos podem ser extraídos sob pressão por passagem através de rolos ou trituração ou semelhantes para espremer ou libertar a proteína livre de dentro do espaço extracelular. 0 processamento mínimo também poderia envolver a preparação de extratos brutos de proteínas solúveis, uma vez que essas preparações teriam contaminação desprezível de produtos vegetais secundários. Além disso, o processamento mínimo pode envolver a extração aquosa da proteína solúvel das folhas, seguida de precipitação com qualquer sal adequado. Outros métodos podem incluir maceração em grande escala e extração de suco, a fim de permitir o uso direto do extrato. A matéria vegetal, na forma de material vegetal ou tecido, pode ser administrada oralmente a um sujeito. A matéria vegetal pode ser administrada como parte de um suplemento dietético, junto com outros alimentos, ou encapsulada. A matéria vegetal ou tecido também pode ser concentrado para melhorar ou aumentar a palatabilidade, ou fornecido juntamente com outros materiais, ingredientes ou excipientes farmacêuticos, conforme necessário.

Exemplos de um sujeito ou organismo alvo que as VLPs da presente invenção podem ser administradas para incluir, mas não estão limitados a humanos, primatas, aves, aves aquáticas, aves migratórias, codornas, patos, gansos, aves domésticas, galinhas, suínos, ovelhas, equino, cavalo, camelo, canino, cães, felino, gatos, tigre, leopardo, civeta, marta, marta de pedra, furões, casa de animais de estimação, gado, coelhos, ratos, cobaias ou outros roedores, selo, baleia e o gosto. Tais organismos alvo são exemplares e não devem ser considerados limitantes às aplicações e utilizações da presente invenção. É contemplado que uma planta compreendendo a HA quimérica de acordo com algumas formas de realização da invenção, ou expressando a VLP compreendendo a HA quimérica de acordo com algumas formas de realização da invenção, pode ser administrada a um sujeito ou organismo alvo, numa variedade de maneiras dependendo sobre a necessidade e a situação. Por exemplo, o HA quimérico obtido a partir da planta pode ser extraído antes da sua utilização quer numa forma bruta, parcialmente purificada, quer purificada. Se o HA quimérico deve ser pelo menos parcialmente purificado, então pode ser produzido em plantas comestíveis ou não comestíveis. Além disso, se o HA quimérico for administrado oralmente, o tecido da planta pode ser colhido e ser alimentado diretamente ao indivíduo, ou o tecido colhido pode ser seco antes da alimentação, ou um animal pode ser permitido pastar na planta sem colheita prévia. Lugar, colocar. É também considerado dentro do âmbito desta invenção que os tecidos vegetais colhidos sejam fornecidos como um suplemento alimentar na alimentação animal. Se o tecido vegetal estiver a ser alimentado a um animal com pouco ou nenhum processamento adicional, é preferível que o tecido vegetal a ser administrado seja comestível.

0 silenciamento génico pós-transcricional (PTGS) pode estar envolvido na limitação da expressão de transgenes em plantas, e a coexpressão de um supressor de silenciamento do vírus da batata Y (HcPro) pode ser usada para neutralizar a degradação específica de mARNs transgénicos (Brigneti et al., 1998). Supressores alternativos de silenciamento são bem conhecidos na técnica e podem ser usados como descrito aqui (Chiba et al., 2006, Virology 346: 7-14; que é aqui incorporado por referência), por exemplo mas não se limitando a, TEV-pl / HC-Pro (Vírus etch de tabaco-pl/HC-Pro), BYV-p21, pl9 de Tomato stab virus (TBSV ρ19), cápside proteína do Tomato plinkle virus (TCV-PC), 2b do vírus do mosaico do pepino; CMV-2b), p25 do Potato virus X (PVX-p25), pll do Potato virus M (PVM-pll), pll do Potato virus S (PVS-pll), pl6 do Blueberry scorch virus, (BScV-pl6), p23 do virus Citrus tristeza (CTV-p23), p24 do virus associado a Leafroll Grapevine-2, (GLRaV-2 p24), plO do virus Grapevine A, (GVA-plO), pl4 do virus Grapevine B (GVB-pl4), plO do vírus latente Heracleum (HLV-plO) , ou pl6 do virus latente comum Garlic (GCLV-pl6). Portanto, um supressor de silenciamento, por exemplo, mas não limitado a HcPro, TEV-pl/HC-Pro, BYV-p21, TBSV pl9, TCV-CP, CMV-2b, PVX-p25, PVM-pll, PVS- pll, BScV-pl6, CTV-p23, GLRaV-2 p24, GBV-pl4, HLV-plO, GCLV-pl6 ou GVA-plO, podem ser co-expressos juntamente com a sequência de ácido nucleico que codifica a proteina de interesse para assegurar ainda mais elevados niveis de produção de proteina dentro de uma planta.

Além disso, as VLP produzidas como aqui descrito não compreendem neuraminidase (NA) . No entanto, a NA pode ser co-expressa com HA se as VLPs compreendendo HA e NA forem desejadas.

Por conseguinte, a presente divulgação inclui ainda um vetor adequado compreendendo a sequência de HA quimérica adequada para utilização com sistemas de expressão estável ou transitória. A informação genética pode também ser fornecida dentro de um ou mais de uma construção. Por exemplo, uma sequência nucleotídica que codifica uma proteina de interesse pode ser introduzida numa construção e uma segunda sequência nucleotídica que codifica uma proteína que modifica a glicosilação da proteína de interesse pode ser introduzida utilizando uma construção separada. Estas sequências nucleotídicas podem então ser co-expressas dentro de uma planta. No entanto, uma construo compreendendo uma sequência nucleotídica que codifica a proteína de interesse e a proteína que modifica o perfil de glicosilação da proteína de interesse pode também ser utilizada.

Por "co-expresso" entende-se que duas ou mais do que duas sequências de nucleótidos são expressas aproximadamente ao mesmo tempo dentro da planta e dentro do mesmo tecido da planta. No entanto, as sequências de nucleotídeos não precisam ser expressas exatamente ao mesmo tempo. Pelo contrário, as duas ou mais sequências de nucleótidos são expressas de Lima maneira tal que os produtos codificados têm uma pQssibllldãdê de líibêragir·. :P©r exemplO::r ã proteína que modified á giieosilaçã©: da proteina de interesse pode ser expressa antes ou duranfe q; period©;: pmque a .proteína: de interesse;· φ expressa:*: ide ®dde que a ;m©difí cação: da: gliepsiiaçãQ; das duas Οή paid de duas·· sequénçiSS:' nucleotídicas podem ser co-expressas utilizando um sistema de expressão transiente, onde as duas ou mais sequências são introduzidas denito dã, planta sproximadamente ao pespo tempo .sob eondiçbes em que aíÉSaS as! sequências são expressas. Alternativamente, uma plstóa de pjatãfofla compreendendo uma das sequências nucleotídicas, por exemplo, a sequência que codifica: jpOtsihS tpê modifica o peitil· de glicosilaçâo da proteína de interesse, pode ser transformada, transitoriamentê ©u de um Podo estilei,. cbP uma sequência SdidiOial que codifica a proteína ,de interesse*: iMMÍte eas©:, a: sequência que codifica: a proteína que modifica o perfil de glicosilação ;da proteína de interesse: pode. ser: expressa dentro: de um tecido; desejado, durante um ssfidip de desenvolvimento desejado* ou a sua expressão ;pode ser induzida utilizando um promotor indutível e a sequência adicional codificando a proteína de interesse pode ser expressa em condições semelhantes e no mesmo tecido, para assegurar que as sequências nucleotídicas sejam co-expressas.

As construções da presente invenção podem ser introduzidas em células vegetais utilizando plasmídeos Ti, plasmídeos Ri, vetores de vírus de plantas, transformação direta de ADN, microinjeção, electroporação, infiltração e semelhantes. Para revisões de tais técnicas ver por exemplo, Weissbach e Weissbach, Methods for Plant Molecular Biology, Academia Press, New York VIII, pp. 421-463 (1988); Geierson e Corey, Plant Molecular Biology, 2d Ed. (1988); e Miki e Iyer, Fundamentals of Gene Transfer in Plants. In Plant Metabolism, 2d Ed. DT. Dennis, DH Turpin, DD Lefebrve, DB Layzell (eds), Addison-Wesley, Langmans Ltd. London, pp. :561-51:9 |1997) , ©atros: métodos incluem a absorção direta de ADN, a utilização de ilpossomas, alecÊfòpofâÇiO:, por exemplo, utilizando protoplastos^ microinjeção,; mi cr ©projéteis; ou ''whiskers” ψ infiltração s vicu©* Veja,, por exemplo:*: Sllanp st al. (Gene lOtt: 247-250 (1991) ) ÍOlieid qt:: al« (Mol. Gen. Genet. 228: 104-112, 1991) Guerche et al. (Plant Science 52: 111-116, 1987) Neuhause et al. (Theor. Appl Genet. 75: 30-36, 1987) Klein et al.. Nature 327: 70-73 (1987); Howell et al. (Ciência 208: 1265, 1980) Horsch et al. (Science 227: 1229-1231, 1985) DeBlock et al., Plant Physiology 91: 694-701, 1989), Liu e Lomonossoff (J. Virol Meth, 105: 343-348, 2002,), Patentes US 4945050; 5036006; 5100792; 6403865; 5625136, (todos os quais são aqui incorporados por referência).

Os métodos de expressão transiente podem ser usados para expressar as construções da presente invenção (ver Liu e Lomonossoff, 2002, Journal of Virological Methods, 105: 343-348; que é aqui incorporado por referência). Em alternativa, um método de expressão transiente baseado em vácuo, como descrito por Kapila et al. 1997 Plant Science 122: 101-108(aqui incorporado por referência) pode ser usado. Estes métodos podem incluir, por exemplo, mas não estão limitados a um método de Agro-inoculação ou de Agro-infiltração, no entanto, outros métodos transitórios podem também ser utilizados como mencionado acima. Com Agro-inoculação ou Agro-infiltração, uma mistura de Agrobacteria compreendendo o ácido nucleico desejado entra nos espaços intercelulares de um tecido, por exemplo, as folhas, porção aérea da planta (incluindo caule, folhas e flor), outra porção da planta (caule, raiz, flor) , ou a planta inteira. Depois de atravessar a epiderme, o Agrobacterium infecta e transfere cópias de t-ADN para as células. O t-ADN é epissalograficamente transcrito e o mARN é traduzido, levando à produção da proteína de interesse em células infetadas, no entanto, a passagem do t-ADN dentro do núcleo é transitória.

As VLP compreendendo HA quimérico proporcionado pela presente invenção podem ser utilizadas em conjunto com uma vacina de gripe existente, para suplementar a vacina, torná-la mais eficaz ou para reduzir as dosagens de administração necessárias. Tal como seria do conhecimento de um perito na arte, a vacina pode ser dirigida contra um ou mais do que um vírus da gripe. Exemplos de vacinas adequadas incluem, mas não estão limitados a, aqueles comercialmente disponíveis da Sanofi-

Pasteur, ID Biomedical, Merial, Sinovac, Quiron, Roche, Medlmmune, GlaxoSmithKline, Novartis, Sanofi-Aventis, Serono, Shire Pharmaceuticals e semelhantes.

Se desejado, as VLPs da presente invenção podem ser misturadas com um adjuvante adequado, como seria do conhecimento de um especialista na técnica. Além disso, a VLP pode ser utilizada numa composição de vacina compreendendo uma dose eficaz da VLP para o tratamento de um organismo alvo, como definido acima. AI disso, a VLP produzida de acordo com a presente invenção pode ser combinada com VLPs obtidas utilizando diferentes proteínas de gripe, por exemplo, neuraminidase (NA) .

Por conseguinte, a presente invenção proporciona um método para induzir imunidade à infeção por vírus da gripe num organismo animal ou alvo compreendendo a administração de uma dose eficaz de uma vacina compreendendo uma ou mais de uma VLP. A vacina pode ser administrada oralmente, intradermicamente, intranasalmente, intramuscularmente, intraperitonealmente, intravenosamente ou subcutaneamente.

As composições de acordo com a presente divulgação podem compreender VLPs de duas ou mais estirpes ou subtipos de gripe. "Dois ou mais" refere-se a duas, três, quatro, cinco, seis, sete, oito, nove, 10 ou mais estirpes ou subtipos. As estirpes ou subtipos representados podem ser de um único subtipo (por exemplo, todo o HlNl ou todo ο H5N1) ou podem ser uma combinação de subtipos. Exemplos de subtipos e estirpes incluem H5/Indo, Hl/Bri, Hl/NC. A escolha da combinação de estirpes e subtipos pode depender da área geográfica dos sujeitos suscetíveis de serem expostos à gripe, proximidade de espécies animais a uma população humana a ser imunizada (por exemplo, espécies de aves aquáticas, animais agrícolas como porcos, etc.) e as estirpes que eles carregam, estão expostos ou provavelmente serão expostos a predições de deriva antigênica dentro de subtipos ou estirpes, ou combinações desses fatores.

As duas ou mais VLPs podem ser expressas individualmente, e as VLPs purificadas ou semi-purificadas subsequentemente combinadas. Alternativamente, as VLPs podem ser co-expressas no mesmo hospedeiro, por exemplo, uma planta, protão de planta ou célula vegetal. As VLPs podem ser combinadas ou produzidas numa proporção desejada, por exemplo, em rácios equivalentes, ou podem ser combinadas de tal maneira que um subtipo ou estirpe compreende a maioria das VLPs na composição.

Por conseguinte, a divulgação proporciona composições compreendendo VLPs de duas ou mais estirpes ou subtipos.

Também proporcionado um artigo de fabrico, compreendendo material de embalagem e uma composição compreendendo uma VLP compreendendo uma HA quimérica. A composição inclui um excipiente fisiologicamente ou farmaceuticamente aceitável, e o material de embalagem pode incluir uma etiqueta que indica os ingredientes ativos da composição (por exemplo, a VLP).

Um kit compreendendo uma composição compreendendo um ácido nucleico codificando um HA quimérico como aqui proporcionado, juntamente com instruções para utilização do áido nucleico para produção de HA quimérico, ou VLPs compreendendo o HA quimérico também proporcionado. 0 kit pode ser útil para a produção de VLPs compreendendo o HA quimérico e as instruções podem incluir, por exemplo, informação na expressão do ácido nucleico numa planta ou numa célula vegetal, instruções para colheita e obtenção das VLPs da planta ou tecido da planta.

Noutra forma de realização, é proporcionado um kit para a preparação de um medicamento, compreendendo uma VLP compreendendo uma HA quimérica, juntamente com instruções para a sua utilização. As instruções podem compreender uma série de passos para a preparação do medicamento, sendo o medicamento útil para induzir uma resposta imunitária terapêutica ou profilática num sujeito a quem é administrado. 0 kit pode ainda compreender instruções que abordam concentrações de dose, intervalos de dose, métodos de administração preferidos ou semelhantes.

A presente invenção será ainda ilustrada nos exemplos seguintes. As sequências aqui descritas estão resumidas abaixo. Métodos e Materiais 1. Montagem de cassetes de expressão de HA. A- pCAMBIAPlasto

Todas as manipulações foram realizadas utilizando os protocolos gerais de biologia molecular de Sambrook e Russell (2001, que é aqui incorporado por referência) . A Tabela 1 apresenta iniciadores oligonucleoticos utilizados para montagem de cassetes de expressão. O primeiro passo de clonagem consistiu na montagem de um plasmideo recetor contendo elementos reguladores a montante e a jusante do gene da plastocianina de alfafa. O promotor de plastocianina e as sequências 5'UTR foram amplificados a partir do ADN genómico de alfafa utilizando os iniciadores oligonucleotidicos Xmal-pPlas.c (SEQ ID NO: 1) e SacI-ATG-pPlas. r (SEQ ID NO: 2). O produto de amplificçãao resultante foi digerido com Xmal e Saci e ligado a pCAMBIA2300 (Cambia, Canberra, Áustria), previamente digerido com as mesmas enzimas, para criar pCAMBIApromoPlasto. Similarmente, as sequências de 3'UTR e o terminador do gene da plastocianina foram amplificados a partir do ADN genómico de alfafa utilizando os seguintes iniciadores: Sacl-PlasTer.c (SEQ ID NO: 3) e EcoRI-PlasTer.r (SEQ ID NO: 4), e o produto foi digerido com Saci e EcoRI antes de ser inserido nos mesmos locais de pCAMBIApromoPlasto para criar pCAMBIAPlasto.B-

Plasto-Nativo SP-H5 A/ Indonásia/5/05 (número de construção 660)

Um fragmento que codifica hemaglutinina da estirpe de gripe A / Indonesia / 5/05 (H5N1; Acc. No. LANL ISDN125873) foi sintetizado por Epoch Biolabs (Sugar Land, TX, EUA). O fragmento produzido, contendo a região codificadora H5 completa incluindo o péptido sinal nativo flanqueado por um sitio HindIII imediatamente a montante do ATG inicial, e um local Saci imediatamente a jusante do codão stop (TAA), é apresentado em (SEQ ID NO: 52 Figura 17). A região codificadora de H5 foi clonada numa cassete de expressão baseada em plastocianina pelo modo de ligação baseado em PCR apresentado em Darveau et al. (1995). Resumidamente, foi obtida uma primeira amplificação por PCR utilizando os iniciadores Plasto-443c (SEQ ID NO: 5;) e SpHA (Ind) -Plasto.r (SEQ ID NO: 6) e pCAMBIApromoPlasto como modelo. Em paralelo, foi realizada uma segunda amplificação com os iniciadores Plasto-SpHA (SEQ ID NO: 7) e HA (Ind) -Sac. r (SEQ ID NO: 8) com fragmento codificador de H5 (SEQ ID NO: 52; Figura 17) como modelo. A amplificação obtida de ambas as reações foi misturada e a mistura serviu como molde para uma terceira reação (reação de montagem) utilizando Plasto-443c (SEQ ID NO: 5) e HA (Ind) -Sac.r (SEQ ID NO: 8) como iniciadores. 0 fragmento resultante foi digerido com BamHI (no promotor de plastocianina) e Saci (na extremidade 3 'do fragmento) e clonado em pCAMBIAPlasto previamente digerido com as mesmas enzimas. 0 plasmideo resultante, denominado 660, apresentado na Figura 18 (SEQ ID NO: 53). O fragmento resultante foi digerido com BamHI (no promotor de plastocianina) e Saci (na extremidade 3'do fragmento) e clonado em pCAMBIAPlasto previamente digerido com as mesmas enzimas. O plasmideo resultante, denominado 660, apresentado na Figura 18 (SEQ ID NO: 53). O fragmento resultante foi digerido com BamHI (no promotor de plastocianina) e Saci (na extremidade 3 'do fragmento) e clonado em pCAMBIAPlasto previamente digerido com as mesmas enzimas. O plasmideo resultante, denominado 660, apresentado na Figura 18 (SEQ ID NO: 53). C-Plasto-PDI SP-H1 A/Nova Caledónia/20/99 (número de construção 540) O quadro de leitura aberto do gene Hl da estirpe A / New Caledonia / 20/99 (HlNl) foi sintetizado em dois fragmentos (Plant Biotechnology Institute, National Research Council, Saskatoon, Canadá). Um primeiro fragmento sintetizado corresponde à sequência de codificação Hl de tipo selvagem (n° de acesso GenBank AY289929; SEQ ID N°: 54; Figura 19) sem a sequência codificadora do peptídeo sinal na extremidade 5 'e a sequência codificadora do domínio transmembrana na extremidade 3'. A extremidade 5'do fragmento é composta pelos últimos nucleótidos que codificam PDISP (incluindo um local de restrição BglII) e foi adicionado um local duplo Saci / StuI imediatamente a jusante do codão de terminação na extremidade terminal 3' do fragmento, para produzir SEQ. ID No: 55 (Figura 20). O primeiro fragmento Hl foi digerido com BglII e Saci e clonado nos mesmos locais de um vetor binário (pCAMBIAPlasto) contendo o promotor da plastocianina e 5'UTR fundido ao peptídeo sinal do gene da dissulfeto isomerase da proteína da alfafa (PDI) (nucleotideos 32-103; Acesso No. Z11499; SEQ ID No: 57; Figura 22) resultando num gene quimérico PDI-Hl a jusante dos elementos reguladores da plastocianina. A sequência da cassete base de plastocianina, contendo o promotor e o péptido de sinalização PDI até ao local de restrição BglII e o terminador de plastocianina a jusante de um local Saci, apresentada na SEQ ID NO. 58 (Figura 23). A adição da extremidade C-terminal da região de codificação Hl (codificando o dominio transmembranar e a cauda citoplasmática) foi obtida inserindo o fragmento sintetizado (SEQ ID NO. 56; Figura 21) previamente digerida com Kpnl e Saci, no plasmídeo de expressão Hl. A construção resultante, denominada 540, é apresentada na SEQ ID NO. 59 (Figura 24) . D-Plasto-nativo SP-Hl A/Briabane/59/07 (número de construção 774) A cassete de expressão número 774, conduzindo a expressão de Hl de A / Brisbane / 59/07, foi montada como se segue. Foi sintetizado um fragmento sintético compreendendo a sequência completa de codificação de hemaglutinina (de ATG para parar) flanqueada em 3 'por sequências de genes de plastocianina de alfafa correspondendo aos primeiros 84 nucleótidos a montante da plastocianina ATG começando com um local de restrição Drain. Os fragmentos sintéticos também compreendiam um sitio Saci imediatamente a jusante do codão de terminação. O fragmento sintético foi sintetizado pela Top Gene Technologies (Montreal, QC, Canadá). 0 fragmento sintetizado é apresentado na SEQ ID NO. 60 (Figura 25) . Para a montagem da cassete de expressão completa, o fragmento sintético foi digerido com Drain e Saci e clonado em pCAMBIAPlasto previamente digerido com as mesmas enzimas para dar a construção 774 (SEQ ID NO. 61; Figura 26). E-CPMV HT-LC C51 (número de construção 828)

As cassetes de expressão CPMV-HT utilizam o promotor 35S para controlar a expressão de um mARN compreendendo uma sequência codificadora de interesse flanqueada, em 5 ', pelos nucleotideos 1-512 do RNA2 do virus do mosaico do feijão-caupi (CPMV) com ATG mutado nas posições 115 e 161 e em 3 pelos nucleótidos 3330-3481 do CPMV RNA2 (correspondendo ao 3' UTR) seguido pelo terminador NOS. Plasmídeo pBD-C5-lLC, (Sainsbury et al. 2008; Plant Biotechnology Journal 6: 82-92 e Publicação PCT WO 2007/135480) , foi usado para a montagem de cassetes de expressão de hemaglutinina baseados em CPMV-ΗΤ. A mutação dos ATGs na posição 115 e 161 do CPMV RNA2 foi feita usando um método de ligação baseado em PCR Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). Dois PCRs separados foram realizados usando pBD-C5-lLC como modelo. Os iniciadores para a primeira amplificação foram pBinPlus.2613c (SEQ ID NO: 9) e Mut- ATG115.r (SEQ ID NO: 10) . Os iniciadores para a segunda amplificação foram Mut-ATG161.C (SEQ ID NO: 11) e LC-C5-1.110r (SEQ ID NO: 12). Os dois fragmentos obtidos foram misturados e utilizados como molde para uma terceira amplificação utilizando pBinPlus.2613c (SEQ ID NO: 9) e LC-C5-1.110r (SEQ ID NO: 12) como iniciadores. O fragmento resultante foi digerido com Pad e Apal e clonado em pBD-C5-lLC digerido com as mesmas enzimas. A construção gerada, denominado 828, é apresentado na Figura 27 (SEQ ID NO: 62).

Domínio de ligação ao recetor F-Hl A/Brlsbane/59/07 (RB) na estrutura H5 A/lndonésia/5/05 (número de construção 690)

Um HA quimérico foi feito substituindo o domínio RB no H5 A / Indonésia / 5/05 pelo de Hl A / Brisbane / 59/07 usando o método de ligação baseado em PCR apresentado em Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). Numa primeira ronda de PCR, um segmento do promotor de plastocianina fundido com o péptido sinal natural, os domínios F'l e El do H5 A / Indonésia / 5/05 foram amplificados utilizando os iniciadores Plasto-443c (SEQ ID NO: 5) e E1H1B-E1H5I.r (SEQ ID NO: 13) com o número de construção 660 (SEQ ID NO: 53, Figura 18) como modelo. Um segundo fragmento, compreendendo a sequência de codificação do domínio Rl HlA / Brisbane / 59/07, foi amplificado com os iniciadores El H5N-E1H1B.c (SEQ ID NO: 14) e E2H5I-RB HIB.r (SEQ ID NO: 15) utilizando o número de construção 774 (SEQ ID NO: 61; Figura 26) como modelo. Um terceiro fragmento compreendendo os domínios E2, F'2, F, transmembranar e citoplasmático de H5 A /

Indonésia/ 5/05 foi amplificado utilizando os iniciadores RB HlB-E2H5I.C (SEQ ID NO: 16) e HA (Ind) -Sacl.r (SEQ ID NO: 8) com o número de construção 660 (SEQ ID NO: 53; Figura 18) como modelo. Os produtos de amplificação foram então misturados e utilizados como molde para um segundo ciclo de amplificação (reação de montagem) com os iniciadores Plasto-443c (SEQ ID NO: 5) e HA (Ind) -Sacl.r (SEQ ID NO: 8) . O fragmento resultante foi digerido com BamHI (no promotor de plastocianina) e Saci (após o codão de terminação) e clonado no número de construção 660 (SEQ ID NO: 53; Figura 18) , previamente digerido com as mesmas enzimas de restrição para originar o número 690 (SEQ ID NO: 63) . A construção é apresentada na Figura 28. previamente digerido com as mesmas enzimas de restrição para dar o número 690 (SEQ ID NO: 63). A construção é apresentada na Figura 28. previamente digerido com as mesmas enzimas de restrição para dar o número 690 (SEQ ID NO: 63). A construção é apresentada na Figura 28.

Domínios G-Hl A / Brisbane / 59/07 esterase e de ligação ao recetor (E1-RB-E2) na estrutura H5 A / Indonésia / 5/05 (número de construção 691)

Um HA quimérico foi montado substituindo os domínios E1-RB-E2 em H5 A / Indonésia / 5/05 por aqueles de Hl A / Brisbane / 59/07 usando o método de ligação baseado em PCR apresentado em Darveau et al. (Methods in Neuroscience 26: 77-85 (1995}}}. Numa primeira ronda de PCR, um segmento do promotor de plastocianina fundido com o péptido sinal natural e o domínio F ' 1 de H5 A / Indonésia / 5/05 foi amplificado utilizando os iniciadores Plasto-443c (SEQ ID NO: 5) e El HlB-F'l H5I.r (SEQ ID NO: 17) com o número de construção 660 (SEQ ID NO: 53; Figura 18) como modelo. Em paralelo, dois outros fragmentos foram amplificados. O segundo fragmento, contendo a sequência de codificação dos domínios E1-RB-E2 de HlA / Brisbane / 59/07, foi amplificado com os iniciadores F'1H5N-E1H1B.c (SEQ ID NO: 18) e F’2H5I-E2. HIB.r (SEQ ID NO: 19) utilizando o número de construção 774 (SEQ ID NO: 61; Figura 26) como modelo. Para o terceiro fragmento, os domínios F'2, F, transmembrana e citoplasmático de H5 A / Indonesia / 5/05 foram amplificados usando os iniciadores E2 HIB-F'2H5l.c (SEQ ID NO: 20) e HA (Ind) - Saci.r (SEQ ID NO: 8) com o número de construção 660 (SEQ ID NO: 53; Figura 18) como modelo. Os produtos de amplificação foram então misturados e utilizados como molde para um segundo ciclo de amplificação (reação de montagem) com os iniciadores Plasto-443c (SEQ ID NO: 5) e HA (Ind) -Sacl.r (SEQ ID NO: 8). O fragmento resultante foi digerido com BamHI (no promotor de plastocianina) e Saci (após o codão de terminação) e clonado no número de construção 660 (SEQ ID NO: 53; Figura 18) , previamente digerido com as mesmas enzimas de restrição para originar o número 691 (SEQ ID NO: 64). A construção é apresentada na Figura 29.

Domínio de ligação ao recetor H-H5 A / Indonésia / 5/05 (BB) na estrutura Hl A / Nova Caledónia / 20/99 (número de construção 696)

Um HA quimérico foi feito substituindo o domínio RB no Hl A / Nova Caledónia / 20/99 pelo de H5 A / Indonésia / 5/05, usando o método de ligação baseado em PCR apresentado em Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). Num primeiro ciclo de PCR, um segmento do promotor de plastocianina fundido ao péptido sinal da dissulfureto isomerase da proteina de alfafa (PDISP; N° de Acesso Z11499; nucleótidos 32-103 da SEQ ID NO: 57; Figura 22), o F'l e os domios El de H1A / New Caledonia / 20/99 foram amplificados utilizando os iniciadores Plasto-443c (SEQ ID NO: 5) e E1H5I-E1H1NC.r (SEQ ID NO: 21) com o nero de construo 540 (SEQ ID NO: 59; Figura 24) como modelo. Um segundo fragmento, compreendendo a sequência de codificação do domínio H5 A / Indonésia / 5/05 RB, foi amplificado com os iniciadores E1H1NC-E1H5I.c (SEQ ID NO: 22) e E2H1NC-RBH5I.r (SEQ ID NO: 23) utilizando o número de construção 660 (SEQ ID NO: 53; Figura 18) como modelo. O fragmento Athird compreendendo os domios E2, F'2, F, transmembranar e citoplasmico de Hl A / New Caledonia / 20/99 foi amplificado utilizando os iniciadores RB H5I-E2 HINC.c (SEQ ID NO: 24) e HA-SacI. r (SEQ ID NO: 25) com o número de construção 540 (SEQ ID NO: 59; Figura 24) como modelo. Os produtos de amplificação foram então misturados e utilizados como molde para um segundo ciclo de amplificação (reação de montagem) com os iniciadores Plasto-443c (SEQ ID NO: 5) e HA-Sacl.r (SEQ ID NO: 25). O fragmento resultante foi digerido com BglII e Saci e clonado no nero de construo 540 (SEQ ID N59; Figura 24) previamente digerido com as mesmas enzimas de restrição para dar o número de construção 696 (SEQ ID NO: 65) . A construção é apresentada na Figura 30. I- Montagem de Hl A / Brisbane / 59/2007 na cassete de expressão CPMV-HT (número de construção 732). A sequência de codificação de HA de Hl A / Brisbane / 59/2007 foi clonada em CPMV-HT como se segue. Os sítios de restrição Apal (imediatamente a montante de ATG) e StuI (imediatamente a jusante do codão stop) foram adicionados à sequência de codificação da hemaglutinina através da realização de uma amplificação por PCR com os iniciadores Apal-HIB.c (SEQ ID NO: 26) e StuI-HIB. r (SEQ ID NO: 27) utilizando o número de construção 774 (SEQ ID NO: 61; Figura 26) como modelo. O fragmento resultante foi digerido com as enzimas de restrição Apal e StuI e clonado no número de construção 828 (SEQ ID NO: 62; Figura 27) digerido com as mesmas enzimas. A cassete resultante foi denominada número de construção 732 (SEQ ID NO: 66; Figura 31). J- Montagem dm SpPDI-Hl A / Brisbane / 59/2007 na cassete de expressão CPMV-ΗΓ (número de construção 733).

Uma sequência que codifica o péptido de sinal da dissulfureto isomerase da proteína alfafa (PDISP; nucleótidos 32-103 da SEQ ID NO: 57 Figura 22; Acesso N Z11499) foi fundida com a sequência de codificação HAO de Hl de A / Brisbane / 59/2007, e o fragmento

resultante foi clonado em CPMV-ífrdo seguinte modo. A sequência de codificação Hl foi amplificada com os iniciadores SpPDI-HlB.c (SEQ ID NO: 28) e SacI-HlB.r (SEQ ID NO: 29) utilizando a construção 774 (SEQ ID NO: 61; Figura 26) como modelo. 0 fragmento resultante consistia na sequência de codificação Hl flanqueada, em 5', pelos últimos nucleótidos que codificam PDISP (incluindo um local de restrição BglII) e, em 3', por um sítio de restrição Saci. 0 fragmento foi digerido com BglII e Saci e clonado no número de construção 540 (SEQ ID NO: 59; Figura 24) previamente digerido com as mesmas enzimas de restrição. A sequência de codificação da cassete intermédia, denominado número de construção 787 (SEQ ID NO: 67), é apresentada na Figura 32. Os sítios de restrição Apal (imediatamente a montante ATG) e StuI (imediatamente a jusante do codão de paragem) foram adicionados à sequência de codificação da hemaglutinina através da realização de uma amplificação por PCR com os iniciadores Apal-SpPDI.c (SEQ ID NO: 30) e StuI-HlB.r (SEQ ID N27) utilizando o nero de construo 787 (SEQ ID N 67; Figura 32) como modelo. O fragmento resultante foi digerido com as enzimas de restrição Apal e StuI e clonado no número de construção 828 (SEQ ID NO: 62; Figura 27) digerido com as mesmas enzimas. A cassete resultante foi denominada número de construção 733 (SEQ ID NO: 68; Figura 33). K- Montagem do domínio de ligação ao recetor HlA / Brisbane / 59/07 (BB) no esqueleto de H5A / Indonésia / 5/05 na cassete de expressão de CPMV-HT (número de construção 734). A sequência de codificação de HA quimérico consistindo no domínio RB de HlA / Brisbane / 59/07 em estrutura H5A / Indonésia / 5/05 foi clonada em CPMV-HT como se segue. Os locais de restrição Apal (imediatamente a montante de ATG) e StuI (imediatamente a jusante do codão de terminação) foram adicionados sequência de codificação da hemaglutinina quimérica através da realização de uma amplificação por PCR com os iniciadores Apal-H5 (A-Indo) .lc (SEQ ID NO: 31) e H5 (A-Indo) -StuI.1707r (SEQ ID NO: 32) utilizando o número de construção 690 (SEQ ID NO: 63; Figura 28) como modelo. O fragmento resultante foi digerido com as enzimas de restrição Apal e StuI e clonado no número de construção 828 (SEQ ID NO: 62; Figura 27) digerido com as mesmas enzimas. A cassete resultante foi denominada número de construção 734 (SEQ ID NO: 69; Figura 34). L-Montagem de SpPDX-H3 A / Brisbane / 10/2007 em cassete de expressão CPMV- HT (número de construção 736).

Uma sequência codificando o péptido sinal de alfalfa PDI fundido a HAO a partir de H3A / Brisbane / 10/2007 foi clonada em CPMV- HT como se segue. Primeiro, sintetizou-se um fragmento sintético compreendendo a sequência codificadora da hemaglutinina completa (de ATG para parar) flanqueada em 3 'pela sequência do gene da plastocianina de alfafa correspondente aos primeiros 84 nucleótidos (começando com um local de restrição Drain) a montante da plastocianina ATG. O fragmento sintético também continha um local Saci imediatamente após o códon de parada. Fragmento sintético foi sintetizado pela Top Gene Technologies (Montreal, QC, Canadá). O fragmento sintetizado é apresentado na SEQ ID NO: 70 (Figura 35) e foi utilizado como molde para posterior ligação baseada em PCR.

Em segundo lugar, o péptido sinal da dissulfureto isomerase da proteína de alfafa (PDISP) (nucleótidos 32-103; N.° de acesso Z11499; SEQ ID NO: 57; Figura 22) foi ligado à sequência de codificação HAO de H3 de A / Brisbane / 10/2007 ao longo com o sítio de restrição Apal imediatamente a montante do local de restrição ATG e StuI a jusante do codão de paragem como se segue. A PDISP foi ligada à sequência de codificação H3 pelo método de ligação baseado em PCRDarveau et al. (Methods in Neuroscience 26: 77-85 (1995))). Num primeiro ciclo de PCR, amplificou-se o péptido sinal PDISP utilizando os iniciadores Apal-SpPDI.c (SEQ ID NO: 30) e H3B-SpPDI.r (SEQ ID NO: 33) com o número de construção 540 (SEQ ID NO: 59; Figura 24) como modelo. Paralelamente, outro fragmento contendo uma porção da sequência de codificação de H3A / Brisbane / 10/2007 (do codão 17 ao codão de paragem) foi amplificado com os iniciadores SpPDI-H3B.c (SEQ ID NO: 34) e StuI-H3B.r (SEQ ID NO: 35) utilizando fragmentos previamente sintetizados (SEQ ID NO: 70; Figura 35) como modelo. Os produtos de amplificação foram então misturados e utilizados como molde para um segundo ciclo de amplificação (reação de montagem) com os iniciadores Apal-SpPDI.c (SEQ ID NO: 30) e StuI-H3B.r (SEQ ID NO: 35). O fragmento resultante foi digerido com as enzimas de restrição Apal e StuI e clonado no número de construção 828 (SEQ ID NO: 62; Figura 27) digerida com as mesmas enzimas. A cassete resultante foi denominada número de construção 736 (SEQ ID NO: 71; Figura 36). M-Montagem de SpPDI-H3 A / Brisbane / 10/2007 quimérico (ectodomínio) + H5 A / Indonésia / 5/2005 (TmD + cauda Cyto) na cassete de expressão CPMV-HT (número de construção 737).

Uma sequência codificando o péptido sinal de alfalfa PDI fundido ao ectodomínio de H3A / Brisbane / 10/2007 e aos domínios transmembranar e citoplasmático de H5A / Indonesia / 5/2005 foi clonada em CPMV-HT como se segue. A sequência codificadora da PDISP-H3 foi fundida ao domínio transmembranar H5 pelo método de ligação baseado em PCR apresentado em Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). Num primeiro ciclo de PCR, um fragmento compreendendo péptido sinal PDISP e ectodomínio de H3 Brisbane foi gerado por amplificação (com local de restrição Apal a montante do ATG inicial PDISP) utilizando os iniciadores Apal-SpPDI.c (SEQ ID NO: 30) e TmD H5I-H3B.r (SEQ ID NO: 36) com o número de construção 736 (SEQ ID NO: 71; Figura 36) como modelo. Paralelamente, outro fragmento contendo os domínios transmembranar e citoplasmático de H5 da Indonésia foi amplificado com os iniciadores H3B-TmD H5I.c (SEQ ID NO: 37) e H5 (A-Indo)-StuI.1707r (SEQ ID NO: 32) utilizando construo número 660 (SEQ ID NO. 53; Figura 18) como modelo. Os produtos de amplificação foram então misturados e utilizados como molde para um segundo ciclo de amplificação (reação de montagem) com os iniciadores Apal-SpPDI.c (SEQ ID NO: 30) e H5 (A-Indo)-StuI. 1707r (SEQ ID NO: 32). O fragmento resultante foi digerido com enzimas de restrição Apal e StuI e clonado no número de construção 828 (SEQ ID NO: 62; Figura 27) digerido com as mesmas enzimas. A cassete resultante foi denominada número de construção 737 (SEQ ID NO: 72; Figura 37). tf-Montagem de SpPDI-HA B / Florida / 4/2006 na cassete de expressão CPMV- HT (número de construção 739).

Uma sequência codificando o péptido sinal de alfalfa PDI fundido a HA0 de HA B / Florida / 4/2006 foi clonada em CPMV- HT como se segue. Primeiro, sintetizou-se um fragmento sintético compreendendo a sequência codificadora da hemaglutinina completa (de ATG para parar) flanqueada em 3'pela sequência do gene da plastocianina de alfafa correspondente aos primeiros 84 nucleótidos (começando com um local de restrição Drain) a montante da plastocianina ATG. 0 fragmento sintético também continha um local de restrição Saci imediatamente após o códon de terminação. 0 fragmento sintético foi sintetizado pela Epoch Biolabs (Sugar Land, Texas, EUA). 0 fragmento sintetizado é apresentado na SEQ ID NO: 7 3 (Figura 38) e foi utilizado como molde para posterior ligação baseada em PCR.

Segundo, o peptideo sinal da dissulfeto isomerase da proteína da alfafa (PDISP) (nucleotídeos 32-103 da SEQ ID NO: 57; Figura 22; Acesso No. Z11499) foi ligado à sequência de codificação HA de HA de B / Florida / 4/2006 juntamente com o sítio de restrição Apal imediatamente a montante de ATG e o sítio de restrição a jusante de sítio de restrição StuI como se segue. A PDISP foi ligada à sequência de codificação de HA pelo método de ligação baseado em PCR apresentado em Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)). Num primeiro ciclo de PCR, amplificou-se o péptido sinal PDISP utilizando os iniciadores Apal-SpPDI.c (SEQ ID NO: 30) e HBF-SpPDI.r (SEQ ID NO: 38) com o número de construção 540 (SEQ ID NO: 59; Figura 24) como modelo. Paralelamente, outro fragmento contendo uma porção da sequência de codificação de HA de B / Florida / 4/2006 (do códon 16 ao códon de parada) foi amplificado com os iniciadors SpPDI-HBF.c (SEQ ID NO: 39) e StuI- HBF.r (SEQ ID NO: 40) utilizando fragmentos previamente sintetizados (SEQ ID NO: 73; Figura 38) como modelo. Os produtos de amplificação foram então misturados e utilizados como molde para um segundo ciclo de amplificação (reação de montagem) com os iniciadores Apal-SpPDI.c (SEQ ID NO: 30) e StuI-HBF.r (SEQ ID NO: 40). O fragmento resultante foi digerido com as enzimas de restrição Apal e StuI e clonado no nero de construo 828 (SEQ ID NO: 62; Figura 27) digerida com as mesmas enzimas. A cassete resultante foi denominada número de construção 739 (SEQ ID NO: 74; Figura 39). O-Montagem de SpPDI-HA quimérico B / Florida / 4/2006 (ectodominio) + H5 A / Indonésia / 5/2005 (TmD + cauda Cyto) na cassete de expressão CPMV- ST (número de construção 745).

Uma sequência que codifica o péptido de sinal PDI de alfafa fundido com o ectodominio de HA B / Florida / 4/2006 e aos domínios transmembranar e citoplasmático de H5 A / Indonésia/ 5/2005 foi clonada em CPMV- ET como se segue. A sequência codificadora do ectodominio PDISP-B / Florida / 4/2006 foi fundida aos domínios transmembrana e citoplasmática H5 pelo método de ligação baseado em PCR Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). Num primeiro ciclo de PCR, um fragmento compreendendo péptido sinal PDISP fundido com o ectodominio de HA B / Florida / 4/2006 foi gerado por amplificação utilizando os iniciadores Apal-SpPDI.c (SEQ ID NO: 30) e TmD H5I-B Flo.r (SEQ ID NO: 41) com o número de construção 739 (SEQ ID NO: 74; Figura 39) como modelo. Paralelamente, outro fragmento contendo os domínios transmembranar e citoplasmático H5 da Indonésia foi amplificado com os iniciadores B Flo-TmD H5I.c (SEQ ID NO: 42) e H5 (A-Indo)-StuI.1707r (SEQ ID NO: 32) utilizando construo número 660 (SEQ ID NO. 53; Figura 18) como modelo. Os produtos de amplificação foram então misturados e utilizados como molde para um segundo ciclo de amplificação (reação de montagem) com os iniciadores Apal-SpPDI.c (SEQ ID NO: 30) e H5 (A-Indo)-StuI.1707r (SEQ ID NO: 32). O fragmento resultante foi digerido com as enzimas de restrição Apal e StuI e clonado no número de construção 828 (SEQ ID NO: 62; Figura 27) digerido com as mesmas enzimas. A cassete resultante foi denominada número de construção 745 (SEQ ID NO: 75; Figura 40).

Montagem em P de SpPDI-HA quimérico B / Florida / 4/2006 + H5 A / Indonia / 5/2005 (TmD + cauda Cyto) na cassete de expressão 2X35S-CPMV- ST (número de construo 747) .

Uma sequência codificando o péptido sinal de alfalfa PDI fundido com HA0 de HA B / Florida / 4/2006 e ao domínio transmembranar e citoplasmático de H5 A / Indonésia/ 5/2005 foi clonada em 2X35S-CPMV- HT como se segue. A troca do promotor foi realizada utilizando o método de ligação baseado em PCR Darveau et al. (Methods in

Neuroscience 26: 77-85 (1995))). Um primeiro fragmento contendo o promotor 2X35S (SEQ ID NO: 88; Figura 50A) foi amplificado por PCR com os iniciadores Pad - MCS -2X35S.C (SEQ ID NO: 89) e CPMV 5’UTR- 2X35S.r (SEQ ID NO: 90):

Pad - MCS -2X35S.C (ID SEQ NO: 89)

ATAGTA TTAATTAA GTCGACAAGCTTGCATGCCTGCAGG TCAAC CPMV 5'UTR- 2X35S .r (SEQ ID NO: 90)

T CAAAACCTAT TAAGAT T T TAATA CCTCTCCAAATGAAATGAACTTCC utilizando um plasmideo contendo o promotor 2X35S como modelo. Paralelamente, foi realizada uma segunda PCR utilizando os iniciadores 2X35S- CPMV 5'UTR.c (SEQ ID NO: 91) e Apal- M prot.r (SEQ ID NO: 92): 2X35S-CPMV 5'UTR.c (ID SEQ NO: 91)

TTGGAGAGG TATTAAAATCTTAATAGGTTTTGATAAAAGCGAACGTGGG

Apal-M prot.r (ID SEQ NO: 92)

TCTCCAT GGGCCC GACAAATTTGGGCAGAATATACAGAAGCTTA utilizando a construção 745 (SEQ ID NO 75; Figura 40) como modelo. Os dois fragmentos obtidos foram então misturados e utilizados como molde para um segundo ciclo de PCR (reação de montagem) com Pad - MCS- 2X35S.C (SEQ ID NO: 8 9 e Apal -M prot.r (SEQ ID NO: 92) como iniciadores. O fragmento resultante foi digerido com Pad e Apal e clonado na construção 745 (SEQ ID NO: 75; Figura 40) digerido com as mesmas enzimas de restrição da sequência da cassete de expressão, denominada construção 747 (SEQ ID NO: 93), é apresentado na Figura 50B. 2. Montagem de cassetes de expressão acompanhantes

Duas cassetes de expressão de proteína de choque térmico (Hsp) foram montadas. Em uma primeira cassete, a expressão da HSP70 citosólica de Arabidopsis thaliana (ecótipo Columbia) (Athsp70-1 emLin et al. (2001) Cell Stress and Chaperones 6: 201-208) é controlado por um promotor quimérico que combina elementos dos promotores de Plastocianina de Nitrito Redutase (Nir) e alfafa (Nir/Plasto). Uma segunda cassete que compreende a região de codificação da HSP40 citosólica da alfafa (MsJl; Frugis et al. (1999) Plant Molecular Biology 40: 397-408) sob o controlo do promotor quimérico Nir/Plasto foi também montado.

Um plasmideo aceitador contendo o promotor da redutase de nitrato de alfafa (Nir), o gene repórter GUS e o terminador NOS no vetor binário da planta foi primeiro montado. Plasmideo pNir3K51 (descrito anteriormente em Patente US 6420548) foi digerido com HindIII e EcoRI. O fragmento resultante foi clonado em pCAMBIA2300 (Cambia, Canberra, Austrália) digerido pela mesma enzima de restrição para dar pCAMBIA-Nir3K51.

As sequências de codificação para Hsp70 e Hsp40 foram clonadas separadamente no plasmideo aceitador pCAMBIANir3K51 pelo método de ligação baseado em PCR apresentado em Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))).

Para Hsp40, a sequência de codificação Msjl (SEQ ID NO: 7 6; Figura 41) foi amplificada por RT-PCR a partir de ARN total de folhas de alfafa (ecotipo Rangelander) utilizando os iniciadores Hsp40Luz.lc (SEQ ID NO: 43) e Hsp40Luz-SacI. 1272r (SEQ ID NO: 44). Uma segunda amplificação foi realizada com os iniciadores Plasto-443c (SEQ ID NO: 5) e Hsp40Luz-Plasto.r (SEQ ID NO: 45) com a construção 660 (SEQ ID NO: 53; Figura 18) como modelo. Os produtos de PCR foram então misturados e utilizados como molde para uma terceira amplificação (reação de montagem) com os iniciadores Plasto-443c (SEQ ID NO: 5) e Hsp40Luz-SacI.1272r (SEQ ID NO: 44). O fragmento resultante foi digerido com Hpal (no promotor de plastocianina) e clonado em pCAMBIANir3K51, previamente digerido com Hpal (no promotor de Nir) e Saci e arquivado com ADN-polimerase de T4 para gerar extremidades cegas. Os clones obtidos foram triados para orientação correta e sequenciados para integridade da sequência. O plasmideo resultante, denominado R850, é apresentado na Figura 42 (SEQ ID NO: 77). A região codificadora do Athsp70-1 foi amplificada por RT-PCR a partir do ARN da folha de Arabidopsis utilizando os iniciadores Hsp70Ara.lc (SEQ ID NO: 46) e Hsp70Ara-SacI. 1956r (SEQ ID NO: 47). Uma segunda amplificação foi realizada com os iniciadores Plato-443c (SEQ ID NO: 5) e Hsp70Ara-Plasto.r (SEQ ID NO: 48) com a construção 660 (SEQ ID NO: 53; Figura 18) como modelo. Os produtos de PCR foram então misturados e utilizados como molde para uma terceira amplificação (reação de montagem) com os iniciadores Plasto-443c (SEQ ID NO: 5) e Hsp70ARA-SacI.1956r (SEQ ID NO: 47). O fragmento resultante foi digerido com Hpal (no promotor de plastocianina) e clonado em pCAMBIANir3K51 digerido com Hpal (no promotor de Nir) e Saci e depositado com ADN-polimerase de T4 para gerar extremidades cegas. Os clones obtidos foram triados para orientação correta e sequenciados para integridade da sequência. O plasmídeo resultante, denominado R860, é apresentado na Figura 43 (SEQ ID NO: 78).

Um plasmídeo de expressão Hsp duplo foi montado como se segue. A R860 (SEQ ID NO: 78; Figura 43) foi digerida com BsrBI (a jusante do terminador NOS), tratada com polimerase de ADN T4 para gerar uma extremidade romba e digerida com Sbfl (a montante do promotor NIR / Plasto quimérico). 0 fragmento resultante (promotor quimérico Nir / Plasto-sequência de codificação de HSP70-terminador Nos) foi clonado em R850 (SEQ ID NO: 77; Figura 42) previamente digerido com Sbfl e Smal (ambos localizados no sitio de clonagem múltipla a montante Nir / Plasto quimérico promotor). 0 plasmídeo resultante, denominado R870, é apresentado na Figura 44 (SEQ ID NO: 79). 3. Montagem de outras cassetes de expressão Cassete de expressão HoPro

Uma construção HcPro (35HcPro) foi preparada como descrito em Hamilton et al. (2002) . Todos os clones foram sequenciados para confirmar a integridade das construções. Os plasmídeos foram utilizados para transformar Agrobacteium tumefaciens (AGLl; ATCC, Manassas, VA 20108, EUA) por electroporação (Mattanovich et al., 1989). A integridade de todas as estirpes de A. tumefaciens foi confirmada pelo mapeamento de restrição.

Cassete de expressão P19 A sequência codificadora da proteína pl9 do vírus do tomateiro de tomateiro (TBSV) foi ligada à cassete de expressão de plastocianina de alfafa pelo método de ligação baseado em PCR apresentado em Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). Numa primeira ronda de PCR, um segmento do promotor de plastocianina foi amplificado utilizando os iniciadores Plasto-443c (SEQ ID NO: 5) e supPl9-plasto.r (SEQ ID NO: 49) com a construi^^ío 660 (SEQ ID NO: 53) como modelo. Paralelamente, um outro fragmento contendo a sequência de codificação de pl9 foi amplificado com os iniciadores supPl9-lc (SEQ ID NO: 50) e SupP19-SacI.r (SEQ ID NO: 51) utilizando a construção 35S: pl9 como descrito em Voinnet et al. (The Plant Journal 33: 949-956 (2003) ) ) como modelo. Os produtos de amplificação foram então misturados e utilizados como molde para um segundo ciclo de amplificação (reação de montagem) com os iniciadores Plasto-443c (SEQ ID NO: 5) e SupPl9-SacI.r (SEQ ID NO: 51). O fragmento resultante foi digerido com BamHI (no promotor de plastocianina) e Saci (no final da sequência de codificação de pl9) e clonado no número de construção 660 (SEQ ID NO: 53; Figura 18), previamente digerido com as mesmas enzimas de restrição para dar o número de construção R472. 0 plasmídeo R472 é apresentado na Figura 45. Número de construção 443 O número de construção 443 corresponde a pCAMBIA2300 (vetor vazio).

Tabela 1: iniciadores oligonucleotides para montagem de cassetes de expressão

Tabela 2: Estirpes de Agrobacterium usadas para expressão de hemaglutininas de gripe com peptideos sinalizadores nativos ou PDI

4. Preparação da bxomassa vegetal, inoculo, agro-infiltração e colheita

Plantas de Nicotiana benthamiana foram cultivadas a partir de sementes em apartamentos preenchidos com substrato comercial de turfa. As plantas foram deixadas crescer na estufa sob um fotoperiodo de 16/8 e um regime de temperatura de 25°C dia/20°C noite. Três semanas após a sementeira, as plântulas individuais foram colhidas, transplantadas em vasos e deixadas a crescer na estufa durante mais três semanas sob as mesmas condições ambientais. Antes da transformação, os botões apicais e axilares foram removidos em vários momentos, conforme indicado abaixo, seja comprimindo os botões da planta, ou tratando quimicamente a planta.

As agrobacterias transfectadas com cada construção foram cultivadas num meio YEB suplementado com ácido 2- [N-morfolino] etanossulfónico (MES) , acetoseringona 20, 50 / ml de canamicina e 25 / ml de carbenicilina pH5,6 até atingirem um Οϋβοο entre 0,6 e 1,6. As suspensões de Agrobacterium foram centrifugadas antes da utilização e ressuspenderam-se em meio de infiltração (10 mM de MgCl2 e MES 10 mM pH 5,6). A infiltração com seringa foi realizada como descrito por Liu e Lomonossoff (2002, Journal of Virological Methods, 105: 343-348) . Para a infiltração por vácuo, as suspensões de A. tumefaciens foram centrifugadas, ressuspensas no meio de infiltração e armazenadas durante a noite a 4°C. No dia da infiltração, os lotes de cultura foram diluídos em 2,5 volumes de cultura e deixados a aquecer antes da utilização. Plantas inteiras de N. benthamiana ou N. tabacumforam colocados de cabeça para baixo na suspensão bacteriana em um tanque de aço inoxidável hermético sob um vácuo de 20-40 Torr por 2 min. Após a seringa ou infiltração a vácuo, as plantas foram devolvidas à estufa durante um período de incubação de 4-5 dias até à colheita. Salvo especificação em contrário, todas as infiltrações foram realizadas como co-infiltração com AGLl / 35S-HcPro numa proporção de 1: 1, exceto para as estirpes contendo cassetes CPMV-HT que foram co-infiltradas com a estirpe AGLl / R472 numa proporção de 1:1. 5. Amostragem de folhas e extração total de proteínas

Após a incubação, a parte aérea das plantas foi colhida, congelada a -80°C, esmagada em pedaços. As proteínas solúveis totais foram extraídas por homogeneização (Polytron) de cada amostra de material vegetal triturado congelado em 3 volumes de Tris 50 mM, pH 8, NaCl 0,15 M, metabissulfito de sódio 0,04% e fluoreto de fenilmetanossulfonilo 1 mM. Após a homogeneização, as suspensões foram centrifugadas a 20.000 g por 20 min a 4°C e esses extratos brutos clarificados (sobrenadante) foram mantidos para análise. O teor de proteína total dos extratos brutos clarificados foi determinado pelo ensaio de Bradford (Bio-Rad, Hercules, CA) utilizando albumina de soro bovino como padrão de referência. 6. Análise de Proteína e Imunoblotting

As concentrações de proteína foram determinadas pelo ensaio de proteína BCA (Pierce Biochemicals, Rockport IL) . As proteínas foram separadas por SDS-PAGE sob condições redutoras e coradas com Azul de Coomassie. Os géis corados foram digitalizados e a análise densitométrica realizada usando o ImageJ Software (NIH).

Proteínas da fração de eluição de SEC foram precipitadas com acetona (Bollag et al., 1996), ressuspensas em 1/5 do volume em equilíbrio/tampão de eluição e separadas por SDS-PAGE sob condições redutoras e eletrotransferidas em membranas de polivinil difluoreto (PVDF) (Roche Diagnostics Corporation, Indianapolis, IN) para imunodeteção. Antes da imunotransferência, as membranas foram bloqueadas com leite desnatado a 5% e Tween-20 a 0,1% em solução salina tamponada com Tris (TBS-T) durante 16-18 h a 4°C. A imunotransferência foi realizada por incubação com um anticorpo adequado (Tabela 6) , em 2 pg/ml em leite desnatado a 2% em TBS-Tween 20 a 0,1%. Os anticorpos secundários utilizados para deteção de quimiluminescência foram os indicados na Tabela 4, diluições como indicadas em leite desnatado a 2% em TBS-Tween 20 a 0,1%. Complexos imunorreativos foram detetados por quimiluminescência usando luminol como substrato (Roche Diagnostics Corporation). A conjugação de peroxidase de rábano-enzima do anticorpo IgG humano foi realizada utilizando o kit de conjugação de peroxidase ativada EZ-Link Plus® (Pierce, Rockford, IL) . Virus inativados inteiros (WIV), utilizados como controlos de deteção para os subtipos Hl, H3 e B, foram adquiridos ao Instituto Nacional de Normas Biológicas e Controlo (NIBSC).

Tabela 3: Condições de eletroforese, anticorpos e diluições para imunotransferência de proteínas expressas.

7. Esclarecimento e concentração antes da SEC

Para melhorar a resolução e aumentar o sinal nas frações de eluição, os extratos a serem carregados na cromatografia por exclusão de tamanho, os extratos de proteína bruta foram clarificados e concentrados utilizando o método seguinte. Os extratos foram centrifugados a 70 000 g, 4 durante 20 min e o sedimento foi lavado duas vezes por ressuspensos em 1 volume (comparado com o volume inicial do extrato) de tampão de extração (50 mM Tris pH 8, 0,15 M NaCl) e centrifugação a 70 000 g, 4 durante 20 min. O sedimento resultante foi ressuspenso em 1/3 do volume (comparado com o volume inicial do extrato) e as proteínas (incluindo VLPs) foram precipitadas pela adição de 20% (p/v) de PEG 3350 seguido por incubação em gelo durante 1 h. As proteínas precipitadas foram recuperadas por centrifugação a 10 000 g, 4°C, 20 min e ressuspensas em 1/15 do volume (comparado com o volume inicial de extrato) do tampão de extração. 8. Cromatografia de exclusão de tamanho do extrato proteico

Colunas de cromatografia de exclusão por tamanhos (SEC) de 32 ml de esferas de alta resolução Sephacryl“ S-500 (S-500 HR: GE Healthcare, Uppsala, Suíça, Cat. No. 17-0613-10) foram empacotadas e equilibradas com tampão de equilíbrio/eluição (Tris pH 8 mM, NaCl 150 mM) . Um mililitro e meio de extrato de proteína bruta foi carregado na coluna seguido de um passo de eluição com 45 mL de tampão de equilíbrio/eluição. A eluição foi recolhida em frações de 1,5 mL. O conteúdo proteico relativo das frações eluídas foi monitorizado misturando 10 μΐ da fração com 200 μΐ de reagente corante de proteína de diluição Bio-Rad (Bio-Rad, Hercules, CA. A coluna foi lavada com 2 colunas volumes de NaOH 0,2 N seguidos de 10 volumes de coluna de Tris 50 mM pH 8, NaCl 150 mM, 20% de etanol. Cada separação foi seguida por uma calibração da coluna com Blue Dextran 2000 (GE Healthcare Bio-

Science Corp., Piscataway, NJ, EUA). Os perfis de eluição de Blue Dextran 2000 e as proteínas solúveis do hospedeiro foram comparados entre cada separação para assegurar a uniformidade dos perfis de eluição entre as colunas utilizadas.

Exemplo 1: Estratégia de troca de domínio para domínios BB e/ou Esterase em hastes do subtipo de gripe. O subdomínio RB de H5 / Indo pode ser substituído por um subdomínio RB de HI, H3 ou B HA. O HA quimérico resultante proporciona um SDC H5 / Indo para formar VLPs e apresenta o subdomínio RB compreendendo sítios imunogénicos de Hl, H3 ou B. 0 subdomínio H5 / Indo RB pode ser inserido numa haste Hl (Hl/NC). As Figuras 15A e 15B ilustram as sequências de aminoácidos nas fusões dos subdomínios indicados, e as sequências de aminoácidos dos respetivos subdomínios são fornecidas na Figura 2 (construções 690, 734, 696 e 691) e na Tabela 4 (construções 900 e 745) e 5 (construções 910, 920 e 930) . As sequências de aminoácidos ilustradas na Figura 2 e as Tabelas 4 e 5 não incluem sequências peptídicas de sinal.

Tabula 4 Subdominios a Gripa HA quimérica. Gripe HA quimérica compreendendo suhdominio BB heterólogo.

Os aminoácidos 1-92 da SEQ ID NO: 105 são um domínio F'l + El de H5 / Indo; os aminoácidos 93-259 são o domínio da cabeça RB de H3 / Brisbane; os aminoácidos 260-548 são o domínio E2 + F'2 do H5 / Indo.

Os aminoácidos 1-92 da SEQ ID NO: 106 são um domínio F'l + El de H5 / Indo; os aminoácidos 93-27 6 s o domínio principal RB de B / Florida; os aminoácidos 277-565 são o domínio E2 + F'2 de H5 / Indo.

Tabela 5 Subdomiaioe @ Gripe EH quimérica, Gripe EH quimérica ccsspreeudeudo subdominio KB beteróiogo

Os aminoácidos 1-42 da SEQ ID NO: 107 são um domínio F '1 do terminal N de H5 / Indo; os aminoácidos 43-228 são o domínio principal El-RB-E2 de H3 / Brisbane; os aminoácidos 229-507 são o domínio F'2 do H5 / Indo.

Os aminoácidos 1-42 da SEQ ID NO: 108 são um domínio F 11 do terminal N de H5 / Indo; os aminoácidos 43-281 são o domínio principal El-RB-E2 de B / Florida; os aminoácidos 282-556 são o domínio F'2 do H5 / Indo.

Os aminoácidos 1-42 da SEQ ID NO: 109 são um domínio F'l no terminal N de Hl / NC; os aminoácidos 43-273 são o domínio da cabeça E1-RB-E2 de H5 / Indo; os aminoácidos 274-548 s o domínio F'2 de Hl / NC.

Os pontos de fusão para as várias quimeras foram selecionados de modo a estarem tão próximos (mas não necessariamente diretamente) dos terminais N e C dos vários subdomínios - sem querer ficarem limitados pela teoria, essas fusões foram selecionadas de forma a maximizar a estabilidade do HA quimérico. Por exemplo, a conservação de estrutura e sequência é observada no terminal N do subdomínio RB (Ha et al. 2002, EMBO J. 21: 865-875). Uma região menos variável na sequência primária é encontrada na tríade CF / YP localizada em aproximadamente 15 aminoácidos antes, no subdomínio El. Esta cisteína está envolvida na ponte dissulfureto # 3, que conservada entre as HAs (ver Figuras 46 e 47) . Uma junção nesta Cys pode proporcionar uma estabilidade adequada ou superior à HA quimérica em relação à sequência nativa. A extremidade do terminal C do RB fornece recursos conservados: por exemplo, um resíduo Ser conservado na posição -1 e o subdomínio E2 começa com uma folha beta observada em todo o HA no alinhamento (Ha et al. 2002, EMBO J. 21: 865-875). Portanto, o terminal C deste RB pode ser fundido ao aminoácido de iniciação desta estrutura de folha beta do subdomínio E2. Além disso, o padrão de ponte dissulfureto não é alterado, ou não é alterado substancialmente, para as quimeras compreendendo subdomínios RB de Hl / NC, HIBri, H3 / Bri ou B / Fio em um H5 / Indo SDC e para H5 / Indo RB subdomínio em Hl SDC (total de 6), mas uma ponte dissulfeto será adicionada (ponte n° 8) no híbrido HA de BBR na haste H5. Esta adição de ponte dissulfureto não deve interferir com o enrolamento do HA (porque está localizado dentro do domínio RB e o Cys é adjacente na sequência), e pode produzir um híbrido HA ainda mais estável.

Os subdomínios E1-RB-E2 de um primeiro tipo de gripe foram substituídos por subdomínios E1-RB-E2 de um segundo tipo de gripe. Tal disposição pode apresentar um maior número de aminoácidos do segundo tipo na superfície do H5-VLP. Neste exemplo, o HDC de Hl, H3 ou B foi colocado num H5 / Indo SDC, e um HDC de H5 / Indo num Hl / NC SDC (Tabela 5). A junção do HDC foi definida com um resíduo de cisteína conservada (compreendendo a ponte dissulfureto # 6 de HA tipo A e # 7 em HA tipo B). A junção da HDC no terminal C do subdomínio E2 foi definida com outro resíduo de cisteína conservada compreendendo a ponte dissulfureto # 6 (o segundo aminoácido do subdomínio F'2) do tipo Hl ou H3 de gripe num SDC de H5 / Indo ou para gripe tipo H5 em um SDC de Hl. Para a quimera gripe B, a junção foi estabelecida a conexão na primeira cisteína compreendendo a ponte dissulfeto # 4 (localizada a 4 aminoácidos do subdomínio F'2 e conservada entre os HAs). As quimeras resultantes não exibem qualquer alteração nos padrõess de ponte dissulfureto - os HAs Hl / H3 / H5 híbridos contêm 6 pontes de dissulfido e o híbrido B tem 7 deles.

Exemplo 2: Substituição dos subdomínios de ligação ao recetor (BB) ou de ligação ao recetor e esterase (E1-RB-E2) de H5 A / Indonésia / 5/05 pela de Hl A / Brisbane / 59/2007: Comparação da expressão para quimérico e formas nativas.

Para combinar o alto nível de acumulação de VLPs de H5 A / Indonésia / 5/05 com as características de antigenicidade de Hl A / Brisbane / 59/2007, hemaglutininas quiméricas foram projetadas compreendendo domínios de Hl A / Brisbane / 59/2007 fundidos a um H5 A / Indonesia / 5/05 cluster de domínio de tronco. As cassetes de expressão para a expressão das fusões de hemaglutinina H5 / Hl estão representadas na Figura 1 e as sequências de aminoácidos das proteínas de fusão maduras produzidas ilustradas na Figura 2.

Comparar o nível de acumulação de hemaglutininas quiméricas H5 / Hl com as suas formas nativas, Nicotiana benthamianaplantas foram infiltradas com AGL1 / 774, AGL1 / 691 e AGL1 / 690, e as folhas foram colhidas após um período de incubação de seis dias. Para determinar o nível de acumulação de cada forma de HA nas folhas agro-infiltradas, as proteínas foram extraídas do tecido foliar infiltrado e analisadas por Western blotting utilizando anticorpos monoclonais anti-HA. Uma banda única de aproximadamente 75 kDa (Figura 3), correspondendo em tamanho à forma HAO não-clivada de hemaglutinina da gripe, foi detetada em extratos de folhas infiltradas com AGLl / 690 mas não em AGL1 / 774 ou AGLl / 691, indicando que a hemaglutinina quimérica compreendendo a região de ligação ao recetor de Hl A / Brisbane / 59/2007 fusionada à estrutura H5 A / Indonésia / 5/05 acumulou um nível mais elevado do que a forma nativa de Hl A / Brisbane / 59/2007 (AGLl / 774) e a hemaglutinina quimérica combinando as regiões de ligação esterase e recetor de Hl A / Brisbane / 59/2007 com a estrutura H5 A / Indonesia / 5/05. O vírus inteiro inativado (WIV) (HI A / Brisbane / 59/2007) usado como controle positivo foi detetado como múltiplas bandas com uma banda principal a aproximadamente 80 kDa, correspondendo ao peso molecular do precursor HAO de Hl A / Brisbane. / 59/2007. Estes resultados demonstraram que a substituição da região de ligação ao recetor de H5 A / Indonésia / 5/05 pela de Hl A / Brisbane / 59/2007 gerou uma hemaglutinina quimérica que apresentou a região antigênica de Hl e que se acumulou em um nível mais alto que o nativo Hl A / Brisbane / 59/2007 em plantas. No entanto, a hemaglutinina quimérica em que as regiões de ligação da esterase e do recetor de H5 A / Indonésia / 5/05 foram substituídas pelas de Hl A / Brisbane / 59/2007 não se acumulou a um nível detetável nas plantas. A fusão da região de ligação ao recetor de Hl A / Brisbane / 59/2007 à estrutura H5 A / Indonésia / 5/05 como um método para aumentar a acumulação de VLP apresentadoras de antigénio Hl em plantas foi reavaliada sob o controlo de uma cassete de expressão forte baseada em CPMV-HT. Esta estratégia de fusão também foi comparada com a substituição do peptideo sinal como meio de aumentar o nível de acumulação. As cassetes de expressão para a expressão das fusões de hemaglutinina H5 / Hl sob CPMV-HT estão representadas na Figura 8 e a sequência de aminoácidos da proteína de fusão madura produzida é apresentada na Figura 2.

As plantas de Nicotiana benthamiana foram infiltradas com AGLl / 732, AGLl / 733 ou AGLl / 734, e as folhas foram colhidas após um período de incubação de seis dias. Para determinar o nível de acumulação de cada forma de HA nas folhas agro-infiltradas, as proteínas foram primeiro extraídas do tecido foliar infiltrado e analisadas por Western blotting utilizando anticorpos policlonais anti-Hl (Brisbane). Uma banda única de aproximadamente 75 kDa (Figura 6) , correspondendo em tamanho à forma HAO não clivada de hemaglutinina de gripe, foi detetada em extratos de folhas infiltradas com AGLl / 732, AGLl / 733 e AGLl / 734. Entretanto, embora a hemaglutinina tenha sido detetada em todos os extratos analisados, diferenças importantes no acúmulo puderam ser notadas. Enquanto a expressão de H1A / Brisbane / 59/2007 foi dificilmente detetável sob estas condições quando se utiliza o seu peptideo sinal natural (732), a substituição do peptideo sinal pelo de PDI resultou em maior acúmulo de Hl A maduro / Brisbane / 59/2007 (733), e a hemaglutinina H5 / Hl quimérica (734) acumulou-se no nível mais alto. Em conjunto, estes resultados mostram que a fusão do domínio de ligação ao recetor de Hl em uma estrutura H5 leva a um alto acúmulo de hemaglutinina apresentadora de antígenos Hl e que o nível de acumulação obtido para essa fusão em plantas é maior do que o obtido com o nativo, forma com ou sem substituição do péptido sinal.

Exemplo 3: Substituição do eubdominio de ligaç&o ao recetor (BB) de Hl A / Nova Caledónia / 20/99 com o de H5 A / Indonésia / 5/05. Comparação de expressão para formas quiméricas e nativas. 0 uso de uma estrutura Hl (de A / New Caledonia / 20/99) para a apresentação da região antigênica de H5 também foi avaliado. As cassetes de expressão para a expressão da fusão de hemaglutinina Hl / H5 estão representadas na Figura 1 e a sequência de aminoácidos da proteína de fusão madura produzida apresentada na Figura 2.

Para comparar o nível de acumulação de hemaglutinina Hl / H5 quimérica com a sua forma nativa, plantas de Nicotians benthamiana foram infiltradas com AGLl / 660 e AGLl / 696, e as folhas foram colhidas após um período de incubação de seis dias. Para determinar o nível de acumulação de cada forma de HA nas folhas agro-infiltradas, as proteínas foram extraídas do tecido foliar infiltrado e analisadas por Western blotting utilizando anticorpos policlonais anti-H5 (Indica). Uma faixa única de aproximadamente 75 kDa (Figura 7), correspondendo em tamanho à forma HAO não-clivada de hemaglutinina da gripe, foi detetada em extratos de folhas infiltradas com AGLl / 660 e AGLl / 696, indicando que tanto ο H5 A nativo / Indonésia / 5/05 e a hemaglutinina quimérica Hl / H5 se acumulam em alto nível nas plantas.

Exemplo 4: Substituição do ectodaminio de H5 λ / Indonésia / 5/05 com o de H3 ou B. Comparação da expressão para formas quiméricas e nativas. A fusão da ectodamaina de H3 A / Brisbane / 10/2007 ou B Florida / 4/2006 aos subdomínios transmembrana e citoplasmática de H5 A / Indonésia / 5/05 foi avaliada como uma estratégia para apresentar regiões antigênicas de hemaglutinina de H3 e B estirpes, aumentando o seu nível de acumulação nas plantas. As cassetes de expressão para a expressão das fusões de hemaglutinina H5 / H3 e H5 / B estão representadas na Figura 10 e os aminoácidos na margem das fusões são apresentados na Figura 11. O nível de acumulação de hemaglutinina H5 / B quimérica (745) foi comparado com o de HA B nativa (739) em plantas de Nicotiana benthamiana. As plantas foram infiltradas com AGLl / 739 e AGLl / 745, e as folhas foram colhidas após um period© de incubação de seis dias. Para determinar o nível de acumulaçãoo de cada forma de HA nas folhas agro-infiltradas, as proteínas foram primeiro extraídas do tecido foliar infiltrado e analisadas por Western blotting utilizando anticorpos policlonais anti-B (Florida). Uma faixa única de aproximadamente 75 kDa (Figura 14), correspondendo em tamanho à forma HAO não-clivada de hemaglutinina da gripe, foi detetada em extratos de folhas de uma planta infiltrada com AGLl / 739 enquanto as 3 plantas infiltradas com AGLl / 745 mostraram sinal positivo correspondendo à hemaglutinina, indicando que a forma quimérica H5 / B da hemaglutinina se acumulou mais regularmente em níveis elevados do que a forma nativa da hemaglutinina B.

Similarmente, o nível de acumulação de hemaglutinina H5 / H3 quimérica (737) foi comparado com o de sua forma nativa (736) em plantas de Nicotiana benthamiana. As plantas foram infiltradas com AGLl / 736 e AGLl / 737 e as folhas foram colhidas após um período de incubação de seis dias. Para determinar o nível de acumulação de cada forma de HA nas folhas agro-infiltradas, as proteínas foram extraídas do tecido foliar infiltrado e analisadas por Western blotting utilizando anticorpos policlonais anti-H3 (Brisbane). Uma banda única de aproximadamente 75 kDa (Figura 15), correspondendo em tamanho à forma HAO não-clivada da hemaglutinina da gripe, foi detetada em extratos de folhas infiltradas com AGLl / 736 e AGL 1/737. Este resultado indica que a fusão de subdomínios transmembrana e citoplasmática de H5 A / Indonésia / 5/05 ao ectodomínio de H3 A / Brisbane / 10/2007 cria uma hemaglutinina quimérica que se acumula a um nível semelhante ao H3A nativo / Brisbane / 10/2007 A produção de VLPs a partir da expressão da hemaglutinina quimérica H5 / B (construção n° 745) foi avaliada utilizando cromatografia de exclusão por tamanhos. Extratos de proteína concentrada de plantas infiltradas com AGLl / 745 (1,5 mL) foram fracionados por cromatografia de exclusão por tamanho (SEC) em colunas SephacrylTM S- 500 HR (GE Healthcare Bio-Science Corp., Piscataway, NJ, EUA) . Como mostrado na Figura 16, a eluição de Dextran Azul (2 MDa) atingiu um pico na fração 8. Quando as proteínas de 200 μΐ de cada fração de eluição SEC foram concentradas (5 vezes) por precipitação com acetona e analisadas por Western blotting usando anti-B Flórida), anticorpos policlonais (Figura 16), a hemaglutinina quimérica foi encontrada principalmente na fração 7, indicando a incorporação de HA em estruturas de alto peso molecular. Sem querer ser limitado pela teoria, isso sugere que a proteína HA quimérica foi montada em uma superestrutura grande ou que foi fixada a uma estrutura de alto peso molecular. Os resultados obtidos indicam que o HA quimérico que consiste no ectodomínio de HA B / Florida / 4/2006 fundido aos subdominios transmembrana e citosólico de H5 A / Indonesia / 5/05 se agrupa em partículas de alto peso molecular e que o perfil de eluição destas partículas de alto peso molecular é indistinguíveis àquelas das VLPs da gripe.

Exemplo 5: Co-expressão de hemaglutinina quimérica H5 / B (número de construção 747; compreendendo B / Flo HDC e SDC fundida com um TDC H5 / Indo) com Hsp70 e Hsp40 em combinação com modificação do péptido sinal. A expressão de Hsp40 e Hsp70 em plantas e a co-expressão com hemaglutininas de gripe são descritas no pedido co-pendente PCT / CA2009 / 000032. A Hsp70 citosólica e a Hsp40 (número de construção R870) de origem vegetal podem também ser co-expressas com hemaglutininas quiméricas, para aumentar o seu nível de acumulação nas plantas. A co-expressão pode ser realizada por agro-filtração de plantas de N. benthamiana com uma suspensão bacteriana contendo uma mistura (proporção de 1:1:1) de AGLl contendo a cassete para a expressão do HA quimérico desejado com AGLl / R870 e AGLl / 35SHcPro. O nível de acumulação de hemaglutinina H5 / B quimérica (B / Fio HDC e SDC fundida com um H5 / Indo TDC) foi avaliado em co-expressão com HSP40 e HSP70 em plantas de Nicotiana benthamiana. As plantas foram infiltradas com AGLl / 747, AGLl / 747 + AGLl / 443 (vetor vazio) ou AGL1 / 747 + AGL1 / R870 (HSP40 / HSP70), e as folhas foram colhidas após um período de incubação de seis dias. Para determinar o nível de acumulação de HA quimérico H5 / B nas folhas agro-infiltradas, as proteínas foram primeiro extraídas do tecido foliar infiltrado e analisadas por Western blotting utilizando anticorpos policlonais anti-B (Florida). Uma banda única de aproximadamente 75 kDa (Figura 50), correspondente em tamanho à forma HAO não-clivada da hemaglutinina da gripe, foi detectada em extratos de folhas de 3 plantas infiltradas com AGL1 / 747 + AGL1 / R870 enquanto as 3 plantas infiltradas com AGL1 / 747 + vetor de controle (443) não mostraram sinal (sob a condição de exposição usada) indicando que ο H5 / B quimérico forma de hemaglutinina acumulada em alto nível quando co-expressa com as HSP40 e HSP 70 chaperones.

Na descrição, vários termos são usados extensivamente e são fornecidas definições para facilitar a compreensão de vários aspetos da invenção. Os intervalos numéricos incluem os números que definem o intervalo. Na descrição, a palavra "compreendendo" é usada como um termo aberto, substancialmente equivalente à frase "incluindo, mas não limitado a", e a palavra "compreende" tem um significado correspondente.

LISTAGEM DE SEQUÊNCIAS

<110> Medicago Inc. COUTURE, MANON DARGIS, MICHELE LAVOIE, PIERRE-OLIVIER VEZINA, LOUIS- PHILIPPE DAOUST, MARC-ANDRE <120> Chimeric Influenza Virus-Like Particles Comprising Hemagglutinin

45 <130> V82197WO <140> not assigned <141 > not assigned so <150> 61/220,161 <151 >2009-06-24 <160> 113 55 <170> Patentln version 3.4 <210> 1 <211> 32 <212> D ΝΑ <213> Artificial sequence <220> <223> Synthesized Xmal-pPlas.c <400> 1 agttccccgg gctggtatat ttatatgttg tc 32 <210>2

<211 >46 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Sacl-ATG-pPlas.r <400>2 aatagagctc cattttctct caagatgatt aattaattaa ttagtc 46

<210> 3 <211 >46 <212> DNA <213> Artificial sequence <220> <223> Synthesized Sacl-PlasTer.c <400> 3 aatagagctc gttaaaatgc ttcttcgtct cctatttata atatgg 46

<210> 4 <211 >48 <212> DNA <213> Artificial sequence <220> <223> Synthesized EcoRI-PlasTer.r <400>4 ttacgaattc tccttcctaa ttggtgtact atcatttatc aaagggga 48

<210> 5 <211 >25 <212> DNA <213> Artificial sequence <220> <223> Synthesized Plasto-443C <400> 5 gtattagtaa ttagaatttg gtgtc 25 <210> 6 <211> 44

<212> DNA <213> Artificial Sequence <220> <223> SpHa(lnd)-Plasto-r <400>6 gcaagaagaa gcactatttt ctccattttc tctcaagatg atta 44

<210>7 <211 >45 <212> DNA <213> Artificial sequence <220> <223> Plasto-SpHa.c <400>7 ttaatcatct tgagagaaaa tggagaaaat agtgcttctt cttgc 45

<210> 8 <211> 38 <212> DNA <213> Artificial sequence <220> <223> HA(lnd)-Sac.r <400>8 actttgagct cttaaatgcaaattctgcat tgtaacga 38 <210> 9 <211> 24

<212> DNA <213> Artificial sequence <220> <223> Synthesized pBinPlus.2613c <400>9 aggaagggaa gaaagcgaaa ggag 24 <210> 10

<211> 56 <212> DNA <213> Artificial sequence <220> <223> Synthesized Mut-ATG115.r <400> 10 gtgccgaagc acgatctgac aacgttgaag atcgctcacg caagaaagac aagaga 56

<210> 11 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Mut-ATG161.c gttgtcagat cgtgcttcgg caccagtaca acgttttctt tcactgaagc ga 52

<210> 12 <211 >25 <212> DNA <213> Artificial sequence <220> <223> Synthesized LC-C5-1.110r <400> 12 tctcctggag tcacagacag ggtgg 25

<210> 13 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Synthesized E1 H1B-E1 H51.r <400> 13 tcatagtcag cgaaatgccc tgggtaacag aggtcattgg ttggattggc ct 52

<210> 14 <211 >48 <212> DNA <213> Artificial Sequence <220> <223> Synthesized E1 H5N-E1 H1B.C <400> 14 atgacctctg ttacccaggg catttcgctg actatgagga actgaggg 48

<210> 15 <211 >48 <212> DNA <213> Artificial Sequence <220> <223> Synthesized E2 H5I-RB H1B.r <400> 15 ccaattcact tttcataatt cctgatccaa agcctctact cagtgcga 48

<210> 16 <211>51 <212> DNA <213> Artificial Sequence <220> <223> Synthesized RB H1B-E2 H51.C <400> 16 ggctttggat caggaattat gaaaagtgaa ttggaatatg gtaactgcaa c 51 <211 >48 <212> D ΝΑ <213> Artificial Sequence <220> <223> Synthesized E1 H1B-F(prime)1 H51.r <400> 17 ggctattcct tttaataggc agagcttccc gttgtgtgtc ttttccag 48

<210> 18 <211 >48 <212> DNA <213> Artificial Sequence <220> <223> Synthesized F’1 H5N-E1 H1B.C <400> 18 aacgggaagc tctgcctatt aaaaggaata gccccactac aattgggt 48

<210> 19 <211 >48 <212> DNA <213> Artificial Sequence <220> <223> Synthesized F(prime)2 H5I-E2 H1 B.r <400> 19 ggagtttgac acttggtgtt gcatttatcc attggtgcat ttgagttg 48

<210> 20 <211 >48 <212> DNA <213> Artificial Sequence <220> <223> Synthesized E2 FI1B-F(prime)2 FI51.C <400> 20 aatgcaccaa tggataaatg caacaccaag tgtcaaactc caatgggg 48

<210>21 <211 >48 <212> DNA <213> Artificial Sequence <220> <223> Synthesized E1 H5I-E1 FUNC.r <400> 21 tcttcatagt cgttgaaact ccctgggtaa catgttccat tctcagga 48

<210> 22 <211 >48 <212> DNA <220> <223> Synthesized E1 H1NC-E1 H51.C <400> 22 ctgagaatgg aacatgttac ccagggagtt tcaacgacta tgaagaac 48 <210> 23 <211>51

<212> DNA <213> Artificial Sequence <220> <223> Synthesized E2 H1NC-RB H51.r <400> 23 atttgaggtg atgattgctg agtccccttt cttgacaatt ttgtatgcat a 51 <210> 24

<211 >48 <212> DNA <213> Artificial Sequence <220> <223> Synthesized RB H5I-E2 H1NC.C <400> 24 gtcaagaaag gggactcagc aatcatcacc tcaaatgcac caatggat 48

<210> 25 <211 >43 <212> DNA <213> Artificial Sequence <220> <223> Synthesized HA-Sacl.r <400> 25 ttaacttaga gctcttagat gcatattcta cactgcaaag ace 43

<210> 26 <211 >45 <212> DNA <213> Artificial sequence <220> <223> Synthesized Apal-H1B.c <400> 26 tgtcgggccc atgaaagtaa aactactggt cctgttatgc acatt 45

<210> 27 <211 >46 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Stul-H1B.r <400> 27 aaataggcct ttagatgcat attctacact gtaaagaccc attgga 46

<210> 28 <211 >49 <212> DNA <213> Artificial Sequence <220> <223> Synthesized SpPDI-H18.c <400> 28 ttctcagatc ttcgctgaca caatatgtat aggctaccat gctaacaac 49

<210> 29 <211>47 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Sacl-H1B.r <400> 29 cttagagctc ttagatgcat attctacact gtaaagaccc attggaa 47

<210> 30 <211 >45 <212> DNA <213> Artificial sequence <220> <223> Synthesized Apal-SpPDI.c <400> 30 ttgtcgggcc catggcgaaa aacgttgcga ttttcggctt attgt 45 <210> 31 <211> 39

<212> DNA <213> Artificial Sequence <220> <223> Synthesized Apal-H5 (A-lndo).lc <400> 31 tgtcgggccc atggagaaaa tagtgcttct tcttgcaat 39 <210> 32

<211>37 <212> DNA <213> Artificial Sequence <220> <223> Synthesized H5 (A-lndo)-Stul.1707r <400> 32 aaataggcct ttaaatgcaa attctgcatt gtaacga 37

<210> 33 <211 >45 <212> DNA <213> Artificial Sequence <220> <223> Synthesized H3B-SpPDI.r <400> 33 tgtcatttcc gggaagtttt tgagcgaaga tctgagaagg aacca 45

<210> 34 <211 >45 <212> DNA <213> Artificial Sequence <220> <223> Synthesized SpPDI-H3B.c <400> 34 tctcagatct tcgctcaaaa acttcccgga aatgacaaca gcacg 45

<210> 35 <211 >44 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Stul-H3B.r <400> 35 aaaataggcc ttcaaatgca aatgttgcac ctaatgttgc cttt 44

<210> 36 <211 >45 <212> DNA <213> Artificial Sequence <220> <223> Synthesized TmD H5l-H3B.r <400> 36 atttggtaag ttcctattga cttcagctca acgcccttga tctgg 45

<210> 37 <211 >48 <212> DNA <213> Artificial Sequence <220> <223> Synthesized H3B-TmD H51.C <400> 37 tgagctgaag tcaataggaa cttaccaaat actgtcaatt tattcaac 48 <210> 38 <211> 50 <212> D ΝΑ <213> Artificial sequence <220> <223> Synthesized HBF-SpPDI.r <400> 38 gttattccag tgcagattcg atcagcgaag atctgagaag gaaccaacac 50

<210> 39 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthesized SpPDI-HBF.c <400> 39 cagatcttcg ctgatcgaat ctgcactgga ataacatctt caaactcacc 50

<210> 40 <211 >46 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Stul-FIBF.r <400> 40 aaaataggcc tttatagaca gatggagcat gaaacgttgt ctctgg 46

<210> 41 <211 >45 <212> DNA <213> Artificial sequence <220> <223> Synthesized TmD H5I-B Flo.r <400> 41 tgacagtatt tggtagttat ccaatccatc atcatttaaa gatgc 45

<210> 42 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthesized B Flo-TmD FI51.C <400> 42 ggattggata actaccaaat actgtcaatt tattcaacag tggcgagttc 50

<210> 43 <211 >20 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Hsp-40Luz.1c <400> 43 atgtttgggc gcggaccaac 20

<210> 44 <211>31 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Hsp40Luz-Sacl.1272r <400> 44 agctgagctc ctactgttga gcgcattgca c 31

<210> 45 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Hsp40Luz-Plasto.r <400> 45 gttggtccgc gcccaaacat tttctctcaa gatgat 36

<210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Hsp70Ara.1c <400> 46 atgtcgggta aaggagaagg a 21

<210>47 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Hsp70Ara-Sacl.1956r <400> 47 agctgagctc ttagtcgacc tcctcgatct tag 33

<210> 48 <211>37 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Hsp70Ara-Plasto.r <400> 48 tccttctcct ttacccgaca ttttctctca agatgat 37

<210> 49 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthesized supP19-plasto.r <400> 49 ccttgtatag ctcgttccat tttctctcaa gatg 34 <210> 50

<211 >20 <212> DNA <213> Artificial Sequence <220> <223> Synthesized supP19-1c <400> 50 atggaacgag ctatacaagg 20

<210> 51 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthesized SupP19-Sacl.r <400> 51 agtcgagctc ttactcgctt tctttttcga ag 32

<210> 52 <211 > 1719 <212> DNA <213> Artificial Sequence <220> <223> Synthesized B-Plasto-Native SP-H5 A/lndonesia/5/05 <400> 52 aagcttatgg agaaaatagt gcttcttctt gcaatagtca gtcttgttaa aagtgatcag 60 atttgcattg gttaccatgc aaacaattca acagagcagg ttgacacaat catggaaaag 120 aacgttactg ttacacatgc ccaagacata ctggaaaaga cacacaacgg gaagctctgc 180 gatctagatg gagtgaagcc tctaatttta agagattgta gtgtagctgg atggctcctc 240 gggaacccaa tgtgtgacga attcatcaat gtaccggaat ggtcttacat agtggagaag 300 gccaatccaa ccaatgacct ctgttaccca gggagtttca acgactatga agaactgaaa 360 cacctattga gcagaataaa ccattttgag aaaattcaaa tcatccccaa aagttcttgg 420 tccgatcatg aagcctcatc aggagttagc tcagcatgtc catacctggg aagtccctcc 480 ttttttagaa atgtggtatg gcttatcaaa aagaacagta catacccaac aataaagaaa 540 agctacaata ataccaacca agaggatctt ttggtactgt ggggaattca ccatcctaat 600 gatgcggcag agcagacaag gctatatcaa aacccaacca cctatatttc cattgggaca 660 tcaacactaa accagagatt ggtaccaaaa atagctacta gatccaaagt aaacgggcaa 720 agtggaagga tggagttctt ctggacaatt ttaaaaccta atgatgcaat caacttcgag 780 agtaatggaa atttcattgc tccagaatat gcatacaaaa ttgtcaagaa aggggactca 840 gcaattatga aaagtgaatt ggaatatggt aactgcaaca ccaagtgtca aactccaatg 900 ggggcgataa actctagtat gccattccac aacatacacc ctctcaccat cggggaatgc 960 cccaaatatg tgaaatcaaa cagattagtc cttgcaacag ggctcagaaa tagccctcaa 1020 agagagagca gaagaaaaaa gagaggacta tttggagcta tagcaggttt tatagaggga 1080 ggatggcagg gaatggtaga tggttggtat gggtaccacc atagcaatga gcaggggagt 1140 gggtacgctg cagacaaaga atccactcaa aaggcaatag atggagtcac caataaggtc 1200 aactcaatca ttgacaaaat gaacactcag tttgaggccg ttggaaggga atttaataac 1260 ttagaaagga gaatagagaa tttaaacaag aagatggaag acgggtttct agatgtctgg 1320 acttataatg ccgaacttct ggttctcatg gaaaatgaga gaactctaga ctttcatgac 1380 tcaaatgtta agaacctcta cgacaaggtc cgactacagc ttagggataa tgcaaaggag 1440 ctgggtaacg gttgtttcga gttctatcac aaatgtgata atgaatgtat ggaaagtata 1500 agaaacggaa cgtacaacta tccgcagtat tcagaagaag caagattaaa aagagaggaa 1560 ataagtgggg taaaattgga atcaatagga acttaccaaa tactgtcaat ttattcaaca 1620 gtggcgagtt ccctagcact ggcaatcatg atggctggtc tatctttatg gatgtgctcc 1680 aatggatcgt tacaatgcag aatttgcatt taagagctc 1719 <210> 53

<211> 3194 <212> DNA <213> Artificial Sequence <220> <223> Synthesized 6G0 expression cassette from Hindill to Eco-Rl <400> 53 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 dacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttqacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 7 80 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc acgcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaac acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tggagaaaat agtgcttctt cttgcaatag tcagtcttgt 1080 taaaagtgat cagatttgca ttggttacca tgcaaacaat tcaacagagc aggttgacac 1140 aatcatggaa aagaacgtta ctgttacaca tgcccaagac atactggaaa agacacacaa 1200 cgggaagctc tgcgatctag atggagtgaa gcctctaatt ttaagagatt gtagtgtagc 1260 tggatggctc ctcgggaacc caatgtgtga cgaattcatc aatgtaccgg aatggtctta 1320 catagtggag aaggccaatc caaccaatga cctctgttac ccagggagtt tcaacgacta 1380 tgaagaactg aaacacctat tgagcagaat aaaccatttt gagaaaattc aaatcatccc 1440 caaaagttct tggtccgatc atgaagcctc atcaggagtt agctcagcat gtccatacct 1500 gggaagtccc tccttttt:ta gaaatgtggt atggcttatc aaaaagaaca gtacataccc 1560 aacaataaag aaaagctaca ataataccaa ccaagaggat cttttggtac tgtggggaat 1620 tcaccatcct aatgatgcgg cagagcagac aaggctatat caaaacccaa ccacctatat 1680 ttccattggg acatcaacac taaaccagag attggtacca aaaatagcta ctagatccaa 1740 agtaaacggg caaagtggaa ggatggagtt cttctggaca attttaaaac ctaatgatgc 1800 aatcaacttc gagagtaatg gaaatttcat tgctccagaa tatgcataca aaattgtcaa 1860 gaaaggggac tcagcaatta tgaaaagtga attggaatat ggtaactgca acaccaagtg 1920 tcaaactcca atgggggcga taaactctag tatgccattc cacaacatac accctctcac 1980 catcggggaa tgccccaaat atgtgaaatc aaacagatta gtccttgcaa cagggctcag 2040 aaatagccct caaagagaga gcagaagaaa aaagagagga ctatttggag ctatagcagg 2100 ttttatagag ggaggatggc agggaatggt agatggttgg tatgggtacc accatagcaa 2160 tgagcagggg agtgggtacg ctgcagacaa agaatccact caaaaggcaa tagatggagt 2220 caccaataag gtcaactcaa tcattgacaa aatgaacact cagtttgagg ccgttggaag 2280 gaatttaaac aagaagatgg aagacgggtt 2340 ggaatttaat aacttagaaa ggagaataga tctagatgtc tggacttata atgccgaact tctggttctc atggaaaatg agagaactct 2400 agactttcat gactcaaatg ttaagaacct ctacgacaag gtccgactac agcttaggga 2460 taatgcaaag gagctgggta acggttgttt cgagttctat cacaaatgtg ataatgaatg 2520 tatggaaagt ataagaaacg gaacgtacaa ctatccgcag tattcagaag aagcaagatt 2580 aaaaagagag gaaataagtg gggtaaaatt ggaatcaata ggaacttacc aaatactgtc 2640 aatttattca acagtggcga gttccctagc actggcaatc atgatggctg gtctatcttt 2700 atggatgtgc tccaatggat cgttacaatg cagaatttgc atttaagagc tctaagttaa 2760 aatgcttctt cgtctcctat ttataatatg gtttgttatt gttaattttg ttcttgtaga 2820 agagcttaat taatcgttgt tgttatgaaa tactatttgt atgagatgaa ctggtgtaat 2880 gtaattcatt tacataagtg gagtcagaat cagaatgttt cctccataac taactagaca 2940 tgaagacctg ccgcgtacaa ttgtcttata tttgaacaac taaaattgaa catcttttgc 3000 cacaacttta taagtggtta atatagctca aatatatggt caagttcaat agattaataa 3060 tggaaatatc agttatcgaa attcattaac aatcaactta acgttattaa ctactaattt 3120 tatatcatcc cctttgataa atgatagtac accaattagg aaggagcatg ctcgaggcct 3180 ggctggccga attc 3194

<210> 54 <211>1711 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Wld-type Hl/NC coding sequence lacking Tm D and Ctail <400> 54 atgaaagcaa aactactggt cctgttatgt acatttacag ctacatatgc agacacaata 60 tgtataggct accatgccaa caactcaacc gacactgttg acacagtact tgagaagaat 120 gtgacagtga cacactctgt caacctactt gaggacagtc acaatggaaa actatgtcta 180 ctaaaaggaa tagccccact acaattgggt aattgcagcg ttgccggatg gatcttagga 240 aacccagaat gcgaattact gatttccaag gaatcatggt cctacattgt agaaacacca 300 aatcctgaga atggaacatg ttacccaggg tatttcgccg actatgagga actgagggag 360 caattgagtt cagtatcttc atttgagaga ttcgaaatat tccccaaaga aagctcatgg 420 cccaaccaca ccgtaaccgg agtatcagca tcatgctccc ataatgggaa aagcagtttt 480 tacagaaatt tgctatggct gacggggaag aatggtttgt acccaaacct gagcaagtcc 540 tatgtaaaca acaaagagaa agaagtcctt gtactatggg gtgttcatca cccgcctaac 600 atagggaacc aaagggccct ctatcataca gaaaatgctt atgtctctgt agtgtcttca 660 cattatagca gaagattcac cccagaaata gccaaaagac ccaaagtaag agatcaggaa 720 ggaagaatca actactactg gactctgctg gaacctgggg atacaataat atttgaggca 780 aatggaaatc taatagcgcc atggtatgct tttgcactga gtagaggctt tggatcagga 840 atcatcacct caaatgcacc aatggatgaa tgtgatgcga agtgtcaaac acctcaggga 900 gctataaaca gcagtcttcc tttccagaat gtacacccag tcacaatagg agagtgtcca 960 aagtatgtca ggagtgcaaa attaaggatg gttacaggac taaggaacat cccatccatt 1020 caatccagag gtttgtttgg agccattgcc ggtttcattg aaggggggtg gactggaatg 1080 gtagatgggt ggtatggtta tcatcatcag aatgagcaag gatctggcta tgctgcagat 1140 caaaaaagta cacaaaatgc cattaacggg attacaaaca aggtgaattc tgtaattgag 1200 aaaatgaaca ctcaattcac agctgtgggc aaagaattca acaaattgga aagaaggatg 1260 gaaaacttaa ataaaaaagt tgatgatggg tttctagaca tttggacata taatgcagaa 1320 ttgttggttc tactggaaaa tgaaaggact ttggatttcc atgactccaa tgtgaagaat 1380 ctgtatgaga aagtaaaaag ccaattaaag aataatgcca aagaaatagg aaacgggtgt 1440 tttgaattct atcacaagtg taacaatgaa tgcatggaga gtgtgaaaaa tggaacttat 1500 gactatccaa aatattccga agaatcaaag ttaaacaggg agaaaattga tggagtgaaa 1560 ttggaatcaa tgggagtcta tcagattctg gcgatctact caactgtcgc cagttccctg 1620 gttcttttgg tctccctggg ggcaatcagc ttctggatgt gttccaatgg gtctttgcag 1680 tgtagaatat gcatctgaga ccagaatttc a 1711

<210> 55 <211> 1556 <Z1Z> DNA <Z13> Artificial Sequence <2Z0> <ZZ3> Synthesized Bglll-Hl A/NewCaledonla/20/99-Sacl/Stul. <400>55 agatcttcgc tgacacaata tgtataggct accatgccaa caactcaacc gacactgttg 60 acacagtact tgagaagaat gtgacagtga cacactctgt caacctactt gaggacagtc 120 acaatggaaa actatgtcta ctaaaaggaa tagccccact acaattgggt aattgcagcg 180 ttgccggatg gatcttagga aacccagaat gcgaattact gatttccaag gaatcatggt 240 cctacattgt agaaacacca aatcctgaga atggaacatg ttacccaggg tatttcgccg 300 actatgagga actgagggag caattgagtt cagtatcttc atttgagaga ttcgaaatat 360 tccccaaaga aagctcatgg cccaaccaca ccgtaaccgg agtatcagca tcatgctccc 420 ataatgggaa aagcagtttt tacagaaatt tgctatggct gacggggaag aatggtttgt 480 acccaaacct gagcaagtcc tatgtaaaca acaaagagaa agaagtcctt gtactatggg 540 gtgttcatca cccgcctaac atagggaacc aaagggcact ctatcataca gaaaatgctt 600 atgtctctgt agtgtcttca cattatagca gaagattcac cccagaaata gccaaaagac 660 ccaaagtaag agatcaggaa ggaagaatca actactactg gactctgctg gaacctgggg 720 atacaataat atttgaggca aatggaaatc taatagcgcc atggtatgct tttgcactga 780 gtagaggctt tggatcagga atcatcacct caaatgcacc aatggatgaa tgtgatgcga 840 agtgtcaaac acctcaggga gctataaaca gcagtcttcc tttccagaat gtacacccag 900 tcacaatagg agagtgtcca aagtatgtca ggagtgcaaa attaaggatg gttacaggac 960 taaggaacat cccatccatt caatccagag gtttgtttgg agccattgcc ggtttcattg 1020 aaggggggtg gactggaatg gtagatgggt ggtatggtta tcatcatcag aatgagcaag 1080 gatctggcta tgctgcagat caaaaaagta cacaaaatgc cattaacggg attacaaaca 1140 aggtcaattc tgtaattgag aaaatgaaca ctcaattcac agctgtgggc aaagagttca 1200 acaaattgga aagaaggatg gaaaacttaa ataaaaaagt tgatgatggg tttctagaca 1260 tttggacata taatgcagaa ttgttggttc tactggaaaa tgaaaggact ttggatttcc 1320 atgactccaa tgtgaagaat ctgtatgaga aagtaaaaag ccaattaaag aataatgcca 1380 aagaaatagg aaacgggtgt tttgagttct atcacaagtg taacaatgaa tgcatggaga 1440 gtgtgaaaaa tggtacctat gactatccaa aatattccga agaatcaaag ttaaacaggg 1500 agaaaattga tggagtgaaa ttggaatcaa tgggagtata ctaagagctc aggcct 1556

<210» 56 <211>219 <212> DNA <213> Artificial Sequence <220» <223> Synthesized Kpnl-Hl A/NewCaledonia/20/99 TmD+Ctail-Sad/Stul. <400» 56 ggtacctatg actatccaaa atattccgaa gaatcaaagt taaacaggga gaaaattgat 60 ggagtgaaat tggaatcaat gggagtatac cagattctgg cgatctactc aactgtcgcc 120 agttccctgg ttcttttggt ctccctgggg gcaatcagct tctggatgtg ttccaatggg 180 tctttgcagt gtagaatatg catctaagag ctcaggcct 219

<210> 57 <211>1781 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Signal peptide of alfalfa protein disulfide isomerase (POI) gene <400> 57 ccaaatcctt aacattcttt caacaccaac aatggcgaaa aacgttgcga ttttcggttt 60 attgttttct cttcttctgt tggttccttc tcagatcttc gctgaggaat catcaactga 120 cgctaaggaa tttgttctta cattggataa cactaatttc catgacactg ttaagaagca 180 cgatttcatc gtcgttgaat tctacgcacc ttggtgtgga cactgtaaga agctagcccc 240 agagtatgag aaggctgctt ctatcttgag cactcacgag ccaccagttg ttttggctaa 300 agttgatgcc aatgaggagc acaacaaaga cctcgcatcg gaaaatgatg ttaagggatt 360 cccaaccatt aagattttta ggaatggtgg aaagaacatt caagaataca aaggtccccg 420 tgaagctgaa ggtattgttg agtatttgaa aaaacaaagt ggccctgcat ccacagaaat 480 taaatctgct gatgatgcga ccgcttttgt tggtgacaac aaagttgtta ttgtcggagt 540 tttccctaaa ttttctggtg aggagtacga taacttcatt gcattagcag agaagttgcg 600 ttctgactat gactttgctc acactttgaa tgccaaacac cttccaaagg gagactcatc 660 agtgtctggg cctgtggtta ggttatttaa gccatttgac gagctctttg ttgactcaaa 720 ggatttcaat gtagaagctc tagagaaatt cattgaagaa tccagtaccc caattgtgac 780 tgtcttcaac aatgagccta gcaatcaccc ttttgttgtc aaattcttta actctcccaa 840 cgcaaaggct atgttgttca tcaactttac taccgaaggt gctgaatctt tcaaaacaaa 900 ataccatgaa gtggctgagc aatacaaaca acagggagtt agctttcttg ttggagatgt 960 tgagtctagt caaggtgcct tccagtattt tggactgaag gaagaacaag tacctctaat 1020 tattattcag cataatgatg gcaagaagtt tttcaaaccc aatttggaac ttgatcaact 1080 cccaacttgg ttgaaggcat acaaggatgg caaggttgaa ccatttgtca agtctgaacc 1140 tattcctgaa actaacaacg agcctgttaa agtggtggtt gggcaaactc ttgaggacgt 1200 tgttttcaag tctgggaaga atgttttgat agagttttat gctccttggt gtggtcactg 1260 caagcagttg gctccaatct tggatgaagt tgctgtctca ttccaaagcg atgctgatgt 1320 tgttattgca aaactggatg caactgccaa cgatatccca accgacacct ttgatgtcca 1380 aggctatcca accttgtact tcaggtcagc aagtggaaaa ctatcacaat acgacggtgg 1440 taggacaaag gaagacatca tagaattcat tgaaaagaac aaggataaaa ctggtgctgc 1500 tcatcaagaa gtagaacaac caaaagctgc tgctcagcca gaagcagaac aaccaaaaga 1560 tgagctttga aaagttccgc ttggaggata tcggcacaca gtcatctgcg ggctttacaa 1620 ctcttttgta tctcagaatc agaagttagg aaatcttagt gccaatctat ctatttttgc 1680 gtttcatttt atctttttgg tttactctaa tgtattactg aataatgtga gttttggcgg 1740 agtttagtac tggaactttt gtttctgtaa aaaaaaaaaa a 1781

<210> 58 <211> 1457 <212> DNA <213> Artificial Sequence <220> <223> Synthesized PromPlasto-PDISP-Plasto 3(prime)UTR plasmid sequence <400> 58 ctggtatatt tatatgttgt caaataactc aaaaaccata aaagtttaag ttagcaagtg 60 tgtacatttt tacttgaaca aaaatattca cctactactg ttataaatca ttattaaaca 120 ttagagtaaa gaaatatgga tgataagaac aagagtagtg atattttgac aacaattttg 180 ttgcaacatt tgagaaaatt ttgttgttct ctcttttcat tggtcaaaaa caatagagag 240 agaaaaagga agagggagaa taaaaacata atgtgagtat gagagagaaa gttgtacaaa 300 agttgtacca aaatagttgt acaaatatca ttgaggaatt tgacaaaagc tacacaaata 360 agggttaatt gctgtaaata aataaggatg acgcattaga gagatgtacc attagagaat 420 ttttggcaag tcattaaaaa gaaagaataa attattttta aaattaaaag ttgagtcatt 480 tgattaaaca tgtgattatt taatgaattg atgaaagagt tggattaaag ttgtattagt 540 aattagaatt tggtgtcaaa tttaatttga catttgatct tttcctatat attgccccat 600 agagtcagtt aactcatttt tatatttcat agatcaaata agagaaataa cggtatatta 660 atccctccaa aaaaaaaaaa cggtatattt actaaaaaat ctaagccacg taggaggata 720 acaggatccc cgtaggagga taacatccaa tccaaccaat cacaacaatc ctgatgagat 780 aacccacttt aagcccacgc atctgtggca catctacatt atctaaatca cacattcttc 840 cacacatctg agccacacaa aaaccaatcc acatctttat cacccattct ataaaaaatc 900 acactttgtg agtctacact ttgattccct tcaaacacat acaaagagaa gagactaatt 960 aattaattaa tcatcttgag agaaaatggc gaaaaacgtt gcgattttcg gcttattgtt 1020 ttctcttctt gtgttggttc cttctcagat ctgagctcta agttaaaatg cttcttcgtc 1080 tcctatttat aatatggttt gttattgtta attttgttct tgtagaagag cttaattaat 1140 cgttgttgtt atgaaatact atttgtatga gatgaactgg tgtaatgtaa ttcatttaca 1200 taagtggagt cagaatcaga atgtttcctc cataactaac tagacatgaa gacctgccgc 1260 gtacaattgt cttatatttg aacaactaaa attgaacatc ttttgccaca actttataag 1320 tggttaatat agctcaaata tatggtcaag ttcaatagat taataatgga aatatcagtt 1380 atcgaaattc attaacaatc aacttaacgt tattaactac taattttata tcatcccctt 1440 tgataaatga tagtaca 1457

<Z10> 59 <211>3206 <212> DNA <213> Artificial Saquanca <Z20>

<2Z3> Synthesized 540 expression cassette from Hindi II <400> 59 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 aacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttgacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 780 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc acgcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaao acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tggcgaaaaa cgttgcgatt ttcggcttat tgttttctct 1080 tcttgtgttg gttccttctc agatcttcgc tgacacaata tgtataggct accatgccaa 1140 caactcaacc gacactgttg acacagtact tgagaagaat gtgacagtga cacactctgt 1200 caacctactt gaggacagtc acaatggaaa actatgtcta ctaaaaggaa tagccccact 1260 acaattgggt aattgcagcg ttgccggatg gatcttagga aacccagaat gcgaattact 1320 gatttccaag gaatcatggt cctacattgt agaaacacca aatcctgaga atggaacatg 1380 ttacccaggg tatttcgccg actatgagga actgagggag caattgagtt cagtatcttc 1440 atttgagaga ttcgaaatat tcacaaaaga aagctcatgg cccaaccaca ccgtaaccgg 1500 agtatcagca tcatgctccc ataatgggaa aagcagtttt tacagaaatt tgctatggct 1560 gacggggaag aatggtttgt acccaaacct gagcaagtcc tatgtaaaca acaaagagaa 1620 agaagtcctt gtactatggg gtgttcatca cccgcctaac atagggaacc aaagggcact 1680 ctatcataca gaaaatgctt atgtctctgt agtgtcttca cattatagca gaagattcac 1740 cccagaaata gccaaaaqac ccaaagtaag agatcaggaa ggaagaatca actactactg 1800 gactctgctg gaacctgggg atacaataat atttgaggca aatggaaatc taatagcgcc 1860 atggtatgct tttgcactga gtagaggctt tggatcagga atcatcacct caaatgcacc 1920 aatgqatgaa tgtgatgcga agtgtcaaac acctcaggga gctataaaca gcagtcttcc 1980 tttccagaat gtacacccag tcacaatagg agagtgtcca aagtatgtca ggagtgcaaa 2040 attaaggatg gttacaggac taaggaacat cccatccatt caatccagag gtttgtttgg 2100 agccattgcc ggtttcattq aaggggggtg gactggaatq gtagatgggt ggtatggtta 2160 tcatcatcag aatgagcaag gatctggcta tgctgcagat caaaaaagta cacaaaatgc 2220 cattaacggg attacaaaca aggtcaattc tgtaattgag aaaatgaaca ctcaattcac 2280 agctgtgggc aaagagttca acaaattgga aagaaggatg gaaaacttaa ataaaaaagt 2340 tgatgatggg tttctagaca tttggacata taatgcagaa ttgttggttc tactggaaaa 2400 tgaaaggact ttggatttcc atgactccaa tgtgaagaat ctgtatgaga aagtaaaaag 2460 ccaattaaag aataatgcca aagaaatagg aaacgggtgt tttgagttct atcacaagtg 2520 taacaatgaa tgcatggaga gtgtgaaaaa tggtacctat gactatccaa aatattccga 2580 agaatcaaag ttaaacaggg agaaaattga tggagtgaaa ttggaatcaa tgggagtata 2640 ccagattctg gcgatcta::::t caactgtcgc cagttccctg gttcttttgg tctccctggg 2700 ggcaatcagc ttctggatgt gttccaatgg gtctttgcag tgtagaatat gcatctaaga 2760 gctctaagtt aaaatgcttc ttcgtctcct atttataata tggtttgtta ttgttaattt 2820 tgttcttgta gaagagctta attaatcgtt gttgttatga aatactattt gtatgagatg 2880 aactggtgta atgtaattca tttacataag tggagtcaga atcagaatgt ttcctccata 2940 actaactag2 catgaagacc tgccgcgtac aattgtctta tatttgaaca actaaaattg 3000 aacatctttt gccacaactt tataagtggt taatatagct caaatatatg gtcaagttca 3060 atagattaat aatggaaata tcagttatcg aaattcatta acaatcaact taacgttatt 3120 aactactaat tttatatcat cccctttgat aaatgatagt acaccaatta ggaaggagca 3180 tgctcgaggc ctggctggcc gaattc 3206

<210> 60 <211>1788 <212> DNA <213> Artificial Sequence <220> <223> Synthesized fragment Oralll-Plasto(-84+ 1 )-H 1 A/Brisbane/59/07-Sacl. <400> 60 cactttgtga gtctacactt tgattccctt caaacacata caaagagaag agactaatta 60 attaattaat catcttgaga gaaaatgaaa gtaaaactac tggtcctgtt atgcacattt 120 aatatgtata ggctaccatg ctaacaactc gaccgacact 180 acagctacat atgcagacac gttgacacag tacttgaaaa gaatgtgaca gtgacacact ctgtcaacct gcttgagaac 240 agtcacaatg gaaaactatg tctattaaaa ggaatagccc cactacaatt gggtaattgc 300 agcgttgccg ggtggatctt aggaaaccca gaatgcgaat tactgatttc caaggagtca 360 tggtcctaca ttgtagaaaa accaaatcct gagaatggaa catgttaccc agggcatttc 420 gctgactatg aggaactgag ggagcaattg agttcagtat cttcatttga gaggttcgaa 480 atattcccca aagaaagctc atggcccaac cacaccgtaa ccggagtgtc agcatcatgc 540 tcccataatg gggaaagcag tttttacaga aatttgctat ggctgacggg gaagaatggt 600 ttgtacccaa acctgagcaa gtcctatgca aacaacaaag aaaaagaagt ccttgtacta 660 tggggtgttc atcacccgcc aaacataggt gaccaaaagg ccctctatca tacagaaaat 720 gcttatgtct ctgtagtgtc ttcacattat agcagaaaat tcaccccaga aatagccaaa 780 agacccaaag taagagatca agaaggaaga atcaattact actggactct gcttgaaccc 840 ggggatacaa taatatttga ggcaaatgga aatctaatag cgccaagata tgctttcgca 900 ctgagtagag gctttggatc aggaatcatc aactcaaatg caccaatgga taaatgtgat 960 gcgaagtgcc aaacacctca gggagctata aacagcagtc ttcctttcca gaacgtacac 1020 ccagtcacaa taggagagtg tccaaagtat gtcaggagtg caaaattaag gatggttaca 1080 ggactaagga acatcccatc cattcaatcc agaggtttgt ttggagccat tgccggtttc 1140 attgaagggg ggtggactgg aatggtagat ggttggtatg gttatcatca tcagaatgag 1200 caaggatctg gctatgctgc agatcaaaaa agcacacaaa atgccattaa tgggattaca 1260 aacaaggtca attctgtaat tgagaaaatg aacactcaat tcacagcagt gggcaaagag 1320 ttcaacaaat tggaaagaag gatggaaaac ttgaataaaa aagttgatga tgggtttata 1380 gacatttgga catataatgc agaactgttg gttctactgg aaaatgaaag gactttggat 1440 ttccatgact ccaatgtgaa gaatctgtat gagaaagtaa aaagccagtt aaagaataat 1500 gctaaagaaa taggaaatgg gtgttttgag ttctatcaca agtgtaacga tgaatgcatg 1560 agagtgtaa agaatggaac ttatgactat ccaaaatatt ccgaagaatc aaagttaaac 1620 agggagaaaa ttgatggagt gaaattggaa tcaatgggag tctatcagat tctggcgatc 1680 tactcaacag tcgccagttc tctggttctt ttggtctccc tgggggcaat cagcttctgg 1740 atgtgttcca atgggtcttt acagtgtaga atatgcatct aagagctc 1788

<210>61 <211> 3185 <212> DMA <213> Artificial Sequence <220> <223> Synthesized 774 expression cassette from Hindi II <400> 61 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 aacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttgacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 780 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc acgcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaac acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tgaaagtaaa actactggtc ctgttatgca catttacagc 1080 tacatatgca gacacaatat gtataggcta ccatgctaac aactcgaccg acactgttga 1140 cacagtactt gaaaagaatg tgacagtgac acactctgtc aacctgcttg agaacagtca 1200 caatggaaaa ctatgtctat taaaaggaat agccccacta caattgggta attgcagcgt 1260 tgccgggtgg atcttaggaa acccagaatg cgaattactg atttccaagg agtcatggtc 1320 ctacattgta gaaaaaccaa atcctgagaa tggaacatgt tacccagggc atttcgctga 1380 ctatgaggaa ctgagggagc aattgagttc agtatcttca tttgagaggt tcgaaatatt 1440 ccccaaagaa agctcatggc ccaaccacac cgtaaccgga gtgtcagcat catgetceca 1500 taatggggaa agcagttttt acagaaattt gctatggctg acggggaaga atggtttgta 1560 cccaaacctg agcaagtcct atgcaaacaa caaagaaaaa gaagtccttg tactatgggg 1620 tgttcatcac ccgccaaaca taggtgacca aaaggccctc tatcatacag aaaatgctta 1680 tgtctctgta gtgtcttcac attatagcag aaaattcacc ccagaaatag ccaaaagacc 1740 caaagtaaga gatcaagaag gaagaatcaa ttactactgg actctgcttg aacccgggga 1800 tacaataata tttgaggcaa atggaaatct aatagcgcca agatatgctt tcgcactgag 1860 tagaggcttt ggatcaggaa tcatcaactc aaatgcacca atggataaat gtgatgcgaa 1920 gtgccaaaca cctcagggag ctataaacag cagtcttcct ttccagaacg tacacccagt 1980 cacaatagga gagtgtccaa agtatgtcag gagtgcaaaa ttaaggatgg ttacaggact 2040 aaggaacatc ccatccattc aatccagagg tttgtttgga gccattgccg gtttcattga 2100 aggggggtgg actggaatgg tagatggttg gtatggttat catcatcaga atgagcaagg 2160 atctggctat gctgcagatc aaaaaagcac acaaaatgcc attaatggga ttacaaacaa 2220 ggtcaattct gtaattgaga aaatgaacac tcaattcaca gcagtgggca aagagttcaa 2280 caaattggaa agaaggatgg aaaacttgaa taaaaaagtt gatgatgggt ttatagacat 2340 ttggacatat aatgcagaac tgttggttct actggaaaat gaaaggactt tggatttcca 2400 tgactccaat gtgaagaatc tgtatgagaa agtaaaaagc cagttaaaga ataatgctaa 2460 agaaatagga aatgggtgtt ttgagttcta tcacaagtgt aacgatgaat gcatggagag 2520 tgtaaagaat ggaacttatg actatccaaa atattccgaa gaatcaaagt taaacaggga 2580 gaaaattgat ggagtgaaat tggaatcaat gggagtctat cagattctgg cgatctactc 2640 aacagtcgcc agttctctgg ttcttttggt ctccctgggg gcaatcagct tctggatgtg 2700 ttccaatggg tctttacagt gtagaatatg catctaagag ctctaagtta aaatgcttct 2760 tcqtctccta tttataatat ggtttqttat tgttaatttt gttcttgtag aagagcttaa 2820 ttaatcgttg ttgttatgaa atactatttg tatgagatga actggtgtaa tgtaattcat 2880 ttacataagt ggagtcagaa tcagaatgtt tcctccataa ctaactagac atgaagacct 2940 gccgcgtaca attgtcttat atttgaacaa ctaaaattga acatcttttg ccacaacttt 3000 ataagtggtt aatatagctc aaatatatgg tcaagttcaa tagattaata atggaaatat 3060 cagttatcqa aattcattaa caatcaactt aacgttatta actactaatt ttatatcatc 3120 ccctttgata aatgatagta caccaattag gaaggagcat gctcgaggcc tggctggccg aattc 55

<210> 62 <211> 2065 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Expression cassette number 828, from Pad to Asel <400> 62 3180 3185 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 ataaaggaaa cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cccaaatttg tcgggcccat ggttttcaca cctcagatac ttggacttat gcttttttgg 900 atttcagcct ccagaggtga tattgtgcta actcagtctc cagccaccct gtctgtgact 960 ccaggagata gtgtcagtct ttcctgcagg gccagccaaa gtattagcaa caacctacac 1020 tggtttcaac aaaaatcgca tgagtctcca aggcttctca tcaagtatgc ttcccagtcc 1080 atatctggga tcccctccag gttcagtggc agtggatctg ggacagattt cactctcagt 1140 atcaacagtg tgaagactga agattttgga atgtttttct gtcaacagag taacagctgg 1200 cctctcacgt tcggtgatgg gacaaagctg gagctgaaac gggctgatgc tgcaccaact 1260 gtatccatct tcccaccatc cagtgagcag ttaacatctg gaggtgcctc agtcgtgtgc 1320 ttcttgaaca acttctaccc caaagacatc aatgtcaagt ggaagattga tggcagtgaa 1380 cgacaaaatg gcgtcctgaa cagttggact gatcaggaca gcaaagacag cacctacagc 1440 atgagcagca ccctcacgtt gaccaaggac gagtatgaac gacataacag ctatacctgt 1500 gaggccactc acaagacatc aacttcaccc attgtcaaga gcttcaacag gaatgagtgt 1560 tagaggccta ttttctttag tttgaattta ctgttattcg gtgtgcattt ctatgtttgg 1620 tgagcggttt tctgtgctca gagtgtgttt attttatgta atttaatttc tttgtgagct 1680 cctgtttagc aggtcgtccc ttcagcaagg acacaaaaag attttaattt tattaaaaaa 1740 aaaaaaaaaa aagaccggga attcgatatc aagcttatcg acctgcagat cgttcaaaca 1800 tttggcaata aagtttctta agattgaatc ctgttgccgg tcttgcgatg attatcatat 1860 aatttctgtt gaattacgtt aagcatgtaa taattaacat gtaatgcatg acgttattta 1920 tgagatgggt ttttatgatt agagtcccgc aattatacat ttaatacgcg atagaaaaca 1980 aaatatagcg cgcaaactag gataaattat cgcgcgcggt gtcatctatg ttactagatt 2040 ctagagtctc aagcttcggc gcgcc 2065

<210> 63 <211>3194 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Construct number 690, from Hindi·· to EcoRI <400> 63 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 aacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttgacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 780 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc acgcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaac acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tggagaaaat agtgcttctt cttgcaatag tcagtcttgt 1080 taaaagtgat cagatttgca ttggttacca tgcaaacaat tcaacagagc aggttgacac 1140 aatcatggaa aagaacgtta ctgttacaca tgcccaagac atactggaaa agacacacaa 1200 cgggaagctc tgcgatctag atggagtgaa gcctctaatt ttaagagatt gtagtgtagc 1260 tggatggctc ctcgggaacc caatgtgtga cgaattcatc aatgtaccgg aatggtctta 1320 catagtggag aaggccaatc caaccaatga cctctgttac ccagggcatt tcgctgacta 1380 tgaggaactg agggagcaat tgagttcagt atctt:cattt gagaggttcg aaatattccc 1440 caaagaaagc tcatggccca accacaccgt aaccggagtg tcagcatcat gctcccataa 1500 tggggaaagc agtttttaca gaaatttgct atggctgacg gggaagaatg gtttgtaccc 1560 aaacctgagc aagtcctatg caaacaacaa agaaaaagaa gtccttgtac tatggggtgt 1620 tcatcacccg ccaaacatag gtgaccaaaa ggccctctat catacagaaa atgcttatgt 1680 ctctgtagtg tcttcacatt atagcagaaa attcacccca gaaatagcca aaagacccaa 1740 agtaagagat caagaaggaa gaatcaatta ctactggact ctgcttgaac ccggggatac 1800 aataatattt gaggcaaatg gaaatctaat agcgccaaga tatgctttcg cactgagtag 1860 aggctttgga tcaggaatta tgaaaagtga attggaatat ggtaactgca acaccaagtg 1920 tcaaactcca atgggggcga taaactctag tatgccattc cacaacatac accctctcac 1980 catcggggaa tgccccaaat atgtgaaatc aaacagatta gtccttgcaa cagggctcag 2040 aaatagccct caaagagaga gcagaagaaa aaagagagga ctatttggag ctatagcagg 2100 ttttatagag ggaggatggc agggaatggt agatggttgg tatgggtacc accatagcaa 2160 tgagcagggg agtgggtacg ctgcagacaa agaatccact caaaaggcaa tagatggagt 2220 caccaataag gtcaactcaa tcattgacaa aatgaacact cagtttgagg ccgttggaag 2280 ggaatttaat aacttagaaa ggagaataga gaatttaaac aagaagatgg aagacgggtt 2340 tctagatgtc tggacttata atgecgaact tctggttcte atggaaaatg agagaactct 2400 agactttcat gactcaaatg ttaagaacct ctacgacaag gtccgactac agcttaggga 2460 taatgcaaag gagctgggta acggttgttt cgagttctat cacaaatgtg ataatgaatg 2520 tatggaaagt a.taagaaacg gaacgtacaa ctatccgcag tattcagaag aagcaagatt 2590 aaaaa.gagag gaaataagtg gggtaaaatt ggaatcaata ggaacttacc aaatactgtc 2640 aatttattca acagtggcga gttccctagc actggcaatc atgatggctg gtctatcttt 2700 atggatgtgc tccaatggat cgttacaatg cagaatttgc atttaagagc tctaagttaa 2760 aatgcttctt cgtctcctat ttataatatg gtttgttatt gttaattttg ttcttgtaga 2820 agagcttaat taatcgttgt tgttatgaaa tactatttgt atgagatgaa ctggtgtaat 2880 gtaattcatt tacataagtg gagtcagaat cagaatgttt cctccataac taactagaca 2940 tgaagacctg ccgcgtacaa ttgtcttata tttgaacaac taaaattgaa catcttttgc 3000 cacaacttta taagtggtta atatagctca aatatatggt caagttcaat agattaataa 3060 tggaaatatc agttatcgaa attcattaac aatcaactta acgttattaa ctactaattt 3120 tatatcatcc cctttgataa atgatagtac accaattagg aaggagcatg ctcgaggcct 3180 ggctggccga attc 3194

<210> 64 <211>3194 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Construct number 691, from Hindlll to EcoRI <400> 64 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 aacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttgacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 780 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc acgcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaac acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tggagaaaat agtgcttctt cttgcaatag tcagtcttgt 1080 taaaagtgat cagatttgca ttggttacca tgcaaacaat tcaacagagc aggttgacac 1140 aatcatggaa aagaacgtta ctgttacaca tgcccaagac atactggaaa agacacacaa 1200 cgggaagci:c tgcctattaa aaggaatagc cccactacaa ttgggtaatt gcagcgttgc 1260 cgggtggatc ttaggaaacc cagaatgcga attactgatt tccaaggagt catggtccta 1320 cattgtagaa aaaccaaatc ctgagaatgg aacatgttac ccagggcatt tcgctgacta 1380 tgaggaactg agggagcaat tgagttcagt atcttcattt gagaggttcg aaatattccc 1440 caaagaaagc tcatggccca accacaccgt aaccggagtg tcagcatcat gctcccataa 1500 tggggaaagc agtttttaca gaaatttgct atggctgacg gggaagaatg gtttgtaccc 1560 aaacctgagc aagtcctatg caaacaacaa agaaaaagaagtccttgtac tatggggtgt 1620 tcatcacccg ccaaacatag gtgaccaaaa ggccctctat catacagaaa atgcttatgt 1680 ctctgtagtg tcttcacatt atagcagaaa attcacccca gaaatagcca aaagacccaa 1740 agtaagagat caagaaggaa gaatcaatta ctactggact ctgcttgaac ccggggatac 1800 aataatattt gaggcaaatg gaaatctaat agcgccaaga tatgctttcg cactgagtag 1860 aggctttgga tcaggaatca tcaactcaaa tgcaccaatg gataaatgca acaccaagtg 1920 tcaaactcca atgggggcga taaactctag tatgccattc cacaacatac accctctcac 1980 cu.tcggggaa tgccccaaat atgtgaaatc aaacagatta gtccttgcaa cagggctcag 2040 aaatagccct caaagagaga gcagaagaaa aaagagagga ctatttggag ctatagcagg 2100 ttttatagag ggaggatggc agggaatggt agatggttgg tatgggtacc accatagcaa 2160 tgagcagggg agtgggtacg ctgcagacaa agaatccact caaaaggcaa tagatggagt 2220 caccaataag gtcaactcaa tcattgacaa aatgaacact cagtttgagg ccgttggaag 2280 ggaatttaat aacttagaaa ggagaataga gaatttaaac aagaagatgg aagacgggtt 2340 tctagatgtc tggacttata atgccgaact tctggttctc atggaaaatg agagaactct 2400 agactttcat gactcaaatg ttaagaacct ctacgacaag gtccgactac agcttaggga 2460 taatgcaaag gagctgggta acggttgttt cgagttctat cacaaatgtg ataatgaatg 2520 tatggaaagt ataagaaacg gaacgtacaa ctatccgcag tattcagaag aagcaagatt 2580 aaaaagagag gaaataagtg gggtaaaatt ggaatcaata ggaacttacc aaatactgtc 2640 aatttattca acagtggcga gttccctagc actggcaatcatgatggctg gtctatcttt 2700 atggatgtgc tccaatggat cgttacaatg cagaatttgc atttaagagc tctaagttaa 2760 aatgcttctt cgtctcctat ttataatatg gtttgttatt gttaattttg ttcttgtaga 282 0 agagcttaat taatcgttgt tgttatgaaa tactatttgt atgaqatgaa ctggtgtaat 2880 gtaattcatt tacataagtg gagtcagaat cagaatgttt cctccataac taactagaca 2940 tgaagacctg ccgcgtacaa ttgtcttata tttgaacaac taaaattgaa catcttttgc 3000 cacaacttta taagtggtta atatagctca aatatatggt caagttcaat agattaataa 3060 tggaaatatc agttatcgaa attcattaac aatcaactta acgttattaa ctactaattt 3120 tatatcatcc cctttgataa atgatagtac accaattagg aaggagcatg ctcgaggcct 3180 ggctggccga attc 3194

<21065 <211>3206 <212> DNA <213> Artificial Sequence <220 <223> Synthesized Construct number 696, from Hlndlll to EcoRI <400 65 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 aacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttgacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 780 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc acgcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaac acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tggcgaaaaa cgttgcgatt ttcggcttat tgttttctct 1080 tcttgtgttg gttccttctc agatcttcgc tgacacaata tgtataggct accatgccaa 1140 caactcaacc gacactgttg acacagtact tgagaagaat gtgacagtga cacactctgt 1200 caacctactt gaggacagtc acaatggaaa actatgtcta ctaaaaggaa tagccccact 1260 acaattgggt aattgcagcg ttgccggatg gatcttagga aacccagaat gcgaattact 1320 gatttccaag gaatcatggt cctacattgt agaaacacca aatcctgaga atggaacatg 1380 ttacccaggg agtttcaacg actatgaaga actgaaacac ctattgagca gaataaacca 1440 ttttgagaaa attcaaatca tccccaaaag ttcttggtcc gatcatgaag cctcatcagg 1500 agttagctca gcatgtccat acctgggaag tccctccttt tttagaaatg tggtatggct 1560 tatcaaaaag aacagtacat acccaacaat aaagaaaagc tacaataata ccaaccaaga 1620 ggatcttttg gtactgtgqg gaattcacca tcctaatgat gcggcaqagc agacaaggct 1680 atatcaaaac ccaaccacct atatttccat tgggacatca acactaaacc agagattggt 1740 accaaaaata gctactagat ccaaagtaaa cgggcaaagt ggaaggatgg agttcttctg 1800 gacaatttta aaacctaatg atgcaatcaa cttcgagagt aatggaaatt tcattgctcc 1860 agaatatgca tacaaaattg tcaagaaagg ggactcagca atcatcacct caaatgcacc 1920 aatggatgaa tgtgatgcga agtgtcaaac acctcaggga gctataaaca gcagtcttcc 1980 tttccagaat gtacacccag tcacaatagg agagtgtcca aagtatgtca ggagtgcaaa 2040 attaaggatg gttacaggac taaggaacat cccatccatt caatccagag gtttgtttgg 2100 agccattgcc ggtttcattg aaggggggtg gactggaatg gtagatgggt ggtatggtta 2160 tcatcatcag aatgagcaag gatctggcta tgctgcagat caaaaaagta cacaaaatgc 2220 cattaacggg attacaaaca aggtcaattc tgtaattgag aaaatgaaca ctcaattcac 2280 agctgtgggc aaagagttca acaaattgga aagaaggatg gaaaacttaa ataaaaaagt 2340 tgatgatggg tttctagaca tttggacata taatgcagaa ttgttggttc tactggaaaa 2400 tgaaaggact ttggatttcc atqactccaa tgtgaagaat ctgtatgaga aagtaaaaag 2460 ccaattaaag aataatgcca aagaaatagg aaacgggtgt tttgagttct atcacaagtg 2520 taacaatgaa tgcatggaga gtgtgaaaaa tggtacctat gactatccaa aatattccga 2580 agaatcaaag ttaaacaggg agaaaattga tggagtgaaa ttggaatcaa tgggagtata 2640 ccagattctg gcgatctact caactgtcgc cagttccctg gttcttttgg tctccctggg 2700 ggcaatcagc ttctggatgt gttccaatgg gtctttgcag tgtagaatat gcatctaaga 2760 gctctaagtt aaaatgcttc ttcgtctcct atttataata tggtttgtta ttgttaattt 2820 tgttcttgta gaagagctta attaatcgtt gttgttatga aatactattt gtatgagatg 2880 aactggtgta atgtaattca tttacataag tggagtcaga atcagaatgt ttcctccata 2940 actaactaga catgaagacc tgccgcgtac aattgtctta tatttgaaca actaaaattg 3000 aacatctttt gccacaactt tataagtggt taatatagct caaatatatg gtcaagttca 3060 atagattaat aatggaaata tcagttatcg aaattcatta acaatcaact taacgttatt 3120 aactactaat tttatatcat cccctttgat aaatgatagt acaccaatta ggaaggagca 3180 OO/li tgctcgaggc ctggctggcc gaattc

<210> 66 <211>3058 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Construct 732, from Paci to Asel <400> 66 aattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttacaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cccaaatttg tcgggcccat gaaagtaaaa ctactggtcc tgttatgcac atttacagct 900 acatatgcag acacaatatg tataggctac catgctaaca actcgaccga cactgttgac 960 acagtacttg aaaagaatgt gacagtgaca cactctgtca acctgcttga gaacagtcac 1020 aatggaaaac tatgtctatt aaaaggaata gccccactac aattgggtaa ttgcagcgtt 1080 gccgggtgga tcttaggaaa cccagaatgc gaattactga tttccaagga gtcatggtcc 1140 tacattgtag aaaaaccaaa tcctgagaat ggaacatgtt acccagggca tttcgctgac 1200 tatgaggaac tgagggagca attgagttca gtatcttcat ttgagaggtt cgaaatattc 1260 cccaaagaaa gctcatggcc caaccacacc gtaaccggag tgtcagcatc atgctcccat 1320 aatggggaaa gcagttttta cagaaatttg ctatggctga cggggaagaa tggtttgtac 1380 ccaaacctga gcaagtccta tgcaaacaac aaagaaaaag aagtccttgt actatggggt 1440 gttcatcacc cgccaaacat aggtgaccaa aaggccctct atcatacaga aaatgcttat 1500 gtctctgtag tgtcttcaca ttatagcaga aaattcaccc cagaaatagc caaaagaccc 1560 aaagtaagag atcaagaagg aagaatcaat tactactgga ctctgcttga acccggggat 1620 acaataatat ttgaggcaaa tggaaatcta atagcgccaa gatatgcttt cgcactgagt 1680 agaggctttg gatcaggaat catcaactca aatgcaccaa tggataaatg tgatgcgaag 1740 tgccaaacac ctcagggagc tataaacagc agtcttcctt tccagaacgt acacccagtc 1800 acaataggag agtgtccaaa gtatgtcagg agtgcaaaat taaggatggt tacaggacta 1860 aggaacatcc catccattca atccagaggt ttgtttggag ccattgccgg tttcattgaa 1920 ggggçfÇftgga ctggaatggt agatggttgg tatggttatc atcatcagaa tgagcaagga 1980 tctggctatg ctgcagatca aaaaagcaca caaaatgcca ttaatgggat tacaaacaag 2040 gtcaattctg taattgagaa aatgaacact caattcacag cagtgggcaa agagttcaac 2100 aaattggaaa gaaggatgga aaacttgaat aaaaaagttg atgatgggtt tatagacatt 2160 tggacatata atgcagaact gttggttcta ctggaaaatg aaaggacttt ggatttccat 2220 gactccaatg tgaagaatct gtatgagaaa gtaaaaagcc agttaaagaa taatgctaaa 2280 gaaataggaa atgggtgttt tgagttctat cacaagtgta acgatgaatg catggagagt 2340 gtaaagaatg gaacttatga ctatccaaaa tattccgaag aatcaaagtt aaacagggag 2400 aaaattgatg gagtgaaatt ggaatcaatg ggagtctatc agattctggc gatctactca 2460 acagtcgcca gttctctggt tcttttggtc tccctggggg caatcagctt ctggatgtgt 2520 tccaatgggt ctttacagtg tagaatatgc atctaaaggc ctattttctt tagtttgaat 2580 ttactgttat tcggtgtgca tttctatgtt tggtgagcgg ttttctgtgc tcagagtgtg 2640 tttattttat gtaatttaat ttctttgtga gctcctgttt agcaggtegt cccttcagca 2700 aggacacaaa aagattttaa ttttattaaa aaaaaaaaaa aaaaagaccg ggaattcgat 2760 atcaagctta tcgacctgca gatcgttcaa acatttggca ataaagtttc ttaagattga 2820 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 2880 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 2940 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 3000 tatcgcgcgc ggtgtcatct atgttactag attctagagt ctcaagcttc ggcgcgcc 3058

<210» S7 <211> 1719 <212> DNA <213> Artificial Sequence <220> <223> Synthesized construct number 787 <400> 67 atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60 cagatcttcg ctgacacaat atgtataggc taccatgcta acaactcgac cgacactgtt 120 gacacagtac ttgaaaagaa tgtgacagtg acacactctg tcaacctgct tgagaacagt 180 cacaatggaa aactatgtct attaaaagga atagccccac tacaattggg taattgcagc 240 gttgccgggt ggatcttagg aaacccagaa tgcgaattac tgatttccaa ggagtcatgg 300 tcctacattg tagaaaaacc aaatcctgag aatggaacat gttacccagg gcatttcgct 360 gactatgagg aactgaggga gcaattgagt tcagtatctt catttgagag gttcgaaata 420 ttccccaaag aaagctcatg gcccaaccac accgtaaccg gagtgtcagc atcatgctcc 480 cataatgggg aaagcagttt ttacagaaat ttgctatggc tgacggggaa gaatggtttg 540 tacccaaacc tgagcaagtc ctatgcaaac aacaaagaaa aagaagtcct tgtactatgg 600 ggtgttcatc acccgccaaa cataggtgac caaaaggccc tctatcatac agaaaatgct 660 tatgtctctg tagtgtcttc acattatagc agaaaattca ccccagaaat agccaaaaga 720 cccaaagtaa gagatcaaga aggaagaatc aattactact ggactctgct tgaacccggg 780 gatacaataa tatttgaggc aaatggaaat ctaatagcgc caagatatgc tttcgcactg 840 agtagaggct ttggatcagg aatcatcaac tcaaatgcac caatggataa atgtgatgcg 900 aagtgccaaa cacctcaggg agctataaac agcagtcttc ctttccagaa cgtacaccca 960 gtcacaatag gagagtgtcc aaagtatgtc aggagtgcaa aattaaggat ggttacagga 1020 ctaaggaaca tcccatccat tcaatccaga ggtttgtttg gagccattgc cggtttcatt 1080 gaaggggggt ggactggaat ggtagatggt tggtatggtt atcatcatca gaatgagcaa 1140 ggatctggct atgctgcaga tcaaaaaagc acacaaaatg ccattaatgg gattacaaac 1200 aaggtcaatt ctgtaattga gaaaatgaac actcaattca cagcagtggg caaagagttc 1260 aacaaattgg aaagaaggat ggaaaacttg aataaaaaag ttgatgatgg gtttatagac 1320 atttggacat ataatgcaga actgttggtt ctactggaaa atgaaaggac tttggatttc 1380 catgactcca atgtgaagaa tctgtatgag aaagtaaaaa gccagttaaa gaataatgct 1440 aaagaaatag gaaatgggtg ttttgagttc tatcacaagt gtaacgatga atgcatggag 1500 agtgtaaaga atggaactta tgactatcca aaatattccg aagaatcaaa gttaaacagg 1560 gagaaaattg atggagtgaa attggaatca atgggagtct atcagattct ggcgatctac 1620 tcaacagtcg ccagttctct ggttcttttg gtctccctgg gggcaatcag cttctggatg 1680 tgttccaatg ggtctttaca gtgtagaata tgcatctaa 1719

<210> 68 <211> 3079 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Construct number 73% from Pad to Asel <400> 68 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cccaaatttg tcgggcccat ggcgaaaaac gttgcgattt tcggcttatt gttttctctt 900 cttgtgttgg ttccttctca gatcttcgct gacacaatat gtataggcta ccatgctaac 960 aactcgaccg acactgttga cacagtactt gaaaagaatg tgacagtgac acactctgtc 1020 aacctgcttg agaacagtca caatggaaaa ctatgtctat taaaaggaat agccccacta 1080 caattgggta attgcagcgt tgccgggtgg atcttaggaa acccagaatg cgaattactg 1140 atttccaagg agtcatggtc ctacattgta gaaaaaccaa atcctgagaa tggaacatgt 1200 tacccagggc atttcgctga ctatgaggaa ctgagggagc aattgagttc agtatcttca 1260 tttgagaggt tcgaaatatt ccccaaagaa agctcatggc ccaaccacac cgtaaccgga 1320 gtgtcagcat catgetceca taatggggaa agcagttttt acagaaattt gctatggctg 13Θ0 acggggaaga atggtttgta cccaaacctg agcaagtcct atgcaaacaa caaagaaaaa 1440 gaagtccttg tactatgggg tgttcatcac ccgccaaaca taggtgacca aaaggccctc 1500 164 tatcatacag aaaatgctta tgtctctgta gtgtcttcac attatagcag aaaattcacc 1560 ccagaaatag ccaaaagacc caaagtaaga gatcaagaag gaagaatcaa ttactactgg 1620 tttgaggcaa atggaaatct aatagcgcca 1680 actctgcttg aacccgggga tacaataata agatatgctt tcgcactgag tagaggcttt ggatcaggaa tcatcaactc aaatgcacca 1740 atggataaat gtgatgcgaa gtgccaaaca cctcagggag ctataaacag cagtcttcct 1800 ttccagaacg tacacccagt cacaatagga gagtgtccaa agtatgtcag gagtgcaaaa 1860 ttaaggatgg ttacaggact aaggaacatc ccatccattc aatccagagg tttgtttgga 1920 gccattgccg gtttcattga aggggggtgg actggaatgg tagatggttg gtatggttat 1980 catcatcaga atgagcaagg atctggctat gctgcagatc aaaaaagcac acaaaatgcc 2040 attaatggga ttacaaacaa ggtcaattct gtaattgaga aaatgaacac tcaattcaca 2100 gcagtgggca aagagttcaa caaattggaa agaaggatgg aaaacttgaa taaaaaagtt 2160 gatgatgggt ttatagacat ttggacatat aatgcagaac tgttggttct actggaaaat 2220 gaaaggactt tggatttcca tgactccaat gtgaagaatc tgtatgagaa agtaaaaagc 2280 cagttaaaga ataatgctaa agaaatagga aatgggtgtt ttgagttcta tcacaagtgt 2340 aacgatgaat gcatggagag tgtaaagaat ggaacttatg actatccaaa atattccgaa 2400 gaatcaaagt taaacaggga gaaaattgat ggagtgaaat tggaatcaat gggagtctat 2460 cagattctgg cgatctactc aacagtcgcc agttctctgg ttcttttggt ctccctgggg 2520 gcaatcagct tctggatgtg ttccaatggg tctttacagt gtagaatatg catctaaagg 2580 cctattttct ttagtttgaa tttactgtta ttcggtgtgc atttctatgt ttggtgagcg 2640 gttttctgtg ctcagagtgt gtttatttta tgtaatttaa tttctttgtg agctcctgtt 2700 tagcaggtcg tcccttcagc aaggacacaa aaagatttta attttattaa aaaaaaaaaa 2760 aaaaaagacc gggaattcga tatcaagctt atcgacctgc agatcgttca aacatttggc 2820 aataaagttt cttaagattg aatcctgttg ccggtcttgc gatgattatc atataatttc 2880 tgttgaatta cgttaagcat gtaataatta acatgtaatg catgacgtta tttatgagat 2940 gggtttttat gattagagtc ccgcaattat acatttaata cgcgatagaa aacaaaatat 3000 agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta gattctagag 3060 tctcaagctt cggcgcgcc 3079

<210> 69 <211>3067 <212> DNA <21S> Artificial Sequence 166 <220> <223> Synthesized Construct 734, from Paci to Asel <400> 69 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cccaaatttg tcgggcccat ggagaaaata gtgcttcttc ttgcaatagt cagtcttgtt 900 aaaagtgatc agatttgcat tggttaccat gcaaacaatt caacagagca ggttgacaca 960 atcatggaaa agaacgttac tgttacacat gcccaagaca tactggaaaa gacacacaac 1020 gggaagctct gcgatctaga tggagtgaag cctctaattt taagagattg tagtgtagct 1080 ggatggctcc tcgggaaccc aatgtgtgac gaattcatca atgtaccgga atggtcttac 1140 atagtggaga aggccaatcc aaccaatgac ctctgttacc cagggcattt cgctgactat 1200 gaggaactga gggagcaatt gagttcagta tcttcatttg agaggttcga aatattcccc 1260 aaagaaagct catggcccaa ccacaccgta accggagtgt cagcatcatg ctcccataat 1320 ggggaaagca gtttttacag aaatttgcta tggctgacgg ggaagaatgg tttgtaccca 1380 aacctgagca agtcctatgc aaacaacaaa gaaaaagaag tccttgtact atggggtgtt 1440 catcacccgc caaacatagg tgaccaaaag gccctctatc atacagaaaa tgcttatgtc 1500 tctgtagtgt cttcacatta tagcagaaaa ttcaccccag aaatagccaa aagacccaaa 1560 gtaagaqatc aagaaggaag aatcaattac tactggactc tgcttgaacc cggggataca 1620 ataatatttg aggcaaatgg aaatctaata gcgccaagat atgctttcgc actgagtaga 1680 ggctttggat caggaattat gaaaagtgaa ttggaatatg gtaactgcaa caccaagtgt 1740 caaactccaa tgggggcgat aaactctagt atgccattcc acaacataca ccctctcacc 1800 atcggggaat gccccaaata tgtgaaatca aacagattag tccttgcaac agggctcaga 1860 aatagccctc aaagagagag cagaagaaaa aagagaggac tatttggagc tatagcaggt 1920 tttatagagg gaggatggca gggaatggta gatggttggt atgggtacca ccatagcaat 1980 gagcagggga gtgggtacgc tgcagacaaa gaatccactc aaaaggcaat agatggagtc 2040 accaataagg tcaactcaat cattgacaaa atgaacactc agtttgaggc cgttggaagg 2100 gaatttaata acttagaaag gagaatagag aatttaaaca agaagatgga agacgggttt 2160 ctagatgtct ggacttataa tgccgaactt ctggttctca tggaaaatga gagaactcta 2220 gactttcatg actcaaatgt taagaacctc tacgacaagg tccgactaca gcttagggat 2280 aatgcaaagg agctgggtaa cggttgtttc gagttctatc acaaatgtga taatgaatgt 2340 atggaaagta taagaaacgg aacgtacaac tatccgcagt attcagaaga agcaagatta 2400 aaaagagagg aaataagtgg ggtaaaattg gaatcaatag gaacttacca aatactgtca 2460 atttattcaa cagtggcgag ttccctagca ctggcaatca tgatggctgg tctatcttta 2520 tggatgtgct ccaatggatc gttacaatgc agaatttgca tttaaaggcc tattttcttt 2580 agtttgaatt tactgttatt cggtgtgcat ttctatgttt ggtgagcggt tttctgtgct 2640 cagagtgtgt ttattttatg taatttaatt tctttgtgag ctcctgttta gcaggtcgtc 2700 ccttcagcaa ggacacaaaa agattttaat tttattaaaa aaaaaaaaaa aaaagaccgg 2760 gaattcgata tcaagcttat cgacctgcag atcgttcaaa catttggcaa taaagtttct 2820 taagattgaa tcctgttgcc ggtcttgcga tgattatcat ataatttctg ttgaattacg 2880 ttaagcatgt aataattaac atgtaatgca tgacgttatt tatgagatgg gtttttatga 2940 ttagagtccc gcaattatac atttaatacg cgatagaaaa caaaatatag cgcgcaaact 3000 aggataaatt atcgcgcgcg gtgtcatcta tgttactaga ttctagagtc tcaagcttcg 3060 gcgcgcc 3067

<210> 70 <211> 1791 <212> DNA <213> Artificial Sequence <220> <223> Synthesized fragment Oral ll-Plasto(-84+ l)-H3A/Brisbane/10/07-Sacl <400>70 cactttgtga gtctacactt tgattccctt caaacacata caaagagaag agactaatta 60 attaattaat catcttgaga gaaaatgaag actatcattg ctttgagcta cattctatgt 120 ctggttttca ctcaaaaact tcccggaaat gacaacagca cggcaacgct gtgccttggg 180 171 caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgacca aattgaagtt 240 actaatgcta ctgagctggt tcagagttcc tcaacaggtg aaatatgcga cagtcctcat 300 cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 360 gatggcttcc aaaataagaa atgggacctt tttgttgaac gcagcaaagc ctacagcaac 420 tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 480 acactggagt ttaacaatga aagtttcaat tggactggag tcactcaaaa cggaacaagc 540 tctgcttgca taaggagatc taataacagt ttctttagta gattgaattg gttgacccac 600 ttaaaattca aatacccagc attgaacgtg actatgccaa acaatgaaaa atttgacaaa 660 ttgtacattt ggggggttca ccacccgggt acggacaatg accaaatctt cctgtatgct 720 caagcatcag gaagaatcac agtctctacc aaaagaagcc aacaaactgt aatcccgaat 780 atcggatcta gacccagagt aaggaatatc cccagcagaa taagcatcta ttggacaata 840 gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 900 tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 960 tgcaattctg aatgcatcac tccaaacgga agcattccca atgacaaacc attccaaaat 1020 gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaaacac tctgaaattg 1080 gcaacaggga tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaatcgcg 1140 ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtatggttt caggcatcaa 1200 aattctgagg gaataggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1260 atcaatggga agctgaatag gttgatcggg aaaaccaacg agaaattcca tcagattgaa 1320 aaagagttct cagaagtcga agggagaatc caggaccttg agaaatatgt tgaggacacc 1380 aaaatagatc tctggtcata caacgcggag cttcttgttg cectggagaa ccaacataca 1440 attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1500 gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1560 tgcataggat caatcagaaa tggaacttat gaccacgatg tatacagaga tgaagcatta 1620 aacaaccggt tccagatcaa gggcgttgag ctgaagtcag gatacaaaga ttggatacta 1680 tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1740 tgggcctgcc aaaaaggcaa cattaggtgc aacatttgca tttgagagct c 1791

<210> 71 <211> 3085 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Construct 736, from Paci to Asel <400> 71

I

I

I

I ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cccaaatttg tcgggcccat ggcgaaaaac gttgcgattt tcggcttatt gttttctctt 900 cttgtgttgg ttccttctca gatcttcgct caaaaacttc ccggaaatga caacagcacg 960 gcaacgctgt gccttgggca ccatgcagta ccaaacggaa cgatagtgaa aacaatcacg 1020 aatgaccaaa ttgaagttac taatgctact gagctggttc agagttcctc aacaggtgaa 1080 atatgcgaca gtcctcatca gatccttgat ggagaaaact gcacactaat agatgctcta 1140 ttgggagacc ctcagtgtga tggcttccaa aataagaaat gggacctttt tgttgaacgc 1200 agcaaagcct acagcaactg ttacccttat gatgtgccgg attatgcctc ccttaggtca 1260 ctagttgcct catccggcac actggagttt aacaatgaaa gtttcaattg gactggagtc 1320 actcaaaacg gaacaagctc tgcttgcata aggagatcta ataacagttt ctttagtaga 13.80 ttgaattggt tgacccactt aaaattcaaa tacccagcat tgaacgtgac tatgccaaac 1440 aatgaaaaat ttgacaaatt gtacatttgg ggggttcacc acccgggtac ggacaatgac 1500 caaatcttcc tgtatgctca agcatcagga agaatcacag tctctaccaa aagaagccaa 1560 caaactgtaa tcccgaatat cggatctaga cccagagtaa ggaatatccc cagcagaata 1620 agcatctatt ggacaatagt aaaaccggga gacatacttt tgattaacag cacagggaat 1680 ctaattgctc ctaggggtta cttcaaaata cgaagtgggaaaagctcaat aatgagatca 1740 gatgcaccca ttggcaaatg caattctgaa tgcatcactc caaacggaag cattcccaat 1800 gacaaaccat tccaaaatgt aaacaggatc acatacgggg cctgtcccag atatgttaag 1860 caaaacactc tgaaattggc aacagggatg cgaaatgtac cagagaaaca aactagaggc 1920 1980 atatttggcg caatcgcggg tttcatagaa aatggttggg agggaatggt ggatggttgg tatggtttca ggcatcaaaa ttctgaggga ataggacaag cagcagatct caaaagcact 2040 caagcagcaa tcgatcaaat caatgggaag ctgaataggt tgatcgggaa aaccaacgag 2100 aaattccatc agattgaaaa agagttctca gaagtcgaag ggagaatcca ggaccttgag 2160 aaatatgttg aggacaccaa aatagatctc tggtcataca acgcggagct tcttgttgcc 2220 ctggagaacc aacatacaat tgatctaact gactcagaaa tgaacaaact gtttgaaaaa 2280 acaaagaagc aactgaggga aaatgctgag gatatgggca atggttgttt caaaatatac 2340 cacaaatgtg acaatgcctg cataggatca atcagaaatg gaacttatga ccacgatgta 2400 tacagagatg aagcattaaa caaccggttc cagatcaagg gcgttgagct gaagtcagga 2460 tacaaagatt ggatactatg gatttccttt gccatatcat gttttttgct ttgtgttgct 2520 ttgttggggt tcatcatgtg ggcctgccaa aaaggcaaca ttaggtgcaa catttgcatt 2580 tgaaggccta ttttctttag tttgaattta ctgttattcg gtgtgcattt ctatgtttgg 2640 tgagcggttt tctgtgctca gagtgtgttt attttatgta atttaatttc tttgtgagct 2700 cctgtttagc aggtcgtccc ttcagcaagg acacaaaaag attttaattt tattaaaaaa 2760 aaaaaaaaaa aagaccggga attcgatatc aagcttatcg acctgcagat cgttcaaaca 2820 tttggcaata aagtttctta agattgaatc ctgttgccgg tcttgcgatg attatcatat 2880 aatttctgtt gaattacgtt aagcatgtaa taattaacat gtaatgcatg acgttattta 2940 tgagatgggt ttttatgatt agagtcccgc aattatacat ttaatacgcg atagaaaaca 3000 aaatatagcg cgcaaactag gataaattat cgcgcgcggt gtcatctatg ttactagatt 3060 ctagagtctc aagcttcggc gcgcc 3085 <210> 72 <211> 3088

<212> DNA <213> Artificial Sequence <220> <223> Synthesized Construct 737, from Pad to Asel <400> 72 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cccaaatttg tcgggcccat ggcgaaaaac gttgcgattt tcggcttatt gttttctctt 900 cttgtgttgg ttccttctca gatcttcgct caaaaacttc ccggaaatga caacagcacg 960 gcaacgctgt gccttgggca ccatgcagta ccaaacggaa cgatagtgaa aacaatcacg 1020 aatgaccaaa ttgaagttac taatgctact gagctggttc agagttcctc aacaggtgaa 1080 atatgcgaca gtcctcatca gatccttgat ggagaaaact gcacactaat agatgctcta 1140 ttgggagacc ctcagtgtga tggcttccaa aataagaaat gggacctttt tgttgaacgc 1200 agcaaagcct acagcaactg ttacccttat gatgtgccgg attatgcctc ccttaggtca 1260 ctagttgcct catccggcac actggagttt aacaatgaaa gtttcaattg gactggagtc 1320 actcaaaacg gaacaagctc tgcttgcata aggagatcta ataacagttt ctttagtaga 1380 ttgaattggt tgacccactt aaaattcaaa tacccagcat tgaacgtgac tatgccaaac 1440 aatgaaaaat ttgacaaatt gtacatttgg ggggttcacc acccgggtac ggacaatgac 1500 caaatcttcc tgtatgctca agcatcagga agaatcacag tctctaccaa aagaagccaa 1560 caaactgtaa tcccgaatat cggatctaga cccagagtaa ggaatatccc cagcagaata 1620 agcatctatt ggacaatagt aaaaccggga gacatacttt tgattaacag cacagggaat 1680 ctaattgctc ctaggggtta cttcaaaata cgaagtggga aaagctcaat aatgagatca 1740 gatgcaccca ttggcaaatg caattctgaa tgcatcactc caaacggaag cattcccaat 1800 gacaaaccat tccaaaatgt aaacaggatc acatacgggg cctgtcccag atatgttaag 1860 caaaacactc tgaaattggc aacagggatg cgaaatgtac cagagaaaca aactagagqc 1920 atatttggcg caatcgcggg tttcatagaa aatggttggg agggaatggt ggatggttgg 1980 tatggtttca ggcatcaaaa ttctgaggga ataggacaag cagcagatct caaaagcact 2040 caagcagcaa tcgatcaaat caatgggaag ctgaataggt tgatcgggaa aaccaacgag 2100 aaattccatc agattgaaaa agagttctca gaagtcgaag ggagaatcca ggaccttgag 2160 aaatatgttg aggacaccaa aatagatctc tggtcataca acgcggagct tcttgttgcc 2220 ctggagaacc aacatacaat tgatctaact gactcagaaa tgaacaaact gtttgaaaaa 2280 acaaagaagc aactgaggga aaatgctgag gatatgggca atggttgttt caaaatatac 2340 cacaaatgtg acaatgcctg cataggatca atcagaaatg gaacttatga ccacgatgta 2400 tacagagatg aagcattaaa caaccggttc cagatcaagg gcgttgagct gaagtcaata 2460 ggaacttacc aaatactgtc aatttattca acagtggcga gttccctagc actggcaatc 2520 atgatggctg gtctatcttt atggatgtgc tccaatggat cgttacaatg cagaatttgc 2580 atttaaaggc ctattttctt tagtttgaat ttactgttat tcggtgtgca tttctatgtt 2640 tggtgagcgg ttttctgtgc tcagagtgtg tttattttat gtaatttaat ttctttgtga 2700 gctcctgttt agcaggtcgt cccttcagca aggacacaaa aagattttaa ttttattaaa 2760 aaaaaaaaaa aaaaagaccg ggaattcgat atcaagctta tcgacctgca gatcgttcaa 2820 acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg atgattatca 2880 tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc atgacgttat 2940 ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac gcgatagaaa 3000 acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag 3060 attctagagt ctcaagcttc ggcgcgcc 3088

<210> 73 <211> 1845 <212> DNA <213> Artificial Sequence <220> <223> Synthesized fragment Oral ll-P1asto{-84+ 1}-HA B/Florlda/4/06-Sad <400» 73 cactttgtga gtctacactt tgattccctt caaacacata caaagagaag agactaatta 60 attaattaat catcttgaga gaaaatgaag gcaataattg tactactcat ggtagtaaca 120 tccaatgcag atcgaatctg cactggaata acatcttcaa actcacctca tgtggtcaaa 180 acagccactc aaggggaggt caatgtgact ggtgtgatac cactaacaac aacaccaaca 240 aaatcttatt ttgcaaatct caaaggaaca aggaccagag ggaaactatg cccagactgt 300 ctcaactgca cagatctgga tgtggctttg ggcagaccaa tgtgtgtggg gaccacacct 360 tcggcgaagg cttcaatact ccacgaagtc aaacctgtta catccgggtg ctttcctata 420 atgcacgaca gaacaaaaat caggcaacta cccaatcttc tcagaggata tgaaaatatc 480 aggctatcaa cccaaaacgt catcgatgcg gaaaaggcac caggaggacc ctacagactt 540 ggaacctcag gatcttgccc taacgctacc agtaagagcg gatttttcgc aacaatggct 600 tgggctgtcc caaaggacaa caacaaaaat gcaacgaacc cactaacagt agaagtacca 660 tacatttgta cagaagggga agaccaaatc actgtttggg ggttccattc agataacaaa 720 acccaaatga agaacctcta tggagactca aatcctcaaa agttcacctc atctgctaat 780 ggagtaacca cacactatgt ttctcagatt ggcagcttcc cagatcaaac agaagacgga 840 ggactaccac aaagcggcag gattgttgtt gattacatga tgcaaaaacc tgggaaaaca 900 ggaacaattg tctaccaaag aggtgttttg ttgcctcaaa aggtgtggtg cgcgagtggc 960 aggagcaaag taataaaagg gtccttgcct ttaattggtg aagcagattg ccttcatgaa 1020 aaatacggtg gattaaacaa aagcaagcct tactacacag gagaacatgc aaaagccata 1080 ggaaattgcc caatatgggt gaaaacacct ttgaagctcg ccaatggaac caaatataga 1140 cctcctgcaa aactattaaa ggaaaggggt ttcttcggag ctattgctgg tttcctagaa 1200 ggaggatggg aaggaatgat tgcaggctgg cacggataca catctcacgg agcacatgga 1260 gtggcagtgg cggcggacct taagagtacg caagaagcta taaacaagat aacaaaaaat 1320 ctcaattctt tgagtgagct agaagtaaag aatcttcaaa gactaagtgg tgccatggat 1380 gaactccaca acgaaatact cgagctggat gagaaagtgg atgatctcag agctgacact 1440 ataagctcgc aaatagaact tgcagtcttg ctttccaacg aaggaataat aaacagtgaa 1500 gatgagcatc tattggcact tgagagaaaa ctaaagaaaa tgctgggtcc ctctgctgta 1560 gagataggaa atggatgctt cgaaaccaaa cacaagtgca accagacctg cttagacagg 1620 atagctgctg gcacctttaa tgcaggagaa ttttctctcc ccacttttga ttcactgaac 1680 attactgctg catctttaaa tgatgatgga ttggataacc atactatact gctctattac 1740 tcaactgctg cttctagttt ggctgtaaca ttgatgctag ctatttttat tgtttatatg 1800 gtctccagag acaacgtttc atgctccatc tgtctataag agctc 1845

<210> 74 <211>3142 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Construct 739, from Pad to Asel <400> 74 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgc:g gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg gg2aacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg tt2agcttct gtatattctg 840 cccaaatttg tcgggcccat ggcgaaaaac gttgcgattt tcggcttatt gttttctctt 900 cttgtgttgg ttccttctca gatcttcgct gatcgaatct gcactggaat aacatcttca 960 aactcacctc atgtggtcaa aacagccact caaggggagg tcaatgtgac tggtgtgata 1020 ccactaacaa caacaccaac aaaatcttat tttgcaaatc tcaaaggaac aaggaccaga 1080 gggaaactat gcccagactg tctcaactgc acagatctgg atgtggcttt gggcagacca 1140 atgtgtgtgg ggaccacacc ttcggcgaag gcttcaatac tccacgaagt caaacctgtt 1200 acatccgggt gctttcctat aatgcacgac agaacaaaaa tcaggcaact acccaatctt 1260 ctcagaggat atgaaaatat caggctatca acccaaaacg tcatcgatgc ggaaaaggca 1320 ccaggaggac cctacagact tggaacctca ggatcttgcc ctaacgctac cag-::aagagc 1380 ggatttttcg caacaatggc ttgggctgtc ccaaaggaca acaacaaaaa tgcaacgaac 1440 ccactaacag tagaagtacc atacatttgt acagaagggg aagaccaaat cactgtttgg 1500 gggttccatt cagataacaa aacccaaatg aagaaectct atggagactc aaatcctcaa 1560 aagttcacct catctgctaa tggagtaacc acacactatg tttctcagat tggcagcttc 1620 ccagatcaaa cagaagacgg aggactacca caaagcggca ggattgttgt tgattacatg 1680 atgcaaaaac ctgggaaaac aggaacaatt gtctaccaaa gaggtgtttt gttgcctcaa 1740 aaggtgtggt gcgcgagtgg caggagcaaa gtaataaaag ggtccttgcc tttaattggt 1800 gaagcagatt gccttcatga aaaatacggt ggattaaaca aaagcaagcc ttactacaca 1860 ggagaacatg caaaagccat aggaaattgc ccaatatggg tgaaaacacc tttgaagctc 1920 qccaatgqaa ccaaatatag acctcctgca aaactattaa aggaaagggg tttcttcgga 1980 gctattgctg gtttcc-::aga aggaggatgg gaaggaatga ttgcaggctg gcacggatac 2040 acatctcacg gagcacatgg agtggcagtg gcggcggacc ttaagagtac gcaagaagct 2100 ataaacaaga taacaaaaaa tctcaattct ttgagtgagc tagaagtaaa gaatcttcaa 2160 agactaagtg gtgccatgga tgaactccac aacgaaatac tcgagctgga tgagaaagtg 2220 gatgatctca gagctgacac tataagctcg caaatagaac ttgcagtctt gctttccaac 2280 gaaggaataa taaacagtga agatgagcat ctattggcac ttgagagaaa actaaagaaa 2340 atgctgggtc cctctgctgt agagatagga aatggatgct tcgaaaccaa acacaagtgc 2400 aaccagacct gcttagacag gatagctgct ggcaccttta atgcaggaga attttctctc 2460 cccacttttg attcactgaa cattactgct gcatctttaa atgatgatgg attggataac 2520 catactatac tgctctatta ctcaactgct gcttctagtt tggctgtaac attgatgcta 2580 gctattttta ttgtttatat ggtctccaga gacaacgttt catgctccat ctgtctataa 2640 aggcctattt tctttagttt gaatttactg ttattcggtg tgcatttcta tgtttggtga 2700 gcggttttct gtgctcagag tgtgtttatt ttatgtaatt taatttcttt gtgagctcct 2760 gtttagcagg tcgtcccttc agcaaggaca caaaaagatt ttaattttat taaaaaaaaa 2820 aaaaaaaaag accgggaatt cgatatcaag cttatcgacc tgcagatcgt tcaaacattt 2880 ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt atcatataat 2940 ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga 3000 gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata gaaaacaaaa 3060 tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagattcta 3120 gagtctcaag cttcggcgcg cc 3142

<210> 75 <211>3142 <212> DNA <213> Artificial Sequence <220> <223> Construct 745, from Peel to Asel <400> 75 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 84 0 cccaaatttg tcgggcccat ggcgaaaaac gttgcgattt tcggcttatt gttttctctt 900 cttgtgttgg ttccttctca gatcttcgct gatcgaatct gcactggaat aacatcttca 960 aactcacctc atgtggtcaa aacagccact caaggggagg tcaatgtgac tggtgtgata 1020 ccactaacaa caacaccaac aaaatcttat tttgcaaatc tcaaaggaac aaggaccaga 1080 gggaaactat gcccagactg tctcaactgc acagatctgg atgtggcttt gggcagacca 1140 atgtgtgtgg ggaccacacc ttcggcgaag gcttcaatac tccacgaagt caaacctgtt 1200 acatccgggt gctttcctat aatgcacgac agaacaaaaa tcaggcaact acccaatctt 1260 ctcagaggat atgaaaatat caggctatca acccaaaacg tcatcgatgc ggaaaaggca 1320 ccaggaggac cctacagact tggaacctca ggatcttgcc ctaacgctac cagtaagagc 1380 ggatttttcg caacaatggc ttgggctgtc ccaaaggaca acaacaaaaa tgcaacgaac 1440 ccactaacag tagaagtacc atacatttgt acagaagggg aagaccaaat cactgtttgg 1500 gggttccatt cagataacaa aacccaaatg aagaacctct atggagactc aaatcctcaa 1560 aagttcacct catctgctaa tggagtaacc acacactatg tttctcagat tggcagcttc 1620 ccagatcaaa cagaagacgg aggactacca caaagcggca ggattgttgt tgattacatg 1680 atgcaaaaac ctgggaaaac aggaacaatt gtctaccaaa gaggtgtttt gttgcctcaa 1740 aaggtgtggt gcgcgagtgg caggagcaaa gtaataaaag ggtccttgcc tttaattggt 1800 gaagcagatt gccttcatga aaaatacggt ggattaaaca aaagcaagcc ttactacaca 1860 ggagaacatg caaaagccat aggaaattgc ccaatatggg tgaaaacacc tttgaagctc 1920 gccaatggaa ccaaatatag acctcctgca aaactattaa aggaaagggg tttcttcgga 1980 gctattgctg gtttcctaga aggaggatgg gaaggaatga ttgcaggctg gcacggatac 2040 acatctcacg gagcacatgg agtggcagtg gcggcggacc ttaagagtac gcaagaagct 2100 ataaacaaga taacaaaaaa tctcaattct ttgagtgagc tagaagtaaa gaatcttcaa 2160 aqactaaqtq qtgccatqqa tqaactccac aacgaaatac tcgagctgga tgagaaagtg 2220 gatgatctca gagctgacac tataagctcg caaatagaac ttgcagtctt gctttccaac 2280 gaaggaataa taaacagtga agatgagcat ctattggcac ttgagagaaa actaaagaaa 2340 atgctgggtc cctctgctgt agagatagga aatggatgct tcgaaaccaa acacaagtgc 2400 aaccagacct gcttagacag gatagctgct ggcaccttta atgcaggaga attttctctc 2460 cccacttttg attcactgaa cattactgct gcatctttaa atgatgatgg attggataac 2520 taccaaatac tgtcaattta ttcaacagtg gcgagttccc tagcactggc aatcatgatg 2580 gctggtctat ctttatggat gtgctccaat ggatcgttac aatgcagaat ttgcatttaa 2640 aggcctattt tctttagttt gaatttactg ttattcggtg tgcatttcta tgtttggtga 2700 gcggttttct gtgctcagag tgtgtttatt ttatgtaatt taatttcttt gtgagctcct 2760 gtttagcagg tcgtcccttc agcaaggaca caaaaagatt ttaattttat taaaaaaaaa 2820 aaaaaaaaag accgggaatt cgatatcaag cttatcgacc tgcagatcgt tcaaacattt 2880 ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt atcatataat 2940 ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga 3000 gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata gaaaacaaaa 3060 tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagattcta 3120 gagtctcaag cttcggcgcg cc 3142

<210> 76 <211>1272 <212> DNA <213> Artificial Sequence <220> <223> Synthesized MsJI coding sequence <400> 76 atgtttgggc gcggaccaac aaggaagagt gataacacca aatattacga tattcttggt 60 gtttcaaaaa gtgctagtga agatgaaatc aagaaagcct atagaaaggc agcgatgaag 120 aaccatccag ataagggtgg ggatcctgag aagttcaagg agttgggcca agcatatgaa 180 gtgttgagcg atcctgaaaa gaaagaactg tatgatcaat atggtgaaga tgcccttaaa 240 gaaggaatgg ggggaggcgc aggaagctca tttcataatc cgtttgatat tttcgaatca 300 ttttttggtg caggctttgg tggtggtggt ccttcacgcg caagaagaca gaagcaagga 360 gaagatgtgg tgcattctat aaaggtttcc ttggaggatg tgtataacgg cactacaaag 420 aagctatcac tttctaggaa tgcactgtgc tcaaaatgta aagggaaagg ttcaaaaagt 480 ggaactgctg gaaggtgttt tggatgccag ggcacaggta tgaagattac cagaaggcaa 540 attggactgg gcatgattca acaaatgcaa cacgtctgtc ctgactgcaa aggaacaggc 600 gaggtcatta gtgagagaga tagatgccct caatgcaagg gaaacaagat tactcaagaa 660 aagaaggtgc tggaggtgca tgtggaaaag gggatgcagc agggtcacaa gattgtattc 720 gaaggacaag ctgatgaagc tcctgataca atcacaggag acatagtttt tgtcttgcaa 780 gtaaagggac atccgaagtt tcggagggag cgtgatgacc tccacattga acacaatttg 840 agcttaactg aggctctctg tggcttccag tttaatgtca cacatcttga tggaaggcaa 900 ctattggtca aatcgaaccc cggcgaagtc atcaagccag gtcaacataa agctataaat 960 gatgagggaa tgccacaaca tggtaggccg ttcatgaagg gacgcctata catcaagttt 1020 agtgttgatt tcccggattc gggttttctt tccccaagcc aaagcctgga attagaaaag 1080 atattacctc aaaagacaag caagaacttg tcccaaaagg aggtagatga ttgtgaggag 1140 accaccctgc atgatgtcaa tattgcagag gagatgagtc gaaagaagca acaataccgt 1200 gaggcatatg atgacgatga tgatgaagat gatgagcact cgcagcctcg ggtgcaatgc 1260 gctcaacagt ag 1272

<210> 77 <211> 4402 <212> DNA <213» Artificial Sequence <220> <223> Synthesized Construct number RS50, from Hlndlll <400> 77 aagcttgcat gcctgcaggt cgactctaga ggatccccgg gctggtctgt acattcatct 60 tgccgccttt gcattcactt ggccacaaag agtagagaga aggaagagaa gagcccagac 120 ttcaagaagc gaccttgcaa gtgcactcga gggtcagaaa ctgtatatca tatctatgtg 180 agagaaaggg gaacatttga gatggagtcc atttacttga ggtatactta ttattttgat 240 caataaattt gtatacttct tatttagatc aataaatttg tcattaagct ataatccaaa 300 ataaattacg atcaaatatg caaatgttag ccagtacttg tgttaaactt gatggcatct 360 cttggtttct ttggcaatca catgcctaag aaataaatag tatcatatga ttgtgtttgg 420 tcagacttca gagtcagatg actctgtttg gataaacagc ttaattaagc gcttatagaa 480 tatcatatga ttgtgtttgg tcagacttca gagcatctct tggtttctct ggcaatcata 540 tgcctaagaa ataaatagta tcatatgatt gtgtttggtc agacttcaga gtcagatgac 600 cctgtttggg taaacagctt aattaagtgc ttatagaata agcgcttatc atataagtgc 660 ttttgtacag ttatttctat gaaagtagaa gaaatagtca tattgtttta atataagcta 720 tcctggagag cttgtggaaa taaccagaaa agaacttatg gacacgtcat gagctgttta 780 cataagatct ccctaacagt ctcaaaagtg tttatgccag tagataaatt caaataagtc 840 aatctaaaca gaccctaaat ccattatggt acctatcatt ttagcttatt ccatctttat 900 taagaatgtc atgagataac ataatgataa cacattattt tgacacaaat gggcagatct 960 agcaatttaa ctctggagtc cttcaagact gctgttctta cgaagttcac gtccctgaat 1020 catgttcctg tatggaagcc tgaaagacct caaattctaa aaggtggcga taaattgaag 1080 gtttacaaaa tataccctgc gggcttgaca cagaggcaag ctctttatac cttccagttc 1140 aacggggatg ttgatttcag aagtcacttg gagagcaatc cttgtgccaa gtttgaagta 1200 atttttgtgt agcatatgtt gagctaccta caatttacat gatcacctag cattagctct 1260 ttcacttaac tgagagaatg aagttttagg aatgagtatg accatggagt cggcatggct 1320 ttgtaatgcc taccctactt tggccaactc atcggggatt tacattcaga aaatatacat 1380 gacttcaacc atacttaaac ccctttttgt aagataactg aatgttcata tttaatgttg 1440 ggttgtagtg tttttacttg attatatcca gacagttaca agttggacaa caagattgtg 1500 ggtctgtact gttatttatt tatttttttt ttagcagaaa caccttatct tttgtttcgt 1560 ttgaatgtag aatgaaaata aaagaaagaa aatataacat catcggccgc gcttgtctaa 1620 tttcgggcag ttaggatcct ctccggtcac cggaaagttt cagtagaaga aacaaaacac 1680 cgtgactaaa atgatactat tattttattt attgtgtttt tcttttttct accggaactt 1740 tttagaacgg atcccaactc gttccggggc cgctacaact gaaacaaaag aagatatttt 1800 ctctctcttc agaaatgtaa gttttccttt acagataccc attcaccatt tgattcagat 1860 gtggtgacta gagataaagc atactaattt gactcttgga aacccataaa gtttatgtta 1920 tccgtgttct ggaccaatcc acttgggggc ataacctgtg tctatgtgtg gtttggtttc 1980 ::::attctgatt tatg::: :ggcga cttgtaattt aaaatctagg aggggcagac attgaacaat 2040 cccaatattt taataactta tgcaagattt tttttattaa tgagatgatg tgtttgtgac 2100 tgagattgag tcatacattt cactaagaaa tggttccaag taccaaacta tcatgaccca 2160 gttgcaaaca tgacgttcgg gagtggtcac tttgatagtt caatttcatc ttggcttctt 2220 attcctttta taattctaat tcttcttgtg taaactattt catgtattat ttttctttaa 2280 aatttacatg tcatttattt tgcctcacta actcaatttt gcatataaca atgataagtg 2340 atattttgac tcacaaaatt tacatcaaat ttcgacatcg tttattatgt tcattggatg 2400 attaacaaat ataacaaact ttgcaactaa ttaaccacca actgaatata attaactata 2460 actgtgaaag tagttaactc atttttatat ttcatagatc aaataagaga aataacggta 2520 tattaatccc tccaaaaaaa aaaaacggta tatttactaa aaaatctaag ccacgtagga 2580 ggataacagg atccccgtag gaggataaca tccaatccaa ccaatcacaa caatcctgat 2640 gagataaccc actttaagcc cacgcatctg tggcacatct acattatcta aatcacacat 2700 tcttccacac atctgagcca cacaaaaacc aatccacatc tttatcaccc attctataaa 2760 aaatcacact ttgtgagtct acactttgat tcccttcaaa cacatacaaa gagaagagac 2820 taattaatta attaatcatc ttgagagaaa atgtttgggc gcggaccaac aaggaagagt 2880 gataacacca aatattacga tattcttggt gtttcaaaaa gtgctagtga agatgaaatc 2940 aagaaagcct atagaaaggc agcgatgaag aaccatccag ataagggtgg ggatcctgag 3000 aagttcaagg agttgggcca agcatatgaa gtgttgagcg atcctgaaaa gaaagaactg 3060 tatgatcaat atggtgaaga tgcccttaaa gaaggaatgg ggggaggcgc aggaagctca 3120 tttcataatc cgtttgatat tttcgaatca ttttttggtg caggctttgg tggtggtggt 3180 ccttcacgcg caagaagaca gaagcaagga gaagatgtgg tgcattctat aaaggtttcc 3240 ttggaggatg tgtataacgg cactacaaag aagctatcac tttctaggaa tgcactgtgc 3300 tcaaaatgta aagggaaagg ttcaaaaagt ggaactgctg gaaggtgttt tggatgccag 3360 ggcacaggta tgaagattac cagaaggcaa attggactgg gcatgattca acaaatgcaa 3420 cacgtctgtc ctgactgcaa aggaacaggc gaggtcatta gtgagagaga tagatgccct 3480 caatgcaagg gaaacaagat tactcaagaa aagaaggtgc tggaggtgca tgtggaaaag 3540 gggatgcagc agggtcacaa gattgtattc gaaggacaag ctgatgaagc tcctgataca 3600 atcacaggag acatagtttt tgtcttgcaa gtaaagggac atccgaagtt tcggagggag 3660 cgtgatgacc tccacattga acacaatttg agcttaactg aggctctctg tggcttccag 3720 tttaatgtca cacatcttga tggaaggcaa ctattggtca aatcgaaccc cggcgaagtc 3780 atcaagccag gtcaacataa agctataaat gatgagggaa tgccacaaca tggtaggccg 3840 ttcatgaagg gacgcctata catcaagttt agtgttgatt tcccggattc gggttttctt 3900 tccccaagcc aaagcctgga attagaaaag atattacctc aaaagacaag caagaacttg 3960 tcccaaaagg aggtagatga ttgtgaggag accaccctgc atgatgtcaa tattgcagag 4020 gagatgagtc gaaagaagca acaataccgt gaggcatatg atgacgatga tgatgaagat 4080 gatgagcact cgcagcctcg ggtgcaatgc gctcaacagt aggagctcag ctcgaatttc 4140 cccgatcgtt caaacatttg gcaataaagt ttcttaagat tgaatcctgt tgccggtctt 4200 gcgatgatta tcatataatt tctgttgaat tacgttaagc atgtaataat taacatgtaa 4260 tgcatgacgt tatttatgag atgggttttt atgattagag tcccgcaatt atacatttaa 4320 tacgcgatag aaaacaaaat atagcgcgca aactaggata aattatcgcg cgcggtgtca 4380 tctatgttac tagatcgaat tc 4402 <210> 78

<211> 5086 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Construct number R860, from Hindlll to EcoRI <400> 78 aagcttgcat gcctgcaggt cgactctaga ggatccccgg gctggtctgt acattcatct 60 tgccgccttt gcattcactt ggccacaaag agtagagaga aggaagagaa gagcccagac 120 ttcaagaagc gaccttgcaa gtgcactcga gggtcagaaa ctgtatatca tatctatgtg 180 agagaaaggg gaacatttga gatggagtcc atttacttga ggtatactta ttattttgat 240 caataaattt gtatacttct tatttagatc aataaatttg tcattaagct ataatccaaa 300 ataaattacg atcaaatatg caaatgttag ccagtacttg tgttaaactt gatggcatct 360 cttggtttct ttggcaatca catgcctaag aaataaatag tatcatatga ttgtgtttgg 420 tcagacttca gagtcagatg actctgtttg gataaacagc ttaattaagc gcttatagaa 480 tatcatatga ttgtgtttgg tcagacttca gagcatctct tggtttctct ggcaatcata 540 tgcctaagaa ataaatagta tcatatgatt gtgtttggtc agacttcaga gtcagatgac 600 cctgtttggg taaacagctt aattaagtgc ttatagaata agcgcttatc atataagtgc 660 ttttgtacag ttatttctat gaaagtagaa gaaatagtca tattgtttta atataagcta 720 tcctggagag cttgtggaaa taaccagaaa agaacttatg gacacgtcat gagctgttta 780 cataagatct ccctaacagt ctcaaaagtg tttatgccag tagataaatt caaataagtc 840 aatctaaaca gaccctaaat ccattatggt acctatcatt ttagcttatt ccatctttat 900 taagaatgtc atgagataac ataatgataa cacattattt tgacacaaat gggcagatct 960 agcaatttaa ctctggagtc cttcaagact gctgttctta cgaagttcac gtccctgaat 1020 catgttcctg tatggaagcc tgaaagacct caaattctaa aaggtggcga taaattgaag 1080 gtttacaaaa tataccctgc gggcttgaca cagaggcaag ctctttatac cttccagttc 1140 aacggggatg ttgatttcag aagtcacttg gagagcaatc cttgtgccaa gtttgaagta 1200 atttttgtgt agcatatgtt gagctaccta caatttacat gatcacctag cattagctct 1260 ttcacttaac tgagagaatg aagttttagg aatgagtatg accatggagt cggcatggct 1320 ttgtaatgcc taccctactt tggccaactc atcggggatt tacattcaga aaatatacat 1380 gacttcaacc atacttaaac ccctttttgt aagataactg aatgttcata tttaatgttg 1440 ggttgtagtg tttttacttg attatatcca gacagttaca agttggacaa caagattgtg 1500 ggtctgtact gttatttatt tatttttttt ttagcagaaa caccttatct tttgtttcgt 1560 ttgaatgtag aatgaaaata aaagaaagaa aatataacat catcggccgc gcttgtctaa 1620 tttcgggcag ttaggatcct ctccggtcac cggaaagttt cagtagaaga aacaaaacac 1680 cgtgactaaa atgatactat tattttattt attgtgtttt tcttttttct accggaactt 1740 tttagaacgg atcccaactc gttccggggc cgctacaact gaaacaaaag aagatatttt 1800 ctctctcttc agaaatgtaa gttttccttt acagataccc attcaccatt tgattcagat 1860 gtggtgacta gagataaagc atactaattt gactcttgga aacccataaa gtttatgtta 1920 tccgtgttct ggaccaatcc acttgggggc ataacctgtg tctatgtgtg gtttggtttc 1980 cattctgatt tatgcggcga cttgtaattt aaaatctagg aggggcagac attgaacaat 2040 cccaatattt taataactta tgcaagattt tttttattaa tgagatgatg tgtttgtgac 2100 tgagattgag tcatacattt cactaagaaa tggttccaag taccaaacta tcatgaccca 2160 gttgcaaaca tgacgttcgg gagtggtcac tttgatagtt caatttcatc ttggcttctt 2220 attcctttta taattctaat tcttcttgtg taaactattt catgtattat ttttctttaa 2280 aatttacatg tcatttattt tgcctcacta actcaatttt gcatataaca atgataagtg 2340 atattttgac tcacaaaatt tacatcaaat ttcgacatcg tttattatgt tcattggatg 2400 attaacaaat ataacaaact ttgcaactaa ttaaccacca actgaatata attaactata 2460 actgtgaaag tagttaactc atttttatat ttcatagatc aaataagaga aataacggta 2520 tattaatccc tccaaaaaaa aaaaacggta tatttactaa aaaatctaag ccacgtagga 2580 ggataacagg atccccgtag gaggataaca tccaatccaa ccaatcacaa caatcctgat 2640 gagataaccc actttaagcc cacgcatctg tggcacatct acattatcta aatcacacat 2ΊΟΟ tcttccacac atctgagcca cacaaaaacc aatccacatc tttatcaccc attctataaa 2760 aaatcacact ttgtgagtct acactttgat tcccttcaaa cacatacaaa gagaagagac 2820 taattaatta attaatcatc ttgagagaaa atgtcgggta aaggagaagg accagctatc 2880 ggtatcgatc ttggtaccac ttactcttgc gtcggagtat ggcaacacga ccgtgttgag 2940 atcattgcta atgatcaagg aaacagaacc acgccatctt acgttgcttt caccgactcc 3000 gagaggttga teggtgacgc agctaagaat eaggtcgcca tgaaccccgt taacaccgtt 3060 ttcgacgcta agaggttgat cggtcgtcgt ttctctgaca getctgttca gagtgaeatg 3120 aaattgtggc cattcaagat tcaagccgga cctgccgata agccaatgat ctacgtcgaa 3180 tacaagggtg aagagaaaga gttegcagct gagge.gattt ctteeatggt tcttattaag 3240 atgcgtgaga ttgctgaggc ttaccttggt gtcacaatca agaacgccgt tgttaccgtt 3300 ccagcttact tcaacgactc tcagcgtcag gctacaaagg atgctggtgt catcgctggt 3360 ttgaacgtta tgcgaatcat caacgagcct acagccgccg ctattgccta cggtcttgac 3420 aaaaaggcta ccagcgttgg agagaagaat gttcttatct tcgatcttgg tggtggcact 3480 ΟΩΔ. tttgatgtct ctcttcttac cattgaagag ggtatctttg aggtgaaggc aactgctggt 3540 gacacccatc ttggtgggga agattttgac aacagaatgg ttaaccactt tgtccaagag 3600 ttcaagagga agagtaagaa ggatatcacc ggtaacccaa gagctcttag gaggttgaga 3660 acttcctgtg agagagcgaa gaggactctt tcttccactg ctcagaccac catcgagatt 3720 gactctctat acgagggtat cgacttctac tccaccatca cccgtgctag atttgaggag 3780 ctcaacatgg atctcttcag gaagtgtatg gagccagttg agaagtgtct tcgtgatgct 3840 aagatggaca agagcactgt tcatgatgtt gtccttgttg gtggttctac ccgtatccct 3900 aaggttcagc aattgctcca ggacttcttc aacggcaaag agctttgcaa gtctattaac 3960 cctgatgagg ctgttgccta cggtgctgct gtccagggag ctattctcag cggtgaagga 4020 aacgagaagg ttcaagatct tctattgctc gatgtcactc ctctctccct tggtttggaa 4080 actgccggtg gtgtcatgac cactttgatc ccaaggaaca caaccatccc aaccaagaag 4140 gaacaagtct tctccaccta ctcagacaac caacccggtg tgttgatcca ggtgtacgaa 4200 ggagagagag ccagaaccaa ggacaacaac cttcttggta aatttgagct ctccggaatt 4260 cctccagctc ctcgtggtgt cccccagatc acagtctgct ttgacattga tgccaatggt 4320 atcctcaatg tctctgctga ggacaagacc accggacaga agaacaagat caccatcacc 4380 aatgacaagg gtcgtctctc caaggatgag attgagaaga tggttcaaga ggctgagaag 4440 tacaagtccg aagacgagga gcacaagaag aaggttgaag ccaagaacgc tctcgagaac 4500 tacgcttaca acatgaggaa caccatccaa gacgagaaga ttggtgagaa gctcccggct 4560 gcagacaaga agaagatcga ggattctatt gagcaggcga ttcaatggct cgagggtaac 4620 cagttggctg aggctgatga gttcgaagac aagatgaagg aattggagag catctgcaac 4680 ccaatcattg ccaagatgta ccaaggagct ggtggtgaag ccggtggtcc aggtgcctct 4740 ggtatggacg atgatgctcc ccctgcttca ggcggtgctg gacctaagat cgaggaggtc 4800 gactaagagc tcagctcgaa tttccccgat cgttcaaaca tttggcaata aagtttctta 4860 agattgaatc ctgttgccgg tcttgcgatg attatcatat aatttctgtt gaattacgtt 4920 aagcatgtaa taattaacat gtaatgcatg acgttattta tgagatgggt ttttatgatt 4980 agagtcccgc aattatacat ttaatacgcg atagaaaaca aaatatagcg cgcaaactag 5040 gataaattat cgcgcgcggt gtcatctatg ttactagatc gaattc 5086

<210> 79 <211> 9493 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Construct number R870, from Hindlll to EcoRI <400> 79 aagcttgcat gcctgcaggt cgactctaga ggatccccgg gctggtctgt acattcatct 60 tgccgccttt gcattcactt ggccacaaag agtagagaga aggaagagaa gagcccagac 120 ttcaagaagc gaccttgcaa gtgcactcga gggtcagaaa ctgtatatca tatctatgtg 180 agagaaaggg gaacatttga gatggagtcc atttacttga ggtatactta ttattttgat 240 caataaattt gtatacttct tatttagatc aataaatttg tcattaagct ataatccaaa 300 ataaattacg atcaaatatg caaatgttag ccagtacttg tgttaaactt gatggcatct 360 cttggtttct ttggcaatca catgcctaag aaataaatag tatcatatga ttgtgtttgg 420 tcagacttca gagtcagatg actctgtttg gataaacagc ttaattaagc gcttatagaa 480 tatcatatga ttgtgtttgg tcagacttca gagcatctct tggtttctct ggcaatcata 540 tgcctaagaa ataaatagta tcatatgatt gtgtttggtc agacttcaga gtcagatgac 600 cctgtttggg taaacagctt aattaagtgc ttatagaata agcgcttatc atataagtgc 660 ttttgtacag ttatttctat gaaagtagaa gaaatagtca tattgtttta atataagcta 720 tcctggagag cttgtggaaa taaccagaaa agaacttatg gacacgtcat gagctgttta 780 cataagatct ccctaacagt ctcaaaagtg tttatgccag tagataaatt caaataagtc 840 aatctaaaca gaccctaaat ccattatggt acctatcatt ttagcttatt ccatctttat 900 taagaatgtc atgagataac ataatgataa cacattattt tgacacaaat gggcagatct 960 agcaatttaa ctctggagtc cttcaagact gctgttctta cgaagttcac gtccctgaat 1020 catgttcctg tatggaagcc tgaaagacct caaattctaa aaggtggcga taaattgaag 1080 gtttacaaaa tataccctgc gggcttgaca cagaggcaag ctctttatac cttccagttc 1140 aacggggatg ttgatttcag aagtcacttg gagagcaatc cttgtgccaa gtttgaagta 1200 atttttgtgt agcatatgtt gagctaccta caatttacat gatcacctag cattagctct 1260 ttcacttaac tgagagaatg aagttttagg aatgagtatg accatggagt cggcatggct 1320 ttgtaatgcc taccctactt tggccaactc atcggggatt tacattcaga aaatatacat 1380 gacttcaacc atacttaaac ccctttttgt aagataactg aatgttcata tttaatgttg 1440 ggttgtagtg tttttacttg attatatcca gacagttaca agttggacaa caagattgtg 1500 ggtctgtact gttatttatt tatttttttt ttagcagaaa caccttatct tttgtttcgt 1560 ttgaatgtag aatgaaaata aaagaaagaa aatataacat catcggccgc gcttgtctaa 1620 tttcgggcag ttaggatcct ctccggtcac cggaaagttt cagtagaaga aacaaaacac 1680 cgtgactaaa atgatactat tattttattt attgtgtttt tcttttttct accggaactt 1740 tttaqaacgg atcccaactc gttccggggc cgctacaact gaaacaaaag aagatatttt 1800 ctctctcttc agaaatgtaa gttttccttt acagataccc attcaccatt tgattcagat 1860 gtggtgacta gagataaagc atactaattt gactcttgga aacccataaa gtttatgtta 1920 tccgtgttct ggaccaatcc acttgggggc ataacctgtg tctatgtgtg gtttggtttc 1980 cattctgatt tatgcggcga cttgtaattt aaaatctagg aggggcagac attgaacaat 2040 cccaatattt taataactta tgcaagattt tttttattaa tgagatgatg tgtttgtgac 2100 tgagattgag tcatacattt cactaagaaa tggttccaag taccaaacta tcatgaccca 2160 gttgcaaaca tgacgttcgg gagtggtcac tttgatagtt caatttcatc ttggcttctt 2220 attcctttta taattctaat tcttcttgtg taaactattt catgtattat ttttctttaa 2280 aatttacatg tcatttattt tgcctcacta actcaatttt gcatataaca atgataagtg 2340 atattttgac tcacaaaatt tacatcaaat ttcgacatcg tttattatgt tcattggatg 2400 attaacaaat ataacaaact ttgcaactaa ttaaccacca actgaatata attaactata 2460 actgtgaaag tagttaactc atttttatat ttcatagatc aaataagaga aataacggta 2520 tattaatccc tccaaaaaaa aaaaacggta tatttactaa aaaatctaag ccacgtagga 2580 ggataacagg atccccgtag gaggataaca tccaatccaa ccaatcacaa caatcctgat 2640 gagataaccc actttaagcc cacgcatctg tggcacatct acattatcta aatcacacat 2700 tcttccacac atctgagcca cacaaaaacc aatccacatc tttatcaccc attctataaa 2760 aaatcacact ttgtgagtct aeactttgat tcccttcaaa cacatacaaa gagaagagac 2820 taattaatta attaatcatc ttgagagaaa atgtcgggta aaggagaagg accagctatc 2880 ggtatcgatc ttggtaccac ttactcttgc gtcggagtat ggcaacacga ccgtgttgag 2940 atcattgcta atgatcaagg aaacagaacc acgccatctt acgttgcttt caccgactcc 3000 gagaggttga tcggtgacgc agctaagaat caggtcgcca tgaaccccgt taacaccgtt 3060 ttcgacgcta agaggttgat cggtcgtcgt ttctctgaca gctctgttca gagtgacatg 3120 aaattgtggc eattcaagat tcaagcegga cctgccgata agccaatgat ctacgtcgaa 3180 tacaagggtg aagagaaaga gttegeagct gaggagattt cttccatggt tcttattaag 3240 atgcgtgaga ttgctgaggc ttaccttggt gtcacaatca agaacgccgt tgttaccgtt 3300 ccagcttact tcaacgactc tcagcgtcag gctacaaagg atgctggtgt catcgctggt 3360 ttgaacgtta tgcgaatcat caacgagcct acagccgccg ctattgccta cggtcttgac 3420 aaaaaggcta ccagcgttgg agagaagaat gttcttatct tcgatcttgg tggtggcact 3480 tttgatgtct ctcttcttac cattgaagag ggtatctttg aggtgaaggc aactgctggt 3540 gacacccatc ttggtgggga agattttgac aacagaatgg ttaaccactt tgtccaagag 3600 >11 ttcaagagga agagtaagaa ggatatcacc ggtaacccaa gagctcttag gaggttgaga 3660 acttcctgtg agagagcgaa gaggactctt tcttccactg ctcagaccac catcgagatt 3720 gactctctat acgagggtat cgacttctac tccaccatca cccgtgctag atttgaggag 3780 ctcaacatgg atctcttcag gaagtgtatg gagccaqttg agaagtgtct tcgtgatgct 3840 aagatggaca agagcactgt tcatgatgtt gtccttgttg gtggttctac ccgtatccct 3900 aaggttcagc aattgctcca ggacttcttc aacggcaaag agctttgcaa gtctattaac 3960 cctgatgagg ctgttgccta cggtgctgct gtccagggag ctattctcag cggtgaagga 4020 aacgagaagg ttcaagatct tctattgctc gatgtcactc ctctctccct tggtttggaa 4080 actgccggtg gtgtcatgac cactttgatc ccaaggaaca caaccatccc aaccaagaag 4140 gaacaagtct tctccaccta ctcagacaac caacccggtg tgttgatcca ggtgtacgaa 4200 ggagagagag ccagaaccaa ggacaacaac cttcttggta aatttgagct ctccggaatt 4260 cctccagctc ctcgtggtgt cccccagatc acagtctgct ttgacattga tgccaatggt 4320 atcctcaatg tctctgctga ggacaagacc accggacaga agaacaagat caccatcacc 4380 aatgacaagg gtcgtctctc caaggatgag attgagaaga tggttcaaga ggctgagaag 4440 tacaagtccg aagacgagga gcacaagaag aaggttgaag ccaagaacgc tctcgagaac 4500 tacgcttaca acatgaggaa caccatccaa gacgagaaga ttggtgagaa gctcccggct 4560 gcagacaaga agaagatcga ggattctatt gagcaggcga ttcaatggct cgagggtaac 4620 cagttggctg aggctgatga gttcgaagac aagatgaagg aattggagag catctgcaac 4680 ccaatcattg ccaagatgta ccaaggagct ggtggtgaag ccggtggtcc aggtgcctct 4740 ggtatggacg atgatgctcc ccctgcttca ggcggtgctg gacctaagat cgaggaggtc 4800 gactaagagc tcagctcgaa tttccccgat cgttcaaaca tttggcaata aagtttctta 4860 agattgaatc ctgttgccgg tcttgcgatg attatcatat aatttctgtt gaattacgtt 4920 aagcatgtaa taattaacat gtaatgcatg acgttattta tgagatgggt ttttatgatt 4980 agagtcccgc aattatacat ttaatacgcg atagaaaaca aaatatagcg cgcaaactag 504 0 gataaattat cgcgcgcggt gtcatctatg ttactagatc gaattcgtaa tcatggtcat 5100 agctgtttcc tgtgtgaaat tgttatccgg ggctggtctg tacattcatc ttgccgcctt 5160 tgcattcact tggccacaaa gagtagagag aaggaagaga agagcccaga cttcaagaag 5220 cgaccttgca agtgcactcg agggtcagaa actgtatatc atatctatgt gagagaaagg 5280 ggaacatttg agatggagtc catttacttg aggtatactt attattttga tcaataaatt 5340 tgtatacttc ttatttagat caataaattt gtcattaagc tataatccaa aataaattac 5400 gatcaaatat gcaaatgtta gccagtactt gtgttaaact tgatggcatc tcttggtttc 5460 tttggcaatc acatgcctaa gaaataaata gtatcatatg attgtgtttg gtcagacttc 5520 agagtcagat gactctgttt ggataaacag cttaattaag cgcttataga atatcatatg 5580 attgtgtttg gtcagacttc agagcatctc ttggtttctc tggcaatcat atgcctaaga 5640 aataaatagt atcatatgat tgtgtttggt cagacttcag agtcagatga ccctgtttgg 5700 gtaaacagct taattaagtg cttatagaat aagcgcttat catataagtg cttttgtaca 5760 gttatttcta tgaaagtaga agaaatagtc atattgtttt aatataagct atcctggaga 5820 gcttgtggaa ataaccagaa aagaacttat ggacacgtca tgagctgttt acataagatc 5380 tccctaacag tctcaaaagt gtttatgcca gtagataaat tcaaataagt caatctaaac 5940 agaccctaaa tccattatgg tacctatcat tttagcttat tccatcttta ttaagaatgt 6000 catgagataa cataatgata acacattatt ttgacacaaa tgggcagatc tagcaattta 6060 actctg9agt ccttcaagac t9ctgttctt acgaagttca cgtccctgaa tcatgttcct 6120 gtatggaagc ctgaaagacc tcaaattcta aaaggtggcg ataaattgaa ggtttacaaa 6180 atataccct9 cgggcttgac acagaggcaa gctctttata ccttccagtt caacgg9gat 6240 gttgatttca gaagtcactt ggagagcaat ccttgtgcca agtttgaagt aatttttgtg 6300 tagcatatgt tgagctacct acaatttaca tgatcaccta gcattagctc tttcacttaa 6360 ctgagagaat gaagttttag gaatgagtat gaccatggag tcggcatggc tttgtaatgc 6420 ctaccctact ttggccaact catcggggat ttacattcag aaaatataca tgacttcaac 6480 catacttaaa cccctttttg taagataact gaatgttcat atttaatgtt gggttgtagt 6540 gtttttactt gattatatcc agacagttac aagttggaca acaagattgt gggtctgtac 6600 tgttatttat ttattttttt tttagcagaa acaccttatc ttttgtttcg tttgaatgta 6660 gaatgaaaat aaaagaaaga aaatataaca tcatcggccg cgcttgtcta atttcgggca 6720 gttaggatcc tctccggtca ccggaaagtt tcagtagaag aaacaaaaca ccgtgactaa 6780 aatgatacta ttattttatt tattgtgttt ttcttttttc taccggaact ttttagaacg 6840 ratcccaact cgttccgggg ccgctacaac tgaaacaaaa gaagatattt tctctctctt 6900 cagaaatgta agttttcctt tacagatacc cattcaccat ttgattcaga tgtggtgact 6960 agagataaag catactaatt tgactcttgg aaacccataa agtttatgtt atccgtgttc 7020 tggaccaatc cacttggggg cataacctgt gtctatgtgt ggtttggttt ccattctgat 7080 ttatgcggcg acttgtaatt taaaatctag gaggggcaga cattgaacaa tcccaatatt 7140 ttaataactt atgcaagatt ttttttatta atgagatgat gtgtttgtga ctgagattga 7200 gtcat=tcatt tcactaagaa atggttccaa gtaccaaact atcatgaccc agttgcaaac 7260 atgacgttcg ggagtggtca ctttgatagt tcaatttcat cttggcttct tattcctttt 7320 ataattctaa ttcttcttgt gtaaactatt tcatgtatta tttttcttta aaatttacat 7380 gtcatttatt ttgcctcact aactcaattt tgcatataac aatgataagt gatattttga 7440 ctcacaaaat ttacatcaaa tttcgacatc gtttattatg ttcattggat gattaacaaa 7500 tataacaaac tttgcaacta attaaccacc aactgaatat aattaactat aactgtgaaa 7560 gtagttaact catttttata tttcatagat caaataagag aaataacggt atattaatcc 7620 ctccaaaaaa aaaaaacggt atatttacta aaaaatctaa gccacgtagg aggataacag 7680 gatccccgta ggaggataac atccaatcca accaatcaca acaatcctga tgagataacc 7740 cactttaagc ccacgcatct gtggcacatc tacattatct aaatcacaca ttcttccaca 7800 catctgagcc acacaaaaac caatccacat ctttatcacc cattctataa aaaatcacac 7860 tttgtgagtc tacactttga ttcccttcaa acacatacaa agagaagaga ctaattaatt 7920 aattaatcat cttgagagaa aatgtttggg cgcggaccaa caaggaagag tgataacacc 7980 aaatattacg atattcttgg tgtttcaaaa agtgctagtg aagatgaaat caagaaagcc 804 0 tatagaaagg cagcgatgaa gaaccatcca gataagggtg gggatcctga gaagttcaag 8100 gagttgggcc aagcatatga agtgttgagc gatcctgaaa agaaagaact gtatgatcaa 8160 tatggtgaag atgcccttaa agaaggaatg gggggaggcg caggaagctc atttcataat 8220 ccgtttgata ttttcgaatc attttttggt gcaggctttg gtggtggtgg tccttcacgc 8280 gcaagaagac agaagcaagg agaagatgtg gtgcattcta taaaggtttc cttggaggat 8340 gtgtataacg gcactacaaa gaagctatca ctttctagga atgcactgtg ctcaaaatgt 8400 aaagggaaag gttcaaaaag tggaactgct ggaaggtgtt ttggatgcca gggcacaggt 84 60 atgaagatta ccagaaggca aattggactg ggcatgattc aacaaatgca acacgtctgt 8520 cctgactgca aaggaacagg cgaggtcatt agtgagagag atagatgccc tcaatgcaag 8580 ggaaacaaga ttactcaaga aaagaaggtg ctggaggtgc atgtggaaaa ggggatgcag 8 64 0 cagggtcaca agattgtatt cgaaggacaa gctgatgaag ctcctgatac aatcacagga 8700 gacataqttt ttgtcttgca agtaaaggga catccgaagt ttcggaggga gcgtgatgac 8760 ctccacattg aacacaattt gagcttaact gaggctctct gtggcttcca gtttaatgtc 8820 acacatcttg atggaaggca actattggtc aaatcgaacc ccggcgaagt catcaagcca 8880 ggtcaacata aagctataaa tgatgaggga atgccacaac atggtaggcc gttcatgaag 8 94 0 ggacgcctat acatcaagtt tagtgttgat ttcccggatt cgggttttct ttccccaagc 9000 caaagcctgg aattagaaaa gatattacct caaaagacaa gcaagaactt gtcccaaaag 9060 917 gaggtagatg attgtgagga gaccaccctg catgatgtca atattgcaga ggagatgagt 9120 cgaaagaagc aacaataccg tgaggcatat gatgacgatg atgatgaaga tgatgagcac 9180 tcgcagcctc gggtgcaatg cgctcaacag taggagctca gctcgaattt ccccgatcgt 9240 tcaaacattt ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt 9300 atcatataat ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg 9360 ttatttatga gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata 9420 gaaaacaaaa tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta 9480 ctagatcgaa ttc 9493

<210> 80 <211> 568 <212> PUT <213> Artificial Sequence <220> <223> Synthesized amino add translation of coding sequence In construct 690 expression cassette <400> 80

Met Glu Lys lie Val Leu Leu Leu Ala lie Val Ser Leu Val Lys Ser 15 10 15

Asp Gin lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 20 25 30

Asp Thr lie Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 35 40 45

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 50 55 60

Pro Leu He Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 65 70 75 80

Pro Met Cys Asp Glu Phe lie Asn Val Pro Glu Trp Ser Tyr lie Val 85 90 95

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Pro Gly His Phe Ala 100 105 110

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 115 120 125

Arg Phe Glu lie Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 130 135 140

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser ser Phe Tyr 145 150 155 160

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 165 170 175

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 180 185 190

Gly Val His His Pro Pro Asn lie Gly Asp Gin Lys Ala Leu Tyr His 195 200 205

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Lys 210 215 220

Phe Thr Pro Glu lie Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 225 230 235 240

Arg lie Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr lie lie 245 250 255

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 260 265 270

Ser Arg Gly Phe Gly Ser Gly lie Met Lys Ser Glu Leu Glu Tyr Gly 275 280 285

Asn Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala lie Asn Ser Ser 290 295 300

Met Pro Phe His Asn lie His Pro Leu Thr lie Gly Glu Cys Pro Lys 305 310 315 320

Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 325 330 335

Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala lie 340 345 350

Ala Gly Phe lie Glu Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr 355 360 365

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 370 375 380

Glu Ser Thr Gin Lys Ala lie Asp Gly Val Thr Asn Lys Val Asn Ser 385 390 395 400

He He Asp Lys Met Asn Thr Gin Phe Glu Ala val Gly Arg Glu Phe 405 410 415

Asn Asn Leu Glu Arg Arg lie Glu Asn Leu Asn Lys Lys Met Glu Asp 420 425 430

Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met 435 440 445

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 450 455 460

Tyr Asp Lys Val Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 465 470 475 480

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 485 490 495

Ser lie Arg Asn Gly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala 500 505 510 991

Arg Leu Lys Arg Glu Glu lie Ser Gly Val Lys Leu Glu Ser lie Gly 515 520 525

Thr Tyr Gin lie Leu Ser lie Tyr Ser Thr Val Ala Ser Ser Leu Ala 530 535 540

Leu Ala lie Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 545 550 555 560

Ser Leu Gin Cys Arg lie Cys lie 565

<210> 81 <211> 568 <212> PRT <213> Artificial Sequence <22Q> <223> Synthesized Amino acid translation of coding sequence hi construct 691 expression cassette <400> 81

Met Glu Lys lie Val Leu Leu Leu Ala lie Val Ser Leu Val Lys Ser 15 10 15

Asp Gin lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 20 25 30

Asp Thr lie Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 35 40 45

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 50 55 60

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 65 70 75 80

Pro Glu Cys Glu Leu Leu lie Ser Lys Glu Ser Trp Ser Tyr lie Val 85 90 95

Glu Lys Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly His Phe Ala 100 105 110

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 115 120 125

Arg Phe Glu lie Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 130 135 140

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser Ser Phe Tyr 145 150 155 160

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 165 170 175

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 180 185 190

Gly Val His His Pro Pro Asn lie Gly Asp Gin Lys Ala Leu Tyr His 195 200 205

Thr Glu Asn Ala Tyr Vai Ser Vai Vai Ser Ser His Tyr Ser Arg Lys 210 215 220

Phe Thr Pro Glu lie Ala Lys Arg Pro Lys Vai Arg Asp Gin Glu Gly 225 230 235 240

Arg lie Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr lie Ile 245 250 255

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 260 265 270

Ser Arg Gly Phe Gly Ser Gly Ile Ile Asn Ser Asn Ala Pro Met Asp 275 280 285

Lys Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala Ile Asn Ser Ser 290 295 3JO

Met Pro Phe His Asn lie His Pro Leu Thr lie Gly Glu Cys Pro Lys 305 310 315 320

Tyr Vai Lys Ser Asn Arg Leu Vai Leu Ala Thr Gly Leu Arg Asn Ser 325 330 335

Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile 340 345 350

Ala Gly Phe lie Glu Gly Gly Trp Gin Gly Met Vai Asp Gly Trp Tyr 355 360 365

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 370 375 380

Glu Ser Thr Gin Lys Ala Ile Asp Gly Vai Thr Asn Lys Vai Asn Ser 385 390 395 400 lie lie Asp Lys Met Asn Thr Gin Phe Glu Ala Vai Gly Arg Glu Phe 405 410 415

Asn Asn Leu Glu Arg Arg lie Glu Asn Leu Asn Lys Lys Met Glu Asp 420 425 430

Gly Phe Leu Asp Vai Trp Thr Tyr Asn Ala Glu Leu Leu Vai Leu Met 435 440 445

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Vai Lys Asn Leu 450 455 460

Tyr Asp Lys Vai Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 465 470 475 480

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 485 490 495

Ser lie Arg A:sn Gly Thr Tyr A:sn Tyr Pro Gin Tyr Ser Glu Glu Ala 500 505 510

Arg Leu Lys Arg Glu Glu Ile Ser Gly Vai Lys Leu Glu Ser Ile Gly 515 520 525

Thr Tyr Gin lie Leu Ser lie Tyr Ser Thr Val Ala Ser Ser Leu Ala 530 535 540

Leu Ala lie Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 545 550 555 560

Ser Leu Gin Cys Arg lie Cys lie 565

<210>82 <211> 572 <212> PRT <213> Artificial Sequence <220> <223> Synthesized Amino acid translation of coding sequence in construct 696 expression cassette <400> 82

Met Ala Lys Asn Val Ala lie Phe Gly Leu Leu Phe Ser Leu Leu Val 15 10 15

Leu Val Pro Ser Gin lie Phe Ala Asp Thr lie Cys lie Gly Tyr His 20 25 30

Ala Asn Asn Ser Thr Asp Thr Val Asp Thr Val Leu Glu Lys Asn Val 35 40 45

Thr Val Thr His Ser Val Asn Leu Leu Glu Asp Ser His Asn Gly Lys 50 55 60

Leu Cys Leu Leu Lys Gly lie Ala Pro Leu Gin Leu Gly Asn Cys Ser 65 70 75 80

Val Ala Gly Trp lie Leu Gly Asn Pro Glu Cys Glu Leu Leu lie Ser 85 90 95

Lys Glu Ser Trp Ser Tyr lie Val Glu Thr Pro Asn Pro Glu Asn Gly 100 105 110

Thr Cys Tyr Pro Gly Ser Phe Asn Asp Tyr Glu Glu Leu Lys His Leu 115 120 125

Leu Ser Arg lie Asn His Phe Glu Lys lie Gin lie lie Pro Lys Ser 130 135 140

Ser Trp Ser Asp His Glu Ala Ser Ser Gly Val Ser Ser Ala Cys Pro

Tyr Leu Gly Ser Pro Ser Phe Phe Arg Asn Val Val Trp Leu lie Lys 165 170 175

Lys Asn Ser Thr Tyr Pro Thr lie Lys Lys Ser Tyr Asn Asn Thr Asn 180 185 190

Gin Glu Asp Leu Leu Val Leu Trp Gly lie His His Pro Asn Asp Ala 195 200 205

Ala Glu Gin Thr Arg Leu Tyr Gin Asn Pro Thr Thr Tyr He Ser lie 210 215 220

Gly Thr Ser Thr Leu Asn Gin Arg Leu Val Pro Lys lie Ala Thr Arg 225 230 235 240

Ser Lys Val Asn Gly Gin Ser Gly Arg Met Glu Phe Phe Trp Thr lie 245 250 255

Leu Lys Pro Asn Asp Ala lie Asn Phe Glu Ser Asn Gly Asn Phe lie 260 265 270

Ala Pro Glu Tyr Ala Tyr Lys lie Val Lys Lys Gly Asp Ser Ala lie 275 280 285 lie Thr Ser Asn Ala Pro Met Asp Glu Cys Asp Ala Lys Cys Gin Thr 290 295 300

Pro Gin Gly Ala lie Asn Ser Ser Leu Pro Phe Gin Asn Val His Pro 305 310 315 320

Val Thr lie Gly Glu Cys Pro Lys Tyr Val Arg Ser Ala Lys Leu Arg 325 330 335

Met Val Thr Gly Leu Arg Asn lie Pro Ser lie Gin Ser Arg Gly Leu 340 345 350

Phe Gly Ala lie Ala Gly Phe lie Glu Gly Gly Trp Thr Gly Met Val 355 360 365

Asp Gly Trp Tyr Gly Tyr His His Gin Asn Glu Gin Gly Ser Gly Tyr 370 375 380

Ala Ala Asp Gin Lys Ser Thr Gin Asn Ala lie Asn Gly lie Thr Asn 385 390 395 400

Lys Val Asn Ser Val lie Glu Lys Met Asn Thr Gin Phe Thr Ala Val 405 410 415

Gly Lys Glu Phe Asn Lys Leu Glu Arg Arg JY:et Glu Asn Leu Asn Lys 420 425 430

Lys Val Asp Asp Gly Phe Leu Asp lie Trp Thr Tyr Asn Ala Glu Leu 435 440 445

Leu Val Leu Leu Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn 450 455 460

Val Lys Asn Leu Tyr Glu Lys Val Lys Ser Gin Leu Lys Asn Asn Ala 465 470 475 480

Lys Glu lie Gly Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asn Asn 485 490 495

Glu Cys Met Glu Ser Val Lys Asn Gly Thr Tyr Asp Tyr Pro Lys Tyr 500 505 510

Ser Glu Glu Ser Lys Leu Asn Arg Glu Lys lie Asp Gly Val Lys Leu 515 520 525

Glu Ser Met Gly Vai Tyr Gin lie Leu Ala Ile Tyr Ser Thr Vai Ala __535_5AQ_

Ser Ser Leu Vai Leu Leu Vai Ser Leu Gly Ala Ile Ser Phe Trp Met 545 550 555 560

Cys Ser Asn Gly Ser Leu Gin Cys Arg Ile Cys Ile 565 570

<210> S3 <211>575 <212> PRT <213> Artificial Sequence <220> <223> Synthesbed amino add translation of coding sequence In construct 737 expression cassette <400> 83

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val 15 10 15

Leu Val Pro Ser Gin He Phe Ala Gin Lys Leu Pro Gly Asn Asp Asn 20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr 35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Gin Ile Glu Val Thr Asn Ala Thr 50 55 60

Glu Leu Val Gin Ser Ser Ser Thr Gly Glu Ile Cys Asp Ser Pro His 65 70 75 80

Gin Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly 85 90 95

Asp Pro Gin Cys Asp Gly Phe Gin Asn Lys Lys Trp Asp Leu Phe Val 100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp 115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe 130 135 140

Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gin Asn Gly Thr Ser 145 150 155 160

Ser Ala Cys Ile Arg Arg Ser Asn Asn Ser Phe Phe Ser Arg Leu Asn 165 170 175

Trp Leu Thr His Leu Lys Phe Lys Tyr Pro Ala Leu Asn Val Thr Met 180 185 190

Pro Asn Asn Glu Lys Phe Asp Lys Leu Tyr lie Trp Gly Val His His 195 200 205

Pro Gly Thr Asp Asn Asp Gin lie Phe Leu Tyr Ala Gin Ala Ser Gly 210 215 220

Arg lie Thr Val Ser Thr Lys Arg Ser Gin Gin Thr Val lie Pro Asn 225 230 235 240

He Gly Ser Arg Pro Arg Val Arg Asn lie Pro Ser Arg lie Ser He 245 250 255

Tyr Trp Thr lie Val Lys Pro Gly Asp He Leu Leu He Asn Ser Thr 260 265 270

Gly Asn Leu He Ala Pro Arg Gly Tyr Phe Lys He Arg Ser Gly Lys 275 280 285

Ser Ser He Met Arg Ser Asp Ala Pro He Gly Lys Cys Asn Ser Glu 290 295 300

Cys He Thr Pro Asn Gly Ser He Pro Asn Asp Lys Pro Phe Gin Asn 305 310 315 320

Val Asn Arg He Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gin Asn 325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gin Thr 340 345 350

Arg Gly He Phe Gly Ala He Ala Gly Phe He Glu Asn Gly Trp Glu 355 360 365

Gly Met Val Asp Cly Trp Tyr Gly Phe Arg His Gin Asn Ser Glu Gly 370 375 380

He Gly Gin Ala Ala Asp Leu Lys Ser Thr Gin Ala Ala He Asp Gin 385 390 395 400

He Asn Gly Lys Leu Asn Arg Leu He Gly Lys Thr Asn Glu Lys Phe 405 410 415

His Gin He Glu Lys Glu Phe Ser Glu Val Glu Gly Arg He Gin Asp 420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys He Asp Leu Trp Ser Tyr Asn 435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gin His Thr He Asp Leu Thr 450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gin Leu Arg 465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys He Tyr His Lys 485 490 495

Cys Asp Asn Ala Cys He Gly Ser He Arg Asn Gly Thr Tyr Asp His 500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Asn Arg Phe Gin He Lys Gly 515 520 525

Val Glu Leu Lys Ser He Gly Thr Tyr Gin He Leu Ser He Tyr Ser 530 535 540

Thr Vai Ala Ser Ser Leu Ala Leu Ala lie Met Met Ala Gly Leu Ser 545 550 555 560

Leu Trp Met Cys Ser Asn Gly Ser Leu Gin Cys Arg lie Cys lie 565 570 575

<210> 84 <211 > 593 <212> PRT <213> Artificial Sequence <220> <223> Synthesized amino acid translation of coding sequence in construct 745 expression cassette <400> 84

Met Ala Lys Asn Val Ala He Phe Gly Leu Leu Phe Ser Leu Leu Val 15 10 15

Leu Val Pro Ser Gin lie Phe Ala Asp Arg He Cys Thr Gly lie Thr 5 20 25 30

Ser Ser Asn Ser Pro His Val Val Lys Thr Ala Thr Gin Gly Glu Val 35 40 45

Asn Val Thr Gly Val He Pro Leu Thr Thr Thr Pro Thr Lys Ser Tyr 50 55 60

Phe Ala Asn Leu Lys Gly Thr Arg Thr Arg Gly Lys Leu Cys Pro Asp 65 70 75 80 15

Cys Leu Asn Cys Thr Asp Leu Asp Val Ala Leu Gly Arg Pro Met Cys 85 90 95

Val Gly Thr Thr Pro Ser Ala Lys Ala Ser He Leu His Glu Val Lys 20 1 00 1 05 110

Pro Val Thr Ser Gly Cys Phe Pro He Met His Asp Arg Thr Lys He 115 120 125 25 Arg Gin Leu Pro Asn Leu Leu Arg Gly Tyr Glu Asn He Arg Leu Ser 130 135 140

Thr Gin Asn Val He Asp Ala Glu Lys Ala Pro Gly Gly Pro Tyr Arg 145 150 155 160 30

Leu Gly Thr Ser Gly Ser Cys Pro Asn Ala Thr Ser Lys Ser Gly Phe 165 170 175

Phe Ala Thr Met Ala Trp Ala Val Pro Lys Asp Asn Asn Lys Asn Ala 180 185 190 35

Thr Asn Pro Leu Thr Val Glu Val Pro Tyr He Cys Thr Glu Gly Glu 195 200 205

Asp Gin He Thr Val Trp Gly Phe His Ser Asp Asn Lys Thr Gin Met 40 210 215 220

Lys Asn Leu Tyr Gly Asp Ser Asn Pro Gin Lys Phe Thr Ser Ser Ala 225 230 235 240 45 Asn Gly Val Thr Thr His Tyr Val Ser Gin lie Gly Ser Phe Pro Asp

JO 55 245 250 255

Gin Thr Glu Asp Gly Gly Leu Pro Gin Ser Gly Arg lie Val Val Asp 260 265 270 s

Tyr Met Met Gin Lys Pro Gly Lys Thr Gly Thr lie Val Tyr Gin Arg 275 280 285

Gly Val Leu Leu Pro Gin Lys Val Trp Cys Ala Ser Gly Arg Ser Lys „ 290 295 300

Val lie Lys Gly Ser Leu Pro Leu lie Gly Glu Ala Asp Cys Leu His 305 310 315 320

Glu Lys Tyr Gly Gly Leu Asn Lys Ser Lys Pro Tyr Tyr Thr Gly Glu H 325 330 335

His Ala Lys Ala lie Gly Asn Cys Pro lie Trp Val Lys Thr Pro Leu 340 345 350 20 Lys Leu Ala Asn Gly Thr Lys Tyr Arg Pro Pro Ala Lys Leu Leu Lys 355 360 365

Glu Arg Gly Phe Phe Gly Ala He Ala Gly Phe Leu Glu Gly Gly Trp 370 375 380 25 Glu Gly Met lie Ala Gly Trp His Gly Tyr Thr Ser His Gly Ala His 385 390 395 400

Gly Val Ala Val Ala Ala Asp Leu Lys Ser Thr Gin Glu Ala He Asn 405 410 415 30

Lys He Thr Lys Asn Leu Asn Ser Leu Ser Glu Leu Glu Val Lys Asn 420 425 430

Leu Gin Arg Leu Ser Gly Ala Met Asp Glu Leu His Asn Glu lie Leu 435 440 445 35

Glu Leu Asp Glu Lys Val Asp Asp Leu Arg Ala Asp Thr He Ser Ser 450 455 460

Gin lie Glu Leu Ala Val Leu Leu Ser Asn Glu Gly lie lie Asn Ser 40 4 6 5 4 7 0 4 7 5 4 8 0

Glu Asp Glu His Leu Leu Ala Leu Glu Arg Lys Leu Lys Lys Met Leu 485 490 495 45 Gly Pro Ser Ala Val Glu He Gly Asn Gly Cys Phe Glu Thr Lys His 500 505 510

Lys Cys Asn Gin Thr Cys Leu Asp Arg He Ala Ala Gly Thr Phe Asn 515 520 525 30 Ala Gly Glu Phe Ser Leu Pro Thr Phe Asp Ser Leu Asn He Thr Ala 530 535 540

Ala Ser Leu Asn Asp Asp Gly Leu Asp Asn Tyr Gin lie Leu Ser lie 545 550 555 560 55

Tyr Ser Thr Val Ala Ser Ser Leu Ala Leu Ala lie Met Met Ala Gly 565 570 575

Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gin Cys Arg lie Cys 580 585 590 lie 5

<210>85 <211>405 <212> DNA <213> ArtHielal Sequence 10 <220» <223> Synthesized Sacl-Plasto 3(prime)UTR sequence <400>85 is 60 gagctctaag ttaaaatgct tcttcgtctc ctatttataa tatggtttgt tattgttaat 120 tttgttcttg tagaagagct taattaatcg ttgttgttat gaaatactat ttgtatgaga 180 20 tgaactggtg taatgtaatt catttacata agtggagtca gaatcagaat gtttcctcca 240 taactaacta gacatgaaga cctgccgcgt acaattgtct tatatttgaa caactaaaat tgaacatctt ttgccacaac tttataagtg gttaatatag ctcaaatata tggtcaagtt 300 25 360 caatagatta ataatggaaa tatcagttat cgaaattcat taacaatcaa cttaacgtta 405 ttaactacta attttatatc atcccctttg ataaatgata gtaca 30 <210> 86

<211> 1718 <212> DNA <213> Artificial Sequence 35 <220> <22J> Synthesized POI sp - A/CalHbmia/W/09 <40086 40 atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttcctctc 60 agatcttcgc tgacacatta tgtataggtt atcatgcgaa caattcaaca gacactgtag 120 5 acacagtact agaaaagaat gtaacagtaa cacactctgt taaccttcta gaagacaagc 180 ataacgggaa actatgcaaa ctaagagggg tagccccatt gcatttgggt aaatgtaaca 240 ttgctggctg gatcctggga aatccagagt gtgaatcact ctccacagca agctcatggt 300 10 cctacattgt ggaaacacct agttcagaca atggaacgtg ttacccagga gatttcatcg 360 attatgagga gctaagagag caattaagct cagtgtcatc atttgaaagg tttgagatat 420 *5 tccccaagac aagttcatgg cccaatcatg actcgaacaa aggtgtaacg gcagcatgtc 480 ctcatgctgg agcaaaaagc ttctacaaaa atttaatatg gctagttaaa aaaggaaatt 540 catacccaaa gctcagcaaa tcctacatta atgataaagg gaaagaagtc ctcgtgctat 600 20 ggggcattca ccatccatct actagtgctg accaacaaag tctctatcag aatgcagata 660 catatgtttt tgtggggtca tcaagataca gcaagaagtt caagccggaa atagcaataa 720 25 gacccaaagt gagggatcaa gaagggagaa tgaactatta ctggacacta gtagagccgg 780 gagacaaaat aacattcgaa gcaactggaa atctagtggt accgagatat gcattcgcaa 840 tggaaagaaa tgctggatct ggtattatca tttcagatac accagtccac gattgcaata 900 caacttgtca aacacccaag ggtgctataa acaccagcct cccatttcag aatatacatc 960 cgatcacaat tggaaaatgt ccaaaatatg taaaaagcac aaaattgaga ctggccacag 1020 35 gattgaggaa tatcccgtct attcaatcta gaggactatt tggggccatt gccggtttca 1080 ttgaaggggg gtggacaggg atggtagatg gatggtacgg ttatcaccat caaaatgagc 1140 aggggtcagg atatgcagcc gacctgaaga gcacacagaa tgccattgac gagattacta 1200 acaaagtaaa ttctgttatt gaaaagatga atacacagtt cacagcagta ggtaaagagt 1260 tcaaccacct ggaaaaaaga atagagaatt taaataaaaa agttgatgat ggtttcctgg 1320 *s acatttggac ttacaatgcc gaactgttgg ttctattgga aaatgaaaga actttggact 1380 accacgattc aaatgtgaag aacttatatg aaaaggtaag aagccagcta aaaaacaatg 1440 ccaaggaaat tggaaacggc tgctttgaat tttaccacaa atgcgataac acgtgcatgg 1500 50 aaagtgtcaa aaatgggact tatgactacc caaaatactc agaggaagca aaattaaaca 1560 gagaagaaat agatggggta aagctggaat caacaaggat ttaccagatt ttggcgatct 1620 ss attcaactgt cgccagttca ttggtactgg tagtctccct gggggcaatc agtttctgga 1680 tgtgctctaa tgggtctcta cagtgtagaa tatgtatt 1718

<210> 87 <211> 573 <212> PRT <213> Artificial Sequence <220> <223> Synthesized POI sp- A/CalHbmia 04/09 <400> 87

Met Ala Lys Asn Val Ala lie Phe Gly Leu Leu Phe Ser Leu Leu Val 15 10 15

Leu Val Pro Ser Gin lie Phe Ala Asp Thr Leu Cys lie Gly Tyr His 20 25 30

Ala Asn Asn Ser Thr Asp Thr Val Asp Thr Val Leu Glu Lys Asn Val 35 40 45

Thr Val Thr His Ser Val Asn Leu Leu Glu Asp Lys His Asn Gly Lys 50 55 60

Leu Cys Lys Leu Arg Gly Val Ala Pro Leu His Leu Gly Lys Cys Asn 65 70 75 80 lie Ala Gly Trp lie Leu Gly Asn Pro Glu Cys Glu Ser Leu Ser Thr 85 90 95

Ala Ser Ser Trp Ser Tyr lie Val Glu Thr Pro Ser Ser Asp Asn Gly 100 105 110

Thr Cys Tyr Pro Gly Asp Phe lie Asp Tyr Glu Glu Leu Arg Glu Gin 115 120 125

Leu Ser Ser Val Ser Ser Phe Glu Arg Phe Glu lie Phe Pro Lys Thr 130 135 140

Ser Ser Trp Pro Asn His Asp Ser Asn Lys Gly Val Thr Ala Ala Cys 145 150 155 160

Pro His Ala Gly Ala Lys Ser Phe Tyr Lys Asn Leu lie Trp Leu Val 165 170 175

Lys Lys Gly Asn Ser Tyr Pro Lys Leu Ser Lys Ser Tyr lie Asn Asp 180 185 190

Lys Gly Lys Glu Val Leu Val Leu Trp Gly lie His His Pro Ser Thr 195 200 205

Ser Ala Asp Gin Gin Ser Leu Tyr Gin Asn Ala Asp Thr Tyr ValPt.e 210 215 220

Val Gly Ser Ser Arg Tyr Ser Lys Lys Phe Lys Pro Glu lie Ala lie 225 230 235 240

Arg Pro Lys Val Arg Asp Gin Glu Gly Arg Met Asn Tyr Tyr Trp Thr 245 250 255

Leu Val Glu Pro Gly Asp Lys lie Thr Phe Glu Ala Thr Gly Asn Leu 260 265 270

Val Val Pro Arg Tyr Ala Phe Ala Met Glu Arg Asn Ala Gly Ser Gly 275 280 285 lie lie lie Ser Asp Thr Pro val His Asp Cys Asn Thr Thr Cys Gin 290 295 300

Thr Pro Lys Gly Ala lie Asn Thr Ser Leu Pro Phe Gin Asn lie His 305 310 315 320

Pro He Thr lie Gly Lys Cys Pro Lys Tyr val Lys Ser Thr Lys Leu 325 330 335

Arg Leu Ala Thr Gly Leu Arg Asn lie Pro Ser lie Gin Ser Arg Gly 340 345 350

Leu Phe Gly Ala lie Ala Gly Phe lie Glu Gly Gly Trp Thr Gly Met 355 360 365

Val Asp Gly Trp Tyr Gly Tyr His His Gin Asn Glu Gin Gly Ser Gly 370 375 380

Tyr Ala Ala Asp Leu Lys Ser Thr Gin Asn Ala lie Asp Glu lie Thr 385 390 395 400

Asn Lys Val Asn Ser Val lie Glu Lys Met Asn Thr Gin Phe Thr Ala 405 410 415

Vai Gly Lys Glu Phe Asn His Leu Glu Lys Arg Ile Glu Asn Leu Asn 420 425 430

Lys Lys Vai Asp Asp Gly Phe Leu Asp Ile Trp Thr Tyr Asn Ala Glu 435 440 445

Leu Leu Vai Leu Leu Glu Asn Glu Arg Thr Leu Asp Tyr Hls Asp Ser 450 455 460

Asn Vai Lys Asn Leu Tyr Glu Lys Vai Arg Ser Gin Leu Lys Asn Asn 465 470 475 480

Ala Lys Glu Ile Gly Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp 485 490 495

Asn Thr Cys Met Glu Ser Vai Lys Asn Gly Thr Tyr Asp Tyr Pro Lys 500 505 510

Tyr Ser Glu Glu Ala Lys Leu Asn Arg Glu Glu Ile Asp Gly Vai Lys 515 520 525

Leu Glu Ser Thr Arg lie Tyr Gin Ile Leu Ala Ile Tyr Ser Thr Vai 530 535 540

Ala Ser Ser Leu Vai Leu Vai Vai Ser Leu Gly Ala Ile Ser Phe Trp 545 550 555 560

Met Cys Ser Asn Gly Ser Leu Gin Cys Arg lie Cys Ile 565 570

<210>tt <211> 747 <212> D NA <213> Artificial Sequence <220» <223> Synthesized 2X35S promoter sequence <400>88 gtcaacatgg tggagcacga cacacttgtc tactccaaaa atatcaaaga tacagtctca 60 gaagaccaaa gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga 120 ttccattgcc cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc 180 tacaaatgcc atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt 240 ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc 300 acgtcttcaa agcaagtgga ttgatgtgat aacatggtgg agcacgacac acttgtctac 360 tccaaaaata tcaaagatac agtctcagaa gaccaaaggg caattgagac ttttcaacaa 420 agggtaatat ccggaaacct cctcggattc cattgcccag ctatctgtca ctttattgtg 480 aagatagtgg aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc 540 atcgttgaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 600 atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 660 tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagaccc ttcctctata 720 taaggaagtt catttcattt ggagagg 747

<210> 89 <211>43 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Pad-MCS-2X35S.c <400>89 aattgttaat taagtcgaca agcttgcatg cctgcaggtc aac 43

<210> 90 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Synthesized CPMV 5{prtme)l/TR-2X35S.r <400> 90 tcaaaaccta ttaagatttt aatacctctc caaatgaaat gaacttcc 48

<210> 91 <211> 49 <212> DNA <2U> Artificial Sequence <220> <223> Synthesized 2X35S-CPMV 5(prlme)UTR.c <400> 91 ttggagaggt attaaaatct taataggttt tgataaaagc gaacgtggg 49

<210> 92 <211 >44 <212> DNA <213> Artificial Sequence <220> <223> Synthesized Apal-M prot.r <400> 92 tctccatggg cccgacaaat ttgggcagaa tatacagaag ctta 44 <210> 93 <211>3580

<212> DNA <213> Artificial Sequence <220> <223> Synthesized Construct 747, from Pad to Asel <400> 93 ttaattaagt cgacaagctt gcatgcctgc aggtcaacat ggtggagcac gacacacttg 60 tctactccaa aaatatcaaa gatacagtct cagaagacca aagggcaatt gagacttttc 120 aacaaagggt aatatccgga aacctcctcg gattccattg cccagctatc tgtcacttta 180 ttgtgaagat agtggaaaag gaaggtggct cctacaaatg ccatcattgc gataaaggaa 240 aggccatcgt tgaagatgcc tctgccgaca gtggtcccaa agatggaccc ccacccacga 300 ggagcatcgt ggaaaaagaa gacgttccaa ccacgtcttc aaagcaagtg gattgatgtg 360 ataacatggt ggagcacgac acacttgtct actccaaaaa tatcaaagat acagtctcag 420 aagaccaaag ggcaattgag acttttcaac aaagggtaat atccggaaac ctcctcggat 480 tccattgccc agctatctgt cactttattg tgaagatagt ggaaaaggaa ggtgqctcct 540 acaaatgcca tcattgcgat aaaggaaagg ccatcgttga agatgcctct gccgacagtg 600 gtcccaaaga tggaccccca cccacgagga gcatcgtgga aaaagaagac gttccaacca 660 cgtcttcaaa gcaagtggat tgatgtgata tctccactga cgtaagggat gacgcacaat 720 cccactatcc ttcgcaagac ccttcctcta tataaggaag ttcatttcat ttggagaggt 780 attaaaatct taataggttt tgataaaagc gaacgtgggg aaacccgaac caaaccttct 840 tctaaactct ctctcatctc tcttaaagca aacttctctc ttgtctttct tgcgtgagcg 900 atcttcaacg ttgtcagatc gtgcttcgqc accagtacaa cgttttcttt cactgaagcg 960 aaatcaaaga tctctttgtg gacacgtagt gcggcgccat taaataacgt gtacttgtcc 1020 tattcttgtc ggtgtggtct tgggaaaaga aagcttgctg gaggctgctg ttcagcccca 1080 tacattactt gttacgattc tgctgacttt cggcgggtgc aatatctcta cttctgcttg 1140 acgaggtatt gttgcctgta cttctttctt cttcttcttg ctgattggtt ctataagaaa 1200 tctagtattt tctttgaaac agagttttcc cgtggttttc gaacttggag aaagattgtt 1260 aagcttctgt atattctgcc caaatttgtc gggcccatgg cgaaaaacgt tgcgattttc 1320 ggcttattgt tttctcttct tgtgttggtt ccttctcaga tcttcgctga tcgaatctgc 1380 actggaataa catcttcaaa ctcacctcat gtggtcaaaa cagccactca aggggaggtc 1440 aatgtgactg gtgtgatacc actaacaaca acaccaacaa aatcttattt tgcaaatctc 1500 aaaggaacaa ggaccagagg gaaacbatgc ccagacfcgfcc tcaactgcac agatctggat 1560 gtggctttgg gcagaccaat gtgtgtgggg aecaeaectt cggcgaaggc ttcaatactc 1620 cacgaagtca aacctgttac atccgggtgc tttcctataa tgcacgacag aacaaaaalc 1680 aggcaactac ccaatcttct cagaggatat gaaaatatca ggctatcaac ccaaaacgtc 1740 atcqatgcgg aaaaggcacc aggaggaccc tacagacttg gaacctcagg atcttgccct 1800 aacgctacca gtaagagcgg atttttcgca acaatggctt gggctgtccc aaaggacaac 1860 aacaaaaatg caacgaaccc actaacagta gaagtaccat acatttgtac agaaggggaa 1920 gaccaaatca ctgtttgggg gttccattca gataacaaaa cccaaatgaa gaacctctat 1980 ggagactcaa atcctcaaaa gttcacctca tctgctaatg gagtaaccac acactatgtt 2040 tctcagattg gcagcttccc agatcaaaca gaagacggag gactaccaca aagcggcagg 2100 attgttgttg attacatgat gcaaaaacct gggaaaacag gaacaattgt ctaccaaaga 2160 ggtgttttgt tgcctcaaaa ggtgtggtgc gcgagtggca ggagcaaagt aataaaaggg 2220 tccttgcctt taattggtga agcagattgc cttcatgaaa aatacggtgg attaaacaaa 2280 agcaagcctt actacacagg agaacatgca aaagccatag gaaattgccc aatatgggtg 2340 aaaacacctt tgaagctcgc caatggaacc aaatatagac ctcctgcaaa actattaaag 2400 gaaaggggtt tcttcggagc tattgctggt ttcctagaag gaggatggga aggaatgatt 2460 gcaggctggc acggatacac atctcacgga gcacatggag tggcagtggc ggcggacctt 2520 aagagtacgc aagaagctat aaacaagata acaaaaaatc tcaattcttt gagtgagcta 2580 gaagtaaaga atcttcaaag actaagtggt gccatggatg aactccacaa cgaaatactc 2640 gagctggatg agaaagtgga tgatctcaga gctgacacta taagctcgca aatagaactt 2700 gcagtcttgc tttccaacga aggaataata aacagtgaag atgagcatct attggcactt 2760 gagagaaaac taaagaaaat gctgggtccc tctgctgtag agataggaaa tggatgcttc 2820 gaaaccaaac acaagtgcaa ccagacctgc ttagacagga tagctgctgg cacctttaat 2880 gcaggagaat tttctctccc cacttttgat tcactgaaca ttactgctgc atctttaaat 2940 gatgatggat tggataacta ccaaatactg tcaatttatt caacagtggc gagttcccta 3000 gcactggcaa tcatgatggc tggtctatct ttatggatgt gctccaatgg atcgttacaa 3060 tgcagaattt gcatttaaag gcctattttc tttagtttga atttactgtt attcggtgtg 3120 catttctatg tttggtgagc ggttttctgt gctcagagtg tgtttatttt atgtaattta 3180 atttctttgt gagctcctgt ttagcaggtc gtcccttcag caaggacaca aaaagatttt 3240 aattttatta aaaaaaaaaa aaaaaaagac cgggaattcg atatcaagct tatcgacctg 3300 cagatcgttc aaacatttgg caataaagtt tcttaagatt gaatcctgtt gccggtcttg 3360 cgatgattat catataattt ctgttgaatt acgttaagca tgtaataatt aacatgtaat 3420 gcatgacgtt atttatgaga tgggttttta tgattagagt cccgcaatta tacatttaat 3480 acgcgataga aaacaaaata tagcgcgcaa actaggataa attatcgcgc gcggtgtcat 3540 ctatgttact agattctaga gtctcaagct tcggcgcgcc 3580

<210> 94 <211> S69 <212> PRT <213> Artificial Sequence <220> <223> Synthesized Influenza B virus B/Florida/4/2006 <400> 94

Asp Arg lie Cys Thr Gly lie Thr Ser Ser Asn Ser Pro His Val Val 15 10 15

Lys Thr Ala Thr Gin Gly Glu Val Asn Val Thr Gly Val lie Pro Leu 20 25 30

Thr Thr Thr Pro Thr Lys Ser Tyr Phe Ala Asn Leu Lys Gly Thr Arg 35 40 45

Thr Arg Gly Lys Leu Cys Pro Asp Cys Leu Asn Cys Thr Asp Leu Asp 50 55 60

Val Ala Leu Gly Arg Pro Met Cys Val Gly Thr Thr Pro Ser Ala Lys 65 70 75 80

Ala Ser lie Leu His Glu Val Lys Pro Val Thr Ser Gly Cys Phe Pro 85 90 95 lie Met His Asp Arg Thr Lys lie Arg Gin Leu Pro Asn Leu Leu Arg 100 105 110

Gly Tyr Glu Asn lie Arg Leu Ser Thr Gin Asn Val lie Asp Ala Glu 115 120 125

Lys Ala Pro Gly Gly Pro Tyr Arg Leu Gly Thr Ser Gly Ser Cys Pro 130 135 140

Asn Ala Thr Ser Lys Ser Gly Phe Phe Ala Thr Met Ala Trp Ala Val 145 150 155 160

Pro Lys Asp Asn Asn Lys Asn Ala Thr Asn Pro Leu Thr Val Glu Val 165 170 175

Pro Tyr lie Cys Thr Glu Gly Glu Asp Gin lie Thr Val Trp Gly Phe 180 185 190

His Ser Asp Asp Lys Thr Gin Met Lys Asn Leu Tyr Gly Asp Ser Asn 195 200 205

Pro Gin Lys Phe Thr Ser Ser Ala Asn Gly Val Thr Thr His Tyr Val 210 215 220

Ser Gin lie Gly Ser Phe Pro Asp Gin Thr Glu Asp Gly Gly Leu Pro 225 230 235 240

Gin Ser Gly Arg lie Val Val Asp Tyr Met Met Gin Lys Pro Gly Lys 245 250 255

Thr Gly Thr lie Val Tyr Gin Arg Gly Val Leu Leu Pro Gin Lys Val 260 265 270

Trp Cys Ala Ser Gly Arg Ser Lys Val lie Lys Gly Ser Leu Pro Leu 275 280 285 lie Gly Glu Ala Asp Cys Leu His Glu Lys Tyr Gly Gly Leu Asn Lys 290 295 300

Ser Lys Pro Tyr Tyr Thr Gly Glu His Ala Lys Ala lie Gly Asn Cys 305 310 315 320

Pro lie Trp Val Lys Thr Pro Leu Lys Leu Ala Asn Gly Thr Lys Tyr 325 330 335

Arg Pro Pro Ala Lys Leu Leu Lys Glu Arg Gly Phe Phe Gly Ala lie 340 345 350

Ala Gly Phe Leu Glu Gly Gly Trp Glu Gly Met lie Ala Gly Trp His 355 360 365

Gly Tyr Thr Ser His Gly Ala His Gly Val Ala Val Ala Ala Asp Leu 370 375 380

Lys Ser Thr Gin Glu Ala lie Asn Lys lie Thr Lys Asn Leu Asn Ser 385 390 395 400

Leu Ser Glu Leu Glu Val Lys Asn Leu Gin Arg Leu Ser Gly Ala Met 405 410 415

Asp Glu Leu His Asn Glu lie Leu Glu Leu Asp Glu Lys Val Asp Asp 420 425 430

Leu Arg Ala Asp Thr lie Ser Ser Gin lie Glu Leu Ala Val Leu Leu 435 440 445

Ser Asn Glu Gly lie lie Asn Ser Glu Asp Glu His Leu Leu Ala Leu 450 455 460

Glu Arg Lys Leu Lys Lys Met Leu Gly Pro Ser Ala Val Glu lie Gly 465 470 475 480

Asn Gly Cys Phe Glu Thr Lys His Lys Cys Asn Gin Thr Cys Leu Asp 485 490 495

Arg lie Ala Ala Gly Thr Phe Asn Ala Gly Glu Phe Ser Leu Pro Thr 500 505 510

Phe Asp Ser Leu Asn lie Thr Ala Ala Ser Leu Asn Asp Asp Gly Leu 515 520 525

Asp Asn His Thr lie Leu Leu Tyr Tyr Ser Thr Ala Ala Ser Ser Leu 530 535 540

Ala Val Thr Leu Met Leu Ala lie Phe lie Val Tyr Met Val Ser Arg 545 550 555 560

Asp Asn Val Ser Cys Ser lie Cys Leu 565 <210> 95

<211> 570 <212> PRT <213> Artificial Sequence <220> <223> Synthesized Influenza B virus B/Malaysia/2506/2004 <400> 95

Asp Arg lie Cys Thr Gly lie Thr Ser Ser Asn Ser Pro His Val Val 15 10 15

Lys Thr Ala Thr Gin Gly Glu Val Asn Val Thr Gly Val lie Pro Leu 20 25 30

Thr Thr Thr Pro Thr Lys Ser His Phe Ala Asn Leu Lys Gly Thr Glu 35 40 45

Thr Arg Gly Lys Leu Cys Pro Lys Cys Leu Asn Cys Thr Asp Leu Asp 50 55 60

Val Ala Leu Gly Arg Pro Lys Cys Thr Gly Asn lie Pro Ser Ala Arg 65 70 75 80

Val Ser lie Leu His Glu Val Arg Pro Val Thr Ser Gly Cys Phe Pro 85 90 95 lie Met His Asp Arg Thr Lys lie Arg Gin Leu Pro Lys Leu Leu Arg 100 105 110

Gly Tyr Glu His lie Arg Leu Ser Thr His Asn Val lie Asn Ala Glu 115 120 125

Asn Ala Pro Gly Gly Pro Tyr Lys lie Gly Thr Ser Gly Ser Cys Pro 130 135 140

Asn Val Thr Asn Gly Asn Gly Phe Phe Ala Thr Met Ala Trp Ala Val 145 150 155 160

Pro Lys Asn Asp Asn Asn Lys Thr Ala Thr Asn Ser Leu Thr lie Glu 165 170 175

Val Pro Tyr lie Cys Thr Glu Gly Glu Asp Gin lie Thr Val Trp Gly 180 185 190

Phe His Ser Asp Asn Glu Thr Gin Met Ala Lys Leu Tyr Gly Asp Ser 195 200 205

Lys Pro Gin Lys Phe Thr Ser Ser Ala Asn Gly Val Thr Thr His Tyr 210 215 220

Vai Ser Gin lie Gly Gly Phe Pro Asn Gin Thr Glu Asp Gly Gly Leu 225 230 235 240

Pro Gin Ser Gly Arg lie Vai Vai Asp Tyr Met Vai Gin Lys Ser Gly 245 250 255

Lys Thr Gly Thr lie Thr Tyr Gin Arg Gly lie Leu Leu Pro Gin Lys 260 265 270

Vai Trp Cys Ala Ser Gly Arg Ser Lys Vai Ile Lys Gly Ser Leu Pro 275 280 285

Leu Ile Gly Glu Ala Asp Cys Leu His Glu Lys Tyr Gly Gly Leu Asn 290 295 300

Lys Ser Lys Pro Tyr Tyr Thr Gly Glu His Ala Lys Ala Ile Gly Asn 305 310 315 320

Cys Pro lie Trp Val Lys Thr Pro Leu Lys Leu Ala Asn Gly Thr Lys 325 330 335

Tyr Arg Pro Pro Ala Lys Leu Leu Lys Glu Arg Gly Phe Phe Gly Ala 340 345 350 lie Ala Gly Phe Leu Glu Gly Gly Trp Glu Gly Met lie Ala Gly Trp 355 360 365

His Gly Tyr Thr Ser His Gly Ala His Gly Val Ala Val Ala Ala Asp 370 375 380

Leu Lys Ser Thr Gin Glu Ala lie Asn Lys lie Thr Lys Asn Leu Asn 385 390 395 400

Ser Leu Ser Glu Leu Glu Val Lys Asn Leu Gin Arg Leu Ser Gly Ala 405 410 415

Met Asp Glu Leu His Asn Glu lie Leu Glu Leu Asp Glu Lys Val Asp 420 425 430

Asp Leu Arg Ala Asp Thr lie Ser Ser Gin lie Glu Leu Ala Val Leu 435 440 445

Leu Ser Asn Glu Gly lie lie Asn Ser Glu Asp Glu His Leu Leu Ala 450 455 460

Leu Glu Arg Lys Leu Lys Lys Met Leu Gly Pro Ser Ala Val Glu lie 465 470 475 480

Gly Asn Gly Cys Phe Glu Thr Lys His Lys Cys Asn Gin Thr Cys Leu 485 490 495

Asp Arg lie Ala Ala Gly Thr Phe Asp Ala Gly Glu Phe Ser Leu Pro 500 505 510

Thr Phe Asp Ser Leu Asn lie Thr Ala Ala Ser Leu Asn Asp Asp Gly 515 520 525

Leu Asp Asn His Thr lie Leu Leu Tyr Tyr Ser Thr Ala Ala Ser Ser 530 535 540

Leu Ala Val Thr Leu Met lie Ala lie Phe Val Val Tyr Met Val Ser 545 550 555 560

Arg Asp Asn Val Ser Cys Ser lie Cys Leu 565 570

<210> 96 <211> 548 <212> PRT <213> Artificial Sequence <220> <223> Synthesized Influenza A virus A/Brisbane/59/2007(HlNl) <400> 96

Asp Thr lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val 15 10 15

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu 20 25 30

Leu Glu Asn Ser His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 35 40 45

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 50 55 60

Pro Glu Cys Glu Leu Leu lie Ser Lys Glu Ser Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly His Phe Ala 85 90 95

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 100 105 110

Arg Phe Glu lie Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 115 120 125

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser Ser Phe Tyr 130 135 140

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 145 150 155 160

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 165 170 175

Gly Val His His Pro Pro Asn lie Gly Asn Gin Lys Ala Leu Tyr His 180 185 190

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Lys 195 200 205

Phe Thr Pro Glu lie Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 210 215 220

Arg lie Jl.sn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr lie lie 225 230 235 240

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 245 250 255

Ser Arg Gly Phe Gly Ser Gly lie lie Asn Ser Asn Ala Pro Met Asp 260 265 270

Lys Cys Asp Ala Lys Cys Gin Thr Pro Gin Gly Ala lie Asn Ser Ser 275 280 285

Leu Pro Phe Gin Asn Val His Pro Val Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Vai Arg Ser Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn lie 305 310 315 320

Pro Ser lie Gin Ser Arg Gly Leu Phe Gly Ala lie Ala Gly Phe lie 325 330 335

Glu Gly Gly Trp Thr Gly Met Vai Asp Gly Trp Tyr Gly Tyr His His 340 345 350

Gin Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Gin Lys Ser Thr Gin 355 360 365

Asn Ala lie Asn Gly Ile Thr Asn Lys Vai Asn Ser Vai Ile Glu Lys 370 375 380

Met Asn Thr Gin Phe Thr Ala Vai Gly Lys Glu Phe Asn Lys Leu Glu 385 390 395 400

Arg Arg Met Glu Asn Leu Asn Lys Lys Vai Asp Asp Gly Phe Ile Asp 405 410 415

Ile Trp Thr Tyr Asn Ala Glu Leu Leu Vai Leu Leu Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Vai Lys Asn Leu Tyr Glu Lys Vai 435 440 445

Lys Ser Gin Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asn Asp Glu Cys Met Glu Ser Vai Lys Asn 465 470 475 480

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg 485 490 495

Glu Lys Ile Asp Gly Vai Lys Leu Glu Ser Met Gly Vai Tyr Gin Ile 500 505 510

Leu Ala Ile Tyr Ser Thr Vai Ala Ser Ser Leu Vai Leu Leu Vai Ser 515 520 525

Leu Gly Ala Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg lie Cys Ile 545

<210> 97 <211> 548 <212> PRT <213> Artificial Sequence <220> <223> Synthesized Influenza A vírus A/Solomon lslands/3/2006(HlNl) <400> 97

Asp Thr lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val 15 10 15

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu 20 25 30

Leu Glu Asp Ser His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 35 40 45

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 50 55 60

Pro Glu Cys Glu Leu Leu lie Ser Arg Glu Ser Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly His Phe Ala 85 90 95

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 100 105 110

Arg Phe Glu lie Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Thr 115 120 125

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser Ser Phe Tyr 130 135 140

Lys Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 145 150 155 160

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 165 170 175

Gly Val His His Pro Pro Asn lie Gly Asp Gin Arg Ala Leu Tyr His 180 185 190

Lys Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arq Lys 195 200 205

Phe Thr Pro Glu lie Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 210 215 220

Arg lie Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr lie lie 225 230 235 240

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 245 250 255

Ser Arg Gly Phe Gly Ser Gly lie lie Asn ser Asn Ala Pro Met Asp 260 265 270

Glu Cys Asp Ala Lys Cys Gin Thr Pro Gin Gly Ala lie Asn Ser Ser 275 280 285

Leu Pro Phe Gin Asn Val His Pro Val Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Val Arg Ser Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn lie 305 310 315 320

Pro Ser lie Gin Ser Arg Gly Leu Phe Gly Ala lie Ala Gly Phe lie 325 330 335

Glu Gly Gly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 340 345 350

Gin Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Gin Lys Ser Thr Gin 355 360 365

Asn Ala lie Asn Gly Ile Thr Asn Lys Vai Asn Ser Vai Ile Glu Lys 370 375 380

Met Asn Thr Gin Phe Thr Ala Val Gly Lys Glu Phe Asn Lys Leu Glu 385 390 395 400

Arg Arg Met Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe lie Asp 405 410 415 lie Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val 435 440 445

Lys Ser Gin Leu Lys Asn Asn Ala Lys Glu lie Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asn Asp Glu Cys Met Glu Ser Val Lys Asn 465 470 475 480

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg 485 490 495

Glu Lys lie Asp Gly Val Lys Leu Glu Ser Met Gly Val Tyr Gin lie 500 505 510

Leu Ala lie Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Leu Val Ser 515 520 525

Leu Gly Ala lie Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg lie Cys lie 545

<210> 98 <211> 548 <212> PRT <213> Artificial Sequence <220> <223> Synthesized Influenza A virus A/New Caledonla/20/1999(H1N1) <400> 98

Asp Thr lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val 15 10 15

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu 20 25 30

Leu Glu Asp Ser His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 35 40 45

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 50 55 60

Pro Glu Cys Glu Leu Leu lie Ser Lys Glu Ser Trp Ser Tyr lie Val 65 70 75 80

Glu Thr Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly Tyr Phe Ala 85 90 95

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 100 105 110

Arg Phe Glu lie Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 115 120 125

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Lys Ser Ser Phe Tyr 130 135 140

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 145 150 155 160

Ser Lys Ser Tyr Val Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 165 170 175

Gly Val His His Pro Pro Asn lie Gly Asn Gin Arg Ala Leu Tyr His 180 185 190

Thr Glu Asn Ala Tyr val Ser Val Val Ser Ser His Tyr Ser Arg Arg 195 200 205

Phe Thr Pro Glu lie Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 210 215 220

Arg lie Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr lie lie 225 230 235 240

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Trp Tyr Ala Phe Ala Leu 245 230 255

Ser Arg Gly Phe Gly Ser Gly lie lie Thr Ser Asn Ala Pro Met Asp 260 265 270

Glu Cys Asp Ala Lys Cys Gin Thr Pro Gin Gly Ala lie Asn Ser Ser 275 280 285

Leu Pro Phe Gin Asn Val His Pro Val Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Val Arg Ser Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn lie 305 310 315 320

Pro Ser lie Gin Ser Arg Gly Leu Phe Gly Ala He Ala Gly Phe lie 325 330 335

Glu Gly Gly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 340 345 350

Gin Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Gin Lys Ser Thr Gin 355 360 365

Asn Ala He Asn Gly He Thr Asn Lys Val Asn Ser Val He Glu Lys 370 375 380

Met Asn Thr Gin Phe Thr Ala Val Gly Lys Glu Phe Asn Lys Leu Glu 385 390 395 400

Arg Arg Met Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe Leu Asp 405 410 415 lie Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val 435 440 445

Lys Ser Gin Leu Lys Asn Asn Ala Lys Glu lie Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asn Asn Glu Cys Met Glu Ser Val Lys Asn 465 470 475 480

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg 485 490 495

Glu Lys lie Asp Gly Val Lys Leu Glu Ser Met Gly Val Tyr Gin lie 500 505 510

Leu Ala lie Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Leu Val Ser 515 520 525

Leu Gly Ala lie Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg lie Cys lie 545

<210> 99 <211> 547 <212> PRT <213> Artificial Sequence <220> <223> Synthesized Influenza A virus A/Slngapore/l/1957(H2N2) <400» 99

Asp Gin lie Cys He Gly Tyr His Ala Asn Asn Ser Thr Glu Lys Val 15 10 15

Asp Thr lie Leu Glu Arg Asn Val Thr Val Thr His Ala Lys Asp lie 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Lys Leu Asn Gly He Pro 35 40 45

Pro Leu Glu Leu Gly Asp Cys Ser lie Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Glu Cys Asp Arg Leu Leu Ser Val Pro Glu Trp Ser Tyr He Met 65 70 75 80

Glu Lys Glu Asn Pro Arg Asp Gly Leu Cys Tyr Pro Gly Ser Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Ser Val Lys His Phe Glu 100 105 110

Lys Val Lys He Leu Pro Lys Asp Arg Trp Thr Gin His Thr Thr Thr 115 120 125

Gly Gly Ser Arg Ala Cys Ala Val Ser Gly Asn Pro Ser Phe Phe Arg 130 135 140

Asn Met Val Trp Leu Thr Lys Lys Glu Ser Asn Tyr Pro Val Ala Lys 145 150 155 160

Gly Ser Tyr Asn Asn Thr Ser Gly Glu Gin Met Leu lie lie Trp Gly 165 170 175

Val His His Pro Asn Asp Glu Thr Glu Gin Arg Thr Leu Tyr Gin Asn 180 185 190

Val Gly Thr Tyr Val Ser Val Gly Thr Ser Thr Leu Asn Lys Arg Ser 195 200 205

Thr Pro Asp lie Ala Thr Arg Pro Lys Val Asn Gly Leu Gly Ser Arg 210 215 220

Met Glu Phe Ser Trp Thr Leu Leu Asp Met Trp Asp Thr lie Asn Phe 225 230 235 240

Glu Ser Thr Gly Asn Leu lie Ala Pro Glu Tyr Gly Phe Lys lie Ser 245 250 255

Lys Arg Gly Ser Ser Gly lie Met Lys Thr Glu Gly Thr Leu Glu Asn 260 265 270

Cys Glu Thr Lys Cys Gin Thr Pro Leu Gly Ala lie Asn Thr Thr Leu 275 280 285

Pro Phe His Asn Val His Pro Leu Thr lie Gly Glu Cys Pro Lys Tyr 290 295 300

Val Lys Ser Glu Lys Leu Val Leu Ala Thr Gly Leu Arg Asn Val Pro 305 310 315 320

Gin lie Glu Ser Arg Gly Leu Phe Gly Ala lie Ala Gly Phe lie Glu 325 330 335

Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr Gly Tyr His His Ser 340 345 350

Asn Asp Gin Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gin Lys 355 360 365

Ala Phe Asp Gly lie Thr Asn Lys Val Asn Ser Val lie Glu Lys Met 370 375 380

Asn Thr Gin Phe Glu Ala Val Gly Lys Glu Phe Ser Asn Leu Glu Arg 385 390 395 400

Arrr Τ.Α1Ί fll π ZLcn T.ail 71 ο·η Taíc T.we Mat Tiers ίϊΐ w UVsta T.an &amp;ev\ TTa 1 405 410 415

Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg Thr 420 425 430

Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val Arg 435 440 445

Met Gin Leu Arg Asp Asn Val Lys Glu Leu Gly Asn Gly Cys Phe Glu 450 455 460

Phe Tyr His Lys Cys Asp Asp Glu Cys Met Asn Ser Val Lys Asn Gly 465 470 475 480

Thr Tyr Asp Tyr Pro Lys Tyr Glu Glu Glu Ser Lys Leu Asn Arg Asn 485 490 495

Glu lie Lys Gly Val Lys Leu Ser Ser Met Gly Val Tyr Gin lie Leu 500 505 510

Ala lie Tyr Ala Thr Val Ala Gly Ser Leu Ser Leu Ala lie Met Met 515 520 525

Ala Gly lie Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys Arg 530 535 540 lie Cys lie 545

<210> 100 <211>541 <212> PRT <213> Artificial Sequence <220> <223> Synthesized [Influenza A virus A/Brisbane/10/2007(H3N2) <400> 100

Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr lie 15 10 15

Val Lys Thr lie Thr Asn Asp Gin lie Glu Val Thr Asn Ala Thr Glu 20 25 30

Leu Val Gin Ser Ser Ser Thr Gly Glu lie Cys Asp Ser Pro His Gin 35 40 45 lie Leu Asp Gly Glu Asn Cys Thr Leu lie Asp Ala Leu Leu Gly Asp 50 55 60

Pro Gin Cys Asp Gly Phe Gin Asn Lys Lys Trp Asp Leu Phe Val Glu 65 70 75 80

Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp Tyr 85 90 95

Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe Asn 100 105 110

Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gin Asn Gly Thr Ser Ser 115 120 125

Ala Cys lie Arg Arg Ser Asn Asn Ser Phe Phe Ser Arg Leu Asn Trp 130 135 140

Leu Thr His Leu Lys Phe Lys Tyr Pro Ala Leu Asn Val Thr Met Pro 145 150 155 160

Asn Asn Glu Lys Phe Asp Lys Leu Tyr lie Trp Gly Vai His His Pro 165 170 175

Gly Thr Asp Asn Asp Gin Ile Phe Leu Tyr Ala Gin Ala Ser Gly Arg 180 185 190

Ile Thr Vai Ser Thr Lys Arg Ser Gin Gin Thr Vai lie Pro Asn Ile 195 200 205

Gly Ser Arg ?ro Arg Vai Arg Asn lie Pro Ser Arg Ile Ser Ile Tyr 210 215 220

Trp Thr lie Vai Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr Gly 225 230 235 240

Asn Leu lie Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys Ser 245 250 255

Ser lie Met Arg Ser Asp Ala Pro lie Gly Lys Cys Asn Ser Glu Cys 260 265 270 lie Thr Pro Asn Gly Ser lie Pro Asn Asp Lys Pro Phe Gin Asn Vai 275 280 285

Asn Arg lie Thr Tyr Gly Ala Cys Pro Arg Tyr Vai Lys Gin Asn Thr 290 295 300

Leu Lys Leu Ala Thr Gly Met Arg Asn Vai Pro Glu Lys Gin Thr Arg 305 310 315 320

Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly 325 330 335

Met Vai Asp Gly Trp Tyr Gly Phe Arg His Gin Asn Ser Glu Gly Ile 340 345 350

Gly Gin Ala Ala Asp Leu Lys Ser Thr Gin Ala Ala Ile Asp Gin Ile 355 360 365

Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe His 370 375 380

Gin Ile Glu Lys Glu Phe Ser Glu Vai Glu Gly Arg Ile Gin Asp Leu 385 390 395 400

Glu Lys Tyr Vai Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn Ala 405 410 415

Glu Leu Leu Vai Ala Leu Glu Asn Gin His Thr Ile Asp Leu Thr Asp 420 425 430

Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gin Leu Arg Glu 435 440 445

Asn Ala Glu Asp Met Gly J:..snGly Cys Phe Lys lie Tyr His Lys Cys 450 455 460

Asp Asn Ala Cys He Gly Ser lie Arg Asn Gly Thr Tyr Asp His Asp 465 470 475 480

Val Tyr Arg Asp Glu Ala Leu Asn Asn Arg Phe Gin lie Lys Gly Val 485 490 495

Glu Leu Lys Ser Gly Tyr Lys Asp Trp lie Leu Trp Ile Ser Phe Ala 500 505 510

Ile Ser Cys Phe Leu Leu Cys Vai Ala Leu Leu Gly Phe lie Met Trp 515 520 525

Ala Cys Gin Lys Gly Asn lie Arg Cys Asn lie Cys Ile 530 535 540

<210> 101 <211> 541 <212> PRT <213> Artificial Sequence <220> <223> Synthesized A/Wisconsin/67e5/2005(H3) <400> 101

Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr lie 15 10 15

Val Lys Thr lie Thr Asn Asp Gin lie Glu Val Thr Asn Ala Thr Glu 20 25 30

Leu Val Gin Ser Ser Ser Thr Gly Gly lie Cys Asp Ser Pro His Gin 35 40 45 lie Leu Asp Gly Glu Asn Cys Thr Leu lie Asp Ala Leu Leu Gly Asp 50 55 60

Pro Gin Cys Asp Gly Phe Gin Asn Lys Lys Trp Asp Leu Phe Val Glu 65 70 75 80

Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp Tyr 85 90 95

Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe Asn 100 105 110

Asp Glu Ser Phe Asn Trp Thr Gly Val Thr Gin Asn Gly Thr Ser Ser 115 120 125

Ala Cys Lys Arg Arg Ser Asn Asn Ser Phe Phe Ser Arg Leu Asn Trp 130 135 140

Leu Thr His Leu Lys Phe Lys Tyr Pro Ala Leu Asn Val Thr Met Pro 145 150 155 160

Asn Asn Glu Lys Phe Asp Lys Leu Tyr lie Trp Gly Val His His Pro 165 170 175

Gly Thr Asp Asn Asp Gin lie Phe Leu His Ala Gin Ala Ser Gly Arg 180 185 190 lie Thr Val Ser Thr Lys Arg Ser Gin Gin Thr Val lie Pro Asn lie 195 200 205

Gly Ser Arg Pro Arg lie Arg Asn lie Pro Ser Arg lie Ser lie Tyr 210 215 220

Trp Thr lie Val Lys Pro Gly Asp lie Leu Leu lie Asn Ser Thr Gly 225 230 235 240

Asn Leu He Ala Pro Arg Gly Tyr Phe Lys lie Arg Ser Gly Lys Ser 245 250 255

Ser He Met Arg Ser Asp Ala Pro He Gly Lys Cys Asn Ser Glu Cys 260 265 270

He Thr Pro Asn Gly Ser He Pro Asn Asp Lys Pro Phe Gin Asn Val 275 280 285

Asn Arg He Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gin Asn Thr 290 295 300

Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gin Thr Arg 305 310 315 320

Gly He Phe Gly Ala He Ala Gly Phe He Glu Asn Gly Trp Glu Gly 325 330 335

Met Val Asp Gly Trp Tyr Gly Phe Arg His Gin Asn Ser Glu Gly He 340 345 350

Gly Gin Ala Ala Asp Leu Lys Ser Thr Gin Ala Ala He Asn Gin lie 355 360 365

Asn Gly Lys Leu Asn Arg Leu He Gly Lys Thr Asn Glu Lys Phe His 370 375 380

Gin He Glu Lys Glu Phe Ser Glu Val Glu Gly Arg lie Gin Asp Leu 385 390 395 400

Glu Lys Tyr Val Glu Asp Thr Lys He Asp Leu Trp Ser Tyr Asn Ala 405 410 415

Glu Leu Leu Val Ala Leu Glu Asn Gin His Thr lie Asp Leu Thr Asp 420 425 430

Ser Glu Met Asn Lys Leu Phe Glu Arg Thr Lys Lys Gin Leu Arg Glu 435 440 445

Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys He Tyr His Lys Cys 450 455 460

Asp Asn Ala Cys He Gly Ser He Arg Asn Gly Thr Tyr Asp His Asp 465 470 475 480

Val Tyr Arg Asp Glu Ala Leu Asn Asn Arg Phe Gin He Lys Gly Val 485 490 495

Glu Leu Lys Ser Gly Tyr Lys Asp Trp He Leu Trp He Ser Phe Ala 500 505 510 lie Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe lie Met Trp 515 520 525

Ala Cys Gin Lys Gly Asn lie Arg Cys Asn lie Cys lie 530 535 540

-IOC

<210> 102 <211> 551 <212> PRT <213> Artificial Sequence <220> <223> Synthesized Influenza A virus A/Anhui/1/2005(H5N1) <400102

Asp Gin lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr lie Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu lie Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe lie Asn Val Pro Glu Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Ala Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg lie Asn His Phe Glu 100 105 110

Lys lie Gin lie lie Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser 115 120 125

Ser Gly Val Ser Ser Ala Cys Pro Tyr Gin Gly Thr Pro Ser Phe Phe 130 135 140

Arg Asn Val Val Trp Leu lie Lys Lys Asn Asn Thr Tyr Pro Thr lie 145 150 155 160

Lys Arg Ser Tyr Asn Asn Thr Asn Gin Glu Asp Leu Leu lie Leu Trp 165 170 175

Gly lie His His Ser Asn Asp Ala Ala Glu Gin Thr Lys Leu Tyr Gin 180 185 190

Asn Pro Thr Thr Tyr He Ser Val Gly Thr Ser Thr Leu Asn Gin Arg 195 200 205

Leu Val Pro Lys lie Ala Thr Arg Ser Lys Val Asn Gly Gin Ser Gly 210 215 220

Arg Met Asp Phe Phe Trp Thr He Leu Lys Pro Asn Asp Ala He Asn 225 230 235 240

Phe Glu Ser Asn Gly Asn Phe He Ala Pro Glu Tyr Ala Tyr Lys lie 245 250 255

Val Lys Lys Gly Asp Ser Ala He Val Lys Ser Glu Val Glu Tyr Gly 260 265 270

Asn Cys Asn Thr Lys Cys Gin Thr Pro lie Gly Ala lie Asn Ser Ser 275 280 285

Met Pro Phe His Asn lie His Pro Leu Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Val Lys Ser Asn Lys Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 305 310 315 320

Pro Leu Arg Glu Arg Arg Arg Lys Arg Gly Leu Phe Gly Ala lie Ala 325 330 335

Gly Phe He Glu Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr Gly 340 345 350

Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys Glu 355 360 365

Ser Thr Gin Lys Ala lie Asp Gly Val Thr Asn Lys Val Asn Ser He 370 375 380

He Asp Lys Met Asn Thr Gin Phe Glu Ala Val Gly Arg Glu Phe Asn 385 390 395 400

Asn Leu Glu Arg Arg lie Glu Asn Leu Asn Lys Lys Met Glu Asp Gly 405 410 415

Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met Glu 420 425 430

Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr 435 440 445

Asp Lys Val Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly Asn 450 455 460

Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu Ser 465 470 475 480

Val Arg Asn Gly Thr Tyr Asp Tyr Pro Gin Tyr Ser Glu Glu Ala Arg 485 490 495

Leu Lys Arg Glu Glu lie Ser Gly Val Lys Leu Glu Ser lie Gly Thr 500 505 510

Tyr Gin He Leu Ser He Tyr Ser Thr Val Ala Ser Ser Leu Ala Leu 515 520 525

Ala lie Met Val Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly Ser 530 535 540

Leu Gin Cys Arg He Cys He 545 550

<210> 103 <211> 552 <212> PRT <213> Artificial Sequence <220 <223> Synthesized [Influenza A virus ANietnam/1194/2004(H5Nl) <400103

Asp Gin lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr lie Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu lie Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe lie Asn Val Pro Glu Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Ala Asn Pro val Asn Asp Leu Cys Tyr Pro Gly Asp Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg lie Asn His Phe Glu 100 105 110

Lys lie Gin lie lie Pro Lys Ser Ser Trp Ser Ser His Glu Ala Ser 115 120 125

Leu Gly Val Ser Ser Ala Cys Pro Tyr Gin Gly Lys Ser Ser Phe Phe 130 135 140

Arg Asn Val Val Trp Leu lie Lys Lys Asn Ser Thr Tyr Pro Thr lie 145 150 155 160

Lys Arg Ser Tyr Asn Asn Thr Asn Gin Glu Asp Leu Leu Val Leu Trp 165 170 175

Gly lie His His Pro Lys Asp Ala Ala Glu Gin Thr Lys Leu Tyr Gin 1B0 185 190

Asn Pro Thr Thr Tyr lie Ser Val Gly Thr Ser Thr Leu Asn Gin Arg 195 200 205

Leu Val Pro Arg lie Ala Thr Arg Ser Lys Val Asn Gly Gin Ser Gly 210 215 220

Arg Met Glu Phe Phe Trp Thr He Leu Lys Pro Asn Asp Ala lie Asn 225 230 235 240

Phe Glu Ser Asn Gly Asn Phe He Ala Pro Glu Tyr Ala Tyr Lys He 245 250 255

Val Lys Lys Gly Asp Ser Thr lie Met Lys Ser Glu Leu Glu Tyr Gly 260 265 270

Asn Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala lie Asn Ser Ser 275 280 285

Met Pro Phe His Asn He His Pro Leu Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Vai Lys Ser Asn Arg Leu Vai Leu Ala Thr Gly Leu Arg Asn Ser 305 310 315 320

Pro Gin Arg Glu Arg Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile 325 330 335

Ala Gly Phe lie Glu Gly Gly Trp Gin Gly Met Vai Asp Gly Trp Tyr 340 345 350

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 355 360 365

Glu Ser Thr Gin Lys Ala Ile Asp Gly Vai Thr Asn Lys Vai Asn Ser 370 375 380 lie lie Asp Lys Met Asn Thr Gin Phe Glu Ala Vai Gly Arg Glu Phe 385 390 395 400

Asn Asn Leu Glu Arg Arg lie Glu Asn Leu Asn Lys Lys Met Glu Asp 405 410 415

Gly Phe Leu Asp Vai Trp Thr Tyr Asn Ala Glu Leu Leu Vai Leu Met 420 425 430

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Vai Lys Asn Leu 435 440 445

Tyr Asp Lys Vai Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 450 455 460

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 465 470 475 480

Ser Vai Arg Asn Gly Thr Tyr Asp Tyr Pro Gin Tyr Ser Glu Glu Ala 485 490 495

Arg Leu Lys Arg Glu Glu Ile Ser Gly Vai Lys Leu Glu Ser Ile Gly 500 505 510

Ile Tyr Gin Ile Leu Ser Ile Tyr Ser Thr Vai Ala Ser Ser Leu Ala 515 520 525

Leu Ala lie Met Val Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 530 535 540

Ser Leu Gin Cys Arg lie Cys lie 545 550

<210> 104 <211> 553 <212> PRT <213> Artificial sequence <220> <223> Synthesized A/lndonesia/5/2005(H5Nl) <400> 104

Asp Gin lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr lie Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu lie Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe lie Asn Val Pro Glu Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Pro Gly Ser Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg lie Asn His Phe Glu 100 105 110

Lys lie Gin lie He Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser 115 120 125

Ser Gly Val Ser Ser Ala Cys Pro Tyr Leu Gly Ser Pro Ser Phe Phe 130 135 140

Arg Asn Val Val Trp Leu lie Lys Lys Asn Ser Thr Tyr Pro Thr lie 145 150 155 160

Lys Lys Ser Tyr Asn Asn Thr Asn Gin Glu Asp Leu Leu Val Leu Trp 165 170 175

Gly He His His Pro Asn Asp Ala Ala Glu Gin Thr Arg Leu Tyr Gin 180 185 190

Asn Pro T r Thr Tyr He Ser lie Gly Thr Ser Thr Leu Asn Gin Arg 195 200 205

Leu Val Pro Lys He Ala Thr Arg Ser Lys Val Asn Gly Gin Ser Gly 210 215 220

Arg Met Glu Phe Phe Trp Thr He Leu Lys Pro Asn Asp Ala lie Asn 225 230 235 240

Phe Glu Ser Asn Gly Asn Phe He Ala Pro Glu Tyr Ala Tyr Lys He 245 250 255

Val Lys Lys Gly Asp Ser Ala He Met Lys Ser Glu Leu Glu Tyr Gly 260 265 270

Asn Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala He Asn Ser Ser 275 280 285

Met Pro Phe His Asn He His Pro Leu Thr He Gly Glu Cys Pro Lys 290 295 300

Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 305 310 315 320

Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala lie 325 330 335

Ala Gly Phe lie Glu Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr 340 345 350

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 355 360 365

Glu Ser Thr Gin Lys Ala lie Asp Gly Val Thr Asn Lys Val Asn Ser 370 375 380 lie lie Asp Lys Met Asn Thr Gin Phe Glu Ala Val Gly Arg Glu Phe 385 390 395 400

Asn Asn Leu Glu Arg Arg lie Glu Asn Leu Asn Lys Lys Met Glu Asp 405 410 415

Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met 420 425 430

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 435 440 445

Tyr Asp Lys Val Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 450 455 460

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 465 470 475 480

Ser lie Arg Asn Gly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala 485 490 495

Arg Leu Lys Arg Glu Glu lie Ser Gly Val Lys Leu Glu Ser lie Gly 500 505 510

Thr Tyr Gin lie Leu Ser lie Tyr Ser Thr Val Ala Ser Ser Leu Ala 515 520 525

Leu Ala lie Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 530 535 540

Ser Leu Gin Cys Arg lie Cys lie Lys 545 550 <210> 105

<211> 548 <212> PRT <213> Artificial Sequence <220> <223> Construct 900 <400> 105

Asp Gin lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr lie Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp He 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu lie Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe He Asn Val Pro Glu Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Pro Tyr Asp Val Pro 85 90 95

Asp Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu 100 105 110

Phe Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gin Asn Gly Thr 115 120 125

Ser Ser Ala Cys lie Arg Arg Ser Asn Asn Ser Phe Phe Ser Arg Leu 130 135 140

Asn Trp Leu Thr His Leu Lys Phe Lys Tyr Pro Ala Leu Asn Val Thr 145 150 155 160

Met Pro Asn Asn Glu Lys Phe Asp Lys Leu Tyr He Trp Gly Val His 165 170 175

His Pro Gly Thr Asp Asn Asp Gin lie Phe Leu Tyr Ala Gin Ala Ser 180 185 190

Gly Arg He Thr Val Ser Thr Lys Arg Ser Gin Gin Thr Val lie Pro 195 200 205

Asn He Gly Ser Arg Pro Arg Val Arg Asn He Pro Ser Arg He Ser 210 215 220

He Tyr Trp Thr He Val Lys Pro Gly Asp He Leu Leu He Asn Ser 225 230 235 240

Thr Gly Asn Leu He Ala Pro Arg Cly Tyr Phe Lys He Arg Ser Gly 245 250 255

Lys Ser Ser He Met Lys Ser Glu Leu Glu Tyr Gly Asn Cys Asn Thr 260 265 270

Lys Cys Gin Thr Pro Met Gly Ala He Asn Ser Ser Met Pro Phe His 275 280 285

Asn He His Pro Leu Thr lie Cly Glu Cys Pro Lys Tyr Val Lys Ser 290 295 300

Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser Pro Gin Arg Glu 305 310 315 320

Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala He Ala Gly Phe He 325 330 335

Glu Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr Cly Tyr His His 340 345 350

Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gin 355 360 365

Lys Ala He Asp Gly Val Thr Asn Lys Val Asn Ser He He Asp Lys 370 375 380

Met Asn Thr Gin Phe Glu Ala Val Gly Arg Glu Phe Asn Asn Leu Glu 385 390 395 400

Arg Arg lie Glu Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp 405 410 415

Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val 435 440 445

Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu Ser lie Arg Asn 465 470 475 480

Gly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala Arg Leu Lys Arg 485 490 495

Glu Glu lie Ser Gly Val Lys Leu Glu Ser lie Gly Thr Tyr Gin lie 500 505 510

Leu Ser lie Tyr Ser Thr Val Ala Ser Ser Leu Ala Leu Ala lie Met 515 520 525

Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg lie Cys lie 545

<210> 106 <211> 565 <212> PRT <213> Artificial Sequence <220> <223> Construct 745 <400> 106

Asp Gin lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr lie Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu lie Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe lie Asn Val Pro Glu Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Pro lie Met His Asp 85 90 95

Arg Thr Lys He Arg Gin Leu Pro Asn Leu Leu Arg Gly Tyr Glu Asn 100 105 110 lie Arg Leu Ser Thr Gin Asn Val He Asp Ala Glu Lys Ala Pro Gly 115 120 125

Gly Pro Tyr Arg Leu Gly Thr Ser Gly Ser Cys Pro Asn Ala Thr Ser 130 135 140

Lys Ser Gly Phe Phe Ala Thr Met Ala Trp Ala val Pro Lys Asp Asn 145 150 155 160

Asn Lys Asn Ala Thr Asn Pro Leu Thr Val Glu Val Pro Tyr He Cys 165 170 175

Thr Glu Gly Glu Asp Gin He Thr Val Trp Gly Phe His Ser Asp Asn 180 185 190

Lys Thr Gin Met Lys Asn Leu Tyr Gly Asp Ser Asn Pro Gin Lys Phe 195 200 205

Thr Ser Ser Ala Asn Gly Val Thr Thr His Tyr Val Ser Gin lie Gly 210 215 220

Ser Phe Pro Asp Gin Thr Glu Asp Gly Gly Leu Pro Gin Ser Gly Arg 225 230 235 240

He Val Val Asp Tyr Met Met Gin Lys Pro Gly Lys Thr Gly Thr He 245 250 255

Val Tyr Gin Arg Gly Val Leu Leu Pro Gin Lys Val Trp Cys Ala Ser 260 265 270

Gly Arg Ser Lys He Met Lys Ser Glu Leu Glu Tyr Gly Asn Cys Asn 275 280 285

Thr Lys Cys Gin Thr Pro Met Gly Ala lie Asn Ser Ser Met Pro Phe 290 295 300

His Asn He His Pro Leu Thr He Gly Glu Cys Pro Lys Tyr Val Lys 305 310 315 320

Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser Pro Gin Arg 325 330 335

Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe 340 345 350 lie Glu Gly Gly Trp Gin Gly Met Vai Asp Gly Trp Tyr Gly Tyr His 355 360 365

His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr 370 375 380

Gin Lys Ala Ile Asp Gly Vai Thr Asn Lys Vai Asn Ser lie Ile Asp 385 390 395 400

Lys Met Asn Thr Gin Phe Glu Ala Vai Gly Arg Glu Phe Asn Asn Leu _405_410_415

Glu Arg Arg lie Glu Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu 420 425 430

Asp Vai Trp Thr Tyr Asn Ala Glu Leu Leu Vai Leu Met Glu Asn Glu 435 440 445

Arg Thr Leu Asp Phe His Asp Ser Asn Vai Lys Asn Leu Tyr Asp Lys 450 455 460

Vai Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys 465 470 475 480

Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu Ser Ile Arg 485 490 495

Asn Gly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala Arg Leu Lys 500 505 510

Arg Glu Glu Ile Ser Gly Vai Lys Leu Glu Ser Ile Gly Thr Tyr Gin 515 520 525

Ile Leu Ser Ile Tyr Ser Thr Vai Ala Ser Ser Leu Ala Leu Ala Ile 530 535 540

Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gin 545 550 555 560

Cys Arg Ile Cys Ile 565

<210> 107 <211> 545 <212> PRT <213> Artificial Sequence <22Q> <223> Construct 910 <400> 107

Asp Gin lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr lie Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Ser Pro His Gin lie 35 40 45

Leu Asp Gly Glu Asn Cys Thr Leu lie Asp Ala Leu Leu Gly Asp Pro 50 55 60

Gin Cys Asp Gly Phe Gin Asn Lys Lys Trp Asp Leu Phe Val Glu Arg 65 70 75 80

Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala 85 90 95

Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe Asn Asn 100 105 110

Glu Ser Phe Asn Trp Thr Gly Vai Thr Gin Asn Gly Thr Ser Ser Ala 115 120 125

Cys Ile Arg Arg Ser Asn Asn Ser Phe Phe Ser Arg Leu Asn Trp Leu 130 135 140

Thr His Leu Lys Phe Lys Tyr Pro Ala Leu Asn Vai Thr Met Pro Asn 145 150 155 160

Asn Glu Lys Phe Asp Lys Leu Tyr lie Trp Gly Vai His His Pro Gly 165 170 175

Thr Asp Asn Asp Gin Ile Phe Leu Tyr Ala Gin Ala Ser Gly Arg Ile 180 185 190

Thr Vai Ser Thr Lys Arg Ser Gin Gin Thr Vai lie Pro Asn Ile Gly 195 200 205

Ser Arg Pro Arg Vai Arg Asn lie Pro Ser Arg Ile Ser Ile Tyr Trp 210 215 220

Thr He Vai Lys Pro Gly Asp He Leu Leu lie Asn ser Thr Gly Asn 225 230 235 240

Leu lie Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys Ser Ser 245 250 255 lie Met Arg Ser Asp Ala Pro lie Gly Lys Cys Asn Thr Lys Cys Gin 260 265 270

Thr Pro Met Gly Ala Ile Asn Ser Ser Met Pro Phe His Asn lie His 275 280 285

Pro Leu Thr Ile Gly Glu Cys Pro Lys Tyr Val Lys Ser Asn Arg Leu 290 295 300

Val Leu Ala Thr Gly Leu Arg Asn Ser Pro Gin Arg Glu Ser Arg Arg 305 310 315 320

Lys Lys Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly 325 330 335

Trp Gin Gly Met Val Asp Gly Trp Tyr Gly Tyr His His Ser Asn Glu 340 345 350

Gin Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gin Lys Ala He 355 360 365

Asp Gly Val Thr Asn Lys Val Asn Ser Ile lie Asp Lys Met Asn Thr 370 375 380

Gin Phe Glu Ala Val Gly Arg Glu Phe Asn Asn Leu Glu Arg Arg Ile 385 390 395 400

Glu Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp Val Trp Thr 405 410 415

Tyr Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg Thr Leu Asp 420 425 430

Phe His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val Arg Leu Gin 435 440 445

Leu Arg Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe Glu Phe Tyr 450 455 460

His Lys Cys Asp Asn Glu Cys Met Glu Ser lie Arg Asn Gly Thr Tyr 465 470 475 480

Asn Tyr Pro Gin Tyr Ser Glu Glu Ala Arg Leu Lys Arg Glu Glu lie 485 490 495

Ser Gly Val Lys Leu Glu Ser lie Gly Thr Tyr Gin lie Leu Ser lie 500 505 510

Tyr Ser Thr Val Ala Ser Ser Leu Ala Leu Ala lie Met Met Ala Gly 515 520 525

Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gin Cys Arg lie Cys 530 535 540

He 545

<210> 108 <211> 556 <212> PRT <213> Artificial Sequence <220 <223> Construct 920 <400108

Asp Gin lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr lie Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Pro Asp Cys Leu Asn Cys 35 40 45

Thr Asp Leu Asp Val Ala Leu Gly Arg Pro Met Cys Val Gly Thr Thr 50 55 60

Pro Ser Ala Lys Ala Ser lie Leu His Glu Val Lys Pro Val Thr Ser 65 70 75 80

Gly Cys Phe Pro lie Met His Asp Arg Thr Lys lie Arg Gin Leu Pro 85 90 95

Asn Leu Leu Arg Gly Tyr Glu Asn lie Arg Leu Ser Thr Gin Asn Val 100 105 110 lie Asp Ala Glu Lys Ala Pro Gly Gly Pro Tyr Arg Leu Gly Thr Ser 115 120 125

Gly Ser Cys Pro Asn Ala Thr Ser Lys Ser Gly Phe Phe Ala Thr Met 130 135 140

Ala Trp Ala Val Pro Lys Asp Asn Asn Lys Asn Ala Thr Asn Pro Leu 145 150 155 160

Thr Vai Glu Vai Pro Tyr lie Cys Thr Glu Gly Glu Asp Gin lie Thr 165 170 175

Val Trp Gly Phe His Ser Asp Asn Lys Thr Gin Met Lys Asn Leu Tyr 180 185 190

Gly Asp Ser Asn Pro Gin Lys Phe Thr Ser Ser Ala Asn Gly Val Thr 195 200 205

Thr His Tyr Val Ser Gin lie Gly Ser Phe Pro Asp Gin Thr Glu Asp 210 215 220

Gly Gly Leu Pro Gin Ser Gly Arg lie Val Val Asp Tyr Met Met Gin 225 230 235 240

Lys Pro Gly Lys Thr Gly Thr lie Val Tyr Gin Arg Gly Val Leu Leu 245 250 255

Pro Gin Lys Val Trp Cys Ala Ser Gly Arg Ser Lys Val lie Lys Gly 260 265 270

Ser Leu Pro Leu lie Gly Glu Ala Asp Cys Gin Thr Pro Met Gly Ala 275 280 285 lie Asn Ser Ser Met Pro Phe His Asn lie His Pro Leu Thr lie Gly 290 295 300

Glu Cys Pro Lys Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly 305 310 315 320

Leu Arg Asn Ser Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu 325 330 335

Phe Gly Ala lie Ala Gly Phe lie Glu Gly Gly Trp Gin Gly Met Val 340 345 350

Asp Gly Trp Tyr Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr 355 360 365

Ala Ala Asp Lys Glu Ser Thr Gin Lys Ala lie Asp Gly Val Thr Asn 370 375 380

Lys Val Asn Ser lie lie Asp Lys Met Asn Thr Gin Phe Glu Ala Val 385 390 395 400

Gly Arg Glu Phe Asn Asn Leu Glu Arg Arg lie Glu Asn Leu Asn Lys 405 410 415

Lys Met Glu Asp Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu 420 425 430

Leu Val Leu Met Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn 435 440 445

Vai Lys Asn Leu Tyr Asp Lys Vai Arg Leu Gin Leu Arg Asp Asn Ala 450 455 460

Lys Glu Leu Gly Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn 465 470 475 480

Glu Cys Met Glu Ser lie Arg Asn Gly Thr Tyr Asn Tyr Pro Gin Tyr 485 490 495

Ser Glu Glu Ala Arg Leu Lys Arg Glu Glu Ile Ser Gly Vai Lys Leu 500 505 510

Glu Ser Ile Gly Thr Tyr Gin Ile Leu Ser Ile Tyr Ser Thr Vai Ala 515 520 525

Ser Ser Leu Ala Leu Ala lie Met Met Ala Gly Leu Ser Leu Trp Met 530 535 540

Cys Ser Asn Gly Ser Leu Gin Cys Arg Ile Cys Ile 545 550 555

<210> 109 <211> 548 <212> PRT <213> Artificial Sequence <220> <223> Construct 930 <400> 109

Asp Thr lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val 15 10 15

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu 20 25 30

Leu Glu Asp Ser His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu lie Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe lie Asn Val Pro Glu Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Pro Gly Ser Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg lie Asn His Phe Glu 100 105 110

Lys lie Gin lie lie Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser 115 120 125

Ser Gly Val Ser Ser Ala Cys Pro Tyr Leu Gly Ser Pro Ser Phe Phe 130 135 140

Arg Asn Val Val Trp Leu lie Lys Lys Asn Ser Thr Tyr Pro Thr lie 145 150 155 160

Lys Lys Ser Tyr Asn Asn Thr Asn Gin Glu Asp Leu Leu Val Leu Trp 165 170 175

Gly lie His His Pro Asn Asp Ala Ala Glu Gin Thr Arg Leu Tyr Gin 180 185 190

Asn Pro Thr Thr Tyr lie Ser lie Gly Thr Ser Thr Leu Asn Gin Arg 195 200 205

Leu Val Pro Lys lie Ala Thr Arg Ser Lys Val Asn Gly Gin Ser G:'..y 210 215 220

Arg Met Glu Phe Phe Trp Thr lie Leu Lys Pro Asn Asp Ala lie Asn 225 230 235 240

Phe Glu Ser Asn Gly Asn Phe lie Ala Fro Glu Tyr Ala Tyr Lys lie 245 250 255

Val Lys Lys Gly Asp Ser Ala lie Met Lys Ser Glu Leu Glu Tyr Gly 260 265 270

Asn Cys Asp Ala Lys Cys Gin Thr Pro Gin Gly Ala lie Asn Ser Ser 275 280 285

Leu Pro Phe Gin Asn Val His Pro Val Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Val Arg Ser Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn lie 305 310 315 320

Pro Ser lie Gin Ser Arg Gly Leu Phe Gly Ala lie Ala Gly Phe lie 325 330 335

Glu Gly Sly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 340 345 350

Gin Asn Slu Gin Gly Ser Gly Tyr Ala Ala Asp Gin Lys Ser Thr Gin 355 360 365

Asn Ala lie Asn Gly lie Thr Asn Lys Val Asn Ser Val lie Glu Lys 370 375 380

Met Asn Thr Gin Phe Thr Ala Val Gly Lys Glu Phe Asn Lys Leu Glu 385 390 395 400

Arg Arg Met Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe Leu Asp 405 410 415 lie Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val 435 440 445

Lys Ser Gin Leu Lys Asn Asn Ala Lys Glu lie Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asn Asn Glu Cys Met Glu Ser Val Lys Asn 465 470 475 480

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg 485 490 495

Glu Lys lie Asp Sly Val Lys Leu Glu Ser Met Gly Val Tyr Gin lie 500 505 510

Leu Ala lie Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Leu Val Ser 515 520 525

Leu Gly Ala lie Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg lie Cys lie 545 <210> 110 <400> 110 000

<210> 111 <211> 552 <212> PRT <2U> Artificial Sequence <220> <223> Construct 690 and 734 <400> 111

Asp Gin lie Cys Ι1θ Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr lie Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu lie Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe lie Asn Val Pro Glu Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Pro Gly His Phe Ala 85 90 95

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 100 105 110

Arg Phe Glu lie Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 115 120 125

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser Ser Phe Tyr 130 135 140

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 145 150 155 160

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 165 170 175

Gly Val His His Pro Pro Asn lie Gly Asp Gin Lys Ala Leu Tyr His 180 185 190

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Lys 195 200 205

Phe Thr Pro Glu lie Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 210 215 220

Arg lie Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr lie lie 225 230 235 240

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 245 250 255

Ser Arg Gly Phe Gly Ser Gly lie Met Lys Ser Glu Leu Glu Tyr Gly 260 265 270

Asn Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala lie Asn Ser Ser 275 280 285

Met Pro Phe His Asn lie His Pro Leu Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 305 310 315 320

Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala lie 325 330 335

Ala Gly Phe lie Glu Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr 340 345 350

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 355 360 365

Glu Ser Thr Gin Lys Ala lie Asp Gly Val Thr Asn Lys Val Asn Ser 370 375 380 lie He Asp Lys Met Asn Thr Gin Phe Glu Ala Val Cly Arg Glu Phe 385 390 395 400

Asn Asn Leu Glu Arg Arg lie Glu Asn Leu Asn Lys Lys V:et Glu Asp 405 410 415

Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met 420 425 430

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 435 440 445

Tyr Asp Lys Val Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 450 455 460

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 465 470 475 480

Ser lie Arg ll.snGly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala 4B5 490 495

Arg Leu Lys Arg Glu Glu lie Ser Gly Val Lys Leu Glu Ser lie Gly 500 505 510

Thr Tyr Gin lie Leu Ser lie Tyr Ser Thr Val Ala Ser Ser Leu Ala 515 520 525

Leu Ala lie Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 530 535 540

Ser Leu Gin Cys Arg lie Cys lie 545 550

<210> 112 <211> 548 <212> PRT <213> Artificial Sequence <220> <223> Construct 696 <400> 112

Asp Thr lie Cys lie Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val 15 10 15

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu 20 25 30

Leu Glu Asp Ser His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 35 40 45

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 50 55 60

Pro Glu Cys Glu Leu Leu lie Ser Lys Glu Ser Trp Ser Tyr lie Val 65 70 75 80

Glu Thr Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly Ser Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg lie Asn His Phe Glu 100 105 110

Lys lie Gin lie lie Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser 115 120 125

Ser Gly Val Ser Ser Ala Cys Pro Tyr Leu Gly Ser Pro Ser Phe Phe 130 135 140

Arg Asn Val Val Trp Leu lie Lys Lys Asn Ser Thr Tyr Pro Thr lie 145 150 155 160

Lys Lys Ser Tyr Asn Asn Thr Asn Gin Glu Asp Leu Leu Val Leu Trp 165 170 175

Gly lie His His Pro Asn Asp Ala Ala Glu Gin Thr Arg Leu Tyr Gin 180 185 190

Asn Pro Thr Thr Tyr lie Ser lie Gly Thr Ser Thr Leu Asn Gin Arg 195 200 205

Leu Val Pro Lys lie Ala Thr Arg Ser Lys Val Asn Gly Gin Ser Gly 210 215 220

Arg Met Glu Phe Phe Trp Thr lie Leu Lys Pro Asn Asp Ala lie Asn 225 230 235 240

Phe Glu Ser Asn Gly Asn Phe lie Ala Pro Glu Tyr Ala Tyr Lys Ile 245 250 255

Vai Lys Lys Gly Asp Ser Ala He ile Thr ser Asn Ala Pro Met Asp 260 265 270

Glu Cys Asp Ala Lys Cys Gin Thr Pro Gin Gly Ala Ile Asn Ser Ser 275 280 285

Leu Pro Phe Gin Asn Val His Pro Val Thr Ile Gly Glu Cys Pro Lys 290 295 300

Tyr Val Arg Ser Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn Ile 305 310 315 320

Pro Ser Ile Gin Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile 325 330 335

Glu Gly Gly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 340 345 350

Gin Asn Glu Gin Gly Ser Gly r,yr Ala Ala Asp Gin Lys Ser Thr Gin 355 360 365

Asn Ala Ile Asn Gly Ile Thr Asn Lys Val Asn Ser Val Ile Glu Lys 370 375 380

Met Asn T r Gin Phe Thr Ala Val Gly Lys Glu Phe Asn Lys Leu Glu 385 390 395 400

Arg Arg Met Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe Leu Asp 405 410 415

Ile Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val 435 440 445

Lys Ser Gin Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asn Asn Glu Cys Met Glu Ser Val Lys Asn 465 470 475 480

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg 485 490 495

Glu Lys lie Asp Gly Val Lys Leu Glu Ser Met Gly Val Tyr Gin lie 500 505 510

Leu Ala lie Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Leu Val Ser 515 520 525

Leu Gly Ala lie Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg lie Cys lie 545

<210> 113 <211> 552 <212> PRT <213> Artificial Sequence <220 c223> Construct 691 <400113

Asp Gin lie Cys lie Gly Tyr His A_:_a Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr lie Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 35 40 45

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 50 55 60

Pro Glu Cys Glu Leu Leu lie Ser Lys Glu Ser Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly His Phe Ala 85 90 95

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 100 105 110

Arg Phe Glu lie Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 115 120 125

Thr Gly Val Ser Ala Ser Cys Ser H:_s Asn Gly Glu Ser Ser Phe Tyr 130 135 140

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 145 150 155 160

Ser Lys Ser Tyr Ala Asn Asn Lys G_:_u Lys Glu Val Leu Val Leu Trp 165 170 175

Gly Val His His Pro Pro Asn He g -y Asp Gin Lys Ala Leu Tyr His 180 lfl5 190

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Lys 195 200 205

Phe Thr Pro Glu lie Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 210 215 220

Arg He Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr He He 225 230 235 240

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 245 250 255

Ser Arg Gly Phe Gly Ser Gly lie lie Asn Ser Asn Ala Pro Met Asp 260 265 270

Lys Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala lie

Asn Ser Ser 275 280 285

Met Pro Phe His Asn lie His Pro Leu Thr lie Gly Glu

Cys Pro Lys 290 295 300

Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu

Arg Asn Ser 305 310 315 320

Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala He 325 330 335

Ala Gly Phe lie Glu Gly Gly Trp Gin Gly Met Val Asp

Gly Trp Tyr 340 345 350

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 355 360 365

Glu Ser Thr Gin Lys Ala He Asp Gly Val Thr Asn Lys Val Asn Ser 370 375 380 lie lie Asp Lys Met Asn Thr Gin Phe Glu Ala Val Gly Arg Glu Phe 385 390 395 400

Asn Asn Leu Glu Arg Arg lie Glu Asn Leu Asn Lys Lys Met Glu 405 410 415

Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu

Val Leu Met 420 425 430

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 435 440 445

Tyr Asp Lys Val Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 450 455 460

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 465 470 475 480

Ser He Arg Asn Gly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala 485 490 495

Arg Leu Lys Arg Glu Glu He Ser Gly Val Lys Leu Glu

Ser lie Gly 500 505 510

Thr Tyr Gin lie Leu Ser lie Tyr Ser Thr Val Ala Ser Ser Leu Ala 515 520 525

Leu Ala lie Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 530 535 540

Ser Leu Gin Cys Arg lie Cys lie 545 550

DESCRIPTION

CHEMICAL PARTICLES SIMILAR TO INFLUENZA VIRUS COMPREHENDING

HEMAGLUTININ

FIELD OF INVENTION The present invention relates to virus-like particles. More specifically, the present invention relates to virus-like particles comprising chimeric influenza hemagglutinin and methods of producing chimeric influenza virus-like particles.

BACKGROUND OF THE INVENTION Influenza is the leading cause of death in humans due to a respiratory virus and during the "flu season" it is estimated that 10 to 20% of the world population may be infected, leading to 250 to 500 thousand deaths per annum. The current method of combating influenza in humans is by annual vaccination. The vaccine is usually a combination of several strains that are expected to be the dominant strains for the upcoming flu season, however, the number of doses of vaccine produced annually is not enough to vaccinate the world's population. For example, Canada and the United States have sufficient vaccine doses to immunize about one-third of their population, and in Europe only about 17% can be vaccinated, given current production - in the face of a global flu pandemic, this would be insufficient. Even if the required annual production could somehow be met in a given year, the dominant varieties change from year to year, so storage at low times of need in the year is impractical. The economic and large-scale production of an effective influenza vaccine is of significant interest to the government and to private industry. The influenza hemagglutinin (HA) surface glycoprotein is both a receptor binding protein and a membrane fusion protein. It is a trimer of identical subunits, each containing two disulfide-linked polypeptides, HAl and HA2, which are derived by proteolytic cleavage of a precursor, HAO, having a signal peptide sequence at its N-terminus and a membrane anchor sequence in its terminal C. Cleavage to form HAl and HA2 generates the N-terminus of the minor polypeptide, HA2, which has the membrane anchor sequence at its C-terminus. Cleavage is required for membrane fusion activity but not for immunogenicity. The N-terminal sequence of HA2 is called the "fusion peptide" because cleavage in similar hydrophobic sequences is also required for the activity of other virus fusion proteins in vitro.

Generally, the surface of the globular "head" comprises several flexible loops with well characterized and variable antigenic regions designated as sites A, B, C, D and E (reviewed in Wiley et al., 1987. Annu Rev Biochem 56: 365- 394). Insertion or replacement of short peptide sequences at some sites (e.g., B and E) for immunity studies have been described (Garcia-Sastré et al., 1995 Biologicals 23: 171-178). Epidermal growth factor (EGF), single chain antibody (scFV) and IgG Fc domain, ranging in size from 53 to 246 amino acids, were inserted at the N-terminus of an H7 and the chimeras were successfully expressed (Hatziioannou et al., 1999. Human Gene Therapy 10: 1533-1544). More recently, 90 and 140 amino acid domains of the Bacillus anthracis protective antigen were fused to the amino terminus of an H3 (Li et al., 2005, J. Virol 79: 10003-1002). Copeland (Copeland et al., J. Virol 79: 6459-6471) describes the expression of the HIV gp120 Env surface glycoprotein on an H3 stem, wherein the gp120 domain replaced the entire globular head of HA. Several recombinant products have been developed as recombinant influenza vaccine candidates. These approaches focused on the expression, production and purification of HA and NA proteins of influenza type A, including the expression of these proteins using baculovirus-infected insect cells (Crawford et al, 1999 Vaccine 17: 2265-74; Johansson, 1999 Vaccine 17: 2073-80), viral vectors and DNA vaccine constructs (Olsen et al., Vaccine 15: 1149-56, 1997). The production of a non-infectious influenza virus strain for vaccine purposes is a way of avoiding inadvertent infection. Alternatively, virus-like particles (VLPs) as substitutes for the cultured virus were investigated. VLPs mimic the structure of the viral capsid but do not have a genome and therefore can not replicate or provide a means for a secondary infection. Current VLP production technologies influence the coexpression of multiple viral proteins, and this dependence represents a disadvantage of these technologies, since in the case of a pandemic and annual epidemic, response time is crucial for vaccination. A simpler VLP production system, for example, one that relies on the expression of only one or some viral proteins without requiring the expression of non-structural viral proteins is desirable to accelerate the development of vaccines. Enveloped viruses can get their lipid envelope when they 'sprout' out of the infected cell and get the membrane of the plasma membrane, or that of an internal organelle. In mammalian or baculovirus cell systems, for example, plasma membrane influenza outbreaks (Quan et al., 2007 J. Virol 81: 3514-3524). Only a few enveloped viruses are known to infect plants (eg members of Tospovirus and Rhabdoviruses). Of viruses enveloped in known plants, they are characterized by budding of internal membranes of the host cell, not of the plasma membrane. Although a small number of recombinant VLPs have been produced in plant hosts, none has been derived from the plasma membrane, raising the question of whether plasma membrane derived VLPs, including influenza VLPs, can be produced in plants. The formation of VLPs in any system places considerable demands on the structure of proteins - altering short strings of sequence that correspond to selected surface loops of a globular structure may not have much effect on the expression of the polypeptide itself, however structural studies are lacking to demonstrate the effect of such changes on the formation of VLPs. Cooperation of the various regions and structures of HA (for example, membrane anchor sequences, stem or trunk regions of the trimer that separates the globular head from the membranes) has evolved with the virus and may not be amenable to similar changes without loss Integrity of the HA trimer and VLP formation. Production of influenza VLPs HA has previously been described by the inventors in WO 2009/009876.

SUMMARY OF THE INVENTION The present invention relates to virus-like particles. More specifically, the present invention relates to virus-like particles comprising chimeric influenza hemagglutinin and methods of producing chimeric influenza hemagglutinin virus-like particles. It is an object of the invention to provide an improved chimeric influenza virus (VLP) -like particle. The present invention provides a polypeptide that can be expressed in a plant host, comprising a chimeric influenza HA comprising a stem domain domain (SDC), a major domain domain (HDC), and a transmembrane domain domain (TDC) wherein : the SDC comprises a Subdomain F'1, F'2 and F; the HDC comprises a subdomain RB, E1 and E2; the TDC comprises a subdomain TmD and Ctail; wherein the subdomain RB is of a first friable HA polypeptide and the subdomains SDC and EI and E2 are of a second influenza HA polypeptide and wherein the first influenza HA polypeptide is H1 or H5 influenza and the second polypeptide HA of influenza is either H1 or H5 influenza, and the second H1 influenza polypeptide is derived from a different influenza strain from the first H1 influenza polypeptide. In addition, the polypeptide may comprise a signal peptide. The present invention also provides a nucleic acid encoding the polypeptide comprising a chimeric influenza HA comprising a stem domain array (SDC), a head domain cluster (HDC), and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F'1, Subdomain F'2 and F; the HDC comprises a subdomain RB, E1 and E2; the TDC comprises a subdomain TmD and Ctail; wherein the subdomain RB is of a first influenza HA polypeptide and the subdomains SDC and EI and E2 are of a second influenza HA polypeptide and wherein the first influenza HA polypeptide is of influenza HI or H5 and the second polypeptide HA of influenza is either H1 or H5 influenza, and the second H1 influenza polypeptide is derived from a different influenza strain from the first H1 influenza polypeptide. The nucleic acid may also encode the polypeptide comprising a signal peptide as defined in claim 2 in addition to SDC, HDC and TDC.

Also provided is a method for producing chimeric influenza virus-like particles (VLPs) in a plant, the method comprising: a) introducing a nucleic acid encoding a chimeric influenza HA comprising a signal peptide, a trunk domain cluster ( SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) where: the SDC comprises a F'1, F subdomain 2 and F; the HDC comprises a subdomain RB, E1 and E2; the TDC comprises a subdomain TmD and Ctail; wherein the subdomain RB is of a first influenza HA polypeptide and the subdomains SDC and EI and E2 are of a second influenza HA polypeptide and wherein the first influenza HA polypeptide is of influenza HI or H5 and the second polypeptide HA of influenza is H1 or H5 influenza, and the second influenza HA polypeptide is derived from a different influenza strain of the first influenza HA polypeptide in the plant, or portion thereof, and b) incubating the plant, or portion thereof, under conditions which allow expression of the nucleic acid, thus producing the VLPs. The present invention includes the method described above wherein in the introductory step (step a), the nucleic acid is introduced into the plant in a transient manner. Alternatively, in the introductory step (step a), the nucleic acid is introduced into the plant and is stably integrated. The method may further comprise a step of: c) harvesting the host and purifying the VLPs. The present invention provides a plant, or portion thereof, comprising a chimeric influenza HA, or a nucleotide sequence encoding chimeric HA, chimeric influenza HA comprising a trunk domain (SDC), a domain (HDC) and a transmembrane membrane. domain cluster (TDC) where: the SDC comprises a subdomain F'1, F'2 and F; the HDC comprises a subdomain RB, E1 and E2; the TDC comprises a subdomain TmD and Ctail, wherein the subdomain RB is a first influenza HA polypeptide and the subdomains SDC and EI and E2 are a second influenza HA polypeptide and wherein the first influenza HA polypeptide is influenza HI or H5 and the second influenza HA polypeptide is H1 or H5 influenza, and the second influenza HA polypeptide is derived from a different influenza strain than the first influenza HA polypeptide. The plant, or portion thereof, may further comprise a nucleic acid comprising a nucleotide sequence encoding one or more of an accompanying protein operably linked to a regulatory region active in a plant. The one or more of an accompanying protein may be selected from the group comprising Hsp40 and Hsp70. The present invention relates to a virus-like particle (VLP) comprising a chimeric influenza HA, chimeric influenza HA comprising a trunk domain (SDC), a major domain (HDC) domain, and a domain domain transmembrane (TDC) wherein: comprises a subdomain F'1, F'2 and F; the HDC comprises a subdomain RB, E1 and E2; the TDC comprises a TmD and Ctail subdomain; wherein the subdomain RB is of a first influenza HA polypeptide and the subdomains SDC and EI and E2 are of a second influenza HA polypeptide and wherein the first influenza HA polypeptide is of influenza HI or H5 and the second polypeptide HA of influenza is either H1 or H5 influenza, and the second H1 influenza polypeptide is derived from a strain of influenza different from the first H1 influenza polypeptide. The VLP may further comprise plant-specific N-glycans, or modified N-glycans.

A composition comprising an effective dose of the VLP as just described and a pharmaceutically acceptable carrier is also provided.

In an alternative aspect of the present invention there is provided a method of inducing immunity to influenza virus infection in an individual, comprising administering the VLP to the subject. VLP can be administered to an individual orally, intradermally, intranasally, intramuscularly, intraperitoneally, intravenously or subcutaneously.

Regulatory regions that can be operably linked to a sequence encoding a chimeric HA protein include those that are operative in a plant cell, an insect cell or a yeast cell. Such regulatory regions may include a plastocyanin regulatory region, a Ribulose 1,5-bisphosphate carboxylase / oxygenase (RuBisCO) regulatory region, chlorophyll a / b (CAB) or ST-LS 1 binding protein. Other regulatory regions include a UTR, 3'UTR or termination sequences. The plastocyanin regulatory region may be an alfalfa plastocyanin regulatory region; the 5'UTR, 3'UTR or terminator sequences may also be alfalfa sequences. The present disclosure provides a chimeric influenza HA polypeptide comprising a first influenza and a second influenza, the first influenza and the second influenza may be independently selected from the group comprising H1 and H5; with the condition that the first influenza and the second influenza are not of the same type of influenza, subtype or of the same origin.

According to some aspects of the disclosure, the chimeric influenza HA polypeptide comprises a signal peptide sequence, the signal peptide sequence may be selected from the group comprising a native signal peptide sequence, an alfalfa PDI signal peptide sequence, a signal peptide sequence H5 and a H1 signal peptide sequence of the influenza The present disclosure provides a way to produce a VLP containing chimeric influenza (HA) haemagglutinin in a host capable of producing a VLP, including a plant, insect or yeast comprising introducing a nucleic acid encoding a chimeric HA influenza comprising a domain domain (SDC), a head domain cluster (HDC) and a cluster of transmembrane domains (TDC) wherein: the SDC comprises a subdomain F'1, F'2 and F; the HDC comprises a subdomain RB, E1 and E2; the TDC comprises a subdomain TmD and Ctail wherein the subdomain RB is a first influenza HA polypeptide and the subdomains SDC and EI and E2 are a second influenza HA polypeptide and wherein the first influenza HA polypeptide is influenza H1 or H5 and the second influenza HA polypeptide is influenza HI or H5, and the second influenza HA polypeptide is derived from a different influenza strain of the first influenza HA polypeptide in the host and incubation of the host under conditions that allow expression of the nucleic acid, thus producing the VLPs. The production of VLPs in plants has several advantages over the production of these particles in insect cell culture. Plant lipids can stimulate specific immune cells and increase the immune response induced. Plant membranes are made of lipids, phosphatidylcholine (PC) and phosphatidylethanolamine (PE), and also contain glycosphingolipids that are unique to plants and some bacteria and protozoa. Sphingolipids are unusual because they are not esters of glycerol such as PC or PE but consist of a long chain amino alcohol which forms an amide bond to a fatty acid chain containing more than 18 carbons. PC and PE as well as glycosphingolipids may bind to CD1 molecules expressed by mammalian immune cells such as antigen presenting cells (APCs) such as dendritic cells and macrophages and other cells including B and T lymphocytes in the thymus and liver. In addition, in addition to the potential adjuvant effect of the presence of plant lipids, the ability of plant N-glycans to facilitate the capture of glycoprotein antigens by antigen-presenting cells may be advantageous for the production of chimeric VLPs in plants. Without wishing to be bound by theory, chimeric VLPs are predicted to produce a stronger immune reaction than chimeric VLPs produced in other manufacturing systems and that the immune reaction induced by such chimeric VLPs is stronger when compared to the immune-induced reaction by live or attenuated live vaccines.

Unlike vaccines made from complete viruses, chimeric VLPs provide the advantage as they are non-infectious, so restrictive biological containment is not as significant a problem as working with a complete infectious virus and is not required for production. Chimeric plant VLPs provide an additional advantage again by allowing the expression system to be cultured in a greenhouse or field, thus being significantly more economical and suitable for scaling.

In addition, the plants do not comprise the enzymes involved in synthesizing and adding sialic acid residues to proteins. VLPs can be produced in the absence of neuraminidase (NA), and there is no need to co-express NA, either treat producer cells or extract with sialidase (neuraminidase), to ensure VLP production in plants.

BRIEF DESCRIPTION OF THE DRAWINGS

These and other features of the invention will become more apparent from the following description, in which reference is made to the accompanying drawings, in which: Figure 1A shows a schematic diagram of HA subdomains. SP: signal peptide, F'1, F'2 and F: fusion subdomains; RB: receptor-binding subdomain, E1 and E2: esterase subdomains, TMD / CT: transmembrane and cytoplasmic tail subdomains. Figure 1B shows schematic representations of plastocyanin-based expression cassettes (construction numbers: 774, 540, 660, 690, 691, 696) for hemagglutinin expression HI A / Brisbane / 59/2007 (H1 / Bri), hemagglutinin H1A / New Caledonia / 20/99 (H1 / NC) and hemagglutinin H5A / Indonesia / 5/05 (H5 / Indo) in native and chimeric forms. Protoplasm: Alfalfa plastocyanin promoter, Plastother: Alfalfa plastocyanin terminator, SP: signal peptide, RB: receptor-binding subdomain, E1-RB-E2: esterase and receptor-binding subdomains, TMD / CT: subdomains of transmembrane and cytoplasmic tail: disulfide isomerase of alfalfa protein. Figure 2 shows the amino acid sequence of the indicated subdomains of chimeric HA expressed with top panel, constructs 690, 734 (SEQ ID NO: 11), 696 (SEQ ID NO: 112) and lower panel, 691 (SEQ ID NO: 113 Amino acids 1-92 of SEQ ID NO: 111 is the HIF / EI domain of H5 / Indo; amino acids 93-263 are a HB / Brisbane RB head domain and amino acids 2664-552 are an E2 + H5 / Indo domain F'2 Amino acids 1-92 of SEQ ID NO: 112 is the F'1 + E1 domain of H5 / NC, amino acids 93-301 is an R5 H5 / Indo head domain and amino acids 302-586 are an E2 + F'2 domain of H1 / NC amino acids 1-42 of SEQ ID NO: 113 are the H1 / Indo domain F'1; amino acids 43-273 are an El-RB Figure 3 shows the amino acid sequence of the coding region of constructs 690 and 734 (SEQ ID NO: 80) and the amino acid sequence (SEQ ID NO: 80) comprising a subdomain RB of H1 / Bri, a peptide H5 / Indo signal and a complex trunk domain (SDC) comprising subdomains H5 / Indo F'1, E1, E2, F'2 and F. Figure 4 shows the amino acid sequence of the coding region of construct 691 (SEQ ID NO: NO: 81) comprising the H1 / Bri (HDC) domain domain complex containing E1, RB, E2, a signal peptide H5 / Indo and H5 / Indo Domain Trunk Complex (SDC) comprising subdomains H5 / Indo F'1 , F'2 and F. Figure 5 shows the amino acid sequence of the coding region of construct 696 (SEQ ID NO: 82) comprising an R5 subdomain of H5 / Indo, a PDI signaling peptide, and stem domain complex H1 / NC comprising F'1, E1, E2 and F'2. Figure 6 shows an immunoblot analysis of H1 / Bri expression in native form, construct 774 (comprising H1 / Bri), construct 692 (comprising the H1 / Bri head domain complex (HDC)) and construct 690 (comprising the RB subgroup of H1 / Bri domain fused to the H5 / Indo trunk domain (SDC) complex in plants were analyzed for each construct, total protein extracts from 3 separate plants were analyzed and twenty micrograms of protein were loaded for each plant analyzed. Construction 774 expresses H1 / Bri with the native H1 / Bri signal peptide: constructs 690, 691 express the HA with the native signal peptide of Figure 7 shows immunoblot analysis of H5 / Indo expression in native form, construct 660 (comprising H5 / Indo, or construct 696 (comprising subdomain H1 / Indo RB fused to H1 / NC subdomains SDC, El and E2), were analyzed Total protein extracts from 3 separate plants, 20 micrograms of proteins were loaded for each plant analyzed and the Western blot was developed with polyclonal anti-H5 antibodies from Indonesia (ITC IT-003-005V). Construction 660 expresses H5 / Indo as its native signal peptide, construct 696 expresses the chimeric HA with a PDI signal peptide. Figure 8 shows a schematic representation of 35SCPMV / HT based expression cassettes for the expression of H1 / Bri in native (construct 732) and chimeric (constructs 733 and 734) forms. Construction 733, comprising the PDI signal peptide and HDC complex, SDC and H1 / Bri transmembrane domain (TDC), and construct 734 comprising an H5 / Indo signal peptide, F'1, E2, F'2, F , and a RB of H1 / Bri. Promoter 35S pro: CaMV 35S, NOSter: nopaline synthase terminator, SP: signal peptide, RB: receptor-binding subdomain, E1-RB-E2: esterase and receptor-binding subdomains, TMD / CT: transmembrane tail subdomains and cytoplasmic, PDI: alfalfa protein disulfide isomerase; CPMV-HT: 5 'and 3' elements of the hypercritible virus expression system of cowpea mosaic. Figure 9 shows the immunoblot analysis of H1 / Bri expression in native form, construct 732 (comprising H1 / Bri under control of the 35SCPMV / HT-based expression cassette), construct 733 (comprising a PDI signal peptide fused to Hl / Bri, under the control of the 35SCPMV / HT-based expression cassette), or construct 734 comprising a H1 / Bri RB subdomain fused to an H5 / Indo subdomain SDC, E1 and E2; under control of the 35SCPMV / HT-based expression cassette). For each construct, total protein extracts from 3 separate plants were analyzed. Five micrograms of protein were loaded for each analyzed plant. Western blot was developed with anti-HA monoclonal antibodies (FII 10-150). Figure 10 shows the schematic representation of 35SCPMV / HT based expression cassettes for the expression of hemagglutinins H3A / Brisbane / 10/2007 HA (H3 / Bri) and B / Florida / 4/2006 HA (B / Flo). The construct 736 comprises H3 / Bri fused to a signal peptide of the PDI. Construction 737 comprises H3 / Bri fused to a PDI signal peptide and an H5 / Indo TMD / CT. The construct 739 comprises B / Flo fused to a PDI signal peptide. Construction 745 comprises B / Flo fused to a PDI signal peptide and an H5 / Indo TMD / CT. Promoter 35S pro: CaMV 35S, NOSter: nopaline synthase terminator, SP: signal peptide, RB: receptor-binding subdomain, E1-RB-E2: esterase and receptor-binding subdomains, TMD / CT: transmembrane tail subdomains and cytoplasmic, PDI: alfalfa protein disulfide isomerase; CPMV-HT: 5 'and 3' elements of the hypercritible virus expression system of cowpea mosaic. Figure 11 shows the melting edge in constructions number 745 and 737. The origin of the HA sequence is indicated by bullet-tip arrows. The amino acids of the transmembrane domain are QILSIYSTVA and are preceded by amino acids that are part of the ectodomain. Figure 12 shows the amino acid sequence of the chimeric H5 / H3 hemagglutinin (SEQ ID NO: 83; structure 737) comprising a PDI signal peptide, a H3 A / Brisbane / 10/2007 ectodomain and a H5 A / Indonesia / 5/2005. Figure 13 shows the amino acid sequence of the chimeric H5 / B hemagglutinin (SEQ ID NO: 84) comprising a B / Florida / 4/2006 ectodomain and an H5 A / Indonesia / 5/2005 DTM / CT / open reading in construction number 745. Figure 14 shows the immunoblot analysis of B / Flo expression in native form, construct 739 (comprising PDI-B / Flo), or construct 745 (comprising B / Flo HDC and SDC fused to an H5 / Indo TDC). For each construct, total protein extracts from 3 separate plants were analyzed. Twenty micrograms of protein were loaded for each plant analyzed. Western blot was developed with anti-HA B / Florida polyclonal antibodies (NIBSC 07/356). Figure 15 shows immunoblotting analysis of H3 / Bri expression in native form, construct 736 (comprising PDI sp-H3 / Bri) or construct 737 (H3 / Bri HDC and SCD fused to an H5 / Indo TDC). For each construct, total protein extracts from 3 separate plants were analyzed. Twenty micrograms of protein were loaded for each plant analyzed. Western blot was developed with anti-H3 Brisbane polyclonal antibodies (NIBSC 08/124). Figure 16 shows size exclusion chromatography of protein extracts from plant leaves infiltrated with construct number 745. The relative protein content of the elution fractions is presented for each fraction. Immunodetion (western blot) of hemagglutinin using anti-HAB / Florida polyclonal antibodies (NIBSC 07/356) in fractions 7 to 15 is shown below the graph. The elution peak of Blue Dextran 2000 is indicated by the arrow (fraction 8). Figure 17 shows the nucleic acid sequence (SEQ ID NO: 52) of the synthesized fragment comprising the complete H5 coding region (A / Indonesia / 5/05 (H5N1)) (including signal peptide and stop codon) flanked, in 5 'by a HindIII site and, at 3', by a Saci site. Figure 18 shows the nucleic acid sequence (SEQ ID NO: 53) of the construct 660, an HA expression cassette comprising an alfalfa plastocyanin promoter and 5'UTR, H5 / A5 / hemagglutinin coding sequence / 05 (H5N1), 3 'UTR plastocyanin alfalfa and terminator sequences. Figure 19 shows the nucleic acid sequence (SEQ ID NO: 54) of the wild type HI coding sequence (A / New Caledonia / 20/99 (HI1N1) (GenBank AY289929) without TmD and Ctail. nucleotide sequence (SEQ ID NO: 55) of a synthesized fragment comprising H1 (A / New Caledonia / 20/99 (H1N1) coding sequence lacking TmD and Ctail In the 5 'region, the latter nucleotides originate from PDI SP and 3, a double Saci / StuI site is found immediately downstream of the stop codon Figure 21 shows the nucleic acid sequence (SEQ ID NO: 56) of the synthesized fragment comprising the sequence of BglII and 3 ' coding C-ter H1 (A / New Caledonia / 20/99 (H1N1) including the TmD and Ctail from the Kpn1 site to the stop codon (flanked at 3 'by a double Saci / StuI site). Figure 22 shows the sequence of nucleotides for Medicago sativa mRNA for protein disulfide isomerase GenBank Z11 499 (SEQ ID NO: 57) Nucleotides 32-103 encode the PDI signal peptide. Figure 23 shows the nucleotide sequence for the plasmid PromPlasto-PDISP-Plasto 3'UTR. Figure 23A shows the nucleotide sequence for PromPlasto-PDISP (SEQ ID NO: 58). Figure 23B shows the nucleotide sequence of Plasto 3'UTR (SEQ ID NO: 85). The protein disulfide isomerase (PDI) signal peptide is underlined. The restriction sites BglII (AGATCT) and Saci (GAGCTC) used for cloning are shown in bold. Figure 24 shows the nucleic acid sequence (SEQ ID NO: 59; construct 540) of the HA expression cassette comprising alfalfa plastocyanin promoter and 5'UTR, PDI signal peptide coding sequence and H1A / New Caledonia form / 20/99 (H1N1), 3'UTR alfalfa plastocyanin and terminator sequences. Hl coding sequence A / New Caledonia / 20/1999 is underlined. Figure 25 shows the nucleic acid sequence (SEQ ID NO: 60) of the synthesized fragment comprising the complete H1 (A / Brisbane / 59/07 (H1N1) coding region (including signal peptide and stop codon) flanked, in 5 'by sequences of alfalfa plastocyanin genes corresponding to the first 84 nucleotides upstream of the initial ATG, starting with a Drain site and 3' by a Saci site. Figure 26 shows the nucleic acid sequence (SEQ ID NO: 61; construct 774) of the HA expression cassette comprising alfalfa plastocyanin promoter and 5'UTR, H1 hemagglutinin coding sequence A / Brisbane / 59/07 (H1N1), alfalfa, 3'UTR plastocyanin and terminator sequences. Figure 27 shows the nucleic acid sequence of expression cassette number 828 (SEQ ID NO: 62), from Pad (upstream of the promoter) to Asei (immediately downstream of the NOS terminator). bold. Apal constraint location underlined and italic. Figure 28 shows the nucleic acid sequence (SEQ ID NO: 63; construction 690) of a chimeric H5 / H1 expression cassette comprising alpha plastocyanin and 5'UTR promoter, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3 'RTUs and termination sequences. The chimeric HA coding sequence is underlined. Figure 29 shows the nucleic acid sequence (SEQ ID NO: 64; construct 691) of a chimeric H5 / H1 expression cassette comprising alpha plastocyanin and 5'UTR promoter, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3 'UTR and terminator sequences. The chimeric HA coding sequence is underlined. Figure 30 shows the nucleic acid sequence (SEQ ID NO: 65; construct 696) of a chimeric H1 / H5 expression cassette comprising alpha plastocyanin and 5'UTR promoter, chimeric hemagglutinin coding sequence, plastocyanin UTR of alfalfa and terminator sequences. The chimeric HA coding sequence is underlined. Figure 31 shows the nucleic acid sequence (SEQ ID NO: 66; construct 732) of the HA expression cassette comprising the CaMV 35S promoter, CPMV-HT 5'UTR, H1 / Brisbane / 59 hemagglutinin coding sequence / 07 (H1N1), CPMV-HT 3'UTR and NOS terminator sequences. The H1 / Bri coding sequence is underlined. Figure 32 shows the nucleic acid sequence (SEQ ID NO: 67) of the ATG coding sequence to stop of the intermediate construct number 787. Figure 33 shows the nucleic acid sequence (SEQ ID NO: 68; 733) of the SpPDI H1 / Bri expression cassette comprising the CaMV 35M promoter, CPMV-HT 5'UTR, PDI signal peptide coding sequence, A / Brisbane / 59/07 (H1N1) sequences hemagglutinin coding sequence, , CPMV-HT 3'UTR and NOS termination. The SpPDI H1 / Bri coding sequence is underlined. Figure 34 shows the nucleic acid sequence (SEQ ID NO: 69; construct 734) of a chimeric H5 / H1 expression cassette comprising the CaMV 35S promoter, CPMV-HT 5'UTR, chimeric hemagglutinin coding sequence, CPMV- HT 3 'UTR and NOS terminator sequences. The chimeric HA coding sequence is underlined. Figure 35 shows the nucleic acid sequence (SEQ ID NO: 70) of the synthesized fragment comprising the complete (A / Brisbane / 10/07 (H3N2)) (including signal peptide and stop codon) H3 coding region flanked, in 5 'by sequences of alfalfa plastocyanin genes corresponding to the first 84 nucleotides upstream of the initial ATG, starting with a Drain site and 3' by a Saci site. Figure 36 shows the nucleic acid sequence (SEQ ID NO: 71; construct 736) of the HA expression cassette comprising the CaMV 35M promoter, 5 'CPMV-HT UTR, PDI signal peptide coding sequence, hemagglutinin H3 form A / Brisbane / 10/07 (H2N3), CPMV-HT 3'UTR and NOS terminator sequences. The coding sequence of Sp PDI H3 / Bris is underlined. Figure 37 shows the nucleic acid sequence (SEQ ID NO: 72; construct 737) of a chimeric H5 / H3 expression cassette comprising the CaMV 35M promoter, CPMV-HT 5'UTR, chimeric hemagglutinin coding sequence, CPMV -HT3 '. UTR and NOS terminator sequences. The chimeric HA coding sequence is underlined. Figure 38 shows the nucleic acid sequence (SEQ ID NO: 73) of the synthesized fragment comprising the complete coding region of HA (B / Florida / 4/06) (including signal peptide and stop codon) flanked at 5 by alfalfa, plastocyanin gene sequences corresponding to the first 84 nucleotides upstream of the initial ATG, starting with a Drain site and at 3 'by a Saci site. Figure 39 shows the nucleic acid sequence (SEQ ID NO: 74; construct 739) of the HA expression cassette comprising the CaMV 35S promoter, CPMV-HT 5'UTR, PDI signal peptide coding sequence, hemagglutinin coding sequence HA form B / Florida / 4/06, CPMV-HT 3'UTR and NOS terminator sequences. The Sp PDI B / Flo coding sequence is underlined. Figure 40 shows the nucleic acid sequence (SEQ ID NO: 75; construction 745) of a chimeric H5 / B expression cassette comprising the CaMV 35S promoter, CPMV-HT 5'UTR, chimeric hemagglutinin coding sequence, CPMV- HT 3 'UTR and NOS terminator sequences. The chimeric HA coding sequence is underlined. Figure 41 shows the nucleic acid sequence encoding Msjl (SEQ ID NO: 76). Figure 42 shows the nucleic acid sequence (SEQ ID NO: 77) of a portion of the R850 construct, from HindIII (at the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator). The coding sequence of HSP40 is underlined. Figure 43 shows the nucleic acid sequence (SEQ ID NO: 78) of a portion of construction number R860, from HindIII (at the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator). The coding sequence of HSP70 is underlined. Figure 44 shows the nucleic acid sequence (SEQ ID NO: 79) of a portion of the construct number R870, from HindIII (at the multiple cloning site, 5 upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator) . The HSP40 coding sequence is italicized underlining and the HSP70 coding sequence is underlined. A) nucleotides 1-4946; B) nucleotides 4947-9493. 45 shows a schematic representation of the construction number R472. Figure 46 shows the influenza A disulfide bridge pattern. 1) Cys4HAl-Cys 137HA2, 2) Cys60HA1-Cys72HA1, 3) Cys94HA1-Cys1443HA1, 4) Cys292HAl-Cys318HA5) Cys444HA2-Cys184HA2 and 6) Cys52HA1-Cys277HA1. Disulfide bridges that differ between subtypes A and B (Figure 47) are indicated by arrows. Numbering of the mature H3 protein was used. Figure 47 shows the influenza HA disulfide bridge pattern. Number of bridge: 1) Cys4HAl-Cysl37HA2, 2) Cys60HAl-Cys72HA1, 3) Cys94HAl-Cys 143HA1, 4) Cys292HAl-Cys318HA5) Cys444HA2-Cysl48HA2.6) Cys52HAl-Cys277HA1.7) Cys54HAl-Cys57HA1 and 8) Cys272HA1 Disulfide bridges that differ between subtypes A (Figure 46) and B are indicated by arrows. Numbering of the mature H3 protein was used. Figure 48 shows a schematic diagram of domain exchange fusion junctions. Figure 4BA shows the subdomain RB fusion of H1 / Bri, H3 / Bri and B / Flo with H5 / Indo SDC, and subdomain R5 of H5 / Indo with H1 / NC trunk domain. Figure 48B shows the melting of the subdomains E1-RB-E2 (HDC) of H1 / Bri, H3 / Bri or B / Flo with H5 / Indo SDC, and H5 / Indo HDC without H1 / NC SDC. Figure 49A shows the nucleotide sequence SEQ ID NO: 86) of HI1 / California / 04/09. The signal peptide coding sequence of the alfalfa protein disulfide isomerase is underlined and the mature HI coding sequence is highlighted in bold. Figure 49B shows the amino acid sequence (SEQ ID NO: 87) of HI1 / California / 04/09. The alfalfa protein disulfide isomerase signal peptide is underlined. Figure 50 shows immunoblot analysis of chimeric H5 / B hemagglutinin expression (construct number 747; comprising B / Flo HDC and SDC fused to an H5 / Indo TDC) after infiltration of undiluted AGL1 / 747, co-infiltrated with AGL1 / 443 (empty vector) and co-infiltrated with AGL1 / R870 (HSP40 / HSP70). For each construct, total protein extracts from 3 separate plants were analyzed. Twenty micrograms of proteins were loaded for each plant analyzed. Western blot was developed with anti-B Florida polyclonal antibodies (NIBSC). Figure 51A shows the nucleotide sequence for the 2X35S promoter sequence (SEQ ID NO: 88). Figure 51B shows the nucleotide sequence for Pad construct 747 (SEQ ID NO: 93) (upstream 35S promoter) for Asei (NOS terminator immediately downstream). The chimeric HA coding sequence is underlined. The sequence of the 2X35S promoter is indicated in italics.

DETAILED DESCRIPTION The present invention relates to virus-like particles. More specifically, the present invention relates to virus-like particles comprising chimeric influenza hemagglutinin and methods of producing chimeric influenza virus-like particles. The following description is of a preferred embodiment. The present invention provides a nucleic acid comprising a nucleotide sequence encoding a chimeric influenza (HA) hemagglutinin operably linked to a regulatory region active in a plant.

In addition, the present invention provides a method of producing virus-like particles (VLPs) in a plant. The method involves introducing a nucleic acid encoding a chimeric influenza AH operably linked to an active regulatory region in the plant, plant, or portion of the plant, and incubating the plant or a portion of the plant under conditions allowing the expression of the nucleic acid, thus producing the VLPs. The present invention further provides a VLP comprising chimeric HA influenza. The VLP can be produced by the method as provided by the present invention.

By "chimeric protein" or "chimeric polypeptide" is meant a protein or polypeptide comprising amino acid sequences of two or more than two sources, for example, but not limited to two or more types or subtypes of influenza, or influenza different origins, which are fused as a single polypeptide. The chimeric protein or polypeptide may include a signal peptide that is the same, or heterologous, with the remainder of the polypeptide or protein. The chimeric protein or chimeric polypeptide may be produced as a transcript of a chimeric nucleotide sequence, and the chimeric protein or chimeric polypeptide cleaved after synthesis and, as required, associated to form a multimeric protein. Thus, a chimeric protein or a chemical polypeptide also includes a protein or polypeptide comprising subunits that are linked through disulfide bridges (i.e., a multimeric protein). For example, a chimeric polypeptide comprising amino acid sequences of two or more than two sources can be processed into subunits, and the associated subunits via disulfide bridges to produce a chimeric protein or chimeric polypeptide (see Figures 46 and 47). The polypeptide may be hemagglutinin (HA), and each of the two or more than two amino acid sequences forming the polypeptide may be obtained from different HAs to produce a chimeric HA, or chimeric influenza A. A chimeric HA may also include an amino acid sequence comprising heterologous signal peptide (an HA chimeric protein) which cleaves after or during protein synthesis. Preferably, the chimeric polypeptide, or chimeric influenza HA does not occur naturally. A nucleic acid encoding a chimeric polypeptide may be described as a " chimeric nucleic acid &quot;, or a " chimeric nucleotide sequence &quot;. A virus-like particle comprised by chimeric HA can be described as a "chimeric VLP". The chimeric influenza HA according to various embodiments of the present invention may comprise a trunk domain complex (SDC), a head domain complex (HDC), and a complex domain domain. A compound of the formula: TDC is a first type of influenza HA, subtype or an origin, and one or more of a subdomain of SDC, HDC or TDC is of a second type of influenza KA , subtype or a second or different origin. As described herein, the "SDC" comprises a subdomain F'1, F'2 and F, the "HDC" comprises a subdomain RB, E1 and E2, the "TDC" comprises a subdomain ti1: The term "virus-like particle" (VLP) or "virus-like particles" or VLPs refers to structures which self-assemble and comprise structural proteins such as HA protein of the influenza virus or chimeric influenza HA protein VLPs and chimeric VLPs are generally morphologically and antigenically similar to the virions produced in an infection but lack sufficient genetic information to replicate and therefore non-infectious VLPs and chimeric VLPs can be produced in the presence of an appropriate host cell, including host cells, after extracting the host cell and after further isolation and purification under suitable conditions, the chimeric VLPs and VLPs can be purified as intact structures, chimeric VLPs, or VLPs, pr derived from influenza derived proteins according to the present invention do not comprise M1 protein. It is known that M1 protein binds to RNA (Wakefield and Brownlee, 1989) which is a contaminant of the VLP preparation. The presence of unwanted RNA when regulatory approval is obtained for the chimeric VLP product, whereby a VLP preparation chimeric antibody without ARM may be advantageous.

The chimeric VLPs of the present invention may be produced in a host cell which is characterized as not having the ability to sialylate proteins, for example, a plant cell. See, for example, Gupta et al., 1999 Nucleic Acids Research 27: 370-372; Toukach et al., 2007. Nucleic Acids: Késèta et al. 35: D280-D286; Nakahara et al., 2008 Nucleic Acids Research 36: D368-D371. Chimeric VLPs produced as described herein typically do not typically comprise; neuraminidase (NA). However, NA may be co-expressed with HA if VLPs comprising HA and NA are desired:;); The invention also provides VLPs containing chimeric HA that obtain a lipid envelope from the plasma membrane of the cell in which the chimeric HA is expressed. For example, if the chimeric HA is expressed in an herbal system, the resulting VLP can obtain a lipid envelope from the plasma membrane of the plant cell.

Generally, the term " lipid " refers to naturally-soluble fat (lipophilic) molecules. A chimeric VLP produced in a plant according to some aspects of the invention may be complexed with plant-derived lipids. Plant derived lipids may be in the form of a lipid bilayer and may further comprise an envelope surrounding the VLP. Plant derived lipids may comprise lipid components of the plasma membrane of the plant where the VLP is produced, including phospholipids, tri-, di- and monoglycerides, as well as fat soluble esters or metabolites comprising esters. Examples include phosphatidylcholine (PC), phosphatidylcholine (ph), phosphatidylinositoX, phosphatidylserine, glycosphingolipids, phytoesthetics, or a combination thereof. A plant derived lipid may alternatively be referred to as a "plant lipid:". Examples of phytosterols include: campester 1, stigmasin, ergosterol, brass sterase, tetramethylether 1, delta-7-avenasterol, daunosterol, sitosterol, 24-methylcholesterol, cholesterol, or beta-sitosterol - see, for example, pragmatics: As one skilled in the art would understand, the lipid composition of the plastic membrane of a . cell may vary with the culture or growth conditions of the cell or organism, or species, from which W cell is obtained. Generally, beta-sitosterol is the most abundant fifteen percent. the lipid composition of the plasma membrane of a cell can vary with the culture or growth conditions of the cell or organism, or species, from which the cell is obtained. Generally, beta-sitosterol is the most abundant phytosterol, the lipid composition of the plasma membrane of a cell can vary with the culture or growth conditions of the cell or organism, or species, from which the cell is obtained. Generally, beta-sitosterol is the most abundant phytosterol.

Cell membranes generally comprise lipid bilayers as well as proteins for various functions. Localized concentrations of particular lipids can be found in the lipid bilayer, known as lipid rafts. These lipid raft microdomains can be enriched in sphingolipids and sterols. Without being bound by theory, lipid rafts may have significant roles in endo and exocytosis, entry or exit of viruses or other infectious agents, intercellular signal transduction, interaction with other structural components of the cell or organism such as intracellular and extracellular matrices. The disclosure includes VLPs comprising chimeric HA, from which subdomains can be obtained from any type, influenza virus subtype that can infect humans, including, for example, H1 and H5 types or subtypes. Non-limiting examples of H1 or H5 types or subtypes include subtype A / New Caledonia / 20/99 (H1N1) ("H1 / NC"; SEQ ID NO: 56), subtype H1A / California 04/09 (H1N1) . ("H1 / Cal", SEQ ID NO: 86), and subtype A / Indonesia / 5/05 (H5N1) ("H5 / Indo"), as well as A / Brisbane / ). In addition, the chimeric HA may comprise one or more subdomains of a hemagglutinin that is isolated from one or more emerging or newly identified influenza viruses. The present disclosure also relates to influenza viruses infecting other mammals or host animals, for example humans, primates, horses, pigs, birds, avian aquatic birds, migratory birds, quail, ducks, geese, birds, chickens, camels, canines, other felines, cats, tigers, leopards, civets, martens, stone martens, ferrets, domestic animals, cattle, mice, rats, seals, whales and the like. Some influenza viruses can infect more than one host animal.

With reference to the influenza virus, the term "hemagglutinin" or "HA", as used herein, refers to a structural glycoprotein of influenza virus particles. The structure of influenza hemagglutinin is well studied and shows a high degree of conservation in the secondary, tertiary and quaternary structure. This structural conservation is observed even though the amino acid sequence may vary (see, for example, Skehel and Wiley, 2000 Ann Rev Biochem 69: 531-69; Vaccaro et al 2005, which is hereby incorporated by reference). The nucleotide sequences encoding HA are well known and are available, for example, in the BioDefense and Public Health Database (for example, URL: biohealthbase.org/GSearch/home.do?decorator=Influenza) or databases maintained by the National Center for Biotechnology Information (NCBI, for example, at URL: ncbi.nlm.nih.gov/sites/entrez? db = nuccore & cmd = search &amp; term = influenza), both incorporated herein by reference. The HA monomer may be subdivided into three functional domains - a trunk domain or a trunk domain domain (SDC), a globular head domain or a primary domain domain (HDC) and a transmembrane domain domain (TDC). SDC comprises four subdomains, a fusion peptide F, F'1 and F'2 (this subdomain may be generally referred to as a 'backbone'). The CDT comprises two subdomains, the transmembrane (TmD) and a C-terminal tail (CT). The HDC comprises three subdomains, vestigial esterase domains El 'and E2 and a receptor binding domain RB. SDC and HDC may be collectively referred to as 'ectodomain'. A publication by Ha et al. 2002 (EMBO J. 21: 865-875, which is incorporated herein by reference) illustrates the relative orientation of the various subdomains of the CDS and HDC in various influenza subtypes, based on X-ray crystallographic structures. A schematic diagram of the relative subdomains to the N and C termini of the HA1 and HA2 polypeptides is shown in Figure 1A. An annotated structural alignment of various influenza subtypes is provided in Figure 1C. Amino acid variation is tolerated in influenza virus haemagglutinins. This variation provides new, continuously identified strains. The infectivity between the new strains may vary. However, the formation of hemagglutinin trimers, which subsequently form VLPs, is maintained. The present invention therefore provides a hemagglutinin amino acid sequence comprising chimeric HA or a nucleic acid encoding a chimeric hemagglutinin amino acid sequence which forms VLPs in a plant and includes known sequences and variant HA sequences which can be grown . The present invention also relates to the use of a chimeric HA polypeptide comprising a TDC, SDC and HDC. For example, the chimeric protein HA may be HAO, or a chimeric cleaved HA comprising subdomains of HA1 and HA2 of two or more types of influenza. The HAO can be expressed and folded to form a trimer, which can subsequently be assembled into VLPs. HAO cleavage produces HAl and HA2 polypeptides bound by a disulfide bridge (see Figures 1C, 46 and 47 for illustration of the disulfide bridge patterns). For an infectious virus particle, cleavage of the HAO precursor is required to elicit conformational HA2 alteration that releases the fusion peptide (at the N-terminus of the HA2 polypeptide) and make it available for fusion of cell and viral membranes. However, VLPs are not infectious and HA cleavage in HAl and HA2 is not required, for example, for the production of vaccines. The non-cleaved HAO precursor also meets in trimers and sprouts from the plasma membrane to form nanoparticles of VLP. The HAO polypeptide comprises several domains. The HDC subdomain of the HDC comprises several loops in antigenic regions designated as site AE. Antibodies that can neutralize the infectious influenza virus are often targeted to one or more of these sites. The vestibial esterase subdomains (El and E2) may have a role in the fusion and may bind to Ca ++. The F, F'1 and F'2 domains interact and cooperate to form a rod, raising the head of trimer HA above the membrane. A TmD and CT may be involved in anchoring the HA folded to a membrane. TmD may play a role in the affinity of HA for lipid rafts, whereas CT may play a role in HA secretion, while some of the cysteine residues found in the subdomain of CT may be palmitoylated. A signal peptide (SP) can also be found at the N-terminus of the HAO polypeptide. Figure 2 and Tables 4 and 5 provide examples of the amino acid sequences of the SP, F'1, F'2, El, RB, E2 and F domains of some influenza virus subtypes. Processing of an N-terminal signal peptide (SP) sequence during expression and / or secretion of influenza hemagglutinins may have a role in the HA coil. The term "signal peptide" generally refers to a short sequence (about 5-30 amino acids) of amino acids, generally found at the N-terminus of a hemagglutinin polypeptide that can direct the translocation of the newly translated polypeptide to a particular organelle, or in the positioning of specific domains of the polypeptide chain in relation to others. The signal peptide of the hemagglutinins targets the translocation of the protein to the endoplasmic reticulum and has been proposed to assist in positioning the N-terminal proximal domain relative to a membrane anchor domain of the nascent hemagglutinin polypeptide to aid in the cleavage and folding of the mature hemagglutinin. The insertion of HA into the endoplasmic reticulum (ER) membrane of the host cell, signal peptide cleavage and protein glycosylation are co-translational events. Correct HA coiling requires glycosylation of the protein and formation of at least 6 intra-chain disulfide bonds (see Figures 46 and 47). In Figure 46, the HA of subtype A shows to have 6 disulfide bridges conserved per monomer. By comparison, the B HA monomer (Figure 47) has seven disulfide bonds, and five of these disulfide bonds have a counterpart in A (reviewed in Skehel and Wiley, 2000. Ann Rev

Biochem. 69: 531-569; examples of structures illustrating intra and intermolecular disulfide bridges and other conserved amino acids and their relative positions are described, for example, in Gamblin et al., 2004, Science 303: 1838-1842; both of which are hereby incorporated by reference). As one skilled in the art would appreciate, it is important to ensure that a similar arrangement of disulfide bridges is obtained when preparing chimeric HAs.

A signal peptide may be native to hemagglutinin, or a signal peptide may be heterologous in relation to the primary hemagglutinin sequence to be expressed. A chimeric HA may comprise a signal peptide of a first type, subtype or strain of influenza with the HA balance of one or more than one different influenza type, subtype or strain. For example, native SPs of HA subtypes H1, H2, H3, H5, H6, H7, H9 or influenza type B can be used to express HA in a plant system. In some embodiments of the invention, the SP may be of an influenza type B, H1, H3 or H5; or subtype H1 / Bri, H1 / NC, H5 / Indo, H3 / Bri or B / Flo.

An SP may also be non-native, for example, from a structural or hemagglutinin protein of a virus other than influenza, or from a plant, animal or bacterial polypeptide. A non-limiting example of a signal peptide that may be used is that of the alfalfa protein disulfide isomerase (PDI SP; nucleotides 32-103 of accession number Z11499; SEQ ID NO: 34; Figure 17) having the sequence of The present invention therefore provides a chimeric influenza hemagglutinin comprising a native or non-native signal peptide and nucleic acids encoding such chimeric hemagglutinins. The present invention provides a chimeric influenza hemagglutinin comprising a native or non-native signal peptide and nucleic acids encoding such chimeric hemagglutinins. Correct folding of hemagglutinins may be important for protein stability, multimer formation, VLP formation and HA function (haemagglutinate capacity), among other characteristics of influenza hemagglutinins. The folding of a protein may be influenced by one or more factors, including, but not limited to, the protein sequence, the relative abundance of the protein, the degree of intracellular agglomeration, the availability of cofactors that may bind or be transiently associated with folded, partially folded or unfolded protein, the presence of one or more accompanying proteins or the like.

Heat shock proteins (Hsp) or stress proteins are examples of accompanying proteins, which can participate in various cellular processes, including protein synthesis, intracellular traction, prevention of incorrect folding, prevention of protein aggregation, assembly and disassembly of complexes protein folding, and protein breakdown. Examples of such chaperone proteins include, but are not limited to, Hsp60, Hsp65, Hsp70, Hsp90, HsplOO, Hsp20-30, HsplO, Hspl00-200, HsplOO, Hsp90, Lon, TF55, FKBPs, cyclophilins, ClpP, GrpE, ubiquitin , calnexin and protein disulfide isomerases (see, for example, Macario, AJL, Cold Spring Harbor Laboratory Res. 25: 59-70, 1995, Parsell, DA and Lindquist, S. Ann. Rev. Gen. 27: 437- 496 (1993); U.S. Patent No. 5,232,833). As described herein, the accompanying proteins, for example, but not limited to Hsp40 and Hsp70 can be used to ensure folding of a chimeric HA.

Examples of Hsp70 include Hsp72 and Hsc73 from mammalian cells, BDNA from bacteria, particularly mycobacteria such as Mycobacterium leprae, Mycobacterium tuberculosis and Mycobacterium bovis (such as Bacille-Calmette Guerin: referred to herein as Hsp71). DNA kinases from Escherichia coli, yeast and other prokaryotes, and BiP and Grp78 from eukaryotes, such as A. thaliana (Lin et al., 2001 (Cell Stress and Chaperones 6: 201-208) A particular example of a Hsp70 is A. thaliana Hsp70 (Genbank encoded ref: AY120747.1) Hsp70 is capable of specifically binding ATP, as well as polypeptides and unfolded peptides, thus participating in the folding and unfolding of proteins, as well as assembly and disassembly of protein complexes.

Examples of Hsp40 include DNAs from prokaryotes such as E. coli and mycobacteria and HSJ1, HDJ1 and Hsp40 from eukaryotes, such as alfalfa (Frugis et al., 1999, Plant Molecular Biology 40: 397-408). A particular example of an Hsp40 is M. sativa MsJl (AJ000995.1 or SEQ ID NO: 76). Hsp40 plays a role as a molecular chaperone in protein folding, thermotolerance and DNA replication, among other cellular activities. Figure 41 shows the nucleic acid sequence encoding Ms 1 (SEQ ID NO: 76).

Among Hsp, Hsp70 and its co-chaperone, Hsp40, are involved in the stabilization of translational and newly synthesized polypeptides before the synthesis is complete. Without wishing to be bound by theory, Hsp40 binds to hydrophobic patches of unfolded (nascent or recently transferred) polypeptides, thereby facilitating the interaction of the Hsp70-ATP complex with the polypeptide. The hydrolysis of ATP leads to the formation of a stable complex between the polypeptide, Hsp70 and ADP, and the release of Hsp40. The association of the Hsp70-ADP complex with the hydrophobic fragments of the polypeptide prevents its interaction with other hydrophobic fragments, preventing incorrect folding and aggregation with other proteins (reviewed in Hartl, FU, 1996, Nature 381: 571-579).

Native chaperone proteins may be able to facilitate correct folding of low levels of recombinant protein, but as expression levels increase, the abundance of native chaperones may become a limiting factor. High levels of hemagglutinin expression in agroinfiltrated leaves can lead to accumulation of hemagglutinin polypeptides in the cytosol, and co-expression of one or more of a chaperone protein, such as Hsp70, Hsp40 or both Hsp70 and Hsp40, may reduce the level of unfolding or polipii aggregated hemagglutinin and increase the number of polypeptides exhibiting tertiary and quaternary structural characteristics that allow hemagglutination and / or formation of virus-like particles. SEQ ID NO: 77 is the nucleic acid sequence of a portion of the R850 construct number, HindIII (at the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator), encoding HSP40 (underlined) . SEQ ID NO: 78 is a nucleic acid sequence of a portion of construction number R860, from HindIII (at the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator), encoding HSP70 (underlined) . SEQ ID NO: 79 is a nucleic acid sequence of a portion of construction number R870, HindIII (at the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator) encoding HSP40 (underlined italic) and HSP70 (underlined). upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator), encoding HSP70 (underlined). SEQ ID NO: 79 is a nucleic acid sequence of a portion of construction number R870, HindIII (at the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator) encoding HSP40 (underlined italic) and HSP70 (underlined). upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator), encoding HSP70 (underlined). SEQ ID NO: 79 is a nucleic acid sequence of a portion of construction number R870, HindIII (at the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator) encoding HSP40 (underlined italic) and HSP70 (underlined).

Accordingly, the present invention also provides a method for producing chimeric influenza VLPs in a plant, wherein a first nucleic acid encoding a chimeric influenza HA is coexpressed with a second nucleic acid encoding a companion. The first and second nucleic acids may be introduced into the plant in the same step, or may be introduced into the plant sequentially.

VLPs can be evaluated for structure and size, for example, by hemagglutination assay, electron microscopy, or by size exclusion chromatography.

For size exclusion chromatography, the total soluble proteins can be extracted from the plant tissue by homogenization (Polytron) of the sample of frozen ground vegetable material in extraction buffer and the insoluble material removed by centrifugation. Precipitation with PEG may also be beneficial. The soluble protein is quantified and the extract is passed through a Sephacryl ™ column. 0 Blue Dextrano 2000 can be used as calibration standard. After chromatography, the fractions can be further analyzed by immunoblotting to determine the protein complement of the fraction. The present invention also provides a plant comprising a nucleic acid encoding one or more of a chimeric influenza hemagglutinin and a nucleic acid encoding one or more of the chaperones. The present disclosure includes nucleotide sequences: SEQ ID NO: 63 (construct 690; a chimeric H5 / H1 expression cassette comprising alfalfa plastocyanine promoter and 5'UTR, chimeric hemagglutinin coding sequence, 3 'UTR, and plastocyanin terminator sequences of alfalfa) and the underlined portion of SEQ ID NO: 63 encoding SP, F'1, EI from H5 / Indo-RB from H1 / Bri-E2, F'2, F, TMD / CT from H5 / Indo; SEQ ID NO: 64 (construct 691; a H5 / H1 chimeric expression cassette comprising alfalfa plastocyanin promoter and 5'UTR, chimeric hemagglutinin coding sequence, 3 'alfalfa plastocyan UTR and terminator sequences) and the pore underlining of SEQ ID NO: 64, encoding SP, F'1, from H5 / Indo-El, RB.E2 from H1 / Bri-F'2, F, TMD / CT from H5 / Indo; SEQ ID NO: 65 (construction 696; a chimeric H1 / H5 expression cassette comprising alfalfa plastocyanin promoter and 5'UTR, chimeric hemagglutinin coding sequence, 3 'UTR sequences and alfalfa plastocyanin terminator) and the underlined pore of SEQ ID NO: 65 encoding SP-F'1 PDI, H1 / NC-RB of H5 / lndo-E2, F'2, F, TMD / CT of H1 / NC; SEQ ID NO: 68 (construct 733; the SpPDI H1 / Bri expression cassette comprising the CaMV 35S promoter, CPMV-HT 5'UTR, PDI signal peptide coding sequence, H1A / Brisbane / CPI-HT 3'UTR and NOS terminator sequences), and the underlined portion of SEQ ID NO: 68, encoding PDI SP-F'1, EL, RB, E2, F'2, F , Hl / BRI TMD / CT; SEQ ID NO: 69 (construct 734; a chimeric H5 / H1 expression cassette comprising the CaMV 35S promoter, CPMV-HT 5'UTR, chimeric hemagglutinin coding sequence, 3 'UTR CPMV-HT, and NOS terminator sequences). The chimeric HA coding sequence is underlined, encoding the same chimeric HA as SEQ ID NO: 63; SEQ ID NO: 71 (construct 736, an HA expression cassette comprising the CaMV 35M promoter, 5 'CPMV-HT UTR, PDI signal peptide coding sequence, H3 hemagglutinin coding sequence A / Brisbane / 10 / RTI ID = 0.0 &gt; SEQ ID NO: 71 encoding PDI SP-F'1, EL, RB, E2, F'2, F, TMD / CT H3 / Bri; SEQ ID NO: 72 (construct 737; a chimeric H5 / H3 expression cassette comprising the CaMV 35S promoter, CPMV-HT 5'UTR, chimeric hemagglutinin coding sequence, CPMV-HT 3 'UTR and NOS terminator sequences) and the underlined pore of SEQ ID NO: 72 encoding PD5 SP-F'1, El, RB, E2, F'2, F, TMD / CT H5 / Indo; SEQ ID NO: 74 (construct 739; an HA expression cassette comprising the CaMV 35S promoter, 5 'CPMV-HT UTR, PDI signal peptide coding sequence, HA hemagglutinin coding sequence B / Florida / 4/06 , CPMV-HT terminator sequences 3'UTR and NOS) and the underlined portion of SEQ ID NO: 74 encoding PD-SP'F, F, I, RB, E2, F'2, F, TMD / CT B / Flo; SEQ ID NO: 75 (construct 734, a H5 / B chimeric expression cassette comprising the CaMV 35S promoter, CPMV-HT 5'UTR, chimeric hemagglutinin coding sequence, 3 'UTR CPMV-HT and NOS terminator sequences) and the pore underlined sequence of SEQ ID NO: 75 encoding H5 / Indo B-Flo-TND / CT PDI SP-F'1, El, RB, E2, F'2, F. The present disclosure also includes a nucleotide sequence that hybridizes under stringent hybridization conditions to the underlined portions of any one of SEQ ID NOs: 63-65, 68, 69 and 71-75. The present disclosure also includes a nucleotide sequence that hybridizes under stringent hybridization conditions to a complement of the underlined portions of any one of SEQ ID NOs: 63-65, 68, 69 and 71-75. These nucleotide sequences which hybridize to the underlined portions of SEQ ID NOs: 63-65, 68, 69 and 71-75, or a complement of the underlined portions of SEQ ID NOs: 63-65, 68, 69 and 71-75, encode a chimeric hemagglutinin protein which, when expressed, forms a chimeric VLP, and the chimeric VLP induces the production of an antibody when administered to a subject. For example, expression of the nucleotide sequence within a plant cell forms a chimeric VLP, and the chimeric VLP can be used to produce an antibody which is capable of binding to HA, including mature HA, HAO, HAl or HA2 of one or more types or subtypes. Chimeric VLP, when administered to a subject, induces an immune response. Hybridization under stringent hybridization conditions known in the art (see for example Current Protocols in Molecular Biology, Ausubel et al., Eds., 1995 and Supplements, Maniatis et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, 1982, Sambrook and Russell, in Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, each of which is hereby incorporated by reference). An example of such a stringent hybridization conditions may be about 16-20 hours of hybridization in 4 X SSC at 65, followed by washing in 0.1 X SSC at 65 ° C for one hour, or 2 washes at 0.1 X SSC to 65? C for 20 or 30 minutes. Alternatively, an exemplary stringent hybridization condition may be overnight (16-20 hours) in 50% formamide, 4X SSC at 42øC, followed by washing in 0.1 X SSC at 65øC for one hour, or 2 washes in 0.1X SSC at 65øC each aqueous phosphate buffer for 20 or 30 minutes, or overnight (16-20 hours), or in-Church hybridization (7% SDS; 0.5 M NaPO4 buffer pH 7.2, 10 mM EDTA) at 65 ° C, with 2 washes at 50 in 0.1 X SSC, 0.1% SDS for 20 or 30 minutes each, or 2 washes at 65 in 2 X SSC, 0.1% SDS for 20 or 30 minutes each.

In addition, the present disclosure includes nucleotide sequences which are characterized as having about 70, 75, 80, 85, 87, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100%, or any amount from sequence identity, or sequence similarity, to the nucleotide sequence encoding chimeric HA according to the underlined portions of any one of SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, wherein the nucleotide sequence encodes a hemagglutinin protein which when expressed forms a chimeric VLP and that the chimeric VLP induces the production of an antibody. For example, expression of the nucleotide sequence in a plant cell forms a chimeric VLP and the chimeric VLP can be used to produce an antibody which is capable of binding to HA, including mature HA, HA0, HAl or HA2. VLP, when administered to a subject, induces an immune response.

An "immune response" generally refers to an adaptive immune system response. The adaptive immune system generally comprises a humoral response and a cell-mediated response. The humoral response is the aspect of immunity that is mediated by secreted antibodies produced in the cells of the B lymphocyte (B-cell) lineage. Segregated antibodies bind to antigens on the surface of invading microbes (such as viruses or bacteria), which signal them to be destroyed. Humoral immunity is generally used to refer to antibody production and the accompanying processes, as well as effector functions of antibodies, including Th2 cell activation and cytokine production, memory cell generation, opsonin phagocytosis promotion, elimination of pathogens and the like. The terms "modular" or "modulation" or the like refer to an increase or decrease of a particular response or parameter, as determined by any of the various generally known or used assays, some of which are exemplified herein.

A cell-mediated response is an immune response that does not involve antibodies, but involves the activation of macrophages, natural killer (NK) cells, antigen-specific cytotoxic T lymphocytes, and the release of various cytokines in response to an antigen. Cell mediated immunity is generally used to refer to some Th cell activation, Tc cell activation and T cell mediated responses. Cell mediated immunity is of particular importance in response to viral infections.

For example, induction of antigen-specific CD8 positive T lymphocytes can be measured using an ELISPOT assay; Stimulation of CD4 + positive T lymphocytes can be measured using a proliferation assay. Anti-influenza antibody titer can be quantified using an ELISA assay; Antigen specific or cross-reactive isotypes can also be measured using anti-isotype antibodies (e.g., anti-IgG, IgA, IgE or IgM). Methods and techniques for carrying out such assays are well known in the art.

A hemagglutinin inhibition (HI or HAI) assay may also be used to demonstrate the efficacy of antibodies induced by a vaccine, or vaccine composition comprising chimeric HA or chimeric VLP can inhibit red cell agglutination (RBC) by recombinant HA. Hemagglutination inhibitory antibody titres from serum samples can be assessed by microtiter HAI (Aymard et al., 1973). The erythrocytes of any of several species may be used - for example, horse, turkey, chicken or the like. This assay provides indirect information on the assembly of the HA trimer on the surface of the VLP, confirming the adequate presentation of antigenic sites in HAs.

Cross-HAI titers may also be used to demonstrate the efficacy of an immune response to other virus strains related to the vaccine subtype. For example, serum from a subject immunized with a vaccine composition comprising a chemical hemagglutinin comprising a HDC of a first type or influenza subtype may be used in an HAI assay with a second whole virus strain or virus particles and the titer of HAI determined.

Without being bound by theory, the ability of HA to bind to RBC from different animals is driven by the affinity of HA by sialic acids bound to Î ± 2,3 or Î ± 2,6 linkages and the presence of these sialic acids on the RBC surface. EH of horses and birds of influenza viruses agglutinate erythrocytes of all various species, including turkeys, chickens, ducks, guinea pigs, humans, sheep, horses and cows; considering that human AH binds to erythrocytes of turkeys, chickens, ducks, guinea pigs, humans and sheep (Ito T. et al., 1997, Virology, 227; 493-499; Medeiros R et al, 2001. Virology 289: 74 -85). The presence or levels of cytokines can also be quantified. For example, a helper T cell response (Th1 / Th2) will be characterized by the measurement of IFN-γ and IL-4 secreting cells using by ELISA (e.g., BD Biosciences OptEIA kits). Peripheral blood mononuclear cells (PBMCs) or splenocytes obtained from a subject, and the supernatant analyzed, may be cultured. T lymphocytes can also be quantified by fluorescence activated cell sorting (FACS) using fluorescence-specific marker markers and methods as are known in the art.

A microneutralization assay may also be conducted to characterize an immune response in an individual, see for example the methods of Rowe et al., 1973. Virus neutralization titers can be obtained in various ways, including: 1) enumeration of plaques of lysis (plaque assay) after fixation of violet crystal / cell staining; 2) microscopic observation of cell lysis in culture; 3) ELISA and spectrophotometric detection of NP virus protein (correlated with viral infection of host cells) Δ sequence identity or sequence similarity can be determined using a sequence comparison program such as that provided in ADNSIS (e.g. , using, but not limited to, the following parameters: GAP 5 penalty, # upper diagonals 5, GAP 10 fixed penalty, k-tuple 2, floating gap 10, and window size 5). However, other methods of aligning sequences for comparison are well known in the art, for example, Smith &amp; Waterman (1981, Adv. Appl. Math. 2: 482) Needleman &amp; Wunsch (J. Mol. Biol. 48: 443, 1970), and by computerized implementations of such algorithms (eg, GAP, BESTFIT, FASTA, et al., Pearson and Lipman, 1988, Proc. Natl. BLAST (Altschul et al., 1990, J. Mol Biol 215: 403-410), or by manual alignment and visual inspection. Nucleic acid or amino acid sequences can be compared or aligned and consensus sequences can be determined using any of the various software packages known in the art, for example MULTALIN (Corpet F., 1988, Nucl Acids Res., 16 (22), 10881-10890), BLAST, CLUSTAL or the like, alternatively the sequences may be aligned manually and similarities and differences between the given sequences.

A fragment or portion of a protein, fusion protein or polypeptide includes a peptide or polypeptide comprising a subset of the amino acid complement of a particular protein or polypeptide, so long as the fragment can form a chimeric VLP when expressed. The fragment may, for example, comprise an antigenic region, a stress response inducing region or a region comprising a functional domain of the protein or polypeptide. The fragment may also comprise a region or domain common to proteins of the same general family, or the fragment may include sufficient amino acid sequence to specifically identify the full length protein from which it is derived.

For example, a fragment or portion may comprise from about 60% to about 100%, the length of the total length of the protein, or any amount thereon, so long as the fragment may form a chimeric VLP when expressed. For example, from about 60% to about 100%, from about 70% to about 100%, from about 80% to about 100%, from about 90% to about 100%, from about 95% to about 100% length of the total length of the protein, or any amount among them. Alternatively, a fragment or moiety may be from about 150 to about 500 amino acids, or any amount thereof, depending on the chimeric HA, and so long as the fragment can form a chimeric VLP when expressed. For example, a fragment may be from 150 to about 500 amino acids, or any amount thereof, from about 200 to about 500 amino acids, or any amount thereof, from about 250 to about 500 amino acids, or any amount between about 300 to about 500 or any amount among them, from about 350 to about 500 amino acids, or any amount thereof, from about 400 to about 500 or any amount thereof, from about 450 to about 500 or any amount thereof, depending on the chimeric HA, and provided that the fragment can form a chimeric VLP when expressed. For example, about 5, 10, 20, 30, 40 or 50 amino acids, or any amount thereof, may be removed from the C-terminus, N-terminus or both N and C termini of a chimeric HA protein, that the fragment may form a chimeric VLP when it expresses, from about 400 to about 500 or any amount among them, from about 450 to about 500 or any amount thereof, depending on the chimeric HA, and provided that the fragment can form a chimeric VLP when expressed. For example, about 5, 10, 20, 30, 40 or 50 amino acids, or any amount thereof, may be removed from the C-terminus, N-terminus or both N and C termini of a chimeric HA protein, that the fragment may form a chimeric VLP when it expresses, from about 400 to about 500 or any amount among them, from about 450 to about 500 or any amount thereof, depending on the chimeric HA, and provided that the fragment can form a chimeric VLP when expressed. For example, about 5, 10, 20, 30, 40, or 50 amino acids, or any amount thereof, may be removed from the C-terminus, the N-terminus, or both N and C termini of a chimeric HA protein, that the fragment may form a chimeric VLP when expressed. Amino acid numbering in any given sequence is relative to the particular sequence, however, one skilled in the art can readily determine the equivalence of a particular amino acid in a sequence based on the structure and / or sequence. For example, if 6 N-terminal amino acids were removed, this would change the specific numerical identity of the amino acid (for example, relative to the total length of the protein), but would not alter the relative position of the amino acid in the structure. The present disclosure describes, but is not limited to, the expression of a nucleic acid encoding a chimeric HA in a plant cell portion, or a plant cell, and the production of chimeric influenza VLPs from the plant, suitable for vaccine production. Examples of such nucleic acids include, for example, but are not limited to, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69. The present disclosure further provides the expression of a nucleic acid encoding a chimeric HA, for example but not limited to SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, in a plant, a portion of a plant, or a plant cell, and production of influenza vaccine candidates or reagents composed of recombinant influenza structural proteins that self-assemble into functional and immunogenic macrophobic macromolecular protein structures, including subviral influenza particles and influenza chimeric VLP in transformed plant cells.

Accordingly, the disclosure provides chimeric VLPs and a mode for the production of chimeric VLPs in a plant expression system, from the expression of a single chimeric envelope protein. The nucleic acid encoding chimeric influenza subtypes HA, for example, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, can be synthesized by reverse transcription and polymerase chain reaction (PCR) using HA RNA. As an example, the RNA may be isolated from H1 / NC, H1 / Bri or H5 / Indo, or from cells infected with these or other types or subtypes of influenza virus. For reverse transcription and PCR, oligonucleotide primers specific for HA RNA may be used. In addition, a nucleic acid encoding a chimeric HA can be synthesized chemically using methods as would be known to one skilled in the art. The present invention is further directed to a genetic construct comprising a nucleic acid encoding a chimeric HA as described above, operatively linked to a regulatory element that is operative in a plant. Examples of operative regulatory elements in a plant cell and which may be used in accordance with the present invention include, but are not limited to, a plastocyanin regulatory region (US 7125978), or a Ribulose 1,5-bisphosphate carboxylase / oxygenase regulatory region (RuBisco, US 4962028), chlorophyll a / b binding protein (CAB; Leutwiler et al., 1986), ST-LS1 (associated with the oxygen-enveloping photosystem II complex described by Stockhaus et al., 1987, 1989 ). The genetic construct of the present invention may also comprise a constitutive promoter which directs the expression of a gene that is operably linked to the promoter throughout the various parts of a plant and continuously throughout the development of the plant. A non-limiting example of a constitutive promoter is that associated with the CaMV transcript 35, dell et al., 1985, Nature, 313: 810-81.).

An example of a sequence comprising a plastocyanin regulatory region is sequence 5 'for the sequenced underlined coding for a PDI signal peptide of SEQ ID NO: 58. A regulatory element or regulatory region may enhance the translation of a sequence nucleotide sequence to which it is operably linked, where the nucleotide sequence may encode a protein or polypeptide. Another example of a regulatory region, the derivative of untranslated regions of cowpea mosaic virus (CPMV), which can be used to preferentially translate the nucleotide sequence to which it is operably linked. This CPMV regulatory region is exploited in a hyper-translatable CMPV system (CPMV-HT; see, for example, Sainsbury et al., 2008, Plant Physiology 148: 1212-1218; Sainsbury et al., 2008 Plant Biotechnology Journal 6: 82 -92).

Accordingly, one aspect of the invention provides a nucleic acid comprising a regulatory region operably linked to a sequence encoding a chimeric influenza HA. The regulatory region may be a plastocyanin regulatory element, and chimeric HA influenza may comprise subdomains H5 / Indo, H1 / Bri, H1 / NC, subtype or strain subdomains. Nucleic acid sequences comprising a plastocyanin regulatory element and a chimeric influenza HA are exemplified herein by SEQ ID NOs: 63 and 64. Nucleic acid sequences comprising a 35S regulatory element and a chimeric influenza HA are exemplified herein by SEQ ID NOs: 63 and 64. ID NOs: 68, 69 and 71-75.

In another aspect, the invention provides a nucleic acid comprising a regulatory region of CPMV and a chimeric influenza HA, comprising subdomains of H5 / Indo, H1 / Bri, H1 / NC subtype types or subtypes or strains. Nucleic acid sequences comprising a CPMP regulatory element and a chimeric HA are exemplified herein by SEQ ID NOs: 66-69 and 71-75. Plant chimeric influenza virus VLPs sprout from the plasma membrane and the lipid composition of the chimeric VLPs reflects that of the cell tissue type or plant plant from which they are produced. The VLPs produced according to the present invention comprise chimeric HA of two types or subtypes of influenza, complexed with plant-derived lipids. Plant lipids can stimulate specific immune cells and increase the immune response induced. Plant lipids such as PC (phosphatidylcholine) and PE (phosphatidyl ethanolamine) as well as glycosphingolipids may bind to CD1 molecules expressed by mammalian immune cells such as antigen presenting cells (APCs) such as dendritic cells and macrophages and other cells including B and T lymphocytes in the thymus and liver (reviewed in Tsuji M, 2006 Cell Mol Life Sci 63: 1889-98). The CD1 molecules are structurally similar to the major histocompatibility complex (MHC) class I molecules and their role is to present glycolipid antigens to NKT cells (Natural Killer T cells). After activation, NKT cells activate innate immune cells, such as NK cells and dendritic cells, and also activate adaptive immune cells, such as B cells and antibody-producing T cells.

Phytosterols present in a influenza VLP complexed with a lipid bilayer, such as a plasma membrane derived envelope, can provide an advantageous vaccine composition. Without wishing to be bound by theory, plant VLPs, including those comprising chimeric HA, complexed with a lipid bilayer, such as a plasma membrane-derived envelope, may induce a stronger immune reaction than VLPs made in other expression, be similar to the immune reaction induced by live or attenuated whole virus vaccines.

Accordingly, in some embodiments, the invention provides a VLP comprising a chimeric HA complexed with a plant derived lipid bilayer. In some embodiments, the plant derived lipid bilayer may comprise the VLP envelope. VLP produced within a plant may include a chimeric HA comprising plant-specific N-glycans. Therefore, this invention also provides a VLP comprising a chimeric HA having plant-specific N-glycans.

In addition, modification of N-glycan in plants is known (see, for example, WO 2008/151 440) and chimeric HA having modified N-glycans can be produced. A chimeric HA comprising a modified glycosylation pattern, for example with fucosylated, xylosylated or both fucosylated and xylosylated N-glycans, or can be obtained chimeric HA having a modified glycosylation pattern, wherein the protein has no fucosylation, xylosylation or both and comprises increased galatosylation. In addition, modulation of post-translational modifications, for example the addition of terminal galactose may result in a reduction of the fucosylation and xylosylation of the expressed chimeric HA as compared to a wild type plant expressing chimeric HA.

For example, which should not be considered limiting, the synthesis of chimeric HA having a modified glycosylation pattern can be achieved by co-expressing the protein of interest together with a nucleotide sequence encoding beta-1,4galactosyltransferase (GalT), for example, but not limited to mammalian GalT, or human GalT, however, GalT can also be used from other sources. The catalytic domain of GalT can also be fused to a CTS domain (ie, cytoplasmic tail, transmembrane domain, trunk region) of N-acetylglucosaminyl transferase (GNT1), to produce a hybrid enzyme GNT1-GalT, and the hybrid enzyme may be co-expressed with HA. HA may also be coexpressed together with a nucleotide sequence encoding N-acetylglucosaminyltransferase III (GnT-III), for example but not limited to mammalian GnT-III or human GnT-III, GnT-III from other sources may also be co-expressed. be used. Additionally, a hybrid enzyme GNT1-GnT-III, comprising GNT1 CTS fused to GnT-III, may also be used.

Therefore, the present invention also includes VLP comprising chimeric HA having modified N-glycans.

Without wishing to be bound by theory, the presence of plant N-glycans in a chimeric HA can stimulate the immune response by promoting the binding of HA by antigen-presenting cells. The stimulation of the immune response using the N-glycan plant has been proposed by Saint-Jore-Dupas et al. (Trends Biotechnol 25: 317-23, 2007). Furthermore, the conformation of the VLP may be advantageous for the presentation of the antigen and increase the adjuvant effect of the VLP when complexed with a lipid layer derived from the plant.

By "regulatory region,""regulatoryelement," or "promoter" is meant a portion of nucleic acid typically, but not always, upstream of the protein coding region of a gene, which may comprise DNA or RNA, or both DNA and RNA. When a regulatory region is active, and in operative, or operably linked, association with a gene of interest, this may result in expression of the gene of interest. A regulatory element may be capable of mediating organ specificity or controlling the activation of temporal or developmental genes. A "regulatory region" includes promoter elements, central promoter elements exhibiting a basal promoter activity, elements that are inducible in response to an external stimulus, elements that mediate promoter activity, such as negative regulatory elements or transcription enhancers. "Regulatory region," as used herein, also includes elements that are active following transcription, for example, regulatory elements that modulate gene expression, such as translation and transcription enhancers, translation and transcription repressors, upstream activation sequences and determinants of mRNA instability. Several of these latter elements may be located near the coding region.

In the context of this disclosure, the term "regulatory element" or "regulatory region" typically refers to a DNA sequence, usually, but not always, upstream (5 ') of the coding sequence of a structural gene, which controls the expression of the coding region, providing recognition of RNA polymerase and / or other factors necessary for transcription to start at a particular site. However, it is to be understood that other nucleotide sequences, located within the introns, or 3 'of the sequence may also contribute to the regulation of the expression of a coding region of interest. An example of a regulatory element that provides recognition of RNA polymerase or other transcriptional factors to ensure initiation at a specific site is a promoter element. Most but not all of the eukaryotic promoter elements contain a TATA box, a conserved nucleic acid sequence composed of pairs of adenosine and thymidine nucleotide bases usually located approximately 25 base pairs upstream of a transcription start site. A promoter element comprises a basal promoter element, responsible for the initiation of transcription, as well as other regulatory elements (as listed above) that modify gene expression.

There are several types of regulatory regions, including those that are regulated by development, inducible or constitutive. A regulatory region that is regulated by development, or controls the differential expression of a gene under its control, is activated within certain organs or tissues of an organ at specific times during the development of that organ or tissue. However, some regulatory regions that are regulated by development may be preferentially active within certain organs or tissues at specific stages of development, they may also be active in a developmentally regulated manner, or at basal level in other organs or tissues within the plant also. Examples of tissue-specific regulatory regions, for example, a sight-specific regulatory region, include the napin promoter and the cruciferin promoter (Rask et al., 1998, J. Plant Physiol 152: 595-599, Bilodeau et al. 1994, Plant Cell 14: 125-130). An example of a specific leaf promoter includes the plastocyanin promoter (see, for example, SEQ ID NO: 58); US 7125978, which is hereby incorporated by reference).

An inducible regulatory region is one that is capable of directly or indirectly activating the transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequences or genes will not be transcribed. Typically, the factor of protein that specifically binds to an inducible regulatory region to activate transcription may be present in an inactive form, which is then directly or indirectly converted to the active form by the inducer. However, the protein factor may also be absent. The inducer may be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress directly imposed by heat, cold, salt or toxic elements or indirectly by the action of a pathogen or disease-causing agent, such as a virus. A plant cell containing an inducible regulatory region may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or the like. Inducible regulatory elements may be derived from plant or non-plant genes (by Gatz, C. and Lenk, IRP, 1998, Trends Plant Sci. 3, 352-358, which is incorporated by reference). Examples of potential inducible promoters include, but are not limited to, a tetracycline-inducible promoter (Gatz, C., 1997, Ann. Rev. Plant Physiol.Pol. Mol. Biol. 48, 89-108, which is incorporated by reference), induced promoter by Steroids (Aoyama, T. and Chua, NH, 1997, Plant J. 2, 397-404, which is incorporated by reference) and ethanol inducible promoter (Salter, MG, et al., 1998, Plant Journal 16, In the present invention, the cytokinin-inducible IB6 and CKI1 genes (Brandstatter, I., and Kieber, JJ, 1998, Plant (1992), Caddick, MX et al., 1998, Nature Biotech, 16, 177-180, which are incorporated by reference) Cell 10, 1009-1019; Kakimoto, T., 1996, Science 274, 982-985; incorporated by reference) and the auxin inducible element, DR5 (Ulmasov, T., et al., 1997, Plant Cell 9, 1963-1971, which is incorporated by reference).

A constitutive regulatory region directs the expression of a gene throughout the various parts of a plant and continuously during the development of the plant. Examples of known constitutive regulatory elements include promoters associated with the CaMV 35S transcript. (An et al., 1996). In the present study, the actin-1 (Zhang et al., 1991, Plant Cell, 3: 1155-1165), actin 2 (Odell et al., 1985, Nature 313: 810-812) Plant J., 10: 107-121) or tms2 (US 5428147, which is incorporated herein by reference), and triosephosphate isomerase 1 genes (Xu et al., 1994, Plant Physiol 106: 459-467) , the maize ubiquitin 1 gene (Cornejo et al, 1993, Plant Mol. Biol. 29: 637-646), the Arabidopsis ubiquitin 1 and 6 genes (Holtorf et al., 1995, Plant Mol. Biol. 29: 637 -646) and the translational initiation factor gene for tobacco 4A (Mandei et al., 1995 Plant Mol. Biol. 29: 995-1004). The term "constitutive," as used herein, does not necessarily indicate that a gene under the control of the constitutive regulatory region is expressed at the same level in all cell types, but that the gene is expressed on a wide range of cell types, although variation abundance is often observed. The constitutive regulatory elements may be coupled to other sequences to further enhance the transcription and / or translation of the nucleotide sequence to which they are operably linked. For example, the CPMV-HT system is derived from the untranslated regions of the Cowpea mosaic virus (CPMV) and demonstrates improved translation of the associated coding sequence.

By "native" is meant that the nucleic acid or amino acid sequence occurs naturally or "wild type".

By "operably linked" it is meant that particular sequences, for example a regulatory element and a coding region of interest, interact directly or indirectly to perform a desired function, such as mediation or modulation of gene expression. The interaction of operably linked sequences may, for example, be mediated by proteins which interact with the operably linked sequences. The nucleotide sequence of the present invention may be expressed in any suitable plant host that is transformed by the nucleotide sequence or constructs or vectors of the present invention. Examples of suitable hosts include, but are not limited to, agricultural crops including alfalfa, canola, Brassica spp., Maize, Nicotiana spp., Alfalfa, potato, ginseng, pea, oats, rice, soybean, wheat, barley, sunflower, It's similar. The chimeric gene construct of the present invention may further comprise a 3 'untranslated region. A 3 'untranslated region refers to the portion of a gene comprising a DNA segment containing a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by effecting the addition of polyadenylic acid lanes to the 3 'end of the mRNA precursor. Polyadenylation signals are commonly recognized by the presence of homology with the canonical form 5 'AATAAA-3', although variations are not uncommon.

Non-limiting examples of suitable 3 'regions are the 3' transcribed untranslated regions containing a polyadenylation signal of Agrobacterium tumor (Ti) -ducing plasmid genes, such as the nopaline synthase (NOS) gene, plant genes such such as the soybean storage protein, the small subunit of the ribulose-1,5-bisphosphate carboxylase gene (ssRUBISCO, US 4962028, which is incorporated herein by reference), the promoter used in regulating the expression of plastocyanin, described in US 7125978 (which is hereby incorporated by reference).

One or more of the chimeric genetic constructs of the present invention may also include other enhancers, be they translators or transcriptional enhancers, as may be required. Enhancers may be located 5 'or 3' for the sequence being transcribed. Enhancer regions are well known to those skilled in the art and may include an ATG initiation codon, adjacent sequences or the like. The start codon, if present, may be in phase with the reading frame ("in the frame") of the coding sequence to provide correct translation of the transcribed sequence.

To assist in the identification of transformed plant cells, the constructs of this invention may be further manipulated to include selectable plant markers. Useful selectable markers include enzymes that provide resistance to chemicals such as an antibiotic, for example, gentamicin, hygromycin, kanamycin or herbicides such as phosphinothricin, glyphosate, chlorosulfuron and the like. Similarly, enzymes can be used which provide for the production of a color-alterable identifiable compound, such as GUS (beta-glucuronidase), or luminescence, such as luciferase or GFP.

Also contemplated are part of this invention transgenic plants, plant cells or seeds containing the chimeric gene construct of the present invention. Methods of regenerating entire plants from plant cells are also known in the art. In general, transformed plant cells are cultured in an appropriate medium, which may contain selective agents such as antibiotics, where selectable markers are used to facilitate the identification of transformed plant cells. Once formed by the calli, bud formation can be encouraged by employing the appropriate plant hormones according to known methods and the shoots transferred to the rooting medium for plant regeneration. The plants can then be used to establish repetitive generations, from seeds or using vegetative propagation techniques. Transgenic plants can also be generated without the use of tissue cultures.

Also contemplated as part of this invention are transgenic plants and trees containing the chimeric gene construct comprising a nucleic acid encoding HA or recombinant chimeric HAO for VLP production, in accordance with the present invention.

The regulatory elements of the present disclosure may also be combined with the coding region of interest for expression within a range of host organisms that are amenable to transient expression or transformation. Such organisms include, but are not limited to, monocotyledonous and dicotyledonous plants, for example but not limited to corn, cereal plants, wheat, barley, oats, Nicotiana spp., Brassica spp., Soybeans, beans, peas, alfalfa, potatoes, tomatoes , ginseng and Arabidopsis. Methods for stable transformation and regeneration of such organisms are set forth in the art and known to one skilled in the art. The method of obtaining transformed and regenerated plants is not critical to the present invention.

"Transformation" means the interspecific transfer of genetic information (nucleotide sequence) that manifests itself genotypically, phenotypically or both. Interspecific transfer of genetic information from a chimeric construct to a host may be hereditary and the transfer of genetic information considered stable, or the transfer may be transient and the transfer of genetic information is not hereditary.

By the term "plant matter" is meant any material derived from a plant. The plant matter may comprise an entire plant, tissue, cells or any fraction thereof. In addition, the plant material may comprise intracellular plant components, extracellular plant components, liquid extracts or plant solids or a combination thereof. In addition, the plant material may comprise plants, plant cells, tissue, a liquid extract or a combination thereof, from plant leaves, stems, fruits, roots or a combination thereof. The plant material may comprise a plant or part thereof which has not undergone any processing steps. A part of a plant may comprise plant matter. However, it is also contemplated that the plant material may be subjected to minimum processing steps, as defined below, or to more stringent processing, including partial or substantial protein purification using techniques commonly known in the art including, but not limited to chromatography, electrophoresis, and the like.

By the term "minimal processing" is meant plant matter, for example, a plant or portion thereof comprising a protein of interest that is partially purified to produce a plant extract, homogenate, plant homogenate fraction or the like (i.e. minimally processed). Partial purification may comprise, but is not limited to, cleavage of plant cell structures, thereby creating a composition comprising soluble plant components and insoluble plant components which may be separated, for example, but not limited to, centrifugation, filtration or a combination thereof. In this regard, proteins secreted into the extracellular space of the sheet or other tissues may be readily obtained using vacuum or centrifugal extraction, or the tissues may be extracted under pressure by passing through rolls or grinding or the like to squeeze or release the free protein within the extracellular space. Minimal processing could also involve the preparation of crude extracts of soluble proteins, since such preparations would have negligible contamination of secondary plant products. In addition, minimal processing may involve aqueous extraction of the leaf soluble protein, followed by precipitation with any suitable salt. Other methods may include large-scale maceration and juice extraction to allow direct use of the extract. Vegetable matter, in the form of plant or tissue material, may be administered orally to a subject. Vegetable matter can be administered as part of a dietary supplement, along with other foods, or encapsulated. The vegetable matter or tissue may also be concentrated to improve or enhance palatability, or provided together with other pharmaceutical materials, ingredients or excipients as required.

Examples of a subject or target organism that the VLPs of the present invention may be administered include, but are not limited to, humans, primates, birds, waterfowl, migratory birds, quails, ducks, geese, poultry, chickens, swine, sheep animals equine horse camel canine dogs feline cats tiger leopard civet marta stone ferrets pet house the taste. Such target organisms are exemplary and should not be considered limiting to the applications and uses of the present invention. It is contemplated that a plant comprising the chimeric HA according to some embodiments of the invention, or expressing the VLP comprising the chimeric HA according to some embodiments of the invention, may be administered to a subject or target organism in a variety of ways depending on the need and the situation. For example, the chimeric HA obtained from the plant can be extracted prior to its use either in a crude, partially purified or purified form. If the chimeric HA must be at least partially purified, then it may be produced in edible or inedible plants. In addition, if the chimeric HA is administered orally, the plant tissue may be harvested and fed directly to the individual, or the harvested tissue may be dried prior to feeding, or an animal may be allowed to graze on the plant without prior harvesting. Place, place. It is also contemplated within the scope of this invention that the harvested plant tissues are provided as a food supplement in animal feed. If the plant tissue is to be fed to an animal with little or no further processing, it is preferred that the plant tissue to be administered is edible.

Posttranscriptional gene silencing (PTGS) may be involved in limiting the expression of transgenes in plants, and the coexpression of a potato virus silencing suppressor Y (HcPro) can be used to neutralize the specific degradation of transgenic mRNAs (Brigneti et al., 1998). Alternative silencing suppressors are well known in the art and can be used as described herein (Chiba et al., 2006, Virology 346: 7-14, which is incorporated herein by reference), for example but not limited to, TEV-pl (HCV-Pro / HC-Pro), BYV-p21, pl9 of Tomato stab virus (TBSV ρ19), capsid protein of Tomato plinkle virus (TCV-PC), 2b of cucumber mosaic virus ; CMV-2b), p25 from Potato virus X (PVX-p25), pll from Potato virus M (PVM-pll), pll from Potato virus S (PVS-pll), pl6 from Blueberry scorch virus, p23 from Grapevine-B virus (GVB-pl4), p23 from Grapevine-B virus (GTV-p23), p24 from Citrus tristeza virus (CTV-p23), p24 from Grapevine- , Heracleum latent virus plO (HLV-plO), or pl6 of the common latent virus Garlic (GCLV-pl6). Therefore, a silencing suppressor, for example, but not limited to HcPro, TEV-pl / HC-Pro, BYV-p21, TBSV pl9, TCV-CP, CMV-2b, PVX-p25, PVM-pll, PVS-pll , BScV-pl6, CTV-p23, GLRaV-2 p24, GBV-p14, HLV-p10, GCLV-p16 or GVA-p10, can be coexpressed together with the nucleic acid sequence encoding the protein of interest to ensure even higher levels of protein production within a plant.

In addition, the VLPs produced as described herein do not comprise neuraminidase (NA). However, NA may be co-expressed with HA if VLPs comprising HA and NA are desired.

Accordingly, the present disclosure further includes a suitable vector comprising the chimeric HA sequence suitable for use with stable or transient expression systems. Genetic information may also be provided within one or more of a construction. For example, a nucleotide sequence encoding a protein of interest may be introduced into a construct, and a second nucleotide sequence encoding a protein that modifies the glycosylation of the protein of interest may be introduced using a separate construct. These nucleotide sequences can then be coexpressed within a plant. However, a construct comprising a nucleotide sequence encoding the protein of interest and the protein that modifies the glycosylation profile of the protein of interest may also be used.

By "co-expressed" is meant that two or more than two nucleotide sequences are expressed at about the same time within the plant and within the same plant tissue. However, nucleotide sequences need not be expressed at exactly the same time. In contrast, the two or more nucleotide sequences are expressed in a manner such that the encoded products have a libido fragment. For example, the protein that modifies the glycosylation of the protein of interest may be expressed before or during the course of the preparation. the protein: of interest; φ expressed: ® d d d m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m. of the two double-stranded nucleotide sequences can be coexpressed using a transient expression system, wherein the two or more sequences are introduced into the DNA sequence, approximately at the same time, and in which case, sequences are expressed. Alternatively, a plasmid plasmid comprising one of the nucleotide sequences, for example, the coding sequence: modifies the glycosylation peptide of the protein of interest, can be transformed, transiently, from a POD. cbP a SdidiOial sequence encoding the protein, of interest, is the sequence encoding the protein which modifies the glycosylation profile of the protein of interest: be: expressed within: of a fabric; may be induced using an inducible promoter and the additional sequence encoding the protein of interest may be expressed under similar conditions and in the same tissue to ensure that the nucleotide sequences are co- expressed.

The constructs of the present invention can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, infiltration and the like. For reviews of such techniques see, for example, Weissbach and Weissbach, Methods for Plant Molecular Biology, Academy Press, New York, VIII, pp. 421-463 (1988); Geierson and Corey, Plant Molecular Biology, 2d Ed. (1988); and Miki and Iyer, Foundations of Gene Transfer in Plants. In Plant Metabolism, 2d Ed. DT. Dennis, DH Turpin, DD Lefebrve, DB Layzell (eds), Addison-Wesley, Langmans Ltd. London, pp. : 561-51: 9 (1997), Methods: include direct DNA uptake, the use of ilpossomes, e.g., using protoplasts, microinjection; my cr © projectiles; or "whiskers" ψ infiltration s vicu © * See, for example: *: Sllanp st al. (Gene 10: 247-250 (1991)) (1981) Moly Genet 228: 104-112 (1991) Guerche et al. (Plant Science 52: 111-116, 1987) Neuhause et al. (Theor. Appl Genet, 75: 30-36, 1987) Klein et al., Nature 327: 70-73 (1987); Howell et al. (Science 208: 1265, 1980) Horsch et al. (Science 227: 1229-1231, 1985) DeBlock et al., Plant Physiology 91: 694-701, 1989), Liu and Lomonossoff (J. Virol Meth., 105: 343-348, 2002), U.S. Patents 4,944,5050; 5,036,006; 5,100,792; 6403865; 5625136, (all of which are hereby incorporated by reference).

Transient expression methods can be used to express the constructs of the present invention (see Liu and Lomonossoff, 2002, Journal of Virological Methods, 105: 343-348, which is hereby incorporated by reference). Alternatively, a vacuum-based transient expression method, as described by Kapila et al. 1997 Plant Science 122: 101-108 (incorporated herein by reference) may be used. These methods may include, for example, but are not limited to, an Agro-inoculation or Agro-infiltration method, however, other transient methods may also be used as mentioned above. With Agro-inoculation or Agro-infiltration, a mixture of Agrobacteria comprising the desired nucleic acid enters the intercellular spaces of a tissue, for example the leaves, aerial part of the plant (including stem, leaves and flower), another portion of the plant ( stem, root, flower), or the whole plant. After crossing the epidermis, Agrobacterium infects and transfers copies of t-DNA to the cells. The t-DNA is episcopically transcribed and the mRNA is translated, leading to the production of the protein of interest in infected cells, however, the passage of t-DNA into the nucleus is transient.

The VLPs comprising chimeric HA provided by the present invention may be used in conjunction with an existing influenza vaccine to supplement the vaccine, make it more effective or to reduce the dosages of administration required. As would be known to one skilled in the art, the vaccine may be directed against one or more than an influenza virus. Examples of suitable vaccines include, but are not limited to, those commercially available from Sanofi-

Pasteur, Biomedical ID, Merial, Sinovac, Quiron, Roche, Medlmmune, GlaxoSmithKline, Novartis, Sanofi-Aventis, Serono, Shire Pharmaceuticals and the like.

If desired, the VLPs of the present invention may be admixed with a suitable adjuvant, as would be known to one skilled in the art. In addition, the VLP may be used in a vaccine composition comprising an effective dose of VLP for the treatment of a target organism, as defined above. Furthermore, the VLP produced according to the present invention can be combined with VLPs obtained using different influenza proteins, for example, neuraminidase (NA).

Accordingly, the present invention provides a method for inducing immunity to influenza virus infection in an animal or target organism comprising administering an effective dose of a vaccine comprising one or more of a VLP. The vaccine may be administered orally, intradermally, intranasally, intramuscularly, intraperitoneally, intravenously or subcutaneously.

The compositions according to the present disclosure may comprise VLPs of two or more influenza strains or subtypes. "Two or more" refers to two, three, four, five, six, seven, eight, nine, 10 or more strains or subtypes. The represented strains or subtypes may be of a single subtype (for example, all of the H1N1 or all of the H5N1) or may be a combination of subtypes. Examples of subtypes and strains include H5 / Indo, H1 / Bri, H1 / NC. The choice of combination of strains and subtypes may depend on the geographical area of the subjects susceptible to being exposed to influenza, the proximity of animal species to a human population to be immunized (eg waterbird species, agricultural animals such as swine, etc.) and the strains they carry are exposed or likely to be exposed to antigenic drift predictions within subtypes or strains, or combinations of these factors.

The two or more VLPs may be expressed individually, and the purified or semi-purified VLPs subsequently combined. Alternatively, the VLPs may be co-expressed in the same host, for example, a plant, plant proton or plant cell. VLPs may be combined or produced in a desired ratio, for example, in equivalent ratios, or they may be combined in a way that a subtype or strain comprises most of the VLPs in the composition.

Accordingly, the disclosure provides compositions comprising VLPs of two or more strains or subtypes.

Also provided is an article of manufacture, comprising packaging material and a composition comprising a VLP comprising a chimeric HA. The composition includes a physiologically or pharmaceutically acceptable excipient, and the packaging material may include a label indicating the active ingredients of the composition (e.g., VLP).

A kit comprising a composition comprising a nucleic acid encoding a chimeric HA as provided herein, together with instructions for use of the nucleic acid for the production of chimeric HA, or VLPs comprising the chimeric HA also provided. The kit may be useful for the production of VLPs comprising the chimeric HA and the instructions may include, for example, information on the expression of the nucleic acid in a plant or a plant cell, instructions for harvesting and obtaining the VLPs from the plant or plant tissue.

In another embodiment, there is provided a kit for the preparation of a medicament, comprising a VLP comprising a chimeric HA, together with instructions for its use. The instructions may comprise a series of steps for the preparation of the medicament, the medicament being useful for inducing a therapeutic or prophylactic immune response in a subject to whom it is administered. The kit may further comprise instructions that address dose concentrations, dose ranges, preferred methods of administration or the like.

The present invention will be further illustrated in the following examples. The sequences described herein are summarized below. Methods and Materials 1. Assembling HA expression cassettes. A- pCAMBIAPlasto

All manipulations were performed using the general molecular biology protocols of Sambrook and Russell (2001, which is hereby incorporated by reference). Table 1 shows oligonucleotide primers used for assembly of expression cassettes. The first step of cloning consisted of assembling a receptor plasmid containing regulatory elements upstream and downstream of the alfalfa plastocyanin gene. The plastocyanin promoter and the 5'UTR sequences were amplified from the alfalfa genomic DNA using the oligonucleotide primers Xmal-pPlas.c (SEQ ID NO: 1) and SacI-ATG-pPlas. r (SEQ ID NO: 2). The resulting amplification product was digested with Xmal and Saci and ligated to pCAMBIA2300 (Cambia, Canberra, Austria), previously digested with the same enzymes, to create pCAMBIApromoPlasto. Similarly, the 3'UTR sequences and the terminator of the plastocyanin gene were amplified from the alfalfa genomic DNA using the following primers: Sacl-PlasTer.c (SEQ ID NO: 3) and EcoRI-PlasTer.R (SEQ ID NO: 4), and the product was digested with Saci and EcoRI before being inserted into the same sites of pCAMBIApromoPlasto to create pCAMBIAPlasto.B-

Plasto-Native SP-H5 A / Indonesia / 5/05 (construction number 660)

A fragment encoding hemagglutinin from influenza strain A / Indonesia / 5/05 (H5N1; Acc. No. LANL ISDN125873) was synthesized by Epoch Biolabs (Sugar Land, TX, USA). The fragment produced, containing the complete H5 coding region including the native signal peptide flanked by a HindIII site immediately upstream of the initial ATG, and a Saci site immediately downstream of the stop codon (TAA), is shown in (SEQ ID NO: 52 Figure 17). The H5 coding region was cloned into a plastocyanin-based expression cassette by the PCR-based binding method shown in Darveau et al. (1995). Briefly, a first PCR amplification was obtained using primers Plasto-443c (SEQ ID NO: 5;) and SpHA (Ind) -Plasto.r (SEQ ID NO: 6) and pCAMBIApromoPlasto as template. In parallel, a second amplification was performed with Plasto-SpHA (SEQ ID NO: 7) and HA (Ind) -Sac primers. r (SEQ ID NO: 8) with H5 coding fragment (SEQ ID NO: 52; Figure 17) as template. The amplification obtained from both reactions was mixed and the mixture served as a template for a third reaction (assembly reaction) using Plasto-443c (SEQ ID NO: 5) and HA (Ind) -Sac.r (SEQ ID NO: 8 ) as primers. The resulting fragment was digested with BamHI (in the plastocyanin promoter) and Saci (at the 3 'end of the fragment) and cloned into pCAMBIAPlasto previously digested with the same enzymes. The resulting plasmid, designated 660, is shown in Figure 18 (SEQ ID NO: 53). The resulting fragment was digested with BamHI (in the plastocyanin promoter) and Saci (at the 3 'end of the fragment) and cloned into pCAMBIAPlasto previously digested with the same enzymes. The resulting plasmid, designated 660, is shown in Figure 18 (SEQ ID NO: 53). The resulting fragment was digested with BamHI (in the plastocyanin promoter) and Saci (at the 3 'end of the fragment) and cloned into pCAMBIAPlasto previously digested with the same enzymes. The resulting plasmid, designated 660, is shown in Figure 18 (SEQ ID NO: 53). C-Plasto-PDI SP-H1 A / New Caledonia / 20/99 (Construction Number 540) The open reading frame of the A / New Caledonia / 20/99 H1N1 gene was synthesized in two fragments (Plant Biotechnology Institute, National Research Council, Saskatoon, Canada). A first synthesized fragment corresponds to the wild type coding sequence H1 (GenBank accession number AY289929; SEQ ID NO: 54; Figure 19) without the signal peptide coding sequence at the 5 'end and the coding sequence of the transmembrane domain at 3 'end. The 5'-end of the fragment is composed of the last nucleotides encoding PDISP (including a BglII restriction site) and a double Saci / StuI site was added immediately downstream of the termination codon at the 3 'endpoint of the fragment, to produce SEQ. ID No: 55 (Figure 20). The first H1 fragment was digested with BglII and SacI and cloned into the same sites of a binary vector (pCAMBIAPlasto) containing the plastocyanin promoter and 5'UTR fused to the signal peptide of the alfalfa protein disulfide isomerase (PDI) gene (nucleotides 32 SEQ ID NO: 57; Figure 22) resulting in a chimeric PDI-H1 gene downstream of the plastocyanin regulatory elements. The plastocyanin base cassette sequence containing the promoter and the PDI signaling peptide to the BglII restriction site and the plastocyanin terminator downstream of a SacI site, set forth in SEQ ID NO. 58 (Figure 23). Addition of the C-terminal end of the H1 coding region (encoding the transmembrane domain and the cytoplasmic tail) was obtained by inserting the previously digested KpnI and Saci synthesized fragment (SEQ ID NO: 56; Figure 21) into the H1 expression plasmid . The resulting construct, termed 540, is shown in SEQ ID NO. 59 (Figure 24). D-Plasto-native SP-Hl A / Briabane / 59/07 (construction number 774) Expression cassette number 774, leading to H1 expression of A / Brisbane / 59/07, was assembled as follows. A synthetic fragment comprising the complete 3 'flanked hemagglutinin (from ATG to stop) coding sequence was synthesized by alfalfa plastocyanin gene sequences corresponding to the first 84 nucleotides upstream of plastocyanin ATG starting with a Drain restriction site. Synthetic fragments also comprised a Saci site immediately downstream of the stop codon. The synthetic fragment was synthesized by Top Gene Technologies (Montreal, QC, Canada). The synthesized fragment is shown in SEQ ID NO. 60 (Figure 25). For the assembly of the full expression cassette, the synthetic fragment was digested with Drain and Saci and cloned into pCAMBIAPlasto previously digested with the same enzymes to give construct 774 (SEQ ID NO: 61; E-CPMV HT-LC C51 (Construction Number 828)

The CPMV-HT expression cassettes utilize the 35S promoter to control the expression of an mRNA comprising a 5 'flanking coding sequence of the nucleotides 1-512 of the cowpea mosaic virus (CPMV) RNA2 with ATG mutated at positions 115 and 161 and 3 by nucleotides 3330-3481 of CPMV RNA2 (corresponding to 3 'UTR) followed by the NOS terminator. Plasmid pBD-C5-lLC, (Sainsbury et al., 2008; Plant Biotechnology Journal 6: 82-92 and PCT Publication WO 2007/135480), was used for the assembly of hemagglutinin expression cassettes based on CPMV-ΗΤ. The mutation of ATGs at positions 115 and 161 of CPMV RNA2 was done using a PCR-based binding method Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). Two separate PCRs were performed using pBD-C5-lLC as template. The primers for the first amplification were pBinPlus.2613c (SEQ ID NO: 9) and Mut-ATG115.r (SEQ ID NO: 10). The primers for the second amplification were Mut-ATG161.C (SEQ ID NO: 11) and LC-C5-1,110r (SEQ ID NO: 12). The two fragments obtained were mixed and used as template for a third amplification using pBinPlus.2613c (SEQ ID NO: 9) and LC-C5-1,110r (SEQ ID NO: 12) as primers. The resulting fragment was digested with Pad and Apal and cloned into pBD-C5-lLC digested with the same enzymes. The generated construct, designated 828, is shown in Figure 27 (SEQ ID NO: 62).

Receptor binding domain F-Hl A / Brunsbane / 59/07 (RB) in structure H5 A / Indonesian / 5/05 (construction number 690)

A chimeric HA was made by replacing the RB domain in H5A / Indonesia / 5/5 by H1A / Brisbane / 59/07 using the PCR-based binding method presented in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). In a first round of PCR, a segment of the plastocyanin promoter fused to the natural signal peptide, the H5 A / Indonesia / 5/05 domains F'1 and El were amplified using primers Plasto-443c (SEQ ID NO: 5) and E1H1B-E1H5I.r (SEQ ID NO: 13) under construction number 660 (SEQ ID NO: 53, Figure 18) as template. A second fragment, comprising the H1A / Brisbane / 59/07 domain coding sequence, was amplified with the primers H5N-E1H1B.c (SEQ ID NO: 14) and E2H5I-RB HIB.r (SEQ ID NO: 15) using construct number 774 (SEQ ID NO: 61; FIG. 26) as the template. A third fragment comprising the E2, F'2, F, transmembrane and cytoplasmic domains of H5A /

Indonesia / 5/05 was amplified using RB primers HlB-E2H5I.C (SEQ ID NO: 16) and HA (Ind) -Sacl.R (SEQ ID NO: 8) under construction number 660 (SEQ ID NO: 53, Figure 18) as a model. The amplification products were then mixed and used as template for a second round of amplification (assembly reaction) with primers Plasto-443c (SEQ ID NO: 5) and HA (Ind) -Sacl (SEQ ID NO: 8 ). The resulting fragment was digested with BamHI (in the plastocyanin promoter) and Saci (after the stop codon) and cloned into the construction number 660 (SEQ ID NO: 53; Figure 18), previously digested with the same restriction enzymes to give rise 690 (SEQ ID NO: 63). The construct is shown in Figure 28 previously digested with the same restriction enzymes to give the number 690 (SEQ ID NO: 63). The construct is shown in Figure 28 previously digested with the same restriction enzymes to give the number 690 (SEQ ID NO: 63). The construction is shown in Figure 28.

G-Hl A / Brisbane / 59/07 domains and receptor-binding domains (E1-RB-E2) in structure H5 A / Indonesia / 5/05 (building number 691)

A chimeric HA was assembled by replacing the E1-RB-E2 domains in H5 A / Indonesia / 5/05 by those of H1 A / Brisbane / 59/07 using the PCR-based binding method presented in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)) In a first round of PCR, a segment of the plastocyanin promoter fused to the natural signal peptide and the F5 domain of H5 A / Indonesia / 5/05 was amplified using the primers Plasto-443c (SEQ ID NO: 5) and El H1B-F1 H5I.r (SEQ ID NO: 17) as construction number 660 (SEQ ID NO: 53; The second fragment, containing the coding sequence of the H1A / Brisbane / 59/07 E1-RB-E2 domains, was amplified with the primers F'1H5N-E1H1B.c (SEQ ID NO: 18) and F'2H5I-E2, HIB.r (SEQ ID NO: 19) using construct number 774 (SEQ ID NO: 61, Figure 26) as the template For the third fragment, domains F'2, F , transmembrane and cytoplasmic sequences of H5A / Indonesia / 5/05 were amplified using the E2 primers HIB-F'2H5l.c (SEQ ID NO: 20) and HA (Ind) -Sacir (SEQ ID NO: 8) with the construction number 660 (SEQ ID NO: 53; Figure 18) The amplification products were then mixed and used as template for a second round of amplification (assembly reaction) with primers Plasto-443c (SEQ ID NO: 5) and HA (Ind) -Sacl (SEQ ID NO: 8). The resulting fragment was digested with BamHI (in the plastocyanin promoter) and Saci (after the stop codon) and cloned into the construction number 660 (SEQ ID NO: 53; Figure 18), previously digested with the same restriction enzymes to give rise 691 (SEQ ID NO: 64). The construction is shown in Figure 29.

Receptor binding domain H-H5 A / Indonesia / 5/05 (BB) in H1 A / New Caledonia / 20/99 structure (construction number 696)

A chimeric HA was made by replacing the RB domain in H1A / New Caledonia / 20/99 by H5A / Indonesia / 5/05, using the PCR-based binding method presented in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). In a first PCR cycle, a segment of the plastocyanin promoter fused to the disulfide isomerase signal peptide of the alfalfa protein (PDISP; Accession No. Z11499; nucleotides 32-103 of SEQ ID NO: 57; Figure 22), F ' l and the El domains of H1A / New Caledonia / 20/99 were amplified using primers Plasto-443c (SEQ ID NO: 5) and E1H5I-E1H1NC.r (SEQ ID NO: 21) at construct number 540 (SEQ ID NO: ID NO: 59; Figure 24) as a model. A second fragment, comprising the H5A / Indonesia / 5/05 RB domain coding sequence, was amplified with the primers E1H1NC-E1H5I.c (SEQ ID NO: 22) and E2H1NC-RBH5I.r (SEQ ID NO: 23 ) using construction number 660 (SEQ ID NO: 53; Figure 18) as the template. The Athird fragment comprising the H1A / New Caledonia / 20/99 transmembrane and cytoplasmic E2, F'2, F domains was amplified using primers RB H5I-E2 HINC.c (SEQ ID NO: 24) and HA-SacI . r (SEQ ID NO: 25) having the construct number 540 (SEQ ID NO: 59; Figure 24) as template. The amplification products were then mixed and used as template for a second round of amplification (assembly reaction) with primers Plasto-443c (SEQ ID NO: 5) and HA-SacI.r (SEQ ID NO: 25). The resulting fragment was digested with BglII and SacI and cloned into the construct number 540 (SEQ ID NO: 59) previously digested with the same restriction enzymes to give construct number 696 (SEQ ID NO: 65). The construction is shown in Figure 30. I- Assembling H1 A / Brisbane / 59/2007 in the CPMV-HT expression cassette (construction number 732). The H1A / Brisbane / 59/2007 HA coding sequence was cloned into CPMV-HT as follows. The restriction sites Apal (immediately upstream of ATG) and StuI (immediately downstream of the stop codon) were added to the hemagglutinin coding sequence by performing a PCR amplification with the Apal-HIB.c (SEQ ID NO : 26) and StuI-HIB. r (SEQ ID NO: 27) using construct number 774 (SEQ ID NO: 61; Figure 26) as template. The resulting fragment was digested with the restriction enzymes Apal and StuI and cloned into the construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes. The resulting cassette was designated construction number 732 (SEQ ID NO: 66; Figure 31). J- Assembling dm SpPDI-Hl A / Brisbane / 59/2007 on the CPMV-expressão expression cassette (construction number 733).

A sequence encoding the disulfide isomerase signal peptide of the alfalfa protein (PDISP; nucleotides 32-103 of SEQ ID NO: 57, Figure 22; Accession N Z11499) was fused to the H1 HA1 coding sequence of A / Brisbane / 59 / 2007, and the fragment

The resulting product was cloned into the following CPMV-mode. The H1 coding sequence was amplified with the primers SpPDI-HBB (SEQ ID NO: 28) and SacI-HBB (SEQ ID NO: 29) using construct 774 (SEQ ID NO: 61; model. The resulting fragment consisted of the H1 coding sequence flanked 5 'by the last nucleotides encoding PDISP (including a BglII restriction site) and 3' by a Saci restriction site. The fragment was digested with BglII and SacI and cloned into the construct number 540 (SEQ ID NO: 59; Figure 24) previously digested with the same restriction enzymes. The coding sequence of the intermediate cassette, designated construction number 787 (SEQ ID NO: 67), is shown in Figure 32. The restriction sites Apal (immediately upstream ATG) and StuI (immediately downstream of the stop codon) were added to the hemagglutinin coding sequence by performing a PCR amplification with primers ApAL-SpPDI.c (SEQ ID NO: 30) and StuI-HlB.r (SEQ ID NO: 27) using construct number 787 (SEQ ID NO: N 67, Figure 32) as a model. The resulting fragment was digested with the restriction enzymes Apal and StuI and cloned into the construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes. The resulting cassette was designated construction number 733 (SEQ ID NO: 68; Figure 33). K- Assembling the HlA / Brisbane / 59/07 (BB) receptor binding domain in the H5A / Indonesia / 5/05 backbone in the CPMV-HT expression cassette (construct number 734). The chimeric HA coding sequence consisting of the RB domain of HLA / Brisbane / 59/07 in H5A / Indonesia / 5/05 structure was cloned into CPMV-HT as follows. The restriction sites Apal (immediately upstream of ATG) and StuI (immediately downstream of the termination codon) were added chimeric hemagglutinin coding sequence by performing a PCR amplification with the Apal-H5 (A-Indo) primers (SEQ ID NO: 31) and H5 (A-Indo) -StuI.1707r (SEQ ID NO: 32) using construct number 690 (SEQ ID NO: 63; Figure 28) as template. The resulting fragment was digested with the restriction enzymes Apal and StuI and cloned into the construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes. The resulting cassette was designated construction number 734 (SEQ ID NO: 69; Figure 34). L-Assembling of SpPDX-H3 A / Brisbane / 10/2007 on CPMV-HT expression cassette (construction number 736).

A sequence encoding the HAO-fused PDI alfalfa signal peptide from H3A / Brisbane / 10/2007 was cloned into CPMV-HT as follows. First, a synthetic fragment comprising the complete (from ATG to stop) hemagglutinin coding sequence flanked at 3 'was synthesized by the sequence of the alfalfa plastocyanin gene corresponding to the first 84 nucleotides (starting with a Drain restriction site) upstream of the plastocyanin ATG. The synthetic fragment also contained a Saci site immediately after the stop codon. Synthetic fragment was synthesized by Top Gene Technologies (Montreal, QC, Canada). The synthesized fragment is shown in SEQ ID NO: 70 (Figure 35) and was used as template for subsequent PCR-based binding.

Second, the disulfide isomerase signal peptide of the alfalfa protein (PDISP) (nucleotides 32-103; accession no. Z11499; SEQ ID NO: 57; Figure 22) was ligated to the HA3 coding sequence of H3 from A Along with the Apal restriction site immediately upstream of the restriction site ATG and StuI downstream of the stop codon as follows. PDISP was ligated to the H3 coding sequence by the PCR-based binding methodDarveau et al. (Methods in Neuroscience 26: 77-85 (1995))). In a first PCR cycle, the PDISP signal peptide was amplified using primers Apal-SpPDI.c (SEQ ID NO: 30) and H3B-SpPDI.r (SEQ ID NO: 33) under construct number 540 (SEQ ID NO: NO: 59; Figure 24) as a model. In parallel, another fragment containing a portion of the H3A / Brisbane / 10/2007 coding sequence (from codon 17 to the stop codon) was amplified with the primers SpPDI-H3B.c (SEQ ID NO: 34) and StuI-H3B. r (SEQ ID NO: 35) using previously synthesized fragments (SEQ ID NO: 70; Figure 35) as template. The amplification products were then mixed and used as template for a second amplification cycle (assembly reaction) with primers Apal-SpPDI.c (SEQ ID NO: 30) and StuI-H3B.r (SEQ ID NO: 35) . The resulting fragment was digested with the restriction enzymes Apal and StuI and cloned into the construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes. The resulting cassette was designated construction number 736 (SEQ ID NO: 71; Figure 36). M-Assay of SpPDI-H3 A / Brisbane / 10/2007 chimeric (ectodomain) + H5 A / Indonesia / 5/2005 (TmD + Cyto tail) on the CPMV-HT expression cassette (construction number 737).

A sequence encoding the H3A / Brisbane / 10/2007 ectodomain-fused PDI alfalfa signal peptide and to the H5A / Indonesia / 5/2005 transmembrane and cytoplasmic domains was cloned into CPMV-HT as follows. The PDISP-H3 coding sequence was fused to the H5 transmembrane domain by the PCR-based binding method shown in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). In a first PCR cycle, a fragment comprising PDISP signal peptide and Brisbane H3 ectodomain was generated by amplification (with Apal restriction site upstream of the initial PDISP ATG) using the Apal-SpPDI.c (SEQ ID NO: 30) primers and TmD H5I-H3B.r (SEQ ID NO: 36) with construction number 736 (SEQ ID NO: 71; Figure 36) as template. In parallel, another fragment containing the transmembrane and cytoplasmic domains of H5 from Indonesia was amplified with primers H3B-TmD H5I.c (SEQ ID NO: 37) and H5 (A-Indo) -StuI.1707r (SEQ ID NO: 32) using construct number 660 (SEQ ID NO: 53; Figure 18) as the template. The amplification products were then mixed and used as a template for a second amplification cycle (assembly reaction) with the primers Apal-SpPDI.c (SEQ ID NO: 30) and H5 (A-Indo) -StuI. 1707r (SEQ ID NO: 32). The resulting fragment was digested with restriction enzymes Apal and StuI and cloned into the construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes. The resulting cassette was designated construction number 737 (SEQ ID NO: 72; Figure 37). tf-Assay of SpPDI-HA B / Florida / 4/2006 on the CPMV-HT expression cassette (construction number 739).

A sequence encoding the HA0 fused PDI alfalfa signal peptide of HA B / Florida / 4/2006 was cloned into CPMV-HT as follows. First, a synthetic fragment comprising the full (from ATG to stop) hemagglutinin coding sequence flanked 3 'was synthesized by the alfalfa plastocyanin gene sequence corresponding to the first 84 nucleotides (starting with a Drain restriction site) upstream of the plastocyanin ATG. The synthetic fragment also contained a Saci restriction site immediately after the termination codon. The synthetic fragment was synthesized by Epoch Biolabs (Sugar Land, Texas, USA). The synthesized fragment is shown in SEQ ID NO: 73 (Figure 38) and was used as template for subsequent PCR-based binding.

Second, the signal peptide of the disulfide isomerase of the alfalfa protein (PDISP) (nucleotides 32-103 of SEQ ID NO: 57; Figure 22; Access No. Z11499) was ligated to the HA coding sequence of B / Florida / 4 HA Along with the Apal restriction site immediately upstream of ATG and the restriction site downstream of restriction site StuI as follows. PDISP was ligated to the HA coding sequence by the PCR-based binding method disclosed in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)). In a first PCR cycle, the PDISP signal peptide was amplified using the primers Apal-SpPDI.c (SEQ ID NO: 30) and HBF-SpPDI.r (SEQ ID NO: 38) under construct number 540 (SEQ ID NO: NO: 59; Figure 24) as a model. In parallel, another fragment containing a portion of the B / Florida / 4/2006 HA coding sequence (from codon 16 to the stop codon) was amplified with primers SpPDI-HBF.c (SEQ ID NO: 39) and StuI- HBF.R (SEQ ID NO: 40) using previously synthesized fragments (SEQ ID NO: 73; Figure 38) as template. The amplification products were then mixed and used as template for a second amplification cycle (assembly reaction) with primers Apal-SpPDI.c (SEQ ID NO: 30) and StuI-HBF.r (SEQ ID NO: 40) . The resulting fragment was digested with the restriction enzymes Apal and StuI and cloned into the construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes. The resulting cassette was designated construction number 739 (SEQ ID NO: 74; Figure 39). O-Assay of chimeric SpPDI-HA B / Florida / 4/2006 (ectodomain) + H5 A / Indonesia / 5/2005 (TmD + Cyto tail) on the CPMV-ST expression cassette (construction number 745).

A sequence encoding the alfalfa PDI signal peptide fused to the HA / B / Florida / 4/2006 ectodomain and the transmembrane and cytoplasmic domains of H5 A / Indonesia / 5/2005 was cloned into CPMV-ET as follows. The coding sequence of the PDISP-B / Florida / 4/2006 ectodomain was fused to the transmembrane and H5 cytoplasmic domains by the PCR-based binding method Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). In a first PCR cycle, a fragment comprising PDISP signal peptide fused to the HA / Florida / 4/2006 ectodomain was generated by amplification using the primers Apal-SpPDI.c (SEQ ID NO: 30) and TmD H5I-B Flo (SEQ ID NO: 41) having the construct number 739 (SEQ ID NO: 74; Figure 39) as template. In parallel, another fragment containing the transmembrane and H5 cytoplasmic domains of Indonesia was amplified with the Flo-TmD B primers H5I.c (SEQ ID NO: 42) and H5 (A-Indo) -StuI.1707r (SEQ ID NO: 32) using construct number 660 (SEQ ID NO: 53; Figure 18) as the template. The amplification products were then mixed and used as template for a second amplification cycle (assembly reaction) with the primers Apal-SpPDI.c (SEQ ID NO: 30) and H5 (A-Indo) -StuI.1707r (SEQ ID NO: ID NO: 32). The resulting fragment was digested with the restriction enzymes Apal and StuI and cloned into the construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes. The resulting cassette was designated construction number 745 (SEQ ID NO: 75; Figure 40).

Chimeric SpPDI-HA P-assembly B / Florida / 4/2006 + H5 A / Indonia / 5/2005 (TmD + Cyto tail) on expression cassette 2X35S-CPMV-ST (construction number 747).

A sequence encoding the HA0 fused PDI alfalfa signal peptide from HA / Florida / 4/2006 to the transmembrane and cytoplasmic domain of H5 A / Indonesia / 5/2005 was cloned into 2X35S-CPMV-HT as follows. Promoter exchange was performed using the PCR-based binding method Darveau et al. (Methods in

Neuroscience 26: 77-85 (1995)). A first fragment containing the 2X35S promoter (SEQ ID NO: 88; Figure 50A) was amplified by PCR with Pad-MCS-2X35S.C (SEQ ID NO: 89) and CPMV 5'UTR-2X35S.r (SEQ ID NO: 90):

Pad-MCS -2X35S.C (SEQ ID NO: 89)

ATAGTA TTAATTAA GTCGACAAGCTTGCATGCCTGCAGG TCAAC CPMV 5'UTR-2X35S .r (SEQ ID NO: 90)

CAAAACCTAT TAAGAT TT TAATA CCTCTCCAAATGAAATGAACTTCC using a plasmid containing the 2X35S promoter as template. In parallel, a second PCR was performed using the primers 2X35S-CPMV 5'UTR.c (SEQ ID NO: 91) and Apal-M PROT.R (SEQ ID NO: 92): 2X35S-CPMV 5'UTR.c (ID SEQ NO: 91)

TTGGAGAGG TATTAAAATCTTAATAGGTTTTGATAAAAGCGAACGTGGG

Apal-M prot.r (SEQ ID NO: 92)

TCTCCAT GGGCCC GACAAATTTGGGCAGAATATACAGAAGCTTA using construct 745 (SEQ ID NO: 75; Figure 40) as template. The two fragments obtained were then mixed and used as template for a second round of PCR (assembly reaction) with Pad-MCS-2X35S.C (SEQ ID NO: 89 and Apal-M prot.r (SEQ ID NO: 92 ) as primers The resulting fragment was digested with Pad and Apal and cloned into construct 745 (SEQ ID NO: 75; Figure 40) digested with the same restriction enzymes from the expression cassette sequence, designated construct 747 (SEQ ID NO: 93), is shown in Figure 50 B. 2. Assembly of accompanying expression cassettes

Two heat shock protein (Hsp) expression cassettes were assembled. In a first cassette, the expression of Arabidopsis thaliana cytosolic HSP70 (Columbia ecotype) (Athsp70-1 in Len et al. (2001) Cell Stress and Chaperones 6: 201-208) is controlled by a chimeric promoter combining elements of the promoters from Nitrite Reductase Plastocyanin (Nir) and Alfalfa (Nir / Plasto). A second cassette comprising the coding region of the alfalfa HSP40 (MsJl; Frugis et al. (1999) Plant Molecular Biology 40: 397-408) under the control of the chimeric Nir / Plasto promoter was also assembled.

An acceptor plasmid containing the alfalfa nitrate reductase (Nir) promoter, the GUS reporter gene and the NOS terminator in the plant binary vector was first assembled. Plasmid pNir3K51 (described previously in U.S. Patent 6420548) was digested with HindIII and EcoRI. The resulting fragment was cloned into pCAMBIA2300 (Cambia, Canberra, Australia) digested by the same restriction enzyme to give pCAMBIA-Nir3K51.

The coding sequences for Hsp70 and Hsp40 were cloned separately in the acceptor plasmid pCAMBIANir3K51 by the PCR-based binding method shown in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))).

For Hsp40, the Msjl (SEQ ID NO: 76; Figure 41) coding sequence was amplified by RT-PCR from total RNA from alfalfa leaves (Rangelander ecotype) using primers Hsp40Luz.lc (SEQ ID NO: 43 ) and Hsp40 Light-SacI. 1272r (SEQ ID NO: 44). A second amplification was performed with primers Plasto-443c (SEQ ID NO: 5) and Hsp40 Lig-Plasto.r (SEQ ID NO: 45) with construct 660 (SEQ ID NO: 53; PCR products were then mixed and used as template for a third amplification (assembly reaction) with primers Plasto-443c (SEQ ID NO: 5) and Hsp40 Lig-SacI.1272r (SEQ ID NO: 44). The resulting fragment was digested with Hpal (in the plastocyanin promoter) and cloned into pCAMBIANir3K51, previously digested with Hpal (on the Nir promoter) and SacI and filed with T4 DNA polymerase to generate blunt ends. The obtained clones were screened for correct orientation and sequenced for sequence integrity. The resulting plasmid, designated R850, is shown in Figure 42 (SEQ ID NO: 77). The coding region of Athsp70-1 was amplified by RT-PCR from Arabidopsis leaf RNA using primers Hsp70Ara.lc (SEQ ID NO: 46) and Hsp70Ara-SacI. 1956r (SEQ ID NO: 47). A second amplification was performed with primers Plato-443c (SEQ ID NO: 5) and Hsp70Ara-Plasto.r (SEQ ID NO: 48) with construct 660 (SEQ ID NO: 53; The PCR products were then mixed and used as template for a third amplification (assembly reaction) with primers Plasto-443c (SEQ ID NO: 5) and Hsp70ARA-SacI.1956r (SEQ ID NO: 47). The resulting fragment was digested with Hpal (in the plastocyanin promoter) and cloned into Hpal digested pCAMBIANir3K51 (in the Nir promoter) and SacI and deposited with T4 DNA polymerase to generate blunt ends. The obtained clones were screened for correct orientation and sequenced for sequence integrity. The resulting plasmid, designated R860, is shown in Figure 43 (SEQ ID NO: 78).

A double Hsp expression plasmid was assembled as follows. R860 (SEQ ID NO: 78; Figure 43) was digested with BsrBI (downstream of the NOS terminator), treated with T4 DNA polymerase to generate a blunt end and digested with Sbfl (upstream of the chimeric NIR / Plasto promoter). The resulting fragment (chimeric Nir / Plasto-coding sequence of HSP70-terminator Nos) was cloned into R850 (SEQ ID NO: 77; Figure 42) previously digested with Sbfl and Smal (both located at the upstream multiple cloning site Nir / Chimaeric promoter plasmid). The resulting plasmid, designated R870, is shown in Figure 44 (SEQ ID NO: 79). 3. Assembly of other expression cassettes HoPro expression cassette

An HcPro construct (35HcPro) was prepared as described in Hamilton et al. (2002). All clones were sequenced to confirm the integrity of the constructs. Plasmids were used to transform Agrobacterium tumefaciens (AGL1; ATCC, Manassas, VA 20108, USA) by electroporation (Mattanovich et al., 1989). The integrity of all strains of A. tumefaciens was confirmed by restriction mapping.

Expression cassette P19 The coding sequence of the p9 protein from tomato tomato virus (TBSV) was ligated to the alfalfa plastocyanin expression cassette by the PCR-based binding method presented in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995))). In a first round of PCR, a segment of the plastocyanin promoter was amplified using primers Plasto-443c (SEQ ID NO: 5) and supP9-plaste (SEQ ID NO: 49) with construct 660 (SEQ ID NO: 53) as a model. In parallel, another fragment containing the pl9 coding sequence was amplified with the primers supPl9-1c (SEQ ID NO: 50) and SupP19-SacIr (SEQ ID NO: 51) using the 35S: pI9 construct as described in Voinnet et al. (The Plant Journal 33: 949-956 (2003))) as a model. The amplification products were then mixed and used as template for a second round of amplification (assembly reaction) with primers Plasto-443c (SEQ ID NO: 5) and SupPl9-SacIr (SEQ ID NO: 51). The resulting fragment was digested with BamHI (in the plastocyanin promoter) and Saci (at the end of the p9 coding sequence) and cloned into the construct number 660 (SEQ ID NO: 53; Figure 18), previously digested with the same enzymes from restriction to give construction number R472. Plasmid R472 is shown in Figure 45. Construction number 443 Construction number 443 corresponds to pCAMBIA2300 (empty vector).

Table 1: oligonucleotide primers for assembling expression cassettes

Table 2: Agrobacterium strains used for expression of influenza hemagglutinins with native signal peptides or PDI

4. Preparation of vegetable biomass, inoculum, agro-infiltration and harvesting

Nicotiana benthamiana plants were grown from seeds in apartments filled with commercial peat substrate. The plants were allowed to grow in the oven under a 16/8 photoperiod and a temperature regime of 25 ° C day / 20 ° C overnight. Three weeks after sowing, the individual seedlings were harvested, transplanted into pots and allowed to grow in the greenhouse for another three weeks under the same environmental conditions. Prior to transformation, the apical and axillary buds were removed at various times, as indicated below, either by compressing the buds of the plant, or by chemically treating the plant.

Agrobacteria transfected with each construct were grown in YEB medium supplemented with 2- [N-morpholino] ethanesulfonic acid (MES), acetosyringone 20.50 μg / ml kanamycin and 25 μg carbenicillin pH5.6 until they reached a Οϋβοο between 0, 6 and 1.6. Agrobacterium suspensions were centrifuged prior to use and resuspended in infiltration medium (10 mM MgCl 2 and 10 mM MES pH 5.6). Syringe infiltration was performed as described by Liu and Lomonossoff (2002, Journal of Virological Methods, 105: 343-348). For vacuum infiltration the A. tumefaciens suspensions were centrifuged, resuspended in the infiltration medium and stored overnight at 4 ° C. On the day of infiltration, the culture batches were diluted in 2.5 culture volumes and allowed to warm up prior to use. Whole plants of N. benthamiana or N. tabacum were placed upside down in the bacterial suspension in an airtight stainless steel tank under a vacuum of 20-40 Torr for 2 min. After syringe or vacuum infiltration, the plants were returned to the greenhouse for an incubation period of 4-5 days until harvest. Unless otherwise specified, all infiltrations were performed as co-infiltration with AGL1 / 35S-HcPro in a ratio of 1: 1, except for strains containing CPMV-HT cassettes that were co-infiltrated with strain AGL1 / R472 at a ratio of 1: 1. 5. Leaf sampling and total protein extraction

After incubation, the shoots were harvested, frozen at -80 ° C, crushed to pieces. Total soluble proteins were extracted by homogenization (Polytron) from each sample of frozen ground vegetable material in 3 volumes of 50 mM Tris, pH 8, 0.15 M NaCl, 0.04% sodium metabisulfite and 1 mM phenylmethanesulfonyl fluoride. After homogenization, the suspensions were centrifuged at 20,000 g for 20 min at 4øC and these clarified crude extracts (supernatant) were kept for analysis. The total protein content of the clarified crude extracts was determined by the Bradford assay (Bio-Rad, Hercules, CA) using bovine serum albumin as the reference standard. 6. Protein and Immunoblotting Analysis

Protein concentrations were determined by the BCA protein assay (Pierce Biochemicals, Rockport IL). The proteins were separated by SDS-PAGE under reducing conditions and stained with Coomassie Blue. The stained gels were scanned and densitometric analysis performed using ImageJ Software (NIH).

Proteins from the SEC elution fraction were precipitated with acetone (Bollag et al., 1996), resuspended in 1/5 of the equilibrated volume / elution buffer and separated by SDS-PAGE under reducing conditions and electroblotted onto polyvinyl difluoride membranes ( PVDF) (Roche Diagnostics Corporation, Indianapolis, IN) for immunodetection. Prior to immunoblotting, the membranes were blocked with 5% skim milk and 0.1% Tween-20 in Tris buffered saline (TBS-T) for 16-18 h at 4øC. Immunoblotting was performed by incubation with a suitable antibody (Table 6) in 2 pg / ml in 2% skim milk in 0.1% TBS-Tween 20. Secondary antibodies used for chemiluminescence detection were as shown in Table 4, dilutions as indicated in 2% skim milk in 0.1% TBS-Tween 20. Immunoreactive complexes were detected by chemiluminescence using luminol as a substrate (Roche Diagnostics Corporation). Conjugation of horseradish peroxidase from the human IgG antibody was performed using the EZ-Link Plus® activated peroxidase conjugation kit (Pierce, Rockford, IL). Whole inactivated viruses (WIV), used as detection controls for subtypes H1, H3 and B, were purchased from the National Institute for Biological Standards and Control (NIBSC).

Table 3: Electrophoresis conditions, antibodies and dilutions for immunoblotting expressed proteins.

7. Clarification and concentration before SEC

To improve resolution and increase the signal in the elution fractions, the extracts to be loaded in size exclusion chromatography, the crude protein extracts were clarified and concentrated using the following method. The extracts were centrifuged at 70,000 g, 4 for 20 min and the pellet was washed twice by resuspending in 1 volume (compared to the initial extract volume) of extraction buffer (50 mM Tris pH 8, 0.15 M NaCl ) and centrifugation at 70,000 g, 4 for 20 min. The resulting pellet was resuspended in 1/3 volume (compared to the initial volume of the extract) and the proteins (including VLPs) were precipitated by the addition of 20% (w / v) PEG 3350 followed by incubation on ice for 1 h . The precipitated proteins were recovered by centrifugation at 10,000 g, 4 ° C, 20 min and resuspended in 1/15 volume (compared to the initial extract volume) of the extraction buffer. 8. Size exclusion chromatography of protein extract

Sephacryl "S-500 (S-500 HR: GE Healthcare, Uppsala, Switzerland, Cat. No. 17-0613-10) size exclusion chromatography (SEC) columns were packaged and equilibrated with equilibration / elution buffer (Tris pH 8 mM, 150 mM NaCl). One milliliter and one half crude protein extract was loaded onto the column followed by an elution step with 45 mL equilibration / elution buffer. Elution was collected in 1.5 mL fractions. The relative protein content of the eluted fractions was monitored by mixing 10 μ of the fraction with 200 μl of Bio-Rad dilution protein dye reagent (Bio-Rad, Hercules, CA). The column was washed with 2 column volumes of 0.2 N NaOH followed by 10 column volumes of 50 mM Tris pH 8, 150 mM NaCl, 20% ethanol Each separation was followed by a column calibration with Blue Dextran 2000 (GE Healthcare Bio-

Science Corp., Piscataway, NJ, USA). Elution profiles of Blue Dextran 2000 and soluble host proteins were compared between each separation to ensure uniformity of the elution profiles between the columns used.

Example 1: Domain exchange strategy for BB and / or Esterase domains on influenza subtype rods. The subdomain RB of H5 / Indo can be replaced by a subdomain RB of HI, H3 or B HA. The resulting chimeric HA provides a H5 / Indo SDC to form VLPs and has the subdomain RB comprising immunogenic sites of H1, H3 or B. The subdomain H5 / Indo RB can be inserted into a H1 (H1 / NC) stem. Figures 15A and 15B illustrate the amino acid sequences in the fusions of the indicated subdomains, and the amino acid sequences of the respective subdomains are provided in Figure 2 (constructs 690, 734, 696 and 691) and in Table 4 (constructs 900 and 745) and 5 (constructions 910, 920 and 930). The amino acid sequences shown in Figure 2 and Tables 4 and 5 do not include signal peptide sequences.

Table 4 Subdominance to Chimeric HA Grip. A chimeric HA virus comprising its heterologous BB domain.

Amino acids 1-92 of SEQ ID NO: 105 are an F'1 + El domain of H5 / Indo; amino acids 93-259 are the H3 / Brisbane RB head domain; amino acids 260-548 are the E2 + F'2 domain of H5 / Indo.

Amino acids 1-92 of SEQ ID NO: 106 are a F'1 + El domain of H5 / Indo; amino acids 93-276 are the primary domain B of Florida; amino acids 277-565 are the E2 + F'2 domain of H5 / Indo.

Table 5 Subdomain and Influenza EH chimeric, Influenza EH chimeric ccsspreeudeudo subdomain KB beteróiogo

Amino acids 1-42 of SEQ ID NO: 107 are a N-terminal domain F '1 of H5 / Indo; amino acids 43-228 are the major H3 / Brisbane El-RB-E2 domain; amino acids 229-507 are the F'2 domain of H5 / Indo.

Amino acids 1-42 of SEQ ID NO: 108 are an N-terminal F 11 domain of H5 / Indo; amino acids 43-281 are the B / Florida main domain El-RB-E2; amino acids 282-556 are the F'2 domain of H5 / Indo.

Amino acids 1-42 of SEQ ID NO: 109 are an F1 domain at the N-terminus of HI / NC; amino acids 43-273 are the H5 / Indo E1-RB-E2 head domain; amino acids 274-548 are the F'2 domain of H1 / NC.

The melting points for the various chimeras were selected so as to be so close (but not necessarily directly) to the N and C termini of the various subdomains - without wishing to be bound by theory, such fusions were selected in order to maximize HA stability chimeric. For example, the conservation of structure and sequence is observed at the N-terminus of the subdomain RB (Ha et al., 2002, EMBO J. 21: 865-875). A less variable region in the primary sequence is found in the CF / YP triad located at approximately 15 amino acids before, in subdomain El. This cysteine is involved in the disulfide bridge # 3, which conserved between the HAs (see Figures 46 and 47). A junction in this Cys may provide a stability appropriate or superior to the chimeric HA relative to the native sequence. The C-terminal end of the RB provides conserved resources: for example, a residue is conserved at position -1 and subdomain E2 begins with a beta sheet observed throughout the HA in alignment (Ha et al., 2002, EMBO J. 21: 865-875). Therefore, the C-terminus of this RB can be fused to the initiating amino acid of this beta sheet structure of subdomain E2. In addition, the disulfide bridge pattern is not altered, or substantially unchanged, for the chimeras comprising HB / NC, HIBRI, H3 / Bri or B / Wire RB subdomains in a H5 / Indo SDC and for H5 / Indo RB subdomain in Hl SDC (total of 6), but a disulfide bridge will be added (bridge # 8) in the BBR HA hybrid on the H5 rod. This bridging disulfide addition should not interfere with HA coiling (because it is located within the RB domain and Cys is adjacent in the sequence), and may produce an even more stable HA hybrid.

The E1-RB-E2 subdomains of a first influenza type were replaced by E1-RB-E2 subdomains of a second type of influenza. Such an arrangement may exhibit a higher number of amino acids of the second type on the surface of H5-VLP. In this example, HD1 of H1, H3 or B was placed in an H5 / Indo SDC, and an HD5 of H5 / Indo in a H1 / NC SDC (Table 5). The HDC junction was defined as a conserved cysteine residue (comprising the disulfide bridge # 6 of type A HA and # 7 in type B HA). The HDC junction at terminal C of subdomain E2 was defined with another conserved cysteine residue comprising the disulfide bridge # 6 (the second amino acid subdomain F'2) of influenza type H1 or H3 in an H5 / Indo SDC or for influenza type H5 in an SDI of HI. For the influenza B chimera, the junction was established the connection in the first cysteine comprising the disulfide bridge # 4 (located at 4 amino acids of subdomain F'2 and conserved among the HAs). The resulting chimeras exhibit no change in the disulfide bridge patterns - the hybrid H 1 / H 3 / H 5 HAs contain 6 disulfide bridges and the B hybrid has 7 of them.

Example 2: Replacement of receptor-binding (B) or receptor-binding subdomains and (H1-RB-E2) esterase of H5A / Indonesia / 5/05 by H1A / Brisbane / 59/2007: Comparison of expression for chimeric and native forms.

To combine the high level of accumulation of H5 A / Indonesia / 5/05 VLPs with the antigenicity characteristics of H1 A / Brisbane / 59/2007, chimeric hemagglutinins were designed comprising H1 A / Brisbane / 59/2007 domains fused to an H5 A / Indonesia / 5/05 trunk domain cluster. Expression cassettes for expression of the H5 / H1 hemagglutinin fusions are shown in Figure 1 and the amino acid sequences of the mature fusion proteins produced shown in Figure 2.

Comparing the level of accumulation of H5 / H1 chimeric hemagglutinins with their native forms, Nicotiana benthamianaplantas were infiltrated with AGL1 / 774, AGL1 / 691 and AGL1 / 690, and the leaves were harvested after a six-day incubation period. To determine the level of accumulation of each HA form in the agro-infiltrated leaves, the proteins were extracted from the infiltrated leaf tissue and analyzed by Western blotting using anti-HA monoclonal antibodies. A single band of approximately 75 kDa (Figure 3), corresponding in size to the non-cleaved HAO form of influenza hemagglutinin, was detected in leaf extracts infiltrated with AGL1 / 690 but not in AGL1 / 774 or AGL1 / 691, indicating that the chimeric hemagglutinin comprising the H 1 A / Brisbane / 59/2007 receptor binding region fused to the H5 A / Indonesia / 5/05 structure accumulated a higher level than the native H1 A / Brisbane / 59/2007 ( AGL1 / 774) and chimeric hemagglutinin combining the H1A / Brisbane / 59/2007 esterase and receptor binding regions with structure H5A / Indonesia / 5/05. The inactivated whole virus (WIV) (HI A / Brisbane / 59/2007) used as a positive control was detected as multiple bands with a major band at approximately 80 kDa, corresponding to the molecular weight of the H1 A / Brisbane HAO precursor. / 59/2007. These results demonstrated that the replacement of the H5A / Indonesian / 5/05 receptor binding region by H1A / Brisbane / 59/2007 generated a chimeric hemagglutinin which showed the H1 antigenic region and accumulated at a higher level high than the native Hl A / Brisbane / 59/2007 in plants. However, chimeric hemagglutinin in which the esterase and the H5A / Indonesian / 5/05 receptor binding regions were replaced by H1A / Brisbane / 59/2007 did not accumulate to a detectable level in the plants. Fusion of the H1A / Brisbane / 59/2007 receptor binding region to H5A / Indonesia / 5/05 structure as a method to increase the accumulation of H1 antigen-presenting VLPs in plants was reevaluated under the control of a cassette expression based on CPMV-HT. This fusion strategy was also compared to substitution of the signal peptide as a means of increasing the level of accumulation. Expression cassettes for the expression of hemagglutinin H5 / H1 fusions under CPMV-HT are shown in Figure 8 and the amino acid sequence of the mature fusion protein produced is shown in Figure 2.

Nicotiana benthamiana plants were infiltrated with AGL1 / 732, AGL1 / 733 or AGL1 / 734, and the leaves were harvested after a six-day incubation period. To determine the level of accumulation of each HA form in the agro-infiltrated leaves, the proteins were first extracted from the infiltrated leaf tissue and analyzed by Western blotting using anti-HI polyclonal antibodies (Brisbane). A single band of approximately 75 kDa (Figure 6), corresponding in size to the non-cleaved HAO form of influenza hemagglutinin, was detected in leaf extracts infiltrated with AGL1 / 733, AGL1 / 733 and AGL1 / 734. However, although hemagglutinin was detected in all analyzed extracts, important differences in the accumulation could be noticed. While expression of H1A / Brisbane / 59/2007 was hardly detectable under these conditions when using its natural signal peptide (732), substitution of the signal peptide by the PDI resulted in increased accumulation of mature H1A / Brisbane / 59 / 2007 (733), and chimeric H5 / H1 hemagglutinin (734) accumulated at the highest level. Taken together, these results show that fusion of the H1 receptor binding domain in an H5 structure leads to a high accumulation of H1 antigen presenting hemagglutinin and that the level of accumulation obtained for such fusion in plants is greater than that obtained with the native, forms with or without substitution of the signal peptide.

Example 3: Replacement of the binding subunit to the H1 A / New Caledonia receptor / BB / 20/99 with that of H5 A / Indonesia / 5/05. Comparison of expression for chimeric and native forms. The use of an H1 structure (from A / New Caledonia / 20/99) for the presentation of the antigenic region of H5 was also evaluated. The expression cassettes for expression of the hemagglutinin H 1 / H 5 fusion are shown in Figure 1 and the amino acid sequence of the mature fusion protein produced shown in Figure 2.

To compare the level of accumulation of chimeric H1 / H5 hemagglutinin with its native form, Nicotians benthamiana plants were infiltrated with AGL1606 and AGL1 / 696, and the leaves were harvested after a six-day incubation period. To determine the level of accumulation of each HA form in the agro-infiltrated leaves, the proteins were extracted from the infiltrated leaf tissue and analyzed by Western blotting using polyclonal anti-H5 (Indica) antibodies. A single band of approximately 75 kDa (Figure 7), corresponding in size to the non-cleaved HAO form of influenza hemagglutinin, was detected in leaf extracts infiltrated with AGL1606 and AGL1 / 696, indicating that either the native H5 A / Indonesia / 5/05 and H1 / H5 chimeric hemagglutinin accumulate at high levels in plants.

Example 4: Replacement of H5 λ / Indonesia / 5/05 ectodamain with that of H3 or B. Comparison of expression to chimeric and native forms. The fusion of H3A / Brisbane / 10/2007 or B Florida / 4/2006 ectodamin to the transmembrane and cytoplasmic subdomains of H5A / Indonesia / 5/05 was evaluated as a strategy to present antigenic regions of hemagglutinin from H3 and B strains , increasing their level of accumulation in plants. Expression cassettes for the expression of the hemagglutinin H5 / H3 and H5 / B fusions are shown in Figure 10 and the amino acids in the margin of fusions are shown in Figure 11. The level of accumulation of chimeric H5 / B hemagglutinin (745) was compared to native HA B (739) in Nicotiana benthamiana plants. The plants were infiltrated with AGL1 / 739 and AGL1 / 745, and the leaves were harvested after a six-day incubation period. To determine the accumulation level of each HA form in the agro-infiltrated leaves, the proteins were first extracted from the infiltrated leaf tissue and analyzed by Western blotting using anti-B (Florida) polyclonal antibodies. A single band of approximately 75 kDa (Figure 14), corresponding in size to the non-cleaved HAO form of influenza hemagglutinin, was detected in leaf extracts from a plant infiltrated with AGL1 / 739 while the 3 plants infiltrated with AGL1 / 745 showed positive signal corresponding to hemagglutinin, indicating that the H5 / B chimeric form of hemagglutinin accumulated more regularly at elevated levels than the native form of hemagglutinin B.

Similarly, the level of accumulation of chimeric H5 / H3 hemagglutinin (737) was compared with that of its native form (736) in Nicotiana benthamiana plants. The plants were infiltrated with AGL1 / 736 and AGL1 / 737 and the leaves were harvested after a six-day incubation period. To determine the level of accumulation of each HA form in the agro-infiltrated leaves, the proteins were extracted from the infiltrated leaf tissue and analyzed by Western blotting using polyclonal anti-H3 (Brisbane) antibodies. A single band of approximately 75 kDa (Figure 15), corresponding in size to the non-cleaved HAO form of influenza hemagglutinin, was detected in leaf extracts infiltrated with AGL1 / 736 and AGL 1/737. This result indicates that the fusion of transmembrane and cytoplasmic subdomains of H5A / Indonesia / 5/05 to the H3A / Brisbane / 10/2007 ectodomain creates a chimeric hemagglutinin that accumulates at a level similar to native H3A / Brisbane / 10 / 2007 Production of VLPs from expression of chimeric hemagglutinin H5 / B (construct # 745) was assessed using size exclusion chromatography. Concentrated protein extracts from plants infiltrated with AGL1 / 745 (1.5 mL) were fractionated by size exclusion chromatography (SEC) on Sephacryl ™ S-500 HR columns (GE Healthcare Bio-Science Corp., Piscataway, NJ) . As shown in Figure 16, elution of Dextran Blue (2 MDa) peaked at fraction 8. When the 200 μ proteínas proteins of each SEC elution fraction were concentrated (5 times) by precipitation with acetone and analyzed by Western blotting using anti-B Florida), polyclonal antibodies (Figure 16), chimeric hemagglutinin was found primarily in fraction 7, indicating the incorporation of HA in high molecular weight structures. Without wishing to be bound by theory, this suggests that the chimeric HA protein was mounted on a large superstructure or that it was attached to a high molecular weight structure. The results indicate that the chimeric HA consisting of the ectodomain of HA / Florida / 4/2006 fused to the transmembrane and cytosolic subdomains of H5A / Indonesia / 5/05 is clumped into high molecular weight particles and that the elution profile of these high molecular weight particles are indistinguishable from those of influenza VLPs.

Example 5: Coexpression of H5 / B chimeric hemagglutinin (construct number 747; comprising B / Flo HDC and SDC fused to a H5 / Indo TDC) with Hsp70 and Hsp40 in combination with modification of the signal peptide. Expression of Hsp40 and Hsp70 in plants and co-expression with influenza hemagglutinins are described in co-pending application PCT / CA2009 / 000032. Cytosolic Hsp70 and Hsp40 (construction number R870) of plant origin may also be co- expressed with chimeric hemagglutinins, to increase their level of accumulation in plants. Co-expression can be performed by agro-filtration of N. benthamiana plants with a bacterial suspension containing a mixture (1: 1: 1 ratio) of AGL1 containing the cassette for the expression of the desired chimeric HA with AGL1 / R870 and AGL1 / 35SHcPro. The level of accumulation of chimeric H5 / B hemagglutinin (B / HDC HDC and SDC fused with an H5 / Indo TDC) was evaluated in coexpression with HSP40 and HSP70 in Nicotiana benthamiana plants. Plants were infiltrated with AGL1 / 747, AGL1 / 747 + AGL1 / 443 (empty vector) or AGL1 / 747 + AGL1 / R870 (HSP40 / HSP70), and the leaves were harvested after a six day incubation period. To determine the level of H5 / B chimeric HA accumulation in the agro-infiltrated leaves, the proteins were first extracted from the infiltrated leaf tissue and analyzed by Western blotting using anti-B (Florida) polyclonal antibodies. A single band of approximately 75 kDa (Figure 50), corresponding in size to the non-cleaved HAO form of influenza hemagglutinin, was detected in leaf extracts of 3 plants infiltrated with AGL1 / 747 + AGL1 / R870 while the 3 plants infiltrated with AGL1 / 747 + vector control (443) showed no signal (under the exposure condition used) indicating that the H5 / B chimeric form of hemagglutinin accumulated at high level when co-expressed with the HSP40 and HSP 70 chaperones.

In the description, various terms are used extensively and definitions are provided to facilitate understanding of various aspects of the invention. Numerical ranges include the numbers that define the range. In the description, the word "comprising" is used as an open term, substantially equivalent to the phrase "including, but not limited to", and the word "comprises" has a corresponding meaning.

SEQUENCE LISTING

<110> Medicago Inc. COUTURE, MANON DARGIS, MICHELE LAVOIE, PIERRE-OLIVIER VEZINA, LOUIS- PHILIPPE DAOUST, MARC-ANDRE <120> Chimeric Influenza Virus-Like Particles Comprising Hemagglutinin

45 <130> V82197WO <140> not assigned <141> not assigned so <150> 61 / 220,161 <151> 2009-06-24 <160> 113 55 <170> Patentln version 3.4 <210> 1 <211> 32 <212> D ΝΑ <213> Artificial sequence <220><223> Synthesized Xmal-pPlas.c <400> 1 agttccccgg gctggtatat ttatatgttg tc ??? 32 <210> 2

<211> 46 <212> DNA <213> Artificial Sequence <220><223> Synthesized Sacl-ATG-pPlas.r <400> 2 aatagagctc cattttctct caagatgatt aattaattaa ttagtc 46

<210> 3 <211> 46 <212> DNA <213> Artificial sequence <220><223> Synthesized Sacl-PlasTer.c <400> 3 aatagagctc gttaaaatgc ttcttcgtct cctatttata atatgg 46

<210> 4 <211> 48 <212> DNA <213> Artificial sequence <220><223> Synthesized EcoRI-PlasTer.r <400> 4 ttacgaattc tccttcctaa ttggtgtact atcatttatc aaagggga 48

<210> 5 <211> 25 <212> DNA <213> Artificial sequence <220><223> Synthesized Plasto-443C <400> 5 gtattagtaa ttagaatttg gtgtc ??? 25 <210> 6 <211> 44

<212> DNA <213> Artificial Sequence <220><223> SpHa (lnd) -Plasto-r <400> 6 gcaagaagaa gcactatttt ctccattttc tctcaagatg atta 44

<210> 7 <211> 45 <212> DNA <213> Artificial sequence <220><223> Plasto-SpHa.c <400> 7 ttaatcatct tgagagaaaa tggagaaaat agtgcttctt cttgc 45

<210> 8 <211> 38 <212> DNA <213> Artificial sequence <220><223> HA (lnd) -Sac.r <400> 8 actttgagct cttaaatgcaaattctgcat tgtaacga 38 <210> 9 <211> 24

<212> DNA <213> Artificial sequence <220><223> Synthesized pBinPlus.2613c <400> 9 aggaagggaa gaaagcgaaa ggag ??? 24 <210> 10

<211> 56 <212> DNA <213> Artificial sequence <220><223> Synthesized Mut-ATG115.r <400> 10 gtgccgaagc acgatctgac aacgttgaag atcgctcacg caagaaagac aagaga 56

<210> 11 <211> 52 <212> DNA <213> Artificial Sequence <220><223> Synthesized Mut-ATG161.c gttgtcagat cgtgcttcgg caccagtaca acgttttctt tcactgaagc ga 52

<210> 12 <211> 25 <212> DNA <213> Artificial sequence <220><223> Synthesized LC-C5-1.110r <400> 12 tctcctggag tcacagacag ggtgg ??? 25

<210> 13 <211> 52 <212> DNA <213> Artificial Sequence <220><223> Synthesized E1 H1B-E1 H51.r <400> 13 tcatagtcag cgaaatgccc tgggtaacag aggtcattgg ttggattggc ct 52

<210> 14 <211> 48 <212> DNA <213> Artificial Sequence <220><223> Synthesized E1 H5N-E1 H1B.C <400> 14 atgacctctg ttacccaggg catttcgctg actatgagga actgaggg 48

<210> 15 <211> 48 <212> DNA <213> Artificial Sequence <220><223> Synthesized E2 H5I-RB H1B.r <400> 15 ccaattcact tttcataatt cctgatccaa agcctctact cagtgcga 48

<210> 16 <211> 51 <212> DNA <213> Artificial Sequence <220><223> Synthesized RB H1B-E2 H51.C <400> 16 ggctttggat caggaattat gaaaagtgaa ttggaatatg gtaactgcaa c 51 <211> 48 <212> D ΝΑ <213> Artificial Sequence <220><223> Synthesized E1 H1B-F (prime) 1 H51.r <400> 17 ggctattcct tttaataggc agagcttccc gttgtgtgtc ttttccag 48

<210> 18 <211> 48 <212> DNA <213> Artificial Sequence <220><223> Synthesized F'1 H5N-E1 H1B.C <400> 18 aacgggaagc tctgcctatt aaaaggaata gccccactac aattgggt 48

<210> 19 <211> 48 <212> DNA <213> Artificial Sequence <220><223> Synthesized F (prime) 2 H5I-E2 H1 Br <400> 19 ggagtttgac acttggtgtt gcatttatcc attggtgcat ttgagttg 48

<210> 20 <211> 48 <212> DNA <213> Artificial Sequence <220><223> Synthesized E2 FI1B-F (prime) 2 FI51.C <400> 20 aatgcaccaa tggataaatg caacaccaag tgtcaaactc caatgggg 48

<210> 21 <211> 48 <212> DNA <213> Artificial Sequence <220><223> Synthesized E1 H5I-E1 FUNC.r <400> 21 tcttcatagt cgttgaaact ccctgggtaa catgttccat tctcagga 48

<210> 22 <211> 48 <212> DNA <220><223> Synthesized E1 H1NC-E1 H51.C <400> 22 ctgagaatgg aacatgttac ccagggagtt tcaacgacta tgaagaac 48 <210> 23 <211> 51

<212> DNA <213> Artificial Sequence <220><223> Synthesized E2 H1NC-RB H51.r <400> 23 atttgaggtg atgattgctg agtccccttt cttgacaatt ttgtatgcat at 51 <210> 24

<211> 48 <212> DNA <213> Artificial Sequence <220><223> Synthesized RB H5I-E2 H1NC.C <400> 24 gtcaagaaag gggactcagc aatcatcacc tcaaatgcac caatggat 48

<210> 25 <211> 43 <212> DNA <213> Artificial Sequence <220><223> Synthesized HA-Sacl.r <400> 25 ttaacttaga gctcttagat gcatattcta cactgcaaag ace 43

<210> 26 <211> 45 <212> DNA <213> Artificial sequence <220><223> Synthesized Apal-H1B.c <400> 26 tgtcgggccc atgaaagtaa aactactggt cctgttatgc acatt 45

<210> 27 <211> 46 <212> DNA <213> Artificial Sequence <220><223> Synthesized Stul-H1B.r <400> 27 aaataggcct ttagatgcat attctacact gtaaagaccc attgga 46

<210> 28 <211> 49 <212> DNA <213> Artificial Sequence <220><223> Synthesized SpPDI-H18.c <400> 28 ttctcagatc ttcgctgaca caatatgtat aggctaccat gctaacaac 49

<210> 29 <211> 47 <212> DNA <213> Artificial Sequence <220><223> Synthesized Sacl-H1B.r <400> 29 cttagagctc ttagatgcat attctacact gtaaagaccc attggaa 47

<210> 30 <211> 45 <212> DNA <213> Artificial sequence <220><223> Synthesized Apal-SpPDI.c <400> 30 ttgtcgggcc catggcgaaa aacgttgcga ttttcggctt attgt 45 <210> 31 <211> 39

<212> DNA <213> Artificial Sequence <220><223> Synthesized Apal-H5 (A-lndo) .lc <400> 31 tgtcgggccc atggagaaaa tagtgcttct tcttgcaat 39 <210> 32

<211> 37 <212> DNA <213> Artificial Sequence <220><223> Synthesized H5 (A-lndo) -Stul.1707r <400> 32 aaataggcct ttaaatgcaa attctgcatt gtaacga 37

<210> 33 <211> 45 <212> DNA <213> Artificial Sequence <220><223> Synthesized H3B-SpPDI.r <400> 33 tgtcatttcc gggaagtttt tgagcgaaga tctgagaagg aacca 45

<210> 34 <211> 45 <212> DNA <213> Artificial Sequence <220><223> Synthesized SpPDI-H3B.c <400> 34 tctcagatct tcgctcaaaa acttcccgga aatgacaaca gcacg 45

<210> 35 <211> 44 <212> DNA <213> Artificial Sequence <220><223> Synthesized Stul-H3B.r <400> 35 aaaataggcc ttcaaatgca aatgttgcac ctaatgttgc cttt ??? 44

<210> 36 <211> 45 <212> DNA <213> Artificial Sequence <220><223> Synthesized TmD H5l-H3B.r <400> 36 atttggtaag ttcctattga cttcagctca acgcccttga tctgg 45

<210> 37 <211> 48 <212> DNA <213> Artificial Sequence <220><223> Synthesized H3B-TmD H51.C <400> 37 tgagctgaag tcaataggaa cttaccaaat actgtcaatt tattcaac 48 <210> 38 <211> 50 <212> D ΝΑ <213> Artificial sequence <220><223> Synthesized HBF-SpPDI.r <400> 38 gttattccag tgcagattcg atcagcgaag atctgagaag gaaccaacac 50

<210> 39 <211> 50 <212> DNA <213> Artificial Sequence <220><223> Synthesized SpPDI-HBF.c <400> 39 cagatcttcg ctgatcgaat ctgcactgga ataacatctt caaactcacc 50

<210> 40 <211> 46 <212> DNA <213> Artificial Sequence <220><223> Synthesized Stul-FIBF.r <400> 40 aaaataggcc tttatagaca gatggagcat gaaacgttgt ctctgg 46

<210> 41 <211> 45 <212> DNA <213> Artificial sequence <220><223> Synthesized TmD H5I-B Flo.r <400> 41 tgacagtatt tggtagttat ccaatccatc atcatttaaa gatgc 45

<210> 42 <211> 50 <212> DNA <213> Artificial Sequence <220><223> Synthesized B Flo-TmD FI51.C <400> 42 ggattggata actaccaaat actgtcaatt tattcaacag tggcgagttc 50

<210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220><223> Synthesized Hsp-40 Light.1c <400> 43 atgtttgggc gcggaccaac 20

<210> 44 <211> 31 <212> DNA <213> Artificial Sequence <220><223> Synthesized Hsp40Luz-Sacl.1272r <400> 44 agctgagctc ctactgttga gcgcattgca c 31

<210> 45 <211> 36 <212> DNA <213> Artificial Sequence <220><223> Synthesized Hsp40Luz-Plasto.r <400> 45 gttggtccgc gcccaaacat tttctctcaa gatgat 36

<210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220><223> Synthesized Hsp70Ara.1c <400> 46 atgtcgggta aaggagaagg at 21

<210> 47 <211> 33 <212> DNA <213> Artificial Sequence <220><223> Synthesized Hsp70Ara-Sacl.1956r <400> 47 agctgagctc ttagtcgacc tcctcgatct tag 33

<210> 48 <211> 37 <212> DNA <213> Artificial Sequence <220><223> Synthesized Hsp70Ara-Plasto.r <400> 48 tccttctcct ttacccgaca ttttctctca agatgat 37

<210> 49 <211> 34 <212> DNA <213> Artificial Sequence <220><223> Synthesized supP19-plasto.r <400> 49 ccttgtatag ctcgttccat tttctctcaa gatg ??? 34 <210> 50

<211> 20 <212> DNA <213> Artificial Sequence <220><223> Synthesized supP19-1c <400> 50 atggaacgag ctatacaagg 20

<210> 51 <211> 32 <212> DNA <213> Artificial Sequence <220><223> Synthesized SupP19-Sacl.r <400> 51 agtcgagctc ttactcgctt tctttttcga ag 32

<210> 52 <211> 1719 <212> DNA <213> Artificial Sequence <220><223> Synthesized B-Plasto-Native SP-H5 A / lndonesia / 5/05 <400> 52 aagcttatgg agaaaatagt gcttcttctt gcaatagtca gtcttgttaa aagtgatcag 60 atttgcattg gttaccatgc aaacaattca acagagcagg ttgacacaat catggaaaag 120 aacgttactg ttacacatgc ccaagacata ctggaaaaga cacacaacgg gaagctctgc 180 gatctagatg gagtgaagcc tctaatttta agagattgta gtgtagctgg atggctcctc 240 gggaacccaa tgtgtgacga attcatcaat gtaccggaat ggtcttacat agtggagaag 300 gccaatccaa ccaatgacct ctgttaccca gggagtttca acgactatga agaactgaaa 360 cacctattga gcagaataaa ccattttgag aaaattcaaa tcatccccaa aagttcttgg 420 tccgatcatg aagcctcatc aggagttagc tcagcatgtc catacctggg aagtccctcc 480 ttttttagaa atgtggtatg gcttatcaaa aagaacagta catacccaac aataaagaaa 540 agctacaata ataccaacca agaggatctt ttggtactgt ggggaattca ccatcctaat 600 gatgcggcag agcagacaag gctatatcaa aacccaacca cctatatttc cattgggaca 660 tcaacactaa accagagatt ggtaccaaaa atagctacta gatccaaagt aaacgggcaa 720 agtggaagga tggagttctt ctggacaatt ttaaaaccta atgatgcaat caacttcgag 780 agtaatggaa atttcattgc tccagaatat gcatacaaaa ttgtcaagaa aggggactca 840 gcaattatga a aagtgaatt ggaatatggt aactgcaaca ccaagtgtca aactccaatg 900 ggggcgataa actctagtat gccattccac aacatacacc ctctcaccat cggggaatgc 960 cccaaatatg tgaaatcaaa cagattagtc cttgcaacag ggctcagaaa tagccctcaa 1020 agagagagca gaagaaaaaa gagaggacta tttggagcta tagcaggttt tatagaggga 1080 ggatggcagg gaatggtaga tggttggtat gggtaccacc atagcaatga gcaggggagt 1140 gggtacgctg cagacaaaga atccactcaa aaggcaatag atggagtcac caataaggtc 1200 aactcaatca ttgacaaaat gaacactcag tttgaggccg ttggaaggga atttaataac 1260 ttagaaagga gaatagagaa tttaaacaag aagatggaag acgggtttct agatgtctgg 1320 acttataatg ccgaacttct ggttctcatg gaaaatgaga gaactctaga ctttcatgac 1380 tcaaatgtta agaacctcta cgacaaggtc cgactacagc ttagggataa tgcaaaggag 1440 ctgggtaacg gttgtttcga gttctatcac aaatgtgata atgaatgtat ggaaagtata 1500 agaaacggaa cgtacaacta tccgcagtat tcagaagaag caagattaaa aagagaggaa 1560 ataagtgggg taaaattgga atcaatagga acttaccaaa tactgtcaat ttattcaaca 1620 gtggcgagtt ccctagcact ggcaatcatg atggctggtc tatctttatg gatgtgctcc 1680 aatggatcgt tacaatgca g aatttgcatt taagagctc 1719 <210> 53

<211> 3194 <212> DNA <213> Artificial Sequence <220><223> Synthesized 6G0 expression cassette from Hindill to Eco-Rl <400> 53 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 dacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttqacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 7 80 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc acgcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaac acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tggagaaaat agtgcttctt cttgcaatag tcagtcttgt 1080 taaaagtgat cagatttgca ttggttacca tgcaaacaat tcaacagagc aggttgacac 1140 aatcatggaa aagaacgtta ctgttacaca tgcccaagac atactggaaa agacacacaa 1200 cgggaagctc tgcgatctag atggagtgaa gcctctaatt ttaagagatt gtagtgtagc 1260 tggatggctc ctcgggaacc caatgtgtga cgaattcatc aatgtaccgg aatggtctta 1320 catagtggag aaggccaatc caaccaatga cctctgttac ccagggagtt tcaacgacta 1380 tgaagaactg aaacacctat tgagcagaat aaaccatttt gagaaaattc aaatcatccc 1440 caaaagttct tggtccgatc atgaagcctc atcaggagtt agctcagcat gtccatacct 1500 gggaagtccc tccttttt: rt gaaatgtggt atggcttatc aaaaagaaca gtacataccc 1560 aacaataaag aaaagctaca ataataccaa ccaagaggat cttttggtac tgtggggaat 1620 tcaccatcct aatgatgcgg cagagcagac aaggctatat caaaacccaa ccacctatat 1680 ttccattggg acatcaa scar taaaccagag attggtacca aaaatagcta ctagatccaa 1740 agtaaacggg caaagtggaa ggatggagtt cttctggaca attttaaaac ctaatgatgc 1800 aatcaacttc gagagtaatg gaaatttcat tgctccagaa tatgcataca aaattgtcaa 1860 gaaaggggac tcagcaatta tgaaaagtga attggaatat ggtaactgca acaccaagtg 1920 tcaaactcca atgggggcga taaactctag tatgccattc cacaacatac accctctcac 1980 catcggggaa tgccccaaat atgtgaaatc aaacagatta gtccttgcaa cagggctcag 2040 aaatagccct caaagagaga gcagaagaaa aaagagagga ctatttggag ctatagcagg 2100 ttttatagag ggaggatggc agggaatggt agatggttgg tatgggtacc accatagcaa 2160 tgagcagggg agtgggtacg ctgcagacaa agaatccact caaaaggcaa tagatggagt 2220 caccaataag gtcaactcaa tcattgacaa aatgaacact cagtttgagg ccgttggaag 2280 gaatttaaac aagaagatgg aagacgggtt 2340 ggaatttaat aacttagaaa ggagaataga tctagatgtc tggacttata atgccgaact tctggttctc atggaaaatg agagaactct 2400 agactttcat gactcaaatg ttaagaacct ctacgacaag gtccgactac agcttaggga 2460 taatgcaaag gagctgggta acggttgttt cgagttctat cacaaatgtg ataatgaatg 2520 tatggaaagt ataagaaacg g acgtacaa ctatccgcag tattcagaag aagcaagatt 2580 aaaaagagag gaaataagtg gggtaaaatt ggaatcaata ggaacttacc aaatactgtc 2640 aatttattca acagtggcga gttccctagc actggcaatc atgatggctg gtctatcttt 2700 atggatgtgc tccaatggat cgttacaatg cagaatttgc atttaagagc tctaagttaa 2760 aatgcttctt cgtctcctat ttataatatg gtttgttatt gttaattttg ttcttgtaga 2820 agagcttaat taatcgttgt tgttatgaaa tactatttgt atgagatgaa ctggtgtaat 2880 gtaattcatt tacataagtg gagtcagaat cagaatgttt cctccataac taactagaca 2940 tgaagacctg ccgcgtacaa ttgtcttata tttgaacaac taaaattgaa catcttttgc 3000 cacaacttta taagtggtta atatagctca aatatatggt caagttcaat agattaataa 3060 tggaaatatc agttatcgaa attcattaac aatcaactta acgttattaa ctactaattt 3120 tatatcatcc cctttgataa atgatagtac accaattagg aaggagcatg ctcgaggcct 3180 ggctggccga attc 3194

<210> 54 <211> 1711 <212> DNA <213> Artificial Sequence <220><223> Synthesized Wld-type Hl / NC coding sequence lacking Tm D and Ctail <400> 54 atgaaagcaa aactactggt cctgttatgt acatttacag ctacatatgc agacacaata 60 tgtataggct accatgccaa caactcaacc gacactgttg acacagtact tgagaagaat 120 gtgacagtga cacactctgt caacctactt gaggacagtc acaatggaaa actatgtcta 180 ctaaaaggaa tagccccact acaattgggt aattgcagcg ttgccggatg gatcttagga 240 aacccagaat gcgaattact gatttccaag gaatcatggt cctacattgt agaaacacca 300 aatcctgaga atggaacatg ttacccaggg tatttcgccg actatgagga actgagggag 360 caattgagtt cagtatcttc atttgagaga ttcgaaatat tccccaaaga aagctcatgg 420 cccaaccaca ccgtaaccgg agtatcagca tcatgctccc ataatgggaa aagcagtttt 480 tacagaaatt tgctatggct gacggggaag aatggtttgt acccaaacct gagcaagtcc 540 tatgtaaaca acaaagagaa agaagtcctt gtactatggg gtgttcatca cccgcctaac 600 atagggaacc aaagggccct ctatcataca gaaaatgctt atgtctctgt agtgtcttca 660 cattatagca gaagattcac cccagaaata gccaaaagac ccaaagtaag agatcaggaa 720 ggaagaatca actactactg gactctgctg gaacctgggg atacaataat atttgaggca 780 aatggaaatc taatagcgcc atggtatgct tttgcactga gtagaggctt tggatcagga 840 atcatcacct c aaatgcacc aatggatgaa tgtgatgcga agtgtcaaac acctcaggga 900 gctataaaca gcagtcttcc tttccagaat gtacacccag tcacaatagg agagtgtcca 960 aagtatgtca ggagtgcaaa attaaggatg gttacaggac taaggaacat cccatccatt 1020 caatccagag gtttgtttgg agccattgcc ggtttcattg aaggggggtg gactggaatg 1080 gtagatgggt ggtatggtta tcatcatcag aatgagcaag gatctggcta tgctgcagat 1140 caaaaaagta cacaaaatgc cattaacggg attacaaaca aggtgaattc tgtaattgag 1200 aaaatgaaca ctcaattcac agctgtgggc aaagaattca acaaattgga aagaaggatg 1260 gaaaacttaa ataaaaaagt tgatgatggg tttctagaca tttggacata taatgcagaa 1320 ttgttggttc tactggaaaa tgaaaggact ttggatttcc atgactccaa tgtgaagaat 1380 ctgtatgaga aagtaaaaag ccaattaaag aataatgcca aagaaatagg aaacgggtgt 1440 tttgaattct atcacaagtg taacaatgaa tgcatggaga gtgtgaaaaa tggaacttat 1500 gactatccaa aatattccga agaatcaaag ttaaacaggg agaaaattga tggagtgaaa 1560 ttggaatcaa tgggagtcta tcagattctg gcgatctact caactgtcgc cagttccctg 1620 gttcttttgg tctccctggg ggcaatcagc ttctggatgt gttccaatgg gtctttgcag 1680 tgtagaatat gcatctgag the ccagaatttc to 1711

<210> 55 <211> 1556 <Z1Z> DNA <Z13> Artificial Sequence <2Z0><ZZ3> Synthesized BglII-H1 A / NewCaledonla / 20/99-Sacl / Stul. <400> 55 agatcttcgc tgacacaata tgtataggct accatgccaa caactcaacc gacactgttg 60 acacagtact tgagaagaat gtgacagtga cacactctgt caacctactt gaggacagtc 120 acaatggaaa actatgtcta ctaaaaggaa tagccccact acaattgggt aattgcagcg 180 ttgccggatg gatcttagga aacccagaat gcgaattact gatttccaag gaatcatggt 240 cctacattgt agaaacacca aatcctgaga atggaacatg ttacccaggg tatttcgccg 300 actatgagga actgagggag caattgagtt cagtatcttc atttgagaga ttcgaaatat 360 tccccaaaga aagctcatgg cccaaccaca ccgtaaccgg agtatcagca tcatgctccc 420 ataatgggaa aagcagtttt tacagaaatt tgctatggct gacggggaag aatggtttgt 480 acccaaacct gagcaagtcc tatgtaaaca acaaagagaa agaagtcctt gtactatggg 540 gtgttcatca cccgcctaac atagggaacc aaagggcact ctatcataca gaaaatgctt 600 atgtctctgt agtgtcttca cattatagca gaagattcac cccagaaata gccaaaagac 660 ccaaagtaag agatcaggaa ggaagaatca actactactg gactctgctg gaacctgggg 720 atacaataat atttgaggca aatggaaatc taatagcgcc atggtatgct tttgcactga 780 gtagaggctt tggatcagga atcatcacct caaatgcacc aatggatgaa tgtgatgcga 840 agtgtcaaac ac ctcaggga gctataaaca gcagtcttcc tttccagaat gtacacccag 900 tcacaatagg agagtgtcca aagtatgtca ggagtgcaaa attaaggatg gttacaggac 960 taaggaacat cccatccatt caatccagag gtttgtttgg agccattgcc ggtttcattg 1020 aaggggggtg gactggaatg gtagatgggt ggtatggtta tcatcatcag aatgagcaag 1080 gatctggcta tgctgcagat caaaaaagta cacaaaatgc cattaacggg attacaaaca 1140 aggtcaattc tgtaattgag aaaatgaaca ctcaattcac agctgtgggc aaagagttca 1200 acaaattgga aagaaggatg gaaaacttaa ataaaaaagt tgatgatggg tttctagaca 1260 tttggacata taatgcagaa ttgttggttc tactggaaaa tgaaaggact ttggatttcc 1320 atgactccaa tgtgaagaat ctgtatgaga aagtaaaaag ccaattaaag aataatgcca 1380 aagaaatagg aaacgggtgt tttgagttct atcacaagtg taacaatgaa tgcatggaga 1440 gtgtgaaaaa tggtacctat gactatccaa aatattccga agaatcaaag ttaaacaggg 1500 agaaaattga tggagtgaaa ttggaatcaa tgggagtata ctaagagctc 1556 aggcct

<210, 56 <211> 219 <212> DNA <213> Artificial Sequence <220><223> Synthesized Kpnl-Hl A / NewCaledonia / 20/99 TmD + Ctail-Sad / Stul. <400 »56 ggtacctatg actatccaaa atattccgaa gaatcaaagt taaacaggga gaaaattgat 60 ggagtgaaat tggaatcaat gggagtatac cagattctgg cgatctactc aactgtcgcc 120 agttccctgg ttcttttggt ctccctgggg gcaatcagct tctggatgtg ttccaatggg 180 tctttgcagt gtagaatatg catctaagag ctcaggcct 219

<210> 57 <211> 1781 <212> DNA <213> Artificial Sequence <220><223> Synthesized Signal peptide of alfalfa protein disulfide isomerase (POI) gene <400> 57 ccaaatcctt aacattcttt caacaccaac aatggcgaaa aacgttgcga ttttcggttt 60 attgttttct cttcttctgt tggttccttc tcagatcttc gctgaggaat catcaactga 120 cgctaaggaa tttgttctta cattggataa cactaatttc catgacactg ttaagaagca 180 cgatttcatc gtcgttgaat tctacgcacc ttggtgtgga cactgtaaga agctagcccc 240 agagtatgag aaggctgctt ctatcttgag cactcacgag ccaccagttg ttttggctaa 300 agttgatgcc aatgaggagc acaacaaaga cctcgcatcg gaaaatgatg ttaagggatt 360 cccaaccatt aagattttta ggaatggtgg aaagaacatt caagaataca aaggtccccg 420 tgaagctgaa ggtattgttg agtatttgaa aaaacaaagt ggccctgcat ccacagaaat 480 taaatctgct gatgatgcga ccgcttttgt tggtgacaac aaagttgtta ttgtcggagt 540 tttccctaaa ttttctggtg aggagtacga taacttcatt gcattagcag agaagttgcg 600 ttctgactat gactttgctc acactttgaa tgccaaacac cttccaaagg gagactcatc 660 agtgtctggg cctgtggtta ggttatttaa gccatttgac gagctctttg ttgactcaaa 720 ggatttcaat gtagaagctc tagagaaatt cattgaagaa tccagtaccc caattgtgac 780 tgtcttcaac aatgagccta gcaatcaccc ttttgttgtc aaattcttta actctcccaa 840 cgcaaaggct a tgttgttca tcaactttac taccgaaggt gctgaatctt tcaaaacaaa 900 ataccatgaa gtggctgagc aatacaaaca acagggagtt agctttcttg ttggagatgt 960 tgagtctagt caaggtgcct tccagtattt tggactgaag gaagaacaag tacctctaat 1020 tattattcag cataatgatg gcaagaagtt tttcaaaccc aatttggaac ttgatcaact 1080 cccaacttgg ttgaaggcat acaaggatgg caaggttgaa ccatttgtca agtctgaacc 1140 tattcctgaa actaacaacg agcctgttaa agtggtggtt gggcaaactc ttgaggacgt 1200 tgttttcaag tctgggaaga atgttttgat agagttttat gctccttggt gtggtcactg 1260 caagcagttg gctccaatct tggatgaagt tgctgtctca ttccaaagcg atgctgatgt 1320 tgttattgca aaactggatg caactgccaa cgatatccca accgacacct ttgatgtcca 1380 aggctatcca accttgtact tcaggtcagc aagtggaaaa ctatcacaat acgacggtgg 1440 taggacaaag gaagacatca tagaattcat tgaaaagaac aaggataaaa ctggtgctgc 1500 tcatcaagaa gtagaacaac caaaagctgc tgctcagcca gaagcagaac aaccaaaaga 1560 tgagctttga aaagttccgc ttggaggata tcggcacaca gtcatctgcg ggctttacaa 1620 ctcttttgta tctcagaatc agaagttagg aaatcttagt gccaatctat ctatttttgc 1680 gtttcatttt atctttttg g tttactctaa tgtattactg aataatgtga gttttggcgg 1740 agtttagtac tggaactttt gtttctgtaa aaaaaaaaaa a 1781

<210> 58 <211> 1457 <212> DNA <213> Artificial Sequence <220><223> Synthesized PromPlasto-PDISP-Plasto 3 (prime) UTR plasmid sequence <400> 58 ctggtatatt tatatgttgt caaataactc aaaaaccata aaagtttaag ttagcaagtg 60 tgtacatttt tacttgaaca aaaatattca cctactactg ttataaatca ttattaaaca 120 ttagagtaaa gaaatatgga tgataagaac aagagtagtg atattttgac aacaattttg 180 ttgcaacatt tgagaaaatt ttgttgttct ctcttttcat tggtcaaaaa caatagagag 240 agaaaaagga agagggagaa taaaaacata atgtgagtat gagagagaaa gttgtacaaa 300 agttgtacca aaatagttgt acaaatatca ttgaggaatt tgacaaaagc tacacaaata 360 agggttaatt gctgtaaata aataaggatg acgcattaga gagatgtacc attagagaat 420 ttttggcaag tcattaaaaa gaaagaataa attattttta aaattaaaag ttgagtcatt 480 tgattaaaca tgtgattatt taatgaattg atgaaagagt tggattaaag ttgtattagt 540 aattagaatt tggtgtcaaa tttaatttga catttgatct tttcctatat attgccccat 600 agagtcagtt aactcatttt tatatttcat agatcaaata agagaaataa cggtatatta 660 atccctccaa aaaaaaaaaa cggtatattt actaaaaaat ctaagccacg taggaggata 720 acaggatccc cgtaggagga taacatccaa tccaaccaat cacaacaatc ctgatgagat 780 aacccacttt aagcccacgc atctgtggca catctacatt atctaaatca cacattcttc 840 cacacatctg a gccacacaa aaaccaatcc acatctttat cacccattct ataaaaaatc 900 acactttgtg agtctacact ttgattccct tcaaacacat acaaagagaa gagactaatt 960 aattaattaa tcatcttgag agaaaatggc gaaaaacgtt gcgattttcg gcttattgtt 1020 ttctcttctt gtgttggttc cttctcagat ctgagctcta agttaaaatg cttcttcgtc 1080 tcctatttat aatatggttt gttattgtta attttgttct tgtagaagag cttaattaat 1140 cgttgttgtt atgaaatact atttgtatga gatgaactgg tgtaatgtaa ttcatttaca 1200 taagtggagt cagaatcaga atgtttcctc cataactaac tagacatgaa gacctgccgc 1260 gtacaattgt cttatatttg aacaactaaa attgaacatc ttttgccaca actttataag 1320 tggttaatat agctcaaata tatggtcaag ttcaatagat taataatgga aatatcagtt 1380 atcgaaattc attaacaatc aacttaacgt tattaactac taattttata tcatcccctt 1440 tgataaatga tagtaca 1457

<59> 59 <211> 3206 <212> DNA <213> Artificial Saquanca <Z20>

<2Z3> Synthesized 540 expression cassette from Hindi II <400> 59 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 aacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttgacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 780 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc a cgcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaao acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tggcgaaaaa cgttgcgatt ttcggcttat tgttttctct 1080 tcttgtgttg gttccttctc agatcttcgc tgacacaata tgtataggct accatgccaa 1140 caactcaacc gacactgttg acacagtact tgagaagaat gtgacagtga cacactctgt 1200 caacctactt gaggacagtc acaatggaaa actatgtcta ctaaaaggaa tagccccact 1260 acaattgggt aattgcagcg ttgccggatg gatcttagga aacccagaat gcgaattact 1320 gatttccaag gaatcatggt cctacattgt agaaacacca aatcctgaga atggaacatg 1380 ttacccaggg tatttcgccg actatgagga actgagggag caattgagtt cagtatcttc 1440 atttgagaga ttcgaaatat tcacaaaaga aagctcatgg cccaaccaca ccgtaaccgg 1500 agtatcagca tcatgctccc ataatgggaa aagcagtttt tacagaaatt tgctatggct 1560 gacggggaag aatggtttgt acccaaacct gagcaagtcc tatgtaaaca acaaagagaa 1620 agaagtcctt gtactatggg gtgttcatca cccgcctaac atagggaacc aaagggcact 1680 ctatcataca gaaaatgct t atgtctctgt agtgtcttca cattatagca gaagattcac 1740 cccagaaata gccaaaaqac ccaaagtaag agatcaggaa ggaagaatca actactactg 1800 gactctgctg gaacctgggg atacaataat atttgaggca aatggaaatc taatagcgcc 1860 atggtatgct tttgcactga gtagaggctt tggatcagga atcatcacct caaatgcacc 1920 aatgqatgaa tgtgatgcga agtgtcaaac acctcaggga gctataaaca gcagtcttcc 1980 tttccagaat gtacacccag tcacaatagg agagtgtcca aagtatgtca ggagtgcaaa 2040 attaaggatg gttacaggac taaggaacat cccatccatt caatccagag gtttgtttgg 2100 agccattgcc ggtttcattq aaggggggtg gactggaatq gtagatgggt ggtatggtta 2160 tcatcatcag aatgagcaag gatctggcta tgctgcagat caaaaaagta cacaaaatgc attacaaaca cattaacggg 2220 aggtcaattc tgtaattgag aaaatgaaca ctcaattcac 2280 agctgtgggc aaagagttca acaaattgga aagaaggatg gaaaacttaa ataaaaaagt 2340 tgatgatggg tttctagaca tttggacata taatgcagaa ttgttggttc tactggaaaa 2400 tgaaaggact ttggatttcc atgactccaa tgtgaagaat ctgtatgaga aagtaaaaag 2460 ccaattaaag aataatgcca aagaaatagg aaacgggtgt tttgagttct atcacaagtg 2520 taacaatgaa tgcatggaga GTGT gaaaaa tggtacctat gactatccaa aatattccga 2580 agaatcaaag ttaaacaggg agaaaattga tggagtgaaa ttggaatcaa tgggagtata 2640 ccagattctg gcgatcta :::: t caactgtcgc cagttccctg gttcttttgg tctccctggg 2700 ggcaatcagc ttctggatgt gttccaatgg gtctttgcag tgtagaatat gcatctaaga 2760 gctctaagtt aaaatgcttc ttcgtctcct atttataata tggtttgtta ttgttaattt 2820 tgttcttgta gaagagctta attaatcgtt gttgttatga aatactattt gtatgagatg 2880 aactggtgta atgtaattca tttacataag tggagtcaga atcagaatgt ttcctccata 2940 actaactag2 catgaagacc tgccgcgtac aattgtctta tatttgaaca actaaaattg 3000 aacatctttt gccacaactt tataagtggt taatatagct caaatatatg gtcaagttca 3060 atagattaat aatggaaata tcagttatcg aaattcatta acaatcaact taacgttatt 3120 aactactaat tttatatcat cccctttgat aaatgatagt acaccaatta ggaaggagca GAATTC 3206 3180 tgctcgaggc ctggctggcc

<210> 60 <211> 1788 <212> DNA <213> Artificial Sequence <220><223> Synthesized fragment Oralll-Plasto (-84 + 1) -H 1 A / Brisbane / 59/07-Sacl. <400> 60 cactttgtga gtctacactt tgattccctt caaacacata caaagagaag agactaatta 60 attaattaat catcttgaga gaaaatgaaa gtaaaactac tggtcctgtt atgcacattt 120 aatatgtata ggctaccatg ctaacaactc gaccgacact 180 acagctacat atgcagacac gttgacacag tacttgaaaa gaatgtgaca gtgacacact ctgtcaacct gcttgagaac 240 agtcacaatg gaaaactatg tctattaaaa ggaatagccc cactacaatt gggtaattgc 300 agcgttgccg ggtggatctt aggaaaccca gaatgcgaat tactgatttc caaggagtca 360 tggtcctaca ttgtagaaaa accaaatcct gagaatggaa catgttaccc agggcatttc 420 gctgactatg aggaactgag ggagcaattg agttcagtat cttcatttga gaggttcgaa 480 atattcccca aagaaagctc atggcccaac cacaccgtaa ccggagtgtc agcatcatgc 540 tcccataatg gggaaagcag tttttacaga aatttgctat ggctgacggg gaagaatggt 600 ttgtacccaa acctgagcaa gtcctatgca aacaacaaag aaaaagaagt ccttgtacta 660 tggggtgttc atcacccgcc aaacataggt gaccaaaagg ccctctatca tacagaaaat 720 gcttatgtct ctgtagtgtc ttcacattat agcagaaaat tcaccccaga aatagccaaa 780 agacccaaag taagagatca agaaggaaga atcaattact actggactct gcttgaaccc 840 ggggatacaa t aatatttga ggcaaatgga aatctaatag cgccaagata tgctttcgca 900 ctgagtagag gctttggatc aggaatcatc aactcaaatg caccaatgga taaatgtgat 960 gcgaagtgcc aaacacctca gggagctata aacagcagtc ttcctttcca gaacgtacac 1020 ccagtcacaa taggagagtg tccaaagtat gtcaggagtg caaaattaag gatggttaca 1080 ggactaagga acatcccatc cattcaatcc agaggtttgt ttggagccat tgccggtttc 1140 attgaagggg ggtggactgg aatggtagat ggttggtatg gttatcatca tcagaatgag 1200 caaggatctg gctatgctgc agatcaaaaa agcacacaaa atgccattaa tgggattaca 1260 aacaaggtca attctgtaat tgagaaaatg aacactcaat tcacagcagt gggcaaagag 1320 ttcaacaaat tggaaagaag gatggaaaac ttgaataaaa aagttgatga tgggtttata 1380 gacatttgga catataatgc agaactgttg gttctactgg aaaatgaaag gactttggat 1440 ttccatgact ccaatgtgaa gaatctgtat gagaaagtaa aaagccagtt aaagaataat 1500 gctaaagaaa taggaaatgg gtgttttgag ttctatcaca agtgtaacga tgaatgcatg 1560 agagtgtaa agaatggaac ttatgactat ccaaaatatt ccgaagaatc aaagttaaac 1620 agggagaaaa ttgatggagt gaaattggaa tcaatgggag tctatcagat tctggcgatc 1680 tactcaacag tcgccagttc tctggttctt ttggtctccc tgggggcaat cagcttctgg 1740 atgtgttcca atgggtcttt acagtgtaga atatgcatct aagagctc 1788

<210> 61 <211> 3185 <212> DMA <213> Artificial Sequence <220><223> Synthesized 774 expression cassette from Hindi II <400> 61 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 aacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttgacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 780 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc a cgcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaac acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tgaaagtaaa actactggtc ctgttatgca catttacagc 1080 tacatatgca gacacaatat gtataggcta ccatgctaac aactcgaccg acactgttga 1140 cacagtactt gaaaagaatg tgacagtgac acactctgtc aacctgcttg agaacagtca 1200 caatggaaaa ctatgtctat taaaaggaat agccccacta caattgggta attgcagcgt 1260 tgccgggtgg atcttaggaa acccagaatg cgaattactg atttccaagg agtcatggtc 1320 ctacattgta gaaaaaccaa atcctgagaa tggaacatgt tacccagggc atttcgctga 1380 ctatgaggaa ctgagggagc aattgagttc agtatcttca tttgagaggt tcgaaatatt 1440 ccccaaagaa agctcatggc ccaaccacac cgtaaccgga gtgtcagcat catgetceca 1500 taatggggaa agcagttttt acagaaattt gctatggctg acggggaaga atggtttgta 1560 cccaaacctg agcaagtcct atgcaaacaa caaagaaaaa gaagtccttg tactatgggg 1620 tgttcatcac ccgccaaaca taggtgacca aaaggccctc tatcatacag aaaatgctta 1680 tgtctctgta gtgtcttca c attatagcag aaaattcacc ccagaaatag ccaaaagacc 1740 caaagtaaga gatcaagaag gaagaatcaa ttactactgg actctgcttg aacccgggga 1800 tacaataata tttgaggcaa atggaaatct aatagcgcca agatatgctt tcgcactgag 1860 tagaggcttt ggatcaggaa tcatcaactc aaatgcacca atggataaat gtgatgcgaa 1920 gtgccaaaca cctcagggag ctataaacag cagtcttcct ttccagaacg tacacccagt 1980 cacaatagga gagtgtccaa agtatgtcag gagtgcaaaa ttaaggatgg ttacaggact 2040 aaggaacatc ccatccattc aatccagagg tttgtttgga gccattgccg gtttcattga 2100 aggggggtgg actggaatgg tagatggttg gtatggttat catcatcaga atgagcaagg 2160 atctggctat gctgcagatc aaaaaagcac acaaaatgcc attaatggga ttacaaacaa 2220 ggtcaattct gtaattgaga aaatgaacac tcaattcaca gcagtgggca aagagttcaa 2280 caaattggaa agaaggatgg aaaacttgaa taaaaaagtt gatgatgggt ttatagacat 2340 ttggacatat aatgcagaac tgttggttct actggaaaat gaaaggactt tggatttcca 2400 tgactccaat gtgaagaatc tgtatgagaa agtaaaaagc cagttaaaga ataatgctaa 2460 agaaatagga aatgggtgtt ttgagttcta tcacaagtgt aacgatgaat gcatggagag 2520 tgtaaagaat ggaacttatg minutes tccaaa atattccgaa gaatcaaagt taaacaggga 2580 gaaaattgat ggagtgaaat tggaatcaat gggagtctat cagattctgg cgatctactc 2640 aacagtcgcc agttctctgg ttcttttggt ctccctgggg gcaatcagct tctggatgtg 2700 ttccaatggg tctttacagt gtagaatatg catctaagag ctctaagtta aaatgcttct 2760 tcqtctccta tttataatat ggtttqttat tgttaatttt gttcttgtag aagagcttaa 2820 ttaatcgttg ttgttatgaa atactatttg tatgagatga actggtgtaa tgtaattcat 2880 ttacataagt ggagtcagaa tcagaatgtt tcctccataa ctaactagac atgaagacct 2940 gccgcgtaca attgtcttat atttgaacaa ctaaaattga acatcttttg ccacaacttt 3000 ataagtggtt aatatagctc aaatatatgg tcaagttcaa tagattaata atggaaatat 3060 cagttatcqa aattcattaa caatcaactt aacgttatta actactaatt ttatatcatc 3120 ccctttgata aatgatagta caccaattag gaaggagcat gctcgaggcc tggctggccg aattc 55

<210> 62 <211> 2065 <212> DNA <213> Artificial Sequence <220><223> Synthesized Expression cassette number 828, from Pad to Asel <400> 62 3180 3185 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 ataaaggaaa cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cc caaatttg tcgggcccat ggttttcaca cctcagatac ttggacttat gcttttttgg 900 atttcagcct ccagaggtga tattgtgcta actcagtctc cagccaccct gtctgtgact 960 ccaggagata gtgtcagtct ttcctgcagg gccagccaaa gtattagcaa caacctacac 1020 tggtttcaac aaaaatcgca tgagtctcca aggcttctca tcaagtatgc ttcccagtcc 1080 atatctggga tcccctccag gttcagtggc agtggatctg ggacagattt cactctcagt 1140 atcaacagtg tgaagactga agattttgga atgtttttct gtcaacagag taacagctgg 1200 cctctcacgt tcggtgatgg gacaaagctg gagctgaaac gggctgatgc tgcaccaact 1260 gtatccatct tcccaccatc cagtgagcag ttaacatctg gaggtgcctc agtcgtgtgc 1320 ttcttgaaca acttctaccc caaagacatc aatgtcaagt ggaagattga tggcagtgaa 1380 cgacaaaatg gcgtcctgaa cagttggact gatcaggaca gcaaagacag cacctacagc 1440 atgagcagca ccctcacgtt gaccaaggac gagtatgaac gacataacag ctatacctgt 1500 gaggccactc acaagacatc aacttcaccc attgtcaaga gcttcaacag gaatgagtgt 1560 tagaggccta ttttctttag tttgaattta ctgttattcg gtgtgcattt ctatgtttgg 1620 tgagcggttt tctgtgctca gagtgtgttt attttatgta atttaatttc tttgtgagct 1680 cctgtttagc aggtcgtccc ttcagcaagg acacaaaaag attttaattt tattaaaaaa 1740 aaaaaaaaaa aagaccggga attcgatatc aagcttatcg acctgcagat cgttcaaaca 1800 tttggcaata aagtttctta agattgaatc ctgttgccgg tcttgcgatg attatcatat 1860 aatttctgtt gaattacgtt aagcatgtaa taattaacat gtaatgcatg acgttattta 1920 tgagatgggt ttttatgatt agagtcccgc aattatacat ttaatacgcg atagaaaaca 1980 aaatatagcg cgcaaactag gataaattat cgcgcgcggt gtcatctatg ttactagatt 2040 ctagagtctc aagcttcggc gcgcc 2065

<210> 63 <211> 3194 <212> DNA <213> Artificial Sequence <220><223> Synthesized Construct number 690, from Hindi ·· to EcoRI <400> 63 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 aacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttgacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 780 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc a cgcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaac acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tggagaaaat agtgcttctt cttgcaatag tcagtcttgt 1080 taaaagtgat cagatttgca ttggttacca tgcaaacaat tcaacagagc aggttgacac 1140 aatcatggaa aagaacgtta ctgttacaca tgcccaagac atactggaaa agacacacaa 1200 cgggaagctc tgcgatctag atggagtgaa gcctctaatt ttaagagatt gtagtgtagc 1260 tggatggctc ctcgggaacc caatgtgtga cgaattcatc aatgtaccgg aatggtctta 1320 catagtggag aaggccaatc caaccaatga cctctgttac ccagggcatt tcgctgacta 1380 tgaggaactg agggagcaat tgagttcagt atctt: cattt gagaggttcg aaatattccc 1440 caaagaaagc tcatggccca accacaccgt aaccggagtg tcagcatcat gctcccataa 1500 tggggaaagc agtttttaca gaaatttgct atggctgacg gggaagaatg gtttgtaccc 1560 aaacctgagc aagtcctatg caaacaacaa agaaaaagaa gtccttgtac tatggggtgt 1620 tcatcacccg ccaaacatag gtgaccaaaa ggccctctat catacagaaa atgcttatgt 1680 ctctgtagtg tcttcaca tt atagcagaaa attcacccca gaaatagcca aaagacccaa 1740 agtaagagat caagaaggaa gaatcaatta ctactggact ctgcttgaac ccggggatac 1800 aataatattt gaggcaaatg gaaatctaat agcgccaaga tatgctttcg cactgagtag 1860 aggctttgga tcaggaatta tgaaaagtga attggaatat ggtaactgca acaccaagtg 1920 tcaaactcca atgggggcga taaactctag tatgccattc cacaacatac accctctcac 1980 catcggggaa tgccccaaat atgtgaaatc aaacagatta gtccttgcaa cagggctcag 2040 aaatagccct caaagagaga gcagaagaaa aaagagagga ctatttggag ctatagcagg 2100 ttttatagag ggaggatggc agggaatggt agatggttgg tatgggtacc accatagcaa 2160 tgagcagggg agtgggtacg ctgcagacaa agaatccact caaaaggcaa tagatggagt 2220 caccaataag gtcaactcaa tcattgacaa aatgaacact cagtttgagg ccgttggaag 2280 ggaatttaat aacttagaaa ggagaataga gaatttaaac aagaagatgg aagacgggtt 2340 tctagatgtc tggacttata atgecgaact tctggttcte atggaaaatg agagaactct 2400 agactttcat gactcaaatg ttaagaacct ctacgacaag gtccgactac agcttaggga 2460 taatgcaaag gagctgggta acggttgttt cgagttctat cacaaatgtg ataatgaatg 2520 tatggaaagt a. okay ga acgtacaa ctatccgcag tattcagaag aagcaagatt 2590 aaaaa.gagag gaaataagtg gggtaaaatt ggaatcaata ggaacttacc aaatactgtc 2640 aatttattca acagtggcga gttccctagc actggcaatc atgatggctg gtctatcttt 2700 atggatgtgc tccaatggat cgttacaatg cagaatttgc atttaagagc tctaagttaa 2760 aatgcttctt cgtctcctat ttataatatg gtttgttatt gttaattttg ttcttgtaga 2820 agagcttaat taatcgttgt tgttatgaaa tactatttgt atgagatgaa ctggtgtaat 2880 gtaattcatt tacataagtg gagtcagaat cagaatgttt cctccataac taactagaca 2940 tgaagacctg ccgcgtacaa ttgtcttata tttgaacaac taaaattgaa catcttttgc 3000 cacaacttta taagtggtta atatagctca aatatatggt caagttcaat agattaataa 3060 tggaaatatc agttatcgaa attcattaac aatcaactta acgttattaa ctactaattt 3120 tatatcatcc cctttgataa atgatagtac accaattagg aaggagcatg ctcgaggcct 3180 ggctggccga attc 3194

<210> 64 <211> 3194 <212> DNA <213> Artificial Sequence <220><223> Synthesized Construct number 691, from Hindlll to EcoRI <400> 64 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 aacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttgacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 780 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc a cgcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaac acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tggagaaaat agtgcttctt cttgcaatag tcagtcttgt 1080 taaaagtgat cagatttgca ttggttacca tgcaaacaat tcaacagagc aggttgacac 1140 aatcatggaa aagaacgtta ctgttacaca tgcccaagac atactggaaa agacacacaa 1200 cgggaagci c tgcctattaa aaggaatagc cccactacaa ttgggtaatt gcagcgttgc 1260 cgggtggatc ttaggaaacc cagaatgcga attactgatt tccaaggagt catggtccta 1320 cattgtagaa aaaccaaatc ctgagaatgg aacatgttac ccagggcatt tcgctgacta 1380 tgaggaactg agggagcaat tgagttcagt atcttcattt gagaggttcg aaatattccc 1440 caaagaaagc tcatggccca accacaccgt aaccggagtg tcagcatcat gctcccataa 1500 tggggaaagc agtttttaca gaaatttgct atggctgacg gggaagaatg gtttgtaccc 1560 aaacctgagc aagtcctatg caaacaacaa agaaaaagaagtccttgtac tatggggtgt 1620 tcatcacccg ccaaacatag gtgaccaaaa ggccctctat catacagaaa atgcttatgt 1680 ctctgtagtg tcttcacat t atagcagaaa attcacccca gaaatagcca aaagacccaa 1740 agtaagagat caagaaggaa gaatcaatta ctactggact ctgcttgaac ccggggatac 1800 aataatattt gaggcaaatg gaaatctaat agcgccaaga tatgctttcg cactgagtag 1860 aggctttgga tcaggaatca tcaactcaaa tgcaccaatg gataaatgca acaccaagtg 1920 tcaaactcca atgggggcga taaactctag tatgccattc cacaacatac accctctcac 1980 cu.tcggggaa tgccccaaat atgtgaaatc aaacagatta gtccttgcaa cagggctcag 2040 aaatagccct caaagagaga gcagaagaaa aaagagagga ctatttggag ctatagcagg 2100 ttttatagag ggaggatggc agggaatggt agatggttgg tatgggtacc accatagcaa 2160 tgagcagggg agtgggtacg ctgcagacaa agaatccact caaaaggcaa tagatggagt 2220 caccaataag gtcaactcaa tcattgacaa aatgaacact cagtttgagg ccgttggaag 2280 ggaatttaat aacttagaaa ggagaataga gaatttaaac aagaagatgg aagacgggtt 2340 tctagatgtc tggacttata atgccgaact tctggttctc atggaaaatg agagaactct 2400 agactttcat gactcaaatg ttaagaacct ctacgacaag gtccgactac agcttaggga 2460 taatgcaaag gagctgggta acggttgttt cgagttctat cacaaatgtg ataatgaatg 2520 tatggaaagt ataagaaacg gaa cgtacaa ctatccgcag tattcagaag aagcaagatt 2580 aaaaagagag gaaataagtg gggtaaaatt ggaatcaata ggaacttacc aaatactgtc 2640 aatttattca acagtggcga gttccctagc actggcaatcatgatggctg gtctatcttt 2700 atggatgtgc tccaatggat cgttacaatg cagaatttgc atttaagagc tctaagttaa 2760 aatgcttctt cgtctcctat ttataatatg gtttgttatt gttaattttg ttcttgtaga 282 0 agagcttaat taatcgttgt tgttatgaaa tactatttgt atgaqatgaa ctggtgtaat 2880 gtaattcatt tacataagtg gagtcagaat cagaatgttt cctccataac taactagaca 2940 tgaagacctg ccgcgtacaa ttgtcttata tttgaacaac taaaattgaa catcttttgc 3000 cacaacttta taagtggtta atatagctca aatatatggt caagttcaat agattaataa 3060 tggaaatatc agttatcgaa attcattaac aatcaactta acgttattaa ctactaattt 3120 tatatcatcc cctttgataa atgatagtac accaattagg aaggagcatg ctcgaggcct 3180 ggctggccga attc 3194

<21065 <211> 3206 <212> DNA <213> Artificial Sequence <220 <223> Synthesized Construct number 696, from Hlndlll to EcoRI <400 65 aagcttgcta gcggcctcaa tggccctgca ggtcgactct agaggtaccc cgggctggta 60 tatttatatg ttgtcaaata actcaaaaac cataaaagtt taagttagca agtgtgtaca 120 tttttacttg aacaaaaata ttcacctact actgttataa atcattatta aacattagag 180 taaagaaata tggatgataa gaacaagagt agtgatattt tgacaacaat tttgttgcaa 240 catttgagaa aattttgttg ttctctcttt tcattggtca aaaacaatag agagagaaaa 300 aggaagaggg agaataaaaa cataatgtga gtatgagaga gaaagttgta caaaagttgt 360 accaaaatag ttgtacaaat atcattgagg aatttgacaa aagctacaca aataagggtt 420 aattgctgta aataaataag gatgacgcat tagagagatg taccattaga gaatttttgg 480 caagtcatta aaaagaaaga ataaattatt tttaaaatta aaagttgagt catttgatta 540 aacatgtgat tatttaatga attgatgaaa gagttggatt aaagttgtat tagtaattag 600 aatttggtgt caaatttaat ttgacatttg atcttttcct atatattgcc ccatagagtc 660 agttaactca tttttatatt tcatagatca aataagagaa ataacggtat attaatccct 720 ccaaaaaaaa aaaacggtat atttactaaa aaatctaagc cacgtaggag gataacagga 780 tccccgtagg aggataacat ccaatccaac caatcacaac aatcctgatg agataaccca 840 ctttaagccc ac gcatctgt ggcacatcta cattatctaa atcacacatt cttccacaca 900 tctgagccac acaaaaacca atccacatct ttatcaccca ttctataaaa aatcacactt 960 tgtgagtcta cactttgatt cccttcaaac acatacaaag agaagagact aattaattaa 1020 ttaatcatct tgagagaaaa tggcgaaaaa cgttgcgatt ttcggcttat tgttttctct 1080 tcttgtgttg gttccttctc agatcttcgc tgacacaata tgtataggct accatgccaa 1140 caactcaacc gacactgttg acacagtact tgagaagaat gtgacagtga cacactctgt 1200 caacctactt gaggacagtc acaatggaaa actatgtcta ctaaaaggaa tagccccact 1260 acaattgggt aattgcagcg ttgccggatg gatcttagga aacccagaat gcgaattact 1320 gatttccaag gaatcatggt cctacattgt agaaacacca aatcctgaga atggaacatg 1380 ttacccaggg agtttcaacg actatgaaga actgaaacac ctattgagca gaataaacca 1440 ttttgagaaa attcaaatca tccccaaaag ttcttggtcc gatcatgaag cctcatcagg 1500 agttagctca gcatgtccat acctgggaag tccctccttt tttagaaatg tggtatggct 1560 tatcaaaaag aacagtacat acccaacaat aaagaaaagc tacaataata ccaaccaaga 1620 ggatcttttg gtactgtgqg gaattcacca tcctaatgat gcggcaqagc agacaaggct 1680 atatcaaaac ccaaccacct atatttccat tgggacatca acactaaacc agagattggt 1740 accaaaaata gctactagat ccaaagtaaa cgggcaaagt ggaaggatgg agttcttctg 1800 gacaatttta aaacctaatg atgcaatcaa cttcgagagt aatggaaatt tcattgctcc 1860 agaatatgca tacaaaattg tcaagaaagg ggactcagca atcatcacct caaatgcacc 1920 aatggatgaa tgtgatgcga agtgtcaaac acctcaggga gctataaaca gcagtcttcc 1980 tttccagaat gtacacccag tcacaatagg agagtgtcca aagtatgtca ggagtgcaaa 2040 attaaggatg gttacaggac taaggaacat cccatccatt caatccagag gtttgtttgg 2100 agccattgcc ggtttcattg aaggggggtg gactggaatg gtagatgggt ggtatggtta 2160 tcatcatcag aatgagcaag gatctggcta tgctgcagat caaaaaagta cacaaaatgc attacaaaca cattaacggg 2220 aggtcaattc tgtaattgag aaaatgaaca ctcaattcac 2280 agctgtgggc aaagagttca acaaattgga aagaaggatg gaaaacttaa ataaaaaagt 2340 tgatgatggg tttctagaca tttggacata taatgcagaa ttgttggttc tactggaaaa 2400 tgaaaggact ttggatttcc atqactccaa tgtgaagaat ctgtatgaga aagtaaaaag 2460 ccaattaaag aataatgcca aagaaatagg aaacgggtgt tttgagttct atcacaagtg 2520 taacaatgaa tgcatggaga gtgtg aaaaa tggtacctat gactatccaa aatattccga 2580 agaatcaaag ttaaacaggg agaaaattga tggagtgaaa ttggaatcaa tgggagtata 2640 ccagattctg gcgatctact caactgtcgc cagttccctg gttcttttgg tctccctggg 2700 ggcaatcagc ttctggatgt gttccaatgg gtctttgcag tgtagaatat gcatctaaga 2760 gctctaagtt aaaatgcttc ttcgtctcct atttataata tggtttgtta ttgttaattt 2820 tgttcttgta gaagagctta attaatcgtt gttgttatga aatactattt gtatgagatg 2880 aactggtgta atgtaattca tttacataag tggagtcaga atcagaatgt ttcctccata 2940 actaactaga catgaagacc tgccgcgtac aattgtctta tatttgaaca actaaaattg 3000 aacatctttt gccacaactt tataagtggt taatatagct caaatatatg gtcaagttca 3060 atagattaat aatggaaata tcagttatcg aaattcatta acaatcaact taacgttatt 3120 aactactaat tttatatcat cccctttgat aaatgatagt acaccaatta ggaaggagca 3180 OO / li tgctcgaggc ctggctggcc gaattc

<210> 66 <211> 3058 <212> DNA <213> Artificial Sequence <220><223> Synthesized Construct 732, from Paci to Asel <400> 66 aattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttacaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cccaaatttg tcg ggcccat gaaagtaaaa ctactggtcc tgttatgcac atttacagct 900 acatatgcag acacaatatg tataggctac catgctaaca actcgaccga cactgttgac 960 acagtacttg aaaagaatgt gacagtgaca cactctgtca acctgcttga gaacagtcac 1020 aatggaaaac tatgtctatt aaaaggaata gccccactac aattgggtaa ttgcagcgtt 1080 gccgggtgga tcttaggaaa cccagaatgc gaattactga tttccaagga gtcatggtcc 1140 tacattgtag aaaaaccaaa tcctgagaat ggaacatgtt acccagggca tttcgctgac 1200 tatgaggaac tgagggagca attgagttca gtatcttcat ttgagaggtt cgaaatattc 1260 cccaaagaaa gctcatggcc caaccacacc gtaaccggag tgtcagcatc atgctcccat 1320 aatggggaaa gcagttttta cagaaatttg ctatggctga cggggaagaa tggtttgtac 1380 ccaaacctga gcaagtccta tgcaaacaac aaagaaaaag aagtccttgt actatggggt 1440 gttcatcacc cgccaaacat aggtgaccaa aaggccctct atcatacaga aaatgcttat 1500 gtctctgtag tgtcttcaca ttatagcaga aaattcaccc cagaaatagc caaaagaccc 1560 aaagtaagag atcaagaagg aagaatcaat tactactgga ctctgcttga acccggggat 1620 acaataatat ttgaggcaaa tggaaatcta atagcgccaa gatatgcttt cgcactgagt 1680 agaggctttg gatcaggaat catcaactca aatgcaccaa tggataaatg tgatgcgaag 1740 tgccaaacac ctcagggagc tataaacagc agtcttcctt tccagaacgt acacccagtc 1800 acaataggag agtgtccaaa gtatgtcagg agtgcaaaat taaggatggt tacaggacta 1860 aggaacatcc catccattca atccagaggt ttgtttggag ccattgccgg tttcattgaa 1920 ggggçfÇftgga ctggaatggt agatggttgg tatggttatc atcatcagaa tgagcaagga 1980 tctggctatg ctgcagatca aaaaagcaca caaaatgcca ttaatgggat tacaaacaag 2040 gtcaattctg taattgagaa aatgaacact caattcacag cagtgggcaa agagttcaac 2100 aaattggaaa gaaggatgga aaacttgaat aaaaaagttg atgatgggtt tatagacatt 2160 tggacatata atgcagaact gttggttcta ctggaaaatg aaaggacttt ggatttccat 2220 gactccaatg tgaagaatct gtatgagaaa gtaaaaagcc agttaaagaa taatgctaaa 2280 gaaataggaa atgggtgttt tgagttctat cacaagtgta acgatgaatg catggagagt 2340 gtaaagaatg gaacttatga ctatccaaaa tattccgaag aatcaaagtt aaacagggag 2400 aaaattgatg gagtgaaatt ggaatcaatg ggagtctatc agattctggc gatctactca 2460 acagtcgcca gttctctggt tcttttggtc tccctggggg caatcagctt ctggatgtgt tA 2520 tccaatgggt ctttacagtg gaatatgc atctaaaggc ctattttctt tagtttgaat 2580 ttactgttat tcggtgtgca tttctatgtt tggtgagcgg ttttctgtgc tcagagtgtg 2640 tttattttat gtaatttaat ttctttgtga gctcctgttt agcaggtegt cccttcagca 2700 aggacacaaa aagattttaa ttttattaaa aaaaaaaaaa aaaaagaccg ggaattcgat 2760 atcaagctta tcgacctgca gatcgttcaa acatttggca ataaagtttc ttaagattga 2820 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 2880 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 2940 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 3000 tatcgcgcgc ggtgtcatct atgttactag attctagagt ctcaagcttc ggcgcgcc 3058

<210> S7 <211> 1719 <212> DNA <213> Artificial Sequence <220><223> Synthesized construct number 787 <400> 67 atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60 cagatcttcg ctgacacaat atgtataggc taccatgcta acaactcgac cgacactgtt 120 gacacagtac ttgaaaagaa tgtgacagtg acacactctg tcaacctgct tgagaacagt 180 cacaatggaa aactatgtct attaaaagga atagccccac tacaattggg taattgcagc 240 gttgccgggt ggatcttagg aaacccagaa tgcgaattac tgatttccaa ggagtcatgg 300 tcctacattg tagaaaaacc aaatcctgag aatggaacat gttacccagg gcatttcgct 360 gactatgagg aactgaggga gcaattgagt tcagtatctt catttgagag gttcgaaata 420 ttccccaaag aaagctcatg gcccaaccac accgtaaccg gagtgtcagc atcatgctcc 480 cataatgggg aaagcagttt ttacagaaat ttgctatggc tgacggggaa gaatggtttg 540 tacccaaacc tgagcaagtc ctatgcaaac aacaaagaaa aagaagtcct tgtactatgg 600 ggtgttcatc acccgccaaa cataggtgac caaaaggccc tctatcatac agaaaatgct 660 tatgtctctg tagtgtcttc acattatagc agaaaattca ccccagaaat agccaaaaga 720 cccaaagtaa gagatcaaga aggaagaatc aattactact ggactctgct tgaacccggg 780 gatacaataa tatttgaggc aaatggaaat ctaatagcgc caagatatgc tttcgcactg 840 agtagaggct t tggatcagg aatcatcaac tcaaatgcac caatggataa atgtgatgcg 900 aagtgccaaa cacctcaggg agctataaac agcagtcttc ctttccagaa cgtacaccca 960 gtcacaatag gagagtgtcc aaagtatgtc aggagtgcaa aattaaggat ggttacagga 1020 ctaaggaaca tcccatccat tcaatccaga ggtttgtttg gagccattgc cggtttcatt 1080 gaaggggggt ggactggaat ggtagatggt tggtatggtt atcatcatca gaatgagcaa 1140 ggatctggct atgctgcaga tcaaaaaagc acacaaaatg ccattaatgg gattacaaac 1200 aaggtcaatt ctgtaattga gaaaatgaac actcaattca cagcagtggg caaagagttc 1260 aacaaattgg aaagaaggat ggaaaacttg aataaaaaag ttgatgatgg gtttatagac 1320 atttggacat ataatgcaga actgttggtt ctactggaaa atgaaaggac tttggatttc 1380 catgactcca atgtgaagaa tctgtatgag aaagtaaaaa gccagttaaa gaataatgct 1440 aaagaaatag gaaatgggtg ttttgagttc tatcacaagt gtaacgatga atgcatggag 1500 agtgtaaaga atggaactta tgactatcca aaatattccg aagaatcaaa gttaaacagg 1560 gagaaaattg atggagtgaa attggaatca atgggagtct atcagattct ggcgatctac 1620 tcaacagtcg ccagttctct ggttcttttg gtctccctgg gggcaatcag cttctggatg 1680 tgttccaatg ggtctttac a gtgtagaata tgcatctaa 1719

<210> 68 <211> 3079 <212> DNA <213> Artificial Sequence <220><223> Synthesized Construct number 73% from Pad to Asel <400> 68 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cccaaatttg t cgggcccat ggcgaaaaac gttgcgattt tcggcttatt gttttctctt 900 cttgtgttgg ttccttctca gatcttcgct gacacaatat gtataggcta ccatgctaac 960 aactcgaccg acactgttga cacagtactt gaaaagaatg tgacagtgac acactctgtc 1020 aacctgcttg agaacagtca caatggaaaa ctatgtctat taaaaggaat agccccacta 1080 caattgggta attgcagcgt tgccgggtgg atcttaggaa acccagaatg cgaattactg 1140 atttccaagg agtcatggtc ctacattgta gaaaaaccaa atcctgagaa tggaacatgt 1200 tacccagggc atttcgctga ctatgaggaa ctgagggagc aattgagttc agtatcttca 1260 tttgagaggt tcgaaatatt ccccaaagaa agctcatggc ccaaccacac cgtaaccgga 1320 gtgtcagcat catgetceca taatggggaa agcagttttt acagaaattt gctatggctg 13Θ0 acggggaaga atggtttgta agcaagtcct atgcaaacaa caaagaaaaa cccaaacctg 1440 gaagtccttg tactatgggg tgttcatcac ccgccaaaca taggtgacca aaaggccctc 1500 164 tatcatacag aaaatgctta tgtctctgta gtgtcttcac attatagcag aaaattcacc 1560 ccagaaatag ccaaaagacc caaagtaaga gatcaagaag gaagaatcaa ttactactgg 1620 tttgaggcaa atggaaatct aatagcgcca 1680 actctgcttg aacccgggga tacaataata agatatgctt TCGC actgag tagaggcttt ggatcaggaa tcatcaactc aaatgcacca 1740 atggataaat gtgatgcgaa gtgccaaaca cctcagggag ctataaacag cagtcttcct 1800 ttccagaacg tacacccagt cacaatagga gagtgtccaa agtatgtcag gagtgcaaaa 1860 ttaaggatgg ttacaggact aaggaacatc ccatccattc aatccagagg tttgtttgga 1920 gccattgccg gtttcattga aggggggtgg actggaatgg tagatggttg gtatggttat 1980 catcatcaga atgagcaagg atctggctat gctgcagatc aaaaaagcac acaaaatgcc 2040 attaatggga ttacaaacaa ggtcaattct gtaattgaga aaatgaacac tcaattcaca 2100 gcagtgggca aagagttcaa caaattggaa agaaggatgg aaaacttgaa taaaaaagtt 2160 gatgatgggt ttatagacat ttggacatat aatgcagaac tgttggttct actggaaaat 2220 gaaaggactt tggatttcca tgactccaat gtgaagaatc tgtatgagaa agtaaaaagc 2280 cagttaaaga ataatgctaa agaaatagga aatgggtgtt ttgagttcta tcacaagtgt 2340 aacgatgaat gcatggagag tgtaaagaat ggaacttatg actatccaaa atattccgaa 2400 gaatcaaagt taaacaggga gaaaattgat ggagtgaaat tggaatcaat gggagtctat 2460 cagattctgg cgatctactc aacagtcgcc agttctctgg ttcttttggt ctccctgggg 2520 gcaatcagct tctggatgtg ttccaatggg tctttacagt gtagaatatg catctaaagg 2580 cctattttct ttagtttgaa tttactgtta ttcggtgtgc atttctatgt ttggtgagcg 2640 gttttctgtg ctcagagtgt gtttatttta tgtaatttaa tttctttgtg agctcctgtt 2700 tagcaggtcg tcccttcagc aaggacacaa aaagatttta attttattaa aaaaaaaaaa 2760 aaaaaagacc gggaattcga tatcaagctt atcgacctgc agatcgttca aacatttggc 2820 aataaagttt cttaagattg aatcctgttg ccggtcttgc gatgattatc atataatttc 2880 tgttgaatta cgttaagcat gtaataatta acatgtaatg catgacgtta tttatgagat 2940 gggtttttat gattagagtc ccgcaattat acatttaata cgcgatagaa aacaaaatat 3000 agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta gattctagag 3060 tctcaagctt cggcgcgcc 3079

<210> 69 <211> 3067 <212> DNA <21S> Artificial Sequence 166 <220><223> Synthesized Construct 734, from Paci to Asel <400> 69 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cccaaatttg t cgggcccat ggagaaaata gtgcttcttc ttgcaatagt cagtcttgtt 900 aaaagtgatc agatttgcat tggttaccat gcaaacaatt caacagagca ggttgacaca 960 atcatggaaa agaacgttac tgttacacat gcccaagaca tactggaaaa gacacacaac 1020 gggaagctct gcgatctaga tggagtgaag cctctaattt taagagattg tagtgtagct 1080 ggatggctcc tcgggaaccc aatgtgtgac gaattcatca atgtaccgga atggtcttac 1140 atagtggaga aggccaatcc aaccaatgac ctctgttacc cagggcattt cgctgactat 1200 gaggaactga gggagcaatt gagttcagta tcttcatttg agaggttcga aatattcccc 1260 aaagaaagct catggcccaa ccacaccgta accggagtgt cagcatcatg ctcccataat 1320 ggggaaagca gtttttacag aaatttgcta tggctgacgg ggaagaatgg tttgtaccca 1380 aacctgagca agtcctatgc aaacaacaaa gaaaaagaag tccttgtact atggggtgtt 1440 catcacccgc caaacatagg tgaccaaaag gccctctatc atacagaaaa tgcttatgtc 1500 tctgtagtgt cttcacatta tagcagaaaa ttcaccccag aaatagccaa aagacccaaa 1560 gtaagaqatc aagaaggaag aatcaattac tactggactc tgcttgaacc cggggataca 1620 ataatatttg aggcaaatgg aaatctaata gcgccaagat atgctttcgc actgagtaga 1680 ggctttggat caggaatta t gaaaagtgaa ttggaatatg gtaactgcaa caccaagtgt 1740 caaactccaa tgggggcgat aaactctagt atgccattcc acaacataca ccctctcacc 1800 atcggggaat gccccaaata tgtgaaatca aacagattag tccttgcaac agggctcaga 1860 aatagccctc aaagagagag cagaagaaaa aagagaggac tatttggagc tatagcaggt 1920 tttatagagg gaggatggca gggaatggta gatggttggt atgggtacca ccatagcaat 1980 gagcagggga gtgggtacgc tgcagacaaa gaatccactc aaaaggcaat agatggagtc 2040 accaataagg tcaactcaat cattgacaaa atgaacactc agtttgaggc cgttggaagg 2100 gaatttaata acttagaaag gagaatagag aatttaaaca agaagatgga agacgggttt 2160 ctagatgtct ggacttataa tgccgaactt ctggttctca tggaaaatga gagaactcta 2220 gactttcatg actcaaatgt taagaacctc tacgacaagg tccgactaca gcttagggat 2280 aatgcaaagg agctgggtaa cggttgtttc gagttctatc acaaatgtga taatgaatgt 2340 atggaaagta taagaaacgg aacgtacaac tatccgcagt attcagaaga agcaagatta 2400 aaaagagagg aaataagtgg ggtaaaattg gaatcaatag gaacttacca aatactgtca 2460 atttattcaa cagtggcgag ttccctagca ctggcaatca tgatggctgg tctatcttta 2520 tggatgtgct ccaatggatc GTTA caatgc agaatttgca tttaaaggcc tattttcttt 2580 agtttgaatt tactgttatt cggtgtgcat ttctatgttt ggtgagcggt tttctgtgct 2640 cagagtgtgt ttattttatg taatttaatt tctttgtgag ctcctgttta gcaggtcgtc 2700 ccttcagcaa ggacacaaaa agattttaat tttattaaaa aaaaaaaaaa aaaagaccgg 2760 gaattcgata tcaagcttat cgacctgcag atcgttcaaa catttggcaa taaagtttct 2820 taagattgaa tcctgttgcc ggtcttgcga tgattatcat ataatttctg ttgaattacg 2880 ttaagcatgt aataattaac atgtaatgca tgacgttatt tatgagatgg gtttttatga 2940 ttagagtccc gcaattatac atttaatacg cgatagaaaa caaaatatag cgcgcaaact 3000 aggataaatt atcgcgcgcg gtgtcatcta tgttactaga ttctagagtc tcaagcttcg 3060 gcgcgcc 3067

<210> 70 <211> 1791 <212> DNA <213> Artificial Sequence <220><223> Synthesized fragment Oral ll-Plasto (-84 + 1) -H3A / Brisbane / 10/07-Sacl <400> 70 cactttgtga gtctacactt tgattccctt caaacacata caaagagaag agactaatta 60 attaattaat catcttgaga gaaaatgaag actatcattg ctttgagcta cattctatgt 120 ctggttttca ctcaaaaact tcccggaaat gacaacagca cggcaacgct gtgccttggg 180 171 caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgacca aattgaagtt 240 actaatgcta ctgagctggt tcagagttcc tcaacaggtg aaatatgcga cagtcctcat 300 cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 360 gatggcttcc aaaataagaa atgggacctt tttgttgaac gcagcaaagc ctacagcaac 420 tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 480 acactggagt ttaacaatga aagtttcaat tggactggag tcactcaaaa cggaacaagc 540 tctgcttgca taaggagatc taataacagt ttctttagta gattgaattg gttgacccac 600 ttaaaattca aatacccagc attgaacgtg actatgccaa acaatgaaaa atttgacaaa 660 ttgtacattt ggggggttca ccacccgggt acggacaatg accaaatctt cctgtatgct 720 caagcatcag gaagaatcac agtctctacc aaaagaagcc aacaaactgt aatcccgaat 780 atcggatcta gacccagagt aaggaatatc cccagcagaa taagcatcta ttggacaata 840 gtaaaaccg g gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 900 tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 960 tgcaattctg aatgcatcac tccaaacgga agcattccca atgacaaacc attccaaaat 1020 gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaaacac tctgaaattg 1080 tgcgaaatgt accagagaaa caaactagag gcaacaggga gcatatttgg cgcaatcgcg 1140 ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtatggttt caggcatcaa 1200 aattctgagg gaataggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1260 atcaatggga agctgaatag aaaaccaacg agaaattcca tcagattgaa 1320 aaagagttct gttgatcggg cagaagtcga agggagaatc caggaccttg agaaatatgt tgaggacacc 1380 aaaatagatc tctggtcata caacgcggag cttcttgttg cectggagaa ccaacataca 1440 attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1500 gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1560 tgcataggat caatcagaaa tggaacttat gaccacgatg tatacagaga tgaagcatta 1620 aacaaccggt tccagatcaa gggcgttgag ctgaagtcag gatacaaaga ttggatacta 1680 tggatttcct ttgcca tatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1740 tgggcctgcc aaaaaggcaa cattaggtgc aacatttgca tttgagagct c 1791

<210> 71 <211> 3085 <212> DNA <213> Artificial Sequence <220><223> Synthesized Construct 736, from Paci to Asel <400> 71

I

I

I

I ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cccaaatttg tcgggccc at ggcgaaaaac gttgcgattt tcggcttatt gttttctctt 900 cttgtgttgg ttccttctca gatcttcgct caaaaacttc ccggaaatga caacagcacg 960 gcaacgctgt gccttgggca ccatgcagta ccaaacggaa cgatagtgaa aacaatcacg 1020 aatgaccaaa ttgaagttac taatgctact gagctggttc agagttcctc aacaggtgaa 1080 atatgcgaca gtcctcatca gatccttgat ggagaaaact gcacactaat agatgctcta 1140 ttgggagacc ctcagtgtga tggcttccaa aataagaaat gggacctttt tgttgaacgc 1200 agcaaagcct acagcaactg ttacccttat gatgtgccgg attatgcctc ccttaggtca 1260 ctagttgcct catccggcac actggagttt aacaatgaaa gtttcaattg gactggagtc 1320 actcaaaacg gaacaagctc tgcttgcata aggagatcta ataacagttt ctttagtaga 13.80 ttgaattggt tgacccactt aaaattcaaa tacccagcat tgaacgtgac tatgccaaac 1440 aatgaaaaat ttgacaaatt gtacatttgg ggggttcacc acccgggtac ggacaatgac 1500 caaatcttcc tgtatgctca agcatcagga agaatcacag tctctaccaa aagaagccaa 1560 caaactgtaa tcccgaatat cggatctaga cccagagtaa ggaatatccc cagcagaata 1620 agcatctatt ggacaatagt aaaaccggga gacatacttt tgattaacag cacagggaat 1680 ctaattgctc ctaggggtta CTTC aaaata cgaagtgggaaaagctcaat aatgagatca 1740 gatgcaccca ttggcaaatg caattctgaa tgcatcactc caaacggaag cattcccaat 1800 gacaaaccat tccaaaatgt aaacaggatc acatacgggg cctgtcccag atatgttaag 1860 caaaacactc tgaaattggc aacagggatg cgaaatgtac cagagaaaca aactagaggc 1920 1980 atatttggcg caatcgcggg tttcatagaa aatggttggg agggaatggt ggatggttgg tatggtttca ggcatcaaaa ttctgaggga ataggacaag cagcagatct caaaagcact 2040 caagcagcaa tcgatcaaat caatgggaag ctgaataggt tgatcgggaa aaccaacgag 2100 aaattccatc agattgaaaa agagttctca gaagtcgaag ggagaatcca ggaccttgag 2160 aaatatgttg aggacaccaa aatagatctc tggtcataca acgcggagct tcttgttgcc 2220 ctggagaacc aacatacaat tgatctaact gactcagaaa tgaacaaact gtttgaaaaa 2280 acaaagaagc aactgaggga aaatgctgag gatatgggca atggttgttt caaaatatac 2340 cacaaatgtg acaatgcctg cataggatca atcagaaatg gaacttatga ccacgatgta 2400 tacagagatg aagcattaaa caaccggttc cagatcaagg gcgttgagct gaagtcagga 2460 tacaaagatt ggatactatg gatttccttt gccatatcat gttttttgct ttgtgttgct 2520 ttgttggggt tcatcatgtg ggcctgccaa aaaggcaaca ttaggtgcaa catttgcatt 2580 tgaaggccta ttttctttag tttgaattta ctgttattcg gtgtgcattt ctatgtttgg 2640 tgagcggttt tctgtgctca gagtgtgttt attttatgta atttaatttc tttgtgagct 2700 cctgtttagc aggtcgtccc ttcagcaagg acacaaaaag attttaattt tattaaaaaa 2760 aaaaaaaaaa aagaccggga attcgatatc aagcttatcg acctgcagat cgttcaaaca 2820 tttggcaata aagtttctta agattgaatc ctgttgccgg tcttgcgatg attatcatat 2880 aatttctgtt gaattacgtt aagcatgtaa taattaacat gtaatgcatg acgttattta 2940 tgagatgggt ttttatgatt agagtcccgc aattatacat ttaatacgcg atagaaaaca 3000 aaatatagcg cgcaaactag gataaattat cgcgcgcggt gtcatctatg ttactagatt 3060 ctagagtctc aagcttcggc gcgcc 3085 <210> 72 <211> 3088

<212> DNA <213> Artificial Sequence <220><223> Synthesized Construct 737, from Pad to Asel <400> 72 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 840 cccaaatttg t cgggcccat ggcgaaaaac gttgcgattt tcggcttatt gttttctctt 900 cttgtgttgg ttccttctca gatcttcgct caaaaacttc ccggaaatga caacagcacg 960 gcaacgctgt gccttgggca ccatgcagta ccaaacggaa cgatagtgaa aacaatcacg 1020 aatgaccaaa ttgaagttac taatgctact gagctggttc agagttcctc aacaggtgaa 1080 atatgcgaca gtcctcatca gatccttgat ggagaaaact gcacactaat agatgctcta 1140 ttgggagacc ctcagtgtga tggcttccaa aataagaaat gggacctttt tgttgaacgc 1200 agcaaagcct acagcaactg ttacccttat gatgtgccgg attatgcctc ccttaggtca 1260 ctagttgcct catccggcac actggagttt aacaatgaaa gtttcaattg gactggagtc 1320 actcaaaacg gaacaagctc tgcttgcata aggagatcta ataacagttt ctttagtaga 1380 ttgaattggt tgacccactt aaaattcaaa tacccagcat tgaacgtgac tatgccaaac 1440 aatgaaaaat ttgacaaatt gtacatttgg ggggttcacc acccgggtac ggacaatgac 1500 caaatcttcc tgtatgctca agcatcagga agaatcacag tctctaccaa aagaagccaa 1560 caaactgtaa tcccgaatat cggatctaga cccagagtaa ggaatatccc cagcagaata 1620 agcatctatt ggacaatagt aaaaccggga gacatacttt tgattaacag cacagggaat 1680 ctaattgctc ctaggggtt the cttcaaaata cgaagtggga aaagctcaat aatgagatca 1740 gatgcaccca ttggcaaatg caattctgaa tgcatcactc caaacggaag cattcccaat 1800 gacaaaccat tccaaaatgt aaacaggatc acatacgggg cctgtcccag atatgttaag 1860 caaaacactc tgaaattggc aacagggatg cgaaatgtac cagagaaaca aactagagqc 1920 atatttggcg caatcgcggg tttcatagaa aatggttggg agggaatggt ggatggttgg 1980 tatggtttca ggcatcaaaa ttctgaggga ataggacaag cagcagatct caaaagcact 2040 caagcagcaa tcgatcaaat caatgggaag ctgaataggt tgatcgggaa aaccaacgag 2100 aaattccatc agattgaaaa agagttctca gaagtcgaag ggagaatcca ggaccttgag 2160 aaatatgttg aggacaccaa aatagatctc tggtcataca acgcggagct tcttgttgcc 2220 ctggagaacc aacatacaat tgatctaact gactcagaaa tgaacaaact gtttgaaaaa 2280 acaaagaagc aactgaggga aaatgctgag gatatgggca atggttgttt caaaatatac 2340 cacaaatgtg acaatgcctg cataggatca atcagaaatg gaacttatga ccacgatgta 2400 tacagagatg aagcattaaa caaccggttc cagatcaagg gcgttgagct gaagtcaata 2460 ggaacttacc aaatactgtc aatttattca acagtggcga gttccctagc actggcaatc 2520 atgatggctg gtctatcttt atgg atgtgc tccaatggat cgttacaatg cagaatttgc 2580 atttaaaggc ctattttctt tagtttgaat ttactgttat tcggtgtgca tttctatgtt 2640 tggtgagcgg ttttctgtgc tcagagtgtg tttattttat gtaatttaat ttctttgtga 2700 gctcctgttt agcaggtcgt cccttcagca aggacacaaa aagattttaa ttttattaaa 2760 aaaaaaaaaa aaaaagaccg ggaattcgat atcaagctta tcgacctgca gatcgttcaa 2820 acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg atgattatca 2880 tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc atgacgttat 2940 ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac gcgatagaaa 3000 acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag 3060 attctagagt ctcaagcttc ggcgcgcc 3088

<210> 73 <211> 1845 <212> DNA <213> Artificial Sequence <220><223> Synthesized fragment Oral ll-P1asto {-84+ 1} -HA B / Florlda / 4/06-Sad <400 »73 cactttgtga gtctacactt tgattccctt caaacacata caaagagaag agactaatta 60 attaattaat catcttgaga gaaaatgaag gcaataattg tactactcat ggtagtaaca 120 tccaatgcag atcgaatctg cactggaata acatcttcaa actcacctca tgtggtcaaa 180 acagccactc aaggggaggt caatgtgact ggtgtgatac cactaacaac aacaccaaca 240 aaatcttatt ttgcaaatct caaaggaaca aggaccagag ggaaactatg cccagactgt 300 ctcaactgca cagatctgga tgtggctttg ggcagaccaa tgtgtgtggg gaccacacct 360 tcggcgaagg cttcaatact ccacgaagtc aaacctgtta catccgggtg ctttcctata 420 atgcacgaca gaacaaaaat caggcaacta cccaatcttc tcagaggata tgaaaatatc 480 aggctatcaa cccaaaacgt catcgatgcg gaaaaggcac caggaggacc ctacagactt 540 ggaacctcag gatcttgccc taacgctacc agtaagagcg gatttttcgc aacaatggct 600 tgggctgtcc caaaggacaa caacaaaaat gcaacgaacc cactaacagt agaagtacca 660 tacatttgta cagaagggga agaccaaatc actgtttggg ggttccattc agataacaaa 720 acccaaatga agaacctcta tggagactca aatcctcaaa agttcacctc atctgctaat 780 ggagtaacca cacactatgt ttctcagatt ggcagcttcc cagatcaaac agaagacgga 840 ggactaccac aaagcggcag gattgttgtt gattacatga tgcaaaaacc tgggaaaaca 900 ggaacaattg tctaccaaag aggtgttttg ttgcctcaaa aggtgtggtg cgcgagtggc 960 aggagcaaag taataaaagg gtccttgcct ttaattggtg aagcagattg ccttcatgaa 1020 aaatacggtg gattaaacaa aagcaagcct tactacacag gagaacatgc aaaagccata 1080 ggaaattgcc caatatgggt gaaaacacct ttgaagctcg ccaatggaac caaatataga 1140 cctcctgcaa aactattaaa ggaaaggggt ttcttcggag ctattgctgg tttcctagaa 1200 ggaggatggg aaggaatgat tgcaggctgg cacggataca catctcacgg agcacatgga 1260 gtggcagtgg cggcggacct taagagtacg caagaagcta taaacaagat aacaaaaaat 1320 ctcaattctt tgagtgagct agaagtaaag aatcttcaaa gactaagtgg tgccatggat 1380 gaactccaca acgaaatact cgagctggat gagaaagtgg atgatctcag agctgacact 1440 ataagctcgc aaatagaact tgcagtcttg ctttccaacg aaggaataat aaacagtgaa 1500 gatgagcatc tattggcact tgagagaaaa ctaaagaaaa tgctgggtcc ctctgctgta 1560 gagataggaa atggatgctt cgaaaccaaa cacaagtgca accagacctg cttagacagg 1620 atagctgctg gcacctttaa tgcaggagaa ttttctctcc ccacttttga ttcactgaac 1680 attactgctg catcttta aa tgatgatgga ttggataacc atactatact gctctattac 1740 tcaactgctg cttctagttt ggctgtaaca ttgatgctag ctatttttat tgtttatatg 1800 gtctccagag acaacgtttc atgctccatc tgtctataag agctc 1845

<210> 74 <211> 3142 <212> DNA <213> Artificial Sequence <220><223> Synthesized Construct 739, from Pad to Asel <400> 74 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgc: g gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg gg2aacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg tt2agcttct gtatattctg 840 cccaaatttg tcgggcccat ggcgaaaaac gttgcgattt tcggcttatt gttttctctt 900 cttgtgttgg ttccttctca gatcttcgct gatcgaatct gcactggaat aacatcttca 960 aactcacctc atgtggtcaa aacagccact caaggggagg tcaatgtgac tggtgtgata 1020 ccactaacaa caacaccaac aaaatcttat tttgcaaatc tcaaaggaac aaggaccaga 1080 gggaaactat gcccagactg tctcaactgc acagatctgg atgtggcttt gggcagacca 1140 atgtgtgtgg ggaccacacc ttcggcgaag gcttcaatac tccacgaagt caaacctgtt 1200 acatccgggt gctttcctat aatgcacgac agaacaaaaa tcaggcaact acccaatctt 1260 ctcagaggat atgaaaatat caggctatca acccaaaacg tcatcgatgc ggaaaaggca 1320 ccaggaggac cctacagact tggaacctca ggatcttgcc ctaacgctac cag - 1380 :: aagagc ggatttttcg caacaatggc ttgggctgtc ccaaaggaca acaacaaaaa tgcaacgaac 1440 ccactaacag tagaagtacc atacatttgt acagaagggg aagaccaaat cactgtttgg 1500 gggttccatt cagataacaa aacccaaatg aagaaectct atggagactc aaatcctcaa 1560 aagttcacct catctgctaa tggagtaacc acacactatg tttctcagat tggcagcttc 1620 ccagatcaaa cagaagacgg aggactacca caaagcggca ggattgttgt tgattacatg 1680 atgcaaaaac ctggga AAAC aggaacaatt gtctaccaaa gaggtgtttt gttgcctcaa 1740 aaggtgtggt gcgcgagtgg caggagcaaa gtaataaaag ggtccttgcc tttaattggt 1800 gaagcagatt gccttcatga aaaatacggt ggattaaaca aaagcaagcc ttactacaca 1860 ggagaacatg caaaagccat aggaaattgc ccaatatggg tgaaaacacc tttgaagctc 1920 qccaatgqaa ccaaatatag acctcctgca aaactattaa aggaaagggg tttcttcgga 1980 gctattgctg gtttcc - :: aga aggaggatgg gaaggaatga ttgcaggctg gcacggatac 2040 acatctcacg gagcacatgg agtggcagtg gcggcggacc ttaagagtac gcaagaagct 2100 ataaacaaga taacaaaaaa tctcaattct ttgagtgagc tagaagtaaa gaatcttcaa 2160 agactaagtg gtgccatgga tgaactccac aacgaaatac tcgagctgga tgagaaagtg 2220 gatgatctca gagctgacac tataagctcg caaatagaac ttgcagtctt gctttccaac 2280 gaaggaataa taaacagtga agatgagcat ctattggcac ttgagagaaa actaaagaaa 2340 atgctgggtc cctctgctgt agagatagga aatggatgct tcgaaaccaa acacaagtgc 2400 aaccagacct gcttagacag gatagctgct ggcaccttta atgcaggaga attttctctc 2460 cccacttttg attcactgaa cattactgct gcatctttaa atgatgatgg attggataac 2520 catactatac tgctctatta ctcaactgct gcttctagtt tggctgtaac attgatgcta 2580 gctattttta ttgtttatat ggtctccaga gacaacgttt catgctccat ctgtctataa 2640 aggcctattt tctttagttt gaatttactg ttattcggtg tgcatttcta tgtttggtga 2700 gcggttttct gtgctcagag tgtgtttatt ttatgtaatt taatttcttt gtgagctcct 2760 gtttagcagg tcgtcccttc agcaaggaca caaaaagatt ttaattttat taaaaaaaaa 2820 aaaaaaaaag accgggaatt cgatatcaag cttatcgacc tgcagatcgt tcaaacattt 2880 ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt atcatataat 2940 ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga 3000 gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata gaaaacaaaa 3060 tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagattcta 3120 gagtctcaag cttcggcgcg cc 3142

<210> 75 <211> 3142 <212> DNA <213> Artificial Sequence <220><223> Construct 745, from Peel to Asel <400> 75 ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc ccagctatct 60 gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 120 ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 180 cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 240 attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 300 acccttcctc tatataagga agttcatttc atttggagag gtattaaaat cttaataggt 360 tttgataaaa gcgaacgtgg ggaaacccga accaaacctt cttctaaact ctctctcatc 420 tctcttaaag caaacttctc tcttgtcttt cttgcgtgag cgatcttcaa cgttgtcaga 480 tcgtgcttcg gcaccagtac aacgttttct ttcactgaag cgaaatcaaa gatctctttg 540 tggacacgta gtgcggcgcc attaaataac gtgtacttgt cctattcttg tcggtgtggt 600 cttgggaaaa gaaagcttgc tggaggctgc tgttcagccc catacattac ttgttacgat 660 tctgctgact ttcggcgggt gcaatatctc tacttctgct tgacgaggta ttgttgcctg 720 tacttctttc ttcttcttct tgctgattgg ttctataaga aatctagtat tttctttgaa 780 acagagtttt cccgtggttt tcgaacttgg agaaagattg ttaagcttct gtatattctg 84 0 cccaaatttg tcgggcccat ggcgaaaaac gttgcgattt tcggcttatt gttttctctt 900 cttgtgttgg ttccttctca gatcttcgct gatcgaatct gcactggaat aacatcttca 960 aactcacctc atgtggtcaa aacagccact caaggggagg tcaatgtgac tggtgtgata 1020 ccactaacaa caacaccaac aaaatcttat tttgcaaatc tcaaaggaac aaggaccaga 1080 gggaaactat gcccagactg tctcaactgc acagatctgg atgtggcttt gggcagacca 1140 atgtgtgtgg ggaccacacc ttcggcgaag gcttcaatac tccacgaagt caaacctgtt 1200 acatccgggt gctttcctat aatgcacgac agaacaaaaa tcaggcaact acccaatctt 1260 ctcagaggat atgaaaatat caggctatca acccaaaacg tcatcgatgc ggaaaaggca 1320 ccaggaggac cctacagact tggaacctca ggatcttgcc ctaacgctac cagtaagagc 1380 ggatttttcg caacaatggc ttgggctgtc ccaaaggaca acaacaaaaa tgcaacgaac 1440 ccactaacag tagaagtacc atacatttgt acagaagggg aagaccaaat cactgtttgg 1500 gggttccatt cagataacaa aacccaaatg aagaacctct atggagactc aaatcctcaa 1560 aagttcacct catctgctaa tggagtaacc acacactatg tttctcagat tggcagcttc 1620 ccagatcaaa cagaagacgg aggactacca caaagcggca ggattgttgt tgattacatg 1680 atgcaaaaac ctgggaaa ac aggaacaatt gtctaccaaa gaggtgtttt gttgcctcaa 1740 aaggtgtggt gcgcgagtgg caggagcaaa gtaataaaag ggtccttgcc tttaattggt 1800 gaagcagatt gccttcatga aaaatacggt ggattaaaca aaagcaagcc ttactacaca 1860 ggagaacatg caaaagccat aggaaattgc ccaatatggg tgaaaacacc tttgaagctc 1920 gccaatggaa ccaaatatag acctcctgca aaactattaa aggaaagggg tttcttcgga 1980 gctattgctg gtttcctaga aggaggatgg gaaggaatga ttgcaggctg gcacggatac 2040 acatctcacg gagcacatgg agtggcagtg gcggcggacc ttaagagtac gcaagaagct 2100 ataaacaaga taacaaaaaa tctcaattct ttgagtgagc tagaagtaaa gaatcttcaa 2160 aqactaaqtq qtgccatqqa tqaactccac aacgaaatac tcgagctgga tgagaaagtg 2220 gatgatctca gagctgacac tataagctcg caaatagaac ttgcagtctt gctttccaac 2280 gaaggaataa taaacagtga agatgagcat ctattggcac ttgagagaaa actaaagaaa 2340 atgctgggtc cctctgctgt agagatagga aatggatgct tcgaaaccaa acacaagtgc 2400 aaccagacct gcttagacag gatagctgct ggcaccttta atgcaggaga attttctctc 2460 cccacttttg attcactgaa cattactgct gcatctttaa atgatgatgg attggataac 2520 taccaaatac tgtcaattta ttc aacagtg gcgagttccc tagcactggc aatcatgatg 2580 gctggtctat ctttatggat gtgctccaat ggatcgttac aatgcagaat ttgcatttaa 2640 aggcctattt tctttagttt gaatttactg ttattcggtg tgcatttcta tgtttggtga 2700 gcggttttct gtgctcagag tgtgtttatt ttatgtaatt taatttcttt gtgagctcct 2760 gtttagcagg tcgtcccttc agcaaggaca caaaaagatt ttaattttat taaaaaaaaa 2820 aaaaaaaaag accgggaatt cgatatcaag cttatcgacc tgcagatcgt tcaaacattt 2880 ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt atcatataat 2940 ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga 3000 gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata gaaaacaaaa 3060 tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagattcta 3120 gagtctcaag cttcggcgcg cc 3142

<210> 76 <211> 1272 <212> DNA <213> Artificial Sequence <220><223> Synthesized MsJI coding sequence <400> 76 atgtttgggc gcggaccaac aaggaagagt gataacacca aatattacga tattcttggt 60 gtttcaaaaa gtgctagtga agatgaaatc aagaaagcct atagaaaggc agcgatgaag 120 aaccatccag ataagggtgg ggatcctgag aagttcaagg agttgggcca agcatatgaa 180 gtgttgagcg atcctgaaaa gaaagaactg tatgatcaat atggtgaaga tgcccttaaa 240 gaaggaatgg ggggaggcgc aggaagctca tttcataatc cgtttgatat tttcgaatca 300 ttttttggtg caggctttgg tggtggtggt ccttcacgcg caagaagaca gaagcaagga 360 gaagatgtgg tgcattctat aaaggtttcc ttggaggatg tgtataacgg cactacaaag 420 aagctatcac tttctaggaa tgcactgtgc tcaaaatgta aagggaaagg ttcaaaaagt 480 ggaactgctg gaaggtgttt tggatgccag ggcacaggta tgaagattac cagaaggcaa 540 attggactgg gcatgattca acaaatgcaa cacgtctgtc ctgactgcaa aggaacaggc 600 gaggtcatta gtgagagaga tagatgccct caatgcaagg gaaacaagat tactcaagaa 660 aagaaggtgc tggaggtgca tgtggaaaag gggatgcagc agggtcacaa gattgtattc 720 gaaggacaag ctgatgaagc tcctgataca atcacaggag acatagtttt tgtcttgcaa 780 gtaaagggac atccgaagtt tcggagggag cgtgatgacc tccacattga acacaatttg 840 agcttaactg a ggctctctg tggcttccag tttaatgtca cacatcttga tggaaggcaa 900 ctattggtca aatcgaaccc cggcgaagtc atcaagccag gtcaacataa agctataaat 960 gatgagggaa tgccacaaca tggtaggccg ttcatgaagg gacgcctata catcaagttt 1020 agtgttgatt tcccggattc gggttttctt tccccaagcc aaagcctgga attagaaaag 1080 atattacctc aaaagacaag caagaacttg tcccaaaagg aggtagatga ttgtgaggag 1140 accaccctgc atgatgtcaa tattgcagag gagatgagtc gaaagaagca acaataccgt 1200 gaggcatatg atgacgatga tgatgaagat gatgagcact cgcagcctcg ggtgcaatgc 1260 gctcaacagt g 1272

<210> 77 <211> 4402 <212> DNA <213 »Artificial Sequence <220><223> Synthesized Construct number RS50, from Hlndlll <400> 77 aagcttgcat gcctgcaggt cgactctaga ggatccccgg gctggtctgt acattcatct 60 tgccgccttt gcattcactt ggccacaaag agtagagaga aggaagagaa gagcccagac 120 ttcaagaagc gaccttgcaa gtgcactcga gggtcagaaa ctgtatatca tatctatgtg 180 agagaaaggg gaacatttga gatggagtcc atttacttga ggtatactta ttattttgat 240 caataaattt gtatacttct tatttagatc aataaatttg tcattaagct ataatccaaa 300 ataaattacg atcaaatatg caaatgttag ccagtacttg tgttaaactt gatggcatct 360 cttggtttct ttggcaatca catgcctaag aaataaatag tatcatatga ttgtgtttgg 420 tcagacttca gagtcagatg actctgtttg gataaacagc ttaattaagc gcttatagaa 480 tatcatatga ttgtgtttgg tcagacttca gagcatctct tggtttctct ggcaatcata 540 tgcctaagaa ataaatagta tcatatgatt gtgtttggtc agacttcaga gtcagatgac 600 cctgtttggg taaacagctt aattaagtgc ttatagaata agcgcttatc atataagtgc 660 ttttgtacag ttatttctat gaaagtagaa gaaatagtca tattgtttta atataagcta 720 tcctggagag cttgtggaaa taaccagaaa agaacttatg gacacgtcat gagctgttta 780 cataagatct ccctaacagt ctcaaaagtg tttatgccag tagataaatt caaataagtc 840 aatctaaaca g accctaaat ccattatggt acctatcatt ttagcttatt ccatctttat 900 taagaatgtc atgagataac ataatgataa cacattattt tgacacaaat gggcagatct 960 agcaatttaa ctctggagtc cttcaagact gctgttctta cgaagttcac gtccctgaat 1020 catgttcctg tatggaagcc tgaaagacct caaattctaa aaggtggcga taaattgaag 1080 gtttacaaaa tataccctgc gggcttgaca cagaggcaag ctctttatac cttccagttc 1140 aacggggatg ttgatttcag aagtcacttg gagagcaatc cttgtgccaa gtttgaagta 1200 atttttgtgt agcatatgtt gagctaccta caatttacat gatcacctag cattagctct 1260 ttcacttaac tgagagaatg aagttttagg aatgagtatg accatggagt cggcatggct 1320 ttgtaatgcc taccctactt tggccaactc atcggggatt tacattcaga aaatatacat 1380 gacttcaacc atacttaaac ccctttttgt aagataactg aatgttcata tttaatgttg 1440 ggttgtagtg tttttacttg attatatcca gacagttaca agttggacaa caagattgtg 1500 ggtctgtact gttatttatt tatttttttt ttagcagaaa caccttatct tttgtttcgt 1560 ttgaatgtag aatgaaaata aaagaaagaa aatataacat catcggccgc gcttgtctaa 1620 tttcgggcag ttaggatcct ctccggtcac cggaaagttt cagtagaaga aacaaaacac 1680 cgtgactaaa atgatacta t tattttattt attgtgtttt tcttttttct accggaactt 1740 tttagaacgg atcccaactc gttccggggc cgctacaact gaaacaaaag aagatatttt 1800 ctctctcttc agaaatgtaa gttttccttt acagataccc attcaccatt tgattcagat 1860 gtggtgacta gagataaagc atactaattt gactcttgga aacccataaa gtttatgtta 1920 tccgtgttct ggaccaatcc acttgggggc ataacctgtg tctatgtgtg gtttggtttc 1980 :::: attctgatt tatg :::: ggcga cttgtaattt aaaatctagg aggggcagac attgaacaat 2040 cccaatattt taataactta tgcaagattt tttttattaa tgagatgatg tgtttgtgac 2100 tgagattgag tcatacattt cactaagaaa tggttccaag taccaaacta tcatgaccca 2160 gttgcaaaca tgacgttcgg gagtggtcac tttgatagtt caatttcatc ttggcttctt 2220 attcctttta taattctaat tcttcttgtg taaactattt catgtattat ttttctttaa 2280 aatttacatg tcatttattt tgcctcacta actcaatttt gcatataaca atgataagtg 2340 atattttgac tcacaaaatt tacatcaaat ttcgacatcg tttattatgt tcattggatg 2400 attaacaaat ataacaaact ttgcaactaa ttaaccacca actgaatata attaactata 2460 actgtgaaag tagttaactc atttttatat ttcatagatc aaataagaga aataacggta 2520 tattaatccc tccaaaaa aa aaaaacggta tatttactaa aaaatctaag ccacgtagga 2580 ggataacagg atccccgtag gaggataaca tccaatccaa ccaatcacaa caatcctgat 2640 gagataaccc actttaagcc cacgcatctg tggcacatct acattatcta aatcacacat 2700 tcttccacac atctgagcca cacaaaaacc aatccacatc tttatcaccc attctataaa 2760 aaatcacact ttgtgagtct acactttgat tcccttcaaa cacatacaaa gagaagagac 2820 taattaatta attaatcatc ttgagagaaa atgtttgggc gcggaccaac aaggaagagt 2880 gataacacca aatattacga tattcttggt gtttcaaaaa gtgctagtga agatgaaatc 2940 aagaaagcct atagaaaggc agcgatgaag aaccatccag ataagggtgg ggatcctgag 3000 aagttcaagg agttgggcca agcatatgaa gtgttgagcg atcctgaaaa gaaagaactg 3060 tatgatcaat atggtgaaga tgcccttaaa gaaggaatgg ggggaggcgc aggaagctca 3120 tttcataatc cgtttgatat tttcgaatca ttttttggtg caggctttgg tggtggtggt 3180 ccttcacgcg caagaagaca gaagcaagga gaagatgtgg tgcattctat aaaggtttcc 3240 ttggaggatg tgtataacgg cactacaaag aagctatcac tttctaggaa tgcactgtgc 3300 tcaaaatgta aagggaaagg ttcaaaaagt ggaactgctg gaaggtgttt tggatgccag 3360 ggcacaggta tgaagattac cag aaggcaa attggactgg gcatgattca acaaatgcaa 3420 cacgtctgtc ctgactgcaa aggaacaggc gaggtcatta gtgagagaga tagatgccct 3480 caatgcaagg gaaacaagat tactcaagaa aagaaggtgc tggaggtgca tgtggaaaag 3540 gggatgcagc agggtcacaa gattgtattc gaaggacaag ctgatgaagc tcctgataca 3600 atcacaggag acatagtttt tgtcttgcaa gtaaagggac atccgaagtt tcggagggag 3660 cgtgatgacc tccacattga acacaatttg agcttaactg aggctctctg tggcttccag 3720 tttaatgtca cacatcttga tggaaggcaa ctattggtca aatcgaaccc cggcgaagtc 3780 atcaagccag gtcaacataa agctataaat gatgagggaa tgccacaaca tggtaggccg 3840 ttcatgaagg gacgcctata catcaagttt agtgttgatt tcccggattc gggttttctt 3900 tccccaagcc aaagcctgga attagaaaag atattacctc aaaagacaag caagaacttg 3960 tcccaaaagg aggtagatga ttgtgaggag accaccctgc atgatgtcaa tattgcagag 4020 gagatgagtc gaaagaagca acaataccgt gaggcatatg atgacgatga tgatgaagat 4080 gatgagcact cgcagcctcg ggtgcaatgc gctcaacagt aggagctcag ctcgaatttc 4140 cccgatcgtt caaacatttg gcaataaagt ttcttaagat tgaatcctgt tgccggtctt 4200 gcgatgatta tcatataatt tctgttgaa t tacgttaagc atgtaataat taacatgtaa 4260 tgcatgacgt tatttatgag atgggttttt atgattagag tcccgcaatt atacatttaa 4320 tacgcgatag aaaacaaaat atagcgcgca aactaggata aattatcgcg cgcggtgtca 4380 tctatgttac tagatcgaat tc 4402 <210> 78

<211> 5086 <212> DNA <213> Artificial Sequence <220><223> Synthesized Construct number R860, from Hindlll to EcoRI <400> 78 aagcttgcat gcctgcaggt cgactctaga ggatccccgg gctggtctgt acattcatct 60 tgccgccttt gcattcactt ggccacaaag agtagagaga aggaagagaa gagcccagac 120 ttcaagaagc gaccttgcaa gtgcactcga gggtcagaaa ctgtatatca tatctatgtg 180 agagaaaggg gaacatttga gatggagtcc atttacttga ggtatactta ttattttgat 240 caataaattt gtatacttct tatttagatc aataaatttg tcattaagct ataatccaaa 300 ataaattacg atcaaatatg caaatgttag ccagtacttg tgttaaactt gatggcatct 360 cttggtttct ttggcaatca catgcctaag aaataaatag tatcatatga ttgtgtttgg 420 tcagacttca gagtcagatg actctgtttg gataaacagc ttaattaagc gcttatagaa 480 tatcatatga ttgtgtttgg tcagacttca gagcatctct tggtttctct ggcaatcata 540 tgcctaagaa ataaatagta tcatatgatt gtgtttggtc agacttcaga gtcagatgac 600 cctgtttggg taaacagctt aattaagtgc ttatagaata agcgcttatc atataagtgc 660 ttttgtacag ttatttctat gaaagtagaa gaaatagtca tattgtttta atataagcta 720 tcctggagag cttgtggaaa taaccagaaa agaacttatg gacacgtcat gagctgttta 780 cataagatct ccctaacagt ctcaaaagtg tttatgccag tagataaatt caaataagtc 840 aatctaaaca g accctaaat ccattatggt acctatcatt ttagcttatt ccatctttat 900 taagaatgtc atgagataac ataatgataa cacattattt tgacacaaat gggcagatct 960 agcaatttaa ctctggagtc cttcaagact gctgttctta cgaagttcac gtccctgaat 1020 catgttcctg tatggaagcc tgaaagacct caaattctaa aaggtggcga taaattgaag 1080 gtttacaaaa tataccctgc gggcttgaca cagaggcaag ctctttatac cttccagttc 1140 aacggggatg ttgatttcag aagtcacttg gagagcaatc cttgtgccaa gtttgaagta 1200 atttttgtgt agcatatgtt gagctaccta caatttacat gatcacctag cattagctct 1260 ttcacttaac tgagagaatg aagttttagg aatgagtatg accatggagt cggcatggct 1320 ttgtaatgcc taccctactt tggccaactc atcggggatt tacattcaga aaatatacat 1380 gacttcaacc atacttaaac ccctttttgt aagataactg aatgttcata tttaatgttg 1440 ggttgtagtg tttttacttg attatatcca gacagttaca agttggacaa caagattgtg 1500 ggtctgtact gttatttatt tatttttttt ttagcagaaa caccttatct tttgtttcgt 1560 ttgaatgtag aatgaaaata aaagaaagaa aatataacat catcggccgc gcttgtctaa 1620 tttcgggcag ttaggatcct ctccggtcac cggaaagttt cagtagaaga aacaaaacac 1680 cgtgactaaa atgatacta t tattttattt attgtgtttt tcttttttct accggaactt 1740 tttagaacgg atcccaactc gttccggggc cgctacaact gaaacaaaag aagatatttt 1800 ctctctcttc agaaatgtaa gttttccttt acagataccc attcaccatt tgattcagat 1860 gtggtgacta gagataaagc atactaattt gactcttgga aacccataaa gtttatgtta 1920 tccgtgttct ggaccaatcc acttgggggc ataacctgtg tctatgtgtg gtttggtttc 1980 cattctgatt tatgcggcga cttgtaattt aaaatctagg aggggcagac attgaacaat 2040 cccaatattt taataactta tgcaagattt tttttattaa tgagatgatg tgtttgtgac 2100 tgagattgag tcatacattt cactaagaaa tggttccaag taccaaacta tcatgaccca 2160 gttgcaaaca tgacgttcgg gagtggtcac tttgatagtt caatttcatc ttggcttctt 2220 attcctttta taattctaat tcttcttgtg taaactattt catgtattat ttttctttaa 2280 aatttacatg tcatttattt tgcctcacta actcaatttt gcatataaca atgataagtg 2340 atattttgac tcacaaaatt tacatcaaat ttcgacatcg tttattatgt tcattggatg 2400 attaacaaat ataacaaact ttgcaactaa ttaaccacca actgaatata attaactata 2460 actgtgaaag tagttaactc atttttatat ttcatagatc aaataagaga aataacggta 2520 tattaatccc tccaaaaaaa yyyy acggta tatttactaa aaaatctaag ccacgtagga 2580 ggataacagg atccccgtag gaggataaca tccaatccaa ccaatcacaa caatcctgat 2640 gagataaccc actttaagcc cacgcatctg tggcacatct acattatcta aatcacacat 2ΊΟΟ tcttccacac atctgagcca cacaaaaacc aatccacatc tttatcaccc attctataaa 2760 aaatcacact ttgtgagtct acactttgat tcccttcaaa cacatacaaa gagaagagac 2820 taattaatta attaatcatc ttgagagaaa atgtcgggta aaggagaagg accagctatc 2880 ggtatcgatc ttggtaccac ttactcttgc gtcggagtat ggcaacacga ccgtgttgag 2940 atcattgcta atgatcaagg aaacagaacc acgccatctt acgttgcttt caccgactcc 3000 gagaggttga teggtgacgc agctaagaat eaggtcgcca tgaaccccgt taacaccgtt 3060 ttcgacgcta agaggttgat cggtcgtcgt ttctctgaca getctgttca gagtgaeatg 3120 aaattgtggc cattcaagat tcaagccgga cctgccgata agccaatgat ctacgtcgaa 3180 tacaagggtg aagagaaaga gttegcagct gagge.gattt ctteeatggt tcttattaag 3240 atgcgtgaga ttgctgaggc ttaccttggt gtcacaatca agaacgccgt tgttaccgtt 3300 ccagcttact tcaacgactc tcagcgtcag gctacaaagg atgctggtgt catcgctggt 3360 ttgaacgtta tgcgaatcat caacga gcct acagccgccg ctattgccta cggtcttgac 3420 aaaaaggcta ccagcgttgg agagaagaat gttcttatct tcgatcttgg tggtggcact 3480 ΟΩΔ. tttgatgtct ctcttcttac cattgaagag ggtatctttg aggtgaaggc aactgctggt 3540 gacacccatc ttggtgggga agattttgac aacagaatgg ttaaccactt tgtccaagag 3600 ttcaagagga agagtaagaa ggatatcacc ggtaacccaa gagctcttag gaggttgaga 3660 acttcctgtg agagagcgaa gaggactctt tcttccactg ctcagaccac catcgagatt 3720 gactctctat acgagggtat cgacttctac tccaccatca cccgtgctag atttgaggag 3780 ctcaacatgg atctcttcag gaagtgtatg gagccagttg agaagtgtct tcgtgatgct 3840 aagatggaca agagcactgt tcatgatgtt gtccttgttg gtggttctac ccgtatccct 3900 aaggttcagc aattgctcca ggacttcttc aacggcaaag agctttgcaa gtctattaac 3960 cctgatgagg ctgttgccta cggtgctgct gtccagggag ctattctcag cggtgaagga 4020 aacgagaagg ttcaagatct tctattgctc gatgtcactc ctctctccct tggtttggaa 4080 actgccggtg gtgtcatgac cactttgatc ccaaggaaca caaccatccc aaccaagaag 4140 gaacaagtct tctccaccta ctcagacaac caacccggtg tgttgatcca ggtgtacgaa 4200 ggagagagag ccagaaccaa ggacaacaac cttcttggta aatttgagct ctccggaatt 4260 cctccagctc ctcgtggtgt cccccagatc acagtctgct ttgacattga tgccaatggt 4320 atcctc AATG tctctgctga ggacaagacc accggacaga agaacaagat caccatcacc 4380 aatgacaagg gtcgtctctc caaggatgag attgagaaga tggttcaaga ggctgagaag 4440 tacaagtccg aagacgagga gcacaagaag aaggttgaag ccaagaacgc tctcgagaac 4500 tacgcttaca acatgaggaa caccatccaa gacgagaaga ttggtgagaa gctcccggct 4560 gcagacaaga agaagatcga ggattctatt gagcaggcga ttcaatggct cgagggtaac 4620 cagttggctg aggctgatga gttcgaagac aagatgaagg aattggagag catctgcaac 4680 ccaatcattg ccaagatgta ccaaggagct ggtggtgaag ccggtggtcc aggtgcctct 4740 ggtatggacg atgatgctcc ccctgcttca ggcggtgctg gacctaagat cgaggaggtc 4800 gactaagagc tcagctcgaa tttccccgat cgttcaaaca tttggcaata aagtttctta 4860 agattgaatc ctgttgccgg tcttgcgatg attatcatat aatttctgtt gaattacgtt 4920 aagcatgtaa taattaacat gtaatgcatg acgttattta tgagatgggt ttttatgatt 4980 agagtcccgc aattatacat ttaatacgcg atagaaaaca aaatatagcg cgcaaactag 5040 gataaattat cgcgcgcggt gtcatctatg ttactagatc GAATTC 5086

<210> 79 <211> 9493 <212> DNA <213> Artificial Sequence <220><223> Synthesized Construct number R870, from Hindlll to EcoRI <400> 79 aagcttgcat gcctgcaggt cgactctaga ggatccccgg gctggtctgt acattcatct 60 tgccgccttt gcattcactt ggccacaaag agtagagaga aggaagagaa gagcccagac 120 ttcaagaagc gaccttgcaa gtgcactcga gggtcagaaa ctgtatatca tatctatgtg 180 agagaaaggg gaacatttga gatggagtcc atttacttga ggtatactta ttattttgat 240 caataaattt gtatacttct tatttagatc aataaatttg tcattaagct ataatccaaa 300 ataaattacg atcaaatatg caaatgttag ccagtacttg tgttaaactt gatggcatct 360 cttggtttct ttggcaatca catgcctaag aaataaatag tatcatatga ttgtgtttgg 420 tcagacttca gagtcagatg actctgtttg gataaacagc ttaattaagc gcttatagaa 480 tatcatatga ttgtgtttgg tcagacttca gagcatctct tggtttctct ggcaatcata 540 tgcctaagaa ataaatagta tcatatgatt gtgtttggtc agacttcaga gtcagatgac 600 cctgtttggg taaacagctt aattaagtgc ttatagaata agcgcttatc atataagtgc 660 ttttgtacag ttatttctat gaaagtagaa gaaatagtca tattgtttta atataagcta 720 tcctggagag cttgtggaaa taaccagaaa agaacttatg gacacgtcat gagctgttta 780 cataagatct ccctaacagt ctcaaaagtg tttatgccag tagataaatt caaataagtc 840 aatctaaaca g accctaaat ccattatggt acctatcatt ttagcttatt ccatctttat 900 taagaatgtc atgagataac ataatgataa cacattattt tgacacaaat gggcagatct 960 agcaatttaa ctctggagtc cttcaagact gctgttctta cgaagttcac gtccctgaat 1020 catgttcctg tatggaagcc tgaaagacct caaattctaa aaggtggcga taaattgaag 1080 gtttacaaaa tataccctgc gggcttgaca cagaggcaag ctctttatac cttccagttc 1140 aacggggatg ttgatttcag aagtcacttg gagagcaatc cttgtgccaa gtttgaagta 1200 atttttgtgt agcatatgtt gagctaccta caatttacat gatcacctag cattagctct 1260 ttcacttaac tgagagaatg aagttttagg aatgagtatg accatggagt cggcatggct 1320 ttgtaatgcc taccctactt tggccaactc atcggggatt tacattcaga aaatatacat 1380 gacttcaacc atacttaaac ccctttttgt aagataactg aatgttcata tttaatgttg 1440 ggttgtagtg tttttacttg attatatcca gacagttaca agttggacaa caagattgtg 1500 ggtctgtact gttatttatt tatttttttt ttagcagaaa caccttatct tttgtttcgt 1560 ttgaatgtag aatgaaaata aaagaaagaa aatataacat catcggccgc gcttgtctaa 1620 tttcgggcag ttaggatcct ctccggtcac cggaaagttt cagtagaaga aacaaaacac 1680 cgtgactaaa atgatacta t tattttattt attgtgtttt tcttttttct accggaactt 1740 tttaqaacgg atcccaactc gttccggggc cgctacaact gaaacaaaag aagatatttt 1800 ctctctcttc agaaatgtaa gttttccttt acagataccc attcaccatt tgattcagat 1860 gtggtgacta gagataaagc atactaattt gactcttgga aacccataaa gtttatgtta 1920 tccgtgttct ggaccaatcc acttgggggc ataacctgtg tctatgtgtg gtttggtttc 1980 cattctgatt tatgcggcga cttgtaattt aaaatctagg aggggcagac attgaacaat 2040 cccaatattt taataactta tgcaagattt tttttattaa tgagatgatg tgtttgtgac 2100 tgagattgag tcatacattt cactaagaaa tggttccaag taccaaacta tcatgaccca 2160 gttgcaaaca tgacgttcgg gagtggtcac tttgatagtt caatttcatc ttggcttctt 2220 attcctttta taattctaat tcttcttgtg taaactattt catgtattat ttttctttaa 2280 aatttacatg tcatttattt tgcctcacta actcaatttt gcatataaca atgataagtg 2340 atattttgac tcacaaaatt tacatcaaat ttcgacatcg tttattatgt tcattggatg 2400 attaacaaat ataacaaact ttgcaactaa ttaaccacca actgaatata attaactata 2460 actgtgaaag tagttaactc atttttatat ttcatagatc aaataagaga aataacggta 2520 tattaatccc tccaaaaaaa yyyy acggta tatttactaa aaaatctaag ccacgtagga 2580 ggataacagg atccccgtag gaggataaca tccaatccaa ccaatcacaa caatcctgat 2640 gagataaccc actttaagcc cacgcatctg tggcacatct acattatcta aatcacacat 2700 tcttccacac atctgagcca cacaaaaacc aatccacatc tttatcaccc attctataaa 2760 aaatcacact ttgtgagtct aeactttgat tcccttcaaa cacatacaaa gagaagagac 2820 taattaatta attaatcatc ttgagagaaa atgtcgggta aaggagaagg accagctatc 2880 ggtatcgatc ttggtaccac ttactcttgc gtcggagtat ggcaacacga ccgtgttgag 2940 atcattgcta atgatcaagg aaacagaacc acgccatctt acgttgcttt caccgactcc 3000 gagaggttga tcggtgacgc agctaagaat caggtcgcca tgaaccccgt taacaccgtt 3060 ttcgacgcta agaggttgat cggtcgtcgt ttctctgaca gctctgttca gagtgacatg 3120 aaattgtggc eattcaagat tcaagcegga cctgccgata agccaatgat ctacgtcgaa 3180 tacaagggtg aagagaaaga gttegeagct gaggagattt cttccatggt tcttattaag 3240 atgcgtgaga ttgctgaggc ttaccttggt gtcacaatca agaacgccgt tgttaccgtt 3300 ccagcttact tcaacgactc tcagcgtcag gctacaaagg atgctggtgt catcgctggt 3360 ttgaacgtta tgcgaatcat caacgagcct acagccgccg ctattgccta cggtcttgac 3420 aaaaaggcta ccagcgttgg agagaagaat gttcttatct tcgatcttgg tggtggcact 3480 tttgatgtct ctcttcttac cattgaagag ggtatctttg aggtgaaggc aactgctggt 3540 gacacccatc ttggtgggga agattttgac aacagaatgg ttaaccactt tgtccaagag 3600> 11 ttcaagagga agagtaagaa ggatatcacc ggtaacccaa gagctcttag gaggttgaga 3660 acttcctgtg agagagcgaa gaggactctt tcttccactg ctcagaccac catcgagatt 3720 gactctctat acgagggtat cgacttctac tccaccatca cccgtgctag atttgaggag 3780 ctcaacatgg atctcttcag gaagtgtatg gagccaqttg agaagtgtct tcgtgatgct 3840 aagatggaca agagcactgt tcatgatgtt gtccttgttg gtggttctac ccgtatccct 3900 aaggttcagc aattgctcca ggacttcttc aacggcaaag agctttgcaa gtctattaac 3960 cctgatgagg ctgttgccta cggtgctgct gtccagggag ctattctcag cggtgaagga 4020 aacgagaagg ttcaagatct tctattgctc gatgtcactc ctctctccct tggtttggaa 4080 actgccggtg gtgtcatgac cactttgatc ccaaggaaca caaccatccc aaccaagaag 4140 gaacaagtct tctccaccta ctcagacaac caacccggtg tgttgatcca ggtgtacgaa 4200 ggagagagag ccagaaccaa ggacaacaac W ttcttggta aatttgagct ctccggaatt 4260 cctccagctc ctcgtggtgt cccccagatc acagtctgct ttgacattga tgccaatggt 4320 atcctcaatg tctctgctga ggacaagacc accggacaga agaacaagat caccatcacc 4380 aatgacaagg gtcgtctctc caaggatgag attgagaaga tggttcaaga ggctgagaag 4440 tacaagtccg aagacgagga gcacaagaag aaggttgaag ccaagaacgc tctcgagaac 4500 tacgcttaca acatgaggaa caccatccaa gacgagaaga ttggtgagaa gctcccggct 4560 gcagacaaga agaagatcga ggattctatt gagcaggcga ttcaatggct cgagggtaac 4620 cagttggctg aggctgatga gttcgaagac aagatgaagg aattggagag catctgcaac 4680 ccaatcattg ccaagatgta ccaaggagct ggtggtgaag ccggtggtcc aggtgcctct 4740 ggtatggacg atgatgctcc ccctgcttca ggcggtgctg gacctaagat cgaggaggtc 4800 gactaagagc tcagctcgaa tttccccgat cgttcaaaca tttggcaata aagtttctta 4860 agattgaatc ctgttgccgg tcttgcgatg attatcatat aatttctgtt gaattacgtt 4920 aagcatgtaa taattaacat gtaatgcatg acgttattta tgagatgggt ttttatgatt 4980 agagtcccgc aattatacat ttaatacgcg atagaaaaca aaatatagcg cgcaaactag 504 0 gataaattat cgcgcgcggt gtcatctatg ttacta GATC gaattcgtaa tcatggtcat 5100 agctgtttcc tgtgtgaaat tgttatccgg ggctggtctg tacattcatc ttgccgcctt 5160 tgcattcact tggccacaaa gagtagagag aaggaagaga agagcccaga cttcaagaag 5220 cgaccttgca agtgcactcg agggtcagaa actgtatatc atatctatgt gagagaaagg 5280 ggaacatttg agatggagtc catttacttg aggtatactt attattttga tcaataaatt 5340 tgtatacttc ttatttagat caataaattt gtcattaagc tataatccaa aataaattac 5400 gatcaaatat gcaaatgtta gccagtactt gtgttaaact tgatggcatc tcttggtttc 5460 tttggcaatc acatgcctaa gaaataaata gtatcatatg attgtgtttg gtcagacttc 5520 agagtcagat gactctgttt ggataaacag cttaattaag cgcttataga atatcatatg 5580 attgtgtttg gtcagacttc agagcatctc ttggtttctc tggcaatcat atgcctaaga 5640 aataaatagt atcatatgat tgtgtttggt cagacttcag agtcagatga ccctgtttgg 5700 gtaaacagct taattaagtg cttatagaat aagcgcttat catataagtg cttttgtaca 5760 gttatttcta tgaaagtaga agaaatagtc atattgtttt aatataagct atcctggaga 5820 gcttgtggaa ataaccagaa aagaacttat ggacacgtca tgagctgttt acataagatc 5380 tccctaacag tctcaaaagt gtttatgcca gtagataaat t caaataagt caatctaaac 5940 agaccctaaa tccattatgg tacctatcat tttagcttat tccatcttta ttaagaatgt 6000 catgagataa cataatgata acacattatt ttgacacaaa tgggcagatc tagcaattta 6060 actctg9agt ccttcaagac t9ctgttctt acgaagttca cgtccctgaa tcatgttcct 6120 gtatggaagc ctgaaagacc tcaaattcta aaaggtggcg ataaattgaa ggtttacaaa 6180 atataccct9 cgggcttgac acagaggcaa gctctttata ccttccagtt caacgg9gat 6240 gttgatttca gaagtcactt ggagagcaat ccttgtgcca agtttgaagt aatttttgtg 6300 tagcatatgt tgagctacct acaatttaca tgatcaccta gcattagctc tttcacttaa 6360 ctgagagaat gaagttttag gaatgagtat gaccatggag tcggcatggc tttgtaatgc 6420 ctaccctact ttggccaact catcggggat ttacattcag aaaatataca tgacttcaac 6480 catacttaaa cccctttttg taagataact gaatgttcat atttaatgtt gggttgtagt 6540 gtttttactt gattatatcc agacagttac aagttggaca acaagattgt gggtctgtac 6600 tgttatttat ttattttttt tttagcagaa acaccttatc ttttgtttcg tttgaatgta 6660 gaatgaaaat aaaagaaaga aaatataaca tcatcggccg cgcttgtcta atttcgggca 6720 gttaggatcc tctccggtca ccggaaagtt tcagtagaag aaacaaa ACA ccgtgactaa 6780 aatgatacta ttattttatt tattgtgttt ttcttttttc taccggaact ttttagaacg 6840 ratcccaact cgttccgggg ccgctacaac tgaaacaaaa gaagatattt tctctctctt 6900 cagaaatgta agttttcctt tacagatacc cattcaccat ttgattcaga tgtggtgact 6960 agagataaag catactaatt tgactcttgg aaacccataa agtttatgtt atccgtgttc 7020 tggaccaatc cacttggggg cataacctgt gtctatgtgt ggtttggttt ccattctgat 7080 ttatgcggcg acttgtaatt taaaatctag gaggggcaga cattgaacaa tcccaatatt 7140 ttaataactt atgcaagatt ttttttatta atgagatgat gtgtttgtga ctgagattga 7200 gtcat = tcatt tcactaagaa atggttccaa gtaccaaact atcatgaccc agttgcaaac 7260 atgacgttcg ggagtggtca ctttgatagt tcaatttcat cttggcttct tattcctttt 7320 ataattctaa ttcttcttgt gtaaactatt tcatgtatta tttttcttta aaatttacat 7380 gtcatttatt ttgcctcact aactcaattt tgcatataac aatgataagt gatattttga 7440 ctcacaaaat ttacatcaaa tttcgacatc gtttattatg ttcattggat gattaacaaa 7500 tataacaaac tttgcaacta attaaccacc aactgaatat aattaactat aactgtgaaa 7560 gtagttaact catttttata tttcatagat caaataagag aaataacggt a tattaatcc 7620 ctccaaaaaa aaaaaacggt atatttacta aaaaatctaa gccacgtagg aggataacag 7680 gatccccgta ggaggataac atccaatcca accaatcaca acaatcctga tgagataacc 7740 cactttaagc ccacgcatct gtggcacatc tacattatct aaatcacaca ttcttccaca 7800 catctgagcc acacaaaaac caatccacat ctttatcacc cattctataa aaaatcacac 7860 tttgtgagtc tacactttga ttcccttcaa acacatacaa agagaagaga ctaattaatt 7920 aattaatcat cttgagagaa aatgtttggg cgcggaccaa caaggaagag tgataacacc 7980 aaatattacg atattcttgg tgtttcaaaa agtgctagtg aagatgaaat caagaaagcc 804 0 tatagaaagg cagcgatgaa gaaccatcca gataagggtg gggatcctga gaagttcaag 8100 gagttgggcc aagcatatga agtgttgagc gatcctgaaa agaaagaact gtatgatcaa 8160 tatggtgaag atgcccttaa agaaggaatg gggggaggcg caggaagctc atttcataat 8220 ccgtttgata ttttcgaatc attttttggt gcaggctttg gtggtggtgg tccttcacgc 8280 gcaagaagac agaagcaagg agaagatgtg gtgcattcta taaaggtttc cttggaggat 8340 gtgtataacg gcactacaaa gaagctatca ctttctagga atgcactgtg ctcaaaatgt 8400 aaagggaaag gttcaaaaag tggaactgct ggaaggtgtt ttggatgcca gggcac AGGT 84 60 atgaagatta ccagaaggca aattggactg ggcatgattc aacaaatgca acacgtctgt 8520 cctgactgca aaggaacagg cgaggtcatt agtgagagag atagatgccc tcaatgcaag 8580 ggaaacaaga ttactcaaga aaagaaggtg ctggaggtgc atgtggaaaa ggggatgcag 8 64 0 cagggtcaca agattgtatt cgaaggacaa gctgatgaag ctcctgatac aatcacagga 8700 gacataqttt ttgtcttgca agtaaaggga catccgaagt ttcggaggga gcgtgatgac 8760 ctccacattg aacacaattt gagcttaact gaggctctct gtggcttcca gtttaatgtc 8820 acacatcttg atggaaggca actattggtc aaatcgaacc ccggcgaagt catcaagcca 8880 ggtcaacata aagctataaa tgatgaggga atgccacaac atggtaggcc gttcatgaag 8 94 0 ggacgcctat acatcaagtt tagtgttgat ttcccggatt cgggttttct ttccccaagc 9000 caaagcctgg aattagaaaa gatattacct caaaagacaa gcaagaactt gtcccaaaag 9060 917 gaggtagatg attgtgagga gaccaccctg catgatgtca atattgcaga ggagatgagt 9120 cgaaagaagc aacaataccg tgaggcatat gatgacgatg atgatgaaga tgatgagcac 9180 tcgcagcctc gggtgcaatg cgctcaacag taggagctca gctcgaattt ccccgatcgt 9240 tcaaacattt ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgc gatgatt 9300 atcatataat ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg 9360 ttatttatga gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata 9420 gaaaacaaaa tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta 9480 ctagatcgaa ttc 9493

<210> 80 <211> 568 <212> PUT <213> Artificial Sequence <220><223> Synthesized amino add translation of coding sequence In construct 690 expression cassette <400> 80

Met Glu Lys lie Val Leu Leu Leu Ala lie Val Ser Leu Val Lys Ser 15 10 15

Asp Gin Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 20 25 30

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 35 40 45

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 50 55 60

Pro Leu He Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 65 70 75 80

Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val 85 90 95

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Pro Gly His Phe Ala 100 105 110

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 115 120 125

Arg Phe Glu Ile Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 130 135 140

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser ser Phe Tyr 145 150 155 160

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 165 170 175

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 180 185 190

Gly Val His His Pro Pro Asn lie Gly Asp Gin Lys Ala Leu Tyr His 195 200 205

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Lys 210 215 220

Phe Thr Pro Glu Ile Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 225 230 235 240

Arg Ile Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr Ile Ile 245 250 255

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 260 265 270

Ser Arg Gly Phe Gly Ser Gly Ile Met Lys Ser Glu Leu Glu Tyr Gly 275 280 285

Asn Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala Ile Asn Ser Ser 290 295 300

Met Pro Phe His Asn lie His Pro Leu Thr lie Gly Glu Cys Pro Lys 305 310 315 320

Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 325 330 335

Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala lie 340 345 350

Ala Gly Phe Ile Glu Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr 355 360 365

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 370 375 380

Glu Ser Thr Gin Lys Ala lie Asp Gly Val Thr Asn Lys Val Asn Ser 385 390 395 400

He He Asp Lys Met Asn Thr Gin Phe Glu Ala val Gly Arg Glu Phe 405 410 415

Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp 420 425 430

Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met 435 440 445

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 450 455 460

Tyr Asp Lys Val Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 465 470 475 480

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 485 490 495

Ser is Arg Asn Gly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala 500 505 510 991

Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly 515 520 525

Thr Tyr Gin lie Leu Ser lie Tyr Ser Thr Val Ala Ser Ser Leu Ala 530 535 540

Leu Ala Ile Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 545 550 555 560

Ser Leu Gin Cys Arg Ile Cys Ile 565

<210> 81 <211> 568 <212> PRT <213> Artificial Sequence <22Q><223> Synthesized Amino acid translation of coding sequence hi construct 691 expression cassette <400> 81

Met Glu Lys lie Val Leu Leu Leu Ala lie Val Ser Leu Val Lys Ser 15 10 15

Asp Gin Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 20 25 30

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp lie 35 40 45

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 50 55 60

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 65 70 75 80

Pro Glu Cys Glu Leu Leu lie Ser Lys Glu Ser Trp Ser Tyr lie Val 85 90 95

Glu Lys Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly His Phe Ala 100 105 110

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 115 120 125

Arg Phe Glu Ile Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 130 135 140

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser Ser Phe Tyr 145 150 155 160

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 165 170 175

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 180 185 190

Gly Val His His Pro Pro Asn lie Gly Asp Gin Lys Ala Leu Tyr His 195 200 205

Thr Glu Asn Ala Tyr It Will Be It Will Be His His Ser Ser Arg Lys 210 215 220

Phe Thr Pro Glu Ile Ala Lys Arg Pro Lys Vai Arg Asp Gin Glu Gly 225 230 235 240

Arg Ile Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr Ile Ile 245 250 255

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 260 265 270

Ser Arg Gly Phe Gly Ser Gly Ile Ile Asn Ser Asn Ala Pro Met Asp 275 280 285

Lys Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala Ile Asn Ser Ser 290 295 3JO

Met Pro Phe His Asn lie His Pro Leu Thr lie Gly Glu Cys Pro Lys 305 310 315 320

Tyr Go Lys Ser Asn Arg Leu Go Leu Ala Thr Gly Leu Arg Asn Ser 325 330 335

Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile 340 345 350

Ala Gly Phe Ile Glu Gly Gly Trp Gin Gly Met Go Asp Gly Trp Tyr 355 360 365

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 370 375 380

Glu Ser Thr Gin Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser 385 390 395 400 Ile Ile Asp Lys Met Asn Thr Gin Phe Glu Ala Val Gly Arg Glu Phe 405 410 415

Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp 420 425 430

Gly Phe Leu Asp Go Trp Thr Tyr Asn Ala Glu Leu Leu Go Leu Met 435 440 445

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 450 455 460

Tyr Asp Lys Go Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 465 470 475 480

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 485 490 495

Ser Gly A A: sn Gly Thr Tyr A: sn Tyr Pro Gin Tyr Ser Glu Glu Ala 500 505 510

Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly 515 520 525

Thr Tyr Gin lie Leu Ser lie Tyr Ser Thr Val Ala Ser Ser Leu Ala 530 535 540

Leu Ala Ile Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 545 550 555 560

Ser Leu Gin Cys Arg Ile Cys Ile 565

<210> 82 <211> 572 <212> PRT <213> Artificial Sequence <220><223> Synthesized Amino acid translation of coding sequence in construct 696 expression cassette <400> 82

Met Ala Lys Asn Val Ala lie Phe Gly Leu Leu Phe Ser Leu Leu Val 15 10 15

Leu Val Pro Ser Gin Ile Phe Ala Asp Thr Ile Cys Ile Gly Tyr His 20 25 30

Ala Asn Asn Ser Thr Asp Thr Val Asp Thr Val Leu Glu Lys Asn Val 35 40 45

Thr Val Thr His Ser Val Asn Leu Leu Glu Asp Ser His Asn Gly Lys 50 55 60

Leu Cys Leu Leu Lys Gly lie Ala Pro Leu Gin Leu Gly Asn Cys Ser 65 70 75 80

Val Ala Gly Trp lie Leu Gly Asn Pro Glu Cys Glu Leu Leu lie Ser 85 90 95

Lys Glu Ser Trp Ser Tyr lie Val Glu Thr Pro Asn Pro Glu Asn Gly 100 105 110

Thr Cys Tyr Pro Gly Ser Phe Asn Asp Tyr Glu Glu Leu Lys His Leu 115 120 125

Leu Ser Arg Ile Asn His Phe Glu Lys Ile Glu Ile Pro Lys Ser 130 135 140

Ser Trp Ser Asp His Glu Ala Ser Ser Gly Val Ser Ser Ala Cys Pro

Tyr Leu Gly Ser Pro Ser Phe Phe Arg Asn Val Val Trp Leu lie Lys 165 170 175

Lys Asn Ser Thr Tyr Pro Thr lie Lys Lys Ser Tyr Asn Asn Thr Asn 180 185 190

Gin Glu Asp Leu Leu Val Leu Trp Gly His His Pro Asn Asp Ala 195 200 205

Ala Glu Gin Thr Arg Leu Tyr Gin Asn Pro Thr Thr Tyr He Ser lie 210 215 220

Gly Thr Ser Thr Leu Asn Gin Arg Leu Val Pro Lys lie Ala Thr Arg 225 230 235 240

Ser Lys Val Asn Gly Gin Ser Gly Arg Met Glu Phe Phe Trp Thr lie 245 250 255

Leu Lys Pro Asn Asp Ala lie Asn Phe Glu Ser Asn Gly Asn Phe lie 260 265 270

Ala Pro Glu Tyr Ala Tyr Lys lie Val Lys Lys Gly Asp Ser Ala lie 275 280 285 Ile Thr Ser Asn Ala Pro Met Asp Glu Cys Asp Ala Lys Cys Gin Thr 290 295 300

Pro Gin Gly Ala lie Asn Ser Ser Leu Pro Phe Gin Asn Val His Pro 305 310 315 320

Val Thr Ile Gly Glu Cys Pro Lys Tyr Val Arg Ser Ala Lys Leu Arg 325 330 335

Met Val Thr Gly Leu Arg Asn Ile Pro Ser Ile Gin Arg Arg Gly Leu 340 345 350

Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp Thr Gly Met Val 355 360 365

Asp Gly Trp Tyr Gly Tyr His His Asn Glu Gin Gly Ser Gly Tyr 370 375 380

Ala Ala Asp Gin Lys Ser Thr Gin Asn Ala lie Asn Gly lie Thr Asn 385 390 395 400

Lys Val Asn Ser Valine Glu Lys Met Asn Thr Gin Phe Thr Ala Val 405 410 415

Gly Lys Glu Phe Asn Lys Leu Glu Arg Arg JY: et Glu Asn Leu Asn Lys 420 425 430

Lys Val Asp Asp Gly Phe Leu Asp lie Trp Thr Tyr Asn Ala Glu Leu 435 440 445

Leu Val Leu Leu Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn 450 455 460

Val Lys Asn Leu Tyr Glu Lys Val Lys Ser Gin Leu Lys Asn Asn Ala 465 470 475 480

Lys Glu Ile Gly Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asn Asn 485 490 495

Glu Cys Met Glu Ser Val Lys Asn Gly Thr Tyr Asp Tyr Pro Lys Tyr 500 505 510

Ser Glu Glu Ser Lys Leu Asn Arg Glu Lys lie Asp Gly Val Lys Leu 515 520 525

Glu Ser Met Gly Go Tyr Gin lie Leu Ala Ile Tyr Ser Thr Go Ala __535_5AQ_

Ser Ser Leu Vai Leu Leu Will Be Leu Gly Ala Ile Ser Phe Trp Met 545 550 555 560

Cys Ser Asn Gly Ser Leu Gin Cys Arg Ile Cys Ile 565 570

<210> S3 <211> 575 <212> PRT <213> Artificial Sequence <220><223> Synthesbed amino add translation of coding sequence In construct 737 expression cassette <400> 83

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val 15 10 15

Leu Val Pro Ser Gin He Phe Ala Gin Lys Leu Pro Gly Asn Asp Asn 20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr 35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Gin Ile Glu Val Thr Asn Ala Thr 50 55 60

Glu Leu Val Gin Ser Ser Ser Thr Gly Glu Ile Cys Asp Ser Pro His 65 70 75 80

Gin Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly 85 90 95

Asp Pro Gin Cys Asp Gly Phe Gin Asn Lys Lys Trp Asp Leu Phe Val 100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp 115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe 130 135 140

Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gin Asn Gly Thr Ser 145 150 155 160

Ser Ala Cys Ile Arg Arg Ser Asn Asn Ser Phe Phe Ser Arg Leu Asn 165 170 175

Trp Leu Thr His Leu Lys Phe Lys Tyr Pro Ala Leu Asn Val Thr Met 180 185 190

Pro Asn Asn Glu Lys Phe Asp Lys Leu Tyr Ile Trp Gly Val His His 195 200 205

Pro Gly Thr Asp Asn Asp Gin lie Phe Leu Tyr Ala Gin Ala Ser Gly 210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gin Gin Thr Val Ile Pro Asn 225 230 235 240

He Gly Ser Arg Pro Arg Arg Arg Asn I Pro Pro Ser Arg Arg Ser I 245 250 255

Tyr Trp Thr lie Val Lys Pro Gly Asp He Leu Leu He Asn Ser Thr 260 265 270

Gly Asn Leu He Wing Pro Arg Gly Tyr Phe Lys He Arg Ser Gly Lys 275 280 285

Ser Ser He Met Arg Ser Asp Ala Pro He Gly Lys Cys Asn Ser Glu 290 295 300

Cys He Thr Pro Asn Gly Ser He Pro Asn Asp Lys Pro Phe Gin Asn 305 310 315 320

Val Asn Arg He Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gin Asn 325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gin Thr 340 345 350

Arg Gly He Phe Gly Ala He Ala Gly Phe He Glu Asn Gly Trp Glu 355 360 365

Gly Met Val Asp Cly Trp Tyr Gly Phe Arg His Gin Asn Ser Glu Gly 370 375 380

He Gly Gin Wing Wing Asp Leu Lys Ser Thr Gin Wing Wing He Asp Gin 385 390 395 400

He Asn Gly Lys Leu Asn Arg Leu He Gly Lys Thr Asn Glu Lys Phe 405 410 415

His Gin He Glu Lys Glu Phe Ser Glu Val Glu Gly Arg He Gin Asp 420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys He Asp Leu Trp Ser Tyr Asn 435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gin His Thr He Asp Leu Thr 450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gin Leu Arg 465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys He Tyr His Lys 485 490 495

Cys Asp Asn Ala Cys He Gly Ser He Arg Asn Gly Thr Tyr Asp His 500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Asn Arg Phe Gin He Lys Gly 515 520 525

Val Glu Leu Lys Ser He Gly Thr Tyr Gin He Leu Ser He Tyr Ser 530 535 540

Thr Ala Ser Ser Leu Ala Leu Ala lie Met Met Ala Gly Leu Ser 545 550 555 560

Leu Trp Met Cys Ser Asn Gly Ser Leu Gin Cys Arg Ile Cys 565 570 575

<210> 84 <211> 593 <212> PRT <213> Artificial Sequence <220><223> Synthesized amino acid translation of coding sequence in construct 745 expression cassette <400> 84

Met Ala Lys Asn Val Ala He Phe Gly Leu Leu Phe Ser Leu Leu Val 15 10 15

Leu Val Pro Ser Gin Ile Phe Ala Asp Arg He Cys Thr Gly Ile Thr 5 20 25 30

Ser Ser Asn Ser Pro His Val Val Lys Thr Ala Thr Gin Gly Glu Val 35 40 45

Asn Val Thr Gly Val He Pro Leu Thr Thr Thr Pro Thr Lys Ser Tyr 50 55 60

Phe Ala Asn Leu Lys Gly Thr Arg Thr Arg Gly Lys Leu Cys Pro Asp 65 70 75 80 15

Cys Leu Asn Cys Thr Asp Leu Asp Val Ala Leu Gly Arg Pro Met Cys 85 90 95

Val Gly Thr Thr Pro Ser Ala Lys Ala Ser He Leu His Glu Val Lys 20 1 00 1 05 110

Pro Val Thr Ser Gly Cys Phe Pro He Met His Asp Arg Thr Lys He 115 120 125 25 Arg Gin Leu Pro Asn Leu Leu Arg Gly Tyr Glu Asn He Arg Leu Ser 130 135 140

Thr Gin Asn Val He Asp Ala Glu Lys Ala Pro Gly Gly Pro Tyr Arg 145 150 155 160 30

Leu Gly Thr Ser Gly Ser Cys Pro Asn Ala Thr Ser Lys Ser Gly Phe 165 170 175

Phe Ala Thr Met Ala Trp Ala Val Pro Lys Asp Asn Asn Lys Asn Ala 180 185 190 35

Thr Asn Pro Leu Thr Val Glu Val Pro Tyr He Cys Thr Glu Gly Glu 195 200 205

Asp Gin He Thr Val Trp Gly Phe His Ser Asp Asn Lys Thr Gin Met 40 210 215 220

Lys Asn Leu Tyr Gly Asp Ser Asn Pro Gin Lys Phe Thr Ser Ser Ala 225 230 235 240 45 Asn Gly Val Thr Thr His Tyr Val Ser Gin Ile Gly Ser Phe Pro Asp

OJ 55 245 250 255

Gin Thr Glu Asp Gly Gly Leu Pro Gin Ser Gly Arg Ile Val Val Asp 260 265 270 s

Tyr Met Met Gin Lys Pro Gly Lys Thr Gly Thr Ile Val Tyr Gin Arg 275 280 285

Gly Val Leu Leu Pro Gin Lys Val Trp Cys Ala Ser Gly Arg Ser Lys "290 295 300

Val Ile Lys Gly Ser Leu Pro Leu Ile Gly Glu Ala Asp Cys Leu His 305 310 315 320

Glu Lys Tyr Gly Gly Leu Asn Lys Ser Lys Pro Tyr Tyr Thr Gly Glu H 325 330 335

His Ala Lys Ala lie Gly Asn Cys Prole Trp Val Lys Thr Pro Leu 340 345 350 20 Lys Leu Ala Asn Gly Thr Lys Tyr Arg Pro Pro Ala Lys Leu Leu Lys 355 360 365

Glu Arg Gly Phe Phe Gly Ala He Ala Gly Phe Leu Glu Gly Gly Trp 370 375 380 25 Glu Gly Met le Al Gly Trp His Gly Tyr Thr Ser His Gly Ala His 385 390 395 400

Gly Val Ala Val Ala Ala Asp Leu Lys Ser Thr Gin Glu Ala He Asn 405 410 415 30

Lys He Thr Lys Asn Leu Asn Ser Leu Ser Glu Leu Glu Val Lys Asn 420 425 430

Leu Gin Arg Leu Ser Gly Ala Met Asp Glu Leu His Asn Glu leu 435 440 445 35

Glu Leu Asp Glu Lys Val Asp Asp Leu Arg Ala Asp Thr He Ser Ser 450 455 460

Gin lie Glu Leu Ala Val Leu Leu Ser Asn Glu Gly lie lie Asn Ser 40 4 6 5 4 7 0 4 7 5 4 8 0

Glu Asp Glu His Leu Leu Ala Leu Glu Arg Lys Leu Lys Lys Met Leu 485 490 495 45 Gly Pro Ser Ala Val Glu He Gly Asn Gly Cys Phe Glu Thr Lys His 500 505 510

Lys Cys Asn Gin Thr Cys Leu Asp Arg He Ala Gly Thr Phe Asn 515 520 525 30 Ala Gly Glu Phe Ser Leu Pro Thr Phe Asp Ser Leu Asn He Thr Ala 530 535 540

Ala Ser Leu Asn Asp Asp Gly Leu Asp Asn Tyr Gin lie Leu Ser lie 545 550 555 560 55

Tyr Ser Thr Val Ala Ser Ser Leu Ala Leu Ala lie Met Met Ala Gly 565 570 575

Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gin Cys Arg Ile Cys 580 585 590 Ile 5

<210> 85 <211> 405 <212> DNA <213> ArtHielal Sequence 10 <220><223> Synthesized Sacl-Plasto 3 (prime) UTR sequence <400> 85 is 60 gagctctaag ttaaaatgct tcttcgtctc ctatttataa tatggtttgt tattgttaat 120 tttgttcttg tagaagagct taattaatcg ttgttgttat gaaatactat ttgtatgaga 180 20 tgaactggtg taatgtaatt catttacata agtggagtca gaatcagaat gtttcctcca 240 taactaacta gacatgaaga cctgccgcgt acaattgtct tatatttgaa caactaaaat tgaacatctt ttgccacaac tttataagtg gttaatatag ctcaaatata tggtcaagtt 300 25 360 caatagatta ataatggaaa tatcagttat cgaaattcat taacaatcaa cttaacgtta 405 ttaactacta attttatatc atcccctttg ataaatgata gtaca 30 <210> 86

<211> 1718 <212> DNA <213> Artificial Sequence 35 <220><22J> Synthesized POI sp-A / CalHbmia / W / 09 <40 086 40 atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttcctctc 60 agatcttcgc tgacacatta tgtataggtt atcatgcgaa caattcaaca gacactgtag 120 5 acacagtact agaaaagaat gtaacagtaa cacactctgt taaccttcta gaagacaagc 180 ataacgggaa actatgcaaa ctaagagggg tagccccatt gcatttgggt aaatgtaaca 240 ttgctggctg gatcctggga aatccagagt gtgaatcact ctccacagca agctcatggt 300 10 cctacattgt ggaaacacct agttcagaca atggaacgtg ttacccagga gatttcatcg 360 attatgagga gctaagagag caattaagct cagtgtcatc atttgaaagg tttgagatat 420 * 5 tccccaagac aagttcatgg cccaatcatg actcgaacaa aggtgtaacg gcagcatgtc 480 ctcatgctgg agcaaaaagc ttctacaaaa atttaatatg gctagttaaa aaaggaaatt 540 catacccaaa gctcagcaaa tcctacatta atgataaagg gaaagaagtc ctcgtgctat 600 20 ggggcattca ccatccatct actagtgctg accaacaaag tctctatcag aatgcagata 660 catatgtttt tgtggggtca tcaagataca gcaagaagtt caagccggaa atagcaataa 720 25 gacccaaagt gagggatcaa gaagggagaa tgaactatta ctggacacta gtagagccgg 780 gagacaaaat aacattcgaa gcaactggaa atctagtggt accgagatat gcattcgcaa 8 40 tgctggatct ggtattatca tttcagatac tggaaagaaa accagtccac gattgcaata 900 caacttgtca aacacccaag ggtgctataa acaccagcct cccatttcag aatatacatc 960 cgatcacaat tggaaaatgt ccaaaatatg taaaaagcac aaaattgaga ctggccacag 1020 35 gattgaggaa tatcccgtct attcaatcta gaggactatt tggggccatt gccggtttca 1080 gtggacaggg atggtagatg gatggtacgg ttgaaggggg ttatcaccat caaaatgagc 1140 aggggtcagg atatgcagcc gacctgaaga gcacacagaa tgccattgac gagattacta 1200 acaaagtaaa ttctgttatt gaaaagatga atacacagtt cacagcagta ggtaaagagt 1260 tcaaccacct ggaaaaaaga atagagaatt taaataaaaa agttgatgat ggtttcctgg 1320 * s acatttggac ttacaatgcc gaactgttgg ttctattgga aaatgaaaga actttggact 1380 accacgattc aaatgtgaag aacttatatg aaaaggtaag aagccagcta aaaaacaatg 1440 ccaaggaaat tggaaacggc tgctttgaat tttaccacaa atgcgataac acgtgcatgg 1500 50 aaagtgtcaa aaatgggact tatgactacc caaaatactc agaggaagca aaattaaaca 1560 gagaagaaat agatggggta aagctggaat caacaaggat ttaccagatt ttggcgatct 1620 ss attcaactgt cgccagttca ttggtactgg tagtctccct gggggcaatc agtttctgg at 1680 tgtgctctaa tgggtctcta cagtgtagaa tatgtatt 1718

<210> 87 <211> 573 <212> PRT <213> Artificial Sequence <220><223> Synthesized POI sp- A / CalHbmia 04/09 <400> 87

Met Ala Lys Asn Val Ala lie Phe Gly Leu Leu Phe Ser Leu Leu Val 15 10 15

Leu Val Pro Ser Gin Ile Phe Ala Asp Thr Leu Cys Ile Gly Tyr His 20 25 30

Ala Asn Asn Ser Thr Asp Thr Val Asp Thr Val Leu Glu Lys Asn Val 35 40 45

Thr Val Thr His Ser Val Asn Leu Leu Glu Asp Lys His Asn Gly Lys 50 55 60

Leu Cys Lys Leu Arg Gly Val Ala Pro Leu His Leu Gly Lys Cys Asn 65 70 75 80 Ile Ala Gly Trp Ile Leu Gly Asn Pro Glu Cys Glu Ser Leu Ser Thr 85 90 95

Ala Ser Ser Trp Ser Tyr lie Val Glu Thr Pro Ser Ser Asp Asn Gly 100 105 110

Thr Cys Tyr Pro Gly Asp Phe Ile Asp Tyr Glu Glu Leu Arg Glu Gin 115 120 125

Read Ser Ser Ser Val Ser Ser Phe Glu Arg Phe Glu Ile Phe Pro Lys Thr 130 135 140

Ser Ser Trp Pro Asn His Asp Ser Asn Lys Gly Val Thr Ala Ala Cys 145 150 155 160

Pro His Wing Gly Wing Lys Ser Phe Tyr Lys Asn Leu lie Trp Leu Val 165 170 175

Lys Lys Gly Asn Ser Tyr Pro Lys Leu Ser Lys Ser Tyr lie Asn Asp 180 185 190

Lys Gly Lys Glu Val Leu Val Leu Trp Gly His His Pro Ser Thr 195 200 205

Ser Wing Asp Gin Gin Ser Leu Tyr Gin Asn Wing Asp Thr Tyr ValPt.e 210 215 220

Val Gly Ser Ser Arg Arg Ser Lys Lys Phe Lys Pro Glu Ile Alaine 225 230 235 240

Arg Pro Lys Val Arg Asp Gin Glu Gly Arg Met Asn Tyr Tyr Trp Thr 245 250 255

Leu Val Glu Pro Gly Asp Lys lie Thr Phe Glu Ala Thr Gly Asn Leu 260 265 270

Val Val Pro Arg Tyr Ala Phe Ala Met Glu Arg Asn Ala Gly Ser Gly 275 280 285 Ile Ile Ile Ser Asp Thr Pro Val His Asp Cys Asn Thr Thr Cys Gin 290 295 300

Thr Pro Lys Gly Ala lie Asn Thr Ser Leu Pro Phe Gin Asn lie His 305 310 315 320

Pro He Thr Ile Gly Lys Cys Pro Lys Tyr Val Lys Ser Thr Lys Leu 325 330 335

Arg Leu Ala Thr Gly Leu Arg Asn lie Pro Ser Ile Gin Arg Arg Gly 340 345 350

Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp Thr Gly Met 355 360 365

Val Asp Gly Trp Tyr Gly Tyr His His Asn Glu Gin Gly Ser Gly 370 375 380

Tyr Ala Ala Asp Leu Lys Ser Thr Gin Asn Ala Ile Asp Glu Ile Thr 385 390 395 400

Asn Lys Val Asn Ser Valine Glu Lys Met Asn Thr Gin Phe Thr Ala 405 410 415

Go Gly Lys Glu Phe Asn His Leu Glu Lys Arg Ile Glu Asn Leu Asn 420 425 430

Lys Lys Go Asp Asp Gly Phe Leu Asp Ile Trp Thr Tyr Asn Ala Glu 435 440 445

Leu Leu Leu Leu Leu Glu Asn Glu Arg Thr Leu Asp Tyr Hls Asp Ser 450 455 460

Asn Go Lys Asn Leu Tyr Glu Lys Go Arg Ser Gin Leu Lys Asn Asn 465 470 475 480

Ala Lys Glu Ile Gly Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp 485 490 495

Asn Thr Cys Met Glu Ser Vai Lys Asn Gly Thr Tyr Asp Tyr Pro Lys 500 505 510

Tyr Ser Glu Glu Ala Lys Leu Asn Arg Glu Glu Ile Asp Gly Val Lys 515 520 525

Leu Glu Ser Thr Arg Ile Tyr Gin Ile Leu Ala Ile Tyr Ser Thr Val 530 535 540

Ala Ser Ser Leu Vai Leu Goes To Be Leu Gly Ala Ile Ser Phe Trp 545 550 555 560

Met Cys Ser Asn Gly Ser Leu Gin Cys Arg Ile Cys Ile 565 570

<210> tt <211> 747 <212> D NA <213> Artificial Sequence <220><223> Synthesized 2X35S promoter sequence <400> 88 gtcaacatgg tggagcacga cacacttgtc tactccaaaa atatcaaaga tacagtctca 60 gaagaccaaa gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga 120 ttccattgcc cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc 180 tacaaatgcc atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt 240 ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc 300 acgtcttcaa agcaagtgga ttgatgtgat aacatggtgg agcacgacac acttgtctac 360 tccaaaaata tcaaagatac agtctcagaa gaccaaaggg caattgagac ttttcaacaa 420 agggtaatat ccggaaacct cctcggattc cattgcccag ctatctgtca ctttattgtg 480 aagatagtgg aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc 540 atcgttgaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 600 atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 660 tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagaccc ttcctctata 720 747 taaggaagtt catttcattt ggagagg

<210> 89 <211> 43 <212> DNA <213> Artificial Sequence <220><223> Synthesized Pad-MCS-2X35S.c <400> 89 aattgttaat taagtcgaca agcttgcatg cctgcaggtc aac 43

<210> 90 <211> 48 <212> DNA <213> Artificial Sequence <220><223> Synthesized CPMV 5 (prtme) l / TR-2X35S.r <400> 90 tcaaaaccta ttaagatttt aatacctctc caaatgaaat gaacttcc 48

<210> 91 <211> 49 <212> DNA <2U> Artificial Sequence <220><223> Synthesized 2X35S-CPMV 5 (prlme) UTR.c <400> 91 ttggagaggt attaaaatct taataggttt tgataaaagc gaacgtggg 49

<210> 92 <211> 44 <212> DNA <213> Artificial Sequence <220><223> Synthesized Apal-M prot.r <400> 92 tctccatggg cccgacaaat ttgggcagaa tatacagaag ctta 44 <210> 93 <211> 3580

<212> DNA <213> Artificial Sequence <220><223> Synthesized Construct 747, from Pad to Asel <400> 93 ttaattaagt cgacaagctt gcatgcctgc aggtcaacat ggtggagcac gacacacttg 60 tctactccaa aaatatcaaa gatacagtct cagaagacca aagggcaatt gagacttttc 120 aacaaagggt aatatccgga aacctcctcg gattccattg cccagctatc tgtcacttta 180 ttgtgaagat agtggaaaag gaaggtggct cctacaaatg ccatcattgc gataaaggaa 240 aggccatcgt tgaagatgcc tctgccgaca gtggtcccaa agatggaccc ccacccacga 300 ggagcatcgt ggaaaaagaa gacgttccaa ccacgtcttc aaagcaagtg gattgatgtg 360 ataacatggt ggagcacgac acacttgtct actccaaaaa tatcaaagat acagtctcag 420 aagaccaaag ggcaattgag acttttcaac aaagggtaat atccggaaac ctcctcggat 480 tccattgccc agctatctgt cactttattg tgaagatagt ggaaaaggaa ggtgqctcct 540 acaaatgcca tcattgcgat aaaggaaagg ccatcgttga agatgcctct gccgacagtg 600 gtcccaaaga tggaccccca cccacgagga gcatcgtgga aaaagaagac gttccaacca 660 cgtcttcaaa gcaagtggat tgatgtgata tctccactga cgtaagggat gacgcacaat 720 cccactatcc ttcgcaagac ccttcctcta tataaggaag ttcatttcat ttggagaggt 780 attaaaatct taataggttt tgataaaagc gaacgtgggg aaacccgaac caaaccttct 840 tctaaactct c tctcatctc tcttaaagca aacttctctc ttgtctttct tgcgtgagcg 900 atcttcaacg ttgtcagatc gtgcttcgqc accagtacaa cgttttcttt cactgaagcg 960 aaatcaaaga tctctttgtg gacacgtagt gcggcgccat taaataacgt gtacttgtcc 1020 tattcttgtc ggtgtggtct tgggaaaaga aagcttgctg gaggctgctg ttcagcccca 1080 tacattactt gttacgattc tgctgacttt cggcgggtgc aatatctcta cttctgcttg 1140 acgaggtatt gttgcctgta cttctttctt cttcttcttg ctgattggtt ctataagaaa 1200 tctagtattt tctttgaaac agagttttcc cgtggttttc gaacttggag aaagattgtt 1260 aagcttctgt atattctgcc caaatttgtc gggcccatgg cgaaaaacgt tgcgattttc 1320 ggcttattgt tttctcttct tgtgttggtt ccttctcaga tcttcgctga tcgaatctgc 1380 actggaataa catcttcaaa ctcacctcat gtggtcaaaa cagccactca aggggaggtc 1440 aatgtgactg gtgtgatacc actaacaaca acaccaacaa aatcttattt tgcaaatctc 1500 aaaggaacaa ggaccagagg gaaacbatgc ccagacfcgfcc tcaactgcac agatctggat 1560 gtggctttgg gcagaccaat gtgtgtgggg aecaeaectt cggcgaaggc ttcaatactc 1620 cacgaagtca aacctgttac atccgggtgc tttcctataa tgcacgacag aacaaaaalc 1680 aggcaactac ccaatct TCT cagaggatat gaaaatatca ggctatcaac ccaaaacgtc 1740 atcqatgcgg aaaaggcacc aggaggaccc tacagacttg gaacctcagg atcttgccct 1800 aacgctacca gtaagagcgg atttttcgca acaatggctt gggctgtccc aaaggacaac 1860 aacaaaaatg caacgaaccc actaacagta gaagtaccat acatttgtac agaaggggaa 1920 gaccaaatca ctgtttgggg gttccattca gataacaaaa cccaaatgaa gaacctctat 1980 ggagactcaa atcctcaaaa gttcacctca tctgctaatg gagtaaccac acactatgtt 2040 tctcagattg gcagcttccc agatcaaaca gaagacggag gactaccaca aagcggcagg 2100 attgttgttg attacatgat gcaaaaacct gggaaaacag gaacaattgt ctaccaaaga 2160 ggtgttttgt tgcctcaaaa ggtgtggtgc gcgagtggca ggagcaaagt aataaaaggg 2220 tccttgcctt taattggtga agcagattgc cttcatgaaa aatacggtgg attaaacaaa 2280 agcaagcctt actacacagg agaacatgca aaagccatag gaaattgccc aatatgggtg 2340 aaaacacctt tgaagctcgc caatggaacc aaatatagac ctcctgcaaa actattaaag 2400 gaaaggggtt tcttcggagc tattgctggt ttcctagaag gaggatggga aggaatgatt 2460 gcaggctggc acggatacac atctcacgga gcacatggag tggcagtggc ggcggacctt 2520 aagagtacgc aagaagctat aa acaagata acaaaaaatc tcaattcttt gagtgagcta 2580 gaagtaaaga atcttcaaag actaagtggt gccatggatg aactccacaa cgaaatactc 2640 gagctggatg agaaagtgga tgatctcaga gctgacacta taagctcgca aatagaactt 2700 gcagtcttgc tttccaacga aggaataata aacagtgaag atgagcatct attggcactt 2760 gagagaaaac taaagaaaat gctgggtccc tctgctgtag agataggaaa tggatgcttc 2820 gaaaccaaac acaagtgcaa ccagacctgc ttagacagga tagctgctgg cacctttaat 2880 gcaggagaat tttctctccc cacttttgat tcactgaaca ttactgctgc atctttaaat 2940 gatgatggat tggataacta ccaaatactg tcaatttatt caacagtggc gagttcccta 3000 gcactggcaa tcatgatggc tggtctatct ttatggatgt gctccaatgg atcgttacaa 3060 gcatttaaag tgcagaattt gcctattttc tttagtttga atttactgtt attcggtgtg 3120 catttctatg tttggtgagc ggttttctgt gctcagagtg tgtttatttt atgtaattta 3180 atttctttgt gagctcctgt ttagcaggtc gtcccttcag caaggacaca aaaagatttt aattttatta 3240 aaaaaaaaaa 3300 aaaaaaagac cgggaattcg atatcaagct tatcgacctg cagatcgttc aaacatttgg caataaagtt tcttaagatt gaatcctgtt gccggtcttg 3360 cgatgattat catataattt ctgttgaa tt acgttaagca tgtaataatt aacatgtaat 3420 gcatgacgtt atttatgaga tgggttttta tgattagagt cccgcaatta tacatttaat 3480 acgcgataga aaacaaaata tagcgcgcaa actaggataa attatcgcgc gcggtgtcat 3540 ctatgttact agattctaga gtctcaagct tcggcgcgcc 3580

<210> 94 <211> S69 <212> PRT <213> Artificial Sequence <220><223> Synthesized Influenza B virus B / Florida / 4/2006 <400> 94

Asp Arg Ile Cys Thr Gly Ile Thr Ser Ser Asn Ser Pro His Val Val 15 10 15

Lys Thr Ala Thr Gin Gly Glu Val Asn Val Thr Gly Val le Pro Leu 20 25 30

Thr Thr Thr Pro Thr Lys Ser Tyr Phe Ala Asn Leu Lys Gly Thr Arg 35 40 45

Thr Arg Gly Lys Leu Cys Pro Asp Cys Leu Asn Cys Thr Asp Leu Asp 50 55 60

Val Ala Leu Gly Arg Pro Met Cys Val Gly Thr Thr Pro Ser Ala Lys 65 70 75 80

Ala Ser is Leu His Glu Val Lys Pro Val Thr Ser Gly Cys Phe Pro 85 90 95 Ile Met His Asp Arg Thr Lys lie Arg Gin Leu Pro Asn Leu Leu Arg 100 105 110

Gly Tyr Glu Asn lie Arg Leu Ser Thr Gin Asn Valine Asp Ala Glu 115 120 125

Lys Ala Pro Gly Gly Pro Tyr Arg Leu Gly Thr Ser Gly Ser Cys Pro 130 135 140

Asn Ala Thr Ser Lys Ser Gly Phe Phe Ala Thr Met Ala Trp Ala Val 145 150 155 160

Pro Lys Asp Asn Asn Lys Asn Ala Thr Asn Pro Leu Thr Val Glu Val 165 170 175

Pro Tyr Ile Cys Thr Glu Gly Glu Asp Gin Ile Thr Val Trp Gly Phe 180 185 190

His Ser Asp Asp Lys Thr Gin Met Lys Asn Leu Tyr Gly Asp Ser Asn 195 200 205

Pro Gin Lys Phe Thr Ser Ser Ala Asn Gly Val Thr Thr His Tyr Val 210 215 220

Ser Gin is Gly Ser Phe Pro Asp Gin Thr Glu Asp Gly Gly Leu Pro 225 230 235 240

Gin Ser Gly Arg Val Val Asp Tyr Met Met Gin Lys Pro Gly Lys 245 250 255

Thr Gly Thr lie Val Tyr Gin Arg Gly Val Leu Leu Pro Gin Lys Val 260 265 270

Trp Cys Ala Ser Gly Arg Ser Lys Valine Lys Gly Ser Leu Pro Leu 275 280 285 Ile Gly Glu Ala Asp Cys Leu His Glu Lys Tyr Gly Gly Leu Asn Lys 290 295 300

Ser Lys Pro Tyr Tyr Thr Gly Glu His Ala Lys Ala lie Gly Asn Cys 305 310 315 320

Prole Trp Val Lys Thr Pro Leu Lys Leu Ala Asn Gly Thr Lys Tyr 325 330 335

Arg Pro Pro Ala Lys Leu Leu Lys Glu Arg Gly Phe Phe Gly Alaine 340 345 350

Ala Gly Phe Leu Glu Gly Gly Trp Glu Gly Met Ile Ala Gly Trp His 355 360 365

Gly Tyr Thr Ser His Gly Ala His Gly Val Ala Val Ala Ala Asp Leu 370 375 380

Lys Ser Thr Gin Glu Ala lie Asn Lys lie Thr Lys Asn Leu Asn Ser 385 390 395 400

Leu Ser Glu Leu Glu Val Lys Asn Leu Gin Arg Leu Ser Gly Ala Met 405 410 415

Asp Glu Leu His Asn Glu leu Glu Leu Asp Glu Lys Val Asp Asp 420 425 430

Leu Arg Wing Asp Thr Ile Ser Ser Glu Leu Wing Val Leu Leu 435 440 445

Ser Asn Glu Gly Ile lie Asn Ser Glu Asp Glu His Leu Leu Ala Leu 450 455 460

Glu Arg Lys Leu Lys Lys Met Leu Gly Pro Ser Ala Val Glu Ile Gly 465 470 475 480

Asn Gly Cys Phe Glu Thr Lys His Lys Cys Asn Gin Thr Cys Leu Asp 485 490 495

Arg Ile Ala Gly Thr Phe Asn Ala Gly Glu Phe Ser Leu Pro Thr 500 505 510

Phe Asp Ser Leu Asn lie Thr Ala Ala Ser Leu Asn Asp Asp Gly Leu 515 520 525

Asp Asn His Thr Ile Leu Leu Tyr Tyr Ser Thr Ala Ala Ser Ser Leu 530 535 540

Ala Val Thr Leu Met Leu Ala lie Phe lie Val Tyr Met Val Ser Arg 545 550 555 560

Asp Asn Val Ser Cys Ser is Cys Leu 565 <210> 95

<211> 570 <212> PRT <213> Artificial Sequence <220><223> Synthesized Influenza B virus B / Malaysia / 2506/2004 <400> 95

Asp Arg Ile Cys Thr Gly Ile Thr Ser Ser Asn Ser Pro His Val Val 15 10 15

Lys Thr Ala Thr Gin Gly Glu Val Asn Val Thr Gly Val le Pro Leu 20 25 30

Thr Thr Thr Pro Thr Lys Ser His Phe Ala Asn Leu Lys Gly Thr Glu 35 40 45

Thr Arg Gly Lys Leu Cys Pro Lys Cys Leu Asn Cys Thr Asp Leu Asp 50 55 60

Val Ala Leu Gly Arg Pro Lys Cys Thr Gly Asn lie Pro Ser Ala Arg 65 70 75 80

Val Ser is Leu His Glu Val Arg Pro Val Thr Ser Gly Cys Phe Pro 85 90 95 Ile Met His Asp Arg Thr Lys lie Arg Gin Leu Pro Lys Leu Leu Arg 100 105 110

Gly Tyr Glu His Ile Arg Leu Ser Thr His Asn Valine Asn Ala Glu 115 120 125

Asn Ala Pro Gly Gly Pro Tyr Lys Ile Gly Thr Ser Gly Ser Cys Pro 130 135 140

Asn Val Thr Asn Gly Asn Gly Phe Phe Ala Thr Met Ala Trp Ala Val 145 150 155 160

Pro Lys Asn Asp Asn Asn Lys Thr Ala Thr Asn Ser Leu Thr Ile Glu 165 170 175

Val Pro Tyr lie Cys Thr Glu Gly Glu Asp Gin lie Thr Val Trp Gly 180 185 190

Phe His Ser Asp Asn Glu Thr Gin Met Ala Lys Leu Tyr Gly Asp Ser 195 200 205

Lys Pro Gin Lys Phe Thr Ser Ser Ala Asn Gly Val Thr Thr His Tyr 210 215 220

Will Be Gin lie Gly Gly Phe Pro Asn Gin Thr Glu Asp Gly Gly Leu 225 230 235 240

Pro Gin Ser Gly Arg lie Go Go Asp Tyr Met Go Gin Lys Ser Gly 245 250 255

Lys Thr Gly Thr lie Thr Tyr Gin Arg Gly leu Leu Pro Gin Lys 260 265 270

Go Trp Cys Ala Ser Gly Arg Ser Lys Go Ile Lys Gly Ser Leu Pro 275 280 285

Leu Ile Gly Glu Ala Asp Cys Leu His Glu Lys Tyr Gly Gly Leu Asn 290 295 300

Lys Ser Lys Pro Tyr Tyr Thr Gly Glu His Ala Lys Ala Ile Gly Asn 305 310 315 320

Cys Proin Trp Val Lys Thr Pro Leu Lys Leu Ala Asn Gly Thr Lys 325 330 335

Tyr Arg Pro Pro Ala Lys Leu Leu Lys Glu Arg Gly Phe Phe Gly Ala 340 345 350 Ile Ala Gly Phe Leu Glu Gly Gly Trp Glu Gly Met Ile Allyl Gly Trp 355 360 365

His Gly Tyr Thr Ser His Gly Ala His Gly Val Ala Val Ala Ala Asp 370 375 380

Leu Lys Ser Thr Gin Glu Ala lie Asn Lys lie Thr Lys Asn Leu Asn 385 390 395 400

Ser Leu Ser Glu Leu Glu Val Lys Asn Leu Gin Arg Leu Ser Gly Ala 405 410 415

Met Asp Glu Leu His Asn Glu leu Glu Leu Asp Glu Lys Val Asp 420 425 430

Asp Leu Arg Ala Asp Thr be Ser Serine Glu Leu Ala Val Leu 435 440 445

Leu Ser Asn Glu Gly Ile lie Asn Ser Glu Asp Glu His Leu Leu Ala 450 455 460

Leu Glu Arg Lys Leu Lys Lys Met Leu Gly Pro Ser Ala Val Glu Ile 465 470 475 480

Gly Asn Gly Cys Phe Glu Thr Lys His Lys Cys Asn Gin Thr Cys Leu 485 490 495

Asp Arg Ile Ala Gly Thr Phe Asp Ala Gly Glu Phe Ser Leu Pro 500 505 510

Thr Phe Asp Ser Leu Asn lie Thr Ala Ala Ser Leu Asn Asp Asp Gly 515 520 525

Leu Asp Asn His Thr lie Leu Leu Tyr Tyr Ser Thr Ala Ala Ser Ser 530 535 540

Leu Ala Val Thr Leu Met lie Ala lie Phe Val Val Tyr Met Val Ser 545 550 555 560

Arg Asp Asn Val Ser Cys Ser is Cys Leu 565 570

<210> 96 <211> 548 <212> PRT <213> Artificial Sequence <220><223> Synthesized Influenza A virus A / Brisbane / 59/2007 (HlNl) <400> 96

Asp Thr Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val 15 10 15

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu 20 25 30

Leu Glu Asn Ser His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 35 40 45

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 50 55 60

Pro Glu Cys Glu Leu Leu lie Ser Lys Glu Ser Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly His Phe Ala 85 90 95

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 100 105 110

Arg Phe Glu Ile Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 115 120 125

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser Ser Phe Tyr 130 135 140

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 145 150 155 160

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 165 170 175

Gly Val His His Pro Pro Asn lie Gly Asn Gin Lys Ala Leu Tyr His 180 185 190

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Lys 195 200 205

Phe Thr Pro Glu Ile Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 210 215 220

Arg Ile Jl.sn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr Ileine 225 230 235 240

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 245 250 255

Ser Arg Gly Phe Gly Ser Gly Ile lie Asn Ser Asn Ala Pro Met Asp 260 265 270

Lys Cys Asp Ala Lys Cys Gin Thr Pro Gin Gly Ala lie Asn Ser Ser 275 280 285

Leu Pro Phe Gin Asn Val His Pro Val Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr is Arg Arg Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn lie 305 310 315 320

Pro Serine Gin Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe lie 325 330 335

Glu Gly Gly Trp Thr Gly Met Go Asp Gly Trp Tyr Gly Tyr His His 340 345 350

Gin Asn Glu Gin Gly Ser Gly Tyr Ala Wing Asp Gin Lys Ser Thr Gin 355 360 365

Asn Ala Ile Asn Gly Ile Thr Asn Lys Go Asn Ser Ile Ile Glu Lys 370 375 380

Met Asn Thr Gin Phe Thr Ala Go Gly Lys Glu Phe Asn Lys Leu Glu 385 390 395 400

Arg Arg Met Glu Asn Leu Asn Lys Lys Go Asp Asp Gly Phe Ile Asp 405 410 415

Ile Trp Thr Tyr Asn Ala Glu Leu Leu Leu Leu Leu Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Go 435 440 445

Lys Ser Gin Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asn Asp Glu Cys Met Glu Ser Vai Lys Asn 465 470 475 480

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg 485 490 495

Glu Lys Ile Asp Gly Vai Lys Leu Glu Ser Met Gly Vai Tyr Gin Ile 500 505 510

Leu Ala Ile Tyr Ser Thr Go Ala Ser Ser Leu Vai Leu Leu Ser Ser 515 520 525

Leu Gly Ala Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg Ile Cys Ile 545

<210> 97 <211> 548 <212> PRT <213> Artificial Sequence <220><223> Synthesized Influenza A virus A / Solomon Islands / 3/2006 (HlNl) <400> 97

Asp Thr Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val 15 10 15

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu 20 25 30

Leu Glu Asp Ser His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 35 40 45

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 50 55 60

Pro Glu Cys Glu Leu Leu Ile Ser Arg Glu Ser Trp Ser Tyr Ile Val 65 70 75 80

Glu Lys Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly His Phe Ala 85 90 95

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 100 105 110

Arg Phe Glu Ile Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Thr 115 120 125

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser Ser Phe Tyr 130 135 140

Lys Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 145 150 155 160

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 165 170 175

Gly Val His His Pro Pro Asn lie Gly Asp Gin Arg Ala Leu Tyr His 180 185 190

Lys Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arq Lys 195 200 205

Phe Thr Pro Glu Ile Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 210 215 220

Arg Ile Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr Ile Ile 225 230 235 240

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 245 250 255

Ser Arg Gly Phe Gly Ser Gly Ile lie Asn Asn Ala Pro Met Asp 260 265 270

Glu Cys Asp Ala Lys Cys Gin Thr Pro Gin Gly Ala lie Asn Ser Ser 275 280 285

Leu Pro Phe Gin Asn Val His Pro Val Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Val Arg Ser Wing Lys Leu Arg Met Val Thr Gly Leu Arg Asn lie 305 310 315 320

Pro Serine Gin Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe lie 325 330 335

Glu Gly Gly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 340 345 350

Gin Asn Glu Gin Gly Ser Gly Tyr Ala Wing Asp Gin Lys Ser Thr Gin 355 360 365

Asn Ala Ile Asn Gly Ile Thr Asn Lys Go Asn Ser Ile Ile Glu Lys 370 375 380

Met Asn Thr Gin Phe Thr Ala Val Gly Lys Glu Phe Asn Lys Leu Glu 385 390 395 400

Arg Arg Met Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe Ile Asp 405 410 415 Ile Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val 435 440 445

Lys Ser Gin Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asn Asp Glu Cys Met Glu Ser Val Lys Asn 465 470 475 480

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg 485 490 495

Glu Lys lie Asp Gly Val Lys Leu Glu Ser Met Gly Val Tyr Gin lie 500 505 510

Leu Ala lie Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Leu Val Ser 515 520 525

Leu Gly Ala Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg Ile Cys Ile 545

<210> 98 <211> 548 <212> PRT <213> Artificial Sequence <220><223> Synthesized Influenza A virus A / New Caledonla / 20/1999 (H1N1) <400> 98

Asp Thr Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val 15 10 15

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu 20 25 30

Leu Glu Asp Ser His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 35 40 45

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 50 55 60

Pro Glu Cys Glu Leu Leu lie Ser Lys Glu Ser Trp Ser Tyr lie Val 65 70 75 80

Glu Thr Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly Tyr Phe Ala 85 90 95

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 100 105 110

Arg Phe Glu Ile Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 115 120 125

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Lys Ser Ser Phe Tyr 130 135 140

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 145 150 155 160

Ser Lys Ser Tyr Val Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 165 170 175

Gly Val His His Pro Pro Asn lie Gly Asn Gin Arg Ala Leu Tyr His 180 185 190

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Arg 195 200 205

Phe Thr Pro Glu Ile Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 210 215 220

Arg Ile Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr Ile Ile 225 230 235 240

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Trp Tyr Ala Phe Ala Leu 245 230 255

Ser Arg Gly Phe Gly Ser Gly Ile lie Thr Ser Asn Ala Pro Met Asp 260 265 270

Glu Cys Asp Ala Lys Cys Gin Thr Pro Gin Gly Ala lie Asn Ser Ser 275 280 285

Leu Pro Phe Gin Asn Val His Pro Val Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Val Arg Ser Wing Lys Leu Arg Met Val Thr Gly Leu Arg Asn lie 305 310 315 320

Pro Serine Gin Ser Arg Gly Leu Phe Gly Ala He Ala Gly Phe lie 325 330 335

Glu Gly Gly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 340 345 350

Gin Asn Glu Gin Gly Ser Gly Tyr Ala Wing Asp Gin Lys Ser Thr Gin 355 360 365

Asn Ala He Asn Gly He Thr Asn Lys Val Asn Ser Val He Glu Lys 370 375 380

Met Asn Thr Gin Phe Thr Ala Val Gly Lys Glu Phe Asn Lys Leu Glu 385 390 395 400

Arg Arg Met Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe Leu Asp 405 410 415 Ile Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val 435 440 445

Lys Ser Gin Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asn Asn Glu Cys Met Glu Ser Val Lys Asn 465 470 475 480

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg 485 490 495

Glu Lys lie Asp Gly Val Lys Leu Glu Ser Met Gly Val Tyr Gin lie 500 505 510

Leu Ala lie Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Leu Val Ser 515 520 525

Leu Gly Ala Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg Ile Cys Ile 545

<210> 99 <211> 547 <212> PRT <213> Artificial Sequence <220><223> Synthesized Influenza A virus A / Slngapore / l / 1957 (H2N2) <400> 99

Asp Gin Ile Cys He Gly Tyr His Ala Asn Asn Ser Thr Glu Lys Val 15 10 15

Asp Thr Ile Leu Glu Arg Asn Val Thr Val Thr His Ala Lys Asp Ile 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Lys Leu Asn Gly He Pro 35 40 45

Pro Leu Glu Leu Gly Asp Cys Ser lie Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Glu Cys Asp Arg Leu Leu Ser Val Pro Glu Trp Ser Tyr He Met 65 70 75 80

Glu Lys Glu Asn Pro Arg Asp Gly Leu Cys Tyr Pro Gly Ser Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Ser Val Lys His Phe Glu 100 105 110

Lys Val Lys He Leu Pro Lys Asp Arg Trp Thr Gin His Thr Thr Thr 115 120 125

Gly Gly Ser Arg Ala Cys Ala Val Ser Gly Asn Pro Ser Phe Phe Arg 130 135 140

Asn Met Val Trp Leu Thr Lys Lys Glu Ser Asn Tyr Pro Val Ala Lys 145 150 155 160

Gly Ser Tyr Asn Asn Thr Ser Gly Glu Gin Met Leu lie Ile Trp Gly 165 170 175

Val His His Asn Asp Asp Glu Thr Glu Gin Arg Thr Leu Tyr Gin Asn 180 185 190

Val Gly Thr Tyr Val Ser Val Gly Thr Ser Thr Leu Asn Lys Arg Ser 195 200 205

Thr Pro Asp lie Ala Thr Arg Pro Lys Val Asn Gly Leu Gly Ser Arg 210 215 220

Met Glu Phe Ser Trp Thr Leu Leu Asp Met Trp Asp Thr lie Asn Phe 225 230 235 240

Glu Ser Thr Gly Asn Leu lie Ala Pro Glu Tyr Gly Phe Lys lie Ser 245 250 255

Lys Arg Gly Ser Ser Gly Ile Met Lys Thr Glu Gly Thr Leu Glu Asn 260 265 270

Cys Glu Thr Lys Cys Gin Thr Pro Leu Gly Ala lie Asn Thr Thr Leu 275 280 285

Pro Phe His Asn Val His Pro Leu Thr Ile Gly Glu Cys Pro Lys Tyr 290 295 300

Val Lys Ser Glu Lys Leu Val Leu Ala Thr Gly Leu Arg Asn Val Pro 305 310 315 320

Gin Ile Glu Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu 325 330 335

Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr Gly Tyr His His Ser 340 345 350

Asn Asp Gin Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gin Lys 355 360 365

Ala Phe Asp Gly Ile Thr Asn Lys Val Asn Ser Val Ile Glu Lys Met 370 375 380

Asn Thr Gin Phe Glu Ala Val Gly Lys Glu Phe Ser Asn Leu Glu Arg 385 390 395 400

Arrr Τ.Α1Ί fll π ZLcn T.ail 71 ο · η Taíc T.we Mat Tiers ϊΐϊΐ UVsta T.an & ev a 1 405 410 415

Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg Thr 420 425 430

Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val Arg 435 440 445

Met Gin Leu Arg Asp Asn Val Lys Glu Leu Gly Asn Gly Cys Phe Glu 450 455 460

Phe Tyr His Lys Cys Asp Asp Glu Cys Met Asn Ser Val Lys Asn Gly 465 470 475 480

Thr Tyr Asp Tyr Pro Lys Tyr Glu Glu Glu Ser Lys Leu Asn Arg Asn 485 490 495

Glu Ile Lys Gly Val Lys Leu Ser Ser Met Gly Val Tyr Gin Ile Leu 500 505 510

Ala Ile Tyr Ala Thr Val Ala Gly Ser Leu Ser Leu Ala Ile Met Met 515 520 525

Ala Gly Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys Arg 530 535 540 Ile Cys Ile 545

<210> 100 <211> 541 <212> PRT <213> Artificial Sequence <220><223> Synthesized [Influenza A virus A / Brisbane / 10/2007 (H3N2) <400> 100

Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr Ile 15 10 15

Val Lys Thr Ile Thr Asn Asp Gin Ile Glu Val Thr Asn Ala Thr Glu 20 25 30

Leu Val Gin Ser Ser Ser Thr Gly Glu lie Cys Asp Ser Pro His Gin 35 40 45 lie Leu Asp Gly Glu Asn Cys Thr Leu lie Asp Ala Leu Leu Gly Asp 50 55 60

Pro Gin Cys Asp Gly Phe Gin Asn Lys Lys Trp Asp Leu Phe Val Glu 65 70 75 80

Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp Tyr 85 90 95

Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe Asn 100 105 110

Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gin Asn Gly Thr Ser Ser 115 120 125

Ala Cys Ile Arg Arg Ser Asn Asn Ser Phe Phe Ser Arg Leu Asn Trp 130 135 140

Leu Thr His Leu Lys Phe Lys Tyr Pro Ala Leu Asn Val Thr Met Pro 145 150 155 160

Asn Asn Glu Lys Phe Asp Lys Leu Tyr Ile Trp Gly Vai His His Pro 165 170 175

Gly Thr Asp Asn Asp Gin Ile Phe Leu Tyr Ala Gin Ala Ser Gly Arg 180 185 190

Ile Thr Will Be Thr Lys Arg Ser Gin Gin Thr Will Ile Pro Asn Ile 195 200 205

Gly Ser Arg Arg Arg Val Arg Arg Pro Arg Arg Ile Ser Ile Tyr 210 215 220

Trp Thr Ile Ile Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr Gly 225 230 235 240

Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys Ser 245 250 255

Ser is Met Arg Ser Asp Ala Proly Gly Lys Cys Asn Ser Glu Cys 260 265 270 lie Thr Pro Asn Gly Ser is Pro Asn Asp Lys Pro Phe Gin Asn Go 275 280 285

Asn Arg is Thr Tyr Gly Ala Cys Pro Arg Tyr Is Lys Gin Asn Thr 290 295 300

Leu Lys Leu Ala Thr Gly Met Arg Asn Go Pro Glu Lys Gin Thr Arg 305 310 315 320

Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly 325 330 335

Met Val Asp Gly Trp Tyr Gly Phe Arg His Gin Asn Ser Glu Gly Ile 340 345 350

Gly Gin Wing Wing Asp Leu Lys Ser Thr Gin Wing Wing Ile Asp Gin Ile 355 360 365

Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe His 370 375 380

Gin Ile Glu Lys Glu Phe Ser Glu Vai Glu Gly Arg Ile Gin Asp Leu 385 390 395 400

Glu Lys Tyr Go Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn Ala 405 410 415

Glu Leu Leu Leu Leu Glu Asn Gin His Thr Ile Asp Leu Thr Asp 420 425 430

Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gin Leu Arg Glu 435 440 445

Asn Ala Glu Asp Met Gly J: snGly Cys Phe Lys lie Tyr His Lys Cys 450 455 460

Asp Asn Ala Cys He Gly Ser Ile Arg Asn Gly Thr Tyr Asp His Asp 465 470 475 480

Val Tyr Arg Asp Glu Ala Leu Asn Asn Arg Phe Gin lie Lys Gly Val 485 490 495

Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe Ala 500 505 510

Ile Ser Cys Phe Leu Leu Cys Leu Leu Leu Gly Phe lie Met Trp 515 520 525

Ala Cys Gin Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile 530 535 540

<210> 101 <211> 541 <212> PRT <213> Artificial Sequence <220><223> Synthesized A / Wisconsin / 67e5 / 2005 (H3) <400> 101

Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr Ile 15 10 15

Val Lys Thr Ile Thr Asn Asp Gin Ile Glu Val Thr Asn Ala Thr Glu 20 25 30

Leu Val Gin Ser Ser Ser Thr Gly Gly th Cys Asp Ser Pro His Gin 35 40 45 lie Leu Asp Gly Glu Asn Cys Thr Leu lie Asp Ala Leu Leu Gly Asp 50 55 60

Pro Gin Cys Asp Gly Phe Gin Asn Lys Lys Trp Asp Leu Phe Val Glu 65 70 75 80

Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp Tyr 85 90 95

Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe Asn 100 105 110

Asp Glu Ser Phe Asn Trp Thr Gly Val Thr Gin Asn Gly Thr Ser Ser 115 120 125

Ala Cys Lys Arg Arg Ser Asn Asn Ser Phe Phe Ser Arg Leu Asn Trp 130 135 140

Leu Thr His Leu Lys Phe Lys Tyr Pro Ala Leu Asn Val Thr Met Pro 145 150 155 160

Asn Asn Glu Lys Phe Asp Lys Leu Tyr Ile Trp Gly Val His His Pro 165 170 175

Gly Thr Asp Asn Asp Gin lie Phe Leu His Ala Gin Ala Ser Gly Arg 180 185 190 lie Thr Val Ser Thr Lys Arg Ser Gin Gin Thr Val lie Pro Asn lie 195 200 205

Gly-Ser-Arg-Arg-Arg-Arg-Asn-Pro-Ser-Arg-Arg-Ser-Tyr-210 215 220

Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr Gly 225 230 235 240

Asn Leu He Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys Ser 245 250 255

Ser He Met Arg Ser Asp Ala Pro He Gly Lys Cys Asn Ser Glu Cys 260 265 270

He Thr Pro Asn Gly Ser He Pro Asn Asp Lys Pro Phe Gin Asn Val 275 280 285

Asn Arg He Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gin Asn Thr 290 295 300

Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gin Thr Arg 305 310 315 320

Gly He Phe Gly Ala He Ala Gly Phe He Glu Asn Gly Trp Glu Gly 325 330 335

Met Val Asp Gly Trp Tyr Gly Phe Arg His Gin Asn Ser Glu Gly He 340 345 350

Gly Gin Wing Wing Asp Leu Lys Ser Thr Gin Wing Wing Asn Gin lie 355 360 365

Asn Gly Lys Leu Asn Arg Leu He Gly Lys Thr Asn Glu Lys Phe His 370 375 380

Gin He Glu Lys Glu Phe Ser Glu Val Glu Gly Arg lie Gin Asp Leu 385 390 395 400

Glu Lys Tyr Val Glu Asp Thr Lys He Asp Leu Trp Ser Tyr Asn Ala 405 410 415

Glu Leu Leu Val Ala Leu Glu Asn Gin His Thr lie Asp Leu Thr Asp 420 425 430

Ser Glu Met Asn Lys Leu Phe Glu Arg Thr Lys Lys Gin Leu Arg Glu 435 440 445

Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys He Tyr His Lys Cys 450 455 460

Asp Asn Ala Cys He Gly Ser He Arg Asn Gly Thr Tyr Asp His Asp 465 470 475 480

Val Tyr Arg Asp Glu Ala Leu Asn Asn Arg Phe Gin He Lys Gly Val 485 490 495

Glu Leu Lys Ser Gly Tyr Lys Asp Trp He Leu Trp He Ser Phe Ala 500 505 510 lie Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe lie Met Trp 515 520 525

Ala Cys Gin Lys Gly Asn lie Arg Cys Asn lie Cys lie 530 535 540

-OC

<210> 102 <211> 551 <212> PRT <213> Artificial Sequence <220><223> Synthesized Influenza A virus A / Anhui / 1/2005 (H5N1) <400102

Asp Gin Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp Ile 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val 65 70 75 80

Glu Lys Ala Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu 100 105 110

Lys Ile Ginyl Ile Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser 115 120 125

Ser Gly Val Ser Ser Cys Pro Tyr Gin Gly Thr Pro Ser Phe Phe 130 135 140

Arg Asn Val Val Trp Leu lie Lys Lys Asn Asn Thr Tyr Pro Thr lie 145 150 155 160

Lys Arg Ser Tyr Asn Asn Thr Asn Gin Glu Asp Leu Leu lie Leu Trp 165 170 175

Gly His His Ser Asn Asp Ala Ala Glu Gin Thr Lys Leu Tyr Gin 180 185 190

Asn Pro Thr Thr Tyr He Ser Val Gly Thr Ser Thr Leu Asn Gin Arg 195 200 205

Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gin Ser Gly 210 215 220

Arg Met Asp Phe Phe Trp Thr He Leu Lys Pro Asn Asp Ala He Asn 225 230 235 240

Phe Glu Ser Asn Gly Asn Phe He Ala Pro Glu Tyr Ala Tyr Lys lie 245 250 255

Val Lys Lys Gly Asp Ser Ala He Val Lys Ser Glu Val Glu Tyr Gly 260 265 270

Asn Cys Asn Thr Lys Cys Gin Thr Proly Gly Ala Ile Asn Ser Ser 275 280 285

Met Pro Phe His Asn lie His Pro Leu Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Val Lys Ser Asn Lys Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 305 310 315 320

Pro Leu Arg Glu Arg Arg Arg Lys Arg Gly Leu Phe Gly Ala lie Ala 325 330 335

Gly Phe He Glu Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr Gly 340 345 350

Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys Glu 355 360 365

Ser Thr Gin Lys Ala lie Asp Gly Val Thr Asn Lys Val Asn Ser He 370 375 380

He Asp Lys Met Asn Thr Gin Phe Glu Ala Val Gly Arg Glu Phe Asn 385 390 395 400

Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp Gly 405 410 415

Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met Glu 420 425 430

Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr 435 440 445

Asp Lys Val Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly Asn 450 455 460

Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu Ser 465 470 475 480

Val Arg Asn Gly Thr Tyr Asp Tyr Pro Gin Tyr Ser Glu Glu Ala Arg 485 490 495

Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly Thr 500 505 510

Tyr Gin He Leu Ser He Tyr Ser Thr Val Ala Ser Ser Leu Ala Leu 515 520 525

Ala Ile Met Val Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly Ser 530 535 540

Leu Gin Cys Arg He Cys He 545 550

<210> 103 <211> 552 <212> PRT <213> Artificial Sequence <220 <223> Synthesized [Influenza A virus ANietnam / 1194/2004 (H5N1) <400103

Asp Gin Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp Ile 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val 65 70 75 80

Glu Lys Ala Asn Pro val Asn Asp Leu Cys Tyr Pro Gly Asp Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu 100 105 110

Lys Ile Ginyl Ile Pro Lys Ser Ser Trp Ser Ser His Glu Ala Ser 115 120 125

Leu Gly Val Ser Ser Wing Cys Pro Tyr Gin Gly Lys Ser Ser Phe Phe 130 135 140

Arg Asn Val Val Trp Leu lie Lys Lys Asn Ser Thr Tyr Pro Thr Ile 145 150 155 160

Lys Arg Ser Tyr Asn Asn Thr Asn Gin Glu Asp Leu Leu Val Leu Trp 165 170 175

Gly His His Pro Lys Asp Ala Ala Glu Gin Thr Lys Leu Tyr Gin 1B0 185 190

Asn Pro Thr Thr Tyr Ile Ser Gly Thr Ser Thr Leu Asn Gin Arg 195 200 205

Leu Val Pro Arg Ile Ala Thr Arg Ser Lys Val Asn Gly Gin Ser Gly 210 215 220

Arg Met Glu Phe Phe Trp Thr He Leu Lys Pro Asn Asp Ala lie Asn 225 230 235 240

Phe Glu Ser Asn Gly Asn Phe He Ala Pro Glu Tyr Ala Tyr Lys He 245 250 255

Val Lys Lys Gly Asp Ser Thr lie Met Lys Ser Glu Leu Glu Tyr Gly 260 265 270

Asn Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala Ile Asn Ser Ser 275 280 285

Met Pro Phe His Asn He His Pro Leu Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Go Lys Ser Asn Arg Leu Go Leu Ala Thr Gly Leu Arg Asn Ser 305 310 315 320

Pro Gin Arg Glu Arg Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile 325 330 335

Ala Gly Phe Ile Glu Gly Gly Trp Gin Gly Met Go Asp Gly Trp Tyr 340 345 350

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 355 360 365

Glu Ser Thr Gin Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser 370 375 380 Ile Ile Asp Lys Met Asn Thr Gin Phe Glu Ala Val Gly Arg Glu Phe 385 390 395 400

Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp 405 410 415

Gly Phe Leu Asp Go Trp Thr Tyr Asn Ala Glu Leu Leu Go Leu Met 420 425 430

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 435 440 445

Tyr Asp Lys Go Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 450 455 460

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 465 470 475 480

Ser Go to Arg Asn Gly Thr Tyr Asp Tyr Pro Gin Tyr Ser Glu Glu Ala 485 490 495

Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly 500 505 510

Ile Tyr Gin Ile Leu Ser Ile Tyr Ser Thr Go Ala Ser Ser Leu Ala 515 520 525

Leu Ala lie Met Val Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 530 535 540

Ser Leu Gin Cys Arg lie Cys lie 545 550

<210> 104 <211> 553 <212> PRT <213> Artificial sequence <220><223> Synthesized A / lndonesia / 5/2005 (H5N1) <400> 104

Asp Gin Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp Ile 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val 65 70 75 80

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Pro Gly Ser Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu 100 105 110

Lys Ile Gin Ile He Lys Ser Ser Trp Ser Asp His Glu Ala Ser 115 120 125

Ser Gly Val Ser Ser Cys Pro Tyr Leu Gly Ser Pro Ser Phe Phe 130 135 140

Arg Asn Val Val Trp Leu lie Lys Lys Asn Ser Thr Tyr Pro Thr Ile 145 150 155 160

Lys Lys Ser Tyr Asn Asn Thr Asn Gin Glu Asp Leu Leu Val Leu Trp 165 170 175

Gly He His His Pro Asn Asp Ala Ala Glu Gin Thr Arg Leu Tyr Gin 180 185 190

Asn Pro T r Thr Tyr He Ser is Gly Thr Ser Thr Leu Asn Gin Arg 195 200 205

Leu Val Pro Lys He Ala Thr Arg Ser Lys Val Asn Gly Gin Ser Gly 210 215 220

Arg Met Glu Phe Phe Trp Thr He Leu Lys Pro Asn Asp Ala lie Asn 225 230 235 240

Phe Glu Ser Asn Gly Asn Phe He Ala Pro Glu Tyr Ala Tyr Lys He 245 250 255

Val Lys Lys Gly Asp Ser Ala He Met Lys Ser Glu Leu Glu Tyr Gly 260 265 270

Asn Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala He Asn Ser Ser 275 280 285

Met Pro Phe His Asn He His Pro Leu Thr He Gly Glu Cys Pro Lys 290 295 300

Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 305 310 315 320

Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala lie 325 330 335

Ala Gly Phe Ile Glu Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr 340 345 350

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 355 360 365

Glu Ser Thr Gin Lys Ala lie Asp Gly Val Thr Asn Lys Val Asn Ser 370 375 380 Ile lie Asp Lys Met Asn Thr Gin Phe Glu Ala Val Gly Arg Glu Phe 385 390 395 400

Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp 405 410 415

Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met 420 425 430

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 435 440 445

Tyr Asp Lys Val Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 450 455 460

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 465 470 475 480

Ser is Arg Asn Gly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala 485 490 495

Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly 500 505 510

Thr Tyr Gin Ile Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Ala 515 520 525

Leu Ala Ile Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 530 535 540

Ser Leu Gin Cys Arg Ile Cys lie Lys 545 550 <210> 105

<211> 548 <212> PRT <213> Artificial Sequence <220><223> Construct 900 <400> 105

Asp Gin Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp He 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe He Asn Val Pro Glu Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Pro Tyr Asp Val Pro 85 90 95

Asp Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu 100 105 110

Phe Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gin Asn Gly Thr 115 120 125

Ser Ser Ala Cys lie Arg Arg Ser Asn Asn Ser Phe Phe Ser Arg Leu 130 135 140

Asn Trp Leu Thr His Leu Lys Phe Lys Tyr Pro Ala Leu Asn Val Thr 145 150 155 160

Met Pro Asn Asn Glu Lys Phe Asp Lys Leu Tyr He Trp Gly Val His 165 170 175

His Pro Gly Thr Asp Asn Asp Gin lie Phe Leu Tyr Ala Gin Ala Ser 180 185 190

Gly Arg He Thr Val Ser Thr Lys Arg Ser Gin Gin Thr Val Ile Pro 195 200 205

Asn He Gly Ser Arg Pro Arg Val Arg Asn He Pro Ser Arg He Ser 210 215 220

He Tyr Trp Thr He Val Lys Pro Gly Asp He Leu Leu He Asn Ser 225 230 235 240

Thr Gly Asn Leu He Ala Pro Arg Cly Tyr Phe Lys He Arg Ser Gly 245 250 255

Lys Ser Ser He Met Lys Ser Glu Leu Glu Tyr Gly Asn Cys Asn Thr 260 265 270

Lys Cys Gin Thr Pro Met Gly Ala He Asn Ser Ser Met Pro Phe His 275 280 285

Asn He His Pro Leu Thr Ile Cly Glu Cys Pro Lys Tyr Val Lys Ser 290 295 300

Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser Pro Gin Arg Glu 305 310 315 320

Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala He Ala Gly Phe He 325 330 335

Glu Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr Cly Tyr His His 340 345 350

Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gin 355 360 365

Lys Ala He Asp Gly Val Thr Asn Lys Val Asn Ser He He Asp Lys 370 375 380

Met Asn Thr Gin Phe Glu Ala Val Gly Arg Glu Phe Asn Asn Leu Glu 385 390 395 400

Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp 405 410 415

Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val 435 440 445

Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu Ser is Arg Asn 465 470 475 480

Gly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala Arg Leu Lys Arg 485 490 495

Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly Thr Tyr Gin Ile 500 505 510

Leu Ser is Tyr Ser Thr Val Ala Ser Ser Leu Ala Leu Ala lie Met 515 520 525

Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg Ile Cys Ile 545

<210> 106 <211> 565 <212> PRT <213> Artificial Sequence <220><223> Construct 745 <400> 106

Asp Gin Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp Ile 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val 65 70 75 80

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Protein Met His Asp 85 90 95

Arg Thr Lys He Arg Gin Leu Pro Asn Leu Leu Arg Gly Tyr Glu Asn 100 105 110 Ile Arg Leu Ser Thr Gin Asn Val He Asp Ala Glu Lys Ala Pro Gly 115 120 125

Gly Pro Tyr Arg Leu Gly Thr Ser Gly Ser Cys Pro Asn Ala Thr Ser 130 135 140

Lys Ser Gly Phe Phe Ala Thr Met Ala Trp Ala val Pro Lys Asp Asn 145 150 155 160

Asn Lys Asn Ala Thr Asn Pro Leu Thr Val Glu Val Pro Tyr He Cys 165 170 175

Thr Glu Gly Glu Asp Gin He Thr Val Trp Gly Phe His Ser Asp Asn 180 185 190

Lys Thr Gin Met Lys Asn Leu Tyr Gly Asp Ser Asn Pro Gin Lys Phe 195 200 205

Thr Ser Ser Ala Asn Gly Val Thr Thr His Tyr Val Ser Gin lie Gly 210 215 220

Ser Phe Pro Asp Gin Thr Glu Asp Gly Gly Leu Pro Gin Ser Gly Arg 225 230 235 240

He Val Val Asp Tyr Met Met Gin Lys Pro Gly Lys Thr Gly Thr He 245 250 255

Val Tyr Gin Arg Gly Val Leu Leu Pro Gin Lys Val Trp Cys Ala Ser 260 265 270

Gly Arg Ser Lys He Met Lys Ser Glu Leu Glu Tyr Gly Asn Cys Asn 275 280 285

Thr Lys Cys Gin Thr Pro Met Gly Ala Ile Asn Ser Ser Met Pro Phe 290 295 300

His Asn He His Pro Leu Thr He Gly Glu Cys Pro Lys Tyr Val Lys 305 310 315 320

Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser Pro Gin Arg 325 330 335

Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe 340 345 350 Ile Glu Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr Gly Tyr His 355 360 365

His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr 370 375 380

Gin Lys Ala Ile Asp Gly Go Thr Asn Lys Go Asn Ser Ile Ile Asp 385 390 395 400

Lys Met Asn Thr Gin Phe Glu Ala Go Gly Arg Glu Phe Asn Asn Leu _405_410_415

Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu 420 425 430

Asp Go Trp Thr Tyr Asn Ala Glu Leu Leu Go Leu Met Glu Asn Glu 435 440 445

Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys 450 455 460

Go Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys 465 470 475 480

Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu Ser Ile Arg 485 490 495

Asn Gly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala Arg Leu Lys 500 505 510

Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly Thr Tyr Gin 515 520 525

Ile Leu Ser Ile Tyr Ser Thr Go Ala Ser Ser Leu Ala Leu Ala Ile 530 535 540

Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gin 545 550 555 560

Cys Arg Ile Cys Ile 565

<210> 107 <211> 545 <212> PRT <213> Artificial Sequence <22Q><223> Construct 910 <400> 107

Asp Gin Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp Ile 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Ser Pro His Histoin Gin 35 40 45

Leu Asp Gly Glu Asn Cys Thr Leu lie Asp Ala Leu Leu Gly Asp Pro 50 55 60

Gin Cys Asp Gly Phe Gin Asn Lys Lys Trp Asp Leu Phe Val Glu Arg 65 70 75 80

Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala 85 90 95

Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe Asn Asn 100 105 110

Glu Ser Phe Asn Trp Thr Gly Go Thr Gin Asn Gly Thr Ser Ser Ala 115 120 125

Cys Ile Arg Arg Ser Asn Asn Ser Phe Phe Ser Arg Leu Asn Trp Leu 130 135 140

Thr His Leu Lys Phe Lys Tyr Pro Ala Leu Asn Go Thr Met Pro Asn 145 150 155 160

Asn Glu Lys Phe Asp Lys Leu Tyr Ile Trp Gly Val His His Gly 165 170 175

Thr Asp Asn Asp Gin Ile Phe Leu Tyr Ala Gin Ala Ser Gly Arg Ile 180 185 190

Thr Will Be Thr Lys Arg Ser Gin Gin Thr Go Pro Pro Asn Ile Gly 195 200 205

Ser Arg Arg Arg Arg Arg Asn lie Pro Arg Arg Ile Ser Ile Tyr Trp 210 215 220

Thr He Vai Lys Pro Gly Asp He Leu Leu lie Asn be Thr Gly Asn 225 230 235 240

Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys Ser Ser 245 250 255 Ile Met Arg Ser Asp Ala Prole Gly Lys Cys Asn Thr Lys Cys Gin 260 265 270

Thr Pro Met Gly Ala Ile Asn Ser Ser Met Pro Phe His Asn lie His 275 280 285

Pro Leu Thr Ile Gly Glu Cys Pro Lys Tyr Val Lys Ser Asn Arg Leu 290 295 300

Val Leu Ala Thr Gly Leu Arg Asn Ser Pro Gin Arg Glu Ser Arg Arg 305 310 315 320

Lys Lys Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly 325 330 335

Trp Gin Gly Met Val Asp Gly Trp Tyr Gly Tyr His His Asn Glu 340 345 350

Gin Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gin Lys Ala He 355 360 365

Asp Gly Val Thr Asn Lys Val Asn Ser Ile lie Asp Lys Met Asn Thr 370 375 380

Gin Phe Glu Ala Val Gly Arg Glu Phe Asn Asn Leu Glu Arg Arg Ile 385 390 395 400

Glu Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp Val Trp Thr 405 410 415

Tyr Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg Thr Leu Asp 420 425 430

Phe His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val Arg Leu Gin 435 440 445

Leu Arg Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe Glu Phe Tyr 450 455 460

His Lys Cys Asp Asn Glu Cys Met Glu Ser Ile Arg Asn Gly Thr Tyr 465 470 475 480

Asn Tyr Pro Gin Tyr Ser Glu Glu Ala Arg Leu Lys Arg Glu Glu Ile 485 490 495

Ser Gly Val Lys Leu Glu Ser lie Gly Thr Tyr Gin lie Leu Ser lie 500 505 510

Tyr Ser Thr Val Ala Ser Ser Leu Ala Leu Ala lie Met Met Ala Gly 515 520 525

Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gin Cys Arg Ile Cys 530 535 540

He 545

<210> 108 <211> 556 <212> PRT <213> Artificial Sequence <220 <223> Construct 920 <400108

Asp Gin Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp Ile 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Pro Asp Cys Leu Asn Cys 35 40 45

Thr Asp Leu Asp Val Ala Leu Gly Arg Pro Met Cys Val Gly Thr Thr 50 55 60

Pro Ser Ala Lys Ala Ser is Leu His Glu Val Lys Pro Val Thr Ser 65 70 75 80

Gly Cys Phe Proly Met His Asp Arg Thr Lys lie Arg Gin Leu Pro 85 90 95

Asn Leu Arg Gly Tyr Glu Asn Ile Arg Leu Ser Thr Asn Val 100 105 110 Asp Ala Glu Lys Ala Pro Gly Gly Pro Tyr Arg Leu Gly Thr Ser 115 120 125

Gly Ser Cys Pro Asn Ala Thr Ser Lys Ser Gly Phe Phe Ala Thr Met 130 135 140

Ala Trp Wing Val Pro Lys Asp Asn Asn Lys Asn Ala Thr Asn Pro Leu 145 150 155 160

Thr Go Glu Go Pro Tyr Ile Cys Thr Glu Gly Glu Asp Gin Ile Thr 165 170 175

Val Trp Gly Phe His Ser Asp Asn Lys Thr Gin Met Lys Asn Leu Tyr 180 185 190

Gly Asp Ser Asn Pro Gin Lys Phe Thr Ser Ser Ala Asn Gly Val Thr 195 200 205

Thr His Tyr Val Ser Gin lie Gly Ser Phe Pro Asp Gin Thr Glu Asp 210 215 220

Gly Gly Leu Pro Gin Ser Gly Arg Ile Val Val Asp Tyr Met Met Gin 225 230 235 240

Lys Pro Gly Lys Thr Gly Thr lie Val Tyr Gin Arg Gly Val Leu Leu 245 250 255

Pro Gin Lys Val Trp Cys Ala Ser Gly Arg Ser Lys Valine Lys Gly 260 265 270

Ser Leu Pro Leu Ile Gly Glu Ala Asp Cys Gin Thr Pro Met Gly Ala 275 280 285 Ile Asn Ser Ser Met Pro Phe His Asn lie His Pro Leu Thr lie Gly 290 295 300

Glu Cys Pro Lys Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly 305 310 315 320

Leu Arg Asn Ser Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu 325 330 335

Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp Gin Gly Met Val 340 345 350

Asp Gly Trp Tyr Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr 355 360 365

Ala Ala Asp Lys Glu Ser Thr Gin Lys Ala lie Asp Gly Val Thr Asn 370 375 380

Lys Val Asn Ser is Ile Asp Lys Met Asn Thr Gin Phe Glu Ala Val 385 390 395 400

Gly Arg Glu Phe Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys 405 410 415

Lys Met Glu Asp Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu 420 425 430

Leu Val Leu Met Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn 435 440 445

Go Lys Asn Leu Tyr Asp Lys Go Arg Leu Gin Leu Arg Asp Asn Ala 450 455 460

Lys Glu Leu Gly Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn 465 470 475 480

Glu Cys Met Glu Ser Ile Arg Asn Gly Thr Tyr Asn Tyr Pro Gin Tyr 485 490 495

Ser Glu Glu Ala Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu 500 505 510

Glu Ser Ile Gly Thr Tyr Gin Ile Leu Ser Ile Tyr Ser Thr Val Ala 515 520 525

Ser Ser Leu Wing Leu Wing Met Met Wing Wing Gly Leu Ser Leu Trp Met 530 535 540

Cys Ser Asn Gly Ser Leu Gin Cys Arg Ile Cys Ile 545 550 555

<210> 109 <211> 548 <212> PRT <213> Artificial Sequence <220><223> Construct 930 <400> 109

Asp Thr Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val 15 10 15

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu 20 25 30

Leu Glu Asp Ser His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val 65 70 75 80

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Pro Gly Ser Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu 100 105 110

Lys Ile Ginyl Ile Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser 115 120 125

Ser Gly Val Ser Ser Cys Pro Tyr Leu Gly Ser Pro Ser Phe Phe 130 135 140

Arg Asn Val Val Trp Leu lie Lys Lys Asn Ser Thr Tyr Pro Thr Ile 145 150 155 160

Lys Lys Ser Tyr Asn Asn Thr Asn Gin Glu Asp Leu Leu Val Leu Trp 165 170 175

Gly His His Pro Asn Asp Ala Ala Glu Gin Thr Arg Leu Tyr Gin 180 185 190

Asn Pro Thr Thr Tyr Ile Ser Gly Thr Ser Thr Leu Asn Gin Arg 195 200 205

Leu Val Pro Lys lie Ala Thr Arg Ser Lys Val Asn Gly Gin Ser G: '.. and 210 215 220

Arg Met Glu Phe Phe Trp Thr lie Leu Lys Pro Asn Asp Ala lie Asn 225 230 235 240

Phe Glu Ser Asn Gly Asn Phe lie Ala Fro Glu Tyr Ala Tyr Lys lie 245 250 255

Val Lys Lys Gly Asp Ser Ala Ile Met Lys Ser Glu Leu Glu Tyr Gly 260 265 270

Asn Cys Asp Ala Lys Cys Gin Thr Pro Gin Gly Ala lie Asn Ser Ser 275 280 285

Leu Pro Phe Gin Asn Val His Pro Val Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Val Arg Ser Wing Lys Leu Arg Met Val Thr Gly Leu Arg Asn lie 305 310 315 320

Pro Serine Gin Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe lie 325 330 335

Glu Gly Sly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 340 345 350

Gin Asn Slu Gin Gly Ser Gly Tyr Ala Wing Asp Gin Lys Ser Thr Gin 355 360 365

Asn Ala Ile Asn Gly Ile Thr Asn Lys Val Asn Ser Val Ile Glu Lys 370 375 380

Met Asn Thr Gin Phe Thr Ala Val Gly Lys Glu Phe Asn Lys Leu Glu 385 390 395 400

Arg Arg Met Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe Leu Asp 405 410 415 Ile Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val 435 440 445

Lys Ser Gin Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asn Asn Glu Cys Met Glu Ser Val Lys Asn 465 470 475 480

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg 485 490 495

Glu Lys lie Asp Sly Val Lys Leu Glu Ser Met Gly Val Tyr Gin lie 500 505 510

Leu Ala lie Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Leu Val Ser 515 520 525

Leu Gly Ala Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg Ile Cys Ile 545 <210> 110 <400> 110,000

<210> 111 <211> 552 <212> PRT <2U> Artificial Sequence <220><223> Construct 690 and 734 <400> 111

Asp Gin Ile Cys Ι 1θ Gly Tyr His Ala Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp Ile 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 35 40 45

Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 50 55 60

Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val 65 70 75 80

Glu Lys Ala Asn Pro Thr Asn Asp Leu Cys Tyr Pro Gly His Phe Ala 85 90 95

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 100 105 110

Arg Phe Glu Ile Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 115 120 125

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser Ser Phe Tyr 130 135 140

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 145 150 155 160

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 165 170 175

Gly Val His His Pro Pro Asn lie Gly Asp Gin Lys Ala Leu Tyr His 180 185 190

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Lys 195 200 205

Phe Thr Pro Glu Ile Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 210 215 220

Arg Ile Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr Ile Ile 225 230 235 240

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 245 250 255

Ser Arg Gly Phe Gly Ser Gly Ile Met Lys Ser Glu Leu Glu Tyr Gly 260 265 270

Asn Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala Ile Asn Ser Ser 275 280 285

Met Pro Phe His Asn lie His Pro Leu Thr lie Gly Glu Cys Pro Lys 290 295 300

Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 305 310 315 320

Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala lie 325 330 335

Ala Gly Phe Ile Glu Gly Gly Trp Gin Gly Met Val Asp Gly Trp Tyr 340 345 350

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 355 360 365

Glu Ser Thr Gin Lys Ala lie Asp Gly Val Thr Asn Lys Val Asn Ser 370 375 380 lie He Asp Lys Met Asn Thr Gin Phe Glu Ala Val Cly Arg Glu Phe 385 390 395 400

Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys V: et Glu Asp 405 410 415

Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met 420 425 430

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 435 440 445

Tyr Asp Lys Val Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 450 455 460

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 465 470 475 480

Ser is Arg Arg.snGly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala 4B5 490 495

Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly 500 505 510

Thr Tyr Gin Ile Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Ala 515 520 525

Leu Ala Ile Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 530 535 540

Ser Leu Gin Cys Arg lie Cys lie 545 550

<210> 112 <211> 548 <212> PRT <213> Artificial Sequence <220><223> Construct 696 <400> 112

Asp Thr Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val 15 10 15

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu 20 25 30

Leu Glu Asp Ser His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 35 40 45

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 50 55 60

Pro Glu Cys Glu Leu Leu lie Ser Lys Glu Ser Trp Ser Tyr lie Val 65 70 75 80

Glu Thr Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly Ser Phe Asn 85 90 95

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu 100 105 110

Lys Ile Ginyl Ile Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser 115 120 125

Ser Gly Val Ser Ser Cys Pro Tyr Leu Gly Ser Pro Ser Phe Phe 130 135 140

Arg Asn Val Val Trp Leu lie Lys Lys Asn Ser Thr Tyr Pro Thr Ile 145 150 155 160

Lys Lys Ser Tyr Asn Asn Thr Asn Gin Glu Asp Leu Leu Val Leu Trp 165 170 175

Gly His His Pro Asn Asp Ala Ala Glu Gin Thr Arg Leu Tyr Gin 180 185 190

Asn Pro Thr Thr Tyr Ile Ser Gly Thr Ser Thr Leu Asn Gin Arg 195 200 205

Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gin Ser Gly 210 215 220

Arg Met Glu Phe Phe Trp Thr lie Leu Lys Pro Asn Asp Ala lie Asn 225 230 235 240

Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Tyr Ala Tyr Lys Ile 245 250 255

Go Lys Lys Gly Asp Be Ala He ile Thr be Asn Ala Pro Met Asp 260 265 270

Glu Cys Asp Ala Lys Cys Gin Thr Pro Gin Gly Ala Ile Asn Ser Ser 275 280 285

Leu Pro Phe Gin Asn Val His Pro Val Thr Ile Gly Glu Cys Pro Lys 290 295 300

Tyr Val Arg Ser Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn Ile 305 310 315 320

Pro Ser Ile Gin Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile 325 330 335

Glu Gly Gly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 340 345 350

Gin Asn Glu Gin Gly Ser Gly r, yr Ala Ala Asp Gin Lys Ser Thr Gin 355 360 365

Asn Ala Ile Asn Gly Ile Thr Asn Lys Val Asn Ser Val Ile Glu Lys 370 375 380

Met Asn T r Gin Phe Thr Ala Val Gly Lys Glu Phe Asn Lys Leu Glu 385 390 395 400

Arg Arg Met Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe Leu Asp 405 410 415

Ile Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg 420 425 430

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val 435 440 445

Lys Ser Gin Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys Phe 450 455 460

Glu Phe Tyr His Lys Cys Asn Asn Glu Cys Met Glu Ser Val Lys Asn 465 470 475 480

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg 485 490 495

Glu Lys lie Asp Gly Val Lys Leu Glu Ser Met Gly Val Tyr Gin lie 500 505 510

Leu Ala lie Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Leu Val Ser 515 520 525

Leu Gly Ala Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gin Cys 530 535 540

Arg Ile Cys Ile 545

<210> 113 <211> 552 <212> PRT <213> Artificial Sequence <220 c223> Construct 691 <400113

Asp Gin Ile Cys Ile Gly Tyr His A Asn Asn Ser Thr Glu Gin Val 15 10 15

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gin Asp Ile 20 25 30

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Leu Leu Lys Gly lie Ala 35 40 45

Pro Leu Gin Leu Gly Asn Cys Ser Val Ala Gly Trp lie Leu Gly Asn 50 55 60

Pro Glu Cys Glu Leu Leu lie Ser Lys Glu Ser Trp Ser Tyr lie Val 65 70 75 80

Glu Lys Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly His Phe Ala 85 90 95

Asp Tyr Glu Glu Leu Arg Glu Gin Leu Ser Ser Val Ser Ser Phe Glu 100 105 110

Arg Phe Glu Ile Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val 115 120 125

Thr Gly-Val-Ser-Al-Ser-Ser-Cys-Ser-As-Gly-Glu-Ser-Ser-Phe-Tyr-130 135 140

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu 145 150 155 160

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp 165 170 175

Gly Val His His Pro Pro Asn Heg-Asp Gin Lys Ala Leu Tyr His 180 lfl5 190

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Lys 195 200 205

Phe Thr Pro Glu Ile Ala Lys Arg Pro Lys Val Arg Asp Gin Glu Gly 210 215 220

Arg He Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr He He 225 230 235 240

Phe Glu Ala Asn Gly Asn Leu lie Ala Pro Arg Tyr Ala Phe Ala Leu 245 250 255

Ser Arg Gly Phe Gly Ser Gly Ile lie Asn Ser Asn Ala Pro Met Asp 260 265 270

Lys Cys Asn Thr Lys Cys Gin Thr Pro Met Gly Ala lie

Asn Ser Ser 275 280 285

Met Pro Phe His Asn lie His Pro Leu Thr lie Gly Glu

Cys Pro Lys 290 295 300

Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu

Arg Asn Ser 305 310 315 320

Pro Gin Arg Glu Ser Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala He 325 330 335

Ala Gly Phe Ile Glu Gly Gly Trp Gin Gly Met Val Asp

Gly Trp Tyr 340 345 350

Gly Tyr His His Ser Asn Glu Gin Gly Ser Gly Tyr Ala Ala Asp Lys 355 360 365

Glu Ser Thr Gin Lys Ala He Asp Gly Val Thr Asn Lys Val Asn Ser 370 375 380 lie Ile Asp Lys Met Asn Thr Gin Phe Glu Ala Val Gly Arg Glu Phe 385 390 395 400

Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu 405 410 415

Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu

Val Leu Met 420 425 430

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 435 440 445

Tyr Asp Lys Val Arg Leu Gin Leu Arg Asp Asn Ala Lys Glu Leu Gly 450 455 460

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu 465 470 475 480

Ser He Arg Asn Gly Thr Tyr Asn Tyr Pro Gin Tyr Ser Glu Glu Ala 485 490 495

Arg Leu Lys Arg Glu Glu He Ser Gly Val Lys Leu Glu

Ser lie Gly 500 505 510

Thr Tyr Gin Ile Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Ala 515 520 525

Leu Ala Ile Met Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly 530 535 540

Ser Leu Gin Cys Arg lie Cys lie 545 550

Claims (1)

REIVINDICAÇÕES Ácido nucleico que pode ser expresso numa planta hospedeira compreendendo uma ou mais regiões reguladoras operando numa planta, e operacionalmente ligado a uma sequência codificando um polipéptido de hemaglutinina (HA) de gripe quimérico compreendendo um agregado de domínio de haste (SDC), uma cabeça de agrupamento de domínio (HDC) e um grupo de domínios transmembranares (TDC), uma ou mais regiões reguladoras compreendendo um promotor e um 5'UTR, 3'UTR ou 5'UTR e 3'UTR, e em que a) o SDC compreende um subdomínio F'l, F'2 e F; b) o HDC compreende um subdomínio de ligação ao recetor (RB) , El e E2; c) o CDT compreende um subdomínio transmembrana (TmD) e terminal C (CT); e i) em que o subdomínio RB é de um primeiro polipéptido de HA de gripe e os subdomínios de SDC e El e E2 são de um segundo polipéptido de HA de gripe e, ii) em que o primeiro polipéptido de HA de gripe é de gripe Hl ou H5 e o segundo polipéptido de HA de gripe é de gripe Hl ou H5 e o segundo polipéptido de HA de gripe é derivado de uma estirpe de gripe diferente do primeiro polipéptido de HA de gripe. Ácido nucleico da reivindicação 1, em que: i) a sequência que codifica o polipéptido de HA de gripe quimérico compreende ainda uma sequência peptídica de sinal selecionada do grupo de uma sequência peptídica de sinal nativa de HA e uma sequência peptídica de sinal de PDI de alfafa e/ou ii) ii) em que o 5'UTR, 3'UTR ou 5'UTR e 3'UTR são obtidos a partir de uma UTR de plastocianina ou UTR e/ou iii) em que o promotor é obtido a partir de uma região reguladora de plastocianina, uma 1,5-bisfosfato de ribulose região reguladora carboxilase / oxigenase (RuBisCO), uma região reguladora da proteína de ligação clorofila a / b (CAB), uma região reguladora CaMV 35S, uma região reguladora da actina, uma região reguladora da ubiquitina, uma região reguladora da triosofosfato isomerase 1, um fator de iniciação translacional 4A região reguladora e uma região reguladora ST-LSl. . Método de produzir partículas semelhantes a vírus da gripe quiméricas (VLPs) numa planta compreendendo: a) introduzir o ácido nucleico da reivindicação 1 ou 2 na planta, ou sua porção, e b) incubar a planta, ou porção da mesma, sob condições que permitem a expressão do ácido nucleico, produzindo assim as VLPs, e c) opcionalmente colheita da planta e purificação das VLPs. Método de acordo com a reivindicação 3, em que no passo de introdução (passo a) , i) o ácido nucleico é introduzido na planta de um modo transitório ou ii) o ácido nucleico é introduzido na planta de modo a ser integrado de forma estável em um genoma. Polipéptido codificado pelo ácido nucleico da reivindicação 1. Partícula semelhante a vírus (VLP) compreendendo o polipéptido da reivindicação 5. VLP da reivindicação 6 compreendendo ainda N-glicanos específicos de plantas, ou N-glicanos modificados. Composição compreendendo uma dose eficaz da VLP da reivindicação 6 ou 7 e um veículo farmaceuticamente aceitável. Partícula semelhante a vírus, de acordo com a reivindicação 6 ou 7, ou composição de acordo com a reivindicação 8, para uso na indução de imunidade a uma infeção por vírus gripe em um indivíduo. Partícula semelhante a vírus ou a composição para uso de acordo com a reivindicação 9, que é adequada para administração oral, intradérmica, intranasal, intramuscular, intraperitoneal, intravenosa ou subcutânea a um sujeito. Planta, ou sua porção, compreendendo um polipéptido codificado pelo ácido nucleico da reivindicação 1.A nucleic acid that can be expressed in a host plant comprising one or more regulatory regions operating in a plant, and operably linked to a sequence encoding a chimeric influenza hemagglutinin (HA) polypeptide comprising a rod domain array (SDC), a head domain (HDC) and a group of transmembrane domains (TDC), one or more regulatory regions comprising a promoter and a 5'UTR, 3'UTR or 5'UTR and 3'UTR, and wherein a) the SDC comprises a subdomain F'1, F'2 and F; b) the HDC comprises a receptor-binding subdomain (RB), E1 and E2; c) the CDT comprises a transmembrane subdomain (TmD) and terminal C (CT); and i) wherein the subdomain RB is a first influenza HA polypeptide and the subdomains of SDC and El and E2 are of a second influenza HA polypeptide and ii) wherein the first influenza HA polypeptide is influenza H1 or H5 and the second influenza HA polypeptide is H1 or H5 influenza and the second influenza HA polypeptide is derived from a different influenza strain from the first influenza HA polypeptide. The nucleic acid of claim 1, wherein: i) the sequence encoding the chimeric influenza HA polypeptide further comprises a signal peptide sequence selected from the group of an HA native signal peptide sequence and a PDI signal peptide sequence of alfalfa and / or ii) ii) wherein the 5'UTR, 3'UTR or 5'UTR and 3'UTR are obtained from an UTR of plastocyanin or UTR and / or iii) wherein the promoter is obtained from of a plastocyanin regulatory region, a ribulose 1,5-bisphosphate carboxylase / oxygenase regulatory region (RuBisCO), a chlorophyll a / b binding protein (CAB) regulatory region, a CaMV 35S regulatory region, an actin regulatory region , a ubiquitin regulatory region, a triosophosphate isomerase 1 regulatory region, a translational initiation factor 4A regulatory region, and a regulatory ST-LS1 region. . A method of producing chimeric influenza virus-like particles (VLPs) in a plant comprising: a) introducing the nucleic acid of claim 1 or 2 into the plant, or portion thereof, and b) incubating the plant, or portion thereof, under conditions allowing the expression of the nucleic acid, thus producing the VLPs, and c) optionally harvesting the plant and purifying the VLPs. The method according to claim 3, wherein in the step of introducing (step a), i) the nucleic acid is introduced into the plant in a transient manner or ii) the nucleic acid is introduced into the plant so as to be stably integrated in a genome. Polypeptide encoded by the nucleic acid of claim 1. A virus-like particle (VLP) comprising the polypeptide of claim 5. VLP of claim 6 further comprising plant-specific N-glycans, or modified N-glycans. A composition comprising an effective dose of the VLP of claim 6 or 7 and a pharmaceutically acceptable carrier. A virus-like particle according to claim 6 or 7, or a composition according to claim 8, for use in inducing immunity to influenza virus infection in an individual. A virus-like particle or composition for use according to claim 9, which is suitable for oral, intradermal, intranasal, intramuscular, intraperitoneal, intravenous or subcutaneous administration to a subject. A plant, or portion thereof, comprising a polypeptide encoded by the nucleic acid of claim 1.
PT107911190T 2009-06-24 2010-06-25 Chimeric influenza virus-like particles comprising hemagglutinin PT2445928T (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US22016109P 2009-06-24 2009-06-24

Publications (1)

Publication Number Publication Date
PT2445928T true PT2445928T (en) 2018-06-07

Family

ID=43385835

Family Applications (1)

Application Number Title Priority Date Filing Date
PT107911190T PT2445928T (en) 2009-06-24 2010-06-25 Chimeric influenza virus-like particles comprising hemagglutinin

Country Status (25)

Country Link
US (1) US10272148B2 (en)
EP (2) EP2445928B1 (en)
JP (2) JP5871796B2 (en)
KR (1) KR101377725B1 (en)
CN (1) CN102482328B (en)
AU (1) AU2010265766B2 (en)
BR (1) BRPI1015053A2 (en)
CA (1) CA2762042C (en)
DK (1) DK2445928T3 (en)
ES (1) ES2669303T3 (en)
HK (2) HK1170250A1 (en)
HR (1) HRP20180706T1 (en)
HU (1) HUE039100T2 (en)
IL (1) IL216937A (en)
IN (1) IN2012DN00650A (en)
MX (1) MX349924B (en)
MY (1) MY182643A (en)
NO (1) NO2445928T3 (en)
NZ (1) NZ597401A (en)
PL (1) PL2445928T3 (en)
PT (1) PT2445928T (en)
SG (1) SG176820A1 (en)
SI (1) SI2445928T1 (en)
WO (1) WO2010148511A1 (en)
ZA (1) ZA201200481B (en)

Families Citing this family (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2615372A1 (en) * 2007-07-13 2009-01-13 Marc-Andre D'aoust Influenza virus-like particles (vlps) comprising hemagglutinin
CN101978066A (en) * 2007-11-27 2011-02-16 麦迪卡格公司 Recombinant influenza virus-like particles (vlps) produced in transgenic plants expressing hemagglutinin
CN105753948A (en) * 2008-07-08 2016-07-13 麦迪卡格公司 Soluble recombinant influenza antigens
EP2413962A1 (en) 2009-03-30 2012-02-08 Mount Sinai School of Medicine Influenza virus vaccines and uses thereof
AU2010254136B2 (en) 2009-05-26 2016-09-29 Mount Sinai School Of Medicine Monoclonal antibodies against influenza virus generated by cyclical administration and uses thereof
NO2445928T3 (en) 2009-06-24 2018-08-25
SG178947A1 (en) 2009-09-22 2012-04-27 Medicago Inc Method of preparing plant-derived proteins
WO2011103453A2 (en) 2010-02-18 2011-08-25 Mount Sinai School Of Medicine Vaccines for use in the prophylaxis and treatment of influenza virus disease
KR20130075732A (en) 2010-03-30 2013-07-05 마운트 시나이 스쿨 오브 메디슨 Influenza virus vaccines and uses thereof
TWI526539B (en) 2010-12-22 2016-03-21 苜蓿股份有限公司 Method of producing virus-like particles (vlps) in plants and vlp produced by such method
CN103562389B (en) * 2011-02-08 2020-06-23 淡马锡生命科学研究院有限公司 Novel expression cassette for efficient surface display of antigenic proteins
TWI620816B (en) 2011-03-23 2018-04-11 苜蓿股份有限公司 Method of recovering plant-derived proteins
SI3418300T1 (en) 2011-07-18 2021-03-31 Institute For Research In Biomedicine Neutralizing anti-influenza a virus antibodies and uses thereof
EP4241785A3 (en) * 2011-09-20 2023-09-27 Icahn School of Medicine at Mount Sinai Influenza virus vaccines and uses thereof
US11390878B2 (en) 2011-09-30 2022-07-19 Medicago Inc. Increasing protein yield in plants
EP3626733B1 (en) 2011-09-30 2024-01-24 Medicago Inc. Increasing virus-like particle yield in plants
MX2015005056A (en) 2012-11-27 2015-07-23 Univ Pittsburgh Computationally optimized broadly reactive antigens for h1n1 influenza.
AU2013362935B2 (en) 2012-12-18 2018-10-04 Icahn School Of Medicine At Mount Sinai Influenza virus vaccines and uses thereof
US9908930B2 (en) 2013-03-14 2018-03-06 Icahn School Of Medicine At Mount Sinai Antibodies against influenza virus hemagglutinin and uses thereof
EP2978848B1 (en) 2013-03-28 2020-05-06 Medicago Inc. Influenza virus-like particle production in plants
JP2016521553A (en) * 2013-06-06 2016-07-25 ノバルティス アーゲー Influenza virus reassembly
CN105980561B (en) 2014-01-10 2020-06-02 莫迪卡戈公司 CPMV enhancer element
AU2015234595B2 (en) 2014-03-27 2021-03-25 Medicago Inc. Modified CPMV enhancer elements
CN105233302B (en) * 2014-07-10 2018-10-19 中国人民解放军军事医学科学院生物工程研究所 A kind of preparation method of influenza hemagglutinin glycopolypeptide multimer object nano particle
CA2974699A1 (en) 2015-01-23 2016-07-28 Icahn School Of Medicine At Mount Sinai Influenza virus vaccination regimens
KR20180088629A (en) 2015-07-02 2018-08-06 메디카고 인코포레이티드 Jasmonic Acid Pathway Activator
KR101755114B1 (en) * 2015-09-08 2017-07-06 건국대학교 산학협력단 A chimeric virus-like particle vaccine confers broadened antibody responses against different clades of highly pathogenic avian influenza H5 viruses
US20180326040A1 (en) * 2015-11-16 2018-11-15 Kansas State University Research Foundation Influenza virus vaccine and vaccine platform
MX2018009395A (en) * 2016-02-03 2018-11-09 Cg Discovery Inc Compositions of influenza hemagglutinin with heterologous epitopes and/or altered maturation cleavage sites.
WO2017218624A1 (en) 2016-06-15 2017-12-21 Icahn School Of Medicine At Mount Sinai Influenza virus hemagglutinin proteins and uses thereof
CA3058652A1 (en) 2017-04-07 2018-10-11 Icahn School Of Medicine At Mount Sinai Anti-influenza b virus neuraminidase antibodies and uses thereof
JP6622825B2 (en) * 2018-01-25 2019-12-18 インスティテュート・フォー・リサーチ・イン・バイオメディシンＩｎｓｔｉｔｕｔｅ Ｆｏｒ Ｒｅｓｅａｒｃｈ Ｉｎ Ｂｉｏｍｅｄｉｃｉｎｅ Influenza A virus neutralizing antibody and method of use thereof
JP2022534464A (en) 2019-03-14 2022-08-01 田辺三菱製薬株式会社 endogenous plant expression enhancer
TWI817041B (en) * 2019-09-20 2023-10-01 中央研究院 Chimeric hemagglutinin protein and a vaccine composition comprising the same
JP2020048568A (en) * 2019-11-22 2020-04-02 インスティテュート・フォー・リサーチ・イン・バイオメディシンＩｎｓｔｉｔｕｔｅ Ｆｏｒ Ｒｅｓｅａｒｃｈ Ｉｎ Ｂｉｏｍｅｄｉｃｉｎｅ Influenza a virus neutralizing antibodies and use methods thereof
CA3182526A1 (en) * 2020-05-08 2021-11-11 Academia Sinica Chimeric influenza vaccines

Family Cites Families (64)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5428147A (en) 1983-04-15 1995-06-27 Mycogen Plant Science, Inc. Octopine T-DNA promoters
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US5036006A (en) 1984-11-13 1991-07-30 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US5100792A (en) 1984-11-13 1992-03-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues
JPS62501263A (en) 1984-11-29 1987-05-21 スクリツプス　クリニツク　アンド　リサ−チ　フアウンデ−シヨン Polypeptides and antibodies associated with deglycosylated viral glycoproteins
US4962028A (en) 1986-07-09 1990-10-09 Dna Plant Technology Corporation Plant promotors
US5232833A (en) 1988-09-14 1993-08-03 Stressgen Biotechnologies Corporation Accumulation of heat shock proteins for evaluating biological damage due to chronic exposure of an organism to sublethal levels of pollutants
US6403865B1 (en) 1990-08-24 2002-06-11 Syngenta Investment Corp. Method of producing transgenic maize using direct transformation of commercially important genotypes
ATE142883T1 (en) 1991-03-28 1996-10-15 Rooperol Na Nv COMPOSITIONS OF PHYTOSTEROLS WITH PHYTOSTEROLINS AS IMMUNE MODULATORS
UA48104C2 (en) 1991-10-04 2002-08-15 Новартіс Аг Dna fragment including sequence that codes an insecticide protein with optimization for corn, dna fragment providing directed preferable for the stem core expression of the structural gene of the plant related to it, dna fragment providing specific for the pollen expression of related to it structural gene in the plant, recombinant dna molecule, method for obtaining a coding sequence of the insecticide protein optimized for corn, method of corn plants protection at least against one pest insect
US6326470B1 (en) 1997-04-15 2001-12-04 The Penn State Research Foundation Enhancement of accessibility of cellulose by expansins
US5762939A (en) 1993-09-13 1998-06-09 Mg-Pmc, Llc Method for producing influenza hemagglutinin multivalent vaccines using baculovirus
GB9414118D0 (en) 1994-07-13 1994-08-31 Axis Genetics Ltd Modified plant viruses as vectors of heterologous peptides
US6020169A (en) 1995-07-20 2000-02-01 Washington State University Research Foundation Production of secreted foreign polypeptides in plant cell culture
US6042832A (en) 1996-08-28 2000-03-28 Thomas Jefferson University Polypeptides fused with alfalfa mosaic virus or ilarvirus capsid proteins
US20010006950A1 (en) 1998-02-11 2001-07-05 Juha Punnonen Genetic vaccine vector engineering
US6489537B1 (en) 1998-08-07 2002-12-03 The Trustees Of The University Of Pennsylvania Phytochelatin synthases and uses therefor
BR9912875A (en) 1998-08-11 2002-02-13 Large Scale Biology Corp Method for the recovery of proteins from the interstitial fluid of plant tissues
US6392121B1 (en) 1998-10-07 2002-05-21 Boyce Thompson Institute For Plant Research Gemini virus vectors for gene expression in plants
US6287570B1 (en) 1998-11-23 2001-09-11 Patricia L. Foley Vaccine against swine influenza virus
FR2791358B1 (en) 1999-03-22 2003-05-16 Meristem Therapeutics CHEMICAL EXPRESSION PROMOTERS, EXPRESSION CASSETTES, PLASMIDS, VECTORS, PLANTS AND TRANSGENIC SEEDS CONTAINING THEM AND METHODS OF OBTAINING THEM
EP1173582B1 (en) * 1999-04-29 2006-06-14 Syngenta Limited Herbicide resistant plants
CA2385347C (en) 1999-10-04 2009-12-15 Medicago Inc. Method for regulating transcription of foreign genes
US7125978B1 (en) 1999-10-04 2006-10-24 Medicago Inc. Promoter for regulating expression of foreign genes
ATE433491T1 (en) 2001-01-18 2009-06-15 Vlaams Interuniv Inst Biotech OLIGOMERIC COMPLEXES OF CHIMERIC PROTEINS WITH ENHANCED IMMUNOGENIC POTENTIAL
CN1997734A (en) * 2002-02-13 2007-07-11 威斯康星旧生研究基金会 Signal for packaging of influenza virus vectors
BRPI0307679A2 (en) * 2002-02-13 2016-11-08 Wisconsin Alumni Res Found influenza viral vector, recombinant influenza virus, isolated nucleic acid molecule, and methods for expressing a heterologous nucleic acid segment in a cell and for preparing replication-incompetent influenza-like viruses.
US20040063188A1 (en) 2002-02-14 2004-04-01 Novavax, Inc. Kit for treating gastrointestinal tract
AU2003219402B2 (en) 2002-03-19 2008-05-08 Stichting Dienst Landbouwkundig Onderzoek GnTIII (UDP-n-acethylglucosamine:beta-D mannoside beta (1,4)-N-acethylglucosaminy ltransferase III) expression in plants
ES2224792B1 (en) 2002-06-28 2007-02-16 Era Plantech, S.L. PRODUCTION OF PEPTIDES AND PROTEINS BY ACCUMULATION OF PROTEIN BODIES DERIVED FROM ENDOPLASMIC RETICLES IN PLANTS.
CA2524799A1 (en) 2003-05-05 2004-11-18 Dow Agrosciences Llc Stable immunoprophylactic and therapeutic compositions derived from transgenic plant cells and methods for production
BRPI0410340A (en) 2003-05-05 2006-05-30 Dow Agrosciences Llc vectors and cells for preparing transgenic plant-derived immunoprotective compositions
EP1633312A4 (en) 2003-06-16 2012-09-26 Medimmune Llc Influenza hemagglutinin and neuraminidase variants
US8592197B2 (en) 2003-07-11 2013-11-26 Novavax, Inc. Functional influenza virus-like particles (VLPs)
US7226781B1 (en) 2003-07-24 2007-06-05 Belyaev Alexander S Chaperone expression genomes
ES2381200T3 (en) 2005-04-29 2012-05-24 University Of Cape Town Expression of viral proteins in plants
CN101227920A (en) 2005-07-19 2008-07-23 陶氏环球技术公司 Recombinant flu vaccines
US7871626B2 (en) 2005-08-04 2011-01-18 St. Jude Children's Research Hospital Modified influenza virus for monitoring and improving vaccine efficiency
CA2656705A1 (en) 2005-08-16 2007-02-22 Hawaii Biotech, Inc. Influenza recombinant subunit vaccine
DK1937301T3 (en) 2005-10-18 2015-07-20 Novavax Inc FUNCTIONAL INFLUENZA-like particles (VLPs)
WO2008060669A2 (en) 2006-04-21 2008-05-22 Dow Agrosciences Llc Vaccine for avian influenza and methods of use
US8124103B2 (en) 2006-02-13 2012-02-28 Fraunhofer Usa, Inc Influenza antigens, vaccine compositions, and related methods
US8778353B2 (en) 2006-05-01 2014-07-15 Technovax, Inc. Influenza virus-like particle (VLP) compositions
EP2023952B1 (en) 2006-05-18 2015-07-15 Epimmune Inc. Inducing immune responses to influenza virus using polypeptide and nucleic acid compositions
CA2651907C (en) 2006-05-22 2016-12-20 Plant Bioscience Limited Bipartite system, method and composition for the constitutive and inducible expression of high levels of foreign proteins in plants
US20070286873A1 (en) 2006-05-23 2007-12-13 Williams John V Recombinant Influenza H5 Hemagluttinin Protein And Nucleic Acid Coding Therefor
EP2035565A4 (en) 2006-06-30 2010-07-21 Novavax Inc Methods of enhancing protein incorporation into virus like particles
US20080233150A1 (en) 2006-11-16 2008-09-25 Gale Smith Respiratory syncytial virus-virus like particle (vlps)
US7730950B2 (en) 2007-01-19 2010-06-08 Halliburton Energy Services, Inc. Methods for treating intervals of a subterranean formation having variable permeability
WO2008148104A1 (en) 2007-05-25 2008-12-04 Novavax, Inc. Novel vlps derived from cells that do not express a viral matrix or core protein
PT2155880T (en) 2007-06-15 2016-11-18 Medicago Inc Modifying glycoprotein production in plants
KR100964462B1 (en) 2007-07-10 2010-06-16 성균관대학교산학협력단 An avian influenza virus vaccine and a method for preparing same
CA2615372A1 (en) 2007-07-13 2009-01-13 Marc-Andre D'aoust Influenza virus-like particles (vlps) comprising hemagglutinin
CN101820903A (en) 2007-08-20 2010-09-01 美国弗劳恩霍夫股份有限公司 Prophylactic and therapeutic influenza vaccines, antigens, compositions, and methods
CN101978066A (en) 2007-11-27 2011-02-16 麦迪卡格公司 Recombinant influenza virus-like particles (vlps) produced in transgenic plants expressing hemagglutinin
GB0800272D0 (en) 2008-01-08 2008-02-13 Plant Bioscience Ltd Protein expression systems
EA034733B1 (en) 2008-01-21 2020-03-13 Медикаго Инк. Nucleic acid for increased expression of hemagglutinin of influenza virus in a plant and use thereof
CN105753948A (en) 2008-07-08 2016-07-13 麦迪卡格公司 Soluble recombinant influenza antigens
CA2730668C (en) 2008-07-18 2020-04-28 Medicago Inc. New influenza virus immunizing epitope
AU2009285667B2 (en) 2008-08-27 2015-05-28 Arizona Board Of Regents For And On Behalf Of Arizona State University A DNA replicon system for high-level rapid production of vaccines and monoclonal antibody therapeutics in plants
WO2010042551A2 (en) 2008-10-06 2010-04-15 Genvault Corporation Methods for providing cellular lysates from cell wall-containing samples
WO2010077712A1 (en) 2008-12-09 2010-07-08 Novavax, Inc. Bovine respiratory syncytial virus virus-like particle (vlps)
NO2445928T3 (en) 2009-06-24 2018-08-25
SG178947A1 (en) 2009-09-22 2012-04-27 Medicago Inc Method of preparing plant-derived proteins

Also Published As

Publication number Publication date
IL216937A0 (en) 2012-02-29
EP2445928B1 (en) 2018-03-28
SI2445928T1 (en) 2018-05-31
HK1245294A1 (en) 2018-08-24
JP2014158483A (en) 2014-09-04
PL2445928T3 (en) 2018-07-31
NZ597401A (en) 2013-09-27
KR101377725B1 (en) 2014-03-27
AU2010265766A1 (en) 2012-02-02
IL216937A (en) 2017-01-31
ZA201200481B (en) 2013-05-29
DK2445928T3 (en) 2018-05-28
BRPI1015053A2 (en) 2019-07-09
HRP20180706T1 (en) 2018-06-01
JP5871796B2 (en) 2016-03-01
HK1170250A1 (en) 2013-02-22
CA2762042C (en) 2012-11-20
WO2010148511A8 (en) 2011-03-10
CN102482328A (en) 2012-05-30
US20120189658A1 (en) 2012-07-26
MY182643A (en) 2021-01-27
MX2011013517A (en) 2012-05-23
JP6141228B2 (en) 2017-06-07
KR20120133371A (en) 2012-12-10
EP2445928A1 (en) 2012-05-02
CN102482328B (en) 2014-11-26
MX349924B (en) 2017-08-21
NO2445928T3 (en) 2018-08-25
HUE039100T2 (en) 2018-12-28
AU2010265766B2 (en) 2015-03-19
RU2569195C2 (en) 2015-11-20
JP2012530499A (en) 2012-12-06
IN2012DN00650A (en) 2015-06-12
CA2762042A1 (en) 2010-12-29
SG176820A1 (en) 2012-01-30
ES2669303T3 (en) 2018-05-24
WO2010148511A1 (en) 2010-12-29
RU2012101946A (en) 2013-07-27
EP2445928A4 (en) 2013-11-06
US10272148B2 (en) 2019-04-30
EP3228627A1 (en) 2017-10-11

Similar Documents

Publication Publication Date Title
KR101956910B1 (en) RECOMBINANT INFLUENZA VIRUS-LIKE PARTICLES(VLPs) PRODUCED IN TRANSGENIC PLANTS EXPRESSING HEMAGGLUTININ
PT2445928T (en) Chimeric influenza virus-like particles comprising hemagglutinin
DK2610345T3 (en) RECOMBINANT INFLUENZA VIRUS SIMULAR PARTICULARS (VLPS) MADE IN TRANSGENE PLANTS THAT EXPRESS HEMAGGLUTININ
KR101974017B1 (en) Increasing virus-like particle yield in plants
JP6297488B2 (en) Production of rabies virus-like particles in plants
PT2173886E (en) Influenza virus-like particles (vlps) comprising hemagglutinin produced within a plant
PT2318530T (en) New influenza virus immunizing epitope
RU2569195C9 (en) Hemagglutinin-containing chimeric virus-like particles, similar to particles of flu virus