CN1997734A - Signal for packaging of influenza virus vectors - Google Patents

Abstract

The invention provides a packaging (incorporation) signal for influenza virus vectors, and methods of using the signal to transmit and maintain influenza viral and foreign nucleic acid in virus and cells.

Description

The signal of packaging of influenza virus vectors

Government's rights and interests statement

It is (the state-run commune hospital subsidize number be AI47446) that finishes under the subsidy of United States of America government that the present invention has a part at least.Government enjoys some right among the present invention.

Background of invention

The genome of influenza virus A and B is made up of eight sections negative polarity single stranded RNA fragments, wherein two sections encoded packets membrane glycoproteins, hemagglutinin (HA) and neuraminidases (NA).Influenza virus is duplicated with the lip-deep viral HA albumen of virion and contains sialic cell receptor and is combined into initial.After receptors bind, host cell is taken in virus by pinosome.Sour environment in the late period endosome excites the conformation of HA to change, and starts the fusion between peplos and the endosome film, and makes the activation of M2 ionic channel, causes in the proton inflow virion.It is believed that the virion interior exposed in low pH, can destroy sour dependent interaction between M1 albumen and ribonucleoprotein (RNP) mixture, RNP is released in the tenuigenin.RNP can be transported to nuclear then, synthetic here virus mRNA and viral genome.MRNA enters in the tenuigenin, thereby viral protein is synthesized.Nucleoprotein (NP) enters in the nuclear and with housing and packs new synthetic vRNA, and forms RNP with three kinds of polymerase albumen (PA, PB1, PB2).When M1 and NS2 albumen exist, outside the RNP output nuclear.Three kinds of serous coat associated protein (HA, NA and M2) and RNP interact and form new virion in the mode of budding.NA is responsible for removing sialic acid from the compounding sugar of cell and viral glycoprotein, thereby virus is discharged (Lamb etc., 2000) from cells infected.

((the antigenicity A C-type virus C of N1～N9) is divided into several hypotypes for H1～H5) and NA according to HA.In the cell that two kinds of different A C-type virus Cs are infected, can generate and reset body (Wright etc., 2000) in the type with range gene fragment combination.But,, do not find yet to reset body between the natural type between A C-type virus C and the Type B virus although two kinds of viruses are all propagated altogether the human colony.

The investigator has attempted generating the rearrangement body between A type and the Type B virus in the laboratory, but not successful (Kaverin etc., 1983; Mikheera etc., 1982; Tobita etc., 1983).Muster etc. (1991) have generated a kind of sudden change A C-type virus C, and the NA fragment non-coding region of one of them fragment is replaced by the non-coding region fragment of Type B virus non structural (NS) gene.Although the reproduction ratio wild-type virus of this mutated viruses slowly many, the titre that is reached is also low than wild-type, the generation of this viroid shows that segmental non-coding region of Type B NS and A type influenza virus component are compatible on rna transcription and levels of replication.On the contrary, when the side of the contained external source encode fragment of RNA fragment is an A type Influenza Virus RNA fragment 3 ' and during 5 ' end non-coding region, through can not be in virion after going down to posterity repeatedly stable maintenance (Luytjes etc., 1989).Muster etc. (1991) also find mutated viruses attenuation in mouse, can tolerate the attack of wild-type virus with the mutated viruses infected animals.

Therefore need a kind of method and differentiate the influenza virus sequence of being responsible for the institute's sequence that links importing between the influenza virus replicative phase and/or keeping.

Summary of the invention

The invention provides and separate recombinant nucleic acid molecules (polynucleotide), as carrier, wherein this molecule contains importing sequence (" packaging signal " or vRNA encapsidation signal) and the optional heterologous nucleic acids fragment of influenza virus.Usually import sequence and be present in about 150 to 250 Nucleotide places, each influenza vRNA fragment one or both ends.In one embodiment, influenza virus imports sequence and comprises 3 ' the terminal corresponding sequence with NA, comprise and sequence that NA coding region N end is corresponding, for example comprise 37 Nucleotide of A type NA vRNA 3 ' end of 19 Nucleotide of 3 ' non-coding region and corresponding with initial 19 coding nucleotides of NA at least sequence; With optional NA vRNA 5 ' terminal corresponding importing sequence, comprise terminal corresponding sequence with NA coding region C-, for example comprise terminal 67 Nucleotide of A type NA vRNA 5 ' of 28 Nucleotide of 5 ' non-coding region; And at least 39 Nucleotide of 39 the Nucleotide correspondences in NA 3 ' coding region therewith.In another embodiment, influenza virus imports sequence and comprises 3 ' the terminal corresponding sequence with NS vRNA, comprises the terminal corresponding sequence with NS coding region N-.In another embodiment, influenza virus imports sequence and comprises 5 ' the terminal corresponding sequence with HA vRNA, comprise terminal corresponding sequence, for example comprise A type HA vRNA 5 ' terminal 135 Nucleotide of 45 Nucleotide of 5 ' non-coding sequence and at least 80 Nucleotide corresponding with 80 3 ' coding nucleotides of HA with HA coding region C-; With optional and the corresponding importing sequence of HA vRNA 3 ' end, comprise terminal corresponding sequence, for example comprise 33 3 ' non-coding sequence Nucleotide and at least 3 terminal 36 Nucleotide of the A type HA vRNA 5 ' with initial 3 the corresponding Nucleotide of HA coding nucleotide with HA coding region N-.In a further embodiment, influenza virus imports sequence and comprises 5 ' the terminal corresponding sequence with PB2 vRNA, comprises the terminal corresponding sequence with PB2 coding region C-.In another embodiment, influenza virus imports sequence and comprises 3 ' the terminal corresponding sequence with M vRNA, comprise and the corresponding sequence of M coding region N end, for example comprise A type M vRNA 3 ' terminal 247 Nucleotide of 26 Nucleotide of 3 ' non-coding sequence and 221 Nucleotide corresponding with the M coding nucleotide; With M vRNA 5 ' terminal corresponding sequence, comprise terminal corresponding importing sequence, for example comprise 23 3 ' non-coding sequence Nucleotide and 219 terminal 242 Nucleotide of the A type M vRNA 5 ' with last 219 the corresponding Nucleotide of M coding region C-terminal nucleotide with M coding region C-.In another embodiment, influenza virus imports sequence and comprises 5 ' the terminal corresponding sequence with NS vRNA, comprise and the terminal corresponding sequence of NS coding region N-, for example comprise the sequence of 3 ' non-coding sequence and at least 30 Nucleotide corresponding with NS coding region N-end; With the terminal corresponding sequence of NSvRNA 5 ', comprise and importing sequence that C end in NS coding region is corresponding, for example comprise that 5 ' non-coding sequence reaches the sequence of at least 30 Nucleotide of the sequence corresponding with NS coding region C-end.In one embodiment, influenza virus imports sequence and comprises 5 ' the terminal corresponding sequence with PB1 vRNA, comprise with the terminal corresponding sequence of PB1 coding region N-and with the terminal corresponding sequence of PB1 vRNA5 ', comprise and importing sequence that C-end in PB1 coding region is corresponding.In another embodiment, influenza virus imports that sequence comprises and PA vRNA 5 ' terminal corresponding sequence, comprise with the terminal corresponding sequence of PA coding region N-and with the corresponding sequence of PA vRNA 5 ' end, comprise and sequence that C-end in PA coding region is corresponding.Influenza virus described herein " importing sequence " can make the nucleic acid molecule that contains this sequence import in the virion and the sequence that in the process that goes down to posterity repeatedly this molecule is maintained in virion when being meant in being present in the vRNA with corresponding (homology) 3 ' and 5 ' non-coding region.

As will be explained hereinafter, utilize reverse genetics in containing the segmental mutated viruses of brachymemma NA, to identify NA importing sequence based on plasmid.This NA imports sequence and is arranged in a zone that comprises NAvRNA 3 ' end, and wherein this 3 ' end extends in the part NA coding region.Therefore, this zone can be used for packing and keeps wild-type NA RNA and sudden change NA RNA, and for example inner RNA that disappearance takes place and/or insert comprises and expresses the purpose open reading frame as the segmental recombinant RNA of the heterologous nucleic acids that contains the purpose open reading frame.

Also as described here, in order to understand non-compatibility between the type between A type and the Type B influenza virus in depth, adopt reverse genetics under A C-type virus C background, to generate and contain the segmental rearrangement body of complete Type B HA.Although Type B HA fragment is transcribed by A type polysaccharase mixture really, do not produce virus.Can survive though contain the segmental A C-type virus C of forming by whole encoding sequences of Type B HA and side A type HA non-coding sequence thereof of chimeric HA, only can faintly duplicate.Generate a series of based on the A type, comprise the virus of chimeric HA, wherein chimeric HA has A type non-coding region, coding A C-type virus C signal peptide or strides film/cytoplasmic domain or the two all has, and the Type B HA other parts of coming source region.These viruses are all long to surpassing 10 in cell culture ⁶TCID ₅₀/ ml, good more but A type HA sequence is duplicated situation more at most, illustrate that protein-protein interaction or more HA fragments import in the virion for virus efficient growth and play a role.Compare these A/B embedded viruses equal attenuation in mouse with wild-type A type or Type B virus.And when giving the wild-type Type B virus attack of lethal quantity to these animals with embedded virus immunity in nose, all animals all survive, a kind of method that brand-new virus of live vaccine gets a good chance of that designs of having demonstrated.

Like this, import sequence when containing specific influenza virus fragment, homology 3 ' and 5 ' non-coding sequence (district) and the segmental isolated nucleic acid molecule of the present invention of heterologous nucleic acids, with vRNA production carrier format and at PA, PB1, PB2, NP, HA, NA, the carrier of one or more viral protein or coding viral protein exists down among M such as M1 and/or M2 and/or the NS, and at PA, PB1, PB2, NP, HA, NA, one or more being used for imports to cell when vRNA that vRNA produces or carrier exist among M such as M1 and M2 and/or the NS, just produced recombinant virus.This recombinant virus can be used for cells infected.The vRNA corresponding with nucleic acid molecule of the present invention is preferably being that at least 10%, more preferably at least 30% even more preferably at least 50% the efficient of corresponding wild-type vRNA imports in the virion.In one embodiment, this nucleic acid molecule comprises sequence corresponding with wild-type vRNA and heterologous nucleic acids fragment, and wherein this heterologous nucleic acids fragment imports in the sequence corresponding with this vRNA coding region among the vRNA, and preferably this inserts and does not destroy this importing sequence basically.For example, this heterologous nucleic acids fragment imports to after the sequence corresponding with initial 300 Nucleotide in NA coding region.

In another embodiment, it is corresponding that 3 ' NA imports between sequence and NA coding region N-end 1～183,1～90,1～45,1～21,1～19 or 19 to 183 an arbitrary integer Nucleotide, and the place also can comprise sudden change in the NA initiator codon.In another embodiment, 5 ' NA imports sequence in sequence and the NA coding region C-end, the sequence that is equivalent to an arbitrary integer Nucleotide between the NA coding region C-end 3 ' maximum 39,78 or 157 or 1 to 157 is corresponding.In another embodiment, 5 ' HA imports sequence in sequence and the HA coding region C-end, corresponding corresponding to the sequence of an arbitrary integer Nucleotide between the HA coding region C-end 3 ' maximum 75,80,268,291 or 518 or 1 to 518.It is corresponding with 1～3,1～6,1～9,1～15,1～216,1～468 or 1～468 arbitrary integer Nucleotide of HA coding region N-end that 3 ' HA imports sequence.In one embodiment, it is corresponding with 1～250,1～200,1～150 or 1～250 arbitrary integer Nucleotide of PB1 coding region C-end that 3 ' PB1 imports sequence.In one embodiment, it is corresponding with 1～250,1～200,1～150 or 1～250 arbitrary integer Nucleotide of PA coding region N-end that 3 ' PA imports sequence.In one embodiment, it is corresponding with PA coding region C-end 3 ' most Nucleotide that 5 ' PA imports sequence, as corresponding with 3 ' 1～250,1～200,1～150 or 1～250 arbitrary integer Nucleotide of PA coding region C-end.In another embodiment, it is corresponding with 1～250,1～242,1～240 or 1～250 arbitrary integer Nucleotide of M coding region N-end that 3 ' M imports sequence, and the place also can comprise sudden change in the M initiator codon.In another embodiment, 5 ' M imports sequence in sequence and the M coding region C-end, corresponding corresponding to the sequence of an arbitrary integer Nucleotide between the M coding region C-end 3 ' maximum 50,100 or 220 or 1 to 250.In another embodiment, it is corresponding with 1～250,1～200,1～150,1～30,1～20 or 1～250 arbitrary integer Nucleotide of NS coding region N-end that 3 ' NS imports sequence, and the place also can comprise sudden change in the NS initiator codon.In another embodiment, 5 ' NS imports sequence in sequence and the NS coding region C-end, corresponding corresponding to the sequence of an arbitrary integer Nucleotide between the NS coding region C-end 3 ' maximum 10,30,150,200 or 250 or 1 to 250.

Correspondingly, the invention provides importing sequence and the segmental influenza vectors of heterologous nucleic acids that comprises the sequence corresponding, corresponding vRNA with specific vRNA 3 ' and 5 ' non-coding region.Like this, in one embodiment, this carrier comprises NA vRNA 3 ' non-coding region, 3 ' or 5 ' NA vRNA imports sequence and optional 3 ' or 5 ' NA imports sequence, heterologous nucleic acids fragment and NA vRNA 5 ' non-coding region.In another embodiment, this carrier comprises HA vRNA 3 ' non-coding region, 5 ' or 3 ' HA vRNA imports sequence or 5 ' and 3 ' HA imports sequence, heterologous nucleic acids fragment and HAvRNA 5 ' non-coding region.In another embodiment, this carrier comprises NS vRNA 3 ' non-coding region, NS imports sequence, heterologous nucleic acids fragment and NS vRNA 5 ' non-coding region.In another embodiment, this carrier comprises M vRNA 3 ' non-coding region, 5 ' or 3 ' M imports sequence or 5 ' and 3 ' M imports sequence, heterologous nucleic acids fragment and M vRNA 5 ' non-coding region.In another embodiment, this carrier comprises PB2 vRNA 3 ' non-coding region, heterologous nucleic acids fragment, PB2 importing sequence, reaches PB2 vRNA 5 ' non-coding region.When in carrier, using two sections to import sequence, preferably they are separated with the heterologous nucleic acids fragment.Can use each preparing carriers to be used for the vRNA of transfered cell or express vRNA, also have virus production required other influenza virus vRNA and albumen in the cell at cell.

In one embodiment, this heterologous nucleic acids fragment comprises the sequence corresponding with the marker gene open reading frame.In another embodiment, this heterologous nucleic acids fragment comprises the sequence corresponding with the therapeutic gene open reading frame.In another embodiment, this heterologous nucleic acids fragment comprises and pathogenic agent or tumour cell immunogenic peptide or the corresponding sequence of proteic open reading frame, as is used to induce the peptide or the albumen of protective immunological reaction.For instance, the immunogen epi-position in cancer therapy or vaccine, used of this heterologous nucleic acids fragment codified.Thereby can prepare and comprise the segmental carrier of this heterologous nucleic acids, so that transcribing of carrier vRNA can generate the proteic mRNA that coding and influenza virus protein such as NA merge.Can consider that thus this heterologous nucleic acids fragment and virus are imported sequence to be merged with encoding fusion protein, as with the syzygy of terminal 21 residues of NA N-.This fusion rotein can comprise the sequence from two kinds of different influenza virus proteins, comprises from two kinds of different N A or the proteic sequence of HA.In another embodiment, the heterologous nucleic acids fragment can comprise and the corresponding sequence of IRES that is connected in open reading frame 5 ' end.

For preparing recombinant virus by the reverse genetics based on plasmid with a large amount of influenza vectors, what the influenza virus DNA in the carrier can be in justice with respect to promotor also can be in the direction of antisense.Like this, the influenza virus protein (justice) of carrier codified A type, Type B or C type influenza virus, virus strain or isolated body or recombinant influenza or vRNA (antisense) are [referring to " virusology " the 45th and 46 chapter relevant portions (volume such as Fields, Lippincott-Rawen press, Philadelphia, PA (1996)), be incorporated herein by reference especially at this].Available any promotor is expressed viral protein, and the gained carrier comprises the promotor that is connected with the DNA steering quality of specific influenza virus protein.The promotor of carrier of vRNA of being used to encode preferably includes but is not limited to rna plymerase i promotor, rna plymerase ii promotor, rna plymerase iii promotor, T7 promotor and T3 promotor.In one embodiment, rna plymerase i promotor behaviour rna plymerase i promotor.Its transcription termination sequence of carrier of coding vRNA preferably includes but is not limited to rna plymerase i transcription termination sequence, rna plymerase ii transcription termination sequence, rna plymerase iii transcription termination sequence or ribozyme.Therefore, the vRNA carrier comprises the promotor that is connected with the direction control with respect to the promotor antisense with influenza virus protein cDNA, and described cDNA is connected with transcription termination sequence steering quality.For generation has the recombinant virus of carrier of the present invention, can omit some wild-type vRNA carriers and the carrier of some encoding wild type viral proteins is replaced.For example, for containing HA 3 ' and 5 ' non-coding sequence, 5 ' HA importing sequence and the heterologous nucleic acids segmental vRNA carrier corresponding, can ignore the wild-type vRNA carrier of HA with influenza virus protein encoding sequence such as VSV G albumen coded sequence.Carrier of the present invention can be successively or is imported simultaneously in the cell.Also provide contain a plurality of above-mentioned compositions of mentioning carrier, with the cell of one or more contacted host cells of these carriers and virus infection.

But a plurality of carrier physical connections of the present invention, or each carrier is positioned at single plasmid or other for example on the linear nucleic acid delivery vehicles.

The host cell that increases with above-mentioned recombinant DNA molecules can be used for preparing the influenza virus with infectious replication defective.For example, the host cell of recombinant DNA molecules stable conversion with coding HA, NA, M1, M2 and NS2, can contact with a plurality of carriers, promptly express vRNA, the vRNA that comprises NP, the vRNA that comprises PB1 that comprises PA, the vRNA that comprises PB2 and the optional carrier that comprises the vRNA of target gene; And the carrier of coding PA, PB1, PB2 and NP.

Virus production method as herein described does not need the infection of helper virus, in the production of virus mutation Journal of Sex Research, the vaccine vaccine of AIDS, influenza, viral hepatitis type b, hepatitis C, rhinovirus infection, inovirus infection, malaria, bleb and foot and mouth disease (as be used for) and gene therapy vector (as be used for cancer, AIDS, adenosine deaminase, muscular dystrophy, ornithine transcarbamylase lack and central nerve neuroma) of great use.

The recombinant virus that uses in the pharmacological agent (as vaccine therapy or gene therapy) so just is provided.For example, the invention provides make individual to pathogenic agent such as the immunifacient method of bacterium, virus, parasite or malignant tumour.This method comprises that at least a isolated viral of a certain amount of the present invention with effective immune body is applied to individuality, optional and adjuvant coupling.Described virus comprises the vRNA that contains coded polypeptide of pathogenic agent or tumour-specific polypeptides.

The present invention also provides and increased or promoted the method that endogenous protein is expressed in Mammals, and it is the indication or the disease of feature that wherein said Mammals has with this endogenous protein content decline or shortage.This method comprises to administration can effectively increase or promote the recombinant virus a certain amount of of the present invention that endogenous protein is expressed in Mammals.Mammals is preferably human.

The present invention further provides the method that suppresses influenza infection and/or duplicate.This method comprises allows cell contact with a certain amount of composition that can effectively suppress influenza infection and/or duplicate, and wherein is contained in the influenza virus that isolated nucleic acid molecule in the composition contains NA, M, HA, NS, NP, PB1, PB2, PA or its arbitrary combination and imports sequence.Cell can be the cell that does not infect, and also can be the cell of influenza infection.Importing sequence can be special to one or more types NA or HA.In one embodiment, cell also further contacts with M2 channel inhibitor or neuraminidase inhibitor.

The present invention also provides and has identified the alternative compositions and methods that suppresses or prevent influenza virus importing virion.This method comprises allows the cell of influenza infection contact with reagent, detects or measures the Influenza Virus RNA whether this reagent suppress such as NA vRNA or reorganization NA vRNA and import in the virion.Also provide reagent of identifying by this method and uses thereof, as suppressing or preventing that influenza virus from duplicating.

The accompanying drawing summary

Fig. 1. the combination of lectin resistant cell line.For each clone, cell with the Maackia amurensis Rupr et Maxim (maakia amurensis) of Myodigin mark (MAA) or golden elder (Sambucus) (SNA) lectin hatch, hatch with the anti-Myodigin antibody of marked by fluorescein isothiocyanate again, use facs analysis then.Thick line is the combination of MAA lectin, and fine rule is the combination of SNA lectin, the negative contrast of dash area (not adding lectin).

The NA gene structure of Fig. 2 .AL3 (MaKS)-13 and K4 (MaKS)-13 mutant.(A) AL3 (MaKS)-13 comprises the disappearance (the 220th base to 1253 base) of a 936-Nucleotide, and this disappearance has been removed most coding region of NA gene.This sudden change also is brought into a TAG terminator codon in the framework of outer two bases of disappearance, makes this gene 66 amino acid whose peptides of only encoding, and the endochylema tail end of this peptide and NA, strides a part of corresponding of film district, stem and head.(B) K4 (MaKS)-13 comprises the disappearance (the 130th base to 1193 base) of a 1066-Nucleotide, and this disappearance has been removed most coding region of NA gene.This sudden change also is brought into a TAG terminator codon in the framework of outer four bases of disappearance, makes this gene 38 amino acid whose peptides of only encoding, the endochylema tail end of this peptide and NA gene and to stride the film district corresponding.

The sialidase activity of Fig. 3 .AM2AL3 and K4 parental virus and AL3 (MaKS)-13 and K4 (MaKS)-13 mutant.For each sample, will duplicate virus (5 * 10 ²PFU) under the condition that can produce the sialidase substrate of fluorescence (4-methyl umbelliferone base-α-D-N-n acetylneuraminic acid n) existence, hatched 1 hour in 37 ℃.With the fluorescence intensity of luminoscope (LabsystemsFluoroskan II) mensuration 4-methyl Umbelliferone, excitation wavelength is 360nm, and emission wavelength is 460nm.

The synoptic diagram of Fig. 4 A. wild-type and NAFLAG carrier.

The production method synoptic diagram of Fig. 4 B.NAFLAG virus.

The immunostaining of the mdck cell of Fig. 4 C.NAFLAGWT virus or NA (-) virus infection.Cell dyes with anti--FLAG monoclonal antibody (MAb) M2 or anti--WSN polyclonal antibody.

Fig. 5. the competition analysis synoptic diagram of recombinate 7 fragment influenza viruses and NAFLAG virus.

The synoptic diagram of Fig. 6 A.NAFLAG and NAFLAGM (-) (" ATG ") carrier.

Fig. 6 B. immunostaining of the mdck cell of NAFLAGM (-) virus infection.Cell dyes with anti--FLAG monoclonal antibody M2 or anti--WSN polyclonal antibody.

The FLAG sequence in situ hybridization of Fig. 7 A.NAFLAG and NAFLAGM (-) cells infected is analyzed.

The duplicating efficiency of Fig. 7 B.NAFLAGWT virus or NAFLAGM (-) virus.

The synoptic diagram of Fig. 8 A.NA disappearance virus.

The packaging ratio of Fig. 8 B.NA disappearance virus.

Fig. 9. contain 6,7 or 8 time dependent virus titers of segmental influenza virus.

Figure 10. show the synoptic diagram of influenza virus fragment (stipled) lead-in signal.

The electron microscope tomography figure of Figure 11 A. influenza virus.

The influenza virus particles icones that Figure 11 B～F. is found with the electron microscope tomography.

Figure 12 .A) A type influenza virus and the HA encoding sequence viral fragment of the A type influenza virus of Type B HA replacement.B) A type influenza virus and the HA encoding sequence virion of the A type influenza virus of Type B HA replacement.

The chimeric HA construct of Figure 13 .A/B figure.Chimeric HA construct generates between wild-type A type/WSN virus HA (pPolI-WSN-HA) and wild-type Type B/LEE virus HA (pPolI-B-HA) in based on the plasmid (pHH21) of pPolI as described in (1999) such as Neumann.

The Type B HA of Figure 14 .A/B HA embedded virus expresses.Mdck cell with each virus infection was fixed in infection in back 24 hours, dyeed with anti--A/HA, anti--B/HA or anti--A/NP antibody mediated immunity then.

The growth of Figure 15 .A/B HA embedded virus.With MOI is 0.01 TCID ₅₀Each virus infection mdck cell, the growth of monitoring virus then.Shown in the figure twice once result in the independent experiment analog result.

Figure 16. the mouse of inoculation A/B HA embedded virus is to the antibody response of Type B virus.A) each virus (10 of intranasal vaccination ³TCID ₅₀) mouse (3 mouse/groups).Inoculate after 3 days, get nose/tracheae washing lotion and serum sample detects anti-Type B virus-specific IgA (nose/tracheae washing lotion) or IgG (serum) antibody with the ELISA method from each mouse.B) the HI titre in the mensuration serum sample.Every post is represented with this embedded virus mice infected individuality.

Figure 17. sudden change HA vRNA and virion thereof import the synoptic diagram of efficient.All sudden change HA RNA are all with the direction indication opposite with justice.Each mutant comprises side the GFP open reading frame of terminator codon, HA vRNA 33 Nucleotide of (black post bar) 3 ' non-coding region and 45 Nucleotide of 5 ' non-coding region (being inserted in the framework of band HA open reading frame).These mutant are named according to the few nucleotide that derives from the HA coding region.The HA coding region is represented with grey post bar.Horizontal dotted line is represented disappearance.The length not to scale (NTS) in zone is described.Infect and fixed in back 16 hours,, measure the importing efficient that sudden change HA vRNA imports VLPs with this with expressing the cell count of the cell count of GFP divided by expression NP in the VLP-cells infected.

Figure 18. with the vRNA level in the 293T cell that plasmid infected of expressing sudden change HA vRNA.The 293T cell is with pPol IHA (0) GFP (0) or pPol IHA (9) GFP (80) and express the plasmid infection of PA, PB1, PB2 and NP.

The cell expressing VSV G and the GFP of Figure 19 .VSVG (HA) GFP (NA) virus infection.Mdck cell is with VSVG (HA) GFP (NA) virus or WSN virus infection, and with 1.0% agarose covering.The cell that infects was hatched 48 hours in 37 ℃, with plaque at (A, B) under the ordinary ray and have that (C, D) takes pictures with the evaluation plaque under the fluorescence of limit normal light.With being dissolved in the 0.1%Triton-X100 fixed cell in 3% formaldehyde and penetrating.With anti--VSVG monoclonal antibody (E, F), anti--HA monoclonal antibody (G, H) or anti--NP monoclonal antibody (I, J) as first antibody and biotinylated second antibody, use Vectastain ABC test kit (Vector, Burlingame, CA), carry out immunostaining and detect viral protein.

Figure 20 .VSG albumen is to the importing of VSVG (HA) GFP (NA) virus.Spissated WNS, VSVG (HA) GFP (NA) and the cracking in sample buffer of VSV virus.Viral protein is handled with 2 mercapto ethanol, and 10%SDS-PAGE separates, and forwards on the pvdf membrane, hatches with anti--VSV G monoclonal antibody or anti--WSN-HA-monoclonal antibody.The left side is depicted as the molecular weight of labelled protein.

The growth curve of Figure 21 .VSVG (HA) GFP (NA) virus in BHK, CHO and mdck cell.BHK (A), CHO (B) and MDCK (C) cell MOI are 0.001 virus infection.Fixed time is measured virus titer in the supernatant liquor with mdck cell after infection.Institute's indicating value is the average of twice trial value.

Figure 22. the synoptic diagram of sudden change NS vRNA and importing efficient thereof.

Figure 23. the synoptic diagram of sudden change M vRNA and importing efficient thereof.

Figure 24. viral fragment (A) and express the synoptic diagram of the virion (B) of two kinds of heterologous proteins.

Figure 25. viral fragment contains the influenza virus synoptic diagram of HIV gp160 and two kinds of heterologous proteins of gag.

Figure 26. use the synoptic diagram that Cre/lox production can not duplicating virus.

Detailed Description Of The Invention

Term used herein " separation and/or purifying " refers to host cell of the present invention or virus at external preparation, separation and/or purifying, thus with the substance in vivo onrelevant, or come out from the basic purifying of external material. " basic purifying " used herein means target substance and accounts for major part and (namely figure by mole, other arbitrary substance in its abundance ratio composition is all high), preferred basic purified components is that target substance consists of the composition that there be 50% (figuring by mole) of macromolecular substances in all at least. Usually, the composition of basic purifying will comprise composition there will be about 50%, more preferably from about 80% even more preferably from about 85%, 90%, 95% and 99% of macromolecular substances in all in depositing. Most preferably, target substance is purified to basic homogeneity (can not detect polluter in the composition with the conventional detection method).

Term used herein " recombinant nucleic acid " or " recombinant DNA sequence or fragment " refer to nucleic acid such as DNA etc., derive or separate from original material, can carry out chemical modification external subsequently, it is not naturally occurring making its sequence, or position consistent from naturally occurring sequence but in its position and the natural gene group is different. Being accredited as useful fragment dna sequence dna or coming from the RNA reverse transcription is that " deriving " is in the DNA of original material example with the synthetic dna sequence dna of basic purified form then. This type of from one of DNA example of original material " separation " is, use chemical method as using restriction enzyme useful dna sequence dna, scale off, remove from described original material, in order to utilize gene engineering method further to operate such as amplification in order to use in the present invention. Recombinant virus prepares from recombinant nucleic acid.

" allos " used herein nucleic acid fragment, sequence or molecule mean original material that fragment, sequence or molecule originate from different with reference to the source of nucleic acid fragment, sequence or molecule. For example, A type influenza virus fragment or wherein a part to corresponding Type B influenza virus fragment or wherein a part be allos, the NA viral fragment of a kind of strains of influenza viruses or serotype is allos for the NA viral fragment of homophyletic or serotype not, and non-influenza nucleic acids molecule is allos such as HIV gap160 for the influenza nucleic acids molecule. On the contrary, the homologous nucleic acid fragment derives from the original material identical with reference nucleic acid fragment source. Therefore, nucleic acid molecules of the present invention is chimeric molecule, it comprise 3 ' noncoding region, each other at least one section of homology import sequence and 5 ' noncoding region.

Phrase " efficient replication " is defined as the very high infection titer of generation in the vitro tissue culture systems in the context of the present invention, such as 10⁴～10 ¹⁰PFU/ml, preferred 10⁶～10 ⁹PFU/ml. Copy or production of vaccine in the influenza virus screening used, can use this area in any known and/or suitable assay method to measure. The assay method that is suitable for screening (alone or any coupling) includes but not limited to, use virus replication such as reverse genetics, rearrangement, complementation and/or the method that infects, deactivation (as using the antiserum deactivation) quantitative and/or qualitative determination, transcribe, copy, translation, virion importing, toxicity, HA or NA activity, virus yield and/or morphology. For example, virus replication is measured attenuation or the deactivation that can be used for screening virus. Referring to Krug, R.M. etc., " influenza virus ", Plenum publishing house, New York, 1989.

" sialic acid " refers to that gang contains the amino sugar of 9 or more carbon atoms, such as N-and the O-substitutive derivative of neuraminic acid.

" locus specificity restructuring " used herein should comprise following three kinds of events: 1) side has the target dna fragment deletion in locus specificity recombination site or sequence such as lox site; 2) side has the nucleotide sequence counter-rotating of the target dna fragment in locus specificity recombination site or sequence such as lox site; With 3) mutually exchange takes place in the target dna fragment on locus specificity recombination site or sequence such as next door, lox site on the different dna moleculars. Site-specific recombination system includes but not limited to, bite (the No.5 of Cre/lox system of mattress body P1,658, No. 772 United States Patent (USP)s), FLP/FRT system (Golic and the lindquist of yeast, 1989), the Gin recombinase (Maeser etc. of Mu, 1991), the R/RS system (Araki etc., 1992) of the Pin recombinase of E.coli (Enomoto etc., 1983) and plasmid pSR1.

The clone that can use in the present invention and influenza virus

According to the present invention, the cell of any support influenza virus efficient replication all can use in the present invention, comprises as one or more sialic acid expressions minimizings of influenza virus acceptor or the mutant cell that descends. The method gained virus can be prepared into the rearrangement precursor virus.

Preferably but cell is identify or the appraisable continuous cell line of WHO. The demand that authenticates this type of clone comprises at least a feature in genealogy, growth characteristics, amynologic label, viral neurological susceptibility, oncogenicity and the condition of storage, and animal, ovum and cell are cultivated. These features are used for confirming that cell does not contain detectable exotic. In some countries, also need karyology. In addition, preferably checking oncogenicity with the used cell of production of vaccine with in the cell for level. Before deactivation or attenuation that vaccine generates, virus is preferred with having shown that the method that can provide consistent results carries out purifying (referring to the World Health Organization, 1982).

Preferably finish whole evaluations of used clone, to comprise suitable finished product purity check. Can be used for the data that used cell is identified among the present invention comprises: (a) its historical information that originates from, derives and go down to posterity; (b) information of its growth and morphological feature; (c) exogenous material assay; (d) can in other clone, know the obvious characteristic of identifying this cell, such as biochemistry, immunology and cytogenetics pattern; Reach (e) oncogenicity assay. Preferably, the amplification of the level that goes down to posterity of used host cell or quantity is as far as possible low.

What preferably produce in cell before the preparation of vaccine or gene therapy formulation is viral highly purified. Usually, purge process can be removed a large amount of cell DNAs, other cellular component and exogenous material. The method of the extensive degraded of DNA or sex change also can be used. Referring to Mizrahi, 1990.

Vaccine

Vaccine of the present invention can comprise and comprise any pathogen glycoprotein immunogenic protein, such as the immunogenic protein from one or more bacteriums, virus, yeast or fungi. Therefore, in one embodiment, influenza virus of the present invention can be the vaccine carrier of influenza virus or other viral pathogens, these pathogen include but not limited to the slow virus such as HIV, hepatitis B virus, HCV, the herpesviral such as CMV or HSV or foot and mouth disease virus.

The complete virus particle vaccine concentrates with ultrafiltration, then with band centrifugation or chromatography method purifying. Virus is carried out deactivation before purifying or behind the purifying, as with formaldehyde or beta-propiolactone deactivation.

Subunit vaccine comprises the glycoprotein of purifying. This type of vaccine can be prepared as follows: with the viral suspension of detergent-treatment fragmentation, purifying surface antigen, as utilize ultracentrifugation. Thereby subunit vaccine mainly comprises HA albumen, also comprises NA. Used detergent can be cationic detergent, such as softex kw (Bachmeyer, 1975); Anionic detergent is such as deoxycholic aicd amine (Laver ﹠ Webster, 1976; Webster etc., 1977); Or nonionic detergent, such as the commercial detergent of TRITON X100 by name. Virion can be separated hemagglutinin after using Protease Treatment such as bromelain, and purifying in addition then is as with Grand and the described method purifying of Skehel (1972).

Split vaccines comprises the virion of having crossed with the agent treated of solubilized lipid.Split vaccines can be prepared as follows: as the above-mentioned purified virus aqueous suspension that obtains, handle no matter its deactivation whether, is used under jolting such as the fat solvating agent relevant with stain remover such as ether or chloroform.Water reverts to and comprises split vaccines, mainly hemagglutinin and sialidase, core or its degraded product of having been removed by the initial lipid external world.If residual infectious particles is not deactivation also, then with its deactivation.

The vaccine of deactivation

Inactivating influenza virus vaccine of the present invention can make the inactivation of virus after duplicating and prepared with currently known methods, and these methods include but not limited to handle with formaldehyde or beta-propiolactone.The inactivated vaccine type that can use in the present invention can comprise totivirus (WV) vaccine or subviral particle (SV) (fragment) vaccine.Virus complete, deactivation that the WV vaccine comprises; And the SV vaccine comprises purified virus, and this virus is destroyed with the stain remover that solubilized contains the fat peplos, then with residual virus chemical process deactivation.

In addition, the available vaccine comprises the vaccine that contains separation HA and NA surface protein, and surface protein refers to surface antigen or subunit vaccine.Usually, the reaction to SV and surface antigen (being the HA or the NA of purifying) vaccine is similar.As if the tentative deactivation WV vaccine that contains relevant NA antigen of popular virus and uncorrelated HA than the efficient low (Ogra etc., 1977) of conventional vaccine.The inactivated vaccine that preferably comprises two kinds of surface antigens.

The attenuated virus vaccine of living

According to the step operation of currently known methods, the attenuated virus vaccine of living also can be used for prevention or treatment influenza infection.Preferably, in a step, the gene of attenuation is transferred to the chorista that duplicates or reset virus from the donor virus of attenuation, thereby realize attenuation according to currently known methods (referring to Murphy, 1993).Because the resistance to influenza virus A is mediated by the immune response development to HA and NA glycoprotein, the gene of these surface antigens of encoding must derive from these clinical choristas of resetting virus or high-speed rapid growth.The gene source of attenuation is in the parental generation of attenuation.In this method, the gene of being responsible for attenuation preferably do not encode HA and NA glycoprotein.Otherwise these genes can not be transferred to and contain the clinical viral chorista surface antigen of resetting body.

Estimated the ability of many donor virus reproducibilities ground attenuated influenza virus.As one of non-restrictive example, the donor virus of A/Ann Arbor (AA)/6/60 (H2N2) cold-resistant (ca) can be used for the production of attenuated vaccine (referring to Edwards, 1994; Murphy, 1993).In addition, ca donor virus and poisonous replication-competent virus pairing of the present invention can be reset virus vaccines thereby generate the attenuation of living.In 25 ℃ (limiting duplicating of poisonous virus) filial generation of resetting body is selected under the condition that the H2N2 antiserum(antisera) exists then, described antiserum(antisera) suppresses to contain the virus replication of attenuation A/AA/6/60 (H2N2) ca donor virus surface antigen.

Estimated most H1N1 and H3N2 rearrangement series the mankind, and found that they are satisfied: (a) tool infectivity; (b) attenuation is taken place in the adult of seronegativity children and immunology stimulation; (c) tool immunogenicity; Reach (d) inheritance stability.The immunogenicity of Ca rearrangement body is parallel with its levels of replication.Therefore, 6 transferable genes that obtain the ca donor virus by new wild-type virus again terrain make these viral attenuations to be used for susceptible adult and children's vaccine inoculation.

Can utilize rite-directed mutagenesis that other attenuation sudden change is imported in the influenza virus gene to keep the virus that contains these mutator genes.But the non-coding region and the coding region of attenuation sudden change quiding gene group.The sudden change of this type of attenuation also can import in the gene outside HA or the NA, as PB2 pol gene (Subbarao etc., 1993).Like this, new donor virus also can contain the attenuation sudden change that rite-directed mutagenesis imports when generating, and these new viruses can be used for resetting body H1N1 and H3N2 vaccine candidate to reduce attenuation alive with above-mentioned A/AA/6/60 ca donor virus mode roughly the same.Similarly, other known and suitable attenuated virus can be reset attenuated virus (Ewami etc., 1990 to obtain to be adapted to use in the Mammals vaccine inoculation with influenza virus of the present invention; Muster etc., 1991; Subbarao etc., 1993).

Preferably these attenuated virus are kept the gene that comes from virus, the basic similarly antigenic determinant of described genes encoding and original clinical chorista.This is that infectivity reduces to vaccine can cause inducing serious disease state generation minor alteration in seeded with mammalian degree simultaneously because the target of attenuated vaccine provides and the essentially identical antigenicity of viral original chorista.

Virus can be made preparation and react with induction of immunity in animal such as Mammals as vaccine administration according to currently known methods attenuation or deactivation like this.Whether this type of attenuation or inactivated vaccine have kept and clinical chorista or its similar antigenicity of high-speed rapid growth strain of deriving, and its measuring method is well-known in this area.Such method comprises uses antiserum(antisera) or cleaning antibody to express the virus of donor virus antigenic determinant; Chemistry is selected (as amantadine or rimantidine); Active and the inhibition of HA and NA; And DNA screening (such as probe hybridization or PCR) confirms not exist in the attenuated virus donor gene of coding for antigens determinant (as HA or NA gene).Referring to Robertson etc., 1988; Kilbourne etc., 1969; Aymard-Henry etc., 1985; Robertson etc., 1992.

Medicinal compositions

The present invention is suitable for inoculating, non-enteron aisle uses or oral medicinal compositions comprises the influenza virus of attenuation or deactivation, optional sterile aqueous or non-aqueous solution, suspension and the emulsion of also comprising.Composition also can further comprise known auxiliary or vehicle in the field, referring to Berkow etc., 1987; Goodman etc., 1990; The pharmacological agent of Avery, 1987; Osol, 1980; Katzung, 1992.Composition of the present invention provides with the form of single agent (unitary dose) usually.

Conventional vaccine comprises about 0.1～200 μ g, preferred about 10～15 μ g enter its composition from each strain hemagglutinin usually.The vaccine that constitutes the main component of vaccine composition of the present invention can comprise A type, Type B or C type or its arbitrary combination, as at least two kinds in three types, at least two kinds of different subtype, at least two kinds of same type, at least two kinds of identical hypotype, or different chorista or reset body.A type human influenza virus comprises H1N1, H2N2 and H3N2 hypotype.

Non-enteron aisle is used goods and is comprised sterile aqueous or non-aqueous solution, suspension and/or emulsion, and they can comprise known auxiliary reagent or vehicle in the field.Non-aqueous solvent example comprises propylene glycol, polyoxyethylene glycol, the vegetables oil such as sweet oil and the injectable organosilane ester such as ethyl oleate.Available support or airtight dressing strengthen the perviousness and the antigen absorption of skin.Oral liquid preparation can comprise the liposome solutions that contains this liquid preparation usually.The suitable form of liposome of being used to suspend comprises emulsion, suspension, solution, syrup and contains the elixir of inert diluent commonly used in this area such as purified water.Except inert diluent, this based composition also can comprise adjuvant, wetting agent, emulsifying agent and suspension agent, sweeting agent, seasonings or perfuming agent.Referring to Berkow etc., 1992; Goodman etc., 1990; Avery ' s etc., 1987; Osol etc., 1980; And Katzung, 1992.

When composition of the present invention was used for individuality and uses, it also can comprise salt, damping fluid, adjuvant or the required material of other enhancing composition usefulness.For example, can use this material that can enlarge specific immune response of adjuvant.Under the normal circumstances, before being administered to immunity system, adjuvant and composition are mixed, or separate administration but enter the same position of inoculation organ.The examples of materials that is adapted at using in the vaccine composition is seen Oso1 (1980).

Heterology in the vaccine can by make such as in 2～50 strains or its any range, the replicating influenza virus of at least two kinds of strains of influenza viruses of arbitrary number mixes and realizes.The A type or the Type B strains of influenza viruses that preferably contain modern antigen composition.According to the present invention, can provide the vaccine that uses technology known in the art that the influenza virus individual plant is morphed.

Root is according to the present invention, and medicinal compositions also can be further or comprised compound, immunosuppressor, anti-inflammatory agent or the immunostimulant of a kind of chemotherapy compound as being used for gene therapy in addition; For vaccine, chemotherapeutic includes but not limited to gamma globulin, amantadine, guanidine class, hydroxy benzo imidazoles, alpha-interferon, beta-interferon, gamma-interferon, tumor necrosis factor-alpha, (thiosemicarbazone), Metisazone, Rifampin, ribavirin, pyrimidine analogue, purine analogue, phosphine formic acid, phosphine acyl acetic acid, acyclovir, dideoxyribonucleoside, proteinase inhibitor or ganciclovir.Referring to Katzung (1992), and the document of quoting respectively at 798-800 and 680-681 page or leaf.

Composition also can comprise adjustable but no intracellular toxin formaldehyde and sanitas in a small amount, and they are all known to be safe, can't produce unwanted effect in the organism that composition is used.

The pharmacy purpose

The purpose of using composition (or antiserum(antisera) that it excited) can be " preventative ", also can be " curative ".When preventative use, the present composition is a vaccine, manifests preceding use in any symptom of pathogenic infection.The preventative infection usefulness that to prevent or to weaken subsequently of using of the present composition.When therapeutic was used, attenuation or the virus vaccines of living were used after detecting the symptom of viral infection.The therapeutic administration of the present composition can be used for weakening any real infection.Referring to Berkow etc., 1992; Goodman etc., 1990; Avery, 1987; And Katzung, 1992.

Therefore, attenuation of the present invention or inactivated vaccine composition can use (so that preventing or weaken the infection of expection) before infecting generation, also can start the back use in real infection.

Similarly,, use before composition can display in any symptom of illness or disease, also can after detecting one or more symptoms, use for gene therapy.

If composition can be tolerated by accepting the patient, then this is combined as and is called " pharmacology can be accepted ".If used measurer has physiological meaning, then claim " with the treatment significant quantity " to use.If the existence of the present composition can make and accept the patient and take place and can change by detected physiology, for example strengthen elementary or secondary body fluid or cell immune response, but then weighing-appliance there is physiologic meaning at least one strain of infectious influenza virus.

" protection " that is provided is not necessarily absolute, that is to say if compare with contrast crowd or one group of patient, and obtained gratifying improvement, then influenza infection not necessarily prevents fully or eradicated.Protection may only limit to alleviate the severity or the generation speed of influenza infection symptom.

Pharmacy is used

Composition of the present invention provides resistance to one or more pathogenic agent by passive immunization or active immunity, as the resistance to a strain or many influenzae strains virus strain.During active immunity, deactivation or attenuated live vaccine composition are preventative to be applied to host (as Mammals), and the host protects the host to avoid infecting and/or morbidity to the immune response of using vaccine.For passive immunization, the antiserum(antisera) that is excited can restore and be applied to the recipient that may have the infection that is caused by at least a strains of influenza viruses.

In second embodiment; vaccine administration is in mammiferous female (in gestation or the childbirth or use before), time of application and dosage be enough to produce can protect simultaneously female and fetus or baby (by antibody passive pass placenta or enter in mother's the milk work) immune response.

Therefore, the present invention includes prevention or improve illness or disease, for example by the method for the infection due at least one pathogen strain body.As described herein, if using of vaccine can obtain improving wholly or in part (promptly suppressing) of disease condition or symptom, or individual immunizing power wholly or in part to this disease, say that then this vaccine can prevent or alleviate this disease.

Deactivation of the present invention or attenuated influenza virus or its composition have at least a kind of aforementioned pharmaceutical compositions of utilizing to use by reaching required purpose any means.

For example, can use such composition by various parenteral routes, as in subcutaneous, intravenously, abdomen abdominal cavity, intramuscular, intraperitoneal, the nose, oral cavity or transdermal route.It can be to inject together or progressively to inject in time that non-enteron aisle is used.One of preference pattern that uses medicinal compositions of the present invention is in intramuscular or subcutaneous application.Referring to Berkow etc., 1992; Goodman etc., 1990; Avery, 1987; And Katzung, 1992.

The typical scenario of prevention, inhibition or treatment influenza virus related pathologies comprises the aforementioned vaccine composition of this paper that uses significant quantity, but single administration treatment, or comprise 1 week to about 24 months or wherein in one period of any range or numerical value to strengthen or the boost repetitive administration.

Press according to the present invention, " significant quantity " vaccine composition is the amount that can obtain required biological effect.Be understandable that effective dose depends on age, sex, recipient's healthy state and body weight,, also depend on the person's character of required effect if combined treatment is arranged then also depend on the kind of combined treatment and the frequency of treatment.The effective dosage ranges that provides below is not to want to limit the present invention, but has represented the preferred dosage scope.But most preferred dosage is decided according to individual subjects, and is known and can be determined by it by the one skilled in the art.Referring to Berkow etc., 1992; Goodman etc., 1990; Avery, 1987; And Katzung, 1992.

The attenuated virus vaccine consumption of mammals (as the people) or bird adult organism body can be about 10 ³～10 ⁷Plaque forming unit (PFU)/kg, or the amount of any range or numerical value wherein.The dosage of inactivated vaccine can be about 0.1～200 μ g hemagglutinin, as 50 μ g.But as starting point, it should be safety and effective amount that ordinary method is measured institute's consumption with existing vaccine.

The consumption of the immunoreactive HA of tool in each dosage of replication-competent virus vaccine can be standardized as and contain suitable content, as 1～50 μ g or wherein any range or numerical value, or the consumption recommended of public health service of USA, normally be not less than 3 years old the every component 15 μ g of children, less than the every component 7.5 μ g of 3 years old children.But the also stdn of the amount of NA, but this glycoprotein instability (Kendal etc., 1980 when purge process and storage; Kerr etc., 1975).The vaccine of preferred every 0.5-ml amount comprises hundred million virions of about 1-50, more preferably 1,000,000,000 particles.

The present invention is further described the restricted embodiment of non-limit below.

Embodiment 1

Materials and methods

Virus and cellSeparate, be positioned at and contain embryo egg (A/Tottori/AT1/AM2AL3/94 from single patient; AM1AL3) or madin-darby dog kidney in people H3N2 virus, obtain from T.ito (Tottori university, Tottori, Japan).The virus original seed contained in the embryo egg (AMZAL3 virus) 10 day age to be cultivated, or the mdck cell (K4 virus) in the minimum minimum medium (MEM) that is supplemented with 0.3% bovine serum albumin bletilla 0.5mg trypsinase/ml is gone up cultivation.(Sigma, St.Louis cultivate among MEM MO) mdck cell being supplemented with 5% new-born calf serum.

The generation of lectin resistant cell line.Growing to 75% mdck cell that merges washs three times with phosphate buffered saline (PBS), with Maackia amurensis Rupr et Maxim (MMA) lectin (100mg/ml, BoehringerMannheim) or golden elder (SNA) lectin (100mg/ml BoehringerMannheim) is hatched in the MEM that contains 0.3% bovine serum albumin together.After hatching 48 hours, substratum replaces with growth medium (MEM-5% foetal calf serum).Lectin is selected to repeat in addition twice as mentioned above.The cell colony of surviving is cloned, and the clone that SNA and MAA select is appointed as MDCK-Sn10 and MDCK-Ma respectively.

Measure sialic acid content with photofluorometer HPLC methodIt is described to press Suzuki etc. (1997), measures sialic acid (N-n acetylneuraminic acid n [NeuAc] and N-glycosyl neuraminic acid [NeuGc]) content in two kinds of clones and the purified virus with high performance liquid chromatography with photofluorometer.Each sample places 5-ml top mat glass bottle, mixes with 100 μ l (25mM) sulfuric acid.Then bottle is heated 12 hours hydrolysis saliva-sugar chains in 60 ℃.After the cooling, add 50 μ l 1 in the 50 μ l hydrolyzates, 2-diamino-4, the 5-methylenedioxybenzenes, the mixture lucifuge heats 2.5 hours so that sialic fluorography in 60 ℃.Gained solution is got separatory such as 10 μ l and is injected sample injection valve (model 7125 is housed, Reodyne) and spectrophotofluorometer (650-105, Hirachi, Tokyo, Japan) 880-PU high performance liquid chromatography (JASCO, Tokyo, Japan), this spectrophotofluorometer has 20-μ l flow cell and registering instrument (Chromatopac C-RSA, Shionadzu, Tokyo, Japan).It is that 373nm, emission wavelength are 448nm that spectrophotofluorometer is arranged to excitation wavelength.The standard mixture of NeuAc (Sigma) and NeuGc (Sigma) (200pmol/ μ l) is used to set up calibration curve.

Use the sialidase activity of photofluorometer to measureVirus sialidase activity (5 * 10 ⁵PFU) press (1987) such as Hara described, be that substrate is measured with 2 '-(4-methyl umbelliferone base)-α-D-N-n acetylneuraminic acid n (Sigma).Briefly, fluorogenic substrate is added in the equivalent sample after diluting with 1: 2 with 0.5M sodium-acetate (pH4.6), hatches 30 minutes in 37 ℃.Na with 200ml 0.5M ₂CO ₂(pH10.7) termination reaction is in excitation wavelength 360nm and emission wavelength 460nm hatching fluorescence.Institute responds and implements in duplicate.

NA and HA Gene Sequence AnalysisUse Qiappin vRNA purification kit, (Valencia Calif.) illustrates from viral sample acquisition total viral rna (vRNA) for Qiagen, Inc. by manufacturer.When producing cDNA, use with A C-type virus C gene fragment 3 ' and hold 12 conservative vRNA Nucleotide complementary oligonucleotide Uni-12 as moloneys mouse leukemia virus reverse transcriptase (Promega, Madison, WI) Fan Ying primer.NA gene cDNA NA gene-specific primer JN2-43 (5 ' cRNA justice sequence: 5 '-TGGCTCGTTTCTCTCACTATTGCC-3 '; SEQ ID NO:1), JN2-1410r (3 ' cRNA antisense sequences: 5 '-TTATATAGGCATGAGATTGATGTTCCG-3 '; SEQ ID NO:2) and 10U Pwo archaeal dna polymerase (Boehringer Mannheim) carry out 30 and take turns cyclic amplification.Gained PCR product subclone is gone into carrier pCR21, and (Inbitrogen, Carlsbad Calif.), use in the order-checking of automatization fluorescence.HA gene HA gene-specific primer JH3-Up (5 ' cRNA sense primer sequence: AGCAAAAGCAGGGGATAATTCTATTAACCATGAAGAC-3 '; SEQ ID NO:3) and JH3-Down (3 ' cRNA antisense primer sequence: 5 '-AGTAGAAACAAGGGTGTTTTTAATTAATGCACTC-3 '; SEQ ID NO:4) to clone with the similar mode of NA gene.For each chorista, check three clones to obtain the consensus sequence of NA and HA.

The result

The generation of lectin resistant cell lineIn order to produce the clone that cell surface sialic acid expression level descends, sialic acid binding specificity different lectin SNA and MAA have been used.Pass through α (2,3) key and semi-lactosi (Wang etc., 1988) with MAA bonded sialic acid, and be connected (Shibuya etc., 1987) with semi-lactosi or N-acetylgalactosamine by α (2-6) key with SNA bonded sialic acid.Use the parental cell of the mdck cell of support influenza virus growth as the lectin selection.When importing under the condition that any one lectin exists therein, most of cell is dead in a week.Allow the resistant cell clone longer then as the original seed culture.MAA and SNA lectin select resulting clone to be appointed as MDCK-Ma and MDCK-Sn10 respectively.

The fluorescence-activated cell sorting (Figure 1A) that carries out with the MAA and the SNA lectin of Myodigin mark prove as former report (Ito etc., 1997), mdck cell is all very high with the level that combines of two kinds of lectins.With the plain MDCK-Sn10 cell of selecting of α (2,6) key specific agglutination, still keep the strong combination with α (2,3) specificity MAA lectin, died down but the combination of SNA lectin compared with parental generation MDCK parental generation.By contrast, with the plain MDCK-Ma cell of selecting of α (2,3) key specific agglutination, to the combination of two kinds of lectins all than a little less than the mdck cell many.

The growth of virus in MDCK-Sn10 and MDCK-Ma cloneIn order to learn that how influenza virus adapts to the cell that expression of receptor reduces, and uses two kinds of known influenza virus variants of sialic acid acceptor key specificity (AM2AL3 and K4) (Ito etc., 1997).NeuAc[NeuAc α (2, the 6) Gal that the identification of K4 virus-specific ground is connected with semi-lactosi by α (2,6) key], and AM2AL3 virus-specific identification NeuAc α (2,3) Gal.Two kinds of virus duplicating and duplicate the same good (table 1) in mdck cell in the MDCK-Sn10 cell.But the titre of two kinds of cells in the MDCK-Ma cell is all than low 1 log of the titre in the mdck cell.Equally, wherein behind any one virus infection, also only there is sub-fraction MDCK-Ma cell to continue to grow to merge and cytopathic effect do not take place even infection multiplicity reaches 10.When substratum when containing the tryptic substratum that can promote viral growth and replace, hemagglutination is measured the virus that can not detect in these survivaling cells and is generated.The HA of these cells and NP protein immunization chemical staining also are negative (data are unlisted), thereby the not persistent infection of proof cell.The cell of survival is appointed as MaKS.

Table 1. influenza virus duplicating in the lectin resistant cell line ^*

Clone	Titre (TCID 50/ml)
			AM2AL3	K4
	?MDCK ?MDCK-Sn10 ?MDCK-Ma	1.5×10 9 5.6×10 8 1.8×10 8			5.6×10 4 3.2×10 4 5.6×10 3

* with AM2AL3 or K4 and virus cells infected together, and measure and infect the needed dosage (TCID of 50% tissue culture cells ₅₀), measure the susceptibility of each clone with this.

The facs analysis of SNA and MAA lectin proves, the MaKS cell is as the MDCK-Ma cell in its source of deriving, with the binding ratio mdck cell of α (2,6) specificity SNA weak many (Figure 1B).In addition, the MAA lectin of MaKS cell is in conjunction with peak than MDCK-Ma clone much narrow in conjunction with the peak, and lacked and represent the little acromion (Fig. 1) of Geng Gao MAA in conjunction with the group.

In order to measure the sialic acid content minimizing is the reason of MaKS cell agglutinin in conjunction with minimizing, with liquid-phase chromatographic analysis the sialic acid that exists in the MaKS cell is carried out quantitatively.Although the level of NeuGc is much lower, the NeuAC of MaKS cell and NeuGc level (be respectively 8.2 and 0.4pmol/ μ g albumen) are more much lower than the level in the mdck cell (be respectively 216.0 and 2.5pmol/ μ g albumen).Sialic acid acceptor determinant reduces in a large number in these data declarations MaKS cell.

The adaptation of virus in the MaKS cellHow to breed in the low-down cell of expressing viral level and the adaptation growth for measuring AM2AL3 and K4 virus, two kinds of viruses successively go down to posterity in the MaKS cell in liquid culture.Since two kinds of viruses in the MaKs cell duplicate all than duplicating in mdck cell weak many (tables 2), in the 1st to 3 generation, do not dilute, in the 4th to 13 generation,, 000 diluted by 1: 1.After the 8th generation, the plaque diameter that any one variant produced diminishes (about 1mm) by big (surpassing 3mm).To 10 generations or higher algebraically, the virus of measuring with mdck cell only presents littler plaque (data are unlisted).Through successive after 13 generations, two kinds of virus all can in the MaKS cell, grow with the same in mdck cell or look better (table 2).The viral original seed that is produced by arbitrary mutation after 13 generations increases, and be appointed as AL3 respectively (MaKS)-13 and K4 (MaKS)-13.

Table 2. is adapted to duplicating of the virus of growing in lectin is selected cell ^*

Clone	Titre (TCID 50/ml)
					?AM2AL3	AL3(MaKS)- 13	?K4	K4(MaKS) -13
	MDCK MaKS Resin, MDCK titre/MaKS titre	?1.5×10 8?5.6×10 6?321	5.6×10 4 5.6×10 4 1	?5.6×10 4?1.8×10 3?31					5.6×10 4 1.8×10 3 0.3

* use the cell of AM2AL3 (in ovum, growing), K4 (in mdck cell, growing), AL3 (MaKS)-13 or K4 (MaKS)-13 original seed virus infection, measure and infect the needed dosage (TCID of 50% tissue culture cells ₅₀), measure the susceptibility of each clone with this.Note two kinds of viruses being adapted to grow in the MaKS cell in these cells in growing state and the mdck cell the same good (AL3 (MaKS)-13) or better (K4 (MaKS)-13), and initial virus is grown in MDCK more betterly.

AL3 (MaKS)-13 is as the mutation analysis of viral HA of K4 (MaKS)-13 and NA geneAdapt to the cellular environment that is reduced to feature with acceptor density for measuring virus,, use pcr amplification cDNA, products therefrom is checked order the HA gene reverse transcription of AL3 (MaKS)-13 and K4 (MaKS)-13 virus.Compare with the corresponding HA gene of two parental generation viruses, the gene of two kinds of viruses does not all contain sudden change.

Because the NA sialidase activity influences the HA receptor-binding activity probably, thereby has measured the NA sequence of AL3 (MaKS)-13 and K4 (MaKS)-13 virus.The NA gene sequencing of two kinds of variants shows that all there is a sheet of disappearance (Fig. 2) inside.In the AL3 (MaKS)-13, disappearance extends to the 1253rd Nucleotide from the 220th Nucleotide, a reading frame is moved prop up, thereby produced a terminator codon after being right after this disappearance.The coding capacity of this NA is 66 amino acid, with the endochylema tail end of NA, stride a part of corresponding of film district, stem and head.Similarly, K4 (MaKS)-13 chorista takes place from the 130th base to 1193 base in the NA gene, has introduced a terminator codon at the 39th codon place.The catalysis header area the same with AL3 (MaKS)-13, that this gene is no longer encoded complete.Thereby the virus that goes down to posterity in the cell that the expression of receptor level descends has been lost its NA catalytic activity.

In order to confirm this result, analyzed the sialidase activity of AL3 (MaKS)-13 and K4 (MaKS)-13 variant with fluorescence sialidase substrate [2 '-(4-methyl umbelliferone base)-α-D-N-n acetylneuraminic acid n].Different with parental virus, two NA deletion mutants all do not detect sialidase activity (Fig. 3).

The sialylated degree of viral glycoproteinDuring normal the infection, the virus that sialidase activity descends can not and be assembled (Palese etc., 1974 in the effective growth of cell expressing; Shibata etc., 1993).So, can the AL3 (MaKS)-13 and K4 (MaKS)-13 virus that why lack sialidase activity be grown in the MaKS cell? a kind of possible explanation is because the sialic acid content of these cells is low, the sialylated degree of HA and NA oligosaccharides is also low, stoped virus in the lip-deep gathering of cells infected, even also like this during virus-free sialidase activity.In order to check this hypothesis, AL3 (MaKS)-13 virus of growing in the AM2AL3 that grows and K4 virus and the MaKS cell has been done the sialic acid content comparison of purified virus goods in mdck cell.Though the sialic acid content of AM2AL3 virus (0.9pmol NeuAc/g albumen) is than other content of two kinds (A/Tottori/872/K4/94,3.8pmol NeuAc/g albumen; AL3 (MaKS)-13,2.6pmol NeuAc/g albumen) low, the NeuAc content in three kinds of viral sample is similar.

Therefore, the virus that lacks sialidase activity can efficiently be grown in the cell that the sialic acid level descends, because compare with normal cell system, viral protein does not have not sialylated widely and combines with HA, and these can stop the gathering of virus.

Discuss

In the research in the past, A type influenza virus is gone down to posterity under the condition that has thin mattress sialidase activity of external source and virus N A antibody to exist and causes virus N A genetically deficient (Liu etc., 1993; Liu etc., 1995; Yang etc., 1997).And, as this molecule to the proteic compensatory sudden change result of HA that sialic acid residues avidity descends, so go down to posterity gained NA mutant can the cell culture that lacks the external source sialidase activity, and ovum and mouse in growth (Hughes etc., 2000).As described herein, A type influenza virus can be adapted to grow in lack the cell that expression of receptor extremely descends in a large number because of the NA gene, and wherein a large amount of disappearances of NA gene make its sialidase activity forfeiture.Although the minimizing of virus receptor can influence the HA albumen of bind receptor in theory, have only the NA gene that change has taken place.

What is this result's molecular basis? in normal cellular environment, sialic acid acceptor abundance is very high, the active disappearance of NA can compensate by the avidity of minimizing sialic acid to viral HA, filial generation is discharged from host cell effectively, prevent virion gathering (Hughes etc., 2000).When virus receptor is not high enough, as our MaKS cell, HA avidity descend not for daughter of virus release and NA deletion mutantion bulk-growth essential.In fact, for the virus replication that is subjected in virus in the expression level decline cell, must keep the proteic high-affinity combination of HA.But sialidase activity is for the release of virion in this type of environment and prevent that virion is optional assembling, because the sialic acid content of cell surface molecule is very low, its sialic acid content of virion of NA disappearance and wild-type virus particulate species are seemingly.In fact, sialidase activity is likely deleterious for viral growth, because it has further removed acceptor determinant sialic acid from cell surface.Recently, thus find that A type influenza virus that disappearance NA stem can not be grown has obtained 22 amino acid whose stems of as many as by non-homogeneous RNA-RNA reorganization and inserted (Mitnau etc., 2000) in ovum.Summary is got up, and these results show that influenza virus can be adapted to new host environment by comprising that a large amount of insertions and the basic genetics that lacks change.

This research and research (Hughes etc., 2000 in the past; Liu etc., 1993) find that all virus loses its sialidase activity by the disappearance in the NA gene fragment, wherein Sheng Xia fragment coding endochylema tail with stride the film district.Therefore, the NA gene conservative region in these mutant may be necessary for forming and stablize such as morphology of virus.

The sialic acid content of MaKS cell is lower than its parental generation (MDCK) cell.Although also generated similar clone (Ray etc., 1991), can not prove and in influenza virus research, to use, because they can not effectively support influenza virus from Chinese hamster ovary celI.On the contrary, the standard cell lines that the MaKS cell derives from the influenza virus research is a mdck cell, should use in the analysis based on virus receptor.For example, because the ganglioside of exogenous interpolation can be incorporated into (Cafroll etc., 1985) in the host cell membrane, thereby can hatch a kind of known ganglioside with MaKS, and check its ability as virus receptor.

In eighties of last century, when both introduced the mankind when the HA of emerging virus or HA and NA gene, three kinds of A type influenza viruses budded out into popularity.The virus control in different host animals source studies show that the NA gene has been introduced sudden change (Bean etc., 1992) in these popular virus strain.Whether virus breaks through host's kind obstacle needs to take place among the NA similarly sudden change and it be unclear that, but its substrate specificity of human virus N2 NA that derives from a kind of bird virus changes in the mankind's reproduction process gradually (Baum etc., 1991).The above results explanation NA sudden change can help A type influenza virus to be adapted to new environment really.For example, the rearrangement precursor virus of human virus NA and all the other genes of duck virus can not duplicate (Hinshaw etc., 1983) in duck, also be (Scholtissek etc., 1978) like this even human virus's NA derives from bird virus.Illustrate that the NA gene in adapting to human process sudden change has taken place probably.The reverse genetics based on plasmid (Fodor etc., 1999 that the virus N A comparative study in different animals source and latest developments are come out; Neumann etc., 1999) together, may and help deeply understand these surface glycoproteins and help influenza virus to adapt to variation in the nature.

Embodiment 2

Materials and methods

CellThe 293T HEKC is cultivated in Dulbecco ' the s substratum that is supplemented with 10% foetal calf serum (FCS), and Madindarby dog kidney (MDCK) cell is cultivated in Eagle ' the s substratum that is supplemented with 5% new-born calf serum.

Reverse genetics based on plasmidIt is described to press Neumann etc. (1999), with the pCAGGS/MCS plasmid generation A type influenza virus (Fig. 4) of plasmid (being called the Pol1 plasmid) that contains A/WSN/33 (H1N1) the virogene cNDA that is subjected to rna plymerase i promotor and terminator control and expression of influenza viral protein.Briefly, Pol1 plasmid and protein expressing plasmid and infection reagent Trans ITLT-1 (Panvera, Madison, WI) mix after, in incubated at room 10 minutes, be added to that Opti-MEM (GIBCO/BRL) cultivates 1 * 10 ⁶In the individual 293T cell.After the transfection 48 hours, adding 0.5 μ g/ml is tryptic to activate HA albumen in the substratum, hatches 1 hour in 37 ℃.Collect supernatant.

PlasmidThe NAFLAG gene contains the 5 ' non-coding region of NA cRNA; With endochylema tail (6 amino acid), stride film district (29 amino acid) and stem district (16 amino acid) corresponding 51 NA codons (Fig. 4 A); FLAG epi-position (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys; SEQ ID:5); Two continuous terminator codon (TAA TAG; SEQ ID NO:6); And 185 bases of NA cRNA 3 ' terminal sequence.3 ' terminal sequence of this length is the short-movie section of finding in the brachymemma NA fragment (Yang etc., 1997).With the individual nucleotide deletion of the 173rd to 1070 (in the positive-sense strand) of WSN gene among the pT7Blue-NA and insert FLAG sequence, two terminator codons and a StuI site, generation can produce the pPol1-NAFLAGWT of antisense NAFLAG RNA with PCR.Digest this fragment with StuI, make it the oneself and connect.With BsmBI NAFLAG is scaled off, be inserted in the BsmBI site of pHH21.

Be used for the proteic initiator codon of pPOl1-NAFLAGM (-) shortage NA that NAFLAGM (-) produces.(GeneEditor Promega) becomes the proteic ATG initiator codon of brachymemma NAFLAG into GCG, realizes this target with external rite-directed mutagenesis system.

By inverse PCR the individual Nucleotide of the 203rd to 1109 (in the positive-sense strand) of WSN gene among the pT7Blue-NA is replaced with the BglII site, generate pPOl1-(183) GFP (157), the RNA that its generates contains NA vRNA 3 ' terminal non-coding region and the coding complementary sequence with the fusion rotein of 61 NA N-end codons, and 185 bases of NA vRNA 5 ' end, wherein fusion rotein for strengthen fluorescin (eGFP, Clontech).The eGFP gene clone is gone into this BglII site and is arranged in the StuI site that 1226 of NA albumen frames are located (wild-type NA gene).Then NA-(183) GFP (157) gene is inserted the BsmBI site of pHH21.

Generate NA (0) GFP (0) gene with the Oligonucleolide primers that contains the BbsI site by PCR, it contains complementary encoding sequence and the NA vRNA 5 ' non-coding region of NA vRNA 3 ' terminal non-coding region, eGFP.This PCR fragment is with BbsI digestion and insert in the BsmBI site of this HH21 so that when plasmid introduced cell, can synthesize and contain the RNA that side has the eGFP encoding sequence of 5 ' and 3 ' NA vRNA district non-coding region in the minus strand direction.

Generate a series of deletion mutants by the PCR sudden change.NA-(183) GFP (157) the gene preparation of the deletion mutant of NA-eGFP fusion rotein from the pT7Blue carrier.Generate NA-(183) GFP (0) gene by the PCR sudden change, it has lacked the whole 3 ' end (justice) of the NA coding region of NA-(183) GFP (157).This mutant contains 61 amino acid, the eGFP gene of 5 ' non-coding region (justice), NA sequence, two terminator codons and 3 ' non-coding region.NA-(90) GFP (0), NA-(45) GFP (0), NA-(21) GFP (0) and NA-(18) GFP PCR mutant such as (0) comprise 30,15,7 or 6-terminal amino acid disappearances of NA-(180) GFP (0) NA coding region respectively.

Prepare the NA0G185 gene with the mode identical with NA (61) GFP gene, it contains 185 Nucleotide of 5 ' non-coding region, the eGFP gene of NA gene (justice), two terminator codons and 3 ' non-coding region.This mutant has the 5 ' non-coding region (28 thuja acids) of NA vRNA and 157 Nucleotide of NA vRNA 5 ' coding region.NA-(183) GFP (78) and NA-(183) GFP (39) mutant are the deletion mutants of NA0G185, resemble respectively have NA 5 ' coding region the NA0G185 half or 1/4th.

ImmunostainingIn order to detect the FLAG epi-position that adheres on the brachymemma NA albumen, use the virus infection mdck cell that contains this epi-position, and cover with 0.6% agarose that contains 0.5 μ g trypsinase/ml and 100 μ U/ml cholera arc mattress sialidases (GIBCO/BRL).The cell that infects is fixed with 3% formaldehyde solution.Be first antibody with anti--FLAG monoclonal antibody M2 (Sigma) then and be second antibody, with Vectastain ABC test kit (Vector, Burlingame, CA) detection FLAG epi-position with biotinylated anti-mouse IgG.In order to identify the cell of WSN virus infection, with the anti-WSN serum of rabbit as first antibody.

In situ hybridizationWith the probe and the cells infected hybridization of Myodigin (DIG) mark, and according to the explanation of manufacturers DIG kit for detecting nucleic acid (Roche) dyeing.With coding FLAG epi-position nucleotide sequence complementary oligonucleotide (100pmol) (GAC TAC AAG GAC GAC GATGAC AAG; SEQ ID NO:7) with DIG oligonucleotide tailing test kit (Roche) in 37 ℃ of marks 6 hours.The cell of virus infection is fixed with 3% formaldehyde solution, penetrate with the 0.1%Triton-X100 that is dissolved in 3% formaldehyde, at prehybridization damping fluid (5X SSC, 1% closed reagent in the detection kit, the acid of 1%N-lauryl creatine contains 0.02% sodium lauryl sulphate [SDS] of poly (the A)-DNA of 0.1mg/ml detection kit) in 65 ℃ of prehybridizations 30 minutes.Add oligonucleotide probe (10pmol) in the prehybridization damping fluid, in 55 ℃ of hybridization 1 hour.The cell of hybridization with washings (the 0.1M toxilic acid, 0.15M NaCl, 0.3% polysorbas20, pH7.5) washing is 5 minutes, in room temperature sealing 30 minutes, the resisting of alkaline phosphatase-DIG antibody (1: 5000) is arranged in incubated at room 30 minute with coupling with 1% closed reagent.Use the lavation buffer solution washed cell then, (0.1M Tris-HCl, 0.1M NaCl were hatched 3 hours in the room temperature lucifuge in chlorination nitroblue tetrazolium(NBT) pH9.5)/5-bromo-4-chloro-3-indoles phosphoric acid (NBT/BCIP) with detecting damping fluid.

Competition is gone down to posterityNAFLAGWT or NAFLAGM (-) virus (300 plaque forming units [PFU]) and 3 * 10 ⁴PFU NA (-) virus is mixed, and is used to infect the inferior mdck cell (infection multiplicity is 0.01) that merges, and hatches 72 hours in the substratum that contains 0.5 μ g trypsinase/ml and 100 μ U/ml cholera arc mattress sialidases.Virus infection mdck cell with results.This process repeats 5 times.

The result

The A type influenza virus that lacks the NA gene fragment can surviveThe back brachymemma NA gene that goes down to posterity is repeatedly remained its importance for virus replication of explanation.There is not the segmental sudden change of NA RNA A type influenza virus in order to generate, with producing vRNA and the plasmid transfection 293T cell of expressing nine kinds of structural protein except that NA vRNA.When the 293T cells and supernatant is hatched under the condition that the cholera virus sialidase exists with mdck cell, observed plaque (diameter is 189 ± 15.6 μ m).In liquid culture, this virus (being appointed as NA (-)) is long to 10 ⁵PFU/ml.Thereby, have only 7 the segmental A type of vRNA influenza viruses to survive.

Efficient growth is essential to brachymemma NA fragment for virusIn order to understand the molecular basis that the back NA stable gene that goes down to posterity is repeatedly kept, the viral growth situation that will contain brachymemma NA gene contrasts with the viral growth situation that lacks NA gene start codon, coding NA (virus).Generate the NAFLAGWT mutated viruses with reverse genetics.The FLAG epitope sequences that there is disappearance the contained NA gene inside of NAFLAGWT and merges with brachymemma NA.NAFLAGWT grows to 10 ⁵PFU/ml, and under the condition that the bacterium sialidase exists, generated plaque.Plaque carries out immunostaining (Fig. 4 C) with anti--FLAG monoclonal antibody or anti--WSN polyclonal antibody.Anti--WSN the antibody staining of the viral plaque that generates of NA (-) or NAFLAGWT, only anti--FLAG antibody staining of plaque that the latter is produced.

In order to measure the difference of replication, NA (-) and NAFLAGWT virus are hatched (Fig. 5) with this mixture with mdck cell with 100: 1 mixed.Infect after 48 hours, get supernatant and be used to generate plaque, plaque dyes with anti--FLAG monoclonal antibody immunity.Calculate the per-cent of the positive plaque of FLAG-in total plaque, measure the incidence that contains the segmental virus of brachymemma NA with this.This process repeats more than 4 times.Shown in Fig. 7 B, the positive plaque of FLAG increases in the process that goes down to posterity gradually in the colony, almost reaches 90% during to the 5th generation.This presentation of results contains 8 segmental viruses (even the NA gene of this brachymemma not encoding function sialidase) and gets better than containing 7 segmental viral growths.

Efficient growth is important to viral RNA for virusFor whether important the NA albumen of measuring brachymemma or viral RNA efficiently duplicate for virus, made up NAFLAGM (-) gene (Fig. 6 A) of another ATG password in shortage NA initiator codon and the frame (the 15th codon).Fail to detect the plaque (Fig. 6 B) that NAFLAGM (-) virus generates with anti--FLAG antibody, show that albumen is untranslated to come out.Have NAFLAGM (-) gene in order to ensure NAFLAGM (-) virus, the plaque that this virus is generated carries out in situ hybridization with the FLAG specific probe.These plaques and probe react, and confirm the existence of NAFLAGM (-) gene in this virus.Then that this is viral replication is compared with above-mentioned 7 fragment viruses.Plaque percentage with FLAG sequence-specific probe mark progressively rises (Fig. 7 B), and the plaque near 80% during to the 5th generation becomes the FLAG sequence positive (Fig. 7 A).As lack anti--painted plaque of FLAG antibody mediated immunity and prove, find to express the proteic revertant of brachymemma NA in the process that goes down to posterity.Therefore, although because become virus replication speed when dominating of NAFLAGM (-) is lower than the multiple-copy rate of NAFLGWT in the polyinfection thing, thereby NA albumen may play a role in efficient virus is effectively duplicated, but viral RNA itself may play an important role in efficient virus replication.

Virus N A vRNA packaging signal extends into the coding regionEven CK2-29 and E17E virus are after going down to posterity widely, brachymemma NA gene is still remained, and shows that the signal (being packaging signal) that has vRNA to import in the virus in the segmental coding region of NA RNA exists.In order to check this hypothesis, the sequence of coding eGFP is inserted the position that brachymemma NA gene is read NA sequence deletion in the frame.This recombination is appointed as NA-(183) GFP (157), and it has the 3 ' non-coding region of NA vRNA and terminal 61 codons of N-, eGFP coding region and 185 terminal Nucleotide of NA vRNA5 ' of NA coding region.Prepare the virus that replaces corresponding wild-type NA gene with NA-(183) GFP (157) gene, carry out plaque measurement (Fig. 8 A).Surpass 90% plaque expression eGFP, show that NA-(183) GFP (157) gene has imported virion and remained (Fig. 8 B) in the reproduction process of virus.Consider that side has NS non-coding area sequence CAT gene to fail to keep being left to surpass 5 generations above (Luytjes etc., 1989), this result is noticeable.

Since the present encoding viral sequence of the difference table between NA-(183) GFP (157) and the CAT construct has made up and the similar gene NA of CAT construct (0) GFP (0), it comprises the eGFP encoding sequence that side has 3 ' and 5 ' NA non-coding region.This construct disappearance NA coding region.Although the virus that generates with this gene can generate plaque, have only sub-fraction (0.1%) plaque to have to express for one or two the cell of eGFP, show that NA (0) GFP (0) gene fails to be remained in virus replication.With the 293T cell that plasmid infects, comprise that is expressed the 293T cell that plasmid infected of producing viral used NA (0) GFP (0) gene, the expression degree of its eGFP is lower than the expression level of the plasmid institute infective virus of expressing NA (61) GFP.The PolI plasmid amount that is used for NA (0) GFP (0) has increased by 10 times, and the result makes the 293T cell count of expressing eGFP with similar with the polI plasmid institute cells transfected number of NA (0) GFP (0).The PolI plasmid consumption that promptly is used in NA (61) GFP exceeds 10 times, and the plaque that NA (0) GFP (0) virus generates only has 1% to comprise the eGFP positive cell, and the cell in these plaques has only a small amount of expression eGFP.These results show that the packaging signal of virus N A RNA has extended in the NA coding region.

The effect of RNA fragment in efficient virus productionIn order to be interpreted as that what 8 fragment RNA viruses looks good than 7 fragment RNA viruses, done the comparison (Fig. 9) that infectious viral particle is produced to having 6,7 or 8 segmental viruses of viral RNA.In order to generate 8 fragment viruses, with all 9 proteic protein expressing plasmids of fragment structure and 8 kinds of PolI plasmid transfection 293T cells of normal virus production.Use simultaneously to have the NS PolI plasmid that two sudden changes can not generate NS2, the virus that generates from the 293T cell can not carried out repeatedly replication cycle so yet.In addition, use respectively to have HA and the NA PolI plasmid that makes the sudden change that HA and NA albumen can not generate, so that the elimination of gene fragment only limits to the RNA fragment, rather than gene product.For the production of 7 fragment viruses, do not comprise the PolI gene of NA gene, but comprise that is expressed the proteic plasmid of NA.For preparing 6 fragment viruses,, but comprise HA and NA protein expressing plasmid without the plasmid of HA and NA RNA.

For the virion output of three kinds of viruses relatively,, with anti-WSN antibody the cell that infects was carried out immunostaining back 48 hours of infection, thereby titration is from the infectious viral particle quantity of plasmid transfection cell generation with these virus infection mdck cells.As shown in Figure 9, the efficient of infectious viral particle production becomes positive correlation with the viral RNA number of fragments: the viral RNA fragment is many more, and the production of virion is good more.These results show that the viral RNA fragment playing a role in efficient virion production.

3 ' the end of Na vRNA is packaged in the virion very important for itDwindle the scope of packaging signal among the NA vRNA, prepared the virus (Fig. 8 A) that further disappearance is arranged in 3 ' or 5 ' (vRNA justice) coding region of brachymemma NA gene.Have 40% to express eGFP approximately by lacking NA coding region 5 ' the terminal viral plaque that generates of NA-(183) GFP (0), and only have 1.8% to express eGFP by lacking NA coding region 3 ' the terminal viral plaque that generates of NA0G185.These data show that the 3 ' end of NA vRNA is packaged into very important (Fig. 8) in the virion for it.

Discuss

By preparation disappearance construct, measured the NA coding region that makes NA fragment importing virion.The two ends of finding the coding region are all very important, but terminal more even more important than the other end with NA coding region 5 ' terminal corresponding vRNA3 '.For the NS fragment, seem than the other end even more important (Figure 22) with NS coding region 5 ' terminal corresponding vRNA 3 ' end.By contrast, for HA, M and NP fragment, two ends are all very important, and for PB2, more important with PB2 coding region 3 ' terminal corresponding vRNA 5 ' end.These presentation of results, important sequence is positioned at the coding region for the vRNA fragment imports, and is unique for each fragment.Those zones might interact by base pairing and other viral RNA, cause one group of 8 vRNA fragment to reenter virion.Because the interaction between vRNA and the virus component is a virus-specific, such interaction can become the target spot of antiviral compound research and development.

Embodiment 3

In order to obtain the authentic image of viral inclusion, carried out electron microscope tomography (Figure 11 A).Having gathered thickness is the image of the virion of 50nm.Then, analyze the 3D image of reconstruct virion inclusion to one in these virions.Intragranular structure (bar) is carried out painted, to distinguish each structure (Figure 11 B～F shows top view, side-view and upward view).Most of view of bar is a cross section, but the bar view transversal from the centre, has shown whole molecule.But, all views have all shown the interaction between the bar.

Based on above-mentioned summary results, and support each viral fragment to comprise the data of one section very important unique sequence in importing virion, this sequence has the formation that helps viral inclusion the unique form characteristic, and the vRNA fragment optionally imports in the influenza virus particles probably.This information is not only useful to identifying the research and development antiviral compound, and to the preparation attenuated live vaccine also of great use, can suppress virus replication and make it attenuation because the break virus specificity interacts.

Embodiment 4

Materials and methods

CellThe cultivation in being supplemented with the minimum medium (DMEM) of 10% foetal calf serum (FCS) and antibiotic Dulbecco ' s improvement Eagle ' s of 293T HEKC and COS-7 cell.Madindarby dog kidney (MDCK) cell is cultivated in being supplemented with 5% new-born calf serum and antibiotic MEM.Cell in 5%CO2 in 37 ℃ of cultivations.

The structure of plasmidNeumann etc. (1999) have described how to generate the plasmid construction body that contains wild-type A/WSN/33 (H1N1) HA gene (called after pPolI-WSN-HA) and wild-type B/Lee/40HA gene (pPolI-B-HA), is used for viral RNA production, and wherein both HA gene sides have human RNA polymerase I promotor and mouse rna plymerase i terminator.Use primer and ProofStart polysaccharase (QiaGEN) to generate the chimeric HA pPolI of a series of A/B construct, connect (Figure 13) with wild-type HA construct then through pcr amplification.All constructs all check order, and guarantee not comprise unwanted sudden change.

The biological assay of expressed HA in the cell culturesWith Trans IT reagent (Mirus) the chimeric HA pPolI of each A/B construct (1 μ g) and other four kinds of plasmids based on pCAGGS (each 1 μ g) are transfected into the COS-7 cell together, wherein based on the three kinds of polymerases of plasmid expression (PA, PB1 and PB2) of pCAGGS and the nucleoprotein (NP) (Neumann etc., 1991) of A/WSN virus.After the transfection 48 hours, cell was with cholera arc mattress sialidase (10U/ml) and TPCK-trypsin 2.5 μ g/ml) in 37 ℃ of processing 30 minutes.Cell is fixed with 4% Paraformaldehyde 96 then, and carries out immunostaining with anti--B/HA antibody and commercial ABC detection kit (Vector laboratory).Equally, carry out the receptors bind character that the hemocyte determining adsorption is assessed each HA.Briefly, in incubated at room 30 minutes, washing was 5 times before observing in 1% chicken erythrocyte suspension of transfectional cell in phosphate buffer.In addition, merge mensuration.Briefly, transfectional cell was hatched 5 minutes in 37 ℃ in HEPES damping fluid (pH5.0), hatched in substratum then 7 hours.With ice methyl alcohol fixing after, fused cell carries out immunostaining as mentioned above.

Reverse genetics.Use A/WSN or Blee reverse genetic system to generate virus by (1999) such as Neumann are described based on plasmid.Band comes from the virus of the wild type gene type of plasmid and is appointed as A/WSN-R or B/Lee-R respectively, as correlated contrast.In order to generate the A/B embedded virus, replaced pPolI-WSN-HA with chimeric HA PolI construct.Carry out limiting dilution one time from the virus that the 293T cell generates, implement biological cloning, in mdck cell, generate original seed virus.

Experimental infectionIn order to measure the pathogenicity bo of virus, the female BALB/c mouse in age is after Sevoflurane anesthesia, with A/B embedded virus or wild-type virus (10 all around ⁵TCID ₅₀/ 50 μ l) carry out intranasal infection.Back 14 days mortality ratio and body weight are infected in monitoring.Infect after three days, some mice infected are sentenced painless execution, measure the virus titer in the organ.

In order to estimate the vaccine potency that each embedded virus is attacked wild-type virus, mouse is with embedded virus or wild-type virus (10 ³TCID ₅₀/ 50 μ l) carry out intranasal infection.After three weeks, one group of mouse is sentenced painless execution, obtains serum and tracheae-nose washing lotion, detects the IgA or the IgG antibody of virus-specific.After infecting for 4 weeks, take advantage of surplus mouse under narcosis with 50 times of LD ₅₀Wild-type virus (B/Lee-R) attack, monitor mortality ratio and body weight in 14 days.

The detection of special viral antibodyWith IgA or the IgG antibody in (1982) described enzyme-linked immunosorbent assays (ELISA) such as Kida check serum and the tracheae-nose washing lotion.Serum sample has also been checked HI antibody after handling with receptor destroying enzyme (REDII:Denka Seken).

The result

The structure of the chimeric HA gene of A/BIn order to measure the compatibility of Type B HA and A C-type virus C component, between A/WSN and B/Lee HA gene, a series of mosaic genes (Figure 14) have been made up.Because the non-coding region of two ends of RNA fragment can be intercoursed between A C-type virus C and Type B virus probably, to carry out rna transcription and to duplicate (Crescenzo-Chaigne etc., 1999; Desselberger etc., 1980; Mster etc., 1981), prepared the chimeric HA gene that contains A C-type virus C non-coding region and Type B virus complete coding region (Figure 14 A, ANBH).This construct will produce complete Type B HA albumen.Prepare the mosaic gene (ANSBH) that Type B virus HA coding region and non-coding region change A C-type virus C corresponding section into then.This construct also can produce complete Type B HA after the cell signal peptase is removed the type A signalling peptide.Similarly, the sequence that preparation coding Type B HA strides film district and cytoplasmic domain changes the mosaic gene (ANTBH) of A type into, thereby encodes the chimeric HA albumen of A/B.Preparation coding Type B HA signal, the sequence of striding film district and cytoplasmic domain all change the mosaic gene (ANSTBH) of A type into.This construct also can produce the chimeric HA albumen identical with ANTBH after cutting signal peptide.In addition, preparation cleavage site upstream, HA coding region all corresponding sequence come from Type B virus, the downstream sequence mosaic (ANBW) from the A C-type virus C.This construct will produce the chimeric HA albumen that comprises Type B virus HA1 district and A C-type virus C HA2 district.Prepare signal sequence in the ANBW construct at last and change the mosaic gene of A type into, also can produce the chimeric HA albumen the same with ANBW from Type B.

The biological property of the chimeric Ha of expressed A/B in the cell culturesIn order to estimate the functional of chimeric HA, each pPolI construct is transfected in the COS-7 cell with the plasmid of expressing wild-type PA, PB1, PB2 and NP.These chimeric HA constructs all can be at cell surface expression.In order to check the receptor-binding activity of these HA, carry out the hemocyte determining adsorption.Before the mensuration, cells transfected is handled to remove the terminal sialic acid in the HA oligosaccharides side chain, because these sialic acids can disturb receptor-binding activity (Luo etc., 1999) with the bacterium sialidase.Hemocyte absorption has taken place in the cell of expressing ANBH, ANSBH, ANTBH and ANSTBH, and hemocyte absorption (table 3) does not take place the cell of expressing other two kinds (ANBW and ANSBW).Similarly, the HA inducing cell of front merges, and the latter can not.These results show that the HA mosaic of front has biological function, and the back two-phase does not have, and may be due to the structural modification.Desired the same with former report, A type polysaccharase mixture and NP have generated functional Type B HA (table 3) from complete wild-type Type B HA fragment, have proved conclusively the compatibility between Type B promoter structure and the A type polysaccharase mixture.

Table 3.A/B chimeric HA is at expressed cell and comprise character in their virus

The HA construct	Character in the cell cultures a)			Generation has the virus of this gene b)	Virus titer in the transfectional cell supernatant b) (TCID 50/ml)	The virus titer of original seed c) (TCID 50/ml)
							Cell surface expression	Hemocyte absorption	Merge
	Wild-type HA
WSN-HA				+	+	+	+	3.2×10 7	6.3×10 7
	B-HA	+	+							+		NA d)
The chimeric HA of A/B
	ANBH	+	+							+	+	2.0×10	6.3×10 2
ANSBH				+	+	+	+	1.1×10 2	2.0×10 6
	ANTBH	+	+							+	+	2.0×10 4	6.3×10 6
ANSTBH				+	+	+	+	1.1×10 6	3.6×10 6
	ANBW	+										NA
ANSBW				+				NA

A) each HA construct is transfected into the COS-7 cell with the plasmid of expressing A type polysaccharase and expression NA.The biological property of each HA is measured in transfection after 48 hours.

B) virus that contains wild-type or chimeric HA gene and other A type influenza virus gene uses the reverse genetics system based on plasmid to generate.The 294T cell conditioned medium is collected in transfection after 48 hours, carry out infectious titration.

C) prepare viral original seed with mdck cell.Results virus when cytopathic effect takes place.

D) NA: can not record.

The virus that contains chimeric HA generatesWhether chimeric HA gene works when measuring A type influenza infection, and having prepared the HA gene is the sudden change WSN virus that A/B HA mosaic gene is replaced.Can produce titre based on the reverse genetics of plasmid and be about 10 ⁷TCID ₅₀The wild-type virus (table 3) of/ml.When replacing pPolI-WSN-HA, do not produce infectious virus with pPolI-B-HA.Though by the efficient difference that the viral supernatant titre of plasmid institute transfectional cell is judged, these the four kinds chimeric HA constructs (table 3) with biological function have all successfully remained in infectious A C-type virus C.The virus that contains ANBH HA only has faint duplicating, and contains the viral most effective of ANSTBHHA, and long having arrived surpasses 10 ⁶TCID ₅₀/ ml.Do not express proteic HA gene and can not support viral growth for other two kinds with biological function.These A/B embedded viruses are appointed as ANBH virus, ANSBH virus, ANTBH virus and ANSTBH virus.

For the virus of confirming any generation comprises the outer functional domain of Type B HA really,, and check the reactivity (Figure 14) of they and A C-type virus C or the viral HA antibody of Type B with these virus infection mdck cells.With the cell of the virus infection that contains chimeric HA construct and anti--B/HA antibody and anti--A/NP antibody response, but not with anti--A/HA antibody response, proved conclusively these viruses and comprised the outer functional domain of Type B HA.

The growth characteristics of A/B embedded virus in cell culturesIn order to measure the character of duplicating of A/B HA embedded virus, with this this virus with 0.01 MOI cells infected, to moving learn (Figure 15) of its growth of gained virus examination.Although these viruses with chimeric HA do not have a kind ofly to look better than wild-type A C-type virus C, ANSTBH and ANTBH embedded virus are almost long to 10 ⁶TCID ₅₀/ ml.All different with A type and Type B virus, these viruses all form minimum plaque, have only with immunostaining just can detect (data are unlisted).

A/B embedded virus duplicating in mouseA/B embedded virus restricted in cell cultures duplicated these viruses of prompting can be at external attenuation.Therefore, mouse is used A/B HA embedded virus (10 ⁵TCID ₅₀/ 50 μ l) carry out intranasal vaccination.ANBH virus is not done check, because its original seed titre is too low by (about 10 ³TCID ₅₀/ ml).The embedded virus of other three kinds of checks does not have a kind of dead mouse that causes, and the A C-type virus C of same dosage has killed all mice infected, and the Type B virus of same dosage has then been killed 7 (table 4) in 8 infected mouse.Embedded virus was restored from lung and concha on the 3rd day in the inoculation back, showed that these viruses are duplicated in mouse.What is interesting is, embedded virus to be replicated in lung more limited, and to lack in the restriction that duplicating of concha is subjected to.Illustrate to exist between virus replication in the lung and the lethality and get in touch.Compare with wild-type A C-type virus C mice infected, the degree of ANTBH and its weight loss of ANSTBH embedded virus mice infected is smaller.Generally speaking, these data show A/B HA embedded virus attenuation in mouse.

The pathogenicity bo of A/B embedded virus in table 4. mouse

Virus a)	Duplicating in the organ b)		Body weight change (%) c)		Lethality (%) (death toll/tried number)
						Concha	Lung	The 5th day	The 14th day
	Wild-type virus
A/WSN-R					?5.0±0.3	8.2±0.1	-27.4±1.1	NA c)	100(8/8)
	B/Lee-R	?4.7±0.1	5.6±0.1	-19.3±7.9						NA	87.5(7/8)
The A/B embedded virus
	ANSBH	?4.0±0.3	2.8±0.3	2.6±1.0						4.6±1.2	0(0/8)
ANTBH					?5.3±0.3	4.9±0.1	-17.3±0.7	-8.3±0.4	0(0/8)
	ANSTBH	?5.3±0.4	4.6±0.1	-20.9±0.3						-6.2±8.8	0(0/8)
Contrast (PBS) d)					?NA	NA	2.9±1.3	7.1±0.2	0(0/8)

A) mouse is with viral (10 ⁶TCID ₅₀) in intranasal vaccination, monitored 14 days.(SD n=3) represents body weight change with means standard deviation.

B) virus titer in the 3rd day mensuration in the inoculation back organ is with Log ₁₀TCID ₅₀The mean value SD of/g (n=3) expression.

C) NA: can not record

D) control mice is simulated inoculation with phosphate buffered saline (PBS) (PBS).

When wild-type virus infected, the immunity of A/B HA embedded virus was to the provide protection of mouseBecause the A/BHA embedded virus is expressed the outer functional domain of the HA that derives from Type B virus, foreseeable is that these viruses can provide the protective immunological reaction to wild-type Type B virus infection.Before attacking experiment, measure mouse and after embedded virus infects, whether induced anti--Type B antibody.After inoculating for three weeks, in the nose that comes from embedded virus institute infecting mouse/tracheae washing lotion, detected Type B virus-specific IgA, in serum, then detected IgG antibody (Figure 16 A) with the ELISA check.Come from the serum sample of A/B HA embedded virus institute infecting mouse and also detected HI antibody (Figure 16 B).Therefore, although ANSBH inductive immune response efficient is low, all proof has produced specific antibody response in the useful embedded virus mice infected of institute.

These embedded virus mice immunized after immunity 4 weeks with 50 times of LD ₅₀Type B virus attack (table 5).After the attack, these mouse all survive, and all contrast simulation mice immunized all in the dust, with sublethal dose (10 ³TCID ₅₀) 8 mouse of WSN virus immunity adopt only having under 2 survivals after the virus attack of wild-type Type B, show that the immune response of embedded virus has the specificity provide protection to wild-type Type B virus infection.In addition, accept the mouse of ANSBH virus after 3 days, do not restore Type B virus (data are unlisted) from pre-mice immunized concha of embedded virus or lung except that an attack.

Table 5.A/B embedded virus immune mouse is to the provide protection of wild-type Type B virus attack

The virus that is used for immunity a)	After the attack
				Body weight change (%)		Survival rate (%) (survival number/tried number)
	The 5th day	The 14th day
			Wild-type virus A/WSN-R B/Lee-R A/B embedded virus ANSBH ANTBH ANSTBH contrasts (PBS)d)	-17.5±3.6 1.8±0.9 -5.6±0.8 0.9±0.9 1.52±0.2 -20.8±0.5	NA c) 1.4±0.6 -0.7±0.7 1.9±0.9 2.9±0.7 NA		25(2/8) 100(8/8) 100(8/8) 100(8/8) 100(8/8) 0(0/8)

A) mouse carries out intranasal infection with institute's influenza virus

B) after immune 4 weeks, mouse is used wild-type B/Lee-R virus (50 times of LD ₅₀) in nose, attack, attack back monitoring 14 days.The variation of body weight mean value SD (n=3).

C) NA: can not record

D) control mice is simulated inoculation with phosphate buffered saline (PBS) (PBS) and is attacked.

Discuss

As described herein, under A C-type virus C background, generated influenza virus first, thereby comprised A type and Type B viral protein simultaneously with Type B rather than A type HA.Is generating A/B HA embedded virus necessary what? mosaic gene must transcribe and duplicate so that keep in virion down.Although guard in identical Virus Type, the non-coding region between A type and the Type B RNA fragment (contains rna transcription and end sequence difference (Crescenzo-Chaigne etc., 1999 of duplicating required promoter sequence (Luyt jes etc., 1989) two ends; Desselberger etc., 1980).But the former A type that studies show that polysaccharase makes side have the reporter gene of Type B virus N S fragment non-coding region to be transcribed (Muster etc., 1991).And, generated the chimeric A/B influenza virus (NA/B-NS) that comprises mosaic gene, wherein mosaic gene comprises the encoding sequence of A C-type virus C NA and the non-coding region (Muster etc., 1991) of Type B virus N S.Though these data show degree and are lower than the homologous promoter of A C-type virus C gene that A type polysaccharase mixture has identified the promoter sequence of Type B NS gene.

The segmental non-coding region of each RNA comprises two structural zones: terminator sequence and the specific sequence of interior segments guarded in all 8 RNA fragments.Because promoter activity mainly by front region decision (Portela etc., 1999), all might be transcribed and duplicate by A type polysaccharase mixture by all Type B gene fragments.In fact, with the pPolI-B-HA plasmid that contains the Type B non-coding region with after expressing the plasmid cells infected of A type polysaccharase and NP, have Type B HA to express (table 3) in the cell, these data are supported above-mentioned idea.Therefore, generate that to contain the segmental virus of complete Type B HA be to reset body between the HA type, can not be interpreted as lacking transcribing and duplicating of RNA.

The restricted level that may originate in RNA fragment importing virion that embedded virus generates; Generate for virus, chimeric fragment must be packaged into virion.Although there is report to think that the segmental non-volume of A type NS district comprises RNA packaging signal (Luyt jes etc., 1989), the segmental packing mechanism of Influenza Virus RNA is not illustrated as yet fully.Virion imports required RNA fragments sequence or structural performance and most is still unknownly, and still, recent findings A type NA RNA fragment all has the virion lead-in signal (Fujii etc., 2002, embodiment 2) of himself at the two ends of coding region.In this research, the duplicating efficiency of ANSBH virus is than the duplicating efficiency of ANBH virus higher (Figure 14 and table 3).Because the HA albumen of expressing in these two kinds of viruses be the same, the difference of duplicating efficiency may be the different result of RNA packaging efficiency so.That is to say, may have the required structural characteristics of efficient RNA packing in the zone of coding HA signal sequence.Similarly, the difference of duplicating efficiency between this also soluble ANTBH and the ANSTBH virus, they also express identical HA albumen.In fact, the segmental packaging signal of A type HA is positioned at the two ends (data are unexposed) of coding region.What is interesting is that the chimeric NA gene that contains A C-type virus C NA non-coding sequence and Type B virus N A coding region sequence can not enter (Ghate etc., 1999) in the A C-type virus C.This can be interpreted as lacking due to the A C-type virus C NA coding region that contains the RNA packaging signal, with aforementioned recent findings (Fujii etc., 2002) unanimity.

May also have key interactions on the protein level with regard to the generation of A/B HA embedded virus: chimeric protein must be packaged in the virion, and must play a role to virus replication.The Type B NA egg folding that trans mode is supplied can substitute the function of A type NA and import in the A-type virus particles, supports the A C-type virus C of NA disappearance to finish a plurality of replication cycle (Ghate etc., 1999) in cell cultures.But, just as previously discussed, do not produce the A C-type virus C that contains Type B NA.Although produced chimeric A/B HA virus, compared them with wild-type virus and weakened.This reduction may originate in the suboptimum balance between Type B HA receptor-binding activity and the A type NA sialidase activity.In addition, the signal peptide and/or the replacement of striding film district/cytosolic domain may make structure that change has taken place among the HA.For example, stride film district/cytosolic domain can interact with the M1 of other virus component such as guide effective virus assembling (Ali etc., 2000 among the HA; Cenami etc., 1996; Jin etc., 1997; Zhang etc., 2000).Therefore, can not produce and contain the segmental A C-type virus C of complete Type B RNA or contain the segmental Type B virus of complete A type RNA, its reason may be for being restricted on RNA fragment importing level or the protein functional interaction level, and perhaps the two haves both at the same time.

A/B HA embedded virus duplicates because of lung is restricted in mouse and is able to attenuation, and for mouse provides protective immunity to wild-type Type B virus infection, has proposed a kind of novel method of researching and developing influenza vaccines.At present, subcutaneous administration trivalent inactivated influenza vaccine is global standard, but their efficient is not optimum.This mainly is because fail to induce gratifying humoral immunization (Wavening etc., 2001) outside the upper respiratory tract of the initial invasion of influenza virus.Thereby, though the severity that these vaccines can palliate a disease, can not prophylaxis of viral infections.Different with inactivated vaccine, living vaccine is induced humoral immune reaction and immune response of cytotoxic T lymphocyte reaction simultaneously.The chimeric manipulation that studies show that the HA gene described herein can be controlled viral attenuation to different degree.Like this, this method can allow to produce the living vaccine strain of reaching proper equilibrium between attenuation and immunogenicity.In addition, the chimeric HA of A/B can import in the cold-resistant A type influenza virus that attenuation sudden change well identified (Maassab etc., 1999).At present cold-resistant vaccine is the mixture of A C-type virus C and Type B virus.Two kinds of viruses interaction may influence the effectiveness of vaccine, though this problem is by adjusting viral dosage than being solved.The A C-type virus C that contains the chimeric HA of A/B will allow to produce based on living vaccines single rather than two attenuated virus, and potential disturbs between A C-type virus C and the Type B virus thereby eliminate.

Therefore, different with the attenuated vaccine alive of Type B vaccine strain attenuation sudden change being known little, contained A C-type virus C and Type B virus mixture, can generate the virus that contains Type B HA and NA under the A C-type virus C background.This method allow to be produced the living vaccine based on main vaccine strain, and wherein main vaccine strain is used to express the attenuation sudden change of A type and Type B HA and NA and is well defined.And the knowledge of viral fragment packaging signal has also promoted the research and development of improvement Gripovax alive.

Embodiment 5

Materials and methods

Cell and virus293T HEKC (having inserted deriving of simian virus 40T antigen gene in 293 clones is) is cultivated in being supplemented with Dulbecco ' the s improvement Eagle substratum of 10% foetal calf serum (FCS).Baby hamster nephrocyte (BHK), Chinese hamster ovary cell (CHO) and Madindarby Madin-Darby canine kidney(cell line) (MDCK) are cultivated with the DMEM that contains 5%FCS, the MEM that contains the MEM of 10% new-born calf serum and contain 5% new-born calf serum respectively.All cells is at 5%CO ₂In in 37 ℃ of cultivations.A/WSN/33 (H1N1) (WSN) virus generates through described reverse genetics such as Neumann (1999), and breeds in mdck cell.The strain of VSV indiana is generated by reverse genetics and breeds in bhk cell.

Reverse geneticsBe particle (VLP) and the sudden change A type stream virus that generates influenza virus-like, used the plasmid (being called the PolI plasmid) and the eukaryotic protein expression vector pCAGGS/MCS (controlled by the avian beta-actin promotor) that contain WSN virogene cDNA, wherein the WSN virogene is controlled by human RNA polymerase I promotor and mouse rna plymerase i terminator.Briefly, PolI plasmid and protein expression vector and transfection reagent Trans IT LT-1 (Panver, MadisCon WI) mix, in incubated at room 15 minutes, be added to that Opti-MEM (GIBCO/BRL) cultivates 1 * 10 ⁶In the individual 293T cell.After 6 hours, the DNA transfection reagent changes the Opti-MEMI (GIBCO/BRL) that contains 0.3%BSA and 0.01%FCS into.After 48 hours, VLP in the results supernatant or sudden change A type influenza virus.The transfection body that generates in this research all comprises the HA vRNA fragment of sudden change and other vRNA fragment of WSN virus, and by sudden change HA vRNA fragment name (for example, contain the segmental VLP of HA (0) GFP (0) RNA and be appointed as HA (0) GFP (0) VLP).

The structure of plasmidPPolI HA (0) GFP (0) is used for generating the sense-rna that contains HA vRNA3 ' non-coding region, strengthens fluorescin complementary encoding sequence and HA vRNA 5 ' non-coding region.Briefly, the GFP gene, digests with BsmBI through pcr amplification with the primer that contains BsmBI site and HA 5 ' or 3 ' non-coding sequence, and is cloned into the BsmBI site of PolI plasmid.This plasmid transfered cell can generate the RNA of the sequence that contains the GFP that encodes on the antisense orientation, wherein this sequence side 5 ' and the 3 ' non-coding region of HA vRNA is arranged.

PPol IHA (468) GFP (513) is preparation like this: earlier be right after primer Bam500R (5 '-GCGGAT CCT CCC CTA TGG GAG CAT GAT AC-3 '; SEQ ID NO:6) and Xba1218F (5 '-GCT CTA GAA ACT CTG TTA TCG AGA AAA TG-3 '; SEQ ID NO:7) is used to generate the pPolIHA of WSN vRNA through inverse PCR amplification.The PCR product is gone into the GFP gene clone BamHI site and XbaI site then with BamHI and XbaI digestion.Gained plasmid pPol IHA (468) GFP (513) is used for producing the sense-rna that contains 468 bases of HA vRNA 3 ' non-coding region and 3 ' coding region, GFP encoding sequence, 513 bases in HA vRNA 5 ' coding region and 5 ' non-coding region.Generate a series of HA deletion mutants through inverse PCR in the same way.These mutant are according to the few nucleotide name that derives from the HA coding region, for example HA (9) GFP (80) RNA fragment comprises HA 3 ' non-coding region, 9 corresponding with the N-end region, as to come from HA coding region Nucleotide, GFP reads frame, 80 corresponding with the C-end region, as to come from HA coding region Nucleotide, and HA 5 ' non-coding sequence.These plasmid construction bodies all check order, and guarantee that PCR does not introduce unwanted sudden change.

Generate pPol IHA (0) VSVG (0) with PCR, it is used for generating the sense-rna that contains HA vRNA 3 ' non-coding region, V SVG complementary encoding sequence and HA vRNA 5 ' non-coding region.Briefly, with the primer that contains BsmBI site and HA 5 ' or 3 ' non-coding sequence, be that template is through pcr amplification VSV G gene with pCAGGS-VSVG.The PCR product digests with BsmBI, and is cloned into the BsmBI site of pHH21 carrier.The encoding sequence of VSV G is cloned into BamHI site and the XbaI site of HA (9) GFP (80), thereby prepares pPol IHA (9) VSVG (80).PPol INA (183) GFP (157) comprises the complementary sequence of NA vRNA 3 ' non-coding region and encoding fusion protein, and wherein the sequence of encoding fusion protein contains 185 bases of N-termination codon, two successive terminator codons (TAA-TAG) and the NA vRNA 5 ' end of 61 NA.Its preparation method is as follows: in the pT7Blue-NA in the WSN NA gene zone corresponding with the 203rd to 1099 Nucleotide (justice) earlier through PCR with the replacement of BglII site, then the GFP gene clone is gone into this BglII site and 1226 s' StuI site.Then NA (183) GFP (157) gene is inserted the BsmBI site of PolI plasmid pHH21.

PPol INA (183) GFP (157) Met (-) that are used to produce antisense INA (183) GFP (157) Met (-) RNA lack the proteic initiation codon of NA.Its preparation method is as follows: (GeneEditor, Promega) the ATG initiator codon with pPol INA (183) GFP (157) gene among pPol INA (183) GFP (157) changes GCG into another ATG that is positioned at the 15th codon by external rite-directed mutagenesis.Gained construct pPol INA (183) GFP (157) Met (-) comprise NA 3 ' non-coding region (19 Nucleotide), 183 Nucleotide corresponding with NA coding region N end, GFP open reading frame, two successive terminator codons (TAA-TAG), hold corresponding 157 Nucleotide and NA 5 ' non-coding region (28 Nucleotide) with NA coding region C, and it is controlled by human RNA polymerase I promotor and mouse rna plymerase i terminator.

Immunostaining is measuredAfter influenza VLP infects 16 hours, cell phosphate buffered saline (PBS) (PBS) washed twice, (in PBS) fixes 20 minutes in room temperature with 3.7% formaldehyde, handles with 0.1%TritonX-100 then.In order to check the formation efficiency of VLP, get 10 ⁶Individual cell is hatched with the 293T cells and supernatant of 0.1ml plasmid transfection, and record infects the positive cell count of immunostaining mensuration NP after 16 hours.

The Western traceVLP or mutated viruses get off in 4 ℃ of centrifugal force with 50,000 * g is centrifugal.VLP after concentrating or virus be resuspended in lysis buffer (0.6M KCl, 50mM TrisHCl, pH7.5,0.5%TritonX-100) in.Lysate places on the 15%SDS-polyacrylamide gel, electrotransfer is to Polyvinylidene difluoro (PVDF) film, spend the night in 4 ℃ of sealings with 5% skimmed milk among the PBS, then with anti--WSN virus polyclonal antibody, anti--HA monoclonal antibody or anti--VSVG monoclonal antibody in incubated at room 1 hour.Film washs three times with the PBS that contains 0.05% tween 20.Bonded antibody detects with VECTASTAIN ABC test kit (Vector) and Konica immunization coloration kit (Konica).

Northern hybridizationBeing present in the PolI plasmid infects vRNA in the 293T cell and extracts test kit (Nippon Gene, Tokyo, Japan) with Isogen RNA and extract after transfection 24 is little.RNA in 50 ℃ of glyoxalated Glyoxalateization, carries out electrophoretic separation on 1.0% sepharose in 10mM phosphoric acid buffer (pH7.0) in oxalic dialdehyde/DMSO/ phosphoric acid buffer.The RNA point sample to nylon membrane, and and oligonucleotide probe hybridization, this probe and GFP sequence (ATGGCCGACAAGCAGAAGAACGGCATCAAGG; SEQ ID NO:8) (10pmol) complementation, and with DI G oligonucleotide tailing test kit (Roche) in 37 ℃ of marks 30 minutes.Utilize this GFP probe in Easy Hyb (Roche), to spend the night and finish hybridization in 42 ℃.The RNA band detects with DIG kit for detecting nucleic acid (Roche).Briefly, Hybond membrane washing lotion (0.1M toxilic acid, 0.15M NaCl, 0.3% tween 20, pH7.5) washing in room temperature sealing 30 minutes, has the anti--DIG antibody (1: 5000) one of alkaline phosphatase to arise from incubated at room 30 minutes with coupling with 1% closed reagent.Film washs with lavation buffer solution then, and (0.1M Tris-HCl, 0.1M NaCl are hatched in the room temperature lucifuge in chlorination nitroblue tetrazolium(NBT) pH9.5)/5-bromo-4-chloro-3-indoles phosphoric acid (NBT/BCIP) with detecting damping fluid.The RNA band detects with DIG kit for detecting nucleic acid (Roche).Contrast RNA extracts from the 293T cell of simulation transfection.

The transfection precursor virus duplicate characterDiplopore RHK, CHO in 24 orifice plates or mdck cell virus infection cover with the MEM substratum that contains 0.01%FCS, hatch in 37 ℃.Get supernatant in different time and measure infectious virus in the mdck cell plaque measurement.

The result

The coding region of HA vRNA is necessary in the HA fragment importing virionFor the coding region of measuring HA vRNA whether resemble the NA vRNA essential by importing virion, made up two plasmids: only contain pPol IHA (0) GFP (0) of HA vRNA 5 ' and 3 ' non-coding region and GFP encoding sequence and HA sequence GFP encoding sequence behind 500～1218 (just direction) nucleotide deletions insert in the HA gene frame pPol IHA (468) GFP (513) (Figure 17).A next construct contains HA 3 ' non-coding region (33 Nucleotide), 468 Nucleotide corresponding with coding region N-end, with the GFP open reading frame and the HA 5 ' non-coding region (45 Nucleotide) of a terminator codon.The gained fusion rotein comprises 156 amino acid and the complete GFP sequence of HA N-end.

In order to produce the VLP that contains these sudden changes HA vRNA, with pPol IHA (0) GFP (0) or pPol IHA (468) GFP (513), 7 RNA PolI plasmids and protein expressing plasmid transfection 293T cell, wherein 7 RNA PolI plasmids are used to generate remaining viral RNA fragment, and protein expression vector is used to express 9 kinds of viral proteins (being PA, PB1, PB2, NP, HA, NA, M1, M2 and NS2).After the transfection 48 hours, the VLP in the results 293T cells and supernatant infects mdck cell with them.Because gained VLP contains sudden change HA, they express GFP and all viral proteins except that HA.Therefore do not produce and do not have infectious progeny virus (data are unlisted).Infect after 16 hours,, import efficient with this virion of measuring sudden change HA vRNA with expressing the cell count (i.e. the number of all infectious VLP) of the cell count (the segmental VLP number that promptly contains coding GFP gene) of GFP divided by expression NP.All infectious VLP are 7.4 * 10 in the titre that pPol IHA (468) GFP (513) is infected in 293T cell (i.e. all the NP positive cells numbers) culture supernatant ⁵Infectious VLP/ml, and VLP (the being GFP positive cells number) titre that contains pPol IHA (468) GFP (513) RNA is 3.2 * 10 ⁵VLP/ml.These results show have 42.8% to produce the sudden change HA vRNA (Figure 18) of concealment among all infectious VLP.Phase-plate has only 3.9% VLP to contain pPol IHA (0) GFP (0) RNA fragment (Figure 18).These results suggest, it is essential that the coding region of HA vRNA imports in the influenza virus particles for the HA fragment.

3 ' and 5 ' end of HA vRNA coding region imports in the virion all very heavy for the HA fragment Want3 ' the end that it is found that NA vRNA coding region is in the past being brought into play the more crucial effect of 5 ' end of comparing when virion imports.Whether therefore, measured 3 ' end, 5 ' end or two ends imports important for the segmental virion of HA vRNA.In order to address this problem, to have prepared HA (0) GFP (1011) gene of shortage HA vRNA coding region 3 ' end and lacked HA (966) GFP (0) gene (Figure 17) that hold HA vRNA coding region 5 ', and checked the virion of HA vRNA to import as mentioned above.Although the amount of two kinds of vRNA is all measured quite (data are unlisted) with HA (468) GFP (513) vRNA in the plasmid cells infected, the fragment of HA (0) GFP (1011) and HA (966) GFP (0) imports efficient and has only 6.8% and 8.4% (Figure 17) respectively, shows that 3 ' and 5 ' end of HA vRNA coding region imports in the virion all very important for the HA fragment.

In order further to determine to import for himself among the HA vRNA critical area of virion, generated the VLPs (Figure 17) that disappearance also further takes place a series of contained brachymemma HA vRNA in 3 ' and/or 5 ' coding region.Measure the importing efficient that sudden change HA vRNA imports VLPs then.Do not import efficient (HA (468) GFP (513) and HA (15) GFP (268) compare) because the further disappearance that makes 3 ' end only be left 15 Nucleotide and remaining 268 Nucleotide of 5 ' end does not influence HA vRNA, made up the disappearance construct in addition with HA (15) GFP (268) that contains HA coding region 15 Nucleotide of 3 ' end and 268 Nucleotide of 5 ' end.Though descend gradually along with the degree of disappearance increases the vRNA degree that imports, 80 Nucleotide of HA coding region 5 ' end are that HA vRNA efficiently imports virion institute essential at least (HA (15) GFP (80) and HA (15) GFP (75) compare).Further deletion analysis proves, though the HA in the transfectional cell (9) GFP (80) level and HA (0) GFP (0) rna level have not a particle of difference, HA (9) GFP (80) of remaining 9 nucleotide residues of HA coding region 3 ' end can make HA vRNA efficiently import virion (surpassing 65%) (Figure 17 and 18).These results show in the HA coding region that it is essential that 80 nucleotide pairs of 9 Nucleotide of 3 ' end and 5 ' end import in the virion effectively in HA vRNA.

HA and NA gene contain the generation of the new A type influenza virus of foreign gene encoding sequenceBecause the HA fragment imports the required preface of virion and measures, checked side to have the foreign gene of these sequences whether can import A type influenza virus again and when going down to posterity repeatedly, can remain.Insert BamHI and the XbaI site replacement GFP sequence of pPol IHA (9) GFP (80) as the VSV G coding region sequence of foreign gene model.The gained construct is appointed as pPolIHA (9) VSVG (80), and it comprises HA 3 ' non-coding region (33 Nucleotide), 9 Nucleotide corresponding with HA coding type N end, with a terminator codon VSVG open reading frame (1552 Nucleotide), hold corresponding 80 Nucleotide and HA 5 ' non-coding region (45 Nucleotide) with HA coding region C.Make up carrier pPol IHA (0) VSVG (0) only contain 3 ' and 5 ' non-coding region but not contain HA vRNA coding region in contrast.Because VSV G albumen should be replaced HA and NA albumen, the NA coding region can be replaced with foreign gene.Therefore, making up pPol INA (183) GFP (157) Met (-) is used to produce and contains the reorganization NA RNA fragment that GFP encoding sequence and NA fragment efficiently import the required NA encoding sequence of virion.In this construct, ATG is replaced to GCG the initiator codon of NA open reading frame is destroyed.Like this, the GFP open reading frame will begin translation from the initiator codon of himself.

With the plasmid transfection 293T cell of producing HA (9) VSVG (80), NA (183) GFP (157) Met (-) and 6 kinds of segmental plasmids of viral RNA of residue and expression of influenza varial polymerases albumen NP, M1, M2, NS2 and VSVG.After the transfection 72 hours, collect the 293T cell conditioned medium and carry out plaque measurement with mdck cell.Contain the segmental transfection precursor virus of HA (9) VSVG (80) RNA fragment and NA (183) GFP (157) Met (-) RNA (being appointed as VSVG (HA) GFP (NA) virus) can survive and under the condition of no trypsinase, generated express GFP bite mattress body (Figure 19).Immunostaining has been confirmed to contain VSV G but has not been the expression (Figure 19) of the plaque of HA.VSVG (HA) GFP (NA) virus but be not that the cell of contrast WSN virus infection is also expressed GFP.On the contrary, when replacing pPol IHA (9) VSVG (80), express GFP and/or the proteic individual cells of NP, fail to observe plaque (data are unlisted) though can in mdck cell, detect with pPol IHA (0) VSVG (0) plasmid.And, also observing all continuous expressions (data are unlisted) in the mdck cell that VSVG (HA) GFP (NA) infects of VSVG and GFP after 5 continuous passages.Go down to posterity for 5 times the back in VSVG (HA) GFP (NA) virus the segmental residue of HA (9) VSVG (80) RNA HA zone do not detect sudden change.But found three sudden changes in the VSVG aminoacid sequence: 57 Ile becomes the Gln that Leu, 95 Gln become His and 499 and becomes terminator.Though wild-type VSV G albumen contains 29 residues of cytosolic domain, 499 Gln becomes the terminator sudden change has lacked last 13 residues of this structural domain.

The biological property of VSVG (HA) GFP (NA) virusWhether imported really in the virion that contains other influenza virus protein in order to measure VSV G albumen, carried out the western engram analysis concentrating VSVG (HA) GFP (NA) virus and WSN (contrast) virus.As shown in figure 20, detected VSV G albumen in VSVG (HA) GFP (NA) virion and do not detected HA, confirmed that VSV G albumen has imported virion.

Next, checked the growth properties of VSVG (HA) GFP (NA) virus in BHK, CHO or mdck cell.MOI cells infected with 0.001 is measured virus yield in culture supernatant in 37 ℃ with the plaque measurement on the mdck cell at metainfective different time.Although be lower than the titre of WSN virus, the maximum titre of VSVG (HA) GFP (NA) virus in BHK and mdck cell reached 10 at least ⁶PFU/ml (Figure 21).Compare with WSN virus poor growth in Chinese hamster ovary celI, VSVG (HA) GFP (NA) virus in these cells with in other two kinds of subject cells are, look the same good (Figure 21).In addition, when in each clone, duplicating, the cell expressing GFP of VSVG (HA) GFP (NA) virus infection.

These results show that HA (9) VSVG (80) and NA (183) GFP (157) Met (-) fragment have all efficiently imported in the influenza virus particles, and these two kinds of foreign genes are stably remained in A type influenza virus when going down to posterity repeatedly.

Discuss

To be used to express foreign protein based on the carrier of influenza virus very crucial to understanding influenza virus life cycle and research and development to measure genome packing mechanism.Originally studies have shown that HA vRNA coding region 3, and 5 ' terminal sequence all to be that this fragment efficiently imports virion necessary.In addition, utilize this knowledge to generate a kind of new virus, proved two kinds of stabilized expression of exogenesis genes based on influenza virus; This new virus comprises two kinds of recombinant RNA fragments that contain VSV G and GFP encoding sequence, and their sides have HA vRNA and NA vRNA to import the required sequence of virion respectively.

Reported that several methods is used to research and develop the vaccine carrier based on A type influenza virus, these carriers are used to express gene or its part that derives from uncorrelated infectious reagent.Short polypeptide has inserted the antigen site of HA, has caused the positive immune response to insertion peptide section.For longer polypeptide and protein, foreign gene inserts in the gene of influenza virus gene, and here foreign protein utilizes internal ribosome inlet site (IRES) or foot and mouth disease virus 2A proteolytic enzyme to express.Here, the new system that has set up cis acting virion lead-in signal among a kind of NA of utilization and the HA vRNA is used to express foreign protein.This system can make the virus based on influenza import the foreign gene (as VSV G) that surpasses 1.5kb, has proved the potential of this carrier system.Because the vaccine efficient of replication competent type influenza VLP in middle mouse is unknown, contain the gene that derives from uncorrelated pathogenic agent, can be used as the vaccine that gets a good chance of with the recombinant RNA fragment based on the VLP of replication competent type influenza (virus) not.This potential at HIV, foot and mouth disease, and the outstanding base of vaccine of other infection attractive, virus of live vaccine is all unacceptable to any answer of wild-type virus under these situations, or owing to the reaction of humoral immunization and cytotoxic T cell causes the efficient of inactivated vaccine very limited.Therefore, use this method influenza virus can be used as vaccine carrier.For example, can prepare the virus (Figure 24 and 25) that a kind of HIV gp160 coding region replaces HA, gag coding region replacement NA.In addition, if VSV G has replaced HA, M2 has just no longer needed, thereby just has three kinds of genes to substitute with heterologous gene.For example, HA can replace with HIV gp160, and NA can replace with gag, and M2 can replace with nef.The gained recombinant influenza can be used as vaccine or as the toughener of another kind of HIV vaccine such as HIV dna vaccination.In addition; vaccine also can be based on the multivalent vaccine of recombinant influenza; wherein the NA encode fragment in this recombinant virus is with the encode fragment of another kind of pathogenic agent such as simplexvirus D glycoprotein, and this vaccine can produce protective immunological reaction to influenza virus and herpesvirus infection like this.

The virus vector that derives from adenovirus, retrovirus and poxvirus can import foreign gene in the target cell effectively.Because these viruses comprise the DNA or the dna replication dna intermediate that can be integrated into host chromosome, can't eliminate the danger that adverse consequences takes place.On the contrary, owing to lack the DNA phase in infected cell, such being incorporated in the influenza virus is impossible.In addition, do not need the required trypsinase of HA cutting because VSVG (HA) GFP (NA) virus does not resemble other typical influenza virus, it can have purposes widely.In addition, can generate recombinant virus by changing the lip-deep glycoprotein of virion with required cytotropism.Like this, the system that utilizes virion in the vRNA fragment to import the cis acting signal can design the recombinant viral vector based on influenza, and these carriers can be conveyed into target cell with a plurality of foreign genes.

Deriving from its assembling of epithelial virus and being released in some viruses is polar, optionally occurs in the surface of summit or basic side.It is believed that the viral budding of polarization plays a role when measuring the virus infection pathogenicity bo.A type influenza virus is from infected epithelial top budding, the top surface that indivedual HA, NA that express and M2 albumen also are targeted to cell.On the other hand, VSV discharges from infected cell base side surface, and VSV G albumen also is transported to basic side surface.In this research, successfully generated with VSV G replacement HA and the proteic recombinant virus VSVG of NA (HA) GFP (NA) virus.But, because last 13 residues of the VSV G hypoproteinosis endochylema structural domain of this recombinant virus of point mutation.This 13 residues disappearance in the known endochylema structural domain and the protein transport that generates is transported to the efficient height of basic side surface to the efficiency ratio of top surface.Therefore, the sudden change of introducing in the VSV G albumen in VSVG (HA) GFP (NA) virus promotes it efficiently to be transported to top surface probably, has caused the efficient budding of VSVG (HA) GFP (NA) virus.

The popular virus strain of usually take place resetting the HA that makes virus and/or NA and propagation in the past in the Influenza Virus RNA fragment of influenza has generation simultaneously of immunology.Coding region 3 ' and 5 ' sequence are essential for their efficient importing virions in HA, NA, M and the NS vRNA.The segmental packing of vRNA (being likely the form of virus nucleoprotein mixture) is by the RNA-RNA interaction mediation of the intersegmental trans generation of viral RNA sheet.If like this, the specificity lead-in signal in each fragment may limit the segmental rearrangement of RNA.On experience, random rearrangement can not take place in known Influenza Virus RNA fragment.It is believed that the functional interaction (as formation, HA-NA and or the functional connection of cutting HA-M2 of polysaccharase mixture) between albumen has limited random rearrangement.On protein level these are reset the restriction, may also have similar restriction on the rna level.Under this background, 1957 and nineteen sixty-eight when popular, the PB1 gene has also imported the Human virus who derives from avian viruses except that HA and/or NA gene, prompting HA and PB1 RNA sheet be intersegmental may exist related.Identify that further the critical area for other RNA fragment importing virion can provide the clue of understanding the rearrangement of RNA fragment, thus the appearance of prediction new A type influenza virus epidemic strain.

In a word, the information of vRNA packaging signal has been arranged, just can research and develop new influenza vaccines and based on the vaccine carrier of influenza.

Embodiment 6

As shown in figure 26, can prepare the clone of the influenza virus-like RNA of constructive expression's proteins encoded such as NS2, even this RNA lacks lead-in signal.Also can prepare the virus (Neumann etc., 2000 that lack NS2 encoding sequence (NS2 KO); Watanabe etc., 2002).Because virus lacks NS2, when NS2 KO virus infection normal cell, will can not produce progeny virus.On the contrary, when NS2 KO virus infection is expressed coding NS but lacked the cell of influenza virus-like RNA of lead-in signal, thereby NS2 is expressed and has been produced filial generation NS2 KO virus behind the virus infection.But the influenza virus-like RNA of coding NS2 can not import in the NS2 KO virus, because it lacks the virion lead-in signal.Therefore, NS2 KO remains not replication competent type in normal cell.This system can be used for producing can not duplicating virus the production cell.Utilize this system, can prepare the production cell of expressing viral protein, the toxicity of its pair cell can stop their clone of constructive expression to produce usually.Therefore, in this application, the knowledge of virion lead-in signal can be used to design the system that does not allow specific fragment importing virion.

Reference

Air etc., Struct.Func.Genet., 6: 341 (1989).

Ali etc., J.Virol., 74: 8709 (2000).

Avery’s?Drug?Treatment：Principles?and?Practice?of?Clinical?Pharmacologyand?Therapeutics，3 ^rdedition，ADIS?Press，LTD.，Williams?and?Wilkins，Baltimore，MD(1987).

Baum etc., Virology, 180: 10 (1991).

Bean etc., J.Virol., 66: 1129 (1992).

Berkow etc., The Merck Manual, 15 ^ThEdition, Merck and Co., Rahway, NJ (1987).

Carroll etc., Virus Res., 3: 165 (1985).

Crescenzo-Chaigne etc., Virology: 265: 342 (1999).

Desselberger etc., Gene, 8: 315 (1980).

Ebadi， Pharmacology，Little，Brown?and?Co.，Boston，MA(1985).

Edwards， J.Infect.Dis.， 169：68(1994).

Enami etc., J.Virol., 70: 6653 (1996).

Ewami etc., Proc.Natl.Acad.Sci.USA, 87: 3802 (1990).

Fodor etc., J.Virol., 23: 9679 (1999).

Fujii etc., Virus, 52: 203 (2002).

Ghate etc., Virology, 264: 265 (1999).

Goodman etc., eds., Goodman and Gilman ' s The Pharmacological Basis ofTherapeutics, 8 ^ThEdition, Pergamon Press, Inc., Elmsford, NY (1990).

Hara etc., Anal.Biochem., 164: 138 (1987).

Hinshaw etc., Virology, 128: 260 (1983).

Hughes etc., J.Virol., 74: 5206 (2000).

Ito etc., J.Virol., 71: 3357 (1997).

Jambrina etc., Virology, 235: 209 (1997).

Jin etc., EMBOJ., 16: 1236 (1997).

Katzung，ed.，Basic?and?Clinical?Pharmacology，Fifth?Edition，Appleton?andLange，Norwalk，Conn.(1992).

Kavcrin etc., J.Gen.Virol., 64: 2139 (1983).

Kawaoka etc., J.Virol., 63: 4603 (1989).

Kendal etc., Infect.Immun., 29: 966 (1980).

Kerr etc., Lancet, 1: 291 (1975).

Kida etc., Virology, 122: 38 (1982).

Kilboume， Bull.M2?World?Health?Org.， 41：643(1969).

Kobasa etc., J.Virol., 71: 6706 (1997).

Krug，R.M.，ed.，The?Influenza?Viruses，Plenum?Press，New?York(1989).

Lamb etc., In B.N.Fields, D.M.Knipe, and P.M.Howley (ed.), FieldsVirology, 3 ^RdEd.Lippincott-Raven Publishers, Philadelphia, PA, p.1353-1395, (1996).

Lamb etc., Orthomyxoviridae:The viruses and their replication.In FieldsVirology (4 ^ThEdn) (Knipe, D.M. wait eds) pp.1487-1531 (2000).

Laver etc., Virology, 51: 383 (1973).

Liu etc., J.Virol., 69: 1099 (1995).

Liu etc., Virology, 194: 403 (1993).

Luo etc., J.Gen.Virol., 80: 2969 (1999).

Luytjes etc., Cell. 59: 1107 (1989).

Maassab etc., Rev.Med.Virol., 9: 237 (1999).

Mikheeva etc., Arch.Virol., 73: 287 (1982).

Mitnaul etc., J.Virol., 74: 6015 (2000).

Mizrahi，ed，Viral?Vaccines，Wiley-Liss，New?York(1990).

Murphy， Infect.Dis.Clin.Pract.， 2：174(1993).

Muster etc., Proc.Natl.Acad.Sci.USA, 88: 5177 (1991).

Neumann etc., Proc.Natl.Acad.Sci.USA, 96: 9345 (1999).

Neumann etc., EMBO J., 19: 6751 (2000).

Ogra etc., J.Infect.Dis., 135: 499 (1977).

Palese etc., Virology, 61: 397 (1974).

Portela etc., Adv.Virus Res., 54: 319 (1999).

Ray etc., J.Biol.Chem., 268: 18 (1991).

Robertson etc., Biologicals, 20: 213 (1992).

Robertson etc., Giomale di Igiene e Medicina Preventiva, 29: 4 (1988).

Rogers etc., Virology, 127: 361 (1983a).

Rogers etc., Virology, 131: 394 (1983b).

Scholtissek etc., Virology, 87: 13 (1978).

Shibata etc., J.Virol., 67: 3264 (1993).

Shibuya etc., J.Biol.Chem., 262: 1596 (1987).

Subbarao etc., J.Virol., 67: 7223 (1993).

Suzuki etc., FEBS Lett., 404: 192 (1997).

Tobita etc., Arch.Virol., 75: 17 (1983).

Wagner etc., Rev.Med.Virol., 12: 159 (2002).

Wang etc., J.Biol.Chem., 263: 4576 (1988).

Warening etc., Vaccine, 19: 3320 (2001).

Watanabe etc., J.Virol., 76: 767 (2002).

Webster etc., Microbiol.Rev., 56: 152 (1992).

Wiley etc., Annu.Ref.Biochem., 56: 3665 (1987).

Wright etc., Orthomyxovirses, In: Fields Virology, Knipe etc. (eds), Lippincott-Raven Publishers, Philadelphia, PA (2000).

Wright etc., Orthomyxoviruses.In Fields Virology (4 ^ThEdn) (Knipe, D.M. wait eds) pp.1533-1579 (2000).

Yang etc., Virology, 229: 155 (1997).

Zhang etc., J.Virol., 74: 4634 (2000).

All publications, patent and patent application are hereby incorporated by. Although the present invention has illustrated relevant some of them preferred embodiment in aforementioned specification, the many details of also listing for purposes of illustration; For the one skilled in the art, the present invention allows that other embodiments and some details described herein can be made very big change and do not deviated from basic principle of the present invention is very intuitively.

Claims (39)

1. comprise the influenza vectors that influenza virus imports sequence, this carrier comprises:

A) with the corresponding sequence of influenza virus NA vRNA3 ' non-coding region, 3 ' NA imports sequence, heterologous nucleic acids fragment and NA vRNA5 ' non-coding region;

B) with the corresponding sequence of influenza virus HA vRNA3 ' non-coding region, the heterologous nucleic acids fragment, 5 ' HA imports sequence and HA vRNA5 ' non-coding region;

C) with the corresponding sequence of influenza virus M vRNA3 ' non-coding region, 3 ' M imports sequence, the heterologous nucleic acids fragment, and 5 ' M imports sequence and M vRNA5 ' non-coding region;

D) with the corresponding sequence of influenza virus NS vRNA3 ' non-coding region, 3 ' NS imports sequence, heterologous nucleic acids fragment and NS vRNA5 ' non-coding region;

E) with the corresponding sequence of influenza virus PB2 vRNA3 ' non-coding region, the heterologous nucleic acids fragment, 5 ' PB2 imports sequence and PB2 vRNA5 ' non-coding region;

F) with the corresponding sequence of influenza virus PB1 vRNA3 ' non-coding region, the heterologous nucleic acids fragment, 5 ' PB1 imports sequence and PB1 vRNA5 ' non-coding region; Or

G) with the corresponding sequence of influenza virus PA vRNA3 ' non-coding region, the heterologous nucleic acids fragment, 5 ' PA imports sequence and PA vRNA5 ' non-coding region;

Wherein when the vRNA corresponding with this carrier be present in the expression of influenza viral protein and comprise except that with the corresponding vRNA of this carrier the cell of vRNA in the time, the vRNA corresponding with this carrier is packaged in the virion.

2. carrier claim 1a), wherein 3 ' NA import sequence comprise at least 19 with initial 19 Nucleotide that coding nucleotide is corresponding of NA.

3. the carrier of claim 2, wherein said carrier also comprise 5 ' NA and import sequence.

4. the carrier of claim 3, wherein said 5 ' NA import sequence comprise at least 39 with 39 corresponding Nucleotide of coding nucleotide of NA3 '.

5. carrier claim 1a), wherein 3 ' NA import sequence comprise at least 90 with initial 90 Nucleotide that coding nucleotide is corresponding of NA.

6. carrier claim 1b), wherein 5 ' HA import sequence comprise at least 80 with 80 corresponding Nucleotide of coding nucleotide of HA3 '.

7. carrier claim 1b), wherein 5 ' HA import sequence comprise at least 291 with 291 corresponding Nucleotide of coding nucleotide of HA3 '.

8. carrier claim 1b), wherein said carrier also comprise 3 ' HA and import sequence.

9. the carrier of claim 8, wherein 3 ' HA import sequence comprise at least 3 with initial 3 Nucleotide that coding nucleotide is corresponding of HA.

10. the carrier of claim 8, wherein 3 ' HA import sequence comprise at least 9 with initial 9 Nucleotide that coding nucleotide is corresponding of HA.

11. the carrier of claim 1, wherein said heterologous nucleic acids fragment comprise and the corresponding sequence of internal ribosome inlet sequence.

12. the carrier of claim 1, wherein said heterologous nucleic acids fragment comprises the sequence corresponding with the marker gene open reading frame.

13. the carrier of claim 1, wherein said heterologous nucleic acids fragment comprise the corresponding sequence of open reading frame with pathogen immunogenic albumen or peptide or human cytokines.

14. the carrier of claim 1, wherein said importing sequence comes from A type influenza virus.

15. the carrier of claim 1, wherein said importing sequence comes from the Type B influenza virus.

16. the carrier of claim 1, wherein said heterologous nucleic acids fragment and another nucleic acid fragment merge with encoding fusion protein.

17. comprise the recombinant influenza of the vRNA corresponding with the carrier of claim 1.

18. the recombinant virus of claim 17, wherein said heterologous nucleic acids fragment comprises the sequence corresponding with the marker gene open reading frame.

19. the recombinant virus of claim 17, wherein said heterologous nucleic acids fragment comprises the sequence corresponding with the open reading frame of pathogen immunogenic albumen or peptide.

20. the recombinant virus of claim 19, wherein said open reading frame coding HA albumen.

21. the recombinant virus of claim 19, wherein said open reading frame coding NA albumen.

22. the recombinant virus of claim 17, wherein said heterologous nucleic acids fragment comprises the sequence corresponding with the transmembrane protein open reading frame.

23. the recombinant virus of claim 17, wherein said heterologous nucleic acids fragment comprises the sequence corresponding with the albumen open reading frame, and this albumen has the film fusion-activity.

24. the recombinant virus of claim 17, wherein said heterologous nucleic acids fragment comprises the sequence corresponding with the viral capsid proteins open reading frame.

25. the recombinant virus of claim 17, wherein said heterologous nucleic acids fragment comprise and the corresponding sequence of vesicular stomatitis virus G albumen open reading frame.

26. the recombinant virus of claim 17, wherein said heterologous nucleic acids fragment comprises the sequence corresponding with the human cytokines open reading frame.

27. the recombinant virus of claim 20, wherein said HA albumen are Type B HA albumen.

28. the method for expressing heterologous nucleic acid fragment in cell, this method comprises: allow cell contact with the recombinant virus of claim 17, detect or measure the product whether described heterologous nucleic acids fragment coding is arranged in the cell and express.

Import sequence and the segmental isolated nucleic acid molecule of heterologous nucleic acids 29. comprise the influenza virus NA corresponding with NA5 ' coding region.

Import sequence and the segmental isolated nucleic acid molecule of heterologous nucleic acids 30. comprise the influenza virus NS corresponding with NS5 ' coding region.

Import sequence and the segmental isolated nucleic acid molecule of heterologous nucleic acids 31. comprise the influenza virus HA corresponding with HA3 ' coding region.

Import sequence and the segmental isolated nucleic acid molecule of heterologous nucleic acids 32. comprise the influenza virus PB2 corresponding with PB23 ' coding region.

Import sequence and the segmental isolated nucleic acid molecule of heterologous nucleic acids 33. comprise the influenza virus M corresponding with M3 ' coding region and M5 ' coding region.

34. the carrier of claim 1, wherein corresponding vRNA with described carrier when in cell, existing being that at least 10% the efficient of corresponding wild-type vRNA is packaged in the virion.

35. the carrier of claim 1, wherein corresponding vRNA with described carrier when in cell, existing being that at least 30% the efficient of corresponding wild-type vRNA is packaged in the virion.

36. the carrier of claim 1, wherein corresponding vRNA with described carrier when in cell, existing being that at least 60% the efficient of corresponding wild-type vRNA is packaged in the virion.

37. prepare the not method of replication competent type influenza sample virus, this method comprises:

A) allow recombinant host cell with lack the recombinant influenza contain the vRNA of wild-type NS encoding sequence and to comprise the recombinase sequence and contact, wherein recombinant host cell comprises recombinant nucleic acid molecules, this recombinant nucleic acid molecules comprises the NS2 open reading frame that is connected with two locus specificity recombination sequence steering quality rather than imports sequence, described recombination sequence is connected with 5 ' end of NS2 open reading frame, and described recombination sequence is discerned by recombinase; And NS2 does not express when no recombinase exists; With

B) replication competent type influenza sample virus is not separated with recombinant host cell.

38. the method for claim 37, wherein said recombinase are Cre, the locus specificity recombination sequence is the loxP sequence.

39. the method for claim 37, wherein said recombinase are FLP, the locus specificity recombination sequence is the frt sequence.

Images