PT2412812E - Optimized non-canonical zinc finger proteins - Google Patents

Description

DESCRIPTION " PROTEINS WITH OPTIMIZED NON-CANONIC ZINC FINGERS "

TECHNICAL FIELD The present disclosure is in the fields of genetic engineering, gene targeting, targeted chromosomal integration, protein expression and epigenome editing.

BACKGROUND The binding of proteins to specific sequences of DNA, RNA, proteins and other molecules is involved in a number of cellular processes such as, for example, transcription, replication, chromatin structure, recombination, DNA repair, RNA processing and translation. The binding specificity of the cellular binding proteins that participate in the protein-DNA, protein-RNA and protein-protein interactions contributes to the development, differentiation and homeostasis.

Zinc finger proteins (ZFPs) are proteins that can bind to DNA in a sequence specific form. Zinc fingers were first identified in the TFIIIA transcription factor derived from African nail frog oocytes, Xenopus laevis. A zinc finger domain of this class of ZFPs is about 30 amino acids in length and several structural studies have demonstrated that it has a beta loop (containing two conserved cysteine residues) and an alpha helix (containing two conserved histidine residues), which are maintained in a particular conformation by the coordination of a zinc atom by the two cysteines and by the two histidines. This class of ZFPs is also known as C2H2 ZFPs. Other classes of ZFPs were also suggested. See, e.g., Jiang et al. (1996) J. Biol. Chem. 271: 10723-10730, for a discussion of Cys-Cys-His-Cys (C3H) ZFPs. To date, more than 10000 zinc finger sequences have been identified on several hundred known or putative transcription factors. Zinc finger domains are involved not only in DNA recognition, but also in RNA binding and protein-protein binding. Current estimates indicate that this class of molecules constitutes about 2% of all human genes. Most zinc finger proteins have conserved cysteine and histidine residues that tetrahedrally coordinate a single zinc atom per finger domain. In particular, most ZFPs are characterized by finger components having the general sequence: -Cys- (X) 2-4-Cys- (X) 12-His- (X) 3-5-His- (SEQ ID NO: ID NO: 1), wherein X represents any amino acid (the C 2 H 2 ZFPs). The coordinating sequences of zinc of this most widely represented class have two cysteines and two histidines with particular spacings. The rolled structures of each finger have an antiparallel β-loop, a finger-tip region, and a short antipathic α-helix. The metal coordination ligands bind to the zinc ion and in the case of zif268 zinc fingers, the short antipathic α helix binds to the major groove of the DNA. Further, the zinc finger structure is stabilized by certain conserved hydrophobic amino acid residues (eg, the residue directly preceding the conserved first Cys and the residue at the +4 position of the helical segment of the finger) and by the coordination of the zinc through the residues conserved cysteine and histidine.

Canonized zinc finger proteins (C2H2) with changes in positions that make direct contact, " support " residues have been described. or " buttressing " immediately adjacent to the positions contacting the bases and at positions capable of contacting the phosphate backbone of the DNA. See, e.g., U.S. Pat. 6, 007, 988; 6, 013,453; 6, 140, 081; 6, 866, 997; 6, 746, 838; 6, 140, 081;

6,610,512; 7,101,972; 6,453,242; 6,785,613; 7,013,219; PCT WO 98/53059; Choo et al. (2000) Curr. Opin. Struct. Biol. 10: 411-416; Segai et al. (2000) Curr. Opin. Chem. Biol. 4: 34-39.

In addition, zinc fingered zinc finger proteins with modified zinc coordination residues have also been described (see, eg, U.S. Patent Application Serial No. 20030108880, 20060246567 and 20060246588. However, while zinc finger proteins containing these non-canonical zinc fingers retain the function of regulating transcription, their ability to act as zinc finger nucleases (ZFNs) is in some cases reduced relative to proteins consisting of zinc fingers having exclusively canine zinc fingers C2H2.

Houchens et al. , describe RIP60 containing fifteen C2H2 zinc finger DNA binding motifs organized into three groups. WO 02/057293 describes zinc finger binding proteins with modified metal coordination sites, whereby the binding proteins have three zinc coordinating fingers and one or more of these fingers are components of modified non-canonical fingers. WO 2005/014792 discloses fusion polypeptides comprising a genetically manipulated zinc finger binding domain and a cleavage domain and fusion polypeptides comprising a genetically engineered zinc finger binding domain and a cleavage half domain. WO 2006/029296 discloses polynucleotides encoding inositol polyphosphate 2-kinase (IPP-k) and polypeptides with an activity that modulates phytic acid biosynthesis.

Thus, the need remains, particularly in the construction of more zinc finger nucleases, of zinc finger fingers containing zinc fingers having optimized non-canonical zinc coordination regions.

SUMMARY The present disclosure provides for DNA binding zinc finger domains with changes in at least one zinc coordination residue. These zinc fingers may further comprise additional changes (substitutions, insertions and / or deletions) in the vicinity of the zinc coordination residues, for example in the residues surrounding the more C-terminal zinc coordination residue. Also described are zinc finger polypeptides and fusion proteins comprising one or more CCHC zinc fingers, polynucleotides encoding these zinc fingers and fusion proteins, and methods of using such polypeptides and / or zinc finger fusion proteins. The present invention is described by claims 1-32. The following is also disclosed: 1. A zinc finger protein comprising a non-canonical zinc finger (not C2H2), wherein the noncanonical zinc finger has a helical portion involved in DNA binding and wherein the coordination region of the zinc of the helical portion comprises the amino acid sequence HX1X2RCXL (SEQ ID NO: 2); and wherein the zinc finger protein is engineered to bind to a target sequence. 2. The zinc finger protein of item 1, wherein Xi is A and X2 is Q. 3. The zinc finger protein of item 1, wherein Xi is K and X2 is E. 4. The fingered protein of zinc of item 1, wherein X 1 is T and X 2 is R. 5. The zinc finger protein of item 1, wherein X 1 is G. 6. The zinc finger protein comprising two or more zinc fingers, in which at least one zinc finger comprises the sequence Cys- (Xa) 2-4-Cys- (XB) 12-His- (Xc) 3-5-Cys- (XD) 1-10 (SEQ ID NO: 3) ), where Xa, Xb, Xc and XD represent any amino acid. The zinc finger protein of any one of items 1 to 6, comprising any of the sequences shown in any one of Tables 1, 2, 3 or 4. 8. The zinc finger protein of any of items 6 or 7, wherein XD comprises the sequence QLV or QKP. 9. The zinc finger protein of item 8, wherein the QLV or QKP sequence is the 3 C-terminal amino acid residues of the zinc finger. The zinc finger protein of any of items 6 to 9, wherein XD comprises the 1, 2 or 3 Gly (G) residues. A protein comprising a plurality of zinc fingers, wherein at least one of the zinc fingers comprises a zinc finger CCHC according to any one of items 1 to 10. The zinc finger protein of item 1, wherein the zinc finger protein comprises 3, 4, 5 or 6 zinc fingers. The zinc finger protein of item 11 or 12, wherein the finger 2 comprises the zinc finger CCHC. The zinc finger protein of any one of items 11 to 13, wherein the C-terminal zinc finger comprises the zinc finger CCHC. The zinc finger protein of any one of items 11 to 14, wherein at least two zinc fingers C comprises the zinc finger CCHC. The zinc finger protein of any one of items 11 to 15, wherein the zinc finger protein comprises any of the sequences shown in Table 8 and is engineered to bind to a target sequence in an IPP2-K gene. A fusion protein comprising a zinc finger protein of any one of items 1 to 16 and one or more functional domains. A fusion protein comprising: (a) a cleavage half domain, (b) the zinc finger protein of any one of items 1 to 16 and (c) a ZC linker interposed between the cleavage half domain and zinc finger protein. The fusion protein of item 18, wherein the length of the ZC linker is 5 amino acids. 20. The fusion protein of item 19, wherein the amino acid sequence of the ZC linker is GLRGS (SEQ ID NO: 4). 21. The fusion protein of item 18, wherein the length of the ZC linker is 6 amino acids. 22. The fusion protein of item 21, wherein the amino acid sequence of the ZC linker is GGLRGS (SEQ ID NO: 5). A polynucleotide encoding a zinc finger protein according to any one of items 1 to 16 or a fusion protein according to any one of items 17 to 22. A method for the targeted cleavage of cellular chromatin in a The method comprises the expression, in the cells, of a pair of fusion proteins according to any one of items 18-22; wherein: (a) the target sequences of the fusion proteins are ten nucleotides apart; and (b) the fusion proteins dimerize and cleave DNA located between the target sequences. A method of directed genetic recombination in a plant host cell, the method comprising (a) expression in the host cell of a pair of fusion proteins according to any one of items 18 to 22, wherein the target sequences of the fusion proteins are present at a target locus selected from the host, and (b) identification of a recombinant host cell exhibiting a sequence change at the host target locus. 26. The method of item 19 or claim 24 or 25, wherein the sequence change is a mutation selected from the group consisting of a deletion of genetic material, an insertion of genetic material, a replacement of genetic material, and any combination thereof . The method of any one of items 24 to 26, further comprising introducing an exogenous polynucleotide into the host cell. 28. The method of item 27, wherein the exogenous polynucleotide comprises sequences homologous to the host's target locus. The method of any one of items 24 to 28 wherein the plant is selected from the group consisting of a monocotyledon, a dicotyledon, gymnosperms and eukaryotic algae. The method of item 29, wherein the plant is selected from the group consisting of maize, rice, wheat, potato, soybean, tomato, tobacco, members of the Brassica family and Arabidopsis. The method of any one of items 24 to 29, wherein the plant is a tree. 32. The method of any one of items 24 to 31, wherein the target sequences are in an IPP2-K gene. The method of claim 27 for reducing the level of phytic acid in seeds, comprising inactivating or altering the IPP2-K gene according to item 32. The method of claim 28 for rendering phosphorus more metabolically available in the comprising the inactivation or alteration of the IPP2-K gene according to item 32. A plant cell comprising a fusion protein according to any one of items 1 to 16, a fusion protein according to any one of items 17 to 22 or a polynucleotide according to item 23. 36. The plant cell of item 35, wherein the cell is the seed. 37. The plant cell of item 36, wherein the seed is a maize seed. 38. The plant cell of any of items 35 to 37, wherein IPP2-K is partially or fully inactivated. 39. The plant cell of item 38, wherein the levels of phytic acid in the seed are reduced. 40. The plant cell of items 35 to 39, wherein the phosphorus levels metabolically available in the cell are increased.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a graph depicting the gene correction rates, measured by the percentage of cells expressing GFP, in a reporter assay system as described in U.S. Patent No. 2005/0064474 and below. ZFN variants are designated " X-Y ", where " X " refers to the number of the Table and " Y " refers to the number given to the zinc finger in the particularly selected table. For example, " 2-21 " refers to a ZFN with a finger comprising the sequence shown in Table 2 in the numbered line 21, namely HAQRCGLRGSQLV (SEQ ID NO: 53).

Figure 2 is a graph depicting the percentage of a Cel-1 signal resulting from cleavage with several pairs of ZFN variants. For each pair of ZFNs, results from two experiments are shown by reference to the sample number. The pairs of variants used for each sample are shown in the box in the upper right corner, while " wt 5-8 " and " wt 5-9 " refers to canonical ZFN pairs described in Example 14 (Table 17) of U.S. Patent Application No. 2005/0064474. In samples 3-12, the C-terminal region of finger recognition helices 2 or finger 4 of the 5-8 or 5-9 canonical ZFN are replaced with non-canonical sequences. The partial sequence of the designated non-canonical ZFN variants 20, 21, 43, 45, 47 and 48 in samples 3-12 and the finger position of these variants within the 4-finger ZFN is shown in the upper left corner above the graph. The asterisk above the bar describing the results of experiment 2 of samples 8 and 9 indicates the background in the lane, resulting from an underestimation of the efficiency of ZFN.

Figure 3 is a graph depicting the correction rates of the genes in the GFP cell reporter assay system described in U.S. Patent No. 2005/0064474 and herein. The ZFN pairs tested in each sample are shown below the bar, where the numbers of the zinc fingers CCHC 1a to 10a comprise the sequence shown in Tables 3 and 4. The zinc fingers 20, 21, 7a, 8a, 9a and 10a were used on Finger 4; the zinc fingers 43, 45, 47, 48, 1a, 2a, 3a, 4a, 5a and 6a were used in Finger 2.

Figure 4 is a schematic linear representation of plasmid pDAB1585, a target vector for tobacco.

Figure 5 is a schematic representation of plasmid pDAB1585, a target vector for tobacco.

Figures 6A and 6B disclose zinc finger nucleases (ZFN). FIG. 6A is a scheme that describes the binding of ZFN. FIG. 6B shows the sequence of the target sequence. plasmid pDABl400.

Figure 7 is a schematic representation of the

Figure 8 is a schematic representation of plasmid pDAB782.

Figure 9 is a schematic representation of plasmid pDAB1 582.

Figure 10 is a schematic representation of the plasmid pDAB354.

Figure 11 is a schematic representation of plasmid pDAB1503.

Figure 12 is a schematic representation of plasmid pDAB2407.

Figure 13 is a schematic representation of plasmid pDAB1584.

Figure 14 is a schematic representation of plasmid pDAB2418.

Figure 15 is a schematic representation of plasmid pDAB4045. plasmid pDAB! 575.

Figure 16 is a schematic representation of the

Figure 17 is a schematic representation of plasmid pDABl577.

Figure 18 is a schematic representation of the plasmid pDAB1579.

Figure 19 is a schematic representation of plasmid pDAB150.

Figure 20 is a schematic representation of plasmid pDAB3401.

Figure 21 is a schematic representation of plasmid pDAB170.

Figure 22 is a schematic representation of plasmid pDAB1772.

Figure 23 is a schematic representation of plasmid pDAB4003.

Figure 24 is a schematic representation of the plasmid pDABl71.

Figure 25 is a schematic representation of the plasmid pDAB7204. plasmid pDAB! 573.

Figure 26 is a schematic representation of the

Figure 27 is a schematic representation of plasmid pDAB1754.

Figure 28 is a schematic representation of the plasmid pDABl581.

Figure 29 is a schematic representation of the plasmid pD AB 1576.

Figure 30 are schematic representations of plasmid pDABl600.

Figure 31 is a schematic representation of plasmid pDAB3731.

Figure 32 is a schematic representation of plasmid pDAB4322.

Figure 33 is a schematic representation of plasmid pDAB4331.

Figure 34 is a schematic representation of plasmid pDAB4332.

Figure 35 is a schematic representation of plasmid pDAB4333.

Figure 36 is a schematic representation of plasmid pDAB4334. plasmid pDAB4336.

Figure 37 is a schematic representation of the

Figure 38 is a schematic representation of plasmid pDAB4339.

Figure 39 is a schematic representation of plasmid pDAB4321.

Figure 40 is a schematic representation of plasmid pDAB4323.

Figure 41 is a schematic representation of the plasmid pDAB4341.

Figure 42 is a schematic representation of plasmid pDAB4342.

Figure 43 is a schematic representation of plasmid pDAB4343.

Figure 44 is a schematic representation of the plasmid pDAB4344.

Figure 45 is a schematic representation of plasmid pDAB4346. plasmid pDAB4330.

Figure 46 is a schematic representation of the

Figure 47 is a schematic representation of plasmid pDAB4351.

Figure 48 is a schematic representation of plasmid pDAB4356.

Figure 49 is a schematic representation of plasmid pDAB4359.

Figure 50 is a schematic representation of plasmid pDAB7002.

Figure 51 is a schematic representation of plasmid pDAB7025.

Figure 52 is a schematic representation of plasmid pDAB1591.

Figure 53 is a schematic representation of the plasmid pcDNA3.l-SCD27a-L0-Fokl, the DNA template used for PCR amplification of Scd27 ZFN.

Figure 54 is a schematic representation of plasmid pDAB1594.

Figure 55 is a schematic representation of plasmid pDAB! 598.

Figure 56 is a schematic representation of plasmid pDABl577.

Figure 57 is a schematic representation of plasmid pDABl578.

Figure 58 is a schematic representation of plasmid pDAB1601,

Figure 59 is a schematic describing predicted intrachromosomal homologous recombination stimulated by the IL-1-Fok1 fusion protein.

Figure 60 is a schematic representation of plasmid pDABl590, a positive control of GFP expression.

Figure 61 is a schematic describing predicted interchromosomal homologous recombination stimulated by the IL-1-Fokl fusion protein with zinc fingers.

Figure 62 is a schematic describing predicted interchromosomal homologous recombination stimulated by the Scd27-Fokl fusion protein with zinc fingers.

Figure 63 is a gel describing the PCR analysis of the recombinants. The first 4 lanes on the left are marked above the gel. Lanes 1-5 show HR events of the BY2-380 transformation with the C3H IL-1-Fokl fusion protein gene and the 6-7-labeled lanes show the HR events of the BY2-380 transformation with the protein gene of fusion C3H SCD27-Fokl.

Figure 64 shows a sequence of the corn IPP2K gene (SEQ ID NO: 6), derived from the Hill cell culture and which served as a matrix for the genetic manipulation of ZFNs targeting maize IPP2K.

Figures 65, panels A to E, disclose a cloning scheme of the ZFN expression vector. A multi-step cloning strategy was used to generate ZFN expression constructs. The individual ZFN encoding genes were cloned into the vectors pVAX-N2A-NLSop2-EGFP-FokMono (A) and pVAX-C2A-NLSop2-EGFP-FokMono (B) to create a cassette for two (C) proteins. This cassette was ligated to pDAB3872 (D) to generate a final plasmid (E) for expression of the ZFN heterodimer.

Figure 66 depicts the binding of ZFN to a maize IPP2K gene. Two ZFN proteins are required to perform the double-stranded DNA cut. The sequence around the cutoff site (indicated with an arrow down) is shown (SEQ ID NO: 7). A protein (8705) bound to the CTGTGGGGCCAT (upper strand) (SEQ ID NO: 8) sequence, while the other protein (8684, 8685 or 8686) bound to the lower sequence (CTTGACCAACTCAGCCAG, lower strand) (SEQ ID NO: 9).

Figure 67 depicts wild-type sequences (upper sequence, SEQ ID NO: 10) and clone ZFN 127 (lower sequence, SEQ ID NO: 11). The cutoff target for this ZFN is evidenced in a gray box.

Figure 68 shows an alignment of multiple deletions resulting from the non-homologous linkage (NHEJ) of a cut in dsDNA, mediated by ZFN, in the gene IPP2K of maize according to detection by sequencing of 454. The cut target for this ZFN is evidenced in a gray box.

Figure 69 is a graph depicting the correction rates in the GFP cell reporter assay system described in U.S. Patent No. 2005/0064474 and herein. The ZFN pairs tested in each sample are presented below each bar.

Figure 70 depicts the plasmid pDAB7471, con-truted as described in Example 18B.

Figure 71 depicts plasmid pDAB7451, constructed as described in Example 18C.

Figure 72 is a schematic description of an autonomous expression cassette for a herbicide tolerance gene. This construct comprises a full transcription promoter-unit (PTU) containing a promoter, a herbicide tolerance gene and the termination and polyadenylation (polyA) sequence as described in Example 18D.

Figure 73 depicts plasmid pDAB7422, constructed as described in Example 18E. The plasmid includes a complete transcription promoter (PTU) containing a promoter, a herbicide tolerance gene and the termination and polyadenylation (polyA) sequence inserted into a position 1 plasmid backbone.

Figure 74 depicts plasmid pDAB7452, constructed as described in Example 18E. The plasmid includes a complete transcription promoter (PTU) containing a promoter, a herbicide tolerance gene and the polyadenylation (polyA) termination sequence inserted into a position 2 plasmid backbone.

Figure 75 is a schematic description of a non-autonomous expression cassette for a herbicide tolerance gene. This construct comprises a full transcription promoter-unit (PTU) containing a promoter, a herbicide tolerance gene and the polyadenylation (polyA) termination sequence as described in Example 18F.

Figure 76 depicts plasmid pDAB7423, constructed as described in Example 18G. This plasmid includes an incomplete transcription promoter (PTU) containing a herbicide tolerance gene and a polyadenylation (polyA) termination sequence inserted into a position 1 plasmid backbone.

Figure 77 depicts plasmid pDAB7454, constructed as described in Example 18G. The plasmid includes an incomplete transcription promoter (PTU) containing a herbicide tolerance gene and a polyadenylation (polyA) termination sequence inserted into a position 2 plasmid backbone as described in Example 18H.

Figure 78 depicts plasmid pDAB7424 (an example of a position-1 autonomous donor adapted from Gateway®), constructed as described in Example 18H.

Figure 79 depicts plasmid pDAB 7425 (an example of a position-1 autonomous donor adapted from Gateway®), constructed as described in Example 18H.

Figure 80 depicts plasmid pDAB 7426, constructed as described in Example 18H. pADB 7426 is a combination plasmid containing the position-1 autonomous donor with an ZFN expression cassette.

Figure 81 depicts plasmid pDAB 7427, constructed as described in Example 18H. pADB 7427 is a combination plasmid containing the position-1 autonomous donor with an ZFN expression cassette. Figure 82 depicts the amplification of specific DNA donor sequences derived from genomic DNA. The presence of a 317 bp product is diagnostic for the presence of donor DNA containing the PAT gene inserted into the genome of corn callus lines # 61-72 as described in Example 20C. Hill indicates a wild-type negative control.

Figure 83 depicts the amplification of the 5 'border between the donor DNA and the maize genomic sequences specific for IPP2K. The products of the second PCR reaction derived from the targeted integration of the donor into the IPP2K gene were diagnosed by the presence of 1.65 kbp DNA fragments as described in Example 21A. Hill indicates a wild-type negative control.

Figure 84 depicts the 3 'border amplification between donor DNA and specific genomic IPP2K maize sequences. The products of the second PCR reaction derived from the targeted integration of the donor into the IPP2K gene were diagnosed by the presence of 1.99 kbp DNA fragments as described in Example 21A. Hill indicates a wild-type negative control.

Figure 85 depicts the amplification of the 5 'upstream border between genome and donor. The products of the second PCR reaction derived from the targeted integration of the donor into the IPP2K gene (5 'border) were diagnosed by the presence of DNA fragments of 1.35 kbp in size as described in Example 21B. Hill indicates a wild-type negative control.

Figure 86 depicts the amplification of the 3 'downstream border between donor and genome. The products of the second PCR reaction derived from the targeted integration of the donor into the IPP2K gene (3 'border) were diagnosed by the presence of DNA fragments of 1.66 kbp in size as described in Example 21B. Hill indicates a wild-type negative control.

Figure 87 depicts the 5 'flanking homology sequence of the -1 position (SEQ ID NO: 171).

Figure 88 depicts the 3 'flanking sequence of position -1 (SEQ ID NO: 172).

Figure 89 depicts the 5 'flanking homology sequence of the -2 position (SEQ ID NO: 139).

Figure 90 depicts the 3 'flanking sequence of position -2 (SEQ ID NO: 140).

Figure 91 depicts the sequence of a genomic sequence (5'-) IPP2K upstream of the ZFN target regions (SEQ ID NO: 141).

Figure 92 depicts the sequence of a genomic sequence (3'-) IPP2K downstream of the ZFN target regions (SEQ ID NO: 142).

DETAILED DESCRIPTION Disclosed herein are compositions comprising zinc finger binding polypeptides (ZFPs) containing non-canonized zinc fingers of the Cys-Cys-His-Cys formate as claimed. Although zinc coordination provides the main zinc finger winding energy, the adjustment of the coordination of the zinc fingers provides a rapid means of modifying the structural stability of the fingers, which impacts on a variety of important functional characteristics of finger proteins including, for example, cell half-life, interactions with other cellular factors, DNA binding specificity and affinity, and relative orientation of the functional domains.

Zinc finger proteins comprising non-canonical zinc fingers such as those described in U.S. Patent Application Serial Nos. 2,003,108,880; 20060246567; and 20060246588 have proved capable of binding to DNA and altering transcription. However, when incorporated into zinc finger nucleases (ZFNs, see for example U.S. Patent Application Serial No. 2005/0064474), these previously described noncanonical zinc finger proteins may sometimes exhibit suboptimal activity at cutting the target DNA. Described herein are zinc finger proteins comprising one or more CCHC zinc fingers as claimed, wherein specific sequences surrounding the C-terminal pair of the zinc coordination residues have been altered. Also described are fusion proteins, for example zinc finger nucleases (ZFNs), comprising these optimized non-canonical zinc fingers, wherein the ZFNs cut the target DNA at rates comparable to the cut obtained using ZFNs comprising canonical zinc fingers (CCHH ).

Fusion polypeptides, as described herein, can stimulate or suppress transcription of a gene and / or cut a target sequence. Also provided are optimized non-canonized zinc finger coding polynucleotides and polynucleotides encoding fusion proteins comprising one or more optimized non-canonical zinc fingers. Also provided are pharmaceutical compositions comprising a therapeutically effective amount of any of the nucleotide-binding zinc finger polypeptides described herein or functional fragments thereof; or a therapeutically effective amount of a nucleotide sequence encoding any of the modified zinc finger nucleotide binding polypeptides or functional fragments thereof in combination with a pharmaceutically acceptable carrier. Also provided are agricultural compositions comprising an agronomically effective amount of any of the zinc finger nucleotide binding polypeptides described herein or functional fragments thereof; or an agronomically effective amount of a nucleotide sequence encoding any of the modified zinc finger nucleotide binding polypeptides or functional fragments thereof in combination with an agronomically acceptable carrier. Also provided are screening methods for obtaining a modified zinc finger nucleotide-binding polypeptide that binds to a genomic sequence.

Genomic sequences include those present on chromosomes, episomes, organelle genomes (eg, mitochondria, chloroplasts), artificial chromosomes and any other type of nucleic acid present in a cell such as, for example, amplified sequences, small double chromosomes, and genomes of bacteria that are endogenous or that cause infection and viruses. The genomic sequences may be normal (i.e., wild) or mutant; the mutant sequences may comprise, for example, insertions, deletions, substitutions, translocations, rearrangements and / or point mutations. A genomic sequence may also comprise one of a number of different alleles.

General The practice of the methods, as well as the preparation and use of the compositions described herein, employ, unless otherwise indicated, conventional techniques of molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell cultures, recombinant DNA, and related fields of knowledge of those familiar with the art. These techniques are fully described in the literature. See, for example, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL,

Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, " Chromatin " (P.M.

Wassarman and A. P. Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, " Chromatin Protocols " (P.B. Becker, ed.) Humana Press, Totowa, 1999.

Definitions

The terms " nucleic acid ", " polynucleotide " and " oligonucleotide " are used interchangeably and refer to a polymer of deoxyribonucleotides or ribonucleotides, in the linear or circular conformation and in single or double stranded form. For purposes of the present disclosure, these terms are not considered limiting with respect to the length of the polymer. The terms may include known analogs of natural nucleotides, as well as nucleotides that are modified in the base, sugar and / or phosphate (e.g., phosphorothioate backbone) moieties. In general, an analogue of a particular nucleotide has the same base pairing specificity; i.e., an analog of A will pair with T.

The terms " polypeptide " " " peptide " and " protein " are used interchangeably to refer to a polymer of amino acid residues. The term also applies to amino acid polymers wherein one or more amino acids are chemical analogues or modified derivatives of a corresponding natural amino acid. " Link " refers to a sequence-specific non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). Not all components of a binding interaction need to be sequence specific (e.g., contacts with phosphate residues in a DNA backbone), provided the interaction as a whole is sequence specific. Such interactions are generally characterized by a dissociation constant (Kd) of 10-6 M -1 or less. " Affinity " refers to the strength of the bond: the increase in bond affinity being correlated with a lower Kd.

&Quot; binding protein " is a protein that is capable of non-covalently binding to another molecule. A binding protein may bind, for example, to a DNA molecule (a DNA binding protein), an RNA molecule (an RNA binding protein) and / or a protein molecule (a binding protein the protein). In the case of a protein binding protein, it may bind itself (to form homodimers, homotrimers, etc.) and / or may be one or more molecules of a different protein or proteins. A binding protein may have more than one type of binding activity. For example, zinc finger proteins have DNA binding, RNA binding, and protein binding activity.

A " zinc finger binding protein " (or binding domain) is a protein or a domain within a larger protein, which binds to DNA in a sequence specific form through one or more zinc fingers, which are regions of the amino acid sequence within the binding domain whose structure is stabilized through the coordination of a zinc ion. The term DNA finger zinc finger protein is often abbreviated as zinc finger protein or ZFP.

Binding zinc finger domains can be " handled " to bind a predetermined nucleotide sequence. Non-limiting examples of methods for handling zinc finger proteins are design and selection. A planned zinc finger protein is an unnatural protein whose design / composition results primarily from rational criteria. Rational criteria for the design include application of substitution rules and computer algorithms for processing information in a database of information storage on existing ZFP drawings and binding data. See, for example, U.S. Patents 6,140,081; 6,453,242;

6,534,261; and 6,785,613; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496; and U.S. Patents 6,746,838; 6,866,997; and 7,030,215.

A protein with zinc fingers " selected " is a protein not found in nature whose production results primarily from an empirical process, such as phage display, capture by interaction or selection of hybrids. See e.g., US 5,789,538; US 5,925,523; US 6,007,988; US 6,013,453; US 6,200,759; US 6,733,970; US RE 3, 9.229; and WO 95/19431; WO 96/06166; WO 98/53057; WO 98/54311; WO 00/27878; WO 01/60970 WO 01/88197 and WO 02/099084.

A protein with zinc fingers " non-canonical " is a protein comprising a non-canonical zinc finger (not C2H2). A non-canonical zinc finger thus comprises a substitution, addition and / or deletion of at least one amino acid, as compared to a natural zinc finger protein C2H2. Non-limiting examples of non-canonical zinc fingers include those comprising zinc (from the amino to carboxyl terminus) coordination residues of Cys-Cys-His-Cys (e.g., C3H).

A " homologous sequence " refers to a first sequence that shares a degree of sequence identity with a second sequence and whose sequence may be identical to that of the second sequence. A " non-identical homologous sequence " refers to a first sequence that shares a degree of sequence identity with a second sequence but whose sequence is not identical to that of the second sequence. For example, a polynucleotide comprising the wild-type sequence of a mutant gene is homologous and not identical to the sequence of the mutant gene. In certain embodiments, the degree of homology between the two sequences is sufficient to permit homologous recombination between them, using normal cellular mechanisms. Two non-identical homologous sequences may be any length and their degree of non-homology may be as small as a single nucleotide (eg, for correction of a genomic point mutation by directed homologous recombination) or as large as 10 or more kilobases (eg , for insertion of a gene at a predetermined location on a chromosome). Two polynucleotides comprising the non-identical homologous sequences need not have the same length. For example, an exogenous polynucleotide (i.e., donor polynucleotide) between 20 and 10,000 nucleotides or nucleotide pairs may be used.

Techniques for determining the identity of nucleic acid and amino acid sequences are known in the art. Typically, such techniques include determining the nucleotide sequence of the mRNA for a gene and / or encoding the amino acid sequence and comparing these sequences with a second nucleotide or amino acid sequence. Genomic sequences can also be determined and compared in this way. In general, the identity refers to an exact match nucleotide to nucleotide or amino acid to amino acid of two polynucleotide or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their percentage identity. The percentage identity of two sequences, whether nucleic acid or amino acid, is the number of exact matches between the two aligned sequences divided by the length of the shortest sequence and multiplied by 100. Approximate alignment for nucleic acid sequences is provided by the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981). This algorithm can be applied to the amino acid sequences through the use of the dot matrix developed by Dayhoff, Atlas of Protein Sequences and Structure. M. 0. Dayhoff ed., 5 suppl. 3: 353-358, National Biomedical Research Foundation, Washington, D.C., USA, and standardized by Gribskov, Nucl. Acids Res. 14 (6): 6745-6763 (1986). One example of implementing this algorithm to determine the percent identity of a sequence is provided by the Genetics Computer Group (Madison, WI) in the " BestFit " tool application. The default parameters for this method are described in the Wisconsin Sequence Analysis Package Program Manual, Version 8 (1995) (available from the Genetics Computer Group, Madison, WI). An example of a method of establishing percent identity in the context of the present disclosure is to use the MPSRCH program package, the rights of which are from the University of

Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, CA). From this set of packages we can employ the Smith-Waterman algorithm in which the default parameters are used for the scoring table (for example, the penalty for an open space of 12, the penalty for extending the space of one a space of six). From the data generated, the value of " Correspondence " reflects the identity of the sequences. Other suitable programs for calculating the percentage of identity or similarity between sequences are known in the art, for example another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used with the following default parameters: genetic code = default; filter = none; chain = both; threshold = 60; expected = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + Swiss protein + Spupdate + PIR. The details of these programs can be found on the network. With respect to the sequences described herein, the range of degrees of sequence identity desired is from about 35% to 100% and any integer value therebetween. Typically percentages of identity between sequences are at least 35-40%; 40-45%; 45% -50%; 50% -60%; 60% -70%; 70-75%, preferably 80-82%, more preferably 85-90%, still more preferably 92%, still more preferably95%, and most preferably 98% sequence identity.

Alternatively, the degree of sequence similarity between polynucleotides can be determined by hybridization of polynucleotides under conditions that allow the formation of stable double helices between homologous regions, followed by single nucleotide specific nucleases digestion and determination of the size of the digested fragments. Two nucleic acid sequences or two polypeptide sequences are substantially homologous to each other when the sequences have at least about 70-75%, preferably 80-82%, more preferably 85-90%, still more preferably 92-85%. %, still more preferably 95% and more preferably 98% sequence identity over a defined length of the molecules as determined using the above methods. As used herein, substantially homologous also refers to sequences which have complex identity with a specified DNA or protein sequence. DNA sequences that are substantially homologous may be identified in a Southern hybridization experiment, for example under stringent conditions, as defined for that particular system. Those familiar with the art know how to define suitable hybridization conditions. See, e.g., Sambrook et al., Supra; Nucleic Acid Hybridization: A Practical Approach, B.D. editors. Hames and SJ. Higgins, (1985) Oxford; Washington, DC; ERL Press). Selective hybridization of two nucleic acid fragments can be determined as follows. The degree of sequence identity between the two nucleic acid molecules affects the efficiency and strength of the hybridization events between such molecules. A partially identical nucleic acid sequence will at least partially inhibit the hybridization of a fully identical sequence to a target molecule. Inhibition of completely identical sequence hybridization can be evaluated using hybridization assays which are known in the art (eg, Southern blotting, Northern blotting, hybridisation in solution or the like, see Sambrook, et al., Molecular Cloning : A Laboratory Manual, Second Edition, (1989) Cold Spring Harbor, NY). Such assays may be conducted using varying degrees of selectivity, for example, using conditions ranging from low to high stringency. If low stringency conditions are employed, the absence of non-specific binding can be assessed using a secondary probe that does not even have a partial degree of sequence identity (e.g., a probe having less than about 30% sequence with the target molecule) so that, in the absence of non-specific binding events, the secondary probe will not hybridize to the target.

When a hybridization-based detection system is used, a nucleic acid probe is chosen which is complementary to a reference nucleic acid sequence and then, through the selection of suitable conditions, the probe and reference sequences hybridize selectively or bind to one another to form a double helix molecule. A nucleic acid molecule which is capable of selectively hybridizing with a reference sequence under typically stringent conditions typically hybrid under conditions allowing the detection of a target nucleic acid sequence of at least about 10-14 nucleotides in length having at least about 70% sequence identity to the selected nucleic acid probe sequence. Stringent hybridization conditions typically permit the detection of target nucleic acid sequences of at least about 10-14 nucleotides in length, with a sequence identity greater than about 90-95% with the sequence of the selected nucleic acid probe. Hybridization conditions useful for the hybridization of the probe / reference sequences, wherein the probe and reference have a high degree of sequence identity, can be determined as is known in the art (see, for example, Nucleic Acid Hybridization: A Practical Approach, editors BD Hames and SJ Higgins, (1985) Oxford, Washington, DC, IRL Press).

Hybridization conditions are known to those skilled in the art. Hybridization stringency refers to the degree to which hybridization conditions disfavor the formation of uncorrected nucleotide-containing hybrids, with the highest stringency correlated with a lower tolerance for uncorrected hybrids. Factors affecting the stringency of hybridization are known to those of ordinary skill in the art and include, but are not limited to, temperature, pH, ionic strength and concentration of organic solvents such as, for example, formamide and dimethylsulfoxide. As known to those skilled in the art, the stringency of hybridization is increased through higher temperature and lower ionic strength and lower solvent concentrations.

With respect to stringency conditions for hybridization, it is known in the art that numerous equivalent conditions may be employed to establish a particular stringency by varying, for example, the following factors: the length and nature of the sequences, the base composition of the various sequences, concentrations of salts and other components of the hybridization solution, the presence or absence of blocking agents in the hybridization solutions (eg, dextran sulfate and polyethylene glycol), temperature and time parameters of the hybridization reaction, as well as varying washing conditions . Selection of a particular series of hybridization conditions is done following methods conventional in the art (see, for example, Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, (1989) Cold Spring Harbor, N.Y.). " Recombination " refers to a process of exchanging genetic information between two polynucleotides. For purposes of the present disclosure " homologous recombination (HR) " refers to the specialized form in which the exchange occurs, for example, during the repair of double strand breaks in cells. This process requires homology of the nucleotide sequence, uses a " donor " molecule " for shaping the repair of a " target molecule " (i.e., double stranded) and is known as " crossing-over " or " gene conversion in a short segment ", because it leads to the transfer of genetic information from the donor to the target. Without being bound by any particular theory, such transfer may involve correction of DNA mismatches of heteroduplexes that form between the broken target and the donor and / or " synthesis-dependent chain pairing " in which the donor is used to re-synthesize the genetic information that will become part of the target and / or related processes. Such specialized HR often results in a change in the sequence of the target molecule, so that part or all of the sequence of the donor polynucleotide is incorporated into the target polynucleotide. " Cleavage " refers to the breaking of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-chain cleavage and double-stranded cleavage are possible and double-stranded cleavage may occur as a result of two distinct single-stranded cleavage events. DNA cleavage can result in the production of blunt ends or cohesive ends. In certain embodiments, the fusion polypeptides are used for the targeted cleavage of double-stranded DNA.

A cleavage domain " comprises one or more polypeptide sequences which have catalytic activity for DNA cleavage. A cleavage domain may be contained within a single polypeptide chain or the cleavage activity may result from the combination of two (or more) polypeptides.

A " half cleavage domain " is a polypeptide sequence which together with a second (identical or different) polypeptide forms a complex with cleavage activity (e.g., double-stranded cleavage activity).

The terms " cleavage domain " and " half cleavage domain " include wild-type domains and portions or mutants of the cleavage domains or cleavage domains that maintain the ability to multimerize (e.g., dimerize) to form a functional cleavage domain. " Chromatin " is the nucleoprotein structure comprising the cellular genome. Cellular chromatin comprises nucleic acid, primarily DNA, and protein, including histones and non-histone chromosomal proteins. Most eukaryotic cellular chromatin exists in the form of nucleosomes, wherein a central nucleosome module comprises approximately 150 DNA base pairs associated with an octamer comprising two of each of the histones H2A, H2B, H3 and H4; and the binder DNA (of variable length depending on the organism) extends between the central modules of the nucleosome. The histone H1 molecule is generally associated with the ligand DNA. For purposes of the present disclosure, the term " " chromatin " is intended to encompass all types of cellular, prokaryotic and eukaryotic nucleoprotein. Cellular chromatin includes chromosomal and episomal chromatin.

A " chromosome " is a chromatin complex comprising all or a portion of the genome of a cell. The genome of a cell is often characterized by its karyotype, which is the set of all chromosomes comprising the genome of the cell. The genome of a cell may comprise one or more chromosomes.

An " epizome " is a replicating nucleic acid, nucleoprotein complex or other structure comprising a nucleic acid that is not part of the chromosomal karyotype of a cell. Examples of episomes include plasmids and certain viral genomes.

An " accessible region " is a site in the cellular chromatin where a target site present on the nucleic acid can be attached to an exogenous molecule that recognizes the target site. Without wishing to be bound by any particular theory, it is believed that an accessible region is one which is not included in a nucleosomal structure. The distinct structure of an accessible region can often be detected by its sensitivity to chemical and enzymatic probes, for example, nucleases.

A " target location " or " target sequence " is a nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule will bind, provided sufficient conditions exist for attachment. For example, the sequence 5'-GAATTC-3 'is a target site of the restriction endonuclease EcoRI.

An " exogenous " is a molecule which is not normally present in a cell but which can be introduced into a cell through one or more genetic, biochemical or other methods. &Quot; normal cell presence " is determined relative to the stage of the particular development and environmental conditions of the cell. Thus, for example, a molecule which is present only during the embryonic development of the muscle is a molecule exogenous to an adult muscle cell. Similarly, a heat shock-induced molecule is a molecule exogenous to a cell not exposed to thermal shock. An exogenous molecule may comprise, for example, a functional version of an endogenous molecule that is not functional or a malfunctioning version of an endogenous normally functioning molecule.

An exogenous molecule may be, among other things, a small molecule, such as those generated by a combinatorial chemistry or macromolecule such as a protein, nucleic acid, sugar, lipid, glycoprotein, lipoprotein, polysaccharide, any modified derivative of the molecules behind or any complex comprising one or more of the above molecules. Nucleic acids include DNA or RNA, may be single or double-stranded; can be linear, branched or circular; and may have any length. Nucleic acids include those capable of forming double helices, as well as nucleic acids capable of forming triple helices. See, for example, U.S. Pat. 5,176,996 and 5,422,251. Proteins include, but are not limited to, DNA binding proteins, transcription factors, chromatin remodeling factors, methylated DNA binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, integrins, recombines -syles, ligases, topiosomes, gyroses and helicases.

An exogenous molecule may be of the same type as an endogenous molecule, e.g., an exogenous nucleic acid or protein. For example, an exogenous nucleic acid may comprise an infectious viral genome, an Agrobacterium tumefaciens T-chain, a plasmid or episomal introduced into a cell or a chromosome that is not normally present in the cell. Exogenous nucleic acids or polynucleotides may, however, have sequences that are homologous or identical to endogenous sequences. Relative to a particular endogenous genomic region, an " exogenous sequence " refers to a nucleotide sequence that is not present in that region. Such an exogenous sequence may be present at another endogenous chromosomal location or may not be present at another endogenous chromosomal location or may not be entirely present in the genome. Thus, an exogenous polynucleotide may contain exogenous and endogenous sequences: for example, a transgene flanked by homologous sequences of a genomic region. Such exogenous nucleic acids are used in methods of directed integration and directed recombination as described infra. Methods for introducing exogenous molecules into cells are known in the art and include, but are not limited to, lipid mediated transfer (ie liposomes including neutral and cationic lipids), electroporation, direct injection, cell fusion, bombardment particle size distribution, calcium phosphate co-precipitation, DEAE-dextran mediated transfer, and viral vector mediated transfer.

On the contrary, an " endogenous " is one which is normally present in a particular cell at a particular stage of development under particular environmental conditions. For example, an endogenous nucleic acid may comprise a chromosome, the genome of a mitochondria, chloroplast or other organelle, or a natural episomal-like nucleic acid. Other endogenous molecules may include proteins, for example, transcription factors and enzymes.

A " fusion " is a molecule in which two or more subunit molecules are attached, for example, covalently. The subunit molecules may be of the same chemical type of molecule or may be of different chemical types. Examples of the first type of fusion molecule include, but are not limited to, fusion proteins (for example, a fusion between a DNA binding domain ZFP and a cleavage domain) and fusion nucleic acids (e.g. nucleic acid encoding the fusion protein described supra). Examples of the second type of fusion molecule include, but are not limited to, a fusion between a triple helix nucleic acid and a polypeptide and a fusion between a minor sulcus ligand and a nucleic acid. Expression of a fusion protein in a cell can result from delivery of the fusion protein to the cell or delivery of a polynucleotide encoding the fusion protein to a cell, wherein the polynucleotide is transcribed and the transcript is translated, to generate the protein of fusion. Trans-splicing, polypeptide cleavage and polypeptide binding may also be involved in the expression of a protein in a cell. Methods for delivery of polynucleotides and polypeptides to cells are shown elsewhere in this disclosure.

A " gene " for purposes of the present disclosure, includes a DNA region encoding a gene product (see below), as well as all regions of DNA that regulate the production of the gene product, whether or not those regulatory sequences are adjacent to the coding sequences and / or transcribed. Thus, a gene includes, but is not necessarily limited to, sequences of promoters, terminators, translation regulatory sequences, such as ribosome binding sites and internal ribosome entry sites, stimulators, silencers, isolators, flanking elements, replication, matrix binding sites, and locus control regions. " Gene Expression " refers to the conversion of the information contained in a gene into a gene product. A gene product may be the product of the direct transcription of a gene (eg, mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any other type of RNAs that are modified by processes such as capping, adenylation, methylation and editing, and modified proteins by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristoylation and glycosylation. " Modulation of gene expression " refers to a change in the activity of The expression modulation may include, but is not limited to, gene activation and gene repression. " Plant cells " include, but are not limited to, monocotyledonous or dicot cells. Non-limiting examples of monocots include cereal plants such as corn, rice, barley, oats, sorghum, rye, sugarcane, pineapple, onion, banana and coconut. ts include tobacco, tomato, sunflower, cotton, sugar beet, potato, lettuce, melon, soybean, canola and alfalfa. The plant cells may be from any part of the plant and / or from any stage of the development of the plant.

A " region of interest " is any region of the cellular chromatin, such as, for example, a gene or non-coding sequence within or adjacent to a gene, where it is desirable to link an exogenous molecule. Binding may be for purposes of directed DNA cleavage and / or targeting. A region of interest may, for example, be present on a chromosome, episomal, organelle genome (e.g., mitochondria, chloroplast) or infectious viral genome. A region of interest may be within the coding region of a gene within non-coding transcripts such as, for example, leader sequences, tow sequences or introns, or within non-transcribed regions, upstream or downstream of the coding region . One region of interest may be as small as one nucleotide pair or have up to 25,000 nucleotide pairs in length or any integer value of nucleotide pairs.

The terms " operative link " and " operably linked " (or " operatively linked ") are used interchangeably referring to a juxtaposition of two or more components (such as elements of a sequence) wherein the components are arranged so that both components function normally and allow the possibility of at least least one of the components may mediate a function which is exerted on at least one of the other components. By way of illustration, a transcriptional regulatory sequence, such as a promoter, is operably linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcription regulatory factors . A transcriptional regulatory sequence is generally operably linked in cis to a coding sequence, but need not be adjacent thereto. For example, a stimulator is a transcriptional regulatory sequence that is operably linked to a coding sequence, even though it is not contiguous.

With respect to the fusion polypeptides, the term " operably linked " may refer to the fact that each of the components perform the same function when connected to the other component it would have if it were not connected. For example, with respect to a fusion polypeptide in which a DNA binding domain ZFP is fused to a cleavage domain, the DNA binding domain ZFP and the cleavage domain are operably linked if, in a fusion polypeptide, the of the DNA binding domain ZFP is capable of binding to its target site and / or binding site, while the cleavage domain is capable of cleaving the DNA in the vicinity of the target site.

A " functional fragment " of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to the full-length protein or nucleic acid, while still maintaining the same function as the full-length protein, polypeptide or nucleic acid. A functional fragment may have more, less or the same number of residues of the corresponding native molecule and / or may contain one or more amino acid or nucleotide substitutions. Methods for determining the function of a nucleic acid (e.g., coding function, ability to hybridize to another nucleic acid) are known in the art. Similarly, methods for determining the function of the protein are well known. For example, the DNA binding function of a polypeptide can be determined, for example, by binding to filters, altering electrophoretic motility or immunoprecipitation assays. DNA cleavage can be tested by gel electrophoresis. See Ausubel et al., Supra. The ability of a protein to interact with another protein can be determined, for example, by co-immunoprecipitation, double hybrid assays or complementation, both genetic and biochemical. See, for example, Fields et al. (1989) Nature 340: 245-246; U.S. Patent No. 5,585,245 and PCT WO 98/44350.

Zinc Finger Binding Domains Non-canon finger zinc binding domains and polynucleotides encoding these zinc finger binding domains are described herein. Non-canonical zinc finger binding domains, which are zinc fingers C3H, are described herein, wherein one of the two conserved histidine residues from the coordination of zinc is converted to cysteine. In further embodiments, the more C-terminal histidine residue is converted to a cysteine residue, yielding a " CCHC protein ".

A zinc finger binding domain may comprise one or more zinc fingers (eg, 2, 3, 4, 5, 6, 7, 8, 9 or more zinc fingers) and may be manipulated to bind to any target sequence (eg a genomic sequence). The zinc finger binding domains may bind to DNA, RNA and / or protein. Typically, a zinc finger domain is about 30 amino acids in length. Zinc fingers include canonical zinc fingers C2H2 (ie, those in which the zinc ion is coordinated by two cysteine residues and two histidine residues) and noncanonic zinc fingers including, for example, C3H zinc fingers (those in that the zinc ion is coordinated by three cysteine residues and one histidine residue). See also U.S. Patent Applications Nos. 20030108880, 20060246567 and 20060246588.

Structural studies have demonstrated that a canonical zinc finger domain has two beta sheets (maintained on a beta turn containing the two invariant cysteine residues) and an alpha helix (containing the two invariant histidine residues), which are maintained in a particular conformation through the coordination of a zinc atom by the two cysteines and the two histidines. The non-canonical zinc fingers described herein maintain this beta-beta-alpha structure.

The non-canonical zinc fingers described herein may be natural zinc finger binding domains. However, more typically, noncanonic zinc fingers as described herein include one or more zinc finger components wherein at least one of the cysteine or histidine residues of the zinc coordination has been substituted with one or more amino acids. For example, in certain embodiments, the C-terminal His residue of a canonical zinc finger attachment module is substituted with a Cys residue.

The CCHC zinc fingers described herein may also comprise one or more changes (relative to the sequence of a natural C2H2 zinc finger) in the sequence of amino acid residues other than the coordinating zinc residues. Such changes may comprise substitutions, deletions and / or insertions. Amino acids can be changed anywhere on the zinc finger. Non-limiting examples of changes include: (1) isolated residue substitutions surrounding the altered zinc coordination residue; (2) addition of extra residues before or after the altered zinc coordination residue, (eg, in cases where the His plus C-terminal residue is converted to Cys, the addition of extra amino acid residues may facilitate coordination of zinc by compensating for the shorter side chain of the cysteine and / or (3) residues replacements located between the His and Cys residues of a natural CCHC zinc finger in the corresponding region of a non-canonical CCHC zinc finger.

The zinc finger proteins described herein may include at least one zinc finger comprising a non-canonical zinc finger (not C2H2), wherein the noncanonical zinc finger has a helical portion involved in DNA binding and wherein the region of the coordination of the zinc of the helical portion comprises the amino acid sequence HX1X2RCXL (SEQ ID NO: 2); and wherein the zinc finger protein is engineered to bind to a target sequence. X 1 may be A or K or T; X 2 may be Q or E or R; and XL may be G.

Alternatively, the non-canine zinc fingers described herein may have the general structure: Cys- (Xa) 2-4-Cys- (XB) 1-2-His- (Xc) 3-5-Cys- (X D) 1-10 (SEQ ID NO: 3), where Xa, Xb, Xc and XD represent any amino acid. In case Xc comprises 3 residues (i) at least one of these residues is altered compared to a canonical zinc finger CCHH; and / or (ii) XD comprises at least one deletion, substitution or insertion as compared to a canonical zinc finger CCHH. XD may comprise the QLV or QKP sequence. Alternatively, XD may comprise one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) Gly residues (G). The partial amino acid sequence (including the C-terminal end relative to the 3rd zinc coordination residue) of non-canonical zinc finger examples is set forth in Tables 1, 2, 3 and 4 below. In all Tables, the two more C-terminal (i.e., third and fourth) zinc coordination residues (H and C) are underlined. The changes (e.g., substitutions, insertions, deletions) as compared to the non-canonical "wild" finger sequence " (line 2 of Tables 1 and 3) are presented with double underscore.

Table 1

(continuation)

Table 2

(continuation)

(continuation)

Table 3

Table 4

As noted above, a ZFP may include any number of zinc finger binding domains, for example at least 3 zinc fingers. Yet, one, more than one, or all of the zinc fingers may be noncanonic zinc fingers as described herein. The most C-terminal finger of a zinc finger multiplier protein may comprise a canonical zinc finger. As an alternative, the more C-terminal finger of a zinc finger multiple protein may comprise a CCHC zinc finger as described herein, for example a CCHC finger comprising one or more C-terminal amino acid insertions relative to the Cys coordinating residue of zinc plus C-terminal. See examples 1-5 describing 4 finger zinc proteins wherein finger 2 (F2) and / or finger 4 (F4) are non-canonical zinc fingers as described herein.

Zinc finger binding domains can be manipulated to bind to a selected sequence. See, for example, Beerli et al. (2002) Nature Biotechnol. 20: 135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70: 313-340; Isalan et al. (2001) Nature Biotechnol. 19: 656-660; Segai et al. (2001) Curr. Opin. Biotechnol. 12: 632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10: 411-416. A manipulated zinc finger domain may have a novel binding specificity compared to a natural zinc finger protein. Methods of manipulation include, but are not limited to, rational design and various types of selection (e.g., methods wherein a plurality of different zinc finger sequences are tested against a single target nucleotide sequence). The rational design includes, for example, the use of databases comprising triplet (or quadrupole) sequences and individual zinc finger amino acid sequences, wherein each nucleotide sequence of the triplet or quadrupole is associated with one or more sequences of amino acids of zinc fingers. See, for example, U.S. Patents 6,453,242 and 6,534,261 in co-ownership. Additional drawing methods are described, for example, in U.S. Patents 6,746,838; 6,785,613; 6,866,997; and 7,030,215. Increased binding specificity for the zinc finger domains has been described, for example, in co-owned U.S. Patent No. 6,794,136.

Examples of selection methods, including phage display and double hybrid systems, are described in U.S. Patent Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as in WO 98/37186; WO 98/53057; WO 00/27878; WO 01/88197 and GB 2,338,237.

Since the individual zinc fingers bind to a sequence of three nucleotides (ie triplet) (or to a four nucleotide sequence that can overlap, at a nucleotide, with the four nucleotide binding site of the zinc finger adjacent), the length of a sequence in which a zinc finger binding domain has been manipulated to bind (eg, to a target sequence) will determine the number of zinc fingers in a manipulated zinc finger binding domain. For example for ZFPs where finger zinc motifs do not bind to overlapping sublocals, a six nucleotide target sequence binds to a two finger binding domain; a nine nucleotide target sequence binds to a three finger binding domain, etc. Individual (ie, sublocal) zinc finger binding sites at a target site need not be contiguous, and may be separated by one or more nucleotides, depending on the length and nature of the amino acid sequences between the zinc fingers (ie, between fingers) in a multiple finger binding domain. See, for example, U.S. Patents 6,479,626; 6,903,185 and 7,153,949 and U.S. Patent Application Publication No. 2003/0119023.

In a zinc finger multiplexing domain, the adjacent zinc fingers may be separated by amino acid linker sequences of approximately 5 amino acids (so-called " canonical " interleaver binders) or, alternatively, by one or more binders not canonical. See, e.g., U.S. Patents 6,453,242 and 6,534,261 in co-ownership. For manipulated zinc finger binding domains comprising more than three fingers, insertion of longer (" non-canonical ") inter-finger ligand sequences between some of the zinc fingers may increase the affinity and / or specificity of the binding through connection domain. See for example, U.S. Patent No. 6,479,626 U.S. Patent Application Publication No. 2003/0119023. Thus, multiple finger zinc binding domains can also be characterized with respect to the presence and location of non-canon inter-finger ligands. The use of longer interfinger ligands may also facilitate attachment of a zinc finger protein to target sites comprising noncontiguous nucleotides. As a result, one or more sublocals at a target site for a zinc finger domain may be separated from each other by 1, 2, 3, 4, 5 or more nucleotides. By way of example only, a four finger binding domain can bind to a 13 nucleotide target site comprising sequentially two contiguous 3 nucleotide sublocals, one gap nucleotide and two contiguous triplet sublocals.

A target sublocal is a nucleotide sequence (generally 3 or 4 nucleotides) that is bound by a single finger of zinc. However, a target site need not be a multiple of three nucleotides. For example, in instances where chain interactions occur (see, e.g., U.S. Patents 6,453,242 and 6,794,136), one or more of the individual zinc fingers of a multiple finger zinc binding domain may attach to overlapping quadrupole sublocals. See also U.S. Patents 6,746,838 and 6,866,997. To mention only one example, a three finger domain can bind to a 10 nucleotide target site comprising three overlapping 4 nucleotide sublocals. Selection of a sequence in the cellular chromatin for binding by a zinc finger domain (e.g., a target site) may be achieved, for example, according to the methods described in U.S. 6,453,242 co-ownership (Sept. 17, 2002), which also discloses methods for the design of ZFPs to bind to a selected sequence. It will be clear to those of skill in the art that simple visual inspection of a nucleotide sequence may also be used for the selection of a target site. Thus, any means for selecting a target site can be used in the methods described herein.

The zinc multiple finger proteins can be constructed by bonding the individual zinc fingers obtained, for example by drawing or selection. Alternatively, the linker modules consisting of two zinc fingers may be attached to each other using canonical linkers or longer non-canonical linkers (see above) to generate four to six-finger proteins. Such two-finger modules can be obtained, for example, by selecting two adjacent fingers, which bind to a particular target sequence of six nucleotides, in the context of a multi-fingered protein (generally three fingers). See for example, WO 98/53057 and U.S. Patent Application Publication No. 2003/0119023. Alternatively, two-finger modules can be constructed through the individual zinc finger assembly.

Thus, the individual zinc finger domains described herein can be used individually, or in various combinations, to construct multiple zinc finger proteins that can bind to any target site. The distance between sequences (e.g., target sites) refers to the number of nucleotides or nucleotide pairs in the range between two sequences, measured from the ends of the sequences closest to each other.

In the case of use of ZFNs, for example where cleavage depends on the binding of two finger zinc domains / cleavage domain media to separate target sites, the two target sites may be opposite DNA strands. In other cases, both target sites are in the same chain. See for example, WO 2005/084190. Also described are polynucleotides encoding zinc fingers or zinc finger proteins. These polynucleotides can be constructed using standard techniques and inserted into a vector and the vector can be introduced into a cell (see below for further vectors relating to the disclosure and methods for introducing polynucleotides into cells) such that the encoded protein is expressed in the cell.

Fusion proteins Also provided are fusion proteins comprising one or more non-canonical zinc finger components described herein and one or more functional domains, wherein the functional domain comprises a cleavage half domain as claimed.

The fusion molecules are constructed by biochemical cloning and conjugation methods well known in the art. The fusion molecules comprise a CCHC-containing ZFP and, for example, a cleavage domain, a transcription activation domain, a transcription repression domain, a chromatin remodeling complex component, an isolator domain, a functional fragment of any of these domains; and / or any combinations of two or more functional domains or fragments thereof.

The fusion molecules may comprise a zinc finger-modified plant protein and at least two functional domains (e.g., an isolator domain or a methyl-binding protein domain and also a transcriptional activation or repression domain).

The fusion molecules also optionally comprise a nuclear localization signal (such as, for example, FLAG or hemagglutinin). The fusion proteins (and nucleic acids encoding them) are designed so that the translated reading frame is preserved among the components of the fusion. Methods for the design and construction of fusion proteins (and polynucleotides encoding the same) are known to those skilled in the art. For example, methods for designing and constructing the fusion protein comprising zinc finger proteins (and polynucleotides encoding the same) are described in U.S. Patents 6,453,242 and 6,534,261 in co-ownership.

Polynucleotides encoding such fusion proteins are also within the scope of the present disclosure. These polynucleotides can be constructed using standard techniques and inserted into a vector and the vector can be introduced into a cell (see below for further disclosure concerning vectors and methods for introducing polynucleotides into cells).

An example of a functional domain for fusion with a DNA binding domain ZFP to be used for repression of gene expression is a KRAB repression domain of the human KOX-1 protein (see, eg, Thiesen et al., New Biologist 2, 363-374 (1990); Margolin et al., Proc Natl.

Acad. Know. USA 91, 4509-4513 (1994); Pengue et al., Nucl.

Acids Res. 22: 2908-2914 (1994); Witzgall et al., Proc.

Natl. Acad. Know. USA 91, 4514-4518 (1994). The KOX domain is also suitable for use as a repression domain. Another suitable domain of repression is the methyl-binding domain of protein 2B (MBD-2B) (see also Hendrich et al. (1999) Mamm Genome 10: 906-912 for description of MBD proteins). Another useful repression domain is that associated with the v-ErbA protein. See, for example, Damm, et al. (1989) Nature 339: 593-597; Evans (1989) Int. J. Cancer Suppl. 4: 26-28; Pain et al. (1990) New Biol. 2: 284-294; Sap et al. (1989) Nature 340: 242-244; Zenke et al. (1988) Cell 52: 107-119; and Zenke et al. (1990) Cell 61: 1035-1049. Other examples of repression domains include, but are not limited to, thyroid hormone receptor (TR), SID, MB D1, MBD2, MBD3, MBD4, MBD-like proteins, members of the DNMT family (eg, DNMT1, DNMT3A, DNMT3B ), Rb, MeCPl and MeCP2. See, for example, Zhang et al. (2000) Ann Rev Physiol 62: 439-466; Bird et al. (1999) Cell 99: 451-454; Tyler et al. (1999) Cell 99: 443-446; Knoepfler et al. (1999) Cell 99: 447-450; and Robertson et al. (2000) Nature Genet. 25: 338-342. Other exemplary repressive domains include, but are not limited to, ROM2 and AtHD2A. See, for example, Chern et al. (1996) Plant Cell 8: 305-321; and Wu et al. (2000) Plant J. 22: 19-27.

Suitable domains for achieving activation include the activation domain of HSV VP16 (see, eg, Hagmann et al., J. Virol., 71, 5952-5962 (1997)), hormone receptors (see, eg, Torchia et al , Curr. Opin Cell Biol. 10: 373-383 (1998)); the p65 subunit of kappa nuclear factor B (Bitko & Bank, J. Virol., 72: 5610-5618 (1998) and Doyle & Hunt, Neuroreport 8: 2937-2942 (1997)); Liu et al., Cancer Gene Ther. 5: 3-28 (1998)), or artificial chimeric functional domains such as VP64 (Seifpal et al., EMBO J. 11, 4961-4968 (1992)).

Other examples of activation domains include, but are not limited to, p300, CBP, PCAF, SRC1 PvALF, and ERF-2. See, for example, Robyr et al. (2000) J Mol. Endocrinol. 14: 329-347; Collingwood et al. (1999) J. Mol. Endocrinol. 23: 255-275; Leo et al. (2000) Gene 245: 1-11; Manteuffel-Cymborowska (1999) Acta Biochim. Pol. 46: 77-89; McKenna et al. (1999) J. Steroid Biochem. Mol Biol. 69: 3-12; Malik et al. (2000) Trends Biochem. ScL 25: 277-283; and Lemon et al. (1999) Curr. Opin. Genet. Dev. 9: 499-504. Other examples of activation domains include, but are not limited to, OsGAI, HALF-I, Cl, API, ARF-5, -6, -7, and -8, CPRF1, CPRF4, MYC-RP / GP, and TRAB1 . See, for example, Ogawa et al. (2000) Gene 245: 21-29; Okanami et al. (1996) Genes Cells 1: 87-99; Goff et al (1991) Genes Dev. 5: 298-309; Cho et al. (1999) Plant Mol. Biol. 40: 419-429; Ulmason et al. (1999) Proc. Natl. Acad. Know. USA 96: 5844-5849; Sprenger-Haussels et al. (2000) Plant J. 22: 1-8; Gong et al. (1999) Plant Mol. Biol. 41: 33-44; and Hobo et al. (1999) Proc. Natl. Acad. Sci. USA 96: 15,348-15,353.

Other functional domains are described, for example, in U.S. Patent No. 6,933,113 in co-ownership. In addition, isolator domains, chromatin remodeling proteins such as ISWI-containing domains and proteins with methyl-binding domains suitable for use in the fusion molecules are described, for example, in International Publication Nos. WO 01/83793 and WO 02/26960 in co-ownership.

Alternatively, the fusion proteins of the invention are zinc finger nucleases (ZFN) comprising one or more zinc fingers CCHC as described herein and a cleavage domain (or cleavage half domain). Zinc fingers can be manipulated to recognize a target sequence in any selected genomic region and, when introduced into a cell, will result in binding of the fusion proteins to their binding and cleavage sites within or near said genomic region. Such cleavage may result in alteration of the nucleotide sequence of the genomic region (e.g., mutation) after non-homologous binding of ends. Alternatively, if sequences containing exogenous polynucleotides homologous to the genomic region are also present in the cell, homologous recombination occurs at a high rate between the genomic region and the exogenous polynucleotide following ZFN-directed cleavage. Homologous recombination may result in directed substitution of the sequence or in targeted integration of exogenous sequences, depending on the nucleotide sequence of the exogenous poly-nucleotide.

The non-canonical zinc fingers described herein provide better cleavage function when incorporated into ZFNs. As described in the Examples, 4-finger ZFNs containing at least one CCHC finger as described herein cut at least as well as nucleases containing exclusively CCHH fingers. In some embodiments, when the C-terminal finger comprises a non-canonical CCHC zinc finger, the residues between the third and fourth coordination residues (ie, between the C-terminal His and Cys residues) are different from those present on a canonical zinc finger CCHH residue and one or more glycine residues (eg, 1, 2, 3, 4, 5 or more) are inserted prior to the C-terminal Cys residue. The portion of the cleavage domain of the ZFNs described herein can be obtained from either endonuclease or exonuclease. Examples of endonucleases from which a cleavage domain may be derived include, but are not limited to, restriction endonucleases and maintenance endonucleases. See, for example, 2002-2003 Catalog, New England Biolabs, Beverly, MA; and Belfort et al. (1997) Nucleic Acids Res. 25: 3379-3388. Other enzymes that cleave the DNA (eg, nuclease S1, bean nuclease, pancreatic DNAse I, micrococyte nuclease, yeast endonuclease, see also Linn et al. (Eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993 ). One or more of these enzymes (or functional fragments thereof) can be used as a source of cleavage domains and cleavage half-domains.

Similarly, a cleavage half domain can be derived from any nuclease or portion thereof, as described above, provided that the cleavage half domain requires dimerization for cleavage activity. In general, two fusion proteins are required for the targeted cleavage of genomic DNA if the fusion proteins comprise half-domains of cleavage. Alternatively, a single protein comprising two half-cleavage domains may be used. The two half-cleavage domains may derive from the same endonuclease or each cleavage half-domain may derive from a different endonuclease. In addition, the target sites for the two fusion proteins are arranged relative to one another so that the binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation relative to each other, which allows the cleavage half-domains to form a functional cleavage domain, eg, by dimerization. Thus, in certain embodiments, the ends closest to the target sites are separated by 5-8 nucleotide pairs or by 15-18 nucleotide pairs. However, any integer number of nucleotides or nucleotide pairs may be between two target sites (e.g., 2 to 50 nucleotides or more). In general, the cleavage point lies between the target sites.

Restriction endonucleases (restriction enzymes) are present in many species and are capable of binding to sequence specific DNA (at a recognition site) and DNA cleavage at or near the binding site. Some restriction enzymes (e.g., type IIS) cut the DNA at sites other than those at the recognition site and have separable binding and cleavage domains. For example, the IIS Fokl Type enzyme catalyzes the cleavage of the double strand of DNA, spacing 9 nucleotides from its recognition site into one strand and 13 nucleotides from its recognition site at the other. See, for example, U.S. Patents 5,356,802; 5,436,150 and 5,487,994; as well as Li et al. (1992) Proc. Natl. Acad. Know. USA 89: 4275-4279; Li et al. (1993) Proc. Natl. Acad. Know. USA 90: 2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Know. USA 91: 883-887; Kim et al. (1994b) J. Biol. Chem. 269: 31978-31,982. Thus, in one embodiment, the fusion proteins comprise the cleavage (or semi-cleavage domain) domain of at least one IIS restriction enzyme and one or more zinc finger binding domains, which may or may not be manipulated .

An example of an IIS restriction enzyme whose cleavage domain is separable from the binding domain is Fok1. This particular enzyme is active as a dimer. Bitinaite et al. (1998) Proc. Natl. Acad. Know. USA 95: 10570-10575. Thus, for purposes of the present invention, the portion of the Fokl enzyme used in the described fusion proteins is considered a cleavage half domain. Thus, for directed double-stranded cleavage and / or directed substitution of cellular sequences using ZFNs comprising zinc-Fokl finger fusions, two fusion proteins, each comprising a Fokl cleavage half domain, may be used to reconstitute a catalytically active cleavage domain. Alternatively, an isolated polypeptide molecule containing a zinc finger binding domain and two Fokl cleavage half-domains may also be used. Parameters for directed cleavage and target sequence alteration using Fok-zinc finger fusions are provided some in this disclosure and, for example, in U.S. Patent Application Publication No. 2005/0064474.

Alternatively, a Fok1 cleavage half domain may include one or more mutations at any amino acid residue that affects dimerization. Such mutations may be useful to prevent a pair of ZFP / Fokl fusions from undergoing homodimerization which may lead to the cleavage of undesirable sequences. For example, amino acid residues at positions 446, 447, 473, 484, 486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537 and 538 of Fokl are all very close to the interface of dimerization to influence it. Thus, alterations of the amino acid sequence at one or more of the above positions can be used to alter the dimerization properties of the cleavage half domain. Such changes may be introduced, for example, by constructing a library containing (or encoding) different amino acid residues at these positions and selecting variants with the desired properties or by rationally designing individual mutants. In addition to the prevention of homodimerization, it is also possible that some of these mutations may increase the cleavage efficiency, as compared to that obtained with two wild-type cleavage domains.

Thus, for targeted cleavage using a pair of ZFP / Fokl fusions, one or both of the fusion proteins may comprise one or more amino acid changes that inhibit self-dimerization but allow heterodimerization of the two fusion proteins to occur cleavage occurs at the intended target site. In certain embodiments, the changes are present in both fusion proteins and the changes have additive effects; i.e. homodimerization of any of the fusions, leading to aberrant cleavage, is minimized or abolished, whereas heterodimerization of the two fusion proteins is facilitated comparatively with that obtained with wild-type cleavage semi-domains. The cleavage domain may comprise two cleavage half-domains, both being part of a single polypeptide comprising a binding domain, a first cleavage half domain, and a second cleavage half domain. The cleavage half domains may have the same amino acid sequence or different amino acid sequences as long as they function to cut the DNA.

The cleavage half-domains may be provided in separate molecules. For example, two fusion polypeptides may be expressed in a cell, wherein each of the polypeptides comprises a binding domain and a cleavage half domain. The cleavage half domains may have the same amino acid sequence or different amino acid sequences as long as they function to cut the DNA. In addition, the binding domains bind to target sequences which are typically arranged such that, upon attachment of the fusion polypeptides, the two cleavage half domains are presented in spatial orientation relative to each other so as to allow the reconstitution of a cleavage domain (eg, through the dimerization of the half-domains), thereby positioning the half-domains relative to each other to form a functional cleavage domain, resulting in the cleavage of the cellular chromatin in a region of interest. In general, cleavage by the reconstituted cleavage domain occurs at a location between the two target sequences. One or both of the proteins may be manipulated to bind to their target site. Expression of two fusion proteins in a cell can result from the delivery of the two proteins in the cell; the delivery of a protein and a nucleic acid encoding one of the proteins in the cell; delivery of two nucleic acids, each encoding one of the proteins, into the cell; or by delivery of a single nucleic acid encoding both proteins to the cell. In other embodiments, a fusion protein comprises a single polypeptide chain comprising two cleavage half-domains and a zinc finger domain. In this case, a single fusion protein is expressed in a cell and, without being bound by a theory, is thought to cut DNA as a result of the formation of an intramolecular dimer of the cleavage half domains.

The components of a ZFN can be arranged arranged so that the zinc finger domain is closer to the amino terminus of the fusion protein and the cleavage half domain is closer to the carboxyl terminus. This mirrors the relative orientation of the cleavage domain in natural dimerization cleavage domains such as those derived from the Fok1 enzyme in which a DNA binding domain is closer to the amino terminus and the cleavage half domain is closer to the carboxyl. In these embodiments, the dimerization of the cleavage half domains to form a functional nuclease is achieved by binding the fusion proteins to sites in opposing DNA strands with the 5 'ends of the proximal binding sites relative to each other.

In this orientation, the most C-terminal zinc finger is proximal relative to the Fokl cleavage half domain. It has previously been determined that non-canonical zinc finger proteins bind to their DNA targets more efficiently when a CCHC-like zinc finger is present as the most C-terminal zinc finger. It is therefore possible that the presence of previously described CCHC-like zinc fingers in the vicinity of the Fokl cleavage half domain inhibits their function. If this is the case, the optimized CCHC zinc fingers, presently described, apparently do not exhibit this postulated inhibitory activity.

Alternatively, the components of the fusion proteins (eg, ZFP-Fokl fusions) are arranged so that the cleavage half domain is closer to the amino terminus of the fusion protein and the zinc finger domain is closer to the carboxyl terminus . In these embodiments, the dimerization of the cleavage half-domains to form a functional nuclease is achieved by binding the fusion proteins to sites in opposite DNA strands, with the 3 'ends of the binding sites being proximal relative to each other.

Alternatively, a first fusion protein has the cleavage half domain closest to the amino terminus of the fusion protein and the zinc finger domain closest to the carboxy strand and a second fusion protein is arranged so that the finger domain of zinc is situated closer to the amino terminus of the fusion protein and the cleavage half domain is closer to the carboxyl terminus. In these cases, both fusion proteins bind to the same DNA strand with the binding site of the first zinc finger-containing fusion protein closest to the carboxyl terminus located on the 5 'side of the binding site of the second protein of the zinc finger domain containing the zinc finger domain closer to the amino terminus. See also 2005/084190. The amino acid sequence between the zinc finger domain and the cleavage domain (or cleavage half domain) is designated as " ZC linker ". The ZC linker should be distinguished from the inter-finger ligands discussed above. See, e.g., U.S. Patent Publications 20050064474A1 and 20030232410, and International Patent Publication WO 2005/084190, for details on obtaining ZC linkers that optimize cleavage.

Expression vectors

A nucleic acid encoding one or more ZFPs or fusion proteins with ZFPs (e.g., ZFNs) may be cloned into a vector for transformation of prokaryotic or eukaryotic cells for replication and / or expression. The vectors may be prokaryotic or eukaryotic vectors, including but not limited to plasmids, shuttle vectors, insect vectors, binary vectors (see, eg, U.S. Patent No. 4,940,838; Horsch et al. (1984) Science 233: 496 Et al. (1983) Proc. Natl Acad Sci USA 80: 4803) and the like. A nucleic acid encoding a ZFP may also be cloned into an expression vector, for administration to a plant cell.

In order to express the fusion proteins, ZFPs or ZFP fusion sequences are typically subcloned into an expression vector that has a promoter to direct transcription. Suitable bacterial and eukaryotic promoters are known in the art and described, e.g., in Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed., 1989, 3rd ed., 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Bacterial Expression Systems for ZFP expression are available for, eg, E. coli, Bacillus sp., and Salmonella (Paiva et al, Gene 22: 229-235 (1983), and Current Protocols in Molecular Biology (Ausubel et al., supra. ) There are commercial kits of such expression systems Eukaryotic expression systems for mammalian cells, yeast and insect cells are known in the art and can be purchased The promoter used to direct the expression of a nucleic acid encoding ZFP depends For example, a strong constitutive promoter suitable for the host cell is typically used for expression and purification of ZFPs.

In contrast, when a ZFP is administered in vivo for regulation of plant genes (see " Introduction of nucleic acid in plant cells " section below) a constitutive promoter or inducible promoter is used, depending on the particular use of ZFP. Non-limiting examples of plant promoters include promoter sequences derived from A. thaliana ubiquitin-3 (ubi-3) (Callis, et al., 1990, J. Biol. Chem. 265-12486-12493); mannopine-synthetase from A. tumefaciens (Amas) (Petolino et al., U.S. Patent No. 6,730,824); and / or cassava rib mosaic virus (CsVMV) (Verdaguer et al., 1996, Plant Molecular Biology 31: 1129-1139). See, also, Examples.

In addition to the promoter, the expression vector typically has a transcription unit or expression cassette which contains all the additional elements necessary for expression of the nucleic acid in host, prokaryotic or eukaryotic cells. Thus, a typical expression cassette contains a promoter operably linked, e.g., to a ZFP-encoding nucleic acid sequence and necessary signals, e.g., for efficient transcript polyadenylation, transcription termination, ribosome binding sites or translation termination. Other elements of the cassette may include, e.g., stimulators and " splicing " heterologous. The particular expression vector used to transport the genetic information to the cell is selected relative to the intended use for ZFP, e.g., expression in plants, animals, bacteria, fungi, protozoa, etc. (see expression vectors described below). In the art, conventional bacterial and animal expression vectors are known and are described in detail, for example, in U.S. Patent Publication No. 20050064474A1 and in International Patent Publications W005 / 084190, W005 / 014791 and W003 / 080809. Conventional transfection methods can be used to produce bacterial, mammalian, yeast or insect cell lines expressing large amounts of protein, which can then be purified using standard techniques (see, eg, Colley et al, J. Biol. Chem. 264: 17619-17622 (1989); Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher, ed., 1990)). The transformation of eukaryotic and prokaryotic cells is carried out according to conventional techniques (see, eg, Morrison, J. Bact., 132: 349-351 (1977), Clark-Curtiss & Curtiss, Methods in Enzymology 101: 347-362 Wu et al., Eds., 1983).

Any of the well known methods for introducing foreign nucleotide sequences into such host cells can be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, ultrasound methods), liposomes, microinjection, naked DNA, plasmid vectors, viral, episomal and integrative vectors, and any of the other known methods for introduction of genomic DNA, cDNA, synthetic DNA or other foreign material into a host cell (see, eg, Sambrook et al., supra). It is only necessary that the particular genetic procedure used is capable of successfully introducing at least one gene into the host cell capable of expressing the desired protein.

Introduction of nucleic acid in plant cells

As noted above, DNA constructs may be introduced to the desired plant host (e.g., into the genome) by a variety of conventional techniques. For reviews of such techniques see, for example, Weissbach & Weissbach Methods for Plant Molecular Biology (1988, Academic Press, N.Y.) Section VIII, pp. 421-463; and

Grierson & Corey, Plant Molecular Biology (1988, 2d Ed.), Blackie, London, Ch. 7-9.

For example, the DNA construct can be introduced into a plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or DNA constructs can be introduced directly into the plant tissue using biolistic methods, such as bombardment with DNA particles (see , eg, Klein et al (1987) Nature 327: 70-73). Alternatively, the DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional host vector of Agrobacterium tumefaciens. Transformation techniques mediated by Agrobacterium tumefaciens, including the removal of arms and the use of binary vectors, are well described in the scientific literature. See, for example, Horsch et al (1984) Science 233: 496-498, and Fraley et al (1983) Proc. Natl Acad. ScL USA 80: 4803.

In addition, gene transfer can be accomplished using non-Agrobacterium bacteria or viruses such as

Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhi-zobium loti, potato virus X, cauliflower mosaic virus and cassava rib mosaic virus and / or tobacco mosaic virus. See, e.g., Chung et al. (2006) Trends Plant Sci. 11 (1): 1-4.

The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and the adjacent tag into the DNA of the plant cell when the cell is infected by the bacteria using the B-DNA vector (Bevan (1984) Nuc. Acid Res. 12: 8711- 8721) or the co-culture procedure (Horsch et al (1985) Science 227: 1229-1231). In general, the Agrobacterium transformation system is used for the manipulation of dicotyledonous plants (Bevan et al (1992) Ann. Rev. Genet 16: 357-384; Rogers et al. (1986) Methods Enzymol. 641). The Agrobacterium transformation system can also be used to transform, as well as to transfer, DNA to monocotyledonous plants and plant cells. See U.S. Patent No. 5,591,616; Hernalsteen et al (1984) EMBO J 3: 3039-3041; Hooykass-Van Slogteren et al (1984) Nature 311: 763-764; Grimsley et al (1987) Nature 325: 1677-179; Boulton et al (1989) Plant Mol. Biol. 12: 31-40; and Gould et al (1991) Plant Physiol. 95: 426-434. Alternative methods of gene transfer and transformation include, but are not limited to, protoplast transformation through capture of calcium-mediated, polyethylene glycol (PEG) or electroporated DNA (see Paszkowski et al. (1984) EMBOJ 3: 2717 (1985) Proc. Nat. Acad. Sd., USA 82: 5824-5828; and Shimamoto (1989) Nature 338: 274-276) and electroporation of plant tissues (D'Halluin et al. (1992) Plant Cell 4: 1495-1505). Other methods for transforming plant cells include microinjection, silicon carbide-mediated DNA internalization (Kaeppler et al. (1990) Plant Cell Reporter 9: 415-418), and bombardment of microprojectiles (see Klein et al. 1988) Proc Nat Nat. Acad Sci USA 85: 4305-4309 and Gordon-Kamm et al. (1990) Plant Cell 2: 603-618).

The described methods and compositions may be used to insert exogenous sequences at a predetermined location into a plant cell genome. This is useful insofar as the expression of a transgene introduced into a plant genome depends critically on its site of integration. Thus, coding genes, e.g., of nutrients, antibiotics or therapeutic molecules can be inserted, by directed recombination, into regions of a plant genome favorable to expression thereof.

Transformed plant cells that are produced by any of the above transformation techniques can be cultured to regenerate a complete plant having the transformed genotype and thus the desired phenotype. Such regeneration techniques are based on the manipulation of certain phytohormones in a tissue culture medium, typically based on a biocidal and / or herbicidal marker that has been introduced along with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans, et al., &Quot; Protoplasts Isolation and Culture " in Handbook of Plant Cell Culture, pp. 124-176, Macmillian

Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Mouth

Raton, 1985. Regeneration may also be obtained from plant calli, explants, organs, pollen, embryos or parts thereof. Such regeneration techniques are generally described in Klee et al (1987) Ann. Rev. of Plant Phys. 38: 467-486.

Nucleic acids introduced into a plant cell can be used to impart desired characteristics in essentially any plant. A wide variety of plants and plant cell systems can be manipulated relative to the desired physiological and agronomic characteristics described herein using nucleic acid constructs of the present disclosure and the various transformation methods mentioned above. In certain embodiments, target plants and plant cells for manipulation include, but are not limited to, monocotyledonous and dicotyledonous plants, such as agricultural crops including cereal crops (eg wheat, corn, rice, millet, barley), fruit growing (eg, tomato, apple, pear, strawberry, orange), forage crops (eg alfalfa), tuber crops (eg, carrot, potato, sugar beet, yams), green vegetable crops (eg lettuce, spinach); floriculture plants (e.g., petunias, roses, chrysanthemums), conifers and pines (e.g., spruce, spruce); plants used in phyto-remediation (e.g., plants accumulating heavy metals); oleaginous crops (e.g., sunflower, rapeseed) and plants used for experimental purposes (e.g., Arabidopsis). Thus, the methods and compositions disclosed have utility in a wide range of plants, including, but not limited to, species of the genera Asparagus, Avena, Brassica, Citrus, Citrus, Capsicum, Cucurbita, Daucus, Glycine, Gossypium, Hordeum, Lactuca, Lycopersicon, Malus, Manihot, Nicotiana, Oryza, Persea, Pisum, Pyrus, Prunus, Raphanus, Secale, Solanum, Sorghum, Triticum, Vitis, Vigna and Zea.

Those familiar with the art will recognize that after the expression cassette is stably incorporated into transgenic plants and confirmed as operational, it can be introduced into other plants through sexual intercrossing. Any of a number of conventional crossing techniques may be used depending on the species to be crossed.

A plant cell, callus, tissue or transformed plant can be identified and isolated by selecting or screening the plant material for characteristics encoded by the marker genes present in the transforming DNA. For example, selection can be accomplished by growing the manipulated plant material in medium containing an antibiotic or herbicidal inhibitor amount to which the transforming gene construct confers resistance. In addition, transformed plant and plant cells can also be identified by screening the activities of any genes of visible tags (e.g., β-glucuronidase, luciferase, B or Cl genes) that may be present in the recombinant nucleic acid constructs. Such screening and screening methodologies are known to those skilled in the art. Physical and biochemical methods may also be used to identify plant and plant cell transformants containing constructs with inserted genes. These methods include, but are not limited to: 1) Southern analysis or PCR amplification for detection and determination of recombinant DNA insert structure; 2) Northern analysis, RNase I 1 protection, primer extension or reverse transcription-PCR amplification for detection and evaluation of RNA transcripts of the genetic constructs; 3) enzymatic assays for detecting enzymatic or ribozyme activity, whereby such gene products are encoded by the gene construct; 4) protein gel electrophoresis, Western blotting technique, immunoprecipitation or enzyme linked immunoassays, wherein the products of the genetic constructs are proteins. Other techniques such as in situ hybridization, enzymatic staining and immunostaining may also be used to detect the presence or expression of the recombinant construct in plant-specific organs and tissues. Methods for carrying out all of these assays are known in the art.

The effects of genetic manipulation using the methods described herein can be observed by, for example, Northern blots of RNA (e.g., mRNA) isolated from tissues of interest. Typically, if the amount of mRNA has increased, it can be assumed that the corresponding endogenous gene is being expressed at a rate higher than previously. Other methods of measuring gene and / or CYP74B activity may be used. Different types of enzymatic assays may be used, depending on the substrate used and the method of detecting the increase or decrease of a reaction product or by-product. In addition, expressed CYP74B gene and / or protein levels can be measured immunochemically, ie by ELISA, RIA, EIA, and other antibody-based assays known to those skilled in the art, such as electrophoretic detection assays (via staining or Western blotting ). The transgene may be selectively expressed in some tissues of the plant or in some stages of development or the transgene may be expressed in substantially all tissues of the plant, substantially throughout its life cycle. However, any mode of combinatorial expression is also applicable.

Also described are seeds of the transgenic plants described above wherein the seed has the transgene or gene construct. The present disclosure further encompasses the above-described progeny, clones, cell lines or cells of the transgenic plants wherein said progeny, clone, cell line or cell has the transgene or genetic construct. ZFPs and expression vectors encoding ZFPs can be administered directly in the plant for cleavage and / or targeted recombination. Administration of effective amounts occurs by any of the routes normally used for introducing ZFP in intimate contact with the plant cell to be treated. Suitable methods of administering such compositions are available and are known to those skilled in the art, and although more than one route may be used to administer a particular composition, one particular route may often offer a more immediate and more effective reaction than another.

Carriers may also be used and are determined in part by the composition to be administered, as well as by the particular method used to administer the composition. Thus, a variety of suitable formulations of pharmaceutical compositions are available (see, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1985)).

applications

Zinc finger proteins comprising one or more non-canonical zinc fingers as described herein are useful for whole genome regulation and editing applications for which canonical C2H2 ZFPs are commonly used, including but not limited to: gene activation; gene repression; genome editing (cleavage, directed insertion, substitution or deletion); and epigenomic editing (targeting histone or DNA covalent modifications). ZFNs comprising non-canonical zinc fingers as described herein may be used to cut out DNA in a region of interest in cellular chromatin (e.g., at a desired or predetermined site in a genome, for example in a mutant or wild-type gene). For such targeted DNA cleavage, a zinc finger binding domain is manipulated to bind to a target site at or near a predetermined cleavage site and a fusion protein comprising the manipulated zinc finger binding domain and a cleavage domain is expressed in a cell. Upon binding of the finger portion of the fusion protein to the target site, the DNA is cut near the target site through the cleavage domain. The exact location of the cleavage may depend on the length of the ZC linker.

Alternatively, two ZFNs, each comprising a zinc finger binding domain and a cleavage half domain, are expressed in a cell, and bind to target sites that are juxtaposed such that a functional cleavage domain is reconstituted DNA and the DNA cut in the vicinity of the target sites. In one embodiment, the cleavage occurs between the target sites of the two zinc finger binding domains. One or both of the zinc finger binding domains can be manipulated.

For cleavage directed using a zinc finger cleavage domain-domain cleavage polypeptide, the binding site may include the cleavage site or the proximal end of the binding site may be 1, 2, 3, 4, 5 , 6, 10, 25, 50 or more nucleotides (or any integer value between 1 and 50 nucleotides) of the cleavage site. The exact location of the binding site, relative to the cleavage site, will depend on the particular cleavage domain and the length of the ZC linker. For methods in which two fusion polypeptides, each comprising zinc finger binding domain and a cleavage half domain, are used, the binding sites generally encompass the cleavage site. Thus, the proximal end of the first binding site may be 1, 2, 3, 4, 5, 6, 10, 25 or more nucleotides (or any integer between 1 and 50 nucleotides) on one side of the binding site and the proximal portion of the second binding site may be 1, 2, 3, 4, 5, 6, 10, 25 or more nucleotides (or any integer between 1 and 50 nucleotides) on the other side of the cleavage site. Methods for mapping the cleavage sites in vitro and in vivo are known to those skilled in the art.

Once introduced or expressed in the target cell, the fusion protein binds to the target sequence and cuts into or near the target sequence. The exact location of the cleavage depends on the nature of the cleavage domain and / or the presence and / or nature of the linker sequences between the binding and cleavage domains. In cases where two ZFNs are used, each comprising a cleavage half-domain, the distance between the proximal ends of the binding sites may be 1, 2, 3, 4, 5, 6, 10, 25 or more nucleotides (or any integer between 1 and 50 nucleotides). Optimal cleavage levels may also depend on the distance between the binding sites of the two ZFNs (see, for example, Smith et al. (2000) Nucleic Acids Res. 28: 3361-3369; Bibikova et al. (2001) Mol. Cell Biol. 21: 289-297) and the length of the ZC linker in each ZFN. See also, U.S. Patent Publication 20050064474A1 and International Patent Publications W005 / 084190, W005 / 014791 and W003 / 080809.

Two ZFNs, each comprising a cleavage half-domain, may bind to the region of interest in the same polarity or opposite polarity and their binding sites (ie, target sites) may be separated by any number of nucleotides, eg, between 0 and 50 nucleotide pairs or any intermediate integer value. In certain embodiments, the binding sites for two fusion proteins, each comprising a zinc finger binding domain and a cleavage half domain, may be separated between 5 and 18 nucleotide pairs, for example, 5-8 pairs nucleotides or 15-18 nucleotide pairs or 6 nucleotide pairs or 16 nucleotide pairs or within 10 nucleotide pairs of each other, measured between the ends of each binding site closest to the other binding site and the cleavage occurs between the binding sites. The location where the DNA is cut generally lies between the binding sites for the two fusion proteins. DNA double strand breakage often results from two single-stranded cuts or " nicks ", separated by 1, 2, 3, 4, 5, 6 or more nucleotides, (for example, Fokl double-stranded DNA cleavage native results from single-stranded cuts separated by 4 nucleotides). Thus, cleavage does not necessarily occur at exactly opposite sites in each DNA strand. In addition, the structure of the fusion proteins and the distance between target sites may influence whether cleavage occurs adjacent to a single nucleotide pair or whether cleavage occurs at multiple sites. However, for many applications, including targeted recombination and site-directed mutagenesis, cleavage within a range of nucleotides is generally sufficient and cleavage between particular base pairs is not required.

As noted above, one or more fusion proteins may be expressed in a cell upon introduction into the cell of polypeptides and / or polynucleotides. For example, two polynucleotides, each comprising sequences encoding one of the aforementioned polypeptides, may be introduced into a cell and when the polypeptides are expressed and each of them binds to its target sequence, cleavage occurs in or near the target sequence. Alternatively, a single polynucleotide comprising sequences encoding both fusion polypeptides is introduced into a cell. The polynucleotides may be DNA, RNA or any modified or analogous forms or DNA and / or RNA. Cleavage directed at a genomic region by a ZFN results in alteration of the nucleotide sequence of the region after repair of the non-homologous linkage cleavage event (NHEJ).

Alternatively, cleavage directed into a genomic region by a ZFN may also be part of a procedure in which a genomic sequence (eg, a region of interest in the cellular chromatin) is replaced with a non-identical homologue sequence (ie by directed recombination) (eg, insertion of a donor sequence comprising an exogenous sequence together with one or more sequences which are identical or homologous to the non-identical, with a predetermined genomic sequence (ie, a target site). double-strand breaks in cellular DNA stimulate cellular repair mechanisms several hundred fold in the vicinity of the cleavage site, directed cleavage with ZFNs as described herein allows the alteration or substitution (via homology-directed repair) of sequences at virtually any site in the targeting a selective genomic sequence. In addition to the ZFNs described herein, the introduction of an exogenous (donor) polynucleotide is required. The donor polynucleotide may be introduced into the cell prior to, at the same time or after expression of the ZFNs. The donor polynucleotide has sufficient homology for a genomic sequence to support homologous recombination (or homology-directed repair) between it and the genomic sequence with which it has homology. Approximately 25, 50, 100, 200, 500, 750, 1,000, 1,500, 2,000 nucleotides or more of sequence homology (or any integer value between 10 and 2000 nucleotides or more) will support homologous recombination. The donor polynucleotides may range in length from 10 to 5000 nucleotides (or any intermediate integer value of nucleotides) or more.

It will readily be apparent that the nucleotide sequence of the donor polynucleotide is typically not identical to that of the genomic sequence it replaces. For example, the sequence of the donor polynucleotide may contain one or more substitutions, insertions, deletions, inversions or arrangements relative to the genomic sequence, provided that sufficient homology to the chromosomal sequences is present. Such sequence alterations may be of any size and may even be a pair of nucleotides. Alternatively, a donor polynucleotide may contain a non-homologous sequence (i.e., an exogenous sequence, to be distinguished from an exogenous polynucleotide) flanked by two regions of homology. In addition, the donor polynucleotides may comprise a vector molecule containing sequences that are not homologous to the region of interest in the cellular chromatin. In general, the homologous regions of a donor polynucleotide will have at least 50% sequence identity to a genomic sequence with which recombination is desired. In certain embodiments, 60%, 70%, 80%, 90%, 95%, 98%, 99% or 99.9% sequence identity is present. Any value between 1% and 100% sequence identity may be present, depending on the length of the donor polynucleotide.

A donor molecule may contain several discontinuous regions of homology with the cellular chromatin. For example, for targeted insertion of sequences not normally present in a region of interest, said sequences may be present in a donor nucleic acid molecule and flanked by regions of homology with the sequence in the region of interest.

To simplify assays (e.g., hybridization, PCR, digestion with restimulating enzymes) to determine the successful insertion of donor polynucleotide sequences, certain sequence differences may be present in the donor sequence as compared to the genomic sequence. Preferably, if located in a coding region, such nucleotide sequence differences will not alter the amino acid sequence or make silent amino acid changes (i.e., changes that do not affect the structure or function of the protein). The donor polynucleotide can optionally contain changes in the sequences corresponding to the zinc finger domain binding sites in the region of interest to prevent cleavage of donor sequences that have been introduced into the cellular chromatin by homologous recombination.

A polynucleotide may be introduced into a cell as part of a vector molecule having additional sequences such as, for example, origins of replication, promoters, and genes encoding antibiotic resistance. Furthermore, donor polynucleotides may be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or may be delivered by bacteria or viruses (eg Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, virus of tobacco mosaic, potato virus X, cauliflower mosaic virus, and mosaic virus of cassava veins, see, eg, Chung et al. (2006) Trends Plant Sci. 11 (1): 1-4.

To change a chromosomal sequence, it is not necessary for the entire donor sequence to be copied to the chromosome, so long as sufficient donor sequence is copied to effect the desired sequence change. The efficiency of insertion of the donor sequences through homologous recombination is inversely related to the distance in the cellular DNA between the double strand break and the site where recombination is desired. In other words, higher homologous recombination efficiencies are observed when the double strand break is closer to the site where recombination is desired. In cases where a precise recombination site is not predetermined (eg, the desired recombination event may occur over a range of genomic sequence), the length and sequence of the donor nucleic acid, together with the cleavage sites , are selected to obtain the desired recombination event. In cases where the desired event is to alter the sequence of a single nucleotide pair in a genomic sequence, the cellular chromatin is cleaved within 10,000 nucleotides on each side of the nucleotide pair. In certain embodiments, cleavage occurs within 1000, 500, 200, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5 or 2 nucleotides or any integer between 2 and 1000 nucleotides, on each side of the nucleotide pair whose sequence is to be altered. The targeted insertion of exogenous sequences into a genomic region is achieved by directed cleavage at the genomic region using ZFNs, along with delivery of an exogenous (donor) polynucleotide containing the exogenous sequences. The donor polynucleotide typically also contains sequences flanking the exogenous sequence, which have sufficient homology to the genomic region to support homology-directed repair of the double strand break in the genomic sequence, thereby inserting the exogenous sequence into the genomic region. Thus, the donor nucleic acid may be of any size sufficient to support integration of the exogenous sequence through homology-dependent (e.g., homologous recombination) repair mechanisms. Without wishing to be bound by any particular theory, it is believed that the homology regions flanking the exogenous sequence provide the broken ends of the chromosome with a matrix for the new synthesis of the genetic information at the double-stranded breaking site. The targeted integration of exogenous sequences, as described above, can be used to insert a gene from a tag into a chosen chromosomal location. Trademark genes include, but are not limited to, protein coding sequences that measure resistance to antibiotics (eg, ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance), coding sequences for stained or fluorescent proteins or (eg, fluorescent green protein, increased green fluorescent protein, red fluorescent protein, luciferase) and proteins that mediate cell growth stimulation and / or gene amplification (eg, dihydrofolate reductase). Examples of such marker genes include, but are not limited to, β-glucuronidase (GUS), phosphinothricin N-acetyl transferase (PAT, BAR), neomycin phosphotransferase, β-lactamase, catechol dioxygenase, α-amylase, tyrosinase, β galactosidase, luciferase, aequorin, EPSP synthase, nitrilase, acetolactate synthetase (ALS), dihydrofolate reductase (DHFR), dalapon dehalogenase and anthranilate synthetase. In certain embodiments, targeted integration is used to insert a construct for RNA expression, e.g., sequences responsible for the regulated expression of micro-RNA or siRNA. Promoters, stimulators and other transcriptional regulatory sequences may also be incorporated into an RNA expression construct.

Further increases in the efficiency of targeted recombination in cells comprising a zinc finger / nuclease fusion molecule and a donor DNA molecule were achieved by blocking the cells in the G2 phase of the cell cycle when homology-directed repair processes are at its maximum activity. Such a stop can be achieved in a number of ways. For example, cells can be treated with eg, drugs, compounds and / or small molecules that influence cell cycle progression in order to stop cells in the G2 phase. Examples of such molecules include, but are not limited to, compounds (eg, vinblastine, nocodazole, Taxol), compounds that interact with DNA (eg, cis-platinum (II) diamine dichloride, Cisplatin, doxorubicin) and / or compounds that affect DNA synthesis (eg, thymidine, hydroxyurea, L-mimosine, etoposide, 5-fluorouracil). Further increases in recombination efficiency are achieved through the use of histone deacetylase (HDAC) inhibitors (e.g., sodium butyrate, trichostatin A) that alter the chromatin structure to make genomic DNA more accessible to cell recombination machinery.

Other methods for stopping the cell cycle include excessive expression of proteins that inhibit the activity of the cell cycle CDK kinases, for example, by introducing into the cell a cDNA encoding the protein or by introducing into the ZFP cell which activates expression of the gene encoding the protein. Cell cycle arrest is also achieved by inhibiting the activity of cyclins and CDKs, for example, using RNAi methods (e.g., U.S. Patent 6,534,261 for methods of synthesizing proteins with manipulated zinc fingers for regulation of gene expression.

As described above, methods and compositions disclosed for targeted cleavage can be used to induce mutations in a genomic sequence. Targeted cleavage may also be used to create gene deletions (e.g. for functional genomics or target validation) and to facilitate targeted insertion of a sequence into a genome (i.e., gene activation). The insertion may be through substitutions of chromosomal sequences by homologous recombination or by directed integration, wherein a novel sequence (ie, a sequence not present in the region of interest), flanked by homologous sequences of the region of interest on the chromosome, is inserted at a predetermined target. The same methods may also be used to replace a wild-type sequence with a mutant sequence, or to convert an allele into a different allele. The targeted cleavage of pathogens that infect or are integrated into plants may be used to treat pathogenic infections in a plant host, for example, by cleaving the genome of the pathogen so that its pathogenicity is reduced or eliminated. In addition, directed cleavage of genes encoding plant virus receptors can be used to block the expression of such receptors, thereby preventing viral infection and / or virus spreading in the plant.

Examples of plant pathogens include, but are not limited to, plant viruses such as Alfamoviruses, Alphacryptoviruses, Badnaviruses, Betacryptoviruses, Bigeminiviruses, Bromoviruses, Bymoviru-ses, Capilloviruses, Carlaviruses, Carmoviruses, Caulimovi-ruses, Closteroviruses, Comoviruses, Cucumoviruses , Cytor-habdoviruses, Dianthoviruses, Enamoviruses, Fabiviruses, Furoviruses, Hordeiviruses, Hybrigeminiviru-ses, Idaeoviruses, Ilarviruses, Ipomoviruses, Luteoviruses, Machlomoviruses, Macluraviruses, Marafiviruses, Monogemi-niviruses, Nanaviruses, Neuroviruses, Nepoviruses, Nucle-orhabdoviruses, Oryzaviruses , Ourmiaviruses, Phytoreoviruses, Potexviruses, Potyviruses, Rymoviruses, satellite RNAs, satelivirus, Sequiviruses, Sobemoviruses, Tenuivi-ruses, Tobamoviruses, Tobraviruses, Tombusviruses, Tospovi-ruses, Trichoviruses, Tymoviruses, Umbraviruses, Varico-saviruses and Waikaviruses; pathogenic fungi such as fuligens (e.g. Ustilaginales), rusts (Uredinales), spikes (Clavicepts pupurea) and downy mildew; molds (Oomycetes) such as Phytophthora infestans (potato mildew); pathogenic bacteria such as Erwinia (e.g., E. herbicola), Pseudomonas (e.g., P. aeruginosa, P. syringae, P. fluorescense and P. put ida), Ralstonia (e.g., R. solana-cearum), Agrobacterium and Xanthomonas; worms (Nematoda); and Phytomyxea (Polymyxa and Plasmodiophora).

The disclosed methods for targeted recombination can be used to replace any genomic sequence with a non-identical homologue sequence. For example, a mutant genomic sequence may be substituted for its wild-type counterpart, thus providing methods for the treatment of plant diseases; providing resistance to plant pathogens; increasing yields of crops, etc. Similarly, one allele of a gene may be replaced by a different allele using the directed recombination methods described herein.

In many of these cases, one region of interest comprises a mutation and the donor polynucleotide comprises the corresponding wild sequence. Similarly, a wild-type genomic sequence may be substituted by a mutant sequence if desired. In fact, any pathology dependent on a particular genomic sequence, however, can be corrected or alleviated using the methods and compositions described herein. Targeted cleavage and targeted recombination may also be used to alter noncoding sequences (e.g., regulatory sequences such as promoters, primers, primers, terminators, " splice sites ") to alter the levels of expression of a gene product. Such methods may be used, for example, for therapeutic purposes, changes in cellular physiology and biochemistry, functional genomics and / or target validation studies.

The methods and compositions described herein can also be used for activation and repression of gene expression using fusions between a non-canonical zinc finger binding domain and a functional domain. Such methods are described, for example, in U.S. Patents 6,534,261; 6,824,978 and 6,933,113 in co-ownership.

Other methods of repression include the use of antisense oligonucleotides and / or small interfering RNAs (siRNA or RNAi) directed against the gene sequence to be repressed.

As an alternative, one or more fusions between a zinc finger binding domain and a recombinase (or functional fragment thereof) may be used, in addition to or instead of the zinc finger-domain cleavage fusions, to facilitate targeted recombination . See, for example, U.S. Patent No. 6,534,261 in co-ownership and Akopian et al. (2003) Proc. Natl. Acad. Know. USA 100: 8688-8691.

Alternatively, the disclosed methods and compositions are used to provide fusions of ZFP-binding domains with transcriptional activation or repression domains that require dimerization (homodimerization or heterodimerization) for their activity. In such cases, a fusion polypeptide comprises a zinc finger binding domain and a functional domain monomer (e.g., a monomer of a dimeric domain for activation or transcription repression). Binding of two of such fusion polypeptides to suitably situated target sites allows dimerization to reconstitute a functional domain of transcription activation or repression.

EXAMPLES The present invention is further defined in the Examples which follow, in which all parts and percentages are by weight and degrees are degrees Celsius, unless otherwise stated. It will be understood that these examples, while indicating certain embodiments of the invention, are given for illustrative purposes only.

Example 1: ZFN expression vectors

Expression vectors comprising the 4-finger ZFN coding sequences (designated " 5-8 " and " 5-9 ") as described in Examples 2 and 114 of U.S. Patent Publication 2005/0064474 (See Example 2 of that application ) were modified as follows. Briefly, ZFN 5-8 and 5-9 (comprising 4 zinc finger domains fused to the nuclease domain of the Fokl IIS restriction enzyme (amino acids 384-579 of the sequence of Wah et al. (1998) Proc. Natl. ScL USA 95: 10564-10569) through a four amino acid ZC linker) were modified to a CCHC structure. Further modifications (substitutions and insertions) were also made to the residues between the C-terminal and / or C-terminal His and Cys zinc coordination structures relative to the C-terminal Cys relative to the finger 2 and / or finger 4.

Correlation of eGFP genes in reporter cell lines The ability of ZFNs comprising CCHC zinc fingers as described herein to facilitate homologous recombination was tested in the GFP system described in Urnov (2005) Nature 435 (7042): 646- 51 and U.S. Patent Publication No. 20050064474 (eg, Examples 6-11). Briefly, 50 ng of each ZFN and 500 ng of the no-promoter GFP donor (Urnov (2005) Nature) were transfected into 500,000 reporter cells using 2 μl of Lipofectamine 2000 per sample according to Invitrogen's Lipofectamine 2000 protocol.

Vinblastine was added 24 hours after transfection at a final concentration of 0.2 μΜ and was removed 72 hours after transfection.

Cells were tested for GFP expression 5 days post-transfection by measuring 40,000 cells per transfection in the Guava bench-top FACS analyzer.

As shown in Fig. 1, most ZFNs comprising CCHC-modified zinc fingers, as shown in Tables 1 and 2 above, facilitate homologous recombination at the reporter locus (GFP), resulting in levels of GFP expression above the fingers unmodified zinc and several CCHC had similar performance to ZFNs comprising zinc fingers CCHH. The best performing variant when positioned on finger 4 (F4) comprised the following sequence (including the His-zinc coordination residue and in addition at the C-terminus): HAQRCGLRGSQLV (SEQ ID NO: 53) (the zinc finger designated Table 2 # 21 and shown in Figure 1 as " 2-21 "). The best performing variant when placed on finger 2 (F2) comprised the following sequence (including the His-zinc coordination residue and beyond this at the C-terminus): HIRTCTGSQKP (SEQ ID NO: 75) (the zinc finger in designated Table 2 # 43 and shown in Fig. 1 as " 2-43 ").

Example 3: Vim chromosomal IL2Rγ gene editing by directed recombination ZFNs as described herein were also tested in the endogenous IL2Ry assay described in Urnov (2005) Nature 435 (7042): 646-51 and in Example 2 of U.S. Patent Application No. 20050064474. Briefly, two and a half micrograms of each ZFN expression construct were transfected into 500,000 K562 cells using a

Nucleofector (Amaxa). Genomic DNA was harvested and gene disruption was tested at the endogenous IL2Ry locus using the Surveyor endonuclease kit.

The ZFNs are shown in the upper left corner of FIG. 2. In particular, the altered zinc finger 20 refers to a CCHC zinc finger comprising the sequence HAQRCGLRGSQLV (SEQ ID NO: 53); the zinc finger 43 comprises the sequence HIRTCTGSQKP (SEQ ID NO: 75); the zinc finger 45 comprises the sequence HERTGCTGSQKP; the zinc finger 47 comprises the sequence HIRRCTGSQKP; and the zinc finger 48 comprises the sequence HIRRGCTGSQKP. Zinc fingers 20 and 21 were used on finger 4 of ZFNs with 4 fingers and zinc fingers 43, 45, 47 and 48 were used on zinc finger 2 of ZFNs with 4 fingers.

The pairs of ZFNs tested are shown in Fig. 2 on the right side above the graph and in Table 5:

Table 5

To determine if the mutations had been induced at the cleavage site, the amplification product was analyzed using a Cel-1 assay, where the amplification product was denatured and renatured, followed by treatment with the specific nucleotide degrading Cel-1, ments. See, for example, Oleykowski et al (1998) Nucleic Acids res. 26: 4597-4602; Qui et al. (2004)

BioTechniques 36: 702-707; Yeung et al. (2005) BioTechniques 38: 749-758.

The results of two experiments for each sample are shown in Fig. Experiment # 2 for samples # 2 and # 8 had background noise in the runways, which reduced the apparent efficacy of these ZFNs.

As shown in Fig. 2, some CCHC variants are essentially equivalent to wild ZFNs C2H2. The finger of zinc 21 on finger 4 (samples 5 and 9) produced better results than the finger of zinc 20 on finger 4 (samples 4 and 8). On Finger 2, the zinc finger 43 produced the best results.

Example 4: Correction of eGFP genes in reporter cell lines

Based on the results shown in Figs. 1 and 2, the CCHC zinc fingers shown in Tables 3 and 4 above (designated the 10a) were produced. These zinc fingers were produced in ZFNs 5-8 and 5-9 and tested in the GFP gene correction assay described in Example 2 above. The pairs of ZFNs tested in each sample are shown below each bar, wherein the numbers of the zinc fingers 20, 21, 43, 45, 47 and 48 are as described in Example 3 and the zinc fingers CCHC 1a to 10a comprise the sequence shown in Tables 3 and 4 above. The zinc fingers 20, 21, 7a, 8a, 9a and 10a were used in Finger 4; the zinc fingers 43, 45, 47, 48, 1a, 2a, 3a, 4a, 5a and 6a were used in Finger 2.

The results are shown in Fig. 3. The upper line behind each bar refers to the zinc finger embedded in ZFN 5-8 and the bottom pain line behind each bar refers to the zinc finger embedded in ZFN 5- 9. For example, the left 2nd bar in the graph of Fig. 3 refers to a sample transfected with ZFNs 5-8 and 5-9, wherein F4 of both ZFNs comprises the sequence of the zinc finger 20. As shown , many of the ZFNs comprising CCHC zinc fingers had comparable performance with wild ZFNs (CCHH).

Example 5: Design and generation of the target vector A. Overall structure of the target sequence The target construct for tobacco (a dicotyledone) included the following 7 components as shown in Figs. 4 and 5: i) a hygromycin phospho-transferase (HPT) expression cassette comprising an A. thaliana ubiquitin-3 (ubi-3) promoter (Callis, et al., 1990, J. Biol. Chem. 265-12486-12493) which directs the E. coli HPT gene (Waldron et al., 1985, Plant Mo Biol. 18: 189-200) terminated by a 3 'untranslated region (UTR) of the open reading frame 24 from A. tumefaciens (orf-24) (Gelvin et al., 1987, EP 222493); ii) homologous sequence-1, comprising the matrix binding region (MAR) RB7 from N. tabacum) (Thompson et al., 1997, WO9727207); iii) a 5 'fragment of the green fluorescent protein (GFP) gene (Evrogen Joint Stock Company, Moscow, Russia) directed by a modified manupine synthetase promoter from A. tumefaciens (Petmas) (Petolino et al., US Patent No. 6,730,824); and (iv) a β-glucuronidase (GUS) expression cassette comprising a cassava rib mosaic virus (CsVMV) promoter (Verdaguer et al., 1996, Plant Molecular Biology 31: 1129-1139) directing a GUS gene (Jefferson, 1987, Plant Mol. Biol. Rep. 5: 387-405) terminated by the 3'UTR of the nopaline synthase (nos) of A. tumefaciens (DePicker et al., 1982, J. Mol. Appl. Genet. 573); v) a 3 'fragment of the GFP gene (Evrogen Joint Stock Company, Moscow, Russia) terminated by a 3'UTR of orf-1 from A. tumefaciens (Huang et al., J. Bacteriol, 172: 1814-1822); vi) homologous sequence-2, comprising the intron 1 of 4-coumaroyl-CoA synthetase (4-CoAS) from A. thaliana (Locus At3g21320, GenBank NC 003074) and; vii) a 3 'fragment of the S. viridochromogenes phosphinotricin phosphotransferase (PAT) gene (Wohlleben et al., 1988, Gene 70: 25-37) terminated by A. tumefaciens 3'UTR of ORF-25/26 et al., 1987, EP 222493).

A binding site of zinc-Fokl (IL-1-LO-Fokl) finger fusion protein (Urnov et al., 2005, US 2005/0064474) was inserted downstream of the CsVMV promoter (Verdaguer et al., 1996, Plant Molecular Biology 31: 1129-1139) and fused to the GUS coding sequence (Jefferson, 1987, Plant Mol. Biol. Rep. 5: 387-405) at the N-terminus. Two copies of a second binding site of the Fokl zinc finger (Scd27-L0-Fokl) (Urnov et al., 2005, US 2005/0064474) flanked the 5 'and 3' fragments of the GFP gene (Evrogen Joint Stock Company, Moscow, Russia). Each binding site contained four tandem repeats of the Fokl zinc fingerprint fusion primer, so that each binding site was -200 bp in size (Fig. 6A). This was designed to ensure that the recognition sequences would be accessible to the zinc-Fokl finger fusion protein in the complex chromatin environment. Each recognition sequence included an inverted repeat sequence, to which a single zinc-Fokl finger fusion protein bound as homodimer and cut the double stranded DNA (Fig. 6B). The 5 'and 3' fragments of the GFP gene overlapped at 540 bp providing homology within the target sequence and a stop codon was inserted at the 3 'end of the GFP 5' fragment to ensure non-functional translation from the target sequence. The transformation vector comprising the target sequence was generated by a multi-step cloning process as described below. B. Construction of HPT binary vector (pDABl584) The vector pDABl400, which contained a GUS expression cassette, comprising an A. thaliana ubi-3 promoter (Callis, et al., 1990, J. Biol. Chem. 265-12486-12493) targeting the GUS gene (Jefferson, 1987, Plant Mol. Biol. Rep. 5: 387-405) terminated by A. tumefaciens orf-UTR UTR (Huang et al., J. Bacteriol. : 1814-1822), was used as the starting base construction (Fig. 7).

To avoid any unnecessary repeating regulatory elements in the target construct, the orf-1 RTU of A. tumefaciens (Huang et al., J. Bacteriol. 172: 1814-1822) in pDAB140 was replaced by the A. orf-24 UTR. tumefaciens (Gelvin et al., 1987, EP 222493), which was excised from pDAB782 (FIG.8) as a SacI / XbaI fragment and cloned into the same sites in pDAB140. The resulting construct contained an A. thaliana ubi-3 promoter (Callis, et al., 1990, J. Biol. Chem. 265-12486-12493) targeting the GUS gene (Jefferson, 1987, Plant Mol. Biol. Rep 5: 387-405) terminated by an ort-24 UTR of A. tumefaciens (Gelvin et al., 1987, EP222493) and was designated PDAB1582 (FIG.9). The HPT coding sequence (Waldron et al., 1985, Plant Mo Biol. 18: 189-200) was amplified by PCR from plasmid pDAB354 (FIG 10) using primers Pi and P2. A Bbs1 site was added at the 5 'end of the Pl primer sequence and the Saci site was maintained at the 3' end of the P2 primer. The HPTII PCR fragment was digested with Bbs1 / Sac1 and cloned into pDAB1,582 digested with NcoI-SacI to replace the GUS gene with the HPT gene of the PCR fragment. The resulting plasmid was designated pDAB1683 (Fig. 11). The A. thaliana / HPTA / ort-24 fragment of A. tumefaciens was then excised from pDAB1583 by digestion with No11 and treated with T4 DNA polymerase to generate blunt ends. The HPT expression cassette endowed with blunt ends was cloned into pDAB2407 (Fig. 12), a binary base vector, at the Pmel site resulting in the plasmid pDAB145 (Fig. 13). C. Construction of the vector comprising the homologous sequences and the binding site of the Scd27-FokI zinc finger fusion protein (pDABl580) The ort-1 UTR of A. tumefadens (Huang et al., J. Bacteriol., 172: 1814 -1822) in pDAB2418 (FIG.14) was replaced with the A. tumefaciens orf25 / 26 RTU (Gelvin et al., 1987, EP222493) to avoid repeated regulatory sequences in the target vector. To reverse the RTU, the ort25 / 26 RTU of A. tumefaciens (Gelvin et al., 1987, EP222493) was amplified by PCR from plasmid pDAB4045 (FIG 15) using primers P3 and P4. The Smal and Agel sites were added to the 3 'end of the PCR fragment and the Saci site was maintained at the 5' end. Plasmid pDAB2418 DNA, which contained a PAT gene expression cassette, comprising the ubiquitin-10 (ubi-10) promoter of A. thaliana (Callis, et al., 1990, J. Biol. Chem. 265-12486 -12493) by targeting the PAT gene (Wohlleben et al, 1988, Gene 70: 25-37) terminated by A. tumefaciens orf-UTR UTR (Huang et al., J. Bacteriol. 172: 1814-1822) and a MAR sequence RB7 from N. tabacum (Thompson et al., 1997, WO9727207), was digested with Saci and Agel and the two larger fragments were recovered. These fragments were ligated to the PCR product of the orf25 / 26 UTR of A. tumefaciens (Gelvin et al., 1987, EP222493) digested with Saci and Agel. The resulting plasmid was designated pDAB175 (Fig. 16). MAR RB7 of N. tabacum

Thompson et al., 1997, WO9727207) served as homologous sequence 1 in the target vector. The 4-CoAS intron 1 of Ά. thaliana (Locus At3g21320, GenBank NC 003074) was selected to serve as homologous sequence 2 in the target vector. The coding sequence of the PAT gene (Wohlleben et al., 1988, Gene 70: 25-37) was analyzed and 299/300 bp downstream of the start codon was identified as the site of insertion of the intron, so that the sites of " splicing " 5 'and 3' could be formed. The full-length intron was then fused with 253 bp of the 3 'partial coding sequence of PAT through DNA synthesis (Picoscript Ltd., LLP, Houston, Texas). The NotI and Saci sites were added to the 5 'and 3' ends of the DNA fragment, respectively. The synthesized DNA fragment was then digested with NotI / SacI and inserted into pDAB175 at the same sites to replace the full-length PAT coding sequence. The resulting construct was designated pDAB1577 (Fig. 17).

A 241 bp DNA fragment containing 4 tandem repeats from Scd27-L0-Fokl recognition sites (Fig. 6) was synthesized (Picoscript Ltd., LLP, Houston, Texas) with a Smal site added at both 5 ' and 3 'of the fragment. The synthesized fragment containing the zinc-Fok1 finger binding site was then digested with SmaI and inserted into pDAB1577 at the MscI site. The resulting vector was designated pDAB1579 (Fig. 18). A second fragment containing the SmaI-digested zinc-Fokl finger binding site was then inserted into pDAB1579 at the SwaI site. The resulting construct was designated pDABl580 (Fig. 19). This vector has homologous sequences 1 and 2 (RB7 MAR from N. tabacum and intron 1 from A. thaliana 4-CoAS, respectively) and two Scd27-L0-Fokl zinc finger binding sites each containing 4 tandem repeats of the Scd27-L0-Fokl recognition sites. D. Construction of the vector containing two partially duplicated non-functional GFP fragments (pDAB1772) The GFP gene, CopGFP, was purchased from Evrogen Joint Stock Company (Moscow, Russia) and the full-length coding sequence was amplified by PCR using primers P5 and P6. The Bbs1 and Saci sites were added to the 5 'and 3' ends of the PCR product, respectively. The PCR product CopGFP was then digested with BbsI / SacI and cloned into pDAB3401 (Fig. 20) comprising the modified A. tumefaciens Amomas promoter (Petolino et al., US6730824) directing the GUS gene (Jefferson, 1987, Plant Mol. Biol. Rep. 5: 387-405) and terminated by the 3 'UTR of orf-1 from A. tumifaciens (Huang et al., J. Bacteriol. 172: 1814-1822) at the Ncol / SacI sites to replace the GUS gene . The resulting vector was designated pDAB170 (Fig. 21).

To make the two partially duplicated nonfunctional GFP fragments, a DNA fragment containing the majority of the coding sequence of CopGFP with a 47 bp deletion at the 5 'end was amplified by PCR using the P9 and P10 primers. An Apal site was added to both the 5 'and 3' ends and an additional StuI site was added to the 5 'end downstream of the Apal site. The PCR product was then digested with Apal and inserted into pDAB170 at the Apal site, thereby creating two non-functional GFP fragments in the same vector with a duplicate sequence of 540 bp. The resulting construct was designated pDAB1772 (Fig. 22). E. Construction of the IL-1-FokI / GUS gene (PDAB1573) fusion finger binding site fusion fusion vector

A 233 bp DNA fragment containing 4 replicates in tandem from the ILl_L0-FokI recognition site (Fig. 6) was synthesized by Picoscript Ltd., LLP, (Houston, Texas) with Ncol and AflIII sites added to the 5 'and 3' ends ', respectively. The synthesized fragment was then digested with NcoI / AflIII and inserted into pDAB4003 (Fig. 23), which contained a GUS gene (Jefferson, 1987, Plant Mol. Biol. Rep. 5: 387-405) directed by a CsVMV promoter ( Verdaguer et al., 1996, Plant Molecular Biology 31: 1129-1139) terminated by the 3 'UTR of orf-1 from A. tumefaciens (Huang et al., J. Bacteriol., 172: 1814-1822) at an Ncol site. An N-terminal fusion between the IL-1_LO-Fokl binding site and the GUS coding sequence was then generated. The resulting vector was designated pDAB1771 (Fig. 24).

To avoid repeating elements of the 3 'UTR in the target vector, the 3' UTR of A. tumefaciens (DePicker et al., 1982, J. Mol. Appl. Genet. 1: 561-573) was removed from pDAB7204 (FIG. 25) as a SacI / Pmel fragment and cloned into pDAB1771 which was digested with SacI / Nael to replace the 3 'UTR of A. tumefaciens orf-1 (Huang et al., J. Bacteriol, 172: 1814-1822 ). The resulting plasmid was designated pDAB1773 (FIG 26). F. Construction of the final target vector (pDAB1585)

To make a final target vector, the GUS expression cassette with the insertion of the target site of the IL-1-Fok1 fusion protein was removed from pDAB1773 by NotI digestion, endowed with blunt ends and inserted into pDAB1772 at the StuI site. The resulting intermediate vector was designated pDAB1574 (Fig. 27). The entire cassette containing the modified Amas promoter (Petolino et al., US6730824), a partially duplicated GFP sequence (Evrogen Joint Stock Company, Moscow, Russia), the CsVMV promoter (Verdaguer et al., 1996, Plant Molecular Biology 31 : 1129-1139), a target sequence of the IL-1-Fokl fusion protein, the coding region of the GUS gene (Jefferson, 1987, Plant Mol. Biol. Rep. 5: 387-405), a 3 'UTR A tumefaciens (DePicker et al., 1982, J. Mol. Appl. Genet. 1: 561- 573), a partially duplicated 3 'GFP (Evrogen Joint Stock Company, Moscow, Russia) and the 3' UTR of orf-1 of A. tumefaciens (Huang et al., J. Bacteriol. 172: 1814-1822) was removed from pDAB1754 and inserted into pDAB150 at the NotI site. The resulting plasmid was designated pDAB1681 (Fig. 28). The Agel fragment of pDAB was then inserted into pDAB1584 at the Agel site thus creating the final target construct, pDAB1585 (Figures 4 and 5).

Example 6. Generation of transgeneic cell lines with integrated target sequences

A suspension culture of tobacco cells, referred to as BY2, was used in which the target sequences of Example 5 were stably integrated through the transformation of Agrobacterium. The base cell line, BY2, was purchased from Jun Ueki of Japan Tobacco, Iwata, Shizuoka, Japan. This culture proliferates as cells with a diameter of 5-10 μ in clusters of 100-150 cells, with a doubling time of approximately 18 hours. Suspension cultures of BY2 cells were maintained in medium containing LS basal salts (PhytoTechnology Labs L689), 170 mg / 1 KH2 PO4, 30 g / l sucrose, 0.2 mg / l 2,4-D and 0,6 mg / L thiamine-HCl at a pH of 6.0. BY2 cells were subcultured every 7 days by the addition of 50 ml of LS-based medium to 0.25 ml PCV. Suspension culture of BY2 cells was maintained in 250 ml flasks on an orbital shaker at 25øC and 125 rpm. In order to generate a transgenic BY2 cell culture with integrated target sequences, a vial of a four day tobacco suspension subculture was divided into 10-12 aliquots of four ml, which were subcultured into 100x25 mm Petri dishes with 100 μg of Agrobacterium strain LBA4404 harboring pDAB1585 grown overnight to a DCPoo ~ 1.5. The plates were wrapped in parafilm and incubated at 25øC with shaking for 3 days, after which the excess liquid was removed and replaced with 11 ml of LS-based basal medium containing 500 mg / l of carbenicillin.

After resuspension of the tobacco cells, 1 ml of suspension was distributed into 100x25 mm plates with suitable base medium containing 500 mg / ml carbenicillin and 200 mg / l hygromycin solidified with 8 g / l TC agar and incubated un-wrapped at 28 ° C in the dark. This resulted in 120-144 selection plates for a single treatment. Individual hygromycin-resistant isolates appeared 10-14 days after seeding and were transferred to individual 60x20 mm plates (one isolate per dish) where they were maintained as callus in a 14-day subculture protocol required for analysis and subsequent retransformation experiments.

Example 7: Screening and characterization of transgenic target events

The hygromycin resistant transgenic events generated from transformation of the target vector into BY2 tobacco cell cultures as described in Example 6 were analyzed as follows.

Initial analyzes conducted for screening for these transgenic events included analysis of GUS expression to indicate accessibility of the target sequence, PCR analysis of the partial and complete target sequence to confirm the presence and integrity of the target vector and analysis of Southern blots for determine the number of copies of the integrated target sequence. A subset of transgenic events showing the GUS expression contained only one copy of the complete target sequence; these were selected for restoration of the suspension cultures to generate the target lines for subsequent retransformation. These re-established target lines were subjected to further characterization, which included more thorough Southern blot analysis, sequencing for confirmation of target insert integrity, and flanking genomic sequence analysis. Callus tissue or transgenic tobacco suspension cultures, initiated from the selected events, were analyzed for GUS activity by incubating 50 mg samples in 150 μl of assay buffer for 24-48 hours at 37 ° C. The assay buffer consisted of 0.2M sodium phosphate pH 8.0, potassium ferricyanide and 0.1 mM potassium ferrocyanide, 1.0 mM EDTA sodium, 0.5 mg / ml 5-bromo-4 3-indolyl-β-glucuronide and 0.6% (v / v) Triton X-100 (Jefferson, 1987, Plant Mol. Biol. Rep. 5: 387-405). The appearance of stained blue regions was used as an indicator of GUS gene expression, which indicated that the insertion of the target sequence was transcriptionally active and thus accessible in the local genomic environment.

The transgenic events expressing GUS were tested by PCR using the primer pair P15 / P16 which led to the amplification of a 10 kb DNA fragment extending between the 3 'UTR of the HTP expression cassette at the 5' end of the sequence and the 3 'UTR of the partial PAT gene cassette at the 3' end of the target sequence. Since all events were obtained under hygromycin selection, it was assumed that the HPT expression cassette was intact at all target events. Thus, only the 3 'UTR of the HPT expression cassette was covered by full-length PCR analysis. A subset of events were also tested by PCR using the primer pairs P15 / P17 and P18 / P19 to determine the integrity of the 5 'and 3' ends of the target sequence, respectively. All target events confirmed by PCR analysis were further tested by Southern blot analysis to determine the number of copies of the integrated target sequence. Southern blot analysis was performed for all target events that underwent full-length GUS expression and PCR screening. Ten æg of genomic DNA was digested with Nsil, which cut only once within the target sequence. The digested genomic DNA was separated on a 0.8% agarose gel and transferred to a nylon membrane. After ligation, the transferred DNA present on the membrane was hybridized with an HPT gene probe to determine the number of copies of the 5 'end of the target sequence. The same membrane was then subjected to removal of the hybridized material and re-hybridized with a PAT gene probe to determine the number of copies of the 3 'end of the target sequence. Multiple events that showed GUS expression and contained a single copy of the full-length target sequence were selected for further characterization, which included a more thorough analysis of Southern blots, confirmation of the integrity of the target sequence and analysis of the flanking genomic sequences . One event, referred to as BY2-380, was selected based on molecular characterization. The suspension culture was re-established from this event for subsequent retransformation with vectors comprising donor DNA and non-C2H2-Fok1 zinc finger fusion protein genes.

To ensure that the suspension culture established from the target event BY2-380 contained the target sequence intact as expected, most of the target sequence from the 3 'UTR of the HPT expression cassette at the 5' end of the target sequence to the UTR 3 of the partial PAT gene cassette at the 3 'end of the target sequence was amplified by PCR using the primer pair P15 / P16 and cloned into the pCR2.1 TOPO vector (Invitrogen,

Carlsbad, California). The PCR products inserted into the TOPO vector were sequenced by Lark technology, Inc. (Houston, Texas). Sequencing results indicated that BY2-380 had the complete target sequences as expected. The BY2-380 cell line was further analyzed to provide the flanking genomic sequences using the Universal Genome Walker kit (Clontech, Mountain View, California). Briefly, 2.5 .mu.g of genomic DNA was digested with restriction endpoint generating enzymes, EcoRV, Dral and StuI, in separate reactions. The digested DNA was purified by phenol / chloroform extraction and ligated to the Genome Walker BD adapter. PCR amplification of two successive reactions was performed with the template binding and primer sequences P20 (upstream of the 5 'end of the target sequence insertion site) and P21 (progression downstream of the 3' end of the insertion site ) for the first PCR reaction and primers P22 (upstream of the 5 'end of the target sequence insertion site) and P23 (upstream of the 3' end of the target sequence insertion site) to the second PCR reaction. Fragments amplified from the second PCR reactions were cloned into pCR2.1 TOPO or the pCR Blunt II TOPO vector (Invitrogen, Carlsbad, California) and sequenced using a Dye Terminator Cycle Sequencing Kit (Beckman Coulter, Fullerton, CA ). The flanking genomic sequences were obtained from the target line BY2-380 through this process. Primer sequences were designed based on the flanking genomic sequences and used to amplify the entire target sequence.

The amplified fragments obtained from this target line were of the expected size. Both ends of the amplified fragments were confirmed by sequencing.

Example 8: Design and generation of the donor vector of

DNA The DNA donor construct included the homologous sequence 1 (N. tabacum RB7 MAR) (Thompson et al., 1997, WO9727207), a full-length A. thaliana promoter (Callis, et al., 1990, J. Biol. Chem. 265-12486-12493), 299 bp of the coding sequence 5 'fragment of the PAT gene (Wohlleben et al., 1988, Gene 70: 25-37) and the homologous sequence 2 (A. thaliana 4-CoAS intron 1) (Locus At3g21320, GenBank NC 003074). Homologous sequence 1 and homologous sequence 2 in the donor vector were identical to the corresponding homologous sequences 1 and 2 in the target vector (pDAB1585).

To construct the donor vector, the 299 bp sequence of partial 5 'PAT encoding was fused to the complete intron 1 of A. thaliana 4-CoAS (Locus At3g21320, GenBank NC 003074) through DNA synthesis by Picoscript Ltd., LLP, (Houston, Texas). The sites Ncol and

XhoI were added to the 5 'and 3' ends of the fragment, respectively. This synthesized DNA fragment was then digested with NcoI / XhoI and inserted into pDAB1575 at the same sites to replace the coding sequence of the full-length PAT gene and its 3 'UTR. This resulting construct was designated DAB1576 (Fig. 29). pDAB1657 was then digested with Agel and the whole fragment containing the 5 'partial PAT expression cassette flanked by the homologous sequence 1 and the homologous sequence 2 was inserted into pDAB2407, the binary base vector, in the same place. The resulting construct was designated pDABl600 (Fig. 30) and was the binary version of the donor vector for the retransformation of the plant cell.

Example 9: Design and generation of zinc finger nucleases expression vectors The Fokl zinc finger fusion protein gene was driven by a promoter and 5 'UTR of CsVMV UTR (Verdaguer et al., 1996, Plant Molecular Biology 31: 1129-1139). Also included in the cassette was a 3 'untranslated region (UTR) from the open reading frame 24 (orf-24) of A. tumefaciens (Gelvin et al., 1987, EP 222493).

To prepare these vectors, sequences encoding the C2H2 controls and their C3H IL-1-Fok1 and Scd27-FokI variants described in Examples 1 to 4 above were amplified by PCR from their original drawings with Bbs1 or NcoI sites and Saci cells added to the 5 'end and the 3' end of the PCR fragments, respectively, and cloned into Ncol-Sacl digested pDAB3731 (Fig. 31). The resulting plasmids were designated pDAB4322 (Fig. 32), pDAB4331 (FIG.33), pDAB4332 (FIG.34), pDAB4333 (FIG.35) pDAB4334 (FIG.36), pDAB4336 (FIG.37), and pDAB4339 38). All of these vectors contained the attL1 and attL2 sites flanking the ZFN expression cassette and were compatible with the Gateway ™ cloning system (Invitrogen, Carlsbad, California).

Two series of binary version vectors were constructed for the IL-1-FokI fusion protein. One contained the PAT selectable marker gene and the other did not contain the PAT selectable marker gene. For the Scd27-FokI fusion protein, only the primary version of the vector without the selectable marker gene PAT was constructed. To prepare the binary vectors with the PAT selectable marker gene, the IL-1-Fok fusion protein expression cassette in pDAB4322, pDAB4331, pDAB4332, pDAB4333, pDAB4334, and pDAB4336 were cloned into pDAB4321 (FIG. LR recombination reaction using the enzyme mixture LR Clonase ™ Enzyme Mix (Invitrogen, Carlsbad, California). The resulting plasmids were designated pDAB4323 (FIG 40), pDAB4341 (FIG 41), pDAB4342 (FIG.42), pDAB4343 (FIG.43), pDAB4344 (FIG.44), pDAB4346 (FIG45). To prepare the binary vectors without the PAT selectable marker gene, the expression cassettes C2H2 IL-1-FokI, C3H IL-1-FokI and Scd27-FokI in pDAB4331, pDAB4336 and pDAB4339, respectively, were cloned into pDAB4330 (FIG. 46) through the LR recombination reaction using the enzyme mixture LR Clonase ™ Enzyme Mix (Invitrogen, Carlsbad, California). The resulting plasmids were designated pDAB4351 (FIG.47), pDAB4356 (FIG.48) and pDAB4359 (FIG.49), respectively.

To prepare the SCD27-FokI C2H2 control, the HindIII / SacI fragment comprising the CsVMV promoter and the 5 'UTR driving PAT in pDAB7002 (Fig. 50) was replaced with a fragment comprising the CsVMV promoter and the 5' UTR of N. tabacum GUS, which was excised from pDAB7025 (Fig. 51) with HindIII / Saci. The resulting plasmid was designated pDAB1591 (Fig. 52). The Scd27-L0-Fok1 coding sequences were amplified by PCR from their original vector vectors pCDNA3.l-SCD27a-L0-Fokl (FIG.53) using the primer pair P13 / P14. The Bbs1 and Saci sites were added to the 5 'and 3' ends of the PCR fragments, respectively. The PAT gene in pDAB1591 was replaced with the PCR fragment of the zinc finger fusion protein gene through Sacl / Ncol cloning. The resulting plasmid was designated pDAB1594 (Fig. 54). The binary version of this vector was constructed by excising the zinc finger fusion protein gene expression cassette of pDAB1504 as a Pmel / XhoI fragment, end-filling and cloning in pDAB2407 at the Pmel site. The resulting plasmid was designated pDAB1698 (Fig. 55). Details of all binary vectors used in plant transformation are summarized in Table 6.

Table 6: Nuclease expression vectors with zinc fingers

Example 10: Design and generation of positive control vector

To estimate the frequency of illegitimate recombination and to serve as a positive control, a vector containing the PAT gene expression cassette was used. In order to be comparable with the final recombinants, A. thaliana 4-CoAS intron 1 (Locus At3g21320, GenBank NC 003074) was inserted at position 299/300 bp of the PAT coding sequence (Wohlleben et al., 1988, Gene 70: 25-37). To make this construct, the 2559 bp Swal / Clal fragment from pDABl576 was ligated to the backbone fragment of pDAB! 577 (Fig. 56) which was digested with the same restriction enzymes. The resulting vector contained the PAT gene expression cassette with the insertion of 1743 bp of A. thaliana 4-CoAS intron 1 (Locus At3g21320, GenBank NC 003074) (Locus At3g21320, GenBank NC 003074) in the coding sequence of PAT (Wohlleben et al., 1988, Gene 70: 25-37). This vector was designated pDAB1778 (FIG 57).

To prepare the binary version of pDABl578, the PAT gene expression cassette with A. thaliana intron 1 (Locus At3g21320, GenBank NC 003074) was excised from pDABl578 with Pmel / XhoI. After the 3 'end of the fragment was rendered blind, it was inserted into pDAB2407, the binary base vector, at the Pmel site. The resulting vector was designated pDAB1601 (Fig. 58) which comprised the PAT gene (Wohlleben et al., 1988, Gene 70: 25-37) containing the 4-CoAS intron sequence of A thaliana (Locus At3g21320, GenBank NC 003074 ) by the ubilO promoter of A. thaliana (Callis, et al., 1990, J. Biol. Chem. 265-12486-12493) and terminated by the 3 'UTR of A. tumefaciens (Gelvin et al. 1987, EP 222493).

Example 11: Demonstration of intrachromosomal homologous recombination by the retransformation of target cell cultures with the C3H zinc finger nuclease genes

To validate the functionality of the C3H zinc finger nucleases in the stimulation of intrachromosomal homologous recombination, two non-functional GFP fragments with 540 bp overlap sequences were included in the target vector as shown in Fig. 59. Among these two fragments was a set of expression of GUS. The IL-1-Fokl fusion protein binding sequence was fused to the GUS coding sequence at its N-terminus. Without being bound by any theory, it was hypothesized that in the presence of the IL-1-FokI fusion protein the IL-1-ZFN binding sequences are recognized and a double-stranded DNA is induced which would stimulate the process of endogenous DNA repair. Without the presence of donor DNA, the two partially homologous GFP fragments would undergo an intracromossomic homologous recombination process and a functional GFP gene would be reconstituted.

A BY2-380 transgenic cell line containing a single full-size copy integrated into the target sequence was used to restart suspension cultures by placing -250-500 ng of callus tissue in 40-50 ml of LS-based basal medium containing 100 mg / 1 hygromycin, and subculture every 7 days as described above. Prior to retransformation, the suspension cultures were transferred to basal medium without hygromycin for at least two passages. Agrobacterium-mediated transformation of target cell cultures was performed as described above. For each experiment, 8 co-culture plates were generated as follows: one plate contained cocultivated cells with 300 μg of Agrobacterium strain LBA4404 base; one plate comprised cells cocultivated with 300 μg of an Agrobacterium strain bearing pDAB1590 (construct with functional GFP); six plates each contained 300 μ coc cocultivated cells of an Agrobacterium strain bearing pDAB4323, pDAB4341, pDAB4342, pDAB4343, pDAB4344 and pDAB4346, respectively. After coculture using the methods described above, cells were seeded into eight plates containing LS-based basal medium supplemented with 500 mg / l carbenicillin without selection reagent. The apparent expression of the constituted functional GFP gene resulted in visible fluorescence around days 5-8 after transformation). The number of green fluorescent foci per field was counted by randomly observing 5 microscope fields per plate, 8 plates per construct in each experiment and averaging 6 independent experiments.

As summarized in Table 7, we observed a mean of 9.50 and 7.57 green fluorescent foci from the two zinc finger nucleases C3H, pDAB4346 and pDAB4343, respectively. These two IL-1-Fokl C3H designs performed better than their controls C2H2, pDAB4341 (6.37 foci per field) and pDAB4323 (5.53 foci per field). However, compared to the C2H2 controls, the function of two other C3H variants of the IL-1-Fok1 fusion protein, pDAB4344 (4.39 foci per field) and pDAB4342 (0.25 foci per field) was significantly inhibited, in particular pDAB4342, wherein the C3H conversion was made by replacing the second histidine with cysteine in the fourth finger. No appreciable fluorescence was observed beyond a slight background in the negative controls transformed with the Agrobacterium base strain LBA4404.

Table 7

Example 12: Demonstration of the interchromosomal homologous recombination through the retransformation of target cell cultures with nucleotide genes with C3H zinc fingers and donor DNA sequences

To validate the functionality of the C3H-FokI zinc finger fusion protein in the stimulation of the homologous interchromosomal recombination in the exemplary system of tobacco, two strategies were developed and tested.

In strategy 1, the binding site for zinc-Fokl finger-fusion protein (Il-1-L0-Fokl) was included in the medium of the target construct (Fig. 61). In this strategy, the binding site was flanked by ~ 3 kb of non-homologous sequences on both sides followed by the homologous sequence 1 (MAR RB7 of N. tabacum) and the homologous sequence 2 (A. thaliana 4-CoAS intron 1) upstream and downstream, respectively. As previously demonstrated (eg, U.S. Patent Publication No. 20050064474) in the presence of the IL-1 C2H2-FokI zinc finger fusion protein, the IL-1-L0-Fok1 binding sequences were recognized and a Double-stranded DNA at this specific site, which stimulated the repair process of endogenous DNA. In the presence of donor DNA, which contained partial homologous sequences identical to those of the target sequence, the partial 5 'PAT gene together with its promoter, replaced the ~6 kb DNA fragment between the homologous sequences in the target through homologous recombination. Through this process, the two partial sequences of the PAT gene, with A. thaliana 4-CoAs intron 1 of permease, reconstituted a functional PAT gene, resulting in the expression of PAT and a phenotype of herbicide resistance.

In strategy 2, two Fokl zinc finger binding sites (Scd27-L0-Fok1) were included in the target vector: one directly downstream of MAR RB7 from N. tabacum and the other directly upstream of intron 1 from 4- CoAs of A. thaliana (Fig. 62). Between the two zinc-Fokl finger fusion protein binding sites were ~ 6 kb of sequence, which included the 5 'GFP fragment, a GUS expression cassette, and the 3' GFP fragment. As previously demonstrated (eg, U.S. Patent Publication No. 20050064474), in the presence of the Scd27-FokI zinc finger fusion protein, the two binding sequences were recognized and the double stranded DNA breaks were induced at both locations, which removed the ~6 kb DNA fragment between these two binding sequences and stimulated the endogenous DNA repair process. Similarly to strategy 1, in the presence of donor DNA, which contained homologous sequences identical to that of the target sequence, the 5 'partial PAT gene along with its promoter was inserted into the target sequence by homologous recombination at the site where the breaks of the double stranded DNA were induced. Through this process, the two partial sequences of the PAT gene with the 4-CoAS intron 1 interposed between them, a functional PAT gene was reconstituted, resulting in the expression of PAT and the herbicide resistance phenotype. The Agrobacterium-mediated transformation of the BY2-380 target cell culture was performed as described above. For each experiment, 12 coculture plates were generated as follows: one plate contained cells cocultivated with 50 μg of an Agrobacterium strain bearing pDABl600 (donor DNA) and 250 μg of the Agrobacterium base strain LBA4404; one plate contained cocultivated cells with 50 μg of an Agrobacterium strain bearing pDABl601 (selectable marker with PAT) and 250 μg of Agrobacterium strain base LBA4404; two plates containing 50 μg of an Agrobacterium strain bearing pDABl600 (donor DNA) and 250 μg of an Agrobacterium strain bearing pDAB4351 (C2H2 IL-1 ZFP-Fok1); three plates contained co-cultured cells with 50 μg of an Agrobacterium strain bearing pDAB 1600 (donor DNA) and 250 μg of an Agrobacterium strain bearing pDAB4356 (C3H IL-1 ZFP-Fok1); two plates contained co-cultured cells with 50 μg of an Agrobacterium strain bearing pDABl600 (donor DNA) and 250 μg of an Agrobacterium strain bearing pDABl598 (C2H2 Scd 27a ZFP-Fok1); three plates contained co-cultured cells with 50 μg of an Agrobacterium strain bearing pDABl600 (donor DNA) and 250 μg of an Agrobacterium strain bearing pDAB4359 (C3H Scd27a ZFP-Fok1). After coculture using the methods described above, the cells were seeded in LS-based basal medium containing 500 mg / l carbenicillin and 15 mg / l Bialaphos®. Individual isolates resistant to Bialaphos ® emerged 2-4 weeks after seeding and were transferred to individual 60x20 mm plates (one isolate per dish) where they were kept as callus in a 14 day subculture protocol until required for analysis.

Multiple isolates resistant to

Bialaphos® from the zinc finger nuclease C3H IL-1 (pDAB4356) and the zinc finger nuclease C3H Scd27 (pDAB4359). These isolates were analyzed by PCR using the primer pair P24 / 25, which amplified a DNA fragment spanning the reconstituted PAT gene. The P24 primer was homologous to the 5 'end of the PAT coding sequence in the donor DNA and the P25 primer was homologous to the 3' end of the PAT coding sequence in the target DNA. A 2.3 kb PCR fragment would result if two partial PAT coding sequences were ligated by homologous recombination. As shown in Fig. 63, a 2.3 kb PCR product was obtained from multiple isolates analyzed. These isolates were obtained from cotransformation of the IL-1 C3H-FokI / donor DNA zinc finger fusion protein gene and the Scd27 C3H-FokI / donor DNA zinc finger fusion protein gene. The 2.3 kb PCR products derived from multiple independent isolates representative of those derived from the IL-1 C3H-FokI zinc finger fusion proteins and the Scd27 C3H-FokI zinc finger fusion proteins were purified from agarose gels and cloned into the pCR2.1 TOPO vector (Invitrogen, Carlsbad, California). The 2.3 kb PCR product inserted into the TOPO vector was then sequenced using the Dye Terminator Cycle Sequencing Kit (Beckman Coulter) sequencing kit. Sequencing results confirmed that all PCR products cloned into the TOPO vector contained the recombined sequence as predicted, including the 5 'and 3' partial sequences of the PAT gene with the intercalated A. thaliana 4-CoAS intron 1. These results confirmed the predicted cross-chromosomal recombination for both strategies and exemplified gene targeting through the expression of C3H-Fok1 zinc finger fusion proteins.

Example 13: Identification of target gene sequences in maize cell culture A. Sequence identification

In this example, DNA sequences from a known endogenous maize gene were selected as targets for genome editing using zinc finger nucleases. The genomic structure and sequence of this gene, referred to as IPP2-K, which is derived from a syngeneic line of 5XH751 maize co-property, has been described in WO2006 / 029296; the disclosure of which is hereby incorporated by reference.

In particular, the genomic sequence of IPP2-K was used to search the TIGR corn genome database (available on the web at http://www.tigr.org/tdb/tgi/ maize /) using BLAST algorithms. Several other genomic fragments were identified with overlapping homology segments with IPP2-K, including, but not limited to, AZM515213 and TC311535. Based on the sequence of these accession numbers as well as the IPP2-K sequence, multiple short oligonucleotides were designed for use as PCR primers using the Primer3 program (Rozen, S. and Skaletsky, HJ. (2000) Primer 3 on the In general, the use of biotechnology as a biolog- ical agent for the use of biolog- ical biologists is a common practice in biotechnology. These primer sequences include, but are not limited to, the following oligonucleotides with forward orientation: 1. 5'-ATGGAGATGGATGGGGTTCTGCAAGCCGC-3 '(SEQ ID NO: 104) 2. 5'-CTTGGCAAGGTACTGCGGCTCAAGAAGATTC-3' (SEQ ID NO: 161) 3. 5'-ATGAAGAAAGACAGGGAATGAAGGAC-3 '(SEQ ID NO: 162) 4. 5'-ATGAAGAAAGACAGGGAATGAAGGACCGCCAC-3' (SEQ ID NO: 163) 5. 5'-CATGGAGGGCGACGAGCCGGTGTAGCTG-3 '(SEQ ID NO: 164) '-ATCGACATGATTGGCACCCAGGTGTTG-3' (SEQ ID NO: 165)

In addition, the starter sequences include, but are not limited to, the following reverse oriented oligonucleotides: 5'-TTTCGACAAGCTCCAGAAAATCCCTAGAAAC-3 '(SEQ ID NO: 166) 8. 5'-ACAAGCTCCAGAAAATCCCTAGAAACAC-3' (SEQ ID NO: (SEQ ID NO: 168). 5'-TGCTAAGAACATTCTTTTCGACAAGCTCC-3 '(SEQ ID NO: 169) 11. 5'-GAACATTCTTTTCGACAAGCTCCAGAAAATCC-3' (SEQ ID NO: 168) 9. 5'-TTCGACAAGCTCCAGAAAATCCCTAGAAACAC-3 '

All primer oligonucleotide sequences were synthesized and purchased from Integrated DNA Technologies (EDT, Coralville, IA). B. Hill Corn Cell Culture

In order to obtain immature embryos for the initiation of callus culture, Fi crosses were performed between greenhouse grown Hi-II A and B progenitors (Armstrong, C, Green, C. and Phillips, R. (1991) Maize Genet. Lett., 65: 92-93). Embryos of approximately 1.0-1.2 mm in size (-9-10 days after pollination) were harvested from healthy spindles and sterilized on the surface by scrubbing with Liqui-Nox® soap, followed by immersion in 70% ethanol for 2- 3 minutes, then immersed in 20% commercial bleach (0.1% sodium hypochlorite) for 30 minutes.

The spikes were rinsed in sterile distilled water and the immature zygotic embryos were excised aseptically and cultured in 15Ag0 medium (Medium N6 (Chu CC, Wang CC, Sun CS, Hsu C, Yin KC, Chu CY, and Bi FY (1975 ) Synic 18: 659-668), 1.0 mg / l 2,4-D, 20 g / 1 sucrose, 100 mg / l casein hydrolyzate (enzymatic digestion), 25 mM L-proline, 10 mg / 1 AgNCh, 2.5 g / 1

Gelrite, pH 5.8) for 2-3 weeks with the scutellum facing upwards relative to the medium. Tissues with the expected morphology (Welter, ME, Clayton, DS, Miller, MA, Petolino, JF. (1995) Plant Cell Rep: 14: 725-729) were selectively transferred, at intervals of two weeks, to fresh 15Ag0 medium for about 6 weeks, then transferred to medium 4 (Medium N6, 1.0 mg / l 2,4-D, 20 g / 1 sucrose, 100 mg / 1 casein hydrolyzate

(enzymatic digestion), 6 mM L-proline, 2.5 g / 1 Gelrite, pH 5.8) at two week intervals for approximately 2 months.

To initiate suspension embryonic cultures, a volume of approximately 3 ml of calf tissue pelleted cells (PCV) derived from a single embryo was added to approximately 30 ml of H9PC + liquid medium (MS basal salt mixture (Murashige T., & MS modified vitamins containing 10 times less nicotinic acid and 5 times more thiamine-HCl, 2.0 mg / 1 2,4-D, 2.0 30 mg / 1 sucrose, 200 mg / 1 casein hydrolyzate (acid digestion), 100 mg / 1 myoinositol, 6 mM L-proline, 5% v / v water of coconut (added just before the subculture), pH 6.0). Suspension cultures were kept in the dark in 125 ml Erlenmeyer flasks on a temperature controlled shaker set at 125 rpm at 28øC. During the establishment of the cell line (2-3 months) the suspensions were cultured every 3.5 days by the addition of 3 ml PCV of cells and 7 ml of conditioned medium to 20 ml of fresh H9CP + liquid medium using a nozzle pipette long When maturity reached, as evidenced by doubling the growth, the suspensions were increased in volume and kept in 500 ml vials whereby 12 ml PCV cells and 28 ml conditioned media were transferred to 80 ml H9CP + medium. When the establishment of the suspension culture was completed, aliquots were cryopreserved for further use. See WO 2005/107437.

C. DNA isolation and amplification

Corn Hill cell cultures as described above were grown in 250 ml vials in standard GN6 medium (N6 medium, 2.0 mg / l 2,4-D, 30 g / 1 sucrose, 2.5 g / l

Gelrite, pH 5.8) and the genomic DNA was extracted using the Qiagen Plant DNeasy extraction kit (Valencia, CA) according to the manufacturer's recommendations. PCR amplification reactions using the primers described above in all possible combinations were performed under the following conditions: 25 μΐ reaction volume containing 20ng gDNA array, 20 pmole of each primer, 1% DMSO, and 10 units of Accuprime ™ polymerase Pf (Invitrogen, Carlsbad, CA) in the enzyme manufacturer's buffer. Amplification products ranging from 500 bp to 2 kb resulted from amplification cycles consisting of 95 ° C-1 ', (95 ° C-30 ", 57-62 ° C-30 ", 72 ° C-1') X 30, 72 ° C-5 ', 4 ° C-remainder time. The amplified fragments were cloned directly into pCR2.1 (Invitrogen, Carlsbad, CA) using the Invitrogen TA cloning kit (Carlsbad, CA) according to the manufacturer's recommendations. D. Analysis of Sequences Previous analysis of the IPP2-k gene in syngeneic cultures of 5XH751 and Hill maize indicated the presence of 2-3 distinct genes comprising a small family of genes (Sun et al., In press, Plant Physiology; WO2006029296) . Thus, isolated cloned fragments were sequenced with the Beckman Coulter CEQ Dye Terminator Cycle Sequencing Kit (Fullerton, CA) sequencing kit according to the manufacturer's recommendations. Analysis of the sequence of multiple clones revealed that 2 distinct gene fragments, derived from distinct and previously characterized loci of the maize genome, had been isolated from Hill cells. Comparison of the two isolated sequences from cultured Hill cells indicated that in the predicted coding regions, there are small differences, such as isolated nucleotide polymorphisms (SNPs), between the two paralogs, whereas the intronic and non-coding regions vary significantly at the level two nucleotides. These differences between the two paralogues are noted since they show regions of sequences that can be discriminated through a sequence dependent DNA binding protein, such as a zinc finger domain. Those skilled in the art can draw DNA finger binding domains that bind to a sequence of one gene and not to another, sequence of a highly similar gene. The partial sequence of the 1.2 kb gene corresponding to the paralog of interest (Fig. 66) was selected as the template for the design of zinc finger nucleases proteins and subsequently subjected to the analysis of zinc finger binding domains described above.

Example 14: Design of the zinc-fingered domino of DNA binding of IPP2-K

Using target sites identified for IPP2-K, recognition fingers were selected for zinc finger IPP2-K. The zinc finger designs are shown below in Table 8:

Table 8: Designs of zinc finger IPP2-K

The target sites of the zinc finger designs are shown below in Table 9:

Table 8: Zinc finger target sites IPP2-K

The IPP2-K designs were incorporated into zinc finger expression vectors encoding a protein having the CCHC structure. See, Tables 1 to 4 above. The non-canonical zinc finger coding sequences were then fused to the Fokl IIS restriction enzyme nuclease domain (amino acids 384-579 of the sequence Wah et al. (1998) Proc. Natl. Acad. ScL USA 95: 10564- 10569 through a four amino acid ZC linker) to form IPP2-K ZFNs.

The ability of IPP2-K ZFNs as described herein to facilitate homologous recombination was tested in the GFP system described in Urnov (2005) Nature 435 (7042): 646-51 and U.S. Patent Publication No. 20050064474 (eg,

Examples 6-11). Briefly, 50 ng of each ZFN and 500 ng of the no-promoter GFP donor (Urnov (2005) Nature) were transfected into 500,000 reporter cells using 2 μl of Lipofectamine 2000 per sample according to Invitrogen's Lipofectamine 2000 protocol.

Twenty-four hours post-transfection was added to a final concentration of 0.2 μg and removed 72 hours post-transfection.

Cells were tested for GFP expression 5 days post-transfection by measuring 40,000 cells per transfection in the Guava bench-top FACS analyzer. The results are shown in Fig. 69.

Example 16: Expression of C3H1 ZFNs in

corn HiII A. Vector drawing

Plasmid vectors were constructed for the expression of proteins with ZFNs in maize cells. In order to optimize expression and relative stoichiometry of the 2 distinct proteins required to form a zinc-nuclease finger functional heterodimer, an expression strategy was adopted which results in open reading frames of both ZFN monomers in a single vector, directed by a single promoter. This strategy exploits the functionality of the Thesoa virus derived sequence 2A (Mattion, NM, Harnish, EC, Crowley, JC & Reilly, PA (1996) J. Virol. 70, 8124-8127), a nuclear localization signal (NLS) of the opaque-2 (op-2) gene of maize (Maddaloni, M., Di Fonzo, N., Hartings, H., Lazzaroni, N., Salaminil, F., Thompson, R., & Motto M. (1989) Nucleic Acids Research Vol. 17 (18): 7532), and a promoter derived from the corn ubiquitin-1 gene (Christensen AH, Sharrock RA, & Quail PH (1992) Plant

MoI Biol. 18 (4): 675-89). A modular, multi-step cloning scheme was followed to develop these expression vectors for any specific pair of ZFN encoding genes selected from the library file or de novo synthesized.

First, a pVAX vector (see, for example, U.S. Patent Publication 2005-0267061; the disclosure of which is incorporated herein by reference) was modified to encompass the N-terminal expression domain as shown in Fig. 65, panels A to E. The characteristics of this modified plasmid (pVAX-N2A-NLSop2-EGFP-FokMono) (FIG 65A) include a redesigned and synthesized segment encoding a corn op-2 derivative NLS (RKRKESNRESARRSRYRK, SEQ ID NO: 133 ) and a concatenated and synthesized network segment encoding the Fokl nuclease domain using the codons most commonly used by maize. In addition, insertion of a single nucleotide (C) downstream of the unique Xhol site has created an extra Saci site for convenience of cloning.

Second, a pVAX vector (see, for example, U.S. Patent Publication 2005-0277061) was also modified to encompass the C-terminal expression domain The characteristics of this modified plasmid (pVAX-C2A-NLSop2-EGFP-FokMono) (FIG 65B) include a redesigned and synthesized segment encoding a corn op-2 derived NLS (RKRKE SNRE S ARRS RYRK, SEQ ID NO: 133) and a redesigned and synthesized segment encoding the Fokl nuclease domain using the codons most commonly used by corn. In addition, Sucha virus sequence 2A assigns (EGRGSLLTCGD VEENPGP, SEQ ID NO: 134) was introduced at the N-terminus of the ZFN ORF for the purpose of subsequent binding of the 2-protein coding domains.

The gene cassettes encoding the ORFs of the individual zinc finger proteins were cloned into the N2A or C2A vector by ligation using restriction enzymes KpnI and BamHI to create compatible ends. Thereafter, the BglII / XhoI fragment of the C2A vector was inserted into the N2A vector through the same restriction sites, giving an intermediate construct having a cassette that includes 2 ZFN coding domains flanked by NcoI and SaciI restriction sites.

Finally, the NcoI / SacI cassette of this intermediate construct (Fig. 65C), containing both ZFN genes, was excised by restriction using those enzymes and ligated to the backbone of plasmid pDAB3872 (FIG 65D). The resulting plasmids include the ZFN genes plus the relevant promoter and terminator sequences, plus selectable tags for the maintenance of the plasmid.

In the final constructs, an example of which is shown in Fig. 65E, the ZFN expression cassette (including the promoter and terminator elements) is flanked by attL sites for convenient manipulation using the Invitrogen Gateway system (Carlsbad, CA) . Each of the ZFN constructs generated using this cloning scheme was used to transform E. coli DH5α cells (Invitrogen, Carlsbad, CA) and subsequently maintained under suitable selection. B. DNA delivery and transient expression

The plasmid preparations of the ZFN expression vectors constructed as described in Fig. 65E were generated from 2 liters of E. coli cell culture grown in LB medium plus two antibiotics using a Gigaprep kit from Qiagen (Valencia, CA) of accordance with the manufacturer's recommendations. Plasmid DNA was delivered directly to Hill corn cells in culture using a variety of methods.

In one example, the maize cells were subjected to DNA delivery through Whoskers ™. Approximately 24 hours prior to DNA delivery, 3 ml PCV of Hill corn cell suspension plus 7 ml of conditioned media were subcultured in 20 ml of GN6 liquid medium (GN6 medium without Gelrite) in a 125 ml Erlenmeyer flask and placed on a shaker at 125 rpm, at 28 ° C, for 24 hours. 2 ml of PCV were removed and added to 12 ml of GN6 S / M osmotic medium (N6 medium, 2.0 mg / l 2,4-D, 30 g / 1 sucrose, 45.5 g / 1 sorbitol, 5 g / 1 mannitol, 100 mg / L myoinositol, pH 6.0) in a 125 ml Erlenmeyer flask. The flask was incubated in the dark for 30-35 minutes at 28øC with moderate agitation (125 rpm). During this time, a suspension of 50 mg / ml of silicon carbide vanes (Advanced Composite Materials, Inc., Eureka Springs, AK) was prepared by adding the appropriate volume of GN6 S / M liquid medium to pre-weighed vanes . After incubation in GN6 S / M, the contents of each vial were poured into a 15 ml conical centrifuge tube.

After sedimentation of the cells, all of the GN6 S / M liquid except 1 ml was withdrawn and collected in the 125 ml vial for future use. The preweighed vane suspension was vortexed for 60 seconds at full speed, 160 μΐ was added to the centrifuge tube using a broad-tip filter micropipette tip, and 20 μg of DNA added. The tube was vortexed and immediately placed in a Caulk ™ Vari-Mix II dental amalgamator modified to support a 17x100 mm culture tube and then stirred for 60 seconds at medium speed. After stirring, the mixture of cells, medium, vanes and DNA returned to the Erlenmeyer flask along with 18 ml of more GN6 liquid medium. Cells were allowed to recover on a shaker at 125 rpm for 2 hours at 28øC in the dark.

Approximately 5-6 ml of dispersed suspension was filtered through a Whatman # 4 (5.5 cm) filter paper using a glass cell collector unit connected to a vacuum line so that 5-6 filters per sample. The filters were plated onto 60 x 20 mm plates of G6N medium and grown at 28 ° C in the dark. After 24, 48 or 72 hours, the cells of 2-5 filter papers were scraped, collected in a tube, placed on dry ice and then frozen at -80Â ° C.

In another example of DNA delivery, the purified plasmid preparations without endonucleases were delivered directly to maize cells using microprojectile bombardment techniques adapted from the protocol of the instrument manufacturer. All bombardments were conducted with the Biolistic PDS-1000 / He ™ system (Bio-Rad Laboratories, Hercules, CA). For coating the particles, 3 mg of 1.0 micron diameter gold particles were washed once with 100% ethanol, twice with sterile water and resuspended in 50 μl of water in a siliconized Eppendorf tube. Five micrograms of plasmid DNA, 20 μ of spermidine (0.1 M) and 50 μ of calcium chloride (2.5 M) were added to the gold suspension. The mixture was incubated at room temperature for 10 min, sedimented at 10 Krpm for 10 s, resuspended in 60 μΐ of cold 100% ethanol and 8-9 μΐ were distributed over each macroveicle. To prepare the cells for bombardment, groups of cells were removed from the liquid culture 3 days after subculture and placed in a 2.5 cm diameter petri dish containing osmotic medium consisting of growth medium plus 0.256 M mannitol and sorbitol. Cells were incubated in osmotic medium for 4 h prior to bombardment. The bombardment took place in the instrument described above by placing the fabric on the middle shelf under the conditions of 1100 psi and vacuum of 27 inches Hg and following the manual of handling. At 24 hours post-treatment, the bombarded cell pool was harvested, frozen in liquid N2 and stored at -80 ° C.

Another example of DNA delivery and transient expression of ZFNs in maize cells involved the use of protoplast preparations. Using the modified methods of Mitchell and Petolino (1991) J. Plant. Physiol. 137: 530-536 and Lyznik et al. (1995) Plant J. 8 (2): 177-186), protoplasts were prepared from Hill corn cell cultures. Suspension cultures were harvested 48 hours after subculture (growth in the middle of the log phase) by centrifugation at 1000 rpm for 5 minutes. The culture medium was removed and 5 ml PCV pelleted was gently washed in 10 ml W5 medium (154 mM NaCl2, 125 mM CaCl2 H2O, 5 mM KCl2, 5 mM glucose, pH 5.8).

The washed cells were harvested by centrifugation at 100 rpm for 5 minutes and subsequently incubated in a mixture of% cellulase YC + 0.3% pectinase Y23 (Karlan Research Products Corp., Cottonwood, AZ) in 25 ml of K3 medium sterilized by (2.5 g KNO 3, 250 mg NH 4 NO 3, 900 mg CaCl 2 (dihydrate), 250 mg MgSO 4, 250 mg NH 4 SO 4, 150 mg NaPCh (monobasic), 250 mg xylose, 10 ml ferrous sulfate / chelate stock (F318); ml micronutrient B5 (1000X stock - 750 mg potassium iodide 250 mg molybdic acid (sodium salt) dehydrated 25 mg cobalt chloride 25 mg cupric sulfate) 10 ml Vitamins K3 (10 OX stock - 1 g myo-inositol; The cells were incubated at 25Â ° C for 5-6 hours with gentle shaking (50 rpm) in vacuo. to digest the secondary wall of the plant cell.

Upon cell wall degradation, the cell-enzyme mixture was filtered through a 100 micron cell strainer and the unretained stock containing protoplasts and cell debris was washed with an equal volume of K3 + 0.6M mannitol medium. The protoplasts were centrifuged at 800 rpm for 5 minutes, the supernatant discarded and repeated washing. The protoplast pellet was resuspended and washed in 20 ml K3 + 0.6 M solution mannitol + 9% Ficoll 400. Ten ml of this solution was distributed through 2 sterile plastic tubes and the suspension was gently covered with 2 ml of medium (19.52 g MES, 36.45 g mannitol, 40 ml 2M CaCl 2 H 2 O stock, pH = 5.5)), forming a discontinuous gradient.

Viable protoplasts were separated from non-viable protoplasts, cell debris and suspension of intact cells by centrifugation at 800 rpm for 5 minutes. The distinct protoplast band formed at the gradient interface was pipetted and washed with 10 ml of fresh TM solution followed by centrifugation at 800 rpm for 5 minutes. The resulting protoplast pellet was resuspended in 1 ml TM medium and the number of viable protoplasts was quantified by staining with 25 mg / ml fluorescein diacetate (FDA) on a hemocytometer. The protoplast solution was adjusted to a final concentration of 1x107 protoplasts / ml in TM medium.

Approximately 1 x 106 protoplasts (100 μΐ) were transferred to an Eppendorf tube containing 10-80 μg of purified plasmid DNA. 100 μl of a 40% solution of PEG-3350 (Sigma Chemical Co., St. Louis, MO) was added dropwise and the slurry mixed gently. The protoplast / DNA mixture was incubated for 30 minutes at room temperature, followed by a dropwise dilution with 1 ml of GN6 growth medium. The diluted protoplasts were incubated in this medium for 24 hours at 25 ° C and subsequently collected, frozen in liquid N2 and stored at -80 ° C.

The functionality of a ZFN in vivo in this example is understood to include (but is not limited to) the ability of a ZFN to express itself in cells of a cultured species and that ZFN mediate a double strand break in the endogenous genome of this cultivar, through the recognition, binding and cutting of its intended target. It is also understood that, in this example, the ZFN target is a gene at an endogenous locus and conformation within the genome of the cultivar.

In order to assess whether ZFNs have functionality against the predicted target gene in a genomic context, assays based on DNA sequences have been established. ZFN-induced double-stranded DNA breaks are predicted to induce repair mechanisms as non-homologous (NHEJ) binding (reviewed by Cahill et al., (2006) Mechanisms Front Biosci. 1 (11): 1958-76 ). One end of NHEJ is that a proportion of the broken DNA strands are repaired in an imperfect form, resulting in minor deletions, insertions or substitutions at the locus of DNA. Those skilled in the art can detect these changes in the DNA sequence through a variety of methods.

A. PCR-based cloning and sequencing

In one example, corn Hill cell cells expressing ZFN proteins were isolated at 24 hours post-processing, frozen and subjected to genomic DNA extraction using the Qiagen (Valencia, CA) Plant DNeasy extraction kit according to the recommendations of the manufacturer. PCR amplification was performed using oligonucleotide primer sequences specific for the target gene and flanking the predicted cleavage site of the ZFN. A primer with direct orientation PCR (5'-GGAAGCATTATTCCAATTTGATGATAATGG-3 ') (SEQ ID NO: 135) and a specific reverse primer PCR (5'-CCCAAGTGTCGAGGTTGTCAATATGTTAC-3') (SEQ ID NO: 136) were used in combination to amplify purified genomic DNA under the following conditions: 25 μl reaction volume containing 20ng of gDNA matrix, 20 pmol of each primer, 1% DMSO and 10 units of the Accuprime Pf polymerase ( Invitrogen, Carlsbad, CA) in the enzyme manufacturer's buffer. Amplification products of the expected size resulted from amplification cycles consisting of 95Â ° C-1 ', (95Â ° C-30Â °, 61Â ° C-30Â °, 72Â ° C-1') X 30.72Â ° C- 5 ', 4 ° C-remainder.

The amplified fragments were cloned directly into the pCR2.1 vector (Invitrogen, Carlsbad, CA) using the Invitrogen TA cloning kit (Carlsbad, CA). The isolated cloned fragments were sequenced with the Beckman Coulter CEQ Dye Terminator Cycle Sequencing Kit (Fullerton, CA) according to the manufacturer's recommendations in a 96-well format. In this experiment, ZFN proteins are predicted to bind to 2 specific short sequences of the IPP2-K gene to create a heterodimeric nuclease that cleaves the dsDNA as shown in Fig. 66. Analysis of the sequencing results of multiple clones revealed that clone # 127 contained a small deletion at the exactly predicted ZFN cleavage site, indicating that the NHEJ mechanism had mediated an imperfect repair of the DNA sequence at that site (Fig.

These results demonstrate the ability of these ZFNs engineered to induce double stranded breaks directed, in a specific form, into a locus of an endogenous gene within a cultivar. B. Analysis by parallel mass sequencing

In another example, a combination of PCR and parallel mass pyro-sequencing methods were applied to query the genomes of multiple cell samples expressing different ZFN proteins directed against this same sequence. Three variants of a direct guiding PCR primer (5'-XXXCACCAAGTTGTATTGCCTTCTCA-3 ') (SEQ ID NO: 137) where XXX = GGG, CCC or GGC were synthesized and three variants of a reverse-oriented PCR primer (5'-XXXAT AGGCTTGAGCCAAGCAATCTT-3 ') (SEQ ID NO: 138) where XXX = GCC, CCG or CGG (IDT, Coralville, IA). The 3 bp labels at the 5 'end of each primer serve as a tag and indicate the cell sample from which the amplicon is derived. Pairs of primer sequences with corresponding tag (s) were used in combination to amplify purified genomic DNA derived from maize cell samples under the following conditions: 50 μl reaction volume containing 40 ng of gDNA array, 20 pmol of each primer sequence , 1% DMSO and 10 units Accuprime ™ Pf polymerase (Invitrogen, Carlsbad, CA) in the enzyme manufacturer's buffer. The amplification products of the expected size resulted from amplification cycles consisting of 95 ° C-1 ', (95 ° C-30 ° C, 65 ° C-30 ° C, 72 ° C-1') X 30.72 ° C- 5 ', 4Â ° C-remainder time and were purified using the Qiagen (Valencia, CA) MinElute PCR purification kit according to the manufacturer's recommendations.

Mass parallel pyro-sequencing reactions (also known as 454 sequencing) were performed directly on the PCR products as described in (Margulies et al. (2005) Nature 437: 376-380) by 454 Life Sciences (Branford, CT). The analysis of sequencing results 454 was performed by identifying sequence readings containing deletions of expected size and position within the DNA molecule.

The results of these analyzes indicated the presence of multiple small deletions at the expected cleavage site for these ZFNs as shown in Fig. 68. These deletions are precisely located at the target site of ZFN and indicate that ZFN induced ds breaks were generated in the genome and subsequently repaired by NHEJ. These results further demonstrate the ability of these engineered ZFNs to induce targeted double stranded breaks in a specific form at an endogenous gene locus within a cultivar.

Example 18: Donor DNA design for targeted integration

In this example, donor DNA is understood to include double-stranded DNA molecules that are delivered to plant cells and incorporated into the nuclear genome. The mechanism by which this incorporation occurs may be via homology-independent homology linkage (NHEJ; revised by Cahill et al., (2006) Mechanisms Front Biosci. 1: 1958-76) or another similar mechanism at the site of a breaking the double strand in nuclear DNA. Such incorporation of the NHEJ-driven binding donor DNA into the genome is referred to as random integration, since the position of the donor DNA integration is determined primarily by the presence of a double-stranded DNA break. In this mechanism, the integration of donor DNA into the genome is not dependent on the nucleotide sequence of the genome at the site of the donor's own nucleotide break or sequence. Thus, during random integration, the " address " in the genome where the donor DNA is incorporated is neither specified nor predicted based on the donor DNA sequence. Random integration is the major mechanism by which transgenesis of donor DNA occurs during standard transformation of plants via Agrobacterium-mediated DNA delivery or by biolysis in plant cells.

Unlike random integration, donor DNA can also be incorporated into the genome through targeted integration. Targeted integration is understood to occur at the site of a double-stranded breakdown (position) through homology-dependent mechanisms such as homology-dependent simple chain matching or homologous recombination (reviewed in van den Bosch et al. (2002) Biol Chem 383 (6): 873-892). In the case of repairing homology-dependent DNA breaks, the donor DNA containing the nucleotide sequence with identity or similarity to the DNA of the site of the break can be incorporated therein. Thus, the " address " wherein the donor DNA integrates into the genome is dependent on the nucleotide sequence identity or sequence similarity between the genome and donor DNA molecules. In plant systems, repair of double strand breaks in DNA is known to utilize NHEJ and homology-dependent pathways (reviewed in Puchta (2005) J. Exp. Bot. 56: 1-14).

In this example, we describe the design and construction of donor DNA molecules to be integrated into the genome via targeted integration at the site of a double strand break induced by sequence specific ZFN proteins.

Different ZFN proteins can induce double-strand breaks in different nucleotides in the target gene sequence; the specific location of the induced double strand break is referred to as the position.

As described in Example 13, we characterize the nucleotide sequence of a target gene, maize IPP2K. Subsequently, we designed ZFN proteins to bind to specific bases of that target gene (Example 14) and validated their binding / cleavage activity in that sequence within the target gene in both heterologous systems and against the endogenous gene in maize cells (Examples 15 -17). Here we describe the construction of various donor molecules designed to incorporate into the maize genome in the position of the ZFN-mediated double-strand break in the IPP2K gene via targeted integration. Those skilled in the art can construct a donor DNA molecule designed to incorporate into a double stranded, ZFN-induced breakdown via homology driven homology at any position in any genome for which the nucleotide sequence is known and is predicted to this sequence contains a double stranded break.

In one embodiment described herein, the donor DNA molecule comprises an autonomous herbicide tolerance gene expression cassette delimited by nucleotide sequence segments identical to that of the target gene, IPP2K at the target position. In this embodiment, the autonomous herbicide tolerance cassette includes a full promoter-transcription unit (PTU) containing a promoter, the herbicide tolerance gene and functional terminator sequence in plant cells. Those skilled in the art may select any combination of promoter, gene and terminator to constitute the autonomous PTU. Also included in this plasmid construct are DNA fragments with sequence identity to the target gene in maize (IPP2K) at the indicated position. These fragments serve as " flanking sequences of homology " of the donor DNA and direct incorporation of this donor into the target gene at the specified position through targeted integration. Homology flanking sequences are placed upstream and downstream of the PTU in the correct 5'-3 'orientation relative to PTU. Those skilled in the art may consider flanking sequences of homology of different size and orientation in a donor DNA construct.

In another embodiment described herein, the donor DNA molecule comprises a plasmid construct containing a non-autonomous herbicide tolerance gene expression cassette flanked by nucleotide sequence segments identical to those of IPP2K at the target position. In this embodiment, the non-autonomous herbicide tolerance cassette includes an incomplete promoter-transcription unit (PTU) which lacks a functional promoter. Non-autonomous PTU has a herbicide tolerance gene and functional terminator sequence in plant cells. Those skilled in the art may select any combination of the gene and terminator to constitute a non-autonomous PTU. In this example of a non-autonomous donor, expression of the herbicide tolerance gene is dependent upon incorporation of the donor segment at a genomic location close to a functional promoter that can direct the expression of that gene. Consideration should be given to the relatively rare situation in which the donor will be incorporated by random integration into a genetic locus where a promoter is serendipitously located and available to direct expression of the herbicide tolerance gene. As an alternative, based on the presence of flanking sequences of homology of DNA fragments of suitable size with sequence identity to the target gene at a specified position in maize within the donor DNA construct, precise targeting of donor DNA into the target gene can occur in the target gene position (as described for the autonomous donor) and therefore exploits the endogenous promoter of said target gene. In this embodiment, the homology flanking sequences are placed upstream and downstream of the PTU at the correct orientation 5'-3 'to the PTU. Those skilled in the art may consider flanking sequences of homology of different size and orientation in a donor DNA construct.

In both embodiments described herein (autonomous and non-autonomous donor design), plasmid constructs typically have additional elements to enable cloning, herbicide tolerance gene expression and subsequent analysis. Such elements include bacterial origins of replication, restricted restriction sites, etc. and are described below. Those skilled in the art may consider using different constituent elements of a donor DNA molecule. A. Bacterial strains and culture conditions

Escherichia coli strains (One Shot® Top 10 Chemically Competent Cells; MAX Efficiency® DH5a ™ Chemically Competent Cells, Invitrogen Life Technologies, Carlsbad, CA) were grown at 37 ° C, 16 hrs, using Luria-Bertani liquid medium (LB 10 g / 1 NaCl, 5 g / 1 Bacto yeast extract), LB agar (LB liquid medium plus 15 g / 1 Bacto agar), or Terrific medium (TB: 12 g / 1 Bacto-tryptone , 24 g / 1 yeast extract

Bacto, 0.4% v / v glycerol, 17 mM KH 2 PO 4, 72 mM K 2 HPO 4). The liquid cultures were shaken at 200 rpm. Chloramphenicol (50æg / ml), kanamycin (50æg / ml) or ampicillin (100æg / ml) were added as needed. All antibiotics, culture media and buffer reagents used in this study were purchased from Sigma-Aldrich Corporation (St. Louis, MO) or Difco Laboratories (Detroit, MI). B. Plasmid Skeletal Position 1

A plasmid backbone containing homology flanking sequences for the 1-position of IPP2K was manipulated to allow integration of the donor DNA sequence at the corresponding target site of the IPP2K gene. Those skilled in the art can plan plasmid backbones using various cloning sites, modular elements and homologous sequences of any target sequence within the genome of interest. The plasmid backbone exemplified herein is derived from the plasmid vector pBC SK (-) phagemid (3.4 kbp) (Stratagene, La Jolla, CA). A four-step synthesis as described below was used to construct the 1-position plasmid backbone.

In step # 1, the base plasmid was prepared. Three μg of pBC SK (-) were linearized using restriction endonucleases, 10 units of Spel and 10 units of Notl (New England Biolabs, Beverly, MA) for 1 hr at 37 ° C. The cut DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel (0.04 M Tris-acetate, 0.002 M EDTA) supplemented with 0.5% ethidium bromide (Sigma- Aldrich Corporation, St. Louis, MO). The DNA fragments were visualized with UV light and the size of the fragments estimated by comparison to the 1 kbp DNA ladder (Invitrogen Life Technologies, Carlsbad, CA). The 3.4 kbp sub-cloning vector pBC SK (-), digested with Spel / Notl was removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, HERE).

In step # 2, the 5 'and 3' flanking sequences of IPP2K position 1 were isolated. The following oligonucleotide sequences were synthesized by

Integrated DNA Technologies, Inc. (Coralville, IA) under standard conditions of desalination and diluted with water to a concentration of 0.125 pg / L: 5'-ACGGGCCGCGTCTCACCGCGGCTTGGGGATTGGATACGGAGCT-3 '(SEQ ID NO: 143) 5'-ACTAGTGATATGGCCCCACAGGAGTTGCTCATGACTTG- (SEQ ID NO: 144) 5'-ACTAGTCCAGAACTGGTTGAGTCGGTCAAACAAGATTGCT-3 '(SEQ ID NO: 145) 5'-GTCGACCTTGATGCTACCCATTGGGCTGTTGT-3' (SEQ ID NO: 146)

PCR amplification reactions were performed using reagents provided by TaKaRa

Biotechnology Inc., Seta 3-4-1, Otsu, Shiga, 520-2193, Japan consisting of the following: Five μl of buffer 10X LA PCR ™ Buffer II (Mg2 +), 20 ng gDNA double-stranded matrix (HiII maize) , 10 pmol of the direct oligonucleotide sequence, 10 pmol of the reverse oligonucleotide sequence, 8 μ of the mixture of dNTPs (2.5 mM each), 33.5 μH 2 O, 0.5 μ (2.5 units) TaKaRa LA DNA polymerase Taq ™, 1 drop of mineral oil. PCR reactions were performed using a Perkin-Elmer Cetus thermal cycler, 48-sample DNA Thermal Cycler (Norwalk, CT) under the following conditions: 94øC, 4 min / 1 cycle; 98 ° C 20 sec, 65 ° C 1 min, 68 ° C 1 min / 30 cycles; 72 ° C, 5 min / 1 cycle; 4 ° C / remainder. Fifteen μΐ of each PCR reaction were electrophoresed at 100 V for 1 hr on a 1.0% agarose gel in TAE agarose supplemented with 0.5% ethidium bromide. The amplified fragments were visualized with UV light and the size of the fragments estimated by comparison with a 1 kbp DNA ladder. Expected amplification products were diagnosed by the presence of DNA fragments of 0.821 kpb (5 'homology flanking sequence) or 0.821 kbp (3' homology flanking sequence).

These fragments were removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA). The purified fragments were then cloned into plasmid pCR2.1 using the TOPO TA Cloning Kit Kit (vector pCR®2.1) and One Shot® TOPIO (Invitrogen Life Technologies, Carlsbad, CA) E. coli cells from accordance with the manufacturer's protocol.

Individual colonies were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml TB supplemented with 50 μg / ml kanamycin and incubated 16 hrs at 37 ° C with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a 1.7 ml Costar (Fisher Scientific, Pittsburgh, PA) microfuge tube and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA was isolated as described above using the NucleoSpin® Plasmid Kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three æg of the plasmid isolated from plasmids from the clones with 5 'homology sequences were digested with 10 units of Spel and NotI. Plasmids of clones with 3 'homology sequences were digested with 10 Spel units and 20 Sail units

(New England Biolabs, Beverly, MA). All plasmid digests were incubated for 1 hr at 37 ° C. Restricted enzyme-cut DNA was subjected to electrophoresis at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The fragments were visualized with UV light and the size of the fragments estimated by comparison with a ladder of 1 kbp DNA. Expected plasmid clones were diagnosed by the presence of 0.821 kpb (5 'homology flanking sequence) or 0.821 kpb (3' homology flanking sequence) insert fragments in addition to the 3.9 kbp pCR®2.1 vector.

The double-stranded sequencing reactions of the plasmid clones were performed as described by the manufacturer using the CEQ ™ DTCS-Quick Start Kit kit (Beckman-Coulter, Paio Alto, CA). Reactions were purified using Performa DTR Gel Filtration Cartridges (Edge BioSystems, Gaithersburg, MD) as described by the manufacturer's protocols. Sequencing reactions were analyzed on a Beckman-Coulter CEQ ™ 2000 XL DNA analysis system and nucleotide characterization performed using Sequencher ™ version 4.1.4 (Gene Codes Corporation, Ann Arbor, MI). The sequence of the 0.821 kpb fragment corresponding to the 1 position of the 5 'homology flanking sequence derived from IPP2K is shown in Fig. 87 (SEQ ID NO: 171). The 0.821 kbp fragment sequence corresponding to position 1 of the 3 'homology flanking sequence derived from IPP2K is shown in Fig. 88 (SEQ ID NO: 172).

In step # 3 the 5 'homology flanking sequences for position 1 were attached to the base plasmid. Restriction enzyme-cleaved fragments corresponding to the clones containing the correct 5 'homology flanking sequence were removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc. , Valencia, CA). The fragments corresponding to the 5 'homology flanking sequence for position 1 (0.821 kbp) were then ligated to the Spel / Notl digested purified base plasmid (step # 1) in a ratio of 1: 5 vector: insert using 500 units of DNA- ligase (Invitrogen Life Technologies, Carlsbad, CA) in a reaction volume of 20 μΐ under 16 hr incubation conditions in a water bath at 16 ° C. Five μΐ of the ligation reaction were subsequently used to transform One Shot® TOPIO chemically competent E. coli cells (Invitrogen Life Technologies, Carlsbad, CA) and seeded under the selection conditions described by the manufacturer. Individual colonies were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml TB supplemented with 50 μg / ml kanamycin and incubated 16 hrs at 37 ° C with shaking at 200 rpm.

After incubation, 1.5 ml of cells were transferred to a 1.7 ml Costar (Fisher Scientific, Pittsburgh, PA) microfuge tube and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA isolated as described above using the NucleoSpin® Plasmid Kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three μg of plasmid DNA were digested with 10 units of Spel and Notl (New England Biolabs, Beverly, MA) and incubated for 1 hr at 37 ° C. Restricted enzyme-cleaved DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The fragments were visualized with UV light and the size of the fragments estimated by comparison with a ladder of 1 kbp DNA. Expected plasmid clones were diagnosed by the presence of inserted 0.821 kbp DNA fragments (5 'homology flanking sequence) in addition to the 3.4 kbp base plasmid.

In step # 4, position 1 of the 3 'homology flanking sequences was ligated to the product of step # 3. Three μg of the engineered product described in step # 3 were linearized using restriction enzymes, 10 units Spel and 20 Sail units (New England Biolabs, Beverly, MA) for 1 hr at 37 ° C. Restricted enzyme-cut DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel (0.04 M Tris-acetate, 0.002 M EDTA) supplemented with 0.5% ethidium bromide (Sigma-Aldrich Corporation, St. Louis, MO). The DNA fragments were visualized with UV light and the size of the fragments estimated by comparison with a 1 kbp DNA ladder (Invitrogen Life Technologies, Carlsbad, CA). The ~ 4.2 kpb Spel / SalI digestion product from step # 3 was taken from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA) .

The isolated fragments of the 3 '(0.821 kpb) homology flanking sequences generated in step # 2 were subsequently combined with the product of step # 3 which was digested with Spel / SalI and purified as described above in 20 μl of binding reaction using a vector: insert ratio of 1: 5 and 500 units of T4 DNA ligase (Invitrogen Life Technologies, Carlsbad, CA). Binding reactions were incubated for 16 hours in a water bath at 16 ° C. After ligation, 5 μl of the binding reaction was used to transform chemically competent MAX Efficiency® DH5a ™ cells (Invitrogen Life Technologies, Carlsbad, CA) according to the manufacturer's instructions. Individual colonies inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml of TB supplemented with 50 μg / ml chloramphenicol.

Cultures were incubated for 16 hrs at 37 ° C with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a Costar microfuge tube of 1.7 ml (Fisher Scientific, Pittsburgh, PA) and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA isolated as described above using the NucleoSpin® Plasmid kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three æg of the isolated plasmid were digested with 10 Sail and Notl units (New England Biolabs, Beverly, MA) and incubated for 1 hr at 37øC. Restricted enzyme-cut DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The fragments were visualized with UV light and the size of the fragments estimated by comparison with a ladder of 1 kbp DNA. Expected plasmid clones were diagnosed by the presence of two DNA fragments of 1.64 kbp (insert) and 3.33 kb (plasmid base of 3.4 kbp). The resulting plasmid was designated pDAB7471 (Fig. 70). C. Plasmid Skeletal Position 2

A plasmid backbone containing homology flanking sequences for the 2-position of IPP2K was manipulated to allow integration of the donor DNA sequence at the corresponding target site of the IPP2K gene. Those familiar with the art can plan plasmid skeletons using various cloning sites, modular elements and homologous sequences of any target sequence within the genome of interest. The plasmid backbone exemplified herein is derived from the plasmid base plasmid vector pBC SK (-) (3.4 kbp) (Stratagene, La Jolla, CA). A four-step synthesis, as described below, was used to construct the 2-position plasmid backbone.

In step # 1, the base plasmid was prepared. Three μg of pBC SK (-) were linearized using restriction endonucleases, 10 units of Spel and 10 units of Notl (New England Biolabs, Beverly, MA) for 1 hr at 37 ° C. The cut DNA was electrophoresed at 100 V for 1 hr on a 1.0% agarose gel in TAE (0.04 M Tris-acetate, 0.002 M EDTA) supplemented with 0.5% ethidium bromide (Sigma- Aldrich Corporation, St. Louis, MO). The DNA fragments were visualized with UV light and the size of the fragments estimated by comparison to the 1 kbp DNA ladder (Invitrogen Life Technologies, Carlsbad, CA). The 3.4 kbp, Spel / Notl digested pBC SK (-) subcloning vector was removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, HERE).

In step # 2, the 5 'and 3' flanking sequences of IPP2K position 2 were isolated. The following oligonucleotide sequences were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA) under standard desalination conditions and diluted with water to (SEQ ID NO: 149) 5'-ACTAGTCATGTCGATGGTGGGGTATGGTTCAGATTCAG-3 '(SEQ ID NO: 149) 5'-ACTAGTATTGGCACCCAGGTGTTGGCTCA-3' (SEQ ID NO: 148) 5'-ACTAGTCATGTCGATGGTGGGGTATGGTTCAGATTCAG- 5'-GTCGACGTACAATGATTTCAGGTTACGGCCTCAGGAC-3 '(SEQ ID NO: 150)

PCR amplification reactions were performed using reagents provided by TaKaRa Biotechnology Inc., Seta 3-4-1, Otsu, Shiga, 520-2193, Japan and consisted of the following: Five μl of buffer 10X LA PCR ™ Buffer II (Mg 2 +), 20 ng of double-stranded matrix (Hill maize), 10 pmole of the direct oligonucleotide sequence, 10 pmole of the reverse oligonucleotide sequence, 8 μ of the mixture of dNTPs (2.5 mM each), 33.5 μ H 2 O, 0.5 μΐ (2.5 units) TaKaRa LA Taq ™ DNA polymerase, 1 drop of mineral oil. PCR reactions were performed using a Perkin-Elmer Cetus thermal cycler, 48-sample DNA Thermal Cycler (Norwalk, CT) under the following conditions: 94øC, 4 min / 1 cycle; 98 ° C 20 sec, 55 ° C 1 min, 68 ° C 1 min / 30 cycles; 72 ° C, 5 min / 1 cycle; 4 ° C / remainder. Fifteen μΐ of each PCR reaction were electrophoresed at 100 V for 1 hr on a 1.0% agarose gel in TAE agarose supplemented with 0.5% ethidium bromide. The amplified fragments were visualized with UV light and the size of the fragments estimated by comparison with a 1 kbp DNA ladder. Expected amplification products were diagnosed by the presence of DNA fragments of 0.855 kbp (5 'homology flanking sequence) or 0.845 kbp (3' homology flanking sequence). These fragments were removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA). The purified fragments were then cloned into plasmid pCR2.1 using the TOPO TA Cloning Kit Kit (vector pCR®2.1) and One Shot® TOPIO (Invitrogen Life Technologies, Carlsbad, CA) E. coli cells from accordance with the manufacturer's protocol.

Individual colonies were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml TB supplemented with 50 μg / ml kanamycin and incubated 16 hrs at 37 ° C with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a 1.7 ml Costar (Fisher Scientific, Pittsburgh, PA) microfuge tube and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA isolated as described above using the NucleoSpin® Plasmid Kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three æg of the plasmid isolated from plasmids from clones with 5 'homology sequences were digested with 10 units of Spel and NotI. Plasmids of clones with 3 'homology sequences were digested with 10 units of Spel and 20 units of Sail (New England Biolabs, Beverly, MA). All plasmid digests were incubated for 1 hr at 37 ° C. Restricted enzyme-cut DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The fragments were visualized with UV light and the size of the fragments estimated by comparison with a ladder of 1 kbp DNA. Expected plasmid clones were diagnosed by the presence of inserted 0.855 bpb (5 'homology flanking sequence) or 0.845 kbp (3' homology flanking sequence) inserted DNA fragments in addition to the 3.9 kbp pCR®2.1 vector.

The double-stranded sequencing reactions of the plasmid clones were performed as described by the manufacturer using the CEQ ™ DTCS-Quick Start Kit kit (Beckman-Coulter, Paio Alto, CA). Reactions were purified using Performa DTR Gel Filtration Cartridges (Edge BioSystems, Gaithersburg, MD) as described by the manufacturer's protocols. Sequencing reactions were analyzed on a Beckman-Coulter CEQ ™ 2000 XL DNA analysis system and nucleotide characterization performed using Sequencher ™ version 4.1.4 (Gene Codes Corporation, Ann Arbor, MI). The 0.855 kbp fragment sequence corresponding to the 2-position of the 5 'homology flanking sequence derived from IPP2K is shown in Fig. 89 (SEQ ID NO: 139). The sequence of the 0.845 kbp fragment corresponding to the 2-position of the 3 'homology flanking sequence derived from IPP2K is shown in Fig. 90 (SEQ ID NO: 140).

In step # 3 the 5 'homology flanking sequences for position 1 were ligated to the base plasmid. Restriction enzyme-cut fragments corresponding to the clones containing the 5 'homology flanking sequence to the 2-position were removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA). Fragments corresponding to the 5 'homology flanking sequence at position 1 (0.855 kbp) were then ligated to the purified base plasmid digested with Spel / Notl (step # 1) in a ratio of 1: 5 vector: insert using 500 units of DNA- ligase (Invitrogen Life Technologies, Carlsbad, CA) in a reaction volume of 20 μΐ under 16 hr incubation conditions in a water bath at 16 ° C.

Five μΐ of the binding reaction were subsequently used to transform One Shot® TOPlO chemically competent E. coli cells (Invitrogen Life Technologies, Carlsbad, CA) and seeded under the selection conditions described by the manufacturer. Individual colonies were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml TB supplemented with 50 μg / ml kanamycin and incubated 16 hrs at 37 ° C with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a 1.7 ml Costar (Fisher Scientific, Pittsburgh, PA) microfuge tube and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA isolated as described above using the NucleoSpin® Plasmid Kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three pg of plasmid DNA was digested with 10 units of Spel and Notl (New England Biolabs, Beverly, MA) and incubated for 1 hr at 37 ° C. The restriction enzyme-cleaved DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The fragments were visualized with UV light and the size of the fragments estimated by comparison with a ladder of 1 kbp DNA. Expected plasmid clones were diagnosed by the presence of 0.855 kbp inserted DNA fragments (5 'homology flanking sequence) in addition to the 3.4 kbp base plasmid.

In step # 4, the 3 'homology flanking sequences for position 2 were ligated to the product of step # 3. Three μg of the engineered product described in step # 3 were linearized using restriction enzymes, 10 units Spel and 20 Sail units (New England Biolabs, Beverly, MA) for 1 hr at 37 ° C. Restricted enzyme-cut DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel (0.04 M Tris-acetate, 0.002 M EDTA) supplemented with 0.5% (Sigma-Aldrich Corporation, St. Louis, MO). The DNA fragments were visualized with UV light and the size of the fragments estimated by comparison with a 1 kbp DNA ladder (Invitrogen Life Technologies, Carlsbad, CA). The 4.25 kpb Spel / SalI digestion product from step # 3 was removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA).

The isolated fragments of the 3 '(0.845 kpb) homology flanking sequences generated in step # 2 were subsequently combined with the product of step # 3, which was digested with Spel / SalI and purified as described above, in 20 μl of reaction binding ratio using a vector: insert ratio of 1: 5 and 500 units of T4 DNA ligase (Invitrogen Life Technologies, Carlsbad, CA).

Binding reactions were incubated for 16 hours in a water bath at 16 ° C. After ligation, 5 μl of the binding reaction was used to transform chemically competent MAX Efficiency® DH5a ™ cells (Invitrogen Life Technologies, Carlsbad, CA) according to the manufacturer's instructions. Individual colonies were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml of TB supplemented with 50 μg / ml chloramphenicol. Cultures were incubated for 16 hrs at 37 ° C with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a Costar microcentrifuge tube of 1.7 ml (Fisher Scientific, Pittsburgh, PA) and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA isolated as described above using the NucleoSpin® Plasmid kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three μg of the isolated plasmid were digested with 10 units Sail and Notl (New England Biolabs, Beverly, MA) and incubated for 1 hr at 37 ° C. Restricted enzyme-cleaved DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The fragments were visualized with UV light and the size of the fragments estimated by comparison with a ladder of 1 kbp DNA. Expected plasmid clones were diagnosed by the presence of two 1.7 kbp (insert) and 3.33 kb (base plasmid) DNA fragments. The resulting plasmid was designated pDAB7451 (Fig. 71). D. Construction of the autonomous expression cassette of the herbicide tolerance gene

An autonomic herbicide tolerance gene expression cassette comprising a promoter-transcription unit (PTU) containing promoter, herbicide tolerance gene, and polyadenylation (polyA) and termination sequences (Fig. 72) was constructed. In this embodiment, the promoter sequence is derived from actin 1 of 0. sativa [McElroy et al. (Plant Cell 2, 163-171, 1990); GenBank Accession No. S44221 and GenBank Accession No. X63830]. The herbicide tolerance gene comprises the PAT gene (phosphino-tricine acetyl transferase), which confers resistance to the herbicide bialaphos (a modified version of the PAT coding region originally derived from Streptomyces viridochromogenes (GenBank Accession No. M22827; Wohlleben et al. al., Gene 70, 25-37, 1988) Modifications to the original sequence of the longest open reading frame of M22827 are substantial and include changing the codon usage pattern to optimize expression in plants Except methionine substitution by valine as the first encoded amino acid and the addition of alanine as the second encoded amino acid, the protein encoded from the open reading frame PAT of pDAB3014 is identical to that encoded by the longest open reading frame of accession No. M22827. the reconstructed version of PAT is found under Accession No. 143995. The terminator sequences are derived from the lipase L of Z. mays [clone and cDNA from the corn lipase under GenBank Accession No. L35913, except a C at position 1093 of L35913 is substituted with a G at position 2468 in pDAB3014. This maize sequence comprises the 3 'untranslated region / transcription terminator region for the PAT mole].

The following oligonucleotide primer sequences were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA) under standard conditions of desalination and diluted with water to a concentration of 0.125 pg / μ: 5'-ACTAGTTAACTGACCTCACTCGAGGTCATTCATATGCTTGA-3 '(SEQ ID NO: : 151) 5'-ACTAGTGTGAATTCAGCACTTAAAGATCT-3 '(SEQ ID NO: 152).

PCR amplification reactions were performed using reagents provided by TaKaRa Biotechnology Inc., Seta 3-4-1, Otsu, Shiga, 520-2193, Japan and consisted of the following: 5 μl of buffer 10X LA PCR ™ Buffer II (Mg2 + ), 20 ng of double stranded template [plasmid pDAB3014 DNA], 10 pmole of the direct oligonucleotide sequence, 10 pmole of the reverse oligonucleotide sequence, 8 of the mixture of dNTPs (2.5 mM each), 33.5 μ H 2 O, 0.5 μΐ (2.5 units) TaKaRa LA Taq ™ DNA polymerase, 1 drop of mineral oil. PCR reactions were performed using a Perkin-Elmer Cetus thermal cycler, 48-sample DNA Thermal Cycler (Norwalk, CT) under the following conditions: 94øC, 4 min / 1 cycle; 98 ° C 20 sec, 55 ° C 1 min, 68 ° C 3 min / 30 cycles; 72 ° C, 5 min / 1 cycle; 4 ° C / remainder. Fifteen μΐ of

each PCR reaction was electrophoresed at 100 V for 1 hr on a 1.0% agarose gel in TAE agarose supplemented with 0.5% ethidium bromide.

The amplified fragments were visualized with UV light and the estimated fragment sizes compared to a 1 kbp DNA ladder. Expected amplification products were diagnosed by the presence of a 2.3 kbp DNA fragment. This fragment was removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA). The purified fragments were then cloned into plasmid pCR2.1 using the TOPO TA Cloning Kit Kit (vector pCR®2.1) and One Shot® TOPIO (Invitrogen Life Technologies, Carlsbad, CA) E. coli cells from accordance with the manufacturer's protocol.

Individual colonies were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml TB supplemented with 50 μg / ml kanamycin and incubated 16 hrs at 37 ° C with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a 1.7 ml Costar (Fisher Scientific, Pittsburgh, PA) microfuge tube and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA isolated as described above using the NucleoSpin® Plasmid Kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three æg of the isolated plasmid were digested with 10 units of Spel and NotI. All plasmid digests were incubated for 1 hr at 37 ° C. Restricted enzyme-cleaved DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The fragments were visualized with UV light and the size of the fragments estimated by comparison with a ladder of 1 kbp DNA. Expected plasmid clones were diagnosed by the presence of a 2.325 kbp inserted DNA fragment in addition to the 3.9 kbp pCR®2.1 vector. The double-stranded sequencing reactions of the plasmid clones were performed as described by the manufacturer using the CEQ ™ DTCS-Quick Start Kit kit (Beckman-Coulter, Paio Alto, CA). Reactions were purified using Performa DTR Gel Filtration Cartridges (Edge BioSystems, Gaithersburg, MD) as described by the manufacturer's protocols. The follow-up reactions were analyzed on a Beckman-Coulter CEQ ™ 2000 XL DNA analysis system and the nucleotide characterization performed using Seguencher ™ version 4.1.4 (Gene Codes Corporation, Ann Arbor, MI). E. Insertion of the autonomic cassette of the herbicide tolerance gene in the plasmid sperm - Autonomous Donor

In order to create a donor plasmid, the autonomous cassette of the herbicide tolerance gene described in Example 18D was inserted into the plasmid spleen constructs described in Examples 18B and 18C. The restriction enzyme-cleaved fragment derived from a clone having the expected 2,325 kbp sequence described above (Fig. 72) was removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA).

This fragment was then combined in a binding reaction with purified pDAB7471 (plasmid skeleton for position 1, Fig. 70) or pDAB 7451 (plasmid skeleton for position 2, Fig. 71) which had been digested with the restriction enzyme Spel and subsequently dephosphorylated. Binding was performed under the following conditions: vector: 1: 5 insert ratio and 500 units of T4 DNA ligase (Invitrogen Life Technologies, Carlsbad, CA) in a reaction volume of 20 μΐ under the incubation conditions of 16 hours in a flash- maria at 16 ° C. Five μΐ of the binding reaction was used to subsequently transform 50 μΐ of chemically competent MAX Efficiency® DH5α ™ cells (Invitrogen Life Technologies, Carlsbad, CA) and seeded under the selection conditions described by the manufacturer.

Individual colonies were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml of TB supplemented with 50 μg / ml of chloramphenicol. Cultures were incubated for 16 hrs at 37 ° C with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a Costar microcentrifuge tube of 1.7 ml (Fisher Scientific, Pittsburgh, PA) and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA isolated as described above using the NucleoSpin® Plasmid kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three μg of the isolated plasmid were digested with 10 units of Spel (New England Biolabs, Beverly, MA) and incubated for 1 hr at 37 ° C. Restricted enzyme-cut DNA was subjected to electrophoresis at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The fragments were visualized with UV light and the size of the fragments estimated by comparison with a ladder of 1 kbp DNA. The expected plasmid clones were diagnosed by the presence of 2.325 kbp ~ 4.9 kbp DNA fragments (vector pDAB7452) or 2,325 Kbps and ~5.5 kbp (pDAB vector455).

The resulting plasmids were designated pDAB7422 (position 1 donor autonomous) (Fig. 73) and pDAB7452 (position 2 donor autonomous) (Fig. 74), respectively. F. Construction of the Non-autonomous Expression Cassette of the Herbicide Tolerance Gene

A non-autonomous expression cassette of the herbicide tolerance gene comprising a promoter-transcription unit (PTU) (Fig. 75) was constructed. In this embodiment, a strategy was utilized which exploits the functionality of a 2A (Mattion, NM, Harnish, EC, Crowley, JC & Reilly, PA (1996) J. Virol. 70, 8124-8127) Thesoa assigns a herbicide tolerance gene and polyadenylation (polyA) sequences and termination, but without the promoter. In this embodiment, the translation termination signal sequence was manipulated to be in the same translation grid of the herbicide tolerance gene. In addition, the 2A / herbicide coding sequence was manipulated to match the translation frame of the target IPP2K gene. The herbicide tolerance gene comprises the PAT gene (phosphinothricin acetyl transferase), which confers resistance to the herbicide bialaphos (a modified version of the PAT coding region originally derived from Streptomyces viridochromos genes (GenBank Accession No. M22827; Wohlleben et al. The modifications of the original sequence of the longer open reading frame of M22827 are substantial and include changing the codon usage pattern to optimize expression in plants Except for the replacement of methionine by valine as the first encoded amino acid and the addition of alanine as the second encoded amino acid, the protein encoded from the open reading frame PAT of pDAB3014 is identical to that encoded by the longest open reading frame of accession No. M22827. The reconstructed version of PAT is found under Accession No. 143995. The terminator sequences are derived from the lipase L of Z. mays [clo ml of corn lipase cDNA with GenBank Accession No. L35913, except a C at position 1093 of L35913 is substituted with a G at position 2468 in pDAB3014]. This maize sequence comprises the 3 'untranslated region / transcriptional terminator region for the PAT gene.

The following oligonucleotide primer sequences were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA) under standard conditions of desalination and diluted with water to a concentration of 0.125 pg / μ: 5'-ACTAGTGGCGGCGGAGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTAGGATGGCTTCTCCGGAGAGGAGAC CAGTTGA-3 '(SEQ ID NO: ID NO: 153) 5'-ACTAGTATGCATGTGAATTCAGCACTTAAAGATCT-3 '(SEQ ID NO: 154).

PCR amplification reactions were performed using reagents provided by TaKaRa Biotechnology Inc., Seta 3-4-1, Otsu, Shiga, 520-2193, Japan and consisted of the following: 5 μl of buffer 10X LA PCR ™ Buffer II (Mg 2 +), 20 ng of double stranded matrix (plasmid pDAB3014 DNA), 10 pmole of the direct oligonucleotide sequence, 10 pmole of the reverse oligonucleotide sequence, 8 of the mixture of dNTPs (2.5 mM each), 33.5 , 0.5 μΐ (2.5 units) TaKaRa LA Taq ™ DNA polymerase, 1 drop of mineral oil. PCR reactions were performed using a Perkin-Elmer Cetus thermal cycler, 48-sample DNA Thermal Cycler (Norwalk, CT) under the following conditions: 94øC, 4 min / 1 cycle; 98 ° C 20 sec, 55 ° C 1 min, 68 ° C 2 min / 30 cycles; 72 ° C, 5 min / 1 cycle; 4 ° C / remainder. Fifteen μΐ of each PCR reaction were electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The amplified fragments were visualized with UV light and the estimated fragment sizes compared to a 1 kbp DNA ladder. Expected amplification products were diagnosed by the presence of ~ 1 kbp DNA fragment. This fragment was removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA). The purified fragments were then cloned into plasmid pCR2.1 using the TOPO TA Cloning Kit Kit (vector pCR2.2) and One Shot® T0P10 chemically competent E. coli cells (Invitrogen Life Technologies, Carlsbad, CA) of accordance with the manufacturer's protocol.

Individual colonies were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml TB supplemented with 50 μg / ml kanamycin and incubated 16 hrs at 37 ° C with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a 1.7 ml Costar (Fisher Scientific, Pittsburgh, PA) microfuge tube and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA isolated as described above using the NucleoSpin® Plasmid Kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three æg of the isolated plasmid were digested with 10 Spel units. All plasmid digests were incubated for 1 hr at 37 ° C. The restriction enzyme-cleaved DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The fragments were visualized with UV light and the size of the fragments estimated by comparison with a ladder of 1 kbp DNA. Expected plasmid clones were diagnosed by the presence of an inserted ~ 1.0 kbp and 3.9 kbp DNA fragment (vector pCR2.2). The double-stranded sequencing reactions of the plasmid clones were performed as described by the manufacturer using the CEQ ™ DTCS-Quick Start Kit kit (Beckman-Coulter, Paio Alto, CA). Reactions were purified using Performa DTR Gel Filtration Cartridges (Edge BioSystems, Gaithersburg, MD) as described by the manufacturer's protocols. Sequencing reactions were analyzed on a Beckman-Coulter CEQ ™ 2000 XL DNA analysis system and nucleotide characterization performed using Sequencher ™ version 4.1.4 (Gene Codes Corporation, Ann Arbor, MI). G. Insertion of the non-autonomous cassette of the herbicide tolerance gene into the plasmid skeleton - Non-autonomous donor

In order to create a donor plasmid, the autonomous cassette of the herbicide tolerance gene described in Example 18F was inserted into the plasmid backbone constructs described in Examples 18B and 18C. The restriction enzyme-cleaved fragment derived from a clone having the correct 1 kbp sequence was removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA) .

This fragment was then combined in a ligation reaction with purified pDAB7471 (plasmid backbone for position 1, Fig. 70) or pDAB 7451 (plasmid backbone for position 2, Fig. 71) which had been digested with the restriction enzyme Spel and subsequently dephosphorylated. The connection was made in the following

conditions: vector: 1: 5 insert ratio and 500 units of T4 DNA ligase (Invitrogen Life Technologies, Carlsbad, CA) in a reaction volume of 20 μΐ under the incubation conditions of 16 hours in a 16 ° C water bath. Five μΐ of the binding reaction was used to subsequently transform 50 μΐ of MAX chemically competent cells

Efficiency® DH5a ™ (Invitrogen Life Technologies, Carlsbad, CA) and seeded under the selection conditions described by the manufacturer.

Individual colonies were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml of TB supplemented with 50 μg / ml chloramphenicol. Cultures were incubated for 16 hrs at 37øC with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a Costar microfuge tube of 1.7 ml (Fisher Scientific, Pittsburgh, PA) and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA isolated as described above using the NucleoSpin® Plasmid kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three μg of the isolated plasmid were digested with 10 units of Spel (New England

Biolabs, Beverly, MA) and incubated for 1 hr at 37 ° C. Restricted enzyme-cut DNA was subjected to electrophoresis at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The fragments were visualized with UV light and the size of the fragments estimated by comparison with a ladder of 1 kbp DNA. Expected plasmid clones were diagnosed by the presence of 1.0 kbp and 4.96 kbp DNA fragments (vector pDB7471) or ~ 4.9 kbp (vector pDAB7452) or 1.0 kbp ~ 5.0 kbp (vector pDAB7451 ). The resulting plasmids were designated pDAB7423 (non-autonomous donor position 1) (Fig. 76) and pDAB7454 (non-autonomous donor position 2) (Fig. 77), respectively. H. Position 1 ZFN + HR donor sequences: Combination plasmid

As an alternative strategy for delivering two separate plasmids into a plant cell (e.g., a plasmid containing ZFN elements and a second containing the herbicide tolerant donor sequences), isolated plasmids were engineered to contain all the necessary elements illustrated in this patent. The combination plasmids described in this example have both ZFNs intended to target and generate double strand breaks at the specified IPP2K locus as well as autonomous PTT and / or 2A / PAT PTU PAT and donor flanking sequences designed for integration at those sites of breakage.

Gateway® technology using lambda phage-specific site recombination (Landy, A. (1989) Ann Rev. Biochem 55: 913) was used to convert the vectors pDAB7422 and pDAB7423 (described in examples 6E and 6G) gateway destination vectors. Once converted, plasmids containing ZFN expression cassettes (inserted into Gateway® Entry vectors) can be readily mobilized to the target vector by creating a ZFN / donor combination plasmid. One Âμg of each of these plasmids was digested with 10 units NotI (New England Biolabs, Beverly, MA) for 1 hr at 37Â ° C. The Notl restriction endonuclease was heat inactivated at 65 ° C for 15 min and the fragment ends subsequently dephosphorylated at 37 ° C for 1 hr using 3 units of shrimp alkaline phosphatase (SAP) (Roche Diagnostics GmbH, Mannheim, Germany) . Restricted enzyme-cut DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The vector fragments (pDB7422 = 7.317 Kbp, pDAB7423 = 5.971 Kbp) were visualized with UV light, estimated fragment size compared to a 1 kbp DNA ladder, removed from the gel and subsequently purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA).

This vector fragment was then combined with a 2.277 kbp Notl fragment containing Gateway

Technology attRl, ccdB, CmR and attR2 in a binding reaction performed under the following conditions: 1: 5 vector: insert ratio and 500 units of T4 DNA ligase (Invitrogen Life Technologies, Carlsbad, CA) in a reaction volume of 20 μΐ under conditions of 16 hr incubation in a water bath at 16 ° C. Five μΐ of the ligation reaction were subsequently used to transform chemically competent One Shot® ccdB Survival ™ (Invitrogen Life Technologies, Carlsbad, CA) E. coli cells and seeded under the selection conditions described by the manufacturer.

Individual colonies were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml TB supplemented with 50 μg / ml kanamycin and incubated 16 hrs at 37 ° C with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a 1.7 ml Costar (Fisher Scientific, Pittsburgh, PA) microfuge tube and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA was isolated as described above using the NucleoSpin® Plasmid Kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three μg of plasmid DNA were digested with 10 units of EcoRI (New England Biolabs, Beverly, MA) and incubated for 1 hr at 37 ° C. Restricted enzyme-cut DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. The fragments were visualized with UV light and the size of the fragments estimated by comparison with a ladder of 1 kbp DNA. The expected plasmid clones were diagnosed by the presence of inserted DNA fragments of 1,448 Kbp, 1,946 Kbp and 6,197 Kbp PAT PTU autonomous position 1 HR donor and 5,807 Kbp and 2,438 Kbp for non-autonomous PAT position 1 HR donor. The resulting plasmids were designated pDAB7424 (Gateway 1 proprietary autonomous donor) (FIG.78) and pDAB7425 (Gateway® non-autonomous donor position 1) (FIG. 79), respectively.

As a result of these cloning manipulations, the plasmids pDAB7424 and pDAB7425 were designated as Gateway target vectors. pDAB7412 has functionality as a Gateway® input vector containing the following elements: ZMJbilv.2 / ZFNl2 / Zm Per5 3 'UTR. To transfer a ZFN expression cassette (Gateway entry vector), a reaction was performed with LR Clonase ™ II (Invitrogen Life Technologies, Carlsbad, CA) as described by the manufacturer at a ratio of 50 ng (input vector): 150 ng / μΐ (target vector). The resulting plasmids positive for the combination were designated pDAB7426 (autonomous HR donor position -1 / ZFN12) (FIG. 80) & pDAB7427 (non-autonomous HR donor / ZFN12) (FIG 81).

Example 19: Delivery of ZFN and donor DNA in plant cells

In order to allow ZFN-mediated integration of donor DNA into the plant genome via targeted integration, it is understood that delivery of ZFN-encoding DNA is required followed by expression of functional ZFN protein in the plant cell. Concomitant delivery of donor DNA into said plant cell is also required so that the ZFN protein can induce double strand breaks in the target DNA, which are then repaired by integration carried out by homology of the donor DNA at the target locus. Those skilled in the art can appreciate that the expression of the functional ZFN protein can be achieved by various methods, including, but not limited to, transgenesis of the ZFN coding construct or transient expression of the ZFN coding construct. In both cases, the expression of the functional ZFN protein and delivery of donor DNA in the plant cell is simultaneously achieved in order to conduct targeted integration.

In the examples cited herein, we have demonstrated methods for the concomitant delivery of DNA encoding ZFN and donor DNA in plant cells. Those skilled in the art may use any of a variety of DNA delivery methods suitable for plant cells, including, but not limited to, Agrobacterium-mediated transformation, biolistic-based DNA delivery, or Whiskers ™ mediated DNA delivery . In one embodiment described herein, Whiskers ™ mediated DNA delivery experiments were performed using various combinations of donor DNA with DNA constructs encoding ZFN. These combinations include 1) a single plasmid containing ZFN coding sequence and donor DNA and 2) two distinct plasmids, one containing ZFN coding sequence and one containing donor DNA. In another embodiment, biolistic-based DNA delivery was performed using various combinations of donor DNA with DNA constructs encoding ZFN. Those skilled in the art may deduce that such combinations may include 1) a single plasmid containing the ZFN coding sequence and the donor DNA and 2) two distinct plasmids, one containing the ZFN coding sequence and the other containing donor DNA. A. Whiskers ™ mediated DNA delivery

As described hereinbefore, human Hi-II embryonic cell cultures were produced and were used as a source of live plant cells in which targeted integration is demonstrated. Those skilled in the art may consider the use of cell cultures derived from a variety of plant species or differentiated plant tissues, derived from a variety of plant species, as the source of living plant cells in which targeted integration is demonstrated.

In this example, 12 ml of PCV from a previously cryopreserved cell line plus 28 ml of conditioned medium were subcultured into 80 ml of GN6 liquid medium (Chu CC, et al.1975), 2.0 mg / l 2,4-D, 30 g / 1 sucrose, pH 5.8) in a 500 ml Erlenmeyer flask and placed on a shaker at 125 rpm at 28 ° C. This step was repeated 2 times using the same cell line, so that a total of 36 ml PCV was distributed over 3 vials. After 24 hours, the GN6 liquid medium was removed and replaced with 72 ml of GN6 S / M osmotic medium (N6 Medium, 2.0 mg / 1 2,4-D, 30 g / 1 sucrose, 45.5 g / 1 sorbitol, 45.5 g / L mannitol, 100 mg / 1 myo-inositol, pH 6.0). The flask was incubated in the dark for 30-35 minutes at 28øC with moderate agitation (125 rpm). During the incubation period, a 50 mg / ml suspension of silicon carbide vanes (Advanced Composite Materials, LLC, Greer, SC) was prepared by adding 8.1 ml of GN6 / SM liquid medium to 405 mg of sterile silicon carbide vanes.

After incubation in GN6 S / M osmotic medium, the contents of each vial were pooled in a 250 ml centrifuge bottle. After all cells in the flask had sedimentated at the bottom, the volume of the excess content of approximately 14 ml of GN6 S / M liquid was removed and collected in a sterile 1 liter flask for later use. The pre-wet vane suspension was blended at full speed in a vortex for 60 seconds and then added to the centrifuge vial.

In one example, where a single plasmid containing the ZFN coding sequence plus the donor DNA is delivered into the plant cells, 170æg of purified circular plasmid DNA was added to the flask. In an alternative example, where two distinct plasmids were co-delivered, one containing a ZFN coding sequence and the other containing donor DNA, multiple strategies for the amounts of DNA were evaluated. One strategy used 85 g of donor DNA and 85 g of DNA encoding zinc fingers. Other modifications used molar ratios of 10, 5 or 1 time donor DNA to 1x finger zinc finger, based on the size (in kilopars of bases) of the individual plasmids, so that a total of 170æg of DNA was added per vial. In all co-delivery cases, the DNA was pooled into a tube before being added to the centrifuge bottle. Once the DNA was added, the vial was immediately placed in a modified Red Devil 5400 commercial paint mixer (Red Devil Equipment Co., Plymouth, MN) and shaken for 10 seconds. After stirring, the mixture of cells, medium, vanes and DNA was added to the contents of a 1 liter flask along with 125 ml of fresh GN6 liquid medium to reduce the osmotic pressure regulator. Cells were recovered on a shaker at 125 rpm for 2 hrs. Six ml of the dispersed suspension were filtered on Whatman # 4 (5.5 cm) filter paper using a glass collection unit connected to a vacuum line to obtain 60 filters per vial. Filters were plated onto 60 x 20 mm plates of solid GN6 medium (the same as GN6 liquid medium except 2.5 g / l Gelrite gelling agent) and incubated at 28øC in the dark for 1 week. B. Biolistics-mediated DNA delivery

In the examples mentioned above, the embryonic suspensions of corn were subcultured in GN6 liquid medium approximately 24 hours prior to the experimentation as described above. Excess liquid medium was removed and approximately 0.4 PCV of cells were finely scattered in a circle of 2.5 cm in diameter at the center of a 100x15 mm petri dish containing GN6 S / M medium solidified with 2.5 g / 1 gelrite. Cells were grown in the dark for 4 hrs. To coat the biolystic particles with DNA, 3 mg of gold particles of 1.0 micron in diameter were washed once with 100% ethanol, twice with sterile distilled water and resuspended in 50 μl of water in a siliconized Eppendorf tube. A total of 5 μg of plasmid DNA, 20 μg of spermidine (0.1 M) and 50 μl of calcium chloride (2.5 M) were added separately to the gold suspension and vortexed. The mixture was incubated at room temperature for 10 min, sedimented at 10,000 rpm in a bench microfuge for 10 seconds, resuspended in 60 μΐ of cold 100% ethanol and 8-9 μΐ were distributed over each macroveicle. The bombardment was performed with the Biolistic PDS-1000 / He ™ system (Bio-Rad Laboratories, Hercules, CA). The plates containing the cells were placed on the medium shelf under conditions of 1100 psi and 27 inches of vacuum Hg and were bombarded following the operating manual. Sixteen hours after bombardment, the tissue was transferred in small pellets to GN6 (1H) medium and cultured for 2-3 weeks at 28øC in the dark. Transfers were continued every 2-4 weeks until putative transgenic isolates from integration of the donor DNA appeared. The identification, isolation and regeneration of putative donor DNA integration events generated through the delivery of biolithic-mediated DNA are identical to the process used for putative donor DNA integration events through the delivery of DNA mediated by Whiskers ™ and described below. C. Identification and isolation of putative targeted transgenic events

One week after DNA delivery, the filter papers were transferred to 60x20 mm plates of GN6 (1H) selection medium (Medium N6, 2.0 mg / 1 2,4-D, 30 g / 1 sucrose, 100 mg 1 myoinositol, 1.0 mg / l Herbiace bialaphos (Meiji Seika, Japan), 2.5 g / l Gelrite, pH 5.8). These selection plates were incubated at 28 ° C for one week in the dark.

After 1 week of selection in the dark, the tissue was soaked in fresh medium by scraping half of the cells from each plate into a tube containing 3.0 ml of GN6 medium with agarose maintained at 37-38 ° C (N6 medium, 2.0 mg / 1 of 2,4-D, 30 g / 1 sucrose, 100 mg / 1 myoinositol, 7 g / 1 SeaPlaque® agarose, pH 5.8, autoclaved for only 10 minutes at 121 ° C) and 1 mg / l of Bialaphos from Herbiace. The agarose / tissue blend was split with a spatula, and subsequently 3 ml of the agarose / tissue mixture was poured onto the surface of a 100 x 15 mm petri dish containing GN6 (1H) medium. This process was repeated for the two halves of each plate. Once the whole tissue was soaked, the plates were individually closed with Nescofilm® or Parafilm®, and cultured at 28 ° C in the dark for up to 10 weeks. Putatively transformed isolates grown under these selection conditions were removed from the embedded plates and transferred to fresh selection medium in 60 x 20 mm dishes. In case sustained growth was evident after approximately 2 weeks an event was considered to be resistant to the applied herbicide (bialophos) and an aliquot of the cells was subsequently harvested into 2 ml Eppendorf tubes for genotype analysis.

Those skilled in the art may use a gene encoding any suitable selectable marker in the donor DNA and apply comparable selection conditions to the living cells. For example, an alternative selectable marker gene such as AAD-1 as described in WO 2005/107437 A2 may be implemented as a donor for the selection and recovery of events integrated into maize cells as described herein.

Example 20: Integration Event Tracing

directed by PCR genotyping

In this example, PCR genotyping includes but is not limited to polymerase chain reaction (PCR) amplification of genomic DNA derived from isolated corn callus tissue, provided as containing donor DNA inserted into the genome, followed by conventional cloning and sequence analysis of the PCR amplification products. PCR genotyping methods have been well described (for example, Rios, G. et al. (2002) Plant J. 32: 243-253) and can be applied to genomic DNA derived from any species or type of plant tissue, including cell cultures.

Those skilled in the art may consider strategies for PCR genotyping which include (but are not limited to) amplification of specific sequences in the plant genome, amplification of multiple specific sequences in the plant genome, amplification of non-specific sequences in the plant genome or combinations thereof . The amplifications may be followed by cloning and sequencing as described in this example, or by direct sequence analysis of the amplification products. Those familiar with the art may consider alternative methods of analyzing the amplification products generated herein.

In one embodiment described herein, oligonucleotide sequences specific for the target gene are employed in PCR amplifications. In another embodiment described herein, oligonucleotide sequences specific for donor DNA sequences are employed in the PCR amplifications. A further embodiment includes a combination of oligonucleotide sequences that bind to the target gene sequence and the donor DNA sequence. Those skilled in the art may consider other combinations of primer sequences and amplification reactions to test the genome. A. Genomic DNA Extraction Genomic DNA (gDNA) was extracted from the herbicide tolerant isolated maize cells described in Example 19 and used as template in the PCR genotyping experiments. The gDNA was extracted from approximately 100-300 μl of herbicide tolerant Hill callus sediment cell volume (PCV), isolated as described above according to the manufacturer's protocols detailed in the DNeasy® 96 Plant Kit (QIAGEN Inc., Valencia, CA). The genomic DNA was eluted in 100 μl of the elution buffer provided with the kit, yielding final concentrations of 20-200 ng / μΐ and subsequently analyzed by PCR-based genotyping methods described below.

B. Design of primers for PCR genotyping

Those familiar with the art can use a variety of strategies for the design and implementation of PCR-based genotyping. Exemplary oligonucleotide primer sequences designed for

pair with the target gene, with the donor DNA sequences and / or combinations of the two. In order to design oligonucleotide sequences that can anneal to the target gene IPP2K in regions not encompassed by the flanking homology sequences inserted into the donor DNA molecules, plasmid clones containing other target gene sequences were characterized by DNA sequencing. The double-stranded sequencing reactions of the palsic clones were performed as described by the manufacturer using the CEQ ™ DTCS-Quick Start Kit kit (Beckman-Coulter, Paio Alto, CA). Reactions were purified using Performa DTR Gel Filtration Cartridges (Edge BioSystems, Gaithersburg, MD) cassettes as described by the manufacturer's protocols. Sequencing reactions were analyzed on a Beckman-Coulter CEQ ™ 2000 XL DNA analysis system and nucleotide characterization performed using Sequencher ™ version 4.1.4 (Gene Codes Corporation, Ann Arbor, MI). Fig. 91 (SEQ ID NO: 141) and Fig. 92 (SEQ ID NO: 141). These sequences correspond to regions of the IPP2K gene upstream (5'-) and downstream (3 ') of the ZFN target regions and are described in Fig. : 142).

In the examples presented herein, all oligonucleotide sequences were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA) under standard conditions of desalination and diluted with water to a concentration of 100 μΜ. The series of forward and reverse oligonucleotide primer sequences that follow are designed to pair with specific gPNA sequences of the target gene IPP2K located outside the boundaries of the donor DNA sequences. These oligonucleotides are as follows: 5'-TGGCAGGAGCGAGAGCCAGAATTCGACGCT G-3 '(SEQ ID NO: 153) 5'-GTGCAAGAATGTATTGGGAATCAACCTGAT G-3' (SEQ ID NO: 154)

A second set of forward and reverse oligonucleotide primer sequences were also designed to anneal to the target gene specific gDNA sequence IPP2K outside the borders of the donor DNA sequences, although within the limits of the first pair: 5'-CTGTGGTACCAGTACTAGTACCAGCATC-S ' (SEQ ID NO: 155) 5'-TCT TGGATCAAGGCATCAAGC ATTCCAATCT-3 '(SEQ ID NO: 156)

Direct and reverse oligonucleotide primer sequences were also designed to specifically match donor DNA corresponding to the coding region of the herbicide tolerance gene: 5'-TGGGTAACTGGCCTAACTGG-3 '(SEQ ID NO: 157) 5'-TGGAAGGCTAGGAACGCTTA-3' (SEQ ID NO: 157). ID NO: 158) 5'-CCAGTTAGGCCAGTTACCCA-3 '(SEQ ID NO: 159) 5'-TAAGCGTTCCTAGCCTTCCA-3' (SEQ ID NO: 160) C. Specific PCR amplification of the donor DNA

The first PCR amplification reactions were performed using reagents provided by TaKaRa

Biotechnology Inc., Seta 3-4-1, Otsu, Shiga, 520-2193, Japan and consisted of the following: 2.5 μl of buffer 10X Ex Taq PCR ™ Buffer, 40-200 ng of double stranded matrix genomic DNA, 10 μ of the forward oligonucleotide sequence, 10 μ of the reverse oligonucleotide sequence, 2 μ of the mixture of dNTPs (2.5 mM each), 16 μ SBO, 0.5 μ (2.5 units) Ex Taq ™ DNA polymerase. PCR reactions were performed using a 96-sample Bio-Rad, DNA Engine Tetrad2, Peltier Thermal Cycler (Hercules, CA) thermal cycler under the following conditions: 94øC, 3 min / 1 cycle; 94 ° C 30 sec, 64 ° C 30 sec, 72 ° C 5 min / 35 cycles; 72 ° C, 10 min / 1 cycle; 4 ° C / remainder.

Amplification products of the first PCR reaction were subsequently amplified in a second PCR reaction consisting of: 2.5 μl of 10X Ex Taq PCR ™ Buffer buffer, 2 μl of matrix (1: 100 dilution of the PCR reaction in H 2 O) , 10 μ of the forward oligonucleotide sequence, 10 μ of the reverse oligonucleotide sequence, 2 μ of the mixture of dNTPs (2.5 mM each), 16 μ H 2 O, 0.5 μ (2.5 units) Ex Taq ™ DNA polymerase. PCR reactions were performed using a 96-sample Bio-Rad, DNA Engine Tetrad2, Peltier Thermal Cycler (Hercules, CA) thermal cycler under the following conditions: 94øC, 3 min / 1 cycle; 94 ° C 15 sec, 61 ° C 30 sec, 72 ° C 30 sec / 30 cycles; 72 ° C, 10 min / 1 cycle; 4 ° C / rest time. Ten μg of each amplified product were electrophoresed at 100 V for 1 hr on a 1.0% agarose gel in TAE agarose supplemented with 0.5% ethidium bromide. The amplified fragments were visualized with UV light and the estimated fragment sizes compared to a 1 kbp DNA ladder. The PCR products containing the expected fragment were diagnosed by the presence of a DNA fragment of 0.317 kbp, as shown in Fig. 82.

Example 21: Detection of Directed Integration Events

Among the herbicide tolerance events containing an integrated donor DNA molecule, encoding a cassette of the herbicide tolerance gene, it is expected that some proportion of said events will be the product of targeted donor DNA integration at the site of the ZFN-induced double chain. In order to differentiate these integration events from those derived from the random integration of the cassette of the herbicide tolerance gene, a PCR-based genotyping strategy was used using a combination of genome-specific and subsequently specific genome-specific PCR primers of donor. A. Genome specific amplification and subsequent genome / donor specific amplification

In this embodiment, the first PCR reactions utilized oligonucleotide primers specific for the target gene regions IPP2K upstream and downstream of the donor integration region (e.g., Figures 92 and 93). The first PCR amplification reactions were performed using reagents provided by TaKaRa Biotechnology Inc., Seta 3-4-1, Otsu, Shiga, 520-2193, Japan and consisted of the following: 2.5 μl of 10X Ex Taq PCR ™ buffer Buffer, 40-200 ng of double stranded matrix genomic DNA, 10 μ of the direct oligonucleotide sequence, 10 μ of the reverse oligonucleotide sequence, 2 μ of the mixture of dNTPs (2.5 mM each), 16 μ H 2 O, 0.5 μ (2.5 units) Ex Tag ™ DNA polymerase. PCR reactions were performed using a 96-sample Bio-Rad, DNA Engine Tetrad2, Peltier Thermal Cycler (Hercules, CA) thermal cycler under the following conditions: 94øC, 3 min / 1 cycle; 94 ° C 30 sec, 64 ° C 30 sec, 72 ° C 5 min / 35 cycles; 72 ° C, 10 min / 1 cycle; 4 ° C / remainder. The product from the first PCR reaction was subsequently diluted 1: 100 in H2O and used as template DNA in two different second PCR reactions. In this embodiment, the second reactions use primer sequences that bind to the genomic region of IPP2K and the donor molecule, giving rise to an amplicon spanning the integration border between the genome and the donor. The first reaction focused on the 5 'border between the donor and genome. Both reactions consisted of the following: 2.5 μΐ 10X Ex Taq PCR ™ Buffer buffer, 2 μΐ matrix (1: 100 dilution of the PCR reaction in H 2 O), 10 μΜ of the direct oligonucleotide sequence, 10 μΜ of the oligonucleotide sequence 2 μg of the mixture of dNTPs (2.5 mM each), 16 μ H 2 O, 0.5 μ (2.5 units) Ex Tag ™ DNA polymerase. PCR reactions were performed using a thermal cycler

Bio-Rad, DNA Engine Tetrad2, Peltier Thermal Cycler (Hercules, CA) 96 samples under the following conditions: 94øC, 3 min / 1 cycle; 94 ° C 15 sec, 60 ° C 30 sec, 72 ° C 2 min / 35 cycles; 72 ° C, 10 min / 1 cycle; 4 ° C / rest time. Twenty μΐ of each 2nd PCR reaction was electrophoresed at 100 V for 1 hr on a 1.0% agarose gel in TAE agarose supplemented with 0.5% ethidium bromide.

Amplified fragments were visualized with UV light and fragment size estimated by comparison to a 1 kbp DNA ladder (Invitrogen Life Technologies, Carlsbad, CA). PCR products derived from the targeted integration of the donor into the IPP2K gene were diagnosed by the presence of DNA fragments of 1.65 kbp (Fig. 83) or 1.99 kbp (Fig. ). These fragments were removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA). The purified fragments were then cloned into plasmid pCR2.1 using the TOPO TA Cloning Kit Kit (vector pCR®2.1) and One Shot® TOP10 (Invitrogen Life Technologies, Carlsbad, CA) chemically competent E. coli cells from accordance with the manufacturer's protocol.

Individual colonies were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml TB supplemented with 50 μg / ml kanamycin and incubated 16 hrs at 37 ° C with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a 1.7 ml Costar (Fisher Scientific, Pittsburgh, PA) microfuge tube and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA was isolated as described above using the NucleoSpin® Plasmid Kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three æg of the plasmid isolated from plasmids from the clones with 5 'homology sequences were digested with 10 units of EcoRI (New England Biolabs, Beverly, MA). All plasmid digests were incubated for 1 hr at 37 ° C. Restricted enzyme-cut DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. Fragments were visualized with UV light and fragment size estimated by comparison to a 1 kbp DNA ladder (Invitrogen Life Technologies, Carlsbad, CA).

Expected plasmid clones were diagnosed by the presence of inserted DNA fragments of appropriate size in addition to the 3.9 kbp pCR®2.1 vector. The double-stranded sequencing reactions of the plasmid clones were performed as described by the manufacturer using the CEQ ™ DTCS-Quick Start Kit kit (Beckman-Coulter, Paio Alto, CA). Reactions were purified using Performa DTR Gel Filtration Cartridges (Edge BioSystems, Gaithersburg, MD) as described in the manufacturer's protocols. Sequencing reactions were analyzed on a Beckman-Coulter CEQ ™ 2000 XL DNA analysis system and the nucleotide characterization performed using

Sequencher ™ version 4.1.4 (Gene Codes Corporation, Ann Arbor, MI). Nucleotide alignments were performed using Vector NTi version 10.1 (Invitrogen Life Technologies, Carlsbad, CA). Analysis of sequence data derived from a directed integration event (event # 073) was conducted as follows. The first PCR products covering the entire genome integration site were subjected to a second amplification focused on the 5 'or 3' border between the genome and the donor. Alignment of the cloned fragments corresponding to these amplification products of the second reaction with the wild-type IPP2K genomic sequence, as well as the expected sequence of a directed integration event, clearly indicated that precise integration of the donor DNA occurred at the target site. The nucleotide sequence of the IPP2K genomic locus, the genome / donor border, the nucleotide sequence of the donor regions corresponding to the IPP2K homology flanking sequences and the nucleotide sequence of the herbicide tolerance cassette were all preserved in the multiple cloned PCR products derived from this event . Thus, this event represented a genome in which repair resulted from homology of a double stranded, ZFN-mediated breakdown and directed integration of a donor DNA into a specific target gene. Further transformed events representing unique instances of directed integration were obtained, demonstrating that the methods described herein are reproducible in corn calliums. Those skilled in the art may apply these methods to any target gene in any plant species for which targeted integration is desired. B. Genome / donor specific amplification in two successive reactions

In this embodiment, the first PCR reaction and the second subsequent reaction used oligonucleotide primer sequences specific for the regions of the IPP2K gene upstream or downstream of the donor integration region (appendices V and VI) in combination with oligonucleotide primer sequences specific for the sequence donor. In this example, the first PCR amplification reactions were performed using reagents provided by TaKaRa Biotechnology Inc., Seta 3-4-1, Otsu, Shiga, 520-2193, Japan and consisted of the following: 2.5 μl of 10X Ex buffer Taq PCR ™ Buffer, 40-200 ng of double stranded matrix genomic DNA, 10 μ of the direct oligonucleotide sequence, 10 μ of the reverse oligonucleotide sequence, 2 μ of the mixture of dNTPs (2.5 mM each), 16 μFRO , 0.5 μΐ (2.5 units) Ex Tag ™ DNA polymerase. PCR reactions were performed using a 96-sample Bio-Rad, DNA Engine Tetrad2, Peltier Thermal Cycler (Hercules, CA) thermal cycler under the following conditions: 94øC, 3 min / 1 cycle; 94 ° C 30 sec, 52 ° C or 64 ° C 30 sec, 72 ° C 2 min / 35 cycles; 72 ° C, 10 min / 1 cycle; 4 ° C / remainder. The product of the first PCR reaction was subsequently diluted 1: 100 in H2O and used as template DNA in a second PCR reaction. In this embodiment, the second reactions use primer sequences that bind to the genomic region of IPP2K and the donor molecule, giving rise to an amplicon spanning the integration border between the genome and the donor. The specific primers used determine whether the amplification is focused at the 5 'or 3' border between the genome and the donor. Reagents for these reactions consisted of the following: 2.5 μl of 10X Ex Taq PCR ™ Buffer buffer, 2 μl of matrix (1: 100 dilution of the PCR reaction in H2O), 10 μ of the direct oligonucleotide sequence, 10 μ of the oligonucleotide-reverse sequence, 2 μΐ of the mixture of dNTPs (2.5 mM each), 16 μΐH2O, 0.5 μΐ (2.5 units) Ex Tag ™ DNA polymerase. PCR reactions were performed using a 96-sample Βίο-Rad, DNA Engine Tetrad2, Peltier Thermal Cycler (Hercules, CA) thermal cycler under the following conditions: 94øC, 3 min / 1 cycle; 94 ° C 30 sec, 54 ° C or 60 ° C 30 sec, 72 ° C 2 min / 35 cycles; 72 ° C, 10 min / 1 cycle; 4 ° C / rest time.

Twenty μΐ of each 2nd PCR reaction were electrophoresed at 100 V for 1 hr on a 1.0% agarose gel in TAE agarose supplemented with 0.5% ethidium bromide.

The amplified fragments were visualized with UV light and the size of the fragments estimated by comparison with a 1 kbp DNA ladder (Invitrogen Life

Technologies, Carlsbad, CA). PCR products derived from targeted donor integration into the IPP2K gene were diagnosed by the presence of DNA fragments of 1.35 kbp (5 'border) (Fig. 85) or 1.66 kbp (3' border) (Fig. ). These fragments were removed from the gel and purified according to the manufacturer's instructions using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA). The purified fragments were then cloned into plasmid pCR2.1 using the TOPO TA Cloning Kit Kit (vector pCR®2.1) and One Shot® TOPIO (Invitrogen Life Technologies, Carlsbad, CA) E. coli cells from accordance with the manufacturer's protocol. C. Analysis of Nucleotide Sequences of PCR Products for Genotyping

Individual colonies described in Example 21B were inoculated into a 14 ml Falcon tube (Becton-Dickinson, Franklin Lakes, NJ) containing 2 ml TB supplemented with 50 μg / ml kanamycin and incubated 16 hrs at 37 ° C with shaking at 200 rpm. After incubation, 1.5 ml of cells were transferred to a 1.7 ml Costar (Fisher Scientific, Pittsburgh, PA) microfuge tube and pelleted at 16,000 xg for 1 min. The supernatant was removed and the plasmid DNA was isolated as described above using the NucleoSpin® Plasmid Kit (BD Biosciences / Clontech / Macherey-Nagel, Paio Alto, CA). Three æg of the plasmid isolated from plasmids from clones with 5 'homology sequences were digested with 10 units of EcoRI (New England

Biolabs, Beverly, MA). All plasmid digests were incubated for 1 hr at 37 ° C. Restricted enzyme-cleaved DNA was electrophoresed at 100 V for 1 hr on a 1.0% TAE agarose gel supplemented with 0.5% ethidium bromide. Fragments were visualized with UV light and fragment size estimated by comparison to a 1 kbp DNA ladder (Invitrogen Life Technologies, Carlsbad, CA).

Plasmid clones were diagnosed by the presence of inserted DNA fragments in addition to the 3.9 kbp pCR®2.1 vector. The double-stranded sequencing reactions of the plasmid clones were performed as described by the manufacturer using the CEQ ™ DTCS-Quick Start Kit kit (Beckman-Coulter, Paio Alto, CA). Reactions were purified using Performa DTR Gel Filtration Cartridges (Edge BioSystems, Gaithersburg, MD) as described by the manufacturer's protocols. Sequencing reactions were analyzed on a Beckman-Coulter CEQ ™ 2000 XL DNA analysis system and nucleotide characterization performed using Sequencher ™ version 4.1.4 (Gene Codes Corporation, Ann Arbor, MI). Nucleotide alignments were performed using Vector NTi version 10.1 (Invitrogen Life Technologies, Carlsbad, CA).

Sequence data spanning the border between the upstream 5 'IPP2K genomic sequence and the donor DNA derived from multiple directed integration events were also obtained, including sequence data spanning the border between donor DNA and the derived 3' IPP2K genomic sequence multiple directed integration events as well as upstream (5 ') border sequence data derived from a single transformed callus (# 114). The transformed targeting event (# 114) was a result of the integration of an autonomous donor into the target gene IPP2K.

In these analyzes, both the first and second PCR amplification reactions focused on the 5 'or 3' border between the genome and the donor. Alignment of the cloned fragments corresponding to these secondary amplification products with the wild-type genomic sequence of IPP2K, as well as the expected sequence of an integration event, revealed that integration of a donor DNA occurred at the target site. The nucleotide sequence of the IPP2K genomic locus, the genome / donor border, the nucleotide sequence of the donor regions corresponding to the IPP2K homology flanking sequences and the nucleotide sequence of the herbicide tolerance cassette were all preserved in the multiple cloned PCR products derived from this event .

Thus, this event represents a genome in which repair resulted from homology of a ZFN-mediated double stranded DNA break in a specific target gene. Other transformed events were obtained representing single occurrences of targeted integration, demonstrating that the methods described herein are reproducible in corn callus. Those skilled in the art may apply these methods to any target gene in any plant species for which targeted integration is desired.

Example 22: Regeneration of fertile complete plants from corn callus tissue

Isolates from herbicide tolerant corn cells derived from Hill cell culture can be regenerated to yield fertile complete corn plants. Those skilled in the art will be able to regenerate fertile complete corn plants from a variety of embryonic maize cell cultures.

In this example, regeneration of isolated bialophos resistant calli calli was initiated by transfer of isolated callus tissue to a cytokinin-based induction medium, 28 (1H), containing MS salts and vitamins, 30.0 g / 1 sucrose, 5 mg / l benzylaminopurine, 0.25 mg / l 2,4-D, 1 mg / l bialaphos and 2.5 g / l Gelrite; pH 5.7. Cells were grown in low light (13 pEm-2s-1) for one week, followed by transfer to higher light intensity conditions (40 pEm-2s-1) for one week. The cells were then transferred to regeneration medium, 36 (1H), which is identical to the induction medium except they lack plant growth regulators. Small seedlings (3-5 cm) were hand-picked and placed in 150x25 mm glass culture tubes containing SHGA medium (Schenk and Hildebrandt basal salts and vitamins, 1972, Can J. Bot 50: 199-204; g / 1 myoinositol, 10 g / 1 sucrose, 2.0 g / 1 Gelrite, pH 5.8).

Once the seedlings developed to a sufficiently large and differentiated root and shoot system were transplanted into 4-inch pots containing Metro-Mix 360 growth medium (Sun Gro Horticulture Canada Ltd.) and placed in an oven. The seedlings were totally or partially covered with plastic cups for 2-7 days, then transplanted into 5-gallon pots containing a mixture consisting of 95% Metro-Mix 360 and 5% clayey / loam soil and grown to maturity . The plants may be self-pollinated or cross-pollinated with a syngeneic line so as to produce seeds T1 or F1, respectively. Those familiar with the technique may self-pollinate regenerated plants or cross-pollination of regenerated plants with a variety of germplasm to allow reproduction of maize.

Additional information regarding directed cleavage, directed recombination and directed integration can be found in the United States Patent Application Publication Nos. US-2003-0232410; US-2005-0026157; US-2005-0064474; US-2005-0208489; and US-2006-0188987; and in US-2007-0134796.

Lisbon, April 9, 2015

Claims (32)

A fusion protein comprising (a) a zinc finger protein comprising a non-canonical zinc finger, wherein the noncanonical zinc finger is a non-C2H2 zinc finger and has a helical portion enclosed in the DNA linkage and wherein the zinc coordination region of the helical portion comprises the amino acid sequence HTRRCG; and wherein the zinc finger protein is engineered to bind to a target sequence, and (b) one or more functional domains, wherein a functional domain comprises a cleavage half domain, and (c) an interposed ZC linker between the cleavage half domain and the zinc finger protein, wherein the amino acid sequence between the zinc finger protein and the cleavage half domain is designated the ZC linker. The fusion protein of claim 1 comprising a plurality of zinc fingers, wherein at least one of the zinc fingers comprises a zinc finger CCHC. The fusion protein of claim 1 or 2, wherein at least one zinc finger comprises the sequence Cys- (XA) 2-4-Cys- (XB) 12-His- (Xc) 3-5-Cys- (XD) wherein XA, Xb, Xc and Xd may be any amino acid. The fusion protein of any one of claims 1 to 3, comprising any of the sequences shown in any of Table 1, 2, 3 or 4. The fusion protein of any one of claims 3 or 4, wherein (XD) is the sequence QLV or QKP. The fusion protein of claim 5, wherein the QLV or QKP sequence is the 3 C-terminal amino acid residues of the zinc finger. The fusion protein of any one of claims 3 to 6, wherein (X 1) is 1, 2 or 3 Gly (G) residues. The fusion protein of any one of claims 2-7, wherein the fusion protein comprises 3, 4, 5 or 6 fingers of zinc. The fusion protein of claims 2-8, wherein the finger 2 comprises the zinc finger CCHC. The fusion protein of any one of claims 2-9, wherein the C-terminal zinc finger comprises the CCHC finger. The fusion protein of any one of claims 2-10, wherein at least two fingers of zinc comprises the zinc finger CCHC. The fusion protein of any one of claims 2-11, wherein the fusion protein comprises any of the sequences shown in Table 8 and is engineered to bind to a target sequence in an IPP2-K gene. The fusion protein of claim 1 wherein the length of the ZC linker is 5 amino acids. The fusion protein of claim 14, wherein the amino acid sequence of the ZC linker is GLRGS (SEQ ID NO: 4). The fusion protein of claim 1 wherein the length of the ZC linker is 6 amino acids. The fusion protein of claim 15, wherein the amino acid sequence of the ZC linker is GGLRGS (SEQ ID NO: 5). A polynucleotide encoding a fusion protein according to any one of claims 1 to 16. A method for the targeted cleavage of cellular chromatin in a plant cell, the method comprising expressing, in the cells, a pair of fusion proteins according to any one of claims 1 to 16; wherein: (a) the target sequences of the fusion proteins are ten nucleotides apart; and (b) the fusion proteins dimerize and cleave DNA located between the target sequences. A method of genetic recombination in a plant host cell, the method comprising (a) expression in the host cell of a pair of fusion proteins according to any one of claims 1 to 16, wherein the target sequences of the proteins are present at a target locus selected from the host, and (b) identification of a recombinant host cell exhibiting a sequence change at the target host locus. The method of claim 18 or claim 19, wherein the sequence change is a mutation selected from the group consisting of a deletion of genetic material, an insertion of genetic material, a replacement of genetic material, and any combination thereof. The method of any one of claims 18 to 20, further comprising introducing the exogenous poly-nucleotide into the host cell. The method of claim 21, wherein the exogenous polynucleotide comprises sequences homologous to the host's target locus. The method of any one of claims 18 to 23 wherein the plant is selected from the group consisting of a monocotyledon, a dicotyledon, gymnosperms and eukaryotic algae. The method of claim 23, wherein the plant is selected from the group consisting of corn, rice, wheat, potato, soybean, tomato, tobacco, members of the Brassica family and Arabidopsis. The method of any one of claims 18 to 23, wherein the plant is a tree. The method of any one of claims 18 to 25, wherein the target sequences are in an IPP2-K gene. A method for reducing the level of phytic acid in seeds, comprising inactivating or altering the IPP2-K gene according to the method of claim 26. A method for making phosphorus more metabolically available in the seed, comprising inactivating or altering the IPP2-K gene according to the method of claim 26. A plant cell comprising a fusion protein according to any one of claims 1 to 16 or a polynucleotide according to claim 17. The plant cell of claim 29, wherein the cell is contained in a seed. The plant cell of claim 30, wherein the seed is a corn seed. The plant cell of any one of claims 29 to 31, wherein IPP2-K is partially or fully inactivated. Lisbon, April 9, 2015