PT1578903E - Novel methods of constructing libraries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel libraries - Google Patents

Description

DESCRIPTION " NEW METHODS OF CONSTRUCTION OF LIBRARIES UNDERSTANDING MEMBERS PRESENTED AND / OR EXPRESSED FROM A DIVERSE FAMILY OF PEPTIDES, POLYPEPTIDES OR PROTEINS AND NEW LIBRARIES "

This application is in part a continuation of United States provisional application 60/198069 filed on April 17, 2000, in part a continuation of U.S. patent application 09/837306, filed April 17, 2001 , in part a continuation of PCT application PCT / US01 / 12454, filed April 17, 2001, in part a continuation of U.S.A. application 10/000516, filed on October 24, 2001, and in part a continued application from the United States 10/045674, filed October 25, 2001. The present invention relates to the embodiments characterized in the claims.

Thus, it relates to a method for producing a population or library of immunoglobulin genes which comprises the steps of: (i) introducing synthetic diversity into at least one of CDR1 VH or CDR2 VH of such genes; and (ii) combining the diversity of step (i) with the diversity of CDR3 VH captured from B cells. The present invention also relates to a library comprising a collection of genetic packages displaying a member of a diverse family of peptides , polypeptides or proteins and which collectively exhibits at least a portion of the family, the peptides, polypeptides or proteins shown being encoded by DNA sequences, comprising sequences encoding (a) a CDR1 VH having an amino acid sequence in accordance with wherein X1, X2 and X3 are independently selected from the group consisting of A, D, E, F, G, Η, I, K, L, Μ, N, P, Q, R, S, T, V, W and Y; (b) a CDR2 VH having an amino acid sequence according to the formula wherein X4 and X5 are independently selected from the group consisting of Y, R3, X5, X6, , W, V, Ge S, X6 is selected from the group consisting of P and S and X7 and X8 are independently selected from the group consisting of A, D, E, F, G, Η, I, K, L, Μ, N , P, Q, R, S, T, V, W and Y; and (c) a CDR3 VH coding sequence, wherein said CDR3 VH is a CDR3 VH captured from the CDR3 VH region of a B cell immunoglobulin gene.

In a preferred embodiment, the genetic packages are filamentous or phagemid phages. The present disclosure further relates to vectors for presenting and / or expressing a diverse family of peptides, polypeptides or proteins. The present disclosure further relates to methods of screening the libraries of the invention and the peptides, polypeptides and proteins identified by such screening.

BACKGROUND OF THE INVENTION It is now common practice in the art to prepare libraries of genetic packages which display, express or comprise a member of a diverse family of peptides, polypeptides or proteins and collectively exhibit, express or comprise at least a portion of the diversity of the family. In many common libraries, the peptides, polypeptides or proteins are antibody related. Often these are Fab or single chain antibodies.

In general, DNAs encoding members of the families to be presented and / or expressed must be amplified before they are cloned and used to present and / or express the intended member. Typically this amplification uses forward and reverse primers.

Such primers may be complementary to native DNA sequences to amplify or complementary to oligonucleotides attached at the 5 'or 3' ends of such DNA. Primers that are complementary to native DNA sequences to be amplified have the disadvantage of these biasing the members of the families to be presented. Members which contain a sequence in the native DNA that is substantially complementary to the primer will only be amplified. Those who do not are absent from the family. For those members that are amplified, any diversity within the primer region will be suppressed. 3

For example, in European patent 368684 B1, the primer that is used is at the 5 'end of the VH region of an antibody gene. This anneals to a region of the native DNA sequence which is referred to as " sufficiently well conserved " within a single species. This initiator will bias the amplified members to those that have this " conserved " region. Any diversity within this region is extinguished. It is generally accepted that human antibody genes arise through a process involving a combinatorial selection of V and J or V, D and J followed by somatic mutations. Although most diversity occurs in the Complementarity Determining Regions (CDRs), diversity also occurs in the most conserved Structural Regions (FR), and at least some of this diversity confers or enhances the specific binding to antigens (Ag). As a consequence, libraries should contain as much diversity of CDR and FR as possible.

To clone the amplified DNAs of the peptides, polypeptides or proteins which they encode for presentation in a genetic package and / or for expression, the DNAs must be cleaved to produce ends suitable for binding to a vector. Such cleavage is generally performed using restriction endonuclease recognition sites contained in the primers. When the primers are at the 5 'end of the DNA produced from the reverse transcription of the RNA, this restriction leaves deleterious 5' untranslated regions in the amplified DNA. These regions interfere with the expression of the cloned genes and thus with the presentation of the peptides, polypeptides and proteins encoded thereby. 4

SUMMARY OF THE INTENTION It is an object of this invention to provide a method for producing a population or library of immunoglobin genes comprising the steps of: (i) introducing synthetic diversity into at least one of the CDR1 VH or CDR2 VH of such genes; and (ii) combining the diversity of step (i) with the diversity of CDR3 VH captured from B cells.

These methods are not biased to DNAs containing native sequences that are complementary to the primers used for amplification. These also allow to remove any sequence that may be deleterious to the expression of the amplified DNA prior to cloning and presentation and / or expression.

Further objects of the invention are reflected in claims 3 to 14. Each of these claims is specifically incorporated by reference in this specification.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a scheme of various methods that can be employed to amplify VH genes without using specific primers for VH sequences. FIG. 2 is a scheme of various methods that can be used to amplify VL genes without using primers specific for VL sequences. FIG. 3 is a RACE amplification scheme of the heavy and light chains of the antibody. FIG. 4 depicts the gel analysis of amplification products obtained after the primary PCR reaction of 4 different patient samples. FIG. 5 depicts the gel analysis of the cleaved kappa DNA of Example 2. FIG. 6 depicts the gel analysis of the cleaved extensor-kappa DNA of Example 2. FIG. 7 depicts the gel analysis of the PCR product of the extensor-kappa amplification of Example 2. FIG. 8 depicts the gel analysis of the PCR product purified from the extensor-kappa amplification of Example 2. FIG. 9 depicts the gel analysis of cleaved and ligated kappa light chains of Example 2. FIG. 10 is a scheme for designing the synthetic diversity of CDR1 and CDR2. FIG. 11 is a schematic of the cloning scheme for constructing the heavy chain repertoire. FIG. 12 is a schematic of antibody light chain cleavage and binding. FIG. 13 depicts the gel analysis of cleaved and ligated lambda light chains of Example 4. FIG. 14 is a schematic of antibody heavy chain cleavage and binding. FIG. 15 depicts the gel analysis of cleaved and ligated lambda light chains of Example 5. FIG. 16 is a schematic of a phage display vector. FIG. 17 is a schematic of a Fab housing. FIG. 18 is a schematic of a process for incorporating fixed residues FR1 into an antibody lambda sequence. FIG. 19 is a schematic of a process for incorporating fixed residues FR1 into an antibody kappa sequence. FIG. 20 is a schematic of a process for incorporating fixed residues FR1 into an antibody heavy chain sequence.

TERMS

In this application, the following terms and abbreviations are used:

String sense The upper strand of DNA cd as usually written. In the sense strand, 5'-ATG-3 'codes for Met.

Antisense string The lower strand of DNA cd as usually written. In the antisense strand, 3'-TAC-5 'will correspond to a Met codon in the sense strand. Direct Launcher A " direct " is complementary to a portion of the sense strand and initiates the synthesis of a new antisense strand molecule. " Direct Launcher " and " lower chain primer " are equivalent. Inverse initiator An " inverse " is complementary to a part of the antisense strand and initiates the synthesis of a new sense strand molecule. " Inverse primer " and " upper chain initiator " are equivalent. Bases Bases are specified by their position either in a vector or in a gene as their position within a gene per codon and base. For example, " 89.1 " is the first base of codon 89, 89.2 is the second base of codon 89. Sv Streptavidin Ap Ampicillin ApR A gene that confers resistance to ampicillin. 8

RERS Restriction endonuclease recognition site RE restriction endonuclease, preferably RERS URE Universal restriction endonuclease Functionally complementary Two sequences are sufficiently complementary if they pair under the selected conditions. AA Amino Acid PCR Polymerase chain reaction GLG Germline genes Ab Antibody: an immunoglobin. The term also encompasses any protein having a binding domain that is homologous to an immunoglobin binding domain. Some examples of antibodies within this definition are, inter alia, immunoglobulin isotypes and the Fab, F (ab1) 2, scfv, Fv, dAbe and Fd fragments. Fab A two-chain molecule comprising an Ab light chain and part of a heavy chain. scFv A single-chain Ab comprising VH :: binding member :: VL or VL :: binding member :: VH W. t.

HC

LC

VK

VH

VL

Wild type

Heavy chain

Light chain

A variable domain of a Kappa light chain.

A variable domain of a heavy chain.

A variable domain of a lambda light chain.

In this application where it is stated that the nucleic acids are cleaved only at the site of cleavage of a restriction endonuclease, it should be understood that less random cleavage may occur, e.g. g. , at non-specific sites beyond the specific site of break which is characteristic of the restriction endonuclease. One skilled in the art will recognize that such non-specific, random cleavage is of normal occurrence. As a consequence, " only at the cleavage site " of a restriction endonuclease means that cleavage occurs preferably at the locus characteristic of that endonuclease.

As used in this application and claims, the term " cleavage site formed by complementation of the nucleic acid and the single-stranded region of the oligonucleotide " includes cleavage sites formed by the single-stranded portion of the partially double-stranded oligonucleotide to form a duplex with the single stranded DNA, double stranded splice sites of the partially double stranded oligonucleotide, and cleavage sites introduced by the amplification primer used to amplify the combination of partially duplex single stranded DNA oligonucleotide.

In the two methods of this invention for preparing single stranded nucleic acid sequences, the first of these cleavage sites is preferred. In the methods of this invention for capturing diversity and cloning a family of diverse nucleic acid sequences, the latter two cleavage sites are preferred.

In this application, all such references are specifically incorporated by reference.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

Nucleic acid sequences which are useful in the methods of this invention, those that encode at least partially the individual peptides, polypeptides and proteins shown or expressed in or comprising the libraries of this invention may be native, synthetic or a combination thereof. These may be mRNA, DNA, or cDNA. In the preferred embodiment, the nucleic acids encode antibodies. Most preferably, they encode Fab.

The nucleic acids useful in this invention may be naturally diverse, synthetic diversity may be introduced into the naturally occurring members or the diversity may be entirely synthetic. For example, synthetic diversity can be introduced into one or more CDRs of antibody genes. Preferably, this is introduced into immunoglobulin CDR1 and CDR2. Preferably, naturally occurring CDR3 regions of the immunoglobulin genes of this invention are captured from B cells. Most preferably, the nucleic acids of this invention comprise a population of immunoglobulin genes comprising synthetic diversity in less, one, and more preferably both CDR1 and CDR2 and diversity in CDR3 captured from B cells. Synthetic diversity can be created, for example, by use of TRIM technology (US 5869644). TRIM technology allows you to control exactly which types of amino acids are allowed in variegated positions and in what proportions. In TRIM technology, codons to be diversified are synthesized using trinucleotide blends. This allows any set of amino acid types to be included in any ratio.

Another alternative that can be used to produce diversified DNA is synthesis of mixed oligonucleotides. With TRIM technology, you can allow Ala and Trp. With the synthesis of mixed oligonucleotides, a mixture including Ala and Trp will also necessarily include Ser and Gly. The types of amino acids allowed in the variegated positions are selected with reference to the structure of antibodies or other peptides, polypeptides or proteins of the family, the diversity observed in germline genes, frequently observed somatic mutations and the areas and types of variegation required.

In a preferred embodiment of this invention, the nucleic acid sequences for at least one CDR or other region of the family peptides, polypeptides or proteins are cDNAs produced by reverse transcription of mRNA. More preferably, mRNAs are obtained from peripheral blood cells, bone marrow cells, spleen cells or lymph node cells (such as B lymphocytes or plasma cells) which express members of naturally diverse sets of genes related issues. More preferably mRNAs encode a diverse family of antibodies. Most preferably mRNAs are obtained from patients suffering from at least one autoimmune disorder or cancer. Preferably, mRNAs containing a high diversity of autoimmune diseases, such as systemic lupus erythematosus, systemic sclerosis, rheumatoid arthritis, antiphospholipid syndrome and vasculitis are used.

In a preferred embodiment of this invention, the cDNAs are produced from mRNA using reverse transcription. In this preferred embodiment, the mRNAs are separated from the cell and degraded using conventional methods, so that only the full mRNAs (i.e., capped) remain. The remainder is then removed and reverse transcription is used to produce the cDNAs. Reverse transcription of the first strand (antisense) can be performed in any manner with any suitable primer. See, e.g. HJ de Haard et al., Journal of Biological Chemistry, 279 (26): 18218-30 (1999). In the preferred embodiment of this invention, where the mRNAs encode antibodies, primers that are complementary to the constant regions of antibody genes can be used. These primers are useful because they do not produce bias for subclasses of antibodies. In another embodiment, poly-dT primers (and may be preferred for the heavy chain genes) are used. Alternatively, complementary sequences may be attached to the primer to the ends of the antisense strand. 13

In a preferred embodiment of this invention, the reverse transcriptase primer can be biotinylated, thereby allowing the cDNA product to be immobilized on beads with streptavidin (Sv). The immobilization can also be carried out using a 5 'end-labeled primer with one of a) free amino group, b) thiol, c) carboxylic acid or d) another group not found in the DNA that can react to form a strong bond with a partner in an insoluble environment. If, for example, a free amine (preferably a primary amine) is provided at the 5 'end of a DNA primer, this amine may be reacted with carboxylic acid groups on a polymer bead using amide. If such preferred immobilization is used during reverse transcription, the RNA upper chain is degraded using well known enzymes, such as a combination of RNase H and RNase A, before or after immobilization.

Nucleic acid sequences useful in the methods of this invention are generally amplified prior to being used to display and / or express the peptides, polypeptides or proteins they encode. Prior to amplification, the single stranded DNAs may be cleaved using any of the methods described above. Alternatively, single stranded DNAs can be amplified and then cleaved using one of these methods.

Any of the well known methods for amplifying nucleic acid sequences may be used in this amplification. Methods that maximize and do not bias diversity are preferred. In a preferred embodiment of this invention, wherein the nucleic acid sequences are derived from antibody genes, the present invention preferably utilizes primers in the constant regions of the heavy and light chain genes and primers for a synthetic sequence which are attached at the 5 'end of the sense strand. Initiation into such synthetic sequences avoids the use of sequences within the variable regions of the antibody genes. Such initiation sites in the variable regions produce bias against V genes which are either of rare subclasses or mutated at the initiation sites. This bias is partly due to the suppression of diversity within the primer region and partially due to the absence of primer when many mutations are present in the primer complementary region. The methods disclosed in this invention have the advantage of not skewing the population of amplified antibody genes for particular types of V genes.

Synthetic sequences can be attached to the 5 'end of the DNA strand by several well known methods for the binding of DNA sequences together. 0 RT CapExtention is a preferred method.

In RT CapExtention (derived from Smart PCR (tm)), a short overlap (5'-...GGG-3 'in the upper chain primer (USP-GGG) is used to complement 3'-CCC .... 5' in the lower strand) and reverse transcripts so that the reverse complement of the upper strand primer is attached to the lower strand.

FIG. 1 and 2 show schemes to amplify VH and VL genes using RT CapExtention. FIG. 1 shows a scheme of VH gene amplification. FIG. 1, Panel A shows a specific primer for the poly-dT region of the 3 'UTR initiating the synthesis of the lower first strand. Also suitable are primers which bind to the constant region. Panel B shows the extended lower chain at its 3 'end by three Cs which are not complementary to the mRNA. Panel C shows the result of annealing a synthetic primer of the upper strand terminating to three GGGs which hybridize to CCC of the 3 'terminus and prolonging the reverse transcription by extending the lower strand through the reverse complement of the synthetic primer sequence. Panel D shows the result of PCR amplification using a 5 'biotinylated upper chain synthetic primer that replicates the 5' end of the C panel synthetic primer and a lower chain primer complementary to the part of the constant domain. Panel E shows immobilized double-stranded cDNA (cd) obtained using a 5 'biotinylated top chain primer. FIG. 2 shows a similar scheme for VL gene amplification. FIG. 2, Panel A shows a specific primer for the constant region at the 3 'or close end initiating the synthesis of the first lower strand. Also suitable are primers which bind to the poly-dT region. Panel B shows the extended lower chain at its 3 'end in three Cs which are not complementary to the mRNA. Panel C shows the result of annealing a synthetic upper chain primer terminating to three GGGs that hybridize the 3 'terminal CCCs and prolongs reverse transcription by extending the lower strand by the reverse complement of the synthetic primer sequence. Panel D shows the result of PCR amplification using a 5 'biotinylated upper chain synthetic primer that replicates the 5' end of the C panel synthetic primer and a lower chain primer complementary to the part of the constant domain. The lower strand primer also contains a useful restriction endonuclease site, such as Ase1. Panel E shows immobilized cDNA obtained using a 5 'biotinylated upper chain primer. 16

In FIG. 1 and 2, each V gene consists of a 5 'untranslated region (UTR) and a secretion signal, followed by the region

variable, followed by a constant region, followed by a 3 'untranslated region (which typically ends in poly-A). An initial primer for reverse transcription may be complementary to the constant region or the 3'-UTR poly A segment. For human heavy chain genes, a 15 T primer is preferred. Reverse transcripts bind several C-residues to the 3 'end of newly synthesized DNA. RT CapExtention explores this feature. The reverse transcription reaction is initially performed with only one lower chain primer. After about 1 hour, a primer terminating in GGG (USP-GGG) and further RTase is added. This causes the lower strand cDNA to be extended by the reverse complement of USP-GGG to the final GGG. All V genes are amplified independently of their V gene subclass using an initiator identical to the part of the linked synthetic sequence and a second primer complementary to a known sequence region at the 3 'end of the sense strand.

In another preferred embodiment, synthetic sequences can be added by Rapid Amplification of

CDNA ends (RACE) (see Frohman, A., Dush, K., and Martin, G.R. (1988) Proc Natl Acad Sci USA (85): 8998-9002). FIG. 1 shows a RACE amplification scheme of the heavy and light chains of the antibody. First, mRNA is selected by treatment of total RNA or poly (A +) with calf intestinal phosphatase (CIP) to remove the 5 'phosphates from all molecules that have them such as ribosomal RNA, fragmented mRNA, tRNA and genomic DNA. The complete mRNA (containing a

protective structure of 7 mils) is not affected. RNA 17 is then treated with tobacco acid pyrophosphatase (TAP) to remove the backbone of the full mRNA leaving a 5 'monophosphate group. Thereafter, a synthetic RNA adapter is attached to the RNA population, only molecules having a 5-phosphate (full, un-capped mRNA) will accept the adapter. Reverse transcriptase reactions are then utilized using an oligodT primer and PCR with internal primers (using an adapter primer (located on the 5 'synthetic adapter) and a primer for the gene) to amplify the desired transcript.

In a preferred embodiment of this invention, the upper or lower chain primer may also be biotinylated or labeled at the 5 'end with one of a) free amino group, b) thiol, c) carboxylic acid, and d) another group not found in the DNA that can react to form a strong bond with a partner known as an insoluble medium. These can then be used to immobilize the labeled strand after amplification. The immobilized DNA may be single-stranded or double-stranded.

After amplification (using e.g., RT CapExtension or RACE), the DNAs of this invention are single stranded. For example, the strands can be separated using a biotinylated primer, capturing the biotinylated product in beads with streptavidin, denaturing the DNA and removing the complementary strand by washing. Depending on which end of the captured DNA is desired, it will be chosen to immobilize the upper (sense) or lower (antisense) strand.

In order to prepare single-stranded amplified DNAs for cloning into genetic packages in order to perform the presentation, or for expression, of the peptides, polypeptides or proteins at least partially encoded by such DNAs, they must be manipulated to provide ends suitable for cloning and presentation and / or expression. In particular, any 5 'untranslated regions and mammalian signal sequences must be removed and replaced in the correct reading frame by a suitable signal sequence that functions in the presentation or expression host. In addition, portions of the variable domains (in antibody genes) and substituted by synthetic segments containing synthetic diversity may be removed. The diversity of other genetic families can likewise be expanded with synthetic diversity.

According to the methods of this invention, there are two ways of manipulating the single stranded DNA for presentation and / or expression. The first method comprises the steps of: (i) contacting the nucleic acid with a single stranded oligonucleotide, the oligonucleotide is functionally complementary to the nucleic acid in the region where the cleavage is desired and including a sequence which with its complement in nucleic acid forms a site of recognition of a restriction endonuclease which under restriction results in the breakdown of the nucleic acid at the desired position; and (ii) cleaving the nucleic acid only at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide; the contacting and cleavage steps being performed at a temperature sufficient to maintain the nucleic acid in a substantially single stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a region large enough to allow the two chains to associate so that the cleavage can occur at the selected temperature and in the desired position and the cleavage being performed using a restriction endonuclease which is active at the selected temperature.

In this first method, short stranded oligonucleotides are paired with single stranded DNA so that restriction endonuclease recognition sites formed within regions of now double-stranded DNA can be cleaved. In particular, a recognition site that occurs at the same location in a substantial fraction of the single stranded DNA is identical.

For antibody genes, this may be done using a germline sequence catalog. See, e.g. g., " http: //www.mrc-cpe.cam.ac.uk/imt-doc/restricted/ok.htm 1. " Updates from this location can be obtained under the heading " Amino acid and nucleotide sequence alignments. &Quot; There are similar comparisons for other families and can be used to select regions suitable for cleavage and maintain diversity.

For example, Table 1 represents the DNA sequences of the FR3 regions of 51 known human germline VH genes. In this region, the genes contain restriction endonuclease recognition sites shown in Table 2. Restriction endonucleases cleaving a large fraction of germline genes in the same site relative to endonucleases that cut at various sites are preferred. In addition, it is preferred that there is only one site for the restriction endonucleases within the region to which the short oligonucleotide binds to the single stranded DNA, e.g. about 10 bases on either side of the restriction endonuclease recognition site. Also preferred is an enzyme which cleaves downstream in FR3 because it captures fewer mutations in the structure. This may be advantageous in some cases. However, it is well known that there are mutations in structure and confer and enhance binding of the antibody. The present invention allows all or part of FR3 diversity to be captured by selection of the appropriate restriction site. In this way, the method also allows an extensive diversity to be captured.

Finally, restriction endonucleases that are active at about 37 ° C to about 75 ° C are used in the methods of this invention. Preferably, restriction endonucleases that are active between about 45 ° C and about 75 ° C can be used. More preferably, enzymes are used which are active above 50 ° C and most preferably active at about 55 ° C. Such temperatures maintain the nucleic acid sequence to cleave substantially in the single-stranded form.

The enzymes shown in Table 2 which cleave many of the heavy chains of germline FR3 genes in a single position include: MaelII (2404), Tsp45I (2104), Hphl (4405), BsaJI (23065), Alui (23047), BlpI ( 21048), Dde I (29058), BglII (10061), Msll (44072), BsiEI (23074), Eael (23074), EagI (23074), HaelII (25075), Bst4CI (51086), BpyCH4III (51086), HinfI (3802), Mlyl (1802), Ple I (1802), Μη II (31067), BpyCH4V (21044), BsmAI (16011), Bprnl (19012), Xmnl (12030) and Saci (11051). (The notation used means, for example, that BsmAI cleaves 16 of the germline FR3 genes with a restriction endonuclease recognition site starting at the FR3 base 11.)

For cleavage of human heavy chains in FR3, the preferred restriction endonucleases are: Bst4 Cl (or Taal or HpyCH4III), BlpI, HpyCH4V and MslI. Since ACNGT (the restriction endonuclease recognition site for Bst4CI, Taal and HpyCH4III) is found at a consistent site in all human germline FR3 genes, one of those enzymes is most preferred for capturing the CDR3 diversity of the heavy chain . BlpI and fyyCH4V are complementary. BlpI cuts most members of the VH1 and VH4 families while i7pyCH4V cuts off most members of the VH3, VH5, VH6 and VH7 families. No enzyme cuts VH2, but this is a very small family, containing only three members. Accordingly, these enzymes may also be used in preferred embodiments of the methods of this invention.

All restriction endonucleases HpyCH4III, Bst4Cl and Taal recognize 5'-ACnGT-3 'and cleave the DNA in the upper chain after n and the lower chain DNA before the complementary base at n. This is the most preferred restriction endonuclease recognition site for this method in human heavy chains because this is found in all germline genes. In addition, the restriction endonuclease recognition region (ACnGT) combines the second and third bases of a tyrosine codon (tay) and the next cis-codon (tgy) as shown in Table 3. These codons are highly conserved, especially cysteine in mature antibody genes. The table E 4 shows the distinct oligonucleotides having 22 bases in length (except the last which is 20 in length). Table 5 C shows the analysis of 1617 real antibody heavy chain genes. Of these, 1511 have the site and correspond to one of the candidate oligonucleotides within 4 mismatches. Eight oligonucleotides correspond to most of the 22 matches and are given in Table 4 F.l. The 8 oligonucleotides are very similar so that it is likely that satisfactory cleavage with only one oligonucleotide (such as H43.77.97.1-02 # 1) will be achieved by adjusting the temperature, pH, salinity, and the like. Likewise, one or two oligonucleotides may be sufficient whenever the germline gene sequences differ very little and especially if they differ very little close to the restriction endonuclease recognition region to be cleaved. Table 5D shows a repeat analysis of 1617 real antibody heavy chain genes using only 8 selected oligonucleotides. This shows that 1463 of the sequences correspond to at least one of the oligonucleotides within 4 mismatches and have the site as expected. Only 7 sequences have a second restriction endonuclease recognition region phy and CH4III in this region.

A further illustration of the selection of a suitable restriction endonuclease recognition site involves cleavage in FR1 from human heavy chains. Cleavage in FR1 allows the capture of the full diversity of heavy chain CDRs.

The germline genes for human heavy chain FR1 are shown in Table 6. Table 7 shows the restriction endonuclease recognition sites found in human germline FR1 genes. Preferred sites are Bsgl (GTGCAG; 39-4), BsoFI (GCng: 4306,1109,203,1012), Tsel (Gcwgc; 4306,1109,203,1012), MspAlI (CMGckg; 4607,201), PvuII ( CsAg (4607.201), Alui (AGct; 4808202), Dde I (Ctnag; 220529048), Hphl (tcacc; 22080), BssKI (Ngcgg: 35039,2040), BsaJI (Cnngg: 32090,2041), BstNI (CCwgg; 33040), ScrFI (CCng: 35 40.2 41), EcoO109l (RGnccy; 22046, 11043), Sau96l (Ggncc: 23047,11044), Avall (Ggwcc: 230474044), PpuMI (RGgwccy; No. 220969043), BsmFI (gtccc; 20-48), 23

Hinfl (Gantc: 34016,21056,21077), Tfi I (21077), Mly I (GAGTC; 34016), Mlyl (gactc; 21056) and AlwNI (CAGnnnctg: 22068). The most preferred sites are MspAI and PvuII. MspAI and PvuII have 46 sites at 7-12 and 2 at 1-6. To avoid cleavage at both sites, oligonucleotides that do not completely cover the site at 1-6 are used. In this way, the DNA will not be cleaved at that site. Applicants have shown that DNA extending 3, 4 or 5 bases in addition to a PvuII site can be cleaved efficiently.

A further illustration of the selection of a suitable restriction endonuclease recognition site involves FR1 cleavage of human kappa light chains. Table 8 shows human germline kappa FR1 genes and Table 9 shows restriction endonuclease recognition sites which are found in a substantial number of human germline kappa FR1 genes in consistent positions. Of the restriction endonuclease recognition sites listed, BsmAI and PflFI are highly preferred enzymes. BsmAI sites are found in 35 of 40 genes in the 18 germline base. PflFI sites are found in 35 of 40 germline genes in base 12.

A further example of the selection of a suitable restriction endonuclease recognition site involves FR1 cleavage of the human lambda light chain. Table 10 shows the known human lambda germline FR1 gene sequences. Table 11 shows restriction endonuclease recognition sites found in human lambda FR1 'germline genes. HinFI and Ddel are the most preferred restriction endonucleases for cleaving human lambda strands in FR1.

After selecting the appropriate site or sites for cleavage, one or more short oligonucleotides are prepared in a manner to functionally complement, either alone or in combination, the selected recognition site. Oligonucleotides also include sequences flanking the recognition site in most of the amplified genes. This flanking region allows the sequence to anneal to the single stranded DNA sufficiently to allow cleavage by the restriction endonuclease specific for the selected site. The actual length and sequence of the oligonucleotide depend on the recognition site and the conditions to be used to contact and cleave. The length should be sufficient so that the oligonucleotide is functionally complementary to the single stranded DNA over a region large enough to allow the two strands to associate so that the break can occur at the selected temperature and in the desired position.

Typically, the oligonucleotides of this preferred method of the invention are about 17 to about 30 nucleotides in length. Below about 17 bases, the pairing is too weak and above 30 bases there may be a loss of specificity. A preferred length is 18 to 24 bases.

Oligonucleotides of this length do not have to be identical complements of the germline genes. On the contrary, some mismatches may be tolerated. However, more than 1-3 mismatches are preferably not allowed. Such mismatches do not adversely affect pairing of the oligonucleotide with the single stranded DNA. Thus, the two DNAs are said to be functionally complementary. The second method for manipulating the single stranded DNA of this invention for presentation and / or expression comprises the steps of: (i) contacting the nucleic acid with a partially double stranded oligonucleotide, the single stranded strand of the functionally complementary oligonucleotide to the nucleic acid in the region where cleavage is desired and the double-stranded region of the oligonucleotide having a restriction endonuclease recognition site; and (ii) cleavage of the nucleic acid only at the cleavage site formed by complementation of the nucleic acid and the single-stranded region of the oligonucleotide; the contacting and cleavage steps performed being at a temperature sufficient to maintain the nucleic acid in substantially single stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a region large enough to allow the association of the two that the cleavage can occur at the selected temperature and in the desired position and the cleavage being performed using a restriction endonuclease that is active at the selected temperature.

As discussed above, the cleavage site may be formed by the single-stranded portion of the partially double-stranded oligonucleotide forming a duplex with the single-stranded DNA, the cleavage site may be contained in the double-stranded portion of the partially double stranded oligonucleotide or the cleavage site may be introduced by the amplification primer used to amplify the combination single-stranded DNA-partially double-stranded oligonucleotide. In this embodiment, the former is preferred. And the restriction endonuclease recognition site may be located in the double stranded portion of the oligonucleotide or introduced by the amplification primer, which is complementary to the double stranded region, as used to amplify the combination.

Preferably, the restriction endonuclease site is a Type II-S restriction endonuclease, the site of the restriction being located at a known distance from its recognition site.

This second method preferably employs Universal Restriction Endonucleases (" URE "). The ERUs are partially double stranded oligonucleotides. The single-stranded or overlapping ERUs consist of a DNA adapter that is functionally complementary to the sequence to be cleaved into the single-stranded DNA. The double-stranded moiety consists of a restriction endonuclease recognition site, preferably type II-S. The ERU method of this invention is specific and accurate and can tolerate some (e.g., 1-3) mismatches in the complementary regions, i.e., e., is functionally complementary to that region. In addition, the conditions under which the ERU is used can be adjusted so that the majority of the genes that are amplified can be cut, reducing bias in the library produced from those genes. The single stranded DNA adapter sequence or the overlap portion of the ERU typically consists of about 14-22 bases. However, longer or shorter adapters may be used. The size depends on the ability of the adapter to associate with its functional complement in the single stranded DNA and the temperature used to contact the ERU and the single stranded DNA at the temperature used to cleave the DNA with the restriction enzyme. The adapter should be functionally complementary to the single stranded DNA over a region large enough to allow the two chains to associate so that the cleavage can occur at the selected temperature and in the desired position. Applicants prefer single or overlapping portions of 14-17 bases in length and, more preferably, 18-20 bases in length. The site selected for cleavage using ERUs is preferably one that is substantially conserved in the amplified DNA family. In comparison to the first breaking method of this invention, these sites do not have to be endonuclease recognition sites. However, as the first method, the sites selected may be synthetic as opposed to existing in the native DNA. Such sites may be selected by references to known antibody sequences or other gene families. For example, sequences of many germline genes are described at http: //www.mrc-cpe.cam.ac.uk/imt-doc/restricted/ok ◆ html. For example, a preferred site occurs near the FR3-codon end 89 to the second base of codon 93. CDR3 starts at codon 95.

Sequences of 79 human heavy chain genes are also available at http: //www.ncbi.nlm.nih.qov/entre2/nucleotide.html. This site can be used to identify sequences suitable for the cleavage of ERUs according to the methods of this invention. See, e.g. Table 12B. 28

Most preferably, one or more sequences are identified using these sites or other available sequence information. These sequences together are present on a substantial fraction of the amplified DNAs. For example, multiple sequences may be used to take into account the known diversity in germline genes or for frequent somatic mutations. Synthetic degenerate sequences may also be used. Preferably, a sequence (s) occurring in at least 65% of examined genes having no more than 2-3 mismatches is selected. Subsequently, URE strand adapters are made or overlaps to be complementary to the selected regions. The conditions for using ERUs are determined empirically. These conditions should allow cleavage of the DNA containing the functionally complementary sequences with no more than 2 or 3 mismatches but not allowing cleavage of the DNA free of those sequences.

As described above, the double-stranded portion of the ERU includes an endonuclease recognition site, preferably a Type II-S recognition site. Any enzyme that is active at a temperature necessary to keep the single stranded DNA substantially in that fashion and allow the portion of the single stranded DNA adapter of the URE to anneal for sufficient time with the single stranded DNA to allow cleavage at the intended location.

Preferred Type II-S enzymes for use in the URE methods of this invention provide asymmetric cleavage of the single stranded DNA. Among these are the enzymes listed in Table 13. The most preferred Type II-S enzyme is Fok1. 29

When URE containing the preferred Fokl is used, various conditions are preferably used to carry out the cleavage: 1) Excess ERU over the target DNA should be present to activate the enzyme. URE present only in equimolar amounts relative to the target DNA will produce little ssDNA breakage because the amount of the available active enzyme will be limiting. 2) An activator may be used to activate part of the Fokl enzyme to dimerize without causing cleavage. Examples of suitable activators are shown in Table 14. 3) The cleavage reaction is carried out at a temperature between 45 ° -75 ° C, preferably above 50 ° C, and most preferably above 55 ° C.

The ERUs used in the prior art contained a single 14 base chain segment, one 10 base stem (containing one Fokl site), followed by the 10 base stem palindrome. While such ERUs may be used in the methods of this invention, the preferred ERUs of this invention also include a three to eight base segment (one loop) between the segments containing the restriction endonuclease recognition site Fok1. In the preferred embodiment, the stem (containing the Fokl site) and its palindrome are also longer than 10 bases. Preferably, these are 10-14 bases in length. Examples of these URE " lollipop " adapters are shown in Table 15. 30

An example of using an ERU to cleave a single stranded DNA involves the FR3 region of the human heavy chain. Table 16 shows an analysis of 840 mature human heavy chains complete with the shown URE recognition sequences. The vast majority (718/840 = 0.85) will be recognized with 2 or fewer mismatches using five ERUs (VHS881-1.1, VHS881-1.2, VHS881-2.1, VHS881-4.1 and VHS881-9.1). Each has a 20 base complementing sequence to complement the germline gene, a ten base rod segment containing a FokI site, a five base loop, and the reverse complement of the first stem segment. The pairing of such adapters, alone or in combination, with single-stranded antisense heavy chain DNA and FokI treatment in the presence of, e.g. g., FOKIact activator, will lead to cleavage of the antisense strand in the indicated position.

Another example of using (a) ERU to break a single-stranded DNA involves the FR1 region of human kappa light chains. Table 17 shows an analysis of 182 complete human kappa chains for correspondence with the four 19 base probe sequences shown. Ninety-six percent of the sequences combine with one of the probes with 2 or fewer mismatches. The URE adapters shown in Table 17 are for sense-chain ligation of kappa chains. Thus, the adapter sequences are the reverse complement of the germline gene sequences. The ERU consists of a ten base rod, a five base loop, the reverse rod complement, and the complementation sequence. The loop shown here is TTGTT, but other sequences may be used. Its function is to interrupt the palindrome of the rods so that the formation of a " lollypop " monomeric relative to dimerization. Table 17 also shows in which direction the chain is cleaved. 31

Another example of using an ERU to cleave a single stranded DNA involves the human lambda light chain. Table 18 shows the analysis of 128 human lambda light chains for correspondence with the four 19-base probes shown. 88 of 128 (69%) of the strands combine with one of the probes, with three or fewer mismatches. Table 18 also shows URE adapters corresponding to these probes. Pairing of these adapters with lambda chain upper chain cDNAs and FokI treatment in the presence of Foklact at a temperature of 45Â ° C or greater will result in specific and precise cleavage of the chains.

The conditions under which the short oligonucleotide sequences of the first method and the ERUs of the second method are contacted with the single stranded DNA can be determined empirically. The conditions must be such that the single stranded DNA remains in substantially single stranded form. More particularly, the conditions must be such that the single stranded DNA does not form loops that may interfere with its association with the oligonucleotide sequence or with ERUs or which in themselves can provide cleavage sites for the selected restriction endonuclease. The efficiency and specificity of the short oligonucleotides (first method) and ERU (second method) can be adjusted by controlling the concentrations of the URE / oligonucleotide and substrate DNA adapters, temperature, pH, metal ion concentration, strength (such as urea and formamide), the concentration of the restriction endonuclease (eg, FokI) and the time of digestion. These conditions may be optimized with synthetic oligonucleotides having either: 1) target germ line gene sequences, 2) mutated target gene sequences or 3) somewhat related non-target sequences. The aim is to cleave most of the target sequences and minimal amounts of the non-target.

In accordance with this invention, the single-stranded DNA is maintained substantially in that form using a temperature between about 37 ° C and about 75 ° C. Preferably, a temperature between about 45 ° C and about 75 ° C is used. More preferably, a temperature between 50 ° C and 60 ° C, most preferred between 55 ° C and 60 ° C, is used. These temperatures are used when contacting the DNA with the oligonucleotide or the ERU and when the DNA is cleaved using the methods of this invention.

The two breaking methods of this invention have several advantages. The first method allows the individual members of the single stranded DNA family to be cleaved, preferably at a substantially conserved endonuclease recognition site. The method also does not require incorporation of an endonuclease recognition site into the reverse transcription or amplification primers. Any native or synthetic site in the family can be used. The second method has both of these advantages. In addition, the preferred URE method allows single stranded DNAs to be cleaved at positions where no naturally occurring or syntactically constructed endonuclease recognition site exists.

More importantly, both of the cleavage methods allow the use of 5 'and 3' primers in order to maximize the diversity and then cleave to remove unintended or harmful sequences prior to cloning, presentation and / or expression.

After cleavage of the amplified DNAs using one of the methods of this invention, the DNA is prepared for cloning, presentation and / or expression. This is accomplished using a partially duplex synthetic DNA adapter whose terminal sequence is based on the specific breaking site at which the amplified DNA has been cleaved. Synthetic DNA is designed so that when it is ligated to the single stranded DNA cleaved in the appropriate reading frame so that the desired peptide, polypeptide or protein can be presented and / or expressed on the surface of the genetic package. Preferably, the double-stranded portion of the adapter comprises the sequence of several codons encoding the amino acid sequence characteristic of the family of peptides, polypeptides or proteins to the break site. For human heavy chains, amino acids of structure 3-23 are preferably used to provide the sequences necessary for the expression of the cleaved DNA.

Preferably, the double-stranded portion of the adapter is about 12 to 100 bases in length. More preferably, about 20 to 100 bases are used. The dual adapter double region also preferably contains at least one endonuclease recognition site useful for cloning the DNA into a suitable presentation and / or expression vector (or a receptor vector used to archive diversity). This restriction endonuclease site may be native to the germline gene sequences used to prolong the DNA sequence. 34

This can also be constructed using degenerate sequences relative to the native germline gene sequences. Or, this can be totally synthetic. The single-stranded portion of the adapter is complementary to the region of the single stranded DNA break. The overlap may be from about 2 bases to about 15 bases. The longer the overlap, the more efficient the connection will probably be. A preferred extension for the overlap is 7 to 10. This allows for some mismatches in the region so that diversity can be captured in this region. The single stranded region or partially duplex adapter overlap is advantageous because they allow for cleaved DNA to be captured at the selected site, but not other fragments. Such fragments would contaminate the library with genes encoding sequences that will not bind to suitable antibodies and are likely to be non-specifically adherent.

An illustration of the use of the partially duplex adapter in the methods of this invention involves the attachment of that adapter to a human FR3 region which has been cleaved, as described above, to 5'-ACnGT-3 'using HpyCH4III, Bst4Cl or Taal. Table 4 F.2 shows the lower strand of the double-stranded portion of the cleaved lower strand DNA linker. Since the HpyCH4III site is situated to the right (as shown in Table 3), a sequence including the AflII site as well as the XbaI site may be added. This lower half portion of the partially duplex adapter, H43.XAExt, incorporates XbaI and AflII sites. The upper chain of the double-stranded portion of the adapter has no locale (due to mismatches planned in the segments opposite the Xbal and AflII sites of H43.XAExt), but will pair very closely with H43.XAExt. H43AExt contains only the AflII site and is intended to be used with the higher chains H43.ABrl and H43.ABr2 (which have intentional changes to destroy the AflII site).

After ligation, the captured target DNA may be PCR amplified if desired, using in the preferred embodiment a primer for the constant region downstream of the antibody gene and a primer for part of the standard double region of the adapter. The primers may also contain restriction endonuclease sites for use in cloning the amplified DNA.

Upon binding and possibly amplification, of the partially double stranded adapter to the single stranded amplified DNA, the compound DNA is cleaved at selected 5 'and 3' endonuclease recognition sites.

Cleavage sites useful for cloning depend on the phage or phagemid or other vectors in which the envelope will be inserted and the available sites on the antibody genes. Table 19 provides restriction endonuclease data for human light chains. Table 20 shows data corresponding to 79 human heavy chains. In each Table, the endonucleases are ordered by the increasing cutoff frequency. In these tables, Nch is the number of chains cut by the enzyme and Ns is the number of sites (some chains have more than one site).

From this analysis, I, I, Not I, Afl II, Apa I and Asc I are very suitable. Sig1 and Not1 are preferably used in pCES1 to insert the heavy chain display segment. 36

ApaLI and AseI are preferably used in pCES1 to insert the light chain presentation segment.

BstEII sites occur in 97% of the germline JH genes. In rearranged V genes, only 54/79 (68%) of the heavy chain genes contain a BstEII site and 7/61 of these contain two sites. Thus, 47/79 (59%) contain a single BstEII site. An alternative to the use of BstEII is to cleave through URE at the JH end and to attach to a synthetic oligonucleotide encoding part of CHI.

One example of preparing a family of DNA sequences using the methods of this invention involves capturing the diversity of human CDR3. As described above, mRNAs from various autoimmune patients are reverse transcribed in the lower cDNA strand. After the upper RNA strand is degraded, the lower strand is immobilized and a short oligonucleotide is used to break up the cDNA upstream of CDR3. A partially duplex synthetic DNA adapter is then paired with the DNA and the DNA is amplified using a primer for the adapter and a primer for the constant region (after FR4). The DNA is then cleaved using BstEII (in FR4) and a restriction endonuclease suitable for the partially double stranded adapter (e.g., XbaI and AfIII (in FR3)). The DNA is then ligated into a synthetic V H base structure such as 3-23.

An example of preparation of a single stranded DNA that has been cleaved using the URE method involves the human Kappa chain. The cleavage site in the sense strand of this strand is shown in Table 17. The kapextURE oligonucleotide is paired with the oligonucleotides (kaBROI1, kaBR02UR, kaBR03UR and kaBR04UR) to form a partially duplex DNA. This DNA is then bound to the broken soluble kappa chains. The ligation product is then amplified using kapextUREPCR and CKForeAsc primers (inserting an Asei site after the end of C kappa). This product is then cleaved with ApaLI and AscI and ligated to a similarly cleaved receptor vector.

Another example involves the lambda light chain breakdown, shown in Table 18. After the break, an extender (on_LamExl33) and four bridge oligonucleotides (ON_LamBl-133, ON-LamB2-133, ON_LamB3-133 and ON-LamB4 -133) to form a partially duplex DNA. This DNA is bound to the chains of the broken lambda chain. After ligation, the DNA is amplified with ON_Laml33PCR and a specific lambda constant domain specific primer, such as CL2ForeAsc or CL7ForeAsc (Table 130).

In human heavy chains, almost all FR4 genes (downstream, ie, towards the 3 'end of the sense strand, CDR3) can cleave at a BstEII site which occurs at a constant position in a very large fraction of V genes of human heavy chain. A FR3 site is then required if it is intended to capture only the diversity of CDR3, in FR2, if CDR2 and CDR3 diversity is desired, or in FR1, if all of the CDR diversity is desired. These sites are preferably inserted as part of the partially double stranded adapter. The present disclosure also relates to receptor vectors (e.g., for presentation and / or expression) having sites that allow the cloning of both light and heavy chains. Such vectors are well known and widely used in the art. A preferred phage display vector according to the invention is phage MALIA3. This shows the gene III. The MALIA3 phage sequence is shown in Table 21A (annotated) and Table 21B (condensed). The DNA encoding the selected regions of the light or heavy chains can be transferred to the vectors using endonucleases which cleave both light and heavy chains only very rarely. For example, light chains can be captured with ApaLI and Asc I. Heavy chain genes are preferably cloned into a receptor vector having SfiI, Ncol, XbaI, AflII, BstEII, ApaI and NotI sites. The light chains are preferably transferred to the library as ApaLI-Ascl fragments. The heavy chains are preferably transferred to the library as Sfil-NotI fragments.

Most preferably, the presentation occurs on the surface of a M13 phage derivative. The most preferred vector contains all the M13 genes, an antibiotic resistance gene and the presentation envelope. The preferred vector is provided with restriction sites that allow the introduction and excision of members of the diverse gene family, as envelopes. The preferred vector is stable against rearrangement under the growth conditions used to amplify the phage.

In another embodiment of this invention, the diversity captured by the methods of the present invention may be presented and / or expressed in a phagemid vector (e.g., pCESI) which displays and / or expresses the peptide, polypeptide or protein. Such vectors may also be used to store diversity for subsequent presentation and / or expression using other vectors or phages. 39

In another embodiment of this invention, the diversity captured by the methods of the present invention may be presented and / or expressed in a yeast vector.

In another embodiment, the embodiment may be through a short linker to anchor the domains - a possible anchor comprising the final portion of M13 III (" Illstump ") and a second possible anchor being the mature protein III complete. The Illstump fragment contains sufficient M13 III for assembly in the phage but not the domains involved in the mediation of infectivity. Since proteins III w are present. t. it is unlikely that the phage will eliminate antibody genes and the phage that effectively eliminates these segments receives only a very small growth advantage. For each of the anchor domains, DNA encodes the sequence of AA w. t., but differs from the DNA sequence w. t. to a very high extent. This will greatly reduce the potential for homologous recombination between the anchor and the w gene. t. which is also present (see Example 6).

Most preferably, the present invention utilizes a complete phage containing an antibiotic resistance gene (such as an ampicillin resistance gene) and the presentation cassette. Given the genes iii and possibly viii are present. t., the w-proteins are also present. t. The presentation cassette is transcribed from an adjustable promoter (e.g., PLacz). The use of an adjustable promoter allows the control of the ratio between the fusion gene and the envelope protein w. t. corresponding. This ratio determines the average number of copies of the phage (or phagemid) particle display. 40

In another embodiment of the methods of this invention, the phage or phagemid may display and / or express proteins in addition to Fab, replacing the Fab portions indicated above, by other protein genes.

Various hosts may be used in the aspect of the presentation and / or expression of this invention. Such hosts are well known in the art. In the preferred embodiment, in which Fab is being presented and / or expressed, the preferred host should grow at 30 ° C and be RecA- (to reduce unintended genetic recombination) and EndA- (to make it easier to recovery of RF DNA). It is also preferred that the host strain is readily transformed by electroporation. XLl-Blue MRF 'satisfies most of these preferences, but does not grow well at 30 ° C. XLl-Blue MRF 'actually grows slowly at 38 ° C and thus is an acceptable host. TG-1 is also an acceptable host although this is RecA * and EndA *. XLl-Blue MRF 'is most preferred for the intermediate host used to accumulate diversity prior to final library construction.

Upon presentation and / or expression, the libraries of this invention may be screened using techniques well known and conventionally used. The selected peptides, polypeptides or proteins may then be used to treat the disease. Generally, peptides, polypeptides or proteins for use in therapy or in pharmaceutical compositions are produced by isolating the DNA encoding the desired peptide, polypeptide or protein from the selected library member. Such DNA is then used in conventional methods to produce the peptide, polypeptides or protein encoding it in suitable host cells, preferably mammalian host cells, e.g. CHO cells. After isolation, the peptide, polypeptide or protein is used alone or with pharmaceutically acceptable compositions in therapy to treat the disease.

EXAMPLES

Example 1: RACE amplification of antibody heavy and light chain repertoires of autoimmune patients.

Total RNA was isolated from individual blood samples (50 ml) from 11 patients using an RNAzol ™ kit (CINNA / Biotecx) as described by the manufacturer. Patients were diagnosed as follows: 1. SLE and phospholipid syndrome 2. limited systemic sclerosis 3. SLE and Sjogren's syndrome 4. Limited systemic sclerosis 5. Rheumatoid arthritis with active vasculitis 6. Limited systemic sclerosis and Sjogren's syndrome 7. Rheumatoid arthritis and vasculitis (not active) 8. SLE and Sjogren's syndrome 42

9. SLE 10. SLE and glomerulonephritis (active) 11. Polyarthritis / Raynaud's phenomenon

Poly-A + RNA was isolated from these 11 total RNA samples using the Promega PolyATtract® mRNA Isolation kit (Promega).

250 ng of each poly-A + RNA sample was used to amplify the heavy and light antibody chains with the GeneRAacer ™ kit (Cat No. Invitrogen L1500-01). In FIG. 3 shows a schematic summary of the RACE process.

An RNA adapter was attached to the 5 'end of all mRNAs using the GeneRacer ™ general kit protocol. Thereafter, a reverse transcriptase reaction was performed in the presence of oligo-specific primer (dT15) under conditions described by the manufacturer in the GeneRAacer ™ kit.

One-fifth of the reverse transcriptase reaction cDNA was used in a 20 pL PCR reaction. A direct primer based on the IgM CHI chain [HuCmFOR] and a reverse primer based on the synthetic linker sequence [5] was used for amplification of the IgM heavy chain repertoire. (See Table 22)

A forward primer containing the 3 'end of the cDNA encoding [HuCkFor and HuCLFor2 + HuCLfor7] and a reverse primer based on the synthetic adapter sequence 43 bound [5'A] was used for the amplification of the kappa and lambda light chains, ( See Table 22). Specific amplification products were obtained after 30 cycles of primary PCR. FIG. 4 shows the amplification products obtained after the primary PCR reaction from 4 different patient samples. 8 μl of primary PCR products from 4 different patients [labeled 1,2,3 and 4] were analyzed on an agarose gel. For the heavy chain, a product of approximately 950 nt is obtained while for the kappa and lambda light chains the product is approximately 850 nt. Ml-2 are molecular weight markers.

PCR products were also analyzed by DNA sequencing [10 lambda, kappa or heavy chain repertoire clones]. All sequenced antibody genes recovered contained the complete coding sequence as well as the 5 'leader sequence and V gene diversity was the expected diversity (compared to literature data).

50 ng of all 11 individual amplified samples were mixed for the heavy, light lambda or light kappa chains and were used in secondary PCR reactions.

In all of the secondary PCRs, approximately 1 ng template DNA from the primary PCR blend was used in multiple 50 pL PCR reactions [25 cycles].

For the heavy chain, an internal biotinylated forward primer [HuCm-Internal] was used and a reverse primer of the inner 5 'end located in the synthetic adapter sequence [5'NA] was used. The 5 'end of the heavy chain lower chain was biotinylated. 44

For the light chains, a 5 'end biotinylated internal primer was used in the synthetic adapter [5'NA] in combination with a 3' end primer in the Ckappa and Clambda constant region, extended with a sequence encoding the restriction site Asei [kappa: HuCkForAscI, Lambda: HuCL2-F0R-ASC + HuCL7-F0R-ASC]. [5 'end DNA of the upper strand was biotinylated]. After gel analysis, the secondary PCR products were pooled and purified with Promega Wizzard PCR cleanup. Approximately 25 pg of biotinylated heavy chain DNA, lambda light chain and kappa light chain were isolated from the 11 patients.

Example 2: Capture of kappa chains with BsmAI.

A repertoire of human kappa chain mRNA was prepared using the RACE method of Example 1 from a collection of patients having various autoimmune diseases.

This Example followed the protocol of Example 1. Approximately 2 micrograms (pg) RACE material of the human kappa chain (Igkappa) gene with biotin attached to the 5 'end of the upper chain was immobilized as in Example 1 in 200 microliters (pL ) of Seradyn magnetic beads. The lower strand was removed by washing the DNA with 2 aliquots of 200 μl of 0.1 M NaOH (pH 13) for 3 minutes for the first aliquot followed by 30 seconds for the second aliquot. The beads were neutralized with 200 μl of 10 mM Tris (pH 7.5) 100 mM NaCl. The short oligonucleotides shown in Table 23 were added in a 40-fold molar excess in 100æl of NEB 2 buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl 2, 1 mM dithiothreitol, pH 7.9) to the dried beads. The mixture was incubated at 95øC for 5 minutes then cooled to 55øC over 30 minutes. Excess oligonucleotide was removed by washing with 2 washes with NEB 3 buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl 2, 1 mM dithiothreitol, pH 7.9). Ten units of BsmAI (NEB) were added in NEB 3 buffer and incubated for 1 h at 55 ° C. Downstream DNA cleaved was collected and purified through a Qiagen PCR purification column (FIGS. 5 and 6). FIG. 5 shows a digested single-stranded kappa DNA analysis. Approximately 151.5 pmol of the adapter were annealed with 3.79 pmol of immobilized single stranded kappa DNA followed by digestion with 15 U BsmAI. The supernatant containing the desired DNA was removed and analyzed with 5% polyacrylamide gel along with the remaining beads containing complete unclipped kappa DNA. 189 pmol of cleaved single stranded DNA was purified for further analysis. Five percent of the original complete ssDNA remained in the spheres. FIG. 6 shows an extensor-cleaved kappa binding analysis. 180 pmol of pre-annealed bridge / extender was ligated to 1.8 pmol of BsmAI digested single stranded DNA. Bound DNA was purified with a Qiagen PCR purification column and analyzed on a 5% polyacrylamide gel. The results indicated that the binding of the extender to the single stranded DNA was 95% efficient.

A partially double stranded adapter was prepared using the oligonucleotide shown in Table 23. The adapter was added to single stranded DNA in a 100-fold molar excess along with 1000 units of T4 DNA ligase and incubated overnight at 16 ° C. Excess oligonucleotide was removed with a Qiagen PCR purification column. The bound material was amplified by PCR using the kapPCRt1 and kapfor primers shown in Table 23 for 10 cycles with the program shown in Table 24. The soluble PCR product was separated on a gel and presented a band of approximately 700 n as (Figures 7 and 8). The DNA was cleaved with the enzymes ApaLI and Asei, gel purified and ligated to the pCES1 vector cleaved in a similar fashion. FIG. 7 shows an analysis of the PCR product of extensor-kappa amplification. The bound extender-kappa single stranded DNA was amplified with primers specific for the extender and for the constant region of the light chain. Two different template concentrations, 10 ng versus 50 ng, were used as template and 13 cycles were used to produce approximately 1.5 pg dsDNA as shown by 0.8% agarose gel analysis. FIG. 8 shows an analysis of the PCR product purified from extensor-kappa amplification. About 5 μg of amplified-kappa double stranded DNA was amplified by PCR on a 0.8% agarose gel, excised and extracted with a GFX gel purification column. 3.5 Âμg double-stranded DNA was prepared by gel analysis. The assay for capturing kappa chains with BsmAl was repeated and yielded similar results. FIG 9A shows the DNA after it has been cleaved and collected and purified through a Qiagen PCR purification column. FIG. 9B shows the partially double stranded adapter attached to the single stranded DNA. This bound material was then amplified (FIG 9C). The gel had a band with approximately 700 n. Table 25 shows the DNA sequence of a kappa light chain captured by this process. Table 26 shows a second sequence captured by this process. The closest bridging sequence was complementary to the 5'-agccacc-3 'sequence, but the captured sequence shows 5'-Tgccacc-3', showing that some mismatching in the overlapping region is tolerated.

Example 3: Construction of Diversity of CDR1 and Synthetic CDR2 in Structure V-3-23 VH.

Synthetic diversity was created in the Complementarity Determining Region (CDR) 1 and 2 in structure 3-23 VH in a two step process: first, a vector containing the 3-23 VH structure was constructed; and then, a synthetic 1 and 2 CDRs were assembled and cloned into this vector.

For the 3-23 VH structure construction, 8 oligonucleotides and two PCR primers (T0PFR1A, B0TFR1B, B0TFR2, B0TFR3, F06, B0TFR4, ON-vgCl and 0N-vgC2 and primers - SFPRMET and BOTPCRPRIM were designed, shown in Table 27) which overlap based on the Genebank sequence of the 3-23 VH framework region. The design incorporated at least one restriction site useful in each framework region, as shown in Table 27. In Table 27, the segments that were synthesized are shown in bold, the overlapping regions are underlined and the PCR primer regions in each end are underlined.

A mixture of these oligonucleotides at a final concentration of 2.5 uM in a 20 uL PCR reaction was combined. The PCR mixture contained 200 ÂμM dNTP, 2.5 mM MgCl2, 0.02 U of Pfu Turbo ™ Polymerase DNA, 1 U of Qiagen HotStart Taq Polymerase DNA and 1 x Qiagen PCR cap. The PCR program consisted of 10 cycles of 94øC for 30 sec, 55øC for 30 sec and 72øC for 30 sec. The assembled VH 3-23 DNA sequence was then amplified using 2.5 æl of a 10 fold dilution of the initial PCR in a 100æL PCR reaction. The PCR reaction contained 200æM dNTP, 2.5 mM MgCl 2, 0.02 U of Pfu Turbo ™ Polymerase DNA, 1 U of Qiagen HotStart Taq Polymerase DNA, 1 x Qiagen PCR Buffer and 2 external primers (SFPRMET and BOTPCRPRIM) on concentration of 1æM. The PCR program consisted of 23 cycles at 94øC for 30 sec, 55øC for 30 sec and 72øC for 60 sec. The 3-23 V H DNA sequence was digested and cloned into pCES1 (phagemid vector) using the SfiI and BstEII endonuclease restriction sites. All of the restriction enzymes mentioned herein were provided by New England BioLabs, Beverly, MA and used according to the manufacturer's instructions.

Filler sequences (shown in Table 28 and Table 29) were introduced into pCES1 to replace the CDR1 / CDR2 sequences (900 bases between the BspEI and Xfoal RE sites) and CDR3 sequences (358 bases between AflII and BstEII) prior to cloning the diversity of CDR1 / CDR2. This new vector was named pCES5 and its sequence is given in Table 29.

Having the fillers in place of the CDR avoids the risk of a parental sequence being overrepresented in the library. Filler sequences are fragments of the E. coli penicillin gene. The CDR1-2 filler contains restriction sites for BglII, Bsu361, Bell, Xcm1, MluI, PvuII, HpaI and HincII, the underlined sites being unique within the pCES5 vector. Filler replacing CDR3 contains the single RsrII restriction endonuclease site. 49

In FIG. 10 there is shown a schematic representation of the design for synthetic diversity of CDR1 and CDR2. The design was based on the presence of mutations in DP47 / 3-23 and related germline genes. Diversity is designed to be introduced into the positions within CDR1 and CDR2 indicated by the numbers in FIG. 10. The diversity in each position has been selected to be one of the following three schemes: 1 = ADEFGHIKLMNPQRSTVWY; 2 = YRWVGS; 3 = PS, wherein the letters encode equimolar mixtures of the indicated amino acids.

For the construction of CDR1 and CDR2 diversity, 4 overlapping oligonucleotides (ON-vgCl, ON_Brl2, ON_CD2Xba and ON-vgC2, shown in Table 27 and in Table 30) encoding CDR1 / 2, plus flanking regions were designed. A mixture of these 4 oligonucleotides at a final concentration of 2.5 μM in a PCR reaction of 40 μl was combined. Two of the 4 oligonucleotides contained varied sequences positioned on the CDR1 and CDR2. The PCR mixture contained 200æM dNTP, 2.5μ Pwo DNA Polymerase (Roche) and 1x Pwo PCR buffer with MgSO4.2 mM. The PCR program consisted of 10 cycles at 94øC for 30 sec, 60øC for 30 sec and 72øC for 60 sec. This assembled CDR1 / 2 DNA sequence was amplified using 2.5 æl of the mixture in a 100 æl PCR reaction. The PCR reaction contained 200æM dNTP, 2.5μ Pwo DNA Polymerase, 1x Pwo PCR Buffer with MgSO4.2 mM and 2 external primers at a concentration of 1æM. The PCR program consisted of 10 cycles at 94 ° C for 30 sec, 60 ° C for 30 sec and 72 ° C for 60 sec. These variegated sequences were digested and cloned into the 3-23 VH structure in place of the CDR1 / 2 filler.

Applicants obtained approximately 7 x 107 independent transformants. The CDR3 diversity of either 50 donor populations or synthetic DNA can be cloned into the vector containing synthetic CDR1 and CDR2 diversity.

In FIG. 11 is a schematic representation of this process. A sequence was encoded the FR regions of the human V3-23 gene segment and CDR regions with synthetic diversity by assembly of oligonucleotides and cloning through the XbaI and BspEl sites in a vector which complements the FR1 and FR3 regions. In this library of synthetic VH segments, the complementary VH-CDR3 (upper right) sequence was cloned through the XbaI and BstEll sites. The resulting cloned CH genes contain a combination of designed synthetic diversity and natural diversity (see FIGURE 11).

Example 4: Cleavage and ligation of lambda light chains with HinfI.

In FIG. 12A and 12B is shown a schematic of antibody light chains breaking and binding. Approximately 2 μg of the biotinylated human Lambda DNA prepared as described in Example 1 were immobilized in 200 μl of Seradyn magnetic beads. The lower strand was removed by incubating the DNA with 200æl of 0.1 M NaOH (pH = 13) for 3 minutes, the supernatant was removed and an additional 30 second wash was performed with 200æl of 0.1æ NaOH. The supernatant was removed and the beads were neutralized with 200 μl of 10 mM Tris (pH = 7.5), 100 mM NaCl. Two additional washes were performed with 200 æl of NEB 2 buffer containing 10 mM Tris (pH = 7.9), 50 mM NaCl, 10 mM MgCl 2 and 1 mM dithiothreitol. After immobilization, the amount of cDNAs was estimated on a 5% PAGE-UREIA gel. 51

About 0.8 pg of cDNAs were incubated and incubated in 100 ul of NEB2 buffer containing 80 molar excess of an equimolar mixture of ON_Lamla B7, ON_Lam2aB7, ON Lam3lB7 and ON_Lam3rB7 (each oligonucleotide in a 20-fold molar excess) ( see Table 31). The mixture was incubated at 95 ° C for 5 minutes and then cooled slowly to 50 ° C over a period of 30 minutes. The excess of the oligonucleotide was removed by washing with 2 washes of 200æl of NEB 2 buffer. 4 U / pg of Hinf I were added and incubated for 1 hour at 50øC. The beads were mixed every 10 minutes.

After incubation the sample was purified through a Qiagen PCR purification column and then analyzed on a 5% PAGE-urea gel (see Figure 13A, cleavage was more than 70% efficient).

In FIG. 12B shows a schematic of the cleavage of the light chains. A mixture of bridge / extender pairs was prepared from the Pte / Ext oligonucleotides listed in Table 31 (total 100-fold molar excess) in 1000 U of DNA Ligase T4 (NEB) and incubated overnight at 16 ° C . After DNA ligation, the excess oligonucleotide was removed with a Qiagen PCR purification column and the binding was checked on a Urea-PAGE gel (see Figure 13B, binding was more than 95% efficient).

Multiple PCRs were performed containing 10 ng of the ligated material in a 50 pL PCR reaction using 25 pMol ON lamPlePCR and 25 pmole of an equimolar mixture of the Hu-CL2 AscI / HuCL7 AscI primer (see Example 1). PCR was performed at 60 ° C for 15 cycles using Pfu polymerase. About 1 pg of cDNA was recovered by PCR (see Figure 13C) and cleaved with ApaL1 and As cl to clone the lambda light chains in pCES2.

Example 5: Capture of the CDR3 population of human heavy dog.

In FIG. 14A and 14B shows a scheme of cleavage and binding of the antibody light chains.

Approximately 3æg RACE material of the human heavy chain (IgM) gene with biotin attached to the 5 'end of the lower chain was immobilized in 300æl of Seradyn magnetic beads. The upper strand was removed by washing the DNA with 2 aliquots of 300 μl of 0.1 M NaOH (pH 13) for 3 minutes for the first aliquot followed by 30 seconds for the second aliquot. The beads were neutralized with 300 μl of 10 mM Tris (pH 7.5) 100 mM NaCl. REdaptors (oligonucleotides used to make double-stranded locally single-stranded DNA) shown in Table 32 were added in a 30-fold molar excess in 200 μl of NEB 4 buffer (50 mM Potassium Acetate, 20 mM Tris-Acetate, 10 mM Magnesium, 1 mM dithiothreitol pH 7.9) to the dried beads. REdaptors were incubated with single stranded DNA at 80 ° C for 5 minutes then cooled to 55 ° C over 30 minutes. Excess REdaptors were removed by washing with 2 washes with NEB 4 buffer. Fifteen units of HpyCH4III (NEB) were added to NEB buffer 4 and incubated for 1 hour at 55 ° C. The cleaved downstream DNA remaining on the beads was removed from the beads using a Qiagen Nucleotide stripping column (see Figure 15). 53

The Bridge / Extender pairs shown in Table 33 were added in a molar excess of 25 along with 1200 units of the T4 DNA ligase and incubated overnight at 16 ° C. The excess Bridge / Extender was removed with a Qiagen PCR purification column. Bound material was amplified by PCR using primers H43.XAExtPCR2 and Hucumnest shown in Table 34 for 10 cycles with the program shown in Table 35. The soluble PCR product was separated on a gel and presented a band with approximately 500 n as expected (see FIG 15B). The DNA was cleaved with the Sfil and NotI enzymes, gel purified and ligated to the PCES1 vector cleaved in the same manner.

Example 6: Description of CJRA05 Phagemid Display Vector, a member of the library incorporated into vector DY3F7. Table 36 contains an annotated DNA sequence from a library member, CJRA05, see FIG. 16. Table 36 should be read as follows: on each line everything follows an exclamation mark "! &Quot; is a comment. All occurrences of A, C, G, and T before "! &Quot; are the DNA sequence. Capitals are used only to show that some bases constitute special features, such as restriction sites, ribosome binding sites, and the like, which are captioned below the DNA. CJRA05 is a derivative of the phage DY3F7, obtained by cloning an ApaLI to NotI fragment at these sites in DY3F31. DY3F31 is similar to DY3F7 except that the light chain and the heavy chain genes have been replaced by the " filler " DNA. which does not code for any antibody. DY3F7 contains an antibody which binds to streptavidin, but does not come from the present library. 54

Phage genes start with gene ii and continue with genes x, v, vii, ix, viii, iii, vi, i and iv. The gene iii has been slightly modified because eight codons have been inserted between the signal sequence and the mature protein and the final amino acids of the signal sequence have been altered. This allows the restriction enzyme recognition sites EagI and Xfoal to be present. Following the iv gene is the origin of phage replication (ori). After ori is bla which confers resistance to ampicillin (ApR). The phage and bla genes are transcribed in the same sense.

After bla, there is the Fab envelope (shown in Figure 17) comprising: a) the PlacZ promoter, b) a first Ribosome Binding Site (RBS1), c) the signal sequence form M13 iii, d) a RERS ApaLI, e) A light chain (a L20 :: JK1 kappa shortened by a codon at the boundary VJ in this case), f) A RERS Asei, g) A second Ribosome Binding Site (RBS2), h) A signal sequence , preferably a PelB, which contains, i) a RERS SfII, 55 j) a synthetic 3-23 V region with diversity in CDR1 and CDR2, k) a captured CDR3, l) a partially synthetic J region (FR4 after A) A His6 label, p) A cMyc label, q) An amber codon, r) An anchor DNA encoding the same amino acid sequence as codons 273 to 424 of M13 iii (as shown in Table 37). s) Two termination codons, t) One RERS AvrlI, and u) One trp terminator. The anchor (item r) encodes the same amino acid sequence as codons 273 to 424 of M13 iii but the DNA is approximately as different as possible from the wild type DNA sequence. In Table 36, III 'stump goes from base 8997 to base 9455. Below the DNA, as comments, are the differences from wild type 56 for codons comparable with " W.T " end of these lines. It should be noted that Met and Trp have only a single codon and must be maintained as such. These types of AA are rare. Ser codons can be modified in all three bases, while the Leu and Arg codons can be modified in two.

In most cases, a modification of one base per codon can be introduced. This has three advantages: 1) recombination with the wild-type gene contained elsewhere in the phage is less likely, 2) new restriction sites can be introduced, facilitating construction; and 3) sequencing primers can be designed which bind in only one of the two regions. The M13 III fragment shown in CJRA05 has the preferred length for the anchor segment. Longer or shorter alternative anchor segments defined relative to full mature protein III may also be used. The sequence of M13 III consists of the following elements: Signal Sequence :: Domain 1 (D1) :: Link element 1 (LL) :: Domain 2 (D2):: Link element 2 (L2):: Domain 3 (D3) ) :: Transmembrane Segment (TM) :: Intracellular anchor (IC) (see Table 38). The anchor pIII (also known as trpIII) preferably consists of D2 :: L2 :: D3 :: TM :: IC. Another embodiment of the anchor pIII consists of D2 ':: L2 :: D3 :: TM :: IC (where D2' comprises the last 21 residues of D2 with the first 109 residues removed). A further embodiment of the anchor pIII consists of D2 '(C> S): L2 :: D3 :: TM :: IC (where D2' (C> S) is D2 'with the sole C converted to S) ed) D3 :: TM :: IC. Table 38 shows a gene fragment comprising the NotI site, His6 labeling, cMyc labeling, an amber codon, a recombinant enterokinase cleavage site, and complete mature M13 III protein. The DNA used to encode this sequence is intentionally very different from the DNA of the wild type gene iii as shown by the lines designated " W. T. ". containing the bases w. t. in which they differ from this gene. III is divided into domains designated " domain 1 ", " ", ", ", " domain 2 ", " link element 2 ", " domain 3 ", " transmembrane segment " and " intracellular anchor ".

Preferred alternative anchor segments (defined by reference to the sequence of Table 38) include: codons 1-29 attached to codons 104-435, eliminating domain 1 and conserving attachment element 1 to the end; codons 1-38 attached to codons 104-435, deleting the domain and retaining the rEK cleavage site plus the linker 1 to the III end; codons 1-29 attached to codons 236-435, eliminating domain 1, linker 1 and most of domain 2 and preserving linker 2 to the end; codons 1-38 attached to codons 236-435 deleting domain 1, linker 1 and most of domain 2 and conserving linker 2 to the rEK cleavage site and the cleavage site; Codons 1-29 attached to codons 236-435 and altering the codon 240 to Ser (eg, age), eliminating domain 1, linker 1 and most of domain 2 and conserving linker 2 to far end; and codons 1-38 attached to codons 236-435 and altering codon 240 to Ser (eg, age), deleting domain 1, linker 1 and most of domain 2 and conserving linker 2 to end and the rEK cleavage site.

Constructs will be more readily accomplished by methods similar to those of Wang and Wilkinson (Biotechniques 2001: 31 (4) 722-724) where PCR is used to copy the vector except the part to be deleted and corresponding restriction sites are introduced or preserved in end of the part to be maintained. Table 39 shows the oligonucleotides to be used in the deletion of parts of anchor segment III. The DNA shown in Table 38 has a NheI site prior to the cleavage site of the recombinant enterokinase DINDDRMA (rEKCS). If Nhe I is used in the elimination process with this DNA, the rEKCS site will be lost. This site may be very useful in cleaving Fab from the phage and may facilitate the capture of antibodies of very high affinity. This sequence can be mutagenized so that the NheI site follows the rEKCS site, an amino acid sequence Ala Ser is already present. Alternatively, SphI may be used for the deletions. This would involve a slight modification in the amino acid sequence but would have no consequence. 59

Example 7: Selection of antigen binders from a human antibody enriched library using the DY3F31 phage vector.

In this example, the library of human antibodies used is described in de Haard et al., (Journal of Biological Chemistry, 274 (26): 18218-30 (1999) This library, consisting of a large library of human non- the first selected one in phOx-BSA was selected for re-reclaiming two pre-selected Fab libraries, the first one selected in phOx-BSA immobilized (R1 -ox) and the second selected twice in streptavidin (R2-strep).

These enriched repertoires of phage antibodies, in which only a very low percentage have the antigen binding activity used in the selection, were confirmed by screening clones in an ELISA for antigen binding. Selected Fab genes were transferred from the phagemid vector of this library to the DY3F31 vector through ApaI1-NotI restriction sites.

DNA from the phage vector DY3F31 was pretreated with ATP-dependent DNAse to remove the chromosomal DNA and then digested with ApaL1 and NotI. Further digestion with Asei was performed intermediately to prevent vector self-ligation. The ApaI1 / NotI Fab fragment from the pre-selected libraries was subsequently ligated into the vector DNA and transformed into competent XL1-blue MRF 'cells. 60

The libraries were made using vector: 1: 2 insert ratios for the phOx library and 1: 3 for the STREP library and using 100 ng of DNA bound by 50 æl of competent cells by electroporation (electroporation conditions: a discharge of 1700 V , 1 hour recovery of cells in rich SOC medium, plating on ampicillin-containing agar plates).

This transformation resulted in a library size of 1.6 x 106 for R1-ox in DY3F31 and 2.1x106 for R2-strep in DY3F31. Sixteen colonies from each library were screened for insertion and all presented the correct size insert (± 1400 bp) (for both libraries). The phage were prepared from these Fab libraries as follows. A representative sample of the library was inoculated into ampicillin and glucose medium and OD 0.5, the medium was switched to ampicillin and 1 mM IPTG. After overnight growth at 37øC, the phage were collected from the supernatant by PEG-NaCl precipitation. Phage was used for antigen selection. R 1 -ox in phOx-coated with BSA was selected by passive adsorption on immunotubes and R2-strep in streptavidin coated paramagnetic beads (Dynal, Norway), in procedures described in de Haard et al. and Marks et al., Journal of Molecular Biology, 222 (3): 581-97 (1991). The phage titers and the enrichments are provided in Table 40.

Clones from these selected libraries, respectively R2-ox duplicated and R3-strep, were screened for binding to their antigens in ELISA. 44 clones of each selection were screened as phage or soluble Fab for binding in ELISA. For the DY3F31 libraries, the clones were first cultured in 2% 2TY-glucose 50æg / ml AMP to an OD600 of approximately 0.5 and then grown overnight in 50 æg / ml 2TY-AMP + / - 1 mM IPTG. Induction with IPTG may result in the production of both phage-Fab and soluble Fab. Consequently the same (same) clones were also cultured without IPTG. Table 41 shows the results of an ELISA screening of the resulting supernatant either for the detection of antigen-binding phage particles (Anti-M13 HRP = anti-phage antibody) or for the detection of human Fab, either in the phage or as fragments either with the anti-myc 9E10 antibody detecting the myc label that each Fab contains at the C-terminal end of the heavy chain followed by a HRP-labeled rabbit-anti-mouse serum (9E10 / RAM-HRP column) or with anti-light chain reagent followed by a HRP-labeled goat-anti-rabbit antiserum (anti-CK / CL Gar-HRP).

The results show that in both cases the antigen ligands are identified in the library, either as phage Fab or with anti-Fab reagents (Table 41). Induction with IPTG produces an increase in the number of positives. It may also be found that for phOx clones, the phage ELISA produces more positives than the soluble Fab ELISA, most likely due to the avid phage binding. Twenty-four of the ELISA-positive clones were screened using Fab-insert PCR of the vector, followed by digestion with BstNI. This produced 17 different standards for the phOx binding Fabs in 23 samples that were correctly analyzed and 6 in 24 for the streptavidin binding clones. Thus, data from screening and screening from this pre-enriched non-immune Fab library shows that the DY3F31 vector is suitable for presentation and selection of Fab fragments and provides both Fab and Fab Fabs in phage for post-screening experiments selection. 62

Example δ: Selection of antibody-Phage libraries on streptavidin magnetic beads. The following example describes a selection in which a sample is initially drained from the library of ligands to streptavidin and optionally from ligands to a non-target (i.e., a molecule other than the target which the selected Fab is not bound to bind). It is hypothesized to be especially useful to have a molecule, termed a " competitive ligand ", which binds to the target and that an antibody that binds to the same site.

For this process Streptavidin Magnetic Spheres (Dynal) were blocked once with blocking solution (Marvel Milk 2%, PBS (pH 7.4), 0.01% Tween-20 (" MPBST 2% ")) for 60 minutes at room temperature and then washed five times with 2% MPBST. 450 μl of beads were blocked for each depletion and subsequent established selection.

By selection, 6.25 æl of the biotinylated depletion target (storage at 1 mg / ml in PBST) was added to 0.250 ml of blocked, beaded beads (from step 1). The target binding was allowed overnight with rotation at 4 ° C. The next day, the beads are washed 5 times with PBST.

By selection, 0.010 ml of the biotinylated target antigen (storage at 1 mg / ml in PBST) was added to 0.100 ml of blocked and washed beads (from step 1). Antigen binding was allowed overnight with rotation at 4 ° C. The next day, the beads were washed 5 times with PBST. 63

In loop 1, 2 x 1012 nonspecific binding to 1013 plaque forming units (pfu) were blocked by addition selection to 0.500 ml 2% MPBS (= 2% MPBST without Tween) for 1 hour at RT (rotation) . In subsequent cycles, 1011 pfu were blocked by selection as performed in cycle 1.

Each phage pool was incubated with 50 μl of target beads of depletion (removing the final wash supernatant just before use) in a Labquake rotor for 10 min at room temperature. After incubation, the phage supernatant was removed and incubated with an additional 50 æl of target beads of depletion. This was repeated another 3 times using target beads of exhaustion and twice using blocks blocked streptavidin in a total of 7 exhaustion cycles, whereby each phage assembly required 350 μl of beads of depletion.

A small sample of each set of the depleted library was collected for titration. Each library set was added to 0.100 ml target beads (removing the final wash supernatant just prior to use) and incubation was allowed for 2 hours at room temperature (rotation).

The beads were then washed as fast as possible (e.g., total 3 minutes) with 5 x 0, 500 mL of PBST and then with 2 x PBS. The phage still bound to beads after washing was eluted once with 0.250 mL of competitive ligand (~1ppm) in PBST for 1 hour at room temperature in a Labquake rotor. The eluate was removed, mixed with 0.500 mL Minimum A solution and stored. For a second selection, 0.500 mL of 100 mM TEA was eluted for 10 min at RT, then neutralized in a mixture of 0.250 mL of 1 M Tris, pH 7.4 + 0.500 mL of MinA salts.

After the first elution selection, the beads can be eluted again with 0.300 ml of non-biotinylated target (1 mg / ml) for 1 hour at RT in a Labquake rotor. The eluted phage is added to 0.450 mL of Minimum A salts.

Three eluates (competitor of the selection, target Ia selection and elution with neutralized TEA of the 2nd selection) were kept separated and a small aliquot collected from each for titration. 0.500 ml of Minimum A salts were added to the remaining bead aliquots after elution of the competitor and the target and after elution with TEA. A small aliquot of each was collected for titration.

Each elution and each set of eluted beads was mixed with 2X YT and an aliquot (eg, 1 mL with 1.10 μg / ml) of E. coli XL1-Blue MRF 'cells (or another F cell line) that had was ice-cooled after being cultured to mid-log phase, depleted and concentrated (see the procedure below " Mid-Log preparation of XL-1 blue MRF cells for infection ").

After approximately 30 minutes at room temperature, the phage / cell mixtures were spread on Bio-Assay Plates (243 x 243 x 18 mM, Nalge Nunc) containing 2XYT, agar with 1 mM IPTG. The plates were incubated overnight at 30 ° C. The next day, each amplified phage culture was harvested from its respective plate. The plate was submerged with 35 mL of TBS or LB and the cells were scraped from the plate. The resuspended cells were transferred to a centrifuge tube. An additional 20 mL of TBS or LB was used to remove any cells from the plate and were collected with the cells in the centrifuge tube. Cells were removed by centrifugation and phage 65 was recovered in the supernatant by PEG precipitation. The amplified phage preparations were titrated over the following day.

In the first cycle, two selections produced five amplified eluates. These amplified eluates were isolated for an additional 2-3 cycles of selection using ~ 1. E 12 phages / cycle. For each additional cycle, depletion and target beads were prepared the night before the cycle was started.

For the elution steps in subsequent cycles, all elutions were carried out to the elution step from which the elution occurred and the previous elutions were treated as washes. For, for example, the phage domain amplified by infection, elutions of the competitive ligand and target were performed and then were shaken as washes (see below). The beads were then used to infect E. coli. Consequently, two sets produced a total of 5 final elutions at the end of the selection. I2 selection set A. Amplified elution of ligand: elute with ligand for 1 hour, maintain as elution B. Amplified elution of target: elute with ligand for 1 hour, shake as eluate to elute the target for 1 hour, maintain as elution C. Elution of amp. infect: elute with ligand for 1 hour, shake as elution wash with target for 1 hour, shake as wash elute with cell infection, maintain as elution 2 2 selection set A. TEA amplified elution; elute with TEA for 10 min, keep as elution B. Elution of ampules. infect .; elute with TEA for 10 min, shake as washing elute with cell infection, maintain as elution

Preparation of mid-log XLl blue MRF 'cells for infection (based on Barbas et al., Phage Display manual procedure)

Culture of XLl blue MRF 'in NZCYM (12.5 mg / mL tet) at 37 ° C and 250 rpm overnight. A 500 mL culture is initiated in a 2 liter flask by dilution of 1/50 cells in NZCYM / tet (10 mL culture is added overnight) and incubated at 37 ° C at 250 rpm until an OD 600 of 0.45 (1.5-2 hours). Stirring was reduced to 100 rpm for 10 min. When OD600 reached 0.55-0.65 the cells were transferred to 2 x 250 mL centrifuge tubes, centrifuged at 600 g for 15 min at 4øC. The supernatant was poured. The residual liquid was removed with a pipette.

The sediments were gently resuspended (not pipetting up and down) in the original volume of 1 x salts Minimum A at temp. environment. The resuspended cells were transferred back into the 2 liter flask, shaken at 100 rpm for 45 min at 67-37øC. This process was performed to deplete the cells and restore the pili. Cells were transferred to 2 x 250 mL centrifuge tubes and centrifuged as before.

Cells were resuspended gently in Leak To A (5 mL per 500 mL of native culture) salts. The cells were placed on ice for use in infections as soon as possible.

The phage elutes were brought to 7.5 ml with 2XYT medium and 2.5 ml of cells were added. The beads were taken up to 3

ml with 2XYT and 1 ml of cells was added. Incubated at 37 ° C for 30 min. Cells were plated on large NUNC plates with 2XYT agar, 1 mM IPTG and incubated for 18 h at 30øC.

Example 9: Incorporation of synthetic region into FR1 / 3 region.

Examples below are shown for incorporating fixed residues into antibody sequences for kappa and lambda light chain genes and for heavy chains. The experimental conditions and the oligonucleotides used in the examples below were described in previous examples (e.g., Examples 3 and 4). The process for incorporating fixed residues FR1 into an antibody lambda sequence consists of 3 steps (see Figure 18): (1) annealing the single stranded DNA material encoding VL genes with a mixture of partially complementary oligonucleotides (indicated with Ext and Bridge) to anneal in this example to the region encoding residues 5-7 of the FR1 of the lambda genes (indicated with X.X, the overlap may sometimes not be perfect within the lambda genes); (2) binding of this complex; (3) PCR of the material bound with the indicated primer ('PCRpr') and, for example, a primer based on the VL gene. In this process the first few residues of all lambda genes will be encoded by the sequences present in the oligonucleotides (Ext., Bridge or PCRpr). After PCR, lambda genes can be cloned using the restriction site indicated for ApaLI. The process for incorporating fixed residues FR1 into an antibody kappa sequence (FIG 19) consists of 3 steps: (1) annealing the single stranded DNA material encoding VK genes with a mixture of partially complementary oligonucleotides (indicated with Ext and Pon) , to anneal in this example to the region encoding residues 8-10 FR1 of the kappa genes (indicated with X.X; overlap may sometimes not be perfect within the kappa genes); (2) binding of this complex; (3) PCR of the material bound with the indicated primer ('PCRpr') and for example a primer based within the VK gene. In this process the first few (8) residues of all kappa genes will be encoded by the sequences present in the oligonucleotides (Ext., Bridge or PCRpr.). After PCR, the kappa genes can be cloned using the restriction site indicated for ApaLI. The process incorporating fixed FR3 residues into an antibody in a heavy chain sequence (FIG. 20) consists of 3 steps: (1) annealing the single stranded DNA material encoding part of the VH genes (for example encoding the FR3, CDR3 and FR4 regions ) with a mixture of partially complementary oligonucleotides (indicated with Ext and Ponte), to anneal in this example to the region encoding residues 92-94 (within the FR3 region) of the VH genes (indicated with X..X; be sometimes perfect within the VH genes); (2) binding of this complex; (3) PCR of the material bound with the indicated primer ('PCRpr') and for example a primer based on the VH gene (such as in the FR4 region). In this process some residues of all VH genes will be encoded by the sequences present in the oligonucleotides used herein, in particular PCRpr (for residues 70-73) or from Ext / Ponte oligonucleotides (residues 74-91). After PCR, the partial VH genes can be cloned using the XbaI indicated restriction site.

It will be understood that the foregoing is only illustrative of the principles of this invention and that various modifications may be made by those skilled in the art without departing from the scope and spirit of the invention. 70

Table 1: Human GLG FR3 sequences! VH1 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 agg gtc acc atg acc agg gac acg tcc at age aca gee tac atg 81 82 82a 82b 82c 83 84 85 86 87 88 89 90 91 92 gag ctg agg agg ctg aga tet gac gac acg gee gtg tat tac tgt 93 94 95 gcg aga ga! l-i 02 # 1 aga gtc acc att acc agg gac aca tcc gcg age aca gee tac atg gag ctg age age ctg aga tet gaa gac acg gctg tat tac tgt gcg aga ga! l-i 03 # 2 aga gtc acc atg acc agg aac acc tcc ata aca gee tac atg gag ctg age age ctg aga tet gag gac acg gee gtg tat tac tgt gcg aga gg! l-i 08 # 3 aga gtc acc atg acc aca gac aca tcc acg age aca gee tac atg gag ctg agg age ctg aga tet gac gac acg gee gtg tat tac tgt gcg aga ga! ! 1- 18 # 4 aga gtc acc atg acc gag gac aca tet aca gac aca gee tac atg gag ctg age age ctg aga tet gag gac acg gee gtg tat tac tgt gca aca ga! 1- 24 # 5 aga gtc acc att acc agg gac agg tet atg age aca gee tac atg gag ctg age age ctg aga tet gag gac aca gee atg tat tac tgt gca aga ta! 1-45 # 6 aga gtc acc atg acc agg gac acg tcc acg age aca gtc tac atg gag ctg age age ctg aga tet gag gac acg gee gtg tat tac tgt gcg aga ga! 1- 46 # 7 aga gtc acc att acc agg gac atg tcc aca age aca gee tac atg gag ctg age age ctg aga tcc gag gac acg gee gtg tat tac tgt gcg gca ga! 1- 58 # 8 aga gtc acg att acc gcg gac gaa tcc acg age aca gee tac atg gag ctg age age ctg aga tet gag gac acg gee gtg tat tac tgt gcg aga ga! 1- 69 # 9 aga gtc acg att acc gcg gac aaa tcc acg age aca gee tac atg gag ctg age age ctg aga tet gag gac acg gee gtg tat tac tgt gcg aga ga! 1- and # 10 aga gtc acc ata acc gcg gac acg tet aca gac aca gee tac atg gag ctg age age ctg aga tet gag gac acg gee grg tat tac tgt gca aca ga! 1-f # 11 71! VH2 agg ctc acc ate aag gac acc tcc aaa aac cag gtg gtc ctt aca atg acc aac atg gac cct gtg gac aca gee aca tat tac tgt gca cac aga c! 2-05 # 12 agg ctc acc to tcc aag gac acc tcc aaa age cag gtg gtc ctt acc atg acc aac atg gac cct gtg gac aca gee aca tat tac tgt gca cgg ata c! 2-26 # 13 agg ctc acc to tcc aag gac acc tcc aaa aac cag gtg gtc ctt aca atg acc aac atg gac cct gtg gac aca gee acg tat tac tgt gca cgg ata c! 2-70 # 14 VH3 cga ttc acc ate tcc aga gac aac gee aag aac tea ctg tat ctg caa atg aac age ctg aga gee gag gac acg gctg tat tac tgt gcg aga ga! ! 3-07 # 15 cga ttc acc ate tcc aga gac aac gee aag aac tcc ctg tat ctg caa atg aac agt ctg aga gct gag gac acg gee ttg tat tac tgt gca aaa gat a! 3-09 # 16 cga ttc acc ate tcc agg gac aac gee aag aac tea ctg tat ctg caa atg aac age ctg aga gee gag gac acg gee gtg tat tac tgt gcg aga ga! ! 3-11 # 17 cga ttc acc ate tcc aga gaa aat gee aag aac tcc ttg tat ctt caa atg aac age ctg aga gee ggg gac acg gct gtg tat tac tgt gca aga ga! ! 3-13 # 18 aga ttc acc ate tea aga gat gat tea aaa aac acg ctg tat ctg caa atg aac age ctg aaa acc gag gac aca gee gtg tat tac tgt acc aca ga! ! 3-15 # 19 cga ttc acc ate tcc aga gac aac gee aag aac tcc ctg tat ctg caa atg aac agt ctg aga gee gag gac acg gee ttg tat cac tgt gcg aga ga! ! 3-20 # 20 cga ttc acc ate tcc aga gac aac gee aag aac tea ctg tat ctg caa atg aac age ctg aga gee gag gac acg gctg tat tac tgt gcg aga ga! ! 3-21 # 21 cgg ttc acc ate tcc aga gac aat tcc aag aac acg ctg tat ctg caa atg aac age ctg aga gee gag gac acg gee gta tat tac tgt gcg aaa ga! 3-233 # 22 cga ttc acc ate tcc aga gac aat tcc aag aac acg ctg tat ctg caa atg aac age ctg aga gct gag gac acg gctg tat tac tgt gcg aaa ga! 3-30 # 23 cga ttc acc ate tcc aga gac aat tcc aag aac acg ctg tat ctg caa atg aac age ctg aga gct gag gac acg gct gtg tat tac tgt 72 gag aga ga! ! 3303 # 24 cga ttc acc ate tcc aga gac aat tcc aag aac acg ctg tat ctg caa atg aac age ctg aga gct gag gac acg gctg tat tac tgt gcg aaa ga! ! 3305 # 25 cga ttc acc ate tcc aga gac aat tcc aag aac acg ctg tat ctg caa atg aac age ctg aga gee gag gac acg gctg tat tac tgt gcg aga ga! ! 3- 33 # 26 cga ttc acc ate tcc aga gac aac age aaa aac tcc ctg tat ctg caa atg aac agt ctg aga act gag gac acc gee ttg tat tac tgt gca aaa gat a! 3-43 # 27 cga ttc acc ate tcc aga gac aat gee aag aac tea ctg tat ctg caa atg aac age ctg aga gac gag gac acg gctg tat tac tgt gcg aga ga! ! 3- 48 # 28 aga ttc acc atc tea aga gat ggt tcc aaa age at gee tat ctg caa atg aac age ctg aaa acc gag gac aca gee gtg tat tac tgt act aga ga! 3-49 # 29 cga ttc acc ate tcc aga gac aat tcc aag aac acg ctg tat ctt caa atg aac age ctg aga gee gag gac acg gee gtg tat tac tgt gcg aga ga! ! 3- 53 # 30 aga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat ctt caa atg ggc age ctg aga gct gag gac atg gctg tat tac tgt gcg aga ga! ! 3- 64 # 31 aga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat ctt caa atg aac age ctg aga gct gag gac acg gctg tat tac tgt gcg aga ga! ! 3- 66 # 32 aga ttc acc atc tea aga gat gat tea aag aac tea ctg tat ctg caa atg aac age ctg aaa acc gag gac acg gee gtg tat tac tgt gct aga ga! ! 3- 72 # 33 agg ttc acc atc tcc aga gat gat tea aag aac acg gcg tat ctg caa atg aac age ctg aaa acc gag gac acg gtg tat tac tgt act aga ca! ! 3- 73 # 34 cga ttc acc atc tcc aga gac aac gee aag aac acg ctg tat ctg caa atg aac agt ctg aga gee gag gac acg gct gtg tat tac tgt gca aga ga! ! 3- 74 # 35 aga ttc acc atc tcc aga gac aat tcc aag aac acg ctg cat ctt caa atg aac age ctg aga gct gag gac acg gct gtg tat tac tgt aag aaa ga! ! 3- d # 36 73 VH4 cga gtc acc ata tea gta gac aag tcc aag cac ttc tcc ctg aag ctg age tet gtg acc gcc gac acg gcc gtg tat tac tgt gcg aga ga! ! 4- 04 # 37 cga gtc acc atg tea gag ac acg tcc aag aac cag ttc tcc < ctg aag ctg age tet gtg acc gcc gtg gac acg gcc gtg tat tac tgt gcg aga aa! ! 4- 28 # 38 cga gtt acc ata tet gta gac acg tet aag aac cag ttc tcc ctg aag ctg age tet gtg act gcc gcg gac acg gcc gtg tat tac tgt gcg aga ga! ! 4301 # 39 cga gtc acc ata tea gta gac agg tcc aag aac cag ttc tcc ctg aag ctg age tet gtg acc gcc gcg gac acg gcc gtg tat tac tgt gcc aga ga! ! 4302 # 40 cga gtc acc ata gta gac acg tcc aag aac cag ttc tcc ctg aag ctg age tet gtg act gcc gea gac acg gcc gtg tat tac tgt gcc aga ga! ! 43 0 4 # 41 cga gtc acc ata gta gac acg tcc aag aac cag ttc tcc ctg aag ctg age tet gtg act gcc gea gac acg gcc gtg tat tac tgt gcc aga ga! ! 4- 31 # 42 cga gtc acc ata gta gac acg tcc aag aac cag ttc tcc ctg aag ctg age tet gtg act gcc gea gac acg gcc gtg tat tac tgt gcc aga ga! ! 4- 34 # 43 cga gtc acc ata gta gac acg tcc aag aac cag ttc tcc ctg aag ctg age tet gtg act gcc gea gac acg gcc gtg tat tac tgt gcc aga ga! ! 4- 39 # 44 cga gtc acc ata gta gac acg tcc aag aac cag ttc tcc ctg aag ctg age tet gtg act gcc gea gac acg gcc gtg tat tac tgt gcc aga ga! ! 4- 59 # 45 cga gtc acc ata gta gac acg tcc aag aac cag ttc tcc ctg aag ctg age tet gtg act gcc gea gac acg gcc gtg tat tac tgt gcc aga ga! ! 4- 61 # 46 cga gtc acc ata gta gac acg tcc aag aac cag ttc tcc ctg aag ctg age tet gtg act gcc gea gac acg gcc gtg tat tac tgt gcc aga ga! ! 4- b # 47 cga gtc acc ata tea gta gac acg tcc aac cag ttc tcc ctg aag ctg age tet gtg act gcc gea gac acg gcc gtg tat tac tgt VH5 cag gtc acc ate tea gcc gac aag tcc ate age acc gcc tac ctg cag tgg age age ctg aag gcc teg gac acc gcc atg tat tac tgt gcg aga ca! 5-51 # 48 74 cac gtc acc ate tea gct gac aag tcc ate age act gee tac ctg tgg age age ctg aag gee teg gac acc gee atg tat tac tgt aga! 5- to # 49! VH6 cga acts as a cca gac aca tcc aag aac cag ttc tcc ctg cag ctg aac tet gtg act ccc gag gac acg gct tat tac tgt gea aga ga! 6-1 # 50! VH7 cgg ttt gtc ttc tcc ttg gac acc tet gtc age acg gea tat ctg cag ate tgc age cta aag gct gag gac act gee gtg tat tac tgt gcg aga ga! 74.1 # 51

Table 2: Enzymes that cut 15 or more human GLGs or have 5 + - base recognition on typical FR3T entry:

Name recognition RE #locals GLGid #: base # GLGid #: base # GLGid #: base # .....

BstEII Ggtnacc 2 1: 3 48: 3

There are 2 hits on base # 3

MaelII gtnac 36 1: 4 2: 4 3: 4 4: 4 5: 4 6: 7: 4 9: 4 10: 4 11: 4 37 4 37: 58 38: 4 39: 4 39: 4 39 : 58 40 4: 58: 4: 58: 4: 58: 4: 58: 4: 58: 4 49: 4 50 58 There are 24 hits on the base # 4 Tsp45I gtsac 33 1: 4 2: 4 3: 4 5: 4 6 4 7: 4 8: 4 9: 4 10: 4 11: 4 37 4 37 : 58 38: 58 38: 58 40: 4 40 58 41: 58 42: 58 43: 4 43: 58 44: 4 44: 45: 4 45: 58 46: 4 46: 58 47: 4 97 58 48: 4 49: 4 50: 58

There are 21 hits on base # 4 45

Hphl tcacc 75 1: 5 2: 5 3: 5 5: 5 6: 5 7: 5 11: 5 12: 5 12: 11 13: 5 14: 5 15: 5 16: 5: 1: 1: 5: 1: 1: 1: 1: 1 : 5: 35: 5 36: 5 37: 5

GLGid #: base # GLGid #: base # 38: 5 40: 5 43: 5 44: 5 45: 5 4 6: 5 47: 5 48: 5 49: 5 There are 44 hits on base # 5 NlalII CATG 26 1: 9 1: 42 2: 42 3: 42 4: 9 4: 42 5: 9 6: 42 6: 78 7: 9 7: There are 11 hits on base # 42 There is 1 hit on base # 48 It may cause irregularities. BSAJI Cnngg 37 1: 14 2: 14 5: 14 6: 14 7: 14 8: 14 9: 14 10: 14 11: 14 12: 14 13: 14 14: 14 15: 65 17: 14 17: 65 06: 65: 65: 65 07:35 65: 65 07:35 65: 65 07: There are 14 hits on base # 14 Alui AGct 42 1: 47 2: 47 3: 47 4: 47 5: 47 6: 47 7: : 477: 478 4:47 22:57 37: 47 37: 52 38: 47 40: 47 40: 47 41: 47 41: 52 42: 47 42: 52 43: 52 44: 52 44: 52 45: 47 45: 52 46: 47 4: 52 47 47 47 : 52 49: 15 50: 47 There are 23 hits on base # 47 There are 11 hits on base # 52 Only 5 bases on 47 76

BlpI GCtnagc 1:48 2: 48: 48: 48: 48: 48 10:48 39: 48 40: 48 41: 48

Name Recognition RE GLGid #: base # GLGid #: base # 21 5: 48 6: 48 11:48 37:48 38:48 42: 48 43: 48 44: 48 #locals GLGid #: base #. 46: 48 46: 48 47: 48

There are 21 hits on base # 48

There are 10 hits on base # 67 There are 7 hits on base # 36 19 22:36. There are 7 hits on base # 67 19:36 23: 36: 37: 67 39: 67 40: 67 44: 67 45: 67 4: 67

Ddel Ctnag 1: 49 1: 58 2: 49 3: 65 4: 49 6: 49 6: 58 8: 49 8: 58 9: 49 10:49 0: 49 4:49 4:49 4:49 16: 65 22: 58 22: 58 23: 58 23: 58 23: 58 23: 58 22: 49 46: 49: 49: 49 47: 49: 57: 2: 58 3: 49 5: 49 5: 58 7: 49 7: 58 9: 58 9: 65 3: 49: 49: 25: 58: 58: 58 32: 58: 58: 58 35: 58 20: 58: 49 43 49 49: 49 45: 49 49 12 51: 65

There are 29 hits on base # 58

There are 22 hits on base # 49 Only nine bases on 58 There are 16 hits on base # 65 Only seven bases on 58

BglII Agatct 11 5:61 6:61 51:47 1:61 2:61 3:61 4:61 7:61 9:61 10:61 11:51

There are 10 hits on base # 61 77

BstYI Rgatcy 1:61 2:61 3:61 7:61 8:61 9:61 There are 11 hits on base # 61 Hpy1881 TCNga RE Name Recognition GLGid #: base # GLGid #: base # 12 4: 10: 17 61 61 5:61 6:61 11: 61 51: 47 #locals GLGid #: base # ..... 1: 64 2: 6 4 3: 6 4 9: 6 4 5: 6 4 6: 6 4 7: There are 11 hits on base # 6 4 There are 4 hits on base # 57 There are 11 hits on base # 6 4 There are 4 hits on base # 57 There are 2 hits on base # 67. Msll CAYNNnnRTG 44 1: 72 2: 72 3: 72 4: 72 5:72 6: 72 7: 72 8: 72 10: 72 11:72 2:15 p.m.: 17: 72 23: 72 24: 72 25: 72 26: 72 28: 72 29: 72 30: 72 31: 72 32: 72 34: 72 35: 72 36: 72 37: 72 38: 72 39: 72 40 : 72 41: 72 42: 72 43: 72 47: 72 47: 72 47: 72 47: 72 47: 72 47: 72 There are 44 hits on the base # 72 BsiEI CGRYcg 23 1: 74 3: 74 4: 74 7: 74 11:74 10:74 10:37 2:41 11:74 17:74 22:74 30:74 33:74 34: 74 37: 74 38: 74 39: 74 40: 74 41 74: 74 74: 74 46: 74 47: 74 There are 23 hits on base # 74 Eael Yggccr 23 1: 74 3: 74 4: 74 5: 74 7: 74 8: 74 9: 74 10: 74 11: 74 17: 74 22: 74 30: 74 33: 74 34: 74 37: 74 38: 74 40: 74 41: 74 42: 74 45: 74 46: 74 47: 74

There are 23 hits on base # 74 78

EagI Cggccg 23 1: 74 3: 74 4:74 5: 74 7: 74 8: 74 9: 74 10:74 0: 74 17: 74 22: 74 30: 74 33: 74 34: 74 37: 74 39: 74 40: 74 Name Recognition RE #locals GLGid #: base # GLGid #: base # GLGid # base #. 41: 74 42: 74 45: 74 47: 74 47: 74 There are 23 hits on base # 74 HaelII GGcc 27 1: 75 3:75 4:75 5:75 7:75 8:75 9:75 10:75 11 : 75 16: 75 10:75 0: 75 0: 75 0: 75 0: 75 0: 75 0: 75 0: 75 0: 75 0: 75 48: 63-49: 63

There are 25 hits on base # 75

Bst4CI ACNgt 65 ° C 63 Locations There is a third isoskeletonism 1: 86 2: 86 3: 86 4: 86 5:36 a.m. 6:86 7:34 7:86 8:86 9:86 10:86 2:31 12:86 13: 86: 16: 86 20: 86 21:36 21:56 0: 86 24: 86 25: 86 26: 86 27: 86 28: 36 28: 86 29: 86 30: 86 32: 86 33: 36 33: 86 34: 86 35: 53 35: : 86: 86: 86 41: 86 41: 86 42: 86 43: 86 44: 86 46: 86 47: 86 48: 86 49: 86 50: 86 51: There are 51 hits on base # 86 All other places are far away HpyCH4III ACNgt 63 1: 86 2: 86 3: 86 4: 86 5: 86 6: 86 7: 34 7: 86 8: 86 9: 86 10: 86 11: 86 10:36 0: 86 12:36 0: 867: 867: 867: 867: 86 20: 0 22: 86 29: 86 25: 86 25: 86 26: 86 27: 53 27: 86 28: 36 29: 86 30: 86 31: 86 32: 86 33: 36 33: 35: 53 35: 86 36: 86 37: 86 38: 86 39: 86 40: 86 41: 86 42: 86 43: 86 44: 86 48: 86 48: 86 48: 86 49: 86 51: 86 51: 0 51: 86 There are 51 hits on the base # 86 RE Name recognition # GLGid locations #: base # GLGid #: base # GLGid # base #. . Hinfl Gantc 43 2: 2 3: 2 5: 2 6: 2 7: 2 8: 2 9: 2 9: 22 11: 2 15: 2 16: 2 17: 2 18: 2 19:22 20: 2 21: 2 23: 2 23: 2 24: 2 25: 2 26: 2 27: 2 28: 2 29: 2 30: 2 31: 2 32: 2 33: 2 33: 22 34: 22 35 There are 38 hits on base # 2 MlyI GAGTCNNNNNn 18 2: 2 3: 2 4: 2 40: 2 40: 2 43: 2 5: 2 6: 2 7: 2 8: 2 10: 2 11: 2 38: 2 40: 2 43: 2 44: 2 45: 2 46: 2 47: 2 There are 18 hits in base # 2 Piei gagtc 18 2: 2 3: 2 4: 2 5: 2 6: 2 7: 2 8: 2 9: 2 10: 2 11: 2 37: 2 38: 2 40: 2 43: 2 44: 2 45: 2 46: 2 47: 2 There are 18 hits on base # 2 Acil Ccgc 24 2: 26 9: 14 10:14 11:17 27: 74 37: 62 37: 65 38: 62 39: 65 40: 62 40: 65 41: 65 41: 65 43: 62 43: 62 44: 62 44: 65 46: 62 47: 62 47: 65 48: 35 48: 74 49: 74 There are 8 hits on base # 62 There are 8 hits on base # 65 There are 3 hits on base # 14 There is m 3 hits on base # 74 80

There is 1 hit on base # 26 There is 1 hit on base # 35 Gcgg 11 8: 91 9:16 10:16 11:16 37:67 40:67 42:67 43: 67 45: 67 46: 67 There are 7 hits on the base # 67

Name Recognition RE #locals GLGid #: base # GLGid #: base # GLGid #: base #

There are 3 nits in base # 16 There is 1 hit in base # 91 BsiHKAI GWGCWc 2: 30 4: 30 6: 30 12: 89 13: 89 14: 89 40: 51 41: 51 42: 51 46: 51 47: 51 There are 11 hits on base # 51 Bspl2861 GDGCHc 2: 30 4: 30 6: 30 12: 89 13: 89 40: 51 41: 51 42: 51 46: 51 47: 51 There are 11 hits on base # 51 HgiAI GWGCWc There are 11 hits on base # 51 BsoFI GCngc 2:53 3:53 5:53 PM 4:59 p.m. There are 13 hits on base # 53 There are 10 hits on base # 53 There are 10 hits on base # 53 There are 10 hits on base # 53 There are 10 hits on base # 6 4 20 7: 30 9:30 30: 30 10: 30 37 51 38 51 39: 51 43 51 44 51 45: 51 20 7: 30 9:30 30: 30 37 51 38 51 39: 51 43 51 44 51 45: 51 20 7: 30 9: 30 9:30 30: 30 37 51 38 51 39: 51 43 51 44 51 45: 51 26: 53: 53 8:53 11: 53 31: 53 36: 36 41: 64 42: 64 43 : 64 47: 6 4 48: 53 49: 53 81

Tsel Gcwgc 17 2: 53 3:53 5: 53 6: 53 7: 53 8: 53 9: 53 10: 53 11: 53 31: 53 36: 36 45: 6 4 46: 64 48: 53 49: 53 50 : 51 51: 53 There are 13 hits on base # 53 Mnll gagg 34 3: 67 3: 95 4:16 5: 16 5: 67 6: 67 Name recognition RE #locals GLGid #: base # GLGid #: base # GLGid #: base #. . 7:67 p.ru:67 10:37 10:37 10:37 10:37 4:37 4:37 7:67:19 p: 67 28: 67 29: 67 30: 67 32: 67 32: 67 33: 67 34: 67 35: 67 36: 67 50: 67 51: 67 There are 31 hits on base # 67 HpyCH4V TGca 34 5: 90 6: 90 11: 90 12: 90 12:50 21:44 23:44 23:44 19:44 19:44 21:44 0: 44 27: 44 28: 44 28: 44 28: 44 29: 44 34: 44 34: 44 35: 90 35: 90 36: 38 48: 44 50: 44 50: 44 51: 44 51: 52 51: 52 base # 44 There is 1 hit on base # 52 Accl GTmkac 13 base recognition 5 7:37 11:24 37:16 38:16 39:16 40:16 41:16 42:16 43:16 44:16 45:16 4 6:16 47: 16 There are 11 hits on base # 16 SacII CCGCgg 8 base recognition 6 9:14 10:14 11:37 37:65 39:65 40: 65 42: 65 43: 65 There are 5 hits on the base # 65 There are 3 hits on base # 14 82

There are 20 hits on base # 2 BsmAI Nnnnnngagac 15: 2 16: 2 20: 2 21: 2 27: 2 28: 2 32: 2 33: 2 33: 16: 11 24: 11 25: 11 26: 11 RE Name Recognition GLGid #: base # GLGid #: base # 30: 11 31: 11 32: 11 48: 87 There are 16 hits on base # 11 Bpml ctccag 15: 12-12: 12 12:12 p.m. 12: 12-12: 12 12:12 p.m.

There are 19 hits on base # 12 24 17: 2 18: 2 19: 2 23: 2 24: 2 25: 2 29: 2 30: 2 31: 2 34: 22 35: 2 36: 2 19 21: 11 22: 11 23: 11 27: 11 28: 11 28: 56 #local GLGid #: base # ..... 35: 11 36: 11 44: 87 19 18: 12 20: 12 21: 12 25: 12 26: 12 27: 12 32: 12 34: 12 35: 12

Xmnl GAANNnnttc 37: 30 38: 30 39 43: 30 44: 30 45 There are 12 hits on base # 30 12 30 40: 30 41: 30 42: 30 30 4 6:30 30 47:30 30:30

Bsrl NCcagt 37: 32 38: 32 39 43: 32 44: 32 45 There are 12 hits on base # 32 12 32 40: 32 41: 32 42: 32 32 4 6:32 47: 32 50: 32

There are 11 hits on base # 51 Ecl13 61 GAGctc 37: 51 38: 51 39 43: 51 44: 51 45 There are 11 hits on base # 51 11 51 40 : 51: 51: 51: 51: 51: 51: 51: 51: 51: 51: 51: 51: 51 51: 51 51: 51 51: 51 51: 51

Saci GAGCTc 11 37: 51 38: 51 40: 51 41: 51 42: 51 43: 51 44: 51 45: 51 4: 51 51: 51 There are 11 hits on base # 51 84

Table 3: Synthetic FR3 3-23 of human heavy chains showing positions of Possible cleavage sites! The sites built on the synthetic gene are shown in the DNA, in uppercase letter,! with the name RE between vertical bars (as in Xbal). ! The RERS often found in GLG are shown below the synthetic sequence! with the name on the right (as in gtn ac = MaeIII (24), indicating that 24 of the 51 GLG contain the location). in synthetic 3-23)! Allowed DNA ii Hinfl (38) i Piei (18) i Tfil (20) i MaelII (24) i Tsp4 SI (21) i Hphl (44) I --- FR3 --- 89 90 (codon RF # cgc | ttc | 6 | cgn | tty | agr | ga ntc = ga gtc = ga wtc 'ac = gts ac = tc acc = -------- FR3 ------------- --------------------------------------- 91 92 93 94 95 96 97 98 99 100 101 102 103 104 TISRDNSKNTLY LQ | act | ate | TCT | AGA | gac | aac | tet | aag | aat | act | ctc | tac | ttg | cag | atg | permitted | acn | ath | ten | cgn | gay | aay | ten (a) | aay | acn | ttr | tay | ttr | car | atg | agy | ag | agy | etn | ctn | ga | gac = BsmAI (16) ag ct

105 M

Alui (23) 85 51

I c | tcc ag = Bpl (19) g ctn age =

BlpI (21) g aan nnn ttc = Xmnl (12) | Xbal tg ca = HpyCH4V (21) -------- FR3 --------------------------------- ------------------------ 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 nslra edtavyyca k Iaac | agC | TTA | AGe | gct | gag | gac | aCT | GCA | Gtc | tac | tat | tgc | gct | aaa | 96 allowed | aay | ten | ttr | cgn | gen | gar | gay | acn | gen | gtn | tay | tay | tgy | gene | aar | | agyIctnIagrI | | aga Rga I cc nng g = Bs aJi (23) ac ngt tet = BglII (10) 1 ac ngt tcY = BstYI (11) l ac ngt c ayn nnn rtc = Msll (44) cg ryc g = BsiEI (23) y gee r = Eael (23) cg gee g = EagI (23) | gee = HaelII (25) Bst4Cl (51) HpyCH4III (51) Taal (51) gag g = Mnll (31) | | PstI |

Af III 86

Table 4: REdaptors, Extenders and Bridges used for Cleavage and Capture of Human Heavy Chains in FR3. A: HpyCH4V Probes of HC real human genes! HpyCH4V in FR3 of human HC, bases 35-56; only those with a TGca Tc site; 10, a recognition of length 4 is expected in 10 1 6-1 agttctccctgcagctgaactc 2 3-11.3-07,3-21,3-72,3-48 cactgtatctgcaaatgaacag 3 3-09, 3-43.3-20 ccctgtatctgcaaatgaacag 4 5-51 ccgcctacctgcagtggagcag 5 3 -15.3-30.3-30.5,3-30.3,3-74,3-23,3-33 cgctgtatctgcaaatgaacag 6 7-4.1 cggcatatctgcagatctgcag 7 3 -73 cggcgtatctgcaaatgaacag 8 5-a ctgcctacctgcagtggagcag 9 3-49 tcgcctatctgcaaatgaacag B; HpyCH4v REdaptors, Extenders and Fonts B.1 REdaptor! HC lower chain cut:! TmKeller for 100 mM NaCl, zero formamide! REdapters for cleavage T w Jm τ K Jm (ON_HCFR36-1) 5'-agttctcccTGCAgctgaactc-3 '68.0 6 4.5 (ON_HCFR3 6-1A) 5'-TTCTCCCtgcaGCTGAACTC-3' 62.0 62.5 (0N_HCFR36-1B) 5'-ttctcccTGCAgctgaac-3 '56.0 59.9 (ON_HCFR33-15B) 5'-cactgtacTGCAaatgaacag-3' 62.0 58.9 (ON_HCFR35-51) 5'-cactgtacTGCAaatgaacag-3 '64.0 60.8 (ON_HCFR3 3-15A 5'-ctgtatcTGCAaatgaacag-3' 56.0 56.3 I 5'-ccgcctaccTGCAgtggagcag-3 '74.0 70.1 B.2 Synthetic 3-23 gene segment in which the captured CDR3 is to be cloned 1 Xbal ...

D323 * cgCttcacTaag tcT aga gac aaC tcT aag aaT acT ctC taC scab ... ... gene 3-23 designed ................ 87

HpyCH4V .. .. AflII ...

Ttg caG atg aac aqc TtA aqG ... B.3 Extender and Bridges! Extender (backbone): i (ON_HCHpyEx01) 5'-cAAgTAgAgAgTATTcTTAqAgTTgTcTcTAqAcTTAgTgAAgcg-3 '! ON_HCHpyExO1 is the reverse of! 5'-cgCttcacTaag tcT aga gac aaC aag aaT acT ctC taC Ttg-3 '! Bridges (top chain, overlapping base): (ON_HCHpyBr016-1) 5'-cgCttcacTaag tcT aga gac aaC tcT aag-aaT acT ctC taC Ttg CAgctgaac-3 'term C 3' is blocked! 3-15 et al. + 3-11 (ON_HCHpyBr023-15) 5'-chCttcacTaag tcT aga gac aac tcT aTaTaT acT ctC taC Ttg CAaatgaac-3 'term C 3' is blocked! 5-51 (ON_HCHpyBr045-51) 5'-cgCttcacTaag tcT aga gac aaC tcT aag- aaT acT ctC taC Ttg CAgtggagc-3 'term C 3' is blocked! PCR Primer (ON_HCHpyPCR) 5'-chCttcacTaag tcT aga gac-3 'C: BlpI Human GLG probes HC 1-58, 1-03, 1-08, 1-69, 1-24, 1-45, 1-46, 1-f, 1-e acatggaGCTGAGCaggctgag 2 1-02 acatggaGCTGAGCaggctgag 3 1-18 acatggagctgaggagcctgag 4 5-51,5-a acctgcagtggagcagcctgaa 5 3-15,3-73, 3-49,3- 72 atctgcaaatgaacagcctgaa 3303.3-33.3-07,3-11,3-30,3-21,3-23,3305,3-48 6 atctgcaaatgaacagcctgag 7 atctgcaaatgaacagtctgag 8 atctgcagatctgcagcctaaa 9 atcttcaaatgaacagcctgag 10 atcttcaaatgggcagcctgag 11 4301,4-28, 4302.4-04,4304,4-31,4-ccctgaaGCTGAGCtctgtgac 12 ccctgcagctgaactctgtgac 13 tccttacaatgaccaacatgga 14 tccttaccatgaccaacatgga D: BlpI REdaptors, Extender and Bridges D.1 REdaptors

(BlpF3HCl-58) 5'-ac atg gaG CTG AGC (BlpF3HC6-1) 5'-cc ctg aag ctg age! BlpF3HC6-1 combinations 4-30.1, not 6-: D.2 Synthetic 3-23 gene segment 3-20,3-74,3-09,3-43 74. 1 3-66.3-13.3-53.3-d 3-64 1, 4-3-4,49,4,5,5,6,7,6-Trifluoromethyl-4- 05 2-26 TW > p K age et gag-3 '70 66. 4 tet gtg ac-3' 70 66. 4 in which is to clone the captured CDR3 |

BlpI

Xbal ... i! D323 * cgCttcacTaag TCT AGA gac aaC tcT aag aaT acT ctC taC Ttg caG atg aac i! AflII ...

! agC TTA AGG D.3 Extender and Bridges! (BlpF3Brl) 5'-cgCttcacTcag tcT agA gaT aaC AGT aaA aaT acT TtG-taC Ttg caG Ctg a | GC age ctg-3 '(BlpF3Br2) 5'-cgCttcacTcag teT aga gaT aaC AGT aaA aaT TtG-taC Ttg caG Ctg a | gc tet gtg-3 '| the bottom chain is cut here! Extent (BlpF3Ext) 5'-TcAqcTgcAAqTAcAAAqTATTTTTAcTgTTATcTcTAgA cTqAqTqAAqcq-3 'BlpF3Ext is the reverse complement of: 5'-cgCttcacTcag tcT aga gaT aaC AGT aaA aaT TtG taC Ttg caG Ctg a-3' (BlpF3PCR) 5'-cgCttcacTcag tet agA gaT aaC -3 'E: HpyCH4lII surrounding site of distinct GLG sequences, bases 77-9: 102: 1.118 # 4,146 # 7,169 # 9, le # 10,311 # 17,353 # 30,404 # 37,4301 ccgtgtattactgtgcgagaga 2 103 # 2,307 # # 21.3303 # 24.333 # 26.348 # 28.364 # 31.366 # 32 ctgtgtattactgtgcgagaga ccgtgttattactgtgcgagagg ccgtgtattactgtgcaacaga 4 5 6 ccatgtattactgtgcaagata ccgtgtattactgtgcggcaga ccacatattactgtgcacacag 7 8 9 ccacatattactgtgcacggat ccacgtattactgtgcacggat 10 ccttgtattactgtgcaaaaga ctgtgtattactgtgcaagaga 11 12 13 ccgtgtattactgtaccacaga ccttgtatcactgtgcgagaga ccgtatattactgtgcgaaaga 14 15 108 # 3 124 # 5, # LF ll 1 45 # 6 158 # 8 205 # 12 226 # 13 2 70 # 14 309 # 16,343 # 27 313 # 18,374 # 35,61 # 50 315 # 19 320 # 20 323 # 22 330 # 23,3305 # 25 90 349 # 29 372 # 33 3 73 # 3 4 3d # 3 6 428 # 38 4302 # 40,4304 # 41 439 # 44 5 51 # 4 8 5a # 49 rn K 78 901 235 567 897 123 456 7 rp W Jm (H43.77.97.1-02 # 1) 5'-cc gtg tat tAC TGT gcg aga g-3 '6462.6 (H43.77.97.l-03 # 2) 5'-gtg TAC TGT gcg aga g-3 '6260.6 (H43.77.97.108 # 3) 5'-cg gtg tat tAC TGT gcg aga g-3' 6462.6 (H43.77.97.323 # 22) 5'-cg tattat tgt gcg aaa g-3 '6058.7 (H43.77.97.330 # 23) 5'-gtg tat tac tgt gcg aaa g-3' 6058.7 (H43.77.97.439 # 44) 5'-gtg tat tac tgt gcg (c-3 '), 6260.6 (H43.77.97.551 # 48) 5'-c at tato c tgt gcg aga c-3' 6260.6 (H43.77.97.5a # 49) 5'-c atgat tAC TGT gcg aga c -3 '5858.3 ctgtgtattactgtgcgaaaga ccgtgtattactgtactagaga 16 17 18 ccgtgtattactgtgctagaga ccgtgtattactgtactagaca ctgtgtattactgtaagaaaga 19 20 21 ccgtgtattactgtgcgagaaa ccgtgtattactgtgccagaga ctgtgtattactgtgcgagaca 22 23 24 ccatgtattactgtgcgagaca ccatgtattactgtgcgaga F: HpyCH4III REdaptors, extenders and Bridges F.1 REdaptors! ON for cleavage of HC (lower) in FR3 (bases 77-97)! For cleavage with HpyCH4III, Bst4Cl, or Taal! The cleavage is in the lower chain before base 88.! 77 788 888 888 889 999 999 9 F.2 Extender and Bridges! Xbal and AflII sites on bridges are capped (H43.XABrl) 5'-ggtgtagtga- ITCTIAGtIgacIaacItctIaagIaatIact | ctc | tac | ttg | cag | atg 91 | aac | aqC | TTtIAGq | qct | qaq | qac [aCT | GCA | Gtc | tac | tgt gcg aga-3 '(H43.XABr2) 5' -ggtgtagtga- ITCT | AGt | gac | aac | tct | aag | aat | act | ctc | tac | ttg | cag | atg | -Iaac | aqC | TTt (H43.XAExt) 5'-ATAgTAgAcT gcAgTgTccT cAgcccTTAA gcTgTTcATc (H43.XAExt) 5'-ATAgTAgAcT gcAgTgTccT tgt gcg aaa-3 '

TgcAAgTAgA gAgTATTcTT AgAgTTgTcT cTAgATcAct AcAcc-3 '! H43.XAExt is the reverse complement of! 5 '-ggtgtagtga-! | TCT | AGA | gac | aac | tct | aag | aat | act | ctc | tac | ttg | cag | atg | -! aac | ag | TTA | AGg | gct | gag | gacIaCT | GCA | Gtc | tac-tat -3 '(H43.XAPCR) 5'-taggtagtga | TCT | AGA | gac | aac-3'! Xbal and AflII sites on bridges are capped (H43.Abrl) 5 '-ggtgtagtga- | aac | agC | TTA | AGg | gct | gag | gac | aCT | GCA | Gtc | tac | tat tgt gcg aga-3' (H43 (H43.XAExt) 5'-ATAgTAgAcTgcAgTgTccTcAgcccTTTAAgcTgTTTcAcTAcAcc-3 '(H43.XAExt) 5'-ATAgTAgAcTgcAgTgTccTcAgcccTTTAAgcTgTTTcAcTAcAcc-3' 5'-ATAgTAgAcTgcAgTgTccTcAgcccTTTAAgcTgTTTcAcTAcAcc-3 ' ! (H43.XAExt) is the reverse complement of 5'-ggtgtagtga-! aAC | agA | AGq | gct | qaq | gac | aCT | GCA | Gtc | tac | tat -3 '(H43.APCR) 5'-ggtgtagtga | aac | aqC | TTA | AGg | qct | g-3 92

Table 5: Analysis of the frequency of combining REdaptors in real V genes A: HpyCH4V in HC in bases 35-56 ε 6 Incorrect pairing number .. .............. .... Number t 0 1 2 3 4 5 6 7 8 9 K 1 Cut Id Probe 1 510 5 11 274 9 6 2 2 1 1 3 5 443 6-1 agttctcccTGCAgctgaact 2 1 5 2 1 c 2 192 54 42 32 2 1 2 3 1 3 1 6 167 3-11 cactgtatcTGCAaatgaaca 4 5 0 g 3 58 19 7 17 6 5 1 0 1 0 2 0 54 3-09 ccctgtatcTGCAaatgaacag 4 267 42 33 9 8 8 8 4 2 8 1 1 100 5-51 ccgcct accTGCAgt ggagc 2 3 2 1 ag 5 250 111 59 41 2 7 5 1 0 0 2 0 242 3-15 cgctgtatcTGCAaatgaaca 4 g 6 7 0 2 0 1 0 0 0 0 0 4 0 3 7-4.1 cggcatatcTGCAgatctgcag 7 7 0 2 2 0 0 2 1 0 0 0 0 4 3-73 cggcgtatcTGCAaatgaacag 8 26 10 4 1 3 1 2 1 3 1 0 0 19 5-a ctgcctaccTGCAgtggagcag 9 21 8 2 3 1 6 1 0 0 0 0 0 20 3-49 tcgcctatcTGCAaatgaacag 133 249 162 379 1 1 1 7 4 1 2 12 1052 8 4 0 2 1 7 3 3 9 3 0 249 411 790 9 1 1 1 3 1 2 3 2 0 6 1 1 1 1338 0 2 2 4 3 9 2 3 3

Dotted

Probe

Id probe probe 6- 1 agttctcccTGCAgctgaactc agttctcccTGCAgctgaactc 3-11 cactgtatcTGCAaatgaacag cac.g.at ..... aa ..... ag 3-09 ccctgtatcTGCAaatgaacag ccc.g.at ..... aa ..... ag 5-51 ccgcctaccTGCAgtggagcag ccgc., A ....... tg .. g. ag 3-15 cgctgtatcTGCAaatgaacag c.c.g.at ..... aa ..... ag 7- 4.1 cggcatatcTGCAgatctgcag c. gca. at ...... a. ctg. ag 3-73 cggcgtatcTGCAaatgaacag c.gcg.at ..... aa ..... ag 5-a ctgcctaccTGCAgtggagcag ctgc .. a ....... tg .. g. ag 3-4 9 tcgcctatcTGCAaatgaacag tcgc .. at ..... aa ..... ag

Seqs only with the expected RE location ....... 1004 ^ (count only cases with 4 or fewer mismatches)

Seqs only with an unexpected location ......... 0

Seqs with expected and unexpected .... 48 (count only cases with 4 or fewer mismatches) Seqs without locations ........................ 0

B: Blpl in HC

Id Ntot 0 1 2 3 4 5 6 7 8 N cut! Name 1 133 73 16 11 13 6 9 1 4 0 119 1-58 acatggaGCTGAGCagcctgag 2 14 11 1 0 0 0 0 1 0 1 12 1-02 acatggagctgagcaggctgag 3 34 17 8 2 6 1 0 0 0 0 0 1-18 acatggagctgaggagcctgag 4 120 50 32 16 10 9 1 1 1 0 2 5-51 acctgcagtggagcagcctgaa 5 55 13 11 10 17 3 1 0 0 0 0 3-15 atctgcaaatgaacagcctgaa 6 340 186 88 41 15 6 3 0 1 0 0 3303 atctgcaaatgaacagcctgag 7 82 25 16 25 12 1 3 0 0 0 0 3-20 atctgcaaatgaacagtctgag 8 3 0 2 0 1 0 0 0 0 0 9 23 18 2 2 1 0 0 0 0 10 2 1 0 1 0 0 0 0 0 11 486 249 78 81 38 21 10 4 4 1 12 16 6 3 1 0 1 1 3 1 0 13 28 15 8 2 2 1 0 0 0 0 14 2 0 2 0 0 0 0 0 0 0 Ο 74.1 atctgcagatctgcagcctaaa Ο 3-66 atcttcaaatgaacagcctgag Ο 3-64 atcttcaaatgggcagcctgag 467 4301 ccctgaagctgagctctgtgac 1 6-1 ccctgcagctgaactctgtgac 0 2-70 tccttacaatgaccaacatgga 0 2-26 tccttaccatgaccaacatgga

Name Full sequence Point mode 1-58 acatggaGCTGAGCagcc acatggaGCTGAGCagcctgag tgag 1-02 acatggagctgagcaggctga ................ g ..... g 1- 18 acatggagctgaggagcctga ....... ...... g ........ 01 g 5- 51 acctgcagtggagcagcctga, .c..c..tg ........... aa 3-15 atctgcaaatgaacagcctgaa. tc .. c. aa ... to ........ a 3-30.3 atctgcaaatgaacagcctgag .tc..c.aa ... a ......... 3-20 atctgcaaatgaacagtctgag .tc..c.aa. ..a .., t ..... 7-4.1 atctgcagatctgcagcctaaa .tc..c..a.ct ....... aa 3-66 atcttcaaatgaacagcctgag .tc.tc.aa ... a .. ....... 3- 64 atcttcaaatgggcagcctgag .tc.tc.aa..g .......... 4- 30.1 ccctgaagctgagctctgtgac cc.a ........ tctg ... c 6- 1 ccctgcagctgaactctgtgac cc.c ...... a.tctg ... c 2- 70 tccttacaatgaccaacatgga tctacaa ... c..aa.ga 2-2 6 tccttaccatgaccaacatgga tctacca ... c..aa. ga

Seqs only with the expected RE location ....... 597 (counting sequences with 4 or fewer mismatches)

Seqs only with an unexpected location ......... 2

Seqs with expected and unexpected .... 2

Seqs without locations ........................ 686

C: HpyCH4III, Bst4 Cl or Taal in HC

When classifying if the RE site of interest is present, only ONs with 4 or fewer mismatches are counted Number of sequences .......... 1617 9 6

Nt Id t 1 244 2 457 3 173 NCU 0 1 2 3 4 5 6 7 8 t 78 92 43 1 1 1 2 0 0 2 8 0 4 1 69 150 115 6 3 1 8 3 1 4 6 4 1 3 52 45 36 2 1 3 0 0 1 1 2 4 6 9 acngt acngt 102 | 1 ccgtgtattACTGTgcgaga ccgtgtattactgtgcgagaga, 1 ga 103f2 ctgtgtattactgtgcgagaga .t ...................., 3 108f3 ccgtgtattactgtgcgagagg ..................... g 4 16 5 4 6 15 7 23 8 9 0 3 2 2 1 6 0 1 1 8 124 # 5 ccgtgtattactgtgcaacaga .... ............ ac .., 1 00101101 10106411 48522110 11103210 2 145f6 ccatgtattactgtgcaagata 8 15818 ccgtgtattactgtgcggcaga 2 205fl ccacatattactgtgcacacag 1 2 6 226 # 1 ccacatattactgtgcacggat ..a .......... ... to ... t. ................. gc ..., .aca ........... acacag ..aca ac.gat 3 3 1311001 7355210 6 270fl ccacgtattactgtgcacggat. .ac ............ ac.gat 4 2 309fl ccttgtattactgtgcaaaaga ..t ............. aa ,. 2 6, 5 10 7 6 3 3 0 1 0 3 313fl ctgtgtattactgtgcaagaga .t .............. a ... 1 8, 2 3 2 2 6 1 0 2 0 1 315fl ccgtgtattactgtaccacaga acc 5 9 1 2 0 0 0 0 0 0 0 3 320 # 2 ccttgtatcactgtgcgagaga ..t ..... c ........... 0 29 23 28 2 8 4 2 1 0 1 323 # 2 ccgtatattactgtgcgaaaga .... a ............. a. 1 2 21 25 13 9 1 4 2 0 0 6 330 # 2 ctgtgtattactgtgcgaaaga .t ................ a. 9 3, 2223031 0010010 9 349f2 ccgtgtattactgtactagaga 9 1 372f3 ccgtgtattactgtgctagaga ..... at .... ....... t ..... 3 0 0 1 0 0 0 0 0 0 1 37313 ccgtgtattactgtactagaca .. ............ at..c. 4 0 0 0 0 0 0 0 0 2 0 3df36 ctgtgtattactgtaagaaaga 4 9 9 4 5 3 0 0 0 3 428f3 ccgtgtattactgtgcgagaaa 1 8 5 4 2 2 3 1 0 0 0 1 4302 # ccgtgtattactgtgccagaga 6 40 15 17 24 7 1 1 1 0 0 7 439 # 4 ctgtgtattactgtgcgagaca 3 4 23 40 14 15 4 5 1 0 1 0 0 3 551 # 4 ccatgtattactgtgcgagaca ..a ................. c. 9 8

24 213 26 56 60 4 2 7 2 0 0 2 5a # 49 ccatgtattactgtgcgagaA ..a ................. AA

2 0 0 A 4

Group 337 471 363 218 130 58 23 11 6

Cumula 337 808 117 1389 1519 1577 1600 1611 1617 tivo

Seqs only with the expected RE location ..... 1 5 1 1 8 6

Seqs only with an unexpected location ..... 0

Seqs with expected and unexpected .... 8

Seqs without locations ......................... 0

Table 5D:

Repeated analysis using only 8 REdaptors best 6 6

Id Ntot 0 1 2 3 4 5 6 7 8+ 1 301 18 101 54 32 16 9 10 1 0 281 10211 ccgtgtattactgtgcgagaga 2 493 69 155 125 73 37 14 11 3 6 459 10312 ctgtgtattactgtgcgagaga 3 189 52 45 38 23 18 5 4 1 3 176 10813 ccgtgtattactgtgcgagagg 4 127 29 23 28 24 10 6 5 2 0 114 323122 ccgtatattactgtgcgaaaga 5 78 21 25 14 11 1 4 2 0 0 72 330123 ^ ctgtgtattactgtgcgaaaga 6 79 15 17 25 8 11 ^ 439f44 ctgtgtattactgtgcgagaca 7 43 14 15 5 5 3 0 1 0 0 42 551148 ccatgtattactgtgcgagaca 8 307 26 63 72 51 38 24 14 13 6 250 5a # 49

ccatgtattactgtgcgaga 1 102J1 ccgtgtattactgtgcgagaga ccgtgtattactgtgcgagaga 2 10312 ctgtgtattactgtgcgagaga .t .................... 3 10813 ccgtgtattactgtgcgagagg ................. ... g 4 323122 ccgtatattactgtgcgaaaga .... a ............. a ... 5 330123 ctgtgtattactgtgcgaaaga .t ............... .a ... 6 439144 ctgtgtattactgtgcgagaca .t .................. c. 7 551148 ccatgtattactgtgcgagaca ..a ................. c. 8 5af49 ccatgtattactgtgcgagaAA ..a ................. AA ο ο τ

Seqs only with the expected RE location ....... 1463/161?

Seqs only with an unexpected location ....... 0

Seqs with expected and unexpected .............. 7

Seqs without locations ...................... 0

Table 6: FR1 GLG HC Human Sequences

VH-exon-nucleotide sequence alignment VH1

1-02 CG GTG CG CTG GTG CGG TCT GGG GCT GGG GTG AAG AAG CCT GGG GCC TCA AAG GTC TCC TGC AAG GCT TCT GGA TAC ACC TTC ACC

1-03 cag gtC cag ctT gtg cag tct ggg gct gag gtg aag aag cct ggg gcc tca gtg aag gtT tcc tgc aag gct tct gga tac acc ttc acT 1-08 cag gtg cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg gcc tca gtg aag gtc tcc tgc aag gct tct gga tac acc ttc acc 1-18 cag gtT cag ctg gtg cag tct ggA gct gag gtg aag aag cct ggg gcc tca gtg aag gtc tcc tgc aag gct tct ggt tac acc ttT acc

1-24 cag gtC cag ctg gta cag tct ggg gct gag aag aag cct ggg gcc tca gtg aag gtc tcc tgc aag gTt tcC gga tac acc Ctc acT τ ο τ 1-45 cag Atg cag gtg cg tct ggg gct gag gtg aag aag Act ggg Tcc tca gtg aag gct tcC gga tac acc ttc acc 1-46 cag gtg cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg gcc tca gtg aag gtT tcc tgc aag gcA tct gga tac acc ttc acc

1-58 ccA Atg cg gtg cg tg ggg Cct gag gtg aag aag cct ggg Acc tca gtg aag gtc tcc tgc aag gct tct gga tTc acc ttT acT 1-69 cag gtg cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg Tcc tcG gtg aag gtc tcc tgc aag gct tct gg GGc acc ttc aGc 1-e cg gtg cag gtg cg tct ggg gct gag gtg aag aag cct ggg Tcc tcG gtg aag gtc tccc ag gct tct gga GGc acc ttc aGc 1 - GG gtC cag ctg gtA cg tct ggg gct gag gtg aag aag cct ggg gcT Aca gtg aaA Ate tcc tgc aag gTt tct gga tac acc ttc acc VH2

2-5 GAG ATC ACC TTG AAG GAG TCT GGT CCT ACG CTG GTG AAA CCC ACA CAG ACC CTC ACG CTG ACC TGC ACC TTC TCT

TTC TCA CTC AGC 2-26 CAG Gtc acc ttg aag gag tct ggt cct GTg ctg gtg aaa ccc aca Gag acc ctc acg ctg acc tgc acc Gtc tct ggg ttc tca ctc age 2-70 cag Gtc acc ttg aag gag tct ggt cct Gcg ctg aaa ccc aca cag acc ctc acA ctg acc tgc acc ttc tct ggg ttc tca ctc age 201 3-07 GAG GTG CAG CTG GTG GG TCT GGG GGA GGC TTG GTC CAG CCT GGG GGG TCC CTG AGA CTC TCC TGT GCA GCC TCT GGA TTC ACC TTT AGT 3-09 gaA gtg cg gt g gt g gt g gt g gt gg gt gg gg gt gg gg gg gg gg gg gg gg gg gg gg ggg gtc Ag cct ggA ggg tcc ctg aga ctc tcc tgt gea gee tct gga ttc acc ttc agt 3-13 gag gtg cag gtg gag tct ggg gga ggc ttg gtA cag cct ggg ggg tcc ctg aga ctc tcc tgt gea gee tct gga ttc acc ttc agt 3-15 gag gtg cag ctg gtg gag tct ggg gga ggc ttg gtA Aag cct ggg ggg tcc ctT aga ctc tcc tgt gea gee tct gga ttc acT ttc agt 3-20 g g g g g g g g g g g g g g g g g g g g g g g g g g gg g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g t ggg tcc ctg aga ctc tcc tgt gea gee tct gga ttc acc ttc agt 3-23 gag gtg cag ctg tgtc tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg 3-30 C g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g + a g h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h cct ggg Agg tcc ctg aga ctc tcc tgt gea gee tct gga ttc acc ttc agt

Gtg gtc cg cg gg Agg tcc ctg aga crc tcc tgt gea gee tct 3-30.5 Cg gtg cg gtg gtg gt tg gt tg ttc acc ttC agt 3-33 Cg gtg cg gtg gtg tct ggg gg gc gtg gtc gg cg gg tgg Agg tcc ctg aga ctc tcc tgt gca gcG tct gga ttc acc ttC agt 3-43 gaA gtg cag gtg gtg gtg gg gtg gtg gtg gtg gtg gtg gtg gtg gtg gtg gtg gtg gtg gtg tt gt tg gt gt ttc acc ttt Gt 3-48 gag gtg ctg gtg gtg gtg ggg gtc ttg gtA cg cct ggg ggg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttC agt 3-49 gag gtg cg gtg gtg tg ggg ggg ggc ttg gtA cag ccA ggg Cgg tcc ctg aga ctc tcc tgt Aca gcT tct gga ttc acc ttt Ggt 3-53 gag gtg cag gtg gag Act ggAgga ggc ttg Ate cag cct ggg ggg tcc ctg aga ctc tcc tgt gca gcc tct ggG ttc acc GtC agt 3-64 gag gtg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cc cg cc cg cc cg cc cg cc cg cc cg cc cg ccg cg ccg cg ccg ccg ccg ccg ccg ccg ccg ccg ccg ccg ccg ccg ccg ccg cg ccg ccg ccg ccg ccg ccg ccg ccg ccg cg ccg ccg ccg ccg ccg ccg ccg cg ccg ccgg tcc tgt gca gcc tct gga ttc acc GtC agt 10 3 3-92 gag gtg ctg gtg gtg gtg gtg gtc ttg gtc cg ctg gtc gtc tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc agt 3-93 gag gtg cag gtg gtg gtc tg ggg ggc ttg gtc cg cg ggg ggg tcc ctg aAa ctc tcc tgt gca gcc tct ggG ttc acc ttC agt 3-94 gag gtg cag gtg gtg gt gt gt gt gt cg gt cg cg gg gcc tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc agt 3- d gag gtg cag ctg gtg gag tct Cgg gga gTc ttg gtA cag cct ggg ggg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc GtC agt VH4

4-4 CAG GTG CAG CTG CAG GAG TCG GGC CCA CTG GTG AAG CCT TCG GGG ACC CTG TCC CTC ACC TGC GCT GTC TCT GGT

GGT GGC TCC ATC AGC VH4 4-28 cag gtg cg cg gag ggc ggc cca gg cg gtg aag cct teg gc acc ctg tcc ctc acc tgc gct gtc tct ggt TAc tcc until age ggc cca gga ctg gtg aag cct teA cag acc ctg tcc ctc acc tgc Act gtc tct 4-30.1 cag gtg cag cg gag gag ggt ggc tcc ate age 4-30.2 cag Cg cg cg gag tcC ggc Tg gg cg gtg aag cct tcA CAg acc ctg tcc ctc acc tgc gct gtc tct ggt gcc tcc ate age 4-30.4 cag gtg cag gag teg ggc cca gga ctg gtg aag cct teA CAg acc ctg tcc ctc acc tgc Act gtc tct ggt ggc tcc ate age 4-31 cag gtg cag cg gag gag teg ggc cca gga ctg gtg aag cct tg tgt tcc tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt t tt tt Ttc agi 4-39 cg Cg cg cg gag cg ggc cca gg cg gtg aag cct teg gg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg gg cg cg gg cg cg aag cct teg gAg acc ctg tcc ctc acc tgc Act gtc tc tgg tgt tgt tgt tgt tgt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt tt teg ggc cca gga ctg gtg aag cct teg gAg acc ctg tcc ctc acc tgc gct gtc tct ggt TAc tcc ate age VH5

5- 51 GAG GTG CAG CTG GTG CAG TCT GGA GCA GAG GTG AAA AAG CCC GGG GAG TCT CTG AAG ATC TCC TGT AAG GGT TCT

GGA TAC AGC TTT ACC 5- a gaG gg gg gg gg gg geg gg gg aaa aag ccc ggg gag tct ctg aGg tgt tgt aag ggt tct gga tc ttt ttt acc VH6

6- 1 CAG GTA CAG CTG CAG CAG TCA GGT CCA GGA CTG GTG AAG CCC TCG CAG ACC CTC TCA CTC ACC TGT GCC ATC TCC GGG GAC AGT GTC TCT VH7

7- 4.1 CAG GTG CAG CTG GTG CAA TCT GGG TCT GAG TTC AAG AAG CCT GGG GCC TCA GTG AAG GTT TCC TGC AAG GCT TCT

GGA TAC ACC TTC ACT

Table 7: human RERS sites in FRl GLG HC where there are at least 20

GLG cuts

Bsgl GTGCAG 71 (16 cuts / 14 bases to the right) 1: 4 1: 13 2: 13 3: 4 4: 13 6: 13 7: 4 8: 13 9: 4 16: 4 16: 4 16: 4 16: 4 17: 4 18: 4 18: 65 19: 4 20: 4 20: 65 21: 4 21: 65 22: 4 : 656 23: 4: 23: 4: 23: 4: 25: 4: 32: 4 32: 4 33: 4 33: 4 33: 4 33: 4 33: 4 35: 4 36: 4 36: There are 39 hits on base # 4 There are 21 hits on base # 65 _ M _ ctgcac 9 12: 63 13: 63 47: 4 49: 14: 63: 63: 63 41: 63 41: 63 42: 63 44: 63 45: 63 46: 63 Bbvl GCAGC 65 1: 6 3: 6 6: 6 8: 6 9: 6 10: 6 15: 67 16: 6 10:16 7: 6-7: 6-7: 6-7: 6-7: 6-7: : 6 25: 6 25: 6 25: 67 26: 6 26: 67 27: 6 28: 6 28: 67 29: 6 30: 6 31: 67 32: 6 32: 67 33: 6 33: 6 39: 6 35: 6 35: 6 36: 67 37: 6 38: 6 39: 6 40: 6 41: 6 : 6 93: 6 44: 6 45: 6 46: 6 47: 6 98: 6 99: 6 50: 12 51: 6 There are 43 hits on base # 6 Bold locations very close to the lc below There are 21 hits on base # 67 gctgc 13 39: 9 40: 46: 46: 46: 46: 41: 9 47: 9 105 71 (16 cuts / 14 bases on the right)

Bsgl GTGCAG 50: 9

There are 11 hits on base # 9

BsoFI GCnge 78 1: 6 3: 6 6: 6 7: 6 9: 6 10: 6 15: 6 16: 6 16: 67 17: 6 18: 6 19:67 23: 6 23: 6 10:36 6: 67-10: 6 25: 6 25: 6 26: 6 22: : 67 28: 6: 29: 6: 6-30: 6-30: 67: 6: 6-7: 6-7: 39: 9 40: 3 40: 9 41: 6 41: 9 41: 9 42: 6 42: 6 43: 6 38: 6: 44: 9: 46: 9 46: 9 47: 6: 46: 9: 46: 9: 46: 9: 46:

There are 43 hits on base # 6 Often these occur together. There are 11 hits on base # 9

There are 2 hits on base # 3 There are 21 hits on base # 67

Tsel Gcwgc 78 1: 6 3: 6 6: 6 8: 6 9: 6 10: 6 15: 6 16: 6 16: 67 17: 6 18: 6 19:67 23: 6 23: 6 10:36 6: 67-10: 6 25: 6 25: 6 26: 6 22: : 67 28: 6 28: 6 29: 6 30: 67 30: 67 31: 6 31: 67 32: 6 33: 6 33: 67 34: 6 34: 67 35: 6 35: 67 36: 6 39: 9 40: 3 40: 9 41: 6 41: 9 41: 9 42: 6 42: 6 43: 6 38: 6 44: 9 45: 6: 46: 9 46: 9 47: 6 47: 6 48: 6 49: 6 50: 9 50: 12 51: 6

There are 43 hits on base # 6 Often together. There are 11 hits on base # 9 There are 2 hits on base # 3 106

Bsgl GTGCAG 71 (16 cuts / 14 bases on the right)

There is 1 hit on base # 12 There are 21 hits on base # 67

MspAlI CMGckg 48 1: 7 3: 7 4: 7 5: 7 6: 7 7: 7 9: 7 10: 7 11: 7 15: 7 16: 7 17: 7 18: 7 19: 7 20: 7 21: 7 22: 7 23: 7 23: 7 29: 7 25: 7 26: 7 27: 7 28: 7 30: 7 31: 7 32: 7 33: 7 34: 7 35: 7 36: 7 37 : 7 38: 7 40: 1 40: 7 41: 7 42: 7 44: 1 45: 7: 6: 7 47: 7 48: 7 49: 7 50: 7 51: 7 There are 46 hits on base # 7 PvuII CAGctg 48 1: 7 3: 7 5: 7 6: 7 7: 7 8: 7 10: 7 11: 7 15: 7 16: 7 17: 7 18: 7 19: 7 21: 7 21: 7 22: 7 23: 7 23: 7 25: 7 26: 7 27: 7 29: 7 30: 7 31: 7 32: 7 33: 7 34: 7 35: 7: 7: 7: 6: 7: 6: 7: 6: 7 51: 7 There are 46 hits on base # 7 There are 2 hits on base # 1 Alui AGct 54 1: 8 2: 8 3: 8 4: 24 5: 8 6: 8 7: 8 8: 8 9: 8 10: 8 11: 8 15: 8 -16: 8 -7: 8-8: 8: 8 27: 8 29: 8 29: 8 29: 8 30: 8 31: 8 33: 8 34: 8 35: 8 36: 8 37: 8 38: 8 39: 8 40: 2 40: 8 41 : 8 42: 8 42: 8 43: 8 44: 8: 48: 8 46: 8 47: 8 48: 8 49: 8 44: 8 50: 8 51: 8

There are 48 hits on base # 8

There are 2 hits on base # 2 107

Bsgl GTGCAG 71 (16 cuts / 14 bases on the right)

Ddel Ctnag 48 1: 26 1: 48 2: 26 2: 48 3: 26 3: 48 4: 48 5: 26 5: 48 6: 26 6: 48 7: 26 8: 26 8: 48 9: 26 10:26 11: : 52 26: 52 27: 52 28: 52 29: 52 30: 52 31: 52 32: 52 33: 52 35: 52 35: 52 36: 52 40: 24 49: 52 51: 26 51: 48 There are 22 hits on base # 52 52 and 48 never together. There are 9 hits on base # 48 There are 12 hits on base # 26 26 and 24 never together. Hphl tcacc 42 1: 86 3: 86 6: 86 7: 86 8: 80 11: 86 12: 5 13: 5 15: 80 16: 80 17: 80 18:80 20:80 21:80 22: 80 23: 80 25: 80 25: 80 25: 80 26: 80 26: : 59 40: 59 41: 59 41: 59 43: 59 44: 59 45: 59 4: 59 47: 59 50: 59 There are 22 hits on base # 80 80 and 86 never together There are 5 hits on base # 86 There are 12 hits on base # 59 BssKI Nccngg 50 1: 39 2: 39 3: 39 4: 39 7: 39 8: 39 9: 39 10: 39 11: 39 15: 39 16: 39 17: 39 18 : 39: 39: 39: 39: 39: 39: 39 21: 39 21: 39 21: 39: 39: 39 - 34: 39.35: 39.35: 39.35: 39.35: 39.35: 39.35: 38.35: 38.35: 38: 24.35: 39.35: 38.35: 40 50: 24 50: 73 51: 39 There are 35 hits on base # 39 39 and 40 together twice. There are 2 hits on base # 40 BsaJI Cnngg 47 1: 40 2: 40 3 4:40 5: 40 7:40 108

Bsgl GTGCAG 71 (16 cuts / 14 bases on the right) 8:40 9:40 9:47 p.m.:40 10:47 p.m. 11:40 p.m.:40 p.40:40 p.40:40 p.40:40 p.40:40 p.40:40 p.m. 40 24: 40 35: 20 35: 40 36: 40 37: 24 38: 24 39: 24 25: 40 There are 32 hits on base # 40 40 and 41 on a two-way basis. There are 32 hits on base # 40 40 and 41 together twice There are 2 hits on base # 41 There are 9 hits on base # 24 There are 2 hits on base # 47 BstNI CCwgg 44 PspGI ccwgg ScrFI (SM.HpalI CCwgg 1: 40 2: 40 3: 40 4: 40 5:40 7:40 8:40; 10:40; 10:40; 10:40; 10:40; 10:40; 10:40; 11:40; 10:40; 40 27:40 40:40 37:25 38:25 38: 25 39:25 41:25: 25: 40 : 25 46: 25 47: 25 50: 25 51: 40 There are 33 hits on base # 40 ScrFI CCngg 50 1: 40 2:40 2:40 4:40 4:40 5:40 7:40 8:40 9:40 10:40 11:40 15:40 16:40 17:40 18:40 19:40 20: 40 21:40 21:40 21:40 21:40 22:40 22:40 : 40: 40: 40: 40 38: 25 38:25 41:25:42: 25: 25: 46: 25 47:25 46:25: 49: 51: 40 There are 35 hits on base # 40

There are 2 hits on base # 41

EcoO109I RGgnccy 34 109

Bsgl GTGCAG 71 (16 cuts / 14 bases on the right) 1: 43 2: 43 3: 43 4: 43 5: 43: 43 7: 43 9: 43 10: 43 15: 46 16: 46 17: 46 18: 46: 46: 46 21:46: 46: 46 21:46 21:46: 46: 46 | There are 22 hits on base # 46 46 and 43 never together There are 11 hits on base # 43 NlalV GGNncc 71 1: 43 2: 43 3: 43 4: 43 4: 36 46: 46 37: 46 43: 79 51: 43 5: 43 6: 43 7: 43 9: 43 9: 49 10: 43 15: 4 16: 47 16: 47 17: 4 6 17: 47 18: 4 6 18: 47 19: 46 19:47 23:47 25:47 25:47 26:47 26:47 27:46 28:46 28:46 6:47 » : 47 30: 4 6: 47 6: 47: 46: 47: 46: 47: 46: 47 6: 47: 35: 46 35: 46 36: 46 37: 46 37:46 37:37 38:21 38:21 39:21 40: 79 41: 21 41:19 42:21 42: 79 43: 79 44: 21 44: 21 46: 79 47: 21 51: 43

There are 23 hits on There are 17 hits on Sau96I Ggncc base # 47 46 & 47 often on base set # 46 There are 11 hits on base # 43 70 1: 44 2: 44 2: 44 3: 44 4: 44 5: 3 6: 44 7: 44 8: 22 : 44 10: 44 11: 3 12:22 a.m. 22:47 14:22 15:33 15:47 16:47 17:47 18:47 19: 47 20: 47 21: 47 22: 47 23: 33 23: 47 33: 33 33:47 28:47: 47: 33: 47: 33: 47: 33: 47 25: 33 34: 21 37: 21 37: 22 37: 22 37: 22 38:21 38: 22 39:21 39:22 41: 21 41: 22 42: 21 42:22 43: 80 : 22 45: 21 45: 22 46: 22 46: 22 47: 21 47: 22 50: 22 51: 44 There are 23 hits on base # 47 These do not occur together

There are 11 hits on base # 44

There are 14 hits on base # 22 These occur together. There are 9 hits on base # 21

BsmAI GTCTCNnnnn 22 58 9: 58 1: 58 3: 58 4: 58 5: 58 110

There are 11 hits on base # 70 37: 70 38: 70 39: 70 44: 70 40: 70 41: 70 41: 70 47: 70 48: 48 49: 70 46: 70 50: 85 71 (16 cuts / 14 bases on the right)

Nnnnnngagac 13:40 21:48 28:48 28:48 28:48 28:48 33:48 33:48 35:48 45:40 46:40 there are 20 hits in the base # 48 27: 48: 48: 48: 48: 48: 48: 48: 48: 48: 48: 48: 48: 48: 48: 48:

Avall Ggwcc

Sau9 61 ($ M.Hael11) Ggwcc 8:44 9:44 10:44 14:22 15:33 15:47 19:47 20:47 21:47 24: 33 25: 33 27: 47 28: 47 29: 47 32: 33 32: 47 33: 33 35: 47 36: 47 37: 47 27 10: 43 15: 4 6 16: 4 6 20: 4 6 21: 4 6 22: 4 6 26: 4 6 27: 4 6: 4: 28: 4 6: 46: 4: 2: 3 6: There are 23 hits on base # 47 44 There are 4 hits on the base. # 44 PpuMI RGgwccy 6:43 8:43 9:43 6:18 6 19: 4 6 23: 4 6 24: 4 6 25: 4 6 30: 46 31: 46 32: 46 36: 4 6 37: 4 6 43: 79 There are 22 hits on base # 46 43 There are 4 hits on base # 43 BsmFI GGGAC 8: 43 37: 4 6 50: 77 _ II _ gtccc 15:48 16:48 17:48 21:48 22: 48 23: 48 47 never together 46 never occur together. 3 33 1: 0 1: 0 20:48 24: 48 25: 48 26: 48 111

(16 cuts / 14 bases on the right) 21: 48 28: 48 29: 48: 48: 48: 48: 48: 48: 48: 48: 48: 48: There are 20 hits on base # 48 There are 11 hits on base # 54 Hinfl Gantc 80 8:77 12: 16 40: 54 41: 54 43: 54 44: 54 45: 54 46: 54 47: 16 16:16 17:16 17:16 18:16 18:16 18:56 18:77 19:16 19:56 19:17 16:16 16:16 16:16 16:16 : 16: 56: 10:21 21:16 21:16 21:16 21:16 23:16 23:16 23:16 23: 25: 77 26: 56 26: 56 21:16 21:16 21:16 21:16 28:16 28:16 29:16 29:16 29:16 29: 56 31: 77 32: 16 32: 56 32: 56 33: 56 33: 56 34: 16 35: 16 35: 56 36: 16 36: 56 36: : 16 39: 16 40: 16 41: 16 42: 16 44: 16 45: 16 46: 16 47: 16 49: 46 49: 46 There are 34 hits on base # 16 Tf il Gawtc 21 07:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21:77 21: 77 32: 77 33: 77 35: 77 36: 77 There are 21 hits on base # 77 Mly I GAGTC 38 12: 16 13:16 14:16 15:16 16:16 17:16 18:16 19:16 20: 16 21:16:16: 16:16: 16:16 16:16 21:16 21:16 21:16 21:16 21:16 21:16 21:16 16:16 : 26: 16 37: 16 38: 16 40: 16 41: 16 42: 16 44: 16: 16 46: 16 47: 16 48: 4: 49: 4 6:

There are 34 hits on base # 16 _ II _ GACTC 21 15: 56 16: 56 17:56 18:56 19:56 20:56 21:56 22:56 23: 56 24: 56 35: 56 36: 56 25: 56 There are 21 hits on the base # 56 Piei gagtc 38 12: 16 '' '' '' '' '' '' '' '' '' '' '' '' '' '' ' 16 29:16 38:16 21:16 16:16 0: 16: 16 0: 1 »0: 0» 0: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 : 16 47: 16 48: 4 6 49: 4 6 There are 34 hits on base # 16 _ II _ gactc 21 15:56 16:56 17:56 18:56 19:56 20:56 21:56 22:56 23 : 56 24: 56 25: 56 25: 56 26: 56 26: 56 28: 56 28: 56 29: 56 30: 56 31: 56 32: 56 33: 56 35: 56 36: 56 There are 21 hits on base # 56 AlwNI CAGNNNctg 26 15: 68 16: 68 17: 68 18: 6 08 07:18:28 P: 29: 68: 68 07:40:28 P: 29: 68 07: : 68 36: 68 39: 46 40: 4 6 41: 4 6 42: 4 6

There are 22 hits in basel 68 113

Table 8: GLG FR1 Kappa 1 2 3 4 5 6 7 8 9 10 11 12 GAC ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT 13 14 15 16 17 18 19 20 21 22 23 GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC 1 012 GAC ATC CAG ATG ACC CAG TCT CCA TCC CTG TCT GCA TCT GTA GGA GAC AGA CTC ACC ATC ACT TGC 1 02 GAC ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC 1 018 GAC ATC CAG ATG ACC CAG TCT CCA TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC 1 08 GAC ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA CTC ACC ATC ACT TGC 1 A2 0 GAC ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC 1 A3 0 AAC ATC CAG ATG ACC CAG TCT CCA TCT GCC ATG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT 1 LI 4 GAC ATC CAG ATG ACC CAG TCT CCA TCA TCA CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT 1 LI GAC ATC CAG ATG ACC CAG TCT CCA TCC TCA CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT 1 L15 GC C ATC CAG TTG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC 1 L4 GCC ATC CAG TTG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC 1 LI 8 GAC ATC CAG ATG ACC CAG TCT CCA TCT TCC GTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT 1 L5 GAC ATC CAG ATG ACC CAG TCT CCA TCT TCT GTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT 1 L19 GAC ATC CAG TTG ACC CAG TCT CCA TCC TTC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC 1 L8 GCC ATC CGG ATG ACC CAG TCT CCA TTC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC 1 L23 GCC ATC CGG ATG ACC CAG TCT CCA TCC TCA TTC TCT GCA TCT ACA GGA GAC AGA GTC ACC ATC ACT TGT 1 L9 GTC ATC TGG ATG ACC CAG TCT CCA TCC TTA CTC TCT GCA TCT ACA GGA GAC AGC GTC ACC ATC AGT TGT 1 L24 GCC ATC CAG ATG ACC CAG TCT CCA TCC TCA CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC 1 LI 1 GAC ATC CAG ATG ACC CAG TCT CCT TCC ACC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC 1 L12 114

GAT ATT GTG ATG ACC CAG ACT CCA CTC TCC CTG CCC GTC ACC CCT GGA GAG CCG GCC TCC ATC TCC TGC 1 011 GAT ATT GTG ATG ACC CAG ACT CCA CTC TCC CTG CCC GTC ACC CCT GGA GAG CCG GCC TCC ATC TCC TGC 1 01 GAT GTG GTG ATG ACT CAG TCT CCA CTC TCC CTG CCC GTC ACC CTT GGA CAG CCG GCC TCC ATC TCC TGC 1 AI 7 GAT GTT GTG ATG ACT CAG TCT CCA CTC TCC CTG CCC GTC ACC CTT GGA CAG CCG GCC TCC ATC TCC TGC 1 AI GAT ATT GTG ATG ACC CAG ACT CCA CTC TCT CTG TCC GTC ACC CTT GGA CAG CCG GCC TCC ATC TCC TGC 1 AI 8 GAT ATT GTG ATG ACC CAG ACT CCA CTC TCT CTG TCC GTC ACC CCT GGA CAG CCG GCC TCC ATC TCC TGC 1 A2 GAT ATT GTG ATG ACT CAG TCT CCA CTC TCC CTG CCC GTC ACC CCT GGA GAG CCG GCC TCC ATC TCC TGC 1 AI 9 GAT ATT GTG ATG ACT CAG TCT CCA CTC TCC CTG CCC GTC ACC CCT GGA GAG CCG gcc tcc ate tcc tgc 1 A3 GAT ATT GTG ATG ACC CAG ACT CCA CTC TCA TCA CCT GTC ACC CTT GGA CAG CCG GCC TCC ATC TCC TGC 1 A23 GAA ATT GTG TTG ACG CAG TCT CCA GGC ACC CTG TCT TTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TG C 1 A2 7 GAA ATT GTG TTG ACG CAG TCT CCA GCC ACC CTG TCT TTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC 1 AI 1 GAA ATA GTG ATG ACG CAG TCT CCA GCC ACC CTG TCT GTG TCT CCA GGG GAA GAG GCC ACC CTC TCC TGC 1 L2 GAA ATA GTG ATG ACG CAG TCT CCA GCC ACC CTG TCT GTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC 1 L16 GAA ATT GTG TTG ACA CAG TCT CCA GCC ACC CTG TCT TTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC 1 L6 GAA ATT GTG TGG ACA CAG TCT CCA GCC ACC CTG TCT TTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC 1 L20 GAA ATT GTA ATG ACA CAG TCT CCA GCC ACC CTG TCT TTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC 1 L25 GAT ATC GTG ATG ACC CAG TCT CCA GAC TAC CTG GCT GTG TCT CTG GGC GAG AGG GCC ACC ATC AAC TGC 1 B3 GAA ACG ACA CTC ACG CAG TCT CCA GCA TTC ATG TCA GCG ACT CCA GGA GAC AAA GTC AAC ATC TCC TGC 1 B2 GAA ATT GTG CTG ACT CAG TCT CCA GAC TTT CAG TCT GTG ACT CCA AAG GAG AAA GTC ACC ATC ACC TGC 1 A2 6 GAA ATT GTG CTG ACT CAG TCT CCA GAC TTT CAG TCT GTG ACT CCA AAG GAG AAA GTC ACC A TC ACC TGC 1 AIO GAT GTT GTG ATG ACA CAG TCT CCA GCT TTC CTC TCT 115 GTG ACT CCA GGG GAG AAA GTC ACC ATC ACC TGC! AI 4 116

Table 9 RERS sites found in GLG FR1 Kappa Human

Msll 1 1 1 X / 1 1 X / PflFI Bsrl BsmAl Mnll HpyCH 4 V VKI 012 1-69 3 3 23 12 49 15 18 47 26 36 02 101,169 103 103 123 112 149 115 118 147 126 136 018 201-269 203 203 223 212 249 215 218 247 226 236 08 301-369 303 303 323 312 349 315 318 347 326 336 A20 401-469 403 403 423 412 449 415 418 447 426 436 A30 501-569 503 503 523 512 549 515 518 547 526 536 L14 601-669 603 603 612 649 615 615 615 615 615 615 615 646 670 707 730 718 747 726 736 L15 801-869 803 803 823 812 849 815 818 847 826 836 L4 901-969 - 903 923 912 949 906 915 oo oo 926 936 L18 1001-1069 - 1003 101 1049 1006 1015 1018 1047 1026 1036 L5 1101-1169 1103-1112 1149 1115 1118 147-1136 L19 1201-1269 1203 1203 1212 1249 1215 1218 247-1236 L8 1301 -1369 - 1303 1323 1312 1349 1306 1315 1318 347 - 1336 L23 1401-1469 1403 1408 1403 1412 1449 1415 1418 447 - 1436 L9 1501-1569 1503 1503 1508 1523 1512 1549 1515 1518 1547 1526 1536 L24 1601-1669 1603 1608 1623 1612 1649 1615 1618 1647-1636 L ll 1701-1769 1703 1703 1723 1712 1749 1715 1718 1747 1726 1736 L12 1801-1869 1803 1803 1812 1849 1815 1818 1847-1836 VKII 011 1901-1969 - - - - - 1956-01 01 2001-2069 - - - - 2056 - A17 2101-2169 - - 2112 - 2118 2156 - s τ τ

1 - 1 1 X / 1 1 X / PflFI Bsrl BsmAl Mnll HpyCH 4V VKI AI 2201-2269 - - 2212 - 2218 2256 - A18 2301-2369 - - - - - 2356 - A2 2401-2469 - - - - - 2456 - A19 2501-2569 - - 2512 - 2518 2556 - A3 2601-2669 - - 2612 - 2618 2656 - A23 2901-2969 - - - - 2929 2956 - VKIII - A29 2801-2869 - - 2812 - 2818 2839 2860 - All 2901- 2920 - 2912 - 2912 - 2918 2939 2960 - L2 3001-3069 - - 3012 - 3018 3039 3060 - L16 3101-3169 - - 3112 - 3118 3139 3160 - L6 3201-3269 - - 3212 - 3218 3239 3260 - L20 3301-3369 - - 3312 - 3318 3339 3360 - L25 3401-3469 - - 3412 - 3418 3439 3460 VKIV B3 3501-3569 3503 - 3512 3515 3539 3518 355K - VKV 82 3601-3669 - - 3649 - 3649 3618 - VKVI A26 3901-3969 - - 3912 - 3918 - AIO 3801-3869 - - 3812 - 3818 - A14 3901-3969 - - 3912 - 3918 3930) - VKI 012 1-69 39 41 53 53 55 56 - 02 101-169 139 141 153 153 155 156 - 018 201-269 239 241 253 253 255 256 - 6 Τ Τ

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - L14 601-669 639 641 653 653 655 656 - L1 701-769 939 741 953 953 955 956 - L15 801-869 839 841 853 853 855 856 - L4 901-969 939 941 953 953 955 956 - L18 1001-1069 1039 1041 1053 1053 1055 1056 - L5 1101-1169 1139 1141 1153 1153 1155 1156 - L19 1201-1269 1239 1241 1253 1253 1255 1256 - L8 1301-1369 1339 1341 1353 1353 1355 1356 - L23 1401-1469 1439 1441 1453 1453 1455 1456 1406 L9 1501-1569 1539 1541 1553 1553 1555 1556 1506 SfaNl Sfcl Hinfl Mlyl - > - > < - same sites Maelll Tsp451 Hphl xx38 xx56 xx62 Hpall Mspl xx06 xx52 L24 1601-1669 1639 1641 1653 1653 1655 1656 L11 1901-1969 1939 1941 1953 1953 1955 1956 L12 1801-1869 1839 1841 1853 1853 1855 1856 VKII 011 1901-1969 - - 1918 1918 1939 1938 1952 01 2001-2069 - - 2018 2018 2039 2038 2052 Α19 2101-2169 - - 2112 2112 2139 2138 2152 Α1 2201-2269 - - 2212 2212 2239 2238 2252 Α18 2301-2369 - - 2318 2318 2339 2338 2352 Α2 2401-2469 - - 2418 2418 2439 2438 2452 Α19 2501-2569 - - 2512 2512 2539 2538 2552 Α3 2601-2669 - - 2612 2612 2639 2638 2652 οζτ

1 1 1/1 1 X / PflFI Bsrl BsmAl Mnll HpyCH 4V VKI Α23 2701-2769 - - 2718 2718 2737 2731 * 2738 * - VKIII A27 2801-2869 - - - - - All 2901-2969 - - - - - L2 3001-3069 - - - - L16 3101-3169 - - - - - L6 3201-3269 - - - - L20 3301-3369 - - - - - L25 3401-3469 - - - - - VKIV B3 3501-3569 - - 3525 3525 - VKV B2 3601-3669 - - 3639 3639 - VKVI A26 3701-3769 - - 3712 3739 3712 3739 3737 3755 3756 3762 - AIO 3801-3869 - - 3839 3812 3812 3839 3837 3855 3856 3862 - A14 3901-3969 - - 3939 3939 3937 3955 3956 3962 - BsaJl BssKl Bpml xx20 BsrFl Haelll Tsp5091 xx29 (NstNl) xx41 xx44 Cac81 Nael xx42 xx22 xx30 -> - &gt; NgoMIV xx43 xx43 <- VKI 012 1-69 - - - - - - 02 101-169 - - - - - - 018 201-269 - - - - - 08 301-369 - - - - - - A20 401- 469 - - - - - - A30 501-569 - - - - - -

1x1 1 X / 1 1 X / PflFI Bsrl BsmAl Mnll HpyCH 4V VKI L14 601-669 - - - - - - LI 701-769 - - - - - - L15 801-869 - - - - - - L4 901- - - L18 - - - - - L18 - - - - - L18 - - - 1469 - - - - - - L9 1501-1569 - - - - - - L24 1601-1669 - - - - - - Lll 1901-1969 - - - - - L12 1801-1869 - - - - - - VKII 011 1901 -1969 1942 1943 1944 1951 1954-01 01 2001-2069 2042 2043 2044 2051 2054 - A19 2101-2169 2142 - - 2151 2154 - AI 2201-2269 2242 - - 2251 2254 - A18 2301-2369 2342 2343 - 2351 2354 - A2 2401 -2469 2442 2443 - 2451 2454 - A19 2501-2569 2542 2543 2544 2551 2554 - A3 2601-2669 2642 2643 2644 2651 2654 - A23 2901-2969 2942 - - 2951 2954 - VKIII A29 2801-2869 2843 2822 2843 2820 2841 - - 2803 All 2901-2969 2943 2943 2920 2941 - - 2903 L2 3001-3069 3043 3043 3041 - - -

Msll 1 1/1 1 X / 1 1 X / PflFI Bsrl BsmAl Mnll HpyCH 4V VKI L16 3101-3169 3143 3143 3120 3141 - - - L6 3201-3269 3243 3243 3220 3241 - - 3203 L20 3301-3369 3343 3343 3320 3341 - - 3303 L25 3401-3469 3443 3443 3420 3441 - - 3403 VKIV B3 3501-3569 3529 3530 3520 - 3554 VKV B2 3601-3669 3643 3620 3641 - - VKVI A26 3101-3169 - 3120 - - 3103 AIO 3801-3869 - 3820 - - 3803 A14 3901-3969 3943 3943 3920 3941 - - -

Table 10 Sequences FR1 GLG Lambda! VL1

CAG TCT GIG CTG ACT CAG CCA CCC TCG GTG TCT GAA GCC ccc AGG CAG AGG CTC ACC ATC TCC TGT! cg cg cg cg cc cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg le cag tct gtg ctg act cag cca ccc teA gCg tct gGG Acc ccc Ggg cag agg gtc acc ate teTgt! le cag tct gtg ctg act cag cca ccc teA gCg tct gGG Acc ccc Ggg cag agg gtc acc ate teTgt! cc cg cc cc cg cg cg cg cg cg cg cg cg cg cg cg cg cc cg lb VL2 CAG TCT GCC CTG ACT CAG CCT CCC TCC GCG TCC GGG TCT CCT GGA CAG TCA GTC ACC ATC TCC TGC! 2c cag tct gcc ctg act cag cct eGe teA gTg tcc ggg tct cct gga cag tca gt c acc act tcc tgc! 2e cag tct gcc ctg act cag cct Gcc tcc gTg teT ggg tct cct gga cag tcG Until acc tcc tgc! 2a2 cag tct gcc ctg act cag cct ccc tcc gTg tcc ggg tct cct gga cag tca gt c acc to tcc tgc! 2d cag tct gcc ctg act cag cct Gcc tcc gTg teT ggg tct cct gga cag tcG Ate acc ate tcc tgc! 2b2 VL3 TCC TAT GAG CTG ACT CAG CCA CCC TCA GTG TCC GTG TCC CCA GGA CAG ACA GCC AGC ATC ACC TGC! 3 r tcc tat gag ctg act cag cca ctc tca gtg teA gtg Gcc cTG gga cag acG gcc agG atT acc tgT! 3 j tcc tat gag ctg acA cag cca ccc tcG gtg teA gtg tcc cca gga caA acG gcc agG ate acc tgc! 3p tcc tat gag ctg acA cag cca ccc tcG gtg teA gtg tcc cTa gga cag aTg gcc agG ate acc tgc! 3a tT tCt gag ctg act cag GAC ccT GcT gtg tcT gtg Gcc TTG gga cag aca gTc agG ate acA tgc! 31 tcc tat gTg ctg cca ccc tca gtg teA gtg Gcc cca gga Aag acG gcc agG atT acc tgT! 3h tcc tat gag ctg acA cag cTa ccc tcG gtg teA gtg tcc cca gga cag aca gcc agG ate acc tgc! 3e tcc tat gag ctg aTG cag cca ccc tcG gtg teA gtg tcc cca gga cag acG gcc agG ate acc tgc! 3m tcc tat gag ctg acA cag cca Tcc tca gtg teA gtg tcT ccG gga cag aca gcc agG ate acc tgc! V2-19 VL4 CTG CCT GTG CTG ACT CAG CCC CCG TCT GCA TCT GCC TTG CTG GGA GCC TCG ATC AAG CTC ACC TGC! 4c cAg cct gtg ctg act caA TeA teC tct gcC tct gcT tcc ctg gga Tcc teg Gtc aag etc acc tgc! 4a cAg cTt gtg ctg act caA TcG ccC tct gcC tct gcc tcc ctg gga gcc teg Gtc aag etc acc tgc! 4b VL5 CAG CCT GTG CTG ACT CAG CCA CCT TCC TCC TCC GCA TCT CCT GGA GAA TCC GCC AGA CTC ACC TGC! 5e cag Gct gtg ctg act cag ccG Gct tcc CTc teT gea tct cct gga gCa teA gcc agT etc acc tgc! 5c cag cct gtg ctg act cag cca Tct tcc CAT teT gea 123 tgc! 5b acc

Tct Tct gga gCa tcA gTc aga ctc! VL6 AAT TTT ATG CTG ACT CAG CCC CAC TCT GTG TCG GAG TCG CCG GGG AAG ACG GTA ACC ATC TCC TGC! 6a! VL 7 CAG ACT GTG GTG ACT CAG GAG CCC TCA CTG ACT GTG TCC CCA GGA GGG ACA GTC ACT CTC ACC TGT! 7a cg Gct gtg act cag gag CCC tca ctg act gtg tcc cca gga ggg aca gtc act ctc acc tgt! 7b VL8 CAG ACT GTG GTG ACC CAG GAG CCA TCG TTC TCA GTG TCC CCT GGA GGG ACA GTC ACA CTC ACT TGT! 8a VL9 CAG CCT GTG CTG ACT CAG CCA CCT TCT GCA TCA GCC TCC CTG GA GCC TCG (GTC ACA CTC ACC 'TGC! 9a VL 10 CAG GCA GGG CTG ACT CAG CCA CCC TCG GTG TCC AAG GGC TTG AGA CAG ACC GCC ACA TCT ACC TGC! 10a 124

Table 11 RERS found in GLG FR1 human lambda

! There are 31 GLG lambda MlyI NnnnnnGACTC 1: 6 4: 9: 6 10: 6 1: 20: 6 21: 6 22 25: 6 25: 50 26 31: 6 25 6: 6 7: 6 15: 6 23: 6 23: 6 24: 6 27: 6 16: 6 23: 6 23: 6 30: 6

There are 23 hits on base # 6 GAGTCNNNNNn 1 26: 34

There are 19 hits on base # 9 Hinfl Gantc 1: 12 3: 12 4: 9: 12 Mwol GCNNNNNnngc 1: 9 3: 12: 9 13: 9 14 19: 9 20: 9 23 30: 9 31: 9 10: 12 11 20: 12 21: 12 22 24: 12 25: 12 25 28: 12 30: 12 31 There are 23 hits on base # 12 Piei gactc 1: 12 3: 12 4: 9: 12 10: 12 11 20 : 12 21: 12 22 25: 12 25: 56 26 31: 12 There are 23 hits on base # 12 gagtc 26: 34 Ddel Ctnag 1: 14 2: 24 3: 5: 24 6: 14 7: 10: 14 11: 14 11 20 4: 9 11: 9 11: 56 16: 9 17: 9 18: 9 25: 9 26: 9 27 6: 12 7: 12 8: 12 12: 12 15: 12 16: 12 23 : 12 23: 4: 23: 4: 23: 56-6: 12: 12: 12: 12: 12: : 12 30: 12 1: 3: 24 4: 14 4:24 4:24 7:24 8:14 9:14 12:: 14 12:: 24 15:: 5: 15: 15: 16: 14 16: 24 19:24 20: 14 23:14 24:14 25:14 26:14 27:14 28:14 29:30 30:14 31:14 There are 21 hits on base # 14 BSAJI Cnngg 38 1: 23 1: 40 2: 39 2: 40 3: 39 4: 39 9: 40 11: 39 12: 38 12: 39 13: 23 13: 39 14: 23 14: 39 15:38 21:39 21:39 21:39 21:39 21:39 22:39 22: 39 22: 47 26: There are 17 hits on base # 39 There are 5 hits on base # 38 There are 5 hits on base # 40 They make uneven cleavage. MnlI cctc 35 1: 23 2: 23 3: 23 4: 23 5: 23 6: 23 6: 23 7: 19 9:19 9:23 10: 23 11: 23 13: 23 14: 23 16: 237: 23-23: 23-23 21:23 21:23 22:23 22:23 22:23 21:23 : 35: 47 31: 23

There are 21 hits on base # 23 There are 3 hits on base # 19 There are 3 hits on base # 29 There is 1 hit on base # 26

There is 1 hit on base # 27 These can make uneven cleavage. gagg 1: 48 2: 39 3: 40 4: 39 9: 40 6:31 6:31 6:31 6:31 6:31 6:31 0: 39 7:39 8:39 9:39 9:39 9:39 9:39 11:39 12:38 12:52 13:39 13:52 14:52 16:39 16:52 17:39 17:52 18 : 39: 52: 39 19: 39 19:59 21: 38: 21: 38 23: 39: 39: 52: 29: 39:

There are 21 hits on base # 39 There are 4 hits on base # 38 There are 3 hits on base # 31 There are 3 hits on base # 40 Irregular

BstNI CCwgg 30 1: 41 2:40 5:40 5:40 6:40 7:40 8:49:40 10: 40 11: 40 12:39 12:53 13 13:53 14:53 16:40 16:53 17: 40 17 18: 40 18:53 19:53 21: 39 22: 39 23 24: 40 27: 40 28: 40 29: 15 29: 40 30

There are 17 hits on base # 40 There are 7 hits on base # 53 There are 4 hits on base # 39 There is 1 hit on uneven base # 41

PspGI ccwgg 30 1: 41 10:40 5: 40 6:40 7:40 8:49:40 10: 40 11: 40 12:39 12:53 13 13:53 14:53 16:40 16:53 17: 40 17 18: 40 18:53 19:53 21: 39 22: 39 23 24: 40 27: 40 28: 40 29: 15 29: 40 30

There are 17 hits on base # 40 There are 7 hits on base # 53 There are 4 hits on base # 39 There is 1 hit on base # 41

ScrFI CCngg 39 1: 41 2: 40 3: 40 4:41 4:40 4: 5: 40 6:32 6:40 7:32 7:40 8: 9: 32 9:40 10:40 11: 40 12 : 39 12 13: 40 13: 53 14: 53 16: 40 16: 53 17: 53 18: 40 18:53 19: 40 21: 39 23: 40 29: 40 26: 40 27: 40 28 29: 15 29: 40 30: 39

There are 21 hits on base # 40 There are 4 hits on base # 39 There are 3 hits on base # 41 127

MaelII gtnac 16 1: 52 2: 52 3: 52 4: 52 5: 52 7: 52 9: 52 26: 52 21: 10 21: 52 28: 10 28: 52 29: 10 29: 52 30: 52 There are 13 hits on the base # 52 Tsp45I gtsac 15 1: 52 2: 52 3: 52 5: 52 6: 52 7: 52 9: 52 21: 10 21: 52 28: 10 28: 52 29: 10 29: 52 30: 52 There are 12 hits on base # 52 Hphl tcacc 26 1: 53 2: 53 3: 53 4: 53 5: 53 6: 53 7: 53 8: 53 9: 53 10: 53 11: 59 13 : 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59: 59 There are 10 hits on base # 53 BspMI ACCTGCNNNNn 14 11: 61 13: 61 14: 61 17: 61 19: 61 20: 61 21: 61 22: 61 23: 61 24: 61 25: 61 30: 61 31: 61 There are 14 hits on base # 61 Go to CDR1

Table 12: Combinations with FR3 URE adapters in 79 human HCs. A. List of heavy chain genes sampled AF008566 AF 1033 6 7 HSA235674 HSU94417 S83240 AF035043 AF10 3 3 6 8 HSA235673 HSU94418 SABVH369 AF103026 AF103369 HSA240559 HSU963 89 SADEIGVH af103 033 AF10 3 3 7 0 HSCB201 HSU96391 SAH2IGVH AF103061 af103371 HSIGGVHC HSU96392 SDA3IGVH Af103072 AF10 3 3 7 2 HSU44791 HSU96395 SIGVHTTD af103078 AF158381 HSU44793 HSZ93849 SUK4IGVH AF103099 E05213 HSU82771 HSZ93850 AF103102 E05886 HSU82949 HSZ93851 AF103103 E05887 HSU82950 HSZ93853 AF103174 HSA23 5 6 61 HSU82952 HSZ93855 128 AF103186 HSA235664 HSU82961 HSZ93857 af103187 HSA235660 HSU86522 HSZ93860 AF103195 HSA235659 HSU86523 HSZ93863 af103277 HSA235678 HSU92452 MCOMFRAA af103286 HSA235677 HSU94412 MCOMFRVA AF103309 HSA235676 HSU94415 582745 af103343 HSA235675 HSU94416 S82764

Table 12B. Test all GLGs other than bases 89.1 to 93.2 of the heavy variable domain

Id Nb 0 1 2 3 4 SEQ ID NO: 1 38 15 11 10 0 2 Seql gtgtattactgtgc 25 2 19 7 6 4 2 0 Seq2 gtAtattactgtgc 26 3 1 0 0 1 0 0 Seq3 gtgtattactgtAA 27 4 7 1 5 1 0 0 Seq4 gtgtattactgtAc 28 5 0 0 0 0 0 0 Seq5 Ttgtattactgtgc 29 6 0 0 0 0 0 0 Seq6 TtgtatCactgtgc 30 7 3 1 0 1 1 0 Seq7 ACAtattactgtgc 31 8 2 0 2 0 0 0 Seq8 ACgtattactgtgc 32 9 9 2 2 4 1 0 Seq9 ATqtattactqtqc 33 26 26 21 4 2 Cumulative 26 52 73 77 79 1 VHSzyl GTGtattactgtgc 2 VHSzy2 GTAtattactgtgc 3 VHSzy4 GTGtattactgtac 4 VHSzy9 ATGtattactgtgc Most important URE in Heavy FR3 (ON_SHCl03) (SEQ ID NO: 25) (ON_SHC3 23) (SEQ ID NO: 26) (ON_SHC3 49) (SEQ ID NO: 28) (ON_SHC5a) (SEQ ID NO: 33)

Table 12C Number Recognition Sequences Number Table 12D, Human HC 79 V gene base sequence assays with fourth probes 79 29143 Number of combinations Id Best 0 1 2 3 4 5 1 39 15 11 10 1 2 0 Seql gtgtattactgtgc (SEQ ID NO: 25) 2 22 7 6 5 3 0 1 Seq2 gtAtattactgtgc (SEQ ID NO: 26) 3 7 15 1 0 0 0 Seq4 gtgtattactgtAc (SEQ ID NO: 28) 4 11 2 4 4 1 0 0 Seq9 ATgtattactgtgc (SEQ ID NO: 33)

Group 25 26 20 5 2 Cumulative 25 51 71 76 78

A sequence has five combinations with sequences 2, 4, and 9; is rated as the best for 2.

Id is the adapter number.

Best is the sequence number for which the identified adapter was the best available. The remainder of the Table shows how the sequences match well with the adapters. For example, there are 10 sequences that combine with VHSzyl (Id = 1 with 2 incorrect pairings and are worse for all other adapters. In this sample, 90% comes within 2 bases of one of the fourth adapters.

Table 13 The following list of enzymes has been removed from http://rebase.neb.com/cqi-bin/asymmlist.

The enzymes that a) cut within the recognition, b) cut on both sides of the recognition, or c) have less than 2 bases between the recognition site and the nearest cutting site were removed.

Enzymes REBASE 04/13/2001

Type II restriction enzymes with asymmetric recognition sequences:

Enzymes Recognition Sequence Isosquizómeros Providers Aar I CAC C TGCNNNNA NNNN_ - Y AcelII CAGCTCNNNNNNNA NNNN_ - - Bbr 71 GAAGACNNNNNNNA NNNN_ - - BbvI G AGC CNNNNNNNN The NNNN_ y BbvI I GAAGACNNA NNNN_ Bce83I CTT GAGNNNNNNNNNNNNNN_NNA _ - - BceAI AC GGCNNNNNNNNNNNN The NN_ - Y BCEF BC GGCNNNNNNNNNNNN The N_ - - BciVI GTATCCNNNNN_NA Bful Y Bfil ACTGGGNNNN_NA Bmr I y Bini GGATCNNNNAN_ BscAI GCATCNNNNANN_ - - BseRI GAGGAGNNNNNNNN_NNA - Y BsmFI GGGACNNNNNNNNNNA NNNN_ BspLUl1III Y BspMI AC CT GCNNNNA NNNN_ Acc36I Y Ecil G GC G GANNNNNNNNN_NNA - Y Eco57I CT GAAGNNNNNNNNNNNNNN_NNA BspKT 51 And Faul CCCGCNNNNANN_ BstFZ438I Y Fokl GGATGNNNNNNNNNANNNN_ BstPZ418I Y 130

Gul

CTGGAGNNNNNNNNNNNNNN

Y ΝΝΛ HgaI GACGCNNNNNΛNNNNN_ - Y Hphl GGTGANNNNNNN ΝΛ AsuHPI Y Mbo II GAAGANNNNNNN_NΛ - Y Enzymes Recognition Sequence Isosquizómeros Providers Mly I GAGT CNNNNN Λ Schi Y MMEL TCC RACNNNNNNNNNNNNNNNNNN_ - - ΝΝΛ Mnl I CCTCNNNNNN_NA - Y Piel GAGTCNNNNAN_ Pps IY RleAI DC CACANNNNNNNNN_NNNA - - SfaNI GCAT CNNNNN A NNNN_ BspST5I YS spD51 GGT GANNNNNNNN A - - Sthl3 21 CCC GNNNN A NNNN_ - - Stsl GGAT GNNNNNNNNNNA NNNN_ - - Taqll GAC C GANNNNNNNNN_NNA, CACC CANNNNNNNNN_NNA - TthlllII CAARCANNNNNNNNN_NNA - - UbaPI CGAACG The notation is A means cut of the upper chain e .. means cut of the lower chain. If the top and bottom chains are cut in the same place, then only aparece appears. 131

Table 14 (FOKIact) 5'-cAcATccgTg TTgTT cAcggATgTg-3 'to be reviewed by DNAs (VHExBB1) 5'-AATAgTAgAc TgcAgTgTcc TcAgcccTTA AgcTgTTcAT cTgcAAgTAgAgAgTATTcT TAgAgTTgTc TcTAgAcTTA gTgAAgcg-3'! note that VHEx881 is the reverse complement of the ON below! [RC] 5'-cgCttcacTaag-! Scab ........! 3-23 Synthetic as in Table 206! | TCT | AGA | gac | aac | tct | aag | aat | act | ctc | tac | ttg | cag | atg | Xbal. aac agC TTA AGG gct gag gAC aCT GCA Gtc tac t tat 3 -AgIII ,,, (VHBA881) 5'-cgCttcadaag | TCT | AGA | gac | aac | tct | aag | aat | act | ctc | tac | ttg | cag | atg11aac | agC | TTA | agg | gct | gag | aCT | GCA | Gtc | tac | tat | tgt gcg ag-3 '(VHBB881) 5'-cgCttcacTaag | TCT | AGA | gac | aac | tact | aag | aat | act | ctc | tac | ttg | Ac- ag-3 '(VH881PCR) 5'-cgCttcacTaag | TCT | AGA | gac | 5'-cgCttcacTaag | TCT | AGA | gac | aac -3 '

Table 15: Use of FokI as &quot; Universal Restriction Enzyme &quot;

(SEQ ID NO: 15) 3'-gtgCCTACac-nnnnnnnnnnnnnnnnnn-5 '(SEQ ID No 16), for the cDNA, I represents cleavage sites cleavage 5'-cacGGATGtq-nnnnnnnnnnnnnn-

RECOGNIZE

Fokl cement

(SEQ ID NO: 17) 3'-caa-ataaItaacaca-atGTAGGcac-5'-caCATCCgtg / (SEQ ID No 18)

(SEQ ID NO: 19) r-cacataa-tctaIacq-5 '/ gtgCCTACac? CGGATGtg-3' (SEQ ID No 20)

Case III (Case I rotated 180 degrees) / gtgCCTACac-5 '\ cacGGATGtg · &gt; (SEQ ID NO: 22) 3cacagaa-tgtc | agg..substrato ....- 5 '(SEQ ID NO: 22)

Case IV (Case II rotated 180 degrees) 3'-gtGTAGGcac (SEQ ID No 23) i-caCATCCat g / 5'-gag | tctc-actaaac caCATCCgtg / 5'-gag11 ctc-actgagc

Substrate 3 '-... ctc-agag | tgactcg ...- 5' (SEQ ID NO: 24)

Improved FokI adapters

Fokl - for dsDNA, I represents cleavage sites Case I

Rod 11, loop 5, rod 11, recognition 17 5 '. Catgtg I tatt-actgtgc. . Substrate .... -3 · 3'-atacac-atacaItqacaca-iRT-, atGTAGGcacG T 5 * - caCATCCgtgc C IfT- ·

Case II

Rod 10, loop 5, rod 10, recognition 18 133 5 '-. . .gtgtatt lagac-tgctgcc. .Substrato .... 3 'ΓΤη i-cacataa-tctaIacoacoa-51 T gtgCCTACac C cGGATGtg-3'

Lttj

Case III (Case I rotated 180 degrees)

Rod 11, loop 5, stem 11, recognition 20 Γ Τη T TgtgCCTACac-5 · G AcacGGATGtq-i

LtT · * atatctt I acáa-tccattcta-3 * Adapter 3 * -... cacagaa-tgtc | aggtaagac. .Substrato ....- 5 '

Case IV (Case II rotated 180 degrees) Rod 11, loop 4, rod 11, recognition 17 ΓΤΊ

3'-gtGTAGGcacc T i-cCATCCgtgg T 5 '-atcgag | tctc-actaaac * -TJ

Substrate 3 '-... taqctc-aqaqItqactcq ...- 5'

BseRI cleavage sites 5'-cacGAGGAGnnnnnnnnnnnnnnn-3 '3'-gtgct cctnnnnnnnnnnnnnnn-5'

RECOGNIZE

Cement of BseRI

Rod 11, loop 5, rod 11, recognition 19 3 '-... gaacat I cg-ttaagccagta ..... 5' ι-Τ-Τη cttgta-gc I aattcggtcat-3 'C GCTGAGGAGTC-- 1

T cgactcetcag-5 'An adapter for BseRI cleaves the above substrate. Lt_I 134

Table 16 Bases of human heavy chains 88.1 to 94.2 Number of sequences .......... 840 Number of Incorrect Matchers ......... Probe

Id Ntot 0 12 3 4 5 6 7 Name Sequence ......... Mode with Points ..... 1 364 152 93 36 26 7 4 2 0 VHS881-1.1 gctgtgtattactgtgcgag gctgtgtattactgtgcgag 2 265 150 60 33 13 5 4 0 0 VHS881-1.2 gccgtgtattactgtgcgag, .c ...... 3 96 14 34 16 10 5 7 9 1 VHS881-2.1 gccgtatattactgtgcgag, .c..a ... 4 20 0 3 4 9 2 2 0 0 VHS881 -4.1 gccgtgtattactgtacgag, .c ...... .... a ... 5 95 25 36 18 11 2 2 0 1 VHS881-9.1 gccatgtattactgtgcgag ..ca ..... 840 341 230 143 69 21 19 11 2 341 571 718 787 808 827 838 840 845 840 (VHS881-1.1) (VHS881-1.2) (VHS881-1.2) (VHS881-4.1) (VHS881-9.1) 88 89 90 91 92 93 94 95 Number of codon as in Table 195

Recognition ........... Stem ...... ansa, Stem ...... 5'-gctgtgtat | tact-gtgcgag cAcATccgTg TTgTT cAcggATgTg-3 '5'-gctgtgtat | tact-gtgcgag cAcATccgTg TTgTT cAcggATgTg-3 '5'-gctgtgtat | tact-gtgcgag cAcATccgTg TTgTT cAcggATgTg-3' 5'-gctgtgtat | tact-gtgcgag cAcATccgTg TTgTT cAcggATgTg-3 '5'-gctgtgtat | tact-gtgcgag cAcATccgTg TTgTT cAcggATgTg-3' | substrate cleavage site (FOKIact) 5'-cAcATccgTg TTgTT cAcggATgtg-3 '(VHEx881) 5'-AATAgTAgAc TgcAgTgTcc TcAgcccTTA AgcTgTTcAT cTgcAAgTAg-AgAgTCTTcT TAgAgTTgTc TcTAgAcTTA gTgAAgcg-3' Note that CHEx881 is the reverse complement of ON below! [RC] 5'-cgCttcacTaag-! Scab .......! 3-23 Synthetic as in Table 206! | TCT | AGA | gac | aac | tct | aag | aat | act | ctc | tac | ttg | cag | atg | -! Xbal ...! | aac | agC | TTA | AGg | gct | gag | gac | aCT | GCA | Gtc | tac | tat | t-3 '! AflII .., (VHBA881) 5'-cgCttcacTaag- | TCT | AGA | gac | aac | tact | aag | aat | act | ctc | tac | ttg | cag | atg | - | aac | agC | TTA | AGg | gct gag | gac | aCT | GCA | Gtc | tac | tat | tgt gcg ag-3 (VHBB881) 5'-cgCttcacTaag- | TCT | AGA | gac | aac | t | aag | aat | act | ctc | tac | ttg Agar ag-3 (VH881PCR) 5 '-cgCttcacTaag | TCT | AGA | gac | Gag | gag | gag | gag | gac | gtc | aac -3 '13 6

Table 17: Kappa, bases 12-30 1! ID Ntot 0 12 3 4 5 6 Name Sequence ............ Dotted mode ..........! 1 84 40 21 20 1 2 0 0 SK12012gacccagtctccatcctcc gaccagtctccatcctcc! 2 32 19 3 6 2 1 0 1 SK12A17 gactcagtctccactctcc ... t ........ ct ....! 3 26 17 8 1 0 0 0 0 SK12A27 gacgcagtctccaggcacc • •• g ........ gg-a ..! 4 40 21 18 1 0 0 0 0 SK12A11gacgcagtctccagccacc • •• g ........ g..a! 182 97 50 28 3 3 0 1 1 1 97 147 175 178 181 181 182 URE adapters:! Stem ...... loop. Stem ...... Recognition ........ (SzKB1230-012) 5'-cAcATccgTg TTgTT cAcggATgTg ggAggATggAgAcTgggTc-3 '! [RC] 5'-gacccagtctccatcctcc cAcATccgTg AAcAA cAcggATgTg-3 '! Recognition ....... Haste ....... loop. Rod FokI. FokI. i Stem ....... loop. Stem ...... Recognition ... (SzKB1230-A17) 5'-cAcATccgTg TTgTT cAcggATgTg ggAgAgTggAgAcTgAgTc-3 '! [RC] 5'-gactcagctctccactctcc cAcATccgTg AAcAA cAcggATgTg-3 '! Recognition ....... Haste ....... loop. Rod FokI. FokI. i Stem ....... loop. Rod ...... Recognition ........ (SzKB1230-A27) 5'-cAcATccgTg TTgTT cAcggATgTg ggTgccTggAgAcTgcgTc-3 '! [RC] 5'-gacgcagtctccaggcacc cAcATccgtg AAcAA cAcggATgtg-3 '! Recognition ....... Haste ....... loop. Stem......

FokI

FokI 13 8! Stem ....... loop. Stem ...... Recognition ........ (SzKB1230-All) 5'-cAcATccgTg TTgTT cAcggATgTg ggTggcTggAgAcTgcgTc-3 '! [RC] 5'-gacgcagtctccagccacc cAcATccgtg AAcAA cAcggATgTg-3 '! Recognition ....... Haste ....... loop. Rod FokI. FokI. (SzKB1230-A17 * (SzKB1230-A27 * (SzKB1230-All * 5'-gaccca-cc-tc-cc-3 ') cleavage site on the substrate 5'- gac cctc cc-ct ctc c-3 '5'-gac gca gtc tcc a-gg cac c-3' 5'-gac gca gc cc-cc cc-3 '(kapextURE) 5'-ccTctactctTgTcAcAgTgcAcAA gAc ATc cAg-3 '! Sense chain

Scab ............. ApaLI. (kapextUREPCR) 5'-ccTctactctTgTcAcAgtg-3 '

Scab ............. (kaBROlUR) 5'-ggAggATggA cTggATgTcT TgTgcAcTgT gAcAAgAgTA cAgg-3 '! [RC] 5'-ccTctactcTgTcAcAgtgcAcAA gAc ATc cAg tc-tc ctc c-3 'ON above is R. ((kaBR02UR) 5'-ggAgAgTggA cTggATgTcT TgTgcAcTgT gAcAAgAgTA gAgg-3'

! [RC] 5'-ccTctactctTgTcAcAgTgcAcAA gAc ATC cAg-ct cc-3 'ON above is R (kaBR03UR) 5'-ggTgccTggA cTggATgTcT TgTgcAcTgT gAcAAgAgTA gAgg-3'! [RC] 5'-ccTctactcTgTcAcAgTgcAcAA gAc ATC cAg-cg cc-3 '3' ON above is (kaBROiUR) 5'-ggTggcTggA cTggATgTcT TgTgcAcTgT gAcAAgAgTA gAgg-3 '

! [RC] 5'-ccTctactctTgTcAcAgTgcAcAA gAc ATc cAg cc-cc cc-3 'ON above is R

Scab ............. ApaLI. :. of this C. of this C. of this C.

Table 18 URE Lambda adapters bases 13.3 to 19.3 Number of sequences .......... 128! Number of Incorrect Matchers .........! Ld Ntot 0 1 2 3 4 5 6 7 8 Name Sequence .......... Point Mode .....! 1 58 45 1 1 0 0 0 2 2 1 VL133-2a2 gtctcctggacagtcgatc gtctcctggacagtcgatc! 2 16 10 1 0 1 0 1 1 0 2 VL133-31 ggccttgggacagacagtc.g.cttg ...... a.ag ..! 3 17 6 0 0 0 4 115 0 VL133-2c gtctcctggacagtcagtc ............ ag ..! 4 37 3 0 10 4 4 3 1 4 2 VL133-lc ggccccagggcagagggtc.g.c..a..g ... ag.g ..! 128 64 8 11 5 8 5 11 11 5! 64 12 83 88 96 101 112 123 128! Stem ....... loop. Stem ...... Recognition ... (VL133-2a2) 5'-cAcATccgTg TTGTT cAcggATgTg gATcgAcTgTccAggAgAc-3 '! [RC] 5'-gtctcctggacacagtcgatc cAcATccgTg AAcAA cAcggATgTg-3 '! Recognition ....... Haste ....... loop. Rod Stem ....... loop. Stem ...... Recognition ... (VL133-31) 5'-cAcATccgTg RRgTT cAcggATgTg gAcTgTcTgTcccAAggcc-3 '! [RC] 5'-gtctcctggacagtcgatc cAcATccgtg AAcAA cAcggATgTg-3 '! Recognition ....... Haste ....... loop. Rod Stem ....... loop. Stem ...... Recognition ... (VL133-2c) 5'-cAcATccgTg TTgTT cAcggATgTg gAcTgAcTgTccAggAgac-3 '[RC] 5'-gtctcctggacagtcagtc cAcATccgTg AAcAA cAcggATgTg-3'! Recognition ....... Haste ....... loop. Rod Stem ....... loop. (VL133-lc) 5'cAcATccgTg TTgTT cAcggATgTg gAcccTcTgcccTggggcc-3 which occurs in the top strand: (VL133-2 a2 *) i (VL133-31 * ) (VL133-2c *) i (VL133-1C *) cleavage site in the upper chain 5'-g tct cct g g g g g g g g g g 5 g -g g g g t g g g g g g 5 The following Extenders and Bridges encode all of the AA Sequence of 2a2 to codons 1-15! 1 (ON_LamExl33) 5 '-ccTcTgAcTgAgT gcA cAg-i! 2 3 4 5 6 7 8 9 10 11 12 AGt gcT ttA acC caA ccG gcT AGT gtT AgC ggT-i! 13 14 15 tcC ccG g! 2a2! 1 (ON_LamBl-133) [RC] 5'-ccTcTgAcTgAgTgcA cAg- 2 3 4 5 6 7 8 9 10 11 12 AGt gcT ttA acC caA ccG gcT AGT gtT AGC ggT-i! 13 14 15 tcC gc cg tcg at-3 '! 2a2 N.B. the actual seq is the reverse complement of that shown. (ON_LamB2-l33) [RC] 5'-ccTcTgAcTgAgT gcA cAg- 2 3 4 5 6 7 8 9 10 11 12 AGt gcT ttA acC caA ccG gcT AGT gtT aGC ggT-i! 13 14 15 tcC ccG gc cag tea gt -3 '! 2c N.B the actual seq is! reverse complement of the shown. 140 (0N_LamB3-133) [RC] 5'-ccTcTgAcTgAgT gcA cAg-0 0 FR3HC 0 0 after LC 0 0 0 0 0 0 0 0 0 0 0 HC FR1 0 2 3 4 5 6 7 8 9 10 11 12

AGt gcT TtA acC caA ccG gcT AGT 13 14 15 tcC ccG gca cca gt -3 '! 2c

(ON_LamB4-133) [RC] 5'-ccTcTgAcTgAgT 2 3 4 5 6 7 8 9 10 11 12

AGt gcT TtA acC caA ccG gcT AGT 13 14 15 tcC ccG g gg cag agg gt-3 '! lc (ON_Laml33PCR) 5'-ccTcTgAcTgAgT gcA cAg

Table 19: Cleavage Enzyme Recognition * 1

Afel AGCgct 0 Af III Cttaag 0 Agel Accggt 0 Asei GGcgcgcc 0 BglII Agatct 0 BsiWI Cgtacg 0 BspDI ATcgat 0 BssHII Gcgcgc 0 BstBI TTcgaa 0 DralII CACNNNgtg 0 EagI Cggccg 0 Fsel GGCCGGcc 0 FspI TGCgca 0 Hpal GTT clcLC 0 Mfel Caattg 0 MluI Acgcgt 0 gtT aGC ggT-ti.B a real seg is the reverse complement of that shown. gcA cAg-gtT AGC ggT-s N.B a real seg is the reverse complement of that shown. AGt gc-3 '75 human light chains.

Ns Planned position of the site 141

Enzyme Recognition * Nch Ns Planned location location Ncol Ccatgg 0 0 Heavy chain signal Nhel Gctagc 0 0 HC / anchor binding element Not I GCggccgc 0 0 on binding element after HC NruI TCGcga 0 0 PacI TTAATtaa 0 0 Pinei GTTTcLcíCíC 0 0 Pmll CACgtg 0 0 Pvul CGATcg 0 0 Saci I CCGCgg 0 0 Sall Gtcgac 0 0 Sfil GGCCNNNNnggcc 0 0 Heavy chain signal Sgf I GC GAT ege 0 0 SnaBI TACgta 0 0 StuI AGGcct 0 0 Xbal Tctaga 0 0 HC FR3 Aatll GACGTc 1 1 Acl I AAcgtt 1 1 Assay ATtaat 1 1 Bsg GAATGCN 1 1 BspEI Tccgga 1 1 HC FR1 BstXI CCANNNNNTGG 1 1 HC FR2 DrdI GACNNNNnngtc 1 1 HindiII Aagctt 1 1 Pci I Acatgt 1 1 SapI gaagagc 1 1 Seal AGTact 1 1 SexAI Accwggt 1 1 Spel Actagt 1 1 Tlil Ctcgag 1 1 Tbcgag 1 1 Bcgl cnnnnntgc 2 2 Bcgcnnnnntgc 2 2 BssSI Ctcgtg 2 2 BstAPI GCANNNNntgc 2 2 EspI GCtnagc 2 2 Kasl Ggcgcc 2 2 Pf 1MI CCANNNNntgg 2 2 Xmnl GAANNnnttc 2 2 ApaLI Gtgcac 3 3 Seq LC Nael GCCggc 3 3 signal 142

Enzyme

Recognition

Nch

Ns

Planned location location

NgoMI Gccggc 3 3 PvuII CAGctg 3 3 Rsrll CGgwccg 3 3 BsrBI GAGcgg 4 4 BsrDI GCAATGNNn 4 4 BstZ17I GTAtac 4 4 EcoRI Gaattc 4 4 Sphl GCATGc 4 4 SspI AATatt 4 4 Accl GTmkac 5 5 Bell Tgatca 5 5 BsmBI Nnnnnngagacg 5 5 BsrGI Tgtaca 5 5 Oral TTTaaa 6 6 Ndel CAtatg 6 6 HC SwaI ATTTaaat 6 6 BamHI Ggatcc 7 7 Saci GAGCTc 7 7 BciVI GTATCCNNNNNN 8 8 BsaBI GATNNnnatc 8 8 Nsil ATGCAt 8 8 Bspl20I Gggccc 9 9 CHI Apal GGGCCc 9 9 CHI PspOOMl Gggccc 9 9 BspHI Tcatga 9 11 EcoRV GAT at c 9 9 Ahdl GACNNNnngtc 11 11 Bbs I GAAGAC 11 14 Psil TTAtaa 12 12 Bsal GGTCTCNnnnn 13 15 Xmal Cccggg 13 14 Aval Cycgrg 14 16 Bgll GCCNNNNnggc 14 17 AlwNI CAGNNNctg 16 16 BspMI ACCTGC 17 19 Xcml CCANNNNnnnnntgg 17 26 BstEII Ggtnacc 19 22 HC Sse8387I CCTGCAgg 20 20 Avrll Cctagg 22 22 HincII GTYrac 22 22 FR4 FR4 143

Enzyme

Recognition

Nch

Ns

Planned location location

Bsgl GTGCAG 27 29 Msc TGGcca 30 34 BseRI NNnnnnnnnnctcctc 32 35 Bsu3 61 CCtnagg 35 37 PstI CTGCAg 35 40 Epo I nnnnnnncccccc 38 40 PpuMI RGgwccy 41 50 Styl Ccwwgg 44 73 EcoOl09I RGgnccy 46 70 Acc65I Ggtacc 50 51 Kpnl GGTACc 50 51 Bpml ctccag 53 82 The cleavage occurs in the top strand after the last base of upper case For RE that cut palindromic sequences, the lower strand is cut at the symmetrical site.

Enzyme Table 20: Cleavage Recognition * Nch of 79 Ns heavy chains Planned site location Afel AGCgct 0 0 Af III Cttaag 0 0 HC FR3 Asein GGcgcgcc 0 0 after LC BsiWI Cgtacg 0 0 BspDI ATcgat 0 0 BssHII Gcgcgc 0 0 Fsel GGCCGGcc 0 0 Hpal GTTaac 0 0 Nhel Gctagc 0 0 HC Linking Element Notch Gcggccgc 0 0 On linker, HC / anchor NruI TCGcga 0 0 Ns i I ATGCAt 0 0 PacI TTAATtaa 0 0 Pcil Acatgt 0 0 Pmel GTTTaaac 0 0 Pvul CGATcg 0 0 Rsrll CGgwccg 0 0 SapI gaagagc 0 0 Sfil GGCCIJNNNnggcc 0 0 signal sequence HC Sgf I GCGATc gc 0 0 144

Enzyme

Recognition

Nch

Ns

Planned location location

SwaI ATTTaaat 0 Ac 11 AAcgtt 1 Agel Accggt 1 Assay ATtaat 1 Avrll Cctagg 1 BsrBI GAGcgg 1 BsrBI GAGcgg 1 BsrDI GCAATGNNn 1 Dral TTTaaa 1 FspI TGCgca 1 HindiII Aagctt 1 Mfel Caattg 1 Nael GCCggc 1 NgoMI Gccggc 1 Spel Actagt 1 Acc65I Ggtacc 2 BstBI TTCGAA 2 KpnI GGTACc 2 Mlu Acgcgt two NcoI CCATGG 2 NdeI CATATG 2 Pml I CACGTG 2 XcmI CCANNNNNnnnntgg Bcgl cgannnnnntgc 3 Bell Tgatca three Bgl I GCCNNNNnggc 3 BsaBI GATNNnnatc 3 BsrGI Tgtaca 3 SnaBI TACGTA 3 Sse8387I CCTGCAgg 3 ApaLI Gtgcac 4 BspHI Tcatga 4 BssSI Ctcgtg 4 Psil TTAtaa 4 Sphl GCATGc 4 Ahdl GACNNNnngtc 5 BspEI Tccgga 5 MscI T GGc ca 5 Saci GAGCTc 5 Seal AGTact 5 HC FRl

In signal sequence HC HC FR4

LC / FRl HC FRl signal 5

Enzyme

Recognition

Nch

Ns

Planned location location

SexAI Accwggt 5 6 SspI AAT att 5 5 Tlil Ctcgag 5 5 Xhol Ctcgag 5 5 Bbs I GAAGAC 7 8 BstAPI GCANNNNntgc 7 8 BstZ17I GTAtac 7 7 EcoRV GAT at c 7 7 EcoRI Gaattc 8 8 BlpI GCtnagc 9 9 Bsu36I CCtnagg 9 9 DralII CACNNNgtg 9 9 EspI GCtnagc 9 9 StuI AGGcct 9 13 Xbal Tctaga 9 9 HC FR3 Bspl20l Gggccc 10 11 CHI Apal GGGCCc 10 11 CHI PspOOMI Gggccc 10 11 BciVI GTATCCNNNNNN 11 11 Sall Gtcgac 11 12 Drd GACNNNNnngtc 12 12 Kasl Ggcgcc 12 12 Xmal Cccggg 12 14 BglII Agatct 14 14 HincII GTYrac 16 18 BamHI Ggatcc 17 17 PF 1MI CCANNNNget 17 18 BsmBI Nnnnnngagacg 18 21 BstXI CCANNNNNggg 18 19 HC FR2 Xmnl GAANNnnttc 18 18 Saci I CCGCgg 19 19 Pst I CTGCAg 20 24 PvuII CAGctg 20 22 Aval Cycgrg 21 24 EagI Cggccg 21 22 Aatll GACGTc 22 22 BspMI ACCTGC 27 33 Ac cl GTmkac 30 43 Styl Ccwwgg 36 49 AlwNI CAGNNNctg 38 44 146

Enzyme Acknowledgment * Nch Ns Planned position of lg Bsal GGTCTCNnnnn 38 44 PpuMI RGgwccy 43 46 Bsgl GTGCAG 44 54 BseRI NNnnnnnnnnctcctc 48 60 Ecil nnnnncccccc 52 57 BstEII Ggtnacc 54 61 HC Fr4, 47/79 have an EcoO109I RGgnccy 54 86 Bpml ctccag 60 121 Avall Ggwcc 71 140

Table 21: MALIA3, annotated! 9532 bases of MALIA3 1 aat act gct act att agt aga att gat gcc acc ttt tca gct cgc gcc gene ii continue 49 cca aat gaa aat ata gct aaa cag gtt att gac cat ttg cga aat gta 97 tct aat ggt caa act aaa tct act cgt tcg cag aat tgg gaa tca act 145 gtt aca tgg aat gaa act tcc aga cac cgt act tta gtt gca tat tta 193 aaa cat gtt gag cta cag cag att cag caa tta age tct aag cca 241 tcc gca aaa atg acc tct tat caa aag gag caa tta aag gta ctc tct 289 aac cct g tt g gt ttt gct tcc ggt ctg gtt cgc ttt gaa gct 337 cga att aaa acg cga tat ttg aag tct ttc ggg ctt cct ctt aat ctt 385 ttt gat gca till cgc ttt gct tct gac tat aat agt cag ggt aaa gac 433 ctg att ttt gat tta tgg tca ttc tcg ttt tct gaa ctg ttt aaa gca 481 ttt gag ggg gat tca ATG aat att tat gac gat tcc gca gta ttg gac RBS? • Gene start X, ii continues 529 gct until cag tct aaa cat ttt act att acc ccc tct ggc aaa act tct 577 ttt gca aaa gcc tct cgc tat ttt ggt ttt tat cgt cgt gtg gta aac 625 gag ggt tat gat agt gtt gct ctt act atg cct cgt aat tcc ttt tgg 673 cgt tat gta tct gca tta gtt gaa tgt ggt att cct aaa tct caa ctg 721 atg aat ctt tct acc tgt aat aat gtt gtt ccg tta gtt cgt ttt att 769 aac gta gat ttt tct tcc caa cgt cct gac tgg tat aat gag cca gtt 817 ctt aaa gca TAA End of X ii II 832 ggtaattca ca Ml E5 Q10 T15 843 ATG att aaa gtt gaa att aaa cca tct caa gcc caa ttt act act cgt

V 147 gene onset

I S17 891 tct ggt S20 P25 E30 891 tct ggt gtt tct cgt cag ggc aag cct tat tca ctg aat gag cag ctt V35 E40 V45 939 tgt t gt gt gt gt tg gt tg gt tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg tg gat gaa ggt cag cca gcc tat gct cct ggt cTG TAC Acc gtt cat BsrGI ... L55 V70 S75 R80 1035 ctg tcc tct tta aaa gtt ggt cag ttc ggt tcc ctt atg att gac cgt

P85 K87 End of V

1083 ctg cgc ctc gtt ccg gct aag TAA C

1108 ATG gag cag gtc gcg gat ttc gac aca att tat cag gcg atg Gene VII 1150 beginning ata tcc gtt gta ctt tgt ttc gcg ctt ggt ata up to VII and IX superimposed. ..... S2 V3 L4 V5 S10 1192 gct ggg ggt caa agA TGA gt gtt tta gtg tat tct ttc gcc tct ttc gtt

End of VIII | Start of IX L13 W15 G20 T25 E29 1242 tta ggt tgg tgc ctt cgt agt ggc att acg tat ttt acc cgt tta atg gaa 1393 act tcc tc .... stop of IX. IX and VIII overlaid by four bases 1301 ATG aaa aag tct tta gtc ctc aaa gcc tct gta gcc gtt gct acc ctc Beginning of the signal sequence of viii. 1349 gtt ccg atg ctg tct ttc gct gct gg ggt gac gat ccc gea aaa gcg mature VIII ---> 1397 gcc ttt aac tcc ctg caa gcc tea gcg acc gaa tat ggt tat gcg 1445 tgg gcg atg gtt gtt gtc att 1466 gtc ggc gea act ggt aag ctg ttt aag 1499 aaa ttc acc teg aaa gea! 1515 .............. -35 148

I 1517 age tga taaaccgat acaattaaag gctccttttg ..... -10 ... 1552 gagccttttt ttttGGAGAt ttt! S.D. underscore <------ Signal Sequence III ------------------------------------ &gt; MKKLLFAIPLV 1575 caac GTG aaa aaa tta tta ttc gea att cct tta gtt! 1611

VPFYSHSAQ 1612 gtt cct ttc tat tet cac aGT geA Cag TCT

ApaLI ... 1642 GTC GTG ACG CAG CCG CCC TCA GTG TCT GGG GCC CCA GGG CAG AGG GTC ACC ATC TCC TGC ACT GGG AGC AGC TCC AAC ATC GGG GCA BstEII .. 1729 GGT TAT GAT GTA CAC TGG TAC CAG CAG CTT CCA GGA ACA GCC CCC AAA 1777 CTC CTC ATC TAT GGT AAC AGC AAT CGG CCC TCA GGG GTC CCT GAC CGA 1825 TTC TCG GGC TCC AAG TCT GGC ACC TCA GCC TCC CTG GCC ATC ACT 1870 GGG CTC CAG GCT GAG GAT GAT GCT GAT TAT 1900 TAC TGC CAG TCC TAT GAC AGC AGC CTG AGT 1930 GGC CTT TAT GTC TTC GGA ACT GGG ACC AAG GTC ACC GTC BstEII .. 196 9 CTA GGT CAG CCC AAG GCC AAC CCC ACT GTC ACT 2002 CTG TTC CCG CCC TCC TCT GAG GAG CTC CAA GCC AAC AAG GCC AGA CTA 2050 GTG TGT CTG ATC AGT GAC TTC TAC CCG GGA GCT GTG ACA GTG GCC TGG 2098 AAG GCA GAT AGC AGC CCC GTC AAG GCG GGA GTG GAG ACC ACC ACA CCC 2146 TCC AAA CAA AGC AAC AAC AAG TAC GCG GCC AGC AGC TAT CTG AGC CTG 2194 ACG CCG GAG CAG TGG AAG TCC CAC AGA AGC TAC AGC TGC CAG GTC ACG 2242 CAT GAA GGG AGC ACC GTG GAG AAG ACA GTG GCC CCT ACA GAA TGT TCA 2290 TAA TAA ACCG CCTCCACCGG GCGCGCCAAT TCTATTTCAA GGAGACAGTC ATA Asep .. PelB signal - - &gt; M K Y L L P L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L

Sfil

NgoMI ... (1/2)

Ncol ......... FR1 (DP47 / V3-23) --------------- 23 24 25 26 27 28 29 30

EVQLLESG 2409 gaa | gtt | CAA | TTG | tta | gag | tct | ggt |

| Mfei I __________________ FR1 -------------------------------------------- 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 2433 qGLVQPGGSLRLSCA Iggc | ggtIctt | gtt | cag | cct | ggt | ggt | tct | tta | cgt | ctt | tct | tgc | gct | __________ FR1 --------------- &gt; | . . . CDR1 ............ | --- FR2 ----- 46 47 48 49 50 51 52 53 54 55 56 57 58 58 60 2478 asgftfssyamswvr | gct | TCC | GGA | ttc | act | ttc | tct | tCG | TAC | Gct | atg | tct | tgg | gtt | cgC | | BspEI | | BsiWI | | BstXI. _______________ FR2 ---------------------------- &gt; I. . . CDR2 ......... 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 2523 qAPGKGLEWVSAI SG | CAa | gct | ccT | GGt | aaa | ggt | ttg | gag | tgg | gtt | tct | gct | ate | tct | ggt | .BstXI | . . . . CDR2 ........................................... I --- FR3- - 2568 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 SGGSTYYADSVKGRF tct | ggt | ggc | agt | act | tac | tat | gct | gac | tcc | gtt | aaa | ggt | ege | ttc -------------- FR3 ---------------------------------- ---------- 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 2613 TI SRDNSKNTLYLQM | act | ate | TCT | AGA | gac | aac | tact | aag | aat | act | etc | tac | ttg | cag | atg | I Xbal | ---- FR3 --------------------------------------------- ---------- &gt; | 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 150

I I 2658 NSLRAEDTAVYYCAK aac | agC | TTA | AGg | gct | gag | gac | aCT | GCA | Gtc | tac | tat | tgc | gct | aaa |

AfIII II PstI I ...... CDR3 ....................... --- --- FR4 ----------- ------------- 121 122 123 124 125 126 127 128 128 130 131 132 133 134 135 DYEGTGYAFDIWGQG 2703 | gac | tat | gaa | ggt | act | ggt | tat | gct | ttc | gaC | ATA | TGg | ggt | caa | ggt | | Ndel | (1/4)! ---------------- FR3 ----------- &gt; ! 136 137 138 139 140 141 142

! T Μ V T V S S 2748 | act | atG | GTC | ACC | gtc | tct | agt! | BstEII | ! From the BstEII front, pV323 is the same as PCEs, except as noted, the BstEII sites may occur in light chains; not as being unique in the final vector i i! 143 144 145 146 147 148 149 150 151 152

! ASTKGPSVFP 2769 gcc tcc acc aaG GGC CCa tcg GTC TTC ccc! Bspl20I. Bbsl ... (2/2)! Apal .... 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 L A P S S S S S G G T A A L 2799 ctg gca ccC Tcc TCc aag age acc tct ggg ggc aca gcg gcc ctg

BseRI ... (2/2) 168 16 9 170 171 172 173 174 175 176 177 178 179 180 181 182 G C L V K D Y F P E P T V S 2844 ggc tgc ctg GTC AAG GAC TAC TTC CCc GAG CCG GTg acg gtg tcg

Agel ... 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 w N G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G

Kasl ... (1/4) 151 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 VLQSSGLYSLSSVVT 2934 gtc cta cct tct age GGA ctc tact cc ctc age age gta gtg acc (Bsu36I ..) (destroyed ) 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 VPSSSLGTQTTICNV 2979 gtg ccC tct tct age tTG Ggc acc cg acc tac tt tgc aac gtg (BstXI .. - •) NB destruction of the BstXi &amp; 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 NHKPSNTKVDKKVEP 3024 aat cac aag ccc age aac acc aag gtg gac aag aaa gtt gag ccc 243 244 245 KSCAAAHHHHHHSA 3069 aaa tct tgt GCG GCC GCt cat cac cac cat cat cac tct gt; gt; g &lt; / RTI &gt; &gt; &gt; &gt; g &gt; .. Kasl .. ·

EcoRV .. AETVESCLA 3183 gct gaa act gtt gaa agt tgt tta gca KPHTEISF 3210 aaa ccc cat aca gaa aat tca ttt TNVWKDDKT 3234 aCT AAC GTC TGG AAA GAC GAC AAA Act

LDRYANYEGCLWNATGV 152 3261 tta gat cgt tac gct aac tat gag ggt tgt ctg tgG AAT GCt aca ggg gtt

BsnI_ vvctgdetqcygtwvpi 3312 gta gtt tgt act ggt GASC GAA ACT CAG TGT TAC GGT ACA TGG GTT cct att

GLAIPEN 3363 ggg ctt gct act cct gaa aat binding element: Dl - EGGGSEGGGS 3384 gag ggt ggt ggt tct ggt ggt ggt tct EGGG s EGGGT 3414 gag ggt ggt ggt tg gag ggt ggc ggt act Domain 2 - - 3444 aaa cct cct gag tac ggt gat aca cct att ccg ggc tat act tat aac 3495 cct ctc gac ggc act tat ccg cct ggt act gag caa aac ccc gct aat cct 3546 aat ctc tct ctt GAG GAG tct cag cct ctt aat act ttc atg ttt cag aat BseRI 3597 aat agg ttc cga aat agg cag ggg gca tta act gtt tat acg ggc act 3645 gtt act caa ggc act gac ccc gtt aaa act tat tac cag tac act cct 3693 gta tca aaa gcc atg tat gac gct tac tgg aac ggt aaa ttc AGA AlwNI 3741 GAC TGc gct ttc cat tct ggc ttt aat gaa gat cca ttc gtt tgt gaa AlwNI 3789 tat caa ggc caa tcg tct gac ctg cct ca. acct cct gtc aat gct 3834 ggc ggc ggc tct Start of Lλ - 3846 ggt ggt ggt tct 3858 ggt ggt ggt tct 3870 gg ggt ggt ggt ggt ggt ggt ggt tct 3900 gg ggt ggt ggc tct gag ggt ggc ggt tct 3930 ggt ggt ggt tct ggt 1 End of L2

Domain 3 --------

SGDFDYEKMANANKGA 3945 tcc gat ttt gat tat gaa aag atg gca aac gct aat aag ggg gct 153 MTENADENALQSDAKG 3993 atg acc gaa aat gcc gat gaa aac gcg cta cg tct gac gct gat aaa ggc KLDSVATDYGAAIDGF 4041 aaa ctt gat tct gtc gct act gat tac ggt gct gct gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt ggt ggt ggt ggt ggt ggt ggt ggt ggt ggt ggt ggt ggt gat gat gat gat gat gat gat gat aat SPLMNNFRQYLPSLPQ 4185 tca cct tta atg aat aat ttc agt cata tat tta cct tcc ctc cct caa SVECRPFVFSAGKPYE 4233 tcg gtt gaa tgt cgc cct ttt gtc ttt age gct ggt cLclcL cca tat gaa FSIDCDKINLFR 4281 ttt tct att gat tgt gac aaa ata aac tta ttc cgt Domain Name 3 GVFAFLLYVATFMY v: F140 4317 ggt gtc ttt gcg ttt ctt tta tat gtt gcc acc ttt atg tat gta ttt beginning i of the transmembrane segment s TFA N I L 4365 tct acg ttt gct aac ata ctg R N K E S 4386 cgt aat aag gag tct TAA! Intracellular anchor

Ml P2 VL L5 GIPL LIO LRFL G15 4404 tc ATG cca gtt ctt ttg ggt att ccg tta tta ttg cgt ttc ctc ggt Start of VI 4451 ttc ctt ctg gta act ttg ttc ggc tat ctg ctt act ttt ctt aaa aag 4499 ggc ttc ggt aag ata gct att gct att tct ttg ttt ctt gtt ctt att 4547 att ggg ctt aac tca att ctt gtg ggt tat ctc tct gat att age gct 4595 caa tta ccc tct gac ttt gtt cag ggt gtt cag tta att ctc ccg tct 4643 aat gcg ctt ccc tgt ttt tat gtt att ctc tct gta aag gct gct att 154 ttc att ttt gac gtt aaa caa aaa gtt tet tat ttg gat tgg gat

M1 A2 V3 F5 LIO G13

aaa TAA t ATG gct gtt tat ttt gta act gee aaa tta ggc tet gga End of VI Start of gene I 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 KTLVSVGKIQDKIVA aag acg etc gtt age gtt gag aag att cag gat aaa att gta gct 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 GCKIATNLDLRLQNL ggg tgc aaa ata gea act aat ctt gat tta agg ctt caa aac etc 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 PQVGRFAKTPRVLRI ccg caa gtc ggg agg ttc gct aaa acg cct ege gtt ctt aga ata 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 PDKPSISDLLAIGRG ccg gat aag cct tet ata tet gat ttg Ctt gct att ggg ege ggt 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 NDSYDENKNGLLVLD aat gat tcc tac gat gaa aat aaa aac ggc ttg ctt gtt etc gat 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 ECGTWFNTRSWNDKE gag tgc gtg act tgg ttt aat acc cgt tet tgg aat gat aag gaa 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 RQPIIDWFL H A R K L G a. cag ccg att att gat tgg 'ttt cta. cat gct cgt aaa tta gga 119 120 121 122 123 124 125 126 126 128 129 130 131 132 133 WDIIFLVQDLSIVDK tgg gat att att ttt ctt gtt cag gac tta tet att gtt gat aaa 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 QARSALAEHVVYCRR cg gcg gct tet gea tta gct gaa cat gtt gtt tat tgt cgt cgt 155

I

149 150 151 152 153 154 15 5 156 157 158 159 160 161 162 163 LDRITLPFVGTLYSL 5190 ctg gac aga att act tta cct ttt gtc ggt act tta tat tct Ctt 164 165 166 167 168 16 9 170 171 172 173 174 175 176 177 178 ITGSKMPLPKLHVGV 5235 att act ggc tcg aaa atg cct ctg cct aaa tta cat gtt ggc gtt 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 VKYGDSQLSPTVERW 5280 gtt aaa tat ggc gat tct caa tta age cct act gtt gag cgt tgg 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 LYTGKNLYNAYDTKQ 5325 ctt tat act ggt aag aat ttg tat aac gea tat gat act aaa cag 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 AFSSNYDSGVYSYLT 5370 gct ttt tct agat aat tat gat tcc ggt gtt tat tct tat tta acg 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 PYLSHGRYFKPLNLG 5415 cct tat tca cca ggt cgg tat ttc aaa cca tta aat tta ggt 239 240 241 242 243 244 245 246 247 24 8 249 250 251 252 253 QKMKLTKIYLKKFSR 5460 cag aag aaa tta act aaa ata tat ttg aaa aag ttt tct cgc 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 VLCLAIGFASFTYS 5505 gtt ctt tgt ctt gcg att gga ttt gea tca gea ttt aca tat agt 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 YITQPKPEVKKVVSQ 5550 tat ata acc ca. acct aag ccg gag gtt aaa aag gta gtc tct cag 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 TYDFDKFTIDSSQRL 5595 acc tat gat ttt gat aaa ttc act att gac tct tct cag cgt ctt 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 NLSYRYVFKDSKGKL 156 5640 aat cta age tat tat gtt ttc aag gat tet aag gga aaa TTA PacI 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 INSDDLQKQGYSLTY ATT AAT age gac gat tta cag aac caa ggt tat tea etc. here tat

PacI 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 i IDLCTVSIKKGGNSNE iv Ml K 5730 att gat tta tgt act gtt tcc att aaa aaa ggt aat tea aAT Gaa i nicio IV IV 344 345 346 347 348 349 i IVKCN. End of I iv L3 L N5 V 17 NF VI0 5775 att gtt aaa tgt aat TAA 1 'TTT' GTT IV continues 5800 ttc ttg atg ttt gtt tea tet tet ttt gct cg gta att gaa atg 5848 aat aat teg cct ctg ege gat ttt gta act tgg tat tea aag caa tea 5896 ggc gaa tcc gtt att gtt tet ccc gat gta aaa ggt act gtt act gta 5944 tat tea tet gac gtt aaa cct gaa aat cta ege aat ttc ttt att tet 5992 gtt tta cgt gct aat aat ttc gat atg gtt ggt tea att cct tcc ata 6040 att cag aag tat aat cca aat cag gat tat att gat gaa ttg cca 6088 tea tet gat aat cag gaa tat gat aat tcc gct cct tet ggt ggt 6136 ttc ttt gtt ccg caa aat gat aat gtt act caa act ttt aa att aat 6184 aac gtt cgg gea aag gat tta ata cga gtt gtc gaa ttg ttt gta aag 6232 tet aat act tet aaa tcc tea aat gta tta tet att gac ggc tet aat 6280 cta tta gtt gtt TCT gea cct aaa gat att tta gat aac ctt cct caa ApaLI removed 6328 ttc ctt tet act gtt gat ttg cca act gac cag ata ttg att gag ggt 6376 ttg ata ttt gag gtt cag caa ggt gat gct tta gat ttt tea ttt gct 6424 gct ggc tet cag cgt ggc act gtt gea ggc ggt gtt aat act gac ege 6472 etc. acc tet gtt tta tet tet gct ggt ggt tg gt gt gt gt gt gt gt gt gt tg gt gt gt gt gt gt gt gt gt gt gt gt gtg gt gt gt gt gt gt gt gt gt gt gt gt gt gt gtg gtg gtT GGC CAg at gtc cct ttt att act ggt cgt i gtg MscI 6664 act ggt gaa tet gee aat gta aat cca ttt cag acg att gag cgt 6712 caa aat gta gt att att tcc atg age gtt ttt cct gtt gea atg gct ggc 6760 ggt aat att gtt ctg gat att acc age aag gee gt agt ttg agt tet 157 6808 6856 6904 6952 7000 7048 7060 7120 7180 7240 7300 7360 7420 7480 7540 tc t act cag gca agt gat gtt att act aat caa aa agt att gct aca acg gtt aat ttg cgt gat gga cag act ctt tta ctc ggt ggc ctc act gat tat aaa aac act tct caa gat tct ggc gta ccg ttc ctg tct aaa till cct tta ggc ctc ctg ttt age tcc ege tct gat tcc aac gag gaa age acg tta tac gtg ctc gtc aaa gca acc ata gta ege gee ctg

TAG cggcgcatt End of IV aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca gcgccctagc gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcGCCGGCt tccccgtca

NgoMI_ agctctaaat cgggggctcc ctttagggtt ccgatttagt gctttacggc acctcgaccc caaaaaactt gatttgggtg atggttCACG TAGTGggcca tcgccctgat agacggtttt

DralII_ tcgccctttG ACGTTGGAGT Ccacgttctt taatagtgga ctcttgttcc aaactggaac DrdI_ gggattttgc cgatttcgga gcgtggaccg cttgctgcaa cCGTCTCact ggtgaaaaga aacactcaac cctatctcgg gctattcttt tgatttataa accaccatca aacaggattt tcgcctgctg gggcaaacca ctctctcagg gccaggcggt gaagggcaat CAGCTGttgc

PvuII. BsmBI.

aaaaccaccc tGGATCC AAGCTT

BamHI HindIII ()

Insert gene carrier bla 7563 gcaggtg gcacttttcg gggaaatgtg cgcggaaccc 7600 ctatttgttt atttttctaa atacattcaa atatGTATCC gctcatgaga caataaccct

BeiVI 7660 gataaatgct tcaataatat tgaaaaAGGA AGAgt RBS.?. . . start of gene bla 7695 ATG agt att caa cat ttc cgt gtc gee ctt att ccc ttt ttt gcg gca ttt 7746 tgc ctt cct gtt ttt gct cac cca gaa acg ctg aaa gta aaa gat gct 7797 gaa gat cag ttg ggC gCA CGA gtg ggt tac until gaa ctg gat ctc aac age BssSI. • ApaLI removed 7848 ggt aag to ctt gag agt ttt ege ccc gaa gaa cgt ttt cca atg atg age 7899 act ttt aaa gtt ctg cta tgt cat aca cta tta tcc cgt att gac gee ggg 7950 caa gaG CAA CTC GGT CGc cgg gcg cgg tat tct cag aat gac ttg gtt gag BegI Sca 8001 TAC Tea cca gtc aca gaa aag cat ctt acg gat ggc atg aca gta aga gaa Scal_ 8052 tta tgc agt gct gee ata acc atg agt gat aac act gcg gee aac tta ctt 158 8103 ctg aca aCG AC (gga ccg aag t gg cta gct ttt ttg <cac aac atg Pvul 8154 ggg gat cat gta act cgc ctt gat cgt tgg gaa ccg gag ctg aat gaa gee 8205 ata cca aac gac gag cgt gac acc acg atg cct gta gac atg cca aca acg 8256 tTG CGC Aaa cta tta act ggc gaa cta cta act cta gct tcc cgg caa caa FspI - 8307 tta ata gac tgg atg gag gcg gat aaa gtt gega gca cca ctt ctg cgc teg 8358 GCC ctt ccG GCt ggc tgg ttt att gct gat aaa tet gga gee ggt gag cgt Bgl I 8409 gGG TCT Cgc ggt att att gea cg ggg cca gat ggt aag ccc tcc cgt Bs 8460 to gta gtt gt gt gt gt ctg att aag cat tgg TAA ctgt stop 8560 cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 8620 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 8680 cgttccactg tacgtaagac cccc 8704 AAGCTT GTCAC tgaa tggcgaatgg cgctttgcct

HinflII Sall ..

(2/2) 8740 HincII ggtttccggc accagaagcg gtgccggaaa gctggctgga gtgcgatctt CCTGAGG Bsu36I_ 8790 8797 8832 ccgat actgtcgtcg tcccctcaaa ctggcagatg cacggttacg atgcgcccat ctacaccaac gtaacctatc ccattacggt caatccgccg 8892 tttgttccca cggagaatcc gacgggttgt tactcgctca catttaatgt tgatgaaagc 8952 tggctacagg aaggccagac gcgaattatt tttgatggcg ttcctattgg ttaaaaaatg

9012 agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaATTTAAA

SwaI ... 9072 Tatttgctta tacaatcttc ctgtttttgg ggcttttctg attatcaacc GGGGTAcat RBS? 9131 ATG att gac atg cta gtt tta cga tta ccg ttc at gat tet ctt gtt tgc start i of gene II 9182 tcc aga etc tea ggc aat gac ctg ata gee ttt gtA GAT CTc tea aaa ata Bgl 11 9233 gct acc etc tcc ggc atg aat tta tea gct aga acg gtt gaa tat cat att 9284 gat ggt gat ttg act gtc tcc ggc ctt tet cac cct ttt gaa tet tta cct 9335 aca cat tact ca ggc att gea ttt aaa ata tat gag ggt tet aaa aat tt 159 ι 9386 tat cct tgc 9437 aat gtt ttt 9488 aat ttt gct gene II continues gtt gaa ata aag gct tct ccc ggt aca acc gat tta tgc tct aat tct ttg cct tgc ctg tat gca aaa aaa gag gct gat tta gta tta ttg tta ttg gat cag ggt cat ctt gtt! 9532

Table 21 B: Sequence of MALIA3, condensed LOCAL MALIA3 9532 CIRCULAR

SOURCE

1 AATGCTACTA CTATTAGTAG AATTGATGCC ACCTTTTCAG CTCGCGCCCC AAATGAAAAT 61 ATAGCTAAAC AGGTTATTGA CCATTTGCGA AATGTATCTA ATGGTCAAAC TAAATCTACT 121 CGTTCGCAGA ATTGGGAATC AACTGTTACA TGGAATGAAA CTTCCAGACA CCGTACTTTA 181 GTTGCATATT TAAAACATGT TGAGCTAGAG CACCAGATTC AGCAAT TAAG CTCTAAGCCA 241 TCCGCAAAAA TGACCTCTTA TCAAAAGGAG CAATTAAAGG TACTCTCTAA TCCTGACCTG 361 TCTTTCGGGC TTCCTCTTAA TCTTTTTGAT GCAATCCGCT TTGCTTCTGA CTATAATAGT 421 CAGGTAAAG ACCTGATTTT TGATTTATGG TCATTCTCGT TTTCTGAACT GTTTAAGCA 481 TTTGAGGGGG ATTCAATGAA TATTTATGAC GATTCCGCAG TATTGGACGC TATCCAGTCT 541 AAACATTTTA CTATTACCCC CTCTGGCAAA ACTTCTTTTG CAAAAGCCTC TCGCTATTTT 601 GGTTTTTATC GTCGTCTGGT AAACGAGGGT TATGATAGTG TTGCTCTTAC TATGCCTCGT 661 AATTCCTTTT GGCGTTATGT ATCTGCATTA GTTGAATGTG GTATTCCTAA ATCTCAACTG 721 ATGAATCTTT CTACCTGTAA TAATGTTGTT CCGTTAGTTC GTTTTATTAA CGTAGATTTT 781 TCTTCCCAAC GTCCTGACTG GTATAATGAG CCAGTTCTTA AAATCGCATA AGGTAATTCA 841 CAATGATTAA AGTTGAAATT AAACCATCTC AAGCCCAATT TACTACTCGT TCTGGTGTTT 901 CTCGTC AGGG CAAGCCTTAT TCACTGAATG AGCAGCTTTG TTACGTTGAT TTGGGTAATG 961 AATATCCGGT TCTTGTCAAG ATTACTCTTG ATGAAGGTCA GCCAGCCTAT GCGCCTGGTC 1021 TGTACACCGT TCATCTGTCC TCTTTCAAAG TTGGTCAGTT CGGTTCCCTT ATGATTGACC 1081 GTCTGCGCCT CGTTCCGGCT AAGTAACATG GAGCAGGTCG CGGATTTCGA CACAATTTAT 1141 CAGGCGATGA TACAAATCTC CGTTGTACTT TGTTTCGCGC TTGGTATAAT CGCTGGGGGT 1201 CAAAGATGAG TGTTTTAGTG TATTCTTTCG CCTCTTTCGT TTTAGGTTGG TGCCTTCGTA 1261 GTGGCATTAC GTATTTTACC CGTTTAATGG AAACTTCCTC ATGAAAAGT CTTTAGTCCT 1321 CAAAGCCTCT GTAGCCGTTG CTACCCTCGT TCCGATGCTG TCTTTCGTG CTGAGGGTGA 1381 CGATCCCGCA AAAGCGGCCT TTAACTCCCT GCAAGCCTCA GCGACCGAAT ATATCGGTTA 1441 TGCGTGGGCG ATGGTTGTTG TCATTGTCGG CGCAACTATC GGTATCAAGC TGTTTAAGAA 1501 ATTCACCTCG AAAGCAAGCT GATAAACCGA TACAATTAAA GGCTCCTTTT GGAGCCTTTT 1561 TTTTTGGAGA TTTTCAACGT GAAAAAATTA TTATTCGCAA TTCCTTTAGT TGTTCCTTTC 1621 TATTCTCACA GTGCACAGTC TGTCGTGACG CAGCCGCCCT CAGTGTCTGG GGCCCCAGGG 1681 CAGAGGGTCA CCATCTCCTG CACTGGGAGC AGCTCCAACA TCGGGGCAGG 1741 C TTATGATGTA ACTGGTACC AGCAGCTTCC AGGAACAGCC CCCAAACTCC TCATCTATGG TAACAGCAAT 1801 CGGCCCTCAG GGGTCCCTGA CCGATTCTCT GGCTCCAAGT CTGGCACCTC AGCCTCCCTG 1861 GCCATCACTG GGCTCCAGGC TGAGGATGAG GCTGATTATT ACTGCCAGTC CTATGACAGC 160

1921 AGCCTGAGTC GCCTTTATGT CTTCGGAACT GGGACCAAGG TCACCGTCCT AGGTCAGCCC 1981 AAGGCCAACC CCACTGTCAC TCTGTTCCCG CCCTCCTCTG AGGAGCTCAA AGCCAACAAG 2041 GCCACACTAG TGTGTCTGAT CAGTGACTTC TACCCGGGAG CTGTGACAGT GGCCTGGAAG 2101 GCAGATAGCA GCCCCGTCAA GGCGGGAGTG GAGACCACCA CACCCTCCAA ACAAAGCAAC 2161 AACAAGTACG CGGCCAGCAG CTATCTGAGC CTGACGCCTG AGCAGTGGAA GTCCCACAGA 2221 AGCTACAGCT GCCAGGTCAC GCATGAAGGG AGCACCGTGG AGAAGACAGT GGCCCCTACA 2281 GAATGTTCAT AATAAACCGC CTCCACCGGG CGCGCCAATT CTATTTCAAG GAGACAGTCA 2341 TAATGAAATA CCTATTGCCT ACGGCAGCCG CTGGATTGTT ATTACTCGCG GCCCAGCCGG 2401 CCATGGCCGA AGTTCAATTG TTAGAGTCTG GTGGCGGTCT TGTTCAGCCT GGTGGTTCTT 2461 TACGTCTTTC TTGCGCTGCT TCCGGATTCA CTTTCTCTTC GTACGCTATG TCTTGGGTTC 2521 GCCAAGCTCC TGGTAAGGT TTGGAGTGGG TTTCTGCTAT CTCTGGTTCT GGTGGCAGTA 2581 CTTACTATGC TGACTCCGTT AAAGGTCGCT TCACTATCTC TAGAGACAAC TCTAAGAATA 2641 CTCTCTACTT GCAGATGAAC AGCTTAAGGG CTGAGGACAC TGCAGTCTAC TATTGCGCTA 2701 AAGACTATGA AGGTACTGGT TATGCTTTCG ACATATGGGG TCAAGGTACT ATGGT CACCG 2761 TCTCTAGTGC CTCCACCAAG GGCCCATCGG CTTCCCCCT GGCACCCTCC TCCAAGAGCA 2821 CCTCTGGGGG CACAGCGGCC CTGGGCTGCC TGGTCAAGGA CTACTTCCCC GAACCGGTGA 2881 CGGTGTCGTG GAACTCAGGC GCCCTGACCA GCGGCGTCCA CACCTTCCCG GCTGTCCTAC 2941 AGTCTAGCGG ACTCTACTCC CTCAGCAGCG TAGTGACCGT GCCCTCTTCT AGCTTGGGCA 3001 CCCAGACCTA CATCTGCAAC GTGAATCACA AGCCCAGCAA CACCAAGGTG GACAAGAAAG 3061 TTGAGCCCAA ATCTTGTGCG GCCGCTCATC ACCACCATCA TCACTCTGCT GAACAAAAAC 3121 TCATCTCAGA AGAGGATCTG AATGGTGCCG CAGATATCAA CGATGATCGT ATGGCTGGCG 3181 CCGCTGAAAC TGTTGAAAGT TGTTTAGCAA AACCCCATAC AGAAAATTCA TTTACTAACG 3241 TCTGGAAAGA CGACAAAACT TTAGATCGTT ACGCTAACTA TGAGGGTTGT CTGTGGAATG 3301 CTACAGGCGT TGTAGTTGT ACTGGTGACG AAACTCAGTG TTACGGTACA TGGGTTCCTA 3361 TTGGGCTTGC TATCCCTGAA AATGAGGGTG GTGGCTCTGA GGGTGGCGGT TCTGAGGGTG 3421 GCGGTTCTGA GGGTGGCGGT ACTAAACCTC CTGAGTACGG TGATACACCT ATTCCGGGCT 3481 ATACTTATAT CAACCCTCTC GACGGCACTT ATCCGCCTGG TACTGAGCAA AACCCGCTA 3541 ATCCTAATCC TTCTCTTGAG GAGTCTCAGC CTCTTAATAC TTTCATGTT C AGAATAATA 3601 GGTTCCGAAA TAGGCAGGGG GCATTAACTG TTTATACGGG CACTGTTACT CAAGGACTG 3661 ACCCCGTTAA AACTTATTAC CAGTACACTC CTGTATCATC AAAAGCCATG TATGACGTT 3721 ACTGGAACGG TAAATTCAGA GACTGCGCTT TCCATTCTGG CTTTAATGAA GATCCATTCG 3781 TTTGTGAATA TCAAGGCCAA TCGTCTGACC TGCCTCAACC TCCTGTCAAT GCTGGCGGCG 3841 GCTCTGGTGG TGGTTCTGGT GGCGGCTCTG agggtggtgg ctctgagggt ggcggttctg 3901 AGGGTGGCGG CTCTGAGGGA GGCGGTTCCG GTGGTGGCTC TGGTTCCGGT GATTTTGATT 3961 ATGAAAAGAT GGCAAACGCT AATAAGGGGG CTATGACCGA AAATGCCGAT GAAAACGCGC 4021 TACAGTCTGA CGCTAAAGGC AAACTTGATT CTGTCGCTAC TGATTACGGT GCTGCTATCG 4081 ATGGTTTCAT TGGTGACGTT TCCGGCCTTG CTAATGGTAA TGGTGCTACT GGTGATTTTG 4141 CTGGCTCTAA TTCCCAAATG GCTCAAGTCG GTGACGGTGA TAATTCACCT TTAATGAATA 4201 ATTTCCGTCA ATATTTACCT TCCCTCCCTC AATCGGTTGA ATGTCGCCCT TTTGTCTTTA 4261 GCGCTGGTAA ACCATATGAA TTTTCTATGG ATTGTGACAA AATAAACTTA TTCCGTGGTG 4321 TCTTTGCGTT TCTTTTATAT GTTGCCACCT TTATGTATGT ATTTTCTACG TTTGCTAACA 161

TACTGCGTAA TAAGGAGTCT TAATCATGCC AGTTCTTTTG GGTATTCCGT TATTATTGCG TTTCCTCGGT TTCCTTCTGG TAACTTTGTT CGGCTATCTG CTTACTTTTC TTAAAAAGGG CTTCGGTAAG ATAGCTATTG CTATTTCATT GTTTCTTGCT CTTATTATTG GGCTTAACTC AATTCTTGTG GGTTATCTCT CTGATATTAG CGCTCAATTA CCCTCTCACT TTGTTCAGGG TGTTCAGTTA ATTCTCCCGT CTAATGCGCT TCCCTGTTTT TATGTTATTC TCTCTGTAAA GGCTGCTATT TTCATTTTTG ACGTTAAACA AAAAATCGTT TCTTATTTGG ATTGGGATAA ATAATATGGC TGTTTATTTT GTAACTGGCA AATTAGGCTC TGGAAAGACG CTCGTTAGCG TTGGTAAGAT TCAGGATAAA ATTGRAGCTG GGTGCAAAAT AGCAACTAAT CTTGATTTAA GGCTTCAAAA CCTCCCGCAA GTCGGGAGGT TCGCTAAAAC GCCTCGCGTT CTTAGAATAC CGGATAAGCC TTCTATATCT GATTTGCTTG CTATTGGGCG CGGTAATGAT TCCTACGATG AAAATAAAAA CGGCTTGCTT GTTCTCGATG AGTGCGGTAC TTGGTTTAAT ACCCGTTCTT GGAATGATAA GGAAAGACAG CCGATTATTG ATTGGTTTCT ACATGCTCGT AAATTAGGAT GGGATATTAT TTTTCTTGTT CAGGACTTAT CTATTGTTGA TAAACAGGCG CGTTCTGCAT TAGCTGAACA TGTTGTTTAT TGTCGTCGTC TGGACAGAAT TACTTTACCT TTTGTCGGTA CTTTATATTC TCTTATTACT GGCTCGAAAA TGCCTCTGCC TAAATTACAT GTTGGCG TTG TTAAATATGG CGATTCTCAA TTAAGCCCTA CTGTTGAGCG TTGGCTTTAT ACTGGTAAGA ATTTGTATAA CGCATATGAT ACTAAACAGG OTTTTTOTAG TAATTATGAT TCCGGTGTTT ATTCTTATTT AACGCCTTAT TTATCACACG GTCGGTATTT CAAACCATTA AATTTAGGTC AGAAGATGAA ATTAACTAAA ATATATTTGA AAAAGTTTTC TCGCGTTCTT TGTCTTGCGA TTGGATTTGC ATCAGCATTT ACATATAGTT ATATAACCCA ACCTAAGCCG GAGGTTAAAA AGGTAGTCTC TCAGACCTAT GATTTTGATA AATTCACTAT TGACTCTTCT CAGCGTCTTA ATCTAAGCTA TCGCTATGTT TTCAAGGATT CTAAGGGAAA ATTAATTAAT AGCGACGATT TACAGAAGCA AGGTTATTCA CTCACATATA TTGATTTATG TACTGTTTCC ATTAAAAAAG GTAATTCAAA TGAAATTGTT AAATGTAATT AATTTTGTTT TCTTGATGTT TGTTTCATCA TCTTCTTTTG CTCAGGTAAT TGAAATGAAT AATTCGCCTC TGCGCGATTT TGTAACTTGG TATTCAAAGC AATCAGGCGA ATCCGTTATT GTTTCTCCCG ATGTAAAAGG TACTGTTACT GTATATTCAT CTGACGTTAA ACCTGAAAAT CTACGCAATT TCTTTATTTC TGTTTACGT GCTAATAATT TTGATATGGT TGGTTCAATT CCTTCCATAA TTCAGAAGTA TAATCCAAAC AATCAGGATT ATATTGATGA ATTGCCATCA TCTGATAATC AGGAATATGA TGATAATTCC GCTCCTTCTG GTGGTTTCTT TGTTCCGCAA AATGATAATG TTACTCAAAC TTT TAAAATT AATAACGTTC GGGCAAAGGA TTTAATACGA GTTGTCGAAT TGTTTGTAAA GTCTAATACT TCTAAATCCT CAAATGTATT ATCTATTGAC GGCTCTAATC TATTAGTTGT TTCTGCACCT AAAGATATTT TAGATAACCT TCCTCAATTC CTTTCTACTG TTGATTTGCC AACTGACCAG ATATTGATTG AGGGTTTGAT ATTTGAGGTTCAGCAAGGTG ATGCTTTAGA TTTTTCATTT GCTGCTGGCT CTCAGCGTGG CACTGTTGCA GGCGGTGTTA ATACTGACCG CCTCACCTCT GTTTTATCTT CTGCTGGTGG TTCGTTCGGT ATTTTTAATG GCGATGTTTT AGGGCTATCA GTTCGCGCAT TAAAGACTAA TAGCCATTCA AAAATATTGT CTGTGCCACG TATTCTTACG CTTTCAGGTC AGAAGGGTTC TATCTCTGTT GGCCAGAATG TCCCTTTTAT TACTGGTCGT GTGACTGGTG AATCTGCCAA AGTAAATAAT CCATTTCAGA CGATTGAGCG TCAAAATGTA GGTATTTCCA TGAGCGTTTT TCCTGTTGCA ATGGCTGGCG GTAATATTGT TCTGGATATT ACCACCAAGG CCGATAGTTT GAGTTCTTCT ATCCAGGCAA GTGATGTTAT TACTAATCAA 162

AGAAGTATTG CTACAACGGT TAATTTGCGT GATGGACAGA CTCTTTTACT CGGTGGCCTC ACTGATTATA AAAACACTTC TCAAGATTCT GGCGTACCGT TCCTGTCTAA ATCCCTTTA ATCGGCCTCC TGTTTAGCTC CCGCTCTGAT TCCAACGAG AAAGCACGTT ATACGTGCTC

GTCAAAGCAA CATAGTACG CGCCCTGTAG CGGCGCATTA AGCGCGGCGG GTGTGGTGGT TACGCGCAGC GTGACCGCA CACTTGCCAG CGCCCTAGCG CCCGCTCCTT TCGTTCTT

CCCTTCCTTT CTCGCCACGT TCGCCGGCTT TCCCGTCAA GCTCTAAATC GGGGGCTCCC TTTAGGGTTC CGATTTAGTG CTTTACGGCA CCTCGACCCC AAAAAACTTG ATTTGGGTGA TGGTTCACGT AGTGGGCCAT CGCCCTGATA GACGGTTTTT CGCCCTTTGA CGTTGGAGTC CACGTTCTTT AATAGTGGAC TCTTGTTCCA AACTGAACA ACACTCAACC CTATCTCGGG CTATTCTTTT GATTTATAAG GGATTTTGCC GATTTCGGAA CCACCATCAA ACAGGATTTT CGCCTGCTGG GGCAAACCAG CGTGGACCGC TTGCTGCAAC TCTCTCAGGG CCAGGCGGTG AAGGGCAATC AGCTGTTGCC CGTCTCACTG GTGAAAAGAA AAACCACCCT GGATCCAAGC

TTGCCAGGTGG CACTTTTCGG GGAAATGTGC GCGGAACCCC TATTTGTTTA TTTTTCTAA

TACATTCAAA TATGTATCCG CTCATGAGAC AATAACCCTG ATAAATGCTT CAATAATATT GAAAAAGGAA GAGTATGAGT ATTCAACATT TCCGTGTCGC CCTTATTCCC TTTTTTGCGG CATTTTGCCT TCCTGTTTTT GCTCACCAG AAACGCTGGT GAAAGTAAAA GATGCTGAAG ATCAGTTGGG CGCACGAGTG GGTTACATCG AACTGGATCT CAACAGCGGT AAGATCCTTG AGAGTTTTCG CCCCGAAGAA CGTTTTCCAA TGATGAGCAC TTTTAAAGTT CTGCTAGTC ATACACTATT ATCCCGTATT GACGCCGGGC AAGAGCAACT CGGTCGCCGG GCGCGGTATT

CTAGAATGA CTTGGTTGAG TACTCACCAG TCACAGAA GCATCTTACG GATGGCATGA

GAGTAAGAGA ATTATGCAGT GCTGCCATAA CCATGAGTGA TAACACTGCG GCCAACTTAC TTCTGACAAC GATCGGAGGA CCGAAGGAGC TAACCGCTTT TTTGCACAAC ATGGGGGATC ATGTAACTCG CCTTGATCGT TGGGAACCGG AGCTGAATGA AGCCATACCA AACGACGAGC GTGACACCAC GATGCCTGTA GCAATGCCA CAACGTTGCG CAAACATTA ACTGGCGAAC TACTTACTCT AGCTTCCCGG CAACAATTAA TAGACTGGAT GGAGGCGGAT AAAGTTGCAG

GACCACTTCT GCGCTCGGC CTTCCGGCTG GCTGGTTTAT TGCTGATAA TCTGAAGCCG

GTGAGCGTGG GTCTCGCGGT ATCATTGCAG CACT GGGGCC AGATGTAAG CCCTCCCGTA TCGTAGTTAT CTACACGACG GGGAGTCAGG CAACTATGGA TGAACGAAAT AGACAGATCG CTGAGATAGG TGCCTCACTG ATTAGCATT GGTAACTGTC AGACCAAGTT TACTCATATA TACTTTAGAC TGATTTAAAA CTTCATTTTT AATTTAAAAG GATCTAGGTG AAGATCCTTT TTGATAATCT CATGACCAAA ATCCCTTAAC GTGAGTTTTC GTTCCACTGT ACGTAAGACC CCCAAGCTTG TCGACTGAAT GGCGAATGGC GCTTTGCCTG GTTTCCGGA CCAGAAGCGG

TGCCGGAAAG CTCGGCTGGAG TGCGATCTTC CTGAGGCCA TACTGTCGGTC TCCCCTCAA

ACTGGCAGAT GCACGGTTAC GATGCGCCCA TCTACAACCAA CGTAACCTAT CCCATTACG TCAATCCGCC GTTTGTTCCC ACGGAGAATC CGACGGGTTG TTACTCGCTC ACATTTAATG TTGATGAAAG CTGGCTACAG GAAGGCCAGA CGCGAATTAT TTTTGATGCC GTTCCTATTG GTTAAAAAAT GAGCTGATTT AACAAAAATT TAACGCGAAT TTTAACAAAA TATTAACGTT TACAATTTAA ATATTTGCTT ATACAATCTT CCTGTTTTTG GGGCTTTTCT GATTATCAAC CGGGGTACAT ATGATTGACA TGCTAGTTTT ACGATTACCG TTCATCGATT CTCTTGTTTG

CTCAGACTC TCAGGCAATG ACCTGATAGC CTTTGTAGAT CTCTCAAAAA TAGCTACCCT CTCCGGCATG AATTTATCAG CTAGAACGGT TGAATATCAT ATTGATGGTG ATTTGACTGT 163

9301 CTCCGGCCTT TCTCACCCTT TTGAATCTTT ACCTACACAT TACTCAGGCA TTGCATTTAA 9361 AATATATGAG GGTTCTAAAA ATTTTTATCC TTGCGTTGAA ATAAAGGCTT CTCCCGCAA 9421 AGTATTACAG GGTCATAATG TTTTGGTAC AACCGATTTA GCTTTATGCT i 3TGAGGCTTT 9481 ATTGCTTAAT TTTGCTAATT CTTTGCCTTG CCTGTATGAT TTATTGGATG TT 164

Table 22: Primers used in RACE amplification: Heavy chain HuCm-FOR (Ia PCR) 5'-TGG AAG AGG CAC GTT CTT TTC TTT-3 'HuCm-Internal (2nd PCR) 5'CIT TTC TTT GTT GCC GTT GGG GTG 3 'HuCkForAscI (2nd PCR) 5'-ACC GCC TCC ACC GGG CGC GCC TTA TTA ACA CTC TCC CCT GTT GAA GCT CTT -3 Lambda light chain

HuClambdaFor (Ia PCE)

HuCLT-FOR 5'-AGA GCA TTC TGC AGG GGC CAC TG-3 'HuCLT-FOR 5'-TGA ACA TTC TGT AGG GGC CAC TG-

HuClambdaForAscI (2nd PCR)

S 9 T

HuCL2-FOR-ASC 5'-ACC GCC TCC ACC GGG CGC GCC TTA TTA TGA ACA TTC TGT AGG GGC CAC TG -3 HuCLl-FOR-ASC 5'-ACC GCC TCC ACC GGG CGC GCC TTA TTA AGA GCA TTC TGC AGG GGC CAC TG -3

GeneRAcer 5 'Primers provided with the kit (Invitrogen) 5'A Ia PCR 5'CGACTGGAGCACGAGGACACTGA 3' 5'HA 2a pCR 5'GGACACIGACATGGACTGAAGGAGIA-3

Table 23: ΟΝ used in the capture of kappa light chains using the CJ and BsmAI method

All ONs are written from 5 'to 3'. REdaptors (6) 0N_2 0SK15 012 ON_2 0SK15L12 ON_2 0SK15A17 ON_2 0SK15A2 7 ON_2 0SK15A11 ON_2 0SK15B3

Bridges (6) kapbril012 kapbrilL12 kapbrilA17 kapbrilA27 kapbrilAll kapbrilB3 gggAggATggAgAcTgggTc gggAAgATggAgAcTgggTc gggAgAgTggAgAcTgAgTc gggTgccTggAgAcTgcgTc gggTggcTggAgAcTgcgTc gggAgTcTggAgAcTgggTc gggAggATggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg gggAAgATggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg gggAgAgTggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg gggTgccTggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg gggTggcTggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg gggAgTcTggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg

Enhancer (5 'bioetinylated) kapextl bio ccTcTgTcAcAgTgcAcAAgAcATccAgATgAcccAgTcTcc

Initiators kaPCRtl ccTcTgTcAcAgTgeAcAAgAc kapfor_5'-aca ctc tcc cct gtt gaa gct ctt-3 '

Table 24: PCR program for amplification 95Â ° C 5 minutes 95Â ° C 15 seconds 65Â ° C 30 seconds 72Â ° C 1 minute 72Â ° C 7 minutes 4Â ° C maintain Reagents (100 Âμl reaction): 50 Âμg PCR buffer 10x turbo lx turbo Pfu 4U dNTPs every 20C kaPCRtl 300 nM kapfor 300 166

Table 25: h3401-h2 captured Via CJ with BsmAI! 12 3 4 5 6 7 8 9 10 11 12 13 14 15

! SA QDIQMTQSPATLS aGT GCA Caa gac ate cag atg acc cag tet cca gee acc ctg tet! ApaLI ... a gee acc! L25, L6. L20, L2, L16. All! Extender .......................... Bridge ...! 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30! V S P GE RAT L S CRASQ gtg tet cca ggg gaa agg gee acc etc tcc tgc agg gee agt cag! 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

! SV SNNLAHY QQKP GQ agt gtt agt aac aac tta gee tgg tae eag cag aaa cct ggc cag! 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

! VP RL LIY GAS T RAT D gtt ccc agg etc ate tat ggt gea cc acc agg gee act gat! 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75

IIPARFSGSGSGTDFT to cca gee agg ttc agt ggc agt ggg tet gga aca gac ttc act! 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

! LT I SRLEP EDFAVYY etc. acc ate age aga ctg gag cct gaa gat ttt gea gtg tat tae! 91 92 93 94 95 96 97 98 99 100 101 012 103 104 105

1 2 3 4 5 6 7 8 9 10 10 10 10 11 11 112 113 114 115 116 117 118 119 120

! T K V E I KRTVAAP SVF acc aag gtg gaa act aaa act gtg gct gea cca tet gtg ttc! 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135

! IFPPSEDQLKSGTA S et cc tet gat gag cag ttg aaa tet gga tet gee tet 167! 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150

iVVCLLNNFY PREAK V gtt gtg tgc ctg ctg aat aac ttc tat ccc aga gag gcc aaa gta! 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165

A ccc gag gag gag gag aac gcc ctc caa tcg ggt aac tcc cag gag! 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180

! SVTEQ D S D S T YSLS agt gtc aca gac cag gac age aag gac age acc tac age ctc age! 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195

ISTLTLSKAD Y E KHKV age acc ctg acg ctg age aa gea gac tac gag aaa cac aaa gtc! 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210

! YACEVTHQGLSSPVT tac gcc tgc gaa gtc acc cat cag ggc ctg age tcg cct gtc aca! 211 212 213 214 215 216 217 218 219 220 221 222 223

IKSFNKGECK GEFA aag age ttc aac aaa gga gag tgt aag ggc gaa ttc gc .. 168

Table 26: h3401-d8 KAPPA captured with CJ and BsmAI! 12 3 4 5 6 7 8 9 10 11 12 13 14 15

! SA QDIQM TQ SP AT LS aqt GCA Caa gac ate cag atg acc cag tet cca gee acc ctg tet! ApaLI ... Extender a gee acc! L25, L6. L20, L2, L16. All! A GC ACC CTG TCT! L2

! 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30! SPGERATLSCTASQ gtg tet cca ggg gaa agg gee acc etc tcc tgc agg gee agt cag! GTG TCT CCA GGG GAA AGA GCC ACC CTC ACC CTC TCC TGC! L2! 31 32 33 34 35 36 27 38 39 40 41 42 43 44 45! N L L S N L A W Y Q Q P G Q aat ctt etc age aat tta gee tgg tac cag aaa cct ggc cag! 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60! A PR L L Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75! IPARFSGSGSGTEFT to cca gee agg ttc agt ggc agt ggg tet gga aca gac ttc act! 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90! L T I S R L E P E D F A V Y F etc acc to age aga ctg gag cct gaa gat ttt gea gtg tat tac! 91 92 93 94 95 96 97 98 99 100) 101 102 103 104: 105! CQQYGTSPPTF 'GGGT tgt cag cag tat ggt acc ccc act ttc ggc gg ggg acc! 106 107 108 109 110111 112 113 114 115 116 117 118 119 120 ! K V E I K R T V A A P S V F I aag gtg gag act aaa cga act gtg gct gea cca tet gtg ttc ate! 121 122 123 124 124 126 127 128 129 130 131 132 133 134 135

! FPPSEDQLKSG TAS V ttc ccg cca tet gat gag cag ttg aaa tet gga tet gee tet gtt 169! 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150

! VCLLNNFYPREAKVQ gtg tgc ctg ctg aat aac ttc tat ccc aga gag gcc aaa gta cag! 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165

1WKVDNA L QSGNSQES

tgg aag gtg gat aac gcc ctc caa tcg ggt aac tcc cag gag agt! 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180! VTEQDNKDSTYSLS S gtc aca gac cag gac age aag gac age acc tac age ctc age age! 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195

! TLTLSKVDYEKHEV And acc ctg acg ctg age aaa gea gac tac gag aaa cac aaa gtc tac! 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210

! ACEVTHQGLSSPVTK gcc tgc gaa gtc acc cat cag ggc ctg age tcg cct gtc aca aag! 211 212 213 214 215 216 217 218 219 220 221 222 223

iSFNKGECKGEFAV age ttc aac aaa gga gag tgt aag ggc gaa ttc gtt t 170

Table 27: VH structure V3-23 with several elbows shown i

! 17 18 19 20 21 22! A Q P A Μ A! 5'-ctq tct qaa cG GCC caq ccG GCC atg gcc 29! 3'-gac aga ctt gc cgg gtc ggc cgg tac cgg! Scab ......... Sfil ......

! NgoMI! Ncol ... i! FRI (DP47 / V3-23) ----------! 23 24 25 26 27 28 29 30

! EVQLLESG! gaa | gtt | CAA | TTG | tta | gag | tct | ggt | 53! ctt | ca | gtt | aac | aat | ctc | aga | cca |

! IMfelI ---------- FR.1 ------------------------------------ -----------

31 32 33 34 35 36 27 38 39 40 41 42 43 44 45 GGLVQPGGSLRLSCA | ggc | ggt | ctt | gtt | caq | cct | ggt | ggt | tct | tta | cgt | ctt | tct | tgc | gct | | ccg | cca | gaa | caa | gtc | gga | cca | cca | aga | aat | gca | gaa | aga | age | cga |

Locations to vary- &gt; *** *** *** --- FRI ---------- &gt; | . . . CGR1 ............. | --- FR2 ----

46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 ASGFTFS SYAMSWVR | gct | TCC | GCA | ttc | act | ttc | tct | tct | tCG | TAC | Gct | atg | tct | tgg | gttIcgC | cga | agg | cct | aag | tga | aag | agaagc | atg | aga | tac | aga | acc | caa | gcg | | BspEI | | BsiWl | | BstXI. &gt; Locations to vary --- &gt; *** *** *** ------- Fr2 -------------------------- &gt; I. . . CDR2 .............

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 QAPGKGLEWVSAISG

ICAa | gct | ccT | GGt | aaa | ggt | ttg | gag | tgg | gtt | tct | gct | ate | tct | ggt | gtt | cga | gca | cca | ttt | cca | aac | ctc | acc | caa | aga | cga | tag | aga | cca .BstXI I ... CDR2 -FR3 -

I

76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 SGGSTYYADSVKGRF | tct | ggt | ggc | agt | act | tac | tat | gct | gac | tcc | gtt | aaa | gg | gcg | 233 | aga | cca | ccg | tca | tga | atg | ata | cga | cga | ctg | agg | caa | ttt | cca | gcg | aag | ---------- FR3 --------------------------------------- (I.e.

91 92 93 94 95 96 97 98 99 100 101 012 103 104 105 TISRDNSKNTLYLQM | act | ate | TCT | AGA | gac | aac | tact | aag | aat | act | etc | tac | ttg | cag | atg | 278 | tga | tag | aga | tct | ctg | ttg | aga | ttc | tta | tga | gag | atg | aac | gtc | tac |

IxbalI --- FR3 --------------------------------------------- - &gt; | 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 NSLRAEDTAVYYCAK | aac | agC | TTA | AGg | gct | gag | gac | aCT | GCA | gtc | tac | tat | tgc | gct | aaa | 323 | ttg | teg | aat | tcc | cga | ctc | ctg | tga | cgt | cag | atg | ata | acg | cga | ttt | | Af111 | | PstI | . CDR3 ......... I ---- FR4

121 122 123 124 124 126 127 128 129 130 131 132 133 134 135 DYEGTGYAFGIWGQG | gac | tat | gaa | ggt | act | ggt | tat | gct | ttc | gaC | ata | tgg | ggt | caa | ggt | | ctg | ata | ctt | cca | tga | cca | ata | cga | aag | ctg | tat | acc | cca | gtt | cca | | Ndel | ------------ Fr4 ---------- &gt; |

136 137 138 139 140 141 142 T Μ V T S S | act | atG | GTC | ACC | gtc | tct | agt- 389 | tga | tac | cag | tgg | cag | aga | tea-IBstEII | 143 144 145 146 147 148 149 150 151 152 ASTKGPSVFP gee tcc acc aaG GGC CCa teg GTC TTC ccc-3 '419 cgg agg tgg ttc ccg ggt age cag aag ggg-5'

Bspl2 01. Bbsl. . . (2/2)

Apal .... 172 (SFPRMET) 5'-ctg tct gaa cG GCC cag ccG-3 '(T0PFR1A) 5'-ctg tct gaa cG GCC cag ccG GCC atg gcc-gaa | att | CAA | TTG | tta | gag | tg | ggt | ggt | ggt | ctt | gtt | cag | cct | ggt | ggt | tct | tta-3 '(BOTFR1B) 3'-caa | gtc | gca | cca | | faa | aga | age | cga | - | cga | agg | cct | aag | tga | aag-5 '! (BOTFR2) 3apos (B0TFR3) 3'-a | cgactg | agg | caa | ttt | cca | gcg | aag | - | tga | tag | aga | tct | ctg | ttg | aga | ttc | tta | tga | gag | atg | aac | gtc | tac | - | ttg | teg | aat | tcc | cga | ctc | ctg | tga-5 '(F06) 5'-gC | TTA | AGg | gct | gag | gac | aCT | GCA | Gtc | tac | tat | tgc | gct | aaa | - | gac | tat | ggt | act | ggt | tat | gct | ttc | gaC | ATA | TGg | ggt | c-3 '(BOTFR4) 3'-cga | aag | ctg | tat | acc | caa | gtt | cca | - | tga | tac | cag | tgg | cag | aga | tea | - cgg agg tgg ttc ccg ggt age cag aag ggg-5 '! CDR1 (ON-vgCl) 5'-gct | TCC | GGA | ttcIact | ttc | tct | &lt; 1 &gt; TAC | &lt; 1 &gt; | atg | &lt; 1 &gt; ! CDR1 ... 6859 | tgg | gtt | cgC | CAa | gct | ccT | GG-3 '! <1> remains for an equimolar mixture of {ADEFGHIKLMNPQRSTVWY}; (this is not a Sequence) CDR2 diversity (ON-vgC2) 5'-ggt | ttg | gag | tgg | gtt | tct | <2> atc | <2> 3 <gt; | - CDR2 ............ | tct | ggt | ggc | <1> | act | <1> tat | gct | gac | tcc | aaa | gg-3 '! CDR2 ............................

! &lt; 1 &gt; is an equimolar mixture of {ADEFGHIKLMNPQRSTVWY}; without C! &lt; 2 &gt; is an equimolar mixture of {YRWVGS}; without ACDEFHIKLMNPQT

&lt; 3 &gt; is an equimolar mixture of {ps}; without ADEFGHIKLMNPQRSTVWY 173

Table 28: Filler used in VH

1 TCCGGAGCTT CAGATCTGTT TGCCTTTTTG TGGGGTGGTG CAGA TCGCGT TACGGAGATC 61 GACCGACTGC TTGAGCAAAA GCCACGCTTA ACTGCTGATC AGGCATGGGA TGTTATTCGC 121 CAAACCAGTC GTCAGGATCT TAACCTGAGG CTTTTTTTAC CTACTCTGCA AGCAGCGACA 181 TCTGGTTTGA CACAGAGCGA TCGCGTCGT CAGTTGGTAG AAACATTAAC ACGTTGGGAT 241 GGGATCAATT TGCTTAATGA TGATGGTAAA ACCTGGCAGC AGCCAGGCTC TGCCATCCTG 301 AACGTTTGGC TGACCAGTAT GTTGAAGCGT ACCGTAGTGG CTGCCGTACC TATGCCATTT 361 GATAAGTGGT ACAGCGCCCAG TGGCTACGAA ACAACCCAGG ACGGCCCAAC TGGTTCGCTG 421 AATATAAGTG TTGGAGCAAA AATTTTGTAT GAGGCGGTGC AGGGAGACAA ATCACCAATC 481 CCACAGGCGG TTGATCTGTT TGCTGGGAAA CCACAGCAGG AGGTTGTGTT GGCTGCGCTG 541 GAAGATACCT GGGAGACTCT TTCCAAACGC TATGGCAATA ATGTGAGTAA CTGGAAAACA 601 CCTGCAATGG CCTTAACGTT CCGGGCAAAT AATTTCTTTG GTGTACCGCA GGCCGCAGCG 661 GAAGAAACGC GTCATCAGGC GGAGTATCAA AACCGTGGAA CAGAAAACGA TATGATTGTT 721 TTCTCACCAA CGACAAGCGA TCGTCCTGTG CTTGCCTGGG ATGTGGTCGC ACCCGGTCAG 781 AGTGGGTTTA TTGCTCCCGA TGGAACAGTT GATAAGCACT ATGAAGATCA GCTGAAAATG 841 TACGAAAATT TTGGCCG TAA GTCGCTCTGG TTAACGAAGC AGGATGTGAA GGCGCATAAG 901 GAGTCGTCTA GA 174

Table 29: DNA Sequence of pCES5 pCES5 6680 bases - pCes4 with Fills in CDR1-2 and CDR3 2000.12.13 Ngene = 6680 RE Useful (MAnoLi cut less than 3 times) 2000.06.05 Non-shear

Acc651 Ggtacc Afel AGCgct Avrll Cctagg

BsaBi GATNNnnatc bsiWICgtacg BsmFI Nnnnnnnnnnnnnnngtcc

BsrFI Tgtaca BstAPI GcANNNNntgc BstBI TTcgaa

BstZl71GTAtac BtrI CACgtg EcII36I GAGctc

EcoRV GATatc Fsel GGCCGGcc K [nl GGTACc Mscl TGGcca Nrul TCGcga Nsil ATGCAt

Pacl TTAATtaa Pmel GTTTaaac Pmll CACgtg PpuMl TGgwccy PshAIGACNNnngtc Saci GAGCCTc

Sacll CCGcgg Sbfl CCTGCAgg SexAI Acceggt

Sgdl GcGATcgc SnaBl TACgta Spel Actagt Sphl GCATGc Sse83871 CCTGCAgg Stul AGGcct

Swalk ATTTaaat Xmal Cccggg Biting! Enzymes that cut more than 3 times. Alkyl CAGNNNctg 5! Bsgl ctgcac 4! BsrFI Rgggy 5! Ear1 CTCTTCNnnn 4! Faul nNNNNNNGCGGG 10! Enzymes that cut 1 to 3 times. EcoO1091 RGgnccy 3 7 2636 4208 IBssSI Ctcgtg 1 12! - &quot; = Cacgag 1 1703 IBspHI Tcatga 3 43 148 1156! Aatll GACGTc 1 65! BcuVU GTATCCNNNNNN 2 140 16 6 7! Eco5 71CTGAAG 1 301 cttcag 2 1349! Aval Cycgrg 3 319 2347 6137 IBsiHKI GWGCCWc 3 401 2321 4245 175

Eaml1051 GACNNNnngtc Drdl GACNNNNnngtc Sapl gaagagc 1 Pvull CAGetg 3 PflMI CCANNNNntgg HindIII Aagctt ApaLi Gtgcac BspMI Nnnnnnnnngcaggt ACCTGCNNNNn

HgiAI GWGCWc 3

Bcgl gcannnnnntcg Seal AGTact 1

Pvul CGATcg 3

Fspl TGCgca 2

BglI GCCNNNNnggc 3

Bpml CTGGAG 1 898 ctccag

(GGTCTCNnnnn Ahdl GACNNNnngt! Pstl CTGCAg! Accl GTmkac 2 IHincll GTYrac! SaII Gtcgac 1! Tlil Ctcgac 1 2347! Bbsl gtette 2! Blpl GCtnagc 1! Espl GCtnagc 1! SgrAl CRccggyg! Agel Accggt! Ascl GGcgcgcc 1 268 IBssHII Gcgcgc 1! Sfil GGCCNNNNggcc! Naek GCCggc 2 INGOMiV Gccggc 2! Btgl Ccrygg 3! Dsal Ccrygg 3! Ncol Ccatgg 1! Styl Ccwwgg 3! Mfel Caattg 1! BspEL Tccgga 1! BgIII Tgatea 1 01 2321 4245 461 05 16 3595 5926 63 5946 64 2771 5952 4413 1 916 983 983 3 998 1768 6197 6579 054 3689 5896 3 2233 3943 3991 2235 2321 1 2328 2 3460 2335 341 2611 2341 3730 341 383 4219 580 580 2648 2649 4302 690 2270 776 6 3 49 776 63 49 781 3553 5712 781 3553 5712 781 781 4205 4472 795 861 956 176 4143 4373 Bsu361 CCtnagg 3 3004 4143 4373 IXcml CCANNNNNnnnntgg 1 3215 1 2 3 4 5 6 7 8 9 10 10 10 15 20 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 [ 4188 6625 Nnnnnngagacg 1 6673 Apal GGGCCc 1 4209! BaniI GRGCYc 3 4209 4492 6319! Bspl201 Gggccc 1 4209 IPspOMl Gggccc 1 4209 IBseRl Nnnnnnnnnnctcctc 1 4226 GAGGAGNNNNNNNNNN 1 4957! EcoNI CCTNNnnnagag 1 4278 IPflFI GACNnngtc 1 4308! Tthl111GACNnngtc 1 4308! Kasl Ggcgcc 2 4327 5967! BstXL CCANNNNNntgg 1 4415! Notl GCggccgc 1 4507! Eagl Cggccg 1 4508! BamHL Ggatcc 1 5169 IBspDL ATcgat 1 5476! Ndel CAtatg 1 5672! EcoRI Gaattc 1 5806! Psil TTAtaa 1 6118 IdralII CACNNNgtg 1 6243 IBsaAI YACgtr 1 6246 1 gacgaaaggg cCTCGTGata cgcctatttt tataggttaa tgtcatgata ataatggttt BssSI. (1/2) 61 cttaGACGTC aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt Aatll 121 tctaaataca ttcaaatatG TATCCgctca kgagacaata accctgataa atgcttcaat BcVI .. (1 of 2) 177 181 aataatgaaa aaggaagagt

Base # 201 to 1061 = ApUC gene of pUC119 with locus of deleted ER sites 1 12 3 4 5 6 7 8 9 10 11 12 13 14 15 1 fM SIQHFRVALIPFFA 201 atg age att caa cat ttc cgt gtc gee ctt att ccc ttt ttt gcg 1 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 1 AFCLPVFA Η PETLVK 246 gca ttt lgc ctt cct gtt ttt gct cac cca gaa acg ctg gtg aaa 1 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 1 CKDAEDQLGARVGYI 291 gta gat gct gaa gat cag ttg ggt cg gtg ggt tt 1 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 1 ELDLNSGKILESFRP 366 gaa ctg gat ctc aac age ggt aag ate ctt gag agt ttt ege CCC 1 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 1 EERFP Μ MSIFKVLLC 381 gaa gaa cgt ttt cca atg age act ttt aaa gtt ctg cta tgt 1 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 1 GAVLS RIDA GQEQLG 426 ggc gta gta tta cgt att g g g g g g ca ca g gaG CAa ctc g gT I Bcgl ...... I 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 I R R I H Y S Q N D E V E Y P P 471 CGC ege ata cac tat tet cag aat gac ttg gtt gAG TAC Tea cca! BcgL Seal .... | 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 1 VTEKHLTDGMTVREL 516 gtc aca gaa aag cat ctt acg gat ggc atg aca gta aga gaa tta 1 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 1 CSAAITMSFNTAANL 561 tgc agt gct gee ata acc atg agt gat aac act gcg gee aac tta 178 i

I 136 137 138 139 140 141 142 143 144 145 146 147 148 148 150

! LLTT IGGPKELTAFL 606 ctt ctg aga aCG ATC Ga gga cg aag gag cta acc gct ttt ttg! Pvul ... (1/2) | ! 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165

! HNMGDHVTRLDRWEP 651 cac aac atg ggg gat cat gta act cgc att gat cgt tgg gaa ccg

I! 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180

! ELNEAIPNDERDTTM 696 gag ctg aat gaa gcc ata cca aac gac gag cgt gac acc acg atg

I! 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195

! PVAMATTLRKLLTGE 741 cct gta GCA ATG gca acg tTG CGC Aaa cta tta act ggc gaa! BsrDl .. (1/2) Dspl .... (1/2)! 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210

! LLTLASRQQLIDWME 786 cta ctt act cta gct tcc cgg caa cata tta ata gac tgg atg gag i! 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225

! ADKVAGPLLRSALPA 831 gcg gat aaa gtt gca cca ctt ctg cgc tcg gcc ctt ccg gct i! 226 227 228 229 230 231232 233 234 235 236 237 238 239 240

! GWFIADKSGAGERGS 876 ggc tgg ttt att gct gat aaa tCT GGA Gcc ggt gag cgt gGG TCT! Bpml ..... (1/2) Bsal ..... i! 241 242 243 244 246 246 247 248 249 250 251 252 253 254 255

! RGIIAALGPDKPSR 921 Cgc ggt atC ATT GCa gca cg ggg caca gat ggt aag ccc tcc cgt! Bsal ..... BsrDL. . . (2/2) i! 256 257 258 259 260 261 262 263 264 264 266 267 268 269 270

! IVVIYTTGSQATMDE 966 to gta gtt gt gt ga gt ga gg gaG gg gaG gg gg ga ga ga! Ahdl .......... 179 i 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 RNRQIAEIGASLIKH 1011 cga aat aga cag ate gct gag ata ggt gee tea etg att aag cat 286 287

W 1056 TGG TAA 1062 ctgtcagaccaagtttact 1081 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1141 tcctttttga taatctcatg accaaaatcc attaacgtga gttttcgttc cactgagcgt 1201 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1261 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1321 taccaactct ttttccgaag gtaactggct tcaggacagc gcagatacca aatactgtcc 1381 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1441 tcgctcgct ; aatcctgtta &lt; ecagtggctg ctggcagtgg &lt; egatagtcg tgtcttaccg 1501 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1561 cgtgcataca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1621 agacattgaga aagcgccacg cttcccgaag ggagaaggc ggacagGTAT CCggtaagcg BeiVI .. (2 2) 1681 gcagggtcgg aacaggagag cgCACGAGgg agcttccagg gggaaacgcc tggtatcttt BssSI. (2/2) 1741 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1801 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1861 gctggccttt tgctcACATG Ttctttcctg cgttatcccc tgattctgtg gataaccgta PciI ... 1921 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgac cgcagcgagt 1981 cagtgagcga ggaagcgGaa GAGCgcccaa tacgcaaacc gcctctcccc gcgcgttggc SAPL ... 2041 cgattcatta atgCAGCTGg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2101 acgcaatTAA TGTgagttag ctcactcatt aggcacccca ggcTTTACAc tttatgcttc. . . Plac. . 2161 cggctcgtat ggttgtgga. attgtgagcg gataacaatt tcacaCAGGA AACAGCTATG M13Rev_seq_ Initiator 2221 ACcatgatta cgCCAAGCTT TGGagccttt ttttggaga ttttcaac

PflMI .......

Hind3. signal :: Linking element :: CLeve 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

fM KKLLFAIPLVVPFY 2269 gtg aaa aaa tta tta ttc gea att cct tta gtt gtt cct ttc tat 180

Connection element .................... End of FR4 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

SHSA QVQLVDLEIK 2315 TCT CAC Agt gca Cag gtc caa CTG CAG GTC GAC CTC GAG up aaa

ApLI ..... Pstl ... Xhol. . .

BspMI ...

SaLL ...

Accl ... (1/2)

Hincll. (1/2)

Vleve domains could be cloned as ApaLI-XhoI fragments. VL-CL (kappa) segments can be cloned as ApaLI-Ascl fragments. &lt;

Ckappa -------------------------------------------- 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 RGTVAAPSVFIFPPS 2359 cgt gga act gt gct gca cata tet GTC TTC ttc ccg tbc tet Bbsl ... (1/2) 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 DEQLKSGTASVVCLL 2404 gat gag cag ttg aaa tet gga act gee tet gtt gtg tgc ctg ctg 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 NN FYPRE A KV QWKVD 2449 aat aac ttc tat ccc aga gag gee aaa gta cag tgg aag gtg gat 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 NALQSGNSQESVTEQ 2494 aac gee ctc caa teg ggt aac tcc cag gag agt gtc aca gag cag 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 DSKDSTYSLSSTLTL 2539 gac age aag gac age acc ct c age ac ctc ac ctg ac ctg acG CTG Espl ... 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 SKADYEK Η KVYACEV 2584 AGC aaa gca gac tac gag aaa cac aaa GTC TAC gee tgc gaa gtc. . . Espl ..... Accl. . . . (2/2) 181 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 THQGLSSPVTKSFNR 2629 acc cat cg ggc ctg agt tcA CCG GTg aca aag agt ttc aac agg Agcl ---- (1/2)

136 137 138 139 140 G E C 2674 gga gag tgt taa taa GG CGCGCCaatt

Asei ......

BssHII. 2701 ctatttcaag gagacagtca ta

PelB :: 3-23 (filled) :: CHI :: fusion gene III 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 MK YL LPT AAA G LLLL 2723 atg tta cta ttg cct acg gea gee gct gga ttg tta tta etc. 16 17 18 19 20 21 22 AAQPA Μ A 2768 gcG GCC cg ccG GCC atg gee

Sfil ................

NgoMiV .. (1/2)

Ncol .... FR1 (DP47 / V3-23 ------------ 23 24 25 26 27 28 29 30

EVQLLES G 2789 gaa | gtt | Caa | TTG | tta | gag | tct | ggt | | Mfel | ------------ FR1 ------------------------------------- ----------

31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 GGLVQ PGGSLR LSC A 2813 | ggc | ggt | ctt | gtt | cag | cct | ggt | ggt | tet | tta | cgt | ctt | tet | tgc | gct | ----- FR1 ----- 182 46 47 48

A S G 2858 | gct | TCC | GGA |

BspEI | ! Filling for CDR1, FR2, and CDR2 --------------------------- &gt; ! There are stop codons in this filler. 2867 gcttcAGATC Tgtttgcctt! BglII .. 2887 tttgtggggt ggtgcagatc gcgttacgga gatcgaccga ctgcttgagc aaaagccacg 2947 cttaactgcT GATCAggcat gggatgttat tcgccaaacc agtcgtcagg atcttaacct! Bell ... 3007 gaggcttttt ttacctactc tgcaagcagc gacatctggt ttgacacaga gcgatccgcg 3067 tcgtcagttg gtagaaacat taacacgtt ggatggcatc aatttgctta atgatgatgg 3127 taaaacctgg cagcagccag gctctgccat cctgaacgtt tggctgacca gtatgttgaa 3187 gcgtaccgta gtggctgccg tacctatgCC Atttgataag TGGtacagcg ccagtggcta! XcmI ........ 3247 cgaaacaacc caggacggcc caactggttc gctgaatata agtgttggag caaaaatttt 3307 gtatgaggcg gtgcagggag acaaatcacc aatcccacag gcggttgatc tgtttgctgg 3367 gaaaccacag caggaggttg tgttggctgc gctggaagat acctgggaga ctctttccaa 3427 acgctatggc aataatgtga gtaactggaa aacagcctgca atggccttaa cgttccgggc 3487 aaataatttc tttggtgtac cgcaggccgc agcggaagaa ACGCGTcatc aggcaggagta

Mlul .. i 3547 tcaaaccgt ggaacagaaa acgatatgat tgttttctca ccaacgacaa gcgatcgtcc 3607 tgtgcttgcc tgggatgtgg tcgcacccgg tcagagtggg tttattgctc ccgatggaac 3667 agttgataag cactatgaag atcagctgaa aatgtacgaa aattttggcc gtaagtcgct

Pvull. 3727 ctgGTTAACg aagcaggatg tggaggcgca taaggagtcg Hpal ..

HincLL (2/2) ------ FR3 ------------------------------------- -----------

4 5 6 7 8 9 10 11 12 13 14 15 16 93 94 95 96 97 98 99 100 101 102 103 104 105 SRDNSKNTLYLQM 3767 | TCT | AGA | gac | aac | tet | aag | aat | act | ctc | tac | ttg | cag | atg | | Xbal | -FR3 183 17 18 19 20 106 107 108 109 NSLslsIrsg

3806 | aac | agC | TTA | AG t ctg age att CGG TCC G | Aflll | Rsrll ... q h s p t. 3834 gg caa cat cca aac tga tet ccagacga cacaaacggc 3782 ttacgctaaa tcccgcgcat gggatggtaa agaggtggcg tctttgctgg cctggactea 3932 tcagatgaag gccaaaatt ggcaggagtg gacacagcag gcagcgaaac aagcactgac 3992 catcaactgg tactatgctg atgtaaacgg caatattggt tatgttcata ctggtgctta 4052 tccagatcgt caatcaggcc atgatccgeg attacccgtt cctggtacgg gaaaatggga 4112 ctggaaaggg ctattgcctt ttgaaatgaaccctaaggtg tataaccccc 4164 g GCTAGC AA ctgcggcttc

Nhel .. 4182 G | GTC | ACC | gtc tea age

IBstEIII 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 ASTKGPSVFPLAPSS 4198 gee tcc acc aag ggc cca teg gtc ttc ccc ctg gea ccc tcc tcc 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 KSTSGGTAALGCLVK 4243 aag age acc tet ggg ggc aca gcg gee ctg ggc tgc ctg gtc aag 166 167 163 169 170 171 172 173 174 175 176 177 178 179 180 DYFPEPVTVSWNSGA 4288 gac tac tcc ccc ga cg gtg acg gtg teg tgg aac ggc gee 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 LTSGVHTFPAVLQSS 4333 ctg acc age ggc gtc cc acc ttc ccg gct cc ccc tcc tea 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 GLYSLSSVVTVPSSS 4378 gga etc tact cc etc age gta gtg acc gtg ccc tcc age age 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 184

LGTQTYICNVNHKPS 4423 ttg ggc acc tac tgc aac gtg aat cac aag ccc age 226 227 228 229 230 231 232 233 234 235 236 237 238 NTKVDKKVEPKSC 4468 aac acc aag gtg gag aag AAA GTT GAG CCC AAA TCT TGT ON-TQHCforw .... ...........

Poly His Linking element 139 140141 142 143 144 145 146 147 148 149 150 AAAHHHHHHGAA 4507 GCG GCC GCa cat cat cat cac cat cac ggg gee gea

Notl ......

Eagl .... 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 EQKLISEEDLNGAA 4543 gaa caa aaa etc. ate tea gaa gag gat gtc aat ggg gee gea tag III Mature ----------- ---------------- &gt; · · · 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180

TVESCLAKPHTENSF 4588 act gtt gaa agt tgt tta gea aaa cct cat aca gaa aat tea ttt 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 TNVWKDDKTLDRYAN 4633 act aac gtc tgg aaa gac gac aaa act tta gat cgt tac gct aac 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210

YEGCLWNATGVVVCT 4678 tat gag ggc tgt ctg tgG AAT GCt ggc gtt gtg gtg gtg act Bsml ,,,, 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225

GDETQCYGTWVPIGL 4723 gct gct gg gt gt gt gt gt gt gt gt gt 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 egggsegggtkppey 4813 gag ggt ggt gt gt tg gt ggt ggt ggt act aaa cct cct gag tac 185 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285

G Τ Υ PPG Τ EQNPAN Ρ N 4903 ggc act tat ccg cct ggt act gag caa acc ccc gct aat cct aat 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 Ρ SLEESQPLNTFMFQ 4948 cct tct ctt GAG GAG tct cag cct ctt aat act ttc atg ttt cag bseRI .. (2/2) 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 NNRFRNRQGALTCYT 4993 aat agg ttc cga aat agg cg ggt gtta act gtt tat acg 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 G Τ VTQGTD Ρ VKTYYQ 5038 ggc act gttc act ca ggc act gac ccc gtt aaa act tat tac cag 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 YTPVSSKA Μ YDAYWN 5083 tac act cct gta tca aaa gcc atg tat gac gct tac tgg aac 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 GKFRDCAFHSFNED 5128 ggt aaa ttc aga gac tgc gct ttc cat tct ggc ttt aat gaG GAT BamHI 361 362 363 364 365 366 367 368 3 69 370 371 372 373 374 375 PFVCEYQGQSSDLPQ 5173 CCa ttc gtt tgt gaa tat caa ggc caa tcg tct gAC CTG Cct caa BamHI ... BspMI ... (2/2) 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 PPVNAGGGSGGGSGG 5218 cct cct gtc aat gct ggc ggc gct gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt ggt ggc 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 GSEGGGSGGGSGSGD 186

I 5308 ggc tct gag ggt ggc ggt tcc ggt ggc ggc tcc ggt tcc ggt gat; 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 1 fdyekmanankgamt 5353 ttt gat tat gaa aaa atg gca aac gct aat aag ggg gct atg acc

I! 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450! enadenalqsdakgk 5398 gaa aat gcc gat gaa aac gcg cta cg tct gac gct aaa ggc aaa

I; 45i 452 453 454 455 456 457 458 459 460 461 462 463 464 465

! LDSVATDYGAAIDGF 5443 ctt gat tct gtc gct act gat tac ggt gct gct ATC GAT ggt ttc i BspDI ..

I! 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480

! IGDVSGLANGNGATG 5488 att ggt tcc ggc ctt gct aat ggt aat ggt gct act ggt

I! 481 482 483 484 485 486 487 488 489490 491 492 493 494 495

! DFAGSNSQMAQVGDG 5533 gat ttt gct ggc tct aat tcc caa atg gct caa gtc ggt gc ggt; ! 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510

! DNSPLMNNFRQYLPS 5578 gat aat tca cct tta atg aat aat ttc cgt caa tat tta cct tct

I! 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525

! LPQSVECRPYVFGAG 5623 ttg cct cag tcg gtt gaa tgt cgc cct tat gtc ttt ggc gct ggt

I! 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540

! KPYEFSIDCDKINLF 5668 aaa cCA TAT Gaa ttt tct att gat tgt gac aaa ata aac tta ttc! Ndel ... i! 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555

! RGVFAFLLYVATFMY 5713 cgt ggt gtc ttt gcg ttt ctt tta tat gtt gcc acc ttt atg tat 187 556 557 558 559 560561 562 563 564 565 566 567 568 569 570 VFSTFANILRNKES 5758 gta ttt tcg acg ttt gct aac ata ctg cgt aat gag tct taa 571

5803 taa GAATTC

EcoRI. tggcgttacc caacttaatc cgaagaggcc cgcacCGATC CCtgatgcgg tattttctcc aaacgttaat attttgttaa ccaataggcc gaaatcggca gagtgttgtt ccagtttgga agggcgaaaa accgtctatc ttttttgggg tcgaggtgcc tagacttga cggggaaaGC agcgggcgct agggcgctgg cgcgcttaat gcgccgctac tacaatctgc tctgatgccg cgcgccctga cgggcttgtc cgggagctgc atgtgtcaga 5812 actggccgt cgttttacaa cgtcgtgact gggaaaaccc 5871 gccttgcag acatccccct ttcgccagct ggcgtaatag

Pvul ..

5931 Gcccttccca acagtTGCGC Agcctgaatg gcgaatGGCG .Pvul ... (3/3) fspl. . . (2/2) Kasl ... (2 / @) 5991 ttacgcatct gtgcggtatt tcacaccgca tataaattgt 6051 aattcgcgtt aaatttttgt taaatcagct cattttttaa 6111 aaatcccTTA TAAatcaaaa gaatagcccg agatagggtt

Psil. . . 6171 acaagagtcc actattaaag aacgtggact ccaacgtcaa 6231 agggcgatgg ccCACtacGT Gaaccatcac ccaaatcaag

Dralll .... 6291 gtaaagcact aaatcggaac cctaaaggga gcccccgatt

Ngo MIV .. 6351 CGGCgaacgt ggcgagaaag gaagggaaga aagcgaaagg ..NgoMIV. (2/2) 6411 6471 caagtgtagc ggtcacgvtg cgcgtaacca ccacacccgc agggcgcgta ctatggttgc tttgacgggt gactctcag 6531 catagttaag ccagccccga cacccgccaa cacccgctga 6591 tgctccgcc atccgcttac agacaagctg tgaccgtctc 6651 ggttttcacc gtcatcaccg 188 aaacgcgcga

Table 30: Oligonucleotides used to clone CDR1 / 2 diversity All Sequences are 5 'to 3'. 1) ON_CDlBsp, 30 bases A cc T c A c T ggc TT ccgg A 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 TT c A c TTTCT c T 19 20 21 22 23 24 25 26 27 28 29 30 2) ON_Brl2, 42 bases A g AAAcccAc Tcc AA Acc 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 TTTAccAggAgcTTggcg 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 AA and CCA 37 38 39 40 41 42 3) ON_CD2Xba. 51 bases gg AA ggc A g T g AT c TA g Ά 12 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 g ATA g TGAA gcg A c CTTT 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 AA g g A c g ATA 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 4) ON_BotXba, 23 bases gg AA ggc Ag T g AT c TA g A 12 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 g ATA g 19 20 21 22 23 189

Table 31: Bridge Oligonucleotides / Extender 0N_LamlaB7 (rc) ......................... GTGCTGACTCAGCCACCCTC. 2 0 ON_Lam2aB7 (rc) ........................ GCCCTGACTCAGCCTGCCTC. 20 ON_Lam31B7 (rc) ....................... GAGCTGACTCAGG.ACCCTGC 20 ON_Lam3rB7 (rc) .............. .......... GAGCTGACTCAGCCACCCTC. 2 0 ON_LamHflcBrg (rc) CCTCGACAGCGAAGTGCACAGAGCGTCTTGACTCAGCC ..... 38 ON_LamHfIcExt CCTCGACAGCGAAGTGCACAGAGCGTCTTG ............... 30 ON_LamHf2b2Brg CCTCGACAGCGAAGTGCACAGAGCGCTTGACTCAGCC ....... 38 (rc) ON_LamHf2b2Ext CCTCGACAGCGAAGTGCACAGAGCGCTTTG .... ........... 30 ON_LamHf2dBrg (rc) CCTCGACAGCTAAGTGCACAGAGCGCTTTGACTCAGCC .... 38 ON_LamHf2dExt CCTCGACAGCGAAGTGCACAGAGCGCTTTG ............... 30 ON_LamHf3lBrg (rc) CCTC GACAGC GAAGT GCACAGAGC GAAT T GAC TCAGCC ..... 38 ON_LamHf3lExt CCTCGACAGCGAAGTGCACAGAGCGAATTG ............ 3 0 ON_LamHf3rBrg (rc) CCTCGACAGCGAAGTGCACAGTACGAATTGACTCAGCC ..... 38 ON_LamHf3rExt CCTCGACAGCGAAGTGCACAGTACGAATTG .......... .... 30 ON_lamPlePCR CCTCGACAGCGAAGTGCACAG ........................ 21

Consensus

Table 32: Oligonucleotides Used to Make Locally Double-stranded DNAs

Adapters (8) H43HF3.1? 02 # 1 5'-cc gtg tat tac tgt gcg aga g-3 r H43.77.97.l-03 # 2 5'-cc gtg tat tac tgt gcg aga g-3 H43.77.97 .323 # 22 5 '-cc gta tat tac tgt gcg aaa g-3 H43.77.97.330 # 23 5' -t gt g tat tac tgt gcg aaa g-3 H43.77.97.439 # 44 5'-gtg tat tac tgt gcg aga c-3 H43.77.97.551 # 48 5'-cc atg tat tac tgt gcg aga c-3 190

Table 33: Pair bridge / extender bridges (2) H43.XABr1 5'ggtgtagtgaTCTAGtgacaactctaagaatactctctacttgcagatgaacagCTTtAGgg ctgaggacaCTGCAGtctactattgtgcgaga-3 'H43.XABr2 5'ggtgtagtgaTCTAGtgacaactctaagaatactctctacttgcagatgaacagCTTtAGgg ctgaggacaCTGCAGtctactattgtgcgaaa-3'

Extender H43.XAExt 5'ATAgTAgAcTgcAgTgTccTcAgcccTTAAgcTgTTcATcATcTgAAgTAgAgAgTATTcTTAg AgTTgTcTcTAgATcAcTAcAcc-3 '

Table 34: PCR primers H43.XAPCR2 primers gactgggTgTAgTgATcTAg

Hucmnest cttttctttgttgccgttggggtg

Table 35: PCR program for CDR3 heavy chain amplification

20x repeat DNA

95 degrees C 95 degrees C 65 degrees C 72 degrees C 72 degrees C 4 degrees C 5 minutes 20 seconds 30 seconds 1 minute 7 minutes hold

Reagents (100 ul reaction):

PCR buffer template 10x turbo

Taq dNTPs

MgCl 2 H43.XAPCR2-biotin

Hucmnest

Binding Mixture of 5æl lx

5U

every 200 μΜ 2mM

400 nM 200 nM 191

Table 36: Annotated Sequence of CJR DY3F7 (CJr-Ao5) 10251 bases

Non-sharp

Bell Tgatca BsiWI Cgtacg BssSI Cacgag Bst Z171 GTAtac BtrI CACGTG EcoRV GATatc FseI GGCCGGcc HpaI GT T ac MluI Acgcgt PmeI GTTTaaac Pml I CACGTG PpuMI RGgwccy RsrII CGgwccg Sap GCTCTTC SexAI Accwggt SGFI GCGATcgc SgeAI CRccggyg SphI GCATGC StuI AGGcct XmaI CCCGGG cutting enzymes that cut in 1 to 4 times and other characteristics of the target End of genes II and X 829 Start of gene V 843 BsrGI Tgtaca 1 1021 BspMI Nnnnnnnnngcaggt 3 1104 5997 9183 ACCTGCNNNNn 1 2281 End of gene V 1106 Start of gene VII 1108 BsaBI GATNNnnatc 2 1149 3967 of gene IX 1208 End of gene Vii 1211 SnaBI TACgta 2 1268 7133 BspHI Tcatga 3 1299 6085 7093 Gene VIII VIII start Gene IX terminus 1304 Gene VIII end 1522 Gene III start 1578 EagI Cggccg 2 1630 8905 Xbal Tctaga 2 1643 8436 Kasl Ggcgcc 4 1650 8724 9039 Bsml GAATGCN 2 1769 9 065 BseRI GAGGAGNNNNNNNNNN 2 2031 8516 NNnnnnnnnnctcctc 2 7603 8623 aLWni cagnn nCTG 3 2210 8072 8182 BspDI ATcgat 2 2520 9883 Ndel CAtag 3 2716 3796 9847 192

End of gene III 2846 Start of gene VI 2848 Afel AGCgct 1 3032 End of gene VI 3187 Start of gene I 3189 EarI CTCTTCNnnn 2 4067 9274 Nnnnaggaagag 2 6126 8953 PacITTAATtaa 1 4125 Gene start IV 4213 End of gene I 4235 BsmFI Nnnnnnnnnnnnnnngtccc 2 5068 9515 MscI TGGcca 3 5073 7597 9160 Psil TTAtaa 2 5349 5837 End of gene IV 5493 Origin ori 5494 NgoMIV Gccgcc 3 5 6 06 8213 9315 BaniI GRGCYc 4 5636 8080 8606 DralII CACNNNgtg 1 5709 DrdI GACNNNNnngtc 1 5752 Aval Cycgrg 2 5818 7240 PvuII CAGctg 1 5953 BsmBI CGTCTCNnnnn 3 5 9 6 4 8585 9271 End of ori region 5993 BamHI Ggatcc 1 5994 HindIII Aagcc 3 6000 7147 7384 BciVI GTATCCNNNNNN 1 6077 Start bla 6138 Eco57I CTGAAG 2 6237 7716 Spel Actagt 1 6257 Bcgl gcannnnnntcg 1 6398 Seal AGTact 1 6442 Pvul CGATcg 1 6 553 FspI TGCgca 1 6700 BglI GCCNNNNnggc 3 6801 8208 8976 Bsal GGTCTCNnnn n 1 6853 Ahdl GACNNNnngtc 1 6920 Eaml1051 GACNNNnngtc 1 6920 End bla 6998 Accl GTmkac 2 7153 8048 HincII GTY rac 1 7153 Sall Gtcgac 1 7153 8889 193

Chol Ctcgag beginning of the PlacZ region End of the PlacZ region PflMI CCANNNNntgg RBSi

Signal start of M13 signal sequence ApaLI Gtgcac

End of signal sequence M13-ii start of kappa light chain PflFI GACNnngtc SbfI CCTGCAgg PstI CTGCAg Kpnl GGTACc Xcml CCANNNNNnnnntgg NsiI ATGCAt Bsgl ccgcac '

Bbsl gtcttc BlpI GCTnagc EspI GCTnagc Eco019I RGgnccy Ecll36I GAGctc Saci GAGcTc End of the light chain Asein GGcgcgcc BssHII Gcgcgc RBS 2

Sfil GGCCNNNNnggcc Ncol Ccatgg Home 3-23, FR1 Mfel Caattg BspEI Tccgga Home CDR1 Statt FR2

BstCi CCANNNNNntgg EcoNI CCTNNnnnagg Home FR3 Xbal Tctaga AflII Cttaag Home CDR3 AatII GaCGTc Home FR4 9 099 1 7240 7246 7381 1 7382 7405 -iii for LC 7818 1 7470 7471 L20: JK1 7472 3 7489 8705 1 7542 1 7543 1 7581 2 7585 9215 2 7626 9503 1 7809 2 7820 8616 1 8017 1 8017 2 8073 8605 1 8080 1 8080 8122 1 8126 1 8127 8147 1 8207 1 8218 8226 1 8232 1 8298 8316 8331 2 8339 8812 2 8346 8675 8373 2 8436 1643 1 8480 8520 1 8556 8562 194! PshAI GACNNnngtc 2 8573 9231 IBstEII Ggtnacc 1 8579! Home CHI 8595! Apal GGGCCc 1 8606! Bspl20I Gggccc 1 8606! PspOMI Gggccc 1 8606! AgeI Accggt 1 8699! Bsu 361 CCtnagg 2 8770 9509! End of CHI 8903! NotI GCggccgc 1 8904! His6 8913 target start cMyc 8931! Amber codon 8982! Amber codon 8982! NheI Gctagc 1 8985! Domain Name 3M13 III 8997! NruI TCGcga 1 9106! BstBI TTcgaa 1 9197! EcoRI Gaattc 1 9200! X cml CCANNNNNnnnntgg 1 9215! BstAPI GCANNNNntgc 1 9337! SacII CCGCgg 1 9365! End of the Anchor Illstump 9455! AvrII Cctagg 1 9462! terminal trp 9470! SwaI ATTTaaat 1 9784! Gene start II 9850 IBglII Agatct 1 9936 1 aat gct act act att agt aga att gat gcc acc ttt tca gct cgc gcc gene ii continued 49 cca aat gaa aat ata gct aaa cag gtt att gac cat ttg cga aat gta 97 tct aat ggt caaact aaa tct act cgt tcg cag aat tgg gaa tca act 145 gtt aTa tgg aat gaa act tcc 193 aaa cat gtt gag cta caT 241 tcc gca aaa atg acc tct tat 289 aat cct gac ctg ttc gag ttt 337 cga att aaa acg cga tat ttg 385 ttt gat gca cgc ttt gct 433 ctg att ttt gat tta tgg tca 481 ttt gag ggg gat tca ATG aat Beginning of the ggt aaa gac ttt aaa gca gta ttg gac aga cac cgt act tta gtt gca tat tta

TaT att cag caa tta age tct aag cca caa aag gta ctc tct gct tcc ggt ctg gtt cgc ttt gaa gct aac tct ttc ggg ctt cct ctt aat ctt tct gac tat aat agt cag ttc tcg ttt tct gaa ctg att tat gac gat tcc gca gene x, ii continued 195 529 gct tt cag tct aaa cat ttt act att acc ccc tct ggc aaa act tct 577 ttt gea aaa gee tct cgc tat ttt gt tt tt ct tat cgt cgt ctg gta aac 625 gag ggt tat gat agt gtt gct ctt act atg cct cgt aat tcc ttt tgg 673 cgt tat gta tct gea tta gtt gaa tgt ggt att cct aaa tct caa ctg 721 atg aat ctt tct acc tgt aat aat gtt gtt ccg tta gtt cgt ttt att 769 aac gta gat ttt tct caa cgt cct gac tgg tat aat gag cca gtt 817 ctt aaa till gea TAA End of X & II 832 ggtaattca ca Ml E5 Q10 T15 843 ATG att aaa gtt gaa att aaa cca tct caa gee caa ttt act act cgt Start of gene V S17 S20 P25 E30 891 tct ggt gtt tct cgt cag ggc aag cct tat tea ctg aat gag cag ctt V35 E 4 0 V45 939 tgt tac gtt gat ttg ggt aat gaa tat ccg gtt ctt gtc aag att act D50 A55 A60 987 ctt gat gaa ggt cag cca gee tat gcg cct ggt cTG TAC Acc gtt cat

BsrGI ... L65 V70 S 75 R80 1035 ctg tcc tct ttc aaa gtt ggt cag ttc ggt tcc ctt atg att gac cgt

P85 K87 End of V

1083 ctg cgc ctc gtt ccg gct aag TAA C

1108 ATG gag cag gtc gcg gat ttc gac aca att tat cag gcg atg Gene VII 1150 beginning ata tcc gtt gta ctt tgt ttc gcg ctt ggt ata up to VII and IX superimposed. ..... S2 V3 L4 V5 S10

1192 gct ggg ggt caa agA TGA gt gtt tta gtg tat tct ttT gee tct ttc gtt End of VII | Start IX L13 W15 G20 T25 E29 1242 tta ggt tgg tgc ctt cgt agt ggc att acg tat ttt acc cgt tta atg gaa 196 1293 act tcc tc .... stop of IX, IX and VIII overlapped by four bases 1301 ATG aaa aag tct tta gtc ctc aaa gcc tct gta gcc gtt gct acc ctg Beginning of the signal sequence of viii. 1349 gtt ccg atg ctg tct ttc gct gct gg ggt gac gat ccc gca aaa gcg mature VIII ---> 1397 gcc ttt aac tcc ctg caa gcc tca gcg acc gaa tat ate ggt tat gcg 1445 tgg gcg atg gtt gtt gtc att 1466 gtc ggc gca act ggt ate aag ctg ttt aag

Bases 1499-1539 are likely promoters for 1499 aaa ttc acc teg aaa gca! 1515 .............- 35. . 1517 age tga taaaccgat acaattaag gctccttttg ......- 10 ... 1552 gagccttttt ttt GGAGAt ttt! S.D. capital letter, can be 9 Ts c ---- --- signal sequence III &gt; MKKLLF AIPLVVPF 1574 caac gtg aaa aaa tta tta ttc gca att cct tta gtt gtt cct ttc! 1620 1620 AND SGAAE S HLDGA tat tct ggc gCG GCC Gaa tca caT CTA GAc ggc gcc EagI ...... Xbal ....

Domain 1 1656 ETVESCLA gct gaa act gtt gaa agt tgt tta gca 1683 KSHTEISFTNVWKDDKT aaA Tcc cat aca gaa aat tca ttt aCT AAC GTC Tgg AAa GAC GAC AAA Act 1734 LDRYANYEGSLWNATGV tta gat cgt tac gct aac tat gag ggC tgt ctg tgg AAT GCt aca ggc gtt Bsml ... 197

I

VGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCG

1887 t gag ggt ggt ggt tct gag ggt ggc ggt act! Domain 2 ---- 1917 aaa cct cct gag tac ggt gat ac acct att ccg ggc tat act tat ate aac 1968 cct ctc gac ggc act tat ccg cct ggt act gag caa aac CCC gct aat cct 2019 aat cct tct ctt GAG GAG tct cag cct ctt aat act ttc atg ttt cag aat I BseRI * * 2070 aat agg ttc cga aat agg cag ggg gca tta act gtt tat acg ggc act 2118 gtt act caa ggc act gac ccc gtt aaa act tat tac cag tac act cct 2166 gta tea tea aaa gcc atg tat gac gct tac tgg aac ggt aaa ttc AGA AlwNI

2214 GAC TGc gct ttc cat tct ggc ttt aat gaG gat TTa ttT gtt tgt gaa AlwNI 2262 tat caa ggc caa tcg tct gac ctg cct ca acct cct gtc aat gct 2307 ggc ggc ggc tct! Start ------------------------------------------------- ----------------- 2319 ggt ggt tct 2331 ggt ggc ggc tct 2343 gag ggt ggt ggc tct gag gga ggc ggt tcc 2373 ggt ggt ggc tct ggt! end L2

Many published sequences of M13 derived offspring have a binding linkage greater than that shown here by repeats of the EGGGS motif more than twice. i! Domain 3 ---------------------------------------------- ----------------

I sgDFDYEKMANANKGA 2388 tcc ggt gat ttt gat tat gaa aag atg gca aac gct aat aag ggg gct 198

IIMTENADENALQSDAKG 2436 atg acc gaa aat gcc gat gaa aac gcg cta cct tct gac gct gct aaa ggc KLDSVATDYGAAMDGF 2484 aaa ctt gat tct gtc gct act gat tac ggt gct gct gct ggt ttc IGDVSGLANGNGATGD 2532 att ggt gac gtt tcc ggc ctt gct aat ggt aat ggt gct act ggt gat FAGSN s QMAQVGDGDN 2580 ttt gct gctc tct aat tcc caa atg gct caa gtc ggt gac gt gat aat SPLMNNFRQYLP s LPQ 2628 tca cct tta atg aat ttc cca ct cta cct tcc ccc cct caa SVECRPFVFGAGKPYE 2676 teg gtt gaa tgt ege cct ttc gtc ttt ggc gct ggt aaa cca tat gaa fsidcdkinlfr 2724 ttt tct att gat tgt gac aaa ata aac tta ttc cgt

End of Domain 3 GVFAFLLYVATFMYV f 14 o 2760 ggt gtc ttt gcg ttt ctt tta tat gtt gcc acc ttt atg tat gta ttt Beginning of the transmembrane segment

S T F A N I L 2808 tct acg ttt gct aac ata ctg

R N K E S 2829 cgt aat aag gag tct TAA! intracellular anchor stop.

Ml P2 V L L5 G I P LIO L R F L G15 2847 tc ATG cca gtt ctt ttg ggt att ccg tta tta ttg cgt ttc ctc ggt

Home VI 2894 2942 2990 ttc ctt ctg gta act ttg ttc ggc tat ctg ctt act ttt ctt aaa aag ggc ttc ggt aag ata gct att gct att tca ttg ttt ctt gct ctt att att ggg ctt aac tca att ctt gtg gt tt ctc tct gat att age gct 199 3038 caa tta ccc tct gac ttt gtt cag ggt gtt cag tta att ctc ccg tct 3086 aat gcg ctt ccc tgt ttt tat gtt att ctc tct gta aag gct gct att 3134 ttc att ttt gac gtt aa caa aaa ate gtt tct tat ttg gat tgg gat

Ml A2 V3 F5 LIO G13 3182 aa TAA t ATG gct gtt tat ttt gtc act ggc aaa tta ggc tct gga

End of VI Start of gene I K T L V S V G K I Q D I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 3273 ggg tgc aaa ata gea act aat ctt gat tta agg ctt caa aac ctc 1 P Q V G R F A K T P R V L R I! 3318 ccg caa gtc ggg agg ttc gct aaa acg cct ege gtt ctt aga ata 1 PDKPSISDLLAIGRG 1 3363 ccg gat aag cct tct ata tct gat ttg ctt gct att ggg ege ggt INDSYDENKNGLLVLD l 3408 aat gat tcc tac gat gaa aat aaa aac ggc ttg ctt gtt ctc gat IECGTWFNTRSWNDKE 1 3453 gag tgc ggt act tgg ttt aat acc cgt tct tgg aat gat aag gaa 1 RQPIIDWFLHARKLG 1 3498 aga cag ccg att att gat tgg ttt cta cat gct cgt aaa tta gga IWDIIFLVQDLSIVDK t 3543 tgg gat att att ttt ctt gtt cag gac tta att att att gtt gat 3.3.3. 1 QARSALAEHVVYRR 3588 cg 1 gcg cgt tct gea tta gct gaa cat gtt gtt tat tgt cgt cgt 1 LDRITLPFVGTLYSLI 3633 ctg gac aga att act tta cct ttt gtc ggt act tta tat tct ctt 1 ITGSKMPLPKLHVGV 3678 att act ggc teg aaa atg cct ctg cct aaa tta cat gtt ggc gtt 200 i

RW Τ V Ε VKYGDSQL SP 3723 gtt aaa tat ggc gat tct caa tta age cct act gtt gag cgt tgg LYTGKNLYNAYDTKQ 3768 ctt tat act ggt aag aat ttg tat aac gea tat gat act aaa cag AFSSNYDSGVYSYLT 3813 gct ttt tct agt aat tat gat tcc ggt gtt tat tct tat tta acg PYLSHGRYFKPLNLG 3858 cct tat tta tea cac ggt cgg tat ttc aaa cca tta aat tta ggt

QKMKLTKIYLKKFSR 3903 cag aag atg aaa tta aaa ata tat ttg aaa aag ttt tct ege CLCLAIGFASAFTYS 3948 gtt ctt tgt ctt gcg att gga ttt gea tea gea ttt aca tat agt YITQPKPEVKKVVSQ 3993 tat ata acc caa cct aag ccg gag gtt aaa aag gta gtc tct cag TYDFDKFTIDSSQRL 4038 acc tat gat ttt gat ttc: act. att gac: tct. tct cag 'cgt Ctt N Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y

PacI

INSDDLQKQGYSLTY 4128 ATT AAt age gac gat tta cag aag caa ggt tat tea etc aca tat PacI

IIDLCTVSIKKGNSNE iv Ml K 4173 att gat tta tgt act gtt tcc att aaa aaa ggt aat tea aAT Gaa

Beginning of IV I IVKCN. End of I iv L3 L N5 V 17 NF V10 4218 att gtt aaa tgt aat ATT T TTT GTT IV continued ..... 4243 ttc ttg at ttt ttt gtt tea tct tct tct gct cag gta att gaa atg 4291 aat aat teg cct ctg ege gat ttt gta act tgg tat tea aag caa tea 201 4339 ggc gaa tcc gtt att 4387 tat tca tct gac gtt 4435 gtt tta cgt geA aat 4483 att cag aag tat aat 4531 tca tct gat aat cag 4579 ttc ttt gtt ccg caa 4627 aac gtt cgg gea aag 4675 tct aat act tct aaa 4723 cta tta gtt gtt agt 4771 ttc ctt teA act gtt 4819 ttg ata ttt gag gtt 4867 gct ggc tct cag cgt 4915 ctc acc tct gtt tta 4963 ggc gat gtt tta ggg 5011 tca aa ata ttg tct &lt; 5059 g tb tct tct gtT M, 5107 act ggt gaa tct gcc a; 5155 caa aat gta ggt att 5203 ggt aat att gtt ctg 5251 tct act cag gea agt 5299 acg gtt aat ttg cgt 5347 gat tat aaa aac act 5395 ate cct tta ate ggc 5443 gaa age acg tta tac 5491 ccc ggc gaa tcc gtt att gtt tct ccc gat gta aaa ggt act gtt act gta t aaa cct t aat ttt t cca aac g gaa tat a aat gat g gat tt; a tcc tc; t gcT cct t gat ttc t cag ca; t ggc acl a tct tc t t t t t t t; gtg cca T GGC CAc MacI .... gcc jt at; t ct: &amp; agg g ac icc gg ac

TAG CGGCGCATT End IV aagcgcggcg 5503 5563 5623 gcccgctcct agctctaaat caaaaaactt 5683 5743 5803 tcgccctttG aacactccac accaccatca 5863 5923 5983 ctctctcagg aaaaccaccc aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgacca gcgccctagc gcccgctcct ttcgcttct tcccttcctt tctcgcaacg ttcGCCGGCt ttccccgtca

NgoMI. agctctaaat cgggggctcc ctttagggtt ccgatttagt gctttacggc acctcgaccc caaaaaactt gatttgggtg atggttCACG TAGTGggcca tcgccctgat agacggtttt

DraIII .... tcgccctttG ACGTTGGAGT Ccacgttctt taatagtgga ctcttgttcc aaactggaac DrdI ...... aacactccac cctatctcgg gctattcttt tgatttataa gggattttgc cgatttcgga accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg cttgctgcaa ctctctcagg gccaggcggt gaagggcaat CAGCTGttgc cCGTCTCact ggtgaaaaga

PvuII. BsmBI. tGGATCC AAGCTT BamHI HindIII (1/2) 202! insert gene transporter bla 6006 gcaggtg gcacttttcg gggaaatgtg cgcggaaccc

6043 ctatttgttt atttttctaa atacattcaa atatGTATCC gctcatgaga caataaccct! BciVI 6103 gataatgct tcaataatat tgaaaAGGA AGAgt! RBS.? ...! Home gene bla 6138 ATG agt att caa cat ttc cgt gtc gcc ctt att ccc ttt ttt gcg gea ttt 6189 tgc ctt cct gtt ttt gct cac cca gaa acg ctg gtg aa gta aaa gat gct 6240 gaa gat cag ttg ggC gcA CTA GTg ggt tac hasta gaa ctg gat ctc aac age

Spel ....

ApaLI &amp; BssSI removed 6291 ggt aag to ctt gag agt ttt cgc ccc gaa gaa cgt ttt cca atg atg age 6342 act tt. aaa &gt; gtt &lt; ctg i cta tgt GGC GcG Gta tta tcc &lt; cgt att gac gcc ggg 6393 caA gaG CAA CTC GGT CGc cGC ATA cAC tat tet cag aat gac ttg gtt gAG BegI. Seal 6444 TAC Tca cca gca aca cat ctt acg gat ggc atg aca gta aga gaa Seal. 6495 tta tgc agt gct gcc ata acc atg agt gat aac act gcg gcc aac tta ctt 6546 ctg aca aCG ATC Gga gga ccg aag gag cta acc gct tttg cac aac atg Pvul .... 6597 ggg gat cat gta act cgc ctt gat cgt tgg gaa ccg gag ctg aat: gaa. gcc 6648 ata cca aac gac gg cgt gac acc acg tag cct gta gea atg Gea aca acg 6699 tTG CGC Aaa cta tta act ggc gaa cta ctt cta gct tcc cgg caa caa FspI. . . . 6750 tta ata gac tgg atg gag gcg gat aaa gtt gca cca ctt ctg ege teg 6801 GCC ctt ccG GCt ggc tgg ttt att gct gat aaa tet gga gcc ggt gag cgt BglI .... . . . • 6852 gGG TCTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG . 6903 to gta gtt gta gta ga gga aga gg aGT Gag gaa gat gaa cga aat Ahdl. 6954 aga cag gct gag ata ggt gcc tca erg att aag cat tgg TAA ctgt stop 7003 cagaccaagt ttactcatat atactttaga. ttgatttaaa acttcatttt taatttaaaa 7063 ggatctaggt gaagatcctt tttgataatc: tcatgaccaa aatcccttaa cgtgagtttt 7123 cgttccactg tacgtaagac cccc 7147 AAGCTT GTCGAC tgaa tggcgaatgg cgctttgcct

HindIII SalI. . (2/2) HincII 203 7183 ggtttccggc accagaagcg gtgccggaaa actggctgga gtgcgatctt! Beginning of the Fab presentation envelope, Fab DSR-A05, selected to bind to a protein antigen. i 7233 CCTGAcG CTCGAG! xBau36I Xhol .. i! the PlacZ promoter is on the next block 7246 cgcaacgc aattaatgtg agttagctca 7274 ctcattaggc accccaggct ttacactta tgcttccggc tcgtatgttg 7324 tgtggaatg tgagcggata acaatttcac acaggaaaca gctatgacca 7374 tgattacgGG AagcttTGGa gcctttttt tggagatttt caac! PflMI ......! Hind3. (There are 3) Gene signal sequence: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 MKKLLFAIPLVVPFY 7418 gtg aaa tta tta ttc gea att cct tta gtt gtt cct ttc tat 16 17 18 Chain initiation light (L20: JK1) SHSAQDIQMTQ s PA 7463 tct cag aGT GCA Caa gac to cag at cca tct cca gee ApaLI. . . Sequence provided by the Extender ..... . . . . . TLSL 7505 acc ctg tct ttg s PGERATLSCRA s QG 7517 tct cca ggg gaa aga gee acc ctc tcc tgc agg gee agt cag Ggt V ss YLA w YQQKPGQA 7562 gtt age age tta gee tgg tac cag cag aaa cct ggc cag gct PRLLIYDA ss RATGI 7607 ccc agt ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc ctc tgt QQRSWHP wGGQGTR 7742 cag cag CGt aAc tgg cat ccg tgg ACG TTC GGC CAA GGG ACC AAG VEIKRTVAAPSVFIF 7787 gtg gaa aaa cga act gtg gCT GCA cca tet gtc ttc to ttc Bsg. P P S D E Q L K S G T A S V V 7832 ccg cca tet gat gag cag ttg aaa tet gga act gee tet gtt gtg c L L N N F Y P R E K V Q W 7877 tgc ctg ctg aat aac ttc tat ccc aga gag gee aa gta < ag ag ag K K TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER TER 80 80 80 80 80 80 80 80 80 80 ctg acG CTG AGC aaa gea gac tac gag aaa cac aaa gtc tac gee EspI .... - CEVTHQGLS s PVTK s 8057 tgc gaa gtc acc cat cag ggc ctG AGC TCg ccc gtc aca aag age Saci. F N R G E c. 8102 ttc aac agg gga gag tgt taa taa 8126 GGCGCG (CCaattctat ttcaa GGAGA cagtcata Assay RBS2 signal sequence PelB - (22 elbows)> 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Μ KYLLPTAAAGLLLL 8160 atg aaa t cg ttg cct acg gea gee gct gga ttg tta tta etc. • · · PelB signal - -> Home VH, FR1 --- -> 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 205 aaqpamaevqllesg gcG GCC cag ccG GCC atg gcc gaa gtt CAA TTG tta gag tct ggt

Sf il .......... Mfel.

Ncol .... 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 gglvqpggslrlsca 8250 ggc ggt ctt gtt cag cct ggt gt tct tta cgt ctt tct tgc gct. . . FR1 ------------ &gt; CDR1 -------------> FR2 -------- &gt; 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 asgftfstyemrwvr 8295 gct TCC GGA ttc act ttc tct act tac gag atg cgt tgg gtt cgC BspEI .. BstXI ... FR2 ---------- --------------------- &gt; CDR2 -------------- &gt; 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75

QAPGKGLEWVSYIAP 8340 CAa gct cct GGt aaa ggt ttg gag tgg gtt tct tat gct cct BstCI ........... . . CDR2 --------------------------------- FR3 ---- &gt; 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

SGGDTAYADSVKGRF 8385 tct ggt ggt gat act gct tat gct tg gt gt aaa ggt ege ttc 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105

TI SRDNSKNTLYLQM 8430 act to TCT AGA crac aac tct aag aat act etc tac ttg cag atg Xbal ...

Provided by Extender ---------------------------- 106 107 108 109 110 111 112 113 114 115 116 117 118 119 --- &gt; 120 N S A R A E D T A V Y Y C A R 8475 aac agC TTA AGe gct gac qac act qca gtc tac tat tgt gcg agg AflII. . . of Extender FR4 - CDR3 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 206 1 RLDGYISYYYGMDVW 8520 agg ctc gat ggc tat att tcc tac tacho ggt atg GAC GTC tgg 1 AatII .. I 126 137 138 139 140 141 142 143 144 145 1 GQGTTVTVSS 8565 gg ca ca g g g acc acc GG ACC ACC gtc tca age 1 BstEII .. - 1 CHI IgG1 -> 1 ASTKGPSVFPLAP s 8595 gcc tcc acc aag ggc cca gtc ttc ccc ctg gea ccc tcc tcc JK s TSGGTAALG c LVK 8640 aag age acc tet ggg ggc aca gcg gcc ctg ggc tgc ctg gtc aag IDYFPEPVTVSWNSGA 8685 gac tac ttc ccc gaa ccg gtg acg gtg teg tgg aac tca ggc gcc 1 LTSGVHTFPAVLQS s 8730 ctg acc age ggc gtc cac acc ttc ccg gct gtc cta gac tcc TCA I Bsu36I. . . I G L Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Bsu36I. t G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G M N D E N G R A N N N N N T Y N T K V D K K V E P K S c A A 8865 aac acc aag gtg gac aag aaa gtt gag ccc aaa tet tgt GCG GCC 11 Notl. 1 A H H H H H H G A E Q K L I 8910 GC cat cat cat cat cat g g g gea gaa caa aaa ctc ate! ..Notl. 1 H6 tag .. Myc- Tag. I S E E D L N G A A A A A A A A A A A A A

Myc-Tag ................. .Nhel. . .

Amber 207 III 'stump

Domain 3 of III - S G D F D E E M M N E N G E 8997 agt ggc gac ttc gac tac gac aaa atg gct aat gee aac aaa GGC GCC tcc t t t t g t t g g t t! W. T Kasl. (2/4) M T E N A D E N A L E S T A G G 9045 ATG ACT GAG AAC GCT GAC GAG aat gct ttg caa age gat gee aag ggt C a t c t a c g c a t t c c t a c! W.T. KL D S V A T D Y G A A D G F 9093 a g t g g g g g G G G G G G G G G G G G G AT G G G G G G G G G G G G G G G G G G G G G G G G G G G G G R Q T E T T ST T t t t!

NruI ... KasL ... (3/4)

I G D V G G G G G G G G G G G G G G G G T G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G GC G G G G G G G G G G G G G G G G G G G G G G R S MscI. ... (3/3) F A G S N S Q M A Q V G D G D N 9189 ttc GCA GGT teG AAT TCt cag atg gaC CAG GTT GGA GAT GGg gac aac t t c t t t c t t t t t! W.T

BspMI .. (2/2) Xcml

EcoRI ...

S P L M N N F R S S P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P W.T S V E C R P F V G S P G E G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G g g g g g g g g g g g g g g th e g t g y g t g t g t g t W.T

FS IDCDKINLFR 9333 ttc aGC Ate gac TGC gat aag tt ctt ttC CGC t tet tttcaactact!

BstAPI ....... SacII. . .

End of Domain 3 208

GVFAFLLYVATFMYVF 9369 GGc gtt ttc gct ttc ttg cta tac gtc gct act ttc atg tac gtt ttc tctg tcttattcct tat! W. T.

Beginning of the transmembrane segment STFANILRNKES 9417 aGC ACT TTC GCC AAT ATT TTA Cgc aac aaa gaa age tet gtte acgttgg tet! W.T. Intracellular anchor. 9453 tag tga tet CCT AGG AvrII .. 9468 aag ccc gee taa tga gcg ggc ttt ttt ttt et ggt Trp terminal

End of Fab wrap

ctggcagatg ccattacggt caatccgccg catttaatgt tgatgaaagc ttcctattgg ttaaaaaatg attaacgttt acaATTTAAA 9503 ATGCAT CCTGAGG ccgat actgtcgtcg tccccctcaaa .. Bsu36I NsiI. (3/3) 9551 9611 cacggttacg atgcgcccat ctacaccaac gtgacctatc tttgttccca cggagaatcc gacgggttgt tactcgctca 9671 tggctacagg aaggccagac gcgaattatt tttgatggcg 9731 agctgattta acaaaaattt aaTgcgaatt ttaacaaaat

Swai ... 9791 Tatttgctta tacaatcttc ctgtttttgg ggcttttctg attatcaacc GGGGTAcat 9850 ATG att gac atg cta gtt tta cga tta ccg ttc till gat tet ctt gtt tgc Gene start II 9901 tcc aga etc tea ggc aat gac ctg ata gee ttt gtA GAT CTc tea aaa ata BglII ... 9952 gct acc etc tcc ggc atT aat tta tea gct aga acg gtt gaa tat cat att 10003 gat ggt gat ttg act gtc tcc gtt ct tet cac cct ttt gaa tet tta cct 10054 aca cat tact ca ggc att gea ttt aaa ata tat gag ggt tet aaa aat ttt 10105 tat cct tgc gtt gaa ata aag gct tet ccc gea aaa gta tta cag ggt cat 10105 tat cct tgc gtt gaa ata aag gct tet ccc gea aaa gta tta cag ggt cat 10156 aat gtt ttt ggt aca acc gat tta gct tta tgc tet gag gct tta ttg ctt 10207 aat ttt gct aat tet ttg cct tgc ctg tat gat tta ttg gat gtt 1 gene II continues ----------------- ------------ End of Table 209

Table 37: DNA seq w.t. M13 gene iii

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 fM KKLLFAIPLVVPFY 1579 gtg aaa tta tta ttc gca att cct tta gtt gtt cct ttc tat Signal sequence 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 SHSAETVESCLAKPH 1624 tct cac tcc gct gaa act gtt gaa agt tgt tta gca aaa ccc cat Signal Sequence &gt; Domain 1 ---- 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 TENSFTNV wKDDKTL 1669 aca gaa aat tca ttt act aac gtc tgg aaa gac gac aaa act tta Domain 1 - 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 DRYANYEGCLWNATG 1714 gat cgt tac gct aac tat gag ggt tgt ctg tgG AAT GCt aca ggc Bsml Domain 1 --- 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 VVVCTGDETQCYGTW 1759 gtt gta gtt tgt act ggt gac gaa act cag tgt tac ggt aca tgg Domain 1 --- 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 VPIGLAIPENEGGGS 1804 gtt cct acc ggg ctt gct ate cct gaa aat gag ggt ggt ggc tct Domain 1 - - &gt; Connection element 1 91 92 93 94 95 9 6 97 98 99 100 1 101. 102 103 104 105 EGGGSEGGGs EGGGT 1849 gag ggt ggt tct gag ggt ggt ggt tct gag ggt ggt ggt act Element of determination 1 - 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 KPPEYGDTPIPGYTY 210 1894 aaa cct cct gag tac ggt gat ac acct att ccg ggc tat act tat

Domain 2

121 122 I N 1939 to aac

Domain 2 ------

136 137 P A 1984 ccc gct 123 124 125 126 P L D G cct etc. gac ggc Ecil ....

138 139 140 141 N P N P aat cct aat cct 127 128 129 130 T Y P P pact taT CCG CCt 142 143 144 145 S L E E tet ctt GAG GAG BseRI ..

131 132 133 134 G T E G gt act gag caa 146 147 148 149 S Q P L tet cag cct ctt 135 N aac 150 N aat

Domain 2 151 152 TF 2029 act ttc Domain 2 ----- 153 154 155 156 MFQN atg ttt cag aat 157 158 159 160 NRFR aat agg ttc cga 161 162 163 164 NRQG aat agg cag ggg 166 167 168 169 170 171 172 173 174 175 176 177 178 179 LTVYTGTVTQGTDP 2074 tta act gtt tat acg ggc act gtt act caa ggc act gac ccc Domain 2 -------------------------- -------------------- 181 182 183 184 185 186 187 188 189 190 191 192 193 194 KTYYQYTPVSSKAM 2119 aaa act tat tac cag tac act cct gta tea tea aaa gee atg Domain 2 ----------------------------------------------

196 197 198 199 200 201 202 203 204 205 206 207 208 209 DAYWNGKFRDCAFH 2164 gac gct tac tgg aac ggt aaa ttC AGa gaC TGc gct ttc cat AlwNI ... 165 A ge 180 V gtt 195 Y tat 210 S tet

Domain 2 211 212 213 214 215 216 217 218 219 220 221 222 223 224 GFNEDPFVCEYQGQ 2209 ggc ttt aat gaG GAT CCa ttc gtt tgt gaa tat caa ggc caa BamHI ... 225 S teg

Domain 2 211

I 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240

SDLPQPPCNAGGGSG 2254 tct gac ctg cct ca acct cct gtc aat gct ggc ggc ggc tct ggt Domain 2 ------------------------------- ----- &gt; Connection element 2 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255

GGSGGGSEGGGSEGG 2299 ggt ggt tct ggt ggc ggc tct gag ggt ggt ggc tct gag ggt ggc Connection element 2 ----------------------------- ----------------- 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270

GSEGGGSEGGGSGGG 2344 ggt tct gag ggt ggc ggc tct gag gg ggc ggt tcc ggt ggt ggt Connection element 2 ----------------------------- ----------------- 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 sgsgdfdyekmanan 2389 tct ggt tcc ggt gat ttt gat tat gaa aag atg gca aac gct aat Element of binding 2 &gt; Domain 3 ---------------------------------- 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300

KGAMTENADENALQS 2434 aag ggg gct atg acc gaa aat gcc gat gaa aac gcg cta cag tct Domain 3 ------------------------------- --------------- 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 dakgkldsvatdyga 2479 gac gct aaa ggc aaa ctt gat tct gtc gtc act gat tac ggt gct Domain 3- --------------------------------------------- 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 AIDGFIGDVSGLANG 2524 gct gt gt gt gt gt gt gt gt gt gt gt gt gt gt Domain 3 --------------------- ------------------------- 331 332 333 334 445 336 337 338 39 340 341 342 343 344 345 ngatgdfagsnsqma 2569 aat ggt gct act ggt gat ttt gct ggc tct aat tcc caa atg gct Domain 3 ----------------------------------------- ----- 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 212

QVGDGDNSPLMNNFR 2614 Domain name 3 - gtc ggt gc gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gat gaat ege cct ttt Domain 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 VFSAGKPYEFSIDCD 2704 Domain gtc ttt age gct ggt aaa cca tat gaa ttt tct att gat tgt gac O 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 KINLFRGVFAFLLYV 2749 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 406 407 408 409 410 411 412 413 414 415 416 417 418 aac ata ctg cgt Trans-membrane Segment - &gt; ICA- 421 422 423 424 425 N K E S 2839 aat aag gag tct taa! 2853 ICA -------------------- &gt; ICA = intracellular anchor

End of Table 213

Table 38: Anchor III Total maturation M13-III

Anchor Derivative with encoded DNA 12 3

A A A GC GC gca gca

Notl .......... 4 5 6 7 8 9 10 11 12 13 14 15 16 17 HHHHHHGAAEQKLI cat cat cat cat cat cat g gca gca gaa caa aaa ctc till 18 19 20 21 22 23 24 25 26 27 28 29 SEEDLNGAAAS gla gat gt gat gt gat gt g gt Gca Tag GCT AGC Nhel 30 31 32 33 34 35 36 37 38 39 DINDDRMAST GAT ATC aac gat gat cgt atg gct tet act (0N_G37bot) [RC] 5'-c aac qat qat cqt atg gcG Cat Gct gcc gag g-3 'EcoRV .. site of Enterocinase cleavage. beginning of mature III (recoded) Domain 1 --- &gt; 40 41 42 43 118 A E T V | gcG | gaG | acA | gtC | do not W. T. 1 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 1 E S C L A K P H T E N S F T N 130 | gaa | TCC | tgC 1CTG | GCC | AaG | ccT | caC | acT | gaG | aat I AGT | ttc 1 aCA | Aat! agt t a t c t a t t t c I | MscI. . . 1 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 1 V W K D D K T L D R Y A N Y E 175 | gtg T GG | aaG gaT | gaT | aaG | aaC | CtT gAT CGA TaT gcC aaT taC gaA 1 c a c t t t c t c t g

BspDI ... 214 265 265 310 355 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 G C L W N A T G V V C T G D 220 | ggC | tgC | Tta | tgg | aat | gcC | ACC | GGC | GtC | gtT | gtC | TGC ACG | ggC | gaT | tc c t t t t t t c W.T. SgrAI Bsgl. 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 E T Q C Y G T W V P I G LAI | gaG | acA | caA | tgC | taT | ggC | ACG | TGg | gtG | ccG | atA | gGC | TTA | GCC | atA | a t g t c t t t g t t c W.T. Pml I. BlpI • Domain 1- - &gt; Linking element 1- ---- &gt; 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 P E N G G G S E G G G S E G | cgG | gaG | aaC | gaA | ggC | ggC | ggT | AGC | gaA | ggC | ggT | ggC | AGC | gaA | ggC | t g t t t t g t t t t t t W. T. Linking Element 1-- ----- &gt; Domain 2 ---- 119 120 121 122 123 124 125 126 127 128 1299 130 131 132 133 G G S E G G G T K P P E Y G D | ggT | GGA | TCC | gaA | ggA | ggT | ggA | acC | aaG | ccG | ccG | gaA | taT | ggC | gaC | ct t g t c t t a t t g c t t! W.T. BamHI .. (2/2) 134 235 136 137 138 139 140 141 142 143 144 145 146 147 148 T P I P G Y T Y I N P L D G T acT | ccG | atA | CCT | ggi '| taC | acC | taC | atT | aaT | ccG | Tta | gaT | gga | acC | a t t g t t t c c t c c c t t! W.T. SexAI .... 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 Y P P G T E Q N P A N P N P S | taC | cct | ccG | ggC | acC | gaA | caG | aaT | ccT | gcC | aaC I ccG | aaC | cca | agc | T g t t t g t t t t t WT HindIII ... 400 445 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 LEESQPLNTFMFQNN | TTA | ggA | gaA | AGC | caA | ccG | TtA | aaC | acC | ttT | atg | ttC | caA | aaC | aaC | G tct gtctttc tgtt! 215 490. HindIII. 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 R F R N R Q G A L T V Y T G T 535 | Cgt | ttT AgG | aaC CgT | ccA | gGT | GCT CtT acC | gTG | TAC Ac TggA | acC a g c a t g g a t t t t g c t HgiAI ... BsrGI ... 194 195 19 6 197 198 199 200 201 202 203 204 205 206 207 208 V T Q G T D P V K T Y Y Q Y T 580 | gtc | acC caG | GGT ACC | gaT | ccT | gtC aaG acC | taC | taT caA | taT | acC t t c t c c t t t c c c t kpnl 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 P V S S RAM Y D A Y W N G K 625 | ccG | gtC TCG | AGt aaG | gcT | atg | taC gaT | gcC | taT | tgg | aaT | ggC | aag taa tca actctccta Bsal ... Xhol 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 FRDCAFHSGFNEDPF 670 | ttT | CgT | gaT | tgT | gcC | ttT | caC | AGC | ggT | ttC | aaC ga ga | gac | CCt | ttT c A c C tct tct c t t G T a c 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 V C E Y Q G S S D L P Q P 715 | gtC | tgC | gaG | taC caG | ggT | caG | AGT | AGC | gaT | TtA | ccG caG | ccA | CCG t t t t t t t t t t t t t t t t t t t t t t t ! W.T. ! W.T. ! W.T. ! W.T. DrdI .... Agel ....! Domain 2 -------- &gt; Connection Element 2 --------------------! 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268

! VNAGGGSGGGSGGGS

760 | GTT | AAC | gcG | ggT | ggT | ggT | AGC | ggC | ggA | ggC | AGC | ggC | ggT | ggT | AGC | W.T. ! c t t c c t t t t t t t t c c t t t! Agel ....! Hpal ....! HincII. 216! Link Element 2 -------------------------------------------- &gt;

Domain 3 -------- &gt;

1 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 1 E G G G E G G G G G G G G G G G G G G G G G G C G G G G G G G G G G G G G G G G B G G D E G g T G g T G g T G g T> AGC ggC | I g t t c t t t t t t t t t t t t t t t! W. T. I - Domain 3 -------- &gt; 1 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 1 S G D F D E E K M A N A N K G 850 | AGT | ggC | gac ttc gac tac | gag | aaa | atg | gct aat | gcc aac | aaa GGC | 1 tcc t t t t t g t t t g g! W.T 1 Kasl .... 1 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 1 A M E N A D E N A L S S A 895 | GCC | atg | act gag aac gct | gac | gaG | AAT | GCA | ctg | caa agt | gat | gCC | 1 t c t t t t t t t t t t t Kas I Bsml .... Sty 1 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 I K G K L D S V A T D Y G A A I 940 | AAG GGt | aag tta gac age | gTC | GCc | Aca gac tat | ggT | GCt | gcc ate | I have to c t t t t t t t t c t! W. T. ! Styl PflFI ... 1 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 1 G G G G G G G G G | gac ggc | ttt ate ggc gat | gtc | agt | ggt | ctg | gct | aac ggc | aac gga | 1 t t c t t c t tcc c c t t t t t! W.T. 1 344 345 346 347 348 349 350 351 352 353 1 A T G D F A G S N S 1030 | gcc | acc | gga | gac | ttc | GCA | GGT | tcG | AAT | TCt | ! ttttttct c! W. T.

BstBI ...

EcoRI ... bspMI ..

354 355 356 357 358 359 360 361 362 363 QMAQVGDGDN 217 1060 cag atg gcC CAG GTT GGA GAT GGg gac aac t a C t c t t t! W. T. 1 Xcml 1 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 1 S P L M N N E R E S P E S P E 1090 agt ccg ctt atg aac a tt cag ct ct ct ct ct ct ctt ccg cag 1 tca t t t t c c t t! W. T 1 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 1 S V E C R P F E F G E P E E 1138 agt gtc gg tgc cgt cca ttc gtt ttc tct gcc ggc aag cct tac gag 1 1 tcg t a t c t t c t age t t a t a! 1 Domain 3 - - &gt; 1 396 397 398 399 400 401 402 403 404 405 406 407 1 F S I D C D K I N L F R 1186 ttc aGC Ate gac TGC gat aag ate aat ctt ttc CGC 1 t tct t t t c a t t t 1 BstAPI. SaciI ... 1 transmembrane segment -> 1 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 1 G V F A L E V A T F M Y V F 1222 GGc gtt ttc gct ttc ttg cta tac gtc gct act ttc atg t g ttc t t t t t t t t t t t t t t t t t t t! W. T 1 424 425 426 427 428 429 430 431 432 433 434 435 1 S T A N I L R N K E S 1270 aGC ACT TTC GCC AAT ATT TTA Cgc aac aaa gaa age 1 tct g t t c a c g t t g g tct! W. T. 1 Intracellular anchor

1306 tag tga tct CCT AGG

AvrII ..

1321 aag ccc gcc taa tga gcg ggc ttt ttt ttt ct ggt I Terminal Trp I 218! End of Envelope Fab <End of Table ·

Table 39: On to make deletions on III! On for use with Nhel

N (ON_G29bot) 5'-c gTT gAT ATc gcT Age cTA Tgc-3 '! 22! this is the reverse complement of 5'-gca tag gcat age gat aac g-3 '! Nhel ... scab .......... (On_Gl04top) 5 '-g | ata | ggc | tta | gcT | aGC | ccg | gag | aac | gaa | gg-3'! 30! Scab ............. Nhel ... 104 105 106 107 107 (ON_G236top) 5 '-c | ttt | cac | age | ggt | ttc | GCT | AGC | gag | cct | ttt | gtc | tgc-3 '37 I (ON_G236tCS) i

Nhel ... 236 237 238 239 240 5 '-c | ttt | cac | age | ggt | ttc | GCT | AGC | gac | cct | ttt | gtc | Agc-

Nhel ... 236 237 238 239 240

I gag | tac | cag | ggt | c-3 '50! ON for use with Sphl G CAT Gc (ON_X37bot) 5'-gAc TgT cTc ggc Age ATg gt CAT Acg ATc ATc gTT g-3'! 37

! NDDRMAHA! (ON_X37bot) = [RC] 5'-c at gat gat cgt atg gcG Cat Gct g g g g gc-3 '! Sphl ... Scab ............... (ON_X104top) 5'-g (ON_X37bot) gtG ccg | ata | ggc | ttG | CAT | GCa | ccg | gag | aac | ga | gg-3 '! 36! scab ............................ Sphl____ 104 105 106 107 108 (ON_X236top) 5 '-c | ttt | cac | age | ggt | ttG | CaT | gCa | gac | cct | ttt | gtc | tgc-3 '! 37! Sphl. 236 237 238 239 240 (ON_X236tCS) 5 '-c | ttt | cac | age | ggt | ttG | CaT | gCa | gac | cct | ttt | gtc | Nhel ... 236 237 238 239 240

Table 40: Phage titers and concentration of a selection with a human Fab library based on DY3F31

Input (total cfu) Output (total cfu) Rl-ox input / output ration selected in phOx-BSA 4.5 x 1012 3.4 x 108 7.5 x 10-8 R2-strep selected on 9.2 x 1012 3 x 108 3.3 x 1CT5

Table 41: Frequency of ELISA positive in human Fab libraries based on DY3F31

Anti-Ml 3 HRP 9E10 / RAMHRP Anti-CK / CL Gar-HRP R2-ox (with IPTG induction) R2-ox (without IPTG) 18/44 13/4 10/44 ND 10/44 ND R3-strep IPTG) 39/44 38/44 36/44 R3-estrep (without IPTG) 33/44 ND ND 220

SEQUENCE LISTING

&lt; 110 &gt; LADNER, ROBERT C. COHEN, EDWARD H. NASTRI, HORACIO G. ROOKEY, KRISTIN L. HOET, RENE HOOGENBOOM, HENDRICUS R. J. M. &lt; 120 &gt; NEW METHODS OF CONSTRUCTION LIBRARIES UNDERSTANDING ELEMENTS

PRESENTED AND / OR EXPRESSED FROM A DIFFERENT FAMILY OF PEPTIDES, POLYPEPTIDES OR PROTEINS AND NEW LIBRARIES &lt; 130 &gt; DYAX / 002 CIP2 &lt; 140 &gt; &lt; 141 &gt; 10 / 045,674 2001-10-25 &lt; 150 &gt; &lt; 151 &gt; 06 / 198,069 2000-04-17 &lt; 150 &gt; &lt; 151 &gt; 09 / 837,306 2001-04-17 &lt; 16 0 &gt; 635 &lt; 170 &gt; Patentln Ver. 2.1 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 1 17 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 1 catgtgtatt actgtgc 17 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 2 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 2 cacatccgtg cttcttgcac ggatgtggca cagtaataca catg 44 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 3 DNA Artificial Sequence 221 &lt; 22 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 3 gtgtattaga ctgctgcc ??? 18

&lt; 210 &gt; 4 &lt; 211 &gt; 43 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 4 ggcagcagtc taatacacca catccgtgtt cttcacggat 43

&lt; 210 &gt; 5 &lt; 211 &gt; 47 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 5 cacatccgtg tttgttacac ggatgtggtg tcttacagtc cattctg 47

&lt; 210 &gt; 6 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 6 cagaatggac tgtaagacac 20

&lt; 210 &gt; 7 &lt; 211 &gt; 43 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 7 atcgagtctc actgagccac atccgtggtt ttccacggat gtg 43

&lt; 210 &gt; 8 &lt; 211 &gt; 17 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 222 &lt; 2 2 0 &gt;

Synthetic oligonucleotide &lt; 223 &gt; Description of the Artificial Sequence: &lt; 400 &gt; 8 gctcagtgag actcgat 17

&lt; 210 &gt; 9 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (10). . (24) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 9 cacgaggagn nnnnnnnnnn nnnn 24 &lt; 210 &gt; 10 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence

Synthetic oligonucleotide &lt; 400 &gt; 10 atgaccgaat tgctacaag 19

&lt; 210 &gt; 11 &lt; 211 &gt; 46 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Oligonucleotide &lt; 400 &gt; 11 gactcctcag cttcttgctg aggagtcctt gtagcaattc ggtcat &lt; 210 &gt; 12 &lt; 211 &gt; 6 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the sequence Art: Infect: 6 His tag &lt; 400 &gt; His His His His His His His His His 5 Synthetic 4 6 223

&lt; 210 &gt; 13 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (10) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 13 gtctcnnnnn 10

&lt; 210 &gt; 14 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (6) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 14 nnnnnagaga c 11

&lt; 210 &gt; 15 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (11) .. (24) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 15 cacggatgtg nnnnnnnnnn nnnn 24 &lt; 210 &gt; 16 &lt; 211 &gt; 24 &lt; 212 &gt; DNA Λ cn 1-1 CN V Sequence Art &lt; 2 2 0> &lt; 223 &gt; Description of ificial Artificial Sequence

Synthetic oligonucleotide 224 &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (14) &lt; 223 &gt; A, Τ, C, G, other or unknown &lt; 400 &gt; 16 ηηηηηηηηη nnnncacatc cgtg 24 &lt; 210 &gt; 17 &lt; 211 &gt; 14 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 17 gtgtattact gtgc 14

Synthetic oligonucleotide 10 &gt; 18 11 &gt; 34 12 &gt; DNA 13 &gt; Sequence 20 &gt; 23 &gt; Description 00 &gt; 18

Synthetic oligonucleotide cacatccgtg cacggatgtg gacactact acac 34 &lt; 210 &gt; 19 &lt; 211 &gt; 14 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Sequence &lt; 400 &gt; 19 Artificial gtgtattaga ctgc 14 &lt; 210 &gt; 20 &lt; 211 &gt; 34 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Sequence &lt; 400 &gt; 20 gcagtctaat acaccacatc cgtgcacgga tgtg

Synthetic oligonucleotide

Synthetic oligonucleotide 34 225 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 21 34 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 21 cacatccgtg cacggatgtg gtgtcttaca gtcc 34 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 22 14 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 22 ggactgtaag acac 14 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 23 34 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 23 gagtctcact gagccacatc cgtgcacgga tgtg ??? 21 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 24 14 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 24 gctcagtgag actc 14 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 25 14 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 25 gtgtattact gtgc 14 226 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; Artificial Sequence DNA &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 26 gtatattact gtgc 14 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; Artificial Sequence DNA &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 27 gtgtattact gtaa 14 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; Artificial Sequence DNA &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 28 gtgtattact gtac 14 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; Artificial Sequence DNA &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 29 ttgtattact gtgc 14 &lt; 210 &gt; 30 &lt; 211 &gt; 14 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Sequence &lt; 400 &gt; 30 ttgtatcact gtgc 14

Synthetic oligonucleotide 227

&lt; 210 &gt; 31 &lt; 211 &gt; 14 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 31 acatattact gtgc 14

&lt; 210 &gt; 32 &lt; 211 &gt; 14 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 32 acgtattact gtgc 14

&lt; 210 &gt; 33 &lt; 211 &gt; 14 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 33 atgtattact gtgc 14 &lt; 210 &gt; &Lt; tb &gt; 101

&lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 34 agggtcacca tgaccaggga cacgtccatc agcacagcct acatgabcga gctgagcagg 60 ctgagatctg acgacacggc cgtgtattac tgtgcgagag a 101

&lt; 210 &gt; &Lt; tb &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 35 agagtcacca ttaccaggga cacatccgcg agcacagcct acatggagct gagcagcctg 60 agatctgaag acacggctgt gtattactgt gcgagaga 98 228

&lt; 210 &gt; 36 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 36 agagtcacca tgaccaggaa cacctccata agcacagcct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtattactgt gcgagagg 98

&lt; 210 &gt; 37 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 37 agagtcacca tgaccacaga cacatccacg agcacagcct acatggagct gaggagcctg 60 agatctgacg acacggccgt gtattactgt gcgagaga 98

&lt; 210 &gt; 38 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 38 agagtcacca tgaccgagga cacatctaca gacacagcct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtattactgt gcaacaga 98

&lt; 210 &gt; 39 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 39 agagtcacca ttaccaggga caggtctatg agcacagcct acatggagct gagcagcctg 60 agatctgagg acacagccat gtattactgt gcaagata 98

&lt; 210 &gt; 40 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 40 agagtcacca tgaccaggga cacgtccacg agcacagtct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtattactgt gcgagaga 98

&lt; 210 &gt; 41 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens 229 &lt; 4 Ο Ο &gt; 41 agagtcacca ttaccaggga catgtccaca agcacagcct acatggagct gagcagcctg 60 agatccgagg acacggccgt gtattactgt gcggcaga 98

&lt; 210 &gt; 42 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 42 agagtcacga ttaccgcgga cgaatccacg agcacagcct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtattactgt gcgagaga 98

&lt; 210 &gt; 43 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 43 agagtcacga ttaccgcgga caaatccacg agcacagcct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtattactgt gcgagaga 98

&lt; 210 &gt; 44 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 44

agagtcacca taaccgcgga cacgtctaca gacacagcct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtattactgt gcaacaga 98 &lt; 210 &gt; 45 &lt; 211 &gt; 100 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 45

aggctcacca tcaccaagga cacctccaaa aaccaggtgg tccttacaat gaccaacatg 60 gaccctgtgg acacagccac atattactgt gcacacagac 100 &lt; 210 &gt; 46 &lt; 211 &gt; 100 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 46 aggctcacca tctccaagga cacctccaaa agccaggtgg tccttaccat gaccaacatg 60 gaccctgtgg acacagccac atattactgt gcacggatac 100 230 &lt; 210 &gt; 47 &lt; 211 &gt; 100 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 47 sapiens aggctcacca gaccctgtgg tctccaagga cacctccaaa aaccaggtgg tccttacaat gaccaacatg 60 acacagccac gtattactgt gcacggatac 100 &lt; 210 &gt; 48 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 48 sapiens cgattcacca agagccgagg tctccagaga caacgccaag aactcactgt atctgcaaat gaacagcctg 60 acacggctgt gtattactgt gcgagaga 98 &lt; 210 &gt; 49 &lt; 211 &gt; 100 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 49 sapiens cgattcacca agagctgagg tctccagaga caacgccaag aactccctgt atctgcaaat gaacagtctg 60 acacggcctt gtattactgt gcaaaagata 100 &lt; 210 &gt; 50 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 50 sapiens cgattcacca agagccgagg tctccaggga caacgccaag aactcactgt atctgcaaat gaacagcctg 60 acacggccgt gtattactgt gcgagaga 98 &lt; 210 &gt; 51 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 51 sapiens cgattcacca agagccgggg tctccagaga aaatgccaag aactccttgt atcttcaaat gaacagcctg 60 acacggctgt gtattactgt gcaagaga 98 &lt; 210 &gt; 52 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 52 agattcacca tctcaagaga tgattcaaaa aacacgctgt atctgcaaat gaacagcctg 60 aaaaccgagg acacagccgt gtattactgt accacaga 98

&lt; 210 &gt; 53 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 53 cgattcacca tctccagaga caacgccaag aactccctgt atctgcaaat gaacagtctg 60 agagccgagg acacggcctt gtatcactgt gcgagaga 98

&lt; 210 &gt; 54 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 54 cgattcacca tctccagaga caacgccaag aactcactgt atctgcaaat gaacagcctg 60 agagccgagg acacggctgt gtattactgt gcgagaga 98

&lt; 210 &gt; 55 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 55 cggttcacca tctccagaga caattccaag aacacgctgt atctgcaaat gaacagcctg 60 agagccgagg acacggccgt atattactgt gcgaaaga 98

&lt; 210 &gt; 56 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 56 cgattcacca tctccagaga caattccaag aacacgctgt atctgcaaat gaacagcctg 60 agagctgagg acacggctgt gtattactgt gcgaaaga 98

&lt; 210 &gt; 57 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 57 cgattcacca tctccagaga caattccaag aacacgctgt atctgcaaat gaacagcctg 60 agagctgagg acacggctgt gtattactgt gcgagaga 98 232

&lt; 210 &gt; 58 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 58 cgattcacca tctccagaga caattccaag aacacgctgt atctgcaaat gaacagcctg 60 agagctgagg acacggctgt gtattactgt gcgaaaga 98

&lt; 210 &gt; 59 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 59 cgattcacca tctccagaga caattccaag aacacgctgt atctgcaaat gaacagcctg 60 agagccgagg acacggctgt gtattactgt gcgagaga 98

&lt; 210 &gt; 60 &lt; 211 &gt; 100 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 60 cgattcacca tctccagaga caacagcaaa aactccctgt atctgcaaat gaacagtctg 60 agaactgagg acaccgcctt gtattactgt gcaaaagata 100

&lt; 210 &gt; 61 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 61 cgattcacca tctccagaga caatgccaag aactcactgt atctgcaaat gaacagcctg 60 agagacgagg acacggctgt gtattactgt gcgagaga 98

&lt; 210 &gt; 62 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 62 agattcacca tctcaagaga tggttccaaa agcatcgcct atctgcaaat gaacagcctg 60 aaaaccgagg acacagccgt gtattactgt actagaga 98 233

&lt; 210 &gt; 63 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 63 cgattcacca tctccagaga caattccaag aacacgctgt atcttcaaat gaacagcctg 60 agagccgagg acacggccgt gtattactgt gcgagaga 98

&lt; 210 &gt; 64 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 64 agattcacca tctccagaga caattccaag aacacgctgt atcttcaaat gggcagcctg 60 agagctgagg acatggctgt gtattactgt gcgagaga 98

&lt; 210 &gt; 65 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 65 agattcacca tctccagaga caattccaag aacacgctgt atcttcaaat gaacagcctg 60 agagctgagg acacggctgt gtattactgt gcgagaga 98

&lt; 210 &gt; 66 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 66 agattcacca tctcaagaga tgattcaaag aactcactgt atctgcaaat gaacagcctg 60 aaaaccgagg acacggccgt gtattactgt gctagaga 98

&lt; 210 &gt; 67 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 67 aggttcacca tctccagaga tgattcaaag aacacggcgt atctgcaaat gaacagcctg 60 aaaaccgagg acacggccgt gtattactgt actagaca 98

&lt; 210 &gt; 68 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens 234 &lt; 4 Ο Ο &gt; 68 cgattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagtctg 60 agagccgagg acacggctgt gtattactgt gcaagaga 98

&lt; 210 &gt; 69 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 4 0 0 &gt; 69 agattcacca tctccagaga caattccaag aacacgctgc atcttcaaat gaacagcctg 60 agagctgagg acacggctgt gtattactgt aagaaaga 98

&lt; 210 &gt; 70 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 70 cgagtcacca tatcagtaga caagtccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgcgg acacggccgt gtattactgt gcgagaga 98

&lt; 210 &gt; 71 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 71 cgagtcacca tgtcagtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgtgg acacggccgt gtattactgt gcgagaaa 98

&lt; 210 &gt; 72 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 72 cgagttacca tatcagtaga cacgtctaag aaccagttct ccctgaagct gagctctgtg 60 actgccgcgg acacggccgt gtattactgt gcgagaga 98

&lt; 210 &gt; 73 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 73 cgagtcacca tatcagtaga caggtccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgcgg acacggccgt gtattactgt gccagaga 98 235

&lt; 210 &gt; 74 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 74 cgagttacca tatcagtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 actgccgcag acacggccgt gtattactgt gccagaga 98

&lt; 210 &gt; 75 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 75 cgagttacca tatcagtaga cacgtctaag aaccagttct ccctgaagct gagctctgtg 60 actgccgcgg acacggccgt gtattactgt gcgagaga 98

&lt; 210 &gt; 76 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 76 cgagtcacca tatcagtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgcgg acacggctgt gtattactgt gcgagaga 98

&lt; 210 &gt; 77 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 77 cgagtcacca tatccgtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgcag acacggctgt gtattactgt gcgagaca 98

&lt; 210 &gt; 78 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 78 cgagtcacca tatcagtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 accgctgcgg acacggccgt gtattactgt gcgagaga 98

&lt; 210 &gt; 79 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 79 cgagtcacca tatcagtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 accgctgcgg acacggccgt gtattactgt gcgagaga 98

&lt; 210 &gt; 80 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 80 cgagtcacca tatcagtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgcag acacggccgt gtattactgt gcgagaga 98

&lt; 210 &gt; 81 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 81 caggtcacca tctcagccga caagtccatc agcaccgcct acctgcagtg gagcagcctg 60 aaggcctcgg acaccgccat gtattactgt gcgagaca 98

&lt; 210 &gt; 82 &lt; 211 &gt; 96 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 82 cacgtcacca tctcagctga caagtccatc agcactgcct acctgcagtg gagcagcctg 60 aaggcctcgg acaccgccat gtattactgt gcgaga 96

&lt; 210 &gt; 83 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 83 cgaataacca tcaacccaga cacatccaag aaccagttct ccctgcagct gaactctgtg 60 actcccgagg acacggctgt gtattactgt gcaagaga 98

&lt; 210 &gt; 84 &lt; 211 &gt; 98 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 84 cggtttgtct tctccttgga cacctctgtc agcacggcat atctgcagat ctgcagccta 60 aaggctgagg acactgccgt gtattactgt gcgagaga 98 237

&lt; 210 &gt; 85 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (3) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 85 gcnnnnnnng c 11

&lt; 210 &gt; 86 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (7) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 86 caynnnnrtg 10

&lt; 210 &gt; 87 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 87 gagtcnnnnn n 11

&lt; 210 &gt; 88 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide 238 <2 2 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (6) &lt; 223 &gt; A, Τ, C, G, other or unknown &lt; 400 &gt; 88 nnnnnagaga c 11

&lt; 210 &gt; 89 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (7) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 89 gaannnnttc 10

&lt; 210 &gt; 90 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Nucleotide Sequence 3-23 Synthetic FR3 &lt; 2 2 0 &gt; &lt; 221 &gt; CDS &lt; 222 &gt; (1) .. (90) &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (3) &lt; 223 &gt; A, T, C or G &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (9) &lt; 223 &gt; A, T, C or G &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (12)

&lt; 223 &gt; A, T, C or G &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (21)

&lt; 223 &gt; A, T, C or G 239 &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (30)

&lt; 223 &gt; A, Τ, C or G &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (36)

&lt; 223 &gt; Α, Τ, C or G <2 2 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (51)

&lt; 223 &gt; Α, Τ, C or G <2 2 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (57)

&lt; 223 &gt; Α, Τ, C or G <2 2 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (60)

&lt; 223 &gt; Α, Τ, C or G <2 2 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (69)

&lt; 223 &gt; Α, Τ, C or G <2 2 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (72)

&lt; 223 &gt; Α, Τ, C or G <2 2 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (75)

&lt; 223 &gt; Α, Τ, C or G <2 2 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (78)

&lt; 223 &gt; Α, Τ, C or G <2 2 0> &lt; 221 &gt; modified_base &lt; 2 2 2 &gt; (87)

&lt; 223 &gt; Α, Τ, C or G &lt; 400 &gt; 90 acn ath wsn mgn gay aay wsn aar aay acn ytn tay ttn car atg aay 48 Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn 1 5 10 15 wsn ttr mgn gcn gar gay acn gcn gtn tay tay tgy gcn aar 90 Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys 20 25 30 240 &lt; 210 &gt; 91 &lt; 211 &gt; 30 &lt; 212 &gt; PRT &lt; 213 &gt; Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description &lt; 400 &gt; 91 Thr Ile Ser Arg

Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn 10 15

Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys 20 &lt; 210 &gt; 92 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Sequence &lt; 400 &gt; 92 agttctccct gcagctgaac tc 25 30 22

&lt; 210 &gt; 93 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 93 cactgtatct gcaaatgaac ag ??? 22

&lt; 210 &gt; 94 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 94 ccctgtatct gcaaatgaac ag ??? 22

&lt; 210 &gt; 95 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Probe 241 &lt; 400 &gt; 95 ccgcctacct gcagtggagc ag &lt; 210 &gt; 96 &lt; 211 &gt; 22 &lt; 212 &gt; DNA Λ cn 1-1 CN V Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 96

Synthetic probe cgctgtatct gcaaatgaac ag 22 &lt; 210 &gt; 97 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 97

Synthetic probe cggcatatct gcagatctgc ag 22 &lt; 210 &gt; 98 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Sequence &lt; 400 &gt; 98 cggcgtatct gcaaatgaac ag

Artificial: Synthetic probe 22 &lt; 210 &gt; 99 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 99

Synthetic probe ctgcctacct gcagtggagc ag 22

&lt; 210 &gt; 100 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Probe 242 &lt; 400 &gt; 100

tcgcctatct gcaaatgaac ag &lt; 210 &gt; 101 &lt; 211 &gt; 63 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 101

cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaacagctta 60 agg 63 &lt; 210 &gt; 102 &lt; 211 &gt; 45 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 102 caagtagaga gtattcttag agttgtctct agacttagtg aagcg 45

&lt; 210 &gt; 103 &lt; 211 &gt; 54 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 103 cgcttcacta agtctagaga caactctaag aatactctct acttgcagct gaac 54

&lt; 210 &gt; 104 &lt; 211 &gt; 54 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 104 cgcttcacta agtctagaga caactctaag aatactctct acttgcaaat gaac 54

&lt; 210 &gt; 105 &lt; 211 &gt; 54 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 243 &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 105 cgcttcacta agtctagaga caactctaag aatactctct acttgcagtg gagc ??? 54 &lt; 210 &gt; 106 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 106 cgcttcacta agtctagaga c 21 &lt; 210 &gt; 107 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic &lt; 400 &gt; 107 acatggagct gagcagcctg ag 22 &lt; 210 &gt; 108 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 108 acatggagct gagcaggctg ag 22 &lt; 210 &gt; 109 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 109 acatggagct gaggagcctg ag 22 244 &lt; 210 &gt; 110 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Sequence &lt; 400 &gt; 110 acctgcagtg gagcagcctg aa &lt; 210 &gt; 111 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Sequence &lt; 400 &gt; 111 atctgcaaat gaacagcctg aa &lt; 210 &gt; 112 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Sequence &lt; 400 &gt; 112 atctgcaaat gaacagcctg ag &lt; 210 &gt; 113 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Sequence &lt; 400 &gt; 113 atctgcaaat gaacagtctg ag &lt; 210 &gt; 114 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Sequence &lt; 400 &gt; 114 atctgcagat ctgcagccta aa

Artificial: Synthetic probe 22

Artificial: Synthetic probe 22

Artificial: Synthetic probe 22

Artificial: Synthetic probe 22

Artificial: Synthetic probe 22 245 &lt; 210 &gt; 115 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 115 atcttcaaat gaacagcctg ag 22 &lt; 210 &gt; 116 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 116 atcttcaaat gggcagcctg ag 22 &lt; 210 &gt; 117 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 117 ccctgaagct gagctctgtg ac 22 &lt; 210 &gt; 118 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 118 ccctgcagct gaactctgtg ac 22 &lt; 210 &gt; 119 &lt; 211 &gt; 22 &lt; 212 &gt; DNA Λ cn 1-1 CN V Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence

Synthetic probe

Synthetic probe

Synthetic probe

Synthetic probe

Synthetic probe 246 22 < 4 Ο Ο &gt; 119 tccttacaat gaccaacatg ga &lt; 210 &gt; 120 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 120 tcctt. accat gaccaacatg ga 22 &lt; 210 &gt; 121 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 121 acatggagct gagcagcctg ag 22 &lt; 210 &gt; 122 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 122 ccctgaagct gagctctgtg ac 22 &lt; 210 &gt; 123 &lt; 211 &gt; 54 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 123 cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaac 54

&lt; 210 &gt; 124 &lt; 211 &gt; 60 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide 247 &lt; 400 &gt; 124 cgcttcactc agtctagaga taacagtaaa aatactttgt acttgcagct gagcagcctg &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 125 60 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 125 cgcttcactc agtctagaga taacagtaaa aatactttgt acttgcagct gagctctgtg &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 126 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 126 tcagctgcaa gtacaaagta tttttactgt tatctctaga ctgagtgaag cg 52 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 127 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 127 cgcttcactc agtctagaga taac 24 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 128 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 128 ccgtgtatta ctgtgcgaga ga 22

&lt; 210 &gt; 129 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide 248 22 < 4 Ο Ο &gt; 129 ctgtgtatta ctgtgcgaga ga &lt; 210 &gt; 130 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 130 ccgtgtatta ctgtgcgaga gg 22 &lt; 210 &gt; 131 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 131 ccgtgtatta ctgtgcaaca ga 22 &lt; 210 &gt; 132 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 132 ccatgtatta ctgtgcaaga ta 22 &lt; 210 &gt; 133 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 133 ccgtgtatta ctgtgcggca ga 22 &lt; 210 &gt; 134 &lt; 211 &gt; 22 &lt; 212 &gt; DNA Λ cn 1-1 CN V Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide 249 &lt; 4 Ο Ο &gt; 134 ccacatatta ctgtgcacac ag &lt; 210 &gt; 135 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 135 ccacatatta ctgtgcacgg at 22 &lt; 210 &gt; 136 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 136 ccacgtatta ctgtgcacgg at 22 &lt; 210 &gt; 137 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 137 ccttgtatta ctgtgcaaaa ga 22 &lt; 210 &gt; 138 &lt; 211 &gt; 22 &lt; 212 &gt; DNA Λ cn 1-1 CN V Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 138 ctgtgtatta ctgtgcaaga ga 22 &lt; 210 &gt; 139 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide 250 &lt; 400 &gt; 139 ccgtgtatta ctgtaccaca ga &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 140 22 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 140 ccttgtatca ctgtgcgaga ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 141 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 141 ccgtatatta ctgtgcgaaa ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 142 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 142 ctgtgtatta ctgtgcgaaa ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 143 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 143 ccgtgtatta ctgtactaga ga 22

&lt; 210 &gt; 144 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 251 &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 144 ccgtgtatta ctgtgctaga ga 22 &lt; 210 &gt; 145 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 145 ccgtgtatta ctgtactaga ca 22 &lt; 210 &gt; 146 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 146 ctgtgtatta ctgtaagaaa ga 22 &lt; 210 &gt; 147 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 147 ccgtgtatta ctgtgcgaga aa 22 &lt; 210 &gt; 148 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 148 ccgtgtatta ctgtgccaga ga 22 &lt; 210 &gt; 149 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide 252 &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 149 ctgtgtatta ctgtgcgaga ca 22 &lt; 210 &gt; 150 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 150 ccatgtatta ctgtgcgaga ca 22 &lt; 210 &gt; 151 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 151 ccatgtatta ctgtgcgaga 20 &lt; 210 &gt; 152 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 152 ccgtgtatta ctgtgcgaga ??? 21 &lt; 210 &gt; 153 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 153 ctgtgtatta ctgtgcgaga g ??? 21 &lt; 210 &gt; 154 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide 253 &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 154 ccgtgtatta ctgtgcgaga g 21 &lt; 210 &gt; 155 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 155 ccgtatatta ctgtgcgaaa g 21 &lt; 210 &gt; 156 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 156 ctgtgtatta ctgtgcgaaa g ??? 21 &lt; 210 &gt; 157 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 157 ctgtgtatta ctgtgcgaga c 21 &lt; 210 &gt; 158 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 158 ccatgtatta ctgtgcgaga c 21 &lt; 210 &gt; 159 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide

Synthetic oligonucleotide &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 159

ccatgtatta ctgtgcgaga ??? 20 &lt; 210 &gt; 160 &lt; 211 &gt; 94 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 160

ggtgtagtga tctagtgaca actctaagaa tactctctac ttgcagatga acagctttag 60 ggctgaggac actgcagtct actattgtgc gag 94 &lt; 210 &gt; 161 &lt; 211 &gt; 94 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 161 ggtgtagtga tctagtgaca actctaagaa tactctctac ttgcagatga acagctttag 60 ggctgaggac actgcagtct actattgtgc gaaa 94

&lt; 210 &gt; 162 &lt; 211 &gt; 85 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 162 atagtagact gcagtgtcct cagcccttaa gctgttcatc tgcaagtaga gagtattctt 60 agagttgtct ctagatcact acacc 85

&lt; 210 &gt; 163 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 163 ggtgtagtga tctagagaca ac 22 255

&lt; 210 &gt; 164 &lt; 211 &gt; 55 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 164 ggtgtagtga aacagcttta gggctgagga cactgcagtc tactattgtg cgaga 55

&lt; 210 &gt; 165 &lt; 211 &gt; 55 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 165 ggtgtagtga aacagcttta gggctgagga cactgcagtc tactattgtg cgaaa 55

&lt; 210 &gt; 166 &lt; 211 &gt; 46 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 166 atagtagact gcagtgtcct cagcccttaa gctgtttcac tacacc 46

&lt; 210 &gt; 167 &lt; 211 &gt; 46 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 167 ggtgtagtga aacagcttaa gggctgagga cactgcagtc tactat 46

&lt; 210 &gt; 168 &lt; 211 &gt; 26 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt;

Synthetic oligonucleotide &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 168 ggtgtagtga aacagcttaa gggctg 26 &lt; 210 &gt; 169 256

&lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 169 agttctccct gcagctgaac tc ??? 22

&lt; 210 &gt; 170 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 170 cactgtatct gcaaatgaac ag ??? 22

&lt; 210 &gt; 171 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 171 ccctgtatct gcaaatgaac ag ??? 22

&lt; 210 &gt; 172 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 172 ccgcctacct gcagtggagc ag ??? 22

&lt; 210 &gt; 173 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 173 cgctgtatct gcaaatgaac ag 257 22

&lt; 210 &gt; 174 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 174 cggcatatct gcagatctgc ag 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 175 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 175 cggcgtatct gcaaatgaac ag ??? 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 176 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 176 ctgcctacct gcagtggagc ag ??? 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 177 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 177 tcgcctatct gcaaatgaac ag 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 178 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Oligonucleotide &lt; 400 &gt; 178 acatggagct gagcagcctg ag 22 258 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 179 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 179 acatggagct gagcaggctg ag 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 180 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 180 acatggagct gaggagcctg ag 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 181 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 181 acctgcagtg gagcagcctg aa 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 182 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 182 atctgcaaat gaacagcctg aa 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 183 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 183 atctgcaaat gaacagcctg ag ??? 22

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide 259

&lt; 210 &gt; 184 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 184 atctgcaaat gaacagtctg ag 22 &lt; 210 &gt; 185 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 185 atctgcagat ctgcagccta aa 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 186 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 186 atcttcaaat gaacagcctg ag 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 187 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 187 atcttcaaat gggcagcctg ag 22 &lt; 210 &gt; 188 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic oligonucleotide &lt; 400 &gt; 188 ccctgaagct gagctctgtg ac 22 260 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 189 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 189 ccctgcagct gaactctgtg ac 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 190 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 190 tccttacaat gaccaacatg ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 191 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 191 tccttaccat gaccaacatg ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 192 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 192 ccgtgtatta ctgtgcgaga ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 193 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 193 ctgtgtatta ctgtgcgaga ga 22

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide 261 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 194 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 194 ccgtgtatta ctgtgcgaga gg 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 195 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 195 ccgtgtatta ctgtgcaaca ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 19 6 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 196 ccatgtatta ctgtgcaaga ta 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; Artificial Sequence DNA &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 197 ccgtgtatta ctgtgcggca ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 198 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 198 ccacatatta ctgtgcacac ag 22

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide 262 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 199 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 199 ccacatatta ctgtgcacgg at 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 200 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 200 ccacgtatta ctgtgcacgg at 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 201 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 201 ccttgtatta ctgtgcaaaa ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 202 22 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 202 ctgtgtatta ctgtgcaaga ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 203 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 203 ccgtgtatta ctgtaccaca ga 22

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide 263 &lt; 210 &gt; 204 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 204 ccttgtatca ctgtgcgaga ga 22 &lt; 210 &gt; 205 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 205 ccgtatatta ctgtgcgaaa ga 22 &lt; 210 &gt; 206 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 206 ctgtgtatta ctgtgcgaaa ga 22 &lt; 210 &gt; 207 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 207 ccgtgtatta ctgtactaga ga 22 &lt; 210 &gt; 208 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 208 ccgtgtatta ctgtgctaga ga 22 264 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 209 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 209 ccgtgtatta ctgtactaga ca 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 210 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 210 ctgtgtatta ctgtaagaaa ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 211 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 211 ccgtgtatta ctgtgcgaga aa 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 212 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 212 ccgtgtatta ctgtgccaga ga 22 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 213 22 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 213 ctgtgtatta ctgtgcgaga ca 22

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide 265

&lt; 210 &gt; 214 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 214 ccatgtatta ctgtgcgaga ca 22

&lt; 210 &gt; 215 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 215 ccatgtatta ctgtgcgaga aa 22

&lt; 210 &gt; 216 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 216

caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg cttctggata caccttcacc &lt; 210 &gt; 217 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 217

caggtccagc ttgtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtt 60 tcctgcaagg cttctggata caccttcact &lt; 210 &gt; 218 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 218

caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg cttctggata caccttcacc &lt; 210 &gt; 219 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens 266 &lt; 400 &gt; 219 caggttcagc tggtgcagtc tggagctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg cttctggtta cacctttacc 90 &lt; 210 &gt; 220 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 220 caggtccagc tggtacagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg tttccggata caccctcact &lt; 210 &gt; 221 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 221 cagatgcagc tggtgcagtc tggggctgag gtgaagaaga ctgggtcctc agtgaaggtt 60 tcctgcaagg cttccggata caccttcacc &lt; 210 &gt; 222 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 222 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtt 60 tcctgcaagg catctggata caccttcacc &lt; 210 &gt; 223 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 223 caaatgcagc tggtgcagtc tgggcctgag gtgaagaagc ctgggacctc agtgaaggtc 60 tcctgcaagg cttctggatt cacctttact 90 &lt; 210 &gt; 224 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 224 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagc 90 267 &lt; 210 &gt; 225 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 225 sapiens caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagc &lt; 210 &gt; 226 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 226 gaggtccagc tggtacagtc tggggctgag gtgaagaagc ctggggctac agtgaaaatc 60 tcctgcaagg tttctggata caccttcacc &lt; 210 &gt; 227 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 227 cagatcacct tgaaggagtc tggtcctacg ctggtgaaac ccacacagac cctcacgctg 60 acctgcacct tctctgggtt ctcactcagc &lt; 210 &gt; 228 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 228 caggtcacct tgaaggagtc tggtcctgtg ctggtgaaac ccacagagac cctcacgctg 60 acctgcaccg tctctgggtt ctcactcagc &lt; 210 &gt; 229 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 229 caggtcacct tgaaggagtc tggtcctgcg ctggtgaaac ccacacagac cctcacactg 60 acctgcacct tctctgggtt ctcactcagc 90 268

&lt; 210 &gt; 230 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 230 gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttagt 90

&lt; 210 &gt; 231 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; G1

&lt; 210 &gt; 232 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 232 caggtgcagc tggtggagtc tgggggaggc ttggtcaagc ctggagggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt 90

&lt; 210 &gt; 233 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 233 gaggtgcagc tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt 90

&lt; 210 &gt; 234 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 234 gaggtgcagc tggtggagtc tgggggaggc ttggtaaagc ctggggggtc ccttagactc 60 tcctgtgcag cctctggatt cactttcagt 90 269

&lt; 210 &gt; 235 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 235 gaggtgcagc tggtggagtc tgggggaggt gtggtacggc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat 90

&lt; 210 &gt; 236 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 236 gaggtgcagc tggtggagtc tgggggaggc ctggtcaagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt 90

&lt; 210 &gt; 237 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 237 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttagc 90

&lt; 210 &gt; 238 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 238 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt 90

&lt; 210 &gt; 239 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 239 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt 90

&lt; 210 &gt; 240 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens 270 &lt; 4 Ο Ο &gt; 240

caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt &lt; 210 &gt; 241 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 241

caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cgtctggatt caccttcagt &lt; 210 &gt; 242 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 242

gaagtgcagc tggtggagtc tgggggagtc gtggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat &lt; 210 &gt; 243 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 243

gaggtgcagc tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt &lt; 210 &gt; 244 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 244

gaggtgcagc tggtggagtc tgggggaggc ttggtacagc cagggcggtc cctgagactc 60 tcctgtacag cttctggatt cacctttggt 90 &lt; 210 &gt; 245 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 245 gaggtgcagc tggtggagac tggaggaggc ttgatccagc ctggggggtc cctgagactc 60 tcctgtgcag cctctgggtt caccgtcagt 90 271

&lt; 210 &gt; 246 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 246 gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt 90

&lt; 210 &gt; 247 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 247 gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccgtcagt 90

&lt; 210 &gt; 248 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 248 gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggagggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt 90

&lt; 210 &gt; 249 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 249 gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgaaactc 60 tcctgtgcag cctctgggtt caccttcagt 90

&lt; 210 &gt; 250 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 250 gaggtgcagc tggtggagtc cgggggaggc ttagttcagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt 90

&lt; 210 &gt; 251 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 251

gaggtgcagc tggtggagtc tcggggagtc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccgtcagt &lt; 210 &gt; 252 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 252

caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggggac cctgtccctc 60 acctgcgctg tctctggtgg ctccatcagc &lt; 210 &gt; 253 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 253

caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggacac cctgtccctc 60 acctgcgctg tctctggtta ctccatcagc &lt; 210 &gt; 254 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 254

caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcacagac cctgtccctc 60 acctgcactg tctctggtgg ctccatcagc &lt; 210 &gt; 255 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 255

cagctgcagc tgcaggagtc cggctcagga ctggtgaagc cttcacagac cctgtccctc 60 acctgcgctg tctctggtgg ctccatcagc &lt; 210 &gt; 256 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 256 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcacagac cctgtccctc 60 acctgcactg tctctggtgg ctccatcagc 90 273

&lt; 210 &gt; 257 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 257 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcacagac cctgtccctc 60 acctgcactg tctctggtgg ctccatcagc 90

&lt; 210 &gt; 258 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 258 caggtgcagc tacagcagtg gggcgcagga ctgttgaagc cttcggagac cctgtccctc 60 acctgcgctg tctatggtgg gtccttcagt 90

&lt; 210 &gt; 259 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 259 cagctgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggagac cctgtccctc 60 acctgcactg tctctggtgg ctccatcagc 90

&lt; 210 &gt; 260 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 260 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggagac cctgtccctc 60 acctgcactg tctctggtgg ctccatcagt 90

&lt; 210 &gt; 261 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 261 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggagac cctgtccctc 60 acctgcactg tctctggtgg ctccgtcagc 90

&lt; 210 &gt; 262 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 262

caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggagac cctgtccctc 60 acctgcgctg tctctggtta ctccatcagc &lt; 210 &gt; 263 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 263

gaggtgcagc tggtgcagtc tggagcagag gtgaaaaagc ccggggagtc tctgaagatc 60 tcctgtaagg gttctggata cagctttacc 90 &lt; 210 &gt; 264 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 264

gaagtgcagc tggtgcagtc tggagcagag gtgaaaaagc ccggggagtc tctgaggatc 60 tcctgtaagg gttctggata cagctttacc 90 &lt; 210 &gt; 265 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 265

caggtacagc tgcagcagtc aggtccagga ctggtgaagc cctcgcagac cctctcactc 60 acctgtgcca tctccgggga cagtgtctct 90 &lt; 210 &gt; 266 &lt; 211 &gt; 90 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 266

caggtgcagc tggtgcaatc tgggtctgag ttgaagaagc ctggggcctc agtgaaggtt 60 tcctgcaagg cttctggata caccttcact &lt; 210 &gt; 267 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide 275 < 4 Ο Ο &gt; 267 ccgtgtatta ctgtgcgaga ga 22 &lt; 210 &gt; 268 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 268 ctgtgtatta ctgtgcgaga ga 22 &lt; 210 &gt; 269 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 269 ccgtgtatta ctgtgcgaga gg 22 &lt; 210 &gt; 270 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 270 ccgtatatta ctgtgcgaaa ga 22 &lt; 210 &gt; 271 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 271 ctgtgtatta ctgtgcgaaa ga 22 &lt; 210 &gt; 272 &lt; 211 &gt; 22 &lt; 212 &gt; DNA Λ cn 1-1 CN V Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide

Synthetic Oligonucleotide &lt; 400 &gt; 272 ctgtgtatta ctgtgcgaga ca 22

&lt; 210 &gt; 273 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 273 ccatgtatta ctgtgcgaga ca 22 &lt; 210 &gt; 274 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 274 ccatgtatta ctgtgcgaga aa 22 &lt; 210 &gt; 275 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 275 gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc ??? 21 &lt; 210 &gt; 276 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 276 gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc ??? 21 &lt; 210 &gt; 277 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 277 gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 277 &lt; 210 &gt; 278 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 278 sapiens gacatccaga atcacttgc tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 &lt; 210 &gt; 279 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 279 sapiens gacatccaga atcacttgc tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 &lt; 210 &gt; 280 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 280 sapiens gacatccaga atcacttgc tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 &lt; 210 &gt; 281 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 281 sapiens aacatccaga atcacttgt tgacccagtc tccatctgcc atgtctgcat ctgtaggaga cagagtcacc 60 &lt; 210 &gt; 282 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 282 sapiens gacatccaga atcacttgt tgacccagtc tccatcctca ctgtctgcat ctgtaggaga cagagtcacc 60 &lt; 210 &gt; 283 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens 278 &lt; 4 Ο Ο &gt; 283

gacatccaga tgacccagtc tccatcctca ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgt ??? 21 &lt; 210 &gt; 284 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 284

gccatccagt tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc ??? 21 &lt; 210 &gt; 285 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 285

gccatccagt tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc ??? 21 &lt; 210 &gt; 286 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 286

gacatccaga tgacccagtc tccatcttcc gtgtctgcat ctgtaggaga cagagtcacc 60 atcacttgt ??? 21 &lt; 210 &gt; 287 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 287

gacatccaga tgacccagtc tccatcttct gtgtctgcat ctgtaggaga cagagtcacc 60 atcacttgt ??? 21 &lt; 210 &gt; 288 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 288 gacatccagt tgacccagtc tccatccttc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc ??? 69 &lt; 210 &gt; 289 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 289 sapiens gccatccgga atcacttgc tgacccagtc tccattctcc ctgtctgcat ctgtaggaga cagagtcacc 60 &lt; 210 &gt; 290 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 290 sapiens gccatccgga atcacttgt tgacccagtc tccatcctca ttctctgcat ctacaggaga cagagtcacc 60 &lt; 210 &gt; 291 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 291 sapiens gtcatctgga atcagttgt tgacccagtc tccatcctta ctctctgcat ctacaggaga cagagtcacc 60 &lt; 210 &gt; 292 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 292 sapiens gccatccaga atcacttgc tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 &lt; 210 &gt; 293 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 293 sapiens gacatccaga atcacttgc tgacccagtc tccttccacc ctgtctgcat ctgtaggaga cagagtcacc 60 &lt; 210 &gt; 294 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens 280 &lt; 400 &gt; 294

gatattgtga tgacccagac tccactctcc ctgcccgtca cccctggaga gccggcctcc 60 atctcctgc 69 &lt; 210 &gt; 295 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 295

gatattgtga tgacccagac tccactctcc ctgcccgtca cccctggaga gccggcctcc 60 atctcctgc 69 &lt; 210 &gt; 296 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 296

gatgttgtga tgactcagtc tccactctcc ctgcccgtca cccttggaca gccggcctcc 60 atctcctgc ??? 21 &lt; 210 &gt; 297 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 297

gatgttgtga tgactcagtc tccactctcc ctgcccgtca cccttggaca gccggcctcc 60 atctcctgc ??? 21 &lt; 210 &gt; 298 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 298

gatattgtga tgacccagac tccactctct ctgtccgtca cccctggaca gccggcctcc 60 atctcctgc 69 &lt; 210 &gt; 299 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 299 gatattgtga tgacccagac tccactctct ctgtccgtca cccctggaca gccggcctcc 60 atctcctgc 69 281 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 300 69 Homo sapiens DNA &lt; 400 &gt; 300 gatattgtga tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc 60 atctcctgc 69 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 301 69 Homo sapiens DNA &lt; 400 &gt; 301 gatattgtga tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc 60 atctcctgc 69 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 302 69 DNA Homo sapiens &lt; 400 &gt; 302 gatattgtga tgacccagac tccactctcc tcacctgtca cccttggaca gccggcctcc 60 atctcctgc ??? 21 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 303 69 DNA Homo sapiens &lt; 400 &gt; 303 gaaattgtgt tgacgcagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60 cctctcctg &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 304 69 Homo sapiens DNA &lt; 400 &gt; 304 gaaattgtgt tgacgcagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60 cctcctgc 69 282 &lt; 210 &gt; 305 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 305 gaaatagtga tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60 cctctcctg &lt; 210 &gt; 306 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 306 sapiens gaaatagtga tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60 ctctcctgc ??? 21 &lt; 210 &gt; 307 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 307 sapiens gaaattgtgt ctctcctgc tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60 &lt; 210 &gt; 308 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 308 sapiens gaaattgtgt ctctcctgc tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60 &lt; 210 &gt; 309 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 309 sapiens gaaattgtaa tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgc 69

&lt; 210 &gt; 310 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens 283 &lt; 4 Ο Ο &gt; 310

gacatcgtga tgacccagtc tccagactcc ctggctgtgt ctctgggcga gagggccacc 60 atcaactgc ??? 21 &lt; 210 &gt; 311 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 311

gaaacgacac tcacgcagtc tccagcattc atgtcagcga ctccaggaga caaagtcaac 60 atctcctgc ??? 21 &lt; 210 &gt; 312 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 312

gaaattgtgc tgactcagtc tccagacttt cagtctgtga ctccaaagga gaaagtcacc 60 atcacctgc ??? 21 &lt; 210 &gt; 313 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 313

gaaattgtgc tgactcagtc tccagacttt cagtctgtga ctccaaagga gaaagtcacc 60 atcacctgc ??? 21 &lt; 210 &gt; 314 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 314

gatgttgtga tgacacagtc tccagctttc ctctctgtga ctccagggga gaaagtcacc 60 atcacctgc ??? 21 &lt; 210 &gt; 315 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 315 cagtctgtgc tgactcagcc accctcggtg tctgaagccc ccaggcagag ggtcaccatc 60 tcctgt 66 284 &lt; 210 &gt; 316 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 316 sapiens cagtctgtgc tcctgc tgacgcagcc gccctcagtg tctggggccc cagggcagag ggtcaccatc 60 66 &lt; 210 &gt; 317 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 317 sapiens cagtctgtgc tcttgt tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 66 &lt; 210 &gt; 318 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 318 sapiens cagtctgtgc tcttgt tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 66 &lt; 210 &gt; 319 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 319 sapiens cagtctgtgt tcctgc tgacgcagcc gccctcagtg tctgcggccc caggacagaa ggtcaccatc 60 66 &lt; 210 &gt; 320 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 320 sapiens cagtctgccc tcctgc tgactcagcc tccctccgcg tccgggtctc ctggacagtc agtcaccatc 60 66 &lt; 210 &gt; 321 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 321

cagtctgccc tgactcagcc tcgctcagtg tccgggtctc ctggacagtc agtcaccatc 60 tcctgc 66 &lt; 210 &gt; 322 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 322

cagtctgccc tgactcagcc tgcctccgtg tctgggtctc ctggacagtc gatcaccatc 60 tcctgc 66 &lt; 210 &gt; 323 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 323

cagtctgccc tgactcagcc tccctccgtg tccgggtctc ctggacagtc agtcaccatc 60 tcctgc 66 &lt; 210 &gt; 324 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 324

cagtctgccc tgactcagcc tgcctccgtg tctgggtctc ctggacagtc gatcaccatc 60 tcctgc 66 &lt; 210 &gt; 325 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 325

tcctatgagc tgactcagcc accctcagtg tccgtgtccc caggacagac agccagcatc 60 acctgc 66 &lt; 210 &gt; 326 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 326 tcctatgagc tgactcagcc actctcagtg tcagtggccc tgggacagac ggccaggatt 60 acctgt 66 286

&lt; 210 &gt; 327 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 327 tcctatgagc tgacacagcc accctcggtg tcagtgtccc caggacaaac ggccaggatc 60 acctgc 66

&lt; 210 &gt; 328 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 328 tcctatgagc tgacacagcc accctcggtg tcagtgtccc taggacagat ggccaggatc 60 acctgc 66

&lt; 210 &gt; 329 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 329 tcttctgagc tgactcagga ccctgctgtg tctgtggcct tgggacagac agtcaggatc 60 acatgc 66

&lt; 210 &gt; 330 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 330 tcctatgtgc tgactcagcc accctcagtg tcagtggccc caggaaagac ggccaggatt 60 acctgt 66

&lt; 210 &gt; 331 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 331 tcctatgagc tgacacagct accctcggtg tcagtgtccc caggacagac agccaggatc 60 acctgc 66 287 &lt; 210 &gt; 332 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 332 sapiens tcctatgagc acctgc tgatgcagcc accctcggtg tcagtgtccc caggacagac ggccaggatc 60 66 &lt; 210 &gt; 333 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 333 sapiens tcctatgagc acctgc tgacacagcc atcctcagtg tcagtgtctc cgggacagac agccaggatc 60 66 &lt; 210 &gt; 334 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 334 sapiens ctgcctgtgc acctgc tgactcagcc cccgtctgca tctgccttgc tgggagcctc gatcaagctc 60 66 &lt; 210 &gt; 335 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 335 sapiens cagcctgtgc acctgc tgactcaatc atcctctgcc tctgcttccc tgggatcctc ggtcaagctc 60 66 &lt; 210 &gt; 336 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 336 sapiens cagcttgtgc acctgc tgactcaatc gccctctgcc tctgcctccc tgggagcctc ggtcaagctc 60 66 &lt; 210 &gt; 337 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens 288 &lt; 4 Ο Ο &gt; 337 cagcctgtgc tgactcagcc accttcctcc tccgcatctc ctggagaatc cgccagactc 60 acctgc 66

&lt; 210 &gt; 338 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 338

caggctgtgc tgactcagcc ggcttccctc tctgcatctc ctggagcatc agccagtctc 60 acctgc 66 &lt; 210 &gt; 339 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 339

cagcctgtgc tgactcagcc atcttcccat tctgcatctt ctggagcatc agtcagactc 60 acctgc 66 &lt; 210 &gt; 340 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 340

aattttatgc tgactcagcc ccactctgtg tcggagtctc cggggaagac ggtaaccatc 60 tcctgc 66 &lt; 210 &gt; 341 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 341

cagactgtgg tgactcagga gccctcactg actgtgtccc caggagggac agtcactctc 60 acctgt 66 &lt; 210 &gt; 342 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 342 caggctgtgg tgactcagga gccctcactg actgtgtccc caggagggac agtcactctc 60 acctgt 66 289 &lt; 210 &gt; 343 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo &lt; 400 &gt; 343 sapiens cagactgtgg tgacccagga gccatcgttc tcagtgtccc ctggagggac agtcacactc 60 acttgt 66 &lt; 210 &gt; 344 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 344 cagcctgtgc tgactcagcc accttctgca tcagcctccc tgggagcctc ggtcacactc 60 acctgc 66 &lt; 210 &gt; 345 &lt; 211 &gt; 66 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 345 caggcagggc tgactcagcc accctcggtg tccaagggct tgagacagac cgccacactc 60 acctgc 66 &lt; 210 &gt; 346 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 2 &gt; 21 &gt; modified base &lt; 222 &gt; <213> 21 <211> <212> <212> DNA <213> Sequê <213> <223> The expression of the DNA sequence of the DNA sequence <222> <222> <222> <221> <222> <222> <222> <223> Artificial Sequence <223> Artificial Sequence <223> T, C, G, other or unknown &lt; 400 &gt; 347 gagtcnnnnn n 11

&lt; 210 &gt; 348 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (3) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 348 gcnnnnnnng c 11

&lt; 210 &gt; 349 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 349 acctgcnnnn n 11

&lt; 210 &gt; 350 &lt; 211 &gt; 25 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 350 cacatccgtg ttgttcacgg atgtg 25 291

&lt; 210 &gt; 351 &lt; 211 &gt; 88 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 351

aatagtagac tgcagtgtcc tcagccctta agctgttcat ctgcaagtag agagtattct 60 tagagttgtc tctagactta gtgaagcg 88 &lt; 210 &gt; 352 &lt; 211 &gt; 88 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 352 cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaacagctta 60 agggctgagg acactgcagt ctactatt 88

&lt; 210 &gt; 353 &lt; 211 &gt; 95 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 353

cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaacagctta 60 agggctgagg acactgcagt ctactattgt gcgag 95 &lt; 210 &gt; 354 &lt; 211 &gt; 95 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 354

cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaacagctta 60 agggctgagg acactgcagt ctactattgt acgag 95 &lt; 210 &gt; 355 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 292 &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 355 cgcttcacta agtctagaga caac 24

&lt; 210 &gt; 356 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (8) .. (15) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 356 cacctgcnnn nnnnn 15

&lt; 210 &gt; 357 &lt; 211 &gt; 17 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (17) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 357 cagctcnnnn nnnnnnn 17

&lt; 210 &gt; 358 &lt; 211 &gt; 17 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (17) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 358 gaagacnnnn nnnnnnn 17 293

&lt; 210 &gt; 359 &lt; 211 &gt; 17 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (17) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 359 gcagcnnnnn nnnnnnn 17

&lt; 210 &gt; 360 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 360 gaagacnnnn nn 12

&lt; 210 &gt; 361 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7). . (22) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 361 cttgagnnnn nnnnnnnnnn nn 22

&lt; 210 &gt; 362 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 294 &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6). . (19) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 362 acggcnnnnn nnnnnnnnn 19

&lt; 210 &gt; 363 &lt; 211 &gt; 18 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (18) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 363 acggcnnnnn nnnnnnnn 18

&lt; 210 &gt; 364 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 364 gtatccnnnn nn 12

&lt; 210 &gt; 365 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide 295 11 <22 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (11) &lt; 223 &gt; A, Τ, C, G, other or unknown &lt; 400 &gt; 365 actgggnnnn η

&lt; 210 &gt; 366 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (10) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 366 ggatcnnnnn ??? 10

&lt; 210 &gt; 367 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 367 gcatcnnnnn n 11

&lt; 210 &gt; 368 &lt; 211 &gt; 16 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (16) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 368 gaggagnnnn nnnnnn 16 296 &lt; 210 &gt; 369 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 2 &gt; 21 &gt; modified_base &lt; 222 &gt; (6) .. (19) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 369 gggacnnnnn ηηηηηηηηη 19 &lt; 210 &gt; 370 &lt; 211 &gt; 14 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 22 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (14) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 370 acctgcnnnn ηηηη 14 &lt; 210 &gt; 371 &lt; 211 &gt; 17 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 2 &gt; 21 &gt; modified_base &lt; 222 &gt; (7) .. (17) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 371 ggcggannnn ηηηηηηη 17 &lt; 210 &gt; 372 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 297 &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7). . (22) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 372 ctgaagnnnn nnnnnnnnnn nn ??? 22

&lt; 210 &gt; 373 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 373 cccgcnnnnn n 11

&lt; 210 &gt; 374 &lt; 211 &gt; 18 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (18) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 374 ggatgnnnnn nnnnnnnn 18

&lt; 210 &gt; 375 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7). . (22) &lt; 223 &gt; A, Τ, C, G, other or unknown &lt; 400 &gt; 375 ctggagnnnn ηηηηηηηηηηηηη 22

&lt; 210 &gt; 376 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (15) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 376 gacgcnnnnn nnnnn 15

&lt; 210 &gt; 377 &lt; 211 &gt; 13 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (13) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 377 ggtgannnnn nnn 13

&lt; 210 &gt; 378 &lt; 211 &gt; 13 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (13) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 378 13 gaagannnnn nnn &lt; 210 &gt; 379 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 220 &gt; &lt; 2 &gt; 21 &gt; modified_base &lt; 222 &gt; (6) .. (10) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 379 gagtcnnnnn &lt; 210 &gt; 380 &lt; 211 &gt; 26 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (26) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 380 tccracnnnn nnnnnnnnnn nnnnnn &lt; 210 &gt; 381 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 220 &gt; &lt; 2 &gt; 21 &gt; modified_base &lt; 222 &gt; (5) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 381 cctcnnnnnn n &lt; 210 &gt; 382 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence

Synthetic Oligonucleotide 10

Synthetic Oligonucleotide 26

Synthetic Oligonucleotide 300 &lt; 22 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 2 &gt; 21 &gt; &lt; 222 &gt; &lt; 223 &gt; modified base (6). (10) A, T, C, G, other or unknown &lt; 400 &gt; 382 gagtcnnnnn ??? 10 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 383 18 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 2 &gt; 21 &gt; &lt; 222 &gt; &lt; 223 &gt; modified base (7). (18) A, T, C, G, other or unknown &lt; 400 &gt; 383 cccacannnn ηηηηηηηη 18 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 384 14 DNA Artificial Sequence &lt; 22 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; &lt; 222 &gt; &lt; 223 &gt; modified base (6). (14) A, T, C, G, other or unknown &lt; 400 &gt; 384 gcatcnnnnn ηηηη 14 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 385 13 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide 301 &lt; 22 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6) .. (13) &lt; 223 &gt; A, Τ, C, G, other or unknown &lt; 400 &gt; 385 ggtgannnnn ηηη 13

&lt; 210 &gt; 386 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (5) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 386 cccgnnnnnn nn ??? 12

&lt; 210 &gt; 387 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (6). . (19) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 387 ggatgnnnnn nnnnnnnnn 19

&lt; 210 &gt; 388 &lt; 211 &gt; 17 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (17) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 388 gaccgannnn nnnnnnn 17 302

&lt; 210 &gt; 389 &lt; 211 &gt; 17 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (17) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 389 cacccannnn nnnnnnn 17

&lt; 210 &gt; 390 &lt; 211 &gt; 17 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (17) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 390 caarcannnn nnnnnnn 17

&lt; 210 &gt; 391 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic probe &lt; 400 &gt; 391 gctgtgtatt actgtgcgag ??? 20 &lt; 210 &gt; 392 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Sequence &lt; 400 &gt; 392 gccgtgtatt actgtgcgag

Artificial: Synthetic probe 20 303 20

&lt; 210 &gt; 393 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt;

Synthetic probe &lt; 223 &gt; Description of the Artificial Sequence: &lt; 400 &gt; 393 gccgtatatt actgtgcgag &lt; 210 &gt; 394 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 394

Synthetic probe gccgtgtatt actgtacgag 20 &lt; 210 &gt; 395 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Sequence &lt; 400 &gt; 395 gccatgtatt actgtgcgag

Artificial: Synthetic probe &lt; 210 &gt; 396 &lt; 211 &gt; 25 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 396 cacatccgtg ttgttcacgg atgtg &lt; 210 &gt; 397 &lt; 211 &gt; 88 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence 20

Synthetic Oligonucleotide 25

Synthetic Oligonucleotide 304 < 4 Ο Ο &gt; 397 aatagtagac tgcagtgtcc tcagccctta agctgttcat ctgcaagtag agagtattct 60 tagagttgtc tctagactta gtgaagcg 88 &lt; 210 &gt; 398 &lt; 211 &gt; 95 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 398

Synthetic Oligonucleotide

cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaacagctta 60 agggctgagg acactgcagt ctactattgt gcgag 95 &lt; 210 &gt; 399 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 399 cgcttcacta agtctagaga caac 24

&lt; 210 &gt; 400 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 400 cacatccgtg ttgttcacgg atgtgggagg atggagactg ggtc 44

&lt; 210 &gt; 401 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 401 cacatccgtg ttgttcacgg atgtgggaga gtggagactg agtc 44 305 &lt; 210 &gt; 402 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 402 cacatccgtg ttgttcacgg atgtgggtgc ctggagactg cgtc 44 &lt; 210 &gt; 403 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 403 cacatccgtg ttgttcacgg atgtgggtgg ctggagactg cgtc 44 &lt; 210 &gt; 404 &lt; 211 &gt; 34 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 404 cctctactct tgtcacagtg cacaagacat ccag ??? 21 &lt; 210 &gt; 405 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 405 cctctactct tgtcacagtg ??? 21 &lt; 210 &gt; 406 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide 306 &lt; 4 Ο Ο &gt; 406 ggaggatgga ctggatgtct tgtgcactgt gacaagagta gagg &lt; 210 &gt; 407 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Sequence Description

Artificial: Oligonucleotide

Synthetic &lt; 400 &gt; 407 44 ggagagtgga ctggatgtct tgtgcactgt gacaagagta gagg &lt; 210 &gt; 408 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 408 ggtgci ctgga ctggatgtct tgtgcactgt gacaagagta gagg ??? 43 &lt; 210 &gt; 409 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 409 ggtggctgga ctggatgtct tgtgcactgt gacaagagta gagg ??? 44

&lt; 210 &gt; 410 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt;

Synthetic &lt; 223 &gt; Description of the Artificial Sequence: Oligonucleotide &lt; 400 &gt; 410 cacatccgtg ttgttcacgg atgtggatcg actgtccagg agac

&lt; 210 &gt; 411 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 307 &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 411 cacatccgtg ttgttcacgg atgtggactg tctgtcccaa ggcc 44

&lt; 210 &gt; 412 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 412 cacatccgtg ttgttcacgg atgtggactg actgtccagg agac 44

&lt; 210 &gt; 413 &lt; 211 &gt; 44 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 413 cacatccgtg ttgttcacgg atgtggaccc tctgccctgg ggcc 44

&lt; 210 &gt; 414 &lt; 211 &gt; 59 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 414 cctctgactg agtgcacaga gtgctttaac ccaaccggct agtgttagcg gttccccgg 59 &lt; 210 &gt; 415 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 415

Synthetic oligonucleotide cctctgactg agtgcacaga gtgctttaac ccaaccggct agtgttagcg gttccccggg 60 acagtcgat 69 308

&lt; 210 &gt; 416 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 416

cctctgactg agtgcacaga gtgctttaac ccaaccggct agtgttagcg gttccccggg 60 acagacagt ??? 21 &lt; 210 &gt; 417 &lt; 211 &gt; 69 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 417

cctctgactg agtgcacaga gtgctttaac ccaaccggct agtgttagcg gttccccggg 60 acagtcagt 69 &lt; 210 &gt; 418 &lt; 211 &gt; 70 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 418

cctctgactg agtgcacaga gtgctttaac ccaaccggct agtgttagcg gtstccccgg 60 ggcagagggt 70 &lt; 210 &gt; 419 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide &lt; 400 &gt; 419 cctctgactg agtgcacaga gtgc 24 309

&lt; 210 &gt; 420 &lt; 211 &gt; 13 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (5) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 420 ggccnnnnng gcc 13

&lt; 210 &gt; 421 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 421 ccannnnnnn nntgg 15

&lt; 210 &gt; 422 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 422 cgannnnnnt gc 12

&lt; 210 &gt; 423 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide 310 &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, Τ, C, G, other or unknown &lt; 400 &gt; 423 gccnnnnngg c 11

&lt; 210 &gt; 424 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (7) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 424 gnatin 10

&lt; 210 &gt; 425 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 425 gacnnnnngt c 11

&lt; 210 &gt; 426 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown 311 11

&lt; 4 Ο Ο &gt; 426 gcannnnntg c &lt; 210 &gt; 427 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 427 gtatccnnnn nn 12

&lt; 210 &gt; 428 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 428 gacnnnnnng tc 12

&lt; 210 &gt; 429 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 429 ccannnnntg g 11

&lt; 210 &gt; 430 &lt; 211 &gt; 12 &lt; 212 &gt; DNA 312 &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (6) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 430 nnnnngaga cg ??? 12

&lt; 210 &gt; 431 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 431 ccannnnnnt gg ??? 12

&lt; 210 &gt; 432 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (7) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 432 gaannnnttc &lt; 210 &gt; 433 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide 313 &lt; 22 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (11) &lt; 223 &gt; A, Τ, C, G, other or unknown &lt; 400 &gt; 433 ggtctcnnnn η 11

&lt; 210 &gt; 434 &lt; 211 &gt; 16 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (10) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 434 nnnnnnnnnn ctcctc 16

&lt; 210 &gt; 435 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 435 nnnnnnnnnt ccgcc 15

&lt; 210 &gt; 436 &lt; 211 &gt; 13 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (5) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 436 ggccnnnnng gcc 13 314

&lt; 210 &gt; 437 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 437 ccannnnnnt gg ??? 12

&lt; 210 &gt; 438 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 438 gacnnnnnng tc 12

&lt; 210 &gt; 439 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 439 cgannnnnnt gc ??? 12

&lt; 210 &gt; 440 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 315 &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 440 gcnnnntg c 11

&lt; 210 &gt; 441 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 441 ccannnnntg g 11

&lt; 210 &gt; 442 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (7) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 442 gaannnnttc &lt; 210 &gt; 443 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic Oligonucleotide 316 &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (6) &lt; 223 &gt; A, Τ, C, G, other or unknown &lt; 400 &gt; 443 nnnnnngaga cg ??? 12

&lt; 210 &gt; 444 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 444 gtatccnnnn nn 12

&lt; 210 &gt; 445 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, C, G, other or unknown &lt; 400 &gt; 445 gacnnnnngt c 11

&lt; 210 &gt; 446 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 446 ggtctcnnnn n 11 317

&lt; 210 &gt; 447 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 447 gccnnnnngg c 11

&lt; 210 &gt; 448 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 448 ccannnnnnn nntgg 15

&lt; 210 &gt; 449 &lt; 211 &gt; 16 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (10) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 449 nnnnnnnnnn ctcctc 16

&lt; 210 &gt; 450 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 450 nnnnnnnnnt ccgcc 15

&lt; 210 &gt; 451 &lt; 211 &gt; 9532 &lt; 212 &gt; DNA &lt; 213 &gt; Unknown Organism &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Unknown Organism: nucleotide sequence MALIA3 &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (1579). . (1638) &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (2343). . (3443) &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (3945) .. (4400) &lt; 220 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (4406) .. (4450) &lt; 220 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (4746). . (5789) &lt; 400 &gt; 451 aatgctacta ctattagtag aattgatgcc accttttcag ctcgcgcccc aaatgaaaat 60 atagctaaac aggttattga ccatttgcga aatgtatcta atggtcaaac taaatctact 120 cgttcgcaga attgggaatc aactgttaca tggaatgaaa cttccagaca ccgtacttta 180 gttgcatatt taaaacatgt tgagctacag caccagattc agcaattaag ctctaagcca 240 tccgcaaaaa tgacctctta tcaaaaggag caattaaagg tactctctaa tcctgacctg 300 ttggagtttg cttccggtct ggttcgcttt gaagctcgaa ttaaaacgcg atatttgaag 360 tctttcgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctataatagt 420 cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtttaaagca 480 tttgaggggg attcaatgaa tatttatgac gattccgcag tattggacgc tatccagtct 540 aaacatttta ctattacccc ctctggcaaa acttcttttg caaaagcctc tcgctatttt 600 319 ggtttttatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt 660 aattcctttt ggcgttatgt atctgcatta gttgaatgtg gtattcctaa atctcaactg 720 atgaatcttt ctacctgtaa taatgttgtt ccgttagttc gttttattaa cgtagatttt 780 tcttcccaac gtcctgactg gtataatgag ccagttctta aaatcgcata aggtaattca 840caatgattaa agttgaaatt aaaccatctc aagcccaatt tactactcgt tctggtgttt 900 ctcgtcaggg caagccttat tcactgaatg agcagctttg ttacgttgat ttgggtaatg 960 aatatccggt tcttgtcaag attactcttg atgaaggtca gccagcctat gcgcctggtc 1020 tgtacaccgt tcatctgtcc tctttcaaag ttggtcagtt cggttccctt atgattgacc 1080 gtctgcgcct cgttccggct aagtaacatg gagcaggtcg cggatttcga cacaatttat 1140 caggcgatga tacaaatctc cgttgtactt tgtttcgcgc ttggtataat cgctgggggt 1200 caaagatgag tgttttagtg tattctttcg cctctttcgt tttaggttgg tgccttcgta 1260 gtggcattac gtattttacc cgtttaatgg aaacttcctc atgaaaaagt ctttagtcct 1320 caaagcctct gtagccgttg ctaccctcgt tccgatgctg tctttcgctg ctgagggtga 1380 cgatcccgca aaagcggcct ttaactccct gcaagcctca gcgaccgaat atatcggtta 1440 tgcgtgggcg atggttgttg tcattgtcgg cgcaactatc ggtatcaagc tgtttaagaa 1500 attcacctcg aaagcaagct gataaaccga tacaattaaa ggctcctttt ggagcctttt 1560 tttttggaga ttttcaac gtg aaa aaa tta tta ttc Met Lys Lys Leu Leu Phe 1 5 gca att cct tta gtt Ala Ile Pro Leu Vai 10 1611 gtt cct ttc Go P ro Phe: tat tct cac agt gca &lt; ! Tyr Ser His Being Ala (15 oag tctgtcgtga cgcagccgcc Sln 20 1658 ctcagtgtct ggggccccag ggcagagggt caccatctcc tgcactggga gcagctccaa 1718 catcggggca ggttatgatg tacactggta ccagcagctt ccaggaacag cccccaaact 1778 cctcatctat ggtaacagca atcggccctc aggggtccct gaccgattct ctggctccaa 1838 gtctggcacc tcagcctccc tggccatcac tgggctccag gctgaggatg aggctgatta 1898 ttactgccag tcctatgaca gcagcctgag tggcctttat gtcttcggaa ctgggaccaa 1958 ggtcaccgtc ctaggtcagc ccaaggccaa ccccactgtc actctgttcc cgccctcctc 2018 tgaggagctc caagccaaca aggccacact agtgtgtctg atcagtgact tctacccggg 2078 agctgtgaca gtggcctgga aggcagatag cagccccgtc aaggcgggag tggagaccac 2138 cacaccctcc aaacaaagca acaacaagta cgcggccagc agctatctga gcctgacgcc 2198 tgagcagtgg aagtcccaca gaagctacag ctgccaggtc acgcatgaag ggagcaccgt 2258 320 ggagaagaca gtggccccta cagaatgttc ataataaacc gcctccaccg ggcgcgccaa 2318 ttctatttca aggagacagt vane atg aaa tac cta ttg cct acca gca gcc 2369

Met Lys Tyr Leu Leu Pro Thr Ala gct gta gta gta cta gcg gcc cg ccg gcc 25 atg gcc gaa gtt caa 2417 Ala Gly Leu Leu Leu Leu Ala Ala Gin Pro Ala Met Ala Glu Go Gin Gin 30 35 40 45 ttg tta gag tct ggt ggc ggt ctt gtt cag cct ggt gt tct tta cgt 2465 Leu Leu Glu Ser Gly Gly Gly Leu Go Pro Gin Gly Gly Ser Leu Arg 50 55 60 ctt tct tgc gct gct tcc gga ttc act ttc tct teg tac gct atg tct 2513 Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser 65 70 75 tgg g gt cct ggt aaa ggt ttg gag tgg gtt tct gct tt 2561 Trp Go Arg Arg Ala Pro Gly Lys Gly Leu Glu Trp Will Be Ala Ile 80 85 90 tct ggt tct ggt ggc agt act tac gct gac tcc gtt aaa ggt ege 2609 Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg 95 100 105 ttc act tct aga gac aac tct aag aat act ctc tac ttg cag atg 2657 Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met 110 115 120 125 aac aga agg gct gag gac act gca gtc tac tat tgc gct aaa gac 2705 Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Asp 130 135 140 tat gaa ggt act ggt tat gct ttc gac ata tgg ggt caa ggt act atg 2753 Tyr Glu Gly Thr Gly Tyr Ala Phe Asp Ile Trp Gly Gin Gly Thr Met 145 150 155 gtc acc gtc tct agt gcc tcc acc aag gcc cca gtc ttc ccc ctg 2801 Will Thr Will Be Ala Ser Thr Lys Gly Pro Ser Vai Phe Pro Leu 160 165 170 gca ccc tcc tcc aag age acc tct gcc ggc aca gcg gcc ctg ggc tgc 2849 Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys 175 180 185 ctg gtc aag gac tac ttc ccc gaa ccg gtg acg gtg teg tgg aac tea 2897 Leu Vai Lys Asp Tyr Phe Pro Glu Pro Go Thr Will Be Trp Asn Ser 190 195 200 205 ggc gcc ctg acc age ggc gtc cac acc ttc ccg gct ct cct tct 2945 Gly Ala Leu Thr Ser Gly Go His Thr Phe Pro Ala Go Leu Gin Ser 210 215 220 age gga ct c tac tcc ctc age age gta gtg acc gtg ccc tct tct age 2993 Ser Gly Leu Tyr Ser Leu Ser Ser Vai Vai Thr Vai Pro Ser Ser Ser Ser 225 230 235 tg ggc acc cag acc tac tgc aac gtg aat cac aag ccc age aac 3041 Leu Gly Thr Gin Thr Tyr Ile Cys Asn Go Asn His Lys Pro Ser Asn 240 245 250 321 acc aag gtg gac aag aaa gtt gag ccc aaa tct tgt gcg gcc gct cat Thr Lys Go Asp Lys Lys Go Glu Pro Lys Ser Cys Ala Ala His His 255 260 265 cac cat cat cac tct gct gaa caa aaa ctc ate tea gaa gag gat His His His His His Ser Ala Glu Gin Lys Leu Ile Ser Glu Glu Asp 270 275 280 285 ctg aat ggt gcc gca gat ate aac gat gat cgt atg gct ggc gcc gct Leu Asn Gly Ala Ala Asp Ile Asn Asp Asp Arg Met Ala Gly Ala Ala 290 295 300 gaa act gtt gaa agt tgt tta gca aaa ccc cat aca gaa aat tea ttt Glu Thr Go Glu Ser Cys Leu Ala Lys Pro His Thr Glu Asn Ser Phe 305 310 315 act aac gtc tgg aaa gac gac aaa act tta gat cgt tac gct aa c tat Thr Asn Go Trp Lys Asp Asp Lys Thr Leu Asp Arg Tyr Ala Asn Tyr 320 325 330 gag ggt tgt ctg tgg aat gct ctg tgg aat gct gt gt gt gt gt gt gtg gtg gtg gt Gly Gly Cys Leu Trp Asn Ala Thr Gly Go Go Go Cys Thr Gly Asp 335 340 345 gaa act cag tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tgt tt tt tt tt tt tt tt tt tt tt tt tt gag ggt ggt ggt gt gg gtg gt gt Gg Gn Gly Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly 370 375 380 3089 tg gag ggt ggt ggt act aaacctcctg agtacggtga tacacctatt Ser Glu Gly Gly Gly Thr 385 ccgggta potato ccctctcgac ggcacttatc cgcctggtac tgagcaaaac cccgctaatc ctaatccttc tcttgaggag tctcagcctc ttaatacttt catgtttcag aataataggt tccgaaatag gcagggggca ttaactgttt atacgggcac tgttactcaa ggcactgacc ccgttaaaac ttattaccag tacactcctg tatcatcaaa agccatgtat gacgcttact ggaacggtaa attcagagac tgcgctttcc attctggctt taatgaagat ccatt cgttt gtgaatatca aggccaatcg tctgacctgc ctcaacctcc tgtcaatgct ggcggcggct ctggtggtgg ttctggtggc ggctctgagg gtggtggctc tgagggtggc ggttctgagg gtggcggctc tgagggaggc ggttccggtg gtggctctgg t tcc ggt Ser Gly GAT TTT GAT TAT GAA AAG ATG GCA AAC GCT AAT AAG GGG GCT ATG ACC Asp 390 Phe Asp Tyr Glu Lys 395 Met Ala Asn Ala Asn 400 Lys Gly Ala Met Thr 405 gaa gat gaa aac gcg cta cct tct gac gct aaa ggc aaa ctt Glu Asn Ala Asp Glu 410 Asn Ala Leu Gin Ser 415 Asp Ala Lys Gly Lys 420 Leu 3137 3185 3233 3281 3329 3377 3425 3473 3533 3593 365333713 3773 3833 3893 3950 3998 4046 322 gat tct gtc gct act gat tac ggt gct gct gt gt ttc att ggt 4094 Asp Ser Va Ala Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe Ile Gly 425 430 435 gac gtt gcc ctt gct aat ggt aat ggt gct act ggt gat ttt gct 4142 Asp Will Be Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala 440 445 450 ggc tct aat tcc caa atg gct caa gtc ggt gac ggt gat aat tea cct 4190 Gly Ser Asn Ser Gin Met Ala Gin Go Gly Asp Gly Asp Asn Ser Pro 455 460 465 tta atg aat ttc cgt cata tat tta cct tcc ctc cct caa teg gtt 4238 Leu Met Asn Asn Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin Ser Vai 470 475 480 485 gaa tgt cgc cct ttt gtc ttt age gct ggt aaa cca tat gaa ttt tct 4286 Glu Cys Arg Pro Phe Go Phe Be Ala Gly Lys Pro Tyr Glu Phe Ser 490 495 500 att gat tgt gac aaa ata aac tta cgt ggt gtc ttt gcg ttt ctt 4334 Ile Asp Cys Asp Lys Ile Asn Leu Phe Arg Gly Go Phe Ala Phe Leu 505 510 515 tta tat gtt gcc acc ttt atg tat gta ttt tct acg ttt gct aac ata 4382 Leu Tyr Go Ala Thr Phe Met Tyr Go Phe Ser Thr Phe Ala Asn Ile 520 525 530 ctg cgt aat gag tct taatc atg cca gtt ctt ttg ggt att ccg tta 4432 Leu Arg Asn Lys Glu Ser Met Pro Val Leu Leu Gly Ile Pro Leu 535 540 545 ttg cgt ttc ctc ggt ttccttctgg taactttgtt cggctatctg 4480

Leu Leu Arg Phe Leu Gly 550 cttacttttc ttaaaaaggg cttcggtaag atagctattg ctatttcatt gtttcttgct 4540 cttattattg ggcttaactc aattcttgtg ggttatctct ctgatattag cgctcaatta 4600 ccctctgact ttgttcaggg tgttcagtta attctcccgt ctaatgcgct tccctgtttt 4660 tatgttattc tctctgtaaa ggctgctatt ttcatttttg acgttaaaca aaaaatcgtt 4720 tcttatttgg attgggataa ataat ATG Met 555 GCT Ala gtt will tat Tyr TTT Phe gta Go 560 act Thr ggc Gly aaa Lys 4772 tta ggc tct gga aag acg ctc gtt age gtt gag aag att cag gat aaa 4820 Leu Gly 565 Ser Gly Lys Thr Leu 570 Go Go Go Gly Lys 575 Ile Gin Asp Lys att gta gct ggg tgc aaa ata gea act aat ctt gat tta agg ctt caa 4868 Ile 580 Go Ala Gly Cys Lys 585 Ile Ala Thr Asn Leu 590 Asp Leu Arg Leu Gin 595 aac ctc ccg caa gtc ggg agg ttc gct aaa acg cct cgc gtt ctt aga 4916 Asn Leu Pro Gin Vai 600 Gly Arg Phe Ala Lys 605 Thr Pro Arg Vai Leu 610 Arg 323 ata ccg gat aag cct tct ata tct gat ttg ctt gct att ggg ege ggt 4964 Ile Pro Asp Lys Pro Ser Ile Ser Asp Leu Leu Ala Ile Gl and Arg Gly 615 620 625 aat gat tcc tac gat gaa aat aaa aac ggc ttg ctt gtt ctc gat gag 5012 Asn Asp Ser Tyr Asp Glu Asn Lys Asn Gly Leu Leu Vai Leu Asp Glu 630 635 640 tgc ggt act tgg ttt aat acc cgt tct tgg aat gat aag gaa aga cag 5060 Cys Gly Thr Trp Phe Asn Thr Arg Ser Trp Asn Asp Lys Glu Arg Gin 6 45 650 655 ccg att att gat tgg ttt cta cat gct cgt aaa tta gga tgg gat att 5108 Pro Ile Ile Asp Trp Phe Leu His Ala Arg Lys Leu Gly Trp Asp Ile 660 665 670 675 att ttt ctt gtt cag gac tta tct att gtt gat aaa cag gcg cgt tct 5156 Ile Phe Leu Vai Gin Asp Leu Ser Ile Go Asp Lys Gin Ala Arg Ser 680 685 690 gca tta gct gaa cat gtt gtt tat tgt cgt cgt ctg gac aga att act 5204 Ala Leu Ala Glu His Vai Vai Tyr Cys Arg Arg Leu Asp Arg Ile Thr 695 700 705 tta cct ttt gtc ggt act tta tat tct ctt att act ggc teg aaa atg 5252 Leu Pro Phe Go Gly Thr Leu Tyr Ser Leu Ile Thr Gly Ser Lys Met 710 715 720 cct ctg cctg cct aaa tta cat gtt ggc gtt gtt aaa tat ggc gat tct caa 5300 Pro Leu Pro Lys Leu His Go Gly Go Go Lys Tyr Gly Asp Ser Gin 725 730 735 tta age cct act gtt gag cgt tgg ctt tat act ggt aag aat ttg tat 5348 Leu Ser Pro Thr Go Glu Arg Trp Leu Tyr Thr Gly Lys Asn Leu Tyr 740 745 750 755 aac gca tat gat act aaa cag gct ttt tct agt aat tat gat tcc ggt 5396 Asn Ala Tyr Asp Thr Lys Gin Ala Phe Ser Ser Asn Tyr Asp Ser Gly 760 765 770 gtt tat tct tat tta acg cct tat tta tea cac ggt cgg tat ttc aaa 5444 Go Tyr Ty Tyr Leu Thr Pro Tyr Leu Ser His Gly Arg Tyr Phe Lys 775 780 785 cca tta aat tta ggt cag aag atg aaa tta act aaa ata tat ttg aaa 5492 Pro Leu Asn Leu Gly Gin Lys Met Lys Leu Thr Lys Ile Tyr Leu Lys 790 795 800 aag ttt tt gt ctt tgt ctt gcg att gga ttt gca tt gca ttt 5540 Lys Phe Ser Arg Val Leu Cys Leu Ala Ile Gly Phe Ala Ser Ala Phe 805 810 815 aca tat agt tat ata acc caa cct aag ccg gag gtt aaa aag gta gtc 5588 Thr Tyr Ser Tyr Ile Thr Gin Pro Lys Pro Glu Go Lys Lys Go Go 820 825 830 835 tct cag acc tat gat ttt gat aaa ttc act att gac tct tct cag cgt 5636 Ser Gin Thr Tyr Asp Phe Asp Lys Phe Thr Ile Asp Ser Ser Gin Arg 840 845 850 ctt aat cta age tat ege tat gtt ttc aag gat tct aag gga aaa tta 5684 324

Leu Asn Leu Ser Tyr Arg Tyr Go Phe Lys Asp Ser Lys Gly Lys Leu 855 860 865 att aat age gac gat tta cag aag caa ggt tat tea ctc aca tat att 5732

Ile Asn Ser Asp Asp Leu Gin Lys Gin Gly Tyr Ser Leu Thr Tyr Ile 870 875 880 gat tta tgt act gtt tcc att aaa aaa ggt aat tea aat gaa att gtt 5780

Asp Leu Cys Thr Will Be Ile Lys Lys Gly Asn Ser Asn Glu Ile Go 885 890 895 aaa tgt aat taattttgtt ttcttgatgt ttgtttcatc atcttctttt 5829

Lys Cys Asn 900 gctcaggtaa ttgaaatgaa taattcgcct ctgcgcgatt ttgtaacttg gtattcaaag 5889 caatcaggcg aatccgttat tgtttctccc gatgtaaaag gtactgttac tgtatattca 5949 tctgacgtta aacctgaaaa tctacgcaat ttctttattt ctgttttacg tgctaataat 6009 tttgatatgg ttggttcaat tccttccata attcagaagt ataatccaaa caatcaggat 6069 tatattgatg aattgccatc atctgataat caggaatatg atgataattc cgctccttct 6129 ggtggtttct ttgttccgca aaatgataat gttactcaaa cttttaaaat taataacgtt 6189 cgggcaaagg atttaatacg agttgtcgaa ttgtttgtaa agtctaatac ttctaaatcc 6249 tcaaatgtat tatctattga cggctctaat ctattagttg tttctgcacc taaagatatt 6309 ttagataacc ttcctcaatt cctttctact gttgatttgc caactgacca gatattgatt 6369 gagggtttga tatttgaggt tcagcaaggt gatgctttag atttttcatt tgctgctggc 6429 tctcagcgtg gcactgttgc aggcggtgtt aatactgacc gcctcacctc tgttttatct 6489 tctgctggtg gttcgttcgg tatttttaat ggcgatgttt tagggctatc agttcgcgca 6549 ttaaagacta atagccattc aaaaatattg tctgtgccac gtattcttac gctttcaggt 6609 cagaagggtt ctatctctgt tggccagaat gtccctttta TTAC tggtcg tgtgactggt 6669 gaatctgcca atgtaaataa tccatttcag acgattgagc gtcaaaatgt aggtatttcc 6729 atgagcgttt ttcctgttgc aatggctggc ggtaatattg ttctggatat taccagcaag 6789 gccgatagtt tgagttcttc tactcaggca agtgatgtta ttactaatca aagaagtatt 6849 gctacaacgg ttaatttgcg tgatggacag actcttttac tcggtggcct cactgattat 6909 aaaaacactt ctcaagattc tggcgtaccg ttcetgtcta aaatcccttt aatcggcctc 6969 ctgtttagct cccgctctga ttccaacgag gaaagcacgt tatacgtgct cgtcaaagca 7029 accatagtac gcgccctgta gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag 7089 cgtgaccgct acacttgcca gcgccctagc gcecgctcct ttcgctttct tcccttcctt 7149 tctcgccacg ttcgccggct ttccccgtca agctctaaat cgggggctce ctttagggtt 7209 325 ccgatttagt gctttacggc acctcgaccc caaaaaactt gatttgggtg atggttcacg 7269 tagtgggcca tcgccctgat agacggtttt tcgccctttg acgttggagt ccacgttctt 7329 taatagtgga ctcttgttcc aaactggaac aacactcaac cctatctcgg gctattcttt 7389 tgatttataa gggattttgc cgatttcgga accaccatca aacaggattt tcgcctgctg 7449 gggcaaacca gcgtggaccg cttgctgcaa CTCT ctcagg gccaggcggt gaagggcaat 7509 cagctgttgc ccgtctcact ggtgaaaaga aaaaccaccc tggatccaag cttgcaggtg 7569 gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa 7629 atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga 7689 agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc 7749 ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg 7809 gcgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc 7869 gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt catacactat 7929 tatcccgtat tgacgccggg caagagcaac tcggtcgccg ggcgcggtat tctcagaatg 7989 acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag 8049 aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa 8109 cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc 8169 gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca 8229 cgatgcctgt agcaatgcca acaacgttgc gcaaactatt aactggcgaa ctacttactc 8289 tagcttcccg gcaacaatta atagact gga tggaggcgga taaagttgca ggaccacttc 8349 tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg 8409 ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta 8469 tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag 8529 gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga 8589 ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc 8649 tcatgaccaa aatcccttaa cgtgagtttt cgttccactg tacgtaagac ccccaagctt 8709 gtcgactgaa tggcgaatgg cgctttgcct ggtttccggc accagaagcg gtgccggaaa 8769 gctggctgga gtgcgatctt cctgaggccg atactgtcgt cgtcccctca aactggcaga 8829 tgcacggtta cgatgcgccc atctacacca acgtaaccta tcccattacg gtcaatccgc 8889 cgtttgttcc cacggagaat ccgacgggtt gttactcgct cacatttaat gttgatgaaa 8949 gctggctaca ggaaggccag acgcgaatta tttttgatgg cgttcctatt ggttaaaaaa 9009 tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt ttacaattta 9069 326 aatatttgct tatacaatct tcctgttttt ggggcttttc tgattatcaa ccggggtaca 9129 tatgattgac atgctagt tt tacgattacc gttcatcgat tctcttgttt gctccagact 9189 ctcaggcaat gacctgatag cctttgtaga tctctcaaaa atagctaccc tctccggcat 9249 gaatttatca gctagaacgg ttgaatatca tattgatggt gatttgactg tctccggcct 9309 ttctcaccct tttgaatctt tacctacaca ttactcaggc attgcattta aaatatatga 9369 gggttctaaa aatttttatc cttgcgttga aataaaggct tctcccgcaa aagtattaca 9429 gggtcataat gtttttggta caaccgattt agctttatgc tctgaggctt tattgcttaa ttttgctaat 9489 9532 gtt tctttgcctt gcctgtatga tttattggat

&lt; 210 &gt; 452 &lt; 211 &gt; 20 &lt; 212 &gt; PRT &lt; 213 &gt; Unknown Organism &lt; 220 &gt; &lt; 223 &gt; Description of Unknown Organism: peptide sequence MALIA3 &lt; 400 &gt; 452

Met Lys Lys Leu Leu Phe Ala Ile Pro Leu Will Pro Phe Tyr Ser 15 10 15

His Ser Ala Gin 20

&lt; 210 &gt; 453 &lt; 211 &gt; 367 &lt; 212 &gt; PRT &lt; 213 &gt; Unknown Organism &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Unknown Organism: protein sequence &lt; 400 &gt; 453

Met 1 Lys Tyr Leu Leu 5 Pro Thr Ala Ala Ala 10 Gly Leu Leu Leu Leu 15 Ala Ala Gin Pro Ala 20 Met Ala Glu Vai Gin 25 Leu Leu Glu Ser Gly 30 Gly Gly Leu Go Gin 35 Pro Gly Gly Ser Leu 40 Arg Leu Ser Cys Ala 45 Ala Ser Gly Phe Thr 50 Phe Ser Ser Tyr Ala 55 Met Ser Trp Val Arg 60 Gin Pro Gly Lys 65 Gly Leu Glu Trp Val 70 Ser Ala Ile Ser Gly 75 Ser Gly Gly Ser Thr 80 Tyr Tyr Ala Asp Ser 85 Val Lys Gly Arg Phe 90 Thr Ile Ser Arg Asp 95 Asn 327

Ser Lys Asn Thr 100 Leu Tyr Leu Gin Met 105 Asn Ser Leu Arg Ala 110 Glu Asp Thr Ala V 115 Tyr Tyr Cys Ala Lys 120 Asp Tyr Glu Gly Thr 125 Gly Tyr Ala Phe Asp 130 Ile Trp Gly Gin Gly 135 Thr Met Go Thr Will Be Be Ala Will Be Thr 145 Lys Gly Pro Will Be 150 Phe Pro Leu Ala Pro 155 Be Be Lys Be Thr 160 Be Gly Gly Thr Ala 165 Ala Leu Gly Cys Leu 170 Go Lys Asp Tyr Phe 175 Pro Glu Pro Go Thr 180 Will Be Trp Asn Ser 185 Gly Ala Leu Thr Ser 190 Gly Will His Thr Phe 195 Pro Ala Will Leu Gin 200 Be Ser Gly Leu Tyr 205 Ser Leu Ser Ser Will Go 210 Will Go Be Pro 215 Be Ser Leu Gly Thr 220 Gin Thr Tyr Ile Cys 225 Asn Go Asn His Lys 230 Pro Asn Thr Lys 235 Go Asp Lys Lys Go 240 Glu Pro Lys Ser Cys 245 Ala Ala His His His His His His His 255 Ala Glu Gin Lys Leu 260 Ile Ser Glu Glu Asp 265 Leu Asn Gly Ala Ala 270 Asp Ile Asn Asp Asp 275 Arg Met Ala Gly Ala 280 Ala Glu Thr Va Glu 285 Ser Cys Leu Ala Lys 290 Pro His Thr Glu Asn 295 Ser Phe Thr Asn Go 300 Trp Lys Asp Asp Lys 305 Thr Leu Asp Arg Tyr 310 Ala Asn Tyr Glu Gly 315 Cys Leu Trp Asn Ala 320 Thr Gly Go Go Go 325 Cys Thr Gly Asp Glu 330 Thr Gin Cys Tyr Gly 335 Thr Trp Go Pro Ile 340 Gly Leu Ala Ile Pro 345 Glu Asn Glu Gly Gly 350 Gly Ser Glu Gly Gly 355 Gly Ser Glu Gly Gly 360 Gly Ser Glu Gly Gly 365 Gly Thr

&lt; 210 &gt; 454 &lt; 211 &gt; 152 &lt; 212 &gt; PRT &lt; 213 &gt; Unknown Organism &lt; 220 &gt; &lt; 223 &gt; Description of Unknown Organism: MALIA3 protein sequence &lt; 400 &gt; 454 328

Ser 1 Gly Asp Phe Asp 5 Tyr Glu Lys Met Ala 10 Asn Ala Asn Lys Gly 15 Ala Met Thr Glu Asn 20 Ala Asp Glu Asn Ala 25 Leu Gin Ser Asp Ala 30 Lys Gly Lys Leu Asp 35 Ser Vai Ala Thr Asp 40 Tyr Gly Ala Ala Ile 45 Asp Gly Phe Ile Gly 50 Asp Will Be Gly Leu 55 Ala Asn Gly Asn Gly 60 Ala Thr Gly Asp Phe 65 Ala Gly Ser Asn Ser 70 Gin Met Ala Gin Go 75 Gly Asp Gly Asp Asn 80 Ser Pro Leu Met Asn 85 Asn Phe Arg Gin Tyr 90 Leu Pro Ser Leu Pro 95 Gin Ser Vai Glu Cys 100 Arg Pro Phe Go Phe 105 Ser Gly Lys Pro 110 Tyr Glu Phe Ser Ile 115 Asp Cys Asp Lys Ile 120 Asn Leu Phe Arg Gly 125 Go Phe Ala Phe Leu 130 Leu Tyr Go Ala Thr 135 Phe Met Tyr Go Phe 140 Ser Thr Phe Ala Asn 145 Ile Leu Arg Asn Lys 150 Glu Ser

&lt; 210 &gt; 455 &lt; 211 &gt; 15 &lt; 212 &gt; PRT &lt; 213 &gt; Unknown Organism &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Unknown Organism: peptide sequence MALIA3 &lt; 400 &gt; 455

Met Pro Go Leu Leu Gly le Pro Leu Leu Leu Arg Phe Leu Gly 15 10 15

&lt; 210 &gt; 456 &lt; 211 &gt; 34B &lt; 212 &gt; PRT &lt; 213 &gt; Unknown Organism &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Unknown Organism: MALIA3 protein sequence &lt; 400 &gt; 456

Met 1 Ala Vai Tyr Phe 5 Go Thr Gly Lys Leu 10 Gly Ser Gly Lys Thr 15 Leu Will Go Go Gly 20 Lys Ile Gin Asp Lys 25 Ile Go Ala Gly Cys 30 Lys Ile Ala Thr Asn 35 Leu Asp Leu Arg Leu 40 Gin Asn Leu Pro Gin 45 Go Gly Arg 329

Phe Ala 50 Lys Thr Pro Arg Val 55 Leu Ser 65 Asp Leu Leu Ala Ile 70 Gly Arg Lys Asn Gly Leu Leu 85 Vai Leu Asp Arg Ser Trp Asn 100 Asp Lys Glu Arg His Ala Arg 115 Lys Leu Gly Trp Asp 120 Ser Ile 130 Go Asp Lys Gin Ala 135 Arg Tyr 145 Cys Arg Arg Leu Asp 150 Arg Ile Tyr Ser Leu Ile Thr 165 Gly Ser Lys Gly Vai Val Lys 180 Tyr Gly Asp Ser Trp Leu Tyr 195 Thr Gly Lys Asn Leu 200 Ala Phe 210 Ser Ser Asn Tyr Asp 215 Ser Tyr 225 Leu Ser His Gly Arg 230 Tyr Phe Met Lys Leu Thr Lys 245 Ile Tyr Leu Leu Ala Ile Gly 260 Phe Ala Ser Ala Pro Lys Pro 275 Glu Val Lys Lys Val 280 Lys Phe 290 Thr Ile Asp Ser Ser 295 Gin Go 305 Phe Lys Asp Ser Lys 310 Gly Lys Lys Gin Gly Tyr Ser 325 Leu Thr Tyr Lys Lys Gly Asn 340 Ser Asn Glu Ile

Arg Ile Pro Asp 60 Lys Pro Ser Ile Gly Asn Asp 75 Ser Tyr Asp Glu Asn 80 Glu Cys 90 Gly Thr Trp Phe Asn 95 Thr Gin 105 Pro Ile Ile Asp Trp 110 Phe Leu Ile Ile Phe Leu Vai 125 Gin Asp Leu Ser Ala Leu Wing 140 Glu His Will Go Thr Leu Pro 155 Phe Go Gly Thr Leu 160 Met Pro 170 Leu Pro Lys Leu His 175 Go Gin 185 Leu Ser Pro Thr Go 190 Glu Arg Tyr Asn Ala Tyr Asp 205 Thr Lys Gin Gly Go Tyr Ser 220 Tyr Leu Thr Pro Lys Pro Leu 235 Asn Leu Gly Gin Lys 240 Lys Lys 250 Phe Ser Arg Val Leu 255 Cys Phe 265 Thr Tyr Ser Tyr Ile 270 Thr Gin Will Be Gin Thr Tyr 285 Asp Phe Asp Arg Leu Asn Leu 300 Ser Tyr Arg Tyr Leu Ile Asn 315 Ser Asp Asp Leu Gin 320 Ile Asp 330 Leu Cys Thr Will Be 335 Ile Will 345 Lys Cys Asn 330 24

&lt; 210 &gt; 457 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt;

Primer &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 457 tggaagaggc acgttctttt cttt &lt; 210 &gt; 458 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 458

Primer cttttctttg ttgccgttgg ggtg ??? 21 &lt; 210 &gt; 459 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 459

Primer acactctccc ctgttgaagc tctt 24 &lt; 210 &gt; 460 &lt; 211 &gt; 51 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 460 accgcctcca ccgggcgcgc cttattaaca ctctcccctg ttgaagctct t 51

&lt; 210 &gt; 461 &lt; 211 &gt; 23 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 461 tgaacattct gtaggggcca ctg 331 23 23

&lt; 210 &gt; 462 &lt; 211 &gt; 23 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 462 agagcattct gcaggggcca ctg &lt; 210 &gt; 463 &lt; 211 &gt; 50 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 463 accgcctcca ccgggcgcgc cttattatga acattctgta ggggccactg &lt; 210 &gt; 464 &lt; 211 &gt; 50 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 464 accgcctcca ccgggcgcgc cttattaaga gcattctgca ggggccactg &lt; 210 &gt; 46 &lt; 211 &gt; 23 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 46 5 cgactggagc acgaggacac tga &lt; 210 &gt; 46 &lt; 211 &gt; 26 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 46 6 ggacactgac atggactgaa ggagta 50 50 23 332 26 20 20 &lt; 210 &gt; 467 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 467 gggaggatgg agactgggtc &lt; 210 &gt; 468 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 468 gggaagatgg agactgggtc &lt; 210 &gt; 46 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 46 gggagagtgg agactgagtc &lt; 210 &gt; 470 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 470 gggtgcctgg agactgcgtc &lt; 210 &gt; 471 &lt; 211 &gt; 20 &lt; 212 &gt; DNA Λ cn 1-1 CN V Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence

Synthetic oligonucleotide

Synthetic oligonucleotide 20

Synthetic oligonucleotide 20

Synthetic oligonucleotide 20

Synthetic oligonucleotide 333 &lt; 4 Ο Ο &gt; 471

gggtggctgg agactgcgtc &lt; 210 &gt; 472 &lt; 211 &gt; 50 < 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 472 gggaggatgg agactgggtc atctggatgt cttgtgcact gtgacagagg 50

&lt; 210 &gt; 473 &lt; 211 &gt; 50 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 473 gggaagatgg agactgggtc atctggatgt cttgtgcact gtgacagagg 50

&lt; 210 &gt; 474 &lt; 211 &gt; 50 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 474 gggagagtgg agactgggtc atctggatgt cttgtgcact gtgacagagg 50

&lt; 210 &gt; 475 &lt; 211 &gt; 50 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 475 gggtgcctgg agactgggtc atctggatgt cttgtgcact gtgacagagg 50

&lt; 210 &gt; 476 &lt; 211 &gt; 50 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 334 &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 476 gggtggctgg agactgggtc atctggatgt cttgtgcact gtgacagagg ??? 21 &lt; 210 &gt; 477 &lt; 211 &gt; 50 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 477 gggagtctgg agactgggtc atctggatgt cttgtgcact gtgacagagg ??? 21 &lt; 210 &gt; 478 &lt; 211 &gt; 42 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 478 cctctgtcac agtgcacaag acatccagat gacccagtct cc ??? 42 &lt; 210 &gt; 479 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 479 cctctgtcac agtgcacaag ac 22 &lt; 210 &gt; 480 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 4Q0 &gt; 480 acactctccc ctgttgaagc tctt 24 335

&lt; 210 &gt; 481 &lt; 211 &gt; 668 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 220 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (1) .. (668) &lt; 400 &gt; 481 agt gca caa gac ca cg atg acc cag tct cca gee acc ctg tct gtg 48 Ser Wing Gin Asp Ile Gin Met Thr Gin Ser Pro Wing Thr Leu Ser Val 1 5 10 15 tct cca ggg gaa agg gee acc ctc tcc tgc agg gee agt cag agt gtt 96 Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Ser Val 20 25 30 ag ag aac a tta c g g c c g g c c g g c c g agg 144 Ser Asn Asn Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin Val Pro Arg 35 40 45 ctc ctc gcc gcc gcc gcc gcc gcc agg gg gcg gcg gcg gcg gcg gcg gcg gcg gcg ggg tct ggg aca gac ttc act ctc acc to age aga 240 Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg 65 70 75 80 ctg gag cct gaa gat ttt gca gtg tat tac tgt cag cgg tat ggt age 288 Leu Glu Pro Glu Asp Phe Ala Vai Tyr Tyr Cys Gin Arg Tyr Gly Ser 85 90 95 tca ccg ggg tgg acg ttc ggc caa ggg acc aa g gtg gaa to aaa cga 336 Ser Pro Gly Trp Thr Phe Gly Gin Gly Thr Lys Val Glu Ile Lys Arg 100 105 110 act gtg gct gca cca tct gtc ttc to ttc ccg cca tct gat gag cag 384 Thr Go Ala Ala Pro Ser Go Phe Ile Phe Pro Pro Ser Asp Glu Gin 115 120 125 ttg aaa tct gga act gee tct gtt gtg tgc ctg ctg aat aac ttc tat 432 Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 130 135 140 ccc aga gag gee aaa gta cag tgg aag gtg gat aac gee ctc caa teg 480 Pro Arg Glu Ala Lys Vai Gin Trp Lys Val Asp Asn Ala Leu Gin Ser 145 150 155 160 ggt aac tcc cag gag agt gtc aca gag cag gac age aag gac age acc 528 Gly Asn Ser Gin Glu Ser Vai Thr Glu Gin Asp Ser Lys Asp Ser Thr 165 170 175 tac age ctc act age ac ctg acg ctg age aaa gca gac tac gag aaa 576 Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 180 185 190 cac aaa gtc tac gee tgc gaa gtc acc cat cag ggc ctg age teg cct 624 His Lys Go Tyr Ala Cys Glu Go Thr His Gin Gly Leu Ser Ser Pro 195 200 205 336 668 gtc aca aag age ttc aac aaa gga gag tgt aag ggc gaa ttc gc Go Thr Lys Ser Phe Asn Lys Gly Glu Cys Lys Gly Glu Phe Ala 210 215 220

&lt; 210 &gt; 482 &lt; 211 &gt; 223 &lt; 212 &gt; PRT &lt; 213 &gt; Homo sapiens &lt; 400 &gt; 482

Be Wing Gin Asp Ile Gin Met Thr Gin Be Pro Ala Thr Leu Be Go 1 5 10 15 Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Ser Vai 20 25 30 Ser Asn Asn Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin Vai Pro Arg 35 40 45 Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala Thr Asp Ile Pro Ala Arg 50 55 60 Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg 65 70 75 80 Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gin Arg Tyr Gly Ser 85 90 95 Ser Pro Gly Trp Thr Phe Gly Gin Gly Thr Lys Go Glu Ile Lys Arg 100 105 110 Thr Go Ala Ala Pro Ser Goa Phe Ile Phe Pro Pro Ser Asp Glu Gin 115 120 125 Leu Lys Ser Gly Thr Ala Ser Vai Cys Leu Leu Asn Asn Phe Tyr 130 135 140 Pro Arg Glu Ala Lys Vai Gin Trp Lys Go Asp Asn Ala Leu Gin Ser 145 150 155 160 Gly Asn Ser Gin Glu Ser Vai Thr Glu Gin Asp Ser Lys Asp Ser Thr 165 170 175 Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 180 185 190 His Lys Go Tyr Ala Cys Glu Go Thr His Gin Gly Leu Ser Ser Pro 195 200 205 Go Thr Lys Ser Phe Asn Lys Gly Glu Cys Lys Gly Glu Phe Ala 210 215 220

&lt; 210 &gt; 483 &lt; 211 &gt; 13 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 483 agccaccctg tct 13

&lt; 210 &gt; 484 &lt; 211 &gt; 700 &lt; 212 &gt; DNA &lt; 213 &gt; Homo sapiens &lt; 220 &gt; &lt; 221 &gt; CDS &lt; 222 &gt; (1) .. (699) &lt; 400 &gt; 484 agt gca caa gac ca cg atg acc cag tct cct gee acc ctg tct gtg 48 Be Wing Gin Asp Ile Gin Met Thr Gin Be Pro Ala Thr Leu Be Vai 1 5 10 15 tct cca ggt gaa aga gee acc etc tcc tgc agg gee agt cag gtg tct 96 Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Will be 20 25 30 cca ggg gaa aga gee acc etc tccc aat ctt et age aac tta gee 144 Pro Gly Glu Ar g Ala Thr Leu Ser Cys Asn Leu Leu Ser Asn Leu Ala 35 40 45 tgg tac cag cag aaa cct ggc cag gct ccc agg etc etc. ate tat ggt 192 Trp Tyr Gin Gin Lys Pro Gly Gin Wing Pro Arg Leu Leu Ile Tyr Gly 50 55 60 gct tcc acc ggg gee att ggt to cca gee agg ttc agt ggc agt ggg 240 Ala Ser Thr Gly Ala Ile Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly 65 70 75 80 tct ggg aca gag ttc act etc acc to age age ctg cag tct gaa gat 288 Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gin Ser Glu Asp 85 90 95 ttt gca gtg tat ttc tgt cag tat ggt a cc tea ccg ccc act ttc 336 Phe Ala Vai Tyr Phe Cys Gin Gin Tyr Gly Thr Ser Pro Pro Thr Phe 100 105 gg g g g g g g g g g g g g g g g g g g g g g g c c c tct 384 Gly Gly Gly Thr Lys Go Glu Ile Lys Arg Thr Go Ala Ala Pro Ser 115 120 125 gtc ttc ttc ccg tca gat gag cag ttg aaa tct gga act gee 432 Go Phe Ile Phe Pro Pro Ser Asp Glu Gin Leu Lys Ser Gly Thr Ala 130 135 140 tct gtt gtg tgc ccg ctg aat aac ttc tat ccc aga gag gee aaa gta 480 Be Vai Cys Pro Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Go 145 150 155 160 cag tgg aag gtg gat aac gee etc caa teg ggt aac tcc cag gag agt 528 Gin Trp Lys Vai Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin Glu Ser 165 170 175 338 gtc aca gag cag gac aac aag gac age acc tac age etc age acc 576 Go Thr Glu Gin Asp Asn Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr 180 185 190 ctg acg ctg age aaa gta gac tac gag aaa cac gaa gtc tac gee tgc 6 24 Leu Thr Leu Ser Lys Go Asp Tyr Glu Lys His Glu Go Tyr Ala Cys 195 200 205 gaa gtc acc cat cag ggc ctt age teg ccc gtc acg aag age ttc aac 672 Glu Go Thr His Gin Gly Leu Ser Ser Pro Go Thr Lys Ser Phe Asn 210 215 220 agg gga gag tgt aag aaa gaa ttc gtt t 700 Arg Gly Glu Cys Lys Lys Glu Phe V 225 225 &lt; 210 &gt; 485 &lt; 211 &gt; 233 &lt; 212 &gt; PRT &lt; 213 &gt; Homo: sapiens &lt; 400 &gt; 485 Ser Wing Gin Asp Ile Gin Met Thr Gin Ser Pro Wing Thr Leu Ser Vai 1 5 10 15 Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Will Be 20 25 30 Pro Gly Glu Arg Ala Thr Leu Ser Cys Asn Leu Leu Ser Asn Leu Ala 35 40 45 Trp Tyr Gin Gin Lys Pro Gly Gin Ala Pro Arg Leu Leu Ile Tyr Gly 50 55 60 Ala Ser Thr Gly Ala Ile Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly 65 70 75 80 Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gin Ser Glu Asp 85 90 95 Phe Ala Vai Tyr Phe Cys Gin Gin Tyr Gly Thr Ser Pro Pro Thr Phe 100 105 110 Gly Gly Gly Thr Lys Go Glu Ile Lys Arg Thr Go Ala Ala Pro Ser 115 120 125 Will Phe Ile Phe Pro Pro Ser Asp Glu Gin Leu Lys Ser Gly Thr Ala 130 135 140 Will Be Vai Cys Pro Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Go 145 150 155 160 Gin Trp Lys Go Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin Glu Ser 165 170 175 Go Thr Glu Gin Asp Asn Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr 180 185 190 Leu Thr Leu Ser Lys Val Asp Tyr Glu Lys His Glu Val Tyr Ala Cys 195 200 205 339

Glu Vai Thr 210

His Gin Gly Leu Ser Ser Pro Go 215

Thr Lys Ser Phe Asn 220

Arg Gly Glu Cys Lys Lys Glu Phe VÎ ± 225 230

&lt; 210 &gt; 486 &lt; 211 &gt; 419 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic 3-23 VH Nucleotide sequence &lt; 220 &gt; &lt; 221 &gt; CDS &lt; 222 &gt; (12) .. (419) &lt; 400 &gt; 486 ctgtctgaac g gcc cg ccg gcc atg gcc gaa gtt caa ttg tta gag tct 50 Ala Gin Pro Ala Met Ala Glu Vai Gin Leu Leu Glu Ser 1 5 10 ggt ggc ggt ctt gtt cag cct ggt gt tct tta cgt ctt tct tgc gct 98 Gly Gly Gly Leu Gly Leu Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala 15 20 25 gct tcc gt ttc act ttc tct tcg tb gct tg tct tg g tg tg tg tg tg tg tg tg tg Arg Gin 30 35 40 45 gct cct ggt aaa ggt ttg gag tgg gtt tct gct tct gct tct ggt 194 Ala Pro Gly Lys Gly Leu Glu Trp Will Be Ala Ile Ser Gly Ser Gly 50 55 60 ggc agt act tac tat gct gcc gtt aaa tgt ttc act tt tt 242 Gly Ser Thr Tyr Tyr Ala Asp Ser Vai Lys Gly Arg Phe Thr Ile Ser 65 70 75 aga gac aac tct aag aat act ctc ttg cag atac a t ag ag ect 290 Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg 80 85 90 gct gag gac act gca gtc tac tat tgc gct aaa gac tat gaa ggt act 338 Ala Glu Asp Thr Ala Vai Tyr Tyr Cys Ala Lys Asp Tyr Glu Gly Thr 95 100 105 ggt tat gct ttc gac ata tgg ggt caa ggt act atg gtc acc gtc tct 386 Gly Tyr Ala Phe Asp Ile Trp Gly Gin Gly Thr Met Go Thr Go Ser 110 115 120 125 agt gcc tcc acc aag gcc cca tcg gtc ttc ccc 419 Be Ala Ser Thr Lys Gly Pro Ser Vai Phe Pro 130 135 340

&lt; 210 &gt; 487 &lt; 211 &gt; 136 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic 3-23 VH Protein Sequence &lt; 400 &gt; 487

Ala Gin Pro Ala Met Ala Glu Vai Gin Leu Leu Glu Ser Gly Gly Gly 1 5 10 15 Leu Go Pro Gin Gly Gly Ser Leu Ar g Leu Ser Cys Ala Ala Ser Gly 20 25 30 Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Go Arg Gin Ala Pro Gly 35 40 45 Lys Gly Leu Glu Trp Will Be Ala Ile Ser Gly Ser Gly Gly Ser Thr 50 55 60 Tyr Tyr Ala Asp Ser Vai Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 65 70 75 80 Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp 85 90 95 Thr Ala Go Tyr Tyr Cys Ala Lys Asp Tyr Glu Gly Thr Gly Tyr Ala 100 105 110 Phe Asp Ile Trp Gly Gin Gly Thr Met Will Thr Will Be Ala Ser 115 120 125 Thr Lys Gly Pro Ser Vai Phe Pro 130 135

&lt; 210 &gt; 488 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 488 ctgtctgaac ggcccagccg ??? 20

&lt; 210 &gt; 489 &lt; 211 &gt; 83 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide 341 < 4 Ο Ο &gt; 489

ctgtctgaac ggcccagccg gccatggccg aagttcaatt gttagagtct ggtggcggtc 60 ttgttcagcc tggtggttct tta 83 &lt; 210 &gt; 490 &lt; 211 &gt; 54 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 490 gaaagtgaat ccggaagcag cgcaagaaag acgtaaagaa ccaccaggct gaac 54

&lt; 210 &gt; 491 &lt; 211 &gt; 42 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 491 agaaacccac tccaaacctt taccaggagc ttggcgaacc ca 42

&lt; 210 &gt; 492 &lt; 211 &gt; 94 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 492

agtgtcctca gcccttaagc tgttcatctg caagtagaga gtattcttag agttgtctct 60 agagatagtg aagcgacctt taacggagtc agca 94 &lt; 210 &gt; 493 &lt; 211 &gt; 81 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 493 gcttaagggc tgaggacact gcagtctact attgcgctaa agactatgaa ggtactggtt 60 atgctttcga catatggggt c 81 342

&lt; 210 &gt; 494 &lt; 211 &gt; 72 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 494

ggggaagacc gatgggccct tggtggaggc actagagacg gtgaccatag taccttgacc 60 tatgtcgaaa gc 72 &lt; 210 &gt; 495 &lt; 211 &gt; 23 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 495 ggggaagacc gatgggccct tgg ??? 23

&lt; 210 &gt; 496 &lt; 211 &gt; 56 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (22) .. (24) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (28) .. (30) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 2 2 2 &gt; (34) .. (36) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 220 &gt; &lt; 223 &gt; nnn code for any amino acid but Cys &lt; 400 &gt; 496 gcttccggat tcactttctc tnnntacnnn atgnnntggg ttcgccaagc tcctgg 56

&lt; 210 &gt; 497 &lt; 211 &gt; 68 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (19). (21)

&lt; 223 &gt; A, T, C or G &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (25). (30)

&lt; 223 &gt; A, T, C or G &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (40). (42)

&lt; 223 &gt; A, T, C or G &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (46). (48)

&lt; 223 &gt; A, T, C or G &lt; 400 &gt; 497 ggtttggagt gggtttctnn natcnnnnnn tctggtggcn nnactnnnta tgctgactcc 60 gttaaagg 68 &lt; 210 &gt; 498 &lt; 211 &gt; 912 &lt; 212 &gt; DNA &lt; 213 &gt; Escherichia coli &lt; 400 &gt; 498 tccggagctt gaccgactgc caaaccagtc tctggtttga ggcatcaatt aacgtttggc gataagtggt aatataagtg ccacaggcgg gaagatacct cctgcaatgg gaagaaacgc ttctcaccaa agtgggttta tacgaaaatt gagtcgtcta 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 912 cagatctgtt ttgagcaaaa gtcaggatct cacagagcga tgcttaatga tgaccagtat acagcgccag ttggagcaaa ttgatctgtt gggagactct ccttaacgtt gtcatcaggc cgacaagcga ttgctcccga ttggccgtaa g tgcctttttg gccacgctta taacctgagg tccgcgtcgt tgatggtaaa gttgaagcgt tggctacgaa aattttgtat tgctgggaaa ttccaaacgc ccgggcaaat ggagtatcaa tcgtcctgtg tggaacagtt gtcgctctgg tggggtggtg actgctgatc ctttttttac cagttggtag acctggcagc accgtagtgg acaacccagg gaggcggtgc ccacagcagg tatggcaata aatttctttg aaccgtggaa cttgcctggg gataagcact ttaacgaagc cagatcgcgt aggcatggga ctactctgca aaacattaac agccaggctc ctgccgtacc acggcccaac agggagacaa aggttgtgtt atgtgagtaa gtgtaccgca cagaaaacga atgtggtcgc atgaagatca aggatgtgga tacggagatc tgttattcgc agcagcgaca acgttgggat tgccatcctg tatgccattt tggttcgctg atcaccaatc ggctgc gctg ctggaaaaca ggccgcagcg tatgattgtt acccggtcag gctgaaaatg ggcgcataag &lt; 210 &gt; 499 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of Artificial Sequence: Synthetic oligonucleotide 344 <2 2 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (7) &lt; 223 &gt; Α, Τ, C, G, other or unknown &lt; 400 &gt; 499 gnatin 10

&lt; 210 &gt; 500 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (15) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 500 nnnnnnnnnnnnnnngtccc 20

&lt; 210 &gt; 501 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 501 gcnnnntg c 11

&lt; 210 &gt; 502 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (9) .. (7) &lt; 223 &gt; A, T, C, G, other or unknown 345 10

&lt; 4 Ο Ο &gt; 502 gacnnnngtc &lt; 210 &gt; 503 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (7) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 503 nnnnnnngcg gg ??? 12

&lt; 210 &gt; 504 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 504 gtatccnnnn nn 12

&lt; 210 &gt; 505 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 505 gcannnnnnt cg 12 346

&lt; 210 &gt; 506 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 506 gccnnnnngg c 11

&lt; 210 &gt; 507 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 507 ggtctcnnnn n 11

&lt; 210 &gt; 508 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 508 gacnnnnngt c 11

&lt; 210 &gt; 509 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, Τ, C, G, other or unknown &lt; 400 &gt; 509 gacnnnnngt c 11

&lt; 210 &gt; 510 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 510 gacnnnnnng tc 12

&lt; 210 &gt; 511 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 511 ccannnnntg g 11

&lt; 210 &gt; 512 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 4 Ο Ο &gt; 512 nnnnnnnnng caggt &lt; 210 &gt; 513 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence

Synthetic oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified base &lt; 222 &gt; (7) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 513 acctgcnnnn &lt; 210 &gt; 514 &lt; 211 &gt; 13 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence

Synthetic oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified base &lt; 222 &gt; (5) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 514 ggccnnnnng gcc 13 &lt; 210 &gt; 515 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence

Synthetic oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified base &lt; 222 &gt; (4) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 515 ccannnnnnn nntgg 349 15

&lt; 210 &gt; 516 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 516 cgtctcnnnn n 11

&lt; 210 &gt; 517 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (6) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 517 nnnnnngaga cg ??? 12

&lt; 210 &gt; 518 &lt; 211 &gt; 16 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (10) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 518 nnnnnnnnnn ctcctc 16

&lt; 210 &gt; 519 &lt; 211 &gt; 16 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide 350 <2 2 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (16) &lt; 223 &gt; Α, Τ, C, G, other or unknown &lt; 400 &gt; 519 gaggagnnnn ηηηηηη 16

&lt; 210 &gt; 520 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 520 cctnnnnnag g 11

&lt; 210 &gt; 521 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 521 ccannnnnnt gg ??? 12

&lt; 210 &gt; 522 &lt; 211 &gt; 6680 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Nucleotide sequence of Vector pCES 5 &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (201) .. (1058) 351 &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (2269) .. (2682) &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (2723). . (2866) &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (3767). . (3850) &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (4198). . (5799) &lt; 400 &gt; 522 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 atg agt att aatattgaaa aaggaagagt ttc caa cat ctt gcc cgt gtc att 233

Met Ser Ile Gin His Phe Arg Val Ala Leu Ile 15 10 ccc ttt ttt gcg gea ttt tgc ctt cct gtt ttt gct cac cca gaa acg 281 Pro Phe Phe Ala Ala Phe Cys Leu Pro Val Phe Ala His Pro Glu Thr 15 20 25 ctg gtg aaa gat aaa gat gct gaa gat cag ttg ggt gcc cga gtg ggt 329 Leu Vai Lys Vai Lys Asp Ala Glu Asp Gin Leu Gly Ala Arg Go Gly 30 35 40 tata gaa ctg gat ctc aac age ggt aag ate ctt gag agt ttt cgc 377 Tyr Ile Glu Leu Asp Leu Asn Ser Gly Lys Ile Leu Glu Ser Phe Arg 45 50 55 ccc gaa gaa cgt ttt cca atg atg age act ttt aaa gtt cta tgt 425 Pro Glu Glu Arg Phe Pro Met Met Ser Thr Phe Lys Vu Leu Leu Cys 60 65 70 75 ggc gta tta tcc cgt att gac gcc ggg caa gag caa ctc ggt cgc 473 Gly Ala Vai Leu Ser Arg Ile Asp Ala Gly Gin Glu Gin Leu Gly Arg 80 85 90 cgc ata cac tat tet cag aat gac ttg gtt gag tac tea cca gtc aca 521 Arg Ile His Tyr Ser Gin Asn Asp Leu Go Glu Tyr Ser Pro Go Thr 95 100 105 gaa aag cat ctt acg gat ggc atg aca gta aga ga tta tgc agt gct 569 Glu Lys His Leu Thr Asp Gly Met Thr Go Arg Arg Glu Leu Cys Ser Ala 110 115 120 gcc ata acc agg agat gat aac act gcg gcc aac tta ctt ctg aca ac 617 Ala Ile Thr Met Ser Asp Asn Thr Ala Ala Asn Leu Leu Leu Thr Thr 125 130 135 352 665 665 ata gga gga cga gag cta acc Ile Gly Gly Pro Lys Glu Leu Thr 140 145 cat gta act ege ctt gat cgt tgg His Vai Thr Arg Leu Asp Arg Trp 160 cca gac gag cgt gac acc acg Pro Asn Asp Glu Arg Asp Thr Thr 175 tgg et al. cta tta act ggc gaa Leu Arg Lys Leu Leu Thr Gly Glu 190 195 caa tta ata gac tgg atg gag gcg Gin Leu Ile Asp Trp Met Glu Ala 205 210 ege teg gee ctt gc gct ggc tgg Arg Be Lea Pro Ala Gly Trp 220 225 g gt g gt g gt t g gt g gt Gly Glu Arg Gly Ser Arg Gly Ile 240 aag ccc tcc cgt to gta gtt to Lys Pro Ser Arg Ile Vai Vai Ile 255 atg gat gaa cga aat aga cag ate Met Asp Glu Arg Asn Arg Gin Ile 270 275 gct Ala ttt Phe ttg Leu 150 cac His aac Asn atg Met ggg Gly gat Asp 155 gaa Glu ccg Pro 165 gag Glu ctg Leu aat Asn gaa Glu gee Ala 170 ata Ile atg Met 180 cct Pro gta Go to gea Ala atg Met gea Ala 185 aca Thr acg Thr cta Leu ctt Leu act Thr cta Leu gct Ala 200 tcc Be cgg Arg caa Gin gat Asp aaa Lys gtt Goa gea Ala 215 gga Glyca Pro ctt Leu ctg Leu ttt Phe att Ile gct Ala 230 gat Asp aaa Lys tet Ser gga Gly gee Ala 235 att Ile ala 245 gea Ala ctg Leu ggg Glyca Pro gat Asp 250 ggt Glyc Tac Tyr 260 acg Thr acg Thr ggg Gly agt Ser cag Gin 265 gea Ala act Thr gct Ala gag Glu ata Ile ggt Gly gee Ala tea Ser ctg Leu att Ile 713 761 809 857 905 953 1001 1049 280 aag cat tgg taactgtcag accaagttta ctcatatata ctttagattg 1098

Lys His Trp 285 atttaaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatetea 1158 tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga 1218 tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa 1278 aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga 1338 aggtaactgg etteageaga gcgcagatac caaatactgt ccttctagtg tagccgtagt 1398 taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt 1458 taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat 1518 agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcata cagcccagct 1578 tggagcgaac gacctacacc gaactgagat acctacagcg tgagcattga gaaagcgcca 1638 cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag 1698 agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc 1758 353 gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga 1818 aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca 1878 tgttctttcc tgcgttatcc cctgattctg tggataaccg t attaccgcc tttgagtgag 1938 ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg 1998 aagagcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct 2058 ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt 2118 agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt atgttgtgtg 2178 gaattgtgag cggataacaa tttcacacag gaaacagcta tgaccatgat tacgccaagc 2238 tttggagcct tttttttgga gattttcaac gtg aaa aaa Lys Lys Met. tta tta ttc gca att Leu Leu Phe Ala Ile 290 2292 cct ttt gtt gtt cct ttc tat tet cac agt gca cag gtc caa ctg cag 2340 Pro Leu Will Pro Phe Tyr Ser His Ser Ala Gin Go Gin Gin Leu Gin 295 300 305 310 gtc gac ctc gag ga gg gct act gtg gct gca cet tet gtc ttc 2388 Go Asp Leu Glu Ile Lys Arg Gly Thr Go Ala Ala Pro Be Go Phe 315 320 325 until ttc ccg tca gat gag cag ttg aaa tet gga act gee tet gtt 2436 Ile Phe Pro Pro Ser Asp Glu Gin Leu Lys Ser Gly Thr Ala Ser Go 330 335 340 gtg tgc ctg ctg aat aac ttc tat ccc aga gag gee aaa gta cag tgg 2484 Go Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Vai Gin Trp 345 350 3 5 5 aag gtg gat aac gee ctc caa teg ggt aac tcc cag gag agt gtc aca 2532 Lys Go Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin Glu Ser Go Thr 360 365 370 gag cag gac age aag gac age acc tac age ctc age age acc ctg acg 2580 Glu Gin Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu T hr 375 380 385 390 ctg age aaa gca gac tac gag aaa cac aaa gtc tac gee tgc gaa gtc 2628 Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Go Tyr Ala Cys Glu Go 395 400 405 acc cat cg ggc ctg agt tea ccg gtg aca aag age ttc aac agg gga 2676 Thr His Gin Gly Leu Ser Ser Pro Go Thr Lys Ser Phe Asn Arg Gly 410 415 420 gag tgt taataaggcg cgccaattct atttcaagga gacagtcata atg aaa tac 2731 Glu Cys Met Lys Tyr 425 cta ttg cct acg gca gee gct gga ttg tta tta ctc gcg gee cag ccg 2779 Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala Ala Gin Pro 430 435 440 354 2827 gcc atg gcc gaa gtt caa ttg tta gag tct ggt ggc ggt ctt gtt cag Ala Met Ala Glu Vai Gin Leu Leu Glu Ser Gly Gly Gly Leu Vai Gin 445 450 455 cct ggt tg tta cgt ctt tct tgc gct gct tcc gga gcttcagatc 2876 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly 460 465 470 tgtttgcctt tttgtggggt ggtgcagatc gcgttacgga gatcgaccga ctgcttgagc 2936 aaaagccacg cttaactgct gatcaggcat gggatgttat tcgccaaacc agtcgtcagg 2996 atcttaacct gaggcttttt ttacctactc tgcaagcagc gacatctggt ttgacacaga 3056 gcgatccgcg tcgtcagttg gtagaaacat taacacgttg ggatggcatc aatttgctta 3116 atgatgatgg taaaacctgg cagcagccag gctctgccat cctgaacgtt tggctgacca 3176 gtatgttgaa gcgtaccgta gtggctgccg tacctatgcc atttgataag tggtacagcg 3236 ccagtggcta cgaaacaacc caggacggcc caactggttc gctgaatata agtgttggag 3296 caaaaatttt gtatgaggcg gtgcagggag acaaatcacc aatcccacag gcggttgatc 3356 tgtttgctgg gaaaccacag caggaggttg tgttggctgc gctggaagat acctgggaga 3416 ctctttccaa acgctatggc aataatgtga gtaactggaa aacacctgca atggccttaa 3476 cgttccgggc aaataatttc tttggtgtac cgcaggccgc agcggaagaa acgcgtcatc 3536 aggcggagta tcaaaaccgt ggaacagaaa acgatatgat tgttttctca ccaacgacaa 3596 gcgatcgtcc tgtgcttgcc tgggatgtgg tcgcacccgg tcagagtggg tttattgctc 3656 ccgatggaac agttgataag cactatgaag atcagctgaa aatgtacgaa aattttggcc 3716 gtaagtcgct ctggttaacg aagcaggatg tggaggcgca taaggagtcg tct aga 3 772

Ser Arg gac aac tct aag aat act ctc ttg cag atg aac age tta agt ctg 3820

Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Ser Leu 475 480 485 490 age att cgg tcc ggg caa cat tct cca aac tgaccagacg acacaaacgg 3870

Ser Ile Arg Ser Gly Gin His Being Pro Asn 495 500 cttacgctaa atcccgcgca tgggatggta aagaggtggc gtctttgctg gcctggactc 3930 atcagatgaa ggccaaaaat tggcaggagt ggacacagca ggcagcgaaa caagcactga 3990 ccatcaactg gtactatgct gatgtaaacg gcaatattgg ttatgttcat actggtgctt 4050 atccagatcg tcaatcaggc catgatccgc gattacccgt tcctggtacg ggaaaatggg 4110 actggaaagg gctattgcct tttgaaatga accctaaggt gtataacccc cagaagctag 4170 cctgcggctt cggtcaccgt ctcaagc gcc tcc acc aag ggc cca teg gtc ttc 4224

Ala Ser Thr Lys Gly Pro Ser Vai Phe 505 355 ccc ctg gea ccc tcc tcc aag age acc tet ggg ggc aca gcg gee ctg 4272 Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu 510 515 520 525 ggc tgc ctg gtc aag gac tac ttc ccc gaa ccg gtg acg gtg teg tgg 4320 Gly Cys Leu Vs Lys Asp Tyr Phe Pro Glu Pro Vs Thr Val Ser Trp 530 535 540 aac tea ggc gee ctg acc age ggc gtc cac acc ttc ccg gctc cta 4368 Asn Be Gly Ala Leu Thr Be Gly Be His Thr Phe Pro Ala Val Leu 545 550 555 cag tcc tea gga etc tac tcc etc act age gta gt g acc gtg ccc tcc 4416 Gin Be Ser Gly Leu Tyr Be Leu Ser Be Go Go Thr Val Pro Ser 560 565 570 age age tg ggc acc cag acc tac tgc aac gtg aat cac aag ccc 4464 Ser Ser Leu Gly Thr Gin Thr Tyr Ile Cys Asn Go Asn His Lys Pro 575 580 585 age aac acc aag gtg gac aag aaa gtt gag ccc aaa tet tgt gcg gee 4512 Ser Asn Thr Lys Go Asp Lys Lys Go Glu Pro Lys Ser Cys Ala Ala 59 0 595 600 605 gea cat cat cat cac cat cac ggg gee gea gaa caa aaa etc ate tea 4560 Ala His His His His His Gly Ala Ala Glu Gin Lys Leu Ile Ser 610 615 620 gaa gag gat ctg aat ggg gee gea tag act gtt gaa agt tgt tta gea 4608 Glu Glu Asp Leu Asn Gly Ala Ala Thr Go Glu Ser Cys Leu Ala 625 630 635 aaa cct cat aca gaa aat tea ttt act aac gtc tgg aaa gac gac aaa 4656 Lys Pro His Thr Glu Asn Ser Phe Thr Asn Go Trp Lys Asp Asp Lys 640 645 650 act tta gat cgt tac gct aac tat gag ggc tgt ctg tgg aat gct aca 4704 Thr Leu Asp Ar g Tyr Ala Asn Tyr Glu Gly Cys Leu Trp Asn Ala Thr 655 660 665 ggc gtt gtg gtt tgt act ggt gg ga ga act cag tgt tgt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gtg gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt 4800 Go Pro Ile Gly Leu Ala Ile Pro Glu Asn Glu Gly Gly Gly Ser Glu 685 690 6 9 5 700 g gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt Gly Gly Gly Gly Gly Gly Gly Gly Gly Thr Lys Pro 705 710 715 cct aac cct 4896 Pro Glu Tyr Gly Asp Thr Pro Ile Pro Gly Tyr Thr Tyr Ile Asn Pro 720 725 730 etc. gac ggc act tat ccg cct ggt act gag caa aac ccc gct aat cct 4944 Leu Asp Gly Thr Tyr Pro Pro Gly Thr Glu Gin Asn Pro Wing Asn Pro 735 740 745 aat cct tet ctt gag gag tet cag cct ctt aat act ttc atg ttt cag 4992 356

Asn Pro 750 Ser Leu Glu Glu Ser 755 Gin Pro Leu Asn Thr 760 Phe Met Phe Gin aat aat agg ttc cga aat agg cag ggt gea tta act gtt tat acg ggc 5040 Asn 765 Asn Arg Phe Arg Asn 770 Arg Gin Gly Ala Leu 775 Thr Go Tyr Thr Gly 780 act gtt act act gac ccc gtt aa act act cag tac act 5088 Thr Go Thr Gin Gly 785 Thr Asp Pro Vai Lys 790 Thr Tyr Tyr Gin Tyr 795 Thr cct gta tea tea aaa gee atg tat gac tac tgg aac ggt aaa ttc 5136 Pro Will Be Ser 800 Lys Ala Met Tyr Asp 805 Ala Tyr Trp Asn Gly 810 Lys Phe aga gac tgc gct ttc cat tct ggc ttt aat gag gat cca ttc gtt tgt 5184 Arg Asp Cys 815 Ala Phe His Ser Gly 820 Phe Asn Glu Asp Pro 825 Phe Vs Cys gaa tat caa ggc caa teg tct gac ctg cct cca cct gtc aat gct 5232 Glu Tyr 830 Gin Gly Gin Ser Ser 835 Asp Leu Pro Gin Pro 840 Pro Go Asn Ala ggc ggc tg ggt ggt ggt tct ggt ggc ggc tct gag ggt ggc ggc 5280 Gly 845 Gly Gly Ser Gly Gly 850 Gly Ser Gly Gly Gly 855 Ser Glu Gly Gly Gly 860 tct gag ggt ggc ggt tct ga g gg g g g g g g g g g g g t t 5328 Ser Glu Gly Gly Gly 865 Ser Glu Gly Gly Gly 870 Ser Glu Gly Gly Gly 875 Ser ggt ggc gcc gcc gcc tg gat gat ttt gat tat gaa aaa atg gea aac 5376 Gly Gly Gly Ser 880 Gly Ser Gly Asp Phe 885 Asp Tyr Glu Lys Met 890 Ala Asn gct gat gat gat gat gat gaat aac gcg cta cag 5424 Ala Asn Lys 895 Gly Ala Met Thr Glu 900 Asn Ala Asp Glu Asn 905 Ala Leu Gin tct gac aaa ggc aaa ctt gat tct gtc gct act gat tac ggt gct 5472 Ser Asp 910 Ala Lys Gly Lys Leu 915 Asp Ser Ala Thr 920 Asp Tyr Gly Ala gct ggt ttc att ggt gac gtt tcc ggc ctt gct aat ggt aat 5520 Ala 925 Ile Asp Gly Phe Ile 930 Gly Asp Will Be Gly 935 Leu Ala Asn Gly Asn 940 ggt gct act ggt gat ttt gct gtc tct aat tcc caa atg gct caa gtc 5568 Gly Ala Thr Gly Asp 945 Phe Ala Gly Ser Ser Asn 950 Ser Gin Met Ala Gin 955 Go ggt gac ggt gat aat tea cct tta atg aat aat ttc cgt cata tat tta 5616 Gly Asp Gly Asp 960 Asn Ser Pro Leu Met 965 Asn Asn Phe Arg Gin 970 Tyr Leu cct ttg cct cag teg gtt gaa tgt ege cct tat gtc ttt ggc gct 5664 Pro Ser Leu 975 Pro Gin Ser Goa Glu 980 Cys Arg Pro Tyr Go 985 Phe Gly Ala 357 5712 ggt aaa cca tat gaa ttt tct att gat tgt gac aaa ata aac tta ttc Gly Lys Pro Tyr Glu Phe Ser Ile Asp Cys Asp Lys Ile Asn Leu Phe 990 995 1000 ctt tta tat gtt gcc Leu Leu Tyr Goa Ala 1015 cgt ggt gtc ttt gcg ttt Arg Gly Go Phe Ala Phe 1005 1010 acc ttt atg tat gta 5760 Thr Phe Met Tyr Go 1020 ttt tcg acg ttt gct aac ata ctg cgt aat aag gag tct taataagaat 5809 Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn Lys Glu Ser 1025 1030 tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 5869 cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat 5929 cgcccttccc aacagttgcg cagcctgaat ggcgaatggc gcctgatgcg gtattttctc 5989 cttacgcatc tgtgcggtat ttcacaccgc atataaattg taaacgttaa tattttgtta 6049 aaattcgcgt taaatttttg ttaaatcagc tcatttttta accaataggc cgaaatcggc 6109 aaaatccctt ataaatcaaa agaatagccc gagataggg t tgagtgttgt tccagtttgg 6169 aacaagagtc cactattaaa gaacgtggac tccaacgtca aagggcgaaa aaccgtctat 6229 cagggcgatg gcccactacg tgaaccatca cccaaatcaa gttttttggg gtcgaggtgc 6289 cgtaaagcac taaatcggaa ccctaaaggg agcccccgat ttagagcttg acggggaaag 6349 ccggcgaacg tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc tagggcgctg 6409 gcaagtgtag cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa tgcgccgcta 6469 cagggcgcgt actatggttg ctttgacggg tgcagtctca gtacaatctg ctctgatgcc 6529 gcatagttaa gccagccccg acacccgcca acacccgctg acgcgccctg acgggcttgt 6589 ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag 6649 aggttttcac cgtcatcacc gaaacgcgcg a 6680

&lt; 210 &gt; 523 &lt; 211 &gt; 286 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Vector Protein Sequence pCES5 &lt; 400 &gt; 523

Met Ser Ile Gin His Phe Arg Val Ala Leu Ile Pro Phe Phe Ala Ala 15 10 15

Phe Cys Leu Pro Go Phe Ala His Pro Glu Thr Leu Go Lys Go Lys 20 25 30

Asp Ala Glu Asp Gin Leu Gly Ala Arg Go Gly Tyr Ile Glu Leu Asp 35 40 45 358

Leu Asn Ser Gly Lys Ile Leu Glu Ser Phe Arg Pro Glu Glu Arg Phe 50 55 60 Pro Met Met Ser Thr Phe Lys Val Leu Leu Cys Gly Ala Val Leu Ser 65 70 75 80 Arg Ile Asp Ala Gly Gin Glu Gin Leu Gly Arg Arg Ile His Tyr Ser 85 90 95 Gin Asn Asp Leu Val Glu Tyr Ser Pro Val Thr Glu Lys His Leu Thr 100 105 110 Asp Gly Met Thr Val Arg Arg Glu Leu Cys Ser Ala Ala Ile Thr Met Ser 115 120 125 Asp Asn Thr Ala Ala Asn Leu Leu Leu Thr Thr Ile Gly Gly Pro Lys 130 135 140 Glu Leu Thr Ala Phe Leu His Asn Met Gly Asp His Vai Thr Arg Leu 145 150 155 160 Asp Arg Trp Glu Pro Glu Leu Asn Glu Ala Ile Pro Asn Asp Glu Arg 165 170 175 Asp Thr Thr Met Pro Go Ala Met Ala Thr Thr Leu Arg Lys Leu Leu 180 185 190 Thr Gly Glu Leu Leu Thr Leu Ala Ser Arg Gin Gin Leu Ile Asp Trp 195 200 205 Met Glu Ala Asp Lys Go Ala Gly Pro Leu Leu Arg Be Lea Pro 210 215 220 Wing Gly Trp Phe Ile Ala Asp Lys Ser Gly Ala Gly Glu Arg Gly Ser 225 230 235 240 Arg Gly Ile Ile Ala Ala Leu Gly Pro Asp Gly Lys Pro Ser Arg Ile 245 250 255 Vai Vai Ile Tyr Thr Thr Gly Ser Gin Ala Thr Met Asp Glu Arg Asn 260 265 270 Arg Gin Ile Ala Glu Ile Gly Ala Ser Leu Ile Lys His Trp 275 280 285

&lt; 210 &gt; 524 &lt; 211 &gt; 138 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Vector Protein Sequence pCES5 &lt; 400 &gt; 524

Met Lys Lys Leu Leu Phe Ala Ile Pro Leu Will Pro Phe Tyr Ser 15 10 15 359

His Be Ala Gin 20 Go Gin Leu Gin Go 25 Asp Leu Glu Ile Lys 30 Arg Gly Thr Go Ala 35 Ala Pro Be Go Phe 40 Ile Phe Pro Pro Ser 45 Asp Glu Gin Leu Lys 50 Ser Gly Thr Ala Ser 55 Vai Vai Cys Leu Leu 60 Asn Asn Phe Tyr Pro 65 Arg Glu Ala Lys Go 70 Gin Trp Lys Go Asp 75 Asn Ala Leu Gin Ser 80 Gly Asn Ser Gin Glu 85 Ser Go Thr Glu Gin 90 Asp Ser Lys Asp Ser 95 Thr Tyr Ser Leu Ser 100 Ser Thr Leu Thr Leu 105 Ser Lys Ala Asp Tyr 110 Glu Lys His Lys Val 115 Tyr Ala Cys Glu Val 120 Thr His Gin Gly Leu 125 Ser Ser Pro Val Thr 130 Lys Ser Phe Asn Arg 135 Gly Glu Cys &lt; 210 &gt; 525

&lt; 211 &gt; 48 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Vector Protein Sequence pCES5 &lt; 400 &gt; 525

Met 1 Lys Tyr Leu Leu 5 Pro Thr Ala Ala Ala 10 Gly Leu Leu Leu Leu 15 Ala Ala Gin Pro Ala 20 Met Ala Glu Vai Gin 25 Leu Leu Glu Ser Gly 30 Gly Gly Leu Go Gin 35 Pro Gly Gly Ser Leu 40 Arg Leu Ser Cys Ala 45 Ala Ser Gly

&lt; 210 &gt; 526 &lt; 211 &gt; 28 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Vector Protein Sequence pCES5 &lt; 400 &gt; 526

Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu 15 10 15

Ser Leu Ser Ile Arg Ser Gly Gin His Ser Pro Asn 20 25 360

&lt; 210 &gt; 527 &lt; 211 &gt; 533 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Vector Protein Sequence pCES5 &lt; 400 &gt; 527

Ala Ser Thr Lys Gly Pro Ser Va Phe Pro Leu Ala Pro Ser Ser Lys 1 5 10 15 Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Vai Lys Asp Tyr 20 25 30 Phe Pro Glu Pro Will Thr Will Be Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Vai His Thr Phe Pro Ala Go Leu Gin Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Go Go Go Thr Go Pro Be Ser Ser Go Leu Gly Thr Gin Thr 65 70 75 80 Tyr Ile Cys Asn Go Asn His Lys Pro Be Asn Thr Lys Go Asp Lys 85 90 95 Lys Go Glu Pro Lys Ser Cys Ala Ala His His His His His His 100 105 110 Gly Ala Ala Glu Gin Lys Leu Ile Ser Glu Glu Asp Leu Asn Gly Ala 115 120 125 Ala Thr Va Glu Ser Cys Leu Ala Lys Pro His Thr Glu Asn Ser Phe 130 135 140 Thr Asn Go Trp Lys Asp Asp Lys Thr Leu Asp Arg Tyr Ala Asn Tyr 145 150 155 160 Glu Gly Cys Leu Trp Asn Ala Thr Gly Go Go Go Cys Thr Gly Asp 165 170 175 Glu Thr Gin Cys Tyr Gly Thr Trp Pro V Ile Pro Gly Leu Ala Ile Pro 180 185 190 Glu Asn Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly 195 200 205 Ser Glu Gly Gly Gly Thr Lys Pro Pro Glu Tyr Gly Asp Thr Pro Ile 210 215 220 Pro Gly Tyr Thr Tyr Ile Asn Pro Leu Asp Gly Thr Tyr Pro Pro Gly 225 230 235 240 Thr Glu Gin Asn Pro Ala Asn Pro Asn Pro Ser Leu Glu Glu Ser Gin 245 250 255 361

Pro Leu Asn Thr 260 Phe Met Phe Gin Asn 265 Asn Arg Phe Arg Asn 270 Arg Gin Gly Ala Leu 275 Thr Go Tyr Thr Gly 280 Thr Go Thr Gin Gly 285 Thr Asp Pro Vai Lys 290 Thr Tyr Tyr Gin Tyr 295 Thr Pro Go Ser Ser 300 Lys Ala Met Tyr Asp 305 Ala Tyr Trp Asn Gly 310 Lys Phe Arg Asp Cys 315 Ala Phe His Ser Gly 320 Phe Asn Glu Asp Pro 325 Phe V Cys Glu Tyr 330 Gin Gly Gin Ser Ser 335 Asp Leu Pro Gin Pro 340 Pro Go Asn Ala Gly 345 Gly Gly Gly Gly Gly 35 Gly Gly Gly Gly 355 Gly Gly Gly Gly 360 Ser Glu Gly Gly Gly 365 Ser Glu Gly Gly Gly 370 Ser Glu Gly Gly Gly 375 Ser Gly Gly Gly Ser 380 Gly Ser Gly Asp Phe 385 Asp Tyr Glu Lys Met 390 Ala Asn Ala Asn Lys 395 Gly Ala Met Thr Glu 400 Asn Ala Asp Glu Asn 405 Ala Leu Gin Ser Asp 410 Ala Lys Gly Lys Leu 415 Asp Ser Ala Thr 420 Asp Tyr Gly Ala Ala 425 Ile Asp Gly Phe Ile 430 Gly Asp Will Be Gly 435 Leu Ala Asn Gly Asn 440 Gly Ala Thr Gly Asp 445 Phe Ala Gly Ser Asn 450 Ser Gin Met Ala Gin 455 Go Gly Asp Gly Asp 460 Asn Ser Pro Leu Met 465 Asn Asn Phe Arg Gin 470 Tyr Leu Pro Ser Leu 475 Pro Gin Ser Glu 480 Cys Arg Pro Tyr Go 485 Phe Gly Ala Gly Lys 490 Pro Tyr Glu Phe Ser 495 Ile Asp Cys Asp Lys 500 Ile Asn Leu Phe Arg 505 Gly Go Phe Ala Phe 510 Leu Leu Tyr Go Ala 515 Thr Phe Met Tyr Go 520 Phe Ser Thr Phe Ala 525 Asn Ile Leu Arg Asn Lys Glu Ser 530

&lt; 210 &gt; 528 &lt; 211 &gt; 30 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 362 &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 528 acctcactgg cttccggatt cactttctct &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 529 42 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 529 agaaacccac tccaaacctt taccaggagc ttggcgaacc ca 42 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 530 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 530 ggaaggcagt gatctagaga tagtgaagcg acctttaacg gagtcagcat a &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 531 23 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 531 ggaaggcagt gatctagaga tag 23 &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 532 20 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 532 gtgctgactc agccaccctc 20 363 20 &lt; 210 &gt; 533 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 533 gccctgactc agcctgcctc

Synthetic oligonucleotide &lt; 210 &gt; 534 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 534 gagctgactc aggaccctgc

Synthetic oligonucleotide &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 53 5 20 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Oligonucleotide &lt; 400 &gt; 535 gagctgactc agccaccctc &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 536 38 DNA Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Oligonucleotide &lt; 400 &gt; 536 cctcgacagc gaagtgcaca gagcgtcttg actcagcc &lt; 210 &gt; &lt; 211 &gt; &lt; 212 &gt; &lt; 213 &gt; 537 30 DNA Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Synthetic Synthetic Oligonucleotide 20 38 364 < 4 0 0 &gt; 537 cctcgacagc gaagtgcaca gagcgtcttg ??? 21 &lt; 210 &gt; 538 &lt; 211 &gt; 38 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 538 cctcgacagc gaagtgcaca gagcgctttg actcagcc 38 &lt; 210 &gt; 539 &lt; 211 &gt; 30 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 539 cctcgacagc gaagtgcaca gagcgctttg ??? 21 &lt; 210 &gt; 540 &lt; 211 &gt; 38 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 540 cctcgacagc taagtgcaca gagcgctttg actcagcc 38 &lt; 210 &gt; 541 &lt; 211 &gt; 30 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 541 cctcgacagc gaagtgcaca gagcgctttg ??? 21 &lt; 210 &gt; 542 &lt; 211 &gt; 38 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 365 &lt; 22 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 542 cctcgacagc gaagtgcaca gagcgaattg actcagcc 38 &lt; 210 &gt; 543 &lt; 211 &gt; 30 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 543 cctcgacagc gaagtgcaca gagcgaattg ??? 21 &lt; 210 &gt; 544 &lt; 211 &gt; 38 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 544 cctcgacagc gaagtgcaca gtacgaattg actcagcc 38 &lt; 210 &gt; 545 &lt; 211 &gt; 30 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 545 cctcgacagc gaagtgcaca gtacgaattg ??? 21 &lt; 210 &gt; 5 21 <211> 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 5 4 6 cctcgacagc gaagtgcaca g 21 366 &lt; 210 &gt; 547 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 547 ccgtgtatta ctgtgcgaga g ??? 21 &lt; 210 &gt; 548 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 548 ctgtgtatta ctgtgcgaga g ??? 21 &lt; 210 &gt; 549 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 549 ccgtatatta ctgtgcgaaa g

Synthetic oligonucleotide &lt; 210 &gt; 55 0 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 55 0 ctgtgtatta ctgtgcgaaa g

Synthetic oligonucleotide &lt; 210 &gt; 551 &lt; 211 &gt; 21 &lt; 212 &gt; DNA Λ cn 1-1 CN V Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence

Synthetic oligonucleotide 367 &lt; 4 Ο Ο &gt; 551

ctgtgtatta ctgtgcgaga c &lt; 210 &gt; 552 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 552 ccatgtatta ctgtgcgaga c 21

&lt; 210 &gt; 553 &lt; 211 &gt; 94 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 553 ggtgtagtga tctagtgaca actctaagaa tactctctac ttgcagatga acagctttag 60 ggctgaggac actgcagtct actattgtgc gaga 94

&lt; 210 &gt; 554 &lt; 211 &gt; 94 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 554 ggtgtagtga tctagtgaca actctaagaa tactctctac ttgcagatga acagctttag 60 ggctgaggac actgcagtct actattgtgc gaaa 94

&lt; 210 &gt; 555 &lt; 211 &gt; 85 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 555 atagtagact gcagtgtcct cagcccttaa gctgttcatc tgcaagtaga gagtattctt 60 agagttgtct ctagatcact acacc 85 368 20

&lt; 210 &gt; 556 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt;

Primer &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 556 gactgggtgt agtgatctag &lt; 210 &gt; 557 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 557

Primer cttttctttg ttgccgttgg ggtg 24

&lt; 210 &gt; 558 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 558 nnnnnnnnng caggt ??? 15

&lt; 210 &gt; 559 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 559 acctgcnnnn n 11 369

&lt; 210 &gt; 560 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (7) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 560 gnatin 10

&lt; 210 &gt; 561 &lt; 211 &gt; 16 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (16) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 561 gaggagnnnn nnnnnn 16

&lt; 210 &gt; 562 &lt; 211 &gt; 16 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (10) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 562 nnnnnnnnnn ctcctc 16

&lt; 210 &gt; 563 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide 370 <2 2 0> &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (10) &lt; 223 &gt; A, Τ, C, G, other or unknown &lt; 400 &gt; 563 ctcttcnnnn 10

&lt; 210 &gt; 564 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (5) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 564 nnnnngaaga g 11

&lt; 210 &gt; 565 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (1) .. (15) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 565 nnnnnnnnnnnnnnngtccc 20

&lt; 210 &gt; 566 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown 371 12

&lt; 4 Ο Ο &gt; 566 gacnnnnnng tc &lt; 210 &gt; 567 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 567 cgtctcnnnn n 11

&lt; 210 &gt; 568 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 568 gtatccnnnn nn 12

&lt; 210 &gt; 569 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 569 gcannnnnnt cg 12 372

&lt; 210 &gt; 570 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 570 gccnnnnngg c 11

&lt; 210 &gt; 571 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (11) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 571 ggtctcnnnn n 11

&lt; 210 &gt; 572 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 572 gacnnnnngt c 11

&lt; 210 &gt; 573 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, Τ, C, G, other or unknown &lt; 400 &gt; 573 gacnnnnngt c 11

&lt; 210 &gt; 574 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 574 ccannnnntg g 11

&lt; 210 &gt; 575 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 575 ccannnnnnn nntgg 15

&lt; 210 &gt; 576 &lt; 211 &gt; 13 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (5) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown 374 13

&lt; 4 Ο Ο &gt; 576 ggccnnnnng gcc &lt; 210 &gt; 577 &lt; 211 &gt; 12 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (9) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 577 ccannnnnnt gg ??? 12

&lt; 210 &gt; 578 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 578 cctnnnnnag g 11

&lt; 210 &gt; 579 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (7) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 579 gacnnnngtc 10 375

&lt; 210 &gt; 580 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (12) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 580 ccannnnnnn nntgg 15

&lt; 210 &gt; 581 &lt; 211 &gt; 11 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4) .. (8) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 581 gcnnnntg c 11

&lt; 210 &gt; 582 &lt; 211 &gt; 10251 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Nucleotide sequence CJRA05 &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (1578) .. (1916) &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (2388) .. (2843) <2 2 0>

&lt; 221 &gt; CDS &lt; 222 &gt; (2849). . (2893) &lt; 220 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (3189). . (4232) 376 &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (7418) .. (8119) &lt; 2 2 0 &gt;

&lt; 221 &gt; CDS &lt; 222 &gt; (8160) .. (9452) &lt; 400 &gt; 582 aatgctacta ctattagtag aattgatgcc accttttcag ctcgcgcccc aaatgaaaat 60 atagctaaac aggttattga ccatttgcga aatgtatcta atggtcaaac taaatctact 120 cgttcgcaga attgggaatc aactgttata tggaatgaaa cttccagaca ccgtacttta 180 gttgcatatt taaaacatgt tgagctacag cattatattc agcaattaag ctctaagcca 240 tccgcaaaaa tgacctctta tcaaaaggag caattaaagg tactctctaa tcctgacctg 300 ttggagtttg cttccggtct ggttcgcttt gaagctcgaa ttaaaacgcg atatttgaag 360 tctttcgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctataatagt 420 cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtttaaagca 480 tttgaggggg attcaatgaa tatttatgac gattccgcag tattggacgc tatccagtct 540 aaacatttta ctattacccc ctctggcaaa acttcttttg caaaagcctc tcgctatttt 600 ggtttttatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt 660 aattcctttt ggcgttatgt atctgcatta gttgaatgtg gtattcctaa atctcaactg 720 atgaatcttt ctacctgtaa taatgttgtt ccgttagttc gttttattaa cgtagatttt 780 tcttcccaac gtcctgactg gtataatgag ccagttctta aaatcgcata aggtaattca 840 caa tgattaa agttgaaatt aaaccatctc aagcccaatt tactactcgt tctggtgttt 900 ctcgtcaggg caagccttat tcactgaatg agcagctttg ttacgttgat ttgggtaatg 960 aatatccggt tcttgtcaag attactcttg atgaaggtca gccagcctat gcgcctggtc 1020 tgtacaccgt tcatctgtcc tctttcaaag ttggtcagtt cggttccctt atgattgacc 1080 gtctgcgcct cgttccggct aagtaacatg gagcaggtcg cggatttcga cacaatttat 1140 caggcgatga tacaaatctc cgttgtactt tgtttcgcgc ttggtataat cgctgggggt 1200 caaagatgag tgttttagtg tattcttttg cctctttcgt tttaggttgg tgccttcgta 1260 gtggcattac gtattttacc cgtttaatgg aaacttcctc atgaaaaagt ctttagtcct 1320 caaagcctct gtagccgttg ctaccctcgt tccgatgctg tctttcgctg ctgagggtga 1380 cgatcccgca aaagcggcct ttaactccct gcaagcctca gcgaccgaat atatcggtta 1440 tgcgtgggcg atggttgttg tcattgtcgg cgcaactatc ggtatcaagc tgtttaagaa 1500 attcacctcg aaagcaagct gataaaccga tacaattaaa ggctcctttt ggagcctttt 1560 377 1610 ttttggagat tttcaac gtg aaa aaa tta tta ttc gca att cct tta gtt Met Lys Lys Leu Leu Phe Ala Ile Pro Leu Go 15 10 gtt cct ttc tat tct ggc gc gcc gaa tca cat cta gac ggc gcc gct 1658 Go Pro Phe Tyr 15 Ser Gly Ala Ala Glu 20 Ser His Leu Asp Gly 25 Ala Ala gaa act gtt gaa agt tgt tta gca aaa tcc cata gaa aat tca ttt 1706 Glu Thr Go 30 Glu Ser Cys Leu Ala 35 Lys Ser His Thr Glu 40 Asn Ser Phe act aac gtc tgg aaa gac gac aaa act tta gat cgt tac gct aac tat 1754 Thr Asn 45 will Trp Lys Asp Asp 50 Lys Thr Leu Asp Arg 55 Tyr Ala Asn Tyr gag ggc tgt ctg tgg aat gct gc gtt gta gtt gtg act ggt gac 1802 Glu 60 Gly Cys Leu Trp Asn 65 Ala Thr Gly Will Go 70 Will Cys Thr Gly Asp 75 gaa act cag tgt t gt t gt att ggg ctt gct cct 1850 Glu Thr Gin Cys Tyr 80 Gly Thr Trp Go Pro 85 Ile Gly Leu Ala Ile 90 Pro gaa aat gag ggt ggt ggt tct gag ggt ggt tct gag ggt ggt ggt 1898 Glu Asn Glu Gly 95 Gly Gly Ser Glu Gly 100 Gly Gly Ser Glu Gly 105 Gly Gly tct gag ggt ggc ggt act aaacctcctg agtacggtga tacacctatt 1946

Be Glu Gly Gly Gly Thr 110 cttatatcaa ccctctcgac ggcacttatc cgcctggtac tgagcaaaac 2006 ctaatccttc tcttgaggag tctcagcctc ttaatacttt catgtttcag 2066 tccgaaatag gcagggggca ttaactgttt atacgggcac tgttactcaa 2126 ccgttaaaac ttattaccag tacactcctg tatcatcaaa agccatgtat 2186 ggaacggtaa attcagagac tgcgctttcc attctggctt taatgaggat 2246 gtgaatatca aggccaatcg tctgacctgc ctcaacctcc tgtcaatgct 2306 ctggtggtgg ttctggtggc ggctctgagg gtggtggctc tgagggaggc 2366 ccgggctata gccgctaatc

Ser Gly Asp 115 aac gct aat aag ggg gct atg acc gaa Asn Ala 125 Asn Lys Gly Ala Met 130 Thr Glu cag tct gac gct aaa ggc aaa ctt gat Gin 140 Ser Asp Ala Lys Gly 145 Lys Leu Asp gct gct gat ggt ttc att ggt gac Ala Ala Ile Asp Gly 160 Phe Ile Gly Asp ttt gat tat gaa atag gca 2417 Phe Asp Tyr Glu 120 Lys Met Ala aat gcc gat gaa aac gcg cta 2465 Asn Ala Asp 135 Glu Asn Ala Leu tct gtc gct act gat tac ggt 2513 Ser Vai 150 Ala Thr Asp Tyr Gly 155 gtt tcc ggc ctt gct aat ggt 2561 Go 165 Be Gly Leu Ala Asn 170 Gly 378 gat gt gt gat gat gt gt gt gt gt gt gt gt gt gt gt Gly Asp Phe Ala Gly Ser Asn Ser Gin Met Ala Gin 175 180 185 GTC GGT GAC GGT GAT AAT tea cct tta atg aat aat ttc cgt caa tat Val Gly Asp Gly Asp Asn Ser Pro Leu Met Asn Asn Phe Arg Gin Tyr 190 195 200 tt cc tcc ctc cct caa teg gtt gaa tgt ege cct ttt gtc ttt ggc Leu Pro Ser Leu Pro Gin Ser Go Glu Cys Arg Pro Phe Go Phe Gly 205 210 21 5 gct ggt aaa cca tat gaa ttt tet att gat tgt gac aaa ata aac tta Ala Gly Lys Pro Tyr Glu Phe Ser Ile Asp Cys Asp Lys Ile Asn Leu 220 225 230 235 ttc cgt ggt gtc ttt gcg ttt ctt tta tat gtt gee acc ttt atg tat Phe Arg Gly Go Phe Ala Phe Leu Leu Tyr Go Ala Thr Phe Met Tyr 240 245 250 gta ttt tet acg ttt gac aac ata ctg cgt aat aag gag tet taatc atg Will Phe Be Thr Phe Ala Asn Ile Leu Arg Asn Lys Glu Ser Met 2 5 5 260 265 cca gtt ctt ttg ggt att ccg tta tta ttg cgt ttc ctc ggt Pro Vai Leu Leu Gly Ile Pro Leu Leu Leu Arg Phe Leu Gly 270 275 280 ttccttctgg taactttgtt cggctatctg cttacttttc ttaaaaaggg i cttcggtaag atagctattg etattteatt gtttcttgct cttattattg ggcttaactc. aattcttgtg ggttatctct ctgatattag cgctcaatta. ccctctgact ttgttcaggg tgttcagtta attctcccgt ctaatgcgct tccctgtttt tatgttattc tctctgtaaa &gt; ggctgctatt ttcatttttg acgttaaaca aaaaatcgtt tcttatttgg attgggataa. ataat atg Met gct gtt tat ttt gta act ggc aaa tta ggc tet gga aag acg ctc gtt Ala Vai Tyr Phe Go Thr Gly Lys Leu Gly Ser Gly Lys Thr Leu Go 285 290 295 age gtt ggt aag att cag gat aaa att gta gct ggg tgc aaa ata gea Ser Go to Gly Lys Ile Gin Asp Lys Ile Go to Ala Gly Cys Lys Ile Ala 300 305 310 act aat ctt gat tta agg ctt caa aac ctc ccg caa gtc ggg agg ttc Thr Asn Leu Asp Leu Arg Leu Gin Asn Leu Pro Gin Go Gly Arg Phe 315 320 325 gct aaa acg cct ege gtt ctt aga ata ccg gat aag cct tet ata tet Ala Lys Thr Pro Arg Vai Leu Arg Ile Pro Asp Lys Pro Ser Ile Ser 330 335 340 345 gat ttg ctt gct att ggg ege gat aat gat tcc tac gat gaa aat aaa Asp Leu Leu Ala Ile Gly Arg Gly Asn Asp Ser Tyr Asp Glu Asn Lys 350 355 360 2609 2657 2705 2753 2801 2851 2893 2953 3013 3073 3133 3191 3239 3287 3335 3383 3431 379 aac ggc ttg ctt gtt ctc gat gag tgc ggt act tgg ttt aat acc cgt 3479 Asn Gly Leu Leu Go Leu Asp Glu Cys Gly Thr Trp Phe Asn Thr Arg 365 370 375 tct tgg aat gat aag gaa aga cag ccg att att gat tgg ttt cta cat 3527 Ser Trp Asn Asp Lys Glu Arg Gin Pro Ile Ile Asp Trp Phe Leu His 380 385 390 gct cgt aaa tta gga tgg gat att att ttt ctt gtt cag gac tta tct 3575 Ala Arg Lys Leu Gly Trp Asp Ile Ile Phe Leu Vai Gin Asp Leu Ser 395 400 405 att gtt gat aaa cag gcg cgt tct gca tta gct gaa cat gtt gtt tat 3623 Ile Vai Asp Lys Gin Ala Arg Ser Ala Leu Ala Glu His Vai Vai Tyr 410 415 420 425 tgt cgt cgt ctg gac aga att act tta cct ttt gtc ggt act tta tat 3671 Cys Arg Arg Leu Asp Arg Ile Thr Leu Pro Phe Go Gly Thr Leu Tyr 430 435 440 tct ctt att act ggc tcg aaa atg cct ctg cct aaa tta cat gtt ggc 3719 Ser Leu Ile Thr Gly Ser Lys Met Pro Leu Pro Lys Leu His Val Gly 445 450 455 gtt gtt gatt gat tct caa tta age cct act gtt gag cgt tgg 3767 Go Vai Lys Tyr Gly Asp Ser Gin Leu Ser Pro Th r Go Glu Arg Trp 460 465 470 ctt tat act ggt aag aat ttg tat aac gca tat gat act aaa cag gct 3815 Leu Tyr Thr Gly Lys Asn Leu Tyr Asn Ala Tyr Asp Thr Lys Gin Ala 475 480 485 ttt tct agt aat tat gat tcc ggt gtt tat tct tat tta acg cct tat 3863 Phe Ser Ser Asn Tyr Asp Ser Gly Ty Tyr Ser Tyr Leu Thr Pro Tyr 490 495 500 505 tta tca cac ggt cgg tat ttc aaa cca tta aat tta ggt cag aag atg 3911 Leu Ser His Gly Arg Tyr Phe Lys Pro Leu Asn Leu Gly Gin Lys Met 510 515 520 aaa tta act aaa ata tat ttg aaa aag ttt tct ege gtt ctt tgt ctt 3959 Lys Leu Thr Lys Ile Tyr Leu Lys Lys Phe Ser Arg Vai Leu Cys Leu 525 530 535 gcg att gga ttt gca tca gca ttt aca tat agt tat ata acc caa cct 4007 Ala Ile Gly Phe Ala Ser Ala Phe Thr Tyr Ser Tyr Ile Thr Gin Pro 540 545 550 aag ccg gag gtt aaa ag gta gtc tct cag acc tat gat ttt gat aaa 4055 Lys Pro Glu Go Lys Lys Go Go Be Gin Thr Tyr Asp Phe Asp Lys 555 560 565 ttc act att gac tct tct cag cgt ctt aat cta age tat ege tat gtt 4103 Phe Thr Ile Asp Ser Ser Arg Arg Leu Asn Leu Ser Tyr Arg Tyr Go 570 575 580 585 ttc aag gat tct aga gga aaa tta att aat age gac gat tta cag aag 4151 Phe Lys Asp Ser Lys Gly Lys Leu Ile Asn Ser Asp Asp Asu Leu Gin Lys 590 595 600 380 caa ggt tat tca ctc aca tat att gat tta tgt Gin Gly Tyr Ser Leu Thr Tyr Ile Asp Leu Cys 605 610 aaa ggt aat tca aat gaa att gTT aaa tgt aat Lys Gly Asn Ser Asn Glu Ile Val Lys Cys Asn 620 act gTT tcc att aaa Thr Val Ser Ile Lys 615 4199 ttgtttcatc atcttctttt ttgtaacttg gtattcaaag gtactgttac tgtatattca ctgttttacg tgcaaataat ataatccaaa caatcaggat atgataattc cgctccttct cttttaaaat taataacgtt agtctaatac ttctaaatcc ttagtgctcc taaagatatt caactgacca gatattgatt atttttcatt tgctgctggc gcctcacctc tgttttatct tagggctatc agttcgcgca gtattcttac gctttcaggt ttactggtcg tgtgactggt gtcaaaatgt aggtatttcc ttctggatat taccagcaag ttactaatca aag aagtatt tcggtggcct cactgattat aaatcccttt aatcggcctc tatacgtgct cgtcaaagca ggtgtggtgg ttacgcgcag ttcgctttct tcccttcctt cgggggctcc ctttagggtt gatttgggtg atggttcacg acgttggagt ccacgttctt cctatctcgg gctattcttt 625 gctcaggtaa ttgaaatgaa caatcaggcg aatccgttat tctgacgtta aacctgaaaa tttgatatgg taggttctaa tatattgatg aattgccatc ggtggtttct ttgttccgca cgggcaaagg atttaatacg tcaaatgtat tatctattga ttagataacc ttcctcaatt gagggtttga tatttgaggt tctcagcgtg gcactgttgc tctgctggtg gttcgttcgg ttaaagacta atagccattc cagaagggtt ctatctctgt gaatctgcca atgtaaataa atgagcgttt ttcctgttgc gccgatagtt tgagttcttc gctacaacgg ttaatttgcg aaaaacactt ctcaggattc ctgtttagct cccgctctga accatagtac gcgccctgta cgtgaccgct acacttgcca tctcgccacg ttcgccggct ccgatttagt gctttacggc tagtgggcca tcgccctgat taatagtgga ctcttgttcc tgatttataa gggattttgc taattttgtt ttcttgatgt taattcgcct ctgcgcgatt tgtttctccc gatgtaaaag tctacgcaat ttctttattt cccttccatt attcagaagt atctgataat caggaatatg aaatgataat gttactcaaa agttgtcgaa ttgtttgtaa cggctctaat ctattagttg cctttcaact gttgatttgc tcagcaaggt gatgctttag aggcggtgtt aatactgacc tatttttaat ggcgatgttt aaaaatattg tctgtgccac tggccagaat gtccctttta tccatttcag acgattgagc aatggctggc ggtaatattg tactcaggca agtgatgtta tgatggacag actcttttac tggcgtaccg ttcctgtcta ttctaacgag gaaagcacgt gcggcgcatt aagcgcggcg gcgccctagc gcccgctcct ttccccgtca agctctaaat acctcgaccc caaaaaactt agacggtttt tcgccctttg aaactggaac aacactcaac 4252 4312 4372 4432 4492 4552 4612 4672 4732 4792 4852 4912 4972 5032 5092 5152 5212 5272 5332 5392 5452 5512 5572 5632 5692 5752 5812 cgatttcgga accaccatca 5872 381 aacaggattt tcgcctgctg gggcaaacca gcgtggaccg cttgctgcaa ctctctcagg 5932 gccaggcggt gaagggcaat cagctgttgc ccgtctcact ggtgaaaaga aaaaccaccc 5992 tggatccaag cttgcaggtg gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt 6052 atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct gataaatgct 6112 tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg cccttattcc 6172 cttttttgcg gc attttgcc ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa 6232 agatgctgaa gatcagttgg gcgcactagt gggttacatc gaactggatc tcaacagcgg 6292 taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca cttttaaagt 6352 tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac tcggtcgccg 6412 catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa agcatcttac 6472 ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg ataacactgc 6532 ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt ttttgcacaa 6592 catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg aagccatacc 6652 aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc gcaaactatt 6712 aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga tggaggcgga 6772 taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta ttgctgataa 6832 atctggagcc ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc cagatggtaa 6892 gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg atgaacgaaa 6952 tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt cagaccaagt 7012 ttact catat atactttaga ttgatttaaa acttcatttt taatttaaaa ggatctaggt 7072 gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt cgttccactg 7132 tacgtaagac ccccaagctt gtcgactgaa tggcgaatgg cgctttgcct ggtttccggc 7192 accagaagcg gtgccggaaa gctggctgga gtgcgatctt cctgacgctc gagcgcaacg 7252 caattaatgt gagttagctc actcattagg caccccaggc tttacacttt atgcttccgg 7312 ctcgtatgtt gtgtggaatt gtgagcggat aacaatttca cacaggaaac agctatgacc 7372 atgattacgc caagctttgg agcctttttt ttggagattt tcaac gtg aaa aaa tta Met Lys Lys Leu 7429 630 tta ttc gca att cct tta gtt gtt cct ttc tat tct cac agt gca caa 7477

Leu Phe Ala Ile Pro Leu Will Pro Phe Tyr Be His Ser Ala Gin 635 640 645 382 gac to cag atg acc cag tet cca gcc acc ctg tet ttg tet cca ggg Asp Ile Gin Met Thr Gin Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly 650 655 660 gaa aga gcc acc ctc tcc tgc agg gcc agt cag ggt gt g age gauge Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Gly Ser Ser Tyr 6 6 5 670 675 680 tta gcc tgg tac cag aaaa cct gg c cg gct ccc agg ctc ct c ate Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ala Pro Arg Leu Leu Ile 685 690 695 tat gat gca tcc aac agg gcc act gcc to cca gcc agg ttc agt ggc Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 700 705 710 agt ggg cct ggg aca gac ttc act ctc acc until acts act cta gag cct Ser Gly Pro Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro 715 720 725 gaa gat ttt gca gtt tat tac tgt cag cag cgt aac tgg cat ccg tgg Glu Asp Phe Ala Go Tyr Tyr Cys Gin Gin Arg Asn Trp His Pro Trp 730 735 740 acg ttc ggc caa ggg acc aag gtg gaa aaa cga act gtg gct gca Thr Phe Gly Gin Gly Thr Lys Go Glu Ile Lys Arg Thr Go Ala Ala 745 750 755 760 cca tet gtc ttc cc tet gat gag cag ttg aaa tet gga Pro Ser Phe Ile Phe Pro Pro Ser Asp Glu Gin Leu Lys Ser Gly 765 770 775 act gcc tet gtt gtg tgc ctg ctg aat aac ttc tat ccc aga gag gcc Thr Ala Ser Vai Vai Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 780 785 790 aaa gta cag tgg aag gtg gat aac gcc ctc caa teg ggt aac tcc cag Lys Vai Gin Trp Lys Go Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin 795 800 805 gag agt gtc aca gag cgg gac age aac gac age acc tac age ctc age Glu Ser Vai Thr Glu Arg Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 810 815 820 age acc gtg acg ctg age aaa gca gac tac gag aaa cac aaa gtc tac Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Vai Tyr 825 830 835 840 gcc tgc gaa gtc acc cat cg ggc ctg a ge teg ccc gtc aca aag age Ala Cys Glu Vai Thr His Gin Gly Leu Ser Ser Pro Go Thr Lys Ser 845 850 855 7525 7573 7621 7669 7717 7765 7813 7861 7909 7957 8005 8053 8101 8149 8198 ttc aac agg gga gg tgt taataaggcg cgccaattct atttcaagga Phe Asn Arg Gly Glu Cys 860 acg gca gct gga ttg tta Thr Ala Ala Gly Leu Leu 870 875 gacagtcata atgta cta ttg cct Met Lys Tyr Leu Leu Pro 865 383 tta ctc gcg gcc cg ccg gcc atg gcc gaa gtt caa ttg tta gag tct 8246 Leu Leu Ala Ala Gin Pro Ala Met Ala Glu Vai Gin Leu Leu Glu Ser 880 885 890 ggt ggc ggt ctt gtt cag cct ggt gt tct tta cgt ctt tct tgc gct 8294 Gly Gly Gly Leu Gly Gly Gly Ser Leu Arg Leu Ser Cys Ala 895 900 905 gct tcc act ttc act tact gag atg cgt tgg gt cae 8342 Ala Ser Gly Phe Thr Phe Ser Thr Tyr Glu Met Arg Trp Val Arg Arg 910 915 920 gct cct ggt aaa ggt ttg gag tgg gtt tct tat ate gct cct tct ggt 8390 Ala Pro Gly Lys Gly Leu Glu Trp It will be Tyr Ile Ala Pro Ser Gly 925 930 935 ggc gat act gct tat gct gac tcc gtt aaa ggt ege ttc act tct 8438 Gly Asp Thr Ala Tyr Ala Asp Ser Go Lys Gly Arg Phe Thr Ile Ser 940 945 950 955 aga gac aac tct aag aat act ctc tac ttg cag atg aac age tta agg 8486 Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg 960 965 970 gct gag gac act gea gtc tac tat tgt gcg agg agg ctc gat ggc tat 8534 Ala Glu Asp Thr Ala Va Tyr Tyr Cys Ala Arg Arg Leu Asp Gly Tyr 975 980 985 att tcc tac tac tac ggt atg gac gtc tgg ggc caa ggg acc acg gtc 8582 I le Ser Tyr Tyr Tyr Gly Met Asp Go Trp Gly Gin Gly Thr Thr Go 990 995 1000 acc gtc tca age gcc tcc acc aag gcc cca teg gtc ttc ccc ctg gea 8630 Thr Will Be Be Ala Be Thr Lys Gly Pro Will Be Phe Pro Leu Ala 1005 1010 1015 ccc tcc tcc tcc aag age acc tct ggg ggc aca gcg gcc ctg ggc tgc ctg 8678 Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala L I Gly Cys Leu 1020 1025 1030 1035 gtc aag gac tac ttc ccc gaa ccg gtg acg gtg teg tgg aac tca ggc 8726 Go Lys Asp Tyr Phe Pro Glu Pro Go Thr Will Be Trp Asn Ser Gly 1040 1045 1050 gcc ctg acc age ggc gtc cac acc ttc ccg gct gtc cta cag tcc tca 8774 Ala Leu Thr Ser Gly Go His Thr Phe Pro Ala Go Leu Gin Ser Ser 1055 1060 1065 gga ctc tac tcc ctc age age gta gtg acc gtg ccc tcc age age ttg 8822 Gly Leu Tyr Being Leu Being Being Going Going Going Being Being Being Leu 1070 1075 1080 ggc acc cag acc tac tgc aac gtg aat cac aag CCC age aac acc 8870 Gly Thr Gin Thr Tyr I le Cys Asn Going Asn His Lys Pro Being Asn Thr 1085 1090 1095 aag gtg gac aag aaa gtt gag ccc aaa tct tgt gcg gcc gea cat cat 8918 Lys Go Asp Lys Lys Go Glu Pro Lys Ser Cys Ala Ala His His 1100 1105 1110 1115 384 cat cac cat cac ggg gcc gca gaa caa aaa ctc ate tea gaa gag gat 8966 His His His His Gly Ala Ala Glu Gin Lys Leu Ile Ser Glu Glu As p 1120 1125 1130 ctg aat ggg gcc gca tag gct age tet gct wsy ggy gay tty gay tay 9014 Leu Asn Gly Wing Wing Gin Wing To Be Wing Wing Gly Asp Phe Asp Tyr 1135 1140 1145 gar aar atg gct aaw gcy aay aar ggs gcy atg acy gar aay gcy gay 9062 Glu Lys Met Ala Asn Ala Asn Lys Gly Ala Met Thr Glu Asn Ala Asp 1150 1155 1160 gar aay gck ytr car wsy gay gcy aar ggy aar ytw gay wsy gtc gck 9110 Glu Asn Ala Leu Gin Ser Asp Ala Lys Gly Lys Leu Asp Ser Vai Ala 1165 1170 1175 acy gay tay ggy gcy gcc gay ggy tty aty ggy gay gtc wsy ggy 9158 Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe Ile Gly Asp Will Be Gly 1180 1185 1190 1195 ytk gcy aay ggy aay ggy gcy acy ggw gay tty gcw ggy tck aat tcy 9206 Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala Gly Be Asn Ser 1200 1205 1210 car atg gcy car gty ggw gay ggw gay aay wsw cck ytw atg aay aay 9254 Gin Met Wing Gin Go Gly Asp Gly Asp Asn Ser Pro Leu Met Asn Asn 1215 1220 1225 tty mgw car tay ytw cck tcy cty cck car wsk gty gar tgy cgy ccw 9302 Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin Be Go Glu Cys Arg Pro 1230 1235 1240 tty gty tty wsy gcy ggy aar ccw tay gar tty wsy aty gay tgy gay 9350 Phe Go Phe Be Gly Lys Pro Tyr Glu Phe Be Ile Asp Cys Asp 1245 1250 1255 aar atm aay ytw tty cgy ggy gty tty gck tty ytk yta tay gty gcy 9398 Lys Ile Asn Leu Phe Arg Gly Vai Phe Ala Phe Leu Leu Tyr Go Wing 1260 1265 1270 1275 acy tty atg tay gtw tty wsy ack tty gcy aay atw ytr cgy aay aar 9446 Thr Phe Met Tyr Go Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn Lys 1280 1285 1290 gar wsy tagtgatctc ctaggaagcc cgcctaatga gcgggctttt tttttctggt 9502 Glu Being atgcatcctg aggccgatac tgtcgtcgtc ccctcaaact ggcagatgca cggttacgat 9562 gcgcccatct acaccaacgt gacctatccc attacggtca atccgccgtt tgttcccacg 9622 gagaatccga cgggttgtta ctcgctcaca tttaatgttg atgaaagctg gctacaggaa 9682 ggccagacgc gaattatttt tgatggcgtt cctattggtt aaaaaatgag ctgatttaac 9742 aaaaatttaa tgcgaatttt aacaaaatat taacgtttac aatttaaata tttgcttata 9802 caatcttcct gtttttgggg cttttctgat tatcaaccgg ggtacatatg attgacatgc 9862 tagttttacg attaccgttc atcgattctc ttgtttgctc cagactctca ggcaatgacc 9922 385 tgatagcctt tgtagatctc tcaaaaatag ctaccctctc cggcattaat ttatcagcta 9982 gaacggttga atatcatatt gatggtgatt tgactgtctc cggcctttct cacccttttg 10042 aatctttacc tacacattac tcaggcattg catttaaaat atatgagggt tctaaaaatt 10102 tttatccttg cgttgaaata aaggcttctc ccgcaaaagt attacagggt cataatgttt 10162 ttggtacaac cgatttagct ttatgctctg aggctttatt gcttaatttt gctaattctt 10222 tgccttgcct gtatgattta ttggatgtt 10251

&lt; 210 &gt; 583 &lt; 211 &gt; 113 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Protein sequence CJRA05 &lt; 400 &gt; 583

Met 1 Lys Lys Leu Leu 5 Phe Ala Ile Pro Leu 10 Will Pro Phe Tyr 15 Ser Gly Ala Ala Glu 20 Ser His Leu Asp Gly 25 Ala Ala Glu Thr Val 30 Glu Ser Cys Leu Ala 35 Lys Ser His Thr Glu 40 Asn Ser Phe Thr Asn 45 V Trp Lys Asp Asp 50 Lys Thr Leu Asp Arg 55 Tyr Ala Asn Tyr Glu 60 Gly Cys Leu Trp Asn 65 Ala Thr Gly Vai Vai 70 Vai Cys Thr Gly Asp 75 Glu Thr Gin Cys Tyr 80 Gly Thr Trp Go Pro 85 Ile Gly Leu Ala Ile 90 Pro Glu Asn Glu Gly 95 Gly Gly Ser Glu Gly 100 Gly Gly Ser Glu Gly 105 Gly Gly Ser Glu Gly 110 Gly Gly

Thr

&lt; 210 &gt; 584 &lt; 211 &gt; 152 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Protein sequence CJRA05 &lt; 400 &gt; 584

Ser Gly Asp Phe Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Ala 1 5 10 15 386

Met Thr Glu Asn 20 Ala Asp Glu Asn Ala 25 Leu Gin Ser Asp Ala 30 Lys Gly Lys Leu Asp 35 Ser Vai Ala Thr Asp 40 Tyr Gly Ala Ala Ile 45 Asp Gly Phe Ile Gly 50 Asp Will Be Gly Leu 55 Ala Asn Gly Asn Gly 60 Ala Thr Gly Asp Phe 65 Ala Gly Ser Asn Ser 70 Gin Met Ala Gin Go 75 Gly Asp Gly Asp Asn 80 Ser Pro Leu Met Asn 85 Asn Phe Arg Gin Tyr 90 Leu Pro Ser Leu Pro 95 Gin Ser Vai Glu Cys 100 Arg Pro Phe Go Phe 105 Gly Ala Gly Lys Pro 110 Tyr Glu Phe Ser Ile 115 Asp Cys Asp Lys Ile 120 Asn Leu Phe Arg Gly 125 Go Phe Ala Phe Leu 130 Leu Tyr Go Ala Thr 135 Phe Met Tyr Go Phe 140 Ser Thr Phe Ala Asn 145 Ile Leu Arg Asn Lys 150 Glu Ser

&lt; 210 &gt; 585 &lt; 211 &gt; 15 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: CJRA05 peptide sequence &lt; 400 &gt; 585

Met Pro Go Leu Leu Gly Ile Pro Leu Leu Leu Arg Phe Leu Gly 15 10 15

&lt; 210 &gt; 586 &lt; 211 &gt; 348 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Protein sequence CJRA05 &lt; 400 &gt; 586

Met 1 Ala Vai Tyr Phe 5 Go Thr Gly Lys Leu 10 Gly Ser Gly Lys Thr 15 Leu Will Go Go Gly 20 Lys Ile Gin Asp Lys 25 Ile Go Ala Gly Cys 30 Lys Ile Ala Thr Asn 35 Leu Asp Leu Arg Leu 40 Gin Asn Leu Pro Gin 45 Go Gly Arg 387

Phe Ala 50 Lys Thr Pro Arg Val 55 Leu Ser 65 Asp Leu Leu Ala Ile 70 Gly Arg Lys Asn Gly Leu Leu 85 Vai Leu Asp Arg Ser Trp Asn 100 Asp Lys Glu Arg His Ala Arg 115 Lys Leu Gly Trp Asp 120 Ser Ile 130 Go Asp Lys Gin Ala 135 Arg Tyr 145 Cys Arg Arg Leu Asp 150 Arg Ile Tyr Ser Leu Ile Thr 165 Gly Ser Lys Gly Vai Val Lys 180 Tyr Gly Asp Ser Trp Leu Tyr 195 Thr Gly Lys Asn Leu 200 Ala Phe 210 Ser Ser Asn Tyr Asp 215 Ser Tyr 225 Leu Ser His Gly Arg 230 Tyr Phe Met Lys Leu Thr Lys 245 Ile Tyr Leu Leu Ala Ile Gly 260 Phe Ala Ser Ala Pro Lys Pro 275 Glu Val Lys Lys Val 280 Lys Phe 290 Thr Ile Asp Ser Ser 295 Gin Go 305 Phe Lys Asp Ser Lys 310 Gly Lys Lys Gin Gly Tyr Ser 325 Leu Thr Tyr Lys Lys Gly Asn 340 Ser Asn Glu Ile

Arg Ile Pro Asp 60 Lys Pro Ser Ile Gly Asn Asp 75 Ser Tyr Asp Glu Asn 80 Glu Cys 90 Gly Thr Trp Phe Asn 95 Thr Gin 105 Pro Ile Ile Asp Trp 110 Phe Leu Ile Ile Phe Leu Vai 125 Gin Asp Leu Ser Ala Leu Wing 140 Glu His Will Go Thr Leu Pro 155 Phe Go Gly Thr Leu 160 Met Pro 170 Leu Pro Lys Leu His 175 Go Gin 185 Leu Ser Pro Thr Go 190 Glu Arg Tyr Asn Ala Tyr Asp 205 Thr Lys Gin Gly Go Tyr Ser 220 Tyr Leu Thr Pro Lys Pro Leu 235 Asn Leu Gly Gin Lys 240 Lys Lys 250 Phe Ser Arg Val Leu 255 Cys Phe 265 Thr Tyr Ser Tyr Ile 270 Thr Gin Will Be Gin Thr Tyr 285 Asp Phe Asp Arg Leu Asn Leu 300 Ser Tyr Arg Tyr Leu Ile Asn 315 Ser Asp Asp Leu Gin 320 Ile Asp 330 Leu Cys Thr Will Ser 335 Ile Will 345 Lys Cys Asn 388

&lt; 210 &gt; 587 &lt; 211 &gt; 234 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Protein sequence CJRA05 &lt; 400 &gt; 587

Met Lys Lys Leu Leu Phe Ala Ile Pro Leu Vai Pro Phe Tyr Ser 1 5 10 15 His Ser Ala Gin Asp Ile Gin Met Thr Gin Ser Pro Ala Thr Leu Ser 20 25 30 Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gly 35 35 45 Ser Ser Tyr Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ala Pro 50 55 60 Arg Leu Leu Ile Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala 65 70 75 80 Arg Phe Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 85 90 95 Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gin Gin Arg Asn 100 105 110 Trp His Pro Trp Thr Phe Gly Gin Gly Thr Lys Go Glu Ile Lys Arg 115 120 125 Thr Go Ala Ala Pro Ser Phe Ile Phe Pro Pro Ser Asp Glu Gin 130 135 140 Leu Lys Ser Gly Thr Ala Ser Vai Vai Cys Leu Leu Asn Asn Phe Tyr 145 150 155 160 Pro Arg Glu Ala Lys Vai Gin Trp Lys Go Asp Asn Ala Leu Gin Ser 165 170 175 Gly Asn Ser Gin Glu Ser Go Thr Glu Arg Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 195 200 205 His Lys Go Tyr Ala Cys Glu Go Thr His Gin Gly Leu Ser Ser Pro 210 215 220 Go Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230

&lt; 210 &gt; 588 &lt; 211 &gt; 431 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt;

Protein sequence CJRA05 &lt; 223 &gt; Description of the Artificial Sequence: &lt; 400 &gt; 588

Met Lys Tyr Leu Leu Pro Thr Ala 1 5 Ala Gin Pro Ala Met Ala Glu Vai 20 Leu Vai Gin Pro Gly Gly Ser Leu 35 40 Phe Thr Phe Ser Thr Tyr Glu Met 50 55 Lys Gly Leu Glu Trp Will Be Tyr 65 70 Ala Tyr Ala Asp Ser Go Lys Gly 85 Ser Lys Asn Thr Leu Tyr Leu Gin 100 Thr Ala Go Tyr Tyr Cys Ala Arg 115 120 Tyr Tyr Gly Met Asp Go Trp Gly 130 135 Ser Ala Ser Thr Lys Gly Pro Ser 145 150 Lys Ser Thr Ser Gly Gly Thr Ala 165 Tyr Phe Pro Glu Pro Go Thr Go 180 Be Gly Go His Thr Phe Pro Ala 195 200 Ser Leu Ser Be Go Go Thr Go 210 215 Thr Tyr Ile Cys Asn Go Asn His 225 230 Lys Go Glu Pro Lys Ser Cys 245 His Gly Ala Ala Glu Gin Lys Leu 260 Ala Ala Gin Ala Ser Ser Ala Ser 275 280 Ala Asn Ala Asn Lys Gly Ala Met 290 295

Ala Ala 10 Gly Leu Leu Leu Leu 15 Ala Gin 25 Leu Leu Glu Ser Gly 30 Gly Gly Arg Leu Ser Cys Ala 45 Ala Ser Gly Arg Trp Val Arg 60 Gin Ala Pro Gly Ile Ala Pro 75 Ser Gly Gly Asp Thr 80 Arg Phe 90 Thr Ile Ser Arg Asp 95 Asn Met 105 Asn Ser Leu Arg Ala 110 Glu Asp Arg Leu Asp Gly Tyr 125 Ile Ser Tyr Gin Gly Thr Thr 140 Will Thr Will Be Phe Pro 155 Leu Ala Pro Ser Ser 160 Ala Leu 170 Gly Cys Leu Vai Lys 175 Asp Ser 185 Trp Asn Ser Gly Ala 190 Leu Thr Go Leu Gin Ser Ser 205 Gly Leu Tyr Pro Ser Ser Ser 220 Leu Gly Thr Gin Lys Pro Ser 235 Asn Thr Lys Go Asp 240 Ala Ala 250 Ala His His His His 255 His Ile 265 Ser Glu Glu Asp Leu 270 Asn Gly Gly Asp Phe Asp Tyr 285 Glu Lys Met Thr Glu Asn Ala 300 Asp Glu Asn Ala 390

Leu 305 Gin Ser Asp Ala Lys 310 Gly Lys Leu Asp Ser 315 will Ala Thr Asp Tyr 320 Gly Ala Ala Ile Asp 325 Gly Phe Ile Gly Asp 330 will Ser Gly Leu Ala 335 Asn Gly Asn Gly Ala 340 Thr Gly Asp Phe Ala 345 Gly Ser Asn Ser Gin 350 Met Ala Gin Go Gly 355 Asp Gly Asp Asn Ser 360 Pro Leu Met Asn Asn 365 Phe Arg Gin Tyr Leu 370 Pro Ser Leu Pro Gin 375 Ser Go Glu Cys Arg 380 Pro Phe Go Phe Ser 385 Ala Gly Lys Pro Tyr 390 Glu Phe Ser Ile Asp 395 Cys Asp Lys Ile Asn 400 Leu Phe Arg Gly V 405 Phe Ala Phe Leu Leu 410 Tyr Go Ala Thr Phe 415 Met Tyr Go Phe Ser 420 Thr Phe Ala Asn Ile 425 Leu Arg Asn Lys Glu 430 Ser

&lt; 210 &gt; 589 &lt; 211 &gt; 5 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: illustrative peptide &lt; 400 &gt; 589

Glu Gly Gly Gly Ser 15

&lt; 210 &gt; 590 &lt; 211 &gt; 1275 &lt; 212 &gt; DNA &lt; 213 &gt; Unknown Organism &lt; 220 &gt; &lt; 221 &gt; CDS &lt; 222 &gt; (1) .. (1272) &lt; 220 &gt; &lt; 223 &gt; Description of Unknown Organism: Nucleotide sequence M13 &lt; 400 &gt; 590 gtg aaa aaa tta tta ttc gca att cct tta gtt gtt cct ttc tat tct Met 1 Lys Lys Leu Leu 5 Phe Ala Ile Pro Leu 10 Will Go Pro Phe Tyr 15 Be cacccccctct gaa act gtt gaa agt tgtta gca aaa ccc cat aca gaa His Ser Ala Glu 20 Thr Val Glu Ser Cys 25 Leu Ala Lys Pro His 30 Thr Glu 391 144 aat tca ttt act aac gtc tgg aaa gac gac aaa act tta gat cgt tac Asn Ser Phe Thr Asn Go Trp Lys Asp Asp Lys Thr Leu Asp Arg Tyr 35 40 45 gct aac tat gag ggt tgt ctg tgg aat gct tgt Ala Asn Tyr Glu Gly Cys Leu Trp Asn Ala Thr Gly Vai Vai Vai Cys 50 55 60 act ggt gac gaa act cag tgt tgt tgt tgt tg gtt cct att ggg ctt Thr Gly Asp Glu Thr Gin Cys Tyr Gly Thr Trp Go Pro Ile Gly Leu 65 70 75 80 gct tgt tgt tgt tgt tgt tgt tgt tgt ggt tgt Asn Glu Gly Gly Gly Gly Gly Gly Gly Gly Gly 85 85 g gt g gt g gt g gt g gt g gt g gt g gt g gt g gt g gt g gt gt Gt Gly Gly Gly Gly Gly Gly Gly Thr Lys Pro Pro Glu Tyr Gly Asp 100 105 110 aca cct att ccg ggc tat act tat aac cct ctc gac ggc act tat Thr Pro Ile Pro Gly Tyr Thr Tyr Ile Asn Pro Leu Asp Gly Thr Tyr 115 120 ccg cct ggt act gag caa ccc gct aat cct act cct tct ctt gag Pro Pro Gly Thr Glu Gin Asn Pro Ala Asn Pro Asn Pro Ser Leu Glu 130 135 140 gag tct cag cct ctt aat act ttc atg ttt cag aat aat agg ttc cga Glu Ser Gin Pro Leu Asn Thr Phe Met Phe Gin Asn Asn Arg Phe Arg 145 150 155 160 aat agg cag ggg gea tta act gtt tat acg ggc act gtt act caa ggc Asn Arg Gin Gly Ala Leu Thr Go Tyr Thr Gly Thr Go Thr Gin Gly 165 170 175 act gac ccc gtt aaa act tat tac cag tac act cct gta tca tca aaa Thr Asp Pro Go Lys Thr Tyr Tyr Gin Tyr Thr Pro Will Be Ser Lys 180 185 190 gcc atg tat gac tct tgg aac ggt aaa ttc aga gac tgc gct ttc Ala Met Tyr Asp Ala Tyr Trp Asn Gly Lys Phe Arg Asp Cys Ala Phe 195 200 205 c at tct ggc ttt aat gag gat cca ttc gtt tgt gaa tat caa ggc caa His Ser Gly Phe Asn Glu Asp Pro Phe Go Cys Glu Tyr Gin Gly Gin 210 215 220 tcg tct gac ctg cct ca cct cct gtc aat gct ggc ggc tgt ggt Ser Ser Asp Leu Pro Gin Pro Pro Go Asn Ala Gly Gly Gly Ser Gly 225 230 235 240 ggt ggt tct ggt ggt ggt tg ggt ggt ggt tg ggt ggt ggt ggt Gly Gly Ser Gly Gly Gly Ser Glu Gly Gly Gly Gly Ser Glu Gly Gly Gly 245 250 2 55 tct gag ggt ggc gt gag gg gt ggt tcc ggt Gg Gly Gly Gly Ser Glu Gly Gly Gly Ser Gly Gly Gly Ser Gly 260 265 270 192 240 288 336 384 432 480 528 576 624 672 720 768 392 816 tcc ggt gat ttt gat tat gaa aag atg Ser Gly Asp Phe Asp Tyr Glu Lys Met 275 280 atg acc g a g g g g ga ga a g g G Met G G Asn Ala Asp Glu Asn Ala 290 295 aaa ctt gat tct gtc gct act gat tac Lys Leu Asp Ser Vai Ala Thr Asp Tyr 305 310 att ggt gac gtt tcc ggc ctt gat aat Ile Gly A Sp Be Gly Leu Ala Asn 325 ttt gctc tct aat tcc caa atg gct Phe Ala Gly Ser Asn Ser Gin Met Ala 340 345 tca cct tta atg aat tat c gt caa Ser Pro Leu Met Asn Asn Phe Arg Gin 355 360 tcg gtt gaa tgt cgc cct ttt gtc ttt Ser Go Glu Cys Arg Pro Phe Go Phe 370 375 ttt tct att gat tgt gac aaa ata aac Phe Ser Ile Asp Cys Asp Lys Ile Asn 385 390 ttt ctt tta tat gtt gcc acc ttt atg Phe Leu Leu Tyr Go Ala Thr Phe Met 405 aac ata ctg cgt aat aag gag tct taa Asn Ile Leu Ar g Asn Lys Glu Ser 420 g aac gct aag ggg gct 864 Ala Asn Ala Asn 285 Lys Gly Ala cta cct t gac gct aaa ggc 912 Leu Gin Ser 300 Asp Ala Lys Gly gct gt gt ttc 960 Gly Ala 315 Ala Ile Asp Gly Phe 320 ggt aat ggt gct act ggt gat 1008 Gly 330 Asn Gly Ala Thr Gly 335 Asp caa gtc ggt gac gt gat aat 1056 Gin Go Gly Asp Gly 350 Asp Asn tatta cctcc ctc cct caa 1104 Tyr Leu Pro Ser 365 Leu Pro Gin age gct ggt aaa cca tat g aa 1152 Ser Ala Gly Lys Pro Tyr Glu 380 TTA TTC CGT GGT GTC TTT GCG 1200 Leu Phe Arg 395 Gly Ala Val Phe 400 gta ttt tat tct acg gct ttt 1248 Tyr 410 Phe Val Phe Ser Thr Ala 415 1275

&lt; 210 &gt; 591 &lt; 211 &gt; 424 &lt; 212 &gt; PRT &lt; 213 &gt; Unknown Organism &lt; 220 &gt; &lt; 223 &gt; Description of Unknown Organism: Protein sequence M13 &lt; 400 &gt; 591

Met 1 Lys Lys Leu Leu 5 Phe Ala Ile Pro Leu 10 Will Pro Phe Tyr 15 Ser His Ser Ala Glu 20 Thr Will Glu Ser Cys 25 Leu Ala Lys Pro His 30 Thr Glu Asn Ser Phe 35 Thr Asn Will Trp Lys 40 Asp Asp Lys Thr Leu 45 Asp Arg Tyr 393 to Asn Tyr Glu 50

Thr Gly Asp Glu 65

Ala Ile Pro Glu

Gly Gly Gly Ser 100

Thr Pro Ile Pro 115

Pro Pro Gly Thr 130

Glu Ser Gin Pro 145

Asn Arg Gin Gly

Thr Asp Pro Go 180

Ala Met Tyr Asp 195

His Ser Gly Phe 210

Ser Ser Asp Leu 225

Gly Gly Ser Gly

Ser Glu Gly Gly 260

Ser Gly Asp Phe 275

Met Thr Glu Asn 290

Lys Leu Asp Ser 305

Ile Gly Asp Go

Phe Ala Gly Ser 340

Ser Pro Leu Met 355

Gly Cys Leu Trp 55

Thr Gin Cys Tyr 70

Asn Glu Gly Gly 85

Glu Gly Gly Gly

Gly Tyr Thr Tyr 120

Glu Gin Asn Pro 135

Leu Asn Thr Phe 150

Ala Leu Thr Go 165

Lys Thr Tyr Tyr

Wing Tyr Trp Asn 200

Asn Glu Asp Pro 215

Pro Gin Pro Pro 230

Gly Gly Ser Glu 245

Gly Ser Glu Gly

Asp Tyr Glu Lys 280

Wing Asp Glu Asn 295

Go Ala Thr Asp 310

Ser Gly Leu Wing 325

Asn Ser Gin Met

Asn Asn Phe Arg 360

Asn Ala Thr Gly 60

Gly Thr Trp Val 75

Gly Ser Glu Gly 90

Thr Lys Pro Pro 105

Ile Asn Pro Leu

Wing Asn Pro Asn 140

Met Phe Gin Asn 155

Tyr Thr Gly Thr 170

Gin Tyr Thr Pro 185

Gly Lys Phe Arg

Phe Vai Cys Glu 220

Go Asn Ala Gly 235

Gly Gly Gly Ser 250

Gly Gly Ser Gly 265

Met Ala Asn Ala

Ala Leu Gin Ser 300

Tyr Gly Ala Ala 315

Asn Gly Asn Gly 330

Gin Wing Goes Gly 345

Gin Tyr Leu Pro

Go, go, go, Cys.

Pro Ile Gly Leu 80

Gly Gly Ser Glu 95

Glu Tyr Gly Asp 110

Asp Gly Thr Tyr 125

Pro Ser Leu Glu

Asn Arg Phe Arg 160

Go Thr Gin Gly 175

Will Be Ser Lys 190

Asp Cys Ala Phe 205

Tyr Gin Gly Gin

Gly Gly Ser Gly 240

Glu Gly Gly Gly 255

Gly Gly Ser Gly 270

Asn Lys Gly Ala 285

Asp Ala Lys Gly

Ile Asp Gly Phe 320

Ala Thr Gly Asp 335

Asp Gly Asp Asn 350

Ser Leu Pro Gin 365 394

Ser is 370 Glu Cys Arg Pro Phe 375 Go Phe Be Gly 380 Lys Pro Tyr Glu Phe 385 Ser Ile Asp Cys Asp 390 Lys Ile Asn Leu Phe 395 Arg Gly Go Phe Ala 400 Phe Leu Leu Tyr Go 405 Ala Thr Phe Met Tyr 410 Will Phe Ser Thr Phe 415 Ala Asn Ile Leu Arg 420 Asn Lys Glu Ser

&lt; 210 &gt; 592 &lt; 211 &gt; 35 < 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 592 caacgatgat cgtatggcgc atgctgccga gacag 35

&lt; 210 &gt; 593 &lt; 211 &gt; 1355 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Nucleotide sequence M13-III &lt; 220 &gt; &lt; 221 &gt; CDS &lt; 222 &gt; (1) .. (1305) &lt; 400 &gt; 593 gcg gee gea cat cat cat cac cat cac ggg gee gea gaa caa aaa ctc 48 Ala Wing His His His His His Gly Ala Wing Glu Gin Lys Leu 1 5 10 15 ate tea gaa gag gat ctg aat ggg gee gea tag gct age gat to aac 96 Ile Ser Glu Glu Asp Leu Asn Gly Ala Ala Ala Ser Asp Ile Asn 20 25 30 gat gat gg gct tet act gey gar acw gty gaa wsy tgy ytr gem 144 Asp Asp Arg Met Ala Ser Thr Ala Glu Thr Vai Glu Ser Cys Leu Ala 35 40 45 aar ccy cay acw gar aat wsw tty acw aay gts tgg aar gay gay aar 192 Lys Pro His Thr Glu Asn Ser Phe Thr Asn Go Trp Lys Asp Asp Lys 50 55 60 acy ytw gat cgw tay gey aay tay gar ggy tgy ytr tgg aat gey acm 240 Thr Leu Asp Arg Tyr Ala Asn Tyr Glu Gly Cys Leu Trp Asn Ala Thr 65 70 75 395 ggc gty gtw gty tgy ack ggy gay gar Gly Go Go Go Cys Thr Gly Asp Glu 80 85 gtk cck atw ggs ytw gcy atm cck gar Go Pro Ile Gly Leu Ala Ile Pro Glu 100 ggy ggy ggy wsy gar ggy ggy ggw t cy Gly Gly Gly Gly Gly Gly Gly Gly Ser 115 120 cck gar tay ggy gay acw cck atw cck Pro Glu Tyr Gly Asp Thr Pro Ile Pro 130 135 ytm gay ggm acy tay cck cck ggy acy Leu Asp Gly Thr Tyr Pro Pro Gly Thr 145 150 aay ccw wsy ytw gar gar wsy car cck Asn Pro Ser Leu Glu Glu Ser Gin Pro 160 165 aay aay mgk tty mgr aay mgk car ggk Asn Asn Arg Phe Arg Asn Arg Gin Gly 180 acy gty acy car ggy acy gay ccy gty Thr Go Thr Gin Gly Thr Asp Pro Go 195 200 cc gtm ter wsw aar gcy atg tay gay Pro Will Be Ser Lys Ala Met Tyr Asp 210 215 mgw gay tgy gcy tty cay wsy ggy tty Arg Asp Cys Ala Phe His Ser Gly Phe 225 230 gar tay car ggy car wsk wsy gay ytr Glu Tyr Gin Gly Gin Ser Ser Asp Leu 240 245 ggy ggy ggy wsy ggy ggw ggy wsy ggy Gly Gly Gly Ser Gly Gly Gly Ser Gly 260 wsy gar ggw ggy ggy wsy ggr ggy ggy Ser Glu Gly Gly Gly Ser Gly Gly Gly 275 280 tay gar atar gg a and gcy aay aar Tyr Glu Lys Met Ala Asn Ala Asn Lys 290 295 gay gar aay ger ctr car wst gay gcy Asp Glu Asn Ala Leu Gin Be Asp Ala 305 310 gcy acw gay tay ggt gct gcy gcy gy gy g gay acw car tgy tay ggy acr tgg 288 Thr Gin 90 Cys Tyr Gly Thr Trp 95 aay g ggy ggy ggy wsy gar 336 Asn 105 Glu Gly Gly Gly Ser 110 Glu g g g g g gw acy ack cck 384 Glu Gly Gly Gly Thr 125 Lys Pro ggy tay acy tay aty aay cck 432 Gly Tyr Thr Tyr 140 Ile Asn Pro gar car aay ccy gcy aay cck 480 Glu Gin Asn 155 Pro Ala Asn Pro ytw aay acy tty atg tty car 528 Leu Asn 170 Thr Phe Met Phe Gin 175 gcw ytw acy gtk tay ack ggm 576 Wing 185 Leu Thr Vai Tyr Thr 190 Gly aar acy tay tay car tay acy 624 Lys Thr Tyr Tyr Gin 205 Tyr Thr gcy tay tgg aay ggy aar tty 672 Ala Tyr Trp Asn 220 Gly Lys Phe aay gar gay ccw tty gty tgy 720 Asn Glu Asp 235 Pro Phe Go Cys cck car ccw cck gty aay gck 768 Pro Gin 250 Pro Pro Go Asn Ala 255 ggy ggy wsy gar ggy ggw ggy 816 Gly 265 Gly Ser Glu Gly Gly 270 Gly wsy ggy wsy ggy gay tty gay 864 Be Gly Be Gly Asp 285 Phe Asp ggs gcy atg acy gar aay gcy 912 Gly Ala Met Thr Glu Asn Ala 300 aar Lys ggy Gly aar Lys 315 ytw Leu gay Asp wsy Ser gtc Go 960 ggy tty aty ggy gay gty wsy 1008 396

Ala Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe Ile Gly Asp Will Be 320 325 330 335 ggy ctk gct aay ggy aay ggw gcy acy ggw gay tty gcw ggy tck aat 1056 Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn 340 345 350 tcy car atg gcy gg ggw gay ggw gay aay wsw cck ytw atg aay 1104 Be Gin Met Wing Gin Go Gly Asp Gly Asp Asn Ser Pro Leu Met Asn 355 360 365 aay tty mgw car tay ytw cck tcy cty cck car wsk gty gar tgy cgy 1152 Asn Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin Be Go Glu Cys Arg 370 375 380 ccw tty gty tty wsy gcy ggy aar ccw tay gar tty wsy aty gay tgy 1200 Pro Phe Goes Phe Ser Ala Gly Lys Pro Tyr Glu Phe Ser Ile Asp Cys 385 390 395 gay aar atm aay ytw ttc cgy ggy gty tty gck tty ytk yta tay gty 1248 Asp Lys Ile Asn Leu Phe Arg Gly Vai Phe Ala Phe Leu Leu Tyr Go 400 405 410 415 gcy acy tty atg tay gtw tty wsy ack tty gcy aay atw ytr cgy aay 1296 Wing Thr Phe Met Tyr V Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn 420 425 430 aar gar wsy tagtgatctc ctaggaagcc cgcctaatga gcgggctttt 1345 Lys Glu Ser tttttctggt 1355 &lt; 210 &gt; 594 &lt; 211 &gt; 434 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence:: Protein sequence M13-III &lt; 400 &gt; 594 Ala Ala His His His His His Gly Ala Ala Glu Gin Lys Leu 1 5 10 15 Ile Ser Glu Glu Asp Leu Asn Gly Ala Ala Ala Ser Asp Ile Asn Asp Asp 20 25 30 Asp Arg Met Ala Ser Thr Ala Glu Thr Go Glu Ser Cys Leu Ala Lys 35 40 45 Pro His Thr Glu Asn Ser Phe Thr Asn Go Trp Lys Asp Asp Lys Thr 50 55 60 Leu Asp Arg Tyr Ala Asn Tyr Glu Gly Cys Leu Trp Asn Ala Thr Gly 65 70 75 80 Will Go Go Cys Thr Gly Asp Glu Thr Gin Cys Tyr Gly Thr Trp Go 85 90 95 397

Pro Ile Gly Leu Ala Ile Pro Glu 100 Gly Gly Ser Glu Gly Gly Gly Ser 115 120 Glu Tyr Gly Asp Thr Pro Ile 130 130 Asp Gly Thr Tyr Pro Pro Gly Thr 145 150 Pro Ser Leu Glu Glu Ser Gin Pro 165 Asn Arg Phe Arg Asn Arg Gin Gly 180 Go Thr Gin Gly Thr Asp Pro Go 195 200 Will Be Ser Lys Ala Met Tyr Asp 210 215 Asp Cys Ala Phe His Ser Gly Phe 225 230 Tyr Gin Gly Gin Ser Ser Asp Leu 245 Gly Gly Ser Gly Gly Gly Ser Gly 260 Glu Gly Gly Gly Ser Gly Gly Gly 275 280 Glu Lys Met Ala Asn Ala Asn Lys 290 295 Glu Asn Ala Leu Gin Ser Asp Ala 305 310 Thr Asp Tyr Gly Ala Ala Ile Asp 325 Leu Ala Asn Gly Asn Gly Ala Thr 340 Gin Met Ala Gin Go Gly Asp Gly 355 360 Phe Arg Gin Tyr Leu Pro Ser Leu 370 375 Phe Will Phe Be Ala Gly Lys Pro 385 390 Lys Ile Asn Leu Phe Arg Gly Will

Asn Glu Gly Gly Gly Ser Glu Gly 105 110 Glu Gly Gly Gly Thr Lys Pro Pro 125 Gly Tyr Thr Tyr Ile Asn Pro Leu 140 Glu Gin Asn Pro Ala Asn Pro Asn 155 160 Leu Asn Thr Phe Met Phe Gin Asn 170 175 Ala Leu Thr Go Tyr Thr Gly Thr 185 190 Lys Thr Tyr Tyr Gin Tyr Thr Pro 205 Ala Tyr Trp Asn Gly Lys Phe Arg 220 Asn Glu Asp Pro Phe Vai Cys Glu 235 240 Pro Gin Pro Pro Go Asn Ala Gly 250 255 Gly Gly Ser Glu Gly Gly Gly Ser 265 270 Ser Gly Ser Gly Asp Phe Asp Tyr 285 Gly Ala Met Thr Glu Asn Ala Asp 300 Lys Gly Lys Leu Asp Ser Vai Ala 315 320 Gly Phe Ile Gly Asp Will Be Gly 330 335 Gly Asp Phe Ala Gly Ser Asn Ser 345 350 Asp Asn Ser Pro Leu Met Asn Asn 365 Pro Gin Ser Glu Cys Arg Pro 380 Tyr Glu Phe Ser Ile Asp Cys Asp 395 400 Phe Ala Phe Leu Leu Tyr Go Ala 410 415 398 405

Thr Phe Met Tyr Go Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn Lys 420 425 430 Glu Ser &lt; 210 &gt; 595 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 595 cgttgatatc gctagcctat gc 22 &lt; 210 &gt; 596 &lt; 211 &gt; 30 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 596 gataggctta gctagcccgg agaacgaagg ??? 21 &lt; 210 &gt; 597 &lt; 211 &gt; 37 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 597 ctttcacagc ggtttcgcta gcgacccttt tgtctgc 37 10 &gt; 598 11 &gt; 50 12 &gt; DNA 13 &gt; Sequence 20 &gt; 23 &gt; Description 00 &gt; 598 ctttcacagc ggtttcgcta gcgacccttt tgtcagcgag taccagggtc 50 399

&lt; 210 &gt; 599 &lt; 211 &gt; 37 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 599 gactgtctcg gcagcatgcg ccatacgatc atcgttg 37

&lt; 210 &gt; 600 &lt; 211 &gt; 37 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; CDS &lt; 222 &gt; (2) .. (25) &lt; 400 &gt; 600 c aac gat gat cgt atg gcg cat gct gccgagacag tc 37

Asn Asp Asp Arg Met Ala His Ala 15

&lt; 210 &gt; 601 &lt; 211 &gt; 8 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Peptide &lt; 400 &gt; 601

Asn Asp Asp Arg Met Ala His Ala 15

&lt; 210 &gt; 602 &lt; 211 &gt; 37 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 602 ctttcacagc ggtttgcatg cagacccttt tgtctgc 37 400

&lt; 210 &gt; 603 &lt; 211 &gt; 50 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 603 ctttcacagc ggtttgcatg cagacccttt tgtcagcgag taccagggtc 50

&lt; 210 &gt; 604 &lt; 211 &gt; 7 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Illustrative Peptide &lt; 400 &gt; 604

Tyr Ala Asp Ser Vai Lys Gly 1 5

&lt; 210 &gt; 605 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 605 cctcgacagc gaagtgcaca g ??? 21

&lt; 210 &gt; 606 &lt; 211 &gt; 38 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 606 ggctgagtca agacgctctg tgcacttcgc tgtcgagg ??? 38

&lt; 210 &gt; 607 &lt; 211 &gt; 7 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of Artificial Sequence: Illustrative Peptide 401 < 4 Ο Ο &gt; 607

Gin Be Ala Leu Thr Gin Pro 1 5

&lt; 210 &gt; 608 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 608 cctctgtcac agtgcacaag ac 22

&lt; 210 &gt; 609 &lt; 211 &gt; 42 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 609 cctctgtcac agtgcacaag acatccagat gacccagtct cc 42

&lt; 210 &gt; 610 &lt; 211 &gt; 50 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 610 gggaggatgg agactgggtc gtctggatgt cttgtgcact gtgacagagg ??? 21 &lt; 210 &gt; 611 &lt; 211 &gt; 11 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Illustrative Peptide Artificial Sequence &lt; 400 &gt; 611 Gin Asp Ile Gin Met Thr Gin Ser Pro Ser 1 5 10

&Lt; 210 &gt; 612 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence 402 &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Primer &lt; 400 &gt; 612 gactgggtgt agtgatctag ??? 21 &lt; 210 &gt; 613 &lt; 211 &gt; 28 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 400 &gt; 613 ggtgtagtga tcttctagtg acaactct

Synthetic oligonucleotide 28

&lt; 210 &gt; 614 &lt; 211 &gt; 6 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: synthetic peptide &lt; 400 &gt; 614

It will be Arg Asp Asn 15 &lt; 210 &gt; 615 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence &lt; 220 &gt; &lt; 221 &gt; CDS &lt; 222 &gt; (<15> <400> 6 15 tac tat tgt gcg aaa Tyr Tyr Cys Ala Lys 1 <210> 616 <211> 5 <212> PRT <213> Artificial Sequence &lt; tb &gt; 2 2 0> <223> Description of the Artificial Sequence peptide

Synthetic synthetic oligonucleotide 403 &lt; 4 Ο Ο &gt; 616

Tyr Tyr Cys Ala Lys 15 &lt; 210 &gt; 617 &lt; 211 &gt; 36 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 617 ggtgccgata ggcttgcatg caccggagaa cgaagg 36 &lt; 210 &gt; 618 &lt; 211 &gt; 95 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic oligonucleotide &lt; 400 &gt; 618 cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaacagctta 60 agggctgagg acactgcagt ctactattgt acgag 95 &lt; 210 &gt; 619 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Synthetic Oligonucleotide &lt; 220 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (4). . (7) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 619 gatnnnnatc 10 &lt; 210 &gt; 620 &lt; 211 &gt; 10 &lt; 212 &gt; PRT &lt; 213 &gt; Unknown Organism &lt; 220 &gt; &lt; 223 &gt; Description of Unknown Organism &gt;: peptide derived from MALIA3 404 &lt; 400 &gt; 620

Met Lys Leu Leu Asn Go Ile Asn Phe Go 15 10

&lt; 210 &gt; 621 &lt; 211 &gt; 29 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: CJRA05-derived peptide &lt; 400 &gt; 621

Met 1 Ser Vai Leu Val 5 Tyr Ser Phe Ala Ser 10 Phe Val Leu Gly Trp Cys 15 Leu Arg Ser Gly 20 Ile Thr Tyr Phe Thr 25 Arg Leu Met Glu

&lt; 210 &gt; 622 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: Illustrative nucleotide sequence &lt; 400 &gt; 622 tttttttttt ttttt 15

&lt; 210 &gt; 623 &lt; 211 &gt; 87 &lt; 212 &gt; PRT &lt; 213 &gt; Unknown Organism &lt; 220 &gt; &lt; 223 &gt; Description of Unknown Organism: peptide derived from MALIA3 &lt; 400 &gt; 623

Met 1 Ile Lys Go Glu 5 Ile Lys Pro Ser Gin 10 Ala Gin Phe Thr Thr 15 Arg Ser Gly Will Be 20 Arg Gin Gly Lys Pro 25 Tyr Ser Leu Asn Glu 30 Gin Leu Cys Tyr Go 35 Asp Leu Gly Asn Glu 40 Tyr Pro Vai Leu Vai 45 Lys Ile Thr Leu Asp 50 Glu Gly Gin Pro Ala 55 Tyr Ala Pro Gly Leu 60 Tyr Thr Vai His Leu 65 Ser Ser Phe Lys Val 70 Gly Gin Phe Gly Ser 75 Leu Met Ile Asp Arg 80 Leu Arg Leu Go Pro 85 Ala Lys 405

&lt; 210 &gt; 624 &lt; 211 &gt; 29 &lt; 212 &gt; PRT &lt; 213 &gt; Unknown Organism &lt; 220 &gt; &lt; 223 &gt; Description of Unknown Organism: peptide derived from MALIA3 &lt; 400 &gt; 624

Met 1 Ser Vai Leu Val 5 Tyr Ser Phe Ala Ser 10 Phe Val Leu Gly Trp Cys 15 Leu Arg Ser Gly 20 I le Thr Tyr Phe Thr 25 Arg Leu Met Glu

&lt; 210 &gt; 625 &lt; 211 &gt; 10 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: synthetic oligonucleotide &lt; 2 2 0 &gt; &lt; 221 &gt; modified_base &lt; 222 &gt; (7) .. (10) &lt; 223 &gt; A, T, C, G, other or unknown &lt; 400 &gt; 625 ctcttcnnnn 10

&lt; 210 &gt; 626 &lt; 211 &gt; 87 &lt; 212 &gt; PRT &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: CJRA05-derived peptide &lt; 400 &gt; 626

Met 1 Ile Lys Go Glu 5 Ile Lys Pro Ser Gin 10 Ala Gin Phe Thr Thr 15 Arg Ser Gly Will Be 20 Arg Gin Gly Lys Pro 25 Tyr Ser Leu Asn Glu 30 Gin Leu Cys Tyr Go 35 Asp Leu Gly Asn Glu 40 Tyr Pro Vai Leu Vai 45 Lys Ile Thr Leu Asp 50 Glu Gly Gin Pro Ala 55 Tyr Ala Pro Gly Leu 60 Tyr Thr Vai His Leu 65 Ser Ser Phe Lys Val 70 Gly Gin Phe Gly Ser 75 Leu Met Ile Asp Arg 80 406

Leu Arg Leu Vai Pro Ala Lys 85 &lt; 210 &gt; 627 &lt; 211 &gt; 10 &lt; 212 &gt; PRT Λ cn 1-1 CN V Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: CJRA05-derived peptide &lt; 400 &gt; 627 Met Lys Leu Leu Asn Vai Ile Asn Phe Vai 1 5 10 &lt; 210 &gt; 628 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: synthetic oligonucleotide &lt; 400 &gt; 628 gaccc, agtct ccatcctcc 19 &lt; 210 &gt; 629 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: synthetic oligonucleotide &lt; 400 &gt; 629 gactc, agtct ccactctcc 19 &lt; 210 &gt; 630 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: synthetic oligonucleotide &lt; 400 &gt; 630 gacgcagtct ccaggcacc 19 407 &lt; 210 &gt; 631 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: synthetic oligonucleotide &lt; 400 &gt; 631 gacgcagtct ccagccacc ??? 19 &lt; 210 &gt; 632 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: synthetic oligonucleotide &lt; 400 &gt; 632 gtctcctgga cagtcgatc ??? 19 &lt; 210 &gt; 633 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: synthetic oligonucleotide &lt; 400 &gt; 633 ggccttggga cagacagtc ??? 19 &lt; 210 &gt; 634 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Description of the Artificial Sequence: synthetic oligonucleotide &lt; 400 &gt; 634 gtctcctgga cagtcagtc ??? 19 &lt; 210 &gt; 635 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 2 2 0 &gt; &lt; 223 &gt; Description of the Artificial Sequence: synthetic oligonucleotide 408 &lt; 4 Ο Ο &gt; 635 ggccccaggg cagagggtc

Lisbon, December 29, 2011 409

Claims (14)

A method for producing a population or library of immunoglobulin genes comprising the steps of: (i) introducing synthetic diversity into at least one of the CDR1 VH or CDR2 VH of such genes; and (ii) combining the diversity of step (i) with CDR3 VH diversity captured from B cells. A method according to claim 1, wherein the synthetic diversity is introduced into both CDR1 VH and CDR2 VH. A method according to claim 2, wherein the synthetic diversity comprises: (a) a CDR1 VH having an amino acid sequence according to the formula -X1 -Y-X2 -M-X3-, wherein X1, X2 and X3 are independently selected from the group consisting of A, D, E, F, G, Η, I, K, L, Μ, N, P, Q, R, S, T, V, W and Y; and (b) a CDR2 VH having an amino acid sequence according to formula X4-X5-X6-SGG-X7-T-X8-YADSVK-G-, wherein X4 and X5 are independently selected from the group consisting of Y, R, W, V, Ge S, X 6 is selected from the group consisting of P and S and X 7 and X 8 are independently selected from the group consisting of A, D, E, F, G, H, I, K, L , Μ, N, P, Q, R, S, T, V, W, and Y. A library comprising a collection of genetic packages having a member of a diverse family of peptides, polypeptides or proteins and collectively displaying at least a portion of the family, the peptides, polypeptides or proteins shown being encoded by DNA sequences comprising sequences encoding (a) a CDR1 VH having an amino acid sequence according to the formula wherein X1, X2 and X3 are independently selected from the group consisting of A, D, E, F, G, Η, I, K, L, Μ, N, P, Q, R, S, T, V, W and Y; (b) a CDR2 VH having an amino acid sequence according to the formula wherein X4 and X5 are independently selected from the group consisting of Y, R3, X5, X6, , W, V, Ge S, X 6 is selected from the group consisting of P and S and X 7 and X 8 are independently selected from the group consisting of A, D, E, F, G, H, I, K, L, , P, Q, R, S, T, V, W and Y; and (c) a VH CDR3 encoding sequence, wherein said VH CDR3 is a VH CDR3 captured from the CDR3 VH region of a B cell immunoglobulin gene. The library of claim 4, wherein said DNA sequences further comprise a sequence encoding an immunoglobulin light chain. A library according to claim 5, wherein said immunoglobulin light chain encoding sequence is captured from a B cell. A library according to claim 6, wherein said B cell is isolated from a blood sample of an autoimmune patient. A library according to claim 7, wherein the autoimmune patient is diagnosed with a disorder selected from the group consisting of systemic lupus erythematosus, systemic sclerosis, rheumatoid arthritis, antiphospholipid syndrome and vasculitis. The library of any one of claims 4 or 5 to 8, wherein said DNA sequences further comprise sequences encoding VH structural regions 3-23. The library of any one of claims 4 or 5 to 8, wherein said genetic packets are M13 phages. The library of claim 10, wherein said DNA sequences are in a phage vector. A library according to claim 10 or 11, wherein said phage comprises a wild-type gene iii and a truncated gene iii for displaying peptides, polypeptides or proteins. The library of any one of claims 4 or 5 to 8, wherein said DNA sequences are in a phagemid vector. The library of any one of claims 10 to 13, wherein said short linking peptides, polypeptides or proteins are presented through an element of the final portion of the M13III gene. Lisbon, December 29, 2011 4