DK1578903T4 - New methods of preparing libraries comprising displayed and / or expressed members of various families of peptides, polypeptides or proteins and novel libraries - Google Patents

Description

DESCRIPTION

[0001] This application is a continuation-in-part of United States provisional application 60/198,069, filed April 17, 2000, a continuation-in-part of United States patent application 09/837,306, filed on April 17, 2001, a continuation-in-part of PCT application PCT/US01/12454, filed on April 17, 2001, a continuation-in-part of United States application 10/000,516, filed on October 24, 2001 and a continuation-in-part of United States application 10/045,674, filed on October 25, 2001.

[0002] The present invention relates to the embodiments characterized in the claims.

[0003] Thus, it relates to a method for producing a population or library of immunoglobin genes that comprises the steps of: 1. (i) introducing synthetic diversity into at least one of VH CDR1 or VH CDR2 of those genes; and 2. (ii) combining the diversity from step (i) with VH CDR3 natural diversity captured from the VH CDR3 region of immunoglobulin genes from B cells.

[0004] The present invention also relates to a library comprising a collection of genetic packages that display a member of a diverse family of antibodies and that collectively display at least a portion of the family, the antibodies being encoded by DNA sequences comprising sequences each encoding a) a VH CDR1 having an amino acid sequence according to the formula -X1-Y-X2-M-X3-, wherein X1, X2, and X3 are independently selected from the group consisting of A, D, E, F, G, Η, I, K, L, Μ, N, P, Q, R, S, T, V, W, and Y, provided in a human 3-23 framework; b) a VH CDR2 having an amino acid sequence according to the formula X4-I-X5-X6-S-G-G-X7-T-X8-Y-A-D-S-V-K-G-, wherein X4 and X5 are independently selected from the group consisting of Y, R, W, V, G, and S, X6 is selected from the group consisting of P and S, and X7 and X8 are independently selected from the group consisting of A, D, E, F, G, Η, I, K, L, Μ, N, P, Q, R, S,T, V, W, and Y, provided in a human 3-23 framework; and (c) a sequence encoding a natural VH CDR3, wherein said VH CDR3 is a VH CDR3 captured from the VH CDR3 region of an immunoglobin gene from a B cell; as defined in the claims.

[0005] In a preferred embodiment, the genetic packages are filamentous phage or phagemids.

[0006] The present disclosure further relates to vectors for displaying and/or expressing a diverse family of peptides, polypeptides or proteins.

[0007] The present disclosure further relates to methods of screening the libraries of the invention and to the peptides, polypeptides and proteins identified by such screening.

BACKGROUND OF THE INVENTION

[0008] It is now common practice in the art to prepare libraries of genetic packages that display, express or comprise a member of a diverse family of peptides, polypeptides or proteins and collectively display, express or comprise at least a portion of the diversity of the family. In many common libraries, the peptides, polypeptides or proteins are related to antibodies. Often, they are Fabs or single chain antibodies.

[0009] In general, the DNAs that encode members of the families to be displayed and/or expressed must be amplified before they are cloned and used to display and/or express the desired member. Such amplification typically makes use of forward and backward primers.

[0010] Such primers can be complementary to sequences native to the DNA to be amplified or complementary to oligonucleotides attached at the 5' or 3' ends of that DNA. Primers that are complementary to sequences native to the DNA to be amplified are disadvantaged in that they bias the members of the families to be displayed. Only those members that contain a sequence in the native DNAthat is substantially complementary to the primer will be amplified. Those that do not will be absent from the family. For those members that are amplified, any diversity within the primer region will be suppressed.

[0011] For example, in European patent 368,684 B1, the primer that is used is at the 5' end of the Vh region of an antibody gene. It anneals to a sequence region in the native DNA that is said to be "sufficiently well conserved" within a single species. Such primer will bias the members amplified to those having this "conserved" region. Any diversity within this region is extinguished.

[0012] It is generally accepted that human antibody genes arise through a process that involves a combinatorial selection of V and J or V, D, and J followed by somatic mutations. Although most diversity occurs in the Complementary Determining Regions (CDRs), diversity also occurs in the more conserved Framework Regions (FRs) and at least some of this diversity confers or enhances specific binding to antigens (Ag). As a consequence, libraries should contain as much of the CDR and FR diversity as possible.

[0013] To clone the amplified DNAs of the peptides, polypeptides or proteins that they encode for display on a genetic package and/or for expression, the DNAs must be cleaved to produce appropriate ends for ligation to a vector. Such cleavage is generally effected using restriction endonuclease recognition sites carried on the primers. When the primers are at the 5' end of DNA produced from reverse transcription of RNA, such restriction leaves deleterious 5' untranslated regions in the amplified DNA. These regions interfere with expression of the cloned genes and thus the display of the peptides, polypeptides and proteins coded for by them.

SUMMARY OF THE INVENTION

[0014] It is an object of this invention to provide a method for producing a population or library of immunoglobin genes that comprises the steps of: 1. (i) introducing synthetic diversity into at least one of VH CDR1 or VH CDR2 of those genes; and 2. (ii) combining the diversity from step (i) with VH CDR3 natural diversity captured from the VH CDR3 region of immunoglobulin genes from B cells.

[0015] These methods are not biased toward DNAs that contain native sequences that are complementary to the primers used for amplification. They also enable any sequences that may be deleterious to expression to be removed from the amplified DNA before cloning and displaying and/or expressing.

[0016] Additional objects of the invention are reflected in claims 2 to 13. Each of these claims is specifically incorporated by reference in this specification.

BRIEF DESCRIPTION OF THE DRAWINGS

[0017] FIG. 1 is a schematic of various methods that may be employed to amplify VH genes without using primers specific for VH sequences. FIG. 2 is a schematic of various methods that may be employed to amplify VL genes without using primers specific for VL sequences. FIG. 3 is a schematic of RACE amplification of antibody heavy and light chains. FIG. 4 depicts gel analysis of amplification products obtained after the primary PCR reaction from 4 different patient samples. FIG. 5 depicts gel analysis of cleaved kappa DNA from Example 2. FIG. 6 depicts gel analysis of extender-cleaved kappa DNA from Example 2. FIG. 7 depicts gel analysis of the PCR product from the extender-kappa amplification from Example 2. FIG. 8 depicts gel analysis of purified PCR product from the extender-kappa amplification from Example 2. FIG. 9 depicts gel analysis of cleaved and ligated kappa light chains from Example 2. FIG. 10 is a schematic of the design for CDR1 and CDR2 synthetic diversity. FIG. 11 is a schemaitc of the cloning schedule for construction of the heavy chain repertoire. FIG. 12 is a schematic of the cleavage and ligation of the antibody light chain. FIG. 13 depicts gel analysis of cleaved and ligated lambda light chains from Example 4. FIG. 14 is a schematic of the cleavage and ligation of the antibody heavy chain. FIG. 15 depicts gel analysis of cleaved and ligated lambda light chains from Example 5. FIG. 16 is a schematic of a phage display vector. FIG. 17 is a schematic of a Fab cassette. FIG. 18 is a schematic of a process for incorporating fixed FR1 residues in an antibody lambda sequence. FIG. 19 is a schematic of a process for incorporating fixed FR1 residues in an antibody kappa sequence. FIG. 20 is a schematic of a process for incorporating fixed FR1 residues in an antibody heavy chain sequence.

TERMS

[0018] In this application, the following terms and abbreviations are used:

Sense strand

The upper strand of ds DNAas usually written. In the sense strand, 5'-ATG-3' codes for Met.

Antisense strand

The lower strand of ds DNAas usually written. In the antisense strand, 3-TAC-5' would correspond to a Met codon in the sense strand.

Forward primer A "forward" primer is complementary to a part of the sense strand and primes for synthesis of a new antisense-strand molecule. "Forward primer" and "lower-strand primer" are equivalent.

Backward primer A "backward" primer is complementary to a part of the antisense strand and primes for synthesis of a new sense-strand molecule. "Backward primer" and "top-strand primer" are equivalent.

Bases

Bases are specified either by their position in a vector or gene as their position within a gene by codon and base. For example, "89.1" is the first base of codon 89, 89.2 is the second base of codon 89.

Sv

Streptavidin

Ap

Ampicillin

apR A gene conferring ampicillin resistance.

RERS

Restriction endonuclease recognition site RE

Restriction endonuclease - cleaves preferentially at RERS

URE

Universal restriction endonuclease Functionally complementary

Two sequences are sufficiently complementary so as to anneal under the chosen conditions.

AA

Amino acid

PCR

Polymerization chain reaction GLGs

Germline genes Ab

Antibody: an immunoglobin. The term also covers any protein having a binding domain which is homologous to an immunoglobin binding domain. A few examples of antibodies within this definition are, inter alia, immunoglobin isotypes and the Fab, F(ab1)2, scfv, Fv, dAb and Fd fragments.

Fab

Two chain molecule comprising an Ab light chain and part of a heavy-chain. scFv A single-chain Ab comprising either VH::linker::VL or VL::linker::VH w.t.

Wild type HC

Heavy chain LC

Light chain VK A variable domain of a Kappa light chain.

VH A variable domain of a heavy chain.

VL A variable domain of a lambda light chain.

[0019] In this application when it is said that nucleic acids are cleaved solely at the cleavage site of a restriction endonuclease, it should be understood that minor cleavage may occur at random, e.g., at nonspecific sites other than the specific cleavage site that is characteristic of the restriction endonuclease. The skilled worker will recognize that such nonspecific, random cleavage is the usual occurrence. Accordingly, "solely at the cleavage site" of a restriction endonuclease means that cleavage occurs preferentially at the site characteristic of that endonuclease.

[0020] As used in this application and claims, the term "cleavage site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide" includes cleavage sites formed by the single-stranded portion of the partially double-stranded ologonucleotide duplexing with the single-stranded DNA, cleavage sites in the double-stranded portion of the partially double-stranded oligonucleotide, and cleavage sites introduced by the amplification primer used to amplify the single-stranded DNA-partially double-stranded oligonucleotide combination.

[0021] In the two methods of this invention for preparing single-stranded nucleic acid sequences, the first of those cleavage sites is preferred. In the methods of this invention for capturing diversity and cloning a family of diverse nucleic acid sequences, the latter two cleavage sites are preferred.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] The nucleic acid sequences that are useful in the methods of this invention, i.e., those that encode at least in part the individual peptides, polypeptides and proteins displayed, or expressed in or comprising the libraries of this invention, may be native, synthetic or a combination thereof. They may be mRNA, DNA or cDNA. The nucleic acids encode antibodies. Preferably, they encode Fabs.

[0023] The nucleic acids useful in this invention may be naturally diverse, synthetic diversity may be introduced into those naturally diverse members, or the diversity may be entirely synthetic. For example, synthetic diversity can be introduced into one or more CDRs of antibody genes. Preferably, it is introduced into CDR1 and CDR2 of immunoglobulins. Natural diversity is captured in the CDR3 regions of the immunoglogin genes of this invention from B cells. Thus, the nucleic acids of this invention comprise a population of immunoglobin genes that comprise synthetic diversity in at least one, and more preferably both of the CDR1 and CDR2 and diversity in CDR3 captured from B cells.

[0024] Synthetic diversity may be created, for example, through the use of TRIM technology (U.S. 5,869,644). TRIM technology allows control over exactly which amino-acid types are allowed at variegated positions and in what proportions. In TRIM technology, codons to be diversified are synthesized using mixtures of trinucleotides. This allows any set of amino acid types to be included in any proportion.

[0025] Another alternative that may be used to generate diversified DNA is mixed oligonucleotide synthesis. With TRIM technology, one could allow Ala and Trp. With mixed oligonucleotide synthesis, a mixture that included Ala and Trp would also necessarily include Ser and Gly. The amino-acid types allowed at the variegated positions are picked with reference to the structure of antibodies, or other peptides, polypeptides or proteins of the family, the observed diversity in germline genes, the observed somatic mutations frequently observed, and the desired areas and types of variegation.

[0026] The nucleic acid sequences for at least one CDR or other region of the peptides, polypeptides or proteins of the family are cDNAs produced by reverse transcription from mRNA. More preferably, the mRNAs are obtained from peripheral blood cells, bone marrow cells, spleen cells or lymph node cells (such as B-lymphocytes or plasma cells) that express members of naturally diverse sets of related genes. The mRNAs encode a diverse family of antibodies. Most preferably, the mRNAs are obtained from patients suffering from at least one autoimmune disorder or cancer. Preferably, mRNAs containing a high diversity of autoimmune diseases, such as systemic lupus erythematosus, systemic sclerosis, rheumatoid arthritis, antiphospholipid syndrome and vasculitis are used.

[0027] In a preferred embodiment of this invention, the cDNAs are produced from the mRNAs using reverse transcription. In this preferred embodiment, the mRNAs are separated from the cell and degraded using standard methods, such that only the full length (i.e., capped) mRNAs remain. The cap is then removed and reverse transcription used to produce the cDNAs.

[0028] The reverse transcription of the first (antisense) strand can be done in any manner with any suitable primer. See, e.g., HJ de Haard et al., Journal of Biological Chemistry, 274(26):18218-30 (1999). In the preferred embodiment of this invention where the mRNAs encode antibodies, primers that are complementary to the constant regions of antibody genes may be used. Those primers are useful because they do not generate bias toward subclasses of antibodies. In another embodiment, poly-dT primers may be used (and may be preferred for the heavy-chain genes). Alternatively, sequences complementary to the primer may be attached to the termini of the antisense strand.

[0029] In one preferred embodiment of this invention, the reverse transcriptase primer may be biotinylated, thus allowing the cDNA product to be immobilized on streptavidin (Sv) beads. Immobilization can also be effected using a primer labeled at the 5' end with one of a) free amine group, b) thiol, c) carboxylic acid, or d) another group not found in DNA that can react to form a strong bond to a known partner on an insoluble medium. If, for example, a free amine (preferably primary amine) is provided at the 5' end of a DNA primer, this amine can be reacted with carboxylic acid groups on a polymer bead using standard amideforming chemistry. If such preferred immobilization is used during reverse transcription, the top strand RNA is degraded using well-known enzymes, such as a combination of RNAseH and RNAseA, either before or after immobilization.

[0030] The nucleic acid sequences useful in the methods of this invention are generally amplified before being used to display and/or express the antibodies that they encode. Prior to amplification, the single-stranded DNAs may be cleaved using either of the methods described before. Alternatively, the single-stranded DNAs may be amplified and then cleaved using one of those methods.

[0031] Any of the well known methods for amplifying nucleic acid sequences may be used for such amplification. Methods that maximize, and do not bias, diversity are preferred. The nucleic acid sequences are derived from antibody genes, the present invention preferably utilizes primers in the constant regions of the heavy and light chain genes and primers to a synthetic sequence that are attached at the 5' end of the sense strand. Priming at such synthetic sequence avoids the use of sequences within the variable regions of the antibody genes. Those variable region priming sites generate bias against V genes that are either of rare subclasses or that have been mutated at the priming sites. This bias is partly due to suppression of diversity within the primer region and partly due to lack of priming when many mutations are present in the region complementary to the primer. The methods disclosed in this invention have the advantage of not biasing the population of amplified antibody genes for particular V gene types.

[0032] The synthetic sequences may be attached to the 5' end of the DNA strand by various methods well known for ligating DNA sequences together. RT CapExtention is one preferred method.

[0033] In RT CapExtention (derived from Smart PCR(™)), a short overlap (5'-...GGG-3' in the upper-strand primer (USP-GGG) complements 3'-CCC....5' in the lower strand) and reverse transcriptases are used so that the reverse complement of the upper-strand primer is attached to the lower strand.

[0034] FIGs. 1 and 2 show schematics to amplify VH and VL genes using RT CapExtention. FIG. 1 shows a schematic of the amplification of VH genes. FIG. 1, Panel A shows a primer specific to the poly-dT region of the 3' UTR priming synthesis of the first, lower strand. Primers that bind in the constant region are also suitable. Panel B shows the lower strand extended at its 3' end by three Cs that are not complementary to the mRNA. Panel C shows the result of annealing a synthetic top-strand primer ending in three GGGs that hybridize to the 3' terminal CCCs and extending the reverse transcription extending the lower strand by the reverse complement of the synthetic primer sequence. Panel D shows the result of PCR amplification using a 5' biotinylated synthetic top-strand primer that replicates the 5' end of the synthetic primer of panel C and a bottom-strand primer complementary to part of the constant domain. Panel E shows immobilized double-stranded (ds) cDNA obtained by using a 5'-biotinylated top-strand primer.

[0035] FIG. 2 shows a similar schematic for amplification of VL genes. FIG. 2, Panel A shows a primer specific to the constant region at or near the 3' end priming synthesis of the first, lower strand. Primers that bind in the poly-dT region are also suitable. Panel B shows the lower strand extended at its 3' end by three Cs that are not complementary to the mRNA. Panel C shows the result of annealing a synthetic top-strand primer ending in three GGGs that hybridize to the 3' terminal CCCs and extending the reverse transcription extending the lower strand by the reverse complement of the synthetic primer sequence. Panel D shows the result of PCR amplification using a 5' biotinylated synthetic top-strand primer that replicates the 5' end of the synthetic primer of panel C and a bottom-strand primer complementary to part of the constant domain. The bottom-strand primer also contains a useful restriction endonuclease site, such as Ascl. Panel E shows immobilized ds cDNA obtained by using a 5'-biotinylated top-strand primer.

[0036] In FIGs. 1 and 2, each V gene consists of a 5' untranslated region (UTR) and a secretion signal, followed by the variable region, followed by a constant region, followed by a 3' untranslated region (which typically ends in poly-A). An initial primer for reverse transcription may be complementary to the constant region or to the poly A segment of the 3'-UTR. For human heavy-chain genes, a primer of 15 T is preferred. Reverse transcriptases attach several C residues to the 3' end of the newly synthesized DNA. RT CapExtention exploits this feature. The reverse transcription reaction is first run with only a lower-strand primer. After about 1 hour, a primer ending in GGG (USP-GGG) and more RTase are added. This causes the lower-strand cDNA to be extended by the reverse complement of the USP-GGG up to the final GGG. Using one primer identical to part of the attached synthetic sequence and a second primer complementary to a region of known sequence at the 3' end of the sense strand, all the V genes are amplified irrespective of their V gene subclass.

[0037] In another preferred embodiment, synthetic sequences may be added by Rapid Amplification of cDNA Ends (RACE) (see Frohman, M.A., Dush, M.K., & Martin, G.R. (1988) Proc. Natl. Acad. Sci. USA (85): 8998-9002).

[0038] FIG. 1 shows a schematic of RACE amplification of antibody heavy and light chains. First, mRNA is selected by treating total or poly(A+) RNAwith calf intestinal phosphatase (CIP) to remove the 5'-phosphate from all molecules that have them such as ribosomal RNA, fragmented mRNA, tRNA and genomic DNA. Full length mRNA (containing a protective 7-methyl cap structure) is uneffected. The RNA is then treated with tobacco acid pyrophosphatase (TAP) to remove the cap structure from full length mRNAs leaving a 5'-monophosphate group. Next, a synthetic RNA adaptor is ligated to the RNA population, only molecules which have a 5-phosphate (uncapped, full length mRNAs) will accept the adaptor. Reverse trascriptase reactions using an oligodT primer, and nested PCR (using one adaptor primer (located in the 5' synthetic adaptor) and one primer for the gene) are then used to amplify the desired transcript.

[0039] In a preferred embodiment of this invention, the upper strand or lower strand primer may be also biotinylated or labeled at the 5' end with one of a) free amino group, b) thiol, c) carboxylic acid and d) another group not found in DNA that can react to form a strong bond to a known partner as an insoluble medium. These can then be used to immobilize the labeled strand after amplification. The immobilized DNA can be either single or double-stranded.

[0040] After amplification (using e.g., RT CapExtension or RACE), the DNAs of this invention are rendered single-stranded. For example, the strands can be separated by using a biotinylated primer, capturing the biotinylated product on streptavidin beads, denaturing the DNA, and washing away the complementary strand. Depending on which end of the captured DNA is wanted, one will choose to immobilize either the upper (sense) strand or the lower (antisense) strand.

[0041] To prepare the single-stranded amplified DNAs for cloning into genetic packages so as to effect display of, or for expression of, the peptides, polypeptides or proteins encoded, at least in part, by those DNAs, they must be manipulated to provide ends suitable for cloning and display and/or expression. In particular, any 5' untranslated regions and mammalian signal sequences must be removed and replaced, in frame, by a suitable signal sequence that functions in the display or expression host. Additionally, parts of the variable domains (in antibody genes) may be removed and replaced by synthetic segments containing synthetic diversity. The diversity of other gene families may likewise be expanded with synthetic diversity.

[0042] According to the methods of thisdisclosure, there are two ways to manipulate the single-stranded DNAs for display and/or expression. The first method comprises the steps of: 1. (i) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and 2. (ii) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide; the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.

[0043] In this first method, short oligonucleotides are annealed to the single-stranded DNA so that restriction endonuclease recognition sites formed within the now locally double-stranded regions of the DNA can be cleaved. In particular, a recognition site that occurs at the same position in a substantial fraction of the single-stranded DNAs is identical.

[0044] For antibody genes, this can be done using a catalog of germline sequences. See, e.g., "http://www.mrc-cpe.cam.ac.uk/imt-doc/restricted/ok.html." Updates can be obtained from this site under the heading "Amino acid and nucleotide sequence alignments." For other families, similar comparisons exist and may be used to select appropriate regions for cleavage and to maintain diversity.

[0045] For example, Table 1 depicts the DNA sequences of the FR3 regions of the 51 known human VH germline genes. In this region, the genes contain restriction endonuclease recognition sites shown in Table 2. Restriction endonucleases that cleave a large fraction of germline genes at the same site are preferred over endonucleases that cut at a variety of sites. Furthermore, it is preferred that there be only one site for the restriction endonucleases within the region to which the short oligonucleotide binds on the single-stranded DNA, e.g., about 10 bases on either side of the restriction endonuclease recognition site.

[0046] An enzyme that cleaves downstream in FR3 is also more preferable because it captures fewer mutations in the framework. This may be advantageous is some cases. However, it is well known that framework mutations exist and confer and enhance antibody binding. The present invention, by choice of appropriate restriction site, allows all or part of FR3 diversity to be captured. Hence, the method also allows extensive diversity to be captured.

[0047] Finally, in the methods of this invention restriction endonucleases that are active between about 37°C and about 75°C are used. Preferably, restriction endonucleases that are active between about 45°C and about 75°C may be used. More preferably, enzymes that are active above 50°C, and most preferably active about 55°C, are used. Such temperatures maintain the nucleic acid sequence to be cleaved in substantially single-stranded form.

[0048] Enzymes shown in Table 2 that cut many of the heavy chain FR3 germline genes at a single position include: Maelll (24@4), Tsp45l (21@4), Hph\ (44@5), BsaJI (23@65) , Alu I (23@47) , B/pl (21@48), Ddel (29@58), Bgl\\ (10@61), Ms/I (44@72), Bs/'EI (23@74), Eael (23@74) Eag\ (23@74), Haelll (25@75), est4CI(51@86), HpyCH4lll (51 @86) , Hinf\ (38@2) , M/yl (18@2), Pie I (18@2) , Mnl\ (31@67), HpyCH4V (21@44), BsmAI (16@11), Bpm\ (19@12), Xmn\ (12@30), and Sad (11@51). (The notation used means, for example, that BsmAI cuts 16 of the FR3 germline genes with a restriction endonuclease recognition site beginning at base 11 of FR3.) [0049] For cleavage of human heavy chains in FR3, the preferred restriction endonucleases are: Bsf4CI (or Taal or /7pyCH4lll), B/pl, /7pyCH4V, and Ms/I. Because ACNGT (the restriction endonuclease recognition site for Bst4C\, Taal, and /7pyCH4lll) is found at a consistent site in all the human FR3 germline genes, one of those enzymes is the most preferred for capture of heavy chain CDR3 diversity. B/pl and HpyCH4V are complementary. B/pl cuts most members of the VH1 and VH4 families while /7pyCH4V cuts most members of the VH3, VH5, VH6, and VH7 families. Neither enzyme cuts VH2s, but this is a very small family, containing only three members. Thus, these enzymes may also be used in preferred embodiments of the methods of this invention.

[0050] The restriction endonucleases HpyCH4lll, Ssf4CI, and Taal all recognize 5'-ACnGT-3' and cut upper strand DNA after n and lower strand DNA before the base complementary to n. This is the most preferred restriction endonuclease recognition site for this method on human heavy chains because it is found in all germline genes. Furthermore, the restriction endonuclease recognition region (ACnGT) matches the second and third bases of a tyrosine codon (tay) and the following cysteine codon (tgy) as shown in Table 3. These codons are highly conserved, especially the cysteine in mature antibody genes.

[0051] Table 4 E shows the distinct oligonucleotides of length 22 (except the last one which is of length 20) bases. Table 5 C shows the analysis of 1617 actual heavy chain antibody genes. Of these, 1511 have the site and match one of the candidate oligonucleotides to within 4 mismatches. Eight oligonucleotides account for most of the matches and are given in Table 4 F.1. The 8 oligonucleotides are very similar so that it is likely that satisfactory cleavage will be achieved with only one oligonucleotide (such as H43.77.97.1-02#1) by adjusting temperature, pH, salinity, and the like. One or two oligonucleotides may likewise suffice whenever the germline gene sequences differ very little and especially if they differ very little close to the restriction endonuclease recognition region to be cleaved. Table 5 D shows a repeat analysis of 1617 actual heavy chain antibody genes using only the 8 chosen oligonucleotides. This shows that 1463 of the sequences match at least one of the oligonucleotides to within 4 mismatches and have the site as expected. Only 7 sequences have a second HpyCH4lll restriction endonuclease recognition region in this region.

[0052] Another illustration of choosing an appropriate restriction endonuclease recognition site involves cleavage in FR1 of human heavy chains. Cleavage in FR1 allows capture of the entire CDR diversity of the heavy chain.

[0053] The germline genes for human heavy chain FR1 are shown in Table 6. Table 7 shows the restriction endonuclease recognition sites found in human germline genes FR1s. The preferred sites are Bsgl(GTGCAG;39@4), SsoFI (GCngc; 43@6, 11 @9, 2@3, 1@12), Tsel (Gcwgc; 43@6, 11@9,2@3, 1@12),/WspAII (CMGckg; 46@7, 2@1), PvuW (CAGctg; 46@7, 2@1),A/ul (AGct; 48@82@2), DdeI (Ctnag; 22@52, 9@48), Hph\ (tcacc; 22@80), SssKI (Nccngg; 35@39, 2@40), BsaJI (Ccnngg; 32@40, 2@41), SsfNI (CCwgg; 33@40), ScrFI (CCngg; 35@40, 2@41), EcoO109l (RGgnccy; 22@46, 11@43), Sau96l (Ggncc;23@47, 11 @44), Avail (Ggvicc; 23@47, 4@44), PpuMI (RGgwccy; 22@46, 4@43), BsmFI (gtccc; 20@48), Hinfl (Gantc; 34@16, 21 @56, 21 @77), Tfi\ (21 @77), Mly\ (GAGTC; 34@16), Myl (gactc; 21 @56), and AM/NI (CAGnnnctg; 22@68). The more preferred sites are /WspAI and Pvull. /WspAI and PvuW have 46 sites at 7-12 and 2 at 1-6. To avoid cleavage at both sites, oligonucleotides are used that do not fully cover the site at 1-6. Thus, the DNA will not be cleaved at that site. We have shown that DNA that extends 3, 4, or 5 bases beyond a Pvull-site can be cleaved efficiently.

[0054] Another illustration of choosing an appropriate restriction endonuclease recognition site involves cleavage in FR1 of human kappa light chains. Table 8 shows the human kappa FR1 germline genes and Table 9 shows restriction endonuclease recognition sites that are found in a substantial number of human kappa FR1 germline genes at consistent locations. Of the restriction endonuclease recognition sites listed, BsmA\ and Pf/FI are the most preferred enzymes. BsmM sites are found at base 18 in 35 of 40 germline genes. Pf/FI sites are found in 35 of 40 germline genes at base 12.

[0055] Another example of choosing an appropriate restriction endonuclease recognition site involves cleavage in FR1 of the human lambda light chain. Table 10 shows the 31 known human lambda FR1 germline gene sequences. Table 11 shows restriction endonuclease recognition sites found in human lambda FR1 germline genes. Hinf\ and Dde\ are the most preferred restriction endonucleases for cutting human lambda chains in FR1.

[0056] After the appropriate site or sites for cleavage are chosen, one or more short oligonucleotides are prepared so as to functionally complement, alone or in combination, the chosen recognition site. The oligonucleotides also include sequences that flank the recognition site in the majority of the amplified genes. This flanking region allows the sequence to anneal to the single-stranded DNA sufficiently to allow cleavage by the restriction endonuclease specific for the site chosen.

[0057] The actual length and sequence of the oligonucleotide depends on the recognition site and the conditions to be used for contacting and cleavage. The length must be sufficient so that the oligonucleotide is functionally complementary to the single-stranded DNA over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location.

[0058] Typically, the oligonucleotides of this preferred method of the invention are about 17 to about 30 nucleotides in length. Below about 17 bases, annealing is too weak and above 30 bases there can be a loss of specificity. A preferred length is 18 to 24 bases.

[0059] Oligonucleotides of this length need not be identical complements of the germline genes. Rather, a few mismatches taken may be tolerated. Preferably, however, no more than 1-3 mismatches are allowed. Such mismatches do not adversely affect annealing of the oligonucleotide to the single-stranded DNA. Hence, the two DNAs are said to be functionally complementary.

[0060] The second method to manipulate the single-stranded DNAs of this invention for display and/or expression comprises the steps of: 1. (i) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired, and the double-stranded region of the oligonucleotide having a restriction endonuclease recognition site; and 2. (ii) cleaving the nucleic acid solely at the cleavage site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide; the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.

[0061] As explained above, the cleavage site may be formed by the single-stranded portion of the partially double-stranded oligonucleotide duplexing with the single-stranded DNA, the cleavage site may be carried in the double-stranded portion of the partially double-stranded oligonucleotide, or the cleavage site may be introduced by the amplification primer used to amplify the single-stranded DNA-partially double-stranded oligonucleotide combination. In this embodiment, the first is preferred. And, the restriction endonuclease recognition site may be located in either the double-stranded portion of the oligonucleotide or introduced by the amplification primer, which is complementary to that double-stranded region, as used to amplify the combination.

[0062] Preferably, the restriction endonuclease site is that of a Type ll-S restriction endonuclease, whose cleavage site is located at a known distance from its recognition site.

[0063] This second method, preferably, employs Universal Restriction Endonucleases ("URE"). UREs are partially double-stranded oligonucleotides. The single-stranded portion or overlap of the URE consists of a DNA adapter that is functionally complementary to the sequence to be cleaved in the single-stranded DNA. The double-stranded portion consists of a restriction endonuclease recognition site, preferably type ll-S.

[0064] The URE method of this invention is specific and precise and can tolerate some (e.g., 1-3) mismatches in the complementary regions, i.e., it is functionally complementary to that region. Further, conditions under which the URE is used can be adjusted so that most of the genes that are amplified can be cut, reducing bias in the library produced from those genes.

[0065] The sequence of the single-stranded DNA adapter or overlap portion of the URE typically consists of about 14-22 bases. However, longer or shorter adapters may be used. The size depends on the ability of the adapter to associate with its functional complement in the single-stranded DNA and the temperature used for contacting the URE and the single-stranded DNA at the temperature used for cleaving the DNA with the restriction enzyme. The adapter must be functionally complementary to the single-stranded DNA over a large enough region to allow the two strands to associate such that the cleavage may occur at the chosen temperature and at the desired location. We prefer singe-stranded or overlap portions of 14-17 bases in length, and more preferably 18-20 bases in length.

[0066] The site chosen for cleavage using the URE is preferably one that is substantially conserved in the family of amplified DNAs. As compared to the first cleavage method of this invention, these sites do not need to be endonuclease recognition sites. However, like the first method, the sites chosen can be synthetic rather than existing in the native DNA. Such sites may be chosen by references to the sequences of known antibodies or other families of genes. For example, the sequences of many germline genes are reported at httD://www.mrc-CDe.cam.ac.uk/imt-doc/restricted/ok.html. For example, one preferred site occurs near the end of FR3 — codon 89 through the second base of codon 93. CDR3 begins at codon 95.

[0067] The sequences of 79 human heavy-chain genes are also available at http://www.ncbi.nlm.nih.aov/entre2/nucleotide.html. This site can be used to identify appropriate sequences for URE cleavage according to the methods of this invention. See, e.g., Table 12B.

[0068] Most preferably, one or more sequences are identified using these sites or other available sequence information. These sequences together are present in a substantial fraction of the amplified DNAs. For example, multiple sequences could be used to allow for known diversity in germline genes or for frequent somatic mutations. Synthetic degenerate sequences could also be used. Preferably, a sequence(s) that occurs in at least 65% of genes examined with no more than 2-3 mismatches is chosen [0069] URE single-stranded adapters or overlaps are then made to be complementary to the chosen regions.

Conditions for using the UREs are determined empirically. These conditions should allow cleavage of DNA that contains the functionally complementary sequences with no more than 2 or 3 mismatches but that do not allow cleavage of DNA lacking such sequences.

[0070] As described above, the double-stranded portion of the URE includes an endonuclease recognition site, preferably a Type ll-S recognition site. Any enzyme that is active at a temperature necessary to maintain the single-stranded DNA substantially in that form and to allow the single-stranded DNA adapter portion of the URE to anneal long enough to the single-stranded DNA to permit cleavage at the desired site may be used.

[0071] The preferred Type ll-S enzymes for use in the URE methods of this invention provide asymmetrical cleavage of the single-stranded DNA. Among these are the enzymes listed in Table 13. The most preferred Type ll-S enzyme is Fokl.

[0072] When the preferred Fokl containing URE is used, several conditions are preferably used to effect cleavage: 1. 1) Excess of the URE over target DNA should be present to activate the enzyme. URE present only in equimolar amounts to the target DNA would yield poor cleavage of ssDNA because the amount of active enzyme available would be limiting. 2. 2) An activator may be used to activate part of the Fok\ enzyme to dimerize without causing cleavage. Examples of appropriate activators are shown in Table 14. 3. 3) The cleavage reaction is performed at a temperature between 45°-75°C, preferably above 50°C and most preferably above 55°C.

[0073] The UREs used in the prior art contained a 14-base single-stranded segment, a 10-base stem (containing a Fokl site), followed by the palindrome of the 10-base stem. While such UREs may be used in the methods of this invention, the preferred UREs of this invention also include a segment of three to eight bases (a loop) between the Fokl restriction endonuclease recognition site containing segments. In the preferred embodiment, the stem (containing the Fokl site) and its palindrome are also longer than 10 bases. Preferably, they are 10-14 bases in length. Examples of these "lollipop” URE adapters are shown in Table 15.

[0074] One example of using a URE to cleave an single-stranded DNA involves the FR3 region of human heavy chain. Table 16 shows an analysis of 840 full-length mature human heavy chains with the URE recognition sequences shown. The vast majority (718/840=0.85) will be recognized with 2 or fewer mismatches using five UREs (VHS881-1.1, VHS881-1.2, VHS881-2.1, VHS881- 4.1, and VHS881-9.1). Each has a 20-base adaptor sequence to complement the germline gene, a ten-base stem segment containing a Fok\ site, a five base loop, and the reverse complement of the first stem segment. Annealing those adapters, alone or in combination, to single-stranded antisense heavy chain DNA and treating with Fok\ in the presence of, e.g., the activator FOKIact, will lead to cleavage of the antisense strand at the position indicated.

[0075] Another example of using a URE(s) to cleave a single-stranded DNA involves the FR1 region of the human Kappa light chains. Table 17 shows an analysis of 182 full-length human kappa chains for matching by the four 19-base probe sequences shown. Ninety-six percent of the sequences match one of the probes with 2 or fewer mismatches. The URE adapters shown in Table 17 are for cleavage of the sense strand of kappa chains. Thus, the adaptor sequences are the reverse complement of the germline gene sequences. The URE consists of a ten-base stem, a five base loop, the reverse complement of the stem and the complementation sequence. The loop shown here is TTGTT, but other sequences could be used. Its function is to interrupt the palindrome of the stems so that formation of a lollypop monomer is favored over dimerization. Table 17 also shows where the sense strand is cleaved.

[0076] Another example of using a URE to cleave a single-stranded DNA involves the human lambda light chain. Table 18 shows analysis of 128 human lambda light chains for matching the four 19-base probes shown. With three or fewer mismatches, 88 of 128 (69%) of the chains match one of the probes. Table 18 also shows URE adapters corresponding to these probes. Annealing these adapters to upper-strand ssDNA of lambda chains and treatment with Fok\ in the presence of FOKIact at a temperature at or above 45°C will lead to specific and precise cleavage of the chains.

[0077] The conditions under which the short oligonucleotide sequences of the first method and the UREs of the second method are contacted with the single-stranded DNAs may be empirically determined. The conditions must be such that the single-stranded DNA remains in substantially single-stranded form. More particularly, the conditions must be such that the single-stranded DNA does not form loops that may interfere with its association with the oligonucleotide sequence or the URE or that may themselves provide sites for cleavage by the chosen restriction endonuclease.

[0078] The effectiveness and specificity of short oligonucleotides (first method) and UREs (second method) can be adjusted by controlling the concentrations of the URE adapters/oligonucleotides and substrate DNA, the temperature, the pH, the concentration of metal ions, the ionic strength, the concentration of chaotropes (such as urea and formamide), the concentration of the restriction endonuclease (e.g., Fok\), and the time of the digestion. These conditions can be optimized with synthetic oligonucleotides having: 1) target germline gene sequences, 2) mutated target gene sequences, or 3) somewhat related nontarget sequences. The goal is to cleave most of the target sequences and minimal amounts of non-targets.

[0079] In accordance with this invention, the single-stranded DNA is maintained in substantially that form using a temperature between about 37°C and about 75°C. Preferably, a temperature between about 45°C and about 75°C is used. More preferably, a temperature between 50°C and 60°C, most preferably between 55°C and 60°C, is used. These temperatures are employed both when contacting the DNA with the oligonucleotide or URE and when cleaving the DNA using the method of thisinvention, as defined in the claims.

[0080] The two cleavage methods of this disclosure have several advantages. The first method allows the individual members of the family of single-stranded DNAs to be cleaved preferentially at one substantially conserved endonuclease recognition site. The method also does not require an endonuclease recognition site to be built into the reverse transcription or amplification primers. Any native or synthetic site in the family can be used.

[0081] The second method has both of these advantages. In addition, the preferred URE method allows the single-stranded DNAs to be cleaved at positions where no endonuclease recognition site naturally occurs or has been synthetically constructed.

[0082] Most importantly, both cleavage methods permit the use of 5' and 3' primers so as to maximize diversity and then cleavage to remove unwanted or deleterious sequences before cloning, display and/or expression.

[0083] After cleavage of the amplified DNAs using one of the methods of this invention, the DNA is prepared for cloning, display and/or expression. This is done by using a partially duplexed synthetic DNA adapter, whose terminal sequence is based on the specific cleavage site at which the amplified DNA has been cleaved.

[0084] The synthetic DNA is designed such that when it is ligated to the cleaved single-stranded DNA in proper reading frame so that the desired antibody can be displayed on the surface of the genetic package and/or expressed. Preferably, the double-stranded portion of the adapter comprises the sequence of several codons that encode the amino acid sequence characteristic of the family of peptides, polypeptides or proteins up to the cleavage site. For human heavy chains, the amino acids of the 3-23 framework are preferably used to provide the sequences required for expression of the cleaved DNA.

[0085] Preferably, the double-stranded portion of the adapter is about 12 to 100 bases in length. More preferably, about 20 to 100 bases are used. The double-standard region of the adapter also preferably contains at least one endonuclease recognition site useful for cloning the DNA into a suitable display and/or expression vector (or a recipient vector used to archive the diversity). This endonuclease restriction site may be native to the germline gene sequences used to extend the DNA sequence. It may be also constructed using degenerate sequences to the native germline gene sequences. Or, it may be wholly synthetic.

[0086] The single-stranded portion of the adapter is complementary to the region of the cleavage in the single-stranded DNA The overlap can be from about 2 bases up to about 15 bases. The longer the overlap, the more efficient the ligation is likely to be. A preferred length for the overlap is 7 to 10. This allows some mismatches in the region so that diversity in this region may be captured.

[0087] The single-stranded region or overlap of the partially duplexed adapter is advantageous because it allows DNA cleaved at the chosen site, but not other fragments to be captured. Such fragments would contaminate the library with genes encoding sequences that will not fold into proper antibodies and are likely to be non-specifically sticky.

[0088] One illustration of the use of a partially duplexed adaptor in the methods of this invention involves ligating such adaptor to a human FR3 region that has been cleaved, as described above, at 5'-ACnGT-3' using HpyCH4lll, Bst4CI or Taal.

[0089] Table 4 F.2 shows the bottom strand of the double-stranded portion of the adaptor for ligation to the cleaved bottom-strand DNA. Since the HpyCH4lll-Site is so far to the right (as shown in Table 3), a sequence that includes the Aflll-site as well as the Xbal site can be added. This bottom strand portion of the partially-duplexed adaptor, H43.XAExt, incorporates both Xbal and Aflll-sites. The top strand of the double-stranded portion of the adaptor has neither site (due to planned mismatches in the segments opposite the Xbal and Aflll-Sites of H43.XAExt), but will anneal very tightly to H43.XAExt. H43AExt contains only the Aflll-site and is to be used with the top strands H43.ABr1 and H43.ABr2 (which have intentional alterations to destroy the Aflll-site).

[0090] After ligation, the desired, captured DNA can be PCR amplified again, if desired, using in the preferred embodiment a primer to the downstream constant region of the antibody gene and a primer to part of the double-standard region of the adapter. The primers may also carry restriction endonuclease sites for use in cloning the amplified DNA.

[0091] After ligation, and perhaps amplification, of the partially double-stranded adapter to the single-stranded amplified DNA, the composite DNA is cleaved at chosen 5' and 3' endonuclease recognition sites.

[0092] The cleavage sites useful for cloning depend on the phage or phagemid or other vectors into which the cassette vull be inserted and the available sites in the antibody genes. Table 19 provides restriction endonuclease data for 75 human light chains. Table 20 shows corresponding data for 79 human heavy chains. In each Table, the endonucleases are ordered by increasing frequency of cutting. In these Tables, Nch is the number of chains cut by the enzyme and Ns is the number of sites (some chains have more than one site).

[0093] From this analysis, Sfil, NotI, AM, ApaLI, and AscI are very suitable. Sf/1 and Not\ are preferably used in pCES1 to insert the heavy-chain display segment. ApaLI and AscI are preferably used in pCES1 to insert the light-chain display segment.

[0094] SsfEII-sites occur in 97% of germ-line JH genes. In rearranged V genes, only 54/79 (68%) of heavy-chain genes contain a SsfEII-Site and 7/61 of these contain two sites. Thus, 47/79 (59%) contain a single Bs/EII-Site. An alternative to using Bs/EII is to cleave via UREs at the end of JH and ligate to a synthetic oligonucleotide that encodes part of CH1.

[0095] One example of preparing a family of DNA sequences using the methods of this invention involves capturing human CDR 3 diversity. As described above, mRNAs from various autoimmune patients are reverse transcribed into lower strand cDNA. After the top strand RNA is degraded, the lower strand is immobilized and a short oligonucleotide used to cleave the cDNA upstream of CDR3. A partially duplexed synthetic DNA adapter is then annealed to the DNA and the DNA is amplified using a primer to the adapter and a primer to the constant region (after FR4). The DNA is then cleaved using BstEII (in FR4) and a restriction endonuclease appropriate to the partially double-stranded adapter (e.g., Xbal and Aflll (in FR3)). The DNA is then ligated into a synthetic VH skeleton such as 3-23.

[0096] One example of preparing a single-stranded DNA that was cleaved using the URE method involves the human Kappa chain. The cleavage site in the sense strand of this chain is depicted in Table 17. The oligonucleotide kapextURE is annealed to the oligonucleotides (kaBR01UR, kaBR02UR, kaBR03UR, and kaBR04UR) to form a partially duplex DNA. This DNA is then ligated to the cleaved soluble kappa chains. The ligation product is then amplified using primers kapextUREPCR and CKForeAsc (which inserts a AscI site after the end of C kappa). This product is then cleaved with ApaLI and AscI and ligated to similarly cut recipient vector.

[0097] Another example involves the cleavage of lambda light chains, illustrated in Table 18. After cleavage, an extender (ON_LamEx133) and four bridge oligonucleotides (ON_LamB1-133, ON_LamB2-133, ON_LamB3-133, and ON_LamB4-133) are annealed to form a partially duplex DNA. That DNA is ligated to the cleaved lambda-chain sense strands. After ligation, the DNA is amplified with ON_Lam133PCR and a forward primer specific to the lambda constant domain, such as CL2ForeAsc or CL7ForeAsc (Table 130).

[0098] In human heavy chains, one can cleave almost all genes in FR4 (downstream, i.e., toward the 3' end of the sense strand, of CDR3) at a BstEII-Site that occurs at a constant position in a very large fraction of human heavy-chain V genes. One then needs a site in FR3, if only CDR3 diversity is to be captured, in FR2, if CDR2 and CDR3 diversity is wanted, or in FR1, if all the CDR diversity is wanted. These sites are preferably inserted as part of the partially double-stranded adaptor.

[0099] The present disclosure also relates to recipient vectors (e.g., for display and/or expression) having sites that allow cloning of either light or heavy chains. Such vectors are well known and widely used in the art. A preferred phage display vector in accordance with this invention is phage MALIA3. This displays in gene III. The sequence of the phage MALIA3 is shown in Table 21A (annotated) and Table 21B (condensed).

[0100] The DNA encoding the selected regions of the light or heavy chains can be transferred to the vectors using endonucleases that cut either light or heavy chains only very rarely. For example, light chains may be captured with ApaU and Asd. Heavy-chain genes are preferably cloned into a recipient vector having Sffl, Nco\, Xba\, AM, SsfEII, Apa\, and Not\ sites. The light chains are preferably moved into the library as ApaU-Asc\ fragments. The heavy chains are preferably moved into the library as Sfi\-Not\ fragments.

[0101] Most preferably, the display is had on the surface of a derivative of M13 phage. The most preferred vector contains all the genes of M13, an antibiotic resistance gene, and the display cassette. The preferred vector is provided with restriction sites that allow introduction and excision of members of the diverse family of genes, as cassettes. The preferred vector is stable against rearrangement under the growth conditions used to amplify phage.

[0102] In another embodiment of this invention, the diversity captured by the methods of the present invention may be displayed and/or expressed in a phagemid vector (e.g., pCES1) that displays and/or expresses the peptide, polypeptide or protein. Such vectors may also be used to store the diversity for subsequent display and/or expression using other vectors or phage.

[0103] In another embodiment of this invention, the diversity captured by the methods of the present invention may be displayed and/or expressed in a yeast vector.

[0104] In another embodiment, the mode of display may be through a short linker to anchor domains — one possible anchor comprising the final portion of M13 III ("Mlstump") and a second possible anchor being the full length III mature protein.

[0105] The lllstump fragment contains enough of M13 III to assemble into phage but not the domains involved in mediating infectivity. Because the w.t. Ill proteins are present the phage is unlikely to delete the antibody genes and phage that do delete these segments receive only a very small growth advantage. For each of the anchor domains, the DNA encodes the w.t. AA sequence, but differs from the w.t. DNA sequence to a very high extent. This will greatly reduce the potential for homologous recombination between the anchor and the w.t. gene that is also present (see Example 6).

[0106] Most preferably, the present invention uses a complete phage carrying an antibiotic-resistance gene (such as an ampicillin-resistance gene) and the display cassette. Because the w.t. ///' and possibly viii genes are present, the w.t. proteins are also present. The display cassette is transcribed from a regulatable promoter (e.g., P|_acZ)· Use of a regulatable promoter allows control of the ratio of the fusion display gene to the corresponding w.t. coat protein. This ratio determines the average number of copies of the display fusion per phage (or phagemid) particle.

[0107] In another embodiment of the methods of this invention, the phage or phagemid can display and/or express proteins other than Fab, by replacing the Fab portions indicated above, with other protein genes.

[0108] Various hosts can be used the display and/or expression aspect of this invention. Such hosts are well known in the art. In the preferred embodiment, where Fabs are being displayed and/or expressed, the preferred host should grow at 30°C and be RecA- (to reduce unwanted genetic recombination) and EndA- (to make recovery of RF DNA easier). It is also preferred that the host strain be easily transformed by electroporation.

[0109] XL1-Blue MRF' satisfies most of these preferences, but does not grow well at 30°C. XL1-Blue MRF' does grow slowly at 38°C and thus is an acceptable host. TG-1 is also an acceptable host although it is RecA+ and EndA+. XL1-Blue MRF' is more preferred for the intermediate host used to accumulate diversity prior to final construction of the library.

[0110] After display and/or expression, the libraries of this invention may be screened using well known and conventionally used techniques. The selected peptides, polypeptides or proteins may then be used to treat disease. Generally, the peptides, polypeptides or proteins for use in therapy or in pharmaceutical compositions are produced by isolating the DNA encoding the desired peptide, polypeptide or protein from the member of the library selected. That DNA is then used in conventional methods to produce the peptide, polypeptides or protein it encodes in appropriate host cells, preferably mammalian host cells, e.g., CHO cells. After isolation, the peptide, polypeptide or protein is used alone or with pharmaceutically acceptable compositions in therapy to treat disease.

EXAMPLES

Example 1: RACE amplification of heavy and light chain antibody repertoires from autoimmune patients.

[0111] Total RNAwas isolated from individual blood samples (50 ml) of 11 patients using a RNAzolTM kit (CINNA/Biotecx), as described by the manufacturer. The patients were diagnosed as follows: 1. 1. SLE and phospholipid syndrome 2. 2. limited systemic sclerosis 3. 3. SLE and Sjogren syndrome 4. 4. Limited Systemic sclerosis 5. 5. Reumatoid Arthritis with active vasculitis 6. 6. Limited systemic sclerosis and Sjogren Syndrome 7. 7. Reumatoid Artritis and (not active) vasculitis 8. 8. SLE and Sjogren syndrome

9. 9. SLE 10. 10. SLE and (active) glomerulonephritis 11. 11. Polyarthritis/ Raynauds Phenomen

From these 11 samples of total RNA, Poly-A+ RNAwas isolated using Promega PolyATtract® mRNA Isolation kit (Promega).

[0112] 250 ng of each poly-A+ RNA sample was used to amplify antibody heavy and light chains wth the GeneRAacerTM kit (Invitrogen cat no. L1500-01). A schematic overview of the RACE procedure is shown in FIG. 3.

[0113] Using the general protocol of the GeneRAacer™ kit, an RNA adaptor was ligated to the 5'end of all mRNAs. Next, a reverse transcriptase reaction was performed in the presence of oligo(dT15) specific primer under conditions described by the manufacturer in the GeneRAacer™ kit.

[0114] 1/5 of the cDNAfrom the reverse transcriptase reaction was used in a 20 ul PCR reaction. For amplification of the heavy chain IgM repertoire, a forward primer based on the CH1 chain of IgM [HuCmFOR] and a backward primer based on the ligated synthetic adaptor sequence [5Ά] were used. (See Table 22) [0115] For amplification of the kappa and lambda light chains, a forward primer that contains the 3' coding-end of the cDNA [HuCkFor and HuCLFor2+HuCLfor7] and a backward primer based on the ligated synthetic adapter sequence [5Ά] was used (See Table 22). Specific amplification products after 30 cycles of primary PCR were obtained.

[0116] FIG. 4 shows the amplification products obtained after the primary PCR reaction from 4 different patient samples. 8 ul primary PCR product from 4 different patients was analyzed on a agarose gel [labeled 1,2, 3 and 4], For the heavy chain, a product of approximately 950 nt is obtained while for the kappa and lambda light chains the product is approximately 850 nt. M1-2 are molecular weight markers.

[0117] PCR products were also analyzed by DNAsequencing [10 clones from the lambda, kappa or heavy chain repertoires]. All sequenced antibody genes recovered contained the full coding sequence as well as the 5' leader sequence and the V gene diversity was the expected diversity (compared to literature data).

[0118] 50 ng of all samples from all 11 individual amplified samples were mixed for heavy, lambda light or kappa light chains and used in secondary PCR reactions.

[0119] In all secondary PCRs approximately 1 ng template DNA from the primary PCR mixture was used in multiple 50 ul PCR reactions [25 cycles], [0120] For the heavy chain, a nested biotinylated forward primer [HuCm-Nested] was used, and a nested 5'end backward primer located in the synthetic adapter-sequence [5'NA] was used. The 5'end lower-strand of the heavy chain was biotinylated.

[0121] For the light chains, a 5'end biotinylated nested primer in the synthetic adapter was used [5'NA] in combination with a 3'end primer in the constant region of Ckappa and Clambda, extended with a sequence coding for the AscI restriction site [ kappa: HuCkForAsci, Lambda: HuCL2-FOR-ASC + HuCL7-FOR-ASCj. [5'end Top strand DNA was biotinylated]. After gel-analysis the secondary PCR products were pooled and purified with Promega Wizzard PCR cleanup.

[0122] Approximately 25 ug biotinylated heavy chain, lambda and kappa light chain DNA was isolated from the 11 patients. Example 2: Capturing kappa chains with BsmAI.

[0123] A repertoire of human-kappa chain mRNAs was prepared using the RACE method of Example 1 from a collection of patients having various autoimmune diseases.

[0124] This Example followed the protocol of Example 1. Approximately 2 micrograms (ug) of human kappa-chain (Igkappa) gene RACE material with biotin attached to 5'-end of upper strand was immobilized as in Example 1 on 200 microliters (pL) of Seradyn magnetic beads. The lower strand was removed by washing the DNA with 2 aliquots 200 pL of 0.1 M NaOH (pH 13) for 3 minutes for the first aliquot followed by 30 seconds for the second aliquot. The beads were neutralized with 200 pL of 10 mM Tris (pH 7.5) 100 mM NaCI. The short oligonucleotides shown in Table 23 were added in 40 fold molar excess in 100 pL of NEB buffer 2 (50 mM NaCI, 10 mM Tris-HCI, 10 mM MgCl2, 1 mM dithiothreitol pH 7.9) to the dry beads. The mixture was incubated at 95°C for 5 minutes then cooled down to 55°C over 30 minutes. Excess oligonucleotide was washed away with 2 washes of NEB buffer 3 (100 mM NaCI, 50 mM Tris-HC1, 10 mM MgCl2, 1 mM dithiothreitol pH 7.9). Ten units of BsmAI (NEB) were added in NEB buffer 3 and incubated for 1 h at 55°C. The cleaved downstream DNA was collected and purified over a Qiagen PCR purification column (FIGs. 5 and 6).

[0125] FIG. 5 shows an analysis of digested kappa single-stranded DNA. Approximately 151.5 pmol of adapter was annealed to 3.79 pmol of immobilized kappa single-stranded DNA followed by digestion with 15 U of BsmAI. The supernatant containing the desired DNA was removed and analyzed by 5% polyacrylamide gel along with the remaining beads which contained uncleaved full length kappa DNA. 189 pmol of cleaved single-stranded DNA was purified for further analysis. Five percent of the original full length ssDNA remained on the beads.

[0126] FIG. 6 shows an analysis of the extender - cleaved kappa ligation. 180 pmol of pre-annealed bridge/extender was ligated to 1.8 pmol of BsmAI digested single-stranded DNA. The ligated DNA was purified by Qiagen PCR purification column and analyzed on a 5% polyacrylamide gel. Results indicated that the ligation of extender to single-stranded DNA was 95% efficient.

[0127] A partially double-stranded adaptor was prepared using the oligonucleotide shown in Table 23. The adaptor was added to the single-stranded DNA in 100 fold molar excess along with 1000 units of T4 DNAIigase and incubated overnight at 16°C. The excess oligonucleotide was removed with a Qiagen PCR purification column. The ligated material was amplified by PCR using the primers kapPCRtl and kapfor shown in Table 23 for 10 cycles with the program shown in Table 24. The soluble PCR product was run on a gel and showed a band of approximately 700 n, as expected (FIGs. 7 and 8). The DNA was cleaved with enzymes ApaLI and Asd, gel purified, and ligated to similarly cleaved vector pCES1.

[0128] FIG. 7 shows an analysis of the PCR product from the extender-kappa amplification. Ligated extender-kappa single-stranded DNA was amplified with primers specific to the extender and to the constant region of the light chain. Two different template concentrations, 10 ng versus 50 ng, were used as template and 13 cycles were used to generate approximately 1.5 ug of dsDNA as shown by 0.8% agarose gel analysis.

[0129] FIG. 8 shows an analysis of the purified PCR product from the extender-kappa amplification. Approximately 5 ug of PCR amplified extender-kappa double-stranded DNA was run out on a 0.8% agarose gel, cut out, and extracted with a GFX gel purification column. By gel analysis, 3.5 ug of double-stranded DNA was prepared.

[0130] The assay for capturing kappa chains with BsmAI was repeated and produced similar results. FIG 9A shows the DNA after it was cleaved and collected and purified over a Qiagen PCR purification column. FIG. 9B shows the partially double-stranded adaptor ligated to the single-stranded DNA. This ligated material was then amplified (FIG. 9C). The gel showed a band of approximately 700 n.

[0131] Table 25 shows the DNA sequence of a kappa light chain captured by this procedure. Table 26 shows a second sequence captured by this procedure. The closest bridge sequence was complementary to the sequence 5'-agccacc-3', but the sequence captured reads 5'-Tgccacc-3', showing that some mismatch in the overlapped region is tolerated.

Example 3: Construction of Synthetic CDR1 and CDR2 Diversity in V-3-23 VH Framework.

[0132] Synthetic diversity in Complementary Determinant Region (CDR) 1 and 2 was created in the 3-23 VH framework in a two step process: first, a vector containing the 3-23 VH framework was constructed; and then, a synthetic CDR 1 and 2 was assembled and cloned into this vector.

[0133] For construction of the 3-23 VH framework, 8 oligonucleotides and two PCR primers (long oligonucleotides - TOPFR1A, BOTFR1B, BOTFR2, BOTFR3, F06, BOTFR4, ON-vgC1, and ON-vgC2 and primers - SFPRMET and BOTPCRPRIM, shown in Table 27) that overlap were designed based on the Genebank sequence of 3-23 VH framework region. The design incorporated at least one useful restriction site in each framework region, as shown in Table 27. In Table 27, the segments that were synthesized are shown as bold, the overlapping regions are underscored, and the PCR priming regions at each end are underscored.

[0134] A mixture of these 8 oligos was combined at a final concentration of 2.5uM in a 20ul PCR reaction. The PCR mixture contained 200uM dNTPs, 2.5mM MgCl2, 0.02U Pfu Turbo™ DNA Polymerase, 1U Qiagen HotStart Taq DNA Polymerase, and 1X Qiagen PCR buffer. The PCR program consisted of 10 cycles of 94_C for 30s, 55_C for 30s, and 72_C for 30s.

[0135] The assembled 3-23 VH DNA sequence was then amplified, using 2.5ul of a 10-fold dilution from the initial PCR in 10Oul PCR reaction. The PCR reaction contained 200uM dNTPs, 2.5mM MgCl2, 0.02U Pfu Turbo™ DNA Polymerase, 1U Qiagen HotStart Taq DNA Polymerase, 1X Qiagen PCR Buffer and 2 outside primers (SFPRMET and BOTPCRPRIM) at a concentration of 1uM. The PCR program consisted of 23 cycles at 94_C for 30s, 55_C for 30s, and 72_C for 60s. The 3-23 VH DNA sequence was digested and cloned into pCES1 (phagemid vector) using the Sfi\ and BsfEII restriction endonuclease sites. All restriction enzymes mentioned herein were supplied by New England BioLabs, Beverly, MA and used as per the manufacturer's instructions.

[0136] Stuffer sequences (shown in Table 28 and Table 29) were introduced into pCES1 to replace CDR1/CDR2 sequences (900 bases between BspEI and Xbal RE sites) and CDR3 sequences (358 bases between Afl\\ and BsfEII) prior to cloning the CDR1/CDR2 diversity. This new vector was termed pCES5 and its sequence is given in Table 29.

[0137] Having stuffers in place of the CDRs avoids the risk that a parental sequence would be over-represented in the library. The stuffer sequences are fragments from the penicillase gene of E. coli. The CDR1-2 stuffer contains restriction sites for Bgl\\, Bsu36\, Bcl\, XcmI, Mlu\, PvuW, Hpal, and Hindi, the underscored sites being unique within the vector pCES5. The stuffer that replaces CDR3 contains the unique restriction endonuclease site RsiII.

[0138] A schematic representation of the design for CDR1 and CDR2 synthetic diversity is shown FIG. 10. The design was based on the presence of mutations in DP47/3-23 and related germline genes. Diversity was designed to be introduced at the positions within CDR1 and CDR2 indicated by the numbers in FIG. 10. The diversity at each position was chosen to be one of the three followng schemes: 1 = ADEFGHIKLMNPQRSTVWY; 2 = YRWVGS; 3 = PS, in which letters encode equimolar mixes of the indicated amino acids.

[0139] For the construction of the CDR1 and CDR2 diversity, 4 overlapping oligonucleotides (ON-vgC1, ON_Br12, ON_CD2Xba, and ON-vgC2, shown in Table 27 and Table 30) encoding CDR1/2, plus flanking regions, were designed. A mixture of these 4 oligos was combined at a final concentration of 2.5uM in a 40ul PCR reaction. Two of the 4 oligos contained variegated sequences positioned at the CDR1 and the CDR2. The PCR mixture contained 200uM dNTPs, 2.5U Pwo DNA Polymerase (Roche), and 1X Pwo PCR buffer with 2mM MgS04. The PCR program consisted of 10 cycles at 94_C for 30s, 60_C for 30s, and 72_C for 60s. This assembled CDR1/2 DNA sequence was amplified, using 2.5ul of the mixture in 100ul PCR reaction. The PCR reaction contained 200uM dNTPs, 2.5U Pwo DNA Polymerase, 1X Pwo PCR Buffer with 2mM MgS04 and 2 outside primers at a concentration of 1uM. The PCR program consisted of 10 cycles at 94_C for 30s, 60_C for 30s, and 72_C for 60s. These variegated sequences were digested and cloned into the 3-23 VH framework in place of the CDR1/2 stuffer.

[0140] We obtained approximately 7 X 107 independent transformants. CDR3 diversity either from donor populations or from synthetic DNA can be cloned into the vector containing synthetic CDR1 and CDR 2 diversity.

[0141] A schematic representation of this procedure is shown in FIG. 11. Asequence encoding the FR-regions of the human V3-23 gene segment and CDR regions with synthetic diversity was made by oligonucleotide assembly and cloning via BspEI and Xbal sites into a vector that complements the FR1 and FR3 regions. Into this library of synthetic VH segments, the complementary VH-CDR3 sequence (top right) was cloned via Xbal an BsfEII sites. The resulting cloned CH genes contain a combination of designed synthetic diversity and natural diversity (see FIG. 11).

Example 4: Cleavage and ligation of the lambda light chains with Hinfl.

[0142] A schematic of the cleavage and ligation of antibody light chains is shown in FIGs. 12Aand 12B. Approximately 2 ug of biotinylated human Lambda DNA prepared as described in Example 1 was immobilized on 200 ul Seradyn magnetic beads. The lower strand was removed by incubation of the DNA with 200 ul of 0.1 M NaOH (pH=13) for 3 minutes, the supernatant was removed and an additional washing of 30 seconds with 200 ul of 0.1 M NaOH was performed. Supernatant was removed and the beads were neutralized with 200 ul of 10 mM Tris (pH=7.5), 100 mM NaCI. 2 additional washes with 200 ul NEB2 buffer 2, containing 10 mM Tris (pH=7.9), 50 mM NaCI, 10 mM MgCI2 and 1 mM dithiothreitol, were performed. After immobilization, the amount of ssDNA was estimated on a 5% PAGE-UREA gel.

[0143] About 0.8 ug ssDNA was recovered and incubated in 100 ul NEB2 buffer 2 containing 80 molar fold excess of an equimolar mix of ON_Lam1aB7, ON_Lam2aB7, ON_Lam3IB7 and ON_Lam3rB7 [each oligo in 20 fold molar excess] (see Table 31).

[0144] The mixture was incubated at 95° C for 5 minutes and then slowly cooled down to 50° C over a period of 30 minutes. Excess of oligonucleotide was washed away with 2 washes of 200 ul of NEB buffer 2. 4 U/ug of Hinf I was added and incubated for 1 hour at 50° C. Beads were mixed every 10 minutes.

[0145] After incubation the sample was purified over a Qiagen PCR purification column and was subsequently analysed on a 5% PAGE-urea gel (see FIG. 13A, cleavage was more than 70% efficient).

[0146] Aschematic of the ligation of the cleaved light chains is shown in FIG. 12B. Amixof bridge/extender pairs was prepared from the Brg/Ext oligo's listed in Table 31 (total molar excess 100 fold) in 1000 Uof T4 DNA Ligase (NEB) and incubated overnight at 16° C. After ligation of the DNA, the excess oligonucleotide was removed with a Qiagen PCR purification column and ligation was checked on a Urea-PAGE gel (see FIG. 13B; ligation was more than 95% efficient).

[0147] Multiple PCRs were performed containing 10 ng of the ligated material in an 50 ul PCR reaction using 25 pMol ON lamPlePCR and 25 pmol of an equimolar mix of Hu-CL2Ascl/HuCL7Ascl primer (see Example 1).

[0148] PCR was performed at 60° C for 15 cycles using Pfu polymerase. About 1 ug of dsDNAwas recovered per PCR (see FIG. 13C) and cleaved with ApaL1 and AscI for cloning the lambda light chains in pCES2.

Example 5: Capture of human heavy-chain CDR3 population.

[0149] A schematic of the cleavage and ligation of antibody light chains is shown in FIGs. 14A and 14B.

[0150] Approximately 3 ug of human heavy-chain (IgM) gene RACE material with biotin attached to 5'-end of lower strand was immobilized on 300 uL of Seradyn magnetic beads. The upper strand was removed by washing the DNA with 2 aliquots 300 uL of 0.1 M NaOH (pH 13) for 3 minutes for the first aliquot followed by 30 seconds for the second aliquot. The beads were neutralized with 300 uL of 10 mM Tris (pH 7.5) 100 mM NaCI. The REdaptors (oligonucleotides used to make single-stranded DNA locally double-stranded) shown in Table 32 were added in 30 fold molar excess in 200 uL of NEB buffer 4 (50 mM Potasium Acetate, 20 mM Tris-Acetate, 10 mM Magnesuim Acetate, 1 mM dithiothreitol pH 7.9) to the dry beads. The REadaptors were incubated with the single-stranded DNA at 80 °C for 5 minutes then cooled down to 55 °C over 30 minutes. Excess REdaptors were washed away with 2 washes of NEB buffer 4. Fifteen units of l-^yCH4lll (NEB) were added in NEB buffer 4 and incubated for 1 hour at 55 °C. The cleaved downstream DNA remaining on the beads was removed from the beads using a Qiagen Nucleotide removal column (see FIG. 15).

[0151] The Bridge/Extender pairs shown in Table 33 were added in 25 molar excess along wth 1200 units of T4 DNA ligase and incubated overnight at 16 °C. Excess Bridge/Exfender was removed wth a Qiagen PCR purification column. The ligated material was amplified by PCR using primers H43.XAExtPCR2 and Hucumnest shown in Table 34 for 10 cycles with the program shown in Table 35.

[0152] The soluble PCR product was run on a gel and showed a band of approximately 500 n, as expected (see FIG. 15B). The DNA was cleaved with enzymes Sfil and Notl, gel purified, and ligated to similarly cleaved vector PCES1.

Example 6: Description of Phage Display Vector CJRA05, a member of the library built in vector DY3F7.

[0153] Table 36 contains an annotated DNAsequence of a member of the library, CJRA05, see FIG. 16. Table 36 is to be read as follows: on each line everything that follows an exclamation mark "!" is a comment. All occurrences of A, C, G, and T before "!" are the DNA sequence. Case is used only to show that certain bases constitute special features, such as restriction sites, ribosome binding sites, and the like, which are labeled below the DNA. CJRA05 is a derivative of phage DY3F7, obtained by cloning an ApaLI to Notl fragment into these sites in DY3F31. DY3F31 is like DY3F7 except that the light chain and heavy chain genes have been replaced by "stuffer" DNA that does not code for any antibody. DY3F7 contains an antibody that binds streptavidin, but did not come from the present library.

[0154] The phage genes start with gene ii and continue with genes x, v, vii, ix, viii, iii, vi, i, and iv. Gene iii has been slightly modified in that eight codons have been inserted between the signal sequence and the mature protein and the final amino acids of the signal sequence have been altered. This allows restriction enzyme recognition sites Eagl and Xbal to be present. Following gene iv is the phage origin of replication (ori). After ori is bla which confers resistance to ampicillin (ApR). The phage genes and bla are transcribed in the same sense.

[0155] After bla, is the Fab cassette (illustrated in FIG. 17) comprising: 1. a) PlacZ promoter, 2. b) A first Ribosome Binding Site (RBS1), 3. c) The signal sequence form M13 iii, 4. d) An ApaLI RERS, 5. e) A light chain (a kappa L20::JK1 shortened by one codon at the V-J boundary in this case), 6. f) An Asel RERS, 7. g) A second Ribosome Binding Site (RBS2), 8. h) A signal sequence, preferably PelB, which contains, 9. i) An Sfil RERS, 10. j) A synthetic 3-23 V region with diversity in CDR1 and CDR2, 11. k) A captured CDR3, 12. I) A partially synthetic J region (FR4 after BstEII), 13. m) CH1, 14. n) A Notl RERS, 15. o)AHis6tag, 16. p)AcMyctag, 17. q) An amber codon, 18. r) An anchor DNA that encodes the same amino-acid sequence as codons 273 to 424 of M13 iii (as shown in Table 37). 19. s) Two stop codons, 20. t) An Avrll RERS, and 21. u) A trp terminator.

[0156] The anchor (item r) encodes the same amino-acid sequence as do codons 273 to 424 of M13 iii but the DNA is approximately as different as possible from the wild-type DNA sequence. In Table 36, the III' stump runs from base 8997 to base 9455. Below the DNA, as comments, are the differences with wild-type iii for the comparable codons with ”!W.T” at the ends of these lines. Note that Met and Trp have only a single codon and must be left as is. These AA types are rare. Ser codons can be changed at all three base, while Leu and Arg codons can be changed at two.

[0157] In most cases, one base change can be introduced per codon. This has three advantages: 1) recombination wth the wld-type gene carried elsewhere on the phage is less likely, 2) new restriction sites can be introduced, facilitating construction; and 3) sequencing primers that bind in only one of the two regions can be designed.

[0158] The fragment of M13 III shown in CJRA05 is the preferred length for the anchor segment. Alternative longer or shorter anchor segments defined by reference to whole mature III protein may also be utilized.

[0159] The sequence of M13 III consists of the following elements: Signal Sequence::Domain 1 (D1)::Linker 1 (L1)::Domain 2 (D2)::Linker 2 (L2)::Domain 3 (D3)::Transmembrane Segment (TM):: Intracellular anchor (IC) (see Table 38).

[0160] The pill anchor (also known as trplll) preferably consists of D2::L2::D3::TM::IC. Another embodiment for the pill anchor consists of D2'::L2::D3::TM::IC (where D2' comprises the last 21 residues of D2 with the first 109 residues deleted). A further embodiment of the pill anchor consists of D2'(C>S)::L2::D3::TM::IC (where D2'(C>S) is D2' with the single C converted to S), and d) D3::TM::IC.

[0161] Table 38 shows a gene fragment comprising the Notl site, His6 tag, cMyc tag, an amber codon, a recombinant enterokinase cleavage site, and the whole of mature M13 III protein. The DNA used to encode this sequence is intentionally very different from the DNA of wild-type gene iii as shown by the lines denoted "W.T.” containing the wt. bases where these differ from this gene. Ill is divided into domains denoted "domain 1" "linker 1" "domain 2", "linker 2", "domain 3", "transmembrane segment", and "intracellular anchor".

[0162] Alternative preferred anchor segments (defined by reference to the sequence of Table 38) include: codons 1-29 joined to codons 104-435, deleting domain 1 and retaining linker 1 to the end; codons 1 -38 joined to codons 104-435, deleting domain land retaining the rEK cleavage site plus linker 1 to the end from III; codons 1 -29 joined to codons 236-435, deleting domain 1, linker 1, and most of domain 2 and retaining linker 2 to the end; codons 1 -38 joined to codons 236-435, deleting domain 1, linker 1, and most of domain 2 and retaining linker 2 to the end and the rEK cleavage site; codons 1-29 joined to codons 236-435 and changing codon 240 to Ser(e.g., age), deleting domain 1, linker 1, and most of domain 2 and retaining linker 2 to the end; and codons 1-38 joined to codons 236-435 and changing codon 240 to Ser (e.g., age), deleting domain 1, linker 1, and most of domain 2 and retaining linker 2 to the end and the rEK cleavage site.

[0163] The constructs would most readily be made by methods similar to those of V\fang and Wilkinson (Biotechniques 2001: 31 (4)722-724) in which PCR is used to copy the vector except the part to be deleted and matching restriction sites are introduced or retained at either end of the part to be kept. Table 39 shows the oligonucleotides to be used in deleting parts of the III anchor segment. The DNA shown in Table 38 has an Nhel site before the DINDDRMA recombinant enterokinase cleavage site (rEKCS). If Nhel is used in the deletion process with this DNA, the rEKCS site would be lost. This site could be quite useful in cleaving Fabs from the phage and might facilitate capture of very high-afffinity antibodies. One could mutagenize this sequence so that the Nhel site would follow the rEKCS site, an Ala Ser amino-acid sequence is already present. Alternatively, one could use Sphl for the deletions. This would involve a slight change in amino acid sequence but would be of no consequence.

Example 7 : Selection of antigen binders from an enriched library of human antibodies using phage vector DY3F31.

[0164] In this example the human antibody library used is described in de Haard et al., (Journal of Biological Chemistry, 274 (26): 18218-30 (1999). This library, consisting of a large non-immune human Fab phagemid library, was first enriched on antigen, either on streptavidin or on phenyl-oxazolone (phOx). The methods for this are well known in the art. Two preselected Fab libraries, the first one selected once on immobilized phOx-BSA (R1-ox) and the second one selected twice on streptavidin (R2-strep), were chosen for redoning.

[0165] These enriched repertoires of phage antibodies, in which only a very low percentage have binding activity to the antigen used in selection, were confirmed by screening clones in an ELISA for antigen binding. The selected Fab genes were transferred from the phagemid vector of this library to the DY3F31 vector via ApaL1-Not1 restriction sites.

[0166] DNA from the DY3F31 phage vector was pretreated with ATP dependent DNAse to remove chromosomal DNA and then digested with ApaL1 and Not1.

An extra digestion with AscI was performed in between to prevent self-ligation of the vector. The ApaLIINotl Fab fragment from the preselected libraries was subsequently ligated to the vector DNA and transformed into competent XL1-blue MRF' cells.

[0167] Libraries were made using vectorinsert ratios of 1:2 for phOx-library and 1:3 for STREP library, and using 100 ng ligated DNA per 50 μΙ of electroporation-competent cells (electroporation conditions : one shock of 1700 V, 1 hour recovery of cells in rich SOC medium, plating on amplicillin-containing agar plates).

[0168] This transformation resulted in a library size of 1.6 x 106 for R1-ox in DY3F31 and 2.1 x 106 for R2-strep in DY3F31. Sixteen colonies from each library were screened for insert, and all showed the correct size insert (±1400 bp) (for both libraries).

[0169] Phage was prepared from these Fab libraries as follows. A representative sample of the library was inoculated in medium with ampicillin and glucose, and at OD 0.5, the medium exchanged for ampicillin and 1 mM IPTG. After overnight growth at 37 °C, phage was harvested from the supernatant by PEG-NaCI precipitation. Phage was used for selection on antigen. R1-oxwas selected on phOx-BSA coated by passive adsorption onto immunotubes and R2-strep on streptavidin coated paramagnetic beads (Dynal, Norway), in procedures described in de Haard et. al. and Marks et. al., Journal of Molecular Biology, 222(3): 581-97 (1991). Phage titers and enrichments are given in Table 40.

[0170] Clones from these selected libraries, dubbed R2-ox and R3-strep respectively, were screened for binding to their antigens in ELISA. 44 clones from each selection were picked randomly and screened as phage or soluble Fab for binding in ELISA For the libraries in DY3F31, clones were first grown in 2TY-2% glucose-50 pg/ml AMP to an OD600 of approximately 0.5, and then grown overnight in 2TY-50 pg/ml AMP +/- 1mM IPTG. Induction with IPTG may result in the production of both phage-Fab and soluble Fab. Therefore the (same) clones were also grown without IPTG. Table 41 shows the results of an ELISA screening of the resulting supernatant, either for the detection of phage particles with antigen binding (Anti-M13 HRP = antiphage antibody), or for the detection of human Fabs, be it on phage or as soluble fragments, either with using the anti-myc antibody 9E10 which detects the myc-tag that every Fab carries at the C-terminal end of the heavy chain followed by a HRP-labeled rabbit-anti-Mouse serum (column 9E10/RAM-HRP), or with anti-light chain reagent followed by a HRP-labeled goat-anti-rabbit antiserum(anti-CK/CL Gar-HRP).

[0171] The results show® that in both cases antigen-binders are identified in the library, with as Fabs on phage or with the anti-Fab reagents (Table 41). IPTG induction yields an increase in the number of positives. Also it can be seen that for the phOx-dones, the phage ELISA yields more positives than the soluble Fab ELISA, most likely due to the avid binding of phage. Twenty four of the ELISA-positive clones were screened using PCR of the Fab-insert from the vector, followed by digestion with BstNI. This yielded 17 different patterns for the phOx-binding Fab's in 23 samples that were correctly analyzed, and 6 out of 24 for the streptavidin binding clones. Thus, the data from the selection and screening from this pre-enriched non-immune Fab library show that the DY3F31 vector is suitable for display and selection of Fab fragments, and provides both soluble Fab and Fab on phage for screening experiments after selection.

Example 8: Selection of Phage-antibody libraries on streptavidin magnetic beads.

[0172] The following example describes a selection in which one first depletes a sample of the library of binders to streptavidin and optionally of binders to a non-target (i.e., a molecule other than the target that one does not want the selected Fab to bind). It is hypothesized that one has a molecule, termed a "competitive ligand", which binds the target and that an antibody which binds at the same site would be especially useful.

[0173] For this procedure Streptavidin Magnetic Beads (Dynal) were blocked once with blocking solution (2% Marvel Milk, PBS (pH 7.4), 0.01% Tween-20 ("2%MPBST")) for 60 minutes at room temperature and then washed five times with 2%MPBST. 450 pL of beads were blocked for each depletion and subsequent selection set.

[0174] Per selection, 6.25 pL of biotinylated depletion target (1 mg/mL stock in PBST) was added to 0.250 mL of washed, blocked beads (from step 1). The target was allowed to bind overnight, with tumbling, at 4°C. The next day, the beads are washed 5 times with PBST.

[0175] Per selection, 0.010 mL of biotinylated target antigen (1 mg/mL stock in PBST) was added to 0.100 mL of blocked and washed beads (from step 1). The antigen was allowed to bind overnight, with tumbling, at 4°C. The next day, the beads were washed 5 times with PBST.

[0176] In round 1, 2 X 10^ up to 1013 plaque forming units (pfu) per selection were blocked against non-specific binding by adding to 0.500 mL of 2%MPBS (=2%MPBST without Tween) for 1 hr at RT (tumble). In later rounds, 1011 pfu per selection were blocked as done in round 1.

[0177] Each phage pool was incubated with 50 pl_ of depletion target beads (final wash supernatant removed just before use) on a Labquake rotator for 10 min at room temperature. After incubation, the phage supernatant was removed and incubated with another 50 pL of depletion target beads. This was repeated 3 more times using depletion target beads and twice using blocked streptavidin beads for a total of 7 rounds of depletion, so each phage pool required 350 μΙ_ of depletion beads.

[0178] A small sample of each depleted library pool was taken for titering. Each library pool was added to 0.100 mL of target beads (final wash supernatant was removed just before use) and allowed to incubate for 2 hours at room temperature (tumble).

[0179] Beads were then washed as rapidly as possible (e.g., 3 minutes total) with 5 X 0.500 mL PBST and then 2X with PBS. Phage still bound to beads after the washing were eluted once with 0.250 mL of competitive ligand (~1 μμΜ) in PBST for 1 hour at room temperature on a Labquake rotator. The eluate was removed, mixed with 0.500 mL Minimal A salts solution and saved. For a second selection, 0.500 mL 100 mM TEA was used for elution for 10 min at RT, then neutralized in a mix of 0.250 mL of 1 M Tris, pH 7.4 + 0.500 mL Min A salts.

[0180] After the first selection elution, the beads can be eluted again with 0.300 mL of non-biotinylated target (1 mg/mL) for 1 hr at RT on a Labquake rotator. Eluted phage are added to 0.450 mL Minimal A salts.

[0181] Three eluates (competitor from 1st selection, target from 1st selection and neutralized TEA elution from 2nd selection) were kept separate and a small aliquot taken from each for titering. 0.500 mL Minimal A salts were added to the remaining bead aliquots after competitor and target elution and after TEA elution. Take a small aliquot from each was taken for tittering.

[0182] Each elution and each set of eluted beads was mixed with 2X YT and an aliquot (e.g., 1 mLwith 1. E 10/mL) of XL1-Blue MRF' E. coli cells (or other F' cell line) which had been chilled on ice after having been grown to mid-logarithmic phase, starved and concentrated (see procedure below - "Mid-Log prep of XL-1 blue MRF' cells for infection").

[0183] After approximately 30 minutes at room temperature, the phage/cell mixtures were spread onto Bio-Assay Dishes (243 X 243 X 18 mm, Nalge Nunc) containing 2XYT, 1mM IPTG agar. The plates were incubated overnight at 30°C. The next day, each amplified phage culture was harvested from its respective plate. The plate was flooded with 35 mL TBS or LB, and cells were scraped from the plate. The resuspended cells were transferred to a centrifuge bottle. An additional 20 mL TBS or LB was used to remove any cells from the plate and pooled with the cells in the centrifuge bottle. The cells were centrifuged out, and phage in the supernatant was recovered by PEG precipitation. Over the next day, the amplified phage preps were titered.

[0184] In the first round, two selections yielded five amplified eluates. These amplified eluates were panned for 2-3 more additional rounds of selection using -1. E 12 input phage/round. For each additional round, the depletion and target beads were prepared the night before the round was initiated.

[0185] For the elution steps in subsequent rounds, all elutions up to the elution step from which the amplified elution came from were done, and the previous elutions were treated as washes. For the bead infection amplified phage, for example, the competitive ligand and target elutions were done and then tossed as washes (see below). Then the beads were used to infect E. coli. Two pools, therefore, yielded a total of 5 final elutions at the end of the selection. 1st selection set [0186] 1. A. Ligand amplified elution: elute w/ ligand for 1 hr, keep as elution 2. B. Target amplified elution: elute w/ ligand for 1 hr, toss as wash elute w/ target for 1 hr, keep as elution 3. C. Bead infect, amp. elution: elute w/ ligand for 1 hr, toss as wash elute w/ target for 1 hr, toss as wash elute w/ cell infection, keep as elution 2nd selection set [0187] 1. A. TEA amplified elution; elute W TEA 10min, keep as elution 2. B. Bead infect, amp. elution; elute w/ TEA 10min, toss as wash elute w/ cell infection, keep as elution Mid-log prep of XL1 blue MRF' cells for infection (based on Barbas et al. Phage Display manual procedure) [0188] Culture XL1 blue MRF' in NZCYM (12.5 mg/mL tet) at 37°C and 250 rpm overnight. Started a 500 mL culture in 2 liter flask by diluting cells 1/50 in NZCYM/tet (10 mL overnight culture added) and incubated at 37°C at 250 rpm until OD600 of 0.45 (1.5-2 hrs) was reached. Shaking was reduced to 100 rpm for 10 min. When OD600 reached between 0.55-0.65, cells were transferred to 2 x 250 mL centrifuge bottles, centrifuged at 600 g for 15 min at 4°C. Supernatant was poured off. Residual liquid was removed with a pipette.

[0189] The pellets were gently resuspended (not pipetting up and down) in the original volume of 1 X Minimal A salts at room temp. The resuspended cells were transferred back into 2-liter flask, shaken at 100 rpm for 45 min at 37°C. This process was performed in order to starve the cells and restore pili. The cells were transferred to 2 x250 mL centrifuge bottles, and centrifuged as earlier.

[0190] The cells were gently resuspended in ice cold Minimal A salts (5 mL per 500 mL original culture). The cells were put on ice for use in infections as soon as possible.

[0191] The phage eluates were brought up to 7.5 mL with 2XYT medium and 2.5 mL of cells were added. Beads were brought up to 3 mL with 2XYT and 1 mL of cells were added. Incubated at 37oC for 30 min. The cells were plated on 2XYT, 1 mM IPTG agar large NUNC plates and incubated for 18 hr at 30°C.

Example 9: Incorporation of synthetic region in FR1/3 region.

[0192] Described below are examples for incorporating of fixed residues in antibody sequences for light chain kappa and lambda genes, and for heavy chains. The experimental conditions and oligonucleotides used for the examples below have been described in previous examples (e.g., Examples 3 &4).

[0193] The process for incorporating fixed FR1 residues in an antibody lambda sequence consists of 3 steps (see FIG. 18): (1) annealing of single-stranded DNA material encoding VL genes to a partially complementary oligonucleotide mix (indicated with Ext and Bridge), to anneal in this example to the region encoding residues 5-7 of the FR1 of the lambda genes (indicated with X.X within the lambda genes the overlap may sometimes not be perfect); (2) ligation of this complex; (3) PCR of the ligated material with the indicated primer ('PCRpr') and for example one primer based within the VL gene. In this process the first few residues of all lambda genes will be encoded by the sequences present in the oligonucleotides (Ext., Bridge or PCRpr). After the PCR, the lambda genes can be cloned using the indicated restriction site for ApaLI.

[0194] The process for incorporating fixed FR1 residues in an antibody kappa sequence (FIG. 19) consists of 3 steps : (1) annealing of single-stranded DNA material encoding VK genes to a partially complementary oligonucleotide mix (indicated with Ext and Bri), to anneal in this example to the region encoding residues 8-10 of the FR1 of the kappa genes (indicated with X.X; within the kappa genes the overlap may sometimes not be perfect) ; (2) ligation of this complex; (3) PCR of the ligated material with the indicated primer ('PCRpr') and for example one primer based within the VK gene. In this process the first few (8) residues of all kappa genes will be encode by the sequences present in the oligonucleotides (Ext., Bridge or PCRpr.). After the PCR, the kappa genes can be cloned using the indicated restriction site for ApaLI.

[0195] The process of incorporating fixed FR3 residues in a antibody heavy chain sequence (FIG. 20) consists of 3 steps : (1) annealing of single-stranded DNA material encoding part of the VFI genes (for example encoding FR3, CDR3 and FR4 regions) to a partially complementary oligonucleotide mix (indicated with Ext and Bridge), to anneal in this example to the region encoding residues 92-94 (within the FR3 region) of VFI genes (indicated with X.X; within the VFI genes the overlap may sometimes not be perfect); (2) ligation of this complex; (3) PCR of the ligated material with the indicated primer ('PCRpr') and for example one primer based within the VFI gene (such as in the FR4 region). In this process certain residues of all VFI genes will be encoded by the sequences present in the oligonucleotides used here, in particular from PCRpr (for residues 70-73), or from Ext/Bridge oligonucleotides (residues 74-91). After the PCR, the partial VFI genes can be cloned using the indicated restriction site forXba/.

Table 1: Human GLG FR3 sequences ! VH1 ! 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 agg gtc acc atg acc agg gac acg tcc ate age aca gcc tac atg ! 81 82 82a 82b 82c 83 84 85 86 87 88 89 90 91 92 gag ctg age agg ctg aga tet gac gac acg gcc gtg tat tac tgt ! 93 94 95 geg aga ga ! 1-02# 1 aga gtc acc att acc agg gac aca tec geg age aca gcc tac atg gag ctg age age ctg aga tet gaa gac acg get gtg tat tac tgt geg aga ga ! 1-03# 2 aga gtc acc atg acc agg aac acc tec ata age aca gcc tac atg gag ctg age age ctg aga tet gag gac acg gcc gtg tat tac tgt geg aga gg ! 1-08# 3 aga gtc acc atg acc aca gac aca tec acg age aca gcc tac atg gag ctg agg age ctg aga tet gac gac acg gcc gtg tat tac tgt geg aga ga ! 1-18# 4 aga gtc acc atg acc gag gac aca tet aca gac aca gcc tac atg gag ctg age age ctg aga tet gag gac acg gcc gtg tat tac tgt gca aca ga ! 1-24# 5 aga gtc acc att acc agg gac agg tet atg age aca gcc tac atg gag ctg age age ctg aga tet gag gac aca gcc atg tat tac tgt gca aga ta ! 1-45# 6 aga gtc acc atg acc agg gac acg tec acg age aca gtc tac atg gag ctg age age ctg aga tet gag gac acg gcc gtg tat tac tgt geg aga ga ! 1-46# 7 aga gtc acc att acc agg gac atg tec aca age aca gcc tac atg gag ctg age age ctg aga tec gag gac acg gcc gtg tat tac tgt geg gca ga ! 1-58# 8 aga gtc acg att acc geg gac gaa tec acg age aca gcc tac atg gag ctg age age ctg aga tet gag gac acg gcc gtg tat tac tgt geg aga ga ! 1-69# 9 aga gtc acg att acc geg gac aaa tec acg age aca gcc tac atg gag ctg age age ctg aga tet gag gac acg gcc gtg tat tac tgt geg aga ga ! 1-e# 10 aga gtc acc ata acc geg gac acg tet aca gac aca gcc tac atg gag ctg age age ctg aga tet gag gac acg gcc gtg tat tac tgt gca aca ga ! 1-f# 11 ! VH2 agg etc acc ate ace aag gac ace tee aaa aac cag gtg gtc ett aca atg acc aac atg gac cct gtg gac aca gee aca tat tac tgt gca cac aga c! 2-05# 12 agg etc acc ate tee aag gac acc tee aaa age cag gtg gtc ett acc atg acc aac atg gac cct gtg gac aca gee aca tat tac tgt gca egg ata c! 2-26# 13 agg etc acc ate tee aag gac acc tee aaa aac cag gtg gtc ett aca atg acc aac atg gac cct gtg gac aca gee aeg tat tac tgt gca egg ata cl 2-70# 14 ! VH3 ega ttc acc ate tee aga gac aac gee aag aac tea ctg tat ctg caa atg aac age ctg aga gee gag gac aeg get gtg tat tac tgt geg aga ga ! 3-07# 15 ega ttc acc ate tee aga gac aac gee aag aac tee ctg tat ctg caa atg aac agt ctg aga get gag gac aeg gcc.ttg tat tac tgt gca aaa gat a! 3-09#16 ega ttc acc ate tee agg gac aac gee aag aac tea ctg tat ctg caa atg aac age ctg aga gee gag gac aeg gee gtg tat tac tgt geg aga ga ! 3-11# 17 ega ttc acc ate tee aga gaa aat gee aag aac tee ttg tat ett caa atg aac age ctg aga gee ggg gac aeg get gtg tat tac tgt gca aga ga ! 3-13# 18 aga ttc acc ate tea aga gat gat tea aaa aac aeg ctg tat ctg caa atg aac age ctg aaa acc gag gac aca gee gtg tat tac tgt acc aca ga ! 3-15# 19 ega ttc acc ate tee aga gac aac gee aag aac tee ctg tat ctg caa atg aac agt ctg aga gee gag gac aeg gee ttg tat cac tgt geg aga ga ! 3-20# 20 ega ttc acc ate tee aga gac aac gee aag aac tea ctg tat ctg caa atg aac age ctg aga gee gag gac aeg get gtg tat tac tgt geg aga ga ! 3-21# 21 egg ttc acc ate tee aga gac aat tee aag aac aeg ctg tat ctg caa atg aac age ctg aga gee gag gac aeg gee gta tat tac tgt geg aaa ga ! 3-23# 22 ega ttc acc ate tee aga gac aat tee aag aac aeg ctg tat ctg caa atg aac age ctg aga get gag gac aeg get gtg tat tac tgt geg aaa ga ! 3-30# 23 ega ttc acc ate tee aga gac aat tee aag aac aeg ctg tat ctg caa atg aac age ctg aga get gag gac aeg get gtg tat tac tgt geg aga ga ! 3303# 24 cga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat ctg caa atg aac age ctg aga get gag gac acg get gtg tat tac tgt gcg aaa ga ! 3305# 25 cga tte acc atc tcc aga gac aat tcc aag aac acg ctg tat ctg caa atg aac age ctg aga gee gag gac acg get gtg tat tac tgt gcg aga ga ! 3-33# 26 cga tte acc atc tcc aga gac aac age aaa aac tcc ctg tat ctg caa atg aac agt ctg aga act gag gac acc gcc ttg tat tac tgt gea aaa gat a! 3-43#27 cga tte acc atc tcc aga gac aat gee aag aac tea ctg tat ctg caa atg aac age ctg aga gac gag gac acg get gtg tat tac tgt gcg aga ga ! 3-48# 28 aga tte acc ate tea aga gat ggt tcc aaa age atc gcc tat ctg caa atg aac age ctg aaa acc gag gac aca gcc gtg tat tac tgt act aga ga ! 3-49# 29 cga tte acc atc tcc aga gac aat tcc aag aac acg ctg tat ett caa atg aac age ctg aga gcc gag gac acg gcc gtg tat tac tgt gcg aga ga ! 3-53# 30 aga tte acc atc tcc aga gac aat tcc aag aac acg ctg tat ett caa atg ggc age ctg aga get gag gac atg get gtg tat tac tgt gcg aga ga ! 3-64# 31 aga tte acc atc tcc aga gac aat tcc aag aac acg ctg tat ett caa atg aac age ctg aga get gag gac acg get gtg tat tac tgt gcg aga ga ! 3-66# 32 aga tte acc ate tea aga gat gat tea aag aac tea ctg tat ctg caa atg aac age ctg aaa acc gag gac acg gcc gtg tat tac tgt get aga ga ! 3-72# 33 agg tte acc ate tee aga gat gat tea aag aac acg gcg tat ctg caa atg aac age ctg aaa acc gag gac acg gcc gtg tat tac tgt act aga ca ! 3-73# 34 cga tte acc atc tcc aga gac aac gcc aag aac acg ctg tat ctg caa atg aac agt ctg aga gee gag gac acg get gtg tat tac tgt gea aga ga ! 3-74# 35 aga tte acc atc tcc aga gac aat tee aag aac acg ctg cat ett caa atg aac age ctg aga get gag gac acg get gtg tat tac tgt aag aaa ga ! 3-d# 36 ! VH4 cga gtc acc ata tea gta gac aag tcc aag aac cag tte tcc ctg aag ctg age tet gtg acc gcc gcg gac acg gcc gtg tat tac tgt gcg aga ga ! 4—04# 37 cga gtc acc atg tea gta gac acg tcc aag aac cag tte tcc ctg aag ctg age tet gtg acc gee gtg gac aeg gcc gtg tat tac tgt gcg aga aa ! 4-28# 38 ega gtt acc ata tea gta gac aeg tet aag aac cag tte tee ctg aag ctg age tet gtg act gcc gcg gac aeg gcc gtg tat tac tgt gcg aga ga ! 4301# 39 ega gtc acc ata tea gta gac agg tee aag aac cag tte tee ctg aag ctg age tet gtg acc gcc gcg gac aeg gcc gtg tat tac tgt gcc aga ga ! 4302# 40 ega gtt acc ata tea gta gac aeg tee aag aac cag tte tee ctg aag ctg age tet gtg act gcc gea gac aeg gcc gtg tat tac tgt gcc aga ga ! 4304# 41 ega gtt acc ata tea gta gac aeg tet aag aac cag tte tee ctg aag ctg age tet gtg act gcc gcg gac aeg gcc gtg tat tac tgt gcg aga ga ! 4-31# 42 ega gtc acc ata tea gta gac aeg tee aag aac cag tte tee ctg aag ctg age tet gtg acc gee gcg gac aeg get gtg tat tac tgt gcg aga ga ! 4-34# 43 ega gtc acc ata tee gta gac aeg tee aag aac cag tte tee ctg aag ctg age tet gtg acc gee gea gac aeg get gtg tat tac tgt gcg aga ca ! 4-39# 44 ega gtc acc ata tea gta gac aeg tee aag aac cag tte tee ctg aag ctg age tet gtg acc get gcg gac aeg gcc gtg tat tac tgt gcg aga ga ! 4-59# 45 ega gtc acc ata tea gta gac aeg tee aag aac cag tte tee ctg aag ctg age tet gtg acc get gcg gac aeg gcc gtg tat tac tgt gcg aga ga ! 4-61# 46 ega gtc acc ata tea gta gac aeg tee aag aac cag tte tee ctg aag ctg age tet gtg acc gcc gea gac aeg gcc gtg tat tac tgt gcg aga ga ! 4-b# 47 ! VH5 cag gtc acc ate tea gee gac aag tee atc age acc gcc tac ctg cag tgg age age ctg aag gcc teg gac acc gcc atg tat tac tgt gcg aga ca ! 5-51# 48 cac gtc acc ate tea get gac aag tee ate age act gcc tac ctg cag tgg age age ctg aag gcc teg gac acc gcc atg tat tac tgt gcg aga ! 5-a# 49 ! VH6 ega ata acc atc aac cca gac aca tee aag aac cag tte tee ctg cag ctg aac tet gtg act ccc gag gac aeg get gtg tat tac tgt gea aga ga ! 6-1# 50 ! VH7 egg ttt gtc tte tee ttg gac acc tet gtc age aeg gea tat ctg cag ate tgc age eta aag get gag gac act gcc gtg tat tac tgt gcg aga ga ! 74.1# 51

Table 2: Enzymes that either cut 15 or more human GLGs or have 5+-base recognition in FR3

Table 3: Synthetic 3-23 FR3 of human heavy chains showning positions of possible cleavage sites

! Sites engineered into the synthetic gene are shown in upper case DNA ! with the RE name between vertical bars (as in I Xbal I). ! RERSs frequently found in GLGs are shown below the synthetic sequence with the name to the right (as in gtn ac=MaeIII(24), indicating that ! 24 of the 51 GLGs contain the site).

I l I---FR3--- ! 89 90 (codon # in

! R F synthetic 3-23)

IcgcIttcI 6 ! Allowed DNA (cgnlttyl ! lagrl ! ga ntc =

Hinfl(38) ! ga gtc -

Plel(18) ! ga wtc —

Tfil(20) ! gtn ac =

Maelll{24) ! gts ac «

Tsp45I(21) ! tc acc =

HphI(44) t

Table 4: REdaptors, Extenders, and Bridges used for Cleavage and Capture of Human Heavy Chains in FR3. A: HpyCH4V Probes of actual human HC genes !HpyCH4V in FR3 of human HC, bases 35-56; only those with TGca site TGca;10, RE recognition:tgca of length 4 is expected at

Table 5; Analysis of frequency of matching REdaptors in actual V genes

A: HpyCH4V in HC at bases 35-56

Table 8: Kappa FRI GLGs 1123456789 10 11 12

GAG ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT 1 13 14 15 16 17 18 19 20 21 22 23 GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! 012

GAC ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! 02

GAC ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! 018

GAC ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! 08

GAC ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! A20

GAC ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! A30

AAC ATC CAG ATG ACC CAG TCT CCA TCT GCC ATG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT ! LI 4

GAC ATC CAG ATG ACC CAG TCT CCA TCC TCA CTG TCT

GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT ! LI

GAC ATC CAG ATG ACC CAG TCT CCA TCC TCA CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT ! LI 5

GCC ATC CAG TTG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! L4

GCC ATC CAG TTG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! L18

GAC ATC CAG ATG ACC CAG TCT CCA TCT TCC GTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT ! L5

GAC ATC CAG ATG ACC CAG TCT CCA TCT TCT GTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT ! LI 9

GAC ATC CAG TTG ACC CAG TCT CCA TCC TTC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! L8

GCC ATC CGG ATG ACC CAG TCT CCA TTC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! L23

GCC ATC CGG ATG ACC CAG TCT CCA TCC TCA TTC TCT GCA TCT ACA GGA GAC AGA GTC ACC ATC ACT TGT ! L9

GTC ATC TGG ATG ACC CAG TCT CCA TCC TTA CTC TCT GCA TCT ACA GGA GAC AGA GTC ACC ATC AGT TGT ! L24

GCC ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! Lll

GAC ATC CAG ATG ACC CAG TCT CCT TCC ACC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! LI 2

GAT ATT GTG ATG ACC CAG ACT CCA CTC TCC CTG CCC GTC ACC CCT GGA GAG CCG GCC TCC ATC TCC TGC ! Oil

GAT ATT GTG ATG ACC CAG ACT CCA CTC TCC CTG CCC GTC ACC CCT GGA GAG CCG GCC TCC ATC TCC TGC ! 01

GAT GTT GTG ATG ACT CAG TCT CCA CTC TCC CTG CCC GTC ACC CTT GGA CAG CCG GCC TCC ATC TCC TGC ! A17

GAT GTT GTG ATG ACT CAG TCT CCA CTC TCC CTG CCC GTC ACC CTT GGA CAG CCG GCC TCC ATC TCC TGC ! A1

GAT ATT GTG ATG ACC CAG ACT CCA CTC TCT CTG TCC GTC ACC CCT GGA CAG CCG GCC TCC ATC TCC TGC ! A18

GAT ATT GTG ATG ACC CAG ACT CCA CTC TCT CTG TCC GTC ACC CCT GGA CAG CCG GCC TCC ATC TCC TGC ! A2

GAT ATT GTG ATG ACT CAG TCT CCA CTC TCC CTG CCC GTC ACC CCT GGA GAG CCG GCC TCC ATC TCC TGC ! A19

GAT ATT GTG ATG ACT CAG TCT CCA CTC TCC CTG CCC GTC ACC CCT GGA GAG CCG GCC TCC ATC TCC TGC ! A3

GAT ATT GTG ATG ACC CAG ACT CCA CTC TCC TCA CCT GTC ACC CTT GGA CAG CCG GCC TCC ATC TCC TGC ! A23

GAA ATT GTG TTG ACG CAG TCT CCA GGC ACC CTG TCT TTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC ! A27

GAA ATT GTG TTG ACG CAG TCT CCA GCC ACC CTG TCT TTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC ! All

GAA ATA GTG ATG ACG CAG TCT CCA GCC ACC CTG TCT GTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC ! L2

GAA ATA GTG ATG ACG CAG TCT CCA GCC ACC CTG TCT GTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC ! LI 6

GAA ATT GTG TTG ACA CAG TCT CCA GCC ACC CTG TCT TTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC ! L6

GAA ATT GTG TTG ACA CAG TCT CCA GCC ACC CTG TCT TTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC ! L20

GAA ATT GTA ATG ACA CAG TCT CCA GCC ACC CTG TCT TTG TCT CCA GGG GAA. AGA GCC ACC CTC TCC TGC ! L25

GAC ATC GTG ATG ACC CAG TCT CCA GAC TCC CTG GCT GTG TCT CTG GGC GAG AGG GCC ACC ATC AAC TGC ! B3

GAA ACG ACA CTC ACG CAG TCT CCA GCA TTC ATG TCA GCG ACT CCA GGA GAC AAA GTC AAC ATC TCC TGC ! B2

GAA ATT GTG CTG ACT CAG TCT CCA GAC TTT CAG TCT GTG ACT CCA AAG GAG AAA GTC ACC ATC ACC TGC ! A26

GAA ATT GTG CTG ACT CAG TCT CCA GAC TTT CAG TCT GTG ACT CCA AAG GAG AAA GTC ACC ATC ACC TGC ! A10

GAT GTT GTG ATG ACA CAG TCT CCA GCT TTC CTC TCT GTG ACT CCA GGG GAG AAA GTC ACC ATC ACC TGC ! A14

Table 9 RERS sites found in Human Kappa FRl GLGs

Table 9 RERS sites found in Human Kappa FR1 GLGs, continued

Table 9 RERS sites found in Human Kappa FR1, continued

Table 10 Lambda FRI GLG sequences ! VLl

CAG TCT GTG CTG ACT CAG CCA CCC TCG GTG TCT GAA GCC CCC AGG CAG AGG GTC ACC ATC TCC TGT ! la

cag tct gtg ctg acG cag ccG ccc tcA gtg tct gGG gcc ccA Ggg cag agg gtc acc ate tcc tgC ! le

cag tct gtg ctg act cag cca ccc tcA gCg tct gGG

Acc ccc Ggg cag agg gtc acc ate tcT tgt ! lc

cag tct gtg ctg act cag cca ccc tcA gCg tct gGG

Acc ccc Ggg cag agg gtc acc ate teT tgt ! lg

cag tct gtg Ttg acG cag ccG ccc tcA gtg tct gCG gcc ccA GgA cag aAg gtc acc ate tcc tgC ! lb ! VL2

CAG TCT GCC CTG ACT CAG CCT CCC TCC GCG TCC GGG TCT CCT GGA CAG TCA GTC ACC ATC TCC TGC ! 2c cag tct gcc ctg act cag cct eGe tcA gTg tcc ggg tct cct gga cag tea gtc acc ate tcc tgc! 2e cag tct gcc ctg act cag cct Gcc tcc gTg teT ggg tct cct gga cag teG Ate acc ate tcc tgc ! 2a2 cag tct gcc ctg act cag cct ccc tcc gTg tcc ggg tct cct gga cag tea gtc acc ate tcc tgc ! 2d cag tct gcc ctg act cag cct Gcc tcc gTg teT ggg tct cct gga cag teG Ate acc ate tcc tgc ! 2b2 ! VL3

TCC TAT GAG CTG ACT CAG CCA CCC TCA GTG TCC GTG TCC CCA GGA CAG ACA GCC AGC ATC ACC TGC! 3r tcc tat gag ctg act cag cca cTc tea gtg tcA gtg

Gcc cTG gga cag acG gcc agG atT acc tgT ! 3j tcc tat gag ctg acA cag cca ccc teG gtg tcA gtg tee cca gga caA acG gcc agG ate acc tgc! 3p tcc tat gag ctg acA cag cca ccc teG gtg tcA gtg tcc cTa gga cag aTG gcc agG ate acc tgc ! 3a teT tCt gag ctg act cag GAC ccT GeT gtg teT gtg

Gcc TTG gga cag aca gTc agG ate acA tgc ! 31 tcc tat gTg ctg act cag cca ccc tea gtg tcA gtg

Gee cca gga Aag aeG gee agG atT acc tgT ! 3h tcc tat gag ctg acA cag cTa ccc teG gtg tcA gtg tee cca gga cag aca gee agG atc acc tgc ! 3e tcc tat gag ctg aTG cag cca ccc teG gtg tcA gtg tee cca gga cag aeG gcc agG atc acc tgc ! 3m tee tat gag ctg acA cag cca Tee tea gtg tcA gtg teT ccG gga cag aca gee agG ate acc tgc ! V2-19 VL4

CTG CCT GTG CTG ACT CAG CCC CCG TCT GCA TCT GCC TTG CTG GGA GCC TCG ATC AAG CTC ACC TGC ! 4 c

cAg eet gtg ctg act caA TcA TcC tet gcC tet gcT tCC ctg gga Tee teg Gtc aag etc acc tgc ! 4a cAg eTt gtg ctg act caA TeG ccC tet gcC tet gcc tCC ctg gga gee teg Gtc aag etc acc tgc ! 4b ! VL5

CAG CCT GTG CTG ACT CAG CCA CCT TCC TCC TCC GCA TCT CCT GGA GAA TCC GCC AGA CTC ACC TGC ! 5e cag Get gtg ctg act cag ccG Get tcc CTc teT gea tet eet gga gCa tcA gcc agT etc acc tgc ! 5c cag eet gtg ctg act cag cca Tet tcc CAT teT gea tet Tet gga gCa tcA gTc aga etc acc tgc ! 5b ! VL6

AAT TTT ATG CTG ACT CAG CCC CAC TCT GTG TCG GAG TCT CCG GGG AAG ACG GTA ACC ATC TCC TGC ! 6a ! VL7

CAG ACT GTG GTG ACT CAG GAG CCC TCA CTG ACT GTG TCC CCA GGA GGG ACA GTC ACT CTC ACC TGT ! 7a cag Get gtg gtg act cag gag ccc tea ctg act gtg tee cca gga ggg aca gtc act etc acc tgt ! 7b ! VL8

CAG ACT GTG GTG ACC CAG GAG CCA TCG TTC TCA GTG TCC CCT GGA GGG ACA GTC ACA CTC ACT TGT ! 8a ! VL9

CAG CCT GTG CTG ACT CAG CCA CCT TCT GCA TCA GCC TCC CTG GGA GCC TCG GTC ACA CTC ACC TGC ! 9a ! VL10

CAG GCA GGG CTG ACT CAG CCA CCC TCG GTG TCC AAG GGC TTG AGA CAG ACC GCC ACA CTC ACC TGC ! 10a

Table 11 RERSs found in human lambda FR1 GLGs

Table 12: Matches to URE FR3 adapters in 79 human HC.

Table 12B. Testing all distinct GLGs from bases 89.1 to 93.2 of the heavy variable domain

Table 12C Most important URE recognition seqs in FR3 Heavy

Table 12D, testing 79 human HC V genes with four probes

[0196] One sequence has five mismatches with sequences 2, 4, and 9; it is scored as best for 2.

[0197] Id is the number of the adapter.

[0198] Best is the number of sequence for which the identified adapter was the best available.

[0199] The rest of the table shows how well the sequences match the adapters. For example, there are 10 sequences that match VHSzy1(ld=1) with 2 mismatches and are worse for all other adapters. In this sample, 90% come within 2 bases of one of the four adapters.

Table 13

Table 14 (FOKIact) 5' -cAcATccqTq TTgTT cAcqqATqTq-3* (VHEx881) 5 *-AATAgTAgAc TgcAgTgTcc TcAgcccTTA AgcTgTTcAT cTgcAAgTAg-AgAgTATTcT TAgAgTTgTc TcTAgAcTTA gTgAAgcg-3' ! note that VHEx881 is the reverse complement of the ON below I [RCJ 5'-cgCttcacTaag- ! Scab........ ! Synthetic 3-23 as in Table 206 ! jTCT|AGA|gac|aac|tct|aag|aatI act|etc I taelttglcaglatgl- ! Xbal... ! laaclagC|TTA|AGgI get|gag|gac|aCT|GCA|Gtc|tael tat 11-3' ! Aflll... (VHBA881) 51-cgCttcacTaag- ITCTIAGAIgaclaacItctlaaglaatlactIctcltaclttglcaglatgl-|aaclagCITTA|AGgIgctIgaglgaclaCTIGCAIGtcltael tat Itgt geg ag-3' (VHBB881) 5'-cgCttcacTaag- ITCTIAGAIgacIaacItetIaagI aat I act|etc|tac11tg IcagI atg|-|aac|agC|TTA|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat|tgt Aeg ag-3‘ (VH881PCR) 5*-cgCttcacTaagITCT|AGA|gacIaac -3'

Table 15: Use of Fok I as "Universal Restriction Enzyme"

Fokl - for dsDNA, | represents sites of cleavage sites of cleavage 5'-cacGGATGtg—nnnnnnn | nnnnnnn-3' {SEQ ID N0:15) 3 *-ataCCTACac--nnrmnnnnrmnInnn-51 (SEQ ID N0:16)

RECOG NITion of Fokl

Case I 5'-...gtgItatt-actgtgc..Substrate....-3’ {SEQ ID N0:17) 3’-cac-ataaItoacacq—} qtGTAGGcac\ 5’- caCATCCgtg/(SEQ ID N0:18)

Case II 5’-...gtgtattIagac-tgc.. Substrate....-3 *{SEQ ID NO:19) f—cacataa-tcto|acg-51 /gtgCCTACac \cacGGATGtg-3'(SEQ ID NO:20)

Case III (Case I rotated ISO degrees) /gtgCCTACac-5 * \ c a c G GAT G t^— atatcttIacaa-tcc-31 Adapter (SEQ ID NO:21) 3'-...cacagaa-tgtcIagg.. substrate....-5’(SEQ ID NO:22)

Case IV (Case II rotated 180 degrees) 3'- gtGTAGGcac\ (SEQ ID NO:23) i—caCATCCot g / 5'-gag Itctc-actaaoc

Substrate 3’-...ctc-agagItgactcg...-5'(SEQ ID NO:24)

Improved Fokl adapters

Fokl - for dsDNA, I represents sites of cleavage Case I

Stem 11, loop 5, stem 11, recognition 17 5’-...catgtgltatt-actgtgc..Substrate....-3 ’ 31-atacac-ataaItoacaca—. rT—, atGTAGGcacG T 5'- caCATCCgtgc C ίχχϋ

Case II

Stem 10, loop 5, stem 10, recognition 18 5' -. ..gtgtatt|agac-tgctgcc.. Substrate....-3 * i-Tt cacataa-tcta | acgacgg-5' T gtgCCTACac C cacGGATGtg-3 *

LxxJ

Case III (Case I rotated 180 degrees)

Stem 11, loop 5, stem 11, recognition 20 r Τι T TgtgCCTACac-5’ G AcacGGATGtg—j •-TT-1 qtatctt I acaa-tccattctq-3' Adapter 3' -. ..cacagaa-tgtcIaggtaagac.. substrate....-5'

Case IV (Case II rotated 180 degrees)

Stem 11, loop 4, stem 11, recognition 17 rT*i

3'- gtGTAGGcacc T caCATCCgtgg T 5 * -atcaaa I tctc-actqaoc *-TJ

Substrate 3'-...tagctc-agagItgactcg... -5'

BseRI I sites of cleavage 5'-cacGAGGAGnnnnnnnnnn|nnnnn-3 * 31-gtgctcctcnnnnnnnn|nnnnnnn-5 *

RECOG

NITion of BseRI

Stem 11, loop 5, stem 11, recognition 19 3’-. .... . .gaacatlcg-ttaagccagta.....5' γΤ-Τί cttgta-gcIaattcggtcat-3*

C GCTGAGGAGTC-J

T cgactcctcag-5' An adapter for BseRI to cleave the substrate above. _I ! A fill.., (VHBA881) 5'-cgCttcacTaag- | TCTIAGAI gac | aac | tct | aag | aat | act | etc | tac | ttg| cag J atg |. I aac I agC |ΤΓΑ I AGg I gft I gag I gac I aCT I GCA I Gtc I tac I tat 11« ccr ae.3- (VHBB881) y-cgCttcacTaag- * 1 TCT I AGA I gac | aac | let | aag | aat | act | etc j tac | ttg | cag | atg | - |aac|agC|TTA|AGg|gcr|gag|gac|aCr|GCA|Gtc|iac|t3/|igt Acgag-3' (VH881PCR) 5’-cgCttcacTaag | TCT | AGA | gac | aac -3*

Table 16 Human heavy chains bases 88.1 to 94.2

88 89 90 91 92 93 94 95 Codon number as in Table 195

Recognition........... Stem......Loop. Stem...... (VHS881-1.1) S'-gctgtgtatItact-gtgcgag oAcATocoTa TToTT cAcggATgTg-3* (VHS881-1.2) 5'-gccgtgtatItact-gtgcgag cAcATecqTq TTgTT cAcqqATqTq-31 (VKS881-2.1) 5'-geegtatatItact-gtgcgag cA^^gggTg TTgTT cAGgg££3?9~31 (VHS881-4.1) 5'-gccgtgtatItact-gtacgag cA^^gggTg TTgTT cAqggMgTg-3* (VHS881-9.1) 5'-accatotatItact-gtocoag cAcATccaTq TTgTT cAc^^^Tg-31 t site of substrate cleavage (FOKIact) 5’-cAgAlj£gTg TTgTT cAcpgATgTe-31 (VHEx881) 5’-AATAgTAgAc TgcAgTgTcc TcAgcccITA AgcTgTTcAT cTgcAAgTAg·

AgAgTATTeT TAgAgTTgTc TeTAgAeTTA gTgAAgcg-3' f note that VHEx881 is the reverse complement of the ON below ! (RC) 5'-cgCttcacTaag- ί Scab........ I Synthetic 3*23 as in Table 206 ! I TCT I AGA I gac I aac I tetjaag I aat I act I etc I tac I ttg I cag I atg I- ! Xbal... ! |aac|agC|TTA|AGg|gct|gag|gac|aCr|GCA|Gtc|tac|tat|t-3'

J I 2 3 4 5 6 7 8 9 10 11 12 AGt gcT TtA acC caA ccG gcT AGT gtT AGC ggT-s ! 13 14 15 tcC ccG g gg cag agg gt-3* ! 1c N.B. the actual seq is the 1 reverse complement of the ! one shown. (0N_Laml33PCR) 5' -ccTcTgAcTgAgT gcA. cAg AGt gc-3'

Table 19: Cleavage of 75 human light chains.

Table 21: MALIA3, annotated ! MALIA3 9532 bases j__________________—-------------------—---—------------------------ 1 aat get act act att agt aga att gat gcc acc ttt tea get ege gee ! gene ii continued 49 cca aat gaa aat ata get aaa cag gtt att gac cat ttg ega aat gta 97 tet aat ggt caa act aaa tet act cgt teg cag aat tgg gaa tea act 145 gtt aca tgg aat gaa act tee aga cac cgt act tta gtt gca tat tta 193 aaa cat gtt gag eta cag cac cag att cag caa tta age tet aag cca 241 tee gca aaa atg acc tet tat caa aag gag caa tta aag gta etc tet 289 aat cct gac ctg ttg gag ttt get tee ggt ctg gtt ege ttt gaa get 337 ega att aaa aeg ega tat ttg aag tet ttc ggg ett cct ett aat ett 385 ttt gat gca ate ege ttt get tet gac tat aat agt cag ggt aaa gac 433 ctg att ttt gat tta tgg tea ttc teg ttt tet gaa ctg ttt aaa gca 481 ttt gag ggg gat tea ATG aat att tat gac gat tee gca gta ttg gac ! RBS?...... Start gene x, ii continues 529 get ate cag tet aaa cat ttt act att acc ccc tet ggc aaa act tet 577 ttt gca aaa gcc tet ege tat ttt ggt ttt tat cgt cgt ctg gta aac 625 gag ggt tat gat agt gtt get ett act atg cct cgt aat tee ttt tgg 673 cgt tat gta tet gca tta gtt gaa tgt ggt att cct aaa tet caa ctg 721 atg aat ett tet acc tgt aat aat gtt gtt ccg tta gtt cgt ttt att 769 aac gta gat ttt tet tee caa cgt cct gac tgg tat aat gag cca gtt

817 ett aaa ate gca TAA

! End X & II 832 ggtaattca ca

I ! Ml E5 Q10 T15 843 ATG att aaa gtt gaa att aaa cca tet caa gcc caa ttt act act cgt

! Start gene V ! S17 S20 P25 E30 891 tet ggt gtt tet cgt cag ggc aag cct tat tea ctg aat gag cag ett j ! V35 E40 V45 939 tgt tac gtt gat ttg ggt aat gaa tat ccg gtt ett gtc aag att act

I ! D50 A55 L60 987 ett gat gaa ggt cag cca gcc tat geg cct ggt cTG TAC Acc gtt cat ! BsrGI... ! L65 V70 S75 R80 1035 ctg tee tet ttc aaa gtt ggt cag ttc ggt tee ett atg att gac cgt

! P85 K87 end of V

1083 ctg ege etc gtt ccg get aag TAA C

I

1108 ATG gag cag gtc geg gat ttc gac aca att tat cag geg atg ! Start gene VII

I 1150 ata caa ate tee gtt gta ett tgt ttc geg ett ggt ata ate

I ! VII and IX overlap. ! ..... S2 V3 L4 V5 S10 1192 get ggg ggt caa agA TGA gt gtt tta gtg tat tet ttc gcc tet ttc gtt

! End VII

! I start IX ! L13 W15 G20 T25 E29 1242 tta ggt tgg tgc ett cgt agt ggc att aeg tat ttt acc cgt tta atg gaa 1293 act tcc tc ! .... stop of IX, IX and VIII overlap by four bases 1301 ATG aaa aag tct tta gtc etc aaa gcc tet gta gee gtt get ace etc ! start signal sequence of viii. 1349 gtt ccg atg ctg tct ttc get get gag ggt gac gat ccc gca aaa geg ! mature viii---> 1397 gcc ttt aac tec ctg caa gcc tea geg acc gaa tat ate ggt tat geg 1445 tgg geg atg gtt gtt gtc att 1466 gtc ggc gca act ate ggt ate aag ctg ttt aag 1499 aaa ttc acc teg aaa gca ! 1515 ! ........... -35 .. t 1517 age tga taaaccgat acaattaaag gctccttttg ! ..... -10

I 1552 gagccttttt ttttGGAGAt ttt ! S.D. underlined

I ! <------III signal sequence----------------------------->

! MKKLLFAIPLV 1575 caac GTG aaa aaa tta tta ttc gca att ect tta gtt ! 1611

! VPFYSHSAQ 1612 gtt cct ttc tat tct cac aGT gcA Cag tCT ! ApaLI... i

1642 GTC GTG ACG CAG CCG CCC TCA GTG TCT GGG GCC CCA GGG CAG AGG GTC ACC ATC TCC TGC ACT GGG AGC AGC TCC AAC ATC GGG GCA ! BstEII...

1729 GGT TAT GAT GTA CAC TGG TAC CAG CAG CTT CCA GGA ACA GCC CCC AAA

1777 CTC CTC ATC TAT GGT AAC AGC AAT CGG CCC TCA GGG GTC CCT GAC CGA

1825 TTC TCT GGC TCC AAG TCT GGC ACC TCA GCC TCC CTG GCC ATC ACT

1870 GGG CTC CAG GCT GAG GAT GAG GCT GAT TAT

1900 TAC TGC CAG TCC TAT GAC AGC AGC CTG AGT

1930 GGC CTT TAT GTC TTC GGA ACT GGG ACC AAG GTC ACC GTC ! BstEII...

1969 CTA GGT CAG CCC AAG GCC AAC CCC ACT GTC ACT

2002 CTG TTC CCG CCC TCC TCT GAG GAG CTC CAA GCC AAC AAG GCC ACA CTA

2050 GTG TGT CTG ATC AGT GAC TTC TAC CCG GGA GCT GTG ACA GTG GCC TGG

2098 AAG GCA GAT AGC AGC CCC GTC AAG GCG GGA GTG GAG ACC ACC ACA CCC

214 6 TCC AAA CAA AGC AAC AAC AAG TAC GCG GCC AGC AGC TAT CTG AGC CTG

2194 ACG CCT GAG CAG TGG AAG TCC CAC AGA AGC TAC AGC TGC CAG GTC ACG

2242 CAT GAA GGG AGC ACC GTG GAG AAG ACA GTG GCC CCT ACA GAA TGT TCA

2290 TAA TAA ACCG CCTCCACCGG GCGCGCCAAT TCTATTTCAA GGAGACAGTC ATA ! AscI.....

I ! PelB signal---------------------------------------------->

! MKYLLPTAAAGLLLL

2343 ATG AAA TAC CTA TTG CCT ACG GCA GCC GCT GGA TTG TTA TTA CTC

I ! 16 17 18 19 20 21 22

! A A Q P A M A 2388 geG GCC cag ccG GCC_atg acc ! Sfil............. ! NgoMI...(1/2)

Ncol......... 1 ! FRI(DP47/V3-23)--------------- ! 23 24 25 26 27 28 29 30

! EVQLLESG

2409 gaaIgtt|CAA|TTG11t a|gag ItctIggtI ! I Mfel } j j --------------FRI-------------------------------------------- ! 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

! GGLVQPGGSLRLSCA

2433 I ggc I ggt IcttIgtt|cagIcctIggt|ggtItctIttaIcgt1ctt1tct|tgc!get I i ! ----FRI----------------> I . . . CDRl................I---FR2------ ! 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

! ASGFTFSSYAMSWVR 2478 I get ITCC|GGA|tte|act I tte ItctItCGITAC|Get Iatg|tctItggIgttIegC| ! I BspEI I I BsiWIl IBstXI. i ! -------FR2--------------------------------->1 . . . CDR2......... ! 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75

! QAPGKGLEWVSAISG

2523 I CAa I get I ccT I GGt I aaa \ ggt I ttg I gag I tgg I gtt | tct I get | ate I tct I ggt I ! ...BstXI I

I ! .....CDR2............................................I---FR3--- ! 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

! SGGSTYYADSVKGRF 2568 I tct Iggt IggcI agt 1 act|tacI tat|get Igac|tee IgttIaaaIggtI ege I tte| j i i -----:---FR3-------------------------------------------------- ! 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105

! TISRDNSKNTLYLQM 2613 I act I atc[TCTIAGA|gac|aacItctIaagI aat I act I etc ItacIttgIcagIatg|

! I Xbal I i ! ---FR3----------------------------------------------------->1 ! 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

I NSLRAEDTAVYYCAK

2658 I aac I agC I TTA| AGg | get | gag | gac | aCT I GCA| Gtc I tac | tat | tgc | get I aaa I ! 1 AfIII I I PstI I

I ! .......CDR3.................I----FR4------------------------- ! 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135

! DYEGTGYAFDIWGQG 2703 I gac 11at I gaa I ggt I act I ggt I tat I get! ttel gaC I ATA| TGg I ggt I caa I ggt I ! I Ndel I (1/4)

I i --------------FR4---------->| ! 136 137 138 139 140 141 142

{ T Μ V T V S S

274 8 |act|atG|GTC|ACC|gtc| tct lagt ! I BstEII I ! From BstEII onwards, pV323 is same as pCESl, except as noted. ! BstEII sites may occur in light chains; not likely to be unique in final ! vector.

I ! 143 144 145 146 147 148 149 150 151 152

! ASTKGPSVFP 2769 gcc tcc acc aaG GGC CCa teg GTC TTC ccc ! Bspl20I. Bbsl...(2/2) ! Apal____ j ! 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167

l LAPSSKSTSGGTAAL 2799 ctg gca ccC TCC TCc aag age acc tet ggg ggc aca geg gcc ctg ! BseRI...(2/2) 1 ! 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182

! GCLVKDYFPEPVTVS 2844 ggc tgc ctg GTC AAG GAC TAC TTC CCc gaA CCG GTg aeg gtg teg ! AgeI.... j ! 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197

! WNSGALTSGVHTFPA 2889 tgg aac tea GGC GCC ctg acc age ggc gtc cac acc ttc ccg get ! KasI...(1/4)

I i 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212

! VLQSSGLYSLSSVVT 2934 gtc eta cag tCt age GGa etc tac tcc etc age age gta gtg acc ! (Bsu36I...)(knocked out)

I ! 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227

! VPSSSLGTQTYICNV 2979 gtg ccC tCt tet age tTG Ggc acc cag acc tac ate tgc aac gtg ! (BstXI...........)N.B. destruction of BstXI &amp; Bpml sites.

I ! 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242

! NHKPSNTKVDKKVEP 3024 aat cac aag ccc age aac acc aag gtg gac aag aaa gtt gag ccc

I ! 243 244 245

! KSCAAAHHHH HHSA 3069 aaa tet tgt GCG GCC GCt cat cac cac cat cat cac tet get ! Notl...... 1

! EQKLISEEDLNGAA 3111 gaa caa aaa etc ate tea gaa gag gat ctg aat ggt gcc gca

I

I

1 DINDDRM ASGA 3153 GAT ATC aac gat gat cgt atg get AGC ggc gcc ! rEK cleavage site.......... Nhel. . . KasI... ! EcoRV.. i ! Domain 1 ------------------------------------------------------------

! AETVESCLA 3183 get gaa act gtt gaa agt tgt tta gca

I

I

! KFHTEISF 3210 aaa ccc cat aca gaa aat tea ttt

I

TNVWKDDKT 3234 aCT AAC GTC TGG AAA GAC GAC AAA Act « ! ldryanyegclwnatgv 3261 tta gat cgt tac get aac tat gag ggt tgt ctg tgG AAT GCt aca ggc gtt ! Bsml_ i

! VVCTGD. ETQCYGTWVPI 3312 gta gtt tgt act ggt GAC G AA ACT CAG TGT TAC GGT ACA TGG GTT eet att r

i G L A I P E N 3363 ggg ett get ate eet gaa aat

I i li linker-------------------------------------

! EGGGSEGGGS 3384 gag ggt ggt ggc tet gag ggt ggc ggt tet

I

! EGGGSEGGGT 3414 gag ggt ggc ggt tet gag ggt ggc ggt act

I ! Domain 2----— -------------------------—- 3444 aaa eet eet gag tac ggt gat aca eet att ccg ggc tat act tat atc aac 3495 eet etc gac ggc act tat ccg eet ggt act gag caa aac ccc get aat eet 3546 aat eet tet ett GAG GAG tet cag eet ett aat act tte atg ttt cag aat i BseRI_ 3597 aat agg tte ega aat agg cag ggg gea tta act gtt tat aeg ggc act 3645 gtt act caa ggc act gac ccc gtt aaa act tat tac cag tac act eet

3693 gta tea tea aaa gee atg tat gac get tac tgg aac ggt aaa ttC AGA

! AlwNI

3741 GAC TGc get tte cat tet ggc ttt aat gaa gat cca tte gtt tgt gaa i AlwNI 3789 tat caa ggc caa teg tet gac ctg eet caa eet eet gtc aat get

I 3834 ggc ggc ggc tet ! start L2------------------------------------------------------------- 3846 ggt ggt ggt tet 3858 ggt ggc ggc tet 3870 gag ggt ggt ggc tet gag ggt ggc ggt tet 3900 gag ggt ggc ggc tet gag gga ggc ggt tee 3930 ggt ggt ggc tet ggt ! end L2 i ! Domain 3------------------------------------------------------------—

! SGDFDYEKMANANKGA 3945 tee ggt gat ttt gat tat gaa aag atg gea aac get aat aag ggg get

! MTENADENALQSDAKG 3993 atg acc gaa aat gee gat gaa aac geg eta cag tet gac get aaa ggc r

! KLDSVATDYGAAIDGF 4041 aaa ett gat tet gtc get act gat tac ggt get get atc gat ggt tte i

! IGDVSGLANGNGATGD 4089 att ggt gac gtt tee ggc ett get aat ggt aat ggt get act ggt gat ;

! FAGSNSQMAQVGDGD'N 4137 ttt get ggc tet aat tee caa atg get eaa gte ggt gac ggt gat aat

! SPLMNNFRQYLPSLPC 4185 tea eet tta atg aat aat tte egt caa tat tta eet tee etc eet caa 1

! SVE. CRPFVFSAGKPYE 4233 teg gtt gaa tgt cgc cct ttt gtc ttt age get ggt aaa cca tat gaa i

! FSIDCDKINLFR 4281 ttt tet att gat tgt gac aaa ata aac tta tte egt ! End Domain 3 t ! GVFAFLLYVATFMYV F140 4317 ggt gtc ttt gcg ttt ett tta tat gtt gcc acc ttt atg tat gta ttt ! start transmembrane segment

! S T F Ά N I L 4365 tet aeg ttt get aac ata ctg

! R N K E S 4386 egt aat aag gag tet TAA ! stop of iii ! Intracellular anchor. ! Ml P2 V L L5 G I P L LID L R F L G15 4404 te ATG cca gtt ett ttg ggt att ccg tta tta ttg egt tte etc ggt

! Start VI

I 4451 tte ett ctg gta act ttg tte ggc tat ctg ett act ttt ett aaa aag 4499 ggc tte ggt aag ata get att get att tea ttg ttt ett get ett att 4547 att ggg ett aac tea att ett gtg ggt tat etc tet gat att age get 4595 caa tta cce tet gac ttt gtt cag ggt gtt cag tta att etc ccg tet 4643 aat gcg ett cce tgt ttt tat gtt att etc tet gta aag get get att 4691 tte att ttt gac gtt aaa caa aaa atc gtt tet tat ttg gat tgg gat ; ! Ml A2 V3 F5 L10 G13

4739 aaa TAA t ATG get gtt tat ttt gta act ggc aaa tta ggc tet gga ! end VI Start gene I

I ! 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28

! KTLVSVGKIQDKIVA 4785 aag aeg etc gtt age gtt ggt aag att cag gat aaa att gta get

I ! 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 ! gckiatnldlrlqnl 4830 ggg tgc aaa ata gea act aat ett gat tta agg ett caa aac etc

I ! 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

! PQVGRFAKT PRVLRI 4875 ccg caa gtc ggg agg tte get aaa aeg cct cgc gtt ett aga ata ; ! 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73

! PDKPSISDLLAIGRG 4920 ccg gat aag cct tet ata tet gat ttg ett get att ggg cgc ggt

I ! 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88

! NDSYDENKNGLLVLD 4965 aat gat tee tac gat gaa aat aaa aac ggc ttg ett gtt etc gat

I ! 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103

! ECGTWFNTRSWNDKE 5010 gag tgc ggt act tgg ttt aat acc egt tet tgg aat gat aag gaa 1 ! 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118

! RQPIIDWFLHARKLG 5055 aga cag ccg att att gat tgg ttt eta cat get cgt aaa tta gga ! 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133

! WDIIFLVQDLSIVDK 5100 tgg gat att att ttt ctt.gtt cag gac tta tet att gtt gat aaa ! 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148

! QARSALAEHVVYCRR 514 5 cag geg cgt tet gca tta get gaa cat gtt gtt tat tgt cgt cgt ! 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163

! LDRITLPFVGTLYSL 5190 ctg gac aga att act tta cct ttt gtc ggt act tta tat tet ett ; ! 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178

! ITGSKMPLPKLHVGV 5235 att act ggc teg aaa atg cct ctg cct aaa tta cat gtt ggc gtt

I ! 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193

! VKYGDSQLSPTVERW 5280 gtt aaa tat ggc gat tet caa tta age cct act gtt gag cgt tgg ! 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208

! LYTGKNLYNAYDTKQ 5325 ett tat act ggt aag aat ttg tat aac gca tat gat act aaa cag

I ! 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223

! AFSSNYDSGVYSYLT 5370 get ttt tet agt aat tat gat tee ggt gtt tat tet tat tta aeg ! 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238

! PYLSHGRYFKPLNLG 5415 cct tat tta tea cac ggt egg tat ttc aaa cca tta aat tta ggt

I ! 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253

ί QKMKLTKIYLKKFSR 5460 cag aag atg aaa tta act aaa ata tat ttg aaa aag ttt tet ege t ! 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268

! VLCLAIGFASAFTYS 5505 gtt ett tgt ett geg att gga ttt gca tea gca ttt aca tat agt ! 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283

! YITQPKPEVKKVVSQ 5550 tat ata acc caa cct aag ccg gag gtt aaa aag gta gtc tet cag ! 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298

! TYDFDKFTIDS SQRL 5595 acc tat gat ttt gat aaa ttc act att gac tet tet cag cgt ett ! 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313

! NLSYRYVFKDSKGKL

5640 aat eta age tat ege tat gtt ttc aag gat tet aag gga aaa TTA ! PacI j ! 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328

! INSDDLQKQGYSLTY 568 5 ATT AAt age gac gat tta cag aag caa ggt tat tea etc aca tat ! Pad j ! 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343

! ilDLCTVS IKKGN SNE

! iv Ml K

5730 att gat tta tgt act gtt tee att aaa aaa ggt aat tea aAT Gaa ! Start IV 1 ! 344 345 346 347 348 349

! i I V K C N .End of I l iv L3 L N5 V 17 N F V10 5775 att gtt aaa tgt aat TAA T TTT GTT ί IV continued..... 5800 tte ttg atg ttt gtt tea tea tet tet ttt get cag gta att gaa atg 5848 aat aat teg eet ctg ege gat ttt gta act tgg tat tea aag caa tea 5896 ggc gaa tee gtt att gtt tet ccc gat gta aaa ggt act gtt act gta 5944 tat tea tet gac gtt aaa eet gaa aat eta ege aat tte ttt att tet 5992 gtt tta egt get aat aat ttt gat atg gtt ggt tea att eet tee ata 6040 att cag aag tat aat cca aac aat cag gat tat att gat gaa ttg cca 6088 tea tet gat aat cag gaa tat gat gat aat tee get eet tet ggt ggt 6136 tte ttt gtt ccg caa aat gat aat gtt act caa act ttt aaa att aat 6164 aac gtt egg gea aag gat tta ata ega gtt gtc gaa ttg ttt gta aag 6232 tet aat act tet aaa tee tea aat gta tta tet att gac ggc tet aat 6280 eta tta gtt gtt TCT gea eet aaa gat att tta gat aac ett eet caa ! ApaLI removed 6328 tte ett tet act gtt gat ttg cca act gac cag ata ttg att gag ggt 6376 ttg ata ttt gag gtt cag caa ggt gat get tta gat ttt tea ttt get 6424 get ggc tet cag egt ggc act gtt gea ggc ggt gtt aat act gac ege 6472 etc ace tet gtt tta tet tet get ggt ggt teg tte ggt att ttt aat 6520 ggc gat gtt tta ggg eta tea gtt ege gea tta aag act aat age cat 6568 tea aaa ata ttg tet gtg cca egt att ett aeg ett tea ggt cag aag 6616 ggt tet atc tet gtT GGC CAg aat gtc eet ttt att act ggt egt gtg ! Msel_ 6664 act ggt gaa tet gcc aat gta aat aat cca ttt cag aeg att gag egt 6712 caa aat gta ggt att tee atg age gtt ttt eet gtt gea atg get ggc 6760 ggt aat att gtt ctg gat att acc age aag gcc gat agt ttg agt tet 6808 tet act cag gea agt gat gtt att act aat caa aga agt att get aca 6856 aeg gtt aat ttg egt gat gga cag act ett tta etc ggt ggc etc act 6904 gat tat aaa aac act tet caa gat tet ggc gta ccg tte ctg tet aaa 6952 atc eet tta ate ggc etc ctg ttt age tee ege tet gat tee aac gag 7000 gaa age aeg tta tac gtg etc gtc aaa gea acc ata gta ege gcc ctg

7048 TAG eggegeatt ! End IV 7060 aagegeggeg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca gcgccctagc 7120 gcccgctcct ttegetttet tcccttcctt tctcgccacg ttcGCCGGCt ttccccgtca ! NgoMI_ 7180 agctctaaat cgggggctcc ctttagggtt ccgatttagt getttaegge acctcgaccc 7240 caaaaaactt gatttgggtg atggttCACG TAGTGggcca tcgccctgat agaeggtttt ! Drain_ 7300 tcgccctttG ACGTTGGAGT Ccacgttctt taatagtgga ctcttgttcc aaactggaac ! Drdl_ 7360 aacactcaac cctatctcgg gctattcttt tgatttataa gggattttgc egatttegga 7420 accaccatca aaeaggattt tcgcctgctg gggcaaacca gcgtggaccg cttgctgcaa 7480 ctctctcagg gccaggcggt gaagggcaat CAGCTGttgc cCGTCTCact ggtgaaaaga ! PvuII. BsmBI. 7540 aaaaccaccc tGGATCC AAGCTT • BamHI Hindlll (½) ! Insert carrying bla gene 7563 gcaggtg gcacttttcg gggaaatgtg cgcggaaccc

7600 ctatttgttt atttttctaa atacattcaa atatGTATCC gctcatgaga caataaccct ! BciVI 7660 gataaatgct tcaataatat tgaaaaAGGA AGAgt ! RBS.?... ! Start bla gene 7695 ATG agt att caa cat ttc cgt gtc gcc ctt att ccc ttt ttt gcg gca ttt 7746 tgc ctt cct gtt ttt get cac cca gaa aeg ctg gtg aaa gta aaa gat get 7797 gaa gat cag ttg ggC gCA CGA Gtg ggt tac ate gaa ctg gat etc aac age I BssSI.. . ! ApaLI removed 7848 ggt aag ate ctt gag agt ttt ege ccc gaa gaa cgt ttt cca atg atg age 7899 act ttt aaa gtt ctg eta tgt cat aca eta tta tee cgt att gac gcc ggg

7950 caa gaG CAA CTC GGT CGc egg gcg egg tat tet cag aat gac ttg gtt gAG ! Bcgl_ Seal 8001 TAC Tea cca gtc aca gaa aag cat ctt aeg gat ggc atg aca gta aga gaa ! Scal_ 8052 tta tgc agt get gcc ata acc atg agt gat aac act gcg gcc aac tta ctt 8103 ctg aca aCG ATC Gga gga ccg aag gag eta acc get ttt ttg cac aac atg ! Pvul_ 8154 ggg gat cat gta act ege ctt gat cgt tgg gaa ccg gag ctg aat gaa gcc 8205 ata cca aac gac gag cgt gac acc aeg atg cct gta gca atg cca aca aeg 8256 tTG CGC Aaa eta tta act ggc gaa eta ctt act eta get tee egg caa caa ! FspI____ 8307 tta ata gac tgg atg gag gcg gat aaa gtt gca gga cca ctt ctg ege teg 8358 GCC ctt ccG GCt ggc tgg ttt att get gat aaa tet gga gcc ggt gag cgt ! Bgll_ 8409 gGG TCT Cgc ggt ate att gca gca ctg ggg cca gat ggt aag ccc tee cgt ! Bsal 8460 ate gta gtt ate tac aeG ACg ggg aGT Cag gca act atg gat gaa ega aat ! Ahdl_ 8511 aga cag ate get gag ata ggt gcc tea ctg att aag cat tgg TAA ctgt ! stop 8560 cagaccaagt ttactcatat ataetttaga ttgatttaaa acttcatttt taatttaaaa 8620 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 8680 cgttccactg taegtaagae cccc 8704 AAGCTT GTCGAC tgaa tggcgaatgg cgctttgcct l HindHI Sail.. I (2/2) Hindi 8740 ggtttccggc accagaagcg gtgccggaaa gctggctgga gtgegatett

8790 CCTGAGG ! Bsu36l_ 8797 ccgat actgtcgtcg tcccctcaaa ctggcagatg 8832 cacggttacg atgcgcccat ctacaccaac gtaaectate ccattacggt caatccgccg 8892 tttgttccca cggagaatcc gacgggttgt tactcgctca catttaatgt tgatgaaagc 8952 tggctacagg aaggccagae gegaattatt tttgatggcg ttcctattgg ttaaaaaatg 9012 agctgattta acaaaaattt aaegegaatt ttaacaaaat attaacgttt acaATTTAAA ! Swal... 9072 Tatttgetta tacaatcttc ctgtttttgg ggcttttctg attatcaacc GGGGTAcat ! RBS?

9131 ATG att gac atg eta gtt tta ega tta ccg ttc ate gat tet ctt gtt tgc ! Start gene II 9182 tee aga etc tea ggc aat gac ctg ata gcc ttt gtA GAT CTc tea aaa ata ! Bglll... 9233 get acc etc tee ggc atg aat tta tea get aga aeg gtt gaa tat cat att 9284 gat ggt gat ttg act gtc tee ggc ctt tet cac cct ttt gaa tet tta cct 9335 aca cat tac tea ggc att gca ttt aaa ata tat gag ggt tet aaa aat ttt 9386 tat cct tgc gtt gaa ata aag get tet ccc gca aaa gta tta cag ggt cat 9437 aat gtt ttt ggt aca acc gat tta get tta tgc tet gag get tta ttg ctt 9488 aat ttt get aat tet ttg cct tgc ctg tat gat tta ttg gat gtt ! 9532 ! gene II continues

Table 21B: Sequence of MALIA3, condensed

LOCUS MALIA3 9532 CIRCULAR

ORIGIN 1 AATGCTACTA CTATTAGTAG AATTGATGCC accttttcag CTCGCGCCCC aaatgaaaat

61 ATAGCTAAAC AGGTTATTGA CCATTTGCGA AATGTATCTA ATGGTCAAAC TAAATCTACT

121 CGTTCGCAGA ATTGGGAATC AACTGTTACA TGGAATGAAA CTTCCAGACA CCGTACTTTA

161 GTTGCATATT TAAAACATGT TGAGCTACAG CACCAGATTC AGCAATTAAG CTCTAAGCCA

241 TCCGCAAAAA TGACCTCTTA TCAAAAGGAG CAATTAAAGG TACTCTCTAA TCCTGACCTG

361 TCTTTCGGGC TTCCTCTTAA TCTTTTTGAT GCAATCCGCT TTGCTTCTGA CTATAATAGT

421 CAGGGTAAAG ACCTGATTTT TGATTTATGG TCATTCTCGT TTTCTGAACT GTTTAAAGCA

461 TTTGAGGGGG ATTCAATGAA TATTTATGAC GATTCCGCAG TATTGGACGC TATCCAGTCT

541 AAACATTTTA CTATTACCCC CTCTGGCAAA ACTTCTTTTG CAAAAGCCTC TCGCTATTTT

601 GGTTTTTATC GTCGTCTGGT AAACGAGGGT TATGATAGTG TTGCTCTTAC TATGCCTCGT

661 AATTCCTTTT GGCGTTATGT ATCTGCATTA GTTGAATGTG GTATTCCTAA ATCTCAACTG

721 ATGAATCTTT CTACCTGTAA TAATGTTGTT CCGTTAGTTC GTTTTATTAA CGTAGATTTT

781 TCTTCCCAAC GTCCTGACTG GTATAATGAG CCAGTTCTTA AAATCGCATA AGGTAATTCA

841 CAATGATTAA AGTTGAAATT AAACCATCTC AAGCCCAATT TACTACTCGT TCTGGTGTTT

901 CTCGTCAGGG CAAGCCTTAT TCACTGAATG AGCAGCTTTG TTACGTTGAT TTGGGTAATG

961 AATATCCGGT TCTTGTCAAG ATTACTCTTG ATGAAGGTCA GCCAGCCTAT GCGCCTGGTC 1021 TGTACACCGT TCATCTGTCC tctttcaaag TTGGTCAGTT cggttccctt atgattgacc 1081 GTCTGCGCCT cgttccggct aagtaacatg gagcaggtcg CGGATTTCGA cacaatttat

1141 CAGGCGATGA TACAAATCTC CGTTGTACTT TGTTTCGCGC TTGGTATAAT CGCTGGGGGT

1201 CAAAGATGAG TGTTTTAGTG TATTCTTTCG CCTCTTTCGT TTTAGGTTGG TGCCTTCGTA

1261 GTGGCATTAC GTATTTTACC CGTTTAATGG AAACTTCCTC ATGAAAAAGT CTTTAGTCCT

1321 CAAAGCCTCT GTAGCCGTTG CTACCCTCGT TCCGATGCTG TCTTTCGCTG CTGAGGGTGA

1381 CGATCCCGCA AAAGCGGCCT TTAACTCCCT GCAAGCCTCA GCGACCGAAT ATATCGGTTA

1441 TGCGTGGGCG ATGGTTGTTG TCATTGTCGG CGCAACTATC GGTATCAAGC TGTTTAAGAA

1501 ATTCACCTCG AAAGCAAGCT GATAAACCGA TACAATTAAA GGCTCCTTTT GGAGCCTTTT

1561 TTTTTGGAGA TTTTCAACGT GAAAAAATTA TTATTCGCAA TTCCTTTAGT TGTTCCTTTC

1621 TATTCTCACA GTGCACAGTC TGTCGTGACG CAGCCGCCCT CAGTGTCTGG GGCCCCAGGG

1681 CAGAGGGTCA CCATCTCCTG CACTGGGAGC AGCTCCAACA TCGGGGCAGG TTATGATGTA

1741 CACTGGTACC AGCAGCTTCC AGGAACAGCC CCCAAACTCC TCATCTATGG TAACAGCAAT

1601 CGGCCCTCAG GGGTCCCTGA CCGATTCTCT GGCTCCAAGT CTGGCACCTC AGCCTCCCTG

1861 GCCATCACTG GGCTCCAGGC TGAGGATGAG GCTGATTATT ACTGCCAGTC CTATGACAGC

1921 AGCCTGAGTG GCCTTTATGT CTTCGGAACT GGGACCAAGG TCACCGTCCT AGGTCAGCCC

1981 AAGGCCAACC CCACTGTCAC TCTGTTCCCG CCCTCCTCTG AGGAGCTCCA AGCCAACAAG

2041 GCCACACTAG TGTGTCTGAT CAGTGACTTC TACCCGGGAG CTGTGACAGT GGCCTGGAAG

2101 GCAGATAGCA GCCCCGTCAA GGCGGGAGTG GAGACCACCA CACCCTCCAA ACAAAGCAAC

2161 AACAAGTACG CGGCCAGCAG CTATCTGAGC CTGACGCCTG AGCAGTGGAA GTCCCACAGA

2221 AGCTACAGCT GCCAGGTCAC GCATGAAGGG AGCACCGTGG AGAAGACAGT GGCCCCTACA

2281 GAATGTTCAT AATAAACCGC CTCCACCGGG CGCGCCAATT CTATTTCAAG GAGACAGTCA

2341 TAATGAAATA CCTATTGCCT ACGGCAGCCG CTGGATTGTT ATTACTCGCG GCCCAGCCGG

2401 CCATGGCCGA AGTTCAATTG TTAGAGTCTG GTGGCGGTCT TGTTCAGCCT GGTGGTTCTT

2461 TACGTCTTTC TTGCGCTGCT TCCGGATTCA CTTTCTCTTC GTACGCTATG TCTTGGGTTC

2521 GCCAAGCTCC TGGTAAAGGT TTGGAGTGGG TTTCTGCTAT CTCTGGTTCT GGTGGCAGTA

2581 CTTACTATGC TGACTCCGTT AAAGGTCGCT TCACTATCTC TAGAGACAAC TCTAAGAATA

2641 CTCTCTACTT GCAGATGAAC AGCTTAAGGG CTGAGGACAC TGCAGTCTAC TATTGCGCTA

2701 AAGACTATGA AGGTACTGGT TATGCTTTCG ACATATGGGG TCAAGGTACT ATGGTCACCG

2761 TCTCTAGTGC CTCCACCAAG GGCCCATCGG TCTTCCCCCT GGCACCCTCC TCCAAGAGCA

2821 CCTCTGGGGG CACAGCGGCC CTGGGCTGCC TGGTCAAGGA CTACTTCCCC GAACCGGTGA

2881 CGGTGTCGTG GAACTCAGGC GCCCTGACCA GCGGCGTCCA CACCTTCCCG GCTGTCCTAC

2941 AGTCTAGCGG ACTCTACTCC CTCAGCAGCG TAGTGACCGT GCCCTCTTCT AGCTTGGGCA

3001 CCCAGACCTA CATCTGCAAC GTGAATCACA AGCCCAGCAA CACCAAGGTG GACAAGAAAG

3061 TTGAGCCCAA ATCTTGTGCG GCCGCTCATC ACCACCATCA TCACTCTGCT GAACAAAAAC

3121 TCATCTCAGA AGAGGATCTG AATGGTGCCG CAGATATCAA CGATGATCGT ATGGCTGGCG

3181 CCGCTGAAAC TGTTGAAAGT TGTTTAGCAA AACCCCATAC AGAAAATTCA TTTACTAACG

3241 TCTGGAAAGA CGACAAAACT TTAGATCGTT ACGCTAACTA TGAGGGTTGT CTGTGGAATG

3301 CTACAGGCGT TGTAGTTTGT ACTGGTGACG AAACTCAGTG TTACGGTACA TGGGTTCCTA 3361 TTGGGCTTGC TATCCCTGAA AATGAGGGTG GTGGCTCTGA GGGTGGCGGT TCTGAGGGTG 3421 GCGGTTCTGA GGGTGGCGGT ACTAAACCTC CTGAGTACGG TGATACACCT ATTCCGGGCT 3481 ATACTTATAT CAACCCTCTC GACGGCACTT ATCCGCCTGG TACTGAGCAA AACCCCGCTA 3541 ATCCTAATCC TTCTCTTGAG GAGTCTCAGC CTCTTAATAC TTTCATGTTT CAGAATAATA 3601 GGTTCCGAAA TAGGCAGGGG GCATTAACTG TTTATACGGG CACTGTTACT CAAGGCACTG 3661 ACCCCGTTAA AACTTATTAC CAGTACACTC CTGTATCATC AAAAGCCATG TATGACGCTT 3721 ACTGGAACGG TAAATTCAGA GACTGCGCTT TCCATTCTGG CTTTAATGAA GATCCATTCG 3781 TTTGTGAATA TCAAGGCCAA TCGTCTGACC TGCCTCAACC TCCTGTCAAT GCTGGCGGCG 3841 GCTCTGGTGG TGGTTCTGGT GGCGGCTCTG AGGGTGGTGG CTCTGAGGGT GGCGGTTCTG 3901 AGGGTGGCGG CTCTGAGGGA GGCGGTTCCG GTGGTGGCTC TGGTTCCGGT GATTTTGATT 3961 ATGAAAAGAT GGCAAACGCT AATAAGGGGG CTATGACCGA AAATGCCGAT GAAAACGCGC 4021 TACAGTCTGA CGCTAAAGGC AAACTTGATT CTGTCGCTAC TGATTACGGT GCTGCTATCG 4081 ATGGTTTCAT TGGTGACGTT TCCGGCCTTG CTAATGGTAA TGGTGCTACT GGTGATTTTG 4141 CTGGCTCTAA TTCCCAAATG GCTCAAGTCG GTGACGGTGA TAATTCACCT TTAATGAATA 4201 ATTTCCGTCA ATATTTACCT TCCCTCCCTC AATCGGTTGA ATGTCGCCCT TTTGTCTTTA 4261 GCGCTGGTAA ACCATATGAA TTTTCTATTG ATTGTGACAA AATAAACTTA TTCCGTGGTG 4321 TCTTTGCGTT TCTTTTATAT GTTGCCACCT TTATGTATGT ATTTTCTACG TTTGCTAACA 4381 TACTGCGTAA TAAGGAGTCT TAATCATGCC AGTTCTTTTG GGTATTCCGT TATTATTGCG 4441 TTTCCTCGGT TTCCTTCTGG TAACTTTGTT CGGCTATCTG CTTACTTTTC TTAAAAAGGG 4501 CTTCGGTAAG ATAGCTATTG CTATTTCATT GTTTCTTGCT CTTATTATTG GGCTTAACTC 4561 AATTCTTGTG GGTTATCTCT CTGATATTAG CGCTCAATTA CCCTCTGACT TTGTTCAGGG 4621 TGTTCAGTTA ATTCTCCCGT CTAATGCGCT TCCCTGTTTT TATGTTATTC TCTCTGTAAA 4681 GGCTGCTATT TTCATTTTTG ACGTTAAACA AAAAATCGTT TCTTATTTGG ATTGGGATAA 4741 ATAATATGGC TGTTTATTTT GTAACTGGCA AATTAGGCTC TGGAAAGACG CTCGTTAGCG 4801 TTGGTAAGAT TCAGGATAAA ATTGTAGCTG GGTGCAAAAT AGCAACTAAT CTTGATTTAA 4861 GGCTTCAAAA CCTCCCGCAA GTCGGGAGGT TCGCTAAAAC GCCTCGCGTT CTTAGAATAC 4921 CGGATAAGCC TTCTATATCT GATTTGCTTG CTATTGGGCG CGGTAATGAT TCCTACGATG 4981 AAAATAAAAA CGGCTTGCTT GTTCTCGATG AGTGCGGTAC TTGGTTTAAT ACCCGTTCTT 5041 GGAATGATAA GGAAAGACAG CCGATTATTG ATTGGTTTCT ACATGCTCGT AAATTAGGAT 5101 GGGATATTAT TTTTCTTGTT CAGGACTTAT CTATTGTTGA TAAACAGGCG CGTTCTGCAT 5161 TAGCTGAACA TGTTGTTTAT TGTCGTCGTC TGGACAGAAT TACTTTACCT TTTGTCGGTA 5221 CTTTATATTC TCTTATTACT GGCTCGAAAA TGCCTCTGCC TAAATTACAT GTTGGCGTTG 5281 TTAAATATGG CGATTCTCAA TTAAGCCCTA CTGTTGAGCG TTGGCTTTAT ACTGGTAAGA 5341 ATTTGTATAA CGCATATGAT ACTAAACAGG CTTTTTCTAG TAATTATGAT TCCGGTGTTT 5401 ATTCTTATTT AACGCCTTAT TTATCACACG GTCGGTATTT CAAACCATTA AATTTAGGTC 5461 AGAAGATGAA ATTAACTAAA ATATATTTGA AAAAGTTTTC TCGCGTTCTT TGTCTTGCGA 5521 TTGGATTTGC ATCAGCATTT ACATATAGTT ATATAACCCA ACCTAAGCCG GAGGTTAAAA 5581 AGGTAGTCTC TCAGACCTAT GATTTTGATA AATTCACTAT TGACTCTTCT CAGCGTCTTA 5641 ATCTAAGCTA TCGCTATGTT TTCAAGGATT CTAAGGGAAA ATTAATTAAT AGCGACGATT 5701 TACAGAAGCA AGGTTATTCA CTCACATATA TTGATTTATG TACTGTTTCC ATTAAAAAAG 5761 GTAATTCAAA TGAAATTGTT AAATGTAATT AATTTTGTTT TCTTGATGTT TGTTTCATCA 5821 TCTTCTTTTG CTCAGGTAAT TGAAATGAAT AATTCGCCTC TGCGCGATTT TGTAACTTGG 5881 TATTCAAAGC AATCAGGCGA ATCCGTTATT GTTTCTCCCG ATGTAAAAGG TACTGTTACT 5941 GTATATTCAT CTGACGTTAA ACCTGAAAAT CTACGCAATT TCTTTATTTC TGTTTTACGT 6001 GCTAATAATT TTGATATGGT TGGTTCAATT CCTTCCATAA TTCAGAAGTA TAATCCAAAC 6061 AATCAGGATT ATATTGATGA ATTGCCATCA TCTGATAATC AGGAATATGA TGATAATTCC 6121 GCTCCTTCTG GTGGTTTCTT TGTTCCGCAA AATGATAATG TTACTCAAAC TTTTAAAATT 6181 AATAACGTTC GGGCAAAGGA TTTAATACGA GTTGTCGAAT TGTTTGTAAA GTCTAATACT 6241 TCTAAATCCT CAAATGTATT ATCTATTGAC GGCTCTAATC TATTAGTTGT TTCTGCACCT 6301 AAAGATATTT TAGATAACCT TCCTCAATTC CTTTCTACTG TTGATTTGCC AACTGACCAG 6361 ATATTGATTG AGGGTTTGAT ATTTGAGGTT CAGCAAGGTG ATGCTTTAGA TTTTTCATTT 6421 GCTGCTGGCT CTCAGCGTGG CACTGTTGCA GGCGGTGTTA ATACTGACCG CCTCACCTCT 6481 GTTTTATCTT CTGCTGGTGG TTCGTTCGGT ATTTTTAATG GCGATGTTTT AGGGCTATCA 6541 GTTCGCGCAT TAAAGACTAA TAGCCATTCA AAAATATTGT CTGTGCCACG TATTCTTACG 6601 CTTTCAGGTC AGAAGGGTTC TATCTCTGTT GGCCAGAATG TCCCTTTTAT TACTGGTCGT 6661 GTGACTGGTG AATCTGCCAA TGTAAATAAT CCATTTCAGA CGATTGAGCG TCAAAATGTA 6721 GGTATTTCCA TGAGCGTTTT TCCTGTTGCA ATGGCTGGCG GTAATATTGT TCTGGATATT

6781 ACCAGCAAGG CCGATAGTTT GAGTTCTTCT ACTCAGGCAA GTGATGTTAT TACTAATCAA 6841 AGAAGTATTG CTACAACGGT TAATTTGCGT GATGGACAGA CTCTTTTACT CGGTGGCCTC 6901 ACTGATTATA AAAACACTTC TCAAGATTCT GGCGTACCGT TCCTGTCTAA AATCCCTTTA 6961 ATCGGCCTCC TGTTTAGCTC CCGCTCTGAT TCCAACGAGG AAAGCACGTT ATACGTGCTC 7021 GTCAAAGCAA CCATAGTACG CGCCCTGTAG CGGCGCATTA AGCGCGGCGG GTGTGGTGGT 7081 TACGCGCAGC GTGACCGCTA CACTTGCCAG CGCCCTAGCG CCCGCTCCTT TCGCTTTCTT 7141 CCCTTCCTTT CTCGCCACGT TCGCCGGCTT TCCCCGTCAA GCTCTAAATC GGGGGCTCCC 7201 TTTAGGGTTC CGATTTAGTG CTTTACGGCA CCTCGACCCC AAAAAACTTG ATTTGGGTGA 7261 TGGTTCACGT AGTGGGCCAT CGCCCTGATA GACGGTTTTT CGCCCTTTGA CGTTGGAGTC 7321 CACGTTCTTT AATAGTGGAC TCTTGTTCCA AACTGGAACA ACACTCAACC CTATCTCGGG 7381 CTATTCTTTT GATTTATAAG GGATTTTGCC GATTTCGGAA CCACCATCAA ACAGGATTTT 7441 CGCCTGCTGG GGCAAACCAG CGTGGACCGC TTGCTGCAAC TCTCTCAGGG CCAGGCGGTG 7501 AAGGGCAATC AGCTGTTGCC CGTCTCACTG GTGAAAAGAA AAACCACCCT GGATCCAAGC 7561 TTGCAGGTGG CACTTTTCGG GGAAATGTGC GCGGAACCCC TATTTGTTTA TTTTTCTAAA 7621 TACATTCAAA TATGTATCCG CTCATGAGAC AATAACCCTG ATAAATGCTT CAATAATATT 7681 GAAAAAGGAA GAGTATGAGT ATTCAACATT TCCGTGTCGC CCTTATTCCC TTTTTTGCGG 7741 CATTTTGCCT TCCTGTTTTT GCTCACCCAG AAACGCTGGT GAAAGTAAAA GATGCTGAAG 7801 ATCAGTTGGG CGCACGAGTG GGTTACATCG AACTGGATCT CAACAGCGGT AAGATCCTTG 7861 AGAGTTTTCG CCCCGAAGAA CGTTTTCCAA TGATGAGCAC TTTTAAAGTT CTGCTATGTC 7921 ATACACTATT ATCCCGTATT GACGCCGGGC AAGAGCAACT CGGTCGCCGG GCGCGGTATT 7981 CTCAGAATGA CTTGGTTGAG TACTCACCAG TCACAGAAAA GCATCTTACG GATGGCATGA 8041 CAGTAAGAGA ATTATGCAGT GCTGCCATAA CCATGAGTGA TAACACTGCG GCCAACTTAC 8101 TTCTGACAAC GATCGGAGGA CCGAAGGAGC TAACCGCTTT TTTGCACAAC ATGGGGGATC 8161 ' ATGTAACTCG CCTTGATCGT TGGGAACCGG AGCTGAATGA AGCCATACCA AACGACGAGC 8221 GTGACACCAC GATGCCTGTA GCAATGCCAA CAACGTTGCG CAAACTATTA ACTGGCGAAC 8281 TACTTACTCT AGCTTCCCGG CAACAATTAA TAGACTGGAT GGAGGCGGAT AAAGTTGCAG 8341 GACCACTTCT GCGCTCGGCC CTTCCGGCTG GCTGGTTTAT TGCTGATAAA TCTGGAGCCG 8401 GTGAGCGTGG GTCTCGCGGT ATCATTGCAG CACTGGGGCC AGATGGTAAG CCCTCCCGTA 8461 TCGTAGTTAT CTACACGACG GGGAGTCAGG CAACTATGGA TGAACGAAAT AGACAGATCG 8521 CTGAGATAGG TGCCTCACTG ATTAAGCATT GGTAACTGTC AGACCAAGTT TACTCATATA 8581 TACTTTAGAT TGATTTAAAA CTTCATTTTT AATTTAAAAG GATCTAGGTG AAGATCCTTT 8641 TTGATAATCT CATGACCAAA ATCCCTTAAC GTGAGTTTTC GTTCCACTGT ACGTAAGACC 8701 CCCAAGCTTG TCGACTGAAT GGCGAATGGC GCTTTGCCTG GTTTCCGGCA CCAGAAGCGG 8761 TGCCGGAAAG CTGGCTGGAG TGCGATCTTC CTGAGGCCGA TACTGTCGTC GTCCCCTCAA 8821 ACTGGCAGAT GCACGGTTAC GATGCGCCCA TCTACACCAA CGTAACCTAT CCCATTACGG 8881 TCAATCCGCC GTTTGTTCCC ACGGAGAATC CGACGGGTTG TTACTCGCTC ACATTTAATG 8941 TTGATGAAAG CTGGCTACAG GAAGGCCAGA CGCGAATTAT TTTTGATGGC GTTCCTATTG 9001 GTTAAAAAAT GAGCTGATTT AACAAAAATT TAACGCGAAT TTTAACAAAA TATTAACGTT 9061 TACAATTTAA ATATTTGCTT ATACAATCTT CCTGTTTTTG GGGCTTTTCT GATTATCAAC 9121 CGGGGTACAT ATGATTGACA TGCTAGTTTT ACGATTACCG TTCATCGATT CTCTTGTTTG 9181 CTCCAGACTC TCAGGCAATG ACCTGATAGC CTTTGTAGAT CTCTCAAAAA TAGCTACCCT 9241 CTCCGGCATG AATTTATCAG CTAGAACGGT TGAATATCAT ATTGATGGTG ATTTGACTGT 9301 CTCCGGCCTT TCTCACCCTT TTGAATCTTT ACCTACACAT TACTCAGGCA TTGCATTTAA 9361 AATATATGAG GGTTCTAAAA ATTTTTATCC TTGCGTTGAA ATAAAGGCTT CTCCCGCAAA 9421 AGTATTACAG GGTCATAATG TTTTTGGTAC AACCGATTTA GCTTTATGCT CTGAGGCTTT 9481 ATTGCTTAAT TTTGCTAATT CTTTGCCTTG CCTGTATGAT TTATTGGATG TT

Table 22: Primers used in RACE amplification:

Table 24: PCR program for amplification of kappa DNA

Table 25: h34D1*h2 captured ViaCJ with BsraAI ! 1 2 3 4 5 6 7 8 9 10 It 12 13 14 15 1SAQDIQMTQSPATLS aGT GCA Caa gac ate eag atg acc cag tet cca gee ace ctg tet ! ApaLI... a gee acc ! L25,L6fL20,L2,L16,AU ! Extender....»...........................Bridge... ! 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 1VSPGERATLSCRASQ gtg tet cca ggg gaa agg gee acc etc tee tgc agg gee agt cag ! 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 1SVSNNLAWY- QQKPGQ agt gtt agt aac aac tta gee tgg tac cag cag aaa cct ggc cag ! 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 1VPRLLIYGASTRATD gtt ccc agg etc etc ate tat ggt gea tee acc agg gee act gat ! 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 IIPARFSGSGSGTDFT ate cca gee agg ttc agt ggc agt ggg tet ggg aca gac ttc act ! 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 ILTISRLEPEDFAVYY etc acc ate age aga ctg gag cct gaa gat ttt gea gtg tat tac ! 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 1CQRYGSSPGWTFGQG tgt cag egg tat ggt age tea ccg ggg tgg aeg ttc ggc caa ggg ! 106 107 108 109 110 111112 113 114 115 116 117 118 119 120 ITKVEIKRTVAAPSVF acc aag gtg gaa ate aaa ega act gtg get gea cca tet gtc ttc ! 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 UFPPSDEQLKSGTAS ate ttc ccg cca tet gat gag cag ttg aaa tet gga act gee tet ! 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 iVVCLLNNFYPREAKV gtt gtg tgc ctg ctg aat aac ttc tat ccc aga gag gee aaa gta ! 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 iQWKVDNALQSGNSQE cag tgg aag gtg gat aac gee etc caa teg ggt aac tee cag gag ! 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 !SVTEQDSKDSTYSLS agt gtc aca gag cag gac age aag gac age acc tac age etc age ! 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 ISTLTLSKADYEKHKV age acc ctg aeg ctg age aaa gea gac tac gag aaa cac aaa gtc ! 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 IYACEVTHQGLSSPVT tac gee tgc gaa gtc acc cat cag ggc ctg age teg cct gtc aca 1211212213 214 215 216 217 218 219 220 221 222 223 1KSFNKGECKGEFA aag age ttc aac aaa gga gag tgt aag ggc gaa ttc gc.....

Table 26: h3401-d8 KAPPA captured with CJ and BsmAl ! 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 fSAQDIQMTQSPATLS aGT GCA Caa gac ate cag atg acc cag tet eel gee ace ctg tet

! ApaLL.Extender........................a gee acc ! L25,L6,L20,L2,L16,AU ! A GCCACC CTG TCT ! L2 ! 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 ivspgeratlscrasq gtg tet cca ggt gaa aga gee acc etc tec tgc agg gee agt cag ! GTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC ! L2 Ϊ 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 INLLSNLAWYQQKPGQ aat ett etc age aac tta gee tgg tac cag cag aaa eel ggc cag ! 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 IAPRLLIY GASTGAIG get ccc agg etc etc ate tat ggt get tee acc ggg gee att ggt ! 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 UPARFSGSGSGTEFT ate cca gee agg ttc agt ggc agt ggg tet ggg aca gag ttc act ! 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 ILTISSLQSEDFAVYF etc acc ate age age ctg cag tet gaa gat ttt gca gtg tat ttc ! 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 ICQQYGTSPPTFGGGT tgt cag cag tat ggt acc tea ccg ccc act ttc ggc gga ggg acc ! 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 IKVEIKRTVAAPSVFl aag gtg gag ate aaa ega act gtg get gca cca tet gtc ttc ate ! 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 1FPPSDEQLKSGTASV ttc ccg cca tet gat gag cag ttg aaa tet gga act gee tet gtt ! 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 IVCPLNNFYPREAKVQ gtg tgc ccg ctg aat aac ttc tat ccc aga gag gee aaa gta cag ! 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 1WKVDNALQSGNSQES tgg aag gtg gat aac gee etc caa teg ggt aac tee cag gag agt ! 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 IVTEQDNKDSTY SLSS gtc aca gag cag gac aac aag gac age acc tac age etc age age ! 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 JTLTLSKVDYEKHEVY acc ctg aeg ctg age aaa gta gac tac gag aaa cac gaa gtc tac ! 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 1ACEVTHQGLSSPVTK gee tgc gaa gtc acc cat cag ggc ett age teg ccc gtc aeg aag ! 211 212 213 214 215 216 217 218 219 220 221 222 223 1SFNRGECKKEFV age ttc aac agg gga gag tgt aag aaa gaa ttc gtt t

Table 27: V3-23 VH framework with variegated codons shown ! ! 17 18 19 20 21 22

ί A Q P A M A S'»ctg let eaa cG GCC cag ccG GCC atg gcc 29 3'-gac aga ett gc egg glc ggc egg lac egg » Scab.........Sill............. ! NgoMI... ! Ncol.... » ! FRl(DP47/V3-23)—.--- ! 23 24 25 26 27 28 29 30

! EVQLLESG gaa|gtt|CAA|TTG|tta|gag|tct|ggt| 53 ! ctt|caa}gtt|aac|aat|ctc|aga|cca|

! I Mfel I

I ! -------FR1---------------------- ! 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

! GGLVQPGGSLRLSCA lEge|get|ctt|gtt|cag|cct|gEt|egtltctLtta|CEUctt|tct)igc|gctl 98 ! |ccg|cca|gaa|caa|gtc|gga|cca|cca|aga|aat|gca|gaa|agfl[acg|cga| t ! Sites to be varied—> ·*♦ *** ·*· ! —FR1--->|...CDR1................|—FR2- ! 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

! ASGFTFSSYAMSWVR

IgctlTCCIGCAIttelactlttcItctltCGITAClGctlatgltctltgglgttlceCI 143 ! |cga|agg|cct|aag|tga|aag|agajagcjatg|cga|tac|ag*4cc|caa|gcg| ! I BspEI I iBsiWlj [BstXl. » ! Sites to be varies—> *** *·* *·· I -FR2----->|...CDR2......... ! 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75

! QAPGKGLEWVSAISG ! |gtt|cga|gga|cca|tttjcca[aac|ctc|acc|caa|ag^cga|tag|agajcca|

! ...BstXl I ; ; ··* *** ! .....CDR2............................................1--FR3— ! 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

! SGGSTYYADSVKGRF ltctlggtlggdagtlactltacltatlgctlgacltcclgttlaaalggtlcgclnc) 233 1 |aga|cca|ccg|tcaltgajatg|au|cgaictg|agg]eaa|ttt|cca|gcglaag| t » -FR3--------------------- ! 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105

! T1SRDNSKNTLYLQM |act|atc|TCT|AGA|gac|aac|tct|aag|aat|act|ctc|taclttg|cag|atg| 278 ί |tga|tag|aga[tct|ctg|ttg|aga|ttc|tta|tga|gag|atglaac|gtc|tac|

! |Xbal I

I ! —FR3-------------------->| ! 106 107 108 109 110 111 Π2 113 114 115 116 117118 119 120

! NSLRAEDTAVYYCAK laaclagCITTAIACglgctlgaglgadflCTIGCAIGtdtacItatltgclgctlaaal 323 ' |ttg|tcg|aat|tcc|cga|ctc|ctg|tg&amp;|cgt|cag|atg|ata|acg|cga|m|

! (AMI I I Pst! I

I ! .......CDR3.................1—FR4------ ! 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135

! DYEOTGYAFDIWGQO leadtat|gaa|ggt[act|ggtltatlgctlttclgaCIATAITGg1ggtkaa|ggtl 368 ! |ctg|ata|ctt|cca|lga|ccajatafcga|aag|ctg|tat|acc|cca|gtt|cca)

! I Ndel I

I t---FR4---->| [ 136 137 138 139 140 141 142

[ T Μ V T V S S

(actJatG|GTC|ACC|gtc|tct]agt- 389 > |tga|tac|cag|tgg|cag|aga|tca· i I BstElI I j ! 143 144 145 146 147 148 149 150 151 152

! ASTKGPSVFP gcc tcc acc aaG GGC CCa tcg GTC TTC ccc-3’ 419 ; cgg agg tee ttc ccg ggt age cag aae ggg-5' ! Bspl201. BbsI...(2/2) ! Apal,... (SFPRMET) 5'-ctg tet gaa cG GCC cag ccG-3' (TOPFRI A) 5’*ctg tet gaa cG GCC cag ccG GCC atg gcc-gaa|gtt|CAA|TTG|tta|gag|lct|ggt|-!sI ctt| gtt I cag|cct| ggt| egti tct| t ta~3* (BOTFR1B) 3’-caa|gtc|gga|cca|ccajaga|aat|gcatgaalaga|acg|cga]- |cga]agg|cct|aag|tga|aag-5*! bottom strand (BOTFR2) 3'-ace|caa|gcg[- |gt*lc6alggalccaltt(!ccalfla*!|ctc|acc|caa[aga|-5'! bottom strand (BOTFR3) 3’- a]cga|ctg|agg|caa|ttt|cca|gcg|aag|- |tga|tag|aga|tct|ctg|ttg|aga|ttc|tta|tga|gag]atg|aac|gtc|tac|- |ttg|tcg|aat|tcc|cga[ctc|ctg|tga«5' (F06) 5'-gCjTTA]AGg|gctjgag|gac|aCT|GCA|Gtc|tac|tat|tgc|gct|aaa|-|gac|tat|gaa|ggt|act|ggt|tat|gct]ttclgaC|ATA|TGg|ggt|c-3’ (BOTFR4) 3'-cga|aaglctg|tat|acc|cca|gtt|cca|-|tga|tac)cag|tgg|cag|agfl]tca* cgg agg tgg ttc ccg ggt age cag aag ggg-5*! bottom strand (BOTPRCPRJM) 3’-gg ttc ccg ggt age cag aag ggg-S* j ! CDR1 diversity j (ON-vgC 1) 5'*lgctlTCC|GGAjttc|act|ttc!tct|< 1 >|TACI<1 >|atg[<l >+ 1 CDRlZ.. ........6859 ltgg|gttlcgCICAalECtlccTIGG»3’ i !<1> stands for an equimolar mix of {ADEFGHIKLMNPQRSTVWY}; no C ! (this is not a sequence) f ! CDR2 diversity

I (ON-vgC2) 5’-ggt|ttg|gag|tgg|gtt|tct|<2>|atc|<2>|<3>|- ! CDR2............ |tct|ggt|ggc|<l>|act|<l>jtat|gct|gac|tcc[gtt|aaa|gg-3‘ ! CDR2................................................

! <1> is an equimolar mixture of {ADEFGHIKLMNPQRSTVWY}; no C ! <2> is an equimolar mixture of {YRWVGS}; no ACDEFHIKLMNPQT

! <3> is an equimolar mixture of {PS}; no ACDEFGH1KLMNQRTVWY

Table 28: Sniffer used in VH

1 TCCGGAGCTT CAGATCTGTT TGCCTTTTTG TGGGGTGGTG CAGATCGCGT TACGGAGATC 61 GACCGACTGC TTGAGCAAAA GCCACGCTTA ACTGCTGATC AGGCATGGGA TGTTATTCGC 121 CAAACCAGTC GTCAGGATCT TAACCTGAGG CTTTTTTTAC CTACTCTGCA AGCAGCGACA 181 TCTGGTTTGA CACAGAGCGA TCCGCGTCGT CAGTTGGTAG AAACATTAAC ACGTTGGGAT 241 GGCATCAATT TGCTTAATGA TGATGGTAAA ACCTGGCAGC AGCCAGGCTC TGCCATCCTG 301 AACGTTTGGC TGACCAGTAT GTTGAAGCGT ACCGTAGTGG CTGCCGTACC TATGCCATTT 361 GATAAGTGGT ACAGCGCCAG TGGCTACGAA ACAACCCAGG ACGGCCCAAC TGGTTCGCTG 421 AATATAAGTG TTGGAGCAAA AATTTTGTAT GAGGCGGTGC AGGGAGACAA ATCACCAATC 481 CCACAGGCGG TTGATCTGTT TGCTGGGAAA CCACAGCAGG AGGTTGTGTT GGCTGCGCTG 541 GAAGATACCT GGGAGACTCT TTCCAAACGC TATGGCAATA ATGTGAGTAA CTGGAAAACA 601 CCTGCAATGG CCTTAACGTT CCGGGCAAAT AATTTCTTTG GTGTACCGCA GGCCGCAGCG 661 GAAGAAACGC GTCATCAGGC GGAGTATCAA AACCGTGGAA CAGAAAACGA TATGATTGTT 721 TTCTCACCAA CGACAAGCGA TCGTCCTGTG CTTGCCTGGG ATGTGGTCGC ACCCGGTCAG 781 AGTGGGTTTA TTGCTCCCGA TGGAACAGTT GATAAGCACT ATGAAGATCA GCTGAAAATG 841 TACGAAAATT TTGGCCGTAA GTCGCTCTGG TTAACGAAGC AGGATGTGGA GGCGCATAAG 901 GAGTCGTCTA GA

Table 29: DMA sequence of pCESS ! pCESS 6680 bases ~ pCes4 with stuffers in C DR 1-2 and CDR3 2000.12.13 ! !Ngene= 6680 ! Useful REs (cut MAnoLI fewer than 3 times) 2000.06.05 r ! Non«cutters !Acc65l Gglacc Afel AGCgcl Avrll Cctagg JBsaBl GATNNnnatc BsiWl Cgtacg BsmFl Nnnnnnnnnnnnnnngtccc IBsrGI Tgtaca BstAPI GCANNNNntgc BstBI TTcgaa !BstZ17IGTAtac BtrICACgtg Eel 1361 GAGctc ! EcoRV GATatc Fsel GGCCGGcc Kpnl GGTACc IMscl TGGcca Nrul TCGcga Nsil ATGCAt !PacI TTAATtaa Pmel GTTTaaac Pmll CACgtg IPpuMI RGgwccy PshAI GACNNnngtc Sad GAGCTc ! SacII CCGCgg Sbfl CCTGCAgg SexAl Accwggt ! Sgfl GCGATcgc SnaBl TACgta Spel Aclagt !Sphl GCATGc Ssc8387I CCTGCAgg Stul AGGcct ISwal ATTTaaat XmalCccggg ! cutters ! Enzymes that cut more than 3 times. tAlwNI CAGNNNctg 5 IBsglctgcac 4 •BsrFI Rccggy 5 !EarI CTCTTCNnnn 4 IFaul nNNNNNNGCGGG 10

I ! Enzymes that cut from 1 to 3 times. j !EcoOI09I RGgnccy 3 7 2636 4208 ! BssSI Ctcgtg I 12 r-". Cacgag 1 1703 IBspHl Tcatga 3 43 148 1156 lAatll GACGTc 1 65 »BciVJ GTATCCNNNNNN 2 140 1667 !Eco57l CTGAAG I 301 cttcag 2 1349 •AvalCycgrg 3 319 2347 6137 IBsIHKAl GWGCWc 3 401 2321 4245 IHgiAI GWGCWc 3 401 2321 4245 IBcgl gcannnnnnlcg I 461 •Seal AGTact 1 505 •Pvul CGATcg 3 616 3598 5926 IFspl TGCgca 2 763 5946 IBgll GCCNNNNnggc 3 864 2771 5952 IBpml CTGGAG 1 898 ctccag I 4413 IBsal GGTCTCNnnnn I 916 !Ahdl GACNNNnngtc I 983 ?EamJJ05lGACNNNnngtc 1 983 iDrdl GACNNNNnngtc 3 1768 6197 6579 ISapl gaagagc 1 1998 IPvull CAGctg 3 2054 3689 5896 ΙΡΠΜΙ CCANNNNntgg 3 2233 3943 3991 iHindlll Aagctt 1 2235 !ApaLIGlgcac 1 2321 IBspMl Nnnnnnnnngcaggt I 2328 ACCTGCNNNNn 2 3460 IPsll CTGCAg I 2335 •Accl GTmkac 2 2341 2611 •Hindi GTYrac 2 2341 3730 •Sall Gtcgac 1 2341 ITlil Ctcgag 1 2347 IXhol Ctcgag 1 2347 IBbsl gtcttc 2 2383 4219 !BlpJ GCtnagc 1 2580 lEspl GCtnagc I 2580 ISgrAI CRccggyg I 2648 •Agel Accggt 2 2649 4302 !Asci GGcgcgcc l 2689 IBssHlI Gcgcgc 1 2690 !$ΠΙ GCCCNNNNngg« I 2770 INael GCCggc 2 2776 6349 JNgoMIV Gccggc 2 2776 6349 !Btgl Ccrygg 3 2781 3553 5712 !Dsal Ccrygg 3 2781 3553 5712 INcol Ccatgg t 2781 JStyl Ccwwgg 3 2781 4205 4472 IMfelCaattg I 2795 iBspEI Tccgga 1 2861 !Bglll Agatct 1 2872 ! Betl Tgatca I 2956 !Bsu36ICCtnagg 3 3004 4143 4373 iXtml CCANNNNNnnnntgg 1 3215 !Mlul Acgcgt 1 3527 !Hpal GTTaac 1 3730 'XbalTctaga 1 3767 t !AflII Cttaag ( 3811 !BsmI NGcattc 1 3821 GAATGCN 1 4695 !Rsr(l CGgwccg 1 3827 !NheI Cctagc 1 4166 IBstEll Ggtnacc 1 4182 IBsmBl CGTCTCNnnnn 2 4188 6625

Nnnnnngagacg I 6673 lApal GGGCCc I 4209 IBanllGRGCYc 3 4209 4492 6319 !Bspl20l Gggece I 4209 IPspOMl Gggccc I 4209 IBseRI NNnnnnnnnnctcctc I 4226 !«"· GAGGAGNNNNNNNNNN 1 4957 JEcoNICCTNNnnnagg I 4278 IPflFl GACNnnglc 1 4308 ITthI III GACNnngtc 1 4308 fKasl Ggcgcc 2 4327 5967 IBstXl CCANNNNNntgg 1 4415 INotl GCggccgc 1 4507 !Eagl Cggccg 1 4508 IBamHI Ggatcc I S169 .'BspDl ATcgat 1 S476 !NdeI CAtatg I 5672 lEcoRIGaattc 1 5806 IPsil TTAtaa 1 6118 !DraIIICACNNNgtg I 6243 . IBsaAI YACglr 1 6246 !---------------------------------------------------------- 1 gacgaaaggg cCTCGTGata cgcctatttt tataggttaa tglcatgata alaatggttt ! BssSt.(1/2) 61 ctuGACGTC aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt ! Aatll. 121 tctaaataca ttcaaatatG TATCCgctca tgagacaata accctgataa atgcttcaat ! BciVI„(I of2) 181 aatattgaaa aaggaagagt I Base# 201 to 1061 = ApR gene from pUCI 19 with some RE sites removed ; ! 1 2 3 4 5 6 7 8 9 10 II 12 13 14 15

! fMSIQHFRVALIPFFA 201 atg agt att caa cat ttc cgt gtc gcc ctt att ccc ttt ttt gcg

I ! 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

! AFCLPVFAHPETLVK 246 gca ttt tgc ctt cct gtt ttt get cac cca gaa aeg ctg gtg aaa 1 ! 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

! VKDAEDQIGARVGYI 291 gta aaa gat get gaa gat cag ttg ggt gcc ega gtg ggt tac ate 1 ! 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

! ELDLNSGKILESFRP 336 gaa ctg gat etc aac age ggt aag ate ctt gag agt ttt ege ccc

I ! 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75

! EERFPMMSTFKVLLC 381 gaa gaa cgt ttt cca atg atg age act ttt aaa gtt ctg eta tgt 1 ! 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

! GAVLSR1DAGQEQLG 426 ggc gcg gta na tcc cgt an gac gcc ggg caa gaG CAa ctc ggT ! Bcgl............ i ! 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105

! RRIHYSQNDLVEYSP 471 CGc cgc ala cac tat tct cag aat gac ttg gtt gAG TAC Tea cca LBcgl...... Seal.... i ! 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

! VTEKHLTDGMTVREL 516 gtc aca gaa aag cat ett aeg gat ggc atg aca gta aga gaa tta j ! 121 122 123 124 12$ 126 127 128 129 130 131 132 133 134 135

! CSAAITMSDNTAANL 561 tgc agt get gcc ata acc atg agt gat aac act gcg gcc aac tta j ! 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150

! LLTTIGGPKELTAFL 606 ett ctg aca aCG ATC Gga gga ccg aag gag eta acc get ttt ttg ! Pvul.,.. (1/2) t 1 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165

! HNMGDHVTRLDRWEP 651 cac aac atg ggg gat cat gta act ege ett gat egt tgg gaa ccg

I ! 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180

! ELNEAIPNDERDTTM 696 gag ctg aat gaa gcc ata cca aac gac gag egt gac acc aeg atg

I ! 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195

! PVAMATTLRKLLTGE 741 eet gta GCA ATG gea aca aeg tTG CGC Aaa eta tta act ggc gaa ! BsrDI..(l/2) Fspl.,.. (1/2) j ! 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 ! LLTLASRQQLIDWME 786 eta ett act eta get tee egg caa caa tta ata gac tgg atg gag ! ! 211 212 213 214 215 216217 218 219220 221 222223 224 225

I ADKVAGPLLRSALPA 831 geg gat aaa gtt gca gga oca ett ctg ege teg gee ett ccg get ! ! 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240

! GWFIADKSGAGERGS 876 ggc tgg ttt an get gat aaa tCT GGA Gee ggt gag egt gGG TCT ! Bpml....(l/2) Bsal....

I ! 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255

! RGI1AALGPDGKPSR 921 Cgc ggt atC ATT GCa gca ctg ggg cca gat ggt aag ccc tee cgt t Bsal...... 8$rDL.<2/2) j ! 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270

! I VVI YTTGSQATMDE 966 ate gta gtt ate tac aeG ACg ggg aGT Cag gca act atg gat gaa ! Ahdl........... 1 ! 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285

! RNRQIAEIGASLIKH 1011 ega aat aga cag ate get gag ata ggt gee tea etg art aag cat ! ! 286287 ! W . 1056 tggtaa 1062 ctgtcagac caagtttact 1081 catalatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1141 tcctttttga taatcicatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1201 cagaccccgt agaaaagatc aaaggatett cttgagatcc ttttttlctg egegtaatet 1261 getgettgea aacaaaaaaa ccaccgctac cagcggtggt ttgUlgccg gatcaagagc ! 321 taccaactct ttttccgaag gtaactggct teageagage gcagatacca aatactgtcc 1381 ttctagtgta geegtagtta ggccaccaet teaagaactc tgtagcaccg cctacatacc 1441 tcgctctgct aatcctgtta ccagtggdg ctgccagtgg cgataagtcg Igtcttaccg 1501 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1561 cglgcataca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1621 agcatlgaga aagcgccacg cttcccgaag ggagaaaggc ggacagGTAT CCggtaagcg ! BciVL (2 of 2) 1681 gcagggtcgg aacaggagag cgCACG AGgg agcrtccagg gggaaacgcc tggtatcttt ! BssSI.(2/2) 1741 atagicctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1801 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1861 gctggccltl tgctcACATG Ttctttcctg cgttatcccc tgattctgtg gataaccgta ! PciL. 1921 ttaccgcctt tgagtgagci gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1981 cagtgagcga ggaagcgGAA G AGCgcccaa tacgcaaacc gcctctcccc gcgcgttggc ! SapL... 2041 cgattcatta atgCAGCTGg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca ! PvulI.(l/3) 2 J 01 acgcaatTAA TGT gagttag ctcactcatt aggcacccca ggcTTTACAc tttalgcttc ! ..-35.. Plac ..-10. 216) cggctcgtat gttgtgtgga atlgtgagcg gataacaatt tcacaCAGGA AACAGCTATG ! M13Rev_seqj>rimer 222) ACcatgatta cgCC AAGCTT TGGagccttt tttttggaga ttttcaac ! PflMl....... ! Hindi. ! signal::linker: .CLight ; ! 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

! fMKKLLFAIPLVVPFY 2269 gtg aaa aaa tta tta ttc gca att ccl tta gtt gtt cct ttc tat ; ! Linker..............................End of FR4 ! 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 I SHSA QVQLQVDLE1K 2314 tct cac aGT GCA Cag gtc caa CTG CAG GTC GAC CTC GAG ate aaa ! ApaLl...... Pstl... Xhol... 1 BspMI... ! Sail... ! Acc!...(l/2) ! Hinc11.(I/2) ! ! Vlight domains could be cloned in as ApaLI-XhoI fragments. ! VL-CL(kappa) segments can be cloned in as ApaU-AscI fragments. <----*

I ! 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

! RGTVAAPSVF1FPPS 2359 cgt gga act gtg get gca cca tet GTC TTC ate ttc ccg cca tet ! Bbsl...(1/2) ; 1 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

! DEQLKSGTASVVCLL 2404 gat gag cag ttg aaa tet gga act gee tet gtt gtg tgc ctg ctg j ! 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75

! NNFYPREAKVQWKVD 2449 aat aac ttc tat ccc aga gag gee aaa gta cag tgg aag gtg gat j ! 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

! NALQSGNSQESVTEQ 2494 aac gee etc caa teg ggt aac tee cag gag agt glc aca gag cag

I ! 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105

! DSKDSTYSLSSTLTL 2539 gac age aag gac age acc tac age etc age age ace ctg aeG CTG ! Espl... j ! 106 107 108 109 110 111 112 113 114 115 U6 117 118 119 120

! SKADYEKHKVYACEV 2584 AGC aaa gca gac tac gag aaa cac aaa GTC TAC gee tgc gaa gtc I ...Espl.... Accl...(2/2) t ! 121 122 123 124 12$ 126 127 128 129 130 131 132 133 134 135

! THQGLSSPVTKSFNR 2629 acc cat cag ggc ctg agt tcA CCG GTg aca aag age ttc aac agg ! Agel....(1/2)

I I 136137 138 139 140 ! G E C . . 2674 gga gag Iguaa taa GGCGCGCCaatt ! AscI..... i BssHlI. j 2701 ctattlcaag gagacagtca ta ! ! PelB::3-23(stufFed)::CHl ::111 fusion gene

I

? I 2 3 4 5 6 7 8 9 10 II 12 13 14 15 ! MKYLLPTAAAGLLLL 2723 atg aaa tac eta ttg cct aeg gca gee get gga ttg tta tta etc j t.-.—. -______________ j ! 16 17 18 19 20 21 22

! A A Q P A M A 2768 geG GCC cag ccG GCC atg gee ! Sfil............. ! NgoMlV..(l/2) ! Ncol....

I ! FRKDP47/V3-23)-------- ! 23 24 25 26 27 28 29 30

! EVQLLESG 2789 gaa|gtt|CAA|TTG|tta|gag|tctjggt|

1 I Mfel I j ! 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 ! GGLVQPGGSLRLSCA 2813 |ggc|ggl|cR|gtt|cag!cct|ggt|ggt]tct|tta|cgt|cU|tct(tgc|gct| » ! —FRI--- ! 46 47 48

r. A S G

2858 |gcl|TCC|GGAl I I BspEII i ! StufTer for CDR1, FR2, and CDR2------------------------> ! There are no stop codons in this stufler. 2867 gcttcAGATC Tgtttgcctt ! Bgtll 2887 tttgtggggt ggtgcagatc gcgttacgga gatcgaccga ctgcttgagc aaaagccacg 2947 cttaaclgcT GATCAggcat gggatgttat tcgccaaacc agtcgtcagg atcttaacct ! Bell... 3007 gaggcttttt ttacctactc tgcaagcagc gacatctggt ttgacacaga gcgatccgcg 3067 tcgtcagttg gtagaaacat taacacgttg ggatggcatc aatttgctta atgatgatgg 3127 taaaacctgg cagcagccag gctcigccat cctgaacgtt tggctgacca gtatgttgaa 3187 gcgtaccgta gtggctgccg tacctatgCC Atttgataag TGGtacagcg ccagtggcta ! Xcml............. 3247 cgaaacaacc caggacggcc caactggttc gclgaatata agtgttggag caaaaatttt 3307 gtatgaggcg gtgcagggag acaaatcacc aatcccacag gcggttgatc tgtttgctgg 3367 gaaaccacag caggaggttg tgttggctgc gctggaagal acctgggaga ctctttccaa 3427 aegetatgge aataatgtga gtaactggaa aacacctgca atggccttaa cgttccgggc 3487 aaataatttc tttggtgtac cgcaggccgc ageggaagaa ACGCGTcatc aggeggagta ! Mlul.. 3547 icaaaaccgt ggaacagaaa aegatatgat tgttttctca ccaacgacaa gcgatcgtcc 3607 tgtgcttgcc tgggatgtgg tcgcacccgg tcagagtggg ttlattgctc ccgatggaac 3667 agttgataag cactatgaag atcagcigaa aatgtacgaa aattttggcc glaagtcgct ! Pvull. 3727 clgGTTAACg aagcaggatg tggaggegea taaggagteg ! Hpal.. ! HincII(2/2) j ! -----FR3------------------------------------- ! 4 5 6 7 8 9 10 II 12 13 14 15 16 ! 93 94 95 96 97 98 99 100 101 102 103 104 105

! SRDNSKNTIYLQM 3767 |TCTjAGA|gac|aac|lct|aag{aat|act|ctc|tac|ttg[cag|atg|

! I Xbal I j i .„FR3----------------------------------->| ! 17 18 19 20 ! 106 107 108 109 j NSLsIsirsg 3806 |aacjagC|TTA|AG t ctg age att CGG TCC G ! |Aflll| Rsrll..

I ! q h s p t .

3834 gg caa cat tel cca aac tga ccagacga cacaaacggc 3872 naegetaaa tcccgcgcat gggatggtaa agagglggcg tctttgctgg cctggactca 3932 tcagalgaag gccaaaaatt ggcaggagtg gacacagcag gcagcgaaac aagcactgac 3992 calcaactgg tactatgctg atgtaaacgg caatattggt tatgttcata ctggtgctta 4052 tccagatcgt caatcaggcc atgatcegcg attacccgtt cctggtacgg gaaaatggga 4112 ctggaaaggg ctatlgcclt ttgaaatgaa ccctaaggtg tataaccccc ag 4164 aa GCTAGC ctgcggcttc ! NheL • 4182 G|GTC|ACC| gtetcaage

! I BsiEll I

I ! 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150

! ASTKGPSVFPLAPSS 4198 gee lee ace aag ggc cca teg gtc ttc ccc ctg gca ccc tee tee j ! 1S1 152 153 154 155 156 157 158 159 160 161 162 163 164 165

! KSTSGGTAALGCLVK 4243 aag age acc tet ggg ggc aca geg gee ctg ggc tgc ctg gtc aag ( ! 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180

! DYFPEPVTVSWNSGA 4288 gac lac ttc ccc gaa ccg gtg aeg gtg teg tgg aac tea ggc gee

I ! 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195

! LTSGVHTFPAVLQSS 4333 dg acc age ggc gtc cac acc tte ccg get gtc eta cag tee tea i ! 196 197 198 199200201 202203204205206207208209210

! GLYSLSSVVTVPSSS 4378 gga etc tac tee etc age age gta gig acc gtg ccc tee age age i ! 211 212 213 214 215 216 217218 219 220 221 222 223 224 225

! LGTQTYICNVNHKPS 4423 tig ggc acc cag acc tac atc tgc aac gtg aat cac aag ccc age

I ! 226 227 228 229 230 231 232 233 234 235 236 237 238

! NTKVDKKVEPKSC 4468 aac acc aag gtg gac aaG AAA G TT GAG CCC AAA TCT TGT i ON-TQHCforw...................... ! Poly His linker ! 139 140 141 142 143 144 145 146 147 148 149 150

! AAAHHHHHHGAA 4507 GCG GCC GCa cat cat cat cac cat cac ggg gee gea ! Not!...... ! Eagl... j ! 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 1 EQKL1SEEDLNGAA. 4543 gaa caa aaa etc ate tea gaa gag gat elg aat ggg gcc gea tag

I ! Mature 111-----------------------—------------->... ! 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180

! TVESCLAKPHTENSF 4588 act gtt gaa agt tgt tta gea aaa eet cat aca gaa aal tea ttt t ! 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195

? TNVWKDDKTLDRYAN 4633 act aac gtc tgg aaa gac gac aaa act tta gat egt tac get aac j ! 196 197 198 199200 201 202 203 204 205 206 207 208 209 210

! YEGCLWNATGVVVCT 4678 tat gag ggc tgt ctg tgG AAT GCt aca ggc gtt gtg gtt tgt act ! Bsml... j ! 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225

! GDETQCYGTWVPIGL 4723 ggt gac gaa act cag tgt tac ggt aca tgg gtt cct att ggg cu ! ! 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240

! AIPENEGGGSEGGGS 4768 get ate cct gaa aat gag ggt ggt ggc tet gag ggt ggc ggt tet i

i 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 ! EGGGSEGGGTK.PPEY 4813 gag ggt ggc ggt tet gag ggt ggc ggt act aaa cct cct gag tac t ! 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270

! GDTPIPG YTYINPLD

4858 ggt gat aca cct att ccg ggc tat act tat ate aac cct etc gac I ! 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285

! GTYPPGTEQNPANPN 4903 ggc act tat ccg cct ggt act gag caa aac ccc get aat cct aat

I ! 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300

! PSLEESQPLNTFMFQ 4948 cct tet ett GAG GAG tet cag cct ett aat act tte atg ttt cag ! BseRl..(2/2) t ! 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315

! NNRFRNRQGALTVYT 4993 aat aat agg tte ega aat agg cag ggt gea tta act gtt tat aeg ! ! 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330

! GTVTQGTDPVKTYYQ 5038 ggc act gtt act caa ggc act gac ccc gtt aaa act tat tac cag j « 331 332 333 334 335 336 337 33$ 339 340 341 342 343 344 345 ! YTPVSSKAMYDAYWN 5083 tac act cd gta tea tea aaa gee atg tat gac get tac tgg aac 1 ! 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360

! GKFRDCAFHSGFNED

5128 ggt aaa ttc aga gac tgc get ttc cat tet ggc ttt aat gaG GAT ! BamHL

I ! 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375

! PFVCEYQGQSSDLPQ 5173 CCa ttc gtt tgt gaa tat caa ggc caa teg td gAC CTG Cct caa ! BamHl... BspMI...(2/2) ! ! 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390

! PPVNAGGGSGGGSCG 5218 cct cct gtc aat get ggc ggc ggc let ggt ggt ggt let ggt ggc

I ( 391 392 393 394 395 396397 398 399 400 401 402 403 404 405

! GSEGGGSEGGGSEGG 5263 ggc let gag ggt ggc ggc tet gag ggt ggc ggt tet gag ggt ggc 1 ! 406407 408 409410 411 412413 414 415 416417418 419 420

! GSEGGGSGGGSGSGD 5308 ggc tet gag ggt ggc ggt tee ggt ggc ggc lee ggt tee ggt gat j ! 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435

! FDYEKMANANKGAMT

5353 ttt gat tat gaa aaa atg gca aac get aat aag ggg get atg ace I ! 436437 438 439 440 441 442 443 444 445 446 447448 449 450

! ENADENALQSDAKGK 5398 gaa aat gee gat gaa aac geg eta cag let gac get aaa ggc aaa

I ! 451 4S2 453 454455456457 458459460461 462 463 464 465 ! LDSVATDYGAAIDGF 5443 clt gat tct gtc get act gat tac ggt get get ATC GAT ggt ttc ! BspDl. ! ! 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480

! IGDVSGLANGNGATG 5488 an ggt gae gtt tee ggc ett gel aal ggt aat ggt get act ggt

I ! 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495

! DFAGSNSQMAQVGDG 5533 gat ttt get ggc tct aat tee caa alg get caa gtc ggt gae ggt j ! 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510

! DNSPLMNNFRQYLPS 5578 gat aat tea eet tta atg aat aat ftc egt caa tat tta cct tet j

I 511 512513 514515 516517518519520521 522523 524 525 ! LPQSVECRPYVFGAG 5623 ttg eet cag teg gtt gaa igt ege cct tat gtc ttt ggc get ggt j ! 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540

! KPYEFSIDCDKINLF 5668 aaa cCA TAT Gaa ttt tct att gat tgt gae aaa ata aac tta ttc ! NdcL.. ! 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555

1 RGVFAFLLYVATFMY 5713 cgt ggt gtc m geg ttt ett tta tat gtt gee acc ttt atg tat j ! 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 ! VFSTFANILRNKES. 5758 gta ttt teg aeg m get aac ata ctg cgt aat aag gag let taa 1

571 5803 taa GAATTC EcoRI.

5812 actggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaalc 5871 gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcacCGATC

Pvul.. 593 \ Gcccttccca acagiTGCGC Agcclgaatg gcgaaiGGCG CCtgatgcgg tattttctcc ...Pvul... (3/3) Fspl... (2/2) Kasl..(2/2) 5991 ttacgcatct gtgcggtatt tcacaccgca tataaattgt aaacgttaat altttgttaa 6051 aattcgcgtt aaatttttgt taaatcagct cattttttaa ccaataggcc gaaatcggca 6111 aaatcccTTA TAAatcaaaa gaatagcccg agatagggtt gagtgtlgtl ccagtttgga Psil... 6171 acaagagtcc actattaaag aacgtggact ccaacgtcaa agggcgaaaa accgtctatc 6231 agggcgatgg ccC ACtacGT Gaaccatcac ccaaatcaag Ittttigggg tcgaggtgcc Dralll... 6291 gtaaagcact aaatcggaac cctaaaggga gcccccgatt tagagcttga cggggaaaGC NgoMIV.. 6351 CGGCgaacgt ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct agggcgctgg ..NgoMIV.(2/2) 6411 caagtgtagc ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac 6471 agggcgcgta ctatggttgc tttgacgggt gcagtctcag tacaatctgc tctgatgccg 6531 catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc 6591 tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga 6651 ggttttcacc glcatcaccg aaacgcgcga

Table 31: Bridge/Extender Oligonucleotides ON LamlaB7(rO .........................GTGCTGACTCAGCCACCCTC. 20 ON~Lam2aB7 (rc) ........................GCCCTGACTCAGCCTGCCTC. 20 ON"Larn31B7 (rc) .......................GAGCTGACTCAGG.ACCCTGC 20 ON_Lam3rB7 (rc) ........................GAGCTGACTCAGCCACCCTC. 20 ON LainHflcBrg(rc) CCTCGACAGCGAAGTGCACAGAGCGTCTTGACTCAGCC....... 38 ON~LamH f1cExt CCTCGACAGCGAAGTGCACAGAGCGTCTTG............... 30 ON~LamHf2b2Brg (rc) CCTCGACAGCGAAGTGCACAGAGCGCTTTGACTCAGCC....... 38 ON LamHf2b2Ext CCTCGACAGCGAAGTGCACAGAGCGCTTTG............... 30 ON"LamH£2dBrg (rc) CCTCGACAGCTAAGTGCACAGAGCGOTTTGACTCAGCC....... 38 ON_tamHf2dExt CCTCGACAGCGAAGTGCACAGAGCGCTTTG. .............. 30 ON_LamHf31Brg (rc) CCTCGACAGCGAAGTGCACAGAGCGAATTGACTCAGCC....... 38 0N_LanHf31Ext CCTCGACAGCGAAGTGCACAGAGCGAATTG............... 30 ON_LamHf3rBrg (rc) CCTCGACAGCGAAGTGCACAGTACGAATTGACTCAGCC....... 38 ON_LamHf 3rBxt CCTCGACAGCGAAGTGCACAGTACGAATTG............... 30 ON_lamPlePCR CCTCGACAGCGAAGTGCACAG.............. 21

Consensus

Table 32: Oligonucleotides used to make SSDNA locally double-stranded

Adapters (8) H43HF3.1?02#1 5'-cc gtg tat tac tgt gcg aga g-3' H43.77.97.1-03*2 5'-ct gtg tat tac tgt gcg aga g-31 H43.77.97.323#22 5'-cc gt|| tat tac tgt gcg ajga g-3’ H43.77.97.330*23 5'-eg gtg tat tac tgt gcg ala g-3' H43.77.97.439*44 5’-c§| gtg tat tac tgt gcg aga 8-3' H4 3.77.97.551*48 5'-cc jttg tat tac tgt gcg aga 8-3'

Table 33: Bridge/extender pairs

Table 35: PCR program for amplification of heavy chain CDR3 DNA

Table 34: PCR primers

! Table 36: Annotated sequence of CJR DY3F7(CJR-A05Ϊ 10251 bases ! Non-cutters 1 !BclI Tgatca BsiWI Cgtacg BssSI Cacgag !BstZl7I GTAtac Btrl CACgtg EcoRV GATatc ! Fsel GGCCGGcc Hpal GTTaac Mlul Acgcgt !PmeI GTTTaaac Pmll CACgtg PpuMI RGgwccy IRsrII CGgwccg SapI GCTCTTC SexAI Accwggt !SgfI GCGATcgc SgrAI CRccggyg SphI GCATGc !StuI AGGcct Xmal Cccggg Ϊ cutters ! Enzymes that cut from 1 to 4 times and other features !End of genes II and X 829 !Start gene V 843 !BsrGI Tgtaca 1 1021 !BspMI Nnnnnnnnngcaggt 3 1104 5997 9183 ACCTGCNNNNn 1 2281 ! End of gene V 1106 [Start gene VII 1108 [BsaBI GATNNnnatc 2 1149 3967 IStart gene IX 1208 !End gene VII 1211 !SnaBI TACgta 2 1268 7133 IBspHI Tcatga 3 1299 6085 7093 IStart gene VIII 1301 !End gene IX 1304 !End gene VIII 1522 .'Start gene III 1578 !EagI Cggccg 2 1630 8905 !XbaI Tctaga 2 1643 8436 !KasI Ggcgcc 4 1650 8724 9039 9120 ! BsmI GAATGCN 2 1769 9065 !BseRI GAGGAGNNNNNNNNNN 2 2031 8516 NNnnnnnnnnctcctc 2 7603 8623 !AlwNI CAGNNNctg 3 2210 8072 8182 !BspDI ATcgat 2 2520 9883 !NdeI CAtatg 3 2716 3796 9847 [End gene III 2846 IStart gene VI 2848 !Afel AGCgct 1 3032 !End gene VI 3187 IStart gene I 3189 !EarI CTCTTCNnnn 2 4067 9274

Nnnnngaagag 2 6126 8953 ! PacI TTAATtaa 1 4125 [Start gene IV 4213 [End gene I 4235 [BsmFI Nnnnnnnnnnnnnnngtccc 2 5068 9515 !MscI TGGcca 3 5073 7597 9160 ! Psil TTAtaa 2 534 9 5837 [End gene IV 5493 [Start ori 5494 [NgoMIV Gccggc 3 5606 8213 9315 !Banll GRGCYc 4 5636 8080 8606 8889 [Drain CACNNNgtg 1 5709 ! DrdI GACNNNNnngtc 1 5752 [Aval Cycgrg 2 5818 7240 !PvuII CAGctg 1 5953 IBsmBI CGTCTCNnnnn 3 5964 8585 9271 !End ori region 5993 IBamHI Ggatcc 1 5994 !Hindlll Aagctt 3 6000 7147 7384 IBciVI GTATCCNNNNNN 1 6077 IStart bla 6138 !Eco57I CTGAAG 2 6238 7716 ISpel Actagt 1 6257 !BcgI gcannnnnntcg 1 6398 !ScaI AGTact 1 6442 !Pvul CGATcg 1 6553 !FspI TGCgca 1 6700 !Bgll GCCNNNNnggc 3 6801 8208 8976 !Bsal GGTCTCNnnnn 1 6853 !Ahdl GACNNNnngtc 1 6920 !Eamll05I GACNNNnngtc 1 6920 !End bla 6998 .'AccI GTmkac 2 7153 8048 !Hindi GTYrac 1 7153 ! Sall Gtcgac 1 7153 !Xhol Ctcgag 1 7240 IStart PlacZ region 7246 !End PlacZ region 7381 IPflMI CCANNNNntgg 1 7382 !RBS1 7405

Istart Ml3-iii signal seq for LC 7418 !ApaLI Gtgcac 1 7470 !end M13-iii signal seq 7471 istart light chain kappa L20;JK1 7472 IPflFI GACNnngtc 3 7489 8705 9099 !SbfI CCTGCAgg 1 7542 IPstI CTGCAg 1 7543 IKpnl GGTACc 1 7581 !Xcml CCANNNNNnnnntgg 2 7585 9215 INsil ATGCAt 2 7626 9503 IBsgl ctgcac 1 7809 !Bbsl gtcttc 2 7820 8616 IBlpI GCtnagc 1 8017 !EspI GCtnagc 1 8017 !EcoO109I RGgnccy 2 8073 8605 ! Ecll36I GAGctc 1 8080 !Sad GAGCTc 1 8080 !End light chain 8122 !AscI GGcgcgcc 1 8126 !BssHII Gcgcgc 1 8127 !RBS2 8147 ISfil GGCCNNNNnggcc 1 8207 INcoI Ccatgg 1 8218 IStart 3-23, FRl 8226 IMfel Caattg 1 8232 IBspEI Tccgga 1 8298 IStart CDR1 8316 IStatt FR2 8331 IBstXI CCANNNNNntgg 2 8339 8812 lEcoNI CCTNNnnnagg 2 8346 8675 IStart FR3 8373 IXbal Tctaga 2 8436 1643 lAflll Cttaag 1 8480 IStart CDR3 8520 lAatll GACGTc 1 8556 ! Start FR4 8562 !PshAI GACNNnngtc 2 8573 9231 !BstEII Ggtnacc 1 8579 ! Start CHI 8595 !Apal GGGCCc 1 8606 !Bspl20l Gggccc 1 8606 IPspOMI Gggccc 1 8606 !AgeI Accggt 1 8699 !Bsu36I CCtnagg 2 8770 9509 !End of CHI 8903 !NotI GCggccgc 1 8904 [Start His6 tag 8913 [Start cMyc tag 8931 [Amber codon 8982 !NheI Gctagc 1 8985 [Start M13 III Domain 3 8997 !Nrul TCGcga 1 9106 ! BstBI TTcgaa 1 9197 !BcoRI Gaattc 1 9200 IXcml CCANNNNNnnnntgg 1 9215 !BstAPI GCANNNNntgc 1 9337 ίSadl CCGCgg 1 9365 [End Illstump anchor 9455 [AvrII Cctagg 1 9462 itrp terminator 9470 !Swal ATTTaaat 1 9784 [Start gene II 9850 !BglII Agatct 1 9936 I______________________________________________________________________ 1 aat get act act att agt aga att gat gcc acc ttt tea get ege gee ! gene ii continued 49 cca aat gaa aat ata get aaa cag gtt att gac cat ttg ega aat gta 97 tet aat ggt caa act aaa tet act cgt teg cag aat tgg gaa tea act 145 gtt aTa tgg aat gaa act tee aga cac cgt act tta gtt gca tat tta 193 aaa cat gtt gag eta cag caT TaT att cag caa tta age tet aag cca 241 tee gca aaa atg acc tet tat caa aag gag caa tta aag gta etc tet 289 aat cct gac ctg ttg gag ttt get tee ggt ctg gtt ege ttt gaa get 337 ega att aaa aeg ega tat ttg aag tet ttc ggg ett cct ett aat ett 385 ttt gat gca ate ege ttt get tet gac tat aat agt cag ggt aaa gac 433 ctg att ttt gat tta tgg tea ttc teg ttt tet gaa ctg ttt aaa gca 481 ttt gag ggg gat tea ATG aat att tat gac gat tee gca gta ttg gac ! Start gene x, ii continues 529 get ate cag tet aaa cat ttt act att acc ccc tet ggc aaa act tet 577 ttt gca aaa gcc tet ege tat ttt ggt ttt tat cgt cgt ctg gta aac 625 gag ggt tat gat agt gtt get ett act atg cct cgt aat tee ttt tgg 673 cgt tat gta tet gca tta gtt gaa tgt ggt att cct aaa tet caa ctg 721 atg aat ett tet acc tgt aat aat gtt gtt ccg tta gtt cgt ttt att 769 aac gta gat ttt tet tee caa cgt cct gac tgg tat aat gag cca gtt

817 ett aaa ate gca TAA

! End X &amp; II 832 ggtaattca ca t ! Ml E5 Q10 T15 843 ATG att aaa gtt gaa att aaa cca tet caa gcc caa ttt act act cgt

! Start gene V

I ! S17 S20 P25 E30 891 tet ggt gtt tet cgt cag ggc aag cct tat tea ctg aat gag cag ett ; ! V35 E40 V45 939 tgt tac gtt gat ttg ggt aat gaa tat ccg gtt ett gtc aag att act ! D50 A55 L60 987 ctt gat gaa ggt cag cca gcc tat gcg cct ggt cTG TAC Acc gtt cat ! BsrGI... ! L65 V70 S75 R80 1035 ctg tcc tct ttc aaa gtt ggt cag ttc ggt tcc ctt atg att gac cgt r

! P85 K87 end of V

1083 ctg cgc etc gtt ccg get aag TAA C i

1108 ATG gag cag gtc gcg gat ttc gac aca att tat cag gcg atg ! Start gene VII 1150 ata caa atc tcc gtt gta ctt tgt ttc gcg ctt ggt ata atc

I ! VII and IX overlap. ! .....S2 V3 L4 V5 S10 1192 get ggg ggt caa agA TGA gt gtt tta gtg tat tct ttT gcc tct ttc gtt

! End VII

! i start IX ! L13 W15 G20 T25 E29 1242 tta ggt tgg tgc ctt cgt agt ggc att aeg tat ttt acc egt tta atg gaa i 1293 act tcc te ! .... stop of IX, IX and VIII overlap by four bases 1301 ATG aaa aag tct tta gtc etc aaa gee tct gta gee gtt get acc etc l Start signal sequence of viii. 134 9 gtt ccg atg ctg tct ttc get get gag ggt gac gat ccc gea aaa gcg ! mature VIII ---> 1397 gee ttt aac tee ctg caa gee tea gcg acc gaa tat atc ggt tat gcg 1445 tgg gcg atg gtt gtt gtc att 14 66 gtc ggc gea act atc ggt atc aag ctg ttt aag j ! bases 1499-1539 are probable promoter for iii 1499 aaa ttc acc teg aaa gca ! 1515 ! ........... -35 . .

I 1517 age tga taaaccgat acaattaaag gctccttttg ! ..... -10

I 1552 gagccttttt ttt GGAGAt ttt ! S.D. uppercase, there may be 9 Ts

I i <------ni signal sequence----------------------------->

! MKKLLFA I PLVVPF 1574 caac GTG aaa aaa tta tta ttc gca att cct tta gtt gtt cct ttc ! 1620 j

! YSGAAES HLDGA 1620 tat tct ggc gCG GCC Gaa tea caT CTA GAc ggc gcc ! EagI.... Xbal.... ! Domain 1 ------------------------------------------------------------

! AETVESCLA 1656 get gaa act gtt gaa agt tgt tta gca

! KSHTEIS FTNVWKDDKT 1683 aaA Tcc cat aca gaa aat tea ttt aCT AAC GTC TGG AAA GAC GAC AAA ACt

! LDRYANYEGSLWNATGV 1734 tta gat cgt tac get aac tat gag ggC tgt ctg tgG AAT GCt aca ggc gtt ! BsmI....

! VVCTGDETQCYGTWVPI 1785 gta gtt tgt act ggt GAC GAA ACT CAG TGT TAC GGT ACA TGG GTT cct att

! G L A I P E N 183S ggg ctt get ate cct gaa aat

I ! LI linker ------------------------------------

! EGGGSEGGGS 1857 gag ggt ggt ggc tet gag ggt ggc ggt tet

! EGGGSEGGGT 1887 gag ggt ggc ggt tet gag ggt ggc ggt act ! ! Domain 2 ---------------------------------.--- 1917 aaa cct cct gag tac ggt gat aca cct att ccg ggc tat act tat atc aac 1968 cct etc gac ggc act tat ccg eet ggt act gag caa aac ccc get aat cct 2019 aat cct tet ctt GAG GAG tet cag cct ctt aat act tte atg ttt cag aat ! BseRI.. 2070 aat agg tte ega aat agg cag ggg gea tta act gtt tat aeg ggc act 2118 gtt act caa ggc act gac ccc gtt aaa act tat tac cag tac act cct

2166 gta tea tea aaa gee atg tat gac get tac tgg aac ggt aaa ttC AGA

! AlwNI

2214 GAC TGc get tte cat tet ggc ttt aat gaG gat TTa ttT gtt tgt gaa ! AlwNI 2262 tat caa ggc caa teg tet gac ctg cct caa cct cct gtc aat get i 2307 ggc ggc ggc tet ! start L2------------------------------------------------------------- 2319 ggt ggt ggt tet 2331 ggt ggc ggc tet 2343 gag ggt ggt ggc tet gag gga ggc ggt tee 2373 ggt ggt ggc tet ggt ! end L2

I ! Many published sequences of M13-derived phage have a longer linker ! than shown here by repeats of the EGGGS motif two more times. ! Domain 3--------------------------------------------------------------

* SGDFDYEKMANANKGA 2388 tee ggt gat ttt gat tat gaa aag atg gca aac get aat aag ggg get

I

! MTENADENALQS DAKG 2436 atg acc gaa aat gee gat gaa aac geg eta cag tet gac get aaa ggc ;

! KLDSVAT DYGAAMDG F 2484 aaa ctt gat tet gtc get act gat tac ggt get get atc gat ggt ttc ;

! IGDVSGLANGNGATGD 2532 att ggt gac gtt tee ggc ctt get aat ggt aat ggt get act ggt gat

! FAGSNSQMAQVG DGDN 2580 ttt get ggc tet aat tee caa atg get caa gtc ggt gac ggt gat aat j

! 5PLMNNFRQYLPSLPQ 2628 tea cct tta atg aat aat ttc cgt caa tat tta cct tee etc cct caa j ! svecrpfvfgagkpye 2676 teg gtt gaa tgt ege cct ttt gtc ttt Ggc get ggt aaa cca tat gaa ;

I FSIDCDKINLFR 2724 ttt tct att gat tgt gac aaa ata aac tta ttc cgt ! End Domain 3

I ! GVFAFLLYVATFMYV F140 2760 ggt gtc ttt gcg ttt ctt tta tat gtt gcc acc ttt atg tat gta ttt ! start transmembrane segment

I

! S T F A N I L 2808 tct acg ttt get aac ata ctg

! R N K E S 2829 cgt aat aag gag tct TAA ! stop of iii ! Intracellular anchor.

I ! Ml P2 V L L5 G I P L L10 L R F L G15

2847 tc ATG cca gtt ctt ttg ggt att ccg tta tta ttg cgt ttc ctc ggt ! Start VI 2894 ttc ctt ctg gta act ttg ttc ggc tat ctg ctt act ttt ctt aaa aag 2942 ggc ttc ggt aag ata get att get att tea ttg ttt ctt get ctt att 2990 att ggg ctt aac tea att ctt gtg ggt tat etc tct gat att age get 3038 caa tta ccc tct gac ttt gtt cag ggt gtt cag tta att etc ccg tct 3086 aat gcg ctt ccc tgt ttt tat gtt att etc tct gta aag get get att 3134 ttc att ttt gac gtt aaa caa aaa atc gtt tct tat ttg gat tgg gat

I ! Ml A2 V3 F5 L10 G13

3182 aaa TAA t ATG get gtt tat ttt gta act ggc aaa tta ggc tct gga ! end VI Start gene I j

! KTLVSVGKIQDKIVA 3228 aag acg etc gtt age gtt ggt aag att cag gat aaa att gta get

! GCKIATNLDLRLQNL 3273 ggg tgc aaa ata gea act aat ctt gat tta agg ctt caa aac etc

I

! PQVGRFAKTPRVLRI 3318 ccg caa gtc ggg agg ttc get aaa acg eet ege gtt ctt aga ata

! PDKPSISDLLAIGRG 3363 ccg gat aag eet tct ata tct gat ttg ctt get att ggg ege ggt t

! NDSYDENKNGLLVLD 3408 aat gat tee tac gat gaa aat aaa aac ggc ttg ctt gtt etc gat

I ECGTWFNTRSWNDKE 3453 gag tgc ggt act tgg ttt aat acc cgt tct tgg aat gat aag gaa

I

! RQPIIDWFLHARKLG 3498 aga cag ccg att att gat tgg ttt ,cta cat get cgt aaa tta gga i

i WDIIFLVQDLSIVDK 3543 tgg gat att att ttt ctt gtt cag gac tta tct att gtt gat aaa

I

! QARSALAEHVVYCRR 3588 cag gcg cgt tct gea tta get gaa cat gtt gtt tat tgt cgt cgt

I

! L DRITLP FVGTLYSL 3633 ctg gac aga att act tta eet ttt gtc ggt act tta tat tct ctt 1

ί ITGSKMPLPKLHVGV 3678 att act ggc teg aaa atg eet ctg eet aaa tta cat gtt ggc gtt

J

! VKYGDSQLSPTVERW 3723 gtt aaa tat ggc gat tct caa tta age eet act gtt gag egt tgg j ! lytgknlynaydtkq 37 68 ett tat act ggt aag aat ttg tat aac gea tat gat act aaa eag

I

! AFSSNYDSGVYSYLT 3813 get ttt tct agt aat tat gat tee ggt gtt tat tct tat tta aeg 1

[ PYLSHGRYFKPLNLG 3858 eet tat tta tea cac ggt egg tat tte aaa cca tta aat tta ggt

! QKMKLTKI YLKKFSR 3903 eag aag atg aaa tta act aaa ata tat ttg aaa aag ttt tct ege i

! VLCLAIGFASAFTYS 3948 gtt ett tgt ett gcg att gga ttt gea tea gea ttt aca tat agt i

! YITQPKPEVKKVVSQ 3993 tat ata acc caa eet aag ccg gag gtt aaa aag gta gtc tct eag i

! TYDFDKFTIDSSQRL 4038 acc tat gat ttt gat aaa tte act att gac tct tct eag egt ett

! NLSYRYVFKDS KGKL 4083 aat eta age tat ege tat gtt tte aag gat tct aag gga aaa TTA ! Pacl i

! INSDDLQKQGY SLTY 4128 ATT AAt age gac gat tta eag aag caa ggt tat tea etc aca tat ! Pad

I

! ilDLCTVS I KKGNSNE

! iv Ml K

4173 att gat tta tgt act gtt tee att aaa aaa ggt aat tea aAT Gaa ! Start IV i

! i I V K C N .End of I ! iv L3 L N5 V 17 N F V10 4218 att gtt aaa tgt aat TAA T TTT GTT ! IV continued..... 4243 tte ttg atg ttt gtt tea tea tct tct ttt get eag gta att gaa atg 4291 aat aat teg eet ctg ege gat ttt gta act tgg tat tea aag caa tea 4339 ggc gaa tee gtt att gtt tct ccc gat gta aaa ggt act gtt act gta 4387 tat tea tct gac gtt aaa eet gaa aat eta ege aat tte ttt att tct

4435 gtt tta egt geA aat aat ttt gat atg gtA ggt teT aAC eet tee atT 4483 att eag aag tat aat cca aae aat eag gat tat att gat gaa ttg cca 4531 tea tct gat aat eag gaa tat gat gat aat tee get eet tct ggt ggt 4579 tte ttt gtt ccg caa aat gat aat gtt act caa act ttt aaa att aat 4627 aac gtt egg gea aag gat tta ata ega gtt gtc gaa ttg ttt gta aag 4675 tct aat act tct aaa tee tea aat gta tta tct att gac ggc tct aat 4723 eta tta gtt gtt agt gcT eet aaa gat att tta gat aac ett eet caa 4771 tte ett tcA act gtt gat ttg cca act gac eag ata ttg att gag ggt 4819 ttg ata ttt gag gtt eag caa ggt gat get tta gat ttt tea ttt get 4867 get ggc tct eag egt ggc act gtt gea ggc ggt gtt aat act gac ege 4915 etc acc tct gtt tta tct tct get ggt ggt teg tte ggt att ttt aat 4963 ggc gat gtt tta ggg eta tea gtt ege gea tta aag act aat age cat 5011 tea aaa ata ttg tct gtg cca egt att ett aeg ett tea ggt eag aag 5059 ggt tct atc tct gtT GGC CAg aat gtc eet ttt att act ggt egt gtg ! Mscl- -. . 5107 act ggt gaa tct gcc aat gta aat aat cca ttt cag acg att gag cgt 5155 caa aat gta ggt att tcc atg age gtt ttt cct gtt gca atg get ggc 5203 ggt aat att gtt ctg gat att acc age aag gcc gat agt ttg agt tct 5251 tct act cag gca agt gat gtt att act aat caa aga agt att get aca 5299 acg gtt aat ttg cgt gat gga cag act ett tta etc ggt ggc etc act 534 7 gat tat aaa aac act tct caG gat tct ggc gta ccg ttc ctg tct aaa 5395 ate cct tta ate ggc etc ctg ttt age tec ege tct gat teT aac gag 5443 gaa age acg tta tac gtg etc gtc aaa gca acc ata gta ege gcc ctg

5491 TAG cggcgcatt ! End IV 5503 aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca gcgccctagc 5563 gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcGCCGGCt ttccccgtca ! NgoMI. 5623 agctctaaat cgggggctcc ctttagggtt ccgatttagt getttaegge acctcgaccc 56B3 caaaaaactt gatttgggtg atggttCACG TAGTGggcca tcgccctgat agacggtttt ! Drain.... 5743 tcgccctttG ACGTTGGAGT Ccacgttctt taatagtgga ctcttgttcc aaactggaac ! Drdl.......... 5803 aacactcaac cctatctcgg getattettt tgatttataa gggattttgc cgatttcgga 5863 accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg cttgctgcaa 5923 ctctctcagg gccaggcggt gaagggcaat CAGCTGttgc cCGTCTCact ggtgaaaaga f PvuII. BsmBI. 5983 aaaaccaccc tGGATCC AAGCTT ! BamHI Hindlll (1/2) ! Insert carrying bla gene 6006 gcaggtg gcacttttcg gggaaatgtg cgcggaaccc

6043 ctatttgttt atttttctaa atacattcaa atatGTATCC gctcatgaga caataaccct ! BciVI 6103 gataaatget tcaataatat tgaaaaAGGA AGAgt ! RBS.?... ! Start bla gene 6138 ATG agt att caa cat ttc cgt gtc gcc ett att ccc ttt ttt geg gca ttt 6189 tgc ett cct gtt ttt get cac cca gaa acg ctg gtg aaa gta aaa gat get 6240 gaa gat cag ttg ggC gcA CTA GTg ggt tac ate gaa ctg gat etc aac age ! Spel____ ! ApaLI &amp; BssSI Removed 6291 ggt aag ate ett gag agt ttt ege ccc gaa gaa cgt ttt cca atg atg age 6342 act ttt aaa gtt ctg eta tgt GGC GeG Gta tta tec cgt att gac gcc ggg

6393 caa gaG CAA CTC GGT CGc cgC ATA cAC tat tct cag aat gac ttg gtt gAG ! Bcgl............ Seal 6444 TAC Tea cca gtc aca gaa aag cat ett acg gat ggc atg aca gta aga gaa ! Seal. 6495 tta tgc agt get gcc ata acc atg agt gat aac act geg gcc aac tta ett 6546 ctg aca aCG ATC Gga gga ccg aag gag eta acc get ttt ttg cac aac atg ! Pvul.... 6597 ggg gat cat gta act ege ett gat cgt tgg gaa ccg gag ctg aat gaa gcc 6648 ata cca aac gac gag cgt gac acc acg atg cct gta gca atg Gca aca acg 6699 tTG CGC Aaa eta tta act ggc gaa eta ett act eta get tec egg caa caa ! FspI____ * 6750 tta ata gac tgg atg gag geg gat aaa gtt gca gga cca ett ctg ege teg 6801 GCC ett ccG GCt ggc tgg ttt att get gat aaa tct gga gcc ggt gag cgt ! Bgll.......... 6852 gGG TCT Cgc ggt ate att gca gca ctg ggg cca gat ggt aag ccc tec cgt ! Bsal____ 6903 ate gta gtt ate tac aeG ACg ggg aGT Cag gca act atg gat gaa ega aat ! Ahdl........... 6954 aga cag ate get gag ata ggt gcc tea ctg att aag cat tgg TAA ctgt ! stop 7003 cagaccaagt ttaetcatat ataetttaga ttgatttaaa acttcatttt taatttaaaa 7063 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 7123 cgttccactg tacgtaagac cccc 7147 AAGCTT GTCGftC tgaa tggcgaatgg cgctttgcct ! Hindlll Sall.. ! (2/2) Hindi 7183 ggtttccggc accagaagcg gtgccggaaa gctggctgga gtgcgatctt j ! Start of Fab-display cassette, the Fab DSR-A05, selected for ! binding to a protein antigen.

I 7233 CCTGAcG CTCGAG ! xBsu36I Xhol.. t ! PlacZ promoter is in the following block i 7246 cgcaacgc aattaatgtg agttagctca 7274 ctcattaggc accccaggct ttacacttta tgcttccggc tcgtatgttg 7324 tgtggaattg tgagcggata acaatttcac acaggaaaca gctatgacca 7374 tgattacgCC AagcttTGGa gccttttttt tggagatttt caac ! PflMI....... ! Hind3. (there are 3) ! Gene iii signal sequence: ! 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

* MKKLLFAI PLVVPFY 7418 gtg aaa aaa tta tta ttc gca att cct tta gtt gtt cct ttc tat ! 16 17 18 Start light chain (L20:JK1)

! SHSAQDIQMTQSPA 74 63 tct cac aGT GCA Caa gac ate caa ate acc caa tet cca gcc ! ApaLI... ! Sequence supplied bv extender............

! T L S L 7505 acc ctg tct ttg

! S PGERATL SC RASQG 7517 tct cca ggg gaa aga gcc acc etc tcc tgc agg gcc agt cag Ggt

I

! VSSYLAWYQQKPGQA 7562 gtt age age tac tta gcc tgg tac cag cag aaa cct ggc cag get !

! PRLLIYDASSRATGI 7607 ccc agg etc etc ate tat gAt gca tcc aAc agg gcc act ggc ate j

! PARFSGSGPGTDFTL 7 652 cca gCc agg ttc agt ggc agt ggg Cct ggg aca gac ttc act etc j

! TISSLEPEDFAVYYC 7697 acc ate age agC ctA gag cct gaa gat ttt gca gtT tat tac tgt

I

! QQRSWH PWT FGQGTR

7742 cag cag CGt aAc tgg cat ccg tgg ACG TTC GGC CAA GGG ACC AAG t

! VEIKRTVAAPSVFIF 7787 gtg gaa ate aaa ega act gtg gCT GCA Cca tct gtc ttc ate ttc ! Bsgl.... 1

Ϊ PPSDEQLKSGTASVV 7832 ccg cca tct gat gag cag ttg aaa tct gga act gcc tct gtt gtg

I

! CLLNNFYPREAKVQW 7877 tgc ctg ctg aat aac ttc tat ccc aga gag gcc aaa gta cag tgg 1

! KVDNALQSGNSQESV 7922 aag gtg gat aac gcc ctc caa tcg ggt aac tcc cag gag agt gtc

! TERDSKDSTYSLSST 7967 aca gag egg gac age aag gac age ace tac age etc age age acc

! LTLSKADYEKHKVYA 8012 ctg aeG CTG AGC aaa gea gac tac gag aaa cac aaa gtc tac gcc ! Espi..... j

» CEVTHQGLSS PVTKS 8057 tgc gaa gtc acc cat cag ggc ctG AGC TCg ccc gtc aca aag age ! SacI____ \

! F N R G E C 8102 tte aac agg gga gag tgt taa taa 8126 GGCGCG CCaattctat ttcaaGGAGA cagtcata ! Asel..... RBS2. j ! PelB signal sequence------(22 codons)-----> ! 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

! MKYLLPTAAAGLLLL 8160 atg aaa tac eta ttg eet aeg gea gee get gga ttg tta tta etc

I ! ...PelB signal------------> Start VH, FRI-----------------> ! 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

! AAQPAMAEVQLLESG 8205 gcG GCC cag ccG GCC atg gcc gaa gtt CAA TTG tta gag tet ggt ! Sf il............. Mfel... ! NCOI.... ; ! 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

! GGLVQPGGSLRLSCA 8250 ggc ggt ett gtt cag eet ggt ggt tet tta egt ett tet tgc get j ! ...FRI--------------------> CDR1--------------> FR2---------> ! 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

! ASGFTFSTYEMRWVR 8295 get TCC GGA tte act tte tet act tac gag atg egt tgg gtt egC ! BspEI.. BstXI... i ! FR2--------------------------------------> CDR2----------> ! 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75

! QAPGKGLEWVSYIAP 8340 CAa get ccT GGt aaa ggt ttg gag tgg gtt tet tat ate get eet ! BstXI................

I ! . . . CDR2----------------------------------------------> FR3----> ! 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

! SGGDTAYADSVKGRF 8385 tet ggt ggc gat act get tat get gac tcc gtt aaa ggt ege ttc ; ! 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105

! TISRDNSKNTLYLQM 8430 act ate TCT AGA aac aac tet aao aat act etc tac tto cao ata ! Xbal... \ Supplied by extender------------------------------- 1 ! -----------------------------------------FR3--------------> ! 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

! NSLRAEDTAVYYCAR 8475 aac aaC TTA AGa act oaa aac act oca ate tac tat tgt geg agg ! AfIII.. . ! from extender--------------------------------->

I ! CDR3--------------------------------------------------> FR4—> ! 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135

! RLDGYISYYYGMDVW 8520 agg etc gat ggc tat att tee tac tac tac ggt atg GAC GTC tgg ! AatIZ.. ! 136 137 138 139 140 141 142 143 144 145

! GQGTTVTV.SS 8565 ggc caa ggg acc aeG GTC ACC gtc tea age ! BstEII... ! CHI of IgGl---------->

! ASTKGPSVFPLAPSS 8595 gee tee acc aag ggc cca teg gtc ttc ccc ctg gca ccc tee tee

I

! KSTSGGTAALGCLVK 8640 aag age acc tet ggg ggc aca geg gee ctg ggc tgc ctg gtc aag 1

! DYFPEPVTVSWNSGA 8685 gac tac ttc ccc gaa ccg gtg aeg gtg teg tgg aac tea ggc gee

! LTSGVHT FPAVL QS S

8730 ctg acc age ggc gtc cac acc ttc ccg get gtc eta cag tCC TCA ! Bsu36l.. - . t

! GLYSLSSVVTVPSSS 8775 GGa etc tac tee etc age age gta gtg acc gtg ccc tee age age ! Bsu36I....

! LGTQTYI CNVNHKP S 8820 ttg ggc acc cag acc tac ate tgc aac gtg aat cac aag ccc age

I

! NTKVDKKVEPKSCAA 8865 aac acc aag gtg gac aag aaa gtt gag ccc aaa tet tgt GCG GCC ! NotI......

! AHHHHHHGAAEQKLI 8910 GCa cat cat cat cac cat cac ggg gee gca gaa caa aaa etc ate ! ..Notl.... H6 tag................. Myc-Tag.................-......

I

! SEEDLNGAAqASSA 8955 tea gaa gag gat ctg aat ggg gee gca tag GCT AGC tet get ! Myc-Tag.................... ... Nhel. .. ! Amber t ! Ill’stump ! Domain 3 of III---------------------------------------------------;----

! SGDFDYEKMANANKGA

8997 agt ggc gac ttc gac tac gag aaa atg get aat gee aac aaa GGC GCC ! tee t t t t t a g a c t t g g t!W.T. ! KasI...(2/4)

i MTENADENALQSDAKG 904 5 atG ACT GAG AAC GCT GAC GAG aat get ttg caa age gat gee aag ggt ! catctacgeag tet c t a c !W,T.

I

! KLDSVATDYGAAIDGF 9093 aag tta gae age gTC GCG Acc gac tat GGC GCC gee ATC GAc ggc ttt ! a c t t tet tttcttt ttc IW.T. ! Nral____ Kasl..-(3/4)

I

! IGDVSGLANGNGATGD 9141 ate ggc gat gtc agt ggt tTG GCC Aac ggc aac gga gee acc gga gac ! t t c t tee cct t t t t t t t t t !W.T. ! MscI____(3/3)

I

! FAGSNSQMAQVGDGDN 9189 ttc GCA GGT teG AAT TCt cag atg geC CAG GTT GGA GAT GGg gac aac l ttet ca - tactcttt ! W. T. ! BspMI.. [2/2) Xcml................ ί EcoRI... j

ί SPLMNNFRQYLPSLPQ 9237 agt ccg ett atg aac aac ttt aga cag tac ett ccg tet ett ccg cag I tea tta t t cct a tta t c c t a iw.t.

I

i SVECRPFVFSAGKPYE 9285 agt gtc gag tgc cgt cca ttc gtt ttc tet gee ggc aag cct tac gag l teg tatettet age t t a a t a iw.t.

I

! FSIDCDKINLFR

9333 ttc aGC Ate gac TGC gat aag ate aat ett ttc CGC ! t tet t t t c a a eta c t !W.T. ! BstAPI........ SacII. . . j End Domain 3

I

i GVFAFLLYVAT FMYVF 9369 GGc gtt ttc get ttc ttg eta tac gtc get act ttc atg tac gtt ttc ! tctgtcttattcct tat IW.T. ! start transmembrane segment j

! STFANIL RNKES 9417 aGC ACT TTC GCC AAT ATT TTA Cgc aac aaa gaa age ! tet gtteaeg t t g g tet !W.T. ! Intracellular anchor.

I !

9453 tag tga tet CCT AGG ! AvrII..

9468 aag ecc gee taa tga geg ggc ttt ttt ttt ct ggt ί I Trp terminator I r ! End Fab cassette

I 9503 ATGCAT CCTGAGG ccgat actgtcgtcg tcccctcaaa ctggcagatg ! Nsil.. Bsu36I.(3/3) 9551 cacggttacg atgcgcccat ctacaccaac gtgacctatc ccattacggt caatccgccg 9611 tttgttccca cggagaatcc gacgggttgt tactcgctca catttaatgt tgatgaaage 9671 tggctacagg aaggccagac gegaattatt tttgatggcg ttcctattgg ttaaaaaatg

9731 agctgattta acaaaaattt aaTgegaatt ttaacaaaat attaacgttt acaATTTAAA ! Swal... 9791 Tatttgetta tacaatcttc ctgtttttgg ggcttttctg attatcaacc GGGGTAcat 9850 ATG att gac atg eta gtt tta ega tta ccg ttc ate gat tet ett gtt tgc

! Start gene II 9901 tee aga etc tea ggc aat gac ctg ata gee ttt gtA GAT CTc tea aaa ata ! Bglll... 9952 get acc etc tee ggc atT aat tta tea get aga aeg gtt gaa tat cat att 10003 gat ggt gat ttg act gtc tee ggc ett tet cac cct ttt gaa tet tta cct 10054 aca cat tac tea ggc att gca ttt aaa ata tat gag ggt tet aaa aat ttt 10105 tat cct tgc gtt gaa ata aag get tet ccc gca aaa gta tta cag ggt cat 10156 aat gtt ttt ggt aca acc gat tta get tta tgc tet gag get tta ttg ett 10207 aat ttt get aat tet ttg cct tgc ctg tat gat tta ttg gat gtt ! ! gene II continues !-------------------------End of Table -—--—----—------------------ ! Table 37: DNA seq of w.t. M13 gene iii

I ! 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

! fMKKLLFAIPLVVPFY 1579 gtg aaa aaa tta tta ttc gca att cct tta gtt gtt cct ttc tat ! Signal sequence............................................

I ! 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

! SHSAETV ESCLAKPH 1624 tct cac tcc get gaa act gtt gaa agt tgt tta gca aaa ccc cat ! signal sequence> Domain 1--------------------------------------- t ! 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

! TENSFTNVWKDDKTL 1669 aca gaa aat tea ttt act aac gtc tgg aaa gac gac aaa act tta ! Domain 1---------------------------------------------------

I ! 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

! DRYANYEGCLWNATG 1714 gat cgt tac get aac tat gag ggt tgt ctg tgG AAT GCt aca ggc ! BsmI.... ! Domain 1---------------------------------------------------

I ! 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75

! VVVCTGDETQCYGTW 1759 gtt gta gtt tgt act ggt gac gaa act cag tgt tac ggt aca tgg ! Domain 1---------------------------------------------------

I ! 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

! VPIGLAI PENEGGGS 1804 gtt cct att ggg ett get ate cct gaa aat gag ggt ggt ggc tct ! Domain 1------------------------------> Linker 1-----------

I ! 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105

! EGGGSEGGGSEGGGT 1849 gag ggt ggc ggt tct gag ggt ggc ggt tct gag ggt ggc ggt act ! Linker 1-------------------------------------------------->

I i 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

! KPPEYGDTPI PGYTY 1894 aaa cct cct gag tac ggt gat aca cct att ccg ggc tat act tat ! Domain 2---------------------------------------------------

I ! 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135

Ϊ INPLDGTYPPGTEQN 1939 ate aac cct etc gac ggc act taT CCG CCt ggt act gag caa aac ! Ecil____ ! Domain 2---------------------------------------------------

I ! 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150

! PANPNPSLEESQPLN 1984 ccc get aat cct aat cct tct ett GAG GAG tct cag cct ett aat ! BseRI.. ! Domain 2--------------------------------------------------- ! ! 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 ! tfmfqnnrfrnrqga 2029 act ttc atg ttt cag aat aat agg ttc ega aat agg cag ggg gca ! Domain 2---------------------------------------------------

I ! 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180

I LTVYTGTVTQGTDPV 2074 tta act gtt tat acg ggc act gtt act caa ggc act gac ccc gtt ! Domain 2---------------------------------------------------

I ! 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195

! KTYYQYTPVSSKAMY 2119 aaa act tat tac cag tac act cct gta tea tea aaa gee atg tat ! Domain 2--------------------------------------------------- 1 * 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210

! DAYWNGKFRDCAFHS 2164 gac get tac tgg aac ggt aaa ttC AGa gaC TGc get ttc cat tet ! AlwNI....... 1 Domain 2---------------------------------------------------

I ! 211 212 213 214 215 216 217 210 219 220 221 222 223 224 225

! GFNEDPFVCEYQGQS 2209 ggc ttt aat gaG GAT CCa ttc gtt tgt gaa tat caa ggc caa teg ) BamHI... ! Domain 2---------------------------------------------------

I ! 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240

! SDLPQPPVNAGGGSG 2254 tet gac ctg cct caa cct cct gtc aat get ggc ggc ggc tet ggt ! Domain 2-------------------------------> Linker 2-----------

I ! 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255

‘ GGSGGGS EGGG SEGG 2299 ggt ggt tet ggt ggc ggc tet gag ggt ggt ggc tet gag ggt ggc ! Linker 2--------------------------------------------------- i ! 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270

! GSEGGGSEGGGSGGG 2344 ggt tet gag ggt ggc ggc tet gag gga ggc ggt tee ggt ggt ggc ! Linker 2---------------------------------------------------- j ! 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285

! SGSGDFDYEKMANAN 2389 tet ggt tec ggt gat ttt gat tat gaa aag atg gca aac get aat !Linker 2> Domain 3------------------------------------------- j ! 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300

! KGAMTENADENALQS 2434 aag ggg get atg acc gaa aat gee gat gaa aac geg eta cag tet ! Domain 3--------------------------------------------------- i ! 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315

! DAKGKLDSVATDYGA 2479 gac get aaa ggc aaa ett gat tet gtc get act gat tac ggt get ! Domain 3--------------------------------------------------- j ! 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330

! AIDGFIGDVSGLANG 2524 get ate gat ggt ttc att ggt gac gtt tee ggc ett get aat ggt S Domain 3---------------------------------------------------- 1 ! 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345

! NGATGDFAGSNSQMA 2569 aat ggt get act ggt gat ttt get ggc tet aat tee caa atg get ! Domain 3--------------------------------------------------- ! 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360

! QVGDGDNS PLMNNFR 2614 caa gtc ggt gac ggt gat aat tea cct tta atg aat aat ttc cgt ! Domain 3--------------------------------------------------- ; ! 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375

! QYLPSLPQSVECRPF 2659 caa tat tta cct tee etc eet caa teg gtt gaa tgt ege cct ttt ! Domain 3--------------------------------------------------- 1 ! 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390

! VFSAGKPYEFSIDCD 2704 gtc ttt age get ggt aaa cca tat gaa ttt tet att gat tgt gac ! Domain 3---------------------------------------------------

I ! 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405

! KINLFRGVFAFLLYV 2749 aaa ata aac tta ttc cgt ggt gtc ttt geg ttt ett tta tat gtt ! Domain 3--------------> Transmembrane segment-------------- j ! 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420

! ATFMYVFSTFAN ILR 2794 gee acc ttt atg tat gta ttt tet acg ttt get aac ata ctg cgt ! Transmembrane segment---------------------------------> ICA— ; ! 421 422 423 424 425

! N K E S 2839 aat aag gag tet taa ! 2853 ! ICA-----------> ICA = intracellular anchor

I i------------------End of Table-----------------------------------------

Table 38: Whole mature III anchor M13-III

derived anchor with recoded DNA

I ! 12 3

! AAA 1 GCG gcc gca ! Notl...... ! 4 5 6 7 8 9 10 11 12 13 14 15 16 17 ! hhhhhhgaaeqkli 10 cat cat cat cac cat cac ggg gcc gca gaa caa aaa etc ate ; ! 18 19 20 21 22 23 24 25 26 27 28 29

! SEEDLNGAA. AS 52 tea gaa gag gat ctg aat ggg gcc gca Tag GCT AGC ! Nhel. . . j ! 30 31 32 33 34 35 36 37 38 39

! DINDDRM AST 88 GAT ATC aac oat aat cat ata get tet act ! (ON_G37bot) [RC] 5*-c aac aat oat cat ato geG CAt Get gcc gag aca g-3’ ! EcoRV., ! Enterokinase cleavage site. j ! Start mature III (recoded) Domain 1 ----> ! 40 41 42 43

! A E T V

118 IgcCIgaGlacAIgtCJ ! t a t t ! W.T. • ! 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

i ESCLAKPHTENSFTN 130 I gaa | TCC | tgC|CTG|GCC|AaGj ccT|caC|acT|gaGIaat|AGT!ttC|aCA|AatI ! agt tta a a c t a a tea t t c ! W.T. ! MscI____

I ! 59 60 61 62 63 64 '65 66 67 68 69 70 71 72 73

! VWKDDKTLDRYANYE 175 I gtglTGGlaaGI gaTlgaTI aaG| acC ICtT I gAT ICGAj TaT I gcC | aaT [ taC |gaA | ! c accatta tetetg! W.T. ! BspDI...

I ! 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88

! GCLWNATGVVVCTGD 220 I ggC | tgC | Tt A | tgg | aat} geC | ACC IGGC | GtC | gtT | gtC I TGC | ACG | ggC I gaT | ! tteg ta tattttc! W.T. ! SgrAl...... Bsgl....

I ! 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103

! ETQCYGTWVPIGLAI 265 I gaG I acA I caA f tgC I tal I ggC) ACG I TGg I gtG I ccG I atA I gGC | TTA | GCC I at AI ! atgteta tttgette! W.T. ! Pmll.... BlpI..... i ! Domain 1-----> Linker 1----------------> ! 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118

! PENEGGGSEGGGSEG

310 I ccG ! gaG I aaC I gaAl ggC I ggC| ggTI AGC | gaAl ggC | ggTIggC I AGC I gaAl ggC I ! t a t g t t c tet g t c t tet g t ! W.T.

I ! Linker 1----------------------> Domain 2---------------> ! 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133

S GGSEGGGTKPPEYGD 355 IggT | GGAI TCC lgaA| ggA|ggT I ggAlacC | aaG | ccG I ccG I gaAltaT | ggC I gaC | ! cttgtcttattgctt! W.T. ! BamHI..(2/2)

I ! 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148

! TPIPGYTYINPLDGT 4 00 I acT I ccG I atA I CCT | GGTI taC | acC | taC I atT | aaT | ccG | TtA| gaT | ggA|acC| ! attgctttcctcccct! W.T. ! SexAI____ i ! 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163

! YPPGTEQNPANPNPS 4 4 5 I taC I ccT I ccG | ggC I acC I gaA I caG I aaT I ccT I gcC I aaC | ccG | aaC I ccA I AGO I ! TGtttgaccttttt tct ! W.T. ! Hindlll... i ! 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178

! LEESQPLNTFMFQNN 4 90 I TTA I gaA I gaA IAGCI caA I ccG I TtA | aaC | acC I ttT I atg I ttC | caA | aaC I aaC I I c t G G tct gtctttc tgtt! W.T. i Hindlll..

I l 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193

! RFRNRQGALTVYTGT 535 I CgT I ttT I AgG | aaC I CgT | caA | gGT | GCT | CtT | acC I gTG I TAC I AcT I ggA I acC | ! ag cca tag g g ata t t t g c t! W.T. ! HgiAI... BsrGI...

I ! 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208

! VTQGTDPVKTYYQYT 5B0 I gtC I acC I caG I GGT I ACC I gaT I ccT I gtC | aaG | acC I taC I taT | caA I taT I acC I ! ttactcctattcgct! W.T. ! Kpnl... j ! 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223

! PVSSKAMYDAYWNGK 625 |ccG I gtC ITCG I AGt I aaG | gcT I atg I taC I gaT | gcC I taT | tgg | aaT | ggC | aaG I i t a a tea ae tete eta! W.T. ! Bsal.... ! Xhol.... j ! 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238

! FRDCAFHSGFNEDPF 670 I ttT I CgT | gaT | tgT I gcC | ttT | caC I AGC | ggT | ttC I aaC I gaa I gac I CCt I ttT | ! CAaCctet tct c t t G T a c!W.T. 1 ! 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253

! VCEYQGQSSDLPQ PP 715 I gtC 11 gC I gaG I taC I caG I ggT! caG I AGT | AGC I gaT | TtA | ccG [ caG I ccA I CCG I ! t t a t a c a teg tct ccg t a t t ! W.T. ! DrdI..... Agel..... i ! Domain 2--------> Linker 2---------------------> ί 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268

! VNAGGGSGGGSGGGS 760 IGTTI AAC I geG I ggT I ggT j ggT I AGC I ggC I ggA I ggC I AGC I ggC I ggT I ggT | AGC | ! C t t C C c tct t t t tct t c c tct ! W.T. ! Agel.....

Hpal... ! Hindi.

I ! Linker 2----------------------------------------------> Domain 3—> ! 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 ! egggsegggsgggsg 805 1 gaA| ggCIggAjggT | AGC | gaA IggAI ggT I ggCI AGC I ggA| ggC | ggT | AGC IggC | i g t t c tct g t c t tct g t c tct t ! W.T. t i ------------Domain 3-------------------> ! 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298

! SGDFDYEKMANANKG 850 I AGT IggC Igacl ttc I gac I tac I gag I aaa I atgl get | aat | gee jaac I aaa |GGC | ! tee tttttag aettgg! W.T. ! KasI____

I ! 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313

! AMTENADENALQSDA 895 i GCCI atgl act I gag I aac I get I gac I gaG I AAT I GCA! ctg | caa I agt I gat IgCC I ! t catetaegag tct c t ! W.T. ! KasI.... BsmI____ Styl...

I ! 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328

! KGKLDSVATDYGAAI 94 0 IAAGI GGt | aag | tta j gac I age | gTC | GCc I Aca I gac | tat | ggT I GCt |gcc | ate | ! a c a c t t tct t t t c t ! W.T. ! Styl...... PflFI...... * ! 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343

! DGFIGDVSGLANGNG 985 Igacl ggc | ttt 1 ate I ggc I gat | gtc I agt I ggt I ctg | get | aac I ggc I aac I gga | ! t t c t t c t tee C C t t t t t ! W.T. j ! 344 345 346 347 348 349 350 351 352 353

! ATGDFAGSNS 1030 I gee I acc | gga | gac I tte | GCA | GGT | teG I AAT I TCt | ! ttttttct c! W.T. ! BstBI... ! EcoRI... ! BspMI.. j ! 354 355 356 357 358 359 360 361 362 363

! QMAQVGDGDN 1060 cag atg geC CAG GTT GGA GAT GGg gac aac ! a tactettt! W.T. ! XemI................

I ! 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379

! SPLMNNFRQYLPSLPQ 1090 agt ccg ett atg aac aac ttt aga cag tac ett ccg tct ett ccg cag ! tea tta t t cct a tta t c c t a! W.T.

I ! 3B0 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395

! SVECRPFV FSAGKPYE 1138 agt gtc gag tgc cgt cca ttc gtt ttc tct gee ggc aag cct tac gag ! teg tatettet age t t a a t a ! W.T.

I ! Domain 3--------------------------------------> ! 396 397 398 399 400 401 402 403 404 405 406 407

! FSIDCDKINLFR

1186 ttc aGC Ate gac TGC gat aag ate aat ett ttC CGC 1 t tct ttt caa eta t ! BstAPI........ Sadi...

I ! transmembrane segment-------------> ! 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423

! GVFAFLLYVAT FMYVF 1222 GGc gtt ttc get ttc ttg eta tac gtc get act ttc atg tac gtt ttc ! tctgtcttattcct tat! W.T.

I ! 424 425 426 427 428 429 430 431 432 433 434 435

! STFA.NIL RNKES 1270 aGC ACT TTC GCC AAT ATT TTA Cgc aac aaa gaa age ! tct gttcacg ttgg tct ! W.T. ! Intracellular anchor.

I !

1306 tag tga tct CCT AGG ! AvrII..

I

1321 aag ccc gee taa tga geg ggc ttt ttt ttt ct ggt ! I Trp terminator I j ! End Fab cassette j----------------------------gnci 0f Table-------------------------

Table 39: ONs to make deletions in III

! ONs for use with NheI

N (ON G29bot) 5'-c gTT gAT ATc gcT Age cTA Tgc-3' ! 22 i this is the reverse complement of 5'-gca tag get age gat ate aac g-3' ! Nhel... scab......... (ON G104top) S'-glatalggdttalgcTlaGCIccglgagiaacIgaalgg-S' ! 30 1 Scab..........Nhel... 104 105 106 107 108 (0N_G236top) 5 ' -cl tttIcacI age|ggt|ttcIGCTIAGO IgacIcctItttIgtcItgc-3 * ! 37 ! Nhel... 236 237 238 239 240 (0N_G236tCS) 5' -c I ttt I cac|age|ggt|ttc[GCTIAGCIgacIcctItttIgtcIAgc-! Nhel... 236 237 238 239 240 gag|tac|cag|ggt|c-3* t 50 i ONs for use with SphI G CAT Gc (ON_X37bot) S'-gAc TgT cTc ggc Age ATg ege cAT Aeg ATc ATc gTT g-3' ! 37

! NDDRMAHA ! (ON_X37bot)*»(RC] 5'-c aac gat gat cgt atg aeG CAt Get gee gag aca gtc-3* S SphI....Scab........... (ON_X104top) 5'-g IgtG ccgIataIggc11tGICAT IGCaIccgI gag|aac|gaa|gg-3* ! 36 ! Scab................SphI.... 104 105 106 107 108 (ON_X236top) 5' -c ItttIcacI age|ggtIttGICaTIgCa|gacI eet|ttt|gtc|tgc-3 * ! 37 ! SphI____ 236 237 238 239 240 (0N_X236tCS) 51 -c I ttt I cac I age | ggt I ttG I CaT | gCa I gac I eet I ttt | gtc (Age-! Nhel... 236 237 238 239 240 gagltaclcaglggtlc-3' ! 50

Table 40: Phage titers and enrichments of a selections with a DY3F31-based human Fab library

Table 41: Frequency of ELISA positives in DY3F31-based Fab libraries

SEQUENCE LISTING

[0200] <110> LADNER, ROBERT C. COHEN, EDWARD H. NASTRI, HORACIO G. ROOKEY, KRISTIN L.

HOET, RENE HOOGENBOOM, HENDRICUS R. J. M.

<120> NOVEL METHODS OF CONSTRUCTING LIBRARIES COMPRISING DISPLAYED AND/OR EXPRESSED MEMBERS OF A DIVERSE FAMILY OF PEPTIDES, POLYPEPTIDES OR PROTEINS AND THE NOVEL LIBRARIES <130> DYAX/002 CIP2 <140> 10/045,674 <141> 2001-10-25 <150> 06/198,069 <151> 2000-04-17 <150> 09/837,306 <151> 2001-04-17 <160> 635 <170> Patentln Ver. 2.1

<210> 1 <211 > 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 1 catgtgtatt actgtgc 17

<210> 2 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>2 cacatccgtg cttcttgcac ggatgtggca cagtaataca catg 44

<210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>3 gtgtattaga ctgctgcc 18

<210> 4 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>4 ggcagcagtc taatacacca catccgtgtt cttcacggat gtg 43

<210>5 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>5 cacatccgtg tttgttacac ggatgtggtg tcttacagtc cattctg 47

<210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>6 cagaatggac tgtaagacac 20

<210>7 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>7 atcgagtctc actgagccac atccgtggtt ttccacggat gtg 43

<210> 8 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>8 gctcagtgag actcgat 17

<210>9 <211 > 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (10)..(24) <223> A, T, C, G, other or unknown <400>9 cacgaggagn nnnnnnnnnn nnnn 24

<210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 10 atgaccgaat tgctacaag 19

<210> 11 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 11 gactcctcag cttcttgctg aggagtcctt gtagcaattc ggtcat 46

<210> 12 <211» 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: 6 His tag <400> 12

His His His His His His 1 5

<210> 13 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6)..(10) <223> A, T, C, G, other or unknown <400> 13 gtctcnnnnn 10

<210> 14 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(6) <223> A, T, C, G, other or unknown <400> 14 nnnnnngagac 11

<210> 15 <211 > 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (11)..(24) <223> A, T, C, G, other or unknown <400> 15 cacggatgtg nnnnnnnnnn nnnn 24

<210> 16 <211 > 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(14) <223> A, T, C, G, other or unknown <400> 16 nnnnnnnnnn nnnncacatc cgtg 24

<210> 17 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 17 gtgtattact gtgc 14

<210> 18 <211 > 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 18 cacatccgtg cacggatgtg gcacagtaat acac 34

<210> 19 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 19 gtgtattaga ctgc 14

<210> 20 <211 > 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 20 gcagtctaat acaccacatc cgtgcacgga tgtg 34

<210> 21 <211 > 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 21 cacatccgtg cacggatgtg gtgtcttaca gtcc 34

<210> 22 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 22 ggactgtaag acac 14

<210> 23 <211 > 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 23 gagtctcact gagccacatc cgtgcacgga tgtg 34

<210> 24 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 24 gctcagtgag actc 14

<210> 25 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 25 gtgtattact gtgc 14

<210> 26 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 26 gtatattact gtgc 14 <210> 27

<211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 27 gtgtattact gtaa 14

<210> 28 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 28 gtgtattact gtac 14

<210> 29 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 29 ttgtattact gtgc 14

<210> 30 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 30 ttgtatcact gtgc 14

<210> 31 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 31 acatattact gtgc 14

<210> 32 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 32 acgtattact gtgc 14

<210> 33 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 33 atgtattact gtgc 14 <210> 34 <211> 101 <212> DNA <213> Homo sapiens <400> 34 agggccacca tgaccaggga cacgtccatc agcacagcct acatgabcga gctgagcagg 60 ctgagatctg acgacacggc cgtgtattac tgtgcgagag- a 101 <210> 35 <211> 98

<212> DNA <213> Homo sapiens <400> 35 agagtcacca ttaccaggga cacatccgcg agcacagcct acatggagct gagcagcctg 60 agatctgaag acacggctgt gtattactgt gcgagaga 98 <210> 36 <211> 98

<212> DNA <213> Homo sapiens <400> 36 agagtcacca tgaccaggaa cacctccata agcacagcct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtattactgt gcgagagg 98 <210> 37 <211> 98

<212> DNA <213> Homo sapiens <400> 37 agagtcacca tgaccacaga cacatccacg agcacagcct acatggagct gaggagcctg 60 agatctgacg acacggccgt gtattactgt gcgagaga 98 <210> 38 <211>98

<212> DNA <213> Homo sapiens <400> 38 agagtcacca tgaccgagga cacatctaca gacacagcct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtattactgt gcaacaga 98 <210> 39 <211>98

<212> DNA <213> Homo sapiens <400> 39 agagtcacca ttaccaggga caggtctatg agcacagcct acatggagct gagcagcctg 60 agatctgagg acacagccat gtattactgt gcaagata 98 <210> 40 <211> 98

<212> DNA <213> Homo sapiens <400> 40 agagteaeea tgaecaggga eacgtecacg agcacagtct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtatcactgc gcgagaga 98 <210>41 <211> 98

<212> DNA <213> Homo sapiens <400> 41 agagtcacca ttaccaggga catgtccaca agcacagcct acatggagct gagcagcctg 60 agacccgagg acacggccgt gtattactgt gcggcaga 98 <210> 42 <211 > 98

<212> DNA <213> Homo sapiens <400> 42

agagtcacga ttaccgcgga cgaatccacg agcacagcct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtattactgt gcgagaga 9B <210> 43 <211> 98

<212> DNA <213> Homo sapiens <400> 43 agagtcacga ttaccgcgga caaatccacg agcacagcct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtattactgt gcgagaga 98 <210> 44 <211> 98

<212> DNA <213> Homo sapiens <400> 44 agagtcacca taaccgcgga cacgtctaca gacacagcct acatggagct gagcagcctg 60 agatctgagg acacggccgt gtattactgt gcaacaga 98 <210> 45 <211 > 100

<212> DNA <213> Homo sapiens <400> 45 aggctcacca tcaccaagga cacctccaaa aaccaggtgg tccttacaat gaccaacatg 60 gaccctgtgg acacagccac atattactgt gcacacagac 100 <210> 46 <211 > 100

<212> DNA <213> Homo sapiens <400> 46 aggctcacca tctccaagga cacctccaaa agccaggtgg tccttaccat gaccaacatg 60 gaccctgtgg acacagccac atattactgt gcacggatac 100 <210> 47 <211 > 100

<212> DNA <213> Homo sapiens <400> 47 aggctcacca tctccaagga cacctccaaa aaccaggtgg tccttacaat gaccaacatg 60 gaccctgtgg acacagccac gtattactgt gcacggatac 100 <210> 48 <211> 98

<212> DNA <213> Homo sapiens <400> 48 cgattcacca tctccagaga caacgccaag aactcactgt atctgcaaat gaacagcctg 60 agagccgagg acacggctgt gtattactgt gcgagaga 99 <210> 49 <211 > 100

<212> DNA <213> Homo sapiens <400> 49 cgattcacca tctccagaga caacgccaag aactccctgt atctgcaaat gaacagtctg 60 agagctgagg acacggcctt gtattactgt gcaaaagata 100 <210> 50 <211> 98

<212> DNA <213> Homo sapiens <400> 50 cgacccacca Cccccaggga caacgccaag aacccaccgc atctgcaaat gaacagcctg €0 agagccgagg acacggccgt gtattactgt gcgagaga 98 <210>51 <211> 98

<212> DNA <213> Homo sapiens <400> 51 cgattcacca tctccagaga aaatgccaag aactccttgt atcttcaaat gaacagcctg 60 agagccgggg acacggctgt gtattactgt gcaagaga 98 <210> 52 <211> 98

<212> DNA <213> Homo sapiens <400> 52 agattcacca tctcaagaga tgattcaaaa aacacgctgt atctgcaaat gaacagcctg 60 aaaaccgagg acacagccgt gtattactgt accacaga 98 <210> 53 <211 > 98

<212> DNA <213> Homo sapiens <400> 53 cgattcacca tctccagaga caacgccaag aactccctgt atctgcaaat gaacagtctg 60 agagccgagg acacggcctt gtatcactgt gcgagaga 98 <210> 54 <211> 98

<212> DNA <213> Homo sapiens <400> 54 cgattcacca tctccagaga caacgccaag aactcactgt atctgcaaat gaacagcctg 60 agagccgagg acacggctgt gtattactgt gcgagaga gg <210> 55 <211> 98

<212> DNA <213> Homo sapiens <400> 55 cggttcacca tctccagaga caattccaag aacacgctgt atctgcaaat gaacagcctg 60 agagccgagg acacggccgt atattactgt gcgaaaga 98 <210> 56 <211> 98

<212> DNA <213> Homo sapiens <400> 56 cgattcacca tctccagaga caattccaag aacacgctgt atctgcaaat gaacagcctg 60 agagctgagg acacggctgt gtattactgt gcgaaaga 98 <210> 57 <211 > 98

<212> DNA <213> Homo sapiens <400> 57 cgactcacca tctccagaga caattccaag aacacgctgt atctgcaaat gaacagcctg 60 agagctgagg acacggctgt gtattactgt gcgagaga 98 <210> 58 <211> 98

<212> DNA <213> Homo sapiens <400> 58 cgattcacca tctccagaga caattccaag aacacgctgt atctgcaaat gaacagcctg 60 agagctgagg acacggctgt gtattactgt gcgaaaga 98 <210> 59 <211> 98

<212> DNA <213> Homo sapiens <400> 59 cgactcacca tctccagaga caattccaag aacacgctgt atctgcaaat gaacagcctg 60 agagccgagg acacggctgt gtattactgt gcgagaga 98 <210> 60 <211 > 100

<212> DNA <213> Homo sapiens <400> 60 cgattcacca tctccagaga caacagcaaa aactccctgt atctgcaaat gaacagtctg 60 agaactgagg acaccgcctt gtattactgt gcaaaagata 100 <210> 61 <211> 98

<212> DNA <213> Homo sapiens <400> 61 cgattcacca tctccagaga caatgccaag aactcactgt atctgcaaat gaacagcctg 60 agagacgagg acacggctgt gtattactgt gcgagaga 98 <210> 62 <211> 98

<212> DNA <213> Homo sapiens <400> 62 agattcacca tctcaagaga tggttccaaa agcaccgect atctgcaaat gaacageetg 60 aaaaccgagg acacagccgt gtattactgt actagaga 98 <210> 63 <211> 98

<212> DNA <213> Homo sapiens <400> 63 cgattcacca tctccagaga caattccaag aacacgctgt atcttcaaat gaacagcctg 60 agagccgagg acacggccgt gtattactgc gcgagaga ‘ 98 <210> 64 <211> 98

<212> DNA <213> Homo sapiens <400> 64 agattcacca tctccagaga caattccaag aacacgctgt atcttcaaat gggcagcctg 60 agagctgagg acatggctgt gtattactgt gcgagaga 98 <210> 65 <211 > 98

<212> DNA <213> Homo sapiens <400> 65 agattcacca tctccagaga caattccaag aacacgctgt atcttcaaat gaacagcctg 60 agagctgagg acacggctgt gtattactgt gcgagaga 98 <210> 66 <211 > 98

<212> DNA <213> Homo sapiens <400> 66 agattcacca tctcaagaga tgattcaaag aactcactgt atctgcaaat gaacagcctg 60 aaaaccgagg acacggccgt gtattactgt gctagaga 98 <210> 67 <211> 98

<212> DNA <213> Homo sapiens <400> 67 aggttcacca tctccagaga tgattcaaag aacacggcgt atctgcaaat gaacagcctg 60 aaaaccgagg acacggccgt gtattactgt actagaca- 98 <210> 68 <211> 98

<212> DNA <213> Homo sapiens <400> 68 cgattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagtctg 60 agagccgagg acacggctgt gtattactgt gcaagaga 98 <210> 69 <211> 98

<212> DNA <213> Homo sapiens <400> 69 agattcacca tctccagaga caattccaag aacacgctgc atcttcaaat gaacagcctg 60 agagctgagg acacggctgt gtattactgt aagaaaga 98 <210> 70 <211> 98

<212> DNA <213> Homo sapiens <400> 70 cgagtcacca tatcagtaga caagtccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgcgg acacggccgt gtattactgt gcgagaga 98 <210>71 <211> 98

<212> DNA <213> Homo sapiens <400> 71 cgagtcacca tgtcagtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgtgg acacggccgt gtattactgt gcgagaaa 98 <210> 72 <211> 98

<212> DNA <213> Homo sapiens <400> 72 cgagttacca tatcagtaga cacgtctaag aaccagttct ccctgaagct gagctctgtg 60 actgccgcgg acacggccgt gtattactgt gcgagaga 98 <210> 73 <211> 98

<212> DNA <213> Homo sapiens <400> 73 cgagtcacca tatcagtaga caggtccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgcgg acacggccgt gtattactgt gccagaga 98 <210> 74 <211>98

<212> DNA <213> Homo sapiens <400> 74 cgagttacca tatcagtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 actgccgcag acacggccgt gtattactgt gccagaga 9Θ <210> 75 <211 > 98

<212> DNA <213> Homo sapiens <400> 75 cgagttacca tatcagtaga cacgtctaag aaccagttct ccctgaagct gagctctgtg 60 actgccgcgg acacggccgt gtattactgt gcgagaga 98 <210> 76 <211 > 98

<212> DNA <213> Homo sapiens <400> 76 cgagtcacca tatcagtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgcgg acacggccgt gtattactgt gcgagaga 98 <210> 77 <211> 98

<212> DNA <213> Homo sapiens <400> 77 cgagtcacca tatccgtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgcag aeacggctgt gtattactgt gcgagaca 98 <210> 78 <211> 98

<212> DNA <213> Homo sapiens <400> 78 cgagccacca tatcagtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 accgctgcgg acacggccgt gtattactgt gcgagaga 98 <210> 79 <211> 98

<212> DNA <213> Homo sapiens <400> 79 cgagtcacca tatcagtaga cacgtccaag aaccagttct ccctgaagct gagctctgtg 60 accgctgcgg acacggccgt gtattactgt gcgagaga 98 <210> 80 <211> 98

<212> DNA <213> Homo sapiens <400> 80 cgagccacca tatcagtaga cacgcccaag aaccagttct ccctgaagct gagctctgtg 60 accgccgcag acacggccgt gtattactgt gcgagaga 98 <210> 81 <211> 98

<212> DNA <213> Homo sapiens <400> 81 caggtcacca tctcagccga caagtccatc agcaccgcct acctgcagtg gagcagcctg 60 aaggcctcgg acaccgccat gtattactgt gcgagaca 98 <210> 82 <211 > 96

<212> DNA <213> Homo sapiens <400> 82 cacgtcacca tcccagctga caagtccatc agcactgcct acctgcagtg gagcagcctg 60 aaggcctcgg acaccgccat gtattactgt gcgaga 96 <210> 83 <211> 98

<212> DNA <213> Homo sapiens <400> 83 cgaataacca tcaacccaga cacatccaag aaccagttct ccctgcagct gaactctgtg 60 actcccgagg acacggctgt gtattactgt gcaagaga 98 <210> 84 <211 >98

<212> DNA <213> Homo sapiens <400> 84 cggtttgtct tctccttgga cacctctgtc agcacggcat atctgcagat ctgcagccta 60 aaggctgagg acactgccgt gtattactgt gcgagaga 98

<210> 85 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (3)..(9) <223> A, T, C, G, other or unknown <400> 85 gcnnnnnnngc 11

<210> 86 <211 > 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 modified_base <222> (4)..(7) <223> A, T, C, G, other or unknown <400> 86 caynnnnrtg 10

<210> 87 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6)..(11) <223> A, T, C, G, other or unknown <400> 87 gagtcnnnnn n 11

<210> 88 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(6) <223> A, T, C, G, other or unknown <400> 88 nnnnnngagac 11

<210> 89 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified base <222> (4)..(7) <223> A, T, C, G, other or unknown <400 89 gaannnnttc 10

<210 90 <211> 90 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic 3-23 FR3 nucleotide sequence <220 <221 > CDS <222> (1)..(90) <220> <221 > modified_base <222> (3)

<223> A, T, C or G <220 <221 > modified_base <222> (9)

<223> A, T, C or G <220 <221 > modified_base <222> (12)

<223> A, T, C or G <220> <221 > modified_base <222> (21)

<223> A, T, C or G <220 <221 > modified_base <222> (30)

<223> A, T, C or G <220 <221 > modified_base <222> (36)

<223> A, T, C or G <220 <221 > modified_base <222> (51)

<223> A, T, C or G <220 <221 > modified_base <222> (57)

<223> A, T, C or G <220 <221 > modified_base <222> (60)

<223> A, T, C or G <220> <221 > modified_base <222> (69)

<223> A, T, C or G <220> <221 > modified_base <222> (72)

<223> A, T, C or G <220> <221 > modified_base <222> (75)

<223> A, T, C or G <220> <221 > modified_base <222> (78)

<223> A, T, C or G <220> <221 > modified base <222> (87)

<223> A, T, C or G <400> 90 acn ath wsn mgn gay aay wsn aar aay acn ytn tay ttn car atg aay 48

Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn 15 10 15 wsn ttr mgn gen gar gay acn gen gtn tay tay tgy gen aar 90

Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys 20 25 30

<210> 91 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic 3-23 FR3 protein sequence <400> 91

Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn 1 5 10 15

Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys 20 25 30

<210> 92 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 92 agttctccct geagetgaae tc 22

<210> 93 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 93 cactgtatct gcaaatgaac ag 22

<210> 94 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 94 ccctgtatct gcaaatgaac ag 22

<210> 95 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 95 ccgcctacct gcagtggagc ag 22

<210> 96 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 96 cgctgtatct gcaaatgaac ag 22

<210> 97 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 97 cggcatatct gcagatctgc ag 22

<210> 98 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 98 cggcgtatct gcaaatgaac ag 22 <210> 99

<211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 99 ctgcctacct gcagtggagc ag 22

<210> 100 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400>100 tcgcctatct gcaaatgaac ag 22

<210> 101 <211 > 63 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 101 cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaacagctta 60 agg 63

<210> 102 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 102 caagtagaga gtattcttag agttgtctct agacttagtg aagcg 45

<210> 103 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 103 cgcttcacta agtctagaga caactctaag aatactctct acttgcagct gaac 54

<210> 104 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 104 cgcttcacta agtctagaga caactctaag aatactctct acttgcaaat gaac 54

<210> 105 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>105 cgcttcacta agtctagaga caactctaag aatactctct acttgcagtg gage 54

<210> 106 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400>106 cgcttcacta agtctagaga c 21

<210> 107 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400>107 aeatggaget gagcagcctg ag 22

<210> 108 <211>22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400>108 aeatggaget gageaggetg ag 22

<210> 109 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400>109 aeatggaget gaggagcctg ag 22

<210> 110 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 110 acctgcagtg gagcagcctg aa 22

<210> 111 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 111 atctgcaaat gaacagcctg aa 22

<210> 112 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 112 atctgcaaat gaacagcctg ag 22

<210> 113 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 113 atctgcaaat gaacagtctg ag 22

<210> 114 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 114 atctgcagat ctgcagccta aa 22

<210> 115 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 115 atcttcaaat gaacagcctg ag 22

<210> 116 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 116 atcttcaaat gggcagcctg ag 22

<210> 117 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 117 ccctgaagct gagctctgtg ac 22

<210> 118 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 118 ccctgcagct gaactctgtg ac 22

<210> 119 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 119 tccttacaat gaccaacatg ga 22

<210> 120 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 120 tccttaccat gaccaacatg ga 22

<210> 121 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 121 acatggagct gagcagcctg ag 22 <210> 122

<211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 122 ccctgaagct gagctctgtg ac 22

<210> 123 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 123 cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaac 54

<210> 124 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 124 cgcttcactc agtctagaga taacagtaaa aatactttgt acttgcagct gagcagcctg 60

<210> 125 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>125 cgcttcactc agtctagaga taacagtaaa aatactttgt acttgcagct gagctctgtg 60

<210> 126 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 126 tcagctgcaa gtacaaagta tttttactgt tatctctaga ctgagtgaag cg 52

<210> 127 <211 > 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>127 cgcttcactc agtctagaga taac 24

<210> 128 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 128 ccgtgtatta ctgtgcgaga ga 22

<210> 129 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 129 ctgtgtatta ctgtgcgaga ga 22

<210> 130 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 130 ccgtgtatta ctgtgcgaga gg 22

<210> 131 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 131 ccgtgtatta ctgtgcaaca ga 22

<210> 132 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 132 ccatgtatta ctgtgcaaga ta 22

<210> 133 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 133 ccgtgtatta ctgtgcggca ga 22

<210> 134 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 134 ccacatatta ctgtgcacac ag 22

<210> 135 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>135 ccacatatta ctgtgcacgg at 22

<210> 136 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 136 ccacgtatta ctgtgcacgg at 22

<210> 137 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>137 ccttgtatta ctgtgcaaaa ga 22

<210> 138 <211 >22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 138 ctgtgtatta ctgtgcaaga ga 22

<210> 139 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 139 ccgtgtatta ctgtaccaca ga 22

<210> 140 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>140 ccttgtatca ctgtgcgaga ga 22

<210> 141 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 141 ccgtatatta ctgtgcgaaa ga 22

<210> 142 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 142 ctgtgtatta ctgtgcgaaa ga 22

<210> 143 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 143 ccgtgtatta ctgtactaga ga 22

<210> 144 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 144 ccgtgtatta ctgtgctaga ga 22 <210> 145 <211> 22

<212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>145 ccgtgtatta ctgtactaga ca 22

<210> 146 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>146 ctgtgtatta ctgtaagaaa ga 22

<210> 147 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>147 ccgtgtatta ctgtgcgaga aa 22

<210> 148 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>148 ccgtgtatta ctgtgccaga ga 22

<210> 149 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>149 ctgtgtatta ctgtgcgaga ca 22

<210> 150 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 150 ccatgtatta ctgtgcgaga ca 22

<210> 151 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 151 ccatgtatta ctgtgcgaga 20

<210> 152 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 152 ccgtgtatta ctgtgcgaga g 21

<210> 153 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 153 ctgtgtatta ctgtgcgaga g 21

<210> 154 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 154 ccgtgtatta ctgtgcgaga g 21

<210> 155 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 155 ccgtatatta ctgtgcgaaa g 21

<210> 156 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 156 ctgtgtatta ctgtgcgaaa g 21

<210> 157 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 157 ctgtgtatta ctgtgcgaga c 21

<210> 158 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 158 ccatgtatta ctgtgcgaga c 21

<210> 159 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 159 ccatgtatta ctgtgcgaga 20

<210> 160 <211> 94 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 160 ggtgtagtga tctagtgaca actctaagaa tactctctac ttgcagatga acagctttag 60 ggctgaggac actgcagtct actattgtgc gaga 94

<210> 161 <211> 94 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 161 ggtgtagtga tctagtgaca actctaagaa tactctctac ttgcagatga acagctttag 60 ggctgaggac actgcagtct actattgtgc gaaa 94

<210> 162 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 162 atagtagact gcagtgtcct cagcccttaa gctgttcatc tgcaagcaga gagtattctt 60 agagttgtct ctagatcact acacc 85

<210> 163 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 163 ggtgtagtga tctagagaca ac 22

<210> 164 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 164 ggtgtagtga aacagcttta gggctgagga cactgcagtc tactattgtg cgaga 55

<210> 165 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 165 ggtgtagtga aacagcttta gggctgagga cactgcagtc tactattgtg cgaaa 55

<210> 166 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 166 atagtagact gcagtgtcct cagcccttaa gctgtttcac tacacc 46

<210> 167 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 167 ggtgtagtga aacagcttaa gggctgagga cactgcagtc tactat 46 <210> 168 <211> 26

<212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 168 ggtgtagtga aacagcttaa gggctg 26

<210> 169 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 169 agttctccct gcagctgaac tc 22

<210> 170 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 170 cactgtatct gcaaatgaac ag 22

<210> 171 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 171 ccctgtatct gcaaatgaac ag 22

<210> 172 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 172 ccgcctacct gcagtggagc ag 22

<210> 173 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 173 cgctgtatct gcaaatgaac ag 22

<210> 174 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 174 cggcatatct gcagatctgc ag 22

<210> 175 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 175 cggcgtatct gcaaatgaac ag 22

<210> 176 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 176 ctgcctacct gcagtggagc ag 22

<210> 177 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 177 tcgcctatct gcaaatgaac ag 22

<210> 178 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 178 acatggagct gagcagcctg ag 22

<210> 179 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 179 acatggagct gagcaggctg ag 22

<210> 180 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 180 acatggagct gaggagcctg ag 22

<210> 181 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 181 acctgcagtg gagcagcctg aa 22

<210> 182 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 182 atctgcaaat gaacagcctg aa 22

<210> 183 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 183 atctgcaaat gaacagcctg ag 22

<210> 184 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 184 atctgcaaat gaacagtctg ag 22

<210> 185 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 185 atctgcagat ctgcagccta aa 22

<210> 186 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 186 atcttcaaat gaacagcctg ag 22

<210> 187 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 187 atcttcaaat gggcagcctg ag 22

<210> 188 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 188 ccctgaagct gagctctgtg ac 22

<210> 189 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 189 ccctgcagct gaactctgtg ac 22

<210> 190 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>190 tccttacaat gaccaacatg ga 22 <210> 191 <211> 22

<212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 191 tccttaccat gaccaacatg ga 22

<210> 192 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 192 ccgtgtatta ctgtgcgaga ga 22

<210> 193 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 193 ctgtgtatta ctgtgcgaga ga 22

<210> 194 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 194 ccgtgtatta ctgtgcgaga gg 22

<210> 195 <211 >22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>195 ccgtgtatta ctgtgcaaca ga 22

<210> 196 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>196 ccatgtatta ctgtgcaaga ta 22

<210> 197 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>197 ccgtgtatta ctgtgcggca ga 22

<210> 198 <211 >22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>198 ccacatatta ctgtgcacac ag 22

<210> 199 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>199 ccacatatta ctgtgcacgg at 22

<210> 200 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 200 ccacgtatta ctgtgcacgg at 22

<210> 201 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 201 ccttgtatta ctgtgcaaaa ga 22

<210> 202 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 202 ctgtgtatta ctgtgcaaga ga 22

<210> 203 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 203 ccgtgtatta ctgtaccaca ga 22

<210> 204 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 204 ccttgtatca ctgtgcgaga ga 22

<210> 205 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 205 ccgtatatta ctgtgcgaaa ga 22

<210> 206 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 206 ctgtgtatta ctgtgcgaaa ga 22

<210> 207 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 207 ccgtgtatta ctgtactaga ga 22

<210> 208 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 208 ccgtgtatta ctgtgctaga ga 22

<210> 209 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 209 ccgtgtatta ctgtactaga ca 22

<210 210 <211> 22 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 210 ctgtgtatta ctgtaagaaa ga 22

<210 211 <211 >22 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 211 ccgtgtatta ctgtgcgaga aa 22

<210 212 <211> 22 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 212 ccgtgtatta ctgtgccaga ga 22

<210 213 <211> 22 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 213 ctgtgtatta ctgtgcgaga ca 22 <210 214 <211> 22

<212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 214 ccatgtatta ctgtgcgaga ca 22

<210> 215 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 215 ccatgtatta ctgtgcgaga aa 22 <210> 216 <211> 90

<212> DNA <213> Homo sapiens <400 216 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg cttctggata caccctcacc 90 <210> 217 <211 > 90

<212> DNA <213> Homo sapiens <400> 217 caggtccagc ttgtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtt 60 tcctgcaagg cttctggata caccttcact 90 <210 218 <211> 90

<212> DNA <213> Homo sapiens <400 218 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg cttctggata caccttcacc 90 <210 219 <211> 90

<212> DNA <213> Homo sapiens <400 219 caggttcagc tggtgcagtc tggagctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg cttctggtta cacctttacc 90 <210 220 <211> 90

<212> DNA <213> Homo sapiens <400 220 caggtccagc tggtacagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg tttccggata caccctcact 90 <210> 221 <211> 90

<212> DNA <213> Homo sapiens <400> 221 cagatgcagc tggtgcagtc tggggctgag gtgaagaaga ctgggtcctc agtgaaggtt 60 tcctgcaagg cttccggata caccttcacc 90 <210> 222 <211> 90

<212> DNA <213> Homo sapiens <400> 222 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtt 60 tcctgcaagg catctggata caccttcacc 90 <210> 223 <211> 90

<212> DNA <213> Homo sapiens <400> 223 caaatgeagc tggtgcagtc tgggcctgag gtgaagaagc ctgggacctc agtgaaggtc 60 tcctgcaagg cttctggatt cacctttact 90 <210> 224 <211> 90

<212> DNA <213> Homo sapiens <400> 224 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagc 90 <210> 225 <211> 90

<212> DNA <213> Homo sapiens <400> 225 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagc 90 <210> 226 <211> 90

<212> DNA <213> Homo sapiens <400> 226 gaggtccage tggtacagtc tggggctgag gtgaagaagc ctggggctac agtgaaaatc 60 tcctgcaagg tttctggata caccttcacc 90 <210> 227 <211> 90

<212> DNA <213> Homo sapiens <400> 227 cagetcacct tgaaggagtc tggtcctacg ctggtgaaac ccacacagac cctcacgctg 60 acctgcacct tctctgggtt ctcactcagc 90 <210> 228 <211> 90

<212> DNA <213> Homo sapiens <400> 228 caggtcacct tgaaggagtc tggtcctgtg ctggtgaaac ccacagagac cctcacgctg 60 acctgcaccg tctctgggtt ctcactcagc 90 <210> 229 <211> 90

<212> DNA <213> Homo sapiens <400> 229 caggtcacct tgaaggagtc tggtcctgcg ctggtgaaac ccacacagac cctcacactg 60 acctgcacct tctctgggtt ctcactcagc 90 <210> 230 <211> 90

<212> DNA <213> Homo sapiens <400> 230 gaggtgeage tggtggagtc tgggggaggc ttggtceagc ctggggggtc cctgagactc 60 tcetgtgcag cctctggatt cacctttagt 90 <210> 231 <211> 90

<212> DNA <213> Homo sapiens <400> 231 gaagtgcagc tggtggagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcetgtgcag cctctggatt cacctttgat 90 <210> 232 <211> 90

<212> DNA <213> Homo sapiens <400> 232 eaggtgeage tggtggagtc tgggggaggc ttggtcaagc ctggagggtc cctgagactc 60 tcetgtgcag cctctggatt caccttcagt 90 <210> 233 <211> 90

<212> DNA <213> Homo sapiens <400> 233 gaggtgeage tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcetgtgcag cctctggatt caccttcagt 90 <210> 234 <211> 90

<212> DNA <213> Homo sapiens <400> 234 gaggtgeage tggtggagtc tgggggaggc ttggtaaagc ctggggggtc ccttagactc 60 tcetgtgcag cctctggatt cactttcagt 90 <210> 235 <211> 90

<212> DNA <213> Homo sapiens <400> 235 gaggtgeage tggtggagtc tgggggaggt gtggtacggc ctggggggtc cctgagactc 60 tcetgtgcag cctctggatt cacctttgat 90 <210> 236 <211> 90

<212> DNA <213> Homo sapiens <400> 236 gaggtgcagc tggtggagtc tgggggaggc ctggtcaagc ctggggggtc cctgagactc 60 ccctgtgcag cctccggatt caccttcagt 90 <210> 237 <211> 90

<212> DNA <213> Homo sapiens <400> 237 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgeag cctctggatt cacctttagc 90 <210> 238 <211> 90

<212> DNA <213> Homo sapiens <400> 238 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgeag cctctggatt caccttcagt 90 <210> 239 <211> 90

<212> DNA <213> Homo sapiens <400> 239 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgeag cctctggatt caccttcagt 90 <210> 240 <211> 90

<212> DNA <213> Homo sapiens <400> 240 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgeag cctctggatt caccttcagt 90 <210> 241 <211> 90

<212> DNA <213> Homo sapiens <400> 241 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgeag egtetggatt caccttcagt 90 <210> 242 <211> 90

<212> DNA <213> Homo sapiens <400> 242 gaagtgeage tggtggagtc tgggggagtc gtggtacagc ctggggggtc cctgagactc 60 tcctgtgeag cctctggatt cacctttgat 90 <210> 243 <211 >90

<212> DNA <213> Homo sapiens <400> 243 gaggtgeage tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgeag cctctggatt caccttcagt 90 <210> 244 <211> 90

<212> DNA <213> Homo sapiens <400> 244 gaggtgcagc tggtggagtc tgggggaggc ttggtacagc cagggcggtc cctgagactc 60 tcctgtacag cttctggatt cacctttggt 90 <210> 245 <211> 90

<212> DNA <213> Homo sapiens <400> 245 gaggtgcagc tggtggagac tggaggaggc ttgatccagc ctggggggtc cctgagactc 60 tcctgtgcag cctctgggtt caccgtcagt 90 <210> 246 <211> 90

<212> DNA <213> Homo sapiens <400> 246 gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt 90 <210> 247 <211> 90

<212> DNA <213> Homo sapiens <400> 247 gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccgtcagt 90 <210> 248 <211> 90

<212> DNA <213> Homo sapiens <400> 248 gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggagggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt 90 <210> 249 <211> 90

<212> DNA <213> Homo sapiens <400> 249 gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgaaactc 60 tcctgtgcag cctctgggtt caccttcagt 90 <210> 250 <211> 90

<212> DNA <213> Homo sapiens <400> 250 gaggtgcagc tggtggagtc cgggggaggc ttagttcagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt 90 <210> 251 <211> 90

<212> DNA <213> Homo sapiens <400> 251 gaggtgcagc cggtggagcc tcggggagtc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccgtcagt 90 <210> 252 <211> 90

<212> DNA <213> Homo sapiens <400> 252 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggggac cctgtccctc 60 acctgcgetg tctctggtgg ctccatcagc 90 <210> 253 <211> 90

<212> DNA <213> Homo sapiens <400> 253 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggacac cctgtccctc 60 acctgcgetg tetetggtta ctccatcagc 90 <210> 254 <211> 90

<212> DNA <213> Homo sapiens <400> 254 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcacagac cctgtccctc 60 acctgcactg tctctggtgg ctccatcagc 90 <210> 255 <211> 90

<212> DNA <213> Homo sapiens <400> 255 cagctgcagc tgcaggagtc eggeteagga ctggtgaagc cttcacagac cctgtccctc 60 acctgcgetg tctctggtgg ctccatcagc 90 <210> 256 <211> 90

<212> DNA <213> Homo sapiens <400> 256 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcacagac cctgtccctc 60 acctgcactg tctctggtgg ctccatcagc 90 <210> 257 <211> 90

<212> DNA <213> Homo sapiens <400> 257 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcacagac cctgtccctc 60 acctgcactg tctctggtgg ctccatcagc 90 <210> 258 <211> 90

<212> DNA <213> Homo sapiens <400> 258 caggtgcagc taeageagtg gggcgcagga ctgttgaagc etteggagae cctgtccctc 60 acctgcgetg tctatggtgg gtccttcagt 90 <210> 259 <211 >90

<212> DNA <213> Homo sapiens <400> 259 cagctgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggagac cctgtccctc 60 acctgcactg tctctggtgg ctccatcagc 90 <210> 260 <211> 90

<212> DNA <213> Homo sapiens <400> 260 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggagac cctgtccctc 60 acctgcactg tctctggtgg ctccatcagt 90 <210> 261 <211> 90

<212> DNA <213> Homo sapiens <400> 261 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggagac cctgtccctc 60 acctgcactg tctctggtgg ctccgtcagc 90 <210> 262 <211> 90

<212> DNA <213> Homo sapiens <400> 262 caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggagac cctgtccctc 60 acctgcgctg tctctggtta ctccatcagc 90 <210> 263 <211> 90

<212> DNA <213> Homo sapiens <400> 263 gaggtgcagc tggtgcagtc tggagcagag gtgaaaaagc ccggggagtc tctgaagatc 60 tcctgtaagg gttctggata cagctttacc 90 <210> 264 <211> 90

<212> DNA <213> Homo sapiens <400> 264 gaagtgcagc tggtgcagtc tggagcagag gtgaaaaagc ccggggagtc tctgaggatc 60 tcctgtaagg gttctggata cagctttacc 90 <210> 265 <211> 90

<212> DNA <213> Homo sapiens <400> 265 caggtacagc tgcagcagtc aggtccagga ctggtgaagc cctcgcagac cctctcactc 60 acctgtgcca tctccgggga cagtgtctct 90 <210> 266 <211> 90

<212> DNA <213> Homo sapiens <400> 266 caggtgcagc tggtgcaatc tgggtctgag ttgaagaagc ctggggcctc agtgaaggtt 60 tcctgcaagg cttctggata caccttcact 90

<210> 267 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 267 ccgtgtatta ctgtgcgaga ga 22

<210> 268 <211 >22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 268 ctgtgtatta ctgtgcgaga ga 22

<210> 269 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 269 ccgtgtatta ctgtgcgaga gg 22

<210> 270 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 270 ccgtatatta ctgtgcgaaa ga 22

<210> 271 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 271 ctgtgtatta ctgtgcgaaa ga 22

<210> 272 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 272 ctgtgtatta ctgtgcgaga ca 22

<210> 273 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 273 ccatgtatta ctgtgcgaga ca 22

<210> 274 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 274 ccatgtatta ctgtgcgaga aa 22 <210> 275 <211> 69

<212> DNA <213> Homo sapiens <400> 275 gacatccaga cgacccagtc tccatcctec ctgtetgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 <210> 276 <211> 69

<212> DNA <213> Homo sapiens <400> 276 gacatccaga tgacccagtc tccatcctcc ctgtetgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 <210> 277 <211> 69

<212> DNA <213> Homo sapiens <400> 277 gacatccaga tgacccagtc tccatcctcc ctgtetgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 <210> 278 <211> 69

<212> DNA <213> Homo sapiens <400> 278 gacatccaga tgacccagtc tccatcctcc ctgtetgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 <210> 279 <211> 69

<212> DNA <213> Homo sapiens <400> 279 gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 <210> 280 <211> 69

<212> DNA <213> Homo sapiens <400> 280 gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 <210> 281 <211> 69

<212> DNA <213> Homo sapiens <400> 281 aacatccaga tgacccagtc tccatctgcc atgtctgcat ctgtaggaga cagagtcacc 60 atcacttgt 69 <210> 282 <211> 69

<212> DNA <213> Homo sapiens <400> 282 gacatccaga tgacccagtc tccatcctca ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgt 69 <210> 283 <211> 69

<212> DNA <213> Homo sapiens <400> 283 gacatccaga tgacccagtc tccatcctca ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgt 69 <210> 284 <211> 69

<212> DNA <213> Homo sapiens <400> 284 gccatccagt tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 <210> 285 <211> 69

<212> DNA <213> Homo sapiens <400> 285 gccatccagt tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 <210> 286 <211> 69

<212> DNA <213> Homo sapiens <400> 286 gacatccaga tgacccagtc tccatcttcc gtgtctgcat ctgtaggaga cagagtcacc 60 atcacttgt 69 <210> 287 <211> 69

<212> DNA <213> Homo sapiens <400> 287 gacatccaga tgacccagtc tccatcttct gtgtctgcat ctgtaggaga cagagtcacc 60 atcacttgt 69 <210> 288 <211> 69

<212> DNA <213> Homo sapiens <400> 288 gacatccagt tgacccagtc tccatccttc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc· 69 <210> 289 <211> 69

<212> DNA <213> Homo sapiens <400> 289 gccatccgga tgacccagtc tccattctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 <210> 290 <211> 69

<212> DNA <213> Homo sapiens <400> 290 gccatccgga tgacccagtc tccatcctca ttctctgcat ctacaggaga cagagtcacc 60 atcacttgt 69 <210> 291 <211 >69

<212> DNA <213> Homo sapiens <400> 291 gtcatctgga tgacccagtc tccatcctta ctctctgcat ctacaggaga cagagtcacc 60 atcagttgt 69 <210> 292 <211> 69

<212> DNA <213> Homo sapiens <400> 292 gccatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 <210> 293 <211> 69

<212> DNA <213> Homo sapiens <400> 293 gacatccaga tgacccagtc tccttccacc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgc 69 <210> 294 <211> 69

<212> DNA <213> Homo sapiens <400> 294 gatattgtga tgacccagac tccactctcc ctgcccgtca cccctggaga gccggcctcc 60 atctcctgc 69 <210> 295 <211> 69

<212> DNA <213> Homo sapiens <400> 295 gatattgtga tgacccagac tccactctcc ctgcccgtca cccctggaga gccggcctcc 60 atctcctgc 69 <210> 296 <211> 69

<212> DNA <213> Homo sapiens <400> 296 gatgttgtga tgactcagtc tccactctcc ctgcccgtca cccttggaca gccggcctcc 60 atctcctgc 69 <210> 297 <211> 69

<212> DNA <213> Homo sapiens <400> 297 gatgttgtga tgactcagtc tccactctcc ctgcccgtca cccttggaca gccggcctcc 60 atctcctgc 69 <210> 298 <211> 69

<212> DNA <213> Homo sapiens <400> 298 gatattgtga tgacccagac tccactctct ctgtccgtca cccctggaca gccggcctcc 60 atctcctgc 69 <210> 299 <211> 69

<212> DNA <213> Homo sapiens <400> 299 gatattgtga tgacccagac tccactctct ctgtccgtca cccctggaca gccggcctcc 60 atctcctgc 69 <210> 300 <211> 69

<212> DNA <213> Homo sapiens <400> 300 gatattgtga tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc 60 atctcctgc 69 <210> 301 <211> 69

<212> DNA <213> Homo sapiens <400> 301 gatattgtga tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc 60 atctcctgc 69

<210> 302 <211> 69 <212> DNA <213> Homo sapiens <400> 302 gatattgcga tgacccagac tccactctcc tcacctgtca cccttggaca gccggcctcc 60 atctcctgc 69 <210> 303 <211> 69

<212> DNA <213> Homo sapiens <400> 303 gaaattgtgt tgacgcagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgc 69 <210> 304 <211> 69

<212> DNA <213> Homo sapiens <400> 304 gaaattgtgt tgacgcagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgc 69 <210> 305 <211> 69

<212> DNA <213> Homo sapiens <400> 305 gaaatagtga tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60 ctctcctgc 69 <210> 306 <211> 69

<212> DNA <213> Homo sapiens <400> 306 gaaatagtga tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60 ctctcctgc 69 <210> 307 <211> 69

<212> DNA <213> Homo sapiens <400> 307 gaaattgtgt tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgc 69 <210> 308 <211> 69

<212> DNA <213> Homo sapiens <400> 308 gaaattgtgt tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgc 69 <210> 309 <211> 69

<212> DNA <213> Homo sapiens <400> 309 gaaattgtaa tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgc 69 <210> 310 <211> 69

<212> DNA <213> Homo sapiens <400> 310 gacatcgtga tgacccagtc tccagactcc ctggctgtgt ctctgggcga gagggccacc 60 atcaactgc 69 <210> 311 <211> 69

<212> DNA <213> Homo sapiens <400> 311 gaaacgacac tcacgcagcc tccagcattc atgtcagcga ctccaggaga caaagtcaac 60 atctcctgc 69 <210> 312 <211> 69

<212> DNA <213> Homo sapiens <400 312 gaaattgtgc tgactcagtc tccagacttt cagtctgtga ctceaaagga gaaagtcacc 60 atcacctgc 69 <210> 313 <211> 69

<212> DNA <213> Homo sapiens <400> 313 gaaattgtgc tgactcagtc tccagacttt cagtctgtga ctccaaagga gaaagtcacc 60 atcacctgc 69 <210> 314 <211 > 69

<212> DNA <213> Homo sapiens <400> 314 gatgttgtga tgacacagtc tccagctttc ctctctgtga ctccagggga gaaagtcacc 60 atcacctgc 69 <210> 315 <211> 66

<212> DNA <213> Homo sapiens <400> 315 cagtctgtgc tgactcagcc accctcggtg tctgaagccc ccaggcagag ggtcaccatc 60 tcctgt 66 <210> 316 <211 >66

<212> DNA <213> Homo sapiens <400> 316 cagtctgtgc tgacgcagcc gccctcagtg tctggggccc cagggcagag ggtcaccatc 60 teetgc 66 <210> 317 <211> 66

<212> DNA <213> Homo sapiens <400> 317 cagtecgtge tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgt 66 <210> 318 <211> 66

<212> DNA <213> Homo sapiens <400 318 cagtctgtgc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgt 66 <210> 319 <211> 66 <212> DNA <213> Homo sapiens <400> 319 cagtctgtgt tgacgcagcc gccctcagtg tctgcggccc caggacagaa ggtcaccatc 60 tcctgc 66 <210> 320 <211> 66

<212> DNA <213> Homo sapiens <400 320 cagtctgccc tgactcagcc tccctccgcg tccgggtctc ctggacagtc agtcaccatc 60 tcctgc 66 <210> 321 <211> 66

<212> DNA <213> Homo sapiens <400> 321 cagtctgccc tgactcagcc tcgctcagtg tccgggtctc ctggacagtc agtcaccatc 60 tcctgc 66 <210 322 <211> 66

<212> DNA <213> Homo sapiens <400 322 cagtctgccc tgactcagcc tgcctccgtg tctgggtccc ctggacagtc gatcaccatc 60 tcctgc 66 <210 323 <211> 66

<212> DNA <213> Homo sapiens <400 323 cagtctgccc tgactcagcc tcectccgtg tccgggtctc ctggacagtc agtcaccatc 60 tcctgc 66 <210 324 <211> 66

<212> DNA <213> Homo sapiens <400 324 cagtctgccc tgactcagcc tgcctccgtg tctgggtctc ctggacagtc gatcaccatc 60 tcctgc 66 <210> 325 <211> 66

<212> DNA <213> Homo sapiens <400> 325 tcctatgagc tgactcagcc accctcagtg tccgtgtccc caggacagac agccagcatc 60 acctgc 66 <210> 326 <211> 66 <212> DNA <213> Homo sapiens <400> 326 tcctatgagc tgactcagcc actctcagtg tcagtggcce tgggacagac ggccaggatt 60 acctgt 66 <210> 327 <211> 66 <212> DNA <213> Homo sapiens <400> 327 tcctatgagc tgacacagcc accctcggtg tcagtgtccc caggacaaac ggccaggatc 60 acctgc 66 <210> 328 <211> 66

<212> DNA <213> Homo sapiens <400> 328 tcctatgagc tgacacagcc accctcggtg tcagtgtccc taggacagat ggccaggatc 60 acctgc 66 <210> 329 <211> 66

<212> DNA <213> Homo sapiens <400> 329 tcttctgagc tgactcagga ccctgctgtg tctgtggcct tgggacagac agtcaggatc 60 acatgc 66 <210> 330 <211> 66

<212> DNA <213> Homo sapiens <400> 330 tcctatgtgc tgactcagcc accctcagtg tcagtggccc caggaaagac ggccaggatt 60 acctgt 66 <210> 331 <211> 66 <212> DNA <213> Homo sapiens <400> 331 tcctatgagc tgacacagct accctcggtg tcagtgtccc caggacagac agccaggatc 60 acctgc 66 <210> 332 <211> 66

<212> DNA <213> Homo sapiens <400> 332 tcctatgagc tgatgcagcc accctcggtg tcagtgtccc caggacagac ggccaggatc 60 acctgc 66 <210> 333 <211> 66

<212> DNA <213> Homo sapiens <400> 333 tcctatgagc tgacacagcc atcctcagtg tcagtgtctc cgggacagac agccaggatc 60 acctgc 66 <210> 334 <211> 66

<212> DNA <213> Homo sapiens <400> 334 ctgcctgtgc tgactcagcc cccgtctgca tctgccttgc tgggagcctc gatcaagctc 60 acctgc 66 <210> 335 <211> 66

<212> DNA <213> Homo sapiens <400> 335 cagcctgtgc tgactcaatc atcctctgcc tctgcttccc tgggatcctc ggtcaagctc 60 acctgc 66 <210> 336 <211> 66

<212> DNA <213> Homo sapiens <400> 336 cagcttgtgc tgactcaatc gccc.tctgcc tctgcctcce tgggagcctc ggtcaagctc 60 acctgc 66 <210> 337 <211> 66

<212> DNA <213> Homo sapiens <400> 337 cagcctgtgc tgactcagcc accttcctcc tccgcatctc ctggagaatc cgccagactc 60 acctgc 66 <210> 338 <211> 66

<212> DNA <213> Homo sapiens <400> 338 caggctgtgc tgactcagcc ggcttccctc tctgcatctc ctggagcatc agccagtctc 60 acctgc 66 <210> 339 <211> 66

<212> DNA <213> Homo sapiens <400> 339 cagcctgtgc tgactcagcc atcttcccat tctgcatctt ctggagcatc agtcagactc 60 acctgc 66

<210> 340 <211> 66 <212> DNA <213> Homo sapiens <400> 340 aattttatgc tgactcagcc ccactctgtg tcggagtcte cggggaagac ggtaaccatc 60 tcctgc 66 <210> 341 <211> 66

<212> DNA <213> Homo sapiens <400> 341 cagactgtgg tgactcagga gccctcactg actgtgtccc caggagggac agtcactctc 60 acctgt 66 <210> 342 <211> 66

<212> DNA <213> Homo sapiens <400> 342 caggctgtgg tgactcagga gccctcactg actgtgtccc caggagggac agtcactctc 60 acctgt 66 <210> 343 <211> 66

<212> DNA <213> Homo sapiens <400> 343 cagactgtgg tgacccagga gccatcgttc tcagtgtccc ctggagggac agtcacactc 60 acttgt 66 <210> 344 <211> 66

<212> DNA <213> Homo sapiens <400> 344 cagcctgtge tgactcagcc accttctgca tcagcctccc tgggagcctc ggtcacactc 60 acctgc 66 <210> 345 <211> 66

<212> DNA <213> Homo sapiens <400> 345 caggcagggc tgactcagcc accctcggtg tccaagggct tgagacagac cgccacactc 60 acctgc 66

<210> 346 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(6) <223> A, T, C, G, other or unknown <400> 346 nnnnnngactc 11 <210> 347

<211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6)..(11) <223> A, T, C, G, other or unknown <400> 347 gagtcnnnnn n 11

<210> 348 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (3)..(9) <223> A, T, C, G, other or unknown <400> 348 gcnnnnnnngc 11

<210> 349 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(11) <223> A, T, C, G, other or unknown <400> 349 acctgcnnnn n 11

<210> 350 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 350 cacatccgtg ttgttcacgg atgtg 25

<210> 351 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 351 aatagtagac tgcagtgtcc tcagccctta agctgttcat ctgcaagtag agagtatcct 60 tagagttgtc tccagactta gtgaagcg 88

<210> 352 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 352 cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaacagctta 60 agggctgagg acactgcagt ctactatt 88

<210> 353 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 353 cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaacagctta 60 agggctgagg acactgcagt ctactattgt gcgag 95

<210> 354 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 354 cgcttcacta agtctagaga caactctaag aatactctct acttgcagat gaacagctta 60 agggctgagg acactgcagt ctactattgt acgag 95

<210> 355 <211 > 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 355 cgcttcacta agtctagaga caac 24

<210> 356 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (8)..(15) <223> A, T, C, G, other or unknown <400> 356 cacctgcnnn nnnnn 15

<210> 357 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(17) <223> A, T, C, G, other or unknown <400> 357 cagctcnnnn nnnnnnn 17

<210> 358 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(17) <223> A, T, C, G, other or unknown <400> 358 gaagacnnnn nnnnnnn 17

<210> 359 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6)..(17) <223> A, T, C, G, other or unknown <400> 359 gcagcnnnnn nnnnnnn 17

<210> 360 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(12) <223> A, T, C, G, other or unknown <400> 360 gaagacnnnn nn 12

<210> 361 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(22) <223> A, T, C, G, other or unknown <400> 361 cttgagnnnn nnnnnnnnnn nn 22

<210> 362 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6)..(19) <223> A, T, C, G, other or unknown <400> 362 acggcnnnnn nnnnnnnnn 19

<210> 363 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6)..(18) <223> A, T, C, G, other or unknown <400> 363 acggcnnnnn nnnnnnnn 18

<210> 364 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(12) <223> A, T, C, G, other or unknown <400> 364 gtatccnnnn nn 12

<210> 365 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(11) <223> A, T, C, G, other or unknown <400> 365 actgggnnnn n 11

<210> 366 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6) ..(10) <223> A, T, C, G, other or unknown <400> 366 ggatcnnnnn 10

<210> 367 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6) ..(11) <223> A, T, C, G, other or unknown <400> 367 gcatcnnnnn n 11

<210> 368 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7) ..(16) <223> A, T, C, G, other or unknown <400> 368 gaggagnnnn nnnnnn 16

<210> 369 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6) .. (19) <223> A, T, C, G, other or unknown <400> 369 gggacnnnnn nnnnnnnnn 19

<210> 370 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7) .. (14) <223> A, T, C, G, other or unknown <400> 370 acctgcnnnn nnnn 14

<210> 371 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified base <222> (7) ..(17) <223> A, T, C, G, other or unknown <400> 371 ggcggannnn nnnnnnn 17

<210> 372 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7) ..(22) <223> A, T, C, G, other or unknown <400> 372 ctgaagnnnn nnnnnnnnnn nn 22

<210> 373 <211 >11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (6) .. (11) <223> A, T, C, G, other or unknown <400 373 cccgcnnnnn n 11

<210> 374 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6) ..(18) <223> A, T, C, G, other or unknown <400> 374 ggatgnnnnn nnnnnnnn 18

<210> 375 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(22) <223> A, T, C, G, other or unknown <400 375 ctggagnnnn nnnnnnnnnn nn 22

<210> 376 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6)..(15) <223> A, T, C, G, other or unknown <400> 376 gacgcnnnnn nnnnn 15

<210> 377 <211 > 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6) .. (13) <223> A, T, C, G, other or unknown <400> 377 ggtgannnnn nnn 13

<210> 378 <211 > 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6)..(13) <223> A, T, C, G, other or unknown <400> 378 gaagannnnn nnn 13

<210> 379 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6) ..(10) <223> A, T, C, G, other or unknown <400> 379 gagtcnnnnn 10

<210> 380 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7) ..(26) <223> A, T, C, G, other or unknown <400> 380 tccracnnnn nnnnnnnnnn nnnnnn 26

<210> 381 <211 >11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (5) .. (11) <223> A, T, C, G, other or unknown <400> 381 cctcnnnnnn n 11

<210> 382 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6)..(10) <223> A, T, C, G, other or unknown <400> 382 gagtcnnnnn 10

<210> 383 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 modified_base <222> (7)..(18) <223> A, T, C, G, other or unknown <400> 383 cccacannnn nnnnnnnn 18

<210> 384 <211 > 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6)..(14) <223> A, T, C, G, other or unknown <400> 384 gcatcnnnnn nnnn 14

<210> 385 <211 > 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6) .. (13) <223> A, T, C, G, other or unknown <400> 385 ggtgannnnn nnn 13

<210> 386 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (5) ..(12) <223> A, T, C, G, other or unknown <400> 386 cccgnnnnnn nn 12

<210> 387 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (6) ..(19) <223> A, T, C, G, other or unknown <400> 387 ggatgnnnnn nnnnnnnnn 19

<210> 388 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7) ..(17) <223> A, T, C, G, other or unknown <400> 388 gaccgannnn nnnnnnn 17

<210> 389 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7) ..(17) <223> A, T, C, G, other or unknown <400> 389 cacccannnn nnnnnnn 17

<210> 390 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified base <222> (7)..(17) <223> A, T, C, G, other or unknown <400> 390 caarcannnn nnnnnnn 17

<210> 391 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 391 gctgtgtatt actgtgcgag 20

<210> 392 <211 >20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 392 gccgtgtatt actgtgcgag 20

<210> 393 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 393 gccgtatatt actgtgcgag 20

<210> 394 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 394 gccgtgtatt actgtacgag 20

<210> 395 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 395 gccatgtatt actgtgcgag 20

<210> 396 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 396 cacatccgtg ttgttcacgg atgtg 25

<210> 397 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 397 aacagtagac tgcagtgtcc tcagccctta agctgctcat ctgcaagtag agagtattct 60 tagagttgcc tctagactta gtgaagcg 88

<210> 398 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 398 cgcttcacca agtctagaga caactctaag aatactctct aettgcagat gaacagctta 60 agggctgagg acactgcagt ctactattgt gcgag 95

<210> 399 <211 > 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 399 cgcttcacta agtctagaga caac 24

<210> 400 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 400 cacatccgtg ttgttcacgg atgtgggagg atggagactg ggtc 44

<210>401 <211> 44 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 401 cacatccgtg ttgttcacgg atgtgggaga gtggagactg agte 44

<210 402 <211> 44 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 402 cacatccgtg ttgttcacgg atgtgggtgc ctggagactg egte 44

<210 403 <211> 44 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 403 cacatccgtg ttgttcacgg atgtgggtgg ctggagactg egte 44

<210 404 <211 > 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 404 cctctactct tgtcacagtg cacaagacat ccag 34

<210> 405 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 405 cctctactct tgtcacagtg 20

<210>406 <211> 44 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 406 ggaggatgga ctggatgtct tgtgcactgt gacaagagta gagg 44

<210> 407 <211> 44 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 407 ggagagtgga ctggatgtct tgtgcactgt gacaagagta gagg 44

<210 408 <211> 44 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 408 ggtgcctgga ctggatgtct tgtgcactgt gacaagagta gagg 44

<210 409 <211> 44 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 409 ggtggctgga ctggatgtct tgtgcactgt gacaagagta gagg 44 <210410 <211> 44

<212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 410 cacatccgtg ttgttcacgg atgtggatcg actgtccagg agac 44

<210> 411 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 411 cacatccgtg ttgttcacgg atgtggactg tctgtcccaa ggcc 44

<210> 412 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 412 cacatccgtg ttgttcacgg atgtggactg actgtccagg agac 44

<210> 413 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 413 cacatccgtg ttgttcacgg atgtggaccc tctgccctgg ggcc 44

<210> 414 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 414 cctctgactg agtgcacaga gtgctttaac ccaaccggct agtgttagcg gttccccgg 59

<210>415 <211 > 69 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 415 cctctgactg agtgcacaga gtgctttaac ccaaccggct agtgttagcg gttccccggg 60 acagtcgat 69

<210>416 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 416 cctctgactg agtgcacaga gtgctttaac ccaaccggct agtgttagcg gttccccggg 60 acagacagc 69

<210>417 <211 > 69 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 417 cctctgactg agtgcacaga gtgctttaac ccaaccggct agtgttagcg gttccccggg 60 acagtcagt 69

<210>418 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 418 cctctgactg agtgcacaga gtgctttaac ccaaccggct agtgttagcg gtstccccgg 60 ggcagagggt 70

<210>419 <211 > 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 419 cctctgactg agtgcacaga gtgc 24

<210> 420 <211 > 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (5)..(9) <223> A, T, C, G, other or unknown <400> 420 ggccnnnnng gcc 13 <210> 421 <211> 15

<212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(12) <223> A, T, C, G, other or unknown <400 421 ccannnnnnn nntgg 15

<210> 422 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400> 422 cgannnnnntgc 12

<210> 423 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4) ..(8) <223> A, T, C, G, other or unknown <400> 423 gccnnnnngg c 11

<210> 424 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(7) <223> A, T, C, G, other or unknown <400> 424 gatnnnnatc 10 <210> 425

<211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4) ..(8) <223> A, T, C, G, other or unknown <400> 425 gacnnnnngtc 11

<210 426 <211 > 11 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (4) .. (8) <223> A, T, C, G, other or unknown <400 426 gcannnnntg c 11

<210> 427 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(12) <223> A, T, C, G, other or unknown <400> 427 gtatccnnnn nn 12

<210 428 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400> 428 gacnnnnnng tc 12

<210> 429 <211 >11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 429 ccannnnntg g 11

<210 430 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(6) <223> A, T, C, G, other or unknown <400> 430 nnnnnngaga cg 12

<210 431 <211 > 12 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400 431 ccannnnnntgg 12

<210 432 <211> 10 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (4)..(7) <223> A, T, C, G, other or unknown <400> 432 gaannnnttc 10

<210 433 <211 >11 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (7)..(11) <223> A, T, C, G, other or unknown <400 433 ggtctcnnnn n 11

<210> 434 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(10) <223> A, T, C, G, other or unknown <400 434 nnnnnnnnnn ctcctc 16

<210> 435 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(9) <223> A, T, C, G, other or unknown <400> 435 nnnnnnnnnt ccgcc 15

<210 436 <211 > 13 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (5)..(9) <223> A, T, C, G, other or unknown <400 436 ggccnnnnng gcc 13

<210 437 <211 > 12 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400 437 ccannnnnntgg 12

<210> 438 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400> 438 gacnnnnnng tc 12

<210> 439 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400> 439 cgannnnnntgc 12

<210> 440 <211 > 11 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 440 gcannnnntg c 11

<210> 441 <211 >11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 441 ccannnnntg g 11

<210> 442 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(7) <223> A, T, C, G, other or unknown <400> 442 gaannnnttc 10

<210> 443 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(6) <223> A, T, C, G, other or unknown <400> 443 nnnnnngaga cg 12

<210> 444 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(12) <223> A, T, C, G, other or unknown <400> 444 gtatccnnnn nn 12

<210 445 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (4)..(8) <223> A, C, G, other or unknown <400 445 gacnnnnngtc 11

<210> 446 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(11) <223> A, T, C, G, other or unknown <400> 446 ggtctcnnnn n 11

<210> 447 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 447 gccnnnnngg c 11

<210> 448 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(12) <223> A, T, C, G, other or unknown <400> 448 ccannnnnnn nntgg 15

<210 449 <211> 16 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified base <222> (1)..(10) <223> A, T, C, G, other or unknown <400> 449 nnnnnnnnnn ctcctc 16

<210> 450 <211> 15 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (1)..(9) <223> A, T, C, G, other or unknown <400> 450 nnnnnnnnnt ccgcc 15

<210> 451 <211> 9532 <212> DNA <213> Unknown Organism <220 <223> Description of Unknown Organism: MALIA3 nucleotide sequence <220

<221 > CDS <222> (1579)..(1638) <220

<221 > CDS <222> (2343)..(3443) <220

<221 > CDS <222> (3945)..(4400) <220

<221 > CDS <222> (4406)..(4450)

<220 <221 > CDS <222> (4746)..(5789) <400 451 aatgctacta ctattagtag aaetgatgcc accttttcag ctcgcgcccc aaatgaaaat 60 atagctaaac aggttattga ccatttgcga aatgtatcta atggtcaaac taaatctact 120 cgttcgcaga atcgggaatc aactgttaca tggaatgaaa cctccagaca ccgtacctta 180 gttgcatatt taaaacatge tgagctacag caccagattc agcaatcaag ctctaagcca 240 tccgcaaaaa tgacctctta ccaaaaggag caactaaagg taccctctaa tcctgacctg 300 ttggagtttg cttccggtct ggttcgcttt gaagcccgaa ttaaaacgcg atatttgaag 360 tctttcgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctataatagt 420 cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtttaaagca 480 tttgaggggg atccaatgaa tatttatgac gattccgcag tattggacgc tatccagtct 540 aaacatttta ctattacccc ctctggcaaa acttcttttg caaaagcctc tcgctatttt 600 ggcttctatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt 660 aattcctttt ggcgttatgt atctgcatta gttgaatgtg gtatteetaa atctcaactg 720 atgaatcttt ctacctgtaa taatgttgtt ccgttagtec gttttattaa cgtagatttt 780 tcttcccaac gtcctgactg gtataatgag ccagttctta aaatcgcata aggtaattca 840 caatgattaa agttgaaatt aaaccatctc aagcccaatt tactactcgt tctggtgttt 900 ctcgtcaggg caagcctcat tcactgaatg agcagctttg ttacgttgat ttgggtaatg 960 aatatccggt tcttgccaag attactcttg atgaaggtca gccagcctat gcgcctggtc 1020 tgtaeacegt tcatctgtcc tctttcaaag ttggtcagtt cggttccctt acgattgacc 1080 gtctgcgcct cgttccggct aagtaacatg gagcaggtcg cggatttcga cacaatttat 1140 caggcgacga tacaaatctc cgttgtactt tgtttcgcgc ttggtataat cgctgggggt 1200 caaagatgag tgttttagtg tattcttteg cctctttcgt tttaggttgg tgccttcgta 1260 gtggcattac gtattttacc cgtttaatgg aaacttccec atgaaaaagt ctttagtcct 1320 caaagcccct gcagccgttg ctaccctcgt tccgatgctg tctttcgctg ctgagggtga 13B0 cgatcccgca aaagcggcct ttaactccct gcaagcctca gcgaccgaat atatcggtta 1440 tgegtgggcg atggttgttg tcattgtcgg cgcaactatc ggtatcaagc tgettaagaa 1500 attcacctcg aaagcaagct gataaaccga tacaattaaa ggctcctttt ggagcctttt 1560 tttttggaga tttecaac gtg aaa aaa tta tta ttc gca att cct eta get 1611

Met Lys Lys Leu Leu Phe Ala Ile Pro Leu Val 1 5 10 get cce ttc tat tet cac agt gca cag tctgtcgtga cgcagccgcc 1658

Val Pro Phe Tyr Ser His Ser Ala Gin 15 20 etcagtgtct ggggccccag ggcagagggt caccatctcc tgcactggga gcagctccaa 1718 catcggggca ggttatgatg tacactggta ccagcagctt ccaggaacag cccccaaact 1778 ectcatctat ggtaacagca atcggccctc aggggtccct gaccgattct ctggctccaa 1838 gtctggcacc tcagcctccc tggceatcac tgggctccag gctgaggatg aggccgacta 1898 ttaetgccag tcctatgaca gcagcctgag tggcctttat gtcttcggaa ctgggaccaa 1958 ggtcaccgtc ctaggtcagc ccaaggccaa ccccactgtc actctgttcc cgccctcctc 2018 tgaggagctc caagccaaca aggccacact agtgtgtctg atcagtgact tctacccggg 2078 agctgtgaca gtggcctgga aggcagatag cagccccgtc aaggcgggag tggagaccac 2138 eaeaccetcc aaacaaagca acaacaagta cgcggecage agctatctga gcctgacgcc 2198 tgageagtgg aagtcccaca gaagctacag ctgccaggtc acgcatgaag ggagcaccgt 2258 ggagaagaca gtggccccta cagaatgttc ataataaacc gcctccaccg ggcgcgccaa 2318 ttctatttca aggagacagt cata atg aaa tac eta ttg cct aeg gea gcc 2369 Met Lys Tyr Leu Leu Pro Thr Ala Ala 25 get gga ttg tta tta etc gcg gcc cag eeg gcc atg gcc gaa gtt caa 2417

Ala Gly Leu Leu Leu Leu Ala Ala Gin Pro Ala Met Ala Glu Val Gin 30 35 40 45 ttg tta gag tet ggt ggc ggt ett gtt cag cct ggt ggt tet tta egt 2465

Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Leu Arg 50 55 60 ett tet tgc get get tee gga tte act tte tet teg tac get atg tet 2513

Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser 65 70 75 tgg gtt ege caa get cct ggt aaa ggt ttg gag tgg gtt tet get ate 2561

Trp Val Arg Gin Ala Pro Gly Lya Gly Leu Glu Trp Val Ser Ala Ile BO 85 90 tet ggt tet ggt ggc agt act tac tat get gac tee gtt aaa ggt ege 2609

Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg 95 100 105 tte act ate tet aga gac aac tet aag aat act etc tae ttg cag atg 2657

Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met 110 115 120 125

aac age tta agg get gag gae act gea gtc tac tat tgc get aaa gac 270S

Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Asp 130 135 140 tat gaa ggt act ggt tat get tte gac ata tgg ggt caa ggt act atg 2753

Tyr Glu Gly Thr Gly Tyr Ala Phe Asp Ile Trp Gly Gin Gly Thr Met 145 150 155 gtc acc gtc tct agt gcc tcc acc aag ggc cca tcg gtc ttc ccc ctg 2801

Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu 160 165 170 gca ccc tcc tcc aag age acc tct ggg ggc aca gcg gcc ctg ggc tgc 2849

Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys 175 180 185 ctg gtc aag gac tac ttc ccc gaa ccg gtg aeg gtg tcg tgg aac tea 2897

Leu Val Lys Asp Tyr Phe Pro Gig Pro Val Thr Val Ser Trp Asn Ser 190 195 200 205 ggc gcc ctg acc age ggc gtc cac acc ttc ccg get gtc eta cag tct 2945

Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gin Ser 210 215 220 age gga cte tac tcc ctc age age gta gtg acc gtg ccc tct tct age 2993

Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser 225 230 235 ttg ggc acc cag acc tac atc tgc aac gtg aat cac aag ccc age aac 3041

Leu Gly Thr Gin Thr Tyr Ile Cys Asn val Asn His’ Lys Pro Ser Asn 240 245 250 acc aag gtg gac aag aaa gtt gag ccc aaa tct tgt gcg gcc get cat 3089

Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Ala Ala Ala His 255 260 265 cac cac cat cat cac tct get gaa caa aaa etc atc tea gaa gag gat 3137

His His His His His Ser Ala Glu Gin Lys Leu Ile Ser Glu Glu Asp 270 275 280 285 ctg aat ggt gcc gca gat atc aac gat gat egt atg get ggc gcc get 3185

Leu Asn Gly Ala Ala Asp Ile Asn Asp Asp Arg Met Ala Gly Ala Ala 290 295 300 gaa act gtt gaa agt tgt tta gca aaa ccc cat aca gaa aat tea ttt 3233

Glu Thr Val Glu Ser Cys Leu Ala Lys Pro His Thr Glu Asn Ser Phe 305 310 315 act aac gtc tgg aaa gac gac aaa act tta gat egt tac get aac tat 3281

Thr Asn Val Trp Lys Asp Asp Lys Thr Leu Asp Arg Tyr Ala Asn Tyr 320 325 330 gag ggt tgt ctg tgg aat get aca ggc gtt gta gtt tgt act ggt gac 3329

Glu Gly Cys Leu Trp Asn Ala Thr Gly Val Val Val Cys Thr Gly Asp 335 340 345 gaa act cag tgt tac ggt aca tgg gtt cct att ggg ett get atc cct 3377

Glu Thr Gin Cys Tyr Gly Thr Trp Val Pro Ile Gly Leu Ala Ile Pro 350 355 360 365 gaa aat gag ggt ggt ggc tct gag ggt gge ggt tct gag ggt ggc ggt 3425

Glu Asn Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly 370 37S 380 · tct gag ggt ggc ggt act aaacctcctg agtacggtga tacacctatt 3473

Ser Glu Gly Gly Gly Thr 385 ccgggctata cttatateaa ccctctcgac ggcacttatc cgcctggtac tgagcaaaac 3533 cccgctaatc ctaatccttc tcttgaggag tctcageetc ttaatacttt catgtttcag 3593 aataataggc tccgaaatag gcagggggca ttaactgttt atacgggcac tgttactcaa 3653 ggcactgacc ccgttaaaac ttattaccag tacactcctg tatcatcaaa agccatgtat 3713 gacgcttact ggaacggtaa attcagagac tgcgctttcc attctggctt taatgaagat 3773 ecattcgttt gtgaatatca aggccaatcg tctgacctgc ctcaacctcc tgtcaatgct 3833 ggcggcggct ctggtggtgg ttctggtggc ggctctgagg gtggtggctc tgagggtggc 3893 ggttctgagg gtggcggctc tgagggaggc ggctccggtg gtggctctgg t tcc ggt 3950

Ser Gly gat ttt gat tat gaa aag atg gca aac get aat aag ggg get atg acc 3998

Asp Phe Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Ala Met Thr 390 395 400 405 gaa aat gcc gat gaa aac geg eta cag tct gac get aaa ggc aaa ett 4046

Glu Asn Ala Asp Glu Asn Ala Leu Gin See Asp Ala Lys Gly Lys Leu 410 415 420 gat tct gtc get act gat tac ggt get get ate gat ggt tte att ggt 4094

Asp Ser Val Ala Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe Ile Gly 425 430 435 gac gtt tee ggc ett get aat ggt aat ggt get act ggt gat ttt get 4142

Asp Val Ser Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala 440 44S 450 ggc tct aat tee caa atg get caa gtc ggt gac ggt gat aat tea eet 4190

Gly Ser Asn Ser Gin Met Ala Gin Val Gly Asp Gly Asp Asn Ser Pro 455 460 465 tta atg aat aat tte egt caa tat tta eet tcc etc eet caa teg gtc 4238

Leu Met Asn Asn Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin Ser Val 470 475 480 485 gaa tgt ege eet ttt gtc ttt age get ggt aaa cca tat gaa ttt tct 4286

Glu Cys Arg Pro Phe Val Phe Ser Ala Gly Lys Pro Tyr Glu Phe Ser 490 495 500 att gat tgt gac aaa ata aac tta tte egt ggt gtc ttt geg ttt ett 4334

Ile Asp Cys Asp Lys Ile Asn Leu Phe Arg Gly Val Phe Ala Phe Leu 505 510 515 tta tat gtt gcc acc ttt atg tat gta ttt eet aeg ttt get aac ata 4382

Leu Tyr Val Ala Thr Phe Met Tyr Val Phe Ser Thr Phe Ala Asn Ile 520 525 530 ctg egt aat aag gag tct taatc atg cca gtt ett ttg ggt att ceg tta 4432

Leu Arg Asn Lys Glu Ser Met Pro Val Leu Leu Gly Ile Pro Leu 535 540 545 tta ttg cgt ttc ctc ggt ttccttctgg taactttgtt cggctatctg 4480

Leu Leu Arg Phe Leu Gly 550 cttacttttc ttaaaaaggg cttcggtaag atagctattg ctatttcatt gtttcttgct 4540 cttattattg ggcttaacte aattcttgtg ggttatctct ctgatattag egetcaatta 4600 ccctctgaet ttgttcaggg tgttcagtta attctcccgt ctaatgcgct tccctgtttt 4660 tatgttattc tctctgtaaa ggctgctatt tccatttttg acgttaaaca aaaaatcgtt 4720 tcttatttgg attgggataa ataat atg get gtt tat ttt gta act ggc aaa 4772

Met Ala Val Tyr Phe Val Thr Gly Lys 555 560 tta ggc tet gga aag aeg ctc gtt age gtt ggt aag att cag gat aaa 4820

Leu Gly Ser Gly Lys Thr Leu Val Ser Val Gly Lys Ile Gin Asp Lys 565 570 575 att gta get ggg tgc aaa ata gea act aat ett gat tta agg ett caa 4868

Ile Val Ala Gly Cys Lys Ile Ala Thr Asn Leu Asp Leu Arg Leu Gin 580 58S 590 595 aac etc ccg caa gtc ggg agg ttc get aaa aeg cct cgc gtt ett aga 4916

Asn Leu Pro Gin Val Gly Arg Phe Ala Lys Thr Pro Arg Val Leu Arg 600 605 610 ata ccg gat aag cct tet ata tet gat ttg ett get att ggg cgc ggt 4964

Ile Pro Asp Lys Pro Ser Ile Ser Asp Leu Leu Ala Ile Gly Arg Gly 615 620 625 aat gat tee tac gat gaa aat aaa aac ggc ttg ett gtt ctc gat gag 5012

Asn Asp Ser Tyr Asp Glu Asn Lys Asn Gly Leu Leu Val Leu Asp Glu 630 635 640 tgc ggt act tgg ttt aat acc cgt tet tgg aat gat aag gaa aga cag 5060

Cys Gly Thr Trp Phe Asn Thr Arg Ser Trp Asn Asp Lys Glu Arg Gin 645 650 655 ccg att att gat tgg ttt eta cat get cgt aaa tta gga tgg gat att 5108

Pro Ile Ile Asp Trp Phe Leu His Ala Arg Lys Leu Gly Trp Asp Ile 660 665 670 675 att ttt ett gtt cag gac tta tet att gtt gat aaa cag gcg cgt tet 5156

Ile Phe Leu Val Gin Asp Leu Ser Ile Val Asp Lys Gin Ala Arg Ser 680 665 690 gea tta get gaa cat gtt gtt tat tgt cgt cgt ctg gac aga att act 5204

Ala Leu Ala Glu His Val Val Tyr Cys Arg Arg Leu Asp Arg Ile Thr

695 700 70S tta cct ttt gtc ggt act tta tat tet ett att act ggc teg aaa atg 5252

Leu Pro Phe Val Gly Thr Leu Tyr Ser Leu Ile Thr Gly Ser Lys Met 710 715 720 cct ctg cct aaa tta cat gtt ggc gtt gtt aaa tat ggc gat tct eaa 5300

Pro Leu Pro Lys Leu His Val Gly Val Val Lys Tyr Gly Asp Ser Gin 725 730 735 tta age cct act gtt gag egt tgg ett tat act ggt aag aat ttg tat 5348

Leu Ser Pro Thr Val Glu Arg Trp Leu Tyr Thr Gly Lys Asn Leu Tyr 740 745 750 755 aac gea tat gat act aaa cag get ttt tct agt aat tat gat tee ggt 5396

Asn Ala Tyr Asp Thr Lys Gin Ala Phe Ser Ser Asn Tyr Asp Ser Gly 760 765 770 gtt tat tct tat tta aeg cct tat tta tea cac ggt egg tat tte aaa 5444 val Tyr Ser Tyr Leu Thr Pro Tyr Leu Ser His Gly Arg Tyr Phe Lys 775 780 785 cca tta aat tta ggt cag aag atg aaa tta act aaa ata tat ttg aaa 5492

Pro Leu Asn Leu Gly Gin Lys Met Lys Leu Thr Lys Ile Tyr Leu Lys 790 795 800 aag ttt tct ege gtt ett tgt ett gcg att gga ttt gea tea gea ttt 5540

Lys Phe Ser Arg Val Leu Cys Leu Ala Ile Gly Phe Ala Ser Ala Phe 805 BIO 815 aca tat agt tat ata acc eaa cct aag ccg gag gtt aaa aag gta gtc 5588

Thr Tyr Ser Tyr Ile Thr Gin Pro Lys Pro Glu Val Lys Lys Val Val 820 825 830 835 tct cag acc tat gat ttt gat aaa tte act att gac tct tct cag egt 5636

Ser Gin Thr Tyr Asp Phe Asp Lys Phe Thr Ile Asp Ser Ser Gin Arg 840 84S 850 ett aat eta age tat ege tat gtt tte aag gat tct aag gga aaa tta 5684

Leu A3n Leu Ser Tyr Arg Tyr Val Phe Lys Asp Ser Lys Gly Lys Leu 855 860 865 att aat age gac gat tta cag aag eaa ggt tat tea etc aca tat att 5732

Ile Asn Ser Asp Asp Leu Gin Lys Gin Gly Tyr Ser Leu Thr Tyr Ile 870 875 880 gat tta tgt act gtt tee att aaa aaa ggt aat tea aat gaa att gtt 5780

Asp Leu Cys Thr Val Ser Ile Lys Lys Gly Asn Ser Asn Glu Ile Val 8B5 890 895 aaa tgt aat taattttgtt ttcttgatgt ttgtttcatc atettetttt 5829

Lys Cys Asn 900 getcaggtaa ttgaaatgaa taattcgcct etgegegatt ttgtaacttg gtattcaaag 5889 caatcaggcg aatccgttat tgtttetccc gatgtaaaag gtactgttac tgtatattea 5949 tetgaegtta aacctgaaaa tctacgcaat ttctttattt ctgttttaeg tgctaataat 6009 tttgatatgg ttggttcaat tccttccata atteagaagt ataatccaaa caatcaggat 6069 tatattgatg aattgccatc atetgataat caggaatatg atgataattc cgctccttct 6129 ggtggtttct ttgttccgca aaatgataat gttactcaaa cctttaaaat taataacgtt 6189 cgggcaaagg atttaatacg agttgtcgaa ttgtttgtaa agtctaatac ctctaaatcc 6249 tcaaaCgtat tatctattga eggctctaat ctattagttg tttctgcacc taaagatatt 6309 ttagataacc ttcctcaatt cctttccact gttgatttgc caactgacca gatattgatt 6369 gagggtttga tatttgaggt tcagcaaggt gatgctccag atttttcatt tgctgccggc 6429 tctcagcgtg gcactgttgc aggcggtgtt aatactgacc gcctcacctc tgttttatct 6489 tctgctggtg gttcgttcgg tatttttaat ggcgatgttt tagggctatc agttcgcgca 6549 ttaaagacta atagccattc aaaaatattg cctgtgccac gcattcttac gctttcaggt 6609 cagaagggtt ctatctctgt tggccagaat gtcccttcta etactggtcg tgtgactggt 6669 gaatetgcea atgtaaataa tccattteag acgattgagc gtcaaaatgt aggtatctcc 6729 atgagcgttt ttcctgttgc aatggctggc ggtaatattg ttctggatat taccagcaag 6789 gccgatagtt tgagttcttc tactcaggca agtgatgtta ttactaatca aagaagtatt 6849 gctacaacgg ttaatttgcg tgatggacag actctcttac tcggtggcct cactgattat 6909 aaaaacactt ctcaagattc tggcgtaccg ttcctgtcta aaatcccttt aatcggcctc 6969 ctgcttagct cccgctctga ttccaacgag gaaagcacgt tatacgtgct cgtcaaagca 7029. accatagtac gcgccctgta gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag 7089 cgtgaccgct acacttgcca gcgccctagc gcccgctcct tccgctttct tcccttcctt 7149 tctcgccacg ttcgccggct ttccccgtca agctctaaat cgggggctcc ctttagggtt 7209 ccgacttagt gctttacggc accccgaccc caaaaaactt gatttgggtg atggttcacg 7269 tagtgggcca tcgccctgat agacggtttt tcgccctttg acgttggagt ccacgttctt 7329 taatagtgga ctctcgttcc aaactggaac aacactcaac cctatctcgg gctattcttt 7389 tgatttataa gggattttgc cgatttcgga accaccatca aacaggattt tcgcctgctg 7449 gggcaaacca gcgtggaccg cttgctgcaa ctctctcagg gccaggcggt gaagggcaat 7509 cagccgtcgc ccgtctcact ggcgaaaags aaaaccaccc tggatccaag cttgcaggtg 7569 gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacactcaa 7629 atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga 7689 agagtatgag tattcaacat tcccgtgtcg cccttattcc cttttttgcg gcattttgcc 7749 ttectgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg 7809 gcgcacgagt gggttacatc gaaccggatc Ccaacagcgg taagaccctt gagagttttc 7869 gccccgaaga acgttttcca atgatgagca cttttaaagt tctgetacgt catacactat 7929 tatcccgtat tgacgccggg caagagcaac tcggtcgccg ggcgcggcat tctcagaatg 7969 acttggttga gtactcacca gtcacagaaa agcatcttac ggacggcatg acagtaagag 6049 aattatgcag tgctgccata accatgagtg ataacactgc ggceaactta cttctgacaa 6109 cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgcaactc Θ169 gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca 8229 cgatgcctgt agcaatgcca acaacgttgc gcaaactatt aactggcgaa ctacttactc 8289 tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc 8349 tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg 8409 ggtctcgcgg tatcattgca gcaccgggge eagatggtaa gcectcccgt atcgtagtta 8469 tctacacgac ggggagccag gcaactatgg atgaacgaaa tagacagatc gctgagatag 8529 gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga 8589 ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatccct tttgataatc 8649 tcatgaccaa aatcccttaa cgtgagtttt cgttccactg tacgcaagac ccccaagctt 8709 gtcgactgaa tggcgaatgg cgctttgcct ggtttccggc accagaageg gtgccggaaai 8769 gctggctgga gtgcgatctt cctgaggccg atactgtcgt cgtcccctca aaccggcaga 8829 tgcacggCta cgatgcgccc atctacacca acgtaaccta tcccattacg gtcaatccgc 8889 cgtttgctcc cacggagaat ccgacgggtt gttactcgct cacatttaat gttgatgaaa 8949 getggetaca ggaaggccag acgcgaatta tttttgatgg cgttcctatC ggttaaaaaa 9009 tgagctgatt taacaaaaat ttaacgcgaa ccttaacaaa atattaacgt ttacaattta 9069 aatatttgct tatacaatct tcctgttttt ggggcttttc tgattatcaa ccggggtaca 9129 tatgattgac atgctagttt tacgattacc gttcatcgat tctcttgttt gctccagact 9189 ctcaggcaat gacctgatag cctttgtaga tctctcaaaa atagctaccc tctccggcat 9249 gaatttatca gctagaacgg ttgaatatca tattgatggt gatttgactg tctccggcct 9309 ttctcaccct tttgaatctt tacctacaca Ctactcaggc atcgcatcta aaatatatga 9369 gggttctaaa aatttttatc cttgcgttga aataaaggct tctcccgcaa aagtattaca 9429 gggtcataat gtetttggta caaccgattt agctttatgc tctgaggctt tattgcttaa 9489 ttttgctaat tctttgcctt gcctgtatga tttattggat gtt 9532

<210 452 <211> 20 <212> PRT <213> Unknown Organism <220 <223> Description of Unknown Organism: MALIA3 peptide sequence <400 452

Met Lys Lys Leu Leu Phe Ala He Pro Leu Val Val Pro Phe Tyr Ser 1 5 10 - 15

His Ser Ala Gin 20

<210> 453 <211 > 367 <212> PRT <213> Unknown Organism <220> <223> Description of Unknown Organism: MALIA3 protein sequence <400> 453

Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala 15 10 15

Ala Gin Pro Ala Met Ala Glu Val Gin Leu Leu Glu Ser Gly Gly Gly 20 25 30

Leu Val Gin Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly 35 40 45

Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gin Ala Pro Gly 50 55 60

Lys Gly Leu Glu Trp Val Ser Ala He Ser Gly Ser Gly Gly Ser Thr 65 70 75 80

Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr lie Ser Arg Asp Asn 85 90 95

Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp 100 105 110

Thr Ala Val Tyr Tyr Cys Ala Lys Asp Tyr Glu Gly Thr Gly Tyr Ala 115 120 125

Phe Asp lie Trp Gly Gin Gly Thr Met Val Thr Val Ser Ser Ala Ser 130 135 140

Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr 145 150 155 160

Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro 165 170 175

Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val 180 185 190

His Thr Phe Pro Ala Val Leu Gin Ser Ser Gly Leu Tyr Ser Leu Ser 195 200 205

Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gin Thr Tyr lie 210 215 220

Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val 225 230 235 240

Glu Pro Lys Ser Cys Ala Ala Ala His His His His His His Ser Ala 245 250 2S5

Glu Gin Lys Leu lie Ser Glu Glu Asp Leu Asn Gly Ala Ala Asp lie 260 265 270

Asn Asp Asp Arg Met Ala Gly Ala Ala Glu Thr Val Glu Ser Cys Leu 275 280 28S

Ala Lys Pro His Thr Glu Asn Ser Phe Thr Asn Val Trp Lys Asp Asp 290 295 300

Lys Thr Leu Asp Arg Tyr Ala Asn Tyr Glu Gly Cys Leu Trp Asn Ala 305 310 315 320

Thr Gly Val Val Val Cys Thr Gly Asp Glu Thr Gin Cys Tyr Gly Thr 325 330 335

Trp Val Pro lie Gly Leu Ala lie Pro Glu Asn Glu Gly Gly Gly Ser 340 345 3S0

Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Thr 355 360 365

<210> 454 <211 > 152 <212> PRT <213> Unknown Organism <220> <223> Description of Unknown Organism: MALIA3 protein sequence <400> 454

Ser Gly Asp Phe Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Ala 15 10 15

Met Thr Glu Asn Ala Asp Glu Asn Ala Leu Gin Ser Asp Ala Lys Gly 20 25 30

Lys Leu Asp Ser Val Ala Thr Asp Tyr Gly Ala Ala He Asp Gly Phe 35 40 45

Ile Gly Asp Val Ser Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp SO 55 60

Phe Ala Gly Ser Asn Ser Gin Met Ala Gin Val Gly Asp Gly Asp Asn 65 70 75 80

Ser Pro Leu Met Asn Asn Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin 85 90 95

Ser Val Glu Cys Arg Pro Phe Val Phe Ser Ala Gly Lys Pro Tyr Glu 100 105 110

Phe Ser Ile Asp Cys Asp Lys Ile Asn Leu Phe Arg Gly Val Phe Ala 115 120 125

Phe Leu Leu Tyr Val Ala Thr Phe Met Tyr val Phe Ser Thr Phe Ala 130 135 140

Asn Ile Leu Arg Asn Lys Glu Ser 145 150

<210 455 <211> 15 <212> PRT <213> Unknown Organism <220 <223> Description of Unknown Organism: MALIA3 peptide sequence <400 455

Met Pro Val Leu Leu Gly He Pro Leu Leu Leu Arg Phe Leu Gly 15 10 15

<210> 456 <211 > 34B <212> PRT <213> Unknown Organism <220> <223> Description of Unknown Organism: MALIA3 protein sequence <400> 456

Met Ala Val Tyr Phe Val Thr Gly Lys Leu Gly Ser Gly Lys Thr Leu 15 10 15

Val Ser Val Gly Lys lie Gin Asp Lys He val Ala Gly Cys Lys lie 20 25 30

Ala Thr Asn Leu Asp Leu Arg Leu Gin Asn Leu Pro Gin Val Gly Arg 35 40 45

Phe Ala Lys Thr Pro Arg Val Leu Arg He Pro Asp Lys Pro Ser lie 50 5$ SO

Ser Asp Leu Leu Ala Ile Gly Arg Gly Asn Asp Ser Tyr Asp Glu Asn 65 70 75 80

Lys Asn Gly Leu Leu Val Leu Asp Glu Cys Gly Thr Trp Phe Asn Thr 85 90 95

Arg Ser Trp Asn Asp Lys Glu Arg Gin Pro Ile Ile Asp Trp Phe Leu 100 10S 110

His Ala Arg Lys Leu Gly Trp Asp Ile Ile Phe Leu Val Gin Asp Leu 115 120 125

Ser Ile Val Asp Lys Gin Ala Arg Ser Ala Leu Ala Glu His Val Val 130 135 140

Tyr Cys Arg Arg Leu Asp Arg Ile Thr Leu Pro Phe Val Gly Thr Leu 145 150 155 160

Tyr Ser Leu Ile Thr Gly Ser Lys Met Pro Leu Pro Lys Leu His Val 165 170 175

Gly Val Val Lys Tyr Gly Asp Ser Gin Leu Ser Pro Thr Val Glu Arg 180 185 190

Trp Leu Tyr Thr Gly Lys Asn Leu Tyr Asn Ala Tyr Asp Thr Lys Gin 195 200 205

Ala Phe Ser Ser Asn Tyr Asp Ser Gly Val Tyr Ser Tyr Leu Thr Pro 210 215 220

Tyr Leu Ser His Gly Arg Tyr Phe Lys Pro Leu Asn Leu Gly Gin Lys 225 230 235 240

Met Lys Leu Thr Lys Ile Tyr Leu Lys Lys Phe Ser Arg val Leu Cys 245 250 255

Leu Ala Ile Gly Phe Ala Ser Ala Phe Thr Tyr Ser Tyr Ile Thr Gin 260 265 270

Pro Lys Pro Glu Val Lys Lys Val Val Ser Gin Thr Tyr Asp Phe Asp 275 280 285

Lys Phe Thr Ile Asp Ser Ser Gin Arg Leu Asn Leu Ser Tyr Arg Tyr 290 295 300

Val Phe Lys Asp Ser Lys Gly Lys Leu Ile Asn Ser Asp Asp Leu Gin 305 310 315 320

Lys Gin Gly Tyr Ser Leu Thr Tyr Ile Asp Leu Cys Thr Val Ser Ile 325 330 335

Lys Lys Gly Asn Ser Asn Glu Ile Val Lys Cys Asn 340 345

<210> 457 <211 > 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 457 tggaagaggc acgttctttt cttt 24

<210 458 <211 > 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 458 cttttctttg ttgccgttgg ggtg 24

<210 459 <211 > 24 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Primer <400 459 acactctccc ctgttgaagc tctt 24

<210> 460 <211 > 51 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 460 accgcctcca ccgggcgcgc cttattaaca ctctcccctg ttgaagctct t 51

<210> 461 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 461 tgaacattct gtaggggcca ctg 23

<210> 462 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 462 agagcattct gcaggggcca ctg 23

<210> 463 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 463 accgcctcca ccgggcgcgc cttattatga acattctgta ggggccactg 50

<210> 464 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 464 accgcctcca ccgggcgcgc cttattaaga gcattctgca ggggccactg 50

<210> 465 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 465 cgactggagc acgaggacac tga 23

<210 466 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400 466 ggacactgac atggactgaa ggagta 26

<210> 467 <211> 20 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 467 gggaggatgg agactgggtc 20

<210 468 <211> 20 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 468 gggaagatgg agactgggtc 20

<210> 469 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 469 gggagagtgg agactgagtc 20

<210> 470 <211> 20 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 470 gggtgcctgg agactgcgtc 20

<210> 471 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 471 gggtggctgg agactgcgtc 20

<210> 472 <211> 50 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 472 gggaggatgg agactgggtc atctggatgt cttgtgcact gtgacagagg 50

<210 473 <211> 50 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 473 gggaagatgg agactgggtc atctggatgt cttgtgcact gtgacagagg 50

<210> 474 <211> 50 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 474 gggagagtgg agactgggtc atctggatgt cttgtgcact gtgacagagg 50

<210> 475 <211> 50 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 475 gggtgcctgg agactgggtc atctggatgt cttgtgcact gtgacagagg 50

<210 476 <211> 50 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 476 gggtggctgg agactgggtc atctggatgt cttgtgcact gtgacagagg 50 <210> 477 <211> 50

<212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 477 gggagtctgg agactgggtc atctggatgt cttgtgcact gtgacagagg 50

<210> 478 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 478 cctctgtcac agtgcacaag acatccagat gacccagtct cc 42

<210> 479 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 479 cctctgtcac agtgcacaag ac 22

<210> 480 <211 > 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 480 acactctccc ctgttgaagc tctt 24 <210>481 <211 > 668

<212> DNA <213> Homo sapiens <220 <221 > CDS <222> (1)..(668) <400 481 agt gca caa gac ate cag atg ace cag tet cca gee acc ctg tet gtg 48

Ser Ala Gin Asp lie Gin Met Thr Gin Ser Pro Ala Thr Leu Ser Val 1 5 10 15 tet cca ggg gaa agg gee acc etc tee tgc agg gee agt cag agt gtt 96

Sec Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Ser Val 20 25 30 agt aac aac tta gee tgg tac cag cag aaa cet ggc cag gtt ccc agg 144

Ser Asn Asn Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin val Pro Arg 35 40 45 etc etc ate tat ggt gca tee ace agg gee act gat ate cca gee agg 192

Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala Thr Asp lie Pro Ala Arg 50 55 60 ttc agt ggc agt ggg tet ggg aca gac ttc act etc acc ate age aga 240

Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Arg 65 70 75 80 ctg gag cet gaa gat ttt gca gtg tat tac tgt cag egg tat ggt age 288

Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gin Arg Tyr Gly Ser 85 · 90 95 tea ccg ggg tgg aeg etc ggc caa ggg acc aag gtg gaa ate aaa ega 336

Ser Pro Gly Trp Thr Phe Gly Gin Gly Thr Lys Val Glu lie Lys Arg 100 105 110 act gtg get gca cca tee gtc ttc ate ttc ccg cca tet gat gag cag 364

Thr Val Ala Ala Pro Ser Val Phe lie Phe Pro Pro Ser Asp Glu Gin 115 120 125 ttg aaa tet gga act gee tet gtt gtg tgc ctg ctg aat aac ttc tat 432

Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 130 135 140 ccc aga gag gee aaa gta cag tgg aag gtg gat aac gee etc caa teg 480

Pro Arg Glu Ala Lys Val Gin Trp Lys val Asp Asn Ala Leu Gin Ser 145 150 155 160 ggt aac tee cag gag agt gtc aca gag cag gac age aag gac age acc 528

Gly Asn Ser Gin Glu Ser Val Thr Glu Gin Asp Ser Lys Asp Ser Thr 165 170 175 tac age etc age age acc ctg aeg ctg age aaa gca gac tac gag aaa 576

Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 180 185 190 cac aaa gtc tac gee tgc gaa gtc acc cat cag ggc ctg age teg cet 624

His Lys Val Tyr Ala Cys Glu Val Thr His Gin Gly Leu Ser Ser Pro 195 200 205 gtc aca aag age ttc aac aaa gga gag tgt aag ggc gaa ttc gc 668

Val Thr Lys Ser Phe Asn Lys Gly Glu Cys Lys Gly Glu Phe Ala 210 215 220 <210 482 <211 > 223 <212> PRT <213> Homo sapiens <400 482

Ser Ala Gin Asp Ile Gin Met Thr Gin Ser Pro Ala Thr Leu Ser Val 15 10 15

Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Ser Val 20 25 30

Ser Asn Asn Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin Val Pro Arg 35 40 45

Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala Thr Asp Ile Pro Ala Arg 50 55 60

Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg 65 70 75 80

Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gin Arg Tyr Gly Ser 65 90 95

Ser Pro Gly Trp Thr Phe Gly Gin Gly Thr Lys Val Glu Ile Lys Arg 100 105 110

Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gin 115 120 125

Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 130 135 140

Pro Arg Glu Ala Lys Val Gin Trp Lys Val Asp Asn Ala Leu Gin Ser 145 150 155 160

Gly Asn Ser Gin Glu Ser Val Thr Glu Gin Asp Ser Lys Asp Ser Thr 165 170 175

Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 180 185 190

His Lys Val Tyr Ala Cys Glu Val Thr His Gin Gly Leu Ser Ser Pro 195 200 205

Val Thr Lys Ser Phe Asn Lys Gly Glu Cys Lys Gly Glu Phe Ala 210 215 220

<210 483 <211 > 13 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 483 agccaccctg tct 13 <210> 484 <211> 700

<212> DNA <213> Homo sapiens <220 <221 > CDS <222> (1)..(699) <400 484 agt gca caa gac atc cag atg acc cag tct cct gcc acc ctg tct gtg 48

Ser Ala Gin Asp Ile Gin Met Thr Gin Ser Pro Ala Thr Leu Ser Val 1-5 10 15 tct cca ggt gaa aga gcc acc ctc tcc tgc agg gcc agt cag gtg tct 96

Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Val Ser 20 25 30 cca ggg gaa aga gcc acc ctc tcc tgc aat ctt ctc age aac tta gcc 144

Pro Gly Glu Arg Ala Thr Leu Ser Cys Asn Leu Leu Ser Asn Leu Ala 35 40 45 tgg tac cag cag aaa cct ggc cag get ccc agg ctc ctc atc tat ggt 192

Trp Tyr Gin Gin Lys Pro Gly Gin Ala Pro Arg Leu Leu Ile Tyr Gly 50 55 60 get tcc acc ggg gcc att ggt atc cca gcc agg ttc agt ggc agt ggg 240

Ala Ser Thr Gly Ala Ile Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly 65 70 '75 80 tct ggg aca gag ttc act ctc acc atc age. age ctg cag tct gaa gat 283

Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gin Ser Glu Asp 85 90 95 ttt gca gtg tat ttc tgt cag cag tat ggt acc tea ccg ccc act ttc 336

Phe Ala Val Tyr Phe Cys Gin Gin Tyr Gly Thr Ser Pro Pro Thr Phe 100 105 110 ggc gga ggg acc dag gtg gag ate aaa cga act gtg get gea cca tet 364

Gly Gly Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala Ala Pro Ser

115 120 12S gtc tte ate tec ccg cca tet gat gag cag ttg aaa tet gga act gee 432

Val Phe Ile Phe Pro Pro Ser Asp Glu Gin Len Lys Ser Gly Thr Ala 130 135 140 tet gtt gtg tgc ecg ctg aat aae tte tat ccc aga gag gcc aaa gta 480

Ser Val Val Cys Pro Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val 145 150 155 160 cag tgg aag gtg gat aac gee etc caa teg ggt aac tee cag gag agt S28

Gin Trp Lys Val Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin Glu Ser 16S 170 175 gtc aca gag cag gac aac aag gac age acc tac age etc age age acc 576

Val Thr Glu Gin Asp Asn Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr 180 185 190 ctg aeg ctg age aaa gta gac tac gag aaa cac gaa gtc tac gcc tgc 624

Leu Thr Leu Ser Lys Val Asp Tyr Glu Lys His Glu Val Tyr Ala Cys 195 200 205 gaa gtc acc cat cag ggc ett age teg ccc gtc aeg aag age tte aac 672

Glu Val Thr His Gin Gly Leu Ser Ser Pro Val Thr Lys Ser Phe Asn 210 215 220 agg gga gag tgt aag aaa gaa tte gtt t 700

Arg Gly Glu Cys Lys Lys Glu Phe Val 225 230 <210 485 <211 > 233 <212> PRT <213> Homo sapiens <400 485

Ser Ala Gin Asp Ile Gin Met Thr Gin Ser Pro Ala Thr Leu Sex Val 15 10 15

Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Val Ser 20 25 30

Pro Gly Glu Arg Ala Thr Leu Ser Cys Asn Leu Leu Ser Asn Leu Ala 3S 40 45

Trp Tyr Gin Gin Lys Pro Gly Gin Ala Pro Arg Leu Leu Ile Tyr Gly 50 55 60

Ala Ser Thr Gly Ala Ile Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly 65 70 75 80

Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gin Ser Glu Asp 85 90 95

Phe Ala Val Tyr Phe Cys Gin Gin Tyr Gly Thr Ser Pro Pro Thr Phe 100 105 110

Gly Gly Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala Ala Pro Ser 1X5 120 125

Val Phe zle Phe Pro Pro Ser Asp Glu Gin Leu Lys Ser Gly Thr Ala 130 135 140

Ser Val Val Cys Pro Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val 145 150 155 160

Gin Trp Lys Val Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin Glu Ser 165 170 175

Val Thr Glu Gin Asp Asn Ly3 Asp Ser Thr Tyr Ser Leu Ser Ser Thr 180 185 190

Leu Thr Leu Ser Lys Val Asp Tyr Glu Lys His Glu Val Tyr Ala Cys 195 200 205

Glu Val Thr His Gin Gly Leu Ser Ser Pro Val Thr Lys Ser Phe Asn 210 215 220

Arg Gly Glu Cys Lys Lys Glu Phe Val 225 230

<210 486 <211 > 419 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic 3-23 VH nucleotide sequence <220 <221 > CDS <222> (12)..(419) <400> 486 ctgtctgaae g gcc cag ccg gcc atg gcc gaa gtt caa ttg tta gag tct 50 Ala Gin Pro Ala Met Ala Glu Val Gin Leu Leu Glu Ser 15 10 ggt ggc ggt ctt gtt cag cct ggt ggt tct tta cgt ctt tct tgc get 98

Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala 15 20 25 get tee gga ttc act ttc tct ccg tac get atg tct tgg gtt ege caa 146

Aia Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gin 30 35 40 45 get cct ggt aaa ggt ttg gag tgg gtt tct get ate tct ggt tct ggt 194

Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala Ile Ser Gly Ser Gly 50 55 60 ggc agt act tac tat get gac tee get aaa ggt ege etc act ate tee 242

Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser 65 70 75 aga gac aac tct aag aat act etc tac ttg cag atg aac age tta agg 290

Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg 80 85 90 get gag gac act gea gtc tac tat tgc get aaa gac tat gaa ggt act 338

Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Asp Tyr Glu Gly Thr 95 100 105 ggt tat get ttc gac ata tgg ggt caa ggt act atg gcc acc gtc tct 386

Gly Tyr Ala Phe Asp Ile Trp Gly Gin Gly Thr Met Val Thr Val Ser 110 115 120 125 agt gcc tee acc aag ggc cca teg gtc ttc ccc 419

Ser Ala Ser Thr Lys Gly Pro Ser val Phe Pro • 130 135

<210> 487 <211 > 136 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic 3-23 VH protein sequence <400> 487

Ala Gin Pro Ala Met Ala Glu Val Gin Leu Leu Glu Ser Gly Gly Gly 1.5 10 15

Leu Val Gin Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly 20 25 30

Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gin Ala Pro Gly 35 40 45

Lys Gly Leu Glu Trp Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr 50 55 60

Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 65 70 75 80

Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp 85 90 95

Thr Ala Val Tyr Tyr Cys Ala Lys Asp Tyr Glu Gly Thr Gly Tyr Ala 100 105 110

Phe Asp Ile Trp Gly Gin Gly Thr Met Val Thr Val Ser Ser Ala Ser 115 120 125

Thr Lys Gly Pro Ser Val Phe Pro 130 135

<210 488 <211> 20 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Primer <400 488 ctgtctgaac ggcccagccg 20

<210> 489 <211 > 83 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 489 ctgtctgaac ggcccagccg gccatggccg aagttcaatt gttagagtct ggtggcggtc 60 ttgttcagcc tggtggtcct tta 83

<210> 490 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 490 gaaagtgaat ccggaagcag cgcaagaaag acgtaaagaa ccaccaggct gaac 54

<210> 491 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 491 agaaacccac tccaaacctt taccaggagc ttggcgaacc ca 42

<210> 492 <211> 94 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 492 agtgccctca gcccctaagc cgttcatctg caagtagaga gtattcttag agttgtctct 60 agagatagtg aagcgacctt caacggagcc agca 94

<210> 493 <211 > 81 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 493 gcttaagggc tgaggacacc gcagtctact attgcgctaa agaccatgaa ggtactggtt 60 atgctttcga catatggggt c 81

<210> 494 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 494 ggggaagacc gatgggccct tggtggaggc accagagacg gtgaccatag taccctgacc 60 tatgtcgaaa gc “72 <210 495

<211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 495 ggggaagacc gatgggccct tgg 23

<210 496 <211> 56 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified base <222> (22)..(24) <223> A, T, C, G, other or unknown <220 <221 > modified_base <222> (28)..(30) <223> A, T, C, G, other or unknown <220> <221 > modified_base <222> (34)..(36) <223> A, T, C, G, other or unknown <220> <223> nnn codes for any amino acid but Cys <400> 496 gcttccggat tcactttctc tnnntacnnn atgnnntggg ttcgccaagc tcctgg 56

<210> 497 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (19)..(21)

<223> A, T, C or G <220> <221 > modified_base <222> (25)..(30)

<223> A, T, C or G <220 <221 > modified_base <222> (40)..(42)

<223> A, T, C or G <220 <221 > modified_base <222> (46)..(48)

<223> A, T, C or G <400> 497 ggtttggagt gggtttctnn natcnnnnnn tctggtggcn nnactnnnta tgctgactcc 60 gttaaagg 66 <210 498 <211 > 912

<212> DNA <213> Escherichia coli <400 498 teeggagctt cagatctgtt tgcctctttg tggggtggtg cagategcgt tacggagatc 60 gaccgactgc ttgagcaaaa gccacgccta actgctgatc aggeatggga tgttattcgc 120 caaaccagtc gccaggatct taacctgagg ctttttttac ctactctgca agcagcgaca 190 tctggtttga cacagagcga tccgcgtcgt cagttggtag aaacattaac acgctgggat 240 ggcateaatt tgcttaatga tgatggtaaa acetggcagc agccaggctc tgccatcetg 300 aacgcttggc tgaccagtat gttgaagcgt accgtagtgg ctgccgtacc tatgccattt 360 gataagtggt acagcgccag cggctacgaa acaacccagg acggcccaac tggttcgctg 420 aatataagtg ttggagcaaa aattttgtat gaggcggtgc agggagacaa atcaccaatc 490 ccacaggcgg ttgatctgtt tgctgggaaa ccacagcagg aggttgtgtt ggcCgcgctg 540 gaagatacct gggagactct ttccaaacgc tatggcaata atgtgagtaa ctggaaaaca 600 cctgcaatgg ccttaacgtt ccgggcaaat aatctctctg gtgtaccgca ggccgcagcg 660 gaagaaacgc gtcatcaggc ggagtatcaa aaccg'tggaa cagaaaacga tatgattgtt 720 ttctcaccaa cgacaagcga tcgtcctgtg cctgcctggg acgtggccgc acccggtcag 780 agtgggttta ttgctcccga tggaacagtt gataagcact acgaagatca gctgaaaatg 840 tacgaaaatt ttggccgtaa gtcgctctgg ttaacgaagc aggatgtgga ggcgcataag 900 gagtcgtcta ga 912

<210> 499 <211> 10 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220. <221 > modified_base <222> (4)..(7) <223> A, T, C, G, other or unknown <400 499 gatnnnnatc 10

<210> 500 <211 > 20 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (1)..(15) <223> A, T, C, G, other or unknown <400> 500 nnnnnnnnnn nnnnngtccc 20

<210> 501 <211 > 11 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 501 gcannnnntg c 11

<210> 502 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (9)..(7) <223> A, T, C, G, other or unknown <400> 502 gacnnnngtc 10

<210> 503 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(7) <223> A, T, C, G, other or unknown <400> 503 nnnnnnngcg gg 12

<210> 504 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(12) <223> A, T, C, G, other or unknown <400> 504 gtatccnnnn nn 12

<210> 505 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400> 505 gcannnnnntcg 12

<210> 506 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 506 gccnnnnngg c 11

<210> 507 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(11) <223> A, T, C, G, other or unknown <400> 507 ggtctcnnnn n 11

<210> 508 <211>11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(11) <223> A, T, C, G, other or unknown <400> 508 gacnnnnngt c 11

<210> 509 <211 >11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 509 gacnnnnngtc 11

<210>510 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400> 510 gacnnnnnng tc 12

<210> 511 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 511 ccannnnntg g 11

<210> 512 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(9) <223> A, T, C, G, other or unknown <400> 512 nnnnnnnnng caggt 15

<210> 513 <211>11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(11) <223> A, T, C, G, other or unknown <400> 513 acctgcnnnn n 11

<210> 514 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (5)..(9) <223> A, T, C, G, other or unknown <400> 514 ggccnnnnng gcc 13

<210> 515 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(12) <223> A, T, C, G, other or unknown <400> 515 ccannnnnnn nntgg 15

<210> 516 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7) .. (11) <223> A, T, C, G, other or unknown <400> 516 cgtctcnnnn n 11

<210> 517 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(6) <223> A, T, C, G, other or unknown <400> 517 nnnnnngaga eg 12

<210> 518 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(10) <223> A, T, C, G, other or unknown <400> 518 nnnnnnnnnn ctcctc 16

<210> 519 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(16) <223> A, T, C, G, other or unknown <400> 519 gaggagnnnn nnnnnn 16

<210> 520 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 520 cctnnnnnag g 11

<210> 521 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400> 521 ccannnnnntgg 12

<210> 522 <211 >6680 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Vector pCES5 nucleotide sequence <220> <221 > CDS <222> (201)..(1058) <220> <221 > CDS <222> (2269)..(2682) <220> <221 > CDS <222> (2723)..(2866) <220> <221 > CDS <222> (3767)..(3850) <220> <221 > CDS <222> (4198)..(5799) <400> 522 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaggaagagt atg agt att caa cat ttc cgt gtc gcc ctt att 233 Met Ser Ile Gin His Phe Arg Val Ala Leu Ile 15 10 ccc ttt ttt gcg gca ttt tgc ctt cct gtt ttt get cac cca gaa aeg 281

Pro Phe Phe Ala Ala Phe Cys Leu Pro Val Phe Ala His Pro Glu Thr 15 20 25 ctg gtg aaa gta aaa gat get gaa gat cag ctg ggt gcc ega gtg ggt 329

Leu Val Lys Val Lys Asp Ala Glu Asp Gin Leu Gly Ala Arg Val Gly 30 35-40 tac ate gaa ctg gat ctc aac age ggt aag atc ctt gag agt ttt cgc 377

Tyr Ile Glu Leu Asp Leu Asn Ser Gly Lys Ile Leu Glu Ser Phe Arg 45 50 55 ccc gaa gaa cgt ttt cea atg atg age act ttt aaa gtt ctg eta tgt 425 pro Glu Glu Arg Phe Pro Met Met Ser Thr Phe Lys Val Leu Leu Cys 60 65 70 75 ggc gcg gta tta tee cgt att gac gcc ggg caa gag caa ctc ggt cgc 473

Gly Ala Val Leu Ser Arg Ile Asp Ala Gly Gin Glu Gin Leu Gly Arg 80 85 90 cgc ata cac tat tet cag aat gac ttg gtt gag tac tea cca gtc aca S21

Arg Ile Kis Tyr Ser Gin Asn Asp Leu Val Glu Tyr Ser Pro Val Thr 95 100 105 gaa aag cat ctt aeg gat ggc atg aca gta aga gaa tta tgc agt get 569

Glu Lys Kis Leu Thr Asp Gly Met Thr Val Arg Glu Leu Cys Ser Ala 110 115 120 gcc ata acc atg agt gat aac act gcg gcc aac tta ctt ctg aca aeg 617

Ala Ile Thr Met Ser Asp Asn Thr Ala Ala Asn Leu Leu Leu Thr Thr 125 130 135 atc gga gga ccg aag gag eta acc get ttt ttg cac aac atg ggg gat 665

Ile Gly Gly Pro Lys Glu Leu Thr Ala Phe Leu His Asn Met Gly Asp 140 145 150 155 cat gta act cgc ctt gat cgt tgg gaa ccg gag ctg aat gaa gcc ata 713

His Val Thr Arg Leu Asp Arg Trp Glu Pro Glu Leu Asn Glu Ala Ile 160 165 170 cca aac gac gag cgt gac acc aeg atg cct gta gca atg gca aca aeg 761

Pro Asn Asp Glu Arg Asp Thr Thr Met Pro Val Ala Met Ala Thr Thr 175 180 185 ttg cgc aaa eta tta act ggc gaa eta ctt act eta get tee egg caa 809

Leu Arg Lys Leu Leu Thr Gly Glu Leu Leu Thr Leu Ala Ser Arg Gin 190 195 200 caa tta ata gac tgg atg gag geg gat aaa gtt gca gga cca ctt ctg 857

Gin Leu lie Asp Trp Met Glu Ala Asp Lys Val Ala Gly Pro Leu Leu 205 210 215 cgc teg gcc ctt eeg get ggc tgg ttt att get gat aaa tet gga gee 905

Arg Ser Ala Leu Pro Ala Gly Trp Phe Ile Ala Asp Lys Ser Gly Ala 220 225 230 235 ggt gag cgt ggg tet cgc ggt ate att gea gca ctg ggg cca gat ggt 953

Gly Glu Arg Gly Ser Arg Gly lie lie Ala Ala Leu Gly Pro Asp Gly 240 245 250 aag ccc tcc cgt ate gta gtt ate tac aeg aeg ggg agt cag gca act 1002

Lys Pro Ser Arg Ile Val Val Ile Tyr Thr Thr Gly Ser Gin Ala Thr 255 260 265 atg gat gaa ega aat aga cag ate get gag ata ggt gcc tea ctg att 1049

Met Asp Glu Arg Asn Arg Gin Ile Ala Glu He Gly Ala Ser Leu He 270 275 280 aag cat tgg taaccgtcag accaagttta ctcatatata ctttagattg 1098

Lys His Trp 285 atttaaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatetca 1158 tgaccaaaat cccttaacgt gagttttcgt tccactgage gtcagaccec gtagaaaaga 1218 tcaaaggatc ttettgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa 1278 aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact ccttttccga 1338 aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctsgtg tageegtagt 1398 taggecacca cttcaagaac tctgcagcac cgcctacata cctcgctctg etaateetgt 14SB taccagtggc tgctgccagt ggcgataagt cgtgtcttac egggttggac tcaagacgat 1516 agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgeata eagcccagct 1578 tggagcgaac gacctacacc gaactgagat acctacagcg tgagcattga gaaagcgcca 1638 egctteccga agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag 1698 agcgcacgag ggagcttcca gggggaaacg cctggtatct tcatagtcct gtcgggtttc 1758 gccaectctg aettgagege cgatttttgt gatgetegte aggggggcgg agcctatgga 1818 aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgeteaca 1878 tgttctttcc tgcgttatcc cctgattetg tggataaccg tattaccgcc tttgagtgag 1938 ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc gaggaagegg 1998 aagagcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcac taacgcagct 2058 qgcscgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaacc aatgtgagtt 2118 agctcactca ttaggcaccc caggctttac actttatget tccggctcgt atgttgtgtg 2178 gaattgtgag cggataacaa tttcacacag gaaacagcta egaccatgat tacgccaagc 2238 tttggagcct tttttttgga gattttcaac gtg aaa aaa tta tta ttc gca act 2292

Met Lys Lys Leu Leu Phe Ala Ile 290 cct tta gtt gtt cct ttc tat tct cac agt gca cag gtc caa ctg cag 2340

Pro Leu Val Val Pro Phe Tyr Ser His Ser Ala Gin Val Gin Leu Gin 295 300 305 310 gtc gac etc gag ate aaa cgt gga act gtg get gca cca tct gtc ttc 2388

Val Asp Leu Glu Ile Lys Arg Gly Thr Val Ala Ala Pro Ser Val Phe 315 320 325 ate ttc ccg cca tct gat gag cag ttg aaa tct gga act gcc tct gtt 2436

Ile Phe Pro Pro Ser Asp Glu Gin Leu Lys Ser Gly Thr Ala Ser Val 330 335 340 gtg tgc ctg ctg aat aac ttc tat ccc aga gag gcc aaa gta cag tgg 2484

Val Cys Leu Leu Asn Asn phe Tyr Pro Arg Glu Ala Lys Val Gin Trp 345 350 355 aag gtg gat aac gcc ctc caa teg ggt aac tee cag gag agt gtc aca 2532

Lys Val Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin Glu Ser Val Thr 360 365 370 gag cag gac age aag gac age acc tac age ctc age age acc ctg aeg 2580

Glu Gin Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr 375 380 385 390 ctg age aaa gca gac tac gag aaa cac aaa gtc tac gcc tgc gaa gtc 2628

Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu Val 395 400 405 acc cat cag ggc ctg agt tea ccg gtg aca aag age ttc aac agg gga 2676

Thr His Gin Gly Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly 410 415 420 gag tgt taataaggcg cgccaattct atttcaagga gacagtcata atg aaa tac 2731 Glu Cys Met Lys Tyr 425 eta ttg cct aeg gca gcc get gga ttg tta tta ctc gcg gcc cag ccg 2779

Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala Ala Gin Pro 430 435 440 gcc atg gcc gaa gtt caa ttg tta gag tct ggt ggc ggt ett gtt cag 2827

Ala Met Ala Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin 445 450 455 cct ggt ggt tct tta cgt ett tet tgc get get tee gga getteagate 2876

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly 460 46S 470 tgcctgcctt tttgtggggt ggtgcagatc gcgttacgga gatcgaccga ctgcttgagc 2936 aaaagccacg cttaactgct gatcaggcat gggatgttat tcgccaaacc agtcgtcagg 2996 atcttaacct gaggcttttt ttacctactc tgcaagcagc gacatctggc ttgacacaga 3056 gcgatccgcg tcgtcagttg gtagaaacae taacacgttg ggatggcatc aatttgctta 3116 atgatgatgg taaaacctgg cagcagccag gctctgccat cctgaacgtt tggctgacea 3176 gtatgttgaa gcgtaccgta gtggctgccg tacctatgec atttgataag tggtacagcg 3236 ccagtggcta cgaaacaacc caggacggcc caactggttc gctgaatata agtgttggag 3296 eaaaaatttt gtatgaggcg gtgcagggag acaaatcacc aaCcccacag gcggttgatc 3356 tgtttgetgg gaaaccacag caggaggttg tgttggctgc gctggaagat acctgggaga 3416 etettteeaa acgetatgge aataatgtga gtaactggaa aacacctgea atggeettaa 3476 cgctccgggc aaataatttc tttggtgtac cgcaggccgc agcggaagaa acgcgtcacc 3536 aggcggagca teaaaaccgt ggaacagaaa acgatatgat tgttttctca ccaacgacaa 3596 gcgatcgtcc tgtgcttgcc tgggatgtgg tcgcacccgg tcagagtggg tttattgctc 3656 ccgatggaac agttgataag cactatgaag atcagctgaa aatgtacgaa aattttggcc 3716 gtaagtcgct ctggttaacg aagcaggatg tggaggcgca taaggagccg tct aga 3772

Ser Arg gac aac tct aag aat act etc tac ttg cag atg aac age tta agt ctg 3820

Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Ser Leu 475 480 4Θ5 490 age ate egg tee ggg caa cat tct cca aac tgaccagacg acacaaacgg 3870

Ser Ile Arg Ser Gly Gin His Ser Pro Asn 495 500 ettaegetaa atcccgcgca tgggatggta aagaggtgge gtctttgctg gcctggactc 3930 ateagatgaa ggccaaaaat tggeaggagt ggacacagca ggcagcgaaa caagcactga 3990 ccatcaactg gtactatgct gatgtaaacg gcaatattgg ttatgttcat aetggtgett 4050 atccagatcg tcaatcaggc eatgateegc gattacccgt teetggtaeg ggaaaatggg 4110 actggaaagg gctattgcct tttgaaatga accctaaggt gtataacccc eagaagetag 4170 cctgcggctt cggtcaccgt ctcaagc gcc tee acc aag ggc cca teg gtc tte 4224 Ala Ser Thr Lys Gly Pro Ser Val Phe 505 ccc ctg gea ccc tee tee aag age acc tct ggg ggc aca gcg gcc ctg 4272

Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu 510 515 S20 525 ggc tgc ctg qtc aag gac tac etc cec gaa ccg gtg aeg gtg tcg tgg 4320

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp 530 535 540 aac tea ggc gcc ctg acc age ggc gtc cac acc tte ccg get gtc eta 4366

Asn Ser Gly Ala Leu Thr Ser Gly Val Kis Thr Phe Pro Ala Val Leu 545 550 555 cag tee tea gga etc tac tec etc age age gta gtg acc gtg cec tee 4416

Gin Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser 560 565 570 age age ttg ggc acc cag acc tac atc tgc aac gtg aat cac aag ccc 44 64

Ser Ser Leu Gly Thr Gin Thr Tyr Ile Cys Asn Val Asn His Lys Pro 575 580 585 age aac acc aag gtg gac aag aaa gtt gag ccc aaa tet tgt gcg gcc 4512

Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Ala Ala 590 595 600 605 gea cat cat cat cac cat cac ggg gee gea gaa caa aaa etc ate tea 4560

Ala His Kis His Kis Nis His Gly Ala Ala Glu Gin Lys Leu Ile Ser 610 615 620 gaa gag gat ctg aat ggg gcc gea tag act gtt gaa agt tgttta gea 4608

Glu Glu Asp Leu Asn Gly Ala Ala Thr Val Glu Ser Cys Leu Ala 62S 630 635 aaa eet cat aca gaa aat tea ttt act aac gtc tgg aaa gac gac aaa 4656

Lys Pro His Thr Glu Asn Ser Phe Thr Asn Val Trp Lys Asp Asp Lys 640 645 650 act tta gat egt tac get aac tat gag ggc tgt ctg tgg aat get aca 4704

Thr Leu Asp Arg Tyr Ala Asn Tyr Glu Gly Cys Leu Trp Asn Ala Thr 655 660 665 ggc gtt gtg get tgt act ggt gac gaa act cag tgt tac ggt aca tgg 4752

Gly Val Val Val Cys Thr Gly Asp Glu Thr Gin Cys Tyr Gly Thr Trp 670 675 6Θ0 gtt eet att ggg ett get atc eet gaa aat gag ggt ggt ggc tet gag 4Θ00

Val Pro Ile Gly Leu Ala Ile Pro Glu Asn Glu Gly Gly Gly Ser Glu 685 690 695 700 ggt ggc ggt tet gag ggt ggc ggt tet gag ggt ggc ggt act aaa eet 4848

Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Thr Lys Pro 705 710 715 eet gag tac ggt gat aca eet att ccg ggc tat act tat atc aac eet 4896

Pro Glu Tyr Gly Asp Thr Pro Ile Pro Gly Tyr Thr Tyr Ile Asn Pro 720 725 730 etc gac ggc act tat ccg eet ggt act gag caa aac ccc get aat eet 4944

Leu Asp Gly Thr Tyr Pro Pro Gly Thr Glu Gin Asn Pro Ala Asn Pro 735 740 745 aat eet tet ett gag gag tet cag eet ett aat act tte atg ttt cag 4992

Asn Pro Ser Leu Glu Glu Ser Gin Pro Leu Asn Thr Phe Met Phe Gin 750 755 760 eat aat agg ttc cga aat agg cag ggt gca tta act gtt tat acg ggc 5040

Asn Asn Arg Phe Arg Asn Arg Gin Gly Ala Leu Thr Val Tyr Thr Gly 765 770 775 780 act gtt act caa ggc act gac ccc gtt aaa act tat tac cag tac act 5088

Thr Val Thr Gin Gly Thr Asp Pro Val Lys Thr Tyr Tyr Gin Tyr Thr 785 790 795 cct gta tea tea aaa gee atg tat gac get tac tgg aac ggt aaa ttc 5136

Pro Val Ser Ser Lys Ala Met Tyr Asp Ala Tyr Trp Asn Gly Lys Phe 800 805 810 aga gac tgc get ttc cat tet ggc ttt aat gag gat cca ttc gtt tgt 5184

Arg Asp Cys Ala Phe His Ser Gly Phe Asn Glu Asp Pro Phe Val Cys BIS 820 825 gaa tat caa ggc caa teg tet gac ctg cct caa cct cct gtc aat get 5232

Glu Tyr Gin Gly Gin Ser Ser Asp Leu Pro Gin Pro Pro Val Asn Ala 830 835 840 ggc ggc ggc tet ggt ggt ggt tee ggt ggc ggc tet gag ggt ggc ggc 5280

Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Glu Gly Gly Gly 845 850 855 860 tet gag ggc ggc ggt tet gag ggt ggc ggc tet gag ggt ggc ggt tee 5328

Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser 865 870 875 ggt ggc ggc tee ggt tee ggt gat ttt gat tat gaa aaa atg gca aac 5376

Gly Gly Gly Ser Gly Ser Gly Asp Phe Asp Tyr Glu Lys Met Ala Asn 8B0 885 890 get aat aag ggg get atg acc gaa aat gee gat gaa aac geg eta cag 5424

Ala Asn Lys Gly Ala Met Thr Glu Asn Ala Asp Glu Asn Ala Leu Gin 895 900 905 tet gac get aaa ggc aaa ett gat tet gtc get act gat tac ggt get 5472

Ser Asp Ala Lys Gly Lys Leu Asp Ser Val Ala Thr Asp Tyr Gly Ala 910 915 920 get ate gat ggt ttc att ggt gac gtt tee ggc ett get aat ggt aat 5520

Ala lie Asp Gly Phe lie Gly Asp Val Ser Gly Leu Ala Asn Gly Asn 925 930 935 940 ggt get act ggc gat ttt get ggc tet aat tee caa atg get caa gtc 5566

Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn Ser Gin Met Ala Gin Val

945 950 95S ggt gac ggt gat aat tea eet tta atg aat aat tte egt caa tat tta S616

Gly Asp Gly Asp Asn Ser Pro Leu Met Asn Asn Phe Arg Gin Tyr Leu 960 965 970 eet tet ttg eet cag teg gtt gaa tgt ege cct tat gtc ttt ggc get 5664

Pro Ser Leu Pro Gin Ser Val Glu Cys Arg Pro Tyr Val Phe Gly Ala 975 980 985 ggt aaa cca tat gaa ttt tet att gat tgt gac aaa ata aac tta ttc 5712

Gly Lys Pro Tyr Glu Phe Ser He Asp Cys Asp Lys lie Asn Leu Phe 990 995 1000 cgt ggt gtc ttt geg ttt ett tta tat gtt gee acc ttt atg tac gta 5760

Arg Gly Val Phe Ala Phe Leu Leu Tyr Val Ala Thr Phe Met Tyr Val 1005 1010 1015 1020 ttt teg acg ttt get aac ata ctg cgt aat aag gag tet taataagaat 5809

Phe Ser Thr Phe Ala Asn He Leu Arg Asn Lys Glu Ser 1025 · 1030 tcactggccg tcgttttaca aegtegtgae tgggaaaacc ctggcgttac ecaacttaat 5869 cgccttgcag cacatccccc tttcgccagc tggegtaata gegaagagge cegeaccgat 5929 cgcccttccc aacagttgcg cagcctgaat ggcgaatgge gcctgatgcg gtattttctc 5989 cttacgcatc tgtgeggtat ttcacaccgc atataaattg taaaegttaa tattttgtta 6049 aaattcgcgt taaatttttg ttaaatcagc tcatttttta accaataggc egaaategge 6109 aaaatccctt ataaatcaaa agaatagccc gagatagggt tgagtgttgt tccagtttgg 6169 aacaagagtc cactattaaa gaacgtggac tccaacgtca aagggegaaa aaeegtetat 6229 cagggcgatg geccactacg tgaaccatea cccaaatcaa gttttttggg gtcgaggtgc 6289 egtaaageae taaatcggaa ccctaaaggg agcccccgat ttagagcctg acggggaaag 6349 eeggcgaacg tggegagaaa ggaagggaag aaagcgaaag gagegggege tagggegctg 6409 gcaagtgtag cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa tgcgccgcta 6469 cagggcgcgt actatggttg ctttgacggg tgeagtetea gtacaatctg etetgatgee 6529 gcatagttaa gccagccceg acacccgcca aeaceegctg acgcgecctg acgggcttgt 6589 ctgctcccgg catccgctta cagacaagct gtgaccgtct eegggagctg catgtgtcag 6649 aggttttcac cgtcatcaec gaaaegcgcg a 6680

<210> 523 <211 > 286 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Vector pCES5 protein sequence <400> 523

Met Ser lie Gin Kis Phe Arg Val Ala Leu He Pro Phe Phe Ala Ala 15 10 15

Phe Cys Leu Pro Val Phe Ala His Pro Glu Thr Leu Val Lys Val Lys 20 25 30

Asp Ala Glu Asp Gin Leu Gly Ala Arg Val Gly Tyr lie Glu Leu Asp 35 40 45

Leu Asn Ser Gly Lys lie Leu Glu Ser Phe Arg Pro Glu Glu Arg Phe 50 55 60

Pro Met Met Ser Thr Phe Lys Val Leu Leu Cys Gly Ala Val Leu Ser 65 70 75 80

Arg He Asp Ala Gly Gin Glu Gin Leu Gly Arg Arg He His Tyr Ser 85 90 95

Gin Asn Asp Leu Val Glu Tyr Ser Pro Val Thr Glu Lys His Leu Thr 100 10S 110

Asp Gly Met Thr Val Arg Glu Leu Cys Ser Ala Ala lie Thr Met Ser LIS 120 125

Asp Asn Thr Ala Ala Asn Leu Leu Leu Thr Thr He Gly Gly Pro Lys 130 135 140

Glu Leu Thr Ala Phe Leu His Asn Met Gly Asp His Val Thr Arg Leu 145 150 155 160

Asp Arg Trp Glu Pro Glu Leu Asn Glu Ala He Pro Asn Asp Glu Arg 165 170 175

Asp Thr Thr Met Pro Val Ala Met Ala Thr Thr Leu Arg Lys Leu Leu 180 185 190

Thr Gly Glu Leu Leu Thr Leu Ala Ser Arg Gin Gin Leu lie Asp Trp 195 · 200 205

Met Glu Ala Asp Lys Val Ala Gly Pro Leu Leu Arg Ser Ala Leu Pro 210 215 220

Ala Gly Trp Phe He Ala Asp Lys Ser Gly Ala Gly Glu Arg Gly Ser 225 230 235 240

Arg Gly lie He Ala Ala Leu Gly Pro Asp Gly Lys Pro Ser Arg lie 245 250 255

Val Val He Tyr Thr Thr Gly Ser Gin Ala Thr Met Asp Glu Arg Asn 260 265 270

Arg Gin lie Ala Glu lie Gly Ala Ser Leu He Lys His Trp 275 280 285

<210> 524 <211 > 138 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Vector pCES5 protein sequence <400> 524

Met Lys Lys Leu Leu Phe Ala He Pro Leu Val Val Pro Phe Tyr Ser 15 10 15

His Ser Ala Gin Val Gin Leu Gin Val Asp Leu Glu lie Lys Arg Gly 20 25 30

Thr Val Ala Ala Pro Ser Val Phe lie Phe Pro Pro Ser Asp Glu Gin 35 40 45

Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 50 55 60

Pro Arg Glu Ala Lys Val Gin Trp Lys Val Asp Asn Ala Leu Gin Ser 65 70 75 80

Gly Asn Ser Gin Glu Ser Val Thr Glu Gin Asp Ser Lys Asp Ser Thr 85 90 95

Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 100 105 110

His Lys Val Tyr Ala Cys Glu Val Thr His Gin Gly Leu Ser Ser Pro 115 120 125

Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 130 135 <210> 525 <211> 48

<212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Vector pCES5 protein sequence <400> 525

Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Lea Ala 15 10 15

Ala Gin Pro Ala Met Ala Glu Val Gin Leu Leu Glu Ser Gly Gly Gly 20 25 30

Leu Val Gin Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly 35 40 45

<210> 526 <211 > 28 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Vector pCES5 protein sequence <400> 526

Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu 1 5 10 15

Ser Leu Ser Ile Arg Ser Gly Gin His Ser Pro Asn 20 25

<210> 527 <211> 533 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Vector pCES5 protein sequence <400> 527

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys 15 10 15

Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45

Gly Val His Thr phe Pro Ala Val Leu Gin Ser Ser Gly Leu Tyr Ser 50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gin Thr 65 70 75 80

Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys 85 90 95

Lys Val Glu Pro Lys Ser Cys Ala Ala Ala His His His His His His 100 105 110

Gly Ala Ala Glu Gin Lys Leu Ile Ser Glu Glu Asp Leu Asn Gly Ala 115 120 125

Ala Thr Val Glu Ser Cys Leu Ala Lys Pro His Thr Glu Asn Ser Phe 130 135 140

Thr Asn Val Trp Lys Asp Asp Lys Thr Leu Asp Arg Tyr Ala Asn Tyr 145 150 1S5 160

Glu Gly Cys Leu Trp Α9Π Ala Thr Gly Val Val Val Cys Thr Gly Asp 165 170 175

Glu Thr Gin Cys Tyr Gly Thr Trp val Pro Ile Gly Leu Ala Ile Pro 180 185 190

Glu Asn Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly 195 200 205

Ser Glu Gly Gly Gly Thr Lys Pro Pro Glu Tyr Gly Asp Thr Pro Ile 210 21$ 220

Pro Gly Tyr Thr Tyr Ile Asn Pro Leu Asp Gly Thr Tyr Pro Pro Gly 225 230 235 240

Thr Glu Gin Asn Pro Ala Asn Pro Asn Pro Ser Leu Glu Glu Ser Gin 245 250 255

Pro Leu Asn Thr Phe Met Phe Gin Asn Asn Arg Phe Arg Asn Arg Gin 260 26S 270

Gly Ala Leu Thr Val Tyr Thr Gly Thr Val Thr Gin Gly Thr Asp Pro 275 280 28S

Val Lys Thr Tyr Tyr Gin Tyr Thr Pro Val Ser Ser Lys Ala Met Tyr 290 295 300

Asp Ala Tyr Trp Asn Gly Lys Phe Arg Asp Cys Ala Phe His Ser Gly 305 310 315 320

Phe Asn Glu Asp Pro Phe Val Cys Glu Tyr Gin Gly Gin Ser Ser Asp 325 330 335

Leu Pro Gin Pro Pro Val Asn Ala Gly Gly Gly Ser Gly Gly Gly Ser 340 345 350

Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly 355 360 365

Gly Gly Ser Glu Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly Asp 370 375 380

Phe Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Ala Met Thr Glu 385 390 395 400

Asn Ala Asp Glu Asn Ala Leu Gin Ser Asp Ala Lys Gly Lys Leu Asp 405 410 415

Ser Val Ala Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe Ile Gly Asp 420 425 430

Val Ser Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala Gly 43S 440 445

Ser Asn Ser Gin Met Ala Gin Val Gly Asp Gly Asp Asn Ser Pro Leu 450 455 460

Met Asn Asn Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin Ser val Glu 465 470 475 480

Cys Arg Pro Tyr Val Phe Gly Ala Gly Lys Pro Tyr Glu Phe Ser Ile 485 490 495

Asp Cys Asp Lys Ile Asn Leu Phe Arg Gly Val Phe Ala Phe Leu Leu 500 505 510

Tyr Val Ala Thr Phe Met Tyr Val Phe Ser Thr Phe Ala Asn Ile Leu 515 520 525

Arg Asn Lys Glu Ser 530

<210> 528 <211 > 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 528 acctcactgg cttccggatt cactttctct 30

<210> 529 <211 > 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 529 agaaacccac tccaaacctt taccaggagc ttggcgaacc ca 42

<210> 530 <211 > 51 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 530 ggaaggcagt gatctagaga tagtgaagcg acctttaacg gagtcagcat a 51

<210> 531 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 531 ggaaggcagt gatctagaga tag 23

<210> 532 <211 > 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 532 gtgctgactc agccaccctc 20

<210> 533 <211 > 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 533 gccctgactc agcctgcctc 20

<210> 534 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 534 gagctgactc aggaccctgc 20

<210> 535 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 535 gagctgactc agccaccctc 20 <210> 536 <211 > 38

<212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 536 cctcgacagc gaagtgcaca gagcgtcttg actcagcc 38

<210> 537 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 537 cctcgacagc gaagtgcaca gagcgtcttg 30

<210> 538 <211 > 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 538 cctcgacagc gaagtgcaca gagcgctttg actcagcc 38

<210> 539 <211 > 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 539 cctcgacagc gaagtgcaca gagcgctttg 30

<210> 540 <211 > 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 540 cctcgacagc taagtgcaca gagcgctttg actcagcc 38

<210> 541 <211 > 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 541 cctcgacagc gaagtgcaca gagcgctttg 30

<210> 542 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 542 cctcgacagc gaagtgcaca gagcgaattg actcagcc 38

<210> 543 <211 > 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 543 cctcgacagc gaagtgcaca gagcgaattg 30

<210> 544 <211 > 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 544 cctcgacagc gaagtgcaca gtacgaattg actcagcc 38

<210> 545 <211 > 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 545 cctcgacagc gaagtgcaca gtacgaattg 30

<210> 546 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 546 cctcgacagc gaagtgcaca g 21

<210> 547 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 547 ccgtgtatta ctgtgcgaga g 21

<210> 548 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 548 ctgtgtatta ctgtgcgaga g 21

<210> 549 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 549 ccgtatatta ctgtgcgaaa g 21

<210> 550 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 550 ctgtgtatta ctgtgcgaaa g 21

<210> 551 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 551 ctgtgtatta ctgtgcgaga c 21

<210> 552 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 552 ccatgtatta ctgtgcgaga c 21

<210> 553 <211 > 94 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 553 ggtgtagtga tctagtgaca actctaagaa tactctctac ttgcagatga acagctttag ¢0 ggctgaggac actgcagtct actattgtgc gaga 94

<210> 554 <211> 94 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 554 ggtgtagtga tctagtgaca actctaagaa tactctctac ttgcagatga acagctttag 60 ggctgaggac actgcagtct actattgtgc gaaa 94

<210> 555 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 555 atagtagact gcagtgtcct cagcccttaa gctgttcatc tgcaagtaga gagtattctt 60 agagttgtct ctagatcact acacc 85

<210> 556 <211 > 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 556 gactgggtgt agtgatctag 20

<210> 557 <211 > 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 557 cttttctttg ttgccgttgg ggtg 24

<210> 558 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(9) <223> A, T, C, G, other or unknown <400> 558 nnnnnnnnng caggt 15

<210> 559 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(11) <223> A, T, C, G, other or unknown <400> 559 acctgcnnnn n 11

<210> 560 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified base <222> (4)..(7) <223> A, T, C, G, other or unknown <400> 560 gatnnnnatc 10

<210> 561 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(16) <223> A, T, C, G, other or unknown <400> 561 gaggagnnnn nnnnnn 16

<210> 562 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(10) <223> A, T, C, G, other or unknown <400> 562 nnnnnnnnnn ctcctc 16

<210> 563 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(10) <223> A, T, C, G, other or unknown <400> 563 ctcttcnnnn 10

<210> 564 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(5) <223> A, T, C, G, other or unknown <400> 564 nnnnngaagag 11

<210> 565 <211 > 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (1)..(15) <223> A, T, C, G, other or unknown <400> 565 nnnnnnnnnn nnnnngtccc 20

<210> 566 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400> 566 gacnnnnnng tc 12

<210> 567 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(11) <223> A, T, C, G, other or unknown <400> 567 cgtctcnnnn n 11

<210> 568 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7) ..(12) <223> A, T, C, G, other or unknown <400> 568 gtatccnnnn nn 12

<210> 569 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400> 569 gcannnnnntcg 12

<210> 570 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (9)..(8) <223> A, T, C, G, other or unknown <400> 570 gccnnnnngg c 11

<210> 571 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(11) <223> A, T, C, G, other or unknown <400> 571 ggtctcnnnn n 11

<210> 572 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 572 gacnnnnngtc 11

<210> 573 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 573 gacnnnnngtc 11

<210> 574 <211 >11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 574 ccannnnntg g 11

<210> 575 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(12) <223> A, T, C, G, other or unknown <400> 575 ccannnnnnn nntgg 15

<210> 576 <211 > 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (5)..(9) <223> A, T, C, G, other or unknown <400> 576 ggccnnnnng gcc 13

<210> 577 <211 > 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(9) <223> A, T, C, G, other or unknown <400> 577 ccannnnnntgg 12

<210> 578 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 578 cctnnnnnag g 11

<210> 579 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(7) <223> A, T, C, G, other or unknown <400> 579 gacnnnngtc 10

<210> 580 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4) ..(12) <223> A, T, C, G, other or unknown <400> 580 ccannnnnnn nntgg 15

<210> 581 <211 > 11 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (4)..(8) <223> A, T, C, G, other or unknown <400> 581 gcannnnntg c 11

<210> 582 <211> 10251 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: CJRA05 nucleotide sequence <220> <221 > CDS <222> (1578)..(1916) <220> <221 > CDS <222> (2388)..(2843) <220> <221 > CDS <222> (2849)..(2893) <220> <221 > CDS <222> (3189)..(4232) <220> <221 > CDS <222> (7418)..(8119) <220> <221 > CDS <222> (8160)..(9452) <400> 582 aatgctacta ctattagtag aatcgatgcc accttttcag ctcgcgcccc aaatgaaaat 60 atagctaaac aggttattga ccatctgcga aatgtatcta atggtcaaac taaatctact 120 cgttcgcaga attgggaatc aactgttata tggaatgaaa ettecagaea ecgtaettta 180 gttgcatatt taaaacatgt tgagctacag cattatattc agcaattaag ctctaagcca 240 tccgcaaaaa tgacctccta tcaaaaggag caatcaaagg tactctctaa tcccgacccg 300 ttggagtttg cttccggtct ggttcgcttt gaagctcgaa ttaaaacgcg atatttgaag 360 tcttccgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctataacagc 420 cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtctaaagca 480 tttgaggggg actcaatgaa tatttatgac gattccgcag tattggacgc tatccagtct 540 aaacatttta ccattacccc etctggcaaa aettcttttg caaaagcctc tcgctatttt 600 ggtttttatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt 660 aattcctttt ggcgttacgt atctgcacta gttgaatgtg gtattcctaa atcccaacCg 720 acgaatctct ctacctgtaa taatgttgtt ccgtcagctc gttttattaa cgtagatttt 780 tcttcccaac gtcccgactg gcacaatgag ccagttcCta aaatcgcaca aggcaaccca 840 caatgattaa agttgaaatt aaaccatctc aagcccaatt tactactcgt tctggtgttt 900 ctcgtcaggg caagccttat tcactgaatg agcagctttg ttacgttgat ttgggtaatg 960 aatatccggt tcttgtcaag attactcttg atgaaggtca gccagcctat gcgcctggtc 1020 tgtacaccgt tcatctgtcc tctttcaaag ttggtcagtt cggttccctt atgattgacc 1080 gtctgcgcct cgttccggct aagtaacatg gagcaggtcg cggatttcga cacaatttat 1140 caggcgatga tacaaatctc cgttgtactt tgtttcgcgc ttggtataat cgctgggggt 1200 caaagatgag tgttttagtg tattcttttg cctctttcgt tctaggttgg tgccttcgta 1260 gtggcattac gtattttacc cgtttaatgg aaacttcctc atgaaaaagt ctttagtcct 1320 caaagcctct gtagccgttg ctaccctcgt tccgatgccg tctttcgccg ctgagggtga 1380 cgatcccgca aaagcggcct ttaactccct gcaagcctca gcgaccgaat atatcggtta 1440 tgcgcgggcg atggttgttg tcattgtcgg cgcaaccatc ggtatcaagc tgttcaagaa 1500 attcacctcg aaagcaagct gataaaccga tacaactaaa ggctectttt ggagcctttt 1S60 ttttggagat tctcaac gtg aaa aaa tta tta ttc gca att cct tta gtt 1610 Met Lys Lys Leu Leu Phe Ala Ile Pro Leu Val 1 5 10 gtt cct ttc tat tct ggc gcg gcc gaa tea cat eta gac ggc gcc get 1656

Val Pro Phe Tyr Ser Gly Ala Ala Glu Ser His Leu Asp Gly Ala Ala 15 20 25 gaa act gtt gaa agt tgt tta gca aaa tee cat aca gaa aat tea ttt 1706

Glu Thr Val Glu Ser Cys Leu Ala Lys Ser His Thr Glu Asn Ser Phe 30 35 40 act aac gtc tgg aaa gac gac aaa acc tta gat cgt tac get aac tat 1754

Thr Asn Val Trp Ly$ Asp Asp Lys Thr Leu Asp Arg Tyr Ala Asn Tyr 45 50 55 gag ggc tgt etg tgg aat get aca gge gtt gta gtt tgt act ggt gac 1802

Glu Gly Cys Leu Trp Asn Ala Thr Gly Val Val Val Cys Thr Gly Asp 60 65 70 75 gaa act cag tgt tac ggt aca tgg gtt cct att ggg ett get ate cct 1Θ50

Glu Thr Gin Cys Tyr Gly Thr Trp Val Pro lie Gly Leu Ala He Pro 80 85 90 gaa aat gag ggc ggt ggc tet gag ggt gge ggt tet gag ggt ggc ggt 1898

Glu Asn Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly 95 100 105 tec gag ggt ggc ggt act aaacctcctg agtacggtga tacacctatt 1946

Ser Glu Gly Gly Gly Thr 110 ccgggctata cttatatcaa ccctctcgac ggeaettatc cgcctggtac tgagcaaaac 2006 cccgctaatc ctaatccttc tettgaggag tctcagcctc ttaatacttt catgtttcag 2066 aataataggt teegaaatag gcagggggca ttaactgett ataegggeae tgttactcaa 2126 ggcactgace ccgttaaaac ttattaccag tacactcctg tatcatcaaa ageeatgtat 2186 gacgcctact ggaacggtaa attcagagac tgcgctttec attctggccc taatgaggat 2246 ccatttgccc gtgaatatca aggccaatcg tctgacctgc ctcaacctcc tgtcaatgct 2306 ggcggcggcc ctggtggtgg ttctggtggc ggctctgagg gtggtggcte tgagggaggc 2366 ggttccggtg gtggctctgg t tee ggt gat ttt gac tat gaa aag atg gca 2417

Ser Gly Asp Phe Asp Tyr Glu Lys Met Ala 115 120 aac get aac aag ggg gee atg acc gaa aat gee gat gaa aac geg cta 2465

Asn Ala Asn Lys Gly Ala Met Thr Glu Asn Ala Asp Glu Asn Ala Leu 125 130 135 cag tet gac get aaa ggc aaa ett gat tet gtc get act gat tac ggt 2513

Gin Ser Asp Ala Lys Gly Lys Leu Asp Ser Val Ala Thr Asp Tyr Gly 140' 145 150 155 get get ate gat ggt ttc act ggt gac gtt tee ggc ett get aat ggt 2561

Ala Ala lie Asp Gly Phe He Gly Asp Val Ser Gly Leu Ala Asn Gly 160 165 170 aat ggt get act ggt gat ttt get ggc tet aat tee caa atg get caa 2609

Asn Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn Ser Gin Met Ala Gin 175 180 185 gtc ggt gac ggt gat aat tea cct tta atg aat aat ttc cgt caa tat 2657

Val Gly Asp Gly Asp Asn Ser Pro Leu Met Asn Asn Phe Arg Gin Tyr 190 195 200 tta cct tcc ctc eet caa teg gtt gaa tgt ege eet ttt gte ttt ggc 2705

Leu Pro Ser Leu Pro Gin Ser Val Glu Cys Arg Pro Phe Val Phe Gly 205 210 215 get ggt aaa cca tat gaa ttt tet att gat tgt gac aaa ata aac tta 2753

Ala Gly Lys Pro Tyr Glu Phe Ser Ile Asp Cys Asp Lys Ile Asn Leu 220 225 230 235 tte egt ggt gte ttt geg ttt ett tea tat gtt gcc acc ttt atg tat 2801

Phe Arg Gly Val Phe Ala Phe Leu Leu Tyr Val Ala Thr Phe Met Tyr 240 245 250 gta ttt tet aeg ttt get aac ata ctg egt aat aag gag tet taatc atg 2851

Val Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn Lys Glu Ser Met 255 260 265 cea gtt ett ttg ggt att ecg tta tta ttg egt tte etc ggt 2893

Pro Val Leu Leu Gly Ile Pro Leu Leu Leu Arg Phe Leu Gly 270 275 280 ttecttctgg taactttgtt eggetatetg ettaetttte ttaaaaaggg etteggtaag 2953 atagetattg etattteatt gtttcttgct ettattattg ggcttaactc aattcttgtg 3013 ggttatetet ctgatattag cgctcaatta ccctctgact ttgttcaggg tgtteagtta 3073 attctcccgt etaatgeget tccctgtttt tatgttatte tctctgtaaa ggetgetatt 3133 ttcatttttg aegttaaaea aaaaatcgtt tcttatttgg attgggataa ataat atg 3191

Met get gtt tat ttt gta act ggc aaa tta ggc tet gga aag aeg etc gtt 3239

Ala Val Tyr Phe Val Thr Gly Lys Leu Gly Ser Gly Lys Thr Leu Val 28S 290 295 age gtt ggt aag att eag gat aaa att gta get ggg tgc aaa ata gea 3287

Ser Val Gly Lys Ile Gin Asp Lys Ile Val Ala Gly Cys Lys Ile Ala 300 305 310 act aat ett gat tta agg ett caa aac etc ceg caa gte ggg agg tte 3335

Thr Asn Leu Asp Leu Arg Leu Gin Asn Leu Pro Gin Val Gly Arg Phe 315 320 325 get aaa aeg cct ege gtt ett aga ata ccg gat aag cct tet ata tet 3383

Ala Lys Thr Pro Arg Val Leu Arg Ile Pro Asp Lys Pro Ser Ile Ser 330 335 340 345 gat ttg ett get att ggg ege ggt aat gat tce tac gat gaa aat aaa 3431

Asp Leu Leu Ala Ile Gly Arg Gly Asn Asp Ser Tyr Asp Glu Asn Lys 350 355 360 aac ggc ttg ett gtt etc gat gag tgc ggt act tgg ttt aat acc egt 3479

Asn Gly Leu Leu Val Leu Asp Glu Cys Gly Thr Trp Phe Asn Thr Arg 365 370 375 tet tgg aat gat aag gaa aga eag ccg att att gat tgg ttt eta cat 3527

Ser Trp Asn Asp Lys Glu Arg Gin Pro Ile Ile Asp Trp Phe Leu His 380 385 390 get cgt aaa eta gga egg gae att act ttt ett gtt cag gac tea tee 3575

Ala Arg Lys Leu Gly Trp Asp He lie Phe Leu Val Gin Asp Leu Ser 395 400 405 act gtt gat aaa cag geg cgt tet gca tta get gaa cat gee gee tat 3623 lie Val Asp Lys Gin Ala Arg Ser Ala Leu Ala Glu His Val Val Tyr 410 415 420 425 tgt cgt cgt ctg gac aga ate act tta cct ttt gtc ggt act tta tat 3671

Cys Arg Arg Leu Asp Arg lie Thr Leu Pro Phe Val Gly Thr Leu Tyr 430 435 440 tet ett att act ggc teg aaa atg cct ctg cct aaa tta cat gtt ggc 3719

Ser Leu He Thr Gly Ser Lys Met Pro Leu Pro Lys Leu His Val Gly

445 450 45S gtt gtt aaa tat ggc gat tet caa tta age cct act gtt gag cgt tgg 3767

Val Val Lys Tyr Gly Asp Ser Gin Leu Ser Pro Thr Val Glu Arg Trp 460 465 · 470 ett tat act ggt aag aat ttg tat aac gca tat gat act aaa cag get 3815

Leu Tyr Thr Gly Lys Asn Leu Tyr Asn Ala Tyr Asp Thr Lys Gin Ala 475 480 485 ttt tet agt aat tat gat tcc ggt gtt tat tet tat tta aeg cct tat 3863

Phe Ser Ser Asn Tyr Asp Ser Gly Val Tyr Ser Tyr Leu Thr Pro Tyr 490 495 500 505 tta tea cac ggt egg tat ttc aaa cca tta aat tta ggt cag aag atg 3911

Leu Ser His Gly Arg Tyr Phe Lys Pro Leu Asn Leu Gly Gin Lys Met 510 515 520 aaa tta act aaa ata tat ttg aaa aag ttt tet ege gtt ett tgt ett 3959

Lys Leu Thr Lys He Tyr Leu Lys Lys Phe Ser Arg Val Leu Cys Leu 525 530 535 geg att gga ttt gca tea gca ttt aca tat agt tat ata acc caa cct 4007

Ala He Gly Phe Ala Ser Ala Phe Thr Tyr Ser Tyr lie Thr Gin Pro 540 545 550 aag ccg gag gtt aaa aag gta gtc tet cag acc tat gat ttt gat aaa 4055

Lys Pro Glu Val Lys Lys Val Val Ser Gin Thr Tyr Asp Phe Asp Lys 555 560 565 ttc act att gac tet tet cag cgt ett aat eta age tat ege tat gtt 4103

Phe Thr lie Asp Ser Ser Gin Arg Leu Asn Leu Ser Tyr Arg Tyr Val 570 575 580 585 ttc aag gat tet aag gga aaa tta att aac age gac gat tta cag aag 4151

Phe Lys Asp Ser Lys Gly Lys Leu lie Asn Ser Asp Asp Leu Gin Lys S90 595 600 caa ggt tat tea etc aca tat att gat tta tgt act gtt tcc att aaa 4199

Gin Gly Tyr Ser Leu Thr Tyr lie Asp Leu Cys Thr Val Ser lie Lys 605 610 615 aaa ggt aat tea aat gaa att get aaa tgt aat taattttgtt ttcttgatgt 4252

Lys Gly Asn Ser Asn Glu Ile Val Lys Cys Asn 620 625 ttgtttcatc atcttctttt gctcaggtaa ctgaaatgaa taattcgcct ctgcgcgatt 4312 ttgtaaectg gtattcaaag caatcaggcg aatccgttat tgtttctccc gatgCaaaag 4372 gtactgttac tgtatactca tctgacgtta aacctgaaaa tctacgcaat ttctttattt 4432 ctgttttacg tgcaaataat tttgatatgg taggttctaa cccttccatt attcagaagt 4492 ataatccaaa caatcaggat tatattgatg aactgccatc atctgataat caggaatatg 4552 atgataatcc cgctccttct ggcggtttct ttgttccgca aaatgataat gttactcaaa 4612 cttttaaaat taataacgtt cgggcaaagg attcaatacg agttgtcgaa ttgtttgtaa 4672 agtctaatac tcctaaatcc tcaaatgtat tatctattga cggctctaat ctattagctg 4732 ctagtgcccc taaagatact ttagataacc ttcctcaatC cctttcaact gttgatttgc 4792 caactgacca gatattgact gagggtttga tattegaggt Ccagcaaggt gatgctttag 4652 atttttcatt tgctgccggc tctcagcgtg gcactgttgc aggcggtgtt aatactgacc 4912 gcctcacctc tgttttatct tctgctggtg gttcgttcgg tatttttaat ggcgatgttt 4972 tagggctatc agttcgcgea ttaaagacta atagccattc aaaaatattg tetgtgecae 5032 gtattcttac gctttcaggt cagaagggtt ctatctctgt tggccagaat gtccctttta 5092 ttacCggtcg tgtgactggt gaatctgcca atgtaaataa tccatttcag acgattgagc 5152 gtcaaaatgt aggtacttcc atgagcgttt ttcctgttgc aatggctggc ggtaatattg 5212 ttctggatat taccagcaag gccgatagtt tgagttcttc cactcaggca agtgatgcta 5272 ttactaatca aagaagcatt gctacaacgg ttaatctgcg tgatggacag actctcccac 5332 tcggcggcct caetgattat aaaaacactt ctcaggattc tggcgtaccg ttcctgtcta 5392 aaatcccttt aatcggcctc ctgtttagct cccgctctga ttctaacgag gaaagcacgt 5452 tatacgtgcc cgtcaaagca accatagtac gcgccctgta gcggcgcatt aagcgcggcg SS12 ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcea gegccctage gccegctect 5572 ttcgctttct tcccttcctt tctcgccacg ttcgccggct ttccccgtca agccctaaat 5632 cgggggctcc ccttagggtc ccgatttagt gctttacggc acctcgaccc caaaaaactt 5692 gatttgggtg atggttcacg tagtgggcca tcgccctgat agacggtttt tcgccctttg 5752 acgttggagt ccacgttctt taatagtgga ctettgttcc aaactggaac aacactcaac 5812 cetacctcgg gctattcttt tgatttataa gggatttcgc cgatttcgga accaccatca 5972 aacaggatct tcgcccgctg gggcaaacca gcgtggaccg cttgctgcaa ctctctcagg 5932 gccaggcggt gaagggcaat cagccgcegc ecgtctcact ggtgaaaaga aaaaccaccc 5992 tggatccaag ettgcaggtg gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt 6052 atttttctaa atacattcaa atatgtatcc gctcaCgaga caataaccct gataaatgct 6112 tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg cccttattcc 61*72 cttttttgcg gcattttgcc tteetgtttt tgctcaccca gaaacgctgg tgaaagtaaa 6232 agatgctgaa gatcagttgg gcgcactagt gggtcacatc gaactggatc tcaacagcgg 6292 caagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca cttttaaagt 6352 tetgetatgt ggcgcggtat tatcccgtat cgacgccggg caagagcaac tcggtcgccg 6412 catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa agcatcttac 64*72 ggatggcatg acagtaagag aattatgeag tgctgccata accatgagtg ataacactgc 6532 ggccaaccta cctctgacaa cgatcggagg accgaaggag ctaaccgctt ttctgcacaa 6592 catgggggac catgtaactc gccttgaccg ctgggaaccg gagctgaatg aagccacacc 6652 aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc gcaaactatt 6712 aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga tggaggcgga 6772 taaagtcgca ggaccacttc tgcgcccggc ccttccggct ggctggttta ttgctgataa 6832 atctggagcc ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc cagatggtaa 6692 gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg atgaacgaaa 6952

Cagacagacc gctgagatag gtgccccact gaccaagcat tggtaactgt eagaccaagt 7012 ttaetcatat atactttaga ttgatttaaa aettcatttt taatttaaaa ggatctaggt 7072 gaagatcctt tetgacaatc tcatgaccaa aatcccttaa egtgagtttt cgttccactg 7132 tacgtaagac ccccaagctt gtcgactgaa tggcgaatgg cgctttgcct ggtttccggc 7192 accagaagcg gtgccggaaa gctggctgga gtgcgatctt cctgacgctc gagcgcaacg 7252 eaattaatgt gagttagctc actcattagg caccccaggc tttacacttt atgcttccgg 7312 ctcgtacgct gtgtggaatt gcgagcggat aacaacttca cacaggaaac agctatgacc 7372 atgattacgc caagccttgg agcctttttt ttggagatct Ccaac gtg aaa aaa cca 7429

Met Lys Lys Leu 630 tta ttc gca act cct tta gtt gtt cct ttc cat tcc cac age gea caa 7477

Leu Phe Ala Ile Pro Leu Val Val Pro Phe Tyr Ser Kis Ser Ala Gin 63S 640 645 gac ate cag atg acc cag tet cca gcc acc ctg Cct ttg tet cca ggg 7525

Asp Ile Gin Met Thr Gin Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly 650 655 660 gaa aga gcc acc etc tcc tgc agg gcc agt cag ggt gtt age age tac 7573

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Gly Val Ser Ser Tyr 665 670 675 680 tta gcc tgg tac cag cag aaa cct ggc cag get ccc agg etc etc ate 7621

Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ala Pro Arg Leu Leu lie

685 690 69S tat gat gca tcc aae agg gcc act ggc ate cca gcc agg ttc agt ggc 7669

Tyr Asp Ala Ser Asn Arg Ala Thr Gly He Pro Ala Arg Phe Ser Gly 700 705 710 agt ggg cct ggg aca gac ttc act etc acc ate age age eta gag cct 7717

Ser Gly Pro Gly Thr Asp Phe Thr Leu Thr lie Ser Ser Leu Glu Pro

715 720 72S gaa gat ttt gca gtt tat tac tgt cag cag cgt aac tgg cat ccg tgg 7765

Glu Asp Phe Ala Val Tyr Tyr Cys Gin Gin Arg Asn Trp His Pro Trp 730 735 740 aeg ttc ggc caa ggg acc aag gtg gaa ate aaa ega act gtg get gca 7813

Thr Phe Gly Gin Gly Thr Lys Val Glu lie Lys Arg Thr Val Ala Ala 745 750 755 760 cca tet gtc ttc ate ttc ccg cca tet gat gag cag ttg aaa tet gga 7861

Pro Ser Val Phe lie Phe Pro Pro Ser Asp Glu Gin Leu Lys Ser Gly 765 770 775 act gcc tet gtt gtg tgc ctg ctg aat aac ttc tat ccc aga gag gcc 7909

Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 780 785 790 aaa gta cag tgg aag gtg gat aac gcc etc caa teg ggt aac tcc cag 79S7

Lys Val Gin Trp Lys Val Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin 795 800 805 gag agt gtc aca gag egg gac age aag gac age acc tac age etc age 8005

Glu Ser Val Thr Glu Arg Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser S10 815 820 age acc ctg aeg ctg age aaa gca gac tac gag aaa cac aaa gtc tac 8053

Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 825 830 835 840 gcc tgc gaa gtc acc cat cag ggc ctg age teg ccc gtc aca aag age 8101

Ala Cys Glu Val Thr His Gin Gly Leu Ser Ser Pro Val Thr Lys Ser 845 850 8S5 ttc aac agg gga gag tgt taataaggcg cgccaattct atttcaagga 8149

Phe Asn Arg Gly Glu Cys 860 gacagtcata atg aaa tac eta ttg cct aeg gca gcc get gga ttg tta 8198

Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu 865 870 875 tta etc geg gee cag ccg gee atg gee gaa gtt caa ttg tta gag ret 8246

Leu Leu Ala Ala Gin Pro Ala Met Ala Glu Val Gin Leu Leu Glu Ser 8Θ0 885 690 ggt ggc ggt ett gtt cag cct ggt ggt tet tta cgt ett tet tgc get 8294

Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Θ95 900 905 get tee gga ttc act ttc tet act tac gag atg egt tgg gtt ege caa 8342

Ala Ser Gly Phe Thr Phe Ser Thr Tyr Glu Met Arg Trp Val Arg Gin 910 915 920 get cct ggt aaa ggt ttg gag tgg gtt tet tat ate get cct tet ggt 8390

Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Tyr lie Ala Pro Ser Gly 925 930 935 ggc gat act get tat get gac tee gtt aaa ggt ege ttc act ate tet 8438

Gly Asp Thr Ala Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr lie Ser 940 945 950 955 aga gac aac tet aag aat act etc tac ttg cag atg aae age tta agg 8486

Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg 960 965 970 get gag gac act gca gtc tac tat tgt geg agg agg etc gat ggc tat 8534

Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Arg Leu Asp Gly Tyr 975 980 985 att tee tac tac tac ggt atg gac gtc tgg ggc caa ggg acc aeg gtc 8582 lie Ser Tyr Tyr Tyr Gly Met Asp Val Trp Gly Gin Gly Thr Thr Val 990 995 1000 acc gtc tea age gee tee acc aag ggc cca teg gtc ttc cce ctg gca 8630

Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala 1005 1010 1015 ccc tee tee aag age acc tet ggg ggc aca geg gee ctg gge tgc etg 8678

Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu 1020 1025 1030 1035 gtc aag gac tac ttc ccc gaa ccg gtg aeg gtg teg tgg aac tea ggc 8726

Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly 1040 1045 1050 gee ctg acc age ggc gtc cac acc ttc ccg get gtc eta cag tee tea 8774

Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gin Ser Ser 1055 1060 1065 gga etc tac tee etc age age gta gtg acc gtg ccc tee age age ttg 8822

Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu 1070 1075 1080 ggc acc cag acc tac ate tgc aac gtg aat cac aag ccc age aac acc 8870

Gly Thr Gin Thr Tyr lie Cys Asn Val Asn His Lys Pro Ser Asn Thr 1085 1090 1095 aag gtg gac aag aaa gtt gag ccc aaa tet tgt geg gee gca cat cat 8918

Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Ala Ala Ala His His 1100 1105 1110 1115 cat cac cat cac ggg gcc gca gaa caa aaa etc ate tea gaa gag gat 6966

His His His His Gly Ala Ala Glu Gin Lys Leu Ile Ser Glu Glu Asp 1120 1125 1130 ctg aat ggg gcc gca tag get age tet get wsy ggy gay tty gay tay 9014

Leu Asn Gly Ala Ala Gin Ala Ser Ser Ala Ser Gly Asp Phe Asp Tyr 1135 1140 1145 gar aar atg get aaw gcy aay aar ggs gey atg aey gar aay gcy gay 9062

Glu Lys Met Ala Asn Ala Asn Lys Gly Ala Met Thr Glu Asn Ala Asp 1150 1155 1160 gar aay gck ytr car wsy gay gcy aar ggy aar ytw gay wsy gtc gck 9110

Glu Asn Ala Leu Gin Ser Asp Ala Lys Gly Lys Leu Asp Ser Val Ala 1165 1170 1175 acy gay tay ggy gcy gcc atc gay ggy tty aty ggy gay gtc wsy ggy 9158

Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe Ile Gly Asp Val Ser Gly 1160 1185 1190 1195 ytk gcy aay ggy aay ggy gcy acy ggw gay tty gcw ggy tek aat tcy 9206

Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn Ser 1200 1205 1210 car atg gcy car gty ggw gay ggk gay aay wsw cck ytw atg aay aay 9254

Gin Met Ala Gin Val Gly Asp Gly Asp Asn Ser Pro Leu Met Asn Asn 1215 1220 1225 tty mgw car tay ytw cck tcy ety cck car wsk gty gar tgy egy ccw 9302

Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin Ser Val Glu Cys Arg Pro 1230 1235 1240 tty gty tty wsy gcy ggy aar ccw tay gar tty wsy aty gay tgy gay 93S0

Phe Val Phe Ser Ala Gly Lys Pro Tyr Glu Phe Ser Ile Asp Cys Asp 1245 1250 1255 aar atro aay ytw tty egy ggy gty tty gck tty ytk yta tay gty gcy 9398

Lys Ile Asn Leu Phe Arg Gly Val Phe Ala Phe Leu Leu Tyr Val Ala 1260 1265 1270 1275 acy tty atg tay gtw tty wsy ack tty gcy aay atw ytr egy aay aar 9446

Thr Phe Met Tyr Val Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn Lys 1280 1285 1290 gar wsy tagtgatctc ctaggaagcc cgcctaatga gcgggctttt tttttctggt 9502 Glu Ser atgcatcctg aggeegatac tgtegtegte ccctcaaact ggeagatgea eggttaegat 9S62 gcgcccatct acaccaacgt gacctatccc attaeggtea atccgccgtt tgttcccacg 9622 gagaatccga egggtegtta ctcgctcaca tttaatgttg atgaaagctg gctacaggaa 9682 ggccagacgc gaattatttt cgatggcgtt cctattggtt aaaaaatgag ccgatttaac 9742 aaaaatttaa tgcgaatttt aacaaaatat taaegtttae aatttaaaca tttgcttata 9802 caatcttcct gtttttgggg ettttetgae tatcaaccgg ggtacatatg attgacatgc 9862 tagttttaeg attaccgttc atcgattctc ttgtttgctc cagactctca ggcaatgacc 9922 tgatagcctt tgtagatctc tcaaaaatag ctececcetc eggeattaat ttateageta 9982 gaacggctga atatcatatt gatggtgatt tgactgtctc cggcctttct cacccctttg 10042 aatctttacc tacacattac teaggeattg catttaaaat atatgagggt tctaaaaatt 10102 tttatccttg cgttgaaata aaggcttctc ccgcaaaagt attaeagggt cataatgttt 10162 ttggtacaac egatteaget etatgetetg aggetttatt gcttaatttt gctaattctt 10222 tgccttgcct gtatgattta ttggatgtt 10251

<210> 583 <211 > 113 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: CJRA05 protein sequence <400> 583

Met Lys Lys Leu Leu Phe Ala lie Pro Leu Val Val Pro Phe Tyr Ser IS 10 15

Gly Ala Ala Glu Ser His Leu Asp Gly Ala Ala Glu Thr Val Glu Ser 20 25 30

Cys Leu Ala Lys Ser His Thr Glu Asn Ser Phe Thr Asn Val Trp Lys 35 40 45

Asp Asp Lys Thr Leu Asp Arg Tyr Ala Asn Tyr Glu Gly Cys Leu Trp 50 55 60

Asn Ala Thr Gly Val Val Val Cys Thr Gly Asp Glu Thr Gin Cys Tyr 65 70 75 80

Gly Thr Trp Val Pro lie Gly Leu Ala lie Pro Glu Asn Glu Gly Gly 85 90 95

Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly 100 105 110

Thr

<210> 584 <211 > 152 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: CJRA05 protein sequence <400> 584

Ser Gly Asp Phe Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Ala 15 10 15

Met Thr Glu Asn Ala Asp Glu Asn Ala Leu Gin Ser Asp Ala Lys Gly 20 25 30

Lys Leu Asp Ser Val Ala Thr Asp Tyr Gly Ala Ala lie Asp Gly Phe 35 40 45 lie Gly Asp Val Ser Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp 50 55 60 phe Ala Gly Ser Asn Ser Gin Met Ala Gin Val Gly Asp Gly Asp Asn 65 70 75 80

Ser Pro Leu Met Asn Asn Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin 85 90 95

Ser Val Glu Cys Arg Pro Phe Val Phe Gly Ala Gly Lys Pro Tyr Glu 100 105 no

Phe Ser lie Asp Cys Asp Lys lie Asn Leu Phe Arg Gly Val Phe Ala 115 120 125

Phe Leu Leu Tyr Val Ala Thr Phe Met Tyr Val Phe Ser Thr Phe Ala 130 135 140

Asn lie Leu Arg Asn Lys Glu Ser 145 150

<210> 585 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: CJRA05 peptide sequence <400> 585

Met Pro val Leu Leu Gly He Pro Leu Leu Leu Arg Phe Leu Gly 15 10 15

<210> 586 <211> 348 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: CJRA05 protein sequence <400> 586

Met Ala Val Tyx Phe Val Thr Gly Lys Leo Gly Ser Gly Lys Thr Leu 1 5 10 15

Val Ser Val Gly Lys Ile Gin Asp Lys Ile Val Ala Gly Cys Lys He 20 25 30

Ala Thr Asn Leu Asp Leu Arg Leu Gin Asn Leu Pro Gin Val Gly Arg 35 40 45

Phe Ala Lys Thr Pro Arg Val Leu Arg lie Pro Asp Lys Pro Ser He 50 55 60

Ser Asp Leu Leu Ala Ile Gly Arg Gly Asn Asp Ser Tyr Asp Glu Asn 65 70 75 80

Lys Asn Gly Leu Leu Val Leu Asp Glu Cys Gly Thr Trp Phe Asn Thr 85 90 95

Arg Ser Trp Asn Asp Lys Glu Arg Gin Pro He lie Asp Trp Phe Leu 100 105 110

His Ala Arg Lys Leu Gly Trp Asp lie lie Phe Leu Val Gin Asp Leu 115 120 125

Ser lie Val Asp Lys Gin Ala Arg Ser Ala Leu Ala Glu His val Val 130 135 140

Tyr Cys Arg Arg Leu Asp Arg lie Thr Leu Pro Phe Val Gly Thr Leu 145 150 155 160

Tyr Ser Leu lie Thr Gly Ser Lys Met Pro Leu Pro Lys Leu His Val 165 170 175

Gly Val Val Lys Tyr Gly Asp Ser Gin Leu Ser Pro Thr Val Glu Arg 180 185 190

Trp Leu Tyr Thr Gly Lys Asn Leu Tyr Asn Ala Tyr Asp Thr Lys Gin 195 200 205

Ala Phe Ser Ser Asn Tyr Asp Ser Gly Val Tyr Ser Tyr Leu Thr Pro 210 215 220

Tyr Leu Ser His Gly Arg Tyr Phe Lys Pro Leu Asn Leu Gly Gin Lys 225 230 235 240

Met Lys Leu Thr Lys He Tyr Leu Lys Lys Phe Ser Arg Val Leu Cys 245 250 255

Leu Ala He Gly Phe Ala Ser Ala Phe Thr Tyr Ser Tyr lie Thr Gin 260 265 270

Pro Lys Pro Glu Val Lys Lys Val Val Ser Gin Thr Tyr Asp Phe Asp 275 280 2Θ5

Lys Phe Thr lie Asp Ser Ser Gin Arg Leu Asn Leu Ser Tyr Arg Tyr 290 295 300

Val Phe Lys Asp Ser Lys Gly Lys Leu lie Asn Ser Asp Asp Leu Gin 305 310 315 320

Lys Gin Gly Tyr Ser Leu Thr Tyr lie Asp Leu Cys Thr Val Ser lie 325 330 335

Lys Lys Gly Asn Ser Asn Glu He Val Lys Cys Asn 340 345

<210> 587 <211 > 234 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: CJRA05 protein sequence <400> 587

Met Lys Lys Leu Leu Phe Ala lie Pro Leu Val Val Pro Phe Tyr Ser 15 10 IS

His Ser Ala Gin Asp lie Gin Met Thr Gin Ser Pro Ala Thr Leu Ser 20 25 30

Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Gly 35 40 45

Val Ser Ser Tyr Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ala Pro 50 55 60

Arg Leu Leu He Tyr Asp Ala Ser Asn Arg Ala Thr Gly lie Pro Ala 65 70 75 80

Arg Phe Ser Gly Ser Gly Pro Gly Thr Asp Phe Thr Leu Thr lie Ser 85 90 95

Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gin Gin Arg Asn 100 105 110

Trp His Pro Trp Thr Phe Gly Gin Gly Thr Lys Val Glu lie Lys Arg 115 120 125

Thr Val Ala Ala Pro Ser Val Phe lie Phe Pro Pro Ser Asp Glu Gin 130 135 140

Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 145 150 155 160

Pro Arg Glu Ala Lys Val Gin Trp Lys Val Asp Asn Ala Leu Gin Ser 165 170 175

Gly Asn Ser Gin Glu Ser Val Thr Glu Arg Asp Ser Lys Asp Ser Thr 180 185 190

Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 195 200 205

His Lys Val Tyr Ala Cys Glu Val Thr His Gin Gly Leu Ser Ser Pro 210 215 220

Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230

<210> 588 <211> 431 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: CJRA05 protein sequence <400> 588

Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala 1 5 10 15

Ala Gin Pro Ala Met Ala Glu Val Gin Leu Leu Glu Ser Gly Gly Gly 20 25 30

Leu Val Gin Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly 35 40 45

Phe Thr Phe Ser Thr Tyr Glu Met Arg Trp Val Arg Gin Ala Pro Gly 50 55 60

Lys Gly Leu Glu Trp Val Ser Tyr He Ala Pro Ser Gly Gly Asp Thr 65 70 75 80

Ala Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr He Ser Arg Asp Asn 8S 90 95

Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp 100 105 110

Thr Ala Val Tyr Tyr Cys Ala Arg Arg Leu Asp Gly Tyr He Ser Tyr 115 120 125

Tyr Tyr Gly Met Asp Val Trp Gly Gin Gly Thr Thr Val Thr Val Ser 130 135 140

Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser 145 150 15S 160

Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp 165 170 175

Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr 180 185 190

Ser Gly Val His Thr Phe Pro Ala val Leu Gin Ser Ser Gly Leu Tyr 195 200 205

Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gin 210 215 220

Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp 225 230 235 240

Lys Lys Val Glu Pro Lys Ser Cys Ala Ala Ala His His His Kis His 245 250 255

His Gly Ala Ala Glu Gin Lys Leu Ile Ser Glu Glu Asp Leu Asn Gly 260 265 270

Ala Ala Gin Ala Ser Ser Ala Ser Gly Asp Phe Asp Tyr Glu Lys Met 275 280 285

Ala Asn Ala Asn Lys Gly Ala Met Thr Glu Asn Ala Asp Glu Asn Ala 290 295 300

Leu Gin Ser Asp Ala Lys Gly Lys Leu Asp Ser Val Ala Thr Asp Tyr 305 310 315 320

Gly Ala Ala Ile Asp Gly Phe Ile Gly Asp Val Ser Gly Leu Ala Asn 325 330 335

Gly Asn Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn Ser Gin Met Ala 340 345 350

Gin Val Gly Asp Gly Asp Asn Ser Pro Leu Met Asn Asn Phe Arg Gin 355 360 365

Tyr Leu Pro Ser Leu Pro Gin Ser Val Glu Cys Arg Pro Phe Val Phe 370 375 380

Ser Ala Gly Lys Pro Tyr Glu Phe Ser Ile Asp Cys Asp Lys Ile Asn 3B5 390 395 400

Leu Phe Arg Gly Val Phe Ala Phe Leu Leu Tyr Val Ala Thr Phe Met 405 410 415

Tyr Val Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn Lys Glu Ser 420 425 430

<210> 589 <211 > 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Illustrative peptide <400> 589

Glu Gly Gly Gly Ser 1 5

<210> 590 <211 > 1275 <212> DNA <213> Unknown Organism <220> <221 > CDS <222> (1) .. (1272) <220> <223> Description of Unknown Organism: M13 nucleotide sequence <400> 590 gtg aaa aaa tta tea tte gea att eet tta gtt gtt eet tte tat tet 48

Met Lys Lys Leu Leu Phe Ala Ile Pro Leu Val Val Pro Phe Tyr Ser

15 10 IS cac tec get gaa act gtt gaa agt tgt tta gea aaa ecc cat aea gaa 96

His Ser Ala Glu Thr Val Glu Ser Cys Leu Ala Lys Pro His Thr Glu 20 25 30 aat tea ttt act aac gtc tgg aaa gac gac aaa act tta gat egt tac 144

Asn Ser Phe Thr Asn Val Trp Lys Asp Asp Lys Thr Leu Asp Arg Tyr 35 40 45 get aac tat gag ggt tgt ctg tgg aat get aea ggc gtt gta gtt tgt 192

Ala Asn Tyr Glu Gly Cys Leu Trp Asn Ala Thr Gly Val Val Val Cys 50 55 60 act ggt gac gaa act cag tgt tac ggt aea tgg gtt eet att ggg eet 240

Thr Gly Asp Glu Thr Gin Cys Tyr Gly Thr Trp Val Pro Ile Gly Leu 65 70 75 80 get ate eet gaa aat gag ggt ggt ggc tet gag ggt ggc ggt tet gag 286

Ala Ile Pro Glu Asn Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu 65 90 95 ggt ggc ggt tet gag ggt ggc ggt act aaa eet eet gag tae ggt gat 336

Gly Gly Gly Ser Glu Gly Gly Gly Thr Lys Pro Pro Glu Tyr Gly Asp 100 105 110 aea eet att ecg ggc tat act tat atc aac eet etc gac ggc act tat 384

Thr Pro Ile Pro Gly Tyr Thr Tyr Ile Asn Pro Leu Asp Gly Thr Tyr 115 120 125 ccg eet ggt act gag caa aac ccc get aat eet aat eet tet ett gag 432

Pro Pro Gly Thr Glu Gin Asn Pro Ala Asn Pro Asn Pro Ser Leu Glu 130 135 140 gag tet cag eet ett aat act tte atg ttt cag aat aat agg tte ega 480

Glu Ser Gin Pro Leu Asn Thr Phe Met Phe Gin Asn Asn Arg Phe Arg 145 150 155 160 aat agg eag ggg gea tta act gtt tat aeg ggc act gtt act caa ggc 528 Asn Arg Gin Gly Ala Leu Thr Val Tyr Thr Gly Thr Val Thr Gin Gly 165 170 175 act gac ccc gtt aaa act tat tac eag tac act eet gta tea tea aaa 576

Thr Asp Pro Val Lys Thr Tyr Tyr Gin Tyr Thr Pro Val Ser Ser Lys 180 185 190 gee atg tat gac get tac tgg aac ggt aaa tte aga gac tge get tte 624

Ala Met Tyr Asp Ala Tyr Trp Asn Gly Lys Phe Arg Asp Cys Ala Phe 195 200 205 cat tet ggc ttt aat gag gat cca tte gtt tgt gaa tat caa ggc caa 672

His Ser Gly Phe Asn Glu Asp Pro Phe Val Cys Glu Tyr Gin Gly Gin 210 215 220 teg tet gac ctg eet caa eet eet gtc aat get ggc ggc ggc tet ggt 720

Ser Ser Asp Leu Pro Gin Pro Pro Val Asn Ala Gly Gly Gly Ser Gly 225 230 235 240 ggt ggt tet ggt ggc ggc tet gag ggt ggt ggc tet gag ggt ggc ggt 768

Gly Gly Ser Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly 245 250 255 tet gag ggt ggc ggc tet gag gga ggc ggt tee ggt ggt ggc tet ggt 616

Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Gly Gly Gly Ser Gly 260 * 265 270 tee ggt gat ttt gat tat gaa aag atg gea aac get aat aag ggg get 864

Ser Gly Asp Phe Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Ala 275 280 285 atg acc gaa aat gee gat gaa aac geg eta cag tet gac get aaa ggc 912

Met Thr Glu Aan Ala Asp Glu Asn Ala Leu Gin Ser Asp Ala Lys Gly 290 295 300 aaa ett gat tet gtc gc.t act gat tac ggt get get atc gat ggt tte 960

Lys Leu Asp Ser Val Ala Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe 305 310 315 320 att ggt gac gtt tee ggc ett get aat ggt aat ggt get act ggt gat 1008

Ile Gly Asp Val Ser Gly Leu Aia Asn Gly Asn Gly Ala Thr Gly Asp 325 330 335 ttt get gge tet aat tee caa atg get caa gtc ggt gac ggt gat aat 1056

Phe Ala Gly Ser Asn Ser Gin Met Ala Gin Val Gly Asp Gly Asp Asn 340 345 350 tea eet tta atg aat aat tte egt caa tat tta eet tee etc eet caa 1104

Ser Pro Leu Met Asn Asn Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin 355 360 365 teg gtt gaa tgt ege eet ttt gtc ttt age get ggt aaa cca tat gaa 1152

Ser Val Glu Cys Arg Pro Phe Val Phe Ser Ala Gly Lys Pro Tyr Glu 370 375 380 ttt tet att gat tgt gac aaa ata aac tta tte egt ggt gtc ttt geg 1200

Phe Ser Ile Asp Cys Asp Lys Ile Asn Leu Phe Arg Gly Val Phe Ala 385 390 395 400 ttt ett tta tat gtt gee acc ttt atg cat gta ttt tet aeg ttt get 1248

Phe Leu Leu Tyr Val Ala Thr Phe Met Tyr Val Phe Ser Thr Phe Ala 405 410 415 aac ata ctg egt aat aag gag tet taa 1275

Asn Ile Leu Arg Asn Lys Glu Ser 420

<210> 591 <211 > 424 <212> PRT <213> Unknown Organism <220> <223> Description of Unknown Organism: M13 protein sequence <400> 591

Met Lys Lys Leu Leu Phe Aia Ile Pro teu Val Val Pro Phe Tyr Ser 15 10 IS

His Ser Ala Glu Thr Val Glu Ser Cys Leu Ala Lys Pro His Thr Glu 20 2S 30

Asn Ser Phe Thr Asn Val Trp Lys Asp Asp Lys Thr Leu Asp Arg Tyr 35 40 45

Ala Asn Tyr Glu Gly Cys Leu Trp Asn Ala Thr Gly Val Val Val Cys 50 55 60

Thr Gly Asp Glu Thr Gin Cys Tyr Gly Thr Trp Val Pro Ile Gly Leu 65 70 75 30

Ala Ile Pro Glu Asn Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu 85 90 95

Gly Gly Gly Ser Glu Gly Gly Gly Thr Lys Pro Pro Glu Tyr Gly Asp 100 105 110

Thr Pro Ile Pro Gly Tyr Thr Tyr Ile Asn Pro Leu Asp Gly Thr Tyr 115 120 125

Pro Pro Gly Thr Glu Gin Asn Pro Ala Asn Pro Asn Pro Ser Leu Glu 130 135 140

Glu Ser Gin Pro Leu Asn Thr Phe Met Phe Gin Asn Asn Arg Phe Arg 145 150 155 160

Asn Arg Gin Gly Ala Leu Thr Val Tyr Thr Gly Thr Val Thr Gin Gly 165 170 175

Thr Asp Pro Val Lys Thr Tyr Tyr Gin Tyr Thr Pro val Ser Ser Lys 180 185 190

Ala Met Tyr Asp Ala Tyr Trp Asn Gly Lys Phe Arg Asp Cys Ala Phe 195 200 205

His Ser Gly Phe Asn Glu Asp Pro Phe Val Cys Glu Tyr Gin Gly Gin 210 215 220

Ser Ser Asp Leu Pro Gin Pro Pro Val Asn Ala Gly Gly Gly Ser Gly 225 230 235 240

Gly Gly Ser Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly 24S 250 255

Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Gly Gly Gly Ser Gly 260 265 270

Ser Gly Asp Phe Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Ala 275 280 285

Met Thr Glu Asn Ala Asp Glu Asn Ala Leu Gin Ser Asp Ala Lys Gly 290 295 300

Lys Leu Asp Ser Val Ala Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe 305 310' 315 320

Ile Gly Asp Val Ser Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp 325 330 335

Phe Ala Gly Ser Asn Ser Gin Met Ala Gin Val Gly Asp Gly Asp Asn 340 34S 350

Ser Pro Leu Met Asn Asn Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin 355 360 365

Ser Val Glu Cys Arg Pro Phe Val Phe Ser Ala Gly Lys Pro Tyr Glu 370 375 380

Phe Ser Ile Asp Cys Asp Lys ile Asn Leu Phe Arg Gly Val Phe Ala 385 390 395 400

Phe Leu Leu Tyr Val Ala Thr Phe Met Tyr Val Phe Ser Thr Phe Ala 405 410 415

Asn Ile Leu Arg Asn Lys Glu Ser 420

<210> 592 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 592 caacgatgat cgtatggcgc atgctgccga gacag 35

<210> 593 <211 > 1355 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: M13-III nucleotide sequence <220> <221 > CDS <222>(1)..(1305) <400> 593 gcg gcc gca cat cat cat cac cat cac ggg gcc gca gaa caa aaa etc 4Θ

Ala Ala Ala His His His His His His Gly Ala Ala Glu Gin Lys Leu 1 5 10 15 ate tea gaa gag gat ctg aat ggg gcc gca tag get age gat ate aac 96

Ile Ser Glu Glu Asp Leu Asn Gly Ala Ala Ala Ser Asp lie Asn 20 25 30 gat gat egt atg get tet act gey gar acw gty gaa wsy tgy ytt gem 144

Asp Asp Arg Met Ala Ser Thr Ala Glu Thr Val Glu Ser Cys Leu Ala 35 40 45 aar ccy cay acw gar aat wsw tty acw aay gts tgg aar gay gay aar 192

Lys Pro His Thr Glu Asn Ser Phe Thr Asn Val Trp Lys Asp Asp Lys 50 55 60 acy ytw gat cgw tay gey aay tay gar ggy tgy ytr tgg aat gey a cm 240

Thr Leu Asp Arg Tyr Ala Asn Tyr Glu Gly Cys Leu Trp Asn Ala Thr 65 70 75 ggc gty gtw gty tgy ack ggy gay gar acw car tgy tay ggy acr tgg 288

Gly Val Val Val Cys Thr Gly Asp Glu Thr Gin Cys Tyr Gly Thr Trp 80 85 90 95 gtk cck atw ggs ytw gey atm cck gar aay gar ggy ggy ggy wsy gar 336

Val Pro lie Gly Leu Ala lie Pro Glu Asn Glu Gly Gly Gly Ser Glu 100 105 110 ggy ggy ggy wsy gar ggy ggy ggw tcy gar ggw ggy ggw acy aar cck 384

Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Thr Lys Pro 115 120 125 cck gar tay ggy gay acw cck atw cck ggy tay acy tay aty aay cck 432

Pro Glu Tyr Gly Asp Thr Pro lie Pro Gly Tyr Thr Tyr He Asn Pro 130 135 140 ytm gay ggm acy tay cck cck ggy acy gar car aay ccy gey aay cck 480

Leu Asp Gly Thr Tyr Pro Pro Gly Thr Glu Gin Asn Pro Ala Asn Pro 145 150 . 155 aay ccw wsy ytw gar gar wsy car cck ytw aay acy tty atg tty car 528

Asn Pro Ser Leu Glu Glu Ser Gin Pro Leu Asn Thr Phe Met Phe Gin 160 165 170 175 aay aay itigk tty mgr aay mgk car ggk gew ytw acy gtk tay ack ggm 576

Asn Asn Arg Phe Arg Asn Arg Gin Gly Ala Leu Thr Val Tyr Thr Gly 180 185 190 acy gty acy car ggy acy gay ccy gty aar acy tay tay car tay acy 624

Thr Val Thr Gin Gly Thr Asp Pro Val Lys Thr Tyr Tyr Gin Tyr Thr

195 200 20S cck gun ter wsw aar gey atg tay gay gey tay egg aay ggy aar tty 672

Pro Val Ser Sez Lys Ala Met Tyr Asp Ala Tyr Trp Asn Gly Lys Phe 210 215 220 rogw gay tgy gey tty cay way ggy tty aay gar gay ccw tty gty tgy 720

Arg Asp Cys Ala Phe His Ser Gly Phe Asn Glu Asp Pro Phe Val Cys 225 230 235 gar tay car ggy car wsk wsy gay ytr cck car ccw cclc gty aay gck 768

Glu Tyr Gin Gly Gin Ser Ser Asp Leu Pro Gin Pro Pro Val Asn Ala 240 245 250 255 ggy ggy ggy wsy ggy ggw ggy wsy ggy ggy ggy wsy gar ggy ggw ggy 816

Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Glu Gly Gly Gly 260 265 270 wsy gar ggw ggy ggy wsy ggr ggy ggy wsy ggy wsy ggy gay tty gay 864

Ser Glu Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly Asp Phe Asp 275 280 285 tay gar aar atg gew aay gey aay aar ggs gey atg acy gar aay gey 912

Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Al? Met Thr Glu Asn Ala 290 295 300 gay gar aay gcr ctr car wst gay gey aar ggy aar ytw gay wsy gtc 960

Asp Glu Asn Ala Leu Gin Ser Asp Ala Lys Gly Lys Leu Asp Ser Val 305 310 315 gey acw gay tay ggt get gey ate gay ggy tty aty ggy gay gty wsy 1008

Ala Thr Asp Tyr Gly Ala Ala lie Asp Gly Phe lie Gly Asp Val Ser 320 325 330 335 ggy ctk get aay ggy aay ggw gey acy ggw gay tty gew ggy tek aat 1056

Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn 340 345 350 tcy car atg gey car gty ggw gay ggk gay aay wsw cck ytw atg aay 1104

Ser Gin Met Ala Gin Val Gly Asp Gly Asp Asn Ser Pro Leu Met Asn 355 360 365 aay tty mgw car tay ytw cck tcy cty cck car wsk gty gar tgy egy 1152

Asn Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin Ser Val Glu Cys Arg 370 375 380 ccw tty gty tty wsy gey ggy aar ccw tay gar tty wsy aty gay tgy 1200

Pro Phe Val Phe Ser Ala Gly Lys Pro Tyr Glu Phe Ser lie Asp Cys 385 390 395 gay aar atm aay ytw ttc egy ggy gty tty gck tty ytk yta tay gty 1248

Asp Lys lie Asn Leu Phe Arg Gly Val Phe Ala Phe Leu Leu Tyr Val 400 405 410 415 gey acy tty atg tay gtw tty wsy ack tty gey aay atw ytr egy aay 1296

Ala Thr Phe Met Tyr Val Phe Ser Thr Phe Ala Asn He Leu Arg Asn 420 425 430 aar gar wsy tagtgatctc etaggaagee cgcctaatga gcgggctttt 1345

Lys Glu Ser tttttctggt 1355

<210> 594 <211 > 434 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: M13-ill protein sequence <400> 594

Ala Ala Ala His His His His His His Gly Ala Ala Glu Gin Lys Leu 15 10 15

Ile Ser Glu Glu Asp Leu Asn Gly Ala Ala Ala Ser Asp lie Asn Asp 20 25 30

Asp Arg Met Ala Ser Thr Ala Glu Thr Val Glu Ser Cys Leu Ala Lys 35 40 45

Pro His Thr Glu Asn Ser Phe Thr Asn Val Trp Lys Asp Asp Lys Thr 50 55 60

Leu Asp Arg Tyr Ala Asn Tyr Glu Gly Cys Leu Trp Asn Ala Thr Gly 65 70 75 80

Val Val Val Cys Thr Gly Asp Glu Thr Gin Cys Tyr Gly Thr Trp Val 85 90 95

Pro lie Gly Leu Ala He Pro Glu Asn Glu Gly Gly Gly Ser Glu Gly 100 105 110

Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Thr Lys Pro Pro 115 120 125

Glu Tyr Gly Asp Thr Pro lie Pro Gly Tyr Thr Tyr lie Asn Pro Leu 130 135 140

Asp Gly Thr Tyr Pro Pro Gly Thr Glu Gin Asn Pro Ala Asn Pro Asn 145 150 155 160

Pro Ser Leu Glu Glu Ser Gin Pro Leu Asn Thr Phe Met Phe Gin Asn 165 170 175

Asn Arg Phe Arg Asn Arg Gin Gly Ala Leu Thr Val Tyr Thr Gly Thr 1B0 185 190

Val Thr Gin Gly Thr Asp Pro Val Lys Thr Tyr Tyr Gin Tyr Thr Pro 195 200 205

Val Ser Ser Lys Ala Met Tyr Asp Ala Tyr Trp Asn Gly Lys Phe Arg 210 215 220

Asp Cys Ala Phe His Ser Gly Phe Asn Glu Asp Pro Phe Val Cys Glu 225 230 235 240

Tyr Gin Gly Gin Ser Ser Asp Leu Pro Gin Pro Pro Val Asn Ala Gly 245 250 255

Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Glu Gly Gly Gly Ser 260 265 270

Glu Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly Asp Phe Asp Tyr 275 280 285

Glu Lys Met Ala Asn Ala Asn Lys Gly Ala Met Thr Glu Asn Ala Asp 290 295 300

Glu Asn Ala Leu Gin Ser Asp Ala Lys Gly Lys Leu Asp Ser Val Ala 305 310 315 320

Thr Asp Tyr Gly Ala Ala lie Asp Gly Phe He Gly Asp Val Ser Gly 325 330 335

Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn Ser 340 345 350

Gin Met Ala Gin Val Gly Asp Gly Asp Asn Ser Pro Leu Met Asn Asn 355 360 365

Phe Arg Gin Tyr Leu Pro Ser Leu Pro Gin Ser Val Glu Cys Arg Pro 370 375 380

Phe Val Phe Ser Ala Gly Lys Pro Tyr Glu Phe Ser lie Asp Cys Asp 385 390 395 400

Lys lie Asn Leu Phe Arg Gly Val Phe Ala Phe Leu Leu Tyr Val Ala 405 410 415

Thr Phe Met Tyr Val Phe Ser Thr Phe Ala Asn lie Leu Arg Asn Lys 420 425 430

Glu Ser

<210> 595 <211 > 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 595 cgttgatatc gctagcctat gc 22

<210> 596 <211 > 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 596 gataggctta gctagcccgg agaacgaagg 30

<210> 597 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 597 ctttcacagc ggtttcgcta gcgacccttt tgtctgc 37

<210> 598 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 598 ctttcacagc ggtttcgcta gcgacccttt tgtcagcgag taccagggtc 50

<210> 599 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 599 gactgtctcg gcagcatgcg ccatacgatc atcgttg 37

<210> 600 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > CDS <222> (2)..(25) <400> 600 c aac gat gat cgt atg gcg cat get gccgagacag tc 37

Asn Asp Asp Arg Met Ala His Ala 1 5

<210> 601 <211 > 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 601

Asn Asp Asp Arg Met Ala Kis Ala 1 5

<210> 602 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 602 ctttcacagc ggtttgcatg cagacccttt tgtctgc 37

<210> 603 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 603 ctttcacagc ggtttgcatg cagacccttt tgtcagcgag taccagggtc 50

<210> 604 <211 > 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Illustrative peptide <400> 604

Tyr Ala Asp Ser Val Lys Gly 1 5

<210> 605 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 605 cctcgacagc gaagtgcaca g 21

<210> 606 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 606 ggctgagtca agacgctctg tgcacttcgc tgtcgagg 38

<210> 607 <211 > 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Illustrative peptide <400> 607

Gin Ser Ala Leu Thr Gin Pro 1 5

<210> 608 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 608 cctctgtcac agtgcacaag ac 22

<210> 609 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 609 cctctgtcac agtgcacaag acatccagat gacccagtct cc 42

<210> 610 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 610 gggaggatgg agactgggtc gtctggatgt cttgtgcact gtgacagagg 50

<210>611 <211 > 11 <212> PRT <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Illustrative peptide <400 611

Gin Asp Ile Gin Met Thr Gin Ser Pro Ser Ser 1 5 10

<210 612 <211> 20 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Primer <400 612 gactgggtgt agtgatctag 20 <210 613 <211> 28

<212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 613 ggtgtagtga tcttctagtg acaactct 28

<210> 614 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 614

Val Ser Ser Arg Asp Asn 1 S

<210> 615 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > CDS <222> (1)..(15) <400> 615 tac tat tgt gcg aaa 15

Tyr Tyr Cys Ala Lys 1 5

<210> 616 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 616

Tyr Tyr Cys Ala Lys 1 5

<210 617 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 617 ggtgccgata ggcttgcatg caccggagaa cgaagg 36

<210> 618 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 618 cgcttcacta agtctagaga caactctaag aatactccct acctgcagat gaacagctca 60 agggetgagg acactgcagt ctaccattgt acgag 95

<210> 619 <211 > 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220 <221 > modified_base <222> (4) .. (7) <223> A, T, C, G, other or unknown <400 619 gatnnnnatc 10

<210 620 <211> 10 <212> PRT <213> Unknown Organism <220 <223> Description of Unknown Organism: MALIA3-derived peptide <400 620

Met Lys Leu Leu Asn Val Ile Asn Phe Val 1 5 10

<210 621 <211> 29 <212> PRT <213> Artificial Sequence <220 <223> Description of Artificial Sequence: CJRA05-derived peptide <400 621

Met Ser Val Leu Val Tyr Ser Phe Ala Ser Phe Val Leu Gly Trp Cys 15 10 15

Leu Arg Ser Gly Ile Thr Tyr Phe Thr Arg Leu Met Glu 20 25

<210 622 <211> 15 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Illustrative nucleotide sequence <400 622 tttttttttt ttttt 15

<210 623 <211> 87 <212> PRT <213> Unknown Organism <220 <223> Description of Unknown Organism: MALIA3-derived peptide <400> 623

Met Ile Lys Val Glu Ile Lys Pro Ser Gin Ala Gin Phe Thr Thr Arg 15 10 15

Ser Gly Val Ser Arg Gin Gly Lys Pro Tyr Ser Leu Asn Glu Gin Leu 20 25 30

Cys Tyr Val Asp Leu Gly Asn Glu Tyr Pro Val Leu Val Lys Ile Thr 35 40 45

Leu Asp Glu Gly Gin Pro Ala Tyr Ala Pro Gly Leu Tyr Thr Val His 50 55 60

Leu Ser Ser Phe Lys Val Gly Gin Phe Gly Ser Leu Met Ile Asp Arg 65 70 75 80

Leu Arg Leu Val Pro Ala Lys 85

<210> 624 <211> 29 <212> PRT <213> Unknown Organism <220> <223> Description of Unknown Organism: MALIA3-derived peptide <400> 624

Met Ser Val Leu Val Tyr Ser Phe Ala Ser Phe Val Leu Gly Trp Cys 15 10 15

Leu Arg Ser Gly Ile Thr Tyr Phe Thr Arg Leu Met Glu 20 25

<210> 625 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221 > modified_base <222> (7)..(10) <223> A, T, C, G, other or unknown <400> 625 ctcttcnnnn 10

<210> 626 <211> 87 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: CJRA05-derived peptide <400> 626

Met Ile Lys Val Glu Ile Lys Pro Ser Gin Ala Gin Phe Thr Thr Arg 15 10 15

Ser Gly Val Ser Arg Gin Gly Lys Pro Tyr Ser Leu Asn Glu Gin Leu 20 25 30

Cys Tyr Val Asp Leu Gly Asn Glu Tyr Pro Val Leu Val Lys Ile Thr 35 40 45

Leu Asp Glu Gly Gin Pro Ala Tyr Ala Pro Gly Leu Tyr Thr Val His 50 55 60

Leu Ser Ser Phe Lys Val Gly Gin Phe Gly Ser Leu Met Ile Asp Arg 65 70 75 80

Leu Arg Leu Val Pro Ala Lys 85 <210> 627

<211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: CJRA05-derived peptide <400> 627

Met Lys Leu Leu Asn Val Ile Asn Phe Val 1 S 10

<210> 628 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 628 gacccagtct ccatcctcc 19

<210> 629 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 629 gactcagtct ccactctcc 19

<210> 630 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 630 gacgcagtct ccaggcacc 19

<210> 631 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 631 gacgcagtct ccagccacc 19

<210> 632 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 632 gtctcctgga cagtcgatc 19

<210> 633 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 633 ggccttggga cagacagtc 19

<210 634 <211> 19 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400 634 gtctcctgga cagtcagtc 19

<210 635 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 635 ggccccaggg cagagggtc 19

REFERENCES CITED IN THE DESCRIPTION

This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.

Patent documents cited in the description • US60198089B [0001] • US08837306B [00011 • US0112454W [00011 • US10000516B [0001] • US10045674B Γ0001Ί • EP3S86S4B1 [0011] • US5669644A Γ0024]

Non-patent literature cited in the description . HJ DE HAARD et al.Journal of Biological Chemistry, 1999, vol. 274, 2618218-30 [0028] • FROHMAN, M.ADUSH, M.K.MARTIN, G.R.Proc. Natl. Acad. Sci. USA, 1988, vol. 85, 8998-9002 [0037] . WANGWILKINSONBiotechniques, 2001, vol. 31.4722-724 [01631 • HAARD et al.Journal of Biological Chemistry, 1999, vol. 274, 2618218-30 £0164] . HAARDMARKSJournal of Molecular Biology, 1991. vol. 222. 3581-97 [01691

Claims (13)

A method of producing a population or library of immunoglobulin genes comprising the steps of: (i) introducing synthetic diversity into at least one of VH CDR1 or VH CDR2 of these genes; and (ii) combining the diversity of step (i) with the VH CDR3 natural diversity captured from the VH CDR3 region of B-cell immunoglobulin genes. The method of claim 1, wherein synthetic diversity is introduced into both VH CDR1 and VH CDR2. The method of claim 2, wherein the synthetic diversity is provided in a human 3-23 skeleton and wherein the synthetic diversity comprises: (a) a VH CDR1 having an amino acid sequence of formula -X1-Y-X2-M-X3-, wherein X1, X2 and X3 are independently selected from the group consisting of A, D, E, F, G, Η, I, K, L, Μ, N, P, Q, R, S, T, V, W and Y; and (b) a VH CDR2, having an amino acid sequence of formula X4-I-X5-X6-SGG-X7-T-X8-YA-DS-VKG- wherein X4 and X5 are independently selected from the group consisting of Y, R , W, V, G and S, X6 are selected from the group consisting of P and S, and X7 and X8 are independently selected from the group consisting of A, D, E, F, G, Η, I, K, L, Μ , N, P, Q, R, S, T, V, W and Y. A library comprising a collection of genetic packages showing a member of a diverse family of antibodies and collectively displaying at least a portion of the family, the antibodies encoded by a DNA sequence comprising sequences each encoding (a ) a VH CDR1 having an amino acid sequence of formula -X1-Y-X2-M-X3- wherein X1, X2 and X3 are independently selected from the group consisting of A, D, E, F, G, Η, I, K, L, Μ, N, P, Q, R, S, T, V, W and Y, provided in a human 3-23 skeleton; (b) a VH CDR2 having an amino acid sequence of formula X4-I-X5-X6-SGG-X7-T-X8-YA-DS-VKG- wherein X4 and X5 are independently selected from the group consisting of Y, R, W , V, G and S, X6 are selected from the group consisting of P and S, and X7 and X8 are independently selected from the group consisting of A, D, E, F, G, Η, I, K, L, Μ, N , P, Q, R, S, T, V, W and Y, provided in a human 3-23 skeleton, and (c) a sequence encoding a VH CDR3, wherein VH CDR3 is a natural VH CDR3 captured from The VH CDR3 region of an immunoglobulin gene from a B cell; wherein the DNA sequences have synthetic diversity in said CDR1 and CDR2. The library of claim 4, wherein the DNA sequences further comprise a sequence encoding a light chain immunoglobulin. The library of claim 5, wherein the sequence encoding a light chain immunoglobulin is captured from a B cell. The library of claim 6, wherein the B cell is isolated from a blood sample from an autoimmune patient. The library of claim 7, wherein the autoimmune patient is diagnosed with a disorder selected from the group consisting of systemic lupus erythematosus, systemic sclerosis, rheumatoid arthritis, antiphospholipid syndrome, and vasculitis. A library according to any one of claims 4 or 5 to 8, wherein the genetic packages are M13 phages. The library of claim 9, wherein the DNA sequences are in a phage vector. The library of claim 9 or 10, wherein the phage comprises a wild-type gene iii and a truncated gene iii for displaying peptides, polypeptides or proteins. The library of any one of claims 4 or 5 to 8, wherein the DNA sequences are in a phagemid vector. The library of any one of claims 9 to 12, wherein the antibodies shown are displayed via a short linker to the final portion of the M13 gene III.