PT1560827E - Anti-infective agents - Google Patents

Anti-infective agents Download PDF

Info

Publication number
PT1560827E
PT1560827E PT03768559T PT03768559T PT1560827E PT 1560827 E PT1560827 E PT 1560827E PT 03768559 T PT03768559 T PT 03768559T PT 03768559 T PT03768559 T PT 03768559T PT 1560827 E PT1560827 E PT 1560827E
Authority
PT
Portugal
Prior art keywords
alkyl
group
heteroaryl
heterocycle
alkenyl
Prior art date
Application number
PT03768559T
Other languages
Portuguese (pt)
Inventor
Dale J Kempf
John K Pratt
David A Betebenner
Pamela L Donner
Brian E Green
Keith F Mcdaniel
Clarence J Maring
Vincent S Stoll
Rong Zhang
Original Assignee
Abbott Lab
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US10/285,714 external-priority patent/US20040097492A1/en
Priority claimed from US10/625,121 external-priority patent/US20040162285A1/en
Priority claimed from US10/679,881 external-priority patent/US20050075331A1/en
Application filed by Abbott Lab filed Critical Abbott Lab
Publication of PT1560827E publication Critical patent/PT1560827E/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/62—Oxygen or sulfur atoms
    • C07D213/69—Two or more oxygen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/20—Oxygen atoms
    • C07D215/22—Oxygen atoms attached in position 2 or 4
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D513/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00
    • C07D513/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00 in which the condensed system contains two hetero rings
    • C07D513/04—Ortho-condensed systems

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Nitrogen And Oxygen Or Sulfur-Condensed Heterocyclic Ring Systems (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Quinoline Compounds (AREA)
  • Saccharide Compounds (AREA)
  • Pyridine Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Hydrogenated Pyridines (AREA)
  • Heterocyclic Carbon Compounds Containing A Hetero Ring Having Oxygen Or Sulfur (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

<P>PROBLEM TO BE SOLVED: To provide an HCV (hepatitis C virus) polymerase inhibiting compound and a composition including a therapeutically effective amount of the compound. <P>SOLUTION: This invention relates to the compound having formula (I). This invention also relates to methods for inhibiting HCV polymerase, inhibiting HCV viral replication, and treating or preventing HCV infection. Processes for making the compounds and the synthetic intermediates employed in the processes, are also provided. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

ΕΡ 1 560 827/ΡΤ DESCRIÇÃO &quot;Agentes anti-infecciosos&quot;ΕΡ 1 560 827 / ΡΤ DESCRIPTION &quot; Anti-infective agents &quot;

Campo técnico O presente invento proporciona novos agentes anti-infecciosos. Especificamente, o presente invento proporciona compostos inibidores de VHC-polimerase e uma composição que compreende uma quantidade terapeuticamente eficaz de um ou mais dos referidos compostos. O presente invento proporciona também a utilização dos referidos compostos para o fabrico de um medicamento para inibir a replicação de um vírus contendo ARN, tal como o vírus da hepatite C (VHC) e a utilização dos referidos compostos e referida composição para o fabrico de um medicamento para tratar ou prevenir infecção causada por um vírus contendo ARN, tal como VHC. São também proporcionados intermediários sintéticos empregues em processos para produzir os referidos compostos.TECHNICAL FIELD The present invention provides novel antiinfective agents. Specifically, the present invention provides HCV polymerase inhibitor compounds and a composition comprising a therapeutically effective amount of one or more of said compounds. The present invention also provides the use of said compounds for the manufacture of a medicament for inhibiting the replication of an RNA-containing virus such as hepatitis C virus (HCV) and the use of said compounds and said composition for the manufacture of a medicament for treating or preventing infection caused by a virus containing RNA, such as HCV. Also provided are synthetic intermediates employed in processes for producing said compounds.

Antecedentes do invento A infecção pelo vírus da hepatite C (VHC) é uma causa principal de doença hepática humana em todo o mundo. Mais de 85% de todos os indivíduos infectados tornam-se infectados cronicamente. A infecção crónica por VHC é responsável por 30% de todas as cirroses, doenças terminais do fígado e cancro do fígado nos Estados Unidos. A CDC estima que o número de mortes devidas ao VHC irá aumentar para 38000/ano no ano 2010.BACKGROUND OF THE INVENTION Hepatitis C virus (HCV) infection is a major cause of human liver disease throughout the world. More than 85% of all infected individuals become chronically infected. Chronic HCV infection accounts for 30% of all cirrhosis, terminal liver disease, and liver cancer in the United States. The CDC estimates that the number of deaths due to HCV will increase to 38,000 / year by 2010.

Embora inicialmente a terapia consistisse em interferão isolado, a combinação de interferão alfa-2b com ribavirina durante 24 ou 48 semanas é actualmente a terapia aprovada mais eficaz para o tratamento de infecção crónica por VHC. Contudo, existem muitos efeitos secundários adversos associados a esta terapia (sintomas do tipo gripe, leucopenia, trombocitopenia e depressão derivada do interferão, assim como anemia induzida pela ribavirina). Além disso, esta terapia é menos eficaz contra infecções causadas pelo genotipo 1 do VHC, que constitui cerca de 75% de todas as infecções por VHC. 2 ΕΡ 1 560 827/ΡΤAlthough initially the therapy consisted of isolated interferon, the combination of interferon alfa-2b with ribavirin for 24 or 48 weeks is currently the most effective approved therapy for the treatment of chronic HCV infection. However, there are many adverse side effects associated with this therapy (flu-like, leukopenia, thrombocytopenia, and interferon-derived depression as well as ribavirin-induced anemia). In addition, this therapy is less effective against infections caused by HCV genotype 1, which constitutes about 75% of all HCV infections. 2 ΕΡ 1 560 827 / ΡΤ

Com base no anteriormente exposto, existe uma necessidade significativa de identificar compostos com a capacidade para inibir o VHC. O presente invento proporciona novos agentes anti-infecciosos que são inibidores da VHC-polimerase.Based on the foregoing, there is a significant need to identify compounds with the ability to inhibit HCV. The present invention provides novel antiinfective agents which are inhibitors of HCV-polymerase.

Sumário do invento O presente invento proporciona um composto de fórmula (Vb) ou uma sua forma de sal, estereoisómero ou tautómero farmaceuticamente aceitável tal como definido na reivindicação 1 anexa. O presente invento também proporciona um composto de fórmula (Via) ou uma sua forma de sal, estereoisómero ou tautómero farmaceuticamente aceitável tal como definido na reivindicação 4 anexa. O presente invento proporciona ainda um composto de fórmula (VIb) ou uma sua forma de sal, estereoisómero ou tautómero farmaceuticamente aceitável tal como definido na reivindicação 7 anexa. O presente invento também proporciona intermediários empregues nos processos de fabrico dos compostos do presente invento. O presente invento proporciona adicionalmente uma composição farmacêutica que compreende uma quantidade terapeuticamente eficaz de um ou mais compostos do presente invento ou suas formas de sal, estereoisómeros ou tautómeros farmaceuticamente aceitáveis e um portador farmaceuticamente aceitável. O presente invento também proporciona a utilização de uma composição farmacêutica do presente invento para o fabrico de um medicamento para tratar ou prevenir infecção causada por um virus contendo ARN através da administração a um paciente com necessidade de tal tratamento. O presente invento ainda proporciona a utilização de um ou mais compostos, sais, estereoisómeros ou tautómeros do presente invento para o fabrico de um medicamento para inibir 3 ΕΡ 1 560 827/ΡΤ a replicação de um vírus contendo ARN através do contacto do vírus com uma quantidade terapeuticamente eficaz do composto ou combinação. O presente invento proporciona ainda a utilização de um ou mais compostos, sais, estereoisómeros ou tautómeros do presente invento para o fabrico de um medicamento para tratar ou prevenir infecção causada por um vírus contendo ARN, através da administração a um paciente com necessidade de um tal tratamento de uma quantidade terapeuticamente eficaz do composto ou combinação.SUMMARY OF THE INVENTION The present invention provides a compound of formula (Vb) or a pharmaceutically acceptable salt, stereoisomer or tautomer form thereof as defined in appended claim 1. The present invention also provides a compound of formula (Way) or a pharmaceutically acceptable salt, stereoisomer or tautomer form thereof as defined in claim 4. The present invention further provides a compound of formula (VIb) or a pharmaceutically acceptable salt, stereoisomer or tautomer form thereof as defined in claim 7. The present invention also provides intermediates employed in the manufacturing processes of the compounds of the present invention. The present invention further provides a pharmaceutical composition comprising a therapeutically effective amount of one or more compounds of the present invention or pharmaceutically acceptable salt forms, stereoisomers or tautomers thereof and a pharmaceutically acceptable carrier. The present invention also provides the use of a pharmaceutical composition of the present invention for the manufacture of a medicament for treating or preventing infection caused by an RNA-containing virus by administration to a patient in need of such treatment. The present invention further provides the use of one or more compounds, salts, stereoisomers or tautomers of the present invention for the manufacture of a medicament for inhibiting the replication of an RNA-containing virus by contacting the virus with a therapeutically effective amount of the compound or combination. The present invention further provides the use of one or more compounds, salts, stereoisomers or tautomers of the present invention for the manufacture of a medicament for treating or preventing infection caused by an RNA-containing virus by administration to a patient in need thereof. treatment of a therapeutically effective amount of the compound or combination.

Descrição detalhada do inventoDetailed Description of the Invention

Tal como utilizado no presente fascículo, os sequintes termos possuem os significados indicados:As used in the present specification, the following terms have the indicated meanings:

Tal como aqui utilizado, as formas singulares &quot;um&quot;, &quot;uma&quot; e &quot;o&quot; podem incluir referências plurais, excepto se o contexto indicar claramente o contrário. O termo &quot;alquilo&quot;, tal como aqui utilizado, refere-se a um grupo derivado de um hidrocarboneto saturado de cadeia linear ou ramificada contendo 1, 2, 3, 4, 5, 6, 7, 8, 9 ou 10 átomos de carbono. Exemplos de grupos alquilo incluem butilo, metilo, 2-metilbutilo e similares. O termo &quot;alcenilo&quot;, tal como aqui utilizado, refere-se a um grupo de cadeia linear ou ramificada de 2, 3, 4, 5, 6, 7, 8, 9 ou 10 átomos de carbono contendo pelo menos uma dupla ligação carbono-carbono. Exemplos de grupos alcenilo incluem alilo, propenilo, 3-metil-2-butenilo e similares. O termo &quot;alcinilo&quot;, tal como aqui utilizado, refere-se a um hidrocarboneto de cadeia linear ou ramificada de 2, 3, 4, 5, 6, 7, 8, 9 ou 10 átomos de carbono contendo pelo menos uma tripla ligação carbono-carbono. Exemplos de grupos alcinilo incluem etinilo, 2-metil-3-butinilo, 3-pentinilo e similares. O termo &quot;alcoxi&quot;, tal como aqui utilizado, refere-se a um grupo alquilo ligado porção molecular de origem através de um 4 ΕΡ 1 560 827/ΡΤ átomo de oxigénio. Exemplos de grupos alcoxi incluem tert-butoxi, metoxi, isopropoxi e similares. O termo &quot;alcoxialcoxi&quot;, tal como aqui utilizado, significa um grupo alcoxi, como aqui definido, ligado à porção molecular de origem através de outro grupo alcoxi, como aqui definido. Exemplos representativos de alcoxialcoxi incluem, mas não estão limitados a, tert-butoximetoxi, 2-etoxietoxi, 2-metoxietoxi e metoximetoxi. O termo &quot;alcoxialcoxialquilo&quot;, tal como aqui utilizado, significa um grupo alcoxialcoxi, como aqui definido, ligado à porção molecular de origem através de um grupo alquilo, como aqui definido. Exemplos representativos de alcoxialcoxialquilo incluem, mas não estão limitados a, tert-butoximetoximetilo, etoximetoximetilo, (2-metoxietoxi)metilo e 2-(2-metoxietoxi)-etilo. O termo &quot;alcoxialquilo&quot;, tal como aqui utilizado, refere-se a um grupo alquilo substituído por pelo menos um grupo alcoxi. O termo &quot;alcoxicarbonilo&quot;, tal como aqui utilizado, refere-se a um grupo alcoxi ligado à porção molecular de origem através de um grupo carbonilo. Exemplos de grupos alcoxicarbonilo incluem tert-butoxicarbonilo, etoxicarbonilo, metoxicarbonilo e similares. O termo &quot;alcoxicarbonilalquilo&quot;, tal como aqui utilizado, refere-se a um grupo alcoxicarbonilo ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;alquilcarbonilo&quot;, tal como aqui utilizado, refere-se a um grupo alquilo ligado à porção molecular de origem através de um grupo carbonilo. Exemplos de grupos alquilcarbonilo incluem acrilo, butanoílo, 2,2-dimetil-propanoílo e similares. O termo &quot;alquilcarbonilalquilo&quot;, tal como aqui utilizado, significa um grupos alquilcarbonilo, como aqui definido, ligado à porção molecular de origem através de um grupo alquilo, como aqui definido. Exemplos representativos de 5 ΕΡ 1 560 827/ΡΤ alquilcarbonilalquilo incluem, mas não estão limitados a, 2- oxopropilo, 3,3-dimetil-2-oxopropilo, 3-oxobutilo e 3- oxopentilo. O termo &quot;alquilsulfanilo&quot;, tal como aqui utilizado, refere-se a um grupo alquilo ligado à porção molecular de origem através de um átomo de enxofre. Exemplos de grupos alquilsulfanilo incluem metilsulfanilo, (1-metiletil)-sulfanilo, (2-metilpropil)sulfanilo e similares. O termo &quot;alquilsulfanilalquilo&quot;, tal como aqui utilizado, refere-se a um grupo alquilsulfanilo ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;alquilsulfinilo&quot;, tal como aqui utilizado, refere-se a um grupo alquilo ligado à porção molecular de origem através de um grupo -S(O)-. O termo &quot;alquilsulfinilalquilo&quot;, tal como aqui utilizado, refere-se a um grupo alquilsulfinilo ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;alquilsulfonilo&quot;, tal como aqui utilizado, refere-se a um grupo alquilo ligado à porção molecular de origem através de um grupo -S(0)2-. O termo &quot;alquilsulfonilalquilo&quot;, tal como aqui utilizado, refere-se a um grupo alquilsulfonilo ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;arilo&quot;, tal como aqui utilizado, refere-se a um grupo fenilo ou um sistema anelar de hidrocarboneto fundido biciclico ou triciclico, em que um ou mais dos anéis é um grupo fenilo. Sistemas anelares fundidos biciclicos possuem um grupo fenilo fundido a um grupo cicloalcenilo monociclico, como aqui definido, um grupo cicloalquilo monociclico, como aqui definido ou outro grupo fenilo. Os sistemas anelares fundidos triciclicos são exemplificados por um sistema anelar fundido biciclico fundido a um grupo cicloalcenilo monociclico, como aqui definido, um grupo cicloalquilo monociclico, como aqui definido ou outro grupo fenilo. Exemplos de grupos arilo incluem antracenilo, azulenilo, fluorenilo, indanilo, 6 ΕΡ 1 560 827/ΡΤ indenilo, naftilo, fenilo, tetra-hidronaftilo e similares. Os grupos arilo do presente invento podem ser ligados à porção molecular de origem através de gualguer átomo de carbono substituível do grupo. Os grupos arilo do presente invento podem ser substituídos com 0, 1, 2, 3, 4 ou 5 substituintes independentemente seleccionados do grupo gue consiste em alguilo, alcenilo, alcinilo, ciano, formilo, halo, nitro, oxo, -ORa, -OC (O) Ra, -OC (O) ORa, -0C(0)NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -SORa, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N (Re) C (O) Ra, -N(Re)C(0)0Ra, -N(Re)C(0)NRaRb, -N(Re)S02Ra, -N (Re) S02NRaRb, -N(Re)S02N(Re)C(0)0Ra, -C(0)Ra, -C(0)0Ra, -C (O)NRaRb, cicloalquilo, cicloalcenilo, heterociclo, um segundo grupo arilo e heteroarilo; em que cada um dos alquilo, alcenilo e alcinilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em ciano, formilo, halo, nitro, oxo, -ORa, -0C(0)Ra, -OC (O) ORa, -OC (O) NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -SORa, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N (Re) C (O) Ra, -N (Rc) C (O) ORa, -N (Re) C (O) NRaRb, -N(Re)S02Ra, -N (Re) S02NRaRb, -N (Re) S02N (Re) C (O) ORa, -C(0)Ra, -C(0)0Ra, -C (O) NRaRb, cicloalquilo, cicloalcenilo, heterociclo, um segundo grupo arilo e heteroarilo; em que Ra, Rb e Re são aqui definidos e em que o segundo grupo arilo, o heteroarilo, o cicloalquilo, o cicloalcenilo e o heterociclo podem ser substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em -OH, -O(alquilo), alquilo, alcenilo, alcinilo, ciano, formilo, halo, haloalcoxi, haloalquilo, nitro, -NH2, -N(H)(alquilo), -N(alquilo)2, -C(0)0H, -C(O)O(alquilo), -C(0)NH2, -C(O)N(H)(alquilo), -C(0)N(alquilo)2 e oxo. 0 termo &quot;arilalcenilo&quot;, tal como aqui utilizado, refere-se a um grupo arilo ligado à porção molecular de origem através de um grupo alcenilo. O termo &quot;arilalcoxi&quot;, tal como aqui utilizado, refere-se a um grupo arilalquilo ligado à porção molecular de origem através de um átomo de oxigénio. O termo &quot;arilalquilo&quot;, tal como aqui utilizado, refere-se a um grupo arilo ligado à porção molecular de origem através de um grupo alquilo. 7 ΕΡ 1 560 827/ΡΤ Ο termo &quot;arilcarbonilo&quot;, tal como aqui utilizado, refere-se a um grupo arilo ligado à porção molecular de origem através de um grupo carbonilo. O termo &quot;arilcarbonilalquilo&quot;, tal como aqui utilizado, significa um grupo arilcarbonilo, como aqui definido, ligado à porção molecular de origem através de um grupo alquilo, como aqui definido. O termo &quot;ariloxi,&quot; tal como aqui utilizado, refere-se a um grupo arilo ligado à porção molecular de origem através de um átomo de oxigénio. O termo &quot;ariloxialquilo&quot;, tal como aqui utilizado, refere-se a um grupo ariloxi ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;arilsulfanilo&quot;, tal como aqui utilizado, refere-se a um grupo arilo ligado à porção molecular de origem através de um átomo de enxofre. O termo &quot;arilsulfanilalquilo&quot;, tal como aqui utilizado, refere-se a um grupo arilsulfanilo ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;arilsulfonilo&quot;, tal como aqui utilizado, refere-se a um grupo arilo ligado à porção molecular de origem através de um grupo sulfonilo. O termo &quot;arilsulfonilalquilo&quot;, tal como aqui utilizado, refere-se a um grupo arilsulfonilo ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;carboxi&quot;, tal como aqui utilizado, refere-se a -C02H. O termo &quot;carboxialquilo&quot;, tal como aqui utilizado, refere-se a um grupo carboxi ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;ciano&quot;, tal como aqui utilizado, refere-se a -CN. 8 ΕΡ 1 560 827/ΡΤ Ο termo &quot;cianoalquilo&quot;, tal como aqui utilizado, refere-se a um grupo ciano ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;cicloalcenilo&quot;, tal como aqui utilizado, refere-se a um sistema anelar biciclico ou triciclico, não aromático, parcialmente insaturado, possuindo três a catorze átomos de carbono e zero heteroátomos. Exemplos de grupos cicloalcenilo incluem ciclo-hexenilo, octa-hidronaftalenilo, norbornilenilo e similares. Os grupos cicloalcenilo do presente invento podem ser substituídos com 0, 1, 2, 3, 4 ou 5 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, formilo, halo, nitro, oxo, -ORa, -0C(0)Ra, -0C(0)0Ra, -0C(0)NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -SORa, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N (Re) C (O) Ra, -N (Re) C (O) ORa, -N (Re) C (O) NRaRb, -N(Re)S02Ra, -N (Re) S02NRaRb, -N (Re) S02N (Re) C (O) ORa, -C(0)Ra, -C(0)0Ra, -C (O) NRaRb, cicloalquilo, um segundo cicloalcenilo, heterociclo, arilo, heteroarilo e etilenodioxi; em que cada um dos alquilo, alcenilo e alcinilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em ciano, formilo, halo, nitro, oxo, -ORa, -0C(0)Ra, -0C(0)0Ra, -OC (O) NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -SORa, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N (Re) C (O) Ra, -N (Re) C (O) ORa, -N (Re) C (O) NRaRb, -N(Re)S02Ra, -N(Re)S02NRaRb, -N (Re) S02N (Re) C (O) ORa, -C(0)Ra, -C(0)0Ra, -C(0)NRaRb, cicloalquilo, um segundo cicloalcenilo, heterociclo, arilo e heteroarilo; em que Ra, Rb e Re são aqui definidos e em que o cicloalquilo, o segundo cicloalcenilo, o heterociclo, o arilo e o heteroarilo podem ser substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em -OH, -O(alquilo), alquilo, alcenilo, alcinilo, ciano, formilo, halo, oxo, haloalcoxi, haloalquilo, nitro, oxo, -NH2, -N(H)(alquilo), -N(alquilo)2, -C(0)0H, -C(0)0(alquilo), -C(0)NH2, -C(0)N(H)(alquilo) e -C(0)N(alquilo)2. 0 termo &quot;cicloalcenilalquilo&quot;, tal como aqui utilizado, refere-se a um grupo cicloalcenilo ligado à porção molecular de origem através de um grupo alquilo. 0 termo &quot;cicloalquilo&quot;, tal como aqui utilizado, refere-se a um sistema anelar de hidrocarboneto saturado monocíclico, 9 ΕΡ 1 560 827/ΡΤ bicíclico ou tricíclico possuindo três a catorze átomos de carbono e zero heteroátomos. Exemplos de grupos cicloalquilo incluem ciclopropilo, ciclobutilo, ciclopentilo, ciclo-hexilo, ciclo-heptilo, biciclo[3.1.1]heptilo, 6,6-dimetil- biciclo[3.1.1]heptilo, adamantilo e similares. Os grupos cicloalquilo do presente invento podem ser substituídos com 0, 1, 2, 3, 4 ou 5 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, formilo, halo, nitro, oxo, -ORa, -0C(0)Ra, -0C(0)0Ra, -0C(0)NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -SORa, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N (Re) C (O) Ra, -N (Re) C (O) ORa, -N (Re) C (O) NRaRb, -N(Re)S02Ra, -N(Re)S02NRaRb, -N (Re) S02N (Re) C (O) ORa, -C(0)Ra, -C(0)0Ra, -C(0)NRaRb, um segundo cicloalquilo, cicloalcenilo, heterociclo, arilo, heteroarilo e etilenodioxi; em que cada um dos alquilo, alcenilo e alcinilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em ciano, formilo, halo, nitro, oxo, -0Ra, -0C(0)Ra, -0C(0)0Ra, -0C(0)NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -S0Ra, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N(Re)C(0)Ra, -N(Re)C(0)0Ra, -N (Re) C (0)NRaRb, -N(Re)S02Ra, -N(Re)S02NRaRb, -N(Re)S02N(Re)C(0)0Ra, -C(0)Ra, -C(0)0Ra, -C(0)NRaRb, um segundo cicloalquilo, cicloalcenilo, heterociclo, arilo e heteroarilo; em que Ra, Rb e Re são aqui definidos e em que o segundo cicloalquilo, o cicloalcenilo, o heterociclo, o arilo e o heteroarilo podem ser substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em -OH, -O(alquilo), alquilo, alcenilo, alcinilo, ciano, formilo, halo, haloalcoxi, haloalquilo, nitro, oxo, -NH2, -N(H)(alquilo), -N(alquilo)2, -C(0)0H, -C(0)0(alquilo), -C(0)NH2, -C(O)N(H)(alquilo) e -C(0)N(alquilo)2. 0 termo &quot;cicloalquilalcenilo&quot;, tal como aqui utilizado, refere-se a um grupo cicloalquilo ligado à porção molecular de origem através de um grupo alcenilo. 0 termo &quot;cicloalquilalquilo&quot;, tal como aqui utilizado, refere-se a um grupo cicloalquilo ligado à porção molecular de origem através de um grupo alquilo. 0 termo &quot;formilo&quot;, tal como aqui utilizado, refere-se a -CHO. 10 ΕΡ 1 560 827/ΡΤ Ο termo &quot;formilalquilo&quot;, tal como aqui utilizado, refere-se a um grupo formilo ligado à porção molecular de origem através de um grupo alquilo.As used herein, the singular forms &quot; &quot; &quot; &quot; and &quot; o &quot; may include plural references, unless the context clearly indicates otherwise. The term &quot; alkyl &quot; as used herein refers to a group derived from a straight or branched chain saturated hydrocarbon containing 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 atoms of carbon. Examples of alkyl groups include butyl, methyl, 2-methylbutyl and the like. The term &quot; alkenyl &quot; as used herein refers to a straight or branched chain group of 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms containing at least one double bond carbon-carbon. Examples of alkenyl groups include allyl, propenyl, 3-methyl-2-butenyl and the like. The term &quot; alkynyl &quot; as used herein refers to a straight or branched chain hydrocarbon of 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms containing at least one triple bond carbon-carbon. Examples of alkynyl groups include ethynyl, 2-methyl-3-butynyl, 3-pentynyl and the like. The term &quot; alkoxy &quot; as used herein refers to an alkyl group attached to the parent molecular moiety through an oxygen atom. Examples of alkoxy groups include tert-butoxy, methoxy, isopropoxy and the like. The term &quot; alkoxyalkoxy &quot; as used herein means an alkoxy group as defined herein attached to the parent moiety through another alkoxy group as defined herein. Representative examples of alkoxyalkoxy include, but are not limited to, tert-butoxymethoxy, 2-ethoxyethoxy, 2-methoxyethoxy and methoxymethoxy. The term &quot; alkoxyalkoxyalkyl &quot; as used herein means an alkoxyalkoxy group as defined herein attached to the parent molecular moiety through an alkyl group as defined herein. Representative examples of alkoxyalkoxyalkyl include, but are not limited to, tert-butoxymethoxymethyl, ethoxymethoxymethyl, (2-methoxyethoxy) methyl and 2- (2-methoxyethoxy) ethyl. The term &quot; alkoxyalkyl &quot; as used herein refers to an alkyl group substituted by at least one alkoxy group. The term &quot; alkoxycarbonyl &quot; as used herein refers to an alkoxy group attached to the parent molecular moiety through a carbonyl group. Examples of alkoxycarbonyl groups include tert-butoxycarbonyl, ethoxycarbonyl, methoxycarbonyl and the like. The term &quot; alkoxycarbonylalkyl &quot; as used herein refers to an alkoxycarbonyl group attached to the parent molecular moiety through an alkyl group. The term &quot; alkylcarbonyl &quot; as used herein refers to an alkyl group attached to the parent molecular moiety through a carbonyl group. Examples of alkylcarbonyl groups include acryl, butanoyl, 2,2-dimethylpropanoyl and the like. The term &quot; alkylcarbonylalkyl &quot; as used herein means an alkylcarbonyl groups as defined herein attached to the parent molecular moiety through an alkyl group as defined herein. Representative examples of 5β-alkylcarbonylalkyl include, but are not limited to, 2-oxopropyl, 3,3-dimethyl-2-oxopropyl, 3-oxobutyl and 3-oxopentyl. The term &quot; alkylsulfanyl &quot; as used herein refers to an alkyl group attached to the parent molecular moiety through a sulfur atom. Examples of alkylsulfanyl groups include methylsulfanyl, (1-methylethyl) sulfanyl, (2-methylpropyl) sulfanyl and the like. The term &quot; alkylsulfanylalkyl &quot; as used herein refers to an alkylsulfanyl group attached to the parent molecular moiety through an alkyl group. The term &quot; alkylsulfinyl &quot; as used herein refers to an alkyl group attached to the parent molecular moiety through a -S (O) - group. The term &quot; alkylsulfinylalkyl &quot; as used herein refers to an alkylsulfinyl group attached to the parent molecular moiety through an alkyl group. The term &quot; alkylsulfonyl &quot; as used herein refers to an alkyl group attached to the parent molecular moiety through a -S (O) 2 - group. The term &quot; alkylsulfonylalkyl &quot; as used herein refers to an alkylsulfonyl group attached to the parent molecular moiety through an alkyl group. The term &quot; aryl &quot;, as used herein, refers to a phenyl group or a bicyclic or tricyclic fused hydrocarbon ring system, wherein one or more of the rings is a phenyl group. Bicyclic fused ring systems have a phenyl group fused to a monocyclic cycloalkenyl group, as defined herein, a monocyclic cycloalkyl group as defined herein or another phenyl group. Tricyclic fused ring systems are exemplified by a bicyclic fused ring system fused to a monocyclic cycloalkenyl group, as defined herein, a monocyclic cycloalkyl group as defined herein or other phenyl group. Examples of aryl groups include anthracenyl, azulenyl, fluorenyl, indanyl, indenyl, naphthyl, phenyl, tetrahydronaphthyl, and the like. The aryl groups of the present invention may be attached to the parent molecular moiety through a substitutable carbon atom of the group. The aryl groups of the present invention may be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -ORa, -OC (O) R a, -OC (O) OR a, -O C (O) NR a R b, -SO 2 R a, -SO 2 NR a R b, -SR a, -SOR a, -SO 2 R a, -SO 2 R a, -SO 2 NR a R b, -NR a R b, (Re) C (O) NRaRb, -N (Re) SO 2 R a, -N (Re) SO 2 NRa R b, -N (Re) SO 2 N (Re) C (O) O R a, -C (O) Ra, -C (O) O R a, -C (O) NR a R b, cycloalkyl, cycloalkenyl, heterocycle, a second aryl and heteroaryl group; wherein each of the alkyl, alkenyl and alkynyl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of cyano, formyl, halo, nitro, oxo, -ORa, OC (O) ORa, -OC (O) NRaRb, -SO2 R2a, -SO2NRaRb, -SRa, -SORa, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N (Re) C (O) Ra, -N (Re) C (O) ORa, -N (Re) C (O) NRa Rb, -N (Re) SO 2 R a, -N (Re) SO 2 NRa R b, -N C (O) Ra, -C (O) O R a, -C (O) NR a R b, cycloalkyl, cycloalkenyl, heterocycle, a second aryl and heteroaryl group; wherein R a, R b and R e are defined herein and wherein the second aryl, heteroaryl, cycloalkyl, cycloalkenyl and heterocycle may be substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of -OH Alkyl, alkenyl, alkynyl, cyano, formyl, halo, haloalkoxy, haloalkyl, nitro, -NH 2, -N (H) (alkyl), -N (alkyl) 2, -C (O) OH , -C (O) O (alkyl), -C (O) NH 2, -C (O) N (H) (alkyl), -C (O) N (alkyl) 2 and oxo. The term &quot; arylalkenyl &quot; as used herein refers to an aryl group attached to the parent molecular moiety through an alkenyl group. The term &quot; arylalkoxy &quot; as used herein refers to an arylalkyl group attached to the parent molecular moiety through an oxygen atom. The term &quot; arylalkyl &quot; as used herein refers to an aryl group attached to the parent molecular moiety through an alkyl group. &Quot; arylcarbonyl &quot; as used herein refers to an aryl group attached to the parent molecular moiety through a carbonyl group. The term &quot; arylcarbonylalkyl &quot; as used herein means an arylcarbonyl group as defined herein attached to the parent molecular moiety through an alkyl group as defined herein. The term &quot; aryloxy, &quot; as used herein, refers to an aryl group attached to the parent molecular moiety through an oxygen atom. The term &quot; aryloxyalkyl &quot; as used herein refers to an aryloxy group attached to the parent molecular moiety through an alkyl group. The term &quot; arylsulfanyl &quot; as used herein refers to an aryl group attached to the parent molecular moiety through a sulfur atom. The term &quot; arylsulfanylalkyl &quot; as used herein refers to an arylsulfanyl group attached to the parent molecular moiety through an alkyl group. The term &quot; arylsulfonyl &quot; as used herein refers to an aryl group attached to the parent molecular moiety through a sulfonyl group. The term &quot; arylsulfonylalkyl &quot; as used herein refers to an arylsulfonyl group attached to the parent molecular moiety through an alkyl group. The term &quot; carboxy &quot; as used herein refers to -C02H. The term &quot; carboxyalkyl &quot; as used herein refers to a carboxy group attached to the parent molecular moiety through an alkyl group. The term &quot; cyano &quot; as used herein refers to -CN. &Quot; cyanoalkyl &quot; as used herein refers to a cyano group attached to the parent molecular moiety through an alkyl group. The term &quot; cycloalkenyl &quot; as used herein refers to a bicyclic or tricyclic, non-aromatic, partially unsaturated ring system having three to fourteen carbon atoms and zero heteroatoms. Examples of cycloalkenyl groups include cyclohexenyl, octahydronaphthalenyl, norbornylenyl and the like. The cycloalkenyl groups of the present invention may be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -OR a, -C (O) R a, -O C (O) O R a, -O C (O) NR a R b, -SO 2 R a, -SO 2 NR a R b, -SR a, -SOR a, -SO 2 R a, -SO 2 R a, -SO 2 NR a R b, -NR a R b, (Re) C (O) NRa Rb, -N (Re) SO 2 R a, -N (Re) SO 2 NRa R b, -N (Re) SO 2 N (Re) C (O) ORa, -C (O) Ra, -C (O) O R a, -C (O) NR a R b, cycloalkyl, a second cycloalkenyl, heterocycle, aryl, heteroaryl and ethylenedioxy; wherein each of the alkyl, alkenyl and alkynyl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of cyano, formyl, halo, nitro, oxo, -ORa, (O) R a, -OC (O) NRa R b, -SO 2 R a, -SO 2 NR a R b, -SR a, -SOR a, -SO 2 R a, -SO 2 R a, -SO 2 NR a R b, -NR a R b, (Re) C (O) ORa, -N (Re) C (O) NRa Rb, -N (Re) SO 2 R a, -N (Re) SO 2 NRa R b, -N C (O) Ra, -C (O) O R a, -C (O) NR a R b, cycloalkyl, a second cycloalkenyl, heterocycle, aryl and heteroaryl; wherein R a, R b and R e are defined herein and wherein the cycloalkyl, the second cycloalkenyl, the heterocycle, the aryl and the heteroaryl may be substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of -OH, Alkyl, alkenyl, alkynyl, cyano, formyl, halo, oxo, haloalkoxy, haloalkyl, nitro, oxo, -NH 2, -N (H) (alkyl), -N (alkyl) 2, -C 0) 0 H, -C (O) O (alkyl), -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2. The term &quot; cycloalkenylalkyl &quot; as used herein refers to a cycloalkenyl group attached to the parent molecular moiety through an alkyl group. The term &quot; cycloalkyl &quot; as used herein refers to a monocyclic, bicyclic or tricyclic saturated hydrocarbon ring system having three to fourteen carbon atoms and zero heteroatoms. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, bicyclo [3.1.1] heptyl, 6,6-dimethylbicyclo [3.1.1] heptyl, adamantyl and the like. The cycloalkyl groups of the present invention may be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -OR a, -C (O) R a, -O C (O) O R a, -O C (O) NR a R b, -SO 2 R a, -SO 2 NR a R b, -SR a, -SOR a, -SO 2 R a, -SO 2 R a, -SO 2 NR a R b, -NR a R b, (Re) C (O) NRa Rb, -N (Re) SO 2 R a, -N (Re) SO 2 NRa R b, -N (Re) SO 2 N (Re) C (O) ORa, -C (O) Ra, -C (O) O R a, -C (O) NR a R b, a second cycloalkyl, cycloalkenyl, heterocycle, aryl, heteroaryl and ethylenedioxy; wherein each of the alkyl, alkenyl and alkynyl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of cyano, formyl, halo, nitro, oxo, -O R a, (O) 0 R a, -O C (O) NR a R b, -SO 2 R a R b, -SR a, -SR a, -SO 2 R a, -SO 2 R a, -SO 2 NR a R b, -NR a R b, (Re) C (O) O R a, -N (Re) C (O) NR a R b, -N (Re) SO 2 R a, -N (Re) SO 2 NR a R b, -N C (O) Ra, -C (O) O R a, -C (O) NR a R b, a second cycloalkyl, cycloalkenyl, heterocycle, aryl and heteroaryl; wherein R a, R b and R e are defined herein and wherein the second cycloalkyl, cycloalkenyl, heterocycle, aryl and heteroaryl may be substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of -OH, Alkyl, alkenyl, alkynyl, cyano, formyl, halo, haloalkoxy, haloalkyl, nitro, oxo, -NH 2, -N (H) (alkyl), -N (alkyl) 2, -C (O) OH, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2. The term &quot; cycloalkylalkenyl &quot; as used herein refers to a cycloalkyl group attached to the parent molecular moiety through an alkenyl group. The term &quot; cycloalkylalkyl &quot; as used herein refers to a cycloalkyl group attached to the parent molecular moiety through an alkyl group. The term &quot; formyl &quot; as used herein refers to -CHO. &Quot; formylalkyl &quot; as used herein refers to a formyl group attached to the parent molecular moiety through an alkyl group.

Os termos &quot;halo&quot; e &quot;halogéneo&quot;, tal como aqui utilizados, referem-se a F, Cl, Br e I. O termo &quot;haloalcoxi&quot;, tal como aqui utilizado, refere-se a um grupo haloalquilo ligado à porção molecular de origem através de um átomo de oxigénio. O termo &quot;haloalcoxialquilo&quot;, tal como aqui utilizado, refere-se a um grupo haloalcoxi ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;haloalquilo&quot;, tal como aqui utilizado, refere-se a um grupo alquilo substituído por um, dois, três ou quatro átomos de halogéneo. O termo &quot;heteroarilo&quot;, tal como aqui utilizado, refere-se a um anel aromático de cinco ou seis membros em que pelo menos um átomo é seleccionado do grupo que consiste em N, O e S e os restantes átomos são de carbono. O termo &quot;heteroarilo&quot; também inclui sistemas bicíclicos em que um anel heteroarilo está fundido com um grupo fenilo, um grupo cicloalquilo monocíclico, como aqui definido, um grupo heterociclo, como aqui definido ou um grupo heteroarilo adicional. O termo &quot;heteroarilo&quot; também inclui sistemas tricíclicos em que u sistema bicíclico está fundido com um grupo fenilo, um grupo cicloalquilo monocíclico, como aqui definido, um grupo heterociclo, como aqui definido ou um grupo heteroarilo adicional. Os grupos heteroarilo estão ligados à porção molecular de origem através de qualquer átomo de carbono ou azoto substituível nos grupos. Exemplos de grupos heteroarilo incluem benzotienilo, benzoxazolilo, benzimidazolilo, benzoxadiazolilo, dibenzofuranilo, di-hidrobenzotiazolilo, furanilo, imidazolilo, indazolilo, indolilo, isoindolilo, isoxazolilo, isoquinolinilo, isotiazolilo, oxadiazolilo, oxazolilo, tiazolilo, tienopiridinilo, tienilo, triazolilo, tiadiazolilo, tetrazolilo, piridilo, piridazinilo, pirimidinilo, pirazinilo, pirazolilo, pirrolilo, quinolinilo, tetra-hidroquinolinilo, tetra-hidropiranilo, triazinilo e 11 ΕΡ 1 560 827/ΡΤ similares. Os grupos heteroarilo do presente invento podem ser substituídos com 0, 1, 2, 3, 4 ou 5 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, formilo, halo, nitro, oxo, -ORa, -OC (O) Ra, -OC (O) ORa, -0C(0)NRaRb, -0S02Ra, -0S02NRaRb, —SRa, -SORa, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N (Re) C (O) Ra, -N (Re) C (O) ORa, -N(Re)C(0)NRaRb, -N(Re)S02Ra, -N (Re) S02NRaRb, -N (Re) S02N (Re) C (O) ORa, -C(0)Re, -C(0)0Ra, -C (O) NRaRb, cicloalquilo, cicloalcenilo, heterociclo, arilo e um segundo grupo heteroarilo; em que cada um dos alquilo, alcenilo e alcinilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em ciano, formilo, halo, nitro, oxo, -ORa, -0C(0)Ra, -OC (O) ORa, -0C(0)NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -SORa, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N (Re) C (O) Ra, -N (Re) C (O) ORa, -N(Re)C(0)NRaRb, -N(Re)S02Ra, -N (Re) S02NRaRb, -N (Re) S02N (Re) C (O) ORa, -C(0)Ra, -C(0)0Ra, -C (O) NRaRb, cicloalquilo, cicloalcenilo, heterociclo, arilo e um segundo grupo heteroarilo; em que Ra, Rb e Re são aqui definidos e em que o segundo grupo heteroarilo, o arilo, o cicloalquilo, o cicloalcenilo e o heterociclo podem ser independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em -OH, -O(alquilo), alquilo, alcenilo, alcinilo, ciano, formilo, halo, haloalcoxi, haloalquilo, nitro, -NH2, -N(H)(alquilo), -N(alquilo)2, -C(O)OH, -C(O)O(alquilo), -C(0)NH2, -C(O)N(H)(alquilo), -C(O)N(alquilo)2 e oxo. Além disso, os heteroátomos de azoto podem ser opcionalmente quaternizados ou oxidados para o N-óxido. Também os anéis que contêm azoto podem ser opcionalmente N-protegidos. O termo &quot;heteroarilalcenilo&quot;, tal como aqui utilizado, refere-se a um grupo heteroarilo ligado à porção molecular de origem através de um grupo alcenilo. O termo &quot;heteroarilalquilo&quot;, tal como aqui utilizado, refere-se a um grupo heteroarilo ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;heteroarilsulfonilo&quot;, tal como aqui utilizado, refere-se a um grupo heteroarilo ligado à porção molecular de origem através de um grupo sulfonilo. 12 ΕΡ 1 560 827/ΡΤ Ο termo &quot;heteroarilsulfonilalquilo&quot;, tal como aqui utilizado, refere-se a um qrupo heteroarilsulfonilo liqado à porção molecular de origem através de um grupo alquilo. O termo &quot;heterociclo&quot;, tal como aqui utilizado, refere-se a anéis cíclicos, não aromáticos, saturados ou parcialmente insaturados, de três, quatro, cinco, seis ou sete membros contendo pelo menos um átomo seleccionado do grupo que consiste em oxigénio, azoto e enxofre. O termo &quot;heterociclo&quot; também inclui sistemas bicíclicos em que um anel heterociclo está fundido com um grupo fenilo, um grupo cicloalcenilo monocíclico, como aqui definido, um grupo cicloalquilo monocíclico, como aqui definido ou um grupo heterociclo monocíclico adicional. O termo &quot;heterociclo&quot; também inclui sistemas tricíclicos em que um sistema bicíclico está fundido com um grupo fenilo, um grupo cicloalcenilo monocíclico, como aqui definido, um grupo cicloalquilo monocíclico, como aqui definido ou um grupo heterociclo monocíclico adicional. Os grupos heterociclo do invento estão ligados à porção molecular de origem através de qualquer átomo de carbono ou azoto substituível no grupo. Exemplos grupos heterociclo incluem benzoxazinilo, di-hidroindolilo, di-hidropiridinilo, 1,3-dioxanilo, 1,4-dioxanilo, 1,3-dioxolanilo, isoindolinilo, morfolinilo, piperazinilo, pirrolidinilo, tetra- hidropiridinilo, piperidinilo, tiomorfolinilo, tetra-hidropiranilo e similares. Os grupos heterociclo do presente invento podem ser substituídos com 0, 1, 2, 3, 4 ou 5 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, formilo, halo, nitro, OXO, -0Ra, -0C(0)Ra, -0C(0)0Ra, -0C(0)NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -S0Ra, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N (Re) C (0) Ra, -N (Re) C (0) 0Ra, -N (Re) C (0) NRaRb, -N(Re)S02Ra, -N(Re)S02NRaRb, -N(Re)S02N(Re)C(0)0Ra, -C(0)Ra, -C(0)0Ra, -C(0)NRaRb, cicloalquilo, cicloalcenilo, um segundo heterociclo, arilo, heteroarilo e etilenodioxi; em que cada um dos alquilo, alcenilo e alcinilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em ciano, formilo, halo, nitro, OXO, -0Ra, -0C(0)Ra, -0C(0)0Ra, -0C(0)NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -S0Ra, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N(Re)C(0)Ra, -N(Re)C(0)0Ra, -N (Re) C (0) NRaRb, -N(Re)S02Ra, 13 ΕΡ 1 560 827/ΡΤ -N(Re)S02NRaRb, -N(Re)S02N(Re)C(0)0Ra, -C(0)Ra, -C(0)0Ra, -C(0)NRaRb, cicloalquilo, cicloalcenilo, um segundo heterociclo, arilo e heteroarilo; em que Ra, Rb e Re são aqui definidos e em que o cicloalquilo, o cicloalcenilo, o segundo heterociclo, o arilo e o heteroarilo podem ser independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em -OH, -O(alquilo), alquilo, alcenilo, alcinilo, ciano, formilo, halo, haloalcoxi, haloalquilo, nitro, oxo, -NH2, -N (H) (alquilo), -N(alquilo)2, -C(0)0H, -C(O)O(alquilo), -C(0)NH2, -C(O)N(H)(alquilo) e -C(O)N(alquilo)2. Além disso, os heteroátomos de azoto podem ser opcionalmente quaternizados ou oxidados para o N-óxido. Também os anéis heterocíclicos contendo azoto podem ser opcionalmente N-protegidos. O termo &quot;heterocicloalcenilo&quot;, tal como aqui utilizado, refere-se a um grupo heterociclo ligado à porção molecular de origem através de um grupo alcenilo. O termo &quot;heterocicloalquilo&quot;, tal como aqui utilizado, refere-se a um grupo heterociclo ligado à porção molecular de origem através de um grupo alquilo. O termo &quot;heterociclocarbonilo&quot; tal como aqui utilizado, significa um heterociclo, como aqui definido, ligado à porção molecular de origem através de um grupo carbonilo, como aqui definido. Exemplos representativos do heterociclocarbonilo incluem, mas não limitados a, pirrolidinilcarbonilo e piperazin-l-ilcarbonilo. O termo &quot;hidroxi,&quot; tal como aqui utilizado, refere-se a -OH. O termo &quot;hidroxialquilo&quot;, tal como aqui utilizado, refere-se a um grupo alquilo substituído por pelo menos um grupo hidroxi. O termo &quot;nitro,&quot; tal como aqui utilizado, refere-se a —N02. O termo &quot;nitroalquilo&quot;, tal como aqui utilizado, refere-se a um grupo alquilo substituído por pelo menos um grupo nitro. 14 ΕΡ 1 560 827/ΡΤ Ο termo &quot;οχο,&quot; tal como aqui utilizado, refere-se a =0. O termo &quot;sulfanilo&quot;, tal como aqui utilizado, refere-se a -S-. O termo &quot;sulfinilo&quot;, tal como aqui utilizado, refere-se a -SO-. 0 termo &quot;sulfonilo&quot;, tal como aqui utilizado, refere-se a -S02-.The terms &quot; halo &quot; and &quot; halogen &quot; as used herein refer to F, Cl, Br and I. The term &quot; haloalkoxy &quot; as used herein refers to a haloalkyl group attached to the parent molecular moiety through an oxygen atom. The term &quot; haloalkoxyalkyl &quot; as used herein refers to a haloalkoxy group attached to the parent molecular moiety through an alkyl group. The term &quot; haloalkyl &quot; as used herein refers to an alkyl group substituted by one, two, three or four halogen atoms. The term &quot; heteroaryl &quot; as used herein refers to a five- or six-membered aromatic ring wherein at least one atom is selected from the group consisting of N, O and S and the remaining atoms are carbon. The term &quot; heteroaryl &quot; also includes bicyclic systems in which a heteroaryl ring is fused to a phenyl group, a monocyclic cycloalkyl group as defined herein, a heterocycle group as defined herein or an additional heteroaryl group. The term &quot; heteroaryl &quot; also includes tricyclic systems wherein the bicyclic system is fused to a phenyl group, a monocyclic cycloalkyl group as defined herein, a heterocycle group as defined herein or an additional heteroaryl group. The heteroaryl groups are attached to the parent moiety through any substitutable carbon or nitrogen atom in the groups. Examples of heteroaryl groups include benzothienyl, benzoxazolyl, benzimidazolyl, benzoxadiazolyl, dibenzofuranyl, dihydrobenzothiazolyl, furanyl, imidazolyl, indazolyl, indolyl, isoindolyl, isoxazolyl, isothiazolyl, oxadiazolyl, oxazolyl, thiazolyl, thienopyridinyl, thienyl, thiazolyl, thiadiazolyl, tetrazolyl pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrazolyl, pyrrolyl, quinolinyl, tetrahydroquinolinyl, tetrahydropyranyl, triazinyl and the like. The heteroaryl groups of the present invention may be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -ORa, -OC (O) R a, -OC (O) OR a, -O C (O) NR a R b, -SO 2 R a, -SO 2 NR a R b, -SR a, -SOR a, -SO 2 R a, -SO 2 R a, -SO 2 NR a R b, -NR a R b, (Re) C (O) NRaRb, -N (Re) SO 2 R a, -N (Re) SO 2 NRa R b, -N (Re) SO 2 N (Re) C (O) ORa, -C (O) Re, -C (O) ORa, -C (O) NRaRb, cycloalkyl, cycloalkenyl, heterocycle, aryl and a second heteroaryl group; wherein each of the alkyl, alkenyl and alkynyl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of cyano, formyl, halo, nitro, oxo, -ORa, OC (O) OR a, -O C (O) NR a R b, -SO 2 R a, -SO 2 NR a R b, -SR a, -SOR a, -SO 2 R a, -SO 2 R a, -SO 2 NR a R b, -NR a R b, -N (Re) C (O) ORa, -N (Re) C (O) NRa Rb, -N (Re) SO 2 R a, -N (Re) SO 2 NR a R b, -N C (O) Ra, -C (O) O R a, -C (O) NR a R b, cycloalkyl, cycloalkenyl, heterocycle, aryl and a second heteroaryl group; wherein R a, R b and R e are defined herein and wherein the second heteroaryl, aryl, cycloalkyl, cycloalkenyl and heterocycle groups may be independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of - Alkyl, alkenyl, alkynyl, cyano, formyl, halo, haloalkoxy, haloalkyl, nitro, -NH 2, -N (H) (alkyl), -N (alkyl) 2, -C (O) OH, -C (O) O (alkyl), -C (O) NH 2, -C (O) N (H) (alkyl), -C (O) N (alkyl) 2 and oxo. In addition, the nitrogen heteroatoms may be optionally quaternized or oxidized to the N-oxide. Also, the nitrogen containing rings may optionally be N-protected. The term &quot; heteroarylalkenyl &quot; as used herein refers to a heteroaryl group attached to the parent molecular moiety through an alkenyl group. The term &quot; heteroarylalkyl &quot; as used herein refers to a heteroaryl group attached to the parent molecular moiety through an alkyl group. The term &quot; heteroarylsulfonyl &quot; as used herein refers to a heteroaryl group attached to the parent molecular moiety through a sulfonyl group. &Quot; heteroarylsulfonylalkyl &quot; as used herein refers to a heteroarylsulfonyl group bound to the parent molecular moiety through an alkyl group. The term &quot; heterocycle &quot; as used herein refers to three, four, five, six or seven membered saturated or partially unsaturated, non-aromatic, cyclic rings containing at least one atom selected from the group consisting of oxygen , nitrogen and sulfur. The term &quot; heterocycle &quot; also includes bicyclic systems in which a heterocycle ring is fused to a phenyl group, a monocyclic cycloalkenyl group as defined herein, a monocyclic cycloalkyl group as defined herein or an additional monocyclic heterocycle group. The term &quot; heterocycle &quot; also includes tricyclic systems in which a bicyclic system is fused to a phenyl group, a monocyclic cycloalkenyl group as defined herein, a monocyclic cycloalkyl group as defined herein or an additional monocyclic heterocycle group. The heterocyclic groups of the invention are attached to the parent moiety through any substitutable carbon or nitrogen atom in the group. Examples of heterocycle groups include benzoxazinyl, dihydroindolyl, dihydropyridinyl, 1,3-dioxanyl, 1,4-dioxanyl, 1,3-dioxolanyl, isoindolinyl, morpholinyl, piperazinyl, pyrrolidinyl, tetrahydropyridinyl, piperidinyl, thiomorpholinyl, dihydropyranyl and the like. The heterocycle groups of the present invention may be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, -ORa, -OC (O) R a, -O C (O) O R a, -O C (O) NR a R b, -SO 2 R a, -SO 2 NR a R b, -SR a, -SR a, -SO 2 R a, -SO 2 R a, -SO 2 NR a R b, -NR a R b, C (O) NRa Rb, -N (Re) SO 2 R a, -N (Re) SO 2 NRa R b, -N (Re) SO 2 N (Re) C (O) O R a, -C (O) Ra, -C (O) O R a, -C (O) NR a R b, cycloalkyl, cycloalkenyl, a second heterocycle, aryl, heteroaryl and ethylenedioxy; wherein each of the alkyl, alkenyl and alkynyl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of cyano, formyl, halo, nitro, OXO, -O R a, -O C (O) Ra, - (O) 0 R a, -O C (O) NR a R b, -SO 2 R a R b, -SR a, -SR a, -SO 2 R a, -SO 2 R a, -SO 2 NR a R b, -NR a R b, (Re) C (O) O R a, -N (Re) C (O) NRaRb, -N (Re) SO 2 R a, 13 ΕΡ 1 560 827 / C (O) O R a, -C (O) Ra, -C (O) O R a, -C (O) NR a R b, cycloalkyl, cycloalkenyl, a second heterocycle, aryl and heteroaryl; wherein R a, R b and R e are defined herein and wherein cycloalkyl, cycloalkenyl, the second heterocycle, aryl and heteroaryl may be independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of -OH Alkyl, alkenyl, alkynyl, cyano, formyl, halo, haloalkoxy, haloalkyl, nitro, oxo, -NH 2, -N (H) (alkyl), -N (alkyl) 2, -C (O ) 0 H, -C (O) O (alkyl), -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2. In addition, the nitrogen heteroatoms may be optionally quaternized or oxidized to the N-oxide. Also the nitrogen-containing heterocyclic rings may be optionally N-protected. The term &quot; heterocycloalkenyl &quot; as used herein refers to a heterocycle group attached to the parent molecular moiety through an alkenyl group. The term &quot; heterocycloalkyl &quot; as used herein refers to a heterocycle group attached to the parent molecular moiety through an alkyl group. The term &quot; heterocyclocarbonyl &quot; as used herein means a heterocycle, as defined herein, attached to the parent molecular moiety through a carbonyl group, as defined herein. Representative examples of the heterocyclocarbonyl include, but are not limited to, pyrrolidinylcarbonyl and piperazin-1-ylcarbonyl. The term &quot; hydroxy, &quot; as used herein, refers to -OH. The term &quot; hydroxyalkyl &quot; as used herein refers to an alkyl group substituted by at least one hydroxy group. The term &quot; nitro, &quot; as used herein, refers to -NO2. The term &quot; nitroalkyl &quot; as used herein refers to an alkyl group substituted by at least one nitro group. 14 ΕΡ 1 560 827 / ΡΤ Ο term &quot; οχο, &quot; as used herein, refers to = 0. The term &quot; sulfanyl &quot; as used herein refers to -S-. The term &quot; sulfinyl &quot; as used herein refers to -SO-. The term &quot; sulfonyl &quot; as used herein refers to -SO 2 -.

Está entendido que alcenilo, alcoxi, alcoxialcoxi, alcoxialcoxialquilo, alcoxialquilo, alcoxicarbonilo, alcoxicarbonilalquilo, alquilo, alquilcarbonilo, alquilcarbonilalquilo, alcinilo, alquilsulfanilo, alquilsulfanilalquilo, alquilsulfinilo, alquilsulfinilalquilo, alquilsulfonilo, alquilsulfonilalquilo, arilalcenilo, arilalcoxi, arilalquilo, ariloxialquilo, arilsulfanilalquilo, arilsulfonilalquilo, carboxialquilo, cianoalquilo, cicloalcenilalquilo, cicloalcenilalcenilo, cicloalquilalquilo, formilalquilo, haloalcoxi, haloalcoxialquilo, haloalquilo, heteroarilalcenilo, heteroarilalquilo, heterosulfonilalquilo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo e nitroalquilo podem ser opcionalmente substituídos.It is understood that alkenyl, alkoxy, alkoxyalkoxy, alkoxyalkoxyalkyl, alkoxyalkyl, alkoxycarbonylalkyl, alkylcarbonylalkyl, alkylcarbonylalkyl, alkynyl, alkylsulfanyl, alkylsulfinylalkyl, alkylsulfinylalkyl, alkylsulfonyl, alkylsulfonylalkyl, arylalkenyl, arylalkoxy, arylalkyl, aryloxyalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, , cyanoalkyl, cycloalkenylalkyl, cycloalkenylalkenyl, cycloalkylalkyl, formylalkyl, haloalkoxy, haloalkoxyalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterosulfonylalkyl, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl and nitroalkyl may be optionally substituted.

Numa concretização, o presente invento proporciona um composto ou uma sua forma de sal, estereoisómero ou tautómero farmaceuticamente aceitável, em que: o composto corresponde à estrutura da fórmula (Vb):In one embodiment, the present invention provides a compound or a pharmaceutically acceptable salt, stereoisomer or tautomer form thereof, wherein: the compound corresponds to the structure of formula (Vb):

R1 é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alquilcarbonilalquilo, alquilsulfanilalquilo, 15 ΕΡ 1 560 827/ΡΤ alquilsulfinilalquilo, alquilsulfonilalquilo, alcinilo, arilo, arilalcenilo, arilalquilo, arilsulfanilalquilo, arilsulfonilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, (cicloalquil)alcenilo, (cicloalquil)alquilo, formilalquilo, haloalcoxialquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heteroarilsulfonilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, nitroalquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, RaRbNC (O) O-alquil-, RaRbNC (0)NRc-alquil-, RfRgC=N- e Rk0-, em que R1 é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (ORc), -(alquil) (NRcRe), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, —N (Rc) (Re) , -C(0)Rc, -C(0)0Rce -C(O) NRcRe; R4 é seleccionado do grupo que consiste em alcoxi, arilalcoxi, ariloxi, halo, hidroxi, RaRbN-, N3- e ReS-, em que R4 é substituído com 0, 1 ou 2 substituintes independentemente seleccionados do grupo que consiste em halo, nitro, ciano, -OH, -NH2 e -COOH; R5 é seleccionado do grupo que consiste em RaS02N(Rf)-, RaS02N(Rf) alquil-, RaRbNS02N (Rf) - e RaRbNS02N (Rf) alquil-; R6 é independentemente seleccionado em cada ocorrência do grupo que consiste em alquilo, alcenilo, alcinilo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, heterocicloalquilo, -(alquil)(ORk), -(alquil)(NRaRb), -SRa, -S (O) Ra, —S (O) 2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)0Ra e -C(0)NRaRb; em que cada R6 é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, haloalquilo, ciano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C (O) ORa, -C (O) NRaRb e -NC (O) Ra;R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, , cycloalkenylalkyl, cycloalkylalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN- alkyl-, RaRbNC (O ) wherein R 1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of (a) and (b), R 1, R 2, R 3, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, hetero arylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NRcRe), -SRC, -S (O) Rc, -S (O) 2Rc, -ORc, -N (Rc) (Re) C (O) R c, -C (O) O R c C (O) NR c R e; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3- and ReS-, wherein R4 is substituted with 0,1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 and -COOH; R5 is selected from the group consisting of RaS02N (Rf) -, RaS02N (Rf) alkyl-, RaRbNS02N (Rf) - and RaRbNS02N (Rf) alkyl-; R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocycloalkyl, - (alkyl) (OR k), - alkyl (NRaRb), -SRa, -S (O) Ra, -S (O) 2Ra, -ORk, -N (Ra) (Rb), -C (O) Ra, -C (O) C (O) NR a R b; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NR a R b, -SR a, -SOR a , -SO 2 R a, -C (O) OR a, -C (O) NR a R b and -N C (O) R a;

Ra e Rb, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alcenilo, alquilo, alquilsulfanilalquilo, arilo, arilalcenilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, cicloalquilalcenilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalcenilo, 16 ΕΡ 1 560 827/ΡΤ heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilcarbonilo, nitroalquilo, RcRdN-, RcRdN-alquil-, RcRdNC (O) alquil-, RcS02-, RcS02-alquil-, RcC(O) - , RcC(O)alquil-, Rc0C(0)-, RcOC(O)alquil-,Ra and Rb at each occurrence are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, Heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RcRdN- alkyl-, RcRdNC (O) alkyl-, RcSO2-, RcSO2 -alkyl-, RcC (O) -, RcC ( O) alkyl-, RcOC (O) -, RcOC (O) alkyl-,

RcRdN-alquilC (O)RcRdNC(0), RcRdNC (O) O-alquil- ΘRcRdN-alkylC (O) RcRdNC (O), RcRdNC (O) O-alkyl-Θ

RcRdNC (O)N (Re) alquil-, em que Ra e Rb são substituídos com 0, 1 ou 2 substituintes seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc) , - (alquil) (NRcRd) , -SRC, -S(0)Rc, -S(0)2Rc, -ORc, —N (Rc) (Rd) , -C(0)Rc, -C (O) ORc e -C(0)NRcRd; alternativamente, Ra e Rb, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc) , - (alquil) (NRcRd) , -alquil-S02NRcRd, -alquil-C (0) NRcRd, -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C (0) ORc e -C (O) NRcRd;Wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, RcRdNC (O) N (Re) (ORc), - (alkyl) (NR c R d), -SRC, -S (O) R c, -S (O) 2 R c, -OR c, -N (R c), - (C 1 -C 4) alkyl, Rc) (Rd), -C (O) Rc, -C (O) OR c and -C (O) NR c R d; alternatively Ra and Rb, together with the nitrogen atom to which they are attached, form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc) (Rc) (Rc), -S (O) 2 Rc, -ORc, -N (Rc) (Rd), -N (Rc) -C (O) R c, -C (O) OR c and -C (O) NR c R d;

Rc e Rd, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -S02Rf, -C (O)NRfRh, -S02NRfRh, -C(0)ORf, alcenilo, alquilo, alcinilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, arilo, arilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo e heterocicloalquilo; em que cada Rc e Rd é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (ORf), - (alquil) (NRtRh) , -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C (O) Rf, -C (O) ORf, -C(0)NRfRh, -C (O)N (H)NRfRh, -N (Re) C (O) ORf, -N (Re) S02NRfRh, -N (Re) C (O) NRfRh, -alquil-N (Re) C (O) ORf, -alquil-N (Re) S02NRfRh e -alquil-N (Re) C (O) NRfRh; alternativamente, Rc e Rd, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros 17Rc and Rd at each occurrence are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO- (Rf), -SRf, -SORf, -SO2 Rf, -C (O) NRfRh, -S02 NRfRh, - C (O) OR f, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocycloalkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl (R f), -S (O) Rf, -S (O) 2 R f, -OR f, -N (R f) (Rh), - (C 1 -C 4) alkyl, C (O) Rf, -C (O) OR f, -C (O) NRf R h, -C (O) N (H) -N (Re) C (O) NRf R h, -alkyl-N (Re) C (O) OR f, -alkyl-N (Re) SO 2 NR f R h and -alkyl-N (Re) C (O) NR f R h; alternatively, R c and Rd, together with the nitrogen atom to which they are attached, form a three to six membered ring 17

ΕΡ 1 560 827/PT seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf) , -(alquil) (NRfRh) , -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C (0) Rf, -C (0) ORf e -C(0)NRfRh;Selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and the heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (OR f), - (alkyl) (NR f R h), -SR f, -S (O) R f, -S (O) 2 R f, -OR f, -N (R f) (Rh), -C (O) R f, -C (O) OR f and -C (O) NR f R h;

Re é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo e cicloalquilo;Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg e Rh, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alquilo, alcenilo, arilo, arilalquilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, heterociclo, heterocicloalquilo, heteroarilo e heteroarilalquilo; em que cada Rf, Rg e Rh é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquilo), -NH2, -N(H)(alquilo), -N(alquilo)2, -S(alquilo), -S(0)(alquilo), -S02-alquilo, -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquilo), -alquil-N(alquilo)2, -alquil-S(alquilo), -alquil-S(0)(alquilo), -alquil-S02alquilo, -N(H)C(0)NH2, -C(0)0H, -C(O)0(alquilo), -C(0)alquilo, -C(0)NH2, -C(0)NH2, -C(O)N(H)(alquilo) e -C(O)N(alquilo)2; alternativamente, Rf e Rg juntamente com o átomo de carbono ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em cicloalquilo, cicloalcenilo e heterociclo; alternativamente, Rf e Rh juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em heterociclo e heteroarilo; em que cada um dos heterociclo e heteroarilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquilo), -NH2, -N(H)(alquilo), -N(alquilo)2, -S(alquilo), -S(alquilo), -S(O) (alquilo), -alquil-OH, -alquil-O-alquilo, -alquil-NH2, 18 ΕΡ 1 560 827/ΡΤ -alquil-N(Η)(alquilo), -alquil-S(alquilo), -alquil- S(Ο)(alquilo), -alquil-S02-alquilo, -alquil-N(alquilo)2, -N(H)C(0)NH2, -C(0)0H, -C(O)O(alquilo), -C(O)alquilo, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alquilo) e -C(O)N(alquilo)2;Rf, Rg and Rh at each occurrence are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle heteroaryl, heteroarylalkyl, -OH, -O (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (O) (alkyl), -S02 alkyl-OH, -alkyl-O-alkyl, -alkyl-NH 2, -alkyl-N (H) (alkyl), -alkyl-N (alkyl) 2, -alkyl-S (alkyl), - -S (O) (alkyl), -alkyl-SO2alkyl, -N (H) C (O) NH2, -C (O) OH, -C (O) O (alkyl), -C (O) alkyl, - C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2; alternatively, R f and Rg together with the carbon atom to which they are attached form a three to seven membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively Rf and Rh together with the nitrogen atom to which they are attached form a three to seven membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle (alkyl), -N (alkyl), -N (alkyl), -N (alkyl), -S (alkyl), -S (alkyl), -S (O) (alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkyl-NH 2, -alkyl-N (Η) alkyl, -S (alkyl), -alkyl- S (Ο) (alkyl), -alkyl-SO2-alkyl, -alkyl-N (alkyl) 2, -N (H) C (O) NH2, -C (O) OH, -C (O) O ), -C (O) alkyl, -C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2;

Rk é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo, arilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo, heterocicloalquilo, nitroalquilo, RaRbN-alquil-, RaO-alquil-, RaRbNC(0)-, RaRbNC(0) alquilo, RaS-, RaS(0)-, RaS02-, RaS-alquil-, Ra(0)S- alquil-, RaS02-alquil-, Ra0C(0)-, RaOC (O) alquil-, RaC(0)- e RaC(0)-alquil-, em que cada Rk é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxi-alquilo, - (alquilo) (ORc) , - (alquilo) (NRcRd) , -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)0Rc e -C(0)NRcRd; e méO, 1, 2, 3 ou 4.R1 is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycloalkyl, nitroalkyl, nitroalkyl, RaRbN-alkyl-, RaO- -, RaRbNC (O) -, RaRbNC (O) alkyl, RaS-, RaS (O) -, RaS02-, RaS-alkyl-, Ra (O) S- alkyl-, RaS02- alkyl-, Ra0C (O) - , RaOC (O) alkyl-, RaC (O) - and RaC (O) -alkyl-, wherein each R k is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NR c R d), -SRC, -S (O) R c, -S (O) 2 R c, -OR c, -N (R c) (Rd), -C (O) R c, -C (O) O R c and -C (O) NR c R d; and meO, 1, 2, 3 or 4.

Por exemplo, o presente invento proporciona um composto de fórmula (Vb) em que R4 é hidroxi.For example, the present invention provides a compound of formula (Vb) wherein R 4 is hydroxy.

Por exemplo, o presente invento proporciona um composto de fórmula (Vb) em que R4 é hidroxilo e R1 é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alcinilo, arilalcenilo, arilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalcenilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, RfRgC=N- e RbO-.For example, the present invention provides a compound of formula (Vb) wherein R4 is hydroxy and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkylalkyl, cycloalkylalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, RaRbN-, RaRbN- alkyl-, RaRbNC (O) alkyl-, RfRgC = N- and RbO-.

Por exemplo, o presente invento proporciona um composto de fórmula (Vb) em que R4 é hidroxi e em que R1 é seleccionado do grupo que consiste em alquil-Cl-C7, fenil-alquil-Cl-C2-, heteroaril-alquil-Cl-C2-, ((cicloalquil-C3-C6)-alquil-Cl-C2)-, (alquil-Cl-C7)0-, (cicloalquil-C3-C7)O-, fenil-alquil-Cl-C2-0-, -NH2, (alquil-Cl-C7)N(H)-, (cicloalquil-C3-C7)N(H)-, 19 ΕΡ 1 560 827/ΡΤ ((cicloalquil-C3-C7)-alquil-Cl-C2)Ν(Η)-, (heterociclo)Ν(Η)-, (heteroarilalquil)N(Η)-, (arilalquil)N(Η)For example, the present invention provides a compound of formula (Vb) wherein R 4 is hydroxy and wherein R 1 is selected from the group consisting of C 1 -C 7 -alkyl, phenyl-C 1 -C 2 -alkyl-, heteroaryl- C2-, ((C3-C6-cycloalkyl-C1-C2-alkyl) -, (C1-C7-alkyl) 0-, (C3-C7-cycloalkyl) O-, phenyl-C1-C2- -, -NH 2, (C 1 -C 7 -alkyl) N (H) -, (C 3 -C 7 -cycloalkyl) N (H) -, 19 Ε 1 1,560 827 / ΡΤ ((C 3-7 cycloalkyl) (Heteroarylalkyl) N (Η) -, (arylalkyl) N (Η) - (heteroarylalkyl)

Por exemplo, ο presente invento proporciona um composto de fórmula (Vb) em que R4 é hidroxi e em que R1 é seleccionado do qrupo que consiste em isopropilo, 3-metilbutilo, butilo, isobutilo, fenilmetilo, tienilmetilo, ciclobutilmetilo, ciclopropiletilo, -NH2, (isopropilo)N(H)(isobutilo)N(H) (3-metilbutilo)N(H)(ciclobutilo)N(H)- e (ciclopropilmetilo)N(H)em que o fenilmetilo e o tienilmetilo são independentemente não substituídos ou substituídos com 1, 2 ou 3 substituintes seleccionados do qrupo que consiste em alquilo, alcenilo, alcinilo, haloalquilo, halo, ciano, nitro, -NH2, -Ν(H)alquilo, -N(alquilo)2, hidroxi e alcoxi.For example, the present invention provides a compound of formula (Vb) wherein R 4 is hydroxy and wherein R 1 is selected from the group consisting of isopropyl, 3-methylbutyl, butyl, isobutyl, phenylmethyl, thienylmethyl, cyclobutylmethyl, cyclopropylethyl, -NH 2 , N (H) (cyclobutyl) N (H) - and (cyclopropylmethyl) N (H) wherein the phenylmethyl and the thienylmethyl are independently substituted or substituted by 1, 2 or 3 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, haloalkyl, halo, cyano, nitro, -NH 2, - (H) alkyl, -N (alkyl) 2, hydroxy and .

Compostos exemplares de fórmula (Vb) incluem, mas não estão limitados aos sequintes: • N-{[3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-1,l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-7-il]metil}-metanossulfonamida; • N-[(3—{1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l,l-dioxido-4H-tieno[2,3-e] [1,2,4] — tiadiazin-7-il)metil]metanossulfonamida; • N-[(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il}—1,l-dioxido-4H-tieno[2,3-e] [1,2,4]-tiadiazin-7-il)metil]etanossulfonamida; • N-[(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}—1,l-dioxido-4H-tieno[2,3-e][1,2,4]— tiadiazin-7-il)metil]propano-l-sulfonamida; • N-[(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il }-l, l-dioxido-4fí-tieno [2,3-e] [1,2,4] — tiadiazin-7-il)metil]propano-2-sulfonamida; • N-[{3—{1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il }-l, l-dioxido-4íí-tieno [2,3-e] [1,2,4] — tiadiazin-7-il)metil]benzenossulfonamida; e • N-[(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il }-l, l-dioxido-4fí-tieno [2,3-e] [1,2,4] — tiadiazin-7-il)metil]-1-fenilmetanossulfonamida. 20 ΕΡ 1 560 827/ΡΤExemplary compounds of formula (Vb) include, but are not limited to, the following: N - {[3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -1- , 1-dioxido-4H-thieno [2,3-e] [1,2,4] thiadiazin-7-yl] methyl} methanesulfonamide; • N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-thieno [ 3-e] [1,2,4] thiadiazin-7-yl) methyl] methanesulfonamide; • N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-thieno [ 3-e] [1,2,4] thiadiazin-7-yl) methyl] ethanesulfonamide; • N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-thieno [ 3-e] [1,2,4] thiadiazin-7-yl) methyl] propane-1-sulfonamide; • N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4 H -thieno [ 3-e] [1,2,4] thiadiazin-7-yl) methyl] propane-2-sulfonamide; N - [{3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4 H -thieno [ 3-e] [1,2,4] thiadiazin-7-yl) methyl] benzenesulfonamide; and N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4 H -thieno [2 , 3-e] [1,2,4] thiadiazin-7-yl) methyl] -1-phenylmethanesulfonamide. 20 ΕΡ 1 560 827 / ΡΤ

Noutra concretização, ο presente invento proporciona um composto ou uma sua forma de sal, estereoisómero ou tautómero farmaceuticamente aceitável, em que: o composto corresponde à estrutura da fórmula (Via):In another embodiment, the present invention provides a compound or a pharmaceutically acceptable salt, stereoisomer or tautomer form thereof, wherein: the compound corresponds to the structure of formula (Via):

R1 é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alquilcarbonilalquilo, alquilsulfanilalquilo, alquilsulfinilalquilo, alquilsulfonilalquilo, alcinilo, arilo, arilalcenilo, arilalquilo, arilsulfanilalquilo, arilsulfonilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, (cicloalquil)alcenilo, (cicloalquil)alquilo, formilalquilo, haloalcoxialquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heteroarilsulfonil-alquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, nitroalquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, RaRbNC (O) O-alquil-, RaRbNC (O) NRc-alquil-, RfRgC=N- e RkO-, em que R1 é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, arilo, heteroarilo, heteroarilalquilo, - (alquilo) (NRcRe), -SRC, nitro, haloalquilo, haloalcoxi, heterociclo, arilalquilo, alcoxialcoxialquilo, -(alquilo)(ORc), -S(0)Rc, -S(0)2Rc, -ORc, —N (Rc) (Re) , -C(0)Rc, -C(0)0Rc e -C (O) NRcRe; R4 é seleccionado do grupo que consiste em alcoxi, arilalcoxi, ariloxi, halo, hidroxi, RaRbN-, N3- e ReS-, em que R4 é substituído com 0, 1 ou 2 substituintes independentemente seleccionados do grupo que consiste em halo, nitro, ciano, -OH, -NH2 e -COOH; R5 é seleccionado do grupo que consiste em RaS02N(Rf)-, RaS02N(Rf) alquil-, RaRbNS02N(Rf)- e RaRbNS02N (Rf) alquil-; 21 ΕΡ 1 560 827/ΡΤ R6 é independentemente seleccionado em cada ocorrência do grupo que consiste em alquilo, alcenilo, alcinilo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, heterocicloalquilo, -(alquil) (ORk), -(alquil) (NRaRb), -SRa, -S (O) Ra, -S(0)2Ra/ -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)0Ra e -C(0)NRaRb; em que cada R6 é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, haloalquilo, ciano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C (O) ORa, -C (O) NRaRb e -NC(0)Ra;R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkylcarbonylalkyl, alkylsulfinylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkyl, alkenyl, (cycloalkyl) alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycloalkyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN- alkyl-, RaRbNC (O) alkyl-, RaRbNC (O) O-alkyl-, RaRbNC (O) NRc-alkyl-, RfRgC = N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, aryl, heteroaryl, heteroarylalkyl, - (alkyl) (NRcRe), -SRC, nitro, haloalkyl, haloalkoxy, heteroc arylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), -S (O) Rc, -S (O) 2 Rc, -ORc, -N (Rc) (Re), -C (O) Rc, -C 0) 0 R c and -C (O) NR c R e; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3- and ReS-, wherein R4 is substituted with 0,1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 and -COOH; R5 is selected from the group consisting of RaS02N (Rf) -, RaS02N (Rf) alkyl-, RaRbNS02N (Rf) - and RaRbNS02N (Rf) alkyl-; Wherein R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocycloalkyl, - (O) Ra, -S (O) 2 R a, -ORk, -N (Ra) (R b), -C (O) R a, - C (O) O R a and -C (O) NR a R b; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NR a R b, -SR a, -SOR a , -SO 2 R a, -C (O) OR a, -C (O) NR a R b and -N C (O) Ra;

Ra e Rb, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alcenilo, alquilo, alquilsulfanilalquilo, arilo, arilalcenilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, cicloalquilalcenilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilcarbonilo, nitroalquilo, RcRdN-, RcRdN-alquil-, RcRdNC (O) alquil-, RcS02-, RcS02-alquil-, RcC(0)-, RcC(0)alquil-, Rc0C(0)-, RcOC(O)alquil-, RcRdN-alquil-C(O)-, RcRdNC (O) - , RcRdNC (O) O-alquil- e RcRdNC (O) N (Re) alquil-, em que Ra e Rb são substituídos com 0, 1 ou 2 substituintes seleccionados do grupo gue consiste em alguilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (ORc), -(alquil) (NRcRd) , -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(R0)(Rd), -C (0) Rc, -C (O) ORc e -C(0)NRcRd; alternativamente, Ra e Rb, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc), - (alquil) (NRcRd) , -alquil-S02NRcRd, -alquil- N(Rc)(Rd), -C (O) Rc, C (0) NRcRd, -SRC, -S(0)Rc, -S(0)2Rc, -ORc, - -C(O)ORc e —C(0)NR&lt;R&lt;,; 22 ΕΡ 1 560 827/ΡΤRa and Rb at each occurrence are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RcRdN- alkyl-, RcRdNC (O) alkyl-, RcSO2-, RcSO2- alkyl-, RcC (O) -, RcC (O) alkyl-, RcO ( 0) -, RcOC (O) alkyl-, RcRdN-alkyl-C (O) -, RcRdNC (O) -, RcRdNC (O) O-alkyl- and RcRdNC (O) N (Re) and Rb are substituted by 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - ) (ORc), - (alkyl) (NRcRd), -SRC, -S (O) Rc, -S (O) 2 Rc, -ORc, -N (R0) Rd), -C (O) R c, -C (O) OR c and -C (O) NR c R d; alternatively Ra and Rb, together with the nitrogen atom to which they are attached, form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc) (Rc) (Rd), -C (O) Rc, C (O) NR c R d, -SRC, -S (O) R c, -S (O) ) 2 R c, -OR c, -C (O) OR c and -C (O) NR <R < 22 ΕΡ 1 560 827 / ΡΤ

Rc e Rd/ em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -S02Rf, -C(0)NRfRh, -S02NRfRh, -C(0)0Rf, alcenilo, alquilo, alcinilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, arilo, arilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo e heterocicloalquilo; em que cada Rc e Rd é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (ORf), - (alquil) (NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N (Rf) (Rh) , -C(0)Rf, -C (O) ORf, -C(0)NRfRh, -C (O)N (H)NRfRh, -N (Re) C (O) ORf, -N (Re) S02NRfRh, -N (Re) C (O) NRfRh, -alquil- N (Re) C (O) ORf, -alquil-N (Re) S02NRfRh e -alquil-N (Re) C (O) NRfRh; alternativamente, Rc e Rd, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf) , - (alquil) (NRfRh) , -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C (O) Rf, -C (O) ORf e -C (O) NRfRh;R c and Rd / at each occurrence, are independently selected from the group consisting of hydrogen, -NRf R h, -OR f, -CO (R f), -SR f, -SOR f, -SO 2 R f, -C (O) NR f R h, -SO 2 NR f R h, - C (O) O R f, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocycloalkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl (Rf), -SRf, -S (O) Rf, -S (O) 2 Rf, -ORf, -N (R f) (Rh), - (C 1 -C 4) alkyl, C (O) Rf, -C (O) OR f, -C (O) NRf R h, -C (O) N (H) NR f R h, -N -N (Re) C (O) NRf R h, -alkyl- N (Re) C (O) OR f, -alkyl-N (Re) SO 2 NR f R h and -alkyl-N (Re) C (O) NR f R h; alternatively, Rc and Rd together with the nitrogen atom to which they are attached form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (OR f) (O) Rf, -S (O) 2 Rf, -ORf, -N (R f) (Rh), -C (O) R f, -C (O) OR f and -C (O) NR f R h;

Re é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo e cicloalquilo;Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg e Rh, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alquilo, alcenilo, arilo, arilalquilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, heterociclo, heterocicloalquilo, heteroarilo e heteroarilalquilo; em que cada Rf, Rg e Rh é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquilo), -NH2, -N(H)(alquilo), -N(alquilo)2, -S(alquilo), -S(O)(alquilo), -S02-alquilo, -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil- 23 ΕΡ 1 560 827/ΡΤ Ν(Η) (alquilo), -alquil-N(alquilo)2, -alquil-S(alquilo), -alquil-S(O)(alquilo), -alquil-S02-alquilo, -N(H)C(0)NH2, -C(Ο)OH, -C(Ο)Ο(alquilo), -C(Ο)alquilo, -C(0)NH2, -C(0)NH2, -C(O)N(H)(alquilo) e -C(O)N(alquilo)2; alternativamente, Rf e Rg juntamente com o átomo de carbono ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em cicloalquilo, cicloalcenilo e heterociclo; alternativamente, Rf e Rh juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em heterociclo e heteroarilo; em que cada um de heterociclo e heteroarilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquilo), -NH2, -N (H) (alquilo), -N(alquilo)2, -S(alquilo), -S(alquilo), -S(O)(alquilo), -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquilo), -alquil-S(alquilo), -alquil- S(O)(alquilo), -alquil-S02-alquilo, -alquil-N(alquilo)2, -N(H)C(0)NH2, -C(0)0H, -C(O)O(alquilo), -C(O)alquilo, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alquilo) e -C(O)N(alquilo)2;Rf, Rg and Rh at each occurrence are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle heteroaryl, heteroarylalkyl, -OH, -O (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (O) (alkyl), -S02 -alkyl-OH, -alkyl-O-alkyl, -alkyl-NH 2, -alkyl-, - (alkyl), -alkyl-N (alkyl) 2, -alkyl- S (alkyl), -alkyl-S (O) (alkyl), -alkyl-SO2-alkyl, -N (H) C (O) NH2, -C (Ο) OH, -C (Ο) , -C (Ο) alkyl, -C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2; alternatively, R f and Rg together with the carbon atom to which they are attached form a three to seven membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively Rf and Rh together with the nitrogen atom to which they are attached form a three to seven membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle (alkyl), -N (alkyl), -N (alkyl), -N (alkyl), -S (alkyl), -S (alkyl), -S (O) (alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkyl-NH2, -alkyl-N (H) (alkyl), -alkyl-S (alkyl), -alkyl-S (O) (alkyl) (O) 0, -C (O) O (alkyl), -C (O) -C (O) O- alkyl, -C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2;

Rk é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo, arilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo, heterocicloalquilo, nitroalquilo, RaRbN-alquil-, RaO-alquil-, RaRbNC(0)-, RaRbNC (0) alquilo, RaS-, RaS(0)-, RaS02-, RaS-alquil-, Ra(0)S- alquil-, RaS02-alquil-, Ra0C(0)-, RaOC (O) alquil-, RaC(0)- e RaC (0) alquil-, em que cada Rk é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil)(ORc), - (alquil) (NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)0Rc e -C (O) NRcRd; e méO, 1, 2, 3 ou 4; com a condição de que quando R4 é alcoxi, ariloxi, hidroxi ou ReS- e R5 é ReS02N (Rf) - e R6 é alquilo, alcenilo, alcinilo, 24 ΕΡ 1 560 827/ΡΤ halo, ciano, nitro, arilo, heteroarilo, heterocicloalquilo, -SRa, — S (O) Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C (O) Ra, -C(0)0Ra e -C(0)NRaRb, então R1 não é hidrogénio, alcenilo, alquilo, alcinilo, arilo, arilalcenilo, arilalquilo, cicloalquilo, (cicloalquil)alcenilo, (cicloalquil)alquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heterocicloalcenilo ou heterocicloalquilo.R1 is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycloalkyl, nitroalkyl, nitroalkyl, RaRbN-alkyl-, RaO- -, RaRbNC (O) -, RaRbNC (O) alkyl, RaS-, RaS (O) -, RaS02-, RaS-alkyl-, Ra (O) S- alkyl-, RaS02- alkyl-, Ra0C (O) - , RaOC (O) alkyl-, RaC (O) - and RaC (O) alkyl-, wherein each R k is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NR c R d), -SRC, -S (O) R c, - S (O) 2 R c, -OR c, -N (R c) (Rd), -C (O) R c, -C (O) O R c and -C (O) NR c R d; and m is 1, 2, 3 or 4; with the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS- and R5 is ReS02N (Rf) - and R6 is alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SR a, -S (O) Ra, -S (O) 2Ra, -ORk, -N (Ra) (Rb), -C (O) Ra, -C (O) O R a and -C (O) NR a R b, then R 1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycloalkenyl or heterocycloalkyl.

Por exemplo, o presente invento proporciona um composto de fórmula (Via) em que R4 é hidroxi.For example, the present invention provides a compound of formula (VIa) wherein R 4 is hydroxy.

Por exemplo, o presente invento proporciona um composto de fórmula (Via) em que R4 é hidroxi e R1 é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alcinilo, arilalcenilo, arilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalcenilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, RfCgC=N- e RbO-.For example, the present invention provides a compound of formula (VIa) wherein R4 is hydroxy and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkylalkyl, cycloalkylalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, RaRbN-, RaRbN- alkyl-, RaRbNC (O) alkyl-, RfCgC = N- and RbO-.

Por exemplo, o presente invento proporciona um composto de fórmula (Via) em que R4 é hidroxi e R1 é seleccionado do grupo que consiste em hidrogénio, alquil-Cl-C7, alcenil-Cl-C6, (cicloalquil-C3-C7)(alquil-Cl-C2)-, (cicloalcenil-C5-C6)-(alquil-Cl-C2)-, cicloalquil-C3-C7, fenilalquil-Cl-C2-, furil(alquil-Cl-C2)-, tienil(alquil-Cl-C2)-, fenil(alquil-C1-C2)-, piridinil(alquil-Cl-C2)-, tiazolil(alquil-Cl-C2)-, isoxazolil(alquil-Cl-C2)-, naftil(alquil-Cl-C2)-, benzotienil(alquil-Cl-C2)-, indolil(alquil-Cl-C2)-, fenil-N(H)(alquil-Cl-C6)-, (alquil-Cl-C7)O-, (cicloalquil-C3-C6)O-, ((fenil)alquil-Cl-C2)O-, fenil-CH=N-, NH2, (alquil-Cl-C7)N(H)-, (alcenil-cl-C7)N(H)-, (cicloalquil-C3-C7)N(H)-, ((cicloalquil-C3-C7)alquil-Cl-C2)N(H)-, ((fenil)alquil-Cl-C2)N(H)-, (tienilmetil)N(H)-, (tiazolilmetil)N(H)-, (furilmetil)N(H)-, (piridinilmetil)N(H)-, (tetra-hidropiran)N(H)-, (benzil)N(H)-, (tetra-hidronaftalenil)N(H)-, em que cada R1 é substituído com 0, 1, 2 ou 3 substituintes seleccionados do grupo que consiste em alquilo, hidroxi, oxo, halo, ciano, nitro, haloalquilo, hidroxilo, alcoxi, haloalcoxi, fenilo, piperazinilo, 25 ΕΡ 1 560 827/ΡΤ morfilinilo, carboxi, -C(O)O(alquilo), -ΝΗ2/ -ΝΗ(alquilo), -Ν(alquilo)2, -O-alquilo, -O-fenilo.For example, the present invention provides a compound of formula (VIa) wherein R 4 is hydroxy and R 1 is selected from the group consisting of hydrogen, C 1 -C 7 -alkyl, C 1 -C 6 -alkenyl, (C 3 -C 7 -cycloalkyl) C1-C2-alkyl) -, (C5-C6-cycloalkenyl) - (C1-C2-alkyl) -, C3-C7-cycloalkyl, phenylalkyl-C2-, furyl- (C1-C2-alkyl) -, (C1-C2-alkyl) -, phenyl (C1-C2-alkyl) -, pyridinyl (C1-C2-alkyl) -, thiazolyl- (C1-C2-alkyl) -, isoxazolyl- (C1-C2-alkyl) -, benzothienyl (C1-C2-alkyl) -, indolyl (C1-C2-alkyl) -, phenyl-N (H) (C1-C6-alkyl) O-, (C3-C6-cycloalkyl) O-, ((phenyl) C1-C2-alkyl) O-, phenyl-CH = N-, NH2, (C1-C7-alkyl) N (H) -, (alkenyl- (C 3 -C 7 -cycloalkyl) N (H) -, ((C 1 -C 7 -cycloalkyl-N (H) -, ((C 3-7 -cycloalkyl- N (H) -, (thienylmethyl) N (H) -, (tetrahydropyran) -N (H) -, (thienylmethyl) ) N (H) -, (benzyl) N (H) -, (tetrahydronaphthalenyl) N (H) -, wherein each R 1 is substituted with 0, 1, 2 or 3 substituents selected from the group (C 1 -C 10) alkyl, hydroxy, oxo, halo, cyano, nitro, haloalkyl, hydroxy, alkoxy, haloalkoxy, phenyl, piperazinyl, morpholinyl, carboxy, -Alkyl, -O (alkyl) 2, -O-alkyl, -O-phenyl.

Por exemplo, o presente invento proporciona um composto de fórmula (Via) em que R4 é hidroxi e R1 é seleccionado do grupo que consiste em fenilmetilo, feniletilo, alquilo C3, alquilo C4, alquilo C5, ciclopropilmetilo, ciclopropiletilo, ciclobutilmetilo, (5-clorotien-2-il)metil-, (alquilo C3)N(H)-, (alquilo C4)N(H)(alquilo C5)N(H)-, (ciclobutilo)N(H)- e (ciclopropilmetilo)N(H)For example, the present invention provides a compound of formula (VIa) wherein R4 is hydroxy and R1 is selected from the group consisting of phenylmethyl, phenylethyl, C3 alkyl, C4 alkyl, C5 alkyl, cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, (5- (cyclopropylmethyl) -N (H) -, (C 1 -C 4 alkyl) N (H) -, (H)

Noutra concretização, o presente invento proporciona um composto ou uma sua forma de sal, estereoisómero ou tautómero farmaceuticamente aceitável, em que: o composto corresponde à estrutura da fórmula (VIb):In another embodiment, the present invention provides a compound or a pharmaceutically acceptable salt, stereoisomer or tautomer form thereof, wherein: the compound corresponds to the structure of formula (VIb):

R1 é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alquilcarbonilalquilo, alquilsulfanilalquilo, alquilsulfinil-alquilo, alquilsulfonilalquilo, alcinilo, arilo, arilalcenilo, arilalquilo, arilsulfanilalquilo, arilsulfonilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, (cicloalquil)alcenilo, (cicloalquil)alquilo, formilalquilo, haloalcoxialquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heteroarilsulfonilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, nitroalquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, RaRbNC (O) O-alquil-, RaRbNC (0) NRc-alquil-, RfRgC=N- e RkO-, em que R1 é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, 26 ΕΡ 1 560 827/ΡΤ - (alquil) (ORc) , - (alquil) (NRcRe) r -SR0, -S(0)Rc, -S(0)2Ro, _ORc, -N(Rc)(Re), -C(0)Rc, -C(0)0Rc e -C(0)NRcRe; R4 é seleccionado do grupo que consiste em alcoxi, arilalcoxi, ariloxi, halo, hidroxi, RaRbN-, N3- e ReS-, em que R4 é substituído com 0, 1 ou 2 substituintes independentemente seleccionados do grupo que consiste em halo, nitro, ciano, -OH, -NH2 e -COOH; R5 é seleccionado do grupo que consiste em RaS02N(Rf)-, RaS02N(Rf) alquil-, RaRbNS02N (Rf) - e RaRbNS02N (Rf) alquil-; R6 é independentemente seleccionado em cada ocorrência do grupo que consiste em alquilo, alcenilo, alcinilo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, heterocicloalquilo, -(alquil)(ORk), -(alquil)(NRaRb), -SRa, —S (O) Ra, —S (O) 2Ra, —ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)0Ra e -C(O)NRaRb; em que cada R6 é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, haloalquilo, ciano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C (0) ORa, -C (O) NRaRb e -NC(0)Ra;R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkylcarbonylalkyl, alkylsulfinylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, (C 1 -C 6) alkenyl, (C 1 -C 6) cycloalkylalkyl, (C 1 -C 6) cycloalkylalkyl, (C 1 -C 6) cycloalkylalkyl, (C 1 -C 6) cycloalkylalkyl, (O) O-alkyl-, RaRbNC (O) NRc-alkyl-, RfRgC = N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkyl (Rc), -S (O) Rc, -S (O) 2Ro, -ORc, -N (Rc) ( Re), -C (O) R c, -C (O) O R c and -C (O) NR c R e; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3- and ReS-, wherein R4 is substituted with 0,1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 and -COOH; R5 is selected from the group consisting of RaS02N (Rf) -, RaS02N (Rf) alkyl-, RaRbNS02N (Rf) - and RaRbNS02N (Rf) alkyl-; R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocycloalkyl, - (alkyl) (OR k), - alkyl (NRaRb), -SRa, -S (O) Ra, -S (O) 2Ra, -ORk, -N (Ra) (Rb), -C (O) Ra, -C (O) C (O) NR a R b; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NR a R b, -SR a, -SOR a , -SO 2 R a, -C (O) OR a, -C (O) NR a R b and -N C (O) Ra;

Ra e Rb, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alcenilo, alquilo, alquilsulfanilalquilo, arilo, arilalcenilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, cicloalquilalcenilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilcarbonilo, nitroalquilo, RcRdN-, RcRdN-alquil-, RcRdNC (O) alquil-, RcS02-, RcS02-alquil-, RcC(0)-, RcC(O)alquil-, Rc0C(0)-, Rc0C(0)alquil-,Ra and Rb at each occurrence are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RcRdN- alkyl-, RcRdNC (O) alkyl-, RcSO2-, RcSO2- alkyl-, RcC (O) -, RcC (O) alkyl-, RcO ( 0) -, RcO (O) alkyl-,

RcRdN-alquilC (0) -, RcRdNC(0)-, RcRdNC (0) 0-alquil- eRcRdN-C (O) -, RcRdNC (O) -, RcRdNC (O) O-alkyl- and

RcRdNC (0) N (Re) alquil-, em que Ra e Rb são substituídos com 0, 1 ou 2 substituintes seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc) , - (alquil) (NRcRd) , -SRC, -S(0)Rc, -S(0)2Rc, -0RC, -N(Rc)(Rd), -C (0) Rc, -C (0) 0RC e -C(0)NRcRd; alternativamente, Ra e Rb, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionados do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e heterociclo são 27 ΕΡ 1 560 827/ΡΤ independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc), - (alquil) (NRcRd) , -alquil-S02NRcRd, -alquil- C (O) NRcRd, -SRc, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C (O) ORc e -C (O) NRcRd;Wherein R a and R b are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl (O), - (alkyl) (NR c R d), -SRC, -S (O) R c, -S (O) 2 R c, -OR 9, -N ((C 1 -C 4) alkyl, Rc) (Rd), -C (O) Rc, -C (O) O R C and -C (O) NR c R d; alternatively Ra and Rb, together with the nitrogen atom to which they are attached, form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently selected from the group consisting of: substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - ) (ORc), - (alkyl) (NRcRd), -alkyl-SO2NRcRd, -alkylC (O) NRcRd, -SRc, -S (O) Rc, -S (O) 2Rc, -ORc, -N Rc) (Rd), -C (O) Rc, -C (O) OR c and -C (O) NR c R d;

Rc e Rd, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -S02Rf, -C(0)NRfRh, -S02NRfRh, -C(0)0Rf, alcenilo, alquilo, alcinilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, arilo, arilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo e heterocicloalquilo; em que cada Rc e Rd é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf) , - (alquil) (NRfRh), -Sf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C (O) Rf, -C (O) ORf, -C(0)NRfRh, -C (O)N (H)NRfRh, -N (Re) C (0) ORf, -N (Re) S02NRfRh, -N (Re) C (O)NRfRh, -alquil-N (Re) C (O) ORf, -alquil-N (Re) S02NRfRh e -alquil-N (Re) C (O)NRfRh; alternativamente, Rc e Rd, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionados do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf) , - (alquil) (NRfRh) , -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N (Rf) (Rh) , -C (0) Rf, -C (O) ORf e -C (O) NRfRh;R c and Rd at each occurrence are independently selected from the group consisting of hydrogen, -NRf R h, -OR f, -CO (R f), -SR f, -SOR f, -SO 2 R f, -C (O) NR f R h, -SO 2 NR f R h, - C (O) O R f, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocycloalkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl (Rf), -Sf, -S (O) Rf, -S (O) 2 R f, -OR f, -N (R f) (Rh), - (C 1 -C 4) alkyl, C (O) Rf, -C (O) OR f, -C (O) NRf R h, -C (O) N (H) NR f R h, -N -N (Re) C (O) NRf R h, -alkyl-N (Re) C (O) OR f, -alkyl-N (Re) SO 2 NR f R h and -alkyl-N (Re) C (O) NR f R h; alternatively, Rc and Rd together with the nitrogen atom to which they are attached form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (OR f) (O) 2 R f, -OR f, -N (R f) (Rh), -C (O) R f, -C (O) OR f and -C (O) NR f R h;

Re é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo e cicloalquilo;Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg e Rh, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alquilo, alcenilo, arilo, arilalquilo, cicloalquilo, e cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, heterociclo, heterocicloalquilo, heteroarilo 28 ΕΡ 1 560 827/ΡΤ heteroarilalquilo; em que cada Rf, Rg e Rh é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do qrupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquilo), -NH2, -N(H)(alquilo), -N(alquilo)2, -S(alquilo), -S(0)(alquilo), -S02-alquilo, -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquilo), -alquil-N(alquilo)2, -alquil-S(alquilo), -alquil-S(0)(alquilo), -alquil-S02-alquilo, -N(H)C(O)NH2, -C(0)OH, -C(0)0(alquilo), -C(0)alquilo, -C(0)NH2, -C(0)NH2, -C(O)N(H)(alquilo) e -C(0)N(alquilo)2; alternativamente, Rf e Rg, juntamente com o átomo de carbono ao qual estão ligados, formam um anel de três a sete membros seleccionados do grupo que consiste em cicloalquilo, cicloalcenilo e heterociclo; alternativamente, Rf e Rh, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a sete membros seleccionados do grupo que consiste em heterociclo e heteroarilo; em que cada um dos heterociclo e heteroarilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -0(alquilo), -NH2, -N (H) (alquilo), -N(alquilo)2, -S(alquilo), -S(alquilo), -S(O)(alquilo), -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquilo), -alquil-S(alquilo), -alquil-S(0)(alquilo), -alquil-S02-alquilo, -alquil-N(alquilo)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alquilo), -C(O)alquilo, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alquilo) e -C(O)N(alquilo)2;Rf, Rg and Rh at each occurrence are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, and cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl, and heteroarylalkyl ; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle heteroaryl, heteroarylalkyl, -OH, -O (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (O) (alkyl), -S02 alkyl-OH, -alkyl-O-alkyl, -alkyl-NH 2, -alkyl-N (H) (alkyl), -alkyl-N (alkyl) 2, -alkyl-S (alkyl), - -S (O) (alkyl), -alkyl-SO2-alkyl, -N (H) C (O) NH2, -C (O) OH, -C (O) O (alkyl), -C (O) , -C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2; alternatively Rf and Rg together with the carbon atom to which they are attached form a three to seven membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively Rf and Rh, together with the nitrogen atom to which they are attached, form a three to seven membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle (alkyl), -N (alkyl), -N (alkyl), -N (alkyl), -S (alkyl), -S (alkyl), -S (O) (alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkyl-NH2, -alkyl-N (H) (alkyl), -alkyl-S (alkyl), -alkyl-S (O) (alkyl) alkyl, -N (alkyl) 2, -N (H) C (O) NH 2, -C (O) OH, -C (O) O (alkyl), -C (O) alkyl, -C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2;

Rh é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo, arilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo, heterocicloalquilo, nitroalquilo, RaRbN-alquil-, RaO-alquil-, RaRbNC(0)-, RaRbNC (0) alquilo, RaS-, RaS(0)-, RaS02-, RaS-alquil-, Ra(0)S-alquil-, RaS02-alquil-, RaOC(0)-, RaOC (O) alquil-, RaC(0)- e RaC (O) alquil-, em que cada Rk é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, 29 ΕΡ 1 560 827/ΡΤ nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxi-alquilo, - (alquil) (ORc), - (alquil) (NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)0Rc e -C(0)NRcRd; e méO, 1, 2, 3 ou 4.Rh is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycloalkyl, nitroalkyl, nitroalkyl, RaRbN-alkyl-, RaO- -, RaRbNC (O) -, RaRbNC (O) alkyl, RaS-, RaS (O) -, RaS02-, RaS-alkyl-, Ra (O) S- alkyl-, RaS02- alkyl-, RaOC (O) - , RaOC (O) alkyl-, RaC (O) - and RaC (O) alkyl-, wherein each R k is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo , halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NR c R d), -SR , -S (O) R c, -S (O) 2 R c, -OR c, -N (R c) (Rd), -C (O) R c, -C (O) O R c and -C (O) NR c R d; and meO, 1, 2, 3 or 4.

Por exemplo, o presente invento proporciona um composto de fórmula (VIb) em que R4 é hidroxi.For example, the present invention provides a compound of formula (VIb) wherein R4 is hydroxy.

Por exemplo, o presente invento proporciona um composto de fórmula (VIb) em que R4 é hidroxi e R1 é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alcinilo, arilalcenilo, arilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalcenilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, RfRgC=N- e RkO-.For example, the present invention provides a compound of formula (VIb) wherein R4 is hydroxy and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkylalkyl, cycloalkylalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, RaRbN-, RaRbN- alkyl-, RaRbNC (O) alkyl-, RfRgC = N- and RkO-.

Por exemplo, o presente invento proporciona um composto de fórmula (VIb) em que R4 é hidroxi e R1 é seleccionado do grupo que consiste em hidrogénio, alquilo-Cl-C7, alcenilo-C1-C6, (cicloalquil-C3-C7)(alquil-Cl-C2)-, (cicloalcenil-C5-C6)(alquil-Cl-C2)-, cicloalquilo-C3-C7, fenilalquil-Cl-C2-, furil(alquil-Cl-C2)-, tienil(alquil-Cl-C2)-, fenil(alquil-C1-C2)-, piridinil(alquil-Cl-C2)-, tiazolil(alquil-Cl-C2)-, isoxazolil(alquil-Cl-C2)-, naftil(alquil-Cl-C2), benzotienil(alquil-Cl-C2)-, indolil(alquil-Cl-C2)-, fenilN(H)(alquil-Cl-C6)-, (alquil-Cl-C7)O-, (cicloalquil-C3-C6)0-, ((fenil)alquil-Cl-C2)O-, fenil-CH=N-, NH2, (alquil-C1-C7)N(H)-, (alcenil-Cl-C7)N(H)-, (cicloalquil-C3-C7)N(H)-, ((cicloalquil-C3-C7)alquil-Cl-C2)N(H)-, ((fenil)alquil-Cl-C2)N(H)-, (tienilmetil)N(H)-, (tiazolilmetil)N(H)-, (furilmetil)N(H)-, (piridinilmetil)N(H)-, (tetra-hidropiran)N(H)-, (benzil)N(H)-, (tetra-hidronaftalenil)N(H)-, em que cada R1 é substituído com 0, 1, 2 ou 3 substituintes seleccionados do grupo que consiste em alquilo, hidroxi, oxo, halo, ciano, nitro, haloalquilo, hidroxilo, alcoxi, haloalcoxi, fenilo, piperazinilo, morfilinilo, carboxi, -C(0)O(alquilo), -nh2, -NH(alquilo), -N(alquilo)2, -O-alquilo, -0-fenilo. 30 ΕΡ 1 560 827/ΡΤFor example, the present invention provides a compound of formula (VIb) wherein R 4 is hydroxy and R 1 is selected from the group consisting of hydrogen, C 1 -C 7 -alkyl, C 1 -C 6 -alkenyl, (C 3 -C 7 -cycloalkyl) C1-C2-alkyl) -, (C5-C6-cycloalkenyl) (C1-C2-alkyl) -, C3-C7-cycloalkyl, phenylalkyl-C1-C2-, furyl- (C1-C2-alkyl) -, (C1-C2-alkyl) -, phenyl (C1-C2-alkyl) -, pyridinyl (C1-C2-alkyl) -, thiazolyl- (C1-C2-alkyl) -, isoxazolyl- (C1-C2-alkyl), benzothienyl (C1-C2-alkyl) -, indolyl (C1-C2-alkyl) -, phenylN (H) (C1-C6-alkyl) -, C3-C6 cycloalkyl) O -, ((phenyl) C1-C2-alkyl) O-, phenyl-CH = N-, NH2, (C1-C7-alkyl) N (H) -, (C1-7 alkenyl- (C1-C2-alkyl) -N (H) -, ((C3-C7-cycloalkyl-C7) N (H) -, ((C3-C7-cycloalkyl- N (H) -, (thienylmethyl) N (H) -, (thiazolylmethyl) N (H) -, (furylmethyl) N (H) -, (pyridinylmethyl) N (H) -, (tetrahydropyran) ) -, (benzyl) N (H) -, (tetrahydronaphthalenyl) N (H) -, wherein each R 1 is substituted with 0, 1, 2 or 3 substituents selected from the group (C 1 -C 4) alkyl, hydroxy, oxo, halo, cyano, nitro, haloalkyl, hydroxy, alkoxy, haloalkoxy, phenyl, piperazinyl, morpholinyl, carboxy, -C (O) O (alkyl), -NH 2, , -N (alkyl) 2, -O-alkyl, -O-phenyl. 30 ΕΡ 1 560 827 / ΡΤ

Por exemplo, ο presente invento proporciona um composto de fórmula (VIb) em que R4 é hidroxi e R1 é seleccionado do grupo que consiste em fenilmetilo, feniletilo, alquilo C3, alquilo C4, alquilo C5, ciclopropilmetilo, ciclopropiletilo, ciclobutilmetilo, (5-cloro-tien-2-il)metil-, (alquil-C3)N(H) (alquil-C4)N(H)(alquil-C5)N(H)(ciclobutil)N(H)- e (ciclopropilmetil)N(H)For example, the present invention provides a compound of formula (VIb) wherein R4 is hydroxy and R1 is selected from the group consisting of phenylmethyl, phenylethyl, C3 alkyl, C4 alkyl, C5 alkyl, cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, (5- (cyclopropylmethyl) -N (H) - (C 1 -C 4 -alkyl) N (H) - (C 1 -C 4 -alkyl) N (H)

Noutra concretização, o presente invento proporciona uma composição farmacêutica que compreende uma quantidade terapeuticamente eficaz de um ou mais compostos da fórmula (Vb), (Via) ou (VIb) ou uma sua forma de sal, estereoisómero ou tautómero farmaceuticamente aceitável, e um portador farmaceuticamente aceitável.In another embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of one or more compounds of formula (Vb), (Via) or (VIb) or a pharmaceutically acceptable salt, stereoisomer or tautomer form thereof, and a carrier pharmaceutically acceptable.

Numa concretização preferida da composição farmacêutica de acordo com o presente invento, a composição pode ainda compreender um ou mais agentes seleccionados do grupo que consiste em um modulador da imunidade do hospedeiro e um segundo agente antiviral.In a preferred embodiment of the pharmaceutical composition according to the present invention, the composition may further comprise one or more agents selected from the group consisting of a host immunity modulator and a second antiviral agent.

Por exemplo, cada um dos um ou mais moduladores da imunidade do hospedeiro é seleccionado do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão- beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante.For example, each of the one or more host immunity modulators is selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and a adjuvant.

Por exemplo, o segundo agente antiviral inibe a replicação de VHC pela inibição das funções celulares do hospedeiro associadas com a replicação virai.For example, the second antiviral agent inhibits HCV replication by inhibiting host cell functions associated with viral replication.

Por exemplo, o segundo agente antiviral inibe a replicação de VHC alvejando proteínas do genoma virai.For example, the second antiviral agent inhibits HCV replication by targeting proteins from the viral genome.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro e um ou mais segundos agentes antivirais.For example, the composition may further comprise one or more modulators of host immunity and one or more second antiviral agents.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa- 31For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-31

ΕΡ 1 560 827/PT peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um ou mais segundos agentes antivirais.Interferon-gamma, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant and one or more second antiviral agents.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um ou mais segundos agentes antivirais que inibe a replicação de VHC pela inibição das funções celulares do hospedeiro associadas com a replicação virai.For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant and one or more second antiviral agents which inhibits HCV replication by inhibiting the host cell functions associated with viral replication.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai.For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant and one or more second antiviral agents that inhibit HCV replication by targeting proteins from the viral genome.

Noutra concretização preferida da composição farmacêutica de acordo com o presente invento, a composição pode ainda compreender um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC.In another preferred embodiment of the pharmaceutical composition according to the present invention, the composition may further comprise an agent or combination of agents that treats or alleviates symptoms of HCV infection.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro e um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC, incluindo cirrose e inflamação do fígado.For example, the composition may further comprise one or more modulators of host immunity and an agent or combination of agents that treat or alleviate symptoms of HCV infection, including cirrhosis and inflammation of the liver.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC, incluindo cirrose e inflamação do figado.For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, and an agent or combination of agents that treat or alleviate symptoms of HCV infection, including cirrhosis and inflammation of the liver.

Por exemplo, a composição pode ainda compreender um ou mais segundos agentes antivirais e um agente ou combinação de 32 ΕΡ 1 560 827/ΡΤ agentes que tratam ou aliviam sintomas de infecção por VHC, incluindo cirrose e inflamação do figado.For example, the composition may further comprise one or more second antiviral agents and an agent or combination of agents that treat or alleviate symptoms of HCV infection, including cirrhosis and inflammation of the liver.

Por exemplo, a composição pode ainda compreender um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição das funções celulares do hospedeiro associadas com replicação virai e um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC, incluindo cirrose e inflamação do figado.For example, the composition may further comprise one or more second antiviral agents that inhibit HCV replication by inhibiting the cellular functions of the host associated with viral replication and an agent or combination of agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the liver.

Por exemplo, a composição pode ainda compreender um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai e um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC, incluindo cirrose e inflamação do figado.For example, the composition may further comprise one or more second antiviral agents that inhibit HCV replication by targeting viral genome proteins and an agent or combination of agents that treat or ameliorate symptoms of HCV infection, including cirrhosis and inflammation of the liver.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro, um ou mais segundos agentes antivirais e um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC, incluindo cirrose e inflamação do figado.For example, the composition may further comprise one or more modulators of host immunity, one or more second antiviral agents and an agent or combination of agents that treat or alleviate symptoms of HCV infection, including cirrhosis and inflammation of the liver.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais e um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC, incluindo cirrose e inflamação do fígado.For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents and an agent or combination of agents that treat or alleviate symptoms of HCV infection, including cirrhosis and inflammation of the liver.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição de funções celulares do hospedeiro associadas com replicação virai e um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC, incluindo cirrose e inflamação do fígado. 33 ΕΡ 1 560 827/ΡΤFor example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication by inhibiting host cell functions associated with viral replication, and an agent or combination of agents that treat or alleviate symptoms of HCV infection, including cirrhosis and inflammation of the liver. 33 ΕΡ 1 560 827 / ΡΤ

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai e um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC, incluindo cirrose e inflamação do fígado.For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication targeting viral genome proteins, and an agent or combination of agents that treat or alleviate symptoms of HCV infection, including cirrhosis and inflammation of the liver.

Noutra concretização preferida da composição farmacêutica de acordo com o presente invento, a composição pode ainda compreender um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).In another preferred embodiment of the pharmaceutical composition according to the present invention, the composition may further comprise one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the composition may further comprise one or more modulators of host immunity and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.

Por exemplo, a composição pode ainda compreender um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB) .For example, the composition may further comprise one or more second antiviral agents and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.

Por exemplo, a composição pode ainda compreender um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição de funções celulares do hospedeiro associadas com replicação virai e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB) .For example, the composition may further comprise one or more second antiviral agents that inhibit HCV replication by inhibiting host cell functions associated with viral replication and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, .

Por exemplo, a composição pode ainda compreender um ou mais segundos agentes antivirais que inibem a replicação de 34 ΕΡ 1 560 827/ΡΤ VHC alvejando proteínas do genoma virai e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the composition may further comprise one or more second antiviral agents that inhibit HCV replication targeting viral genome proteins and one or more agents that treat patients for disease caused by hepatitis B infection (HBV ).

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro, um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB) .For example, the composition may further comprise one or more host immunity modulators, one or more second antiviral agents and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição de funções celulares do hospedeiro associadas com replicação virai e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication by inhibiting host cell functions associated with viral replication and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication targeting viral genome proteins and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.

Preferivelmente, o agente que trata pacientes para doença causada por infecção por hepatite B (VHB) nas anteriormente 35 ΕΡ 1 560 827/ΡΤ mencionadas composições farmacêuticas pode ser seleccionado do grupo que consiste em L-desoxitimidina, adefovir, lamivudina e tenofovir.Preferably, the agent for treating disease caused by hepatitis B (HBV) infection in the above-mentioned pharmaceutical compositions may be selected from the group consisting of L-deoxythymidine, adefovir, lamivudine and tenofovir.

Noutra concretização preferida da composição farmacêutica de acordo com o presente invento, a composição pode ainda compreender um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).In another preferred embodiment of the pharmaceutical composition according to the present invention, the composition may further comprise one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the composition may further comprise one or more host immunity modulators and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionado do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection.

Por exemplo, a composição pode ainda compreender um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the composition may further comprise one or more second antiviral agents and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection.

Por exemplo, a composição pode ainda compreender um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição das funções celulares do hospedeiro associadas com replicação virai e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the composition may further comprise one or more second antiviral agents that inhibit HCV replication by inhibiting the cellular functions of the host associated with viral replication and one or more agents that treat patients for disease caused by human immunodeficiency virus infection ( HIV).

Por exemplo, a composição pode ainda compreender um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH). 36 ΕΡ 1 560 827/ΡΤFor example, the composition may further comprise one or more second antiviral agents that inhibit HCV replication by targeting viral genome proteins and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection. 36 ΕΡ 1 560 827 / ΡΤ

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro, um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the composition may further comprise one or more host immunity modulators, one or more second antiviral agents and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionado do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionado do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição das funções celulares do hospedeiro associadas com replicação virai e um ou mais agentes que tratam pacientes para doença causada por virus da imunodeficiência humana (VIH).For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication by inhibiting the cellular functions of the host associated with viral replication and one or more agents that treat patients for human immunodeficiency virus (HIV) disease.

Por exemplo, a composição pode ainda compreender um ou mais moduladores da imunidade do hospedeiro seleccionado do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH). O agente que trata pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH) nas anteriormente mencionadas composições farmacêuticas pode ser, por exemplo mas não limitado a, ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, 37 ΕΡ 1 560 827/ΡΤ tipranavir, TMC-114, fosamprenavir, zidovudina, lamivudina, didanosina, estavudina, tenofovir, zalcitabina, abacavir, efavirenz, nevirapina, delavirdina, TMC-125, L-870812, S-1360, enfuvirtida (T—20) ou T-1249 ou qualquer sua combinação. O presente invento também proporciona a utilização de qualquer das composições farmacêuticas anteriormente divulgadas para o fabrico de um medicamento para tratar ou prevenir infecção causada por um virus contendo ARN, pela administração a um paciente com necessidade de tal tratamento ou prevenção. O presente invento proporciona ainda a utilização de um ou mais compostos da fórmula (Vb), (Via) ou (VIb) ou seus sais, estereoisómeros ou tautómeros, para o fabrico de um medicamento para inibir a replicação de um virus contendo ARN através do contacto do referido virus com uma quantidade terapeuticamente eficaz do composto ou combinação. O presente invento ainda proporciona a utilização de um ou mais compostos da fórmula (Vb), (Via) ou (VIb) ou seus sais, estereoisómeros ou tautómeros, para o fabrico de um medicamento para tratar ou prevenir infecção causada por um virus contendo ARN, pela administração a um paciente com necessidade de tal tratamento ou prevenção de uma quantidade terapeuticamente eficaz do composto ou combinação.For example, the composition may further comprise one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication targeting viral genome proteins and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection. The agent treating patients for disease caused by human immunodeficiency virus (HIV) infection in the aforementioned pharmaceutical compositions may be, for example, but not limited to, ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, 37E 560 827 / ΡΤ tipranavir, TMC-114, fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125, L-870812, S-1360, enfuvirtide (T-20) or T-1249 or any combination thereof. The present invention also provides the use of any of the pharmaceutical compositions previously disclosed for the manufacture of a medicament for treating or preventing infection caused by an RNA-containing virus by administration to a patient in need of such treatment or prevention. The present invention further provides the use of one or more compounds of formula (Vb), (Via) or (VIb) or salts, stereoisomers or tautomers thereof, for the manufacture of a medicament for inhibiting replication of a virus containing RNA through contacting said virus with a therapeutically effective amount of the compound or combination. The present invention further provides the use of one or more compounds of formula (Vb), (Via) or (VIb) or salts, stereoisomers or tautomers thereof, for the manufacture of a medicament for treating or preventing infection caused by an RNA-containing virus , by administering to a patient in need of such treatment or prevention a therapeutically effective amount of the compound or combination.

Por exemplo, numa concretização das anteriores utilizações de acordo com o presente invento, o virus contendo ARN é virus da hepatite C.For example, in one embodiment of the foregoing uses according to the present invention, the RNA-containing virus is hepatitis C virus.

Nesta última concretização, a administração pode ainda compreender o passo de co-administração de um ou mais agentes seleccionados do grupo que consiste em um modulador da imunidade do hospedeiro e um segundo agente antiviral.In the latter embodiment, the administration may further comprise the step of co-administering one or more agents selected from the group consisting of a host immunity modulator and a second antiviral agent.

Por exemplo, cada modulador da imunidade do hospedeiro é independentemente seleccionado do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante. 38For example, each host immunity modulator is independently selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant. 38

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Por exemplo, o segundo agente antiviral inibe a replicação de VHC pela inibição das funções celulares do hospedeiro associadas com replicação virai.For example, the second antiviral agent inhibits HCV replication by inhibiting host cell functions associated with viral replication.

Por exemplo, o segundo agente antiviral inibe a replicação de VHC alvejando proteínas do genoma virai.For example, the second antiviral agent inhibits HCV replication by targeting proteins from the viral genome.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro e um ou mais segundos agentes antivirais.For example, the administration may further comprise the step of co-administering one or more modulators of host immunity and one or more second antiviral agents.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um ou mais segundos agentes antivirais.For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine, and a vaccine optionally comprising an antigen and an adjuvant and one or more second antiviral agents.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição das funções celulares do hospedeiro associadas com replicação virai.For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine, and a vaccine optionally comprising an antigen and an adjuvant and one or more second antiviral agents that inhibit HCV replication by inhibiting the host cell functions associated with viral replication.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai.For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine, and a vaccine optionally comprising an antigen and an adjuvant and one or more second antiviral agents that inhibit HCV replication by targeting proteins from the viral genome.

Numa concretização das utilizações do presente invento em que o vírus contendo ARN é um vírus de hepatite C, a administração pode ainda compreender o passo de co-administrar 39In one embodiment of the uses of the present invention wherein the RNA-containing virus is a hepatitis C virus, administration may further comprise the step of co-administering

ΕΡ 1 560 827/PT um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC, incluindo cirrose e inflamação do figado.And an agent or combination of agents that treats or alleviates symptoms of HCV infection, including cirrhosis and inflammation of the liver.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro e um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC incluindo cirrose e inflamação do figado.For example, administration may further comprise the step of co-administering one or more modulators of host immunity and an agent or combination of agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the liver.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um ou mais agentes que tratam ou aliviam sintomas de infecção por VHC incluindo cirrose e inflamação do figado.For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine, and a vaccine optionally comprising an antigen and an adjuvant and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the liver.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais segundos agentes antivirais e um ou mais agentes que tratam ou aliviam sintomas de infecção por VHC incluindo cirrose e inflamação do figado.For example, administration may further comprise the step of co-administering one or more second antiviral agents and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the liver.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição de funções celulares do hospedeiro associadas com replicação virai e um ou mais agentes que tratam ou aliviam sintomas de infecção por VHC incluindo cirrose e inflamação do figado.For example, administration may further comprise the step of co-administering one or more second antiviral agents that inhibit HCV replication by inhibiting host cell functions associated with viral replication and one or more agents that treat or alleviate symptoms of infection by HCV including cirrhosis and inflammation of the liver.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai e um ou mais agentes que tratam ou aliviam sintomas de infecção por VHC incluindo cirrose e inflamação do fígado.For example, administration may further comprise the step of co-administering one or more second antiviral agents that inhibit HCV replication by targeting viral genome proteins and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the virus. liver.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro, um ou mais segundos agentes antivirais e um ou mais agentes que tratam ou aliviam sintomas de infecção por VHC incluindo cirrose e inflamação do fígado. 40 ΕΡ 1 560 827/ΡΤFor example, administration may further comprise the step of co-administering one or more modulators of host immunity, one or more second antiviral agents and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the liver. 40 ΕΡ 1 560 827 / ΡΤ

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais e um ou mais agentes que tratam ou aliviam sintomas de infecção por VHC incluindo cirrose e inflamação do fígado.For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine, and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the liver.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionado do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição de funções celulares do hospedeiro associadas com replicação virai e um ou mais agentes que tratam ou aliviam sintomas de infecção por VHC incluindo cirrose e inflamação do fígado.For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication by inhibiting host cell functions associated with viral replication and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the liver.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionado do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai e um ou mais agentes que tratam ou aliviam sintomas de infecção por VHC incluindo cirrose e inflamação do fígado.For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication targeting viral genome proteins and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the liver.

Numa concretização das utilizações do presente invento em que o vírus contendo arn é um vírus de hepatite C, a administração pode ainda compreender o passo de co-administrar um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).In one embodiment of the uses of the present invention wherein the virus comprising ARN is a hepatitis C virus, administration may further comprise the step of co-administering one or more agents that treat patients to disease caused by hepatitis B (HBV) infection.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB). 41 ΕΡ 1 560 827/ΡΤFor example, the administration may further comprise the step of co-administering one or more modulators of host immunity and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection. 41 ΕΡ 1 560 827 / ΡΤ

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine, and a vaccine optionally comprising an antigen and an adjuvant and one or more agents treating patients for disease caused by hepatitis B (HBV) infection.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the administration may further comprise the step of co-administering one or more second antiviral agents and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição de funções celulares do hospedeiro associadas com replicação virai e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the administration may further comprise the step of co-administering one or more second antiviral agents that inhibit HCV replication by inhibiting host cell functions associated with viral replication and one or more agents that treat patients for disease caused by infection by hepatitis B (HBV).

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the administration may further comprise the step of co-administering one or more second antiviral agents that inhibit HCV replication by targeting viral genome proteins and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, .

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro, um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the administration may further comprise the step of co-administering one or more modulators of host immunity, one or more second antiviral agents and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB). 42For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine, and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection. 42

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição de funções celulares do hospedeiro associadas com replicação virai e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine, and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication by inhibiting host cell functions associated with viral replication and one or more agents that treat patients for disease caused by hepatitis B infection (HBV ).

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionado do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai e um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication targeting viral genome proteins and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.

Um agente que trata pacientes com doença causada por infecção por hepatite B (VHB) pode ser, por exemplo mas não limitado a, L-desoxitimidina, adefovir, lamivudina ou tenofovir ou qualquer sua combinação.An agent treating patients with a disease caused by hepatitis B (HBV) infection may be, for example but not limited to, L-deoxythymidine, adefovir, lamivudine or tenofovir or any combination thereof.

Numa concretização das utilizações do presente invento em que o vírus contendo ARN é um vírus de hepatite C, a administração pode ainda compreender o passo de co-administrar um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).In one embodiment of the uses of the present invention wherein the RNA-containing virus is a hepatitis C virus, administration may further comprise the step of co-administering one or more agents that treat patients to disease caused by human immunodeficiency virus ).

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the administration may further comprise the step of co-administering one or more modulators of host immunity and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão- 43 ΕΡ 1 560 827/ΡΤ gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon- A cytokine and a vaccine optionally comprising an antigen and an adjuvant and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the administration may further comprise the step of co-administering one or more second antiviral agents and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição de funções celulares do hospedeiro associadas com replicação virai e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the administration may further comprise the step of co-administering one or more second antiviral agents that inhibit HCV replication by inhibiting host cell functions associated with viral replication and one or more agents that treat patients for disease caused by infection human immunodeficiency virus (HIV).

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the administration may further comprise the step of co-administering one or more second antiviral agents that inhibit HCV replication by targeting viral genome proteins and one or more agents that treat patients for disease caused by human immunodeficiency virus infection ( HIV).

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro, um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the administration may further comprise the step of co-administering one or more modulators of host immunity, one or more second antiviral agents and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) .

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH).For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine, and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection.

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do 44 ΕΡ 1 560 827/ΡΤ hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC pela inibição das funções celulares do hospedeiro associadas com replicação virai e um ou mais agentes que tratam pacientes para doença causada por virus da imunodeficiência humana (VIH).For example, the administration may further comprise the step of co-administering one or more host Î ± 1 560 827 / imun immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon a cytokine and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication by inhibiting the host cell functions associated with viral replication and one or more agents that treat patients for disease caused human immunodeficiency virus (HIV).

Por exemplo, a administração pode ainda compreender o passo de co-administrar um ou mais moduladores da imunidade do hospedeiro seleccionados do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante, um ou mais segundos agentes antivirais que inibem a replicação de VHC alvejando proteínas do genoma virai e um ou mais agentes que tratam pacientes para doença causada por infecção por vírus da imunodeficiência humana (VIH) e um portador farmaceuticamente aceitável.For example, the administration may further comprise the step of co-administering one or more host immunity modulators selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine, and a vaccine optionally comprising an antigen and an adjuvant, one or more second antiviral agents that inhibit HCV replication targeting viral genome proteins and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection and a carrier pharmaceutically acceptable.

Um agente que trata pacientes de uma doença causada por infecção por vírus da imunodeficiência humana (VIH) pode ser, por exemplo mas não limitado a, ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudina, lamivudina, didanosina, estavudina, tenofovir, zalcitabina, abacavir, efavirenz, nevirapina, delavirdina, TMC-125, L-870812, S-1360, enfuvirtida (T—20) ou T-1249 ou qualquer sua combinação.An agent treating patients of a disease caused by human immunodeficiency virus (HIV) infection may be, for example, but not limited to, ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir , zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125, L-870812, S-1360, enfuvirtide (T-20) or T-1249 or any combination thereof.

Noutra concretização, o presente invento proporciona um composto que possui a fórmula (IX)In another embodiment, the present invention provides a compound having the formula (IX)

(IX) ou uma sua forma de sal, tautómero ou estereoisómero farmaceuticamente aceitável, em que 45 ΕΡ 1 560 827/ΡΤ R1 é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alquilcarbonilalquilo, alquilsulfanilalquilo, alquilsulfinilalquilo, alquilsulfonilalquilo, alcinilo, arilo, arilalcenilo, arilalquilo, arilsulfanilalquilo, arilsulfonilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, (cicloalquil)alcenilo, (cicloalquil)alquilo, formilalquilo, haloalcoxialquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heteroarilsulfonilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, nitroalquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, RaRbNC (O) O-alquil-, 45 ΕΡ 1 560 827/ΡΤ RaRbNC(0)NRc-alquil-, RfRgC=N-(IX) or a pharmaceutically acceptable salt, tautomer or stereoisomer form thereof, wherein R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, aralkylalkyl, aralkylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, (cycloalkyl) alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl (O) alkyl-, RaRbNC (O) O-alkyl-, NRc-alkyl-, RfRgC = N (R), NRa -

RkO-, em que independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (OR) , - (alquil) (NRcRe), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Re), -C (O) Rc, -C (0) 0RC e -C(0)NRcRe; R2 e R3, juntamente com os átomos de carbono aos quais estão ligados formam um anel de cinco ou seis membros seleccionado do grupo que consiste em arilo, cicloalquilo, heteroarilo e heterociclo, em que o arilo, cicloalquilo, heteroarilo e heterociclo é opcionalmente substituído com (R6)m; R6 é independentemente seleccionado em cada ocorrência do grupo que consiste em alquilo, alcenilo, alcinilo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, heterocicloalquilo, -(alquil)(ORk), -(alquil)(NRaRb), -SRa, -S (O) Ra, — S (0) 2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)0Ra e -C(O)NRaRb; em que cada R6 é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, haloalquilo, ciano, nitro, -ORa, -NRaRb, -SRa, -S0Ra, -S02Ra, -C (0) 0Ra, -C (0) NRaRb e -NC (0) Ra;R 2 -O-, wherein independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl (Rc) (-SR), -S (O) Rc, -S (O) 2 R c, -OR c, -N (R c) (R e), -C (O) R c, -C (O) OR C, and -C (O) NR c R e; R2 and R3 together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein the aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R 6) m; R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocycloalkyl, - (alkyl) (OR k), - alkyl (NRaRb), -SRa, -S (O) Ra, -S (O) 2Ra, -ORk, -N (Ra) (Rb), -C (O) Ra, -C (O) C (O) NR a R b; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NR a R b, -SR a, -SOR , -SO 2 R a, -C (O) O R a, -C (O) NR a R b and -N C (O) Ra;

Ra e Rb, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alcenilo, alquilo, alquilsulfanilalquilo, arilo, arilalcenilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, cicloalquilalcenilo, 46 ΕΡ 1 560 827/ΡΤ formilalquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilcarbonilo, nitroalquilo, RcRdN-, RcRdN-alquil-, RcRdNC (0) alquil-, RcS02-, RcS02-alquil-, RcC(0)RcC(0)alquil-, Rc0C(0)-, Rc0C(0)alquil-, RcRdN-alquilC (0) RcRdNC(0)-, RcRdNC (0) 0-alquil- eRa and Rb at each occurrence are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, (O) RcC (O) RcC (O) RcS02-, RcS02 -alkyl-, RcC (O) RcC (O) RcC (O) Rc, alkyl, RcC (O) -, RcC (O) alkyl-, RcRdN-C (O) RcRdNC (O) -, RcRdNC (O) O-alkyl- and

RcRdNC(0)N(R)alquil-, em que Ra e Rd são substituídos com 0, 1 ou 2 substituintes seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (OR) , - (alquil) (NRcRd) , -sic, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C (0) Rc, -C (0) 0RC e -C(0)NRcRd; alternativamente, Ra e Rd, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (0Ro), - (alquil) (NRcRd), -alquil-S02NRcRd, -alquil- C (0) NRcRd, -SRc, -S(0)Rc, -S(0)2Rc, -0RC, -N(Rc)(Rd), -C(0)Rc, C (0) 0RC e -C (0) NRcRd;Wherein R a and Rd are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl (OR), - (alkyl) (NR c R d), -sic, -S (O) R c, -S (O) 2 R c, -OR c, -N ( Rc) (Rd), -C (O) Rc, -C (O) O R C and -C (O) NR c R d; alternatively Ra and Rd together with the nitrogen atom to which they are attached form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (Rc) (Rc), -S (O) 2 Rc, -OR, -N (Rc) (Rd), -N (Rc) -C (O) R c, C (O) O R C and -C (O) NR c R d;

Rc e Rd, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, -NRfPh, -0Rf, -C0(Rf), -SRf, -S0Rf, -S02Rf, -C (0) NRfRh, -S02NR£Rh, -C(0)0Rf, alcenilo, alquilo, alcinilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, arilo, arilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo e heterocicloalquilo; em que cada Rc e Rd é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (0Rf) , - (alquil) (NRfRh) , -SRf, -S(0)Rf, -S(0)2Rf, -0Rf, -N(Rf)(Rh, ), -C (O) Rf, -C (0) 0Rf, -C(0)NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N(R)S02NRfRh, -N (Re) C (0) NRfRh, -alquil-N (Re) C (0) 0Rf, -alquil-N (Re) S02NRfRh e -alquil-N (Re) C (0) NRfRh; 47 ΕΡ 1 560 827/ΡΤ alternativamente, Rc e Rd, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf) , - (alquil) (NRfRh) , -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C (O) Rf, -C (O) ORf e -C (O) NRfRh;Rc and Rd at each occurrence are independently selected from the group consisting of hydrogen, -NRfPh, -OR1, -C0 (Rf), -SRf, -S0Rf, -SO2 Rf, -C (O) NRfRh, -S02 NR6 Rh , -C (O) ORF, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocycloalkyl groups; wherein each Rc and Rd is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl (R f), -S (O) Rf, -S (O) 2 R f, -O R f, -N (R f) (Rh), - (C 1 -C 4) alkyl, , -C (O) Rf, -C (O) O R f, -C (O) NRf R h, -C (O) N (H) NR f R h, -N (R e) , -N (Re) C (O) NR f R h, -alkyl-N (Re) C (O) O R f, -alkyl- N (Re) SO 2 NR f R h and -alkyl- N (Re) C (O) NR f R h; Alternatively, R c and Rd, together with the nitrogen atom to which they are attached, form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and the heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - alkyl (ORf), - (alkyl) (NRfRh), -SRf, -S (O) Rf, -S (O) 2Rf, -ORf, -N (Rf) (Rh), -C (O) R f, -C (O) OR f and -C (O) NR f R h;

Re é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo e cicloalquilo;Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg e Rh, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alquilo, alcenilo, arilo, arilalquilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, heterociclo, heterocicloalquilo, heteroarilo e heteroarilalquilo; em que cada Rf, Rg e Rh é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquilo), -NH2, -N(H)(alquilo), -N(alquilo)2, -S(alquilo), -S(O)(alquilo), -S02alquilo, -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquilo), -alquil-N(alquilo)2, -alquil-S(alquilo), -alquil-S(O)(alquilo), -alquil-S02-alquilo, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alquilo), -C(O)alquilo, -C(0)NH2, -C(0)NH2, -C(O)N(H)(alquilo) e -C(O)N(alquilo)2; alternativamente, Rf e Rg juntamente com o átomo de carbono ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em cicloalquilo, cicloalcenilo e heterociclo; alternativamente, Rf e Rh juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em heterociclo e heteroarilo; em que cada um de heterociclo e heteroarilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, 48 ΕΡ 1 560 827/ΡΤ heteroarilo, heteroarilalquilo, -OH, -O(alquilo), -NH2, -N(H)(alquilo), -N(alquilo)2, -S(alquilo), -S(alquilo), -S(O)(alquilo), -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquilo), -alquil-S(alquilo), -alquil- S(O)(alquilo), -alquil-S02-alquilo, -alquil-N(alquilo)2, -N(H)C(0)NH2, -C(0)0H, -C(O)O(alquilo), -C(O)alquilo, -C(0)NH2, -C(0)NH2, -C(0)N(H) (alquilo) e -C(0)N(alquilo)2;Rf, Rg and Rh at each occurrence are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle heteroaryl, heteroarylalkyl, -OH, -O (alkyl), -NH 2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (O) (alkyl), -SO 2 alkyl alkyl-OH-alkyl-O-alkyl, -alkyl-NH 2, -alkyl-N (H) (alkyl), -alkyl-N (alkyl) 2, -alkyl-S (alkyl), -alkyl-S (O) (alkyl), -alkyl-SO2-alkyl, -N (H) C (O) NH2, -C (O) OH, -C (O) O (alkyl), -C (O) alkyl, - C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2; alternatively, R f and Rg together with the carbon atom to which they are attached form a three to seven membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively Rf and Rh together with the nitrogen atom to which they are attached form a three to seven membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle , 48 ΕΡ 1 560 827 ΡΤ heteroaryl, heteroarylalkyl, -OH, -O (alkyl), -NH 2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S ), -S (O) (alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkyl-NH2, -alkyl-N (H) (alkyl), -alkyl-S (alkyl), -alkyl- S (O) (alkyl), -alkyl-SO2-alkyl, -alkyl-N (alkyl) 2, -N (H) C (O) NH2, -C (O) OH, -C (O) O ), -C (O) alkyl, -C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2;

Rk é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo, arilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo, heterocicloalquilo, nitroalquilo, RaRbN-alquil-, RaO-alquil-, RaRbNC(0)-, RaRbNC(0) alquilo, RaS-, RaS(0)-, RaS02-, RaS-alquil-, Ra(0)S- alquil-, RaS02alquil-, Ra0C(0)-, RaOC (O) alquil-, RaC(0)- e RaC (0) alquil-, em que cada Rk é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (ORc), -(alquil)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, —N (Rc) (Rd) , -C(0)Rc, -C(0)0Rc e -C (O) NRcRd; méO, 1, 2, 3 ou 4; e R11 e R12 são independentemente seleccionados do grupo que consiste em alquilo, alcenilo e alcinilo.R1 is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycloalkyl, nitroalkyl, nitroalkyl, RaRbN-alkyl-, RaO- -, RaRbNC (O) -, RaRbNC (O) alkyl, RaS-, RaS (O) -, RaS02-, RaS-alkyl-, Ra (O) S- alkyl-, RaS02- alkyl, Ra0C (O) (O) alkyl-, RaC (O) - and RaC (O) alkyl-, wherein each R k is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo alkyl, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NR c R d), -SRC, -S (O) R c, -S 0) 2 R c, -OR c, -N (R c) (Rd), -C (O) R c, -C (O) O R c and -C (O) NR c R d; m is 1, 2, 3 or 4; and R 11 and R 12 are independently selected from the group consisting of alkyl, alkenyl and alkynyl.

Compostos exemplares da fórmula (IX) ou uma sua forma de sal, tautómero ou estereoisómero farmaceuticamente aceitável, incluem, mas não estão limitados aos seguintes: l-benzil-3-(bis(metiltio)metileno)-lH-quinolina-2, 4(1H, 3H-diona; 3-[bis(metiltio)metileno]-1-butil-l, 8-naftiridina-2, 4(1H, 3H)-diona; 3-[bis(metiltio)metileno]-1-(1,3-dioxo-l, 3-di-hidro-2H-isoindol-2-il)quinolina-2, 4(1H, 3H)-diona; 3-[bis(metiltio)metileno]-1-[(ciclopropilmetil)amino]-quinolina-2,4(1H, 3H)-diona; e 3-[bis(metiltio)metileno]-1-(ciclobutilamino)quinolina-2,4(1H,3H) -diona. 49 ΕΡ 1 560 827/ΡΤExemplary compounds of formula (IX) or a pharmaceutically acceptable salt, tautomer or stereoisomer form thereof include, but are not limited to, the following: 1-benzyl-3- (bis (methylthio) methylene) -1H-quinoline-2,4 (1H, 3H-dione; 3- [bis (methylthio) methylene] -1-butyl-1,8-naphthyridine-2,4 (1H, 3H) -dione; 3- [bis (methylthio) methylene] -1- (1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl) quinoline-2,4 (1H, 3H) -dione; 3- [bis (methylthio) methylene] -1 - [( cyclopropylmethyl) amino] -quinoline-2,4 (1H, 3H) -dione; and 3- [bis (methylthio) methylene] -1- (cyclobutylamino) quinoline-2,4 (1H, 3H) -dione. 560 827 / ΡΤ

Os compostos do invento podem compreender átomos de carbono substituídos assimetricamente. Como resultado, pretende-se que todos os estereoisómeros dos compostos do invento sejam incluídos no invento, incluindo misturas racémicas, misturas de diastereoisómeros, misturas de enantiómeros, assim como isómeros ópticos individuais, incluindo enantiómeros e diastereoisómeros simples dos compostos do invento substancialmente isentos dos seus enantiómeros ou outros diastereoisómeros. Por &quot;substancialmente isento&quot; pretende-se referir mais do que cerca de 80% isento de outros enantiómeros ou diastereoisómeros do composto, mais preferivelmente mais do que cerca de 90% isento de outros enantiómeros ou diastereoisómeros do composto, ainda mais preferivelmente mais do que cerca de 95% isento de outros enantiómeros ou diastereoisómeros do composto, ainda mais altamente e preferivelmente mais do que cerca de 98% isento de outros enantiómeros ou diastereoisómeros do composto e muito preferivelmente mais do que cerca de 99% isento de outros enantiómeros ou diastereoisómeros do composto.The compounds of the invention may comprise asymmetrically substituted carbon atoms. As a result, it is intended that all stereoisomers of the compounds of the invention are included in the invention, including racemic mixtures, mixtures of diastereoisomers, mixtures of enantiomers, as well as individual optical isomers, including single enantiomers and diastereomers of the compounds of the invention substantially free of their enantiomers or other diastereoisomers. &Quot; substantially exempt &quot; more than about 80% free of other enantiomers or diastereoisomers of the compound, more preferably more than about 90% free of other enantiomers or diastereoisomers of the compound, more preferably more than about 95% free of other enantiomers or diastereoisomers of the compound, even more highly and preferably more than about 98% free of other enantiomers or diastereoisomers of the compound and most preferably more than about 99% free of other enantiomers or diastereoisomers of the compound.

Além disso, pretende-se que também estejam incluídos neste invento os compostos que compreendem os possíveis isómeros geométricos de duplas ligações carbono-carbono e duplas ligações carbono-azoto.In addition, it is intended that also included in this invention are compounds which comprise the possible geometric isomers of carbon-carbon double bonds and carbon-nitrogen double bonds.

Os estereoisómeros individuais dos compostos deste invento podem ser preparados por qualquer um de diversos métodos que estão dentro do conhecimento da pessoa competente na matéria. Estes métodos incluem síntese estereospecífica, separação cromatográfica de diastereoisómeros, resolução cromatográfica de enantiómeros, conversão de enantiómeros numa mistura enantiomérica em diastereoisómeros e posterior separação cromatográfica dos diastereoisómeros e regeneração dos enantiómeros individuais, resolução enzimática e outros similares. A síntese estereospecífica envolve a utilização de materiais de partida quirais apropriados e reacções de síntese que não causem a racemização ou inversão da estereoquímica nos centros quirais. 50 ΕΡ 1 560 827/ΡΤThe individual stereoisomers of the compounds of this invention may be prepared by any of a number of methods which are within the knowledge of the person skilled in the art. These methods include stereospecific synthesis, chromatographic separation of diastereoisomers, chromatographic resolution of enantiomers, conversion of enantiomers into an enantiomeric mixture into diastereoisomers and subsequent chromatographic separation of the diastereoisomers and regeneration of the individual enantiomers, enzymatic resolution and the like. Stereospecific synthesis involves the use of appropriate chiral starting materials and synthesis reactions that do not cause racemization or reversal of stereochemistry at the chiral centers. 50 ΕΡ 1 560 827 / ΡΤ

As misturas diastereoisoméricas dos compostos resultantes de uma reacção de síntese podem frequentemente ser separadas por técnicas cromatográficas que são bem conhecidas das pessoas competentes na matéria. A resolução cromatográfica de enantiómeros pode ser conseguida em resinas de cromatográfia quirais. As colunas de cromatográfia contendo resinas quirais estão comercialmente disponíveis. Na prática, o racemato é colocado em solução e carregado na coluna contendo a fase estacionária quiral. Os enantiómeros são depois separados por HPLC. A resolução de enantiómeros também pode ser conseguida por conversão dos enantiómeros numa mistura em diastereoisómeros por reacção com auxiliares quirais. Os resultantes diastereoisómeros podem depois ser separados por cromatográfia em coluna. Esta técnica é especialmente útil quando os compostos a separar contêm um grupo carboxilo, amino ou hidroxilo que formará um sal ou ligação covalente com o auxiliar quiral. Aminoácidos quiralmente puros, ácidos carboxílicos orgânicos ou ácidos organossulfónicos são especialmente úteis como auxiliares quirais. Assim que os diastereoisómeros são separados por cromatográfia, os enantiómeros individuais podem ser regenerados. Frequentemente os auxiliares quirais podem ser recuperados e reutilizados novamente.Diastereoisomeric mixtures of the compounds resulting from a synthetic reaction can often be separated by chromatographic techniques which are well known to those skilled in the art. The chromatographic resolution of enantiomers can be achieved in chiral chromatographic resins. Chromatography columns containing chiral resins are commercially available. In practice, the racemate is placed in solution and loaded onto the column containing the chiral stationary phase. The enantiomers are then separated by HPLC. The resolution of enantiomers can also be achieved by conversion of the enantiomers into a mixture in diastereoisomers by reaction with chiral auxiliaries. The resulting diastereoisomers can then be separated by column chromatography. This technique is especially useful when the compounds to be separated contain a carboxyl, amino or hydroxyl group which will form a salt or covalent bond with the chiral auxiliary. Chirally pure amino acids, organic carboxylic acids or organosulfonic acids are especially useful as chiral auxiliaries. Once the diastereoisomers are separated by chromatography, the individual enantiomers can be regenerated. Frequently the chiral auxiliaries can be recovered and reused again.

As enzimas, tais como esterases, fosfatases e lipases, podem ser úteis para a resolução de derivados dos enantiómeros numa mistura enantiomérica. Por exemplo, pode ser preparado um derivado éster de um grupo carboxilo nos compostos a separar. Certas enzimas irão hidrolisar selectivamente apenas um dos enantiómeros na mistura. Depois, o ácido enantiomericamente puro resultante pode ser separado do éster não hidrolisado.Enzymes, such as esterases, phosphatases and lipases, may be useful for the resolution of enantiomeric derivatives in an enantiomeric mixture. For example, an ester derivative of a carboxyl group may be prepared in the compounds to be separated. Certain enzymes will selectively hydrolyze only one of the enantiomers in the mixture. Then, the resulting enantiomerically pure acid can be separated from the non-hydrolyzed ester.

Os presentes compostos podem exibir o fenómeno de tautomerismo ou isomerismo estrutural. Como as Figuras neste fascículo apenas podem representar uma possível forma tautomérica ou isomérica estrutural, deve ser entendido que o invento engloba qualquer forma tautomérica ou isomérica estrutural; ou suas misturas, que possuem a capacidade para 51 ΕΡ 1 560 827/ΡΤ inibir a hepatite C e não estando limitado a qualquer uma forma tautomérica ou isomérica estrutural utilizada nas Figuras.The present compounds may exhibit the phenomenon of tautomerism or structural isomerism. As the Figures in this specification may only represent a possible structural tautomeric or isomeric form, it is to be understood that the invention encompasses any structural tautomeric or isomeric form; or mixtures thereof, which have the ability to inhibit hepatitis C and are not limited to any structural tautomeric or isomeric form used in the Figures.

Além disso, pretende-se que solvatos e hidratos dos compostos do invento sejam incluídos neste invento.In addition, solvates and hydrates of the compounds of the invention are intended to be included in this invention.

Quando qualquer variável (por exemplo R1, R2, R3, m, n, etc.) ocorre mais do que uma vez em qualquer substituinte ou no composto do invento ou qualquer outra fórmula aqui apresentada, a sua definição em cada ocorrência é independente da sua definição em cada outra ocorrência. Além disso, combinações de substituintes são permissíveis apenas se tais combinações resultam em compostos estáveis. Compostos estáveis são compostos que podem ser isolados num grau útil de pureza a partir de uma mistura reaccional.When any variable (for example R1, R2, R3, m, n, etc.) occurs more than once in any substituent or in the compound of the invention or any other formula set forth herein, its definition at each occurrence is independent of its definition in each other occurrence. In addition, combinations of substituents are permissible only if such combinations result in stable compounds. Stable compounds are compounds which can be isolated to a useful degree of purity from a reaction mixture.

Os compostos do presente invento podem existir como sais farmaceuticamente aceitáveis. 0 termo &quot;sal farmaceuticamente aceitável&quot; tal como aqui utilizado, representa sais de ácidos ou bases ou formas zwitteriónicas dos compostos do presente invento que são solúveis ou dispersáveis em água ou óleo, que são adequados para tratamento de doenças sem indevida toxicidade, irritação e resposta alérgica; que são mensuráveis com uma razão beneficio/risco razoável e que são eficazes para a sua utilização pretendida. Os sais podem ser preparados durante o isolamento e purificação final dos compostos ou separadamente por reacção de um grupo básico (por exemplo, um grupo contendo azoto) com um ácido adequado. Sais de adição de ácido representativos incluem acetato, adipato, alginato, citrato; aspartato, benzoato, benzenossulfonato, bissulfato, butirato, canforato, canforsulfonato, digluconato, glicerofosfato, hemissulfato, heptanoato, hexanoato, formato, fumarato, cloridrato, bromidrato, iodidrato, 2-hidroxietano-sulfonato, lactato, maleato, mesitilenossulfonato, metanossulfonato, naftilenossulfonato, nicotinato, 2-naftalenossulfonato, oxalato, pamoato, pectinato, persulfato, 3-fenilproprionato, picrato, pivalato, propionato, succinato, tartarato, tricloroacetato, trifluoroacetato, fosfato, glutamato, bicarbonato, para-toluenossulfonato e undecanoato. De igual modo, os grupos amino nos compostos do presente invento podem ser quaternizados com cloretos, 52 ΕΡ 1 560 827/ΡΤ brometos e iodetos de metilo, etilo, propilo e butilo; sulfatos de dimetilo, dietilo, dibutilo e diamilo; cloretos, brometos e iodetos de decilo, laurilo, miristilo e esterilo; e brometos de benzilo e fenetilo. Exemplos de ácidos que podem ser empregues para formar sais de adição farmaceuticamente aceitáveis incluem ácidos inorgânicos tais como ácidos clorídrico, bromídrico, sulfúrico e fosfórico, e ácidos orgânicos tais como oxálico, maleico, succínico e cítrico.The compounds of the present invention may exist as pharmaceutically acceptable salts. The term &quot; pharmaceutically acceptable salt &quot; as used herein, represents salts of acids or bases or zwitterionic forms of the compounds of the present invention which are soluble or dispersible in water or oil, which are suitable for treatment of diseases without undue toxicity, irritation and allergic response; which are measurable at a reasonable benefit / risk ratio and which are effective for their intended use. The salts may be prepared during the final isolation and purification of the compounds or separately by reaction of a basic group (for example, a nitrogen-containing group) with a suitable acid. Representative acid addition salts include acetate, adipate, alginate, citrate; aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, formate, fumarate, hydrobromide, hydroiodide, hydroiodide, 2-hydroxyethanesulfonate, lactate, maleate, mesitylenesulfonate, methanesulfonate, naphthylenesulfonate, nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylproprionate, picrate, pivalate, propionate, succinate, tartrate, trichloroacetate, trifluoroacetate, phosphate, glutamate, bicarbonate, para-toluenesulfonate and undecanoate. Also, the amino groups in the compounds of the present invention may be quaternized with chlorides, methyl, ethyl, propyl and butyl bromides and iodides; dimethyl, diethyl, dibutyl and diamyl sulfates; chlorides, bromides and iodides of decyl, lauryl, myristyl and esteryl; and benzyl and phenethyl bromides. Examples of acids that may be employed to form pharmaceutically acceptable addition salts include inorganic acids such as hydrochloric, hydrobromic, sulfuric and phosphoric acids, and organic acids such as oxalic, maleic, succinic and citric.

Os sais de adição básicos podem ser preparados durante o isolamento e purificação final dos compostos por reacção de um grupo acídico (por exemplo, um grupo carboxi ou um enol) com uma base adequada tal como o hidróxido, carbonato ou bicarbonato de um catião metálico ou com amoníaco ou uma amina orgânica primária, secundária ou terciária. Os catiões de sais farmaceuticamente aceitáveis incluem lítio, sódio, potássio, cálcio, magnésio e alumínio, assim como catiões de amina quaternária não tóxicos tais como amónio, tetrametilamónio, tetraetilamónio, metilamina, dimetilamina, trimetilamina, trietilamina, dietilamina, etilamina, tributilamina, piridina, N,N-dimetilanilina, N-metilpiperidina, N-metilmorfolina, diciclo-hexilamina, procaína, dibenzilamina, N,N-dibenzil-fenetilamina, 1-efenamina e Ν,Ν'-dibenziletilenodiamina. Outras aminas orgânicas representativas úteis para a formação de sais de adição básicos incluem etilenodiamina, etanolamina, dietanolamina, piperidina e piperazina.The basic addition salts may be prepared during the isolation and final purification of the compounds by reaction of an acidic group (for example, a carboxy or enol group) with a suitable base such as the hydroxide, carbonate or bicarbonate of a metal cation or with ammonia or a primary, secondary or tertiary organic amine. Cations of pharmaceutically acceptable salts include lithium, sodium, potassium, calcium, magnesium and aluminum, as well as non-toxic quaternary amine cations such as ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine, tributylamine, pyridine , N, N-dimethylaniline, N-methylpiperidine, N-methylmorpholine, dicyclohexylamine, procaine, dibenzylamine, N, N-dibenzylphenethylamine, 1-efenamine and β, β-dibenzylethylenediamine. Other representative organic amines useful for the formation of basic addition salts include ethylenediamine, ethanolamine, diethanolamine, piperidine and piperazine.

Sais preferidos dos compostos do presente invento incluem os sais monossódico, dissódico, sal de trietilamina, trifluoroacetato e cloridrato.Preferred salts of the compounds of the present invention include the monosodium, disodium, triethylamine salt, trifluoroacetate and hydrochloride salts.

Os presentes compostos também podem existir como prodrogas farmaceuticamente aceitáveis. O termo &quot;prodroga farmaceuticamente aceitável&quot; refere-se às prodrogas ou zwitteriões que são adequados para utilização em contacto com os tecidos de pacientes sem indevida toxicidade, irritação e resposta alérgica, são mensuráveis com uma razão benefício/risco razoável e são eficazes na sua utilização pretendida. As &quot;prodrogas&quot; são consideradas como quaisquer portadores ligados covalentemente que libertam a droga original activa da fórmula (Vb), (Via) ou (Vlb) in vivo quando tais prodrogas são administradas a um sujeito mamífero. As 53The present compounds may also exist as pharmaceutically acceptable prodrugs. The term &quot; pharmaceutically acceptable prodrug &quot; refers to prodrugs or zwitterions which are suitable for use in contact with the tissues of patients without undue toxicity, irritation and allergic response, are measurable at a reasonable benefit / risk ratio and are effective in their intended use. &Quot; prodrogas &quot; are considered as any covalently attached carriers which release the active original drug of formula (Vb), (Via) or (Vlb) in vivo when such prodrugs are administered to a mammalian subject. The 53

ΕΡ 1 560 827/PT prodrogas dos compostos da fórmula (Vb), (Via) ou (VIb) são preparadas por modificação dos grupos funcionais presentes nos compostos, de tal modo que as modificações são cindidas, quer em manipulação de rotina ou in vivo, nos compostos de origem respectivamente. As prodrogas incluem compostos em que grupos hidroxi, amina, carboxi ou sulfidrilo estão ligados a qualquer grupo que, quando administrado a um sujeito mamifero, cinde para formar um grupo hidroxilo, amino, carboxi ou sulfidrilo livre, respectivamente. Exemplos de prodrogas incluem, mas não estão limitados a, derivados de acetato, formato e benzoato dos grupos funcionais hidroxi, carboxi e amina nos compostos da fórmula (Vb), (Via) ou (VIb); e similares.The prodrugs of the compounds of formula (Vb), (Way) or (VIb) are prepared by modifying the functional groups present in the compounds, such that the modifications are split either in routine or in vivo manipulation , in the parent compounds respectively. Prodrugs include compounds wherein hydroxy, amine, carboxy or sulfhydryl groups are attached to any group which, when administered to a mammalian subject, grains to form a free hydroxyl, amino, carboxy or sulfhydryl group, respectively. Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of the hydroxy, carboxy and amine functional groups in the compounds of formula (Vb), (Way) or (VIb); and the like.

De acordo com o invento, os compostos podem ser administrados isolados ou em combinação com outros agentes antivirais. Quando se usam os compostos, o nivel especifico da dose farmaceuticamente eficaz para qualquer paciente particular irá depender de factores tais como a desordem a tratar e a gravidade da desordem; da actividade do composto particular utilizado; da composição especifica empregue; da idade, peso corporal, saúde geral, sexo e dieta do paciente; do tempo de administração; da via de administração; da taxa de excreção do composto empregue; da duração do tratamento; e das drogas usadas em combinação com ou coincidentes com o composto utilizado. Os compostos podem ser administrados oralmente, parentericamente, osmoticamente (sprays nasais), rectalmente, vaginalmente ou topicamente em formulações de dosagem unitária contendo portadores, adjuvantes, diluentes, veículos ou suas combinações. O termo &quot;parentérico&quot; inclui infusão, assim como injecção subcutânea, intravenosa, intramuscular e intrasternal.According to the invention, the compounds may be administered alone or in combination with other antiviral agents. When using the compounds, the specific level of the pharmaceutically effective dose for any particular patient will depend on factors such as the disorder being treated and the severity of the disorder; of the activity of the particular compound used; of the specific composition employed; the age, body weight, general health, sex and diet of the patient; of the time of administration; the route of administration; the rate of excretion of the compound employed; duration of treatment; and the drugs used in combination with or coincident with the compound used. The compounds may be administered orally, parenterally, osmotically (nasal sprays), rectally, vaginally or topically in unit dosage formulations containing carriers, adjuvants, diluents, carriers or combinations thereof. The term &quot; parenteral &quot; includes infusion, as well as subcutaneous, intravenous, intramuscular and intrasternal injection.

Suspensões aquosas ou oleaginosas dos compostos administradas parentericamente podem ser formuladas com agentes dispersantes, molhantes ou suspensores. A preparação injectável também pode ser uma solução ou suspensão injectável num diluente ou solvente. Entre os diluentes ou solventes aceitáveis empregues estão água, salino, solução de Ringer, tampões, monoglicéridos, diglicéridos, ácidos gordos tais como ácido oleico e óleos gordos tais como monoglicéridos ou diglicéridos. 54 ΕΡ 1 560 827/ΡΤ Ο efeito antiviral dos compostos administrados parentericamente pode ser prolongado pelo retardamento da sua absorção. Uma via de retardar a absorção de um composto particular é administrar formas &quot;depot&quot; injectáveis que compreendem suspensões de formas cristalinas, amorfas ou de outro modo insolúveis em água do composto. A taxa de absorção do composto está dependente da sua taxa de dissolução, a qual por seu lado está dependente do seu estado físico. Outro modo de retardar a absorção de um composto particular é administrar formas &quot;depot&quot; injectáveis que compreendem o composto como uma solução ou suspensão oleaginosa. Ainda outra maneira de retardar a absorção de um composto particular é administrar formas &quot;depot&quot; injectáveis que compreendem matrizes de microcápsulas do composto aprisionados em lipossomas, microemulsões ou polímeros biodegradáveis tais como polilactido-poliglicólido, poli-ortoésteres ou polianidridos. Dependendo da razão de droga para polímero e da composição do polímero, a taxa de libertação da droga pode ser controlada.Aqueous or oleaginous suspensions of the parenterally administered compounds may be formulated with dispersing, wetting or suspending agents. The injectable preparation may also be an injectable solution or suspension in a diluent or solvent. Among the acceptable diluents or solvents employed are water, saline, Ringer's solution, buffers, monoglycerides, diglycerides, fatty acids such as oleic acid and fatty oils such as monoglycerides or diglycerides. The antiviral effect of the parenterally administered compounds can be prolonged by delaying their absorption. One way of delaying absorption of a particular compound is to administer &quot; depot &quot; injectables which comprise suspensions of crystalline, amorphous or otherwise water-insoluble forms of the compound. The rate of absorption of the compound is dependent on its rate of dissolution, which in turn is dependent on its physical state. Another way of delaying the absorption of a particular compound is to administer &quot; depot &quot; injectables comprising the compound as an oil solution or suspension. Yet another way of delaying the uptake of a particular compound is to administer &quot; depot &quot; injectables comprising matrixes of the microcapsules of the compound entrapped in liposomes, microemulsions or biodegradable polymers such as polylactide-polyglycolide, poly-orthoesters or polyanhydrides. Depending on the drug to polymer ratio and the polymer composition, the rate of drug release can be controlled.

Os pensos transdérmicos também podem proporcionar uma entrega controlada dos compostos. A taxa de absorção pode ser reduzida utilizando membranas controladoras da taxa ou aprisionando o composto dentro de uma matriz ou gel polimérico. De modo contrário, podem ser utilizados melhoradores da absorção para aumentar a absorção.The transdermal patches may also provide controlled delivery of the compounds. The rate of uptake can be reduced by using rate controlling membranes or by trapping the compound within a polymer matrix or gel. Otherwise, absorption enhancers may be used to increase absorption.

Formas de dosagem sólidas para administração oral incluem cápsulas, comprimidos, pílulas, pós e grânulos. Nestas formas de dosagem sólidas, o composto activo pode opcionalmente compreender diluentes tais como sacarose, lactose, amido, talco, ácido silícico, hidróxido de alumínio, silicatos de cálcio, poliamida em pó, lubrificantes de comprimidos e adjuvantes de comprimidos tais como estearato de magnésio ou celulose microcristalina. As cápsulas, comprimidos e pílulas podem também compreender agentes tamponantes e comprimidos e pílulas podem ser preparados com revestimentos entéricos ou outros revestimentos de controlo da libertação. Os pós e sprays podem conter também excipientes tais como talco, ácido silícico, hidróxido de alumínio, silicato de cálcio, poliamida em pó ou suas misturas. Os sprays podem adicionalmente conter os propulsores habituais tais como clorofluoro-hidrocarbonetos ou seus substitutos. 55 ΕΡ 1 560 827/ΡΤSolid dosage forms for oral administration include capsules, tablets, pills, powders and granules. In such solid dosage forms, the active compound may optionally comprise diluents such as sucrose, lactose, starch, talc, silicic acid, aluminum hydroxide, calcium silicates, powdered polyamide, tableting lubricants and tablet adjuvants such as magnesium stearate or microcrystalline cellulose. Capsules, tablets and pills may also comprise buffering agents and tablets and pills may be prepared with enteric coatings or other release control coatings. The powders and sprays may also contain excipients such as talc, silicic acid, aluminum hydroxide, calcium silicate, powdered polyamide or mixtures thereof. The sprays may additionally contain the usual propellants such as chlorofluorohydrocarbons or their substitutes. 55 ΕΡ 1 560 827 / ΡΤ

As formas de dosagem líquidas para administração oral incluem emulsões, microemulsões, soluções, suspensões, xaropes e elixires que compreendem diluentes inertes tais como água. Estas composições podem também compreender adjuvantes tais como agentes molhantes, emulsionantes, suspensores, edulcorantes, aromatizantes e perfumantes.Liquid dosage forms for oral administration include emulsions, microemulsions, solutions, suspensions, syrups and elixirs which comprise inert diluents such as water. These compositions may also comprise adjuvants such as wetting, emulsifying, suspending, sweetening, flavoring and perfuming agents.

Formas de dosagem tópica incluem unguentos, pastas, cremes, loções, géis, pós, soluções, sprays, inalantes e pensos transdérmicos. O composto é misturado sob condições estéreis com um portador e quaisquer conservantes ou tampões necessários. Estas formas de dosagem também podem incluir excipientes tais como gorduras animais e vegetais, óleos, ceras, parafinas, amido, goma adragante, derivados de celulose, polietilenoglicóis, silicones, bentonites, ácido silícico, talco e óxido de zinco ou suas misturas. Podem ser preparados supositórios para administração rectal ou vaginal por mistura dos compostos com um excipiente não irritante adequado, tal como manteiga de cacau ou polietilenoglicol, sendo cada um sólido as temperaturas comuns mas fluido no recto ou vagina. As formulações oftálmicas que compreendem gotas oculares, unguentos, pós e soluções para os olhos estão também contemplados dentro do âmbito deste invento.Topical dosage forms include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and transdermal patches. The compound is admixed under sterile conditions with a carrier and any necessary preservatives or buffers. These dosage forms may also include excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide or mixtures thereof. Suppositories for rectal or vaginal administration may be prepared by mixing the compounds with a suitable non-irritating excipient, such as cocoa butter or polyethylene glycol, each solid being the common temperatures but fluid in the rectum or vagina. Ophthalmic formulations comprising eye drops, ointments, powders and solutions for the eyes are also contemplated within the scope of this invention.

Os compostos do invento inibem a ARN-polimerase dependente de ARN do VHC, uma enzima essencial para a replicação virai de VHC. Podem ser administrados como único agente farmacêutico activo ou também podem ser utilizados em combinação com um ou mais agentes para tratar infecções por hepatite C ou os sintomas associados com infecção por VHC. Outros agentes a ser administrados em combinação com um composto do presente invento incluem terapias para doença causada por infecção por VHC que suprime a replicação virai de VHC por mecanismos directos ou indirectos. Estes incluem agentes tais como moduladores da imunidade do hospedeiro, por exemplo, interferão-alfa, interferão-alfa-peguilado, oligonucleótidos de CpG e similares, ou compostos antivirais que inibem funções celulares do hospedeiro tais como monofosfato-desidrogenase de inosina, por exemplo, ribavirina e similares. Também incluídas estão citocinas que modulam as funções da imunidade. Também incluídas estão vacinas que 56 ΕΡ 1 560 827/ΡΤ compreendem antigénios de VHC ou combinações de adjuvantes de antigénio dirigidas contra VHC. Também incluídos estão agentes que interagem com componentes celulares do hospedeiro para bloquear a síntese de proteína virai pela inibição do passo de translação iniciado pelos locais de entrada de ribossoma internos (IRES) da replicação virai de VHC ou para bloquear a maturação da partícula virai e libertação com agentes apontados para a família das viroporinas das proteínas membranares tais como, por exemplo, VHC P7 e similares. Outros agentes a serem administrados em combinação com um composto do presente invento incluem qualquer agente ou combinação de agentes que inibem a replicação de VHC alvejando proteínas do genoma virai envolvidas na replicação virai. Estes agentes incluem mas não estão limitados a outros inibidores de ARN-polimerase dependente de ARN do VHC tais como, por exemplo, inibidores de polimerase do tipo nucleósido descritos em WO 0190121(A2) ou US 6348587 Bl ou WO 0160315 ou WO 0132153 ou inibidores não de nucleósido tais como, por exemplo, inibidores de polimerase de benzimidazole descritos em EP 1162196 Al ou WO 0204425 ou inibidores de VHC-protease tais como, por exemplo, inibidores do tipo peptidomimético tais como BILN2061 e similares, ou inibidores de VHC-helicase.The compounds of the invention inhibit HCV RNA-dependent RNA polymerase, an enzyme essential for viral replication of HCV. They may be administered as the sole active pharmaceutical agent or may also be used in combination with one or more agents to treat hepatitis C infections or the symptoms associated with HCV infection. Other agents to be administered in combination with a compound of the present invention include therapies for disease caused by HCV infection which suppresses viral replication of HCV by direct or indirect mechanisms. These include agents such as host immunity modulators, for example, interferon-alpha, interferon-alpha-pegylated, CpG oligonucleotides and the like, or antiviral compounds that inhibit host cell functions such as inosine monophosphate dehydrogenase, ribavirin and the like. Also included are cytokines that modulate the functions of immunity. Also included are vaccines comprising HCV antigens or combinations of antigen adjuvants directed against HCV. Also included are agents which interact with cellular components of the host to block viral protein synthesis by inhibiting the translation step initiated by the internal ribosome entry sites (IRES) of viral replication of HCV or to block viral particle maturation and release with agents targeted to the viroporin family of membrane proteins such as, for example, HCV P7 and the like. Other agents to be administered in combination with a compound of the present invention include any agent or combination of agents which inhibit HCV replication by targeting viral genome proteins involved in viral replication. These agents include but are not limited to other inhibitors of HCV RNA-dependent RNA polymerase such as, for example, nucleoside type polymerase inhibitors described in WO 0190121 (A2) or US 6,348,587 B1 or WO 0160315 or WO 0132153 or inhibitors non-nucleoside inhibitors such as, for example, benzimidazole polymerase inhibitors described in EP 1162196 A1 or WO 0204425 or HCV protease inhibitors such as, for example, peptidomimetic type inhibitors such as BILN2061 and the like, or inhibitors of HCV-helicase .

Outros agentes a serem administrados em combinação com um composto do presente invento incluem qualquer agente ou combinação de agentes que inibe a replicação de outros vírus para indivíduos co-infectados. Estes agentes incluem mas não estão limitados a terapias para doença causada por infecção por hepatite B (VHB) tais como, por exemplo, adefovir, lamivudina, LdT (L-desoxitimidina) e tenofovir, ou terapias para doença causada por infecção por vírus da imunodeficiência humana (VIH) tais como, por exemplo, inibidores de protease: ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir; inibidores de transcriptase inversa: zidovudina, lamivudina, didanosina, estavudina, tenofovir, zalcitabina, abacavir, efavirenz, nevirapina, delavirdina, TMC-125; inibidores de integrase: L-870812, S-1360 ou inibidores de entrada: enfuvirtida (T-20), T-1249.Other agents to be administered in combination with a compound of the present invention include any agent or combination of agents that inhibits the replication of other viruses to co-infected individuals. These agents include but are not limited to therapies for disease caused by hepatitis B (HBV) infection such as, for example, adefovir, lamivudine, LdT (L-deoxythymidine) and tenofovir, or therapies for disease caused by infection by immunodeficiency virus (HIV) inhibitors such as, for example, protease inhibitors: ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir; reverse transcriptase inhibitors: zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125; integrase inhibitors: L-870812, S-1360 or inhibitors of entry: enfuvirtide (T-20), T-1249.

Outros agentes a serem administrados em combinação com um composto do presente invento incluem qualquer agente ou 57 ΕΡ 1 560 827/ΡΤ combinação de agentes que trata ou alivia sintomas de infecção por VHC, incluindo cirrose e inflamação do figado.Other agents to be administered in combination with a compound of the present invention include any agent or combination of agents that treats or alleviates symptoms of HCV infection, including cirrhosis and inflammation of the liver.

Quando administrados como combinação, os agentes terapêuticos podem ser formulados como composições separadas que são dadas ao mesmo tempo ou dentro de um período de tempo predeterminado ou os agentes terapêuticos podem ser dados como uma forma de dosagem unitária simples. A dose diária total dos compostos administrados a um hospedeiro em doses únicas ou divididas pode estar em quantidades de cerca de 0,1 a cerca de 200 mg/kg de peso corporal, ou preferivelmente de cerca de 0,25 a cerca de 100 mg/kg de peso corporal. As composições de dose simples podem conter estas quantidades ou seus submúltiplos para perfazer a dose diária.When administered as a combination, the therapeutic agents may be formulated as separate compositions which are given at the same time or within a predetermined time period or the therapeutic agents may be given as a single unit dosage form. The total daily dose of the compounds administered to a host in single or divided doses may be in amounts of from about 0.1 to about 200 mg / kg of body weight, or preferably from about 0.25 to about 100 mg / kg body weight. Single dose compositions may contain these amounts or their submultiples to make up the daily dose.

Determinação da actividade biológicaDetermination of biological activity

Ensaio de inibição de VHC-polimerase: IC50 bioquímica:HCV-polymerase inhibition assay: biochemical IC 50:

Ambas diluições em série de duas vezes (ensaio de inibição fraccionada) ou uma gama mais estreita de diluições variando a IC50 do inibidor (ensaio de ligação forte) dos inibidores foram incubadas com 20 mM de Tris-Cl pH 7,5, 5 mM de MgCl2, 50 mM de NaCl, 1 mM de ditiotreitol, 1 mM de ácido etilenodiaminatetraacético (EDTA), 300 μΜ de GTP e 150 a 300 nM de NS5B (Estripe 1B de VHC (J4, número de acesso Genbank AF054247 ou H77, número de acesso Genbank AF011751)) durante 15 minutos a temperatura ambiente. A reacção foi iniciada pela adição de 20 μΜ de CTP, 20 μΜ de ATP, 1 μΜ de 3H-UTP (10 mCi/umol), 150 nM de modelo de ARN e 0,4 U/μΙ de inibidor de RNase (RNasin, Promega) e deixada prosseguir durante 2 a 4 horas a temperatura ambiente. O volume da reacção foi de 50 μΐ. A reacção foi terminada pela adição de 1 volume de 4 mM de espermina em 10 mM de Tris-Cl pH 8,0, 1 mM de EDTA. Após incubação durante pelo menos 15 minutos a temperatura ambiente, o ARN precipitado foi recolhido por filtração através de um filtro GF/B (Millipore) num formato de 96 poços. A placa do filtro foi lavada três vezes com 200 μΐ cada de 2 mM de espermina, 10 mM de Tris-Cl pH 8,0, 1 mM de EDTA e 2 vezes com etanol. Após secagem ao ar, juntaram-se 30 μΐ de 58 ΕΡ 1 560 827/ΡΤ cocktail de cintilação Microscint 20 (Packard) a cada poço e os cpm retidos determinados por contagem de cintilação. Os valores de IC50 foram calculados por uma equação de regressão não linear de duas variáveis, usando um controlo não inibido e uma amostra de controlo totalmente inibido para determinar o mínimo e o máximo para a curva. Os ensaios de ligação forte foram realizados sobre os compostos exibindo valores de iC5o inferiores a 0,15 μΜ no ensaio de inibição fraccionada, de modo a medir mais precisamente os valores de IC50· Os cpm retidos foram representados vs. Concentração de inibidor e ajustados à Equação 1 usando regressão não linear (Ref. 1) para obter os valores de IC50. cpm retido = A[V{ (lC5o+lt-Et) 2+4lC5oEt}-(IC5o+It-Et) ] Eq. 1 em que A = Vmax [S]/2(Km + [S] ) ; It = concentração de inibidor total e Et = concentração total da enzima activa.Both serial two-fold dilutions (fractional inhibition assay) or a narrower range of dilutions varying the inhibitor IC50 (strong binding assay) of the inhibitors were incubated with 20 mM Tris-Cl pH 7.5, 5 mM MgCl 2, 50 mM NaCl, 1 mM dithiothreitol, 1 mM ethylenediaminetetraacetic acid (EDTA), 300 μg GTP and 150 to 300 nM NS5B (HCV Stress 1B (J4, Genbank accession number AF054247 or H77, Genbank Access AF011751)) for 15 minutes at room temperature. The reaction was started by the addition of 20 μCTP, 20 μM ATP, 1 μM 3 H-UTP (10 mCi / umol), 150 nM RNA model and 0.4 U / μM RNase inhibitor (RNasin, Promega) and allowed to proceed for 2 to 4 hours at room temperature. The reaction volume was 50 μΐ. The reaction was terminated by the addition of 1 volume of 4 mM spermine in 10 mM Tris-Cl pH 8.0, 1 mM EDTA. After incubation for at least 15 minutes at room temperature, the precipitated RNA was collected by filtration through a GF / B filter (Millipore) in a 96-well format. The filter plate was washed three times with 200 μg each of 2 mM spermine, 10 mM Tris-Cl pH 8.0, 1 mM EDTA and 2 times with ethanol. After air drying, 30 μΐ of 58æl 1 560 827 / Mic Microscint 20 scintillation cocktail (Packard) was added to each well and retained cpm determined by scintillation counting. The IC 50 values were calculated by a non-linear regression equation of two variables, using an uninhibited control and a fully inhibited control sample to determine the minimum and the maximum for the curve. Strong binding assays were performed on the compounds exhibiting IC50 values less than 0.15 μΜ in the fractional inhibition assay so as to more accurately measure the IC 50 values. The retained cpm were plotted vs. Inhibitor concentration and adjusted to Equation 1 using non-linear regression (Ref. 1) to obtain the IC 50 values. cpm retentate = A [V {(lC5o + lt-Et) 2 + 4lC5oEt} - (IC5o + It-Et)] Eq. 1 where A = Vmax [S] / 2 (Km + [S]); It = total inhibitor concentration and Et = total concentration of the active enzyme.

Ref. 1: Morrison, J.F. and S.R. Stone. 1985. &quot;Approaches to the study and analysis of the inhibition of enzymes by slow-and tight-binding inhibitors&quot;, Comments Mol. Cell. Biophys. 2: 347-368. A sequência do modelo de ARN utilizado foi: 5’gggcgaauugggcccucuagaugcaugcucgagcggccgccagugugauggRef. 1: Morrison, J.F. and S.R. Stone. 1985. &quot; Approaches to the study and analysis of the inhibition of enzymes by slow-and tight-binding inhibitors &quot;, Mol. Biophys. 2: 347-368. The sequence of the RNA template used was: 5'gggcgaauugggcccucuagaugcaugcucgagcggccgccagugugaugg

AUAUCUGCAGAAUUCGCCCUUGGUGGCUCCAUCUUAGCCCUAGUCACGGCUAGAUAUCUGCAGAAUUCGCCCUUGGUGGCUCCAUCUUAGCCCUAGUCACGGCUAG

CUGUGAAAGGUCCGUGAGCCGCUUGACUGCAGAGAGUGCUGAUACUGGCCUCU CUGCAGAUCAAGUC-3’CUGUGAAAGGUCCGUGAGCCGCUUGACUGCAGAGAGUGCUGAUACUGGCCUCU CUGCAGAUCAAGUC-3 '

Quando testados pelo anterior método, os compostos do presente invento inibem VHC-polimerase 1B com valores de IC50 na gama de 0,002 μΜ a 500 μΜ.When tested by the above method, the compounds of the present invention inhibit HCV-polymerase 1B with IC 50 values in the range of 0.002 μΜ to 500 μΜ.

Avaliação dos inibidores de VHC na replicação de VHC: EC50 da cultura de célulaEvaluation of HCV inhibitors in HCV replication: EC50 cell culture

As linhas celulares e ensaios foram conduzidos de acordo com os métodos descritos por Ikeda M, Yi M, Li K, Lemon SM, j Virol 2002 Mar; 76(6):2997-3006, e Blight K.J., Kolykhalov A., Rice C.M., Science 2000 Dec, 290:1972-1974) com as seguintes modificações: 59 ΕΡ 1 560 827/ΡΤCell lines and assays were conducted according to the methods described by Ikeda M, Yi M, Li K, Lemon SM, Virol 2002 Mar; 76 (6): 2997-3006, and Blight K.J., Kolykhalov A., Rice C.M., Science 2000 Dec, 290: 1972-1974) with the following modifications: 59 Ε 1 1560 827 / ΡΤ

Ensaio de ARN Células Replicon foram colocadas em placas a 3*103 células por poço em placas de 96 poços em meio DMEM contendo 5% de soro fetal de bovino. No dia 1, o meio de cultura foi removido e substituído por meio fresco contendo oito séries de diluição dupla do composto. A concentração final de DMSO no meio era de 0,5%. A cultura de controlo não tratada foi tratada de maneira idêntica excepto que não foi adicionado inibidor ao meio. As placas foram incubadas num incubador de C02 a 37°C. No Dia 4, juntaram-se 100 μΐ de tampão de lise (RTL) (Qiagen) a cada poço, após remoção do meio de cultura. O ARN foi purificado de acordo com as recomendações do fabricante (Qiagen RNAeasy) e eluído em 200 μΐ de água. O nível de ARN de VHC foi quantificado a partir de uma porção (5 μΐ dos 200 μΐ) do ARN purificado através do método RT-PCR em tempo real. Os iniciadores e a sonda são derivados da sequência específica na região 5'UTR. A reacção de RT-PCR foi realizada a 48°C durante 30 min, seguida de 40 ciclos ajustados a 95°C, 15 s; 54°C, 30 s; e 72°C, 40 s. A redução percentual de ARN de VHC na presença de composto foi calculada e a concentração inibidora a 50% (IC50) foi calculada por uma análise de regressão não linear usando o programa Prism.RNA assay Replicon cells were plated at 3 × 10 3 cells per well in 96-well plates in DMEM medium containing 5% fetal bovine serum. On day 1, the culture medium was removed and replaced with fresh medium containing eight series of double dilution of the compound. The final concentration of DMSO in the medium was 0.5%. The untreated control culture was treated in the same manner except that no inhibitor was added to the medium. The plates were incubated in a CO 2 incubator at 37 ° C. On Day 4, 100 μl of lysis buffer (RTL) (Qiagen) was pooled to each well, after removal of the culture medium. The RNA was purified according to the manufacturer's recommendations (Qiagen RNAeasy) and eluted in 200 μl water. The level of HCV RNA was quantified from a portion (5 μΐ of 200 μΐ) of the purified RNA by the real-time RT-PCR method. The primers and the probe are derived from the specific sequence in the 5'UTR region. The RT-PCR reaction was performed at 48 ° C for 30 min, followed by 40 cycles set at 95 ° C, 15 sec; 54 ° C, 30 sec; and 72 ° C, 40 s. The percent reduction of HCV RNA in the presence of compound was calculated and the inhibitory concentration at 50% (IC 50) was calculated by a non-linear regression analysis using the Prism program.

Quando testados pelo anterior método, os compostos do presente invento inibem a produção de replicon com valores de EC50 na gama de 0,002 μΜ a &gt;100 μΜ.When tested by the above method, the compounds of the present invention inhibit replicon production with EC 50 values in the range of 0.002 μg to &gt; 100 μg.

Ensaios de citotoxicidadeCytotoxicity assays

Os ensaios de citotoxicidade foram realizados em células replicon. Em resumo, as células replicon de VHC foram plaqueadas a 3xl03 células por poço em placas de 96 poços em meio DMEM contendo 5% de FCS. No Dia 1, o meio de cultura foi removido e substituído com meio fresco contendo oito séries de diluição dupla do composto. A concentração final de DMSO no meio era de 0,5%. Todas as experiências foram realizadas em duplicado. A cultura de controlo não tratada foi tratada de maneira idêntica, excepto que não foi adicionado inibidor ao meio. As placas foram incubadas num incubador de C02 a 37°C. No Dia 4, uma solução de reserva do sal de tetrazólio, MTT (4 mg/ml em PBS, Sigma cat.# M 2128) foi adicionada a cada poço a 60Cytotoxicity assays were performed on replicon cells. Briefly, HCV replicon cells were plated at 3x103 cells per well in 96-well plates in DMEM medium containing 5% FCS. At Day 1, the culture medium was removed and replaced with fresh medium containing eight series of double dilution of the compound. The final concentration of DMSO in the medium was 0.5%. All experiments were performed in duplicate. The untreated control culture was treated in the same manner except that no inhibitor was added to the medium. The plates were incubated in a CO 2 incubator at 37 ° C. On Day 4, a stock solution of the tetrazolium salt, MTT (4 mg / ml in PBS, Sigma cat # M 2128) was added to each well at 60

ΕΡ 1 560 827/PT 25 μΐ por poço. As placas foram ainda incubadas durante 4 horas, tratadas com 20% de SDS mais HC1 0,02N a 50 μΐ por poço para lisar as células. Após uma incubação de um dia para o outro, a densidade óptica foi medida por leitura das placas a comprimentos de onda de 570/650 nm. A redução percentual da cor de azul formazan formada relativamente ao controlo foi calculada e o efeito citopático descrito como uma concentração de toxicidade a 50% (TC50) foi calculado por análise de regressão não linear utilizando o programa Prism.ΕΡ 1 560 827/25 25 μΐ per well. The plates were further incubated for 4 hours, treated with 20% SDS plus 0.02N HCl at 50 μΐ per well to lyse the cells. After overnight incubation, the optical density was measured by reading the plates at wavelengths of 570/650 nm. The percent reduction of the formazan blue color formed relative to the control was calculated and the cytopathic effect described as a 50% toxicity concentration (TC 50) was calculated by non-linear regression analysis using the Prism program.

Quando testados pelo anterior método, os compostos do presente invento exibiram uma redução de CPE com valores de TC50 na gama de 6,6 μΜ a &gt;100 μΜ.When tested by the above method, the compounds of the present invention exhibited a CPE reduction with TC 50 values in the range of 6.6 μΜ to &gt; 100 μΜ.

Ensaios de cultura celular para agentes apontados para a hepatite C ainda não estão disponíveis devido à inabilidade para produzir vírus infecciosos numa linha celular sustentada. O genoma do vírus da hepatite C codifica para uma grande poliproteína, que após processamento produz os necessários componentes funcionais para sintetizar ARN de progénie. As linhas celulares seleccionáveis que produzem níveis elevados e sustentados de ARN de VHC subgenómico (replicons) foram derivadas de células de hepatoma humano (Huh7) como descrito nas anteriores referências. O mecanismo da replicação de ARN nestas linhas celulares é considerado idêntico ao da replicação do ARN de VHC inteiro em hepatócitos infectados. Os compostos e métodos deste invento são inibidores da replicação de ARN de VHC nos sistemas de ensaio de replicon descritos anteriormente. isto forma a base da reivindicação quanto ao seu potencial como terapia no tratamento de doença resultante de infecção virai por hepatite C. Métodos sintéticosCell culture assays for agents designated for hepatitis C are not yet available because of the inability to produce infectious virus in a sustained cell line. The hepatitis C virus genome codes for a large polyprotein, which upon processing produces the necessary functional components to synthesize progeny RNA. Selectable cell lines producing high and sustained levels of subgenomic HCV RNA (replicons) were derived from human hepatoma cells (Huh7) as described in the foregoing references. The mechanism of RNA replication in these cell lines is considered to be identical to replication of whole HCV RNA in infected hepatocytes. The compounds and methods of this invention are inhibitors of HCV RNA replication in the replicon assay systems described above. this forms the basis of the claim as to its potential as therapy in the treatment of disease resulting from viral infection by hepatitis C. Synthetic Methods

Abreviaturas que foram utilizadas nas descrições dos Esquemas e nos Exemplos que se seguem são: DMF é N,N-dimetilformamida, DMSO é dimetilsulfóxido e THF é tetra-hidrofurano.Abbreviations that have been used in the descriptions of the Schemes and the following Examples are: DMF is N, N-dimethylformamide, DMSO is dimethylsulfoxide and THF is tetrahydrofuran.

Os compostos do presente invento serão melhor compreendidos em relação com os seguintes Esquemas sintéticos que ilustram os métodos pelos quais os compostos do invento 61 ΕΡ 1 560 827/ΡΤ podem ser preparados. Os materiais de partida podem ser obtidos a partir de fontes comerciais ou preparados por métodos bem estabelecidos na literatura e conhecidos das pessoas competentes na matéria. Os grupos R1, R4 e R5 são como anteriormente definidos e os grupos R2 e R3 juntamente com os átomos de carbono aos quais estão ligados formam um anel fenilo ou piridilo opcionalmente substituído com (R6)m e 61 ΕΡ 1 560 827/ΡΤThe compounds of the present invention will be better understood in connection with the following synthetic Schemes illustrating the methods by which the compounds of the invention can be prepared. The starting materials may be obtained from commercial sources or prepared by methods well established in the literature and known to those skilled in the art. The groups R 1, R 4 and R 5 are as previously defined and the groups R 2 and R 3 together with the carbon atoms to which they are attached form a phenyl or pyridyl ring optionally substituted with (R 6) m and 61 Ε 1 1560 827 / ΡΤ

ou os grupos R2 e R3 juntamente com os átomos de carbono aos quais estão ligados formam um anel piridilo opcionalmente substituído com (R6)m eor the groups R 2 and R 3 together with the carbon atoms to which they are attached form a pyridyl ring optionally substituted with (R 6) m and

excepto se indicado de outro modo em seguida.unless otherwise indicated below.

Este invento pretende englobar compostos que possuem a fórmula (Vb), (Via) ou (Vlb) quando preparados por processos sintéticos ou por processos metabólicos. A preparação dos compostos do invento por processos metabólicos inclui os que ocorrem no corpo humano ou animal {in vivo) ou processos que ocorrem in vitro.This invention is intended to encompass compounds having the formula (Vb), (Via) or (Vlb) when prepared by synthetic methods or by metabolic processes. The preparation of the compounds of the invention by metabolic processes includes those occurring in the human or animal body (in vivo) or processes occurring in vitro.

Esquema 1Scheme 1

co2ch2ch3 H2NC 02C H2CH3 r\ s „Ad * (2) (3)co2ch2ch3 H2NC 02C H2CH3 r \ s "Ad * (2) (3)

Como se mostra no Esquema 1, os compostos da fórmula (2) podem reagir com compostos da fórmula (3) na presença de oxicloreto de fósforo sob condições de aquecimento para proporcionar compostos da fórmula (4). Os compostos da fórmula 62 ΕΡ 1 560 827/ΡΤ (4) podem reagir com uma base tal como hidreto de sódio, hidreto de potássio, hexametildisilazida de lítio e similares num solvente tal como, mas não limitado a dimetilacetamida, dimetilformamida, THF e similares, seguindo-se a adição de R1-X, (em gue R1 é alcenilo, alcoxialquilo, alcoxicarbonil-alquilo, alquilo, alquilcarbonilalquilo, alquilsulfanil-alquilo, alquilsulfinilalquilo, alquilsulfonilalquilo, alcinilo, arilalcenilo, arilalquilo, arilsulfanilalquilo, arilsulfonilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquil-alcenilo, cicloalquilalquilo, haloalcoxialquilo, haloalquilo, heteroarilalcenilo, heteroarilalquilo, heteroarilsulfonilalquilo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, nitroalquilo, RaRbN-alquil-, RaRbNC(O)alquil-, RaRbNC (O) O-alquil- ou RaRbNC (O)NRc-alquil-, e em que X é Br, Cl, I, CF3S(0)2-, CH3S(0)2- ou tosilo) para proporcionar compostos da fórmula (5). 62 ΕΡ 1 560 827/ΡΤ RÍ R2'As shown in Scheme 1, compounds of formula (2) may be reacted with compounds of formula (3) in the presence of phosphorus oxychloride under heating conditions to provide compounds of formula (4). The compounds of formula 62 and may be reacted with a base such as sodium hydride, potassium hydride, lithium hexamethyldisilazide and the like in a solvent such as but not limited to dimethylacetamide, dimethylformamide, THF and the like , followed by the addition of R 1 -X (in which R 1 is alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenylalkyl, cycloalkenylalkyl, cycloalkylalkenyl, cycloalkylalkyl, haloalkoxyalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-alkyl-, RaRbNC (O) alkyl-, RaRbNC (O) O- or RaRbNC (O) NR c -alkyl-, and wherein X is Br, Cl, I, CF 3 S (O) 2, CH 3 S (O) 2 - or tosyl) to provide formula (5). 62 ΕΡ 1 560 827 / ΡΤ R 2 R 2 '

Esquema 2 .002CH2CH3 + NHZR1 ‘ClScheme 2 .002CH2CH3 + NHZR1 'Cl

(*) (¢) -j (7)(*) (¢) -j (7)

Alternativamente, os compostos da fórmula (6) podem ser tratados com compostos da fórmula (7) (em que R1 é alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alquilcarbonil alquilsulfinilalquilo, arilo, arilalcenilo, arilsulfonilalquilo, cicloalcenilo, cicloalquilalcenilo, haloalcoxialquilo, heteroarilalcenilo, alquilo, alquilsulfanilalquilo, alquilsulfonilalquilo, alcinilo, arilalquilo, arilsulfanilalquilo, carboxialquilo, cicloalcenilalquilo, cicloalquilalquilo, haloalquilo, heteroarilalquilo, heterocicloalcenilo, cianoalquilo, cicloalquilo, formilalquilo, heteroarilo, heteroarilsulfonilalquilo, heterociclo, heterocicloalquilo, hidroxialquilo, nitroalquilo, RaRbN-, RaRb-alquil-, RaRbNC (0) alquil-, RaRbNC (0) O-alquil-, RaRbC (0) NRc-alquil-, RfRgC=N- ou Rk0-), sob condições de aquecimento opcionalmente na presença de uma base tal como carbonato de potássio e um catalisador tal como brometo de cobre, para proporcionar compostos da fórmula (8). 63 ΕΡ 1 560 827/ΡΤAlternatively, the compounds of formula (6) may be treated with compounds of formula (7) (wherein R 1 is alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkylsulfinylalkyl, aryl, arylalkenyl, arylsulfonylalkyl, cycloalkenyl, cycloalkylalkenyl, haloalkoxyalkyl, heteroarylalkenyl, alkylsulphonylalkyl, alkylsulphonylalkyl, alkylsulphonylalkyl, alkylsulphonylalkyl, alkylsulphonylalkyl, alkynyl, arylalkyl, arylsulfanylalkyl, carboxyalkyl, cycloalkenylalkyl, cycloalkylalkyl, heteroarylalkyl, heteroarylalkyl, heterocycloalkenyl, cyanoalkyl, cycloalkyl, formylalkyl, heteroaryl, heteroarylsulfonylalkyl, heterocycloalkyl, hydroxyalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRb-alkyl-, RaRbNC (O) alkyl-, RaRbNC (O) O-alkyl-, RaRbC (O) NRc-alkyl-, RfRgC = N- or RkO-), under heating conditions optionally in the presence of a base such as potassium carbonate and a catalyst such as copper bromide, to provide compounds of formula (8). 63 ΕΡ 1 560 827 / ΡΤ

Os compostos da fórmula (8) podem ser tratados com reagentes incluindo mas não estando limitado a fosgénio, difosgénio, trifosgénio em solventes tais como mas não limitado a 1,2-dicloroetano, tetracloreto de carbono, 1,4-dioxano ou suas misturas, sob condições de aquecimento para proporcionar compostos da fórmula (5).The compounds of the formula (8) may be treated with reagents including but not limited to phosgene, diphosgene, triphosgene in solvents such as but not limited to 1,2-dichloroethane, carbon tetrachloride, 1,4-dioxane or mixtures thereof, under heating conditions to provide compounds of formula (5).

Esquema 3Scheme 3

Além disso, os compostos da fórmula (9) também podem reagir com reagentes incluindo mas não limitado a fosgénio, difosgénio, trifosgénio, carbonildiimidazole, cloroformato de etilo e similares, na presença de uma base tal como hidróxido de potássio, piridina, hidróxido de litio e similares em solventes tais como, mas não limitado a água, tolueno, benzeno e similares, sob condições de aquecimento para proporcionar compostos da fórmula (5).In addition, the compounds of the formula (9) may also be reacted with reagents including but not limited to phosgene, diphosgene, triphosgene, carbonyldiimidazole, ethyl chloroformate and the like, in the presence of a base such as potassium hydroxide, pyridine, lithium hydroxide and the like in solvents such as but not limited to water, toluene, benzene and the like, under heating conditions to provide compounds of formula (5).

Esquema 4Scheme 4

Os compostos da fórmula (5) podem ser tratados com compostos da fórmula (10) na presença de uma base tal como hidreto de sódio, hidreto de potássio, hexametildisilazida de litio e similares, num solvente tal como, mas não limitado a, THF, éter dietilico, éter metil-tert-butilico, seguido de tratamento com um ácido tal como ácido acético, ácido dicloroacético ou ácido sulfúrico, para proporcionar compostos da fórmula (11) que são representativos de um composto de fórmula (I), em que R4 é hidroxi. 64 ΕΡ 1 560 827/ΡΤ Esquema 5The compounds of formula (5) may be treated with compounds of formula (10) in the presence of a base such as sodium hydride, potassium hydride, lithium hexamethyldisilazide and the like, in a solvent such as but not limited to THF, diethyl ether, methyl tert-butyl ether, followed by treatment with an acid such as acetic acid, dichloroacetic acid or sulfuric acid to provide compounds of formula (11) which are representative of a compound of formula (I), wherein R4 is hydroxy. 64 ΕΡ 1 560 827 / ΡΤ Scheme 5

Os compostos da fórmula (5) podem reagir com malonato de dietilo que foi pré-tratado com uma base tal como hidreto de sódio, hidreto de potássio e similares em solventes tais como dimetilacetamida, dimetilformamida, THF e similares sob condições de aquecimento, para proporcionar compostos da fórmula (12). Os compostos da fórmula (12) podem ser tratados com compostos da fórmula (13) em solventes tais como tolueno, mesitileno, benzeno e similares sob condições de aquecimento para proporcionar compostos da fórmula (14). Os compostos da fórmula (14) podem ser tratados com uma base tal como hidróxido de sódio, hidróxido de potássio, hidróxido de lítio e similares em água sob condições de aquecimento para proporcionar compostos da fórmula (11). R3- R2 .C05CH2CH3 NHR1 (S)The compounds of formula (5) may be reacted with diethyl malonate which has been pretreated with a base such as sodium hydride, potassium hydride and the like in solvents such as dimethylacetamide, dimethylformamide, THF and the like under heating conditions to provide compounds of the formula (12). The compounds of formula (12) may be treated with compounds of formula (13) in solvents such as toluene, mesitylene, benzene and the like under heating to provide compounds of formula (14). The compounds of formula (14) may be treated with a base such as sodium hydroxide, potassium hydroxide, lithium hydroxide and the like in water under heating conditions to provide compounds of formula (11). R 3 -R 2 .COORCH 2 CH 3 NHR 1 (S)

F.squema 6 OHF.sketch 6 OH

Alternativamente, os c tratados com cloromalonato opostos da fórmula (8) podem ser etilo na presença de uma base 65Alternatively, the opposite chloromalonate-treated c's of formula (8) may be ethyl in the presence of a base 65

ΕΡ 1 560 827/PT tal como trietilamina, diisopropiletilamina, piridina e similares em solventes tais como diclorometano, clorofórmio, tetracloreto de carbono para proporcionar compostos da fórmula (15). Alternativamente, os compostos da fórmula (8) podem ser tratados com cloromalonato de etilo em solventes tais como benzeno ou tolueno sob condições de aquecimento para proporcionar compostos da fórmula (15). Os compostos da fórmula (15) podem ser tratados com etóxido de sódio em etanol para proporcionar compostos da fórmula (12).Such as triethylamine, diisopropylethylamine, pyridine and the like in solvents such as dichloromethane, chloroform, carbon tetrachloride to provide compounds of the formula (15). Alternatively, the compounds of formula (8) may be treated with ethyl chloromalonate in solvents such as benzene or toluene under heating conditions to provide compounds of formula (15). The compounds of formula (15) may be treated with sodium ethoxide in ethanol to provide compounds of formula (12).

Esquema 7Scheme 7

O Esquema 7 mostra a preparação de compostos da fórmula (Va), (Via) ou (Vlb) em que R4 é halo. Os compostos da fórmula (11) podem ser tratados com reagentes conhecidos dos peritos na especialidade e que são utilizados comummente para converter álcoois em cloretos. Por exemplo, os compostos da fórmula (11) podem ser tratados com reagentes incluindo mas não limitado a PC15, PC13, P0C13 ou cloreto de tionilo, com ou sem solventes tais como mas não limitados a diclorometano, clorofórmio e benzeno, para proporcionar compostos da fórmula (Va), (Via) ou (Vlb), que são representativos de compostos em que R4 é cloro. Transformações similares são possíveis utilizando PBr3 ou DAST para converter o referido álcool no correspondente composto da fórmula (Va), (Via) ou (Vlb), em que R4 é brometo e fluoreto, respectivamente.Scheme 7 shows the preparation of compounds of formula (Va), (Way) or (Vlb) wherein R 4 is halo. The compounds of formula (11) may be treated with reagents known to those skilled in the art and commonly used to convert alcohols to chlorides. For example, the compounds of formula (11) may be treated with reagents including but not limited to PC15, PC13, PO13, or thionyl chloride, with or without solvents such as but not limited to dichloromethane, chloroform and benzene, to provide formula (Va), (Via) or (Vlb), which are representative of compounds wherein R4 is chloro. Similar transformations are possible using PBr3 or DAST to convert said alcohol to the corresponding compound of formula (Va), (Via) or (Vlb), wherein R4 is bromide and fluoride, respectively.

Em alternativa, os compostos da fórmula (Va), (Via) ou (Vlb) em que R4 é iodo podem ser preparados por (a), reacção do composto da fórmula (11) com um reagente mesilante tal como cloreto de etanossulfonilo ou anidrido de metanossulfonilo na presença de uma base de amina tal como trietilamina, piridina ou diisopropiletilamina em solventes tais como mas não limitados a diclorometano, acetonitrilo, tetracloreto de 66 ΕΡ 1 560 827/ΡΤ carbono, clorofórmio e (b) tratamento do mesilato assim formado com N-iodosuccinimida. 66 ΕΡ 1 560 827/ΡΤ Esquema 8Alternatively, the compounds of formula (Va), (Route) or (Vlb) wherein R4 is iodo may be prepared by (a) reacting the compound of formula (11) with a mesylating reagent such as ethanesulfonyl chloride or anhydride of methanesulfonyl in the presence of an amine base such as triethylamine, pyridine or diisopropylethylamine in solvents such as but not limited to dichloromethane, acetonitrile, carbon tetrachloride, chloroform and (b) treatment of the mesylate so formed with N-iodosuccinimide. 66 ΕΡ 1 560 827 / ΡΤ Scheme 8

Como se mostra no Esquema 8, os compostos da fórmula (16) podem ser convertidos em compostos da fórmula (17) que são representativos de compostos da fórmula (Va), (Via) ou (VIb) em que R4 é ReRbN-, por tratamento com uma amina que possui a fórmula RaRbNH, (em que Ra e Rb são como aqui definido) num solvente polar tal como metanol, etanol e similares, sob condições de aquecimento para proporcionar compostos da fórmula (17) .As shown in Scheme 8, compounds of formula (16) may be converted to compounds of formula (17) which are representative of compounds of formula (Va), (Route) or (VIb) wherein R4 is ReRbN-, treatment with an amine having the formula RaRbNH, (wherein Ra and Rb are as defined herein) in a polar solvent such as methanol, ethanol and the like, under heating conditions to provide compounds of formula (17).

Esquema 9Scheme 9

(18)(18)

OH Οχ ,0 &quot;st (19) 1 1 H s (20)OH Οχ, 0 &quot; st (19) 11 H s (20)

Os compostos da fórmula (18) (que são representativos de compostos da fórmula (Va), (Via) ou (VIb) em que R1 é O-Si(isopropilo)3 ou alqum outro qrupo protector de éter facilmente removido) podem ser tratados com um reagente contendo fluoreto para proporcionar compostos da fórmula (19). A porção hidroxilamina dos compostos da fórmula (19) pode ser tratada com uma base tal como hidreto de sódio em solventes tais como dimetilformamida ou hexametildisilazida de litio em solventes tais como mas não limitados a THF, dioxano e similares, seguindo-se a adição de Rk-X (em que Rk é alcoxialquilo, alcoxicarbonilo, alcoxicarbonilalquilo, alquilo, alquilcarbonilalquilo, alquilsulfanilalquilo, alquilsulfonilalquilo, arilo, arilalquilo, 67 ΕΡ 1 560 827/ΡΤ arilsulfanilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, formilalquilo, haloalcoxialquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo, heterocicloalquilo, hidroxialquilo, nitroalquilo, RcRdN-alquil- ou RcRdNC (0) alquil-, e em que X é Br, Cl, I, CF3S(0)2-, CH3S(0)2- ou tosilo) para proporcionar compostos da fórmula (20) que são representativos de compostos da fórmula (Va), (via) ou (vib) onde R1 é definido como RkO-.Compounds of formula (18) (which are representative of compounds of formula (Va), (Way) or (VIb) wherein R 1 is O-Si (isopropyl) 3 or another easily removable ether protecting group) can be treated with a fluoride-containing reagent to provide compounds of formula (19). The hydroxylamine moiety of the compounds of formula (19) may be treated with a base such as sodium hydride in solvents such as lithium dimethylformamide or hexamethyldisilazide in solvents such as but not limited to THF, dioxane and the like, followed by addition of Rk-X (wherein Rk is alkoxyalkyl, alkoxycarbonyl, alkoxycarbonylalkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfonylalkyl, aryl, arylalkyl, carboxylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkoxyalkyl, (0) 2, CH 3 S (O) 2, CH 3 S (O) 2, CH 3 S (O) 2, CH 3 S (O) 2, CH 2 O, or tosyl) to provide compounds of formula (20) which are representative of compounds of formula (Va), (way) or (vib) where R 1 is defined as R 10 O-.

Esquema 10Scheme 10

(21) (22) (23)(21) (22) (23)

Os compostos da fórmula (21) podem ser tratados com base aquosa tal como mas não limitado a hidróxido de potássio, hidróxido de sódio e similares, para proporcionar compostos da fórmula (22). Os compostos da fórmula (22) podem ser tratados com uma base de hidreto metálico tal como hidreto de sódio, um reagente de organolítio (e.g. t-BuLi, n-BuLi ou s-BuLi) ou hexametildisilazida de lítio, num solvente apropriado ou uma mistura de solventes seleccionados de THF, DMSO, DMF, dioxano, éter, diclorometano e similares, seguindo-se a adição de RaX em que X é Br, Cl, I, CF3S(0)2-, CH3S(0)2- ou tosilo, para proporcionar compostos da fórmula (23) que são representativos de compostos da fórmula (Va), (Via) ou (VIb) em que R1 é -NHRa.The compounds of formula (21) may be treated with aqueous bases such as but not limited to potassium hydroxide, sodium hydroxide and the like, to provide compounds of formula (22). The compounds of formula (22) may be treated with a metal hydride base such as sodium hydride, an organolithium reagent (eg t-BuLi, n-BuLi or s-BuLi) or lithium hexamethyldisilazide in an appropriate solvent or A mixture of solvents selected from THF, DMSO, DMF, dioxane, ether, dichloromethane and the like, followed by the addition of RaX wherein X is Br, Cl, I, CF 3 S (O) 2, CH 3 S (O) 2 - or tosyl, to provide compounds of formula (23) which are representative of compounds of formula (Va), (Way) or (VIb) wherein R 1 is -NHR a.

Esquema 11Scheme 11

Alternativamente, os compostos da fórmula (22) podem ser tratados com aldeidos ou cetonas de estrutura RfRgC(0) sem 68 ΕΡ 1 560 827/ΡΤ solventes ou com solventes tais como mas não limitado a dimetilacetamida, tetra-hidrofurano, dioxano e similares sob condições de aquecimento, para proporcionar compostos da fórmula (24) . A redução dos compostos da fórmula (24) com hidrogénio e um catalisador tal como paládio e similares ou um hidreto metálico tal como boro-hidreto de litio, cianoboro-hidreto de sódio e similares proporciona compostos da fórmula (25) .Alternatively, the compounds of formula (22) may be treated with aldehydes or ketones of structure R f R g C (0) without solvents or with solvents such as but not limited to dimethylacetamide, tetrahydrofuran, dioxane and the like under heating conditions to provide compounds of formula (24). Reduction of the compounds of formula (24) with hydrogen and a catalyst such as palladium and the like or a metal hydride such as lithium borohydride, sodium cyanoborohydride and the like provides compounds of formula (25).

Esquema 12Scheme 12

R1 08)R1 08)

Os compostos da fórmula (12) podem reagir com soluções de base aquosa tais como hidróxido de potássio e similares sob condições de aquecimento para proporcionar compostos da fórmula (26) . Os compostos da fórmula (26) podem reagir com uma base num solvente ou misturas de solventes tais como, mas não limitado a, N,N-dimetilformamida, tetra-hidrofurano, éter dietilico ou éter metiltert-butílico e similares, seguindo-se tratamento com dissulfureto de carbono a uma temperatura desde cerca da temperatura ambiente até cerca de 70°C. Exemplos da base incluem, mas não estão limitados a, hidreto de sódio, hidreto de potássio, diisopropilamida de litio, hexametildisilazida de sódio e hexametildisilazida de litio. O tratamento subsequente com um reagente metilante a uma temperatura de cerca de 25°C proporciona compostos da fórmula (27) . Exemplos do agente metilante incluem, mas não limitado a, iodeto de metilo, triflato de metilo, sulfato de dimetilo e similares. 69 ΕΡ 1 560 827/ΡΤThe compounds of formula (12) may be reacted with aqueous solutions such as potassium hydroxide and the like under heating to provide compounds of formula (26). The compounds of the formula (26) may be reacted with a base in a solvent or mixtures of solvents such as, but not limited to, N, N-dimethylformamide, tetrahydrofuran, diethyl ether or methyltert-butyl ether and the like, followed by treatment with carbon disulfide at a temperature from about room temperature to about 70 ° C. Examples of the base include, but are not limited to, sodium hydride, potassium hydride, lithium diisopropylamide, sodium hexamethyldisilazide and lithium hexamethyldisilazide. Subsequent treatment with a methylating reagent at a temperature of about 25 ° C affords compounds of formula (27). Examples of the methylating agent include, but are not limited to, methyl iodide, methyl triflate, dimethyl sulfate and the like. 69 ΕΡ 1 560 827 / ΡΤ

Alternativamente, os compostos da fórmula (26) podem reagir com metilsulfato de tris(metiltio)metilo na presença de uma base num solvente tal como 1,4-dioxano ou dimetilacetamida e similares, a uma temperatura de cerca de 25°C a cerca de 150°C, para gerar compostos da fórmula (27). Exemplos da base incluem, mas não limitados a, bases de amina orgânica tais como imidazole, 1-metilimidazole, 2-metilimidazole, 2- isopropilimidazole, 4-metilimidazole, 4-nitroimidazole, piridina, N,N-dimetilaminopiridina, 1,2,4-triazole, pirrole, 3- metilpirrole, trietilamina, diisopropiletilamina ou N-metilmorfolina e similares.Alternatively, the compounds of formula (26) may be reacted with tris (methylthio) methyl methylsulfate in the presence of a base in a solvent such as 1,4-dioxane or dimethylacetamide and the like at a temperature of from about 25 ° C to about 150 ° C to generate compounds of formula (27). Examples of the base include but are not limited to organic amine bases such as imidazole, 1-methylimidazole, 2-methylimidazole, 2-isopropylimidazole, 4-methylimidazole, 4-nitroimidazole, pyridine, N, N-dimethylaminopyridine, 4-triazole, pyrrole, 3-methylpyrrole, triethylamine, diisopropylethylamine or N-methylmorpholine and the like.

Os compostos da fórmula (27) podem ser tratados com compostos tal como (13) num solvente ou numa mistura de solventes tais como, mas não limitado a, tolueno, benzeno, dioxano ou tetra-hidrofurano e similares, a uma temperatura de cerca de 50°C a cerca de 150°C para proporcionar compostos da fórmula (11) .The compounds of formula (27) may be treated with compounds such as (13) in a solvent or a mixture of solvents such as, but not limited to, toluene, benzene, dioxane or tetrahydrofuran and the like, at a temperature of about 50 ° C to about 150 ° C to provide compounds of the formula (11).

Esquema 13Scheme 13

&lt;M)&lt; M)

Os compostos da fórmula (29) em que X é I, Br, Cl ou F podem ser tratados com alquiltióis tais como benzenometiltiol na presença de uma base tal como carbonato de sódio em solventes tal como etanol e similares sob condições de aquecimento para gerar compostos da fórmula (30) . O tratamento de (30) com cloro gás em ácido clorídrico ou ácido acético proporciona compostos da fórmula (31) . Os compostos da fórmula (31) em solventes tais como mas não limitado a diclorometano, tetra-hidrofurano ou dioxano podem ser tratados com amoníaco ou hidróxido de amónio para gerar compostos da fórmula (32). A redução de compostos da fórmula (32) com ferro em pó e cloreto de amónio em solventes alcoólicos aquosos tais como metanol ou 70 ΕΡ 1 560 827/ΡΤ etanol sob condições de aquecimento, opcionalmente com ferro em pó em ácido acético sob condições de aquecimento, proporciona compostos da fórmula (13).Compounds of formula (29) wherein X is I, Br, Cl or F may be treated with alkylthiols such as benzenemethylthiol in the presence of a base such as sodium carbonate in solvents such as ethanol and the like under heating to generate compounds of formula (30). Treatment of (30) with chlorine gas in hydrochloric acid or acetic acid provides compounds of formula (31). Compounds of formula (31) in solvents such as but not limited to dichloromethane, tetrahydrofuran or dioxane may be treated with ammonia or ammonium hydroxide to generate compounds of formula (32). Reduction of compounds of formula (32) with iron powder and ammonium chloride in aqueous alcoholic solvents such as methanol or ethanol under heating conditions, optionally with iron powder in acetic acid under heating conditions , provides compounds of formula (13).

Esquema 14 (Comparativo)Scheme 14 (Comparative)

Os compostos da fórmula (33) podem ser tratados com nitrato de amónio na presença de um ácido sulfúrico como solvente sob condições de arrefecimento para qerar compostos da fórmula (34). A redução de compostos da fórmula (34) com ferro em pó e cloreto de amónio em solventes alcoólicos aquosos tais como metanol ou etanol sob condições de aquecimento proporciona compostos da fórmula (35). Em alternativa, a redução também pode ser conseguida por tratamento de compostos da fórmula (35) com ferro em pó em ácidos tais como mas não limitados ácido acético ou ácido clorídrico diluído sob condições de aquecimento. O tratamento de compostos da fórmula (35) com um ortoéster da fórmula (36) sob condições de aquecimento proporciona compostos da fórmula (37).The compounds of formula (33) may be treated with ammonium nitrate in the presence of a sulfuric acid as the solvent under cooling conditions to yield compounds of formula (34). Reduction of compounds of formula (34) with iron powder and ammonium chloride in aqueous alcoholic solvents such as methanol or ethanol under heating conditions affords compounds of formula (35). Alternatively, the reduction can also be achieved by treating compounds of formula (35) with iron powder in acids such as but not limited to acetic acid or dilute hydrochloric acid under heating conditions. Treatment of compounds of formula (35) with an orthoester of formula (36) under heating conditions affords compounds of formula (37).

Esquema 15 (Comparativo)Scheme 15 (Comparative)

(39) 71 ΕΡ 1 560 827/ΡΤ(39) 71 ΕΡ 1 560 827 / ΡΤ

Os compostos da fórmula (35) podem ser tratados com brometo de cianogénio sob condições de aquecimento para gerar compostos da fórmula (38). O tratamento de compostos da fórmula (38) com R8X em que X é Br, Cl ou I, R8C02C1 ou R8S02C1 na presença de uma base de amina tal como trietilamina, piridina ou uma base inorgânica tal como carbonato de césio ou carbonato de potássio num solvente apropriado ou numa mistura de solventes seleccionados de dimetilacetamida, N,N-dimetil-formamida, metanol, diclorometano, tetra-hidrofurano ou acetonitrilo e similares proporciona compostos da fórmula (39).The compounds of formula (35) may be treated with cyanogen bromide under heating conditions to generate compounds of formula (38). Treatment of compounds of formula (38) with R 8 X wherein X is Br, Cl or I, R 8 CO 2 Cl or R 8 SO 2 Cl in the presence of an amine base such as triethylamine, pyridine or an inorganic base such as cesium carbonate or potassium carbonate in solvent or a mixture of solvents selected from dimethylacetamide, N, N-dimethylformamide, methanol, dichloromethane, tetrahydrofuran or acetonitrile and the like provides compounds of formula (39).

Esquema 16 (Comparativo)Scheme 16 (Comparative)

Os compostos da fórmula (40) podem ser nitrados com nitrato de amónio ou nitrato de potássio na presença de um ácido tal como ácido sulfúrico ou ácido trifluoroacético em anidrido trifluoroacético, com ou sem solvente adicional, sob condições de arrefecimento para gerar compostos da fórmula (41). A redução de compostos da fórmula (41) com ferro em pó e cloreto de amónio em solventes alcoólicos aquosos tais como metanol ou etanol sob condições de aquecimento proporciona compostos da fórmula (42). Alternativamente, a redução de compostos da fórmula (42) também pode ser conseguida utilizando ferro em pó em ácidos tais como mas não limitados a ácido acético ou ácido clorídrico diluído sob condições de aquecimento. Os compostos da fórmula (42) podem ser convertidos em compostos da fórmula (44) por (a) nitração e (b) redução do produto do passo (b), utilizando as respectivas condições, tal como anteriormente mencionado. Os compostos da fórmula (44) podem ser tratados com um ortoéster da fórmula 72 ΕΡ 1 560 827/ΡΤ (36) sob condições de aquecimento para proporcionar compostos da fórmula (45). 72 ΕΡ 1 560 827/ΡΤ Esquema 17The compounds of formula (40) may be nitrated with ammonium nitrate or potassium nitrate in the presence of an acid such as sulfuric acid or trifluoroacetic acid in trifluoroacetic anhydride with or without additional solvent under cooling conditions to generate compounds of the formula 41). Reduction of compounds of formula (41) with iron powder and ammonium chloride in aqueous alcoholic solvents such as methanol or ethanol under heating conditions affords compounds of formula (42). Alternatively, reduction of compounds of formula (42) may also be achieved using iron powder in acids such as but not limited to acetic acid or dilute hydrochloric acid under heating conditions. The compounds of formula (42) may be converted into compounds of formula (44) by (a) nitration and (b) reduction of the product of step (b), using the respective conditions, as previously mentioned. The compounds of the formula (44) may be treated with an orthoester of the formula 72 ° C under heating conditions to provide compounds of the formula (45). 72 ΕΡ 1 560 827 / ΡΤ Scheme 17

o o I 'N^-VCI (49) H(49) H

(S4)(S4)

1¾1 (47)1¾1 (47)

O O 3? OH NO O 3? OH N

TyS (49) fcTyS (49) fc

Os compostos da fórmula (42) em que os grupos R2 e R3 juntamente com os átomos de carbono aos quais estão ligados formam um anel fenilo ou piridilo opcionalmente substituído com (R6) m e NH, éCompounds of formula (42) wherein the groups R 2 and R 3 together with the carbon atoms to which they are attached form a phenyl or pyridyl ring optionally substituted with (R 6) m and NH, is

ou em que os grupos R2 e R3 juntamente com os átomos de carbono aos quais estão ligados formam um anel piridilo opcionalmente substituído com (R6)m eor wherein the R2 and R3 groups together with the carbon atoms to which they are attached form a pyridyl ring optionally substituted with (R6) m and

podem ser sulfonilados com um cloreto de sulfonilo de fórmula RaS02Cl na presença de uma base tal como piridina isolada ou uma base de amina tal como trietilamina, diisopropiletilamina e similares num solvente ou combinação de solventes tal como diclorometano, tetra-hidrofurano ou dioxano, para proporcionar compostos da fórmula (46). Alternativamente, os compostos da fórmula (42) podem ser sulfamoilados na presença de uma base de amina tal como mas não limitado a trietilamina ou diisopropiletilamina e similares, num solvente ou combinação de solventes tais como diclorometano, tetra-hidrofurano ou dioxano e similares, com compostos da fórmula (49) para gerar compostos 73 ΕΡ 1 560 827/ΡΤ da fórmula (47). Os compostos da fórmula (49) podem ser obtidos por tratamento de isocianato de clorossulfonilo e 2-cloroetanol em condições que são bem conhecidas na arte. Os compostos da fórmula (47) podem ser tratados adicionalmente com uma amina possuindo a fórmula RaRbNH, (onde Ra e Rb são como aqui definido) num solvente ou combinação de solventes tais como diclorometano, thf ou acetonitrilo e similares, sob condições de aquecimento para proporcionar compostos da fórmula (48) . Os compostos da fórmula (42) podem ser sulfamoilados na presença de uma base de amina tal como trietilamina ou diisopropil-etilamina e similares, num solvente ou combinação de solventes tais como diclorometano, tetra-hidrofurano ou dioxano e similares, com compostos da fórmula (54) para qerar compostos da fórmula (48). Os compostos da fórmula (54) podem ser obtidos por tratamento de uma amina da fórmula RaRbNH com cloreto de sulfurilo ou por (a) tratamento de uma amina da fórmula RaRbNH com ácido clorossulfónico e (b) contacto do produto do passo (a) com um agente clorante tal como pentacloreto de fósforo e similares em condições que são bem conhecidas na arte.may be sulfonylated with a sulfonyl chloride of the formula RaS02 Cl in the presence of a base such as isolated pyridine or an amine base such as triethylamine, diisopropylethylamine and the like in a solvent or combination of solvents such as dichloromethane, tetrahydrofuran or dioxane to provide compounds of formula (46). Alternatively, the compounds of formula (42) may be sulfamoylated in the presence of an amine base such as but not limited to triethylamine or diisopropylethylamine and the like, in a solvent or combination of solvents such as dichloromethane, tetrahydrofuran or dioxane and the like, with compounds of formula (49) to generate compounds of the formula (47). The compounds of formula (49) may be obtained by treatment of chlorosulfonyl isocyanate and 2-chloroethanol under conditions which are well known in the art. The compounds of formula (47) may be further treated with an amine having the formula RaRbNH, (where Ra and Rb are as defined herein) in a solvent or combination of solvents such as dichloromethane, thf or acetonitrile and the like, under heating conditions for providing compounds of the formula (48). The compounds of formula (42) may be sulfamoylated in the presence of an amine base such as triethylamine or diisopropylethylamine and the like, in a solvent or combination of solvents such as dichloromethane, tetrahydrofuran or dioxane and the like, with compounds of the formula 54) to yield compounds of formula (48). The compounds of formula (54) may be obtained by treating an amine of the formula RaRbNH with sulfuryl chloride or by (a) treating an amine of the formula RaRbNH with chlorosulfonic acid and (b) contacting the product of step (a) with a chlorinating agent such as phosphorus pentachloride and the like under conditions which are well known in the art.

Similarmente, compostos da fórmula (11) em que R5 é -alquil-NH2 podem ser convertidos em compostos da fórmula (11) em que R5 é -alquil-NHS02NRaRb usando as condições para a transformação de compostos da fórmula (42) em compostos da fórmula (48) . Os compostos da fórmula (11) em que R5 é -alquil-NH2 podem ser convertidos em compostos da fórmula (11) em que R5 é -alquil-NHS02Ra, e pode ser conseguido empregando as condições para a transformação de compostos da fórmula (42) em compostos da fórmula (46).Similarly, compounds of formula (11) wherein R 5 is -alkyl-NH 2 may be converted to compounds of formula (11) wherein R 5 is -alkyl-NHSO 2 NR a R b, using the conditions for the conversion of compounds of formula (42) into formula (48). Compounds of formula (11) wherein R 5 is -alkyl-NH 2 may be converted to compounds of formula (11) wherein R 5 is -alkyl-NHSO 2 R a, and may be achieved employing the conditions for the conversion of compounds of formula ) into compounds of formula (46).

Esquema 18Scheme 18

(53) (52) 74(53) (52)

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Os compostos da fórmula (42) em que os grupos R2 e R3 juntamente com os átomos de carbono aos quais estão ligados formam um anel fenilo ou piridilo opcionalmente substituído com (R6) m eCompounds of formula (42) wherein the groups R 2 and R 3 together with the carbon atoms to which they are attached form a phenyl or pyridyl ring optionally substituted with (R 6) m and

ou em que os grupos R2 e R3 juntamente com os átomos de carbono aos quais estão ligados formam um anel piridilo opcionalmente substituídos com (R6)m eor wherein the R2 and R3 groups together with the carbon atoms to which they are attached form a pyridyl ring optionally substituted with (R6) m and

podem ser sulfamoílados com um cloreto de sulfamoílo de fórmula RcOC (0) NHS02C1 (50), na presença de uma base de amina tal como piridina, trietilamina ou diisopropiletilamina e similares, num solvente ou combinação de solventes tal como diclorometano, tetra-hidrofurano, éter dietílico, benzeno ou acetonitrilo e similares, para proporcionar compostos da fórmula (51). Os compostos da fórmula (50) podem ser preparados por tratamento de um álcool de fórmula RcOH com isocianato de clorossulfonilo num solvente ou combinação de solventes tais como diclorometano, tetracloreto de carbono, éter dietílico, benzeno ou tolueno e similares. Os compostos da fórmula (51) podem ser tratados adicionalmente com um álcool possuindo a fórmula RaOH na presença de tri-n-butil-fosfina ou trifenilfosfina e similares e diisopropilazodi-carboxilato, 1,1(azadicarbonil)piperidina ou dietilazo-dicarboxilato e similares, num solvente ou combinação de solventes tais como diclorometano ou tetra-hidrofurano para proporcionar compostos da fórmula (52) . Alternativamente, os compostos da fórmula (52) em que Ra é metilo podem ser obtidos por metilação de compostos da fórmula (51) com um agente metilante tal como, mas não limitado a, iodeto de metilo, sulfato de dimetilo, trimetilsilildiazometano em condições que são bem conhecidas na arte. A transformação de compostos da 75 ΕΡ 1 560 827/ΡΤ fórmula (52) em compostos da fórmula (53) pode ser conseguida por reacção com um ácido tal como ácido trifluoroacético ou ácido clorídrico ou por condições de hidrogenólise tais como paládio sobre carbono sob hidrogénio gás.may be sulfamoylated with a sulfamoyl chloride of the formula RcOC (O) NHSO2 C1 (50), in the presence of an amine base such as pyridine, triethylamine or diisopropylethylamine and the like, in a solvent or combination of solvents such as dichloromethane, tetrahydrofuran, diethyl ether, benzene or acetonitrile and the like to provide compounds of the formula (51). Compounds of formula (50) may be prepared by treatment of an alcohol of formula RcOH with chlorosulfonyl isocyanate in a solvent or combination of solvents such as dichloromethane, carbon tetrachloride, diethyl ether, benzene or toluene and the like. The compounds of formula (51) may be further treated with an alcohol having the formula RaOH in the presence of tri-n-butyl phosphine or triphenylphosphine and the like and diisopropylazodicarboxylate, 1,1 (azadicarbonyl) piperidine or diethylazo dicarboxylate and the like , in a solvent or combination of solvents such as dichloromethane or tetrahydrofuran to provide compounds of formula (52). Alternatively, the compounds of formula (52) wherein Ra is methyl may be obtained by methylating compounds of formula (51) with a methylating agent such as, but not limited to, methyl iodide, dimethylsulfate, trimethylsilyldiazomethane under conditions are well known in the art. The transformation of compounds of formula (52) into compounds of formula (53) can be achieved by reaction with an acid such as trifluoroacetic acid or hydrochloric acid or by hydrogenolysis conditions such as palladium on carbon under hydrogen gas.

De modo similar, os compostos da fórmula (11) em que R5 é -alquil-NH2 podem ser convertidos em compostos da fórmula (11) em que R5 é -alquil-NHS02NHC00Rc através das condições para a transformação de compostos da fórmula (42) em compostos da fórmula (51).Similarly, compounds of formula (11) wherein R 5 is -alkyl-NH 2 may be converted to compounds of formula (11) wherein R 5 is -alkyl-NHSO 2 NHC 00 R c by conditions for the conversion of compounds of formula (42) in compounds of the formula (51).

Os compostos da fórmula (11) em que R5 é -alquil-NH2 podem ser convertidos em compostos da fórmula (11) em que R5 é -alquil-NHS02N (Ra)COORc pelas condições empregues para a conversão de (51) em (52).Compounds of formula (11) wherein R 5 is -alkyl-NH 2 may be converted to compounds of formula (11) wherein R 5 is -alkyl-NHSO 2 N (Ra) COOR c by the conditions employed for the conversion of (51) to ).

Os compostos da fórmula (11) em que R5 é -alquil-NH2 podem ser convertidos em compostos da fórmula (11) em que R5 é -alquil-NHS02NRaRb pelas condições empregues para a conversão de (52) em (53) . O presente invento será agora descrito em relação a certas concretizações preferidas, que não pretendem limitar o seu âmbito. Pelo contrário, o presente invento cobre todas as alternativas, modificações e equivalentes que podem ser incluídos dentro do âmbito das reivindicações. Assim, os Exemplos seguintes, que incluem concretizações preferidas, irão ilustrar a prática preferida do presente invento, sendo entendido que os Exemplos se destinam à ilustração de certas concretizações preferidas e são apresentados para proporcionar o que se crê ser a descrição mais útil e facilmente percebida dos seus procedimentos e aspectos conceptuais.Compounds of formula (11) wherein R 5 is -alkyl-NH 2 may be converted to compounds of formula (11) wherein R 5 is -alkyl-NHSO 2 NR a R b, by the conditions employed for the conversion of (52) to (53). The present invention will now be described with respect to certain preferred embodiments, which are not intended to limit its scope. Rather, the present invention covers all alternatives, modifications and equivalents that may be included within the scope of the claims. Thus, the following Examples which include preferred embodiments will illustrate the preferred practice of the present invention, it being understood that the Examples are for the illustration of certain preferred embodiments and are presented to provide what is believed to be the most useful and readily perceived disclosure procedures and conceptual aspects.

Os compostos do invento foram nomeados através do programa ACD/ChemSketch version 5.0 (desenvolvido por Advanced Chemistry Development, Inc., Toronto, ON, Canada) ou foram-lhes dados nomes consistentes com a nomenclatura ACD.The compounds of the invention were named through the ACD / ChemSketch version 5.0 program (developed by Advanced Chemistry Development, Inc., Toronto, ON, Canada) or given names consistent with the ACD nomenclature.

Nos Exemplos seguintes, os Exemplos 1-308, 309 (excepto Exemplo 309B), 310-314, 315 (excepto Exemplo 315B), 316-339, 340 (excepto Exemplo 340D), 341-345, 347-349, 350 (excepto 76 ΕΡ 1 560 827/ΡΤIn the following Examples, Examples 1-308, 309 (except Example 309B), 310-314, 315 (except Example 315B), 316-339, 340 (except Example 340D), 341-345, 347-349, 350 76 ΕΡ 1 560 827 / ΡΤ

Exemplo 350C), 351, 352, 354-426, 432 (excepto Exemplo 432B) e 433-471 são Comparativos.Example 350C), 351, 352, 354-426, 432 (except Example 432B) and 433-471 are Comparative.

Exemplo 1 l-butil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 1 1-Butyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo IA 2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado a partir de anidrido 2,3-piridinacarboxílico (11,4 g, 76 mmol) e azida de trimetilsililo (11,0 mL, 80 mmol) de acordo com o procedimento descrito em Synthesis, 1982, 972-973 como um sólido branco (7,27 g, 58%). ΧΗ RMN (300 MHz, DMSO-d6) δ 7,31 (dd, J=7,72, 4,78 Hz, 1H), 8,31 (dd, J=1, 72, 1, 84 Hz, 1H) , 8,66 (dd, J=4, 78, 1, 84 Hz, 1H), 12,27 (s, 1H) .Example 1 2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared from 2,3-pyridinecarboxylic anhydride (11.4 g, 76 mmol ) and trimethylsilyl azide (11.0 mL, 80 mmol) according to the procedure described in Synthesis, 1982, 972-973 as a white solid (7.27 g, 58%). Δ 7.31 (dd, J = 7.72, 4.78 Hz, 1H), 8.31 (dd, J = 1.72, 1.84 Hz, 1H) , 8.66 (dd, J = 4.78, 1.84 Hz, 1H), 12.27 (s, 1H).

Exemplo 1B 1-buti1-2H-pirido[2,3-d][13]oxazina-2,4(1H)-dionaExample 1B 1-butyl-2 H -pyrido [2,3-d] [13] oxazine-2,4 (1H) -dione

Uma suspensão de hidreto de sódio (95%, 0,96 g, 40 mmol) em dimetilacetamida (60 mL) a 10°C sob azoto reagiu com o produto do Exemplo IA (5,7 g, 34,7 mmol) com agitação durante 1 hora e foi tratada com brometo de n-butilo (5,2 g, 38 mmol) e agitada durante 16 horas adicionais. A reacção foi repartida entre acetato de etilo e água. A fase orgânica foi lavada com água e salmoura, seca sobre sulfato de sódio, filtrada e concentrada sob vácuo. O produto em bruto foi purificado por cromatografia instantânea em coluna com sílica gel eluindo com hexano e acetato de etilo (3:1) para gerar o composto em título como um sólido branco, (2,5 g, 33% de rendimento). XH RMN (300 MHz, DMSO-d6) δ 0,92 (t, J=7,35 Hz, 3H), 1,36 (m, 2H), 1,65 (m, 2H), 4,13 (m, 2H) , 7,38 (dd,J=7, 72, 4, 78 Hz, 1H), 8,39 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,77 (dd, J=5,15, 1,84A suspension of sodium hydride (95%, 0.96 g, 40 mmol) in dimethylacetamide (60 mL) at 10 ° C under nitrogen was reacted with the product of Example 1A (5.7 g, 34.7 mmol) with stirring for 1 hour and treated with n-butyl bromide (5.2 g, 38 mmol) and stirred for an additional 16 hours. The reaction was partitioned between ethyl acetate and water. The organic phase was washed with water and brine, dried over sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by flash column chromatography on silica gel eluting with hexane and ethyl acetate (3: 1) to give the title compound as a white solid, (2.5 g, 33% yield). 1 H NMR (300 MHz, DMSO-d 6) δ0.92 (t, J = 7.35 Hz, 3H), 1.36 (m, 2H), 1.65 (m, 2H), 4.13 , 8.38 (dd, J = 7.72, 4.78 Hz, 1H), 8.39 (dd, J = 7.72, 1.84 Hz, 1H), 8.77 (dd, J = 5.15, 1.84

Hz, 1H).Hz, 1H).

Exemplo 1C (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)acetato de etilo O composto em título foi preparado como um sólido branco em dois passos (46% de rendimento) a partir de 2-aminobenzeno- 77 ΕΡ 1 560 827/ΡΤ sulfonamida de acordo com o procedimento descrito em Chemistry of Heterocyclic Compounds (Tradução Inglesa), 1998, 34(7), 791-795. XH RMN (300 MHz, DMSO-d6) δ 1,21 (t, J=7,17 Hz, 3H), 4,16 (q, J=1,23 Hz, 2H), 7,32 (d, J=7,35 Hz, 1H) , 7,47 (m, 1H), 7,69 (m, 1H), 7,82 (dd, J=7,91, 1,29 Hz, 1H), 12,27 (s, 1H).The title compound was prepared as a white solid in two steps (46% yield) from ethyl 2- (2-methoxyphenyl) -1H-benzoimadiazin- aminobenzene-77α-1 560 827 / ΡΤ sulfonamide according to the procedure described in Chemistry of Heterocyclic Compounds, 1998, 34 (7), 791-795. 1 H NMR (300 MHz, DMSO-d 6) δ 1.21 (t, J = 7.17 Hz, 3H), 4.16 (q, J = 1.23 Hz, 2H), 7.32 (d, J = = 7.35 Hz, 1H), 7.47 (m, 1H), 7.69 (m, 1H), 7.82 (dd, J = 7.91, 1.29 Hz, 1H), 12.27 (s, 1H).

Exemplo 1D l-butil-3-(1,1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona A uma solução do produto do Exemplo 1B (0,220 g, 1,0 mmol) e do produto do Exemplo 1C (0,268 g, 1,0 mmol) em THF anidro (10 mL) sob azoto a 0°C adicionou-se hidreto de sódio (95%, 0,10 g, 4,0 mmol). A reacção foi aquecida a refluxo durante 3 horas, arrefecida até 0°C e depois juntou-se-lhe gota a gota ácido acético glacial (2 mL). A mistura resultante foi aquecida a refluxo durante 2 horas, arrefecida até temperatura ambiente e diluída com ácido clorídrico aquoso (0,1 M, 10 mL) . O precipitado resultante foi recolhido por filtração, lavado com água e éter dietílico e seco para gerar o composto em título (0,130 g, 33%). MS (ESI-) m/z 397 (M-H)”.Example 1D 1-Butyl-3- (1,1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) To a solution of the product of Example 1B (0.220 g, 1.0 mmol) and the product of Example 1C (0.268 g, 1.0 mmol) in anhydrous THF (10 mL) under nitrogen at 0øC was added sodium hydride ( 95%, 0.10 g, 4.0 mmol). The reaction was heated at reflux for 3 hours, cooled to 0 ° C and then glacial acetic acid (2 mL) was added dropwise. The resulting mixture was heated to reflux for 2 hours, cooled to room temperature and diluted with aqueous hydrochloric acid (0.1 M, 10 mL). The resulting precipitate was collected by filtration, washed with water and diethyl ether and dried to give the title compound (0.130 g, 33%). MS (ESI-) m / z 397 (M-H).

Uma suspensão agitada do composto em título (0,130 g, 0,326 mmol) em acetonitrilo e água (1:1, 4 mL) reagiu com hidróxido de sódio aquoso (1 M, 0,326 mL, 0,326 mmol), durante aproximadamente 30 minutos quando foi observada uma solução límpida. A solução foi liofilizada para gerar o sal de sódio. XH RMN (300 MHz, DMSO-d6) δ 0,92 (t, J=7,35 Hz, 3H), 1,35 (m, 2H) , 1,58 (m, 2H) , 4,28 (t, J=7,35 Hz, 2H) , 7,13 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,28 (m, 2H) , 7,55 (m, 1H) , 7,66 (dd, J=7, 72, 1,47 Hz, 1H) , 8,37 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,53 (dd,J=4,60, 2, 02 Hz, 1H), 15,92 (s, 1H).A stirred suspension of the title compound (0.130 g, 0.326 mmol) in acetonitrile and water (1: 1, 4 mL) was reacted with aqueous sodium hydroxide (1 M, 0.326 mL, 0.326 mmol) for approximately 30 minutes when observed a clear solution. The solution was lyophilized to give the sodium salt. 1 H NMR (300 MHz, DMSO-d 6) δ0.92 (t, J = 7.35 Hz, 3H), 1.35 (m, 2H), 1.58 (m, 2H), 4.28 (M, 2H), 7.55 (m, 1H), 7.98 (m, 2H), 7.05 , Dd, J = 7.72, 1.84 Hz, 1H), 8.53 (dd, J = 4.60, , 2.02 Hz, 1H), 15.92 (s, 1H).

Exemplo 2 1-[(5-cloro-2-tienil)metil]-3-(1,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 2 1 - [(5-chloro-2-thienyl) methyl] -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridine -2 (1H) -one

Exemplo 2A 1-[(5-cloro-2-tienil)metil]-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-cloro-5- 78Example 2A 1 - [(5-chloro-2-thienyl) methyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to was reacted with the procedure of Example 1B substituting 2-chloro-5-

ΕΡ 1 560 827/PT clorometiltiofeno o brometo de n-butilo (0,195 g, 52%). XH RMN (300 MHz, DMSO-d6) δ 5,38 (s, 2H) , 6,98 (d, J=4,04 Hz, 1H) , 7,08 (d, J=3,6 8 Hz, 1H) , 7,43 (dd, J=7, 72, 4, 78 Hz, 1H), 8,41 (dd, J=7, 72, 1, 84 Hz, 1H), 8,83 (dd, J=4, 78, 1,84 Hz, 1H) .Chloromethylthiophene or n-butyl bromide (0.195 g, 52%). 1 H NMR (300 MHz, DMSO-d 6) δ 5.38 (s, 2H), 6.98 (d, J = 4.04 Hz, 1H), 7.08 (d, J = 1H), 7.43 (dd, J = 7.72, 4.78 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.83 (dd, J = = 4.78, 1.84 Hz, 1H).

Exemplo 2B 1-[(5-cloro-2-tienil)metll]-3-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 2A o produto do Exemplo 1B (0,167 g, 58%). MS (ESI-) m/z 471/473 (Μ-ΗΓ. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 5,53 (s, 2H) , 6,89 (d, J=3,68 Hz, 1H), 7,00 (d, J=3,68 Hz, 1H), 7,20 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,29 (m, 2H) , 7,56 (t, J=1, 72 Hz, 1H) , 7,67 (d, J=7, 72 Hz, 1H) , 8,40 (dd, J=7, 72, 1,84 Hz, 1H) , 8,58 (dd, J=4, 78, 1, 84 Hz, 1H) , 15,73 (S, 1H) .Example 2B 1 - [(5-chloro-2-thienyl) methyl] -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8 -naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 2A for the product of Example 1B (0.167 g, 58%). The sodium salt of the title compound was prepared according to the procedure of Example 1D.1 H NMR (300 MHz, DMSO-d 6) δ 5.53 (m, (d, J = 3.68 Hz, 1 H), 7.00 (d, J = 3.68 Hz, 1 H), 7.20 (dd, J = 7, 72.4 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.67 (t, J = 40 (dd, J = 7, 72, 1.84 Hz, 1H), 8.58 (dd, J = 4.78, 1.84 Hz, 1H), 15.73 (s, 1H).

Exemplo 3 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-(2-etilbutil)- 4- hidroxi-l,8-naftiridin-2(1H)-onaExample 3 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (2-ethylbutyl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 3A 2-[(2-etilbutil)amino]nicotinato de etilo 2-Cloronicotinato de etilo (0,646 g, 3,48 mmol) e 2-etil-butilamina (0,74 g, 7,31 mmol) reagiram num tubo selado a 130°C durante 2 horas. A mistura reaccional foi repartida entre diclorometano e água. A fase aquosa foi extraída com diclorometano (2x50 mL). As fases orgânicas foram combinadas e secas sobre sulfato de magnésio, filtradas e concentradas. O resíduo foi purificado por cromatografia em coluna em sílica gel eluindo com hexano/acetato de etilo (19:1) para proporcionar o composto em título (0,665 g, 76%). MS (ESI+) m/z 251,1 (M+H)+; ΧΗ RMN (300 MHz, CDC13) δ 0,93 (t, J=7,54 Hz, 6H), 1,41 (m, 7H), 1,55 (m, 1H), 3,46 (m, 2H), 4,32 (q, J=6,99 Hz, 2H), 6,48 (dd, J=7, 72, 4, 78 Hz, 1H), 7,99 (s, 1H) , 8,11 (dd, J=7,72, 2,21 Hz, 1H), 8,27 (dd, J=4, 78, 1, 84 Hz, 1H). 79 ΕΡ 1 560 827/ΡΤEthyl 2 - [(2-ethylbutyl) amino] nicotinate Ethyl 2-Chloronicotinate (0.646 g, 3.48 mmol) and 2-ethylbutylamine (0.74 g, 7.31 mmol) were reacted in a sealed tube at 130 ° C for 2 hours. The reaction mixture was partitioned between dichloromethane and water. The aqueous layer was extracted with dichloromethane (2 x 50 mL). The organic phases were combined and dried over magnesium sulfate, filtered and concentrated. The residue was purified by silica gel column chromatography eluting with hexane / ethyl acetate (19: 1) to provide the title compound (0.665 g, 76%). MS (ESI +) m / z 251.1 (M + H) +; NMR (300 MHz, CDCl 3) δ0.93 (t, J = 7.54 Hz, 6H), 1.41 (m, 7H), 1.55 (m, 1H), 3.46 (m, 2H , 4.38 (dd, J = 7, 7, 7, 8 Hz, 1H), 7.99 (s, 1H), 8.11 (dd, J = 7.72, 2.21 Hz, 1H), 8.27 (dd, J = 4.78, 1.84 Hz, 1H). 79 ΕΡ 1 560 827 / ΡΤ

Exemplo 3Β 1-(2-etilbutil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O produto do Exemplo 3A (0,664 g, 2,65 mmol) e difosgénio (1,57 g, 7,96 mmol) em 13 mL de 1,2-dicloroetano e 1,3 mL de 1,4-dioxano reagiram a 80°C durante 16 horas. A reacção foi concentrada sob vácuo e o residuo foi purificado por cromatografia instantânea em coluna em silica gel eluindo com hexano/acetato de etilo (9:1) para proporcionar o composto em titulo (0,235 g, 36%). ΧΗ RMN (300 MHz, CDC13) δ 0,95 (m, 6H), 1,40 (m, 4H), 1,52 (m, 2H), 4,21 (m, 1H), 7,25 (m, 1H), 8,41 (dd, J=1, 72, 1, 84 Hz, 1H) , 8,70 (dd, J=4, 78, 1,84 Hz, 1H) .Example 3â € ƒâ € ƒâ € ƒ1- (2-ethylbutyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The product of Example 3A (0.664 g, 2.65 mmol) and diphosgene (1.57 g, 7.96 mmol) in 13 mL of 1,2-dichloroethane and 1.3 mL of 1,4-dioxane were reacted at 80 ° C for 16 hours. The reaction was concentrated in vacuo and the residue was purified by flash column chromatography on silica gel eluting with hexane / ethyl acetate (9: 1) to provide the title compound (0.235 g, 36%). Δ NMR (300 MHz, CDCl3) δ 0.95 (m, 6H), 1.40 (m, 4H), 1.52 (m, 2H), 4.21 (m, 1H), 7.25 (m 1H), 8.41 (dd, J = 1.72, 1.84 Hz, 1H), 8.70 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 3C 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-(2-etilbutil)- 4- hidroxi-l,8-naftiridin-2(1H)-ona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 3B o produto do Exemplo 1B (0,041 g, 38%). MS (ESI+) m/z 427, 1 (M+H)+, (ESI-) m/z 425,1 (Μ-ΗΓ; ΧΗ RMN (300 MHz, DMSO-de) δ 0,87 (t, J=7,54 Hz, 6H) , 1,30 (m, 4H), 1,99 (m, 1H), 4,44 (d, J=7,35 Hz, 2H), 7,49 (dd, J=7, 72, 4, 78 Hz, 1H), 7,55 (t, J=7,35 Hz, 1H), 7,68 (d, J=8,09 Hz, 1H), 7,77 (t, J=7,17 Hz, 1H), 7,92 (d, J=8,09 Hz, 1H), 8,57 (dd, J=7,72, 1,84 Hz, 1H), 8,86 (d, J=4,78 Hz, 1H) . O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI + ) m/z 427, 1 (M+H)+, (ESI-) m/z 425,1 (M-H) XH RMN (300 MHz, DMSO-d6) δ 0,86 (t, J=7,35 Hz, 6H) , 1,28 (m, 4H) , 1,91 (m, 1H), 4,25 (d, J=7,35 Hz, 2H) , 7,12 (dd, J=7, 72, 4, 78 Hz, 1H), 7,28 (m, 2H), 7,55 (m, 1H), 7,67 (dd, J=8, 09, 1,47 Hz, 1H) , 8,37 (dd, J=7, 72, 1, 84 Hz, 1H), 8,50 (dd, J=4, 60, 2,02 Hz, 1H), 15,97 (s, 1H).Example 3C 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (2-ethylbutyl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 3B for the product of Example 1B (0.041 g, 38%). MS (ESI +) m / z 427.1 (M + H) +, (ESI-) m / z 425.1 (Μ-NMR: (300 MHz, DMSO-d 6): 0.87 (t, J = = 7.54 Hz, 6H), 1.30 (m, 4H), 1.99 (m, 1H), 4.44 (d, J = 7.35 Hz, 2H), 7.49 (dd, J = = 7.72, 4.78 Hz, 1H), 7.55 (t, J = 7.35 Hz, 1H), 7.68 (d, J = 8.09 Hz, 1H), 7.77 (t , J = 7.17 Hz, 1H), 7.92 (d, J = 8.09 Hz, 1H), 8.57 (dd, J = 7.72, 1.84 Hz, 1H), 8.86 (d, J = 4.78 Hz, 1H) The sodium salt of the title compound was prepared according to the procedure of Example 1D MS (ESI +) m / z 427.1 (M + H) +, NMR (300 MHz, DMSO-d 6) δ0.86 (t, J = 7.35 Hz, 6H), 1.28 (m, 4H), 1.45 (m, 1H), 4.25 (d, J = 7.35 Hz, 2H), 7.12 (dd, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 2H), 7.55 (m, 1H), 7.67 (dd, J = 8.9, 1.47 Hz, 1H), 8.37 (dd, J = 7.72, 1.84 Hz, 1H ), 8.50 (dd, J = 4.60, 2.02 Hz, 1H), 15.97 (s, 1H).

Exemplo 4 1-[(5-bromo-2-tienil)metil]-3-(1, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 4 1 - [(5-bromo-2-thienyl) methyl] -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridine -2 (1H) -one

Exemplo 4A 1-[(5-bromo-2-tienil)metil]-2H-pirido[2,3-d] [1,3]oxazina-2, 4(1H)-diona 80 ΕΡ 1 560 827/ΡΤ Ο composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-bromo-5- clorometiltiofeno o brometo de n-butilo (0,229 g/ 55%) . XH RMN (300 MHz, DMSO-d6) δ 5,40 (s, 2H), 7, 06 (m, 2H), 7, 43 (dd, J=7,72, 4,78 Hz, 1H), 8, 41 (dd, J=7,72, 1, 84 Hz, 1H), 8,83 (dd, J=4,78, 1,84 Hz, 1H).Example 4A 1 - [(5-bromo-2-thienyl) methyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione 80 ΕΡ 1 560 827 / ΡΤ Ο The title compound was prepared according to the procedure of Example 1B substituting 2-bromo-5-chloromethylthiophene for n-butyl bromide (0.229 g / 55%). 1 H NMR (300 MHz, DMSO-d 6) δ 5.40 (s, 2H), 7.06 (m, 2H), 7.43 (dd, J = 7.72, 4.78 Hz, , 41 (dd, J = 7.72, 1.84 Hz, 1H), 8.83 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 4B 1-[(5-bromo-2-tienil)metil]-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 4A o produto do Exemplo 1B (0,208 g, 60%). MS (ESI-) m/z 515/517 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. :H RMN (300 MHz, DMSO-d6) δ 5,55 (s, 2H) , 6,97 (d, J=3,68 Hz, 1H) , 7,00 (d, J=3,6 8 Hz, 1H), 7,20 (dd, J=7, 73, 4, 78 Hz, 1H) , 7,29 (m, 2H), 7,56 (m, 1H), 7,68 (d, J=1,12 Hz, 1H), 8,40 (dd, J=7, 72, 2,21 Hz, 1H) , 8,58 (dd, J=4, 78, 2,20 Hz, 1H) , 15,73 (s, 1H) .Example 4B 1 - [(5-bromo-2-thienyl) methyl] -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridine -2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 4A for the product of Example 1B (0.208 g, 60%). MS (ESI-) m / z 515/517 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.55 (s, 2H), 6.97 (d, J = 3.68 Hz, 1H), 7.00 (d, J = 3.68 Hz , 7.20 (dd, J = 7.73, 4.78 Hz, 1H), 7.29 (m, 2H), 7.56 (m, 1H), 7.68 (d, J = (Dd, J = 7.72, 2.21 Hz, 1H), 8.58 (dd, J = 4.78, 2.20 Hz, 1H) 73 (s, 1H).

Exemplo 5 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-metilbenzil)-1,8-naftiridin-2(1H) -onaExample 5 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-methylbenzyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 5A 1-(3-metilbenzil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por brometo de 3-metilbenzilo o brometo de n-butilo (0,305 g, 62%). MS (DCI) m/z 269 (M+H)+.Example 5A 1- (3-methylbenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by 3-methylbenzyl bromide or n-butyl bromide (0.305 g, 62%). MS (DCI) m / z 269 (M + H) +.

Exemplo 5B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-metilbenzil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 5A o produto do Exemplo 1B (0,112 g, 72%). MS (ESI-) 81 ΕΡ 1 560 827/ΡΤ m/z 445 (Μ-Η) . Ο sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1R RMN (300 MHz, DMSO-de) δ 2,23 (s, 3H) , 5,48 (s, 2H) , 7,01 (m, 3H), 7,14 (t, 7=7,35 Hz, 2H), 7,28 (m, 2H) , 7,56 (td, J=7,72, 1,47 Hz, 1H), 7,67 (dd, J=7, 72, 1, 47 Hz, 1H) , 8,41 (dd, J=7,72, 1,84 Hz, 1H), 8,48 (dd, J=4, 78, 1,84 Hz, 1H), 15,86 (s,lH).Example 5B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-methylbenzyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 5A for the product of Example 1B (0.112 g, 72%). MS (ESI-) 81 ΕΡ 1 560 827 / ΡΤ m / z 445 (Μ-Η). The title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.23 (s, 3H), 5.48 (s, 2H), 7.01 (m, 3H), 7.14 (t, J = 7.35 Hz) 2H), 7.28 (m, 2H), 7.56 (td, J = 7.72, 1.47 Hz, 1H), 7.67 (dd, J = 7.72, 1.47 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.48 (dd, J = 4.78, 1.84 Hz, 1H), 15.86 (s, 1H ).

Exemplo 6 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-nitrobenzil)-1,8-naftiridin-2(1H)-onaExample 6 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-nitrobenzyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 6A 1-(3-nitrobenzil)-2H-pirido[2,3-d] [1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por brometo de 3-nitrobenzilo o brometo de n-butilo (0,147 g, 28%). MS (DCI) m/z 300 (M+H)\Example 6A 1- (3-nitrobenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by 3-nitrobenzyl bromide or n-butyl bromide (0.147 g, 28%). MS (DCI) m / z 300 (M + H) +.

Exemplo 6B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-nitrobenzil)-1,8-naftiridin-2(lH)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 6A o produto do Exemplo 1B (0,032 g, 42%). MS (ESI-) m/z 476 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. :Η RMN (300 MHz, DMSO-de) δ 5,62 (s, 2H), 7,19 (dd, J=7, 72, 4,78 Hz, 1H), 7,29 (td, J=8,36, 1,29 Hz, 2H) , 7,56 (t, J=8,46 Hz, 1H), 7,58 (t, J=7, 72 Hz, 1H) , 7,67 (d, J=8,09 Hz, 1H) , 7,74 (d, J=8,09 Hz, 1H), 8,08 (m, 2H), 8,43 (dd, J=7, 54, 2, 02 Hz, 1H), 8,50 (dd, J=4, 60, 2, 02 Hz, 1H) , 15,76 (s, 1H) .Example 6B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-nitrobenzyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 6A for the product of Example 1B (0.032 g, 42%). MS (ESI-) m / z 476 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 5.62 (s, 2H), 7.19 (dd, J = 7.72, 4.78 Hz, 1H), 7.29 (td, J = 8). (D, J = 8.46 Hz, 1H), 7.58 (t, J = 7.72 Hz, 1H), 7.67 (d, J = = 8.09 Hz, 1H), 7.74 (d, J = 8.09 Hz, 1H), 8.08 (m, 2H), 8.43 (dd, J = , 1H), 8.50 (dd, J = 4.60, 2.02 Hz, 1H), 15.76 (s, 1H).

Exemplo 7 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-tienilmetil)-1,8-naftiridin-2(1H)-onaExample 7 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-thienylmethyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 7A 1-(3-tienilmetil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 3-(bromometil)- 82 ΕΡ 1 560 827/ΡΤ tiofeno ο brometo de n-butilo (0,170 g, 52%). XH RMN (300 MHz, DMSO-ds) δ 5,32 (s, 2H) , 7,15 (m, 1H) , 7,40 (dd, J=7,72, 4,78 Hz, 1H), 7,48 (m, 2H) , 8,41 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,76 (dd, J=4,78, 1,84 Hz, 1H).Example 7A 1- (3-Thienylmethyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting for 3- (bromomethyl) -82-ethane-560,827 / thiophene, n-butyl bromide (0.170 g, 52%). 1 H NMR (300 MHz, DMSO- d 6) δ 5.32 (s, 2H), 7.15 (m, 1H), 7.40 (dd, J = 7.72, 4.78 Hz, , 48 (m, 2H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.76 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 7B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-tienilmetil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 7A o produto do Exemplo 1B (0,135 g, 48%). MS (ESI-) m/z 437 (M-H) “. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1R RMN (300 MHz, DMSO-de) δ 5,48 (s, 2H) , 7,09 (d, J=4,04 Hz, 1H) , 7,16 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,27 (m, 3H) , 7,38 (dd, J=4,96, 3,13 Hz, 1H), 7,56 (t, J=7,72 Hz, 1H), 7,67 (d, J=8,09 Hz, 1H), 8,39 (dd, J=7,72, 1,66 Hz, 1H), 8,53 (dd, J=4, 78, 1, 66 Hz, 1H) , 15,85 (s, 1H) .Example 7B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-thienylmethyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 7A for the product of Example 1B (0.135 g, 48%). MS (ESI-) m / z 437 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.48 (s, 2H), 7.09 (d, J = 4.04 Hz, 1H), 7.16 (dd, 1H), 7.56 (t, J = 7.72 Hz, 1H), 7.56 (t, J = 7.72 Hz, , 7.67 (d, J = 8.09 Hz, 1H), 8.39 (dd, J = 7.72, 1.66 Hz, 1H), 8.53 (dd, J = , 66 Hz, 1H), 15.85 (s, 1H).

Exemplo 8 1-(3-clorobenzil)-3-(1,l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 8 1- (3-chlorobenzyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 8A 1-(3-clorobenzil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por brometo de 3-clorobenzilo o brometo de n-butilo (0,405 g, 77%). MS (DCI) m/z 289 (M+H)+.Example 8A 1- (3-Chlorobenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by 3-chlorobenzyl bromide or n-butyl bromide (0.405 g, 77%). MS (DCI) m / z 289 (M + H) +.

Exemplo 8B 1-(3-clorobenzil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 8A o produto do Exemplo 1B (0,050 g, 45%). MS (ESI-) m/z 465 (M-H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ 5,50 (s, 2H), 7,18 (dd, J=7,72, 4,78 Hz, 83 ΕΡ 1 560 827/ΡΤ 1Η), 7,27 (m, 6Η), 7,56 (td, J= 7,91, 1,47 Hz, 1H), 7,67 (d, J=7,72 Hz, 1H), 8,42 (dd, J=7,72, 1,84 Hz, 1H), 8,49 (dd, J=4,78, 2,21 Hz, 1H) , 15,78 (s, 1H) .Example 8B 1- (3-chlorobenzyl) -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 8A for the product of Example 1B (0.050 g, 45%). MS (ESI-) m / z 465 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.50 (s, 2H), 7.18 (dd, J = 7.72, 4.78 Hz, 83 ΕΡ 1 560 827 / ΡΤ 1Η), 7.27 J = 7.91, 1.47 Hz, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.78, 2.21 Hz, 1H), 15.78 (s, 1H).

Exemplo 9 1-(3-bromobenzil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-na£tiridin-2(1H)-onaExample 9 1- (3-bromobenzyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 9A 1-(3-bromobenzil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-dlona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por brometo de 3-bromobenzilo o brometo de n-butilo (0,500 g, 82%). MS (DCI) m/z 333 (M+H)+.Example 9A 1- (3-bromobenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dona The title compound was prepared according to the procedure of Example 1B substituting by 3-bromobenzyl bromide or n-butyl bromide (0.500 g, 82%). MS (DCI) m / z 333 (M + H) +.

Exemplo 9B 1-(3-bromobenzil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto doExample 9B 1- (3-bromobenzyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting

Exemplo 9A o produto do Exemplo 1B (0,050 g, 45%). MS (ESI-) m/z 465 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ 5,50 (s, 2H), 7,18 (dd, J=7, 72, 4,78 Hz, 1H), 7,27 (m, 6H), 7,56 (td, J=7,91, 1,47 Hz, 1H), 7,67 (d, J=7,72 Hz, 1H), 8,42 (dd, J=7, 72, 1, 84 Hz, 1H), 8,49 (dd, J=4,78, 2,21 Hz, 1H), 15,78 (S, 1H).Example 9A The product of Example 1B (0.050 g, 45%). MS (ESI-) m / z 465 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.50 (s, 2H), 7.18 (dd, J = 7.72, 4.78 Hz, 1H), 7.27 (m, 6H), 7 , 7.67 (d, J = 7.72 Hz, 1H), 8.42 (dd, J = 7.72, 1.84 1H), 8.49 (dd, J = 4.78, 2.21 Hz, 1H), 15.78 (s, 1H).

Exemplo 10 1-[(2-cloro-l,3-tiazol-5-il)metil]-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 10 1 - [(2-chloro-1,3-thiazol-5-yl) methyl] -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy -1H-8-naphthyridin-2 (1H) -one

Exemplo 10A 1-[(2-cloro-l,3-tiazol-5-il)metil]-2H-pirido[2,3-d][1,3]— oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-cloro-5-bromometiltiazole o brometo de n-butilo (0,360 g, 60%). MS (APCI) m/z 296 (M+H)+; :Η RMN (300 MHz, DMSO-d6) δ 5,45 (s, 84 ΕΡ 1 560 827/ΡΤ 2Η), 7,44 (dd, J=7, 72, 4, 78 Hz, 1H), 7,76 (s, 1H) , 8,42 (dd, J=7,91, 1,65 Hz, 1H), 8,82 (dd, J=4,78, 1,84 Hz, 1H).Example 10A 1 - [(2-chloro-1,3-thiazol-5-yl) methyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione O The title compound was prepared according to the procedure of Example 1B substituting 2-chloro-5-bromomethylthiazole for n-butyl bromide (0.360 g, 60%). MS (APCI) m / z 296 (M + H) +; 1 H-NMR (300 MHz, DMSO-d 6) δ 5.45 (s, 84 ÅΡ 1 560 827 / ΡΤ 2Η), 7.44 (dd, J = 7.72, 4.78 Hz, 76 (s, 1H), 8.42 (dd, J = 7.91, 1.65 Hz, 1H), 8.82 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 10B 1-[(2-cloro-l,3-tiazol-5-il)metil]-3-(1,l-dioxido-4H-l, 2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 10A o produto do Exemplo 1B (0,136 g, 60%). MS (ESI-) m/z 477 (Μ-ΗΓ; XH RMN (300 MHz, DMSO-d6) δ 5,76 (s, 2H) , 7,56 (m, 2H) , 7,65 (d, J=7,35 Hz, 1H) , 7,77 (s, 1H), 7,78 (m, 1H), 7,92 (d, J=8,09 Hz, 1H) , 8,59 (dd, J=8, 09, 1, 84 Hz, 1H) , 8,92 (dd, J=4, 78, 1, 84 Hz, 1H) , 13,72 (s, 1H) .Example 10B 1 - [(2-chloro-1,3-thiazol-5-yl) methyl] -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 10A for the product of Example 1B (0.136 g, 60%). NMR (300 MHz, DMSO-d 6) δ 5.76 (s, 2H), 7.56 (m, 2H), 7.65 (d, J = 1H), 7.78 (m, 1H), 7.92 (d, J = 8.09 Hz, 1H), 8.59 (dd, J = = 8.91, 1.84 Hz, 1H), 8.92 (dd, J = 4.78, 1.84 Hz, 1H), 13.72 (s, 1H).

Exemplo 11 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-(3-fluoro-benzil)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 11 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (3-fluoro-benzyl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 11A 1-(3—fluorobenzil)-2H-pirido[2,3—d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por brometo de 3-fluorobenzilo o brometo de n-butilo (0,382 g, 76%). MS (DCI) m/z 273 (M+H) +.Example 11A 1- (3-fluorobenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by 3-fluorobenzyl bromide or n-butyl bromide (0.382 g, 76%). MS (DCI) m / z 273 (M + H) +.

Exemplo 11B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-(3-fluoro-benzil)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 11a o produto do Exemplo 1B (0,040 g, 37%). MS (ESI-) m/z 449 (M-H) ~. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 5,52 (s, 2H), 7,02 (m, 2H), 7,08 (d, J=7, 72 Hz, 1H), 7,17 (dd, J=7, 72, 4,41 Hz, 1H) , 7,29 (m, 3H), 7,56 (td, J=7,91, 1,47 Hz, 1H) , 7,67 (d, J=8,09 Hz, 1H), 8,41 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,49 (dd, J=4, 78, 1, 84 Hz, 1H), 15,79 (s, 1H). 85 ΕΡ 1 560 827/ΡΤExample 11B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (3-fluoro-benzyl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 11a for the product of Example 1B (0.040 g, 37%). MS (ESI-) m / z 449 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.52 (s, 2H), 7.02 (m, 2H), 7.08 (d, J = 7.72 Hz, 1H), 7.17 (dd J = 7.72, 4.41 Hz, 1H), 7.29 (m, 3H), 7.56 (td, J = 7.91, 1.47 Hz, 1H), 7.67 (d, J = 8.09 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.78, 1.84 Hz, 1H), 15.79 (s, 1H). 85 ΕΡ 1 560 827 / ΡΤ

Exemplo 12 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-onaExample 12 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-methylbutyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 12A 1-(3-metilbutil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-dionaExample 12A 1- (3-methylbutyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione

Uma suspensão de hidreto de sódio (95%, 0,048 g, 2,0 mmol) em dimetilacetamida (2 mL) a 20°C sob azoto reagiu com o produto do Exemplo IA (0,3 g, 1,83 mmol). A mistura reaccional foi agitada durante 1/2 hora e depois tratada com l-bromo-3-metilbutano (0,3 g, 2,0 mmol) e agitada durante mais 16 horas. A reacção foi repartida entre acetato de etilo e água. A fase orgânica foi lavada com água e salmoura, seca sobre sulfato de sódio, filtrada e concentrada sob vácuo. O produto em bruto foi purificado por cromatografia instantânea em coluna em sílica gel eluindo com hexanos e acetato de etilo (3:1) para gerar o composto em título como um sólido branco (0,218 g, 51%). MS (ESI-) m/z 233 (M-H)&quot;. XH RMN (300 MHz, DMSO-d6) δ 0,93 (s, 3H), 0,96 (s, 3H), 1,55 (m, 2H), 1,66 (m, 1H), 4,14 (t, J=7,72 Hz, 2H), 7,37 (dd, J=7,91, 4,96 Hz, 1H), 8,38 (dd, J=1,72, 1,84 Hz, 1H), 8,78 (dd, J=4, 78, 1,84 Hz, 1H).A suspension of sodium hydride (95%, 0.048 g, 2.0 mmol) in dimethylacetamide (2 mL) at 20 ° C under nitrogen was reacted with the product of Example 1A (0.3 g, 1.83 mmol). The reaction mixture was stirred for 1/2 hour and then treated with 1-bromo-3-methylbutane (0.3 g, 2.0 mmol) and stirred for an additional 16 hours. The reaction was partitioned between ethyl acetate and water. The organic phase was washed with water and brine, dried over sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by flash column chromatography on silica gel eluting with hexanes and ethyl acetate (3: 1) to give the title compound as a white solid (0.218 g, 51%). MS (ESI-) m / z 233 (M-H) &quot;. 1 H NMR (300 MHz, DMSO-d 6) δ0.93 (s, 3H), 0.96 (s, 3H), 1.55 (m, 2H), 1.66 (m, 1H), 4.14 (dd, J = 7.91, 4.96 Hz, 1 H), 8.38 (dd, J = 1.72, 1.84 Hz, 1H), 8.78 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 12B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-ona A uma solução do produto do Exemplo 12A (0,216 g, 0,92 mmol) e do produto do Exemplo 1C (0,247 g, 0,922 mmol) em THF anidro (7,5 mL) sob azoto a 20°C adicionou-se hidreto de sódio (95%, 0,089 g, 3,7 mmol). A reacção foi aquecida a refluxo durante 3 horas, arrefecida até 20°C e juntou-se gota a gota ácido acético glacial (2,4 mL). A mistura resultante foi aquecida a refluxo durante 1 hora, arrefecida até 25°C e diluída com ácido clorídrico aquoso (0,5 M, 35 mL). O precipitado resultante foi recolhido por filtração, lavado com água e seco. O produto em bruto foi purificado por cromatografia instantânea em coluna em sílica gel eluindo com hexanos e acetato de etilo (3:1) para gerar o composto em título como um sólido branco (0,031 g, 20%). MS (ESI-) m/z 411 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 411 86Example 12B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-methylbutyl) -1,8-naphthyridin-2 (1H) -one To a solution of the product of Example 12A (0.216 g, 0.92 mmol) and the product of Example 1C (0.247 g, 0.922 mmol) in anhydrous THF (7.5 mL) under nitrogen at 20øC was added hydride sodium (95%, 0.089 g, 3.7 mmol). The reaction was heated at reflux for 3 hours, cooled to 20 ° C and glacial acetic acid (2.4 mL) was added dropwise. The resulting mixture was heated at reflux for 1 hour, cooled to 25øC and diluted with aqueous hydrochloric acid (0.5 M, 35 mL). The resulting precipitate was collected by filtration, washed with water and dried. The crude product was purified by flash column chromatography on silica gel eluting with hexanes and ethyl acetate (3: 1) to give the title compound as a white solid (0.031 g, 20%). MS (ESI-) m / z 411 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 411 86

ΕΡ 1 560 827/PT (Μ-Η)&quot;. ΧΗ RMN (300 ΜΗζ, DMSO-d6) δ 0,95 (s, 3Η) , 0,98 (s, 3Η), 1,47 (m, 2Η), 1,64 (m, 1Η), 4,30 (t, J=7,72 Hz, 2H) , 7,13 (dd, J=7, 72, 4, 78 Hz, 1H), 7,26 (d, J=8,09 Hz, 1H) , 7,30 (d, J=7, 72 Hz, 1H), 7,55 (t, J=7, 72 Hz, 1H) , 7,66 (d, J= 8,09 Hz, 1H), 8,37 (dd, J=7, 72, 1, 84 Hz, 1H), 8,53 (dd, J=4,78, 2,21 Hz, 1H), 15,94 (s, 1H).ΕΡ 1 560 827 / PT (Μ-Η) &quot;. Δ NMR (300 ΜΗζ, DMSO-d 6) δ 0.95 (s, 3,), 0.98 (s, 3,), 1.47 (m, 2,), 1.64 (m, 1 Η), 4.30 (d, J = 8.09 Hz, 1 H), 7.92 (d, J = 7.72 Hz, 2 H), 7.13 (dd, J = 7.72 Hz, 1H), 7.66 (d, J = 8.09 Hz, 1H), 8.37 (d, (dd, J = 7.72, 1.84 Hz, 1H), 8.53 (dd, J = 4.78, 2.21 Hz, 1H), 15.94 (s, 1H).

Exemplo 13 1-(ciclobutilmetil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 13 1- (cyclobutylmethyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 13A 1-(ciclobutilmetil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-dlona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por bromometil-ciclobutano o brometo de n-butilo (0,255 g, 60%). MS (DCI) m/z 233 (M+H)+.Example 13A 1- (Cyclobutylmethyl) -2 H -pyrido [2,3-d] [1,3] oxazine-2,4 (1 H) -dona The title compound was prepared according to the procedure of Example 1B substituting bromomethyl -cyclobutane or n-butyl bromide (0.255 g, 60%). MS (DCI) m / z 233 (M + H) +.

Exemplo 13B 1- (ciclobutilmetil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 13A o produto do Exemplo 1B (0,120 g, 52%). MS (ESI-) m/z 409 (M-H) ~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 1,83 (m, 6H) , 2,79 (m, 1H), 4,38 (d, J=6,99 Hz, 2H), 7,13 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,29 (t, J=7,54 Hz, 2H), 7,55 (t,J=7,72 Hz, 1H), 7,67 (d, J=7,72Example 13B 1- (Cyclobutylmethyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) was prepared according to the procedure of Example 1D substituting the product of Example 13A for the product of Example 1B (0.120 g, 52%). MS (ESI-) m / z 409 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.83 (m, 6H), 2.79 (m, 1H), 4.38 (d, J = 6.99 Hz, 2H), 7.13 (dd J = 7.72, 4.78 Hz, 1H), 7.29 (t, J = 7.54 Hz, 2H), 7.55 (t, J = 7.72 Hz, 1H), 7.67 (d, J = 7.72

Hz, 1H), 8,36 (dd, J=7,72, 2,21 Hz, 1H), 8,51 (dd, J=4,78, 1,84 Hz, 1H), 15,92 (s, 1H) .1H), 8.36 (dd, J = 7.72, 2.21 Hz, 1H), 8.51 (dd, J = 4.78, 1.84 Hz, 1H), 15.92 , 1H).

Exemplo 14 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[(5-metil-2-tienil)metil]-1,8-naftiridin-2(1H)-onaExample 14 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(5-methyl-2-thienyl) methyl] -1,8-naphthyridine -2 (1H) -one

Exemplo 14A 1-[(5-metil-2-tienil)metil]-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona 87 ΕΡ 1 560 827/ΡΤ Ο composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-bromometil-5-metiltiofeno o brometo de n-butilo (0,181 g, 54%). 1K RMN (300 MHz, DMSO-d6) δ 2,36 (s, 3H), 5,38 (s, 2H), 6,63 (m, 1H), 6,98 (d, J=3,68 Hz, 1H), 7,42 (dd, J=7,72, 4,78 Hz, 1H), 8,41 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,82 (dd, J=4, 78, 1,84 Hz, 1H).Example 14A 1 - [(5-methyl-2-thienyl) methyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione 87 ΕΡ 1 560 827 / ΡΤ Ο The title compound was prepared according to the procedure of Example 1B substituting 2-bromomethyl-5-methylthiophene for n-butyl bromide (0.181 g, 54%). 1 H NMR (300 MHz, DMSO-d 6) δ 2.36 (s, 3H), 5.38 (s, 2H), 6.63 (m, 1H), 6.98 (d, J = 3.68 Hz , 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.82 (dd, J = 7.72, 4.78 Hz, J = 4.78, 1.84 Hz, 1H).

Exemplo 14B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[(5-metil-2-tienil)metil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 14A o produto do Exemplo 1B (0,172 g, 58%). MS (ESI-) m/z 451 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 2,32 (s, 3H) , 5,54 (s, 2H), 6,56 (d, 1H), 6,88 (d, J=3,31 Hz, 1H) , 7,17 (dd, J=7, 72, 4, 78 Hz, 1H), 7,28 (m, 2H), 7,56 (t, J=7,72 Hz, 1H), 7,67 (d, J=7,72 Hz, 1H), 8,38 (dd, J=7, 72, 1, 84 Hz, 1H), 8,56 (dd, J=4,78, 1, 84 Hz, 1H), 15,81 (s, 1H).Example 14B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(5-methyl-2-thienyl) methyl] -1,8-naphthyridine -2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 14A for the product of Example 1B (0.172 g, 58%). MS (ESI-) m / z 451 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.32 (s, 3H), 5.54 (s, 2H), 6.56 (d, 1H), 6.88 (d, J = 3.31 Hz , 7.17 (dd, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 2H), 7.56 (t, J = 7.72 Hz, 1H), 7 , 6.78 (dd, J = 7.72, 1.84 Hz, 1 H), 8.56 (dd, J = 4.78, 1.84 Hz, 1H), 15.81 (s, 1H).

Exemplo 15 l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 15 1-benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 15A l-benzil-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por brometo de benzilo o brometo de n-butilo (0,393 g, 51%). MS (DCI) m/z 255 (M+H)+.Example 15A 1-Benzyl-2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting benzyl bromide n-butyl bromide (0.393 g, 51%). MS (DCI) m / z 255 (M + H) +.

Exemplo 15B l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 15A o produto do Exemplo 1B (0,217 g, 62%). MS (ESI-) m/z 431 (M-H)-. O sal de sódio do composto em título foi 88 ΕΡ 1 560 827/ΡΤ preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-dê) δ 5,52 (s, 2H), 7,16 (m, 2H), 7,25 (d, J=4,41 Hz, 4H) , 7,29 (m, 2H), 7,56 (td, J=7,91, 1,47 Hz, 1H), 7,67 (dd, J=7,91, 1,65 Hz, 1H), 8,41 (dd, J=7,54, 2,02Example 15B 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 15A for the product of Example 1B (0.217 g, 62%). MS (ESI-) m / z 431 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.52 (s, 2H), 7.16 (m, 2H), 7.25 (d, J = 4.41 Hz, 4H), 7.29 J = 7.91, 1.47 Hz, 1H), 7.61 (dd, J = 7.91, 1.65 Hz, 1H), 8.41 (dd, J = 7.54, 2.02

Hz, 1H), 8,48 (dd, i7=4,78, 2,21 Hz, 1H), 15,84 (s, 1H) .Hz, 1H), 8.48 (dd, J = 4.78, 2.21 Hz, 1H), 15.84 (s, 1H).

Exemplo 16 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(5-metil-3-piridinil)metil]-1,8-naftiridin-2(1H)-onaExample 16 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(5-methyl-3-pyridinyl) methyl] -1,8-naphthyridine -2 (1H) -one

Exemplo 16A 1-[(5-metil-3-piridinil)metil]-2H-pirido[2,3-d][1,3]oxazina-2, 4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 3-clorometil-5-metilpiridina o brometo de n-butilo (0,080 g, 24%). XH RMN (300 MHz, DMSO-d6) δ 2,25 (s, 3H), 5,34 (s, 2H), 7,40 (dd, J=7, 72, 4, 78 Hz, 1H), 7,63 (br s, 1H), 8,30 (br S, 1H), 8,43 (dd, J=7, 72, 1, 84 Hz, 1H), 8,46 (br s, 1H), 8,73 (dd, J=4,78, 1,84 Hz, 1H).Example 16A 1 - [(5-methyl-3-pyridinyl) methyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to with the procedure of Example 1B substituting 3-chloromethyl-5-methylpyridine and n-butyl bromide (0.080 g, 24%). 1 H NMR (300 MHz, DMSO-d 6) δ 2.25 (s, 3H), 5.34 (s, 2H), 7.40 (dd, J = 7.72, 4.78 Hz, , Br s, 1H), 8.30 (br s, 1H), 8.43 (dd, J = 7.72, 1.84 Hz, 1H), 8.46 (br s, 1H), 8 , 73 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 16B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[(5-metil-3-piridinil)metil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 16A o produto do Exemplo 1B (0,013 g, 13%). MS (ESI-) m/z 446 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 2,22 (s, 3H), 5,49 (s, 2H), 7,18 dd, J=7, 72, 4, 78 Hz, 1H), 7,29 (m, 2H) , 7,44 (s, 1H) , 7,56 (m, 1H), 7,67 (d, J=8,09 Hz, 1H), 8,23 (d, J=l,47 Hz, 1H), 8,36 (d, J=l,47 Hz, 1H), 8,41 (dd, J=7,72, 1,84 Hz, 1H), 8,51 (dd, J=4, 78, 1, 84 Hz, 1H) , 15,80 (S, 1H) .Example 16B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(5-methyl-3-pyridinyl) methyl] -1,8-naphthyridine -2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 16A for the product of Example 1B (0.013 g, 13%). MS (ESI-) m / z 446 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.22 (s, 3H), 5.49 (s, 2H), 7.18 (d, J = 1H), 7.56 (m, 1H), 7.67 (d, J = 8.09 Hz, 1H), 8.23 (d, J = 1). 1H), 8.36 (d, J = 1.47 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.51 (dd, J = = 4.78, 1.84 Hz, 1H), 15.80 (s, 1H).

Exemplo 17 1-[(2-cloro-4-piridinil)metil]-3-(1,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona 89 ΕΡ 1 560 827/ΡΤExample 17 1 - [(2-chloro-4-pyridinyl) methyl] -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridine -2 (1H) -one 89 to 560,827 / ΡΤ

Exemplo 17Α 1- [ (2-cloro-4-piridinil)metil]-2H-pirido[2,3-d] [1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 4-bromometil-2-cloropiridina o brometo de n-butilo (0,219 g, 62%). :Η RMN (300 MHz, DMSO-de) δ 5,37 (s, 2H) , 7,40 (m, 1H), 7,48 (s, 1H), 7,60 (s, 1H), 8,34 (dd, J=4, 60, 2,39 Hz, 1H), 8,45 (m, 1H), 8,68 (m, 1H).Example 17 1 - [(2-chloro-4-pyridinyl) methyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to was reacted with the procedure of Example 1B substituting 4-bromomethyl-2-chloropyridine for n-butyl bromide (0.219 g, 62%). NMR (300 MHz, DMSO-d 6) δ 5.37 (s, 2H), 7.40 (m, 1H), 7.48 (s, 1H), 7.60 (s, 1H) 34 (dd, J = 4.60, 2.39 Hz, 1H), 8.45 (m, 1H), 8.68 (m, 1H).

Exemplo 17B 1- [ (2-cloro-4-piridinil)metil]-3-(1,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 17A o produto do Exemplo 1B (0,255 g, 73%). MS (ESI-) m/z 466/468 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 5,52 (s, 2H) , 7,19 (m, 2H), 7,30 (m, 3H), 7,56 (t, J=7,54 Hz, 1H), 7,67 (d, J=7, 72 Hz, 1H) , 8,27 (d, J=5,15 Hz, 1H), 8,46 (m, 2H), 15,72 (s, 1H).Example 17B 1 - [(2-chloro-4-pyridinyl) methyl] -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridine -2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 17A for the product of Example 1B (0.255 g, 73%). MS (ESI-) m / z 466/468 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.52 (s, 2H), 7.19 (m, 2H), 7.30 (m, 3H), 7.56 (t, J = 7.54 Hz , 7.67 (d, J = 7.72 Hz, 1H), 8.27 (d, J = 5.15 Hz, 1H), 8.46 (m, 2H), 15.72 (s, , 1H).

Exemplo 18 1-[(5-bromo-3-piridinil)metil]-3-(1,l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 18 1 - [(5-bromo-3-pyridinyl) methyl] -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridine -2 (1H) -one

Exemplo 18A (5-bromo-3-piridinil)metilimidodicarbonato de di-tert-butiloExample 18A Di-tert-butyl (5-bromo-3-pyridinyl) methylimidodicarbonate

Uma solução de cloridrato de 5-bromo-3-clorometilpiridínio (716 mg, 4,189 mmol) em DMF anidra (15 mL) sob azoto a 0°C foi tratada com trietilamina (0,65 mL, 4,61 mmol), brometo de tetrabutilamónio (273 mg, 0,838 mmol) e di-tert-butilimidodicarbonato de potássio (1,284 g, 5,027 mmol). A reacção foi aquecida a 50°C-55°C durante 3,5 horas, depois arrefecida até temperatura ambiente, diluída com acetato de etilo (150 mL) e lavada com água (2x50 mL) e cloreto de sódio aquoso saturado. Os extractos combinados foram secos sobre Na2S04 anidro, filtrados e concentrados por evaporação rotativa. O resíduo foi purificado por cromatografia 90 ΕΡ 1 560 827/ΡΤ instantânea em coluna em sílica gel com 6% de acetato de etilo/diclorometano para gerar o composto em título como um óleo incolor (0,980 g, 60%). MS (ESI+) m/z 387/389 (M+H)+; XH RMN (300 MHz, CDC13) δ 1,49 (s, 18H), 4,75 (s, 2H), 7,83 (t, J=2,02 Hz, 1H), 8,50 (d, J=l,84 Hz, 1H), 8,58 (d, J=2,21 Hz, 1H).A solution of 5-bromo-3-chloromethylpyridinium hydrochloride (716 mg, 4.189 mmol) in anhydrous DMF (15 mL) under nitrogen at 0 ° C was treated with triethylamine (0.65 mL, 4.61 mmol), tetrabutylammonium chloride (273 mg, 0.838 mmol) and potassium di-tert-butylimidodicarbonate (1.284 g, 5.027 mmol). The reaction was heated at 50-55 ° C for 3.5 hours, then cooled to room temperature, diluted with ethyl acetate (150 mL) and washed with water (2 x 50 mL) and saturated aqueous sodium chloride. The combined extracts were dried over anhydrous Na2 SO4, filtered and concentrated by rotary evaporation. The residue was purified by flash column chromatography on silica gel with 6% ethyl acetate / dichloromethane to give the title compound as a colorless oil (0.980 g, 60%). MS (ESI +) m / z 387/389 (M + H) +; 1 H NMR (300 MHz, CDCl 3) δ 1.49 (s, 18H), 4.75 (s, 2H), 7.83 (t, J = 2.02 Hz, 1H), 8.50 (d, J = 1.84 Hz, 1H), 8.58 (d, J = 2.21 Hz, 1H).

Exemplo 18B (5-bromo-3-piridinil)metilamina O produto do Exemplo 18A (0,98 g, 2,53 mmol) foi tratado com ácido trifluoroacético e diclorometano (1:1 v/v, 20 mL) durante 2 horas a temperatura ambiente. O solvente foi removido por evaporação rotativa e o óleo resultante foi capturado com benzeno/diclorometano (3 vezes) para gerar um sólido ceroso. O sal foi dissolvido em metanol anidro (20 mL) e agitado com Amberlite IRA-400(OH), resina (10 g) durante 2 horas. A resina foi removida por filtração sob vácuo e completamente lavada com metanol seco. O filtrado foi concentrado por evaporação rotativa para gerar o composto em título (0,415 g, 88%). MS (DCI/NH3) m/z 187/189 (M+H)+; XH RMN (300 MHz, DMSO-de) δ 3,73 (s, 2H) , 8,02 (t, J=2,02 Hz, 1H) , 8,50 (d, J=1,47 Hz, 1H), 8,53 (d, J=2,21 Hz, 1H).Example 18B (0.98 g, 2.53 mmol) was treated with trifluoroacetic acid and dichloromethane (1: 1 v / v, 20 mL) for 2 hours at room temperature. The solvent was removed by rotary evaporation and the resulting oil was captured with benzene / dichloromethane (3 times) to give a waxy solid. The salt was dissolved in anhydrous methanol (20 mL) and stirred with Amberlite IRA-400 (OH), resin (10 g) for 2 hours. The resin was removed by vacuum filtration and thoroughly washed with dry methanol. The filtrate was concentrated by rotary evaporation to give the title compound (0.415 g, 88%). MS (DCI / NH 3) m / z 187/189 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 3.73 (s, 2H), 8.02 (t, J = 2.02 Hz, 1H), 8.50 (d, J = 1.47 Hz, 1H ), 8.53 (d, J = 2.21 Hz, 1H).

Exemplo 18C 2-{[(5-bromo-3-piridinil)metil]amino}nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo pelo produto do Exemplo 18B a 2-etilbutilamina (0,116 g, 68%). MS (DCI/NH3) m/z 336/338 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 1,32 (t, J= 6,99 Hz, 3H), 4,31 (q, J=7,23 Hz, 2H), 4,71 (d, J=5,88 Hz, 2H) , 6,67 (dd, J=7, 72, 4, 78 Hz, 1H), 7,97 (t, J=2,02 Hz, 1H), 8,12 (dd, J=7,72, 2,21 Hz, 1H) , 8,26 (dd, J=4,78, 1, 84 Hz, 1H), 8,45 (t, J=6,07 Hz, 1H), 8,55 (m, 2H).Example 18C Ethyl 2 - {[(5-bromo-3-pyridinyl) methyl] amino} nicotinate The title compound was prepared according to the procedure of Example 3A substituting the product of Example 18B for 2-ethylbutylamine (0.116 g, 68%). MS (DCI / NH 3) m / z 336/338 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.32 (t, J = 6.99 Hz, 3H), 4.31 (q, J = 7.23 Hz, 2H), 4.71 (d, J = = 5.88 Hz, 2H), 6.67 (dd, J = 7.72, 4.78 Hz, 1H), 7.97 (t, J = 2.02 Hz, 1H), 8.12 (dd , J = 7.72, 2.21 Hz, 1H), 8.26 (dd, J = 4.78, 1.84 Hz, 1H), 8.45 (t, J = 6.07 Hz, , 8.55 (m, 2H).

Exemplo 18D 1-[(5-bromo-3-piridinil)metil]-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 18C o produto do Exemplo 3A e purificando por 91 ΕΡ 1 560 827/ΡΤ cromatografia instantânea em coluna em sílica gel eluindo com 10% acetato de etilo/diclorometano (0,057 g, 51%). ΧΗ RMN (300 MHz, DMSO-d6) δ 5,38 (s, 2H) , 7,41 (dd, J=7, 72, 5,15 Hz, 1H), 8,10 (t, J= 2,02 Hz, 1H), 8,43 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,60 (d, J=2,21 Hz, 1H), 8,66 (d, J=l,84 Hz, 1H), 8,72 (dd, J=5,15, 1, 84 Hz, 1H) .Example 18D 1 - [(5-bromo-3-pyridinyl) methyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to with the procedure of Example 3B substituting the product of Example 18C for the product of Example 3A and purifying it by flash chromatography on silica gel eluting with 10% ethyl acetate / dichloromethane (0.057 g, 51%). . 1 H NMR (300 MHz, DMSO-d 6) δ 5.38 (s, 2H), 7.41 (dd, J = 7.72, 5.15 Hz, 1H), 8.10 (t, J = J = 7.72, 1.84 Hz, 1H), 8.60 (d, J = 2.21 Hz, 1H), 8.66 (d, J = 1.84 Hz, 1H), 8.72 (dd, J = 5.15, 1.84 Hz, 1H).

Exemplo 18E 1-[(5-bromo-3-piridinil)metil]-3-(l,l-dioxido-4H-l, 2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 18D o produto do Exemplo 1B (0,037 g, 43%). MS (ESI-) m/z 510/512 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,52 (s, 2H), 7,20 (dd, J=7, 72, 4,78 Hz, 1H), 7,29 (m, 2H), 7,56 (t, J=7,54 Hz, 1H), 7,68 (d, J= 7,35 Hz, 1H), 7,89 (br s, 1H), 8,42 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,52 (dd, J=4, 78, 1, 84 Hz, 1H), 8,55 (br s, 2H), 15,73 (s, 1H) .Example 18E 1 - [(5-bromo-3-pyridinyl) methyl] -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridine -2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 18D for the product of Example 1B (0.037 g, 43%). MS (ESI-) m / z 510/512 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.52 (s, 2H), 7.20 (dd, J = 7.72, 4.78 Hz, 1H), 7.29 (m, 2H), 7 (D, J = 7.35 Hz, 1H), 7.89 (br s, 1H), 8.42 (dd, J = 7). , 7.18 (1H, s), 8.52 (dd, J = 4.78, 1.84 Hz, 1H), 8.55 (br s, 2H), 15.73 (s, 1H).

Exemplo 19 1-(ciclo-hexilmetil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 19 1- (cyclohexylmethyl) -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 19A 1-(ciclo-hexilmetil)-2H-pirido[2,3—d][1,3]oxazina-2,4(1H)~ diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por (bromometil)ciclo-hexano o brometo de n-butilo (0,05 g, 11%).Example 19A 1- (cyclohexylmethyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting for (bromomethyl) cyclohexane or n-butyl bromide (0.05 g, 11%).

Exemplo 19B 1-(ciclo-hexilmetil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 19B 1- (cyclohexylmethyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 19A o produto do Exemplo 1B (0,025 g, 30%). MS (ESI-) m/z 437 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS 92 ΕΡ 1 560 827/ΡΤ (ESI-) m/z 437 (Μ-Η) ; ΧΗ RMN (300 MHz, DMSO-d6/TFA) δ 0,99 (m, 5Η), 1,50 (m, 5Η), 1,87 (m, 1Η) , 4,32 (d, J=7,35 Ηζ, 2Η) , 7,23 (dd, J=8, 09, 4, 78 Hz, 1H) , 7,38 (m, 2H) , 7,57 (m, 1H) , 7,78 (d, J=8,09 Hz, 1H), 8,40 (dd, J=8,09, 1,84 Hz, 1H), 8,66 (dd, J=4, 78, 1, 84 Hz, 1H) .The title compound was prepared according to the procedure of Example 1D substituting the product of Example 19A for the product of Example 1B (0.025 g, 30%). MS (ESI-) m / z 437 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS 92 ΕΡ 1 560 827 / ΡΤ (ESI-) m / z 437 (Μ-Η); Δ NMR (300 MHz, DMSO-d 6 / TFA) δ 0.99 (m, 5), 1.50 (m, 5), 1.87 (m, 1 H), 4.32 (d, J = , 7.38 (m, 2H), 7.57 (m, 1H), 7.78 (d, J = 8.98 Hz, J = 8.09 Hz, 1H), 8.40 (dd, J = 8.09, 1.84 Hz, 1H), 8.66 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 20 3-(1,l-dioxido-4H-l,2,4-benzotladiazin-3-il)-4-hidroxi-l-[(2 S)-2-metilbutil]-1,8-naftiridin-2(1H)-onaExample 20 3- (1,1-dioxido-4 H -1,2,4-benzotladiazin-3-yl) -4-hydroxy-1 - [(2 S) -2-methylbutyl] -1,8-naphthyridin-2 (1H) -one

Exemplo 20A 2-{[(2S)-2-metilbutil]amino}nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por (S)-(-)-2-metil-butilamina a 2-etilbutilamina (1,6 g, 77%). XH RMN (300 MHz, DMSO-d6) δ 0,89 (t, i7=7,23, 3H), 0,91 (d, J=6,62 Hz, 3H), 1,18 (m, 1H), 1,31 (t, J=6,99 Hz, 3H) , 1,42 (m, 1H), 1,66 (m, 1H), 3,35 (m, 2H), 4,29 (q, J=7,23 Hz, 2H) , 6,59 (dd, J=7,72, 4,78 Hz, 1H), 8,01 (t, J=5,52 Hz, 1H), 8,08 (dd, J=7,72, 1,84 Hz,1H), 8,27 (dd, J=4,60, 2,02 Hz, 1H).Example 20A Ethyl 2 - {[(2S) -2-methylbutyl] amino} nicotinate The title compound was prepared according to the procedure of Example 3A substituting 2 (S) - (-) - 2-methyl-butylamine for 2 -ethyl butylamine (1.6 g, 77%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.89 (t, J = 7.23, 3H), 0.91 (d, J = 6.62 Hz, 3H) , 1.31 (t, J = 6.99 Hz, 3H), 1.42 (m, 1H), 1.66 (m, 1H), 3.35 (m, 2H), 4.29 (q, J = 7.23 Hz, 2H), 6.59 (dd, J = 7.72, 4.78 Hz, 1H), 8.01 (t, J = dd, J = 7.72, 1.84 Hz, 1H), 8.27 (dd, J = 4.60, 2.02 Hz, 1H).

Exemplo 20B 1-[(2 S)-2-metilbutil]-2H-pirido[2,3—d] [1,3]oxazina-2,4(1H)- diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 20A o produto do Exemplo 3A (0,400 g, 68%). MS (DCI) m/z 252 (M+NH4)+.Example 20B 1 - [(2S) -2-methylbutyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to The title compound was prepared according to the procedure of Example 3B substituting the product of Example 20A for the product of Example 3A (0.400 g, 68%). MS (DCI) m / z 252 (M + NH 4) +.

Exemplo 20C 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[(2 S)-2-metilbutil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 20B o produto do Exemplo 1B (0,116 g, 43%). MS (ESI-) m/z 411 (M-H)'. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo ID. XH RMN (300 MHz, DMSO-de) δ 0,80 (d, J= 6,99 Hz, 3H) , 0,87 (t, J= 7,54 Hz, 3H), 1,15 (m, 1H), 1,37 (m, 1H), 2,02 (m, 1H), 4,20 93 ΕΡ 1 560 827/ΡΤ (d, J=7,35 Hz, 2H), 7,12 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,27 (m, 2H), 7,55 (m, 1H), 7,66 (d, J=7, 72 Hz, 1H) , 8,37 (dd, J=7, 72, 2,21 Hz, 1H), 8,51 (dd, J=4, 60, 2,02 Hz, 1H), 15,95 (s, 1H) .Example 20C 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(2 S) -2-methylbutyl] -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 20B for the product of Example 1B (0.116 g, 43%). MS (ESI-) m / z 411 (M-H) +. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1 H NMR (300 MHz, DMSO- d 6) δ 0.80 (d, J = 6.99 Hz, 3H), 0.87 (t, J = 7.54 Hz, 3H) ), 1.37 (m, 1H), 2.02 (m, 1H), 4.20 (d, J = 7.35 Hz, 2H), 7.12 (dd, J = (M, 2H), 7.55 (m, 1H), 7.66 (d, J = 7.72 Hz, 1H), 8.37 (dd, J = 7.72, 2.21 Hz, 1H), 8.51 (dd, J = 4.60, 2.02 Hz, 1H), 15.95 (s, 1H).

Exemplo 21 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(4-metilbenzil)-1,8-naftiridin-2(1H)-onaExample 21 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (4-methylbenzyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 21A 1-(4-metilbenzil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 4-metilbrometo de benzilo o brometo de n-butilo (0,402 g, 82%). MS (DCI) m/z 269 (M+H)+.Example 21A 1- (4-methylbenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by benzyl 4-methylbromide or n-butyl bromide (0.402 g, 82%). MS (DCI) m / z 269 (M + H) +.

Exemplo 21B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(4-metilbenzil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 21A o produto do Exemplo 1B (0,099 g, 60%). MS (ESI-) m/z 445 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 2,22 (s, 3H), 5,47 (s, 2H) , 7,04 (d, J=7,72 Hz, 2H), 7,14 (m, 3H), 7,29 (t, J=7,35 Hz, 2H) , 7,55 (t, J=7, 72 Hz, 1H), 7,67 (d; J=7,72 Hz, 1H), 8,39 (dd, J=7,72, 1,84 Hz, 1H), 8,48 (dd, J=4, 78, 1,84 Hz, 1H), 15,85 (S, 1H) .Example 21B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (4-methylbenzyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 21A for the product of Example 1B (0.099 g, 60%). MS (ESI-) m / z 445 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.22 (s, 3H), 5.47 (s, 2H), 7.04 (d, J = 7.72 Hz, 2H), 7.14 J = 7.72 Hz, 1H), 7.67 (d, J = 7.72 Hz, 1H), 7.55 (t, 8.48 (dd, J = 4.78, 1.84 Hz, 1H), 15.85 (s, 1H), 8.48 (dd, .

Exemplo 22 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[(5-nitro-2-furil)metil]-1,8-naftiridin-2(1H)-onaExample 22 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(5-nitro-2-furyl) methyl] -1,8-naphthyridine -2 (1H) -one

Exemplo 22A 1-[(5-nitro-2-furil)metil]-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-bromometil-5-nitrofurano o brometo de n-butilo (0,120 g, 34%). 1H RMN (300 MHz, DMSO-de) δ 5,45 (s, 2H), 6,90 (d, J= 3,68 Ηζ,ΐΗ), 7,44 94 ΕΡ 1 560 827/ΡΤ (dd, J=7,72, 5,15 Hz, 1H), 7,65 (d; J= 3,68 Hz, 1H), 8,45 (m, 1H), 8,77 (m, 1H).Example 22A 1 - [(5-nitro-2-furyl) methyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to with the procedure of Example 1B substituting 2-bromomethyl-5-nitrofuran and n-butyl bromide (0.120 g, 34%). 1 H NMR (300 MHz, DMSO-d 6) δ 5.45 (s, 2H), 6.90 (d, J = 3.68 Ηζ, ΐΗ), 7.44 94 ΕΡ 1 560 827 / ΡΤ (dd, J = 7.72, 5.15 Hz, 1H), 7.65 (d; J = 3.68 Hz, 1H), 8.45 (m, 1H), 8.77 (m, 1H).

Exemplo 22B 3-(1,l-dioxido-4H-l,2,4-benzotladiazln-3-ll)-4-hidroxi-l-[(5-nitro-2-furil)metil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 21A o produto do Exemplo 1B (0, 040 g, 21%) . MS (DCI/NH3) m/z 468 (M+H)+. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,60 (s, 2H) , 6,54 (d, J= 3,68 Hz, 1H), 7,22 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,29 (m, 2H) , 7,56 (m, 1H), 7,58 (d, J=3,68 Hz, 1H), 7,67 (d, J=8,09 Hz, 1H), 8,43 (dd, J=7, 72, 1,84 Hz, 1H) , 8,53 (dd, J=4, 78, 1, 84 Hz, 1H) , 15, 68 (s, 1H) .Example 22B 3- (1,1-dioxido-4 H -1,2,4-benzotadadiazin-3-yl) -4-hydroxy-1 - [(5-nitro-2-furyl) methyl] -1,8-naphthyridine -2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 21A for the product of Example 1B (0.040 g, 21%). MS (DCI / NH 3) m / z 468 (M + H) +. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.60 (s, 2H), 6.54 (d, J = 3.68 Hz, 1H), 7.22 (dd, 1H), 7.58 (d, J = 3.68 Hz, 1H), 7.67 (d, J = 8, 9 Hz, 1H), 8.43 (dd, J = 7, 72, 1.84 Hz, 1H), 8.53 (dd, J = 4.78,1.84 Hz, 1H), 15.68 ( s, 1H).

Exemplo 23 1-(l-benzotien-2-ilmetil)-3-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 23 1- (1-benzothien-2-ylmethyl) -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin- 2 (1H) -one

Exemplo 23A 1-(l-benzotien-2-ilmetil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-clorometil-benzo[b]tiofeno 0 brometo de n-butilo (0,160 g, 42%). :H rmn (300 MHz, DMSO-de) δ 5,58 (s, 2H) , 7,33 (m, 2H), 7,44 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,51 (S, 1H) , 7,77 (m, 1H) , 7,90 (m, 1H), 8,44 (dd, J=7, 72, 1, 84 Hz, 1H), 8,83 (dd, J=4,78, 1, 84 Hz, 1H) .Example 23A 1- (1-benzothien-2-ylmethyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting 2-chloromethyl-benzo [b] thiophene for n-butyl bromide (0.160 g, 42%). 1 H nmr (300 MHz, DMSO-d 6) δ 5.58 (s, 2H), 7.33 (m, 2H), 7.44 (dd, J = 7.72, 4.78 Hz, 1H), 7.51 (s, 1H), 7.77 (m, 1H), 7.90 (m, 1H), 8.44 (dd, J = 7.72, 1.84 Hz, 1H), 8.83 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 23B 1-(l-benzotien-2-ilmetil)-3-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 23A o produto do Exemplo 1B (0,148 g, 60%). MS (ESI-) m/z 487 (M-H)~. O sal de sódio do composto em título foi 95 ΕΡ 1 560 827/ΡΤ preparado de acordo com o procedimento do Exemplo ID. XH RMN (300 MHz, DMSO-d6) δ 5,74 (S, 2H) , 7,20 (dd, J=7, 72, 4,78 Hz, 1H), 7,28 (m, 4H), 7,36 (s, 1H), 7,56 (m, 1H) , 7,68 (dd, J=7, 72, 1,47 Hz, 1H) , 7,75 (m, 1H) , 7,82 (dd, J=7, 72, 1, 47 Hz, 1H), 8,41 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,58 (dd, J=4,78, 1,84Example 23B 1- (1-benzothien-2-ylmethyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin- 2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 23A for the product of Example 1B (0.148 g, 60%). MS (ESI-) m / z 487 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1 H NMR (300 MHz, DMSO-d 6) δ 5.74 (s, 2H), 7.20 (dd, J = 7, 72, 4.78 Hz, 1H), 7.28 (m, 4H), 7 , 7.66 (m, 1H), 7.68 (dd, J = 7.72, 1.47 Hz, 1H), 7.75 (m, 1H), 7.82 (m, dd, J = 7.72, 1.47 Hz, 1H), 8.41 (dd, J = 7.72,1.84 Hz, 1H), 8.58 (dd, J = 84

Hz, 1H), 15,77 (s, 1H).Hz, 1H), 15.77 (s, 1H).

Exemplo 24 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-metoxibenzil)-1,8-naftiridin-2(1H)-onaExample 24 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-methoxybenzyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 24A 1-(3-metoxibenzil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 3-metoxibrometo de benzilo o brometo de n-butilo (0,446 g, 86%). MS (DCI) m/z 285 (M+H)+.Example 24A 1- (3-Methoxybenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by benzyl 3-methoxybromide or n-butyl bromide (0.466 g, 86%). MS (DCI) m / z 285 (M + H) +.

Exemplo 24B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-metoxibenzil)-18-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 24A o produto do Exemplo 1B (0,086 g, 53%). MS (ESI-) m/z 461 (M-H)”. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 3,69 (s, 3H), 5,49 (s, 2H), 6,75 (m, 3H), 7,15 (m, 2H), 7,29 (td, J=8,46, 1, 84 Hz, 2H) , 7,56 (td, J=7,72, 1,47 Hz, 1H), 7,66 (d, J=7,72 Hz, 1H), 8,41 (dd, J=7,72, 1,84 Hz, 1H), 8,48 (dd, J=4, 78, 1, 84 Hz, 1H), 15,82 (s, 1H).Example 24B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-methoxybenzyl) -18-naphthyridin-2 (1H) was prepared according to the procedure of Example 1D substituting the product of Example 24A for the product of Example 1B (0.086 g, 53%). MS (ESI-) m / z 461 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 3.69 (s, 3H), 5.49 (s, 2H), 6.75 (m, 3H), 7.15 (m, 2H), 7.29 (td, J = 7.72, 1.47 Hz, 1H), 7.66 (d, J = 7.72 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.48 (dd, J = 4.78,1.84 Hz, 1H), 15.82 (s, 1H ).

Exemplo 25 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-iodobenzil)-1,8-naftiridin-2(1H)-onaExample 25 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-iodobenzyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 25A 1-(3-iodobenzil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 3-iodobrometo de 96 ΕΡ 1 560 827/ΡΤ benzilo ο brometo de n-butilo (0,614 g, 88%). MS (DCI) m/z 381 (M+H)+.Example 25A 1- (3-iodobenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by 96 æg 1560 827 / ΡΤ benzyl 3-iodobromide ο n-butyl bromide (0.614 g, 88%). MS (DCI) m / z 381 (M + H) +.

Exemplo 25B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-iodobenzil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 25A o produto do Exemplo 1B (0,176 g, 60%). MS (ESI-) m/z 557 (M-H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,47 (s, 2H) , 7,07 (t, J=7, 72 Hz, 1H) , 7,17 (dd, J=7, 72, 4, 78 Hz, 1H), 7,28 (m, 3H), 7,55 (m, 2H) , 7,66 (m, 2H), 8,41 (dd, J=7,72, 1,84 Hz, 1H), 8,49 (dd, J=4, 78, 1, 84 Hz, 1H), 15,79 (s, 1H) .Example 25B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-iodobenzyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 25A for the product of Example 1B (0.176 g, 60%). MS (ESI-) m / z 557 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.47 (s, 2H), 7.07 (t, J = 7.72 Hz, 1H), 7.17 (dd, 1H), 7.28 (m, 3H), 7.55 (m, 2H), 7.66 (m, 2H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.78, 1.84 Hz, 1H), 15.79 (s, 1H).

Exemplo 26 1-[(3,5-dimetil-4-isoxazolil)metil]-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 26 1 - [(3,5-dimethyl-4-isoxazolyl) methyl] -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8 (1H) -one

Exemplo 26A 1-[(3,5-dimetil-4-isoxazolil)metil]-2H-pirido[2,3—d][1,3]-oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 4-clorometil-3,5-dimetilisoxazole o brometo de n-butilo (0,199 g, 60%). XH RMN (300 MHz, DMSO-de) δ 2,20 (s, 3H) , 2,45 (s, 3H), 5,10 (s, 2H), 7,40 (dd, J=7, 72, 4, 78 Hz, 1H), 8,40 (dd, J=7, 72, 1, 84 Hz, 1H), 8,80 (dd, J=4, 78, 1, 84 Hz, 1H) .Example 26A 1 - [(3,5-dimethyl-4-isoxazolyl) methyl] -2H-pyrido [2,3-d] [1,3] oxazin-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting 4-chloromethyl-3,5-dimethylisoxazole and n-butyl bromide (0.199 g, 60%). 1 H NMR (300 MHz, DMSO-d 6) δ 2.20 (s, 3H), 2.45 (s, 3H), 5.10 (s, 2H), 7.40 (dd, 1H), 8.40 (dd, J = 7, 72, 1, 84 Hz, 1H), 8.80 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 26B 1-[(3,5-dimetil-4-isoxazolil)metil]-3-(1,l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 26A o produto do Exemplo 1B (0,187 g, 63%). MS (DCI/NH3) m/z 452 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 2,20 (s, 3H), 2,38 (S, 3H), 5,44 (s, 2H) , 7,51 (dd, J=7, 90, 4, 60 Hz, 1H), 7,55 (t, J=7,17 Hz, 1H) , 7,64 (d, J=7,72 Hz, 1H), 7,77 97 ΕΡ 1 560 827/ΡΤ (t, J=7,17 Hz, 1Η), 7,92 (d, J=7,72 Hz, 1H), 8,58 (dd, J=7,90, 1,66 Hz, 1H), 8,88 (dd, J=4,60, 1, 66 Hz, 1H), 13,95 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 2,17 (s, 3H), 2,29 (s, 3H), 5,26 (s, 2H), 7,17 (dd, J=7,73, 4,78 Hz, 1H), 7,29 (m, 2H), 7,56 (t, J=1, 72 Hz, 1H), 7,67 (d, J=7,72 Hz, 1H), 8,39 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,53 (dd, J=4,78, 1,84 Hz, 1H), 15,78 (s, 1H).Example 26B 1 - [(3,5-dimethyl-4-isoxazolyl) methyl] -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8 -naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 26A for the product of Example 1B (0.187 g, 63%). MS (DCI / NH 3) m / z 452 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 2.20 (s, 3H), 2.38 (s, 3H), 5.44 (s, 2H), 7.51 (dd, J = 7.17 Hz, 1H), 7.64 (d, J = 7.72 Hz, 1H), 7.77 (s, 1H), 560 827 / (d, J = 7.72 Hz, 1 H), 8.58 (dd, J = 7.90, 1.66 Hz, 1 H), 8 , 88 (dd, J = 4.60, 1.66 Hz, 1H), 13.95 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.17 (s, 3H), 2.29 (s, 3H), 5.26 (s, 2H), 7.17 (dd, J = 1.72 Hz, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.47 (m, 2H) , 39 (dd, J = 7, 72, 1, 84 Hz, 1H), 8.53 (dd, J = 4.78, 1.84 Hz, 1H), 15.78 (s, 1H).

Exemplos 27 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[2-(3-tienil)etil]-l,8-naftiridin-2(1H)-onaExamples 27 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- [2- (3-thienyl) ethyl] -1,8-naphthyridin-2 (1H) -one

Exemplo 27A 1- [2-(3-tienil)etil]-2H-pirido[2,3-d] [1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 3-(2-bromoetil)-tiofeno o brometo de n-butilo (0,156 g, 46%). XH RMN (300 MHz, DMSO-de) δ 2,98 (t, 2H) , 4,36 (t, 2H) , 7,07 (d, J=5,15 Hz, 1H), 7,31 (m,lH), 7,39 (dd, J=7,72, 5,15 Hz, 1H), 7,49 (m, 1H), 8,41 (dd, J=7, 72, 1, 84 Hz, 1H), 8,78 (dd, J=4,78, 1,84 Hz, 1H).Example 27A 1- [2- (3-Thienyl) ethyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to The procedure of Example 1B substituting 3- (2-bromoethyl) thiophene and n-butyl bromide (0.156 g, 46%). 1 H NMR (300 MHz, DMSO- d 6) δ 2.98 (t, 2H), 4.36 (t, 2H), 7.07 (d, J = 5.15 Hz, 1H), 7.31 , 1H), 7.49 (dd, J = 7.72, 5.15 Hz, 1H), 7.49 (m, 1H), 8.41 1H), 8.78 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 27B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[2-(3-tienil)etil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 27A o produto do Exemplo 1B (0,123 g, 48%). MS (ESI-) m/z 451 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 2,90 (t, J=7,90 Hz, 2H), 4,51 (t, J=7,90 Hz, 2H), 7,10 (d, J=4, 78 Hz, 1H) , 7,16 (dd, J=7, 72, 4, 78 Hz, 1H), 7,29 (m, 3H), 7,49 (dd, J=4, 78, 2, 94 Hz, 1H) , 7,56 (m, 1H), 7,68 (d, J=7, 72 Hz, 1H), 8,39 (dd, J=7, 72, 1, 84 Hz, 1H), 8,55 (dd, J=4, 78, 1,84 Hz, 1H), 15,89 (s, 1H). 98 ΕΡ 1 560 827/ΡΤExample 27B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- [2- (3-thienyl) ethyl] -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 27A for the product of Example 1B (0.123 g, 48%). MS (ESI-) m / z 451 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.90 (t, J = 7.90 Hz, 2H), 4.51 (t, J = 7.90 Hz, 2H), 7.10 (d, J = (Dd, J = 7.72, 4.78 Hz, 1H), 7.29 (m, 3H), 7.49 (dd, J = 4.78, 1H), 7.68 (d, J = 7.72 Hz, 1H), 8.39 (dd, J = 7.72, 1.84 Hz, 1H), 8.55 (dd, J = 4.78, 1.84 Hz, 1H), 15.89 (s, 1H). 98 ΕΡ 1 560 827 / ΡΤ

Exemplo 28 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(4-piridlnllmetil)-l-8-naftiridln-2(1H)-onaExample 28 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (4-pyridylmethyl) -1- (8-naphthyridin-2 (1H) -one

Exemplo 28A 1-(4-piridinilmetil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 4-(clorometil)- piridina o brometo de n-butilo (0,089 g, 29%). XH RMN (300 MHz, DMSO-d6) δ 5,37 (s, 2H) , 7,41 (m, 3H) , 8,45 (dd, J=7,72, 1.84 Hz, 1H), 8,49 (m, 2H), 8,69 (dd, J=4, 78, 1, 84 Hz, 1H).Example 28A 1- (4-Pyridinylmethyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting for 4- (chloromethyl) pyridine and n-butyl bromide (0.089 g, 29%). 1 H NMR (300 MHz, DMSOd 6) δ 5.37 (s, 2H), 7.41 (m, 3H), 8.45 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (m, 2H), 8.69 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 28B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(4-piridinilmetil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 28A o produto do Exemplo 1B (0, 034 g, 19%). MS (DCI/NH3) m/z 434 (M+H)+; :H RMN (300 MHz, DMSO-d6) δ 5,83 (s, 2H), 7,52 (m, 2H), 7,60 (d, J=7, 72 Ηζ,ΐΗ), 7,69 (d, J= 6,25 Hz, 2H), 7,73 (m, 1H), 7,91 (d, J=6,99 Hz, 1H), 8,62 (dd, J=7,72, 1.84 Hz, 1H), 8,68 (d, J= 6,25 Hz, 2H), 8,75 (dd, J=4,78, 1,84Example 28B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (4-pyridinylmethyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 28A for the product of Example 1B (0.034 g, 19%). MS (DCI / NH 3) m / z 434 (M + H) +; 1 H NMR (300 MHz, DMSOd 6) δ 5.83 (s, 2H), 7.52 (m, 2H), 7.60 (d, J = 7.72 Ηζ, ΐΗ), 7.69 ( d, J = 6.25 Hz, 2H), 7.73 (m, 1H), 7.91 (d, J = 6.99 Hz, 1H), 8.62 (dd, J = 7.72, 1.84 1H), 8.68 (d, J = 6.25 Hz, 2H), 8.75 (dd, J = 4.78, 1.84

Hz, 1H), 13,98 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,56 (s, 2H), 7,22 (m, 3H), 7,33 (m, 2H), 7,59 (m, 1H), 7,71 (m, 1H) , 8,45 (m, 3H), 8,50 (dd, J=4,78, 1,83 Hz, 1H), 15,54 (s, 1H).1H), 13.98 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.56 (s, 2H), 7.22 (m, 3H), 7.33 (m, 2H), 7.59 (m, 1H), 7.71 (m, 1H), 8.45 (m, 3H), 8.50 (dd, J = 4.78, 1.83 Hz, 1H), 15.54 (s, 1H).

Exemplo 29 1-(4-bromobenzil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 29 1- (4-bromobenzyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 29A 1-(4-bromobenzil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 4-bromobrometo de benzilo o brometo de n-butilo (1,460 g, 72%). MS (DCI) m/z 333 (M+H)+. 99 ΕΡ 1 560 827/ΡΤExample 29A 1- (4-Bromobenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting for benzyl 4-bromobromide or n-butyl bromide (1.460 g, 72%). MS (DCI) m / z 333 (M + H) +. 99 ΕΡ 1 560 827 / ΡΤ

Exemplo 29Β 1-(4-bromobenzil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 29A o produto do Exemplo 1B (0,060 g, 59%). MS (ESI-) m/z 509 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ 5,47 (s, 2H), 7,16 (dd, J=7, 72, 4,78 Hz, 1H), 7,22 (d, J=8,46 Hz, 2H) , 7,27 (t, J=7, 72 Hz, 2H) , 7,44 (d, J=8,46 Hz, 2H), 7,56 (td, J=7,72,l,47 Hz, 1H) , 7,67 (d, J=7,72 Hz, 1H), 8,41 (dd, J=7,72, 1,84 Hz, 1H), 8,48 (dd, J=4, 78, 1, 84 Hz, 1H) , 15,80 (s, 1H) .Example 29 1- (4-Bromobenzyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 29A for the product of Example 1B (0.060 g, 59%). MS (ESI-) m / z 509 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ 5.47 (s, 2H), 7.16 (dd, J = 7.72, 4.78 Hz, 1H), 7.22 (d, J = J = 7.72 Hz, 2H), 7.44 (d, J = 8.46 Hz, 2H), 7.56 (td, J = 7.72, 8.41 (dd, J = 7.72, 1.84 Hz, 1 H), 8.48 (dd, J = 7.72, 1.84 Hz, J = 4.78, 1.84 Hz, 1H), 15.80 (s, 1H).

Exemplo 30 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-neopentil-l,8-naftiridin-2(1H)-onaExample 30 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1-neopentyl-1,8-naphthyridin-2 (1H) -one

Exemplo 30A 2-(neopentilamino)nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por 2,2-dimetil-propilamina a 2-etilbutilamina (0,407 g, 57%). MS (ESI+) 237 (M+H)+; :H RMN (300 MHz, CDC13) δ 1,02 (s, 9H) , 1,38 (t, J=7,17 Hz, 3H), 3,36 (d, J= 5,52 Hz, 2H) , 4,33 (q, J=7,35 Hz, 2H) , 6,48 (dd,J=7,91, 4,60 Ηζ,ΐΗ), 8,12 (dd, J=7,72, 2,21 Hz, 1H), 8,16 (s, 1H), 8,26 (dd, J=4,78, 2,21 Hz, 1H) .Example 30A Ethyl 2- (neopentylamino) nicotinate The title compound was prepared according to the procedure of Example 3A substituting 2,2-dimethyl-propylamine for 2-ethylbutylamine (0.407 g, 57%). MS (ESI +) 237 (M + H) +; 1 H NMR (300 MHz, CDCl 3) δ 1.02 (s, 9H), 1.38 (t, J = 7.17 Hz, 3H), 3.36 (d, J = 5.52 Hz, 2H) , 4.33 (q, J = 7.35 Hz, 2H), 6.48 (dd, J = 7.91, 4.60 Ηζ, ΐΗ), 8.12 (dd, J = , 21 Hz, 1H), 8.16 (s, 1H), 8.26 (dd, J = 4.78, 2.21 Hz, 1H).

Exemplo 30B l-neopentil-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 30A o produto do Exemplo 3A (0,182 g, 89%). ΧΗ RMN (300 MHz, CDC13) δ 1,12 (s, 9H) , 4,28 (s, 2H) , 7,25 (dd, J= 6,99, 4, 04 Hz, 1H) , 8,41 (dd, J=7,91, 2,02 Hz, 1H), 8,69 (dd, J=4, 78, 1, 84 Hz, 1H) . 100 ΕΡ 1 560 827/ΡΤExample 30B 1-Neopentyl-2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 30A the product of Example 3A (0.182 g, 89%). Δ NMR (300 MHz, CDCl3) δ 1.12 (s, 9H), 4.28 (s, 2H), 7.25 (dd, J = 6.99, 4.04 Hz, 1H), 8.41 (dd, J = 7.91, 2.02 Hz, 1H), 8.69 (dd, J = 4.78, 1.84 Hz, 1H). 100 ΕΡ 1 560 827 / ΡΤ

Exemplo 30C 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-neopentil-l,8-naftiridln-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 30B o produto do Exemplo 1B (0,070 g, 22%). MS (ESI+) m/z 413 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 0,96 (s, 9H), 4,52 (s, 2H), 7,49 (dd, J=8, 09, 4,41 Hz, 1H) , 7,56 (t, J=7,54 Hz, 1H), 7,68 (d, J=8,09 Hz, 1H), 7,78 (m, 1H), 7,94 (d, J=6,99Example 30C 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1-neopentyl-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 30B for the product of Example 1B (0.070 g, 22%). MS (ESI +) m / z 413 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ0.96 (s, 9H), 4.52 (s, 2H), 7.49 (dd, J = 8.94, 4.41 Hz, , 7.68 (d, J = 8.09 Hz, 1H), 7.78 (m, 1H), 7.94 (d, J = 99

Hz, 1H), 8,57 (dd, J=8, 09, 1, 84 Hz, 1H) , 8,85 (dd, J=4,41, 1,84 Hz, 1H), 14,11 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI+) m/z 413 (M+H)+; 1h RMN (300 MHz, DMSO-d6) δ 0,91 (s, 9H), 4,34 (s, 2H), 7,11 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,27 (m, 2H), 7,55 (m, 1H), 7,66 (m, 1H), 8,36 (dd, J=7,54, 2,021H), 8.85 (dd, J = 4.41, 1.84 Hz, 1H), 14.11 (s, , 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI +) m / z 413 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ0.91 (s, 9H), 4.34 (s, 2H), 7.11 (dd, J = 7.72, 4.78 Hz, 1H), 7 , 27 (m, 2H), 7.55 (m, 1H), 7.66 (m, 1H), 8.36 (dd, J = 7.54, 2.02

Hz, 1H), 8,48 (dd, i7=4, 60, 2, 02 Hz, 1H), 15,95 (s, 1H) .Hz, 1H), 8.48 (dd, J = 4.60, 2.02 Hz, 1H), 15.95 (s, 1H).

Exemplo 31 l-{[(IS,2R,5S)-6,6-dimetilbiciclo[3.1.1]hept-2-il]metil}-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l, 8-naftiridin-2(1H)-onaExample 31 1 - {[(1S, 2R, 5S) -6,6-dimethylbicyclo [3.1.1] hept-2-yl] methyl} -3- (1,1-dioxido-4H-1,2,4- benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 31 A 2-({[(IS,2R,5S)-6,6-dimetilbiciclo[3.1.1]hept-2-il]metil}-amino)nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por (-)-cis-mirtanil-amina a 2-etilbutilamina (0, 604 g, 40%). MS (ESI+) m/z 303 (M+H)+.Ethyl 2 - ({[(1 S, 2 R, 5 S) -6,6-dimethylbicyclo [3.1.1] hept-2-yl] methyl} amino) nicotinate The title compound was prepared according to The procedure of Example 3A substituting (-) - cis -methanylamine for 2-ethylbutylamine (0.604 g, 40%). MS (ESI +) m / z 303 (M + H) +.

Exemplo 31B l-{[(IS,2r,5S)-6,6-dimetilbiciclo[3.1.1]hept-2-il]metil}-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 31A o produto do Exemplo 3A (0,570 g, 95%). XH RMN (300 MHz, DMSO-d6) δ 0,79 (d, J=9,56 Hz, 1H) , 1,14 (s, 3H) , 1,22 (s, 3H), 1,62 (m, 1H), 1,87 (m, 5H), 2,26 (m, 1H), 2,53 (m, 1H), 4,04 (dd, J=13, 05, 6,07 Hz, 1H), 4,28 (dd, J=13,24, 101 ΕΡ 1 560 827/ΡΤ 9,19 Hz, 1Η), 7,37 (dd, J=7,72, 4,78 Ηζ, 1Η), 8,38 (dd, J=7,72, 1,84 Hz, 1H), 8,76 (dd, J=4,78, 1,84 Hz, 1H).Example 31B 1 - {[(1S, 2S, 5S) -6,6-dimethylbicyclo [3.1.1] hept-2-yl] methyl} -2H-pyrido [2,3- d] [1,3] oxazine- 2,4 (1H) -dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 31A for the product of Example 3A (0.570 g, 95%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.79 (d, J = 9.56 Hz, 1H), 1.14 (s, 3H), 1.22 (s, 3H), 1.62 1H), 2.87 (m, 5H), 2.26 (m, 1H), 2.53 (m, 1H), 4.04 (dd, J = 13.05, 6.07 Hz, , 4.28 (dd, J = 13.24, 101 ÅΡ 1560 827 / ΡΤ 9.19 Hz, 1 Η), 7.37 (dd, J = 7.72, 4.78 Ηζ, 1Η) 38 (dd, J = 7.72, 1.84 Hz, 1H), 8.76 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 31C l-{[(IS,2R,5S)-6,6-dimetilbiciclo[3.1.1]hept-2-il]metil}-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l, 8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 31B o produto do Exemplo 1B (0,050 g, 21%). MS (ESI-) m/z 477 (M-H)”. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 0,78 (d, J= 9,56 Hz, 1H), 1,15 (m, 3H), 1,30 (s, 3H), 1,80 (m, 6H), 2,24 (m, 1H), 2,54 (m, 1H), 4,37 (m, 2H), 7,12 (dd,J=7, 54, 4,60 Hz, 1H), 7,27 (m, 2H), 7,55 (m, 1H), 7,67 (dd, J=7, 72, 1, 47 Hz, 1H) , 8,36 (dd, J=7,54, 2,02Example 31C 1 - {[(1S, 2R, 5S) -6,6-dimethylbicyclo [3.1.1] hept-2-yl] methyl} -3- (1,1-dioxido-4H- 3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 31B for the product of Example 1B (0.050 g, 21%). MS (ESI-) m / z 477 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.78 (d, J = 9.56 Hz, 1H), 1.15 (m, 3H), 1.30 (s, 3H), 1.80 (M, 2H), 7.12 (dd, J = 7, 54, 4.60 Hz, 1 H) , 7.27 (m, 2H), 7.55 (m, 1H), 7.67 (dd, J = 7,71,1.47 Hz, 1H), 8.36 (dd, J = 7.54 , 2.02

Hz, 1H), 8,50 (dd, J=4, 60, 2, 02 Hz, 1H), 15,95 (s, 1H).1H), 8.50 (dd, J = 4.60, 2.02 Hz, 1H), 15.95 (s, 1H).

Exemplo 32 3-{[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi- 2-oxo-l,8-naftiridin-1(2H)-il]metil}benzonitriloExample 32 3 - {[3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ] methyl} benzonitrile

Exemplo 32A 3-[(2,4-dioxo-2H-pirido[2,3-d][1,3]oxazin-1(4H)-il)metil]-benzonitrilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 3-cianobrometo de benzilo o brometo de n-butilo (0,363 g, 71%). MS (DCI) m/z 280 (M+H)+.Example 32A 3 - [(2,4-dioxo-2H-pyrido [2,3-d] [1,3] oxazin-1 (4H) -yl) methyl] benzonitrile The title compound was prepared according to The procedure of Example 1B substituting benzyl 3-cyanobromide and n-butyl bromide (0.363 g, 71%). MS (DCI) m / z 280 (M + H) +.

Exemplo 32B 3-{[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-1(2H)-il]metilbenzonitrilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 32A o produto do Exemplo 1B (0,024 g, 22%). MS (ESI-) m/z 456 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-dej δ 5,54 (s, 2H) , 7,18 (dd, J=7, 72, 4, 78 Hz, 102 ΕΡ 1 560 827/ΡΤ 1Η), 7,29 (m, 2Η), 7,48 (t, 7=7,72 Ηζ, 1Η) , 7,56 (td, J=7,91, 1,47 Hz, 2H), 7,68 (m, 3H) , 8,42 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,49 (dd, J=4, 60, 2,02 Hz, 1H) , 15,77 (s, 1H) .Example 32B 3 - {[3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ] methylbenzonitrile The title compound was prepared according to the procedure of Example 1D substituting the product of Example 32A for the product of Example 1B (0.024 g, 22%). MS (ESI-) m / z 456 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. ¹H NMR (300 MHz, DMSO-dO) δ 5.54 (s, 2H), 7.18 (dd, J = 7.72, 4.78 Hz, 102 ΕΡ 1 560 827 / ΡΤ 1Η), 7.29 7.56 (td, J = 7.91, 1.47 Hz, 2H), 7.68 (m, 3H), 7.48 (t, J = 7.72 Hz, 1H). 8.42 (dd, J = 7, 72, 1, 84 Hz, 1H), 8.49 (dd, J = 4.60, 2.02 Hz, 1H), 15.77 (s, 1H).

Exemplo 33 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-piridinilmetil)-1,8-naftiridin-2(1H)-onaExample 33 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-pyridinylmethyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 33A 1-(3-piridinilmetil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 3-(bromometil)-piridina o brometo de n-butilo (0,153 g, 49%). :Η RMN (300 MHz, DMSO-de) δ 5,38 (s, 2H) , 7,34 (dd, J=7, 72, 4, 78 Hz, 1H), 7.40 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,82 (m, 1H) , 8,42 (dd, J=7, 72, 1,84 Hz, 1H) , 8,47 (dd, J=4,78, 1,10 Hz, 1H), 8,66 (d, J=1,84 Hz, 1H) , 8,74 (dd, J=5,15, 1,84 Hz, 1H).Example 33A 1- (3-Pyridinylmethyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting for 3- (bromomethyl) pyridine and n-butyl bromide (0.153 g, 49%). NMR (300 MHz, DMSO-d 6) δ 5.38 (s, 2H), 7.34 (dd, J = 7.72, 4.78 Hz, 1H), 7.40 (dd, J = 8.42 (dd, J = 7, 72, 1.84 Hz, 1 H), 8.47 (dd, J = 4.78, 1.10 Hz, 1H), 8.66 (d, J = 1.84 Hz, 1H), 8.74 (dd, J = 5.15, 1.84 Hz, 1H).

Exemplo 33B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(3-piridinilmetil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 33A o produto do Exemplo 1B (0,098 g, 41%). MS (DCI/NH3) m/z 434 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 5,72 (s, 2H), 7,41 (dd, J=7,72, 4,78 Hz, 1H), 7,50 (m, 2H), 7,61 (d, J=8,09 Hz, 1H), 7,74 (m, 1H), 7,84 (d, J=7,72 Hz, 1H), 7,89 (d, J=8,09 Hz, 1H) , 8,50 (d, J=4,04 Hz, 1H) , 8,58 (dd, J=1, 73, 1, 84 Hz, 1H), 8,67, (s, 1H) , 8,80 (dd, J=4,78, 1,84 Hz, 1H), 14,15 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,53 (s, 2H) , 7,18 (dd,J=7,72, 4.41 Hz, 1H), 7,29 (m, 3H) , 7,56 (m, 1H), 7,65 (m, 2H), 8,40 (m, 2H), 8,51 (dd, J=4, 60, 2, 02 Hz, 1H), 8,57 (d, J=l,47 Hz, 1H) , 15, 78 (s, 1H) .Example 33B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-pyridinylmethyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 33A for the product of Example 1B (0.098 g, 41%). MS (DCI / NH 3) m / z 434 (M + H) +; 1 H NMR (300 MHz, DMSOd 6) δ 5.72 (s, 2H), 7.41 (dd, J = 7.72, 4.78 Hz, 1H), 7.50 (m, 2H), 7 7.84 (d, J = 7.72 Hz, 1 H), 7.89 (d, J = 8.09 Hz, 1H), 8.50 (d, J = 4.04 Hz, 1H), 8.58 (dd, J = 1.73, 1.84 Hz, 1H), 8.67 ), 8.80 (dd, J = 4.78, 1.84 Hz, 1H), 14.15 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSOd 6) δ 5.53 (s, 2H), 7.18 (dd, J = 7.72, 4.41 Hz, 1H), 7.29 (m, 3H), 7.56 (m, 1H), 7.65 (m, 2H), 8.40 (m, 2H), 8.51 (dd, J = 4.60, J = 1.47 Hz, 1H), 15.78 (s, 1H).

Exemplo 34 1-(1-adamantilmetil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona 103 ΕΡ 1 560 827/ΡΤExample 34 1- (1-Adamantylmethyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one 103 ΕΡ 1 560 827 / ΡΤ

Exemplo 34Α ácido 2-[ (1-adamantilmetil)amino] nlcotínico O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por ácido 2-cloro-nicotínico o 2-cloronicotinato de etilo e por 1-adamantano-metilamina a 2-etilbutilamina (0,185 g, 79%). MS (ESI+) m/z 287, 1 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 1,74 (m, 12H), 2,00 (s, 3H), 3,31 (m, 2H), 6,60 (dd, J=7,35, 5,52 Hz, 1H), 7,96 (dd, J=5,33, 2,02 Hz, 1H), 8,26 (dd, J=7, 35, 1,84 Hz, 1H).The title compound was prepared according to the procedure of Example 3A substituting 2-chloro-nicotinic acid for ethyl 2-chloronicotinate and 1-adamantane-methylamine 2-ethylbutylamine (0.185 g, 79%). MS (ESI +) m / z 287.1 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.74 (m, 12H), 2.00 (s, 3H), 3.31 (m, 2H), 6.60 (dd, 5.52 Hz, 1H), 7.96 (dd, J = 5.33, 2.02 Hz, 1H), 8.26 (dd, J = 7, 1.84 Hz, 1H).

Exemplo 34B 1-(1-adamantilmetil)-2H-pirido[2, 3-d][1,3]oxazina-2, 4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 34A o produto do Exemplo 3A (0, 025 g, 20%). RMN (300 MHz, CDC13) δ 1,74 (m, 12H), 2,04 (s, 3H), 3,65 (d, J=5,88 Hz, 2H), 6,91 (dd, J=7, 72, 5,52 Hz, 1H), 8,51 (d, J=4,78 Hz, 1H), 8, 77 (d, J=7, 72 Hz, 1H).Example 34B 1- (1-Adamantylmethyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 3B substituting by the product of Example 34A the product of Example 3A (0.025 g, 20%). NMR (300 MHz, CDCl 3) δ 1.74 (m, 12H), 2.04 (s, 3H), 3.65 (d, J = 5.88 Hz, 2H), 6.91 (dd, J = 7.72, 5.52 Hz, 1H), 8.51 (d, J = 4.78 Hz, 1H), 8.77 (d, J = 7.72 Hz, 1H).

Exemplo 34C 1-(1-adamantilmetil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 34B o produto do Exemplo 1B (0,018 g, 47%). MS (ESI+) m/z 491,1 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 1,59 (S, 12H), 1,90 (m, 3H), 4,41 (br s, 2H), 7,48 (m, 1H), 7,56 (t, J=7,54 Hz, 1H), 7,69 (m, 1H), 7,77 (m, 1H), 7,94 (d, J=7,72 Hz, 1H), 8,56 (dd, j=8,09, 1,84 Hz, 1H), 8,85 (dd, J=4,60, 1,65 Hz, 1H). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI+) m/z 491,1 (M+H)+; XH NNM (300 MHz, DMSO-de) δ 1,56 (m, 12H), 1,87 (s, 3H), 4,21 (br s, 2H) , 7,10 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,28 (m, 2H) , 7,55 (m, 1H), 7,66 (dd, J=7, 72, 1, 47 Hz, 1H), 8,35 (dd, J=7, 72, 1, 84 Hz, 1H), 8,48 (dd, J=4,60, 2, 02 Hz, 1H), 15,97 (br s, 1H). 104 ΕΡ 1 560 827/ΡΤExample 34C 1- (1-Adamantylmethyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 34B for the product of Example 1B (0.018 g, 47%). MS (ESI +) m / z 491.1 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.59 (s, 12H), 1.90 (m, 3H), 4.41 (br s, 2H), 7.48 (m, 1H) 1H), 7.69 (m, 1H), 7.94 (d, J = 7.72 Hz, 1H) 56 (dd, j = 8.09, 1.84 Hz, 1H), 8.85 (dd, J = 4.60, 1.65 Hz, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI +) m / z 491.1 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.56 (m, 12H), 1.87 (s, 3H), 4.21 (br s, 2H), 7.10 (dd, J = , 4.78 (m, 2H), 7.55 (m, 1H), 7.66 (dd, J = 7.72, 1.47 Hz, 1H), 8.35 (dd, J = 7, 72, 1, 84 Hz, 1H), 8.48 (dd, J = 4.60, 2.02 Hz, 1H), 15.97 (br s, 1H). 104 ΕΡ 1 560 827 / ΡΤ

Exemplo 35 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[3-(trlfluorometll)benzll]-1, 8-naftirldln-2(1H)-onaExample 35 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- [3- (trifluoromethyl) benzyl] -1,8-naphthyl [ ) -one

Exemplo 35A 1-[3-(trifluorometil)benzil]-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 3-(trifluoro-metil)brometo de benzilo o brometo de n-butilo (0,250 g, 42%). XH RMN (300 MHz, DMSO-de) δ 5,43 (s, 2H), 7,40 (dd, J=7,72, 4,78 Hz, 1H), 7,55 (m, 1H), 7,64 (m, 1H), 7,73 (d, J=7,72 Hz, 1H), 7,81 (s, 1H), 8,43 (dd, J=7,72, 1,84 Hz, 1H), 8,72 (dd, J=4,78, 1,84 Hz, 1H).Example 35A 1- [3- (trifluoromethyl) benzyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting benzyl 3- (trifluoromethyl) bromide for n-butyl bromide (0.250 g, 42%). 1 H NMR (300 MHz, DMSO-d 6) δ 5.43 (s, 2H), 7.40 (dd, J = 7.72, 4.78 Hz, 1H), 7.55 (m, 1H), 7 , 7.83 (d, J = 7.72 Hz, 1H), 7.81 (s, 1H), 8.43 (dd, J = 7.72, 1.84 Hz, 1H), 8.72 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 35B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[3-(trifluorometil)benzil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 35A o produto do Exemplo 1B (0,22 g, 57%). MS (ESI-) m/z 499 (Μ-ΗΓ; XH RMN (300 MHz, DMSO-d6) δ 5,77 (s, 2H), 7,54 (m, 6H), 7,66 (d, J=7,72 Hz, 1H), 7,76 (m, 2H) , 7,92 (d, J=8,09 Hz, 1H), 8,61 (dd, J=8, 09, 1, 84 Hz, 1H) , 8,83 (dd, J=4,41, 1,84 Hz, 1H), 13,91 (br s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 499 (M-H)&quot;; XH RMN (300 MHz, DMSO-de) δ 5,58 (s, 2H) , 7,18 (dd, J=7, 72, 4,78 Hz, 1H) , 7,29 (m, 2H), 7,54 (m, 4H), 7,66 (m, 2H), 8,42 (dd, J=7,72, 1,84 Hz, 1H), 8,49 (dd, J=4, 60, 2, 02 Hz, 1H), 15,78 (m, 1H) .Example 35B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- [3- (trifluoromethyl) benzyl] -1,8-naphthyridin-2 (1H ) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 35A for the product of Example 1B (0.22 g, 57%). NMR (300 MHz, DMSO-d 6) δ 5.77 (s, 2H), 7.54 (m, 6H), 7.66 (d, J = = 7.72 Hz, 1H), 7.76 (m, 2H), 7.92 (d, J = 8.09 Hz, 1H), 8.61 (dd, J = 1H), 8.83 (dd, J = 4.41, 1.84 Hz, 1H), 13.91 (br s, 1H) The sodium salt of the title compound was prepared according to the procedure of 1 H NMR (300 MHz, DMSO-d 6) δ 5.58 (s, 2H), 7.18 (dd, J = 7, 72, 4.78 Hz, 1H), 7.29 (m, 2H), 7.54 (m, 4H), 7.66 (m, 2H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.60, 2.02 Hz, 1H), 15.78 (m, 1H).

Exemplo 36 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(2-metil-l,3-tiazol-5-il)metil]-1,8-naftiridin-2(1H)-onaExample 36 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(2-methyl-1,3-thiazol-5-yl) methyl] -1,8-naphthyridin-2 (1H) -one

Exemplo 36A 1-[(2-metil-l,3-tiazol-5-il)metil]-2H-pirido[2,3-d] [1,3]-oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o 105 ΕΡ 1 560 827/ΡΤ procedimento do Exemplo 1B substituindo por 2-metil-5-cloro-metiltiazole o brometo de n-butilo (0,300 g, 54%).Example 36A 1 - [(2-methyl-1,3-thiazol-5-yl) methyl] -2H-pyrido [2,3-d] [1,3] oxazin-2,4 (1H) -dione O The title compound was prepared according to the procedure of Example 1B substituting 2-methyl-5-chloromethylthiazole and n-butyl bromide (0.300 g, 54%).

Exemplo 36B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(2-metil-l,3-tiazol-5-il)metil]-1, 8-naftiridin-2(1H)-ona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 36A o produto do Exemplo 1B (0,123 g, 25%). MS (ESI-) m/z 452 (Μ-ΗΓ; XH RMN (300 MHz, DMSO-d6) δ 2,54 (s, 3H) , 5,76 (s, 1H), 7,53 (m, 1H) , 7,52 (d, J=7, 72 Hz, 1H) , 7,65 (m, 2H) , 7,76 (t, J=7, 72 Hz, 1H) , 7,91 (d, J=7, 72 Hz, 1H) , 8,57 (d, J=7,72 Hz, 1H), 8,90 (d, J=4,04 Hz, 1H), 13,92 (s, 1H). O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D.Example 36B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(2-methyl-1,3-thiazol-5-yl) methyl] -1H-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 36A for the product of Example 1B (0.123 g, 25%). 1 H NMR (300 MHz, DMSO-d 6) δ 2.54 (s, 3H), 5.76 (s, 1H), 7.53 (m, 1H , 7.65 (m, 2H), 7.76 (t, J = 7.72 Hz, 1H), 7.91 (d, J = = 7.72 Hz, 1H), 8.57 (d, J = 7.72 Hz, 1H), 8.90 (d, J = 4.04 Hz, 1H), 13.92 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D.

Exemplo 37 1-(2-ciclo-hexiletil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 37 1- (2-cyclohexylethyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 37A 1-(2-ciclo-hexiletil)-2H-pirido[2,3—d][1,3]oxazina-2,4(1H)-diona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1B substituindo por l-bromo-2-ciclo-hexiletano o brometo de n-butilo (0,196 g, 39%).Example 37A 1- (2-Cyclohexylethyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting 1-bromo-2-cyclohexylethane and n-butyl bromide (0.196 g, 39%).

Exemplo 37B 1-(2-ciclo-hexiletil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 37A o produto do Exemplo 1B (0,030 g, 18% após purificação em coluna). MS (ESI-) m/z 451 (M-H)~. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 451 (M-H) :H RMN (300 MHz, DMSO-d6/TFA) δ 0,78 (m, 2H), 0,98 (m, 3H), 1,18 (m, 1H), 1,40 (m, 5H), 1,59 (d, J=12,50 Hz, 2H), 4,33 (m, 2H), 106 ΕΡ 1 560 827/ΡΤ 7,23 (m, 3Η) , 7,47 (t, J=7,54 Hz, 1H), 7,67 (d, J=7, 72 Hz, 1H), 8,43 (m, 1H), 8,57 (dd, J=4,78, 1,47 Hz, 1H).Example 37B 1- (2-cyclohexylethyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 37A for the product of Example 1B (0.030 g, 18% after column purification). MS (ESI-) m / z 451 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6 / TFA) δ 0.78 (m, 2H), 0.98 (m, 3H), 1.18 (m, 1H), 1.40 (m, 5H), 1.59 (d, J = 12.50 Hz, 2H), 4.33 (m, 2H), 106 ε ε1 560 827 / Î'7.23 (m, , 7.67 (d, J = 7.72 Hz, 1H), 8.43 (m, 1H), 8.57 (dd, J = 4.78, 1.47 Hz, 1H).

Exemplo 38 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(4-metoxibenzil)-1,8-naftiridin-2(lH)-onaExample 38 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (4-methoxybenzyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 38A 1-(4-metoxibenzil)-2H-pirido[2,3—d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por cloreto de 4-metoxibenzilo o brometo de n-butilo (0,364 g, 70%). MS (DCI) m/z 285 (M+H)+.Example 38A 1- (4-Methoxybenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by 4-methoxybenzyl chloride or n-butyl bromide (0.364 g, 70%). MS (DCI) m / z 285 (M + H) +.

Exemplo 38B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(4-metoxibenzil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 38A o produto do Exemplo 1B (0,098 g, 51%). MS (ESI-) m/z 461 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 3,68 (s, 3H), 5,45 (s, 2H), 6,80 (dt, J=8,82, 2,21 Hz, 2H), 7,15 (dd, J=7, 72, 4, 78 Hz, 1H), 7,26 (m, 4H), 7,55 (td,J=7,72, 1,47 Hz, 1H), 7,67 (dd, J=7,91, 1,65 Hz, 1H), 8,39 (dd, J=1,72, 2,21 Hz, 1H), 8,50 (dd, J=4,78, 1,84Example 38B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (4-methoxybenzyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 38A for the product of Example 1B (0.098 g, 51%). MS (ESI-) m / z 461 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 3.68 (s, 3H), 5.45 (s, 2H), 6.80 (dt, J = 8.82, 2.21 Hz, 2H), 7 , 7.36 (m, 4H), 7.55 (td, J = 7.72, 1.47 Hz, 1 H), 7.7 (d, 1H), 8.39 (dd, J = 1.72, 2.21 Hz, 1H), 8.50 (dd, J = 4.78, 1.84

Hz, 1H), 15,86 (s, 1H).1H), 15.86 (s, 1H).

Exemplo 39 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(2-metilbenzil)-1, 8-naftiridin-2(1H)-onaExample 39 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (2-methylbenzyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 39A 1-(2-metilbenzil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-metilbrometo de benzilo o brometo de n-butilo (0,353 g, 72%). MS (DCI) m/z 269 (M+H)+. 107 ΕΡ 1 560 827/ΡΤExample 39A 1- (2-methylbenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by benzyl 2-methylbromide or n-butyl bromide (0.353 g, 72%). MS (DCI) m / z 269 (M + H) +. 107 ΕΡ 1 560 827 / ΡΤ

Exemplo 39Β 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(2-metilbenzll)-1, 8-naftlridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 39A o produto do Exemplo 1B (0,165 g, 62%). MS (ESI-) m/z 445 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 2,44 (s, 3H) , 5,45 (s, 2H) , 6,59 (d, J= 7,35 Hz, 1H), 6,96 (t, J=7,17 Hz, 1H) , 7,06 (t, J=6,80 Hz, 1H), 7,16 (m, 2H) , 7,29 (t, J=7, 54 Hz, 2H) , 7,56 (td, J=7, 72, 1,47 Hz, 1H), 7,66 (d, J=7,72 Hz, 1H) , 8,43 (d, J= 6,25 Hz, 2H) , 15,84 (s, 1H) .Example 39 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (2-methylbenzyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 39A for the product of Example 1B (0.165 g, 62%). MS (ESI-) m / z 445 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.44 (s, 3H), 5.45 (s, 2H), 6.59 (d, J = 7.35 Hz, 1H), 6.96 (t 1H), 7.06 (t, J = 6.80 Hz, 1H), 7.16 (m, 2H), 7.29 (t, J = (D, J = 7.72 Hz, 1 H), 8.43 (d, J = 6.25 Hz, 1H) , 2H), 15.84 (s, 1H).

Exemplo 40 1-(ciclopropilmetil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 40 1- (cyclopropylmethyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 40A 1-(ciclopropilmetil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por (bromometil)-ciclopropano o brometo de n-butilo (0,278 g, 70%). MS (APCI+) m/z 219 (M+H). ’ή RMN (300 MHz, DMSO-d6) δ 0,46 (m, 4H), 1,27 (m, 1H), 4,04 (d, J=6,99 Hz, 2H), 7,39 (dd, J=7,91, 4,96 Hz, 1H), 8,40 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,78 (dd, J=4,78, 1,84Example 40A 1- (cyclopropylmethyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting bromomethyl) -cyclopropane and n-butyl bromide (0.278 g, 70%). MS (APCI +) m / z 219 (M + H). 1 H NMR (300 MHz, DMSO-d 6) δ 0.46 (m, 4H), 1.27 (m, 1H), 4.04 (d, J = 6.99 Hz, 2H), 7.39 dd, J = 7.91, 4.96 Hz, 1H), 8.40 (dd, J = 7.72, 1.84 Hz, 1H), 8.78 (dd, 84

Hz, 1H).Hz, 1H).

Exemplo 40B 1-(ciclopropilmetil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 40A o produto do Exemplo 1B (0,06 g, 20% após purificação em coluna). MS (ESI-) m/z 395 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 395 (M-H)-; 1H RMN (300 MHz, DMSO-de) δ 0,40 (m, 4H), 1,32 (m, 1H), 4,19 (d, 108 ΕΡ 1 560 827/ΡΤ J=6,99 Hz, 2Η), 7,14 (dd, J=7,54, 4,60 Hz, 1H), 7,28 (m, 2H), 7,55 (t, J=7,35 Hz, 1H) , 7,67 (dd, J=7,72, 1,10 Hz, 1H) , 8,38 (dd, J=7, 72, 1,84 Hz, 1H), 8,52 (dd, J=4, 60, 2, 02 Hz, 1H) , 15, 93 (s, 1H) .Example 40B 1- (cyclopropylmethyl) -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one Compound was prepared according to the procedure of Example 1D substituting the product of Example 40A for the product of Example 1B (0.06 g, 20% after column purification). MS (ESI-) m / z 395 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 395 (M-H) -; 1 H NMR (300 MHz, DMSO-d 6) δ 0.40 (m, 4H), 1.32 (m, 1H), 4.19 (d, 108 ε), 1 560 827 / ΡΤ J = 6.99 Hz, 2 ), 7.14 (dd, J = 7.54, 4.60 Hz, 1H), 7.28 (m, 2H), 7.55 (t, J = 7.35 Hz, 1H), 7.67 (dd, J = 7.72, 1.10 Hz, 1 H), 8.58 (dd, J = 4.60, 2) , 2 Hz, 1H), 15.93 (s, 1H).

Exemplo 41 3-(1,l-dioxido-4H-l,2,4-benzotladlazin-3-il)-4-hidroxi-1—(1,3-tiazol-4-ilmetil)-18-naftiridin-2(lH)-onaExample 41 3- (1,1-dioxido-4 H -1,2,4-benzotriazol-3-yl) -4-hydroxy-1- (1,3-thiazol-4-ylmethyl) -18-naphthyridin-2- 1H) -one

Exemplo 41A 1-(1,3-tiazol-4-ilmetil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 4-(clorometil)-tiazole o brometo de n-butilo (0,049 g, 15%). XH RMN (300 MHz, DMSO-d6) δ 5,48 (s, 2H) , 7,40 (dd, J=7, 72, 4, 78 Hz, 1H), 7,66 (s, 1H), 8,45 (dd, J=7, 72, 1, 84 Hz, 1H), 8,72 (dd, J=4,78, 1,84 Hz, 1H), 9,06 (d, J=2,21 Hz, 1H).Example 41A 1- (1,3-Thiazol-4-ylmethyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting 4- (chloromethyl) -thiazole and n-butyl bromide (0.049 g, 15%). 1 H NMR (300 MHz, DMSO-d 6) δ 5.48 (s, 2H), 7.40 (dd, J = 7.72, 4.78 Hz, 1H), 7.66 (s, 1H), 8 J = 7.72, 1.84 Hz, 1H), 8.72 (dd, J = 4.78, 1.84 Hz, Hz, 1H).

Exemplo 41B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(1,3-tiazol-4-ilmetil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 41A o produto do Exemplo 1B (0,046 g, 59%). MS (ESI-) m/z 438 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,65 (s, 2H) , 7,04 (d, J=2,21 Hz, 1H) , 7,16 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,29 (m, 2H), 7,56 (m, 1H) , 7,66 (d, J=1,35 Hz, 1H), 8,42 (dd, J=7,72, 2,21 Hz, 1H), 8,46 (dd, J=4, 78, 2,20 Hz, 1H), 8,98 (d, J=l,84 Hz, 1H), 15,85 (s, 1H) .Example 41B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (1,3-thiazol-4-ylmethyl) -1,8-naphthyridin- 2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 41A for the product of Example 1B (0.046 g, 59%). MS (ESI-) m / z 438 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.65 (s, 2H), 7.04 (d, J = 2.21 Hz, 1H), 7.16 (dd, (D, J = 7 Hz, 1H), 8.42 (dd, J = 7, 1H) (Dd, J = 4.78, 2.20 Hz, 1H), 8.98 (d, J = 1.84 Hz, 1H), 15.85 (d, s, 1H).

Exemplo 42 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(5-fenil-2-tienil)metil]-1,8-naftiridin-2(1H)-ona O produto do Exemplo 4B (100 mg, 0,193 mmol), ácido fenilborónico (49 mg, 0,387 mmol), Na2CC&gt;3 2M aquoso (0,45 mL), etanol absoluto (0,5 mL) e tetraquis(trifenilfosfina)paládio 109 ΕΡ 1 560 827/ΡΤ (14 mg, 0,012 mmol) em DMF purgada com N2 (2 mL) foi aquecido a refluxo durante 2,5 horas, arrefecido até 0°C, diluído com H20 (15 mL), ajustado a pH 3 com HC1 IN e extraído com acetato de etilo (3x25 mL) . Os extractos combinados foram lavados com NaCl saturado, secos sobre Na2S04 anidro, filtrados e concentrados. O resíduo foi purificado por cromatografia instantânea em coluna em sílica gel com 3% acetato de etilo/diclorometano para gerar o composto em título (0,039 g, 40%). MS (ESI-) m/z 513 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,64 (s, 2H), 7,12 (d, J=3,68 Hz, 1H), 7,20 (dd,J=7, 72, 4, 78 Hz, 1H), 7,31 (m, 6H), 7,57 (m, 3H), 7,68 (d, J=7, 72 Hz, 1H), 8,41 (dd, J=7, 72, 1, 84 Hz, 1H), 8,60 (dd, J=4, 78, 1,84 Hz, 1H) , 15,80 (s, 1H) .Example 42 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(5-phenyl-2-thienyl) methyl] -1,8-naphthyridine The product from Example 4B (100 mg, 0.193 mmol), phenylboronic acid (49 mg, 0.387 mmol), aqueous Na2 CO3 (0.45 mL), absolute ethanol (0.5 mL) and tetrakis (triphenylphosphine) palladium 109 ÅΡ 1 560 827 / ΡΤ (14 mg, 0.012 mmol) in N 2 purged DMF (2 mL) was refluxed for 2.5 hours, cooled to 0øC, diluted with H 2 O mL), adjusted to pH 3 with 1N HCl and extracted with ethyl acetate (3x25 mL). The combined extracts were washed with saturated NaCl, dried over anhydrous Na2 SO4, filtered and concentrated. The residue was purified by flash column chromatography on silica gel with 3% ethyl acetate / dichloromethane to give the title compound (0.039 g, 40%). MS (ESI-) m / z 513 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.64 (s, 2H), 7.12 (d, J = 3.68 Hz, 1H), 7.20 (dd, (D, J = 7.72 Hz, 1 H), 8.41 (m, 6H), 7.57 (m, 3H), 7.68 72, 1, 84 Hz, 1H), 8.60 (dd, J = 4.78, 1.84 Hz, 1H), 15.80 (s, 1H).

Exemplo 43 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(4-metil-3-pentenil)-1,8-naftiridin-2(1H)-onaExample 43 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (4-methyl-3-pentenyl) -1,8-naphthyridin-2- 1H) -one

Exemplo 43A 1-(4-metil-3-pentenil)-2H-pirido[2,3—d][1,3]oxazina-2,4(1H)- diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 5-bromo-2-metil-2-penteno o brometo de n-butilo (0,157 g, 35%). MS (DCI+) m/z 247 (M+H)+; 1R RMN (300 MHz, DMSO-d6) δ 1,59 (s, 3H) , 1,66 (s, 3H), 2,35 (m, 2H), 4,09 (m, 2H), 5,18 (t, J=7,54 Hz, 1H), 7,39 (dd, J=7,72, 5,15 Hz, 1H) , 8,40 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,79 (dd, J=5,15, 1,84 Hz, 1H).Example 43A 1- (4-methyl-3-pentenyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to procedure of Example 1B substituting 5-bromo-2-methyl-2-pentene for n-butyl bromide (0.157 g, 35%). MS (DCI +) m / z 247 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.59 (s, 3H), 1.66 (s, 3H), 2.35 (m, 2H), 4.09 (m, 2H), 5.18 (dd, J = 7.72, 5.15 Hz, 1H), 8.40 (dd, J = 7.72, 1.84 Hz, 1H), 8.79 (dd, J = 5.15, 1.84 Hz, 1H).

Exemplo 43B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(4-metil-3-pentenil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 43A o produto do Exemplo 1B (0,030 g, 20% após recristalização) . MS (ESI-) m/z 423 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 423 (M-H)'; XH RMN (300 MHz, DMSO-de) δ 1,63 (s, 3H), 1,67 (s, 3H), 2,26 (m, 2H), 4,23 (m, 110 ΕΡ 1 560 827/ΡΤ 2Η), 5,21 (m, 1Η) , 7,14 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,28 (m, 2H), 7,55 (t, J=7,35 Hz, 1H) , 7,67 (d, J=7, 72 Hz, 1H) , 8,37 (dd, J=7,72, 2,21 Hz, 1H) , 8,53 (dd, J=4, 60, 2, 02 Hz, 1H) , 15, 92 (s, 1H) .Example 43B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (4-methyl-3-pentenyl) -1,8-naphthyridin-2- 1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 43A for the product of Example 1B (0.030 g, 20% after recrystallization). MS (ESI-) m / z 423 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 423 (M-H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.63 (s, 3H), 1.67 (s, 3H), 2.26 (m, 2H), 4.23 (m, (M, 2H), 7.55 (t, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 1H), 8.37 (dd, J = 7.72, 2.21 Hz, 1H), 8.53 (dd, J = J = 4.60, 2.02 Hz, 1H), 15.92 (s, 1H).

Exemplo 44 4-{[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-1(2H)-11]metll}benzonltriloExample 44 4 - {[3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -11 ] methoxy} benzonitrile

Exemplo 44A 4-[(2,4-dioxo-2H-pirido[2,3-d][1,3]oxazin-1(4H)-il)metil]-benzonitrilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 4-cianobrometo de benzilo o brometo de n-butilo (1,02 g, 60%). MS (DCI) m/z 280 (M+H)+.Example 44A 4 - [(2,4-dioxo-2H-pyrido [2,3-d] [1,3] oxazin-1 (4H) -yl) methyl] benzonitrile The title compound was prepared according to The procedure of Example 1B substituting benzyl 4-cyanobromide and n-butyl bromide (1.02 g, 60%). MS (DCI) m / z 280 (M + H) +.

Exemplo 44B 4-{[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-1(2H)-il]metil}benzonitrilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 44A o produto do Exemplo 1B (0,197 g, 60%). MS (ESI-) m/z 456 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,58 (s, 2H) , 7,18 (dd, J=7, 54, 4,60 Hz, 1H), 7,29 (td, J=8, 46, 1, 84 Hz, 2H), 7,41 (d, J=8,46 Hz, 2H), 7,56 (td, J=7,81, 1,65 Hz, 1H), 7,67 (dd, J=7,91, 1,29 Hz, 1H) , 7,72 (d, J=8,46 Hz, 2H), 8,42 (dd, J=7, 72, 1, 84 Hz, 1H), 8,46 (dd, J=4, 60, 2, 02 Hz, 1H), 15,77 (s, 1H).Example 44B 4 - {[3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ] methyl} benzonitrile The title compound was prepared according to the procedure of Example 1D substituting the product of Example 44A for the product of Example 1B (0.197 g, 60%). MS (ESI-) m / z 456 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.58 (s, 2H), 7.18 (dd, J = (D, J = 8.46 Hz, 2H), 7.56 (td, J = 7.81, 1.65 Hz, 1H), 7.67 (d, J = dd, J = 7.91, 1.29 Hz, 1H), 7.72 (d, J = 8.46 Hz, 2H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H ), 8.46 (dd, J = 4.60, 2.02 Hz, 1H), 15.77 (s, 1H).

Exemplo 45 1-[2-(1-ciclo-hexen-l-il)etil]-3-(1,l-dioxido-4H-l, 2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 45 1- [2- (1-cyclohexen-1-yl) ethyl] -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 , 8-naphthyridin-2 (1H) -one

Exemplo 45A 2-{[2-(1-ciclo-hexen-l-il)etil]amino}nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por 2-(l-ciclo- 111Example 45A Ethyl 2 - {[2- (1-cyclohexen-1-yl) ethyl] amino} nicotinate The title compound was prepared according to the procedure of Example 3A substituting 2- (1-cyclo-

ΕΡ 1 560 S27/PT hexenil)etilamina a 2-etilbutilamina (2,2 g, 80%). MS (DCI) m/z 275 (M+H)+.Hexenyl) ethylamine to 2-ethylbutylamine (2.2 g, 80%). MS (DCI) m / z 275 (M + H) +.

Exemplo 45B 1-[2-(1-ciclo-hexen-l-il)etil]-2H-pirido[2,3-d][1,3]oxazina-2, 4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 45A o produto do Exemplo 3A (0,493 g, 91%). MS (DCI) m/z 290 (M+NH4)\Example 45B 1- [2- (1-cyclohexen-1-yl) ethyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 45A for the product of Example 3A (0.493 g, 91%). MS (DCI) m / z 290 (M + NH 4)

Exemplo 45C 1-[2-(1-ciclo-hexen-l-il)etil]-3-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-4-hidroxi-l, 8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 45B o produto do Exemplo 1B (0,048 g, 14%). MS (ESI-) m/z 449 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 1,53 (m, 4H) , 1,90 (m, 2H), 2,05 (m, 2H), 2,18 (t, J=7,54 Hz, 2H), 4,36 (m, 2H), 5,38 (s, 1H), 7,13 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,28 (m, 2H) , 7,55 (td, J=7, 72, 1, 47 Hz, 1H), 7,66 (dd, J=7, 72, 1, 47 Hz, 1H) , 8,37 (dd, J=7,54, 2,02Example 45C 1- [2- (1-cyclohexen-1-yl) ethyl] -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 45B for the product of Example 1B (0.048 g, 14%). MS (ESI-) m / z 449 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.53 (m, 4H), 1.90 (m, 2H), 2.05 (m, 2H), 2.18 (t, J = 7.54 Hz , 7.28 (m, 2H), 4.36 (m, 2H), 5.38 (s, 1H), 7.13 (dd, , 7.56 (dd, J = 7.72, 1.47 Hz, 1 H), 8.37 (dd, J = 7), 7.55 (td, J = 7.72, 1.47 Hz, , 54.22

Hz, 1H), 8,52 (dd, J=4, 60, 2, 02 Hz, 1H) , 15,91 (s, 1H) .1H), 8.52 (dd, J = 4.60, 2.02 Hz, 1H), 15.91 (s, 1H).

Exemplo 46 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[(2-metil-l,3-tiazol-4-il)metil]-1,8-naftiridin-2(1H)-onaExample 46 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(2-methyl-1,3-thiazol-4-yl) methyl] -1,8-naphthyridin-2 (1H) -one

Exemplo 46A 1-[(2-metil-l,3-tiazol-4-il)metil]-2H-pirido[2,3-d] [1,3]-oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 4-clorometil-2-metiltiazole o brometo de n-butilo (0,087 g, 26%). XH RMN (300 MHz, DMSO-d6) δ 2,63 (s, 3H) , 5,37 (d, J=l,47 Hz, 2H) , 7,39 (s, 1H), 7,40 (dd, J=7, 72, 4, 78 Hz, 1H), 8,44 (dd, J=7,72, 1,84 Hz, 1H), 8,72 (dd, J=4,78, 1,84 Hz, 1H). 112Example 46A 1 - [(2-methyl-1,3-thiazol-4-yl) methyl] -2H-pyrido [2,3-d] [1,3] oxazin-2,4 (1H) -dione O The title compound was prepared according to the procedure of Example 1B substituting 4-chloromethyl-2-methylthiazole and n-butyl bromide (0.087 g, 26%). 1 H NMR (300 MHz, DMSOd 6) δ 2.63 (s, 3H), 5.37 (d, J = 1.47 Hz, 2H), 7.39 (s, 1H), 7.40 (dd , J = 7.72, 4.78 Hz, 1H), 8.44 (dd, J = 7.72, 1.84 Hz, 1H), 8.72 (dd, J = 4.78, 1.84 Hz, 1H). 112

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 46B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[(2-metil-l,3-tiazol-4-il)metil]-1,8-naftiridin-2(1H)-onaExample 46B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(2-methyl-1,3-thiazol-4-yl) methyl] -1,8-naphthyridin-2 (1H) -one

O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 46A o produto do Exemplo 1B (0, 078 g, 56%). MS (DCI/NH3) m/z 454 (M+H)+. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ 2,61 (s, 3H) , 5,55 (s, 2H), 6,74 (s, 1H), 7,16 (dd, J=7, 73, 4, 78 Hz, 1H) , 7,29 (m, 2H) , 7,55 (m, 1H), 7,67 (d, J=1 r 72 Hz, 1H), 8,41 (dd, J=7, 72, 1, 84 Hz, 1H), 8,47 (dd, J=4,78, 2,21 Hz, 1H), 15,85 (s, 1H).The title compound was prepared according to the procedure of Example 1D substituting the product of Example 46A for the product of Example 1B (0.078 g, 56%). MS (DCI / NH 3) m / z 454 (M + H) +. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.61 (s, 3H), 5.55 (s, 2H), 6.74 (s, 1H), 7.16 (dd, J = 1 Hz, 1H), 8.41 (dd, J = 1, 72 Hz, 1H) 7.72, 1.84 Hz, 1H), 8.47 (dd, J = 4.78, 2.21 Hz, 1H), 15.85 (s, 1H).

Exemplo 47 2-{[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-1(2H)-il]metil}benzonitriloExample 47 2 - {[3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ] methyl} benzonitrile

Exemplo 47A 2-[(2,4-dioxo-2H-pirido[2,3-d][1,3]oxazin-1(4H)-il)metil]-benzonitrilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-cianobrometo de benzilo o brometo de n-butilo (0,332 g, 65%). MS (DCI) m/z 280 (M+H)+.Example 47A 2 - [(2,4-dioxo-2H-pyrido [2,3-d] [1,3] oxazin-1 (4H) -yl) methyl] benzonitrile The title compound was prepared according to The procedure of Example 1B substituting benzyl 2-cyanobromide and n-butyl bromide (0.332 g, 65%). MS (DCI) m / z 280 (M + H) +.

Exemplo 47B 2-{[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-1(2H)-il]metil}benzonitrilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 47A 0 produto do Exemplo 1B (0,183 g, 66%). MS (ESI-) m/z 456 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 5,68 (s, 2H) , 7,00 (d, J= 8,09 Hz, 1H), 7,19 (dd, J=7,35, 4, 78 Hz, 1H) , 7,30 (t, J=8,09 Hz, 2H) , 7,39 (t, J=7,54 Hz, 1H), 7,56 (t, J=7,85 Hz, 2H) , 7,67 (d, J=7,72Example 47B 2 - {[3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ] methyl} benzonitrile The title compound was prepared according to the procedure of Example 1D substituting the product of Example 47A for the product of Example 1B (0.183 g, 66%). MS (ESI-) m / z 456 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.68 (s, 2H), 7.00 (d, J = 8.09 Hz, 1H), 7.19 (dd, (T, J = 8.09 Hz, 2H), 7.39 (t, J = 7.54 Hz, 1H), 7.56 (t, J = 7.85 Hz, , 2H), 7.67 (d, J = 7.72

Hz, 1H), 7,84 (d, J=7,72 Hz, 1H) , 8,44 (m, 2H), 15,75 (s, 1H) . 113 ΕΡ 1 560 827/ΡΤHz, 1H), 7.84 (d, J = 7.72 Hz, 1H), 8.44 (m, 2H), 15.75 (s, 1H). 113 ΕΡ 1 560 827 / ΡΤ

Exemplo 48 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[(5-metil-3-isoxazolil)metil]-1,8-naftiridin-2(1H)-onaExample 48 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(5-methyl-3-isoxazolyl) methyl] -1,8-naphthyridine -2 (1H) -one

Exemplo 48A 1-[(5-metil-3-isoxazolil)metil]-2H-pirido[2, 3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 3-clorometil-5-metilisoxazole o brometo de n-butilo (0,047 g, 15%). RMN (300 MHz, DMSO-d6) δ 2,34 (s, 3H) , 5,35 (s, 2H) , 6,26 (d, J=l,10 Hz, 1H), 7,42 (dd, J=7, 72, 4, 78 Hz, 1H) , 8,44 (dd, J=7,72, 1,84 Hz, 1H), 8,75 (dd, J=5,15, 1,84 Hz, 1H).Example 48A 1 - [(5-methyl-3-isoxazolyl) methyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to was reacted with the procedure of Example 1B substituting 3-chloromethyl-5-methylisoxazole for n-butyl bromide (0.047 g, 15%). NMR (300 MHz, DMSO-d 6) δ 2.34 (s, 3H), 5.35 (s, 2H), 6.26 (d, J = 1.10 Hz, 1H), 7.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.75 (dd, J = 5.15, 1.84 Hz, 1H), 8.44 (dd, , 1H).

Exemplo 48B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(5-metil-3-isoxazolil)metil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 48A o produto do Exemplo 1B (0,051 g, 67%). MS (ESI-) m/z 436 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 2,29 (s, 3H) , 5,50 (s, 2H), 5,94 (s, 1H), 7,18 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,29 (m, 2H), 7,56 (t, J=8,09Example 48B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(5-methyl-3-isoxazolyl) methyl] -1,8-naphthyridine -2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 48A for the product of Example 1B (0.051 g, 67%). MS (ESI-) m / z 436 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.29 (s, 3H), 5.50 (s, 2H), 5.94 (s, 1H), 7.18 (dd, 4.78 Hz, 1H), 7.29 (m, 2H), 7.56 (t, J = 8.09

Hz, 1H) , 7,67 (d, J=8,09 Hz, 1H) , 8,41 (dd, J=7, 72, 1, 84 Hz, 1H), 8,49 (dd, J=4, 78, 2,21 Hz, 1H), 15,76 (s, 1H).1H), 8.41 (dd, J = 7, 72, 1, 84 Hz, 1H), 8.49 (dd, J = 4). , 78, 2.21 Hz, 1H), 15.76 (s, 1H).

Exemplo 49 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(1-naftilmetil)-1,8-naftiridin-2(1H)-onaExample 49 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (1-naphthylmethyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 49A 1-(2-naftilmetil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 1-(bromometil)-naftaleno o brometo de n-butilo (0,391 g, 71%). MS (DCI) m/z 305 (M+H)+. 114 ΕΡ 1 560 827/ΡΤExample 49A 1- (2-Naphthylmethyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting for 1- (bromomethyl) -naphthalene and n-butyl bromide (0.391 g, 71%). MS (DCI) m / z 305 (M + H) +. 114 ΕΡ 1 560 827 / ΡΤ

Exemplo 49Β 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(1-naftilmetil)-1,8-naftiridln-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 49a o produto do Exemplo 1B (0,087 g, 60%). MS (ESI-) m/z 481 (M-H) ; xh RMN (300 MHz, DMSO- -d6) δ 5, r 88 (S, 2H) f 7 ,45 (m, 2H) , 7,54 (t, J=1 ,72 Hz, 3H), 7,65 (d, J= = 7, 72 Hz r 1H), 7, 75 (m , 2H), 7, 81 (dd , J= 6,07, 3,49 HZ, 1H), r 7 , 86 (d, j= 8 , 46 Hz, 2H) , 7,93 (d, J= 7, 35 Hz, 1H), 8, 63 (dd, J= 7,72, 1, 84 Hz, 1H), 8, 83 (dd, J= 4 , 78, 1,84 Hz, 1H), 14, 04 ( s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ 5,69 (s, 2H) , 7,16 (dd, J=7, 54, 4, 60 Hz, 1H) , 7,29 (t, J=7, 72 Hz, 2H), 7,43 (m, 2H) , 7,49 (dd, J=8, 64, 1, 65 Hz, 1H) , 7,56 (td, J=7, 72, 1, 47 Hz, 1H), 7,67 (d, J=7,35 Hz, 2H) , 7,83 (m, 3H), 8,42 (dd, J= 7, 54, 2, 02 Hz, 1H), 8,48 (dd, J=4, 60, 2, 02 Hz, 1H) , 15, 86 (S, 1H) .Example 49 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (1-naphthylmethyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 49a for the product of Example 1B (0.087 g, 60%). MS (ESI-) m / z 481 (M-H); 1 H NMR (300 MHz, DMSO-d 6) δ 5.88 (s, 2H), 7.45 (m, 2H), 7.54 (t, J = 1.72 Hz, 3H), 7.65 (d, J = 7.0 Hz, 1H), 7.75 (m, 2H), 7.81 (dd, J = 6.07, 3.49 Hz, (dd, J = 7.72, 1.84 Hz, 1 H), 8.83 (d, J = 7, 35 Hz, 1 H), 8.63 dd, J = 4.78, 1.84 Hz, 1H), 14.04 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.69 (s, 2H), 7.16 (dd, J = (Dd, J = 8.64, 1.65 Hz, 1H), 7.56 (td, J = 7.72, 1.47 1H), 7.67 (d, J = 7.35 Hz, 2H), 7.83 (m, 3H), 8.42 (dd, J = 8.48 (dd, J = 4.60, 2.02 Hz, 1H), 15.86 (S, 1H).

Exemplo 50 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(2-piridinilmetil)-1,8-naftiridin-2(1H)-onaExample 50 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (2-pyridinylmethyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 50A 1-(2-piridinilmetil)-2H-pirido[2, 3-d] [1,3-d]oxazina-2,4(1H)- diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-(bromometil)-piridina o brometo de n-butilo (0,060 g, 19%). XH RMN (300 MHz, DMSO-d6) δ 5,45 (s, 2H) , 7,26 (m, 1H) , 7,39 (dd, J=7,72, 4,78 Hz, 1H), 7,45 (d, J=8,09 Hz, 1H) , 7,73 (m, 1H) , 8,46 (dd, J= 7, 72, 1,84 Hz, 1H) , 8,47 (m, 1H), 8,68 (dd, J=4,78, 1,47 Hz, 1H).Example 50A 1- (2-pyridinylmethyl) -2H-pyrido [2,3-d] [1,3-d] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting 2- (bromomethyl) pyridine and n-butyl bromide (0.060 g, 19%). 1 H NMR (300 MHz, DMSOd 6) δ 5.45 (s, 2H), 7.26 (m, 1H), 7.39 (dd, J = 7.72, 4.78 Hz, 8.46 (dd, J = 7.72, 1.84 Hz, 1H), 8.47 (m, 1H) 1H), 8.68 (dd, J = 4.78, 1.47 Hz, 1H).

Exemplo 50B 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-hidroxi-1-(2-piridinilmetil)-1,8-naftiridin-2(1H)-ona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do 115Example 50B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -hydroxy-1- (2-pyridinylmethyl) -1,8-naphthyridin-2 (1H) -one Compound The title compound was prepared according to the procedure of Example 1D substituting the product of 115

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 50A o produto do Exemplo 1B (0,072 g, 72%). MS (ESI-) m/z 432 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 5,62 (s, 2H) , 6,97 (d, J= 8,09 Hz, 1H) , 7,18 (m, 2H), 7,31 (m, 2H), 7,62 (m, 3H), 8,44 (d, J= 6,62 Hz, 3H), 15,71 (s, 1H) .Example 50A The product of Example 1B (0.072 g, 72%). MS (ESI-) m / z 432 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.62 (s, 2H), 6.97 (d, J = 8.09 Hz, 1H), 7.18 (m, 2H), 7.31 , 2H), 7.62 (m, 3H), 8.44 (d, J = 6.62 Hz, 3H), 15.71 (s, 1H).

Exemplo 51 1-(4-tert-butilbenzil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 51 1- (4-tert-Butylbenzyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 51A 1-(4-tert-butilbenzil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 4-(tert-butil)-brometo de benzilo o brometo de n-butilo (0,410 g, 72%). MS (DCI) m/z 311 (M+H)+.Example 51A 1- (4-tert-Butylbenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting benzyl 4- (tert-butyl) -bromide and n-butyl bromide (0.410 g, 72%). MS (DCI) m / z 311 (M + H) +.

Exemplo 51B 1-(4-tert-butilbenzil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 51A o produto do Exemplo 1B (0,109 g, 70%). MS (ESI-) m/z 487 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 1,23 (s, 9H) , 5,49 (s, 2H), 7,16 (m, 3H), 7,28 (m, 4H) , 7,55 (td, J=7,91, 1,47 Hz, 1H), 7,66 (d, J=6,25 Hz, 1H), 8,40 (dd, J=7,72, 2,21 Hz, 1H), 8,49 (dd, J=4,60, 2,02 Hz, 1H) , 15,84 (s, 1H) .Example 51B 1- (4-tert-butylbenzyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 51A for the product of Example 1B (0.109 g, 70%). MS (ESI-) m / z 487 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.23 (s, 9H), 5.49 (s, 2H), 7.16 (m, 3H), 7.28 (m, 4H), 7.55 (td, J = 7.91, 1.47 Hz, 1H), 7.66 (d, J = 6.25 Hz, 1H), 8.40 (dd, J = 7.72, 2.21 Hz, 1H), 8.49 (dd, J = 4.60, 2.02 Hz, 1H), 15.84 (s, 1H).

Exemplo 52 [3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-1,8-naftiridin-1(2H)-il]acetato de etiloExample 52 [3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] acetate ethyl

Exemplo 52A (2,4-dioxo-2H-pirido[2,3-d][1,3]oxazin-1(4H)-il)acetato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por bromoacetato de 116 ΕΡ 1 560 827/ΡΤ etilo ο brometo de n-butilo (0,174 g, 43%). XH RMN (300 MHz, DMSO-d6) δ 1,21 (t, J= 7,17 Hz, 3H), 4,18 (q, J=7,ll Hz, 2H) , 4,92 (s, 2H), 7,45 (dd, J=7, 72, 4, 78 Hz, 1H) , 8,47 (dd, J=7,91, 1,65 Hz, 1H), 8,77 (dd, J=4,78, 1,84 Hz, 1H).Example 52A Ethyl (2,4-dioxo-2H-pyrido [2,3-d] [1,3] oxazin-1 (4H) -yl) acetate The title compound was prepared according to the procedure of Example 1B substituting 116 æg 1560 827 / ΡΤ ethyl bromoacetate for n-butyl bromide (0.174 g, 43%). 1 H NMR (300 MHz, DMSO-d 6) δ 1.21 (t, J = 7.17 Hz, 3H), 4.18 (q, J = 7, 11 Hz, 2H), 4.92 (s, 2H 8.47 (dd, J = 7.91, 1.65 Hz, 1 H), 8.77 (dd, J = 7, 4.78, 1.84 Hz, 1H).

Exemplo 52BExample 52B

[3-(1,l-dioxido-4H-l,2,4-benzotiadiazln-3-ll)-4-hidroxi-2-oxo-1,8-naftiridin-1(2H)-il]acetato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 52A o produto do Exemplo 1B (0,200 g, 52%). MS (ESI-) m/z 427 (M-H) XH RMN (300 MHz, DMSO-d6/CF3COOD) δ 1,26 (t, J= 6,99 Hz, 3H), 4,22 (q, J=7,ll Hz, 2H), 5,34 (s, 2H) , 7,44 (dd, J=7,91, 4,60 Hz, 1H), 7,54 (m, 2H), 7,74 (m, 1H), 7,96 (m, 1H), 8,63 (dd, J=8, 09, 1, 84 Hz, 1H), 8,79 (dd, J=4,78, 1, 84 Hz, 1H).Ethyl [3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] acetate The title compound was prepared according to the procedure of Example 1D substituting the product of Example 52A for the product of Example 1B (0.200 g, 52%). NMR (300 MHz, DMSO-d 6 / CF 3 COOD) δ 1.26 (t, J = 6.99 Hz, 3H), 4.22 (q, J = 7) 2H), 7.44 (dd, J = 7.91, 4.60 Hz, 1H), 7.54 (m, 2H), 7.74 (m, 2H) 1H), 7.96 (m, 1H), 8.63 (dd, J = 8.9, 1.84 Hz, 1H), 8.79 (dd, J = 4.78, 1H).

Exemplo 53 ácido [3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-1(2H)-il]acético A uma suspensão do produto do Exemplo 52B em THF:metanol 1:1 (6 mL) juntou-se hidróxido de lítio aquoso 0,5 N (6 mL). A mistura foi agitada a temperatura ambiente durante 2 horas, ajustada a pH 3 com HC1 1,0 N e filtrada. O bolo de filtração foi lavado com água e seco para gerar o composto em título (0,133 g, 86%). MS (ESI-) m/z 399 (M-H) ; XH RMN (300 MHz, DMSO-de) δ 5,16 (s, 2H), 7,54 (m, 2H), 7,67 (d, J=7, 72 Hz, 1H), 7,77 (t, J=7, 72 Hz, 1H), 7,92 (d, J=7, 72 Hz, 1H) , 8,60 (dd, J=8, 09, 1, 84 Hz, 1H), 8,84 (dd, J=4,60; 1,65 Hz, 1H) , 13,11 (br s, 1H), 13,79 (br s, 1H).Example 53 [3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] acetic acid To a suspension of the product of Example 52B in 1: 1 THF: methanol (6 mL) was added 0.5 N aqueous lithium hydroxide (6 mL). The mixture was stirred at room temperature for 2 hours, adjusted to pH 3 with 1.0 N HCl and filtered. The filter cake was washed with water and dried to give the title compound (0.133 g, 86%). MS (ESI-) m / z 399 (M-H); 1 H NMR (300 MHz, DMSO-d 6) δ 5.16 (s, 2H), 7.54 (m, 2H), 7.67 (d, J = 7.72 Hz, 1H), 7.77 , J = 7.72 Hz, 1H), 7.92 (d, J = 7, 72 Hz, 1H), 8.60 (dd, J = 8.9, 1.84 Hz, 1H), 8.84 (dd, J = 4.60, 1.65 Hz, 1H), 13.11 (br s, 1H), 13.79 (br s, 1H).

Exemplo 54 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(3-fenoxibenzil)-1,8-naftiridin-2(1H)-onaExample 54 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-phenoxybenzyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 54A 1-(3-fenoxibenzil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por cloreto de 117 ΕΡ 1 560 827/ΡΤ 3-fenoxibenzilo ο brometo de n-butilo (0,190 g, 31%). MS (DCI) m/z 347 (M+H)+.Example 54A 1- (3-Phenoxybenzyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting for 117 æC 1 560 827 / ΡΤ 3-phenoxybenzyl chloride n n-butyl bromide (0.190 g, 31%). MS (DCI) m / z 347 (M + H) +.

Exemplo 54B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(3-fenoxibenzil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 54A o produto do Exemplo 1B (0,063 g, 52%). MS (ESI-) m/z 523 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ 5,51 (s, 2H), 6,77 (dd, J=8,09, 1,47 Hz, 1H), 6,91 (S, 1H), 6,99 (t, J=8,46 Hz, 2H) , 7,10 (t, J= 7,35 Hz, 1H), 7,19 (m, 1H), 7,31 (m, 6H), 7,57 (t, J=7, 72 Hz, 1H), 7,68 (d, J=7, 72 Hz, 1H) , 8,41 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,48 (d,J=2,94 Hz, 1H), 15,74 (s, 1H).Example 54B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-phenoxybenzyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 54A for the product of Example 1B (0.063 g, 52%). MS (ESI-) m / z 523 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSOd 6) δ 5.51 (s, 2H), 6.77 (dd, J = 8.09, 1.47 Hz, 1H), 6.91 (s, 1H), 6 , 7.10 (t, J = 7.35 Hz, 1 H), 7.19 (m, 1H), 7.31 (m, 6H), 7.97 (D, J = 7.72 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1 H) , 8.48 (d, J = 2.94 Hz, 1H), 15.74 (s, 1H).

Exemplo 55 l-alil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1,8-naftiridin-2(1H)-onaExample 55 1-Allyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 55A l-alil-2H-pirido[2,3—d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por brometo de alilo o brometo de n-butilo (5,12 g, 82%). MS (DCI/NH3) m/z 205 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ 4,75 (m, 2H) , 5,14 (dd, J=10, 66, 1, 47 Hz, 1H), 5,27 (dd, J=17, 28, 1, 47 Hz, 1H), 5,92 (m, 1H), 7,39 (dd, J=7, 72, 4, 78 Hz, 1H), 8,40 (dd, J=7,91, 2,02 Hz, 1H), 8,75 (dd, J=4,78, 1,84 Hz, 1H).Example 55A 1-Allyl-2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting allyl bromide n-butyl bromide (5.12 g, 82%). MS (DCI / NH 3) m / z 205 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 4.75 (m, 2H), 5.14 (dd, J = 10.66,1.47 Hz, 1H), 5.27 (dd, J = 1H), 5.92 (m, 1H), 7.39 (dd, J = 7.72, 4.78 Hz, 1H), 8.40 (dd, J = 7.91 , 2.02 Hz, 1H), 8.75 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 55B l-alil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 55A o produto do Exemplo 1B (1,4 g, 34,5%). MS (DCI/NH3) m/z 383 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ 5,03 (m, 1H), 5,11-5,15 (m, 3H), 5,93-6,07 (m, 1H), 7,45-7,60 (m, 2H), 118Example 55B 1-Allyl-3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 55A for the product of Example 1B (1.4 g, 34.5%). MS (DCI / NH 3) m / z 383 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 5.03 (m, 1H), 5.11-5.15 (m, 3H), 5.93-6.07 (m, 1H), 7.45- 7.60 (m, 2H), 118

ΕΡ 1 560 827/PT 7, 65-7, 72 (m, J=8,46 Hz, 1H) , 7, 73-7, 80 (t, J=7,72 Hz, 1H) , 7,92 (d, J=7,35 Hz, 1H), 8,58 (dd, J=8, 09, 1, 84 Hz, 1H), 8,85 (dd,J=4,60, 1,65 Hz, 1H).(M, J = 8.46 Hz, 1 H), 7.73-7.80 (t, J = 7.72 Hz, 1H), 7.92 (m, d, J = 7.35 Hz, 1H), 8.58 (dd, J = 8.9, 1.84 Hz, 1H), 8.85 (dd, J = 4.60, 1.65 Hz, 1H ).

Exemplo 56 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(2-naftllmetll)-1,8-naftiridin-2(1H)-onaExample 56 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (2-naphthylmethyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 56A 1-(2-naftllmetll)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-(bromometil)-naftaleno o brometo de n-butilo (0,417 g, 75%). MS (DCI) m/z 305 (M+H)+.Example 56A 1- (2-naphthylmethyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting for 2- (bromomethyl) -naphthalene and n-butyl bromide (0.417 g, 75%). MS (DCI) m / z 305 (M + H) +.

Exemplo 56B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(2-naftilmetil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 56A o produto do Exemplo 1B (0,022 g, 42%). MS (ESI-) m/z 481 (Μ-ΗΓ; ΧΗ RMN (300 MHz, DMSO-d6) δ 6,18 (s, 2H) , 6,83 (d, J= 6,62 Hz, 1H), 7,28 (m, 1H), 7,53 (t, J=7,54 Hz, 2H), 7,68 (m, 4H), 7,81 (d,J=8,09 Hz, 1H), 7,92 (d, J=7,35 Hz, 1H), 8,00 (d, J=8,09 Hz, 1H), 8,32 (d, J=8,46 Hz, 1H), 8,66 (dd, J=8, 09, 1, 84 Hz, 1H), 8,74 (dd, J=4, 78, 1, 84 Hz, 1H), 14,04 (s, 1H). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1E RMN (300 MHz, DMSO-d6; i δ 6,00 (s, 2H) , 6,76 (d, J=6,25 Hz, 1H), 7,18 (dd, J=7, 54, 4, 96 Hz, 1H), 7,30 (m, 3H), 7,63 (m, 4H), 7,75 (d, J=8,09 Hz, 1H), 7,97 (d, J= 6,99 Hz, 1H), 8,31 (d, J=8,46 Hz, 1H), 8, 40 (d, J=3,68 Hz, 1H), 8 ,47 (dd, J=7, 72 , 1,84 Hz, 1H), 15, 78 (s, 1H) .Example 56B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (2-naphthylmethyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 56A for the product of Example 1B (0.022 g, 42%). NMR (300 MHz, DMSO-d 6) δ 6.18 (s, 2H), 6.83 (d, J = 6.62 Hz, 1H), 6.83 (d, J = 7.28 (m, 1H), 7.53 (t, J = 7.54 Hz, 2H), 7.68 (m, 4H), 7.81 (d, J = 8.09 Hz, 1H), 7.92 (d, J = 7.35 Hz, 1H), 8.00 (d, J = 8.09 Hz, 1H), 8.32 (d, J = 8.46 Hz, (Dd, J = 4.78,1.84 Hz, 1H), 14.04 (s, 1H). sodium salt of the title compound was prepared according to the procedure of Example 1D.1H NMR (300 MHz, DMSO-d6, δ 6.00 (s, 2H), 6.76 (d, J = 6.25 Hz, 7.30 (m, 3H), 7.63 (m, 4H), 7.75 (d, J = 8), 7.18 (dd, J = , 9.97 (d, J = 6.99 Hz, 1H), 8.31 (d, J = 8.46 Hz, 1H), 8.46 (d, J = 3.68 1H), 8.47 (dd, J = 7, 72, 1.84 Hz, 1H), 15.78 (s, 1H).

Exemplo 57 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[(IR)-1-feniletil]-1, 8-naftiridin-2(1H)-onaExample 57 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(1 R) -1-phenylethyl] -1,8-naphthyridin-2- 1H) -one

Exemplo 57A 2-{[(IR)-1-feniletil]amino}nicotinato de etilo 119Example 57A Ethyl 2 - {[(1R) -1-phenylethyl] amino} nicotinate

ΕΡ 1 560 827/PT Ο composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por (R)-(+)-a-metil-benzilamina a 2-etilbutilamina (2,23 g, 82%). MS (DCI) m/z 271 (M+H)+.The title compound was prepared according to the procedure of Example 3A substituting 2 (R) - (+) -? - methylbenzylamine for 2-ethylbutylamine (2.23 g, 82%). MS (DCI) m / z 271 (M + H) +.

Exemplo 57B 1-[(lR)-l-feniletil]-2H-pirido[2, 3-d] [1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 57A o produto do Exemplo 3A (0,250 g, 62%). XH RMN (300 MHz, DMSO-de) δ 1,86 (d, J= 6,99 Hz, 3H) , 6,65 (q, J= 6,99 Hz, 1H), 7,27 (m, 3H) , 7,40 (m, 3H), 8,43 (dd, J=7,72, 1,84 Hz, 1H), 8,73 (dd, J=4, 96, 2, 02 Hz, 1H).Example 57B 1 - [(1R) -1-phenylethyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 57A for the product of Example 3A (0.250 g, 62%). 1 H NMR (300 MHz, DMSO- d 6) δ 1.86 (d, J = 6.99 Hz, 3H), 6.65 (q, J = 6.99 Hz, 1H), 7.27 (m, 3H (Dd, J = 7.72, 1.84 Hz, 1 H), 8.73 (dd, J = 4.96, 2.02 Hz, 1 H) .

Exemplo 57C 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(IR)-1-feniletil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 57B o produto do Exemplo 1B (0,080 g, 36%). MS (ESI-) m/z 445 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 1,90 (d, J=7,35 Hz, 3H) , 6,87 (m, 1H) , 7,12 (m, 2H), 7,25 (m, 6H), 7,55 (m, 1H), 7,65 (d, J=7,72 Hz, 1H), 8,40 (d, J=6,25 Hz, 2H), 15,92 (s, 1H).Example 57C 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(1R) -1-phenylethyl] -1,8-naphthyridin-2- 1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 57B for the product of Example 1B (0.080 g, 36%). MS (ESI-) m / z 445 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.90 (d, J = 7.35 Hz, 3H), 6.87 (m, 1H), 7.12 (m, 2H), 7.25 (m 1H), 7.65 (d, J = 7.72 Hz, 1H), 8.40 (d, J = 6.25 Hz, 2H), 15.92 (s, , 1H).

Exemplo 58 1-[(5-tert-butil-2-tienil)metil]-3-(1,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 58 1 - [(5-tert-butyl-2-thienyl) methyl] -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8 (1H) -one

Exemplo 58A 1-[(5-tert-butiltienil)metil]-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-bromometil-5-tert-butiltiofeno o brometo de n-butilo (0,098 g, 25%). 1H RMN (300 MHz, DMSO-de) δ 1,28 (s, 9H), 5,39 (s, 2H), 6,71 (d, 120 ΕΡ 1 560 827/ΡΤ J= 3,68 Hz, 1Η), 7,00 (d, J= 3,68 Hz, 1H), 7,42 (dd, J=7, 72, 4,78 Hz, 1H), 8,40 (dd, J=7,72, 1,47 Hz, 1H), 8,83 (dd, J=4, 78, 1, 84 Hz, 1H) .Example 58A 1 - [(5-tert-butylthienyl) methyl] pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting 2-bromomethyl-5-tert-butylthiophene for n-butyl bromide (0.098 g, 25%). 1 H NMR (300 MHz, DMSO-d 6) δ 1.28 (s, 9H), 5.39 (s, 2H), 6.71 (d, 120 Å), 1 560 827 / ΡΤ J = 3.68 Hz, 1Η , 7.42 (dd, J = 7.72, 4.78 Hz, 1H), 8.40 (dd, J = 7.72, 1.47 Hz, 1H), 8.83 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 58B 1-[(5-tert-butil-2-tienil)metil]-3-(1,l-dioxido-4H-l, 2, 4-benzotiadlazln-3-11)-4-hidroxi-l, 8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 58A o produto do Exemplo 1B (0,082 g, 54%). MS (ESI-) m/z 493 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 1,25 (s, 9H) , 5,55 (s, 2H) , 6,63 (d, J=3,31 Hz, 1H), 6,89 (d, J=3,31 Hz, 1H), 7,18 (dd, J=7,72, 4,78 Hz, 1H), 7,28 (m, 2H), 7,56 (m, 1H), 7,67 (d, J=7, 72 Hz, 1H), 8,39 (dd, J=1, 72, 1, 84 Hz, 1H), 8,57 (dd, J=4,78, 1,84Example 58B 1 - [(5-tert-butyl-2-thienyl) methyl] -3- (1,1-dioxido-4 H -1,2,4-benzothiazol-3-11) -4-hydroxy-1,8 -naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 58A for the product of Example 1B (0.082 g, 54%). MS (ESI-) m / z 493 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.25 (s, 9H), 5.55 (s, 2H), 6.63 (d, J = 3.31 Hz, 1H), 6.89 1H), 7.18 (dd, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 2H), 7.56 (m, 1H). , 6.79 (dd, J = 1.72, 1.84 Hz, 1H), 8.57 (dd, J = 4.78, 1.84

Hz, 1H), 15,83 (s, 1H).Hz, 1H), 15.83 (s, 1H).

Exemplo 59 1-(1,1'-bifenil-4-ilmetil)-3-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 59 1- (1,1'-biphenyl-4-ylmethyl) -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8 (1H) -one

Exemplo 59A 1-(1,1'-bifenil-4-bifenil)-2H-pirido[2,3—d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por cloreto de 4-fenil-benzilo o brometo de n-butilo (0,119 g, 20%). MS (DCI) m/z 331 (M+H)+.Example 59A 1- (1,1'-biphenyl-4-biphenyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to was reacted with the procedure of Example 1B substituting 4-phenylbenzyl chloride for n-butyl bromide (0.119 g, 20%). MS (DCI) m / z 331 (M + H) +.

Exemplo 59B 1-(1,1'-bifenil-4-ilmetil)-3-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 59A o produto do Exemplo 1B (0,061 g, 50%). MS (ESI-) m/z 507 (M-H)”. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 5,57 (s, 2H) , 7,17 (dd, J=7, 72, 4,78 Hz, 1H), 7,31 (m, 5H) , 7,42 (t, J=7,54 Hz, 2H), 7,57 (m, 5H) , 7,67 121 ΕΡ 1 560 827/ΡΤ (d, J=8,09 Hz, 1H), 8,42 (dd, J=7,72, 1,84 Hz, 1H), 8,50 (dd, J=4, 60, 2, 02 Hz, 1H), 15,84 (s, 1H) .Example 59B 1- (1,1'-biphenyl-4-ylmethyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8 -naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 59A for the product of Example 1B (0.061 g, 50%). MS (ESI-) m / z 507 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.57 (s, 2H), 7.17 (dd, J = 7.72, 4.78 Hz, 1H), 7.31 (m, 5H), 7 (D, J = 8.09 Hz, 1 H), 8.42 (d, J = 8.09 Hz, 1 H) (dd, J = 7.72, 1.84 Hz, 1H), 8.50 (dd, J = 4.60, 2.02 Hz, 1H), 15.84 (s, 1H).

Exemplo 60 3-(1,l-dloxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi- 1-[2-(lH-indol-3-il)etil]-1,8-naftiridin-2(1H)-onaExample 60 3- (1,1-Dideoxy-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- [2- (1H-indol-3-yl) ethyl] -1,8- (1H) -one

Exemplo 60A 2-{[2-(lH-indol-3-il)etil]aminojnicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por triptamina a 2-etilbutilamina (1,24 g, 80%). MS (DCI) m/z 310 (M+H)+.Ethyl 2 - {[2- (1H-indol-3-yl) ethyl] amino] nicotinate The title compound was prepared according to the procedure of Example 3A substituting 2-ethylbutylamine for 2-ethylbutylamine (1.24 g, 80% %). MS (DCI) m / z 310 (M + H) +.

Exemplo 60B 1-[2-(lH-indol-3-il)etil]-2H-pirido[2,3—d][1,3]oxazina-2,4(1H)-diona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 60A o produto do Exemplo 3A (0,164 g, 53%) : MS (DCI) m/z 325 (M+NH4)+.Example 60B 1- [2- (1H-Indol-3-yl) ethyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 60A for the product of Example 3A (0.164 g, 53%): MS (DCI) m / z 325 (M + NH 4) +.

Exemplo 60C 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[2-(lH-indol-3-il)etil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 60B o produto do Exemplo 1B (0,140 g, 54%). MS (ESI-) m/z 484 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ 3,09 (m, 2H) , 4,75 (m, 2H), 7,08 (m, 2H), 7,27 (d, J=2,57 Hz, 1H) , 7,36 (d, J= 6,99 Hz, 1H) , 7,54 (m, 2H), 7,77 (m, 3H), 7,94 (d, J=7, 72 Hz, 1H), 8,60 (dd, J=8,09, 1,84 Hz, 1H), 8,95 (dd, J=4,78, 1,84 Hz, 1H), 10,88 (S, 1H).Example 60C 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- [2- (1H-indol-3-yl) ethyl] -1,8- -naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 60B for the product of Example 1B (0.140 g, 54%). MS (ESI-) m / z 484 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 3.09 (m, 2H), 4.75 (m, 2H), 7.08 (m, 2H), 7.27 (d, J = 2.57 Hz 1H), 7.36 (d, J = 6.99 Hz, 1H), 7.54 (m, 2H), 7.77 (m, 3H), 7.94 (d, J = 7.72 Hz) 1H), 8.95 (dd, J = 4.78, 1.84 Hz, 1H), 10.88 (s, 1H).

Exemplo 61 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-[(6-etoxi-2-piridinil)metil]-4-hidroxi-l,8-naftiridin-2(1H)-ona 122 ΕΡ 1 560 827/ΡΤExample 61 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - [(6-ethoxy-2-pyridinyl) methyl] -4-hydroxy-1,8-naphthyridine -2 (1 H) -one 122 Ρ Ρ 1 560 827 / ΡΤ

Exemplo 6ΙΑ 1-[(6-cloro-2-piridinil)metil]-2H-pirido[2,3-d][1,3]oxazina-2, 4(1H)-dlona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-bromometil-6- cloropiridina o brometo de n-butilo (0,159 g, 45%). XH rmn (300 MHz, DMSO-d6) δ 5,40 (s, 2H), 7,41 (m, 2H), 7,49 (d, J=7,72 Hz, 1H), 7,80 (t, J=7, 72 Hz, 1H), 8,46 (dd, J=7,72, 1,84 Hz, 1H), 8,68 (dd, J=5,15, 1,84 Hz, 1H).Example 6 1 - [(6-Chloro-2-pyridinyl) methyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dona The title compound was prepared according to was reacted with the procedure of Example 1B substituting 2-bromomethyl-6-chloropyridine for n-butyl bromide (0.159 g, 45%). 1H NMR (300 MHz, DMSO-d6) δ 5.40 (s, 2H), 7.41 (m, 2H), 7.49 (d, J = 7.72 Hz, 1H), 7.80 J = 7.72, 1.84 Hz, 1H), 8.68 (dd, J = 5.15, 1.84 Hz, 1 H) .

Exemplo 61B 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-[(6-etoxi-2-piridinil)metil]-4-hidroxi-l, 8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 61A o produto do Exemplo 1B (0,109 g, 42%). MS (ESI-) m/z 476 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dé) δ 1,19 (t, J= 6,99 Hz, 3H) , 4,17 (q, J= 6,99 Hz, 2H) , 5,52 (s, 2H), 6,45 (d, J=7,35 Hz, 1H), 6,54 (d, J=7, 72 Hz, 1H), 7,15 (m, 1H), 7,29 (t, J=7, 72 Hz, 2H), 7,54 (m, 2H), 7,66 (d, J=8,09 Hz, 1H), 8,42 (m, 2H), 15,83 (s, 1H).Example 61B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - [(6-ethoxy-2-pyridinyl) methyl] -4-hydroxy-1,8-naphthyridine -2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 61A for the product of Example 1B (0.109 g, 42%). MS (ESI-) m / z 476 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.19 (t, J = 6.99 Hz, 3H), 4.17 (q, J = 6.99 Hz, 2H), 5.52 (s, 2H (D, J = 7.72 Hz, 1H), 7.15 (m, 1H), 7.29 (t, J = (D, J = 8.09 Hz, 1H), 8.42 (m, 2H), 15.83 (s, 1H ).

Exemplo 62 l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)- 4- hidroxi-7-metil-l,8-naftiridin-2(1H)-onaExample 62 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-7-methyl-1,8-naphthyridin-2 (1H) -one

Exemplo 62A 2-(benzilamino)-6-metilnicotinato de fenilmetanamínio O composto em título foi preparado como um sal de benzilamina de acordo com o procedimento do Exemplo 3A substituindo por ácido 2-cloro-6-metilnicotínico o éster etílico do ácido 2-cloro-nicotínico e por benzilamina a 2-etilbutilamina (0,480 g, 46%). MS (ESI+) m/z 243,03 (M+H)+; XH RMN (300 MHz, CDC13) δ 2,35 (s, 3H) , 3,67 (s, 2H) , 4,65 (s, 2H), 5,73 (br s, 3H) , 6,16 (d, J=7,72 Hz, 1H) , 7,17 (m, 10H), 7,76 (d, J=7,35 Hz, 1H), 8,66 (br s, 1H). 123Example 62A Phenylmethanaminium 2- (benzylamino) -6-methylnicotinate The title compound was prepared as a benzylamine salt according to the procedure of Example 3A substituting 2-chloro-6-methylnicotinic acid ethyl ester for 2-chloro -nicotinic acid and benzylamine to 2-ethylbutylamine (0.480 g, 46%). MS (ESI +) m / z 243.03 (M + H) +; 1 H NMR (300 MHz, CDCl 3) δ 2.35 (s, 3H), 3.67 (s, 2H), 4.65 (s, 2H), 5.73 (br s, 3H), 6.16 (s, d, J = 7.72 Hz, 1H), 7.17 (m, 10H), 7.76 (d, J = 7.35 Hz, 1H), 8.66 (br s, 1H). 123

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 62B l-benzil-7-metil-2H-pirido[2,3-d][1,3]oxazina-2,4(lH)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 62A o produto do Exemplo 3A (0,150 g, 50%). XH RMN (300 MHz, CDC13) δ 2,66 (s, 3H) , 5,47 (s, 2H), 7,10 (d, J=8,09 Hz, 1H), 7,31 (m, 3H) , 7,55 (dd, J=7,54, 1,65 Hz, 2H) , 8,26 (d, J=8,09 Hz, 1H).Example 62B 1-benzyl-7-methyl-2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1 H) -dione The title compound was prepared according to the procedure of Example 3B substituting by the product of Example 62A the product of Example 3A (0.150 g, 50%). 1 H NMR (300 MHz, CDCl 3) δ 2.66 (s, 3H), 5.47 (s, 2H), 7.10 (d, J = 8.09 Hz, ), 7.55 (dd, J = 7.54, 1.65 Hz, 2H), 8.26 (d, J = 8.09 Hz, 1H).

Exemplo 62C l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-7-metil-l,8-naftiridin-2(lH)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto doExample 62C 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-7-methyl-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting

Exemplo 62B o produto do Exemplo 1B (0,53 g, 51%). XH RMN (300 MHz, DMSO-d6) δ 2,61 (s, 3H), 5,69 (s, 2H), 7,30 (m, 6H), 7,53 (m, 1H), 7,64 (m, J=7,35 Hz, 1H) , 7,74 (t, J=7,54 Hz, 1H) , 7,90 (d, J= 8,82 Hz, 1H), 8,46 (d, J=8,46 Hz, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI+) m/z 447,0 (M+H)+; *Η RMN (300 MHz, DMSO-d6) δ 2,48 (s, 3H) , 5,50 (s, 2H), 7,25 (m, 7H), 7,54 (m, 1H), 7,66 (d, J= 6,25 Hz, 1H) , 8,28 (d, J=7, 72 Hz, 1H) , 15, 95 (s, 1H) .Example 62B The product of Example 1B (0.53 g, 51%). 1 H NMR (300 MHz, DMSOd 6) δ 2.61 (s, 3H), 5.69 (s, 2H), 7.30 (m, 6H), 7.53 (m, 1H), 7.64 (m, J = 7.35 Hz, 1H), 7.74 (t, J = 7.54 Hz, 1H), 7.90 (d, J = 8.82 Hz, , J = 8.46 Hz, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI +) m / z 447.0 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 2.48 (s, 3H), 5.50 (s, 2H), 7.25 (m, 7H), 7.54 (m, 1H) 66 (d, J = 6.25 Hz, 1H), 8.28 (d, J = 7.72 Hz, 1H), 15.95 (s, 1H).

Exemplo 63 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-[(6-metil-2-piridinil)metil]-1,8-naftiridin-2(1H)-onaExample 63 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(6-methyl-2-pyridinyl) methyl] -1,8-naphthyridine -2 (1H) -one

Exemplo 63A 1-[(6-metil-2-piridinil)metil]-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-bromometil-6-metilpiridina o brometo de n-butilo (0,088 g, 27%). 1H RMN (300 MHz, DMSO-de) δ 2,42 (s, 3H) , 5,38 (s, 2H) , 7,19 (d, J=7, 72 Hz, 1H), 7,37 (m, 2H) , 7,58 (t, J=7, 72 Hz, 1H) , 8,45 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,67 (dd,J=4, 78, 1, 84 Hz, 1H) . 124 ΕΡ 1 560 827/ΡΤExample 63A 1 - [(6-methyl-2-pyridinyl) methyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to with the procedure of Example 1B substituting 2-bromomethyl-6-methylpyridine and n-butyl bromide (0.088 g, 27%). 1H NMR (300 MHz, DMSO-d6) δ 2.42 (s, 3H), 5.38 (s, 2H), 7.19 (d, J = 7.72 Hz, 1H), 7.37 (Dd, J = 7.72, 1.84 Hz, 1 H), 8.67 (dd, J = 4, 78, 1, 84 Hz, 1H). 124 ΕΡ 1 560 827 / ΡΤ

Exemplo 63Β 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(6-metll-2-piridinil)metil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 63a o produto do Exemplo 1B (0,081 g, 40%). MS (ESI-) m/z 446 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ 2,45 (s, 3H) , 5,54 (s, 2H) , 6,57 (d, J=7, 72 Hz, 1H), 7,04 (d, 7=7,35 Hz, 1H) , 7,16 (dd, J=7,17, 4,96 Hz, 1H), 7,29 (t, 7=7,72 Hz, 2H), 7,47 (t, J=7, 72 Hz, 1H), 7,56 (m, 1H), 7,66 (d, J=7,72 Hz, 1H), 8,43 (m, 2H), 15,82 (s, 1H) .Example 63 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(6-methyl-2-pyridinyl) methyl] -1,8-naphthyridine -2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 63a for the product of Example 1B (0.081 g, 40%). MS (ESI-) m / z 446 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 2.45 (s, 3H), 5.54 (s, 2H), 6.57 (d, J = 7.72 Hz, 1H), 7.04 (d , 7 = 7.35 Hz, 1H), 7.16 (dd, J = 7.17, 4.96 Hz, 1H), 7.29 (t, J = 7.72 Hz, 2H), 7.47 (t, J = 7.72 Hz, 1H), 7.56 (m, 1H), 7.66 (d, J = 7.72 Hz, 1H), 8.43 (m, 2H), 15.82 (s, 1H).

Exemplo 64 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-l-(l-etilpropil)- 4- hidroxi-l,8-naftiridin-2(1H)-onaExample 64 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (1-ethylpropyl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 64A 2-[ (1-etilpropil)amino]nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por 2-etil-propilamina a 2-etilbutilamina (1,45 g, 88%). MS (ESI+) 237,1 (M+H)+. XH RMN (300 MHz, CDC13) δ 0,93 (t, J=7,35 Hz, 6M, 1,38 (t, J=7,17 Hz, 3H), 1,60 (m, 4H) , 4,17 (m, 1H), 4,32 (q, J=7, 11 Hz, 2H), 6,45 (dd,J=7, 72, 4, 78 Hz, 1H), 7,89 (br d, &lt;7=8,09 Hz, 1H), 8,10 (dd, 7=7, 72, 1, 84 Hz, 1H), 8,24 (dd, 7=4,78, 2,21Example 64A Ethyl 2 - [(1-ethylpropyl) amino] nicotinate The title compound was prepared according to the procedure of Example 3A substituting 2-ethyl-propylamine for 2-ethylbutylamine (1.45 g, 88%). MS (ESI +) 237.1 (M + H) +. 1 H NMR (300 MHz, CDCl 3) δ0.93 (t, J = 7.35 Hz, 6 M, 1.38 (t, J = 7.17 Hz, 3H), 1.60 (m, 4H), 4 J = 7.11 Hz, 2H), 6.45 (dd, J = 7.72, 4.78 Hz, 1H), 7.89 (br d , 8.10 (dd, J = 7.72, 1.84 Hz, 1H), 8.24 (dd, J = 4.78, 2.21

Hz, 1H).Hz, 1H).

Exemplo 64B 1-(1-etilpropil)-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto doExample 64B 1- (1-ethylpropyl) -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 3B substituting product of the

Exemplo 64A o produto do Exemplo 3A (0,120 g, 57%). MS (ESI+) m/z 223,1 (M+H)+; 1H RMN (300 MHz, CDC13) δ 0,87 (t, 7=7,54 Hz, 6H) , 1,88 (m, 2H) , 2,21 (s , 2H) , 5,43 (s, 1H), 7,24 (dd, 7=6,99, 4, 04 Hz, 1H), 8,42 (dd, 7=7, 72, 1, 84 Hz, 1H), 8,68 (dd, 7=4, 78, 1, 84 Hz, 1H) . 125 ΕΡ 1 560 827/ΡΤExample 64A The product of Example 3A (0.120 g, 57%). MS (ESI +) m / z 223.1 (M + H) +; 1 H NMR (300 MHz, CDCl 3) δ0.87 (t, J = 7.54 Hz, 6H), 1.88 (m, 2H), 2.21 (s, 2H), 5.43 (s, 1H 8.48 (dd, J = 7.72, 1.84 Hz, 1H), 8.68 (dd, J = 4.78, 1.84 Hz, 1H). 125 ΕΡ 1 560 827 / ΡΤ

Exemplo 64C 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-(1-etilpropil)- 4- hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 64B o produto do Exemplo 1B (0,030 g, 15%). MS (ESI+) m/z 413,04 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 0,76 (t, J=7,54 Hz, 6H), 1,90 (m, 2H), 2,29 (m, 2H), 5,37 (m, 0,5H), 5,92 (m, 0,5H) , 7,50 (m, 1H) , 7,56 (t, J=7,54 Hz, 1H) , 7,69 (m, 1H), 7,78 (t, J=7,17 Hz, 1H) , 7,93 (d, J=7,35 Hz, 1H) ; 8,58 (d, J=8,09 Hz, 1H), 8,84 (m, 1H), 14,11 (s, 1H). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI + ) m/z 413,07 (M+H-Na)+; :H RMN (300 MHz, DMSO-de) δ 0,74 (t,J=7,35 Hz, 6H) , 1,88 (br s, 2H) , 2,30 (br s, 2H), 5,35 (br s, 0,5H), 5,78 (br s, 0,5H), 7,28 (br s, 1H) , 7,42 (m,J=7,35 Hz, 2H) , 7,66 (m, 1H) , 7,79 (br d, J=7,35 Hz, 1H), 8,47 (br d, J=7,35 Hz, 1H), 8,64 (br s, 1H).Example 64C 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (1-ethylpropyl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 64B for the product of Example 1B (0.030 g, 15%). MS (ESI +) m / z 413.04 (M + H) +; 1 H NMR (300 MHz, DMSOd 6) δ 0.76 (t, J = 7.54 Hz, 6H), 1.90 (m, 2H), 2.29 (m, 2H), 5.37 (M, 1H), 7.56 (t, J = 7.54 Hz, 1H), 7.69 (m, 1H) , 7.78 (t, J = 7.17 Hz, 1H), 7.93 (d, J = 7.35 Hz, 1H); 8.58 (d, J = 8.09 Hz, 1H), 8.84 (m, 1H), 14.11 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI +) m / z 413.07 (M + H-Na) +; 1 H NMR (300 MHz, DMSO-d 6) δ 0.74 (t, J = 7.35 Hz, 6H), 1.88 (br s, 2H), 2.30 (br s, 2H) (Br s, 0.5H), 5.78 (br s, 0.5H), 7.28 (br s, 1H), 7.42 (m, J = 7.35 Hz, 2H) (Br d, J = 7.35 Hz, 1 H), 8.64 (br s, 1 H), 8.47 (br d, .

Exemplo 65 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1- [ (IS)-1-feniletil]-1,8-naftiridin-2(1H)-onaExample 65 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(1S) -1-phenylethyl] -1,8-naphthyridin-2- 1H) -one

Exemplo 65A 2-{[(IS)-1-feniletil]amino}nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por (S)-(-)-a-metil-benzilamina a 2-etilbutilamina (2,2 g, 81%). MS (DCI) m/z 271 (M+H)+.Example 65A Ethyl 2 - {[(1S) -1-phenylethyl] amino} nicotinate The title compound was prepared according to the procedure of Example 3A substituting (S) - (-) -? - methyl benzylamine for 2 ethylbutylamine (2.2 g, 81%). MS (DCI) m / z 271 (M + H) +.

Exemplo 65B 1-[(IS)-1-feniletil]-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 65A o produto do Exemplo 3A (0,320 g, 80%). 1E RMN (300 MHz, DMSO-de) δ 1,86 (d, J=6,99 Hz, 3H), 6,65 (g, J=6,99 Hz, 1H), 7,27 (m, 3H), 7,40 (m, 3H), 8,43 (dd, J=7,72, 1,84 Hz, 1H), 8,73 (dd, J=4,96, 2,02 Hz, 1H). 126 ΕΡ 1 560 827/ΡΤExample 65B 1 - [(1S) -1-phenylethyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to procedure of Example 3B substituting the product of Example 65A for the product of Example 3A (0.320 g, 80%). 1 H NMR (300 MHz, DMSO-d 6) δ 1.86 (d, J = 6.99 Hz, 3H), 6.65 (g, J = 6.99 Hz, 1H), 7.27 (m, 3H (Dd, J = 7.72, 1.84 Hz, 1 H), 8.73 (dd, J = 4.96, 2.02 Hz, 1 H) . 126 ΕΡ 1 560 827 / ΡΤ

Exemplo 65C 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(IS)-1-feniletil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 65B o produto do Exemplo 1B (0,122 g, 36%). MS (ESI-) m/z 445 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 1,90 (d, J=7,35 Hz, 3H), 6,87 (m, 1H) , 7,12 (m, 2H), 7,25 (m, 6H), 7,55 (m, 1H), 7,65 (d, J=7,72 Hz, 1H), 8,40 (d,J=6,25 Hz, 2H), 15,92 (s, 1H).Example 65C 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(1S) -1-phenylethyl] -1,8-naphthyridin-2- 1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 65B for the product of Example 1B (0.122 g, 36%). MS (ESI-) m / z 445 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.90 (d, J = 7.35 Hz, 3H), 6.87 (m, 1H), 7.12 (m, 2H), 7.25 (m 1H), 7.65 (d, J = 7.72 Hz, 1H), 8.40 (d, J = 6.25 Hz, 2H), 15.92 (s, , 1H).

Exemplo 66 2—{2—[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-1(2H)-il]etil}-lH-isoindole-l,3(2H)-dionaExample 66 2- {2- [3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ethyl} -1H-isoindole-1,3 (2H) -dione

Exemplos 66A 1- [2-(1,3-dioxo-l,3-di-hidro-2H-isoindol-2-il)etil]-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por N-(2-bromoetil)-ftalimida o brometo de n-butilo (0,121 g, 20%). XH RMN (300 MHz, DMSO-de) δ 4,00 (t, J= 5,52 Hz, 2H) , 4,46 (t, J=5,52 Hz, 2H), 7,28 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,80 (s, 4H) , 8,38 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,53 (dd, J=4, 78, 1, 84 Hz, 1H).Examples 66A 1- [2- (1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl) ethyl] -2H-pyrido [2,3-d] [1,3] oxazine- 2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting N- (2-bromoethyl) -phthalimide and n-butyl bromide (0.121 g, 20%). 1 H NMR (300 MHz, DMSO-d 6) δ 4.00 (t, J = 5.52 Hz, 2H), 4.46 (t, J = 5.52 Hz, 2H), 7.28 (dd, J = (Dd, J = 7.72, 1.84 Hz, 1H), 8.53 (dd, J = 7.72, 1.84 Hz, 1H) 4.78, 1.84 Hz, 1H).

Exemplo 66B 2— {2—[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-1(2H)-il]etil}-lH-isoindole-l,3(2 H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 65B o produto do Exemplo 1B (0,085 g, 46%). MS (ESI-) m/z 514 (M-H)“; XH RMN (300 MHz, DMSO-d6/TFA) δ 4,09 (t, J=5,15 Hz, 2H), 4,87 (m, 2H), 7,11 (dd, J=7,91, 4,60 Hz, 1H), 7,19 (d, J=8,09 Hz, 1H), 7,44 (t, J=7, 72 Hz, 1H) , 7,58 (m, 5H), 7,84 (d, J=8,09 Hz, 1H), 8,34 (dd, J=4,41, 1,84 Hz, 1H), 8,42 (dd, J=7, 91, 1,65 Hz, 1H) . 127 ΕΡ 1 560 827/ΡΤExample 66B 2- {2- [3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ethyl} -1H-isoindole-1,3 (2 H) -dione The title compound was prepared according to the procedure of Example 1D substituting the product of Example 65B for the product of Example 1B (0.085 g, 46% ). MS (ESI-) m / z 514 (M-H); 1 H NMR (300 MHz, DMSO-d 6 / TFA) δ 4.09 (t, J = 5.15 Hz, 2H), 4.87 (m, 2H), 7.11 (dd, J = 7.91, (D, J = 8.09 Hz, 1 H), 7.44 (t, J = 7.72 Hz, 1 H), 7.58 (m, 5H), 7 , 8.44 (dd, J = 4.41, 1.84 Hz, 1 H), 8.42 (dd, J = 7.91, 1.65 Hz, 1H). 127 ΕΡ 1 560 827 / ΡΤ

Exemplo 67 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(3-hldroxipropll)-1,8-naftlrldln-2(1H)-onaExample 67 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-hydroxypropl1) -1,8-naphthylidene-2 (1H) -one

Uma solução do produto do Exemplo 73 em THF (5 mL) reagiu com boro-hidreto de sódio (0, 022 g, 0,58 mmol) a 0°C durante 30 minutos. A solução foi vertida em água e extraída com acetato de etilo. O extracto foi seco sobre sulfato de sódio, filtrado, concentrado e purificado por HPLC preparativa numa coluna Waters Symmetry C8 (40 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% a 100% de acetonitrilo/FFA aquoso a 0,1% durante 12 minutos (15 minutos de tempo de ensaio) a um caudal de 70 mL/min para produzir o composto em título. MS (DCI/NH3) m/z 401 (M+H)+; XH RMN (300 MHz, DMSO-de) δ 1,87 (m, 2H) , 3,54 (t, J=6,43 Hz, 2H) , 4,55 (m, 2H), 7,52 (dd, J=8, 09, 4, 78 Hz, 1H) , 7,56 (m, 1H) , 7,71 (d, J=8,09 Hz, 1H), 7,79 (m, 1H), 7,94 (d,J=8,09 Hz, 1H), 8,58 (dd, J= 8, 09, 1, 84 Hz, 1H), 8,90 (dd, J=4, 60, 1, 65 Hz, 1H), 14,13 (S, 1H) .A solution of the product of Example 73 in THF (5 mL) was reacted with sodium borohydride (0.022 g, 0.58 mmol) at 0 ° C for 30 minutes. The solution was poured into water and extracted with ethyl acetate. The extract was dried over sodium sulfate, filtered, concentrated and purified by preparative HPLC on a Waters Symmetry C8 column (40 mm χ 100 mm, 7 pm particle size) using a gradient of 10% to 100% acetonitrile / aqueous FFA at 0.1% for 12 minutes (15 minutes of assay time) at a flow rate of 70 mL / min to afford the title compound. MS (DCI / NH 3) m / z 401 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.87 (m, 2H), 3.54 (t, J = 6.43 Hz, 2H), 4.55 (m, 2H), 7.52 (D, J = 8.09 Hz, 1H), 7.79 (m, 1H), 7.92 (d, J = (D, J = 8.99 Hz, 1 H), 8.90 (dd, J = 4.60, 1.65 1H), 14.13 (s, 1H).

Exemplo 68 l-ciclopentil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 68 1-Cyclopentyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 68A 2-(ciclopentilamino)nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por ciclopentilamina a 2-etilbutilamina (0,231 g, 67%). MS (ESI+) m/z 235,1 (M+H)+; XH RMN (300 MHz, CDC13) δ 1,37 (t, J=7,17 Hz, 3H) , 1,64 (m, 6H), 2,08 (m, 2H), 4,31 (q, J=7,23 Hz, 2H), 4,45 (m, 1H), 6,48 (dd, J=7, 72, 4, 78 Hz, 1H), 8,02 (d, J=5,88 Hz, 1H), 8,10 (dd, J=7,91, 2,02 Hz, 1H), 8,28 (dd, J=4,78,l,84 Hz, 1H).Example 68A Ethyl 2- (cyclopentylamino) nicotinate The title compound was prepared according to the procedure of Example 3A substituting cyclopentylamine for 2-ethylbutylamine (0.231 g, 67%). MS (ESI +) m / z 235.1 (M + H) +; 1 H NMR (300 MHz, CDCl 3) δ 1.37 (t, J = 7.17 Hz, 3H), 1.64 (m, 6H), 2.08 (m, 2H), 4.31 (q, J J = 7.72, 4.78 Hz, 1H), 8.02 (d, J = 5.88 Hz, 2H), 4.45 (m, , 1H), 8.10 (dd, J = 7.91, 2.02 Hz, 1H), 8.28 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 68B l-ciclopentil-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 68A o produto do Exemplo 3A (0,130 g, 56%). MS (ESI+) m/z 221, 08 (M+H)+; ΧΗ RMN (300 MHz, CDC13) δ 1,66 (m, 1H), 1,99 128 ΕΡ 1 560 827/ΡΤ (m, 4Η) , 2,21 (m, 2Η), 5,79 (m, 1Η), 7,25 (dd, J= 8,09, 4,78 Hz, 1H), 8,42 (dd, J=7,72, 2,21 Hz, 1H), 8,70 (dd, J=4,78, 1, 84 Hz, 1H) .Example 68B 1-Cyclopentyl-2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 68A to the product of Example 3A (0.130 g, 56%). MS (ESI +) m / z 221.08 (M + H) +; ¹H NMR (300 MHz, CDCl 3) δ 1.66 (m, 1H), 1.99-1.68 (m, 4), 2.21 (m, 2), 5.79 8.25 (dd, J = 7.72, 2.21 Hz, 1 H), 8.70 (dd, J = 8.09, 4.78 Hz, 4.78, 1.84 Hz, 1H).

Exemplo 68C l-ciclopentil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-21-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 68B o produto do Exemplo 1B (0,133 g, 60%). MS (ESI+) m/z 433,06 (M+H)+; ΧΗ RMN (300 MHz, DMSO-d6) δ 1,70 (m, 2H), 1.85 (m, 2H), 2,07 (s, 2H), 2,28 (m, 2H), 6,17 (m, J=8,64, 8,64 Hz, 1H), 7,52 (m, 2H), 7,65 (d, J=7,72 Hz, 1H) , 7,77 (m, 1H), 7,93 (d, J=6,99 Hz, 1H), 8,57 (dd, J=7,91, 2,02 Hz, 1H), 8.86 (dd, J=4, 78, 1, 84 Hz, 1H), 14,05 (br s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ 1,63 (m, 2H), 1,79 (br s, 2H), 2,04 (m, 2H), 2,23 (m, 2H), 6,08 (m, 1H), 7,31 (br s, 1H), 7,43 (br s, 2H), 7,65 (d, J= 6,25 Hz, 1H), 7,80 (br s, 1H), 8,48 (d, J=7,72 Hz, 1H), 8,69 (br s, 1H).Example 68C 1-Cyclopentyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-21-one The title compound was prepared from according to the procedure of Example 1D substituting the product of Example 68B for the product of Example 1B (0.133 g, 60%). MS (ESI +) m / z 433.06 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.70 (m, 2H), 1.85 (m, 2H), 2.07 (s, 2H), 2.28 (m, 2H), 6.17 , J = 8.64, 8.64 Hz, 1H), 7.52 (m, 2H), 7.65 (d, J = 7.72 Hz, 1H), 7.77 (m, (Dd, J = 7.91, 2.02 Hz, 1H), 8.86 (dd, J = 4.78, 1.84 Hz, 1H), 14.05 (br s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.63 (m, 2H), 1.79 (br s, 2H), 2.04 (m, 2H), 2.23 (m, 2H) 1H), 7.43 (br s, 2H), 7.65 (d, J = 6.25 Hz, 1H), 7.80 (br s, 1H), 8.48 (d, J = 7.72 Hz, 1H), 8.69 (br s, 1H).

Exemplo 69 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-[2-(1,3-dioxolan-2-il)etil]-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 69 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- [2- (1,3-dioxolan-2-yl) ethyl] -4-hydroxy-1 , 8-naphthyridin-2 (1H) -one

Exemplo 69A 1-[2-(1,3-dioxolan-2-il)etil]-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-(2-bromometil)-1,3-dioxolano o brometo de n-butilo (0,86 g, 53%). MS (DCI/NH3) m/z 265 (M+H)+; :Η RMN (300 MHz, DMSO-d6) δ 1,98 (m, 2H), 3,83 (m, 4H), 4,25 (m, 2H), 4,92 (m, 1H), 7,38 (m, 1H), 8,39 (dd, J=7, 72, 1, 84 Hz, 1H), 8,78 (dd, J=4, 96, 2, 02 Hz, 1H).Example 69A 1- [2- (1,3-dioxolan-2-yl) ethyl] -2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting 2- (2-bromomethyl) -1,3-dioxolane and n-butyl bromide (0.86 g, 53%). MS (DCI / NH 3) m / z 265 (M + H) +; NMR (300 MHz, DMSO-d 6) δ 1.98 (m, 2H), 3.83 (m, 4H), 4.25 (m, 2H), 4.92 (m, 1H) 38 (m, 1H), 8.39 (dd, J = 7, 72, 1, 84 Hz, 1H), 8.78 (dd, J = 4.96, 2.02 Hz, 1H).

Exemplo 69B 3-(1,l-dioxido-4H-l, 2,4-benzotiadiazin-3-il)-1-[2- (1,3-dioxolan-2-il)etil]-4-hidroxi-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do 129Example 69B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- [2- (1,3-dioxolan-2-yl) ethyl] -4-hydroxy-1- , 8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of 129

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 69A o produto do Exemplo 1B (0,89 g, 62%). MS (DCI/NH3) m/z 443 (M+H)+; ΧΗ RMN (300 MHz, DMSO-d6) δ 2,03 (m, 2H), 2,50 (m, 2H), 3,84 (m, 2H), 4,59 (m, 2H), 4,97 (t, J=4,60Example 69A The product of Example 1B (0.89 g, 62%). MS (DCI / NH 3) m / z 443 (M + H) +; Δ NMR (300 MHz, DMSO-d 6) δ 2.03 (m, 2H), 2.50 (m, 2H), 3.84 (m, 2H), 4.59 (m, 2H), 4.97 (t, J = 4.60

Hz, 1H), 7,51 (dd, J=7,91, 4,60 Hz, 1H) , 7,56 (m, 1H) , 7,77 (m, 2H), 7,94 (m,lH), 8,56 (dd, J=8, 09, 1, 84 Hz, 1H), 8,89 (dd, J=4, 78, 1, 84 Hz, 1H), 14,09 (s, 1H) .1H), 7.51 (dd, J = 7.91, 4.60 Hz, 1H), 7.56 (m, 1H), 7.77 (m, 2H), 7.94 (m, 1H) 8.89 (dd, J = 4.78,1.84 Hz, 1H), 14.09 (s, 1H), 8.56 (dd, .

Exemplo 70 1-(2,3-di-hidroxipropil)-3-(1,l-dioxido-4H-l, 2, 4-benzo-tiadiazin-3-11)-4-hidroxi-l,8-naftiridin-2(1H)-ona O produto do Exemplo 55B (1,08 g, 0,028 mol) reagiu com tetraóxido de ósmio (0,0007 mol) e N-metilmorfolina N-óxido (4,96 g, 0,043 mol) numa mistura 1:1 de água e THF (50 mL) a temperatura ambiente durante 18 horas. A mistura reaccional foi tratada com bissulfito de sódio e diluida com água. O produto precipitou da mistura aquosa e foi recolhido por filtração sob vácuo para gerar o composto em titulo como um sólido branco (1,09 g, 93%). MS (DCI/NH3) m/z 417 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 3,33 (m, 2H) , 3,87 (m, 1H), 4,37 (m, 2H) , 4,52 (t, J=6,07 Hz; 1H) , 4,78 (d, J= 5,52 Hz, 1H) , 7,17 (dd, J=1 r 72, 4, 78 Hz, 1H), 7,29 (m, 2H), 7,56 (m, 1H), 7,67 (d, J=6,99 Hz, 1H) , 8,40 (dd, J=7, 72, 1, 84 Hz, 1H), 8,53 (dd, J=4, 78, 1, 84 Hz, 1H) , 15,80 (m, 1H) .Example 70 1- (2,3-Dihydroxypropyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin- 2 (1H) -one The product of Example 55B (1.08 g, 0.028 mol) was reacted with osmium tetroxide (0.0007 mol) and N-methylmorpholine N-oxide (4.96 g, 0.043 mol) in a mixture of : 1 water and THF (50 mL) at room temperature for 18 hours. The reaction mixture was treated with sodium bisulfite and diluted with water. The product precipitated from the aqueous mixture and was collected by vacuum filtration to give the title compound as a white solid (1.09 g, 93%). MS (DCI / NH 3) m / z 417 (M + H) +; 1 H NMR (300 MHz, DMSOd 6) δ 3.33 (m, 2H), 3.87 (m, 1H), 4.37 (m, 2H), 4.52 (t, J = 6.07 Hz 1H), 4.78 (d, J = 5.52 Hz, 1H), 7.17 (dd, J = 1, 72.4, 78 Hz, 1H), 7.29 (m, 2H), 7 (Dd, J = 7.72, 1.84 Hz, 1 H), 8.53 (dd, J = J = 4.78, 1.84 Hz, 1H), 15.80 (m, 1H).

Exemplo 71 l-ciclo-heptil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 71 1-cycloheptyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 71A 2-(ciclo-heptilamino)nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por ciclo-heptilamina a 2-etilbutilamina (1,01 g, 83%). MS (ESI+) m/z 263,1 (M+H)+. XH RMN (300 MHz, CDCI3) δ 1,37 (t, J=7,17 Hz, 3H), 1,62 (m, 10H), 2,02 (m, 2H), 4,29 (m, 1H), 4,31 (q, J=7,35 Hz, 2H), 6,45 (dd, J=7, 72, 4, 78 Hz, 1H), 8,05 (d, J= 6,99 Hz, 1H), 8,10 (dd, i7=7,91, 2,02 Hz, 1H), 8,26 (dd, J=4, 78, 1,84 Hz, 1H) . 130 ΕΡ 1 560 827/ΡΤExample 71A Ethyl 2- (cycloheptylamino) nicotinate The title compound was prepared according to the procedure of Example 3A substituting 2-ethylbutylamine for cycloheptylamine (1.01 g, 83%). MS (ESI +) m / z 263.1 (M + H) +. 1 H NMR (300 MHz, CDCl 3) δ 1.37 (t, J = 7.17 Hz, 3H), 1.62 (m, 10H), 2.02 (m, 2H), 4.29 (m, 1H J = 7.35 Hz, 2H), 6.45 (dd, J = 7.72, 4.78 Hz, 1H), 8.05 (d, J = 6.99 Hz) , 1H), 8.10 (dd, J = 7.91, 2.02 Hz, 1H), 8.26 (dd, J = 4.78, 1.84 Hz, 1H). 130 ΕΡ 1 560 827 / ΡΤ

Exemplo 71Β l-ciclo-heptil-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 71A o produto do Exemplo 3A (0,205 g, 55%). MS (ESI+) m/z 249, 1 (M+H)+; :Η RMN (300 MHz, CDC13) δ 1,63 (m, 6H), 1,84 (m, 4H) , 2,43 (m, 2H) , 5,39 (s, 1H) , 7,24 (dd, J=7,72, 4,78Example 71 1-Cycloheptyl-2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 71A the product of Example 3A (0.205 g, 55%). MS (ESI +) m / z 249.1 (M + H) +; NMR (300 MHz, CDCl 3) δ 1.63 (m, 6H), 1.84 (m, 4H), 2.43 (m, 2H), 5.39 (s, 1H), 7.24 (m, dd, J = 7.72, 4.78

Hz, 1H), 8,40 (m, 1H), 8,71 (dd, J=4,78, 1,84 Hz, 1H).Hz, 1H), 8.40 (m, 1H), 8.71 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 71C l-ciclo-heptil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 71B o produto do Exemplo 1B (0,041 g, 15%). MS (ESI+) m/z 439,07 (M+H) + . XH RMN (300 MHz, DMSO-d6) δ 1,23 (m, 6H), 1,58 (m, 4H), 1,79 (m, 2H), 5,90 (m, 1H), 7,45 (m, 1H), 7,53 (m, 1H), 7,66 (m, J=9,56 Hz, 1H), 7,74 (d, J=7,72 Hz, 1H), 7,90 (d, J=6,25 Hz, 1H) , 8,54 (d, J=7,35 Hz, 1H) , 8,85 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 1,61 (m, 8H), 1,77 (m, 4H) , 1,94 (m, 2H) , 5,60 (m, 1H), 7,10 (dd, J=7,54, 4, 60 Hz, 1H), 7,54 (m, 1H), 7,66 (dd, J=7, 72, 1, 47 Hz, 1H), 8,36 (dd, J=7,72, 2,21 Hz, 1H) , 8,51 (dd, i7=4,78, 2,21 Hz, 1H), 15,99 (s, 1H) .Example 71C 1-Cycloheptyl-3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 71B for the product of Example 1B (0.041 g, 15%). MS (ESI +) m / z 439.07 (M + H) +. 1 H NMR (300 MHz, DMSOd 6) δ 1.23 (m, 6H), 1.58 (m, 4H), 1.79 (m, 2H), 5.90 (m, 1H), 7.45 (m, 1H), 7.53 (m, 1H), 7.66 (m, J = 9.56 Hz, 1H), 7.74 (d, J = 7.72 Hz, 1H), 7.90 (d, J = 6.25Hz, 1H), 8.54 (d, J = 7.35Hz, 1H), 8.85 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.61 (m, 8H), 1.77 (m, 4H), 1.94 (m, 2H), 5.60 (m, 1H), 7.10 (dd, J = 7.54, 4.60 Hz, 1H), 7.54 (m, 1H), 7.66 (dd, dd, J = 7.72, 2.21 Hz, 1H), 8.51 (dd, J = 4.78, 2.21 Hz, 1H), 15.99 (s, 1H).

Exemplo 72 1-(3-anilinopropil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 72 1- (3-anilinopropyl) -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Uma solução do produto do Exemplo 73 (0,090 g, 0,23 mmol) e anilina (0,15 mL, 0,23 mmol) em THF (6 mL) foi tratada com triacetoxiboro-hidreto de sódio (0,08 g, 0,38 mmol) e ácido acético glacial (0,025 mL, 0,43 mmol) a temperatura ambiente durante 24 horas. O solvente foi removido sob vácuo e o sólido resultante foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (40 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% a 100% de acetonitrilo/TFA aquoso a 0,1% durante 12 minutos (15 minutos de tempo de ensaio) a um caudal de 70 mL/min para gerar o 131 ΕΡ 1 560 827/ΡΤ composto em título. MS (DCI/NH3) m/z 476 (M+H)+. O composto em título foi dissolvido em 1,4-dioxano (6 mL) e HC1 4M em dioxano (2 mL). Após agitação a temperatura ambiente durante 3 horas, a mistura foi filtrada e o bolo de filtração foi seco para proporcionar o sal cloridrato. 1H RMN (300 MHz, DMSO-d6) δ 2,11 (m, 2H), 3,32 (m, 2H) , 4,59 (t, J=6,80 Hz, 2H) , 7,18 (S, 3H), 7,34 (d, J=7, 35 Hz, 2H) , 7,52 (m, 1H) , 7,57 (m,lH), 7,67 (d, J= 7,35 Hz, 1H) , 7,80 (m, 1H) , 7,94 (d, J=7, 72 Hz, 1H), 8,59 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,89 (dd, J=4,78, 1,84 Hz, 1H), 13,96 (s, 1H).A solution of the product of Example 73 (0.090 g, 0.23 mmol) and aniline (0.15 mL, 0.23 mmol) in THF (6 mL) was treated with sodium triacetoxyborohydride (0.08 g, , 38 mmol) and glacial acetic acid (0.025 mL, 0.43 mmol) were stirred at room temperature for 24 hours. The solvent was removed in vacuo and the resulting solid was purified by preparative HPLC on a Waters Symmetry C8 column (40 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile / aqueous TFA , 1% for 12 minutes (15 minutes of assay time) at a flow rate of 70 mL / min to give the title compound. MS (DCI / NH 3) m / z 476 (M + H) +. The title compound was dissolved in 1,4-dioxane (6 mL) and 4M HCl in dioxane (2 mL). After stirring at room temperature for 3 hours, the mixture was filtered and the filter cake dried to provide the hydrochloride salt. 1 H NMR (300 MHz, DMSOd 6) δ 2.11 (m, 2H), 3.32 (m, 2H), 4.59 (t, J = 6.80 Hz, 2H), 7.18 (D, J = 7.35 Hz, 2H), 7.52 (m, 1H), 7.57 (m, 1H), 7.67 (d, J = 7.35 Hz, , 7.80 (m, 1H), 7.94 (d, J = 7.72 Hz, 1H), 8.59 (dd, J = 7.72, 1.84 Hz, 1H), 8 , 89 (dd, J = 4.78, 1.84 Hz, 1H), 13.96 (s, 1H).

Exemplo 73 3-[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-1,8-naftiridin-1(2 H)— i1]propanalExample 73 3- [3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2 H) ] propanal

Uma suspensão agitada do produto do Exemplo 69B (0,65 g, 0,15 mmol) em água (3 mL) e ácido acético glacial (12 mL) a temperatura ambiente foi tratada gota a gota com ácido sulfúrico (1 mL). A mistura foi aquecida a 60°C durante 1 hora e depois diluída com água. A mistura foi filtrada e o bolo de filtração foi lavado com água e seco para produzir o composto em título (0, 455 g, 78%). MS (DCI/NH3) m/z 399 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 2,72 (m, 2H), 4,59 (t, J= 6,62 Hz, 2H), 7,17 (dd, J= 7, 72, 4, 78 Hz, 1H), 7,28 (m, 1H), 7,55 (m, 1H) , 7,67 (d, J= 7, 72 Hz, 1H) , 8,39 (dd, J=7, 72, 1, 84 Hz, 1H), 8,52 (dd, J=4, 78, 1,84 Hz, 1H) , 9,76 (t, J=2,21 Ηζ,ΐΗ), 9,76 (t, J=2,21 Hz, 1H).A stirred suspension of the product of Example 69B (0.65 g, 0.15 mmol) in water (3 mL) and glacial acetic acid (12 mL) at ambient temperature was treated dropwise with sulfuric acid (1 mL). The mixture was heated at 60 ° C for 1 hour and then diluted with water. The mixture was filtered and the filter cake was washed with water and dried to give the title compound (0.455 g, 78%). MS (DCI / NH 3) m / z 399 (M + H) +; 1 H NMR (300 MHz, DMSOd 6) δ 2.72 (m, 2H), 4.59 (t, J = 6.62 Hz, 2H), 7.17 (dd, J = 1H), 7.28 (m, 1H), 7.55 (m, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.39 (dd, J = (Dd, J = 4.78, 1.84 Hz, 1H), 9.76 (t, J = 2.21, Ηζ), 9.76 (t, J = t, J = 2.21 Hz, 1H).

Exemplo 74 4-{ [3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-1 (2H)-il]metil}benzoato de metiloExample 74 4 - {[3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ] methyl} benzoate

Exemplo 74A 4-[(2,4-dioxo-2H-pirido[2,3-d][1,3]oxazin-1(4H)-il)metil]-benzoato de metilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 4-(bromometil)-benzoato de metilo o brometo de n-butilo (1,5 g, 75%). MS (DCI) m/z 313 (M+H)+. 132 ΕΡ 1 560 827/ΡΤExample 74A Methyl 4 - [(2,4-dioxo-2H-pyrido [2,3-d] [1,3] oxazin-1 (4H) -yl) methyl] benzoate The title compound was prepared according with the procedure of Example 1B substituting methyl 4- (bromomethyl) benzoate and n-butyl bromide (1.5 g, 75%). MS (DCI) m / z 313 (M + H) +. 132 ΕΡ 1 560 827 / ΡΤ

Exemplo 74Β 4-{[3-(1,l-dioxido-4H-l, 2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-l(2H)-il]metil}benzoato de metilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 74A o produto do Exemplo 1B (0,130 g, 37%). MS (ESI-) m/z 489 (M-H)“; :H RMN (300 MHz, DMSO-d6) δ 3,82 (s, 3H) , 5,76 (s, 2H), 7,42 (d, J=8,09 Hz, 2H), 7,50 (m, 2H), 7,63 (d, J=1,12 Hz, 1H), 7,74 (t,J=7,72 Hz, 1H), 7,88 (d, J=8,46 Hz, 2 H), 7,93 (m, 1H), 8,60 (dd, J=8, 09, 1, 84 Hz, 1H) , 8,78 (d, J= 3,31 Hz, 1H), 14,12 (br s, 1H) .Example 74 4 - {[3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ] methyl} benzoate The title compound was prepared according to the procedure of Example 1D substituting the product of Example 74A for the product of Example 1B (0.130 g, 37%). MS (ESI-) m / z 489 (M-H); 1 H NMR (300 MHz, DMSO-d 6) δ 3.82 (s, 3H), 5.76 (s, 2H), 7.42 (d, J = 8.09 Hz, 2H), 7.50 7.74 (d, J = 7.72 Hz, 1H), 7.88 (d, J = 8.46 Hz, 2 H), 7.93 (m, 1H), 8.60 (dd, J = 8.9, 1.84 Hz, 1H), 8.78 (d, J = 3.31 Hz, , 12 (br s, 1H).

Exemplo 75 5-{[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-1(2H)-il]metil}-2-furoato de etiloExample 75 5 - {[3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ] methyl} -2-furoate

Exemplo 75A 5-[(2,4-dioxo-2H-pirido[2,3-d][1,3]oxazin-1(4H)-il)metil]-2-furoato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 5-clorometil-2-furancarboxilato de etilo o brometo de n-butilo (0,073 g, 19%). ΧΗ RMN (300 MHz, DMSO-d6) δ 1,34 (t, J=7,17 Hz, 3H), 4,32 (q, J=7,35 Hz, 2H), 5,56 (s, 2H), 6,49 (d, J= 3,68 Hz, 1H), 7,09 (d, J=3,31 Hz, 1H), 7,31 (dd, J=7, 72, 4, 78 Hz, 1H) , 8,44 (dd, J=7, 72, 1,84 Hz, 1H), 8,76 (dd, J=4, 78, 1, 84 Hz, 1H).Example 75A Ethyl 5 - [(2,4-dioxo-2H-pyrido [2,3-d] [1,3] oxazin-1 (4H) -yl) methyl] -2-furoate The title compound was prepared according to the procedure of Example 1B substituting ethyl 5-chloromethyl-2-furancarboxylate and n-butyl bromide (0.073 g, 19%). NMR (300 MHz, DMSO-d 6) δ 1.34 (t, J = 7.17 Hz, 3H), 4.32 (q, J = 7.35 Hz, 2H), 5.56 (s, 2H (D, J = 3.68 Hz, 1H), 7.09 (d, J = 3.31 Hz, 1H), 7.31 (dd, J = 7.72, 4.78 Hz) , 1H), 8.44 (dd, J = 7, 72, 1.84 Hz, 1H), 8.76 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 75B 5-{[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxo-l,8-naftiridin-1(2H)-il]metil}-2-furoato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 75A o produto do Exemplo 1B (0, 074 g, 69%). MS (DCI/NH3) m/z 495 (M+H)+. ΧΗ RMN (300 MHz, DMSO-d6) δ 1,26 (t, J=7,17 Hz, 3H), 4,26 (q, J=7,23 Hz, 2H), 5,73 (s, 2H), 6,45 (d, J= 3,68 Hz, 1H), 7,19 (d, J= 3,68 Hz, 1H) , 7,55 (m, 2H), 7,75 (m, 2H), 7,93 (d, J=7, 72 Hz, 1H), 8,60 (dd, J=7,91, 1,83 Hz, 1H), 8,86 (dd, J=4, 78, 1, 84 Hz, 1H), 13,80 (S, 1H). O sal de sódio do composto em título foi preparado de acordo com o 133 ΕΡ 1 560 827/ΡΤ procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ 1,27 (t, J=7,17 Hz, 3H), 4,25 (q, J= 7,23 Hz, 2H) , 5,55 (s, 2H), 6,22 (d, J=3,31 Hz, 1H), 7,14 (d, J=3,31 Hz, 1H), 7,20 (dd, J=1, 72, 4, 60 Hz, 1H), 7,29 (m, 2H), 7,56 (m, 1H), 7,67 (d, J=8,09 Hz, 1H), 8,42 (dd, J=7, 72, 2,20 Hz, 1H), 8,52 (dd, J=4,60, 2,21 Hz, 1H), 15,73 (s, 1H) .Example 75B 5 - {[3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ] methyl} -2-furoate The title compound was prepared according to the procedure of Example 1D substituting the product of Example 75A for the product of Example 1B (0.074 g, 69%). MS (DCI / NH 3) m / z 495 (M + H) +. 1 H NMR (300 MHz, DMSOd 6) δ 1.26 (t, J = 7.17 Hz, 3H), 4.26 (q, J = 7.23 Hz, 2H), 5.73 (s, 2H D, J = 3.68 Hz, 1H), 7.19 (d, J = 3.68 Hz, 1H), 7.55 (m, 2H), 7.75 (m, 2H) (Dd, J = 7.91, 1.83 Hz, 1H), 8.86 (dd, J = 4.78, 1, 84 Hz, 1H), 13.80 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 1.27 (t, J = 7.17 Hz, 3H), 4.25 (q, J = 7.23 Hz, 2H), 5.55 (s, 2H (D, J = 3.31 Hz, 1H), 7.14 (d, J = 3.31 Hz, 1H), 7.20 (dd, J = 1.72, 4.60 Hz) 1H), 7.29 (m, 2H), 7.56 (m, 1H), 7.67 (d, J = 8.09 Hz, 1H), 8.42 (dd, J = 2.20 Hz, 1H), 8.52 (dd, J = 4.60, 2.21 Hz, 1H), 15.73 (s, 1H).

Exemplo 76 1-[3-(dimetilamino)propil]-3-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 76 1- [3- (dimethylamino) propyl] -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Uma solução do produto do Exemplo 73 (0,085 g, 0,21 mmol) e dimetilamina (2,0 M em THF, 0,110 mL, 0,22 mmol) em tetra-hidrofurano (4 mL) reagiu com triacetoxiboro-hidreto de sódio (0,06 g, 0,28 mmol) a temperatura ambiente durante 1 hora. O solvente foi removido sob vácuo e o sólido resultante foi triturado com metanol e dimetilsulfóxido (1:1), filtrado e seco para produzir o composto em titulo (0,56 g, 61%). (DCI/NH3) m/z 428 (M+H)+. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 1,72 (m, 2H), 2,15 (s, 6H) , 2,29 (t, J=7,17 Hz, 2H), 4,28 (m, 2H), 7,14 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,27 (m, 2H) , 7,55 (ddd, J= 8,27, 7, 17, 1, 47 Hz, 1H) , 7,67 (dd, J= 8,09, 1,47 Hz, 1H) , 8,37 (dd,J=7, 54, 2, 02 Hz, 1H) , 8,53 (dd, J=4,78, 1,84 Hz, 1H) , 15,93 (s, 1H) .A solution of the product of Example 73 (0.085 g, 0.21 mmol) and dimethylamine (2.0 M in THF, 0.110 mL, 0.22 mmol) in tetrahydrofuran (4 mL) was reacted with sodium triacetoxyborohydride ( 0.06 g, 0.28 mmol) at room temperature for 1 hour. The solvent was removed in vacuo and the resulting solid triturated with methanol and dimethylsulfoxide (1: 1), filtered and dried to give the title compound (0.56 g, 61%). (DCI / NH 3) m / z 428 (M + H) +. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSOd 6) δ 1.72 (m, 2H), 2.15 (s, 6H), 2.29 (t, J = 7.17 Hz, 2H), 4.28 , 2H), 7.14 (dd, J = 7.72, 4.78 Hz, 1H), 7.27 (m, 2H), 7.55 (ddd, J = 8.27, , 7.67 (dd, J = 8.09, 1.47 Hz, 1H), 8.37 (dd, J = 7, 54.02.02 Hz, 1H), 8.53 (dd, J = 4.78, 1.84 Hz, 1H), 15.93 (s, 1H).

Exemplo 77 1—{3—[[2-(dimetilamino)etil](metil)amino]propil}-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com 0 procedimento do Exemplo 72 substituindo por N,N,N-trimetil-etilenodiamina a anilina. MS (DCI/NH3) m/z 485 (M+H) + . O sal di-cloridrato do composto em título foi preparado de acordo com o procedimento do Exemplo 72. 1R RMN (300 MHz, DMSO-d6) δ 2,20 (s, 2H), 2,84 (m, J=4,41 Hz, 6H), 3,50 (m, 9H), 4,54 (m, 2H), 7,54 (m, 3H), 7,77 (m, 1H), 7,91 (d, J=8,09 Hz, 1H), 8,59 (dd, J=8, 09, 1, 84 Hz, 1H), 8,85 (dd, J=4, 60, 1, 65 Hz, 1H) , 10,43 (s, 1H), 14,25 (s, 1H). 134Example 77 1- {3 - [[2- (Dimethylamino) ethyl] (methyl) amino] propyl} -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4- hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 72 substituting N, N, N-trimethyl-ethylenediamine for the aniline. MS (DCI / NH 3) m / z 485 (M + H) +. The di-hydrochloride salt of the title compound was prepared according to the procedure of Example 72. 1R NMR (300 MHz, DMSO-d 6) δ 2.20 (s, 2H), 2.84 (m, J = (M, 2H), 7.54 (m, 3H), 7.77 (m, 1H), 7.91 (d, J = 8.09 Hz, 1H), 8.59 (dd, J = 8.09, 1.84 Hz, 1H), 8.85 (dd, J = 4.60, 1.65 Hz, 43 (s, 1H), 14.25 (s, 1H). 134

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 78 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-ll)-4-hidroxi- 1-[3-(4-metil-l-piperazinil)propil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 72 substituindo por 4-metilpiperazina a anilina. MS (ESI-) m/z 450 (M-H)“. O sal di-cloridrato do composto em título foi preparado de acordo com o procedimento do Exemplo 72. :Η RMN (300 MHz, DMSO-d6) δ 2,03 (m, 2H), 3,10 (m, 4H) , 3,69 (m, 4H) , 3,90 (m, 2H) , 4,39 (s, 2H) , 7,20 (dd, J=l,12, 4,41 Hz, 1H), 7,30 (m, 2H), 7,58 (m, 1H), 7,68 (d, J=7,72 Hz, 1H), 8,42 (dd, J=7,72, 1,84 Ηζ,ΐΗ), 8,55 (dd, J=4,41, 1,84 Hz, 1H), 15,71 (s, 1H).Example 78 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- [3- (4-methyl-1-piperazinyl) propyl] -1,8- -naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 72 substituting 4-methylpiperazine for the aniline. MS (ESI-) m / z 450 (M-H). The di-hydrochloride salt of the title compound was prepared according to the procedure of Example 72.: 1 H NMR (300 MHz, DMSO-d 6) δ 2.03 (m, 2H), 3.10 (m, 4H), 3.69 (m, 4H), 3.90 (m, 2H), 4.39 (s, 2H), 7.20 (dd, J = 1.12, 4.41 Hz, 1H), 7.30 (m, 2H), 7.58 (m, 1H), 7.68 (d, J = 7.72 Hz, 1H), 8.42 (dd, J = 7.72, 1.84 Ηζ, ΐΗ) , 8.55 (dd, J = 4.41, 1.84 Hz, 1H), 15.71 (s, 1H).

Exemplo 79 1-(2-aminoetil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)- 4- hidroxi-l,8-naftiridin-2(1H)-onaExample 79 1- (2-Aminoethyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Uma solução do Exemplo 66 (45, 0 mg, 0, 087 mmol) numa mistura de etanol absoluto (1,5 mL), N,N-dimetilformamida (0,8 mL) e dimetilsulfóxido (1,0 mL) foi tratada com mono-hidrato de hidrazina (13,42 mg, 0,261 mmol) a temperatura ambiente. A mistura foi depois aquecida a refluxo a 80°C durante 5 horas, arrefecida até temperatura ambiente e concentrada. O concentrado foi purificado por uma coluna C8 de HPLC eluindo com 20% a 80% de acetonitrilo em água com 1% de ácido trifluoroacético para gerar o sal de TFA do composto em título (0,010 g, 23%). MS (APCI+) m/z 386 (M+H)“; ΧΗ RMN (300 MHz, DMSO-de) δ 3,20 (dd, J=ll, 95, 6,80 Hz, 2H) , 4,62 (t, J= 5,52A solution of Example 66 (45.0 mg, 0.087 mmol) in a mixture of absolute ethanol (1.5 mL), N, N-dimethylformamide (0.8 mL) and dimethylsulfoxide (1.0 mL) was treated with hydrazine monohydrate (13.42 mg, 0.261 mmol) at room temperature. The mixture was then heated to reflux at 80 ° C for 5 hours, cooled to room temperature and concentrated. The concentrate was purified by HPLC C8 column eluting with 20% to 80% acetonitrile in water with 1% trifluoroacetic acid to give the TFA salt of the title compound (0.010 g, 23%). MS (APCI +) m / z 386 (M + H) +; Δ NMR (300 MHz, DMSO-d 6) δ 3.20 (dd, J = 11.95, 6.80 Hz, 2H), 4.62 (t, J = 5.52

Hz, 2H), 7,27 (m, 1H) , 7,39 (m, 2H), 7,65 (t, J=7,35 Hz, 1H), 7,75 (d, J=7,72 Hz, 1H), 7,82 (br s, 3H), 8,42 (d,J=9,56 Hz, 1H), 8,61 (d, J= 3,31 Hz, 1H), 15,18 (br s, 1H).1H), 7.39 (m, 2H), 7.65 (t, J = 7.35 Hz, 1H), 7.75 (d, J = 7.72 Hz, 8.42 (br s, 3H), 8.42 (d, J = 9.56 Hz, 1H), 8.61 (d, J = 3.31 Hz, 1H), 15.18 (br s, 1H).

Exemplo 80 1-[3-(dietilamino)propil]-3-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona 0 composto em título foi preparado de acordo com 0 procedimento do Exemplo 72 substituindo por dietilamina a anilina. MS (DCI/NH3) m/z 456 (M+H)+. 0 sal cloridrato do composto em título foi preparado de acordo com o procedimento 135Example 80 1- [3- (Diethylamino) propyl] -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 72 substituting diethylamine for the aniline. MS (DCI / NH 3) m / z 456 (M + H) +. The hydrochloride salt of the title compound was prepared according to procedure 135

ΕΡ 1 560 827/PT do Exemplo 72. XH RMN (300 MHz, DMSO-d6) δ 1,19 (t, J=1, 11 Hz, 6H), 2,15 (m, 2H), 3,12 (m, 6H), 4,55 (t, J=6,62 Hz, 2H), 7,57 (m, 2H), 7,66 (m, 1H), 7,80 (m, 1H), 7,95 (d, J=8,09 Hz, 1H), 8,61 (dd, J=7, 72, 1, 84 Hz, 1H), 8,90 (dd, J=4, 60, 1, 65 Hz, 1H), 10,05 (s, 1H) , 13,92 (s, 1H) .1 H-NMR (300 MHz, DMSO-d 6) δ 1.19 (t, J = 1, 11 Hz, 6H), 2.15 (m, 2H), 3.12 (m, (m, 6H), 4.55 (t, J = 6.62 Hz, 2H), 7.57 (m, 2H), 7.66 (m, 1H), 7.80 (m, 1H) (Dd, J = 7.72, 1.84 Hz, 1 H), 8.90 (dd, J = 4.60, 1.65 Hz, , 1H), 10.05 (s, 1H), 13.92 (s, 1H).

Exemplo 81 l-ciclo-hexil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(lH)-onaExample 81 1-cyclohexyl-3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 81A 2-(ciclo-hexilamino)nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por ciclo-hexilamina a 2-etilbutilamina (1,92 g, 61%). MS (ESI+) m/z 249,1 (M+H)+; 1H RMN (300 MHz, CDC13) δ 1,38 (m, 7H) , 1,61 (m, 2H), 1,75 (m, 2H), 2,02 (m, 2H), 4,08 (m, 1H), 4,31 (q, J=7,ll Hz, 2H), 6,46 (dd, J=7, 72, 4, 78 Hz, 1H), 7,99 (d, J=7, 72 Hz, 1H), 8,10 (dd, J=7,72, 2,21 Hz, 1H), 8,25 (dd, J=4, 78, 1,84 Hz, 1H) .Example 81A Ethyl 2- (cyclohexylamino) nicotinate The title compound was prepared according to the procedure of Example 3A substituting 2-ethylbutylamine for cyclohexylamine (1.92 g, 61%). MS (ESI +) m / z 249.1 (M + H) +; 1 H NMR (300 MHz, CDCl 3) δ 1.38 (m, 7H), 1.61 (m, 2H), 1.75 (m, 2H), 2.02 (m, 2H), 4.08 1H), 4.31 (q, J = 7, 11 Hz, 2H), 6.46 (dd, J = 7.72, 4.78 Hz, 1H), 7.99 (d, J = 72 Hz, 1H), 8.10 (dd, J = 7.72, 2.21 Hz, 1H), 8.25 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 81B l-ciclo-hexil-2H-pirido[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com oExample 81B 1-cyclohexyl-2H-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to

procedimento do Exemplo 3B substituindo pelo produto do Exemplo 8lA o produto do Exemplo 3A (0,171 g, 35%). :H RMN (300 MHz, CDCls) δ 1,37 (m, 4H) , 1,73 (m, 2H) , 1,91 (m, 2H), 2,47 (ddd, J=24, 82, 12, 32, 3,31 Hz, 2H) , 5,28 (tt, J=12,27, 3,72 Hz, 1H), 7,24 (dd, J= 6,99, 4, 04 Hz, 1H), 8,41 (dd, J=7,72, 2,21 Hz, 1H), 8,70 (dd, J=4,78, 2,21 Hz, 1H).The title compound was prepared according to the procedure of Example 3B substituting the product of Example 81A for the product of Example 3A (0.171 g, 35%). 1 H NMR (300 MHz, CDCl 3) δ 1.37 (m, 4H), 1.73 (m, 2H), 1.91 (m, 2H), 2.47 (ddd, J = J = 12.27, 3.72 Hz, 1 H), 7.24 (dd, J = 6.99, 4.04 Hz, 1 H) , 8.41 (dd, J = 7.72, 2.21 Hz, 1H), 8.70 (dd, J = 4.78, 2.21 Hz, 1H).

Exemplo 81C l-ciclo-hexil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 81B o produto do Exemplo 1B (0,073 g, 26%). MS (ESI+) m/z 425,04 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 1,25 (m, 4H), 1,76 (m, 4H) , 1,91 (s, 2H) , 5,64 (s, 1H), 7,48 (dd, J=8,09, 4,78 Hz, 1H), 7,55 (t, J=7,54 Hz, 1H), 7,69 (m, J=8,09 Hz, 136 ΕΡ 1 560 827/ΡΤ 1Η), 7,77 (m, 1Η), 7,92 (d, J=8,09 Hz, 1H), 8,56 (dd, J=8,09, 1,84 Hz, 1H), 8,86 (d, J=2,21 Hz, 1H), 14,12 (s, 1H). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI+) m/z 425,04 (M+H)+, 447,1 (M+Na)+; ΧΗ RMN (300 MHz, DMSO-d6) δ 1,31 (m, 4H), 1,52 (d, J=10,66 Hz, 2H), 1,63 (m, 2H), 1,83 (m, J=12,50 Hz, 2H), 5,41 (t, J=ll, 03 Hz, 1H), 7,11 (dd, J=1, 72, 4, 78 Hz, 1H), 7,27 (m, 2H), 7,55 (m, 1H), 7,66 (d, J= 6,62 Hz, 1H) , 8,37 (dd, J=7, 72, 2,21 Hz, 1H), 8,50 (dd, J=4, 60, 2,02 Hz, 1H), 15,94 (s, 1H) .Example 81C 1-Cyclohexyl-3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one Compound was prepared according to the procedure of Example 1D substituting the product of Example 81B for the product of Example 1B (0.073 g, 26%). MS (ESI +) m / z 425.04 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.25 (m, 4H), 1.76 (m, 4H), 1.91 (s, 2H), 5.64 (s, 1H), 7.48 (dd, J = 8.09, 4.78 Hz, 1H), 7.55 (t, J = 7.54 Hz, 1H), 7.69 (m, J = 8.09 Hz, (D, J = 8.09 Hz, 1 H), 8.56 (dd, J = 8.09, 1.84 Hz, 1 H) , 8.86 (d, J = 2.21 Hz, 1H), 14.12 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI +) m / z 425.04 (M + H) +, 447.1 (M + Na) +; NMR (300 MHz, DMSO-d 6) δ 1.31 (m, 4H), 1.52 (d, J = 10.66 Hz, 2H), 1.63 (m, 2H), 1.83 , J = 12.50 Hz, 2H), 5.41 (t, J = 11.03 Hz, 1H), 7.11 (dd, J = 1.72, 4.78 Hz, 1H), 7.27 (m, 2H), 7.55 (m, 1H), 7.66 (d, J = 6.62 Hz, 1H), 8.37 (dd, J = 7.72, 2.21 Hz, , 8.50 (dd, J = 4.60, 2.02 Hz, 1H), 15.94 (s, 1H).

Exemplo 82 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[3-(4-morfolinil)propil]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 72 substituindo por morfolina a anilina (0, 053 g 60%). MS (ESI-) m/z 450 (M-H)”. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-de) δ 2,03 (m, 2H), 3,10 (m, 4H) , 3,69 (m, 4H), 3,90 (m, 2H), 4,39 (s, 2H), 7,20 (dd, J=l,12, 4,41 Hz, 1H) , 7,30 (m, 2H), 7,58 (m, 1H), 7,68 (d, J=7,72 Hz, 1H), 8,42 (dd, J=1, 72, 1, 84 Hz, 1H), 8,55 (dd, J=4,41, 1,84 Hz, 1H) , 15,71 (s, 1H) .Example 82 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- [3- (4-morpholinyl) propyl] -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 72 substituting morpholine for the aniline (0.055 g 60%). MS (ESI-) m / z 450 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 2.03 (m, 2H), 3.10 (m, 4H), 3.69 (m, 4H), 3.90 (m, 2H), 4.39 (s, 2H), 7.20 (dd, J = 1.12, 4.41 Hz, 1H), 7.30 (m, 2H), 7.58 (m, 1H), 7.68 (d, J = 7.72 Hz, 1H), 8.42 (dd, J = 1.72, 1.84 Hz, 1H), 8.55 (dd, J = 4.41, 1.84 Hz, 1H), 15.71 (s, 1H).

Exemplo 83 ácido_5-{[3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)- 4- hidroxi-2-oxo-l,8-naftiridin-1(2H)-il]metil}-2-furóicoExample 83 5 - {[3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxo-1,8-naphthyridin-1 (2H) -yl] ] methyl} -2-furoic acid

Uma solução do produto do Exemplo 75B (23 mg, 0,046 mmol) em THF (1 mL) foi tratada com NaOH IN (0,2 mL) a temperatura ambiente. Após 3 horas, a mistura foi tratada com H20 (5 mL), ajustada a pH 4 com HC1 IN e extraída com acetato de etilo (2 x 25 mL). Os extractos foram lavados com NaCl saturado, secos sobre Na2S04 anidro, filtrados e concentrados. O sólido resultante foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% a 100% de acetonitrilo/TFA aquoso a 0,1% durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (0,039 g, 83%). MS (ESI-) m/z 465 (M-H)“; XH RMN (300 MHz, DMSO-d6) δ 5,72 (s, 2H) , 6,42 (d, J=3,68 Hz, 1H), 7,11 (d, J=3,31 Hz, 1H) , 7,53 (m, 2H) , 7,68 (d, J=1,12 Hz, 137 ΕΡ 1 560 827/ΡΤ 1Η), 7,76 (m, 1Η), 7,92 (d, J=1, 72 Hz, 1H), 8,60 (dd, J=8,09, 1,84 Hz, 1H), 8,86 (dd, J=4,78, 1,84 Hz, 1H), 13,90 (S, 1H).A solution of the product of Example 75B (23 mg, 0.046 mmol) in THF (1 mL) was treated with 1 N NaOH (0.2 mL) at room temperature. After 3 hours, the mixture was treated with H2 O (5 mL), adjusted to pH4 with 1N HCl and extracted with ethyl acetate (2 x 25 mL). The extracts were washed with saturated NaCl, dried over anhydrous Na2 SO4, filtered and concentrated. The resulting solid was purified by preparative HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile / 0.1% aqueous TFA for 8 minutes ( 10 minutes of assay time) at a flow rate of 40 mL / min to give the title compound (0.039 g, 83%). MS (ESI-) m / z 465 (M-H); 1 H NMR (300 MHz, DMSOd 6) δ 5.72 (s, 2H), 6.42 (d, J = 3.68 Hz, 1H), 7.11 (d, J = 3.31 Hz, 1H , 7.68 (d, J = 1.12 Hz, 137 ÅΡ 1 560 827 / ΡΤ 1Η), 7.76 (m, 1Η), 7.92 (d, J = = 1.72 Hz, 1H), 8.60 (dd, J = 8.09, 1.84 Hz, 1H), 8.86 (dd, J = 4.78, 1.84 Hz, 1H), 13 , 90 (S, 1H).

Exemplo 84 l-benzil-3-(7-bromo-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 84 1-Benzyl-3- (7-bromo-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 84A 2-amino-5-bromobenzenossulfonamida O composto em título foi preparado a partir de 4-bromo-anilina utilizando o procedimento descrito em JCS Perkin 1, 1979, 1043.Example 84A 2-Amino-5-bromobenzenesulfonamide The title compound was prepared from 4-bromoaniline using the procedure described in JCS Perkin 1, 1979, 1043.

Exemplo 84B l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l, 8-naftiridina- 3-carboxilato de etilo A uma lama de hidreto de sódio (60%, 0,118 g, 2,95 mmol) em dimetilacetamida anidra (6 mL) a 0°C sob N2 juntou-se malonato de dietilo (0,472 g, 2,95 mmol) gota a gota durante 5 minutos. A mistura foi agitada a temperatura ambiente durante 1 hora, reagiu com o produto do Exemplo 15A (0,50 g, 1,97 mmol) e aquecida a 120°C durante 3 horas. A mistura foi arrefecida até temperatura ambiente e repartida entre acetato de etilo e água fria e ajustada a pH 5 com HC1 1M. A fase aquosa foi extraída com acetato de etilo (2 x 100 mL) e os extractos combinados foram lavados com salmoura, secos sobre sulfato de magnésio, filtrados e concentrados sob vácuo. O resíduo foi recristalizado em metanol para gerar o composto em título como um sólido branco (0,439 g, 68%). MS (ESI+) m/z 325, 0 (M+H)+, 347, 0 (M+Na)+; :Η RMN (300 MHz, DMSO-d6) δ 1,30 (t, J= 7, 17 Hz, 3H) ( , 4,32 i (q, J=7,23 IS] 2H), 5 ,55 (s, 2H), 7,23 (m, 5H), 7, 37 (dd, J= 7, 91, 4,60 Hz, 1H) , , 8,45 (dd, J= 7, 91, 2,02 Hz, 1H), 8, 71 (dd, J=4,78, 1,84 Hz, 1H), . 13,00 (s, 1H) .Example 84B Ethyl 1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxylate To a slurry of sodium hydride (60%, 0.118 g, 2.95 mmol) in anhydrous dimethylacetamide (6 mL) at 0 ° C under N2 was added diethyl malonate (0.472 g, 2.95 mmol) dropwise over 5 minutes. The mixture was stirred at room temperature for 1 hour, reacted with the product of Example 15A (0.50 g, 1.97 mmol) and heated at 120 ° C for 3 hours. The mixture was cooled to room temperature and partitioned between ethyl acetate and cold water and adjusted to pH 5 with 1 M HCl. The aqueous phase was extracted with ethyl acetate (2 x 100 mL) and the combined extracts were washed with brine, dried over magnesium sulfate, filtered and concentrated under vacuum. The residue was recrystallized from methanol to give the title compound as a white solid (0.439 g, 68%). MS (ESI +) m / z 325.0 (M + H) +, 347.0 (M + Na) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.30 (t, J = 7.17 Hz, 3H) (, 4.32 (q, J = 7.23 1 H) (dd, J = 7.91, 4.60 Hz, 1 H),, 8.45 (dd, J = 7.91, 2.02 1H), 8.71 (dd, J = 4.78, 1.84 Hz, 1H), 13.00 (s, 1H).

Exemplo 84C N-[2-(aminossulfonil)-4-bromofenil]-l-benzil-4-hidroxi-2-oxo-1,2-di-hidro-l,8-naftiridina-3-carboxamida O produto do Exemplo 84B (0,065 g, 0,20 mmol) reagiu com o produto do Exemplo 84A (0,050 g, 0,20 mmol) em tolueno (4 138 ΕΡ 1 560 827/ΡΤ mL) a refluxo durante 3 horas. A reacção foi arrefecida e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em titulo como um sólido esbranquiçado (0,074 g, 70%). MS (ESI + ) m/z 528, 9 (M+H)\ 530,9 (M+H)\ 551,1 (M+Na)+, 552,9 (M+Na)+ ; ^ RMN (300 MHz, DMSO-d6) δ 5,67 (s, 2H), 7,23 (m, 2H), 7,29 (m, 3H), 7,48 (dd, J=8,09, 4, 78 Hz, 1H), 7,69 (s, 2H), 7,87 (dd, J= 8,82, 2,21 Hz, 1H), 7,97 (m, 1H), 8,01 (d, J=2,21 Hz, 1H), 8,55 (dd, J=7,91, 1,65 Hz, 1H) , 8,82 (dd, J=4, 60, 1, 65 Hz, 1H), 12,44 (s, 1H), 16,45 (s, 1H) .Example 84C N- [2- (aminosulfonyl) -4-bromophenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The product of Example 84B (0.065 g, 0.20 mmol) was reacted with the product of Example 84A (0.050 g, 0.20 mmol) in toluene (4 138 Ρ Ρ 1 560 827 / ΡΤ mL) at reflux for 3 hours. The reaction was cooled and the resulting precipitate was collected by filtration and dried to give the title compound as an off-white solid (0.074 g, 70%). MS (ESI +) m / z 528.9 (M + H) + 530.9 (M + H) + 551.1 (M + Na) +, 552.9 (M + Na) +; 1 H NMR (300 MHz, DMSOd 6) δ 5.67 (s, 2H), 7.23 (m, 2H), 7.29 (m, 3H), 7.48 (dd, J = 1H), 7.69 (s, 2H), 7.87 (dd, J = 8.82, 2.21 Hz, 1H), 7.97 (m, 1H), 8.01 (s, d, J = 2.21 Hz, 1H), 8.55 (dd, J = 7.91, 1.65 Hz, 1H), 8.82 (dd, J = 4.60, ), 12.44 (s, 1H), 16.45 (s, 1H).

Exemplo 84D l-benzil-3-(7-bromo-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 84D 1-Benzyl-3- (7-bromo-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Uma mistura do produto do Exemplo 84C (0, 074 g, 0,14 mmol) em hidróxido de potássio aquoso (10%, 5 mL) foi aquecida a refluxo durante 16 horas, arrefecida até temperatura ambiente e ajustada a pH 3 com HC1 6M. A mistura foi filtrada e o bolo de filtração foi lavado com água, triturado com tetra-hidrofurano/água, filtrado e seco sob vácuo para gerar o composto em titulo (0,060 g, 84%). MS (ESI+) m/z 511,0 (M+H)+, 512,9 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 5,62 (s, 2H) , 7,21 (m, 1H), 7,27 (m, J=4,41 Hz, 5H) , 7,36 (m, 1H), 7,50 (d, J=8, 82 Hz, 1H), 7,84 (dd, J=8, 82, 1, 84 Hz, 1H) , 7,95 (s, 1H) , 8,51 (dd, J=7,91, 1,65 Hz, 1H), 8,68 (m, 1H) . O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI + ) m/z 511,0 (M+H-Na)\ 512,9 (M+H-Na)+; XH RMN (300 MHz, DMSO-d6) δ 5,52 (s, 2H) , 7,17 (m, 2H) , 7,24 (m, 5H) , 7,71 (m, 1H) , 7,76 (d, J=2,21 Hz, 1H) , 8,40 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,49 (dd, J=4,60, 2, 02 Hz, 1H) , 16,09 (S, 1H) .A mixture of the product of Example 84C (0.074 g, 0.14 mmol) in aqueous potassium hydroxide (10%, 5 mL) was heated at reflux for 16 hours, cooled to room temperature and adjusted to pH 3 with 6M HCl . The mixture was filtered and the filter cake was washed with water, triturated with tetrahydrofuran / water, filtered and dried under vacuum to give the title compound (0.060 g, 84%). MS (ESI +) m / z 511.0 (M + H) +, 512.9 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 5.62 (s, 2H), 7.21 (m, 1H), 7.27 (m, J = 4.41 Hz, 5H), 7.36 1H), 7.50 (d, J = 8.82 Hz, 1H), 7.84 (dd, J = 8.82, , 51 (dd, J = 7.91, 1.65 Hz, 1H), 8.68 (m, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI +) m / z 511.0 (M + H-Na) + 512.9 (M + H-Na) +; 1 H NMR (300 MHz, DMSOd 6) δ 5.52 (s, 2H), 7.17 (m, 2H), 7.24 (m, 5H), 7.71 (m, 1H), 7.76 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.60, 2.02 Hz, 1H), 16.09 (s, 1H).

Exemplo 85 l-benzil-3-(1,l-dioxido-7-fenil-2H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 85 1-Benzyl-3- (1,1-dioxido-7-phenyl-2H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 85A N- [3-(aminosulfonil)-1,1'-bifenil-4-il]-l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84C substituindo por 2-amino-5- 139 ΕΡ 1 560 827/ΡΤ fenilbenzenossulfonamida a 2-amino-5-bromobenzenossulfonamida (0,084 g, 79%). MS (ESI+) m/z 527,1 (M+H)+, 549,1 (M+Na)+; XH RMN (300 MHz, DMSO-d6) δ 5,68 (s, 2H) , 7,2-7,8 (m, 13H) , 7,98 (s, 1H), 8,09 (s, 1H), 8,17 (s, 1H), 8,54 (s, 1H), 8,81 (s, 1H), 12,49 (s, 1H), 16,67 (s, 1H).Example 85A N- [3- (aminosulfonyl) -1,1'-biphenyl-4-yl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3 -carboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-5-bromo-5-bromobenzenesulfonamide (0.084 g, 79%) for 2-amino-5-methyl-5,5,8,8,8,8a-phenylbenzenesulfonamide. MS (ESI +) m / z 527.1 (M + H) +, 549.1 (M + Na) +; 1 H NMR (300 MHz, DMSO-d 6) δ 5.68 (s, 2H), 7.2-7.8 (m, 13H), 7.98 (s, 1H), 8.09 (s, 1H) , 8.17 (s, 1H), 8.54 (s, 1H), 8.81 (s, 1H), 12.49 (s, 1H), 16.67 (s, 1H).

Exemplo 85B l-benzil-3-(1,l-dioxido-7-fenil-2H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 85A o produto do Exemplo 84C (0,055 g, 69%). MS (ESI+) m/z 509,1 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 5,71 (s, 2H) , 7,24 (m, 1H) , 7,30 (m, 3H), 7,49 (m, 4H), 7,79 (m, J=7,35 Hz, 3H), 8,07 (m, J=ll, 03, 2,21 Hz, 2H), 8,60 (dd, J=7,91, 1,65 Hz, 1H), 8,81 (m, J= 3,68 Hz, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI + ) m/z 531,0 (M+), 509, 1 (M-Na+H)+; XH RMN (300 MHz, DMSO-de) δ 5, 53 (s, 2H), 7,17 (m, 2H), 7,25 (m, J=4,41 Hz, 4H), 7,39 (m, 2H), 7, 49 (t, J= 7,54 Hz, 2H), 7,71 (d, J= 6, 99 Hz, 2H), 7, 89 (m, 2H), 8,42 (dd, J=7, 72, 1, 84 Hz, 1H), 8,49 (dd, J=4,60 , 2,02 Hz , 1H), 15,99 (s, 1H).Example 85B 1-Benzyl-3- (1,1-dioxido-7-phenyl-2H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 85A for the product of Example 84C (0.055 g, 69%). MS (ESI +) m / z 509.1 (M + H) +; 1 H NMR (300 MHz, DMSOd 6) δ 5.71 (s, 2H), 7.24 (m, 1H), 7.30 (m, 3H), 7.49 (m, 4H), 7.79 (m, J = 7.35 Hz, 3H), 8.07 (m, J = 11.3, 2.21 Hz, 2H), 8.60 (dd, J = 7.91, 1.65 Hz, 1H), 8.81 (m, J = 3.68 Hz, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI +) m / z 531.0 (M +), 509.1 (M-Na + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 5.53 (s, 2H), 7.17 (m, 2H), 7.25 (m, J = 4.41 Hz, 4H), 7.39 2H), 7.71 (d, J = 6.99Hz, 2H), 7.99 (m, 2H), 8.42 (dd, J = , J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.60, 2.02 Hz, 1H), 15.99 (s, 1H).

Exemplo 86 l-benzil-3-(7-ciclo-hexil-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 86 1-Benzyl-3- (7-cyclohexyl-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 86a 2-amino-5-ciclo-hexilbenzenossulfonamidaExample 86a 2-Amino-5-cyclohexylbenzenesulfonamide

Uma solução de 4-ciclo-hexilanilina (0,877 g, 5,0 mmol, 1,0 eq) em nitroetano (5 mL) foi arrefecida até -40°C, tratada gota a gota com isocianato de clorossulfonilo (0,87 g, (0,523 mL, 6,15 mmol, 1,23 eq), aquecida até 0°C, tratada com tricloreto de alumínio (0,85 g, 6,35 mmol, 1,27 eq), aquecida num banho de óleo a 110°C durante 30 minutos, arrefecida até temperatura ambiente e vertida em 200 mL de água gelada. A mistura foi filtrada e o bolo de filtração foi enxaguada com água fria, dissolvida em H2S04 a 50% (25 mL), aquecida a refluxo durante 4 horas, arrefecida até temperatura ambiente, vertida em 200 mL de água gelada e cuidadosamente neutralizada 140 ΕΡ 1 560 827/ΡΤA solution of 4-cyclohexylaniline (0.877 g, 5.0 mmol, 1.0 eq) in nitroethane (5 mL) was cooled to -40 ° C, treated dropwise with chlorosulfonyl isocyanate (0.87 g, (0.523 mL, 6.15 mmol, 1.23 eq), warmed to 0 ° C, treated with aluminum trichloride (0.85 g, 6.35 mmol, 1.27 eq), heated in an oil bath to 110 ° C The mixture was filtered and the filter cake was rinsed with cold water, dissolved in 50% H2 SO4 (25 mL), heated to reflux for 4 hours. hours, cooled to room temperature, poured into 200 mL of ice water and carefully neutralized 140 Ź 1560 827 / ΡΤ

a ρΗ 7 com NaOH a 40%. A mistura reaccional foi extraída com acetato de etilo (3 χ 100 mL) e os extractos combinados foram lavados com salmoura, secos (MgSCg), filtrados e concentrados para gerar 0,40 g do produto desejado (31% de rendimento). MS (ESI+) m/z 255, 0 (M+H)+, 272, 1 (M+H20)+, 277, 0 (M+Na)+; :Η RMN (300 MHz, DMSO-d6) δ 1,32 (m 4H), 1,71 (m, 6H), 2,36 (m, 1H), 5,64 (s, 2H), 6,72 (d, J=8,09 Hz, 1H), 7,11 (dd, J=8,46, 2,21 Hz, 1H), 7,16 (s, 2H), 7,38 (d, J=2,21 Hz, 1H).at ρ 7 with 40% NaOH. The reaction mixture was extracted with ethyl acetate (3 x 100 mL) and the combined extracts were washed with brine, dried (MgSO 4), filtered and concentrated to give 0.40 g of the desired product (31% yield). MS (ESI +) m / z 255.0 (M + H) +, 272.1 (M + H20) +, 277.0 (M + Na) +; NMR (300 MHz, DMSO-d 6) δ 1.32 (m, 4H), 1.71 (m, 6H), 2.36 (m, 1H), 5.64 (s, 2H), 6.72 (d, J = 8.46, 2.21 Hz, 1H), 7.16 (s, 2H), 7.38 (d, J = 2.21 Hz, 1H).

Exemplo 86B N-[2-(aminosulfonil)-4-ciclo-hexilfenil]-l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 86A a 2-amino-5-bromobenzenossulfonamida (0,081 g, 76%). MS (ESI+) m/z 533,1 (M+H)+, 555,2 (M+Na)+; :H RMN (300 MHz, DMSO-d6) δ 1,27 (m, 1H) , 1,45 (m, 4H), 1,72 (m, 1H), 1,85 (m, 4H), 2,61 (m, 1H) , 5,68 (s, 2H), 7,26 (m, 4H), 7,50 (m, 4H), 7,76 (d, J= 1,84 Hz, 1H) , 7,86 (d, J=8,46 Hz, 2H) , 8,54 (dd, J=8, 09, 1, 47 Hz, 1H), 8,80 (s, 1H), 12,31 (s, 1H) , 16,78 (s, 1H).Example 86B N- [2- (aminosulfonyl) -4-cyclohexylphenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound The title compound was prepared according to the procedure of Example 84C substituting the product of Example 86A for 2-amino-5-bromobenzenesulfonamide (0.081 g, 76%). MS (ESI +) m / z 533.1 (M + H) +, 555.2 (M + Na) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.27 (m, 1H), 1.45 (m, 4H), 1.72 (m, 1H), 1.85 (m, 4H) 1H), 5.68 (s, 2H), 7.26 (m, 4H), 7.50 (m, 4H), 7.76 (d, J = 1.84 Hz, 1H), 7.86 (d, J = 8.46 Hz, 2H), 8.54 (dd, J = 8.9, 1.47 Hz, 1H), 8.80 (s, 1H), 12.31 , 1H), 16.78 (s, 1H).

Exemplo 86C l-benzil-3-(7-ciclo-hexil-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 86B o produto do Exemplo 84C (0,040 g, 53%). MS (ESI+) m/z 533,1 (M+H+H20)+, 555, 1 (M+H20+Na)\ 515,1 (M+H)+; XH RMN (300 MHz, DMSO-ds) δ 1,34 (m, 5H) , 1,77 (m, 5H), 2,60 (m, 1H), 5,66 (s, 2H), 7,25 (m, 4H), 7,51 (m, J=9,56 Hz, 4H), 7,88 (s, 1H), 8,54 (s, 1H), 8,80 (s, 1H), 12,31 (S, 1H), 16,78 (s, 1H). O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dô) δ 1, 41 (m , 5H) , 1,70 (m , 5H), 3,79 (m, , 1H) , 5,52 (s, 2H), 7, 12 (dd, J= 7,54, 4,60 Hz, 1H), 7,17 (m, 1H) , 7,23 (m, 4H) , 7, 41 (dd, J= 8,64, 2,02 Hz, 1H), 7,67 (d, J= 2, 21 Hz, 1H), , 8,33 (d, J= 8, 4 6 Hz, 1H), 8,38 (dd, J= 7,72, 1, 84 Hz, 1H), 8,43 (dd, J=4, 60, 2,02 Hz, 1H), 11,15 (s, 1H) . 141 ΕΡ 1 560 827/ΡΤExample 86C 1-Benzyl-3- (7-cyclohexyl-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 86B for the product of Example 84C (0.040 g, 53%). MS (ESI +) m / z 533.1 (M + H + H 2 O) +, 555.1 (M + H 2 O + Na) + 515.1 (M + H) +; 1 H NMR (300 MHz, DMSO- d 6) δ 1.34 (m, 5H), 1.77 (m, 5H), 2.60 (m, 1H), 5.66 (s, 2H), 7.25 (m, 4H), 7.51 (m, J = 9.56 Hz, 4H), 7.88 (s, 1H), 8.54 (s, 1H), 8.80 (s, 1H), 12 , 31 (S, 1H), 16.78 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.41 (m, 5H), 1.70 (m, 5H), 3.79 (m, 1H), 5.52 (s, 2H) (Dd, J = 7.54, 4.60 Hz, 1H), 7.17 (m, 1H), 7.23 (m, 4H), 7.41 (dd, 1H), 8.33 (d, J = 8.46 Hz, 1H), 8.38 (dd, J = 7, 72, 1, 84 Hz, 1H), 8.43 (dd, J = 4.60, 2.02 Hz, 1H), 11.15 (s, 1H). 141 ΕΡ 1 560 827 / ΡΤ

Exemplo 87 l-benzil-3-(7-tert-butil-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-11)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 87 1-Benzyl-3- (7-tert-butyl-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-11) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 87A N-[2-(aminosulfonil)-4-tert-butilfenil]-l-benzil-4-hidroxi- 2-oxo-l,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por 2-amino-5-tert-butilbenzenossulfonamida a 2-amino-5-bromobenzenossulfonamida (0, 072 g, 79%). MS (ESI + ) m/z 507, 12 (M+H)+, 524,2 (M+H20)\ 529, 1 (M+Na)+; XH RMN (300 MHz, DMSO-d6) δ 1,33 (S, 9H), 5,68 (s, 2H), 7,22 (m, 1H), 7,29 (m, J= 3,6 8 Hz, 4H), 7, 47 (m, 3H), 7, 70 (dd, J=8,64, 2,39 Hz, 1H), 7,88 (d, J-- =8,82 Hz, 1H), 7,91 (d, J= 2,21 Hz, 1H), 8, 54 (dd, J= = 8,09, 1,84 Hz, 1H), 8,81 (dd, J=4,60, 1,65 Hz, 1H), 12,33 (s, 1H), 16,79 (s, 1H).Example 87A N- [2- (aminosulfonyl) -4-tert-butylphenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound The title compound was prepared according to the procedure of Example 84C substituting 2-amino-5-bromobenzenesulfonamide (0.072 g, 79%) with 2-amino-5-tert-butylbenzenesulfonamide. MS (ESI +) m / z 507.12 (M + H) +, 524.2 (M + H 2 O): 529.1 (M + Na) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.33 (s, 9H), 5.68 (s, 2H), 7.22 (m, 1H), 7.29 (m, J = (Dd, J = 8.64, 2.39 Hz, 1 H), 7.88 (d, J = 8.82 Hz, 1 H) ), 7.91 (d, J = 2.21 Hz, 1H), 8.54 (dd, J = 8.09, 1.84 Hz, 1H), 8.81 (dd, J = 4.60 , 1.65 Hz, 1H), 12.33 (s, 1H), 16.79 (s, 1H).

Exemplo 87B l-benzil-3-(7-tert-butil-l,l-dioxido-4H-l,2,4-benzotiadiazin- 3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 87B 1-benzyl-3- (7-tert-butyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 87A o produto do Exemplo 84C (0, 040 g, 100%). MS (ESI+) m/z 489, 1 (M+H)+, 511,1 (M+Na)+; XH RMN (300 MHz, DMSO-d6) δ 1,34 (s, 9H), 5,70 (s, 2H) , 7,22 (m, 1H), 7,29 (m, J=4,41 Hz, 4H) , 7,48 (m, 1H) , 7,59 (d, J= 8,82 Hz, 1H) , 7,75 (s, 1H), 7,81 (d, J=10,66 Hz, 1H), 8,58 (d, J= 6,62 Hz, 1H), 8,79 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 1,32 (s, 9H) , 5,53 (s, 2H), 7,18 (m, 2H), 7,25 (m, J=4,41 Hz, 5H), 7,59 (s, 1H), 7,65 (m, 1H), 8,42 (d, J= 7,35 Hz, 1H), 8,50 (m, J=3, 86, 2, 02 Hz, 1H).The title compound was prepared according to the procedure of Example 84D substituting the product of Example 87A for the product of Example 84C (0.040 g, 100%). MS (ESI +) m / z 489.1 (M + H) +, 511.1 (M + Na) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.34 (s, 9H), 5.70 (s, 2H), 7.22 (m, 1H), 7.29 (m, J = 4.41 Hz , 7.48 (m, 1H), 7.59 (d, J = 8.82 Hz, 1H), 7.75 (s, 1H), 7.81 (d, J = 10.66 Hz, , 1H), 8.58 (d, J = 6.62 Hz, 1H), 8.79 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.32 (s, 9H), 5.53 (s, 2H), 7.18 (m, 2H), 7.25 (m, J = 4.41 Hz (D, J = 7.35 Hz, 1 H), 8.50 (m, J = 3, 86, 2.02 Hz, 1H).

Exemplo 88 l-benzil-4-hidroxi-3-(7-metil-l, l-dioxido-4H-l, 2,4-benzotiadiazin-3-il)-1,8-naftiridin-2(1H)-onaExample 88 1-benzyl-4-hydroxy-3- (7-methyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one

Exemplo 88A N- [2-(aminosulfonil)-4-metilfenil]-l-benzil-4-hidroxi-2-oxo-1,2-di-hidro-l,8-naftiridina-3-carboxamida 142 ΕΡ 1 560 827/ΡΤ Ο composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por 2-amino-5-metilbenzenossulfonamida a 2-amino-5-bromobenzenossulfonamida (0,075 g, 90%). MS (ESI+) m/z 465,1 (M+H)+, 482,0 (M+H20)+, 487, 1 (M+Na)+. XH RMN (300 MHz, DMSO-d6) δ 2,39 (s, 3H) , 5,68 (S, 2H) , 7,23 (m, 1H), 7,29 (m, 4H) , 7,47 (m, 4H) , 7,73 (d, J=l,47 Hz, 1H), 7,84 (d, J=8,09 Hz, 1H), 8,54 (dd, J=7,72, 1,84 Hz, 1H), 8,81 (dd, J=4, 60, 1, 65 Hz, 1H) , 12,30 (s, 1H), 16,78 (s, 1H).Example 88A N- [2- (aminosulfonyl) -4-methylphenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide 142 ΕΡ 1 560 827 The title compound was prepared according to the procedure of Example 84C substituting 2-amino-5-methylbenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.075 g, 90%). MS (ESI +) m / z 465.1 (M + H) +, 482.0 (M + H 2 O) +, 487.1 (M + Na) +. 1 H NMR (300 MHz, DMSO-d 6) δ 2.39 (s, 3H), 5.68 (S, 2H), 7.23 (m, 1H), 7.29 (m, 4H), 7.47 7.4 (d, J = 8.09 Hz, 1 H), 8.54 (dd, J = 7.72, 1.84 Hz, 1H), 8.81 (dd, J = 4.60, 1.65 Hz, 1H), 12.30 (s, 1H), 16.78 (s, 1H).

Exemplo 88B l-benzil-4-hidroxi-3-(7-metil-l,l-dioxido-4H-l, 2,4-benzotiadiazin-3-il)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 88A o produto do Exemplo 84C (0,031 g, 42%). MS (ESI+) m/z 447, 0 (M+H)+, 469, 1 (M+Na) + . :H RMN (300 MHz, DMSO-d6) δ 2,41 (s, 3H), 5,65 (s, 2H), 7,24 (m, 5H), 7,45 (m, 3H), 7,66 (s, 1H), 8,54 (d, J=7,72 Hz, 1H), 8,72 (s, 1H). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 2,37 (s, 3H), 5,55 (S, 2H), 7,21 (m, 7H), 7,41 (d, J=8,46 Hz, 1H), 7,51 (s, 1H), 8,43 (d, J=8,09 Hz, 1H), 8,53 (s, 1H).Example 88B 1-benzyl-4-hydroxy-3- (7-methyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 88A for the product of Example 84C (0.031 g, 42%). MS (ESI +) m / z 447.0 (M + H) +, 469.1 (M + Na) +. 1 H NMR (300 MHz, DMSO-d 6) δ 2.41 (s, 3H), 5.65 (s, 2H), 7.24 (m, 5H), 7.45 (m, 3H) 66 (s, 1H), 8.54 (d, J = 7.72 Hz, 1H), 8.72 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.37 (s, 3H), 5.55 (S, 2H), 7.21 (m, 7H), 7.41 (d, J = 8.46 Hz , 1H), 7.51 (s, 1H), 8.43 (d, J = 8.09 Hz, 1H), 8.53 (s, 1H).

Exemplo 89 l-butil-3-(6-cloro-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 89 1-Butyl-3- (6-chloro-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 89A l-butil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridina-3-carboxilato de etilo A uma lama de NaH (95%, 0,44 g, 18,2 mmol) em 15 ml de DMA anidro a 10°C sob N2 juntou-se malonato de dietilo (2,9 g, 18,2 mmol) gota a gota durante 10 minutos. A mistura foi agitada a temperatura ambiente durante 30 minutos, tratada com o produto do Exemplo 1B (2,0 g, 9,1 mmol) e aquecida a 120°C durante 3 horas. A mistura foi arrefecida até temperatura ambiente e repartida entre acetato de etilo e água fria, ajustando o pH a 5 com HC1 1M. A fase orgânica foi lavada com 143 ΕΡ 1 560 827/ΡΤ 2 χ 100 mL de água, com 2 χ 100 ml de salmoura saturada, seca (Na2S04), filtrada e o filtrado foi concentrado sob vácuo. O resíduo foi recristalizado em hexano/acetato de etilo para gerar o composto desejado como um sólido branco (1,84 g, 70% de rendimento). MS (APCI+) m/z 291 (M+H)+.Ethyl 1-butyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxylate To a slurry of NaH (95%, 0.44 g, 18.2 mmol) in 15 ml of anhydrous DMA at 10 ° C under N2 was added diethyl malonate (2.9 g, 18.2 mmol) dropwise over 10 minutes. The mixture was stirred at room temperature for 30 minutes, treated with the product of Example 1B (2.0 g, 9.1 mmol) and heated at 120 ° C for 3 hours. The mixture was cooled to room temperature and partitioned between ethyl acetate and cold water, adjusting the pH to 5 with 1M HCl. The organic phase was washed with 143 æC 1 560 827 / ΡΤ 2 χ 100 mL of water, 2 χ 100 mL of saturated brine, dried (Na 2 SO 4), filtered and the filtrate was concentrated under vacuum. The residue was recrystallized from hexane / ethyl acetate to give the desired compound as a white solid (1.84 g, 70% yield). MS (APCI +) m / z 291 (M + H) +.

Exemplo 89b N- [2-(aminosulfonil)-4-clorofenil]-l-butil-4-hidroxi-2-oxo-1,2-di-hidro-l,8-naftiridina-3-carboxamidaExample 89b N- [2- (aminosulfonyl) -4-chlorophenyl] -1-butyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide

Uma mistura do produto do Exemplo 89A (87 mg, 0,3 mmol) e 2- amino-4-clorobenzenossulfonamida (62 mg, 0,3 mmol) em tolueno (5 mL) foi refluxada durante 16 horas, arrefecida e o precipitado resultante foi recolhido por filtração e seco para gerar a desejada amida como um sólido esbranquiçado (80 mg, 59% de rendimento). MS (APCI+) m/z 451 (M+H)+.A mixture of the product of Example 89A (87 mg, 0.3 mmol) and 2-amino-4-chlorobenzenesulfonamide (62 mg, 0.3 mmol) in toluene (5 mL) was refluxed for 16 hours, cooled, and the resulting precipitate was collected by filtration and dried to give the desired amide as an off-white solid (80 mg, 59% yield). MS (APCI +) m / z 451 (M + H) +.

Exemplo 89C l-butil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridina- 3- carboxilato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 89B o produto do Exemplo 84B (0,037 g, 53%). MS (ESI-) m/z 431 (M-H) -. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ 0,93 (t, J=7,17 Hz, 3H) , 1,34 (m, 2H), 1,58 (m, 2H), 4,27 (m, 2H) , 7,14 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,32 (dd, J=8, 27, 2, 02 Hz, 1H) , 7,42 (d, J=l,84 Hz, 1H), 7,68 (d, J=8,46 Hz, 1H), 8,37 (dd, J=7,54, 2,02 Hz, 1H), 8,54 (dd, J=4, 78, 1, 84 Hz, 1H) , 16,09 (s, 1H) .Example 89C Ethyl 1-butyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxylate The title compound was prepared according to the procedure of Example 84C substituting the product of Example 89B the product of Example 84B (0.037 g, 53%). MS (ESI-) m / z 431 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ0.93 (t, J = 7.17 Hz, 3H), 1.34 (m, 2H), 1.58 (m, 2H), 4.27 1H), 7.32 (dd, J = 8, 27.02.02 Hz, 1H), 7.42 (d, J = J = 8.46 Hz, 1H), 8.37 (dd, J = 7.54, 2.02 Hz, 1H), 8.54 (d, J = dd, J = 4.78, 1.84 Hz, 1H), 16.09 (s, 1H).

Exemplo 90 l-benzil-3-(8-bromo-5-metil-l,l-dioxido-4H-l, 2, 4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 90 1-Benzyl-3- (8-bromo-5-methyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4- 2 (1H) -one

Exemplo 90A N- [2-(aminosulfonil)-3-bromo-6-metilfenil]-l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por 2-amino-6-bromo- 144 ΕΡ 1 560 827/ΡΤ 3-metilbenzenossulfonamida a 2-amino-5-bromobenzenossulfonamida para gerar o composto em título em bruto (0,1 g, 98%).Example 90A N- [2- (aminosulfonyl) -3-bromo-6-methylphenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-5-bromobenzenesulfonamide for the crude title compound (2-amino-6-bromo-1,5-dihydrobenzofuran- 0.1 g, 98%).

Exemplo 90B l-benzil-3-(8-bromo-5-metil-l,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 90A o produto do Exemplo 84C. O produto em bruto foi purificado por cromatografia em coluna com sílica gel eluindo com diclorometano e metanol (98:2) para gerar o composto em título como um sólido branco, (0,03 g, 31% de rendimento). MS (ESI-) m/z 525 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 16,0 (br s, 1H) , 8,49 (dd, J=4,8, 1,8 Hz, 1H), 8,44 (dd, J=7,7, 1,8 Hz, 1H) , 7,45 (br s, 1H) , 7,37 (m, 1H), 7,23 (m, 3H), 7,16 (dd, J=4,8, 3,3 Hz, 1H), 7,01 (m, 1H), 6,85 (d, J=7,7 Hz, 1H), 5,53 (br s, 2H), 2,43 (s, 3H).Example 90B 1-Benzyl-3- (8-bromo-5-methyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin- 2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 90A for the product of Example 84C. The crude product was purified by silica gel column chromatography eluting with dichloromethane and methanol (98: 2) to give the title compound as a white solid, (0.03 g, 31% yield). MS (ESI-) m / z 525 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 16.0 (br s, 1H), 8.49 (dd, J = 4.8, 1.8 Hz, 1H), 8.44 (dd, J = 7). , 7.45 (br s, 1H), 7.37 (m, 1H), 7.23 (m, 3H), 7.16 (dd, J = 4.8 1H), 7.03 (br s, 2H), 2.43 (s, 2H) 3H).

Exemplo 91 l-benzil-3-(8-fluoro-5-metil-l,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 91 1-Benzyl-3- (8-fluoro-5-methyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin- 2 (1H) -one

Exemplo 91A N-[2-(aminosulfonil)-3-fluoro-6-metilfenil]-1-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por 2-amino-6-fluoro-3-metilbenzenossulfonamida a 2-amino-5-bromobenzenossulfonamida para gerar o composto em título em bruto (0,120 g, 100%).Example 91A N- [2- (aminosulfonyl) -3-fluoro-6-methylphenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide O title compound was prepared according to the procedure of Example 84C substituting 2-amino-5-bromobenzenesulfonamide for 2-amino-6-fluoro-3-methylbenzenesulfonamide to give the crude title compound (0.120 g, 100%).

Exemplo 9lB l-benzil-3-(8-fluoro-5-metil-l,l-dioxido-4H-l, 2, 4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 91A o produto do Exemplo 84C. O produto em bruto foi purificado por cromatografia em coluna com sílica gel eluindo com diclorometano e metanol (98:2) como um sólido branco, 145 ΕΡ 1 560 827/ΡΤ (0,05 g, 44% de rendimento). MS (ESI-) m/z 463 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-d6) δ 16,1 (br s, 1H), 8,49 (dd, J=4,6, 2,0 Hz, 1H), oo (dd, J=7,7, 1,8 Hz, 1H), 7,59 (m, 1H), 7,47 (dd, J=7,3, 5,8 Hz , 1H) , 7,38 (m, 1H), 7,21 (m, 3H), 7,16 (dd, J= 7,7, 5, 8 Hz, 1H), &lt; 5, 99 (t, J=8, 8 Hz, 1H) , 5,53 (s, 2H), 2,42 (s, . 3H) .Example 9B 1-Benzyl-3- (8-fluoro-5-methyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin- 2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 91A for the product of Example 84C. The crude product was purified by silica gel column chromatography eluting with dichloromethane and methanol (98: 2) as a white solid, Î »4560 827 / ΡΤ (0.05 g, 44% yield). MS (ESI-) m / z 463 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 16.1 (br s, 1H), 8.49 (dd, J = 4.6, 2.0 Hz, 1H), o (dd, J = 1.8 Hz, 1H), 7.59 (m, 1H), 7.47 (dd, J = 7.3, 5.8 Hz, 1H), 7.38 (m, 1H), 7.21 (m, m, 3H), 7.16 (dd, J = 7.7, 5.8 Hz, 1H), &lt; 5.99 (t, J = 8.8 Hz, 1H), 5.53 (s, 2H), 2.42 (s, 3H).

Exemplo 92 l-benzil-4-hidroxi-3-(5-isopropil-l,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-1,8-naftiridin-2(1H)-onaExample 92 1-Benzyl-4-hydroxy-3- (5-isopropyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one

Exemplo 92A N-[2-(aminosulfonil)-6-isopropilfenil]-l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por 2-amino-3-isopropilbenzenossulfonamida a 2-amino-5-bromobenzeno-sulfonamida (0,050 g, 55%) após cromatografia em sílica gel (eluindo com hexano/acetato de etilo 4:1). 1H RMN (300 MHz, DMSO -d6) δ XH RMN (300 MHz , DMSO-d6; ) δ 1,12 (d, J=6,62 Hz, 3H) 1,26 (d, J= =6,99 Hz, 3H), 3, 06 (m, 1H) , 5,69 (m, 2H), 7,27 (m 5H), 7,39 (S, 2H), 7, 48 (dd, &lt;7=7, 72, 4,78 Hz, 1H), 7,55 (t J=7, 72 Hz, 1H), 7,71 (d, , J= 8 ,09 Hz, 1H), 7,80 (dd, . J=7 ,72 1,10 Hz, 1H), 8,53 (dd , J=7 ,91, 1, 65 Hz, 1H), 8, ,83 (dd J=4,78, 1,84 Hz, 1H), 11,75 (s, 1H), 16,83 (s, 1H).Example 92A N- [2- (aminosulfonyl) -6-isopropylphenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-3-isopropylbenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.050 g, 55%) after chromatography on silica gel eluting with hexane / ethyl acetate 4: 1). 1 H NMR (300 MHz, DMSO-d 6) δ1 H NMR (300 MHz, DMSO-d6): δ 1.12 (d, J = 6.62 Hz, 3H) 1.26 (d, J = 6.99 1H), 5.69 (m, 2H), 7.27 (m, 5H), 7.39 (s, 2H), 7.48 (dd, 7.72 (d, J = 8.9 Hz, 1H), 7.80 (dd, J = 7, 7 Hz, J = 7.72, 1.10 Hz, 1H), 8.53 (dd, J = 7.91, 1.65 Hz, 1H), 8.33 (dd, J = 4.78, 1.84 Hz, , 1H), 11.75 (s, 1H), 16.83 (s, 1H).

Exemplo 92b l-benzil-4-hidroxi-3-(5-isopropil-l,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 92a o produto do Exemplo 84C (0,038 g, 75%). MS (ESI+) m/z 475,1 (M+H)+, 492, 1 (M+H20)+, 497, 1 (M+Na)\ XH RMN (300 MHz, DMSO-de) δ 1,34 (d, J= 6,62 Hz, 6H), 3,30 (m, 1H), 5,73 (s, 2H), 7,27 (m, 5H), 7,54 (m, 2H), 7,78 (m, J=16,18, 7,72Example 92b 1-benzyl-4-hydroxy-3- (5-isopropyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 92a for the product of Example 84C (0.038 g, 75%). MS (ESI +) m / z 475.1 (M + H) +, 492.1 (M + H 2 O) +, 497.1 (M + Na) 1 H NMR (300 MHz, DMSO- d 6) δ 1.34 (d, J = 6.62 Hz, 6H), 3.30 (m, 1H), 5.73 (s, 2H), 7.27 (m, 5H), 7.54 , 78 (m, J = 16.18, 7.72

Hz, 2H), 8,62 (dd, J=7,91, 1,65 Hz, 1H), 8,84 (s, 1H), 14,64 (s, 1H). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-de) δ 1,32 (d, J= 6,62 Hz, 6H), 3,42 (m, 1H), 5,53 (s, 146 ΕΡ 1 560 827/ΡΤ 2Η) , 7,15 (m, 2Η) , 7,25 (m, J= 4,41 Ηζ, 4Η), 7,29 (m, 1Η) , 7,53 (m, J= 7, 72, 1, 84 Hz, 2H), 8,46 (m, 2H), 16,06 (S, 1H) .Hz, 2H), 8.62 (dd, J = 7.91, 1.65 Hz, 1H), 8.84 (s, 1H), 14.64 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.32 (d, J = 6.62 Hz, 6H), 3.42 (m, 1H), 5.53 (s, 146 ΕΡ 1 560 827 / ΡΤ 2Η ), 7.15 (m, 2 H), 7.25 (m, J = 4.41 Ηζ, 4Η), 7.29 (m, 1Η), 7.53 (m, 84 Hz, 2H), 8.46 (m, 2H), 16.06 (s, 1H).

Exemplo 93 l-benzil-4-hidroxi-3-(5-metil-l,l-dloxido-4H-l, 2,4-benzo-tiadiazin-3-il)-1,8-naftiridin-2(1H)-onaExample 93 1-Benzyl-4-hydroxy-3- (5-methyl-1,1-dideoxy-4H-1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one

Exemplo 93A N- [2-(aminosulfonil)-6-metilfenil]-l-benzil-4-hidroxi-2-oxo-1,2-di-hldro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por 2-amino-3-metilbenzenossulfonamida a 2-amino-5-bromobenzenossulfonamida (0, 059 g, 100%). ΧΗ RMN (300 MHz, DMSO-d6) δ 2,27 (s, 3H) 5,68 (m, 2H) 7,24 (m, 5H) 7,46 (m, 4H) 7,59 (d, J=6,99 Hz, 1H) 7,79 (d, J=7, 72 Hz, 1H) 8,54 (dd, J=-8,09, 1,84 Hz, 1H) 8,83 (dd, J=4,78, 1,84 Hz, 1H) 11,90 (s, 1H) 16,79 (s, 1H).Example 93A N- [2- (aminosulfonyl) -6-methylphenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-5-bromobenzenesulfonamide (0.090 g, 100%) with 2-amino-3-methylbenzenesulfonamide. 1 H NMR (300 MHz, DMSO-d 6) δ 2.27 (s, 3H) 5.68 (m, 2H) 7.24 (m, 5H) 7.46 (m, 4H) 7.59 (d, J = J = 7.72 Hz, 1 H) 8.54 (dd, J = -8.09, 1.84 Hz, 1 H) 8.83 (dd, J = = 4.78, 1.84 Hz, 1H) 11.90 (s, 1H) 16.79 (s, 1H).

Exemplo 93B l-benzil-4-hidroxi-3-(5-metil-l,l-dioxido-4H-l,2,4-benzo- tiadiazin-3-il)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 93A o produto do Exemplo 84C (0,015 g, 25%) após cromatografia em sílica gel (eluindo com diclorometano/metanol 98:2). MS (ESI+) m/z 447,0 (M+H)+, 469,1 (M+Na)+ . :H RMN (300 MHz, -d6) δ 2,52 (m, 3H) 5,75 (m, 2H) 7,23 (m, 1H) 7,30 (m, 4H) 7,47 (t, J=7, 72 Hz, 1H) 7,53 (dd, J=8, 09, 4, 78 Hz, 1H) 7,69 (d, J=7,35 Hz, 1H) 7,79 (d, J=8,09 Hz, 1H) 8,63 (dd, J=1, 72, 1, 84 Hz, 1H) 8,85 (dd, J=4,78, 1,84 Hz, 1H) 14,41 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 2,48 (s, 3H) 5,56 (s, 2H) 7,21 (m, 6H) 7,49 (d, J=7,35 Hz, 1H) 7,56 (d, J=7,35 Hz, 1H) 8,47 (d, J=7,72 Hz, 1H) 8,53 (s, 1H) 11,98 (s, 1H) .Example 93B 1-benzyl-4-hydroxy-3- (5-methyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 93A for the product of Example 84C (0.015 g, 25%) after chromatography on silica gel (eluting with dichloromethane / methanol 98: 2). MS (ESI +) m / z 447.0 (M + H) +, 469.1 (M + Na) +. 1 H NMR (300 MHz, d 6) δ 2.52 (m, 3H) 5.75 (m, 2H) 7.23 (m, 1H) 7.30 (m, 4H) 7.47 (t, J = = 7.72 Hz, 1 H) 7.53 (dd, J = 8.94, 4.78 Hz, 1 H) 7.69 (d, J = 7.35 Hz, 1 H) 7.79 (d, J = 8.09 Hz, 1 H) 8.63 (dd, J = 1.72, 1.84 Hz, 1 H) 8.85 (dd, J = 4.78, 1.84 Hz, 1 H) 14.41 (s , 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.48 (s, 3H) 5.56 (s, 2H) 7.21 (m, 6H) 7.49 (d, J = 7.35 Hz, 7.56 (d, J = 7.35 Hz, 1 H) 8.47 (d, J = 7.72 Hz, 1 H) 8.53 (s, 1 H) 11.98 (s, 1H).

Exemplo 94 l-benzil-3-(5-bromo-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona 147Example 94 1-Benzyl-3- (5-bromo-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one 147

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 94A N-[2-(aminosulfonil)-6-bromofenil]-l-benzil-4-hidroxi-2-oxo-1,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por 2-amino-3- metilbenzenossulfonamida a 2-amino-5-bromobenzenossulfonamida (0, 080 g, 25%) após cromatografia em sílica gel (eluindo com hexano/acetato de etilo 2:1). MS (ESI+) m/z 529,0 (M+H)+, 530, 9 (M+H)+. 1E RMN (300 MHz, DMSO-d6) δ 5,71 (m, 2H) 7,23 (m, 1H) 7,32 (m, 4H) 7,50 (m, 2H) 7,62 (s, 2H) 7,96 (dd, J=7,91, 1,29 Hz, 1H) 8,02 (dd, J=7,91, 1,29 Hz, 1H) 8,55 (dd, J=7,91, 1,65 Hz, 1H) 8,85 (dd, J=4,78, 1,84 Hz, 1H) 11,95 (s, 1H) 16,51 (S, 1H).Example 94A N- [2- (aminosulfonyl) -6-bromophenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-3-methylbenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.080 g, 25%) after silica gel chromatography (eluting with hexane / ethyl acetate 2: 1). MS (ESI +) m / z 529.0 (M + H) +, 530.9 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 5.71 (m, 2H) 7.23 (m, 1H) 7.32 (m, 4H) 7.50 (m, 2H) 7.62 (s, 2H ) 7.96 (dd, J = 7.91, 1.29 Hz, 1 H) 8.02 (dd, J = 7.91, 1.29 Hz, 1 H) 8.55 (dd, J = 7.91 , 1.85 Hz, 1 H) 8.85 (dd, J = 4.78, 1.84 Hz, 1 H) 11.95 (s, 1 H) 16.51 (s, 1H).

Exemplo 94B l-benzil-3-(5-bromo-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 94A o produto do Exemplo 84C (0,040 g, 54%). MS (ESI+) m/z 510,9 (M+H)+, 512,9 (M+H) + . XH RMN (300 MHz, DMSO-d6) δ 5,56 (s, 2H) 7,23 (m, 8H) 7,76 (d, J=8,46 Hz, 1H) 7,94 (d, J=8,09 Hz, 1H) 8,46 (dd, J=7, 72, 1,84 Hz, 1H) 8,55 (m, 1H) 16,17 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,53 (s, 2H) 7,17 (m, 2H) 7,25 (m, 5H) 7,71 (d, J= 6,99 Hz, 1H) 7,90 (m, 1H) 8,43 (dd, J=7,72, 1,84Example 94B 1-benzyl-3- (5-bromo-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 94A for the product of Example 84C (0.040 g, 54%). MS (ESI +) m / z 510.9 (M + H) +, 512.9 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 5.56 (s, 2H) 7.23 (m, 8H) 7.76 (d, J = 8.46 Hz, 1 H) 7.94 (d, J = 8.09 Hz, 1 H) 8.46 (dd, J = 7, 72, 1.84 Hz, 1 H) 8.55 (m, 1 H) 16.17 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.53 (s, 2H) 7.17 (m, 2H) 7.25 (m, 5H) 7.71 (d, J = 6.99 Hz, 1H) 7.90 (m, 1 H) 8.43 (dd, J = 7.72, 1.84

Hz, 1H) 8,49 (dd, J=4, 60, 2, 02 Hz, 1H) 16,38 (s, 1H).Hz, 1 H) 8.49 (dd, J = 4.60, 2.02 Hz, 1 H) 16.38 (s, 1H).

Exemplo 95 l-benzil-3-(1,l-dioxido-5-propil-2H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 95 1-Benzyl-3- (1,1-dioxido-5-propyl-2H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 95A N-[2-(aminosulfonil)-6-propilfenil]-l-benzil-4-hidroxi-2-oxo-1,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por 2-amino-3-propilbenzenossulfonamida a 2-amino-5-bromobenzenossulfonamida 148 ΕΡ 1 560 827/ΡΤ (0, 062 g, 59%) . MS (DCI/NH3) m/ z 493 (M+H) + . XH RMN (300 MHz, DMSO-dê) δ 0,83 e 0 , 93 (dois t, J-- =7,35 Hz, 3H), 1, 57 (m, 2H), 2,57 (m, 2H), 5,66 (m, 2H), 7,28 (m, 5H), 7, 41 (s, 2H), 7, 48 (m, 2H) , 7,61 (m, 1H), 7,81 (dd, J=7,72, 1,47 Hz, 1H), 8,53 (dd, J=7,91, 1,65 Hz, 1H), 8,83 (dd, J=4 ,78, 1,84 Hz, 1H), 11,82 (s, 1Η), 16,80 (s, 1Η).Example 95A N- [2- (aminosulfonyl) -6-propylphenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-3-propylbenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide 148 ÅΡ 1 560 827 / ΡΤ (0.062 g, 59%). MS (DCI / NH 3) m / z 493 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 0.83 and 0.93 (two t, J = 7.35 Hz, 3H), 1.57 (m, 2H), 2.57 (m, 2H (M, 2H), 7.61 (m, 2H), 7.61 (m, 1H), 7.81 (m, 2H) (dd, J = 7.91, 1.65 Hz, 1 H), 8.83 (dd, J = 4.78, 1) , 84 Hz, 1H), 11.82 (s, 1 H), 16.80 (s, 1 H).

Exemplo 95Β l-benzil-3-(1,l-dioxido-5-propil-2H-l,2,4-benzotiadiazin-3-il)-4-hldroxi-l,8-naftlrldln-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 95A o produto do Exemplo 84C (0,029 g, 50%). MS (ESI-) m/z 473 (M-H)”. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 1,03 (t, J=7,17 Hz, 3H), 1,68 (m, 2H), 2.83 (t, J=7,72 Hz, 2H), 5,53 (s, 2H) , 7,19 (m, 7H), 7,44 (d, J=6,25 Hz, 1H), 7,53 (d, J=7,35 Hz, 1H), 8,43 (dd, J=7,54, 1.84 Hz, 1H), 8,48 (dd, J=4, 78, 1,84 Hz, 1H), 16,02 (s, 1H) .Example 95 1-Benzyl-3- (1,1-dioxido-5-propyl-2H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthldldn-2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 95A for the product of Example 84C (0.029 g, 50%). MS (ESI-) m / z 473 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.03 (t, J = 7.17 Hz, 3H), 1.68 (m, 2H), 2.83 (t, J = 7.72 Hz, 2H), 7.53 (s, 2H), 7.19 (m, 7H), 7.44 (d, J = 6.25 Hz, 1H), 7.53 (d, J = 7.35 Hz, 1H), 8.43 (dd, J = 7.54, 1.84 Hz, 1H), 8.48 (dd, J = 4.78, 1.84 Hz, 1H), 16.02 (s, 1H).

Exemplo 96 l-benzil-3-(5-etil-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 96 1-Benzyl-3- (5-ethyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 96A 17-[2-(aminossulfonil)-6-etilfenil]-l-benzil-4-hidroxi-2-oxo-1,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por 2-amino-3-etilbenzenossulfonamida a 2-amino-5-bromobenzenossulfonamida (0, 070 g, 74%). MS (ESI-) m/z 479 (M+H) + . XH RMN (300 MHz, DMSO-de) δ 1,17 (t, J=7,54 Hz, 3H), 2,61 (q, J=7,60 Hz, 2H), 5,70 (m, 2H), 7,27 (m, 5H), 7,42 (s, 2H) , 7,49 (m, 2H) , 7,63 (m, 1H) , 7,81 (dd, J=7,91, 1,29 Hz, 1H), 8,53 (dd, J=7,91, 1,65 Hz, 1H), 8,83 (dd, J=4,41, 1,84 Hz, 1H), 11,82 (s, 1H), 16,80 (s, 1H).Example 96A 17- [2- (aminosulfonyl) -6-ethylphenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-5-bromobenzenesulfonamide (0.070 g, 74%) with 2-amino-3-ethylbenzenesulfonamide. MS (ESI-) m / z 479 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 1.17 (t, J = 7.54 Hz, 3H), 2.61 (q, J = 7.60 Hz, 2H), 5.70 (m, 2H (M, 2H), 7.63 (m, 1H), 7.81 (dd, J = 7.91, 1H), 8.53 (dd, J = 7.91, 1.65 Hz, 1H), 8.83 (dd, J = 4.41, 1.84 Hz, 82 (s, 1H), 16.80 (s, 1H).

Exemplo 96B l-benzil-3-(5-etil-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona 149 ΕΡ 1 560 827/ΡΤExample 96B 1-benzyl-3- (5-ethyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one 149 ΕΡ 1 560 827 / ΡΤ

Ο composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 96A o produto do Exemplo 84C (0,060 g, 93%). MS (ESI-) m/z 459 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO -d6) δ 1, 30 (t, J= 7, 54 Hz, 3H) , 2,86 (q, J= = 7, 35 Hz, 2H) , 5,53 (s, 2H), 7, 14 (dd, J= = 7, 72, 4, 78 Hz, 1H), 7,22 (m, 6H) , 7, 46 (d, J= 7, 72 Hz , 1H) / 7, 53 (d, J= 7,72 Hz, 1H), 8, 44 (dd, J= 7, 72, 1,84 Hz r 1H), 8, 48 (dd, J=4,78, 1,83 Hz, 1H), 15,98 (s, 1H) ,The title compound was prepared according to the procedure of Example 84D substituting the product of Example 96A for the product of Example 84C (0.060 g, 93%). MS (ESI-) m / z 459 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.30 (t, J = 7, 54 Hz, 3H), 2.86 (q, J = 7.35 Hz, 2H), 5.53 (s, 2H), 7.14 (dd, J = 7.72, 4.78 Hz, 1H), 7.22 (m, 6H), 7.46 (d, J = 7.72 Hz, 1H); (Dd, J = 7.72, 1.84 Hz, 1H), 8.48 (dd, J = 4.78, 1.83 1H), 15.98 (s, 1H).

Exemplo 97 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridin-3-il)-2H-1,2,4-benzotiadiazina-5-carbonitrilo, 1,1-dióxidoExample 97 3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl) -2H-1,2,4-benzothiadiazine-5-carbonitrile, 1,1-dioxide

O produto do Exemplo 94B (0,329 g, 0,643 mmol) e CuCN (0,29 g, 3,21 mmol) em DMF anidra (5 mL) foram aquecidos sob N2 a 145° durante 22 horas. A reacção foi arrefecida até temperatura ambiente, diluída com CH2C12 (50 mL) e HC1 IN aq (10 mL) e vigorosamente agitada durante 15 minutos. As fases foram separadas e a fase aquosa extraída com CH2C12 (2x50 mL) . Os extractos orgânicos foram lavados com HC1 IN aquoso (20 mL) e NaCl aquoso saturado, depois secos sobre Na2S04 anidro. Após filtração e concentração por evaporação rotativa, o resíduo foi purificado por cromatografia instantânea em sílica gel (2,5x14 cm, 5% EtOAc/CH2Cl2) para gerar o composto em título (0,136 g, 46%). MS (ESI-) m/z 456 (M-H) ”. XH RMN (300 MHz, DMSO-d6) δ 5,69 (S, 2H) 7,26 (m, 5H) 7,47 (dd, J=7,91, 4,60 Hz, 1H) 7,62 (t, J=7,91 Hz, 1H) 8,25 (m, 2H) 8,59 (dd, J=7,91,The product of Example 94B (0.329 g, 0.643 mmol) and CuCN (0.29 g, 3.21 mmol) in anhydrous DMF (5 mL) were heated under N 2 at 145 ° for 22 h. The reaction was cooled to room temperature, diluted with CH2 Cl2 (50 mL) and aq. 1N HCI (10 mL) and vigorously stirred for 15 minutes. The phases were separated and the aqueous phase extracted with CH 2 Cl 2 (2 x 50 mL). The organic extracts were washed with aqueous 1N HCl (20 mL) and saturated aqueous NaCl, then dried over anhydrous Na2 SO4. After filtration and concentration by rotary evaporation, the residue was purified by flash chromatography on silica gel (2.5 x 14 cm, 5% EtOAc / CH 2 Cl 2) to give the title compound (0.136 g, 46%). MS (ESI-) m / z 456 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ 5.69 (S, 2H) 7.26 (m, 5H) 7.47 (dd, J = 7.91, 4.60 Hz, t, J = 7.91 Hz, 1 H) 8.25 (m, 2 H) 8.59 (dd, J = 7.91,

2,02 Hz, 1H) 8,80 (dd, J=4, 60, 1, 65 Hz, 1H) 15,67 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dô) δ 5,53 (s, 2H) 7,20 (m, 6H) 7,41 (t, J=7,91 Hz, 1H) 8,00 (d, J=7,352.02 Hz, 1 H) 8.80 (dd, J = 4.60, 1.65 Hz, 1 H) 15.67 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.53 (s, 2H) 7.20 (m, 6H) 7.41 (t, J = 7.91 Hz, 7.35

Hz, 1H) 8,07 (d, J=7, 72 Hz, 1H) 8,43 (dd, J=7, 54, 1, 65 Hz, 1H) 8,51 (dd, J=4, 60, 1,65 Hz, 1H) 17,35 (S, 1H).(Dd, J = 7, 72 Hz, 1 H), 8.07 1.65 Hz, 1 H) 17.35 (s, 1H).

Exemplo 98 l-butil-3-(1,l-dioxido-4H-pirido[3,2-e][1,2,4]tiadiazin-3-il)-4-hidroxi-2(1H)-quinolinona 150 ΕΡ 1 560 827/ΡΤExample 98 1-Butyl-3- (1,1-dioxido-4 H -pyrido [3,2- e] [1,2,4] thiadiazin-3-yl) -4-hydroxy-2 (1H) -quinolinone 150 ΕΡ 1 560 827 / ΡΤ

Exemplo 98Α 3-nitropiridina-2-tiol 2-mercapto-3-nitropiridina foi preparada por tratamento de 3-nitro-2-cloro-piridina (50 g, 0,0317 mol) com tioureia (24 g, 0,0317mol) em 200 mL de etanol a refluxo durante várias horas. Após deixar a mistura reaccional arrefecer, juntaram-se 7,19 mL de solução de KOH (42,8 g em 115 mL de água) e a mistura resultante foi aquecida a refluxo durante 3 horas. A mistura reaccional em bruto foi arrefecida até temperatura ambiente e depois concentrada até 50% do seu volume sob vácuo. Após diluição com 300 mL de água, o produto foi isolado por filtração sob vácuo como um sólido laranja que foi utilizado sem purificação adicional. MS (DCI/NH3) m/z 157 (M+H)+. ΧΗ RMN (300 MHz, DMSO-de) δ 5,76 (m, 1H) , 7,67 (dd, J=8, 46, 4,78 Hz, 1H), 8,63 (dd, J=8, 46, 1, 47 Hz, 1H), 8,73 (dd, J=4,60, 1,65 Hz, 1H).3-nitropyridine was prepared by treatment of 3-nitro-2-chloropyridine (50 g, 0.0317 mol) with thiourea (24 g, 0.0317 mol) in methanol 200 mL of refluxing ethanol for several hours. After allowing the reaction mixture to cool, 7.19 mL of KOH solution (42.8 g in 115 mL of water) was added and the resulting mixture was heated to reflux for 3 hours. The crude reaction mixture was cooled to ambient temperature and then concentrated to 50% of its volume under vacuum. After dilution with 300 mL of water, the product was isolated by vacuum filtration as an orange solid which was used without further purification. MS (DCI / NH 3) m / z 157 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 5.76 (m, 1H), 7.67 (dd, J = 8.46, 4.78 Hz, 46, 1.47 Hz, 1H), 8.73 (dd, J = 4.60, 1.65 Hz, 1H).

Exemplo 98B 3-aminopiridina-2-sulfonamida O composto em titulo, (3-aminopirid-2-il)sulfonamida foi preparado em 3 passos (80% de rendimento) a partir de 2-mercapto-3-nitropiridina de acordo com o procedimento de R. Lejeune e colaboradores, como descrito em J. Pharm. Belg., 39, 217-224, 1984. MS (DCI/NH3) m/z 174 (M+H) + . XH RMN (300 MHz, DMSO-de) δ 6,00 (s, 2H) , 7,25 (m, 2H), 7,34 (s, 2H), 7,82 (dd, J=4,04, 1,47 Hz, 1H).Example 98B 3-Aminopyridine-2-sulfonamide The title compound, (3-aminopyrid-2-yl) sulfonamide was prepared in 3 steps (80% yield) from 2-mercapto-3-nitropyridine according to procedure of R. Lejeune et al., as described in J. Pharm. Belg., 39, 217-224, 1984. MS (DCI / NH 3) m / z 174 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6): δ 6.00 (s, 2H), 7.25 (m, 2H), 7.34 (s, 2H), 7.82 (dd, 1.47 Hz, 1H).

Exemplo 98C N- [2-(aminosulfonil)piridin-3-il]-l-butil-4-hidroxi-2-oxo-1,2-di-hidroquinolina-3-carboxamida O composto em titulo foi preparado de acordo com o procedimento do Exemplo 89B substituindo por 3-amino-piridina-2-sulfonamida a 2-amino-4-clorobenzenossulfonamida.Example 98C N- [2- (aminosulfonyl) pyridin-3-yl] -1-butyl-4-hydroxy-2-oxo-1,2-dihydroquinoline-3-carboxamide The title compound was prepared according to Example 89B substituting 3-amino-pyridine-2-sulfonamide for 2-amino-4-chlorobenzenesulfonamide.

Exemplo 98D l-butil-3-(1,l-dioxido-4H-pirido[3,2-e][1,2,4]tiadiazin-3-il)-4-hidroxi-2(1H)-quinolinona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do 151 ΕΡ 1 560 827/ΡΤExample 98D 1-Butyl-3- (1,1-dioxido-4 H -pyrido [3,2- e] [1,2,4] thiadiazin-3-yl) -4-hydroxy-2 (1H) -quinolinone O The title compound was prepared according to the procedure of Example 84D substituting the product of 151 ÅΡ¹ 560 827 / ΡΤ

Exemplo 98C ο produto do Exemplo 84C como um sólido branco (0, 065 g, 22%). MS (ESI-) m/z 397 (M-H) ; XH RMN (300 MHz, DMSO-de) δ 0,96 (t, J=7,35 Hz, 3H), 1,46 (m, 2H) , 1,66 (m, 2H), 4,34 (m, 2H) , 7,46 (t,J=7,54 Hz, 1H), 7,82 (m, 3H) , 8,23 (d, J= 6,99 Hz, 1H), 8,26 (d, J=7,72 Hz, 1H), 8,70 (d, J= 3,68 Hz, 1H), 14,38 (s, 1H), 15,12 (s, 1H).Example 98C The product of Example 84C as a white solid (0.065 g, 22%). MS (ESI-) m / z 397 (M-H); 1 H NMR (300 MHz, DMSO-d 6) δ 0.96 (t, J = 7.35 Hz, 3H), 1.46 (m, 2H), 1.66 (m, 2H), 4.34 , 7.46 (t, J = 7.54 Hz, 1 H), 7.82 (m, 3 H), 8.23 (d, J = 6.99 Hz, 1 H), 8.26 , J = 7.72 Hz, 1H), 8.70 (d, J = 3.68 Hz, 1H), 14.38 (s, 1H), 15.12 (s, 1H).

Exemplo 99 l-benzil-3-(1,l-dioxido-4H-pirido[3,2-e][1,2,4]tiadiazin-3-il)-4-hidroxi-2(1H)-quinollnonaExample 99 1-benzyl-3- (1,1-dioxido-4 H -pyrido [3,2-e] [1,2,4] thiadiazin-3-yl) -4-hydroxy-2 (1H) -quinollnone

Exemplo 99A l-benzil-4-hidroxi-2-oxo-1,2-dl-hidroqulnolina-3-carboxllato de etilo 0 composto em título foi preparado de acordo com o procedimento do Exemplo 84B substituindo por 1-benzil-lH-benzo[d][1,3]oxazina-2,4-diona o produto do Exemplo 15A.Example 99A Ethyl 1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinoline-3-carboxylate The title compound was prepared according to the procedure of Example 84B substituting 1-benzyl-1H-benzo [d] [1,3] oxazine-2,4-dione the product of Example 15A.

Exemplo 99B N-[2-(aminosulfonil)piridin-3-il]-l-benzil-4-hidroxi-2-oxo-1,2-di-hidroquinolina-3-carboxamida 0 composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 99A o produto do Exemplo 84B e substituindo por (3-amino-pirid-2-il)sulfonamida a 2-amino-5-bromobenzeno- sulfonamida, para gerar o produto em bruto como um sólido esbranquiçado.Example 99B N- [2- (aminosulfonyl) pyridin-3-yl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinoline-3-carboxamide The title compound was prepared according to Following the procedure of Example 84C substituting the product of Example 99A for the product of Example 84B and substituting 2-amino-5-bromobenzenesulfonamide for (3-amino-pyrid-2-yl) sulfonamide to give the crude product as a solid whitish.

Exemplo 99C l-benzil-3-(1,l-dioxido-4H-pirido[3,2-e][1,2,4]tiadiazin-3-il)-4-hidroxi-2(1H)-quinolinonaExample 99C 1-Benzyl-3- (1,1-dioxido-4H-pyrido [3,2-e] [1,2,4] thiadiazin-3-yl) -4-hydroxy-2 (1H) -quinolinone

0 composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 99B o produto do Exemplo 84C (0, 076 g, 38%). 1H RMN (300 MHz, DMSO-de) δ 5,64 (s, 2H), 7,29 (m, 5H) , 7,43 (m, J=1, 72, 7, 72 Hz, 1H), 7,54 (d, J=8,46 Hz, 1H) , 7,80 (m, 2H) , 8,23 (m, 2H), 8,69 (d, J=3,31 Hz, 1H). 152 ΕΡ 1 560 827/ΡΤThe title compound was prepared according to the procedure of Example 84D substituting the product of Example 99B for the product of Example 84C (0.076 g, 38%). 1 H NMR (300 MHz, DMSO-d 6) δ 5.64 (s, 2H), 7.29 (m, 5H), 7.43 (m, J = , 54 (d, J = 8.46 Hz, 1H), 7.80 (m, 2H), 8.23 (m, 2H), 8.69 (d, J = 3.31 Hz, 1H). 152 ΕΡ 1 560 827 / ΡΤ

Exemplo 100 l-benzil-3-(1,l-dioxido-4H-pirido[3,2—e][1,2,4]tiadiazin- 3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 100 1-Benzyl-3- (1,1-dioxido-4 H -pyrido [3,2-e] [1,2,4] thiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 100A N- [2-(aminosulfonil)piridin-3-il]-l-benzil-4-hidroxi-2-oxo-1,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por 3-amino-piridina- 2- sulfonamida a 2-amino-5-bromobenzenossulfonamida. MS (ESI-) m/z 452 (M+H)+. :Η RMN (300 MHz, DMSO-d6) δ 5,66 (s, 2H), 7,22 (m, 1H), 7,28 (m, 3H) , 7,43 (m, 1H), 7,70 (m, 3H), 8,52 (m, 2H), 8,77 (s, 3H), 12,56 (s, 1H), 16,34 (s, 1H).Example 100A N- [2- (aminosulfonyl) pyridin-3-yl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 3-amino-pyridine-2-sulfonamide for 2-amino-5-bromobenzenesulfonamide. MS (ESI-) m / z 452 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 5.66 (s, 2H), 7.22 (m, 1H), 7.28 (m, 3H), 7.43 (m, 1H) 70 (m, 3H), 8.52 (m, 2H), 8.77 (s, 3H), 12.56 (s, 1H), 16.34 (s, 1H).

Exemplo 100B l-benzil-3-(1,l-dioxido-4H-pirido[3,2-e][1,2,4]tiadiazin- 3- il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 100A o produto do Exemplo 84C para gerar após purificação por HPLC em fase inversa (gradiente de água/acetonitrilo/0,1% NH4OAc) o composto em título como um sólido branco (0,053 g, 10%). MS (ESI-) m/z 432 (M-H) ; RMN (300 MHz, DMSO-de) δ 5,70 (m, 2H) , 7,25 (m, 7H) , 7,50 (dd, J=7,91, 4,60 Hz, 1H), 7,80 (dd, J=8,46, 4,41 Hz, 1H) , 8,17 (d, J=8,46 Hz, 1H), 8,60 (m, J=5, 79, 1, 88, 1, 88 Hz, 1H), 8,68 (dd, J=4,41, 1,10 Hz, 1H), 8,82 (dd, J=4, 78, 1,84 Hz, 1H) .Example 100B 1-benzyl-3- (1,1-dioxido-4H-pyrido [3,2-e] [1,2,4] thiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 100A for the product of Example 84C to give after purification by reverse phase HPLC (gradient of water / acetonitrile / 0.1% NH4OAc) the title compound as a white solid (0.053 g, 10%). MS (ESI-) m / z 432 (M-H); NMR (300 MHz, DMSO-d 6) δ 5.70 (m, 2H), 7.25 (m, 7H), 7.50 (dd, J = 7.91, 4.60 Hz, (Dd, J = 8.46, 4.41 Hz, 1 H), 8.17 (d, J = 8.46 Hz, 1 H), 8.60 (m, 1.88 Hz, 1H), 8.68 (dd, J = 4.41, 1.10 Hz, 1H), 8.82 (dd, J = 4.78, 1.84 Hz, 1H).

Exemplo 101 5-cloro-3-(1,l-dioxido-4H-pirido[3,2-e][1,2,4]tiadiazin-3-il)- 4-hidroxi-l-(3-metilbutil)-2(1H)-guinolinonaExample 101 5-chloro-3- (1,1-dioxido-4 H -pyrido [3,2- e] [1,2,4] thiadiazin-3-yl) -4-hydroxy-1- (3-methylbutyl) -2 (1H) -guinolinone

Exemplo 101A 5-cloro-2H-3, l-benzoxazina-2, 4(1H)-dionaExample 101A 5-Chloro-2H-3,1-benzoxazine-2,4 (1H) -dione

Uma solução de hidróxido de potássio (1,68 g, 30 mmol) e ácido 2-amino-6-clorobenzóico (3,43 g, 20 mmol) em água (25 mL) a 0°C foi tratada gota a gota com 20% de fosgénio em tolueno (16,8 mL, 32 mmol) resultando um precipitado. A mistura foi agitada durante 1 hora e o sólido foi recolhido 153 ΕΡ 1 560 827/ΡΤ por filtração, lavado com água e seco para gerar o composto em título (3,6 g, 91%). ΧΗ RMN (300 MHz, DMSO-d6) δ 7,11 (d, J=7,35 Hz, 1H), 7,31 (d, J= 6,99 Hz, 1H), 7,66 (t, J=8,09 Hz, 1H), 11,83 (s, 1H).A solution of potassium hydroxide (1.68 g, 30 mmol) and 2-amino-6-chlorobenzoic acid (3.43 g, 20 mmol) in water (25 mL) at 0 ° C was treated dropwise with 20% % phosgene in toluene (16.8 mL, 32 mmol) resulting in a precipitate. The mixture was stirred for 1 hour and the solid was collected by filtration, washed with water and dried to give the title compound (3.6 g, 91%). 1 H NMR (300 MHz, DMSO-d 6) δ 7.11 (d, J = 7.35 Hz, 1H), 7.31 (d, J = 6.99 Hz, 1H), 7.66 (t, J = = 8.09 Hz, 1H), 11.83 (s, 1H).

Exemplo 101B 5-cloro-l-(3-metilbutil)-2H-3,l-benzoxazina-2, 4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por l-bromo-3-metilbutano o brometo de n-butilo e substituindo pelo produto do Exemplo 101A o produto do Exemplo IA (0,610 g, 45%). MS (DCI) m/z 285 (M+NH4) + .Example 101B 5-Chloro-1- (3-methylbutyl) -2H-3,1-benzoxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting 1-bromo- 3-methylbutane and n-butyl bromide and substituting the product of Example 101A for the product of Example 1A (0.610 g, 45%). MS (DCI) m / z 285 (M + NH 4) +.

Exemplo 101C 5-cloro-4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidroquinolina-3-carboxilato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 89A substituindo pelo produto do Exemplo 101B o produto do Exemplo 1B (0, 600 g, 80%). XH RMN (300 MHz, DMSO-de) δ 0,96 (d, J=6,62 Hz, 6H), 1,32 (t, J=7, 17 Hz, 3H), 1,44 (m, 2H), 1,70 (m, J=13,24, 6,62 Hz, 1H), 4,18 (m, 2H), 4,35 (q, J=6,99 Hz, 2H), 7,35 (d, J= 6,99 1H), 7,48 (d, J=8,09 Hz, 1H), 7,67 (m, 1H) , 13,88 (s, 1H) .Example 101C Ethyl 5-chloro-4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydroquinoline-3-carboxylate The title compound was prepared according to the procedure of Example 89A substituting by the product of Example 101B the product of Example 1B (0.600 g, 80%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.96 (d, J = 6.62 Hz, 6H), 1.32 (t, J = 7.17 Hz, 3H) ), 1.70 (m, J = 13.24, 6.62 Hz, 1H), 4.18 (m, 2H), 4.35 (q, J = 6.99 Hz, 2H), 7.35 (d, J = 6.99H), 7.48 (d, J = 8.09Hz, 1H), 7.67 (m, 1H), 13.88 (s, 1H).

Exemplo 101D N- [2-(aminosulfonil)piridin-3-il]-5-cloro-4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidroquinolina-3-carboxamida O produto do Exemplo 101C (0,170 g, 0,50 mmol) reagiu com o produto do Exemplo 98A (0,086 g, 0,50 mmol) em tolueno (6 mL) a refluxo durante 16 horas. A reacção foi arrefecida e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em título (0,200 g, 86%). MS (DCI) m/z 465 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ 0,99 (d, J= 6,62 Hz, 6H), 1,51 (m, 2H), 1,76 (m, 1H), 4,32 (m, 2H), 7,45 (d,J=7,35 Hz, 1H), 7,61 (d, J= 8,82 Hz, 1H) , 7,71 (s, 2H) , 7,7,7 (m, 2H) , 8,45 (dd, J=8, 46, 1,47 Hz, 1H), 8,53 (dd,J=4,60, 1,29 Hz, 1H), 12,84 (s, 1H), 17,22 (s, 1H). 154 ΕΡ 1 560 827/ΡΤExample 101D N- [2- (aminosulfonyl) pyridin-3-yl] -5-chloro-4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydroquinoline-3-carboxamide The product of Example 101C (0.170 g, 0.50 mmol) was reacted with the product of Example 98A (0.086 g, 0.50 mmol) in toluene (6 mL) at reflux for 16 hours. The reaction was cooled and the resulting precipitate was collected by filtration and dried to give the title compound (0.200 g, 86%). MS (DCI) m / z 465 (M + H) +. 1 H NMR (300 MHz, DMSOd 6) δ 0.99 (d, J = 6.62 Hz, 6H), 1.51 (m, 2H), 1.76 (m, 1H), 4.32 , 7.45 (d, J = 7.35 Hz, 1H), 7.61 (d, J = 8.82 Hz, 1H), 7.71 (s, 2H), 7.7-7 (m, 2H), 8.45 (dd, J = 8.46, 1.47 Hz, 1H), 8.53 (dd, J = 4.60, 1.29 Hz, 1H), 12.84 (dd, s, 1H), 17.22 (s, 1H). 154 ΕΡ 1 560 827 / ΡΤ

Exemplo 101Ε 5-cloro-3-(1,l-dioxido-4H-pirido[3,2-e][1,2,4]tiadiazin-3-il)- 4-hidroxi-l-(3-metilbutil)-2(1H)-quinolinona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 101D o produto do Exemplo 84C (0,200 g, 98%). MS (ESI-) m/z 445 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ 0,98 (d, J= 6,62 Hz, 6H), 1,45 (m, 2H), 1,71 (m, 1H), 4,11 (m, 2H), 7,08 (d, J=7,35 Hz, 1H), 7,23 (d, J=8,09 Hz, 1H), 7,43 (t, J=8,27 Hz, 1H), 7,57 (dd, J=8,46, 4,41 Hz, 1H), 7,78 (d, J=8,09 Hz, 1H), 8,45 (d, J=4,41 Hz, 1H), 15,77 (s, 1H).Example 101 and 5-Chloro-3- (1,1-dioxido-4 H -pyrido [3,2-e] [1,2,4] thiadiazin-3-yl) -4-hydroxy-1- (3-methylbutyl) -2 (1H) -quinolinone The title compound was prepared according to the procedure of Example 84D substituting the product of Example 101D for the product of Example 84C (0.200 g, 98%). MS (ESI-) m / z 445 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ0.98 (d, J = 6.62 Hz, 6H), 1.45 (m, 2H), 1.71 (m, 1H), 4.11 1H), 7.23 (d, J = 8.09 Hz, 1H), 7.43 (t, J = 8.27 Hz, 1H), 7.08 (d, (D, J = 8.09 Hz, 1 H), 8.45 (d, J = 4.41 Hz), 7.57 (dd, J = 8.46, 4.41 Hz, , 1H), 15.77 (s, 1H).

Exemplo 102 l-benzil-3-(1,l-dioxido-4H-pirido[3,2-e][1,2,4]tiadiazin-3-il)hidroxi-5-metil-2(1H)-quinolinonaExample 102 1-Benzyl-3- (1,1-dioxido-4 H -pyrido [3,2- e] [1,2,4] thiadiazin-3-yl) hydroxy-5-methyl-2 (1H) -quinolinone

Exemplo 102A 1-benzil-(4-metil)benzo[2,3-d][1,3]oxazina-2,4-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por brometo de benzilo o brometo de n-butilo e substituindo por (4-metil)benzo-[2,3-d][1,3]oxazina-2,4-diona o produto do Exemplo IA (0,67 g, 60%). MS (DCI +) m/z 268 (M+H)'; :H RMN (300 MHz, DMSO-d6) δ 2,66 (s, 3H), 5,28 (s, 2H) , 7,07 (d, J=8,48 Hz, 1H) , 7,14 (d, J=7,80 Hz, 1H), 7,33 (m, 5H) , 7,57 (t, J=7,46 Hz, 1H) .Example 102A 1-benzyl- (4-methyl) benzo [2,3-d] [1,3] oxazine-2,4-dione The title compound was prepared according to the procedure of Example 1B substituting benzyl bromide (4-methyl) benzo [2,3-d] [1,3] oxazine-2,4-dione The product of Example 1A (0.67 g, 60%). MS (DCI +) m / z 268 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 2.66 (s, 3H), 5.28 (s, 2H), 7.07 (d, J = 8.48 Hz, 1H), 7.14 ( d, J = 7.80 Hz, 1H), 7.33 (m, 5H), 7.57 (t, J = 7.46 Hz, 1H).

Exemplo 102B l-benzil-4-hidroxi-5-metil-2-oxo-l,2-di-hidroguinolina-3-carboxilato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 84A substituindo pelo produto do Exemplo 102A o produto do Exemplo 15A (0,71 g, 89%). MS (DCI+) m/z 338 (M+H) ; XH RMN (300 MHz, DMSO-d6) δ 1,33 (t, J=7,17 Hz, 3H), 2,77 (s, 3H), 4,39 (q, J=7,23 Hz, 2H) , 5,47 (s, 2H) , 7,05 (d, J=7,35 Hz, 1H), 7,20 (m, 4H) , 7,31 (m, 2H) , 7,47 (t, J= 8,09 Hz, 1H), 14,43 (s, 1H) . 155Example 102B Ethyl 1-benzyl-4-hydroxy-5-methyl-2-oxo-1,2-dihydroguinoline-3-carboxylate The title compound was prepared according to the procedure of Example 84A substituting the product of Example 102A the product of Example 15A (0.71 g, 89%). MS (DCI +) m / z 338 (M + H); 1 H NMR (300 MHz, DMSO-d 6) δ 1.33 (t, J = 7.17 Hz, 3H), 2.77 (s, 3H), 4.39 (q, J = 7.23 Hz, 2H ), 5.47 (s, 2H), 7.05 (d, J = 7.35 Hz, 1H), 7.20 (m, 4H), 7.31 (m, 2H), 7.47 (t , J = 8.09 Hz, 1H), 14.43 (s, 1H). 155

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 102C 17-[2-(aminosulfonil)piridin-3-il]-l-benzil-4-hidroxi-5-metil- 2-oxo-1,2-di-hidroquinolina-3-carboxamida 0 composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 102b o produto do Exemplo 84B e substituindo pelo produto do Exemplo 98A a 2-amino-5-bromobenzenossulfonamida (0,163 g, 41%). MS (ESI +) m/z 465 (M+H) } XH RMN (300 MHz, DMSO-d6) δ 2,82 (s, 3H), 5,59 (s, 2H) , 7,15 (d, J=7,35 Hz, 1H), 7,24 (m, 3H) , 7,33 (m, 3H) , 7,56 (t, J=7,91 Hz, 1H) , 7,72 (m, 3H), 8,51 (m, 1H), 8,53 (s, 1H), 12,93 (s, 1H), 17,16 (m, 1H).Example 102C 17- [2- (aminosulfonyl) pyridin-3-yl] -1-benzyl-4-hydroxy-5-methyl-2-oxo-1,2-dihydroquinoline-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting the product of Example 102b for the product of Example 84B and substituting the product of Example 98A for 2-amino-5-bromobenzenesulfonamide (0.163 g, 41%). NMR (300 MHz, DMSO-d 6) δ 2.82 (s, 3H), 5.59 (s, 2H), 7.15 (d, J = 7.35 Hz, 1H), 7.24 (m, 3H), 7.33 (m, 3H), 7.56 (t, J = 7.91 Hz, 3H), 8.51 (m, 1H), 8.53 (s, 1H), 12.93 (s, 1H), 17.16 (m, 1H).

Exemplo 102D l-benzil-3-(1,l-dioxido-4H-pirido[3,2-e][1,2,4]tiadiazin- 3-il)-4-hidroxi-5-metil-2(1H)-quinolinonaExample 102D 1-benzyl-3- (1,1-dioxido-4H-pyrido [3,2-e] [1,2,4] thiadiazin-3-yl) -4-hydroxy-5-methyl-2- (1H ) -quinolinone

0 composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 102C o produto do Exemplo 84C (0,064 g, 41%). MS (ESI+) m/z 447 (M+H)-. 0 sal de sódio do composto em títuloThe title compound was prepared according to the procedure of Example 84D substituting the product of Example 102C for the product of Example 84C (0.064 g, 41%). MS (ESI +) m / z 447 (M + H) -. The sodium salt of the title compound

foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI- -) m/z 445 (M- ΗΓ; XH RMN (300 MHz, DMSO- -de) δ 2,81 (s, 3H), 5,37 (dd, J= 6, 07, 2,02 Hz, 2H), 6,80 (d, J=7,35 Hz, 1H), 6,95 (d, J=8,09 Hz, 1H), 7,20 (m, 4H), 7,29 (m, 2H), 7,57 (dd, J=8,46, 4,41 Hz, 1H) , 7, 75 (dd, J= 8,46, 1, 47 Hz, 1H), 8, 44 (dd, J=4,41, 1 ,47 Hz, 1H), 16,29 (s, 1H) .was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6): δ 2.81 (s, 3H), 5.37 (dd, J = 6.07, 2H), 6.80 (d, J = 7.35 Hz, 1H), 6.95 (d, J = 8.09 Hz, 1H), 7.20 (m, 4H), 7.29 (m, 2H), 7.57 (dd, J = 8.46, 4.41 Hz, 1H), 7.75 (dd, J = 8.46, 1.47 Hz, 1H), 8.44 ( dd, J = 4.41, 1.47 Hz, 1H), 16.29 (s, 1H).

Exemplo 103 3- (1,l-dioxido-4H-pirido[3,2-e][1,2,4]tiadiazin-3-il)- 4- hidroxi-l-[(2-metil-l,3-tiazol-5-il)metil]-2(1H)-quinolinonaExample 103 3- (1,1-dioxido-4 H -pyrido [3,2-e] [1,2,4] thiadiazin-3-yl) -4-hydroxy-1 - [(2-methyl-1,3 thiazol-5-yl) methyl] -2 (1H) -quinolinone

Exemplo 103A 1- [ (2-metil-l, 3-tiazol-5-il)metil] -2H-3, l-benzoxazina-2, 4 (liJ) — diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo ou anidrido isatóico o produto do Exemplo IA e por 2-metil-5-clorometiltiazole o brometo de n-butilo, para gerar (0,410 g, 73%). 156 ΕΡ 1 560 827/ΡΤExample 103A 1 - [(2-methyl-1,3-thiazol-5-yl) methyl] -2H-3,1-benzoxazine-2,4 (1 H) -dione The title compound was prepared according to procedure of Example 1B substituting isatoic anhydride for the product of Example 1A and 2-methyl-5-chloromethylthiazole and n-butyl bromide to give (0.410 g, 73%). 156 ΕΡ 1 560 827 / ΡΤ

Exemplo 103Β 1-[(2-metil-l,3-tiazol-5-il)metil]-2,4-dioxo-l, 2,3,4-tetra-hidroquinolina-3-carboxilato de etllo O composto em título foi preparado de acordo com o procedimento do Exemplo 84A substituindo pelo produto do Exemplo 103A o produto do Exemplo 15B (0,132 g, 25%). MS (ESI-) m/z 343 (M-H) “; RMN (300 MHz, CDC13) δ 1,49 (t, J= 6,99 Hz, 3H), 2,61 (s, 3H) , 4,53 (q, J=7,23 Hz, 2H) , 5,54 (s, 2H), 7,27 (t, J=8,09 Hz, 1H) , 7,41 (d, J=8,46 Hz, 1H) , 7,62 (s, 1H), 7,67 (m, 1H) , 8,21 (dd, J=8, 09, 1, 47 Hz, 1H) , 14,32 (s, 1H).EXAMPLE 103 Ethyl 1 - [(2-methyl-1,3-thiazol-5-yl) methyl] -2,4-dioxo-1,2,3,4-tetrahydroquinoline-3-carboxylate The title compound was prepared according to the procedure of Example 84A substituting the product of Example 103A for the product of Example 15B (0.132 g, 25%). MS (ESI-) m / z 343 (M-H); NMR (300 MHz, CDCl 3) δ 1.49 (t, J = 6.99 Hz, 3H), 2.61 (s, 3H), 4.53 (q, J = 7.23 Hz, 2H), 5. , 7.41 (d, J = 8.46 Hz, 1 H), 7.62 (s, 1 H), 7.6 (s, 2H), 7.27 (t, , 67 (m, 1H), 8.21 (dd, J = 8.9, 1.47 Hz, 1H), 14.32 (s, 1H).

Exemplo 103C N- [2-(aminosulfonil)piridin-3-il]-1-[(2-metil-l,3-tiazol-5-il)-metil]-2;4-dioxo-l,2,3,4-tetra-hidroquinolina-3-carboxamida O composto em título foi preparado como descrito no procedimento do Exemplo 84C substituindo pelo produto do Exemplo 99A o produto do Exemplo 84B e substituindo por 3-amino-piridina-2-sulfonamida a 2-amino-5-bromobenzeno-sulfonamida (0,148 g, 79%). MS (APCI) m/z 472 (M+H) + . ΧΗ RMN (300 MHz, DMSO-d6) δ 2,55 (s, 3H) , 5,69 (s, 2H), 7,25 (m, 1H), 7,35 (S, 1H), 7,42 (t, J=6,62 Hz, 1H), 7,81 (m, 4H), 8,17 (d, J=7, 72 Hz, 1H), 8,52 (d, J=2,57 Hz, 1H), 8,54 (s, 1H) , 12,67 (s, 1H), 16,28 (s, 1H).Example 103C N- [2- (aminosulfonyl) pyridin-3-yl] -1 - [(2-methyl-1,3-thiazol-5-yl) methyl] -2,4-dioxo- , 4-tetrahydroquinoline-3-carboxamide The title compound was prepared as described in the procedure of Example 84C substituting the product of Example 99A for the product of Example 84B and substituting 2-amino-3-amino-pyridine-2-sulfonamide -5-bromobenzenesulfonamide (0.148 g, 79%). MS (APCI) m / z 472 (M + H) +. Δ NMR (300 MHz, DMSO-d 6) δ 2.55 (s, 3H), 5.69 (s, 2H), 7.25 (m, 1H), 7.35 (s, 1H), 7.42 (d, J = 7.72 Hz, 1H), 8.52 (d, J = 2.57 Hz, 1H), 7.81 (m, , 1H), 8.54 (s, 1H), 12.67 (s, 1H), 16.28 (s, 1H).

Exemplo 103D 3- (1,l-dioxido-4H-pirido[3,2-e][1,2,4]tiadiazin-3-il)- 4- hidroxi-l-[(2-metil-l,3-tiazol-5-il)metil]-2(1H)-quinolinonaExample 103D 3- (1,1-dioxido-4 H -pyrido [3,2-e] [1,2,4] thiadiazin-3-yl) -4-hydroxy-1 - [(2-methyl-1,3 thiazol-5-yl) methyl] -2 (1H) -quinolinone

O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 103C o produto do Exemplo 84C (0, 033 g, 68%). MS (APCI) m/z 454 (M+H)\ XH RMN (300 MHz, DMSO-d6) δ 2,56 (s, 3H), 5,74 (s, 2H), 7,48 (t, J=6,80 Hz, 1H) , 7,82 (s, 1H), 7,88 (m, 4H), 8,24 (m, 2H), 8,71 (dd, J=4,41, 1,47 Hz, 1H), 14,01 (s, 1H).The title compound was prepared according to the procedure of Example 84D substituting the product of Example 103C for the product of Example 84C (0.033 g, 68%). 1 H NMR (300 MHz, DMSO-d 6) δ 2.56 (s, 3H), 5.74 (s, 2H), 7.48 (t, J = 1H), 7.88 (m, 4H), 8.24 (m, 2H), 8.71 (dd, J = 4.41, 47 Hz, 1H), 14.01 (s, 1H).

Exemplo 104 l-benzil-4-hidroxi-3-(7-metil-l,l-dioxido-4H-pirido[2,3-e]-[1,2,4]tiadiazin-3-il)-2(1H)-quinolinona 157 ΕΡ 1 560 827/ΡΤExample 104 1-benzyl-4-hydroxy-3- (7-methyl-1,1-dioxido-4 H -pyrido [2,3- e] - [1,2,4] thiadiazin-3-yl) -2- 1H) -quinolinone 157 ΕΡ 1 560 827 / ΡΤ

Exemplo 104Α cloreto de (2-amlno-5-metilpirid-3-il)sulfonilo O cloreto de (2-amino-5-metilpirid-3-il)sulfonilo foi preparado a partir de 2-amino-5-picolina pelo método descrito por Weller, H.N. em US 5, 378, 704. XH RMN (300 MHz, DMSO-d6) δ 2,20 (s, 3H) , 7,70 (br s, 2H) , 7,85 (d, J= 5,52 Hz, 1H) , 8,07 (d, J=2,21 Hz, 1H) .Example 104 (2-amino-5-methylpyrid-3-yl) sulfonyl chloride (2-Amino-5-methylpyrid-3-yl) sulfonyl chloride was prepared from 2-amino-5-picoline by the method described by Weller, HN in US 5, 378, 704. 1 H NMR (300 MHz, DMSOd 6) δ 2.20 (s, 3H), 7.70 (br s, 2H), 7.85 (d, J = 5.52 Hz, 1H), 8.07 (d, J = 2.21 Hz, 1H).

Exemplo 104B 2-amino-5-metilpiridina-3-sulfonamida O produto do Exemplo 104A reagiu com hidróxido de amónio concentrado a temperatura ambiente de um dia para o outro. A mistura reaccional foi concentrada para gerar o composto em titulo como um sólido amarelo claro em rendimento quantitativo. MS (DCI/NH3) m/z 188 (M+H) + . XH RMN (300 MHz, DMSO-d6) δ 2,17 (m, 3H), 6,28 (s, 2H), 7,43 (s, 2H), 7,70 (d, J=l,84 Hz, 1H), 8,00 (d, J=2,21 Hz, 1H).Example 104B 2-Amino-5-methylpyridine-3-sulfonamide The product of Example 104A was reacted with concentrated ammonium hydroxide at room temperature overnight. The reaction mixture was concentrated to give the title compound as a pale yellow solid in quantitative yield. MS (DCI / NH 3) m / z 188 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 2.17 (m, 3H), 6.28 (s, 2H), 7.43 (s, 2H), 7.70 (d, J = , 1H), 8.00 (d, J = 2.21 Hz, 1H).

Exemplo 104C N- [3-(aminosulfonil)-5-metilpiridin-2-il]-l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolina-3-carboxamida O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 104B a 2-amino-5-bromobenzenossulfonamida.Example 104C N- [3- (aminosulfonyl) -5-methylpyridin-2-yl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinoline-3-carboxamide The title compound was prepared from according to the procedure of Example 84C substituting 2-amino-5-bromobenzenesulfonamide for the product of Example 104B.

Exemplo 104D l-benzil-4-hidroxi-3-(7-metil-l,l-dioxido-4H-pirido[2,3-e]-[1,2,4]tiadiazin-3-il)—2(1H)-quinolinona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 104C o produto do Exemplo 84C (0,20 g, 35%). XH RMN (300 MHz, DMSO-de) δ 3,32 (m, 3H) , 5,45 (s, 2H), 5,97 (s, 1H), 7,22 (m, 9H), 7,50 (m, 1H), 7,91 (dd, J=7,91, 1,65 Hz, 1H) , 11,50 (m, 1H) . O sal de sódio do composto em titulo foiExample 104D 1-Benzyl-4-hydroxy-3- (7-methyl-1,1-dioxido-4 H -pyrido [2,3- e] - [1,2,4] thiadiazin-3-yl) -2- 1H) -quinolinone The title compound was prepared according to the procedure of Example 84D substituting the product of Example 104C for the product of Example 84C (0.20 g, 35%). 1 H NMR (300 MHz, DMSO-d 6) δ 3.32 (m, 3H), 5.45 (s, 2H), 5.97 (s, 1H), 7.22 (m, 9H), 7.50 (m, 1H), 7.91 (dd, J = 7.91, 1.65 Hz, 1H), 11.50 (m, 1H). The sodium salt of the title compound was

preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ 2,37 (m, 3H) , 5,39 (m, 2H) , 7,07 (m, 1H), 158 ΕΡ 1 560 827/ΡΤ 7,24 (m, 6Η), 7,39 (m, 1Η), 7,94 (d, J=l,47 Hz, 1H), 8,13 (dd, J=7,91, 1,65 Hz, 1H), 8,43 (d, J=l,84 Hz, 1H), 16,49 (m, 1H) .prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.37 (m, 3H), 5.39 (m, 2H), 7.07 (m, 1H), 158 Å ¥ 1 560 827 / ΡΤ 7.24 (m 1H), 8.13 (dd, J = 7.91, 1.65 Hz, 1 H), 8.47 (d, J = , 43 (d, J = 1.84 Hz, 1H), 16.49 (m, 1H).

Exemplo 105 l-butil-4-hidroxi-3-(7-metll-l,l-dioxido-4H-pirido[2,3-e]-[1,2,4]tiadiazin-3-il)-1,8-naftiridin-2(1H)-onaExample 105 1-Butyl-4-hydroxy-3- (7-methyl-1,1-dioxido-4 H -pyrido [2,3- e] - [1,2,4] thiadiazin-3-yl) 8-naphthyridin-2 (1H) -one

Exemplo 105A 3-{[3-(aminosulfonil)-5-metilpiridin-2-il]amino}-3-oxopropanoato de etilo O produto do Exemplo 104B (1,0 g, 0,0053 mol) em 10 mL de THF contendo 5 mL de piridina foi tratado com 3-cloro-3-oxopropionato de etilo (0,97 g, 0,0064 mol) a temperatura ambiente durante várias horas. A mistura reaccional foi concentrada a metade do seu volume original e depois diluída com água. O precipitado resultante foi recolhido por filtração e lavado com água e seco sob vácuo para gerar o composto em título como um sólido esbranquiçado (1,19 g, 75% de rendimento). MS (ESI) m/z 300 (M-H)'. XH RMN (300 MHz, DMSO-d6) δ 1,19 (t, J=7,17 Hz, 3H) , 2,35 (s, 3H), 3,65 (s, 2H) , 4,11 (q, J=1,23 Hz, 2H), 7,60 (s, 2H), 8,06 (d, J=l,47 Hz, 1H), 8,41 (d,J=l, 84 Hz, 1H), 9,79 (s, 1H) .Ethyl 3 - {[3- (aminosulfonyl) -5-methylpyridin-2-yl] amino} -3-oxopropanoate The product of Example 104B (1.0 g, 0.0053 mol) in 10 mL of THF containing 5 mL of pyridine was treated with ethyl 3-chloro-3-oxopropionate (0.97 g, 0.0064 mol) at room temperature for several hours. The reaction mixture was concentrated to half its original volume and then diluted with water. The resulting precipitate was collected by filtration and washed with water and dried under vacuum to give the title compound as an off-white solid (1.19 g, 75% yield). MS (ESI) m / z 300 (M-H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 1.19 (t, J = 7.17 Hz, 3H), 2.35 (s, 3H), 3.65 (s, 2H), 4.11 J = 1.23 Hz, 2H), 7.60 (s, 2H), 8.06 (d, J = 1.47 Hz, 1H), 8.41 (d, J = 1.84 Hz, 1H ), 9.79 (s, 1H).

Exemplo 105C (7-metil-l,l-dioxido-4H-pirido[2,3-e][1,2,4]tiadiazin-3-il)- acetato de etilo O produto do Exemplo 105A (0,363 g, 0,0012 mol) em 20 mL de etanol reagiu com carbonato de sódio (0,350 g, 0,0033 mol). A mistura reaccional foi aquecida a refluxo durante 2 horas. Após arrefecimento, a mistura reaccional foi diluída com diclorometano, filtrada para remover o excesso de carbonato de sódio e concentrada. O resíduo foi purificado por cromatografia em sílica gel com acetato de etilo em hexanos (1:1) seguido de 4% de metanol em diclorometano como fase móvel, para gerar o composto em título como um sólido branco (0,296 g, 87% de rendimento). MS (ESI) m/z 282 (M-H)'; XH RMN (300 MHz, DMSO-d6) δ 1,21 (t, J=6,99 Hz, 3H) , 2,40 (s, 3H) , 3,73 (s, 2H) , 4,15 (q, J=7,11 Hz, 2H), 8,20 (s, 1H), 8,58 (d, J=l,84 Hz, 1H) , 12, 79 (s, 1H) . 159 ΕΡ 1 560 827/ΡΤThe product from Example 105A (0.363 g, 0.6 mmol) was dissolved in dichloromethane , 0.001 mol) in 20 mL of ethanol was reacted with sodium carbonate (0.350 g, 0.0033 mol). The reaction mixture was heated at reflux for 2 hours. After cooling, the reaction mixture was diluted with dichloromethane, filtered to remove excess sodium carbonate and concentrated. The residue was purified by silica gel chromatography with ethyl acetate in hexanes (1: 1) followed by 4% methanol in dichloromethane as the mobile phase to give the title compound as a white solid (0.296 g, 87% yield ). MS (ESI) m / z 282 (M-H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.21 (t, J = 6.99 Hz, 3H), 2.40 (s, 3H), 3.73 (s, 2H), 4.15 , J = 7.11 Hz, 2H), 8.20 (s, 1H), 8.58 (d, J = 1.84 Hz, 1H), 12.79 (s, 1H). 159 ΕΡ 1 560 827 / ΡΤ

Exemplo 105D l-butil-4-hidroxi-3-(7-metil-l,l-dioxido-4H-pirido[2,3-e]-[1,2,4]tiadiazin-3-il)-1,8-naftlrldln-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 105C o produto do Exemplo 1C (0,065 g, 58% de rendimento). 1R RMN (300 MHz, DMSO-d6) δ 0,94 (t, J= 7,35 Hz, 3H), 1,40 (m, 2H), 1,67 (m, 2H), 2,44 (m, 3H) , 4,46 (dd, J=7,91, 7,17 Hz, 2H) , 7,48 (dd, J=8, 09, 4, 78 Hz, 1H) , 8,29 (s, 1H), 8,56 (dd, J=7,91, 1,65 Hz, 1H) , 8,64 (d, J=l,47 Hz, 1H), 8,87 (d, J=5,52 Hz, 1H). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. :H RMN (300 MHz, DMSO-d6) δ 0,93 (t, J=7,35 Hz, 3H) , 1,34 (m, 2H), 1,58 (m, 2H), 2,36 (s, 3H), 4,26 (d, J=7,72 Hz, 1H), 4,29 (d, J=6,99 Hz, 1H), 7,13 (dd, J=7, 72, 4, 78 Hz, 1H) , 7,95 (s, 1H), 8,37 (dd, J=7,72, 2,21 Hz, 1H), 8,42 (d, J=l,84 Hz, 1H), 8,53 (dd, J=4, 60, 2,02 Hz, 1H) , 16,11 (s, 1H) .Example 105D 1-Butyl-4-hydroxy-3- (7-methyl-1,1-dioxido-4H-pyrido [2,3- e] - [1,2,4] thiadiazin-3-yl) 8-naphthylidene-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 105C for the product of Example 1C (0.065 g, 58% yield). 1 H NMR (300 MHz, DMSO-d 6) δ0.94 (t, J = 7.35 Hz, 3H), 1.40 (m, 2H), 1.67 (m, 2H), 2.44 (Dd, J = 8.97, 4.78 Hz, 1 H), 8.29 (s, 1H), 8.56 (dd, J = 7.91, 1.65 Hz, 1H), 8.64 (d, J = 1.47 Hz, 1H), 8.87 (d, J = 5.52 Hz, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ0.93 (t, J = 7.35 Hz, 3H), 1.34 (m, 2H), 1.58 (m, 2H), 2.36 (d, J = 7.72 Hz, 1 H), 4.29 (d, J = 6.99 Hz, 1 H), 7.13 (dd, J = 7, 72.4 1H), 8.95 (s, 1H), 8.37 (dd, J = 7.72, 2.21 Hz, 1H), 8.42 (d, J = 1.84 Hz, 1H) ), 8.53 (dd, J = 4.60, 2.02 Hz, 1H), 16.11 (s, 1H).

Exemplo 106 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(2-tienilmetil)-1,8-naftiridin-2(1H)-onaExample 106 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (2-thienylmethyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 106A 1-(tien-2-ilmetil)-2fl-pirido[2,3-d] [1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 2-(bromometil)-tiofeno o brometo de n-butilo (0,165 g, 51%). ΧΗ RMN (300 MHz, DMSO-d6) δ 5,48 (s, 2H), 6,97 (dd, J=5,15, 3,31 Hz, 1H), 7,21 (d, J= 3,31 Hz, 1H), 7,43 (m, 2H) , 8,41 (dd, J=7, 72, 1, 84 Hz, 1H), 8,83 (dd, J=5,15, 1,84 Hz, 1H).Example 106A 1- (thien-2-ylmethyl) -2'-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting 2- (bromomethyl) thiophene and n-butyl bromide (0.165 g, 51%). 1 H NMR (300 MHz, DMSOd 6) δ 5.48 (s, 2H), 6.97 (dd, J = 5.15, 3.31 Hz, 1H), 7.21 (d, J = 1H), 7.43 (m, 2H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.83 (dd, J = 5.15, 1.84 Hz, 1H).

Exemplo 106B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)hidroxi-1-(2-tienilmetil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 106A o produto do Exemplo 1B (0,162 g, 60%). MS (ESI-) m/z 437 (M-H) . O sal de sódio do composto em título foiExample 106B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) hydroxy-1- (2-thienylmethyl) -1,8-naphthyridin-2 (1H) The title compound was prepared according to the procedure of Example 1D substituting the product of Example 106A for the product of Example 1B (0.162 g, 60%). MS (ESI-) m / z 437 (M-H). The sodium salt of the title compound was

preparado de acordo com o procedimento do Exemplo 1D. XH RMN 160 ΕΡ 1 560 827/ΡΤ (300 MHz, DMSO-dç) δ 5,64 (s, 2H) , 6,90 (m, J=5,15, 3,68 Hz, 1H), 7, 11 (m, J=3,49, 0,92 Hz, 1H) oo \—1 Γ- (dd, J=7, 72, 4,78 Hz, 1H), 7,29 (m, 3H), 7,56 i (m, 1H), 7,67 ( ;dd, J=7,72, 1,10 Hz, 1H), 8, 39 (dd, J=7,72, 2, 21 Hz, 1H), 8, 57 (dd, J=4,78, 1,84 Ηζ, 1Η), 15,80 (s, 1Η).prepared according to the procedure of Example 1D. 1 H-NMR (300 MHz, DMSO-d6) δ 5.64 (s, 2H), 6.90 (m, J = 5.15, 3.68 Hz, 1H), 7.11 (m, J = 3.49, 0.92 Hz, 1H), 7.29 (m, 3H), 7.98 (m, (Dd, J = 7.72, 1.10 Hz, 1H), 8.39 (dd, J = 7.72, 2.21 Hz, 1H), 8 , 57 (dd, J = 4.78, 1.84 Ηζ, 1Η), 15.80 (s, 1Η).

Exemplo 107 1-(benziloxi)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 107 1- (benzyloxy) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 107A 2-[(benziloxilamino]nicotinato de etilo Éster etílico de ácido 2-cloro-nicotínico (4,55 g, 24,6 mmol), cloridrato de O-benzil-hidroxiamina (7,85 g, 49,2 mmol) e N,N-diisopropiletilamina (6,36 g, 49,2 mmol) em 10 mL de 1,4-dioxano reagiu num tubo selado a 120°C durante 48 horas. A mistura reaccional foi repartida entre acetato de etilo e bicarbonato de sódio aquoso a 5%. A fase aquosa foi re-extraída com acetato de etilo (2x50 mL). As fases orgânicas foram combinadas e secas sobre sulfato de sódio, filtradas e concentradas. O resíduo foi purificado por cromatografia em coluna em sílica gel eluindo com hexano e acetato de etilo (9:1) para proporcionar o composto em título (3,5 g, 53%). MS (DCI) m/z 273 (M+H)+.Example 107A 2-Chloro-nicotinic acid ethyl ester (4.55 g, 24.6 mmol), O-benzylhydroxyamine hydrochloride (7.85 g, 49.2 mmol) and N, N-diisopropylethylamine (6.36 g, 49.2 mmol) in 10 mL of 1,4-dioxane was reacted in a sealed tube at 120 ° C for 48 hours. The reaction mixture was partitioned between ethyl acetate and The aqueous phase was re-extracted with ethyl acetate (2 x 50 mL) The organic phases were combined and dried over sodium sulfate, filtered and concentrated The residue was purified by column chromatography on silica gel eluting with hexane and ethyl acetate (9: 1) to provide the title compound (3.5 g, 53%). MS (DCI) m / z 273 (M + H) +.

Exemplo 107B 2-[(benziloxi)(3-etoxi-3-oxopropanoíl)amino]nicotinato de etiloExample 107B Ethyl 2 - [(benzyloxy) (3-ethoxy-3-oxopropanoyl) amino] nicotinate

Uma solução do produto do Exemplo 107A (1,2 g, 4,4 mmol) e trietilamina (0,49 g, 4,8 mmol) em diclorometano (25 mL) foi tratada gota a gota com cloromalonato de etilo (0,73 g, 4,8 mmol), agitada durante 2 horas e repartida entre acetato de etilo e água e as fases foram separadas. A fase de acetato de etilo foi lavada com salmoura, seca (Na2S04) e concentrada. O resíduo foi purificado por cromatografia em coluna em sílica gel eluindo com hexano e acetato de etilo (3:1) para originar o composto em título (1,1 g, 65%). MS (DCI) m/z 387 (M+H)+.A solution of the product of Example 107A (1.2 g, 4.4 mmol) and triethylamine (0.49 g, 4.8 mmol) in dichloromethane (25 mL) was treated dropwise with ethyl chloromalonate (0.73 4.8 mmol), stirred for 2 hours and partitioned between ethyl acetate and water and the phases were separated. The ethyl acetate layer was washed with brine, dried (Na 2 SO 4) and concentrated. The residue was purified by silica gel column chromatography eluting with hexane and ethyl acetate (3: 1) to give the title compound (1.1 g, 65%). MS (DCI) m / z 387 (M + H) +.

Exemplo 107C 1-(benziloxi)-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridina- 3-carboxilato de etilo 161 ΕΡ 1 560 827/ΡΤExample 107C Ethyl 1- (benzyloxy) -4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxylate 161 ΕΡ 1 560 827 / ΡΤ

Uma solução do produto do Exemplo 107B (0,386 g, 1,0 mmol) em etanol (5 mL) foi tratada com etóxido de sódio a 21% em etanol (0,324 g, 1,0 mmol), agitada durante 30 minutos e repartida entre acetato de etilo e HC1 aguoso a 5% e as fases foram separadas. A fase de acetato de etilo foi lavada com salmoura, seca (Na2S04) e concentrada para proporcionar o composto em título (0,28 g, 82%). MS (DCI) m/z 341(M+H)+.A solution of the product of Example 107B (0.386 g, 1.0 mmol) in ethanol (5 mL) was treated with 21% sodium ethoxide in ethanol (0.324 g, 1.0 mmol), stirred for 30 minutes and partitioned between ethyl acetate and 5% aqueous HCl and the phases were separated. The ethyl acetate layer was washed with brine, dried (Na 2 SO 4) and concentrated to provide the title compound (0.28 g, 82%). MS (DCI) m / z 341 (M + H) +.

Exemplo 107D N- [2-(aminosulfonil)fenil]-1-(benziloxi)-4-hidroxi-2-oxo-1,2-di-hidro-l,8-naftiridina-3-carboxamidaExample 107D N- [2- (aminosulfonyl) phenyl] -1- (benzyloxy) -4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide

Uma mistura do produto do Exemplo 107C (340 mg, 0,82 mmol) e 2-aminobenzenossulf onamida (141 mg, 0,82 mmol) em tolueno (10 mL) foi refluxada durante 16 horas, arrefecida e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em título (340 mg, 89%). MS (DCI) m/z 467 (M+H)+.A mixture of the product of Example 107C (340 mg, 0.82 mmol) and 2-aminobenzenesulfonamide (141 mg, 0.82 mmol) in toluene (10 mL) was refluxed for 16 hours, cooled and the resulting precipitate was collected by filtration and dried to give the title compound (340 mg, 89%). MS (DCI) m / z 467 (M + H) +.

Exemplo 107E 1- (benziloxi) -3- (1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 107D o produto do Exemplo 84C para gerar o composto em título (0, 082 g, 87%). MS (ESI-) m/z 447 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ 5,12 (S, 2H) 7,22 (dd, J=7, 72, 4, 78 Hz, 1H) 7,30 (m, 2H) 7,44 (m, 3H) 7,57 (m, 1H) 7,70 (m, 3H) 8,41 (dd, J=1,12, 1,84 Hz, 1H) 8,61 (dd, J=4,78, 1,84 Hz, 1H) 15,70 (s, 1H).Example 107E 1- (Benzyloxy) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The compound was prepared according to the procedure of Example 84D substituting the product of Example 107D for the product of Example 84C to give the title compound (0.082 g, 87%). MS (ESI-) m / z 447 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSOd 6) δ 5.12 (s, 2H) 7.22 (dd, J = 7.72, 4.78 Hz, 1H) 7.30 (m, 2H) 7.44 ( m, 3H) 7.57 (m, 1H) 7.70 (m, 3H) 8.41 (dd, J = 1.12, 1.84 Hz, 1H) 8.61 (dd, J = 4.78 , 1.84 Hz, 1 H) 15.70 (s, 1H).

Exemplo 108 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-8-(2-etilbutil)-5-hidroxi-2-(metilsulfanil)pirido[2,3—d]pirimidin-7(8H)-onaExample 108 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -8- (2-ethylbutyl) -5-hydroxy-2- (methylsulfanyl) pyrido [2,3- d ] pyrimidin-7 (8H) -one

Exemplo 108A 4-[(2-etilbutil)amino]-2-(metiltio)pirimidina-5-carboxilato de metilo 162 ΕΡ 1 560 827/ΡΤ 4-cloro-2-metiltio-5-pirimidinacarboxilato de etilo (0,40 g, 1,72 mmol) reagiu com l-amino-2-etilbutano (0,175 g, 1,72 mmol) e trietilamina (0,60 mL, 4,32 mmol) a temperatura ambiente durante 18 horas. A reacção foi repartida entre água e diclorometano. A fase orgânica foi seca sobre sulfato de sódio, filtrada e concentrada para gerar o composto em titulo (0,50 g, 98%).Example 108A Ethyl 4 - [(2-ethylbutyl) amino] -2- (methylthio) pyrimidine-5-carboxylate Ethyl 4-chloro-2-methylthio-5-pyrimidinecarboxylate (0.40 g , 1.72 mmol) was reacted with 1-amino-2-ethylbutane (0.175 g, 1.72 mmol) and triethylamine (0.60 mL, 4.32 mmol) at room temperature for 18 hours. The reaction was partitioned between water and dichloromethane. The organic phase was dried over sodium sulfate, filtered and concentrated to give the title compound (0.50 g, 98%).

Exemplo 108B ácido_4- [ (2-etilbutil) amino] -2-(metiltio) pirimidina-5- carboxilico O produto do Exemplo 108A (0,50 g, 1,68 mmol) em água e etanol (1:2) reagiu com hidróxido de sódio (0,22 g, 5,50 mmol) a temperatura ambiente durante 3 horas. A reacção foi concentrada sob vácuo para remover o etanol e neutralizada com ácido clorídrico aquoso (1M). O precipitado resultante foi recolhido por filtração e seco para gerar o composto em título (0,41 g, 91%). MS (DCI/NH3) m/z 270 (M+H)+; XH RMN (300 MHz, DMSO-de) δ 0,88 (t, J=7,54 Hz, 6H) , 1,31 (dt, J=14,25, 7,03The product of Example 108A (0.50 g, 1.68 mmol) in water and ethanol (1: 2) was reacted with (1R) -2- (4-methoxyphenyl) (0.22 g, 5.50 mmol) at room temperature for 3 hours. The reaction was concentrated in vacuo to remove the ethanol and neutralized with aqueous hydrochloric acid (1M). The resulting precipitate was collected by filtration and dried to give the title compound (0.41 g, 91%). MS (DCI / NH 3) m / z 270 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 0.88 (t, J = 7.54 Hz, 6H), 1.31 (dt, J = 14.25, 7.03

Hz, 4H) , 1,53 (m, 1H) , 2,47 (s, 3H), 3,46 (t, J=6,07 Hz, 2H), 8,50 (s, 1H), 13,22 (s, 1H).1H), 2.47 (s, 3H), 3.46 (t, J = 6.07 Hz, 2H), 8.50 (s, 1H) 22 (s, 1H).

Exemplo 108C 1-(2-etilbutil)-7-(metiltio)-2H-pirimido[4,5-d][1,3]oxazina- 2,4(1H)-diona O produto do Exemplo 108B (0,41 g, 1,52 mmol) reagiu com cloroformato de etilo (0,445 mL, 4,65 mmol) e piridina (0,405 mL, 5,56 mmol) in tolueno (8 mL) a 90°C durante 24 horas. A reacção foi concentrada sob vácuo. O resíduo foi extraído com acetato de etilo e filtrado. A concentração do filtrado gerou o composto em título (0,394 g, 88%).Example 108C 1- (2-ethylbutyl) -7- (methylthio) -2H-pyrimido [4,5-d] [1,3] oxazine-2,4 (1H) -dione The product of Example 108B (0.41 g, 1.52 mmol) was reacted with ethyl chloroformate (0.445 mL, 4.65 mmol) and pyridine (0.405 mL, 5.56 mmol) in toluene (8 mL) at 90 ° C for 24 hours. The reaction was concentrated in vacuo. The residue was extracted with ethyl acetate and filtered. Concentration of the filtrate gave the title compound (0.394 g, 88%).

Exemplo 108D 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-8-(2-etilbutil)-5-hidroxi-2-(metilsulfanil)pirido[2,3-d]pirimidin-7(8H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 108C o produto do Exemplo 1B (0,153 g, 24%). MS (ESI-) 163 ΕΡ 1 560 827/ΡΤ m/z 472 (Μ-Η)”. Ο sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 0,87 (t, J=7,54 Hz, 6H) , 1,28 (m, 4H), 1,87 (ddd, J=13,05, 6,80, 6,62 Hz, 1H), 2,56 (s, 3H), 4,15 (d, J=7,35 Hz, 2H) , 7,26 (d, J=8,46 Hz, 1H) , 7,31 (m, 1H) , 7,56 (ddd, J=8, 27, 7, 17, 1, 47 Hz, 1H), 7,67 (dd, J=1, 72, 1, 47 Hz, 1H), 8,89 (S, 1H), 15,52 (s, 1H).Example 108D 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -8- (2-ethylbutyl) -5-hydroxy-2- (methylsulfanyl) pyrido [2,3- d ] pyrimidin-7 (8H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 108C for the product of Example 1B (0.153 g, 24%). MS (ESI-) 163 ΕΡ 1 560 827 / ΡΤ m / z 472 (Μ-Η). The title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ0.87 (t, J = 7.54 Hz, 6H), 1.28 (m, 4H), 1.87 (ddd, J = 13.05, 1H), 2.56 (s, 3H), 4.15 (d, J = 7.35 Hz, 2H), 7.26 (d, J = 8.46 Hz, , 7.31 (m, 1H), 7.56 (ddd, J = 8,27,7,7,7Hz, 1H), 7.67 (dd, J = 1.72, 1.47 Hz , 1H), 8.89 (s, 1H), 15.52 (s, 1H).

Exemplo 109 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-8-(2-etilbutil)-5-hidroxipirido[2,3-d]pirimidin-7(8H)-ona O produto do Exemplo 108D (0,15 g, 0,30 mmol) reagiu com um excesso de níquel de Raney (lama em água, 2 mL) em etanol (5 mL) e aquecido a 60 °C durante 1 hora. A mistura foi filtrada através de celite, enxaguada com etanol e o filtrado concentrado sob vácuo para gerar o composto em título. MS (ESI-) m/z 448 (M-H)XH RMN (300 MHz, DMSO-d6) δ 0,86 (t, J=7,35 Hz, 6H), 1,28 (m, 4H), 1,87 (m, 1H), 4,18 (d, J= 7,35 Hz, 2H), 7,30 (m, 2H), 7,57 (ddd, J=8,27, 7,17, 1,47 Hz, 1H), 7,68 (dd, J=7,91, 1,29 Hz, 1H), 8,94 (s, 1H), 9,09 (s, 1H), 15, 43 (s, 1H) .Example 109 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -8- (2-ethylbutyl) -5-hydroxypyrido [2,3- d] pyrimidin-7 (8H) -one The product of Example 108D (0.15 g, 0.30 mmol) was reacted with an excess of Raney nickel (slurry in water, 2 mL) in ethanol (5 mL) and heated at 60 ° C for 1 hour. The mixture was filtered through celite, rinsed with ethanol and the filtrate concentrated under vacuum to give the title compound. NMR (300 MHz, DMSO-d 6) δ 0.86 (t, J = 7.35 Hz, 6H), 1.28 (m, 4H), 1.68 (m, 1H), 4.18 (d, J = 7.35 Hz, 2H), 7.30 (m, 2H), 7.57 (ddd, J = 8.27, 1H), 8.94 (s, 1H), 9.09 (s, 1H), 15.43 (s, 1H), 7.68 (dd, 1H).

Exemplo 110 4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2—b]piridin-5(4H)-onaExample 110 4-Benzyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4H) -one

Exemplo 110A 2H-tieno[3,2-d] [1,3]oxazina-2, 4(1H)-diona O composto em título foi preparado de acordo com o procedimento de Fabis e colaboradores, como descrito em Tetrahedron, 1998, 54, 10789-10800. MS (DCI/NH3) m/z 186,9 (M+NH4)+; 1H RMN (300 MHz, DMSO-de) δ 6,95 (d, J=6 Hz, 1H) 8,25 (d, J=6 Hz, 1H) 12,22 (br s, 1H).Example 110A 2H-thieno [3,2-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Fabis et al. As described in Tetrahedron, 1998, 54, 10789-10800. MS (DCI / NH 3) m / z 186.9 (M + NH 4) +; 1 H NMR (300 MHz, DMSO-d 6): δ 6.95 (d, J = 6 Hz, 1 H) 8.25 (d, J = 6 Hz, 1 H) 12.22 (br s, 1H).

Exemplo 110B 1-benzi1-2H-tieno[3,2-d][1,3]oxazina-2,4(1H)-diona O produto do Exemplo 110A (0,137 g, 0,81 mmol) reagiu com brometo de benzilo (0,10 mL, 0,85 mmol) e carbonato de potássio (0,134 g, 0,97 mmol) in dimetilformamida (5 mL) a 164 ΕΡ 1 560 827/ΡΤ temperatura ambiente durante 20 horas. A mistura reaccional foi diluída com água e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em titulo (0,165 g, 80%). MS (DCI/NH3) m/z 277 (M+NH4)+; XH RMN (300 MHz, DMSO-d6) δ 5,21 (s, 2H) 7,25 (d, J=5,52 Hz, 1H) 7,35 (m, 5H) 8,28 (d, J= 5,52 Hz, 1H) .Example 110B 1-Benzyl-2 H -thieno [3,2- d] [1,3] oxazine-2,4 (1H) -dione The product from Example 110A (0.137 g, 0.81 mmol) was reacted with benzyl bromide (0.10 mL, 0.85 mmol) and potassium carbonate (0.134 g, 0.97 mmol) in dimethylformamide (5 mL) at 164 Å ¹ 1560 Å at room temperature for 20 hours. The reaction mixture was diluted with water and the resulting precipitate was collected by filtration and dried to give the title compound (0.165 g, 80%). MS (DCI / NH 3) m / z 277 (M + NH 4) +; 1 H NMR (300 MHz, DMSO-d 6) δ 5.21 (s, 2H) 7.25 (d, J = 5.52 Hz, 1 H) 7.35 (m, 5H) 8.28 (d, J = 5.52 Hz, 1H).

Exemplo 110C 4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2—b]piridin-5(4H)-ona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 110B o produto do Exemplo 1B (0,137 g, 49%). MS (ESI-) m/z 438 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,26 (s, 2H) 7,03 (d, J= 5,52 Hz, 1H) 7,21 (m, 2H) 7,28 (m, 5H) 7,54 (ddd, J=8,27, 7, 17, 1, 47 Hz, 1H) 7,65 (dd, J=7, 91, 1,29 Hz, 1H) 7,73 (d, J= 5,52 Hz, 1H) 15,89 (s, 1H) .Example 110C 4-Benzyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4H) The title compound was prepared according to the procedure of Example 1D substituting the product of Example 110B for the product of Example 1B (0.137 g, 49%). MS (ESI-) m / z 438 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.26 (s, 2H) 7.03 (d, J = 5.52 Hz, 1H) 7.21 (m, 2H) 7.28 (m, 5H) (D, J = 7.91, 1.29 Hz, 1 H), 7.73 (d, J = 8.7 Hz, 5.52 Hz, 1 H) 15.89 (s, 1 H).

Exemplo 111 4-butil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2—b]piridin-5(4H)-onaExample 111 4-Butyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4H) -one

Exemplo 111 A l-butil-2H-tieno[3, 2-d] [1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com 0 procedimento do Exemplo 110B substituindo por brometo de n-butilo o brometo de benzilo (0,059 g, 22%). MS (DCI) m/z 226 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 0,91 (t, J=7,17 Hz, 3H) 1,36 (dt, J=22,70, 7,22 Hz, 2H) 1,62 (m, 2H) 3,94 (m, 2H) 7,39 (d, J=5,52 Hz, 1H) 8,34 (d, J=5,15 Hz, 1H).Example 111 1-Butyl-2H-thieno [3,2-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 110B substituting n-butyl or benzyl bromide (0.059 g, 22%). MS (DCI) m / z 226 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ0.91 (t, J = 7.17 Hz, 3H) 1.36 (dt, J = 22.70, 7.22 Hz, , 2H) 3.94 (m, 2H) 7.39 (d, J = 5.52 Hz, 1 H) 8.34 (d, J = 5.15 Hz, 1 H).

Exemplo 111B 4-butil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2—b]piridin-5(4H)-onaExample 111B 4-Butyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4H) -one

O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 111A o produto do Exemplo 1B (0, 050 g, 47%). MS 165The title compound was prepared according to the procedure of Example 1D substituting the product of Example 111A for the product of Example 1B (0.050 g, 47%). MS 165

ΕΡ 1 560 827/PT (DCI/NH3) m/z 404 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 0,93 (m, 3H) 1,40 (td, J=14,98, 7,17 Hz, 2H) 1,67 (m, 2H) 4,27 (m, 2H) 7,54 (m, 1H) 7,60 (d, J=5,52 Hz, 1H) 7,67 (d, J=7, 72 Hz, 1H) 7,77 (ddd, J=8,36, 7, 08, 1, 47 Hz, 1H) 7,92 (d, J=7, 72 Hz, 1H) 8,39 (d, J=5,52 Hz, 1H) 14,46 (s, 1H) 14,90 (s, 1H).ΗΡ 1 560 827 (DCI / NH 3) m / z 404 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ0.93 (m, 3H) 1.40 (td, J = 14.98, 7.17 Hz, 2H) 1.67 (m, 2H) 4.27 (d, J = 5.52 Hz, 1 H) 7.67 (d, J = 7.72 Hz, 1 H) 7.77 (ddd, J = 8.36, 7.08, 1.47 Hz, 1 H) 7.92 (d, J = 7.72 Hz, 1 H) 8.39 (d, J = 5.52 Hz, 1 H) 14.46 (s, , 1H) 14.90 (s, 1H).

Exemplo 112 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-(4-piridinilmetil)tieno[3,2-b]piridin-5(4H)-onaExample 112 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4- (4-pyridinylmethyl) thieno [3,2- b] pyridin-5 (4H ) -one

Exemplo 112A 1-(piridin-4-ilmetil)-2H-tieno[3,2-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto doExample 112A 1- (pyridin-4-ylmethyl) -2H-thieno [3,2-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B replacing the product of

Exemplo 110A o produto do Exemplo IA e substituindo por bromidrato de 4-bromometilpiridina o brometo de n-butilo (0,205 g, 80%).Example 110A The product of Example 1A and substituting 4-bromomethylpyridine hydrobromide for n-butyl bromide (0.205 g, 80%).

Exemplo 112B 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-(4-piridinilmetil)tieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto doExample 112B 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4- (4-pyridinylmethyl) thieno [3,2- b] pyridin-5 (4H ) -one The title compound was prepared according to the procedure of Example 1D substituting the product of

Exemplo 112A o produto do Exemplo 1B (0,155 g, 45%). MS (DCI/NH3) m/z 439 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 5,78 (s, 2H) 7,49 (d, J= 5,52 Hz, 1H) 7,55 (t, J=7,54 Hz, 1H) 7,62 (d, J=7,35 Hz, 1H) 7,76 (m, 4H) 7,93 (d, J=7, 72 Hz, 1H) 8,38 (d, J= 5,52 Hz, 1H) 8,75 (d, J=6,25 Hz, 1H) 14,06 (S, 1H) .Example 112A The product of Example 1B (0.155 g, 45%). MS (DCI / NH 3) m / z 439 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 5.78 (s, 2H) 7.49 (d, J = 5.52 Hz, 1 H) 7.55 (t, J = 7.54 Hz, (D, J = 7.35 Hz, 1 H) 7.76 (m, 4H) 7.93 (d, J = 1H), 8.75 (d, J = 6.25 Hz, 1 H) 14.06 (s, 1H).

Exemplo 113 1-(3-bromobenzil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-5,6,7,8-tetra-hidro-2(1H)-quinolinonaExample 113 1- (3-bromobenzyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-5,6,7,8-tetrahydro- 2 (1H) -quinolinone

Exemplo 113A 5,6,7, 8-tetra-hidro-2fí-3, l-benzoxazina-2,4 (1H) -diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo por 2-aminociclo-hex- 166 ΕΡ 1 560 827/ΡΤ 1-eno-l-carboxilato de etilo ο produto do Exemplo 3A (0,960 g, 97%). MS (ESI-) m/z 166 (M-H)+.Example 113A The title compound was prepared according to the procedure of Example 3B substituting 2-aminocyclohexanecarboxylic acid, hexane-1,1-ene-1-carboxylate The product of Example 3A (0.960 g, 97%). MS (ESI-) m / z 166 (M-H) +.

Exemplo 113B 1-(3-bromobenzil)-5, 6,7, 8-tetra-hidro-2fl-3,1-benzoxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 113A o produto do Exemplo IA e substituindo por 3-bromobrometo de benzilo o brometo de n-butilo (0,049 g, 46%). MS (ESI-) m/z 334 (M-H)+.Example 113B 1- (3-bromobenzyl) -5,6,7,8-tetrahydro-2 H -3,1-benzoxazine-2,4 (1 H) -dione The title compound was prepared according to the procedure of Example 1B substituting the product of Example 113A for the product of Example 1A and substituting benzyl 3-bromobromide for n-butyl bromide (0.049 g, 46%). MS (ESI-) m / z 334 (M-H) +.

Exemplo 113C 1-(3-bromobenzil)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-5,6,7,8-tetra-hidro-2(1H)-guinolinona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 113B o produto do Exemplo 1B (0,021 g, 34%). MS (ESI-) m/z 514 (M-H)+; XH RMN (300 MHz, DMSO-d6) δ 1,68 (m, 4H) , 2,51 (m, 2H) , 2,67 (m, 2H), 5,40 (s, 2H), 7,13 (d, J=7,72 Hz, 1H), 7,30 (t, J=7,91 Hz, 1H), 7,51 (m, 3H) , 7,61 (d, J=8,09 Hz, 1H), 7,73 (t, J=7,17 Hz, 1H), 7,90 (d, J=8,46 Hz, 1H), 14,40 (s, 1H), 14,56 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ 1,59 (m, 4H), 2,33 (t, J=5,70 Hz, 2H), 2,41 (m, 2H), 5,14 (s, 2H), 7,11 (d, J=8,09 Hz, 1H), 7,18 (d, J=8,09 Hz, 1H), 7,25 (m, 3H) , 7,41 (d, J=7,72 Hz, 1H) , 7,50 (td, J=7, 72, 1, 47 Hz, 1H) , 7,62 (dd, J=7, 72, 1, 47 Hz, 1H), 17,13 (s, 1H).Example 113C 1- (3-bromobenzyl) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-5,6,7,8-tetrahydro- 2 (1H) -quinolinone The title compound was prepared according to the procedure of Example 1D substituting the product of Example 113B for the product of Example 1B (0.021 g, 34%). MS (ESI-) m / z 514 (M-H) +; 1 H NMR (300 MHz, DMSOd 6) δ 1.68 (m, 4H), 2.51 (m, 2H), 2.67 (m, 2H), 5.40 (s, 2H), 7.13 (d, J = 7.72 Hz, 1H), 7.30 (t, J = 7.91 Hz, 1H), 7.51 (m, 3H), 7.61 (d, J = , 7.73 (t, J = 7.17 Hz, 1 H), 7.90 (d, J = 8.46 Hz, 1 H), 14.40 (s, 1H), 14.56 (s , 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.59 (m, 4H), 2.33 (t, J = 5.70 Hz, 2H), 2.41 (m, 2H), 5.14 , 7.11 (d, J = 8.09 Hz, 1H), 7.18 (d, J = 8.09 Hz, 1H), 7.25 (m, 3H), 7.41 , 7.62 (d, J = 7.72, 1.47 Hz, 1 H), 7.62 (dd, J = 7.72, 1.47 Hz, 1 H) , 17.13 (s, 1H).

Exemplo 114 5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-7-(4-piridinilmetil)tieno[2,3 —b]piridin-6(7H)-onaExample 114 5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-7- (4-pyridinylmethyl) thieno [2,3- b] pyridin-6 (7H ) -one

Exemplo 114A 2H-tieno[2,3-d] [1,3]oxazina-2, 4(1H)-diona O composto em título foi preparado pelo método de Fabis e colaboradores em Tetrahedron 1998 54 10789-10800. MS (DCI/NH3) 167 ΕΡ 1 560 827/ΡΤ m/z 187 (M+NHJ +; ΧΗ RMN (300 ΜΗζ, DMSO-d6) δ 7,17 (d, J=16,8 Hz, 1Η) 7,21 (d, J=16,8 Hz 1 H) 12,56 (br s, 1H).Example 114A 2H-thieno [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared by the method of Fabis et al. In Tetrahedron 1998 54 10789-10800. NMR (300 ΜΗζ, DMSO-d 6) δ 7.17 (d, J = 16.8 Hz, 1Η) δ 7.17 (d, J = 16.8 Hz, 1 ΡΤ) , 21 (d, J = 16.8 Hz, 1 H), 12.56 (br s, 1H).

Exemplo 114B 1- (piridin-4-ilmetil) -2H-tieno [2, 3-d] [1,3] oxazina-2, 4(1 H) -diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 114A o produto do Exemplo IA e substituindo por bromidrato de 4-bromometilpiridina o brometo de n-butilo (0,22 g, 95%) .Example 114B 1- (pyridin-4-ylmethyl) -2H-thieno [2,3-d] [1,3] oxazine-2,4 (1 H) -dione The title compound was prepared according to the procedure of Example 1B substituting the product of Example 114A for the product of Example 1A and substituting 4-bromomethylpyridine hydrobromide for n-butyl bromide (0.22 g, 95%).

Exemplo 114C 5- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-7-(4-piridinilmetil)tieno[2,3—b]piridin-6(7H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 114B o produto do Exemplo 1B (0,047 g, 13%). MS (DCI/NH3) m/z 439 (M+H)+ ; XH RMN (300 MHz, DMSO-d6) δ 5,62 (s, 2H) 7,48 (m, 2 H) 7,55 (t, J=7,54 Hz, 1H) 7,62 (d, J=7,72 Hz, 1H) 7,68 (d, J=6,25 Hz, 1H) 7,76 (ddd, J=8,55, 7,26, 1,47 Hz, 1H) 7,93 (d, J=8, 09 Hz, 1H) 8,71 (d, J=6,62 Hz, I H) 13,87 (s, 1H).Example 114C 5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-7- (4-pyridinylmethyl) thieno [2,3- b] pyridin-6 (7H ) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 114B for the product of Example 1B (0.047 g, 13%). MS (DCI / NH 3) m / z 439 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 5.62 (s, 2H) 7.48 (m, 2 H) 7.55 (t, J = 7.54 Hz, 1 H) 7.62 (d, J = 7.72 Hz, 1 H) 7.68 (d, J = 6.25 Hz, 1 H) 7.76 (ddd, J = 8.55, 7.26, 1.47 Hz, d, J = 8.09 Hz, 1 H) 8.71 (d, J = 6.62 Hz, 1H) 13.87 (s, 1H).

Exemplo 115 6_(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-(3-piridinilmetil)tieno[3,2—b]piridin-5(4H)-onaExample 115 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4- (3-pyridinylmethyl) thieno [3,2- b] pyridin-5 (4H) -one

Exemplo 115A 1-(piridin-3-ilmetil)-2H-tieno[3, 2-d][1,3]oxazina-2,4(lff)-diona O composto em título foi preparado de acordo com 0 procedimento do Exemplo 1B substituindo pelo produto do Exemplo 110A 0 produto do Exemplo IA e substituindo por bromidrato de 3-bromometilpiridina o brometo de n-butilo (0,28 g, 90%). MS (DCI/NH3) m/z 261 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 5,24 (s, 2H) 7,34 (d, J=5,52 Hz, 1H) 7,38 (m, 1H) 7,81 (dt, J= 8, 00, 1,88 Hz, 1H) 8,30 (d, J=5,15 Hz, 1H) 8,51 (dd, J=4,78, 1,47 Hz, 1H) 8,67 (d, J=l,84 Hz, 1H). 168 ΕΡ 1 560 827/ΡΤExample 115A 1- (pyridin-3-ylmethyl) -2H-thieno [3,2-d] [1,3] oxazine-2,4 (1 H) -dione The title compound was prepared according to the procedure of Example 1B substituting the product of Example 110A for the product of Example 1A and substituting 3-bromomethylpyridine hydrobromide for n-butyl bromide (0.28 g, 90%). MS (DCI / NH 3) m / z 261 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 5.24 (s, 2H) 7.34 (d, J = 5.52 Hz, 1H) 7.38 (m, 1H) 7.81 (dt, J = 8.00, 1.88 Hz, 1 H) 8.30 (d, J = 5.15 Hz, 1 H) 8.51 (dd, J = 4.78, 1.47 Hz, 1 H) 8.67 (d , J = 1.84 Hz, 1H). 168 ΕΡ 1 560 827 / ΡΤ

Exemplo 115Β 6- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-(3-piridinilmetll)tieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto doExample 115 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4- (3-pyridinylmethyl) thieno [3,2- b] pyridin-5 (4H ) -one The title compound was prepared according to the procedure of Example 1D substituting the product of

Exemplo 115A o produto do Exemplo 1B (0,237 g, 50%). MS (DCI/NH3) m/z 439 (M+H)+. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ 5,49 (s, 2H) 7,34 (dd, J=7,91, 4,60 Hz, 1H) 7,45 (m, 3H) 7,68 (m, 2H) 7,83 (d, J=8,09 Hz, 1H) 8,16 (s, 1H) 8,47 (d, J=3,68 Hz, 1H) 8,62 (s, 1H) 14,83 (brs, 1H) .Example 115A The product of Example 1B (0.237 g, 50%). MS (DCI / NH 3) m / z 439 (M + H) +. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ 5.49 (s, 2H) 7.34 (dd, J = 7.91, 4.60 Hz, 1 H) 7.45 (m, 3H) 7.68 ( (s, 1H), 8.47 (d, J = 3.68 Hz, 1 H) 8.62 (s, 1 H) 14.83 (brs, 1H).

Exemplo 116 7- benzil-5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxitieno[2,3—b]piridin-6(7H)-onaExample 116 7-benzyl-5- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxythieno [2,3-b] pyridin-6 (7H) -one

Exemplo 116A l-benzil-2fí-tieno [2,3-d] [1,3] oxazina-2, 4 (lff) -diona O composto em título foi preparado de acordo com o procedimento do Exemplo 110B substituindo pelo produto do Exemplo 114A o produto do Exemplo 110A (0,26 g, 100%).Example 116A 1-Benzyl-2 H -nieno [2,3- d] [1,3] oxazine-2,4 (1 H) -dione The title compound was prepared according to the procedure of Example 110B substituting the product of Example 114A the product of Example 110A (0.26 g, 100%).

Exemplo 116B 7-benzil-5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxitieno[2,3—b]piridin-6(7H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 116A o produto do Exemplo 1B (0,144 g, 38%). MS (ESI-) m/z 436 (M-H) -. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 436 (M-H-); δ XH RMN (300 MHz, DMSO-d6) δ 5,14 (s, 2H) 6,90 (d, J= 5,52 Hz, 1H) 7,20 (m, 2H) 7,30 (m, 6H) 7,54 (m, 1H) 7,65 (dd, J=7, 72, 1, 47 Hz, 1H) 16,25 (s, 1H) .Example 116B 7-Benzyl-5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxythieno [2,3-b] pyridin-6 (7H) was prepared according to the procedure of Example 1D substituting the product of Example 116A for the product of Example 1B (0.144 g, 38%). MS (ESI-) m / z 436 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 436 (M-H-); δ 5.14 (s, 2H), 6.90 (d, J = 5.52 Hz, 1 H) 7.20 (m, 2 H) 7.30 (m, 6H ) 7.54 (m, 1 H) 7.65 (dd, J = 7, 72, 1, 47 Hz, 1 H) 16.25 (s, 1H).

Exemplo 117 4-(ciclopropilmetil)-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona 169 ΕΡ 1 560 827/ΡΤExample 117 4- (cyclopropylmethyl) -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4H) -one 169 ΕΡ 1 560 827 / ΡΤ

Exemplo 117Α 1-(ciclopropilmetil)-2ff-tieno[3,2-d][1, 3]oxazina-2, 4(lfl)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 110A o produto do Exemplo IA e substituindo por bromometilciclopropano o brometo de n-butilo (0,23 g, 87%). MS (DCI/NH3) m/z 241 (M+NH4)+; RMN (300 MHz, DMSO-d6) δ 0,47 (m, 4H) 1,21 (m, 1H) 3,89 (d, J= 6,99 Hz, 2H) 7,45 (d, J=5,15Example 117 1- (cyclopropylmethyl) -2 H -thieno [3,2- d] [1,3] oxazine-2,4 (1 H) -dione The title compound was prepared according to the procedure of Example 1B substituting the product of Example 110A the product of Example 1A and substituting bromomethylcyclopropane for n-butyl bromide (0.23 g, 87%). MS (DCI / NH 3) m / z 241 (M + NH 4) +; NMR (300 MHz, DMSO-d 6) δ 0.47 (m, 4H) 1.21 (m, 1H) 3.89 (d, J = 6.99 Hz, 2 H) 7.45 (d, J = 5) , 15

Hz, 1H) 8,35 (d, J=5,15 Hz, 1H).1H), 8.35 (d, J = 5.15 Hz, 1H).

Exemplo 117B 4- (ciclopropilmetil)-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-onaExample 117B 4- (cyclopropylmethyl) -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4H) -one

O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 117A o produto do Exemplo 1B (0,252 g, 60%). MS (ESI-) m/z 400 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ 0,41 (m, 4H) 1,20 (m, 1H) 3,92 (d, J= 6,99The title compound was prepared according to the procedure of Example 1D substituting the product of Example 117A for the product of Example 1B (0.252 g, 60%). MS (ESI-) m / z 400 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.41 (m, 4H) 1.20 (m, 1H) 3.92 (d, J = 6.99

Hz, 2H) 7,19 (m, 2H) 7,26 (t, J=7,54 Hz, 1H) 7,53 (m, 1H) 7,64 (d,J=6,62 Hz, 1H) 7,79 (d, J= 5,52 Hz, 1H) 15,97 (s, 1H).J = 7.54 Hz, 1 H) 7.53 (m, 1 H) 7.64 (d, J = 6.62 Hz, 1 H) 7.79 (d, J = 5.52 Hz, 1 H) 15.97 (s, 1 H).

Exemplo 118 5- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-7-(3-metilbutil)tieno[2,3-b]piridin-6(7H)-onaExample 118 5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-7- (3-methylbutyl) thieno [2,3- b] pyridin-6 (7H ) -one

Exemplo 118A 1-(3-metilbutil)-2H-tieno[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 114A o produto do Exemplo IA e substituindo por brometo de isobutilo o brometo de n-butilo (0,074 g, 35%).Example 118A 1- (3-methylbutyl) -2H-thieno [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by the product of Example 114A the product of Example 1A and substituting isobutyl bromide for n-butyl bromide (0.074 g, 35%).

Exemplo 118B 5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-7-(3-metilbutil)tieno[2,3-b]piridin-6(7H)-ona O composto em título foi preparado de acordo com 0 procedimento do Exemplo 1D substituindo pelo produto do 170 ΕΡ 1 560 827/ΡΤExample 118B 5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-7- (3-methylbutyl) thieno [2,3- b] pyridin-6 (7H ) -one The title compound was prepared according to the procedure of Example 1D substituting the product of 170Âμl 1 560 827 / ΡΤ

Exemplo 118Α ο produto do Exemplo 1B (0,063 g, 49%). MS (ESI-) m/z 416 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ 0,96 (s, 3H) 0,98 (s, 3H) 1,53 (m, 2H) 1,66 (m, 1H) 3,87 (m, 2H) 6,95 (d, J=5,52 Hz, 1H) 7,19 (m, 2H) 7,25 (m, 1H) 7,52 (ddd, J= 8,27, 7, 17, 1, 47 Hz, 1H) 7,64 (dd, J=7, 72, 1, 47 Hz, 1H) 16,30 (s, 1H) .Example 118Α The product of Example 1B (0.063 g, 49%). MS (ESI-) m / z 416 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO- d 6) δ 0.96 (s, 3H) 0.98 (s, 3H) 1.53 (m, 2H) 1.66 (m, 1H) 3.87 (m, 2H ) 6.95 (d, J = 5.52 Hz, 1 H) 7.19 (m, 2 H) 7.25 (m, 1 H) 7.52 (ddd, J = 8.27, 47 Hz, 1 H) 7.64 (dd, J = 7, 72, 1.47 Hz, 1 H) 16.30 (s, 1H).

Exemplo 119 4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-2-feniltieno[3,2—b]piridin-5(4H)-onaExample 119 4-benzyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-2-phenylthieno [3,2- b] pyridin-5 (4H) -one

Exemplo 119A 6-f enil-2ff-tieno [3, 2-d] [1,3] oxazina-2, 4(1 H) -diona 3-amino-5-feniltiofeno-2-carboxilato de metilo (0,25 g, 1,07 mmol) em água (6 mL) reagiu com hidróxido de potássio (0,12 g, 2,14 mmol) a 90°C durante 24 horas. A reacção foi arrefecida até 0°C e juntou-se fosgénio (1,9M em tolueno, 0,70 mL, 1,40 mmol) gota a gota. Após agitação a temperatura ambiente durante 1 hora, o sólido resultante foi recolhido por filtração, lavado com excesso de água e seco para gerar o composto em título como um sólido bege (0,175 g, 65%).Example 119A 6-phenyl-2 H -thieno [3,2-d] [1,3] oxazine-2,4 (1 H) -dione methyl 3-amino-5-phenylthiophene-2-carboxylate (0.25 g g, 1.07 mmol) in water (6 mL) was reacted with potassium hydroxide (0.12 g, 2.14 mmol) at 90 ° C for 24 hours. The reaction was cooled to 0 ° C and phosgene (1.9 M in toluene, 0.70 mL, 1.40 mmol) was added dropwise. After stirring at room temperature for 1 hour, the resulting solid was collected by filtration, washed with excess water and dried to give the title compound as a beige solid (0.175 g, 65%).

Exemplo 119B l-benzil-6-fenil-2ff-tieno[3,2-d] [1,3]oxazina-2, 4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 119A o produto do Exemplo IA (0,19 g, 80%). MS (DCI/NH3) m/z 353 (M+NH4)+; ΧΗ RMN (300 MHz, DMSO-dê) δ 5,26 (s, 2 H) 7,43 (m, 8H) 7,82 (m, 3H) .Example 119B 1-Benzyl-6-phenyl-2 H -thieno [3,2-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by the product of Example 119A the product of Example IA (0.19 g, 80%). MS (DCI / NH 3) m / z 353 (M + NH 4) +; Δ NMR (300 MHz, DMSO-d 6) δ 5.26 (s, 2 H) 7.43 (m, 8H) 7.82 (m, 3H).

Exemplo 119C 4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-2-feniltieno[3,2—b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 119B o produto do Exemplo 1B (0,062 g, 22%). MS (ESI-) m/z 512 (M-H)+. O sal de sódio do composto em título foiExample 119C 4-benzyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-2-phenylthieno [3,2- b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 119B for the product of Example 1B (0.062 g, 22%). MS (ESI-) m / z 512 (M-H) +. The sodium salt of the title compound was

preparado de acordo com o procedimento do Exemplo 1D. 1H RMN 171 ΕΡ 1 560 827/ΡΤ (300 ΜΗζ, DMSO-d6) δ 5,34 (s, 2Η) 7,24 (m, 2Η) 7,33 (m, 5Η) 7,43 (m, 4H) 7,56 (t, J=7,35 Hz, 1H) 7,71 (m, 3H) 15,82 (m, 1H).prepared according to the procedure of Example 1D. (M, 4H), 7.43 (m, 5H), 7.43 (m, 5H) 7.56 (t, J = 7.35 Hz, 1 H) 7.71 (m, 3 H) 15.82 (m, 1H).

Exemplo 120 4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-3-metiltieno[3,2—b]piridin-5(4H)-onaExample 120 4-benzyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-3-methylthieno [3,2- b] pyridin-5 (4H) -one

Exemplo 120A 7-metil-2H-tieno[3,2-d][1,3]oxazina-2,4(lff)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 119A substituindo por 3-amino-4-metiltiofeno-2-carboxilato de metilo o 3-amino-5-feniltiofeno-2-carboxilato de metilo.Example 120A 7-methyl-2H-thieno [3,2-d] [1,3] oxazine-2,4 (1 H) -dione The title compound was prepared according to the procedure of Example 119A substituting 3-amino -4-methylthiophene-2-carboxylate methyl methyl 3-amino-5-phenylthiophene-2-carboxylate.

Exemplo 120B l-benzil-7-metil-2ff-tieno [3,2-d] [1,3] oxazina-2, 4 (1H) -diona O composto em título foi preparado de acordo com o procedimento do Exemplo 110B substituindo pelo produto do Exemplo 120A o produto do Exemplo 110A (0,22 g, 73%). MS (DCI/NH3) m/z 291 (M+NH4) + .Example 120B 1-Benzyl-7-methyl-2 H -thieno [3,2-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 110B substituting by the product of Example 120A the product of Example 110A (0.22 g, 73%). MS (DCI / NH 3) m / z 291 (M + NH 4) +.

Exemplo 120C 4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-3-metiltieno[3,2—b]lpiridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 120B o produto do Exemplo 1B (0,110 g, 30%). MS (ESI-) m/z 450 (M-H) + . O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-dg) δ 2,21 (s, 3H) 5,47 (s, 2H) 7,05 (m, 1H) 7,25 (m, 6H) 7,37 (d, J=0,74 Hz, 1H) 7,54 (ddd, J=8,27, 7,17, 1,47 Hz, 1H) 7,64 (dd, J=7,91, 1,29 Hz, 1H) 15,92 (s, 1H).Example 120C 4-Benzyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-3-methylthieno [3,2- b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 120B for the product of Example 1B (0.110 g, 30%). MS (ESI-) m / z 450 (M-H) +. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.21 (s, 3H) 5.47 (s, 2H) 7.05 (m, 1H) 7.25 (m, 6H) 7.37 (d, J = = 0.74 Hz, 1H) 7.54 (ddd, J = 8.27, 7.17, 1.47 Hz, 1H) 7.64 (dd, J = 7.91, 1.29 Hz, 1H) 15.92 (s, 1H).

Exemplo 121 l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-5,6,7,8-tetra-hidro-2(1H)-quinolinonaExample 121 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-5,6,7,8-tetrahydro-2 (1H) -quinolinone

Exemplo 121A l-benzil-5, 6, 7, 8-tetra-hidro-2ff-3, l-benzoxazina-2, 4 (1H) -diona 172 ΕΡ 1 560 827/ΡΤ Ο composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 113A o produto do Exemplo IA e substituindo por brometo de benzilo o brometo de n-butilo (0,620 g, 67%). MS (ESI-) m/z 256 (M-H)“.Example 121A 1-benzyl-5,6,7,8-tetrahydro-2 H -3,1-benzoxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting the product of Example 113A for the product of Example 1A and substituting benzyl bromide for n-butyl bromide (0.620 g, 67%). MS (ESI-) m / z 256 (M-H).

Exemplo 121B l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-5,6,7,8-tetra-hidro-2(1H)-quinolinona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 121A o produto do Exemplo 1B (0,039 g, 37%). MS (ESI-) m/z 434 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 1,54 (m, 4H), 2,33 (t, J= 5,88 Hz, 2H), 2,42 (m, 2H), 5,15 (s, 2H), 7,10 (d, J=6,99 Hz, 2H) , 7,20 (m, 3H) , 7,30 (t,J=1,35 Hz, 2H), 7,50 (td, J=7, 72, 1,47 Hz, 1H), 7,61 (dd, J=1r 72, 1,10 Hz, 1H) , 17,20 (s, 1H).Example 121B 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-5,6,7,8-tetrahydro-2 (1H) -quinolinone The title compound was prepared according to the procedure of Example 1D substituting the product of Example 121A for the product of Example 1B (0.039 g, 37%). MS (ESI-) m / z 434 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.54 (m, 4H), 2.33 (t, J = 5.88 Hz, 2H), 2.42 (m, 2H), 5.15 , 7.10 (d, J = 6.99 Hz, 2H), 7.20 (m, 3H), 7.30 (t, J = 1.35 Hz, 2H), 7.50 , J = 7.72, 1.47 Hz, 1H), 7.61 (dd, J = 1, 72, 1.10 Hz, 1H), 17.20 (s, 1H).

Exemplo 122 l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2(1H)-piridinonaExample 122 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2 (1H) -pyridinone

Exemplo 122A 2H-1,3-oxazina-2,6(3H)-diona O composto em título foi preparado pelo método descrito por Warren e colaboradores em Journal of Organlc Chemistry 1975 40(6) 743-746. MS (DCI/NM3) m/z 131 (M+NH4)+; XH RMN (300 MHz, DMSO-de) δ 5,61 (d, J=7, 72 Hz, 1H) 7,65 (d, J=7,35 Hz, 1H) 11,55 (s, 1H).Example 122A 2H-1,3-oxazine-2,6 (3H) -dione The title compound was prepared by the method described by Warren et al. In Journal of Organ Chemistry 1975 40 (6) 743-746. MS (DCI / NM 3) m / z 131 (M + NH 4) +; 1 H NMR (300 MHz, DMSO-d 6) δ 5.61 (d, J = 7.72 Hz, 1 H) 7.65 (d, J = 7.35 Hz, 1 H) 11.55 (s, 1H).

Exemplo 122B 3-benzil-2fl-l,3-oxazina-2, 6(3H)-dionaExample 122B 3-Benzyl-2 H -1,3-oxazine-2,6 (3 H) -dione

O composto em título foi preparado de acordo com o procedimento do Exemplo 110B substituindo pelo produto do Exemplo 122A o produto do Exemplo 110A (0,156 g, 25%). MS (DCI/NH3) m/z 221 (M+NH4)+ ; XH RMN (300 MHz, DMSO-d6) δ 4,89 (s, 2H) 5,78 (d, J=7,72 Hz, 1H) 7,37 (m, 5H) 7,97 (d, J=8,09 Hz, 1H). 173The title compound was prepared according to the procedure of Example 110B substituting the product of Example 122A for the product of Example 110A (0.156 g, 25%). MS (DCI / NH 3) m / z 221 (M + NH 4) +; 1H NMR (300 MHz, DMSO-d6) δ 4.89 (s, 2H) 5.78 (d, J = 7.72 Hz, 1H) 7.37 (m, 5H) 7.97 (d, J = 8.09 Hz, 1H). 173

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 122C l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-2(1H)-piridinona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 122B o produto do Exemplo 1B (0,13 g, 5%). MS (ESI-) m/z 380 (M-H)'; XH RMN (300 MHz, DMSO-d6) δ 4,89 (s, 2H) 5,53 (d, J=7,35 Hz, 1H) 7,11 (d, J=7, 72 Hz, 1H) 7,28 (m, 6H) 7,39 (d, J=7, 72 Hz, 1H) 7,50 (m, 1H) 7,61 (dd, J=7,72, 1,10 Hz, 1H) 16,83 (s, 1H).Example 122C 1-Benzyl-3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2 (1H) -pyridinone The title compound was prepared according to The procedure of Example 1D substituting the product of Example 122B for the product of Example 1B (0.13 g, 5%). MS (ESI-) m / z 380 (M-H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 4.89 (s, 2H) 5.53 (d, J = 7.35 Hz, 1 H) 7.11 (d, J = 7.72 Hz, , 28 (m, 6H) 7.39 (d, J = 7.72 Hz, 1 H) 7.50 (m, 1 H) 7.61 (dd, J = 7.72, 1.10 Hz, , 83 (s, 1H).

Exemplo 123 l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-5,6-dimetil-2(1H)-piridinonaExample 123 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-5,6-dimethyl-2 (1H) -pyridinone

Exemplo 123A 4,5-dimetil-2fl-l,3-oxazina-2, 6(3H)-diona O composto em título foi preparado pelo método descrito por Washburne, et al., Tetrahedron Letters 1976 17(4) 243-246. MS (DCI/NH3) m/z 204 (M+H)+.Example 123A The title compound was prepared by the method described by Washburne, et al., Tetrahedron Letters 1976 17 (4) 243-246 (M +). . MS (DCI / NH 3) m / z 204 (M + H) +.

Exemplo 123B 3-benzil-4,5-dimetil-2fl-l, 3-oxazina-2, 6(3fl)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 123A o produto do Exemplo IA e substituindo por brometo de benzilo o brometo de n-butilo (0,109 g, 27%). MS (DCI/NH3) m/z 249 (M+NH4)+; ΧΗ RMN (300 MHz, DMSO-d6) δ 1,86 (s, 3H) 2,14 (s, 3H) 5,09 (s, 2H) 7,32 (m, 5H).Example 123B The title compound was prepared according to the procedure of Example 1B substituting the product of Example 123A for the product of Example 1A and substituting benzyl bromide for n-butyl bromide (0.109 g, 27%). MS (DCI / NH 3) m / z 249 (M + NH 4) +; Δ NMR (300 MHz, DMSO-d 6) δ 1.86 (s, 3H) 2.14 (s, 3H) 5.09 (s, 2H) 7.32 (m, 5H).

Exemplo 123C l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-5,6-dimetil-2(1H)-piridinona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 123B o produto do Exemplo 1B (0,070 g, 36%). MS (ESI-) m/z 408 (M-H) ~. O sal de sódio do composto em título foi 174 ΕΡ 1 560 827/ΡΤ preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ 1,88 (s, 3H) 2,10 (s, 3H) 5,20 (s, 2H) 7,13 (m, 2H) 7,21 (m, 2H) 7,31 (m, J= 7,17, 7,17 Hz, 3H) 7,50 (m, 1H) 7,62 (dd, J=7,91, 1,29 Hz, 1H) 17,28 (s, 1H).Example 123C 1-Benzyl-3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-5,6-dimethyl-2 (1H) -pyridinone The title compound was prepared according to the procedure of Example 1D substituting the product of Example 123B for the product of Example 1B (0.070 g, 36%). MS (ESI-) m / z 408 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSOd 6) δ 1.88 (s, 3H) 2.10 (s, 3H) 5.20 (s, 2H) 7.13 (m, 2H) 7.21 (m, 2H ) 7.31 (m, J = 7.17, 7.17 Hz, 3H) 7.50 (m, 1H) 7.62 (dd, J = 7.91, 1.29 Hz, 1H) 17.28 (s, 1H).

Exemplo 124 7-benzil-5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)- 4-hidroxi-3-metiltieno[2,3-b]piridin-6(7H)-onaExample 124 7-Benzyl-5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-3-methylthieno [2,3- b] pyridin-6 (7H) -one

Exemplo 124A 5-metil-2ff-tieno[2, 3-d] [1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento de Fabis e colaboradores, como descrito em Tetrahedron, 1998, 54, 10789-10800. MS (ESI-) m/z 182 (M-H)'.Example 124A 5-methyl-2 H -thieno [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Fabis et al., As described in Tetrahedron, 1998, 54, 10789-10800. MS (ESI-) m / z 182 (M-H) +.

Exemplo 124B l-benzil-5-metil-2#-tieno[2,3-d] [1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 124A o produto do Exemplo IA e substituindo por brometo de benzilo o brometo de n-butilo (0,075 g, 50%). MS (DCl/NHs) m/z 291 (M+NH4) + .Example 124B 1-Benzyl-5-methyl-2-theno [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting the product of Example 124A for the product of Example 1A and substituting benzyl bromide for n-butyl bromide (0.075 g, 50%). MS (DCI / NH 3) m / z 291 (M + NH 4) +.

Exemplo 124C 7-benzil-5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-3-metiltieno[2,3-b]piridin-6(7H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 124B o produto do Exemplo 1B (0,025 g, 23%). MS (ESI-) m/z 450 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. *H RMN (300 MHz, DMSO-d6) δ 2,46 (s, 3H) , 5,12 (s, 2H), 6,47 (d, J=l,10 Hz, 1H), 7,28 (m, 7H), 7,52 (td, J=7, 72, 1, 47 Hz, 1H), 7,64 (dd, J=7, 72, 1, 47 Hz, 1H), 16,31 (s, 1H).Example 124C 7-Benzyl-5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-3-methylthieno [2,3- b] pyridin-6 (7H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 124B for the product of Example 1B (0.025 g, 23%). MS (ESI-) m / z 450 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.46 (s, 3H), 5.12 (s, 2H), 6.47 (d, J = m), 7.52 (td, J = 7.72, 1.47 Hz, 1H), 7.64 (dd, J = 7.72, 1.47 Hz, 1H), 16.31 (s, , 1H).

Exemplo 125 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-(3-metilbutil)tieno[3,2-b]piridin-5(4H)-ona 175 ΕΡ 1 560 827/ΡΤExample 125 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4- (3-methylbutyl) thieno [3,2- b] pyridin-5 (4H ) -one 175 Ρ Ρ 1 560 827 / ΡΤ

Exemplo 125Α 1-(3-metilbutil)-2ff-tieno[3,2-d] [1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 110A o produto do Exemplo IA e substituindo por l-bromo-3-metilbutano o brometo de n-butilo (0,246 g, 68%).Example 125 1- (3-methylbutyl) -2 H -thieno [3,2- d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by the product of Example 110A the product of Example 1A and substituting 1-bromo-3-methylbutane and n-butyl bromide (0.246 g, 68%).

Exemplo 125B 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-(3-metilbutil)tieno[3,2—b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 125A o produto do Exemplo 1B (0,223 g, 52%). MS (ESI-) m/z 416 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 0,96 (d, J=6,90 Hz, 6H) 1,45 (m, 2H) 1,67 (m, 1H) 3,99 (m, 2H) 7,09 (d, J= 5,52 Hz, 1H) 7,19 (d, J=7, 72 Hz, 1H) 7,26 (m, 1H) 7,53 (ddd, J= 8, 55, 7,26, 1, 47 Hz, 1H) 7,64 (dd, J=7, 72, 1, 47 Hz, 1H) 7,80 (d, J=5,52 Hz, 1H) 15,95 (s, 1H) .Example 125B 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4- (3-methylbutyl) thieno [3,2- b] pyridin-5 (4H ) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 125A for the product of Example 1B (0.223 g, 52%). MS (ESI-) m / z 416 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ0.96 (d, J = 6.90 Hz, 6H) 1.45 (m, 2H) 1.67 (m, 1H) 3.99 (m, 2H) 7.09 (d, J = 5.52 Hz, 1 H) 7.19 (d, J = 7.72 Hz, 1 H) 7.26 (m, 1 H) 7.53 (ddd, J = 7.26, 1.47 Hz, 1 H) 7.64 (dd, J = 7.72, 1.47 Hz, 1 H) 7.80 (d, J = 5.52 Hz, 1 H) 15.95 (s , 1H).

Exemplo 126 6- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-(2-etilbutil)- 7- hidroxitieno[3,2—b]piridin-5(4H)-onaExample 126 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4- (2-ethylbutyl) -7-hydroxythieno [3,2- b] pyridin-5 (4H) -one

Exemplo 126A 1-(2-etilbutil)-2H-tieno[3,2-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 110A o produto do Exemplo IA e substituindo por l-bromo-2-etilbutano o brometo de n-butilo (0,116 g, 31%). MS (DCI/NH3) m/z 271 (M+NH4)\Example 126A 1- (2-ethylbutyl) -2H-thieno [3,2-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by the product of Example 110A the product of Example 1A and substituting 1-bromo-2-ethylbutane and n-butyl bromide (0.116 g, 31%). MS (DCI / NH 3) m / z 271 (M + NH 4)

Exemplo 126B 6- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-(2-etilbutil)- 7- hidroxitieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do 176 ΕΡ 1 560 827/ΡΤExample 126B 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4- (2-ethylbutyl) -7-hydroxythieno [3,2- b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of 176 εε 1 560 827 / ΡΤ

Exemplo 126Α ο produto do Exemplo 1B (0,052 g, 26%). MS (ESI-) m/z 430 (M-H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ 0,87 (t, J= 7,35 Hz, 6H) 1,29 (m, 4H) 1,73 (m, J=13,24, 6,99 Hz, 1H) 3,91 (d, J=7,35 Hz, 2H) 7,08 (d, J=5,52 Hz, 1H) 7,18 (d, J=8,09 Hz, 1H) 7,25 (m, J=7,54, 7,54Example 126 is the product of Example 1B (0.052 g, 26%). MS (ESI-) m / z 430 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.87 (t, J = 7.35 Hz, 6H) 1.29 (m, 4H) 1.73 (m, J = 13.24, 6.99 Hz (D, J = 8.09 Hz, 1 H), 7.98 (d, J = 8.35 Hz, 1 H) 25 (m, J = 7.54, 7.54

Hz, 1H) 7,53 (ddd, J=8,55, 7,26, 1,47 Hz, 1H) 7,64 (dd, J=7,72, 1,47 Hz, 1H) 7,78 (d, J=5,15 Hz, 1H) 15,99 (s, 1H).1H), 7.54 (ddd, J = 8.55, 7.26, 1.47 Hz, 1 H) 7.64 (dd, J = 7.72, 1.47 Hz, d, J = 5.15 Hz, 1 H) 15.99 (s, 1H).

Exemplo 127 l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-6-metil-5-fenil-2(1H)-piridinonaExample 127 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-6-methyl-5-phenyl-2 (1H) -pyridinone

Exemplo 127A 4-metil-5-f enil-2ff-l, 3-oxazina-2, 6 (3H) -diona 2-fenilacetoacetato de etilo (1,0 g, 4,85 mmol) e uretano (0,43 g, 4,85 mmol) foram aquecidos, puros, com oxicloreto de fósforo (3 mL) a 90°C durante 3 horas. O excesso de reagentes foi removido sob vácuo e o resíduo resultante foi triturado com benzeno e filtrado. Este sólido foi triturado com éter dietílico, filtrado e seco para gerar 0,818 g (83%). MS (DCI/NH3) m/z 204 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 1,98 (s, 3H) 7,28 (m, 2H) 7,39 (m, 3H) 11,65 (s, 1H).Example 127A Ethyl 4-methyl-5-phenyl-2 H -1,3-oxazine-2,6 (3H) -dione 2-phenylacetoacetate (1.0 g, 4.85 mmol) and urethane (0.43 g , 4.85 mmol) were heated, pure, with phosphorus oxychloride (3 mL) at 90 ° C for 3 hours. The excess reagents were removed in vacuo and the resulting residue triturated with benzene and filtered. This solid was triturated with diethyl ether, filtered and dried to give 0.818 g (83%). MS (DCI / NH 3) m / z 204 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.98 (s, 3H) 7.28 (m, 2H) 7.39 (m, 3H) 11.65 (s, 1H).

Exemplo 127B 3-benzil-4-metil-5-fenil-2H-l,3-oxazina-2,6(3H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 127A o produto do Exemplo IA e substituindo por brometo de benzilo o brometo de n-butilo (0,257 g, 71%). MS (DCI/NH3) rn/z 311 (M+NH4)+; XH RMN (300 MHz, DMSO-d6) δ 2,03 (s, 3H) 5,16 (s, 2H) 7,34 (m, 10H).Example 127B 3-benzyl-4-methyl-5-phenyl-2H-1,3-oxazine-2,6 (3H) -dione The title compound was prepared according to the procedure of Example 1B substituting the product of Example 127A the product of Example 1A and substituting benzyl bromide for n-butyl bromide (0.257 g, 71%). MS (DCI / NH 3) m / z 311 (M + NH 4) +; 1 H NMR (300 MHz, DMSO-d 6) δ 2.03 (s, 3H) 5.16 (s, 2H) 7.34 (m, 10H).

Exemplo 127C l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)- 4-hidroxi-6-metil-5-fenil-2(1H)-piridinona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 127B o produto do Exemplo 1B (0,022 g, 5%). MS (ESI-) 177 ΕΡ 1 560 827/ΡΤ m/z 470 (Μ-Η) . Ο sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. :H RMN (300 MHz, DMSO-de) δ 1,92 (s, 3H) 5,24 (s, 2H) 7,19 (m, 10H) 7,33 (m, 2H) 7,46 (ddd, J=8,27, 7, 17, 1, 47 Hz, 1H) 7,61 (dd, J=7,91, 1,29 Hz, 1H) 16,97 (s, 1H) .Example 127C 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-6-methyl-5-phenyl-2 (1H) -pyridinone Compound was prepared according to the procedure of Example 1D substituting the product of Example 127B for the product of Example 1B (0.022 g, 5%). MS (ESI-) 177 ΕΡ 1 560 827 / ΡΤ m / z 470 (Μ-Η). The title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.92 (s, 3H) 5.24 (s, 2H) 7.19 (m, 10H) 7.33 (m, 2H) 7.46 (ddd, J = 8.27, 7.17, 1.47 Hz, 1 H) 7.61 (dd, J = 7.91, 1.29 Hz, 1 H) 16.97 (s, 1H).

Exemplo 128 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-5,6-dimetil-l-(3-metilbutil)-2(1H)-piridinonaExample 128 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-5,6-dimethyl-1- (3-methylbutyl) -2 (1H) -pyridinone

Exemplo 128A 4, 5-dimetil-3-(3-metilbutil)-2H-1,3-oxazina-2, 6(3H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 123A o produto do Exemplo IA e substituindo por l-bromo-3-metilbutano o brometo de n-butilo (0,224 g, 60%). MS (DCI/NH3) m/z 255 (M+N:H4)+ ; XH RMN (300 MHz, DMSO-d6) δ 0,92 (d, J= 6,62 Hz, 6H) 1,46 (m, 2H) 1,59 (dt, J=13,14, 6,48 Hz, 1H) 1,85 (s, 3H) 2,26 (s, 3H) 3,77 (m, 2H).Example 128A 4,5-dimethyl-3- (3-methylbutyl) -2H-1,3-oxazine-2,6 (3H) -dione The title compound was prepared according to the procedure of Example 1B substituting Example 123A The product of Example 1A and substituting 1-bromo-3-methylbutane for n-butyl bromide (0.224 g, 60%). MS (DCI / NH 3) m / z 255 (M + N: H 4) +; 1 H NMR (300 MHz, DMSO-d 6) δ0.92 (d, J = 6.62 Hz, 6H) 1.46 (m, 2H) 1.59 (dt, J = 13.14, 6.48 Hz , 1.85 (s, 3H), 2.26 (s, 3H), 3.77 (m, 2H).

Exemplo 128B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-5,6-dimetil-l-(3-metilbutil)-2(1H)-piridinona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 128A o produto do Exemplo 1B (0,132 g, 32%). MS (ESI-) m/z 388 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ 0,94 (d, J=2,5 Hz, 6H) 1,87 (s, 3H) 2,24 (s, 3H) 3,84 (m, 2H) 7,16 (m, 1H) 7,21 (m, 1H) 7,49 (m, 1H) 7,61 (m, 1H) 17,41 (s, 1H).Example 128B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-5,6-dimethyl-1- (3-methylbutyl) -2 (1H) -pyridinone The title compound was prepared according to the procedure of Example 1D substituting the product of Example 128A for the product of Example 1B (0.132 g, 32%). MS (ESI-) m / z 388 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.94 (d, J = 2.5 Hz, 6H) 1.87 (s, 3H) 2.24 (s, 3H) 3.84 (m, 2H) 7.16 (m, 1H) 7.21 (m, 1H) 7.49 (m, 1H) 7.61 (m, 1H) 17.41 (s, 1H).

Exemplo 129 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-(2-etilbutil)- 4- hidroxi-5,6-dimetil-2(1H)-piridinonaExample 129 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (2-ethylbutyl) -4-hydroxy-5,6-dimethyl-2 (1H) -pyridinone

Exemplo 129A 3-(2-etilbutil)-4, 5-dimetil-2fl-l, 3-oxazina-2, 6(3fl)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do 178 ΕΡ 1 560 827/ΡΤExample 129A 3- (2-Ethylbutyl) -4,5-dimethyl-2 H -1,3-oxazine-2,6 (3 H) -dione The title compound was prepared according to the procedure of Example 1B substituting 178 ΕΡ 1 560 827 / ΡΤ

Exemplo 123Α ο produto do Exemplo IA e substituindo por l-bromo-2-etil-butano o brometo de n-butilo (0,181 g, 45%). XH RMN (300 MHz, DMSO-d6) δ 0,85 (t, J=7,35 Hz, 6H) 1,29 (m, 4H) 1,65 (m, 1H) 1,86 (s, 3H) 2,25 (s, 3H) 3,73 (d, J=7,35 Hz, 2H) .Example 123 is the product of Example 1A and substituting 1-bromo-2-ethylbutane for n-butyl bromide (0.181 g, 45%). 1H NMR (300 MHz, DMSO-d6) δ 0.85 (t, J = 7.35 Hz, 6H) 1.29 (m, 4H) 1.65 (m, 1H) 1.86 (s, 3H) 2.25 (s, 3H) 3.73 (d, J = 7.35 Hz, 2H).

Exemplo 129B 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-(2-etilbutil)- 4- hidroxi-5,6-dimetil-2(1H)-piridinona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 129A o produto do Exemplo 1B (0,027 g, 9%). MS (ESI-) m/z 402 (M-H)“. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ 0,85 (t, J=7,35 Hz, 6H) 1,25 (m, 4H) 1,62 (m, 1H) 1,88 (s, 3H) 2,22 (s, 3H) 3,82 (m, 2H) 7,14 (d, J=7,72 Hz, 1H) 7,21 (m, 1H) 7,48 (ddd, J=8,46, 7,17,1,65 Hz, 1H) 7,60 (dd, J=7,91, 1,29 Hz, 1H) 17,42 (s, 1H).Example 129B 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1- (2-ethylbutyl) -4-hydroxy-5,6-dimethyl-2 (1H) -pyridinone The title compound was prepared according to the procedure of Example 1D substituting the product of Example 129A for the product of Example 1B (0.027 g, 9%). MS (ESI-) m / z 402 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.85 (t, J = 7.35 Hz, 6H) 1.25 (m, 4H) 1.62 (m, 2H), 7.14 (d, J = 7.72 Hz, 1 H), 7.21 (m, 1 H), 7.48 (ddd, J = 8.46 , 7.17,1.65 Hz, 1 H) 7.60 (dd, J = 7.91, 1.29 Hz, 1 H) 17.42 (s, 1H).

Exemplo 130 l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-6-fenil-2(1H)-piridinonaExample 130 1-benzyl-3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-6-phenyl-2 (1H) -pyridinone

Exemplo 130A 4-fenil-2ff-l,3-oxazina-2, 6(3H)-dionaExample 130A 4-phenyl-2 H -1,3-oxazine-2,6 (3 H) -dione

O composto em título foi preparado de acordo com o procedimento do Exemplo 127A, substituindo por benzoílacetato de etilo o 2-fenilacetoacetato de etilo para gerar o produto desejado (0,99 g, 47%). MS (DCI/NH3) m/z 188 (M+H)+; XH RMN (300 MHz, DMSO-de) δ 6,03 (s, 1H) 7,56 (m, 3H) 7,79 (m, 2H) 11, 80 (s, 1H) .The title compound was prepared according to the procedure of Example 127A, substituting ethyl benzoylacetate for ethyl 2-phenylacetoacetate to give the desired product (0.99 g, 47%). MS (DCI / NH 3) m / z 188 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 6.03 (s, 1H) 7.56 (m, 3H) 7.79 (m, 2H) 11.80 (s, 1H).

Exemplo 130B 3-benzil-4-fenil-2H-l,3-oxazina-2,6(3H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 130A o produto do Exemplo IA e por brometo de benzilo o brometo de n-butilo (0,223 g, 78%). 179 ΕΡ 1 560 827/ΡΤExample 130B The title compound was prepared according to the procedure of Example 1B substituting the product of Example 130A for the product of Example 130B. Example 130B 3-Benzyl- 1A and benzyl bromide was added n-butyl bromide (0.223 g, 78%). 179 ΕΡ 1 560 827 / ΡΤ

Exemplo 130C l-benzil-3-(1,l-dioxido-4H-l, 2,4-benzotiadiazin-3-il)-4-hidroxi-6-fenil-2(1H)-piridinona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 130B o produto do Exemplo 1B (0,021 g, 6%). MS (ESI-) m/z 456 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ 4,89 (s, 2H) 5,44 (s, 1H) 6,87 (d, J=6,99 Hz, 1H) 7,20 (m, 9H) 7,35 (m, 2H) 7,52 (ddd, J= 8,55, 7,26, 1,47 Hz, 1H) 7,63 (dd, J=7, 72, 1, 47 Hz, 1H) 16,78 (s, 1H) .Example 130C 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-6-phenyl-2 (1H) -pyridinone The title compound was prepared according to the procedure of Example 1D substituting the product of Example 130B for the product of Example 1B (0.021 g, 6%). MS (ESI-) m / z 456 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ 4.89 (s, 2H) 5.44 (s, 1H) 6.87 (d, J = 6.99 Hz, 1H) 7.20 (m, 9H) 7.35 (m, 2H) 7.52 (ddd, J = 8.55, 7.26, 1.47 Hz, 1 H) 7.63 (dd, J = 7.72, 16.78 (s, 1H).

Exemplo 131 5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-7-(3-metil-2-butenil)tieno[2,3-b]piridin-6(7H)-onaExample 131 5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-7- (3-methyl-2-butenyl) thieno [2,3- b] pyridine -6 (7H) -one

Exemplo 131A 1-(3-metilbut-2-enil)-2fl-tieno[2, 3-d][1,3]oxazina-2, 4(lfl)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto doExample 131A 1- (3-methylbut-2-enyl) -2fl-thieno [2,3-d] [1,3] oxazine-2,4 (1 H) -dione The title compound was prepared according to the procedure of Example 1B substituting the product of

Exemplo 114A o produto do Exemplo IA e substituindo por l-bromo-3-metil-but-2-eno o brometo de n-butilo (0,23 g, 82%). MS (DCI/NH3) m/z 255 (M+NH4)+; XH RMN (300 MHz, DMSO-d6) δ 1,72 (d, J=l,10 Hz, 3H) 1,79 (d, J=0,74 Hz, 3H) 4,50 (d, J=6,62 Hz, 2H) 5,23 (m, 1H) 7,28 (d, J=l,10 Hz, 2H).Example 114A The product of Example 1A and substituting 1-bromo-3-methyl-but-2-ene for n-butyl bromide (0.23 g, 82%). MS (DCI / NH 3) m / z 255 (M + NH 4) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.72 (d, J = 1.10 Hz, 3H), 1.79 (d, J = 0.74 Hz, 3H) 4.50 (d, J = 6) , 62 Hz, 2 H), 5.23 (m, 1 H), 7.28 (d, J = 1, 10 Hz, 2H).

Exemplo 131B 5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-7-(3-metil-2-butenil)tieno[2,3-b]piridin-6(7H)-ona O composto em título foi preparado de acordo com 0 procedimento do Exemplo 1D substituindo pelo produto do Exemplo 131A o produto do Exemplo 1B (0,178 g, 44%). MS (ESI-) m/z 414 (M-H) ”. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 1,69 (s, 3H) 1,82 (s, 3H) 4,51 (d, J=6,62Example 131B 5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-7- (3-methyl-2-butenyl) thieno [2,3- b] pyridine -6 (7H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 131A for the product of Example 1B (0.178 g, 44%). MS (ESI-) m / z 414 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.69 (s, 3H) 1.82 (s, 3H) 4.51 (d, J = 6.62

Hz, 2H) 5,13 (m, 1H) 6,94 (d, J= 5,52 Hz, 1H) 7,20 (m, 2H) 7,25 (m, 1H) 7,53 (ddd, J=8,27, 7, 17, 1,47 Hz, 1H) 7,64 (dd, J=1, 72, 1, 47 Hz, 1H) 16,30 (s, 1H) . 180 ΕΡ 1 560 827/ΡΤJ = 5.52 Hz, 1 H) 7.20 (m, 2 H) 7.25 (m, 1 H) 7.53 (ddd, J = = 8.27, 7.17, 1.47 Hz, 1 H) 7.64 (dd, J = 1.72, 1.47 Hz, 1 H) 16.30 (s, 1H). 180 ΕΡ 1 560 827 / ΡΤ

Exemplo 132 1, 5-dibenzil-3-(1,l-dioxido-4H-l, 2,4-benzotiadlazln-3-ll)-4-hidroxi-6-metil-2(1H)-piridinonaExample 132 1,5-dibenzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiazol-3-yl) -4-hydroxy-6-methyl-2 (1H) -pyridinone

Exemplo 132A 5-benzil-4-metil-2ff-l,3-oxazina-2,6(3H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 127A, substituindo por éster etílico de ácido 2-benzil-3-oxo-butírico o 2-fenilacetoacetato de etilo para gerar o produto desejado. MS (DCI/NH3) m/z 218 (M+H)+.Example 132A The title compound was prepared according to the procedure of Example 127A, substituting 2-benzylic acid ethyl ester for 5-benzyl-4-methyl-2 H -1,3-oxazine-2,6 (3H) -3-oxo-butyric acid or ethyl 2-phenylacetoacetate to give the desired product. MS (DCI / NH 3) m / z 218 (M + H) +.

Exemplo 132B 3,5-dibenzil-4-metil-2ff-l, 3-oxazina-2, 6(3H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 132A o produto do Exemplo IA e por brometo de benzilo o brometo de n-butilo (0,215 g, 76%).Example 132B The title compound was prepared according to the procedure of Example 1B substituting the product of Example 132A for the title compound as a white solid of Example 1A and benzyl bromide was added n-butyl bromide (0.215 g, 76%).

Exemplo 132C 1,5-dibenzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-6-metil-2(1H)-piridinona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 132B o produto do Exemplo 1B (0,051 g, 15%). MS (ESI-) m/z 484 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-de) δ 2,05 (s, 3H) 3,84 (s, 2H) 5,21 (s, 2H) 7,21 (m, 12H) 7,49 (m, 1H) 7,62 (dd, J=7,91, 1,29 Hz, 1H) 17,10 (s, 1H).Example 132C 1,5-dibenzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-6-methyl-2 (1H) -pyridinone The title compound was prepared according to the procedure of Example 1D substituting the product of Example 132B for the product of Example 1B (0.051 g, 15%). MS (ESI-) m / z 484 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d6) δ 2.05 (s, 3H) 3.84 (s, 2H) 5.21 (s, 2H) 7.21 (m, 12H) 7.49 (m, 1H ) 7.62 (dd, J = 7.91, 1.29 Hz, 1 H) 17.10 (s, 1H).

Exemplo 133 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-(2-etilbutil)- 4- hidroxi-6-metil-5-fenil-2(1H)-piridinonaExample 133 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (2-ethylbutyl) -4-hydroxy-6-methyl-5-phenyl- -pyridinone

Exemplo 133A 3-(2-etilbutil)-4-metil-5-fenil-2H-l,3-oxazina-2,6(3H)-diona 181 ΕΡ 1 560 827/ΡΤ Ο composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 127A o produto do Exemplo IA e substituindo por l-bromo-2-etilbutano o brometo de n-butilo (0,145 g, 41%). MS (DCI/nh3) m/z 288 (M+H)+.Example 133A 3- (2-ethylbutyl) -4-methyl-5-phenyl-2H-1,3-oxazine-2,6 (3H) -dione The title compound was prepared according to the procedure of Example 1B substituting the product of Example 127A for the product of Example 1A and substituting 1-bromo-2-ethylbutane for n-butyl bromide (0.145 g, 41%). MS (DCI / NH3) m / z 288 (M + H) +.

Exemplo 133B 3- (ll-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-(2-etilbutil)- 4- hidroxi-6-metil-5-fenil-2(1H)-piridinonaExample 133B 3- (11-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (2-ethylbutyl) -4-hydroxy-6-methyl-5-phenyl-2 (1H) -pyridinone

O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 133A o produto do Exemplo 1B (0,019 g, 8%). MS (ESI-) m/z 464 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ 0,88 (t, J= 7,35 Hz, 6H) 1,30 (m, 4H) 1,71 (m, 1H) 2,03 (s, 3H) 3,83 (m, 2H) 7,10 (m, 3H) 7,22 (m, 2H) 7,34 (t, J=7,17 Hz, 2H) 7,45 (ddd, J=8,27, 7, 17, 1, 47 Hz, 1H) 7,60 (dd, J=7,91, 1,29 Hz, 1H) 17,10 (s, 1H).The title compound was prepared according to the procedure of Example 1D substituting the product of Example 133A for the product of Example 1B (0.019 g, 8%). MS (ESI-) m / z 464 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.88 (t, J = 7.35 Hz, 6H) 1.30 (m, 4H) 1.71 (m, 1H) 2.03 (s, 3H) J = 7.17 Hz, 2 H), 7.45 (ddd, J = 8.27 Hz, 2H), 7.83 (m, , 7.17, 1.47 Hz, 1 H) 7.60 (dd, J = 7.91, 1.29 Hz, 1 H) 17.10 (s, 1H).

Exemplo 134 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-pentiltieno[3,2—b]piridin-5(4H)-onaExample 134 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4-pentylthieno [3,2-b] pyridin-5 (4H) -one

Exemplo 134A l-pentil-2ff-tieno[3,2-d] [1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 110A o produto do Exemplo IA e substituindo por brometo de n-pentilo 0 brometo de n-butilo (0,205 g, 72%).Example 134A 1-pentyl-2 H -thieno [3,2- d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting the product of Example 110A the product of Example 1A and substituting n-pentyl bromide for n-butyl bromide (0.205 g, 72%).

Exemplo 134B 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-pentiltieno[3,2—b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 134A o produto do Exemplo 1B (0,189 g, 53%). MS (ESI-) m/z 416 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com 0 procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 0,88 (m, 3H) 1,33 (m, 4H) 1,57 (m, 2H) 182 ΕΡ 1 560 827/ΡΤ 3,97 (m, 2Η) 7,14 (d, J=5,52 Hz, 1H) 7,18 (d, J=8,09 Hz, 1H) 7,25 (m, 1H) 7,53 (m, 1H) 7,64 (dd, J=7,91, 1,29 Hz, 1H) 7,79 (d, J=5,52 Hz, 1H) 15,96 (s, 1H).Example 134B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4-pentylthieno [3,2-b] pyridin-5 (4H) -one The compound was prepared according to the procedure of Example 1D substituting the product of Example 134A for the product of Example 1B (0.189 g, 53%). MS (ESI-) m / z 416 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ0.88 (m, 3H) 1.33 (m, 4H) 1.57 (m, 2H) 182 ΕΡ 1 560 827 / ΡΤ 3.97 (m, 7.14 (d, J = 8.09 Hz, 1 H) 7.25 (m, 1 H) 7.53 (m, 1 H) 7.64 (d, J = dd, J = 7.91, 1.29 Hz, 1 H) 7.79 (d, J = 5.52 Hz, 1 H) 15.96 (s, 1H).

Exemplo 135 5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-3-metll-7-(3-metllbutil)tieno[2,3-b]plrldln-6(7H)-onaExample 135 5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-3-methyl-7- (3-methylbutyl) thieno [2,3- b] pyridine -6 (7H) -one

Exemplo 135A 5-metil-2ff-tieno[2, 3-d] [1,3]oxazina-2,4(1H)-dlona O composto em título foi preparado a partir do éster etílico de ácido 2-amino-4-metil-tiofeno-3-carboxílico, de acordo com o procedimento de Fabis e colaboradores, como descrito em Tetrahedron, 1998, 54, 10789-10800. MS (ESI) m/z 182 (M-H) ; XH RMN (300 MHz, DMSO-D6) δ ppm 2,30 (d, J=l,47 Hz, 3H), 6,78 (s, 1H), 12,51 (s, 1H).The title compound was prepared from 2-amino-4-methyl-2 H -indole [2,3- methyl-thiophene-3-carboxylic acid according to the procedure of Fabis et al., as described in Tetrahedron, 1998, 54, 10789-10800. MS (ESI) m / z 182 (M-H); 1 H NMR (300 MHz, DMSO-D 6) δ ppm 2.30 (d, J = 1.47 Hz, 3H), 6.78 (s, 1H), 12.51 (s, 1H).

Exemplo 135B 5-metil-l-(3-metilbutil)-2H-tieno[2,3-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 135A o produto do Exemplo IA e substituindo por brometo de isopentilo o brometo de n-butilo (0,048 g, 30%). MS (DCI/NH3) m/z 254 (M+H)\ ΧΗ RMN (300 MHz, DMSO-d6) δ 0,94 (d, J= 6,25 Hz, 6H), 1,61 (m, 3H), 2,33 (d, J=l,10 Hz, 3H), 3,83 (m, 2H), 6,92 (d, J=l,10 Hz, 1H).Example 135B 5-Methyl-1- (3-methylbutyl) -2H-thieno [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to procedure of Example 1B substituting the product of Example 135A for the product of Example 1A and substituting isopentyl bromide for n-butyl bromide (0.048 g, 30%). NMR (300 MHz, DMSO-d 6) δ0.94 (d, J = 6.25 Hz, 6H), 1.61 (m, 3H) ), 2.33 (d, J = 1, 10 Hz, 3H), 3.83 (m, 2H), 6.92 (d, J = 1, 10 Hz, 1H).

Exemplo 135C 5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-3-metil-7-(3-metilbutil)tieno[2, 3-b]piridin-6(7H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 135B o produto do Exemplo 1B (0,043 g, 52%). MS (DCI/NH3) m/z 430 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 0,98 (d, J=6,25 Hz, 6H), 1,67 (m, 3H), 2,50 (s, 3H), 4,13 (m, 2H) , 7,08 (s, 1H), 7,55 (t,J=7,54 Hz, 1H) , 7,68 (d, J=8,46 Hz, 1H) , 7,77 (t, J=7,17 Hz, 1H), 7,92 (d, J=7,35 Hz, 1H), 14,30 (S, 1H), 15,22 (s, 1H) . O sal de sódio do composto em título foi 183 ΕΡ 1 560 827/ΡΤ preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ 0,97 (d, J= 6,62 Hz, 6H) , 1,56 (m, 3H) , 3,89 (m, 2H), 7,53 (m, 5H), 16,37 (br s, 1H).Example 135C 5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-3-methyl-7- (3-methylbutyl) thieno [2,3- b] pyridine -6 (7H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 135B for the product of Example 1B (0.043 g, 52%). MS (DCI / NH 3) m / z 430 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ0.98 (d, J = 6.25 Hz, 6H), 1.67 (m, 3H), 2.50 (s, 3H), 4.13 J = 7.54 Hz, 1H), 7.68 (d, J = 8.46 Hz, 1H), 7.77 (t, J = , J = 7.17 Hz, 1H), 7.92 (d, J = 7.35 Hz, 1H), 14.30 (s, 1H), 15.22 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.97 (d, J = 6.62 Hz, 6H), 1.56 (m, 3H), 3.89 (m, 2H), 7.53 , 5H), 16.37 (br s, 1H).

Exemplo 136 6-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-(4-metllpentil)tleno[3,2-b]piridin-5(4H)-onaExample 136 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4- (4-methylpenyl) ethylene [3,2- b] pyridin-5 (4H ) -one

Exemplo 136A 1-(4-metllpentil)-2fl-tieno[3,2-d][1,3]oxazina-2,4(1H)-diona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 110A o produto do Exemplo IA e substituindo por l-bromo-4-metil-pentano o brometo de n-butilo (0,110 g, 61%).Example 136A 1- (4-methylpentyl) -2fl -thieno [3,2-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting by the product of Example 110A the product of Example 1A and substituting 1-bromo-4-methylpentane for n-butyl bromide (0.110 g, 61%).

Exemplo 136B 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-(4_metilpentil)tieno[3,2-b]piridin-5(4H)-ona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 136A o produto do Exemplo 1B (0,064 g, 34%). MS (ESI-) m/z 430 (M-H)~. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 0,86 (s, 3H) 0,88 (s, 3H) 1,24 (m, J=15,81, 6,99 Hz, 2H) 1,56 (m, 3H) 3,96 (d, J= 6,99 Hz, 2H) 7,16 (m, 1H) 7,26 (t, J=7,35 Hz, 1H) 7,53 (t, J=7, 72 Hz, 1H) 7,64 (d, J=7,72 Hz, 1H) 7,80 (d, J=5,15 Hz, 1H) 15,96 (S, 1H).Example 136B 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4- (4-methylpentyl) thieno [3,2- b] pyridin-5 (4H) - one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 136A for the product of Example 1B (0.064 g, 34%). MS (ESI-) m / z 430 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.86 (s, 3H) 0.88 (s, 3H) 1.24 (m, J = 15.81, 6.99 Hz, J = 7.35 Hz, 1 H), 7.53 (t, J = 7.35 Hz, 1 H) 7, 72 Hz, 1 H) 7.64 (d, J = 7.72 Hz, 1 H) 7.80 (d, J = 5.15 Hz, 1 H) 15.96 (s, 1H).

Exemplo 137 4-(3-butenil)-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-hidroxitieno[3,2-b]piridin-5(4H)-onaExample 137 4- (3-butenyl) -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -hydroxythieno [3,2-b] pyridin-5 (4H) -one

Exemplo 137A l-but-3-enil-2ff-tieno[3,2-d] [1,3]oxazina-2,4(lff)-diona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 110A o produto do Exemplo IA e substituindo por 4-bromo-but-l-eno o brometo de n-butilo (0,09 g, 56%). 184 ΕΡ 1 560 827/ΡΤExample 137A 1-But-3-enyl-2 H -thieno [3,2-d] [1,3] oxazine-2,4 (1 H) -dione The title compound was prepared according to the procedure of Example 1B substituting by the product of Example 110A the product of Example 1A and substituting 4-bromo-but-1-ene for n-butyl bromide (0.09 g, 56%). 184 ΕΡ 1 560 827 / ΡΤ

Exemplo 137Β 4-(3-butenil)-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 137A o produto do Exemplo 1B (0,062 g, 38%). MS (ESI-) m/z 399,9 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-de) δ 2,34 (q, J=7,23 Hz, 2H) 4,04 (m, 2H) 5,05 (m, 2H) 5,87 (m, 1H) 7,18 (m, 2H) 7,25 (t, J=7,17 Hz, 1H) 7,53 (m, 1H) 7,64 (d, J=6,62 Hz, 1H) 7,79 (d, J=5,52 Hz, lH) 15,93 (s, 1H) .Example 137 4- (3-Butenyl) -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2- b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 137A for the product of Example 1B (0.062 g, 38%). MS (ESI-) m / z 399.9 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d6) δ 2.34 (q, J = 7.23 Hz, 2H) 4.04 (m, 2H) 5.05 (m, 2H) 5.87 (m, 1H) 7.18 (m, 2H) 7.25 (t, J = 7.17 Hz, 1 H) 7.53 (m, 1 H) 7.64 (d, J = 6.62 Hz, d, J = 5.52 Hz, 1H) 15.93 (s, 1H).

Exemplo 138 7-benzil-5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-fenil-1,7-di-hidro-6H-pirazolo[3,4—b]piridin-6-onaExample 138 7-Benzyl-5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1-phenyl-1,7-dihydro-6H-pyrazolo [ 3,4-b] pyridin-6-one

Exemplo 138A 5-(benzilamino)-1-fenil-l-H-pirazole-4-carboxilato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por 5-amino-l-fenil-4-pirazole-carboxilato de etilo o produto do Exemplo IA e substituindo por brometo de benzilo o brometo de n-butilo (0,990 g, 83%). MS (ESI-) m/z 320(M-H)“.Example 138A Ethyl 5- (benzylamino) -1-phenyl-1H-pyrazole-4-carboxylate The title compound was prepared according to the procedure of Example 1B substituting 5-amino-1-phenyl-4-pyrazole-carboxylate of ethyl the product of Example 1A and substituting benzyl bromide for n-butyl bromide (0.990 g, 83%). MS (ESI-) m / z 320 (M-H).

Exemplo 138B 5- [benzil(3-etoxi-3-oxopropanoíl)amino]-1-fenil-lif-pirazole- 4-carboxilato de etilo O composto em título foi preparado (51% de rendimento) a partir do produto do Exemplo 138A e cloreto de etilmalonilo de acordo com o procedimento de Rowley e colaboradores, tal como descrito em J. Med. Chem., 1993, 36, 3386-3396. MS (ESI-) m/z 434 (M-H)+.Example 138B Ethyl 5- [benzyl (3-ethoxy-3-oxopropanoyl) amino] -1-phenyl-1 H -pyrazole-4-carboxylate The title compound was prepared (51% yield) from the product of Example 138A and ethylmalonyl chloride according to the procedure of Rowley et al., as described in J. Med. Chem., 1993, 36, 3386-3396. MS (ESI-) m / z 434 (M-H) +.

Exemplo 138C 7-benzil-4-hidroxi-6-oxo-l-fenil-6,7-di-hidro-lfí-pirazolo-[3,4-b]piridina-5-carboxilato de metilo O composto em título foi preparado a partir do produto do Exemplo 138B e metóxido de sódio de acordo com o procedimento 185 ΕΡ 1 560 827/ΡΤ de Rowley e colaboradores, tal como descrito em J. Med. Chem., 1993, 36, 3386-3396. MS (ESI-) m/z 374 (M-H)&quot;.Example 138C Methyl 7-benzyl-4-hydroxy-6-oxo-1-phenyl-6,7-dihydro-1 H -pyrazolo [3,4-b] pyridine-5-carboxylate The title compound was prepared from the product of Example 138B and sodium methoxide according to procedure 185E-1560,827 / ΡΤ from Rowley et al., as described in J. Med. Chem., 1993, 36, 3386-3396. MS (ESI-) m / z 374 (M-H) &quot;.

Exemplo 138D N- [2-(aminosulfonil)fenil]-7-benzil-4-hidroxi-6-oxo-l-fenil-6, 7-di-hidro-lil-pirazolo [3,4-b] piridina-5-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 138C o produto do Exemplo 84B e por 2-amino-benzenossulfonamida a 2-amino-5-bromobenzenossulfonamida (0,014 g, 61%). MS (ESI+) m/z 516 (M+H)\Example 138D N- [2- (aminosulfonyl) phenyl] -7-benzyl-4-hydroxy-6-oxo-1-phenyl-6,7-dihydro-1H-pyrazolo [3,4- b] pyridine-5 carboxamide The title compound was prepared according to the procedure of Example 84C substituting the product of Example 138C for the product of Example 84B and 2-amino-benzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.014 g, 61%). MS (ESI +) m / z 516 (M + H) +.

Exemplo 138E 7-benzil-5-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-fenil-1,7-di-hidro-6H-pirazolo[3,4—b]piridin-6-ona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto doExample 138E 7-benzyl-5- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1-phenyl-1,7-dihydro-6H-pyrazolo [ 3,4-b] pyridin-6-one The title compound was prepared according to the procedure of Example 84D substituting

Exemplo 138D o produto do Exemplo 84C (0,061 g, 84%). MS (ESI-) m/z 496 (M-H)“. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 4,92 (s, 2H), 6,53 (m, 2H), 7,21 (m, 9H), 7,43 (t, J=7,35 Hz, 1H), 7,54 (td, J=7,81, 1,65 Hz, 1H), 7,64 (dd, J=7,91, 1,29 Hz, 1H), 7,88 (s, 1H), 16,05 (s, 1H) .Example 138D The product of Example 84C (0.061 g, 84%). MS (ESI-) m / z 496 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSOd 6) δ 4.92 (s, 2H), 6.53 (m, 2H), 7.21 (m, 9H), 7.43 (t, J = 7.35 Hz 1H), 7.64 (dd, J = 7.91, 1.29 Hz, 1H), 7.88 (s, 1H), 16.05 (s, 1H).

Exemplo 139 4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-2,7-di-hidroxi[1,3]tiazolo[4,5—b]piridin-5(4H)-onaExample 139 4-benzyl-6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -2,7-dihydroxy [1,3] thiazolo [4,5- b] pyridin-5 (4H) -one

Exemplo 139A 4-(benzilamino)-2-(metiltio)-1,3-tiazole-5-carboxilato_de metilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo por éster metílico de ácido 4-amino-2-metiltio-5-tiazolecarboxílico o produto do Exemplo IA e substituindo por brometo de benzilo o brometo de n-butilo (0,411 g, 57%). MS (ESI+) m/z 295 (M+H)+. 186 ΕΡ 1 560 827/ΡΤExample 139A 4- (Benzylamino) -2- (methylthio) -1,3-thiazole-5-carboxylate The title compound was prepared according to the procedure of Example 1B substituting 4-amino-2- methylthio-5-thiazolecarboxylic acid the product of Example 1A and substituting benzyl bromide for n-butyl bromide (0.411 g, 57%). MS (ESI +) m / z 295 (M + H) +. 186 ΕΡ 1 560 827 / ΡΤ

Exemplo 139Β 4-[benzil(3-etoxi-3-oxopropanoíl)amino]-2-(metiltio)- 1,3-tiazole-5-carboxilato de metiloExample 139 me Methyl 4- [benzyl (3-ethoxy-3-oxopropanoyl) amino] -2- (methylthio) -1,3-thiazole-5-carboxylate

O composto em título foi preparado de acordo com o procedimento do Exemplo 138B substituindo pelo produto do Exemplo 139A o produto do Exemplo 138A (0,147 g, 30%). MS (ESI+) m/z 409 (M+H)+.The title compound was prepared according to the procedure of Example 138B substituting the product of Example 139A for the product of Example 138A (0.147 g, 30%). MS (ESI +) m / z 409 (M + H) +.

Exemplo 139C 4-benzil-7-hidroxi-2-(metiltio)-5-oxo-4,5-di-hidro[1,3]-tiazolo[4,5-b]piridina-6-carboxilato de etiloExample 139C Ethyl 4-benzyl-7-hydroxy-2- (methylthio) -5-oxo-4,5-dihydro [1,3] -thiazole [4,5-b] pyridine-6-carboxylate

O composto em título foi preparado de acordo com o procedimento do Exemplo 138C substituindo pelo produto do Exemplo 139B o produto do Exemplo 138B (0,111 g, 82%). MS (ESI-) m/z 375 (M-H)'.The title compound was prepared according to the procedure of Example 138C substituting the product of Example 139B for the product of Example 138B (0.111 g, 82%). MS (ESI-) m / z 375 (M-H) +.

Exemplo 139D N- [2-(aminosulfonil)fenil]-4-benzil-7-hidroxi-2-(metiltio)-5-OXO-4,5-di-hidro[1,3]tiazolo[4,5-b]piridina-6-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 139C o produto do Exemplo 84B e por 2-aminobenzeno-sulfonamida a 2-amino-5-bromobenzenossulfonamida (0,114 g, 75%). MS (ESI-) m/z 501 (M-H)&quot;.Example 139D N- [2- (aminosulfonyl) phenyl] -4-benzyl-7-hydroxy-2- (methylthio) -5-oxo-4,5-dihydro [1,3] thiazolo [4,5- b ] pyridine-6-carboxamide The title compound was prepared according to the procedure of Example 84C substituting the product of Example 139C for the product of Example 84B and 2-aminobenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.114 g, 75%). MS (ESI-) m / z 501 (M-H) &quot;.

Exemplo 139E 4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-2,7-di-hidroxi[1,3]tiazolo[4,5-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto doExample 139E 4-benzyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -2,7-dihydroxy [1,3] thiazolo [4,5- b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 84D substituting

Exemplo 139D o produto do Exemplo 84C (0,108 g, 60%). MS (ESI-) m/z 453 (Μ-H)-. XH RMN (300 MHz, DMSO-d6) δ 5,37 (s, 2H) , 7,29 (m, 5H), 7,44 (t, J=7,72 Hz, 1H) , 7,50 (d, J=7, 72 Hz, 1H), 7,67 (td, J=7, 72, 1, 47 Hz, 1H), 7,82 (d, J=7, 72 Hz, 1H), 14,01 (s, 1H), 14,32 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento doExample 139D The product of Example 84C (0.108 g, 60%). MS (ESI-) m / z 453 (Μ-H) -. 1 H NMR (300 MHz, DMSO-d 6) δ 5.37 (s, 2H), 7.29 (m, 5H), 7.44 (t, J = 7.72 Hz, 1H), 7.50 , 7.67 (d, J = 7.72, 1.47 Hz, 1 H), 7.82 (d, J = 7.72 Hz, 1 H), 14.01 (s, 1H), 14.32 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of

Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,13 (s, 2H) , 7,04 187 ΕΡ 1 560 827/ΡΤ (d, J=8,09 Hz, 1H), 7,20 (m, 6H), 7,45 (t, J=7,35 Hz, 1H), 7,56 (d, J=7,72 Hz, 1H), 17,25 (s, 1H).Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.13 (s, 2H), 7.04 (s, 2H), 7.20 (m, 6H ), 7.45 (t, J = 7.35 Hz, 1H), 7.56 (d, J = 7.72 Hz, 1H), 17.25 (s, 1H).

Exemplo 140 4-[(2-cloro-l,3-tlazol-5-il)metil]-6-(1, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-onaExample 140 4 - [(2-chloro-1,3-thiazol-5-yl) methyl] -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythien [3,2-b] pyridin-5 (4H) -one

Exemplo 140A 1-[(2-cloro-l,3-tiazol-5-il)metil]-2ff-tieno[3, 2-d] [1,3] — oxazlna-2,4(1H)-dlona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto doExample 140A 1 - [(2-chloro-1,3-thiazol-5-yl) methyl] -2 H -thieno [3,2-d] [1,3] oxazin-2,4 (1H) -dona O The title compound was prepared according to the procedure of Example 1B substituting

Exemplo 104A o produto do Exemplo IA e substituindo por 2-cloro-5-bromometiltiazole o brometo de n-butilo (0,341 g, 75%). MS (DCI/NH3) m/z 301 (M+H) + . XH RMN (300 MHz, DMSO-d6) δ 5,35 (s, 2H), 7,60 (d, J=5,15 Hz, 1H), 7,89 (s, 1H), 8,38 (d, J=5,52 Hz, 1H).Example 104A is the product of Example 1A and substituting 2-chloro-5-bromomethylthiazole for n-butyl bromide (0.341 g, 75%). MS (DCI / NH 3) m / z 301 (M + H) +. 1H NMR (300 MHz, DMSO-d6) δ 5.35 (s, 2H), 7.60 (d, J = 5.15 Hz, 1H), 7.89 (s, 1H), 8.38 , J = 5.52 Hz, 1H).

Exemplo 140B 4-[(2-cloro-l,3-tiazol-5-il)metil]-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 140A o produto do Exemplo 1B (0,134 g, 40%). MS (ESI-) m/z 477 (M-H)'. :H RMN (300 MHz, DMSO-d6) δ 5,64 (s, 2H), 7,55 (t, J=7,17 Hz, 1H), 7,67 (d, J=7, 72 Hz, 1H), 7,78 (t, J=7,17Example 140B 4 - [(2-chloro-1,3-thiazol-5-yl) methyl] -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythien [3,2-b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 140A for the product of Example 1B (0.134 g, 40%). MS (ESI-) m / z 477 (M-H) +. 1 H NMR (300 MHz, DMSOd 6) δ 5.64 (s, 2H), 7.55 (t, J = 7.17 Hz, 1H), 7.67 (d, J = 7.72 Hz, 1H), 7.78 (t, J = 7.17

Hz, 1H), 7,86 (d,J=5,52 Hz, 1H), 7,93 (d, J=7,72 Hz, 1H), 7,95 (s, 1H), 8,43 (d, J= 5,52 Hz, 1H), 14,10 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D.7.96 (d, J = 7.72 Hz, 1H), 7.95 (s, 1H), 8.43 (d, J = d, J = 5.52 Hz, 1H), 14.10 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D.

Exemplo 141 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-[(5-metil-3-piridinil)metil]tieno[3,2-b]piridin-5(4H)-onaExample 141 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(5-methyl-3-pyridinyl) methyl] thieno [3,2- b] pyridin-5 (4H) -one

Exemplo 141A 1-[(5-metilpiridin-3-il)metil]-2H-tieno[3,2-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do 188Example 141A 1 - [(5-methylpyridin-3-yl) methyl] -2H-thieno [3,2-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to was reacted with the procedure of Example 1B substituting 188

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 110A o produto do Exemplo IA e substituindo por 3- metil-5-clorometilpiridina o brometo de n-butilo (0,255 g, 38%). MS (DCI/NH3) m/z 275 (M+H) + . RMN (300 MHz, DMSO-d6) δ 2,27 (s, 3H), 5,21 (s, 2H), 7,31 (d, J=5,52 Hz, 1H), 7,63 (s, 1H), 8,29 (d, J=5,15 Hz, 1H) , 8,34 (d, J=l,47 Hz, 1H) , 8,47 (d, J=1,84 Hz, 1H).Example 110A is the product of Example 1A and substituting 3-methyl-5-chloromethylpyridine for n-butyl bromide (0.255 g, 38%). MS (DCI / NH 3) m / z 275 (M + H) +. NMR (300 MHz, DMSO-d 6) δ 2.27 (s, 3H), 5.21 (s, 2H), 7.31 (d, J = 5.52 Hz, 1H), 7.63 (s, 8.47 (d, J = 1.84 Hz, 1 H), 8.34 (d, J = .

Exemplo 141B 6-(1,l-dioxido-4H-l,2,4-benzotladiazin-3-ll)-7-hidroxi- 4- [(5-metil-3-piridinil)metil]tieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 141A o produto do Exemplo 1B (0,175 g, 43%). MS (ESI-) m/z 451 (M-H)”. XH RMN (300 MHz, DMSO-d6) δ 2,25 (s, 3H), 5,54 (S, 2H), 7,53 (m, 3H), 7,64 (d, J=7, 72 Hz, 1H), 7,75 (td, J=7,72, 1,47 Hz, 1H), 7,92 (d, J=7,35 Hz, 1H), 8,34 (d, J=5,15 Hz, 1H),8,34 (s, 1H), 8,45 (d, &lt;7=1,4 7 Hz, 1H), 14,30 (S, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D.Example 141B 6- (1,1-dioxido-4 H -1,2,4-benzotladiazin-3-yl) -7-hydroxy-4 - [(5-methyl-3-pyridinyl) methyl] thieno [3,2- b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 141A for the product of Example 1B (0.175 g, 43%). MS (ESI-) m / z 451 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ 2.25 (s, 3H), 5.54 (S, 2H), 7.53 (m, 3H), 7.64 (d, J = 7.72 Hz) , 7.75 (td, J = 7.72, 1.47 Hz, 1H), 7.92 (d, J = 7.35 Hz, 1H), 8.34 (d, J = 15 Hz, 1H), 8.34 (s, 1H), 8.45 (d, <7 = 1.4-7 Hz, 1H), 14.30 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D.

Exemplo 142 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-[(2-meti1-1,3-tiazol-5-il)metil]tieno[3,2-b]piridin-5(4 H)-onaExample 142 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(2-methyl-1,3-thiazol-5-yl) methyl] thieno [3,2-b] pyridin-5 (4 H) -one

Exemplo 142A 1-[(2-metil-l,3-tiazol-5-il)metil]-2ff-tieno[3, 2-d] [1,3]-oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 110A o produto do Exemplo IA e substituindo por 2-metil-5-clorometiltiazole 0 brometo de n-butilo (0,308 g, 55%). MS (DCI/NH3) m/z 281 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ 2,59 (s, 3H) , 5,34 (s, 2H), 7,58 (d, J=5,52 Hz, 1H), 7,81 (s, 1H), 8,37 (d, J=5,52 Hz, 1H).Example 142A 1 - [(2-methyl-1,3-thiazol-5-yl) methyl] -2 H -thieno [3,2-d] [1,3] oxazin-2,4 (1H) -dione O The title compound was prepared according to the procedure of Example 1B substituting the product of Example 110A for the product of Example 1A and substituting 2-methyl-5-chloromethylthiazole for n-butyl bromide (0.308 g, 55%). MS (DCI / NH 3) m / z 281 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 2.59 (s, 3H), 5.34 (s, 2H), 7.58 (d, J = 5.52 Hz, 1H), 7.81 (s, , 1H), 8.37 (d, J = 5.52 Hz, 1H).

Exemplo 142B 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-[(2-metil-l,3-tiazol-5-il)metil]tieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do 189 ΕΡ 1 560 827/ΡΤExample 142B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(2-methyl-1,3-thiazol-5-yl) methyl] thieno [3,2-b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of 189 εε 1 560 827 / ΡΤ

Exemplo 142Α ο produto do Exemplo 1B (0,151 g, 40%). MS (DCI/NH3) m/z 459 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ 2,56 (s, 3H), 5,65 (s, 2H), 7,56 (t,J=7,17 Hz, 1H), 7,68 (d, J=7, 72 Hz, 1H), 7,79 (m, 3H), 7,93 (d, J=7,72 Hz, 1H), 8,42 (d, J=5,52 Hz, 1H), 14,18 (s, 1H). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D.Example 142 The product of Example 1B (0.151 g, 40%). MS (DCI / NH 3) m / z 459 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 2.56 (s, 3H), 5.65 (s, 2H), 7.56 (t, J = 7.17 Hz, 1H), 7.68 (d J = 7.72 Hz, 1H), 7.79 (m, 3H), 7.93 (d, J = 7.72 Hz, 1H), 8.42 (d, J = 5.52 Hz, 1H ), 14.18 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D.

Exemplo 143 4-[(5-cloro-2-tienil)metil]-6-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-onaExample 143 4 - [(5-chloro-2-thienyl) methyl] -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [ b] pyridin-5 (4H) -one

Exemplo 143A 1- [ (5-clorotien-2-il)metil]-2ff-tieno[3,2-d] [1,3]oxazina-2, 4 (1 ff) -diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 110A o produto do Exemplo IA e substituindo por 2-cloro-5-clorometiltiofeno o brometo de n-butilo (0,601 g, 100%) .Example 143A 1 - [(5-chlorothien-2-yl) methyl] -2 H -thieno [3,2- d] [1,3] oxazine-2,4 (1 H) -dione The title compound was prepared from according to the procedure of Example 1B substituting the product of Example 110A for the product of Example 1A and substituting 2-chloro-5-chloromethylthiophene for n-butyl bromide (0.601 g, 100%).

Exemplo 143B 4-[(5-cloro-2-tienil)metil]-6-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 143A o produto do Exemplo 1B (0,115 g, 12%). MS (APCI) m/z 478 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ 5,59 (s, 2H), 6,99 (d, J= 3,68 Hz, 1H), 7,23 (d, J=4,04 Hz, 1H), 7,56 (t, J=7,72 Hz, 1H), 7,68 (d, J=7,72 Hz, 1H) , 7,78 (m, 1H), 7,80 (d, J= 5,88 Hz, 1H), 7,93 (d, J=8,09 Hz, 1H), 8,41 (d, J=5,52 Hz, 1H), 14,18 (s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D.Example 143B 4 - [(5-chloro-2-thienyl) methyl] -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [ -b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 143A for the product of Example 1B (0.115 g, 12%). MS (APCI) m / z 478 (M + H) +. 1H NMR (300 MHz, DMSO-d6) δ 5.59 (s, 2H), 6.99 (d, J = 3.68 Hz, 1H), 7.23 (d, J = 4.04 Hz, 1H (D, J = 7.72 Hz, 1H), 7.78 (m, 1H), 7.80 (d, J = 7.72 Hz, = 5.88 Hz, 1H), 7.93 (d, J = 8.09 Hz, 1H), 8.41 (d, J = 5.52 Hz, 1H), 14.18 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D.

Exemplo 144 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-[(2-metil-l,3-tiazol-4-il)metil]tieno[3,2-b]piridin-5(4 H)-ona 190 ΕΡ 1 560 827/ΡΤExample 144 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(2-methyl-1,3-thiazol-4-yl) methyl] thieno [3,2-b] pyridin-5 (4 H) -one 190 ΕΡ 1 560 827 / ΡΤ

Exemplo 144Α 1-[(2-metil-l,3-tiazol-4-il)metil]-2ff-tieno[3, 2-d][1,3]-oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 110A o produto do Exemplo IA e substituindo por cloridrato de 2-metil-4-clorometiltiazole o brometo de n-butilo (0,200 g, 36%).Example 144 1 - [(2-methyl-1,3-thiazol-4-yl) methyl] -2 H -thieno [3,2-d] [1,3] oxazin-2,4 (1H) -dione O The title compound was prepared according to the procedure of Example 1B substituting the product of Example 110A for the product of Example 1A and substituting 2-methyl-4-chloromethylthiazole hydrochloride for n-butyl bromide (0.200 g, 36%).

Exemplo 144B 6- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-[(2-metil-l,3-tiazol-4-il)metil]tieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 144A o produto do Exemplo 1B (0,127 g, 38%). MS (ESI+) m/z 459 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ 2,60 (s, 3H), 5,55 (S, 2H) , 7,54 (t, J=6,99 Hz, 1H), 7,54 (d, J=5,52 Hz, 1H), 7,65 (d, J=7, 72 Hz, 1H), 7,76 (m, 1H) , 7,92 (d, J= 6,62 Hz, 1H), 8,34 (d, J=5,51 Hz, 1H), 14,30 (s, 1H).Example 144B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(2-methyl-1,3-thiazol-4-yl) methyl] thieno [3,2-b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 144A for the product of Example 1B (0.127 g, 38%). MS (ESI +) m / z 459 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 2.60 (s, 3H), 5.55 (S, 2H), 7.54 (t, J = 6.99 Hz, 1H), 7.54 , 7.65 (d, J = 7.72 Hz, 1H), 7.76 (m, 1H), 7.92 (d, J = 6.62 Hz, 1H) ), 8.34 (d, J = 5.51 Hz, 1H), 14.30 (s, 1H).

Exemplo 145 4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-2-(metilsulfanil)[1,3]tiazolo[4,5-b]piridin-5(4H)-onaExample 145 4-Benzyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-2- (methylsulfanyl) [1,3] thiazolo [ b] pyridin-5 (4H) -one

Exemplo 145A 4-benzil-2-(metiltio)-5H-[1,3]tiazolo[4,5-d][1,3]oxazina-5,7(4H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 139A o produto do Exemplo 3A (0, 048 g, 92%). MS (DCI/NH3) m/z 324 (M+NH4) + .Example 145A 4-Benzyl-2- (methylthio) -5 H - [1,3] thiazolo [4,5- d] [1,3] oxazine-5,7 (4H) -dione The title compound was prepared according to with the procedure of Example 3B substituting the product of Example 139A for the product of Example 3A (0.048 g, 92%). MS (DCI / NH 3) m / z 324 (M + NH 4) +.

Exemplo 145B 4-benzil-6-(1,l-dioxido-4H-l,2, 4-benzotiadiazin-3-il) -7-hidroxi-2-(metilsulfanil)[1,3]tiazolo[4,5-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 145A o produto do Exemplo 1B (0,037 g, 51%). MS (ESI) 191 ΕΡ 1 560 827/ΡΤ m/z 485 (Μ+Η) + . Ο sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 2,73 (s, 3H) , 5,31 (s, 2H), 7,25 (m, 7H), 7,53 (td, J=7, 72, 1, 47 Hz, 1H), 7,64 (dd, J=7,91, 1,29 Hz, 1H), 15,52 (s, 1H).Example 145B 4-Benzyl-6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-2- (methylsulfanyl) [1,3] thiazolo [4,5- b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 145A for the product of Example 1B (0.037 g, 51%). MS (ESI) 191 ΕΡ 1 560 827 / ΡΤ m / z 485 (Μ + Η) +. The title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.73 (s, 3H), 5.31 (s, 2H), 7.25 (m, 7H), 7.53 (td, J = 1, 47 Hz, 1H), 7.64 (dd, J = 7.91, 1.29 Hz, 1H), 15.52 (s, 1H).

Exemplo 146 4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-2-(metilsulfonil)[1,3]tiazolo[4,5-b]piridin-5(4H)-ona O composto em título foi preparado como um sólido branco a partir do produto do Exemplo 145B e ácido 3-cloroperoxi-benzóico de acordo com o procedimento de Leysen e colaboradores descrito em J. Heterocyclic Chem., 1984, 21, 401-406. MS (ESI) m/z 515 (M-H) ; ΧΗ RMN (300 MHz, DMSO-d6) δ 3,59 (s, 3H), 5,51 (s, 2H) , 7,32 (m, 5H), 7,51 (m, 2H), 7,69 (m, 1H), 7,85 (d, J=7,72 Hz, 1H), 13,95 (s, 1H).Example 146 4-benzyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-2- (methylsulfonyl) [1,3] thiazolo [ b] pyridin-5 (4H) -one The title compound was prepared as a white solid from the product of Example 145B and 3-chloroperoxybenzoic acid according to the procedure of Leysen et al., described in J. Heterocyclic Chem. , 1984, 21, 401-406. MS (ESI) m / z 515 (M-H); Δ NMR (300 MHz, DMSO-d6) δ 3.59 (s, 3H), 5.51 (s, 2H), 7.32 (m, 5H), 7.51 (m, 2H), 7.69 (m, 1H), 7.85 (d, J = 7.72 Hz, 1H), 13.95 (s, 1H).

Exemplo 147 2-amino-4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi[1,3]tiazolo[4,5-b]piridin-5(4H)-ona O produto do Exemplo 146, (0,011 g, 0,02 mmol) reagiu com amoníaco (0,5 M em dioxano, 1,3 mL, 0,64 mmol) num tubo pressurizado a 70°C durante 17 horas. A reacção foi arrefecida e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em título como um sólido branco (0,009 g, 100%). MS (ESI) m/z 452 (M-H) ; XH RMN (300 MHz, DMSO-d6) δ 5,43 (S, 2H), 6,91 (s, 1H), 7,07 (s, 1H), 7,30 (m, 4H), 7,52 (dd, J=24,27, 8, 82 Hz, 2H) , 7,69 (t, J=7,54 Hz, 1H), 7,85 (d, J=8,82 Hz, 1H), 9,03 (br s, 1H), 14,57 (br s, 1H).Example 147 2-Amino-4-benzyl-6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy [1,3] thiazolo [4,5- b] The product of Example 146, (0.011 g, 0.02 mmol) was reacted with ammonia (0.5 M in dioxane, 1.3 mL, 0.64 mmol) in a 70 ° pressurized tube C for 17 hours. The reaction was cooled and the resulting precipitate was collected by filtration and dried to give the title compound as a white solid (0.009 g, 100%). MS (ESI) m / z 452 (M-H); 1 H NMR (300 MHz, DMSO-d 6) δ 5.43 (S, 2H), 6.91 (s, 1H), 7.07 (s, 1H), 7.30 (m, 4H), 7.52 (dd, J = 24.27,8.8 Hz, 2H), 7.69 (t, J = 7.54 Hz, 1H), 7.85 (d, J = 8.82 Hz, , Î'(br s, 1H), 14.57 (br s, 1H).

Exemplo 148 4-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi[1,3]tiazolo[4,5-b]piridin-5(4H)-onaExample 148 4-Benzyl-6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy [1,3] thiazolo [4,5- b] pyridin-5- 4H) -one

O produto do Exemplo 147 (0,0085 g, 0,019 mmol) reagiu com nitrito de tert-butilo (5 pL, 0,037 mmol) em DMF (0,3 mL) a 60°C durante 1 hora. A reacção foi arrefecida e a mistura em bruto foi purificada por cromatografia em coluna com sílica gel eluindo com hexano e acetato de etilo (1:1) para gerar o composto em título como um sólido amarelo (0,0045 g, 54%). MS 192 ΕΡ 1 560 827/ΡΤ (ESI) m/z 437 (Μ-Η) ΧΗ RMN (300 ΜΗζ, DMSO-d6) δ 5,53 (s, 2Η) , 7,25 (m, 1Η), 7,31 (m, 4Η), 7,43 (m, 2Η), 7,66 (m, 1Η), 7,80 (d, J=8,46 Hz, 1H), 9,48 (s, 1H), 14,56 (br s, 1H). 759163 Exemplo 149 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi- 1-(2-fenilpropil)-1,8-naftiridin-2(1H)-onaThe product of Example 147 (0.0085 g, 0.019 mmol) was reacted with tert-butyl nitrite (5 μl, 0.037 mmol) in DMF (0.3 mL) at 60 ° C for 1 hour. The reaction was cooled and the crude mixture was purified by silica gel column chromatography eluting with hexane and ethyl acetate (1: 1) to give the title compound as a yellow solid (0.0045 g, 54%). NMR (300 ΜΗζ, DMSO-d 6) δ 5.53 (s, 2,), 7.25 (m, 1 Η), 7 , 7.46 (m, 4), 7.43 (m, 2), 7.66 (m, 1Η), 7.80 (d, J = 8.46 Hz, , 14.56 (br s, 1H). Example 149 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (2-phenylpropyl) -1,8-naphthyridin-2 (1H) - one

Exemplo 149A 2-[ (2-fenilpropil)amino]nicotinato de etilo O composto em titulo foi preparado de acordo com o procedimento do Exemplo 3A substituindo por (±)-beta-metil-fenetilamina a 2-etil-butilamina (0,44 g, 58%). MS (DCI+) m/z 285 (M+H) 1tt RMN (300 MHz, DMSO-d6) δ 1,25 (m, 6H) , 3,07 (m, 1H), 3,64 (m, 3H), 4,22 (q, J=6,99 Hz, 1H), 6,61 (dd, J=7,72, 4,78 Hz, 1H), 7,21 (m, 1H), 7,30 (m, 4H), 7,87 (t, J=5,52 Hz, 1H), 8,05 (m, 1H), 8,29 (m, 1H).Example 149A Ethyl 2 - [(2-phenylpropyl) amino] nicotinate The title compound was prepared according to the procedure of Example 3A substituting 2-ethylbutylamine for (±) -beta-methyl-phenethylamine (0.44 g, 58%). NMR (300 MHz, DMSO-d 6) δ 1.25 (m, 6H), 3.07 (m, 1H), 3.64 (m, 3H) , 4.22 (q, J = 6.99Hz, 1H), 6.61 (dd, J = 7.72, 4.78 Hz, 1H), 7.21 (m, 1H), 7.30 ( m, 4H), 7.87 (t, J = 5.52 Hz, 1H), 8.05 (m, 1H), 8.29 (m, 1H).

Exemplo 149B 1- (2-fenilpropil) -2i7-pirido [2,3-d] [1,3] oxazina-2, 4 (1H) -diona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 149A o produto do Exemplo 3A (0,44 g, 99%). MS (DCI+) m/z 283 (M+H) } XH RMN (300 MHz, DMSO-d6) δ 1,26 (d, J=6,99 Hz, 3H), 3,37 (m, 1H), 4,21 (dd, J=13,24, 6,25 Hz, 1H), 4,36 (m, 1H), 7,21 (m, 1H), 7,29 (m, 4H) , 7,38 (dd, J=7, 72, 4, 78 Hz, 1H), 8,39 (dd, J=7, 72, 1, 84 Hz, 1H) , 8,77 (dd, J=4,78, 1,84Example 149B 1- (2-phenylpropyl) -2,7-pyrido [2,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 3B substituting by the product of Example 149A the product of Example 3A (0.44 g, 99%). NMR (300 MHz, DMSO-d 6) δ 1.26 (d, J = 6.99 Hz, 3H), 3.37 (m, 1H), 4.21 (dd, J = 13.24, 6.25 Hz, 1H), 4.36 (m, 1H), 7.21 (m, 1H), 7.29 (m, 4H), 7.38 (dd, J = 7.72, 1.84 Hz, 1H), 8.77 (dd, J = 4.78, 1) , 84

Hz, 1H).Hz, 1H).

Exemplo 149C 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(2-fenilpropil)-1,8-naftiridin-2(1H)-ona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 149B o produto do Exemplo 1B (0,045 g, 62%). MS (ESI-) m/z 459 (M-H) :H RMN (300 MHz, DMSO-D6) δ 1,23 (d, J=7,35 Hz, 3H), 3,47 (m, 1H), 4,59 (dd, J=12,50, 6,62 Hz, 1H), 4,75 (m, 1H), 7,16 (m, 1H), 7,28 (m, 4H) , 7,45 (dd, J=7,91, 4,60 Hz, 1H), 7,56 (t, J=7,54 Hz, 1H), 7,69 (m, 1H), 7,78 (m, 1H), 7,93 193 ΕΡ 1 560 827/ΡΤ (d, J=8,09 Hz, 1H), 8,53 (dd, J=8,09, 1,84 Hz, 1H), 8,80 (dd, J=4, 60, 1, 65 Hz, 1H), 14,13 (br s, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1R RMN (300 MHz, DMSO-D6) δ 1,12 (d, J=6,99 Hz, 3H), 3,42 (m, 1H) , 4,30 (dd, J=12,50, 5, 52 Hz, 1H), 4,67 (dd, J=12, 32, 9, 74 Hz, 1H), 7,12 (dd, 0=1,12, 4,78 Hz, 1H) , 7,18 (m, 1H), 7,30 (m, 6H) , 7,56 (m, 1H), 7,67 (d, J=7,72 Hz, 1H), 8,36 (dd, J=7, 54, 2, 02 Hz, 1H) , 8,50 (dd, J=4, 78, 1, 84 Hz, 1H) , 15, 92 (s, 1H) .Example 149C 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (2-phenylpropyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 149B for the product of Example 1B (0.045 g, 62%). 1 H NMR (300 MHz, DMSO-D 6) δ 1.23 (d, J = 7.35 Hz, 3H), 3.47 (m, 1H), 4 , 7.75 (m, 1H), 7.16 (m, 1H), 7.28 (m, 4H), 7.45 (m, 1H) dd, J = 7.91, 4.60 Hz, 1H), 7.56 (t, J = 7.54 Hz, 1H), 7.69 (m, 1H), 7.78 (m, 1H), (D, J = 8.09 Hz, 1 H), 8.53 (dd, J = 8.09, 1.84 Hz, 1 H), 8.80 (dd, J = = 4.60, 1.65 Hz, 1H), 14.13 (br s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-D 6) δ 1.12 (d, J = 6.99 Hz, 3H), 3.42 (m, 1H), 4.30 (dd, (Dd, J = 12, 32, 9, 74 Hz, 1H), 7.12 (dd, J = 1.12, 4.78 Hz, 1H), 7.18 (dd, m, 1H), 7.30 (m, 6H), 7.56 (m, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.36 (dd, J = , 2.02 (1H, s), 8.50 (dd, J = 4.78, 1.84 Hz, 1H), 15.92 (s, 1H).

Exemplo 150 8-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-5-hidroxi-2-(metilsulfanil)pirido[2,3—d]pirimidin-7(8H)-onaExample 150 8-Benzyl-6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -5-hydroxy-2- (methylsulfanyl) pyrido [2,3- d] pyrimidin-7 (8H) -one

Exemplo 150A 4-(benzilamino)-2-(metiltio)pirimidina-5-carboxilato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 108A substituindo por benzilamina o l-amino-2-etil-butano (0,97 g, 92%). MS (DCI/NH3) m/z 304 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ 1,32 (q, J=7,48 Hz, 3H) 2,41 (s, 3H) 4,30 (q, J=7,ll Hz, 2H) 4,73 (d, J=5,88 Hz, 2H) 7,30 (m, 5H) 8,58 (s, 1H) 8,89 (t, J=5, 70 Hz, 1H).Example 150A Ethyl 4- (benzylamino) -2- (methylthio) pyrimidine-5-carboxylate The title compound was prepared according to the procedure of Example 108A substituting benzylamine for 1-amino-2-ethyl- 97 g, 92%). MS (DCI / NH 3) m / z 304 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 1.32 (q, J = 7.48 Hz, 3 H) 2.41 (s, 3H) 4.30 (q, J = 7.1 Hz, 2H) 4 , 73 (d, J = 5.88 Hz, 2 H) 7.30 (m, 5H) 8.58 (s, 1 H) 8.89 (t, J = 5.70 Hz, 1H).

Exemplo 150B ácido 4-(benzilamino)-2-(metiltio)pirimidina-5-carboxílico O composto em título foi preparado de acordo com o procedimento do Exemplo 108B substituindo pelo produto do Exemplo 150A o produto do Exemplo 108A. (0,185 g, 78%).Example 150B 4- (Benzylamino) -2- (methylthio) pyrimidine-5-carboxylic acid The title compound was prepared according to the procedure of Example 108B substituting the product of Example 150A for the product of Example 108A. (0.185 g, 78%).

Exemplo 150C l-benzil-7-(metiltio)-2ff-pirimido[4, 5-d] [1,3]oxazina-2,4(1H)-dionaExample 150C 1-Benzyl-7- (methylthio) -2H-pyrimido [4,5-d] [1,3] oxazine-2,4 (1H) -dione

O composto em título foi preparado de acordo com o procedimento do Exemplo 108C substituindo pelo produto do Exemplo 150B o produto do Exemplo 108B (0,145 g, 72%). MS (DCI/NH3) m/z 302 (M+H)+. 194The title compound was prepared according to the procedure of Example 108C substituting the product of Example 150B for the product of Example 108B (0.145 g, 72%). MS (DCI / NH 3) m / z 302 (M + H) +. 194

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 150D 8-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-5-hidroxi-2-(metilsulfanil)pirido[2,3-d]pirimidin-7(8 H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 150C o produto do Exemplo 1B (0,042 g, 18%). MS (ESI) m/z 478 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ 2,48 (s, 3H) 5,41 (s, 2H) 7,26 (m, 7H) 7,57 (m, 1H) 7,67 (dd, J=7,54, 0,92 Hz, 1H) 8,91 (s, 1H) 15,42 (s, 1H) .Example 150D 8-Benzyl-6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -5-hydroxy-2- (methylsulfanyl) pyrido [2,3- d] pyrimidin-7 (8 H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 150C for the product of Example 1B (0.042 g, 18%). MS (ESI) m / z 478 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ 2.48 (s, 3H) 5.41 (s, 2H) 7.26 (m, 7H) 7.57 (m, 1H) 7.67 (dd, J = 7.54, 0.92 Hz, 1 H) 8.91 (s, 1 H) 15.42 (s, 1H).

Exemplo 151 8-benzil-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-5-hidroxipirido[2,3—d]pirimidin-7(8H)-onaExample 151 8-Benzyl-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -5-hydroxypyrido [2,3-d] pyrimidin-7 (8H) -one

O composto em título foi preparado de acordo com o procedimento do Exemplo 109 substituindo pelo produto do Exemplo 151D o produto do Exemplo 108D (0,019 g, 58%). MS (ESI-) m/z 432 (M-H)-; XH RMN (300 MHz, DMSO-d6) δ 5,44 (s, 2H) 7,20 (m, 1H) 7,30 (m, 7H) 7,57 (m, 1H) 7,68 (d, J=8,09 Hz, 1H) 8,94 (s, 1H) 9,12 (s, 1H) 15,32 (s, 1H).The title compound was prepared according to the procedure of Example 109 substituting the product of Example 151D for the product of Example 108D (0.019 g, 58%). MS (ESI-) m / z 432 (M-H) -; 1 H NMR (300 MHz, DMSO-d 6) δ 5.44 (s, 2H) 7.20 (m, 1H) 7.30 (m, 7H) 7.57 (m, 1H) 7.68 (d, J = = 8.09 Hz, 1 H) 8.94 (s, 1 H) 9.12 (s, 1 H) 15.32 (s, 1H).

Exemplo 152 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(3-hidroxibutil)-2(1H)-quinolinonaExample 152 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-hydroxybutyl) -2 (1H) -quinolinone

Uma solução do produto do Exemplo 73 (0,12 g, 0,30 mmol) em tetra-hidrofurano (6 mL) foi tratada com brometo de metilmagnésio 3,0 M (0,11 mL, 0,33 mmol) a -50°C, depois agitada a temperatura ambiente durante 1 hora. A solução foi diluída com HC1 IN e água e depois filtrada. O sólido resultante foi triturado com diclorometano e filtrado. O filtrado foi concentrado para gerar o composto em título (0, 050 g, 40%). MS (DCI/NH3) m/z 415 (M+H)+; XH RMN (300 MHz, DMSO-de) δ 1,14 (d, J= 6,25 Hz, 3H) 1,75 (dd, J=9,19, 5,52 Hz, 2H) 3,78 (m, 1H) 4,57 (m, 2H) 7,54 (m, 2H) 7,77 (m, 2H) 7,94 (d, J=7,35 Hz, 1H) 8,58 (dd, J=7,91, 2,02 Hz, 1H) 8,90 (dd, J=4, 78, 1, 84 Hz, 1H) 14,12 (s, 1H) . 195 ΕΡ 1 560 827/ΡΤA solution of the product of Example 73 (0.12 g, 0.30 mmol) in tetrahydrofuran (6 mL) was treated with 3.0 M methylmagnesium bromide (0.11 mL, 0.33 mmol) at -50 Followed by stirring at room temperature for 1 hour. The solution was diluted with 1N HCl and water and then filtered. The resulting solid was triturated with dichloromethane and filtered. The filtrate was concentrated to give the title compound (0.050 g, 40%). MS (DCI / NH 3) m / z 415 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 1.14 (d, J = 6.25 Hz, 3 H) 1.75 (dd, J = 9.19, 5.52 Hz, 2 H) 3.78 1H), 4.57 (m, 2H) 7.54 (m, 2H) 7.77 (m, 2H) 7.94 (d, J = 7.35 Hz, 1 H) 8.58 (dd, J = 7.91, 2.02 Hz, 1 H) 8.90 (dd, J = 4.78, 1.84 Hz, 1 H) 14.12 (s, 1H). 195 ΕΡ 1 560 827 / ΡΤ

Exemplo 153 l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxitieno[3,4-b]piridin-2(1H)-onaExample 153 1-benzyl-3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxythieno [3,4-b] pyridin-2 (1H) -one

Exemplo 153A 4ff-tieno[3,4-d] [1,3]oxazina-2, 4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 119A substituindo por cloridrato de 3-aminotiofeno-5-carboxilato de etilo o 3-amino-5-fenil-tiofeno-carboxilato de metilo (0,86 g, 50%). MS (DCI/NH3) m/z 187 (M+NH4)+; :Η RMN (300 MHz, DMSO-d6) δ 6,90 (d, J=9,93 Hz, 1H) 8,65 (d, J=9,93 Hz, 1H) 11,57 (brs, 1H).Example 153A 4 H -thieno [3,4- d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 119A substituting 3-aminothiophene-5 -carboxylate or methyl 3-amino-5-phenyl-thiophene-carboxylate (0.86 g, 50%). MS (DCI / NH 3) m / z 187 (M + NH 4) +; NMR (300 MHz, DMSO-d 6) δ 6.90 (d, J = 9.93 Hz, 1 H) 8.65 (d, J = 9.93 Hz, 1 H) 11.57 (brs, 1H) .

Exemplo 153B l-benzil-4i7-tieno [3,4-d] [1,3] oxazina-2, 4(1 H) -diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 153A o produto do Exemplo IA e substituindo por brometo de benzilo o brometo de n-butilo (0,33 g, 91%).Example 153B 1-Benzyl-4,7-thieno [3,4-d] [1,3] oxazine-2,4 (1 H) -dione The title compound was prepared according to the procedure of Example 1B substituting Example 153A The product of Example 1A and substituting benzyl bromide for n-butyl bromide (0.33 g, 91%).

Exemplo 153C l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxitieno[3,4-b]piridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 153B o produto do Exemplo 1B (0,028 g, 5%). MS (ESI-) m/z 436 (M-H) XH RMN (300 MHz, DMSO-d6) δ 5,13 (s, 2H) 6,68 (d, J=3,31 Hz, 1H) 7,21 (m, 2H) 7,28 (m, 5H) 7,54 (m, 1H) 7,64 (m, 1H) 7,99 (d, J=3,31 Hz, 1H) 15,83 (s, 1H).Example 153C 1-Benzyl-3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxythieno [3,4-b] pyridin-2 (1H) was prepared according to the procedure of Example 1D substituting the product of Example 153B for the product of Example 1B (0.028 g, 5%). NMR (300 MHz, DMSO-d 6) δ 5.13 (s, 2H) 6.68 (d, J = 3.31 Hz, 1 H) 7.21 (d, J = m, 2H) 7.28 (m, 5H) 7.54 (m, 1H) 7.64 (m, 1H) 7.99 (d, J = 3.31 Hz, 1H) 15.83 (s, 1H ).

Exemplo 154 4-[(5-bromo-2-tienil)metil]-6-(1, l-dioxido-4H-l, 2, 4-benzo-tiadiazin-3-il)-7-hidroxitieno[3,2—b]piridin-5(4H)-onaExample 154 4 - [(5-bromo-2-thienyl) methyl] -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [ B] pyridin-5 (4H) -one

Exemplo 154A 1-[(5-bromotien-2-il)metil]-2ff-tieno[3, 2-d] [1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do 196 ΕΡ 1 560 827/ΡΤExample 154A 1 - [(5-bromothien-2-yl) methyl] -2 H -thieno [3,2-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to was reacted with the procedure of Example 1B substituting the product of 196 ÅΡ 1 560 827 / ΡΤ

Exemplo 110Α ο produto do Exemplo IA e substituindo por 2-bromo-5-bromometil-tiofeno o brometo de n-butilo (0,25 g, 82%) .Example 110 is the product of Example 1A and substituting 2-bromo-5-bromomethyl-thiophene for n-butyl bromide (0.25 g, 82%).

Exemplo 154B 4-[(5-bromo-2-tienil)metil]-6-(1,l-dioxido-4H-l, 2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2—b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 154A o produto do Exemplo 1B (0,219 g, 58%). MS (ESI-) m/z 521 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,28 (s, 2H) 7,02 (d, J= 3,68 Hz, 1H) 7,09 (d, J= 3,68 Hz, 1H) 7,20 (d, J= 8,09 Hz, 1H) 7,27 (m, 1H) 7,37 (d J=5,15 Hz, 1H) 7,54 (ddd, J=8,55, 7,26, 1, 47 Hz, 1H) 7,66 (dd, J=7, 72, 1, 47 Hz, 1H) 7,81 (d, J= 5,15 Hz, 1H) 15,80 (s, 1H) .Example 154B 4 - [(5-bromo-2-thienyl) methyl] -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2- b ] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 154A for the product of Example 1B (0.219 g, 58%). MS (ESI-) m / z 521 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.28 (s, 2H) 7.02 (d, J = 3.68 Hz, 1 H) 7.09 (d, J = 3.68 Hz, (D, J = 5.15 Hz, 1 H), 7.54 (ddd, J = 8.55, 7.9 Hz, J = 7.72, 1.47 Hz, 1 H) 7.81 (d, J = 5.15 Hz, 1 H) 15.80 (s, 1H ).

Exemplo 155 l-butil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-2(1H)-piridinonaExample 155 1-Butyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -2 (1H) -pyridinone

Exemplo 155A ácido l-butil-2-oxo-l,2-di-hidropiridina-3-carboxílico A uma solução de ácido 2-hidroxi-nicotínico (0,50 g, 3,59 mmol) e hidróxido de potássio (0,40 g, 7,13 mmol) em metanol:água 4:1 (6 mL) a temperatura ambiente, juntou-se 1-iodobutano (0,74 mL, 6,42 mmol). Esta solução foi aquecida a 60°C durante 30 minutos, depois arrefecida até temperatura ambiente e diluída com água e HC1 IN. O sólido resultante foi filtrado e seco para gerar o composto em título (0,27 g, 39%). MS (DCl/NHa) m/z 196 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 0,91 (m, 3H) 1,30 (m, 2H) 1,69 (m, 2H) 4,10 (m, 2H) 6,73 (m, 1H) 8,27 (dd, J= 6,62, 1, 84 Hz, 1H) 8,38 (dd, J=7,35, 2,21 Hz, 1H) 14, 68 (s, 1H) .To a solution of 2-hydroxy-nicotinic acid (0.50 g, 3.59 mmol) and potassium hydroxide (0.32 g, 3.59 mmol) in dichloromethane 40 g, 7.13 mmol) in 4: 1 methanol: water (6 mL) at room temperature, 1-iodobutane (0.74 mL, 6.42 mmol) was added. This solution was heated at 60 ° C for 30 minutes, then cooled to room temperature and diluted with water and 1N HCl. The resulting solid was filtered and dried to give the title compound (0.27 g, 39%). MS (DCl / NHa) m / z 196 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ0.91 (m, 3H) 1.30 (m, 2H) 1.69 (m, 2H) 4.10 (m, 2H) 6.73 (m, 1H ) 8.27 (dd, J = 6.62, 1.84 Hz, 1 H) 8.38 (dd, J = 7.35, 2.21 Hz, 1 H) 14.68 (s, 1H).

Exemplo 155B N- [2-(aminosulfonil)fenil]-l-butil-2-oxo-l,2-di-hidropiridina-3-carboxamidaExample 155B N- [2- (aminosulfonyl) phenyl] -1-butyl-2-oxo-1,2-dihydropyridine-3-carboxamide

Uma solução do produto do Exemplo 155A e 2-aminobenzeno-sulfonamida (0,24 g, 1,39 mmol) em tetra-hidrofurano (8 mL) a 197 ΕΡ 1 560 827/ΡΤ temperatura ambiente e tratada com TBTU (tetrafluoroborato de 0- (lH-benzotriazol-l-il)-N,N,Ν',Ν'-tetrametilurónio) e trietilamina (0,58 mL, 4,15 mmol). Após 18 horas, a mistura foi vertida em água, extraida com acetato de etilo, seca sobre sulfato de sódio, filtrada e o filtrado evaporado sob vácuo e purificado por HPLC preparativa numa coluna Waters Symmetry C8 (40 mm x 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% a 100% de acetonitrilo: TFA aquoso a 0,1% durante 12 minutos (15 minutos de tempo de ensaio) a um caudal de 70 mL/min para gerar o composto em titulo.A solution of the product of Example 155A and 2-aminobenzenesulfonamide (0.24 g, 1.39 mmol) in tetrahydrofuran (8 mL) at 197 Å ø1 560 827 / ΡΤ RT and treated with TBTU (tetrafluoroborate - (1H-benzotriazol-1-yl) -N, N, N ', Ν'-tetramethyluronium hexafluorophosphate) and triethylamine (0.58 mL, 4.15 mmol). After 18 hours, the mixture was poured into water, extracted with ethyl acetate, dried over sodium sulfate, filtered and the filtrate evaporated in vacuo and purified by preparative HPLC on a Waters Symmetry C8 column (40 mm x 100 mm, 7 pm particle size) using a gradient of 10% to 100% acetonitrile: 0.1% aqueous TFA for 12 minutes (15 minutes test time) at a flow rate of 70 mL / min to give the title compound.

Exemplo 155C 1- butil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-2(1H)-piridinona O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84D e purificado por HPLC preparativa numa coluna Waters Symmetry C8 (40 mm x 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% a 100% de acetonitrilo:TFA aquoso a 0,1% durante 12 minutos (15 minutos de tempo de ensaio) a um caudal de 70 mL/min. MS (DCI/NH3) m/z 332 (M+H)+. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. 1R RMN (300 MHz, DMSO-de) δ 0,93 (t, J=7,35 Hz, 3H) 1,34 (td, J=14, 89, 7, 35 Hz, 2H) 1,73 (ddd, J=14, 89, 7, 72, 7, 54 Hz, 2H) 4,13 (m, 2H) 6,73 (dd, J=7, 35, 6,62 Hz, 1H) 7,50 (m, 1H) 7,59 (d,J=7,35 Hz, 1H) 7,71 (m, 1H) 7,85 (dd, J=7,91, 1,29 Hz, 1H) 8,30 (dd, J=6,43, 2,02 Hz, 1H) 8,62 (dd, J=7, 54, 2, 02 Hz, 1H) 13,76 (s, 1H) .Example 155C 1-Butyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -2 (1H) -pyridinone The title compound was prepared according to the procedure of Example 84D and purified by preparative HPLC on a Waters Symmetry C8 column (40 mm x 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile: 0.1% aqueous TFA for 12 minutes (15 minutes of time of assay) at a flow rate of 70 mL / min. MS (DCI / NH 3) m / z 332 (M + H) +. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ0.93 (t, J = 7.35 Hz, 3H) 1.34 (dd, J = 14, 89, (M, 2H), 6.73 (dd, J = 7, 35, 6.62 Hz, 1 H), 7.50 (m, , 1H), 7.59 (d, J = 7.35 Hz, 1 H) 7.71 (m, 1 H) 7.85 (dd, J = 7.91, 1.29 Hz, , J = 6.43, 2.02 Hz, 1 H) 8.62 (dd, J = 7, 54, 2.02 Hz, 1 H) 13.76 (s, 1H).

Exemplo 156 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1,8-naftiridina-2,4-diol O produto do Exemplo 73 (0,12 g, 0,30 mmol) em tetra-hidrofurano (6 mL) reagiu com brometo de metilmagnésio 3,0M (0,11 mL, 0,33 mmol) a -50°C e foi depois agitado a temperatura ambiente durante 1 hora. A solução foi diluída com HC1 IN e filtrado. O sólido resultante foi triturado com diclorometano e filtrado para gerar o produto. MS (DCI/NH3) m/z 343 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 7,46 (dd, J=7,91, 4,60 Hz, 1H) 7,57 (m, 1H) 7,64 (d, J=7, 72 Hz, 1H) 7,79 (ddd, i7=8,36, 7,26, 1,29 Hz, 1H) 7,94 (d,J=7,35 Hz, 1H) 8,49 (dd, 198 ΕΡ 1 560 827/ΡΤ J= 8, 09, 1, 84 Hz, 1Η) 8,80 (dd, J=4, 60, 1, 65 Hz, 1H) 12,92 (s, 1H) 14,28 (s, 1H).Example 156 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridine-2,4-diol The product of Example 73 (0.12 g, 30 mmol) in tetrahydrofuran (6 mL) was reacted with 3.0M methylmagnesium bromide (0.11 mL, 0.33 mmol) at -50 ° C and was then stirred at room temperature for 1 hour. The solution was diluted with 1N HCl and filtered. The resulting solid was triturated with dichloromethane and filtered to give the product. MS (DCI / NH 3) m / z 343 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 7.46 (dd, J = 7.91, 4.60 Hz, 1 H) 7.57 (m, 1 H) 7.64 (d, J = 7.72 Hz 1H), 7.79 (ddd, J = 8.36, 7.26, 1.29 Hz, 1 H) 7.94 (d, J = 7.35 Hz, 1 H) 8.49 (dd, 560 827 / ΡΤ J = 8.99, 1.84 Hz, 1) 8.80 (dd, J = 4.60,1.6 Hz, 1H) 12.92 (s, 1H) 14.28 (s, 1H).

Exemplo 157 1-(benziloxi)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 157 1- (benzyloxy) -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

Exemplo 157A 2- [ (benziloxi)amino]nicotinato de etilo Éster etílico de ácido 2-cloro-nicotínico (4,55 g, 24,6 mmol), cloridrato de O-benzil-hidroxiamina (7,85 g, 49,2 mmol) e N, N-diisopropile ti lamina (6,36 g, 49,2 mmol) em 10 mL de 1,4-dioxano reagiram num tubo selado a 120°C durante 48 horas. A mistura reaccional foi repartida entre acetato de etilo e bicarbonato de sódio aquoso a 5%. A fase aquosa foi re-extraída com acetato de etilo (2 x 50 mL) . As fases orgânicas foram combinadas e secas sobre sulfato de sódio, filtradas e concentradas. O resíduo foi purificado por cromatografia em coluna em sílica gel eluindo com hexano e acetato de etilo (9:1) para proporcionar o composto em título (3,5 g, 53%). MS (DCI) m/z 273 (M+H)+.Example 157A Ethyl 2 - [(benzyloxy) amino] nicotinate 2-Chloro-nicotinic acid ethyl ester (4.55 g, 24.6 mmol), O-benzylhydroxyamine hydrochloride (7.85 g, 49.2 mmol) mmol) and N, N-diisopropylethylamine (6.36 g, 49.2 mmol) in 10 mL of 1,4-dioxane were reacted in a sealed tube at 120 ° C for 48 hours. The reaction mixture was partitioned between ethyl acetate and 5% aqueous sodium bicarbonate. The aqueous layer was re-extracted with ethyl acetate (2 x 50 mL). The organic phases were combined and dried over sodium sulfate, filtered and concentrated. The residue was purified by silica gel column chromatography eluting with hexane and ethyl acetate (9: 1) to provide the title compound (3.5 g, 53%). MS (DCI) m / z 273 (M + H) +.

Exemplo 157B 2-[(benziloxi)(3-etoxi-3-oxopropanoíl)amino]nicotinato de etiloExample 157B Ethyl 2 - [(benzyloxy) (3-ethoxy-3-oxopropanoyl) amino] nicotinate

Uma solução do produto do Exemplo 157A (1,2 g, 4,4 mmol) e trietilamina (0,49 g, 4,8 mmol) em diclorometano (25 mL) foi tratada gota a gota com cloromalonato de etilo (0,73 g, 4,8 mmol), agitada durante 2 horas e repartida entre acetato de etilo e água e as fases foram separadas. A fase de acetato de etilo lavada com salmoura, seca (Na2S04) e concentrada. O resíduo foi purificado por cromatografia em coluna em sílica gel eluindo com hexano e acetato de etilo (3:1) para originar o composto em título (1,1 g, 65%). MS (DCI) m/z 387 (M+H)+.A solution of the product of Example 157A (1.2 g, 4.4 mmol) and triethylamine (0.49 g, 4.8 mmol) in dichloromethane (25 mL) was treated dropwise with ethyl chloromalonate (0.73 4.8 mmol), stirred for 2 hours and partitioned between ethyl acetate and water and the phases were separated. The ethyl acetate layer washed with brine, dried (Na 2 SO 4) and concentrated. The residue was purified by silica gel column chromatography eluting with hexane and ethyl acetate (3: 1) to give the title compound (1.1 g, 65%). MS (DCI) m / z 387 (M + H) +.

Exemplo 157C 1-(benziloxi)-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridina- 3-carboxilato de etiloExample 157C Ethyl 1- (benzyloxy) -4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxylate

Uma solução do produto do Exemplo 157B (0,386 g, 1,0 mmol) em etanol (5 mL) foi tratada com 21% etóxido de sódio em 199 ΕΡ 1 560 827/ΡΤ etanol (0,324 g, 1,0 mmol), agitada durante 30 minutos e repartida entre acetato de etilo e HC1 aquoso a 5% e as fases foram separadas. A fase de acetato de etilo foi lavada com salmoura, seca (Na2S04) e concentrada para proporcionar o composto em titulo (0,28 g, 82%). MS (DCI) m/z 341(M+H)+.A solution of the product of Example 157B (0.386 g, 1.0 mmol) in ethanol (5 mL) was treated with 21% sodium ethoxide in 199 Ρ Ρ 1 560 827 / ΡΤ ethanol (0.324 g, 1.0 mmol), stirred for 30 minutes and partitioned between ethyl acetate and 5% aqueous HCl and the phases were separated. The ethyl acetate layer was washed with brine, dried (Na 2 SO 4) and concentrated to provide the title compound (0.28 g, 82%). MS (DCI) m / z 341 (M + H) +.

Exemplo 157D N- [2-(aminosulfonil)fenil]-1-(benziloxi)-4-hidroxi-2-oxo-1,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 157C o produto do Exemplo 84B e substituindo por 2-aminossulfonamida o produto do Exemplo 84A (340 mg, 89% de rendimento). MS (DCI) m/z 467 (M+H)+.Example 157D N- [2- (aminosulfonyl) phenyl] -1- (benzyloxy) -4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting the product of Example 157C for the product of Example 84B and substituting 2-aminosulfonamide for the product of Example 84A (340 mg, 89% yield). MS (DCI) m / z 467 (M + H) +.

Exemplo 157E 1-(benziloxi)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 157E 1- (Benzyloxy) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one

O composto em titulo foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 157D o produto do Exemplo 84C (0,082 g, 87%). MS (ESI-) m/z 447 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,12 (s, 2H) 7,22 (dd, J=7,72, 4,78 Hz, 1H) 7,30 (m, 2H) 7,44 (m, 3H) 7,57 (m, 1H) 7,70 (m, 3H) 8,41 (dd, J=7,72, 1, 84 Hz, 1H) 8,61 (dd, J= 4, 78, 1, 84 Hz, 1H) 15, 70 (S, 1H) .The title compound was prepared according to the procedure of Example 84D substituting the product of Example 157D for the product of Example 84C (0.082 g, 87%). MS (ESI-) m / z 447 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.12 (s, 2H) 7.22 (dd, J = 7.72, 4.78 Hz, 1 H) 7.30 (m, 2 H) 7.44 ( m, 3H) 7.57 (m, 1H) 7.70 (m, 3H) 8.41 (dd, J = 7.72, 1.84 Hz, 1 H) 8.61 (dd, J = , 1.84 Hz, 1 H) 15.71 (s, 1H).

Exemplo 158 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-isobutoxi-l,8-naftiridin-2(1H)-onaExample 158 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1-isobutoxy-1,8-naphthyridin-2 (1H) -one

Exemplo 158A 2-(isobutoxiamino)nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 157A substituindo por cloridrato de O-isobutil-hidroxilamina o cloridrato de O-benzil-hidroxiamina (0,372 g, 34%). MS (DCI) m/z 239 (M+H)+. 200 ΕΡ 1 560 827/ΡΤExample 158A Ethyl 2- (isobutoxyamino) nicotinate The title compound was prepared according to the procedure of Example 157A substituting O-isobutylhydroxylamine hydrochloride and O-benzylhydroxyamine hydrochloride (0.372 g, 34%). MS (DCI) m / z 239 (M + H) +. 200 ΕΡ 1 560 827 / ΡΤ

Exemplo 158Β 2-[(3-etoxi-3-oxopropanoíl)(isobutoxi)amino]nicotinato de etiloExample 158 Ethyl 2 - [(3-ethoxy-3-oxopropanoyl) (isobutoxy) amino] nicotinate

O composto em título foi preparado de acordo com o procedimento do Exemplo 157B substituindo pelo produto do Exemplo 158A o produto do Exemplo 157A (0,230 g, 42%). MS (DCI) m/z 353 (M+H)+.The title compound was prepared according to the procedure of Example 157B substituting the product of Example 158A for the product of Example 157A (0.230 g, 42%). MS (DCI) m / z 353 (M + H) +.

Exemplo 158C 4-hidroxi-l-isobutoxi-2-oxo-l,2-di-hidro-l,8-naftiridina-3-carboxilato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 157C substituindo pelo produto do Exemplo 158B o produto de 157B (0,200 g, 99%). MS (DCI) m/z 307 (M+H)+.Example 158C Ethyl 4-hydroxy-1-isobutoxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxylate The title compound was prepared according to the procedure of Example 157C substituting the product of Example 158B the product of 157B (0.200 g, 99%). MS (DCI) m / z 307 (M + H) +.

Exemplo 158D N- [2-(aminosulfonil)fenil]-4-hidroxi-l-isobutoxi-2-oxo-l, 2-di-hidro-l, 8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 158C o produto do Exemplo 84B e substituindo por 2- aminossulfonamida o produto do Exemplo 84A (0,225 g, 86%). MS (DCI) m/z 433 (M+M)+.Example 158D N- [2- (aminosulfonyl) phenyl] -4-hydroxy-1-isobutoxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound was prepared according to was reacted with the procedure of Example 84C substituting the product of Example 158C for the product of Example 84B and substituting the product of Example 84A (0.225 g, 86%) for 2-aminosulfonamide. MS (DCI) m / z 433 (M + M) +.

Exemplo 158E 3- (1, l-dioxido-4H-l, 2,4-benzotiadiazin-3-il)-4-hidroxi-1-isobutoxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 158D o produto do Exemplo 84C (0,200 g, 93%). MS (ESI-) m/z 413 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-de) δ 1,05 (d, J= 6,62 Hz, 6H) 2,08 (m, 1H) 3,88 (d, J= 6,62 Hz, 2H) 7,18 (dd, J=7, 72, 4, 78 Hz, 1H) 7,29 (m, 2H) 7,55 (m, 1H) 7,67 (d, J=7,72 Hz, 1H) 8,37 (dd, J=7,72, 1,84 Hz, 1H) 8,55 (dd, J=4,78, 1,84 Hz, 1H) 15,72 (s, 1H). 201 ΕΡ 1 560 827/ΡΤExample 158E 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1-isobutoxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 158D for the product of Example 84C (0.200 g, 93%). MS (ESI-) m / z 413 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.05 (d, J = 6.62 Hz, 6H) 2.08 (m, 1H) 3.88 (d, J = 6.62 Hz, 2H) 7 , 18 (dd, J = 7, 72, 4, 78 Hz, 1 H) 7.29 (m, 2 H) 7.55 (m, 1 H) 7.67 (d, J = 7.72 Hz, , 37 (dd, J = 7.72, 1.84 Hz, 1 H) 8.55 (dd, J = 4.78, 1.84 Hz, 1 H) 15.72 (s, 1H). 201 ΕΡ 1 560 827 / ΡΤ

Exemplo 159 l-butil-3-(1,l-dioxido-4H-l, 2,4-benzotiadiazin-3-il)-4-hidroxi-l,5-naftlrldin-2(1H)-onaEXAMPLE 159 1-Butyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,5-naphthyridin-2 (1H) -one

Exemplo 159A 2fí-pirido [3, 2-d] [1,3] oxazina-2, 4(1 H) -dionaExample 159A 2 H -pyrido [3,2-d] [1,3] oxazine-2,4 (1 H) -dione

O composto em título foi preparado como sub-produto secundário (0,50 g, 4%) a partir de anidrido 2,3-piridina-carboxílico (11,4 g, 76 mmol) e azida de trimetilsililo (11,0 mL, 80 mmol) de acordo com o procedimento de Le Count, D.J. e colaboradores, descrito em Synthesis, 1982, 972-973. *H RMN (300 MHz, DMSO-d6) δ 7,56 (dd, J=8,46,l,47 Hz, 1H) 7,71 (dd, J=8,46, 4,41 Hz, 1H) 8,51 (dd, JM,41, 1,47 Hz, 1H) 11,78 (s, 1H) .The title compound was prepared as by-product (0.50 g, 4%) from 2,3-pyridine carboxylic anhydride (11.4 g, 76 mmol) and trimethylsilyl azide (11.0 mL, 80 mmol) according to the procedure of Le Count, DJ et al., Described in Synthesis, 1982, 972-973. 1 H NMR (300 MHz, DMSO-d 6) δ 7.56 (dd, J = 8.46, 1.47 Hz, 1 H) 7.71 (dd, J = 8.46, 4.41 Hz, 8.51 (dd, JM, 41, 1.47 Hz, 1 H) 11.78 (s, 1H).

Exemplo 159B l-butil-2ff-pirido[3,2-d][1,3]oxazina-2,4(1H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto doExample 159B 1-Butyl-2 H -pyrido [3,2-d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting

Exemplo 159A o produto do Exemplo IA (0,12 g, 35%). XH RMN (300 MHz, DMSO-d6) δ 0,92 (t, J=7,35 Hz, 3H) 1,40 (m, J=15,26, 7,17 Hz, 2H) 1,60 (m, 2H) 3,98 (m, 2H) 7,81 (dd, J=8,82, 4,41Example 159A The product of Example 1A (0.12 g, 35%). 1 H NMR (300 MHz, DMSO-d 6) δ0.92 (t, J = 7.35 Hz, 3H) 1.40 (m, J = 15.26, 7.17 Hz, , 2H), 3.98 (m, 2H), 7.81 (dd, J = 8.82, 4.41

Hz, 1H) 7,97 (dd, J=8,64, 1,29 Hz, 1H) 8,55 (dd, J=4,23, 1,29Hz, 1 H) 7.97 (dd, J = 8.64, 1.29 Hz, 1 H) 8.55 (dd, J = 4.23, 1.29

Hz, 1H).Hz, 1H).

Exemplo 159C l-butil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,5-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 159B o produto do Exemplo 1B (0,053 g, 25%). MS (ESI-) m/z 397 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 0,94 (t, J=7,17 Hz, 3H) 1,39 (m, 2H) 1,54 (m, 2H) 4,07 (t, J=7,72 Hz, 2H) 7,28 (m, 2H) 7,56 (m, 2H) 7,68 (dd, J=7,91, 1,29 Hz, 1H) 7,77 (d, J=8,46 Hz, 1H) 8,39 (d, J=4,04 Hz, 1H) 16,15 (s, 1H). 202 ΕΡ 1 560 827/ΡΤExample 159C 1-Butyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,5-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 159B for the product of Example 1B (0.053 g, 25%). MS (ESI-) m / z 397 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.94 (t, J = 7.17 Hz, 3H) 1.39 (m, 2H) 1.54 (m, 2H) 4.07 (t, J = 7.72 (d, J = 7.91, 1.29 Hz, 1 H), 7.77 (d, J = 8.46 Hz, 1 H) 8.39 (d, J = 4.04 Hz, 1 H) 16.15 (s, 1H). 202 ΕΡ 1 560 827 / ΡΤ

Exemplo 160 l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,5-naftlridin-2(1H)-onaExample 160 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,5-naphthyridin-2 (1H) -one

Exemplo 160A l-benzil-2fí-pirido [3,2-d] [1,3] oxazina-2, 4 (1H) -diona O composto em título foi preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 159A o produto do Exemplo IA e substituindo por brometo de benzilo o brometo de n-butilo (0,92 g, 60%). XH RMN (300 MHz, DMSO-d6) δ 5,28 (s, 2H) 7,33 (m, 3H) 7,43 (m, 2H) 7,70 (m, 2H) 8,54 (dd, J=3,86, 1,65 Hz, 1H).Example 160A 1-Benzyl-2 H -pyrido [3,2- d] [1,3] oxazine-2,4 (1H) -dione The title compound was prepared according to the procedure of Example 1B substituting the product of Example The product of Example 1A and substituting benzyl bromide for n-butyl bromide (0.92 g, 60%). 1 H NMR (300 MHz, DMSO-d 6) δ 5.28 (s, 2H) 7.33 (m, 3H) 7.43 (m, 2H) 7.70 (m, 2H) 8.54 (dd, J = 3.86, 1.65 Hz, 1H).

Exemplo 160B l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,5-naftiridina-3-carboxilato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 89A substituindo pelo produto do Exemplo 160A o produto do Exemplo 1B (0,110 g, 23%). MS (DCI) m/z 325 (M+H)+.Example 160B Ethyl 1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,5-naphthyridine-3-carboxylate The title compound was prepared according to the procedure of Example 89A substituting the product of Example 160A the product of Example 1B (0.110 g, 23%). MS (DCI) m / z 325 (M + H) +.

Exemplo 160C N-[2-(aminosulfonil)fenil]-l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l, 5-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 89B substituindo pelo produto do Exemplo 160B o produto do Exemplo 89A e por 2-aminobenzeno-sulfonamida a 2-amino-4-clorobenzenossulfonamida (0,12 g, 86%). MS (ESI-) m/z 449 (M-H)“.Example 160C N- [2- (aminosulfonyl) phenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,5-naphthyridine-3-carboxamide The title compound was prepared according to was reacted with the procedure of Example 89B substituting the product of Example 160B for Example 89A and 2-aminobenzenesulfonamide for 2-amino-4-chlorobenzenesulfonamide (0.12 g, 86%). MS (ESI-) m / z 449 (M-H).

Exemplo 160D l-benzil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,5-naftiridin-2(1H)-onaExample 160D 1-benzyl-3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,5-naphthyridin-2 (1H) -one

O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 160C o produto do Exemplo 84B (0,120 g, 99%). MS (ESI-) m/z 431 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 203 ΕΡ 1 560 827/ΡΤ ΧΗ RMN (300 ΜΗζ, DMSO-d6) δ 5,39 (s, 2Η) 7,25 (m, 7Η) 7,40 (dd, J=8,46, 4,41 Hz, 1H) 7,57 (m, 2H) 7,68 (d, J=8,09 Hz, 1H) 8,35 (d, J=4,04 Hz, 1H) 16,11 (s, 1H) .The title compound was prepared according to the procedure of Example 84C substituting the product of Example 160C for the product of Example 84B (0.120 g, 99%). MS (ESI-) m / z 431 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 ΜΗζ, DMSO-d 6) δ 5.39 (s, 2 7) 7.25 (m, 7) 7.40 (dd, J = 8.46, 4.41 Hz , 1H), 7.57 (m, 2H), 7.68 (d, J = 8.09 Hz, 1 H) 8.35 (d, J = 4.04 Hz, 1 H) 16.11 (s, 1H).

Exemplo 161 l-benzil-4-cloro-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado a partir do produto do Exemplo 15B e cloreto de fosforilo de acordo com o procedimento de Stadlbauer, W. e colaboradores, descrito em Journal of Heterocyclic Chemistry, 35, 1998, 627-636 (2,07 g, 88%) . , MS (ESI-) m/z 449 (M-H) XH RMN (300 MHz, DMSO- d6) δ 5, 68 (s, 2H) 7,29 ( m, 6 H) 7, 57 (m, 2H) 7,75 (m, 1H) 7, 92 (dd, J=7,91, 1,29 Hz, 1H) 8, 56 (dd, J=8,09, 1,47 Hz, 1H) 8,87 (dd, J=4,60, 1,65 Hz, 1H) 12, 73 (S, 1H).Example 161 1-benzyl-4-chloro-3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared from the product of Example 15B and phosphoryl chloride according to the procedure of Stadlbauer, W. et al., described in Journal of Heterocyclic Chemistry, 35, 1998, 627-636 (2.07 g, 88%). NMR (300 MHz, DMSO-d 6) δ 5.68 (s, 2H) 7.29 (m, 6 H) 7.57 (m, 2H) 7 (Dd, J = 7.91, 1.29 Hz, 1 H) 8.56 (dd, J = 8.09, 1.47 Hz, 1 H) 8.87 (dd, J = , J = 4.60, 1.65 Hz, 1 H) 12.73 (s, 1H).

Exemplo 162 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-{[(1E)-fenilmetileno]amino}1-2(1H)-quinolinonaExample 162 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[(1E) -phenylmethylene] amino} -1,2 (1H) -quinolinone

Exemplo 162A ácido 2-[(2E)-2-benzilideno-hidrazino]benzóico O composto em título foi preparado a partir de cloridrato de ácido 2-hidrazinobenzóico (1,89 g, 10,0 mmol) e benzaldeído (1,06 g, 10,0 mmol) de acordo com o procedimento de Fischer, E. e colaboradores descrito em Chem. Ber., 35, 1902, 2318 (2,4 g, rendimento quantitativo). MS (DCI) m/z 241 (M+H)+.Example 162A 2 - [(2E) -2-benzylidenehydrazino] benzoic acid The title compound was prepared from 2-hydrazinobenzoic acid hydrochloride (1.89 g, 10.0 mmol) and benzaldehyde (1.06 g , 10.0 mmol) according to the procedure of Fischer, E. et al. Described in Chem. Ber., 35, 1902, 2318 (2.4 g, quantitative yield). MS (DCI) m / z 241 (M + H) +.

Exemplo 162B 1— { [ (1E) -fenilmetileno] amino}-2H-3, l-benzoxazina-2, 4 (1 ff) -dionaExample 162B 1 - {[(1E) -phenylmethylene] amino} -2H-3,1-benzoxazine-2,4 (1 H) -dione

Uma solução do produto do Exemplo 162A (1,2 g, 5,0 mmol) e hidróxido de potássio (0,336 g, 6,0 mmol) em 15 ml de água a 0°C foi tratada gota a gota com fosgénio a 20% em tolueno (3,5 ml, 6,5 mmol), agitada durante 1 hora, tratada com NaOH 1M para atingir um pH de 10 e extraída com 3 χ 30 mL de acetato de etilo. Os extractos de acetato de etilo foram combinados, lavados com salmoura, secos (Na2S04) e concentrados para proporcionar o composto em título (0,32 g, 24%). MS (DCI) m/z 267 (M+H) +. 204 ΕΡ 1 560 827/ΡΤA solution of the product of Example 162A (1.2 g, 5.0 mmol) and potassium hydroxide (0.336 g, 6.0 mmol) in 15 mL of water at 0 ° C was treated dropwise with 20% in toluene (3.5 mL, 6.5 mmol), stirred for 1 hour, treated with 1M NaOH to a pH of 10 and extracted with 3 x 30 mL of ethyl acetate. The ethyl acetate extracts were combined, washed with brine, dried (Na 2 SO 4) and concentrated to provide the title compound (0.32 g, 24%). MS (DCI) m / z 267 (M + H) +. 204 ΕΡ 1 560 827 / ΡΤ

Exemplo 162C 3-(ll-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxl-1—{[(1E)-fenilmetileno]amino}-2(1H)-quinolinona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto doExample 162C 3- (11-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[(1E) -phenylmethylene] amino} -2 (1H) -quinolinone The title compound The title compound was prepared according to the procedure of Example 1D substituting

Exemplo 162B o produto do Exemplo 1B (0,110 g, 49%). MS (ESI-) m/z 443 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ 7,16 (m, 1H) 7,30 (m, 2H) 7,54 (m, 6H) 7,67 (dd, J=8, 09, 1, 47 Hz, 1H) 7,99 (m, 2H) 8,13 (dd, J=7,91, 1,29 Hz, 1H) 9,04 (s, 1H) 16,09 (s, 1H).Example 162B the product of Example 1B (0.110 g, 49%). MS (ESI-) m / z 443 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 7.16 (m, 1H) 7.30 (m, 2H) 7.54 (m, 6H) 7.67 (dd, J = 1H), 7.99 (m, 2H), 8.13 (dd, J = 7.91, 1.29 Hz, 1 H) 9.04 (s, 1 H) 16.09 (s, 1H).

Exemplo 163 l-amino-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il) -4-hidroxi-2(1H)-quinolinonaExample 163 1-Amino-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2 (1H) -quinolinone

Uma solução do produto do Exemplo 162C (0, 075 g, 0,17 mmol) em hidróxido de potássio aquoso a 10% (5 mL) foi refluxada durante 2 horas, arrefecida, tratada com HC1 12M a pH 3, o que produziu um precipitado. O sólido foi recolhido por filtração, lavado repetidamente com água e seco até peso constante para gerar o produto desejado (0,050 g, 83%). MS (ESI-) m/z 355 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ 5,31 (s, 2H) 7,05 (t, J=8,09 Hz, 1H) 7,27 (m, 2H) 7,53 (m, 2H) 7,67 (m, 2H) 8,07 (dd, J= 8,09, 1,47 Hz, 1H) 16,38 (S, 1H).A solution of the product of Example 162C (0.075 g, 0.17 mmol) in 10% aqueous potassium hydroxide (5 mL) was refluxed for 2 hours, cooled, treated with 12M HCl to pH 3, which afforded a precipitate. The solid was collected by filtration, washed repeatedly with water and dried to constant weight to give the desired product (0.050 g, 83%). MS (ESI-) m / z 355 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 5.31 (s, 2 H) 7.05 (t, J = 8.09 Hz, 1 H) 7.27 (m, 7.67 (m, 2 H) 8.07 (dd, J = 8.09, 1.47 Hz, 1 H) 16.38 (s, 1H).

Exemplo 164 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(2-feniletil)-1,8-naftiridin-2(1H)-onaExample 164 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (2-phenylethyl) -1,8-naphthyridin-2 (1H) -one

Exemplo 164A 2-[(2-feniletil)amino]nicotinato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 3A substituindo por fenetilamina a 2-etil-butilamina (1,98 g, 73%). MS (DCI) m/z 271 (M+H)+. 205 ΕΡ 1 560 827/ΡΤExample 164A Ethyl 2 - [(2-phenylethyl) amino] nicotinate The title compound was prepared according to the procedure of Example 3A substituting phenethylamine for 2-ethyl-butylamine (1.98 g, 73%). MS (DCI) m / z 271 (M + H) +. 205 ΕΡ 1 560 827 / ΡΤ

Exemplos 164Β 1-(2-feniletil)-2ff-pirido[2,3-d] [1,3]oxazina-2,4(lfl)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto de 164A o produto do Exemplo 3A (0,53 g, 99%). MS (DCI) m/z 269 (M+H)+.The title compound was prepared according to the procedure of Example 3B by substituting the title compound as a white crystalline solid.1H NMR (400 MHz, CDCl3) by the product of 164A the product of Example 3A (0.53 g, 99%). MS (DCI) m / z 269 (M + H) +.

Exemplo 164C 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(2-feniletil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 164B o produto do Exemplo 1B (0,132 g, 59%). MS (ESI-) m/z 445 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 2,87 (m, 2H) 4,47 (m, 2H) 7,16 (dd, J=7,72, 4,78 Hz, 1H) 7,29 (m, 7H) 7,57 (m, 1H) 7,67 (d, J=7,72 Hz, 1H) 8,40 (dd, J=7, 72, 1, 84 Hz, 1H) 8,57 (dd, J=4,78, 1,84 Hz, 1H) 15,90 (s, 1H) .Example 164C 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (2-phenylethyl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 164B for the product of Example 1B (0.132 g, 59%). MS (ESI-) m / z 445 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.87 (m, 2H) 4.47 (m, 2H) 7.16 (dd, J = 7.72, 4.78 Hz, m, 7H) 7.57 (m, 1H) 7.67 (d, J = 7.72 Hz, 1 H) 8.40 (dd, J = 7.72, 1.84 Hz, dd, J = 4.78, 1.84 Hz, 1 H) 15.90 (s, 1H).

Exemplo 165 l-butil-4-cloro-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 161 substituindo pelo produto do Exemplo 1D o produto do Exemplo 15B.Example 165 1-Butyl-4-chloro-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 161 substituting the product of Example 1D for the product of Example 15B.

Exemplo 166 4-amino-l-butil-3-(1,l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)- 1,8-naftiridin-2(1H)-onaExample 166 4-Amino-1-butyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one

Uma solução do produto do Exemplo 165 (0,10 g, 0,24 mmol) e amoníaco (2 ml de uma solução 2M em metanol, 4,0 mmol) foi agitada num tubo selado a 100°C durante 2 horas, deixada arrefecer até temperatura ambiente. O sólido resultante recolhido por filtração e lavado com metanol (2 ml) para gerar o composto em título como um sólido castanho (0,019 g, 20%). MS (ESI-) m/z 396 (M-H)-; XH RMN (300 MHz, DMSO-d6) δ 0,94 (t, J=7,35 Hz, 3H), 1,38 (m, 2H), 1,66 (m, 2H) , 4,44 (t, J=7,35 Hz, 2H), 7,48 (m, 2H), 7,55 (d, J=8,09 Hz, 1H), 7,70 (t, J=8,46 Hz, 206 ΕΡ 1 560 827/ΡΤ 1Η), 7,84 (dd, J=7,72, 1,10 Hz, 1H), 8,77 (d, J=8,09 Hz, 1H), 8,82 (dd, J=4,78, 1,47 Hz, 1H), 9,84 (brs, 1H).A solution of the product of Example 165 (0.10 g, 0.24 mmol) and ammonia (2 mL of a 2M solution in methanol, 4.0 mmol) was stirred in a sealed tube at 100 ° C for 2 hours, allowed to cool up to room temperature. The resulting solid collected by filtration and washed with methanol (2 mL) to give the title compound as a brown solid (0.019 g, 20%). MS (ESI-) m / z 396 (M-H) -; 1 H NMR (300 MHz, DMSO-d 6) δ0.94 (t, J = 7.35 Hz, 3H), 1.38 (m, 2H), 1.66 (m, 2H), 4.44 (t , J = 7.35 Hz, 2H), 7.48 (m, 2H), 7.55 (d, J = 8.09 Hz, 1H), 7.70 (t, J = 8.46 Hz, 206 (D, J = 8.09 Hz, 1 H), 8.82 (dd, J = 7.72, 1.10 Hz, 1 H), 8.77 (dd, , J = 4.78, 1.47 Hz, 1H), 9.84 (brs, 1H).

Exemplo 167 l-butil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-(metilamino)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 166 substituindo por metilamina (solução 2M em metanol) o amoníaco (solução 2m em metanol) como um sólido castanho (0, 023 g, 23%). MS (ESI-) m/z 410 (M-H)“; XH RMN (300 MHz, DMSO-d6) δ 0,91 (t, J=7,17 Hz, 3H) ; 1,34 (m, 2H), 1,60 (m, 2H), 2,95 (d, J=5,15 Hz, 3H) , 4,31 (m, J=7,36 Hz, 2H), 7,36 (dd, J=8,09, 4, 78 Hz, 1H) , 7,40 (d, J=8,46 Hz, 1H), 7,49 (t, J=8,09 Hz, 1H) , 7,71 (m, 2H) , 7,85 (dd, J=7,91, 1,29 Hz, 1H) , 8,56 (dd, J=8,27, 1,29 Hz, 1H), 8,69 (dd, J=4,60, 1, 29 Hz, 1H), 12,44 (brs, 1H).Example 167 1-Butyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4- (methylamino) -1,8-naphthyridin-2 (1H) was prepared according to the procedure of Example 166 substituting methyl amine (2M solution in methanol) for ammonia (2m solution in methanol) as a brown solid (0.023 g, 23%). MS (ESI-) m / z 410 (M-H); 1 H NMR (300 MHz, DMSO-d 6) δ0.91 (t, J = 7.17 Hz, 3H); 1.34 (m, 2H), 1.60 (m, 2H), 2.95 (d, J = 5.15 Hz, 3H), 4.31 (m, J = 7.36 Hz, 2H), 7.36 (dd, J = 8.09, 4.78 Hz, 1H), 7.40 (d, J = 8.46 Hz, 1H), 7.49 (t, J = 8.09 Hz, 1H) ), 7.71 (m, 2H), 7.85 (dd, J = 7.91, 1.29 Hz, 1H), 8.56 (dd, J = 8.27, 1.29 Hz, , 8.69 (dd, J = 4.60, 1.29 Hz, 1H), 12.44 (brs, 1H).

Exemplo 168 l-butil-4-(dimetllamino)-3-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 166 substituindo por dimetilamina (solução 2M em metanol) o amoníaco (solução 2M em metanol) como um sólido castanho (0,015 g, 15%). MS (ESI-) m/z 424 (M-H) ; XH RMN (300 MHz, DMSO-d6) δ 0,93 (t, J=7,35 Hz, 3H) , 1,36 (m, 2H), 1,63 (m, 2H), 2,99 (s, 6H), 4,36 (t, J=7,72 Hz, 2H), 7,38 (m, 2H), 7,51 (m, 1H), 7,73 (m, 1H), 7,88 (dd, J=8, 09, 1, 47 Hz, 1H), 8,36 (dd, J=8, 09, 1, 47 Hz, 1H), 8,71 (dd, J=4, 78, 1, 84 Hz, 1H) , 12,45 (s, 1H).Example 168 1-Butyl-4- (dimethylamino) -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 166 substituting dimethylamine (2M solution in methanol) for ammonia (2M solution in methanol) as a brown solid (0.015 g, 15%). MS (ESI-) m / z 424 (M-H); 1 H NMR (300 MHz, DMSO-d 6) δ0.93 (t, J = 7.35 Hz, 3H), 1.36 (m, 2H), 1.63 (m, 2H), 2.99 (s , 6.38 (m, 2H), 7.51 (m, 1H), 7.73 (m, 1H), 7.88 (dd, J = 8, 09, 1.47 Hz, 1 H), 8.36 (dd, J = 8.9, 1.47 Hz, 1H), 8.71 (dd, J = , 84 Hz, 1H), 12.45 (s, 1H).

Exemplo 169 l-butil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidrazino-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 166 substituindo por hidrazina o amoníaco (solução 2M em metanol) como um sólido castanho (0,026 g, 26%). MS (ESI-) m/z 411 (M-H)&quot;; XH RMN (300 MHz, DMSO-dê) δ 0,94 (t, J=7,35 Hz, 3H), 1,39 (m, 2H), 1,64 (m, 2H), 3,35 (brs, 3H) , 4,41 (t, J= = 7, 72 Hz, 2H), 7,04 (t, J=7,54 207 ΕΡ 1 560 827/ΡΤExample 169 1-Butyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydrazino-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 166 substituting hydrazine for ammonia (2M solution in methanol) as a brown solid (0.026 g, 26%). MS (ESI-) m / z 411 (M-H) &quot;; 1 H NMR (300 MHz, DMSO-d 6) δ0.94 (t, J = 7.35 Hz, 3H), 1.39 (m, 2H), 1.64 (m, 2H), 3.35 (brs , 3H), 4.41 (t, J = 7.72 Hz, 2H), 7.04 (t, J = 7.54 207 ΕΡ 1 560 827 / ΡΤ

Hz, 1Η), 7,42 (dd, J=7, 72, 4, 78 Ηζ, 1Η) , 7,57 (m, 1H) , 7,83 (dd, J=7,91, 1,65 Hz, 1H), 8,49 (dd, J=7, 72, 1,84 Hz, 1H) , 8,64 (d, J=8,46 Hz, 1H), 8,68 (dd, J=4,78, 1,84 Hz, 1H), 9,65 (s, 1H) .(Dd, J = 7, 72, 4, 78, 1), 7.57 (m, 1H), 7.83 (dd, J = 7.91, 1.65 Hz, , 8.49 (dd, J = 7.72, 1.84 Hz, 1H), 8.64 (d, J = 8.46 Hz, 1H), 8.68 (dd, J = 78, 1.84 Hz, 1H), 9.65 (s, 1H).

Exemplo 170 4-azido-l-butil-3-(1,l-dioxido-4H-l,2,4-benzotladiazin-3-il)-1,8-naftiridin-2(1H)-onaExample 170 4-azido-1-butyl-3- (1,1-dioxido-4 H -1,2,4-benzotladiazin-3-yl) -1,8-naphthyridin-2 (1H) -one

Uma solução do produto do Exemplo 165 (0,1 g, 0,24 mmol) e azida de sódio (0,037 g, 0,571 mmol) em dimetilformamida (2,5 ml) foi agitada a 80°C durante 1,5 horas, deixada arrefecer até temperatura ambiente e concentrada sob pressão reduzida. O residuo bruto foi purificado numa coluna C8 HPLC eluindo com 20% para 80% acetonitrilo em água com ácido trifluoroacético a 1% para gerar o composto em título (0,025 g, 26% após purificação em coluna). MS (ESI-) m/z 422 (M-H) ; XH RMN (300 MHz, DMSO-d6) δ 0,94 (t, J=7,35 Hz, 3H), 1,38 (m, 2H), 1,67 (m, 2H), 4,42 (t, J=7,54 Hz, 2H) , 7,41 (d, J=7, 72A solution of the product of Example 165 (0.1 g, 0.24 mmol) and sodium azide (0.037 g, 0.571 mmol) in dimethylformamide (2.5 mL) was stirred at 80 ° C for 1.5 hours, cool to room temperature and concentrated under reduced pressure. The crude residue was purified on a C8 HPLC column eluting with 20% to 80% acetonitrile in water with 1% trifluoroacetic acid to give the title compound (0.025 g, 26% after column purification). MS (ESI-) m / z 422 (M-H); 1 H NMR (300 MHz, DMSO-d 6) δ0.94 (t, J = 7.35 Hz, 3H), 1.38 (m, 2H), 1.67 (m, 2H), 4.42 , J = 7.54 Hz, 2 H), 7.41 (d, J = 7.72

Hz, 1H), 7,46 (dd, J=7,91, 4,60 Hz, 1H) , 7,56 (m, 1H), 7,76 (m, 1H), 7,91 (dd, J=8,09, 1,10 Hz, 1H), 8,41 (dd, J=8,09, 1,84 Hz, 1H), 8,84 (dd, J=41, 1,84 Hz, 1H), 12,74 (s, 1H).(Dd, J = 7.91, 4.60 Hz, 1H), 7.56 (m, 1H), 7.76 (m, 1H), 7.91 (dd, J = = 8.09, 1.10 Hz, 1H), 8.41 (dd, J = 8.09, 1.84 Hz, 1H), 8.84 (dd, J = 41, 1.84 Hz, 1H) , 12.74 (s, 1H).

Exemplo 171 l-butil-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-[(2-hidroxietil)amino]-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 166 substituindo por etanolamina (0,25 g, 4,0 mmol) e metanol anidro (2 ml) o amoníaco (solução 2M em metanol) (0,02 &lt;3r 19%) . MS (ESI-) m/z 440 (M-H) r lH RMN (300 MHz, DMSO- -d6) δ 0, ,92 ( t, J=7,35 Hz, 3H) , 1,35 (m, 2H), 1,61 (m, 2H), 2, 71 (m, 1H), 3, 40 (m, 1H), 3, 47 (m, 2H) , 3,57 (m, 2H), 4,32 (t, J=7 ,36 Hz, 2H), 7, 35 ( m, 1H), 7, 39 (d, J= =6,99 Hz, 1H), 7, 44 (t, J=7 ,72 hz, ih; 1, 7 ,51 (brs, 1H) , 7,67 (m, 1H), 7, 81 (dd, J= 7,91, 1, 29 Hz, 1H), 8, 66 (dd, J= =8,09, 1,47 Hz, 1H), $ 3, 69 (dd, J=4, 78, 1,47 Hz ;, 1H) .Example 171 1-Butyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4 - [(2-hydroxyethyl) amino] -1,8-naphthyridin-2 (1H ) -one The title compound was prepared according to the procedure of Example 166 substituting ethanolamine (0.25 g, 4.0 mmol) and anhydrous methanol (2 mL) for ammonia (2M solution in methanol) (0.02 g &lt; 3r 19%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.92 (t, J = 7.35 Hz, 3H), 1.35 (m, 2H) , 1.61 (m, 2H), 2.71 (m, 1H), 3.40 (m, 1H), 3.47 (m, 2H), 3.57 (m, 2H), 4.32 t, J = 7.36 Hz, 2H), 7.35 (m, 1H), 7.39 (d, J = 6.99 Hz, 1H), 7.44 (t, J = 7.72 Hz 1H), 7.67 (m, 1H), 7.81 (dd, J = 7.91, 1.29 Hz, 1H), 8.66 (dd, J = = = 8.09, 1.47 Hz, 1H), 3.69 (dd, J = 4.78, 1.47 Hz, 1H).

Exemplo 172 3-(1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-propoxiquinolin-2(1H)-ona 208 ΕΡ 1 560 827/ΡΤExample 172 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1-propoxyquinolin-2 (1H) -one 208 Ει1 560 827 / ΡΤ

Exemplo 172Α 2-(hldroxiamino)benzoato de etilo O composto em título é preparado a partir de 2-nitro-benzoato de etilo de acordo com o procedimento de Entwistle and Gilkerson descrito em Tetrahedron, 34, 1978, 213-215.The title compound is prepared from ethyl 2-nitrobenzoate according to the procedure of Entwistle and Gilkerson described in Tetrahedron, 34, 1978, 213-215. Example 172 2- (Hydroxyamino) benzoate

Exemplo 172B 2-(propoxiamino)benzoato de etilo O composto em título é preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 172A o produto do Exemplo IA e substituindo por brometo de n-propilo o brometo de n-butilo.Example 172B Ethyl 2- (propoxyamino) benzoate The title compound is prepared according to the procedure of Example 1B substituting the product of Example 172A for the product of Example 1A and substituting n-propyl bromide for n-butyl bromide.

Exemplo 172C 2-[(3-etoxi-3-oxopropanoíl)(propoxi)amino]benzoato de etilo O composto em título é preparado de acordo com o procedimento do Exemplo 157B substituindo pelo produto do Exemplo 172B o produto do Exemplo 157A.Example 172C Ethyl 2 - [(3-ethoxy-3-oxopropanoyl) (propoxy) amino] benzoate The title compound is prepared according to the procedure of Example 157B substituting the product of Example 172B for the product of Example 157A.

Exemplo 172D 4-hidroxi-2-oxo-l-propoxi-l,2-di-hidroquinolina-3-carboxilato de etilo O composto em título é preparado de acordo com o procedimento do Exemplo 157C substituindo pelo produto do Exemplo 172C o produto do Exemplo 157B.Example 172D Ethyl 4-hydroxy-2-oxo-1-propoxy-1,2-dihydroquinoline-3-carboxylate The title compound is prepared according to the procedure of Example 157C substituting the product of Example 172C for Example 157B.

Exemplo 172E N-[2-(aminossulfonil)fenil]-4-hidroxi-2-oxo-l-propoxi-l, 2-di-hidroquinolina-3-carboxamida O composto em título é preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 172D o produto do Exemplo 84B e substituindo por 2-aminossulfonamida o produto do Exemplo 84A. 209 ΕΡ 1 560 827/ΡΤExample 172E N- [2- (aminosulfonyl) phenyl] -4-hydroxy-2-oxo-1-propoxy-1,2-dihydroquinoline-3-carboxamide The title compound is prepared according to the procedure of Example 84C substituting the product of Example 172D for the product of Example 84B and substituting 2-aminosulfonamide for the product of Example 84A. 209 ΕΡ 1 560 827 / ΡΤ

Exemplo 172F 3-(1, l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi- l-propoxiquinolin-2(1H)-ona O composto em título é preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 172E o produto do Exemplo 84C. O sal de sódio do composto em título é preparado de acordo com o procedimento do Exemplo 1D.Example 172F 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1-propoxyquinolin-2 (1H) -one The title compound is prepared according to The title compound was prepared according to the procedure of Example 84D substituting the product of Example 172E for the product of Example 84C. The sodium salt of the title compound is prepared according to the procedure of Example 1D.

Exemplo 173 7-benzil-5-(1,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi-3-(hidroximetil)-7,7a-di-hidrotieno[2, 3-b]piridin-6(3afl)-onaExample 173 7-benzyl-5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-3- (hydroxymethyl) -7,7a-dihydrothieno [ B] pyridin-6 (3a R) -one

Exemplo 173A 2-amino-4-(hidroximetil)tiofeno-3-carboxilato de metiloExample 173A Methyl 2-amino-4- (hydroxymethyl) thiophene-3-carboxylate

Uma solução de cianoacetato de metilo (1,18 mL, 13,28 mmol) e sulfureto de sódio nona-hidratado (3,20 g, 13,28 mmol) em metanol (25 mL) a 0°C foi tratada com l-acetoxi-3-cloroacetona (2,0 g, 13,28 mmol). O banho frio foi removido e juntou-se trietilamina (1,86 mL, 13,28 mmol) gota a gota. A solução foi agitada a temperatura ambiente durante 20 horas, depois diluída com água e extraída em acetato de etilo. A fase orgânica foi seca sobre sulfato de sódio, filtrada e o solvente removido sob vácuo para proporcionar o composto em título (1,25 g, 51%). MS (DCI/NH3) m/z 188 (M+H)+; XH RMN (300 MHz, DMSO-de) δ 3,68 (s, 3H) 4,45 (dd, J=5,52, 1,47 Hz, 2H) 4,88 (t, J=5,70 Hz, 1H) 6,12 (s, 1H) 7,28 (s, 2H)A solution of methyl cyanoacetate (1.18 mL, 13.28 mmol) and sodium sulfide nonahydrate (3.20 g, 13.28 mmol) in methanol (25 mL) at 0 ° C was treated with 1- acetoxy-3-chloroacetone (2.0 g, 13.28 mmol). The cold bath was removed and triethylamine (1.86 mL, 13.28 mmol) was added dropwise. The solution was stirred at room temperature for 20 hours, then diluted with water and extracted into ethyl acetate. The organic phase was dried over sodium sulfate, filtered and the solvent removed in vacuo to provide the title compound (1.25 g, 51%). MS (DCI / NH 3) m / z 188 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 3.68 (s, 3H) 4.45 (dd, J = 5.52, 1.47 Hz, 2 H) 4.88 (t, J = 5.70 Hz , 1 H) 6.12 (s, 1 H) 7.28 (s, 2 H)

Exemplo 173B 2- amino-4-(1{[tert-butil(dimetil)silil]oxi}metil)tiofeno- 3- carboxilato de metiloExample 173B Methyl 2-amino-4- (1-tert-butyl (dimethyl) silyl] oxy} methyl) thiophene-3-carboxylate

Uma solução do produto do Exemplo 173A (1,25 g, 6,70 mmol) e N, N-diisopropiletilamina (0,71 mL, 7,35 mmol) em diclorometano a 0°C foi tratada com trifluorometanossulfonato de t-butildimetilsililo (0,85 mL, 6,70 mmol). Após agitação a 0°C durante 1 hora, a solução foi vertida em água, extraída em diclorometano e seca sobre sulfato de sódio. O solvente foi removido sob vácuo para proporcionar o composto em título 210 ΕΡ 1 560 827/ΡΤ (0,87 g, 78%), MS (DCI/NH3) m/z 302 (M+H)+; XH RMN (300 MHz, DMSO-ds) δ 0,00 (m, 6 H) 0,84 (s, 9H) 3,62 (s, 3H) 4,59 (d, J=l,47 Hz, 2H) 6,03 (m, 1H) 7,22 (s, 2H).A solution of the product of Example 173A (1.25 g, 6.70 mmol) and N, N-diisopropylethylamine (0.71 mL, 7.35 mmol) in dichloromethane at 0 ° C was treated with t-butyldimethylsilyl trifluoromethanesulfonate ( 0.85 mL, 6.70 mmol). After stirring at 0 ° C for 1 hour, the solution was poured into water, extracted into dichloromethane and dried over sodium sulfate. The solvent was removed in vacuo to provide the title compound 210 ÅΡ 1 560 827 / ΡΤ (0.87 g, 78%), MS (DCI / NH 3) m / z 302 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 0.00 (m, 6 H) 0.84 (s, 9H) 3.62 (s, 3H) 4.59 (d, J = ) 6.03 (m, 1 H) 7.22 (s, 2H).

Exemplo 173C 2-(benzilamino)-4-({[tert-butil(dimetil)silil]oxi}metil)-tiofeno-3-carboxilato de metiloExample 173C Methyl 2- (benzylamino) -4 - ({[tert-butyl (dimethyl) silyl] oxy} methyl) -thiophene-3-carboxylate

Uma solução do produto do Exemplo 173B (0,36 g, 1,20 mmol) e carbonato de potássio (0,185 g, 1,30 mmol) em acetonitrilo (5 mL) foi tratada com brometo de benzilo (0,16 mL, 1,25 mmol) a 45°C durante 24 horas. A solução foi vertida em água e extraída em acetato de etilo (2x) . As fases orgânicas combinadas foram concentradas e purificadas por cromatografia instantânea eluindo com diclorometano para proporcionar o composto em titulo (0,17 g, 36%). MS (DCI/NH3) m/z 392 (M+H)+; :Η RMN (300 MHz, DMSO-d6) δ 0,00 (m, 6H) 0,84 (s, 9H) 3,67 (m, 3H) 4,38 (d, J= 5,88 Hz, 2H) 4,62 (d, J=l, 47 Hz, 2H) 6,12 (s, 1H) 7,28 (m, 5H) 8,16 (t, J=6,07 Hz, 1H).A solution of the product of Example 173B (0.36 g, 1.20 mmol) and potassium carbonate (0.185 g, 1.30 mmol) in acetonitrile (5 mL) was treated with benzyl bromide (0.16 mL, , 25 mmol) at 45 ° C for 24 hours. The solution was poured into water and extracted into ethyl acetate (2x). The combined organic phases were concentrated and purified by flash chromatography eluting with dichloromethane to provide the title compound (0.17 g, 36%). MS (DCI / NH 3) m / z 392 (M + H) +; NMR (300 MHz, DMSO-d 6) δ 0.00 (m, 6H) 0.84 (s, 9H) 3.67 (m, 3H) 4.38 (d, J = 5.88 Hz, 2H ) 4.62 (d, J = 1.47 Hz, 2 H) 6.12 (s, 1 H) 7.28 (m, 5H) 8.16 (t, J = 6.07 Hz, 1H).

Exemplo 173D l-benzil-5-({[tert-butil(dimetil)silil]oxi}metil)-2H-tieno[2,3-d][1,3]oxazina-2,4(1H)-dionaExample 173D 1-Benzyl-5 - ({[tert -butyl (dimethyl) silyl] oxy} methyl) -2H-thieno [2,3- d] [1,3] oxazine-2,4 (1H) -dione

O composto em titulo foi preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 173C o produto do Exemplo 3A (0,015 g, 83%). MS (DCI/NH3) m/z 404 (M+H)+.The title compound was prepared according to the procedure of Example 3B substituting the product of Example 173C for the product of Example 3A (0.015 g, 83%). MS (DCI / NH 3) m / z 404 (M + H) +.

Exemplo 173E 7-benzil-5-(1,l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-4-hidroxi-3-(hidroximetil)-7,7A-di-hidrotieno[2,3-b]piridin-6(3aH)-onaExample 173E 7-Benzyl-5- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-3- (hydroxymethyl) -7,7A-dihydrothieno [ 3-b] pyridin-6 (3a H) -one

O composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 173D o produto do Exemplo 1B. (0,013 g, 8%). MS (DCI/NH3) m/z 468 (M+H)+; XH RMN (300 MHz, DMSO-d6) δ 4,78 (s, 2 H) 5,42 (s, 2H) 7,13 (s, 1H) 7,32 (m, 5H) 7,53 (t, J=1,11 Hz, 1H) 7,64 (d, J=9,93 Hz, 1H) 7,75 (m, 1H) 7,91 (d, J= 6,99 Hz, 1H) . 211 ΕΡ 1 560 827/ΡΤThe title compound was prepared according to the procedure of Example 1D substituting the product of Example 173D for the product of Example 1B. (0.013 g, 8%). MS (DCI / NH 3) m / z 468 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6) δ 4.78 (s, 2 H) 5.42 (s, 2 H) 7.13 (s, 1 H) 7.32 (m, 5H) 7.53 (t, J = 1.11 Hz, 1 H) 7.64 (d, J = 9.93 Hz, 1 H) 7.75 (m, 1 H) 7.91 (d, J = 6.99 Hz, 1H). 211 ΕΡ 1 560 827 / ΡΤ

Exemplo 174 l-benzil-3- (6-cloro-l, l-dioxido-4i7-tieno [3,2-e] [1,2,4]-tiadiazin-3-il)-4-hidroxi-l, 8-naftiridln-2(1H)-onaExample 174 1-Benzyl-3- (6-chloro-1,1-dioxido-4,7-thieno [3,2- e] [1,2,4] thiadiazin-3-yl) -4- 8-naphthyridin-2 (1H) -one

Exemplo 174A 3-amino-5-clorotiofeno-2-sulfonamida O composto em título é preparado de acordo com o procedimento de Hansen, J. e colaboradores, como descrito em J. of Medicinal Chemistry 2002, 45, 4171-4187.Example 174A 3-Amino-5-chlorothiophene-2-sulfonamide The title compound is prepared according to the procedure of Hansen, J. et al., As described in J. of Medicinal Chemistry 2002, 45, 4171-4187.

Exemplo 174B N-[2-(aminosulfonil)-5-clorotien-3-il]-l-benzil-4-hidroxi- 2-oxo-l,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título é preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 174A o produto do Exemplo 84A e substituindo por 3-amino-5-clorotiofeno-2-sulfonamida a 2-amino-5-bromo- benzenossulfonamida.Example 174B N- [2- (aminosulfonyl) -5-chlorothien-3-yl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide title compound is prepared according to the procedure of Example 84C substituting the product of Example 174A for the product of Example 84A and substituting 2-amino-5-bromo-benzenesulfonamide for 3-amino-5-chlorothiophene-2-sulfonamide for the product of Example 84A.

Exemplo 174C l-benzil-3-(6-cloro-l,l-dioxido-4#-tieno[3, 2-e] [1,2,4]-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título é preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 174B o produto do Exemplo 84C.Example 174C 1-Benzyl-3- (6-chloro-1,1-dioxido-4-thieno [3,2-e] [1,2,4] thiadiazin-3-yl) -4- , 8-naphthyridin-2 (1H) -one The title compound is prepared according to the procedure of Example 84D substituting the product of Example 174B for the product of Example 84C.

Exemplo 175 l-benzil-3-(6-cloro-l, l-dioxido-4H-tieno[3,2-e][1,2,4] — tiadiazin-3-il) -4-hidroxiquinolin-2 (1H) -onaExample 175 1-Benzyl-3- (6-chloro-1,1-dioxido-4H-thieno [3,2- e] [1,2,4] thiadiazin-3-yl) -4-hydroxyquinolin-2- 1H) -one

Exemplo 175A N-[2-(aminosulfonil)-5-clorotien-3-il]-l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolina-3-carboxamida O composto em título é preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 174A o produto do Exemplo 84A e substituindo pelo produto do Exemplo 99A o produto do Exemplo 84B. 212 ΕΡ 1 560 827/ΡΤExample 175A N- [2- (aminosulfonyl) -5-chlorothien-3-yl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinoline-3-carboxamide The title compound is prepared from according to the procedure of Example 84C substituting the product of Example 174A for the product of Example 84A and substituting the product of Example 99A for the product of Example 84B. 212 ΕΡ 1 560 827 / ΡΤ

Exemplo 175Β l-benzil-3- (6-cloro-l, l-dioxido-4ff-tieno [3,2-e] [1,2,4]-tiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O composto em título é preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 175A o produto do Exemplo 84C.Example 175 1-Benzyl-3- (6-chloro-1,1-dioxido-4 H -thieno [3,2- e] [1,2,4] thiadiazin-3-yl) -4-hydroxyquinolin-2- 1H) -one The title compound is prepared according to the procedure of Example 84D substituting the product of Example 175A for the product of Example 84C.

Exemplo 176 3-[5-(aminometil)-1, l-dioxido-4ff-l,2, 4-benzotiadiazin-3-il]-l-benzil-4-hidroxi-l,8-naftiridin-2(1H)-ona O produto do Exemplo 97 (91,6 mg, 0,2002 mmol) e níquel de Raney (0,94 g) em tetra-hidrofurano (92 mL) e trietilamina (4,5 mL) foi hidrogenado a 60 psi de pressão de H2 a 50° durante 2 dias, juntando-se níquel de Raney adicional (0,94 g) após 24 horas. A reacção foi arrefecida até temperatura ambiente, filtrada e concentrada por evaporação rotativa até se obter um sólido amarelo esverdeado. O resíduo foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (40 mm x 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo:TFA aquoso a 0,1% durante 12 minutos (15 minutos de tempo de ensaio) a um caudal de 70 mL/minuto para gerar o composto em título como um sólido branco (11 mg, 12%). MS (ESI-)' m/z 460 (M-H)&quot;; XH RMN (300 MHz, DMSO-de) δ 4,31 (s, 2H) 5,64 (s, 2H) 7,28 (m, 6H) 7,49 (m, 1H) 7,74 (d, J=l,35 Hz, 1H) 7,85 (d, J=7,72 Hz, 1H) 8,48 (m, 3H) 8,68 (m, 1H). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ rmn (300 MHz, DMSO-dê) δ 4,16 (s, 2H) 5,54 (s, 2H) 7,24 (m, 7H) 7,65 (d, J=7, 72 Hz, 2H) 8,43 (dd, J=7, 54, 1, 65 Hz, 1H) 8,50 (dd, J=4, 41, 1,84 Hz, 1H).Example 176 3- [5- (Aminomethyl) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -1-benzyl-4-hydroxy-1,8-naphthyridin-2 (1H) -one The product of Example 97 (91.6 mg, 0.2002 mmol) and Raney nickel (0.94 g) in tetrahydrofuran (92 mL) and triethylamine (4.5 mL) was hydrogenated at 60 psi of H2 pressure at 50Â ° for 2 days, additional Raney nickel (0.94 g) was added after 24 hours. The reaction was cooled to room temperature, filtered and concentrated by rotary evaporation to a yellow-green solid. The residue was purified by preparative HPLC on a Waters Symmetry C8 column (40 mm x 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile: 0.1% aqueous TFA for 12 minutes minutes of assay time) at a flow rate of 70 mL / minute to give the title compound as a white solid (11 mg, 12%). MS (ESI-) m / z 460 (M-H) &quot;; 1 H NMR (300 MHz, DMSO-d 6) δ 4.31 (s, 2H) 5.64 (s, 2H) 7.28 (m, 6H) 7.49 (m, 1H) 7.74 (d, J = = 1.35 Hz, 1 H) 7.85 (d, J = 7.72 Hz, 1 H) 8.48 (m, 3 H) 8.68 (m, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. Δ (300 MHz, DMSO-d 6) δ 4.16 (s, 2H) 5.54 (s, 2H) 7.24 (m, 7H) 7.65 (d, J = 7.72 Hz, 2H) 8.43 (dd, J = 7, 54, 1, 65 Hz, 1 H) 8.50 (dd, J = 4.14, 1.84 Hz, 1H).

Exemplo 177 8-benzil-3-cloro-6-(1, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-5-hidroxipirido[2,3-c]piridazin-7(8fl)-onaExample 177 8-Benzyl-3-chloro-6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -5-hydroxypyrido [2,3- c] pyridazin-7 (8 H) -one

Exemplo 177A ácido 3-(benzilamino)-6-cloropiridazina-4-carboxílico 2,5-dicloro-piridizina-3-carboxilato (0,40 g, 2,07 mmol) em tolueno (8 mL) reagiu com trietilamina (0,72 mL, 5,20 mmol) 213 ΕΡ 1 560 827/ΡΤ e benzilamina (0,23 mL, 2,07 mmol) a 90°C durante 8 horas. A solução foi repartida entre água e acetato de etilo. A fase orgânica foi seca sobre sulfato de sódio, filtrada e concentrada para gerar o composto em titulo (0,257 g, 47%). MS (DCI/NH3) m/z 264 (M+H+)\Example 177A 3- (Benzylamino) -6-chloropyridazine-4-carboxylic acid 2,5-dichloro-pyridizine-3-carboxylate (0.40 g, 2.07 mmol) in toluene (8 mL) was reacted with triethylamine 72 mL, 5.20 mmol) and benzylamine (0.23 mL, 2.07 mmol) at 90 ° C for 8 hours. The solution was partitioned between water and ethyl acetate. The organic phase was dried over sodium sulfate, filtered and concentrated to give the title compound (0.257 g, 47%). MS (DCI / NH 3) m / z 264 (M + H +) +

Exemplo 177B 8-benzil-3-cloro-57f-piridazino [3, 4-d] [1,3] oxazina-5, 7 (8H) -diona O composto em titulo é preparado de acordo com o procedimento do Exemplo 108C substituindo pelo produto do Exemplo 177A o produto do Exemplo 108B.Example 177B The title compound is prepared according to the procedure of Example 108C substituting 8-benzyl-3-chloro-5 H -pyridazino [3,4- d] [1,3] oxazine-5,7 (8H) by the product of Example 177A the product of Example 108B.

Exemplo 177C 8-benzil-3-cloro-6-(1,l-dioxido-4/f-l,2,4-benzotiadiazin-3-il)-5-hidroxipirido[2,3-c]piridazin-7(8H)-ona O composto em titulo é preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 177B o produto do Exemplo 1B.Example 177C 8-benzyl-3-chloro-6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -5-hydroxypyrido [2,3- c] pyridazin-7 (8H) -one The title compound is prepared according to the procedure of Example 1D substituting the product of Example 177B for the product of Example 1B.

Exemplo 178 8-benzil-6-(1,l-dioxido-4A-l, 2, 4-benzotiadiazin-3-il) -5-hidroxi-3- (metiltio)pirido [2,3-c]piridazin-7 (817) -ona O produto do Exemplo 177 reagiu com metanotiol em tolueno a temperaturas elevadas e a reacção foi concentrada para gerar 0 composto em título.Example 178 8-Benzyl-6- (1,1-dioxido-4A -1,2,4-benzothiadiazin-3-yl) -5-hydroxy-3- (methylthio) pyrido [2,3-c] pyridazin-7 (817) -one The product of Example 177 was reacted with methanethiol in toluene at elevated temperatures and the reaction concentrated to give the title compound.

Exemplo 179 8-benzil-6-(1,l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il)-5-hidroxipirido[2,3-c]piridazin-7(8H)-ona O composto em título é produzido pelo procedimento do Exemplo 109 substituindo pelo produto do Exemplo 178 o produto do Exemplo 108D.Example 179 8-benzyl-6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -5-hydroxypyrido [2,3-c] pyridazin-7 (8H) The title compound is produced by the procedure of Example 109 substituting the product of Example 178 for the product of Example 108D.

Exemplo 180 l-benzil-3-(1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l,6-naftiridin-2(1H)-ona 214 ΕΡ 1 560 827/ΡΤExample 180 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,6-naphthyridin-2 (1H) -one 214 827 / ΡΤ

Exemplo 180Α 4-(benzilamino)nicotinato de metilo O composto em título é preparado a partir de 3- carbometoxi-4-cloropiridina e benzilamina de acordo com o procedimento de Winn, et al., como descrito em J. Med. Chem., 36, 1993, 2676-2688.Example 180 4- (Benzylamino) nicotinate The title compound is prepared from 3-carbomethoxy-4-chloropyridine and benzylamine according to the procedure of Winn, et al., As described in J. Med. Chem. 36, 1993, 2676-2688.

Exemplo 180B l-benzil-2ff-pirido [4,3-d] [1,3] oxazina-2, 4 (1H) -diona O composto em título é preparado de acordo com o procedimento do Exemplo 3B substituindo pelo produto do Exemplo 180A o produto do Exemplo 3A.Example 180B 1-Benzyl-2 H -pyrido [4,3-d] [1,3] oxazine-2,4 (1H) -dione The title compound is prepared according to the procedure of Example 3B substituting the product of Example 180A the product of Example 3A.

Exemplo 180C l-benzil-3-(1,l-dioxido-4fl-l, 2, 4-benzotiadiazin-3-il)- 4- hidroxi-l,6-naftiridin-2(1H)-ona O composto em título é preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto doExample 180C 1-Benzyl-3- (1,1-dioxido-4,11,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,6-naphthyridin-2 (1H) -one The title compound is prepared according to the procedure of Example 1D substituting the product of

Exemplo 180B o produto do Exemplo 1B.Example 180B The product of Example 1B.

Exemplo 181 l-benzil-3-(1,l-dioxido-4i7-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi-l,7-naftiridin-2(1H)-onaExample 181 1-benzyl-3- (1,1-dioxido-4-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,7-naphthyridin-2 (1H) -one

Exemplo 181A 2ff-pirido [3, 4-d] [1,3] oxazina-2, 4(1 H) -diona O composto em título é preparado de acordo com o procedimento do Exemplo 110A a partir de ácido 3-amino-isonicotínico.Example 181A 2-Pyrido [3,4-d] [1,3] oxazine-2,4 (1 H) -dione The title compound is prepared according to the procedure of Example 110A from 3-amino- isonicotinic acid.

Exemplo 181B l-benzil-2il-pirido [3, 4-d] [1,3] oxazina-2, 4 (1H) -diona O composto em título é preparado de acordo com o procedimento do Exemplo 1B substituindo pelo produto do Exemplo 181A o produto do Exemplo IA, substituindo por DMF a DMA e substituindo por brometo de benzilo o brometo de n-butilo, respectivamente. 215 ΕΡ 1 560 827/ΡΤExample 181B 1-Benzyl-2yl-pyrido [3,4-d] [1,3] oxazine-2,4 (1H) -dione The title compound is prepared according to the procedure of Example 1B substituting the product of Example 181A the product of Example 1A, substituting DMF for DMA and substituting benzyl bromide for n-butyl bromide, respectively. 215 ΕΡ 1 560 827 / ΡΤ

Exemplo 181C l-benzil-3- (1, l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-l,7-naftiridin-2(1H)-ona O composto em título é preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 181C o produto do Exemplo 1B.Example 181C 1-Benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,7-naphthyridin-2 (1H) -one The title compound is prepared according to the procedure of Example 1D substituting the product of Example 181C for the product of Example 1B.

Exemplo 182 1-(benzilamino)-3-(1,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-onaExample 182 1- (benzylamino) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one

Uma lama do produto do Exemplo 162 (0,133 g, 0,3 mmol) e paládio sobre carbono a 10% (0,02 g, quantidade catalítica) em THF (25 mL) foi hidrogenada sob 1 atmosfera de hidrogénio durante 4 horas, filtrada através de Celite e o filtrado foi concentrado. O resíduo foi misturado em 1 mL de DMSO/5 mL de MeOH durante 15 minutos e o sólido foi recolhido por filtração e seco sob vácuo para gerar o composto em título (0,08 g, 60%). MS (ESI-) m/z 445 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-d6) δ 3,93 (s, 2H) 6,09 (t, J= 6,99A slurry of the product of Example 162 (0.133 g, 0.3 mmol) and 10% palladium on carbon (0.02 g, catalytic amount) in THF (25 mL) was hydrogenated under 1 atmosphere of hydrogen for 4 hours, filtered through Celite and the filtrate was concentrated. The residue was mixed in 1 mL DMSO / 5 mL MeOH for 15 minutes and the solid collected by filtration and dried under vacuum to give the title compound (0.08 g, 60%). MS (ESI-) m / z 445 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 3.93 (s, 2H) 6.09 (t, J = 6.99

Hz, 1H) 7,09 (t, J=7,35 Hz, 1H) 7,35 (m, 5H) 7,54 (m, 4H) 7,69 (t, J= 8,82 Hz, 2H) 8,10 (dd, J=7,91, 1,29 Hz, 1H) 16,28 (s, 1H) .J = 7.35 Hz, 1 H), 7.35 (m, 5H), 7.59 (m, 4H), 7.69 (t, J = 8.82 Hz, 8.10 (dd, J = 7.91, 1.29 Hz, 1 H) 16.28 (s, 1H).

Exemplo 183A 2-amino-5-metoxibenzenossulfonamida O composto em título foi preparado a partir de 4-metoxianilina utilizando o procedimento descrito em Journal of the Chemical Society, Perkin 1, 1979, 1043.Example 183A 2-Amino-5-methoxybenzenesulfonamide The title compound was prepared from 4-methoxyaniline using the procedure described in Journal of the Chemical Society, Perkin 1, 1979, 1043.

Exemplo 183B (7-metoxi-l,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)acetato de metilo A uma solução do produto do Exemplo 183A (0,534 g, 2,64 mmol) e trietilamina (0,44 mL, 3,17 mmol) em diclorometano anidro (8 mL) sob azoto a 0°C juntou-se gota a gota cloreto de etilmalonilo (0,39 mL, 3,04 mmol). A mistura resultante foi agitada a 25°C durante 6 horas. A mistura reaccional foi diluída com HC1 IN (30 mL) e a fase aquosa foi extraída com 216 ΕΡ 1 560 827/ΡΤ acetato de etilo (2 χ 30 mL) . Os extractos orgânicos combinados foram lavados com salmoura, secos sobre sulfato de magnésio anidro e filtrados. O filtrado foi concentrado e o sólido castanho resultante foi recristalizado em diclorometano/metanol para gerar um sólido rosa (420 mg) . O sólido foi tratado com carbonato de sódio anidro (700 mg, 6,65 mmol) em etanol anidro (15 mL) e aguecido a refluxo durante 7 horas. O sólido foi removido por filtração e o filtrado foi concentrado para gerar o composto em titulo como um sólido branco (420 mg, rendimento total para os dois passos de 50%). MS (ESI) m/z 297 (M-H)“. XH RMN (300 MHz, DMSO-d6) δ ppm 1,19 (t, J=7,17 Hz, 3H) 3,23 (s, 2H) 3,75 (s, 3H) 4,07 (g, J= 6,99To a solution of the product of Example 183A (0.534 g, 2.64 mmol) and triethylamine (1: 1) in dichloromethane 0.44 mL, 3.17 mmol) in anhydrous dichloromethane (8 mL) under nitrogen at 0 ° C was added dropwise ethylmalonyl chloride (0.39 mL, 3.04 mmol). The resulting mixture was stirred at 25 ° C for 6 hours. The reaction mixture was diluted with 1N HCl (30 mL) and the aqueous phase extracted with 216 Âμl 1560 827 / ΡΤ ethyl acetate (2 x 30 mL). The combined organic extracts were washed with brine, dried over anhydrous magnesium sulfate and filtered. The filtrate was concentrated and the resulting brown solid was recrystallized from dichloromethane / methanol to give a pink solid (420 mg). The solid was treated with anhydrous sodium carbonate (700 mg, 6.65 mmol) in anhydrous ethanol (15 mL) and refluxed for 7 hours. The solid was removed by filtration and the filtrate was concentrated to give the title compound as a white solid (420 mg, 50% overall yield of 50%). MS (ESI) m / z 297 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.19 (t, J = 7.17 Hz, 3H) 3.23 (s, 2H) 3.75 (s, 3H) 4.07 (g, J = = 6.99

Hz, 2H) 6,99 (m, 3H).2H), 6.99 (m, 3H).

Exemplo 183C 4-hidroxi-3-(7-metoxi-l,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il)-1-(3-metilbutil)-1, 8-naftiridin-2(1H)-ona A uma solução do produto do Exemplo 183B (0,5 g, 1,6 mmol) e do produto do Exemplo 12A (0,375 g, 1,6 mmol) em THF anidro (16 mL) sob azoto a 0°C juntou-se hidreto de sódio (95%, 0,162 g, 6,4 mmol). A reacção foi aguecida a refluxo durante 4 horas, arrefecida até 0°C e tratada gota a gota com ácido acético glacial (3 mL). A mistura resultante foi aquecida a refluxo durante 2 horas, arrefecida até 25° e diluída com água gelada (150 mL). O precipitado resultante foi recolhido por filtração, lavado com água e recristalizado em dioxano/água para gerar o composto em titulo (566 mg, 80%). O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 441 (M-H)“. RMN (300 MHz, DMSO-de) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,48 (m, 2H) 1,64 (m, 1H) 3,82 (s, 3H) 4,29 (m, 2H) 7,16 (m, 4H) 8,36 (dd, J=7,54, 2,02 Hz, 1H) 8,52 (dd, J=4,60, 2,02 Hz, 1H) 15,86 (S, 1H) .Example 183C 4-hydroxy-3- (7-methoxy-1,1-dioxido-4,11 -benzothiadiazin-3-yl) -1- (3-methylbutyl) -1,8-naphthyridin-2- 1H) -one To a solution of the product of Example 183B (0.5 g, 1.6 mmol) and the product of Example 12A (0.375 g, 1.6 mmol) in anhydrous THF (16 mL) under nitrogen at 0 ° C was added sodium hydride (95%, 0.162 g, 6.4 mmol). The reaction was refluxed for 4 hours, cooled to 0 ° C and treated dropwise with glacial acetic acid (3 mL). The resulting mixture was heated to reflux for 2 hours, cooled to 25ø and diluted with ice water (150 mL). The resulting precipitate was collected by filtration, washed with water and recrystallized from dioxane / water to give the title compound (566 mg, 80%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 441 (M-H). NMR (300 MHz, DMSO-d6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) 1.64 (m, 1H) 3.82 (s, 3H) 4.29 (m, 2H) 7.16 (m, 4H) 8.36 (dd, J = 7.54, 2.02 Hz, 1 H) 8.52 (dd, J = 4.60, 2.02 1H), 15.86 (s, 1H).

Exemplo 184 4-hidroxi-3-(7-hidroxi-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-(3-metilbutil)-1,8-naftiridin-2(1H)-ona O produto do Exemplo 183C (0,027 g, 0,061 mmol) em diclorometano (0,6 mL) reagiu com tribrometo de boro (1,0 M, 0,37 mL, 0,37 mmol) em diclorometano a 25°C durante 18 horas. A reacção foi extinta com metanol e agitada durante 30 minutos a 25°C. A reacção foi concentrada sob pressão reduzida para 217 ΕΡ 1 560 827/ΡΤ gerar ο composto em título como um sólido (20,4 mg, 78%). O di-sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D utilizando dois equivalentes de hidróxido de sódio. MS (ESI-) m/z 427 (M-H)“. ΧΗ RMN (300 MHz, DMSO-d6) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,47 (m, 2H) 1,64 (m, 1H) 4,29 (m, 2H) 6,51 (m, 2H) 6,78 (m, 1H) 7,09 (dd, J=7,72, 4,78 Hz, 1H) 8,34 (dd, J=7,35, 1,84 Hz, 1H) 8,48 (dd, J=4,60, 2,02 Hz, 1H) 15,23 (br s, 1H).Example 184 4-Hydroxy-3- (7-hydroxy-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1- (3-methylbutyl) -1,8-naphthyridin-2- 1H) -one The product of Example 183C (0.027 g, 0.061 mmol) in dichloromethane (0.6 mL) was reacted with boron tribromide (1.0 M, 0.37 mL, 0.37 mmol) in 25% dichloromethane C for 18 hours. The reaction was quenched with methanol and stirred for 30 minutes at 25 ° C. The reaction was concentrated under reduced pressure to give the title compound as a solid (20.4 mg, 78%). The sodium di-salt of the title compound was prepared according to the procedure of Example 1D using two equivalents of sodium hydroxide. MS (ESI-) m / z 427 (M-H). NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.64 (m, 1H) 4.29 (m, 2H ) 6.51 (m, 2H) 6.78 (m, 1 H) 7.09 (dd, J = 7.72, 4.78 Hz, 1 H) 8.34 (dd, J = 7.35, 84 Hz, 1 H) 8.48 (dd, J = 4.60, 2.02 Hz, 1 H) 15.23 (br s, 1H).

Exemplo 185 ({3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1, 8-naftiridin-3-il]-1, l-dioxido-4ff-l, 2,4-benzotiadiazin-7-il}oxi)acetonitrilo O produto do Exemplo 184 (0,050 g, 0,12 mmol) em N,N-dimetilformamida (1 mL) reagiu com 2-bromoacetonitrilo (14 pL, 0,2 mmol), carbonato de potássio (0,029 g, 0,22 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 30 horas. A mistura reaccional foi diluída com água (50 mL) e acidificada a pH 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aguoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi triturado com hexanos e diclorometano para gerar o composto em título como um sólido amarelo pálido (16,8 mg, 30%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. (ESI-) m/z 466 (M-H) ~. XH RMN (300 MHz, DMSO-d6) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,47 (m, 2H) 1,64 (m, 1H) 4,29 (m, 2H) 5,27 (s, 2H) 7,13 (dd, J=7,72, 4,78 Hz, 1H) 7,31 (m, 3H) 8,36 (dd, J=7,72, 1,84 Hz, 1H) 8,53 (dd, J=4,78, 1,84 Hz, 1H) 15,99 (s, 1H) .Example 185 ({3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido- The product of Example 184 (0.050 g, 0.12 mmol) in N, N-dimethylformamide (1 mL) was reacted with 2-bromoacetonitrile (14 μL, 2 mmol), potassium carbonate (0.029 g, 0.22 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 30 hours. The reaction mixture was diluted with water (50 mL) and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was triturated with hexanes and dichloromethane to give the title compound as a pale yellow solid (16.8 mg, 30%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. (ESI-) m / z 466 (M-H) -. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.64 (m, 1H) 4.29 (m, 2H ) 5.27 (s, 2H) 7.13 (dd, J = 7.72, 4.78 Hz, 1 H) 7.31 (m, 3H) 8.36 (dd, J = 7.72, 84 Hz, 1 H) 8.53 (dd, J = 4.78, 1.84 Hz, 1 H) 15.99 (s, 1H).

Exemplo 186 3- (1,l-dioxido-7-propoxi-4fl-l, 2, 4-benzotiadiazin-3-il)- 4- hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-ona O produto do Exemplo 184 (0,030 g, 0,07 mmol) em N,N-dimetilformamida (1 mL) reagiu com 1-bromopropano (0,025 ml, 0,28 mmol), carbonato de potássio (60 mg, 0,42 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 96 horas. A mistura reaccional foi diluída com água e acidificada 218 ΕΡ 1 560 827/ΡΤ a ρΗ 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aquoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi recristalizado em diclorometano:hexanos para gerar o composto em título (14 mg, 43%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ ppm 0,96 (d, J=6,62 Hz, 6H) 0,99 (t, J=7,35 Hz, 3H) 1,48 (m, 2H) 1,75 (m, 3H) 3,98 (t, J=6,43 Hz, 2H) 4,29 (m, 2H) 7,16 (m, 4H) 8,36 (dd, J=7,72, 1,84 Hz, 1H) 8,52 (dd, J=4,60, 2,02 Hz, 1H) 15,85 (s, 1H), (ESI-) m/z 469 (M-H)”.Example 186 3- (1,1-dioxido-7-propoxy-4,11,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-methylbutyl) -1,8-naphthyridin-2- 1H) -one The product of Example 184 (0.030 g, 0.07 mmol) in N, N-dimethylformamide (1 mL) was reacted with 1-bromopropane (0.025 mL, 0.28 mmol), potassium carbonate (60 mg, 0.42 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified with Î »5 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was recrystallized from dichloromethane: hexanes to give the title compound (14 mg, 43%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 0.99 (t, J = 7.35 Hz, 1.75 (m, 3H) 3.98 (t, J = 6.43 Hz, 2H) 4.29 (m, 2H) 7.16 (m, 4H) 8.36 (dd, J = 7.72 , 1.84 (s, 1H), 8.52 (dd, J = 4.60, 2.02 Hz, 1 H), (ESI-) m / z 469 (MH).

Exemplo 187 4-hidroxi-3-[7-(metoximetoxi)-1,l-dioxido-4fl-l, 2, 4-benzo-tiadiazin-3-il]-1-(3-metilbutil)-1,8-naftiridin-2(1H)-ona O produto do Exemplo 184 (30 mg, 0,07 mmol) em N,N-dimetilformamida (1 mL) reagiu com bromo(metoxi)metano (0,021 mL, 0,28 mmol), carbonato de potássio (38 mg, 0,28 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 96 horas. A mistura reaccional foi diluída com água e acidificada a pH 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aquoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi cromatografado em sílica gel eluindo com 3:1 hexanos/acetato de etilo para gerar o composto em título. :H RMN (300 MHz, DMSO-d6) δ ppm 0,98 (d, J=6,62 Hz, 6H) 1,56 (m, 2H) 1,70 (m, 1H) 3,42 (s, 3H) 4,47 (m, 2H) 5,31 (s, 2H) 7,44 (m, 3H) 7,66 (m, 1H) 8,54 (d, J=8,09 Hz, 1H) 8,85 (s, 1H) . (ESI-) m/z 471 (M-H)”. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D.Example 187 4-hydroxy-3- [7- (methoxymethoxy) -1,1-dioxido-4,1,2,4-benzothiadiazin-3-yl] -1- (3-methylbutyl) -1,8- naphthyridin-2 (1H) -one The product from Example 184 (30 mg, 0.07 mmol) in N, N-dimethylformamide (1 mL) was reacted with bromine (methoxy) methane (0.021 mL, 0.28 mmol), carbonate of potassium (38 mg, 0.28 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was chromatographed on silica gel eluting with 3: 1 hexanes / ethyl acetate to give the title compound. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.98 (d, J = 6.62 Hz, 6H) 1.56 (m, 2H) 1.70 (m, 1H) 3.42 (s, 3H) 4.47 (m, 2H) 5.31 (s, 2H) 7.44 (m, 3H) 7.66 (m, 1H) 8.54 (d, J = 8.09 Hz, , 85 (s, 1H). (ESI-) m / z 471 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D.

Exemplo 188 4-Hidroxi-l-(3-metilbutil)-3-{7-[(2-metilprop-2-enil)oxi]-1,1-dioxido-4/í-l, 2, 4-benzotiadiazin-3-il} -1, 8-naf tiridin-2 (1H) -ona O produto do Exemplo 184 (30 mg, 0,07 mmol) em N,N-dimetilformamida (1 mL) reagiu com 3-bromo-2-metilprop-l-eno (8 pL, 0, 077 mmol), carbonato de potássio (60 mg, 0,42 219 ΕΡ 1 560 827/ΡΤ mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 24 horas. A mistura reaccional foi diluída com água e acidificada a pH 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aquoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi recristalizado em diclorometano:hexanos para gerar o composto em título (17,4 mg, 50%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-dê) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,47 (m, 2H) 1,64 (m, 1H) 1,78 (s, 3H) 4,29 (m, 2H) 4,54 (s, 2H) 4,98 (s, 1H) 5,08 (s, 1H) 7,12 (m, 2H) 7,22 (m, 2H) 8,36 (dd, J=7,54, 2,02 Hz, 1H) 8,52 (dd, J=4, 60, 2, 02 Hz, 1H) 15,86 (S, 1H) , (ESI-) m/z 481 (M-H)~.Example 188 4-Hydroxy-1- (3-methylbutyl) -3- {7 - [(2-methylprop-2-enyl) oxy] -1,1-dioxido-4 H -1,2,4-benzothiadiazin- 3-yl} -1,8-naphthyridin-2 (1H) -one The product from Example 184 (30 mg, 0.07 mmol) in N, N -dimethylformamide (1 mL) was reacted with 3-bromo-2- methylprop-1-ene (8 æL, 0.077 mmol), potassium carbonate (60 mg, 0.42 219 Ρ Ρ 1 560 827 ΡΤ mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 24 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was recrystallized from dichloromethane: hexanes to give the title compound (17.4 mg, 50%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.64 (m, 1H) 1.78 (s, 3H ) 4.29 (m, 2H) 4.54 (s, 2H) 4.98 (s, 1H) 5.08 (s, 1H) 7.12 (m, 2H) 7.22 (m, 2H) 8 , 8.28 (dd, J = 4, 60, 2.02 Hz, 1 H), 15.86 (s, 1H), (ESI-) m / z 481 (MH) +.

Exemplo 189 ({3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}oxi)acetato de tert-butilo O produto do Exemplo 184 (30 mg, 0,07 mmol) em N, N-dimetilformamida (1 mL) reagiu com bromoacetato de tert-butilo (0,04 mL, 0,28 mmol), carbonato de potássio (0,04 g,Example 189 ({3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido- 1,2-benzothiadiazin-7-yl} oxy) acetate The product from Example 184 (30 mg, 0.07 mmol) in N, N-dimethylformamide (1 mL) was reacted with tert-butyl bromoacetate (0.04 mL, 0.28 mmol), potassium carbonate (0.04 g,

O, 28 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 24 horas. A mistura reaccional foi diluída com água e acidificada a pH 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aquoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi cromatografado em sílica gel eluindo com 3:1 hexanos/acetato de etilo para gerar o composto em título (20 mg, 53%) . XH RMN (300 MHz, DMSO-de) δ ppm 0,97 (d, J=6,62 Hz, 6H) 1,43 (s, 9H) 1,51 (m, 2H) 1,66 (m, 1H) 4,35 (m, 2H) 4,77 (s, 2H) 7,33 (m, 4H) 8,42 (d, J=8,09 Hz, 1H) 8,63 (s, 1H) . (ESI-) m/z 541 (M-H)'. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 220 ΕΡ 1 560 827/ΡΤ(28 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 24 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was chromatographed on silica gel eluting with 3: 1 hexanes / ethyl acetate to give the title compound (20 mg, 53%). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.97 (d, J = 6.62 Hz, 6H) 1.43 (s, 9H) 1.51 (m, 2H) 1.66 (m, 1H ) 4.35 (m, 2H) 4.77 (s, 2H) 7.33 (m, 4H) 8.42 (d, J = 8.09 Hz, 1 H) 8.63 (s, 1H). (ESI-) m / z 541 (M-H) +. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 220 ΕΡ 1 560 827 / ΡΤ

Exemplo 190 2-({3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro- 1, 8-naftiridin-3-il] -1, l-dioxido-4H-l, 2,4-benzotiadiazin-7-il}oxi)acetamida O produto do Exemplo 184 (30 mg, 0,07 mmol) em N, N-dimetilformamida (1 mL) reagiu com 2-bromoacetamida (16 mg, 0,12 mmol), carbonato de potássio (24 mg, 0,17 mmol) e iodeto de tetrabutilamónio (catalítico) a 25 °C durante 48 horas. A mistura reaccional foi diluída com água e acidificada a pH 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aquoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi triturado com diclorometano:hexanos para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm O, 96 (d, J=6,62 Hz, 6H) 1,48 (m, 2H) 1,64 (m, 1H) 4,29 (m, 2H) 4,49 (s, 2H) 7,13 (m, 2H) 7,24 (m, 2H) 7,40 (m, 1H) 7,62 (m; 1 H) 8,36 (dd, J=7,54, 2,02 Hz, 1H) 8,52 (dd, J=4,60, 2,02 Hz, 1H) 15,89 (s, 1H) . (ESI-) m/z 484 (M-H)”.Example 190 2 - ({3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1- 4H-1,2,4-benzothiadiazin-7-yl} oxy) acetamide The product of Example 184 (30 mg, 0.07 mmol) in N, N -dimethylformamide (1 mL) was reacted with 2-bromoacetamide (16 mg, 0.12 mmol), potassium carbonate (24 mg, 0.17 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 48 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was triturated with dichloromethane: hexanes to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) 1.64 (m, 1H) 4.29 (m, 2H ) 4.49 (s, 2H) 7.13 (m, 2H) 7.24 (m, 2H) 7.40 (m, 1H) 7.62 (m, 1H) 8.36 (dd, J = 7.54, 2.02 Hz, 1 H) 8.52 (dd, J = 4.60, 2.02 Hz, 1 H) 15.89 (s, 1H). (ESI-) m / z 484 (M-H).

Exemplo 191 3- [7-(benziloxi)-1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il]- 4- hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-ona O produto do Exemplo 184 (30 mg, 0,07 mmol) em N, N-dimetilformamida (1 mL) reagiu com (bromometil)benzeno (0,0138 mL, 0,11 mmol), carbonato de césio (50 mg, 0,15 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 96 horas. A mistura reaccional foi diluída com água e acidificada a pH 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aquoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi triturado com acetato de etilo para gerar o composto em título (13 mg, 36%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm O, 96 (d, J=6,25 Hz, 6H) 1,48 (m, 2H) 1,64 (m, 1H) 4,29 (m, 2H) 5,17 (s, 2H) 7,12 (dd, J=7,72, 4,78 Hz, 1H) 7,23 (m, 3H) 7,41 221 ΕΡ 1 560 827/ΡΤ (m, 5Η) 8,36 (dd, J=7,35, 1,84 Hz, 1H) 8,52 (dd, J=4,78, 1,84 Hz, 1H) 15,87 (s, 1H) . (ESI-) m/z 517 (M-H)~.Example 191 3- [7- (Benzyloxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -4-hydroxy-1- (3-methylbutyl) -1,8-naphthyridin- 2 (1H) -one The product of Example 184 (30 mg, 0.07 mmol) in N, N-dimethylformamide (1 mL) was reacted with (bromomethyl) benzene (0.0138 mL, 0.11 mmol), cesium (50 mg, 0.15 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was triturated with ethyl acetate to give the title compound (13 mg, 36%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.25 Hz, 6H) 1.48 (m, 2H) 1.64 (m, 1H) 4.29 (m, 2H ) 5.17 (s, 2H) 7.12 (dd, J = 7.72, 4.78 Hz, 1 H) 7.23 (m, 3 H) 7.41 221 η 1 1560 827 / δ (m, ) 8.36 (dd, J = 7.35, 1.84 Hz, 1 H) 8.52 (dd, J = 4.78, 1.84 Hz, 1 H) 15.87 (s, 1H). (ESI-) m / z 517 (M-H) -.

Exemplo 192 3-[1,l-dioxido-7-(2-pirrolidin-l-iletoxi)-4H-1,2,4-benzo-tiadiazin-3-il]-4-hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-ona O produto do Exemplo 184 (30 mg, 0,07 mmol) em N,N-dimetilformamida (1 mL) reagiu com cloridrato de 1— (2— cloroetil)pirrolidina (19 mg, 0,11 mmol), carbonato de potássio (96 mg, 0,69 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 72 horas. A mistura reaccional foi diluída com água e acidificada a pH 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aquoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O residuo resultante foi cromatografado em silica gel eluindo com 5% de metanol/diclorometano para gerar o composto em titulo. O sal de potássio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D substituindo por hidróxido de potássio o hidróxido de sódio. 1R RMN (300 MHz, DMSO-d6) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,48 (m, 2H) 1,64 (m, 1H) 1,91 (m, 4H) 3,16 (m, 4H) 3,47 (m, 1H) 4,30 (m, 4H) 7,13 (dd, J=7, 54, 4, 60 Hz, 1H) 7,24 (m, 3H) 8,36 (dd, J=7,72, 1,84 Hz, 1H) 8,53 (dd, J=4,60, 2,02 Hz, 1H) 15,90 (s, 1H) . (ESI-) m/z 524 (M-H)”.Example 192 3- [1,1-dioxido-7- (2-pyrrolidin-1-ylethoxy) -4H-1,2,4-benzothiadiazin-3-yl] -4-hydroxy-1- (3-methylbutyl) ) -1,8-naphthyridin-2 (1H) -one The product from Example 184 (30 mg, 0.07 mmol) in N, N-dimethylformamide (1 mL) was reacted with 1- (2-chloroethyl) pyrrolidine hydrochloride (19 mg, 0.11 mmol), potassium carbonate (96 mg, 0.69 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 72 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was chromatographed on silica gel eluting with 5% methanol / dichloromethane to give the title compound. The potassium salt of the title compound was prepared according to the procedure of Example 1D substituting potassium hydroxide and sodium hydroxide. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) 1.64 (m, 1H) 1.91 (m, 4H ) 3.16 (m, 4H) 3.47 (m, 1H) 4.30 (m, 4H) 7.13 (dd, J = 3H) 8.36 (dd, J = 7.72, 1.84 Hz, 1 H) 8.53 (dd, J = 4.60, 2.02 Hz, 1 H) 15.90 (s, 1H). (ESI-) m / z 524 (M-H).

Exemplo 193 3-[1,l-dioxido-7-(2-oxo-2-feniletoxi)-4H-1,2, 4-benzotiadiazin-3—i1]-4-hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-ona O produto do Exemplo 184 (30 mg, 0,07 mmol) em N,N-dimetilformamida (1 mL) reagiu com 2-bromo-l-feniletanona (30 mg, 0,15 mmol), carbonato de potássio (60 mg, 0,42 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 96 horas. A mistura reaccional foi diluída com água e acidificada a pH 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aquoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi cromatografado em sílica 222 ΕΡ 1 560 827/ΡΤ gel eluindo com 0,2% de metanol/diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,48 (m, 2H) 1,65 (m, 1H) 4,31 (m, 2H) 5,70 (s, 2H) 7,14 (m, 1H) 7,24 (d, J=9,93 Hz, 3H) 7,59 (t, J=7,35 Hz, 2H) 7,71 (t, J=7,35 Hz, 1H) 8,05 (m, 2H) 8,38 (dd, J=7,91, 1,65 Hz, 1H) 8,54 (m, 1H) 15,85 (s, 1H). (ESI-) m/z 545 (M-H)”.Example 193 3- [1,1-dioxido-7- (2-oxo-2-phenylethoxy) -4H-1,2,4-benzothiadiazin-3-yl] -4-hydroxy-1- (3-methylbutyl) - 1,8-naphthyridin-2 (1H) -one The product from Example 184 (30 mg, 0.07 mmol) in N, N-dimethylformamide (1 mL) was reacted with 2-bromo-1-phenylethanone (30 mg, , 15 mmol), potassium carbonate (60 mg, 0.42 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was chromatographed on silica gel and eluted with 0.2% methanol / dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) 1.65 (m, 1H) 4.31 (m, 2H ) 5.70 (s, 2H) 7.14 (m, 1H) 7.24 (d, J = 9.93 Hz, 3H) 7.59 (t, J = 7.35 Hz, 2H) 7.71 (t, J = 7.35 Hz, 1 H) 8.05 (m, 2 H) 8.38 (dd, J = 7.91, 1.65 Hz, 1 H) 8.54 (m, (s, 1H). (ESI-) m / z 545 (M-H).

Exemplo 194 3- [7-(aliloxi)-1,l-dioxido-4fl-l, 2,4-benzotiadiazin-3-il] - 4- hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-ona O produto do Exemplo 184 (30 mg, 0,07 mmol) em N, N-dimetilformamida (1 mL) reagiu com 3-iodoprop-l-eno (0,007 mL, 0,077 mmol), carbonato de potássio (60 mg, 0,42 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 96 horas. A mistura reaccional foi diluída com água e acidificada a pH 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aquoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi triturado com hexanos para gerar o composto em título. :H RMN (300 MHz, DMSO-d6) δ ppm O, 98 (d, J=6,25 Hz, 6H) 1,55 (m, 2H) 1,68 (m, 1H) 4,42 (m, 2H) 4,69 (d, J=5,52 Hz, 2H) 5,30 (dd; J=10,66, 1,47 Hz, 1H) 5,43 (dd, J=17,28, 1,84 Hz, 1H) 6,06 (m, 1H) 7,29 (m, 3H) 7,53 (m, 1H) 8,49 (d, J=6,62 Hz, 1H) 8,76 (m, 1H) 15,29 (brs, 1H) . (ESI-) m/z 467 (M-H)-.Example 194 3- [7- (allyloxy) -1,1-dioxido-4,11,2-benzothiadiazin-3-yl] -4-hydroxy-1- (3-methylbutyl) -1,8-naphthyridin- 2 (1H) -one The product of Example 184 (30 mg, 0.07 mmol) in N, N-dimethylformamide (1 mL) was reacted with 3-iodoprop-1-ene (0.007 mL, 0.077 mmol), potassium carbonate (60 mg, 0.42 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was triturated with hexanes to give the title compound. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.98 (d, J = 6.25 Hz, 6H) 1.55 (m, 2H) 1.68 (m, 1H) 4.42 (m, 2H) 4.69 (d, J = 5.52 Hz, 2 H) 5.30 (dd, J = 10.66, 1.47 Hz, 1 H) 5.43 (dd, J = 17.28, (M, 3H), 7.53 (m, 1H), 8.49 (d, J = 6.62 Hz, 1 H) 8.76 (m, 1H) 15.29 (brs, 1H). (ESI-) m / z 467 (M-H) -.

Exemplo 195 4-Hidroxi-3-(7-isobutoxi-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-(3-metilbutil)-1,8-naftiridin-2(lff)-ona O produto do Exemplo 184 (30 mg, 0,07 mmol) em N,N-dimetilformamida (1 mL) reagiu com l-bromo-2-metilpropano (0,034 mL, 0,3 mmol), carbonato de potássio (60 mg, 0,42 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 96 horas. A mistura reaccional foi diluída com água e acidificada a pH 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aquoso, água e salmoura, seca sobre 223 ΕΡ 1 560 827/ΡΤ sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi recristalizado em hexanos: diclorometano para gerar o composto em título (10,5 mg, 31%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ ppm 0,96 (d, J=6,25 Hz, 6H) 0,99 (d, J=6,62 Hz, 6H) 1,47 (m, 2H) 1,64 (m, 1H) 2,03 (m, 1H) 3,80 (d, J=6,62 Hz, 2H) 4,29 (m, 2H) 7,15 (m, 4H) 8,36 (dd, J=7,72, 1,84 Hz , 1H) 8,52 (dd, J=4, 78, 1 ,84 Hz, 1H) 15,85 (s, , 1H). (ESI-) m/z 483 (M-H)&quot;.Example 195 4-Hydroxy-3- (7-isobutoxy-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1- (3-methylbutyl) -1,8-naphthyridin-2- The product of Example 184 (30 mg, 0.07 mmol) in N, N-dimethylformamide (1 mL) was reacted with 1-bromo-2-methylpropane (0.034 mL, 0.3 mmol), potassium carbonate (60 mg, 0.42 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was recrystallized from hexanes: dichloromethane to give the title compound (10.5 mg, 31%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.25 Hz, 6H) 0.99 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.64 (m, 1 H) 2.03 (m, 1 H) 3.80 (d, J = 6.62 Hz, 2 H) 4.29 (m, 2 H) 7.15 (m, 4 H) 8.36 (dd, J = 7.72, 1.84 Hz, 1 H) 8.52 (dd, J = 4.78, 1.84 Hz, 1 H) 15.85 (s, 1H). (ESI-) m / z 483 (M-H) &quot;.

Exemplo 196 4-({3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1, 8-naftiridin-3-il]-1, l-dioxido-4H-l, 2,4-benzotiadiazin-7-il}oxi)butanonitrilo O produto do Exemplo 184 (30 mg, 0,07 mmol) em N,N-dimetilformamida (1 mL) reagiu com 4-bromobutanonitrilo (0,0154 mL, 0,15 mmol), carbonato de potássio (60 mg, 0,42 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 96 horas. A mistura reaccional foi diluída com água e acidificada a pH 5 com ácido acético concentrado. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com bicarbonato de sódio aquoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi recristalizado com hexanos:diclorometano para gerar o composto em título (21,8 mg, 62%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dô) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,47 (m, 2H) 1,62 (m, 1H) 2,04 (m, 2H) 2,68 (t, J=7,17 Hz, 2H) 4,10 (t, J=5,88 Hz, 2H) 4,29 (m, 2H) 7,17 (m, 4H) 8,36 (dd, J=7,91, 1,29 Hz, 1H) 8,52 (dd, J=4,60, 1,65 Hz, 1H) 15,88 (s, 1H). (ESI-) m/z 494 (M-H)~.Example 196 4 - ({3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1- 4H-1,2,4-benzothiadiazin-7-yl} oxy) butanenitrile The product from Example 184 (30 mg, 0.07 mmol) in N, N-dimethylformamide (1 mL) was reacted with 4-bromobutanenitrile (0.0154 mL, 0.15 mmol), potassium carbonate (60 mg, 0.42 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was recrystallized from hexanes: dichloromethane to give the title compound (21.8 mg, 62%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.62 (m, 1H) 2.04 (m, 2H ) 2.68 (m, 2H), 7.17 (m, 4H), 8.36 (m, 2H) (dd, J = 7.91, 1.29 Hz, 1 H) 8.52 (dd, J = 4.60, 1.65 Hz, 1 H) 15.88 (s, 1H). (ESI-) m / z 494 (M-H) -.

Exemplo 197 ({3- [1- (3-metilbutil)-4-oxido-2-oxo-l,2-di-hidro-1, 8-naftiridin-3-il]-1, l-dioxido-4H-l, 2,4-benzotiadiazin-7-il}oxi)acetato O produto do Exemplo 189 (15 mg, 0,028 mmol) numa mistura de ácido trifluoroacético (0,8 mL) e diclorometano (0,2 mL) foi agitado durante duas horas a 25°C. Os solventes foram 224Example 197 ({3- [1- (3-methylbutyl) -4-oxido-2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4H- 1,2-benzothiadiazin-7-yl} oxy) acetate The product of Example 189 (15 mg, 0.028 mmol) in a mixture of trifluoroacetic acid (0.8 mL) and dichloromethane (0.2 mL) was stirred for two hours at 25 ° C. The solvents were 224

ΕΡ 1 560 827/PT removidos sob pressão reduzida para gerar um sólido amarelo que foi repartido entre acetato de etilo e água. A fase aquosa foi extraída com acetato de etilo (2 χ 20 mL) . A fase aquosa foi acidificada a pH 2 com HC1 IN e extraída com acetato de etilo (3 χ 20 mL) . Os extractos orgânicos combinados foram lavados com salmoura, secos sobre sulfato de magnésio anidro, filtrados e concentrados sob pressão reduzida para gerar o composto em título como um sólido branco (8 mg, 62%). O di-sal de sódio foi preparado de acordo com o procedimento do Exemplo 1D usando dois equivalentes de hidróxido de sódio. 1H RMN (300 MHz, DMSO-d6) δ ppm 0,99 (d, J=6,62 Hz, 6H) 1,58 (m, 2H) 1,70 (m, 1H) 3,17 (s, 1H) 4,49 (m, 2H) 4,88 (s, 2H) 7,36 (m, 2H) 7,49 (m, 1H) 7,70 (d, J=9,56 Hz, 1H) 8,56 (dd, J=7,91, 1,65 Hz, 1H) 8,88 (d, J=2,94 Hz, 1H). (ESI-) m/z 485 (M-H)“.And removed under reduced pressure to give a yellow solid which was partitioned between ethyl acetate and water. The aqueous phase was extracted with ethyl acetate (2 x 20 mL). The aqueous phase was acidified to pH 2 with 1N HCl and extracted with ethyl acetate (3 x 20 mL). The combined organic extracts were washed with brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure to give the title compound as a white solid (8 mg, 62%). The sodium di-salt was prepared according to the procedure of Example 1D using two equivalents of sodium hydroxide. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.99 (d, J = 6.62 Hz, 6H) 1.58 (m, 2H) 1.70 (m, 1H) 3.17 (s, 1H ) 4.49 (m, 2H) 4.88 (s, 2H) 7.36 (m, 2H) 7.49 (m, 1H) 7.70 (d, J = 9.56 Hz, 56 (dd, J = 7.91, 1.65 Hz, 1 H) 8.88 (d, J = 2.94 Hz, 1H). (ESI-) m / z 485 (M-H).

Exemplo 198 3- [7- (2-aminoetoxi) -1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il] - 4- hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-onaExample 198 3- [7- (2-Aminoethoxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -4-hydroxy-1- (3-methylbutyl) -1,8- naphthyridin-2 (1H) -one

Uma solução do produto do Exemplo 185 (21,8 mg, 62%) em tetra-hidrofurano anidro (0,5 mL) foi tratada com LiBH4 (10 mg, 0,46 mmol), agitada a temperatura ambiente durante 16 horas, diluída com água (30 mL) e extraída com acetato de etilo (2 χ 30 mL). As fases orgânicas combinadas foram lavadas com água, salmoura e secas sobre sulfato de magnésio anidro. A lama foi filtrada e o solvente removido sob pressão reduzida gerando o composto em título como um sólido amarelo (10,1 mg, 97%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,48 (m, 2H) 1,64 (m, 1H) 2,82 (m, 2H) 4,13 (t, J=5,33 Hz, 2H) 4,29 (m, 2H) 5,40 (m, 2H) 7,17 (m, 4H) 8,36 (dd, J=7, 72, 1, 84 Hz, 1H) 8,52 (dd, J=4, 60, 2, 02 Hz, 1H) 15,88 (s, 1H). (ESI-) m/z 470 (M-H)&quot;.A solution of the product of Example 185 (21.8 mg, 62%) in anhydrous tetrahydrofuran (0.5 mL) was treated with LiBH4 (10 mg, 0.46 mmol), stirred at room temperature for 16 hours, diluted with water (30 mL) and extracted with ethyl acetate (2 x 30 mL). The combined organic phases were washed with water, brine and dried over anhydrous magnesium sulfate. The slurry was filtered and the solvent removed under reduced pressure to afford the title compound as a yellow solid (10.1 mg, 97%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) 1.64 (m, 1H) 2.82 (m, 2H ) 4.13 (t, J = 5.33 Hz, 2H) 4.29 (m, 2H) 5.40 (m, 2H) 7.17 (m, 4H) 8.36 (dd, J = 72, 1, 84 Hz, 1 H) 8.52 (dd, J = 4.60, 2. 02 Hz, 1 H) 15.88 (s, 1H). (ESI-) m / z 470 (M-H) &quot;.

Exemplo 199 2-({3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4fl-l,2,4-benzotiadiazin-7-il}oxi)-N-metilacetamidaEXAMPLE 199 2 - ({3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1- 4fl -1,2,4-benzothiadiazin-7-yl} oxy) -N-methylacetamide

Uma mistura do Exemplo 197 (4,7 mg, 0,0097 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etilcarbodiimida (1,4 mg, 0,01 mmol), metilamina em tetra-hidrofurano (2,0 M, 10 pL, 225 ΕΡ 1 560 827/ΡΤ 0,02 mmol) e 1-hidroxibenzotriazole (1,4 mg, 0,01 mmol) em N,N-dimetilformamida (0,2 mL) foi agitada a 25°C durante 5 horas. A mistura reaccional foi diluída com acetato de etilo (40 mL), lavada com bicarbonato de sódio saturado, água e salmoura e seca sobre sulfato de magnésio anidro. O agente de secagem foi removido por filtração e o solvente removido sob pressão reduzida para gerar o composto em título como um sólido amarelo pálido (4 mg, 83%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. :Η RMN (300 MHz, DMSO-d6) δ ppm, 0,96 (d, J=6,62A mixture of Example 197 (4.7 mg, 0.0097 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (1.4 mg, 0.01 mmol), methylamine in tetrahydrofuran , And 1-hydroxybenzotriazole (1.4 mg, 0.01 mmol) in N, N-dimethylformamide (0.2 mL) was stirred at 25Â ° C for 5 hours. The reaction mixture was diluted with ethyl acetate (40 mL), washed with saturated sodium bicarbonate, water and brine and dried over anhydrous magnesium sulfate. The drying agent was removed by filtration and the solvent removed under reduced pressure to give the title compound as a pale yellow solid (4 mg, 83%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. : ¹H NMR (300 MHz, DMSO-d 6) δ ppm, 0.96 (d, J = 6.62

Hz, 6H) 1,47 (m, 2H) 1,64 (m, 1H) 2,67 (d, J=4,78 Hz, 3H) 4,30 (m, 2H) 4,53 (s, 2H) 7,18 (m, 4H) 8,11 (m, 1H) 8,36 (dd, J=7,54, 2,02 Hz, 1H) 8,52 (dd, J=4,78, 1,84 Hz, 1H) 15,90 (s, 1H). (ESI-) m/z 498 (M-H)A2H) 1.64 (m, 1H) 2.67 (d, J = 4.78 Hz, 3H) 4.30 (m, 2H) 4.53 (s, 2H ) 7.18 (m, 4H) 8.11 (m, 1 H) 8.36 (dd, J = 7.54, 2.02 Hz, 1 H) 8.52 (dd, J = 84 Hz, 1 H) 15.90 (s, 1H). (ESI-) m / z 498 (M-H) +.

Exemplo 200 acetato de 3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4ff-l,2,4-benzotiadiazin-7-iloEXAMPLE 200 3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido- 1,2,4-benzothiadiazin-7-yl

Uma mistura de Exemplo 184 (30 mg, 0,07 mmol), trietilamina (12 pL, 0,084 mmol) e anidrido acético (8 pL, 0,084 mmol) em diclorometano anidro (1 mL) foi agitada a 25°C durante 16 horas. A mistura reaccional foi diluída com acetato de etilo e água, acidificada a pH 5 com ácido acético e repartida. A fase aquosa foi extraída com acetato de etilo (2 x 20 mL) . Os extractos orgânicos combinados foram lavados com bicarbonato de sódio saturado, água, salmoura, secos sobre sulfato de magnésio anidro, filtrados e o solvente removido sob pressão reduzida para gerar o composto em título como um sólido branco (29,5 mg, 89%). XH RMN (300 MHz, DMSO-d6) δ ppm 0,98 (d, J=6,25 Hz, 6H) 1,56 (m, 2H) 1,69 (m, 1H) 2,30 (s, 3H) 4,46 (m, 2H) 7,44 (m, 1H) 7,52 (d, J=8,82 Hz, 1H) 7,72 (m, 2H) 8,53 (dd, J=7, 72, 1, 47 Hz, 1H) 8,83 (s, 1H) . (ESI-) m/z 469 (M-H)~.A mixture of Example 184 (30 mg, 0.07 mmol), triethylamine (12 μL, 0.084 mmol) and acetic anhydride (8 μL, 0.084 mmol) in anhydrous dichloromethane (1 mL) was stirred at 25 ° C for 16 hours. The reaction mixture was diluted with ethyl acetate and water, acidified to pH 5 with acetic acid and partitioned. The aqueous layer was extracted with ethyl acetate (2 x 20 mL). The combined organic extracts were washed with saturated sodium bicarbonate, water, brine, dried over anhydrous magnesium sulfate, filtered and the solvent removed under reduced pressure to give the title compound as a white solid (29.5 mg, 89%). . 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.98 (d, J = 6.25 Hz, 6H) 1.56 (m, 2H) 1.69 (m, 1H) 2.30 (s, 3H) J = 8.82 Hz, 1 H) 7.72 (m, 2 H) 8.53 (dd, J = 7, 72, 1.47 Hz, 1 H) 8.83 (s, 1H). (ESI-) m / z 469 (M-H) -.

Exemplo 201 3-[1, l-dioxido-7-(piridin-2-iloxi)-4H-1,2, 4-benzotiadiazin-3-il] -4-hidroxi-l- (3-metilbutil) -1,8-naftiridin-2 (li?) -ona O produto do Exemplo 184 (10 mg, 0,023 mmol) reagiu com 2-bromopiridina (2,4 pL, 0,025 mmol), carbonato de césio (15 mg, 0,046 mmol) e cobre metálico (40 mg) em dimetilsulfóxido 226 ΕΡ 1 560 827/ΡΤ (0,1 mL) a 110°C num reactor de microondas durante 2 horas. A mistura foi arrefecida até 25°C, vertida em água (20 mL) e extraída com acetato de etilo (2 χ 20 mL) . Os extractos orgânicos combinados foram lavados com salmoura, secos sobre sulfato de magnésio anidro, filtrados e o solvente removido sob pressão reduzida, deixando um sólido bege. O sólido foi cromatografado em sílica gel, eluindo primeiro com cloreto de metileno, e depois com 1% de metanol em cloreto de metileno, o que gerou o composto em título como um sólido castanho claro (5 mg, 42%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 0,96 (s, 3H) 0,98 (s, 3H) 1,48 (m, 2H) 1,65 (m, 1H) 4,30 (t, J=7,50 Hz, 2H) 7,14 (m, 3H) 7,35 (s, 3H) 7,89 (m, 1H) 8,17 (m, 1H) 8,38 (dd, 0=1,12, 2,21 Hz, 1H) 8,53 (dd, J=4,78, 1,84 Hz, 1H) 16,07 (s, 1H). (ESI-) m/z 504 (M-H)&quot;.Example 201 3- [1,1-dioxido-7- (pyridin-2-yloxy) -4H-1,2,4-benzothiadiazin-3-yl] -4-hydroxy-1- (3-methylbutyl) The product of Example 184 (10 mg, 0.023 mmol) was reacted with 2-bromopyridine (2.4 μL, 0.025 mmol), cesium carbonate (15 mg, 0.046 mmol) and copper (40 mg) in dimethylsulfoxide was added dropwise at 110 ° C in a microwave reactor for 2 hours. The mixture was cooled to 25øC, poured into water (20 mL) and extracted with ethyl acetate (2 x 20 mL). The combined organic extracts were washed with brine, dried over anhydrous magnesium sulfate, filtered and the solvent removed under reduced pressure, leaving a beige solid. The solid was chromatographed on silica gel, eluting first with methylene chloride, and then with 1% methanol in methylene chloride, which afforded the title compound as a light brown solid (5 mg, 42%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (s, 3H) 0.98 (s, 3H) 1.48 (m, 2H) 1.65 (m, 1H) 4.30 (t, J = 7.50 Hz, 2 H) 7.14 (m, 3 H) 7.35 (s, 3 H) 7.89 (m, 1 H) 8.17 (m, 1 H) 8.38 (dd, , 12.2-21 Hz, 1 H) 8.53 (dd, J = 4.78, 1.84 Hz, 1 H) 16.07 (s, 1H). (ESI-) m / z 504 (M-H) &quot;.

Exemplo 202 3-[1,l-dioxido-7-(pirimidin-2-iloxi)-4H-1,2, 4-benzotiadiazin-3—i1]-4-hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-ona O produto do Exemplo 184 (10 mg, 0,023 mmol) reagiu com 2-bromopirimidina (4,5 mg, 0,028 mmol), carbonato de césio (15 mg, 0,046 mmol) e iodeto de tetrabutilamónio (1 mg) em dimetilsulfóxido (0,1 mL) num dispositivo de reacção de microondas a 110°C durante 1 hora. A mistura foi arrefecida até 25°C, vertida em água (20 mL) e extraída com acetato de etilo (2 χ 50 mL) . Os extractos orgânicos combinados foram lavados com salmoura, secos sobre sulfato de magnésio anidro, filtrados e o solvente removido sob pressão reduzida deixando um sólido bege. O sólido foi cromatografado em sílica gel, eluindo primeiro com cloreto de metileno, seguido de 2% de metanol em cloreto de metileno, proporcionando o composto em título como um sólido branco (6 mg, 51%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento tal como descrito no Exemplo 1D. 1R RMN (300 MHz, DMSO-d6) δ ppm 0,96 (s, 3H) 0,98 (s, 3H) 1,48 (m, 2H) 1,65 (m, 1H) 4,30 (t, J=7,50 Hz, 2H) 7,14 (dd, J=7,54, 4, 60 Hz, 1H) 7,30 (t, J=4, 78 Hz, 1H) 7,42 (m, 3H) 8,38 (dd, J=7, 72, 1, 84 Hz, 1H) 8,54 (dd, J=4,78, 1,84 Hz, 1H) 8,67 (s, 1H) 8,68 (s, 1H) 16,10 (s, 1H). (ESI-) m/z 505 (M-H)&quot;. 227 ΕΡ 1 560 827/ΡΤExample 202 3- [1,1-dioxido-7- (pyrimidin-2-yloxy) -4H-1,2,4-benzothiadiazin-3-yl] -4-hydroxy-1- (3-methylbutyl) 8-naphthyridin-2 (1H) -one The product of Example 184 (10 mg, 0.023 mmol) was reacted with 2-bromopyrimidine (4.5 mg, 0.028 mmol), cesium carbonate (15 mg, 0.046 mmol) and tetrabutylammonium bromide (1 mg) in dimethylsulfoxide (0.1 mL) in a microwave reaction apparatus at 110 ° C for 1 hour. The mixture was cooled to 25øC, poured into water (20 mL) and extracted with ethyl acetate (2 x 50 mL). The combined organic extracts were washed with brine, dried over anhydrous magnesium sulfate, filtered and the solvent removed under reduced pressure leaving a beige solid. The solid was chromatographed on silica gel, eluting first with methylene chloride, followed by 2% methanol in methylene chloride, affording the title compound as a white solid (6 mg, 51%). The sodium salt of the title compound was prepared according to the procedure as described in Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (s, 3H) 0.98 (s, 3H) 1.48 (m, 2H) 1.65 (m, 1H) 4.30 (t, J = 7.50 Hz, 2 H) 7.14 (dd, J = 7.54, 4.60 Hz, 1 H) 7.30 (t, J = 4.78 Hz, ) 8.38 (dd, J = 7.72, 1.84 Hz, 1 H) 8.54 (dd, J = 4.78, 1.84 Hz, 1 H) 8.67 (s, 1H) 8.68 (s, 1 H) 16.10 (s, 1 H). (ESI-) m / z 505 (M-H) &quot;. 227 ΕΡ 1 560 827 / ΡΤ

Exemplo 203 2-({3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1, 8-naftiridin-3-ll]-1,l-dioxido-4ff-l, 2,4-benzotiadiazin-7-il}oxi)-N, N-dimetilacetamida O composto em título foi preparado de acordo com o procedimento do Exemplo 185 substituindo por 2-cloro-N,N-dimetilacetamida o 2-bromoacetonitrilo. O composto foi purificado por trituração com metanol. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,47 (m, 2H) 1,64 (m, 1H) 2,86 (s, 3H) 3,01 (s, 3H) 4,30 (m, 2H) 4,90 (s, 2H) 7,16 (m, 4H) 8,36 (dd, J=7,72, 1,84 Hz, 1H) 8,52 (d, J=4,78 Hz, 1H) 15,86 (S, 1H). (ESI-) m/z 512 (M-H)'.Example 203 2 - ({3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1- 2-yl) oxy) -N, N-dimethylacetamide The title compound was prepared according to the procedure of Example 185 substituting 2-chloro-N, N-dimethylacetamide for 2- bromoacetonitrile. The compound was purified by trituration with methanol. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.64 (m, 1H) 2.86 (s, 3H ), 3.01 (s, 3H), 4.30 (m, 2H) 4.90 (s, 2H) 7.16 (m, 4H) 8.36 (dd, J = 7.72, 1.84 Hz, 1H) 8.52 (d, J = 4.78 Hz, 1 H) 15.86 (s, 1H). (ESI-) m / z 512 (M-H) +.

Exemplo 204 4-hidroxi-l-(3-metilbutil)-3-(7-nitro-l, l-dioxido-4H-1,2,4-benzotiadiazin-3-il)-1,8-naftiridin-2(lfl)-onaExample 204 4-Hydroxy-1- (3-methylbutyl) -3- (7-nitro-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2- (R) -one

O produto do Exemplo 12B (0,229 g, 0,56 mmol) a 0°C reagiu com nitrato de amónio (0,058 g, 0,72 mmol) em ácido sulfúrico concentrado (1,5 mL) e foi agitado a 0°C durante 30 minutos. A mistura reaccional foi vertida sobre gelo esmagado e o pH foi ajustado a 9 com hidróxido de sódio aquoso. O sólido resultante foi isolado por filtração para gerar o composto em título (0,21 g, 81%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. (ESI-) m/z 456 (M-H)'. :H RMN (300 MHz, DMSO-d6) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,47 (m, 2H) 1,64 (m, 1H) 4,29 (m, 2H) 7,14 (m, 1H) 7,52 (m, 1H) 8,40 (m, 3H) 8,54 (m, 1H) 16,77 (s, 1H) .The product of Example 12B (0.229 g, 0.56 mmol) at 0 ° C was reacted with ammonium nitrate (0.058 g, 0.72 mmol) in concentrated sulfuric acid (1.5 mL) and stirred at 0 ° C for 30 minutes. The reaction mixture was poured onto crushed ice and the pH adjusted to 9 with aqueous sodium hydroxide. The resulting solid was isolated by filtration to give the title compound (0.21 g, 81%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. (ESI-) m / z 456 (M-H) +. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.64 (m, 1H) 4.29 (m, 2H) 7.14 (m, 1H) 7.52 (m, 1H) 8.40 (m, 3H) 8.54 (m, 1H) 16.77 (s, 1H).

Exemplo 205 RZ 3- (7-amino-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)- 4- hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-onaExample 205 RZ 3- (7-Amino-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-methylbutyl) -1,8-naphthyridin-2 (1H) -one

Uma mistura do produto do Exemplo 204 (0, 198 g, 0,43 mmol), ferro em pó (0,121 g, 2,16 mmol) e NH4C1 (0,031 g, 0,58 mmol) em metanol:tetra-hidrofurano:água (3:3:1,7 mL) foi agitada a refluxo durante nove horas. A mistura reaccional foi arrefecida até 25°C e o ferro foi removido por filtração e 228 ΕΡ 1 560 827/ΡΤ lavado com metanol. O filtrado foi concentrado sob pressão reduzida, diluído com água e extraído com acetato de etilo. A fase orgânica foi lavada com água, salmoura e seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida para gerar o composto em titulo como um sólido amarelo (0,121 g, 66%). (ESI-) m/z 426 (M-H)“. XH RMN (300 MHz, DMSO-de) δ ppm 0,98 (d, J=6,62 Hz, 6H) 1,58 (m, 2H) 1,69 (m, 1H) 4,46 (m, 2H) 5,86 (s, 2H) 6,96 (m, 2H) 7,46 (m, 2H) 8,52 (d, J=6,99 Hz, 1H) 8,84 (m, 1H) 13,90 (s, 1H).A mixture of the product of Example 204 (0.198 g, 0.43 mmol), iron powder (0.121 g, 2.16 mmol) and NH 4 Cl (0.031 g, 0.58 mmol) in methanol: tetrahydrofuran: water (3: 3: 1.7 mL) was stirred at reflux for nine hours. The reaction mixture was cooled to 25 ° C and the iron was removed by filtration and washed with methanol. The filtrate was concentrated under reduced pressure, diluted with water and extracted with ethyl acetate. The organic phase was washed with water, brine and dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure to give the title compound as a yellow solid (0.121 g, 66%). (ESI-) m / z 426 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.98 (d, J = 6.62 Hz, 6H) 1.58 (m, 2H) 1.69 (m, 1H) 4.46 (m, 2H ) 5.86 (m, 2H) 8.56 (s, 2H) 6.96 (m, 2H) 7.46 (m, 2H) 8.52 (d, J = 6.99 Hz, 90 (s, 1H).

Exemplo 206 ({3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4fl-l,2,4-benzotiadiazin-7—il}amino)acetonitrilo À solução do Exemplo 205 (10 mg, 0,023 mmol) em N,N-dimetilformamida (0,2 mL) juntou-se bromoacetonitrilo (2,5 pL, 0,035 mmol) e carbonato de potássio (5 mg, 0,035 mmol). A mistura foi agitada sob aquecimento a 100°C num reactor de microondas durante 1 hora. Após arrefecimento a 25°C, a solução laranja foi diluida com água e o pH da fase aquosa foi ajustado a pH 5 com ácido acético. A fase aquosa foi extraída com acetato de etilo (3 χ 20 mL) . A fase orgânica combinada foi lavada com água e salmoura, seca sobre sulfato de magnésio, filtrada, concentrada e purificada por cromatografia instantânea em coluna em silica gel eluindo com 1% metanol/diclorometano para gerar o composto em título como um sólido amarelo (6,0 mg, 55%). MS (ESI-) m/z 465 (M-H)-. XH RMN (300 MHz, DMSO-dô) δ ppm 0,99 (d, J=6,62 Hz, 6H) 1,58 (m, 2H) 1,68 (m, 1H) 4,46 (m, 4H) 6,92 (m, 1H) 7,16 (m, 2H) 7,49 (m, 1H) 7,61 (d, J=9,19 Hz, 1H) 8,56 (dd, J=7,90,l,65 Hz, 1H) 8,89 (m, 1H) 14,00 (br s, 1H) 15,39 (br s, 1H) . O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 0,96 (d,J=6,62 Hz, 6H) 1,48 (m, 2H) 1,64 (m, 1H) 4,31 (m, 4H) 6,49 (t, J=6,62 Hz, 1H) 6,99 (m, 2H) 7,13 (m, 2H) 8,35 (dd, J=7, 72, 1, 84 Hz, 1H) 8,51 (dd, J=4,41, 1,84 Hz, 1H) 15,73 (s, 1H) .Example 206 ({3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido- To the solution of Example 205 (10 mg, 0.023 mmol) in N, N-dimethylformamide (0.2 mL) was added bromoacetonitrile (2.5 pL, 0.035 mmol) mmol) and potassium carbonate (5 mg, 0.035 mmol). The mixture was stirred under heating at 100 ° C in a microwave reactor for 1 hour. After cooling to 25øC, the orange solution was diluted with water and the pH of the aqueous phase was adjusted to pH 5 with acetic acid. The aqueous phase was extracted with ethyl acetate (3 x 20 mL). The combined organic phase was washed with water and brine, dried over magnesium sulfate, filtered, concentrated, and purified by flash column chromatography on silica gel eluting with 1% methanol / dichloromethane to give the title compound as a yellow solid (6: 0 mg, 55%). MS (ESI-) m / z 465 (M-H) -. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.99 (d, J = 6.62 Hz, 6H) 1.58 (m, 2H) 1.68 (m, 1H) 4.46 (m, 4H ) 6.92 (m, 1 H) 7.16 (m, 2 H) 7.49 (m, 1 H) 7.61 (d, J = 9.19 Hz, 1 H) 8.56 (dd, 90, 1.65 Hz, 1 H) 8.89 (m, 1 H) 14.00 (br s, 1 H) 15.39 (br s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) 1.64 (m, 1H) 4.31 (m, 4H ) 6.49 (t, J = 6.62 Hz, 1 H) 6.99 (m, 2 H) 7.13 (m, 2 H) 8.35 (dd, J = 7.72, 1.84 Hz, 1H ) 8.51 (dd, J = 4.41, 1.84 Hz, 1 H) 15.73 (s, 1H).

Exemplo 207 7-hidroxi-6-(7-metoxi-l,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il)-4-(3-metilbutil)tieno[3,2-b]piridin-5(AH)-ona 229 ΕΡ 1 560 827/ΡΤ Ο composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto doExample 207 7-hydroxy-6- (7-methoxy-1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -4- (3-methylbutyl) thieno [3,2- b] pyridine -5 (AH) -one The title compound was prepared according to the procedure of Example 1D substituting the product of

Exemplo 125A o produto do Exemplo 1B e substituindo pelo produto do Exemplo 183B o produto do Exemplo 1C. O sal de sódio foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,44 (m, 2H) 1,66 (m, 1H) 3,81 (s, 3H) 3,99 (m, 2H) 7,09 (m, 2H) 7,16 (m, 2H) 7,79 (d, J=5,15 Hz, 1H) 15,87 (s, 1H). (ESI-) m/z 446 (M-H)~.Example 125A The product of Example 1B and substituting the product of Example 183B for the product of Example 1C. The sodium salt was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.44 (m, 2H) 1.66 (m, 1H) 3.81 (s, 3H) ) 3.99 (m, 2H) 7.09 (m, 2H) 7.16 (m, 2H) 7.79 (d, J = 5.15 Hz, 1 H) 15.87 (s, 1H). (ESI-) m / z 446 (M-H) -.

Exemplo 208 4-benzil-7-hidroxi-6-(7-metoxi-l,l-dioxido-4ff-l,2, 4-benzo-tiadiazin-3-il)tieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto doExample 208 4-benzyl-7-hydroxy-6- (7-methoxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) thieno [3,2- b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting

Exemplo 110B o produto do Exemplo 1B e substituindo pelo produto do Exemplo 183B o produto do Exemplo 1C. O sal de sódio foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 3,81 (s, 3H) 5,26 (s, 2H) 7,02 (d, J=5,15 Hz, 1H) 7,11 (m, 1H) 7,17 (m, 2H) 7,24 (m, 5H) 7,71 (d, J=5,15 Hz, 1H) 15,80 (s, 1H). (ESI-) m/z 466 (M-H)'.Example 110B The product of Example 1B and substituting the product of Example 183B for the product of Example 1C. The sodium salt was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.81 (s, 3H) 5.26 (s, 2H) 7.02 (d, J = 5.15 Hz, ) 7.17 (m, 2H) 7.24 (m, 5H) 7.71 (d, J = 5.15 Hz, 1 H) 15.80 (s, 1H). (ESI-) m / z 466 (M-H) +.

Exemplo 209A 2-amino-6-metoxi-3-metilbenzenossulfonamida O composto em título foi preparado a partir de 3-metoxi-6-metil-anilina utilizando o procedimento descrito em JCS Perkin 1, 1979, 1043.Example 209A 2-Amino-6-methoxy-3-methylbenzenesulfonamide The title compound was prepared from 3-methoxy-6-methylaniline using the procedure described in JCS Perkin 1, 1979, 1043.

Exemplo 209B N- [2- (aminosulfonil)-3-metoxi-6-metilfenil]-1-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo pelo produto do Exemplo 209A o produto do Exemplo 84A para gerar o composto em título (0,22 g, 100%). 230Example 209B N- [2- (aminosulfonyl) -3-methoxy-6-methylphenyl] -1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide O The title compound was prepared according to the procedure of Example 84C substituting the product of Example 209A for the product of Example 84A to give the title compound (0.22 g, 100%). 230

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 209C l-benzil-3-(8-metoxi-5-metil-l, l-dioxido-4H-l, 2, 4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridln-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 209B o produto do Exemplo 84C. A solução foi depois acidificada com HC1 6N aquoso (10 mL), filtrada e o sólido lavado com metanol (10 mL) para gerar o composto em título como um sólido branco, (0,12 g, 56% de rendimento). MS (ESI-) m/z 477 (M-H) + . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. *H RMN (300 MHz, DMSO-d6) δ 2,37 (s, 3H) 3,83 (s, 3H) 5,52 (s, 2H) 6,76 (d, J=8,5 Hz, 1H) 7,16 (m, 2H) 7,23 (m, 4H) 7,37 (d, J=8,9 Hz, 1H) 8,45 (m, 2H) , 15,67 (s, 1H) .EXAMPLE 209C 1-Benzyl-3- (8-methoxy-5-methyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin- 2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 209 for the product of Example 84C. The solution was then acidified with aqueous 6N HCl (10 mL), filtered and the solid washed with methanol (10 mL) to give the title compound as a white solid, (0.12 g, 56% yield). MS (ESI-) m / z 477 (M-H) +. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 2.37 (s, 3H) 3.83 (s, 3H) 5.52 (s, 2H) 6.76 (d, J = 8.5 Hz, 1H ) 7.16 (m, 2H) 7.23 (m, 4H) 7.37 (d, J = 8.9 Hz, 1H) 8.45 (m, 2H), 15.67 (s, 1H).

Exemplo 210 l-benzil-3-(8-hidroxi-5-metil-l,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-onaExample 210 1-benzyl-3- (8-hydroxy-5-methyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin- 2 (1H) -one

Uma mistura do produto do Exemplo 209C (20 mg, 0,042 mmol) e tribrometo de boro (1,0M em diclorometano) (840 pL, 0,84 mmol) em dicloroetano (5 mL) foi agitada a 70°C durante 16 horas. A mistura reaccional foi arrefecida até 25°C, neutralizada com água (10 mL) e extraída com acetato de etilo (20 mL) . A resultante fase orgânica foi seca sobre MgS04, filtrada e concentrada sob pressão reduzida para proporcionar o composto em título como um sólido branco (0,019 g, 98% de rendimento). MS (ESI-) m/z 463 (M-H)“. O di-sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D usando dois equivalentes de hidróxido de sódio. 1H RMN (300 MHz, DMSO-d6) δ 2,16 (s, 3H) 5,52 (s, 2H) 5,92 (d, J=8,8 Hz, 1H) 6,79 (d, J=8,8 Hz, 1H) 7,11 (dd, J=7,8,4,8 Hz, 1H) 7,17 (m, 1H) 7,23 (m, 4H) 8,42 (m,2H), 14,77 (s, 1H).A mixture of the product of Example 209C (20 mg, 0.042 mmol) and boron tribromide (1.0 M in dichloromethane) (840 μL, 0.84 mmol) in dichloroethane (5 mL) was stirred at 70 ° C for 16 hours. The reaction mixture was cooled to 25 ° C, neutralized with water (10 mL) and extracted with ethyl acetate (20 mL). The resulting organic phase was dried over MgSO4, filtered and concentrated under reduced pressure to provide the title compound as a white solid (0.019 g, 98% yield). MS (ESI-) m / z 463 (M-H). The sodium di-salt of the title compound was prepared according to the procedure of Example 1D using two equivalents of sodium hydroxide. 1H NMR (300 MHz, DMSO-d6) δ 2.16 (s, 3H) 5.52 (s, 2H) 5.92 (d, J = 8.8 Hz, 1H) 6.79 (d, J = 8.8 Hz, 1 H) 7.11 (dd, J = 7.8,4.8 Hz, 1 H) 7.17 (m, 1 H) 7.23 (m, 4H) 8.42 (m, 2H) , 14.77 (s, 1H).

Exemplo 211 {[3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridin-3-il)-5-metil-l,l-dioxido-4H-l,2,4-benzotiadiazin-8-il]oxi}-acetonitriloExample 211 {[3- (1-Benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl) -5-methyl-1,1-dioxido-4H- 1,2,4-benzothiadiazin-8-yl] oxy} acetonitrile

Uma mistura do produto do Exemplo 210 (23 mg, 0,050 mmol), bromoacetonitrilo (14 pL, 0,2 mmol) e carbonato de 231 ΕΡ 1 560 827/ΡΤ potássio (15 mg, 0,11 mmol) em N,N-dimetilformamida (1 mL) foi agitada a 25°C durante 3 dias. A mistura reaccional foi concentrada sob pressão reduzida e o óleo resultante foi cromatografado em sílica gel eluindo com acetato de etilo para proporcionar o composto em título como um sólido branco (0,003 g, 12% de rendimento). MS (ESI-) m/z 500 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-d6) δ 2,38 (s, 3H) 5,25 (m, 2H) 5,54 (s, 2H) 6,93 (m, 1H) 7,18 (m, 2H) 7,23 (m, 4H) 7,37 (m, 1H) 8,46 (m, 2H).A mixture of the product of Example 210 (23 mg, 0.050 mmol), bromoacetonitrile (14 μl, 0.2 mmol) and potassium carbonate (23 mg, Ρ 1 560 827 / (potassium (15 mg, 0.11 mmol) in N, N- dimethylformamide (1 mL) was stirred at 25 ° C for 3 days. The reaction mixture was concentrated under reduced pressure and the resulting oil was chromatographed on silica gel eluting with ethyl acetate to provide the title compound as a white solid (0.003 g, 12% yield). MS (ESI-) m / z 500 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 2.38 (s, 3H) 5.25 (m, 2H) 5.54 (s, 2H) 6.93 (m, 1H) 7.18 (m, 2H) 7.23 (m, 4H) 7.37 (m, 1H) 8.46 (m, 2H).

Exemplo 212 A 2-amino-3-metoxibenzenossulfonamida O composto em título foi preparado a partir de 2-metoxi-anilina utilizando o procedimento como descrito em Journal of the Chemical Society, Perkin 1, 1979, 1043.Example 212 2-Amino-3-methoxybenzenesulfonamide The title compound was prepared from 2-methoxyaniline using the procedure as described in Journal of the Chemical Society, Perkin 1, 1979, 1043.

Exemplo 212B (5-metoxi-l, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il) acetato de etilo 0 composto em título foi preparado de acordo com o procedimento do Exemplo 1C substituindo pelo produto do Exemplo 212A a 2-aminobenzenossulfonamida. MS (DCI) m/z 299 (M+H)+.Example 212B The title compound was prepared according to the procedure of Example 1C substituting the product of Example 212A (5-methoxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) to 2-aminobenzenesulfonamide. MS (DCI) m / z 299 (M + H) +.

Exemplo 212C l-Benzil-4-hidroxi-3-(5-metoxi-l,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-1,8-naftiridin-2(1H)-ona 0 composto em título foi preparado de acordo com o procedimento descrito no Exemplo 1D substituindo pelo produto do Exemplo 15A o produto do Exemplo 1B e substituindo pelo produto do Exemplo 212B o produto do Exemplo 1C (187 mg, 41%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. (ESI-) m/z 461 (M-H). 1H RMN (300 MHz, DMSO-d6) δ ppm 3,98 (s, 3H) 5,52 (s, 2H) 7,18 (m, 9H) 8,42 (dd, J=7,54, 2,02 Hz, 1H) 8,47 (dd, J=4,78, 1,84 Hz, 1H) 15, 71 (s, 1H) . 232 ΕΡ 1 560 827/ΡΤExample 212C 1-Benzyl-4-hydroxy-3- (5-methoxy-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure described in Example 1D substituting the product of Example 15A for the product of Example 1B and substituting the product of Example 212B for the product of Example 1C (187 mg, 41%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. (ESI-) m / z 461 (M-H). 1 H NMR (300 MHz, DMSOd 6) δ ppm 3.98 (s, 3H) 5.52 (s, 2H) 7.18 (m, 9H) 8.42 (dd, J = 2 Hz, 1 H) 8.47 (dd, J = 4.78, 1.84 Hz, 1 H) 15.71 (s, 1H). 232 ΕΡ 1 560 827 / ΡΤ

Exemplo 213 l-Benzil-4-hidroxi-3-(5-hidroxi-l,l-dioxido-4ff-l,2,4-benzo-tiadiazin-3-il)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 184 substituindo pelo produto do Exemplo 212C o produto do Exemplo 183C. (ESI-) m/z 447 (M-H) ~. O di-sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D usando dois equivalentes de hidróxido de sódio. 1H RMN (300 MHz, DMSO-d6) δ ppm 5,53 (s, 2H) 6,25 (m, 2H) 6,76 (t, J=7,91 Hz, 1H) 7,17 (m, 6H) 8,42 (dd, J=4, 78, 1, 84 Hz, 1H) 8,48 (dd, J=7,54, 2,02 Hz, 1H).Example 213 1-Benzyl-4-hydroxy-3- (5-hydroxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure as described in Example 184 substituting the product of Example 212C for the product of Example 183C. (ESI-) m / z 447 (M-H) -. The sodium di-salt of the title compound was prepared according to the procedure of Example 1D using two equivalents of sodium hydroxide. 1H NMR (300 MHz, DMSO-d6) δ ppm 5.53 (s, 2H) 6.25 (m, 2H) 6.76 (t, J = 7.91 Hz, 1 H) 7.17 (m, 6H ) 8.42 (dd, J = 4.78, 1.84 Hz, 1 H) 8.48 (dd, J = 7.54, 2.02 Hz, 1H).

Exemplo 214A {[3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridin-3-il) -1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-5-il] oxijacetonitrilo O composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 185 substituindo pelo produto do Exemplo 213 o produto do Exemplo 184. (ESI-) m/z 486 (M-H)'. XH RMN (300 MHz, DMSO-d6) δ ppm 5,51 (s, 2H) 5,72 (s, 2H) 7,24 (m, 1H) 7,28 (s, 1H) 7,31 (m, 5H) 7,51 (dd, J=7,91, 4,60 Hz, 1H) 7,61 (m, 1H) 8,61 (dd, J=7, 72, 1, 84 Hz, 1H) 8,83 (m, 1H) 14,52 (s, 1H).Example 214A Ethyl {[3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl) -1,1-dioxido- 4-benzothiadiazin-5-yl] oxyacetonitrile The title compound was prepared according to the procedure as described in Example 185 substituting the product of Example 213 for the product of Example 184. (ESI-) m / z 486 (MH) +. 1H NMR (300 MHz, DMSO-d6) δ ppm 5.51 (s, 2H) 5.72 (s, 2H) 7.24 (m, 1H) 7.28 (s, 1H) 7.31 (m, 5H), 7.51 (dd, J = 7.91, 4.60 Hz, 1 H) 7.61 (m, 1 H) 8.61 (dd, J = 7.72, 1.84 Hz, 83 (m, 1 H) 14.52 (s, 1 H).

Exemplo 214B 3-[5-(2-aminoetoxi)-1, l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il]-l-benzil-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 198 substituindo pelo produto do Exemplo 214A o produto do Exemplo 185. (ESI-) m/z 490 (M-H)'. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ ppm 3,06 (S, br, 2H) 4,30 (t, J=4, 78 Hz, 2H) 5,54 (s, 2H) 5,72 (s, br, 2H) 7,20 (m, 9H) 8,50 (dd, J=4,78, 1,84 Hz, 1H) 8,69 (dd, J=7,72, 2,21 Hz, 1H) 16,05 (s, 1H).Example 214B 3- [5- (2-Aminoethoxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -1-benzyl-4-hydroxy-1,8-naphthyridin-2- 1H) -one The title compound was prepared according to the procedure as described in Example 198 substituting the product of Example 214A for the product of Example 185. (ESI-) m / z 490 (MH) +. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.06 (S, br, 2H) 4.30 (t, J = 4.78 Hz, 2H) 5.54 (s, 2H) 5.72 , br, 2H) 7.20 (m, 9H) 8.50 (dd, J = 4.78, 1.84 Hz, 1 H) 8.69 (dd, J = 7.72, 2.21 Hz, 1H ) 16.05 (s, 1H).

Exemplo 215 2- {[3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridin- 3- il) -1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-5-il] oxijacetamida 233 ΕΡ 1 560 827/ΡΤ Ο composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 190 substituindo pelo produto do Exemplo 213 o produto do Exemplo 184. (ESI-) m/z 504 (M-H) -. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ ppm 4,64 (s, 2H) 5,53 (S, 2H) 7,22 (m, 9H) 7,88 (s, 1H) 8,13 (s, 1H) 8,46 (dd, J=7, 72, 1, 84 Hz, 1H) 8,51 (dd, J=4, 78, 1, 84 Hz, 1H) 16,15 (S, 1H) .Example 215 2 - {[3- (1-Benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl) -1,1-dioxido- 1,2,4-benzothiadiazin-5-yl] oxy] acetamide The title compound was prepared according to the procedure as described in Example 190 substituting the product of Example 213 for the product of Example 184. (ESI-) m / z 504 (MH) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 4.64 (s, 2H) 5.53 (S, 2H) 7.22 (m, 9H) 7.88 (s, 1H) 8.13 (s, 1H) 8.46 (dd, J = 7.72, 1.84 Hz, 1 H) 8.51 (dd, J = 4.78, 1.84 Hz, 1 H) 16.15 (s, 1H).

Exemplo 216 l-benzil-4-hidroxi-3-{5-[(4-nitrobenzil)oxi]-1, l-dioxido-4fl-1,2,4-benzotiadiazin-3-il}-l,8-naftiridin-2(lff)-ona O composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 185 substituindo pelo produto do Exemplo 213 o produto do Exemplo 184 e substituindo por para-nitrobrometo de benzilo o 2-bromoacetonitrilo. (ESI-) m/z 582 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 5,54 (s, 2H) 5,55 (s, 2H) 7,26 (m, 9H) 8,08 (s, 1H) 8,11 (s, 1H) 8,28 (s, 1H) 8,31 (s, 1H) 8,48 (q, J=2,08 Hz, 1H) 8,50 (s, 1H) 16,01 (s, 1H).Example 216 1-benzyl-4-hydroxy-3- {5 - [(4-nitrobenzyl) oxy] -1,1-dioxido-4,11,2,4-benzothiadiazin-3-yl} -1,8-naphthyridine -2 (1 H) -one The title compound was prepared according to the procedure as described in Example 185 substituting the product of Example 213 for the product of Example 184 and substituting benzyl para-nitrobromide for 2-bromoacetonitrile. (ESI-) m / z 582 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 5.54 (s, 2H) 5.55 (s, 2H) 7.26 (m, 9H) 8.08 (s, 1H), 8.28 (s, 1H) 8.31 (s, 1H) 8.48 (q, J = 2.08 Hz, 1H) 8.50 (s, 1H) 16.01 (s, 1H).

Exemplo 217A N- [2-(aminosulfonil)fenil]-l-benzil-6-cloro-4-hidroxi-2-oxo-1,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por l-benzil-6-cloro-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridina-3-carboxilato de etilo o produto do Exemplo 84B e substituindo por 2-amino-benzenossulfonamida o produto do Exemplo 84A. XH RMN (300 MHz, DMSO-d6) δ ppm 5,64 (s, 2H) 7,25 (m, 5H) 7,44 (t, J=7,72 Hz, 1H) 7,52 (s, 2H) 7,67 (m, 1H) 7,93 (m, 2H) 8,56 (d,J=2,57 Hz, 1H) 8,87 (d, J=2,57 Hz, 1H) 12,34 (s, 1H) 16,76 (s, 1H) .Example 217A N- [2- (aminosulfonyl) phenyl] -1-benzyl-6-chloro-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting ethyl 1-benzyl-6-chloro-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxylate Example 84B and substituting 2-amino-benzenesulfonamide for the product of Example 84A. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 5.64 (s, 2H) 7.25 (m, 5H) 7.44 (t, J = 7.72 Hz, ) 7.67 (m, 1 H) 7.93 (m, 2 H) 8.56 (d, J = 2.57 Hz, 1 H) 8.87 (d, J = 2.57 Hz, 1 H) 12.34 (s, 1 H) 16.76 (s, 1 H).

Exemplo 217B l-benzil-6-cloro-3-(1,l-dioxido-4fí-l,2, 4-benzotiadiazin-3-il)-4-hidroxi-l,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do 234 ΕΡ 1 560 827/ΡΤExample 217B 1-Benzyl-6-chloro-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of 234 εε 1 560 827 / ΡΤ

Exemplo 217Α ο produto do Exemplo 84C. O sal de sódio do composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 1D. MS (DCI/NH3) m/z 465 (M+H)+, 483 (M+NH3)+. xH RMN (300 MHz, DMSO-d6) δ ppm 5,49 (s, 2H) 7,17 (m, 6H) 7,48 (t, J=7,35 Hz, 1H) 7,83 (dd, J=7, 72, 1, 47 Hz, 1H) 8,32 (d, J=2,57 Hz, 1H) 8,46 (m, 2H) 11,20 (s; 1 H).Example 217 is the product of Example 84C. The sodium salt of the title compound was prepared according to the procedure as described in Example 1D. MS (DCI / NH 3) m / z 465 (M + H) +, 483 (M + NH 3) +. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 5.49 (s, 2 H) 7.17 (m, 6H) 7.48 (t, J = 7.35 Hz, 1 H) 7.83 (dd, J = 7.72, 1.47 Hz, 1 H) 8.32 (d, J = 2.57 Hz, 1 H) 8.46 (m, 2 H) 11.20 (s, 1 H).

Exemplo 218A N- [2-(aminosulfonil)fenil]-l-benzil-4-hidroxi-2-oxo-6-fenil-1,2-di-hidro-l,8-naftiridina-3-carboxamida O composto em título foi preparado de acordo com o procedimento do Exemplo 84C substituindo por l-benzil-6-fenil-4-hidroxi-2-oxo-l, 2-di-hidro-l,8-naftiridina-3-carboxilato de etilo o produto do Exemplo 84B e substituindo por 2-amino-benzenossulfonamida o produto do Exemplo 84A. XH RMN (300 MHz, DMSO-d6) δ ppm 5,72 (s, 2H) 7,28 (m, 6H) 7,44 (m, 2H) 7,54 (m, 3H) 7,67 (m, 1H) 7,85 (d, J= 6,99 Hz, 2H) 7,92 (dd, J=8,09, 1,47 Hz, 1H) 7,99 (d, J=8,09 Hz, 1H) 8,70 (d, J=2,21 Hz, 1H) 9,17 (d, J=2,21 Hz, 1H) 12,41 (s, 1H) 16,80 (s, 1H).Example 218A N- [2- (aminosulfonyl) phenyl] -1-benzyl-4-hydroxy-2-oxo-6-phenyl-1,2-dihydro-1,8-naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting ethyl 1-benzyl-6-phenyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxylate Example 84B and substituting 2-amino-benzenesulfonamide for the product of Example 84A. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 5.72 (s, 2H) 7.28 (m, 6H) 7.44 (m, 2H) 7.54 (m, 3H) 7.67 (m, 1H), 7.85 (d, J = 6.99 Hz, 2 H) 7.92 (dd, J = 8.09, 1.47 Hz, 1 H) 7.99 (d, J = 8.09 Hz, 1H ) 8.70 (d, J = 2.21 Hz, 1 H) 9.17 (d, J = 2.21 Hz, 1 H) 12.41 (s, 1 H) 16.80 (s, 1H).

Exemplo 218B l-benzil-3-(1,l-dioxido-4ff-l,2, 4-benzotiadiazin-3-il)-4-hidroxi-6-fenil-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 84D substituindo pelo produto do Exemplo 218A o produto do Exemplo 84C. MS (ESI-) m/z 507 (M-H)“. O sal de sódio do composto em título foi preparado to o procedimento como descrito no Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ ppm 5,53 (S, 2H) 7,04 (m, 2H) 7,26 (m, 7H) 7,48 (t, J=7,54 Hz, 2H) 7,58 (d, J=8,09 Hz, 1H) 7,70 (d, J=7,35 Hz, 2H) 8,51 (d, J=2,21 Hz, 1H) 8,65 (d, J=2,57 Hz, 1H).Example 218B 1-benzyl-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-6-phenyl-1,8-naphthyridin-2 (1H) -one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 218 for the product of Example 218A. MS (ESI-) m / z 507 (M-H). The sodium salt of the title compound was prepared as described in Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 5.53 (S, 2H) 7.04 (m, 2H) 7.26 (m, 7H) 7.48 (t, J = 7.54 Hz, 2H ) 7.58 (d, J = 8.09 Hz, 1 H) 7.70 (d, J = 7.35 Hz, 2 H) 8.51 (d, J = 2.21 Hz, d, J = 2.57 Hz, 1H).

Exemplo 219A 2-amino-4-metoxibenzenossulfonamida O composto em título foi preparado de acordo com o procedimento como descrito em Topliss et al.r J. Med. Chem. 6, 1963, 122. 235 ΕΡ 1 560 827/ΡΤExample 219A 2-Amino-4-methoxybenzenesulfonamide The title compound was prepared according to the procedure as described in Topliss et al., J. Med. Chem. 6, 1963, 122. 235 ΕΡ 1 560 827 / ΡΤ

Exemplo 219Β (6-metoxi-l,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)acetato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1C substituindo pelo produto do Exemplo 219a a 2-aminobenzenossulfonamida. MS (DCI) m/z 299 (M+H)+.The title compound was prepared according to the procedure of Example 1C substituting the product of Example 219a (M + H) +. Example 219 (6-Methoxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin- to 2-aminobenzenesulfonamide. MS (DCI) m / z 299 (M + H) +.

Exemplo 219C l-benzil-4-hidroxi-3-(6-metoxi-l,l-dioxido-4ff-l,2,4-benzo-tiadiazin-3-il)-1,8-naftiridin-2(1H)-onaExample 219C 1-Benzyl-4-hydroxy-3- (6-methoxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one

O composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 1D substituindo pelo produto do Exemplo 15A o produto do Exemplo 1B e substituindo pelo produto do Exemplo 219B o produto do Exemplo 1C. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 461 (M-H)~. 1H RMN (300 MHz, DMSO-d6) δ ppm 3,90 (m, 3H) 5,72 (s, 2H) 7,08 (dd, J=8,82, 2,21 Hz, 1H) 7,26 (m, 6H) 7,51 (dd, J=8, 09, 4, 78 Hz, 1H) 7,82 (d, J=9,19 Hz, 1H) 8,61 (dd, J=8,09, 1, 84 Hz, 1H) 8,83 (dd, J=4,60, 2,02 Hz, 1H) 13,97 (s, 1H).The title compound was prepared according to the procedure as described in Example 1D substituting the product of Example 15A for the product of Example 1B and substituting the product of Example 219B for the product of Example 1C. The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 461 (M-H) -. 1H NMR (300 MHz, DMSO-d6) δ ppm 3.90 (m, 3H) 5.72 (s, 2H) 7.08 (dd, J = 8.82, 2.21 Hz, 1H) 7.26 (dd, J = 8, 09, 4, 78 Hz, 1 H) 7.82 (d, J = 9.19 Hz, 1 H) 8.61 (dd, J = 8.09 , 1.84 Hz, 1 H) 8.83 (dd, J = 4.60, 2.02 Hz, 1 H) 13.97 (s, 1H).

Exemplo 220A N- [3-amino-4-(aminosulfonil)fenil]acetamida O composto em título foi preparado segundo o procedimento como descrito em Topliss et al, J. Med. Chem. 6, 1963, 122.Example 220A N- [3-Amino-4- (aminosulfonyl) phenyl] acetamide The title compound was prepared according to the procedure as described in Topliss et al., J. Med. Chem. 6, 1963, 122.

Exemplo 220BExample 220B

[6- (acetilamino) -1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il] -acetato de etilo O composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 1C substituindo pelo produto do Exemplo 220A a 2-aminobenzenossulfonamida. MS(DCI) m/z 326 (M+H)+.Ethyl [6- (acetylamino) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] acetate The title compound was prepared according to the procedure as described in Example 1C substituting the product of Example 220A to 2-aminobenzenesulfonamide. MS (DCI) m / z 326 (M + H) +.

Exemplo 220C N- [3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidro-l,8-naftiridin-3-il)-1, l-dioxido-4ff-l,2, 4-benzotiadiazin-6-il]acetamida 236 ΕΡ 1 560 827/ΡΤ Ο composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 1D substituindo pelo produto do Exemplo 15A o produto do Exemplo 1B e substituindo pelo produto do Exemplo 220B o produto do Exemplo 1C. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-de) δ ppm 6,82 (d, J=l, 84 Hz, 2H) 6,95 (dd, J=8, 64, 2, 02 Hz, 2H) 7,29 (d, J=4,04 Hz, 1H) 7,44 (dd, J=8,09, 4,78 Hz, 2H) 7,74 (m, 2H) 8,47 (m, 1H) 8,78 (m, 1H) 10,81 (s, 1H) 12,86 (S, 1H) 14,06 (S, 1H) . MS (ESI-) m/z 447 (M-H)”.Example 220C N- [3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl) -1,1-dioxido-4 H -1,2 , 4-benzothiadiazin-6-yl] acetamide The title compound was prepared according to the procedure as described in Example 1D substituting the product of Example 15A for the product of Example 15A and substituting the product of Example 220B the product of Example 1C. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ ppm 6.82 (d, J = 1.84 Hz, 2 H) 6.95 (dd, J = 8.64.02.02, 2H) J = 8.09, 4.78 Hz, 2 H) 7.74 (m, 2 H) 8.47 (m, 1 H) 8.78 (m, , 1H) 10.81 (s, 1H) 12.86 (s, 1H) 14.06 (s, 1H). MS (ESI-) m / z 447 (M-H).

Exemplo 221 l-benzil-4-hidroxi-3-(6-hidroxi-l,l-dioxido-4fl-l,2,4-benzo-tiadiazin-3-il)-1,8-naftiridin-2(1H)-onaExample 221 1-Benzyl-4-hydroxy-3- (6-hydroxy-1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -1,8-naphthyridin-2 (1H) -one

Uma mistura do produto do Exemplo 219C (20 mg, 0,043 mmol) e tribrometo de boro (1,0 M em diclorometano, 20 equivalentes) em 1,2 dicloroetano (5 mL) foi agitada a refluxo durante 28 horas. A mistura reaccional foi arrefecida até 25°C, diluída com tetra-hidrofurano e HC1 IN aquoso e evada a refluxo durante 2 horas. O sólido resultante foi recolhido por filtração e seco para gerar o composto em título (11,3 mg). O di-sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D utilizando dois equivalentes de hidróxido de sódio. MS (ESI-) m/z 447 (M-H)”. XH RMN (300 MHz, DMSO-dô) δ ppm 6,82 (d, J=l,84 Hz, 2H) 6,95 (dd, J=8,64, 2,02 Hz, 2H) 7,29 (d, J=4,04 Hz, 1H) 7,44 (dd, J=8,09, 4,78A mixture of the product of Example 219C (20 mg, 0.043 mmol) and boron tribromide (1.0 M in dichloromethane, 20 equivalents) in 1,2-dichloroethane (5 mL) was stirred at reflux for 28 hours. The reaction mixture was cooled to 25 ° C, diluted with tetrahydrofuran and 1N aqueous HCl and refluxed for 2 hours. The resulting solid was collected by filtration and dried to give the title compound (11.3 mg). The sodium di-salt of the title compound was prepared according to the procedure of Example 1D using two equivalents of sodium hydroxide. MS (ESI-) m / z 447 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 6.82 (d, J = 1.84 Hz, 2 H) 6.95 (dd, J = 8.64, 2.02 Hz, d, J = 4.04 Hz, 1 H) 7.44 (dd, J = 8.09, 4.78

Hz, 2H) 7,74 (m, 2H) 8,47 (m, 1H) 8,78 (m, 1H) 10,81 (s, 1H) 12,86 (s, 1H) 14,06 (s, 1H).(S, 1H), 12.06 (s, 1H), 7.08 (m, 1H) 1H).

Exemplo 222A 2-amino-6-metilbenzenossulfonamida O composto em título foi preparado segundo o procedimento como descrito em Topliss et al, J. Med. Chem. 6, 1963, 122.Example 222A 2-Amino-6-methylbenzenesulfonamide The title compound was prepared according to the procedure as described in Topliss et al., J. Med. Chem. 6, 1963, 122.

Exemplo 222B (8-metil-l,l-dioxido-4ff-l,2, 4-benzotiadiazin-3-il)acetato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1C substituindo pelo produto do Exemplo 222A a 2-aminobenzenossulfonamida. 237 ΕΡ 1 560 827/ΡΤExample 222B The title compound was prepared according to the procedure of Example 1C substituting the product of Example 222A (8-methyl-1,1-dioxido-4 H -1,2,4-benzothiadiazin- to 2-aminobenzenesulfonamide. 237 ΕΡ 1 560 827 / ΡΤ

Exemplo 222C l-benzil-4-hidroxi-3-(8-metil-l,l-dioxido-4H-l, 2,4-benzo-tiadiazin-3-il)-1, 8-na£tiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 1D substituindo pelo produto do Exemplo 15A o produto do Exemplo 1B e substituindo pelo produto do Exemplo 222B o produto do Exemplo 1C. (35,8 mg, 10%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 446 (M-H) '. XH RMN (300 MHz, DMSO-d6) δ ppm 2,56 (s, 3H) 5,52 (s, 2H) 7,06 (dd, J=7,72, 3,31 Hz, 2H) 7,13 (m, 2H) 7,23 (m, 4H) 7,41 (t, 0=1,12 Hz, 2H) 8,39 (d, J=l,84 Hz, 1H) 8,48 (dd, J=4, 60, 2, 02 Hz, 1H) 15,70 (s, 1H) .Example 222C 1-Benzyl-4-hydroxy-3- (8-methyl-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1,8-naphthyridin-2- 1H) -one The title compound was prepared according to the procedure as described in Example 1D substituting the product of Example 15A for the product of Example 1B and substituting the product of Example 222B for the product of Example 1C. (35.8 mg, 10%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 446 (M-H) +. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 2.56 (s, 3H) 5.52 (s, 2H) 7.06 (dd, J = 7.72, 3.31 Hz, (m, 2H), 7.23 (m, 4H), 7.41 (t, J = 1.12 Hz, 2H), 8.39 (d, J = 1.84 Hz, = 4.60, 2.22 Hz, 1 H) 15.70 (s, 1H).

Exemplo 223 4-hidroxi-3-(5-metoxi-l, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-1-(3-metilbutil)-1,8-naftiridin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 12A o produto do Exemplo 1B e substituindo pelo produto do Exemplo 212B o produto do Exemplo 1C. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 441 (M-H)'. XH RMN (300 MHz, DMSO-d6) δ ppm 0,95 (s, 3H) 0,98 (s, 3H) 1,47 (m, 2H) 1,64 (m, 1H) 3,98 (s, 3H) 4,29 (t, J=7,50 Hz, 2H) 7,11 (dd, J=7,72, 4,78 Hz, 1H) 7,23 (m, 3H) 8,38 (dd, J=7,35, 1,84 Hz, 1H) 8,51 (dd, J=4,41, 1,84 Hz, 1H) 15,80 (s, 1H).Example 223 4-Hydroxy-3- (5-methoxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (3-methylbutyl) -1,8-naphthyridin-2- 1H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 12A for the product of Example 1B and substituting the product of Example 212B for the product of Example 1C. The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 441 (M-H) +. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.95 (s, 3H) 0.98 (s, 3H) 1.47 (m, 2H) 1.64 (m, 1H) 3.98 (s, 2H), 7.11 (dd, J = 7.72, 4.78 Hz, 1 H) 7.23 (m, 3 H) 8.38 (dd, J = 7.35, 1.84 Hz, 1 H) 8.51 (dd, J = 4.41, 1.84 Hz, 1 H) 15.80 (s, 1H).

Exemplo 224 7-hidroxi-6-(5-metoxi-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-(3-metilbutil)tieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 125A o produto do Exemplo 1B e substituindo pelo produto do Exemplo 212B o produto do Exemplo 1C. O sal de sódio do composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 1D. (ESI-) m/z 446 (M-H)'. XH RMN (300 MHz, DMSO-d6) δ ppm 0,95 (s, 3H) 0,97 (s, 238 ΕΡ 1 560 827/ΡΤ 3Η) 1,44 (m, 2Η) 1,67 (m, 1Η) 3,99 (m, 5H) 7,08 (d, J=5,52 Hz, 1H) 7,19 (m, 3H) 7,79 (d, J=5,15 Hz, 1H) 15,75 (S, 1H).Example 224 7-hydroxy-6- (5-methoxy-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4- (3-methylbutyl) thieno [3,2- b] pyridine -5- (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 125A for the product of Example 1B and substituting the product of Example 212B for the product of Example 1C. The sodium salt of the title compound was prepared according to the procedure as described in Example 1D. (ESI-) m / z 446 (M-H) +. 1 H-NMR (300 MHz, DMSO-d 6) δ ppm 0.95 (s, 3H) 0.97 (s, 238 ÅΡ 1 560 827 / ΡΤ 3Η) 1.44 (m, 2Η) 1.67 (m, 1Η ) 3.99 (m, 5H) 7.08 (d, J = 5.52 Hz, 1 H) 7.19 (m, 3 H) 7.79 (d, J = 5.15 Hz, (S, 1H).

Exemplo 225 4-Benzil-7-hidroxi-6-(5-metoxi-l, l-dioxido-4fl-l, 2, 4-benzotiadiazin-3-il)tieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 110B o produto do Exemplo 1B e substituindo pelo produto do Exemplo 212B o produto do Exemplo 1C. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ ppm 3,97 (s, 3H) 5,26 (s, 2H) 7,01 (d, J=5,52 Hz, 1H) 7,25 (m, 8H) 7,70 (d, J=5,52 Hz, 1H) 15,69 (s, 1H). MS (ESI-) m/z 466 (M-H)”.Example 225 4-Benzyl-7-hydroxy-6- (5-methoxy-1,1-dioxido-4,11-1,2-4-benzothiadiazin-3-yl) thieno [3,2- b] pyridin-5 (4H ) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 110B for the product of Example 1B and substituting the product of Example 212B for the product of Example 1C. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.97 (s, 3H) 5.26 (s, 2H) 7.01 (d, J = 5.52 Hz, ) 7.70 (d, J = 5.52 Hz, 1 H) 15.69 (s, 1H). MS (ESI-) m / z 466 (M-H).

Exemplo 226A 2-[2-benzilidenehidrazino]benzoato de metilo Ácido 2-(Ν'-benzilideno-hidrazino)-benzóico (5,0 g, 20,81 mmol) em tetra-hidrofurano e metanol 1:1 (50 mL) reagiu com uma solução de trimetilsilildiazometano em hexanos (2,0M, 12 mL, 25,0 mmol) a 0°C durante 1 hora e depois agitado a 25°C durante 48 horas. O solvente foi removido sob vácuo para gerar o composto em título como um sólido (6,00 g, 100%). XH RMN (300 MHz, DMSO-d6) δ ppm 3,87 (s, 3H) 6,84 (td, J=7,54, 1,10 Hz, 1H) 7,41 (m, 3H) 7,54 (m, 1H) 7,74 (m, 3H) 7,86 (dd, J=8,09, 1,47 Hz, 1H) 8,21 (s, 1H) 11,02 (s, 1H).Example 226A 2- (2'-Benzylidenehydrazino) benzoic acid 2- (2-benzylidenehydrazino) benzoate (5.0 g, 20.81 mmol) in tetrahydrofuran and 1: 1 methanol (50 mL) was reacted with a solution of trimethylsilyldiazomethane in hexanes (2.0M, 12 mL, 25.0 mmol) at 0 ° C for 1 hour and then stirred at 25 ° C for 48 hours. The solvent was removed in vacuo to give the title compound as a solid (6.00 g, 100%). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.87 (s, 3H) 6.84 (td, J = 7.54, 1.10 Hz, 1H) 7.41 (m, 3H) 7.54 (m, 1H) 7.74 (m, 3H) 7.86 (dd, J = 8.09, 1.47 Hz, 1H) 8.21 (s, 1H) 11.02 (s, 1H).

Exemplo 226B 2-[2-benzilideno-l-(3-etoxi-3-oxopropanoí1)hidrazino]benzoato de metilo O produto do Exemplo 226A (5,29 g, 20,81 mmol) em tolueno (80 mL) reagiu com cloromalonato de etilo (2,68 mL, 25,0 mmol) a refluxo durante 4 horas. A mistura reaccional foi arrefecida até 25°C e concentrada sob vácuo. O resíduo foi triturado com éter dietilico e hexanos (3:1) para gerar o composto em título (5,17 g, 70%). MS (DCI) m/z 355 (M+H) + . XH RMN (300 MHz, DMSO-d6) δ ppm 3,32 (s, 2H) 3,69 (s, 3H) 3,73 (s, 3H) 7,16 (s, 1H) 7,32 (dd, J=7,72, 1,10 Hz, 1H) 7,40 (m, 3H) 7,63 (m, 2H) 239 ΕΡ 1 560 827/ΡΤ 7,70 (td, J=7,63, 1,29 Hz, 1H) 7,85 (td, J=7,72, 1,47 Hz, 1H) 8,10 (dd, J=7, 72, 1, 47 Hz, 1H) .Example 226B Methyl 2- [2-benzylidene-1- (3-ethoxy-3-oxopropanoyl) hydrazino] benzoate The product from Example 226A (5.29 g, 20.81 mmol) in toluene (80 mL) was reacted with chloromalonate (2.68 mL, 25.0 mmol) at reflux for 4 hours. The reaction mixture was cooled to 25 ° C and concentrated in vacuo. The residue was triturated with diethyl ether and hexanes (3: 1) to give the title compound (5.17 g, 70%). MS (DCI) m / z 355 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.32 (s, 2H) 3.69 (s, 3H) 3.73 (s, 3H) 7.16 (s, J = 7.72, 1.10 Hz, 1 H) 7.40 (m, 3 H) 7.63 (m, 2 H) 239 Å ¤ 1 560 827 / δ 7.70 (td, J = 7.63, 29 Hz, 1 H) 7.85 (td, J = 7.72, 1.47 Hz, 1 H) 8.10 (dd, J = 7, 72, 1.47 Hz, 1H).

Exemplo 226C 4-hidroxi-2-oxo-l-{[fenilmetileno]amino}-!,2-di-hldroquinolina-3-carboxilato de etilo O produto do Exemplo 226B (5,17 g, 14,59 mmol) em etanol (100 mL) reagiu com etóxido de sódio (21% em peso em etanol, 5,50 mL, 14,60 mmol) a 25°C e foi depois aquecido a 50°C durante 1 hora. Após arrefecimento a 25°C a mistura reaccional foi vertida em água, acidificada a pH 4 com ácido clorídrico 1M e extraída com acetato de etilo. A fase orgânica foi seca sobre sulfato de sódio anidro, filtrada e o solvente removido sob vácuo para gerar o composto em título (4,51 g, 96%). MS (DCI) m/z 323 (M+H) + . XH RMN (300 MHz, DMSO-d6) δ ppm 3,73 (s, 3H) 7,21 (m, 1H) 7,56 (m, 5H) 7,95 (m, 2H) 8,03 (d, J=7,72 Hz, 1H) 9,08 (s, 1H).Example 226C Ethyl 4-hydroxy-2-oxo-1 - {[phenylmethylene] amino} -1,2-dihydroquinoline-3-carboxylate The product of Example 226B (5.17 g, 14.59 mmol) in ethanol (100 mL) was reacted with sodium ethoxide (21% by weight in ethanol, 5.50 mL, 14.60 mmol) at 25 ° C and was then heated at 50 ° C for 1 hour. After cooling to 25øC the reaction mixture was poured into water, acidified to pH 4 with 1M hydrochloric acid and extracted with ethyl acetate. The organic phase was dried over anhydrous sodium sulfate, filtered and the solvent removed in vacuo to give the title compound (4.51 g, 96%). MS (DCI) m / z 323 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.73 (s, 3H) 7.21 (m, 1H) 7.56 (m, 5H) 7.95 (m, 2H) 8.03 (d, J = 7.72 Hz, 1 H) 9.08 (s, 1 H).

767087 Exemplo 226D PKD l-amino-3-(1,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226C (4,51 g, 14,00 mmol) reagiu com 2- aminobenzenossulfonamida (2,41 g, 14,00 mmol) em tolueno (65 mL) a refluxo durante 6 horas. Após arrefecimento a 25°C, o sólido (5,52 g) foi recolhido por filtração e reagiu adicionalmente com hidróxido de potássio aquoso a 10% (100 mL) durante 8 horas a 130°C. Após arrefecimento até 25°C, a reacção foi vertida em gelo e acidificada a pH 2 com ácido clorídrico 1M. O sólido resultante foi isolado por filtração e seco para gerar o composto em título (3,50 g, 71%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. *H RMN (300 MHz, DMSO-dê) δ 5,31 (s, 2H) 7,05 (t, J=8,09 Hz, 1H) 7,27 (m, 2H) 7,53 (m, 2H) 7,67 (m, 2H) 8,07 (dd, J=8,09, 1,47 Hz, 1H) 16,38 (s, 1H).Example 226D PKD 1-Amino-3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 226C (4- 51 g, 14.00 mmol) was reacted with 2-aminobenzenesulfonamide (2.41 g, 14.00 mmol) in toluene (65 mL) at reflux for 6 hours. After cooling to 25øC, the solid (5.52 g) was collected by filtration and further reacted with 10% aqueous potassium hydroxide (100 ml) for 8 hours at 130øC. After cooling to 25 ° C, the reaction was poured onto ice and acidified to pH 2 with 1M hydrochloric acid. The resulting solid was isolated by filtration and dried to give the title compound (3.50 g, 71%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.31 (s, 2H) 7.05 (t, J = 8.09 Hz, 1 H) 7.27 (m, 2 H) 7.53 (m, 2H ) 7.67 (m, 2 H) 8.07 (dd, J = 8.09, 1.47 Hz, 1 H) 16.38 (s, 1H).

Exemplo 227A 3- (1, l-Dioxido-4fl-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(1-propilbutilideno)amino]quinolin-2(1H)-ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com 4- heptanona (0,63 mL, 4,49 mmol) em N,N-dimetilacetamida (1 mL) num tubo selado a 135°C durante 45 minutos num reactor de 240 ΕΡ 1 560 827/ΡΤ microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietilico e filtrado para gerar o composto em título como um sólido (0,032 g, 32%). MS (ESI-) m/z 453 (M-H)&quot;.Example 227A 3- (1,1-Dioxido-4,11,2-benzothiadiazin-3-yl) -4-hydroxy-1 - [(1-propylbutylidene) amino] quinolin-2 (1H) -one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 4-heptanone (0.63 mL, 4.49 mmol) in N, N-dimethylacetamide (1 mL) in a sealed tube at 135 ° C for 45 minutes in a reactor of 240 ΕΡ 1 560 827 / ΡΤ microwave. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound as a solid (0.032 g, 32%). MS (ESI-) m / z 453 (M-H) &quot;.

Exemplo 227B l-(l-propil-butilamino)-3-(l, l-dioxido-4ff-l, 2, 4-benzo-tiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 227A (0,032 g, 0,07 mmol) em tetra-hidrofurano (2 mL) e metanol (0,010 mL, 0,14 mmol) a 0°C foi tratado gota a gota com adição de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,055 mL, 0,11 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M até um pH de aproximadamente 2-4, diluída com água (10 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi suspenso em tetra-hidrofurano (2 mL) e adsorvido em aproximadamente 0,5 g de sílica gel e evaporado. Uma lama do produto em bruto e sílica em diclorometano foram carregados num Alltech Sep-pack de 2 g e eluídos com diclorometano. As fracções contendo produto foram combinadas e concentradas sob vácuo para gerar o composto em título (0,013 g, 40%). MS (ESI-) m/z 453 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 0,85 (m, 6H) 1,33 (m, 8H) 3,13 (m, 1H) 5,66 (d, J=4,04 Hz, 1H) 7,05 (m, 1H) 7,28 (m, 2H) 7,51 (m, 2H) 7,68 (m, 2H) 8,06 (dd, J=7,72, 1,47 Hz, 1H) 16,32 (s, 1H).Example 227B 1- (1-propyl-butylamino) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 227A (0.032 g, 0.07 mmol) in tetrahydrofuran (2 mL) and methanol (0.010 mL, 0.14 mmol) at 0 ° C was treated dropwise with the addition of a 2.0M solution of boron in tetrahydrofuran (0.055 mL, 0.11 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (10 mL) and the resulting precipitate was collected by filtration and dried. The crude product was suspended in tetrahydrofuran (2 mL) and adsorbed onto approximately 0.5 g of silica gel and evaporated. A slurry of the crude product and silica in dichloromethane were charged to a 2 g Alltech Sep-pack and eluted with dichloromethane. The product-containing fractions were combined and concentrated in vacuo to give the title compound (0.013 g, 40%). MS (ESI-) m / z 453 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.85 (m, 6H) 1.33 (m, 8H) 3.13 (m, 1H) 5.66 (d, J = 4.04 Hz, 1H ) 7.05 (m, 1H) 7.28 (m, 2H) 7.51 (m, 2H) 7.68 (m, 2H) 8.06 (dd, J = 7.72, 1.47 Hz, 1H) 16.32 (s, 1H).

Exemplo 228A 3-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi- 1— {[2-metilpropilideno]amino}quinolin-2(1H)-ona O produto do Exemplo 226D (0,178 g, 0,50 mmol) reagiu com 2- metilpropanal (0,9 mL, 10,0 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 135°C durante 45 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietilico e filtrado para gerar o composto em título. 241Example 228A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[2-methylpropylidene] amino} quinolin-2 (1H) -one The product of Example 226D (0.178 g, 0.50 mmol) was reacted with 2-methylpropanal (0.9 mL, 10.0 mmol) in N, N-dimethylacetamide (3 mL) in a sealed tube at 135 ° C for 45 minutes in a reactor microwave. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound. 241

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 228B 3- (1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(isobutilamino)quinolin-2(1H)-ona O produto do Exemplo 228A (0,132 g, 0,32 irnnol) em tetra-hidrofurano (6 mL) e metanol (0,026 mL, 0,64 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,24 mL, 0,48 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (12 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com acetato de etilo:hexano 1:1 (10 ml) e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ ppm 1,03 (d, J=6,62 Hz, 6H) 1,86 (m, 1H) 2,73 (m, 2H) 5,94 (t, J=7,35 Hz, 1H) 7,07 (t, J=7,35 Hz, 1H) 7,27 (m, 2H) 7,54 (m, 2H) 7,60 (d, J=6,99 Hz, 1H) 7,66 (d,Example 228B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (isobutylamino) quinolin-2 (1H) -one The product of Example 228A (0.132 gt; 0.32 mmol) in tetrahydrofuran (6 mL) and methanol (0.026 mL, 0.64 mmol) at 0 ° C was treated dropwise with a 2.0 M solution of lithium borohydride tetrahydrofuran (0.24 mL, 0.48 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (12 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with 1: 1 ethyl acetate: hexane (10 mL) and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.03 (d, J = 6.62 Hz, 6H) 1.86 (m, 1H) 2.73 (m, 2H) 5.94 (t, J = = 7.35 Hz, 1 H) 7.07 (t, J = 7.35 Hz, 1 H) 7.27 (m, 2 H) 7.54 (m, 2 H) 7.60 (d, J = 6.99 1H), 7.66 (d,

J=6,99 Hz, 1H) 8,08 (d, J=8,09 Hz, 1H) 16,27 (s, 1H) . MS (ESI-) (M-H)- m/z 411.J = 6.99 Hz, 1 H) 8.08 (d, J = 8.09 Hz, 1 H) 16.27 (s, 1H). MS (ESI-) (M-H) - m / z 411.

Exemplo 229A 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-[(1-etil-propilideno)amino]-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,178 g, 0,5 mmol) reagiu com pentan-3-ona (0,53 mL, 5,0 mmol) em N,N-dimetilacetamida (4 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 229A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - [(1-ethyl-propylidene) amino] -4-hydroxyquinolin-2 (1H) -one O The product of Example 226D (0.178 g, 0.5 mmol) was reacted with pentan-3-one (0.53 mL, 5.0 mmol) in N, N-dimethylacetamide (4 mL) in a sealed tube at 135 ° C for 60 minutes. minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 229B 3- (1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il) -1- [ (1-etil-propil)amino]-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 229A (0,122 g, 0,287 mmol) em tetra-hidrofurano (8 mL) e metanol (0,023 mL, 0,57 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,215 mL, 0,43 mmol). A reacção foi agitada a 25°C durante 2 horas, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída 242Example 229B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - [(1-ethyl-propyl) amino] -4-hydroxyquinolin-2 (1H) -one O The product of Example 229A (0.122 g, 0.287 mmol) in tetrahydrofuran (8 mL) and methanol (0.023 mL, 0.57 mmol) at 0 ° C was treated dropwise with a 2.0M solution of boro- in tetrahydrofuran (0.215 mL, 0.43 mmol). The reaction was stirred at 25 ° C for 2 hours, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted 242

ΕΡ 1 560 827/PT com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em silica gel com diclorometano/metanol 98:2 para gerar o composto em titulo. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ ppm 0,83 (s, 3H) 0,98 (s, 3H) 1,31 (m, 2H) 1,48 (m, 2H) 2,99 (m, 1H) 5,70 (d, J=4,04 Hz, 1H) 7,05 (t, J=7,17 Hz, 1H) 7,28 (m, 2H) 7,51 (m, 2H) 7,66 (d, J=8,09 Hz, 1H) 7,72 (d, J=8,09 Hz, 1H) 8,06 (d, J=7,72 Hz, 1H) 16,32 (s, 1H) . MS (ESI-) (M-H)“ m/z 425.(15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 98: 2 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.83 (s, 3H) 0.98 (s, 3H) 1.31 (m, 2H) 1.48 (m, 2H) 2.99 (m, J = 7.17 Hz, 1 H), 7.28 (m, 2 H), 7.51 (m, 2 H), 7.50 (d, (D, J = 8.09 Hz, 1 H) 8.06 (d, J = 7.72 Hz, 1 H) 16.32 (s, 1H ). MS (ESI-) (M-H) m / z 425.

Exemplo 230A 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[pentilidenoamino]quinolin-2(1H)-ona O produto do Exemplo 226D (0,05 g, 0,14 mmol) reagiu com pentanal (0,015 mL, 1,4 mmol) em N,N-dimetilacetamida (2 mL) num tubo selado a 135°C durante 45 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 230A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- [pentylideneamino] quinolin-2 (1H) -one The product of Example 226D , 0.05 g, 0.14 mmol) was reacted with pentanal (0.015 mL, 1.4 mmol) in N, N-dimethylacetamide (2 mL) in a sealed tube at 135 ° C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 230B 3-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi- 1-(pentilamino)quinolin-2(1H)-ona O produto do Exemplo 230A (0,034 g, 0,08 mmol) em tetra-hidrofurano (2 mL) e metanol (0,0064 mL, 0,16 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,06 mL, 0,12 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (5 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano/metanol 98:2 para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-de) δ ppm 0,90 (t, J=6,99 Hz, 3H) 1,37 (m, 4H) 1,55 (m, 2H) 2,73 (m, 2H) 5,90 (t, J=6,80 Hz, 1H) 7,07 (t, J=7,72 Hz, 1H) 7,26 (m, 2H) 7,52 (m, 2H) 7,60 (d, J=8,09 Hz, 1H) 7,66 (d, J=8,09 Hz, 1H) 8,09 (d, J=8,09 Hz, 1H) 16,27 (s, 1H). MS (ESI-) (M-H)~ m/z 425. 243 ΕΡ 1 560 827/ΡΤExample 230B 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (pentylamino) quinolin-2 (1H) -one The product of Example 230A (0.034 g, 0.08 mmol) in tetrahydrofuran (2 mL) and methanol (0.0064 mL, 0.16 mmol) at 0 ° C was treated dropwise with a 2.0 M solution of in tetrahydrofuran (0.06 mL, 0.12 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of approximately 2-4, diluted with water (5 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 98: 2 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d6) δ ppm 0.90 (t, J = 6.99 Hz, 3H) 1.37 (m, 4H) 1.55 (m, 2H) 2.73 (m, 2H ) 5.90 (t, J = 6.80 Hz, 1 H) 7.07 (t, J = 7.72 Hz, 1 H) 7.26 (m, 2 H) 7.52 (m, 2 H) 7.60 (d, J = 8.09 Hz, 1 H) 7.66 (d, J = 8.09 Hz, 1 H) 8.09 (d, J = . MS (ESI-) (M-H) - m / z 425. 243 Ρ Ρ 1 560 827 / ΡΤ

Exemplo 231Α 1-(ciclo-hexilidenoamino)-3-(1,l-dioxido-4H-l, 2, 4-benzo-tiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,155 g, 0,60 mmol) reagiu com ciclo-hexanona (20 equivalentes mole) em N,N-dimetilacetamida (2 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 231 1- (cyclohexylideneamino) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 226D (0.155 g, 0.60 mmol) was reacted with cyclohexanone (20 mole equivalents) in N, N-dimethylacetamide (2 mL) in a sealed tube at 135 ° C for 60 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 231B 1-(ciclo-hexilamino)-3-(1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 231A (0,087 g, 0,2 mmol) em tetra-hidrofurano (4 mL) e metanol (0,016 mL, 0,4 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,15 mL, 0,3 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (5 mL) e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-dê) δ ppm 1,13 (m, 6H) 1,58 (m, 2H) 1,75 (m, 2H) 2,97 (m, 1H) 5,68 (d, J=3,68 Hz, 1H) 7,05 (t, J=7,54 Hz, 1H) 7,27 (d, J=8,09 Hz, 1H) 7,30 (d, J=8,09 Hz, 1H) 7,49 (t, J=7,72 Hz, 1H) 7,55 (t, J=7,72 Hz, 1H) 7,67 (d, J=8,09 Hz, 1H) 7,76 (d, J=8,46 Hz, 1H) 8,06 (d, J=7,72 Hz, 1H) 16,30 (S, 1H). MS (ESI-) (M-H)&quot; m/z 437.Example 231B 1- (cyclohexylamino) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 231A 0.087 g, 0.2 mmol) in tetrahydrofuran (4 mL) and methanol (0.016 mL, 0.4 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.15 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid at a pH of about 2-4, diluted with water (5mL) and the resulting precipitate collected by filtration and dried to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d6) δ ppm 1.13 (m, 6H) 1.58 (m, 2H) 1.75 (m, 2H) 2.97 (m, 1H) 5.68 (d, J = = 3.68 Hz, 1 H) 7.05 (t, J = 7.54 Hz, 1 H) 7.27 (d, J = 8.09 Hz, 1 H) 7.30 (d, J = 8.09 Hz 1H), 7.49 (t, J = 7.72 Hz, 1 H) 7.55 (t, J = 7.72 Hz, 1 H) 7.67 (d, 76 (d, J = 8.46 Hz, 1 H) 8.06 (d, J = 7.72 Hz, 1 H) 16.30 (S, 1H). MS (ESI-) (M-H) &quot; m / z 437.

Exemplo 232A 3-(1, l-dioxido-4fl-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi-l-{[(2-metil-l,3-tiazol-4-il)metileno]amino}quinolin-2(1H)-ona O produto do Exemplo 226D (0,119 g, 0,33 mmol) reagiu com 2-metil-l,3-tiazole-4-carbaldeído (5 equivalentes mole) em N,N-dimetilacetamida (3 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi 244 ΕΡ 1 560 827/ΡΤ triturado com éter dietílico e filtrado para gerar o composto em titulo.Example 232A 3- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -4-hydroxy-1 - {[(2-methyl-1,3-thiazol-4-yl) methylene ] amino} quinolin-2 (1H) -one The product of Example 226D (0.119 g, 0.33 mmol) was reacted with 2-methyl-1,3-thiazole-4-carbaldehyde (5 mole equivalents) in N, N- dimethylacetamide (3 mL) in a sealed tube at 135 ° C for 60 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 232B 3- (1, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-l-{[(2-metil-13-tiazol-4-il)metil]amino}quinolin-2(lff)-ona O produto do Exemplo 232A (0,097 g, 0,208 mmol) em tetra-hidrofurano (5 mL) e metanol (0,016 mL, 0,40 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,15 mL, 0,3 mmol). A reacção foi agitada a 25°C durante 3 horas, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (10 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado numa coluna C-18 de fase inversa eluindo com água:acetonitrilo 90:10 - 0:100, para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-dê) δ ppm 2,68 (s, 3H) 3,24 (m, 2H) 6,33 (m, 1H) 7,10 (m, 1H) 7,31 (m, 2H) 7,43 (s, 1H) 7,61 (m, 4H) 8,08 (d, J=7,72 Hz, 1H) 16,24 (s, 1H). MS (ESI-) (M-H)- m/z 466.Example 232B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[(2-methyl-13-thiazol-4-yl) methyl] amino The product of Example 232A (0.097 g, 0.208 mmol) in tetrahydrofuran (5 mL) and methanol (0.016 mL, 0.40 mmol) at 0 ° C was treated dropwise with drop of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.15 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 3 hours, acidified with 1 M hydrochloric acid to a pH of approximately 2-4, diluted with water (10 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on a reverse phase C-18 column eluting with 90:10: 0: 100 water: acetonitrile to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 2.68 (s, 3H) 3.24 (m, 2H) 6.33 (m, 1H) 7.10 (m, 1H) 7.31 (m, 2H) 7.43 (s, 1H) 7.61 (m, 4H) 8.08 (d, J = 7.72 Hz, 1 H) 16.24 (s, 1H). MS (ESI-) (M-H) - m / z 466.

Exemplo 233A 3- (1, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-1-[(1-metiletilideno)amino]quinolin-2(1H)-ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com acetona (0,34 mL, 4,50 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 125°C durante 25 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 233A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(1-methylethylidene) amino] quinolin-2 (1H) -one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with acetone (0.34 mL, 4.50 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 125 ° C for 25 minutes in a reactor microwave. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 233B 3-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-(isopropilamino)quinolin-2(1H)-onaExample 233B 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (isopropylamino) quinolin-2 (1H) -one

O produto do Exemplo 233A (0,044 g, 0,11 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,010 mL, 0,28 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,085 mL, 0,17 mmol). A 245 ΕΡ 1 560 827/ΡΤ reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ ppm 0,99 (m, 6H) 3,94 (m, 1H) 5,65 (d, J=4,41 Hz, 1H) 7,04 (t, J=7,35 Hz, 1H) 7,28 (m, 2H) 7,51 (m, 2H) 7,66 (d, J=7, 72 Hz, 1H) 7,75 (d, J=8,46 Hz, 1H) 8,06 (dd, J=8, 09, 1, 47 Hz, 1H) 16,28 (s, 1H) . (ESI-) m/z 397 (M-H)-.The product of Example 233A (0.044 g, 0.11 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.28 mmol) at 0 ° C was treated dropwise with a solution 2 , 0M lithium borohydride in tetrahydrofuran (0.085 mL, 0.17 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid at a pH of about 2-4, diluted with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.99 (m, 6H) 3.94 (m, 1 H) 5.65 (d, J = 4.41 Hz, 1 H) 7.04 (t, J = = 7.35 Hz, 1 H) 7.28 (m, 2 H) 7.51 (m, 2 H) 7.66 (d, J = 7.72 Hz, 1 H) 7.75 (d, J = 8.46 1H), 8.06 (dd, J = 8.9, 1.47 Hz, 1 H) 16.28 (s, 1H). (ESI-) m / z 397 (M-H) -.

Exemplo 234A 1-(ciclobutilidenoamino)-3-(1, l-dioxido-4H-l, 2,4-benzo-tiadiazin-3-il)-4-hidroxiguinolin-2(1H)-ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com ciclobutanona (0,50 mL, 7,10 mmol) em N,N-dimetilacetamida (0,50 mL) num tubo selado a 125°C durante 40 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 234A 1- (cyclobutylideneamino) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 226D 0.080 g, 0.22 mmol) was reacted with cyclobutanone (0.50 mL, 7.10 mmol) in N, N-dimethylacetamide (0.50 mL) in a sealed tube at 125 ° C for 40 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 234B 1-(ciclobutilamino)-3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 234A (0,032 g, 0,078 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,010 mL, 0,28 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,025 mL, 0,050 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ ppm 1,54 (m, 1H) 1,98 (m, 4H) 3,61 (m, 2H) 6,09 (d, J=6,25 Hz, 1H) 7,06 (td, J=7,35, 1,10 Hz, 1H) 7,27 (m, 2H) 7,53 (m, 2H) 7,65 (m, 2H) 8,06 (dd, J=7,91, 1,65 Hz, 1H) 16,28 (s, 1H) . MS (ESI-) m/z 409 (M-H)-. 246 ΕΡ 1 560 827/ΡΤExample 234B 1- (cyclobutylamino) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 234A (0.032 g , 0.078 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.28 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetra (0.025 mL, 0.050 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.54 (m, 1H) 1.98 (m, 4H) 3.61 (m, 2H) 6.09 (d, J = 6.25 Hz, 1H ) 7.06 (d, J = 7.35, 1.10 Hz, 1 H) 7.27 (m, 2 H) 7.53 (m, 2 H) 7.65 (m, 2 H) 8.06 (dd, J = 7.91, 1.65 Hz, 1 H) 16.28 (s, 1H). MS (ESI-) m / z 409 (M-H) -. 246 ΕΡ 1 560 827 / ΡΤ

Exemplo 235Α 1-(ciclopentilidenoamino)-3-(1,l-dioxido-4ff-l, 2, 4-benzo-tiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,079 g, 0,22 mmol) reagiu com ciclopentanona (0,195 mL, 2,22 mmol) em N,N-dimetilacetamida (1,50 mL) num tubo selado a 130°C durante 30 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.EXAMPLE 235 1- (cyclopentylideneamino) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 226D 0.079 g, 0.22 mmol) was reacted with cyclopentanone (0.195 mL, 2.22 mmol) in N, N-dimethylacetamide (1.50 mL) in a sealed tube at 130 ° C for 30 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplos 235B 1-(ciclopentilamino)-3-(1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il) -4-hidroxiguinolin-2 (1 ff) -ona O produto do Exemplo 235A (0,030 g, 0,071 mmol) em tetra- hidrofurano (2,0 mL) e metanol (0,010 mL, 0,28 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,060 mL, 0,12 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-dô) δ ppm 1,61 (m, 8H) 3,70 (m, 1H) 5,68 (d, J=4,41 Hz, 1H) 7,05 (t, J=7,35 Hz, 1H) 7,28 (t, J=8,27 Hz, 2H) 7,54 (m, 2H) 7,69 (dd, J=15,81, 8,09 Hz, 2H) 8,06 (dd, J=8,09, 1,47 Hz, 1H) 16,28 (s, 1H) . MS (ESI-) m/z 423 (M-H)“.Example 235B 1- (cyclopentylamino) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1 H) -one The product of Example 235A (0.030 g, 0.071 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.28 mmol) at 0 ° C was treated dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.060 mL, 0.12 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.61 (m, 8H) 3.70 (m, 1 H) 5.68 (d, J = 4.41 Hz, 1 H) 7.05 (t, J = 7.35 Hz, 1 H) 7.28 (t, J = 8.27 Hz, 2 H) 7.54 (m, 2 H) 7.69 (dd, J = 15.81, 8.06 (dd, J = 8.09, 1.47 Hz, 1 H) 16.28 (s, 1H). MS (ESI-) m / z 423 (M-H).

Exemplo 236A 3-(1, l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-4-hidroxi-l-{[3-metilciclopentilideno]amino}quinolin-2(1H)-ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com 3-metilciclopentanona (0,50 mL, 5,09 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 135°C durante 40 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O residuo resultante foi triturado com éter dietílico e filtrado para gerar o composto em titulo. 247 ΕΡ 1 560 827/ΡΤExample 236A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[3-methylcyclopentylidene] amino} quinolin-2 (1H) -one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 3-methylcyclopentanone (0.50 mL, 5.09 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 135 ° C for 40 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound. 247 ΕΡ 1 560 827 / ΡΤ

Exemplo 236Β 3-(1, l-dioxido-4fl-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-l-{[3-metilciclopentil]amino}qulnolin-2(1H)-ona O produto do Exemplo 236A (0,068 g, 0,16 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,010 mL, 0,28 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,100 mL, 0,20 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ ppm 1,03 (m, 3H) 1:35 (m, 1H) 1,78 (m, 4H) 2,56 (m, J=5,52 Hz, 2H) 3,69 (m, 1H) 5,78 (m, 1H) 7,05 (m, 1H) 7,27 (m, 2H) 7,52 (m, 2H) 7,69 (m, 2H) 8,06 (dd, J=7,72, 1,47 Hz, 1H) 16,28 (s, 1H) . MS (ESI-) m/z 437 (M-H)”.Example 236 3- (1,1-dioxido-4,11,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[3-methylcyclopentyl] amino} quinolin-2 (1H) -one The product of Example 236A (0.068 g, 0.16 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.28 mmol) at 0 ° C was treated dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.100 mL, 0.20 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.03 (m, 3H) 1:35 (m, 1H) 1.78 (m, 4H) 2.56 (m, J = 5.52 Hz, 2H ) 3.69 (m, 1 H) 5.78 (m, 1 H) 7.05 (m, 1 H) 7.27 (m, 2 H) 7.52 (m, 2 H) 7.69 (m, 2 H) 8 , 6 (dd, J = 7.72, 1.47 Hz, 1 H) 16.28 (s, 1H). MS (ESI-) m / z 437 (M-H).

Exemplo 237A 3- (1, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-1- (tetra-hidro-4fi-piran-4-ilidenoamino) guinolin-2 (1H) -ona 0 produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com tetra-hidro-4H-piran-4-ona (0,215 mL, 2,33 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 130°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 237A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (tetrahydro-4 H -pyran-4-ylideneamino) guinolin-2 (1H ) -one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with tetrahydro-4H-pyran-4-one (0.215 mL, 2.33 mmol) in N, N-dimethylacetamide (1.0 mL ) in a sealed tube at 130 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 237B 3-(1, l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-4-hidroxi-1-(tetra-hidro-2fl-piran-4-ilamino)guinolin-2(1H)-ona O produto do Exemplo 237A (0,082g, 0,19 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,015 mL, 0,42 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,140 mL, 0,28 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída 248 ΕΡ 1 560 827/ΡΤ com água e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em silica gel com diclorometano para gerar o composto em titulo. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ ppm 0,86 (m, 1H) 1,24 (m, 2H) 1,48 (m, 2H) 3,20 (m, J=18,02, 10,66 Hz, 2H) 3,81 (m, 2H) 5,82 (d, J=4,04 Hz, 1H) 7,04 (m, J=7,72 Hz, 1H) 7,27 (m, J=8,46, 8,46 Hz, 2H) 7,52 (m, 2H) 7,66 (d, J=7,72 Hz, 1H) 7,76 (d, J=8,09 Hz, 1H) 8,04 (d, J=l,47 Hz, 1H) . MS (ESI-) m/z 439 (M-H)~.Example 237B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (tetrahydro-2 H -pyran-4-ylamino) guinolin-2 (1H ) -one The product of Example 237A (0.082 g, 0.19 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.140 mL, 0.28 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid at a pH of approximately 2-4, diluted 248 æg -1 560 827 / ΡΤ with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the titled compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.86 (m, 1H) 1.24 (m, 2H) 1.48 (m, 2H) 3.20 (m, J = 18.02, (D, J = 4.04 Hz, 1 H) 7.04 (m, J = 7.72 Hz, 1 H) 7.27 (m, 2 H) (D, J = 8.09 Hz, 1 H), 7.76 (d, J = 7.72 Hz, 1 H) 8.04 (d, J = 1.47 Hz, 1H). MS (ESI-) m / z 439 (M-H) -.

Exemplo 238A 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-l-{[1-etil-butilideno]amino}-4-hidroxiguinolin-2(lff)-ona O produto do Exemplo 226D (0,085 g, 0,24 mmol) reagiu com hexan-3-ona (0,55 mL, 4,48 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 140°C durante 60 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O residuo resultante foi triturado com éter dietilico e filtrado para gerar o composto em titulo.Example 238A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - {[1-ethylbutylidene] amino} -4-hydroxyquinolin-2 (1 H) -one O The product of Example 226D (0.085 g, 0.24 mmol) was reacted with hexan-3-one (0.55 mL, 4.48 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 140 ° C for 60 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 238B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-l-{[1-etil-butil]amino}-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 238A (0,049 g, 0,11 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,015 mL, 0,42 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,152 mL, 0,30 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em título. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 0,88 (m, 6H) 1,37 (m, 6H) 3,05 (m, 1H) 5,68 (m, 1H) 7,05 (m, 1H) 7,28 (m, 2H) 7,52 (m, 2H) 7,66 (d, J=7,72 Hz, 1H) 7,71 (m, 1H) 8,06 (dd, J=7, 72, 1,47 Hz, 1H) 16,32 (s, 1H). MS (ESI-) m/z 439 (M-H) . 249 ΕΡ 1 560 827/ΡΤExample 238B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - {[1-ethyl-butyl] amino} -4-hydroxyquinolin-2 (1H) -one O The product of Example 238A (0.049 g, 0.11 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0 ° C was treated dropwise with a solution of 0M lithium borohydride in tetrahydrofuran (0.152 mL, 0.30 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried to give the title compound. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.88 (m, 6H) 1.37 (m, 6H) 3.05 (m, 1H) 5.68 (m, 1H) 7.05 (m, 1H), 7.28 (m, 2H), 7.52 (m, 2H) 7.66 (d, J = 7.72 Hz, 1 H) 7.71 (m, 1 H) 8.06 (dd, J = 7) , 1.72 (1H, d, J = 8.4 Hz). MS (ESI-) m / z 439 (M-H). 249 ΕΡ 1 560 827 / ΡΤ

Exemplo 239Α 3-(1, l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi-l-{[(3R)-3-metllciclo-hexilideno]amlno}quinolln-2(1H)-ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com (3R)-3-metilciclo-hexanona 0,275 mL, 2,25 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 130°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 239 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[(3 R) -3-methylcyclohexylidene] amino} quinolin- 1H) -one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with N, N-dimethylacetamide (1.0 mL) in (3R) -3-methylcyclohexanone (0.275 mL, 2.25 mmol) in tube sealed at 130 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 239B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-hidroxi-l-{[(3R)-3-metilciclo-hexil]amino}guinolin-2(1H)-ona O produto do Exemplo 239A (0,045 g, 0,10 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,010 mL, 0,28 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,075 mL, 0,15 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em título. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 0,83 (m, 3H) 1,22 (m, 3H) 1,73 (m, 3H) 2,99 (m, 1H) 5,67 (d, J=4,04 Hz, 1H) 7,04 (t, J=6,99 Hz, 1H) 7,28 (t, J=8,27 Hz, 2H) 7,53 (m, 2H) 7,66 (d, J=7,72 Hz, 1H) 7,74 (d, J=8,09 Hz, 1H) 8,06 (m, 1H). MS (ESI-) m/z 451 (Μ—H)-.Example 239B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -hydroxy-1 - {[(3 R) -3-methylcyclohexyl] amino} quinolin-2 (1H) -one The product of Example 239A (0.045 g, 0.10 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.28 mmol) at 0 ° C was treated dropwise with a solution of solution of 2.0M lithium borohydride in tetrahydrofuran (0.075 mL, 0.15 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried to give the title compound. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.83 (m, 3H) 1.22 (m, 3H) 1.73 (m, 3H) 2.99 (m, 1H) 5.67 (d, J = 4.04 Hz, 1 H) 7.04 (t, J = 6.99 Hz, 1 H) 7.28 (t, J = 8.27 Hz, 2 H) 7.53 (m, 2 H) 7.66 (d, J = 7.72 Hz, 1 H) 7.74 (d, J = 8.09 Hz, 1 H) 8.06 (m, 1 H). MS (ESI-) m / z 451 (Μ-H) -.

Exemplo 240A ácido 2-(2-ciclo-heptilideno-hidrazino)benzóico O composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 162A, substituindo por ciclo-heptanona o benzaldeído. 250 ΕΡ 1 560 827/ΡΤExample 240A 2- (2-Cycloheptylidenehydrazino) benzoic acid The title compound was prepared according to the procedure as described in Example 162A, substituting cycloheptanone for benzaldehyde. 250 ΕΡ 1 560 827 / ΡΤ

Exemplo 240Β 1-(ciclo-heptilidenoamino)-2Η-3,l-benzoxazina-2,4(lff)-diona O composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 162B, substituindo pelo produto do Exemplo 240A o produto do Exemplo 162A.The title compound was prepared according to the procedure as described in Example 162B, substituting the product of Example 240A and the title compound as a white solid. 1H NMR (DMSO-d6):? The product of Example 162A.

Exemplo 240C 1-(ciclo-heptilidenoamino)-3-(1,l-dioxido-4fl-l,2,4-benzo-tiadiazin-3-il) -4-hidroxiquinolin-2 (lff) -ona O composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 1D, substituindo pelo produto do Exemplo 240B o produto do Exemplo 1B.Example 240C 1- (cycloheptylideneamino) -3- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1 H) -one The title compound was prepared according to the procedure as described in Example 1D, substituting the product of Example 240B for the product of Example 1B.

Exemplo 240D 1-(ciclo-heptilamino)-3-(1, l-dioxido-4fí-l,2,4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 240C (0,099 g, 0,22 mmol) em tetra-hidrofurano (4,0 mL) (0,099 g, 0,22 mmol) em tetra-hidrofurano (4,0 mL) e metanol (0,020 mL, 0,49 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,16 mL, 0,32 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 1,43 (m, 11H) 1,87 (m, 1H) 3,25 (m, 1H) 5,53 (d, J=3,68 Hz, 1H) 7,04 (m, 1H) 7,28 (m, 2H) 7,51 (m, 2H) 7,66 (d, J=7,72 Hz, lH) 7,73 (d, J=8,46 Hz, lH) 8,05 (dd, 0=1,12, 1,47 Hz, 1H) 16,30 (s, lH) . MS (ESI-) m/z 451 (M-H)'.Example 240D 1- (Cycloheptylamino) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product from Example 240C ( 0.099 g, 0.22 mmol) in tetrahydrofuran (4.0 mL) (0.099 g, 0.22 mmol) in tetrahydrofuran (4.0 mL) and methanol (0.020 mL, 0.49 mmol) at 0 ° C. ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.16 mL, 0.32 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.43 (m, 11H) 1.87 (m, 1H) 3.25 (m, 1H) 5.53 (d, J = 3.68 Hz, 1H 1H), 7.28 (m, 2H), 7.51 (m, 2H) 7.66 (d, J = 7.72 Hz, 1H) 7.73 (d, J = 46 Hz, 1H), 8.05 (dd, J = 1.12, 1.47 Hz, 1H), 16.30 (s, 1H). MS (ESI-) m / z 451 (M-H) +.

Exemplo 241A 3 - (1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il) - l-{ [3-etilei clopentilideno] amino}-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com 3-etilciclopentanona (0,380 mL, 3,30 mmol) em N,N-dimetil-acetamida (1,0 mL) num tubo selado a 135°C durante 35 minutos 251 ΕΡ 1 560 827/ΡΤ num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O residuo resultante foi triturado com éter dietilico e filtrado para gerar o composto em titulo.Example 241A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - {[3-ethylo clopentylidene] amino} -4-hydroxyquinolin-2 (1H) -one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 3-ethylcyclopentanone (0.380 mL, 3.30 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 135 ° C for 35 minutes 251 ÅΡ 1 560 827 / ΡΤ in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 241B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)- l-{[3-etilciclopentil]amino}-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 241A (0,031 g, 0,068 mmol) em tetra- hidrofurano (2,0 mL) e metanol (0,010 mL, 0,25 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,055 mL, 0,11 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-dô) δ ppm 0,85 (m, 3H) 1,56 (m, 8H) 3,65 (m, 2H) 5,75 (m, 1H) 7,05 (t, J=6,99 Hz, 1H) 7,28 (m, 2H) 7,52 (m, 2H) 7,69 (m, 2H) 8,06 (dd, J=7, 90, 1, 65 Hz, 1H) 16,28 (s, 1H) . MS (ESI-) m/z 451 (M-H)&quot;.Example 241B 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1 - {[3-ethylcyclopentyl] amino} -4-hydroxyquinolin-2 (1H) Example 241A (0.031 g, 0.068 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.25 mmol) at 0 ° C was treated dropwise with a 2.0M solution of boro- in tetrahydrofuran (0.055 mL, 0.11 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d6) δ ppm 0.85 (m, 3H) 1.56 (m, 8H) 3.65 (m, 2H) 5.75 (m, 1H) 7.05 (t, J = 6.99 Hz, 1 H) 7.28 (m, 2 H) 7.52 (m, 2 H) 7.69 (m, 2 H) 8.06 (dd, J = 7.90, 1H) 16.28 (s, 1H). MS (ESI-) m / z 451 (M-H) &quot;.

Exemplo 242A 3-(1,l-dioxido-4A-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-{[1-isopropilbutilideno]amino}quinolin-2(1H)-ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com 2- metil-hexan-3-ona (0,620 mL, 4,48 mmol) em N,N-dimetil-acetamida (1,0 mL) num tubo selado a 135°C durante 60 minutos e depois a 145°C durante 60 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietilico e filtrado para gerar o composto em título.Example 242A 3- (1,1-dioxido-4A-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[1-isopropylbutylidene] amino} quinolin-2 (1H) -one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 2-methylhexan-3-one (0.620 mL, 4.48 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 135 ° C for 60 minutes and then at 145 ° C for 60 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 242B 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-{ [ 1-isopropilbutil]amino}quinolin-2(1H)-ona O produto do Exemplo 242A (0,049 g, 0,11 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,010 mL, 0,25 mmol) a 0°C foi 252 ΕΡ 1 560 827/ΡΤ tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,085 mL, 0,17 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ ppm 0,68 (m, 1H) 1,18 (m, 9H) 2,49 (m, 4H) 3,00 (m, J=4,4,49 Hz, 1H) 5,73 (d, J=20,22 Hz, 1H) 7,04 (m, 1H) 7,27 (m, 2H) 7,52 (m, 2H) 7,71 (m, 2H) 8,06 (dd, J=8,09, 1,47 Hz, 1H) 16,33 (s, 1H). MS (ESI-) m/z 453 (M-H)“.Example 242B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[1-isopropylbutyl] amino} quinolin-2 (1H) -one The product of Example 242A (0.049 g, 0.11 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.25 mmol) at 0 ° C was added dropwise at 25 ° C. of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.085 mL, 0.17 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.68 (m, 1 H) 1.18 (m, 9H) 2.49 (m, 4H) 3.00 (m, J = 4.4,49 Hz (M, 2H), 7.52 (m, 2H), 7.71 (m, 2H), 7.23 (d, J = 20.22 Hz, 8.06 (dd, J = 8.09, 1.47 Hz, 1 H) 16.33 (s, 1H). MS (ESI-) m / z 453 (M-H).

Exemplo 243A 3 - (1, l-dioxido-4/f-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-1-{[1-feniletilideno]amino}quinolin-2(1H)-ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com 1-feniletanona (0,49 mL, 4,20 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 135°C durante 40 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 243A 3- (1,1-dioxido-4,11-benzothiadiazin-3-yl) -4-hydroxy-1 - {[1-phenylethylidene] amino} quinolin-2 (1H) -one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 1-phenylethanone (0.49 mL, 4.20 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 135 ° C for 40 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 243B 3- (1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-l-{[1-feniletil]amino}quinolin-2(1H)-ona O produto do Exemplo 243A (0,093 g, 0,20 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,015 mL, 0,42 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,152 mL, 0,30 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 1,31 (m, 3H) 4,41 (d, J=68, 76 Hz, 1H) 5,85 (m, 1H) 7,28 253 ΕΡ 1 560 827/ΡΤ (m, J=7,54, 7, 54 Hz, 7H) 7,59 (m, 4H) 8,07 (m, 2H) 16,30 (s, 1H). MS (ESI-) m/z 459 (M-H)&quot;.Example 243B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[1-phenylethyl] amino} quinolin-2 (1H) -one The product of Example 243A (0.093 g, 0.20 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0 ° C was treated dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.152 mL, 0.30 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.31 (m, 3H) 4.41 (d, J = 68.76 Hz, 1H) 5.85 (m, 1H) 7.28 253 827 / ΡΤ (m, J = 7.54, 7, 54 Hz, 7H) 7.59 (m, 4H) 8.07 (m, 2H) 16.30 (s, 1H). MS (ESI-) m / z 459 (M-H) &quot;.

Exemplo 244A 3-(1, l-dioxido-4fl-l,2,4-benzotiadlazln-3-il)-4-hidroxi-l-{ [l-tien-3-iletilideno] amino}quinolin-2 (li?) -ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com l-tien-3-iletanona (0,14 g, 1,11 mmol) em N,N-dimetilacetamida (0,50 mL) num tubo selado a 135 °C durante 45 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 244A 3- (1,1-dioxido-4,11,2-benzothiazol-3-yl) -4-hydroxy-1 - {[1-thien-3-ylethylidene] amino} quinolin- ) The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 1-thien-3-ylethanone (0.14 g, 1.11 mmol) in N, N-dimethylacetamide (0.50 mL) in a tube sealed at 135 ° C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 244B 3-(1, l-dioxido-4fl-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-{[l-tien-3-iletil]amino}guinolin-2(1H)-ona O produto do Exemplo 244A (0,070 g, 0,15 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,015 mL, 0,42 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,090 mL, 0,18 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ ppm 1,26 (m, 3H) 4,58 (m, 1H) 5,74 (s, 1H) 7,07 (m, 1H) 7,18 (m, 1H) 7,28 (m, 3H) 7,37 (s, 1H) 7,55 (m, 2H) 7,66 (m, 1H) 7,96 (d, J=6,62 Hz, 1H) 8,07 (s, 1H) 16,30 (s, 1H). MS (ESI-) m/z 465 (M-H)”.Example 244B 3- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -4-hydroxy-1 - {[1-thien-3-ylethyl] amino} guinolin-2 (1H) -one The product from Example 244A (0.070 g, 0.15 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0 ° C was treated dropwise with a solution of solution of 2.0M lithium borohydride in tetrahydrofuran (0.090 mL, 0.18 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.26 (m, 3H) 4.58 (m, 1H), 5.74 (s, 1H), 7.28 (m, 3H) 7.37 (s, 1H) 7.55 (m, 2H) 7.66 (m, 1H) 7.96 (d, J = 6.62 Hz, , 7 (s, 1H), 16.30 (s, 1H). MS (ESI-) m / z 465 (M-H).

Exemplo 245A 1—{[3,5-dimetilciclo-hexilideno]amino}-3-(1,l-dioxido-4H-1,2,4-benzotiadiazin-3-il)-4-hidroxiguinolin-2(1H)-ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com 3,5-dimetilciclo-hexanona (0,57 g, 4,52 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 135°C durante 40 minutos num reactor de microondas. A mistura reaccional foi arrefecida 254 ΕΡ 1 560 827/ΡΤ até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 245A 1 - {[3,5-dimethylcyclohexylidene] amino} -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) - one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 3,5-dimethylcyclohexanone (0.57 g, 4.52 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 135 ° C for 40 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 245B 1—{[3,5-dimetilciclo-hexil]amino}-3-(1, l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 245A (0,064 g, 0,14 mmol) em tetra- hidrofurano (2,0 mL) e metanol (0,010 mL, 0,25 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,100 mL, 0,20 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-d6) δ ppm 0,55 (m, 2H) 0,87 (m, 6H) 1,67 (m, 6H) 3,05 (m, 1H) 5,66 (dd, J=5,70, 3,86 Hz, 1H) 7,05 (m, 1H) 7,28 (t, J=8,27 Hz, 2H) 7,51 (m, 2H) 7,66 (d, 0=1,12 Hz, 1H) 7,73 (t, J=7,54 Hz, 1H) 8,06 (dd, J=7,91, 1,29 Hz, 1H) . M (ESI-) m/z 465 (M-H)”.Example 245B 1 - {[3,5-dimethylcyclohexyl] amino} -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) - one The product from Example 245A (0.064 g, 0.14 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.25 mmol) at 0 ° C was treated dropwise with a solution 2.0M lithium borohydride in tetrahydrofuran (0.100 mL, 0.20 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ ppm 0.55 (m, 2H) 0.87 (m, 6H) 1.67 (m, 6H) 3.05 (m, 1H) 5.66 (dd, J = 5.70, 3.86 Hz, 1 H) 7.05 (m, 1 H) 7.28 (t, J = 8.27 Hz, 2 H) 7.51 (m, 2 H) 7.66 (d, = 1.12 Hz, 1 H) 7.73 (t, J = 7.54 Hz, 1 H) 8.06 (dd, J = 7.91, 1.29 Hz, 1H). M (ESI-) m / z 465 (M-H).

Exemplo 246A 3-(1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1—{ [4-isopropilciclo-hexilideno]amino}quinolin-2(lff)-ona 0 produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com 4-isopropilciclo-hexanona (0,63 mL, 4,11 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 135°C durante 45 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 246A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[4-isopropylcyclohexylidene] amino} quinolin-2 (1 H) -one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 4-isopropylcyclohexanone (0.63 mL, 4.11 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 135ø C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 246B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(4-isopropilciclo-hexil)amino]quinolin-2(1H)-ona O produto do Exemplo 246A (0,095 g, 0,20 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,015 mL, 0,42 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro- 255 ΕΡ 1 560 827/ΡΤ hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,30 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1 2 3 4 5 6 7 8 9 10H RMN (300 MHz, DMSO-d6) δ ppm 0,86 (m, 6H) 1,43 (m, 7H) 1,87 (m, 1H) 2,94 (m, 1H) 3,14 (m, 1H) 5,71 (m, 1H) 7,04 (t, J=7,54 Hz, 1H) 7,28 (t, J=8,46Example 246B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(4-isopropylcyclohexyl) amino] quinolin-2 (1H) -one The product of Example 246A (0.095 g, 0.20 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0 ° C was treated dropwise with a solution 2 , 1M borane-560 827 / ith lithium hydride in tetrahydrofuran (0.150 mL, 0.30 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.86 (m, 6H) 1.43 (m, 7H) 1.87 (m, 1H) 2.94 (m , 1H), 3.14 (m, 1H), 5.71 (m, 1H), 7.04 (t, J = 7.54 Hz, 1 H) 7.28 (t, J = 8.46

Hz, 2H) 7,50 (m, 2H) 7,70 (m, 2H) 8,06 (m, 1H) 16,30 (s, 1H). MS (ESI-) m/z 479 (M-H)“.Hz, 2H) 7.50 (m, 2H) 7.70 (m, 2H) 8.06 (m, 1H) 16.30 (s, 1H). MS (ESI-) m / z 479 (M-H).

Exemplo 247A 1-[3,4-di-hidronaftalen-2(1H)-ilidenoamino]-3-(1,l-dioxido-4H-1,2,4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com 3,4-di-hidronaftalen-2(1H)-ona (0,60 mL, 4,54 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 135°C durante 45 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 247A 1- [3,4-dihydronaphthalen-2 (1H) -ylideneamino] -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 3,4-dihydronaphthalen-2 (1H) -one (0.60 mL, 4.54 mmol) in N, N- dimethylacetamide (1.0 mL) in a sealed tube at 135 ° C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 247B 3- (1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi- 1 [1,2,3,4-tetra-hidronaftalen-2-ilamino]quinolin-2(1H)-ona 2 O produto do Exemplo 247A (0,070 g, 0,14 mmol) em tetra- 3 hidrofurano (2,0 mL) e metanol (0,010 mL, 0,25 mmol) a 0°C foi 4 tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,110 mL, 0,22 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída 5 com água e o precipitado resultante foi recolhido por 6 filtração e seco. O produto em bruto foi cromatografado em 7 sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo 8 com o procedimento do Exemplo 1D. 10H RMN (300 MHz, DMSO-d6) δ 9 ppm 2,73 (s, 2H) 3,27 (d, J=12,50 Hz, 4H) 5,93 (d, J=3,68 Hz, 10 1H) 7,07 (m, 6H) 7,28 (t, J=7,54 Hz, 3H) 7,55 (m, 2H) 7,66 (d, 256 ΕΡ 1 560 827/ΡΤ J=l,12 Hz, 1Η) 8,07 (dd, 0=1,12, 1,47 Hz, 1Η) 16,28 (s, 1Η) . MS (ESI—) m/z 485 (Μ-Η)&quot;.Example 247B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 [1,2,3,4-tetrahydronaphthalen-2-ylamino] quinolin- 2 (1H) -one 2 The product of Example 247A (0.070 g, 0.14 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.25 mmol) at 0 ° C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.110 mL, 0.22 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted 5 with water and the resulting precipitate collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 10H NMR (300 MHz, DMSO-d 6) δ 9 ppm 2.73 (s, 2H) 3.27 (d, J = 12.50 Hz, 4H) 5.93 (d, J = 3.68 Hz, 10 1H), 7.07 (m, 6H), 7.28 (t, J = 7.54Hz, 3H) 7.55 (m, 2H) 7.66 (d, 12 Hz, 1Η) 8.07 (dd, J = 1.12, 1.47 Hz, 1Η) 16.28 (s, 1Η). MS (ESI-) m / z 485 (Μ-Η) &quot;.

Exemplo 248Α 3-(1,l-dioxido-4ff-l,2,4-benzotladlazin-3-ll)-4-hidroxi-l-{[3-(trifluorometil)ciclo-hexilideno]amino}quinolin-2(1H)-ona O produto do Exemplo 226D (0,080 g, 0,22 mmol) reagiu com 3-(trifluorometil)ciclo-hexanona (0,75 mL, 4,54 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 135°C durante 40 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título.Example 248 3- (1,1-dioxido-4 H -1,2,4-benzotriazol-3-yl) -4-hydroxy-1 - {[3- (trifluoromethyl) cyclohexylidene] amino} quinolin-2 (1H ) The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 3- (trifluoromethyl) cyclohexanone (0.75 mL, 4.54 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 135 ° C for 40 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Exemplo 248B 3- (1, l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-1—{[3-(trifluorometil)ciclo-hexil]amino}quinolin-2(1H)-ona O produto do Exemplo 248A (0,103 g, 0,20 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,015 mL, 0,42 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,15 mL, 0,30 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 1,21 (m, 4H) 1,76 (m, 2H) 2,31 (m, 1H) 3,11 (m, 2H) 3,97 (m, 1H) 5,81 (d, J=19,85 Hz, 1H) 7,05 (m, 1H) 7,28 (m, 2H) 7,53 (m, 2H) 7,66 (d, J=8,09 Hz, 1H) 7,75 (d, J=7,72 Hz, 1H) 8,06 (dd, J=8,09, 1, 47 Hz, 1H). MS (ESI-) m/z 505 (M-H)”.Example 248B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[3- (trifluoromethyl) cyclohexyl] amino} quinolin-2 (1H ) -one The product of Example 248A (0.103 g, 0.20 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.15 mL, 0.30 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.21 (m, 4H) 1.76 (m, 2H) 2.31 (m, 1H) 3.11 (m, 2H) 3.97 (m, 1H), 5.81 (d, J = 19.85 Hz, 1 H) 7.05 (m, 1 H) 7.28 (m, 2 H) 7.53 (m, 2 H) 7.66 (d, J = 8) , 9 Hz, 1 H), 7.75 (d, J = 7.72 Hz, 1 H) 8.06 (dd, J = 8.09, 1.47 Hz, 1 H). MS (ESI-) m / z 505 (M-H).

Exemplo 249A 1-[butilidenoamino]-3-(1, l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,060 g, 0,168 mmol) reagiu com butiraldeído (0,135 mL, 1,50 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 110°C durante 35 minutos num 257 ΕΡ 1 560 827/ΡΤ reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em titulo.Example 249A 1- [Butylideneamino] -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 226D (0.060 g , 0.168 mmol) was reacted with butyraldehyde (0.135 mL, 1.50 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 110 ° C for 35 minutes in a 257 Ρ Ρ 1 560 827 / de microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 249B 1-(butilamino)-3-(1,l-dioxido-4ff-l,2, 4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 249A (0,040 g, 0,097 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0, 008 mL, 0,194 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,074 mL, 0,148 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2- 4, diluída com água (5,0 mL) e o precipitado resultante foi recolhido por filtração e lavado com água (2 χ 5,0 ml) e seco. O produto em bruto foi triturado com éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 0,93 (t, J=7,17 Hz, 3H) 1,48 (m, 4H) 2,77 (m, 2H) 5,90 (t, J=6,99 Hz, 1H) 7,07 (m, 1H) 7,27 (m, 2H) 7,58 (m, 3H) 7,66 (d, J=8,09 Hz, 1H) 8,08 (dd, J=8, 09, 1, 47 Hz, 1H) 16,28 (s, 1H) . MS (ESI-) m/z 411 (M-H)”.EXAMPLE 249B 1- (Butylamino) -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 249A (0.040 g , 0.097 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.008 mL, 0.194 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetra (0.074 mL, 0.148 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid at a pH of approximately 2-4, diluted with water (5.0 mL) and the resulting precipitate was collected by filtration and washed with water (2 χ 5.0 ml) and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.93 (t, J = 7.17 Hz, 3H) 1.48 (m, 4H) 2.77 (m, 2H) 5.90 (t, J = 1H), 7.07 (m, 2H), 7.58 (m, 3H), 7.66 (d, J = 8.09 Hz, 1 H) 8.08 (dd, J = 8, 09, 1.47 Hz, 1 H) 16.28 (s, 1H). MS (ESI-) m / z 411 (M-H).

Exemplo 250A 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-{[3-metilbutilideno]amino}quinolin-2(1H)-ona O produto do Exemplo 226D (0,060 g, 0,168 mmol) reagiu com 3-metilbutanal (0,161 mL, 1,50 mmol) em N,N-dimetil-acetamida (1,0 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 250A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[3-methylbutylidene] amino} quinolin-2 (1H) -one The product of Example 226D (0.060 g, 0.168 mmol) was reacted with 3-methylbutanal (0.161 mL, 1.50 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 110 ° C for 35 minutes in a reactor microwave. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 250B 3- (1, l-dioxido-4i7-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-l-[(3-metil)amino]quinolin-2(1H)-ona O produto do Exemplo 250A (0,041 g, 0,097 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0, 008 mL, 0,194 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de 258 ΕΡ 1 560 827/ΡΤ boro-hidreto de lítio em tetra-hidrofurano (0,074 mL, 0,148 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2- 4, diluída com água (5,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com éter dietílico e filtrado para gerar o composto em título. 0 sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ ppm 0,92 (s, 3H) 0,94 (s, 3H) 1,45 (q, J=7,ll Hz, 2H) 1,73 (m, 1H) 2,79 (m, 2H) 5,87 (t, J=6,80 Hz, 1H) 7,07 (t, J=7,35 Hz, 1H) 7,28 (t, J=8,46 Hz, 2H) 7,55 (m, 3H) 7,66 (d, J=7,72 Hz, 1H) 8,08 (dd, J=7,91, 1,29 Hz, 1H) 16,28 (s, 1H) . MS (ESI-) m/z 425 (M-H)”.Example 250B 3- (1,1-dioxido-4-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(3-methyl) amino] quinolin-2 (1H) -one The product of Example 250A (0.041 g, 0.097 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.008 mL, 0.194 mmol) at 0 ° C was treated dropwise with a 2.0M solution of 258 Η 1 1560 827 / ΡΤ lithium borohydride in tetrahydrofuran (0.074 mL, 0.148 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (5.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.92 (s, 3H) 0.94 (s, 3H) 1.45 (q, J = 7.1, ) 2.79 (m, 2H) 5.87 (t, J = 6.80 Hz, 1 H) 7.07 (t, J = 7.35 Hz, 1 H) 7.28 (t, J = 8.46 2H) 7.55 (m, 3H) 7.66 (d, J = 7.72 Hz, 1 H) 8.08 (dd, J = 7.91, 1.29 Hz, 1 H) 16.28 ( s, 1H). MS (ESI-) m / z 425 (M-H).

Exemplo 251A 3- (1, l-dioxido-4fl-l,2, 4-benzotiadiazin-3-il)-1-{[3-furil-metileno]amino}-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,070 g, 0,196 mmol) reagiu com 3-furaldeído (0,147 mL, 1,78 mmol) em N,N-dimetilacetamida (1,2 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 251A 3- (1,1-dioxido-4,11,2,4-benzothiadiazin-3-yl) -1 - {[3-furyl-methylene] amino} -4-hydroxyquinolin-2 (1H) -one O The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 3-furaldehyde (0.147 mL, 1.78 mmol) in N, N-dimethylacetamide (1.2 mL) in a sealed tube at 110 ° C for 35 minutes in a microwave. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 251B 3-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-[(3-furil-metil)amino]-4-hidroxiguinolin-2(1H)-ona O produto do Exemplo 251A (0,028 g, 0,064 mmol) em tetra-hidrofurano (1,3 mL) e metanol (0, 005 mL, 0,128 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,050 mL, 0,100 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (6,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 3,79 (m, 2H) 6,03 (t, J=6,80 Hz, 1H) 6,65 (s, 1H) 7,08 (t, J=7,35 Hz, 1H) 7,27 (m, 3H) 7,54 (m, 2H) 7,68 (m, 259 ΕΡ 1 560 827/ΡΤ 3Η) 8,08 (d, J=l,12 Hz, 1Η) 16,26 (s, 1H). MS (ESI-) m/z 435 (M-H)~.Example 251B 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1 - [(3-furylmethyl) amino] -4-hydroxyquinazolin-2 (1H) -one O The product of Example 251A (0.028 g, 0.064 mmol) in tetrahydrofuran (1.3 mL) and methanol (0.005 mL, 0.128 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.050 mL, 0.100 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (6.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.79 (m, 2 H) 6.03 (t, J = 6.80 Hz, 1 H) 6.65 (s, 1 H) 7.08 (t, J = 7.35 Hz, 1 H) 7.27 (m, 3 H) 7.54 (m, 2 H) 7.68 (m, 259 ÅΡ 1 560 827 / ΡΤ 3Η) 8.08 (d, J = Hz, 1H), 16.26 (s, 1H). MS (ESI-) m / z 435 (M-H) -.

Exemplo 252A 3 - (1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il) -1- { [2-furil-metileno]amino}-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,070 g, 0,196 mmol) reagiu com 2-furaldeído (0,147 mL, 1,78 mmol) em N,N-dimetilacetamida (1,2 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 252A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - {[2-furyl-methylene] amino} -4-hydroxyquinolin-2 (1H) -one O The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 2-furaldehyde (0.147 mL, 1.78 mmol) in N, N-dimethylacetamide (1.2 mL) in a sealed tube at 110 ° C for 35 minutes in a microwave. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 252B 3-(1, l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-1-[(2-furil-metil)amino]-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 252A (0,058 g, 0,134 mmol) em tetra-hidrofurano (3,0 mL) e metanol (0,010 mL, 0,268 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,105 mL, 0,210 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2- 4, diluída com água (6,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 4,03 (s, 2H) 6,20 (t, 3=6,01 Hz, 1H) 6,35 (m, 1H) 7,05 (t, J=7, 72 Hz, 1H) 7,29 (t, J=7, 72 Hz, 3H) 7,46 (t, 3=1,12 Hz, 1H) 7,56 (m, 2H) 7,67 (d, 3=1,12 Hz, 2H) 8,06 (d, J=8,09 Hz, 1H) 16,24 (s, 1H). MS (ESI-) m/z 435 (M-H)”.Example 252B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - [(2-furylmethyl) amino] -4-hydroxyquinolin-2 (1H) -one O The product of Example 252A (0.058 g, 0.134 mmol) in tetrahydrofuran (3.0 mL) and methanol (0.010 mL, 0.268 mmol) at 0 ° C was treated dropwise with a 2.0M solution of boro- in tetrahydrofuran (0.105 mL, 0.210 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (6.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 4.03 (s, 2H) 6.20 (t, J = 6.01 Hz, 1 H) 6.35 (m, 1 H) 7.05 (t, J J = 7.72 Hz, 3H), 7.46 (t, J = 1.12 Hz, 1 H), 7.56 (m, 2 H), 7.67 (t, d, J = 8.09 Hz, 1 H) 16.24 (s, 1H). MS (ESI-) m / z 435 (M-H).

Exemplo 253A 3- (1, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-l)-4-hidroxi-l-{[tien-2-ilmetileno]amino}guinolin-2(1H)-ona O produto do Exemplo 226D (0,070 g, 0,196 mmol) reagiu com tiofeno-2-carbaldeído (0,166 mL, 1,78 mmol) em N,N-dimetilacetamida (1,2 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi 260 ΕΡ 1 560 827/ΡΤ arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 253A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[thien-2-ylmethylene] amino} quinolin-2 (1H) -one The product of Example 226D (0.070 g, 0.196 mmol) was reacted with thiophene-2-carbaldehyde (0.166 mL, 1.78 mmol) in N, N-dimethylacetamide (1.2 mL) in a sealed tube at 110 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25Â ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 253B 3-(1/- l-dioxido-4fl-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi- 1-[(tien-2-ilmetil)amino]quinolin-2(1H)-ona O produto do Exemplo 253A (0,025 g, 0,055 mmol) em tetra-hidrofurano (1,2 mL) e metanol (0,005 mL, 0,110 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,044 mL, 0,088 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2- 4, diluída com água (5,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. :Η RMN (300 MHz, DMSO-d6) δ ppm 4,18 (s, 2H) 6,16 (t, J=6,62 Hz, 1H) 7,01 (dd, J=5,15, 3,31 Hz, 1H) 7,07 (d, J=7,72 Hz, 1H) 7,12 (m, 1H) 7,29 (t, J=7,54 Hz, 2H) 7,53 (m, 3H) 7,67 (d, J=7, 72 Hz, 2H) 8,08 (d, J=8,09 Hz, 1H) 16,24 (s, 1 H). MS (ESI-) m/z 451 (M-H)&quot;.Example 253B 3- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -4-hydroxy-1 - [(thien-2-ylmethyl) amino] quinolin-2 (1H) - one The product from Example 253A (0.025 g, 0.055 mmol) in tetrahydrofuran (1.2 mL) and methanol (0.005 mL, 0.110 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.044 mL, 0.088 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (5.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 4.18 (s, 2H) 6.16 (t, J = 6.62 Hz, 1 H) 7.01 (dd, (M, 1H), 7.29 (t, J = 7.54 Hz, 2 H), 7.53 (m, 3H), 7.07 (d, J = ) 7.67 (d, J = 7.72 Hz, 2 H) 8.08 (d, J = 8.09 Hz, 1 H) 16.24 (s, 1 H). MS (ESI-) m / z 451 (M-H) &quot;.

Exemplo 254A 3- (1, l-dioxido-4A-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-{[1,3-tiazol-2-ilmetileno]amino}quinolin-2(1tf)-ona O produto do Exemplo 226D (0,060 g, 0,168 mmol) reagiu com 1,3-tiazole-2-carbaldeído (0,132 mL, 1,5 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 254A 3- (1,1-dioxido-4A-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[1,3-thiazol-2-ylmethylene] amino} quinolin- The product of Example 226D (0.060 g, 0.168 mmol) was reacted with 1,3-thiazole-2-carbaldehyde (0.132 mL, 1.5 mmol) in N, N-dimethylacetamide (1.0 mL) in a tube sealed at 110 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 254B 3-(1, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi-1-[(1,3-tiazol-2-ilmetil)amino]quinolin-2(1H)-onaExample 254B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(1,3-thiazol-2-ylmethyl) amino] quinolin- 1H) -one

O produto do Exemplo 254A (0,030 g, 0,066 mmol) em tetra-hidrofurano (1,3 mL) e metanol (0, 005 mL, 0,132 mmol) a 0°C 261 ΕΡ 1 560 827/ΡΤ foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,050 mL, 0,100 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2- 4, diluída com água (5,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ ppm 4,36 (m, 2H) 6,57 (t, J=6,62 Hz, 1H) 7,09 (dd, J=13, 60, 6,62 Hz, 2H) 7,29 (t, J=7,54 Hz, 2H) 7,56 (m, 2H) 7,68 (in, 2H) 7,97 (d, J=8,46 Hz, 1H) 8,08 (d, J=7,35 Hz, 1H) 16,20 (s, 1H). MS (ESI-) m/z 452 (M-H)'.The product of Example 254A (0.030 g, 0.066 mmol) in tetrahydrofuran (1.3 mL) and methanol (0.005 mL, 0.132 mmol) at 0 ° C was added dropwise at 0 ° C. of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.050 mL, 0.100 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (5.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. Δ NMR (300 MHz, DMSO-d 6) δ ppm 4.36 (m, 2 H) 6.57 (t, J = 6.62 Hz, 1 H) 7.09 (dd, J = 13.66, 6.62 J = 7.54 Hz, 2 H) 7.56 (m, 2 H) 7.68 (in, 2 H) 7.97 (d, J = 8.46 Hz, 1 H) 8.08 (d, J = 7.35 Hz, 1 H) 16.20 (s, 1H). MS (ESI-) m / z 452 (M-H) +.

Exemplo 255A 3- (1, l-dioxido-4/f-l, 2, 4-benzotiadiazin-3-il) -l-{ [ (2-etil-3-metilbutilideno]amino}-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,070 g, 0,196 mmol) reagiu com 2-etil-3-metilbutanal (0,110 mL, 0,733 mmol) em N,N-dimetilacetamida (1,2 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 255A 3- (1,1-dioxido-4,11-benzothiadiazin-3-yl) -1 - {[(2-ethyl-3-methylbutylidene) amino} -4-hydroxyquinolin-2 (1H) -one The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 2-ethyl-3-methylbutanal (0.110 mL, 0.733 mmol) in N, N-dimethylacetamide (1.2 mL) in a sealed tube at 110 ° C for 35 minutes in a microwave reactor The reaction mixture was cooled to 25 ° C and concentrated The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 255B 3-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-l-{[2-etil-3-metilbutil]amino}-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 255A (0,031 g, 0,069 mmol) em tetra-hidrofurano (1,5 mL) e metanol (0, 006 mL, 0,138 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,054 mL, 0,108 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (5,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel, eluído com 30% de acetato de etilo/hexano para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ^ RMN (300 MHz, DMSO-d6) δ ppm 262Example 255B 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -1 - {[2-ethyl-3-methylbutyl] amino} -4-hydroxyquinolin-2 (1H) - one The product of Example 255A (0.031 g, 0.069 mmol) in tetrahydrofuran (1.5 mL) and methanol (0.006 mL, 0.138 mmol) at 0 ° C was treated dropwise with a solution of 2- 0M lithium borohydride in tetrahydrofuran (0.054 mL, 0.108 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (5.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel, eluted with 30% ethyl acetate / hexane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 262

ΕΡ 1 560 827/PT 0,94 (m, 18 Η) 1,36 (dd, J=ll, 58, 5,33 Hz, 2H) 1,47 (m, 4H) 1,91 (S, 2H) 3,32 (s, 4H) 5,87 (t, J=7,54 Hz, 2H) 6,98 (t, J=7,54 Hz, 1H) 7,08 (m, 2H) 7,26 (m, 4H) 7,38 (t, J=8,27 Hz, 1H) 7,56 (m, 4H) 7,66 (m, 2H). MS (ESI-) m/z 453 (M-H)“.(M, 4H) 1.36 (dd, J = 11.58, 5.33 Hz, 2 H) 1.47 (m, 4H) 1.91 (s, 2H) 3.32 (s, 4H) 5.87 (t, J = 7.54 Hz, 2 H) 6.98 (t, J = 7.54 Hz, 1 H) 7.08 (m, 2 H) 7.26 ( m, 4H) 7.38 (t, J = 8.27 Hz, 1 H) 7.56 (m, 4H) 7.66 (m, 2H). MS (ESI-) m / z 453 (M-H).

Exemplo 256A 3-(1, l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il)-4-hidroxi- l-{[(4-metilfenil)metileno]amino}quinolin-2(lff)-ona O produto do Exemplo 226D (0,070 g, 0,196 mmol) reagiu com 4-metilbenzaldeído (0,210 mL, 1,78 mmol) em N,N-dimetil-acetamida (1,2 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O residuo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em titulo.Example 256A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[(4-methylphenyl) methylene] amino} quinolin-2 (1 H) The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 4-methylbenzaldehyde (0.210 mL, 1.78 mmol) in N, N-dimethylacetamide (1.2 mL) in a sealed tube at 110 ° C for 35 hours. minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 256B 3- (1, l-dioxido-4i7-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi- 1- [(4-metilbenzil)amino]quinolin-2(1H)-ona O produto do Exemplo 256A (0,065 g, 0,142 mmol) em tetra-hidrofurano (3,0 mL) e metanol (0,012 mL, 0,284 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,111 mL, 0,222 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2- 4, diluída com água (8,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com diclorometano/éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 2,32 (s, 3H) 3,87 (s, 2H) 6,03 (s, 1H) 7,10 (m, 1H) 7,21 (d, J=7,72 Hz, 2H) 7,30 (t, J=7,17 Hz, 2H) 7,42 (d, J=7,72 Hz, 2H) 7,56 (t, J=8,64 Hz, 2H) 7,70 (t, J=9,38 Hz, 2H) 8,10 (d, J=7,72 Hz, 1H) 16,28 (m, 1H) . MS (ESI-) m/z 459 (M-H)”.Example 256B 3- (1,1-dioxido-4-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(4-methylbenzyl) amino] quinolin-2 (1H) -one The product of Example 256A (0.065 g, 0.142 mmol) in tetrahydrofuran (3.0 mL) and methanol (0.012 mL, 0.284 mmol) at 0 ° C was treated dropwise with a 2.0M solution of borohydride of lithium in tetrahydrofuran (0.111 mL, 0.222 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (8.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 2.32 (s, 3H) 3.87 (s, 2H) 6.03 (s, 1H) 7.10 (m, 1H) 7.21 (d, J = 7.72 Hz, 2 H) 7.30 (t, J = 7.17 Hz, 2 H) 7.42 (d, J = 7.72 Hz, 2 H) 7.56 (t, J = 8.64 Hz, 2H) 7.70 (t, J = 9.38 Hz, 2 H) 8.10 (d, J = 7.72 Hz, 1 H) 16.28 (m, 1H). MS (ESI-) m / z 459 (M-H).

Exemplo 257A 3- (1, l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-4-hidroxi-1—{[(3-metilfenil)metileno]amino guinolin-2(1H)-ona O produto do Exemplo 226D (0,070 g, 0,196 mmol) reagiu com 3-metilbenzaldeído (0,210 mL, 1,78 mmol) em N,N-dimetil- 263Example 257A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[(3-methylphenyl) methylene] amino] quinolin-2 (1H) -one The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 3-methylbenzaldehyde (0.210 mL, 1.78 mmol) in N, N-dimethyl-263

ΕΡ 1 560 827/PT acetamida (1,2 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.(1.2 mL) in a sealed tube at 110 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 257B 3-(1, l-dioxido-4i7-l,2, 4-benzotiadiazin-3-il)-4-hidroxi-[(3-metilbenzil)amino]quinolin-2(lfl)-ona O produto do Exemplo 257A (0,038 g, 0,083 mmol) em tetra-hidrofurano (1,7 mL) e metanol (0, 007 mL, 0,166 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,065 mL, 0,130 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2- 4, diluída com água (5,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com diclorometano/éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 2,35 (s, 3H) 3,87 (s, 2H) 6,05 (t, J=6,62 Hz, 1H) 7,12 (m, 2H) 7,31 (m, 5H) 7,56 (t, J=7,54 Hz, 2H) 7,70 (dd, J=ll,95, 7,91 Hz, 2H) 8,10 (d, J=7,72 Hz, 1H) 16,28 (S, 1H) . MS (ESI-) m/z 459 (M-H)~.Example 257B 3- (1,1-dioxido-4-1,2,4-benzothiadiazin-3-yl) -4-hydroxy - [(3-methylbenzyl) amino] quinolin-2 (1 H) -one The product of Example 257A (0.038 g, 0.083 mmol) in tetrahydrofuran (1.7 mL) and methanol (0.007 mL, 0.166 mmol) at 0 ° C was treated dropwise with a 2.0M solution of borohydride of lithium in tetrahydrofuran (0.065 mL, 0.130 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (5.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 2.35 (s, 3H) 3.87 (s, 2H) 6.05 (t, J = 6.62 Hz, ) 7.31 (m, 5H) 7.56 (t, J = 7.54 Hz, 2 H) 7.70 (dd, J = 11.95, 7.91 Hz, 2 H) 8.10 (d, J = 7.72 Hz, 1 H) 16.28 (s, 1H). MS (ESI-) m / z 459 (M-H) -.

Exemplo 258A 3- (1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-1-{[(2-metilfenil)metileno]amino}quinolin-2(1H)-ona O produto do Exemplo 226D (0,070 g, 0,196 mmol) reagiu com 2-metilbenzaldeído (0,206 mL, 1,78 mmol) em N,N-dimetil-acetamida (1,2 mL) num tubo selado a 110°C, durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 258A 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[(2-methylphenyl) methylene] amino} quinolin-2 (1H) - The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 2-methylbenzaldehyde (0.206 mL, 1.78 mmol) in N, N-dimethylacetamide (1.2 mL) in a sealed tube at 110 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 258B 3-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(2-metilbenzil)amino]quinolin-2(1H)-onaExample 258B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(2-methylbenzyl) amino] quinolin-2 (1H) -one

O produto do Exemplo 258A (0,026 g, 0,057 mmol) em tetra-hidrofurano (1,2 mL) e metanol (0, 005 mL, 0,114 mmol) a 0°C 264 ΕΡ 1 560 827/ΡΤ foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,045 mL, 0,090 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2- 4, diluída com água (5,0 mL) e o precipitado resultante foi recolhido por filtração, lavado com água e seco. O produto em bruto foi triturado com diclorometano/éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ^ RMN (300 MHz, DMSO-d6) δ ppm 3,29 (s, 3H) 3,97 (s, 2H) 6,02 (t, J=6,62 Hz, 1H) 7,08 (t, J=7,35 Hz, 1H) 7,23 (s, 3H) 7,29 (t, J=7,54 Hz, 2H) 7,47 (m, 1H) 7,55 (d, J=7,72 Hz, 2H) 7,67 (m, 2H) 8,10 (d, J=7,72 Hz, 1H) 16,31 (s, 1H) . MS (ESI-) m/z 459 (M-H)”.The product of Example 258A (0.026 g, 0.057 mmol) in tetrahydrofuran (1.2 mL) and methanol (0.005 mL, 0.114 mmol) at 0 ° C was added dropwise at 0 ° C. of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.045 mL, 0.090 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (5.0 mL) and the resulting precipitate was collected by filtration, washed with water and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.29 (s, 3H) 3.97 (s, 2H) 6.02 (t, J = 6.62 Hz, J = 7.54 Hz, 2 H) 7.47 (m, 1 H) 7.55 (d, J = 7.72 Hz, 1 H) Hz, 2 H) 7.67 (m, 2 H) 8.10 (d, J = 7.72 Hz, 1 H) 16.31 (s, 1H). MS (ESI-) m / z 459 (M-H).

Exemplo 259A 3- (1, l-dioxido-4fl-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1— { [ (3-metiltien-2-il)metil] amino}guinolin-2 (li?) -ona O produto do Exemplo 226D (0,060 g, 0,168 mmol) reagiu com 3-metiltiofeno-2-carbaldeído (0,180 mL, 1,50 mmol) em N,N-dimetilacetamida (1,0 mL) num tubo selado a 135°C durante 45 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 259A 3- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -4-hydroxy-1 - {[(3-methylthien-2-yl) methyl] amino} quinolin-2 (0.01 g, 0.168 mmol) was reacted with 3-methylthiophene-2-carbaldehyde (0.180 mL, 1.50 mmol) in N, N-dimethylacetamide (1.0 mL) in a tube sealed at 135 ° C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 259B 3- (1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-1~{[(3-metiltien-2-il)metil]amino}guinolin-2(1H)-ona O produto do Exemplo 259A (0,020 g, 0,043 mmol) em tetra-hidrofurano (1,0 mL) e metanol (0, 004 mL, 0, 086 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,033 mL, 0,065 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (5,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com diclorometano/éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 265 ΕΡ 1 560 827/ΡΤ 1D. ΧΗ RMN (300 ΜΗζ, DMSO-d6) δ ppm 2,42 (s, 3Η) 4,10 (brs, 2Η) 7,09 (d, J=5, 15 Hz, 1H) 7,19 (brs, 1H) 7,37 (m, 3H) 7,58 (m, 2H) 7,72 (m, 2H) 8,04 (m, 1H) 8,14 (d, J=8,09 Hz, 1H) 16,10 (brs, 1H) . MS (ESI-) m/z 465 (M-H~.Example 259B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[(3-methylthien-2-yl) methyl] amino} quinolin-2 (1H) -one The product of Example 259A (0.020 g, 0.043 mmol) in tetrahydrofuran (1.0 mL) and methanol (0.004 mL, 0.080 mmol) at 0 ° C was treated dropwise with of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.033 mL, 0.065 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (5.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 265 ΕΡ 1 560 827 / ΡΤ 1D. 1 H NMR (300 δ, DMSO-d 6) δ ppm 2.42 (s, 3) 4.10 (brs, 2 H) 7.09 (d, J = 5.15 Hz, ) 7.37 (m, 3H) 7.58 (m, 2H) 7.72 (m, 2H) 8.04 (m, 1H) 8.14 (d, J = 8.09 Hz, 10 (brs, 1H). MS (ESI-) m / z 465 (M + H) +.

Exemplo 260A 3-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1—{[(4-metoxifenil)metileno]amino}quinolln-2(1H)-ona O produto do Exemplo 226D (0,070 g, 0,196 mmol) reagiu com 4-metoxibenzaldeído (0,217 mL, 1,78 mmol) em N,N-dimetil-acetamida (1,2 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em titulo.Example 260A 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[(4-methoxyphenyl) methylene] amino} quinol-2 (1H) - The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 4-methoxybenzaldehyde (0.217 mL, 1.78 mmol) in N, N-dimethylacetamide (1.2 mL) in a sealed tube at 110 ° C for 35 hours. minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 260B 3-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1-[(4-metoxibenzil)amino]quinolin-2(lff)-ona O produto do Exemplo 260A (0,045 g, 0,095 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,008 mL, 0,19 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,074 mL, 0,148 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (5,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com metanol/éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com 0 procedimento do Exemplo 1D. 1 H RMN (300 MHz, DMSO-d6) δ ppm 3, 77 (s, 3H) 3,82 (s, 2h) 5, 98 (s, 1H) 6,95 (d, J=8,46 Hz, 2H) 7,10 (t, J=7,54 Hz, 1H) 7,30 (m, 2H) 7,45 (d, J=8,46 Hz, 2H) 7,56 (s, 2H) 7,70 (t, J= =9,38 Hz, 2H) 8,10 (d, J=7,72 Hz, 1H) 16,29 (m, 1H). MS (ESI-) m/z 475 (M-H) .Example 260B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(4-methoxybenzyl) amino] quinolin-2 (1 H) -one The product of Example 260A (0.045 g, 0.095 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.008 mL, 0.19 mmol) at 0 ° C was treated dropwise with a 2.0M solution of boron in tetrahydrofuran (0.074 mL, 0.148 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (5.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with methanol / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.77 (s, 3H) 3.82 (s, 2h) 5.98 (s, 1H) 6.95 (d, J = 8.46 Hz, (D, J = 8.46 Hz, 2 H), 7.56 (s, 2 H), 7.10 (t, J = 70 (t, J = 9.38 Hz, 2 H) 8.10 (d, J = 7.72 Hz, 1 H) 16.29 (m, 1H). MS (ESI-) m / z 475 (M-H).

Exemplo 261A 1-{ [ (5-clorotien-2-il)metileno]amino}-3-(1,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,060 g, 0,168 mmol) reagiu com 5-clorotiofeno-2-carbaldeído (0,160 mL, 1,50 mmol) em 266Example 261A 1 - {[(5-chlorothien-2-yl) methylene] amino} -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2- 1H) -one The product of Example 226D (0.060 g, 0.168 mmol) was reacted with 5-chlorothiophene-2-carbaldehyde (0.160 mL, 1.50 mmol) in 266

ΕΡ 1 560 827/PT Ν,N-dimetilacetamida (1,0 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Ρ N-dimethylacetamide (1.0 mL) in a sealed tube at 110 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 261B l-{[(5-clorotien-2-il)metil]amino}-3-(1,l-dioxido-4fl-l, 2,4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 261A (0,048 g, 0,099 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,008 mL, 0,198 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,074 mL, 0,149 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido cloridrico 1M a um pH de aproximadamente 2-4, diluída com água (6,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com diclorometano/éter dietílico e filtrado para gerar o composto em titulo. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-d6) δ ppm 4,10 (s, 2H) 6,24 (t, J=6,43 Hz, 1H) 7,19 (m, 1H) 7,30 (m, 3H) 7,43 (d, J=8,46 Hz, 1H) 7,56 (m, 3H) 7,67 (d, J=8,09 Hz, 1H) 8,12 (d, J=7,72 Hz, 1H) 15,95 (s, 1H) . MS (ESI-) m/z 485 (M-H)”.Example 261B 1 - {[(5-chlorothien-2-yl) methyl] amino} -3- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -4-hydroxyquinolin-2- 1H) -one The product of Example 261A (0.048 g, 0.099 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.008 mL, 0.198 mmol) at 0 ° C was treated dropwise with a solution 2 , 0M lithium borohydride in tetrahydrofuran (0.074 mL, 0.149 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid at a pH of approximately 2-4, diluted with water (6.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ ppm 4.10 (s, 2 H) 6.24 (t, J = 6.43 Hz, 1 H) 7.19 (m, D, J = 8.46 Hz, 1 H) 7.56 (m, 3 H) 7.67 (d, J = , 1H), 15.95 (s, 1H). MS (ESI-) m / z 485 (M-H).

Exemplo 262A l-{[(2-cloro-l,3-tiazol-5-il)metileno]amino}-3-(1,1-dioxido-4-H-l, 2, 4-benzotiadiazin-3-il) -4-hidroxiquinolin-2 (1H) -ona O produto do Exemplo 226D (0,070 g, 0,196 mmol) reagiu com 2-cloro-l,3-tiazole-5-carbaldeído (0,157 mL, 1,06 mmol) em N,N-dimetilacetamida (1,2 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 262A 1 - {[(2-Chloro-1,3-thiazol-5-yl) methylene] amino} -3- (1,1-dioxido-4-yl, 2,4-benzothiadiazin-3-yl) - The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 2-chloro-1,3-thiazole-5-carbaldehyde (0.157 mL, 1.06 mmol) in N, N-dimethylformamide dimethylacetamide (1.2 mL) in a sealed tube at 110 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 262B 1—{[(2-cloro-l,3-tiazol-5-il)metil]amino}-3-(1, l-dioxido-4H-1,2,4-benzotiadiazin-3-il)-4-hidroxiguinolin-2(lfl)-ona 267 ΕΡ 1 560 827/ΡΤ Ο produto do Exemplo 262Α (0,040 g, 0,082 mmol) em tetra-hidrofurano (1,7 mL) e metanol (0, 007 mL, 0,164 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,064 mL, 0,128 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (5,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com diclorometano/éter dietilico e filtrado para gerar o composto em titulo. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-d6) δ ppm 4,22 (m, 2H) 6,38 (t, J=6,25 Hz, 1H) 7,07 (t, J=7,54 Hz, 1H) 7,28 (t, J=8,09 Hz, 2H) 7,59 (m, 5H) 8,08 (dd, J=8, 09, 1,47 Hz, 1H) 16,19 (s, 1H) . MS (ESI-) m/z 486 (M-H)“.Example 262B 1 - {[(2-chloro-1,3-thiazol-5-yl) methyl] amino} -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) - (0.040 g, 0.082 mmol) in tetrahydrofuran (1.7 mL) and methanol (0.007 mL, 0.164 mmol) in dichloromethane at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.064 mL, 0.128 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (5.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ ppm 4.22 (m, 2 H) 6.38 (t, J = 6.25 Hz, 1 H) 7.07 (t, J = 7.54 Hz, , 28 (t, J = 8.09 Hz, 2 H) 7.59 (m, 5H) 8.08 (dd, J = 8.9, 1.47 Hz, 1 H) 16.19 (s, 1H). MS (ESI-) m / z 486 (M-H).

Exemplo 263A l-{[(3-bromofenil)metileno]amino}-3-(1,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,059 g, 0,165 mmol) reagiu com 3-bromobenzaldeído (0,175 mL, 1,5 mmol) em N,N-dimetil-acetamida (1,0 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 263A 1 - {[(3-bromophenyl) methylene] amino} -3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 226D (0.059 g, 0.165 mmol) was reacted with 3-bromobenzaldehyde (0.175 mL, 1.5 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 110 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 263B 1-[(3-bromobenzil)amino]-3-(1,l-dioxido-4fl-l, 2,4-benzo-tiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 263A (0,048 g, 0,091 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0, 008 mL, 0,182 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,130 mL, 0,260 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (8,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com diclorometano/éter dietilico e filtrado para gerar o composto em título. O sal de sódio do composto em 268 ΕΡ 1 560 827/ΡΤ título foi preparado de acordo com o procedimento do Exemplo 1D. :Η RMN (300 MHz, DMSO-d6) δ ppm 3,93 (brs, 2H) 6,17 (t, J=6,99 Hz, 1H) 7,09 (t, J=7,54 Hz, 1H) 7,28 (d, J=8,09 Hz, 2H) 7,37 (d, J=7,72 Hz, 1H) 7,54 (m, 4H) 7,68 (m, 2H) 7,74 (t, J=l,65 Hz, 1H) 8,09 (dd, J=7,91, 1,29 Hz, 1H) 16,26 (s, 1H) . MS (ESI-) m/z 524 (M-H)”.Example 263B 1 - [(3-bromobenzyl) amino] -3- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one O The product of Example 263A (0.048 g, 0.091 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.008 mL, 0.182 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.130 mL, 0.260 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid at a pH of about 2-4, diluted with water (8.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ ppm 3.93 (brs, 2 H) 6.17 (t, J = 6.99 Hz, 1 H) 7.09 (t, J = 7.54 Hz, 1H ) 7.28 (d, J = 8.09 Hz, 2 H) 7.37 (d, J = 7.72 Hz, 1 H) 7.54 (m, 4H) 7.68 (m, 2 H) 7.74 (t, J = 1.65 Hz, 1 H) 8.09 (dd, J = 7.91, 1.29 Hz, 1 H) 16.26 (s, 1H). MS (ESI-) m / z 524 (M-H).

Exemplo 264A 1—{[(4-bromofenil)metileno]amino}-3-(1,l-dioxido-4fl-l,2, 4-benzotiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 226D (0,060 g, 0,168 mmol) reagiu com 4-bromobenzaldeído (0,278 mL, 1,50 mmol) em N,N-dimetil-acetamida (1,0 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 264A 1 - {[(4-bromophenyl) methylene] amino} -3- (1,1-dioxido-4,11,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one The product of Example 226D (0.060 g, 0.168 mmol) was reacted with 4-bromobenzaldehyde (0.278 mL, 1.50 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 110 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 264B 1-[(4-bromobenzil)amino]-3-(1,l-dioxido-4ff-l, 2,4-benzo-tiadiazin-3-il)-4-hidroxiguinolin-2(1H)-ona O produto do Exemplo 264A (0,049 g, 0,094 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,008 mL, 0,188 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,134 mL, 0,268 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (6,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com diclorometano/éter dietílico e filtrado para gerar o composto em titulo. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 3,92 (brs, 2H) 7,09 (t, J=6,99 Hz, 1H) 7,28 (m, 3H) 7,54 (m, 5H) 7,68 (d, J=8,09 Hz, 2H) 8,09 (dd, J=8,09, 1,47 Hz, 1H) 16,25 (brs, 1H). MS (ESI-) m/z 524 (M-H)~.Example 264B 1 - [(4-bromobenzyl) amino] -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one O The product of Example 264A (0.049 g, 0.094 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.008 mL, 0.188 mmol) at 0 ° C was treated dropwise with a 2.0M solution of boro- in tetrahydrofuran (0.134 mL, 0.268 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (6.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 3.92 (brs, 2H) 7.09 (t, J = 6.99 Hz, 1H) 7.28 (m, 3H) 7.54 (m, 5H ) 7.68 (d, J = 8.09 Hz, 2 H) 8.09 (dd, J = 8.09, 1.47 Hz, 1 H) 16.25 (brs, 1H). MS (ESI-) m / z 524 (M-H) -.

Exemplo 265A 1—{[(2-bromofenil)metileno]amino}-3-(1,l-dioxido-4ff-l,2, 4-benzotiadiazin-3-il)-4-hidroxiguinolin-2(1H)-ona 269Example 265A 1 - {[(2-bromophenyl) methylene] amino} -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one 269

ΕΡ 1 560 827/PT Ο produto do Exemplo 226D (0,060 g, 0,168 mmol) reagiu com 2-bromobenzaldeído (0,175 mL, 1,50 mmol) em N,N-dimetil-acetamida (1,0 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.The product of Example 226D (0.060 g, 0.168 mmol) was reacted with 2-bromobenzaldehyde (0.175 mL, 1.50 mmol) in N, N-dimethylacetamide (1.0 mL) in a sealed tube at 0 ° C. 110 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 265B 1- [(2-bromobenzil)amino]-3-(1, l-dioxido-4ff-l, 2,4-benzo-tiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 265A (0,068 g, 0,129 mmol) em tetra-hidrofurano (3,0 mL) e metanol (0,011 mL, 0,258 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,184 mL, 0,368 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2- 4, diluída com água (8,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com diclorometano/éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ ppm 4,11 (brs, 2H) 6,24 (t, J=6,80 Hz, 1H) 7,06 (t, J=7,54 Hz, 1H) 7,28 (m, 3H) 7,56 (m, 3H) 7,67 (m, 4H) 8,08 (dd, J=7,91, 1,29 Hz, 1H) 16,27 (s, 1H). (ESI-) m/z 524 (M-H)&quot;.Example 265B 1 - [(2-bromobenzyl) amino] -3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxyquinolin-2 (1H) -one O The product of Example 265A (0.068 g, 0.129 mmol) in tetrahydrofuran (3.0 mL) and methanol (0.011 mL, 0.258 mmol) at 0 ° C was treated dropwise with a 2.0M solution of boro- in tetrahydrofuran (0.184 mL, 0.368 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (8.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. (T, J = 7.54 Hz, 1 H), 7.06 (t, J = 7.28 (m, 3H) 7.56 (m, 3H) 7.67 (m, 4H) 8.08 (dd, J = 7.91, 1.29 Hz, 1H) 16.27 (s, 1H ). (ESI-) m / z 524 (M-H) &quot;.

Exemplo 266A 3- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-{[piridin-3-ilmetileno]amino}quinolin-2(1H)-ona O produto do Exemplo 226D (0,070 g, 0,196 mmol) reagiu com nicotinaldeído (0,168 mL, 1,78 mmol) em N,N-dimetil-acetamida (1,2 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 266A 3- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - {[pyridin-3-ylmethylene] amino} quinolin-2 (1H) -one The product of Example 226D (0.070 g, 0.196 mmol) was reacted with nicotinaldehyde (0.168 mL, 1.78 mmol) in N, N-dimethylacetamide (1.2 mL) in a sealed tube at 110 ° C for 35 minutes in a reactor microwave. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 266B 3-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-1- [ (piridin-3-ilmetil) amino] quinolin-2 (1 ff) -ona 270 ΕΡ 1 560 827/ΡΤ Ο produto do Exemplo 266Α (0,062 g, 0,14 mmol) em tetra-hidrofurano (2,5 mL) e metanol (0,012 mL, 0,280 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,105 mL, 0,210 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2- 4, diluída com água (8,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi triturado com metanol/éter dietílico e filtrado para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo lD. 1H RMN (300 MHz, DMSO-d6) δ ppm 3,99 (s, 2H) 6,22 (t, J=6,62 Hz, 1H) 7,08 (t, J=7,35 Hz, 1H) 7,27 (m, 2H) 7,40 (dd, J=7,54, 4,96Example 266B 3- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1 - [(pyridin-3-ylmethyl) amino] quinolin-2 (1 H) (0.062 g, 0.14 mmol) in tetrahydrofuran (2.5 mL) and methanol (0.012 mL, 0.280 mmol) at 0 ° C was treated dropwise with dropwise addition the drop of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.105 mL, 0.210 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (8.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with methanol / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 3.99 (s, 2H) 6.22 (t, J = 6.62 Hz, 1H) 7.08 (t, J = 7.35 Hz, 1H) 7.27 (m, 2 H) 7.40 (dd, J = 7.54, 4.96

Hz, 1H) 7,54 (m, 2H) 7,68 (d, J=8,09 Hz, 2H) 7,93 (m, 1H) 8,08 (dd, J=7,72, 1,47 Hz, 1H) 8,51 (dd, J=4,78, 1,47 Hz). (ESI-) m/z 446 (M-H)“1H), 7.54 (m, 2H), 7.68 (d, J = 8.09 Hz, 2 H) 7.93 (m, 1 H) 8.08 (dd, J = 7.72, 1.47 1H), 8.51 (dd, J = 4.78, 1.47 Hz). (ESI-) m / z 446 (M-H)

Exemplo 267A 3- ({ [3-1, l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il) -4-hidroxi-2-oxoquinolin-l(2H)-il]iminojmetil)benzonitrilo O produto do Exemplo 226D (0,070 g, 0,196 mmol) reagiu com 3-formilbenzonitrilo (0,080 mL, 0,610 mmol) em N,N-dimetilacetamida (1,2 mL) num tubo selado a 110°C durante 35 minutos num reactor de microondas. A mistura reaccional foi arrefecida até 25°C e concentrada. O resíduo resultante foi triturado com acetato de etilo e filtrado para gerar o composto em título.Example 267A 3 - ({[3-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-2-oxoquinolin-1 (2H) -yl] iminoethyl) benzonitrile The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 3-formylbenzonitrile (0.080 mL, 0.610 mmol) in N, N-dimethylacetamide (1.2 mL) in a sealed tube at 110 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Exemplo 267B 3-({[3-(1, l-dioxido-4fl-l, 2,4-benzotiadiazin-3-il)-4-hidroxi-2-oxoquinolin-l(2H)-il]amino}metil)benzonitrilo O produto do Exemplo 267A (0,055 g, 0,117 mmol) em tetra-hidrofurano (2,0 mL) e metanol (0,010 mL, 0,234 mmol) a 0°C foi tratado com adição gota a gota de uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,088 mL, 0,176 mmol) . A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (6,0 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi 271 ΕΡ 1 560 827/ΡΤ triturado com diclorometano/éter dietílico e filtrado para gerar o composto em titulo. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 4,01 (s, 2H) 6,25 (t, J=6,80 Hz, 1H) 7,08 (t, J=7,35 Hz, 1H) 7,28 (m, 2H) 7,56 (m, 3H) 7,68 (dd, J=8, 09, 2,21 Hz, 2H) 7,79 (d, J=8,09 Hz, 1H) 7,86 (d, J=7,72 Hz, 1H) 7,99 (s, 1H) 8,09 (dd, J=7,91, 1,29 Hz, 1H) . (ESI-) m/z 470 (M-H)“.Example 267B 3 - ({[3- (1,1-dioxido-4,11-1,2-benzothiadiazin-3-yl) -4-hydroxy-2-oxoquinolin-1 (2H) -yl] amino} methyl) benzonitrile The product of Example 267A (0.055 g, 0.117 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.234 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.088 mL, 0.176 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (6.0 mL) and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 4.01 (s, 2H) 6.25 (t, J = 6.80 Hz, 1 H) 7.08 (t, J = 7.35 Hz, 7.28 (m, 2H) 7.56 (m, 3H) 7.68 (dd, J = 8.91, 2.21 Hz, 2 H) 7.79 (d, J = 8.09 Hz, 7.86 (d, J = 7.72 Hz, 1 H) 7.99 (s, 1 H) 8.09 (dd, J = 7.91, 1.29 Hz, 1H). (ESI-) m / z 470 (M-H).

Exemplo 268A 3-[(2E)-2-benzilideno-hidrazino]tiofeno-2-carboxilato de metiloExample 268A Methyl 3 - [(2E) -2-benzylidenehydrazino] thiophene-2-carboxylate

Uma solução de 3-hidrazinotiofeno-2-carboxilato de metilo (qualidade Maybridge, 2,0 g, 0,11 mol) em etanol (250 mL) a 25°C reagiu com uma solução de benzaldeido (12,32 g, 0,11 mol) em etanol (100 mL) . A mistura foi agitada a 25°C durante 1,5 horas e concentrada para gerar 30 g de um sólido branco. HPLC/MS mostra um único pico com tempo de retenção de 2,35 minutos e um pico M+l de 261. :H RMN (300 MHz, CDCI3) δ ppm 3,85 (s, 3H) 7,35 (m, 4H) 7,64 (dd, J=8,09, 1,47 Hz, 2H) 7,77 (s, 1H) 10,10 (s, 1H).A solution of methyl 3-hydrazinothiophene-2-carboxylate (Maybridge quality, 2.0 g, 0.11 mol) in ethanol (250 mL) at 25 ° C was reacted with a solution of benzaldehyde (12.32 g, 11 mol) in ethanol (100 mL). The mixture was stirred at 25 ° C for 1.5 hours and concentrated to give 30 g of a white solid. HPLC / MS shows a single peak with retention time of 2.35 minutes and an M + 1 peak of 261. 1 H NMR (300 MHz, CDCl 3) δ ppm 3.85 (s, 3H) 7.35 (m, 4H) 7.64 (dd, J = 8.09, 1.47 Hz, 2 H) 7.77 (s, 1 H) 10.10 (s, 1H).

Exemplo 268B 3-[2-benzilideno-l-(3-etoxi-3-oxopropanoíl)hidrazino]tiofeno- 2-carboxilato de metilo O produto do Exemplo 185A (26,4 g, 0,101 mol) reagiu com cloromalonato de etilo (18,3 g, 0,121 mol) em tolueno (400 mL), foi agitado a refluxo durante 4 horas, permitindo 0 borbulhamento de HC1 gás para fora do condensador. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O residuo resultante foi cromatografado em sílica gel eluindo com hexanos/acetato de etilo 3:1 para gerar o composto em título (37,1 g, 98%).Example 268B Methyl 3- [2-benzylidene-1- (3-ethoxy-3-oxopropanoyl) hydrazino] thiophene-2-carboxylate The product of Example 185A (26.4 g, 0.101 mol) was reacted with ethyl chloromalonate , 3 g, 0.121 mol) in toluene (400 mL) was stirred at reflux for 4 hours, allowing bubbling of HCl gas out of the condenser. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was chromatographed on silica gel eluting with 3: 1 hexanes / ethyl acetate to give the title compound (37.1 g, 98%).

Exemplo 268C 7-hidroxi-5-oxo-4-{[fenilmetileno]amino}-4,5-di-hidrotieno-[3,2-b]piridina-6-carboxilato de etiloExample 268C Ethyl 7-hydroxy-5-oxo-4 - {[phenylmethylene] amino} -4,5-dihydrothieno [3,2-b] pyridine-6-carboxylate

Uma solução do produto do Exemplo 268B (37,8 g, 0,101 mol) em etanol (0,5 L) sob azoto reagiu com etóxido de sódio em etanol (21% em peso, 32,8 g, 0,104 mol) a temperatura 272 ΕΡ 1 560 827/ΡΤ ambiente. A mistura foi lentamente aquecida até 50°C e agitada durante 1 hora a 40-50°C, arrefecida até 25°C, repartida entre acetato de etilo e água e acidificada a pH 4 com ácido clorídrico 1M. A fase de acetato de etilo foi lavada com salmoura, seca sobre sulfato de sódio anidro, filtrada e concentrada para gerar o composto em título (12,0 g, 35%). RMN (300 MHz, CDC13) δ ppm 1,47 (t, J=7,17 Hz, 3H) 4,52 (q, J=7,23 Hz, 2H) 7,33 (d, 7=5,15 Hz, 1H) 7,50 (m, 3H) 7,75 (d, J=5,52 Hz, 1H) 7,88 (dd, J=1, 72, 1,84 Hz, 2H) 9,44 (s, 1H) 14,16 (s, 1H) .A solution of the product of Example 268B (37.8 g, 0.101 mol) in ethanol (0.5 L) under nitrogen was reacted with sodium ethoxide in ethanol (21% by weight, 32.8 g, 0.104 mol) at 272 ΕΡ 1 560 827 / ΡΤ environment. The mixture was slowly warmed to 50øC and stirred for 1 hour at 40-50øC, cooled to 25øC, partitioned between ethyl acetate and water and acidified to pH 4 with 1M hydrochloric acid. The ethyl acetate layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated to give the title compound (12.0 g, 35%). NMR (300 MHz, CDCl 3) δ ppm 1.47 (t, J = 7.17 Hz, 3 H) 4.52 (q, J = 7.23 Hz, 2 H) 7.33 (d, J = 5.15 (D, J = 5.52 Hz, 1 H), 7.88 (dd, J = 1.72, 1.84 Hz, 2 H), 9.44 (m, s, 1H), 14.16 (s, 1H).

Exemplo 268D 4-amino-6-(1,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268C (2,29 g, 6,69 mmol) reagiu com 2-aminobenzenossulfonamida (1,15 g, 6,69 mmol) em tolueno (60 mL) e foi agitado a refluxo durante 5 horas. A reacção foi arrefecida até 25°C e o precipitado resultante foi recolhido por filtração e seco (1,95 g, 62%). O sólido resultante (1,95 g, 4,2 mmol) reagiu com KHO aquoso a 10% (60 mL) a refluxo durante 24 horas, foi arrefecido até 25°C e acidificado com ácido clorídrico concentrado a pH 2. O sólido resultante foi recolhido por filtração, lavado repetidamente com água e seco para proporcionar o composto em título (1,5 g, 98%) (Qualquer sal de sódio produzido?) 1h RMN (300 MHz, DMSO-dô) δ ppm 6,12 (s, 2H) 7,49 (d, J=5,52 Hz, 1H) 7,57 (m, 2H) 7,79 (t, J=7,17Example 268D 4-Amino-6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -hydroxythieno [3,2-b] pyridin-5 (4H) -one The product of Example 268C (2.29 g, 6.69 mmol) was reacted with 2-aminobenzenesulfonamide (1.15 g, 6.69 mmol) in toluene (60 mL) and stirred at reflux for 5 hours. The reaction was cooled to 25 ° C and the resulting precipitate was collected by filtration and dried (1.95 g, 62%). The resulting solid (1.95 g, 4.2 mmol) was reacted with 10% aqueous KOH (60 mL) at reflux for 24 hours, cooled to 25 ° C and acidified with concentrated hydrochloric acid to pH 2. The resulting solid was collected by filtration, washed repeatedly with water and dried to provide the title compound (1.5 g, 98%). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 6.12 ( s, 2H) 7.49 (d, J = 5.52 Hz, 1 H) 7.57 (m, 2 H) 7.79 (t, J = 7.17

Hz, 1H) 7,93 (d, J=7, 72 Hz, 1H) 8,34 (d,J=5,52 Hz, 1H) 14,33 (s, 1H) 14,68 (s, 1H).(D, J = 7.52 Hz, 1 H) 14.33 (s, 1 H) 14.68 (s, 1 H) .

Exemplo 269A 6- (1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il) -7-hidroxi-4-{[2-metilpropilideno]amino}tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com 2-metil-propionaldeído (0,20 g, 2,77 mmol) em N,N-dimetil- acetamida (3 mL) num tubo selado a 135°C durante 40 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com uma mistura de 25% de acetato de etilo em hexanos e filtrado para gerar 0 composto em título como um sólido (0,073 g, 65%). MS (APCI+) m/z 417 (M+H)+. 273 ΕΡ 1 560 827/ΡΤExample 269A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[2-methylpropylidene] amino} thieno [3,2- b] pyridin- 5 (4H) -one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 2-methyl-propionaldehyde (0.20 g, 2.77 mmol) in N, N-dimethylacetamide (3 mL) in a sealed tube at 135 ° C for 40 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with a mixture of 25% ethyl acetate in hexanes and filtered to give the title compound as a solid (0.073 g, 65%). MS (APCI +) m / z 417 (M + H) +. 273 ΕΡ 1 560 827 / ΡΤ

Exemplo 269Β 6- (1, l-dioxido-4fl-l, 2, 4-benzotiadiazin-3-il) -7-hidroxi-4- (isobutilamino) tieno [3,2-b] piridin-5 (4H) -ona O produto do Exemplo 269A (0,073 g, 0,18 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,20 mL, 0,40 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido cloridrico 1M a um pH de aproximadamente 2-4, diluída com água (10 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi suspenso em tetra-hidrofurano (10 mL) e adsorvido em aproximadamente 5 g de silica gel e evaporado. O produto foi eluido com metanol em clorofórmio. As fracções contendo produto foram combinadas e evaporadas sob vácuo para gerar o composto em titulo (0, 032 g, 42%). MS (ESI-) m/z 417 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ ppm 1,01 (d, J= 6,62 Hz, 6H) 1,88 (m, 1H) 2,83 (s, 2H) 6,60 (s, 1H) 7,41 (d, J=4,04 Hz, 1H) 7,55 (t, J=7,54 Hz, 1H) 7,65 (d, J=8,46 Hz, 1H) 7,77 (t, J=7,91 Hz, 1H) 7,93 (d, J=7, 72 Hz, 1H) 8,35 (d,J=4,78 Hz, 1H) 14,21 (s, 1H) 14,82 (s, 1H).Example 269Β 6- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -7-hydroxy-4- (isobutylamino) thieno [3,2-b] pyridin-5 (4H) - one The product of Example 269A (0.073 g, 0.18 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with a 2.0M solution of borohydride in tetrahydrofuran (0.20 mL, 0.40 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid at a pH of about 2-4, diluted with water (10 mL) and the resulting precipitate was collected by filtration and dried. The crude product was suspended in tetrahydrofuran (10 mL) and adsorbed onto approximately 5 g of silica gel and evaporated. The product was eluted with methanol in chloroform. The product-containing fractions were combined and evaporated in vacuo to give the title compound (0.032 g, 42%). MS (ESI-) m / z 417 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.01 (d, J = 6.62 Hz, 6H) 1.88 (m, 1H) 2.83 (s, 2H) 6.60 (s, 1H J = 7.54 Hz, 1 H) 7.65 (d, J = 8.46 Hz, 1 H) 7.77 (d, J = t, J = 7.91 Hz, 1 H) 7.93 (d, J = 7.72 Hz, 1 H) 8.35 (d, J = 4.78 Hz, 1 H) 14.21 (s, 1H) 14 , 82 (s, 1H).

Exemplo 270A 6-(1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[(35)-3-metilciclopentilideno]amino}tieno[3, 2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,065 g, 0,18 mmol) reagiu com (3S)-3-metilciclopentanona (0,54 g, 5,6 mmol) em N,N-dimetil-acetamida (2 mL) num tubo selado a 135°C durante 90 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com acetato de etilo/hexano (2:1) e filtrado para gerar o composto em título.Example 270A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[(35) -3-methylcyclopentylidene] amino} thieno [ b] pyridin-5 (4H) -one The product of Example 268D (0.065 g, 0.18 mmol) was reacted with (3S) -3-methylcyclopentanone (0.54 g, 5.6 mmol) in N, N-dimethyl acetamide (2 mL) in a sealed tube at 135 ° C for 90 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with ethyl acetate / hexane (2: 1) and filtered to give the title compound.

Exemplo 270B 6-(1, l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-7-hidroxi-4-{[(35)-3-metilciclopentil]amino}tieno[3,2-b]piridin-5(4H)-ona 274 ΕΡ 1 560 827/ΡΤ Ο produto do Exemplo 269Α (0,060 g, 0,14 mmol) em tetra-hidrofurano (4 mL) e metanol (0,012 mL, 0,3 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,12 mL, 0,24 mmol). A reacção foi agitada a 25°C durante 2 horas, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (20 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano to diclorometano/metanol (99:1). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1E RMN (300 MHz, DMSO-dê) δ ppm 1,01 (m, 3H) 1,69 (m, 7H) 3,76 (m, 1H) 5,75 (s, 1H) 7,19 (m, 3H) 7,54 (m, 1H) 7,65 (d, J=7,72 Hz, 1H) 7,74 (d, J=6,25 Hz, 1H) 15,91 (S, 1H) . MS (ESI-) m/z 443 (M-H)”.Example 270B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[(35) -3-methylcyclopentyl] amino} thieno [3,2- b] pyridin-5 (4H) -one The product of Example 269 (0.060 g, 0.14 mmol) in tetrahydrofuran (4 mL) and methanol (0.012 mL, 0.3 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.12 mL, 0.24 mmol). The reaction was stirred at 25 ° C for 2 hours, acidified with 1M hydrochloric acid at a pH of approximately 2-4, diluted with water (20 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to dichloromethane / methanol (99: 1). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.01 (m, 3H) 1.69 (m, 7H) 3.76 (m, 1H) 5.75 (s, 1H) 7.19 (m, 3H) 7.54 (m, 1H) 7.65 (d, J = 7.72 Hz, 1 H) 7.74 (d, J = 6.25 Hz, 1 H) 15.91 (s, 1H). MS (ESI-) m / z 443 (M-H).

Exemplo 271A 4-{[1-ciclopropiletilideno]amino}-6-(1,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,065 g, 0,18 mmol) reagiu com 1-ciclopropiletanona (0,54 g, 6,4 mmol) em N,N-dimetil-acetamida (2 mL) num tubo selado a 135°C durante 120 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com acetato de etilo/hexano (2:1) e filtrado para gerar o composto em título.Example 271A 4 - {[1-cyclopropylethylidene] amino} -6- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4H) -one The product of Example 268D (0.065 g, 0.18 mmol) was reacted with 1-cyclopropylethanone (0.54 g, 6.4 mmol) in N, N-dimethylacetamide (2 mL) in a sealed tube at 135 ° C for 120 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with ethyl acetate / hexane (2: 1) and filtered to give the title compound.

Exemplo 271B 4-{[1-ciclopropiletil]amino}-6-(1,l-dioxido-4H-l,2,4-benzo-tiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-onaExample 271B 4 - {[1-cyclopropylethyl] amino} -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridine -5 (4H) -one

O produto do Exemplo 269A (0,058 g, 0,14 mmol) em tetra-hidrofurano (4 mL) e metanol (0,012 mL, 0,3 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,12 mL, 0,24 mmol). A reacção foi agitada a 25°C durante 2 horas, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (20 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano para diclorometano/metanol (99:1) para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN 275 ΕΡ 1 560 827/ΡΤ (300 ΜΗζ, DMSO-d6) δ ppm 1,05 (m, 8Η) 2,44 (m, 1Η) 5,81 (d, J=2,57 Hz, 1H) 7,23 (m, 3H) 7,53 (m, 1H) 7,64 (d, 1=7,72 Hz, 1H) 7,74 (s, br, 1H) 15,95 (s, 1H). MS (ESI-) m/z 429 (M-H)“.The product of Example 269A (0.058 g, 0.14 mmol) in tetrahydrofuran (4 mL) and methanol (0.012 mL, 0.3 mmol) at 0 ° C was treated dropwise with a 2.0M solution of boron in tetrahydrofuran (0.12 mL, 0.24 mmol). The reaction was stirred at 25 ° C for 2 hours, acidified with 1M hydrochloric acid at a pH of approximately 2-4, diluted with water (20 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to dichloromethane / methanol (99: 1) to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (DMSO-d 6) δ ppm 1.05 (m, 8), 2.44 (m, 1), 5.81 (d, J = 2.57 Hz, 1 H) 7.23 (m, 3H) 7.53 (m, 1H) 7.64 (d, 1 = 7.72 Hz, 1 H) 7.74 (s, br, 1 H) 15.95 (s, 1H). MS (ESI-) m / z 429 (M-H).

Exemplo 272A 4-[(butilidenoamino]-6-(1,l-dioxido-4#-l,2, 4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com butiraldeído (0,5 g, 6,9 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 130°C durante 40 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,075 g, 65%).Example 272A 4 - [(butylideneamino) -6- (1,1-dioxido-4-yl, 2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2- b] pyridin-5 (4H) -one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with butyraldehyde (0.5 g, 6.9 mmol) in N, N-dimethylacetamide (3 mL) in a sealed tube at 130 ° C for The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.075 g, 65%).

Exemplos 272B 4-(butilamino)-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,075 g, 0,18 mmol) em tetra-hidrofurano (4 mL) e metanol (0,029 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 2% metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ ppm 0,90 (t, J=7,17 Hz, 3H) 1,39 (dd, J=15,08, 7,35 Hz, 2H) 1,50 (m, 2H) 3,02 (t, J=6,43 Hz, 2H) 6,65 (s, 1H) 7,43 (d, J=5,15 Hz, 1H) 7,55 (t, J=7,72 Hz, 1H) 7,64 (d, J=8,09 Hz, 1H) 7,77 (t, J=7,72 Hz, 1H) 7,92 (d, J=8,09 Hz, 1H) 8,34 (d, J=5,15 Hz, 1H) 14,21 (s, 1H) 14,83 (s, 1H) . MS (ESI-)m/z 417 (Μ-ΗΓ.Examples 272B 4- (butylamino) -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4H) -one The product of Example 269A (0.075 g, 0.18 mmol) in tetrahydrofuran (4 mL) and methanol (0.029 mL, 0.5 mmol) at 0 ° C was treated dropwise with a 2.0M solution of boron in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.90 (t, J = 7.17 Hz, 3H) 1.39 (dd, J = 15.08, 7.35 Hz, 2H) 1.50 ( m, 2H) 3.02 (t, J = 6.43 Hz, 2 H) 6.65 (s, 1 H) 7.43 (d, J = 5.15 Hz, 1 H) 7.55 (t, (D, J = 8.09 Hz, 1 H) 7.77 (t, J = 7.72 Hz, 1 H) 7.92 (d, J = 1H) 8.34 (d, J = 5.15 Hz, 1 H) 14.21 (s, 1 H) 14.83 (s, 1H). MS (ESI-) m / z 417 (Μ-ΗΓ.

Exemplo 273A 6-(1,l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-4-{[2-etil-butilideno]amino}-7-hidroxitieno[3,2-b]piridin-5(4fl)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com 2-etilbutanal (0,5 g, 5,2 mmol) em N,N-dimetilacetamida (3 mL) 276 ΕΡ 1 560 827/ΡΤ num tubo selado a 130°C durante 40 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietilico e filtrado para gerar o composto em titulo (0,082 g, 68%).Example 273A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4 - {[2-ethyl-butylidene] amino} -7-hydroxythieno [3,2- b] pyridine The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 2-ethylbutanal (0.5 g, 5.2 mmol) in N, N-dimethylacetamide (3 mL) 276 ΕΡ 1 560 827 / ΡΤ in a sealed tube at 130 ° C for 40 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.082 g, 68%).

Exemplo 273B 6- (1, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il) -4- [ (2-etilbutil) - amino]-7-hidroxitieno[3,2-b]piridin-5(4fl)-ona O produto do Exemplo 269A (0,82 g, 0,18 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 2% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-dô) δ ppm 0,90 (t, J=7,17 Hz, 6H) 1,45 (m, 5H) 2,94 (m, J=4, 78 Hz, 2H) 6,53 (s, 1H) 7,38 (d, J=5,52 Hz, 1H) 7,55 (t, J=7,54 Hz, 1H) 7,65 (d, J=8,09 Hz, 1H) 7,77 (t, J=8,46 Hz, 1H) 7,92 (d, J=7,72 Hz, 1H) 8,36 (d, J=5,52 Hz, 1H) 14,19 (s, 1H) 14,83 (s, 1H) . MS (ESI-) m/z 445 (M-H)”.Example 273B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4 - [(2-ethylbutyl) amino] -7-hydroxythieno [3,2- b] pyridin- 5 (4H) -one The product of Example 269A (0.82 g, 0.18 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.90 (t, J = 7.17 Hz, 6H) 1.45 (m, 5H) 2.94 (m, J = 4.78 Hz, 2H) (D, J = 5.52 Hz, 1 H) 7.55 (t, J = 7.54 Hz, 1 H) 7.65 (d, J = 8.09 Hz, 1H), 7.76 (d, J = 5.42 Hz, 1H), 7.76 (d, J = 19 (s, 1 H) 14.83 (s, 1 H). MS (ESI-) m / z 445 (M-H).

Exemplo 274A 6-(1, l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-[pentilidenoamino]tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com pentanal (0,5 g, 5,0 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 130°C durante 40 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietilico e filtrado para gerar o composto em título (0,081 g, 70%).Example 274A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4- [pentylideneamino] thieno [3,2-b] pyridin-5 (4H) - one The product from Example 268D (0.10 g, 0.27 mmol) was reacted with pentanal (0.5 g, 5.0 mmol) in N, N-dimethylacetamide (3 mL) in a sealed tube at 130 ° C for 40 hours. minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.081 g, 70%).

Exemplo 274B 6-(1, l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-7-hidroxi-4-(pentilamino)tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,081 g, 0,19 mmol) em tetra-hidrofurano (4 mL) e metanol (0, 020 mL, 0,5 mmol) a 0°C foi 277 ΕΡ 1 560 827/ΡΤ tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 1% metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-dô) δ ppm 0,88 (t, J=6,99 Hz, 3H) 1,34, (m, 4H) 1,53 (m, 2H) 3,01 (t, J=6,62 Hz, 2H) 6,64 (s, 1H) 7,43 (d, J=5,15 Hz, 1H) 7,55 (t, J=7,72 Hz, 1H) 7,64 (d, J=8,09 Hz, 1H) 7,78 (t, J=7,91 Hz, 1H) 7,93 (d, J=8,09 Hz, 1H) 8,35 (d, J=5,52 Hz, 1H) 14,21 (s, 1H) 14,81 (s, 1H). MS (ESI-) m/z 431 (M-H)&quot;.Example 274B 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4- (pentylamino) thieno [3,2- b] pyridin-5 (4H) - one The product of Example 269A (0.081 g, 0.19 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was 277 ÅΡ¹ 560 827 / ΡΤ treated dropwise was added dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.88 (t, J = 6.99 Hz, 3H) 1.34 (m, 4H) 1.53 (m, 2H) 3.01 (t, J = 6.62 Hz, 2 H) 6.64 (s, 1 H) 7.43 (d, J = 5.15 Hz, 1 H) 7.55 (t, J = 7.72 Hz, 1 H) 7.64 (d, J = 8.09 Hz, 1 H) 7.78 (t, J = 7.91 Hz, 1 H) 7.93 (d, J = 5.52 Hz, 1 H) 14.21 (s, 1 H) 14.81 (s, 1 H). MS (ESI-) m / z 431 (M-H) &quot;.

Exemplo 275A 6-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[3-metilbutilideno]amino}tieno[3, 2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com 3- metilbutanal (0,5 g, 5,8 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 130°C durante 40 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,083 g, 71%).Example 275A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[3-methylbutylidene] amino} thieno [3,2- b] pyridin- The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3-methylbutanal (0.5 g, 5.8 mmol) in N, N-dimethylacetamide (3 mL) in a tube sealed at 130 ° C for 40 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.083 g, 71%).

Exemplo 275B 6-(1, l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-7-hidroxi- 4- [(3-metilbutil)amino]tieno[3,2-b]piridin-5(4ff)-ona O produto do Exemplo 269A (0,083 g, 0,19 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 1% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ ppm 0,90 (d, J=6,62 Hz, 6H) 1,44 (g, J=7,ll Hz, 2H) 278 ΕΡ 1 560 827/ΡΤ 1,70 (m, 1Η) 3,03 (t, J=6,99 Hz, 2H) 6,61 (s, 1H) 7,43 (d, J=5,15 Hz, 1H) 7,55 (t, J=7,54 Hz, 1H) 7,65 (d, J=8,09 Hz, 1H) 7,77 (t, J=7, 72 Hz, 1H) 7,92 (d, J=7,72 Hz, 1H) 8,35 (d, J=5,52 Hz, 1H) 14,20 (s, 1H) 14,81 (s, 1H). MS (ESI-) m/z 431 (M-M) “.Example 275B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(3-methylbutyl) amino] thieno [3,2- b] pyridin- 5 (4 F) -one The product of Example 269A (0.083 g, 0.19 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with solution of 2.0M lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.90 (d, J = 6.62 Hz, 6H) 1.44 (g, J = 7, 11 Hz, 2 H) 278 ÅΡ 1 560 827 / ΡΤ 1 , 7.03 (t, J = 6.99 Hz, 2 H), 6.61 (s, 1 H), 7.43 (d, J = 5.15 Hz, (D, J = 8.09 Hz, 1 H) 7.77 (t, J = 7.72 Hz, 1 H) 7.92 (d, J = 7.54 Hz, 72 Hz, 1 H) 8.35 (d, J = 5.52 Hz, 1 H) 14.20 (s, 1 H) 14.81 (s, 1H). MS (ESI-) m / z 431 (M-M).

Exemplo 276A 4-{[3,3-dimetilbutilideno]amino}-6-(1,l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com 3,3-dimetilbutanal (0,5 g, 5,0 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 130°C durante 40 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O residuo resultante foi triturado com éter dietilico e filtrado para gerar o composto em titulo (0,072 g, 77%) .Example 276A 4 - {[3,3-dimethylbutylidene] amino} -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridine The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3,3-dimethylbutanal (0.5 g, 5.0 mmol) in N, N-dimethylacetamide (3 mL) ) in a sealed tube at 130 ° C for 40 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.072 g, 77%).

Exemplo 276B 4-[(3,3-dimetilbutil)amino]-6-(1, l-dioxido-4H-l,2, 4-benzo-tiadiazin-3-il)-7-hidroxitieno[3, 2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,072 g, 0,21 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 2% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ ppm 0,89 (s, 9H) 1,49 (dd, J=9, 56, 6,99 Hz, 2H) 3,03 (m, 2H) 6,61 (s, 1H) 7,43 (d, J=5,52 Hz, 1H) 7,55 (t, J=7,54 Hz, 1H) 7,66 (d, J=7, 72 Hz, 1H) 7,77 (m, 1H) 7,92 (d, J=8,09 Hz, 1H) 8,35 (d, J=5,52 Hz, 1H) 14,19 (s, 1H) 14,83 (s, 1H). MS (ESI-) m/z 445 (M-H)-.Example 276B 4 - [(3,3-dimethylbutyl) amino] -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2- b ] pyridin-5 (4H) -one The product of Example 269A (0.072 g, 0.21 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.89 (s, 9H) 1.49 (dd, J = 9.56 Hz, 2 H) 3.03 (m, 2 H) 6.61 (d, J = 7.52 Hz, 1 H) 7.55 (t, J = 7.54 Hz, 1 H) 7.66 (d, J = 1H NMR (CDCl3): Î'7.77 (m, 1H) 7.92 (d, J = 8.09 Hz, 1 H) 8.35 (d, J = 5.52 Hz, 1 H) 14.13 (s, s, 1H). MS (ESI-) m / z 445 (M-H) -.

Exemplo 277A 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[(3-metilfenil)metileno]amino}tieno[3,2-b]piridin-5(4H)-ona 279 ΕΡ 1 560 827/ΡΤ Ο produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com 3- metilbenzaldeído (0,5 g, 4,2 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 130°C durante 40 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,092 g, 73%) .Example 277A 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[(3-methylphenyl) methylene] amino} thieno [3,2- b ] pyridine-5 (4H) -one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3-methylbenzaldehyde (0.5 g, 4.2 mmol) in N , N-dimethylacetamide (3 mL) in a sealed tube at 130 ° C for 40 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.092 g, 73%).

Exemplo 277B 6-(1, l-dioxido-4fl-l,2, 4-benzotiadiazin-3-il)-7-hidroxi- 4- [ (3-metilbenzil) amino] tieno [3,2 — Jb] piridin-5 (AH) -ona O produto do Exemplo 269A (0,090 g, 0,2 mmol) em tetra-hidrofurano (4 mL) e metanol (0,015 mL, 0,4 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 2% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ ppm 2,29 (s, 3H) 4,15 (s, 2H) 6,94 (s, 1H) 7,22 (m, 4H) 7,30 (d, J=5, 15 Hz, 1H) 7,56 (t, J=7, 72 Hz, 1H) 7,68 (d, J=8,46 Hz, 1H) 7,79 (t, J=6,99 Hz, 1H) 7,94 (d, J=7,72 Hz, 1H) 8,24 (d, J=5,15 Hz, 1H) 14,26 (s, 1H) 14,84 (s, 1H). MS (ESI-) m/z 465(M-H)“.Example 277B 6- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -7-hydroxy-4 - [(3-methylbenzyl) amino] thieno [3,2- b] pyridin- 5 (AH) -one The product of Example 269A (0.090 g, 0.2 mmol) in tetrahydrofuran (4 mL) and methanol (0.015 mL, 0.4 mmol) at 0 ° C was treated dropwise with solution of 2.0M lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 2.29 (s, 3H) 4.15 (s, 2H) 6.94 (s, 1H) 7.22 (m, 4H) 7.30 (d, J = 5.1 Hz, 1H), 7.56 (t, J = 7.72 Hz, 1 H) 7.68 (d, J = 8.46 Hz, 1 H) 7.79 (t, J = 6.99 1H), 14.26 (s, 1H), 14.84 (s, 1H), 7.94 (d, J = 7.72 Hz, . MS (ESI-) m / z 465 (M-H).

Exemplo 278A 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi- 4-{[(2-metilfenil)metileno]amino}tieno[3, 2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com 2-metilbenzaldeído (0,5 g, 4,2 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,072 g, 57%) . 280 ΕΡ 1 560 827/ΡΤExample 278A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[(2-methylphenyl) methylene] amino} thieno [3,2- b ] The product from Example 268D (0.10 g, 0.27 mmol) was reacted with 2-methylbenzaldehyde (0.5 g, 4.2 mmol) in N, N-dimethylacetamide (3 mL) ) in a sealed tube at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.072 g, 57%). 280 ΕΡ 1 560 827 / ΡΤ

Exemplo 278Β 6-(1, l-dioxido-4fl-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-[(2-metilbenzil)amino]tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,072 g, 0,15 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 2% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-de) δ ppm 2,45 (s, 3H) 4,21 (s, 2H) 6,92 (s, 1H) 7,15 (m, 5H) 7,56 (t, 0=Ί,Ί2 Hz, 1H) 7,67 (d, J=8,09 Hz, 1H) 7,79 (t, J=7,72 Hz, H) 7,94 (d, J=7,72 Hz, 1H) 8,17 (d, J=5,52 Hz, 1H) 14,22 (s, 1H) 14,82 (s, 1H) . MS (ESI-) m/z 465 (M-H)”.Example 278 6- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -7-hydroxy-4 - [(2-methylbenzyl) amino] thieno [3,2- b] pyridin- 5 (4H) -one The product of Example 269A (0.072 g, 0.15 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with solution of 2.0M lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d6) δ ppm 2.45 (s, 3H) 4.21 (s, 2H) 6.92 (s, 1H) 7.15 (m, 5H) 7.56 (t, (D, J = 8.09 Hz, 1 H) 7.79 (t, J = 7.72 Hz, H) 7.94 (d, J = 7.72 Hz, 1 H) 8.17 (d, J = 5.52 Hz, 1 H) 14.22 (s, 1 H) 14.82 (s, 1H). MS (ESI-) m / z 465 (M-H).

Exemplo 279A 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi- 4-{[(4-metilfenil)metileno]amino}tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com 4-metilbenzaldeído (0,5 g, 4,2 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,10 g, 81%) .Example 279A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[(4-methylphenyl) methylene] amino} thieno [3,2- b ] The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 4-methylbenzaldehyde (0.5 g, 4.2 mmol) in N, N-dimethylacetamide (3 mL) ) in a sealed tube at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.10 g, 81%).

Exemplo 279B 6- (1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-[(4-metilbenzil)amino]tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,10 g, 0,22 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água 281 ΕΡ 1 560 827/ΡΤ (15 mL) e ο precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em silica gel com 2% de metanol em clorofórmio para gerar o composto em titulo. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ ppm 2,27 (s, 3H) 4,14 (s, 2H) 6,92 (s, 1H) 7,13 (d, J=8,09 Hz, 2H) 7,28 (d, J=2,94 Hz, 1H) 7,30 (d, J=5,88 Hz, 2H) 7,56 (t; J=7,72 Hz, 1H) 7,67 (d, J=8,46 Hz, 1H) 7,79 (t, J=7,72 Hz, 1H) 7,94 (d, J=7,72 Hz, 1H) 8,22 (d, J=5,52 Hz, 1H) 14,21 (s, 1H) 14,82 (s, 1H). MS (ESI-) m/z 465 (M-H)“.Example 279B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(4-methylbenzyl) amino] thieno [3,2- b] pyridin- 5 (4H) -one The product of Example 269A (0.10 g, 0.22 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid at a pH of approximately 2-4, diluted with water (580 μl), and the resulting precipitate was collected by filtration and dried . The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the titled compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 2.27 (s, 3H) 4.14 (s, 2H) 6.92 (s, 1H) 7.13 (d, J = 8.09 Hz, 2H ) 7.28 (d, J = 2.94 Hz, 1 H) 7.30 (d, J = 5.88 Hz, 2 H) 7.56 (t, J = 7.72 Hz, d, J = 8.46 Hz, 1 H) 7.79 (t, J = 7.72 Hz, 1 H) 7.94 (d, J = 7.72 Hz, 1 H) , 52 Hz, 1 H) 14.21 (s, 1 H) 14.82 (s, 1 H). MS (ESI-) m / z 465 (M-H).

Exemplo 280A 6-(1, l-dioxido-4ff-l,2, 4-benzotiadiazin-3-il)-hidroxi- 4-{[3-metilbut-2-enilideno]amino}tieno[3,2-b]piridin-5(4fl)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com 3- metilbut-2-enal (0,5 g, 5,9 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 130°C durante 40 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O residuo resultante foi triturado com éter dietilico e filtrado para gerar o composto em titulo (0,093 g, 80%) .Example 280A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -hydroxy-4 - {[3-methylbut-2-enylidene] amino} thieno [3,2- b] The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3-methylbut-2-enal (0.5 g, 5.9 mmol) in N, N-dimethylacetamide (3 mL) in a sealed tube at 130 ° C for 40 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.093 g, 80%).

Exemplo 280B 6-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi- 4- [(3-metilbut-2-enil)amino]tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,093 g, 0,22 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em silica gel com 2% metanol em clorofórmio para gerar o composto em titulo. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. 1K RMN (300 MHz, DMSO-d6) δ ppm 1,51 (s, 3H) 1,61 (s, 3H) 3,64 (d, J=6,99 Hz, 2H) 5,32 (t, J=8,09 Hz, 1H) 6,65 (s, 1H) 7,43 (d, J=5,52 Hz, 1H) 7,55 (t, J=7,54 Hz, 1H) 7,64 (d, J=8,46 Hz, 1H) 7,78 (t, J=7,17 Hz, 1H) 282 ΕΡ 1 560 827/ΡΤ 7,92 (d, J=7, 72 Hz, 1H) 8,32 (m, 1H) 14,21 (s, 1H) 14,82 (s, 1H) . MS (ESI-) m/z 429 (M-H)”.Example 280B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(3-methylbut-2-enyl) amino] thieno [3,2- b] pyridin-5 (4H) -one The product of Example 269A (0.093 g, 0.22 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise was added dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the titled compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.51 (s, 3H) 1.61 (s, 3H) 3.64 (d, J = 6.99 Hz, 2H) 5.32 (t, J = = 8.09 Hz, 1 H) 6.65 (s, 1 H) 7.43 (d, J = 5.52 Hz, 1 H) 7.55 (t, J = 7.54 Hz, d, J = 8.46 Hz, 1 H) 7.78 (t, J = 7.17 Hz, 1 H) δ 7.90 (d, 32 (m, 1 H) 14.21 (s, 1 H) 14.82 (s, 1 H). MS (ESI-) m / z 429 (M-H).

Exemplo 281A 6-(1,l-dioxido-4fl-l, 2, 4-benzotiadlazin-3-ll)-7-hidroxi-4-[propilidenoamino]tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com propionaldeído (0,5 g, 8,6 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 120°C durante 90 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,073 g, 67%) .Example 281A 6- (1,1-dioxido-4,11-1,2-4-benzothiazol-3-yl) -7-hydroxy-4- [propylideneamino] thieno [3,2- b] pyridin-5 (4H) - one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with propionaldehyde (0.5 g, 8.6 mmol) in N, N-dimethylacetamide (3 mL) in a sealed tube at 120 ° C for 90 minutes minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.073 g, 67%).

Exemplo 281B 6-(1, l-dioxido-4fl-l, 2, 4-benzotiadiazin-3-il)-7-hidroxi-4-(propilamino)tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,073 g, 0,18 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 2% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ ppm 0,95 (t, J=7,35 Hz, 3H) 1,54 (m, 2H) 2,99 (t, J=6,99 Hz, 2H) 6,66 (s, 1H) 7,44 (d, J=5,15 Hz, 1H) 7,55 (t, J=7,54 Hz, 1H) 7,64 (d, J=8,09 Hz, 1H) 7,78 (t, J=7,17 Hz, 1H) 7,93 (d, J=7,72 Hz, 1H) 8,35 (d, J=5,15 Hz, 1H) 14,20 (s, lH) 14,81 (s, 1H). MS (ESI-) m/z 403 (M-H)-.Example 281B 6- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -7-hydroxy-4- (propylamino) thieno [3,2-b] pyridin-5 (4H) - one The product of Example 269A (0.073 g, 0.18 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with a 2.0M solution of borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.95 (t, J = 7.35 Hz, 3H) 1.54 (m, 2H) 2.99 (t, J = 6.99 Hz, 2H) (D, J = 5.15 Hz, 1 H) 7.55 (t, J = 7.54 Hz, 1 H) 7.64 (d, J = , 1H), 7.78 (t, J = 7.17 Hz, 1 H) 7.93 (d, J = 7.72 Hz, 20 (s, 1H) 14.81 (s, 1H). MS (ESI-) m / z 403 (M-H) -.

Exemplo 282A 6-(1,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[piridin-4-ilmetileno]amino}tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com isonicotinaldeído (0,5 g, 4,7 mmol) em N,N-dimetilacetamida (3 283Example 282A 6- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -7-hydroxy-4 - {[pyridin-4-ylmethylene] amino} thieno [3,2- b] pyridin-5 (4H) -one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with isonicotinaldehyde (0.5 g, 4.7 mmol) in N, N -dimethylacetamide (3: 283

ΕΡ 1 560 827/PT mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,093 g, 76%) .Ml) in a sealed tube at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.093 g, 76%).

Exemplo 282B 6- (1,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-[(piridin-4-ilmetil)amino]tieno[3,2-£&gt;]piridin-5(4H)-ona O produto do Exemplo 269A (0,093 g, 0,21 mmol) em tetra- hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 2% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 4,39 (s, 2H) 7,34 (d, J=5,15 Hz, 1H) 7,42 (s, 1H) 7,56 (t, J=7, 72 Hz, 1H) 7,63 (d, J=8, 09 Hz, 1H) 7,79 (m, J=7, 72, 7, 72 Hz, 3H) 7,94 (d, J=7, 72 Hz, 1H) 8,27 (d, J=5,15Example 282B 6- (1,1-dioxido-4fl-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(pyridin-4-ylmethyl) amino] thieno [3,2- ; The product from Example 269A (0.093 g, 0.21 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise was added dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 4.39 (s, 2 H) 7.34 (d, J = 5.15 Hz, 1 H) 7.42 (s, 1 H) 7.56 (t, J = (D, J = 8.09 Hz, 1 H), 7.79 (d, J = 7.72 Hz, 7.72 Hz, 1 H) 8.27 (d, J = 5.15

Hz, 1H) 8,52 (d, J=6,62 Hz, 2H) 14,15 (s, 1H) 14,87 (s, 1H) . MS (ESI-) m/z 452 (M-H)”.1H), 8.52 (d, J = 6.62 Hz, 2 H) 14.15 (s, 1 H) 14.87 (s, 1H). MS (ESI-) m / z 452 (M-H).

Exemplo 283A 6-(1, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-7-hidroxi-4-{[piridin-3-ilmetileno]amino}tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com nicotinaldeido (0,5 g, 4,7 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,102 g, 84%) .Example 283A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[pyridin-3-ylmethylene] amino} thieno [3,2- b] The product of Example 268D (0.10 g, 0.27 mmol) was reacted with nicotinaldehyde (0.5 g, 4.7 mmol) in N, N-dimethylacetamide (3 mL) in a tube sealed at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.102 g, 84%).

Exemplo 283B 6-(1, l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4- [ (piridin-3-ilmetil) amino] tieno [3,2-b] piridin-5 (4ff) -ona 284 ΕΡ 1 560 827/ΡΤ Ο produto do Exemplo 269Α (0,102 g, 0,23 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluida com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. 0 produto em bruto foi cromatografado em sílica gel com 2% de metanol em clorofórmio para gerar o composto em título. 0 sal de sódio do composto em título foi preparado deExample 283B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(pyridin-3-ylmethyl) amino] thieno [3,2- b] (0.102 g, 0.23 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 DEG C. ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared from

acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMS0-d6) δ ppm 4,33 (s, 2H) 7,28 (d, J=5,52 Hz, 1H) 7,36 (s, 1H) 7,61 (m, 3H) 7,79 (t, J=7,17 Hz, 1H) 7,94 (d, J=8,09 Hz, 1H) 8,20 (d, J=ll,03 Hz, 1H) 8,27 (d, J=5,51 Hz, 1H) 8,49 (d, J=5,51 Hz, 1H) 8,64 (s, 1H) 14,14 (s, 1H) 14,83 (s, 1H) . MS (ESI-) m/z 452 (M-H)“.according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 4.33 (s, 2H) 7.28 (d, J = 5.52 Hz, 1H) 7.36 (s, 1H) 7.61 (m, 3H ) 7.79 (t, J = 7.17 Hz, 1 H) 7.94 (d, J = 8.09 Hz, 1 H) 8.20 (d, J = 11.03 Hz, J = 5.51 Hz, 1 H) 8.64 (s, 1 H) 14.14 (s, 1 H) 14.83 (s, 1 H) . MS (ESI-) m / z 452 (M-H).

Exemplo 284A 6-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[piridin-2-ilmetileno]aminojtieno[3,2-b]piridin-5(4H)-ona 0 produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com 2-piridinacarboxaldeído (0,5 g, 4,7 mmol) em N,N-dimetil-acetamida (3 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,071 g, 58%).Example 284A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[pyridin-2-ylmethylene] aminojthieno [3,2- b] pyridin- 5 (4H) -one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 2-pyridinecarboxaldehyde (0.5 g, 4.7 mmol) in N, N-dimethylacetamide (3 mL) in a sealed tube at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.071 g, 58%).

Exemplo 284B 6- (1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il) -7-hidroxi-4-[(piridin-2-ilmetil)amino]tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,071 g, 0,16 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel 285 ΕΡ 1 560 827/ΡΤ com 5% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D: XH RMN (300 MHz, DMSO-dê) δ ppm 4,65 (s, 2H) 7,25 (d, J=5,15 Hz, 1H) 7,45 (s, 1H) 7,59 (m, 3H) 7,78 (t, J=7,91 Hz, 1H) 7,93 (d, J=7,72 Hz, 2H) 8,16 (t, J=7, 72 Hz, 1 m 8,24 (d, J=5,15 Hz, 1H) 8,72 (d, J=5,51 Hz, 1H) 14,10 (s, 1H) 14,87 (s, 1H) . MS (ESI-) m/z 452 (Μ-ΗΓ.Example 284B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(pyridin-2-ylmethyl) amino] thieno [3,2- b] pyridin-5 (4H) -one The product of Example 269A (0.071 g, 0.16 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel 285® 1 560 827 / ΡΤ with 5% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D: 1 H NMR (300 MHz, DMSO-d6) δ ppm 4.65 (s, 2H) 7.25 (d, J = 5.15 (D, J = 7.72 Hz, 1 H) 7.50 (s, 1 H) 7.59 (m, 3 H) 7.78 (t, 8.16 (t, J = 5.15 Hz, 1 H) 8.72 (d, J = 5.51 Hz, 1 H) 14.10 (s, , 1H), 14.87 (s, 1H), MS (ESI-) m / z 452 (M +).

Exemplo 285A 6-(1, l-dioxido-4#-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[(3-metoxifenil)metileno]amino}tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com 3- metoxibenzaldeído (0,5 g, 3,7 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,093 g, 72%) .Example 285A 6- (1,1-dioxido-4-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[(3-methoxyphenyl) methylene] amino} thieno [3,2- b] pyridin-5 (4H) -one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3-methoxybenzaldehyde (0.5 g, 3.7 mmol) in N, N -dimethylacetamide (3 mL) in a sealed tube at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.093 g, 72%).

Exemplo 285B 6-(1, l-dioxido-4#-l,2,4-benzotiadiazin-3-il)-7-hidroxi- 4- [(3-metoxibenzil)amino]tieno[3, 2-b]piridin-5(4fl)-ona O produto do Exemplo 269A (0,093 g, 0,19 mmol) em tetra-hidrofurano (4 mL) e metanol (0, 020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 1% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ ppm 3,73 (s, 3H) 4,17 (s, 2H) 6,84 (m, 1H) 6,98 (m, 3H) 7,22 (d, J=8, 09 Hz, 1H) 7,26 (d, J=5,15 Hz, 1H) 7,56 (t, J=7,17 Hz, 1H) 7,67 (d, J=8,09 Hz, 1H) 7,79 (t, J=8,46 Hz, 1H) 7,94 (d, J=7,72 Hz, 1H) 8,22 (d, J=5,15 Hz, 1H) 14,21 (s, 1H) 14,84 (s, 1H) . MS (ESI-) m/z 481 (M-H)”. 286 ΕΡ 1 560 827/ΡΤExample 285B 6- (1,1-dioxido-4,11-benzothiadiazin-3-yl) -7-hydroxy-4 - [(3-methoxybenzyl) amino] thieno [3,2- b] pyridine The product of Example 269A (0.093 g, 0.19 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.73 (s, 3H) 4.17 (s, 2H) 6.84 (m, 1H) 6.98 (m, 3H) 7.22 (d, (D, J = 5.15 Hz, 1 H) 7.56 (t, J = 7.17 Hz, 1 H) 7.67 (d, J = 8.09 (D, J = 5.15 Hz, 1 H), 7.29 (t, J = 8.46 Hz, 1 H) 7.94 (d, J = , 21 (s, 1 H) 14.84 (s, 1 H). MS (ESI-) m / z 481 (M-H). 286 ΕΡ 1 560 827 / ΡΤ

Exemplo 286Α 6-(1, l-dioxido-4i7-l, 2, 4-benzotiadiazin-3-il) -4-{ [3-furil-metileno]amino}-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com 3-furaldeído (0,5 g, 5,2 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,103 g, 87%) .Example 286 6- (1,1-dioxido-4-1,2,4-benzothiadiazin-3-yl) -4 - {[3-furyl-methylene] amino} -7-hydroxythieno [3,2- b] pyridine The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3-furaldehyde (0.5 g, 5.2 mmol) in N, N-dimethylacetamide (3 mL) in tube sealed at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.103 g, 87%).

Exemplo 286B 6-(1, l-dioxido-4fl-l,2, 4-benzotiadiazin-3-il)-4-[(3-furil-metil) amino] -7-hidroxitieno [3,2-£&gt;] piridin-5 (4H) -ona O produto do Exemplo 269A (0,103 g, 0,23 mmol) em tetra-hidrofurano (4 mL) e metanol (0, 030 mL, 0,8 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,200 mL, 0,4 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 2% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-d6) δ ppm 4,08 (s, 2H) 6,59 (s, 1H) 6,95 (s, 1H) 7,32 (d, J=5,15 Hz, 1H) 7,58 (m, 3H) 7,66 (d, J=8,09 Hz, 1H) 7,79 (t, J=8,46 Hz, 1H) 7,93 (d, J=7,72 Hz, 1H) 8,24 (d, J=5,52 Hz, 1H) 14,21 (s, 1H) 14,83 (s, 1H) . MS (ESI-) m/z 441 (M-H)“.Example 286B 6- (1,1-dioxido-4,11,2,4-benzothiadiazin-3-yl) -4 - [(3-furyl-methyl) amino] -7-hydroxythieno [3,2- b> ] pyridine-5 (4H) -one The product of Example 269A (0.103 g, 0.23 mmol) in tetrahydrofuran (4 mL) and methanol (0.030 mL, 0.8 mmol) at 0 ° C was treated was added dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.200 mL, 0.4 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ ppm 4.08 (s, 2H) 6.59 (s, 1H) 6.95 (s, 1H) 7.32 (d, J = 5.15 Hz, 1H) (D, J = 8.09 Hz, 1 H) 7.79 (t, J = 8.46 Hz, 1 H) 7.93 (d, J = 7.72 Hz) , 1H), 8.24 (d, J = 5.52 Hz, 1 H) 14.21 (s, 1 H) 14.83 (s, 1H). MS (ESI-) m / z 441 (M-H).

Exemplo 287A 3-({[6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-5-oxotieno[3,2-b]piridin-4(5H)-il]imino}metil)benzonitrilo O produto do Exemplo 268D (0,100 g, 0,27 mmol) reagiu com 3-formilbenzonitrilo (0,362 g, 2,75 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com 287Example 287A 3 - ({[6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-5-oxothieno [3,2- b] pyridin-4 (5 H ) The product from Example 268D (0.100 g, 0.27 mmol) was reacted with 3-formylbenzonitrile (0.362 g, 2.75 mmol) in N, N-dimethylacetamide (3 mL) in a sealed tube at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with 287

ΕΡ 1 560 827/PT éter dietílico e filtrado para gerar o composto em título (0,088 g, 69%).Diethyl ether and filtered to give the title compound (0.088 g, 69%).

Exemplo 287B 3- ({ [ 6 - (1, l-dioxido-4H-l, 2,4-benzotiadiazin-3-il) -7-hidroxi-5-oxotieno[3,2-b]piridin-4(5H)—11]amino}metil)benzonitriloExample 287B 3 - ({[6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-5-oxothieno [3,2- b] pyridin-4 (5 H ) -11] amino} methyl) benzonitrile

O produto do Exemplo 269A (0,088 g, 0,19 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. 0 produto em bruto foi cromatografado em sílica gel com 1% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ ppm 4,26 (s, 2H) 7,21 (s, 1H) 7,29 (d, J=5,15 Hz, 1H) 7,55 (m, 2H) 7,65 (d, J=8,09 Hz, 1H) 7,78 (m, 3H) 7,94 (m, 2H) 8,22 (d, J=5,52 Hz, 1H) 14,19 (s, 1H) 14,83 (s, 1H) . MS (ESI-) m/z 476(M-H)'.The product of Example 269A (0.088 g, 0.19 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with a 2.0M solution of boron in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 4.26 (s, 2 H) 7.21 (s, 1 H) 7.29 (d, J = 5.15 Hz, ) 7.65 (d, J = 8.09 Hz, 1 H) 7.78 (m, 3 H) 7.94 (m, 2 H) 8.22 (d, J = 5.52 Hz, (s, 1 H) 14.83 (s, 1 H). MS (ESI-) m / z 476 (M-H) +.

Exemplo 288A 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[tien-3-ilmetileno]aminojtieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com tiofeno-3-carbaldeído (0,5 g, 4,5 mmol) em N,N-dimetil-acetamida (3 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,077 g, 63%).Example 288A 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[thien-3-ylmethylene] amino] thieno [3,2- b] pyridin- 5 (4H) -one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with thiophene-3-carbaldehyde (0.5 g, 4.5 mmol) in N, N-dimethylacetamide (3 mL) in a sealed tube at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.077 g, 63%).

Exemplo 288B 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-[(tien-3-ilmetil)amino]tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,077 g, 0,17 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de 288 ΕΡ 1 560 827/ΡΤ lítio em tetra-hidrofurano (0,150 mL, 0,3 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (25 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em silica gel com 2% de metanol em clorofórmio para gerar o composto em titulo. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ ppm 4,22 (s, 2H) 7,01 (s, 1H) 7,20 (dd, J=4,96, 1,29 Hz, 1H) 7,23 (d, J=5,52 Hz, 1H) 7,40 (d, J=l,84 Hz, 1H)Example 288B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(thien-3-ylmethyl) amino] thieno [3,2- b] pyridin-5 (4H) -one The product of Example 269A (0.077 g, 0.17 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with a 2.0M solution of borohydride of 288 Ρ Ρ 1 560 827 / ΡΤ lithium in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid at a pH of approximately 2-4, diluted with water (25 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the titled compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 4.22 (s, 2H) 7.01 (s, 1H) 7.20 (dd, J = 4.96, 1.29 Hz, (d, J = 5.52 Hz, 1 H) 7.40 (d, J = 1.84 Hz, 1 H)

7,48 (dd, J=4, 78, 2, 94 Hz, 1H) 7,56 (t, J=7,17 Hz, 1H) 7,67 (d, J=7,72 Hz, 1H) 7,79 (t, J=7,72 Hz, 1H) 7,94 (d, J=7,72 Hz, 1H) 8,21 (d, J=5, 15 Hz, 1H) 14,21 (s, 1H) 14,82 (s, 1H) . MS (ESI-) m/z 457 (M-H)-.7.48 (dd, J = 4.78, 2.94 Hz, 1 H) 7.56 (t, J = 7.17 Hz, 1 H) 7.67 (d, J = 7.72 Hz, (D, J = 5.12 Hz, 1 H), 7.23 (d, J = 1H) 14.82 (s, 1H). MS (ESI-) m / z 457 (M-H) -.

Exemplo 289A 4-(ciclobutilidenoamino)-6-(1,l-dioxido-4ff-l, 2,4-benzo-tiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,10 g, 0,27 mmol) reagiu com ciclobutanona (1,0 g, 14,3 mmol) em N,N-dimetilacetamida (2 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,086 g 77%) .Example 289A 4- (cyclobutylideneamino) -6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2- b] pyridin-5 (4H) -one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with cyclobutanone (1.0 g, 14.3 mmol) in N, N-dimethylacetamide (2 mL) in a sealed tube at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.086 g, 77%).

Exemplo 289B 4-(ciclobutilamino)-6-(1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4fl)-ona O produto do Exemplo 269A (0,077 g, 0,21 mmol) em tetra-hidrofurano (4 mL) e metanol (0,030 mL, 0,8 mmol) a 0°C foi tratada gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,200 mL, 0,4 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 1% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, 289 ΕΡ 1 560 827/ΡΤ DMSO-d6) δ ppm 1,81 (m, 6Η) 3,85 (m, 1H) 6,84 (s, 1H) 7,49 (d, J=5,15 Hz, 1H) 7,55 (t, J=7,91 Hz, 1H) 7,62 (d, J=8,09 Hz, 1H) 7,78 (t, J=7,91 Hz, 1H) 7,93 (d, J=8,09 Hz, 1H) 8,33 (d, J=5,15 Hz, 1H) 14,21 (s, 1H) 14,82 (s, 1H). MS (ESI-) m/z 415 (M-H)-.Example 289B 4- (cyclobutylamino) -6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2- b] pyridin-5 (4 H) -one The product of Example 269A (0.077 g, 0.21 mmol) in tetrahydrofuran (4 mL) and methanol (0.030 mL, 0.8 mmol) at 0 ° C was treated dropwise with a 2.0M solution of boron in tetrahydrofuran (0.200 mL, 0.4 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, 289 ÅΡ 1 560 827 / δ DMSO-d 6) δ ppm 1.81 (m, 6 H) 3.85 (m, 1 H) 6.84 (s, 1 H) 7.49 (d, J = 5.15 Hz, 1 H) 7.55 (t, J = 7.91 Hz, 1 H) 7.62 (d, J = 8.09 Hz, 1 H) 7.78 (t, J = 7.91 Hz , 7.93 (d, J = 8.09 Hz, 1 H) 8.33 (d, J = 5.15 Hz, 1 H) 14.21 (s, 1 H) 14.82 (s, 1H). MS (ESI-) m / z 415 (M-H) -.

Exemplo 290A 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[fenilmetileno]amino}tieno[3,2-b]pirldin-5(AH)-ona O produto do Exemplo 268D (0,115 g, 0,30 mmol) reagiu com benzaldeído (0,32 g, 3,0 mmol) em N,N-dimetilacetamida (2 mL) num tubo selado a 135°C durante 50 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O residuo resultante foi triturado com HC1 0,1M (20 mL) e filtrado para gerar o composto em titulo.Example 290A 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[phenylmethylene] amino} thieno [3,2- b] pyridine- The product of Example 268D (0.115 g, 0.30 mmol) was reacted with benzaldehyde (0.32 g, 3.0 mmol) in N, N-dimethylacetamide (2 mL) in a sealed tube at 135 ° C for 50 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with 0.1M HCl (20 mL) and filtered to give the title compound.

Exemplo 290B 4-(benzilamino)-6-(1, l-dioxido-4H-l, 2, 4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4ff)-ona O produto do Exemplo 269A (0,116 g, 0,257 mmol) em tetra-hidrofurano (5 mL) e metanol (0,021 mL, 0,514 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de litio em tetra-hidrofurano (0,19 mL, 0,386 mmol). A reacção foi agitada a 25°C durante 2 horas, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (20 mL) e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-de) δ ppm 3,97 (d, J=5,54 Hz, 2H) 6,17 (t, J=6,43 Hz, 1H) 7,08 (d, J=5,52 Hz, 1H) 7,21 (d, J=8,09 Hz, 1H) 7,33 (m, 4H) 7,47 (d, J=6,62 Hz, 2H) 7,55 (t, J=6,99 Hz, 1H) 7,66 (d, J=7,35 Hz, 1H) 7,73 (d, J=5,52 Hz, 1H) 15,92 (s, 1H). MS (ESI-) m/z 451 (M-H)-.Example 290B 4- (benzylamino) -6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4 H) -one The product of Example 269A (0.116 g, 0.257 mmol) in tetrahydrofuran (5 mL) and methanol (0.021 mL, 0.514 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.19 mL, 0.386 mmol). The reaction was stirred at 25 ° C for 2 hours, acidified with 1M hydrochloric acid at a pH of approximately 2-4, diluted with water (20 mL) and the resulting precipitate was collected by filtration and dried to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.97 (d, J = 5.54 Hz, 2 H) 6.17 (t, J = 6.43 Hz, 1 H) 7.08 (d, 5.52 Hz, 1 H) 7.21 (d, J = 8.09 Hz, 1 H) 7.33 (m, 4H) 7.47 (d, J = 6.62 Hz, 2 H) 7.55 (t , J = 6.99 Hz, 1 H) 7.66 (d, J = 7.35 Hz, 1 H) 7.73 (d, J = 5.52 Hz, 1 H) 15.92 (s, 1H). MS (ESI-) m / z 451 (M-H) -.

Exemplo 291A 4-{ [ciclo-hexilmetileno] amino}-6- (1, l-dioxido-4fí-l, 2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,115 g, 0,30 mmol) reagiu com ciclo-hexanocarbaldeído (0,336 g, 3,0 mmol) em N,N-dimetilacetamida (3 mL) num tubo selado a 135°C durante 60 minutos 290 ΕΡ 1 560 827/ΡΤ num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com HC1 0,1M (20 mL) e filtrado para gerar o composto em título.Example 291A 4 - {[cyclohexylmethylene] amino} -6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4H) -one The product of Example 268D (0.115 g, 0.30 mmol) was reacted with cyclohexanecarbaldehyde (0.336 g, 3.0 mmol) in N, N-dimethylacetamide (3 mL) in a sealed tube at 135 ° C for 60 minutes 290 ÅΡ 1 560 827 / ΡΤ in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with 0.1M HCl (20 mL) and filtered to give the title compound.

Exemplo 291B 4-[(ciclo-hexilmetil)amino]-6-(1,l-dioxido-4ff-l,2,4-benzo-tiadiazin-3-il) -7-hidroxitieno [3,2 —io] piridin-5 (4H) -ona O produto do Exemplo 269A (0,12 g, 0,26 mmol) em tetra-hidrofurano (5 mL) e metanol (0,021 mL, 0,52 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,195 mL, 0,39 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em silica gel com diclorometano/metanol 97:3 para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ ppm 1,04 (m, 2H) 1,23 (m, 3H) 1,52 (m, I H) 1,68 (m, 3H) 1,87 (m, 2H) 2,69 (m, 2H) 5,95 (t, J=7,17 Hz, 1H) 7,07 (d, J=5,52 Hz, 1H) 7,19 (d, J=8,09 Hz, 1H) 7,26 (t, J=7,72 Hz, 1H) 7,53 (t, J=7,17 Hz, 1H) 7,65 (d, J=6,99 Hz, 1H) 7,78 (d, J=5,15 Hz, 1H) 15,91 (s, 1H). MS (APCI+) m/z 459 (M+H)+.Example 291B 4 - [(cyclohexylmethyl) amino] -6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-a] pyridine -5- (4H) -one The product of Example 269A (0.12 g, 0.26 mmol) in tetrahydrofuran (5 mL) and methanol (0.021 mL, 0.52 mmol) at 0 ° C was treated dropwise with dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.195 mL, 0.39 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 97: 3 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d6) δ ppm 1.04 (m, 2H) 1.23 (m, 3H) 1.52 (m, 1H) 1.68 (m, 3H) 1.87 (m, J = 7.17 Hz, 1 H) 7.07 (d, J = 5.52 Hz, 1 H) 7.19 (d, J = 8, J = 7.72 Hz, 1 H) 7.53 (t, J = 7.17 Hz, 1 H) 7.65 (d, J = 6.99 Hz, 1 H) 7.78 (d, J = 5.15 Hz, 1 H) 15.91 (s, 1H). MS (APCI +) m / z 459 (M + H) +.

Exemplo 292A 6-(1,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{ [1,3-tiazol-5-ilmetileno]amino}tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,115 g, 0,30 mmol) reagiu com 1,3-tiazole-5-carbaldeído (0,35 g, 3,0 mmol) em N,N-dimetil-acetamida (3 mL) num tubo selado a 140°C durante 80 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com HC1 0,1M (20 mL) e filtrado para gerar o composto em título.Example 292A 6- (1,1-dioxido-4fl-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[1,3-thiazol-5-ylmethylene] amino} thieno [ The product from Example 268D (0.115 g, 0.30 mmol) was reacted with 1,3-thiazole-5-carbaldehyde (0.35 g, 3.0 mmol) in N , N-dimethylacetamide (3 mL) in a sealed tube at 140 ° C for 80 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with 0.1M HCl (20 mL) and filtered to give the title compound.

Exemplo 292B 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-[(1,3-tiazol-5-ilmetil)amino]tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,137 g, 0,30 mmol) em tetra-hidrofurano (7 mL) e metanol (0,025 mL, 0,6 mmol) a 0°C foi 291Example 292B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - [(1,3-thiazol-5-ylmethyl) amino] thieno [ 2-b] pyridin-5 (4H) -one The product of Example 269A (0.137 g, 0.30 mmol) in tetrahydrofuran (7 mL) and methanol (0.025 mL, 0.6 mmol) at 0 ° C was 291

ΕΡ 1 560 827/PT tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,225 mL, 0,45 mmol). A reacção foi agitada a 25°C durante 2 horas, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (20 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano/metanol 95:5 para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ ppm 4,34 (m, 2H) 6,45 (t, J=5,52 Hz, 1H) 6,97 (d, J=5,15 Hz, 1H) 7,20 (d, J=8,09 Hz, 1H) 7,27 (t, J=,54 Hz, 1H) 7,54 (t, J=7, 17 Hz, 1H) 7,66 (d, J=7,72 Hz, 1H) 7,70 (d,And treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.225 mL, 0.45 mmol). The reaction was stirred at 25 ° C for 2 hours, acidified with 1M hydrochloric acid at a pH of approximately 2-4, diluted with water (20 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 95: 5 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. (D, J = 5.15 Hz, 1 H), 6.97 (d, J = 1H), 7.20 (d, J = 8.09 Hz, 1 H) 7.27 (t, J = J = 7.72 Hz, 1 H) 7.70 (d,

J=5,52 Hz, 1H) 7,79 (s, 1H) 9,02 (s, 1H) 15,87 (s, 1H) . MS (ESI-) m/z 458 (Μ-ΗΓ.J = 5.52 Hz, 1 H) 7.79 (s, 1 H) 9.02 (s, 1 H) 15.87 (s, 1H). MS (ESI-) m / z 458 (Μ-ΗΓ.

Exemplo 293A 4—{[(3-bromofenil)metileno]amino}-6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4ff)-ona O produto do Exemplo 268D (0,115 g, 0,30 mmol) reagiu com 3- bromobenzaldeído (0,555 g, 3,0 mmol) em N,N-dimetilacetamida (2 mL) num tubo selado a 135°C durante 30 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com acetato de etilo (3 mL) e filtrado para gerar o composto em título.Example 293A 4 - {[(3-bromophenyl) methylene] amino} -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2- b] The product from Example 268D (0.115 g, 0.30 mmol) was reacted with 3-bromobenzaldehyde (0.555 g, 3.0 mmol) in N, N-dimethylacetamide (2 mL) in a sealed tube at 135 ° C for 30 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with ethyl acetate (3 mL) and filtered to give the title compound.

Exemplo 293B 4- [(3-bromobenzil)amino]-6-(1,l-dioxido-4ff-l, 2,4-benzo-tiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,13 g, 0,245 mmol) em tetra-hidrofurano (4 mL) e metanol (0,015 mL, 0,36 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,15 mL, 0,30 mmol). A reacção foi agitada a 25°C durante 2 horas, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (15 mL) e o precipitado resultante foi recolhido por filtração e seco para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 4,02 (m, 2H) 6,27 (t, J=6,25 Hz, 1H) 7,08 (d, J=5,15 Hz, 1H) 7,20 (d, J=8,46 Hz, 1H) 7,28 (t, J=7,72 Hz, 1H) 7,32 (t, J=6,99 Hz, 1H) 292 ΕΡ 1 560 827/ΡΤ 7,46 (d, J=7, 72 Hz, 1H) 7,54 (m, 2H) 7,67 (m, 2H) 7,73 (d, J=5,15 Hz, 1H) 15,90 (S, 1H) . MS (ESI-) m/z 529/531 (M-H)~.Example 293B 4 - [(3-bromobenzyl) amino] -6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2- b] pyridine -5- (4H) -one The product of Example 269A (0.13 g, 0.245 mmol) in tetrahydrofuran (4 mL) and methanol (0.015 mL, 0.36 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.15 mL, 0.30 mmol). The reaction was stirred at 25 ° C for 2 hours, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL) and the resulting precipitate was collected by filtration and dried to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 4.02 (m, 2 H) 6.27 (t, J = 6.25 Hz, 1 H) 7.08 (d, J = 5.15 Hz, 7.20 (d, J = 8.46 Hz, 1 H) 7.28 (t, J = 7.72 Hz, 1 H) 7.32 (t, J = 6.99 Hz, 1 H) Δ 7.46 (d, J = 7.72 Hz, 1 H) 7.54 (m, 2 H) 7.67 (m, 2 H) 7.73 (d, J = 5.15 Hz, 90 (S, 1H). MS (ESI-) m / z 529/531 (M-H) -.

Exemplo 294A 4- (ciclo-hexilidenoamino) -6- (1, l-dioxido-4fí-l, 2, 4-benzo-tiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,054 g, 0,15 mmol) reagiu com ciclo-hexanona (0,44 g, 4,5 mmol) em N,N-dimetilacetamida (1 mL) num tubo selado a 135°C durante 45 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico (3 mL) e filtrado para gerar o composto em titulo.Example 294A 4- (cyclohexylideneamino) -6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5- 4H) -one The product of Example 268D (0.054 g, 0.15 mmol) was reacted with cyclohexanone (0.44 g, 4.5 mmol) in N, N-dimethylacetamide (1 mL) in a sealed tube at 135ø C for 45 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.

Exemplo 294B 4- (ciclo-hexilamino) -6- (1, l-dioxido-4i7-l, 2, 4-benzotiadiazin-3-il)-7-hidroxitieno[3,2—b]piridin-5(4H)-ona O produto do Exemplo 269A (0,051 g, 0,115 mmol) em tetra-hidrofurano (5 mL) e metanol (0,01 mL, 0,23 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,090 mL, 0,175 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (10 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano/metanol 97:3 para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ rmn (300 MHz, DMSO-d6) δ ppm 1,16 (m, 5H) 1,59 (m, 5H) 3,01 (m, 1H) 5,75 (d, J=3,31 Hz, 1H) 7,15 (d, J=5,52 Hz, 1H) 7,19 (d, J=7,72 Hz, 1H) 7,26 (t, J=7,54 Hz, 1H) 7,54 (m, 1H) 7,65 (d, J=7,72 Hz, 1H) 7,72 (d, J=5,52 Hz, 1H) 15,93 (s, 1H). MS (ESI-) m/z 443 (M-H)'.Example 294B 4- (cyclohexylamino) -6- (1,1-dioxido-4,7-1,2-4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2- b] pyridin-5 (4H) -one The product of Example 269A (0.051 g, 0.115 mmol) in tetrahydrofuran (5 mL) and methanol (0.01 mL, 0.23 mmol) at 0 ° C was treated dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.090 mL, 0.175 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of approximately 2-4, diluted with water (10 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 97: 3 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. Δ (300 MHz, DMSO-d 6) δ ppm 1.16 (m, 5H) 1.59 (m, 5H) 3.01 (m, 1H) 5.75 (d, J = 3.31 Hz, 1H ) 7.15 (d, J = 5.52 Hz, 1 H) 7.19 (d, J = 7.72 Hz, 1 H) 7.26 (t, J = m, 1H) 7.65 (d, J = 7.72 Hz, 1 H) 7.72 (d, J = 5.52 Hz, 1 H) 15.93 (s, 1H). MS (ESI-) m / z 443 (M-H) +.

Exemplo 295A 4-(ciclopentilidenoamino)-6-(1,l-dioxido-4H-l, 2,4-benzo-tiadiazin-3-il) - 7-hidroxitieno [3,2 —io] piridin-5 (4H) -ona O produto do Exemplo 268D (0,054 g, 0,15 mmol) reagiu com ciclopentanona (0,95 g, 11,3 mmol) em N,N-dimetilacetamida (1 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada 293 ΕΡ 1 560 827/ΡΤ sob vácuo. Ο resíduo resultante foi triturado com éter dietílico (3 mL) e filtrado para gerar o composto em título.Example 295A 4- (cyclopentylideneamino) -6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-a] pyridin-5 (4H) -one The product of Example 268D (0.054 g, 0.15 mmol) was reacted with cyclopentanone (0.95 g, 11.3 mmol) in N, N-dimethylacetamide (1 mL) in a sealed tube at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25øC and concentrated to 293 æg 1560 827 / ΡΤ under vacuum. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.

Exemplo 295B 4-(ciclopentilamino)-6-(1,l-dioxido-4fl-l,2, 4-benzotiadiazin- 3- il)-7-hidroxitieno[3/2 —b]piridin-5(4H)-ona O produto do Exemplo 269A (0,040 g, 0,09 mmol) em tetra-hidrofurano (3 mL) e metanol (0, 008 mL, 0,19 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,07 mL, 0,14 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (10 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano/metanol 98:2 para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1R RMN (300 MHz, DMSO-de) δ ppm 1,54 (m, 6H) 1,74 (m; 2 H) 3,75 (m, 1H) 5,77 (d, J=3,68 Hz, 1H) 7,12 (d, J=5,15 Hz, 1H) 7,19 (d, J=7,72 Hz, 1H) 7,26 (t, -J=7,17 Hz, 1H) 7,54 (m, 1H) 7,64 (d, J=7,72 Hz, 1H) 7,74 (d, J=5, 52 Hz, 1H) 15,91 (s, 1H) . MS (ESI-) m/z 429 (M-H)~.Example 295B 4- (Cyclopentylamino) -6- (1,1-dioxido-4,11,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4H) -one The product of Example 269A (0.040 g, 0.09 mmol) in tetrahydrofuran (3 mL) and methanol (0.008 mL, 0.19 mmol) at 0 ° C was treated dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.07 mL, 0.14 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of approximately 2-4, diluted with water (10 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 98: 2 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.54 (m, 6H) 1.74 (m, 2 H) 3.75 (m, 1 H) 5.77 (d, J = 3.68 Hz, 1H), 7.12 (d, J = 5.15 Hz, 1 H) 7.19 (d, J = 7.72 Hz, 1 H) 7.26 (t, 54 (m, 1 H) 7.64 (d, J = 7.72 Hz, 1 H) 7.74 (d, J = 5.52 Hz, 1 H) 15.91 (s, 1H). MS (ESI-) m / z 429 (M-H) -.

Exemplo 296A 4- (ciclo-heptilidenoamino)-6-(1, l-dioxido-4ff-l, 2, 4-benzo-tiadiazin-3-il)-7-hidroxitieno[3, 2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,054 g, 0,15 mmol) reagiu com ciclo-heptanona (0,84 g, 7,5 mmol) em Ν,Ν-dimetilacetamida (1 mL) num tubo selado a 135°C durante 45 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico (3 mL) e filtrado para gerar o composto em título.Example 296A 4- (Cycloheptylideneamino) -6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5- 4H) -one The product of Example 268D (0.054 g, 0.15 mmol) was reacted with cycloheptanone (0.84 g, 7.5 mmol) in δ, δ-dimethylacetamide (1 mL) in a sealed tube at 135ø C for 45 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.

Exemplo 296B 4-(ciclo-heptilamino)-6-(1,l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,06 g, 0,13 mmol) em tetra-hidrofurano (4 mL) e metanol (0,011 mL, 0,26 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de 294 ΕΡ 1 560 827/ΡΤ lítio em tetra-hidrofurano (0,10 mL, 0,2 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (10 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano/metanol 98:2 para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-de) δ ppm 1,35 (m, 4H) 1,50 (m, 4H) 1,64 (m, 3H) 1,86 (m, 1H) 2,56 (m, 1H) 5,62 (d, J=2,94 Hz, 1H) 7,12 (d, J=5,52 Hz, 1H) 7,19 (d, J=8, 09 Hz, 1H) 7,26 (t, J=7,54 Hz, 1H) 7,53 (m, 1H) 7,64 (d, J=7,72 Hz, 1H) 7,72 (d, J=5,15 Hz, 1H) 15,92 (s, 1H). MS (ESI-) m/z 457 (M-H)'.Example 296B 4- (cycloheptylamino) -6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2- b] pyridin-5 (4H) -one The product of Example 269A (0.06 g, 0.13 mmol) in tetrahydrofuran (4 mL) and methanol (0.011 mL, 0.26 mmol) at 0 ° C was treated dropwise with a solution 2 , 29M Ρ ES60O 560 827 / ΡΤ lithium borohydride in tetrahydrofuran (0.10 mL, 0.2 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of approximately 2-4, diluted with water (10 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 98: 2 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d6) δ ppm 1.35 (m, 4H) 1.50 (m, 4H) 1.64 (m, 3H) 1.86 (m, 1H) 2.56 (m, 1H), 5.62 (d, J = 2.94 Hz, 1 H) 7.12 (d, J = 5.52 Hz, 1 H) 7.19 (d, J = (d, J = 5.15 Hz, 1 H) 7.72 (d, J = 5.15 Hz, 1 H) 7.63 (m, 15.92 (s, 1H). MS (ESI-) m / z 457 (M-H) +.

Exemplo 297A 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{ [3-metilciclo-hexilideno] amino}tieno [3,2-b] piridin-5 (4ff) -ona O produto do Exemplo 268D (0,054 g, 0,15 mmol) reagiu com 3- metilciclo-hexanona (1,26 g, 11,25 mmol) em N,N-dimetil-acetamida (1 mL) num tubo selado a 135°C durante 45 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico (3 mL) e filtrado para gerar o composto em título.Example 297A 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[3-methylcyclohexylidene] amino} thieno [3,2- b] The product of Example 268D (0.054 g, 0.15 mmol) was reacted with 3-methylcyclohexanone (1.26 g, 11.25 mmol) in N, N-dimethylacetamide (1 mL) in a sealed tube at 135 ° C for 45 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.

Exemplo 297B 6-(1, l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-7-hidroxi- 4- {[3-metilciclo-hexil]amino}tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,060 g, 0,13 mmol) em tetra-hidrofurano (4 mL) e metanol (0,011 mL, 0,26 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,1 mL, 0,20 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (10 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano/metanol 98:2 para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. :Η RMN (300 MHz, DMSO-d6) δ ppm 0,86 (m, 4H) 1,08 (m, 1H) 1,29 (m, 3H) 1,60 (m, 295Example 297B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[3-methylcyclohexyl] amino} thieno [3,2- b] pyridine-5 (4H) -one The product of Example 269A (0.060 g, 0.13 mmol) in tetrahydrofuran (4 mL) and methanol (0.011 mL, 0.26 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.1 mL, 0.20 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of approximately 2-4, diluted with water (10 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 98: 2 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ ppm 0.86 (m, 4H) 1.08 (m, 1H) 1.29 (m, 3H) 1.60 (m, 295

ΕΡ 1 560 827/PT 3Η) 1,93 (m, 1H) 3,04 (m, 1H) 5,76 (d, J=3,31 Hz, 1H) 7,14 (d, J=5,52 Hz, 1H) 7,19 (d, J=8,46 Hz, 1H) 7,26 (t, J=7,54 Hz, 1H) 7,52 (dt, J=8,46, 1, 47 Hz, 1H) 7,65 (d, J=8,09 Hz, 1H) 7,73 (t, J=5,15 Hz, 1H) 15,93 (s, 1H). MS (ESI-) m/z 457 (M-H)&quot;.(D, J = 3.31 Hz, 1 H) 7.14 (d, J = 5.52 (m, 1 H) 1H), 7.26 (t, J = 7.54 Hz, 1 H) 7.52 (dt, J = 8.46, 1.47 Hz, , 1H), 7.65 (d, J = 8.09 Hz, 1 H), 7.73 (t, J = 5.15 Hz, 1 H) 15.93 (s, 1H). MS (ESI-) m / z 457 (M-H) &quot;.

Exemplo 298A 6- (1, l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il) -7-hidroxi-4-{[(3R)-3-metilciclo-hexilideno]amino}tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,073 g, 0,2 mmol) reagiu com (3R)-3-metilciclo-hexanona (1,12 g, 10,0 mmol) em N,N-dimetil-acetamida (2 mL) num tubo selado a 135°C durante 45 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietilico (3 mL) e filtrado para gerar o composto em titulo.Example 298A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[(3 R) -3-methylcyclohexylidene] amino} thieno [ 2-b] pyridin-5 (4H) -one The product of Example 268D (0.073 g, 0.2 mmol) was reacted with (3R) -3-methylcyclohexanone (1.12 g, 10.0 mmol) in N , N-dimethylacetamide (2 mL) in a sealed tube at 135 ° C for 45 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.

Exemplo 298B 6-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[(3R)-3-metilciclo-hexil]amino}tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,06 g, 0,13 mmol) em tetra-hidrofurano (6 mL) e metanol (0,011 mL, 0,26 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,1 mL, 0,2 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (10 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano/metanol 98:2 para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ ppm 0,86 (m, 4H) 1,08 (m, 1H) 1,29 (m, 3H) 1,60 (m, 3H) 1,93 (m, 1H) 3,04 (m, 1H) 5,76 (d, J=3,31 Hz, 1H) 7,14 (d, J=5,52 Hz, 1H) 7,19 (d, J=8,46 Hz, 1H) 7,26 (t, J=7,54 Hz, 1H) 7,52 (dt, J=8,46, 1,47 Hz, 1H) 7,65 ((d, J=8,09 Hz, 1H) 7,73 (t, J=5,15 Hz, 1H) 15,93 (s, 1H). MS (ESI-) m/z 457 (M-H)&quot;.Example 298B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[(3 R) -3-methylcyclohexyl] amino} thieno [ 2-b] pyridin-5 (4H) -one The product of Example 269A (0.06 g, 0.13 mmol) in tetrahydrofuran (6 mL) and methanol (0.011 mL, 0.26 mmol) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.1 mL, 0.2 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of approximately 2-4, diluted with water (10 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 98: 2 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.86 (m, 4H) 1.08 (m, 1H) 1.29 (m, 3H) 1.60 (m, 3H) 1.93 (m, 7.14 (d, J = 5.32 Hz, 1 H) 7.14 (d, J = 3.31 Hz, 1 H) 1H), 7.26 (t, J = 7.54 Hz, 1 H) 7.52 (dt, J = 8.46, 1.47 Hz, 9 Hz, 1 H) 7.73 (t, J = 5.15 Hz, 1 H) 15.93 (s, 1H) MS (ESI-) m / z 457 (MH) &quot;.

Exemplo 299A 6-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-[(1-etil-propilideno)amino]-7 hidroxitieno[3,2-b]piridin-5(4H)-ona 296 ΕΡ 1 560 827/ΡΤ Ο produto do Exemplo 268D (0,073 g, 0,2 mmol) reagiu com pentan-3-ona (0,86 g, 10,0 mmol) em N,N-dimetilacetamida (2 mL) num tubo selado a 135°C durante 40 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico (3 mL) e filtrado para gerar o composto em título.Example 299A 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -4 - [(1-ethyl-propylidene) amino] -7-hydroxythieno [3,2- b] The product of Example 268D (0.073 g, 0.2 mmol) was reacted with pentan-3-one (0.86 g, 10.0 mmol) in N, N-dimethylformamide dimethylacetamide (2 mL) in a sealed tube at 135 ° C for 40 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.

Exemplo 299B 6-(1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-[(1-etil-propil)amino]-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 269A (0,08 g, 0,18 mmol) em tetra- hidrofurano (7 mL) e metanol (0,015 mL, 0,36 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,135 mL, 0,27 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (10 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano/metanol 98:2 para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1E RMN (300 MHz, DMSO-de) δ ppm 0,87 (m, 6H) 1,29 (m, 4H) 3,03 (m, 1H) 5,76 (d, J=3,68 Hz, 1H) 7,12 (d, J=5,52 Hz, 1H) 7,19 (d, J=8,46 Hz, 1H) 7,26 (t, J=6,99 Hz, 1H) 7,54 (m, 1H) 7,65 (d, 0=1,12 Hz, 1H) 1,1 A (d, J=5,15 Hz, 1H) 15,95 (s, 1H). MS (ESI-) m/z 431 (M-H)”.Example 299B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4 - [(1-ethyl-propyl) amino] -7-hydroxythieno [3,2- b] pyridine -5- (4H) -one The product of Example 269A (0.08 g, 0.18 mmol) in tetrahydrofuran (7 mL) and methanol (0.015 mL, 0.36 mmol) at 0 ° C was treated dropwise with dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.135 mL, 0.27 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of approximately 2-4, diluted with water (10 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 98: 2 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.87 (m, 6H) 1.29 (m, 4H) 3.03 (m, 1H) 5.76 (d, J = 3.68 Hz, 1H ) 7.12 (d, J = 5.52 Hz, 1 H) 7.19 (d, J = 8.46 Hz, 1 H) 7.26 (t, J = 6.99 Hz, m, 1H) 7.65 (d, J = 1.12 Hz, 1 H) 1.1 A (d, J = 5.15 Hz, 1 H) 15.95 (s, 1H). MS (ESI-) m / z 431 (M-H).

Exemplo 300A 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[l-feniletilideno]aminojtieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,073 g, 0,2 mmol) reagiu com 1-feniletanona (1,2 g, 10,0 mmol) em N,N-dimetilacetamida (2 mL) num tubo selado a 135°C durante 75 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico (3 mL) e filtrado para gerar o composto em título.Example 300A 6- (1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[1-phenylethylidene] aminojthieno [3,2- b] pyridin-5- 4H) -one The product of Example 268D (0.073 g, 0.2 mmol) was reacted with 1-phenylethanone (1.2 g, 10.0 mmol) in N, N-dimethylacetamide (2 mL) in a sealed tube at 135ø C for 75 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.

Exemplo 300B 6-(1, l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[1-feniletil]amino}tieno[3,2-b]piridin-5(AH)-ona 297 ΕΡ 1 560 827/ΡΤ Ο produto do Exemplo 269Α (0,046 g, 0,10 mmol) em tetra-hidrofurano (5 mL) e metanol (0, 005 mL, 0,12 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,06 mL, 0,12 mmol). A reacção foi agitada a 25 °C durante 3 horas, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (10 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano/metanol 99:1 para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMS0-d6) δ ppm 1,26 (m, 3H) 4,49 (m, 1H) 5,90 (m, 1H) 7,20 (d, J=8,09 Hz, 1H) 7,27 (t, J=8,46 Hz, 2H) 7,30 (m, 5H) 7,54 (m, 2H) 7,66 (d, J=8, 09 Hz, 1H) 15,93 (s, 1H) . MS (ESI-) m/z 465 (M-H)'.Example 300B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[1-phenylethyl] amino} thieno [3,2- b] pyridin- (0.046 g, 0.10 mmol) in tetrahydrofuran (5 mL) and methanol (0.005 mL, 0.12 mmol) at 0 DEG C. ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.06 mL, 0.12 mmol). The reaction was stirred at 25 ° C for 3 hours, acidified with 1 M hydrochloric acid to a pH of approximately 2-4, diluted with water (10 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 99: 1 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.26 (m, 3H) 4.49 (m, 1H) 5.90 (m, 1H) 7.20 (d, J = 8.09 Hz, 1H ) 7.27 (t, J = 8.46 Hz, 2 H) 7.30 (m, 5H) 7.54 (m, 2 H) 7.66 (d, J = 8.9 Hz, 1 H) 15.93 (s, 1H). MS (ESI-) m / z 465 (M-H) +.

Exemplo 301A 6-(1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{ [1-metilbutilideno] amino}tieno [3, 2-b]piridin-5 (4ff) -ona O produto do Exemplo 268D (0,073 g, 0,2 mmol) reagiu com pentan-2-ona (0,9 g, 10,4 mmol) em N,N-dimetilacetamida (2 mL) num tubo selado a 135°C durante 60 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico (3 mL) e filtrado para gerar o composto em título.Example 301A 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[1-methylbutylidene] amino} thieno [3,2- b] pyridin- The product of Example 268D (0.073 g, 0.2 mmol) was reacted with pentan-2-one (0.9 g, 10.4 mmol) in N, N-dimethylacetamide (2 mL) in a tube sealed at 135 ° C for 60 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.

Exemplo 301B 6-(1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-7-hidroxi-4-{[1-metilbutil]amino}tieno[3,2-b]piridin-5(AH)-ona O produto do Exemplo 269A (0,070 g, 0,16 mmol) em tetra-hidrofurano (mL) e metanol (0,013 mL, 0,32 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,12 mL, 0,24 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (10 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com diclorometano/metanol 99:1 para gerar o composto em título. O sal de sódio do composto em título foi preparado de 298 ΕΡ 1 560 827/ΡΤ acordo com ο procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 0,87 (m, 6H) 1,30 (m, 4H) 3,25 (m, 1H) 5,74 (d, J=3,68 Hz, 1H) 7,13 (d, J=5,15 Hz, 1H) 7,19 (d, J=8,09 Hz, 1H) 7,26 (t, J=7,54 Hz, 1H) 7,54 (dd, J=8, 09, 1, 47 Hz, 1H) 7,65 (d, J=7, 72 Hz, 1H) 7,73 (d, J=5,52 Hz, 1H) 15,94 (s, 1H) . MS (ESI-) m/z 431 (M-H)~.Example 301B 6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxy-4 - {[1-methylbutyl] amino} thieno [3,2- b] pyridin- 5 (AH) -one The product of Example 269A (0.070 g, 0.16 mmol) in tetrahydrofuran (mL) and methanol (0.013 mL, 0.32 mmol) at 0 ° C was treated dropwise with a solution 2.0M lithium borohydride in tetrahydrofuran (0.12 mL, 0.24 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of approximately 2-4, diluted with water (10 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane / methanol 99: 1 to give the title compound. The sodium salt of the title compound was prepared from 298Âμl 1 560 827 / ΡΤ according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.87 (m, 6H) 1.30 (m, 4H) 3.25 (m, 1H) 5.74 (d, J = 3.68 Hz, 1H ) 7.13 (d, J = 5.15 Hz, 1 H) 7.19 (d, J = 8.09 Hz, 1 H) 7.26 (t, J = dd, J = 8.9, 1.47 Hz, 1 H) 7.65 (d, J = 7.72 Hz, 1 H) 7.73 (d, J = 5.52 Hz, 1 H) 15.94 , 1H). MS (ESI-) m / z 431 (M-H) -.

Exemplo 303A 4-{[ciclopropilmetileno]amino}-6-(1, l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 268D (0,15 g, 0,41 mmol) reagiu com ciclopropanocarbaldeído (1,0 g, 14 mmol) em N,N-dimetil-acetamida (3 mL) num tubo selado a 120°C, durante 90 minutos num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob vácuo. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,104 g, 60%).Example 303A 4 - {[cyclopropylmethylene] amino} -6- (1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -7-hydroxythieno [3,2- b] pyridin-5 (4H ) The product of Example 268D (0.15 g, 0.41 mmol) was reacted with cyclopropanecarbaldehyde (1.0 g, 14 mmol) in N, N-dimethylacetamide (3 mL) in a sealed tube at 120 ° C , for 90 minutes in a microwave reactor. The reaction was cooled to 25 ° C and concentrated in vacuo. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.104 g, 60%).

Exemplo 303B 4-[(ciclopropilmetil)amino]-6-(1,l-dioxido-4fl-l,2,4-benzo- tiadiazin-3-il)-7-hidroxitieno[3,2-b]piridin-5(4H)-onaExample 303B 4 - [(cyclopropylmethyl) amino] -6- (1,1-dioxido-4,11,2-benzothiadiazin-3-yl) -7-hydroxythieno [3,2-b] pyridin-5 (4H) -one

O produto do Exemplo 269A (0,104 g, 0,25 mmol) em tetra-hidrofurano (4 mL) e metanol (0,020 mL, 0,5 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,200 mL, 0,4 mmol). A reacção foi agitada a 25°C durante 1 hora, acidificada com ácido clorídrico 1M a um pH de aproximadamente 2-4, diluída com água (20 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 1% de metanol em clorofórmio para gerar o composto em título. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ ppm 0,06 (m, 2H) 0,36 (m, 2H) 0,96 (m, 1H) 2,92 (d, J=6,99 Hz, 2H) 6,75 (s, 1H) 7,53 (d, J=5,52 Hz, 1H) 7,55 (m, 1H) 7,63 (d, J=8,09 Hz, 1H) 7,77 (m, 1H) 7,92 (d, J=7,72 Hz, 1H) 8,33 (d, J=5,52 Hz, 1H) 14,19 (s, 1H) 14,82 (s, 1H) . MS (ESI-) m/z 415 (M-H)'. 299 ΕΡ 1 560 827/ΡΤThe product of Example 269A (0.104 g, 0.25 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C was treated dropwise with a 2.0M solution of boron in tetrahydrofuran (0.200 mL, 0.4 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of approximately 2-4, diluted with water (20 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.06 (m, 2 H) 0.36 (m, 2 H) 0.96 (m, 1 H) 2.92 (d, J = 6.99 Hz, 2H ) 6.75 (s, 1 H) 7.53 (d, J = 5.52 Hz, 1 H) 7.55 (m, 1 H) 7.63 (d, J = 8.09 Hz, 1 H) 7.77 (d, J = 7.72 Hz, 1 H) 8.33 (d, J = 5.52 Hz, 1 H) 14.19 (s, 1 H) 14.82 (s, 1H ). MS (ESI-) m / z 415 (M-H) +. 299 ΕΡ 1 560 827 / ΡΤ

Exemplo 304Α 4-(benziloxi)-2-fluoro-l-nitrobenzeno 3-Fluoro-4-nitro-fenol (10 g, 0,064 mol) reagiu com brometo de benzilo (8,3 ml; 0,070 mol), carbonato de césio (22,7 g, 0,07 mol) e iodeto de tetrabutilamónio (0,05 g) em N,N-dimetilformamida (100 mL) a 25°C durante 18 horas. A mistura reaccional foi vertida em água destilada água (500 mL) e agitada durante 10 minutos. A mistura reaccional foi extraída com acetato de etilo (3 χ 200 mL) . Os extractos orgânicos combinados foram lavados com salmoura, secos sobre sulfato de sódio anidro, filtrados e o solvente removido sob pressão reduzida para gerar o composto em título como um sólido amarelo claro (15 g) . :Η RMN (300 MHz, DMSO-dô) δ ppm 5,27 (s, 2H) 7,06 (dd, J=9,56, 2,57 ,Ηζ, 1H) 7,29 (dd, J=13,60 2,57 Hz, 1H) 7,44 (m, 5H) 8,17 (t, J=9,19 Hz, 1H) . ESI m/z (M+H)+: 248.Example 304 4- (Benzyloxy) -2-fluoro-1-nitrobenzene 3-Fluoro-4-nitrophenol (10 g, 0.064 mol) was reacted with benzyl bromide (8.3 mL, 0.070 mol), cesium carbonate 22.7 g, 0.07 mol) and tetrabutylammonium iodide (0.05 g) in N, N-dimethylformamide (100 mL) at 25 ° C for 18 hours. The reaction mixture was poured into distilled water (500 mL) and stirred for 10 minutes. The reaction mixture was extracted with ethyl acetate (3 x 200 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered and the solvent removed under reduced pressure to give the title compound as a light yellow solid (15 g). NMR (300 MHz, DMSO-d6) δ ppm 5.27 (s, 2H) 7.06 (dd, J = 9.56, 2.57, δ, 1H) 7.29 (dd, J = 13). , 60 2.57 Hz, 1 H) 7.44 (m, 5 H) 8.17 (t, J = 9.19 Hz, 1 H). ESI m / z (M + H) +: 248.

Exemplo 304B 4-(benziloxi)-2-(benziltio)-1-nitrobenzenoExample 304B 4- (Benzyloxy) -2- (benzylthio) -1-nitrobenzene

Uma lama do produto do Exemplo 304A (15 g, 0,061 mol) em etanol (100 mL), foi tratada com carbonato de sódio (6,41 g, 0,061 mol) e mercaptano de benzilo (7,5 mL, 0,058 mol) em água (50 mL) . A mistura reaccional foi refluxada durante 5 horas, arrefecida até 25°C e vertida em água destilada (800 mL) . A lama resultante foi agitada durante 1 hora a 25°C e filtrada. O resultante sólido amarelo foi lavado com água e seco numa estufa de vácuo a 50°C para gerar o composto em título (20,53 g) . XH RMN (300 MHz, DMSO-d6) δ ppm 4,35 (s, 2H) 5,27 (s, 2H) 7,02 (dd, J=9,19, 2,57 Hz, 1H) 7,16 (d, J=2,57 Hz, 1H) 7,40 (m, 10H) 8,24 (d, J=9,19 Hz, 1H). ESI m/z (M+H)+: 352.A slurry of the product of Example 304A (15 g, 0.061 mol) in ethanol (100 mL) was treated with sodium carbonate (6.41 g, 0.061 mol) and benzyl mercaptan (7.5 mL, 0.058 mol) in water (50 mL). The reaction mixture was refluxed for 5 hours, cooled to 25 ° C and poured into distilled water (800 mL). The resulting slurry was stirred for 1 hour at 25 ° C and filtered. The resulting yellow solid was washed with water and dried in a vacuum oven at 50 ° C to give the title compound (20.53 g). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 4.35 (s, 2H) 5.27 (s, 2H) 7.02 (dd, J = 9.19, 2.57 Hz, (d, J = 2.57 Hz, 1 H) 7.40 (m, 10 H) 8.24 (d, J = 9.19 Hz, 1 H). ESI m / z (M + H) +: 352.

Exemplo 304C 5-(benziloxi)-2-nitrobenzenossulfonamidaExample 304C 5- (Benzyloxy) -2-nitrobenzenesulfonamide

Uma lama do produto do Exemplo 304B (5 g, 0,014 mol) em ácido acético glacial (50 mL) e água (5,5 mL) a 0°C foi borbulhada com cloro gás durante 10 minutos e agitada durante 30-45 minutos adicionais. A mistura reaccional foi vertida em água gelada (200 g), agitada durante 30 minutos e extraída com diclorometano (2 χ 100 mL) . Os extractos de diclorometano 300 ΕΡ 1 560 827/ΡΤ combinados foram arrefecidos num banho de gelo até aproximadamente 5°C e juntou-se lentamente hidróxido de amónio aquoso concentrado (40 mL), resultando na formação de espuma e borbulhamento à medida que o amoníaco era adicionado. Após 30 minutos, o borbulhamento subsistia, a fase orgânica foi separada e a fase aquosa foi extraída com diclorometano (100 ml). Os extractos orgânicos combinados foram lavados com ácido fosfórico IN (50 mL), salmoura, secos sobre sulfato de magnésio anidro, filtrados e o solvente removido sob pressão reduzida para gerar o composto em título como um sólido branco (3,85 g) . RMN (300 MHz, DMSO-d6) δ ppm 5,28 (s, 2H) 7,44 (m, 6H) 7,63 (d, J=2,94 Hz, 1H) 7,79 (s, 2H) 8,01 (d, J= 8,82 Hz, 1H). ESI m/z (M+H)+ 309.A slurry of the product of Example 304B (5 g, 0.014 mol) in glacial acetic acid (50 mL) and water (5.5 mL) at 0 ° C was bubbled with chlorine gas for 10 minutes and stirred for an additional 30-45 minutes . The reaction mixture was poured into ice water (200 g), stirred for 30 minutes and extracted with dichloromethane (2 x 100 mL). The combined dichloromethane extracts 300 ÅΡ 1 560 827 / foram were cooled in an ice bath to approximately 5øC and concentrated aqueous ammonium hydroxide (40 mL) was slowly added, resulting in the formation of foam and bubbling as the ammonia was added. After 30 minutes the bubbling subsisted, the organic phase was separated and the aqueous phase was extracted with dichloromethane (100 ml). The combined organic extracts were washed with 1N phosphoric acid, brine, dried over anhydrous magnesium sulfate, filtered and the solvent removed under reduced pressure to give the title compound as a white solid (3.85 g). NMR (300 MHz, DMSO-d 6) δ ppm 5.28 (s, 2H) 7.44 (m, 6H) 7.63 (d, J = 2.94 Hz, 8.01 (d, J = 8.82 Hz, 1H). ESI m / z (M + H) + 309.

Exemplo 304D 2-amino-5-(benziloxi)benzenossulfonamida O produto do Exemplo 304C (3,85 g, 0,0125 mol) foi tratado com ferro em pó (4,3 g, 0,077 mol, 6,15 equivalentes) e cloreto de amónio (4,4 g, 0,082 mol) em metanol (100 mL) e água (50 mL) e agitado a refluxo durante 1 hora. A mistura reaccional quente foi filtrada através de papel de filtro de pregas e lavado com metanol quente. O filtrado foi concentrado sob pressão reduzida até um semi-sólido branco que foi repartido entre acetato de etilo e água. A fase orgânica foi lavada com salmoura, seca sobre sulfato de sódio anidro, filtrada e o solvente removido sob pressão reduzida para gerar o composto em título como um sólido esbranquiçado (2,5 g). ΧΗ RMN (300 MHz, DMSO-de) δ ppm 4,98 (s, 2H) 5,46 (s, 2H) 6,76 (d, J= 8,82 Hz, 1H) 7,01 (dd, J= 8, 82, 2, 94 Hz, 1H) 7,21 (d, J= 2,94 Hz, 1H) 7,23 (s, 2H) 7,37 (m, 5H) . ESI m/z (M+H)+ 279. ESI m/z (M-H)&quot; 277.The product of Example 304C (3.85 g, 0.0125 mol) was treated with powdered iron (4.3 g, 0.077 mol, 6.15 equivalents) and chloroform (4.4 g, 0.082 mol) in methanol (100 mL) and water (50 mL) and stirred at reflux for 1 hour. The hot reaction mixture was filtered through pleated filter paper and washed with hot methanol. The filtrate was concentrated under reduced pressure to a white semi-solid which was partitioned between ethyl acetate and water. The organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered and the solvent removed under reduced pressure to give the title compound as an off-white solid (2.5 g). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 4.98 (s, 2H) 5.46 (s, 2H) 6.76 (d, J = 8.82 Hz, = 8.22, 2.94 Hz, 1 H) 7.21 (d, J = 2.94 Hz, 1 H) 7.23 (s, 2 H) 7.37 (m, 5 H). ESI m / z (M + H) + 279. ESI m / z (M-H) &quot; 277.

Exemplo 304E 1- amino-N-[2-(aminosulfonil)-4-(benziloxi)fenil]-4-hidroxi- 2- oxo-1,2-di-hidroquinolina-3-carboxamidaExample 304E 1-amino-N- [2- (aminosulfonyl) -4- (benzyloxy) phenyl] -4-hydroxy-2-oxo-1,2-dihydroquinoline-3-carboxamide

Os produtos do Exemplo 304D (4,0 g, 14,37 mmol) e Exemplo 226C (2,42 g, 7,20 mmol) em tolueno (50 mL) reagiram a 118°C durante 4 horas. A mistura foi filtrada ainda quente e o sólido seco para gerar o composto em título (3,13 g, 90%). MS (ESI-) m/z-479 (M-H)'. XH RMN (300 MHz, DMSO-d6) δ ppm 5,20 (s, 301 ΕΡ 1 560 827/ΡΤ 2Η) 5,76 (s, 2Η) 7,40 (m, 10Η) 7,84 (m, 2Η) 8,02 (d, J=8,46 Hz, 1H) 8,10 (dd, J=8, 09, 1,47 Hz, 1H) 12,31 (S, 1H) 16,41 (s, 1H) .The products of Example 304D (4.0 g, 14.37 mmol) and Example 226C (2.42 g, 7.20 mmol) in toluene (50 mL) were reacted at 118 ° C for 4 hours. The mixture was still filtered hot and the solid dried to give the title compound (3.13 g, 90%). MS (ESI-) m / z 479 (M-H) +. 1 H-NMR (300 MHz, DMSO-d 6) δ ppm 5.20 (s, 301 ÅΡ 1 560 827 / ΡΤ 2Η) 5.76 (s, 2Η) 7.40 (m, 10Η) 7.84 (m, 2Η ) 8.02 (d, J = 8.46 Hz, 1 H) 8.10 (dd, J = 8.9, 1.47 Hz, 1 H) 12.31 (s, 1H) 16.41 (s, 1H ).

Exemplo 304F l-amino-3-[7-(benziloxi)-1, l-dioxido-4fl-l, 2, 4-benzotiadiazin-3—i1]-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 304E (3,13 g, 6,51 mmol) foi suspenso numa solução a 10% de hidróxido de potássio (50 mL), aquecido a 125°C durante 24 horas e depois a 140°C durante 24 horas. A mistura foi vertida em gelo e ácido clorídrico 1M, filtrada e seca para gerar o composto em título (2,03 g, 67%). MS (ESI-) m/z 461 (M-H)&quot;. :Η RMN (300 MHz; DMSO-d6) δ ppm 5,18 (s, 2H) 5,33 (s, 2H) 7,06 (m, 1H) 7,25 (m, 3H) 7,43, (m, 6H) 7,69 (d, J=7,72 Hz, 1H) 8,06 (d, J=8,09 Hz, 1H) 16,31 (s, 1H) .EXAMPLE 304F 1-Amino-3- [7- (benzyloxy) -1,1-dioxido-4,11,2,4-benzothiadiazin-3-yl] -4-hydroxyquinolin-2 (1H) -one The product of Example 304E (3.13 g, 6.51 mmol) was suspended in a 10% solution of potassium hydroxide (50 mL), heated at 125 ° C for 24 hours and then at 140 ° C for 24 hours. The mixture was poured onto ice and 1M hydrochloric acid, filtered and dried to give the title compound (2.03 g, 67%). MS (ESI-) m / z 461 (M-H) &quot;. NMR (300 MHz, DMSO-d 6) δ ppm 5.18 (s, 2H) 5.33 (s, 2H) 7.06 (m, 1H) 7.25 (m, 3H) 7.43 ( m, 6H) 7.69 (d, J = 7.72 Hz, 1 H) 8.06 (d, J = 8.09 Hz, 1 H) 16.31 (s, 1H).

Exemplo 304G 3-[7-(benziloxi)-1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il]-1- (ciclobutilidenoamino) -4-hidroxiquinolin-2 (li?) -ona O produto do Exemplo 304F (0,285 g, 0,62 mmol) em N, N-dimetilacetamida (1,5 mL) reagiu com ciclobutanona (0,85 mL, 10,9 mmol) num tubo selado num reactor de microondas a 130°C durante 45 minutos. A reacção foi arrefecida até 25°C, concentrada sob uma corrente de azoto aquecida através de tubagem aquecida a 165°C e o resíduo resultante foi triturado com éter dietílico para gerar o composto em título (0,178 g, 56%) .Example 304G 3- [7- (Benzyloxy) -1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl] -1- (cyclobutylideneamino) -4-hydroxyquinolin-2 (1H) -one O The product of Example 304F (0.285 g, 0.62 mmol) in N, N-dimethylacetamide (1.5 mL) was reacted with cyclobutanone (0.85 mL, 10.9 mmol) in a sealed tube in a microwave reactor at 130 ° C for 45 minutes. The reaction was cooled to 25 ° C, concentrated under a stream of heated nitrogen through piping heated to 165 ° C and the resulting residue triturated with diethyl ether to give the title compound (0.178 g, 56%).

Exemplo 304H 3- [7- (benziloxi) -1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il] -1-(ciclobutilamino)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 304G (0,178 g, 0,35 mmol) em tetra-hidrofurano (3 mL) a 0°C foi tratado com metanol (0,025 mL, O, 70 mmol), seguido pela adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,260 mL, 0,52 mmol), agitada a 25°C durante uma hora e diluída com HC1 IN. O precipitado resultante foi filtrado e seco. O sólido foi dissolvido em tetra-hidrofurano e absorvido em sílica gel por meio de evaporação até à secura. A sílica resultante foi 302 ΕΡ 1 560 827/ΡΤ carregada num Alltech sep pack de 2 g e eluída com diclorometano para gerar o composto em título (0,059 g, 33%). MS (ESI-) m/z 515 (M-H)-. XH RMN (300 MHz, DMSO-d6) δ ppm 1,55 (m, 1H) 1,71 (m, 1H) 2,04 (m, 4H) 3,77 (m, 1H) 5,26 (s, 2H) 6,57 (d, J=5,15 Hz, 1H) 7,45 (m, 8H) 7,64 (d, J=9,56 Hz, 1H) 7,88 (m, 1H) 8,05 (d, J=8,46 Hz, 1H) 8,17 (m, 1H).Example 304H 3- [7- (Benzyloxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -1- (cyclobutylamino) -4-hydroxyquinolin-2 (1H) -one The product of Example 304G (0.178 g, 0.35 mmol) in tetrahydrofuran (3 mL) at 0 ° C was treated with methanol (0.025 mL, 0.70 mmol) followed by the dropwise addition of a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.260 mL, 0.52 mmol), stirred at 25 ° C for one hour and diluted with 1N HCl. The resulting precipitate was filtered and dried. The solid was dissolved in tetrahydrofuran and absorbed onto silica gel by evaporation to dryness. The resulting silica was charged to a 2 g Alltech sep pack and eluted with dichloromethane to give the title compound (0.059 g, 33%). MS (ESI-) m / z 515 (M-H) -. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.55 (m, 1 H) 1.71 (m, 1 H) 2.04 (m, 4H) 3.77 (m, 1H) 5.26 (s, 2H), 6.57 (d, J = 5.15 Hz, 1 H) 7.45 (m, 8H) 7.64 (d, J = 9.56 Hz, 1 H) 7.88 (m, 05 (d, J = 8.46 Hz, 1 H) 8.17 (m, 1H).

Exemplo 3041 1-(ciclobutilamino)-4-hidroxi-3-(7-hidroxi-l, l-dioxido-4fl-1,2,4-benzotiadiazin-3-il)guinolin-2(lff)-ona O produto do Exemplo 304H (0,059 g, 0,11 mmol) em tetra-hidrofurano (4 mL) reagiu com óxido de platina (50 mg) sob atmosfera de hidrogénio a 25°C durante 20 horas. O catalisador foi removido por filtração e o filtrado evaporado para gerar o composto em título (0,048 g, 100%). MS (ESI-) m/z 425 (M-H)-.Example 3041 1- (cyclobutylamino) -4-hydroxy-3- (7-hydroxy-1,1-dioxido-4,11,2,4-benzothiadiazin-3-yl) guinolin-2 (1 H) Example 304H (0.059 g, 0.11 mmol) in tetrahydrofuran (4 mL) was reacted with platinum oxide (50 mg) under hydrogen atmosphere at 25 ° C for 20 hours. The catalyst was removed by filtration and the filtrate evaporated to give the title compound (0.048 g, 100%). MS (ESI-) m / z 425 (M-H) -.

Exemplo 304J 2-({3-[1-(ciclobutilamino)-4-hidroxi-2-oxo-l,2-di-hidro-quinolin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}oxi)-acetamida O produto do Exemplo 3041 (0,048 g, 0,11 mmol) em N, N-dimetilformamida (2 mL) reagiu com carbonato de césio (0,15 g, 0,45 mmol), bromoacetamida (0,026 mL, 0,18 mmol) e uma quantidade catalítica de iodeto de tetrabutilamónio a 25°C durante 3 horas. A reacção foi concentrada sob uma corrente de azoto, aquecida através de uma tubagem aquecida a 165°C e o resíduo resultante foi triturado com água, filtrado e seco. O sólido resultante foi triturado em acetato de etilo quente, filtrado e seco para gerar o composto em título (0,020 g, 37%). MS (ESI-) m/z 482 (M-H)-. XH RMN (300 MHz, DMSO-d6) δ ppm 1,59 (m, 2H) 1,99 (m, 4H) 3,60 (m, 1H) 4,49 (s, 2H) 6,08 (d, J=6,62 Hz, 1H) 7,05 (t, J=7,17 Hz, 1H) 7,20 (m, 3H) 7,40 (s, 1H) 7,50 (m, 1H) 7,65 (m, 2H) 8,05 (d, J=7,72 Hz, 1H) 16,25 (s, 1H). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ ppm 1,59 (m, 1H) 1,99 (m, 4H) 3,61 (m, 2H) 4,49 (s, 2H) 6,08 (d, J=6,62 Hz, 1H) 7,05 (m, 1H) 7,21 (m, 2H) 7,40 (s, 2H) 7,50 (m, 1H) 7,64 (m, 2H) 8,06 (dd, J=7,91, 1,29 Hz, 1H) 8,32 (s, 1H). 303 ΕΡ 1 560 827/ΡΤExample 304: 2 - ({3- [1- (cyclobutylamino) -4-hydroxy-2-oxo-1,2-dihydro-quinolin-3-yl] -1,1-dioxido- The product from Example 3041 (0.048 g, 0.11 mmol) in N, N-dimethylformamide (2 mL) was reacted with cesium carbonate (0.15 g, 0.45 mmol) mmol), bromoacetamide (0.026 mL, 0.18 mmol) and a catalytic amount of tetrabutylammonium iodide at 25 ° C for 3 hours. The reaction was concentrated under a stream of nitrogen, heated through a pipeline heated to 165 ° C and the resulting residue triturated with water, filtered and dried. The resulting solid was triturated in hot ethyl acetate, filtered and dried to give the title compound (0.020 g, 37%). MS (ESI-) m / z 482 (M-H) -. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.59 (m, 2H) 1.99 (m, 4H) 3.60 (m, 1H) 4.49 (s, 2H) 6.08 (d, J = 6.62 Hz, 1 H) 7.05 (t, J = 7.17 Hz, 1 H) 7.20 (m, 3 H) 7.40 (s, 65 (m, 2 H) 8.05 (d, J = 7.72 Hz, 1 H) 16.25 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. (M, 2H), 4.49 (s, 2H), 6.08 (d, J = 6.62 Hz, 1 H) 7.05 (m, 1 H) 7.21 (m, 2 H) 7.40 (s, 2 H) 7.50 (m, 1 H) 7.64 (m, 2 H) 8 , 6 (dd, J = 7.91, 1.29 Hz, 1 H) 8.32 (s, 1 H). 303 ΕΡ 1 560 827 / ΡΤ

Exemplo 305Α 3-[7-(benziloxi)-1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il]-1-(ciclopentilidenoamino)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 304F (0,284 g, 0,61 mmol) e ciclopentanona (0,80 mL, 9,04 mmol) em N,N-dimetilacetamida (2 mL) reagiram a 130°C durante 40 minutos num reactor de microondas num tubo selado. A reacção foi concentrada sob uma corrente de azoto aquecida através de uma tubagem aquecida a 165°C. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,210 g, 65%). XH RMN (300 MHz, DMSO-d6) δ ppm 1,72 (m, 2H) 1,87 (m, 2H) 2,16 (m, 2H) 2,71 (m, 2H) 5,18 (s, 2H) 7,31 (m, 11H) 8,10 (d, J= 8,46 Hz, 1H) 16,22 (s, 1H) .Example 305 3- [7- (Benzyloxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -1- (cyclopentylideneamino) -4-hydroxyquinolin-2 (1H) -one The product of Example 304F (0.284 g, 0.61 mmol) and cyclopentanone (0.80 mL, 9.04 mmol) in N, N-dimethylacetamide (2 mL) were reacted at 130 ° C for 40 minutes in a microwave reactor in a sealed tube . The reaction was concentrated under a heated nitrogen stream through a pipeline heated to 165 ° C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.210 g, 65%). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.72 (m, 2 H) 1.87 (m, 2 H) 2.16 (m, 2 H) 2.71 (m, 2 H) 5.18 (s, 2H) 7.31 (m, 11H) 8.10 (d, J = 8.46 Hz, 1 H) 16.22 (s, 1H).

Exemplo 305B 3-[7-(benziloxi)-1, l-dioxido-4ff-l,2,4-benzotiadiazin-3-il]-1-(ciclopentilamino)-4-hidroxiquinolin-2(lff)-ona O produto do Exemplo 305A (0,21 g, 0,40 mmol) em tetra-hidrofurano (3 mL) e metanol (0,030 mL) a 0°C reagiu com boro-hidreto de lítio (solução 2,0M em tetra-hidrofurano, 0,30 mL, 0,60 mmol). A reacção foi agitada a 25°C durante 1 hora e depois diluída com ácido clorídrico 1M aquoso e filtrado. O produto foi purificado por dissolução em tetra-hidrofurano, absorvido em sílica gel, carregado num Alltech Sep-pack de 2 g e eluído com diclorometano. O filtrado foi evaporado até à secura sob pressão reduzida para gerar o composto em título (0,124 g, 59%). ΧΗ RMN (300 MHz, DMSO-d6) δ ppm 1,54 (m, 4H) 1,79 (m, 2H) 2,55 (m, 2H) 3,94 (m, 1H) 5,26 (s, 2H) 6,23 (m, J=6,99,4,04 Hz, 1H) 7,43 (m, 8H) 7,69 (d, J=6,99 Hz, 1H) 7,87 (m, 1H) 8,09 (d, J=8,09 Hz, 1H) 8,16 (d, J=6,62 Hz, 1H) 14,08 (s, 1H) 15,18 (s, 1H) .Example 305B 3- [7- (Benzyloxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -1- (cyclopentylamino) -4-hydroxyquinolin-2 (1 H) -one The product of Example 305A (0.21 g, 0.40 mmol) in tetrahydrofuran (3 mL) and methanol (0.030 mL) at 0 ° C was reacted with lithium borohydride (2.0 M solution in tetrahydrofuran, , 30 mL, 0.60 mmol). The reaction was stirred at 25 ° C for 1 hour and then diluted with 1M aqueous hydrochloric acid and filtered. The product was purified by dissolution in tetrahydrofuran, absorbed on silica gel, loaded onto a 2 g Alltech Sep-pack and eluted with dichloromethane. The filtrate was evaporated to dryness under reduced pressure to give the title compound (0.124 g, 59%). NMR (300 MHz, DMSO-d6) δ ppm 1.54 (m, 4H) 1.79 (m, 2H) 2.55 (m, 2H) 3.94 (m, 1H) 5.26 (s, J = 6.99, 4.04 Hz, 1 H) 7.43 (m, 8H) 7.69 (d, J = 6.99 Hz, 1 H) 7.87 (m, 1H) 8.09 (d, J = 8.09 Hz, 1 H) 8.16 (d, J = 6.62 Hz, 1 H) 14.08 (s, 1 H) 15.18 (s, 1H).

Exemplo 305C 1-(ciclopentilamino)-4-hidroxi-3-(7-hidroxi-l, l-dioxido-4H-1,2,4-benzotiadiazin-3-il)quinolin-2(1H)-ona O produto do Exemplo 305B (0,122 g, 0,23 mmol) em tetra-hidrofurano (15 mL) reagiu com uma quantidade catalítica de hidróxido de paládio sobre carbono, uma quantidade catalítica de paládio a 5% sobre carbono e formato de amónio (0,080 g, 304 ΕΡ 1 560 827/ΡΤ 1,27 mmol) a 60°C durante 2 horas. A mistura reaccional quente foi filtrada através de celite e o filtrado foi evaporado sob pressão reduzida para gerar o composto em titulo (0,10 g, 100%). MS (ESI-) m/z 439 (Μ-ΗΓ. XH RMN (300 MHz, DMSO-d6) δ ppm 1,54 (m, 4H) 1,78 (m, J=2,94 Hz, 2H) 2,58 (m, 2H) 3,91 (m, 1H) 6,25 (m, 1H) 7,13 (m, 2H) 7,45 (m, 1H) 7,54 (d, J=9,19 Hz, 1H) 7,85 (m, 1H) 8,12 (m, 2H) 10,45 (S, 1H) 14,00 (s, 1H) 15,25 (s, 1H).Example 305C 1- (cyclopentylamino) -4-hydroxy-3- (7-hydroxy-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) quinolin-2 (1H) Example 305B (0.122 g, 0.23 mmol) in tetrahydrofuran (15 mL) was reacted with a catalytic amount of palladium hydroxide on carbon, a catalytic amount of 5% palladium on carbon and ammonium formate (0.080 g, 304 Υ = 1 560 827 / ΡΤ 1.27 mmol) at 60 ° C for 2 hours. The hot reaction mixture was filtered through celite and the filtrate was evaporated under reduced pressure to give the title compound (0.10 g, 100%). NMR (300 MHz, DMSO-d 6) δ ppm 1.54 (m, 4H) 1.78 (m, J = 2.94 Hz, 2H) 2 (M, 1H), 7.12 (m, 2H), 7.45 (m, 1H), 7.54 (d, J = 9.19 Hz, 1H) 7.85 (m, 1H) 8.12 (m, 2H) 10.45 (S, 1H) 14.00 (s, 1H) 15.25 (s, 1H).

Exemplo 305D 2-({3-[1-(ciclopentilamino)-4-hidroxi-2-oxo-l,2-di-hidro-quinolin-3-il]-1,l-dioxido-4fí-l,2,4-benzotiadiazin-7-il}oxi)-acetamida O produto do Exemplo 305C (0,10 g, 0,23 mmol) reagiu com carbonato de césio (0,30 g, 0,92 mmol), 2-bromoacetamida (0,050 g, 0,37 mmol) e uma quantidade catalítica de iodeto de tetrabutilamónio em N,N-dimetilformamida (5 mL) a 25°C durante 2 horas. A reacção foi concentrada até metade do volume sob uma corrente de azoto aquecida através de um tubagem aquecida to 165°C. A solução resultante foi diluída com água e o precipitado foi recolhido por filtração e seco para gerar o composto em título (0,095 g, 85%). MS (ESI-) m/z 496 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (500 MHz, DMSO-d6) δ ppm 1,52 (m; 6 H) 1,76 (m, 2H) 3,70 (m, 1H) 4,47 (s, 2H) 5,68 (d, J=4,88 Hz, 1H) 7,03 (t, J=7,63 Hz, 1H) 7,20 (m, 5H) 7,46 (t, J=7,32 Hz, 1H) 7,70 (d, J=8,54 Hz, 1H) 8,06 (d, J=7,32 Hz, 1H) 16,15 (S, 1H).Example 305D 2 - ({3- [1- (cyclopentylamino) -4-hydroxy-2-oxo-1,2-dihydro-quinolin-3-yl] -1,1-dioxido- The product of Example 305C (0.10 g, 0.23 mmol) was reacted with cesium carbonate (0.30 g, 0.92 mmol), 2-bromoacetamide (0.050 g, 0.23 mmol) g, 0.37 mmol) and a catalytic amount of tetrabutylammonium iodide in N, N-dimethylformamide (5 mL) at 25 ° C for 2 hours. The reaction was concentrated to half the volume under a stream of heated nitrogen through a pipeline heated to 165 ° C. The resulting solution was diluted with water and the precipitate was collected by filtration and dried to give the title compound (0.095 g, 85%). MS (ESI-) m / z 496 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (500 MHz, DMSO-d 6) δ ppm 1.52 (m, 6 H) 1.76 (m, 2 H) 3.70 (m, 1 H) 4.47 (s, 2 H) 5.68 (d 1H), 7.20 (m, 5H), 7.46 (t, J = 7.32 Hz, 1 H), 7.03 (t, 70 (d, J = 8.54 Hz, 1 H) 8.06 (d, J = 7.32 Hz, 1 H) 16.15 (s, 1H).

Exemplo 306A 3-[7-(benziloxi)-1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il]-1-(ciclo-hexilidenoamino)-4-hidroxiquinolin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento como descrito no Exemplo 304G, substituindo por ciclo-hexanona a ciclobutanona.Example 306A 3- [7- (Benzyloxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -1- (cyclohexylideneamino) -4-hydroxyquinolin-2 (1H) -one The title compound was prepared according to the procedure as described in Example 304G, substituting cyclohexanone for cyclobutanone.

Exemplo 306B 3-[7-(benziloxi)-1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il]-1- (ciclo-hexilamino) -4-hidroxiquinolin-2 (1H) -ona 305 ΕΡ 1 560 827/ΡΤ Ο composto em título foi preparado de acordo com o procedimento descrito no Exemplo 304H, substituindo pelo produto do Exemplo 306A o produto do Exemplo 304G (0,11 g, 78%) .Example 306B 3- [7- (Benzyloxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -1- (cyclohexylamino) -4-hydroxyquinolin-2 (1H) -one The title compound was prepared according to the procedure described in Example 304H, substituting the product of Example 306A for the product of Example 304G (0.11 g, 78%). 1H NMR (DMSO-d6):?

Exemplo 306C 1-(ciclo-hexilamino)-4-hidroxi-3-(7-hidroxi-l, l-dioxido-4H-1,2,4-benzotiadiazin-3-il)quinolin-2(1H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 305C substituindo pelo produto do Exemplo 306B o produto do Exemplo 305B (39 mg, 42%).Example 306C 1- (cyclohexylamino) -4-hydroxy-3- (7-hydroxy-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) quinolin-2 (1H) -one O The title compound was prepared according to the procedure of Example 305C substituting the product of Example 306B for the product of Example 305B (39 mg, 42%).

Exemplo 306D 2-({3- [1-(ciclo-hexilamino)4-hidroxi-2-oxo-l,2-di-hidro-quinolin-3-il]-1,l-dioxido-4i7-l,2,4-benzotiadiazin-7-il}oxi)-acetamida O produto do Exemplo 306C (13 mg, 0,028 mmol) em N,N-dimetilformamida (5 mL) reagiu com carbonato de césio (0,0137 g, 0,114 mol) e 2-bromoacetamida (0,008 g, 0,058 mmol) de acordo com o procedimento como descrito no Exemplo 304J para gerar o composto em título. O sal de sódio foi preparado de acordo com o procedimento do Exemplo 1D (7 mg, 48%). ΧΗ RMN (300 MHz, DMSO-d6) δ ppm 1,36 (m, 10H) 2,96 (bs, 1H) 4,49 (s, 2H) 5,67 (d, J=4,04 Hz, 1H) 7,04 (t, J=7, 54 Hz, 1H) 7,20 (m, 3H) 7,40 (s, 1H) 7,47 (m, 1H) 7,62 (s, 1H) 7,74 (d, J=8,46 Hz, 1H) 8,05 (d, J=6,62 Hz, 1H) 16,26 (s, 1H) . (ESI-) m/z 510 (Μ-ΗΓ, m/z 532 (M+Na-H)&quot;.Example 306D 2 - ({3- [1- (cyclohexylamino) -4-hydroxy-2-oxo-1,2-dihydro-quinolin-3-yl] -1,1-dioxido-4,17- , 4-benzothiadiazin-7-yl} oxy} acetamide The product of Example 306C (13 mg, 0.028 mmol) in N, N-dimethylformamide (5 mL) was reacted with cesium carbonate (0.0137 g, 0.114 mol) and 2-bromoacetamide (0.008 g, 0.058 mmol) according to the procedure as described in Example 304J to give the title compound. The sodium salt was prepared according to the procedure of Example 1D (7 mg, 48%). NMR (300 MHz, DMSO-d 6) δ ppm 1.36 (m, 10H) 2.96 (bs, 1H) 4.49 (s, 2H) 5.67 (d, J = 4.04 Hz, 1H ) 7.04 (t, J = 7, 54 Hz, 1 H) 7.20 (m, 3 H) 7.40 (s, 1 H) 7.47 (m, 1 H) 7.62 (s, 74 (d, J = 8.46 Hz, 1 H) 8.05 (d, J = 6.62 Hz, 1 H) 16.26 (s, 1H). (ESI-) m / z 510 (Μ-ΗΓ, m / z 532 (M + Na-H) &quot;.

Exemplo 307 4-[(2-cloro-l,3-tiazol-5-il)metil]-7-hidroxi-6-(7-hidroxi-1,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)tieno[3,2-b]piridin-5(4H)-onaExample 307 4 - [(2-chloro-1,3-thiazol-5-yl) methyl] -7-hydroxy-6- (7-hydroxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin- 3-yl) thieno [3,2-b] pyridin-5 (4H) -one

Exemplo 307AExample 307A

[7-(benziloxi)-1, l-dioxido-4H-l, 2,4-benzotiadiazin-3-il]-acetato de etilo O composto em título foi preparado de acordo com o procedimento do Exemplo 1C substituindo pelo produto do Exemplo 304D a 2-amino-benzenossulfonamida. 306 ΕΡ 1 560 827/ΡΤEthyl [7- (benzyloxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] acetate The title compound was prepared according to the procedure of Example 1C substituting the product of Example 304D to 2-amino-benzenesulfonamide. 306 ΕΡ 1 560 827 / ΡΤ

Exemplo 307Β (7-hidroxi-l,l-dioxido-4-H-l,2, 4-benzotiadiazin-3-il)acetato de etilo O produto do Exemplo 307A (1,42 g, 3,79 mmol) em tetra-hidrofurano (60 mL) reagiu com paládio sobre carbono a 10% (0,2 g) sob atmosfera de hidrogénio durante 16 horas a 25°C. A mistura reaccional foi filtrada e concentrada sob pressão reduzida até um óleo. O residuo foi purificado em silica gel eluindo com acetato de etilo para gerar o composto em titulo como um sólido branco (0,8 g).The title product of Example 307A (1.42 g, 3.79 mmol) in tetrahydrofuran (30 mL) was added dropwise to a solution of ethyl 3- (60 mL) was reacted with 10% palladium on carbon (0.2 g) under hydrogen atmosphere for 16 hours at 25 ° C. The reaction mixture was filtered and concentrated under reduced pressure to an oil. The residue was purified on silica gel eluting with ethyl acetate to give the title compound as a white solid (0.8 g).

Exemplo 307C {1, l-dioxido-7- [ (triisopropilsilil) oxi] 4ff—1,2, 4-benzo-tiadiazin-3-il}acetato de etilo O produto do Exemplo 307B (0,1 g, 0,352 mmol) reagiu com 2,6-lutidina (0,045 mL, 0,387 mmol) e trifluorometanossulfonato de triisopropilo (0,1 mL, 0,387 mmol) em diclorometano (10 mL) a 5°C durante 3 horas. A reacção foi diluída com diclorometano e extraída com ácido fosfórico IN aguoso. A fase orgânica foi lavada com salmoura e seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida para gerar o composto em título como um sólido amarelo claro (0,13 g, 84%).The product from Example 307B (0.1 g, 0.352 mmol) was dissolved in dichloromethane (30 mL) and extracted with dichloromethane was reacted with 2,6-lutidine (0.045 mL, 0.387 mmol) and triisopropyl trifluoromethanesulfonate (0.1 mL, 0.387 mmol) in dichloromethane (10 mL) at 5 ° C for 3 hours. The reaction was diluted with dichloromethane and extracted with aqueous IN phosphoric acid. The organic layer was washed with brine and dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure to give the title compound as a light yellow solid (0.13 g, 84%).

Exemplo 307D 4-[(2-Cloro-l,3-tiazol-5-il)metil]—6—{1,l-dioxido-7-[ (triisopropilsilil) oxi] -4H-1,2, 4-benzotiadiazin-3-il}-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo pelo produto do Exemplo 140A o produto do Exemplo 1B e substituindo pelo produto do Exemplo 307C o produto do Exemplo 1C (0,29 g, 66%) . MS (ESI-) m/z 649 (Μ-ΗΓ. XH RMN (300 MHz, DMSO-d6) δ ppm 1,09 (d, J=7,35 Hz, 18 H) 1,28 (m, 3H) 5,63 (s, 2H) 7,22 (d, J=2,57 Hz, 1H) 7,31 (dd, J=8, 82, 2,94 Hz, 1H) 7,65 (d, J=8,82 Hz, 1H) 7,86 (d, J= 5,52 Hz, 1H) 7,95 (s, 1H) 8,42 (d, J=5,52 Hz, 1H) 14,05 (s, 1H) 14,96 (s, 1H) . 307 ΕΡ 1 560 827/ΡΤExample 307D 4 - [(2-Chloro-1,3-thiazol-5-yl) methyl] -6- (1,1-dioxido-7 - [(triisopropylsilyl) oxy] -4H-1,2,4-benzothiadiazin -3-yl} -7-hydroxythieno [3,2-b] pyridin-5 (4H) -one The title compound was prepared according to the procedure of Example 1D substituting the product of Example 140A for the product of Example 1B and substituting the product of Example 307C for the product of Example 1C (0.29 g, 66%). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.09 (d, J = 7.35 Hz, 18 H) 1.28 (m, 3 H) (D, J = 2.57 Hz, 1 H) 7.31 (dd, J = 8.82, 2.94 Hz, 1 H) 7.65 (d, J = (D, J = 5.52 Hz, 1 H) 7.95 (s, , 1H), 14.96 (s, 1H), 307 ΕΡ 1 560 827 / ΡΤ

Exemplo 307Ε 4-[(2-cloro-l,3-tiazol-5-il)metil]-7-hidroxi-6-(7-hidroxi-1, l-dioxido-4fl-l, 2, 4-benzotiadlazln-3-ll)tleno[3,2-b]plridln-5(4H)-ona O produto do Exemplo 307D (0,235 g, 0,36 mmol) em tetra-hidrofurano (10 mL) reagiu com fluoreto de tetrabutilamónio em tetra-hidrof urano (1M, 0,43 mL) a 25°C durante 2 horas. A mistura reaccional foi diluida com água (50 mL) e ajustada a pH 2 com HC1 1M e extraído com acetato de etilo. A fase orgânica foi concentrada sob pressão reduzida para gerar o composto em titulo (0,15 g, 84%). MS (ESI-) m/z 493 (M-H)“. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dô) δ ppm 5,63 (s, 2H) 7,17 (s, 1H) 7,20 (d, J= 2,57 Hz, 1H) 7,57 (d, J= 8,82 Hz, 1H) 7,85 (d, J= 5,52 Hz, 1H) 7,95 (s, 1H) 8,42 (d, J=5,15 Hz, 1H) 10,42 (s, 1H) 13,95 (s, 1H) 15,10 (s, 1H) .Example 307 and 4 - [(2-chloro-1,3-thiazol-5-yl) methyl] -7-hydroxy-6- (7-hydroxy-1,1-dioxido-4 H -1,2,4-benzothiazol- The product of Example 307D (0.235 g, 0.36 mmol) in tetrahydrofuran (10 mL) was reacted with tetrabutylammonium fluoride in tetrahydrofuran (3 mL) (1M, 0.43 mL) at 25 ° C for 2 hours. The reaction mixture was diluted with water (50 mL) and adjusted to pH 2 with 1M HCl and extracted with ethyl acetate. The organic phase was concentrated under reduced pressure to give the title compound (0.15 g, 84%). MS (ESI-) m / z 493 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 5.63 (s, 2H) 7.17 (s, 1H) 7.20 (d, J = 2.57 Hz, (D, J = 5.12 Hz, 1 H), 8.42 (d, J = 5.12 Hz, 1 H) s, 1 H) 13.95 (s, 1 H) 15.10 (s, 1 H).

Exemplo 308 2-[3-{4- [ (2-cloro-l,3-tiazol-5-il)metil]-7-hidroxi-5-oxo-4,5-di-hidrotieno [3, 2-£&gt;]piridin-6-il}-l, l-dioxido-4fl-l, 2, 4-benzotiadiazin-7-il)oxi]acetamida O produto do Exemplo 307E (0,065 g, 0,13 mmol) em N,N-dimetilformamida (5 mL) reagiu com carbonato de césio (0,171 g, 0,53 mmol) e 2-bromoacetamida (0,036 g, 0,26 mmol) a 25°C durante 24 horas. A mistura reaccional foi diluída com água e o precipitado resultante foi recolhido por filtração para gerar o composto em título (0,036 g, 50%). MS (ESI-) m/z 550 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 2H RMN (300 MHz, DMSO-de) δ ppm 4,60 (s, 2H) 5,63 (s, 2H) 7,38 (t, J=2,21 Hz, 1H) 7,42 (d, J=2, 94 Hz, 1H) 7,44 (s, 1H) 7,69 (d, J=8,46 Hz, 1H) 7,66 (s, 1H) 7,85 (d,J=5,52 Hz, 1H) 7,95 (s, 1H) 8,42 (d, J=5,52 Hz, 1H) 14,04 (s, 1H) 14,99 (s, 1H).Example 308 2- [3- {4 - [(2-Chloro-1,3-thiazol-5-yl) methyl] -7-hydroxy-5-oxo-4,5-dihydrothieno [ The product of Example 307E (0.065 g, 0.13 mmol) in N, N-dimethylformamide (0.8 g, N-dimethylformamide (5 mL) was reacted with cesium carbonate (0.171 g, 0.53 mmol) and 2-bromoacetamide (0.036 g, 0.26 mmol) at 25 ° C for 24 h. The reaction mixture was diluted with water and the resulting precipitate was collected by filtration to give the title compound (0.036 g, 50%). MS (ESI-) m / z 550 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 4.60 (s, 2H) 5.63 (s, 2H) 7.38 (t, J = 2.21 Hz, = 2.94 Hz, 1H) 7.44 (s, 1H) 7.69 (d, J = 8.46 Hz, 1H) 7.66 (s, 1H) 7.85 (d, J = 5.52 1H), 8.42 (d, J = 5.52 Hz, 1 H) 14.04 (s, 1 H) 14.99 (s, 1H).

Exemplo 309A l-benzil-4-hidroxi-lH-quinolin-2-ona O composto em título foi preparado de acordo com o procedimento como descrito em D.R. Buckle, B.C. Cantello, H. 308 ΕΡ 1 560 827/ΡΤExample 309A 1-Benzyl-4-hydroxy-1H-quinolin-2-one The title compound was prepared according to the procedure as described in D.R. Buckle, B.C. Cantello, H. 308 ΕΡ 1 560 827 / ΡΤ

Smith, Β.Α. Spicer, Journal of Medicinal Chemistry, 18, 726-732 (1975).Smith, Β.Α. Spicer, Journal of Medicinal Chemistry, 18, 726-732 (1975).

Exemplo 309B l-benzil-3-(bis-metilsulfanil-metileno)-lH-quinolina-2, 4-diona A uma suspensão de hidreto de sódio (0,75 g, 16 mmol) em N,N-dimetilformamida (20 mL) a 0°C juntou-se uma solução do produto do Exemplo 309A (2 g, 7,97 mmol) em N,N-dimetil- formamida (30 mL) durante 30 minutos. A mistura vermelho-laranja foi aquecida até 25°C e agitada durante 30 minutos enquanto se desenvolvia uma cor violeta. A reacção foi depois aquecida a 50°C durante 2 horas e arrefecida até 25°C durante 30 minutos. Juntou-se dissulfureto de carbono (1,13 mL, 16 mmol) à mistura. A mistura foi aquecida a 50°C durante 2 horas (desenvolveu-se uma cor vermelho-castanho) e arrefecida até 25°C. Juntou-se iodeto de metilo (1,2 mL, 16 mmol) e a reacção foi agitada a 25°C durante 30 minutos. A reacção foi neutralizada com tampão de fosfato (10 mL, pH = 7) e a reacção foi concentrada sob pressão reduzida. O resíduo foi triturado com tampão de fosfato a pH7 e acetato de etilo/hexanos (1:1), os resultantes sólidos laranja foram recolhidos por filtração, lavados com hexanos e secos sob pressão reduzida para gerar o composto em título (1,76 g, 62%). XH RMN (300 MHz, CDCI3) δ ppm 2,65 (s, 6H) 5,43 (s, 2H) 7,06 (d,J=8,46 Hz, 1H) 7,14 (m, 1H) 7,28 (m, 5H) 7,43 (m, 1H) 8,24 (dd, J=7,72, 1,47 Hz, 1H).To a suspension of sodium hydride (0.75 g, 16 mmol) in N, N-dimethylformamide (20 mL) was added sodium bicarbonate ) at 0 ° C was added a solution of the product of Example 309A (2 g, 7.97 mmol) in N, N-dimethylformamide (30 mL) for 30 minutes. The red-orange mixture was warmed to 25øC and stirred for 30 minutes while a violet color developed. The reaction was then heated at 50 ° C for 2 hours and cooled to 25 ° C for 30 minutes. Carbon disulfide (1.13 mL, 16 mmol) was added to the mixture. The mixture was heated at 50 ° C for 2 hours (a red-brown color developed) and cooled to 25 ° C. Methyl iodide (1.2 mL, 16 mmol) was added and the reaction was stirred at 25 ° C for 30 minutes. The reaction was quenched with phosphate buffer (10 mL, pH = 7) and the reaction was concentrated under reduced pressure. The residue was triturated with phosphate buffer at pH 7 and ethyl acetate / hexanes (1: 1), the resulting orange solids collected by filtration, washed with hexanes and dried under reduced pressure to give the title compound (1.76 g , 62%). 1 H NMR (300 MHz, CDCl 3) δ ppm 2.65 (s, 6H) 5.43 (s, 2 H) 7.06 (d, J = 8.46 Hz, 1 H) 7.14 (m, 1 H) 7 , 28 (m, 5H), 7.43 (m, 1H), 8.24 (dd, J = 7.72, 1.47 Hz, 1H).

Exemplo 309C 4-(benziltio)-5-nitrotiofeno-3-carboxilato de metilo O composto em título foi preparado de acordo com o procedimento como descrito em Stanetty, P. et al., Journal of Heterocyclic Chemistry, 36, 761-765 (1999).Example 309C Methyl 4- (benzylthio) -5-nitrothiophene-3-carboxylate The title compound was prepared according to the procedure as described in Stanetty, P. et al., Journal of Heterocyclic Chemistry, 36, 761-765 ( 1999).

Exemplo 309DExample 309D

[4-(benziltio)-5-nitrotien-3-il]metanol O produto do Exemplo 309C (5 g, 16,2 mmol) em diclorometano (150 mL) a -40°C reagiu com hidreto de diisobutilalumínio (1M em diclorometano, 36 mL, 2,2 equivalentes) adicionado gota a gota. A reacção foi agitada durante 15 minutos após completação da adição, neutralizada 309 ΕΡ 1 560 827/ΡΤ com solução de tartarato de sódio e potássio a 10% e agitada a 25°C durante 1 hora. A fase orgânica foi separada, filtrada através de celite® (terra de diatomáceas) e o filtrado foi concentrado sob pressão reduzida. O óleo resultante foi purificado por cromatografia instantânea em sílica gel com uma coluna Biotage-40s eluindo com metanol/diclorometano 2:98 para gerar o composto em título como um óleo, (4,32 g, 95%). :Η RMN (300 MHz, CDC13) δ ppm 4,21 (s, 2H), 4,39 (s, 2H) , 7,11 (m, 3H), 7,23 (m, 2H) 7,40 (s, 1H).The product of Example 309C (5 g, 16.2 mmol) in dichloromethane (150 mL) at -40 ° C was reacted with diisobutylaluminum hydride (1M in dichloromethane , 36 mL, 2.2 equivalents) added dropwise. The reaction was stirred for 15 minutes after completion of the addition, neutralized with 10% sodium and potassium tartrate solution and stirred at 25 ° C for 1 hour. The organic phase was separated, filtered through celite® (diatomaceous earth) and the filtrate was concentrated under reduced pressure. The resulting oil was purified by flash chromatography on silica gel with a Biotage-40s column eluting with methanol / dichloromethane 2:98 to give the title compound as an oil, (4.32 g, 95%). 1 H NMR (300 MHz, CDCl 3) δ ppm 4.21 (s, 2H), 4.39 (s, 2H), 7.11 (m, 3H), 7.23 (m, s, 1H).

Exemplo 309E 3-(benziltio)-4-[(metoximetoxi)metil]-2-nitrotiofeno O produto do Exemplo 309D (3,9 g, 13,9 mmol) em diclorometano (8 mL) reagiu com diisopropiletilamina (7,42 mL, 3 eguivalentes) e cloreto de metoximetilo (2,38 mL, 2,25 eguivalentes) a 25°C durante 16 horas. A reacção foi concentrada sob pressão reduzida e o resíduo purificado por cromatografia instantânea em sílica gel usando uma coluna Biotage-40m eluindo com diclorometano para gerar o composto em título como um óleo amarelado, (4,32 g, 94%). XH RMN (300 MHz, CDCI3) δ ppm 3,36 (s, 3H), 4,20 (s, 2H), 4,34 (s, 2H), 4,62 (s, 2H), 7,13 (m, 3H), 7,21 (m, 2H), 7,40 (s, 1H).Example 309E 3- (Benzylthio) -4 - [(methoxymethoxy) methyl] -2-nitrothiophene The product of Example 309D (3.9 g, 13.9 mmol) in dichloromethane (8 mL) was reacted with diisopropylethylamine (7.42 mL , 3 equiv.) And methoxymethyl chloride (2.38 mL, 2.25 equiv.) At 25 ° C for 16 hours. The reaction was concentrated under reduced pressure and the residue purified by flash chromatography on silica gel using a Biotage-40m column eluting with dichloromethane to give the title compound as a yellowish oil, (4.32 g, 94%). 1 H NMR (300 MHz, CDCl 3) δ ppm 3.36 (s, 3H), 4.20 (s, 2H), 4.34 (s, 2H), 4.62 (s, 2H), 7.13 (s, m, 3H), 7.21 (m, 2H), 7.40 (s, 1H).

Exemplo 309F 4-[(metoximetoxi)metil]-2-nitrotiofeno-3-sulfonamida O produto do Exemplo 309E (4 g, 12,3 mmol) em diclorometano (70 mL) e ácido clorídrico aguoso IN (35 mL) a 0°C reagiu com cloro gás borbulhado lentamente ao longo de um período de 0,5 horas, depois agitado durante 1 hora adicional. A mistura reaccional foi purgada com azoto gás para remover o excesso de cloro e tratada com bissulfito de sódio sólido (11 g) adicionado lentamente à mistura com agitação durante 5 minutos. Juntaram-se diclorometano (15 mL) e água (15 mL), a fase orgânica foi separada e eluída através de 40 g de uma mistura 50:50 de MgS04/Na2S04. O filtrado foi concentrado sob pressão reduzida. Uma solução do concentrado (4,7 g) em diclorometano (100 mL) a -40°C foi borbulhada com amoníaco gás durante um período de 10 minutos. A mistura reaccional foi agitada durante 15 minutos adicionais, purgada com azoto gás para dispensar o excesso de amoníaco e concentrada sob pressão 310 ΕΡ 1 560 827/ΡΤ reduzida. Ο concentrado foi purificado por cromatografia instantânea em sílica gel utilizando uma coluna Biotage-40s eluindo com metanol/diclorometano 5:95 para gerar o composto em título como um óleo (2,3 g, 66%). RMN (300 MHz, CDC13) δ ppm 3,31 (m, 3H), 4,70 (s, 2H), 4,73 (s, 2H), 7,85 (m, 2H), 7,88 (s, 1H).The product of Example 309E (4 g, 12.3 mmol) in dichloromethane (70 mL) and 1N aqueous hydrochloric acid (35 mL) at 0 ° C reacted with chlorine gas bubbled slowly over a period of 0.5 hours, then stirred for an additional 1 hour. The reaction mixture was purged with nitrogen gas to remove excess chlorine and treated with solid sodium bisulfite (11 g) added slowly to the mixture with stirring for 5 minutes. Dichloromethane (15 mL) and water (15 mL) were added, the organic phase separated and eluted through 40 g of a 50:50 mixture of MgSO4 / Na2 SO4. The filtrate was concentrated under reduced pressure. A solution of the concentrate (4.7 g) in dichloromethane (100 mL) at -40øC was bubbled with ammonia gas over a period of 10 minutes. The reaction mixture was stirred an additional 15 minutes, purged with nitrogen gas to dispense excess ammonia and concentrated under reduced pressure. The concentrate was purified by flash chromatography on silica gel using a Biotage-40s column eluting with 5:95 methanol / dichloromethane to give the title compound as an oil (2.3 g, 66%). NMR (300 MHz, CDCl 3) δ ppm 3.31 (m, 3H), 4.70 (s, 2H), 4.73 (s, 2H), 7.85 (m, 2H), 7.88 (s , 1H).

Exemplo 309G 2-amino-4-[(metoximetoxi)metil]tiofeno-3-sulfonamida O produto do Exemplo 309F (1,8 g, 6,4 mmol) reagiu com ferro em pó (1,43 g, 4 equivalentes) em ácido acético (70 mL) a 50°C durante 7,5 horas e depois concentrado sob pressão reduzida. Uma lama do resíduo em 5% de metanol/diclorometano (60 mL) e água (6 mL) foi filtrada através de sílica gel (20 g) e ainda enxaguado com 5% de metanol/diclorometano (300 mL). O filtrado foi concentrado sob pressão reduzida e o resíduo purificado por cromatografia instantânea em sílica gel utilizando uma coluna Biotage-12s eluindo com metanol: diclorometano 2,5:97,5 para gerar o composto em título (1 g, 62%). XH RMN (300 MHz, DMSO-d6) δ ppm 3,30 (s, 3H) , 4,53 (s, 2H), 4,66 (s, 2H), 6,28 (s, 1H), 6,61 (s, 2H), 6,94 (s, 2H).Example 309G 2-Amino-4 - [(methoxymethoxy) methyl] thiophene-3-sulfonamide The product of Example 309F (1.8 g, 6.4 mmol) was reacted with iron powder (1.43 g, 4 equivalents) in acetic acid (70 mL) at 50 ° C for 7.5 hours and then concentrated under reduced pressure. A slurry of the residue in 5% methanol / dichloromethane (60 mL) and water (6 mL) was filtered through silica gel (20 g) and further rinsed with 5% methanol / dichloromethane (300 mL). The filtrate was concentrated under reduced pressure and the residue purified by flash chromatography on silica gel using a Biotage-12s column eluting with 2.5: 97.5 methanol: dichloromethane to give the title compound (1 g, 62%). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.30 (s, 3H), 4.53 (s, 2H), 4.66 (s, 2H), 6.28 (s, (S, 2H), 6.94 (s, 2H).

Exemplo 309H l-benzil-4-hidroxi-3-{7-[(metoximetoxi)metil]-1,1-dioxido-4H-tieno[2,3-e] [1,2,4]tiadiazin-3-il}quinolin-2(lfl)-ona O produto do Exemplo 309G (35 mg, 0,14 mmol) e o produto do Exemplo 309B (50 mg, 0,14 mmol) reagiram em tolueno (3 mL) a 100°C durante 3 horas. O precipitado resultante foi recolhido por filtração e lavado com tolueno e éter dietílico para gerar o composto em título (52 mg, 73,3%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ ppm 3,26 (s, 3H), 4,65 (s, 2H) , 4,72 (s, 2H) , 5,62 (s, 2H), 7,28 (m, 7H), 7,43 (s, 2H), 7,51 (d, J=8,09 Hz, 1H), 7,75 (m, 1H), 8,22 (d, J=8,09 Hz, 1H). 311Example 309H 1-Benzyl-4-hydroxy-3- {7 - [(methoxymethoxy) methyl] -1,1-dioxido-4H-thieno [2,3- e] [1,2,4] thiadiazin-3-yl The product of Example 309G (35 mg, 0.14 mmol) and the product of Example 309B (50 mg, 0.14 mmol) were reacted in toluene (3 mL) at 100 ° C for 3 hours. The resulting precipitate was collected by filtration and washed with toluene and diethyl ether to give the title compound (52 mg, 73.3%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.26 (s, 3H), 4.65 (s, 2H), 4.72 (s, 2H), 5.62 (s, 1H), 7.75 (m, 1H), 8.22 (d, J = 8.09 Hz, 1H), 7.75 (m, 1H), 8.23 , 9Hz, 1H). 311

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 310 l-Benzil-4-hidroxi-3-[7-(hidroximetil)-1, l-dioxido-4ff-tieno[2,3-e][1,2,4]tiadiazin-3-il]quinolin-2(1H)-onaExample 310 1-Benzyl-4-hydroxy-3- [7- (hydroxymethyl) -1,1-dioxido-4 H -thieno [2,3- e] [1,2,4] thiadiazin-3-yl] quinolin- 2 (1H) -one

Uma suspensão do produto do Exemplo 309H (46 mg, 0,09 mmol) em ácido clorídrico 6N aquoso (2,5 mL) e tetra-hidrofurano (5 mL) foi aquecida a 70°C durante 4 horas, arrefecida até 25°C e deixada em repouso durante 18 horas a temperatura ambiente. O precipitado resultante foi recolhido por filtração e lavado com água e éter dietílico para gerar o composto em título (39 mg, 92,8%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-d6) δ ppm 4,63 (s, 2H), 5,62 (s, 2H), 7,31 (m, 6 H) , 7,41 (t, J=7,72 Hz, 1H), 7,53 (d, J=8,46 Hz, 1H), 7,76 (t, J=7,91 Hz, 1H), 8,22 (dd, J=8,09, 1,47 Hz, 1H).A suspension of the product of Example 309H (46 mg, 0.09 mmol) in aqueous 6N hydrochloric acid (2.5 mL) and tetrahydrofuran (5 mL) was heated at 70 ° C for 4 hours, cooled to 25 ° C and allowed to stand for 18 hours at room temperature. The resulting precipitate was collected by filtration and washed with water and diethyl ether to give the title compound (39 mg, 92.8%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ ppm 4.63 (s, 2H), 5.62 (s, 2H), 7.31 (m, 6H), 7.41 (t, J = 7.72 (D, J = 8.46 Hz, 1 H), 7.76 (t, J = 7.91 Hz, 1 H), 8.22 (dd, J = , 47 Hz, 1H).

Exemplo 311A N-(tert-butil)-5-clorotiofeno-2-sulfonamida O composto em titulo foi preparado de acordo com o procedimento como descrito em Unterhalt, B., Moghaddam, S., Pharmazie, 1994, 49, 115-117.The title compound was prepared according to the procedure as described in Unterhalt, B., Moghaddam, S., Pharmazie, 1994, 49, 115-117. Example 311A N- (tert-butyl) -5-chlorothiophene-2-sulfonamide .

Exemplo 311B 3-azido-N-(tert-butil)-5-clorotiofeno-2-sulfonamidaExample 311B 3-azido-N- (tert-butyl) -5-chlorothiophene-2-sulfonamide

Uma solução de Exemplo 311A (1,01 g, 3,99 mmol) em tetra-hidrofurano (32 mL) a -78°C foi tratada com adição gota a gota de sec-BuLi (1,4M em hexano, 2,1 equivalentes). A reacção foi aquecida até -20°C e agitada durante 30 minutos, tratada com uma solução de tosilazida (1,1 equivalentes) em tetra-hidrofurano (7 mL) a -20°C, agitada a 25°C durante 18 horas. A mistura reaccional foi neutralizada com água e extraída com acetato de etilo. A fase orgânica foi lavada com salmoura, seca sobre sulfato de sódio anidro, filtrada e concentrada. O resíduo foi purificado por cromatografia em coluna em sílica gel, eluindo com um gradiente de 30% de diclorometano em hexano até 100% de diclorometano para gerar uma mistura aproximadamente 2:1 de material de partida para o composto em título. 312 ΕΡ 1 560 827/ΡΤA solution of Example 311A (1.01 g, 3.99 mmol) in tetrahydrofuran (32 mL) at -78 ° C was treated dropwise with sec-BuLi (1.4M in hexane, 2.1 equivalents). The reaction was warmed to -20 ° C and stirred for 30 minutes, treated with a solution of tosylazide (1.1 equivalents) in tetrahydrofuran (7 mL) at -20 ° C, stirred at 25 ° C for 18 hours. The reaction mixture was neutralized with water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by silica gel column chromatography, eluting with a gradient of 30% dichloromethane in hexane to 100% dichloromethane to give an approximately 2: 1 mixture of starting material for the title compound. 312 ΕΡ 1 560 827 / ΡΤ

Exemplo 311C 3-amino-5-cloro-N-isopropiltiofeno-2-sulfonamidaExample 311C 3-Amino-5-chloro-N-isopropylthiophene-2-sulfonamide

Uma solução do produto do Exemplo 311B (0,739 g) em tolueno (20 mL) e brometo de hexadeciltributilfosfónio (0,128 g, 0,25 mmol) a 0°C foi tratada gota a gota com uma solução de boro-hidreto de sódio (0,109 g, 2,9 mmol) em água (0,80 mL). A reacção foi agitada a 25°C durante 18 horas e a 5°C durante 72 horas. A reacção foi extraída com acetato de etilo. A fase orgânica foi lavada com hidróxido de sódio IN aquoso, água e salmoura e seca sobre sulfato de sódio anidro, filtrada e concentrada. O resíduo foi purificado por cromatografia em coluna em sílica gel, eluindo com um gradiente de hexanos/diclorometano 1:1 a 100% de diclorometano para gerar o composto em título (0,252 g, 23%). 1H RMN (300 MHz, CDC13) δ ppm 6,36 (s, 1H) 4,93 (br s, 2H) 4,60 (br s, 1H) 1,30 (s, 9H).A solution of the product of Example 311B (0.739 g) in toluene (20 mL) and hexadecyltributylphosphonium bromide (0.128 g, 0.25 mmol) at 0 ° C was treated dropwise with a solution of sodium borohydride (0.109 g, 2.9 mmol) in water (0.80 mL). The reaction was stirred at 25 ° C for 18 hours and at 5 ° C for 72 hours. The reaction was extracted with ethyl acetate. The organic phase was washed with aqueous 1N sodium hydroxide, water and brine and dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by silica gel column chromatography, eluting with a 1: 1 hexane / dichloromethane gradient to 100% dichloromethane to give the title compound (0.252 g, 23%). 1 H NMR (300 MHz, CDCl 3) δ ppm 6.36 (s, 1H) 4.93 (br s, 2H) 4.60 (br s, 1H) 1.30 (s, 9H).

Exemplo 311D 3-amino-5-cloro-i7-isopropiltiof eno-2-sulf onamida,_sal_de trifluoroacetato O produto do Exemplo 311C (0, 0998 g) em ácido trifluoroacético (3,9 mL) foi agitado a 25°C durante 18 horas. A reacção foi concentrada sob pressão reduzida e levada a azeótropo três vezes com acetato de etilo para gerar o composto em título como um sal de trifluoroacetato (0,160 g) . :Η RMN (300 MHz, CDC13) δ ppm 6,41 (s, 1H) 5,22 (br s, 2H) 4,84 (br s, 2H).The product of Example 311C (0.0998 g) in trifluoroacetic acid (3.9 mL) was stirred at 25 ° C for 18 hours. The product of Example 311C (0.0998 g) in trifluoroacetic acid (3.9 mL) was stirred at 25 ° C for 18 hours. hours. The reaction was concentrated under reduced pressure and brought to azeotrope three times with ethyl acetate to give the title compound as a trifluoroacetate salt (0.160 g). : Δ NMR (300 MHz, CDCl3) δ ppm 6.41 (s, 1H) 5.22 (br s, 2H) 4.84 (br s, 2H).

Exemplo 311E l-Benzil-3-(6-cloro-l,l-dioxido-4H-tieno[3,2-e] [1,2,4] — tiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona O composto em título foi preparado de acordo com 0 procedimento do Exemplo 309H, substituindo pelo produto do Exemplo 311D o produto do Exemplo 309G, na presença de diisopropiletilamina (3 equivalentes). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. :Η RMN (300 MHz, DMSO-d6) δ ppm 16,97 (s, 1H) 8,11 (d, J=8,09 Hz, 1H) 7,20 (m, 9H) 5,40 (s, 2H). 313 ΕΡ 1 560 827/ΡΤExample 311E 1-Benzyl-3- (6-chloro-1,1-dioxido-4H-thieno [3,2- e] [1,2,4] thiadiazin-3-yl) -4-hydroxyquinolin-2- 1H) -one The title compound was prepared according to the procedure of Example 309H, substituting the product of Example 311D for the product of Example 309G in the presence of diisopropylethylamine (3 equivalents). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ ppm 16.97 (s, 1 H) 8.11 (d, J = 8.09 Hz, 1 H) 7.20 (m, 9H) 5.40 (s, 2H). 313 ΕΡ 1 560 827 / ΡΤ

Exemplo 312Α 5-bromo-4-nitro-lH-imidazole 4-Bromo-lH-imidazole (2,0 g, 13,6 mmol) reagiu com ácido nítrico concentrado (0,947 mL, 14,96 mmol) em ácido sulfúrico concentrado (20 mL) a 110°C durante 1 hora. A reacção foi arrefecida até 25°C e vertida em 200 mL de água gelada. O precipitado branco resultante foi recolhido por filtração para gerar o composto em título (2,3 g, 87%). MS (ESI-) m/z 191 (ΜΗ)-. 1H RMN (300 MHz, DMSO-d6) δ ppm 7,99 (s, 1H) .Example 312 5-Bromo-4-nitro-1H-imidazole 4-Bromo-1H-imidazole (2.0 g, 13.6 mmol) was reacted with concentrated nitric acid (0.947 mL, 14.96 mmol) in concentrated sulfuric acid ( 20 mL) at 110 ° C for 1 hour. The reaction was cooled to 25 ° C and poured into 200 mL of ice water. The resulting white precipitate was collected by filtration to give the title compound (2.3 g, 87%). MS (ESI-) m / z 191 (ΜΗ) -. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 7.99 (s, 1H).

Exemplo 312B l-benzil-5-bromo-4-nitro-lH-imidazoleExample 312B 1-benzyl-5-bromo-4-nitro-1H-imidazole

Uma solução do produto do Exemplo 312A (2,3 g, 11,98 mmol) em Ν,Ν-dimetilformamida anidra (40 mL) a 25°C reagiu com bicarbonato de sódio (2,0 g, 24 mmol) e adição gota a gota de brometo de benzilo (1,58 mL, 13,17 mmol). A reacção foi agitada durante 12 horas adicionais a 25°C. A reacção foi concentrada sob pressão reduzida e o resíduo foi repartido entre acetato de etilo e água. A fase orgânica foi seca sobre MgS04, filtrada e concentrada sob pressão reduzida. O resíduo foi purificado por cromatografia de fase inversa em coluna numa coluna C18, eluindo com um gradiente de acetonitrilo em água contendo ácido trifluoroacético a 0,1% (5:95 a 100) para gerar o composto em título (1,63 g, 48%). MS (ESI+) m/z 284 (M+H)+. 1H RMN (300 MHz, DMSO-d6) δ ppm 5,38 (s, 2H), 7,24- 7,42 (m, 5H), 8,28 (s, 1H).A solution of the product of Example 312A (2.3 g, 11.98 mmol) in anhydrous β-dimethylformamide (40 mL) at 25 ° C was reacted with sodium bicarbonate (2.0 g, 24 mmol) and drop addition the drop of benzyl bromide (1.58 mL, 13.17 mmol). The reaction was stirred an additional 12 hours at 25 ° C. The reaction was concentrated under reduced pressure and the residue was partitioned between ethyl acetate and water. The organic phase was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by reverse phase column chromatography on a C18 column, eluting with a gradient of acetonitrile in water containing 0.1% trifluoroacetic acid (5:95 to 100) to give the title compound (1.63 g, 48%). MS (ESI +) m / z 284 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 5.38 (s, 2H), 7.24-7.42 (m, 5H), 8.28 (s, 1H).

Exemplo 312C l-benzil-4-nitro-lf7-imidazole-5-tiolato de amónioExample 312C 1-Benzyl-4-nitro-1,7-imidazole-5-thiolate

Uma solução do produto do Exemplo 312B em hidróxido de amónio 5N (16 mL) e dioxano (10 mL) a 35°C foi borbulhada com sulfureto de hidrogénio gás durante 15 minutos. O vaso reaccional foi depois selado e a agitação foi mantida durante 1 hora. A reacção foi purgada com azoto gás durante 10 minutos e concentrada sob pressão reduzida para gerar o composto em título. 314A solution of the product of Example 312B in 5N ammonium hydroxide (16 mL) and dioxane (10 mL) at 35 ° C was bubbled with hydrogen sulfide gas for 15 minutes. The reaction vessel was then sealed and stirring was continued for 1 hour. The reaction was purged with nitrogen gas for 10 minutes and concentrated under reduced pressure to give the title compound. 314

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 312D cloreto de l-benzil-4-nitro-liJ-imidazole-5-sulfoniloExample 312D 1-Benzyl-4-nitro-N-imidazole-5-sulfonyl chloride

Uma solução do produto do Exemplo 312C em HC1 IN (20 mL) e dioxano (10 mL) a 30°C foi borbulhada com cloro gás durante 15 minutos. O vaso reaccional foi depois selado e a mistura reaccional agitada durante 1 hora. A adição de cloro foi repetida como anteriormente e a mistura reaccional foi agitada durante 1 hora adicional. A reacção foi arrefecida num banho de gelo. Juntou-se água fria à reacção e o precipitado resultante foi recolhido por filtração para gerar o composto em título (1,51 g, 87% para 2 passos). 1H RMN (300 MHz, DMSO-d6) δ ppm 5,57 (s, 2H) , 7, 27-7, 40 (m, 5H) , 7,74 (s, 1H) .A solution of the product of Example 312C in 1N HCl (20 mL) and dioxane (10 mL) at 30 ° C was bubbled with chlorine gas for 15 minutes. The reaction vessel was then sealed and the reaction stirred for 1 hour. The addition of chlorine was repeated as above and the reaction mixture was stirred for an additional 1 hour. The reaction was cooled in an ice bath. Cold water was added to the reaction and the resulting precipitate was collected by filtration to give the title compound (1.51 g, 87% for 2 steps). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 5.57 (s, 2H), 7.27-7.40 (m, 5H), 7.74 (s, 1H).

Exemplo 312E l-benzil-4-nitro-li7-imidazole-5-sulf onamidaExample 312E 1-benzyl-4-nitro-17-imidazole-5-sulfonamide

Uma solução do produto do Exemplo 312D (1,5 g, 4,97 mmol) em dioxano (25 mL) a 25°C foi borbulhada com amoníaco gás durante 10 minutos. O vaso reaccional foi depois selado e a mistura reaccional foi agitada mais 30 minutos. O anterior processo foi repetido. A mistura reaccional foi concentrada sob pressão reduzida e o resíduo foi lavado com água fria várias vezes para gerar o composto em título (1,27 g, 90%). MS (ESI-) m/z 281 (M-H)”. XH RMN (300 MHz, DMSO-d6) δ ppm 5,61 (s, 2H), 7,26-7,42 (m, 5H), 8,17 (s, 1H).A solution of the product of Example 312D (1.5 g, 4.97 mmol) in dioxane (25 mL) at 25 ° C was bubbled with ammonia gas for 10 minutes. The reaction vessel was then sealed and the reaction mixture was stirred an additional 30 minutes. The above process was repeated. The reaction mixture was concentrated under reduced pressure and the residue was washed with cold water several times to give the title compound (1.27 g, 90%). MS (ESI-) m / z 281 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 5.61 (s, 2H), 7.26-7.42 (m, 5H), 8.17 (s, 1H).

Exemplo 312F 4-amino-l-benzil-lH-imidazole-5-sulfonamidaExample 312F 4-Amino-1-benzyl-1H-imidazole-5-sulfonamide

Uma solução do produto do Exemplo 312E (434 mg, 1,54 mmol) em ácido acético (4,3 mL) e dioxano (4,3 mL) reagiu com ferro em pó (343 mg, 6,15 mmol) a 50°C durante 3 horas. A mistura reaccional foi arrefecida até 25°C, filtrada através de uma almofada de celite® (terra de diatomáceas) e o filtrado foi concentrado sob pressão reduzida. O resíduo foi dissolvido em diclorometano e lavado com uma solução saturada de bicarbonato de sódio aquoso. A fase aquosa foi extraída com diclorometano (2x) e as fases orgânicas combinadas foram secas sobre sulfato de magnésio, filtradas e concentradas sob pressão reduzida. O resíduo foi cromatografado em sílica gel utilizando um gradiente de metanol em diclorometano (0-5%) 315 ΕΡ 1 560 827/ΡΤ para gerar ο composto em título (180 mg, 46%) . MS (ESI+) m/z 253 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ ppm 5,24 (s,2H), 7,22-7,39 (m, 5H), 7,43 (s, 1H).A solution of the product of Example 312E (434 mg, 1.54 mmol) in acetic acid (4.3 mL) and dioxane (4.3 mL) was reacted with powdered iron (343 mg, 6.15 mmol) at 50 ° C for 3 hours. The reaction mixture was cooled to 25 ° C, filtered through a pad of celite® (diatomaceous earth) and the filtrate was concentrated under reduced pressure. The residue was dissolved in dichloromethane and washed with a saturated aqueous sodium bicarbonate solution. The aqueous layer was extracted with dichloromethane (2x) and the combined organic phases were dried over magnesium sulfate, filtered and concentrated under reduced pressure. The residue was chromatographed on silica gel using a gradient of methanol in dichloromethane (0-5%) 315E-1560-82 / ΡΤ to give the title compound (180mg, 46%). MS (ESI +) m / z 253 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 5.24 (s, 2H), 7.22-7.39 (m, 5H), 7.43 (s, 1H).

Exemplo 312G l-benzil-3-(7-benzil-l,l-dioxido-4,7-di-hidroimidazo[4,5-e]-[1,2,4]tiadiazin-3-il)-4-hidroxiquinolin-2(1H)-ona 0 produto do Exemplo 312F (152 mg, 0,602 mmol) reagiu com o produto do Exemplo 309B (214 mg, 0,602 mmol) em tolueno (8 mL) a 100°C durante 3 horas. A reacção foi deixada arrefecer até 25°C e diluída com hexanos. O precipitado resultante foi recolhido por filtração. O resíduo foi cromatografado em sílica gel, eluindo com gradiente de 0-2% de metanol em diclorometano para gerar o composto em título (155 mg, 50%). MS (ESI+) m/z 512 (M+H)+. 1H RMN (300 MHz, DMSO-d6) δ ppm 5,42 (s, 2H), 5,63 (s, 2H), 7,22-7,44 (m, 11H), 7,53-7,56 (m, 1H), 7, 74-7, 79 (m, 1H), 8,20-8, 23 (dd, J=8,l,l,5 Hz, 1H), 8,32 (s, 1H) .Example 312G 1-benzyl-3- (7-benzyl-1,1-dioxido-4,7-dihydroimidazo [4,5-e] - [1,2,4] thiadiazin-3-yl) -4- hydroxyquinolin-2 (1H) -one The product of Example 312F (152 mg, 0.602 mmol) was reacted with the product of Example 309B (214 mg, 0.602 mmol) in toluene (8 mL) at 100 ° C for 3 hours. The reaction was allowed to cool to 25 ° C and diluted with hexanes. The resulting precipitate was collected by filtration. The residue was chromatographed on silica gel, eluting with 0-2% methanol gradient in dichloromethane to give the title compound (155 mg, 50%). MS (ESI +) m / z 512 (M + H) +. 1 H NMR (300 MHz, DMSOd 6) δ ppm 5.42 (s, 2H), 5.63 (s, 2H), 7.22-7.44 (m, 11H), 7.53-7.56 (m, 1H), 7.74-7.79 (m, 1H), 8.20-8.23 (dd, J = 8.1,1.5Hz, 1H), 8.32 (s, 1H ).

Exemplo 313 l-benzil-3-(1,l-dioxido-4,7-di-hidroimidazo[4,5-e][1,2,4]— tiadiazin-3-il)-4-hidroxiguinolin-2(1H)-ona O produto do Exemplo 312 (19,35 mg, 0,0378 mmol) em dimetilsulfóxido anidro (2,5 mL) reagiu com uma solução de tert-butóxido de potássio em tetra-hidrofurano (1M, 0,265 mL, 0,265 mmol) a 25°C durante 12 horas. A reacção foi neutralizada pela adição de solução saturada de cloreto de amónio aquoso e extraída com diclorometano. A fase aquosa foi tornada básica com uma solução de bicarbonato de sódio e extraída duas vezes com diclorometano. As fases orgânicas combinadas foram combinadas, secas sobre sulfato de magnésio, filtradas e concentradas sob pressão reduzida. O resíduo foi cromatografado numa coluna C18 de fase inversa eluindo com 5%-100% de acetonitrilo em água contendo ácido trifluoroacético a 0,1% para gerar o composto em título (17 mg, 81%). MS (ESI-) m/z 420 (M-H) ”. 1H RMN (300 MHz, DMSO-d6) /CF3COOD) δ ppm 5,6 (s, 2H), 7,17-7,27 (m, 5H), 7, 35-7, 40 (t, J=7,64 Hz, 1H) , 7,51-7,63 (d, J=8,3 Hz, 1H), 7,69-7,73 (t, J=8,8 Hz, 1H), 8,0-8,01 (m, 1H), 8,18-8,20 (dd, J=8,3, 1,2 Hz, 1H). 316 ΕΡ 1 560 827/ΡΤExample 313 1-benzyl-3- (1,1-dioxido-4,7-dihydroimidazo [4,5-e] [1,2,4] thiadiazin-3-yl) -4-hydroxyquinolin-2- 1H) -one The product of Example 312 (19.35 mg, 0.0378 mmol) in anhydrous dimethylsulfoxide (2.5 mL) was reacted with a solution of potassium tert-butoxide in tetrahydrofuran (1M, 0.265 mL, 0.265 mmol) at 25 ° C for 12 hours. The reaction was quenched by the addition of saturated aqueous ammonium chloride solution and extracted with dichloromethane. The aqueous phase was made basic with a solution of sodium bicarbonate and extracted twice with dichloromethane. The combined organic phases were combined, dried over magnesium sulfate, filtered and concentrated under reduced pressure. The residue was chromatographed on a reverse phase C18 column eluting with 5% -100% acetonitrile in water containing 0.1% trifluoroacetic acid to give the title compound (17 mg, 81%). MS (ESI-) m / z 420 (M-H). 1 H NMR (300 MHz, DMSO-d 6)? CD 3 COOD) δ ppm 5.6 (s, 2H), 7.17-7.27 (m, 5H), 7.35-7.40 (t, J = 7) 1H), 7.51-7.63 (d, J = 8.3 Hz, 1H), 7.69-7.73 (t, J = 8.8 Hz, 1H), 8.0 -8.01 (m, 1H), 8.18-8.20 (dd, J = 8.3, 1.2 Hz, 1H). 316 ΕΡ 1 560 827 / ΡΤ

Exemplo 314 Ν2-{3-[4-hidroxl-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1, 8-na£tiridin-3-il]-1,l-dioxido-4fl-l, 2,4-benzotiadiazin-7-11}qlicinamidaExample 314 2- {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxide -4fl-1,2,4-benzothiadiazin-7-yl} glycinamide

Uma solução do produto do Exemplo 206 (10, 8 mg, 0,023 mmol) em ácido sulfúrico concentrado (0,6 mL) foi tratada com adição lenta de água (0,1 mL) e a solução amarela foi agitada a 25°C durante 18 horas. A mistura reaccional foi vertida sobre gelo, o pH foi ajustado a pH 9 com NaOH a 50% e solução aguosa de bicarbonato de sódio. A mistura foi extraida com acetato de etilo (3 x 20 mL) . As fases orgânicas combinadas foram lavadas com água, salmoura, secas sobre sulfato de magnésio e filtradas. O filtrado concentrado sob pressão reduzida para gerar o composto em titulo como um sólido amarelo (9,1 mg, 83%). MS (ESI-) m/z 483 (M-H)'. :Η RMN (300 MHz, DMSO-d6) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,49 (m, 2H) 1,64 (m, 1H) 3,63 (d, J= 5,52 Hz, 2H) 4,30 (m, 2H) 6,23 (br s, 1H) 6,69 (s, 1H) 6,87 (d, J=7,35 Hz, 1H) , 7,12 (s, 3H) 7,42 (s,A solution of the product of Example 206 (10.8 mg, 0.023 mmol) in concentrated sulfuric acid (0.6 mL) was treated with slow addition of water (0.1 mL) and the yellow solution was stirred at 25 ° C for 18 hours. The reaction mixture was poured onto ice, the pH adjusted to pH 9 with 50% NaOH and aqueous sodium bicarbonate solution. The mixture was extracted with ethyl acetate (3 x 20 mL). The combined organic phases were washed with water, brine, dried over magnesium sulfate and filtered. The filtrate is concentrated under reduced pressure to give the title compound as a yellow solid (9.1 mg, 83%). MS (ESI-) m / z 483 (M-H) +. NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.49 (m, 2H) 1.64 (m, 1H) 3.63 (d, J = 5.52 Hz, 2 H) 4.30 (m, 2 H) 6.23 (br s, 1 H) 6.69 (s, 1 H) 6.87 (d, J = 7.35 Hz, 1H), 7.12 (s, 3H) 7.42 (s,

1H) 8,36 (d, J=7,35 Hz, 1H) 8,52 (s, 1H) 15,62 (br s, 1H) . O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ ppm 0,96 (d, J=6,62 Hz, 6H) 1,48 (m, 2H) 1,64 (m, 1H) 3,62 (d, J=5,88 Hz, 2H) 4,29 (m, 2H) 6,20 (m, 1H) 6,68 (d, J=2,57 Hz, 1H) 6,86 (m, 1H) 7,41 (m, 3H) 8,35 (dd, J=7,72, 1,8Hz, 1H) 8,50 (dd, J=4,78, 1,84 Hz, 1H) 15,63 (s, 1H).1H) 8.36 (d, J = 7.35 Hz, 1 H) 8.52 (s, 1 H) 15.62 (br s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) 1.64 (m, 1H) 3.62 (d, J = = 5.88 Hz, 2 H) 4.29 (m, 2 H) 6.20 (m, 1 H) 6.68 (d, J = 2.57 Hz, 1 H) 6.86 (m, 1 H) 7.41 (m, 3H), 8.35 (dd, J = 7.72, 1.8 Hz, 1 H) 8.50 (dd, J = 4.78, 1.84 Hz, 1 H) 15.63 (s, 1H) .

Exemplo 315A l-butil-4-hidroxi-l,8-naftiridin-2(lH)-onaExample 315A 1-Butyl-4-hydroxy-1,8-naphthyridin-2 (1H) -one

Uma lama do produto do Exemplo 89A (3,24 g, 11,16 mmol) em hidróxido de sódio 2N (100 mL) foi aquecida a refluxo durante 3 horas, arrefecida até 10°C e tratada gota a gota com ácido clorídrico concentrado até pH de 3 constante. O resultante sólido branco foi recolhido por filtração, lavado com água e seco para gerar o composto em título (2,47 g, quantitativo). MS (APCI+) m/z 219 (M+H) + . XH RMN (300 MHz, DMSO-d6) δ ppm 0,90 (t, J=7, 35 Hz , 3H) 1,32 (m, 2H) 1,57 (m, 2H) 4,31 (m, 2H) 5,89 (s, 1H) 7, 27 (dd, J=7, 72, 4,78 Hz, 1H) 8,23 (dd, J=7, 72, 1,84 Hz, 1H) 8, 64 (dd, J=4,78, 1,84 Hz, 1H) 11,61 (s, 1H) . 317A slurry of the product of Example 89A (3.24 g, 11.16 mmol) in 2N sodium hydroxide (100 mL) was heated at reflux for 3 hours, cooled to 10 ° C and treated dropwise with concentrated hydrochloric acid until pH of 3 constant. The resulting white solid was collected by filtration, washed with water and dried to give the title compound (2.47 g, quantitative). MS (APCI +) m / z 219 (M + H) +. 1 H NMR (300 MHz, DMSOd 6) δ ppm 0.90 (t, J = 7, 35 Hz, 3H) 1.32 (m, 2H) 1.57 (m, 2H) 4.31 (m, 2H ) 5.89 (s, 1H) 7.27 (dd, J = 7.72, 4.78 Hz, 1 H) 8.23 (dd, J = 7.72, 1.84 Hz, 1 H) 8.64 (dd, J = 4.78, 1.84 Hz, 1 H) 11.61 (s, 1H). 317

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 315B 3-[bis(metiltio)metileno]-1-butil-l, 8-naftiridina-2, 4(1H, 3H)-diona O composto em título foi preparado de acordo com o procedimento do Exemplo 309B substituindo pelo produto do Exemplo 315A o produto do Exemplo 309A . ΧΗ RMN (300 MHz, CDCC13) δ ppm 0,97 (t, J=7,35 Hz, 3H) 1,44 (dd, J=15,44, 7,35 Hz, 2H) 1,69 (m, 2H) 2,64 (s, 6H) 4,39 (m, 2H) 7,10 (dd, J=7,72, 4,78 Hz, 1H) 8,45 (dd, J=7,72, 1,84 Hz, 1H) 8,56 (dd, J=4, 60, 2, 02 Hz, 1H) .Example 315B 3- [Bis (methylthio) methylene] -1-butyl-1,8-naphthyridine-2,4 (1H, 3H) -dione The title compound was prepared according to the procedure of Example 309B substituting Example 315A The product of Example 309A. 1 H NMR (300 MHz, CDCl 3) δ ppm 0.97 (t, J = 7.35 Hz, 3 H) 1.44 (dd, J = 15.44, 7.35 Hz, 2H) 2.64 (s, 6H) 4.39 (m, 2H) 7.10 (dd, J = 7.72, 4.78 Hz, 1 H) 8.45 (dd, J = 7.72, 1 , 84 Hz, 1 H) 8.56 (dd, J = 4.60, 2.02 Hz, 1H).

Exemplo 315C l-butil-4-hidroxi-3-{7-[(metoximetoxi)metil]-1, l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-3-il}—1,8-naftiridin-2(1H)-ona O produto do Exemplo 309G (110 mg, 0,43 mmol) e o produto do Exemplo 315B (140,6 mg, 0,43 mmol) reagiram em tolueno (5 mL) a 100°C durante 3 horas. A reacção foi concentrada sob pressão reduzida e o resíduo foi purificado por cromatografia em sílica gel usando uma coluna Biotage-12m eluindo com metanol:diclorometano 1:99 para gerar o composto em título como um sólido branco (114 mg, 54,6%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz,CDCCl3) δ ppm 1,00 (t, J=7,35Example 315C 1-Butyl-4-hydroxy-3- {7 - [(methoxymethoxy) methyl] -1,1-dioxido-4H-thieno [2,3- e] [1,2,4] thiadiazin-3-yl The product of Example 309G (110 mg, 0.43 mmol) and the product of Example 315B (140.6 mg, 0.43 mmol) were reacted in toluene (5 g). ml) at 100 ° C for 3 hours. The reaction was concentrated under reduced pressure and the residue was purified by silica gel chromatography using a Biotage-12m column eluting with 1:99 methanol: dichloromethane to give the title compound as a white solid (114 mg, 54.6% . The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, CDCl3) δ ppm 1.00 (t, J = 7.35

Hz, 3H) , 1,46 (m, 2H) , 1,74 (m, 2H), 3,45 (s, 3H), 4,56 (m, 2H), 4,80 (s, 2H), 4,84 (s, 2H), 7,09 (s, 1H), 7,26 (s, 1H), 7,36 (dd, J=8,09, 4,41 Hz, 1H), 8,57 (dd, J=8,09, 1,84 Hz, 1H), 8,81 (dd, J=4,78, 1,84 Hz, 1H), 15,06 (s, 1H), 15,11 (s, 1H).3H), 1.46 (m, 2H), 1.74 (m, 2H), 3.45 (s, 3H), 4.56 (m, 2H), 4.80 (s, 2H), 4.84 (s, 2H), 7.09 (s, 1H), 7.26 (s, 1H), 7.36 (dd, J = 8.09, 4.41 Hz, 1H), 8.57 (dd, J = 4.78, 1.84 Hz, 1H), 15.06 (s, 1H), 15.11 (dd, J = s, 1H).

Exemplo 316 l-butil-4-hidroxi-3-[7-(hidroximetil)-1,l-dioxido-4ff-tieno-[2,3-e] [1,2,4] tiadiazin-3-il] -1, 8-naft ir idin-2 (1H) -ona O produto do Exemplo 315C (92 mg, 0,19 mmol) reagiu com ácido clorídrico aquoso 6N (4 mL) e tetra-hidrofurano (8 mL) a 70°C durante 3 horas. A reacção foi concentrada sob pressão reduzida para remover o tetra-hidrofurano e tratada com metanol (5 mL) . O precipitado resultante foi recolhido por filtração e lavado com água e éter dietílico para gerar o composto em título como um sólido branco (65 mg, 77,8%). O sal 318 ΕΡ 1 560 827/ΡΤ de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, CDC13) δ ppm 1,00 (t, J=7,35 Hz, 3H), 1,47 (dd, J=15,26, 7,54 Hz, 2H), 1,73 (m, 2H) 4,57 (m, 2H) , 4,86 (s, 2H), 7,07 (s, 1H) , 7,37 (dd, J=8, 09, 4, 78 Hz, 1H), 8,58 (dd, J=8, 09, 1, 84 Hz, 1H), 8,82 (dd, J=4,60, 2,02 Hz, 1H), 14,94 (s, 1H), 15,24 (s, 1H).Example 316 1-Butyl-4-hydroxy-3- [7- (hydroxymethyl) -1,1-dioxido-4 H -thieno [2,3- e] [1,2,4] thiadiazin-3-yl] - The product from Example 315C (92 mg, 0.19 mmol) was reacted with 6N aqueous hydrochloric acid (4 mL) and tetrahydrofuran (8 mL) at 70 ° C for 3 hours. The reaction was concentrated under reduced pressure to remove the tetrahydrofuran and treated with methanol (5 mL). The resulting precipitate was collected by filtration and washed with water and diethyl ether to give the title compound as a white solid (65 mg, 77.8%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, CDCl 3) δ ppm 1.00 (t, J = 7.35 Hz, 3H), 1.47 (dd, J = 15.26, 2H), 4.76 (s, 2H), 7.07 (s, 1H), 7.37 (dd, J = 8.94, 4.78 Hz, 1H) , 8.58 (dd, J = 8.09, 1.84 Hz, 1H), 8.82 (dd, J = 4.60, 2.02 Hz, 1H), 14.94 (s, 1H), 15.24 (s, 1H).

Exemplo 317A 4-(aminosulfonil)-5-nitrotiofeno-3-carboxilato de metiloExample 317A Methyl 4- (aminosulfonyl) -5-nitrothiophene-3-carboxylate

Uma solução do produto do Exemplo 309A (2 g, 6,5 mmol) em diclorometano (38 mL) e ácido clorídrico aquoso 1,5N (21 mL) a 0°C foi borbulhada com cloro gás durante 30 minutos. O vaso reaccional foi depois selado e agitado durante mais 1 hora. Azoto gás foi borbulhado através da reacção para dispensar o cloro, seguindo-se a adição de bissulfito de sódio sólido (5,12 g) com agitação durante 5 minutos. Juntaram-se à reacção diclorometano (10 mL) e água (10 mL) . A fase orgânica foi separada e eluída através de 20 g de uma mistura 1:1 de sulfato de magnésio e sulfato de sódio. O filtrado foi concentrado sob pressão reduzida e o resíduo triturado com hexanos para gerar o cloreto de sulfonilo como um sólido branco (1,8 g, 97%). Uma solução do cloreto de sulfonilo em bruto (1,5 g) em diclorometano (15 mL) a -40°C foi borbulhada com amoníaco gás ao longo de um período do 5 minutos. O vaso reaccional foi depois selado e agitado durante outros 15 minutos. Azoto gás foi borbulhado na mistura reaccional para dispensar o amoníaco. A reacção foi concentrada sob pressão reduzida enquanto era mantida a temperatura abaixo de 0°C. O resíduo foi cromatografado em sílica gel utilizando uma coluna Biotage-40s eluindo com metanol:diclorometano 5:95 para gerar um óleo. Este óleo foi triturado com uma mistura de 5% de metanol:diclorometano (20 mL) e hexanos (20 mL), para gerar o composto em título como um sólido amarelo (0,75 g, 54%). XH RMN (300 MHz, DMSO-d6) δ ppm 3,81 (s, 3H) , 7,88 (s, 2H), 8,31 (s, 1H).A solution of the product of Example 309A (2 g, 6.5 mmol) in dichloromethane (38 mL) and 1.5N aqueous hydrochloric acid (21 mL) at 0 ° C was bubbled with chlorine gas for 30 minutes. The reaction vessel was then sealed and stirred for an additional 1 hour. Nitrogen gas was bubbled through the reaction to dispense chlorine, followed by the addition of solid sodium bisulfite (5.12 g) with stirring for 5 minutes. Dichloromethane (10 mL) and water (10 mL) were added to the reaction. The organic phase was separated and eluted through 20 g of a 1: 1 mixture of magnesium sulfate and sodium sulfate. The filtrate was concentrated under reduced pressure and the residue triturated with hexanes to give the sulfonyl chloride as a white solid (1.8 g, 97%). A solution of the crude sulfonyl chloride (1.5 g) in dichloromethane (15 mL) at -40 ° C was bubbled with ammonia gas over a period of 5 minutes. The reaction vessel was then sealed and stirred for another 15 minutes. Nitrogen gas was bubbled into the reaction mixture to dispense the ammonia. The reaction was concentrated under reduced pressure while maintaining the temperature below 0 ° C. The residue was chromatographed on silica gel using a Biotage-40s column eluting with 5:95 methanol: dichloromethane to give an oil. This oil was triturated with a mixture of 5% methanol: dichloromethane (20 mL) and hexanes (20 mL), to give the title compound as a yellow solid (0.75 g, 54%). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.81 (s, 3H), 7.88 (s, 2H), 8.31 (s, 1H).

Exemplo 317B 5-amino-4-(aminosulfonil)tiofeno-3-carboxilato de metilo O produto do Exemplo 317A (0,75 g, 2,86 mmol) reagiu com ferro em pó (0,64 g, 4 equivalentes) em ácido acético (30 mL) 319 ΕΡ 1 560 827/ΡΤ a 50°C durante 7,5 horas. A reacção foi concentrada sob pressão reduzida e o resíduo foi lavado em 5% de metanol:diclorometano (20 mL) e água (2 mL) e filtrado através de uma coluna curta de silica gel (20 g) gue foi lavada com 5% de metanol: diclorometano (200 mL). O filtrado foi concentrado sob pressão reduzida e o resíduo foi cromatografado em silica gel utilizando uma coluna Biotage-12s eluindo com acetato de etilo/hexano 1:1 para gerar o composto em titulo como um sólido amarelo (0,527 g, 78%). XH RMN (300 MHz, DMSO-dô) δ ppm 3,77 (s, 3H), 6,84 (s, 2H), 6,88 (s, 2H), 7,28 (s, 1H).Example 317B Methyl 5-amino-4- (aminosulfonyl) thiophene-3-carboxylate The product from Example 317A (0.75 g, 2.86 mmol) was reacted with iron powder (0.64 g, 4 equivalents) in acetic acid (30 mL) 319 Ρ Ρ 1 560 827 / ΡΤ at 50 ° C for 7.5 hours. The reaction was concentrated under reduced pressure and the residue was washed with 5% methanol: dichloromethane (20 mL) and water (2 mL) and filtered through a short silica gel column (20 g) which was washed with 5% methanol: dichloromethane (200 mL). The filtrate was concentrated under reduced pressure and the residue was chromatographed on silica gel using a Biotage-12s column eluting with 1: 1 ethyl acetate / hexane to give the title compound as a yellow solid (0.527 g, 78%). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 3.77 (s, 3H), 6.84 (s, 2H), 6.88 (s, 2H), 7.28 (s, 1H).

Exemplo 317C 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-4H-tieno-[2,3-e][1,2,4]tiadiazina-7-carboxilato de metilo, 1,1-dióxido O produto do Exemplo 317B (180 mg, 0,76 mmol) e o produto do Exemplo 309B (270 mg, 0,76 mmol) reagiram em tolueno (15 mL) a 100°C durante 3 horas. A reacção foi arrefecida até 25°C e o precipitado resultante foi recolhido por filtração, lavado com tolueno e éter dietilico para gerar o composto em título (302 mg, 80%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ ppm 3,85 (s, 3H) , 5,61 (s, 2H), 7,29 (m, 5H), 7,40 (m, 1H), 7,52 (m, 1H), 7,74 (m, 1H), 8,21 (d, J=7,72 Hz, 1H), 8,26 (s, 1H).Example 317C 3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -4H-thieno [2,3- e] [1,2,4] thiadiazine- 7-carboxylate, 1,1-dioxide The product of Example 317B (180 mg, 0.76 mmol) and the product of Example 309B (270 mg, 0.76 mmol) were reacted in toluene (15 mL) at 100 ° C for 3 hours. The reaction was cooled to 25 ° C and the resulting precipitate was collected by filtration, washed with toluene and diethyl ether to give the title compound (302 mg, 80%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSOd 6) δ ppm 3.85 (s, 3H), 5.61 (s, 2H), 7.29 (m, 5H), 7.40 (m, 1H) 52 (m, 1H), 7.74 (m, 1H), 8.21 (d, J = 7.72 Hz, 1H), 8.26 (s, 1H).

Exemplo 318 ácido 3- (l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-4fí-tieno [2,3-e] [1,2,4] tiadiazina-7-carboxílico, 1,1-dióxido O produto do Exemplo 317C (90 mg, 0,09 mmol) reagiu com uma solução de hidróxido de sódio aquoso IN (0,8 mL, 4,4 equivalentes) em etanol (2 mL) a 70°C durante 1,5 horas. A reacção foi filtrada e o filtrado foi acidificado com ácido clorídrico aquoso IN (0,8 mL). O precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietilico para gerar o composto em título (80 mg, 91,5%). XH RMN (300 MHz, DMSO-d6) δ ppm 5,62 (s, 2H), 7,29 (m, 5H) , 7,42 (t, J=7,54 Hz, 1H), 7,53 (d, J= 8,82 Hz, 1H) , 7,76 (t, J=7,17 Hz, 1H), 8,19 (s, 1H), 8,22 (dd, J=8,09,l,47 Hz, 1H). O di-sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D substituindo por dois 320 ΕΡ 1 560 827/ΡΤ equivalentes de hidróxido de sódio um equivalente de hidróxido de sódio.Example 318 3- (1-Benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -4H-thieno [2,3- e] [1,2,4] thiadiazine- 1,1-dioxide The product from Example 317C (90 mg, 0.09 mmol) was reacted with 1N aqueous sodium hydroxide solution (0.8 mL, 4.4 equivalents) in ethanol (2 mL) at 70 ° C for 1.5 hours. The reaction was filtered and the filtrate was acidified with 1N aqueous hydrochloric acid (0.8 mL). The resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound (80 mg, 91.5%). 1H NMR (300 MHz, DMSO-d6) δ ppm 5.62 (s, 2H), 7.29 (m, 5H), 7.42 (t, J = 7.54 Hz, 1H), 7.53 d, J = 8.82 Hz, 1H), 7.76 (t, J = 7.17 Hz, 1H), 8.19 (s, 1H), 8.22 (dd, J = , 47 Hz, 1H). The sodium di-salt of the title compound was prepared according to the procedure of Example 1D substituting two equivalents of sodium hydroxide and one equivalent of sodium hydroxide for two 320 æC 1 560 827 / ΡΤ equivalents.

Exemplo 319 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il) -4H-tieno[2,3-e][1,2, 41tiadiazina-7-carboxamida, 1,1-dióxido O produto do Exemplo 317C (25 mq, 0,05 mmol) foi suspenso em hidróxido de amónio (1 mL) e aquecido a 40°C durante 16 horas. A mistura reaccional foi arrefecida até 25°C, concentrada sob pressão reduzida para remover o excesso de amoníaco e juntou-se uma solução de HC1 IN (0,8 mL), MeOH (1 mL) e água (3 mL) à mistura reaccional. O precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em título (19 mg, 78,4%). 1R RMN (300 MHz, DMSO-d6) δ ppm 5,62 (s, 2H), 7,30 (m, 7H), 7,41 (t, J=7,54 Hz, 1H) , 7,53 (m, 2H), 7,76 (m, 2H), 7,98 (s, 1H), 8,22 (m, 1H) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D.Example 319 3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -4H-thieno [2,3- e] [1,2,4] thiadiazine-7-carboxamide , 1,1-dioxide The product of Example 317C (25 mq, 0.05 mmol) was suspended in ammonium hydroxide (1 mL) and heated at 40 ° C for 16 hours. The reaction mixture was cooled to 25øC, concentrated under reduced pressure to remove excess ammonia and a solution of 1N HCl (0.8 mL), MeOH (1 mL) and water (3 mL) was added to the reaction mixture . The resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound (19 mg, 78.4%). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 5.62 (s, 2H), 7.30 (m, 7H), 7.41 (t, J = 7.54 Hz, m, 2H), 7.76 (m, 2H), 7.98 (s, 1H), 8.22 (m, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D.

Exemplo 320A 3-[7-(benziloxi)-1,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il] -l-{[ciclopropilmetileno]amino}-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 304F (0,800 g, 1,73 mmol) e ciclopropanocarboxaldeído (1,60 mL, 20,76 mmol) em N,N-dimetilacetamida (2 mL) reagiram a 120°C durante 60 minutos num reactor de microondas num tubo selado. A reacção foi concentrada sob uma corrente de azoto aquecida através de uma tubagem aquecida a 165°C. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,750 g, 84%).Example 320A 3- [7- (benzyloxy) -1,1-dioxido-4,11,2-benzothiadiazin-3-yl] -1 - {[cyclopropylmethylene] amino} -4-hydroxyquinolin-2 (1H) - one The product of Example 304F (0.800 g, 1.73 mmol) and cyclopropanecarboxaldehyde (1.60 mL, 20.76 mmol) in N, N-dimethylacetamide (2 mL) were reacted at 120 ° C for 60 minutes in a microwave reactor in a sealed tube. The reaction was concentrated under a heated nitrogen stream through a pipeline heated to 165 ° C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.750 g, 84%).

Exemplo 320B 3- [7- (benziloxi) -1, l-dioxido-4i7-l, 2, 4-benzotiadiazin-3-il] -1-[(ciclopropilmetil)amino]-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 320A (0,75 g, 1,46 mmol) em tetra-hidrofurano (8 mL) e metanol (0,100 mL) a 0°C reagiu com boro-hidreto de lítio (solução 2,0M em tetra-hidrofurano, 1,0 mL, 2,0 mmol). A reacção foi agitada a 25°C durante 1 hora e 321 ΕΡ 1 560 827/ΡΤ depois diluída com ácido clorídrico aquoso 1M e filtrada. O produto foi purificado por trituração com metilsulfóxido, filtrado e seco para gerar o composto em título (0,296 g, 40%).Example 320B 3- [7- (Benzyloxy) -1,1-dioxido-4-1,2,4-benzothiadiazin-3-yl] -1 - [(cyclopropylmethyl) amino] -4-hydroxyquinolin-2 (1H) - one The product from Example 320A (0.75 g, 1.46 mmol) in tetrahydrofuran (8 mL) and methanol (0.100 mL) at 0 ° C was reacted with lithium borohydride (2.0M solution in tetrahydrofuran 1.0 mL, 2.0 mmol). The reaction was stirred at 25 ° C for 1 hour and then extracted with 1M aqueous hydrochloric acid and filtered. The product was purified by trituration with methylsulfoxide, filtered and dried to give the title compound (0.296 g, 40%).

Exemplo 320C 1-[(ciclopropilmetil)amino]-4-hidroxi-3-(7-hidroxi-l, 1-dioxido-4ff-l,2,4-benzotiadiazin-3-il)quinolin-2(1H)-ona O produto do Exemplo 320B (0,296 g, 0,57 mmol) em tetra-hidrofurano (15 mL) reagiu com uma quantidade catalítica de hidróxido de paládio sobre carbono, uma quantidade catalítica de paládio a 5% sobre carbono e formato de amónio (0,180 g, 2,85 mmol) a 60°C durante 2 horas. A mistura reaccional quente foi filtrada através de celite® (terra de diatomáceas) e o filtrado foi diluído com éter dietílico e o precipitado filtrado e seco para gerar o composto em título (0,127 g, 53%).Example 320C 1 - [(cyclopropylmethyl) amino] -4-hydroxy-3- (7-hydroxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) quinolin-2 (1H) -one The product of Example 320B (0.296 g, 0.57 mmol) in tetrahydrofuran (15 mL) was reacted with a catalytic amount of palladium hydroxide on carbon, a catalytic amount of 5% palladium on carbon and ammonium formate (0.180 g, 2.85 mmol) at 60 ° C for 2 hours. The hot reaction mixture was filtered through celite (diatomaceous earth) and the filtrate was diluted with diethyl ether and the precipitate filtered and dried to give the title compound (0.127 g, 53%).

Exemplo 320 D 2-[(3 — {1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l, l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il)-oxilacetamida O produto do Exemplo 320C (0,125 g, 0,29 mmol) reagiu com carbonato de césio (0,38 g, 1,17 mmol), 2-bromoacetamida (0,060 g, 0,43 mmol) e uma quantidade catalítica de iodeto de tetrabutilamónio em N,N-dimetilformamida (3 mL) a 25°C durante 2 horas. A reacção foi concentrada até metade do volume sob uma corrente de azoto aquecida através de uma tubagem aquecida a 165°C. A solução resultante foi diluída com água e o precipitado foi recolhido por filtração e seco para gerar o composto em título (0,134 g, 95%). MS (ESI-) m/z 482 (M-H)-. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-de) δ ppm 0,21 (m, J= 3,86, 2,39 Hz, 2H) 0,46 (m, 2H) 0,99 (m, 1H) 2,55 (m, 2H) 4,49 (s, 2H) 5,96 (t, J=6,43 Hz, 1H) 7,06 (m, 1H) 7,21 (m, 2H) 7,40 (m, 2H) 7,53 (m, 1H) 7,62 (m, J=l,84 Hz, 1H) 7,67 (d, J= 8,46 Hz, 1H) 8,07 (dd, J=8, 09, 1, 47 Hz, 1H) 16,25 (s, 1H) . 322 ΕΡ 1 560 827/ΡΤExample 320 D 2 - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H- The product of Example 320C (0.125 g, 0.29 mmol) was reacted with cesium carbonate (0.38 g, 1.17 mmol), 2-bromoacetamide (0.060 g, 0.43 mmol) and a catalytic amount of tetrabutylammonium iodide in N, N-dimethylformamide (3 mL) at 25 ° C for 2 hours. The reaction was concentrated to half the volume under a heated nitrogen stream through a pipeline heated to 165 ° C. The resulting solution was diluted with water and the precipitate was collected by filtration and dried to give the title compound (0.134 g, 95%). MS (ESI-) m / z 482 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d6) δ ppm 0.21 (m, J = 3.86, 2.39 Hz, 2H) 0.46 (m, 2H) 0.99 (m, 1H) 2.55 (m, m, 2H) 4.49 (s, 2H) 5.96 (t, J = 6.43 Hz, 1 H) 7.06 (m, 1 H) 7.21 (m, 2 H) 7.40 (m, 2H ) 7.53 (m, 1H) 7.62 (m, J = 1.84 Hz, 1 H) 7.67 (d, J = 8.46 Hz, 1 H) 8.07 (dd, J = 8.09 , 1.47 Hz, 1 H) 16.25 (s, 1H). 322 ΕΡ 1 560 827 / ΡΤ

Exemplo 321Α 3- [7-(benziloxi)-1,l-dioxido-4fl-l,2, 4-benzotiadiazin-3-il]- 4- hidroxl-l-{[2-metilpropilideno]amlno}qninolin-2(1H)-ona O produto do Exemplo 304F (0,150 g, 0,32 mmol) e isobutiraldeído (0,44 mL, 4,84 mmol) em N,N-dimetilacetamida (1,5 mL) reagiram a 125°C durante 40 minutos num reactor de microondas num tubo selado. A reacção foi concentrada sob uma corrente de azoto aquecida através de uma tubagem aquecida a 165°C. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,140 g, 84%).Example 321 3- [7- (Benzyloxy) -1,1-dioxido-4,11,2,4-benzothiadiazin-3-yl] -4-hydroxy-1 - {[2-methylpropylidene] amino} quinolin- 1H) -one The product of Example 304F (0.150 g, 0.32 mmol) and isobutyraldehyde (0.44 mL, 4.84 mmol) in N, N-dimethylacetamide (1.5 mL) were reacted at 125 ° C for 40 hours. minutes in a microwave reactor in a sealed tube. The reaction was concentrated under a heated nitrogen stream through a pipeline heated to 165 ° C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.140 g, 84%).

Exemplo 321B 3- [7-(benziloxi)-1,l-dioxido-4i7-l,2,4-benzotiadiazin-3-il]- 4- hidroxi-l-(isobutilamino)guinolin-2(1H)-ona O produto do Exemplo 321A (0,140 g, 0,27 mmol) em tetra-hidrofurano (3 mL) e metanol (0,020 mL) a 0°C reagiu com boro-hidreto de lítio (solução 2,0M em tetra-hidrofurano, 0,20 mL, 0,40 mmol). A reacção foi agitada a 25°C durante 1 hora e depois diluída com ácido clorídrico aquoso 1M e filtrada. O produto foi purificado por dissolução em tetra-hidrofurano, absorvido em sílica gel, carregado numa coluna de sílica gel e eluído com diclorometano. O filtrado foi evaporado até à secura sob pressão reduzida para gerar o composto em título (0,081 g, 58%).Example 321B 3- [7- (Benzyloxy) -1,1-dioxido-4-1,2,4-benzothiadiazin-3-yl] -4-hydroxy-1- (isobutylamino) guinolin-2 (1H) -one O The product of Example 321A (0.140 g, 0.27 mmol) in tetrahydrofuran (3 mL) and methanol (0.020 mL) at 0 ° C was reacted with lithium borohydride (2.0 M solution in tetrahydrofuran, 20 mL, 0.40 mmol). The reaction was stirred at 25 ° C for 1 hour and then diluted with 1M aqueous hydrochloric acid and filtered. The product was purified by dissolution in tetrahydrofuran, absorbed on silica gel, loaded onto a silica gel column and eluted with dichloromethane. The filtrate was evaporated to dryness under reduced pressure to give the title compound (0.081 g, 58%).

Exemplo 321C 4-hidroxi-3- (7-hidroxi-l, l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il)-1-(isobutilamino)quinolin-2(1H)-ona O produto do Exemplo 321B (0,081 g, 0,16 mmol) em tetra-hidrofurano (10 mL) reagiu com uma quantidade catalítica de hidróxido de paládio sobre carbono, uma quantidade catalítica de paládio a 5% sobre carbono e formato de amónio (0,040 g, 0,64 mmol) a 60°C durante 30 minutos. A mistura reaccional quente foi filtrada através de celite® (terra de diatomáceas) e o filtrado foi evaporado sob pressão reduzida para gerar o composto em título (0,048 g, 72%). 323 ΕΡ 1 560 827/ΡΤExample 321C 4-Hydroxy-3- (7-hydroxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (isobutylamino) quinolin-2 (1H) Example 321B (0.081 g, 0.16 mmol) in tetrahydrofuran (10 mL) was reacted with a catalytic amount of palladium hydroxide on carbon, a catalytic amount of 5% palladium on carbon and ammonium formate (0.040 g, , 64 mmol) at 60 ° C for 30 minutes. The hot reaction mixture was filtered through celite (diatomaceous earth) and the filtrate was evaporated under reduced pressure to give the title compound (0.048 g, 72%). 323 ΕΡ 1 560 827 / ΡΤ

Exemplo 321D 2- ({3-[4-hidroxi-l-(isobutilamino)-2-oxo-l,2-di-hidroquinolin- 3- il] -1, l-dioxido-4fl-l, 2, 4-benzotiadiazin-7-il}oxi) acetamida O produto do Exemplo 321C (0,048 g, 0,11 mmol) reagiu com carbonato de césio (0,11 g, 0,34 mmol), 2-bromoacetamida (0,023 g, 0,17 mmol) e uma quantidade catalítica de iodeto de tetrabutilamónio em N,N-dimetilformamida (3 mL) a 25°C durante 2 horas. A reacção foi concentrada até metade do volume sob uma corrente de azoto aquecida através de uma tubagem aquecida a 165°C. A solução resultante foi diluída com água e o precipitado foi recolhido por filtração e seco para gerar o composto em título (0, 042 g, 77%). MS (ESI-) m/z 484 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ ppm 1,03 (m, 6H) 1,86 (m, 1H) 3,25 (m, 2H) 4,50 (m, 2H) 5,94 (t, J=7,35 Hz, 1H) 7,07 (t, J=7, 72 Hz, 1H) 7,21 (m, 2H) 7,40 (s, 1H) 7,58 (m, 2H) 8,07 (dd, J=7, 72, 1, 47 Hz, 1H) 16,23 (s, 1H) .Example 321D 2 - ({3- [4-Hydroxy-1- (isobutylamino) -2-oxo-1,2-dihydroquinolin-3-yl] -1,1-dioxido-4 H -1,2,4- The product from Example 321C (0.048 g, 0.11 mmol) was reacted with cesium carbonate (0.11 g, 0.34 mmol), 2-bromoacetamide (0.023 g, 0.17 mmol) mmol) and a catalytic amount of tetrabutylammonium iodide in N, N-dimethylformamide (3 mL) at 25 ° C for 2 hours. The reaction was concentrated to half the volume under a heated nitrogen stream through a pipeline heated to 165 ° C. The resulting solution was diluted with water and the precipitate was collected by filtration and dried to give the title compound (0.042 g, 77%). MS (ESI-) m / z 484 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.03 (m, 6H) 1.86 (m, 1H) 3.25 (m, 2H) 4.50 (m, 2H) 5.94 (t, J = 7.35 Hz, 1 H) 7.07 (t, J = 7.72 Hz, 1 H) 7.21 (m, 2 H) 7.40 (s, 1 H) 7.58 (m, 07 (dd, J = 7, 72, 1, 47 Hz, 1 H) 16.23 (s, 1H).

Exemplo 322A 3-[7-(benziloxi)-1,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il]-1-[butilidenoamino]-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 304F (0,150 g, 0,32 mmol) e butiraldeído (0,29 mL, 3,24 mmol) em N,N-dimetilacetamida (1,5 mL) reagiram a 120°C durante 25 minutos num reactor de microondas num tubo selado. A reacção foi concentrada sob uma corrente de azoto aquecida através de uma tubagem aquecida a 165°C. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,134 g, 80%).Example 322A 3- [7- (Benzyloxy) -1,1-dioxido-4,11,2-benzothiadiazin-3-yl] -1- [butylideneamino] -4-hydroxyquinolin-2 (1H) -one The product of Example 304F (0.150 g, 0.32 mmol) and butyraldehyde (0.29 mL, 3.24 mmol) in N, N-dimethylacetamide (1.5 mL) were reacted at 120 ° C for 25 minutes in a microwave reactor in a sealed tube. The reaction was concentrated under a heated nitrogen stream through a pipeline heated to 165 ° C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.134 g, 80%).

Exemplo 322B 3-[7-(benziloxi)-1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il]-1-(butilamino)-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 322A (0,134 g, 0,26 mmol) em tetra-hidrofurano (3 mL) e metanol (0,020 mL) a 0°C reagiu com boro-hidreto de lítio (solução 2,0M em tetra-hidrofurano, 0,195 mL, 0,39 mmol). A reacção foi agitada a 25°C durante 1 hora e depois diluída com ácido clorídrico 1M aquoso e filtrado. O produto foi purificado por dissolução em tetra-hidrofurano, absorvido em sílica gel, carregado numa coluna de sílica gel e 324 ΕΡ 1 560 827/ΡΤ eluído com diclorometano. O filtrado foi evaporado até à secura sob pressão reduzida para gerar o composto em titulo (0,045 g, 33%).Example 322B 3- [7- (Benzyloxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -1- (butylamino) -4-hydroxyquinolin-2 (1H) -one The product of Example 322A (0.134 g, 0.26 mmol) in tetrahydrofuran (3 mL) and methanol (0.020 mL) at 0 ° C was reacted with lithium borohydride (2.0 M solution in tetrahydrofuran, 0.195 mL, 0.39 mmol). The reaction was stirred at 25 ° C for 1 hour and then diluted with 1M aqueous hydrochloric acid and filtered. The product was purified by dissolution in tetrahydrofuran, absorbed on silica gel, loaded onto a silica gel column and eluted with dichloromethane. The filtrate was evaporated to dryness under reduced pressure to give the title compound (0.045 g, 33%).

Exemplo 322C 1- (butilamino) -4-hidroxi-3- ( 7-hidroxi-l, l-dioxido-4fí-1,2,4-benzotiadiazin-3-il)quinolin-2(1H)-ona O produto do Exemplo 322B (0,045 g, 0,087 mmol) em tetra-hidrofurano (8 mL) reagiu com uma quantidade catalítica de hidróxido de paládio sobre carbono, uma quantidade catalítica de paládio a 5% sobre carbono e formato de amónio (0,03 g, 0,48 mmol) a 60°C durante 4 horas. A mistura reaccional quente foi filtrada através de celite® (terra de diatomáceas) e o filtrado foi evaporado sob pressão reduzida para gerar o composto em título (0,038 g, 100%).Example 322C 1- (Butylamino) -4-hydroxy-3- (7-hydroxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) quinolin-2 (1H) Example 322B (0.045 g, 0.087 mmol) in tetrahydrofuran (8 mL) was reacted with a catalytic amount of palladium hydroxide on carbon, a catalytic amount of 5% palladium on carbon and ammonium formate (0.03 g, , 48 mmol) at 60 ° C for 4 hours. The hot reaction mixture was filtered through celite® (diatomaceous earth) and the filtrate was evaporated under reduced pressure to give the title compound (0.038 g, 100%).

Exemplo 322D 2- ({3-[1-(butilamino)-4-hidroxi-2-oxo-l,2-di-hidroquinolin- 3- il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}oxi)acetamida O produto do Exemplo 322C (0,038 g, 0,089 mmol) reagiu com carbonato de césio (0,087 g, 0,27 mmol), 2-bromoacetamida (0,018 g, 0,13 mmol) e uma quantidade catalítica de iodeto de tetrabutilamónio em N,N-dimetilformamida (3 mL) a 25°C durante 2 horas. A reacção foi concentrada até metade do volume sob uma corrente de azoto aquecida através de uma tubagem aquecida a 165°C. A solução resultante foi diluída com água e o precipitado foi recolhido por filtração e seco para gerar o composto em título (0,041 g, 95%). MS (ESI-) m/z 484 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-dô) δ ppm 0,93 (t, J=7,17 Hz, 3H) 1,48 (m, 4H) 2,76 (m, 2H) 4,49 (s, 2H) 5,90 (t, J=6,80 Hz, 1H) 7,06 (t, J=6,99 Hz, 1H) 7,21 (m, 2H) 7,40 (m, 1H) 7,54 (m, 2H) 8,07 (dd, J=8,09, 1,10 Hz, 1H) 16,24 (s, 1H) . 325 ΕΡ 1 560 827/ΡΤExample 322D 2 - ({3- [1- (Butylamino) -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl] -1,1-dioxido-4 H -1,2,4- The product of Example 322C (0.038 g, 0.089 mmol) was reacted with cesium carbonate (0.087 g, 0.27 mmol), 2-bromoacetamide (0.018 g, 0.13 mmol) and catalytic amount of tetrabutylammonium iodide in N, N-dimethylformamide (3 mL) at 25 ° C for 2 hours. The reaction was concentrated to half the volume under a heated nitrogen stream through a pipeline heated to 165 ° C. The resulting solution was diluted with water and the precipitate was collected by filtration and dried to give the title compound (0.041 g, 95%). MS (ESI-) m / z 484 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ ppm 0.93 (t, J = 7.17 Hz, 3H) 1.48 (m, 4H) 2.76 (m, 2H) 4.49 (s, 2H ) 5.90 (t, J = 6.80 Hz, 1 H) 7.06 (t, J = 6.99 Hz, 1 H) 7.21 (m, 2 H) 7.40 (m, 1 H) 7.54 (m, 2 H) 8.07 (dd, J = 8.09, 1.10 Hz, 1 H) 16.24 (s, 1H). 325 ΕΡ 1 560 827 / ΡΤ

Exemplo 323Α 3- [7-(benziloxi)-1,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il]- 4- hldroxl-l-{[(1E)-3-metilbutilideno]amino}quinolin-2(1H)-ona O produto do Exemplo 304F (0,220 g, 0,48 mmol) e isovaleraldeído (0,77 mL, 7,18 mmol) em N,N-dimetilacetamida (1,5 mL) reagiram a 130°C durante 35 minutos num reactor de microondas num tubo selado. A reacção foi concentrada sob uma corrente de azoto aquecida através de uma tubagem aquecida a 165°C. O resíduo resultante foi triturado com éter dietílico e filtrado para gerar o composto em título (0,181 g, 72%).Example 323 3- [7- (Benzyloxy) -1,1-dioxido-4,11,2-benzothiadiazin-3-yl] -4-hydroxl-1 - {[(1E) -3-methylbutylidene] amino} quinoline-2 (1H) -one The product of Example 304F (0.220 g, 0.48 mmol) and isovaleraldehyde (0.77 mL, 7.18 mmol) in N, N-dimethylacetamide (1.5 mL) were reacted at 130 ° C for 35 minutes in a microwave reactor in a sealed tube. The reaction was concentrated under a heated nitrogen stream through a pipeline heated to 165 ° C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.181 g, 72%).

Exemplo 323B 3- [7-(benziloxi)-1,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il]- 4- hidroxi-l-[(3-metilbutil)amino]quinolin-2(1H)-ona O produto do Exemplo 323A (0,061 g, 0,11 mmol) em tetra-hidrofurano (3 mL) e metanol (0,010 mL) a 0°C reagiu com boro-hidreto de lítio (solução 2,0M em tetra-hidrofurano, 0,09 mL, 0,18 mmol). A reacção foi agitada a 25°C durante 1 hora e depois diluída com ácido clorídrico 1M aquoso e filtrada. O produto foi purificado por dissolução em tetra-hidrofurano, absorvido em sílica gel, carregado num Alltech Sep-pack de 2 g e eluído com diclorometano. O filtrado foi evaporado até à secura sob pressão reduzida para gerar o composto em título (0,037 g, 62%).Example 323B 3- [7- (Benzyloxy) -1,1-dioxido-4,11,2-benzothiadiazin-3-yl] -4-hydroxy-1 - [(3-methylbutyl) amino] quinolin- 1H) -one The product of Example 323A (0.061 g, 0.11 mmol) in tetrahydrofuran (3 mL) and methanol (0.010 mL) at 0 ° C was reacted with lithium borohydride (2.0M solution in tetra 0.09 mL, 0.18 mmol). The reaction was stirred at 25 ° C for 1 hour and then diluted with 1M aqueous hydrochloric acid and filtered. The product was purified by dissolution in tetrahydrofuran, absorbed on silica gel, loaded onto a 2 g Alltech Sep-pack and eluted with dichloromethane. The filtrate was evaporated to dryness under reduced pressure to give the title compound (0.037 g, 62%).

Exemplo 323C 4-hidroxi-3- ( 7-hidroxi-l, l-dioxido-4ff-l, 2, 4-benzotiadiazin-3-il)-1-[(3-metilbutil)amino]quinolin-2(1H)-ona O produto do Exemplo 323B (0,037 g, 0,07 mmol) em tetra-hidrofurano (8 mL) reagiu com uma quantidade catalítica de hidróxido de paládio sobre carbono, uma quantidade catalítica de paládio a 5% sobre carbono e formato de amónio (0,018 g, 0,29 mmol) a 60°C durante 30 minutos. A mistura reaccional quente foi filtrada através de celite® (terra de diatomáceas) e o filtrado foi evaporado sob pressão reduzida para gerar o composto em título (0,025 g, 80%). 326 ΕΡ 1 560 827/ΡΤExample 323C 4-Hydroxy-3- (7-hydroxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - [(3-methylbutyl) amino] quinolin- -one The product of Example 323B (0.037 g, 0.07 mmol) in tetrahydrofuran (8 mL) was reacted with a catalytic amount of palladium hydroxide on carbon, a catalytic amount of 5% palladium on carbon and ammonium formate (0.018 g, 0.29 mmol) at 60 ° C for 30 minutes. The hot reaction mixture was filtered through celite® (diatomaceous earth) and the filtrate was evaporated under reduced pressure to give the title compound (0.025 g, 80%). 326 ΕΡ 1 560 827 / ΡΤ

Exemplo 323D 2-[(3-{4-hidroxi-l-[(3-metilbutil)amino]-2-oxo-l,2-di-hidro-qulnolln-3-il}-l, l-dioxido-4fl-l, 2, 4-benzotiadiazin-7-il)oxi]-acetamida O produto do Exemplo 323C (0,025 g, 0,057 mmol) reagiu com carbonato de césio (0,055 g, 0,17 mmol), 2-bromoacetamida (0,012 g, 0,087 mmol) e uma quantidade catalítica de iodeto de tetrabutilamónio em N,N-dimetilformamida (3 mL) a 25°C durante 2 horas. A reacção foi concentrada a metade do volume sob uma corrente de azoto aquecida através de uma tubagem aquecida a 165°C. A solução resultante foi diluída com água e o precipitado foi recolhido por filtração e seco para gerar o composto em título (0, 020 g, 72%). MS (ESI-) m/z 498 (M-H)”. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-de) δ ppm 0,90 (m, 3H) 1,33 (m, 6H) 1,54 (m, 2H) 4,49 (s, 2H) 5,90 (m, 1H) 7,06 (m, 1H) 7,21 (m, 2H) 7,40 (m, 1H) 7,55 (m, 2H) 8,07 (dd, J=8,27, 1,29 Hz, 1H) 16,23 (s, 1H).Example 323D 2 - [(3- {4-hydroxy-1 - [(3-methylbutyl) amino] -2-oxo-1,2-dihydro-quinolin-3-yl} -1,1-dioxido- The product from Example 323C (0.025 g, 0.057 mmol) was reacted with cesium carbonate (0.055 g, 0.17 mmol), 2-bromoacetamide (0.012 g, , 0.087 mmol) and a catalytic amount of tetrabutylammonium iodide in N, N-dimethylformamide (3 mL) at 25 ° C for 2 hours. The reaction was concentrated to one-half volume under a stream of heated nitrogen through a pipeline heated to 165 ° C. The resulting solution was diluted with water and the precipitate was collected by filtration and dried to give the title compound (0.020 g, 72%). MS (ESI-) m / z 498 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d6) δ ppm 0.90 (m, 3H) 1.33 (m, 6H) 1.54 (m, 2H) 4.49 (s, 2H) 5.90 (m, 1H ) 7.06 (m, 1H) 7.21 (m, 2H) 7.40 (m, 1H) 7.55 (m, 2H) 8.07 (dd, J = 8.27, 1.29 Hz, 1H) 16.23 (s, 1H).

Exemplo 324A 4-amino-A/- [2- (aminosulfonil) -4- (benziloxi) fenil] -7-hidroxi-5-oxo-4,5-di-hidrotieno[3,2-b]piridina-6-carboxamida e N-[2-(aminosulfonil)-4-(benziloxi)fenil]-7-hidroxi-5-oxo-4-{[(1E)-fenilmetileno]amino}-4,5-di-hidrotieno[3,2-b]piridina-6-carboxamidaExample 324A 4-Amino-N- [2- (aminosulfonyl) -4- (benzyloxy) phenyl] -7-hydroxy-5-oxo-4,5-dihydrothieno [3,2- b] pyridine-6- carboxamide and N- [2- (aminosulfonyl) -4- (benzyloxy) phenyl] -7-hydroxy-5-oxo-4 - {[(1E) -phenylmethylene] amino} -4,5-dihydrothieno [ 2-b] pyridine-6-carboxamide

Os produtos do Exemplo 304D (1,55 g, 5,57 mmol) e Exemplo 268C (1,27 g, 3,71 mmol) em tolueno (100 mL) reagiram a 118°C durante 5 horas. A lama arrefecida foi filtrada, lavada com 25 mL de tolueno e seca para gerar os compostos em título.The products of Example 304D (1.55 g, 5.57 mmol) and Example 268C (1.27 g, 3.71 mmol) in toluene (100 mL) were reacted at 118 ° C for 5 hours. The cooled slurry was filtered, washed with 25 mL of toluene and dried to give the title compounds.

Exemplo 324B 4-amino-6-[7-(benziloxi)-1, l-dioxido-4-H-l, 2, 4-benzotiadiazin-3-il]-7-hidroxitieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 324A (1,95 g, 3,7 mmol) reagiu com hidróxido de potássio aquoso a 10% (100 mL) a refluxo durante 24 horas, arrefeceu até 25°C e foi acidificado com ácido clorídrico concentrado até pH 2. O sólido resultante foi recolhido por filtração, lavado repetidamente com água e seco 327 ΕΡ 1 560 827/ΡΤ para proporcionar ο composto em título (2,05 g, 100%). MS (ESI-) m/z 467 (M-H)-.Example 324B 4-Amino-6- [7- (benzyloxy) -1,1-dioxido-4-yl, 2,4-benzothiadiazin-3-yl] -7-hydroxythieno [3,2- b] pyridin-5- 4H) -one The product of Example 324A (1.95 g, 3.7 mmol) was reacted with 10% aqueous potassium hydroxide (100 mL) at reflux for 24 hours, cooled to 25 ° C and acidified with hydrochloric acid concentrated to pH 2. The resulting solid was collected by filtration, washed repeatedly with water and dried to give the title compound (2.05 g, 100%). MS (ESI-) m / z 467 (M-H) -.

Exemplo 324C 6-[7-(benziloxi)-1,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il]-4-(ciclo-hexilidenoamino) -7-hidroxitieno [3, 2-£&gt;] piridin-5 (4H) -ona O produto do Exemplo 324B (0,20 g, 0,42 mmol) e ciclo- hexanona (2,0 g, 20 mmol) em N,N-dimetilacetamida (4 mL) reagiram a 130°C durante 60 minutos num reactor de microondas num tubo selado. O solvente foi removido sob pressão reduzida e o resíduo resultante foi triturado com éter dietílico (8 mL), filtrado e seco para gerar o composto em título (0,167 g 73%) .Example 324C 6- [7- (Benzyloxy) -1,1-dioxido-4,11,2-benzothiadiazin-3-yl] -4- (cyclohexylideneamino) -7-hydroxythieno [3,2- gt The product from Example 324B (0.20 g, 0.42 mmol) and cyclohexanone (2.0 g, 20 mmol) in N, N-dimethylacetamide (4 mL) were reacted at 130 ° C for 60 minutes in a microwave reactor in a sealed tube. The solvent was removed under reduced pressure and the resulting residue triturated with diethyl ether (8 mL), filtered and dried to give the title compound (0.167 g, 73%).

Exemplo 324D 6-[7-(benziloxi)-1, l-dioxido-4H-l,2,4-benzotiadiazin-3-il]-4- (ciclo-hexilamino) -7-hidroxitieno [3, 2-£&gt;] piridin-5 (4H) -ona O produto do Exemplo 324C (0,167 g, 30 mmol) em tetra-hidrofurano (6 mL) e metanol (0,030 mL, 0,8 mmol) a 0°C reagiu com boro-hidreto de lítio (solução 2,0M em tetra-hidrofurano, 0,250 mL, 0,50 mmol). A reacção foi agitada a 25°C durante 1,5 horas, acidificada a pH 2 com ácido clorídrico aquoso 1M e diluída com água (25 mL). O precipitado resultante foi recolhido por filtração e seco até peso constante para gerar o composto em título (0,114 g, 69%). MS (APCI+) m/z 551 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ ppm 1,36 (m, 10H) 5,25 (s, 2H) 6,50 (s, 1H) 7,43 (m, 8H) 7,69 (d, J= 8,82 Hz, 1H) 8,29 (d, J=5,15 Hz, 1H) 14,10 (s, 1H) 14,87 (s, 1H).Example 324D 6- [7- (benzyloxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -4- (cyclohexylamino) -7-hydroxythieno [3,2- (0.167 g, 30 mmol) in tetrahydrofuran (6 mL) and methanol (0.030 mL, 0.8 mmol) at 0 ° C was reacted with borohydride of lithium (2.0 M solution in tetrahydrofuran, 0.250 mL, 0.50 mmol). The reaction was stirred at 25 ° C for 1.5 hours, acidified to pH 2 with 1 M aqueous hydrochloric acid and diluted with water (25 mL). The resulting precipitate was collected by filtration and dried to constant weight to give the title compound (0.114 g, 69%). MS (APCI +) m / z 551 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.36 (m, 10H) 5.25 (s, 2H) 6.50 (s, 1H) 7.43 (m, 8H) 7.69 (d, J = 8.82 Hz, 1 H) 8.29 (d, J = 5.15 Hz, 1 H) 14.10 (s, 1 H) 14.87 (s, 1H).

Exemplo 324E 4-(ciclo-hexilamino)-7-hidroxi-6-(7-hidroxi-l, l-dioxido-4H-1,2,4-benzotiadiazin-3-il)tieno[3,2-b]piridin-5(4H)-ona O produto do Exemplo 324D (0,114 g, 0,21 mmol) em acetonitrilo seco (11 mL) a 25°C reagiu com iodotrimetilsilano (0,29 mL, 2,1 mmol) a 50°C durante 4 horas. A reacção foi arrefecida até 25°C e diluída com água (50 mL). O precipitado resultante foi recolhido por filtração e seco sob pressão reduzida para gerar o composto em título (0,083 g, 87% de rendimento). MS (ESI-) m/z 459 (M-H)“. 1H RMN (300 MHz, 328 ΕΡ 1 560 827/ΡΤ DMSO-cU) δ ppm 1,20 (m, 5Η) 1,66 (m, 5H) 6,51 (s, 1H) 7,18 (m, 2H) 7,48 (d, J=5,52 Hz, 1H) 7,57 (d, J= 9,56 Hz, 1H) 8,29 (d,J=5,15 Hz, 1H) 10,42 (s, 1H) 14,04 (s, 1H) 14,93 (s, 1H).Example 324E 4- (Cyclohexylamino) -7-hydroxy-6- (7-hydroxy-1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) thieno [3,2- b] pyridine -5- (4H) -one The product of Example 324D (0.114 g, 0.21 mmol) in dry acetonitrile (11 mL) at 25 ° C was reacted with iodotrimethylsilane (0.29 mL, 2.1 mmol) at 50 ° C for 4 hours. The reaction was cooled to 25 ° C and diluted with water (50 mL). The resulting precipitate was collected by filtration and dried under reduced pressure to give the title compound (0.083 g, 87% yield). MS (ESI-) m / z 459 (M-H). 1 H NMR (300 MHz, δ-DMSO-d6) δ ppm 1.20 (m, 5) 1.66 (m, 5H) 6.51 (s, 1H) 7.18 (m, 2H ) 7.48 (d, J = 5.52 Hz, 1 H) 7.57 (d, J = 9.56 Hz, 1 H) 8.29 (d, J = 5.15 Hz, s, 1 H) 14.04 (s, 1 H) 14.93 (s, 1 H).

Exemplo 324F 2-({3-[4-(ciclo-hexilamino)-7-hidroxi-5-oxo-4,5-di-hidrotieno-[3,2-b]piridin-6-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}oxi)acetamida O produto do Exemplo 324E (0,209 g, 0,45 mmol) reagiu com carbonato de césio (0,589 g, 1,81 mmol), 2-bromoacetamida (0,125 g, 0,91 mmol) e uma quantidade catalítica de iodeto de tetrabutilamónio em N,N-dimetilformamida (8 mL) a 25°C durante 18 horas. A reacção foi diluída com 50 mL de água, acidificada a pH 2 com ácido clorídrico 1M. O precipitado resultante foi recolhido por filtração e purificado por cromatografia em coluna em sílica gel eluindo com 5% de metanol em clorofórmio para gerar o composto em título (0,050 g, 21% de rendimento). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 516 (M-H)“. XH RMN (300 MHz, DMSO-d6) δ ppm 1,48 (m, 10H) 4,59 (s, 2H) 6,50 (s, 1H) 7,39 (m, 2H) 7,44 (s, 1H) 7,48 (d, J=5,15 Hz, lH) 7,65 (s, 1H) 7,70 (d, J= 9,56 Hz, 1H) 8,28 (d, J=5,15 Hz, lH) 14,13 (s, 1H) 14,89 (s, 1H) .Example 324F 2 - ({3- [4- (cyclohexylamino) -7-hydroxy-5-oxo-4,5-dihydrothieno [3,2-b] pyridin-6-yl] The product from Example 324E (0.209 g, 0.45 mmol) was reacted with cesium carbonate (0.589 g, 1.81 mmol), 2-chloro-4-fluoro- (0.125 g, 0.91 mmol) and a catalytic amount of tetrabutylammonium iodide in N, N-dimethylformamide (8 mL) at 25 ° C for 18 hours. The reaction was diluted with 50 mL of water, acidified to pH 2 with 1M hydrochloric acid. The resulting precipitate was collected by filtration and purified by silica gel column chromatography eluting with 5% methanol in chloroform to give the title compound (0.050 g, 21% yield). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 516 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ ppm 1.48 (m, 10H) 4.59 (s, 2H) 6.50 (s, 1H) 7.39 (m, 2H) 7.44 (s, 7.48 (d, J = 9.56 Hz, 1 H) 7.48 (d, J = 5.15 Hz, 1H) 7.65 (s, 15 Hz, 1H) 14.13 (s, 1H) 14.89 (s, 1H).

Exemplo 325 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-77-(2-hidroxietil) -4i7-tieno [2,3-e] [1,2,4] tiadiazina-7-carboxamida, 1,1-dióxidoExample 325 3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -77- (2-hydroxyethyl) -4H-thieno [2,3- e] [1 , 2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil-carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxi-benzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetil-formamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura adicionou-se etanolamina (2,8 pL, 1,1 equivalentes) seguindo-se N-metilmorfolina (8 pL, 1,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em título como um sólido branco (18,7 mg, 85,8%). O sal de sódio 329 ΕΡ 1 560 827/ΡΤ do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ 3,34 (m, 2H), 3,51 (m, 2H) , 5,61 (m, 2H), 7,29 (m, 5H), 7,42 (m, 1H), 7,52 (m, 1H) , 7,75 (m, 1H), 7,96 (s, 1H), 8,23 (m, 1H) , 8,37 (m, 1H). MS (DCI+) m/z 525 (M+H)+. 796523 Exemplo 326 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-N-[ (IS) -2-hidroxi-l- (aminocarbonil) etil] -4ff-tieno [2,3-e] [1,2,4] — tiadiazina-7-carboxamida, 1,1-dióxidoA solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole 66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added ethanolamine (2.8 æL, 1.1 equivalents) followed by N-methylmorpholine (8 æL, 1.72 equivalents) and the solution was stirred for 16 hours. 1N hydrochloric acid solution (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.7 mg, 85.8% ). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 3.34 (m, 2H), 3.51 (m, 2H), 5.61 (m, 2H), 7.29 (m, 5H), 7.42 (m, 1H), 7.96 (s, 1H), 8.23 (m, 1H), 8.37 (m, 1H) . MS (DCI +) m / z 525 (M + H) +. Example 326 3- (1-Benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -N - [(1S) -2-hydroxy-1- (aminocarbonyl) ethyl] - 4β-thieno [2,3-e] [1,2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil- carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxi- benzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetil-formamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se cloridrato de L-serinamida (6,5 mg, 1,1 equivalentes) seguido de N-metil-morfolina (12,6 pL, 2,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em título como um sólido branco (17,1 mg, 73%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-d6) δ 3,69 (dd, J=4,96, 3,13 Hz, 2H) , 4,40 (m, 1H) , 5,62 (s, 2H), 7,27 (m, 5H), 7,41 (m, 1H) , 7,53 (m, 1H), 7,75 (m, 1H), 8,12 (s, 1H), 8,22 (d, J=7, 72 Hz, 1H) , 8,28 (d, J=7, 72 Hz, 1H) . MS (DCI+) m/z 568 (M+H)+.A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole 66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added L-serinamide hydrochloride (6.5 mg, 1.1 equivalents) followed by N-methylmorpholine (12.6 æl, 2.72 equivalents) and the solution was stirred for 16 hours. 1N hydrochloric acid solution (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (17.1 mg, 73%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 3.69 (dd, J = 4.96, 3.13 Hz, 2H), 4.40 (m, 1H), 5.62 (s, 2H) (M, 1H), 7.75 (m, 1H), 8.12 (s, 1H), 8.22 (d, J = = 7.72 Hz, 1H), 8.28 (d, J = 7.72 Hz, 1H). MS (DCI +) m / z 568 (M + H) +.

Exemplo 327 N- (2-amino-2-oxoetil)-3-(l-benzil-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il)-4H-tieno[2,3-e] [1,2,4]tiadiazina-7-carboxamida, 1,1-dióxidoExample 327 N- (2-amino-2-oxoethyl) -3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -4H-thieno [ e] [1,2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil-carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxi-benzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetil-formamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se cloridrato de glicinamida (5,1 mg, 1,1 equivalentes) seguido de N-metil- 330 ΕΡ 1 560 827/ΡΤ morfolina (14 pL, 3 equivalentes) e a solução foi agitada durante 3 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em título como um sólido branco (17 mg, 76%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-de) δ 3,83 (d, J=5,52 Hz, 2H), 5,61 (s, 2H), 7,13 (s, 1H), 7,32 (m, 6H), 7,51 (d, J=8,09 Hz, 1H), 7,75 (m, 1H), 8,04 (s, 1H) , 8,21, (d, J=6,99 Hz, 1H), 8,59 (t, J=5,88 Hz, 1H). MS (DCI+) m/z 538 (M+H)+.A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole 66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added glycinamide hydrochloride (5.1 mg, 1.1 equivalents) followed by N-methyl-330 Ει1 560 827 / ΡΤ morpholine (14 æL, 3 equivalents) and the solution was stirred for 3 hours. A solution of 1N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (17 mg, 76%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 3.83 (d, J = 5.52 Hz, 2H), 5.61 (s, 2H), 7.13 (s, 1H), 7.32 (m, 6H), 7.51 (d, J = 8.09 Hz, 1H), 7.75 (m, 1H), 8.04 (s, 1H), 8.21 (d, J = 6.99 Hz , 1H), 8.59 (t, J = 5.88 Hz, 1H). MS (DCI +) m / z 538 (M + H) +.

Exemplo 328 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-N-[(IS)-2-hidroxi-l-metiletil]-4H-tieno[2,3-e][1,2,4]tiadiazina-7-carboxamida, 1,1-dióxidoExample 328 3- (1-Benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -N - [(1S) -2-hydroxy-1-methylethyl] -4H-thieno [ 2,3-e] [1,2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil- carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxi- benzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetil-formamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se (S)-(+)-2-amino-l-propanol (3,6 pL, 1,1 equivalentes) seguido de N-metilmorfolina (8 pL, 1,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em título como um sólido branco (18,4 mg, 82%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 3,46 (m, 2H) , 3,95 (m, 1H), 5,62 (s, 2H), 7,30 (m, 5H), 7,41 (t, J=7,72 Hz, 1H), 7,52 (d, J= 8,82 Hz, 1H), 7,74 (d, J= 6,99 Hz, 1H), 7,96 (s, 1H), 8,10 (d, J=8,09 Hz, 1H), 8,22 (d, J= 6,99 Hz, 1H) . MS (DCI + ) m/z 539 (M+H)\A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole 66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added (S) - (+) - 2-amino-1-propanol (3.6 æL, 1.1 equivalents) followed by N-methylmorpholine (8 æL, 1.72 equivalents) and the solution was stirred for 16 hours. A solution of 1N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.4 mg, 82%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 3.46 (m, 2H), 3.95 (m, 1H), 5.62 (s, 2H), 7.30 (m, 5H), 7.41 (d, J = 8.82 Hz, 1 H), 7.74 (d, J = 6.99 Hz, 1 H), 7.96 (s, , 1H), 8.10 (d, J = 8.09 Hz, 1H), 8.22 (d, J = 6.99 Hz, 1H). MS (DCI +) m / z 539 (M + H) +.

Exemplo 329 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-N,N-bis(2-hidroxietil)-4H-tieno[2,3-e][1,2,4]tiadiazina-7-carboxamida, 1,1-dióxidoExample 329 3- (1-Benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -N, N-bis (2-hydroxyethyl) -4H-thieno [2,3- e ] [1,2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil-carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxi- 331 ΕΡ 1 560 827/ΡΤ benzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetil-formamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se dietanolamina (4,43 pL, 1,1 equivalentes) seguida de N-metilmorfolina (8 pL, 1,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em título como um sólido branco (6,85 mg, 29%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-d6) δ 3,53 (m, 4H), 5,62 (s, 2H), 7,30 (m, 6H), 7,41 (t,J=7,54 Hz, 1H), 7,53 (d, J=8,46 Hz, 1H), 7,59 (s, 1H), 7,76 (m, 1H), 8,22 (d, J=8,09 Hz, 1H); MS (ESI+) m/z 569 (M+H)+.A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxy- 827 / ΡΤ benzotriazole (8.66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added diethanolamine (4.43 æl, 1.1 equivalents) followed by N-methylmorpholine (8 æl, 1.72 equivalents) and the solution was stirred for 16 hours. 1N hydrochloric acid solution (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (6.85 mg, 29%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 3.53 (m, 4H), 5.62 (s, 2H), 7.30 (m, 6H), 7.41 (t, J = 7.54 Hz, 7.56 (d, J = 8.46 Hz, 1H), 7.59 (s, 1H), 7.76 (m, 1H), 8.22 (d, J = 8.09 Hz, 1H); MS (ESI +) m / z 569 (M + H) +.

Exemplo 330 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-N-[2-hidroxi-l-(hidroximetil)etil]-4H-tieno[2,3-e] [1,2,4] — tiadiazina-7-carboxamida, 1,1-dióxidoExample 330 3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -N- [2-hydroxy-1- (hydroxymethyl) ethyl] -4H-thieno [2 , 3-e] [1,2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil- carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxi-benzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetil-formamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se serinol (4,21 mg, 1,1 equivalentes) seguido de N-metilmorfolina (8 pL, 1,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em título como um sólido branco (18,2 mg, 79%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 3,51 (d, J=5,52 Hz, 4H); 3,89 (m, J= 6,25 Hz, 1H), 5,63 (s, 2H), 7,30 (m, 6H), 7,42 (t, J=7,54 Hz, 1H), 7,53 (d, J= 8,82 Hz, 1H), 7,75 (d, J=8,46A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole 66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. Serinol (4.21 mg, 1.1 equivalents) was added to this mixture followed by N-methylmorpholine (8 æL, 1.72 equivalents) and the solution was stirred for 16 hours. 1N hydrochloric acid solution (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.2 mg, 79%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 3.51 (d, J = 5.52 Hz, 4H); 3.89 (m, J = 6.25 Hz, 1H), 5.63 (s, 2H), 7.30 (m, 6H), 7.42 (t, J = 7.54 Hz, 1H), 7.53 (d, J = 8.82 Hz, 1H), 7.75 (d, J = 8.46

Hz, 1H), 8,02 (m, 2H), 8,22 (d, J=8,09 Hz, 1H). MS (DCI + ) m/z 555 (M+H)\ 332 ΕΡ 1 560 827/ΡΤHz, 1H), 8.02 (m, 2H), 8.22 (d, J = 8.09 Hz, 1H). MS (DCI +) m / z 555 (M + H) + 332 ΕΡ 1 560 827 / ΡΤ

Exemplo 331 l-benzil-4-hidroxi-3-(7—{[(3R)-3-hidroxipirrolidin-l-il]-carbonil}-!,l-dioxido-4H-tleno[2, 3-e][1,2,4]tiadiazln-3-11)-quinolin-2(1H)-onaExample 331 1-benzyl-4-hydroxy-3- (7 - {[(3R) -3-hydroxypyrrolidin-1-yl] carbonyl} -1H-dioxido-4H-teno [2,3- e] 1,2,4] thiadiazol-3-11) -quinolin-2 (1H) -one

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil-carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxi-benzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetil-formamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se (R)-(+)-3-pirrolidinol (3,84 pL, 1,1 equivalentes) seguido de N-metil-morfolina (8 pL, 1,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em título como um sólido branco (19,8 mg, 87%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-dê) δ 1,89 (m, 2H), 3,55 (m, 2H), 4,31 (d, 1H), 4,99 (br, s,, 1H), 5,62 (s, 2H), 7,31 (m, 6H) , 7,41 (t, J=7,54 Hz, 1H) , 7,53 (d, J= 8,82 Hz, 1H), 7,69 (d, J=6,99 Hz, 1H) , 7,76 (t, J=7,35A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole 66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added (R) - (+) - 3-pyrrolidinol (3.84 μl, 1.1 equivalents) followed by N-methylmorpholine (8 μl, 1.72 equivalents) and the solution was stirred for 16 hours. 1N hydrochloric acid solution (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (19.8 mg, 87%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.89 (m, 2H), 3.55 (m, 2H), 4.31 (d, 1H), 4.99 (br. 5,62 (s, 2H), 7.31 (m, 6H), 7.41 (t, J = 7.54 Hz, 1H), 7.53 (d, J = 8.82 Hz, 1H), 7.69 (d, J = 6.99 Hz, 1H), 7.76 (t, J = 7.35

Hz, 1H), 8,22 (d, J=6,99 Hz, 1H). MS (ESI+) m/z 551 (M+H)+.1H), 8.22 (d, J = 6.99 Hz, 1H). MS (ESI +) m / z 551 (M + H) +.

Exemplo 332 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-N-(3-hidroxipropil)-4H-tieno[2,3-e][1,2,4]tiadiazina-7-carboxamida, 1,1-dióxidoExample 332 3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -N- (3-hydroxypropyl) -4H-thieno [2,3- e] [1 , 2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil-carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxi-benzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetil-formamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se 2-(metilamino)-etanol (2,8 pL, 1,1 equivalentes) seguido de N-metilmorfolina (8 pL, 1,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em título como um sólido branco (19,2 mg, 86%). O sal de sódio do composto em título foi preparado de acordo com o procedimento 333 ΕΡ 1 560 827/ΡΤ do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 1,67 (m , 2H) , 3, 28 (m, 2H), 3 ,48 (t, J=6, 25 Hz , 2H), 5,61 ( s, 2H), 7, 30 (m, 6H), 7,41 (t, , J=7, 54 Hz, 1H), 7,52 (d, J-- =8, 46 Hz, 1H), 7, 75 (t, J=6,99 Hz , 1H), 7, 92 (s, 1H) , 8, 21 (m, 1H), 8, 34 (t, J=5,33 Hz, 1H) . MS (DCI + ) ml) 539 (M+H) +A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole 66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added 2- (methylamino) ethanol (2.8 æL, 1.1 equivalents) followed by N-methylmorpholine (8 æL, 1.72 equivalents) and the solution was stirred for 16 hours. 1N hydrochloric acid solution (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (19.2 mg, 86%). The sodium salt of the title compound was prepared according to procedure 333 (E) 1 560 827 / ΡΤ from Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 1.67 (m, 2H), 3.28 (m, 2H), 3.48 (t, J = 6, 25 Hz, 2H), 5.61 (s 1H), 7.52 (d, J = 8.46 Hz, 1H), 7.30 (m, 6H) 75 (t, J = 6.99 Hz, 1H), 7.92 (s, 1H), 8.21 (m, 1H), 8.34 (t, J = 5.33 Hz, 1H). MS (DCI +) m / z) 539 (M + H) +

Exemplo 333 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-N-[(2S)-2,3-di-hidroxipropil]-4H-tieno[2,3-e][1,2,4]tiadiazina-7-carboxamida, 1,1-dióxidoExample 333 3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -N - [(2S) -2,3-dihydroxypropyl] -4H-thieno [ 2,3-e] [1,2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil- carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxi- benzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetil-formamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se (S)-(-)-3-amino-1,2-propanodiol (4,21 mg, 1,1 equivalentes) seguido de N-metilmorfolina (8 pL, 1,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietilico para gerar o composto em título como um sólido branco (18,4 mg, 80%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 3,15 (m, 2H), 3,60 (m, 2H) , 5,62 (s, 2H), 7,30 (m, 6H), 7,41 (t, J=7,54 Hz, 1H) , 7,52 (d, J=8,46 Hz, 1H), 7,75 (m, 1H), 7,98 (s, 1H) , 8,22 (d, J= 6,62 Hz, 1H), 8,32 (t, J=5,88 Hz, 1H) . MS (DCI +) m/z 555 (M+H) + .A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole 66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added (S) - (-) - 3-amino-1,2-propanediol (4.21 mg, 1.1 equivalents) followed by N-methylmorpholine (8æl, 1.72 equivalents) and The solution was stirred for 16 hours. 1N hydrochloric acid solution (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.4 mg, 80%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO- d 6) δ 3.15 (m, 2H), 3.60 (m, 2H), 5.62 (s, 2H), 7.30 (m, 6H), 7.41 (d, J = 8.46 Hz, 1H), 7.75 (m, 1H), 7.98 (s, 1H), 8.22 (d, J = 6.62 Hz, 1H), 8.32 (t, J = 5.88 Hz, 1H). MS (DCI +) m / z 555 (M + H) +.

Exemplo 334 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-N-[(IS)-1-(hidroximetil)propil]-4H-tieno[2,3-e] [1,2,4] — tiadiazina-7-carboxamida, 1,1-dióxidoExample 334 3- (1-Benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -N - [(1S) -1- (hydroxymethyl) propyl] -4H-thieno [2 , 3-e] [1,2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil-carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxi-benzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetil-formamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se (S)-(+)-2-amino-l-butanol (4,36 pL, 1,1 equivalentes) seguido de 334 ΕΡ 1 560 827/ΡΤ N-metilmorfolina (8 pL, 1,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietilico para gerar o composto em titulo como um sólido branco (16,5 mg, 72%) . O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. 1K RMN (300 MHz, DMSO-de) δ 0,91 (t, J= 7,35 Hz, 3H) , 1,54 (m, 2H) , 3,45 (m, 2H), 3,81 (m, 1H), 5,62 (s, 2H) 7,31 (m, 6H), 7,41 (t, J=7,72 Hz, 1H), 7,52 (d, J=8,09 Hz, 1H), 7,76 (t,J=7,91 Hz, 1H) , 7,98 (m, 1H), 8,01 (d, J=8,46 Hz, 1H), 8,22 (d, J= 6,99 Hz, 1H) . MS (DCI +) m/z 553 (M+H) + .A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole 66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added (S) - (+) - 2-amino-1-butanol (4.36 æl, 1.1 equivalents) followed by 334 Å Ρ 1 560 827 / ΡΤ N-methylmorpholine (8 æl, 72 equivalents) and the solution was stirred for 16 hours. 1N hydrochloric acid solution (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (16.5 mg, 72%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.91 (t, J = 7.35 Hz, 3H), 1.54 (m, 2H), 3.45 (m, 2H), 3.81 (D, J = 8.09 Hz, 1H), 5.62 (s, 2H), 7.31 (m, 6H), 7.41 (t, (D, J = 8.46 Hz, 1 H), 8.26 (t, J = 7.91 Hz, 1 H), 7.98 (m, J = 6.99 Hz, 1H). MS (DCI +) m / z 553 (M + H) +.

Exemplo 335 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-N-[(IS)-1-(hidroximetil)-2-metilpropil]-4H-tieno[2,3-e][1,2,4]— tiadiazina-7-carboxamida, 1,1-dióxidoExample 335 3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -N - [(1S) -1- (hydroxymethyl) -2-methylpropyl] -4H- thieno [2,3-e] [1,2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil- carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxi- benzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetil-formamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se (S)-(+)-2-amino-3-metil-l-butanol (5,15 pL, 1,1 equivalentes) seguido de N-metilmorfolina (8 pL, 1,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietilico para gerar o composto em titulo como um sólido branco (18,8 mg, 80%) . O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-de) δ 0,92 (dd, J=6,62, 5,15 Hz, 6H), 1,95 (m, 1H), 3,48 (d, J=5,88 Hz, 2H), 3,80 (m, 1H) , 5,62 (s, 2H), 7,30 (m, 6H), 7,40 (t, J=7, 72 Hz, 1H) , 7,51 (d, J=8,46 Hz, 1H) , 7,75 (m, 1H), 7,95 (d, J=8,82 Hz, 1H) , 8,00 (s, 1H), 8,22 (d, J= 6,62 Hz, 1H) . MS (DCI +) m/z 567 (M+H) + .A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole 66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added (S) - (+) - 2-amino-3-methyl-1-butanol (5.15 æl, 1.1 equivalents) followed by N-methylmorpholine (8 æL, 1.72 equivalents) and the solution was stirred for 16 hours. A solution of 1N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.8 mg, 80%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 0.92 (dd, J = 6.62, 5.15 Hz, 6H), 1.95 (m, 1H), 3.48 (d, J = (S, 2H), 7.30 (m, 6H), 7.40 (t, J = 7, 72 Hz, 1H), 7 , 7.95 (d, J = 8.82 Hz, 1 H), 8.00 (s, 1 H), 8.00 (d, J = 8.46 Hz, , 22 (d, J = 6.62 Hz, 1H). MS (DCI +) m / z 567 (M + H) +.

Exemplo 336 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-N-[2-hidroxibutil]-4H-tieno[2,3-e][1,2,4]tiadiazina-7-carboxamida, 1,1-dióxido 335 ΕΡ 1 560 827/ΡΤExample 336 3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -N- [2-hydroxybutyl] -4H-thieno [2,3- e] [1 , 2,4] thiadiazine-7-carboxamide, 1,1-dioxide 335 ΕΡ 1 560 827 / ΡΤ

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etil-carbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxibenzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetilformamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se l-amino-2-butanol (4,43 pL, 1,1 equivalentes) seguido de N-metilmorfolina (8 μΐ, 1,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em título como um sólido branco (19,97 mg, 87%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1 H RMN (300 MHz, DMSO-de) δ 0,90 (t, J= :7, 35 Hz, 3H), 1,41 (m, 2H) , 3, 14 ( m, 2H) , 3,50 (m, 1H), 5, 62 (s, 2H) , 7,29 (m, 6H), 7, . 41 (t, J=7,72 Hz, 1H), 7,52 (d, J= =8, 82 Hz, 1H), 7,74 (m, J= =8,09 Hz , 1H), 7,97 (s, 1H), 8,21 (m, 1H), 8,31 (t, J= 5, 33 Hz, 1H) . MS (DCI+) m/z 553 (M+H)+.A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole (8.66 mg , 1.54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added 1-amino-2-butanol (4.43 æl, 1.1 equivalents) followed by N-methylmorpholine (8 μ, 1.72 equivalents) and the solution was stirred for 16 hours. 1N hydrochloric acid solution (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (19.97 mg, 87%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.90 (t, J = 7, 35 Hz, 3H), 1.41 (m, 2H), 3.14 (m, 2H), 3.50 (m, 1H), 5.62 (s, 2H), 7.29 (m, 6H), 7.1. (D, J = 8.82 Hz, 1 H), 7.74 (m, J = 8.09 Hz, 1 H) 97 (s, 1H), 8.21 (m, 1H), 8.31 (t, J = 5.33 Hz, 1H). MS (DCI +) m / z 553 (M + H) +.

Exemplo 337 3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroguinolin-3-il)-N-[2-hidroxi-2-(4-hidroxifenil)etil]-4H-tieno[2,3-e] [1,2,4]-tiadiazina-7-carboxamida, 1,1-dióxidoExample 337 3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroguinolin-3-yl) -N- [2-hydroxy-2- (4-hydroxyphenyl) ethyl] -4H-thieno [2,3-e] [1,2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etilcarbodiimida (11,76 mg, 1,48 eguivalentes) e 1-hidroxibenzotriazole (8,66 mg, 1,54 equivalentes) em N, N-dimetilf ormamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se cloridrato de octopamina (8,6 mg, 1,1 equivalentes) seguido de N-metilmorfolina (12,6 pL, 2,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em título como um sólido branco (13,58 mg, 53%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 4,63 (dd, J=7,72, 4,41 Hz, 1H), 5,62 (s, 2H), 6,72 (d, J=8,46 Hz, 2H), 7,18 (d, J=8,46 Hz, 2H), 7,31 (m, 6H), 7,41 (t, J=7,54 Hz, 1H), 7,52 (d, J=8,82 Hz, H), 336 ΕΡ 1 560 827/ΡΤ 7,74 (t, J= 6,99 Hz, 1H), 7,94 (s, 1H), 8,21 (m, 1H), 8,42 (t, J= 5,52 Hz, 1H), 9,27 (s, 1H). MS (ESI~) m/z 615 (M-H)”.A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equiv.) And 1-hydroxybenzotriazole (8.66 mg, , 54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added octopamine hydrochloride (8.6 mg, 1.1 equivalents) followed by N-methylmorpholine (12.6 æL, 2.72 equivalents) and the solution was stirred for 16 hours. 1N hydrochloric acid solution (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (13.58 mg, 53%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 4.63 (dd, J = 7.72, 4.41 Hz, 1H), 5.62 (s, 2H), 6.72 (d, J = (D, J = 8.46 Hz, 2H), 7.31 (m, 6H), 7.41 (t, J = 7.54 Hz, 1H), 7.52 (d, J = 8.82 Hz, H), 336 Î'5860 827 / Î'7.74 (t, J = 6.99 Hz, 1H), 7.94 (s, 1H), 8.21 , 1H), 8.42 (t, J = 5.52 Hz, 1H), 9.27 (s, 1H). MS (ESI +) m / z 615 (M-H) +.

Exemplo 338 l-benzll-3-[1, l-dioxido-7-(plperazln-1-llcarbonil)-4H-tieno-[2,3-e][1,2,4]tiadiazin-3-il]-4-hidroxiquinolin-2(1H)-onaExample 338 1-Benzyl-3- [1,1-dioxido-7- (piperazin-1-ylcarbonyl) -4H-thieno [2,3-e] [1,2,4] thiadiazin-3-yl] - 4-hydroxyquinolin-2 (1H) -one

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etilcarbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxibenzotriazole (8,66 mg, 1,54 equivalentes) em N,N-dimetilformamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se piperazina (4 mg 1,1 equivalentes) seguida de N-metilmorfolina (8 pL, 1,72 equivalentes) e a solução foi agitada durante 16 horas. Juntou-se água (5 mL) e o precipitado resultante foi recolhido por filtração e lavado com água, metanol e éter dietílico para gerar o composto em titulo como um sólido branco (18,3 mg, 80,16%). O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. 1E RMN (300 MHz, DMSO-d6) δ 3,14 (s, 4H) , 3,65 (m, 4H) , 5,43 (s, 2H), 7,26 (m, 8H) , 7,46 (m, 2H), 8,11 (t, J=1,72 Hz, 1H), 8,70 (br s, 1H). MS (DCI+) m/z 550 (M+H)+.A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole (8.66 mg, , 54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added piperazine (4 mg, 1.1 equivalents) followed by N-methylmorpholine (8æl, 1.72 equivalents) and the solution was stirred for 16 hours. Water (5 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.3 mg, 80.16%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 3.14 (s, 4H), 3.65 (m, 4H), 5.43 (s, 2H), 7.26 (m, 8H), 7.46 (m, 2H), 8.11 (t, J = 1.72 Hz, 1H), 8.70 (br s, 1H). MS (DCI +) m / z 550 (M + H) +.

Exemplo 339 N-[5-(aminocarbonil)piridin-2-il]-3-(l-benzil-4-hidroxi-2-oxo-1,2-di-hidroquinolin-3-il)-4H-tieno[2,3-e][1,2,4]tiadiazina-7-carboxamida, 1,1-dióxidoExample 339 N- [5- (aminocarbonyl) pyridin-2-yl] -3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -4H-thieno [2 , 3-e] [1,2,4] thiadiazine-7-carboxamide, 1,1-dioxide

Uma solução do produto do Exemplo 318 (20 mg, 0,042 mmol), cloridrato de 1-(3-dimetilaminopropil)-3-etilcarbodiimida (11,76 mg, 1,48 equivalentes) e 1-hidroxibenzotriazole (8,66 mg, 1,54 equivalentes) em N, N-dimetilf ormamida (0,4 mL) foi agitada durante 15 minutos a temperatura ambiente. A esta mistura juntou-se 6-aminonicotinamida (6,33 mg, 1,1 equivalentes) seguida de N-metilmorfolina (8 pL, 1,72 equivalentes) e a solução foi aquecida a 70°C durante 16 horas. Juntou-se uma solução de ácido clorídrico IN (4 mL) e o precipitado resultante foi recolhido por filtração e lavado com água e éter dietílico. O sólido foi dissolvido em 5% de metanol/diclorometano com 2 gotas de trietilamina e purificado por cromatografia instantânea em sílica gel utilizando uma coluna Biotage-12s eluindo com metanol/diclorometano 10:90 para 337A solution of the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole (8.66 mg, , 54 equivalents) in N, N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this was added 6-aminonicotinamide (6.33 mg, 1.1 equivalents) followed by N-methylmorpholine (8 μl, 1.72 equivalents) and the solution was heated at 70 ° C for 16 hours. 1N hydrochloric acid solution (4 mL) was added and the resulting precipitate was collected by filtration and washed with water and diethyl ether. The solid was dissolved in 5% methanol / dichloromethane with 2 drops of triethylamine and purified by flash chromatography on silica gel using a Biotage-12s column eluting with methanol / dichloromethane 10:90 to 337

ΕΡ 1 560 827/PT gerar o composto em título como um sólido branco (5,4 mg, 21,6%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1R RMN (300 MHz, DMSO-de) δ 5,64 (s, 2 H, ) 7,30 (m, 6H), 7,43 (t, J=7,54 Hz, 1H), 7,50 (m, 1H), 7,54 (d, J=8,46 Hz, 1H), 7,76 (m, 1H), 8,10 (s, 1H), 8,24 (m, 2H), 8,32 (m, 1H), 8,38 (s, 1H), 8,88 (d, J=l,84 Hz, 1H), 11,17 (S, 1H). MS (DCT+) m/z 601 (M+H)+.The title compound was obtained as a white solid (5.4 mg, 21.6%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.64 (s, 2 H) 7.30 (m, 6H), 7.43 (t, J = d, J = 8.46 Hz, 1H), 7.76 (m, 1H), 8.10 (s, 1H), 8.24 (m, 2H) 32 (m, 1H), 8.38 (s, 1H), 8.88 (d, J = 1.84 Hz, 1H), 11.17 (S, 1H). MS (DCT +) m / z 601 (M + H) +.

Exemplo 340A 2-(isopentilamino)nicotinato de etiloExample 340A Ethyl 2- (isopentylamino) nicotinate

Uma mistura de 2-cloronicotinato de etilo (3,71 g, 20 mmol), isoamilamina (3,03 mL, 26 mmol) e trietilamina (3,62 mL, 26 mmol) foi aquecida num tubo selado a 140°C durante 8 horas, arrefecida até 25°C, diluída com acetato de etilo e a mistura lavada com água. A fase orgânica foi extraída com ácido clorídrico aquoso IN. A fase aquosa acídica foi ajustada a pH 8,0 com uma solução saturada de bicarbonato de sódio e depois extraída com acetato de etilo (2 porções). Os extractos orgânicos combinados foram secos sobre sulfato de sódio, filtrados e concentrados sob pressão reduzida para gerar o composto em título (3,58 g, 76%). MS (DCI/NH3) m/z 237 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ ppm 0,93 (d, J= 6,25 Hz, 6H) 1,31 (t, J=6,99 Hz, 3H) 1,47 (q, J= 6,99 Hz, 2H) 1,64 (m, 1H) 3,47 (m, 2H) 4,28 (q, J=6,99 Hz, 2H) 6,59 (dd, J=7,72, 4,78 Hz, 1H) 7,90 (t, J= 5,15 Hz, 1H) 8,07 (dd, J=7,91, 2,02 Hz, 1H) 8,28 (dd, J=4, 78, 1, 84 Hz, 1H) .A mixture of ethyl 2-chloronicotinate (3.71 g, 20 mmol), isoamylamine (3.03 mL, 26 mmol) and triethylamine (3.62 mL, 26 mmol) was heated in a sealed tube at 140 ° C for 8 hours. cooled to 25 ° C, diluted with ethyl acetate and the mixture washed with water. The organic phase was extracted with 1N aqueous hydrochloric acid. The acidic aqueous phase was adjusted to pH 8.0 with saturated sodium bicarbonate solution and then extracted with ethyl acetate (2 portions). The combined organic extracts were dried over sodium sulfate, filtered and concentrated under reduced pressure to give the title compound (3.58 g, 76%). MS (DCI / NH 3) m / z 237 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.93 (d, J = 6.25 Hz, 6H) 1.31 (t, J = 6.99 Hz, 3H) 6.99 Hz, 2 H) 1.64 (m, 1 H) 3.47 (m, 2 H) 4.28 (q, J = 6.99 Hz, 2 H) 6.59 (dd, J = 7.72, 4.78 Hz, 1 H) 7.90 (t, J = 5.15 Hz, 1 H) 8.07 (dd, J = 7.91, 2.02 Hz, 1 H) 8.28 (dd, J = 4). , 78.1, 84 Hz, 1H).

Exemplo 340B ácido 2-(isopentilamino)nicotínicoExample 340B 2- (Isopentylamino) nicotinic acid

Uma mistura do Exemplo 340A (1,73 g, 7,31 mmol), hidróxido de sódio aquoso IN (14,6 mL) e metanol (7 mL) foi agitada durante 18 horas e diluída com água. A mistura aquosa foi lavada com acetato de etilo seguido de diclorometano e ajustada a pH 7,5 com ácido clorídrico aquoso IN. O precipitado resultante foi recolhido por filtração sob vácuo, lavado com água e seco ao ar para gerar o composto em título (424,4 mg, 28%). MS (DCI/NH3) m/z 209 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ ppm 0,91 (d, J=6,62 Hz, 6H) 1,46 (q, J=6,99 Hz, 2H) 1,63 (m, 1H) 3,45 (t, J=7,17 Hz, 2H) 6,56 (dd, J=7,72, 4,78 338 ΕΡ 1 560 827/ΡΤA mixture of Example 340A (1.73 g, 7.31 mmol), 1N aqueous sodium hydroxide (14.6 mL) and methanol (7 mL) was stirred for 18 hours and diluted with water. The aqueous mixture was washed with ethyl acetate followed by dichloromethane and adjusted to pH 7.5 with 1N aqueous hydrochloric acid. The resulting precipitate was collected by vacuum filtration, washed with water and air dried to give the title compound (424.4 mg, 28%). MS (DCI / NH 3) m / z 209 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.91 (d, J = 6.62 Hz, 6H) 1.46 (q, J = 6.99 Hz, 3.45 (t, J = 7.17 Hz, 2 H) 6.56 (dd, J = 7.72, 4.78 338 η 1 1560 827 / ΡΤ

Hz, 1Η) 8,04 (dd, J=7, 72, 1, 84 Hz, 1Η) 8,05 (m, 1Η) 8,25 (dd, J=4,78, 2,21 Hz, 1Η) 12,96 (s, 1H) .(Dd, J = 7.72, 1.84 Hz, 1Η) 8.05 (m, 1Η) 8.25 (dd, J = 4.78, 2.21 Hz, 1Η) 12.96 (s, 1H).

Exemplo 340C 4-hidroxi-l-(3-metilbutil)-1,8-naftlridln-2(1H)-onaExample 340C 4-Hydroxy-1- (3-methylbutyl) -1,8-naphthylidene-2 (1H) -one

Uma mistura do Exemplo 340B (1 g, 4,81 mmol), anidrido acético (10 mL) e ácido acético glacial (10 mL) foi aquecida a 130°C durante 2 horas. A mistura foi arrefecida até 25°C e concentrada sob pressão reduzida. O residuo foi repartido entre acetato de etilo e bicarbonato de sódio aquoso saturado. A fase orgânica foi lavada com salmoura, seca sobre sulfato de sódio, filtrada e concentrada sob pressão reduzida. O residuo foi cromatografado em sílica gel, eluindo com 0-100% de hexano em gradiente por passos de acetato de etilo para gerar o composto em título (100 mg, 9%). MS (DCI/NH3) m/z 233 (M+H) + . XH RMN (300 MHz, DMSO-D6) δ ppm 0,94 (d, J=6,62 Hz, 6H) 1,46 (m, 2H) 1,60 (m, 1H) 4,33 (m, 2H) 5,88 (s, 1H) 7,27 (dd, J=7,72, 4,78 Hz, 1H) 8,22 (dd, J=7,72, 1,84 Hz, 1H) 8,65 (dd, J=4, 78, 1, 84 Hz, 1H), 11,61 (s, 1H) .A mixture of Example 340B (1 g, 4.81 mmol), acetic anhydride (10 mL) and glacial acetic acid (10 mL) was heated at 130 ° C for 2 hours. The mixture was cooled to 25 ° C and concentrated under reduced pressure. The residue was partitioned between ethyl acetate and saturated aqueous sodium bicarbonate. The organic layer was washed with brine, dried over sodium sulfate, filtered and concentrated under reduced pressure. The residue was chromatographed on silica gel, eluting with 0-100% hexane in step gradient of ethyl acetate to give the title compound (100 mg, 9%). MS (DCI / NH 3) m / z 233 (M + H) +. 1 H NMR (300 MHz, DMSO-D 6) δ ppm 0.94 (d, J = 6.62 Hz, 6H) 1.46 (m, 2H) 1.60 (m, 1H) 4.33 (m, 2H ) 5.88 (s, 1H) 7.27 (dd, J = 7.72, 4.78 Hz, 1 H) 8.22 (dd, J = 7.72, 1.84 Hz, (dd, J = 4.78, 1.84 Hz, 1H), 11.61 (s, 1H).

Exemplo 340D 3-[bis(metiltio)metilenol-l-butil-1,8-naftiridina-2,4(1H, 3H)-dionaExample 340D 3- [Bis (methylthio) methylene] -1-butyl-1,8-naphthyridine-2,4 (1H, 3H) -dione

Uma solução do produto do Exemplo 340C (0,2 g, 0,86 mmol) em dimetilformamida (7 mL) foi tratada com hidreto de sódio (76 mg, 60% em óleo mineral, 2,2 equivalentes), agitada durante 30 min a 25°C, tratada com dissulfureto de carbono (0,14 g, 2,2 eq.), aquecida a 50°C durante 6 horas, arrefecida até 25°C e tratada com iodeto de metilo (0,27 g, 2,2 eq.). A mistura foi agitada a 25°C durante 18 horas e concentrada. O resíduo foi triturado com água e os sólidos resultantes foram filtrados e secos sob vácuo para gerar o composto em título (0,23 g, rendimento bruto 80%). 1K RMN (300 MHz, DMSO-d6) δ 1,00 (d, J=10 Hz, 6H), 1,6 (m, 2H), 1,75 (m, 1H), 2,63 (s, 6H), 4,4 (m, 2H), 7,1 (dd, J=10 Hz, 7 Hz, 1H), 8,42 (dd, J=10A solution of the product of Example 340C (0.2 g, 0.86 mmol) in dimethylformamide (7 mL) was treated with sodium hydride (76 mg, 60% in mineral oil, 2.2 equivalents), stirred for 30 min was treated with carbon disulfide (0.14 g, 2.2 eq.), heated at 50 ° C for 6 hours, cooled to 25 ° C and treated with methyl iodide (0.27 g, , 2 eq.). The mixture was stirred at 25 ° C for 18 hours and concentrated. The residue was triturated with water and the resulting solids were filtered and dried under vacuum to give the title compound (0.23 g, 80% crude yield). 1 H NMR (300 MHz, DMSO-d 6) δ 1.00 (d, J = 10 Hz, 6H), 1.6 (m, 2H), 1.75 (m, 1H), 2.63 (s, 6H ), 4.4 (m, 2H), 7.1 (dd, J = 10 Hz, 7 Hz, 1H), 8.42 (dd, J = 10

Hz, 3 Hz, 1H), 8,58 (dd, J=1 Hz, 3 Hz, 1H). MS (DCI+) m/z 337 (M+H)+. 339 ΕΡ 1 560 827/ΡΤHz, 3Hz, 1H), 8.58 (dd, J = 1Hz, 3Hz, 1H). MS (DCI +) m / z 337 (M + H) +. 339 ΕΡ 1 560 827 / ΡΤ

Exemplo 340Ε 4-hidroxi-3-{ 7- [ (metoximetoxi)metil] -1, l-dioxido-4ff-tieno-[2,3-e][1,2,4]tiadiazin-3-il}-l-(3-metilbutil)-1,8-naftiridin-2(1H)-ona O produto do Exemplo 309G (37,5 mg, 0,15 mmol) e o produto do Exemplo 340D (50 mg, 0,15 mmol) reagiram em tolueno (5 mL) a 100°C durante 3 horas. A reacção foi concentrada sob pressão reduzida e o resíduo foi purificado por cromatografia em sílica gel utilizando uma coluna Biotage-12m eluindo com metanol:diclorometano 2:98 para gerar o composto em título como um sólido amarelo (36 mg, 49%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 0,98 (d, J= 6,99 Hz, 6H), 1,57 (m, 2H), 1,66 (m, 1H), 4,45 (d, J=7,35 Hz, 2H), 4,64 (s, 3H), 4,71 (s, 3H), 7,43 (s, 1H) , 7,46 (m, 1H) , 8,54 (d, J=6,99 Hz, 1H), 8,87 (s, 1H) , 14,45 (br s, 1H). MS (DCI + ) m/z 510 (M+NH4) + .Example 340 and 4-hydroxy-3- {7 - [(methoxymethoxy) methyl] -1,1-dioxido-4 H -thieno [2,3- e] [1,2,4] thiadiazin-3-yl} -1 The product of Example 309G (37.5 mg, 0.15 mmol) and the product of Example 340D (50 mg, 0.15 mmol) in dichloromethane were reacted in toluene (5 mL) at 100 ° C for 3 hours. The reaction was concentrated under reduced pressure and the residue was purified by silica gel chromatography using a Biotage-12m column eluting with methanol: dichloromethane 2:98 to give the title compound as a yellow solid (36 mg, 49%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ0.98 (d, J = 6.99 Hz, 6H), 1.57 (m, 2H), 1.66 (m, 1H), 4.45 (d 2H), 4.64 (s, 3H), 4.71 (s, 3H), 7.43 (s, 1H), 7.46 (m, 1H), 8.54 (d, J = 6.99 Hz, 1H), 8.87 (s, 1H), 14.45 (br s, 1H). MS (DCI +) m / z 510 (M + NH 4) +.

Exemplo 341 4-hidroxi-3-[7-(hidroximetil)-1, l-dioxido-4H-tieno[2, 3-e]-[1,2,4]tiadiazin-3-il]-1-(3-metilbutil)-1,8-naftiridin-2(1H)- ona O produto do Exemplo 340C (23 mg, 0,05 mmol) reagiu com ácido clorídrico aguoso 6N (1 mL) em tetra-hidrofurano (2 mL) a 70°C durante 3 horas. A reacção foi concentrada sob pressão reduzida para remover o tetra-hidrofurano e tratada com metanol (5 mL). O precipitado resultante foi recolhido por filtração e lavado com água e éter dietílico para gerar o composto em título como um sólido branco (13 mg, 62%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ^ RMN (300 MHz, DMSO-4) δ 0,98 (d, J=6,62 Hz, 6H), 1,57 (m, 2H), 1,67 (m, 1H), 4,46 (m, 2H), 4,62 (s, 2H), 7,30 (s, 1H) , 7,47 (dd, J=8, 09, 4, 78 Hz, 1H), 8,54 (dd, J=7, 72, 1, 84 Hz, 1H), 8,86 (m, 1H) , 14,39 (br s, 1H). MS (DCI+) m/z 466 (M+NH4)+. 340 ΕΡ 1 560 827/ΡΤExample 341 4-Hydroxy-3- [7- (hydroxymethyl) -1,1-dioxido-4H-thieno [2,3-e] - [1,2,4] thiadiazin-3-yl] -1- (3 The product from Example 340C (23 mg, 0.05 mmol) was reacted with 6N aqueous hydrochloric acid (1 mL) in tetrahydrofuran (2 mL) at 70 DEG C. ° C for 3 hours. The reaction was concentrated under reduced pressure to remove the tetrahydrofuran and treated with methanol (5 mL). The resulting precipitate was collected by filtration and washed with water and diethyl ether to give the title compound as a white solid (13 mg, 62%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) δ 0.98 (d, J = 6.62 Hz, 6H), 1.57 (m, 2H), 1.67 (m, 1H), 4.46 2H), 4.62 (s, 2H), 7.30 (s, 1H), 7.47 (dd, J = 8.94,4.7Hz, 1H), 8.54 (dd, J = 7.72, 1.84 Hz, 1H), 8.86 (m, 1H), 14.39 (br s, 1H). MS (DCI +) m / z 466 (M + NH 4) +. 340 ΕΡ 1 560 827 / ΡΤ

Exemplo 342 carbamato de [3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-1, l-dioxido-4fl-tieno[2,3-e] [1,2,4]tladlazin-7-11]metiloExample 342 [3- (1-Benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -1,1-dioxido-4'-thieno [2,3- e] 1,2,4] thiadiazin-7-11] methyl

Uma suspensão do produto do Exemplo 310 (40 mg, 0,086 mmol) numa solução de N, N-dimetilformamida (2 mL) e acetonitrilo (0,6 mL) a -20°C foi tratada com clorossulfonil-isocianato (16,4 pL, 2,2 equivalentes). A mistura foi agitada 0,5 horas a 20°C e 2 horas a 0°C, juntou-se ácido clorídrico 6N (2 mL) e a mistura foi aquecida 2,5 horas a 70°C. A mistura foi arrefecida e juntou-se água (10 mL), o precipitado resultante foi recolhido por filtração e lavado com água e éter dietílico. O sólido foi dissolvido em 5% de metanol/diclorometano com algumas gotas de trietilamina e purificado por cromatografia instantânea em sílica gel utilizando uma coluna Biotage-12s eluindo com metanol/diclorometano 6:94 para gerar o composto em título como um sólido branco (23 mg, 52,6%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo ID. XH RMN (300 MHz, DMSO-d6) δ 5,08 (s, 2H), 5,62 (s, 2H), 6,72 (s, 2 H, ) 7,29 (m, 5H), 7,42 (m, 2H), 7,53 (d, J= 8,82 Hz, 1H), 7,77 (t, J=7,35 Hz, 1H) , 8,22 (d, J= 6,99A suspension of the product of Example 310 (40 mg, 0.086 mmol) in a solution of N, N-dimethylformamide (2 mL) and acetonitrile (0.6 mL) at -20 ° C was treated with chlorosulfonylisocyanate (16.4 μL , 2.2 equivalents). The mixture was stirred 0.5 hours at 20 ° C and 2 hours at 0 ° C, 6N hydrochloric acid (2 mL) was added and the mixture was heated 2.5 hours at 70 ° C. The mixture was cooled and water (10 mL) was added, the resulting precipitate was collected by filtration and washed with water and diethyl ether. The solid was dissolved in 5% methanol / dichloromethane with a few drops of triethylamine and purified by flash chromatography on silica gel using a Biotage-12s column eluting with methanol / dichloromethane 6:94 to give the title compound as a white solid (23%). mg, 52.6%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1 H NMR (300 MHz, DMSO-d 6) δ 5.08 (s, 2H), 5.62 (s, 2H), 6.72 (s, 2 H) 7.29 (m, 5H) (D, J = 8.82 Hz, 1 H), 7.77 (t, J = 7.35 Hz, 1 H), 8.22 (d, J = 6.99

Hz, 1H) . MS (DCI +) m/z 528 (M+NH4)\Hz, 1H). MS (DCI +) m / z 528 (M + NH 4)

Exemplo 343 aminocarbonilcarbamato_de_[3- (l-benzil-4-hidroxi-2-oxo- 1,2-di-hidroquinolin-3-il) -1, l-dioxido-4ff-tieno [2,3-e] [1,2,4] — tiadiazin-7-il]metiloExample 343 [3- (1-Benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -1,1-dioxido-4 H -thieno [2,3- e] [1 , 2,4] thiadiazin-7-yl] methyl

Uma suspensão do produto do Exemplo 310 (40 mg, 0,086 mmol) numa solução de N,N-dimetilformamida (2 mL) e acetonitrilo (0,6 mL) a -20°C foi tratada com clorossulfonil-isocianato (16,4 pL, 2,2 equivalentes). A mistura foi agitada 0,5 horas a -20°C e 2 horas a 0°C, juntou-se ácido clorídrico 6N (2 mL) e a mistura foi aquecida 2,5 horas a 70°C. A mistura foi arrefecida e juntou-se água (10 mL), o precipitado resultante foi recolhido por filtração e lavado com água e éter dietílico. O sólido foi dissolvido em 5% de metanol/diclorometano com algumas gotas de trietilamina e purificado por cromatografia instantânea em sílica gel utilizando uma coluna Biotage-12s eluindo com metanol/diclorometano 6:94 para gerar o composto em título (6 341 ΕΡ 1 560 827/ΡΤ mg, 12,7%). Ο sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 5,23 (s, 2H), 5,61 (s, 2H), 7,28 (m, 4H), 7,35 (m, 2 H) , 7,51 (m, 1H), 8,20 (m, 2H), 10,01 (s, 1H). MS (ESI-) m/z 552 (M-H)“.A suspension of the product of Example 310 (40 mg, 0.086 mmol) in a solution of N, N-dimethylformamide (2 mL) and acetonitrile (0.6 mL) at -20 ° C was treated with chlorosulfonylisocyanate (16.4 μL , 2.2 equivalents). The mixture was stirred 0.5 hours at -20 ° C and 2 hours at 0 ° C, 6N hydrochloric acid (2 mL) was added and the mixture was heated 2.5 hours at 70 ° C. The mixture was cooled and water (10 mL) was added, the resulting precipitate was collected by filtration and washed with water and diethyl ether. The solid was dissolved in 5% methanol / dichloromethane with a few drops of triethylamine and purified by flash chromatography on silica gel using a Biotage-12s column eluting with methanol / dichloromethane 6:94 to give the title compound (6,341 e1,560 827 / ΡΤ mg, 12.7%). The title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 5.23 (s, 2H), 5.61 (s, 2H), 7.28 (m, 4H), 7.35 (m, 2H) 51 (m, 1H), 8.20 (m, 2H), 10.01 (s, 1H). MS (ESI-) m / z 552 (M-H).

Exemplo 344 3-[7-(azidometil)-1,l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-3—i1]-l-benzil-4-hidroxiquinolin-2(1H)-ona À solução do produto do Exemplo 310 (156,4 mg, 0,33 mmol) em diclorometano (3 mL) juntou-se 1,8-diazabiciclo[5.4.0] -undec-7-eno (0,37 mL, 2,47 mmol) e difenilfosforilazida (0,54 mL, 2,50 mmol) a temperatura ambiente. A solução foi agitada a temperatura ambiente de um dia para o outro e concentrada in vacuo. O resíduo foi diluído com etanol e juntou-se cloreto de hidrogénio aquoso (IN, 2 mL) lentamente e apareceu um precipitado. O sólido foi filtrado e enxaguado com uma solução de etanol/água (2:1) para gerar o composto em título como um sólido castanho claro (124,47 mg, 76%). MS (ESI~) m/z 491 (Μ-ΗΓ. RMN (300 MHz, DMSO-d6) δ 4,59 (s, 2H) 5,62 (br s, 2H) 7,30 (m, 5H) 7,41 (t, J=7,54 Hz, 1H) 7,52 (d, J= 8,82 Hz, 1H) 7,58 (s, 1H) 7,76 (m, 1H) 8,22 (dd, J= 8, 09, 1, 47 Hz, 1H).Example 344 3- [7- (Azidomethyl) -1,1-dioxido-4H-thieno [2,3-e] [1,2,4] thiadiazin-3-yl] -1-benzyl-4-hydroxyquinolin-2- (1H) -one To the solution of the product of Example 310 (156.4 mg, 0.33 mmol) in dichloromethane (3 mL) was added 1,8-diazabicyclo [5.4.0] undec-7-ene , 37 mL, 2.47 mmol) and diphenylphosphorylazide (0.54 mL, 2.50 mmol) at room temperature. The solution was stirred at room temperature overnight and concentrated in vacuo. The residue was diluted with ethanol and aqueous hydrogen chloride (1 N, 2 mL) was added slowly and a precipitate appeared. The solid was filtered and rinsed with an ethanol / water (2: 1) solution to give the title compound as a light brown solid (124.47 mg, 76%). NMR (300 MHz, DMSO-d 6) δ 4.59 (s, 2H) 5.62 (br s, 2H) 7.30 (m, 5H) 7 1H), 7.58 (s, 1H), 7.76 (m, 1H), 8.22 (dd, J = 8.82 Hz, , J = 8.09, 1.47 Hz, 1H).

Exemplo 345 3-[7-(aminometil)-1,l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-3-il]-l-benzil-4-hidroxiguinolin-2(1H)-ona A solução do produto do Exemplo 344 (136,2 mg, 0,28 mmol) em piridina (1,68 mL) e hidróxido de amónio concentrado (1,12 mL) juntou-se trifenilfosfina (145 mg, 0,55 mmol) a temperatura ambiente. A solução foi agitada a temperatura ambiente de um dia para o outro e concentrada in vacuo. O resíduo foi diluído com tolueno e o sólido foi filtrado para gerar o composto em título como um sólido castanho claro (100, 78 mg, 78%). MS (ESI + ) m/z 467 (M+H)\ XH RMN (300 MHz, DMSO-de) δ 4,10 (s, 2H) 5,41 (br s, 2H) 7, 07-7, 32 (m, 8H) 7,43 (m, 1H) 8,10 (dd, J=7,91, 1,65 Hz, 1H). 342Example 345 3- [7- (Aminomethyl) -1,1-dioxido-4 H -thieno [2,3- e] [1,2,4] thiadiazin-3-yl] -1-benzyl-4-hydroxyquinolin-2- (1H) -one The solution of the product of Example 344 (136.2 mg, 0.28 mmol) in pyridine (1.68 mL) and concentrated ammonium hydroxide (1.12 mL) was added triphenylphosphine (145 mg, 0.55 mmol) at room temperature. The solution was stirred at room temperature overnight and concentrated in vacuo. The residue was diluted with toluene and the solid filtered to give the title compound as a light brown solid (100.78 mg, 78%). MS (ESI +) m / z 467 (M + H) +; 1 H NMR (300 MHz, DMSO-d 6): δ 4.10 (s, 2H) 5.41 (br s, 2H) 7.07-7.32 (m, 8H) 7.43 (m, 1H) 8.10 (dd, J = 7.91, 1.65 Hz, 1H). 342

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 346 N-{[3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-1,l-dioxido-4H-tieno[2,3-e][1,2, 4]tiadiazin-7-il]metil}-metanossulfonamida A uma solução do produto do Exemplo 345 (15 mg, 0,032 mmol) em tetra-hidrofurano (0,4 mL) juntou-se trietilamina (0,018 mL, 0,129 mmol) seguida de 1, 8-diazabiciclo[5.4.0]undec-7-eno (0,018 mL, 0,129 mmol). A mistura foi arrefecida até 0°C e juntou-se cloreto de metanossulfonilo (0,003 mL, 0,032 mmol). A mistura foi agitada a 0°C durante 2,5 horas e depois aquecida até 23°C e agitada durante 2,5 horas. Juntaram-se 1,8-diazabiciclo[5.4.0]undec-7-eno (0,010 ml, 0,064 mmol) e cloreto de metanossulfonilo (0,003 mL, 0,032 mmol) adicionais e a mistura foi agitada a 23°C durante 15 horas. Juntaram-se algumas gotas de Ν,Ν-dimetilformamida para aumentar a solubilidade. Juntou-se mais cloreto de metanossulfonilo (0,003 mL, 0,032 mmol) e a mistura reaccional foi agitada a 23°C durante 3 horas. Juntaram-se algumas gotas de Ν,Ν-dimetilformamida e cloreto de metanossulfonilo (0,003 mL, 0,032 mmol) e a mistura reaccional foi agitada a 23°C durante 1 hora. Juntou-se cloreto de metanossulfonilo (0,006 mL, 0,064 mmol) adicional e a mistura reaccional foi agitada a 23°C durante 72 horas. A mistura reaccional foi concentrada sob pressão reduzida. O concentrado foi diluído com éter dietílico e juntou-se ácido clorídrico IN até não se observar precipitação adicional. O precipitado foi depois lavado com água seguida de éter dietílico. O sólido foi dissolvido em 1% de trietilamina/diclorometano e purificado por cromatografia de camada fina preparativa eluindo com 5% de (5% de trietilamina/ metanol)/diclorometano. A sílica gel foi lavada com 10% de (5% de trietilamina/metanol)/diclorometano para gerar o sal de trietilamina do composto em título (4,7 mg, 23%). XH RMN (500 MHz, DMSO-d6) δ 1,16 (t, J=6,7 Hz, 9H) 2,94 (s, 3H) 3,08 (bs, 6H) 4,26 (d, 2H) 5,40 (bs, 2H) 7,06 (m, 2H) 7,12 (d, J=8,54 Hz, 1H) 7,23 (m, 5H) 7,40 (t, J=7,32 Hz, 1H) 7,50 (t, J=6,41 Hz, 1H) 8,10 (d, J=6,10 Hz, 1H).Example 346 N - {[3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -1,1-dioxido-4H-thieno [2,3- e] [1,2,4] thiadiazin-7-yl] methyl} methanesulfonamide To a solution of the product of Example 345 (15 mg, 0.032 mmol) in tetrahydrofuran (0.4 mL) was added triethylamine (0.018 mL, 0.129 mmol) followed by 1,8-diazabicyclo [5.4.0] undec-7-ene (0.018 mL, 0.129 mmol). The mixture was cooled to 0 ° C and methanesulfonyl chloride (0.003 mL, 0.032 mmol) was added. The mixture was stirred at 0 ° C for 2.5 hours and then warmed to 23 ° C and stirred for 2.5 hours. 1,8-Diazabicyclo [5.4.0] undec-7-ene (0.010 mL, 0.064 mmol) and methanesulfonyl chloride (0.003 mL, 0.032 mmol) were added and the mixture was stirred at 23 ° C for 15 hours. A few drops of Ν, Ν-dimethylformamide were added to increase the solubility. Additional methanesulfonyl chloride (0.003 mL, 0.032 mmol) was added and the reaction mixture was stirred at 23 ° C for 3 hours. A few drops of Ν, Ν-dimethylformamide and methanesulfonyl chloride (0.003 mL, 0.032 mmol) were added and the reaction mixture was stirred at 23 ° C for 1 hour. Additional methanesulfonyl chloride (0.006 mL, 0.064 mmol) was added and the reaction mixture was stirred at 23 ° C for 72 hours. The reaction mixture was concentrated under reduced pressure. The concentrate was diluted with diethyl ether and 1N hydrochloric acid was added until no further precipitation was observed. The precipitate was then washed with water followed by diethyl ether. The solid was dissolved in 1% triethylamine / dichloromethane and purified by preparative thin layer chromatography eluting with 5% (5% triethylamine / methanol) / dichloromethane. The silica gel was washed with 10% (5% triethylamine / methanol) / dichloromethane to give the triethylamine salt of the title compound (4.7 mg, 23%). 1 H NMR (500 MHz, DMSO-d 6) δ 1.16 (t, J = 6.7 Hz, 9H) 2.94 (s, 3H) 3.08 (bs, 6H) 4.26 (d, 2H) 5.40 (bs, 2H) 7.06 (m, 2H) 7.12 (d, J = 8.54 Hz, 1 H) 7.23 (m, 5H) 7.40 (t, J = 7.32 Hz, 1H) 7.50 (t, J = 6.41 Hz, 1 H) 8.10 (d, J = 6.10 Hz, 1H).

Exemplo 347 N-{3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroguinolin-3-il)-1,l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-7-il]metil}-nicotinamida 343 ΕΡ 1 560 827/ΡΤ À solução do produto do Exemplo 345 (0,015 g, 0,032 mmol) em tetra-hidrofurano (0,4 mL) juntou-se trietilamina (0,022 mL, 0,160 mmol) e 1,8-diazabiciclo[5.4.0]undec-7-eno (0,020 mL, 0,129 mmol). A mistura foi arrefecida até 0°C e juntou-se cloridrato de cloreto de nicotinoílo (0,007 g, 0,035 mmol). A mistura foi agitada durante 2,5 horas e depois aguecida até 23°C e agitada durante 2,5 horas. Juntaram-se 1,8-diaza-biciclo[5.4.0]undec-7-eno (0,010 mL, 0,068 mmol) e cloridrato de cloreto de nicotinoílo (0,006 g, 0,032 mmol) adicionais e a mistura foi agitada a 23°C durante 15 horas. Juntou-se mais cloridrato de cloreto de nicotinoílo (0,006 g, 0,032 mmol) e agitou-se a 23°C durante 6 horas. Juntaram-se algumas gotas de N,N-dimetilformamida para aumentar a solubilidade. Juntou-se mais cloridrato de cloreto de nicotinoílo (0,006 g, 0,032 mmol) e agitou-se a 23°C durante 72 horas. Juntou-se ácido clorídrico (4M em dioxano) (0,095 mL, 0,370 mmol) e a mistura reaccional foi concentrada sob pressão reduzida. O sólido resultante foi depois lavado com éter dietílico e água. O sólido foi dissolvido em 1% de trietilamina/diclorometano e purificado por cromatografia em camada fina preparativa eluindo com 5% de (5% de trietilamina/metanol)/diclorometano. A sílica gel foi lavada com 10% de (5% de trietilamina/ metanol)/diclorometano para gerar o sal de trietilamina do composto em título (0,0068 g, 31%). XH RMN (500 MHz, DMSO-dê) δ 1,17 (t, J=1, 32 Hz, 9H) 3,09 (q, J=7,32 Hz, 6H) 4,60 (d, J=4,88 Hz, 2H) 5,44 (bs, 2H) 7,00 (bs; 1 H) 7,12 (m, 1H) 7,26 (m, 5H) 7,46 (m, 1H) 7,53 (dd, J=7, 63, 4,58 Hz, 1H) 8,12 (d, J=7,32,Hz, 1H) 8,26 (m, J=7,93 Hz, 1H) 8,72 (d, J=3,66 Hz, 1H) 8,86 (bs, 1H) 9,09 (s, 1H) 9,16 (bs, 1H).Example 347 N- {3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroguinolin-3-yl) -1,1-dioxido-4H-thieno [2,3- e] 1,2,4] thiadiazin-7-yl] methyl} -nicotinamide The solution of the product of Example 345 (0.015 g, 0.032 mmol) in tetrahydrofuran (0.4 mL) was added triethylamine (0.022 mL, 0.160 mmol) and 1,8-diazabicyclo [5.4.0] undec-7-ene (0.020 mL, 0.129 mmol). The mixture was cooled to 0 ° C and nicotinoyl chloride hydrochloride (0.007 g, 0.035 mmol) was added. The mixture was stirred for 2.5 hours and then warmed to 23 ° C and stirred for 2.5 hours. 1,8-diaza-bicyclo [5.4.0] undec-7-ene (0.010 mL, 0.068 mmol) and nicotinoyl chloride hydrochloride (0.006 g, 0.032 mmol) were added and the mixture was stirred at 23 ° C for 15 hours. Further nicotinoyl chloride hydrochloride (0.006 g, 0.032 mmol) was added and stirred at 23 ° C for 6 hours. A few drops of N, N-dimethylformamide were added to increase the solubility. Further nicotinoyl chloride hydrochloride (0.006 g, 0.032 mmol) was added and stirred at 23 ° C for 72 hours. Hydrochloric acid (4M in dioxane) (0.095 mL, 0.370 mmol) was added and the reaction mixture was concentrated under reduced pressure. The resulting solid was then washed with diethyl ether and water. The solid was dissolved in 1% triethylamine / dichloromethane and purified by preparative thin layer chromatography eluting with 5% (5% triethylamine / methanol) / dichloromethane. The silica gel was washed with 10% (5% triethylamine / methanol) / dichloromethane to give the triethylamine salt of the title compound (0.0068 g, 31%). 1 H NMR (500 MHz, DMSO-d 6) δ 1.17 (t, J = 1.32 Hz, 9H) 3.09 (q, J = 7.32 Hz, 6H) 4.60 (d, J = 4) (M, 1H), 7.26 (m, 5H), 7.46 (m, 1H), 7.53 (m, (d, J = 7.32, Hz, 1 H) 8.26 (m, J = 7.93 Hz, 1 H) 8.72 (dd, J = 7.63, 4.58 Hz, 1 H) (d, J = 3.66 Hz, 1 H) 8.86 (bs, 1 H) 9.09 (s, 1 H) 9.16 (bs, 1H).

Exemplo 348 N-{[3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroguinolin-3-il)-1,l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-7-il]metil}-morfolina-4-carboxamida A solução do produto do Exemplo 345 (0,015 g, 0,032 mmol) em tetra-hidrofurano (0,4 mL) juntou-se trietilamina (0,009 mL, 0,064 mmol). A mistura foi arrefecida até 0°C e juntou-se cloreto de 4-morfolinacarbonilo (0,004 mL, 0,035 mmol). A mistura reaccional foi aquecida até 23°C e agitada durante 15 horas. Juntou-se ácido clorídrico IN (0,065 mL, 0,064 mmol) e 344 ΕΡ 1 560 827/ΡΤ a mistura foi depois concentrada sob pressão reduzida. O produto foi lavado com éter dietilico e água para gerar o composto em título (7,5 mg, 40%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (500 MHz, DMSO-d6) δ 3,57 (t, 4H) 4,38 (d, J=4,88 Hz, 2H) 5,60 (bs, 2H) 7,11 (m, 2H) 7,27 (m, 6H) 7,38 (m, J=7,32, 3,05 Hz, 1H) 7,49 (m, J=7,32 Hz, 1H) 7,73 (bs, 1H) 8,21 (d, J=7,32 Hz, 1H).Example 348 N - {[3- (1-Benzyl-4-hydroxy-2-oxo-1,2-dihydroguinolin-3-yl) -1,1-dioxido-4H-thieno [2,3- e] [1,2,4] thiadiazin-7-yl] methyl} -morpholine-4-carboxamide The solution of the product of Example 345 (0.015 g, 0.032 mmol) in tetrahydrofuran (0.4 mL) was added triethylamine ( 0.009 mL, 0.064 mmol). The mixture was cooled to 0 ° C and 4-morpholinecarbonyl chloride (0.004 mL, 0.035 mmol) was added. The reaction mixture was warmed to 23 ° C and stirred for 15 hours. 1N hydrochloric acid (0.065 mL, 0.064 mmol) and 344 Ρ Ρ 1 560 827 Jun were added and the mixture was then concentrated under reduced pressure. The product was washed with diethyl ether and water to give the title compound (7.5 mg, 40%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (500 MHz, DMSO-d6) δ 3.57 (t, 4H) 4.38 (d, J = 4.88 Hz, 2H) 5.60 (bs, 2H) 7.11 (m, 2H) 7.27 (m, 6H) 7.38 (m, J = 7.32, 3.05 Hz, 1 H) 7.49 (m, J = 7.32 Hz, 1 H) 7.73 (bs, 8.21 (d, J = 7.32 Hz, 1H).

Exemplo 349 N-{[3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-1,l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-7-il]metil}-2-hidroxiacetamida A solução do produto do Exemplo 345 (0,0226 g, 0,048 mmol) em N,N-dimetilformamida (0,5 mL) juntou-se trietilamina (0,020 mL, 0,145 mmol), 4-(dimetilamino)piridina (0,018 g, 0,145 mmol), ácido glicólico (0,011 g, 0,145 mmol) e cloridrato de 1-(3-dimetilaminopropil)-3-etilcarbodiimida (0,028 g, 0,145 mmol). A mistura foi agitada a 23°C durante 15 horas e depois foi aquecida a 60°C e agitada durante 20 horas. A mistura reaccional foi concentrada sob pressão reduzida. O concentrado foi diluído com diclorometano, arrefecido até 0°C e juntou-se ácido clorídrico (4M em dioxano) (0,037 mL, 0,145 mmol). A mistura foi concentrada sob pressão reduzida. O residuo foi purificado por cromatografia em fase inversa, eluindo com um gradiente de 10% de acetonitrilo em ácido trifluoroacético a 0,1%/água para 95% de acetonitrilo em ácido trifluoroacético a 0,1%/água, para gerar o composto em título (10,8 mg, 42%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 3,91 (s, 2H) 4,44 (d, J=5,88 Hz, 2H) 5,61 (bs, 2H) 7,14 (s, 1H) 7,29 (m, 5H) 7,41 (t, J=7,35 Hz, 1H) 7,52 (d, J=9,19 Hz, 1H) 7,75 (t, 1H) 8,21 (dd, 1H) 8,35 (t, 1H) .Example 349 N - {[3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl) -1,1-dioxido-4H-thieno [2,3- e] [1,2,4] thiadiazin-7-yl] methyl} -2-hydroxyacetamide The solution of the product of Example 345 (0.0226 g, 0.048 mmol) in N, N-dimethylformamide (0.5 mL) triethylamine (0.020 mL, 0.145 mmol), 4- (dimethylamino) pyridine (0.018 g, 0.145 mmol), glycolic acid (0.011 g, 0.145 mmol) and 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (0.028 g, 0.145 mmol). The mixture was stirred at 23 ° C for 15 hours and then heated to 60 ° C and stirred for 20 hours. The reaction mixture was concentrated under reduced pressure. The concentrate was diluted with dichloromethane, cooled to 0øC and hydrochloric acid (4M in dioxane) (0.037 mL, 0.145 mmol) was added. The mixture was concentrated under reduced pressure. The residue was purified by reverse phase chromatography, eluting with a gradient of 10% acetonitrile in 0.1% trifluoroacetic acid / water to 95% acetonitrile in 0.1% trifluoroacetic acid / water, to give the title compound as a white solid. (10.8 mg, 42%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSOd 6) δ 3.91 (s, 2H) 4.44 (d, J = 5.88 Hz, 2H) 5.61 (bs, 2H) 7.14 (s, 1H) 7.29 (m, 5H) 7.41 (t, J = 7.35 Hz, 1 H) 7.52 (d, J = 9.19 Hz, 1 H) 7.75 (t, dd, 1H) 8.35 (t, 1H).

Exemplo 350A l-amino-4-hidroquinolin-2(1H)-ona A uma solução de hidróxido de potássio aquoso a 25% em peso (200 mL) e 1,4-dioxano (50 mL) aquecida a 90-100°C juntou-se em porções o produto do Exemplo 226C (6,72 g, 20,0 345 ΕΡ 1 560 827/ΡΤ mmol). A mistura reaccional foi aquecida a refluxo durante 90 minutos, permitindo a ocorrência de destilação e juntaram-se mais água e dioxano (30 ml de cada) a um vaso reaccional para atingir o volume original. A mistura foi refluxada durante mais 90 minutos com destilação, arrefecida, lavada com 200 mL de éter dietilico/acetato de etilo 1:1, acidificada com ácido clorídrico concentrado até pH 2 e o sólido resultante foi recolhido por filtração, lavado com água e seco até peso constante para gerar o composto em título como um sólido bege (3,22 g, 91% de rendimento). MS (DCI) m/z 177 (M+H) + . 1H RMN (300 MHz, DMSO-d6) δ 5,56 (s, 2H) 5,94 (s, 1H) 7,20 (t, J=7,54 Hz, 1H) 7,62 (m, 1H) 7,85 (m, 2H) 11,33 (s, 1H).To a solution of 25 wt.% Aqueous potassium hydroxide (200 mL) and 1,4-dioxane (50 mL) heated to 90-100 ° C. Example 350A 1-Amino-4-hydroquinolin-2 (1H) The product of Example 226C (6.72 g, 20.0 345 ÅΡ 1560 827 / ΡΤ mmol) was added in portions. The reaction mixture was heated to reflux for 90 minutes allowing distillation to occur and more water and dioxane (30 ml each) were added to a reaction vessel to reach the original volume. The mixture was refluxed for an additional 90 minutes with distillation, cooled, washed with 200 mL of diethyl ether / ethyl acetate 1: 1, acidified with concentrated hydrochloric acid to pH 2, and the resulting solid was collected by filtration, washed with water and dried to constant weight to give the title compound as a beige solid (3.22 g, 91% yield). MS (DCI) m / z 177 (M + H) +. 1H NMR (300 MHz, DMSO-d6) δ 5.56 (s, 2H) 5.94 (s, 1H) 7.20 (t, J = 7.54 Hz, 7.85 (m, 2 H) 11.33 (s, 1 H).

Exemplo 350B 2-(4-hidroxi-2-oxoquinolin-l(2H)-il)-lff-isoindole-1,3(2H)-dionaExample 350B 2- (4-hydroxy-2-oxoquinolin-1 (2H) -yl) -1 H -isoindole-1,3 (2H) -dione

Uma mistura do produto do Exemplo 350A (0,54 g, 3 mmol), anidrido ftálico (1,36 g, 2,2 eq.) e diisopropiletilamina (1,97 g, 5 eq.) em dioxano (20 mL) foi aquecida a 100°C durante 2 horas, arrefecida até 25°C e concentrada. O resíduo foi triturado com água e éter. Os sólidos resultantes foram filtrados e secos in vacuum para gerar o composto em título (0,6 g, 64% de rendimento bruto), o qual foi utilizado directamente no passo seguinte. 1R RMN (300 MHz, DMSO-dê) δ 5,95 (s, 1H), 7,37 (m, 1H), 7,6 (m, 2H), 7,95-8,1 (m, 5H), 12,18 (s, 1H). MS (DCI+) m/z 306 (M+H)+.A mixture of the product from Example 350A (0.54 g, 3 mmol), phthalic anhydride (1.36 g, 2.2 eq.) And diisopropylethylamine (1.97 g, 5 eq.) In dioxane (20 mL) was heated at 100 ° C for 2 hours, cooled to 25 ° C and concentrated. The residue was triturated with water and ether. The resulting solids were filtered and dried in vacuo to give the title compound (0.6 g, 64% crude yield), which was used directly in the next step. 1 H NMR (300 MHz, DMSO-d 6) δ 5.95 (s, 1H), 7.37 (m, 1H), 7.6 (m, 2H), 7.95-8.1 (m, 5H) , 12.18 (s, 1H). MS (DCI +) m / z 306 (M + H) +.

Exemplo 350C 3-[bis(metiltio)metileno]-1-(1,3-dioxo-l, 3-di-hidro-2H-isoindol-2-il)quinolina-2, 4-dionaExample 350C 3- [bis (methylthio) methylene] -1- (1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl) quinoline-2,4-dione

Uma solução do produto do Exemplo 350B (0,6 g, 1,96 mmol) em ácido acético:piridina (5:1, 15 mL) foi tratada com metilsulfato de tris(metiltio)metilo (preparada utilizando o procedimento de Synthesis, 22-25, 1988; M. Barbero, S.A solution of the product of Example 350B (0.6 g, 1.96 mmol) in acetic acid: pyridine (5: 1, 15 mL) was treated with tris (methylthio) methyl methylsulfate (prepared using the procedure of Synthesis, 22 -25, 1988; M. Barbero, S.

Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi)(1,6 g, 3 eq.) e aquecida a 100°C durante 2 horas. A mistura reaccional foi tratada com gelo e os sólidos precipitados foram filtrados e secos in vacuum para gerar 0,53 g (66%) do composto em título. XH RMN (300 MHz, DMSO-d6) δ 2,63 (s, 6H) , 7,34 (m, 346 ΕΡ 1 560 827/ΡΤ 1Η), 7,55 (d, 1Η) , 7,61 (m, 1Η), 8,08 (m, 5Η) . MS (DCI + ) m/z 411 (Μ+Η) +.Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi) (1.6 g, 3 eq.) And heated at 100 ° C for 2 hours. The reaction mixture was ice-treated and the precipitated solids were filtered and dried in vacuo to give 0.53 g (66%) of the title compound. 1 H NMR (300 MHz, DMSO-d 6) δ 2.63 (s, 6H), 7.34 (m, 346 ÅΡ 1 560 827 / ΡΤ 1Η), 7.55 (d, 1Η), 7.61 (m , 1), 8.08 (m, 5). MS (DCI +) m / z 411 (Μ + Η) +.

Exemplo 350D 2-[4-hidroxi-3-{7-[(metoxlmetoxi)metil]-1,l-dioxido-4ff-tieno-[2,3-e][1,2,4]tiadiazin-3-il}-2-oxoquinolin-l(2H)-il]-1H-isoindole-1,3(2H)-dlona O produto do Exemplo 309G (32,6 mg, 0,13 mmol) e o produto do Exemplo 350C (53 mg, 0,13 mmol) reagiram em tolueno (3 mL) a 100°C durante 3 horas. O precipitado resultante foi recolhido por filtração e lavado com metanol e éter dietílico para gerar o composto em título (45 mg, 61,5%). XH RMN (300 MHz, DMSO-dê) δ 3,32 (s, 3H), 4,61 (s, 2H), 4,70 (S, 2H), 7,28 (s, 1H), 7,42 (m, 1H), 7,70 (d, J=4,04 Hz, 2H), 8,06 (m, 2H), 8,11 (m, 2H), 8,22 (d, J=8,09 Hz, 1H). MS (ESI') m/z 565 (M-H)'.Example 350D 2- [4-hydroxy-3- {7 - [(methoxymethoxy) methyl] -1,1-dioxido-4 H -thieno [2,3- e] [1,2,4] thiadiazin-3-yl (2H) -yl] -1H-isoindole-1,3 (2H) -dona The product of Example 309G (32.6 mg, 0.13 mmol) and the product of Example 350C (53) mg, 0.13 mmol) were reacted in toluene (3 mL) at 100 ° C for 3 hours. The resulting precipitate was collected by filtration and washed with methanol and diethyl ether to give the title compound (45 mg, 61.5%). 1 H NMR (300 MHz, DMSO-d 6) δ 3.32 (s, 3H), 4.61 (s, 2H), 4.70 (s, 2H), 7.28 (s, 1H), 7.42 1H), 7.70 (d, J = 4.04 Hz, 2H), 8.06 (m, 2H), 8.11 (m, 2H), 8.22 (d, 09 Hz, 1H). MS (ESI +) m / z 565 (M-H) +.

Exemplo 350E l-amino-4-hidroxi-3-{7-[(metoximetoxi)metil]-1, l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-3-11}qulnolln-2(1H)-onaExample 350E 1-Amino-4-hydroxy-3- {7 - [(methoxymethoxy) methyl] -1,1-dioxido-4H-thieno [2,3-e] [1,2,4] thiadiazin-3-11 } quinolin-2 (1H) -one

Uma solução do produto do Exemplo 350D (185 mg, 0,326 mmol), metil-hidrazina (43,47 pL, 2,5 equivalentes) e trietilamina (0,126 mL, 3 equivalentes) em 1,4-dioxano (10 mL) foi aquecida a 102°C durante 3 horas. A reacção foi concentrada sob pressão reduzida e tratada com uma solução de metanol (75 mL) e ácido clorídrico IN (100 mL) . O precipitado resultante foi recolhido por filtração e lavado com água e éter dietílico para gerar o composto em título como um sólido branco (94 mg, 66%). XH RMN (300 MHz, DMSO-d6) δ 4,65 (s, 2H), 4,71 (s, 2H), 5,84 (br s, 1H), 7,44 (m, 2H) , 7,88 (m, 1H) , 8,04 (d, 1H), 8,15 (d, 1H) , 14,73 (br s, 2H) . MS (ESI') m/z 435 (M-H)'.A solution of the product of Example 350D (185 mg, 0.326 mmol), methylhydrazine (43.47 æL, 2.5 equivalents) and triethylamine (0.126 mL, 3 equivalents) in 1,4-dioxane (10 mL) was heated at 102 ° C for 3 hours. The reaction was concentrated under reduced pressure and treated with a solution of methanol (75 mL) and 1N hydrochloric acid (100 mL). The resulting precipitate was collected by filtration and washed with water and diethyl ether to give the title compound as a white solid (94 mg, 66%). 1 H NMR (300 MHz, DMSO-d 6) δ 4.65 (s, 2H), 4.71 (s, 2H), 5.84 (br s, 1H), 7.44 (m, 2H) 88 (m, 1H), 8.04 (d, 1H), 8.15 (d, 1H), 14.73 (br s, 2H). MS (ESI +) m / z 435 (M-H) +.

Exemplo 350F l-{[ciclopropilmetileno]amino}-4-hidroxi-3-{7-[(metoximetoxi)-metil] -1, l-dioxido-4-H-tieno [2,3-e] [1,2,4] tiadiazin-3-il}-quinolin-2(1H)-ona O produto do Exemplo 350D (94 mg, 0,22 mmol) reagiu com ciclopropanocarbaldeído (0,162 mL, 2,2 mmol) em N,N-dimetil-acetamida (1 mL) num tubo selado a 120°C durante 90 minutos 347 ΕΡ 1 560 827/ΡΤ num reactor de microondas. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O residuo resultante foi triturado com éter dietilico e filtrado para gerar o composto em título (78,9 mg, 75%).Example 350F 1 - {[cyclopropylmethylene] amino} -4-hydroxy-3- {7 - [(methoxymethoxy) methyl] -1,1-dioxido-4-H-thieno [2,3- e] [1,2 , 4] thiadiazin-3-yl} -quinolin-2 (1H) -one The product of Example 350D (94 mg, 0.22 mmol) was reacted with cyclopropanecarbaldehyde (0.162 mL, 2.2 mmol) in N, N- acetamide (1 mL) in a sealed tube at 120 ° C for 90 minutes 347 Ρ Ρ 1 560 827 / ΡΤ in a microwave reactor. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The resulting residue was triturated with diethyl ether and filtered to give the title compound (78.9 mg, 75%).

Exemplo 350G 1-[(ciclopropilmetil)amino]-4-hidroxi-3-{7-[(metoximetoxi)-metil]-1,l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-3-il}-quinolin-2(1H)-ona O produto do Exemplo 350F (78,9 mg, 0,16 mmol) em tetra-hidrofurano (4 mL) e metanol (0,013 mL, 0,32 mmol) a 0°C foi tratado gota a gota com uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,131 mL, 0,24 mmol). A reacção foi agitada a 25 °C durante 1 hora, acidificada com ácido clorídrico IN a aproximadamente pH 2-4, diluída com água (20 mL) e o precipitado resultante foi recolhido por filtração e seco. O produto em bruto foi cromatografado em sílica gel com 2% de metanol/diclorometano para gerar o composto em título (41,6 mg, 52,5%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-d6) δ 0,15 (d, J=4,41, Hz, 2H), 0,42 (d, J=8,09 Hz, 2H), 1,01 (m, 1H), 2,84 (d, J=6,62 Hz, 2H), 4,64 (s, 2H) , 4,71 (s, 2H), 6,36 (br s, 1H) , 7,41 (m, 2H), 7,88 (t, J=7,35 Hz, 1H), 8,07 (d, J=8,46 Hz, 1H), 8,16 (d, J=8,09 Hz, 1H). MS (ESI') m/z 489 (M-H)&quot;.Example 350G 1 - [(cyclopropylmethyl) amino] -4-hydroxy-3- {7 - [(methoxymethoxy) methyl] -1,1-dioxido-4H-thieno [2,3- e] [1,2,4- 3-yl} quinolin-2 (1H) -one The product of Example 350F (78.9 mg, 0.16 mmol) in tetrahydrofuran (4 mL) and methanol (0.013 mL, 0.32 mmol ) at 0 ° C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.131 mL, 0.24 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1N hydrochloric acid at approximately pH 2-4, diluted with water (20 mL) and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol / dichloromethane to give the title compound (41.6 mg, 52.5%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ 0.15 (d, J = 4.41, Hz, 2H), 0.42 (d, J = 8.09 Hz, 2H), 1.01 (m, 1H), 2.84 (d, J = 6.62 Hz, 2H), 4.64 (s, 2H), 4.71 (s, 2H), 6.36 (br s, 1H), 7.41 (m, 2H), 7.88 (t, J = 7.35 Hz, 1H), 8.07 (d, J = 8.46 Hz, 1H), 8.16 (d, J = 8.09 Hz , 1H). MS (ESI +) m / z 489 (M-H) &quot;.

Exemplo 351 1—[(ciclopropilmetil)amino]-4-hidroxi-3-[7-(hidroximetil)-1,l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-3-il]quinolin-2 (1H)-ona O produto do Exemplo 350G (35 mg, 0,07 mmol) a 0°C foi tratado com uma solução de cloreto de hidrogénio 4N em 348 ΕΡ 1 560 827/ΡΤ 1,4-dioxano (1 mL). A reacção foi agitada a 0°C durante 2 horas e a 25°C durante 3 horas, basificada com bicarbonato de sódio a 10% (3 mL) e extraída com 2% de metanol/diclorometano. O solvente foi concentrado e o resíduo foi purificado por cromatografia instantânea em coluna em sílica gel eluindo com 7% de metanol/diclorometano para gerar o composto em título como um sólido branco (20 mg, 62,7%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D . XH RMN (300 MHz, DMSO-de) δ 0, 15 (d, J=4 ,04- Hz, 2H), 0, 42 (d, J= 8, 09 Hz, 2H), 1, 01 (m, 1H), 2, 81 (d, 2H), 4, 62 (s, 2H) , 5,55 (br s, 1H), 6, 35 (br s, 1H), 7, 28 (s, 1H), 7,39 (m, 1H), 7, 85 (m, 1H), 8,03 (m, 1H) , 8,15 (d, J= =7,35 Hz, 1H) . MS (ESI&quot;) m/ z 489 (M-H)&quot;.Example 351 1 - [(cyclopropylmethyl) amino] -4-hydroxy-3- [7- (hydroxymethyl) -1,1-dioxido-4H-thieno [2,3- e] [1,2,4] thiadiazin-3 -yl] quinolin-2 (1H) -one The product of Example 350G (35 mg, 0.07 mmol) at 0 ° C was treated with a 4N hydrogen chloride solution in 348 æg 15 82 82 / æ 1.4 (1mL). The reaction was stirred at 0 ° C for 2 hours and at 25 ° C for 3 hours, basified with 10% sodium bicarbonate (3mL) and extracted with 2% methanol / dichloromethane. The solvent was concentrated and the residue was purified by flash column chromatography on silica gel eluting with 7% methanol / dichloromethane to give the title compound as a white solid (20 mg, 62.7%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ0.15 (d, J = 4.04 Hz, 2H), 0.42 (d, J = 1H), 2.81 (d, 2H), 4.62 (s, 2H), 5.55 (br s, 1H), 6.35 (br s, 1H), 7.28 (s, 1H), 7.39 (m, 1H), 7.85 (m, 1H), 8.03 (m, 1H), 8.15 (d, J = 7.35 Hz, 1H). MS (ESI &quot;) m / z 489 (M-H) &quot;.

Exemplo 352A 3-{[2-(aminosulfonil)-4-(benziloxi)fenil]amino}-3-oxopropanoato de etiloExample 352A Ethyl 3 - {[2- (aminosulfonyl) -4- (benzyloxy) phenyl] amino} -3-oxopropanoic acid

Uma suspensão do produto do Exemplo 304D (508,3 mg, 1,826 mmol) e trietilamina (0,47 mL, 3,394 mmol) em diclorometano anidro (10 mL) foi arrefecida até 0°C sob uma atmosfera de azoto. Juntou-se cloreto de etilmalonilo (0,43 mL, 3,023 mmol) gota a gota e a resultante solução de cor dourada foi agitada a 0°C durante 15 minutos, e depois a temperatura ambiente durante 5 horas. A reacção foi diluída com diclorometano (50 mL) e lavada com água (20 mL) . A lavagem aquosa foi extraída com diclorometano (25 mL) e as fases orgânicas combinadas foram lavadas com ácido clorídrico aquoso IN (20 mL), água (20 mL) e salmoura (20 mL). A fase orgânica foi seca sobre sulfato de sódio anidro, filtrada e o solvente removido sob pressão reduzida. O óleo amarelo foi purificado por cromatografia em coluna em sílica gel eluindo com um gradiente de 12% para 15% de acetato de etilo/diclorometano para gerar o composto em título como um sólido branco (340 mg, 47%). MS (ESI&quot;) m/z 391 (M-H)&quot;. RMN (300 MHz, DMSO-d6) δ 1,22 (t, J=7,17 Hz, 3H) 3,56 (s, 2H) 4,14 (q, J= 6,99 Hz, 2H) 5,15 (s, 2H) 7,27 (dd, J=9,01, 3,13 Hz, 1H) 7,42 (m, 8H) 7,75 (d, J= 8,82 Hz, 1H) 9,42 (s, 1H).A suspension of the product of Example 304D (508.3 mg, 1.826 mmol) and triethylamine (0.47 mL, 3.394 mmol) in anhydrous dichloromethane (10 mL) was cooled to 0øC under a nitrogen atmosphere. Ethylmalonyl chloride (0.43 mL, 3.023 mmol) was added dropwise and the resulting golden solution was stirred at 0 ° C for 15 minutes, then at room temperature for 5 hours. The reaction was diluted with dichloromethane (50 mL) and washed with water (20 mL). The aqueous wash was extracted with dichloromethane (25 mL) and the combined organic phases were washed with 1N aqueous hydrochloric acid (20 mL), water (20 mL) and brine (20 mL). The organic layer was dried over anhydrous sodium sulfate, filtered and the solvent removed under reduced pressure. The yellow oil was purified by silica gel column chromatography eluting with a gradient of 12% to 15% ethyl acetate / dichloromethane to give the title compound as a white solid (340 mg, 47%). MS (ESI &quot;) m / z 391 (M-H) &quot;. NMR (300 MHz, DMSO-d 6) δ 1.22 (t, J = 7.17 Hz, 3H) 3.56 (s, 2H) 4.14 (q, J = 6.99 Hz, 2H) 1H), 7.42 (m, 8H), 7.75 (d, J = 8.82 Hz, 1H), 9.27 (dd, J = 9.01, 3.13 Hz, 42 (s, 1H).

Exemplo 352BExample 352B

[7-(benziloxi)-1,l-dioxido-4H-l, 2,4-benzotiadiazin-3-il] -acetato de etilo 349 ΕΡ 1 560 827/ΡΤ Ο produto do Exemplo 352Α (292 mg, 0,744 mmol) e carbonato de sódio (394 mg, 3,722 mmol) em etanol anidro (12 mL) foi aguecido a refluxo sob uma atmosfera de azoto durante 6,5 horas. A reacção foi arrefecida até temperatura ambiente, filtrada e o filtrado concentrado sob pressão reduzida. O resíduo foi purificado por cromatografia em coluna em sílica gel eluindo com 3% de metanol/diclorometano para gerar o composto em título como um sólido branco (237 mg, 85%). MS (ESI ) m/z 373 (M-H) &quot;. 1R RMN (300 MHz, DMSO-d6) δ 1,21 (t, J= 6,99 Hz, 3H) 3,67 (s, 2H) 4,16 (g, J= 6,99 Hz, 2H) 5,20 (s, 2H) 7,39 (m, 8H) 12,21 (s, 1H) .[7- (benzyloxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl] -acetate The product of Example 352 (292 mg, 0.744 mmol) and sodium carbonate (394 mg, 3.722 mmol) in anhydrous ethanol (12 mL) was refluxed under a nitrogen atmosphere for 6.5 hours. The reaction was cooled to room temperature, filtered and the filtrate concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with 3% methanol / dichloromethane to give the title compound as a white solid (237 mg, 85%). MS (ESI) m / z 373 (M-H) &quot;. 1 H NMR (300 MHz, DMSO-d 6) δ 1.21 (t, J = 6.99 Hz, 3 H) 3.67 (s, 2 H) 4.16 (g, J = 6.99 Hz, 2 H) 5 , 20 (s, 2 H) 7.39 (m, 8H) 12.21 (s, 1H).

Exemplo 352C (7-hidroxi-l,l-dioxido-4fl-l, 2, 4-benzotiadiazin-3-il)acetato de etilo O produto do Exemplo 352B (277 mg, 0,7398 mmol) em etanol (20 mL) foi hidrogenado a 1 atmosfera de pressão de hidrogénio (balão) com paládio sobre carbono a 10% (28 mg, 10% em peso) durante 1,25 horas. A reacção foi filtrada através de um filtro de membrana de PTFE (0,45 pm) e o catalisador muito bem lavado com etanol (50 mL). O filtrado foi concentrado sob pressão reduzida e o resultante óleo triturado com diclorometano/hexanos (1:1 v/v) para gerar o composto em título como um sólido branco cristalino (194 mg, 92%). MS (ESI&quot;) m/z 283 (M-H)&quot;. XH RMN (300 MHz, DMSO-d6) δ 1,21 (t, J=7,17 Hz, 3H) 3,64 (s, 2H) 4,15 (q, J=7,23 Hz, 2H) 7,06 (d, J=2,57 Hz, 1H) 7,11 (dd, J=8,83, 2,57 Hz, 1H) 7,20 (d, J=8,83 Hz, 1H) 10,21 (s, 1H) 12,11 (s, 1H) .The product from Example 352B (277 mg, 0.7398 mmol) in ethanol (20 mL) was refluxed for 2 hours at 0øC. The product of Example 352C (277 mg, 0.7398 mmol) was hydrogenated at 1 atmosphere of hydrogen pressure (flask) with 10% palladium on carbon (28 mg, 10% by weight) for 1.25 hours. The reaction was filtered through a PTFE membrane filter (0.45 Âμm) and the catalyst washed well with ethanol (50 mL). The filtrate was concentrated under reduced pressure and the resulting oil triturated with dichloromethane / hexanes (1: 1 v / v) to give the title compound as a white crystalline solid (194 mg, 92%). MS (ESI) m / z 283 (M-H) &quot;. 1 H NMR (300 MHz, DMSO-d 6) δ 1.21 (t, J = 7.17 Hz, 3 H) 3.64 (s, 2 H) 4.15 (q, J = 7.23 Hz, 2 H) 7 J = 8.83, 2.57 Hz, 1 H) 7.20 (d, J = 8.83 Hz, 1 H) 10, 21 (s, 1 H) 12.11 (s, 1H).

Exemplo 352D (7-hidroxi-8-nitro-l,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-acetato de etiloExample 352D Ethyl (7-hydroxy-8-nitro-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) acetate

Uma suspensão do produto do Exemplo 352C (100 mg, 0,352 mmol) em ácido acético glacial (3 mL) foi tratada a temperatura ambiente com uma solução de ácido nítrico concentrado em ácido acético glacial (1,43 M, 0,305 mL, 0,436 mmol) e agitada a esta temperatura durante 19 horas. Juntou-se mais ácido nítrico l,43M/ácido acético (0,020 mL, 0,029 mmol) e deixou-se sob agitação durante 1,5 horas. A reacção foi 350 ΕΡ 1 560 827/ΡΤ diluída com água (30 mL) e extraída com acetato de etilo (2 χ 50 mL) . Os extractos orgânicos combinados foram lavados com salmoura, secos sobre sulfato de sódio anidro, filtrados e concentrados sob pressão reduzida. O resíduo foi purificado por cromatografia em coluna em sílica gel eluindo com 8% de metanol/diclorometano para gerar o composto em título como um sólido amarelo claro (47 mg, 41%). MS (ESI-) m/z 328 (M-H)“. XH RMN (300 MHz, PIRIDINA-d5) δ 0,98 (t, J=7,17 Hz, 3H) 3,86 (S, 2H) 4,01 (q, J=7,23 Hz, 2H) 7,11 (d, J=8,82,Hz, 1H) 7,22 (d, J= 8, 82 Hz, 1H) .A suspension of the product of Example 352C (100 mg, 0.352 mmol) in glacial acetic acid (3 mL) was treated at ambient temperature with a solution of concentrated nitric acid in glacial acetic acid (1.43 M, 0.305 mL, 0.436 mmol) and stirred at this temperature for 19 hours. 1.34M nitric acid / acetic acid (0.020 mL, 0.029 mmol) was added and allowed to stir for 1.5 hours. The reaction was cooled to -78 ° C and diluted with water (30 mL) and extracted with ethyl acetate (2 x 50 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with 8% methanol / dichloromethane to give the title compound as a pale yellow solid (47 mg, 41%). MS (ESI-) m / z 328 (M-H). 1 H NMR (300 MHz, PYRIDINE-d 5) δ0.98 (t, J = 7.17 Hz, 3H) 3.86 (S, 2H) 4.01 (q, J = 7.23 Hz, 2H) 7 , 11 (d, J = 8.82, Hz, 1 H) 7.22 (d, J = 8.82 Hz, 1 H).

Exemplo 352E (8-amino-7-hidroxi-l, l-dioxido-4fl-l, 2, 4-benzotiadiazin-3-il)-acetato de etilo O produto do Exemplo 352D (61 mg, 0,1852 mmol) em metanol (5 mL) foi hidrogenado a 1 atmosfera de pressão de hidrogénio (balão) com paládio sobre carbono a 10% (9 mg, 15% em peso) durante 45 minutos. A reacção foi filtrada através de um filtro de membrana de PTFE (0,45 pm) e o catalisador muito bem lavado com metanol quente (50 mL) . O filtrado foi concentrado sob pressão reduzida para gerar o composto em título como um sólido bege (55 mg, 99%). MS (ESI-) m/z 298 (M-H)”. XH RMN (300 MHz, DMSO-de) δ 1,21 (t, J=7,17 Hz, 3H) 3,61 (s, 2H) 4,15 (q, J 6,99 Hz, 2H) 5,22 (s, 2H) 6,40 (d, J=8,46 Hz, 1H) 6,93 (d, J=8,46 Hz, 1H) 9,82 (s, 1H) 11,86 (s, 1H) .The product of Example 352D (61 mg, 0.1852 mmol) in ethyl acetate was slowly added to a solution of ethyl acetate. methanol (5 mL) was hydrogenated at 1 atmosphere of hydrogen pressure (flask) with 10% palladium on carbon (9 mg, 15% by weight) for 45 minutes. The reaction was filtered through a PTFE membrane filter (0.45 Âμm) and the catalyst washed well with hot methanol (50 mL). The filtrate was concentrated under reduced pressure to give the title compound as a beige solid (55 mg, 99%). MS (ESI-) m / z 298 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ 1.21 (t, J = 7.17 Hz, 3 H) 3.61 (s, 2 H) 4.15 (q, J 6.99 Hz, J = 8.46 Hz, 1 H) 6.93 (d, J = 8.46 Hz, 1 H) 9.82 (s, 1 H) 11.86 (s, 1H).

Exemplo 352F (8-metil-l, l-dioxido-4.H- [1,3] oxazolo [5,4-h] [1,2,4] — benzotiadiazin-3-il)acetato de metiloExample 352F (8-methyl-1,1-dioxido-4 H- [1,3] oxazolo [5,4- h] [1,2,4] benzothiadiazin-3-yl) acetate

Uma solução do produto do Exemplo 352E (56,3 mg, 0,188 mmol) em N,N-dimetilformamida anidra (2 mL) foi tratada com ortoacetato de trimetilo (0,098 mL, 0,752 mmol) e ácido p-toluenossulfónico mono-hidratado (1 mg) a temperatura ambiente durante 3 horas sob uma atmosfera de azoto. O solvente foi removido sob pressão reduzida e o resíduo purificado por cromatografia em coluna em sílica gel eluindo com 4% de metanol/diclorometano para gerar o composto em título como um sólido branco cristalino (48 mg, 79%). MS (ESI&quot;) m/z 322 (M-H)&quot;. XH RMN (300 MHz, DMSO-d6) δ 1,22 (t, J=7,17 Hz, 351 ΕΡ 1 560 827/ΡΤ 3Η) 2,69 (s, 3Η) 3,71 (s, 2Η) 4,17 (q,J=7,ll Hz, 2Η) 7,27 (d, J=8,82 Hz, 1H) 8,02 (d, J=8,82 Hz, 1H) 12,33 (s, 1H) .A solution of the product of Example 352E (56.3 mg, 0.188 mmol) in anhydrous N, N-dimethylformamide (2 mL) was treated with trimethyl orthoacetate (0.098 mL, 0.752 mmol) and p-toluenesulfonic acid monohydrate (1 mg) at room temperature for 3 hours under a nitrogen atmosphere. The solvent was removed under reduced pressure and the residue purified by silica gel column chromatography eluting with 4% methanol / dichloromethane to give the title compound as a white crystalline solid (48 mg, 79%). MS (ESI &quot;) m / z 322 (M-H) &quot;. 1 H NMR (300 MHz, DMSO-d 6) δ 1.22 (t, J = 7.17 Hz, 351 ÅΡ 1 560 827 / ΡΤ 3Η) 2.69 (s, 3 3) 3.71 (s, (D, J = 8.82 Hz, 1 H) 12.33 (d, J = 8.82 Hz, 1 H) 1H).

Exemplo 352G 4-hidroxi-l-(3-metilbutil)-3-(8-metil-l,l-dloxido-4H-[1,3]— oxazolo[5,4-h] [1,2,4]benzotiadiazin-3-il)-1,8-naftiridin-2 (1H)-ona A uma solução do produto do Exemplo 12A (16,7 mg, 0,0714 mmol) e do produto do Exemplo 352F (23,1 mg, 0,0714 mmol) em tetra-hidrofurano anidro (2 mL) a 0°C juntou-se hidreto de sódio (60%, 11,4 mg, 0,286 mmol) sob uma atmosfera de azoto. A reacção foi aquecida a refluxo durante 3 horas, arrefecida até 0°C e tratada com ácido acético glacial (0,165 mL). A solução amarela resultante foi aquecida a refluxo durante 2 horas, arrefecida até 0°C, diluida com água (5 mL) e acidificada com ácido clorídrico aquoso IN até pH 3. O precipitado resultante foi recolhido por filtração, lavado com água e seco para gerar o composto em título como um sólido amarelo (20 mg, 60%) . MS (ESI') m/z 466 (M-H)'. XH RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,25 Hz, 6H) 1,58 (m, 2H) 1,71 (m, 1H) 2,73 (s, 3H) 4,50 (m, 2H) 7,50 (dd, J=7,72, 4,41 Hz, 1H) 7,64 (d, J=8,82 Hz, 1H) 8,10 (d, J=8,82 Hz, 1H) 8,57 (dd, J=7,91, 2,02 Hz, 1H) 8,89 (dd, J=4, 60, 2, 02 Hz, 1H) 14,18 (s, 1H) . Uma suspensão do produto do Exemplo 352G (14,6 mg, 0,0312 mmol) em tetra- hidrofurano anidro (3 mL) e água destilada (1 mL) foi tratada com hidróxido de sódio aquoso 0,998 N (0,0313 mL, 0,0312 mmol) e a solução amarela misturada durante 15 minutos. O solvente foi removido sob pressão reduzida e o resíduo seco para proporcionar o sal de sódio do Exemplo 352G (15 mg, 98%) . XH RMN (300 MHz, DMSO-d6) δ 0,97 (d, J= 6,25 Hz, 6H) 1,48 (m, 2H) 1,65 (m, 1H) 2,67 (s, 3H) 4,30 (m, J= 8, 82, 6,25 Hz, 2H) 7,13 (dd, J=7,91, 4,60 Hz, 1H) 7,21 (d, J=8,82 Hz, 1H) 7,86 (d, J=8,82 Hz, 1H) 8,38 (dd, J=8,09, 1,47 Hz, 1H) 8,53 (m, J=2,94 Hz, 1H) 16,09 (s, 1H).Example 352G 4-hydroxy-1- (3-methylbutyl) -3- (8-methyl-1,1-dideoxy-4H- [1,3] oxazolo [5,4- h] [1,2,4] To a solution of the product of Example 12A (16.7 mg, 0.0714 mmol) and the product of Example 352F (23.1 mg, 0.0714 mmol) in anhydrous tetrahydrofuran (2 mL) at 0øC was added sodium hydride (60%, 11.4 mg, 0.286 mmol) under a nitrogen atmosphere. The reaction was heated at reflux for 3 hours, cooled to 0 ° C and treated with glacial acetic acid (0.165 mL). The resulting yellow solution was heated at reflux for 2 hours, cooled to 0 ° C, diluted with water (5 mL) and acidified with 1N aqueous hydrochloric acid to pH 3. The resulting precipitate was collected by filtration, washed with water and dried yield the title compound as a yellow solid (20 mg, 60%). MS (ESI +) m / z 466 (M-H) +. 1H NMR (300 MHz, DMSO-d6) δ 0.99 (d, J = 6.25 Hz, 6H) 1.58 (m, 2H) 1.71 (m, 1H) 2.73 (s, 3H) 4.50 (m, 2H) 7.50 (dd, J = 7.72, 4.41 Hz, 1 H) 7.64 (d, J = 8.82 Hz, 1 H) 8.10 (d, J = 8.82 Hz, 1 H) 8.57 (dd, J = 7.91, 2.02 Hz, 1 H) 8.89 (dd, J = 4.60, , 1H). A suspension of the product of Example 352G (14.6 mg, 0.0312 mmol) in anhydrous tetrahydrofuran (3 mL) and distilled water (1 mL) was treated with 0.998 N aqueous sodium hydroxide (0.0313 mL, , 0312 mmol) and the yellow solution mixed for 15 minutes. The solvent was removed under reduced pressure and the residue dried to afford the sodium salt of Example 352G (15 mg, 98%). 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (d, J = 6.25 Hz, 6H) 1.48 (m, 2H) 1.65 (m, 1H) 2.67 (s, 3H) J = 8.82, 6.25 Hz, 2 H) 7.13 (dd, J = 7.91, 4.60 Hz, 1 H) 7.21 (d, J = 8.82 Hz, 1H), 8.38 (dd, J = 8.09, 1.47 Hz, 1 H), 8.53 (m, J = 2.94 Hz, 1H) 16.09 (s, 1H).

Exemplo 353A 1-[(ciclopropilmetil)amino]-4-hidroxiquinolin-2(1H)-ona À suspensão do produto do Exemplo 350A (1,033 g, 5,86 mmol) em metanol (58 mL) juntou-se ácido acético (0,29 mL) e ciclopropilcarboxaldeído (482 pL, 6,45 mmol) seguido da adição 352 ΕΡ 1 560 827/ΡΤ de cianoboro-hidreto de sódio (744,6 mg, 11,85 mmol) a temperatura ambiente. A suspensão foi agitada a temperatura ambiente de um dia para o outro e neutralizada com salmoura meia saturada (100 mL) e bicarbonato de sódio (425 mg, 5,06 mmol). A mistura foi extraída com acetato de etilo (300 mL) e a fase orgânica foi separada e lavada com salmoura meia saturada (2 χ 50 mL) . As fases aguosas combinadas foram extraídas com diclorometano (2 χ 100 mL) . A solução orgânica combinada foi seca com sulfato de magnésio, filtrada e concentrada. O resíduo foi utilizado sem gualguer purificação. XH RMN (300 MHz, DMSO-de) δ 0,09 (m, 2H) 0,40 (m, 2H) 0,95 (m, 1H) 2,70 (t,J=6,43 Hz, 2H) 5,91 (s, 1H) 6,10 (t, J=6,07 Hz, 1H) 7,21 (m, 1H) 7,62 (t, J=7,17 Hz, 1H) 7,87 (m, 2H) 11,42 (br s, 1H).To the suspension of the product of Example 350A (1.033 g, 5.86 mmol) in methanol (58 mL) was added acetic acid (0.8 g, 0.6 mmol) in dichloromethane , 29 mL) and cyclopropylcarboxaldehyde (482 æL, 6.45 mmol) followed by addition of 352 Ρ Ρ 1 560 82 827 ΡΤ ΡΤ sodium cyanoborohydride (744.6 mg, 11.85 mmol) at room temperature. The suspension was stirred at room temperature overnight and neutralized with half saturated brine (100 mL) and sodium bicarbonate (425 mg, 5.06 mmol). The mixture was extracted with ethyl acetate (300 mL) and the organic phase was separated and washed with half saturated brine (2 x 50 mL). The combined aqueous phases were extracted with dichloromethane (2 x 100 mL). The combined organic solution was dried over magnesium sulfate, filtered and concentrated. The residue was used without any purification. 1 H NMR (300 MHz, DMSO-d 6) δ 0.09 (m, 2 H) 0.40 (m, 2 H) 0.95 (m, 1 H) 2.70 (t, J = 6.43 Hz, 2 H) 1H NMR (DMSO-d6): δ 7.71 (s, 1H), 6.10 (t, J = 6.07 Hz, m, 2H) 11.42 (br s, 1H).

Exemplo 353B 3-[bis(metiltio)metileno]-1-[(ciclopropilmetil)amino]-guinolina-2,4(1H, 3H)-dionaExample 353B 3- [Bis (methylthio) methylene] -1 - [(cyclopropylmethyl) amino] -guinoline-2,4 (1H, 3H) -dione

À suspensão do produto do Exemplo 353A (984,4 mg, 4,28 mmol) em 1,4-dioxano (40 mL) juntou-se piridina (2,8 mL, 34,6 mmol) e metilsulfato de tris(metiltio)metilo (preparado utilizando o procedimentos de Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi) (2,26 g, 8,55 mmol) a temperatura ambiente. A suspensão foi colocada num banho de óleo pré-aquecido a 55°C e agitada durante 15 minutos. À solução juntou-se outra porção de metilsulfato de tris(metiltio)metilo (2,26 g, 8,55 mmol) e a mistura foi agitada a 55°C durante 15 minutos e arrefecida até temperatura ambiente. A mistura foi concentrada in vacuo e o resíduo foi diluído com diclorometano e carregado numa coluna de sílica gel e eluído com diclorometano, 2% de acetato de etilo/diclorometano e depois 5% de acetato de etilo/diclorometano para gerar o composto em título (852,1 mg, 60%). XH RMN (300 MHz, DMSO-d6) δ 0,15 (m, 2H) 0,42 (m, 2H) 0,98 (m, 1H) 2,61 (S, 6H) 2,73 (t,J=6,43 Hz, 2H) 6,05 (t, J=5,88 Hz, 1H) 7,15 (m, 1H) 7,64 (m, 1H) 7,76 (d, J=8,09To the suspension of the product of Example 353A (984.4 mg, 4.28 mmol) in 1,4-dioxane (40 mL) was added pyridine (2.8 mL, 34.6 mmol) and tris (methylthio) methyl (prepared using the procedures of Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi) (2.26 g, 8.55 mmol) at room temperature. The suspension was placed in an oil bath preheated to 55øC and stirred for 15 minutes. To the solution was added another portion of tris (methylthio) methyl methylsulfate (2.26 g, 8.55 mmol) and the mixture was stirred at 55 ° C for 15 minutes and cooled to room temperature. The mixture was concentrated in vacuo and the residue was diluted with dichloromethane and loaded onto a silica gel column and eluted with dichloromethane, 2% ethyl acetate / dichloromethane and then 5% ethyl acetate / dichloromethane to give the title compound ( 852.1 mg, 60%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.15 (m, 2H) 0.42 (m, 2H) 0.98 (m, 1H) 2.61 (s, 6H) 2.73 (t, J = = 6.43 Hz, 2 H) 6.05 (t, J = 5.88 Hz, 1 H) 7.15 (m, 1 H) 7.64 (m, 1 H) 7.76 (d, J = 8.09

Hz, 1H) 7,98 (m, 1H). 353 ΕΡ 1 560 827/ΡΤ1H), 7.98 (m, 1H). 353 ΕΡ 1 560 827 / ΡΤ

Exemplo 353C 1-[(ciclopropilmetil)amino]-4-hidroxi-3-{7-[(metoximetoxi)-metil]-1,l-dioxido-4ff-tieno[2,3-e] [1,2,4]tiadiazin-3-il}-quinolin-2(1H)-onaExample 353C 1 - [(cyclopropylmethyl) amino] -4-hydroxy-3- {7 - [(methoxymethoxy) methyl] -1,1-dioxido-4 H -thieno [2,3- e] [1,2,4- ] thiadiazin-3-yl} quinolin-2 (1H) -one

Uma solução do produto do Exemplo 353B (500,3, 1,5 mmol) e do produto do Exemplo 309G (377,62 mg, 1,5 mmol) em dioxano (15 mL) foi agitada a refluxo durante 1,5 horas e concentrada sob pressão reduzida. O residuo foi purificado por cromatografia em silica gel eluindo com 0% a 10% de acetato de etilo/diclorometano para gerar o composto em titulo (384,7 mg, 52%). XH RMN (300 MHz, DMSO-d6) δ 0,15 (m, 2H) 0,42 (m, 2H) 1.01 (m, 1H) 2,84 (d, J=6,99 Hz, 2H) 4,64 (s, 2H) 4,71 (s, 2H) 6,36 (br s, 1H) 7,42 (m, 2H) 7,86 (m, 1H) 8,07 (d,J=8,46 Hz, 1H) 8,16 (m,1H).A solution of the product of Example 353B (500.3, 1.5 mmol) and the product of Example 309G (377.62 mg, 1.5 mmol) in dioxane (15 mL) was stirred at reflux for 1.5 hours and concentrated under reduced pressure. The residue was purified by silica gel chromatography eluting with 0% to 10% ethyl acetate / dichloromethane to give the title compound (384.7 mg, 52%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.15 (m, 2H) 0.42 (m, 2H) 1.01 (m, 1H) 2.84 (d, J = 6.99 Hz, (M, 2H), 7.86 (br s, 1H), 7.42 (m, 2H), 7.86 (m, 1H), 8.07 (d, J = 8.46 1H), 8.16 (m, 1H).

Exemplo 353 3-[7-(azidometil)-1,l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-3-il] -1- [ (ciclopropilmetil) amino] -4-hidroxiquinolin-2 (li?) -onaExample 353 3- [7- (azidomethyl) -1,1-dioxido-4H-thieno [2,3-e] [1,2,4] thiadiazin-3-yl] -1 - [(cyclopropylmethyl) amino] - 4-hydroxyquinolin-2 (1H) -one

Ao produto do Exemplo 353C (384,7 mg, 0,78 mmol) juntou-se uma solução de cloreto de hidrogénio em dioxano (4N, 7,8 mL) a 0°C. A solução foi aquecida até temperatura ambiente e agitada durante 5,5 horas e concentrada sob pressão reduzida. Este sólido foi suspenso em diclorometano (7,8 mL) e à suspensão juntou-se 1,8-diazabiciclo[5.4.0]undec-7-eno (0,6 mL, 4.01 mmol) e difenilfosforilazida (0,85 mL, 3,94 mmol) a temperatura ambiente e agitou-se de um dia para o outro. A solução foi concentrada in vacuo. O residuo foi purificado por cromatografia, eluindo com 1% de trietilamina/diclorometano para gerar um sal de trietilamina do composto em título (357 mg, 79%). MS (ESI~) m/z 470 (M-H)“. ^ RMN (300 MHz, DMSO-d6) δ 0,22 (m, 2H) 0,46 (br d, J=7,35 Hz, 2H) 1,01 (m, 1H) 4,52 (s, 2H) 5,98 (t, J=6,62 Hz, 1H) 7,24 (s, 1H) 7,40 (m, 1H) 7,56 (m, 1H) 8,05 (m, 1H).To the product of Example 353C (384.7 mg, 0.78 mmol) was added a solution of hydrogen chloride in dioxane (4N, 7.8 mL) at 0 ° C. The solution was warmed to ambient temperature and stirred for 5.5 hours and concentrated under reduced pressure. This solid was suspended in dichloromethane (7.8 mL) and to the suspension was added 1,8-diazabicyclo [5.4.0] undec-7-ene (0.6 mL, 4.01 mmol) and diphenylphosphorylazide (0.85 mL, 3.94 mmol) was added at room temperature and stirred overnight. The solution was concentrated in vacuo. The residue was purified by chromatography, eluting with 1% triethylamine / dichloromethane to give a triethylamine salt of the title compound (357 mg, 79%). MS (ESI +) m / z 470 (M-H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 0.22 (m, 2 H) 0.46 (br d, J = 7.35 Hz, 2 H) 1.01 (m, 1 H) 4.52 (s, 2H ) 5.98 (t, J = 6.62 Hz, 1 H) 7.24 (s, 1 H) 7.40 (m, 1 H) 7.56 (m, 1 H) 8.05 (m, 1H).

Exemplo 353E 3-[7-(aminometil)-1,l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-3-il]-1-[(ciclopropilmetil)amino]-4-hidroxiquinolin-2(1H)-ona À solução do produto do Exemplo 353D (357 mg, 0,62 mmol) em piridina (4,6 mL) e hidróxido de amónio concentrado (3 mL) 354 ΕΡ 1 560 827/ΡΤ juntou-se trifenilfosfina (397 mg, 1,51 mmol) a temperatura ambiente. A solução foi agitada a temperatura ambiente de um dia para o outro e concentrada sob pressão reduzida. O resíduo foi diluído com 30% de hexano/tolueno e o sólido foi filtrado para gerar o composto em título (250 mg, 90%). MS (ESI-) m/z 446 (M+H)\ XH RMN (300 MHz, DMSO-d6) δ 0,21 (m, 2H) 0,46 (br d, J=8,09 Hz, 2H) 1,00 (m, 1H) 4,12 (s, 2H) 5,98 (t, J=6,43 Hz, 1H) 7,12 (m, 1H) 7,22 (s, 1H) 7,58 (m, 1H) 7,72 (d, J=7,72 Hz, 1H) 8,04 (m, 1H).Example 353E 3- [7- (aminomethyl) -1,1-dioxido-4H-thieno [2,3-e] [1,2,4] thiadiazin-3-yl] -1 - [(cyclopropylmethyl) amino] - To the solution of the product of Example 353D (357mg, 0.62mmol) in pyridine (4.6mL) and concentrated ammonium hydroxide (3mL) Ρ Ρ Ρ 1 560 827/4 triphenylphosphine (397 mg, 1.51 mmol) was added at room temperature. The solution was stirred at room temperature overnight and concentrated under reduced pressure. The residue was diluted with 30% hexane / toluene and the solid was filtered to give the title compound (250 mg, 90%). NMR (300 MHz, DMSO-d 6) δ 0.21 (m, 2H), 0.46 (br d, J = 8.09 Hz, 2 H) 1.00 (m, 1H), 7.12 (s, 2H), 5.98 (t, J = 6.43 Hz, (m, 1 H) 7.72 (d, J = 7.72 Hz, 1 H) 8.04 (m, 1 H).

Exemplo 353F N—[(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroguinolin-3-il}-l,l-dioxido-4H-tieno[2,3-e][1,2,4]— tiadiazin-7-il)metil]metanossulfonamida À suspensão do sal de trietilamina do produto do Exemplo 353E (85,26 mg, 0,16 mmol) em N,N-dimetilformamida (1,6 mL) juntou-se trietilamina (48 pL, 0,34 mmol) e depois cloreto de metanossulfonilo (13,3 pL, 0,17 mmol) a temperatura ambiente. A solução foi agitada a temperatura ambiente durante 20 minutos e concentrada in vacuo. O resíduo foi purificado por cromatograf ia de fase inversa, eluindo com 20% a 95% de acetonitrilo/ácido trifluoroacético a 0,1% em água para gerar o composto em título (39,86 mg, 49%). MS (ESI+) m/z 524 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ 0,15 (m, 2H) 0,42 (m, 2H) 1,01 (m, 1H) 2,84 (d, J=7,35 Hz, 2H) 2,99 (s, 3H) 4,29 (d, J=6,25 Hz, 2H) 6,37 (br s, 1H) 7,41 (m, 2H) 7,75 (t, J= 6,25 Hz, 1H) 7,87 (m, 1H) 8,08 (d, J=8,09 Hz, 1H) 8,16 (m, 1H) 14,46 (m, 1H) .Example 353F N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroguinolin-3-yl} -1,1-dioxido-4H-thieno [2 , 3-e] [1,2,4] thiadiazin-7-yl) methyl] methanesulfonamide To the suspension of the triethylamine salt of the product of Example 353E (85.26 mg, 0.16 mmol) in N, N-dimethylformamide (1.6 mL) was added triethylamine (48 μL, 0.34 mmol) and then methanesulfonyl chloride (13.3 μL, 0.17 mmol) at room temperature. The solution was stirred at room temperature for 20 minutes and concentrated in vacuo. The residue was purified by reverse phase chromatography, eluting with 20% to 95% acetonitrile / 0.1% trifluoroacetic acid in water to give the title compound (39.86 mg, 49%). MS (ESI +) m / z 524 (M + H) +. 1 H NMR (300 MHz, DMSOd 6) δ 0.15 (m, 2H) 0.42 (m, 2H) 1.01 (m, 1H) 2.84 (d, J = 7.35 Hz, 2H) 2H), 7.75 (t, J = 6.6 Hz, 2H), 7.75 (d, J = 25 Hz, 1 H) 7.87 (m, 1 H) 8.08 (d, J = 8.09 Hz, 1 H) 8.16 (m, 1 H) 14.46 (m, 1H).

Exemplo 354 3-(8-amino-7-hidroxi-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-4-hidroxi-l-(isobutilamino)quinolin-2(1H)-onaExample 354 3- (8-Amino-7-hydroxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (isobutylamino) quinolin-2 (1H) - one

Uma solução do produto do Exemplo 321C (0,26 g, 0,61 mmol) em ácido sulfúrico concentrado (4 mL) a 0°C foi tratada com nitrato de amónio (55 mg, 0,69 mmol). Após agitação a temperatura ambiente durante 30 minutos, a solução foi vertida em água gelada e o precipitado foi filtrado, seco e triturado com acetato de etilo para gerar o intermediário nitrado (0,23 g, 79%). Uma solução deste sólido (0,23 g, 0,48 mmol) em metanol:tetra-hidrofurano:água (3:3:1) (2,3 mL) foi tratada 355 ΕΡ 1 560 827/ΡΤ com ferro em pó (0,12 g, 2,15 mmol) e cloreto de amónio (0,031 g, 0,58 mmol) a 60°C durante 1 hora. A solução quente foi filtrada através de terra de diatomáceas e enxaguada com tetra-hidrofurano. O filtrado foi concentrado e o sólido resultante foi triturado com diclorometano:acetato de etilo 1:1 para gerar o composto em titulo (0,088 g, 42%). MS (ESI-) m/z 442 (M-H)“. RMN (300 MHz, DMSO-d6) δ 1,04 (d, J=6,62 Hz, 6H) 1,92 (m, 1H) 2,76 (m, 2H) 5,40 (s, 2H) 6,34 (m, 1H) 6,66 (d, J=1, 72 Hz, 1H) 7,00 (d, J=8,46 Hz, 1H) 7,44 (m, 1H) 7,94 (m, 2H) 8,17 (d, J= 6,99 Hz, 1H) 10,12 (s, 1H) 13,82 (s, 1H) 15,19 (s, 1H) .A solution of the product of Example 321C (0.26 g, 0.61 mmol) in concentrated sulfuric acid (4 mL) at 0 ° C was treated with ammonium nitrate (55 mg, 0.69 mmol). After stirring at room temperature for 30 minutes, the solution was poured into ice water and the precipitate was filtered, dried and triturated with ethyl acetate to give the nitrated intermediate (0.23 g, 79%). A solution of this solid (0.23 g, 0.48 mmol) in methanol: tetrahydrofuran: water (3: 3: 1) (2.3 mL) was treated with 355 ÅΡ 1 560 827 / ΡΤ with powdered iron ( 0.12 g, 2.15 mmol) and ammonium chloride (0.031 g, 0.58 mmol) at 60 ° C for 1 hour. The hot solution was filtered through diatomaceous earth and rinsed with tetrahydrofuran. The filtrate was concentrated and the resulting solid triturated with dichloromethane: ethyl acetate 1: 1 to give the title compound (0.088 g, 42%). MS (ESI-) m / z 442 (M-H). NMR (300 MHz, DMSO-d 6) δ 1.04 (d, J = 6.62 Hz, 6H) 1.92 (m, 1H) 2.76 (m, 2H) 5.40 (s, 2H) 6 , 7.34 (m, 1H), 7.94 (m, 1H), 7.40 (d, J = , 2H) 8.17 (d, J = 6.99 Hz, 1H) 10.12 (s, 1H) 13.82 (s, 1H) 15.19 (s, 1H).

Exemplo 355 3-(1,l-dioxido-4H-[1,3]oxazolo[5,4-h][1,2,4]benzotiadiazin-3-il)-4-hidroxi-l-(isobutilamino)guinolin-2(1H)-onaExample 355 3- (1,1-dioxido-4H- [1,3] oxazolo [5,4- h] [1,2,4] benzothiadiazin-3-yl) -4-hydroxy-1- (isobutylamino) guinoline -2 (1H) -one

Uma solução do Exemplo 354 (0, 036 g, 0,081 mmol) em dimetilformamida (2 mL) foi tratada com ortoformato de trimetilo (1 mL) e uma quantidade catalítica de ácido para-toluenossulfónico a temperatura ambiente durante 20 horas. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi triturado com acetato de etilo:tetra-hidrofurano 1:1, filtrado e seco para gerar o composto em título (8 mg, 22%). MS (ESI ) m/z 452 (M-H)“. XH RMN (300 MHz, DMSO-d6) δ 1,05 (d, J=6,62 Hz, 6H) 1,93 (m, 1H) 2,78 (m, 2H) 6,33 (m, 1H) 7,45 (t, J=7,54 Hz, 1H) 7,73 (d, J=8,82 Hz, 1H) 7,92 (t, 0=1,12 Hz, 1H) 8,00 (m, 1H) 8,21 (m, 2H) 9,04 (s, 1H) 14,28 (s, 1H).A solution of Example 354 (0.036 g, 0.081 mmol) in dimethylformamide (2 mL) was treated with trimethyl orthoformate (1 mL) and a catalytic amount of para-toluenesulfonic acid at room temperature for 20 hours. The solvent was removed under a stream of hot nitrogen and the residue was triturated with 1: 1 ethyl acetate: tetrahydrofuran, filtered and dried to give the title compound (8 mg, 22%). MS (ESI) m / z 452 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ 1.05 (d, J = 6.62 Hz, 6H) 1.93 (m, 1H) 2.78 (m, 2H) 6.33 (m, 1H) 7.45 (t, J = 7.54 Hz, 1 H) 7.73 (d, J = 8.82 Hz, 1 H) 7.92 (t, J = 1.12 Hz, , 1H), 8.21 (m, 2H), 9.04 (s, 1H), 14.28 (s, 1H).

Exemplo 356 2-({8-amino-3-[4-hidroxi-l-(isobutilamino)-2-oxo-l,2-di-hidro-quinolin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}oxi)- acetamidaExample 356 2 - ({8-amino-3- [4-hydroxy-1- (isobutylamino) -2-oxo-1,2-dihydro-quinolin-3-yl] -1,1-dioxido-4H- 1,2,4-benzothiadiazin-7-yl} oxy) acetamide

Uma solução do produto do Exemplo 321C (0,49 g, 1,15 mmol) em ácido sulfúrico concentrado (6 mL) a 0°C foi tratada com nitrato de amónio (100 mg, 1,25 mmol). Após agitação a temperatura ambiente durante 1 hora, a solução foi vertida em água gelada e o precipitado foi filtrado, seco e triturado com acetato de etilo para gerar o intermediário nitrado (0,27 g, 49%). Uma solução do intermediário nitrado (75 mg, 0,16 mmol) em N,N-dimetilformamida (3 mL) foi tratada com 2-bromoacetamida (33 mg, 0,24 mmol) e carbonato de césio (206 mg, 0,63 mmol) na 356 ΕΡ 1 560 827/ΡΤ presença de uma quantidade catalítica de iodeto de tetrabutilamónio a temperatura ambiente durante 24 horas. O solvente foi removido com uma corrente de azoto quente e o resíduo foi triturado com água, filtrado e seco para gerar o material alquilado (76 mg, 90%) . Uma solução deste material numa mistura 3:3:1 de metanol:tetra-hidrofurano:água (2,3 mL) foi tratada com ferro em pó (36 mg, 0,64 mmol) e cloreto de amónio (9 mg, 0,17 mmol) a 60°C durante 2 horas. A solução foi filtrada através de terra de diatomáceas e enxaguada com tetra-hidrof urano. O filtrado foi concentrado e purificado por coluna instantânea, eluindo com 1% de metanol em diclorometano para gerar o composto em título (16 mg, 22%) . O sal de sódio foi preparado através do procedimento do Exemplo 1D. MS (ESI~) m/z 499 (M-H) . XH RMN (300 MHz, DMSO-d6) δ 1 ,03 (d, J= =6,62 Hz, 6H) 1,86 (m, 1H) 2,55 (m, 2H) 4,39 (s, 2H) 5,73 (s, 2H) 5 ,93 (t, II *~D 54 Hz, 1H) 6,37 (d, J=8,46 Hz, 1H) 7,04 (m, 2H) 7 ,56 (m, 3H) 7,84 (s, 1H) 8,06 (d, J=8,46 Hz, 1H) 15,91 (s, 1H) .A solution of the product of Example 321C (0.49 g, 1.15 mmol) in concentrated sulfuric acid (6 mL) at 0 ° C was treated with ammonium nitrate (100 mg, 1.25 mmol). After stirring at room temperature for 1 hour, the solution was poured into ice water and the precipitate was filtered, dried and triturated with ethyl acetate to give the nitrated intermediate (0.27 g, 49%). A solution of the nitrated intermediate (75 mg, 0.16 mmol) in N, N-dimethylformamide (3 mL) was treated with 2-bromoacetamide (33 mg, 0.24 mmol) and cesium carbonate (206 mg, 0.63 mmol) in the presence of a catalytic amount of tetrabutylammonium iodide at room temperature for 24 hours. The solvent was removed with a stream of hot nitrogen and the residue was triturated with water, filtered and dried to give the alkylated material (76 mg, 90%). A solution of this material in a 3: 3: 1 mixture of methanol: tetrahydrofuran: water (2.3 mL) was treated with powdered iron (36 mg, 0.64 mmol) and ammonium chloride (9 mg, 17 mmol) at 60 ° C for 2 hours. The solution was filtered through diatomaceous earth and rinsed with tetrahydrofuran. The filtrate was concentrated and purified by flash column, eluting with 1% methanol in dichloromethane to give the title compound (16 mg, 22%). The sodium salt was prepared by the procedure of Example 1D. MS (ESI +) m / z 499 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ 1.03 (d, J = 6.62 Hz, 6 H) 1.86 (m, 1 H) 2.55 (m, 2 H) 4.39 (s, 2H ) 5.37 (d, J = 8.46 Hz, 1 H) 7.04 (m, 2 H) 7.56 (s, 2 H) 5.93 (t, (m, 3H) 7.84 (s, 1H) 8.06 (d, J = 8.46 Hz, 1 H) 15.91 (s, 1H).

Exemplo 357 3-[8-(clorornetil)-1,l-dioxido-4H-[1,3]oxazolo[5, 4-h] [1,2,4] — benzotiadiazin-3-il]-4-hidroxi-l-(isobutilamino)quinolin-2(1H)-onaExample 357 3- [8- (Chloromethyl) -1,1-dioxido-4 H - [1,3] oxazolo [5,4-h] [1,2,4] benzothiadiazin-3-yl] -4-hydroxy (1-isobutylamino) quinolin-2 (1H) -one

Uma solução do Exemplo 354 (0,030 g, 0,067 mmol) em dimetilformamida (3 mL) foi tratada com 2-cloro-l,1,1-trimetoxietano (0,50 mL) e uma quantidade catalítica de ácido para-toluenossulfónico a 60°C durante 4 horas. O solvente foi removido sob uma corrente de azoto quente e o resíduo resultante foi triturado com água e filtrado, depois triturado com metanol e filtrado para gerar o composto em título (22 mg, 51%). O sal de sódio foi produzido através do procedimento do Exemplo 1D. MS (ESI-) m/z 500 (M-H)'. :Η RMN (300 MHz, DMSO-d6) δ 1,04 (d, J=6,62 Hz, 6H) 1,87 (m, J=20, 04, 13,42, 6,99 Hz, 1H) 2,63 (m, 2H) 5,13 (s, 2H) 5,95 (t, J=6,99 Hz, 1H) 7,08 (t, J=7,54 Hz, 1H) 7,36 (d, J=9,19 Hz, 1H) 7,57 (m, 2H) 7,99 (d, J=8,82 Hz, 1H) 8,09 (dd, J=7,91, 1,29 Hz, 1H) 16,59 (s, 1H).A solution of Example 354 (0.030 g, 0.067 mmol) in dimethylformamide (3 mL) was treated with 2-chloro-1,1,1-trimethoxyethane (0.50 mL) and a catalytic amount of para-toluenesulfonic acid at 60 C for 4 hours. The solvent was removed under a stream of hot nitrogen and the resulting residue triturated with water and filtered, then triturated with methanol and filtered to give the title compound (22 mg, 51%). The sodium salt was produced by the procedure of Example 1D. MS (ESI-) m / z 500 (M-H) +. NMR (300 MHz, DMSO-d 6) δ 1.04 (d, J = 6.62 Hz, 6H) 1.87 (m, J = 20.04, 13.42, 6.99 Hz, 1H) 2.63 (m, 2H) 5.13 (s, 2H) 5.95 (t, J = 6.99 Hz, 1 H) 7.08 (t, J = 7.54 Hz, d, J = 9.19 Hz, 1 H) 7.57 (m, 2 H) 7.99 (d, J = 8.82 Hz, 1 H) 8.09 (dd, J = 7.91, 1.29 Hz , 1H) 16.59 (s, 1H).

Exemplo 358A 3- [7-(benziloxi)-1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il]- 4- hidroxi-l-[propilidenoamino]quinolin-2(lff)-ona O produto do Exemplo 304F (0,1 g, 0,22 mmol) em N,N-dimetilacetamida (1 mL) reagiu com dietilacetal de propionaldeído (0,34 mL, 2,2 mmol) num tubo selado num reactor 357 ΕΡ 1 560 827/ΡΤ de microondas a 100°C durante 60 minutos. A reacção foi arrefecida até 25°C, concentrada sob uma corrente de azoto aquecido através de uma tubagem aquecida a 165°C e o resíduo resultante foi triturado com éter dietílico para gerar o composto em título (0,045 g, 42%).Example 358A 3- [7- (benzyloxy) -1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl] -4-hydroxy-1- [propylideneamino] quinolin-2 (1 H) -one O The product of Example 304F (0.1 g, 0.22 mmol) in N, N-dimethylacetamide (1 mL) was reacted with propionaldehyde diethyl acetal (0.34 mL, 2.2 mmol) in a sealed tube in a 357 E 827 / ΡΤ microwave at 100 ° C for 60 minutes. The reaction was cooled to 25 ° C, concentrated under a stream of heated nitrogen through a pipeline heated to 165 ° C and the resulting residue triturated with diethyl ether to give the title compound (0.045 g, 42%).

Exemplo 358B 3- [7-(benziloxi)-1,l-dioxido-4fl-l,2,4-benzotiadiazin-3-il]- 4- hidroxi-l-(propilamino)quinolin-2(lfl)-ona O produto do Exemplo 358A (0,045 g, 0,09 mmol) em tetra-hidrofurano (2 mL) a 0°C foi tratado com metanol (0, 005 mL, 0,35 mmol), seguido de adição gota a gota de uma solução 2,0M de boro-hidreto de lítio em tetra-hidrofurano (0,07 mL, 0,13 mmol), agitada a 25°C durante uma hora e diluída com ácido clorídrico IN. O precipitado resultante foi filtrado e seco. O sólido foi dissolvido em tetra-hidrofurano e absorvido sobre sílica gel por meio de evaporação até à secura. A sílica resultante foi carregada num Alltech sep pack de 2 g e eluída com diclorometano para gerar o composto em título (0,020 g, 44%). MS (ESI') m/z 503 (M-H)'.Example 358B 3- [7- (Benzyloxy) -1,1-dioxido-4,11,2-benzothiadiazin-3-yl] -4-hydroxy-1- (propylamino) quinolin-2 (1 H) -one O The product of Example 358A (0.045 g, 0.09 mmol) in tetrahydrofuran (2 mL) at 0 ° C was treated with methanol (0.005 mL, 0.35 mmol), followed by the dropwise addition of a solution 2.0M lithium borohydride in tetrahydrofuran (0.07 mL, 0.13 mmol), stirred at 25 ° C for one hour and diluted with 1N hydrochloric acid. The resulting precipitate was filtered and dried. The solid was dissolved in tetrahydrofuran and absorbed onto silica gel by evaporation to dryness. The resulting silica was charged to a 2 g Alltech sep pack and eluted with dichloromethane to give the title compound (0.020 g, 44%). MS (ESI +) m / z 503 (M-H) +.

Exemplo 358C 4-hidroxi-3-(7-hidroxi-l,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)-1-(propilamino)quinolin-2(1H)-ona O produto do Exemplo 358B (0,020 g, 0,04 mmol) em tetra-hidrofurano (5 mL) foi tratado com formato de amónio (13 mg, 0,19 mmol), hidróxido de paládio (2 mg) e Pd a 10%/C (1 mg) e a mistura resultante foi refluxada durante 1 hora. O catalisador foi removido por filtração e o filtrado evaporado para gerar um sólido branco. O resíduo sólido foi repartido entre acetato de etilo (100 mL) e água (5 mL) . As fases foram separadas e o solvente orgânico foi removido sob pressão reduzida para gerar o composto em título (0,016 g, 100%). MS (ESI') m/z 413 (M-H)'.Example 358C 4-Hydroxy-3- (7-hydroxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (propylamino) quinolin-2 (1H) Example 358B (0.020 g, 0.04 mmol) in tetrahydrofuran (5 mL) was treated with ammonium formate (13 mg, 0.19 mmol), palladium hydroxide (2 mg) and 10% Pd / C 1 mg) and the resulting mixture was refluxed for 1 hour. The catalyst was removed by filtration and the filtrate evaporated to give a white solid. The solid residue was partitioned between ethyl acetate (100 mL) and water (5 mL). The phases were separated and the organic solvent was removed under reduced pressure to give the title compound (0.016 g, 100%). MS (ESI +) m / z 413 (M-H) +.

Exemplo 358D 2- ({3-[4-hidroxi-2-oxo-l-(propilamino)-1,2-di-hidroquinolin- 3- il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}oxi)acetamida O produto do Exemplo 358C (0,016 g, 0,04 mmol) em N,N-dimetilformamida (2 mL) reagiu com carbonato de césio (0,015 g, 0,045 mmol), bromoacetamida (0,006 g, 0,18 mmol) e 358 ΕΡ 1 560 827/ΡΤ uma quantidade catalítica de iodeto de tetrabutilamónio a 25°C durante 3 horas. A reacção foi concentrada sob uma corrente de azoto aquecida através de uma tubagem aquecida a 165°C e o resíduo resultante foi triturado com água, filtrado e seco. O sólido resultante foi triturado em acetato de etilo quente, filtrado e seco para gerar o composto em título (0,008 g, 37%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 470 (Μ-H)-. ΧΗ RMN (300 MHz, DMSO-dê) δ 0,99 (m, 3H)1,55 (t, 2H) 2,73 (t, 2H) 4,11 (d, 1H) 4,41 (d, 1H) 5,83 (d, 1H) 7,05 (s, 3H)7,39 (s, 1H) 7,54 (s, 2H) 7,98 (s, 1H) 16,24 (s, 1H) .Example 358D 2 - ({3- [4-hydroxy-2-oxo-1- (propylamino) -1,2-dihydroquinolin-3-yl] -1,1-dioxido-4 H -1,2,4- The product of Example 358C (0.016 g, 0.04 mmol) in N, N-dimethylformamide (2 mL) was reacted with cesium carbonate (0.015 g, 0.045 mmol), bromoacetamide (0.006 g , 0.18 mmol) and a catalytic amount of tetrabutylammonium iodide at 25 ° C for 3 hours. The reaction was concentrated under a heated nitrogen stream through a pipeline heated to 165øC and the resulting residue triturated with water, filtered and dried. The resulting solid was triturated in hot ethyl acetate, filtered and dried to give the title compound (0.008 g, 37%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 470 (Μ-H) -. NMR (300 MHz, DMSO-d 6) δ 0.99 (m, 3H) 1.55 (t, 2H) 2.73 (t, 2H) 4.11 (d, 1H) 4.41 (d, 1H ) 5.83 (d, 1H) 7.05 (s, 3H) 7.39 (s, 1H) 7.54 (s, 2H) 7.98 (s, 1H) 16.24 (s, 1H).

Exemplo 359 ácido_3-{3-[4-hidroxi-l-(isobutilamino)-2-oxo-l,2-di-hidro- quinolin-3-il]-1,l-dioxido-4H-[1,3]oxazolo[5,4-h] [1,2,4]-benzotiadiazin-8-il}propanóicoExample 359 3- [3- (4-Hydroxy-1- (isobutylamino) -2-oxo-1,2-dihydroquinolin-3-yl] -1,1-dioxido-4H- [1,3] oxazolo [5,4-h] [1,2,4] -benzothiadiazin-8-yl} propanoic acid

Uma solução do produto do Exemplo 354 (15 mg, 0,033 mmol) e anidrido maleico (100 mg, 1,0 mmol) em piridina (2 mL) foiA solution of the product of Example 354 (15 mg, 0.033 mmol) and maleic anhydride (100 mg, 1.0 mmol) in pyridine (2 mL) was

aquecida a 160°C num reactor de microondas durante 1 hora. A mistura em bruto foi arrefecida até 25°C e purificada por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo:ácido trifluoroacético aquoso a 0,1% para gerar o composto em título (5,3 mg, 30%). O di-sal de sódio foi produzido através do procedimento do Exemplo 1D utilizando 2 equivalentes de hidróxido de sódio. MS (ESI-) m/z 524 (M-H)“. XH RMN (300 MHz, DMSO-d6) δ 1,03 (d, J=6,25 Hz, 6H) 1,86 (m, 1H) 2,27 (m, 4H) 2,66 (m, 2H) 5,94 (t, J=7,54 Hz, 1H) 6,81 (m, 2H) 7,05 (t, J=7,91 Hz, 1H) 7,53 (m, 2H) 8,06 (d, J=6,62 Hz, 1H) 15, 74 (s, 1H) .heated at 160 ° C in a microwave reactor for 1 hour. The crude mixture was cooled to 25øC and purified by preparative HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile: aqueous trifluoroacetic acid 0.1% to give the title compound (5.3 mg, 30%). The sodium di-salt was produced by the procedure of Example 1D using 2 equivalents of sodium hydroxide. MS (ESI-) m / z 524 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ 1.03 (d, J = 6.25 Hz, 6H) 1.86 (m, 1H) 2.27 (m, 4H) 2.66 (m, 2H) (T, J = 7.91 Hz, 1 H) 7.53 (m, 2 H) 8.06 (t, J = 7.91 Hz, 1 H) d, J = 6.62 Hz, 1 H) 15.74 (s, 1H).

Exemplo 360 3—(8—{[(2-aminoetil)aminojmetil}-!,l-dioxido-4H-[1,3]oxazolo-[5,4-h][1,2,4]benzotiadiazin-3-il)-4-hidroxi-l-(isobutilamino)-quinolin-2(1H)-onaExample 360 3- (8 - {[(2-Aminoethyl) amino] methyl} -1,1-dioxido-4H- [1,3] oxazolo [5,4- h] [1,2,4] benzothiadiazin- yl) -4-hydroxy-1- (isobutylamino) quinolin-2 (1H) -one

Uma solução do produto do Exemplo 357 (20 mg, 0,039 mmol) e tert-butil-N-(2-aminoetil)carbamato (7,7 mg, 0,046 mmol) em N,N-dimetilformamida (3 mL) foi tratada com carbonato de césio (39 mg, 0,117 mmol) a 50°C durante 2 horas. O solvente foi removido com uma corrente de azoto quente e o resíduo 359 ΕΡ 1 560 827/ΡΤ resultante foi triturado com água, filtrado e seco. Este sólido foi suspenso em 1,4-dioxano (2 mL) e tratado com uma solução de ácido clorídrico 4M em 1,4-dioxano (2 mL) e agitada a temperatura ambiente durante 20 horas. A solução foi concentrada até metade, filtrada e seca para gerar o sal di-cloridrato do composto em título (5,8 mg, (24%). MS (ESI-) m/z 524 (M-H)~. XH RMN (500 MHz, benzeno-d6) δ 1,05 (d, J=6,71 Hz, 6H) 1,93 (m, 1H) 2,60 (m, 2H) 2,81 (d, J=6,10 Hz, 2H) 3,61 (m, 2H) 4,67 (s, 2H) 6,17 (m, 1H) 7,05 (d, J=9,16 Hz, 1H) 7,20 (d, J=8,54 Hz, 1H) 7,44 (t, J=7,63 Hz, 1H) 7,90, (m, 1H) 7,99 (m, 2H) 8,17 (d, J=7,93 Hz, 1H) 8,24 (m, 2H) 13,76 (s, 1H).A solution of the product of Example 357 (20 mg, 0.039 mmol) and tert-butyl-N- (2-aminoethyl) carbamate (7.7 mg, 0.046 mmol) in N, N-dimethylformamide (3 mL) was treated with carbonate of cesium (39 mg, 0.117 mmol) at 50 ° C for 2 hours. The solvent was removed with a stream of warm nitrogen and the resulting residue was triturated with water, filtered and dried. This solid was suspended in 1,4-dioxane (2mL) and treated with a solution of 4M hydrochloric acid in 1,4-dioxane (2mL) and stirred at room temperature for 20 hours. The solution was concentrated to half, filtered and dried to give the di-hydrochloride salt of the title compound (5.8 mg, (24%). MS (ESI-) m / z 524 (MH) .1 H NMR (500 (D, J = 6.71 Hz, 6H) 1.93 (m, 1H) 2.60 (m, 2H) 2.81 (d, J = 6.10 Hz, (D, J = 9.16 Hz, 1 H), 7.20 (d, J = 9.16 Hz, 1 H) 8.54 Hz, 1 H) 7.44 (t, J = 7.63 Hz, 1 H) 7.90, (m, 1 H) 7.99 (m, 2 H) 8.17 (d, J = 7.93 1H), 8.24 (m, 2H), 13.76 (s, 1H).

Exemplo 361 2- ({3-[4-hidroxi-l-(isobutilamino)-2-oxo-l,2-di-hidroquinolin- 3- il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}oxi)propanamida A uma solução do produto do Exemplo 321C (20 mg, 0, 0467 mmol) em N,N-dimetilformamida (2 mL) juntou-se 2-bromo-propionamida (10,6 mg, 0,070 mmol), iodeto de tetra-n-butil-amónio (1,7 mg, 0,0047 mmol) e carbonato de césio (61 mg, 0,187 mmol). A mistura foi agitada a 25°C durante 72 horas. A solução foi depois tratada com ácido clorídrico aquoso IN (10 mL) e extraída com acetato de etilo (10 mL) . A fase orgânica foi separada e seca sobre sulfato de magnésio, filtrada e concentrada sob pressão reduzida para proporcionar o composto em titulo (18,4 mg, 79%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI ) m/z 498 (M-Na) “. XH RMN (300 MHz, DMSO-d5) δ 1,03 (d, J=6,6Hz, 6H), 1,45 (d, J=6,6Hz, 3M), 1,86 (m, 1H), 2,50 (m, 1H), 2,75 (m, 1H), 4,65 (q, J=6,6Hz, 1H), 5,94 (t, J=7,3Hz, 1H), 7,08 (m, 2H), 7,17 (m, 1H) , 7,23 (m, 1H), 7,29 (s, 1H), 7,58 (m, 2H), 7,64 (s, 1H), 8,07 (d, J=6,6Hz, 1H), 16,22 (s, 1H).Example 361 2 - ({3- [4-Hydroxy-1- (isobutylamino) -2-oxo-1,2-dihydroquinolin-3-yl] -1,1-dioxido-4H-1,2,4- benzothiadiazin-7-yl} oxy) propanamide To a solution of the product of Example 321C (20 mg, 0.0467 mmol) in N, N-dimethylformamide (2 mL) was added 2-bromopropionamide (10.6 mg, 0.070 mmol), tetra-n-butylammonium iodide (1.7 mg, 0.0047 mmol) and cesium carbonate (61 mg, 0.187 mmol) were added. The mixture was stirred at 25 ° C for 72 hours. The solution was then treated with 1N aqueous hydrochloric acid (10 mL) and extracted with ethyl acetate (10 mL). The organic phase was separated and dried over magnesium sulfate, filtered and concentrated under reduced pressure to give the title compound (18.4 mg, 79%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI) m / z 498 (M-Na). 1 H NMR (300 MHz, DMSO-d 6) δ 1.03 (d, J = 6.6 Hz, 6 H), 1.45 (d, J = 6.6 Hz, 3 M), 1.86 (m, 1H), J = 6.6Hz, 1H), 5.94 (t, J = 7.3Hz, 1H), 7.92 (m, 1H) 1H), 7.23 (m, 1H), 7.29 (s, 1H), 7.58 (m, 2H), 7.64 (s, 1H) ), 8.07 (d, J = 6.6Hz, 1H), 16.22 (s, 1H).

Exemplo 362 2- ({3-[4-hidroxi-l-(isobutilamino)-2-oxo-l,2-di-hidroquinolin- 3- il] -1, l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il}oxi)butanamida A uma solução do produto do Exemplo 321C (20 mg, 0, 0467 mmol) em N,N-dimetilformamida (2 mL) juntou-se 2-cloro-butiramida (8,5 mg, 0,070 mmol), iodeto de tetra-n-butil-amónio (1,7 mg, 0,0047 mmol) e carbonato de césio (61 mg, 360 ΕΡ 1 560 827/ΡΤ 0,187 mmol). A mistura foi agitada a 25°C durante 18 horas, depois aquecida a 80°C durante 3 horas. Após arrefecimento até 25°C, juntou-se ácido clorídrico aquoso IN (10 mL) e a mistura foi extraída com acetato de etilo (10 mL) . A resultante fase orgânica foi separada e seca sobre sulfato de magnésio, filtrada e concentrada sob pressão reduzida para proporcionar o composto em título (24 mg, 100%) . O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. MS (ESI-) m/z 512 (Μ-Na)'. XH RMN (300 MHz, DMSO-d6) δ 0,99 (t, J=7,7Hz, 3H), 1,03 (d, J=6,3Hz, 6H) , 1,83 (m, 3H), 2,50 (m, 1H), 2,75 (m, 1H), 4,46 (m, 1H), 5,94 (m, 1H), 7,08 (m, 2H), 7,17 (m, 1H) , 7,23 (m, 1H), 7,32 (s, 1H), 7,58 (m, 2H), 7,64 (s, 1H), 8,07 (d, J=7,8Hz, 1H), 16,23 (bs, 1H) .Example 362 2 - ({3- [4-hydroxy-1- (isobutylamino) -2-oxo-1,2-dihydroquinolin-3-yl] -1,1-dioxido-4 H -1,2,4- benzothiadiazin-7-yl} oxy) butanamide To a solution of the product of Example 321C (20 mg, 0.0467 mmol) in N, N-dimethylformamide (2 mL) was added 2-chloro-butyramide (8.5 mg, 0.070 mmol), tetra-n-butylammonium iodide (1.7 mg, 0.0047 mmol) and cesium carbonate (61 mg, 360 Ρ Ρ 1 560 827 / ΡΤ 0.187 mmol) were added. The mixture was stirred at 25 ° C for 18 hours, then heated at 80 ° C for 3 hours. After cooling to 25 ° C 1N aqueous hydrochloric acid (10 mL) was added and the mixture was extracted with ethyl acetate (10 mL). The resulting organic phase was separated and dried over magnesium sulfate, filtered and concentrated under reduced pressure to give the title compound (24 mg, 100%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 512 (M + Na) +. 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (t, J = 7.7 Hz, 3H), 1.03 (d, J = 6.3 Hz, 6H), 1.83 (m, 3H), 2.50 (m, 1H), 2.75 (m, 1H), 4.46 (m, 1H), 5.94 (m, 1H), 7.08 (m, 2H), 7.17 1H), 7.23 (m, 1H), 7.32 (s, 1H), 7.58 (m, 2H), 7.64 (s, 1H), 8.07 (d, J = 8Hz, 1H), 16.23 (bs, 1H).

Exemplo 363 {3-[4-hidroxi-l-(isobutilamino)-2-oxo-l, 2-di-hidroquinolin-3-il]-1,l-dioxido-4H-[1,3]oxazolo[5,4-h][1,2,4]benzotiadiazin-8-il}acetato de metiloEXAMPLE 363 {3- [4-Hydroxy-1- (isobutylamino) -2-oxo-1,2-dihydroquinolin-3-yl] -1,1-dioxido-4H- [1,3] oxazolo [ 4-h] [1,2,4] benzothiadiazin-8-yl} acetate

Uma solução do produto do Exemplo 354 (67, 5 mg, 0,015 mmol) em N,N-dimetilformamida (2 mL) foi tratada com ácido p-toluenossulfónico mono-hidratado (1 mg) e éster tetrametílico de ácido monoortomalónico (272 mg, 1,52 mmol). A mistura foi aquecida a 50°C num banho de óleo sob uma atmosfera de azoto e a solução amarela resultante foi agitada durante 3 horas. Nesse momento, juntou-se orto-éster adicional (272 mg, 1,52 mmol) e o aquecimento foi continuado durante outras 5 horas. A reacção foi arrefecida até temperatura ambiente e a solução foi concentrada por evaporação rotativa sob vácuo. O resíduo foi ainda seco numa bomba de vácuo, depois dissolvido em diclorometano (100 mL) e lavado com água (2 x 50 mL) e salmoura. A fase orgânica foi seca sobre sulfato de sódio anidro, filtrada e concentrada sob pressão reduzida. O resíduo foi cromatografado em sílica gel, eluindo com 1% de metanol/diclorometano. O material impuro resultante foi recromatografado em sílica gel, eluindo com um gradiente de 5% a 7% de acetonitrilo/diclorometano para gerar o composto em título (36 mg, 45%). MS (APCI + ) m/z 526 (M+H) + . XH RMN (300 MHz, DMSO-d6) δ 1,05 (d, J= 6,62 Hz, 6H) 1,91 (m, 1H) 2,77 (br m, 2H) 3,72 (s, 3H) 4,40 (s, 2H) 6,36 (br m, 1H) 7,45 (t, J=1,35 Hz, 1H) 7,70 (d, J=9,19 Hz, 1H) 7,94 (m, 2H) 8,20 361 ΕΡ 1 560 827/ΡΤ (d, J=8,82 Hz, 2H) 14,25 (br s, 1H). Uma suspensão do produto do Exemplo 363 (6,0 mg, 0,0114 mmol) em tetra-hidrofurano anidro (3 mL) e água destilada (1 mL) foi tratada com hidróxido de sódio aquoso 0,998 N (0,0114 mL, 0,0114 mmol) e a solução amarela misturada durante 15 minutos. O solvente foi removido sob pressão reduzida e o resíduo seco numa bomba de vácuo para proporcionar o sal de sódio do Exemplo 363 (6,1 mg, 98%). XH RMN (300 MHz, DMSO-d6) δ 1,04 (d, J=5,15 Hz, 6H) 1,88 (m, 1H) 2,75 (m, 1H) 3,72 (s, 3H) 4,31 (s, 2H) 5,95 (m, 1H) 7,08 (m, 1H) 7,30 (m, 1H) 7,58 (m, 2H) 7,95 (m, 1H) 8,09 (m, 1H) 16,55 (s, 1H).A solution of the product of Example 354 (67.5 mg, 0.015 mmol) in N, N-dimethylformamide (2 mL) was treated with p-toluenesulfonic acid monohydrate (1 mg) and monoortomalonic acid tetramethyl ester (272 mg, 1.52 mmol). The mixture was heated at 50 ° C in an oil bath under a nitrogen atmosphere and the resulting yellow solution was stirred for 3 hours. At that time, additional ortho ester (272 mg, 1.52 mmol) was added and heating was continued for another 5 hours. The reaction was cooled to room temperature and the solution was concentrated by rotary evaporation under vacuum. The residue was further dried on a vacuum pump, then dissolved in dichloromethane (100 mL) and washed with water (2 x 50 mL) and brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was chromatographed on silica gel, eluting with 1% methanol / dichloromethane. The resulting crude material was rechromatographed on silica gel, eluting with a gradient of 5% to 7% acetonitrile / dichloromethane to give the title compound (36 mg, 45%). MS (APCI +) m / z 526 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 1.05 (d, J = 6.62 Hz, 6H) 1.91 (m, 1H) 2.77 (br m, 2H) 3.72 (s, 3H ) 4.40 (s, 2H) 6.36 (br m, 1 H) 7.45 (t, J = 1.35 Hz, 1 H) 7.70 (d, J = 9.19 Hz, (M, 2H), 8.20 (br. A suspension of the product of Example 363 (6.0 mg, 0.0114 mmol) in anhydrous tetrahydrofuran (3 mL) and distilled water (1 mL) was treated with 0.998 N aqueous sodium hydroxide (0.0114 mL, , 0114 mmol) and the yellow solution mixed for 15 minutes. The solvent was removed under reduced pressure and the residue dried on a vacuum pump to provide the sodium salt of Example 363 (6.1 mg, 98%). 1 H NMR (300 MHz, DMSO-d 6) δ 1.04 (d, J = 5.15 Hz, 6H) 1.88 (m, 1H) 2.75 (m, 1H) 3.72 (s, 3H) 4.31 (s, 2H) 5.95 (m, 1H) 7.08 (m, 1H) 7.30 (m, 1H) 7.58 (m, 2H) 7.95 (m, 09 (m, 1 H) 16.55 (s, 1 H).

Exemplo 364 4-hidroxi-3-(8-{[3-hidroxipirrolidin-l-il]metil}-1,1-dioxido-4H-[1,3]oxazolo[5,4-h][1,2,4]benzotiadiazin-3-il)-1-(isobutil-amino)quinolin-2(1H)-onaExample 364 4-Hydroxy-3- (8 - {[3-hydroxypyrrolidin-1-yl] methyl} -1,1-dioxido-4 H - [1,3] oxazolo [5,4- 4] benzothiadiazin-3-yl) -1- (isobutylamino) quinolin-2 (1H) -one

Uma solução do produto do Exemplo 357 (80 mg, 0,160 mmol) e 3-hidroxi-pirrolidina (20 mg, 0,240 mmol) em acetonitrilo (4 mL) foi tratada com diisopropiletilamina (0,115 mL, 0,640 mmol) a temperatura ambiente durante 24 horas. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 um de tamanho de partícula) utilizando um gradiente de 10% a 100% de acetonitrilo:ácido trifluoroacético aquoso a 0,1% para gerar o composto em título (16,2 mg, 18%). O sal de sódio foi produzido através do procedimento do Exemplo 1D. MS (ESI ) m/z 551 (M-H)~. 1H RMN (300 MHz, DMSO-d6) δ 1,04 (d, J=6,62 Hz, 6H) 1,58 (m, 1H) 1,88 (m, 1H) 2,03 (m, 1H) 2,60 (m, 2H) 2,75 (m, 2H) 2,88 (m, J=9,56, 6,25 Hz, 2H) 3,97 (s, 2H) 4,23 (m, 1H) 4,76 (m, 1H) 5,95 (t, J=7,35 Hz, 1H) 7,08 (m, 1H) 7,27 (d, J=8,82 Hz, 1H) 7,56 (m, 2H) 7,92 (d, J=8,82 Hz, 1H) 8,09 (d, J=6,62 Hz, 1H) 16,51 (s, 1H).A solution of the product of Example 357 (80 mg, 0.160 mmol) and 3-hydroxypyrrolidine (20 mg, 0.240 mmol) in acetonitrile (4 mL) was treated with diisopropylethylamine (0.115 mL, 0.640 mmol) at room temperature for 24 hours . The solvent was removed under a stream of hot nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 æm particle size) using a gradient from 10% to 100% acetonitrile: trifluoroacetic acid to give the title compound (16.2 mg, 18%). The sodium salt was produced by the procedure of Example 1D. MS (ESI) m / z 551 (M-H) -. 1 H NMR (300 MHz, DMSO-d 6) δ 1.04 (d, J = 6.62 Hz, 6H) 1.58 (m, 1H) 1.88 (m, 1H) 2.03 (m, 1H) 2H), 2.88 (m, J = 9.56, 6.25 Hz, 2 H) 3.97 (s, 2 H) 4.23 (m, 1 H ) 4.76 (m, 1 H) 5.95 (t, J = 7.35 Hz, 1 H) 7.08 (m, 1 H) 7.27 (d, J = 8.82 Hz, 1 H) 7.56 (m, 2H) 7.92 (d, J = 8.82 Hz, 1 H) 8.09 (d, J = 6.62 Hz, 1 H) 16.51 (s, 1H).

Exemplo 365 3-[1,l-dioxido-8-(piridínio-l-ilmetil)-4H-[1,3]oxazolo[5,4—h]-[1,2,4] benzotiadiazin-3-il]-1-(isobutilamino)-2-oxo-l,2-di-hidroquinolin-4-olatoExample 365 3- [1,1-dioxido-8- (pyridinium-1-ylmethyl) -4H- [1,3] oxazolo [5,4- h] - [1,2,4] benzothiadiazin-3-yl] -1- (isobutylamino) -2-oxo-1,2-dihydroquinolin-4-olate

Uma solução do produto do Exemplo 357 (16,5 mg, 0,033 mmol) em piridina (2 mL) foi aquecida a 45°C durante 20 horas. O excesso de piridina foi removido com uma corrente de azoto 362 ΕΡ 1 560 827/ΡΤ quente e ο resíduo foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 um de tamanho de partícula) utilizando um gradiente de 10% a 100% de acetonitrilo: ácido trifluoroacético aquoso a 0,1% para gerar o composto em título (6 mg, 34%). MS (ESI-) m/z 543 (M-H)~. RMN (300 MHz, DMSO-d6) δ 1,03 (d, J=6,62 Hz, 6H) 1,84 (m, J=13, 42, 6,43 Hz, 1H) 2,72 (m, 2H) 5,93 (t, J=7,35 Hz, 1H) 6,39 (s, 2H) 7,07 (m, 1H) 7,36 (d, J=8,82 Hz, 1H) 7,56 (m, 2H) 8,00 (d, J=8,82 Hz, 1H) 8,08 (m, 1H) 8,33 (m, 2H) 8,78 (t, J=7,91 Hz, 1H) 9,30 (d, J=5,52 Hz, 2H) 16,59 (s, 1H).A solution of the product of Example 357 (16.5 mg, 0.033 mmol) in pyridine (2 mL) was heated at 45 ° C for 20 hours. The excess pyridine was removed with a stream of hot nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 æm particle size) using a gradient of 10% to 100% acetonitrile: 0.1% aqueous trifluoroacetic acid to give the title compound (6 mg, 34%). MS (ESI-) m / z 543 (M-H) -. NMR (300 MHz, DMSO-d 6) δ 1.03 (d, J = 6.62 Hz, 6H) 1.84 (m, J = 13.44, 6.43 Hz, 1H) 2.72 (m, 2H), 7.07 (m, 1H), 7.36 (d, J = 8.82 Hz, 1H), 7.03 (t, (M, 2H), 8.78 (t, J = 7.91 Hz, 1H), 8.00 (d, 1H) 9.30 (d, J = 5.52 Hz, 2 H) 16.59 (s, 1H).

Exemplo 366 3-[1,l-dioxido-8-(pirrolidin-l-ilmetil)-4H-[1,3]oxazolo[5,4-h]-[1,2,4] benzotiadiazin-3-il]-4-hidroxi-l-(isobutilamino)-quinolin-2(1H)-onaExample 366 3- [1,1-dioxido-8- (pyrrolidin-1-ylmethyl) -4H- [1,3] oxazolo [5,4- h] - [1,2,4] benzothiadiazin-3-yl] -4-hydroxy-1- (isobutylamino) -quinolin-2 (1H) -one

Uma solução do produto do Exemplo 357 (80 mg, 0,160 mmol) e pirrolidina (17 mg, 0,240 mmol) em acetonitrilo (4 mL) foi tratada com diisopropiletilamina (0,115 mL; 0,640 mmol) a temperatura ambiente durante 24 horas. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 um de tamanho de partícula) utilizando um gradiente de 10% a 100% de acetonitrilo:ácido trifluoroacético aquoso a 0,1% para gerar o composto em título (12,4 mg, 15%). O sal deA solution of the product of Example 357 (80 mg, 0.160 mmol) and pyrrolidine (17 mg, 0.240 mmol) in acetonitrile (4 mL) was treated with diisopropylethylamine (0.115 mL, 0.640 mmol) at room temperature for 24 hours. The solvent was removed under a stream of hot nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 æm particle size) using a gradient from 10% to 100% acetonitrile: trifluoroacetic acid to give the title compound (12.4 mg, 15%). The salt of

sódio foi produzido através do procedimento do Exemplo 1D. MS (ESI&quot;) m/z 535 (M-H)&quot;. XH RMN (300 MHz, DMSO-d6) δ 1,04 (d, J=6,62 Hz, 6H) 1,73 (m, 4H) 1,87 (m, 1H) 2,63 (q, J=4,90 Hz, 4H) 2,75 (m, 2H) 3,99 (s, 2H) 5,95 (t, J=7,35 Hz, 1H) 7,08 (m, 1H) 7,27 (d, J=8, 82 Hz, 1H) 7,56 (m, 2H) 7,92 (d, J=8,82 Hz, 1H) 8,09 (dd, J=7, 90, 1,29 Hz, 1H) 16,50 (S, 1H) .sodium was produced by the procedure of Example 1D. MS (ESI) m / z 535 (M-H) &quot;. 1 H NMR (300 MHz, DMSO-d 6) δ 1.04 (d, J = 6.62 Hz, 6H) 1.73 (m, 4H) 1.87 (m, 1H) 2.63 (q, 4.90 Hz, 4H) 2.75 (m, 2H) 3.99 (s, 2H) 5.95 (t, J = 7.35 Hz, 1 H) 7.08 (m, 1 H) 7.27 ( d, J = 8.82 Hz, 1 H) 7.56 (m, 2 H) 7.92 (d, J = 8.82 Hz, 1 H) 8.09 (dd, J = 7.90, 1.29 Hz , 1H) 16.50 (s, 1H).

Exemplo 367 metanossulfonato de 8-amino-3-[4-hidroxi-l-(isobutilamino)-2-oxo-l,2-di-hidroquinolin-3-il]-1,l-dioxido-4H-l,2,4-benzo-tiadiazin-7-iloExample 367 8-Amino-3- [4-hydroxy-1- (isobutylamino) -2-oxo-1,2-dihydroquinolin-3-yl] -1,1-dioxido-4H- 4-benzo-thiadiazin-7-yl

Uma solução do produto do Exemplo 354 (44 mg, 0,099 mmol) e cloreto de metanossulfonilo (0,010 mL, 0,011 mmol) em tetra-hidrofurano (4 mL) foi tratada com diisopropiletilamina (0,075 mL, 0,040 mmol) a temperatura ambiente durante 2 horas. A solução foi vertida em água. O precipitado resultante foi 363 ΕΡ 1 560 827/ΡΤA solution of the product of Example 354 (44 mg, 0.099 mmol) and methanesulfonyl chloride (0.010 mL, 0.011 mmol) in tetrahydrofuran (4 mL) was treated with diisopropylethylamine (0.075 mL, 0.040 mmol) at ambient temperature for 2 hours . The solution was poured into water. The resulting precipitate was 363 Ρ Ρ 1 560 827 / ΡΤ

filtrado, seco e purificado por coluna instantânea, eluindo com 1% de metanol em diclorometano para gerar o composto em titulo (14,2 mg, 28%). O sal de sódio foi produzido através do procedimento do Exemplo 1D. MS (ESI') m/z 520 1H RMN (300 MHz, DMSO-d6) δ 1,03 (d, J=6,62 Hz, 6H) 1,88 (m, 1H) 2,71 (m, 2H) 3,46 (s, 3H) 5,94 (m, 1H) 6,53 (m, 1H) 7,16 (m, 1H) 7,35 (m, 1H) 7,64 (m, 2H) 8,09 (d, J=7,35 Hz, 1H) 16,23 (s, 1H) .filtered, dried and purified by flash column, eluting with 1% methanol in dichloromethane to give the title compound (14.2 mg, 28%). The sodium salt was produced by the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 1.03 (d, J = 6.62 Hz, 6H) 1.88 (m, 1H) 2.71 (m, 2H ) 3.46 (s, 3H) 5.94 (m, 1H) 6.53 (m, 1H) 7.16 (m, 1H) 7.35 (m, 1H) 7.64 (m, 2H) 8 , 9 (d, J = 7.35 Hz, 1 H) 16.23 (s, 1 H).

Exemplo 368 3-[8-(3-aminofenil)-1,l-dioxido-4H-[1,3]oxazolo[5,4-h][1,2,4]— benzotiadiazin-3-il]-4-hidroxi-l-(isobutilamino)quinolin-2(1H)-onaExample 368 3- [8- (3-aminophenyl) -1,1-dioxido-4 H - [1,3] oxazolo [5,4- h] [1,2,4] benzothiadiazin-3-yl] -4 hydroxy-1- (isobutylamino) quinolin-2 (1H) -one

Uma mistura do produto do Exemplo 354 (38 mg, 0,086 mmol) e ácido 3-aminobenzóico (13 mg, 0,094 mmol) em ácido polifosfórico (1 mL) foi aquecida a 190°C durante 1 hora. A solução foi arrefecida até 25°C, triturada com água e uma solução de carbonato de sódio a 10%. O sólido foi filtrado, seco e purificado por coluna instantânea, eluindo com 2% de metanol em diclorometano para gerar o composto em titulo (15 mg, 38%) . O sal de sódio foi produzido através do procedimento do Exemplo 1D. MS (ESI') m/z 543 (M-H)&quot;. XH RMN (300 MHz, DMSO-de) δ 1,04 (d, J=6,62 Hz, 6H) 1,86 (m, 1H) 2,56 (m, 2H) 5,53 (s, 2H) 5,96 (t, J=7,35 Hz, 1H) 6,82 (ddd, J=8,09, 2,21, 1.10 Hz, 1H) 7,08 (td, J=7,35, 1,47 Hz, 1H) 7,27 (m, 2H) 7,36 (dt, J=7,72, 1,29 Hz, 1H) 7,57 (m, 3H) 7,96 (d, J=8,82 Hz, 1H) 8.10 (dd, J=8,09, 1,47 Hz, 1H) 16,51 (s, 1H).A mixture of the product of Example 354 (38 mg, 0.086 mmol) and 3-aminobenzoic acid (13 mg, 0.094 mmol) in polyphosphoric acid (1 mL) was heated at 190 ° C for 1 hour. The solution was cooled to 25 ° C, triturated with water and 10% sodium carbonate solution. The solid was filtered, dried and flash column purified, eluting with 2% methanol in dichloromethane to give the title compound (15 mg, 38%). The sodium salt was produced by the procedure of Example 1D. MS (ESI +) m / z 543 (M-H) &quot;. 1 H NMR (300 MHz, DMSO-d 6) δ 1.04 (d, J = 6.62 Hz, 6H) 1.86 (m, 1H) 2.56 (m, 2H) 5.53 (s, 2H) (Td, J = 7.35, 1, J = 8.09, 2.21, 1.10 Hz, 1 H) (Dt, J = 7.72, 1.29 Hz, 1 H) 7.57 (m, 3 H) 7.96 (d, J = 8, 82 Hz, 1 H) 8.10 (dd, J = 8.09, 1.47 Hz, 1 H) 16.51 (s, 1H).

Exemplo 369 3-[8-(aminometil)-1,l-dioxido-4H-[1,3]oxazolo[5, 4-h] [1,2,4]-benzotiadiazin-3-il]-4-hidroxi-l-(isobutilamino)quinolin-2(1H)-onaExample 369 3- [8- (Aminomethyl) -1,1-dioxido-4H- [1,3] oxazolo [5,4-h] [1,2,4] -benzothiadiazin-3-yl] -4-hydroxy (1-isobutylamino) quinolin-2 (1H) -one

Uma solução do produto do Exemplo 357 (32 mg, 0,063 mmol) em tetra-hidrofurano (2 mL) foi tratada com amoníaco a 20% em metanol (1 mL) e hidróxido de amónio (1 mL) e uma solução de hidróxido de sódio 1M (0,063 mL, 0,063 mmol) a temperatura ambiente durante 16 horas. A mistura foi soprada com azoto quente e o resíduo resultante foi repartido entre água e acetato de etilo. A fase orgânica foi concentrada e purificada por cromatografia instantânea, eluindo com um gradiente de 364 ΕΡ 1 560 827/ΡΤ 100% de diclorometano para 2% de metanol em diclorometano, para gerar o composto em título (4 mg, 13%). MS (ESI-) m/z 481 (M-H) “. XH RMN (300 MHz, DMSO-d6) δ 1,04 (d, J=6,62 Hz, 6H) 1,91 (m, 1H) 2,75 (m, 2H) 4,55 (s, 2H) 6,33 (m, 1H) 6,98 (d, J=7, 72 Hz, 1H) 7,16 (d, J=8,46 Hz, 1H) 7,44 (m, 1H) 7,92 (m, 2H) 8,17 (d, J=8,09 Hz, 1H) 13,65 (s, 1H) 15,60 (s, 1H) .A solution of the product of Example 357 (32 mg, 0.063 mmol) in tetrahydrofuran (2 mL) was treated with 20% ammonia in methanol (1 mL) and ammonium hydroxide (1 mL) and a solution of sodium hydroxide 1M (0.063 mL, 0.063 mmol) at room temperature for 16 hours. The mixture was blown with hot nitrogen and the resulting residue was partitioned between water and ethyl acetate. The organic phase was concentrated and purified by flash chromatography, eluting with a gradient of 364 æg -1 560 827 / ΡΤ 100% dichloromethane to 2% methanol in dichloromethane to give the title compound (4 mg, 13%). MS (ESI-) m / z 481 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ 1.04 (d, J = 6.62 Hz, 6H) 1.91 (m, 1H) 2.75 (m, 2H) 4.55 (s, 2H) J = 7.72 Hz, 1 H) 7.16 (d, J = 8.46 Hz, 1 H) 7.44 (m, 1 H) 7.92 (m, m, 2 H) 8.17 (d, J = 8.09 Hz, 1 H) 13.65 (s, 1 H) 15.60 (s, 1H).

Exemplo 370 4-hidroxi-3-[8-(hidroximetil)-1,l-dioxido-4H-[1,3]oxazolo-[5,4-h][1,2,4]benzotiadiazin-3-il]-1-(isobutilamino)quinolin-2(1H)-onaExample 370 4-Hydroxy-3- [8- (hydroxymethyl) -1,1-dioxido-4 H - [1,3] oxazolo [5,4- h] [1,2,4] benzothiadiazin-3-yl] -1- (isobutylamino) quinolin-2 (1H) -one

Uma solução do produto do Exemplo 357 (32 mg, 0,063 mmol) em tetra-hidrofurano (2 mL) foi tratada com amoníaco a 20% em metanol (1 mL) e hidróxido de amónio (1 mL) e uma solução de hidróxido de sódio 1M (0,063 mL, 0,063 mmol) a temperatura ambiente durante 16 horas. A mistura foi soprada com azoto quente e o resíduo resultante foi repartido entre água e acetato de etilo. A fase aquosa foi ajustada a pH 1 com ácido clorídrico 1M e extraída com acetato de etilo. A fase orgânica foi concentrada sob pressão reduzida para gerar o composto em título (5 mg, 16%). MS (ESI') m/z 482 (M-H)'. XH RMN (300 MHz, DMSO-d6) δ 1,04 (d, J=6,62 Hz, 6H) 1,91 (m, 1H) 2,76 (m, 2H) 4,82 (s, 2H) 6,34 (d, J=8,82 Hz, 1H) 7,31 (d, J=8,82 Hz, 1H) 7,43 (m, 2H) 7,92 (m, 2H) 8,18 (d, J=7,72 Hz, 1H) 9,04 (s, 1H) 14,31 (s, 1H).A solution of the product of Example 357 (32 mg, 0.063 mmol) in tetrahydrofuran (2 mL) was treated with 20% ammonia in methanol (1 mL) and ammonium hydroxide (1 mL) and a solution of sodium hydroxide 1M (0.063 mL, 0.063 mmol) at room temperature for 16 hours. The mixture was blown with hot nitrogen and the resulting residue was partitioned between water and ethyl acetate. The aqueous phase was adjusted to pH 1 with 1M hydrochloric acid and extracted with ethyl acetate. The organic phase was concentrated under reduced pressure to give the title compound (5 mg, 16%). MS (ESI +) m / z 482 (M-H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 1.04 (d, J = 6.62 Hz, 6H) 1.91 (m, 1H) 2.76 (m, 2H) 4.82 (s, 2H) J = 8.82 Hz, 1 H) 7.43 (m, 2 H) 7.92 (m, 2 H) 8.18 (d, d, J = 7.72 Hz, 1 H) 9.04 (s, 1 H) 14.31 (s, 1 H).

Exemplo 371 3—{8—[(butilamino)metil]-1,l-dioxido-4H-[1,3]oxazolo[5,4-h]-[1,2,4]benzotiadiazin-3-il}-4-hidroxi-l-(isobutilamino)-quinolin-2(1H)-onaExample 371 3- {8 - [(Butylamino) methyl] -1,1-dioxido-4 H - [1,3] oxazolo [5,4- h] - [1,2,4] benzothiadiazin-3-yl} - 4-hydroxy-1- (isobutylamino) -quinolin-2 (1H) -one

Uma solução do produto do Exemplo 357 (15,5 mg, 0,031 mmol) em piridina (2 mL) foi tratada com n-butilamina (0,030 mL, 0,31 mmol) a temperatura ambiente durante 4 horas. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% a 100% de acetonitrilo:ácido trifluoroacético aquoso a 0,1% para gerar o composto em título (1,2 mg, 7,2%). MS (ESI') m/z 537 (M-H)'. XH RMN (300 MHz, DMSO-de) δ 0,91 (t, J=7,35 Hz, 3H) 1,04 (d, J=6,62 Hz, 6H) 365 ΕΡ 1 560 827/ΡΤ 1,36 (m, 2Η) 1,64 (m, 2Η) 1,87 (m, 1H) 2,66 (m, 2H) 3,05 (m, 2H) 4,62 (s, 2H) 5,96 (t, J=7,54 Hz, 1H) 7,10 (t, J=,80 Hz, 1H) 7,39 (d, J=9,19 Hz, 1H) 7,59 (m, 2H) 8,02 (d, J=8,82 Hz, 1H) 8,09 (d, J=8,09 Hz, 1H) 16,54 (s, 1H).A solution of the product of Example 357 (15.5 mg, 0.031 mmol) in pyridine (2 mL) was treated with n-butylamine (0.030 mL, 0.31 mmol) at room temperature for 4 hours. The solvent was removed under a stream of hot nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient of 10% to 100% acetonitrile: trifluoroacetic acid to give the title compound (1.2 mg, 7.2%). MS (ESI +) m / z 537 (M-H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 0.91 (t, J = 7.35 Hz, 3H) 1.04 (d, J = 6.62 Hz, 6H) 36 (m, 2) 1.64 (m, 2) 1.87 (m, 1 H) 2.66 (m, 2 H) 3.05 (m, 2 H) 4.62 (s, 2 H) 5.96 ( (d, J = 7.54 Hz, 1 H) 7.10 (t, J =, 80 Hz, 1 H) 7.39 (d, (D, J = 8.82 Hz, 1 H) 8.09 (d, J = 8.09 Hz, 1 H) 16.54 (s, 1H).

Exemplo 372 RZ N-{3- [4-hidroxi-l- (3-metilbutil) -2-oxo-l, 2-di-hidro-l, 8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}acetamidaExample 372 Rz N- {3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1- 4H-1,2,4-benzothiadiazin-7-yl} acetamide

Ao produto do Exemplo 205 (0,020 g, 0,047 mmol) em piridina (0,5 mL) juntou-se anidrido acético (0,057 g, 0,0053 mL, 0,056 mmol). A mistura reaccional foi aquecida num reactor de microondas a 100°C durante 30 minutos. A reacção foi vertida em 30 mL de água. O sólido foi recolhido por filtração para gerar o composto em titulo (15,8 mg, 72%). 1K RMN (300 MHz, DMSO-d6) δ 0,98 (d, J=6,62 Hz, 6H) 1,57 (m, 2H) 1,70 (m, 1H) 2,10 (s, 3H) 4,48 (m, 2H) 7,48 (dd, J=8,09, 4,78 Hz, 1H) 7,66 (d, J=8,82 Hz, 1H) 7,78 (m, 1H) 8,30 (d, J=l,84 Hz, 1H) 8,55 (dd, J=7,72, 1,84 Hz, 1H) 8,87 (dd, J=4,60, 1,65 Hz, 1H) 10,39 (s, 1H) 14,21 (br s, 1H), MS (ESI&quot;) m/z 468 (M-H)&quot;.To the product of Example 205 (0.020 g, 0.047 mmol) in pyridine (0.5 mL) was added acetic anhydride (0.057 g, 0.0053 mL, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100 ° C for 30 minutes. The reaction was poured into 30 mL of water. The solid was collected by filtration to give the title compound (15.8 mg, 72%). 1 H NMR (300 MHz, DMSO-d 6) δ0.98 (d, J = 6.62 Hz, 6H) 1.57 (m, 2H) 1.70 (m, 1H) 2.10 (s, 3H) 7.48 (m, 1H) 7.66 (d, J = 8.82 Hz, 1 H) 7.78 (m, 2 H) 7.48 (dd, 8.30 (d, J = 1.84 Hz, 1 H) 8.55 (dd, J = 7.72, 1.84 Hz, 1 H) 8.87 (dd, J = 4.60, 1.65 Hz , 1H), 10.39 (s, 1H), 14.21 (br s, 1H), MS (ESI &quot;) m / z 468 (MH) &quot;.

Exemplo 373 2.2.2- trifluoro-N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo- 1.2- di-hidro-l,8-naftiridin-3-il]-1,l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il}acetamida A uma lama do produto do Exemplo 205 (0,043 g, 0,1 mmol) em 5 ml de clorofórmio juntou-se gota a gota anidrido trifluoroacético (0,074 g, 0,35 mmol). A mistura reaccional foi agitada durante 30 minutos e repartida entre acetato de etilo e água. A fase de acetato de etilo foi lavada com salmoura, seca sobre sulfato de sódio, filtrada e concentrada sob pressão reduzida para gerar o composto em titulo (0,048 g, 92% de rendimento). MS (ESI&quot;) m/z 522 (M-H)&quot;. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. ^ RMN (300 MHz, DMSO-d6) δ 0,96 (d, J=6,62 Hz, 6H) 1,48 (m, 2H) 1,65 (m, 1H) 4,30 (m, 2H) 7,14 (dd, J=7, 54, 4, 60 Hz, 1H) 7,35 (d, J=8,82 Hz, 1H) 7,83 (dd, J=8,82, 2,57 Hz, 1H) 8,07 (d, J=2,57 Hz, 1H) 8,37 (dd, J=7,72, 1,84 Hz, 1H) 8,54 (dd, J=4, 78, 1, 84 Hz, 1H) 11,43 (s, 1H) 16,09 (s, 1H). 366 ΕΡ 1 560 827/ΡΤExample 373 2,2,2-trifluoro-N- {3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1 To a slurry of the product of Example 205 (0.043 g, 0.1 mmol) in 5 mL of chloroform was added dropwise trifluoroacetic anhydride (0.074 g) in dichloromethane g, 0.35 mmol). The reaction mixture was stirred for 30 minutes and partitioned between ethyl acetate and water. The ethyl acetate layer was washed with brine, dried over sodium sulfate, filtered and concentrated under reduced pressure to give the title compound (0.048 g, 92% yield). MS (ESI &quot;) m / z 522 (M-H) &quot;. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) 1.65 (m, 1H) 4.30 (m, 2H) 7.14 (dd, J = 7, 54, 4.60 Hz, 1 H) 7.35 (d, J = 8.82 Hz, 1 H) 7.83 (dd, J = 8.82, 2.57 Hz 1H), 8.07 (d, J = 2.57 Hz, 1 H), 8.37 (dd, J = 7.72, 1.84 Hz, 1 H) 8.54 (dd, J = , 84 Hz, 1 H) 11.43 (s, 1 H) 16.09 (s, 1H). 366 ΕΡ 1 560 827 / ΡΤ

Exemplo 374 2,2,2-trifluoro-N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-1, 8-naftiridin-3-il]-8-nitro-l,l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il}acetamida A uma solução de ácido trifluoroacético (2,5 mL) e anidrido trifluoroacético (2,5 mL) a 0°C juntou-se em porções o produto do Exemplo 205 (0,5 g, 1,17 mmol) . A resultante solução vermelha foi agitada a 0°C durante 30 minutos, arrefecida até -20°C e tratada em porções com nitrato de potássio (0,13 g, 1,3 mmol). A mistura foi agitada a -20°C durante 1 hora, vertida sobre gelo e o resultante sólido bege foi recolhido por filtração, lavado com água e seco até peso constante para gerar o composto em titulo (0,628 g, 94% de rendimento). MS (ESI-) m/z 567 (M-H)“. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. RMN (300 MHz, DMSO-d6) δ 0,96 (d, J=6,62 Hz, 6H) 1,49 (m, 2H) 1,64 (m, 1H) 4,30 (m, 2H) 7,16 (dd, 0=1,12, 4,78 Hz, 1H) 7,67 (m, 2H) 8,38 (dd, J=7,54, 2,02 Hz, 1H) 8,57 (dd, J=4,41,1,84 Hz, 1H) 11,61 (s, 1H) 16,67 (s, 1H).Example 374 2,2,2-trifluoro-N- {3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -8-nitro-1,1-dioxido-4 H -1,2,4-benzothiadiazin-7-yl} acetamide To a solution of trifluoroacetic acid (2.5 mL) and trifluoroacetic anhydride (2.5 mL) at 0 ° The product of Example 205 (0.5 g, 1.17 mmol) was added portionwise. The resulting red solution was stirred at 0 ° C for 30 minutes, cooled to -20 ° C and treated portionwise with potassium nitrate (0.13 g, 1.3 mmol). The mixture was stirred at -20 ° C for 1 hour, poured onto ice and the resulting beige solid was collected by filtration, washed with water and dried to constant weight to give the title compound (0.628 g, 94% yield). MS (ESI-) m / z 567 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ0.96 (d, J = 6.62 Hz, 6H) 1.49 (m, 2H) 1.64 (m, 1H) 4.30 (m, 2H) 7 , 16 (dd, J = 1.12, 4.78 Hz, 1 H) 7.67 (m, 2 H) 8.38 (dd, J = 7.54, 2.02 Hz, , J = 4.41,1.84 Hz, 1 H) 11.61 (s, 1 H) 16.67 (s, 1H).

Exemplo 375 3-[1,l-dioxido-8-(trifluorometil)-4,7-di-hidroimidazo[4,5-h]-[1,2,4]benzotiadiazin-3-il]-4-hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-onaExample 375 3- [1,1-dioxido-8- (trifluoromethyl) -4,7-dihydroimidazo [4,5- h] - [1,2,4] benzothiadiazin-3-yl] -4-hydroxy- 1- (3-methylbutyl) -1,8-naphthyridin-2 (1H) -one

Uma mistura do produto do Exemplo 374 (0, 043 g, 0,075 mmol) e ferro em pó (0,025 g, 0,45 mmol) em ácido acético (2 mL) foi aquecida a 80°C durante 1 hora, arrefecida, diluída com 20 mL de acetato de etilo e filtrada através de uma rolha de Celite®. O filtrado de acetato de etilo foi lavado com água, salmoura, seco sobre sulfato de sódio, filtrado e concentrado para gerar o composto em título como um sólido laranja (0,035 g, 90% de rendimento). MS (ESI~) m/z 519 (M-H)~. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 0,97 (d, J=6,25 Hz, 6H) 1,48 (m, 2H) 1,66 (m, 1H) 4,31 (m, 2H) 7,14 (m, 1H) 7,25 (d, J=8,46 Hz, 1H) 7,96 (d, J=9,19 Hz, 1H) 8,38 (d, J=6,99 Hz, 1H) 8,54 (m, 1H), 14,46 (s, 1H) 16,33 (S, 1H). 367 ΕΡ 1 560 827/ΡΤA mixture of the product of Example 374 (0.043 g, 0.075 mmol) and iron powder (0.025 g, 0.45 mmol) in acetic acid (2 mL) was heated at 80 ° C for 1 hour, cooled, diluted with 20 mL of ethyl acetate and filtered through a plug of Celite®. The ethyl acetate filtrate was washed with water, brine, dried over sodium sulfate, filtered and concentrated to give the title compound as an orange solid (0.035 g, 90% yield). MS (ESI +) m / z 519 (M-H) -. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (d, J = 6.25 Hz, 6H) 1.48 (m, 2H) 1.66 (m, 1H) 4.31 (m, 2H) 7.14 (m, 1H) 7.25 (d, J = 8.46 Hz, 1 H) 7.96 (d, J = 9.19 Hz, 1 H) 8.38 (d, J = 6.99 Hz , 1H), 8.54 (m, 1H), 14.46 (s, 1H) 16.33 (s, 1H). 367 ΕΡ 1 560 827 / ΡΤ

Exemplo 376 3- (7-amino-8-nitro-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)- 4- hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-onaExample 376 3- (7-Amino-8-nitro-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-methylbutyl) -1,8- naphthyridin-2 (1H) -one

Uma mistura do produto do Exemplo 374 (0,500 g, 0,88 mmol) e carbonato de potássio (1,4 g, 10,1 mmol) em metanol (20 mL), tetra-hidrofurano (8 mL) e água (8 mL) foi aquecida a 60°C durante 4 horas, arrefecida e concentrada. O residuo resultante foi dissolvido em acetato de etilo, tratado com ácido clorídrico 1M a um pH de cerca de 1, lavado com salmoura, seco sobre sulfato de sódio, filtrado e concentrado para gerar o composto em titulo como um sólido castanho (0,4 g, 96% de rendimento). MS (ESI-) m/z 471 (M-H)“. O sal de sódio do composto em titulo foi preparado de acordo com o procedimento do Exemplo 1D. 1H RMN (300 MHz, DMSO-de) δ 0,96 (d, J=6,62 Hz, 6H) 1,45 (m, 2H) 1,64 (m, 1H) 4,28 (m, 2H) 6,37 (s, 2H) 7,13 (dd, J=7,17, 4,23 Hz, 1H) 7,16 (d, J=9,19 Hz, 1H) 7,33 (d, J=9,19 Hz, 1H) 8,35 (dd, J=7, 72, 1, 84 Hz, 1H) 8,53 (dd, J=4, 78, 1, 84 Hz, 1H) 16,02 (s, 1H) .A mixture of the product of Example 374 (0.500 g, 0.88 mmol) and potassium carbonate (1.4 g, 10.1 mmol) in methanol (20 mL), tetrahydrofuran (8 mL) and water (8 mL) ) was heated at 60 ° C for 4 hours, cooled and concentrated. The resulting residue was dissolved in ethyl acetate, treated with 1M hydrochloric acid at a pH of about 1, washed with brine, dried over sodium sulfate, filtered and concentrated to give the title compound as a brown solid (0.4 g, 96% yield). MS (ESI-) m / z 471 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.96 (d, J = 6.62 Hz, 6H) 1.45 (m, 2H) 1.64 (m, 1H) 4.28 (m, 2H) J = 7.17, 4.23 Hz, 1 H) 7.16 (d, J = 9.19 Hz, 1 H) 7.33 (d, J = 9.19 Hz, 1 H) 8.35 (dd, J = 7.72, 1.84 Hz, 1 H) 8.53 (dd, J = 4.78, 1.84 Hz, 1 H) 16.02 (s , 1H).

Exemplo 377 3- (7,8-diamino-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)- 4- hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-onaExample 377 3- (7,8-diamino-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1- (3-methylbutyl) -1,8-naphthyridin- 2 (1H) -one

Uma mistura do produto do Exemplo 376 (2,1 g, 4,45 mmol), ferro em pó (1,24 g, 22,25 mmol) e cloreto de amónio (0,29 g, 5,3 mmol) em metanol (50 mL), tetra-hidrofurano (50 mL) e água (20 mL) foi aquecida a 75°C durante 6 horas, arrefecida e filtrada através de uma rolha de Celite®. O filtrado foi tratado com ácido clorídrico 1M a um pH de cerca de 2 e a solução foi concentrada sob vácuo. O resíduo resultante foi agitado em 100 mL de água durante 30 minutos e filtrado para recolher um sólido que foi depois triturado com 50 mL de éter dietílico, filtrado e seco para gerar o composto em título (1,72 g, 87% de rendimento). MS (ESI”) m/z 441 (M-H)”. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. ΧΗ RMN (300 MHz, DMSO-d6) δ 0,96 (d, J=6,62 Hz, 6H) 1,49 (m, 2H) 1,63 (m, 1H) 4,28 (m, 2H) 4,63 (s, 2H) 5,20 (s, 2H) 6,30 (d, J=8,09 Hz, 1H) 6,74 (d, J=8, 46 Hz, 1H) 7,10 (dd, J=7,72, 4,78 Hz, 1H) 8,34 (dd, J=7,72, 1,84 Hz, 1H) 8,50 (dd, J=4,60, 2,02 Hz, 1H) 15,41 (s, 1H). 368 ΕΡ 1 560 827/ΡΤA mixture of the product of Example 376 (2.1 g, 4.45 mmol), iron powder (1.24 g, 22.25 mmol) and ammonium chloride (0.29 g, 5.3 mmol) in methanol (50 mL), tetrahydrofuran (50 mL) and water (20 mL) was heated at 75 ° C for 6 hours, cooled and filtered through a plug of Celite®. The filtrate was treated with 1M hydrochloric acid at a pH of about 2 and the solution was concentrated under vacuum. The resulting residue was stirred in 100 mL of water for 30 minutes and filtered to collect a solid which was then triturated with 50 mL of diethyl ether, filtered and dried to give the title compound (1.72 g, 87% yield) . MS (ESI ") m / z 441 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. NMR (300 MHz, DMSO-d 6) δ 0.96 (d, J = 6.62 Hz, 6H) 1.49 (m, 2H) 1.63 (m, 1H) 4.28 (m, 2H) 4.63 (s, 2H) 5.20 (s, 2H) 6.30 (d, J = 8.09 Hz, 1 H) 6.74 (d, J = 8.46 Hz, dd, J = 7.72, 4.78 Hz, 1 H) 8.34 (dd, J = 7.72, 1.84 Hz, 1 H) 8.50 (dd, J = 4.60, 2.02 Hz , 1H) 15.41 (s, 1H). 368 ΕΡ 1 560 827 / ΡΤ

Exemplo 378 4-hidroxi-3-(8-hidroxi-l,l-dioxido-4,7-di-hidroimidazo[4,5-h]-[1,2,4]benzotiadiazin-3-il)-1-(3-metilbutll)-1,8-naftiridin-2(1H)-onaExample 378 4-Hydroxy-3- (8-hydroxy-1,1-dioxido-4,7-dihydroimidazo [4,5- h] - [1,2,4] benzothiadiazin-3-yl) -1- (3-methylbutyl) -1,8-naphthyridin-2 (1H) -one

Uma mistura do produto do Exemplo 377 (0, 022 g, 0,05A mixture of the product of Example 377 (0.022 g, 0.05

mmol) e ureia (0,012 g, 0,2 mmol) em N,N-dimetilacetamida (0,5 mL) num tubo selado foi aquecida por microondas a 180 °C durante 60 minutos. A mistura foi arrefecida e repartida entre acetato de etilo e água ajustada a pH 3 com ácido clorídrico 1M. A fase de acetato de etilo foi lavada com água, salmoura, seca sobre sulfato de sódio, filtrada e concentrada. O resíduo foi cromatografado em sílica gel eluindo primeiro com diclorometano e depois com diclorometano/metanol 96:4 para gerar o composto em título (0,022 g, 90% de rendimento). MS (ESI-) m/z 467 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 0,97 (d, J=6,62 Hz, 6H) 1,49 (m, 2H) 1,65 (m, 1H) 4,29 (m, 2H) 6,69 (br, s, 1H) 7,00 (br, s,, 1H) 7,12 (dd, J=7, 72, 4, 78 Hz, 1H) 8,36 (m, 1H) 8,51 (dd, J=4,41, 1,84 Hz, 1H) 10,66 (s, 1H) 15,76 (s, 1H) .mmol) and urea (0.012 g, 0.2 mmol) in N, N-dimethylacetamide (0.5 mL) in a sealed tube was heated by microwave at 180 ° C for 60 minutes. The mixture was cooled and partitioned between ethyl acetate and water adjusted to pH 3 with 1M hydrochloric acid. The ethyl acetate layer was washed with water, brine, dried over sodium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting first with dichloromethane and then with dichloromethane / methanol 96: 4 to give the title compound (0.022 g, 90% yield). MS (ESI-) m / z 467 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (d, J = 6.62 Hz, 6H) 1.49 (m, 2H) 1.65 (m, 1H) 4.29 (m, 2H) 1H NMR (DMSO-d6): Î'6.69 (br s, 1H), 7.00 (br, s, 51 (dd, J = 4.41, 1.84 Hz, 1 H) 10.66 (s, 1 H) 15.76 (s, 1H).

Exemplo 379 4-hidroxi-l-(3-metilbutil)-3-(8-metil-l,1-dioxido- 4.7- di-hidro-imidazo[4,5-h][1,2,4]benzotiadiazin-3-il)- 1.8- naftiridin-2(1H)-onaExample 379 4-Hydroxy-1- (3-methylbutyl) -3- (8-methyl-1,1-dioxido-4,7-dihydroimidazo [4,5- h] [1,2,4] benzothiadiazin- 3-yl) -1,8-naphthyridin-2 (1H) -one

Uma mistura do produto do Exemplo 377 (0, 022 g, 0,05 mmol) e ácido acético (1 mL) num tubo selado foi aquecida por microondas a 160°C durante 30 minutos, arrefecida e filtrada para recolher um sólido que foi depois lavado repetidamente com éter dietílico e seco para gerar o composto em título como um sólido bege (0,006 g; 26% de rendimento). MS (ESI”) m/z 465 (M-H)”. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-de) δ 0,97 (d, J=6,62 Hz, 6H) 1,48 (m, 2H) 1,64 (m, 1H) 2,47 (s, 3H) 4,31 (m, 2H) 6,98 (d, J=8,46 Hz, 1H) 7,13 (dd, J=7,54, 4,96 Hz, 1H) 7,67 (d, J=8,46 Hz, 1H) 8,38 (dd, J=7,54, 2,02 Hz, 1H) 8,53 (dd, J=4,60, 1, 65 Hz, 1H) 12,57 (s, 1H) 16,04 (s, 1H). 369 ΕΡ 1 560 827/ΡΤA mixture of the product of Example 377 (0.022 g, 0.05 mmol) and acetic acid (1 mL) in a sealed tube was heated by microwave at 160 ° C for 30 minutes, cooled and filtered to collect a solid which was then washed repeatedly with diethyl ether and dried to give the title compound as a beige solid (0.006 g, 26% yield). MS (ESI ") m / z 465 (M-H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.97 (d, J = 6.62 Hz, 6 H) 1.48 (m, 2 H) 1.64 (m, (D, J = 8.46 Hz, 1 H) 7.13 (dd, J = 7.54, 4.96 Hz, 1 H) 7.67 (d, J = 8.46 Hz, 1 H) 8.38 (dd, J = 7.54, 2.02 Hz, 1 H) 8.53 (dd, J = 4.60, 1.65 Hz, 1 H) 12.57 (s , 1H) 16.04 (s, 1H). 369 ΕΡ 1 560 827 / ΡΤ

Exemplo 380 3-[1,l-dioxido-8-(pentafluoroetil)-4,7-di-hidroimidazo[4, 5-h]-[1,2,4]benzotiadlazin-3-11]-4-hldroxl-l-(3-metilbutil)-1,8-naftiridin-2(1H)-onaExample 380 3- [1,1-dioxido-8- (pentafluoroethyl) -4,7-dihydroimidazo [4,5- h] - [1,2,4] benzothiazol-3-11] -4-hydroxl- 1- (3-methylbutyl) -1,8-naphthyridin-2 (1H) -one

Uma mistura do produto do Exemplo 377 (0,022 g, 0,05 mmol) e ácido pentafluoropropiónico (0,5 mL) num tubo selado foi aquecida por microondas a 130°C durante 30 minutos, arrefecida e concentrada sob pressão reduzida. O material em bruto foi cromatografado em sílica eluindo primeiro com diclorometano e depois em diclorometano/metanol 99:1 para gerar o composto em título (0,011 g, 38% de rendimento). MS (ESI~) m/z 569 (M-H)“. O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-dê) δ 0. 98 (d, J=6,25 Hz, 6H) 1,52 (m, 2H) 1,69 (m, 1H) 4,37 (m, 2H) 7,30 (m, 2H) 7,97 (m, 1H) 8,54 (m, 2H) 14,65 (m, 1H) .A mixture of the product of Example 377 (0.022 g, 0.05 mmol) and pentafluoropropionic acid (0.5 mL) in a sealed tube was heated by microwave at 130 ° C for 30 minutes, cooled and concentrated under reduced pressure. The crude material was chromatographed on silica eluting first with dichloromethane and then in dichloromethane / methanol 99: 1 to give the title compound (0.011 g, 38% yield). MS (ESI) m / z 569 (M-H) +. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.98 (d, J = 6.25 Hz, 6H) 1.52 (m, 2H) 1.69 (m, 1H) 4.37 (m, 2H) 7.30 (m, 2 H) 7.97 (m, 1 H) 8.54 (m, 2 H) 14.65 (m, 1 H).

Exemplo 381 1-[(ciclopropilmetil)amino]-4-hidroxi-3-(7-hidroxi-8-nitro- 1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-3-il) guinolin-2 (1H) -onaExample 381 1 - [(cyclopropylmethyl) amino] -4-hydroxy-3- (7-hydroxy-8-nitro-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) guinolin-2- 1H) -one

Uma solução do produto do Exemplo 320C (47 mg, 0,11 mmol) em ácido sulfúrico concentrado (2 mL) a 0°C foi tratada com nitrato de amónio (10 mg, 0,13 mmol). Após agitação a temperatura ambiente durante 25 minutos, a solução foi vertida em água gelada e o precipitado foi filtrado, seco e purificado por cromatografia instantânea, eluindo com 2% de metanol em diclorometano para gerar o composto em título (10 mg, 19%). MS (ESI-) m/z 470 (M-H) “. ΧΗ RMN (300 MHz, DMSO-d6) δ 0,14 (d, J=4,04 Hz, 2H) 0,41 (m, 2H) 1,01 (m, 1H) 2,84 (d, J=6,99 Hz, 2H) 7,44 (m, 2H) 7,77 (d, J=9,56 Hz, 1H) 7,88 (t, J=7,91 Hz, 1H) 8,08 (d, J=8,46 Hz, 1H) 8,16 (dd, J=8,09, 1,10 Hz, 1H) 11, 83 (s, 1H) .A solution of the product of Example 320C (47 mg, 0.11 mmol) in conc. Sulfuric acid (2 mL) at 0 ° C was treated with ammonium nitrate (10 mg, 0.13 mmol). After stirring at room temperature for 25 minutes, the solution was poured into ice water and the precipitate was filtered, dried and purified by flash chromatography, eluting with 2% methanol in dichloromethane to give the title compound (10 mg, 19%). . MS (ESI-) m / z 470 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ 0.14 (d, J = 4.04 Hz, 2 H) 0.41 (m, 2 H) 1.01 (m, 6.99 Hz, 2 H) 7.44 (m, 2 H) 7.77 (d, J = 9.56 Hz, 1 H) 7.88 (t, J = 7.91 Hz, 1 H) 8.08 (d , J = 8.46 Hz, 1 H) 8.16 (dd, J = 8.09, 1.10 Hz, 1 H) 11.83 (s, 1H).

Exemplo 382 3— (7—{2—[(35)-3-aminopirrolidin-l-il]-2-oxoetoxi}—1,1-dioxido-4H-1, 2,4-benzotiadiazin-3-il)-1-[(ciclopropilmetil)amino]- 4- hidroxiquinolin-2(1H)-ona A uma mistura do produto do Exemplo 384, cloridrato de 1-[3-(dimetilamino)propil]-3-etilcarbodiimida e 1-hidroxi-benzotriazole em N,N-dimetilformamida junta-se éster tert- 370 ΕΡ 1 560 827/ΡΤ butílico de ácido pirrolidin-3(S)-il-carbâmico. A mistura é agitada durante 1 dia. A solução é vertida em acetato de etilo e lavada com bicarbonato de sódio saturado, água, salmoura e seca com sulfato de magnésio. O solvente é removido sob vácuo. 0 resíduo é triturado com metanol/água e filtrado. O sólido é adicionado a ácido clorídrico (1M em dioxano, 2 mL) e agitado de um dia para o outro, filtrado e lavado com acetato de etilo/hexano (1:1) para gerar o composto em título.Example 382 3- (7- {2 - [(3,5) -3-Aminopyrrolidin-1-yl] -2-oxoethoxy} -1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl) - 1 - [(cyclopropylmethyl) amino] -4-hydroxyquinolin-2 (1H) -one To a mixture of the product of Example 384, 1- [3- (dimethylamino) propyl] -3-ethylcarbodiimide hydrochloride and 1-hydroxybenzotriazole hydrochloride in N, N-dimethylformamide is added tert-butyl ester of pyrrolidin-3 (S) -yl-carbamic acid. The mixture is stirred for 1 day. The solution is poured into ethyl acetate and washed with saturated sodium bicarbonate, water, brine and dried with magnesium sulfate. The solvent is removed in vacuo. The residue is triturated with methanol / water and filtered. The solid is added to hydrochloric acid (1M in dioxane, 2mL) and stirred overnight, filtered and washed with ethyl acetate / hexane (1: 1) to give the title compound.

Exemplo 383 2-[(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l,l-dioxido-4H-l,2,4-benzotiadiazin-7-il)oxi]-N-etilacetamidaExample 383 2 - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-1,2 , 4-benzothiadiazin-7-yl) oxy] -N-ethylacetamide

Ao produto do Exemplo 384 (24 mg, 0,05 mmol), cloridrato de 1-[3-(dimetilamino)propil]-3-etilcarbodiimida (16 mg, 0,08 mmol) e 1-hidroxibenzotriazole (14 mg, 0,1 mmol) em N,N-dimetilformamida (2 mL) juntou-se etilamina (100 μΐ, 2M em tetra-hidrofurano, 0,2 mmol). A mistura foi agitada durante 1 dia. A solução foi vertida em acetato de etilo (40 mL) e lavada com bicarbonato de sódio aquoso saturado, água, salmoura e seca com sulfato de magnésio. O solvente foi removido sob pressão reduzida. O resíduo foi triturado com metanol/água e filtrado para gerar o composto em título (6 mg, 24%). XH RMN (500 MHz, DMSO-d6) δ 0,20 (m, 2H) 0,45 (m, 2H) 1,00 (m, 1H) 1,07 (t, J=7,08 Hz, 3H) 2,70 (s, 2H) 3,18 (m, 2H) 4,49 (s, 2H) 5,99 (s, br, 1H) 7,08 (s, br, 1H) 7,23 (s, br, 3H) 7,52 (s, br, 1H) 7,70 (s, br, 1H) 7,88 (s, br, 1H) 8,09 (d, J=7,81 Hz, 1H). MS (ESI) m/z 510 (M-H)“.To the product of Example 384 (24 mg, 0.05 mmol), 1- [3- (dimethylamino) propyl] -3-ethylcarbodiimide hydrochloride (16 mg, 0.08 mmol) and 1-hydroxybenzotriazole hydrochloride (14 mg, 1 mmol) in N, N-dimethylformamide (2 mL) was added ethylamine (100 μM, 2M in tetrahydrofuran, 0.2 mmol). The mixture was stirred for 1 day. The solution was poured into ethyl acetate (40 mL) and washed with saturated aqueous sodium bicarbonate, water, brine and dried over magnesium sulfate. The solvent was removed under reduced pressure. The residue was triturated with methanol / water and filtered to give the title compound (6 mg, 24%). 1 H NMR (500 MHz, DMSO-d 6) δ 0.20 (m, 2H) 0.45 (m, 2H) 1.00 (m, 1H) 1.07 (t, J = 7.08 Hz, 3H) 2H), 4.99 (s, 2H), 5.99 (s, br, 1H), 7.08 (s, br, 1H), 7.23 (s, br, 1H), 7.88 (s, br, 1H), 8.08 (s, br, 1H), 8.09 (d, J = 7.81 Hz, 1H). MS (ESI) m / z 510 (M-H).

Exemplo 384AExample 384A

[(3 —{1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il}-1,l-dioxido-4#-l,2, 4-benzotiadiazin-7-il)oxi]acetato de tert-butilo O produto do Exemplo 320C (400 mg, 0,94 mmol) em N,N-dimetilformamida (10 mL) reagiu com bromoacetato de tert-butilo (0,555 mL, 3,76 mmol), carbonato de potássio (1,225 g, 3,76 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C de um dia para o outro. A mistura reaccional foi diluída com água e ajustada a pH 7 com ácido acético glacial. A reacção foi extraída com acetato de etilo e a fase orgânica foi lavada com 371 ΕΡ 1 560 827/ΡΤ bicarbonato de sódio aquoso, água e salmoura, seca sobre sulfato de magnésio anidro, filtrada e concentrada sob pressão reduzida. O resíduo resultante foi cromatografado em sílica gel eluindo com um gradiente de hexanos:acetato de etilo 3:1 para hexanos:acetato de etilo 1:1 para gerar o composto em título (195 mg, 38%).[(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4,11,12,14- benzothiadiazin-7-yl) oxy] acetate The product from Example 320C (400 mg, 0.94 mmol) in N, N-dimethylformamide (10 mL) was reacted with tert -butyl bromoacetate (0.555 mL, 76 mmol), potassium carbonate (1.225 g, 3.76 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C overnight. The reaction mixture was diluted with water and adjusted to pH 7 with glacial acetic acid. The reaction was extracted with ethyl acetate and the organic phase was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure. The resulting residue was chromatographed on silica gel eluting with a gradient of 3: 1 hexanes: ethyl acetate to 1: 1 hexanes: ethyl acetate to afford the title compound (195 mg, 38%).

Exemplo 384B ácido [(3 —{1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l,l-dioxido-4H-l,2,4-benzotiadiazin-7-il)oxi]acético O produto do Exemplo 384A (195 mg, 0,36 mmol) numa mistura de ácido trifluoroacético (5 mL) e diclorometano (5 mL) foi agitada durante três horas a 25°C. Os solventes foram removidos sob pressão reduzida. O resíduo foi triturado com hexanos/acetato de etilo (1:1) e filtrado para gerar o composto em título (114 mg, 65%). ΧΗ RMN (300 MHz, DMSO-d6) δ 0,14 (d, J=4,04 Hz, 2H) 0,41 (d, J=7,35 Hz, 2H) 1,02 (m, 1H) 2,86 (d, J=6,25 Hz, 2H) 4,88 (s, 2H) 6,44 (s, 1H) 7,39 (m, 3H) 7,67 (d, J=8,82 Hz, 1H) 7,89 (m, 1H) 8,10 (d, J=8,46 Hz, 1H) 8,17 (dd, J=1,47 Hz, J=6,62 Hz, 1H) 13,16 (s, 1H) 14,07 (s, 1H) 15,12 (s, 1H). MS (ESI-) m/z 483 (M-H)“.Example 384B [3- (1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H- 4-benzothiadiazin-7-yl) oxy] acetic acid The product from Example 384A (195 mg, 0.36 mmol) in a mixture of trifluoroacetic acid (5 mL) and dichloromethane (5 mL) was stirred for three hours at 25 ° C. The solvents were removed under reduced pressure. The residue was triturated with hexanes / ethyl acetate (1: 1) and filtered to give the title compound (114 mg, 65%). NMR (300 MHz, DMSO-d 6) δ 0.14 (d, J = 4.04 Hz, 2 H) 0.41 (d, J = 7.35 Hz, 2 H) 1.02 (m, 1 H) (D, J = 8.82 Hz, 4H), 6.88 (d, J = 6.25 Hz, 1H), 8.87 (dd, J = 1.47 Hz, J = 6.62 Hz, 1 H) 13, 16 (s, 1 H) 14.07 (s, 1 H) 15.12 (s, 1H). MS (ESI-) m / z 483 (M-H).

Exemplo 385 3- {7-[2-(3-aminopirrolidin-l-il)-2-oxoetoxi]-1,1-dioxido-4H-1,2,4-benzotiadiazin-3-il}-l-[(ciclopropilmetil)amino]- 4- hidroxiquinolin-2(1H)-onaExample 385 3- {7- [2- (3-Aminopyrrolidin-1-yl) -2-oxoethoxy] -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl} -1 - [( cyclopropylmethyl) amino] -4-hydroxyquinolin-2 (1H) -one

Ao produto do Exemplo 384B (24 mg, 0,05 mmol), cloridrato de 1-[3-(dimetilamino)propil]-3-etilcarbodiimida (16 mg, 0,08 mmol) e 1-hidroxibenzotriazole (14 mg, 0,1 mmol) em N,N-dimetilformamida (2 mL) juntou-se éster tert-butílico de ácido pirrolidin-3-il-carbâmico (19 mg, 0,1 mmol). A mistura foi agitada durante 1 dia. A solução foi vertida em acetato de etilo (40 mL) e lavada com bicarbonato de sódio aquoso saturado, água e salmoura, seca com sulfato de magnésio, filtrada e concentrada. O resíduo foi triturado com metanol/água e filtrado. O sólido foi tratado com ácido clorídrico (1M em dioxano, 2 mL) e agitado de um dia para o outro, filtrado e lavado com acetato de etilo/hexano (1:1) para gerar o composto em título (15 mg, 51%). 1H RMN (500 MHz, 372 ΕΡ 1 560 827/ΡΤ BENZENO-d6) δ 0,16 (m, 2Η) 0,43 (m, 2Η) 1,01 (m, 1H) 2,14 (m, 2H) 2,29 (m, 1H) 2,89 (d, J=6,84 Hz, 2H) 3,36 (m, 2H) 3,81 (m, 2H) 4,88 (m, 2H) 7,42 (m, 3H) 7,61 (m, 1H) 7,88 (m, 1H) 8,09 (d, J=8,30 Hz, 1H) 8,17 (d, J=8,30 Hz, 1H) 8,28 (s, 3H) 13,99 (S, 1H) . MS (ESI ) m/z 551 (M-H)”. 793695 Exemplo 386 DL2 3-(8-amino-7-hidroxi-l, l-dioxido-4H-l,2,4-benzotiadiazln-3-il)-1-[(ciclopropilmetil)amino]-4-hidroxiquinolin-2(1H)-onaTo the product of Example 384B (24 mg, 0.05 mmol), 1- [3- (dimethylamino) propyl] -3-ethylcarbodiimide hydrochloride (16 mg, 0.08 mmol) and 1-hydroxybenzotriazole (14 mg, 1 mmol) in N, N-dimethylformamide (2 mL) was added pyrrolidin-3-yl-carbamic acid tert-butyl ester (19 mg, 0.1 mmol). The mixture was stirred for 1 day. The solution was poured into ethyl acetate (40 mL) and washed with saturated aqueous sodium bicarbonate, water and brine, dried over magnesium sulfate, filtered and concentrated. The residue was triturated with methanol / water and filtered. The solid was treated with hydrochloric acid (1M in dioxane, 2mL) and stirred overnight, filtered and washed with ethyl acetate / hexane (1: 1) to give the title compound (15mg, 51% ). 1 H NMR (500 MHz, 372 ÅΡ 1 560 827 / ΡΤ BENZENO-d 6) δ 0.16 (m, 2 0) 0.43 (m, 2 1,0) 1.01 (m, 1H) 2.14 (m, 2H) 2H), 3.88 (m, 2H), 4.88 (m, 2H), 4.88 (m, 2H), 7.42 (m, 3H) 7.61 (m, 1 H) 7.88 (m, 1 H) 8.09 (d, J = 8.30 Hz, 1 H) 8.17 (d, J = 8.30 Hz, 1H ) 8.28 (s, 3H) 13.99 (s, 1H). MS (ESI) m / z 551 (M-H). Example 386 3- (8-Amino-7-hydroxy-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - [(cyclopropylmethyl) amino] -4-hydroxyquinolin-2 (1H) -one

Uma mistura do produto do Exemplo 381 (10 mg, 0,021 mmol), ferro em pó (5,9 mg, 0,105 mmol) e cloreto de amónio (1,3 mg, 0,024 mmol) em metanol:tetra-hidrofurano:água (2:2:1, 2 mL) foi aquecida a 60°C durante 1 hora. A solução foi filtrada através de Celite® e lavada com tetra-hidrofurano. A solução foi evaporada sob pressão reduzida e o resíduo foi triturado com acetato de etilo, filtrado e lavado com água e seco para gerar o composto em título (5 mg, 53%) . XH RMN (300 MHz, DMSO-de) δ 0,13 (d, J=3,68 Hz, 2H) 0,40 (d, J=7,72 Hz, 2H) 1,02 (m, 1H) 2,85 (d, J=5,52 Hz, 2H) 5,40 (s, 2H) 6,46 (s, 1H) 6,65 (d, J=8, 46 Hz, 1H) 7,00 (d, J=8,09 Hz, 1H) 7,45 (t, J=7,35 Hz, 1H) 7,89 (t, J=7,17 Hz, 1H) 8,10 (d, J=8,46 Hz, 1H) 8,17 (d, J=8,82 Hz, 1H) 10,13 (s, 1H) 13,82 (s, 1H) 15,17 (s, 1H). MS (ESI) m/z 440 (M-H)-.A mixture of the product of Example 381 (10 mg, 0.021 mmol), iron powder (5.9 mg, 0.105 mmol) and ammonium chloride (1.3 mg, 0.024 mmol) in methanol: tetrahydrofuran: water : 2: 1, 2mL) was heated at 60 ° C for 1 hour. The solution was filtered through Celite® and washed with tetrahydrofuran. The solution was evaporated under reduced pressure and the residue triturated with ethyl acetate, filtered and washed with water and dried to give the title compound (5 mg, 53%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.13 (d, J = 3.68 Hz, 2 H) 0.40 (d, J = 7.72 Hz, 2 H) 1.02 (m, 1 H) (D, J = 8.52 Hz, 2 H), 5.40 (s, 2 H), 6.46 (s, 1 H), 6.65 (D, J = 8.09 Hz, 1 H) 7.45 (t, J = 7.35 Hz, 1 H) 7.89 (t, J = 46 Hz, 1 H) 8.17 (d, J = 8.82 Hz, 1 H) 10.13 (s, 1 H) 13.82 (s, 1 H) 15.17 (s, 1H). MS (ESI) m / z 440 (M-H) -.

Exemplo 387A 2-[(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-8-nitro-l,l-dioxido-4H-l, 2,4-benzo-tiadiazin-7-il)oxi]acetamida O produto do Exemplo 381 (20 mg, 0, 042 mmol) em N,N-dimetilformamida (2 mL) foi tratado com 2-bromoacetamida (11,6 mg, 0,084 mmol), carbonato de potássio (54,7 mg, 0,168 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C, agitado a 25°C durante 18 horas. A solução foi evaporada sob pressão reduzida e o resíduo foi triturado com acetato de etilo, filtrado e lavado com água para gerar o composto em título (12 mg, 54%).Example 387A 2 - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -8-nitro-1,1-dioxido-4H The product of Example 381 (20 mg, 0.042 mmol) in N, N-dimethylformamide (2 mL) was treated with 2-bromoacetamide (11 mg, 0.8 mmol). , 6 mg, 0.084 mmol), potassium carbonate (54.7 mg, 0.168 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C, stirred at 25 ° C for 18 hours. The solution was evaporated under reduced pressure and the residue triturated with ethyl acetate, filtered and washed with water to give the title compound (12 mg, 54%).

Uma mistura do produto do Exemplo 387A (12 mg, 0,023 mmol), ferro em pó (6,0 mg, 0,107 mmol) e cloreto de amónio (1,4 mg, 0,026 mmol) em metanol:tetra-hidrofurano:água 373 ΕΡ 1 560 827/ΡΤ (2:2:1,2 mL) foi aquecida a 60°C durante 1 hora. A solução foi filtrada através de Celite® e lavada com tetra-hidrofurano. A solução foi evaporada sob pressão reduzida e o resíduo foi triturado com acetato de etilo, filtrado, lavado com água e seco para gerar o composto em título (7 mg, 62%). 1H RMN (300 MHz, DMSO-d6) δ 0,14 (d, J=3,31 Hz, 2H) 0,41 (d, J=6,99 Hz, 2H) 1,01 (m, 1H) 2,85 (d, J=5,88 Hz, 2H) 4,49 (s, 2H) 5,98 (s, 2H) 6,46 (s, 1H) 6,73 (d, J=8,46 Hz, 1H) 7,17 (d, J=8,46 Hz, 1H) 7,44 (t, J=7,54 Hz, 1H) 7,55 (s, 1H) 7,89 (t, J=8,07, 1H) 7,92 (s, 1H) 8,10 (d, J=8,46 Hz, 1H) 8,16 (d, J=8,09 Hz, 1H) 13,86 (s, 1H) 15,07 (s, 1H). MS (ESI&quot;) m/z 497 (M-H)&quot;.A mixture of the product of Example 387A (12 mg, 0.023 mmol), iron powder (6.0 mg, 0.107 mmol) and ammonium chloride (1.4 mg, 0.026 mmol) in methanol: tetrahydrofuran: water 373 Ε 37 1 560 827 / ΡΤ (2: 2: 1.2 mL) was heated at 60 ° C for 1 hour. The solution was filtered through Celite® and washed with tetrahydrofuran. The solution was evaporated under reduced pressure and the residue triturated with ethyl acetate, filtered, washed with water and dried to give the title compound (7 mg, 62%). 1 H NMR (300 MHz, DMSOd 6) δ 0.14 (d, J = 3.31 Hz, 2 H) 0.41 (d, J = 6.99 Hz, 2 H) 1.01 (m, 1H) 2 1H), 6.73 (d, J = 8.46 Hz, 2H), 5.85 (d, J = 5.88 Hz, , 1H), 7.17 (d, J = 8.46 Hz, 1 H) 7.44 (t, J = 7.54 Hz, 1 H) 7.55 (s, 1 H) 7.89 (t, J = 8) (D, J = 8.46 Hz, 1 H) 8.16 (d, J = 8.09 Hz, 1 H) 13.86 (s, 1H) ) 15.07 (s, 1H). MS (ESI) m / z 497 (M-H) &quot;.

Exemplo 388AExample 388A

[ (3—{1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-8-nitro-l,l-dioxido-4if-l, 2,4-benzo-tiadiazin-7-il)oxi]acetonitrilo O produto do Exemplo 381 (20 mg, 0,042 mmol) em N,N-dimetilformamida (2 mL) reagiu com 2-bromoacetonitrilo (6 μΐ, 0,086 mmol), carbonato de potássio (54,7 mg, 0,168 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 18 horas. A solução foi evaporada sob pressão reduzida e o resíduo foi triturado com acetato de etilo, filtrado e lavado com água para gerar o composto em título (13 mg, 60%).[(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -8-nitro-1,1-dioxido-4 H -1,2 , 4-benzothiadiazin-7-yl) oxy] acetonitrile The product of Example 381 (20 mg, 0.042 mmol) in N, N-dimethylformamide (2 mL) was reacted with 2-bromoacetonitrile (6 μ, 0.086 mmol), carbonate of potassium (54.7 mg, 0.168 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 18 hours. The solution was evaporated under reduced pressure and the residue triturated with ethyl acetate, filtered and washed with water to give the title compound (13 mg, 60%).

Exemplo 388BExample 388B

[(8-amino-3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-1,2-di-hidroquinolin-3-il}-l,l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il)oxi]acetonitrilo[(8-amino-3- (1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-1,2 , 4-benzothiadiazin-7-yl) oxy] acetonitrile

Uma mistura do produto do Exemplo 388A (13 mg, 0,025 mmol), ferro em pó (6,0 mg, 0,107 mmol) e cloreto de amónio (1,5 mg, 0,028 mmol) em metanol:tetra-hidrofurano:água (2:2:1,2 mL) foi aquecida a 60°C durante 1 hora. A solução foi filtrada através de Celite® e lavada com tetra-hidrofurano. A solução foi evaporada sob pressão reduzida e o resíduo foi triturado com acetato de etilo, filtrado, lavado com água e seco para gerar o composto em título (5 mg, 41%) . XH RMN (300 MHz, DMSO-d6) δ 0,14 (d, J=l,ll Hz, 2H) 0,41 (d, J=5,88 Hz, 2H) 1,01 (m, 1H) 2,85 (d, J=5,40 Hz, 2H) 5,23 (s, 2H) 5,80 (s, 2H) 6,45 (s, 1H) 6,83 (d, J=8,46 Hz, 1H) 7,38 (d, J=8,46 Hz, 1H) 7,44 (t, J=7, 02 Hz, 1H) 7,90 (t, J=7, 02 Hz, 1H) 8,10 (d, 374 ΕΡ 1 560 827/ΡΤ J=8,46 Hz, 1Η) 8,16 (d, J=7,74 Hz, 1H) 13,93 (s, 1H) 14,94 (s, 1H). MS (ESI ) m/z 479 (M-H)&quot;.A mixture of the product of Example 388A (13 mg, 0.025 mmol), iron powder (6.0 mg, 0.107 mmol) and ammonium chloride (1.5 mg, 0.028 mmol) in methanol: tetrahydrofuran: water : 2: 1.2 mL) was heated at 60 ° C for 1 hour. The solution was filtered through Celite® and washed with tetrahydrofuran. The solution was evaporated under reduced pressure and the residue triturated with ethyl acetate, filtered, washed with water and dried to give the title compound (5 mg, 41%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.14 (d, J = 1.1 Hz, 2 H) 0.41 (d, J = 5.88 Hz, 2 H) 1.01 (m, 1H) 2 2H), 5.80 (s, 2H), 6.45 (s, 1H), 6.83 (d, J = 8.46 Hz, J = 7.02 Hz, 1 H), 7.90 (t, J = 7.02 Hz, 1 H) (D, J = 7.74 Hz, 1 H) 13.93 (s, 1 H) 14.94 (s, 1H ). MS (ESI) m / z 479 (M-H) &quot;.

Exemplo 389 1-[(ciclopropilmetil)amino]-4-hidroxi-3-[7-(2-hidroxietoxi)-1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il]quinolin-2(1H)-onaExample 389 1 - [(cyclopropylmethyl) amino] -4-hydroxy-3- [7- (2-hydroxyethoxy) -1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl] quinolin- 1H) -one

Ao produto do Exemplo 384 (10 mg, 0,021 mmol) em tetra-hidrofurano (10 mL) juntou-se borano (0,8 mL, 1M em tetra-hidrofurano, 0,8 mmol). A mistura foi refluxada durante 4 horas. Depois, foi vertida em água gelada (20 mL) e acidificada até pH 2 com ácido clorídrico IN. O sólido foi filtrado e lavado com água para gerar o composto em titulo (5 mg, 51%). XH RMN (300 MHz, DMSO-d6) δ 0,14 (d, J=4,41 Hz, 2H) 0,41 (d, J=7, 72 Hz, 2H) 1,01 (m, 1H) 2,86 (d, J=5,52 Hz, 2H) 3,74 (t, J=4, 78 Hz, 2H) 4,13 (t, J=4,78 Hz, 2H) 4,89 (s, 1H) 6,44 (s, 1H) 7,41 (m, 3H) 7,65 (d, J=9,84 Hz, 1H) 7,89 (t, J=7,91 Hz, 1H) 8,10 (d, J=8,46 Hz, 1H) 8,17 (d, J=7,35 Hz, 1H) 14,05 (s, 1H) 15,14 (s, 1H). MS (ESI) m/z 469 (M-H)'.To the product of Example 384 (10 mg, 0.021 mmol) in tetrahydrofuran (10 mL) borane (0.8 mL, 1M in tetrahydrofuran, 0.8 mmol) was added. The mixture was refluxed for 4 hours. It was then poured into ice water (20 mL) and acidified to pH 2 with 1N hydrochloric acid. The solid was filtered and washed with water to give the title compound (5 mg, 51%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.14 (d, J = 4.41 Hz, 2 H) 0.41 (d, J = 7.72 Hz, 2 H) 1.01 (m, 1H) 2 J = 4.78 Hz, 2H), 4.86 (t, J = 4.78 Hz, 2 H), 4.89 (s, 7.49 (m, 3H) 7.65 (d, J = 9.84 Hz, 1 H) 7.89 (t, J = 7.91 Hz, 1 H) 10 (d, J = 8.46 Hz, 1 H) 8.17 (d, J = 7.35 Hz, 1 H) 14.05 (s, 1 H) 15.14 (s, 1H). MS (ESI) m / z 469 (M-H) +.

Exemplo 390A 3— { 7— [ (l-benzil-lff-imidazol-2-il) metoxi] -1, l-dioxido-4H-1,2,4-benzotiadiazin-3-il}-l-[(ciclopropilmetil)amino]- 4- hidroxiquinolin-2(1H)-ona O produto do Exemplo 320C (20 mg, 0,047 mmol) em Ν,Ν-dimetilformamida (1 mL) foi aquecido com cloridrato de l-benzil-2-(clorometil)-lH-imidazole (23 mg, 0,095 mmol), carbonato de potássio (0,061 g, 0,187 mmol) e iodeto de tetrabutilamónio (catalítico) a 120°C durante 2 horas num reactor de microondas. A solução foi arrefecida até 25°C e concentrada. O resíduo foi triturado com acetato de etilo, filtrado e lavado com água para gerar o composto em título (21 mg, 75%).Example 390A 3- {7 - [(1-Benzyl-1 H -imidazol-2-yl) methoxy] -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl} -1 - [(cyclopropylmethyl ) The title product of Example 320C (20 mg, 0.047 mmol) in N, N -dimethylformamide (1 mL) was heated with 1-benzyl-2- (chloromethyl) -1H-imidazole (23 mg, 0.095 mmol), potassium carbonate (0.061 g, 0.187 mmol) and tetrabutylammonium iodide (catalytic) were heated at 120 ° C for 2 hours in a microwave reactor. The solution was cooled to 25 ° C and concentrated. The residue was triturated with ethyl acetate, filtered and washed with water to give the title compound (21 mg, 75%).

Exemplo 390B 1- [ (ciclopropilmetil)amino]-4-hidroxi-3-[7-(lH-imidazol-2-il-metoxi)-1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il]quinolin-2 (1H)-onaExample 390B 1 - [(cyclopropylmethyl) amino] -4-hydroxy-3- [7- (1H-imidazol-2-ylmethoxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3- yl] quinolin-2 (1H) -one

Ao produto do Exemplo 390A (16 mg, 0,027 mmol) em Ν,Ν-dimetilformamida (1 mL) juntou-se 1,4-ciclodieno (25,5 μΐ, 375 ΕΡ 1 560 827/ΡΤ 0,27 mmol) e negro de paládio (16 mg). A mistura foi aquecida a 70°C durante 1 dia. A mistura foi filtrada com Celite® e lavada com N,N-dimetilformamida. A solução foi evaporada sob pressão reduzida e o resíduo foi cromatografado em sílica gel eluindo com diclorometano:metanol (98:2) para gerar o composto em título (6 mg, 44%). XH RMN (300 MHz, DMSO-d6) δ 0,16 (d, J=4,41 Hz, 2H) 0,43 (d, J=7,35 Hz, 2H) 0,99 (m, 1H) 2,78 (s, br, 2H) 5,25 (s, 2H) 6,27 (s, br, 1H) 7,22 (s, 2H) 7,31 (m, 1H) 7,39 (dd, J=9,01, 2,76 Hz, 1H) 7,49 (d, J=2,57 Hz, 1H) 7,54 (d, J=8,82 Hz; 1H) 7,77 (m, 1H) 7,95 (d, J=8,09 Hz, 1H) 8,13 (dd, J=8, 09 Hz, 1,47 Hz, 1H) 14,83 (s, br, 1H) . MS (ESI-) m/z 505 (M-H)'.To the product of Example 390A (16 mg, 0.027 mmol) in Î ±, Î'-dimethylformamide (1 mL) was added 1,4-cyclodiene (25.5 Âμ, 375 Âμg -1 560 827 / ΡΤ 0.27 mmol) and black of palladium (16 mg). The mixture was heated at 70 ° C for 1 day. The mixture was filtered with Celite® and washed with N, N-dimethylformamide. The solution was evaporated under reduced pressure and the residue was chromatographed on silica gel eluting with dichloromethane: methanol (98: 2) to give the title compound (6 mg, 44%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.16 (d, J = 4.41 Hz, 2 H) 0.43 (d, J = 7.35 Hz, 2 H) 0.99 (m, 1H) 2 , 7.28 (s, br, 1H), 7.22 (s, 2H), 7.31 (m, 1H), 7.39 (dd, J = (D, J = 2.57 Hz, 1 H) 7.54 (d, J = 8.82 Hz, 1 H) 7.77 (m, 1 H) 7.95 (d, J = 8.09 Hz, 1 H) 8.13 (dd, J = 8.99 Hz, 1.47 Hz, 1 H) 14.83 (s, br, 1H). MS (ESI-) m / z 505 (M-H) +.

Exemplo 391A 1,3-tiazol-2-ilmetanol A tiazole-2-carbaldeído (113 mg, 1 mmol) em metanol (10 mL) juntou-se boro-hidreto de sódio (41 mg, 1,2 mmol) em porções a 0°C. A mistura foi agitada a temperatura ambiente durante 2 horas. A mistura foi diluída com água e acidificada até pH 3 com ácido clorídrico 1M e extraída com acetato de etilo (2 x 50 mL) . As fases orgânicas foram lavadas com bicarbonato de sódio aquoso saturado, água, salmoura, secas sobre sulfato de magnésio, filtradas e concentradas para gerar o composto em título (69 mg, 60%).To thiazole-2-carbaldehyde (113 mg, 1 mmol) in methanol (10 mL) was added sodium borohydride (41 mg, 1.2 mmol) in portions at 0 ° C. The mixture was stirred at room temperature for 2 hours. The mixture was diluted with water and acidified to pH 3 with 1 M hydrochloric acid and extracted with ethyl acetate (2 x 50 mL). The organic phases were washed with saturated aqueous sodium bicarbonate, water, brine, dried over magnesium sulfate, filtered and concentrated to give the title compound (69 mg, 60%).

Exemplo 391B 2-(clorometil)-1,3-tiazole O produto do Exemplo 391A (66 mg, 0,57 mmol) foi adicionado gota a gota a cloreto de tionilo (0,2 mL, 2,7 mmol) em diclorometano (9 mL) mantendo a temperatura a 25°C. A mistura foi refluxada durante 2 horas. O solvente foi evaporado para gerar o composto em titulo (rendimento quantitativo).Example 391B 2- (chloromethyl) -1,3-thiazole The product of Example 391A (66 mg, 0.57 mmol) was added dropwise to thionyl chloride (0.2 mL, 2.7 mmol) in dichloromethane ( 9 mL) maintaining the temperature at 25 ° C. The mixture was refluxed for 2 hours. The solvent was evaporated to give the title compound (quantitative yield).

Exemplo 391C 1- [(ciclopropilmetil)amino]-3-[1,l-dioxido-7-(1,3-tiazol- 2- ilmetoxi)-4H-1,2,4-benzotiadiazin-3-il]-4-hidroxiquinolin-2(1H)-ona O produto do Exemplo 320C (15 mg, 0,035 mmol) emExample 391C 1 - [(cyclopropylmethyl) amino] -3- [1,1-dioxido-7- (1,3-thiazol-2-ylmethoxy) -4H-1,2,4-benzothiadiazin-3-yl] -4 The product of Example 320C (15 mg, 0.035 mmol) in

N,N-dimetilformamida (1 mL) foi aquecido com o do Exemplo 391B 376 ΕΡ 1 560 827/ΡΤ (19 mg, 0,142 mmol), carbonato de potássio (68 g, 0,209 mmol) e iodeto de tetra-butilamónio (catalítico) a 120°C durante 2 horas. A solução foi evaporada sob pressão reduzida e o resíduo foi triturado com acetato de etilo/hexano (1:1), filtrado e lavado com água para gerar o composto em titulo (17 mg, 92%). XH RMN (500 MHz, DMSO-d6) δ 0,21 (d, J=4,27 Hz, 2H) 0,46 (d, J=7,32 Hz, 2H) 0,99 (m, 1H) 2,67 (s, br, 2H) 5,49 (s, 2H) 5,95 (t, J=6,71 Hz, 1H) 7,04 (m, 1H) 7,26 (m, 3H) 7,50 (m, 1H) 7,66 (d, J=8,54 Hz, 1H) 7,75 (d, J=3,66 Hz, 1H) 7,84 (d, J=3,05 Hz, 1H) 8,07 (dd, J=7,93 Hz, 1,08 Hz, 1H) 16,19 (s, 1H) . MS (ESr) m/z 522 (M-H) ~.(19 mL, 0.142 mmol), potassium carbonate (68 g, 0.209 mmol) and tetramethylbutylammonium iodide (catalytic) were added as a white solid, at 120 ° C for 2 hours. The solution was evaporated under reduced pressure and the residue triturated with ethyl acetate / hexane (1: 1), filtered and washed with water to give the title compound (17 mg, 92%). 1 H NMR (500 MHz, DMSOd 6) δ 0.21 (d, J = 4.27 Hz, 2 H) 0.46 (d, J = 7.32 Hz, 2 H) 0.99 (m, 1H) 2 2H), 5.95 (t, J = 6.71 Hz, 1 H) 7.04 (m, 1 H) 7.26 (m, 3H) 7, (D, J = 8.54 Hz, 1 H) 7.75 (d, J = 3.66 Hz, 1 H) 7.84 (d, J = 3.05 Hz, 1 H) ) 8.07 (dd, J = 7.93 Hz, 1.08 Hz, 1 H) 16.19 (s, 1H). MS (ESr) m / z 522 (M-H) -.

Exemplo 392AExample 392A

[(3 —{1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l,l-dioxido-4ff-l,2, 4-benzotiadiazin-7-il)oxi]acetonitrilo O produto do Exemplo 320C (0,050 g, 0,117 mmol) em N,N-dimetilformamida (2 mL) reagiu com 2-bromoacetonitrilo (16 pL, 0,230 mmol), carbonato de potássio (0,15 g, 0,46 mmol) e iodeto de tetrabutilamónio (catalítico) a 25°C durante 1 dia. A solução foi evaporada sob pressão reduzida e o resíduo foi triturado com acetato de etilo/hexano (1:1), filtrado e lavado com água para gerar o composto em título (52 mg, 95%).[(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4 H -1,2,4-benzothiadiazin -7-yl) oxy] acetonitrile The product of Example 320C (0.050 g, 0.117 mmol) in N, N-dimethylformamide (2 mL) was reacted with 2-bromoacetonitrile (16 μL, 0.230 mmol), potassium carbonate (0.15 g, 0.46 mmol) and tetrabutylammonium iodide (catalytic) at 25 ° C for 1 day. The solution was evaporated under reduced pressure and the residue triturated with ethyl acetate / hexane (1: 1), filtered and washed with water to give the title compound (52 mg, 95%).

Exemplo 392B 2-[(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l,l-dioxido-4H-l,2,4-benzotiadiazin-7-il)oxi]etanimidoato de metiloExample 392B 2 - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-1,2 , 4-benzothiadiazin-7-yl) oxy] ethanimidoate

Borbulhou-se cloreto de hidrogénio gás numa solução do produto do Exemplo 392A (50 mg, 0,11 mmol) em metanol (10 mL) a 0°C até saturação. A reacção foi agitada a temperatura ambiente durante 3 horas. A solução foi evaporada sob pressão reduzida para gerar o composto em título (rendimento quantitativo).Hydrogen chloride gas was bubbled into solution of the product of Example 392A (50 mg, 0.11 mmol) in methanol (10 mL) at 0 ° C until saturated. The reaction was stirred at room temperature for 3 hours. The solution was evaporated under reduced pressure to give the title compound (quantitative yield).

Exemplo 392C 1- [(ciclopropilmetil)amino]-3-[7-(4,5-di-hidro-lH-imidazol- 2- ilmetoxi)-1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il]-4-hidroxiquinolin-2(1H)-ona 377 ΕΡ 1 560 827/ΡΤExample 392C 1 - [(Cyclopropylmethyl) amino] -3- [7- (4,5-dihydro-1H-imidazol-2-ylmethoxy) -1,1-dioxido-4 H -1,2,4-benzothiadiazin- 3-yl] -4-hydroxyquinolin-2 (1H) -one 377 Î'1,560,827 / ΡΤ

Ao produto do Exemplo 392Β (53 mg, 0,11 mmol) em metanol (10 mL) juntou-se etano-1,2-diamina (0,2 mL, 3 mmol) e refluxou-se de um dia para o outro. O solvente foi removido sob pressão reduzida e o resíduo foi cromatografado em sílica gel eluindo com diclorometano/metanol 4:1 para diclorometano/metanol 3:2 para gerar o composto em título (11 mg, 20%). XH RMN (500 MHz, DMSO-d6) δ 0,18 (m, 2H) 0,45 (m, 2H) 1,00 (m, 1H) 2,77 (d, J=6,71 Hz, 2H) 3,91 (s, 4H) 5,23 (s, 2H) 6,11 (s, 1H) 7,21 (m, 1H) 7,42 (m, 3H) 7,66 (m, 1H) 7,85 (d, J=7,32 Hz, 1H) 8,12 (d, J=7,93 Hz, 1H) 10,70 (s, 1H) 15,29 (s, 1H). MS (ESI+) m/z 509 (M+H)+.To the product of Example 392 (53 mg, 0.11 mmol) in methanol (10 mL) was added ethane-1,2-diamine (0.2 mL, 3 mmol) and refluxed overnight. The solvent was removed under reduced pressure and the residue was chromatographed on silica gel eluting with dichloromethane / methanol 4: 1 to dichloromethane / methanol 3: 2 to give the title compound (11 mg, 20%). 1H NMR (500 MHz, DMSO-d6) δ 0.18 (m, 2H) 0.45 (m, 2H) 1.00 (m, 1H) 2.77 (d, J = 6.71 Hz, 2H) 1H NMR (CDCl3): Î'3.91 (s, 4H) 5.23 (s, 2H) 6.11 (s, 1H) 7.21 (m, 1H) 7.42 (m, 3H) 7.66 (m, 1H) 85 (d, J = 7.32 Hz, 1 H) 8.12 (d, J = 7.93 Hz, 1 H) 10.70 (s, 1H) 15.29 (s, 1H). MS (ESI +) m / z 509 (M + H) +.

Exemplo 393A 2-(bromometil)-1,3-tiazole-4-carbonitilo A uma solução de 2-metil-l-tiazole-4-carbonitrilo (248 mg, 2 mmol) em benzeno (20 mL) juntou-se N-bromo-succinimida (1,78 g, 10 mmol) e peróxido de dibenzoílo (20 mg, 0,08 mmol). A mistura foi refluxada durante 2 dias. A solução foi evaporada sob pressão reduzida. O resíduo foi repartido entre diclorometano e água. A fase orgânica foi concentrada sob pressão reduzida e o resíduo foi cromatografado em sílica gel eluindo com diclorometano:hexano 1:1 para gerar o composto em título (190 mg, 47%).To a solution of 2-methyl-1-thiazole-4-carbonitrile (248 mg, 2 mmol) in benzene (20 mL) was added N-benzyl- bromo-succinimide (1.78 g, 10 mmol) and dibenzoyl peroxide (20 mg, 0.08 mmol). The mixture was refluxed for 2 days. The solution was evaporated under reduced pressure. The residue was partitioned between dichloromethane and water. The organic phase was concentrated under reduced pressure and the residue was chromatographed on silica gel eluting with dichloromethane: hexane 1: 1 to give the title compound (190 mg, 47%).

Exemplo 393B 2—{[(3—{1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroguinolin-3-il}-l,l-dioxido-4H-l,2,4-benzotiadiazin-7-il)oxijmetil}-!,3-tiazole-4-carbonitrilo O produto do Exemplo 320C (20 mg, 0,047 mmol) em N, N-dimetilformamida (2 mL) reagiu com o do Exemplo 393A (20 mg, 0,099 mmol), carbonato de potássio (0,070 g, 0,215 mmol) e iodeto de tetrabutilamónio (catalítico) a temperatura ambiente de um dia para o outro. A solução foi concentrada sob pressão reduzida e o resíduo foi triturado com acetato de etilo/hexano (1:1), filtrado e lavado com água para gerar o composto em título (23 mg, 89%). XH RMN (500 MHz, DMSO-d6) δ 0,22 (m, 2H) O, 46 (m, 2H) 1,00 (m, 1H) 2,69 (m, 2H) 5,54 (s, 2H) 5,96 (t, J=6,32 Hz, 1H) 7,04 (m, 1H) 7,28 (m, 3H) 7,49 (m, 1H) 7,67 (d, 378 ΕΡ 1 560 827/ΡΤ J=8,62 Hz, 1Η) 8,08 (dd, J=8,05 Hz, 1,70 Hz, 1H) 8,81 (s, 1H) 16,15 (S, 1H) . MS (ESI ) m/z 547 (M-H)~.EXAMPLE 393B 2 - {[(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroguinolin-3-yl} -1,1-dioxido- 4-carbonitrile The product of Example 320C (20 mg, 0.047 mmol) in N, N-dimethylformamide (2 mL) was reacted with that of Example 393A (20 mg, 0.099 mmol), potassium carbonate (0.070 g, 0.215 mmol) and tetrabutylammonium iodide (catalytic) at room temperature overnight. The solution was concentrated under reduced pressure and the residue triturated with ethyl acetate / hexane (1: 1), filtered and washed with water to give the title compound (23 mg, 89%). 1 H NMR (500 MHz, DMSOd 6) δ 0.22 (m, 2H) 0.46 (m, 2H) 1.00 (m, 1H) 2.69 (m, 2H) 5.54 (s, 2H ) 5.96 (t, J = 6.32 Hz, 1 H) 7.04 (m, 1 H) 7.28 (m, 3 H) 7.49 (m, 1 H) 7.67 (d, 827 / ΡΤ J = 8.62 Hz, 1Η) 8.08 (dd, J = 8.05 Hz, 1.70 Hz, 1 H) 8.81 (s, 1 H) 16.15 (s, 1H). MS (ESI) m / z 547 (M-H) -.

Exemplo 394 3-[7-(2-aminoetoxi)-1,l-dloxido-4H-l,2,4-benzotladlazln-3-il]-l-[(ciclopropilmetil)amino]-4-hidroxiquinolin-2(lH)-onaExample 394 3- [7- (2-Aminoethoxy) -1,1-dioxido-4 H -1,2,4-benzotriazol-3-yl] -1 - [(cyclopropylmethyl) amino] -4-hydroxyquinolin-2 (1H ) -one

Uma solução do produto do Exemplo 392A (39 mg, 0,084 mmol) em tetra-hidrofurano anidro (2 mL) foi tratada com LiBH4 (1 mL, 2M em tetra-hidrofurano, 0,2 mmol), agitada a temperatura ambiente durante 30 minutos, depois juntaram-se 18 μΐ de água e agitou-se de um dia para o outro. A solução foi diluída com água (20 mL) e extraída com acetato de etilo (2 x 50 mL) . As fases orgânicas combinadas foram lavadas com salmoura e secas sobre sulfato de magnésio anidro. A lama foi filtrada e o solvente removido sob pressão reduzida para gerar o composto em título (38 mg, 97%) . 1H RMN (500 MHz, BENZENO- d6) δ 0,20 (d, J=3,05 Hz, 2H) 0,46 (d, J=7,32 Hz, 2H) 1,01 (m, 1H) 2,74 (s, br, 2H) 2,86 (m, 2H) 4,19 (t, J=4,90 Hz, 2H) 5,21 (s, br, 2H) 6,04 (s, br, 1H) 7,15 (s, br, 1H) 7,24 (s, br, 2H) 7,32 (s, br, 1H) 7,59 (s, br, 1H) 7,78 (s, br, 1H) 8,11 (d, J=7,32 Hz, 1H) 15,65 (s, br, 1H). MS (ESI&quot;) m/z 468 (M-H)'.A solution of the product of Example 392A (39 mg, 0.084 mmol) in anhydrous tetrahydrofuran (2 mL) was treated with LiBH4 (1 mL, 2M in tetrahydrofuran, 0.2 mmol), stirred at room temperature for 30 minutes , then 18 μl of water was added and stirred overnight. The solution was diluted with water (20 mL) and extracted with ethyl acetate (2 x 50 mL). The combined organic phases were washed with brine and dried over anhydrous magnesium sulfate. The slurry was filtered and the solvent removed under reduced pressure to give the title compound (38 mg, 97%). 1 H NMR (500 MHz, BENZENO-d 6) δ 0.20 (d, J = 3.05 Hz, 2 H) 0.46 (d, J = 7.32 Hz, 2 H) 1.01 (m, 1H) 2 (S, br, 2H), 6.04 (s, br, 2H), 2.86 (m, (S, br, 2H) 7.32 (s, br, 1H) 7.59 (s, br, 1H) 7.78 (s, br, 1H) 8.11 (d, J = 7.32 Hz, 1 H) 15.65 (s, br, 1H). MS (ESI &quot;) m / z 468 (M-H) +.

Exemplo 395 N—{2—[(3—{1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l,l-dioxido-4H-l,2,4-benzotiadiazin-7-il)oxi]etil}metanossulfonamidaExample 395 N- {2 - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H- 1,2,4-benzothiadiazin-7-yl) oxy] ethyl} methanesulfonamide

Ao produto do Exemplo 394 (15 mg, 0,032 mmol) em piridina (1 mL) juntou-se cloreto de metanossulfonilo (12 μΐ, 0,156 mmol). A mistura reaccional foi aquecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 mL), filtrado e lavado com hexano:acetato de etilo 1:1. O produto em bruto foi purificado por cromatografia em sílica gel eluindo com diclorometano: metanol 199:1 para gerar o composto em título (5 mg, 29%). XH RMN (300 MHz, DMSO-d6) δ 0,14 (d, J=4,04 Hz, 2H) 0,41 (d, J=7,72 Hz, 2H) 1,01 (m, 1H) 2,86 (d, J=5,52 Hz, 2H) 2,97 (s, 3H) 3,38 (t, J=5,33 Hz, 2H) 4,18 (t, J=5,33 Hz, 2H) 6,44 (s, 1H) 7,32 (t, J=5, 88 Hz, 1H) 7,41 (m, 3H) 7,67 (d, J=9,93 Hz, 1H) 7,89 (t, J=7, 91 Hz, 1H) 8,10 (d, J=8,46 Hz, 1H) 8,17 (d, 379 ΕΡ 1 560 827/ΡΤ J=8,46 Hz, 1Η) 14,08 (s, 1H) 15,11 (s, 1H). MS (ESI') m/z 546 (M-H)'.To the product of Example 394 (15 mg, 0.032 mmol) in pyridine (1 mL) was added methanesulfonyl chloride (12 μ, 0.156 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with 1: 1 hexane: ethyl acetate. The crude product was purified by silica gel chromatography eluting with dichloromethane: methanol 199: 1 to give the title compound (5 mg, 29%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.14 (d, J = 4.04 Hz, 2 H) 0.41 (d, J = 7.72 Hz, 2 H) 1.01 (m, 1H) 2 (T, J = 5.33 Hz, 2 H), 4.18 (t, J = 5.32 Hz, 2 H) J = 5.88 Hz, 1 H) 7.41 (m, 3 H) 7.67 (d, J = 9.93 Hz, 1 H) 7, (D, J = 8.46 Hz, 1 H), 8.10 (d, J = 8.46 Hz, 1 H) 14.08 (s, 1H) 15.11 (s, 1H). MS (ESI +) m / z 546 (M-H) +.

Exemplo 396 3-[9-(butilamino)-1,l-dioxido-4H,8H-[1,4]oxazlno[2,3-h]-[1,2,4]benzotiadiazin-3-il]-4-hidroxi-l-(isobutilamino)-quinolin-2(1H)-onaExample 396 3- [9- (Butylamino) -1,1-dioxido-4 H, 8 H - [1,4] oxazino [2,3- h] - [1,2,4] benzothiadiazin-3-yl] -4 hydroxy-1- (isobutylamino) -quinolin-2 (1H) -one

Uma solução do produto do Exemplo 357 (15, 5 mg, 0,031 mmol) em piridina (2 mL) foi tratada com n-butilamina (0,030 mL, 0,31 mmol) a temperatura ambiente durante 4 horas. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um qradiente de 10% para 100% acetonitrilo:ácido trifluoroacético aquoso a 0,1% para gerar o composto em título (3,3 mg, 20%). MS (ESI') m/z 537 (M-H)'. XH RMN (300 MHz, DMSO-d6) δ 0,92 (t, J=7,35 Hz, 3H) 1,04 (d, J=6,62 Hz, 6H) 1,36 (m, 2H) 1,59 (m, 2H) 1,90 (m, 1H) 2,70 (m, 2H) 3,41 (m, 2H) 4,55 (s, 2H) 6,32 (m, 1H) 6,96 (m, 1H) 7,15 (d, J=8,46 Hz, 1H) 7,45 (m, 1H) 7,93 (m, 2H) 8,17 (d, J=6,62 Hz, 1H) 13,66 (s, 1H) 15,69 (s, 1H).A solution of the product of Example 357 (15.5 mg, 0.031 mmol) in pyridine (2 mL) was treated with n-butylamine (0.030 mL, 0.31 mmol) at room temperature for 4 hours. The solvent was removed under a stream of hot nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a 10% to 100% acetonitrile: trifluoroacetic acid 0.1% aqueous to give the title compound (3.3 mg, 20%). MS (ESI +) m / z 537 (M-H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 0.92 (t, J = 7.35 Hz, 3H) 1.04 (d, J = 6.62 Hz, 6H) 1.36 (m, 2H) 1 (M, 2H), 3.92 (m, 2H), 4.00 (s, 2H) (d, J = 8.46 Hz, 1 H) 7.45 (m, 1 H) 7.93 (m, 2 H) 8.17 (d, J = 6.62 Hz, 1H) ) 13.66 (s, 1H) 15.69 (s, 1H).

Exemplo 397 3—{7—[(5-bromopiridin-2-il)oxi]-1,l-dioxido-4H-l, 2, 4-benzo-tiadiazin-3-il}-4-hidroxi-l-(isobutilamino)quinolin-2(lH)-onaExample 397 3- {7 - [(5-bromopyridin-2-yl) oxy] -1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl} -4-hydroxy- isobutylamino) quinolin-2 (1H) -one

Uma mistura do produto do Exemplo 321C (40,0 mg, 0,09 mmol), carbonato de césio (112 mg, 0,34 mmol) e 2,5-dibromo-piridina (40,0 mg, 0,17 mmol) em dimetilsulfóxido (1,2 mL) foi agitada mantendo aquecimento a 110°C num reactor de microondas durante 20 minutos. Após arrefecimento até 25°C, a mistura púrpura foi repartida entre acetato de etilo e água. A fase aquosa foi extraída com uma porção adicional de acetato deA mixture of the product of Example 321C (40.0 mg, 0.09 mmol), cesium carbonate (112 mg, 0.34 mmol) and 2,5-dibromopyridine (40.0 mg, 0.17 mmol) in dimethylsulfoxide (1.2 mL) was stirred maintaining heating at 110 ° C in a microwave reactor for 20 minutes. After cooling to 25øC, the purple mixture was partitioned between ethyl acetate and water. The aqueous phase was extracted with an additional portion of

etilo. As fases orgânicas combinadas foram sobre sulfato de sódio, filtradas, concentradas sob pressão reduzida e purificadas por cromatografia em coluna em sílica gel eluindo com um gradiente por passos (0-100%) de diclorometano em hexanos para gerar o composto em título como um sólido esbranquiçado (34,0 mg, 63%). MS (ESI') m/z 582 (M-H)'. XH RMN (300 MHz, DMSO-de) δ 1,05 (d, J=6,62 Hz, 6H) 1,93 (m, 1H) 2,73 (m, 2H) 6,35 (m, 1H) 7,19 (d, J=8,82 Hz, 1H) 7,45 (m, 1H) 7,61 380 ΕΡ 1 560 827/ΡΤ (dd, J=8,82, 2,57 Hz, 1H) 7,77 (m, 2H) 7,94 (m, 2H) 8,13 (dd, J=8,82, 2,57 Hz, 1H) 8,19 (m, 1H) 8,31 (d, J=2,21 Hz, 1H).ethyl. The combined organic phases were over sodium sulfate, filtered, concentrated under reduced pressure and purified by silica gel column chromatography eluting with a step gradient (0-100%) dichloromethane in hexanes to give the title compound as a solid (34.0 mg, 63%). MS (ESI +) m / z 582 (M-H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 1.05 (d, J = 6.62 Hz, 6H) 1.93 (m, 1H) 2.73 (m, 2H) 6.35 (m, 1H) 7.19 (d, J = 8.82 Hz, 1 H) 7.45 (m, 1 H) 7.61 380 Ρ Ρ 1 560 827 / ΡΤ (dd, J = 8.82, 2.57 Hz, 1 H) 7 (D, J = 8.82, 2.57 Hz, 1 H) 8.19 (m, 1 H) 8.31 (m, 2 H) 2.21 Hz, 1H).

Exemplo 398 4-hidroxi-l-(isobutilamino)-3-{7-[(3-nitropiridin-2-il)oxl]-1,l-dioxido-4H-l,2,4-benzotiadiazin-3-il}quinolin-2(1H)-onaExample 398 4-Hydroxy-1- (isobutylamino) -3- {7 - [(3-nitropyridin-2-yl) oxyl] -1,1-dioxido-4H-1,2,4-benzothiadiazin-3-yl} quinolin-2 (1H) -one

Uma mistura do produto do Exemplo 321C (10,0 mg, 0,02 mmol), carbonato de césio (27,7 mg, 0,09 mmol) e 2-bromo-3-nitropiridina (8,4 mg, 0,04 mmol) em dimetilsulfóxido (0,3 mL) foi agitada mantendo o aquecimento a 110°C num reactor de microondas durante 20 minutos. Após arrefecimento até 25°C, a mistura foi repartida entre acetato de etilo e água. A fase aquosa foi extraída com uma porção adicional de acetato de etilo. As fases orgânicas combinadas foram secas sobre sulfato de sódio, filtradas, concentradas sob pressão reduzida e purificadas por cromatografia em coluna em sílica gel eluindo com um gradiente por passos de 0-100% de diclorometano em hexano para gerar o composto em título como um sólido amarelo (8,6 mg, 68%). MS (ESI') m/z 549 (M-H)'. XH RMN (300 MHz, CDC13) δ 1,13 (d, J=6,62 Hz, 6H) 2,00 (m, 1H) 2,81 (m, 2H) 5,73 (m, 1H) 7,23 (m, 1H) 7,40 (m, 2H) 7,50 (dd, J=8,82,2,57A mixture of the product of Example 321C (10.0 mg, 0.02 mmol), cesium carbonate (27.7 mg, 0.09 mmol) and 2-bromo-3-nitropyridine (8.4 mg, 0.04 mmol) in dimethylsulfoxide (0.3 mL) was stirred maintaining the heating at 110 ° C in a microwave reactor for 20 minutes. After cooling to 25 ° C, the mixture was partitioned between ethyl acetate and water. The aqueous phase was extracted with an additional portion of ethyl acetate. The combined organic phases were dried over sodium sulfate, filtered, concentrated under reduced pressure, and purified by silica gel column chromatography eluting with a 0-100% stepwise dichloromethane in hexane to give the title compound as a solid yellow (8.6 mg, 68%). MS (ESI +) m / z 549 (M-H) +. 1 H NMR (300 MHz, CDCl 3) δ 1.13 (d, J = 6.62 Hz, 6H) 2.00 (m, 1H) 2.81 (m, 2H) 5.73 (m, 23 (m, 1 H) 7.40 (m, 2 H) 7.50 (dd, J = 8.82,

Hz, 1H) 7,82 (m, 2H) 7,97 (m, 1H) 8,27 (dd, J=8,09, 1,10 Hz, 1H) 8,35 (dd, J=4,78, 1,84 Hz, 1H) 8,42 (dd, J=8,09, 1,84 Hz, 1H) 14,39 (s, 1H) 15,02 (s, 1H).1H), 8.27 (dd, J = 8.09, 1.10 Hz, 1 H) 8.35 (dd, J = 4.78, , 1.84 Hz, 1 H) 8.42 (dd, J = 8.09, 1.84 Hz, 1 H) 14.39 (s, 1 H) 15.02 (s, 1H).

Exemplo 399 N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-l, 8-naftiridin-3-il]1,l-dioxido-4H-l, 2,4-benzotiadiazin-7-il}-metanossulfonamidaExample 399 N- {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4H- 1,2,4-benzothiadiazin-7-yl} -methanesulfonamide

Ao produto do Exemplo 205 (0,020 g, 0,047 mmol) em piridina (0,2 mL) juntou-se cloreto de metanossulfonilo (0,0064 g, 0,0043 mL, 0,056 mmol). A mistura reaccional foi aquecida num reactor de microondas a 100°C durante 38 minutos. A reacção foi diluída com acetato de etilo (40 mL), lavada com ácido clorídrico IN, água e salmoura. A fase orgânica foi seca sobre sulfato de magnésio e filtrada. O filtrado foi concentrado sob pressão reduzida para gerar um sólido amarelo, o qual foi purificado por cromatografia em sílica gel eluindo com diclorometano:metanol 99:1 para gerar o composto em título (8,3 mg, 35%). :Η RMN (300 MHz, DMSO-d6) δ 0,98 (d, J=6,62 Hz, 381 ΕΡ 1 560 827/ΡΤ 6Η) 1,57 (m, 2Η) 1,70 (m, 1Η) 3,10 (s, 3H) 4,49 (m, 2H) 7,50 (dd, J=7,91, 4,60 Hz, 1H) 7,58 (dd, J=8,82, 2,57 Hz, 1H) 7,64 (d, J=2,21 Hz, 1H) 7,75 (d, J=8,82 Hz, 1H) 8,56 (dd, J=8,09, 1,84 Hz, 1H) 8,89 (dd, J=4, 60, 1, 65 Hz, 1H) 10,29 (s, 1H) 14,17 (s, 1H) . MS (ESI ) m/z 504 (M-H)-.To the product of Example 205 (0.020 g, 0.047 mmol) in pyridine (0.2 mL) was added methanesulfonyl chloride (0.0064 g, 0.0043 mL, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100 ° C for 38 minutes. The reaction was diluted with ethyl acetate (40 mL), washed with 1N hydrochloric acid, water and brine. The organic phase was dried over magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure to give a yellow solid, which was purified by chromatography on silica gel eluting with 99: 1 dichloromethane: methanol to give the title compound (8.3 mg, 35%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.98 (d, J = 6.62 Hz, 381 ÅΡ 1 560 827 / ΡΤ 6Η) 1.57 (m, 2 H) 1.70 (m, 1 H) 3.10 (s, 3H) 4.49 (m, 2H) 7.50 (dd, J = 7.91, 4.60 Hz, 1 H) 7.58 (dd, J = 8.82, 2.57 (D, J = 2.21 Hz, 1 H) 7.75 (d, J = 8.82 Hz, 1 H) 8.56 (dd, J = 8.09, 1.84 Hz, , 8.89 (dd, J = 4.60, 1.65 Hz, 1 H) 10.29 (s, 1 H) 14.17 (s, 1H). MS (ESI) m / z 504 (M-H) -.

Exemplo 400 N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-l, 8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}-benzenossulfonamidaExample 400 N- {3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4H -1,2,4-benzothiadiazin-7-yl} -benzenesulfonamide

Ao produto do Exemplo 205 (0,020 g, 0,047 mmol) em piridina (0,2 mL) juntou-se cloreto de benzenossulfonilo (0,0099 g, 0,0072 mL, 0,056 mmol). A mistura reaccional foi aquecida num reactor de microondas a 100°C durante 35 minutos. A reacção foi arrefecida até 25°C, diluída com acetato de etilo (40 mL), lavada com ácido clorídrico IN, água e salmoura. A fase orgânica foi seca sobre sulfato de magnésio, filtrada e concentrada. O resíduo foi cromatografado em sílica gel eluindo com diclorometano:metanol 99:1 para gerar o composto em título (18,6 mg, 69%). XH RMN (300 MHz, DMSO-d6) δ 0,97 (d, J=6,25 Hz, 6H) 1,56 (m, 2H) 1,68 (m, 1H) 4,46 (m, 2H) 7,47 (m, 3H) 7,61 (m, 4H) 7,80 (d, J=6,99 Hz, 2H) 8,54 (dd, J=7,91, 1,65 Hz, 1H) 8,87 (dd, J=4,23, 1,29 Hz, 1H) 10,85 (s, 1H) 14,08 (br s, 1H). MS (ESI-) m/z 566 (M-H)-.To the product of Example 205 (0.020 g, 0.047 mmol) in pyridine (0.2 mL) was added benzenesulfonyl chloride (0.0099 g, 0.0072 mL, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100 ° C for 35 minutes. The reaction was cooled to 25 ° C, diluted with ethyl acetate (40 mL), washed with 1N hydrochloric acid, water and brine. The organic phase was dried over magnesium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting with 99: 1 dichloromethane: methanol to give the title compound (18.6 mg, 69%). 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (d, J = 6.25 Hz, 6H) 1.56 (m, 2H) 1.68 (m, 1H) 4.46 (m, 2H) 7.47 (m, 3H) 7.61 (m, 4H) 7.80 (d, J = 6.99Hz, 2H) 8.54 (dd, J = 7.91, 1.65Hz, 1H) 8.87 (dd, J = 4.23, 1.29 Hz, 1 H) 10.85 (s, 1 H) 14.08 (br s, 1H). MS (ESI-) m / z 566 (M-H) -.

Exemplo 401 N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-l, 8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}-tiofeno-2-sulfonamidaExample 401 N- {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4H -1,2,4-benzothiadiazin-7-yl} -thiophene-2-sulfonamide

Ao produto do Exemplo 205 (21,5 mg, 0,05 mmol) em piridina (1 mL) juntou-se cloreto de 2-tiofenossulfonilo (44 mg, 0,24 mmol). A mistura reaccional foi aguecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 mL), filtrado e lavado com hexano:acetato de etilo (1:1). O produto em bruto foi cromatografado em sílica gel eluindo com diclorometano:metanol 199:1 para gerar o composto em título (10 mg, 35%). XH RMN (300 MHz, DMSO-dê) : δ 0,97 (d, J=6,25 Hz, 6H) 1,55 (m, 2H) 1,66 (m, 1H) 4,46 (t, J=7,84 Hz, 2H) 7,16 (dd, J=5,13 Hz, 3,66 382To the product of Example 205 (21.5 mg, 0.05 mmol) in pyridine (1 mL) was added 2-thiophenesulfonyl chloride (44 mg, 0.24 mmol). The reaction mixture was run in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with hexane: ethyl acetate (1: 1). The crude product was chromatographed on silica gel eluting with dichloromethane: methanol 199: 1 to give the title compound (10 mg, 35%). 1 H NMR (300 MHz, DMSO-d 6): δ 0.97 (d, J = 6.25 Hz, 6H) 1.55 (m, 2H) 1.66 (m, 1H) 4.46 (t, J = = 7.84 Hz, 2 H) 7.16 (dd, J = 5.13 Hz, 3.66

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Hz, 1H) 7,48 (m, 2H) 7,53 (d, J=2,21 Hz, 1H) 7,56 (d, J=2,55 Hz, 1H) 7,61 (dd, J=3,68, 1,47 Hz, 1H) 7,68 (d, J=8,82 Hz, 1H) 7,96 (dd, J=5,13 Hz, 1,47 Hz, 1H) 8,53 (dd, J=8,09, 1,84 Hz, 1H) 8,87 (dd, J=4,78, 1,84 Hz, 1H) 10,98 (s, 1H) 14,10 (s; 1 H) . MS (ESI&quot;) rn/z 572 (M-H)~~.(D, J = 2.21 Hz, 1 H) 7.56 (d, J = 2.55 Hz, 1 H) 7.61 (dd, J = 3.68, 1.47 Hz, 1 H) 7.68 (d, J = 8.82 Hz, 1 H) 7.96 (dd, J = 5.13 Hz, 1.47 Hz, dd, J = 8.09, 1.84 Hz, 1 H) 8.87 (dd, J = 4.78, 1.84 Hz, 1 H) 10.98 (s, 1H) 14.10 (s, 1 H ). MS (ESI &quot;) m / z 572 (M-H) +.

Exemplo 402 N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}-l-metll-lH-imidazole-4-sulfonamidaExample 402 N- {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4H -1,2,4-benzothiadiazin-7-yl} -1-methyl-1H-imidazole-4-sulfonamide

Ao produto do Exemplo 205 (21,5 mg, 0,05 mmol) em piridina (1 mL) juntou-se cloreto de 1-metilimidazolesulfonilo (44 mg, 0,24 mmol). A mistura reaccional foi aquecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 mL), filtrado e lavado com hexano:acetato de etilo 1:1 para gerar o composto em título (21 mg, 73%). XH RMN (300 MHz, DMSO-d6) : δ 0,98 (d, J=6,62 Hz, 6H) 1,56 (m, 2H) 1,68 (m, 1H) 3,66 (s, 3H) 4,48 (m, 2H) 7,58 (m, 5H) 7,78 (d, J=l,ll Hz, 1H) 7,92 (d, J=l,47 Hz, 1H) 8,55 (dd, J=8, 09, 1, 84 Hz, 1H) 8,89 (dd, J=4, 78, 1,84 Hz; 1 H) 10,80 (s, 1H) 13,99 (s, 1H). MS (ESI) m/z 570 (M-H)&quot;.To the product of Example 205 (21.5 mg, 0.05 mmol) in pyridine (1 mL) was added 1-methylimidazolesulfonyl chloride (44 mg, 0.24 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with 1: 1 hexane: ethyl acetate to give the title compound (21 mg, 73%). 1 H NMR (300 MHz, DMSO-d 6): δ 0.98 (d, J = 6.62 Hz, 6H) 1.56 (m, 2H) 1.68 (m, 1H) 3.66 (s, 3H ) 4.48 (m, 2H) 7.58 (m, 5H) 7.78 (d, J = 1.1 Hz, 1 H) 7.92 (d, J = 1.47 Hz, 1 H) 8.55 (dd, J = 4.78, 1.84 Hz, 1 H) 10.80 (s, 1 H) 13.99 (s, 1H). MS (ESI) m / z 570 (M-H) &quot;.

Exemplo 403 4,5-dicloro-N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4H-l, 2, 4-benzo-tiadiazin-7-il}tiofeno-2-sulfonamidaExample 403 4,5-dichloro-N- {3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1- , 1-dioxido-4 H -1,2,4-benzothiadiazin-7-yl} thiophene-2-sulfonamide

Ao produto do Exemplo 205 (0,020 g, 0,047 mmol) em piridina (0,2 mL) juntou-se cloreto de 2,3-diclorotiofeno-5-sulfonilo (0,015 g, 0,056 mmol). A mistura reaccional foi aquecida num reactor de microondas a 100°C durante 15 minutos. A reacção foi diluída com acetato de etilo (40 mL), lavada com ácido clorídrico IN, água e salmoura. A fase orgânica foi seca sobre sulfato de magnésio, filtrada e concentrada. O resíduo foi cromatografado em sílica gel eluindo com diclorometano: metanol 99:1 para gerar o composto em título (14,8 mg, 50%). XH RMN (300 MHz, DMSO-d6) δ 0,98 (d, J=6,25 Hz, 6H) 1,56 (m, 2H) 1,69 (m, 1H) 4,47 (m, 2H) 7,50 (m, 2H) 7,56 (s, 1H) 7,71 (d, J=8,82 Hz, 1H) 7,76 (s, 1H) 8,55 (dd, J=7,91, 2,02 383 ΕΡ 1 560 827/ΡΤTo the product of Example 205 (0.020 g, 0.047 mmol) in pyridine (0.2 mL) was added 2,3-dichlorothiophene-5-sulfonyl chloride (0.015 g, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100 ° C for 15 minutes. The reaction was diluted with ethyl acetate (40 mL), washed with 1N hydrochloric acid, water and brine. The organic phase was dried over magnesium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting with 99: 1 dichloromethane: methanol to give the title compound (14.8 mg, 50%). 1 H NMR (300 MHz, DMSO-d 6) δ0.98 (d, J = 6.25 Hz, 6H) 1.56 (m, 2H) 1.69 (m, 1H) 4.47 (m, 2H) 7.50 (m, 2 H) 7.56 (s, 1 H) 7.71 (d, J = 8.82 Hz, 1 H) 7.76 (s, 1 H) 8.55 (dd, J = 7.91 , 2.02 383 ΕΡ 1 560 827 / ΡΤ

Hz, 1Η) 8,88 (dd, J=4,60, 1,65 Hz, 1Η) 11,28 (s, 1H) 14,19 (br S, 1H). MS (ESI~) m/z 640 (M-H)~.Hz, 1H) 8.88 (dd, J = 4.60, 1.65 Hz, 1Η) 11.28 (s, 1H) 14.19 (br s, 1H). MS (ESI +) m / z 640 (M-H) -.

Exemplo 404 2.2.2- trifluoro-N-{3-[4-hidroxi-l-(3-metllbutil)-2-oxo- 1.2- di-hidro-l,8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzo-tiadiazin-7-il}etanossulfonamidaExample 404 2,2,2-trifluoro-N- {3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] 4H-1,2,4-benzothiadiazin-7-yl} ethanesulfonamide

Ao produto do Exemplo 205 (21,5 mg, 0,05 mmol)em piridina (1 mL) juntou-se cloreto de 2,2,2-trifluoroetanossulfonilo (28 μΐ, 0,25 mmol). A mistura reaccional foi aquecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 mL), filtrado e lavado com hexaoe:acetato de etilo 1:1. O produto em bruto foi cromatografado em sílica gel eluindo com acetato de etilo/ hexano 1:1 para gerar o composto em título (5 mg, 17%). XH RMN (300 MHz, DMSO-d6) : δ 0,97 (d, J=6,62 Hz, 6H) 1,49 (m, 2H) 1,64 (m, 1H) 4,31 (t, J=7,53 Hz, 2H) 4,58 (q, J=9,93 Hz, 2H) 7,17 (dd, J=7,35, 4, 78 Hz, 1H) 7,43 (m, 4H) 8,38 (dd, J=7, 72, 1, 84 Hz, 1H) 8,57 (d, J=2,94 Hz, 1H) 10,63 (s, 1H) 15,90 (s, 1H). MS (ESI-) m/z 572 (M-H)“.To the product of Example 205 (21.5 mg, 0.05 mmol) in pyridine (1 mL) was added 2,2,2-trifluoroethanesulfonyl chloride (28 μ, 0.25 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with 1: 1 hexane: ethyl acetate. The crude product was chromatographed on silica gel eluting with 1: 1 ethyl acetate / hexane to give the title compound (5 mg, 17%). 1 H NMR (300 MHz, DMSO-d 6): δ 0.97 (d, J = 6.62 Hz, 6 H) 1.49 (m, 2 H) 1.64 (m, 1 H) 4.31 (t, J = = 7.53 Hz, 2H) 4.58 (q, J = 9.93 Hz, 2 H) 7.17 (dd, J = 7.35, 4.78 Hz, 1 H) 7.43 (m, 4H) 8.68 (dd, J = 7.72, 1.84 Hz, 1 H) 8.57 (d, J = 2.94 Hz, 1 H) 10.63 (s, . MS (ESI-) m / z 572 (M-H).

Exemplo 405 [({3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}amino)sulfonil]acetato de metiloExample 405 [({3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4H -1,2,4-benzothiadiazin-7-yl} amino) sulfonyl] acetate

Ao produto do Exemplo 205 (21,5 mg, 0,05 mmol) em cloreto de metileno (1 mL) juntou-se éster metílico de ácido cloro-sulfonilacético (35 mg, 0,2 mmol) e trietilamina (30 μΐ, 0,22 mmol) e a mistura resultante foi agitada a temperatura ambiente durante 3 dias. Após completação da reacção, o solvente foi removido sob pressão reduzida. O resíduo foi cromatografado em sílica gel eluindo com diclorometano:metanol 199:1. O produto foi dissolvido em diclorometano e juntaram-se duas gotas de ácido acético, depois agitou-se a t.amb. durante 10 minutos e lavou-se com água. A fase orgânica foi seca com sulfato de magnésio e evaporada in vacuo para gerar o composto em título (2 mg, 7%). 1H RMN (300 MHz, DMSO-d6) : δ 0,99 (d, J=6,62 Hz, 6H) 1,57 (m, 2H) 1,70 (m, 1H) 3,65 (S, 3H) 4,40 (s, 2H) 4,49 (m, 2H) 7,50 (dd, J=7,91, 4,60 Hz, 1H) 7,59 (dd, 384 ΕΡ 1 560 827/ΡΤ J=8,82; 2,57 Hz, 1Η) 7,66 (d, J=2,57 Hz, 1H) 7,76 (d, J=8,82 Hz, 1H) 8,57 (dd, J=8,09, 1,84 Hz, 1H) 8,90 (dd, J=4,41, 1,84 Hz, 1H) 10,73 (s, 1H) 14,15 (s, 1H). MS (ESI~) m/z 562 (M-H)“.To the product of Example 205 (21.5 mg, 0.05 mmol) in methylene chloride (1 mL) was added chlorosulfonylacetic acid methyl ester (35 mg, 0.2 mmol) and triethylamine (30 μ, , 22 mmol) and the resulting mixture was stirred at room temperature for 3 days. After completion of the reaction, the solvent was removed under reduced pressure. The residue was chromatographed on silica gel eluting with dichloromethane: methanol 199: 1. The product was dissolved in dichloromethane and two drops of acetic acid were added, then stirred at r.t. for 10 minutes and washed with water. The organic phase was dried over magnesium sulfate and evaporated in vacuo to give the title compound (2 mg, 7%). 1H NMR (300 MHz, DMSO-d6): δ 0.99 (d, J = 6.62 Hz, 6H) 1.57 (m, 2H) 1.70 (m, 1H) 3.65 (s, 3H ) 4.40 (s, 2 H) 4.49 (m, 2 H) 7.50 (dd, J = 7.91, 4.60 Hz, 1 H) 7.59 (dd, 384 ÅΡ 1 560 827 / ΡΤ J = 8.82, 2.57 Hz, 1Η) 7.66 (d, J = 2.57 Hz, 1 H) 7.76 (d, J = 8.82 Hz, 1 H) 8.57 (dd, J = 8.09, 1.84 Hz, 1 H) 8.90 (dd, J = 4.41, 1.84 Hz, 1 H) 10.73 (s, 1 H) 14.15 (s, 1H). MS (ESI +) m / z 562 (M-H) +.

Exemplo 406 N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-1,8-naftiridin-3-11]-1,l-dloxldo-4H-l,2,4-benzotiadiazin-7-11}etanossulfonamldaExample 406 N- {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-11] -1,1-dideoxy-4H -1,2,4-benzothiadiazin-7-11-ethanesulfonamide

Ao produto do Exemplo 205 (21,5 g, 0,05 mmol) em piridina (1 mL) juntou-se cloreto de etanossulfonilo (19 pl, 0,2 mmol). A mistura reaccional foi aquecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 mL), filtrado e lavado com hexano:acetato de etilo 1:1. O produto em bruto foi cromatografado em sílica gel eluindo com diclorometano:metanol 199:1 para gerar o composto em título (3 mg, 11%). RMN (300 MHz, DMSO-d6) : δ 0,98 (d, J=6,62 Hz, 6H) 1,22 (t, J=7,35 Hz, 3H) 1,58 (m, 2H) 1,70 (m, 1H) 3,20 (q, J=7,35 Hz, 2H) 4,49 (m, 2H) 7,50 (dd, J=7,91, 4,60 Hz, 1H) 7,58 (dd, J=8, 82, 2, 57 Hz, 1H) 7,65 (d, J=2,57 Hz, 1H) 7,74 (d, J=9,19 Hz, 1H) 8,56 (dd, J=8,09, 1,84 Hz, 1H) 8,89 (dd, J=4,60, 1,65 Hz, 1H) 10,35 (s, 1H) 14,15 (s, 1H). MS (ESI) m/z 518 (M-H)&quot;.To the product of Example 205 (21.5 g, 0.05 mmol) in pyridine (1 mL) was added ethanesulfonyl chloride (19 μl, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with 1: 1 hexane: ethyl acetate. The crude product was chromatographed on silica gel eluting with dichloromethane: methanol 199: 1 to give the title compound (3 mg, 11%). NMR (300 MHz, DMSO-d 6): δ 0.98 (d, J = 6.62 Hz, 6H) 1.22 (t, J = 7.35 Hz, 3H) 1.58 (m, 2H) 1 , 7.50 (dd, J = 7.91, 4.60 Hz, 1 H), 7.70 (dd, J = 7.91, 4.60 Hz, 1 H) (D, J = 9.19 Hz, 1 H), 7.74 (d, J = 2.57 Hz, 1 H) (Dd, J = 4.60, 1.65 Hz, 1 H) 10.35 (s, 1 H) 14.15 (s, 1H). MS (ESI) m / z 518 (M-H) &quot;.

Exemplo 407 N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}propano-2-sulfonamidaExample 407 N- {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4H -1,2,4-benzothiadiazin-7-yl} propane-2-sulfonamide

Ao produto do Exemplo 205 (21,5 g, 0,05 mmol) em piridina (1 mL) adicionou-se cloreto de isopropilsulfonilo (22 pl, 0,2 mmol). A mistura reaccional foi aquecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 mL), filtrado e lavado com hexano:acetato de etilo 1:1. O produto em bruto foi cromatografado em sílica gel eluindo com diclorometano:metanol 199:1 para gerar o composto em título (2 mg, 7%) . :H RMN (300 MHz, DMSO-d6) : δ 0,98 (d, J=6,62 Hz, 6H) 1,28 (d, J=6,99 Hz, 6H) 1,57 (m, 2H) 1,71 (m, 1H) 3,29 (m, 1H) 4,49 (m, 2H) 7,50 (dd, J=7,91, 4,60 Hz, 1H) 7,59 (dd, J=8,82, 2,57 Hz, 1H) 7,67 385 ΕΡ 1 560 827/ΡΤ (d, J=2, 57 Hz, 1H) 7,74 (d, J=9,18 Hz, 1H) 8,56 (dd, J=8,09, 1,84 Hz, 1H) 8,89 (dd, J=4, 60, 1, 65 Hz, 1H) 10,33 (S, 1H) 14,11 (s, 1H). MS (ESI') m/z 532 (M-H)'.To the product of Example 205 (21.5 g, 0.05 mmol) in pyridine (1 mL) was added isopropylsulfonyl chloride (22 μl, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with 1: 1 hexane: ethyl acetate. The crude product was chromatographed on silica gel eluting with dichloromethane: methanol 199: 1 to give the title compound (2 mg, 7%). 1 H NMR (300 MHz, DMSO-d 6): δ 0.98 (d, J = 6.62 Hz, 6 H) 1.28 (d, J = 6.99 Hz, 6 H) 1.57 (m, 2H 1H), 4.49 (m, 2H), 7.50 (dd, J = 7.91, 4.60 Hz, 1 H) 7.59 (dd, (D, J = 8.82 Hz, 1 H) 7.74 (d, J = 9.88 Hz, 1 H) 8.56 (dd, J = 8.09, 1.84 Hz, 1 H) 8.89 (dd, J = 4.60, 1.65 Hz, 1 H) 10.33 (S, 1 H) 14.11 ( s, 1H). MS (ESI +) m / z 532 (M-H) +.

Exemplo 408 N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}-1-fenllmetanossulfonamidaExample 408 N- {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4H -1,2,4-benzothiadiazin-7-yl} -1-phenylmethanesulfonamide

Uma solução do produto do Exemplo 205 (21,5 g, 0,05 mmol) em piridina (1 mL) foi tratada com cloreto de a-tolueno-sulfonilo (38 mg, 0,2 mmol), aquecida num reactor de microondas a 120°C durante 120 minutos, arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 ml), filtrado e lavado com hexano:acetato de etilo (1:1). O produto em bruto foi cromatografado em sílica gel, eluindo com diclorometano:metanol (399:1) para gerar o composto em título (7 mg, 24%). XH RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,62 Hz, 6H) 1,58 (m, 2H) 1,69 (m, 1H) 4,49 (m, 2H) 4,59 (s, 2H) 7,32 (m, 5H) 7,51 (m, 2H) 7,57 (d, J=2,21 Hz, 1H) 7,71 (d, J=8,82 Hz, 1H) 8,57 (dd, J=8, 09, 1, 84 Hz, 1H) 8,90 (dd, J=4, 78, 1, 84 Hz, 1H) 10,38 (s, 1H) 14,08 (s, 1H) 15,14 (s, 1H). (ESI') m/z 580 (M-H)'.A solution of the product of Example 205 (21.5 g, 0.05 mmol) in pyridine (1 mL) was treated with α-toluenesulfonyl chloride (38 mg, 0.2 mmol), heated in a microwave reactor at 120 ° C for 120 minutes, cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with hexane: ethyl acetate (1: 1). The crude product was chromatographed on silica gel, eluting with dichloromethane: methanol (399: 1) to give the title compound (7 mg, 24%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.62 Hz, 6H) 1.58 (m, 2H) 1.69 (m, 1H) 4.49 (m, 2H) 4.59 (s, 2H) 7.32 (m, 5H) 7.51 (m, 2H) 7.57 (d, J = 2.21 Hz, 1H) 7.71 (d, J = 8.82 8.90 (dd, J = 4.78, 1.84 Hz, 1 H) 10.38 (s, 1 H) 14.08 (s, 1 H) 15.14 (s, 1 H). (ESI +) m / z 580 (M-H) +.

Exemplo 409A N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro-l,8-naftiridin-3-il)-1, l-dioxido-4H-l,2, 4-benzotiadiazin-7-il]-2-nitro-benzenossulfonamidaExample 409A N- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl) -1,1-dioxido-4H-1,2 , 4-benzothiadiazin-7-yl] -2-nitro-benzenesulfonamide

Ao produto do Exemplo 205 (21,5 g, 0,05 mmol) em piridina (1 mL) juntou-se cloreto de 2-nitrobenzenossulfonilo (44 mg, 0,2 mmol). A mistura reaccional foi aquecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi concentrada sob pressão reduzida. O resíduo foi triturado com água (1 ml), filtrado e lavado com hexano:acetato de etilo (1:1). O produto em bruto foi cromatografado em sílica gel, eluindo com diclorometano:metanol (399:1) para gerar o composto em título (8 mg, 26%). 386 ΕΡ 1 560 827/ΡΤTo the product of Example 205 (21.5 g, 0.05 mmol) in pyridine (1 mL) was added 2-nitrobenzenesulfonyl chloride (44 mg, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with hexane: ethyl acetate (1: 1). The crude product was chromatographed on silica gel, eluting with dichloromethane: methanol (399: 1) to give the title compound (8 mg, 26%). 386 ΕΡ 1 560 827 / ΡΤ

Exemplo 409Β 2-amino-N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro-1, 8-naftlrldln-3-il)-1, l-dioxldo-4H-l, 2,4-benzotiadiazin-7-il]benzenossulfonamidaExample 409 2-Amino-N- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro-1,8-naphthldldn-3-yl) -1,1-dioxid- -1,2,4-benzothiadiazin-7-yl] benzenesulfonamide

Uma mistura do produto do Exemplo 409A (8 mg, 0,013 mmol), ferro em pó (5,0 mg, 0, 089 mmol) e NH4C1 (1 mg, 0,019 mmol) em metanol:tetra-hidrofurano:água (2:2:1,10 mL) foi aquecida a 60°C durante 2 horas. A solução foi filtrada através de Celite® e lavada com THF. A solução foi concentrada e o resíduo foi diluído com água e extraído com acetato de etilo. A fase orgânica foi lavada com água, seca com MgS04, filtrada e concentrada para gerar o composto em título (7 mg, 92%). XH RMN (300 MHz, DMSO-d6) δ 0,97 (d, J=6,62 Hz, 6H) 1,54 (m, 2H) 1,68 (m, 1H) 4,46 (m, 2H) 6,06 (s, 2H) 6,59 (t, J=7,17A mixture of the product of Example 409A (8 mg, 0.013 mmol), iron powder (5.0 mg, 0.089 mmol) and NH4 Cl (1 mg, 0.019 mmol) in methanol: tetrahydrofuran: water (2: 2 : 1.10 mL) was heated at 60 ° C for 2 hours. The solution was filtered through Celite® and washed with THF. The solution was concentrated and the residue was diluted with water and extracted with ethyl acetate. The organic phase was washed with water, dried over MgSO4, filtered and concentrated to give the title compound (7 mg, 92%). 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (d, J = 6.62 Hz, 6H) 1.54 (m, 2H) 1.68 (m, 1H) 4.46 (m, 2H) 6.06 (s, 2 H) 6.59 (t, J = 7.17

Hz, 1H) 6,78 (d, J=8,46 Hz, 1H) 7,23 (m, 1H) 7,46 (m, 4H) 7,63 (d, J=8,82 Hz, 1H) 8,53 (dd, J=8, 09, 1, 84 Hz, 1H) 8,87 (dd, J=4,41, 1,84 Hz, 1H) 10,79 (s, 1H) 14,00 (s, 1H) . (ESI~) m/z 581 (M-H)“.J = 8.46 Hz, 1 H) 7.23 (m, 1 H) 7.46 (m, 4H) 7.63 (d, J = 8.82 Hz, 1 H) 8.53 (dd, J = 8.9, 1.84 Hz, 1 H) 8.87 (dd, J = 4.41, 1.84 Hz, 1 H) 10.79 (s, 1 H) 14.00 ( s, 1H). (ESI) m / z 581 (M-H).

Exemplo 410 3-[8-(clorometil)-1,l-dioxido-4,7-di-hidroimidazo[4,5-h]-[1,2,4]benzotiadiazin-3-il]-4-hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-onaExample 410 3- [8- (Chloromethyl) -1,1-dioxido-4,7-dihydroimidazo [4,5- h] - [1,2,4] benzothiadiazin-3-yl] -4-hydroxy- 1- (3-methylbutyl) -1,8-naphthyridin-2 (1H) -one

Uma mistura do produto do Exemplo 377 (0, 022 g, 0,05 mmol) e ácido cloroacético (0,06 g, 0,63 mmol) num tubo selado foi aquecida num reactor de microondas a 120°C durante 30 minutos, arrefecida até 25°C e repartida entre acetato de etilo e água. A fase de acetato de etilo foi lavada com salmoura, seca sobre sulfato de sódio, filtrada e concentrada. O resíduo foi cromatografado em sílica gel eluindo com diclorometano e depois com diclorometano:metanol 98:2 para gerar o composto em título (0,010 g, 40% de rendimento). MS (APCI + ) m/z 501 (M+H) + . XH RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,25 Hz, 6H) 1,60 (m, 2H) 1,71 (m, 1H) 4,50 (m, 2H) 5,00 (m, 2H) 7,47 (m, 2H) 7,95 (d, J=8,09 Hz, 1H) 8,57 (dd, J=8,09, 1,84 Hz, 1H) 8,90 (dd, J=4,41, 1,47 Hz, 1H). 387 ΕΡ 1 560 827/ΡΤA mixture of the product of Example 377 (0.022 g, 0.05 mmol) and chloroacetic acid (0.06 g, 0.63 mmol) in a sealed tube was heated in a microwave reactor at 120 ° C for 30 minutes, cooled to 25 ° C and partitioned between ethyl acetate and water. The ethyl acetate layer was washed with brine, dried over sodium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting with dichloromethane and then with dichloromethane: methanol 98: 2 to give the title compound (0.010 g, 40% yield). MS (APCI +) m / z 501 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.25 Hz, 6H) 1.60 (m, 2H) 1.71 (m, 1H) 4.50 (m, 2H) 2H), 7.47 (m, 2H), 7.95 (d, J = 8.09 Hz, 1 H) 8.57 (dd, J = 8.09, 1.84 Hz, 8.90 (dd, J = 4.41, 1.47 Hz, 1H). 387 ΕΡ 1 560 827 / ΡΤ

Exemplo 411 {3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-l, 8-naftiridin-3-il]-1,l-dioxido-4,7-di-hidroimidazo[4,5-h]-[1,2,4]benzotiadiazin-8-il}acetonitriloExample 411 {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4,7 -dihydroimidazo [4,5-h] - [1,2,4] benzothiadiazin-8-yl} acetonitrile

Uma mistura do produto do Exemplo 377 (0,044 g, 0,1 mmol) e ácido cianoacético (0,085 g, 1,0 mmol) num tubo selado foi aquecida num reactor de microondas a 120°C durante 30 minutos, arrefecida e repartida entre acetato de etilo e água. A fase de acetato de etilo foi lavada com salmoura, seca sobre sulfato de sódio, filtrada e concentrada para gerar um residuo que foi cromatografado em sílica gel eluindo primeiro com diclorometano e depois com diclorometano/metanol 98:2 para gerar o composto em título (0, 007 g, 14% de rendimento) . MS (ESI) m/z 490 (M-H)&quot;. ΧΗ RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,62 Hz, 6H) 1,57 (m, 2H) 1,71 (m, 1H) 4,49 (m, 4H) 7,50 (m, 2H) 7,96 (m, 1H) 8,57 (dd, J=7, 72, 1, 84 Hz, 1H) 8,89 (dd, J=4,60, 1,29 Hz, 1H).A mixture of the product of Example 377 (0.044 g, 0.1 mmol) and cyanoacetic acid (0.085 g, 1.0 mmol) in a sealed tube was heated in a microwave reactor at 120 ° C for 30 minutes, cooled and partitioned between acetate ethyl acetate and water. The ethyl acetate layer was washed with brine, dried over sodium sulfate, filtered and concentrated to give a residue which was chromatographed on silica gel eluting first with dichloromethane and then with dichloromethane / methanol 98: 2 to give the title compound ( 0.007 g, 14% yield). MS (ESI) m / z 490 (M-H) &quot;. NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.62 Hz, 6H) 1.57 (m, 2H) 1.71 (m, 1H) 4.49 (m, 4H) 7.50 (m, 2 H) 7.96 (m, 1 H) 8.57 (dd, J = 7.72, 1.84 Hz, 1 H) 8.89 (dd, J = 4.60, 1.29 Hz, 1H).

Exemplo 412 {3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-l, 8-naftiridin-3-il]-1,l-dioxido-4,7-di-hidroimidazo[4,5-h]-[1,2,4]benzotiadiazin-8-il}acetato de metiloExample 412 {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4,7 -dihydroimidazo [4,5-h] - [1,2,4] benzothiadiazin-8-yl} acetate

Uma mistura do produto do Exemplo 377 (0, 088 g, 0,2 mmol), éster metílico de ácido 3,3,3-trimetoxi-propiónico (0,360 g, 2,0 mmol) e ácido p-toluenossulfónico mono-hidratado catalítico num tubo selado foi aquecida num reactor de microondas a 60°C durante 30 minutos, arrefecida até 25°C e repartida entre acetato de etilo e água. A fase de acetato de etilo foi lavada com salmoura, seca sobre sulfato de sódio, filtrada e concentrada. O resíduo foi cromatografado em sílica gel eluindo primeiro com diclorometano e depois com diclorometano/metanol 97:3 para gerar o composto em título (0,051 g, 49% de rendimento). MS (ESI~) m/z 523 (M-H)“. XH RMN (300 MHz, DMSO-dê) δ 0,99 (d, J=6,25 Hz, 6H) 1,58 (m, 2H) 1,71 (m, 1H) 3,68 (s, 3H) 4,10 (s, 2H) 4,49 (m, 2H) 7,45 (d, J=8,46 Hz, 1H) 7,51 (dd, J=7,91, 4,60 Hz, 1H) 7,92 (d, J=8,82 Hz, 1H) 8,57 (dd, J=7,91, 1,65 Hz, 1H) 8,90 (dd, J=4,60, 1,65 Hz, 1H) 13,07 (br s, 1H) 14,21 (br s, 1H) 15,31 (br s, 1H). 388A mixture of the product of Example 377 (0.088 g, 0.2 mmol), 3,3,3-trimethoxy-propionic acid methyl ester (0.360 g, 2.0 mmol) and p-toluenesulfonic acid catalytic monohydrate in a sealed tube was heated in a microwave reactor at 60 ° C for 30 minutes, cooled to 25 ° C and partitioned between ethyl acetate and water. The ethyl acetate layer was washed with brine, dried over sodium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting first with dichloromethane and then with dichloromethane / methanol 97: 3 to give the title compound (0.051 g, 49% yield). MS (ESI +) m / z 523 (M-H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.25 Hz, 6H) 1.58 (m, 2H) 1.71 (m, 1H) 3.68 (s, 3H) 4.10 (s, 2H) 4.49 (m, 2H) 7.45 (d, J = 8.46 Hz, 1 H) 7.51 (dd, J = 7.91, 4.60 Hz, 7.92 (d, J = 8.82 Hz, 1 H) 8.57 (dd, J = 7.91, 1.65 Hz, 1 H) 8.90 (dd, J = 4.60, 1.65 Hz , 1H) 13.07 (br s, 1H) 14.21 (br s, 1H) 15.31 (br s, 1H). 388

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 413 3-(9,9-dioxido-6H-[1,2,5]tiadiazolo[3, 4-.fi] [1,2,4]benzo-tiadiazin-7-il)-4-hidroxi-l-(3-metilbutil)-1,8-naftiridin-2(1H)-onaExample 413 3- (9,9-Dioxo-6H- [1,2,5] thiadiazolo [3,4- fi] [1,2,4] benzo-thiadiazin-7-yl) -4-hydroxy- - (3-methylbutyl) -1,8-naphthyridin-2 (1H) -one

Uma mistura do produto do Exemplo 377 (0,044 g, 0,1 mmol) e sulfamida (0,048 g, 0,5 mmol) num tubo selado foi aquecida num reactor de microondas a 190°C durante 4 minutos, arrefecida até 25°C e concentrada. O produto em bruto foi purificado por cromatografia em fase inversa com gradiente eluindo com ácido trifluoroacético a 0,1% em água/metanol (90/10) para ácido trifluoroacético a 0,1% em água/metanol (5/95) para gerar o composto em titulo (0,005 g, 11% de rendimento). MS (ESI ) m/z 469 (M-H)&quot;. :Η RMN (300 MHz, DMSO-de) δ 0,99 (d, J=6,25 Hz, 6H) 1,59 (m, 2H) 1,71 (m, 1H) 4,49 (m, 2H) 7,48 (dd, J=7,91, 4,60 Hz, 1H) 7,93 (d, J=9,56A mixture of the product of Example 377 (0.044 g, 0.1 mmol) and sulfamide (0.048 g, 0.5 mmol) in a sealed tube was heated in a microwave reactor at 190 ° C for 4 minutes, cooled to 25 ° C and concentrated. The crude product was purified by reverse phase gradient chromatography eluting with 0.1% trifluoroacetic acid in water / methanol (90/10) to 0.1% trifluoroacetic acid in water / methanol (5/95) to afford the title compound (0.005 g, 11% yield). MS (ESI) m / z 469 (M-H) &quot;. NMR (300 MHz, DMSO-d6) δ 0.99 (d, J = 6.25 Hz, 6H) 1.59 (m, 2H) 1.71 (m, 1H) 4.49 (m, 2H ) 7.48 (dd, J = 7.91, 4.60 Hz, 1 H) 7.93 (d, J = 9.56

Hz, 1H) 8,39 (d, J=9,19 Hz, 1H) 8,57 (dd, J=7,72, 1,84 Hz, 1H) 8,88 (dd, J=4,78, 1,84 Hz, 1H) 14,38 (s, 1H).(Dd, J = 7.72, 1.84 Hz, 1 H) 8.88 (dd, J = 4.78, 1.84 Hz, 1 H) 14.38 (s, 1H).

Exemplo 414A 4-amino-3-(aminosulfonil)fenilcarbamato de tert-butiloExample 414A tert-Butyl 4-amino-3- (aminosulfonyl) phenylcarbamate

Uma mistura de 2,5-diaminossulfonamida [preparada de acordo com o procedimento de J. Amer. Chem. Soc., 1943, 65, 738] (0,168 g, 0,896 mmol) e dicarbonato de di-tert-butilo (0,196 g, 0,896 mmol) em tetra-hidrofurano (10 mL) foi agitada a temperatura ambiente durante 16 horas. A reacção foi concentrada sob pressão reduzida e o residuo purificado por cromatografia em sílica gel, eluindo com hexano/acetato de etilo 3:2, para proporcionar o composto em título (0,202 g, 78% de rendimento).A mixture of 2,5-diaminosulfonamide [prepared according to the procedure of J. Amer. Chem. Soc., 1943, 65, 738] (0.168 g, 0.896 mmol) and di-tert-butyl dicarbonate (0.196 g, 0.896 mmol) in tetrahydrofuran (10 mL) was stirred at room temperature for 16 hours. The reaction was concentrated under reduced pressure and the residue purified by silica gel chromatography, eluting with 3: 2 hexane / ethyl acetate to provide the title compound (0.202 g, 78% yield).

Exemplo 414B 3—{1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l,2-di-hidro-quinolin-3-il}-l,l-dioxido-4H-l,2,4-benzotiadiazin-7-il-carbamato de tert-butiloExample 414B 3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydro-quinolin-3-yl} -1,1-dioxido-4H-1,2,4- -benzothiadiazin-7-ylcarbamate

Uma mistura do produto do Exemplo 414A (78,1 mg, 0,272 mmol) e do produto do Exemplo 353B (91,0 mg, 0,272 mmol) em dioxano anidro (2,7 mL) foi aquecida sob refluxo durante 3 horas. A mistura reaccional foi depois arrefecida até 25°C e concentrada sob pressão reduzida para proporcionar um sólido 389 ΕΡ 1 560 827/ΡΤ oleoso. Ο sólido foi triturado com metanol para gerar o composto em titulo (72,5 mg, 51%). RMN (300 MHz, DMSO-d6) δ 0,14 (d, J=4,04 Hz, 2H) 0,42 (m, 2H) 1,00 (m, 1H) 1,51 (s, 9H) 2,85 (bd, 7 =4,78 Hz, 2H) 6,45 (bs, 1H) 7,44 (t, 7=7,54 Hz, 1H) 7,62 (d, J= 8,82 Hz, 1H) 7,69 (dd, 7=8,82, 2,20 Hz, 1H) 7,89 (m, 7 =7,91, 7,91 Hz, 1H) 8,10 (d, 7=8,46 Hz, 1H) 8,17 (m, 2H) 9,93 (s, 1H) 14,08 (s, 1H) 15,15 (d, .7=4,78 Hz, 1H) . MS (ESI-) m/z 524, 0 (M-H)“. O sal de sódio do composto foi preparado por reacção do produto do Exemplo 414B (3,9 mg, 0,0074 mmol) com solução de hidróxido de sódio IN (0,0074 mL, 0,0074 mmol) em 0,5 mL de água e 0,5 mL de tetra-hidrofurano a temperatura ambiente durante 1,2 horas. A mistura reaccional foi depois evaporada sob uma corrente de azoto para proporcionar o sal de sódio (4,1 mg, 100% de rendimento). ΧΗ RMN (300 MHz, DMSO-de) δ 0,20 (m, 7 = 5,52 Hz, 2H) 0,46 (d, 7=8,82 Hz, 2H) 1,00 (m, 1H) 1,50 (s, 9H) 3,30 (m, 2H) 5,96 (t, 7=6,25 Hz, 1H) 7,06 (t, 7=7,17 Hz, 1H) 7,20 (d, 7=9,19 Hz, 1H) 7,52 (m, 2H) 7,67 (d, 7=8,82 Hz, 1H) 7,90 (s,A mixture of the product of Example 414A (78.1 mg, 0.272 mmol) and the product of Example 353B (91.0 mg, 0.272 mmol) in anhydrous dioxane (2.7 mL) was heated under reflux for 3 hours. The reaction mixture was then cooled to 25 ° C and concentrated under reduced pressure to provide an oily solid. The solid was triturated with methanol to give the title compound (72.5 mg, 51%). NMR (300 MHz, DMSO-d 6) δ 0.14 (d, J = 4.04 Hz, 2 H) 0.42 (m, 2 H) 1.00 (m, 1 H) 1.51 (s, 9 H) (D, J = 8.82 Hz, 1 H), 7.45 (d, J = 8.82 Hz, 1H), 7.69 (dd, J = 8.82, 2.20 Hz, 1 H) 7.89 (m, 7 = 7.91, 7.91 Hz, 1 H) 8.10 (d, 46 Hz, 1 H) 8.17 (m, 2 H) 9.93 (s, 1 H) 14.08 (s, 1 H) 15.15 (d, J = 4.78 Hz, 1H). MS (ESI-) m / z 524.0 (M-H). The sodium salt of the compound was prepared by reacting the product of Example 414B (3.9 mg, 0.0074 mmol) with 1N sodium hydroxide solution (0.0074 mL, 0.0074 mmol) in 0.5 mL of water and 0.5 ml of tetrahydrofuran at room temperature for 1.2 hours. The reaction mixture was then evaporated under a stream of nitrogen to afford the sodium salt (4.1 mg, 100% yield). NMR (300 MHz, DMSO-d6) δ 0.20 (m, 7 = 5.52 Hz, 2H) 0.46 (d, J = 8.82 Hz, 2H) 1.00 (m, 1H) 1 , 50 (s, 9H) 3.30 (m, 2H) 5.96 (t, J = 6.25 Hz, 1 H) 7.06 (t, J = 7.17 Hz, 1 H) 7.20 (d, , 7 = 9.19 Hz, 1 H) 7.52 (m, 2 H) 7.67 (d, J = 8.82 Hz, 1 H) 7.90 (s,

1H) 8,06 (d, 7=7,35 Hz, 1H) 9,60 (s, 1H) 16,22 (s, 1H) . MS (ESI + ) m/z 543, 1 (M+H+H20-Na)+, 526,1 (M-Na)+, (ESI“) m/z 524,1 (M-H)'.1H) 8.06 (d, J = 7.35 Hz, 1 H) 9.60 (s, 1 H) 16.22 (s, 1H). MS (ESI +) m / z 543.1 (M + H + H 2 O) +, 526.1 (M-Na) +, (ESI +) m / z 524.1 (M-H) +.

Exemplo 415 3-(7-amino-l,l-dioxido-4H-l,2,4-benzotiadiazin-3-il)-1-[(ciclopropilmetil)amino]-4-hidroxiguinolin-2(1H)-onaExample 415 3- (7-Amino-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1 - [(cyclopropylmethyl) amino] -4-hydroxyquinolin-2 (1H) -one

Uma solução do produto do Exemplo 414B (10,1 mg, 0,0192 mmol) em ácido trifluoroacético (0,5 mL) e diclorometano (0,5 mL) foi agitada a temperatura ambiente durante 15 minutos. O solvente foi depois evaporado sob uma corrente de azoto para proporcionar o composto em titulo (10,4 mg, rendimento quantitativo) . ΧΗ RMN (300 MHz, DMSO-d6) δ 0, 13 (d, 7 =4, 04 Hz, 2H) 0,41 (d, 7 =6,99 Hz, 2H) 1,01 (m, 1H) 2, 85 (d, 7 =6, 99 Hz, 2H) 6,98 (m, 2H) 738 (d, 7 =8,46 Hz, 1H) 7, 44 (t, 7 =7, 72 Hz, 1H) 7,89 (m, 1H) 8,10 (d, 7 =8,46 Hz, 1H) 8,16 (d, 7 =6, 99 Hz, 1H) 13,87 (s, 1H) 15,40 (s, 1H) . MS (ESI + ) m/ z 426 ,0 (M+H) +, 448,0 (M+Na)+, (ESI ) m/z 424, 1 (M- -ΗΓ. 390A solution of the product of Example 414B (10.1 mg, 0.0192 mmol) in trifluoroacetic acid (0.5 mL) and dichloromethane (0.5 mL) was stirred at room temperature for 15 minutes. The solvent was then evaporated under a stream of nitrogen to provide the title compound (10.4 mg, quantitative yield). 1 H NMR (300 MHz, DMSO-d 6) δ0.13 (d, J = 4.04 Hz, 2 H) 0.41 (d, J = 6.99 Hz, 2 H) (D, J = 8.46 Hz, 1 H) 7.44 (t, J = 7.72 Hz, 1 H) 7.89 (m, 1H) 8.10 (d, J = 8.46 Hz, 1 H) 8.16 (d, J = 6.99 Hz, 1 H) 13.87 (s, s, 1H). MS (ESI +) m / z 426.0 (M + H) +, 448.0 (M + Na) +, (ESI) m / z 424.1 (M +), 390

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 416 N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4H-l,2, 4-benzotiadiazin-7-il}-4-(metilsulfonil)benzenossulfonamidaExample 416 N- {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4H -1,2,4-benzothiadiazin-7-yl} -4- (methylsulfonyl) benzenesulfonamide

Ao produto do Exemplo 205 (0,020 g, 0,047 mmol) emTo the product of Example 205 (0.020 g, 0.047 mmol) in

piridina (0,2 mL) juntou-se cloreto de 4-metilsulfonilbenzeno-sulfonilo (0,014 g, 0,056 mmol). A mistura reaccional foi aquecida num reactor de microondas a 100°C durante 30 minutos. A reacção foi arrefecida até 25°C e diluída com acetato de etilo (40 mL), lavada com água e salmoura. A fase orgânica foi seca sobre sulfato de magnésio, filtrada e concentrada. O resíduo foi cromatografado em sílica gel eluindo com diclorometano:metanol 99:1 para gerar o composto em título (15 mg, 50%). 1H RMN (300 MHz, DMSO-d6) δ 0,97 (d, J=6,25 Hz, 6H) 1,56 (m, 2H) 1,68 (m, 1H) 3,28 (s, 3H) 4,46 (m, 2H) 7,48 (m, 3H) 7,65 (d, J=8,82 Hz, 1H) 8,04 (d, J=8,82 Hz, 2H) 8,15 (d, J=8,46 Hz, 2H) 8,54 (dd, J=8,09, 1,84 Hz, 1H) 8,86 (dd, J=4,60, 1,65 Hz, 1H) 11,11 (s, 1H) 14,14 (s, 1H) . MS (ESI') m/z 644 (M-H)&quot;.pyridine (0.2 mL) was added 4-methylsulfonylbenzenesulfonyl chloride (0.014 g, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100 ° C for 30 minutes. The reaction was cooled to 25 ° C and diluted with ethyl acetate (40 mL), washed with water and brine. The organic phase was dried over magnesium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting with 99: 1 dichloromethane: methanol to give the title compound (15 mg, 50%). 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (d, J = 6.25 Hz, 6H) 1.56 (m, 2H) 1.68 (m, 1H) 3.28 (s, 3H) J = 8.82 Hz, 1 H) 8.04 (d, J = 8.82 Hz, 2 H) 8.15 (m, d, J = 8.46 Hz, 2 H) 8.54 (dd, J = 8.09, 1.84 Hz, 1 H) 8.86 (dd, J = 4.60, 1.65 Hz, , 11 (s, 1 H) 14.14 (s, 1H). MS (ESI +) m / z 644 (M-H) &quot;.

Exemplo 417 3-[({3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}amino)sulfonil]tiofeno-2-carboxilato de metiloExample 417 3 - [({3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxide -4H-1,2,4-benzothiadiazin-7-yl} amino) sulfonyl] thiophene-2-carboxylate

Ao produto do Exemplo 205 (0,020 g, 0,047 mmol) em piridina (0,2 mL) juntou-se cloreto de 2-(metoxilcarbonil)-tiofeno-3-sulfonilo (0,014 g, 0,056 mmol). A mistura reaccional foi aquecida num reactor de microondas a 100 °C durante 30 minutos. A reacção foi arrefecida até 25°C, diluída com acetato de etilo (40 mL), lavada com água e salmoura. A fase orgânica foi seca sobre sulfato de magnésio, filtrada e concentrada. O resíduo foi cromatografado em sílica gel eluindo com diclorometano/metanol 99:1 para gerar o composto em título (15 mg, 50%). XH RMN (300 MHz, DMSO-d6) δ 0,97 (d, J=6,25 Hz, 6H) 1,56 (m, 2H) 1,69 (m, 1H) 3,89 (s, 3H) 4,46 (m, 2H) 7,50 (m, 4H) 7,65 (d, J=8,82 Hz, 1H) 8,01 (d, J=5,15 Hz, 1H) 8,54 (dd, J=7,91, 1,65 Hz, 1H) 8,88 (dd, J=4,60, 1,65 Hz, 1H) 10,74 (s, 1H) 14,06 (s, 1H). MS (ESI') m/z 630 (M-H)'. 391 ΕΡ 1 560 827/ΡΤTo the product of Example 205 (0.020 g, 0.047 mmol) in pyridine (0.2 mL) was added 2- (methoxylcarbonyl) -thiophene-3-sulfonyl chloride (0.014 g, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100 ° C for 30 minutes. The reaction was cooled to 25 ° C, diluted with ethyl acetate (40 mL), washed with water and brine. The organic phase was dried over magnesium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting with 99: 1 dichloromethane / methanol to give the title compound (15 mg, 50%). 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (d, J = 6.25 Hz, 6H) 1.56 (m, 2H) 1.69 (m, 1H) 3.89 (s, 3H) J = 8.82 Hz, 1 H) 8.01 (d, J = 5.15 Hz, 1 H) 8.54 (m, 4H), 7.65 (d, dd, J = 7.91, 1.65 Hz, 1 H) 8.88 (dd, J = 4.60, 1.65 Hz, 1 H) 10.74 (s, . MS (ESI +) m / z 630 (M-H) +. 391 ΕΡ 1 560 827 / ΡΤ

Exemplo 418 3-(8-amino-l, l-dioxido-4,7-di-hidroimidazo[4,5-h][1,2,4]-benzotladlazin-3-il)-4-hidroxi-l-(3-metilbutil)-1, 8-naftirindin-2(1H)-ona O produto do Exemplo 377 (24 mg, 0,055 mmol) foi suspenso em água (0,1 mL) e arrefecido até 0°C num banho de gelo. A esta lama juntou-se uma solução em acetonitrilo de brometo de cianogénio (0,1 mL, 0,067 mmol) e a mistura foi agitada durante 42 horas a temperatura ambiente. A mistura reaccional foi concentrada sob pressão reduzida para gerar o composto em titulo (23,5 mg, 92%). O composto foi convertido no sal de sódio tal como descrito no Exemplo 1D. MS (ESI-) m/z 466 (ΜΗ)-. 1h RMN (300 MHz, DMSO-d6) δ 0,97 (d, J=6,62 Hz, 6H) 1,49 (s, 2H) 1,65 (s, 1H) 4,29 (d, J=8,46 Hz, 2H) 6,01 (s, 2H) 6,49 (s, 1H) 6,78 (d, J=8,09 Hz, 1H) 7,12 (dd, J=7,72, 4,41 Hz, 1H) 7,30 (d, J=8,09 Hz, 1H) 8,38 (m, 1H) 8,51 (d, J=l,47 Hz, 1H) 11, 03 (s, 1H) .Example 418 3- (8-Amino-1,1-dioxido-4,7-dihydroimidazo [4,5-h] [1,2,4] -benzotladlazin-3-yl) -4-hydroxy- The product of Example 377 (24 mg, 0.055 mmol) was suspended in water (0.1 mL) and cooled to 0 ° C in an ice bath . To this slurry was added an acetonitrile solution of cyanogen bromide (0.1 mL, 0.067 mmol) and the mixture was stirred for 42 hours at room temperature. The reaction mixture was concentrated under reduced pressure to give the title compound (23.5 mg, 92%). The compound was converted to the sodium salt as described in Example 1D. MS (ESI-) m / z 466 (ΜΗ) -. 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (d, J = 6.62 Hz, 6H) 1.49 (s, 2H) 1.65 (s, 1H) 4.29 (d, J = 8.46 Hz, 2 H) 6.01 (s, 2 H) 6.49 (s, 1 H) 6.78 (d, J = 8.09 Hz, 1 H) 7.12 (dd, 4.41 Hz, 1 H) 7.30 (d, J = 8.09 Hz, 1 H) 8.38 (m, 1 H) 8.51 (d, J = 1.47 Hz, , 1H).

Exemplo 419 N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-1,8-naftiridin-3-il]1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}propano-l-sulfonamidaExample 419 N- {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1-dioxido-4H- 1,2,4-benzothiadiazin-7-yl} propane-1-sulfonamide

Ao produto do Exemplo 205 (21,5 g, 0,05 mmol) em piridina (1 mL) juntou-se cloreto de 1-propanossulfonilo (22,5 mL, 0,2 mmol). A mistura reaccional foi aquecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 mL), filtrado e lavado com hexano:acetato de etilo 1:1. O produto em bruto foi cromatografado em HPLC de fase inversa eluindo com ácido trifluoroacético aquoso a 0,1%/metanol (90/10) para ácido trifluoroacético aquoso a 0,1%/metanol (5/95) para gerar o composto em título (3 mg, 11%) . XH RMN (300 MHz, DMSO-dê) δ 0,97 (m, 9H) 1,57 (m, 2H) 1,69 (m, 3H) 3,17 (t, J=7,74 Hz, 2H) 4,49 (t, J=7,74 Hz, 2H) 7,50 (dd, J=7,91, 4,60 Hz, 1H) 7,58 (dd, J=8,82, 2,57 Hz, 1H) 7,64 (d, J=2,21 Hz, 1H) 7,75 (d, J=8,82 Hz, 1H) 8,56 (dd, J=7,72, 1,84 Hz, 1H) 8,90 (dd, J=4,41, 1,84 Hz, 1H) 10,35 (s, 1H) 14,09 (s, 1H) . MS (ESI-) m/z 532 (M-H)-. 392 ΕΡ 1 560 827/ΡΤTo the product of Example 205 (21.5 g, 0.05 mmol) in pyridine (1 mL) was added 1-propanesulfonyl chloride (22.5 mL, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with 1: 1 hexane: ethyl acetate. The crude product was flash chromatographed on reverse phase HPLC eluting with 0.1% aqueous trifluoroacetic acid / methanol (90/10) to 0.1% aqueous trifluoroacetic acid / methanol (5/95) to give the title compound (3 mg, 11%). 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (m, 9H) 1.57 (m, 2H) 1.69 (m, 3H) 3.17 (t, J = 7.74 Hz, 2H) 4.49 (t, J = 7.74 Hz, 2 H) 7.50 (dd, J = 7.91, 4.60 Hz, 1 H) 7.58 (dd, J = 8.82, 2.57 Hz 1H), 7.75 (d, J = 8.82 Hz, 1 H), 8.56 (dd, J = 7.72, 1.84 Hz, 1H) 8.90 (dd, J = 4.41, 1.84 Hz, 1 H) 10.35 (s, 1 H) 14.09 (s, 1H). MS (ESI-) m / z 532 (M-H) -. 392 ΕΡ 1 560 827 / ΡΤ

Exemplo 420 2-cloro-N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1, 8-naftiridin-3-il]-1,l-dioxido-4H-l,2, 4-benzotiadiazin-7-il}benzenossulfonamidaExample 420 2-chloro-N- {3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1 4H-1,2,4-benzothiadiazin-7-yl} benzenesulfonamide

Ao produto do Exemplo 205 (21,5 g, 0,05 mmol) em piridina (1 mL) juntou-se cloreto de 2-clorobenzenossulfonilo (27 mL, 0,2 mmol). A mistura reaccional foi aquecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 mL), filtrado e lavado com hexano:acetato de etilo 1:1. O produto em bruto foi purificado por cromatografia em sílica gel eluindo com diclorometano:metanol 199:1 para gerar o composto em título (14 mg, 46%). 1R RMN (300 MHz, DMSO-d6) δ 0,96 (d, J=6,25 Hz, 6H) 1,54 (m, 2H) 1,67 (m, 1H) 4,44 (t, J=7,71 Hz, 2H) 7,57 (m, 7H) 8,11 (d, J=8,46 Hz, 1H) 8,52 (dd, J=8, 09, 1, 84 Hz, 1H) 8,86 (dd, J=4,78, 1,84 Hz, 1H) 11,24 (s, 1H) 13,99 (s, 1H). MS (ESI') m/z 600 (M-H)“.To the product of Example 205 (21.5 g, 0.05 mmol) in pyridine (1 mL) was added 2-chlorobenzenesulfonyl chloride (27 mL, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with 1: 1 hexane: ethyl acetate. The crude product was purified by silica gel chromatography eluting with dichloromethane: methanol 199: 1 to give the title compound (14 mg, 46%). 1 H NMR (300 MHz, DMSO-d 6) δ0.96 (d, J = 6.25 Hz, 6H) 1.54 (m, 2H) 1.67 (m, 1H) 4.44 (t, J = 7.71 Hz, 2 H) 7.57 (m, 7H) 8.11 (d, J = 8.46 Hz, 1 H) 8.52 (dd, J = 8.9, , 86 (dd, J = 4.78, 1.84 Hz, 1 H) 11.24 (s, 1 H) 13.99 (s, 1H). MS (ESI +) m / z 600 (M-H).

Exemplo 421 l-cloro-N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4H-l,2, 4-benzotiadiazin-7-il}metanossulfonamidaExample 421 1-Chloro-N- {3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] 4H-1,2,4-benzothiadiazin-7-yl} methanesulfonamide

Ao produto do Exemplo 205 (21,5 g, 0,05 mmol) em piridina (1 mL) juntou-se cloreto de clorometilsulfonilo (18 mL, 0,2 mmol). A mistura reaccional foi aquecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 mL), filtrado e lavado com hexano:acetato de etilo 1:1. O produto em bruto foi purificado por cromatografia em fase inversa com gradiente eluindo com ácido trifluoroacético a 0,1% em água/metanol (90/10) para ácido trifluoroacético a 0,1% em água/metanol (5/95) para gerar o composto em título (6 mg, 22%) . XH RMN (300 MHz, DMSO-de) δ 0,99 (d, J=6,62 Hz, 6H) 1,57 (m, 2H) 1,69 (m, lH) 4,49 (t, J=7, 74 Hz, 2H) 5,18 (s, 2H) 7,51 (dd, J=7,91, 4,60To the product of Example 205 (21.5 g, 0.05 mmol) in pyridine (1 mL) was added chloromethylsulfonyl chloride (18 mL, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with 1: 1 hexane: ethyl acetate. The crude product was purified by reverse phase gradient chromatography eluting with 0.1% trifluoroacetic acid in water / methanol (90/10) to 0.1% trifluoroacetic acid in water / methanol (5/95) to afford the title compound (6 mg, 22%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.62 Hz, 6H) 1.57 (m, 2H) 1.69 (m, 1H) 4.49 (t, J = 7.74 Hz, 2 H) 5.18 (s, 2 H) 7.51 (dd, J = 7.91, 4.60

Hz, 1H) 7,62 (dd, J=8,82, 2,57 Hz, lH) 7,67 (d, J=2,57 Hz, lH) 7,77 (d, J=8,82 Hz, 1H) 8,56 (dd, J=8, 09, 1, 84 Hz, 1H) 8,90J = 8.82, 2.57 Hz, 1H), 7.67 (d, J = 2.57 Hz, 1H), 7.77 (d, J = 8.82 Hz, , 1H), 8.56 (dd, J = 8.9, 1.84 Hz, 1 H) 8.90

(dd, J=4,41, 1,84 Hz, 1H) 10,91 (s, 1H) 14,10 (s, 1H) . MS (ESI&quot;) m/z 538 (M-H)'. 393 ΕΡ 1 560 827/ΡΤ(dd, J = 4.41, 1.84 Hz, 1 H) 10.91 (s, 1 H) 14.10 (s, 1H). MS (ESI &quot;) m / z 538 (M-H) +. 393 ΕΡ 1 560 827 / ΡΤ

Exemplo 422 Ν-{3-[4-hldroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-1, 8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}butano-l-sulfonamidaExample 422 - {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido-4H -1,2,4-benzothiadiazin-7-yl} butane-1-sulfonamide

Ao produto do Exemplo 205 (21,5 g, 0,05 mmol) em piridina (1 mL) juntou-se cloreto de 1-butanossulfonilo (26 mL, 0,2 mmol). A mistura reaccional foi aquecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 mL), filtrado e lavado com hexano:acetato de etilo 1:1. O produto em bruto foi cromatografado em sílica gel eluindo com diclorometano:metanol 199:1 para gerar o composto em título (8 mg, 29%). XH RMN (300 MHz, DMSO-d6) δ 0,84 (t, J=7,35 Hz, 3H) 0,98 (d, J=6,62 Hz, 6H) 1,37 (m, 2H) 1,56 (m, 2H) 1,69 (m, 3H) 3,19 (t, J=7, 74 Hz, 2H) 4,48 (t, J= 7,74 Hz, 2H) 7,50 (dd, J=7,91, 4,60 Hz, 1H) 7,58 (dd, J=9,01, 2,39 Hz, 1H) 7,65 (d, J=2,21 Hz, 1H) 7,75 (d, J=8,82 Hz, 1H) 8,55 (dd, J=8,09, 1,84 Hz, 1H) 8,89 (dd, J=4,41, 1,84 Hz, 1H) 10,35 (s, 1H) 14,07 (s, 1H) 15,13 (s, 1H). MS (ESI+) m/z 548 (M+H)+.To the product of Example 205 (21.5 g, 0.05 mmol) in pyridine (1 mL) was added 1-butanesulfonyl chloride (26 mL, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with 1: 1 hexane: ethyl acetate. The crude product was chromatographed on silica gel eluting with dichloromethane: methanol 199: 1 to give the title compound (8 mg, 29%). 1 H NMR (300 MHz, DMSO-d 6) δ0.84 (t, J = 7.35 Hz, 3H) 0.98 (d, J = 6.62 Hz, 6H) 1.37 (m, 2H) 1 (D, J = 7.74 Hz, 2 H), 4.48 (t, J = 7.74 Hz, 2 H), 7.50 (dd, , J = 7.91, 4.60 Hz, 1 H) 7.58 (dd, J = 9.01, 2.39 Hz, 1 H) 7.65 (d, (D, J = 8.82 Hz, 1 H) 8.55 (dd, J = 8.09, 1.84 Hz, 1 H) 8.89 (dd, J = 4.41, 1.84 Hz, 1H ) 10.35 (s, 1 H) 14.07 (s, 1 H) 15.13 (s, 1H). MS (ESI +) m / z 548 (M + H) +.

Exemplo 423 2,6-dicloro-N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4H-l,2,4-benzo-tiadiazin-7-il}benzenossulfonamidaExample 423 2,6-dichloro-N- {3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1- , 1-dioxido-4 H -1,2,4-benzothiadiazin-7-yl} benzenesulfonamide

Ao produto do Exemplo 205 (21,5 g, 0,05 mmol) em piridina (1 mL) juntou-se cloreto de 2,6-diclorobenzenossulfonilo (49, 0,2 mmol). A mistura reaccional foi aquecida num reactor de microondas a 120°C durante 120 minutos. A reacção foi arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado com água (1 mL), filtrado e lavado com hexano:acetato de etilo 1:1. O produto em bruto foi cromatografado em sílica gel eluindo com diclorometano:metanol 399:1 para gerar o composto em título (5 mg, 16%). 1H RMN (300 MHz, DMSO-de) δ 0,97 (d, J=6,62 Hz, 6H) 1,54 (m, 2H) 1,67 (m, 1H) 4,46 (m, 2H) 7,47 (m, 2H) 7,58 (m, 2H) 7,68 (m, 3H) 8,54 (dd, J=7,72, 1,84 Hz, 1H) 8,88 (dd, J=4,78, 1,84 Hz, 1H) 11,43 (s, 1H) 14,02 (s, 1H). MS (ESI&quot;) m/z 634 (M-H)&quot;. 394 ΕΡ 1 560 827/ΡΤTo the product of Example 205 (21.5 g, 0.05 mmol) in pyridine (1 mL) was added 2,6-dichlorobenzenesulfonyl chloride (49.2 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered and washed with 1: 1 hexane: ethyl acetate. The crude product was chromatographed on silica gel eluting with dichloromethane: methanol 399: 1 to give the title compound (5 mg, 16%). 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (d, J = 6.62 Hz, 6H) 1.54 (m, 2H) 1.67 (m, 1H) 4.46 (m, 2H) 7.47 (m, 2H) 7.58 (m, 2H) 7.68 (m, 3H) 8.54 (dd, J = 7.72, 1.84 Hz, 1 H) 8.88 (dd, J = 4.78, 1.84 Hz, 1 H) 11.43 (s, 1 H) 14.02 (s, 1H). MS (ESI &quot;) m / z 634 (M-H) &quot;. 394 ΕΡ 1 560 827 / ΡΤ

Exemplo 424 2-cloro-6-({3-[4-hidroxi-l-(isobutilamino)-2-oxo-l,2-di-hidroquinolin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}oxi)isonicotinato de metiloExample 424 2-Chloro-6 - ({3- [4-hydroxy-1- (isobutylamino) -2-oxo-1,2-dihydroquinolin-3-yl] -1,1-dioxido- 2,4-benzothiadiazin-7-yl} oxy) isonicotinate

Uma mistura do produto do Exemplo 321C (40,0 mg, 0,138 mmol), carbonato de potássio (19,1 mg, 0,138 mmol), óxido de cobre(II) (18,4 mg, 0,23 mmol) e 2,6-dicloroisonicotinato de metilo (28,4 mg, 0,138 mmol) em piridina (0,2 mL) foi agitada mantendo aquecimento a 125°C num reactor de microondas durante 100 minutos. Após arrefecimento até 25°C, a mistura foi carregada directamente sobre silica gel e eluida com gradiente em passos de 0-5% de metanol em diclorometano. As fracções contendo o produto desejado foram combinadas e concentradas. O composto em titulo foi isolado por recristalização do residuo utilizando acetato de etilo/hexano (4,3 mg, 68%). MS (ESI-) m/z 596 (Μ-ΗΓ. RMN (300 MHz, CDC13) δ 1,13 (d, J= 6,62 Hz, 6H) 2,00 (m, 1H) 2,84 (br m, 2H) 3,99 (s, 3H) 5,73 (br s, 1H) 7,43 (m, 4H) 7,62 (d, J=8,46 Hz, 1H) 7,80 (m, 2H) 7,96 (d, J=8,46 Hz, 1H) 8,28 (d, J= 8,09 Hz, 1H) 14,37 (s, 1H) 15,04 (s, 1H) .A mixture of the product of Example 321C (40.0 mg, 0.138 mmol), potassium carbonate (19.1 mg, 0.138 mmol), copper (II) oxide (18.4 mg, 0.23 mmol) 6-dichloroisonicotinate (28.4 mg, 0.138 mmol) in pyridine (0.2 mL) was stirred maintaining heating at 125 ° C in a microwave reactor for 100 minutes. After cooling to 25øC, the mixture was loaded directly onto silica gel and graded eluted in steps of 0-5% methanol in dichloromethane. The fractions containing the desired product were combined and concentrated. The title compound was isolated by recrystallization from the residue using ethyl acetate / hexane (4.3 mg, 68%). NMR (300 MHz, CDCl3) δ 1.13 (d, J = 6.62 Hz, 6H) 2.00 (m, 1H) 2.84 (br. m), 7.62 (d, J = 8.46 Hz, 1 H), 7.80 (m, 2 H) 2H) 7.96 (d, J = 8.46 Hz, 1 H) 8.28 (d, J = 8.09 Hz, 1 H) 14.37 (s, 1 H) 15.04 (s, 1H).

Exemplo 425A 4-(benziloxi)-1-(3-metilbutil)piridin-2(1H)-onaExample 425A 4- (Benzyloxy) -1- (3-methylbutyl) pyridin-2 (1H) -one

Uma solução de 4-benziloxi-lH-piridin-2-ona (1,0 g, 4,97 mmol) e l-bromo-3-metilbutano (0,715 mL, 5,96 mmol) em N,N-dimetilformamida (20 mL) foi tratada com 1,8-diazabiciclo-[5.4.0]undec-7-eno (1,86 mL, 12,43 mmol) a 65°C durante 5 dias. A mistura foi arrefecida até 25°C e repartida entre água e diclorometano. A fase orgânica foi concentrada sob pressão reduzida. O residuo foi cromatografado em sílica gel, eluindo com 1% de metanol em diclorometano para gerar o composto em título (0,57 g, 42%). MS (DCI/NH3) m/z 272 (M+H)+. XH RMN (300 MHz, CDCI3) δ 0,96 (d, J=6,25 Hz, 6H) 1,61 (m, 3H) 3,89 (m, 2H) 4,99 (s, 2H) 5,98 (dd, J=7,54, 2,76 Hz, 1H) 6,06 (d, J=l,84 Hz, 1H) 7,14 (d, J=7,72 Hz, 1H) 7,39 (m, 5H).A solution of 4-benzyloxy-1H-pyridin-2-one (1.0 g, 4.97 mmol) and 1-bromo-3-methylbutane (0.715 mL, 5.96 mmol) in N, N -dimethylformamide mL) was treated with 1,8-diazabicyclo [5.4.0] undec-7-ene (1.86 mL, 12.43 mmol) at 65 ° C for 5 days. The mixture was cooled to 25 ° C and partitioned between water and dichloromethane. The organic phase was concentrated under reduced pressure. The residue was chromatographed on silica gel, eluting with 1% methanol in dichloromethane to give the title compound (0.57 g, 42%). MS (DCI / NH 3) m / z 272 (M + H) +. 1 H NMR (300 MHz, CDCl 3) δ0.96 (d, J = 6.25 Hz, 6H) 1.61 (m, 3H) 3.89 (m, 2H) 4.99 (s, 2H) (D, J = 7.72 Hz, 1 H) 7.09 (dd, J = 7.54, 2.76 Hz, 1 H) (m, 5H).

Exemplo 425B 4-hidroxi-l-(3-metilbutil)piridin-2(1H)-onaExample 425B 4-Hydroxy-1- (3-methylbutyl) pyridin-2 (1H) -one

Uma solução do produto do Exemplo 425A (0,55 g, 2,03 mmol) em tetra-hidrofurano (10 mL) foi tratada com formato de amónio (0,37 g, 5,87 mmol) e uma quantidade catalítica de 395 ΕΡ 1 560 827/ΡΤ hidróxido de paládio a 20% sobre carbono a 60°C durante 3 horas. A solução foi filtrada através de terra de diatomáceas e o filtrado foi concentrado para gerar o composto em titulo (0,21 g, 57%). MS (DCI/NH3) m/z 182 (M+H) + . XH RMN (300 MHz, CDCI3) δ 0,95 (d, J= 6,25 Hz, 6H) 1,60 (in, 3H) 3,90 (m, 2H) 6,09 (dd, J=7,35, 2, 57 Hz, 1H) 6,15 (d, J=2,21 Hz, 1H) 7,17 (d, J=7,35 Hz, 1H).A solution of the product of Example 425A (0.55 g, 2.03 mmol) in tetrahydrofuran (10 mL) was treated with ammonium formate (0.37 g, 5.87 mmol) and a catalytic amount of 395 1 560 827 / ΡΤ 20% palladium hydroxide on carbon at 60 ° C for 3 hours. The solution was filtered through diatomaceous earth and the filtrate was concentrated to give the title compound (0.21 g, 57%). MS (DCI / NH 3) m / z 182 (M + H) +. 1 H NMR (300 MHz, CDCl 3) δ 0.95 (d, J = 6.25 Hz, 6H) 1.60 (in, 3H) 3.90 (m, 2H) 6.09 (dd, J = 35, 2.57 Hz, 1 H) 6.15 (d, J = 2.21 Hz, 1 H) 7.17 (d, J = 7.35 Hz, 1 H).

Exemplo 425C 3-[bis(metiltio)metilenol-l-(3-metilbutil)piridina-2, 4(1H, 3H)-dionaExample 425C 3- [Bis (methylthio) methylene] -1- (3-methylbutyl) pyridine-2,4 (1H, 3H) -dione

Uma solução do produto do Exemplo 425B (0, 038 g, 0,21 mmol) em 1,4-dioxano (3 mL) foi tratada com piridina (0,135 mL, 1,68 mmol) e metilsulfato de tris(metiltio)metilo (preparado utilizando o procedimento de Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi) (0,11 g, 0,42 mmol) a 40°C durante 1 hora. Juntou-se outra porção de metilsulfato de tris(metiltio)metilo (0,11 g, 0,42 mmol) e a solução foi aguecida a 85°C durante 1 hora. A mistura reaccional foi arrefecida até 25°C e o solvente foi removido sob uma corrente de azoto quente. O resíduo foi cromatografado num cartucho Alltech sep-pack de 1 grama eluindo com 100% de diclorometano seguido de 30% de acetato de etilo em diclorometano para gerar o composto em título (19 mg, 33%). XH RMN (300 MHz, CLOROFÓRMIO-D) δ 0,96 (d, J=6,25 Hz, 6H) 1,58 (m, 3H) 2,66 (s, 6H) 3,78 (m, 2H) 5,99 (d, J=7,35 Hz, 1H) 7,06 (d, J=7, 72 Hz, 1H) .A solution of the product of Example 425B (0.038 g, 0.21 mmol) in 1,4-dioxane (3 mL) was treated with pyridine (0.135 mL, 1.68 mmol) and tris (methylthio) methyl methyl sulfate ( prepared using the procedure of Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi) (0.11 g, 0.42 mmol) at 40 ° C for 1 hour. Another portion of tris (methylthio) methyl methylsulfate (0.11 g, 0.42 mmol) was added and the solution was heated at 85 ° C for 1 hour. The reaction mixture was cooled to 25øC and the solvent was removed under a stream of warm nitrogen. The residue was chromatographed on a 1-gram Alltech sep-pack cartridge eluting with 100% dichloromethane followed by 30% ethyl acetate in dichloromethane to give the title compound (19 mg, 33%). 1 H NMR (300 MHz, CHLOROFORM-D) δ 0.96 (d, J = 6.25 Hz, 6H) 1.58 (m, 3H) 2.66 (s, 6H) 3.78 (m, 2H) 5.99 (d, J = 7.35 Hz, 1 H) 7.06 (d, J = 7, 72 Hz, 1H).

Exemplo 425D 2-amino-5-[(metilsulfonil)amino]benzenossulfonamidaExample 425D 2-Amino-5 - [(methylsulfonyl) amino] benzenesulfonamide

Uma mistura de 2,5-diamino-benzenossulfonamida (0,288 g, 0,0015 mol, 1 eq.), diclorometano (5 mL) e piridina (5 mL) foi agitada a 0°C. Juntou-se cloreto de metanossulfonilo (119 uL, 0,0015 mol, 1 eq.) gota a gota durante 3 minutos. A mistura reaccional foi aquecida até 25° e agitada durante 18 horas. A mistura reaccional foi evaporada sob pressão reduzida e o resíduo foi cromatografado em sílica gel utilizando um gradiente em passos de 0-4% de metanol em diclorometano para gerar o composto em título (68% de rendimento) . 1h RMN (300 MHz, DMSO-de) δ 2,87 (s, 3H) 3,39 (s, 1H) 5,80 (s, 1H) 6,78 396 ΕΡ 1 560 827/ΡΤ (d, J= 8,82 Hz, 1H) 7,13 (dd, J=8,64, 2, 39 Hz, 1H) 7,29 (s, 2H) 7,45 (d, J=2,57 Hz, 1H) 9,21 (m, 1H). MS (ESI+) m/z=266 (M+H)+.A mixture of 2,5-diamino-benzenesulfonamide (0.288 g, 0.0015 mol, 1 eq.), Dichloromethane (5 mL) and pyridine (5 mL) was stirred at 0 ° C. Methanesulfonyl chloride (119 æL, 0.0015 mol, 1 eq.) Was added dropwise over 3 minutes. The reaction mixture was warmed to 25 ° and stirred for 18 hours. The reaction mixture was evaporated under reduced pressure and the residue was chromatographed on silica gel using a step gradient of 0-4% methanol in dichloromethane to give the title compound (68% yield). 1 H NMR (300 MHz, DMSO-d 6) δ 2.87 (s, 3H) 3.39 (s, 1H) 5.80 (s, 1H) 6.78 396 η 1 1560 827 / δ (d, 8.82 Hz, 1 H) 7.13 (dd, J = 8.64, 2.39 Hz, 1 H) 7.29 (s, 2 H) 7.45 (d, J = 2.57 Hz, 1 H) 9 , 21 (m, 1H). MS (ESI +) m / z = 266 (M + H) +.

Exemplo 425E N—{3 —[4-hidroxi-l-(3-metilbutil)-2-oxo-l,2-di-hidropiridin-3-il]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il} -metanossulfonamidaExample 425E N- {3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydropyridin-3-yl] -1,1-dioxido-4H-1,2,4- -benzothiadiazin-7-yl} -methanesulfonamide

Uma solução do produto do Exemplo 425C (0,019 g, 0,067 mmol) e do produto do Exemplo 425D (0,018 g, 0,067 mmol) em 1,4-dioxano foi aquecida a 100°C durante 1 hora. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 um de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo:ácido trifluoro-acético aquoso a 0,1% para gerar o composto em título (0,007 g, 23%). MS (ESI~) m/z 453 (M-H)“. XH RMN (300 MHz, DMSO-d6) δ 0,93 (d, J=6,25 Hz, 6H) 1,58 (m, 3H) 3,08 (s, 3H) 3,99 (m, 2H) 6,33 (d, J=6,62 Hz, 1H) 7,57 (m, 2H) 7,67 (d, J=8,82 Hz, 1H) 8,07 (d, J=6,62 Hz, 1H) 10,25 (s, 1H) 13,84 (s, 1H) 14,28 (s, 1H).A solution of the product of Example 425C (0.019 g, 0.067 mmol) and the product of Example 425D (0.018 g, 0.067 mmol) in 1,4-dioxane was heated at 100 ° C for 1 hour. The solvent was removed under a stream of hot nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 æm particle size) using a gradient from 10% to 100% acetonitrile: trifluoroacetic acid to give the title compound (0.007 g, 23%). MS (ESI +) m / z 453 (M-H). 1 H NMR (300 MHz, DMSO-d 6) δ0.93 (d, J = 6.25 Hz, 6H) 1.58 (m, 3H) 3.08 (s, 3H) 3.99 (m, 2H) J = 6.62 Hz, 1 H) 7.57 (m, 2 H) 7.67 (d, J = 8.82 Hz, 1 H) 8.07 (d, J = 6.62 Hz , 1H) 10.25 (s, 1H) 13.84 (s, 1H) 14.28 (s, 1H).

Exemplo 426A l-benzil-4-hidroxipiridin-2(1ff)-ona 0 composto em título foi preparado através do método de Eschenhof et al., Tetrahedron, v 48, 30, p 6225-6230, 1992.Example 426A 1-benzyl-4-hydroxypyridin-2 (1 H) -one The title compound was prepared by the method of Eschenhof et al., Tetrahedron, v 48, 30, p 6225-6230, 1992.

Exemplo 426B 1-benzi1-3-[bis(metiltio)metileno]piridina-2,4(1H,3H)-dionaExample 426B 1-benzyl-3- [bis (methylthio) methylene] pyridine-2,4 (1H, 3H) -dione

Uma solução do produto do Exemplo 426A (0,124 g, 0,62 mmol) em 1,4-dioxano (6 mL) foi tratada com piridina (0,400 mL, 4,96 mmol) e metilsulfato de tris(metiltio)metilo (preparado utilizando o procedimento de Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi) (0,32 g, 1,24 mmol) a 40°C durante 15 minutos. Untou-se outra porção de metilsulfato de tris(metiltio)metilo (0,32 g, 1,24 mmol) e a solução foi aquecida a 90°C durante 1 hora. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado utilizando um cartucho Alltech sep-pack de 1 grama eluindo com 100% de diclorometano seguido de 30% de acetato de etilo em diclorometano para gerar o composto 397 ΕΡ 1 560 827/ΡΤ em título (79 mg, 42%). XH RMN (300 MHz, CLOROFÓRMIO-d) δ 2,68 (s, 6H) 4,99 (S, 2H) 6,11 (d, J=7, 72 Hz, 1H) 7,17 (d, J=8,09 Hz, 1H) 7,33 (m, 5H).A solution of the product of Example 426A (0.124 g, 0.62 mmol) in 1,4-dioxane (6 mL) was treated with pyridine (0.400 mL, 4.96 mmol) and tris (methylthio) methyl methylsulfate (prepared using the procedure of Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi) (0.32 g, 1.24 mmol) at 40 ° C for 15 minutes. Another portion of tris (methylthio) methyl methyl sulphate (0.32 g, 1.24 mmol) was added and the solution was heated at 90 ° C for 1 hour. The solvent was removed under a stream of hot nitrogen and the residue was purified using a 1-gram Alltech sep-pack cartridge eluting with 100% dichloromethane followed by 30% ethyl acetate in dichloromethane to give compound 397 Îμ1,560,827 / ΡΤ in title (79 mg, 42%). 1 H NMR (300 MHz, CHLOROFORM-d) δ 2.68 (s, 6H) 4.99 (S, 2H) 6.11 (d, J = 7.72 Hz, 8.09 Hz, 1 H) 7.33 (m, 5 H).

Exemplo 426C N-[3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidropiridin-3-il)-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il]metanossulfonamidaExample 426C N- [3- (1-benzyl-4-hydroxy-2-oxo-1,2-dihydropyridin-3-yl) -1,1-dioxido-4H-1,2,4-benzothiadiazin-7 -yl] methanesulfonamide

Uma solução do produto do Exemplo 426B (0, 028 g, 0,092 mmol) e do produto do Exemplo 425D (0, 025 g, 0,092 mmol) em 1,4-dioxano foi aquecida a 100°C durante 40 minutos. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi triturado com água e acetato de etilo. O precipitado na fase orgânica foi filtrado e seco para gerar o composto em título (0, 006 g, 12%). MS (ESI-) m/z 473 (M-H)-. XH RMN (500 MHz, DMSO-D6) δ 3,06 (s, 3H) 5,21 (s, 2H) 6,38 (d, J=4,88 Hz, 1H) 7,34 (m, 5H) 7,55 (m, 3H) 8,18 (d, J=3,05 Hz, 1H) 10,25 (s, 1H) 13,87 (s, 1H) 14,05 (s, 1H).A solution of the product of Example 426B (0.028 g, 0.092 mmol) and the product of Example 425D (0.025 g, 0.092 mmol) in 1,4-dioxane was heated at 100 ° C for 40 minutes. The solvent was removed under a stream of hot nitrogen and the residue was triturated with water and ethyl acetate. The precipitate in the organic phase was filtered and dried to give the title compound (0.006 g, 12%). MS (ESI-) m / z 473 (M-H) -. 1H NMR (500 MHz, DMSO-D6) δ 3.06 (s, 3H) 5.21 (s, 2H) 6.38 (d, J = 4.88 Hz, 1H) 7.34 (m, 5H) 7.55 (m, 3H) 8.18 (d, J = 3.05 Hz, 1H) 10.25 (s, 1H) 13.87 (s, 1H) 14.05 (s, 1H).

Exemplo 427 N-[(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l,l-dioxido-4H-tieno[2,3-e][1,2,4]— tiadiazin-7-il)metil]etanossulfonamida A uma solução do produto do Exemplo 353E (16,1 mg, 0,036 mmol) em N,N-dimetilformamida (0,4 mL) juntou-se trietilamina (0,011 mL, 0,079 mmol). A mistura foi arrefecida até 0°C e juntou-se cloreto de etanossulfonilo (0,0036 mL, 0,038 mmol). A mistura foi aquecida até 23°C e agitada durante 2 horas. A mistura reaccional foi concentrada sob pressão reduzida. O resíduo foi purificado por cromatografia em fase inversa, eluindo com um gradiente de 10% de acetonitrilo em ácido trifluoroacético a 0,1% em água para 95% de acetonitrilo/ácido trif luoroacético a 0,1% em água para gerar o composto em título (7,7 mg, 40%). O sal de sódio do composto em título foi preparado pela adição de hidróxido de sódio IN (0,029 mL, 0, 0029 mmol) a uma solução do composto em título (7,7 mg, 0,014 mmol) em água (0,4 mL) e agitação durante trinta minutos. A mistura reaccional foi concentrada sob pressão reduzida. XH RMN (300 MHz, DMSO-d6) δ 0,21 (bs, 2H) 0,46 (d, 2H) 0,99 (m, 1H) 1,19 (t, 3H) 3,01 (q, 2H) 4,23 (s, 2H) 5,85 (t, J=6,62 398 ΕΡ 1 560 827/ΡΤExample 427 N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-thieno [2 , 3-e] [1,2,4] thiadiazin-7-yl) methyl] ethanesulfonamide To a solution of the product of Example 353E (16.1 mg, 0.036 mmol) in N, N-dimethylformamide (0.4 mL ) was added triethylamine (0.011 mL, 0.079 mmol). The mixture was cooled to 0 ° C and ethanesulfonyl chloride (0.0036 mL, 0.038 mmol) was added. The mixture was warmed to 23øC and stirred for 2 hours. The reaction mixture was concentrated under reduced pressure. The residue was purified by reverse phase chromatography, eluting with a gradient of 10% acetonitrile in 0.1% trifluoroacetic acid in water to 95% acetonitrile / 0.1% trifluoroacetic acid in water to give the title compound. (7.7 mg, 40%). The sodium salt of the title compound was prepared by adding 1N sodium hydroxide (0.029 mL, 0.0029 mmol) to a solution of the title compound (7.7 mg, 0.014 mmol) in water (0.4 mL) and stirring for thirty minutes. The reaction mixture was concentrated under reduced pressure. 1 H NMR (300 MHz, DMSO-d 6) δ 0.21 (bs, 2H) 0.46 (d, 2H) 0.99 (m, 1H) 1.19 (t, 3H) 3.01 (q, 2H ) 4.23 (s, 2 H) 5.85 (t, J = 6.62 398 ΕΡ 1 560 827 / ΡΤ

Hz, 1Η) 6,79 (s, 1Η) 6,93 (t, J=7,54 Hz, 1Η) 7,35 (t, J= 6,99 Hz, 2H) 7,59 (d, J=8,09 Hz, 1H) 7,95 (d, J=6,62 Hz, 1H).J = 7.54 Hz, 1Η), 7.35 (t, J = 6.99 Hz, 2 H), 7.59 (d, J = 8.09 Hz, 1 H) 7.95 (d, J = 6.62 Hz, 1 H).

Exemplo 428 77- [ (3 — {1— [ (ciclopropilmetil) amino] -4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l,l-dioxido-4H-tieno[2, 3-e] [1,2,4] — tiadiazin-7-ll)metll]propano-l-sulfonamida A uma solução do produto do Exemplo 353E (16,7 mg, 0,037 mmol) em N,N-dimetilformamida (0,4 mL) juntou-se trietilamina (0,011 mL, 0,079 mmol). A mistura foi arrefecida até 0°C e juntou-se cloreto de 1-propanossulfonilo (0,005 mL, 0,041 mmol). A mistura foi aquecida até 23°C e agitada durante 1,5 horas. A mistura reaccional foi concentrada sob pressão reduzida. O resíduo foi purificado por cromatografia em fase inversa, eluindo com um gradiente de 10% de acetonitrilo/ácido trif luoroacético a 0,1% em água para 95% de acetonitrilo/ ácido trifluoroacético a 0,1% em água para gerar o composto em título (9,9 mg, 48%). XH RMN (300 MHz, DMSO-d6) δ 0,15 (d, J=4,04 Hz, 2H) 0,42 (d, J=7,35 Hz, 2H) 0,99 (m, 4H) 1,69 (m, 2H) 2,84 (d, J=7,35 Hz, 2H) 3,06 (m, 2H) 4,27 (d, J= 6,25 Hz, 2H) 6,35 (bs, 1H) 7,37 (s, 1H) 7,42 (t, J=7,54 Hz, 2H) 7,75 (t, J=6, 07 Hz, 1H) 7,87 (t, J=7,17 Hz, 1H) 8,07 (d, J=8,46 Hz, 1H) 8,15 (dd, 1H) 14,52 (bs, 1H) .Example 428 77 - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-thieno [2 , 3-e] [1,2,4] thiadiazin-7-yl) methyl] propane-1-sulfonamide To a solution of the product of Example 353E (16.7 mg, 0.037 mmol) in N, N -dimethylformamide ( 0.4 mL) was added triethylamine (0.011 mL, 0.079 mmol). The mixture was cooled to 0 ° C and 1-propanesulfonyl chloride (0.005 mL, 0.041 mmol) was added. The mixture was warmed to 23 ° C and stirred for 1.5 hours. The reaction mixture was concentrated under reduced pressure. The residue was purified by reverse phase chromatography, eluting with a gradient of 10% acetonitrile / 0.1% trifluoroacetic acid in water to 95% acetonitrile / 0.1% trifluoroacetic acid in water to give the title compound. (9.9 mg, 48%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.15 (d, J = 4.04 Hz, 2 H) 0.42 (d, J = 7.35 Hz, 2 H) 0.99 (m, 4H) 1 (D, J = 7.35 Hz, 2 H) 3.06 (m, 2 H) 4.27 (d, J = 6.25 Hz, 2 H) 6.35 (bs, 1H), 7.37 (s, 1H) 7.42 (t, J = 7.54 Hz, 2 H) 7.75 (t, J = 6.07 Hz, 1 H) 7.87 (t, J = 7) , 17 Hz, 1 H) 8.07 (d, J = 8.46 Hz, 1 H) 8.15 (dd, 1 H) 14.52 (bs, 1H).

Exemplo 429 N- [(3 — {1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l,l-dioxido-4H-tieno[2,3-e] [1,2,4]-tiadiazin-7-il)metil]propano-2-sulfonamida A uma solução do produto do Exemplo 353E (16,2 mg, 0,036 mmol) em N,N-dimetilformamida (0,4 mL) juntou-se trietilamina (0,011 mL, 0,079 mmol). A mistura foi arrefecida até 0°C e juntou-se cloreto de isopropilsulfonilo (0,0043 mL, 0,038 mmol). A mistura foi aquecida até 23°C e agitada durante 3 horas. Juntou-se cloreto de isopropilsulfonilo adicional (0,006 mL, 0,055 mmol) e a mistura reaccional foi agitada a 23°C durante 15 horas. A mistura reaccional foi agitada a 50°C durante 2 horas. Juntaram-se mais trietilamina (0,040 mL, 0,287 mmol) e cloreto de isopropilsulfonilo (0,010 mL, 0,091 mmol) e a mistura reaccional foi agitada a 50°C durante 2 horas. A mistura reaccional foi arrefecida até 25°C e 399 ΕΡ 1 560 827/ΡΤ concentrada sob pressão reduzida. O resíduo foi purificado por cromatografia em fase inversa, eluindo com um gradiente de 10% de acetonitrilo/ácido trifluoroacético a 0,1% em água para 95% de acetonitrilo/ácido trifluoroacético a 0,1% em água para gerar o composto em título (6,7 mg, 33%). O sal de sódio do composto em título foi preparado de acordo com o procedimento do Exemplo 1D. XH RMN (300 MHz, DMSO-d6) δ 0,21 (bs, 2H) 0,48 (d, 2H) 0,98 (m, 1H) 1,24 (d, J= 6,99 Hz, 6H) 3,19 (m, 1H) 4,25 (s, 2H) 5,85 (t, 1H) 6,76 (S, 1H) 6,92 (t, 1H) 7,34 (m, 2H) 7,57 (d, 1H) 7,96 (d, 1H).Example 429 N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-thieno [2 , 3-e] [1,2,4] thiadiazin-7-yl) methyl] propane-2-sulfonamide To a solution of the product of Example 353E (16.2 mg, 0.036 mmol) in N, N -dimethylformamide ( 0.4 mL) was added triethylamine (0.011 mL, 0.079 mmol). The mixture was cooled to 0 ° C and isopropylsulfonyl chloride (0.0043 mL, 0.038 mmol) was added. The mixture was warmed to 23øC and stirred for 3 hours. Additional isopropylsulfonyl chloride (0.006 mL, 0.055 mmol) was added and the reaction mixture was stirred at 23 ° C for 15 hours. The reaction mixture was stirred at 50 ° C for 2 hours. Further triethylamine (0.040 mL, 0.287 mmol) and isopropylsulfonyl chloride (0.010 mL, 0.091 mmol) were added and the reaction mixture was stirred at 50 ° C for 2 hours. The reaction mixture was cooled to 25 ° C and concentrated under reduced pressure. The residue was purified by reverse phase chromatography, eluting with a gradient of 10% acetonitrile / 0.1% trifluoroacetic acid in water to 95% acetonitrile / 0.1% trifluoroacetic acid in water to give the title compound (6.7 mg, 33%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d 6) δ 0.21 (bs, 2H) 0.48 (d, 2H) 0.98 (m, 1H) 1.24 (d, J = 6.99 Hz, 6H) 1H NMR (CDCl3): Î'2.19 (m, 1H) 4.25 (s, 2H) 5.85 (t, 1H) 6.76 (s, 1H) 6.92 (t, 57 (d, 1 H) 7.96 (d, 1 H).

Exemplo 430 N- [(3 — {1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l,l-dioxido-4fl-tieno[2,3-e][1,2,4] — tiadiazin-7-il)metil]benzenossulfonamida A uma solução do produto do Exemplo 353E (16,9 mg, 0,038 mmol) em N,N-dimetilformamida (0,4 mL) juntou-se trietilamina (0,012 mL, 0,083 mmol) e cloreto de benzenossulfonilo (0,006 mL, 0,042 mmol). A mistura reaccional foi agitada a 23°C durante 0,75 horas. A mistura reaccional foi concentrada sob pressão reduzida. O resíduo foi purificado por cromatografia em fase inversa, eluindo com um gradiente de 10% de acetonitrilo/ácido trifluoroacético a 0,1% em água para 95% de acetonitrilo/ácido trifluoroacético a 0,1% em água para gerar o composto em título (10,7 mg, 48%). XH RMN (300 MHz, DMSO-d6) δ 0,14 (d, J=4,04 Hz, 2H) 0,41 (d, J=7,72 Hz, 2H) 1,01 (m, J=7, 54, 7, 54 Hz, 1H) 2,83 (d, J=6,99 Hz, 2H) 4,07 (d, J= 6,25 Hz, 2H) 6,38 (bs, 1H) 7,30 (s, 1H) 7,41 (t, J=7,54Example 430 N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4'-thieno [2 , 3-e] [1,2,4] thiadiazin-7-yl) methyl] benzenesulfonamide To a solution of the product of Example 353E (16.9 mg, 0.038 mmol) in N, N-dimethylformamide (0.4 mL ) was added triethylamine (0.012 mL, 0.083 mmol) and benzenesulfonyl chloride (0.006 mL, 0.042 mmol). The reaction mixture was stirred at 23 ° C for 0.75 hours. The reaction mixture was concentrated under reduced pressure. The residue was purified by reverse phase chromatography, eluting with a gradient of 10% acetonitrile / 0.1% trifluoroacetic acid in water to 95% acetonitrile / 0.1% trifluoroacetic acid in water to give the title compound (10.7 mg, 48%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.14 (d, J = 4.04 Hz, 2 H) 0.41 (d, J = 7.72 Hz, 2 H) 1.01 (m, J = 7) (D, J = 6.99 Hz, 2 H) 4.07 (d, J = 6.25 Hz, 2 H) 6.38 (bs, 1H) 7, 30 (s, 1 H) 7.41 (t, J = 7.54

Hz, 1H) 7,65 (m, 3H) 7,86 (m, 3H) 8,06 (d, J=8,82 Hz, 1H) 8,15 (d, J= 6,99 Hz, 1H) 8,42 (t,J=6,25 Hz, 1H) 14,43 (bs, 1H) .(D, J = 6.99 Hz, 1 H) 8.15 (d, J = 6.99 Hz, 1 H) 7.65 (m, 3H) 7.86 (m, 3H) 8.42 (t, J = 6.25 Hz, 1 H) 14.43 (bs, 1H).

Exemplo 431 N-[(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l, l-dioxido-4H-tieno[2,3-e] [1,2,4] — tiadiazin-7-il)metil]-1-fenilmetanossulfonamida A uma solução do produto do Exemplo 353E (16,5 mg, 0,037 mmol) em N,N-dimetilformamida (0,4 mL) juntou-se trietilamina (0,011 mL, 0,079 mmol). A mistura foi arrefecida até 0°C e juntou-se cloreto de a-toluenossulfonilo (0,008 g, 0,041 mmol). A mistura reaccional foi aquecida até 23°C e agitada durante 400 ΕΡ 1 560 827/ΡΤ 0,5 horas. A mistura reaccional foi depois aquecida a 50°C e agitada durante 1,75 horas. Juntaram-se mais trietilamina (0,010 mL, 0,074 mmol) e cloreto de α-toluenossulfonilo (0,007 g, 0,037 mmol) e a mistura reaccional foi agitada a 23°C durante 1 hora. A mistura reaccional foi concentrada sob pressão reduzida. O resíduo foi purificado por cromatografia em fase inversa, eluindo com um gradiente de 10% de acetonitrilo/ácido trifluoroacético a 0,1% em água para 95% de acetonitrilo/ácido trifluoroacético a 0,1% em água para gerar o composto em título (7,7 mg, 35%). ^ RMN (300 MHz, DMSO-d6) δ 0,15 (d, J=4,04 Hz, 2H) 0,42 (d, J=7, 72 Hz, 2H) 1,00 (m, 1H) 2,84 (d, J= 7,35 Hz, 2H) 4,23 (d, J=5,52 Hz, 2H) 4,44 (s, 2H) 6,37 (bs, 1H) 7,32 (s, 1H) 7,42 (m, 6H) 7,86 (m, 2H) 8,07 (d, J=8,46 Hz, 1H) 8,16 (dd, 1H) 14,50 (bs, 1H) .Example 431 N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-thieno [2 , 3-e] [1,2,4] thiadiazin-7-yl) methyl] -1-phenylmethanesulfonamide To a solution of the product of Example 353E (16.5 mg, 0.037 mmol) in N, N -dimethylformamide , 4 mL) was added triethylamine (0.011 mL, 0.079 mmol). The mixture was cooled to 0 ° C and α-toluenesulfonyl chloride (0.008 g, 0.041 mmol) was added. The reaction mixture was warmed to 23 ° C and stirred for 400 Ρ Ρ 1 560 827 ΡΤ 0.5 hours. The reaction mixture was then warmed to 50 ° C and stirred for 1.75 hours. Additional triethylamine (0.010 mL, 0.074 mmol) and α-toluenesulfonyl chloride (0.007 g, 0.037 mmol) were added and the reaction mixture was stirred at 23 ° C for 1 hour. The reaction mixture was concentrated under reduced pressure. The residue was purified by reverse phase chromatography, eluting with a gradient of 10% acetonitrile / 0.1% trifluoroacetic acid in water to 95% acetonitrile / 0.1% trifluoroacetic acid in water to give the title compound (7.7 mg, 35%). NMR (300 MHz, DMSO-d 6) δ 0.15 (d, J = 4.04 Hz, 2 H) 0.42 (d, J = 7.72 Hz, 2 H) 1.00 (m, 1H) 2 (D, J = 5.52 Hz, 2 H) 4.44 (s, 2 H) 6.37 (bs, 1 H) 7.32 (s, 1H), 8.16 (dd, 1H), 14.50 (bs, 1H), 8.46 (m, .

Exemplo 432A 1- (ciclobutilamino) -4-hidroxiquinolin-2 (1H) -onaExample 432A 1- (Cyclobutylamino) -4-hydroxyquinolin-2 (1H) -one

Uma solução do produto do Exemplo 350A (0,516 g, 2,9 mmol) e ciclobutanona (1,05 g, 15,0 mmol) em ácido acético (0,90 g, 15,0 mmol) e metanol (20 mL) foi tratada em porções com cianoboro-hidreto de sódio (0,94 g, 15,0 mmol), agitada durante 48 horas e concentrada. O resíduo foi tratado com bicarbonato de sódio 0,5M aquoso, acidificado a pH 2 com ácido clorídrico 1M e extraído com acetato de etilo. O acetato de etilo foi lavado com salmoura, seco sobre sulfato de sódio, filtrado e concentrado. O material em bruto foi cromatografado em sílica gel eluindo com hexano/acetato de etilo 3:2 para gerar o composto em título (0, 400 g, 60%). MS (ESI+) m/z 231 (M+H)+. XH RMN (300 MHz, DMSO-d6) δ 1,52 (m, 1H) 1,63 (m, 1H) 1,96 (m, 4H) 3,64 (m, 1H) 5,91 (s, 1H) 6,26 (d, J= 6,62 Hz, 1H) 7,20 (t, J=8,09 Hz, 1H) 7,61 (m, 1H) 7,84 (m, 2H) 11,42 (s, 1H) .A solution of the product of Example 350A (0.516 g, 2.9 mmol) and cyclobutanone (1.05 g, 15.0 mmol) in acetic acid (0.90 g, 15.0 mmol) and methanol (20 mL) treated portionwise with sodium cyanoborohydride (0.94 g, 15.0 mmol), stirred for 48 hours and concentrated. The residue was treated with 0.5M aqueous sodium bicarbonate, acidified to pH 2 with 1M hydrochloric acid and extracted with ethyl acetate. The ethyl acetate was washed with brine, dried over sodium sulfate, filtered and concentrated. The crude material was chromatographed on silica gel eluting with 3: 2 hexane / ethyl acetate to give the title compound (0. 400 g, 60%). MS (ESI +) m / z 231 (M + H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 1.52 (m, 1H) 1.63 (m, 1H) 1.96 (m, 4H) 3.64 (m, 1H) 5.91 (s, 1H ) 6.26 (d, J = 6.62 Hz, 1 H) 7.20 (t, J = 8.09 Hz, 1 H) 7.61 (m, 1 H) 7.84 (m, 2 H) 11.42 (s, 1H).

Exemplo 432B 3-[bis(metiltio)metileno]-1-(ciclobutilamino)quinolina-2, 4(1H, 3H)-dionaExample 432B 3- [Bis (methylthio) methylene] -1- (cyclobutylamino) quinoline-2,4 (1H, 3H) -dione

Uma solução do produto do Exemplo 432A (0,115 g, 0,5 mmol) e metilsulfato de tris(metiltio)metilo (preparado utilizando o procedimento em Synthesis, 22-25, 1988; M.A solution of the product of Example 432A (0.115 g, 0.5 mmol) and tris (methylthio) methyl methylsulfate (prepared using the procedure in Synthesis, 22-25, 1988; M.

Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. 401 ΕΡ 1 560 827/ΡΤBarbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. 401 ΕΡ 1 560 827 / ΡΤ

Regondi) (0,27 g, 1,0 mmol) em piridina (0,316 g, 4,0 mmol) e dioxano (5,0 mL) foi aquecida a 60°C durante 30 minutos.Regione) (0.27 g, 1.0 mmol) in pyridine (0.316 g, 4.0 mmol) and dioxane (5.0 mL) was heated at 60 ° C for 30 minutes.

Juntou-se mais metilsulfato de tris(metiltio)metilo (0,27 g, 1,0 mmol) e o aquecimento foi continuado durante 30 minutos. A mistura foi arrefecida até 25°C e repartida entre acetato de etilo e água. A fase de acetato de etilo foi lavada com água, salmoura, seca sobre sulfato de sódio, filtrada e concentrada. O material em bruto foi cromatografado em sílica gel eluindo com diclorometano/acetato de etilo 95/5 para gerar o composto em título (0,146 g, 87% de rendimento). MS (ESI+) m/z 335 (M+H)+. RMN (300 MHz, DMSO-dê) δ 1,54 (m, 1H) 1,66 (m, 1H) 1,99 (m, 4H) 2,61 (s, 6H) 3,62 (m, 1H) 6,18 (d, J=6,25 Hz, 1H) 7,15 (t, J=7,54 , Hz, 1H) 7,63 (m, 1H) 7,72 (d, J=8,09 Hz, 1H) 7,98 (dd, J=7,91, 1,29 Hz, 1H).More tris (methylthio) methyl methyl sulphate (0.27 g, 1.0 mmol) was added and heating was continued for 30 minutes. The mixture was cooled to 25 ° C and partitioned between ethyl acetate and water. The ethyl acetate layer was washed with water, brine, dried over sodium sulfate, filtered and concentrated. The crude material was chromatographed on silica gel eluting with dichloromethane / ethyl acetate 95/5 to give the title compound (0.146 g, 87% yield). MS (ESI +) m / z 335 (M + H) +. NMR (300 MHz, DMSO-d6) δ 1.54 (m, 1H) 1.66 (m, 1H) 1.99 (m, 4H) 2.61 (s, 6H) 3.62 (m, 1H) J = 7.54 Hz, 1H), 7.63 (m, 1H), 7.72 (d, J = 8.09, Hz, 1 H) 7.98 (dd, J = 7.91, 1.29 Hz, 1 H).

Exemplo 432C N—{3-[1—(ciclobutilamino)-4-hidroxi-2-oxo-l,2-di-hidro-quinolin-3-il]-1,l-dioxido-4H 1,2,4-benzotiadiazin-7-il}-metanossulfonamida A mistura do produto do Exemplo 425D (0,195 g, 0,585 mmol, 1,5 eq.) e do produto do Exemplo 432B (0,100 g, 0,390 mmol, 1,5 eq.) em dioxano anidro (10 mL) foi aquecida durante 1 hora a 120°C. Após arrefecimento até 25°C, a mistura reaccional foi tratada com metanol (20 mL) e éter dietílico (20 mL) e o produto precipitado recolhido por filtração sob vácuo para gerar o composto em título (25 mg, 12% de rendimento). XH RMN (300 MHz, DMSO-d6) δ 1,69 (m, 2H) 2,13 (m, 4H) 3,10 (s, 3H) 3,77 (m, 1H) 6,57 (s, 1H) 7,44 (t, J=7,35 Hz, 1H) 7,65 (m, 3H) 7,89 (t, J=7,35 Hz, 1H) 8,06 (d, J=8,46 Hz, 1H) 8,16 (d, J=7,72 Hz, 1H) 10,31 (S, 1H) 14,16 (s, 1H) 15,03 (S, 1H). MS (ESI+) m/z=504 (M+H)+.Example 432C N- {3- [1- (Cyclobutylamino) -4-hydroxy-2-oxo-1,2-dihydro-quinolin-3-yl] -1,1-dioxido-4H-1,2,4- The product of Example 425D (0.195 g, 0.585 mmol, 1.5 eq.) and the product of Example 432B (0.100 g, 0.390 mmol, 1.5 eq) in anhydrous dioxane (10 mL) was heated for 1 hour at 120 ° C. After cooling to 25 ° C, the reaction mixture was treated with methanol (20 mL) and diethyl ether (20 mL) and the precipitated product collected by vacuum filtration to give the title compound (25 mg, 12% yield). 1 H NMR (300 MHz, DMSO-d 6) δ 1.69 (m, 2H) 2.13 (m, 4H) 3.10 (s, 3H) 3.77 (m, 1H) 6.57 (s, 1H ) 7.44 (t, J = 7.35 Hz, 1 H) 7.65 (m, 3 H) 7.89 (t, J = 7.35 Hz, 1 H) 8.06 (d, J = 8.46 Hz, 1H) 8.16 (d, J = 7.72 Hz, 1H) 10.31 (S, 1H) 14.16 (s, 1H) 15.03 (s, 1H). MS (ESI +) m / z = 504 (M + H) +.

Exemplo 433 N-(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il}-l,l-dioxido-4fl-l,2,4-benzotiadiazin-7-il)metanossulfonamidaExample 433 N- (3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido- 4-benzothiadiazin-7-yl) methanesulfonamide

Uma solução do produto do Exemplo 353B (0, 090 g, 0,269 mmol, 1 eq.) e do produto do Exemplo 425D (0,071g, 0,269 mmol, 1 eq.) em dioxano anidro (5 mL) foi aquecida durante 1 hora a 120°C. Após arrefecimento da mistura reaccional até 25°C, 402 ΕΡ 1 560 827/ΡΤ juntou-se metanol (20 mL) e éter dietílico (20 mL) e o produto precipitado foi recolhido por filtração sob vácuo para gerar o composto em titulo (21 mg, 15,5% de rendimento). XH RMN (300 MHz, DMSO-dê) δ 0,16 (m, 2H) 0,41 (m, 2H) 1,07 (m, 1H) 2,85 (m, 2H) 3,10 (s, 3H) 6,44 (m, 1H) 7,44 (t, J=7,54 Hz, 1H) 7,62 (m, 2H) 7,71 (m, 1H) 7,90 (t, J=7,91 Hz, 1H) 8,10 (d, J=8,46 Hz, 1H) 8,17 (d, J= 6,99 Hz, 1H) 10,30 (m, 1H) 14,15 (m, 1H) . MS (ESI+) m/z=504 (M+H)+.A solution of the product of Example 353B (0.090 g, 0.269 mmol, 1 eq.) And the product of Example 425D (0.071g, 0.269 mmol, 1 eq.) In anhydrous dioxane (5 mL) was heated for 1 hour at 120øC. After cooling the reaction mixture to 25 ° C, methanol (20 mL) and diethyl ether (20 mL) were added and the precipitated product was collected by vacuum filtration to give the title compound (21 mg). mg, 15.5% yield). 1 H NMR (300 MHz, DMSO-d 6) δ 0.16 (m, 2H) 0.41 (m, 2H) 1.07 (m, 1H) 2.85 (m, 2H) 3.10 (s, 3H) ) 7.44 (t, J = 7.54 Hz, 1 H) 7.62 (m, 2 H) 7.71 (m, (D, J = 8.46 Hz, 1 H) 8.17 (d, J = 6.99 Hz, 1 H) 10.30 (m, 1 H) 14.15 (m, 1H ). MS (ESI +) m / z = 504 (M + H) +.

Exemplo 434 4-hidroxi-3-[8-(hidroximetil)-1,l-dioxido-4,9-di-hidro-imidazo[4,5-h] [1,2,4]benzotiadiazin-3-il]-1-(3-metilbutil)-1,8-naftiridin-2(1H)-ona O produto do Exemplo 377 (14 mg, 0,033 mmol) foi tratado com HC1 4N (0,5 mL) e ácido glicólico (4 mg, 0,052 mmol) e a mistura resultante foi aquecida a refluxo durante 24 horas. A mistura foi concentrada sob pressão reduzida até um sólido branco pastoso. O sólido foi purificado por cromatografia em sílica gel eluindo com diclorometano:metanol 95:5 para gerar o composto em título (10 mg, 63%) . O composto em título foi convertido no sal de sódio como descrito no Exemplo 1D. MS (ESI + ) m/z: 483. XH RMN (300 MHz, DMSO-d6) δ 0,97 (d, J=6,25Example 434 4-Hydroxy-3- [8- (hydroxymethyl) -1,1-dioxido-4,9-dihydro-imidazo [4,5- h] [1,2,4] benzothiadiazin-3-yl] The product from Example 377 (14 mg, 0.033 mmol) was treated with 4N HCl (0.5 mL) and glycolic acid (4 mg, , 0.052 mmol) and the resulting mixture was heated to reflux for 24 hours. The mixture was concentrated under reduced pressure to a white pasty solid. The solid was purified by silica gel chromatography eluting with 95: 5 dichloromethane: methanol to give the title compound (10 mg, 63%). The title compound was converted to the sodium salt as described in Example 1D. MS (ESI +) m / z: 483. 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (d, J = 6.25

Hz, 6H) 1,50 (s, 1H) 1,64 (d, J=6,99 Hz, 1H) 3,87 (s, 1H) 4,08 (d, J=6,62 Hz, 1H) 4,30 (d, J=6,99 Hz, 1H) 4,54 (s, 1H) 4,66 (d, J=6,62 Hz, 1H) 4,73 (s, 1H) 5,33 (d, J=6,62 Hz, 1H) 7,04 (d, J=8, 82 Hz, 1H) 7,14 (dd, J=7,35, 4, 78 Hz, 1H) 7,76 (d, J=8,82 Hz, 1H) 8,39 (dd, J=7, 54, 2,02 Hz, 1H) 8,53 (m, 1H) 12, 49 (s, 1H) .(D, J = 6.62 Hz, 1 H), 3.87 (s, 1 H) 4.30 (d, J = 6.99 Hz, 1 H) 4.54 (s, 1 H) 4.66 (d, J = 6.62 Hz, 1 H) 4.73 (s, d, J = 6.62 Hz, 1 H) 7.04 (d, J = 8.82 Hz, 1 H) 7.14 (dd, J = 7.35, 4.78 Hz, , J = 8.82 Hz, 1 H) 8.39 (dd, J = 7, 54, 2.02 Hz, 1 H) 8.53 (m, 1 H) 12.49 (s, 1H).

Exemplo 435A ({3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4ff-l,2,4-benzotiadiazin-7-il}amino)sulfonilcarbamato de 2-cloroetiloExample 435A ({3- [4-Hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido- 1,2,4-benzothiadiazin-7-yl} amino) sulfonylcarbamate

Uma solução de isocianato de clorossulfonilo (33 mg, 0,23 mmol) em diclorometano (8 mL) foi arrefecida até 0°C e juntou-se 2-cloroetanol (18,8 mg, 0,23 mmol) gota a gota. A mistura foi agitada a 0°C durante 90 minutos seguido da adição de uma solução contendo o produto do Exemplo 205 (100 mg, 0,23 mmol) e trietilamina (71 mg, 0,70 mmol) em diclorometano (2 mL) . A mistura foi agitada durante 24 horas a 25°C e depois repartida 403 ΕΡ 1 560 827/ΡΤ entre diclorometano (25 mL) e ácido clorídrico IN aquoso (20 mL) . A resultante fase orgânica foi separada e seca sobre sulfato de magnésio, filtrada e concentrada sob pressão reduzida para proporcionar o composto em título (96 mg, 67%). MS (ESI') m/z 611 (M-H)'. ΧΗ RMN (300 MHz, DMSO-d6) δ 0,98 (d, J=6,62 Hz, 6H) 1,57 (m, 2H) 1,69 (m, 1H) 3,78 (m, 2H) 4,32 (m, 2H) 4,49 (m, 2H) 7,51 (m, 2H) 7,63 (s, 1H) 7,77 (d, J=9,19 Hz, 1H) 8,56 (dd, J=7,72, 1,10 Hz, 1H) 8,90 (dd, J=4,41, 1,47 Hz, 1H) 11,15 (S, 1H) 12,26 (S, 1H) 14,10 (S, 1H).A solution of chlorosulfonyl isocyanate (33 mg, 0.23 mmol) in dichloromethane (8 mL) was cooled to 0 ° C and 2-chloroethanol (18.8 mg, 0.23 mmol) was added dropwise. The mixture was stirred at 0øC for 90 minutes followed by the addition of a solution containing the product of Example 205 (100 mg, 0.23 mmol) and triethylamine (71 mg, 0.70 mmol) in dichloromethane (2 mL). The mixture was stirred for 24 hours at 25øC and then partitioned between dichloromethane (25 mL) and aqueous 1N hydrochloric acid (20 mL). The resulting organic phase was separated and dried over magnesium sulfate, filtered and concentrated under reduced pressure to give the title compound (96 mg, 67%). MS (ESI +) m / z 611 (M-H) +. 1 H NMR (300 MHz, DMSO-d 6) δ 0.98 (d, J = 6.62 Hz, 6H) 1.57 (m, 2H) 1.69 (m, 1H) 3.78 (m, 2H) 4.32 (m, 2H) 4.49 (m, 2H) 7.51 (m, 2H) 7.63 (s, 1H) 7.77 (d, J = 9.19 Hz, 1H) 8.56 (dd, J = 4.71, 1.47 Hz, 1 H) 11.15 (s, 1 H) 12.26 (s, 1H ) 14.10 (s, 1H).

Exemplo 435B N-{3-[4-hidroxi-l-(3-metilbutil)-2-oxo-l, 2-di-hidro-1,8-naftiridin-3-il]-1,l-dioxido-4fl-l,2,4-benzotiadiazin-7-il}-2-oxo-l,3-oxazolidina-3-sulfonamida A uma solução do produto do Exemplo 435A (90 mg, 0,147 mmol) em diclorometano (10 mL) juntou-se trietilamina (1 mL) . A mistura foi agitada a 25°C durante 6 horas. A reacção foi tratada com ácido clorídrico IN aquoso (10 mL) e extraída com diclorometano (20 mL) . A fase orgânica foi separada e seca sobre sulfato de magnésio, filtrada e concentrada sob pressão reduzida para proporcionar o composto em título como um sólido incolor (70 mg, 82%). XH RMN (300 MHz, DMSO-d6) δ 0,98 (d, J=6,62 Hz, 6H) 1,57 (m, 2H) 1,69 (m, 1H) 3,98 (m, 2H) 4,36 (m, 2H) 4,48 (m, 2H) 7,49 (dd, J=7, 72, 4, 78 Hz, 1H) 7,60 (m, 1H) 7,62 (s, 1H) 7,75 (d, J=8,82 Hz, 1H) 8,56 (m, 1H) 8,89 (m, 1H) 11,59 (s, 1H) 14,15 (s, 1H).Example 435B N- {3- [4-hydroxy-1- (3-methylbutyl) -2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl] -1,1-dioxido- To a solution of the product of Example 435A (90 mg, 0.147 mmol) in dichloromethane (10 mL) was cooled to 0 ° C. was added triethylamine (1 mL). The mixture was stirred at 25 ° C for 6 hours. The reaction was treated with aqueous 1N hydrochloric acid (10 mL) and extracted with dichloromethane (20 mL). The organic phase was separated and dried over magnesium sulfate, filtered and concentrated under reduced pressure to provide the title compound as a colorless solid (70 mg, 82%). 1 H NMR (300 MHz, DMSO-d 6) δ0.98 (d, J = 6.62 Hz, 6H) 1.57 (m, 2H) 1.69 (m, 1H) 3.98 (m, 2H) 4.36 (m, 2H) 4.48 (m, 2H) 7.49 (dd, J = 7.72, 4.78 Hz, 1 H) 7.60 (m, 1 H) 7.62 (s, 1H ) 7.75 (d, J = 8.82 Hz, 1 H) 8.56 (m, 1 H) 8.89 (m, 1 H) 11.59 (s, 1 H) 14.15 (s, 1H).

Exemplo 435C N-[ 3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro- 1,8-naftiridin-3-il)-1,l-dioxido-4ff-l,2,4-benzotiadiazin- 7-il] -N'-(2-feniletil)sulfamidaExample 435C N- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl) -1,1-dioxido-4 H -1,2 , 4-benzothiadiazin-7-yl] -N '- (2-phenylethyl) sulfamide

Uma mistura do produto do Exemplo 435B (28 mg, 0,05 mmol) e fenetilamina (6 mg, 0,05 mmol) em acetonitrilo (10 mL) e trietilamina (0,5 mL) foi aquecida a refluxo durante 18 horas. A mistura reaccional foi arrefecida até 25°C, diluída com acetato de etilo, extraída com 10 ml de HC1 IN, seguido de 10 mL de salmoura. A fase orgânica foi seca sobre Na2S04 anidro, filtrada e concentrada sob vácuo. O produto foi isolado por cromatografia de camada fina preparativa em sílica gel eluindo com 25% de acetato de etilo em diclorometano para proporcionar 404 ΕΡ 1 560 827/ΡΤ 2 mg do composto em título (10% de rendimento) . XH RMN (300 MHz, DMSO-de) δ 0,98 (d, J=6,62 Hz, 6H) 1,57 (m, 2H) 1,69 (m, 1H) 2,68 (m, 2H) 3,09 (m, 2H) 4,49 (m, 2H) 7,20 (m, 5H) 7,46 (m, 1H) 7,51 (m, 1H) 7,60 (d, J=2,21 Hz, 1H) 7,68 (d, J= 8,82A mixture of the product of Example 435B (28 mg, 0.05 mmol) and phenethylamine (6 mg, 0.05 mmol) in acetonitrile (10 mL) and triethylamine (0.5 mL) was heated at reflux for 18 hours. The reaction mixture was cooled to 25øC, diluted with ethyl acetate, extracted with 10 mL of 1N HCl, followed by 10 mL of brine. The organic layer was dried over anhydrous Na2 SO4, filtered and concentrated under vacuum. The product was isolated by preparative thin layer chromatography on silica gel eluting with 25% ethyl acetate in dichloromethane to provide 404 g of the title compound (10% yield). 1 H NMR (300 MHz, DMSO-d 6) δ 0.98 (d, J = 6.62 Hz, 6H) 1.57 (m, 2H) 1.69 (m, (M, 5H), 7.46 (m, 1H), 7.51 (m, 1H), 7.60 (d, J = 2, 21 Hz, 1 H) 7.68 (d, J = 8.82

Hz, 1H) 7,97 (m, 1H) 8,56 (dd, J=8, 09, 1,84 Hz, 1H) 8,89 (m, 1H) 10,28 (s, 1H) 14,13 (s, 1H) 15,23 (s, 1H).1H), 8.89 (m, 1H), 8.28 (s, 1H), 14.13 (dd, J = (s, 1 H) 15.23 (s, 1 H).

Exemplo 436 3-[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il)-1, l-dioxido-4H-l, 2, 4-benzotiadlazln-7-il] diazatlano-1-carboxilato de benzilo, 2,2-dióxidoExample 436 3- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido-4H-1,2 , Benzyl 4-benzothiazol-7-yl] diazatlan-1-carboxylate, 2,2-dioxide

Uma solução de isocianato de clorossulfonilo (24,5 pL, 0,281 mmol) em diclorometano (2 mL) foi tratada gota a gota com álcool benzílico (29 pL, 0,281 mmol) a 25°C, agitada a 25°C durante 30 minutos, tratada com uma solução do produto do Exemplo 205 (100 mg, 0,234 mmol) e trietilamina (130 pL, 0,936 mmol) em diclorometano (3 mL) e agitada durante 2 horas a 25°C. A mistura reaccional foi tratada com diclorometano (10 mL) e ácido clorídrico IN aquoso (10 mL) . A fase orgânica resultante foi separada e seca sobre sulfato de magnésio, filtrada e concentrada sob pressão reduzida para proporcionar o composto em título (122 mg, 81%). MS (ESI&quot;) m/z 639 (M-H)-. :Η RMN (300 MHz, DMSO-d6) δ 0,99 (d, J= 6,6 Hz, 6H) , 1,59 (m, 2H), 1,66 (m, 1H) , 4,49 (m, 2H) , 5,12 (s, 2H) , 7,32 (m, 5H), 7,48 (m, 2H), 7,65 (d, J= 2,2 Hz, 1H), 7,75 (d, J= 8,8 Hz, 1H), 8,57 (dd, J= 7,7, 1,8 Hz, 1H) , 8,90 (dd, J= ,8, 1,8 Hz, 1H), 11,17 (s, 1H), 12,19 (bs, 1H), 14,11 (bs, 1H) .A solution of chlorosulfonyl isocyanate (24.5 μL, 0.281 mmol) in dichloromethane (2 mL) was treated dropwise with benzyl alcohol (29 μL, 0.281 mmol) at 25 ° C, stirred at 25 ° C for 30 minutes, treated with a solution of the product of Example 205 (100 mg, 0.234 mmol) and triethylamine (130 μL, 0.936 mmol) in dichloromethane (3 mL) and stirred for 2 hours at 25 ° C. The reaction mixture was treated with dichloromethane (10 mL) and aqueous 1N hydrochloric acid (10 mL). The resulting organic phase was separated and dried over magnesium sulfate, filtered and concentrated under reduced pressure to provide the title compound (122 mg, 81%). MS (ESI &lt; + &gt;) m / z 639 (M-H) -. NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.6 Hz, 6H), 1.59 (m, 2H), 1.66 (m, 1H), 4.49 (m, 7.65 (m, 2H), 7.12 (s, 2H), 7.32 (m, 5H), 7.48 (m, 2H), 7.65 (d, (Dd, J = 7.7, 1.8 Hz, 1H), 8.90 (dd, J = 1.8, 1.8 Hz, 1H), 11.17 (s, 1H), 12.19 (bs, 1H), 14.11 (bs, 1H).

Exemplo 437 N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il) -1, l-dioxido-4.fi 1,2, 4-benzotiadiazin-7-il] sulfamidaExample 437 N- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1dioxy- Benzothiadiazin-7-yl] sulfamide

Uma solução do produto do Exemplo 436 (40 mg, 0, 0625 mmol) em metanol (5 mL) foi tratada com paládio sobre carbono a 10% (20 mg) e agitada a 25°C durante 5 horas sob uma atmosfera de hidrogénio. A solução resultante foi depois filtrada e o filtrado concentrado sob pressão reduzida para proporcionar o composto em título (25 mg, 78%). MS (ESI-) m/z 505 (Μ-H)-. XH RMN (300 MHz, DMSO-d6) δ ppm 0,98 (d, J= 6,3A solution of the product of Example 436 (40 mg, 0.0625 mmol) in methanol (5 mL) was treated with 10% palladium on carbon (20 mg) and stirred at 25 ° C for 5 hours under an atmosphere of hydrogen. The resulting solution was then filtered and the filtrate concentrated under reduced pressure to provide the title compound (25 mg, 78%). MS (ESI-) m / z 505 (Μ-H) -. 1 H NMR (300 MHz, DMSO-d 6) δ ppm 0.98 (d, J = 6.3

Hz, 6H), 1,57 (m, 2H) , 1,66 (m, 1H), 4,42 (m, 2H), 7,38 (m, 405 ΕΡ 1 560 827/ΡΤ 1Η), 7,43 (m, 2Η) , 7,59 (m, 1Η), 8,52 (m, 1Η), 8,82 (bs, 1H), 9, 99 (bs, 1H) .(M, 1H), 4.42 (m, 2H), 7.38 (m, 405 eS-1, 560, 827/1), 7, 43 (m, 2 H), 7.59 (m, 1 H), 8.52 (m, 1 H), 8.82 (bs, 1H), 9.99 (bs, 1H).

Exemplo 438 3-[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il) -1, l-dioxido-4fl-l, 2, 4-benzotiadiazin-7-il] -1-propil-diazatiano-l-carboxilato de benzilo, 2,2-dióxidoExample 438 3- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido-4,11- , Benzyl 4-benzothiadiazin-7-yl] -1-propyl diazaine-1-carboxylate, 2,2-dioxide

Uma solução de trifenilfosfina (1,5 eq) em diclorometano é tratada gota a gota com azodicarboxilato de dietilo (1,5 eq) a 25°C. A solução é deixada a agitar durante 10 minutos, seguido de adição gota a gota de uma solução contendo o produto do Exemplo 436 (1 eq) e n-propanol (1,1 eq) em diclorometano. A solução resultante é agitada a 25°C durante 20 horas, seguido da adição de diclorometano e ácido cloridrico IN aquoso. A resultante fase orgânica é separada e seca sobre sulfato de magnésio e filtrada para proporcionar o composto em titulo.A solution of triphenylphosphine (1.5 eq) in dichloromethane is treated dropwise with diethyl azodicarboxylate (1.5 eq) at 25 ° C. The solution is allowed to stir for 10 minutes, followed by dropwise addition of a solution containing the product of Example 436 (1eq) and n-propanol (1.1eq) in dichloromethane. The resulting solution is stirred at 25 ° C for 20 hours, followed by the addition of dichloromethane and aqueous 1N hydrochloric acid. The resulting organic phase is separated and dried over magnesium sulfate and filtered to provide the title compound.

Exemplo 439 N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il)-1,l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il]-N'-propilsulfamidaExample 439 N- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido-4H-1,2 , 4-benzothiadiazin-7-yl] -N'-propylsulfamide

Uma solução do produto do Exemplo 438 em metanol é tratada com paládio sobre carbono a 10% e agitada a 25°C durante 5 horas sob uma atmosfera de hidrogénio. A solução resultante é depois filtrada e o filtrado concentrado sob pressão reduzida para proporcionar o composto em titulo.A solution of the product of Example 438 in methanol is treated with 10% palladium on carbon and stirred at 25 ° C for 5 hours under an atmosphere of hydrogen. The resulting solution is then filtered and the filtrate concentrated under reduced pressure to provide the title compound.

Exemplo 440 3-[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il)-1, l-dioxido-4ff-l, 2, 4-benzotiadiazin-7-il]diazatiano-1-carboxilato de metilo, 2,2-dióxidoExample 440 3- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido-4 H -1,2 , 4-benzothiadiazin-7-yl] diazatian-1-carboxylate, 2,2-dioxide

A uma solução agitada de isocianato de clorossulfonilo (4,9 pL, 0,0562 mmol) em diclorometano (2 mL) juntou-se gota a gota metanol (2,3 pL, 0,0562 mmol) a 25°C. Após 30 minutos, juntou-se uma solução do produto do Exemplo 205 (20 mg, 0,0468 mmol) e trietilamina (26 pL, 0,187 mmol) em diclorometano (2 mL) e agitou-se durante 24 horas a 25°C. A mistura reaccional foi diluída com diclorometano (10 mL) e ácido clorídrico IN 406To a stirred solution of chlorosulfonyl isocyanate (4.9 æL, 0.0562 mmol) in dichloromethane (2 mL) was added methanol (2.3 æL, 0.0562 mmol) at 25 øC. After 30 minutes, a solution of the product of Example 205 (20 mg, 0.0468 mmol) and triethylamine (26 μL, 0.187 mmol) in dichloromethane (2 mL) was added and stirred for 24 hours at 25 ° C. The reaction mixture was diluted with dichloromethane (10 mL) and hydrochloric acid IN 406

ΕΡ 1 560 827/PT aquoso (10 mL). A resultante fase orgânica foi separada e seca sobre sulfato de magnésio, filtrada e concentrada sob pressão reduzida para proporcionar o composto em titulo (12 mg, 39%) como um sal de trietilamina. XH RMN (300 MHz, DMSO-dé) δ 0,98 (d, J= 6,3 Hz, 3H), 1,38 (m, 2H) , 1,67 (m, 1H), 3,63 (s, 3H), 4,50 (m, 2H), 7,53 (m, 2H), 7,63 (d, J= 2,2 Hz, 1H) , 7,77 (d, J= 8,8 Hz, 1H), 8,57 (dd, J= 8,1, 1,8 Hz, 1H), 8,90 (dd, J= 4,4, 1,8 Hz, 1H), 11,15 (s, 1H), 12,10 (s, 1H) , 14,10 (S, 1H). MS (ESI&quot;) m/z 563 (M-H)&quot;.(10 mL). The resulting organic phase was separated and dried over magnesium sulfate, filtered and concentrated under reduced pressure to give the title compound (12 mg, 39%) as a triethylamine salt. 1 H NMR (300 MHz, DMSO-d 6) δ 0.98 (d, J = 6.3 Hz, 3H), 1.38 (m, 2H), 1.67 (m, 1H), 3.63 (D, J = 2.2 Hz, 1H), 7.77 (d, J = 8.8 Hz, 1H) 1H), 8.57 (dd, J = 8.1, 1.8 Hz, 1H), 8.90 (dd, J = 4.4, 1.8 Hz, 1H), 11.15 (s, 1H), 12.10 (s, 1H), 14.10 (s, 1H). MS (ESI &quot;) m / z 563 (M-H) &quot;.

Exemplo 441 3-[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il)-1,l-dioxido-4fl-l,2,4-benzotiadiazin-7-il]-1-metil-diazatiano-l-carboxilato de benzilo, 2,2-dióxidoExample 441 3- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido-4,11- , Benzyl 4-benzothiadiazin-7-yl] -1-methyl diazaheti-1-carboxylate, 2,2-dioxide

Uma solução do produto do Exemplo 436 (0, 032 g, 0,05 mmol) em tetra-hidrofurano/metanol 1:1 (2 ml) a -10°C foi tratada gota a gota com trimetilsilildiazometano (2,0M em hexanos, 50 pL, 0,1 mmol), foi depois agitada a 25°C durante 16 horas e concentrada sob pressão reduzida. O resíduo foi cromatografado em sílica gel eluindo com 3% de metanol em diclorometano para proporcionar o composto em título (5 mg, 15% de rendimento). XH RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,25 Hz, 6H) 1,58 (m, 2H) 1,69 (m, 1H) 3,21 (s, 3H) 4,49 (m, 2H) 5,19 (s, 2H) 7,32 (m, 5H) 7,46 (m, 1H) 7,51 (dd, J=7,91, 4,60 Hz, 1H) 7,58 (d, J=2,21 Hz, 1H) 7,68 (d, J=8,82 Hz, 1H) 8,57 (dd, J=8,09, 1,84 Hz, 1H) 8,90 (dd, J=4,78,l,47 Hz, 1H) 11,29 (s, 1H) 14,09 (s, 1H). MS (ESI) m/z 653 (M-H)-.A solution of the product of Example 436 (0.032 g, 0.05 mmol) in 1: 1 tetrahydrofuran / methanol (2 mL) at -10 ° C was treated dropwise with trimethylsilyldiazomethane (2.0M in hexanes, 50 μl, 0.1 mmol) was then stirred at 25 ° C for 16 hours and concentrated under reduced pressure. The residue was chromatographed on silica gel eluting with 3% methanol in dichloromethane to give the title compound (5 mg, 15% yield). 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.25 Hz, 6H) 1.58 (m, 2H) 1.69 (m, 1H) 3.21 (s, 3H) 4.49 (m, 2H) 5.19 (s, 2H) 7.32 (m, 5H) 7.46 (m, 1H) 7.51 (dd, J = 7.91, 4.60 Hz, 1H ) 7.58 (d, J = 2.21 Hz, 1 H) 7.68 (d, J = 8.82 Hz, 1 H) 8.57 (dd, J = 8.09, 1.84 Hz, 8.90 (dd, J = 4.78, 1.47 Hz, 1 H) 11.29 (s, 1 H) 14.09 (s, 1H). MS (ESI) m / z 653 (M-H) -.

Exemplo 442 N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il)-1, l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il] -N'-metilsulfamidaExample 442 N- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido-4H-1,2 , 4-benzothiadiazin-7-yl] -N'-methylsulfamide

Uma solução do produto do Exemplo 441 (14 mg, 0,0214 mmol) em metanol (3 mL) reagiu com paládio sobre carbono a 10% (10 mg) sob uma atmosfera de hidrogénio a 25°C com agitação durante 2 horas. A solução foi filtrada e concentrada sob pressão reduzida para proporcionar o composto em título (8 mg, 73%). XH RMN (300 MHz, DMSO-d6) δ 0,94 (d, J= 6,6 Hz, 6H), 1,57 (m, 2H), 1,69 (m, 1H), 2,49 (s, 3H), 4,45 (m, 2H), 7,50 407 ΕΡ 1 560 827/ΡΤ (m, 2Η), 7,62 (m, 2Η), 8,57 (m, 1Η), 8,84 (m, 1Η), 10,18 (bs, 1H). MS (ESI) m/z 519 (M-H)&quot;.A solution of the product of Example 441 (14 mg, 0.0214 mmol) in methanol (3 mL) was reacted with 10% palladium on carbon (10 mg) under a hydrogen atmosphere at 25 ° C with stirring for 2 hours. The solution was filtered and concentrated under reduced pressure to provide the title compound (8 mg, 73%). 1 H NMR (300 MHz, DMSO-d 6) δ0.94 (d, J = 6.6 Hz, 6H), 1.57 (m, 2H), 1.69 (m, 1H), 2.49 (M, 2 H), 7.62 (m, 2 H), 8.57 (m, 1 H), 8.84 (m, 1 H), 10.18 (bs, 1H). MS (ESI) m / z 519 (M-H) &quot;.

Exemplo 443 3-[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il) -1, l-dioxido-4fl-l, 2, 4-benzotiadiazin-7-il] diazatiano-1-carboxllato de 2-aminoetilo, 2,2-dióxido A uma solução de isocianato de clorossulfonilo (7,3 pL, 0,0843 mmol) em diclorometano (2 mL) juntou-se N-(2-hidroxi-etil)carbamato de t-butilo (13,6 mg, 0,0843 mmol) a 25°C. Após 30 minutos, a solução foi tratada com uma solução do produto do Exemplo 205 (30 mg, 0,0703 mmol) e trietilamina (39 pL, 0,281 mmol) em diclorometano (2 mL) e agitada durante 24 horas. A mistura reaccional foi diluída com diclorometano (10 mL) e ácido clorídrico IN aquoso (10 mL) . A resultante fase orgânica foi separada e seca sobre sulfato de magnésio, filtrada e concentrada sob pressão reduzida. O resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para proporcionar 8 mg de um sólido. Este sólido foi tratado com uma solução de ácido trifluoroacético (1,6 mL) e diclorometano (0,4 mL) a 25°C durante 3 horas. O solvente foi removido sob pressão reduzida para proporcionar o composto em título (12 mg, 24%) como um sal de ácido trif luoroacético. XH RMN (300 MHz, DMSO-de) δ 0,98 (d, J=6,6 Hz, 6H), 1,57 (m, 2H), 1,68 (m, 1H), 3,06 (m, 2H), 4,21 (t, J=5,l Hz, 2H), 4,46 (m, 2H), 7,49 (m, 2H), 7,63 (d, J= 2,2 Hz, 1H), 7,71 (d, J= 8,8 Hz, 1H), 7,83 (bs, 2H), 8,55 (dd, J=7,7, 1,8 Hz, 1H), 8,86 (m, 1H). MS (ESI-) m/z 592 (M-H)-.Example 443 3- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido-4,11- To a solution of chlorosulfonyl isocyanate (7.3 æL, 0.0843 mmol) in dichloromethane (2 mL) was added dropwise to a solution of 2-aminoethyl 4-benzothiadiazin-7-yl] diazatiane-1-carboxylate t-Butyl N- (2-hydroxy-ethyl) carbamate (13.6 mg, 0.0843 mmol) at 25 ° C. After 30 minutes, the solution was treated with a solution of the product of Example 205 (30 mg, 0.0703 mmol) and triethylamine (39 μL, 0.281 mmol) in dichloromethane (2 mL) and stirred for 24 hours. The reaction mixture was diluted with dichloromethane (10 mL) and aqueous 1N hydrochloric acid (10 mL). The resulting organic phase was separated and dried over magnesium sulfate, filtered and concentrated under reduced pressure. The residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile / 10 mM ammonium acetate in water over 8 (10 minutes test time) at a flow rate of 40 mL / min to provide 8 mg of a solid. This solid was treated with a solution of trifluoroacetic acid (1.6 mL) and dichloromethane (0.4 mL) at 25 ° C for 3 hours. The solvent was removed under reduced pressure to provide the title compound (12 mg, 24%) as a trifluoroacetic acid salt. 1 H NMR (300 MHz, DMSO-d 6) δ 0.98 (d, J = 6.6 Hz, 6H), 1.57 (m, 2H), 1.68 (m, 1H), 3.06 2H), 4.46 (m, 2H), 7.49 (m, 2H), 7.63 (d, J = 2.2 Hz, , 7.71 (d, J = 8.8 Hz, 1H), 7.83 (bs, 2H), 8.55 (dd, J = 7.7, 1.8 Hz, 1H), 8 , 86 (m, 1H). MS (ESI-) m / z 592 (M-H) -.

Exemplo 444 N-ciclopentil-iV'-[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro [1,8] naf tiridin-3-il) -1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-7-il]sulfamidaExample 444 N-cyclopentyl-N '- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxide -4 H -1,2,4-benzothiadiazin-7-yl] sulfamide

Ao produto do Exemplo 435B (0,029 g, 0,05 mmol) em acetonitrilo (2 mL) juntou-se 1-aminociclopentano (0,0085 g, 0,0099 mL, 0,1 mmol). A mistura reaccional foi aquecida num 408 ΕΡ 1 560 827/ΡΤ reactor de microondas a 80°C durante 2 horas e arrefecida até cerca de 25°C. O solvente foi removido sob uma corrente de azoto gás quente e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm x 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (11 mg, 38%). XH RMN (300 MHz, DMSO-d6) δ 0,97 (d, J=6,62 Hz, 6H) 1,51 (m, 11H) 3,53 (m, 11H) 4,48 (m, 2H) 7,49 (m, 2H) 7,60 (d, J=2,57 Hz, 1H) 7,70 (d, J=9,19 Hz, 1H) 7,83 (d, J=7,35 Hz, 1H) 8,55 (dd, J=8, 09, 1, 84 Hz, 1H) 8,88 (dd, J=4, 60, 1, 65 Hz, 1H) 10,19 (s, 1H) 14,06 (s, 1H) . (ESI-) m/z 573 (M-H).To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added 1-aminocyclopentane (0.0085 g, 0.0099 mL, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a nitrogen gas hot stream and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm x 100 mm, 7 pm particle size) using a gradient from 10% to 100% of acetonitrile / 10 mM ammonium acetate in water for 8 minutes (10 minutes test time) at a flow rate of 40 ml / min to give the title compound (11 mg, 38%). 1 H NMR (300 MHz, DMSO-d 6) δ0.97 (d, J = 6.62 Hz, 6H) 1.51 (m, 11H) 3.53 (m, 11H) 4.48 (m, 2H) 7.49 (m, 2H) 7.60 (d, J = 2.57 Hz, 1 H) 7.70 (d, J = 9.19 Hz, 1 H) 7.83 (d, J = 7.35 Hz 1H), 8.88 (dd, J = 4.60, 1.65 Hz, 1H), 10.19 (s, 1H), 8.55 (dd, J = 8.98, , 6 (s, 1H). (ESI-) m / z 573 (M-H).

Exemplo 445 N-ciclobutil-N- [3-(4-hidroxi-l-isopentil-2-oxo-l, 2-di-hidro[1,8]naftiridin-3-il)-1,l-dioxido-4ff-l, 2, 4-benzotiadiazin-7-il]sulfamidaExample 445 N-cyclobutyl-N- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido- -1,2,4-benzothiadiazin-7-yl] sulfamide

Ao produto do Exemplo 435B (0,029 g, 0,05 mmol) em acetonitrilo (2 mL) juntou-se 1-aminociclobutano (0,0071 g, 0,0085 mL, 0,1 mmol). A mistura reaccional foi aquecida num reactor de microondas a 80°C durante 2 horas e arrefecida até cerca de 25°C. O solvente foi removido sob uma corrente de azoto gás quente e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm x 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (8 mg, 28%). ΧΗ RMN (300 MHz, DMSO-d6) δ 0,98 (d, J=6,62 Hz, 6H) 1,64 (m, 7H) 2,05 (m, 2H) 3,68 (m, 1H) 4,49 (m, 2H) 7,50 (m, 2H) 7,59 (d, J=2,57 Hz, 1H) 7,73 (d, J=8,82 Hz, 1H) 8,16 (d, J=8,46 Hz, 1H) 8,56 (dd, J=8,09, 1, 84 Hz, 1H) 8,90 (dd, J=4,60, 1,65 Hz, 1H) 10,17 (s, 1H) 14,02 (s, 1H). MS (ESI-) m/z 559 (M-H)”. 409 ΕΡ 1 560 827/ΡΤ Α-825309.1 Exemplo 446Α 4- [ ({ [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]-naftiridin-3-il)-1,l-dioxido-4fl-l,2, 4-benzotiadiazin-7-il]-amino}sulfonil)amlno]-1-piperidinacarboxilato de tert-butiloTo the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added 1-aminocyclobutane (0.0071 g, 0.0085 mL, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a nitrogen gas hot stream and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm x 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile / 10 mM ammonium acetate in water for 8 minutes (10 minutes test time) at a flow rate of 40 ml / min to give the title compound (8 mg, 28%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.98 (d, J = 6.62 Hz, 6H) 1.64 (m, 7H) 2.05 (m, 2H) 3.68 (m, 1H) (M, 2H), 7.59 (d, J = 2.57 Hz, 1 H), 7.73 (d, J = 8.82 Hz, 1 H), 8.16 (m, d, J = 8.46 Hz, 1 H) 8.56 (dd, J = 8.09, 1.84 Hz, 1 H) 8.90 (dd, J = 4.60, 1.65 Hz, , 17 (s, 1 H) 14.02 (s, 1H). MS (ESI-) m / z 559 (M-H). Example 446 4 - [({[3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] -naphthyridin-3-yl) yl) -1,1-dioxido-4,11,2,4-benzothiadiazin-7-yl] amino} sulfonyl) amino] -1-piperidinecarboxylate

Ao produto do Exemplo 435B (0,029 g, 0,05 mmol) em acetonitrilo (2 mL) juntou-se N-l-Boc-4-aminopiperidina (0,020 g, 0,1 mmol). A mistura reaccional foi aquecida num reactor de microondas a 80°C durante 2 horas e arrefecida até cerca de 25°C. O solvente foi removido sob uma corrente de azoto gás quente e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm x 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (12 mg, 35%).To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added N-1-Boc-4-aminopiperidine (0.020 g, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a nitrogen gas hot stream and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm x 100 mm, 7 pm particle size) using a gradient from 10% to 100% of acetonitrile / 10 mM ammonium acetate in water for 8 minutes (10 minutes test time) at a flow rate of 40 ml / min to give the title compound (12 mg, 35%).

Exemplo 446B N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il) -1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-7-il] -N-(4-piperidinil)sulfamida O produto do Exemplo 446A (0,012 g, 0,017 mmol) foi dissolvido numa solução de cloreto de hidrogénio em 1,4-dioxano (4N, 3 mL) . A mistura foi agitada a 25°C durante 18 horas. O solvente foi removido sob pressão reduzida para gerar o composto em título como o seu sal cloridrato (10 mg, 92%). ΧΗ RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,25 Hz, 6H) 1,70 (m, 7H) 2,95 (m, 2H) 3,16 (m, 3H) 4,49 (m, 2H) 7,50 (m, 2H) 7,63 (d, J=2,21 Hz, 1H) 7,73 (d, J=9,19 Hz, 1H) 8,17 (d, J=7,35 Hz, 1H) 8,52 (m, 1H) 8,56 (dd, J=7,91, 1,65 Hz, 1H) 8,75 (m, 1H) 8,90 (dd, J=4,60, 1,65 Hz, 1H) 10,34 (s, 1H) 14,08 (s, 1H). MS (ESI-) m/z 588 (M-H)'. A-825311.0 Exemplo 447 DL2 N- (2-hidroxietil)-N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro [1,8]naftiridin-3-il)-1,l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il]sulfamidaExample 446B N- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido-4 H -1,2 , 4-benzothiadiazin-7-yl] -N- (4-piperidinyl) sulfamide The product of Example 446A (0.012 g, 0.017 mmol) was dissolved in a solution of hydrogen chloride in 1,4-dioxane (4 N, 3 mL) . The mixture was stirred at 25 ° C for 18 hours. The solvent was removed under reduced pressure to give the title compound as its hydrochloride salt (10 mg, 92%). NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.25 Hz, 6H) 1.70 (m, 7H) 2.95 (m, 2H) 3.16 (m, 3H) 4.49 (m, 2 H) 7.50 (m, 2 H) 7.63 (d, J = 2.21 Hz, 1 H) 7.73 (d, J = 9.19 Hz, d, J = 7.35 Hz, 1 H) 8.52 (m, 1 H) 8.56 (dd, J = 7.91, 1.65 Hz, 1 H) 8.75 (m, dd, J = 4.60, 1.65 Hz, 1 H) 10.34 (s, 1 H) 14.08 (s, 1H). MS (ESI-) m / z 588 (M-H) +. A-825311.0 Example 447 N- (2-hydroxyethyl) -N- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-7-yl] sulfamide

Ao produto do Exemplo 435 B (0, 006 g, 0,0104 mmol) em tetra-hidrofurano (2 ml) juntou-se água (0,1 ml) e etóxido de sódio em etanol (20% p/p, 1 ml). A mistura foi agitada durante 410To the product of Example 435 B (0.006 g, 0.0104 mmol) in tetrahydrofuran (2 ml) was added water (0.1 ml) and sodium ethoxide in ethanol (20% w / ). The mixture was stirred for 410

ΕΡ 1 560 827/PT 24 horas a 25°C. A reacção foi concentrada sob uma corrente de azoto gás quente e o resíduo foi tratado com ácido clorídrico IN (2 ml) com agitação durante 10 min. O sólido resultante foi filtrado e seco para gerar o composto em título (4 mg, 70%). 1H RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,62 Hz, 6H) 1,58 (m, 2H) 1,71 (m, 1H) 2,92 (m, 2H) 3,39 (m, 2H) 4,50 (m, 2H) 7,51 (m, 2H) 7,61 (d, J=2,21 Hz, 1H) 7,72 (d, J=8,82 Hz, 1H) 7,80 (t, J=5,88 Hz, 1H) 8,56 (dd, J=8, 09, 1, 84 Hz, 1H) 8,89 (dd, J=4,41, 1,47, 1H) 10,21 (s, 1H) 14,08 (S, 1H). MS (ESI-) m/z 549 (M-H)&quot; .24 hours at 25 ° C. The reaction was concentrated under a stream of hot gas nitrogen and the residue was treated with 1N hydrochloric acid (2 ml) with stirring for 10 min. The resulting solid was filtered and dried to give the title compound (4 mg, 70%). 1H NMR (300 MHz, DMSO-d6) δ 0.99 (d, J = 6.62 Hz, 6H) 1.58 (m, 2H) 1.71 (m, 1H) 2.92 (m, 2H) (M, 2H), 7.61 (d, J = 2.21 Hz, 1 H), 7.72 (d, J = 8.82 (Dd, J = 8, 09, 1, 84 Hz, 1 H) 8.89 (dd, J = 4.41, 1.47, 1H) 10.21 (s, 1H) 14.08 (S, 1H). MS (ESI-) m / z 549 (M-H) &quot; .

Exemplo 448 3-[({[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]— naftiridin-3-il)-1,l-dioxido-4ff-l,2,4-benzotiadiazin-7-il]-amino}sulfonil)amino]propanamidaExample 448 3 - [({[3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido- -1,2,4-benzothiadiazin-7-yl] amino} sulfonyl) amino] propanamide

Ao produto do Exemplo 435B (0,029 g, 0,05 mmol) emTo the product of Example 435B (0.029 g, 0.05 mmol) in

acetonitrilo (2 mL) juntou-se cloridrato de glicinamida (0,0125 g, 0,1 mmol) e carbonato de potássio (0,4 mmol). A mistura reaccional foi aquecida num reactor de microondas a 80°C durante 2 horas e arrefecida até cerca de 25°C. O solvente foi removido sob uma corrente de azoto gás quente e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40acetonitrile (2 mL) was added glycinamide hydrochloride (0.0125 g, 0.1 mmol) and potassium carbonate (0.4 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a nitrogen gas hot stream and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile / 10 mM ammonium acetate in water for 8 minutes (10 minutes test time) at a flow rate of 40

mL/min para gerar o composto em título (3 mg, 10%) . 1H RMN (300 MHz, DMSO-de) δ 0,99 (d, J=6,62 Hz, 6H) 1,59 (m, 2H) 1,70 (m, 1H) 2,25 (t, J=7,54 Hz, 2H) 3,07 (m, 2H) 4,49 (m, 2H) 6,80 (s, 1H) 7,30 (s, 1H) 7,50 (m, 2H) 7,61 (d, J=2,21 Hz, 1H) 7,70 (d, J=8, 82 Hz, 1H) 7,82 (t, J=5,70 Hz, 1H) 8,56 (dd, 0=1,12, 1,84 Hz, 1H) 8,89 (dd, J=4,41 Hz, 1,47 Hz, 1H) 10,23 (s, 1H) 14,13 (s, 1H). MS (ESI-) m/z 576 (M-H)&quot;. A-832731.0 Exemplo 449 N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il)-1,l-dioxido-4H-l,2, 4-benzotiadiazin-7-il]-1-azetidina-sulfonamidamL / min to give the title compound (3 mg, 10%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.62 Hz, 6H) 1.59 (m, 2H) 1.70 (m, 1H) 2.25 (t, J = 7.54 Hz, 2 H) 3.07 (m, 2 H) 4.49 (m, 2 H) 6.80 (s, 1 H) 7.30 (s, 1 H) 7.50 (m, 2 H) 7.61 (d, J = 8.82 Hz, 1 H) 7.82 (t, J = 5.70 Hz, 1 H) 8.56 (dd, J = 1.12, 1.84 Hz, 1 H) 8.89 (dd, J = 4.41 Hz, 1.47 Hz, 1 H) 10.23 (s, 1 H) 14.13 (s, 1H). MS (ESI-) m / z 576 (M-H) &quot;. A-832731.0 Example 449 N- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido-4H- 1,2,4-benzothiadiazin-7-yl] -1-azetidine-sulfonamide

Ao produto do Exemplo 435B (0,029 g, 0,05 mmol) em acetonitrilo (2 mL) juntou-se cloridrato de azetidina (0,0095 g, 0,1 mmol) e carbonato de potássio (0,4 mmol). A mistura 411 ΕΡ 1 560 827/ΡΤ reaccional foi aquecida num reactor de microondas a 80 °C durante 2 horas e arrefecida até cerca de 25°C. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm x 100 mm, 7 pm de tamanho de partícula) utilizando um qradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em áqua durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (2 mg, 7%) . 1R RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,62 Hz, 6H) 1,58 (m, 2H) 1,71 (m, 1H) 2,15 (m, 2H) 3,83 (t, J=7,54 Hz, 4H) 4,49 (m, 2H) 7,53 (m, 2H) 7,63 (d, J=2,21 Hz, 1H) 7,72 (d, J=9,19 Hz, 1H) 8,56 (dd, J=8,09, 1,84 Hz, 1H) 8,90 (dd, J=4,41, 1,84 Hz, 1H) 10,50 (s, 1H) 14,11 (s, 1H). MS (ESI-) m/z 545 (M-H)&quot;. A-832735.0 Exemplo 450 DL2 3-hidroxi-N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]-naftiridin-3-il)-l-l-dioxido-4H-l,2,4-benzotiadiazin-7-il] -1- azetidinassulfonamidaTo the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added azetidine hydrochloride (0.0095 g, 0.1 mmol) and potassium carbonate (0.4 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a stream of hot nitrogen and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm x 100 mm, 7 pm particle size) using a 10% to 100% strength acetonitrile / 10 mM ammonium acetate in water for 8 minutes (10 minutes test time) at a flow rate of 40 ml / min to give the title compound (2 mg, 7%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.62 Hz, 6H) 1.58 (m, 2H) 1.71 (m, 1H) 2.15 (m, 2H) 1H NMR (DMSO-d6, δ): 3.83 (t, J = 7.54 Hz, 4H) 4.49 (m, 2H) 7.53 (m, 2H) 7.63 (d, J = 2.21 Hz, d, J = 9.19 Hz, 1 H) 8.56 (dd, J = 8.09, 1.84 Hz, 1 H) 8.90 (dd, J = 4.41, 1.84 Hz, , 50 (s, 1 H) 14.11 (s, 1H). MS (ESI-) m / z 545 (M-H) &quot;. A-832735.0 Example 450 DL2 3-hydroxy-N- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] -naphthyridin-3-yl) dioxido-4H-1,2,4-benzothiadiazin-7-yl] -1-azetidinesulfonamide

Ao produto do Exemplo 435B (0,029 g, 0,05 mmol) em acetonitrilo (2 mL) juntou-se cloridrato de 3-hidroxiazetidina (0,011 g, 0,1 mmol) e carbonato de potássio (0,4 mmol). A mistura reaccional foi aquecida num reactor de microondas a 80°C durante 2 horas e arrefecida até cerca de 25°C. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added 3-hydroxyazetidine hydrochloride (0.011 g, 0.1 mmol) and potassium carbonate (0.4 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a stream of warm nitrogen and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% of acetonitrile / 10 mM ammonium acetate in water for 8 minutes (10 minutes test time) at a flow rate of 40

mL/min para gerar o composto em título (3 mg, 13%) . 1E RMN (300 MHz, DMSO-de) δ 0,99 (d, J=6,62 Hz, 6H) 1,58 (m, 2H) 1,71 (m, 1H) 3,66 (m, 2H) 3,92 (m, 2H) 4,38 (m, 1H) 4,50 (m, 2H) 7,55 (m, 3H) 7,73 (d, J=8,82 Hz, 1H) 8,57 (dd, J=8,09 Hz, 1,08 Hz, 1H) 8,90 (dd, J=4,41, 1,84 Hz, 1H) 10,55 (s, 1H) 14,08 (s, 1H) . MS (ESI-) m/z 561 (Μ-ΗΓ. 412mL / min to give the title compound (3 mg, 13%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.62 Hz, 6H) 1.58 (m, 2H) 1.71 (m, 1H) 3.66 (m, 2H) 3.92 (m, 2H) 4.38 (m, 1H) 4.50 (m, 2H) 7.55 (m, 3H) 7.73 (d, J = 8.82 Hz, 1H) 8.57 (dd, J = 4.41, 1.84 Hz, 1 H) 10.55 (s, 1 H) 14.08 (s, 1H). MS (ESI-) m / z 561 (M +), 412

ΕΡ 1 560 827/PTΕΡ 1 560 827 / EN

Exemplo 45ΙΑ 1-({[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]-naftiridin-3-il)-1,l-dioxido-4fl-l,2, 4-benzotiadlazln-7-ll] -amino}sulfonil)-3-pirrolidinilcarbamato de tert-butiloExample 45 1 - ({[3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] -naphthyridin-3-yl) -1,1-dioxido- 1,2,4-benzothiazol-7-yl] amino} sulfonyl) -3-pyrrolidinylcarbamate

Ao produto do Exemplo 435B (0,029 g, 0,05 mmol) em acetonitrilo (2 mL) juntou-se N-Boc-3-aminopirrolidina (0,0186 g, 0,1 mmol). A mistura reaccional foi aquecida num reactor de microondas a 80°C durante 2 horas e arrefecida até cerca de 25°C. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (23 mg, 68%).To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added N-Boc-3-aminopyrrolidine (0.0186 g, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a stream of warm nitrogen and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% of acetonitrile / 10 mM ammonium acetate in water for 8 minutes (10 minutes test time) at a flow rate of 40 ml / min to give the title compound (23 mg, 68%).

Exemplo 451B 3-amino-N- [3-(4-hidroxi-l-isopentil-2-oxo-l, 2-di-hidro[1,8]-naftiridin-3-il)-1,l-dioxido-4fl-l,2,4-benzotiadiazin-7-il]-1-pirrolidinassulfonamida 0 produto do Exemplo 446A (0,012 g, 0,017 mmol) foi dissolvido numa solução de cloreto de hidrogénio em 1,4-dioxano (4N, 3 mL) . A mistura foi agitada a 25°C durante cerca de 18 horas. O solvente foi removido sob pressão reduzida para gerar o composto em título como o seu sal cloridrato (16 mg, 88%) . XH RMN (300 MHz, DMSO-4) δ 0,98 (d, J=6,62 Hz, 6H) 1,54 (m, 2H) 1,67 (m, 1H) 1,91 (m, 1H) 2,18 (m, 1H) 3,26 (m, 2H) 3,50 (m, 2H) 3,79 (m, 1H) 4,43 (m, 2H) 7,40 (dd, J=7, 72, 4, 78 Hz, 1H) 7,58 (m, 3H) 8,22 (s, 3H) 8,50 (dd, J=7,71 Hz, 1,47 Hz,Example 451B 3-Amino-N- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] -naphthyridin-3-yl) -1,1- The product from Example 446A (0.012 g, 0.017 mmol) was dissolved in a solution of hydrogen chloride in 1,4-dioxane (4 N, 3 mL) . The mixture was stirred at 25 ° C for about 18 hours. The solvent was removed under reduced pressure to give the title compound as its hydrochloride salt (16 mg, 88%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.98 (d, J = 6.62 Hz, 6 H) 1.54 (m, 2 H) 1.67 (m, (M, 2H), 3.79 (m, 1H), 4.43 (m, 2H), 7.40 (dd, J = 7, (M, 3H), 8.22 (s, 3H), 8.50 (dd, J = 7.71 Hz, 1.47 Hz,

1H) 8,80 (d, J=3,31 Hz, 1H) 10,52 (s, 1H) 14,55 (s, 1H) . MS (ESI-) m/z 574 (M-H)”.1H) 8.80 (d, J = 3.31 Hz, 1 H) 10.52 (s, 1 H) 14.55 (s, 1H). MS (ESI-) m / z 574 (M-H).

Exemplo 452A cloreto de 1-piperidinassulfoniloExample 452A 1-Piperidine sulfonyl chloride

Uma solução de cloreto de sulfurilo (IN em diclorometano, 75 mL, 75 mmol) a -20°C, foi tratada gota a gota com piperidina (12,6 g, 150 mmol), agitada a 0°C durante 2 horas e repartida entre diclorometano e água (50 mL). A fase orgânica foi lavada com HC1 aquoso IN, salmoura e seca sobre sulfato de magnésio 413 ΕΡ 1 560 827/ΡΤ anidro, filtrada e concentrada sob pressão reduzida. O resíduo foi destilado sob pressão reduzida (1 mm Hg) a 105°C para gerar o composto em titulo (5 gramas).A solution of sulfuryl chloride (1N in dichloromethane, 75 mL, 75 mmol) at -20 ° C was treated dropwise with piperidine (12.6 g, 150 mmol), stirred at 0 ° C for 2 hours and partitioned between dichloromethane and water (50 mL). The organic phase was washed with 1N aqueous HCl, brine and dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The residue was distilled under reduced pressure (1 mm Hg) at 105 ° C to give the title compound (5 grams).

Exemplo 452B N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il)-1, l-dioxido-4Η 1,2,4-benzotiadiazin-7-il]-1-piperidina-sulfonamidaExample 452B N- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido- 4-benzothiadiazin-7-yl] -1-piperidine sulfonamide

Uma mistura do produto do Exemplo 205 (2 mg, 0,1 ml), o produto do Exemplo 451A (17 mg, 0,1 mmol) e trietilamina (0,1 mL) em diclorometano (2 mL) foi agitada durante 18 horas a 25°C, diluída com diclorometano (25 mL) e lavada com HC1 IN e salmoura. A fase orgânica foi seca sobre sulfato de sódio anidro, filtrada e concentrada sob pressão reduzida. O produto foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (10 mg) . 1R RMN (300 MHz, DMSO-d6) δ 0,98 (d, J=6,62 Hz, 6H) 1,43 (s, 6H) 1,57 (m, 2H) 1,69 (m, 1H) 3,14 (s, 4H) 4,49 (m, 2H) 7,51 (m, 1H) 7,53 (s, 1H) 7,60 (d, J=2,21 Hz, 1H) 7,72 (d, J=8,82 Hz, 1H) 8,56 (dd, J=8,09, 1,84 Hz, 1H) 8,90 (dd, J=4, 7 8, 1, 84 Hz, 1H) 10,47 (s, 1H) 14,06 (s, 1H) 15,05 (s, 1H). MS (ESI~) m/z 573 (M-H)“. A-805330.0A mixture of the product of Example 205 (2 mg, 0.1 ml), the product of Example 451A (17 mg, 0.1 mmol) and triethylamine (0.1 ml) in dichloromethane (2 ml) was stirred for 18 hours at 25 ° C, diluted with dichloromethane (25 mL) and washed with 1N HCl and brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The product was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile / 10 mM ammonium acetate in water over 8 (10 minutes test time) at a flow rate of 40 mL / min to give the title compound (10 mg). 1 H NMR (300 MHz, DMSO-d 6) δ0.98 (d, J = 6.62 Hz, 6H) 1.43 (s, 6H) 1.57 (m, 2H) 1.69 (m, 1H) 3.14 (s, 4H) 4.49 (m, 2 H) 7.51 (m, 1 H) 7.53 (s, 1 H) 7.60 (d, J = 2.21 Hz, 1 H) 7.72 (d, J = 8.82 Hz, 1 H) 8.56 (dd, J = 8.09, 1.84 Hz, 1 H) 8.90 (dd, J = 4.78, 1.84 Hz, 1H ) 10.47 (s, 1H) 14.06 (s, 1H) 15.05 (s, 1H). MS (ESI +) m / z 573 (M-H). A-805330.0

Exemplo 453 DLM N-benzil-H'-[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]- naftiridin-3-il)-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il] -sulfamidaExample 453 N-benzyl-N '- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1- dioxido-4H-1,2,4-benzothiadiazin-7-yl] sulfamide

Uma mistura do produto do Exemplo 435B (28 mg, 0,05 mmol), benzilamina (6 mg, 0,05 mmol) e trietilamina (0,5 mL) em acetonitrilo (2 mL) foi agitada a 70°C durante 18 horas. A mistura reaccional foi arrefecida até cerca de 25°C, repartida entre acetato de etilo e HC1 IN (10 mL) . A fase orgânica foi lavada com salmoura e seca sobre Na2S04 anidro, filtrada e concentrada sob pressão reduzida. O resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry 414 ΕΡ 1 560 827/ΡΤ C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (12 mg). :Η RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,25A mixture of the product of Example 435B (28 mg, 0.05 mmol), benzylamine (6 mg, 0.05 mmol) and triethylamine (0.5 mL) in acetonitrile (2 mL) was stirred at 70 ° C for 18 hours . The reaction mixture was cooled to about 25 ° C, partitioned between ethyl acetate and 1N HCl (10 mL). The organic layer was washed with brine and dried over anhydrous Na2 SO4, filtered and concentrated under reduced pressure. The residue was purified by preparative reverse phase HPLC on a Waters Symmetry 414 ÅΡ 1 560 827 / ΡΤ C8 (25 mm χ 100 mm, 7 æm particle size) column using a gradient from 10% to 100% acetonitrile / ammonium acetate 10 mM in water for 8 minutes (10 minutes test time) at a flow rate of 40 mL / min to give the title compound (12 mg). : Δ NMR (300 MHz, DMSO-d 6) δ0.99 (d, J = 6.25

Hz, 6H) 1,65 (m, 3H) 4,08 (d, J=6,25 Hz, 2H) 4,49 (m, 2H) 7,22 (m, 5H) 7,45 (m, 1H) 7,51 (dd, J=8, 09, 4, 78 Hz, 1H) 7,61 (d, J=2,57 Hz, 1H) 7,69 (d, J=8,82 Hz, 1H) 8,41 (t, J=6,25 Hz, 1H) 8,57 (dd, J=8, 09, 1, 84 Hz, 1H) 8,90 (dd, J=4, 78, 1, 84 Hz, 1H) 10,33 (s, 1H) 14,08 (s, 1H) 15,15 (s, 1H) . MS (ESI ) m/z 595 (M-H)&quot;.J = 6.25 Hz, 2 H) 4.49 (m, 2 H) 7.22 (m, 5H), 7.45 (m, 1H), 1.65 (m, 3H) 4.08 (d, ) 7.51 (dd, J = 8.94, 78 Hz, 1H) 7.61 (d, J = 2.57 Hz, 1 H) 7.69 (d, J = 8.82 Hz, 8.41 (t, J = 6.25 Hz, 1 H) 8.57 (dd, J = 8.9, 1.84 Hz, 1 H) 8.90 (dd, J = , 1H) 10.33 (s, 1H) 14.08 (s, 1H) 15.15 (s, 1H). MS (ESI) m / z 595 (M-H) &quot;.

Exemplo 454 3-[({[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]— naftiridin-3-il)-1,l-dioxido-4ff-l,2,4-benzotiadiazin-7-il]amino}sulfonil)amino]benzoato de etiloExample 454 3 - [({[3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido- -1,2,4-benzothiadiazin-7-yl] amino} sulfonyl) amino] benzoate

Uma solução de éster etílico de ácido 3-amino-benzóico (0,165 g, 1,0 mmol) em diclorometano (6 mL) a cerca de 0°C juntou-se gota a gota ácido clorossulfónico (0,128 g, 1,1 mmol). A mistura reaccional foi agitada a 25°C durante 1 hora e depois juntou-se pentacloreto de fósforo (0,229 g, 1,1 mmol) e a mistura reaccional foi aquecida sob refluxo durante 3,5 horas. A mistura reaccional foi depois arrefecida até cerca de 25°C e o solvente evaporado sob pressão reduzida. Uma solução do residuo em diclorometano (10 mL) foi tratada com o produto do Exemplo 205 (0,214 g, 0,5 mmol), seguido de trietilamina (0,152 g, 1,5 mmol). A mistura reaccional foi agitada a 25°C durante 3 horas e depois vertida em 25 mL de ácido clorídrico IN aquoso. A mistura reaccional foi depois extraída com diclorometano (3 χ 25 mL) . Os extractos orgânicos combinados foram secos sobre sulfato de magnésio anidro, filtrados e evaporados sob pressão reduzida. O resíduo foi purificado por cromatografia em sílica gel, eluindo com 0-2% de metanol/diclorometano para proporcionar o composto em título (0,166 g, 48% de rendimento). XH RMN (300 MHz, DMSO-dê) δ 0,98 (d, J= 6,25 Hz, 6H) 1,30 (t, J=7,17 Hz, 3H) 1,56 (m, 2H) 1,68 (m, 1H) 4,29 (q, J=6,99 Hz, 2H) 4,48 (m, 2H) 7,44 (m, 4H) 7,57 (d, J=2,21 Hz, 1H) 7,62 (dt, J=7,36, 1,47 Hz, 1H) 7,69 (d, J=8,82 Hz, 1H) 7,74 (s, 1H) 8,55 (dd, J=8,09, 1,84 Hz, 1H) 8,88 (dd, J=4, 41, 1,84 Hz, 1H) 10,80 (s, 1H) 10,88 (s, 1H) 415 ΕΡ 1 560 827/ΡΤ 14,11 (s, 1Η) . MS (ΕSI+) m/z 655, 1 (Μ+Η)+, 672, 2 (Μ+ΝΗ4)+, 677, 0 (M+Na)+, (ESI ) m/z 653, 1 (Μ-Η)&quot;. Α-824028.0 Exemplo 455 ácido 3-[({[3-(4-hidroxi-l-isopentil-2-oxo-l, 2-di-hidro[1,8] — naftiridin-3-il)-1,l-dioxido-4U-l,2,4-benzotiadiazin-7-il] -amlno}sulfonll)amlno]benzóicoA solution of 3-amino-benzoic acid ethyl ester (0.165 g, 1.0 mmol) in dichloromethane (6 mL) at about 0 ° C was added dropwise chlorosulfonic acid (0.128 g, 1.1 mmol) . The reaction mixture was stirred at 25 ° C for 1 hour and then phosphorus pentachloride (0.229 g, 1.1 mmol) was added and the reaction mixture was heated under reflux for 3.5 hours. The reaction mixture was then cooled to about 25 ° C and the solvent evaporated under reduced pressure. A solution of the residue in dichloromethane (10 mL) was treated with the product of Example 205 (0.214 g, 0.5 mmol), followed by triethylamine (0.152 g, 1.5 mmol). The reaction mixture was stirred at 25 ° C for 3 hours and then poured into 25 mL of aqueous 1N hydrochloric acid. The reaction mixture was then extracted with dichloromethane (3 x 25 mL). The combined organic extracts were dried over anhydrous magnesium sulfate, filtered and evaporated under reduced pressure. The residue was purified by silica gel chromatography, eluting with 0-2% methanol / dichloromethane to provide the title compound (0.166 g, 48% yield). 1 H NMR (300 MHz, DMSO-d 6) δ 0.98 (d, J = 6.25 Hz, 6H) 1.30 (t, J = 7.17 Hz, 3H) 1.56 (m, 2H) 1 J = 6.99 Hz, 2H), 4.48 (m, 2H), 7.44 (m, 4H), 7.57 (d, J = 2.21 Hz, (Dt, J = 7.36, 1.47 Hz, 1 H) 7.69 (d, J = 8.82 Hz, 1 H) 7.74 (s, 1 H) 8.55 (dd, , J = 8.09, 1.84 Hz, 1 H) 8.88 (dd, J = 4.14, 1.84 Hz, 1 H) 10.80 (s, 1 H) 10.88 (s, 1 H) 415 ΕΡ 1 560 827 / ΡΤ 14.11 (s, 1Η). MS (ES +) m / z 655.1 (Μ + Η) +, 672.2 (Μ + ΝΗ 4) +, 677.0 (M + Na) +, (ESI) m / z 653.1 (Μ-Η ) &quot;. Α-824028.0 Example 455 3 - [({[3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1- 4H-1,2,4-benzothiadiazin-7-yl] amino} sulfonyl) aminobenzoic acid

Uma solução do produto do Exemplo 454 (25, 5 mg, 0,389 mmol) em 1 mL de hidróxido de sódio IN aquoso e 1 mL de metanol foi agitada a 25°C durante 17 horas e concentrada sob uma corrente de azoto quente. O resíduo foi tratado com 2 mL de ácido clorídrico IN aquoso. O sólido resultante foi isolado por filtração sob vácuo, lavado com 10 mL de água e seco para proporcionar o composto em título (21,4 mg, 88% de rendimento). 1R RMN (300 MHz, DMSO-d6) δ 0,98 (d, J=6,62 Hz, 6H) 1,56 (m, 2H) 1,68 (m, 1H) 4,48 (m, 2H) 7,32-7,53 (m, 4H) 7,59 (m, 2H) 7,69 (d, J= 8,82 Hz, 1H) 7,75 (s, 1H) 8,55 (dd, J=8,09, 1,84 Hz, 1H) 8,88 (dd, J=4,78, 1,47 Hz, 1H) 10,79 (s, 1H) 10,88 (s, 1H) 13,01 (bs, 1H) 14,12 (bs, 1H). MS (ESI+) m/z 627, 1 (M+H)+, 649, 1 (M+Na)+, (ESI~) m/z 625,1 (M-H)”.A solution of the product of Example 454 (25.5 mg, 0.389 mmol) in 1 mL of 1N aqueous sodium hydroxide and 1 mL of methanol was stirred at 25 ° C for 17 hours and concentrated under a stream of warm nitrogen. The residue was treated with 2 mL of aqueous 1N hydrochloric acid. The resulting solid was isolated by vacuum filtration, washed with 10 mL of water and dried to provide the title compound (21.4 mg, 88% yield). 1 H NMR (300 MHz, DMSO-d 6) δ0.98 (d, J = 6.62 Hz, 6H) 1.56 (m, 2H) 1.68 (m, 1H) 4.48 (m, 2H) 7.32-7.53 (m, 4H) 7.59 (m, 2H) 7.69 (d, J = 8.82 Hz, 1 H) 7.75 (s, 1 H) 8.55 (dd, J = 8.09, 1.84 Hz, 1H) 8.88 (dd, J = 4.78, 1.47 Hz, 1H) 10.79 (s, 1H) 10.88 (s, 1H) 13.01 (bs, 1H) 14.12 (bs, 1H). MS (ESI +) m / z 627.1 (M + H) +, 649.1 (M + Na) +, (ESI +) m / z 625.1 (M-H) +.

Exemplo 456 3-[({3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]-naftiridin-3-il)-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il]-amino}sulfonil)amino]benzamidaExample 456 Ethyl 3 - [({3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] -naphthyridin-3-yl) -1,1-dioxido- benzothiadiazin-7-yl] amino} sulfonyl) amino] benzamide

Uma solução do produto do Exemplo 454 (7, 6 mg, 0,012 mmol) em 1 mL de hidróxido de amónio foi agitada a 25 °C durante 17 horas. O solvente foi evaporado sob uma corrente de azoto quente para proporcionar o composto em título (7,4 mg). 'ή RMN (300 MHz, DMSO-d6) δ 0,96 (d, J=6,62 Hz, 6H) 1,47 (m, 2H) 1,64 (m, 1H) 4,30 (m, 2H) 7,14 (m, 1H) 7,28 (m, 6H) 7,43 (S, 1H) 7,49 (d, J=7,72 Hz, 1H) 7,66 (s, 1H) 7,87 (s, 1H) 8,36 (dd, J=7, 54, 1, 65 Hz, 1H) 8,54 (s, 1H) 10,45 (bs, 1H) 10,51 (bs, 1H) 15,89 (bs, 1H) .A solution of the product of Example 454 (7.6 mg, 0.012 mmol) in 1 mL of ammonium hydroxide was stirred at 25 ° C for 17 hours. The solvent was evaporated under a stream of hot nitrogen to provide the title compound (7.4 mg). 1 H NMR (300 MHz, DMSO-d 6) δ 0.96 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.64 (m, 1H) 4.30 (m, 2H ) 7.47 (m, 6H) 7.43 (s, 1H) 7.49 (d, J = 7.72 Hz, 1 H) 7.66 (s, (S, 1H), 8.36 (dd, J = 7.54, 1.65 Hz, 1 H) 8.54 (s, 1 H) 10.45 (bs, 1H) 10.51 (bs, 1H) 15 , 89 (bs, 1H).

Exemplo 457A 4-(benziloxi)-l-isopentil-2(1H)-piridinonaExample 457A 4- (Benzyloxy) -1-isopentyl-2 (1H) -pyridinone

Uma solução de 4-benziloxi-lfí-piridin-2-ona (1,0 g, 4,97 mmol) e 1, 8-diazabiciclo[5.4.0]undec-7-eno (1,86 mL, 12,43 mmol) e l-bromo-3-metilbutano (0,715 mL, 5,96 mmol) 416 ΕΡ 1 560 827/ΡΤ em Ν, N-dimetilacetamida (20 mL) foi aquecida a 65°C durante 5 dias. A solução foi arrefecida até cerca de 25°C e repartida entre cloreto de amónio aquoso a 10% e diclorometano, a fase orgânica separada e concentrada sob pressão reduzida. O resíduo foi cromatografado em sílica gel, eluindo com 1% de metanol em diclorometano para proporcionar o composto em título (0,569 g, 42%).A solution of 4-benzyloxy-1 H -pyridin-2-one (1.0 g, 4.97 mmol) and 1,8-diazabicyclo [5.4.0] undec-7-ene (1.86 mL, 12.43 mmol) and 1-bromo-3-methylbutane (0.715 mL, 5.96 mmol) in ethyl acetate (20 mL) was heated at 65 ° C for 5 days. The solution was cooled to about 25 ° C and partitioned between 10% aqueous ammonium chloride and dichloromethane, the organic phase separated and concentrated under reduced pressure. The residue was chromatographed on silica gel, eluting with 1% methanol in dichloromethane to give the title compound (0.569 g, 42%).

Exemplo 457B 4-hidroxi-l-isopentil-2(1H)-piridinona O produto do Exemplo 457A (0,452 g, 1,67 mmol) em tetra-hidrofurano (20 mL) foi tratado com formato de amónio (0,30 g, 5,01 mmol) e uma quantidade catalítica de hidróxido de paládio a 20% sobre carbono a 60°C durante 2 horas. A reacção foi filtrada através de terra de diatomáceas e o filtrado concentrado sob pressão reduzida para proporcionar o composto em título (0,30 g, 100%).Example 457B The product of Example 457A (0.452 g, 1.67 mmol) in tetrahydrofuran (20 mL) was treated with ammonium formate (0.30 g, 5.01 mmol) and a catalytic amount of 20% palladium hydroxide on carbon at 60 ° C for 2 hours. The reaction was filtered through diatomaceous earth and the filtrate concentrated under reduced pressure to provide the title compound (0.30 g, 100%).

Exemplo 457C 3-[bis(metilsulfanil)metileno]-l-isopentil-2, 4(1H, 3H)-piridinadiona O produto do Exemplo 457B (2,24 g, 12,37 mmol) em piridina (8,0 mL, 98, 96 mmol) e dioxano (50 mL) a 90°C foi tratado com excesso de metilsulfato de tris(metiltio)metilo (preparado utilizando o procedimento em Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, v. Regondi), agitado a 90°C durante 1,5 horas e arrefecido até cerca de 25°C. A solução reaccional foi decantada dos sólidos resultantes e o solvente foi removido sob pressão reduzida. O resíduo foi dissolvido em hexanos e carregado numa almofada de sílica gel (300 mL) e eluído com hexano seguido de diclorometano e depois 25% de acetato de etilo em diclorometano para proporcionar o composto em título (2,42 g, 75%).Example 457C The product from Example 457B (2.24 g, 12.37 mmol) in pyridine (8.0 mL, 0.8 mmol) in dichloromethane 98.96 mmol) and dioxane (50 mL) at 90 ° C was treated with excess of tris (methylthio) methyl methylsulfate (prepared using the procedure in Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I Degani, R. Fochi, A. Gatti, v Regondi), stirred at 90 ° C for 1.5 hours and cooled to about 25 ° C. The reaction solution was decanted from the resulting solids and the solvent was removed under reduced pressure. The residue was dissolved in hexanes and loaded onto a pad of silica gel (300 mL) and eluted with hexane followed by dichloromethane and then 25% ethyl acetate in dichloromethane to give the title compound (2.42 g, 75%).

Exemplo 457D 3-(7-amino-l,l-dioxido-4H-l,2, 4-benzotiadiazin-3-il)-4-hidroxi-l-isopentil-2 (lfí) -piridinona O produto do Exemplo 457C (2,08 g, 7,29 mmol) foi tratado com o produto do Exemplo 414A (2,00 g, 6,96 mmol) em dioxano 417 ΕΡ 1 560 827/ΡΤ (20 mL) a 115°C durante 30 minutos, arrefecido até 25°C e concentrado sob pressão reduzida. Uma solução do resíduo em ácido clorídrico 4M em dioxano (20 mL) foi agitada a 25°C durante 18 horas e concentrada sob pressão reduzida. O resíduo foi triturado com diclorometano e filtrado para gerar o composto em título. O filtrado contendo o intermediário protegido foi concentrado e purificado por cromatografia em sílica gel eluindo com 1% de metanol em diclorometano. O produto protegido foi de novo sujeito às anteriores condições de desprotecção para proporcionar o composto em título como o seu sal cloridrato (2,02 g, 96%). XH RMN (300 MHz, DMSO-d6) δ 0,92 (s, 3H) 0,94 (s, 3H) 1,58 (m, 3H) 3,99 (m, 2H) 6,31 (d, J=7,35 Hz, 1H) 6,96 (m, 2H) 7,34 (d, J=8,46 Hz, 1H) 8,04 (d, J=7,35 Hz, 1H) 14,04 (s, 1H) 14,19 (s, 1H). MS (ESI-) m/z 375 (M-H)&quot;.Example 457D 3- (7-Amino-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -4-hydroxy-1-isopentyl-2 (1 H) -pyridinone The product of Example 457C 2.08 g, 7.29 mmol) was treated with the product of Example 414A (2.00 g, 6.96 mmol) in dioxane 417 Ρ Ρ 1 560 827 ΡΤ (20 mL) at 115 durante C for 30 minutes, cooled to 25 ° C and concentrated under reduced pressure. A solution of the residue in 4M hydrochloric acid in dioxane (20 mL) was stirred at 25 ° C for 18 hours and concentrated under reduced pressure. The residue was triturated with dichloromethane and filtered to give the title compound. The filtrate containing the protected intermediate was concentrated and purified by silica gel chromatography eluting with 1% methanol in dichloromethane. The protected product was again subjected to the above deprotection conditions to provide the title compound as its hydrochloride salt (2.02 g, 96%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.92 (s, 3H) 0.94 (s, 3H) 1.58 (m, 3H) 3.99 (m, 2H) 6.31 (d, J = (D, J = 7.35 Hz, 1 H) 8.04 (d, J = 7.35 Hz, 1 H) 14.04 (m, s, 1H), 14.19 (s, 1H). MS (ESI-) m / z 375 (M-H) &quot;.

Exemplo 457E 3-[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro-3-piridinil)-1, l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il] diazatiano-1-carboxilato de benzilo, 2,2-dióxidoExample 457E 3- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro-3-pyridinyl) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-7 -yl] diazaan-1-carboxylate, 2,2-dioxide

Uma solução de isocianato de clorossulfonilo (61,8 mg, 0,436 mmol) e álcool benzílico (47,0 mg, 0,436 mmol) em diclorometano (7,5 ml) foi agitada a 25°C durante 1 hora seguido da adição de uma solução do produto do Exemplo 457D (150 mg, 0, 363 mmol) e trietilamina (183,7 mg, 1,82 mmol) em diclorometano (14 mL), agitada a 25°C durante 20 horas e repartida entre diclorometano (25 mL) e ácido clorídrico IN aguoso (25 mL) . A fase orgânica foi separada e seca sobre sulfato de magnésio, filtrada e concentrada sob pressão reduzida para proporcionar o composto em título (200 mg, 93%). XH RMN (300 MHz, DMSO-d6) δ 0,93 (s, 3H) 0,95 (s, 3H) 1,58 (m, 3H) 4,00 (m, 2H) 5,11 (s, 2H) 6,35 (d, J=7,72 Hz, 1H) 7,32 (m, 5H) 7,46 (dd, J=9,01, 2,39 Hz, 1H) 7,61 (d, J=2,57 Hz, 1H) 7,65 (d, J=9,19 Hz, 1H) 8,09 (d, J=7,72 Hz, 1H) 11,10 (s, 1H) 12,14 (s, 1H) 13,87 (s, 1H) 14,25 (s, 1H). MS (ESI-) m/z 588 (M-H)”.A solution of chlorosulfonyl isocyanate (61.8 mg, 0.436 mmol) and benzyl alcohol (47.0 mg, 0.436 mmol) in dichloromethane (7.5 mL) was stirred at 25 ° C for 1 hour followed by the addition of a solution of the product of Example 457D (150 mg, 0.363 mmol) and triethylamine (183.7 mg, 1.82 mmol) in dichloromethane (14 mL), stirred at 25 ° C for 20 hours and partitioned between dichloromethane (25 mL) and aqueous IN hydrochloric acid (25 mL). The organic phase was separated and dried over magnesium sulfate, filtered and concentrated under reduced pressure to give the title compound (200 mg, 93%). 1 H NMR (300 MHz, DMSO-d 6) δ0.93 (s, 3H) 0.95 (s, 3H) 1.58 (m, 3H) 4.00 (m, 2H) 5.11 (s, 2H ) 6.35 (d, J = 7.72 Hz, 1 H) 7.32 (m, 5H) 7.46 (dd, J = 9.01, 2.39 Hz, 1 H) 7.61 (d, J = = 2.57 Hz, 1 H) 7.65 (d, J = 9.19 Hz, 1 H) 8.09 (d, J = 7.72 Hz, 1 H) 11.10 (s, 1 H) 12.14 ( s, 1 H) 13.87 (s, 1 H) 14.25 (s, 1 H). MS (ESI-) m / z 588 (M-H).

Exemplo 458 N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro-3-piridinil)-1,l-dioxido-4fl-l,2,4-benzotiadiazin-7-il]sulfamidaExample 458 N- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro-3-pyridinyl) -1,1-dioxido-4 H -1,2,4-benzothiadiazin-7 -yl] sulfamide

Uma solução do produto do Exemplo 457E (40 mg, 0,068 mmol) em metanol (5 mL) foi agitada com paládio sobre carbono a 10% (22 mg) sob uma atmosfera de hidrogénio a 25°C durante 4 418 ΕΡ 1 560 827/ΡΤ horas. A reacção foi filtrada e o filtrado concentrado sob pressão reduzida para proporcionar o composto em título (28 mg, 99%). RMN (300 MHz, DMSO-d6) δ 0,92 (s, 3H) 0,94 (s, 3H) 1,58 (m, 3H) 3,98 (m, 2H) 6,32 (d, J=4,41 Hz, 1H) 7,36 (s, 2H) 7,47 (m, 1H) 7,60 (m, 2H) 8,06 (s, 1H) 10,00 (s, 1H) 13,97 (s, 1H) 14,23 (s, 1H). MS (ESI-) m/z 454 (M-H)&quot;.A solution of the product of Example 457E (40 mg, 0.068 mmol) in methanol (5 mL) was stirred with 10% palladium on carbon (22 mg) under a hydrogen atmosphere at 25 ° C for 4 418 Ρ Ρ 1 560 827 / ΡΤ hours. The reaction was filtered and the filtrate concentrated under reduced pressure to provide the title compound (28 mg, 99%). NMR (300 MHz, DMSO-d 6) δ 0.92 (s, 3H) 0.94 (s, 3H) 1.58 (m, 3H) 3.98 (m, 2H) 6.32 (d, J = 4.41 Hz, 1H) 7.36 (s, 2H) 7.47 (m, 1H) 7.60 (m, 2H) 8.06 (s, 1H) 10.00 (s, 1H) 13.97 (s, 1 H) 14.23 (s, 1 H). MS (ESI-) m / z 454 (M-H) &quot;.

Exemplo 459 A 2-[({[(3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]— naftiridin-3-il) -1, l-dioxido-4fí-l, 2, 4-benzotiadiazin-7-il] -amino}sulfonil)amino]etilcarbamato de tert-butiloExample 459 2 - [({[(3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxide 4 H -1,2,4-benzothiadiazin-7-yl] amino} sulfonyl) amino] ethylcarbamate

Ao produto do Exemplo 435B (0,029 g, 0,05 mmol) em acetonitrilo (2 mL) juntou-se N-(2-aminoetil)carbamato de tert-butilo (0,016 g, 0,016 mL, 0,1 mmol). A mistura reaccional foi aquecida num reactor de microondas a 80°C durante 2 horas e arrefecida até cerca de 25°C. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm x 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (6,3 mg, 20%). ΧΗ RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,25 Hz, 6H) 1,34 (s, 9H) 1,58 (m, 2H) 1,68 (m, 1H) 2,88 (m, 2H) 2,97 (m, 2H) 4,50 (m, 2H) 6,75 (s, 1H) 7,50 (m, 2H) 7,60 (d, J=2,21 Hz, 1H) 7,72 (d, J= 8,82 Hz, 1H) 7,87 (t, J=5,70 Hz, lH) 8,57 (dd, J=8,09, 1,84 Hz, 1H) 8,90 (dd, J=4,41, 1,84 Hz, 1H) 10,26 (s, 1H) 14,09 (s, 1H). MS (ESI-) m/z 648 (M-H)&quot;.To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added tert-butyl N- (2-aminoethyl) carbamate (0.016 g, 0.016 mL, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a stream of hot nitrogen and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm x 100 mm, 7 pm particle size) using a gradient from 10% to 100% of acetonitrile / 10 mM ammonium acetate in water for 8 minutes (10 minutes test time) at a flow rate of 40 ml / min to give the title compound (6.3 mg, 20%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.25 Hz, 6H) 1.34 (s, 9H) 1.58 (m, 2H), 7.60 (d, J = 2.2, 2H), 2.90 (m, 2H) 21 Hz, 1H) 7.72 (d, J = 8.82 Hz, 1 H) 7.87 (t, J = 5.70 Hz, 1H) 8.57 (dd, J = 8.09, 1.84 Hz, 1 H) 8.90 (dd, J = 4.41, 1.84 Hz, 1 H) 10.26 (s, 1 H) 14.09 (s, 1H). MS (ESI-) m / z 648 (M-H) &quot;.

Exemplo 459B N- (2-aminoetil)-Ν'-[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro [1, 8]naftiridin-3-il)-1, l-dioxido-4#-l,2, 4-benzotiadiazin-7-il]sulfamidaExample 459B N- (2-aminoethyl) -3 '- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) 1-dioxido-4-yl, 2,4-benzothiadiazin-7-yl] sulfamide

Uma solução do produto do Exemplo 459A (0,0053 g, 0,0082 mmol) numa solução de cloreto de hidrogénio em 1,4-dioxano (4N, 3 mL) foi agitada a 25°C durante 18 horas. O solvente foi removido sob pressão reduzida para gerar o composto em título como o sal cloridrato (4 mg, 89%). XH RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,62 Hz, 6H) 1,56 (m, 2H) 1,68 (m, 1H) 2,89 (m, 2H) 3,10 (m, 2H) 4,49 (m, 2H) 7,51 (m, 2H) 7,62 (d, J=2,21 Hz, lH) 419 ΕΡ 1 560 827/ΡΤ 7,74 (d, J= 8,82 Hz, 1H) 7,79 (s, 2H) 8,03 (t, J=5,70 Hz, 1H) 8,56 (dd, J=7, 72, 1, 84 Hz, 1H) 8,89 (dd, J=4,41, 1,84 Hz, 1H) 10,37 (s, 1H) 14,16 (s, 1H) . MS (ESI-) m/z 548 (M-H)-.A solution of the product of Example 459A (0.0053 g, 0.0082 mmol) in a solution of hydrogen chloride in 1,4-dioxane (4N, 3 mL) was stirred at 25 ° C for 18 hours. The solvent was removed under reduced pressure to give the title compound as the hydrochloride salt (4 mg, 89%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.62 Hz, 6H) 1.56 (m, 2H) 1.68 (m, 1H) 2.89 (m, 2H) 3.10 (m, 2H) 4.49 (m, 2H) 7.51 (m, 2H) 7.62 (d, J = 2.21 Hz, 1H) 419 Î »E 1 560 827 / Î'7.74 ( d, J = 8.82 Hz, 1 H) 7.79 (s, 2 H) 8.03 (t, J = 5.70 Hz, 1 H) 8.56 (dd, J = , 8.89 (dd, J = 4.41, 1.84 Hz, 1 H) 10.37 (s, 1 H) 14.16 (s, 1H). MS (ESI-) m / z 548 (M-H) -.

Exemplo 460 1— ({ [3- (4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8] — na£tiridin-3-il)-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il]-amino}sulfonll)-3-piperidinacarboxilato de etiloExample 460 1- ({[3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1- 4H-1,2,4-benzothiadiazin-7-yl] amino} sulfonyl) -3-piperidinecarboxylate

Ao produto do Exemplo 435B (0,029 g, 0,05 mmol) em acetonitrilo (2 mL) juntou-se nipecotato de etilo (0,016 g, 0,016 mL, 0,1 mmol). A mistura reaccional foi aquecida num reactor de microondas a 80°C durante 2 horas e arrefecida até cerca de 25°C. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um qradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (20,3 mg, 63%). XH RMN (300 MHz, DMSO-d6) δ 0,98 (d,J=6,62 Hz, 6H) 1,15 (t, J=7,17 Hz, 3H) 1,45 (m, 2H) 1,56 (m, 2H) 1,68 (m, 2H) 1,82 (m, 1H) 2,88 (m, 1H) 3,04 (m, 1H) 3,63 (m, 1H) 4,02 (m, 2H) 4,49 (m, 2H) 7,51 (dd, J=9,01, 2,39 Hz, 2H) 7,57 (d, J=2,21 Hz, 1H) 7,70 (d, J=8,46 Hz, 1H) 8,56 (dd, J=8, 09, 1, 84 Hz, 1H) 8,88 (d, J=3,68 Hz, 1H) 10,52 (s, 1H) 14,13 (s, 1H). MS (ESI-) m/z 645 (M-H)-.To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added ethyl nipecotate (0.016 g, 0.016 mL, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a stream of hot nitrogen and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a 10% to 100% strength acetonitrile / 10 mM ammonium acetate in water for 8 minutes (10 minutes test time) at a flow rate of 40 ml / min to give the title compound (20.3 mg, 63%). 1 H NMR (300 MHz, DMSO-d 6) δ0.98 (d, J = 6.62 Hz, 6H) 1.15 (t, J = 7.17 Hz, 3H) 1.45 (m, 2H) 1 2H) 1.68 (m, 2H) 1.82 (m, 1H) 2.88 (m, 1H) 3.04 (m, 1H) 3.63 (m, 1H) 4.02 (m, 2H) 4.49 (m, 2H) 7.51 (dd, J = 9.01, 2.39 Hz, 2H) 7.57 (d, J = 2.21 Hz, (d, J = 8.46 Hz, 1 H) 8.56 (dd, J = 8.9, 1.84 Hz, 1 H) 8.88 (d, J = s, 1H), 14.13 (s, 1H). MS (ESI-) m / z 645 (M-H) -.

Exemplo 461a (25)-1-(clorossulfonil)-2-pirrolidinacarboxilato de metiloExample 461a (25) -1- (Chlorosulfonyl) -2-pyrrolidinecarboxylate

Uma solução de cloridrato de éster metílico de L-prolina (0,33 g, 0,002 mole) em tolueno (5 ml), diclorometano (2 ml) e trietilamina (0,6 ml, 0,004 mole) foi adicionada gota a gota durante um período de 3 minutos a um solução fria (-20°C) de cloreto de sulfurilo (0,32 ml, 0,0039 mole) em tolueno. A mistura foi agitada durante mais 45 minutos a -20°C. A reacção foi filtrada e o solvente foi removido sob pressão reduzida para gerar o composto em título (0,40 g) . :H RMN (300 MHz, CDCls) δ 2,13 (m, 2H) 2,32 (m, 2H) 3,58 (m, 1H) 3,75 (m, 1H) 3,79 (S, 3H) 4,40 (dd, J=8, 82, 4, 04 Hz, 1H) . 420 ΕΡ 1 560 827/ΡΤA solution of L-proline methyl ester hydrochloride (0.33 g, 0.002 mol) in toluene (5 ml), dichloromethane (2 ml) and triethylamine (0.6 ml, 0.004 mol) was added dropwise over a period of 1 hour. period of 3 minutes to a cold (-20 ° C) solution of sulfuryl chloride (0.32 ml, 0.0039 mol) in toluene. The mixture was stirred for another 45 minutes at -20 ° C. The reaction was filtered and the solvent was removed under reduced pressure to give the title compound (0.40 g). 1 H NMR (300 MHz, CDCl 3) δ 2.13 (m, 2H) 2.32 (m, 2H) 3.58 (m, 1H) 3.75 (m, 1H) 3.79 (s, 3H) 4.40 (dd, J = 8, 82, 4.04 Hz, 1H). 420 ΕΡ 1 560 827 / ΡΤ

Exemplo 461Β (25)-1-({[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]-naftiridin-3-il)-1,l-dioxido-4fl-l,2, 4-benzotiadlazin-7-ll]-amino}sulfonil)-2-pirrolidinacarboxilato de metilo O produto do Exemplo 205 (0,030 g, 0,0703 mmol) em acetonitrilo (2 ml) foi tratado com o produto do Exemplo 461A (0,018 g, 0,077 mmol) e trietilamina (0,011 ml, 0,077 mmol), agitado a 60°C durante 20 horas e arrefecido até cerca de 25°C. O solvente foi evaporado sob pressão reduzida e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40Example 461 (25) -1 - ({[3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] -naphthyridin-3-yl) -1,1- The product from Example 205 (0.030 g, 0.0703 mmol) in acetonitrile (2 mL) was treated with methyl 2-chloro-4-oxo-1,2,4-benzothiazol-7-yl] amino} sulfonyl) -2-pyrrolidinecarboxylate the product of Example 461A (0.018 g, 0.077 mmol) and triethylamine (0.011 mL, 0.077 mmol), stirred at 60 ° C for 20 hours and cooled to about 25 ° C. The solvent was evaporated under reduced pressure and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile / acetate 10 mM ammonium in water for 8 minutes (10 minutes test time) at a flow rate of 40

mL/min para gerar o composto em título (7 mg, 16%) . XH RMN (300 MHz, DMSO-d6) δ 0,99 (d, J=6,25 Hz, 6H) 1,59 (m, 2H) 1,67 (m, 2H) 1,87 (m, 4H) 2,09 (d, J=8,46 Hz, 1H) 3,60 (s, 3H) 4,26 (dd, J=8, 64, 3, 86 Hz, 1H) 4,50 (m, 2H) 7,55 (m, 4H) 7,73 (d, J=8,82 Hz, 1H) 8,57 (dd, J=8, 09, 1,84 Hz, 1H) 8,90 (dd, J=4, 78, 1,84 Hz, 1H) 10,53 (s, 1H) 14,07 (s, 1H) . MS (ESI-) m/z 617 (M-H)“.mL / min to give the title compound (7 mg, 16%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.25 Hz, 6H) 1.59 (m, 2H) 1.67 (m, 2H) 1.87 (m, 4H) 2H), 2.09 (d, J = 8.46 Hz, 1 H), 3.60 (s, 3H), 4.26 (dd, 7.55 (m, 4H) 7.73 (d, J = 8.82 Hz, 1 H) 8.57 (dd, J = 8.9, 1.84 Hz, 1 H) 8.90 (dd, J = 4.78, 1.84 Hz, 1 H) 10.53 (s, 1 H) 14.07 (s, 1H). MS (ESI-) m / z 617 (M-H).

Exemplo 462 N- [3- (4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il)-1,l-dioxido-4H-l,2, 4-benzotiadiazin-7-il]-1-pirrolidina-sulfonamida O produto do Exemplo 435B (0,029 g, 0,05 mmol) em acetonitrilo (2 mL) foi tratado com pirrolidina (0,0076 g, 0,009 mL, 0,1 mmol). A mistura reaccional foi aquecida num reactor de microondas a 80°C durante 2 horas e arrefecida até cerca de 25°C. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (2,6 mg, 9%). XH RMN (300 MHz, DMSO-d6) δ 0,98 (d, J=6,25 Hz, 6H) 1,23 (s, 1H) 1,55 (s, 1H) 1,75 (m, 1H) 2,51 (m, 4H) 3,21 (t, J=6,62 Hz, 421 ΕΡ 1 560 827/ΡΤ 4Η) 4,48 (s, 2Η) 7,60 (s, 6Η) 8,53 (s, 1Η) 8,87 (s, 1H) 10,35 (S, 1H) . MS (ESI-) m/z 559 (M-H)~.Example 462 N- [3- (4-Hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1-dioxido-4H-1,2 , 4-benzothiadiazin-7-yl] -1-pyrrolidine sulfonamide The product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was treated with pyrrolidine (0.0076 g, 0.009 mL, 1 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a stream of warm nitrogen and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% of acetonitrile / 10 mM ammonium acetate in water for 8 minutes (10 minutes test time) at a flow rate of 40 ml / min to give the title compound (2.6 mg, 9%). 1 H NMR (300 MHz, DMSO-d 6) δ0.98 (d, J = 6.25 Hz, 6H) 1.23 (s, 1H) 1.55 (s, 1H) 1.75 (m, 1H) 2.51 (m, 4H) 3.21 (t, J = 6.62 Hz, 421 ÅΡ 1 560 827 / ΡΤ 4Η) 4.48 (s, 2 7) 7.60 (s, 6Η) 8.53 ( s), 8.87 (s, 1H), 10.35 (s, 1H). MS (ESI-) m / z 559 (M-H) -.

Exemplo 463 3-hidroxi-l\/- [3- (4-hidroxi-l-isopentil-2-oxo-l, 2-dl-hldro [1,8] — naftiridin-3-il)-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il]-1-piperidinassulfonamida O produto do Exemplo 435B (0,029 g, 0,05 mmol) em acetonitrilo (2 mL) foi tratado com cloridrato de 3-hidroxi-piperidina (0,0079 g, 0,1 mmol) e trietilamina (0,00796 ml, 0,057 mmol). A mistura reaccional foi aquecida num reactor de microondas a 80°C durante 2 horas e arrefecida até cerca de 25°C. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa em fase inversa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo/acetato de amónio 10 mM em água durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para gerar o composto em título (4,8 mg, 18%). 1H RMN (300 MHz, DMSO-de) δ 0,99 (d, J=6,62 Hz, 6H) 1,18 (s, 1H) 1,35 (s, 1H) 1,59 (m, 2 H) 1,67 (d, J=34,56 Hz, 2H) 2,71 (s, 4H) 3,51 (s, 4H) 4,50 (m, 2H) 7,51 (m, 2H) 7,58 (m, 1H) 7,72 (d, J=8,82 Hz, 1H) 8,57 (dd, J=8, 09, 1, 84 Hz, 1H) 8,90 (dd, J=4, 60, 1, 65 Hz, 1H) 10,46 (s, 1H) 14,08 (s, 1H) . MS (ESI-) m/z 589 (M-H)“.Example 463 3-Hydroxy-1- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro-1,8-naphthyridin-3-yl) -1,1- The product from Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was treated with 3-hydroxy-piperidine hydrochloride (0.0079 g, 0.1 mmol) and triethylamine (0.00796 mL, 0.057 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a stream of warm nitrogen and the residue was purified by preparative reverse phase HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% of acetonitrile / 10 mM ammonium acetate in water for 8 minutes (10 minutes test time) at a flow rate of 40 ml / min to give the title compound (4.8 mg, 18%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.99 (d, J = 6.62 Hz, 6H) 1.18 (s, 1H) 1.35 (s, 1H) 1.59 (m, 2H 2H), 2.71 (s, 4H), 3.51 (s, 4H), 4.50 (m, 2H), 7.51 (m, (D, J = 8.82 Hz, 1 H) 8.57 (dd, J = 8.9, 1.84 Hz, 1 H) 8.90 (dd, J = 60, 1.65 Hz, 1 H) 10.46 (s, 1 H) 14.08 (s, 1 H). MS (ESI-) m / z 589 (M-H).

Exemplo 464A 3-[1-(ciclobutilamino)-4-hidroxi-2-oxo-l, 2-di-hidro-3-quinolinil]-1,l-dioxido-4fl-l,2,4-benzotiadiazin-7-ilcarbamato de tert-butiloExample 464A 3- [1- (Cyclobutylamino) -4-hydroxy-2-oxo-1,2-dihydro-3-quinolinyl] -1,1-dioxido-4 H -1,2,4-benzothiadiazin-7- ylcarbamate

Uma mistura do produto do Exemplo 432B (1,25 g, 3,74 mmol) e produto do Exemplo 414A (1,06 g, 3,7 mmol) em dioxano anidro (50 mL) foi aquecida a refluxo durante 3 horas, arrefecida até 25°C e concentrada sob pressão reduzida. O resíduo foi triturado em hexano/acetato de etilo 3:1 quente (30 mL), arrefecido e o sólido foi recolhido por filtração e seco para proporcionar o composto em título (1,5 g, 76% de rendimento). 422 ΕΡ 1 560 827/ΡΤA mixture of the product of Example 432B (1.25 g, 3.74 mmol) and the product from Example 414A (1.06 g, 3.7 mmol) in anhydrous dioxane (50 mL) was heated at reflux for 3 hours, cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated in hot 3: 1 hexane / ethyl acetate (30 mL), cooled, and the solid collected by filtration and dried to provide the title compound (1.5 g, 76% yield). 422 ΕΡ 1 560 827 / ΡΤ

Exemplo 464Β 3-(7-amino-l,l-dioxido-4ff-l,2,4-benzotiadiazin-3-il)- 1-(ciclobutilamino)-4-hidroxi-2(1H)-quinolinonaExample 464 3- (7-Amino-1,1-dioxido-4 H -1,2,4-benzothiadiazin-3-yl) -1- (cyclobutylamino) -4-hydroxy-2 (1H) -quinolinone

Uma lama do produto do Exemplo 464A (1,5 g, 2,85 mmol) em diclorometano (10 mL) a 0°C foi tratada gota a gota com 6 mL de ácido trifluoroacético, agitada a 25°C durante 2 horas e concentrada sob pressão reduzida. O resíduo foi dissolvido em acetato de etilo, lavado com bicarbonato de sódio aquoso a 10% (3 x 50 mL), lavado com salmoura, seco sobre sulfato de sódio, filtrado e concentrado sob pressão reduzida para proporcionar o composto em titulo (1,1 g, 91% de rendimento).A slurry of the product of Example 464A (1.5 g, 2.85 mmol) in dichloromethane (10 mL) at 0 ° C was treated dropwise with 6 mL trifluoroacetic acid, stirred at 25 ° C for 2 hours and concentrated under reduced pressure. The residue was dissolved in ethyl acetate, washed with 10% aqueous sodium bicarbonate (3 x 50 mL), washed with brine, dried over sodium sulfate, filtered and concentrated under reduced pressure to afford the title compound (1, 1 g, 91% yield).

Exemplo 464C N-{3-[1-(ciclobutilamino)-4-hidroxi-2-oxo-l,2-di-hidro-3-quinolinil]-1,l-dioxido-4H-l,2, 4-benzotiadiazin-7-il}-etanossulfonamidaExample 464C N- {3- [1- (Cyclobutylamino) -4-hydroxy-2-oxo-1,2-dihydro-3-quinolinyl] -1,1-dioxido-4 H -1,2,4-benzothiadiazin -7-yl} -ethanesulfonamide

Uma solução do produto do Exemplo 464B (0, 0425 g, 0,1 mmol) em piridina (300 pL) foi tratada gota a gota com cloreto de etanossulfonilo (0,026 mg, 0,2 mmol), agitada durante 1 hora a 25°C e concentrada sob pressão reduzida. O resíduo foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm x 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo:TFA aquoso a 0,1% durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/minuto para proporcionar o composto em título (0,020 g, 39% de rendimento). XH RMN (300 MHz, DMSO-d6) δ 1,23 (t, J=7,17 Hz, 3H) 1,56 (m, 1H) 1,70 (m, 1H) 2,05 (m, 4H) 3,19 (q, J=7,35 Hz, 2H) 3,77 (m, 1H) 6,56 (s, 1H) 7,44 (t, J=7,54 Hz, 1H) 7,60 (dd, J=8,82, 2,21 Hz, 1H) 7,67 (m, 2H) 7,89 (m, 1H) 8,06 (d, J=8,46 Hz, 1H) 8,17 (d, J=8,09 Hz, 1H) 10,33 (s, 1H) 14,16 (s, 1H) 15,03 (br s, 1H). MS (ESI ) m/z 516 (M-H)”.A solution of the product of Example 464B (0.0425 g, 0.1 mmol) in pyridine (300 μl) was treated dropwise with ethanesulfonyl chloride (0.026 mg, 0.2 mmol), stirred for 1 hour at 25 ° C and concentrated under reduced pressure. The residue was purified by preparative HPLC on a Waters Symmetry C8 column (25 mm x 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile: 0.1% aqueous TFA for 8 minutes (10 minutes of assay time) at a flow rate of 40 mL / min to provide the title compound (0.020 g, 39% yield). 1 H NMR (300 MHz, DMSO-d 6) δ 1.23 (t, J = 7.17 Hz, 3H) 1.56 (m, 1H) 1.70 (m, 1H) 2.05 (m, 4H) 3.19 (q, J = 7.35 Hz, 2 H) 3.77 (m, 1 H) 6.56 (s, 1 H) 7.44 (t, J = dd, J = 8.82, 2.21 Hz, 1 H) 7.67 (m, 2 H) 7.89 (m, 1 H) 8.06 (d, J = 8.46 Hz, d, J = 8.09 Hz, 1 H) 10.33 (s, 1 H) 14.16 (s, 1 H) 15.03 (br s, 1H). MS (ESI) m / z 516 (M-H).

Exemplo 465 3-{3-[1-(ciclobutilamino)-4-hidroxi-2-oxo-l,2-di-hidro-3guinolinil]-1,l-dioxido-4ff-l, 2, 4-benzotiadiazin-7-il}-diazatiano-l-carboxilato de benzilo, 2,2-dióxidoExample 465 3- {3- [1- (Cyclobutylamino) -4-hydroxy-2-oxo-1,2-dihydro-3-quinolinyl] -1,1-dioxido-4 H -1,2,4-benzothiadiazin-7 -yl} -diazatiano-1-carboxylate, 2,2-dioxide

Uma solução de isocianato de clorossulfonilo (0,051 g, 0,36 mmol) em diclorometano (2 mL) foi tratada gota a gota com álcool benzilico (0,039 g, 0,36 mmol) a 0°C, agitada a 25°C 423 ΕΡ 1 560 827/ΡΤ durante 30 minutos e tratada com uma solução do produto do Exemplo 464B (0,127 g, 0,03 mmol) e trietilamina (0,12 g, 1,2 mmol) em diclorometano (4 mL). A mistura reaccional foi agitada durante 2 horas a 25°C e repartida entre diclorometano (10 mL) e ácido clorídrico IN aguoso (10 mL) . A resultante fase orgânica foi separada, seca sobre sulfato de sódio, filtrada e concentrada sob pressão reduzida. O resíduo foi cromatografado em sílica gel eluindo com 3% de metanol em diclorometano para proporcionar o composto em título (0,127 g, 66% de rendimento). 1H RMN (300 MHz, DMSO-d6) δ 1,57 (m, 1H) 1,70 (m, 1H) 2,04 (m, 4H) 3,78 (m, 1H) 5,12 (s, 2H) 6,57 (s, 1H) 7,30 (m, 5H) 7,44 (t, J=7,54 Hz, 1H) 7,50 (m, 1H) 7,66 (m, 2H) 7,89 (t, J=7,91 Hz, 1H) 8,07 (d, J=8,09 Hz, 1H) 8,17 (d, J=8,46 Hz, 1H) 11,13 (s, 1H) 12,16 (s, 1H) 14,15 (s, 1H) 15,06 (S, 1H) . MS (ESI ) m/z 637 (M-H)~~.A solution of chlorosulfonyl isocyanate (0.051 g, 0.36 mmol) in dichloromethane (2 mL) was treated dropwise with benzyl alcohol (0.039 g, 0.36 mmol) at 0 ° C, stirred at 25 ° C 423 ° F 1 560 827 / ΡΤ over 30 minutes and treated with a solution of the product of Example 464B (0.127 g, 0.03 mmol) and triethylamine (0.12 g, 1.2 mmol) in dichloromethane (4 mL). The reaction mixture was stirred for 2 hours at 25 ° C and partitioned between dichloromethane (10 mL) and aqueous 1N hydrochloric acid (10 mL). The resulting organic phase was separated, dried over sodium sulfate, filtered and concentrated under reduced pressure. The residue was chromatographed on silica gel eluting with 3% methanol in dichloromethane to provide the title compound (0.127 g, 66% yield). 1H NMR (300 MHz, DMSO-d6) δ 1.57 (m, 1H) 1.70 (m, 1H) 2.04 (m, 4H) 3.78 (m, 1H) 5.12 (s, 2H ) 6.57 (s, 1H) 7.30 (m, 5H) 7.44 (t, J = 7.54Hz, 1H) 7.50 (m, 1H) 7.66 (m, (D, J = 8.09 Hz, 1 H) 8.17 (d, J = 8.46 Hz, 1 H) 11.13 (s, 1H ) 12.16 (s, 1H) 14.15 (s, 1H) 15.06 (S, 1H). MS (ESI) m / z 637 (M-H) +.

Exemplo 466A 3-{3-[1-(ciclobutilamino)-4-hidroxi-2-oxo-l,2-di-hidro-3-guinolinil]-1,l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il}-1-metildiazatiano-l-carboxilato de benzilo, 2,2-dióxidoExample 466A 3- {3- [1- (Cyclobutylamino) -4-hydroxy-2-oxo-1,2-dihydro-3-guinolinyl] -1,1-dioxido-4 H -1,2,4-benzothiadiazin -7-yl} -1-methyldiazatiane-1-carboxylate, 2,2-dioxide

Uma solução do produto do Exemplo 465 (0, 045 g, 0,07 mmol) em tetra-hidrofurano/metanol 1:1 (2 ml) a -10°C foi tratada gota a gota com trimetilsilildiazometano (2,0M em hexanos, 70 pL, 0,14 mmol), agitada a 25°C durante 16 horas e concentrada sob pressão reduzida para proporcionar o composto em título (0,045 g, 98% de rendimento).A solution of the product of Example 465 (0.045 g, 0.07 mmol) in 1: 1 tetrahydrofuran / methanol (2 mL) at -10 ° C was treated dropwise with trimethylsilyldiazomethane (2.0M in hexanes, 70 μl, 0.14 mmol), stirred at 25 ° C for 16 hours and concentrated under reduced pressure to provide the title compound (0.045 g, 98% yield).

Exemplo 466B N-{3-[1-(ciclobutilamino)-4-hidroxi-2-oxo-l,2-di-hidro-3-quinolinil]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}- N' -metilsulfamidaExample 466B N- {3- [1- (Cyclobutylamino) -4-hydroxy-2-oxo-1,2-dihydro-3-quinolinyl] -1,1-dioxido-4H-1,2,4-benzothiadiazin -7-yl} -N'-methylsulfamide

Uma solução do produto do Exemplo 466A (0,045 g, 0,069 mmol) em tetra-hidrofurano (8 mL) e metanol (2 mL) foi tratada com paládio sobre carbono a 10% (20 mg) e agitada durante 24 horas a 25°C sob uma atmosfera de hidrogénio. A solução resultante foi filtrada através de Celite® (terra de diatomáceas) e o filtrado concentrado sob pressão reduzida. O resíduo foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo:TFA 424 ΕΡ 1 560 827/ΡΤ aquoso a 0,1% durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/minuto para proporcionar o composto em titulo (0, 006 g, 17% de rendimento). XH RMN (300 MHz, DMSO-de) δ 1,55 (m, 1H) 1,69 (m, 1H) 2,03 (m, 4H) 3,78 (m, 1H) 6,55 (s, 1H) 7,40 (d, J=5,52 Hz, 1H) 7,45 (m, 1H) 7,52 (dd, J=8,82, 2,57 Hz, 1H) 7,65 (m, 2H) 7,88 (t, J=7,91 Hz, 1H) 8,07 (d, J=8,46 Hz, 1H) 8,16 (d, J=6,99 Hz, 1H) 10,24 (s, 1H) 14,11 (s, 1H) 15,11 (s, 1H). MS (ESI&quot;) m/z 517 (M-H)&quot;.A solution of the product of Example 466A (0.045 g, 0.069 mmol) in tetrahydrofuran (8 mL) and methanol (2 mL) was treated with 10% palladium on carbon (20 mg) and stirred for 24 hours at 25 ° C under an atmosphere of hydrogen. The resulting solution was filtered through Celite® (diatomaceous earth) and the filtrate concentrated under reduced pressure. The residue was purified by preparative HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 æm particle size) using a gradient from 10% to 100% acetonitrile: TFA 424 ÅΡ 1 560 827 / ΡΤ aqueous at 0, 1% for 8 minutes (10 minutes of assay time) at a flow rate of 40 mL / min to provide the title compound (0.006 g, 17% yield). 1 H NMR (300 MHz, DMSO-d 6) δ 1.55 (m, 1 H) 1.69 (m, 1 H) 2.03 (m, 4H) 3.78 (m, 1 H) 6.55 (s, 1H ) 7.40 (d, J = 5.52 Hz, 1 H) 7.45 (m, 1 H) 7.52 (dd, J = 8.82, 2.57 Hz, 1 H) 7.65 (m, 2H ) 7.88 (t, J = 7.91 Hz, 1 H) 8.07 (d, J = 8.46 Hz, 1 H) 8.16 (d, J = 6.99 Hz, 1 H) 10.24 ( s, 1H) 14.11 (s, 1H) 15.11 (s, 1H). MS (ESI &quot;) m / z 517 (M-H) &quot;.

Exemplo 467 N-{3-[1-(ciclobutilamino)-4-hidroxi-2-oxo-l, 2-di-hidro-3-quinolinil]-1,l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il}-sulfamidaExample 467 N- {3- [1- (Cyclobutylamino) -4-hydroxy-2-oxo-1,2-dihydro-3-quinolinyl] -1,1-dioxido-4 H -1,2,4-benzothiadiazin -7-yl} -sulfamide

Uma solução do produto do Exemplo 465 (0,790 g, 1,2 mmol) em tetra-hidrofurano (80 mL) e metanol (20 mL) foi tratada com paládio sobre carbono a 10% (200 mg) e agitada durante 24 horas a 25°C sob uma atmosfera de hidrogénio. A reacção foi filtrada através de Celite® (terra de diatomáceas) e o filtrado concentrado sob pressão reduzida para proporcionar o composto em titulo (0,500 g, 83% de rendimento). XH RMN (300 MHz, DMSO-d6) δ 1,58 (m, 1H) 1,67 (m, 1H) 2,03 (m, 4H) 3,78 (m, 1H) 6,56 (s, 1H) 7,39 (s, 2H) 7,44 (t, J=7,54 Hz, 1H) 7,52 (m, 1H) 7,64 (m, 2H) 7,89 (t, J=7,91 Hz, 1H) 8,07 (d, J=8,82 Hz, 1H) 8,17 (d, J=8, 46 Hz, 1H) 10,06 (s, 1H) 14,09 (s, 1H) 15,14 (s, 1H). MS (ESI') m/z 503 (M-H)&quot;.A solution of the product of Example 465 (0.790 g, 1.2 mmol) in tetrahydrofuran (80 mL) and methanol (20 mL) was treated with 10% palladium on carbon (200 mg) and stirred for 24 hours at 25 ° C. Under an atmosphere of hydrogen. The reaction was filtered through Celite (diatomaceous earth) and the filtrate concentrated under reduced pressure to give the title compound (0.500 g, 83% yield). 1 H NMR (300 MHz, DMSO-d 6) δ 1.58 (m, 1H) 1.67 (m, 1H) 2.03 (m, 4H) 3.78 (m, 1H) 6.56 (s, 1H ) 7.39 (s, 2H) 7.44 (t, J = 7.54 Hz, 1 H) 7.52 (m, 1 H) 7.64 (m, 2 H) 7.89 (t, (D, J = 8.82 Hz, 1 H) 8.17 (d, J = 8.46 Hz, 1 H) 10.06 (s, 1 H) 14.09 (s, 1H ) 15.14 (s, 1H). MS (ESI +) m / z 503 (M-H) &quot;.

Exemplo 468A 4-(benziloxi)-1-(ciclobutilmetil)-2(1H)-piridinonaExample 468A 4- (Benzyloxy) -1- (cyclobutylmethyl) -2 (1H) -pyridinone

Uma solução de 4-benziloxi-lH-piridin-2-ona (0,60 g, 2,98 mmol) em N, N-dimetilacetamida (10 mL) a 0°C foi tratada com hidreto de sódio (0,086 g, 3,58 mmol) durante 30 minutos, depois juntou-se bromometilciclobutano (0,40 mL, 3,58 mmol) e a mistura foi agitada a 25°C durante 48 horas. A solução foi repartida entre solução aquosa de cloreto de amónio a 10% e diclorometano, a fase orgânica foi separada, concentrada sob pressão reduzida e o residuo foi cromatografado em silica gel, eluindo com 1% de metanol em diclorometano para proporcionar o composto em titulo (0,426 g, 53%). 425 ΕΡ 1 560 827/ΡΤA solution of 4-benzyloxy-1H-pyridin-2-one (0.60 g, 2.98 mmol) in N, N-dimethylacetamide (10 mL) at 0 ° C was treated with sodium hydride (0.086 g, , 58 mmol) over 30 minutes, then bromomethylcyclobutane (0.40 mL, 3.58 mmol) was added and the mixture was stirred at 25 ° C for 48 hours. The solution was partitioned between aqueous 10% ammonium chloride solution and dichloromethane, the organic phase separated, concentrated under reduced pressure, and the residue chromatographed on silica gel, eluting with 1% methanol in dichloromethane to provide the title compound (0.426 g, 53%). 425 ΕΡ 1 560 827 / ΡΤ

Exemplo 468Β 1-(ciclobutilmetil)-4-hidroxi-2(1H)-piridinonaExample 468 1- (Cyclobutylmethyl) -4-hydroxy-2 (1H) -pyridinone

Uma solução do produto do Exemplo 468A (0, 426 g, 1,58 mmol) em tetra-hidrofurano (20 mL) foi tratada com formato de amónio (0,38 g, 6,03 mmol) e uma quantidade catalítica de hidróxido de paládio sobre carbono a 20% a 70°C durante 2 horas. A mistura reaccional foi arrefecida até cerca de 25°C, filtrada através de terra de diatomáceas e o filtrado concentrado sob pressão reduzida para proporcionar o composto em titulo (0,244 g, 86%).A solution of the product of Example 468A (0.466 g, 1.58 mmol) in tetrahydrofuran (20 mL) was treated with ammonium formate (0.38 g, 6.03 mmol) and a catalytic amount of 20% palladium on carbon at 70 ° C for 2 hours. The reaction mixture was cooled to about 25øC, filtered through diatomaceous earth and the filtrate concentrated under reduced pressure to give the title compound (0.244 g, 86%).

Exemplo 468C 3-[bis(metilsulfanil)metileno]-l-(ciclobutilmetil)-2, 4(1H, 3H)-piridinadionaExample 468C 3- [Bis (methylsulfanyl) methylene] -1- (cyclobutylmethyl) -2,4 (1H, 3H) -pyridinedione

Uma solução do produto do Exemplo 468B (0,244 g, 1,36 mmol) e piridina (0,88 mL, 10,89 mmol) em dioxano (6 mL) foi tratada com excesso de metilsulfato de tris(metiltio)metilo (preparado utilizando o procedimento de Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi), agitada a 90°C durante 1,5 horas e arrefecida até cerca de 25°C. A solução reaccional foi decantada dos sólidos resultantes e o solvente foi removido sob uma corrente de azoto quente. O resíduo foi dissolvido em hexanos e carregado num Alltech Sep pack de 2 g e eluído com hexanos seguidos de diclorometano seguido de acetato de etilo a 25% em diclorometano para gerar o composto em título (0,192 g, 50%).A solution of the product of Example 468B (0.244 g, 1.36 mmol) and pyridine (0.88 mL, 10.89 mmol) in dioxane (6 mL) was treated with excess tris (methylthio) methyl methylsulfate (prepared using the procedure of Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi), stirred at 90 ° C for 1.5 hours and cooled to about of 25 ° C. The reaction solution was decanted from the resulting solids and the solvent was removed under a stream of warm nitrogen. The residue was dissolved in hexanes and charged to a 2 g Alltech Sep pack and eluted with hexanes followed by dichloromethane followed by 25% ethyl acetate in dichloromethane to give the title compound (0.192 g, 50%).

Exemplo 468D N-{3-[1-(ciclobutilmetil)-4-hidroxi-2-oxo-l, 2-di-hidro-3-piridinil]-1,l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il}-metanossulfonamidaExample 468D N- {3- [1- (Cyclobutylmethyl) -4-hydroxy-2-oxo-1,2-dihydro-3-pyridinyl] -1,1-dioxido-4 H -1,2,4-benzothiadiazin -7-yl} -methanesulfonamide

Uma solução do produto do Exemplo 468C (0, 050 g, 0,176 mmol) em dioxano (5 mL) foi tratada com o produto do Exemplo 425D (0,030 g, 0,113 mmol), agitada a 110°C durante 1 hora e arrefecida até 25°C. O precipitado sólido foi recolhido por filtração e seco para proporcionar o composto em título (0,018 g, 35%). XH RMN (300 MHz, DMSO-d6) δ 1,88 (m, 6H) 2,74 (dt, J=15,17, 7,68 Hz, 1H) 3,08 (S, 3H) 4,03 (d, J=7,35 Hz, 2H) 6,32 (d, J=7,72 Hz, 1H) 7,56 (dd, J=8, 82, 2, 57 Hz, 1H) 7,62 426 ΕΡ 1 560 827/ΡΤ (d, J=2,21 Hz, 1H) 7,66 (m, 1H) 8,06 (d, J=7,35 Hz, 1H) 10,24 (S, 1H) 13,83 (s, 1H) 14,28 (s, 1H). MS (ESI-) m/z 451 (M-H)&quot;.A solution of the product of Example 468C (0.050 g, 0.176 mmol) in dioxane (5 mL) was treated with the product of Example 425D (0.030 g, 0.113 mmol), stirred at 110 ° C for 1 hour and cooled to 25 ° C. ° C. The solid precipitate was collected by filtration and dried to provide the title compound (0.018 g, 35%). 1 H NMR (300 MHz, DMSO-d 6) δ 1.88 (m, 6H) 2.74 (dt, J = 15.17, 7.68 Hz, 1 H) 3.08 (s, 3H) 4.03 ( d, J = 7.35 Hz, 2 H) 6.32 (d, J = 7.72 Hz, 1 H) 7.56 (dd, J = 8.82, (D, J = 7.35 Hz, 1 H) 8.06 (d, J = 2.21 Hz, 1 H) 7.66 (m, 1 H) 8.06 (d, 83 (s, 1 H) 14.28 (s, 1 H). MS (ESI-) m / z 451 (M-H) &quot;.

Exemplo 469 N-{3-[5-bromo-l-(ciclobutilmetil)-4-hidroxl-2-oxo-l,2-dl-hidro-3-piridinil]-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il}-metanossulfonamidaExample 469 N- {3- [5-Bromo-1- (cyclobutylmethyl) -4-hydroxy-2-oxo-1,2-dihydro-3-pyridinyl] -1,1-dioxido-4H-1,2 , 4-benzothiadiazin-7-yl} -methanesulfonamide

Uma solução do produto do Exemplo 468D (0, 030 g, 0,066 mmol) em tetra-hidrofurano (2 mL) foi tratada com 1,3-dibromo-5,5-dimetil-hidantoína (0,015 g, 0,052 mmol) a 25°C durante 18 horas. A reacção foi concentrada sob uma corrente de azoto quente e o resíduo foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo:TFA aquoso a 0,1% durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para proporcionar o composto em título (0,008 g, 23%). XH RMN (300 MHz, DMSO-dê) δ 1,83 (m, 4H) 1,95 (m, 2H) 2,75 (m, 1H) 3,08 (s, 3H) 4,03 (d, J=6,99 Hz, 2H) 7,56 (dd, J=9,01, 2,39 Hz, 1H) 7,62 (d, J=2,21 Hz, 1H) 7,67 (d, J=8,82 Hz, 1H) 8,55 (s, 1H) 10,24 (s, 1H) 14,35 (s, 1H) . MS (ESI-) m/z 530 (M-H)”.A solution of the product of Example 468D (0.030 g, 0.066 mmol) in tetrahydrofuran (2 mL) was treated with 1,3-dibromo-5,5-dimethylhydantoin (0.015 g, 0.052 mmol) at 25 ° C for 18 hours. The reaction was concentrated under a stream of hot nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile: TFA (10 minutes test time) at a flow rate of 40 mL / min to provide the title compound (0.008 g, 23%). 1 H NMR (300 MHz, DMSO-d 6) δ 1.83 (m, 4H) 1.95 (m, 2H) 2.75 (m, 1H) 3.08 (s, 3H) 4.03 (d, J = J = 9.01, 2.39 Hz, 1 H) 7.62 (d, J = 2.21 Hz, 1 H) 7.67 (d, J = 8.82 Hz, 1 H) 8.55 (s, 1 H) 10.24 (s, 1 H) 14.35 (s, 1H). MS (ESI-) m / z 530 (M-H).

Exemplo 470A N- [3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro-3-piridinil)-1,l-dioxido-4H-l,2,4-benzotiadiazin-7-il]metanossulfonamidaExample 470A N- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro-3-pyridinyl) -1,1-dioxido-4H-1,2,4-benzothiadiazin-7 -yl] methanesulfonamide

Uma solução do produto do Exemplo 457C (0,195 g, 0,68 mmol) em dioxano (10 mL) reagiu com o produto do Exemplo 425D (0,17 g, 0,64 mmol) a 115°C durante 1 hora. Após arrefecimento até cerca de 25°C, o precipitado sólido foi recolhido por filtração e seco para proporcionar o composto em título (0,258 g, 89 %) · 1R RMN (300 MHz , DMSO-de) δ 0,93 (d, J=6, 25 Hz, 6 H) 1,58 (m, 3H) 3,08 (s, 3H) 3,99 (m, 2H) 6,33 (d, J=6, 62 Hz, 1H) 7, 57 (m, 2H) 7,67 (d , J= 8,82 Hz, 1H) 8, 07 (d, J=6, 62 Hz, 1H) 10,25 (s, , 1H) 13, 84 (s, 1H) 14,28 (S, 1H) . MS (ESI -) m/ z 453 (M-H)“.A solution of the product of Example 457C (0.195 g, 0.68 mmol) in dioxane (10 mL) was reacted with the product of Example 425D (0.17 g, 0.64 mmol) at 115 ° C for 1 hour. After cooling to about 25øC, the solid precipitate was collected by filtration and dried to provide the title compound (0.258 g, 89%). 1 H NMR (300 MHz, DMSO-d 6) δ0.93 (d, J = (S, 3H), 3.99 (m, 2H), 6.33 (d, J = 6.62 Hz, 1H), 7.98 (m, (D, J = 8.82 Hz, 1 H) 8.07 (d, J = 6.62 Hz, 1 H) 10.25 (s, 1 H) 13.84 , 1H) 14.28 (s, 1H). MS (ESI -) m / z 453 (M-H).

Exemplo 470B N- [3-(5-bromo-4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro-3-piridinil)-1,l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il]-metanossulfonamida 427 ΕΡ 1 560 827/ΡΤExample 470B N- [3- (5-bromo-4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro-3-pyridinyl) -1,1-dioxido-4 H -1,2,4 -benzothiadiazin-7-yl] -methanesulfonamide 427 ΕΡ 1 560 827 / ΡΤ

Uma solução do produto do Exemplo 470A (0,258 g, 0,57 mmol) em tetra-hidrofurano (10 mL) foi tratada com 1,3-dibromo-5,5-dimetil-hidantoína (0,24 g, 0,84 mmol) a 25°C durante 18 horas. O solvente foi removido sob uma corrente de azoto quente e o resíduo foi cromatografado em sílica gel eluindo com diclorometano para proporcionar o composto em título (0,13 g, 43%). XH RMN (300 MHz, DMSO-d6) δ 0,94 (d, J=6,25 Hz, 6H) 1,61 (m, 3H) 3,08 (S, 3H) 4,00 (m, 2H) 7,56 (dd, J=8,82, 2,21 Hz, 1H) 7,63 (d, J=2,21 Hz, 1H) 7,70 (m, 1H) 8,59 (s, 1H) 10,26 (s, 1H) 14,29 (s, 1H) . MS (ESI-) m/z 532 (M-H)“.A solution of the product of Example 470A (0.258 g, 0.57 mmol) in tetrahydrofuran (10 mL) was treated with 1,3-dibromo-5,5-dimethylhydantoin (0.24 g, 0.84 mmol ) at 25 ° C for 18 hours. The solvent was removed under a stream of hot nitrogen and the residue was chromatographed on silica gel eluting with dichloromethane to provide the title compound (0.13 g, 43%). 1 H NMR (300 MHz, DMSO-d 6) δ0.94 (d, J = 6.25 Hz, 6H) 1.61 (m, 3H) 3.08 (s, 3H) 4.00 (m, 2H) 7.56 (dd, J = 8.82, 2.21 Hz, 1 H) 7.63 (d, J = 2.21 Hz, 1 H) 7.70 (m, 10.26 (s, 1 H) 14.29 (s, 1 H). MS (ESI-) m / z 532 (M-H).

Exemplo 470C N- [3-(4-hidroxi-l-isopentil-2-oxo-5-vinil-l,2-di-hidro-3-piridinil)-1,l-dioxido-4U-l, 2, 4-benzotiadiazin-7-il]- metanossulfonamida O produto do Exemplo 470B (0,027 g, 0,051 mmol) e tributil(vinil)estanho (0,015 mL, 0,051 mmol) em tetra-hidrofurano e uma quantidade catalítica de diclorobis-(trifenilfosfina)paládio(II) reagiram a 75°C durante 20 horas. A solução foi arrefecida até cerca de 25°C e concentrada. O resíduo foi purificado por HPLC preparativa numa coluna Waters Symmetry C8 (25 mm χ 100 mm, 7 pm de tamanho de partícula) utilizando um gradiente de 10% para 100% de acetonitrilo:TFA aquoso a 0,1% durante 8 minutos (10 minutos de tempo de ensaio) a um caudal de 40 mL/min para proporcionar o composto em título (0,005 g, 21%). XH RMN (300 MHz, DMSO-d6) δ 0,95 (d, J=5,88 Hz, 6H) 1,61 (m, 3H) 3,08 (s, 3H) 4,05 (m, 2H) 5,32 (d; J=ll,03 Hz, 1H) 5,87 (d, J=18,02 Hz, 1H) 6,64 (m, 1H) 7,64 (m, 3H) 8,42 (s, 1H) 10,26 (s, 1H) 14,42 (s, 1H) 14,67 (s, 1H) . (ESI-) m/z 479 (M-H)”.Example 470C N- [3- (4-hydroxy-1-isopentyl-2-oxo-5-vinyl-1,2-dihydro-3-pyridinyl) -1,1-dioxido-4-1,2,4 The product of Example 470B (0.027 g, 0.051 mmol) and tributyl (vinyl) tin (0.015 mL, 0.051 mmol) in tetrahydrofuran and a catalytic amount of dichlorobis (triphenylphosphine) palladium ( II) were reacted at 75 ° C for 20 hours. The solution was cooled to about 25 ° C and concentrated. The residue was purified by preparative HPLC on a Waters Symmetry C8 column (25 mm χ 100 mm, 7 pm particle size) using a gradient from 10% to 100% acetonitrile: 0.1% aqueous TFA for 8 minutes (10 minutes of assay time) at a flow rate of 40 mL / min to provide the title compound (0.005 g, 21%). 1 H NMR (300 MHz, DMSO-d 6) δ 0.95 (d, J = 5.88 Hz, 6H) 1.61 (m, 3H) 3.08 (s, 3H) 4.05 (m, 2H) 5.32 (d, J = 11.03 Hz, 1 H) 5.87 (d, J = 18.02 Hz, 1 H) 6.64 (m, 1 H) 7.64 (m, 3H) 8.42 ( s, 1H) 10.26 (s, 1H) 14.42 (s, 1H) 14.67 (s, 1H). (ESI-) m / z 479 (M-H).

Exemplo 471 N- (2-furilmetil)-3-[3-(4-hidroxi-l-isopentil-2-oxo-l,2-di-hidro[1,8]naftiridin-3-il)-1, l-dioxido-4H-l, 2, 4-benzotiadiazin-7-il]diazatiano-l-carboxamida, 2,2-dióxidoExample 471 N- (2-furylmethyl) -3- [3- (4-hydroxy-1-isopentyl-2-oxo-1,2-dihydro [1,8] naphthyridin-3-yl) -1,1 4H-1,2,4-benzothiadiazin-7-yl] diazatian-1-carboxamide, 2,2-dioxide

Uma solução de isocianato de clorossulfonilo (4,9 pL, 0, 0562 mmol) em diclorometano (2 mL) foi tratada gota a gota com furfurilamina (5 pL, 0, 0562 mmol) a 25°C, agitada a 25°C 428 ΕΡ 1 560 827/ΡΤ durante 30 minutos, tratada com uma solução do produto do Exemplo 205 (20 mg, 0,0468 mmol) e trietilamina (26 pL, 0,187 mmol) em diclorometano (2 mL) e agitada durante 24 horas a 25°C. A mistura reaccional foi repartida entre diclorometano (10 mL) e ácido clorídrico IN aguoso (10 mL) . A resultante fase orgânica foi separada, seca sobre sulfato de magnésio, filtrada e concentrada sob pressão reduzida para proporcionar o composto em título (15%). MS m/z 630 (M+H) + .A solution of chlorosulfonyl isocyanate (4.9 æL, 0.0552 mmol) in dichloromethane (2 mL) was treated dropwise with furfurylamine (5 æL, 0.0552 mmol) at 25 øC, stirred at 25 øC 428 (20 mg, 0.0468 mmol) and triethylamine (26 μl, 0.187 mmol) in dichloromethane (2 mL) and stirred for 24 hours at 25 ° C. ° C. The reaction mixture was partitioned between dichloromethane (10 mL) and aqueous IN hydrochloric acid (10 mL). The resulting organic phase was separated, dried over magnesium sulfate, filtered and concentrated under reduced pressure to provide the title compound (15%). MS m / z 630 (M + H) +.

Os seguintes compostos adicionais do presente invento podem ser preparados por um perito na especialidade utilizando metodologia de síntese conhecida ou empregando metodologia de síntese descrita nos Esguemas e Exemplos aqui contidos. Os compostos adicionais abarcados pelas Tabelas seguintes podem ser descritos tomando um núcleo da Tabela 1, um substituinte R1 da Tabela 2 (em gue Xi representa a Estrutura do Anel Nuclear), um ou dois substituintes Y3 da Tabela 4 e, guando necessário, um substituinte Yi e/ou Y2 da Tabela 3.The following additional compounds of the present invention may be prepared by a person skilled in the art using known synthesis methodology or employing synthetic methodology described in the Examples and Examples herein. The additional compounds encompassed by the following Tables can be described by taking a core from Table 1, a R1 substituent of Table 2 (where X1 represents the Nuclear Ring Structure), one or two substituents Y3 of Table 4 and, where necessary, a substituent Yi and / or Y2 from Table 3.

Nas Tabelas seguintes, os núcleos 1-25, 27, 29-45, 47, 48, 51, 52, 55-69 e 79-97 da Tabela 1 e os substituintes Y3 1-72 e 114-116 na Tabela 4 são comparativos.In the following Tables, nuclei 1-25, 27, 29-45, 47, 48, 51, 52, 55-69 and 79-97 of Table 1 and substituents Y3 1-72 and 114-116 in Table 4 are comparative .

Tabela 1: Exemplos de Estruturas de Anel Nuclear 0, p }s OH N'SV^Y'Y R1 vT v h3c ο,,ο OH N'SXv'Y3 oX»17 S&quot;%^0 owo f JL CH3 ÇH j Yy 5α.νλ0 R1 1 2 3 4 owo f* OH «W R1 qvo f S i v3 OH N|Y SCXX H N&quot;X) qvo OH N'*Y^V'V3 n^n^o R1 o,,o OH N'SY^Y&quot;Y cúY R1 5 6 7 8 O O f OH N *VV R1 VX v* OH N'SY^V&quot; σχΧ R1 o,,p r* , OH N'SfYY OlnX0h R1 VX V3 ?H γυΥ ^yVV^ LI 1 h R1 9 10 11 12 429 ΕΡ 1 560 827/ΡΤ °„ Ν^Υ’’ αττ^ R1 q, „o r! OH N'W Λ. JL 1 h N N^O R1 0W0 Y1 OH Ν'δγΝγ·γ3 R1 V Y3 1 riyy υΎ«ι^η N&gt; ΑΑ·νΛ0 R1 13 14 15 16 νΧ^· HS' o, ,p f a Y* OH Ν^Υγ'1 Ò-R&lt; vX y3 OH N'SyVY Xtór H^.r1 oh &quot;tjcYa^ V 17 18 19 20 ^ VjT ν3 tLXTXJ R1 0,0 f 0H XrV h3CyA,ANAí?J hA-V H1 n o, ,o y3 ΤλΧΧΧ&quot;3 h^cXAd H ft1 V, OH N^Wva oYr’ ^ΐΆΐΆο R1 21 22 23 24 vV Y1 OH N V\ R1 H vrYÍ XJTO γγγ-Ν-s SrV^O ή1 v V Y1 OH hM Ar R1 °.3·ρ rv‘ H XJÍjò3 Yíl H 8 R1 25 26 27 28 v vjn^ H ή’ o. » V K εΧΙΙλ ÕlXh N^O R&gt; °^?ΓΎ οξί$ R1 ΟΛ r OH Ν'ΧΑγ·ν N^kN'S&gt; 29 30 31 32 r v n OH N'SY^Y \A L· H F)1 T V fi Y1 OH Ν'^γ^γ TViT H R’ f vn AXJJ rXiT \λν\ R1 / Vlb OH N'YV r’ 33 34 35 36 Vjrf« ,xÚJ tílH Vo *όΐ&gt;® A1 r v?&gt; onXX XX R1 r XIXI OiTa R1 37 38 39 40 430 ΕΡ 1 560 827/ΡΤ τ VJc° / η °;ΛΡο HN-R, 73 VJO* HNL «1 ^-R, 41 42 43 44 v V VyYi 8 ^^Ν Ο ΗΝ. Η1 y&gt; rYÍ ί ίΜ ι Ο uQJa HN.R, q, o f y1 oh n'^Y^V&quot;y ΎΧ^η HN.h1 °, jo r ., 'c* i y3 OH N'SV^Y B L H N&quot;X) ή· 45 46 47 48 Ο °=Í-RI 0 Ο ^-νη Υ' ΟΗ Ν' |ΓΛ ν1ΤΧΧ^'Η® ΗΝ^ 1' 0 °$-Λ' γτ“Η ViVir3 ηΛό o._,p HtX À νϋγ^'ΧΧ^Χ’ ηνό 49 50 51 52 V ΗΝ^ 1 Δ 0 Ο^Ι-ΝΗΗ1 0 η y--NH χ mró ΗΝ&quot;0 HfL À Α{ί?^τχ*' hS3 53 54 55 56 &lt;U&gt; Η , oh n^Vvn;ãr JU ° 0 η3ο-^κΤ*ο Η η77ο H rnL A 97br&quot;K ] í H h3c^n^ mno P oh ^γν^Β1 Xvp^00 HNL· À 57 58 59 60 v V jO^ Τ° iRl 7 hK.h, }f rírxí0 σχ* ^ hA.r1 B«4L/ 0, .0 &quot;V 61 62 63 64 ν !7t αΧ·0^ &quot;*Χ3 cfR' ^λΌμΡ° αΧ«^ ηνό Ά' HN \jP ^hn^o OH N'^K^nh'4d ο#Ρ* ηνό R1 %P HN--4 o5Jo&gt;· 65 6 6 67 68 431 ΕΡ 1 560 827/ΡΤ V V* OCXfiU 4 HV A X7* X5?r hiír, V/1&quot; M 1X X*N X3 ^ hS.R, 69 70 71 72 O^N-V1 , „xc&quot;S- R'HN *0 p ^'ΝΝχί0 vtnh · &lt;# hno 73 74 75 76 ο#-* ηΛό Vr*&quot; T OH N' jP^sl R1 0¾^ hnO oÍ h V&gt; X V&gt; r-^’0 &gt;# ή1 77 78 79 80 R1 v rm 0# y^tjno νΛΛΗ A v^r· :#* 81 82 83 84 °·&gt;νη-Ρ ν rNH rí OH N*âV-\ ttr Δ 0'iÈNH·/ V/&quot; I v^r/jO fi ΐττ^ Y'&quot;V^0 «XJiW W* Λ#&quot;' VS&gt; A 85 86 87 88 κ «W- π' XiX» νΛ γ3 oh rvV yS&lt;Xiít i I 1 H Υ'^Ν'Χ) ή1 Yr#^1 89 90 91 92 °*ρ γ3 0 ΟΗ νΎΥ *ύύτ^ &gt;Α&gt;Η λ * ^T?xy3 ΓΠ0 γ ^Ijl^O À CLP OH N'SV^VV3 -v ^ Ύ 93 94 95 96 432 ΕΡ 1 560 827/ΡΤ &quot;^7 97 98 99 100Table 1: Examples of Nuclear Ring Structures 0, p = 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, Yy 5α.νλ0 R 1 1 2 3 4 oo R 1 R 2 R 2 R 2 R 2 R 3 or OH N'SY ^ Y &quot; Y &lt; RTI ID = 0.0 &gt; &lt; / RTI &gt; σχΧ R1 o ,, pr *, OH N'SfYY OlnX0h R1 VX V3? H γυΥ ^ yVV ^ LI 1 h R1 9 10 11 12 429 ΕΡ 1 560 827 / ΡΤ ° "Ν ^ Υ" αττ ^ R1 " or! OH N'W Λ. JL 1 h N N ^ O R1 0W0 Y1 OH Ν'δγΝγ · γ3 R1 V Y3 1 riyy υΎ «ι ^ η N &gt; ΑΑ · νΛ0 R1 13 14 15 16 νΧ ^ · HS 'o,, p f a Y * OH Ν ^ Υγ'1 Ò-R < vX y3 OH N'SyVY Xtór H ^ .r1 oh &quot; tjcYa ^ V 17 18 19 20 ^ VjT ν3 tLXTXJ R1 0,0 f 0H XrV h3CyA, ANAí? h hA-V H1 no,, y3 ΤλΧΧΧ &quot; 3 h r r r r r 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 r r r r 1 H-NMR (DMSO-d 6):? V K εΧΙΙλ lXh N ^ O R &gt; RΟΛ OH OH OH · · OH OH OH OH OH R1 R1 R1 R1 R1 R1 R1 R1 R1 ΝΧΑ · · R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 R1 29 30 31 32 rvn OH N'SY ^ Y \ AL · HF) 1 TV fi Y1 OH Ν '^ γ ^ γ TViT H R' f vn AXJJ rXiT \ λν \ R1 / Vlb OH N'YV r '33 34 35 In the following examples, the term &quot; onXX XX R1 RXI OiTa R1 37 38 39 40 430 ΕΡ 1 560 827 / ΡΤ τ VJc ° / η °; ΛΡο HN-R, 73 VJO * HNL «1 ^ -R, 41 42 43 44 v V VyYi 8 ^^ (I.e. Η1 and &gt; X, Y, X, Y, X, Y, X, Y, X, Y, X, Y, X, η · 45 46 47 48 Ο ° = Ο Ο Ο Ο τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ τ Ϋ Ο ΧΧ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ &lt; U &gt; Η Η r 77 Β Β Β Β Β Β Β ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν ν Β Β V ^ Τ Τ Τ Τ Τ Τ Τ Τ Τ Τ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ (1) (1) (1) (1) (2) (1) (2) (1) VV * OCXfiU 4 HV A X7 * X5? R hiír, V / 1 &quot; M 1X X * N X 3 ^ hS.R, 69 70 71 72 O ^ N-V1, "xc" S- R'HN * 0 p ^ 'ΝΝχί0 vtnh · <hno 73 74 75 76 ο # - * ηΛό Vr * &quot; -CH 2 -CH 2 -CH 2 -CH 2 -CH X V &gt; (1): ## STR1 ## ## STR8 ## ## STR8 ## ## STR8 ## ## STR8 ## ## STR8 ## ## STR8 ## ## STR8 ## ttr Δ0'iÈNH · / V / &quot; (1) and (2) and (3) and (4) VS &gt; A 85 86 87 88 κ «W-π» XiX »νΛ γ3 oh rvV yS <Xið i I 1 H Υ '^ Ν'Χ) ή1 Yr # ^ 1 89 90 91 92 ° * ρ γ3 0 ΟΗ νΎΥ * ύύτ ^ Α Α * * * * ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ ΓΠ Ύ Ύ Ύ Ύ Ύ Ύ Ύ Ύ Ύ Ύ Ύ Ύ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ ΡΤ

Tabela 2: Exemplos de Substituintes R1Table 2: Examples of Substituents R1

Xi-H X!-CH3 1 2 3 4 Ls. / O r 5 6 7 8 Λ X, X 4· 9 10 11 12 V Ux V Lk 13 14 15 16 ΐΤ X-. Sr V- 17 18 19 20 &quot;ο V V U 21 22 23 24 25 26 27 28 w Ό u tf 29 30 31 32 i 1 6 6 33 34 35 36 433 ΕΡ 1 560 827/ΡΤ 37 38 39 40 £ ά Ô Ò 41 42 43 44 'ο ¾ *0 45 46 47 48 Χ,χ&gt; *.&gt;0* Χ’ΥΛ U'Y, *1^ Χ^Ν-Υ, 49 50 51 52 ΐ' W f1 r» &quot;ϋ 53 54 55 56 V· f Χ'Ό 57 58 59 60 Χ,Ό V Vn-y, °1 61 62 63 64 X-ι Υ, ΐ1 ΥΤ V ϊ' V) Νγΐ1 Υι 65 66 67 68 *1 ϊ1 Ns^ ί1 Vf Vx ΝνΑΥι ϊ; η Υι 69 70 71 72 Ιλ 1J Ν Í1 Sor Ν V. ,S? 434 ΕΡ 1 560 827/ΡΤX 1 -H X 1 -CH 3 1 2 3 4 Ls. / O r 5 6 7 8 Λ X, X 4 · 9 10 11 12 V Ux V Lk 13 14 15 16 ΐΤ X-. Sr V- 17 18 19 20 &quot; VVU 21 22 23 24 25 26 27 28 w Ό u tf 29 30 31 32 i 1 6 6 33 34 35 36 433 ΕΡ 1 560 827 / ΡΤ 37 38 39 40 Ò Ò 41 42 43 44 'ο ¾ * 0 45 46 47 48 Χ, χ> 49 50 51 52 ΐ ΐ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ , Ό V Vn-y, ° 1 61 62 63 64 X-ι Υ, ΐ1 ΥΤ V ϊ 'V) Νγΐ1 Υι 65 66 67 68 * 1 ϊ1 Ns ^ 11 Vf Vx ΝνΑΥι ϊ; η Υι 69 70 71 72 Ιλ 1J Ν Í1 Sor Ν V., S? 434 ΕΡ 1 560 827 / ΡΤ

435 ΕΡ 1 560 827/ΡΤ ν&gt;· Υ ¥Λν γ’ ν* ϊ1 Τ Ν Υ1 ΐ’ &gt;&gt; Υ2 Υη 113 114 115 116 Χ) Χΐνγ^ίτ^'Υ1 υ &quot;U, Χ,τ^) γ1 117 118 119 120 χ&quot;Λ Χΐγ^γ-Υ1 χ,%ο ν^ΛΥι Χ,Ό γι 121 122 123 124 X Ν XX Ν Χ,χχ Ν Υ, ΧΟ Υ^Ν 125 126 127 128 X V Χ,γ^ ν'νΑυ, ΧιγγΥι Υ,Λ'Ν 129 130 131 132 ζ ji Ν ΧιΥ^Ν \χ, ϊ2 XlVkN kAy Ν Υι Χΐνγ^Ν Υ, ν^υ2 133 134 135 136 X1V&quot;\ 5λ Χ’^ XQ Χ,Ό&gt; Υ1 γι γι γι 137 138 139 140 xVVv, S-J χ,ί5 X,t&gt;-Y’ χ&quot;ά 141 142 143 144 κ Χχγ’ Χ,Ύ&gt; Μ Ή Υ1 Υ1 Υ1 145 146 147 148 Χΐν^Ν Ti-Yi ΧινΑ Υ ΧΎ XiyVYi LrYl γι S-J 149 150 151 152 436 ΕΡ 1 560 827/ΡΤ °d: Xf x,^o XVN· χ-γ2 Yi Yi Yi Yi 153 154 155 156 γ* Λ ΪΗ Y2 x,y&gt; Y/H 2 Yi Y2 XN Yi 157 158 159 160 Yz Y, χ,Ί&gt;-ν, Y2 x,y r n y2x X,T&gt; A, 161 162 163 164 y{ X&quot;0 A χ1ν^Ν. T M o^: Yi Xi^N, T ,N Y2 Y1 165 166 167 168435 ΕΡ 1 560 827 / ΡΤ ν> · Υ ¥ Λν γ 'ν * ϊ1 Τ Ν Υ1 ΐ' &gt; &gt; Υ2 Υη 113 114 115 116 Χ) Χΐνγ ^ ίτ ^ 'Υ1 υ &quot; U, Χ, τ ^) γ1 117 118 119 120 χ 123 124 X Ν XX Ν Χ, χχ Ν Υ, ΧΟ Υ ^ Ν 125 126 127 128 XV Χ, γ ^ ν'νΑυ, ΧιγγΥι Υ, Λ'Ν 129 130 131 132 ζ ji Ν ΧιΥ ^ Ν \ χ, ϊ2 XlVkN kAy Ν Υι Χΐνγ ^ Ν Υ, ν ^ υ2 133 134 135 136 X1V &quot; 5λ Χ '^ XQ Χ, Ό &gt; Υ1 γι γι γι 137 138 139 140 xVVv, S-J χ, ί5 X, t> -Y 'χ 141 142 143 144 κ Χχγ' Χ, Ύ &gt; Μ Ή Υ1 Υ1 Υ1 145 146 147 148 Χΐν ^ Ν Ti-Yi ΧινΑ Υ ΧΎ XiyVYi LrYl γι SJ 149 150 151 152 436 ΕΡ 1 560 827 / ΡΤ ° d: Xf x, ^ o XVN · χ-γ2 Yi Yi Yi Yi 153 154 155 156 γ * Λ ΪΗ Y2 x, y> Y / H 2 Yi Y2 XN Yi 157 158 159 160 Yz Y, χ, Ί> -ν, Y2 x, y r n y2x X, T> A, 161 162 163 164 and {X &quot; 0 A χ1ν ^ Ν. T M o ^: Yi Xi ^ N, T, N Y2 Y1 165 166 167 168

Tabela 3: Substituintes de Yi e Y2 H ch3 -CH2CH3 -CH(CH3)2 -F -Cl -Br no2 -CN -OCH3 -NHCH3 -n(ch3)2 -nh2 OH -C (0)nh2 -NC(0)NH2 Y2 H ch3 -ch2ch3 -ch(ch3)2 -COCH3 -co2ch3 co2ch3 -NC(0)NH2 -nh2 -OH -C(0)NH2Table 3: Substituents of Y1 and Y2 H CH3 -CH2 CH3 -CH (CH3) 2 -F -Cl -Br-2 -NC -OCH3 -NHCH3 -n (ch3) 2 -nh2 OH -C (O) NH2 -NC (O ) NH2 Y2 H ch3 -ch2ch3 -ch (ch3) 2 -COCH3 -co2ch3 co2ch3 -NC (O) NH2 -nh2 -OH -C (O) NH2

Tabela 4: Exemplos de Y3 x2-h X1-CH3 χ2-οη X!-NH2 1 X1-NH V nh2 2 X1-0 V nh2 3 Xf-NH V ^.NH 4 x,-o v ^NH 5 6 7 8 Χ,-ΝΗ - b» XrO b* X|-NH Vo OH XrO y OH 9 10 11 12 Xi-Cl x2-f Xi-NHCHa Xi-OCHa 437 ΕΡ 1 560 827/ΡΤTable 4: Examples of Y3 x2 -h X1-CH3 χ2-οη X1 -NH2 1 X1 -NH2 2 X1 -N V2 NH3 Χ X-O-X-O-X-O-X-OCHa 437 ΕΡ 1 560 827 / Χ

Xi-H K 0 1 K 0 1 X!-NH2 13 14 15 16 Ϋ1 νη2 ?1 ?H HN-^J *1 HNv^. -1 I HN-xY\ 17 18 19 20 Χ1 νη2 * *1 °N^. tx 21 22 23 24 XrNH f-Λ 0 XrflH W D Χ,-NH f^NH O τα&quot; 0 25 26 27 28 νη2 ΧΓΝΗ Α 0 nh2 Χ,-ΝΗ ρΛ Y^ 0 T XrNH ρΛ w 0 PH 0 29 30 31 32 NHg XrNH i^S W 0 NH2 XrNH fN YJ 0 OH xrNH YJ o OH XrNH |&quot;S YJ 0 33 34 35 36 *V&gt; 0 vvo O XrO r^NH w o *\cr o 37 38 39 40 nh2 Xll ^ YJ n nh2 ‘V&gt; O OH Χι-o A Ά 0 OH v* 0 41 42 43 44 Vi í&gt;° 1 .--X X,'NH fO YH · Q X,-NH |Ύ SrNH o X.-NH (Ό SrNH Q 45 46 47 48 YH 0 *&quot;0 A YH 0 SrNH 0 M/O YH 0 49 50 51 52 438 ΕΡ 1 560 827/ΡΤ Χ,-Η Xi-CHa Χ,-ΟΗ Χ!-ΝΗ2 Χ,-ΝΗ ( V ο Χ,-0 ( VNH 0 X·)—ΝΗ ΗΝ^ . Sr* ο Χ,-0 ΗΝ^ V* ο 53 54 55 56 Χ,-ΝΗ ο^νη2 χΊ-0 ο^νη2 Χ,-ΝΗ ΝΗ2 V&quot; Ο Χν-0 νη2 SrNH 0 57 58 59 60 Χ,-ΝΗ cAa&quot; Χι~ΝΗ (Αν&quot;&quot; Η Χ,-ΝΗ cAo^ Χ,-ΝΗ (Αν^ Η 61 62 63 64 χ,-ο °Ύ f1 VS Υι * Γΐ o2s,nA Η *ι θ2^^0 65 6 6 67 68 *1 VS ν^ΑΥι *1 Νγ&gt; Υι * hVnn Η Υι Í1 ΗΝΥΑ Υι 69 70 71 72 ?1 ΗΝ CH3 °*'θ Χι ΗΝ o'&quot;b *· Λ ·1 I ΗΝ Α o/xb 72 73 74 75 ϊι Λ ΗΝ ,Α Λ ΓΊ ΗΝ, λ/ Λ *1 Γ&gt; ΗΝ Α/ Λ * ΓΊ ΗΝ.ΑΑ Λ 76 77 78 79 Γθ ?ι ΗΝν Λ Α 04% -1 fT ΗΝ. Λ 80 81 82 83 À*0 Λ η ϋι rO hn;sAn ο&quot;\ Η Ο γ, r-N »Ά/ Λ *· Ή ΗΝ ΑΑ Λ 84 85 86 87 439 ΕΡ 1 560 827/ΡΤXI-H K 0 1 K 0 1 X 1 -NH 2 13 14 15 16 Ϋ 1 νη 2? 1? H HN? -1 I HN-xY \ 17 18 19 20 Χ1 νη2 * * 1 ° N ^. tx 21 22 23 24 XrNH f-Λ 0 XrflH W D Χ, -NH f ^ NH O τα &quot; 0 25 26 27 28 νη2 ΧΓΝΗ Α 0 nh2 Χ, -ΝΗ ρΛ Y ^ 0 T XrNH ρΛ w 0 PH 0 29 30 31 32 NHg XrNH i ^ SW 0 NH2 XrNH fN YJ 0 OH xrNH YJ o OH XrNH | & S YJ 0 33 34 35 36 * V &gt; The invention relates to a process for the preparation of a compound of formula (I): wherein X, Â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ â € ‡ YH 0 49 50 51 52 438 ΕΡ 1 560 827 / ΡΤ Χ, -Η Xi-CHa Χ, -ΟΗ Χ! -ΝΗ2 Χ, -ΝΗ (V ο Χ, -0 (VNH 0 X ·) - ΝΗ ΗΝ ΗΝ Sr Sr Sr Sr Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ 53 ΝΗ ΝΗ ΝΗ ΝΗ ΝΗ ΝΗ ΝΗ ΝΗ ΝΗ ΝΗ ΝΗ ΝΗ Ο Χν-0 νη2 SrNH 0 57 58 59 60 Χ, -ΝΗ cAa &quot; Χι ~ ΝΗ (Αν &quot; Η Χ, -ΝΗ cAo ^ Χ, -ΝΗ (Αν Η 61 62 63 64 χ, -o Ύ f1 VS Υι * Γΐ o2s, nA Η * ι θ2 ^^ 0 65 6 6 67 68 * 1 VS ν ^ ΑΥι * 1 Νγ> Υι * Χ Χ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ Χ 77 78 79 Γθ? Ι ΗΝν Λ Α 04% -1 fT ΗΝ. Λ 80 81 82 83 Λ Λ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ,,,,,,,,,,, 85 86 87 439 ΕΡ 1 560 827 / Τ

Xi-H Xí-cil Xi-OH Χ!-ΝΗ2 O *írv-/N HVv «Λ H ?1 O HN. A íi ΓΊ*Η HN._yN^ A ?i r\ HN. A 88 89 90 91 f H HN ,Νχ A ?1 H A * H A ?i- 1 HN. yN. A 92 93 94 95 ?' d A * H g hV^nh2 HN 0^ *1 Η Π Λ 96 97 98 100 * hnVq.nh2 A *1 Λ HNv_yN-^ d\ ίι Γη HN„ yNW Λ Χ1 Γγ0Η HN Ν J A 101 102 103 104 X, Γύ^νη2 hn. A Λ HN N-AwHj A s Λ ην!„,νΟ~ΝΗϊ A 105 106 107 108 *1 H A ¥ õá χι rv0H ΗΝ._Ν^ A *1 Η HN. yN^y^\ Λ υ&quot; 109 110 111 112 Ϊ1 r\J) HN A NHz 0 1 Xi NHz XwNHj, Λ I XwNH 0¾ 113 114 115 116Xi-H Xi-Xi-OH. Amino Amino Acid. A 88 89 90 91 H HN, Νχ A? 1 H A * H A? yN. A 92 93 94 95 ' d A * H g hV ^ nh2 HN 0 ^ * 1 Η Π Λ 96 97 98 100 * hnVq.nh2 A * 1 Λ HNv_yN- ^ d \ ίι Γη HN "yNW Λ Χ1 Γγ0Η HN Ν JA 101 102 103 104 X, Γύ ^ νη2 hn. A Λ HN N-AwHj A s Λ ην! ", ΝΟ ~ ΝΗϊ A 105 106 107 108 * 1 H A á á ι ι ι v ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ ΗΝ Η Η Η Η HN. yN ^ y ^ \ Λ υ &quot; 109 110 111 112 Ϊ1 r \ J) HN A NHz 0 1 Xi NHz XwNHj, Λ I XwNH 0¾ 113 114 115 116

Será evidente para o perito na especialidade que o presente invento não está limitado aos anteriores Exemplos ilustrativos e que pode ser concretizado noutras formas especificas sem afastamento dos seus atributos essenciais. É portanto desejável que os Exemplos sejam considerados em todos os aspectos como ilustrativos e não restritivos, sendo feita referência às reivindicações anexas e não aos anteriores Exemplos.It will be apparent to the person skilled in the art that the present invention is not limited to the foregoing illustrative Examples and that it may be embodied in other specific forms without departing from its essential attributes. It is therefore desirable that the Examples be considered in all respects as illustrative and not restrictive, with reference to the appended claims and not to the foregoing Examples.

Lisboa, 2011-03-10Lisbon, 2011-03-10

Claims (35)

ΕΡ 1 560 827/ΡΤ 1/23 REIVINDICAÇÕES 1. Composto ou uma sua forma de sal, estereoisómero ou tautómero farmaceuticamente aceitável, em que: o composto corresponde em estrutura à fórmula (Vb):A compound or a pharmaceutically acceptable salt, stereoisomer or tautomer form thereof, wherein: the compound corresponds in structure to formula (Vb): wherein R 1, R 2, R 3, R1 é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alquilcarbonilalquilo, alquilsulfanilalquilo, alquilsulfinilalquilo, alquilsulfonilalquilo, alcinilo, arilo, arilalcenilo, arilalquilo, arilsulfanilalquilo, arilsulfonilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, (cicloalquil)alcenilo, (cicloalquil)alquilo, formilalquilo, haloalcoxialquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heteroarilsulfonilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, nitroalquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, RaRbNC (0) 0-alquil-, RaRbNC (0)NRc-alquil-, RfRgC=N- e Rk0-, em que R1 é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (ORc), -(alquil) (NRcRe), -SRC, - (O) Rc, -S(0)2Rc, -ORc, -N(Rc)(Re), -C(0)Rc, -C(0)0Rc e -C(O)NRcRe; R4 é seleccionado do grupo que consiste em alcoxi, arilalcoxi, ariloxi, halo, hidroxi, RaRbN-, N3- e ReS-, em que R4 é substituído com 0, 1 ou 2 substituintes independentemente seleccionados do grupo que consiste em halo, nitro, ciano, -OH, -NH2 e -COOH; ΕΡ 1 560 827/ΡΤ 2/23 R5 é seleccionado do grupo que consiste em RaS02N(Rf)-, RaS02N (Rf) alquil-, RaRbNS02N (Rf) - e RaRbS02N (Rf) alquil-; R6 é independentemente seleccionado em cada ocorrência do grupo que consiste em alquilo, alcenilo, alcinilo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, heterocicloalquilo, -(alquil) (ORk), -(alquil) (NRaRb), -SRa, -S(0)Ra, -S (O) 2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)0Ra e -C(O)NRaRb; em que cada R6 é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, haloalquilo, ciano, nitro, -ORa, -NRaRb, -SRa, - SORa, -S02Ra, -C(0)0Ra, -C (O) NRaRb e -NC(0)Ra; Ra e Rb, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alcenilo, alquilo, alquilsulfanilalquilo, arilo, arilalcenilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, cicloalquilalcenilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilcarbonilo, nitroalquilo, RcRdN-, RcRdN-alquil-, RcRdNC (O) alquil-, RcS02-, RS02-alquil-, RcC(O)-, RcC(0)alquil-, Rc0C(0)-, RcOC(O)alquil-, RcRdN-alquilC (0)-, RcRdNC(0)-, RcRdNC (O) O-alquil- e RcRdNC (O) N (Re) alquil-, em que Ra e Rb são substituídos com 0, 1 ou 2 substituintes seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc) , - (alquil) (NRcRd) , -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C (O) Rc, -C (O) ORc e -C(0)NRcRd; alternativamente, Ra e Rb, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, ΕΡ 1 560 827/ΡΤ 3/23 arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc), - (alquil) (NRcRd), -alquilS02NRcRd, -alquilC (O) NRcRd, -SRC, - S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C (O) ORc e -C(0)NRcRd; Rc e Rd, em cada ocorrência, são independentemente seleccionados do qrupo que consiste em hidrogénio, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -S02Rf, -C(0)NRfRh, -S02NRfRh, -C(0)0Rf, alcenilo, alquilo, alcinilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, arilo, arilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo e heterocicloalquilo; em que cada Rc e Rd é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf) , - (alquil) (NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C (O) Rf, -C (0) ORf, -C(0)NRfRh, -C (O) N (H) NRfRh, -N (Re) C (O) ORf, -N (Re) S02NRfRh, -N (Re) C (O)NRfRh, -alquilN (Re) C (0) ORf, -alquilN (Re) S02NRfRh e -alquilN (Re) C (0)NRfRh; alternativamente, Rc e Rd, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf) , - (alquil) (NRfRh) , -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N (Rf) (Rh) , -C (O) Rf, -C (O) ORf e -C(0)NRfRh; Re é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo e cicloalquilo; Rf, Rg e Rh, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alquilo, alcenilo, arilo, arilalquilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, heterociclo, heterocicloalquilo, heteroarilo e ΕΡ 1 560 827/ΡΤ 4/23 heteroarilalquilo; em que cada Rf/ Rg e Rh é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do qrupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquil), -NH2, -N(H)(alquil), -N(alquil)2, -S(alquil), -S(O)(alquil), -S02-alquilo, -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquil), -alquil-N(alquil)2, -alquil-S(alquil), -alquil-S(O) (alquil), -alquil-S02-alquilo, -N(H)C(O)NH2, -C(0)0H, -C(O)O(alquil), -C(O)alquilo, -C(0)NH2, -C(0)NH2, -C(O)N(H)(alquil) e -C(O)N(alquil)2; alternativamente, Rf e Rg, juntamente com o átomo de carbono ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em cicloalquilo, cicloalcenilo e heterociclo; alternativamente, Rf e Rh, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em heterociclo e heteroarilo; em que cada um de heterociclo e heteroarilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquil), -NH2, -N(H)(alquil), -N(alquil)2, -S(alquil), -S(alquil), -S(O)(alquil), -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquil), -alquil-S(alquil), -alquil-S(O)(alquil), -alquil-S02-alquilo, -alquil-N(alquil)2, -N(H)C(O)NH2, -C(0)0H, -C(O)O(alquil), -C(O)alquilo, -C(0)NH2, -C(0)NH2, -C(O)N(H)(alquil) e -C(O)N(alquil)2; Rk é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo, arilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo, heterocicloalquilo, nitroalquilo, RaRbN-alquil-, RaO-alquil-, RaRbNC(0)-, RaRbNC (O) alquilo, RaS-, RaS(0)-, RaS02-, ReS-alquil-, Ra (O)S—alquil—, RaS02-alquil-, Ra0C(0)-, Ra0C(0)alquil-, RaC(0)- ΕΡ 1 560 827/ΡΤ 5/23 e RaC(Ο)alquil-, em que cada Rk é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (ORc), -(alquil) (NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)0Rc e -C (0) NRcRd; e méO, 1, 2, 3 ou 4.R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkylcarbonylalkyl, alkylsulfinylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkyl, alkenyl, (cycloalkyl) alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocyclo, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN- alkyl-, RaRbNC (O) alkyl-, RaRbNC ) Wherein R 1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, C 1 -C 4 -alkyl, C 1 -C 4 -alkyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalk (O) Rc, -S (O) 2 R c, -OR c, -N (R c) (Re), -C (O) ) R c, -C (O) O R c and -C (O) NR c R e; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3- and ReS-, wherein R4 is substituted with 0,1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 and -COOH; (Rf) -, RaS02N (Rf) alkyl-, RaRbNSO2N (Rf) - and RaRbS02N (Rf) alkyl-; R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocycloalkyl, - (alkyl) (OR k), - alkyl (NRaRb), -SRa, -S (O) Ra, -S (O) 2Ra, -ORk, -N (Ra) (Rb), -C (O) Ra, -C (O) C (O) NR a R b; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NR a R b, -SR a, -SOR a , -SO 2 R a, -C (O) O R a, -C (O) NR a R b and -N C (O) Ra; Ra and Rb at each occurrence are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RcRdN- alkyl-, RcRdNC (O) alkyl-, RcSO2-, RSO2- alkyl-, RcC (O) -, RcC (O) alkyl-, RcO ( 0) -, RcOC (O) alkyl-, RcRdN-C (O) -, RcRdNC (O) -, RcRdNC (O) O-alkyl- and RcRdNC (O) N (Re) are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) ORc), - (alkyl) (NR c R d), -SRC, -S (O) R c, -S (O) 2 R c, -OR c, -N (Rc) (Rd), -C (O) Rc, -C (O) ORc and -C (O) NR c R d; alternatively Ra and Rb, together with the nitrogen atom to which they are attached, form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NRcRd), -alkylS02NRcRd, -C (O) NRcRd, -SRC, -S (O) Rc, -S (O) 2Rc, -ORc, -N ) (Rd), -C (O) Rc, -C (O) OR c and -C (O) NR c R d; R c and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRf R h, -OR f, -CO (R f), -SR f, -SOR f, -SO 2 R f, -C (O) NR f R h, -SO 2 NR f R h, - C (O) O R f, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocycloalkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl (Rf), -SRf, -S (O) Rf, -S (O) 2 Rf, -ORf, -N (R f) (Rh), - (C 1 -C 4) alkyl, C (O) Rf, -C (O) OR f, -C (O) NRf R h, -C (O) N (H) -N (Re) C (O) NRf R h, --N (R e) C (O) OR f, --N (R e) R e R (R e R); alternatively, Rc and Rd together with the nitrogen atom to which they are attached form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (OR f) (O) Rf, -S (O) 2 Rf, -ORf, -N (R f) (Rh), -C (O) R f, -C (O) OR f and -C (O) NR f R h; Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh at each occurrence are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl and ΕΡ 1 560 827 / ΡΤ 4 / 23 heteroarylalkyl; wherein each Rf and Rg and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle heteroaryl, heteroarylalkyl, -OH, -O (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (O) (alkyl), -S02 alkyl-OH, -alkyl-O-alkyl, -alkyl-NH 2, -alkyl-N (H) (alkyl), -alkyl-N (alkyl) 2, -alkyl-S (alkyl), - -S (O) (alkyl), -alkyl-SO2-alkyl, -N (H) C (O) NH2, -C (O) OH, -C (O) O (alkyl), -C (O) , -C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2; alternatively Rf and Rg, together with the carbon atom to which they are attached, form a three to seven membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively Rf and Rh, together with the nitrogen atom to which they are attached, form a three to seven membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle (alkyl), -N (alkyl), -N (alkyl), -N (alkyl), -S (alkyl), -S (alkyl), -S (O) (alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkyl-NH2, -alkyl-N (H) (alkyl), -alkyl-S (alkyl), -alkyl-S (O) (alkyl) alkyl, -N (alkyl) 2, -N (H) C (O) NH 2, -C (O) OH, -C (O) O (alkyl), -C (O) alkyl, -C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2; R1 is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycloalkyl, nitroalkyl, nitroalkyl, RaRbN-alkyl-, RaO- -, RaRbNC (O) -, RaRbNC (O) alkyl, RaS-, RaS (O) -, RaS02-, ReS-alkyl-, Ra (O) S- alkyl-, RaS02- alkyl-, Ra0C (O) - , Ra0C (O) -alkyl, RaC (O) - ΕΡ 1 560 827 / ΡΤ 5/23 and RaC (Ο) alkyl-, wherein each R k is substituted with 0, 1, 2 or 3 substituents independently selected from the group alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NR c R d), -SR , -S (O) R c, -S (O) 2 R c, -OR c, -N (R c) (Rd), -C (O) R c, -C (O) O R c and -C (O) NR c R d; and meO, 1, 2, 3 or 4. 2. Composto, sal, estereoisómero ou tautómero de acordo com a reivindicação 1, em que R4 é hidroxi.A compound, salt, stereoisomer or tautomer according to claim 1, wherein R 4 is hydroxy. 3. Composto, sal, estereoisómero ou tautómero de acordo com a reivindicação 2, em que R1 é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alcinilo, arilalcenilo, arilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalcenilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, RfRgC=N- e RkO-.A compound, salt, stereoisomer or tautomer according to claim 2, wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkenyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, RaRbN-, RaRbN- alkyl-, RaRbNC (O) alkyl-, RfRgC = N- and RkO-. 4. Composto ou uma sua forma de sal, estereoisómero ou tautómero farmaceuticamente aceitável, em que: o composto corresponde em estrutura à fórmula (Via):A compound or a pharmaceutically acceptable salt, stereoisomer or tautomer form thereof, wherein: the compound corresponds in structure to formula (Way): (Via); R é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alquilcarbonilalquilo, alquilsulfanilalquilo, alquilsulfinilalquilo, alquilsulfonilalquilo, alcinilo, arilo, arilalcenilo, arilalquilo, arilsulfanilalquilo, ΕΡ 1 560 827/ΡΤ 6/23 arilsulfonilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, (cicloalquil)alcenilo, (cicloalquil)alquilo, formilalquilo, haloalcoxialquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heteroarilsulfonilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, nitroalquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, RaRbNC (O) O-alquil-, RaRbNC (O)NRc-alquil-, RfRgC=N- e RkO-, em que R1 é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil)(ORc), -(alquil)(NRcRe), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Re), -C(0)Rc, -C(0)0Rc e -C(O) NRcRe; R4 é seleccionado do grupo que consiste em alcoxi, arilalcoxi, ariloxi, halo, hidroxi, RaRbN-, N3- e ReS-, em que R4 é substituído com 0, 1 ou 2 substituintes independentemente seleccionados do grupo que consiste em halo, nitro, ciano, -OH, -NH2 e -COOH; R5 é seleccionado do grupo que consiste em RaS02N(Rf)-, RaS02N(Rf) alquil-, RaRbNS02N (Rf) - e RaRbNS02N (Rf) alquil-; R é independentemente seleccionado em cada ocorrência do grupo que consiste em alquilo, alcenilo, alcinilo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, heterocicloalquilo, -(alquil)(ORk), -(alquil)(NRaRb), -SRa, -S (O) Ra, -S (O) 2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)0Ra e -C(0)NRaRb; em que cada R6 é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, haloalquilo, ciano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C (O) ORa, -C (O) NRaRb e -NC(0)Ra; Ra e Rb, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alcenilo, alquilo, alquilsulfanilalquilo, arilo, arilalcenilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, ΕΡ 1 560 827/PT 7/23 cicloalquilo, cicloalquilalquilo, cicloalquilalcenilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilcarbonilo, nitroalquilo, ReRdN-, ReRdN-alquil-, RcRdNC(O)alquil-, RcS02-, RcS02-alquil-, RcC(0)-, RcC(O)alquil-, Rc0C(0)-, RcOC(O)alquil-, RcRdN-alquilC (O) - , RcRdNC (O) - , RcRdNC (0) 0-alquil- e RcRdNC (0) N (Re) alquil-, em que Ra e Rb são substituídos com 0, 1 ou 2 substituintes seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (ORc), - (alquil) (NRcRd) , -SRC, -S(0)Ro, -S(0)2Ro, -0Ro, -N(Rc)(Rd), -C(0)Rc, -C(0)0Rc e -C(0)NRcRd; alternativamente, Ra e Rb, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc) , - (alquil) (NRcRd) , -alquil-S02NRcRd, -alquil-C (O) NRcRd, -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C (O) Rc, -C (O) ORc e -C (O) NRcRd; Rc e Rd, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, -NRfRh, -0Rf, -CO(Rf), -SRf, -SORf, -S02Rf, -C (O)NRfRh, -S02NRfRh, -C(0)0Rf, alcenilo, alquilo, alcinilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, arilo, arilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo e heterocicloalquilo; em que cada Rc e Rd é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (0Rf) , - (alquil) (NRfRh) , -SRf, -S(0)Rf, -S(0)2Rf, -0Rf, -N (Rf) (Rh) , -C (0) Rf, -C (0) ORf, -C(0)NRfRh, -C (0) N (H) NRfRh, ΕΡ 1 560 827/ΡΤ 8/23 -Ν (Re) C (0) ORf, -N(Re)S02NRfRh, -Ν (Re) C (Ο) NRfRh, -alquil-N (Re) C (O) ORf, -alquil-N (Re) S02NRfRh e -alquilN (Re) C (O) NRfRh; alternativamente, Rc e Rd, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf) , - (alquil) (NRfRh) , -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C (O) Rf, -C (O) ORf e -C(0)NRfRh; Re é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo e cicloalquilo; Rf, Rg e Rh, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alquilo, alcenilo, arilo, arilalquilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, heterociclo, heterocicloalquilo, heteroarilo e heteroarilalquilo; em que cada Rf, Rg e Rh é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquil), -NH2, -Ν(H)(alquil), -N(alquil)2, -S(alquil), -S(O)(alquil), -S02-alquilo, -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquil), -alquil-N(alquil)2, -alquil-S(alquil), -alquil-S(O)(alquil), -alquil-S02alquilo, -Ν(H)C(O)NH2, -C(O)OH, -C(O)O(alquil), -C(O)alquilo, -C(0)NH2, -C(0)NH2, -C(Ο)Ν(H)(alquil) e -C(O)N(alquil)2; alternativamente, Rf e Rg, juntamente com o átomo de carbono ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em cicloalquilo, cicloalcenilo e heterociclo; ΕΡ 1 560 827/ΡΤ 9/23 alternativamente, Rf e Rh, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em heterociclo e heteroarilo; em que cada um de heterociclo e heteroarilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquil), -NH2, -N(H)(alquil), -N(alquil)2, -S(alquil), -S(alquil), -S(O) (alquil), -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquil), -alquil-S(alquil), -alquil-S(O)(alquil), -alquil-S02alquilo, -alquil-N(alquil)2, -N(H)C(0)NH2, -C(0)0H, -C(0)O(alquil), -C(O)alquilo, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alquil) e -C(O)N(alquil)2; Rk é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo, arilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo, heterocicloalquilo, nitroalquilo, RaRbN-alquil-, RaO-alquil-, RaRbNC (O) - , RaRbNC(0) alquilo, RaS-, RaS(0)-, RaS02-, RaS-alquil-, Ra (0)S—alquil—, RaS02-alquil-, RaOC(0)-, RaOC(O)alquil-, RaC(0)-e RaC(0)alquil-, em que cada Rk é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil)(ORc), -(alquil)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)0Rc Θ -C (O) NRcRd; e méO, 1, 2, 3 ou 4; com a condição de que quando R4 é alcoxi, ariloxi, hidroxi ou ReS- e R5 é ReS02N (Rf) - e R6 é alquilo, alcenilo, alcinilo, halo, ciano, nitro, arilo, heteroarilo, heterocicloalquilo, -SRa, -S (O) Ra, -S (O) 2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa e -C(O)NRaRb, então R1 não é hidrogénio, alcenilo, alquilo, alcinilo, arilo, arilalcenilo, arilalquilo, cicloalquilo, (cicloalquil)alcenilo, (cicloalquil)alquilo, heteroarilo, ΕΡ 1 560 827/ΡΤ 10/23 heteroarilalcenilo, heteroarilalquilo, heterocicloalcenilo ou heterocicloalquilo.(Via); R2 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, , cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, (cycloalkyl) alkyl (cycloalkyl) alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN-alkyl-, RaRbNC (O) NRc-alkyl-, Rf RgC = N- and RkO-, wherein R 1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group which consists of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, he (Rc) (S), -S (O) Rc, -S (O) 2 R c, -OR c, -N (R c) (R e), - (C 1 -C 6) alkyl, C (O) R c, -C (O) O R c and -C (O) NR c R e; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3- and ReS-, wherein R4 is substituted with 0,1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 and -COOH; R5 is selected from the group consisting of RaS02N (Rf) -, RaS02N (Rf) alkyl-, RaRbNS02N (Rf) - and RaRbNS02N (Rf) alkyl-; R 2 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocycloalkyl, - (alkyl) (OR k), - alkyl (NRaRb), -SRa, -S (O) Ra, -S (O) 2Ra, -ORk, -N (Ra) (Rb), -C (O) Ra, -C (O) C (O) NR a R b; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NR a R b, -SR a, -SOR a , -SO 2 R a, -C (O) OR a, -C (O) NR a R b and -N C (O) Ra; Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl (O) alkyl-, RcSO2-, RcSO2-alkyl-, RcC (O) -, RcCO2-alkyl, RcSO2-, RcSO2-, RcS02-, RcC (O) -, RcRdNC (O) -, RcRdNC (O) O-alkyl- and RcRdNC (O) N (RcC (O) ) alkyl, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NR c R d), -SRC, -S (O) Ro, -S (O) 2 R10, -OR6, -N (Rc) (Rd), -C (O) Rc, -C (O) O Rc and -C (O) NR c R d; alternatively Ra and Rb, together with the nitrogen atom to which they are attached, form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc) (Rc) (Rc), -S (O) 2 Rc, -ORc, -N (Rc) (Rd), -S (O) NR c R d, -C (O) R c, -C (O) OR c and -C (O) NR c R d; R c and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORF, -CO (Rf), -SRf, -SORf, -SO2 Rf, -C (O) NRfRh, -S02 NRfRh, - C (O) O R f, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocycloalkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl (R f), -S (O) Rf, -S (O) 2 R f, -O R f, -N (R f) (Rh), - (C 1 -C 4) alkyl, -C (O) Rf, -C (O) OR f, -C (O) NRf R h, -C (O) N (H) NR f R h, ΕΡ 1 560 827 / R (R) R (R), -N (R) C (O) OR f, -R ) NRfRh; alternatively, Rc and Rd together with the nitrogen atom to which they are attached form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (OR f) (O) Rf, -S (O) 2 Rf, -ORf, -N (R f) (Rh), -C (O) R f, -C (O) OR f and -C (O) NR f R h; Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh at each occurrence are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle heteroaryl, heteroarylalkyl, -OH, -O (alkyl), -NH2, -H (alkyl), -N (alkyl) 2, -S (alkyl), -S (O) (alkyl), -S02 alkyl-OH, -alkyl-O-alkyl, -alkyl-NH 2, -alkyl-N (H) (alkyl), -alkyl-N (alkyl) 2, -alkyl-S (alkyl), - -S (O) (alkyl), -alkyl-SO2alkyl, -Ν (H) C (O) NH2, -C (O) OH, -C (O) O (alkyl), -C (O) alkyl, - C (O) NH2, -C (O) NH2, -C (Ο) Ν (H) (alkyl) and -C (O) N (alkyl) 2; alternatively Rf and Rg, together with the carbon atom to which they are attached, form a three to seven membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; Alternatively, Rf and Rh, together with the nitrogen atom to which they are attached, form a three to seven membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle (alkyl), -N (alkyl), -N (alkyl), -N (alkyl), -S (alkyl), -S (alkyl), -S (O) (alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkyl-NH2, -alkyl-N (H) (alkyl), -alkyl-S (alkyl), -alkyl-S (O) (alkyl) (O) alkyl, -N (alkyl) 2, -N (H) C (O) NH 2, -C (O) OH, -C (O) O (alkyl), -C (O) alkyl, -C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2; R1 is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycloalkyl, nitroalkyl, nitroalkyl, RaRbN-alkyl-, RaO- (O) -, RaRbNC (O) -, RaRbNC (O) alkyl, RaS-, RaS (O) -, RaS02 -, RaS-alkyl-, Ra (O) S- alkyl-, RaS02- alkyl-, RaOC (O) - , RaOC (O) alkyl-, RaC (O) -and RaC (O) alkyl-, wherein each R k is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NR c R d), -SRC, -S (O) R c, - S (O) 2 R c, -OR c, -N (R c) (Rd), -C (O) R c, -C (O) O R c -C (O) NR c R d; and m is 1, 2, 3 or 4; with the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS- and R5 is ReS02N (Rf) - and R6 is alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa, -S (O) Ra, -S (O) 2Ra, -ORk, -N (Ra) (Rb), -C (O) Ra, -C (O) ORa and -C (O) NR a R b, then R 1 is not hydrogen alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, heteroaryl, or heteroarylalkenyl, heteroarylalkyl, heterocycloalkenyl or heterocycloalkyl. 5. Composto, sal, estereoisómero ou tautómero de acordo com a reivindicação 4, em que R4 é hidroxi.A compound, salt, stereoisomer or tautomer according to claim 4, wherein R 4 is hydroxy. 6. Composto, sal, estereoisómero ou tautómero de acordo com a reivindicação 5, em que R1 é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alcinilo, arilalcenilo, arilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilalquilo, heteroarilalcenilo, heterocicloalcenilo, RaRbN-, RaRbN-alquil-, cicloalquilo, cicloalquilalcenilo, formilalquilo, haloalquilo, heteroarilalquilo, heterociclo, heterocicloalquilo, hidroxialquilo, RaRbNC (O) alquil-, RfRgC=N- e RkO-.A compound, salt, stereoisomer or tautomer according to claim 5, wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, heteroarylalkenyl, heterocycloalkenyl, RaRbN-, RaRbN- alkyl-, cycloalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroarylalkyl, heterocycloalkyl, hydroxyalkyl, RaRbNC (O) alkyl-, RfRgC = N- and RkO-. 7. Composto ou uma sua forma de sal, estereoisómero ou tautómero farmaceuticamente aceitável, em que: o composto corresponde em estrutura à fórmula (VIb):A compound or a pharmaceutically acceptable salt, stereoisomer or tautomer form thereof, wherein: the compound corresponds in structure to formula (VIb): R1 é seleccionado do grupo que consiste em hidrogénio alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo alquilcarbonilalquilo, alquilsulfanilalquilo alquilsulfinilalquilo, alquilsulfonilalquilo, alcinilo, arilo arilalcenilo, arilalquilo, arilsulfanilalquilo arilsulfonilalquilo, carboxialquilo, cianoalquilo cicloalcenilo, cicloalcenilalquilo, cicloalquilo (cicloalquil)alcenilo, (cicloalquil)alquilo, formilalquilo haloalcoxialquilo, haloalquilo, heteroarilo heteroarilalcenilo, heteroarilalquilo heteroarilsulfonilalquilo, heterociclo, heterocicloalcenilo heterocicloalquilo, hidroxialquilo, nitroalquilo, RaRbN-RaRbN-alquil-, RaRbNC (0) alquil-, RaRbNC (0) 0-alquil- ΕΡ 1 560 827/ΡΤ 11/23 RaRbNC (Ο)NRc-alquil-, RfRgC=N- e RkO-, em que R1 é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (ORc), -(alquil) (NRcRe), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, —N (Rc) (Re) , -C(0)Rc, -C(0)0Rc e -C(O)NRcRe; R4 é seleccionado do grupo que consiste em alcoxi, arilalcoxi, ariloxi, halo, hidroxi, RaRbN-, N3- e ReS-, em que R4 é substituído com 0, 1 ou 2 substituintes independentemente seleccionados do grupo que consiste em halo, nitro, ciano, -OH, -NH2 e -COOH; R5 é seleccionado do grupo que consiste em RaS02N(Rf)-, RaS02N (Rf) alquil-, RaRbNS02N (Rf) - e RaRbNS02N (Rf) alquil-; R6 é independentemente seleccionado em cada ocorrência do grupo que consiste em alquilo, alcenilo, alcinilo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, heterocicloalquilo, -(alquil) (ORk), -(alquil)(NRaRb), -SRa, -S(0)Ra, —S (O) 2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)0Ra e -C(0)NRaRb; em que cada R6 é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, haloalquilo, ciano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, —C (O) ORa, -C (O) NRaRb e -NC(0)Ra; Ra e Rb, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alcenilo, alquilo, alquilsulfanilalquilo, arilo, arilalcenilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, cicloalquilalcenilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilcarbonilo, nitroalquilo, RcRdN-, RcRdN-alquil-, RcRdNC (O) alquil-, RcS02-, RcS02-alquil-, RcC(O)-, RcC(O)alquil-, Rc0C(0)-, RcOC(O)alquil-, RcRdN-alquilC (O)-, RcRdNC(0)-, RcRdNC (O) O-alquil- e RcRdNC (O)N (Re) alquil-, em que Ra e Rb são substituídos com 0, 1 ΕΡ 1 560 827/ΡΤ 12/23 ou 2 substituintes seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc) , - (alquil) (NRcRd) , -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C (O) ORc e -C(0)NRcRd; alternativamente, Ra e Rb, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc), - (alquil) (NRcRd), -alquil-S02NRcRd, -alquil-C (O) NR0Rd, -SR0, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C (O) ORc e -C (0) NRcRd; Rc e Rd, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, -NRfRh, -ORf, -C0(R£), -SRf, -SORf, -S02Rf, -C(0)NRfRh, -S02NRfRh, -C(O)ORf, alcenilo, alquilo, alcinilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, arilo, arilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo e heterocicloalquilo; em que cada Rc e Rd é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf), - (alquil) (NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C (O) Rf, -C (O) ORf, -C(0)NRfRh, -C (O)N (H)NRfRh, -N (Re) C (O) ORf, -N (Re) S02NRfRh, -N (Re) C (O) NRfRh, -alquil-N (Re) C (O) ORf, -alquil-N (Re) S02NRfRh e -alquil-N(Re)C(0)NRfRh; alternativamente, Rc e Rd, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são ΕΡ 1 560 827/ΡΤ 13/23 independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf), - (alquil) (NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C (O) Rf, -C (O) ORf e -C (O) NRfRh; Re é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo e cicloalquilo; Rf, Rg e Rh, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alquilo, alcenilo, arilo, arilalquilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, heterociclo, heterocicloalquilo, heteroarilo e heteroarilalquilo; em que cada Rf, Rg e Rh é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquil), -NH2, -N(H)(alquil), -N(alquil)2, -S(alquil), -S(O)(alquil), -S02-alquilo, -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H) (alquil), -alquil-N(alquil) 2, -alquil-S(alquil), -alquil-S(0)(alquil), -alquil-S02alquilo, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alquil), -C(O)alquilo, -C(0)NH2, -C(0)NH2, -C(O)N(H)(alquil) e -C(O)N(alquil)2; alternativamente, Rf e Rg, juntamente com o átomo de carbono ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em cicloalquilo, cicloalcenilo e heterociclo; alternativamente, Rf e Rh, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em heterociclo e heteroarilo; em que cada um do heterociclo e heteroarilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, ΕΡ 1 560 827/PT 14/23 heteroarilo, heteroarilalquilo, -OH, -O(alquil), -NH2, -N(H)(alquil), -N(alquil)2, -S(alquil), -S(alquil), -S (0) (alquil), -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquil), -alquil-S(alquil), -alquil-S(O)(alquil), -alquil-S02alquilo, -alquil-N(alquil)2, -N(H)C(0)NH2, -C(0)0H, -C(0)O(alquil), -C(0)alquilo, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alquil) e -C(0)N(alquil)2; Rk é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo, arilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo, heterocicloalquilo, nitroalquilo, RaRbN-alquil-, Ra0-alquil-, RaRbNC(0)-, RaRbNC (0) alquilo, RaS-, RaS(0)-, RaS02-, RaS-alquil-, Ra (0)S-alquil-, RaS02-alquil-, Ra0C(0)-, Ra0C(0)alquil-, RaC(0)-e RaC(0)alquil-, em que cada Rk é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, -(alquil) (ORc), -(alquil) (NRcRd), -SRC, -S (0) Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)0Rc e -C(0)NRcRd; e méO, 1, 2, 3 ou 4.R1 is selected from the group consisting of hydrogen alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkylalkylcarbonylalkyl, alkylsulfanylalkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, arylalkylenyl, arylalkyl, arylsulfanylalkylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl (cycloalkyl) alkenyl, (cycloalkyl) , formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl heteroarylalkenyl, heteroarylalkyl heteroarylsulfonylalkyl, heterocycloalkenyl heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-RaRbN-alkyl-, RaRbNC (O) alkyl-, RaRbNC (O) 0-alkyl-ΕΡ 1 560 827 / ΡΤ 11 Wherein R 1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, C 1 -C 4 -alkyl, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalk (Rc) (Rc), -S (O) Rc, -S (O) 2 Rc, -ORc, -N (Rc) (Re), - C (O) R c, -C (O) O R c and -C (O) NR c R e; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3- and ReS-, wherein R4 is substituted with 0,1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 and -COOH; R5 is selected from the group consisting of RaS02N (Rf) -, RaS02N (Rf) alkyl-, RaRbNS02N (Rf) - and RaRbNS02N (Rf) alkyl-; R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocycloalkyl, - (alkyl) (OR k), - alkyl (NRaRb), -SRa, -S (O) Ra, -S (O) 2Ra, -ORk, -N (Ra) (Rb), -C (O) Ra, -C (O) C (O) NR a R b; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NR a R b, -SR a, -SOR a , -SO 2 R a, -C (O) OR a, -C (O) NR a R b and -N C (O) Ra; Ra and Rb at each occurrence are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RcRdN- alkyl-, RcRdNC (O) alkyl-, RcSO2-, RcSO2- alkyl-, RcC (O) -, RcC (O) alkyl-, RcO ( 0) -, RcOC (O) alkyl-, RcRdN-C (O) -, RcRdNC (O) -, RcRdNC (O) O-alkyl- and RcRdNC (O) N (Re) are substituted with 0, 1 Ρ Ρ Ρ 1 560 827 ΡΤ 12/23 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NR c R d), -SR C (O) R c, -S (O) 2 R c, -OR c, -N (R c) (Rd), -C (O) R c, -C (O) OR c and -C (O) NR c R d; alternatively Ra and Rb, together with the nitrogen atom to which they are attached, form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc) (Rc) (Rc), -S (O) 2 Rc, -ORc, -N (Rc) (Rd), -N (Rc) -C (O) R c, -C (O) OR c and -C (O) NR c R d; Rc and Rd at each occurrence are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -C0 (R6), -SRf, -SORf, -SO2 Rf, -C (O) NRfRh, -S02 NRfRh, -C (O) OR f, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocycloalkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl (Rf), -SRf, -S (O) Rf, -S (O) 2 Rf, -ORf, -N (R f) (Rh), - (C 1 -C 4) alkyl, C (O) Rf, -C (O) OR f, -C (O) NRf R h, -C (O) N (H) -N (Re) C (O) NRf R h, -alkyl-N (Re) C (O) OR f, -alkyl-N (Re) SO 2 NR f R h and -alkyl- N (Re) C (O) NR f R h; alternatively, Rc and Rd together with the nitrogen atom to which they are attached form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and the heterocycle are ηΡ 1 560 827 / ΡΤ 13 Independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORf), - (alkyl) (NRfRh), -SRf, -S (O) Rf, -S (O) 2Rf, -ORf, -N (Rf) (Rh), -C (O) R f, -C (O) OR f and -C (O) NR f R h; Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh at each occurrence are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle heteroaryl, heteroarylalkyl, -OH, -O (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (O) (alkyl), -S02 alkyl-OH, -alkyl-O-alkyl, -alkyl-NH 2, -alkyl-N (H) (alkyl), -alkyl-N (alkyl) 2, -alkyl-S (alkyl), - -S (O) (alkyl), -alkyl-SO2alkyl, -N (H) C (O) NH2, -C (O) OH, -C (O) O (alkyl), -C (O) alkyl, - C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2; alternatively Rf and Rg, together with the carbon atom to which they are attached, form a three to seven membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively Rf and Rh, together with the nitrogen atom to which they are attached, form a three to seven membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle , Heteroaryl, heteroarylalkyl, -OH, -O (alkyl), -NH 2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl), -S (O) (alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkyl-NH 2, -alkyl-N (H) (alkyl), -alkyl-S (alkyl) alkyl-S (O) (alkyl), -alkyl-SO2alkyl, -alkyl-N (alkyl) 2, -N (H) C (O) NH2, -C (O) OH, -C (O) O ), -C (O) alkyl, -C (O) NH 2, -C (O) NH 2, -C (O) N (H) (alkyl) and -C (O) N (alkyl) 2; R 2 is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycloalkyl, nitroalkyl, nitroalkyl, RaRbN- -, RaRbNC (O) -, RaRbNC (O) alkyl, RaS-, RaS (O) -, RaS02-, RaS-alkyl-, Ra (O) S- alkyl-, RaS02- alkyl-, Ra0C (O) - , Wherein each R k is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo (C 1 -C 6) halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NR c R d), -SRC, -S (O) R c, - S (O) 2 R c, -OR c, -N (R c) (Rd), -C (O) R c, -C (O) O R c and -C (O) NR c R d; and meO, 1, 2, 3 or 4. 8. Composto, sal, estereoisómero ou tautómero de acordo com a reivindicação 7, em que R4 é hidroxi.A compound, salt, stereoisomer or tautomer according to claim 7, wherein R 4 is hydroxy. 9. Composto, sal, estereoisómero ou tautómero de acordo com a reivindicação 8, em que R1 é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alcinilo, arilalcenilo, arilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalcenilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, RfRgC=N- e Rk0-. ΕΡ 1 560 827/ΡΤ 15/23A compound, salt, stereoisomer or tautomer according to claim 8, wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkenyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocyclo, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, RaRbN-, RaRbN- alkyl-, RaRbNC (O) alkyl-, RfRgC = N- and RkO-. ΕΡ 1 560 827 / ΡΤ 15/23 10. Composto, sal, estereoisómero ou tautómero de acordo com a reivindicação 1, em que o composto é seleccionado de entre o grupo que consiste em: • N—{[3-(l-benzil-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il)-1,l-dioxido-4H-tieno[2,3-e][1,2,4]tiadiazin-7-il]metil}-metanossulfonamida; • N-[(3 —{1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il}-l,l-dioxido-4H-tieno[2,3-e][1,2,4] — tiadiazin-7-il)metil]metanossulfonamida; • N-[(3 — {1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il}-l,l-dioxido-4H-tieno[2,3-e] [1,2,4] — tiadiazin-7-il)metil]etanossulfonamida; • N-[(3-{1-[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il}-l,l-dioxido-4H-tieno[2,3-e] [1,2,4] — tiadiazin-7-il)metil]propano-l-sulfonamida; • N-[(3 — {1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il}-l, l-dioxido-4£f-tieno [2,3-e] [1, 2, 4] -tiadiazin-7-il)metil]propano-2-sulfonamida; • N-[(3 — {1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l,2-di-hidroquinolin-3-il}-l, l-dioxido-4fí-tieno [2,3-e] [1, 2, 4] -tiadiazin-7-il)metil]benzenossulfonamida; e • N—[(3 — {1—[(ciclopropilmetil)amino]-4-hidroxi-2-oxo-l, 2-di-hidroquinolin-3-il}-l, l-dioxido-4i7-tieno [2,3-e] [1,2,4] — tiadiazin-7-il)metil]-1-fenilmetanossulfonamida.A compound, salt, stereoisomer or tautomer according to claim 1, wherein the compound is selected from the group consisting of: N - {[3- (1-benzyl-4-hydroxy-2-oxo- 1,2-dihydroquinolin-3-yl) -1,1-dioxido-4H-thieno [2,3-e] [1,2,4] thiadiazin-7-yl] methyl} -methanesulfonamide; • N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-thieno [ 3-e] [1,2,4] thiadiazin-7-yl) methyl] methanesulfonamide; • N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-thieno [ 3-e] [1,2,4] thiadiazin-7-yl) methyl] ethanesulfonamide; • N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4H-thieno [ 3-e] [1,2,4] thiadiazin-7-yl) methyl] propane-1-sulfonamide; • N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4β-thieno [ 2,3-e] [1,2,4] thiadiazin-7-yl) methyl] propane-2-sulfonamide; • N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4 H -thieno [ 3-e] [1,2,4] thiadiazin-7-yl) methyl] benzenesulfonamide; and N - [(3- {1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo-1,2-dihydroquinolin-3-yl} -1,1-dioxido-4,7-thieno [2 , 3-e] [1,2,4] thiadiazin-7-yl) methyl] -1-phenylmethanesulfonamide. 11. Composição farmacêutica que compreende uma quantidade terapeuticamente eficaz de um ou mais compostos, sais, estereoisómeros ou tautómeros referidos em qualquer uma das reivindicações 1-10 e um portador farmaceuticamente aceitável.A pharmaceutical composition comprising a therapeutically effective amount of one or more compounds, salts, stereoisomers or tautomers referred to in any one of claims 1-10 and a pharmaceutically acceptable carrier. 12. Composição farmacêutica de acordo com a reivindicação 11, em que a composição compreende adicionalmente um ou mais agentes seleccionados do grupo que consiste em um modulador da imunidade do hospedeiro e um segundo agente antiviral.A pharmaceutical composition according to claim 11, wherein the composition further comprises one or more agents selected from the group consisting of a host immunity modulator and a second antiviral agent. 13. Composição farmacêutica de acordo com a reivindicação 12, em que cada um dos um ou mais moduladores da imunidade do hospedeiro é seleccionado do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante. ΕΡ 1 560 827/ΡΤ 16/23A pharmaceutical composition according to claim 12, wherein each of the one or more host immunity modulators is selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant. ΕΡ 1 560 827 / ΡΤ 16/23 14. Composição farmacêutica de acordo com a reivindicação 12, em que o segundo agente antiviral inibe a replicação de VHC através da inibição das funções celulares do hospedeiro associadas com replicação virai.The pharmaceutical composition of claim 12, wherein the second antiviral agent inhibits HCV replication through inhibition of host cell functions associated with viral replication. 15. Composição farmacêutica de acordo com a reivindicação 12, em que o segundo agente antiviral inibe a replicação de VHC alvejando proteinas do genoma virai.The pharmaceutical composition of claim 12, wherein the second antiviral agent inhibits HCV replication by targeting proteins of the viral genome. 16. Composição farmacêutica de acordo com a reivindicação 11, em que a composição compreende adicionalmente um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC.The pharmaceutical composition of claim 11, wherein the composition further comprises an agent or combination of agents that treats or alleviates symptoms of HCV infection. 17. Composição farmacêutica de acordo com a reivindicação 11, em que a composição compreende adicionalmente um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).The pharmaceutical composition of claim 11, wherein the composition further comprises one or more agents that treat patients for disease caused by hepatitis B (HBV) infection. 18. Composição farmacêutica de acordo com a reivindicação 17, em que cada do um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB) é seleccionado do grupo que consiste em L-desoxitimidina, adefovir, lamivudina e tenofovir.A pharmaceutical composition according to claim 17, wherein each of the one or more agents for treating disease caused by hepatitis B (HBV) infection is selected from the group consisting of L-deoxythymidine, adefovir, lamivudine and tenofovir. 19. Composição farmacêutica de acordo com a reivindicação 11, em que a composição compreende adicionalmente um ou mais agentes que tratam pacientes para doença causada por infecção por virus da imunodeficiência humana (VIH).The pharmaceutical composition of claim 11, wherein the composition further comprises one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection. 20. Composição farmacêutica de acordo com a reivindicação 19, em que cada do um ou mais agentes que tratam pacientes para doença causada por infecção por vih é seleccionado do grupo que consiste em ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudina, lamivudina, didanosina, estavudina, tenofovir, zalcitabina, abacavir, efavirenz, nevirapina, delavirdina, TMC-125, L-870812, S-1360, enfuvirtida (T—20) e T-1249. ΕΡ 1 560 827/ΡΤ 17/23A pharmaceutical composition according to claim 19, wherein each of the one or more agents that treat patients for disease caused by hiv infection is selected from the group consisting of ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, (T-20), T-1249, TMC-114, TMC-114, fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125, L-870812, S-1360, enfuvirtide . ΕΡ 1 560 827 / ΡΤ 17/23 21. Utilização de uma composição farmacêutica de acordo com qualquer uma das reivindicações 11-20 para preparar um medicamento para tratar ou prevenir infecção causada por um virus contendo ARN através da administração a um paciente com necessidade de tal tratamento ou prevenção.Use of a pharmaceutical composition according to any one of claims 11-20 for preparing a medicament for treating or preventing infection caused by an RNA-containing virus by administration to a patient in need of such treatment or prevention. 22. Utilização de um ou mais compostos, sais, estereoisómeros ou tautómeros de acordo com qualquer uma das reivindicações 1-10 para o fabrico de um medicamento para inibir a replicação de um virus contendo ARN através do contacto do virus com uma quantidade terapeuticamente eficaz do composto ou combinação.Use of one or more compounds, salts, stereoisomers or tautomers according to any one of claims 1-10 for the manufacture of a medicament for inhibiting the replication of an RNA-containing virus by contacting the virus with a therapeutically effective amount of the compound or combination. 23. Utilização de um ou mais compostos, sais, estereoisómeros ou tautómeros de acordo com qualquer uma das reivindicações 1-10 para o fabrico de um medicamento para tratar ou prevenir infecção causada por um vírus contendo ARN através da administração a um paciente com necessidade de tal tratamento ou prevenção de uma quantidade terapeuticamente eficaz do composto ou combinação.Use of one or more compounds, salts, stereoisomers or tautomers according to any one of claims 1-10 for the manufacture of a medicament for treating or preventing infection caused by an RNA-containing virus by administration to a patient in need of such treatment or prevention of a therapeutically effective amount of the compound or combination. 24. Utilização de acordo com qualquer uma das reivindicações 21-23, em que o vírus contendo ARN é vírus da hepatite C.Use according to any one of claims 21-23, wherein the RNA-containing virus is hepatitis C virus. 25. Utilização de acordo com a reivindicação 24, em que a administração compreende adicionalmente o passo de co-administração de um ou mais agentes seleccionados do grupo que consiste em um modulador da imunidade do hospedeiro e um segundo agente antiviral.Use according to claim 24, wherein the administration further comprises the step of co-administering one or more agents selected from the group consisting of a host immunity modulator and a second antiviral agent. 26. Utilização de acordo com a reivindicação 25, em que cada modulador da imunidade do hospedeiro é independentemente seleccionado do grupo que consiste em interferão-alfa, interferão-alfa-peguilado, interferão-beta, interferão-gama, uma citocina e uma vacina opcionalmente compreendendo um antigénio e um adjuvante.Use according to claim 25, wherein each host immunity modulator is independently selected from the group consisting of interferon-alpha, interferon-alpha-pegylated, interferon-beta, interferon-gamma, a cytokine and a vaccine optionally comprising an antigen and an adjuvant. 27. Utilização de acordo com a reivindicação 25, em que o segundo agente antiviral inibe a replicação de VHC através da inibição das funções celulares do hospedeiro associadas com replicação virai. ΕΡ 1 560 827/PT 18/23Use according to claim 25, wherein the second antiviral agent inhibits HCV replication by inhibiting the cellular functions of the host associated with viral replication. ΕΡ 1 560 827 / EN 18/23 28. Utilização de acordo com a reivindicação 25, em que o segundo agente antiviral inibe a replicação de VHC alvejando proteinas do genoma virai.Use according to claim 25, wherein the second antiviral agent inhibits HCV replication by targeting proteins of the viral genome. 29. Utilização de acordo com a reivindicação 24, em que a administração compreende adicionalmente o passo de co-administração de um agente ou combinação de agentes que tratam ou aliviam sintomas de infecção por VHC.Use according to claim 24, wherein the administration further comprises the step of co-administering an agent or combination of agents which treats or alleviates symptoms of HCV infection. 30. Utilização de acordo com a reivindicação 24, em que a administração compreende adicionalmente o passo de co-administração de um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB).Use according to claim 24, wherein the administration further comprises the step of co-administering one or more agents that treat patients for disease caused by hepatitis B (HBV) infection. 31. Utilização de acordo com a reivindicação 30, em que cada do um ou mais agentes que tratam pacientes para doença causada por infecção por hepatite B (VHB) é seleccionado do grupo que consiste em L-desoxitimidina, adefovir, lamivudina e tenofovir.Use according to claim 30, wherein each of the one or more agents treating patients for disease caused by hepatitis B (HBV) infection is selected from the group consisting of L-deoxythymidine, adefovir, lamivudine and tenofovir. 32. Utilização de acordo com a reivindicação 24, em que a administração compreende adicionalmente o passo de co-administração de um ou mais agentes que tratam pacientes para doença causada por infecção por virus da imunodeficiência humana (VIH).Use according to claim 24, wherein the administration further comprises the step of co-administering one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection. 33. Utilização de acordo com a reivindicação 32, em que cada do um ou mais agentes que tratam pacientes para doença causada por infecção por virus da imunodeficiência humana (VIH) é seleccionado do grupo que consiste em ofritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudina, lamivudina, didanosina, estavudina, tenofovir, zalcitabina, abacavir, efavirenz, nevirapina, delavirdina, TMC-125, L-870812, S-1360, enfuvirtida (T-20) e T-1249.Use according to claim 32, wherein each of the one or more agents treating patients for disease caused by human immunodeficiency virus (HIV) infection is selected from the group consisting of ofritonavir, lopinavir, indinavir, nelfinavir, saquinavir , amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125, L-870812, S-1360, enfuvirtide (T-20 ) and T-1249. 34. Composto ou uma sua forma de sal, tautómero ou estereoisómero farmaceuticamente aceitável, em que: o composto corresponde em estrutura à fórmula (IX): (ix); ΕΡ 1 560 827/ΡΤ 19/23 (ix); ΕΡ 1 560 827/ΡΤA compound or a pharmaceutically acceptable salt, tautomer or stereoisomer form thereof, wherein: the compound corresponds in structure to formula (IX): (ix); ΕΡ 1 560 827 / ΡΤ 19/23 (ix); ΕΡ 1 560 827 / ΡΤ R é seleccionado do grupo que consiste em hidrogénio, alcenilo, alcoxialquilo, alcoxicarbonilalquilo, alquilo, alquilcarbonilalquilo, alquilsulfanilalquilo, alquilsulfinilalquilo, alquilsulfonilalquilo, alcinilo, arilo, arilalcenilo, arilalquilo, arilsulfanilalquilo, arilsulfonilalquilo, carboxialquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, (cicloalquil)alcenilo, (cicloalquil)alquilo, formilalquilo, haloalcoxialquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heteroarilsulfonilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilo, nitroalquilo, RaRbN-, RaRbN-alquil-, RaRbNC (O) alquil-, ReRbNC (O) O-alquil-, RaRbNC (0)NRc-alquil-, RfRgC=N- RkO-, em que R independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc) , - (alquil) (NRcRe), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Re), -C (O) Rc, -C (O) ORc e -C(0)NRcRe; R2 e R3, juntamente com os átomos de carbono aos quais estão ligados, formam um anel de cinco ou seis membros seleccionado do grupo que consiste em arilo, cicloalquilo, heteroarilo e heterociclo, em que o arilo, cicloalquilo, heteroarilo e heterociclo é opcionalmente substituído com (R6)m; Rb é independentemente seleccionado em cada ocorrência do grupo que consiste em alquilo, alcenilo, alcinilo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, heterocicloalquilo, -(alquil) (ORk), -(alquil) (NRaRb), -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)0Ra e -C(0)NRaRb; em que cada R6 é independentemente substituído com ΕΡ 1 560 827/PT 20/23 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, haloalquilo, ciano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C(0)0Ra, -C(O) NRaRb e -NC(0)Ra; Ra e Rb, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alcenilo, alquilo, alquilsulfanilalquilo, arilo, arilalcenilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, cicloalquilalcenilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalcenilo, heteroarilalquilo, heterociclo, heterocicloalcenilo, heterocicloalquilo, hidroxialquilcarbonilo, nitroalquilo, RcRdN-, RcRdN-alquil-, RcRdNC (O) alquil-, RcS02-, RcS02-alquil-, RcC(O)-, RcC(O)alquil-, Rc0C(0)-, RcOC(O)alquil-, RcRdN-alquilC(0)-, RcRdNC(0)-, RcRdNC (O) O-alquil- e RcRdNC (O)N (Re) alquil-, em que Ra e Rb são substituídos com 0, 1 ou 2 substituintes seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc) , - (alquil) (NRcRd) , -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(R0)(Rd), -C (0) R0, -C (0) OR0 e -C(0)NRcRd; alternativamente, Ra e Rb, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc) , - (alquil) (NRcRd) , -alquil-S02NRcRd, -alquil-C (O) NRcRd, -SRC, -S(0)Ro/ -S(0)2Rc, -ORc, -N(R0)(Rd), -C(0)Rc, -C (O) ORc e -C (O) NRcRd; Rc e Rd, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -S02Rf, -C(0)NRfRh, -S02NRfRh, -C(0)0Rf, alcenilo, alquilo, alcinilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, arilo, ΕΡ 1 560 827/ΡΤ 21/23 arilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo e heterocicloalquilo; em que cada Rc e Rd é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf) , -(alquil) (NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C (O) Rf, -C (O) ORf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N(Re)S02NRfRh, -N (Re) C (0) NRfRh, -alquil-N (Re) C (0) ORf, -alquil-N (Re) S02NRfRh e -alquil-N (Re) C (0) NRfRh; alternativamente, Rc e Rd/ juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a seis membros seleccionado do grupo que consiste em heteroarilo e heterociclo, em que o heteroarilo e o heterociclo são independentemente substituídos com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORf) , - (alquil) (NRfRh), -SRf, -S(0)Rf, -S(0)2R£, -0Rf, -N(Rf)(Rh), -C (O) Rf, -C (0) ORf e -C (0) NRfRh; Re é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo e cicloalquilo; Rf, Rg e Rh, em cada ocorrência, são independentemente seleccionados do grupo que consiste em hidrogénio, alquilo, alcenilo, arilo, arilalquilo, cicloalquilo, cicloalquilalquilo, cicloalcenilo, cicloalcenilalquilo, heterociclo, heterocicloalquilo, heteroarilo e heteroarilalquilo; em que cada Rf, Rg e Rh é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquil), -NH2, -N(H)(alquil), -N(alquil)2, -S(alquil), -S(0)(alquil), -S02-alquilo, -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquil), -alquil-N(alquil)2, -alquil-S(alquil), ΕΡ 1 560 827/ΡΤ 22/23 -alquil-S(Ο)(alquil), -alquil-S02-alquilo, -Ν(Η)C(Ο)ΝΗ2, -C(Ο)OH, -C(Ο)Ο(alquil), -C(Ο)alquilo, -C(0)NH2, -C(0)NH2, -C(Ο)Ν(Η)(alquil) e -C(Ο)Ν(alquil)2; alternativamente, Rf e Rg, juntamente com o átomo de carbono ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em cicloalquilo, cicloalcenilo e heterociclo; alternativamente, Rf e Rh, juntamente com o átomo de azoto ao qual estão ligados, formam um anel de três a sete membros seleccionado do grupo que consiste em heterociclo e heteroarilo; em que cada um do heterociclo e heteroarilo é independentemente substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, ciano, halo, oxo, nitro, arilo, arilalquilo, cicloalquilo, cicloalcenilo, heterociclo, heteroarilo, heteroarilalquilo, -OH, -O(alquil), -NH2, -Ν(H)(alquil), -N(alquil)2, -S(alquil), -S(alquil), -S(O) (alquil) , -alquil-OH, -alquil-O-alquilo, -alquil-NH2, -alquil-N(H)(alquil), -alquil-S(alquil), -alquil-S(O)(alquil), -alquil-S02alquilo, -alquil-N(alquil)2, -Ν(H)C(O)NH2, -C(0)0H, -C(O)O(alquil), -C(O)alquilo, -C(0)NH2, -C(0)NH2, -C(Ο)Ν(H)(alquil) e -C(O)N(alquil)2; Rk é seleccionado do grupo que consiste em hidrogénio, alcenilo, alquilo, arilo, arilalquilo, cianoalquilo, cicloalcenilo, cicloalcenilalquilo, cicloalquilo, cicloalquilalquilo, formilalquilo, haloalquilo, heteroarilo, heteroarilalquilo, heterociclo, heterocicloalquilo, nitroalquilo, RaRbN-alquil-, RaO-alquil-, RaRbNC (O) - , RaRbNC (O) alquilo, RaS-, RaS(0)-, RaS02-, RaS-alquil-, Ra (O) S-alquil-, RaS02-alquil-, Ra0C(0)-, RaOC (O) alquil-, RaC(0)-e RaC(O)alquil-, em que cada Rk é substituído com 0, 1, 2 ou 3 substituintes independentemente seleccionados do grupo que consiste em alquilo, alcenilo, alcinilo, oxo, halo, ciano, nitro, haloalquilo, haloalcoxi, arilo, heteroarilo, heterociclo, arilalquilo, heteroarilalquilo, alcoxialcoxialquilo, - (alquil) (ORc), - (alquil) (NRcRd), -SRC, -S(0)2Rc, 1 -S (O) Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)0Rc e -C (0) NRcRd; ΕΡ 1 560 827/ΡΤ 23/23 méO, 1, 2, 3 ou 4; e R11 e R12 são independentemente seleccionados do grupo que consiste em alquilo, alcenilo e alcinilo.R 2 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkyl, alkenyl, (cycloalkyl) alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocyclo, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN- alkyl-, RaRbNC (O) alkyl-, ReRbNC (O ) O-alkyl-, RaRbNC (O) NRc-alkyl-, RfRgC = N- RkO-, wherein R is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo , halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroaryl (Rc) (S), -S (O) Rc, -S (O) 2 Rc, -ORc, -N (Rc) (Rc), - C (O) R c, -C (O) OR c and -C (O) NR c R e; R2 and R3, together with the carbon atoms to which they are attached, form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein the aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R 6) m; Rb is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocycloalkyl, - (alkyl) (OR k), - alkyl (NRaRb), -SRa, -S (O) Ra, -S (O) 2Ra, -ORk, -N (Ra) (Rb), -C (O) Ra, -C (O) C (O) NR a R b; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -OR a , -NRaRb, -SRa, -SORa, -SO 2 R a, -C (O) O R a, -C (O) NR a R b and -N C (O) Ra; Ra and Rb at each occurrence are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RcRdN- alkyl-, RcRdNC (O) alkyl-, RcSO2-, RcSO2- alkyl-, RcC (O) -, RcC (O) alkyl-, RcO ( 0) -, RcOC (O) alkyl-, RcRdN-C (O) -, RcRdNC (O) -, RcRdNC (O) O-alkyl- and RcRdNC (O) N (Re) are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) ORc), - (alkyl) (NR c R d), -SRC, -S (O) R c, -S (O) 2 R c, -OR c, -N R 0) (Rd), -C (O) R 0, -C (O) OR 0 and -C (O) NR c R d; alternatively Ra and Rb, together with the nitrogen atom to which they are attached, form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc) (O) NR c R d, -S (O) 2 R c, -OR c, -N (R 0) (Rd), -C (O) R c, -C (O) OR c and -C (O) NR c R d; R c and Rd at each occurrence are independently selected from the group consisting of hydrogen, -NRf R h, -OR f, -CO (R f), -SR f, -SOR f, -SO 2 R f, -C (O) NR f R h, -SO 2 NR f R h, - C (O) O R f, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocycloalkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl (Rf), -SRf, -S (O) Rf, -S (O) 2 Rf, -ORf, -N (R f) (Rh), - (C 1 -C 4) alkyl, C (O) Rf, -C (O) OR f, -C (O) NRf R h, -C (O) N (H) NR f R h, -N (R e) -N (Re) C (O) NRf R h, -alkyl-N (Re) C (O) OR f, -alkyl- N (Re) SO 2 NR f R h and -alkyl- N (Re) C (O) NR f R h; alternatively, R c and Rd / together with the nitrogen atom to which they are attached form a three to six membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and the heterocycle are independently substituted with 0,1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (OR f) (O) Rf, -S (O) 2 R,, -ORf, -N (R f) (Rh), -C (O) R f, -C (O) OR f and -C (O) NR f R h; Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh at each occurrence are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle heteroaryl, heteroarylalkyl, -OH, -O (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (O) (alkyl), -S02 alkyl-OH, -alkyl-O-alkyl, -alkyl-NH 2, -alkyl-N (H) (alkyl), -alkyl-N (alkyl) 2, -alkyl-S (alkyl), Ε 1 (ΡΤ) ΝΗ 2, -C (Ο) OH, -C (Ο) Ο (C 1 -C 4) -alkyl, alkyl), -C (Ο) alkyl, -C (O) NH 2, -C (O) NH 2, -C (Ο) Ν (Η) (alkyl) and -C (Ο) Ν (alkyl) 2; alternatively Rf and Rg, together with the carbon atom to which they are attached, form a three to seven membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively Rf and Rh, together with the nitrogen atom to which they are attached, form a three to seven membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle (alkyl), -N (alkyl), -N (alkyl), -N (alkyl), -S (alkyl), -S (alkyl), -S (O) (alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkyl-NH2, -alkyl-N (H) (alkyl), -alkyl-S (alkyl), -alkyl-S (O) (alkyl) (O) alkyl, -C (O) O (alkyl), -C (O) alkyl, -C (O) -C (O) NH2, -C (O) NH2, -C (Ο) Ν (H) (alkyl) and -C (O) N (alkyl) 2; R1 is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycloalkyl, nitroalkyl, nitroalkyl, RaRbN-alkyl-, RaO- -, RaRbNC (O) -, RaRbNC (O) alkyl, RaS-, RaS (O) -, RaS02-, RaS-alkyl-, Ra (O) S- alkyl-, RaS02- alkyl-, Ra0C (O) - , RaOC (O) alkyl-, RaC (O) -and RaC (O) alkyl-, wherein each R k is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORc), - (alkyl) (NR c R d), -SRC, -S (O) 2 R c, 1 -S (O) R c, -S (O) 2 R c, -OR c, -N (R c) (Rd), -C (O) R c, -C (O) O R c and -C (O) NR c R d; ΕΡ 1 560 827 / ΡΤ 23/23 m,, 1, 2, 3 or 4; and R 11 and R 12 are independently selected from the group consisting of alkyl, alkenyl and alkynyl. 35. Composto, sal, estereoisómero ou tautómero de acordo com a reivindicação 34, em que o composto é seleccionado do grupo que consiste em: • l-benzil-3-(bis(metiltio)metileno)-lH-quinolina-2, 4(1Η, 3H)-diona; • 3-[bis(metiltio)metileno]-1-butil-l,8-naftiridina-2, 4(1H,3H)-diona; • 3-[bis(metiltio)metileno]-1-(1,3-dioxo-l,3-di-hidro-2H-isoindol-2-il)quinolina-2, 4(1H,3H)-diona; • 3-[bis(metiltio)metileno]-1-[(ciclopropilmetil)amino]-quinolina-2,4(1H,3H)-diona; e • 3-[bis(metiltio)metileno]-1-(ciclobutilamino)quinolina-2,4(1 H, 3H) -diona. Lisboa, 2011-03-10A compound, salt, stereoisomer or tautomer according to claim 34, wherein the compound is selected from the group consisting of: 1-benzyl-3- (bis (methylthio) methylene) -1H-quinoline-2,4 (1α, 3β) -dione; • 3- [bis (methylthio) methylene] -1-butyl-1,8-naphthyridine-2,4 (1H, 3H) -dione; • 3- [bis (methylthio) methylene] -1- (1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl) quinoline-2,4 (1H, 3H) -dione; • 3- [bis (methylthio) methylene] -1 - [(cyclopropylmethyl) amino] -quinoline-2,4 (1H, 3H) -dione; and • 3- [bis (methylthio) methylene] -1- (cyclobutylamino) quinoline-2,4 (1 H, 3H) -dione. Lisbon, 2011-03-10
PT03768559T 2002-11-01 2003-10-31 Anti-infective agents PT1560827E (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US10/285,714 US20040097492A1 (en) 2002-11-01 2002-11-01 Anti-infective agents
US10/410,853 US20040087577A1 (en) 2002-11-01 2003-04-10 Anti-infective agents
US10/625,121 US20040162285A1 (en) 2002-11-01 2003-07-23 Anti-infective agents
US10/679,881 US20050075331A1 (en) 2003-10-06 2003-10-06 Anti-infective agents

Publications (1)

Publication Number Publication Date
PT1560827E true PT1560827E (en) 2011-03-17

Family

ID=43426110

Family Applications (1)

Application Number Title Priority Date Filing Date
PT03768559T PT1560827E (en) 2002-11-01 2003-10-31 Anti-infective agents

Country Status (6)

Country Link
JP (2) JP4738172B2 (en)
AT (1) ATE493408T1 (en)
DE (1) DE60335564D1 (en)
DK (1) DK1560827T3 (en)
PT (1) PT1560827E (en)
SI (1) SI1560827T1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
UA100120C2 (en) 2007-04-03 2012-11-26 Анадис Фармасьютикалз, Инк. 5,6-dihydro-1h-pyridin-2-one compounds
GB0800855D0 (en) * 2008-01-17 2008-02-27 Syngenta Ltd Herbicidal compounds
AU2009241514A1 (en) * 2008-04-15 2009-11-05 Intermune, Inc. Novel inhibitors of hepatitis C virus replication
EA201100661A1 (en) * 2008-10-29 2011-12-30 Басф Се SUBSTITUTED PYRIDINS WITH HERBICIDAL ACTION
MX2011008641A (en) * 2009-03-06 2011-09-06 Hoffmann La Roche Heterocyclic antiviral compounds.
JP2013525368A (en) * 2010-04-23 2013-06-20 キネタ・インコーポレイテツド Antiviral compounds
SG195288A1 (en) * 2011-06-07 2013-12-30 Anadys Pharmaceuticals Inc [1,2,4]thiadiazine 1,1-dioxide compounds for lowering serum uric acid

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001085172A1 (en) * 2000-05-10 2001-11-15 Smithkline Beecham Corporation Novel anti-infectives
AR036081A1 (en) * 2001-06-07 2004-08-11 Smithkline Beecham Corp COMPOSITE OF 1,2-DIHYDROQUINOLINE, ITS USE TO PREPARE A PHARMACEUTICAL COMPOSITION, METHODS TO PREPARE IT AND N-RENTED 2-AMINOBENZOIC ACID OF UTILITY AS INTERMEDIARY IN SUCH METHODS
WO2003059356A2 (en) * 2001-10-30 2003-07-24 Smithkline Beecham Corporation Novel anti-infectives

Also Published As

Publication number Publication date
JP2011144183A (en) 2011-07-28
JP4738172B2 (en) 2011-08-03
JP5250649B2 (en) 2013-07-31
JP2006509042A (en) 2006-03-16
ATE493408T1 (en) 2011-01-15
DE60335564D1 (en) 2011-02-10
SI1560827T1 (en) 2011-04-29
DK1560827T3 (en) 2011-04-18

Similar Documents

Publication Publication Date Title
US7902203B2 (en) Anti-infective agents
ES2357230T3 (en) ANTI-INFECTIVE AGENTS.
US20050075331A1 (en) Anti-infective agents
EP1560827B1 (en) Anti-infective agents
US20040162285A1 (en) Anti-infective agents
EP1971611B1 (en) Anti-viral compounds
JP4782117B2 (en) Pyrrolotriazine kinase inhibitor
AU2006330924B2 (en) Anti-viral compounds
US8846673B2 (en) Azaindazoles as kinase inhibitors and use thereof
US8604050B2 (en) Bicyclic derivatives of azabicyclic carboxamides, preparation thereof and therapeutic use thereof
JP5250649B2 (en) Antiinfectives
WO2017001924A1 (en) Therapeutic inhibitory compouds
MX2008013942A (en) Pyrido [2, 3-b] pyrazine and [1, 8] -naphthyridine derivatives as alk and c-met inhibitors.
WO2003000657A1 (en) Diamine derivatives
CZ20023945A3 (en) Substituted pyrrolopyridine derivatives intended for use as phosphodiesterase inhibitors
JP2023524821A (en) Iminosulfanone inhibitors of ENPP1
RU2441010C2 (en) Antiviral compound
JPH09263585A (en) Cyclic compound and its production and product
TW200427678A (en) Anti-infective agents
JPH09263587A (en) Cyclic compound, its production and its agent
BRPI0620440A2 (en) antiviral compounds