TW200427678A - Anti-infective agents - Google Patents

Abstract

The present invention provides an HCV polymerase inhibiting compound having the formula (I), and a composition comprising a therapeutically effective amount of said compound. The present invention also provides a method for inhibiting hepatitis C virus (HCV) polymerase, a method for inhibiting HCV viral replication, and a method for treating or preventing HCV infection. Processes for making said compounds, and synthetic intermediates employed in said processes, are also provided,

Description

200427678 发明 Description of the invention: This application is a part of the consecutive US patent application serial number ______ filed. The application is for the national patent application filed on April 29, 2006. Part of the serial case with serial number ug 0,853, which is the partial serial case of US patent application serial number Cong 85,714 filed on November 1, 2010 * The patent specifications are incorporated herein. reference. [Technical Field to which the Invention belongs] The present invention provides a novel anti-infective agent. Specifically, the present invention provides a HCV polymerase inhibitory compound and a composition comprising a therapeutically effective amount of the compound. The present invention also provides a method for inhibiting hepatitis C virus (HCV) polymerase, a method for inhibiting HCV virus replication, and a method for treating or preventing HCV infection. Methods of making the compounds and synthetic intermediates employed in the methods are also provided. [Prior art] Infection with hepatitis C virus (HCV) is one of the main causes of human liver disease worldwide. More than 85% of all infected individuals become chronically infected. In the United States, chronic HCV infection accounts for 30% of all cirrhosis, end-stage liver disease, and liver cancer. The CDC estimates that the number of deaths due to HCV will increase to 38,000 / year by 2010. Although the initial therapies only included interferon alone, the combination of interferon a_2b and trisinonucleoside, which lasted 24 or 48 weeks, is currently the most effective licensed therapy for chronic HCV infection. However, there are many adverse side effects that accompany this therapy (influenza-like symptoms from interferon, leukopenia, thrombocytopenia, and depression, and anemia caused by Sanjun Nuclear Medicine). Furthermore, this therapy is less effective for infections caused by HCV genotype 1, 89166 200427678, which constitutes about 75% of all HCV infections. Based on the foregoing, it has been confirmed that compounds have the ability to inhibit HCV, and there is a significant need for them. The present invention provides novel anti-infective agents as HCV polymerase inhibitors. SUMMARY OF THE INVENTION The present invention provides compounds of formula (I)

Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, and heteroaryl And heterocyclic ring; R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, carbonylalkyl, thioalkyl, thioalkyl, thioalkyl, thioalkyl Continued cyanoyl, decyl, aryl, arylalkyl, aryl, aryl, arylthio, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cyclic Alkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, methylformyl, iSalkyloxy, haloalkyl, heteroaryl, heteroaryl Base, heteroaralkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN_, RaRbN alkyl-, RaRbNC (0) alkane Group-, RaRbNCXOP alkyl-, RaRbNC (0) NRe alkyl-, RfRgC = N- and RkO-89166 200427678, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group including Alkenyl, dilute, decyl, keto, halo Cyano, nitro, haloalkyl, halo: feoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORc ),-(AlkylXNH), -SRC, -S (0) Rc, -S (0) 2Rc, _0 ~, -N (Rc) (Re), -C (0) Rc, -C (0) 0Rc and -C (0) NRcRe; R2 and R3 are independently selected from the group consisting of hydrogen, fluorenyl, alkyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, aralkyl, heteroaryl, heterocyclic , Heteroaralkyl, cyano, halo, -N (Ra) (Rb), RaRbNC (0)-, -SRa, -S (0) Ra, -S (0) 2Ra, and RaC (0)-; Wherein R2 and R3 are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from Ra, alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, and haloalkane Group,-(alkyl) (〇Rk),-(alkyl XNf ^ Rb), -SRa, -S (0) Ra, 4 (0) 21 ^, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra and -C (0) NRaRb; or, R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, Cycloalkyl, heteroaryl, and heterocyclic, wherein the aryl, cycloalkyl, heteroaryl, and heterocyclic are optionally substituted with (R6) m; R4 is selected Including alkoxy, arylalkoxy, aryloxy, 1¾, hydroxy, RaRbN_, N3-, ReS-, where R4 is independently substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group including li Group, nitro group, cyano group, -OH, -NH2, and -COOH; R5 is independently selected from each group including alkenyl group, alkoxy group, alkoxy group, block group, aryl group, aralkyl group, aryl group Carbonyl, aryloxy, azidealkyl, formamyl, halo, haloalkyl, functional carbon, heteroaryl, heteroaralkyl, heterocycle 89166 200427678, heterocycloalkyl, hydroxyalkyl , Cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, Ra (0 ) SN (Rf)-, RaS02N (Rf), Ra (0) SN (Rf) alkyl-, RaS02N (Rf) alkyl-, I ^ RbNSC ^ I ^ Rf)-, RaRbNS02N (Rf) alkyl- , RaRbNC (0)-, Rk0C (0)-, Rk0C (0) alkyl-, RkOalkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0- and -ORk, Each R5 is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, block, keto, fluorenyl, cyano, nitro, alkynyl, and Oxygen Aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl XORe),-(alkyl) Ah Rd), -SK, -S (0 ) Re, -S (0) 2 Rc, -ORe, -N (Re) (Rd), -C (0) Re, -C (0) 0Re, and -CCC ^ NReRd; R6 is independent in each place where it exists Selected from the group consisting of alkyl, alkenyl, decanyl, halo, cyano, nitro, alkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, hetero Cycloalkyl,-(alkyl) (ORk),-(alkyl) (11¾), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N ^ XRb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, and block Group, g-same group, halo, haloalkyl, cyano, nitro, -〇Ra, -NRaRb, -SRa, -SOi ^, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and- NC (0) Ra;

Ra and Rb are independently selected from each group including hydrogen, fluorenyl, alkyl, alkylthioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cycloalkenyl, cycloolefin Alkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methylaminoalkyl, haloalkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heterocyclic, heterocyclic Alkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, ReRdN- 89166 -10- 200427678, RkO_, RkO alkyl-, ReRdN alkyl-, RcRdNCXO) alkyl-, RcS02-, RcS02 alkyl -, RcC (0)-, ReC (O) alkyl-, Rc0C (0)-, RcoC (0) alkyl-, I ^ RdN alkylC (O)-, RcRdNC (0)-, RcRdNC (0) 0 alkyl-, RcRdNC (0) N (Re) alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents, and the substituents are selected from alkyl, alkenyl, alkynyl, Keto, i-based, cyano, nitro, alkynyl, pyrenyloxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-( Alkyl) (〇R〇),-(alkylXNI ^ Rd), -SRe, -SCCORe, -S (0) 2Re, _0 &, -N ^ XRd), -C (0) Re, -C ( 0) 0Rc and -C (0) NReRd; or, heart and ^ and The attached nitrogen atoms together form a three- to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic rings, wherein the heteroaryl and heterocyclic ring systems are independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independent Selected from the group consisting of alkyl, alkenyl, decyl, keto, halo, cyano, nitro, alkynyl, self-oxyl, aryl, heteroaryl, heterocyclic, aryl, heteroaryl Radical, alkoxy radical,-(alkyl) (ORe),-(alkyl) (NReRd), -alkyl SC ^ NI ^ Rd, -alkyl C (0) NReRd, -SRC,- S (0) Rc, -S (0) 2Rc, -ORc, -NdXRd), < (0) &, -C (0) 0Re and -CCCONReRd;

Rc and Rd are independently selected at each occurrence from the group including hydrogen, -NRf Rh, -ORf, CO (Rf), -SRf, -SORf, -SC ^ Rf, -C (0) NRfRh, -S〇2NRfRh, -C (0) 0Rf, alkenyl, alkyl, alkyl, cyclic, cycloalkyl, cycloalkenyl, cycloalkenyl, aryl, aralkyl, alkyl, heteroaryl, Heteroaralkyl, heterocyclic and heterocycloalkyl; wherein each of Re and Rd is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, decyl, and @ 同Base, halo, cyano, nitro, 12-alkynyl, 12-ethenyloxy, aryl, heteroaryl-11- 89166 200427678, heterocyclic, aryl-alkynyl, heteroaralkyl, alkoxyalkane Group,-(alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh),- C (0) Rf, _C (0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, _N (Re) C (0) 0Rf, -i ^ RJSC ^ NRfRh, -N ( Re) C (0) NRfRh, -alkylN (Re) C (0) 0Rf, -alkylN (RJS02 NRfRh, and -alkylN (Re) C (0) NRfRh; or, The attached nitrogen atoms together form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocyclic rings, wherein heteroaryl and heterocyclic rings Independently substituted by 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, 1¾ alkyl, haloalkoxy, Aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) (NRfRh), _SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and -C (0) NRfRh;

Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg & Rh are independently selected from each occurrence including hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocycle, heterocycloalkyl, heteroaryl and heteroarylalkyl; each of Rf, Rg and chemistries is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl and fluorenyl , Decyl, cyano, halo, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -〇 (alkane Group), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (〇) (alkyl), -S02 alkyl, -alkyl- OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl), -alkyl S (0) (alkyl), alkylS02 alkyl, _N (H) C (0) NH2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkane -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl) and -C (0) N (alkyl) 2; -12- 89166 200427678 or Rf Together with Rg and the carbon atom to which they are attached form a three- to seven-membered ring selected from cycloalkyl, cycloalkenyl and heterocyclic rings; or Rf, together with Rh and the nitrogen atom to which they are attached, form a three- to seven-membered ring selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently 0, 1, 2 or 3 Each substituent is independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, Heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S ( Alkyl), -S (0) (alkyl), -alkyl-OH, -alkyl-CM end, -alkylNH2, -alkylN (H) (alkyl), · alkylS (Alkyl), -alkylS (0) (alkyl), -alkylS02alkyl, -alkylN (alkyl) 2, -n (h) c (o) nh2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl), and- C (0) N (alkyl) 2;

Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methylaminoalkyl , Haloalkyl, heteroaryl, heteroaralkyl, heterocycle, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS-, RaS (0)-, RaS02-, RaS alkyl-, Ra (0) S alkyl-, RaS02 alkyl-, I ^ OCCO)-, Ra0C (0) alkyl-, RaC (0)- , RaC (〇) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, keto, iS, cyano, Nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),- (Alkyl) (NRcRd), -SRe, -S (0) Re, -S (0) 2Rc, -0Re, -N (Re) (Rd), -C (0) Rc, -C (0) 0Rc And -C (0) NRcRd; m is 0, 1, 2, 3, or 4; and -13- 89166 200427678 η is 0, 1, 2, 3, or 4; with the proviso that when A is other than the following Monocyclic ring

And R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocycloalkyl, ring Alkyl, cyano, nitro, 1 ^^ 汴, d (3 (0)-, heart 3-, 1 (0) 8-, ^ (0) 28-, RaS02N (Rf)-, RaRbNC (0) _, Rk0C (0)-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, yl, cyano, nitro, aryl, heteroaryl, heterocycloalkyl,- When SRa, _S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb, then R1 is not hydrogen, alkenyl, alkyl, bulk, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, heteroaryl, Heteroarylalkenyl, heteroaralkyl, heterocyclic fluorenyl, or heterocycloalkyl; and another additional condition is that when A is

And R4 is a hydroxyl group or ReS-, and R5 is hydrogen, an unsubstituted alkyl group, a dentyl group, or -ORk, and R6 is a hydrogen group, an alkyl group, a dilute group, a decyl group, a pentyl group, a cyano group, a nitro group, and an aromatic group. Group, heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (〇 ) ORa and -C (0) NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, (Cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl. 89166 -14- 200427678 The present invention also provides methods for making the compounds of the present invention and intermediates used in the methods. The present invention further provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or a combination of compounds of the present invention or a pharmaceutically acceptable salt form thereof, and a pharmaceutically acceptable carrier. The present invention also provides a method for treating or preventing an infection caused by a virus, which comprises administering a pharmaceutical composition of the present invention to a patient in need of such treatment. This month, progress has been made to provide a method for inhibiting RNA-containing virus replication, which comprises contacting the virus with a therapeutically effective amount of a compound or combination of compounds of the invention or a pharmaceutically acceptable salt thereof. This month, I have made further progress & for a method for treating or preventing infection caused by the rjsja virus-containing method, which comprises administering the pharmaceutical composition of the present invention to a patient in need of such treatment. DETAILED DESCRIPTION OF THE INVENTION When used in this patent specification, the following terms have the indicated meanings: as used herein, the singular forms "a", "an" and ,,,,, and, may include the plural reference, unless the context indicates otherwise Clearly stated. As used herein, the term "alkyl" refers to a group derived from a straight or branched chain saturated hydrocarbon containing 1,2,3,4,5,6,7,8,9, or 10 carbons. atom. Examples of the alkyl group include butyl, methyl, 2-methylbutyl and the like. The term "diluted group" as used herein refers to a straight or branched chain group of 2, 3, 4, 5, 6, 7, 8, 9, or 10 stone counteratoms that contains at least one carbon —Carbon double bond. Examples of fluorenyl include allyl, propenyl, 3-methyl-2-butenyl, and the like. 89166 -15- 200427678 As used herein, the term "alkynyl" means Z, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms ... or branched chain hydrocarbons containing at least one carbon _Carbon reference bond. Examples of alkynyl include ethyl block, 2-methyl-3-butynyl, 3-pentyl and the like. As used herein, " carbooxy " -self refers to a fluorenyl group connected to the parent molecular moiety through an oxygen atom of an earth. Examples of carbooxy include tertiary butoxy, methoxy, iso Propoxy, etc. As used herein, the term "垸 oxy 垸 oxy" means a alkoxy group as defined herein, which is added to the parent molecular moiety through another alkoxy group as defined herein. Groups. Representative examples of alkoxyalkoxy include, but are not limited to, tert-butoxymethoxy, 2-ethoxyethoxy, 2-methoxyethoxy, and methoxymethyl. The term "alkoxy" used in this document means a alkoxy radical as defined herein, appended to the parent molecular moiety through a radical as defined herein. Representative examples of oxygen-oxygenated oxygen radicals include, but are not limited to, third butoxymethoxymethyl, ethoxymethoxymethyl, (2-methoxyethoxy) methyl, and 2- ( 2-methoxyethoxy) ethyl. As used herein, the term "alkoxyalkyl" refers to an alkyl group substituted with at least one alkoxy group. The term "alkoxycarbonyl group" as used herein refers to the attachment to the parent molecule through a carbonyl group Some of the radicals are alkoxy. Examples of the oxyalkyl group include a tert-butoxycarbonyl group, an ethoxycarbonyl group, a methoxycarbonyl group, and the like. As used herein, the term "k-oxycarbonylalkyl" refers to an alkoxycarbonyl group attached to the parent molecular group via an alkyl group. As used herein, the term "alkylcarbonyl" refers to an alkyl group attached to a group via a carbonyl group. Parent group 89166 -16-200427678 The alkyl group of the sub-group. Examples of alkylcarbonyl include fluorenyl, butylfluorenyl, 2,2-dimethylpropanyl and the like. "Alkylcarbonylalkyl" as used herein The term, means an alkylcarbonyl group, as defined herein, appended to the parent molecular moiety through an alkyl group, as defined herein. Representative examples of alkylcarbonylalkyl groups include, but are not limited to, 2-ketopropyl Group, 3,3-dimethyl-2-ketopropyl, 3-ketobutyl and 3-ketopentyl. As used herein, the term "alkylthio" refers to the attachment via a sulfur atom An alkyl group to the parent molecular moiety. Examples of alkylthio include methylthio, (1-methylethyl) thio, (2-methylpropyl) thio, etc. As used herein, ' f thioalkyl group π — The term refers to an alkylthio group attached to a parent molecular moiety through an alkyl group. As used herein, "alkylsulfinyl" Words, through means -S (O) - group is attached to the alkyl moiety of the parent molecule. The term "alkylsulfinamidoalkyl" as used herein refers to an alkylsulfinamido group connected to the parent molecular moiety through an alkyl group. The term π-alkylsulfonyl ff, as used herein, refers to an alkyl group attached to the parent moiety by a -S (0) 2- group. As used herein, the term "pi-alkylsulfonylalkyl '" refers to an alkylsulfonyl group attached to the parent molecular moiety through an alkyl group. As used herein, the term "aryl" refers to a phenyl or bicyclic or tricyclic hydrocarbon fused ring system in which one or more rings are phenyl. A bicyclic fused ring system has benzene Group, fused to a monocyclic cyclofluorenyl group, as defined herein, a monocyclic cycloalkyl group, or another phenyl group. Examples of tricyclic fused ring systems are as follows, bicyclic fused A ring-binding system fused to a monocyclic cycloalkenyl group as defined herein, a monocyclic cycloalkyl group as defined herein, or another phenyl group. Examples of aryl groups include anthracenyl, Benzyl, fluorenyl, hydroindenyl, indenyl, naphthyl, phenyl, tetrahydrofluorenyl, etc. The aryl group of the present invention may be connected to the parent molecular moiety through any substitutable carbon atom of this group. The aryl group of the present invention may be substituted with 0, 1, 2, 3, 4 or 5 substituents, and the substituents are independently selected from the group consisting of alkynyl, fluorenyl, block, cyano, formate, halo, schottyl, and ketone. Base, -ORa, -0C (0) Ra, _0C (0) 0Ra, -0C (0) NRaRb, -0S02Ra, -OSC ^ NI ^ Rb, _SRa, -SOK, -S02Ra, -S020Ra, -SC ^ NRaRb , -NRaRb > -N (Re) C (0) Ra ^ ^ (1 ^) 0 (0) 0 ^ > -Ν (ί ^) C (0) NRa Rb ^ -N (Re) S02Ra, _N (Re) S02NRaRb, -N (Re) S02N (Re) C (0) 0Ra, ((0) ¾, -C (0) 0Ra, cycloalkyl, cyclofluorenyl, heterocyclic ring, second aryl and heteroaryl Each of the alkyl, alkenyl and alkynyl groups is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of cyano, formamyl, halo, nitro, keto,- ORa, -0C (0) Ra, -0C (0) 0Ra, -0C (0) NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -S0Ra, -S02Ra, -S020Ra, -S02NRaRb ^ -NRaRb > ^ ( 1 ^) 0 (0) ^ > -N (Re) C (0) 0Ra > -N (Re) C (0) NRa Rb > -N (Re) S02Ra,: N (Re) S02NRaRb,- N (Re) S02N (Re) C (0) 0Ra, < (0) &, -C (0) 0Ra, -C (0) NRaRb, cycloalkyl, cyclofluorenyl, heterocyclic ring, second Aryl and heteroaryl; where Ra, Rb & Re are all defined herein, and where the second aryl, heteroaryl, cycloalkyl, cycloalkenyl and heterocyclic ring can be 0, 1, 2 or 3 Substituted by a substituent, the substituent is independently selected from the group consisting of -OH, -0 (alkyl), alkyl, alkenyl, decyl, cyano, formamyl, halo, 12.5 alkoxy, halo, nitrate base , -NH2, -N (H) (alkyl), -N (alkyl), -C (0) 0H, -C (0) 0 (alkyl), -C (0) NH2, _C (0 ) N (H) (alkyl), -C (0) N (alkyl) 2 and keto. 89166 -18- 200427678 As used herein, the term "arylfluorenylπ" refers to an aryl group attached to the parent molecular moiety through an alkenyl group. The term "arylalkoxy" as used herein , Refers to an aralkyl group connected to the parent molecular moiety through an oxygen atom. The term πaralkylπ, as used herein, refers to an aryl group connected to the parent molecular moiety through an alkyl group. As used herein, the term "arylcarbonyl" refers to an aryl group attached to the parent molecular moiety through a carbonyl group. The term "arylcarbonylalkyl" as used herein means as herein An arylcarbonyl group, as defined herein, is appended to the parent molecular moiety through an alkyl group, as defined herein. The term πaryloxyπ, as used herein, refers to an aryl group attached to the parent molecular moiety through an oxygen atom. As used herein, the term "aryloxyalkyl" refers to an aryloxy group attached to the parent molecular moiety through an alkyl atom. As used herein, the term "arylthio" refers to an aryl group attached to a parent moiety through a sulfur atom. The term "farylthioalkyl" used herein is Refers to an arylthio group attached to the parent molecular moiety through an alkyl group. As used herein, the term "arylsulfonyl" refers to an aryl group attached to the parent molecular moiety through a sulfonyl group. As used herein, the term "πarylsulfonylalkyl" refers to an arylsulfonyl group attached to the parent molecular moiety through an alkyl group. As used herein, the term "carboxyπ" is a Refers to -co2H. -19- 89166 200427678 The term "carboxyalkyl" as used herein refers to a carboxyl group attached to the parent molecular moiety through an alkyl group. The term "cyano" as used herein, Refers to -CN. The term "cyanoalkyl" as used herein refers to a cyano group attached to the parent molecular moiety through an alkyl group. The π-cycloalkenyl f'- The term refers to a non-aromatic, partially unsaturated monocyclic, bicyclic, or tricyclic ring system having three to fourteen carbon atoms and zero heteroatoms. Examples of cycloalkenyl include cyclohexyl , Octahydrothecyl, n-stilbene, etc. The cycloalkenyl group of the present invention may be substituted with 0, 1, 2, 3, 4 or 5 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, and alkynyl , Cyano, methylamido, halo, nitro, keto, -ORa, -0C (0) Ra, -0C (0) 0Ra, -0C (0) NRaRb, -OS02Ra, -0S02NRaRb, -SRa, -SORa, -S02R a, -S020Ra, -S02NRaRb, -NR ^ b, -N (Re) C (0) Ra, -N (Re) C (0) 0Ra, -N (Re) C (0) NRaRb, -N (Re ) S02Ra, -N (Re) S02NRaRb, -N (Re) S02- N (Re) C (0) 0Ra, -C (0) Ra, -C (0) 0Ra, -C (0) NRaRb, naphthenic Group, the second cycloalkenyl group, heterocyclic group, aryl group, heteroaryl group and ethylenedioxy group; wherein each alkyl group, alkenyl group and beadyl group are independently substituted by 0, 1, 2 or 3 substituents, Substituents are independently selected from the group consisting of cyano, formate, thio, nitro, keto, -ORa, -0C (0) Ra, -0C (0) 0Ra, -0C (0) NRaRb, -0S02Ra, -0S02NRaRb , -SRa, -SORa, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -N (1) (3 (0) ϊς, -N (Re) C (0) 0Ra, _N (Re) C (0) NRaRb, -N (Re) S02Ra, -N (Re) S02NRaRb alkyl, second cycloalkenyl, heterocyclic, aryl, and heteroaryl; where Ra, Rb, and Re are all defined herein, and where cyclic Alkyl, second cycloalkenyl, heterocyclic-20- 89166 200427678, aryl and heteroaryl may be substituted with 0, 1, 2 or 3 substituents, the substituents are independently selected from the group including -OH, -〇 ( (Alkyl), alkyl, alkenyl, block, cyano, methyl, keto, keto, alkoxy, alkoxy, Group, keto group, -nh2, · N (Η) (alkyl), -N (alkyl) 2, -C (0) 0H, -C (0) 0 (alkyl), -C (0) NH2, -C (0) N (H) (alkyl) and -C (0) N (alkyl) 2. As used herein, the term "cycloalkenylalkyl" refers to a cycloalkenyl group attached to the parent molecular moiety through an alkyl group. As used herein, the term "π-cycloalkyl" refers to a saturated monocyclic, bicyclic, or tricyclic fe 'system having three to fourteen carbon atoms and zero heteroatoms. Examples of cycloalkyl include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, bicyclo [3.1.1] heptyl, 6,6-dimethylbicyclo [3.1.1] heptyl Base, gold steel alkyl, etc. The cycloalkyl group of the present invention may be substituted by 0, 1, 2, 3, 4 or 5 substituents. The substituents are independently selected from the group consisting of alkyl, fluorenyl, block, cyano, formamyl, halo, and nitrate. Base, keto, -ORa, -0C (0) Ra, -0C (0) 0Ra, -0C (0) NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -SORa, -S02Ra, -S020Ra, _S02NRaRb,- NRaRb, -N (Re) C (0) Ra, -N (Re) C (0) 0Ra, -N (Re) C (0) NRaRb > ^) 802 ^ ^ -N (Re) S02 NRa Rb ^ -N (Re) S02-N (Re) C (0) 0Ra, -C (0) Ra, -C (0) 0Ra, -C (0) NRaRb, second cycloalkyl, cycloalkenyl, hetero Ring, aryl, heteroaryl, and ethylenedioxy; each alkyl, fluorenyl, and alkynyl are independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of cyano, methyl Fluorenyl, i-based, nitro, keto, -0Ra, -0C (0) Ra, -0C (0) 0Ra, -0C (0) NRaRb, -0S02Ra, -0S02NRaRb, -SRa, -S0Ra, -S02Ra , -S020Ra, -S02NRaRb, -NRaRb, -N (Re) C (0) Ra, -Wind1) < 3 (0) 01 ^, -N (Re) C (0) NRaRb, -N (Re) S02Ra, -N (Re) S02NRaRb 89166 -21-200427678 Two cycloalkyl, cycloalkenyl, heterocyclic, aryl and heteroaryl groups; Ra, Rb and Re are all included in this article Meaning, and wherein the second cycloalkyl, cycloalkenyl, heterocyclic, aryl, and heteroaryl group may be substituted with 0, 1, 2 or 3 substituents, the substituents are independently selected from -OH, -0 ( Alkyl), alkyl, alkenyl, decyl, cyano, methylol, halo, halooxy, halo, nitro, keto, _NH2, -N (H) (alkyl) , -N (fe group) 2, -C (0) 0H, -C (0) 0 (alkyl), _c (〇) NH2, -C (0) N⑻ (alkyl), and -C (0) N (Alkyl) 2. As used herein, the term "cycloalkenylalkenyl" refers to a cycloalkyl group attached to the parent molecular moiety through an alkenyl group. As used herein, the term "cycloalkylalkylπ" refers to a cycloalkyl group attached to the parent molecular moiety through an alkyl group. As used herein, the term "formamyl" refers to- CHO. As used herein, the term "formamyl group π" refers to a formamyl group connected to the parent molecular moiety through an alkyl group. As used herein, the term "base" refers to F, C1 The term "isalkoxy" as used herein refers to a haloalkyl group attached to the parent molecular moiety through an oxygen atom. The "haloalkoxy group" as used herein The term " refers to an alkoxy group attached to the parent molecular moiety through an alkyl group. The term πhaloalkylπ, as used herein, refers to a fluorenyl group substituted with one, one, one, two, or four halogen atoms. As used herein, the term "heteroaryl" refers to an aromatic five- or six-membered ring, 89166-22-200427678, wherein at least one atom is selected from the group consisting of N, 0, and S, and the remaining atoms are carbon. The term `` heteroaryl '' also includes bicyclic systems where the heteroaryl ring system is fused to a phenyl group, a monocyclic cycloalkyl group as defined herein, a heterocyclic group as defined herein Or another heteroaryl. The term `` heteroaryl '' also includes tricyclic systems in which a bicyclic system is fused to a phenyl group, a monocyclic cycloalkyl group as defined herein, a heterocyclic group as defined herein Or another heteroaryl. Heteroaryl is attached to the parent molecular moiety through any substitutable carbon or nitrogen atom in the group. Examples of heteroaryl groups include benzopyrimyl, benzoxazolyl, benzimidyl, benzozidine, dibenzocarbanyl, dihydrobenzofluorenyl, crocanyl, Mimiji, 4 丨 Junji, ^ 丨 Jiji, Yii 丨 Jiji, Izaki Junji, Izakirin, Izakiji, Sakijiji, Sakikiji, Makiji, Stilbene p ratio, stilbene group, trisyl group, p 17 stilbyl group, stilbene group, tetratyl group, estrogen group, taffinyl group, strontium group, p ratio p well group, p ratio ρ Billykey, Jun Linji, tetrahydro ρ quelinyl, tetrahydro p dianyl, triple ρ well-based and so on. The heteroaryl group of the present invention may be substituted with 0, 1, 2, 3, 4 or 5 substituents, and the substituents are independently selected from the group consisting of alkynyl, alkynyl, alkynyl: yl, aryl, methylS & yl, halo, Nitro, keto, ORa, -0C (0) Ra, _0C (0) 0Ra, -0C (0) NRaRb, -0S02Ra, -OS〇2 NR ^ Rb, -SRa, -SORa, -S〇2 Ra, -S〇2 〇Ra, -S〇2 NRa R_b, -NRaRb > -N (Re) C (0) Ra ^^) 0 (0) 0 ^ > ^-N (Re) S02Ra,- N (Re) S02NRaRb, -N (Re) S02N (Re) C (0) 0Ra, _C (0) Ra, -C (0) 〇Ra, -C (0) NRaRb, cycloalkyl, cycloalkenyl, Heterocyclic, aryl, and second heteroaryl; each alkyl, alkenyl, and alkynyl are independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of cyano and formamyl , Halo, nitro, keto, -〇Ra, -〇C (0) Ra, -0C (0) 0Ra, -0C (0) NRaRb, 89166 -23- 200427678 -OS〇2 Ra, -〇S 〇2 NRa Rb, -SRa, -SORa, -S〇2 Ra, -S〇2 ORa, -S〇2 NRa Rb, -NRaRb, -NCRJCCCORa, -N (Re) C (〇) 〇Ra, -N (Re) C (0) NRaRb, -N (Re) S02Ra > -N (Re) S02NRaRb > -N (Re) S02 Ν (ΐς) C (0) 0Ra > -C (0) K,- C (0) 0Ra, -C (0) NRaRb, naphthenic , Cycloalkenyl, heterocyclic, aryl, and second heteroaryl; wherein Ra, Rb, and Re are all defined herein, and where the second heteroaryl, aryl, cycloalkyl, cyclofluorenyl, and The heterocyclic ring may be independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of -OH, -0 (alkyl), alkyl, alkenyl, decanyl, cyano, formamyl, and fluorene Radical, || alkoxy, haloalkyl, nitro, -NH2, -N (H) (alkyl), -N (alkyl) 2, -C (0) 0H, -C (0) 0 (alkane Group), -C (0) NH2, -C (0) N (H) (alkyl), -C (0) N (alkyl) 2, and keto. In addition, nitrogen heteroatoms may be quaternized or oxidized to N-oxides as appropriate. Nitrogen-containing rings may also be N-protected, as appropriate. As used herein, the term "heteroarylalkenyl" refers to a heteroaryl group attached to the parent molecular moiety through an alkenyl group. As used herein, the term "heteroaralkyl" refers to a heteroaryl group attached to the parent molecular moiety through an alkyl group. As used herein, the term "heteroarylsulfonyl" refers to a heteroaryl group attached to a moiety of a parent molecule through a sulfonyl group. A π heteroarylsulfonylalkyl group, as used herein "The term refers to a heteroarylsulfonyl group attached to the parent molecular moiety through an alkyl group. As used herein, the term `` heterocycle '' refers to a cyclic, non-aromatic saturated or partially unsaturated tri-, tetra-, penta-, penta-, or tri-membered ring containing at least one member selected from the group consisting of Atoms of oxygen, nitrogen, and sulfur. The term "heterocycle" also includes bicyclic systems in which the heterocyclic ring system is a monocyclic ring fused to a phenyl group, as defined herein, 89166 -24- 200427678 cycloalkenyl , As defined herein, a monocyclic cyclic alkyl group or another monocyclic heterocyclic group. "Heterocyclic π — the word also includes a tricyclic system in which a bicyclic system is fused to a phenyl group, such as A monocyclic cycloalkenyl group as defined herein, a monocyclic cycloalkyl group as defined herein, or another monocyclic heterocyclic group. The heterocyclic group of the present invention is connected to the parent molecular moiety through any substitutable carbon or nitrogen atom in the group. Examples of heterocyclic groups include benzofluorenyl, dihydroindolyl, dihydropyridyl, 1,3-dioxolyl, 1,4-dioxolyl, 1,3-di Oxyfluorenyl, isoindolin, morpholin, hexahydropyryl, tetrahydropyrrolyl, tetrahydropyridyl, hexahydropyridyl, thiomorpholinyl, tetrahydrop-dranyl Base etc. The heterocyclic group of the present invention may be substituted by 0, 1, 2, 3, 4 or 5 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, amino, methylamino, halo, nitrate Base, isopropyl, -〇Ra, -0 (11 (0) ^^, -0C (0) 0Ra, -0C (0) NRaRb, -0S02Ra, _0S02NRaRb, -SRa, -SORa, -S02Ra, -S020Ra , -S02NRaRb, -NRaRb, -N (Re) C (0) Ra, -N (Re) C (0) 0Ra, -N (Re) C (0) NRaRb, -N (Re) S02Ra, -N ^ ) S02 NRa Rb, -N (Re) S02N (Re) C (0) 0Ra, -C (0) Ra, -C (0) 0Ra, -C (0) NRaRb, cycloalkyl, cycloalkenyl, & gt A second heterocyclic ring, aryl, heteroaryl and ethylenedioxy; wherein each alkyl, fluorenyl and alkynyl are independently substituted by 0, 1, 2 or 3 substituents, the substituents are independently selected Including chloro, formate, dentate, nitro, ketone !, -0Ra, -0C (0) Ra, -0C (0) 0Ra, -0C (0) NRaRb, -0S02Ra, _ 0S02NRaRb, -SRa,- SORa, -S02Ra, -S020Ra, -S02NRaRb, -NRaRb, -wind1) (: (Team 0, -N (Re) C (0) 0Ra, -I ^ RJCCCONRaRb, -N (Re) S02Ra > -N (Re) S02NRaRb ^ -N (Re) S02N (Re) C (0) 0Ra ^ -C (0) Ra > -C (0) 0Ra, -C (0) NRaRb, cycloalkyl, cycloalkenyl, Second heterocycle Aryl and heteroaryl 89166 -25- 200427678 groups, where d, d and d are defined herein, and cycloalkyl, cycloalkenyl, second heterocyclic, aryl and heteroaryl can be independently 0 , 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of -OH, -O (alkynyl), alkyl, alkenyl, alkynyl, cyano, methylamino, -yl, alkoxy Base, alkynyl, nitro, keto, _NH2, -N (H) (alkyl), -N (alkyl) 2, -C (0) 0H, -C (0) 0 (alkyl), -C (0) NH2, -C (0) N (H) (burned group), and -C (0) N (alkyl) 2. In addition, nitrogen heteroatoms may be quaternized or oxidized to N_oxidation as appropriate. Nitrogen-containing heterocycles may optionally be N-protected. The term "heterocyclenyl," as used herein, refers to a heterocyclic group attached to the parent molecular moiety through an alkenyl group. Herein The term "heterocycloalkyl" as used herein refers to a heterocyclic group attached to the parent molecular moiety through an alkyl group. The term "heterocyclic carbonyl" as used herein means such as A _ring 'as defined herein is appended to the parent molecular moiety through a carbonyl group as defined herein. Representative examples of heterocyclic carbonyl groups include, but are not limited to, tetrahydropyrrolylcarbonyl and hexahydropyridylcarbonyl. As used herein, the term "hydroxy" is used to refer to -OH. As used herein, the term "hydroxyalkyl" refers to an alkyl group substituted with at least one hydroxyl group. As used herein " Nitro π — The word refers to _N〇2. The term "nitroalkyl" as used herein refers to an alkyl group substituted with at least one nitro group. The term "keto group II" as used herein refers to. The term "thio group" as used herein refers to _s_. 89166 -26- 200427678 The term "sulfinyl" as used herein refers to -so-. As used herein, the term "sulfofluorenyl" refers to -so2-. It should be understood that alkenyl, alkoxy, alkoxyalkoxy, alkoxyalkoxyalkyl, alkoxyalkane Alkyl, alkoxycarbonyl, alkoxycarbonylalkyl, alkyl, alkylcarbonyl, alkylcarbonylalkyl, alkynyl, alkylthio, alkylthioalkyl, alkylidene acid Alkyl, alkynyl, alkynyl, tigeryl, arylfluorenyl, arylalkoxy, aralkyl, aryloxyalkyl, arylthioalkyl, arylsulfonyl Alkyl, carboxyalkyl, cyanoalkyl, cycloalkenylalkyl, cycloalkenylalkenyl, cycloalkylalkyl, methylaminoalkyl, || Base, heteroarylalkenyl, heteroaralkyl, heterosulfofluorenylalkyl, heterocyclofluorenyl, heterocycloalkyl, hydroxyalkyl, and nitroalkyl may be optionally substituted. In the first specific embodiment In the present invention, the compound of formula (I) is provided

Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, and heteroaryl And heterocyclic ring; R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl-27- 89166 200427678, alkylcarbonylalkyl, alkylthioalkyl, alkylsulfinyl Alkyl, alkylsulfonylalkyl, alkynyl, aryl, arylfluorenyl, aralkyl, arylthioalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, Cycloalkenyl, cycloalkenylalkyl, cycloalkenyl, (cycloalkyl) alkenyl, (cycloalkyl) alkenyl, methylaminoalkyl, alkoxyalkyl, haloalkyl, heteroaryl , Heteroarylalkenyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl- , RaRbNC (0) alkyl-, RaRbNCCCOO alkyl-, RaRbNC (0) NRc alkyl-, RfRgC = N- and RkO-, where R1 is independently substituted by 0, 1, 2 or 3 substituents, substituents Independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, Halo, cyano, nitro, haloalkyl, i-alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkylXNReRe), -SRC, -S (0) Rc, -S (0) 2Rc, -〇RO, -NdXRe), < (0) &, -C (0 ) 0Rc and -C (0) NReRe; R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, aralkyl, heteroaryl, hetero Ring, heteroaralkyl, cyano, halo, / N (Ra) (Rb), RaRbNC (0)-, -SRa, -S (0) Ra, _S (0) 2Ra and RaC (0)-; Wherein R2 and R3 are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from Ra, alkyl, alkenyl, decanyl, keto, halo, cyano'nitro, haloalkane Group,-(alkyl) (ORk),-(alkyl) (1¾¾), -SRa, -S (0) Ra, -S (0) 2Ra, _〇Rk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra and -C (0) NRaRb; or, R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, Cycloalkyl, heteroaryl and heterocyclic ring, wherein the aryl group 89166 -28- 200427678, cycloalkyl, heteroaryl and heterocyclic ring system Case is substituted by (R6) m; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, dentyl, hydroxyl, RaRbN-, N3-, and ReS-, where R4 is independently 0, 1 or 2 substituents are substituted, the substituents are independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -COOH; R5 is independently selected from each group including alkenyl, alkoxy, and alkyl , Alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidealkyl, formamyl, halo, haloalkyl, halocarbon, heteroaryl, heteroaralkyl, heterocyclic , Heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, 11 ^] ^, RaC (0)-, RaS-, Ra (0) S_, Ra (0) 2S -, RaRbN alkyl-, 1 ^ (0) 3 wind center)-, RaS02N (Rf), Ra (0) SN (Rf) alkyl-, K ^ 02N (ΙΙ £) alkyl-, RaRbNS02N (Rf )-, RaRbNS02N (Rf) alkyl-, RaRbNC (0)-, Rk0C (0), Rk0C (0) alkyl-, RkO alkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano Base, nitro, lS alkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (0),-(alkyl XNReRd), -S &, 4 (0) 1 ^, -S (0) 2Rc, -0 &, -N ^ XRd), -CCO)! ^, -C (0) 0R ^ -C (0) NRcRd ; R6 is independently selected from each group including alkyl, alkenyl, alkynyl, halo, cyano, nitro, iS alkyl, iS alkoxy, aryl, heteroaryl, heterocyclic, aromatic Alkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (0Rk),-(alkyl) (1¾¾), -SRa, 4 (0) ¾, -S (0) 2Ra, -0Rk, -N ^ XRb), -C (0) Ra, -C (0) 〇Ra, and -C (0) NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents 89166 -29- 200427678 The substituent is independently selected from the group consisting of alkyl, alkenyl, block, keto, fluorenyl, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C ( 0) 0Ra, -C (0) NRaRb, and · N (: (0) ΐς;

Ra and Rb are each independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylthioalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cyclofluorenyl, and cycloolefin Alkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methylaminoalkyl, haloalkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heterocyclic, heterocyclic Alkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-, RkO alkyl-, ReRdN alkyl-, ReR ^ NCCO) alkyl-, RcS02-, ReS02 alkyl-, RcC (0)-, ICXO) alkyl-, & 0: 0:-, RcC (0) alkyl-, I ^ RdN alkyl C (O)-, I ^ RdNCCO)-, RcRdNC ( 0) 0 alkyl-, ReRdNCCCON ^) alkyl-, wherein 1 and 1 ^ are substituted with 0, 1 or 2 substituents, and the substituents are selected from the group consisting of alkyl, fluorenyl, decyl, keto, and south , Cyano, nitro, haloalkyl, i-alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORe ),-(AlkylXNI ^ Rd), -SRe, 4 (0 team, -S (0) 2Rc, 0 &, -N ^ XRd), -C (0) Rc, seven (0) 0, and- C (0) NRcRd; or, ^ connected to the heart and their nitrogen The atoms together form a three- to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic rings, wherein the heteroaryl and heterocyclic ring systems are independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group including alkane Alkyl, alkenyl, alkynyl, keto, dentyl, cyano, nitro, 1S alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxy Alkoxyalkyl,-(alkyl) (〇R〇),-(alkylXNRcRd), -alkyl S02NReRd, -alkyl C (0) NReRd, -SRC, name (0), name (0 ) 2 \, -0 &, -NdXRd), < (0) 1 ^ 89166 -30- 200427678 Heart and Rd are independently selected at each place where they are selected from hydrogen, -NRfRh, -ORf, -CO (Rf) , -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, _C (0) 0Rf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cyclo Fluorenylalkyl, aryl, aralkyl, i-alkyl, heteroaryl, heteroaryl, heterocyclic, and heterocycloalkyl; each of which is independently replaced by 0, 1, 2, or 3 Group substitution, the substituent is independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, haloalkyl, haloalkoxy, Aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (0Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -NCRJSC ^ NRfRh, -N (Re) C (0) NRfRh, -alkylN (Re) C (0) ORf, -alkylN (Re) S02 NRf Rh and -alkylN (Re) C (0) NRf Rh; or, the heart and the heart and the nitrogen atom to which they are attached form a three- to six-membered ring, selected from the group including heteroaryl And heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, keto, cyano, nitrate Group, haloyl, halooxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-( Alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -0Rf, -N (Rf) (Rh), _C (0) Rf, -C (0) 0Rf, and- C (0) NRfRh;

Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg and Rh are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocyclic, heterocycloalkyl, heteroaryl and heteroarylalkyl; each of Rf, Rg 89166 -31-200427678 and Rh are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of Alkyl, alkenyl, alkynyl, cyano, halo, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH -O (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl , -Alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl ), -Alkyl S (0) (alkyl), -alkyl S02 alkyl, -N (H) C (0) NH2, -C (0) 0H, -c (o) o (alkyl), -C (O) alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, Rf, together with Rg and the carbon atom to which they are attached, form a three- to seven-membered ring selected from cycloalkyl, cyclofluorenyl, and heterocyclic rings; or : ^^! ^ Forms a three- to seven-membered ring together with the nitrogen atom to which they are connected, selected from the group consisting of heterocyclic rings and heteroaryl groups; wherein each heterocyclic ring and heteroaryl group are independently substituted by 0, 1, 2 or 3 substituents Substitution, the substituent is independently selected from the group consisting of alkyl, fluorenyl, decyl, cyano, iS, keto, nitro, aryl, aryl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl , Heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl) , -S (0) (alkyl), -alkylrOH, -alkyl · 0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS (alkyl) , · Alkyl S (0) (alkyl), -alkyl S02 alkyl, -alkyl N (alkyl) 2, -n (h) c (o) nh2, -C (0) 0H, < (〇) 〇 (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (Alkyl) 2;

Rk is selected from the group consisting of fluorene, alkenyl, alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, methylaminoalkyl , Self-alkyl, heteroaryl, heteroaryl, heterocyclic, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl 89166 -32- 200427678, RaS-, RaS (0)-, RaS02-, RaS alkyl-, Ra (0) S alkyl-, 1 ^ 802 alkyl-, I ^ OCXO)-, Ra0C (0) alkyl -, RaC (0)-, RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, and keto , Halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl ) (〇Rc),-(alkyl) (^ ¾), -SRC,, -S (0) 2Re, -0RC, -NdXRd), -C (0) Rc, -C (0) 0Rc, and _C (0) NRcRd; m is 0, 1, 2, 3, or 4; and n is 0, 1, 2, 3, or 4; with the proviso that when A is a monocyclic ring other than the following

And R4 is alkoxy, aryloxy, hydroxy, or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, I®, heteroaryl, heterocycloalkyl, Cycloalkyl, cyano, nitrate *, RaRbN-, RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaS02N (Rf)-, RaRbNC (0)-, Rk0C ( 0)-, RaRbNS02- or -0Rk, and R6 is hydrogen, alkyl, alkenyl, alkyl, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa, _S (0 ) Ra, -S (0) 2Ra, _0Rk, _N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra & -C (0) NRaRb, then R1 is not hydrogen or alkenyl , Alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, hetero Aralkyl, heterocycloalkenyl or heterocycloalkyl; and with the additional condition that when A is 89166

-33- 200427678 and R4 is hydroxyl or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -0Rk 'and R6 is hydrogen, alkyl, fluorenyl, alkynyl, (I, cyano , Nitro, aryl, heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) When Ra, seven (0) 0 and _ (:( 0) are accepted, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (Cycloalkyl) fluorenyl, (cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocyclic fluorenyl, or heterocycloalkyl. For example, the present invention provides compounds of formula ① Where A is a monocyclic ring and is selected from the group consisting of aryl and heteroaryl. For example, the present invention provides a compound of formula ① where A is a bicyclic ring and is selected from the group consisting of heterocyclic and heteroaryl. For example, the present invention The invention provides a compound of formula ①, wherein A, phenyl, phenyl, isopropyl, benzo, indazolyl, benzimidazolyl, benzothiazolyl, benzoxazolyl, benzoisoxyl, Benzoisofluorenyl, benzodecyl, benzoredoxinyl, such as linyl, isofluorenyl, and m Iso, tetrazyl, and isopropyl. For example, the present invention provides a compound of formula (1), in which-it is expected to join a carbon atom to form a five- or six-membered ring, selected from the group consisting of 7 "Mulanyl" Pyryl, imidyl "No. Junji" Sethyl, Iso, μ P Li: base "Bythyl" and "Dithyl, Trithyl" Sethyl, phenyl , Pyridyl, targyl, and pyrimidinyl. For example, the present invention provides compounds of formula (1), in which r3 and their attached 89166 -34- 200427678 are joined with < carbon atoms to form a cycloalkyl ring. For example, ' The present invention provides compounds of formula ①, in which 圮 forms a cyclopentyl or cyclohexyl ring with R3 and their attached carbon atoms. For example, 'The present invention provides compounds of formula ①, wherein ^ and trans 3 are independently selected from (Including hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, arylmethyl, heteroaryl, heterocyclic, heteroaralkyl, cyano, halo, and rhyme) ( Heart), RaRbNC (0) _, -SRa, -S (0) Ra, -S (0) 2Ra, and Rac (0)-; where 1 ^ 2 is independently replaced by 0, 1, 2 or 3 Substituent substitution Self-contained group, radical group, block group, keto group, halo group, cyano group, ceryl group, alkynyl group, (alkynyl group) (ORk), valenyl group (NRaRb), _SRa, _s (〇) Ra, _s (〇) 2Ra, -〇Rk, MRaXRb), -C (0) Ra, -C (〇) 〇Ra, and -C (0) NRaRb. For example, the present invention provides a compound of formula (I), wherein R4 is a hydroxy group, a! I group, -NH2, -Li (alkyl), -N (alkyl) 2, -N (H) NH2, extrinsyl, or alkyl) or Rq S-. For example, the present invention provides compounds of formula (I), wherein A is aryl, and R2 forms a five- or six-membered ring together with R3 and the carbon atom to which they are attached, and is selected from the group consisting of phenyl, eodoyl, Pyrimidinyl, daphnyl, pyrimidinyl, furanyl, pyrazolyl, stilbenzyl, sialyl, isosinyl, isopsyl, triazolyl, hydradiazolyl, Tetrazolyl, cyclopentyl and cyclohexyl. For example, the present invention provides a compound of formula (I), wherein A is phenyl, and R2 forms a five- or six-membered ring together with R3 and the carbon atom to which they are attached, selected from the group consisting of phenyl, pyridyl, and pyrimidine Base, daphthyl, sephenyl, furyl, pyrazolyl, pyridinyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, Cyclopentyl and cyclohexyl. 89166 -35- 200427678 3 ^ The present invention provides compounds of formula (I), wherein A is phenyl, and R2, together with R and the carbon atom to which they are attached, are pyridyl. 3 4 The present invention provides a compound of formula (I), wherein A is phenyl, and R 2 together with R and the carbon atom to which they are attached is a pyrimidinyl group. ] If the present invention provides a compound of formula (I), wherein A is a heteroaryl group, and R 2 /, R and the carbon atom to which they are attached together form a five- or six-membered ring, selected from the group consisting of p Base, p dense lake base, targonyl, p cephenyl, cromanyl, exoyl, pyrazolyl, oxazolyl, oxazolyl, imidazolyl, isoxazolyl, isoselenyl, Diazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl. ] According to the present invention, a compound of formula (I) is provided, wherein A is a phenanyl group, and R2 /, R and the carbon atom to which they are attached together form a five- or six-membered ring selected from the group consisting of phenyl and pyridyl , Pyrimidinyl, daphnyl, pyrenyl, furanyl, pyrrolyl, pyrazolyl, oxazolyl, oxazolyl, imidazolyl, isoxazolyl 'isoxazolyl, oxadiazolyl, oxadiazolyl Group, tetrazolyl, cyclopentyl and cyclohexyl. ^ The present invention provides a compound of formula (I), wherein A is a farphenyl group, and R2 forms a benzene ring together with R and the carbon atom to which they are attached. For example, the present invention provides a compound of formula (I), wherein A is pyrimidinyl, and R2, together with R3 and the carbon atom to which they are attached, are pyridyl. For example, the present invention provides a compound of formula (I), wherein A is pyridyl, and R2 forms a five- or six-membered ring together with R3 and the carbon atom to which they are attached, selected from the group consisting of phenyl, Pyrimidinyl, daphnyl, thienyl, furyl, pyrrolyl, pyrazolyl, indazolyl, thiazolyl, imidazolyl, isoxazolyl, isopyrazolyl, triazolyl, thiadiazolyl, tetra Oxazolyl, cyclopentyl and cyclohexyl. For example, the present invention provides a compound of formula (I), wherein A is p-pyridyl, and r2 89166 -36- 200427678 forms a pyridyl ring together with R3 and the carbon atom to which they are attached. For example, 'The present invention provides a compound of formula ①, wherein A is phenyl, sulfenyl, pyridyl, imidazolyl, benzoxazolyl, benzofluorenyl, or benzimidazolyl' and R and R are independently selected Including hydrogen, alkyl, aryl, alkynyl, alkoxycarbonyl, alkyl, aryl, aralkyl, heteroaryl, heterocyclic, heteroaralkyl, cyano, halo, -N ( Ra) (Rb), RaRbNC (0)-, -SRa, _S (〇) Ra, -S (0) 2Ra, and R ^ O)-; where R2 and r3 are independently replaced by 0, 1, 24; 3 Substituents, the substituents are independently selected from the group consisting of &, alkyl, alkenyl, block, keto, halo, cyano, nitro, haloalkyl, < alkyl) (〇Rk), amidino , -SRa, -S (0) Ra, -S (0) 2Ra, -0Rk, -N (Ra) (Rb), ((〇) Ra, c (〇) 〇Ra, and -C (0) NRaRb. a For example, the present invention provides compounds of formula ①, wherein R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of pyrenyl, furyl, pyrrolyl, imidazolyl, fluorene Oxazolyl, thiazolyl, isoxazolyl, isothiazolyl, pyrazolyl, pseudodiazolyl, triazolyl, thiadiazolyl, tetrazolyl, P is more than ytyl, thawyl, and ytyl, and R4 is meridian. In yet another embodiment, the present invention provides compounds of formula ①, wherein A is pyridyl, phenyl, thienyl, Imidazolyl, benzimidazolyl, benzimidazolyl or benzylidene, R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from phenyl, thienyl, pyrazole Group, pyridyl group, oral cough group: or daphnyl group, and R4 is a hydroxyl group. 3 For example, the present invention provides a compound of formula (1) in which A is a fluorenyl group; R2 is together with the carbon atom to which they are attached And an & 4 is a light group. For example, 'The present invention provides a compound of formula ①, wherein A is pyridyl, phenyl 89166-37-200427678, pyridyl, imidazolyl, benzoxazolyl , Benzimidazolyl or benzofluorenyl, R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkynyl, aryl, aralkyl, and heteroaryl , Heterocyclic, heteroaryl, cyano, dentino, -N (Ra) (Rb), RaRbNC (0)-, -SRa, -SCO)! ^, -S (0) 2Ra and Ra C (0 )-; Where R2 and R3 are independently 〇, i, 2 or 3 Each substituent is substituted, and the substituent is independently selected from Ra, alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, haloalkyl,-(alkyl) (〇Rk),-( Alkyl) (^ ¾), _SRa, -S (0) Ra, -S (0) 2Ra, _〇Rk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra And C (0) NRaRb; and R4 is a hydroxyl group. For example, the present invention provides a compound of formula (I), in which A is pyridyl, phenyl, fluorenyl, imidyl, benzimidazolyl, benzazolyl or benzyl, and R2 and R3 and The carbon atoms to which they are attached together form a five- or six-membered ring selected from the group consisting of phenyl, p-pyridyl, p-sedenyl, pyrimido, ethenyl, targonyl, cyclohexyl, or cyclopentyl R4 is a hydroxyl group, and Ri is selected from the group consisting of fluorene, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, aralkyl, carboxyalkyl, and cyanoalkyl Base, cycloalkenyl, cycloalkenylalkyl, cycloalkenyl, cycloalkylalkenyl, cycloalkylalkyl, methylamino, haloalkyl, heteroarylalkenyl, heteroaralkyl, hetero Ring, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, R ^ N-, RaRbN alkyl, RaRbNC (0) alkyl-, RfRgC = N- and

Rk 0- 〇 Exemplary compounds of the first embodiment of the present invention of formula (I) include, but are not limited to, the following: 1- [2- (1-cyclohexene_1-yl) ethyl] each (1, 1_Dioxide_4H-1,2,4-benzopyrene-3-yl) -4-¾yl-1,8-pyridine_2 (1H) _one; 89166 -38- 200427678 [3 -(l, l-dioxide-4H-1,2,4-benzopyrene_3-yl) aspartyl-2-keto-1,8-piperidine-1 (2H) -yl] Ethyl acetate; 1- (3-anilinopropyl) _3_ (1,1_dioxide_4H_1,2,4-benzopyridine), 4-hydroxy-1,8-pyridine-2 (1H) -one; 3- [3_ (1,1-monoemulsified-4H-1,2,4-dongno-pisedion-3-yl) _4-lightyl-2-fluorenyl-1, 8-pyridine-1 (2H) -yl] propanal; 1- [3- (dimethylamino) propyl] -3- (1,1-dioxide-4H-1,2,4-benzopyrimidine Digenyl-3-yl) -4-hydroxy-1,8-pyridin-2 (1H) -one; 1- {3-[[2- (dimethylamino) ethyl] (methyl) amino ] Propylbu 3_ (1,1-dioxide_411-1,2,4_benzopyrimidin-3-yl) -4-pyridyl-1,8_pyridine · 2 (1Η) _one; 1- (2-aminoethyl) -3- (1,1-dioxo-4fluorene-1,2,4-benzo faromen-3-yl) -4-meryl-1,8 · 口奈 淀 -2 (1H) _ 酉 同 ； 1_ [3- (diethylamino Propyl] -3- (l, l-dioxide-4H-1,2,4-benzopyrimidin_3_yl) -4-hydroxy-1,8-piperidine-2 (1H) -one ; 1- (Ethoxy) each (1,1 · dioxide-4Η-1,2,4-benzopyrene-3-yl) -4 side group · 1,8-pyridine-2 (1Η)- Ketones; 1- (benzyloxy) -3- (1,1-dioxide-4Η-1,2,4-benzopyridine), hydroxy-1,8-pyridine-2 (1Η) -Ketone; 3- (1,1-dioxide-4fluorene-1,2,4-benzopyrimidin-3-yl) glacial hydroxyl-1-isobutoxy-1,8-pyridine-2 ( 111) -one; 1-benzyl-4-chloroyl (1,1_dioxide_4,1,2,4-benzopyrimidin-3-yl) _1,8_pyridin-2 ( 1Η) -one; 1-butyl " " 4-amino-3- (1,1_-emulsified-4H-1,2,4-benzo-p-sedi 1: 7-well-3-yl)- 1,8-oxanidin-2 (1H) -one; 89166 -39- 200427678 4-aminobutyl-3- (1,1-dioxide-4H-1,2,4_benzothiazine -3-yl) -1,8-piperidine-2 (1H) -one; 1-butyl each (1,1-dioxide-4H-1,2,4-benzopyrimidine) 4- (methylamino) _1,8-piperidine-2 (1H) · ketone; 1-butyl-4- (dimethylamino) -3- (1,1-dioxide-4H-1,2, 4-benzopyrimidine_3_yl) -1,8-piperidine-2 (1H) -one; 1-butyl-3- (l, l-di Oxidation of _4H-1,2,4-benzobenzodi-p-well-3-yl) hydrazinyl-1,8-kounanido-2 (1 Η) -Identical; 4-azido_1- Butyl-3- (1,1-dioxide-4fluorene-1,2,4-benzoxanthenyl diphenylene) -1,8_ pyridin-2 (1fluorene) -one; 1-butyl-3- (1,1-Dioxide-4Η-1,2,4-benzopyridine group) -4-[(2- # 垔 ethyl) amino] -1,8-pyridine_2 (1Η ) _Ketone; Ν- [3- (4-Hydroxyisopentyl-2-one group_1,2_dihydro_1,8-pyridinyl groups> 1,1_dioxide-4Η · 1 , 2,4-benzofluorenedimorphin_7_yl] -N,-(2-phenylethyl) sulfonamide; 3- [3hydroxyl_1-isopentyl-2-one-1 , 2-dihydro [1,8] pyridine groups) -1,1-dioxide-4fluorene-1,2,4_benzothiadinyl-7-yl] diazepine-l-carboxyl Benzyl acid 2,2-dioxide; _N- [3- (4-hydroxy-small isoamyl-2-one-1,2-dihydro [1,8] pyridin-3-ylfluorene, 1-Dioxide-4Η-1,2,4-Hydroxypyridine-7-yl] contanoic acid amine; 3- [3- (4-hydroxy-1-isopentyl-2-one- 1,2-dihydro [1,8] pyridinyl groups) -1,1_dioxide-4Η-1,2,4-ependorphin-7-yl] -1-propyldiazide Thiulan benzyl benzyl 2,2_ dioxide; Ν- [3 · (4-hydroxy_1_isoamyl Keto-1,2-dihydro [1,8] piperidine dumb! Group) -1,1 · Dioxo-4Η-1,2,4-benzopyrimidinium] · NLpropylsulfonamide; 89166 -40- 200427678 3- [3- (4-hydroxy_ι_ Isoamyl_2-keto · dihydro (^, p-pyridinyl dioxide-4Η-1,2,4 · benzopyrimidinyl group) diazepine + methyl carboxylate dioxide物 ； 3- [3- (4-hydroxy + isopentyl_2_one dihydrogen [丨 Allanidine; group y, i_dioxide-4H-1,2,4-benzothiazine_ 7-yl] diazathioarsine small carboxylic acid allyl 2,2-dioxide; 3- [3- (4-hydroxy small isoamyl_2_one group], 2-dihydro [u] Pyridine · 3 · yl ρ, ι_dioxide-4H-1,2,4-benzo, cedihexyl] diazepine luteol pouric acid 2-propanedioic dioxide; 3- [3 -(4-hydroxy + isopentyl-2_keto_ 丨, 2_dihydro [u] pyridin_3_yl}, 〖· Oxidation-deletion, 2,4-Benzobiene _ · 7 _Yl] diazepine + carboxylic acid 2-aminoethyl alcohol &dioxide; 3- [3- (4-hydroxy-fluorene-isopentyl_2 · keto_ 丨, 2_dihydro [丨 Doxidine_3_ylh, i_dioxide-4H-1,2,4-benzothiadinyl_7_yl] diazepine_ 丨 _carboxylic acid 2_ (trimethylsilyl ) Ethyl 2,2-dioxide; 3- [3- (4-Pentyl-1-isopentyl_2_one group, 2 Dihydro_piperidine · 3_yl ^, 丨 _dioxide-4H-1,2,4-benzopyrene-7-yl] diazepine-1-carboxylic acid benzyl 2,2_ Dioxide; 5 3- [3- (4-Hydroxyisopentyl-2-ketodihydro [benzidine] _ι, ι_dioxide-4Η-1,2,4_benzothiadi Gengdongji] Diazathiolupine small carboxylic acid methyl oxide; 5 3- [3- (4 · Hydroxyisoisopentyl_2_one group + 2 dihydro [berberidine_3_yl) _ι ， Ι_ Dioxide-4Η-1,2,4_benzothiadinyl-7_yl] small methyldiazathiourethane _ 丨 _ benzyl carboxylate ^ dioxide; 89166 -41- 200427678 N -[3- (4-Hydroxyisopentyl-2-keto-i, 2-dihydro [1,8] pyridin-3-yl) -1, l-dioxide-4H-1,2, 4-benzopyrimidin-7-yl] -N, -methylsulfonamide; 3- [3- (4-hydroxy-small isoamyl-2-one-l-1,2-dihydro [1, 8] Pyridin-3-yl) -1,1_dioxide-4H_1,2,4-private p-di-p-well-7.yl] diazepine-1, 2-acid 2-aminoacetamidine N2,2_ dioxide; N_cyclopentyl-N43- (4-light-based small isopentyl-2-one-1,2-dihydro [1,8] pyridin-3-yl oxide -4H-1,2,4-Benzo-P-sedi-p-well-7-yl] contamimonamine; N-cyclobutyl-N '-[3- (4- # f-based small isoamyl-2- Keto-1 , 2-dihydro [1,8] pyridin-3-yl) -1,1 · monoxide-4H-1,2,4-benzobenzodihex-7-yl] continuous S amine; N- [3- (4-hydroxy-1-isopentyl-2-one-1,2-dihydro [1,8] pyridin-3-yl) -1,1-dioxide-4H-1,2 , 4-Benzothiine-7-yl] -N,-(4-hexahydropyridyl) sulfonamide; N- (2-hydroxyethyl) -N,-[3- (4-hydroxy small Isoamyl-2-one-1,2-dihydro [1,8] peak pyridin-3-yl) -1,1-dioxide-4Η-1,2,4-benzopyrimidine-7 -Yl] sulfonamide; hydrazone ({[3- (4-hydroxy-1-isopentyl-2-one-l, 2-dihydro [1,8] peak pyridinyl) -1,1_ Dioxo-4Η-1,2,4-benzopyridine_7_yl] amino} sulfofluorenyl) amino] propanamide; Ν_ [3- (4 · hydroxy small isoamyl-2- Keto-1,2-dihydro [1,8] pyridin-3-yl) -1, 丨 -dioxide_4Η-1,2,4-benzothiadinyl-7-yl] small one nitrogen Tetramethylsulfonamide; 3-hydroxy-N- [3- (4-hydroxy-1-isopentyl-2-one-1,2-dihydro [1,8] 4 syndrome groups> 1, 1-Dioxide-4H-1,2,4_benzothiadinyl-7-yl] -1-monoazatetramethylsulfonamide; 3-amino-N- [3- (4-hydroxy-1 · Isopentyl-2-keto-1,2-dihydro [1,8] hydrazones > U-Dioxide-4 hydrazone-1,2,4-benzopyrimidine Morphine; yl] -1-tetrahydropyrrolidinesulfonamide; Ν- [3- (4-meryl_1_isopentyl_2 • keto-1,2-dihydro [1,8] hydrophile- 3-yl) -1,1 -Monoxide-4'-1,2,4-benzopyrene_7_yl] -1-hexahydropyridinesulfonamide; N-benzyl-N '-[3 -(4-Lauryl-1-isopentyl-2-one-1,2-dihydro [1,8] hydraulic groups) _ 89166 -42- 200427678 1,1-dioxide-4H-1, 2,4-benzopyrimidine_7_yl] sulfonamide; 3-[({[3- [4- (Hydroxyisopentylaspartyl-1,2-dihydro [1,8]) Pyridyl groups ^ 丨 Dioxane-4H-1,2,4-benzothiadinyl-7-yl] amino} sulfofluorenyl) amino] benzoic acid ethyl acetate; 3-[({[3- (4-Hydroxyisopentyl-2_keto · 1,2-dihydro [1,8] pyridin-3-yl) _1,1_dioxide-4Η-1,2,4_benzopyrimidine Ericao_7_yl] amino} sulfofluorenyl) amino] phenylarsinic acid; 3-[({[3- (4- # stemyl-1-isopentyl-2-one-1,2 -Dihydro [1,8] Yodo_3_yl) -1,1_dioxide-4Η-1,2,4-benzopyrimidin-7-yl] amino} sulfofluorenyl) amino ] Benzamidine; Ν- (2-aminoethyl) -N '-[3- (4-Cyclo-1-isopentyl-2-keto · 1,2-dihydro [i, 8 ] tr 奈 岸 -3-yl) -1,1-dioxide-4H-1,2,4-benzopyrimidine -7-yl] sulfonamide; 1-({[3- (4-hydroxy-1-isoamylaspartenyl-1,2-dihydro [1,8] pyridin_3_yl) -1 , 1-Dioxide-4H-1,2,4-Benzobi__7_yl] amino} acetic acid group) -3-Hexahydroanide ethyl acid; (2S) -l-({ [3- (4-Hydroxyisopentyl-2-one-1,2-dihydro [1,8] pyridinyl) -1,1-dioxide-4H-1,2,4-benzene Benzothiene-7-yl] amino} sulfofluorenyl) -2-tetrahydropyrrole carboxylic acid methyl ester; N-〇 (4-hydroxy-small isoamyl-2-one-1,2-dihydro [ 1,8] pyridin-3-yl) -1,1-dioxide-4H-1,2,4-benzothiadinyl-7-yl] small tetrahydropyrrolizidine; 3-hydroxy-N -[3- (4-Hydroxyisopentyl-2-one-1,2-dihydro [1,8] pyridin-3-yl) -U-dioxide-4H-1,2,4- Benzopyrimidine-7-yl] -1-hexahydropyridinesulfonamide; N- (2-creanylmethyl) -3- [3- (4- # 里 基 小 isopentyl-2- Keto-1,2-dihydro [1,8] peak lake-3-yl) -1,1-monoxide-4H-1,2,4-benzo p-di-p-well-7-yl] di Azathiourin-1-benzylamine 2,2-dioxide; 4-amino-6- (l, l-monooxide-4H-1,2,4-benzoP-cedi-3- ) -7-light-l-benzono [3,2-b] pyridin-5 (4H) -one; -43- 89166 2004276 78 6- (1,1-Dioxide-4H-1,2,4-benzothiadinyl-3-yl) -7 · chiyl-4- (isobutylamino) thieno [3,2 -b] pyridine-5 (4H) _one; -4H-1,2,4-benzo [tau] dihex-3-yl) -7-keto-4-{[(3S) -3- Methylcyclopentyl] amino} anhydro [3,2_b wind lake · 5 (4Η) -one; 4-{[1-cyclopropylethyl] amino group 6- (1,1-dioxide -4Η-1,2,4-benzopyridin-3-yl) -7- # ylpyrido [3,2-b] pyridin-5 (4Η) -one; 4- (butylamino ) -6- (1,1-Dioxide-4Η-1,2,4-benzopyridine_3 · yl) _7_ylpyrimo [3,2-b] pyridine-5 (4Η) _Ketone; 6_ (1,1_dioxide-4Η1,2,4-benzopyrene_3_yl) _4 _ [(2_ethylbutyl) amino] -7-hydroxypyrimido [3 , 2-b] pyridine-5 (4Η) -one; 6- (1,1-dioxide-4Η-1,2,4-benzothiadinyl_3-yl) -7-hydroxy-4- (pentyl Amine group) Pyridino [3,2-b] pyridine-5 (4H) -pyridine; 6- (1,1-monooxide-4H-1,2,4_benzop-di-p-well-3 -Yl) -7-light group · 4-[(3-methylbutyl) amino] tetrabenzo [3,2-b] pyridin-5 (4Η) -one; 4-[(3,3_-1 Methylbutyl) amino] each (ι, μ dioxide 4η · 1,2,4-benzoρ plug diρ well-3-yl) -7_ Methylpyreno [3,2-b] pyridine-5 (4H) -one; 6- (1,1-dioxide-4fluorene-1,2,4-benzopyrimidin-3 · yl) -7 -Hydroxy-4-[(3-methylfluorenyl) amino] fluoreno [3,2-b] pyridin-5 (4H) -one; 6- (1,1-dioxide-4H-1,2 , 4-Benzopyrimidine groups) _7_hydroxy-4 _ [(2-methylbenzyl) amino group> Sepheno [3,2_b] p ratio-5 (4H) -one; 6- ( 1,1-dioxide-4H-1,2,4-benzopyrimidin-3-yl) -7-hydroxy-4-[(4-methylbenzyl) amino > cepheno [3, 2_b] Edian_5 (4H) _one; 6- (1,1-dioxide-4H_1,2,4-benzothiadimorph-3-yl) -7-hydroxy-4-[(3-methyl Buten-2-enyl) amino] tetrabenzo [3,2_bHpyridine · 5 (4Η) _one; 89166 -44- 200427678 6- (U-dioxide-4H-1,2,4-benzo All bases of thiadigenol) //-hydroxyl (propylamine), cepheno [3,2-b] edian-5 (4Η) -one; 6- (1,1-monoxide-4Η_1,2, 4-benzobenzothin-3-yl) -7-hydroxy_4-[(pyridin-4-ylmethyl) amino] thieno [3,2-b] pyridin-5 (4H) -one; 6- (1,1-Monoxide-4H_1,2,4-Benzodistoro · 3_yl) _7-Epiyl_4 _ [(pyridine_3_ylmethyl) amino] pyrimido [3 , 2Hepta] pyridine-5 (4Η) -one; 6- (1,1-dioxide_411-1,2,4_benzene Each group of thiacene) _7_hydroxy_4 _ [(pyridine_2_ylmethyl) amino] pyrimido [3,2-b] pyridin-5 (4Η) -one; 6- (11-—oxidation _4Η-1,2,4-benzopyrene-3-yl) -7-quinyl_4 _ [(3_methoxybenzyl) amino] lacpheno [3,2-b wind bite -5 (4H) -one; 6- (1,1-dioxide-4H-1,2,4-benzopyridine-3-yl) ice [(3-furylmethyl) amine]- 7-Aminopyrimido [3,2Hepta] eridine-5 (4H) _one; 3- ({[6- (1,1-Dioxide_4H-1,2,4-benzopyrene Phenan-3-yl) -7-hydroxy-5-keto farpheno [3,2hepta] pyridin-4 (5H) -yl] amino} methyl) benzonitrile; 6- (1,1- Nitric oxide_4H-1,2,4-benzopyridine group) -7-hydroxy_4-[(thiophene group methyl) amino] pyrimo [3,2-b] pyridine-5 (4H) -one; 4- (Cyclobutylamino) -6- (1,1-monooxide-4H-1,2,4-benzopyramidinyl) -7-side thieno [3 , 2-b] pyridine · 5 (4Η) -one; 4- (hexylamino) -6- (1,1_dioxide-4Η-1,2,4-benzopyrene_3_yl> > 7-old thieno [3,2-b] pyridine-5 (4Η) -one; 4 · [(cyclohexylmethyl) amino] -6- (1,1-dioxide-4Η-1,2, 4-benzopyridinyl) _ 7-hydroxythieno || 3,2-b] pyridine_5 ( 4Η)-嗣; 6- (1,1-Monoxide-4Η-1,2,4-benzothiadinyl groups) _7_hydroxyice [(丨, 3_thiazolylmethyl) amino group] Fluoreno [3,2-b] edian-5 (4Η) -one; 89166 -45- 200427678 4-[(3-merylfluorenyl) amino] _6- (1,1-dioxide_4H -1,2,4-benzothiadihu-3-yl) _ 7-borylpyreno [3,2-bwind lake-5 (4H) -pyridine; 4- (cyclohexylamino) -6- (1,1-dioxo-4H-1,2,4-benzopyrimidine_3_yl); thieno [3,2-b] pyridine_5 (4H) _one; 4- (Cyclopentylamino) -6- (1,1-dioxide-4H-1,254-benzothiadi__3_yl) -7-kilylidene [3,2-b] Command; Yodo-5 (4H) -one; 4- (cycloheptylamino) -6- (1,1-dioxide-4H-1,2,4-benzopyrene [3,2-b] pyridine-5 (4H) -one; 4_H_1,2,4-benzo-p-diazepton_3_yl), 7-light group_4 _ {[(lR, 3S) -3-methylcyclohexyl] aminobusetheno [3,2-b] E syndrome-5 (4H) -one; _4H_1,2,4-benzobenzodi-p_3_yl ) -7-Cyclo-4-{[(lR, 3R) -3-methylcyclohexyl] amino P sedeno [3,2seven > Biyodo-5 (4H) -one; 6- ( 1,1-dioxide-4H-1,2,4-benzothiadinyl-3-yl) -4-[(1- Propyl) amino] 7-hydroxythieno [3,2-b] pyridine 5 (4Η) -one; 6- (1,1-dioxo-4_-1,2,4-benzo Di__3_yl) -7-¾_4 _ {[1_phenylethyl] amino} fluoreno [3,2-b] pyridin-5 (4H) -one; -4H-1 , 2,4-Benzo-p-di__3_yl) -7-Cyclo-4-{[(lR) -1-methylbutyl] amino} pyrimo [3,2-b] pyridine -5 (4H) -one; 4- (cyclobutylamino) -6- (1,1-dioxide-4H-1,2,4-benzopyrimidinyl) -7- # Pyrido [3,2-b] pyridine-5 (4H) -one; 4-[(cyclopropylmethyl) amino] -6- (l, l-dioxide-4H-1,2,4 -Benzobenzodiaphthin-3-yl) _ 7-hydroxythieno [3,2-b] pyridine-5 (4H) -one; 2-({3- [4- (cyclohexylamino) -7 -Hydroxy-5-keto-4,5-dihydrothieno [3,2-b] pyridine-6-yl] -1,1-dioxide-4H-1,2,4-benzopyrene -7-yl} oxy) acetamidamine; 89166 -46- 200427678 N-({3- [1- (cyclobutylamino) _4-hydroxy_2_keto], dihydroquinolinyl] _u ^ oxidized-4H-carbobenzop, 3-e] [l, 2,4] carbodiaphthyl-7-yl} methyl) urea; 1-methyl-4-hydroxy-3- {7- [ (Methoxymethoxy) methyl] _u_dioxide_4H_pyrimido [2,3-e] [l, 2,4] pyrimidin-3- Quinoline-2 (1H) -one; 1- + yl-4-hydroxy-3- [7- (hydroxymethyl) -1,1-dioxide-4H-fluoreno [2,3-e] [ l, 2,4] pyrimidin-3-yl] quinoline-2 (1H) -one; 3- (1-cetyl-4-meryl-2-keto-1,2-dihydro p-quinone Lynn-3-yl) -4H-p cepheno [2,3-e] [l, 2,4] acetodigeny-7-renyl acid 1,1-dioxide; 3- (1-woo Phenyl-4-lightyl_2_keto-1,2-dihydrojunline_3.yl) -4H-p cepheno [2,3-e] [l, 2,4] u cephine -7-benzylamine 1,1_dioxide; 3-0 benzyl_4_hydroxy-2-keto_1,2_dihydroquinolin-3_yl) -N_ (2-hydroxyethyl ) -4H-benzopheno [2,3-e] [l, 2,4] pyrimidin-7_carboxamidine 1,1-dioxide; 3- (1-benzyl-4-hydroxy- 2-keto_1,2_dihydroquinolin-3-yl) -N-[(lS) -2_hydroxy-1- (aminofluorenyl) ethyl] -4H_nopheno [2, 3_e] [l, 2, Sedihu-7-side acid amine 1,1-dioxide; N- (2-amino-2-ketoethyl) -3- (1-fluorenyl-4- Lightyl-2-keto-1,2-dihydrop-quelin 3-yl) -4H-telepheno [2,3-e] [l, 2,4] pyrimidine 醯 Carboxamide 1 , 1-dioxide; 3- (1-wordyl-4_carboxy-2-keto-1,2-dihydro 4 U-yl) -N-[(lS) -2- # | group-1 -Methylethyl] -4H- ^ thiopheno [2,3-e] [l, 2, 4] p-di-p-well-7-metaamine 1,1-dioxide; 3- (1-charyl-4-carboxy-2-hexyl-1,2-dihydro-4lin-3- ) -N, N-bis (2-carboxyethyl) _4H-fluoreno [2,3-e] [l, 2,4] pyrimidine_7_carboxamidine 1,1_ dioxide Substance; 3- (1-methyl-4-enyl-2-keto-1,2-dihydroquinone-3-yl) -N- [2_ -4H-farpheno [2,3 <] [1,2,4] thiacide-7-carboxamide 1,1-dioxide; each of 1-benzyl hydroxy groups (7 _ {[(3R) -3-Hydroxytetrahydropyrrole-1-yl] carbonyl} _U_dioxy 89166 -47- 200427678 H-4H-pyrimido [2,3-e] [l, 2,4] pyrimidine-3- ) Quinoline-2 (1H) -one; 3- (1-cetyl-4-meryl-2-fluorenyl-1,2-dihydroρquilin-3-yl) propyl) -4H- p-thiopheno [2,3-e] [l, 2,4] pyrimidin-7-benzidineamine 1,1_dioxide; 3- (1-decyl-4-lightyl-2- Keto-1,2_dihydroρquelin-3-yl) -N _ [(2S) -2,3-dilightylpropyl] -4H-thieno [2,3-e] [l, 2 , 4] Thienogen-7-carboxamide U-dioxide; 3- (1-Hanyl-4-lightyl-2_S isoyl-1,2-dihydrojunin-3-yl) -N -[(lS) -l- (light methyl) propyl] -4H-pyrimido [2,3-e] [l, 2,4] pyrimidine-7-carboxamide U-dioxide ; 3- (1- Lord -4-Bentyl-2-keto-1,2-dihydrobiphenyl-3-yl) _N-[(lS) -1- (Borylmethyl) _2-methylpropyl] -4H- Pyrimido [2,3-e] [l, 2,4] pyrimidin-7-carboxamidine 1,1-dioxide; 3- (1. -1,2-dihydrojunin-3-yl) -N- [2-J% butyl] -4Η_βcepheno [2,3 <] [1,2,4] thienone-7-carboxyl Amidoamine 1,1-dioxide; 3- (1-benzyl-4-hydroxy-2-keto-1,2 · dihydroxanthenyl groups> N- [2- meridyl-2- ( 4-hydroxyphenyl) ethyl HH-pyrimo [2,3-e] [l, 2,4] thiadigon-7-carboxamido 1,1-dioxide; 1-fluorenyl-3 -[l, l-dioxide_7_ (external hexahydro: _ -1_yldanyl) -4Η-ρ cepheno [2,3_e] [1,2,4 > ] -4-Based π Lin-2 (m) -one; N-〇 (aminocarbonyl) pyridin-2-yl] -3- (1-benzyl-4-hydroxy-2-keto-1 , 2-dihydroquinoline groups) -4H-pyrimido [2,3-e] [l, 2,4] pyrimidino-7-carboxamide 1,1 · dioxide; Yueshiji Formic acid [3- (1-fluorenyl-4-meryl-2-S isopropyl-1,2-dichlorojunin-3-yl) -1,1-dioxide-4H-thieno [2,3 -e] [l, 2,4] pyrimidin-7-yl] methyl ester; aminocarbonylcarbamic acid [3- (1-benzyl-4-hydroxy-2-keto-1,2-di Hydroquinoline | yl) -1,1-dioxide-4H-thieno [2,3-e] [l, 2,4] pyrimidin-7-yl] methyl ester; 3- [7- (stack Aminomethyl H, l-dioxide-4H-fluoreno [2,3-e] [l, 2,4] thienone! H-octyl-4_boryl Junlin-2 (1H) -one; 89166 -48- 200427678 H7- (aminomethyl) -l, l-dioxide_4H-pyrimido [2,3 -e] [l, 2,4] Thiucyl] -1-benzyl-4 · hydroxyquinoline-2 (1H) -one; Ν-{[3- (1-benzyloxyl-2 -Keto · 1,2-dihydroquinoline · 3 · yl) -1,1-dioxide-4H-thieno [2,3-e] [l, 2,4] thienone-7-yl ] Methyl} methanesulfonamide; Ν · {[3- (1-benzyl-4-hydroxy-2_keto-1,2-dihydroquinolin-3-yl) -1,1-dioxide -4H-pyrimido [2,3-e] [l, 2,4] pyrimidi-7-yl] methyl} nicotinamide; Ν-{[3- (1-benzyloxyl- 2-keto-1,2-dihydroquinolin-3-yl > 1,1-dioxide-4H-pyrimido [2,3-e] [l, 2,4] _Yl] methyl} morpholine-4_carboxamidine; Ν-{[3- (1- + yl_4-meryl-2-amidino-1,2-dichlorojunin-3-yl ) -1,1-dioxide_4H-pyrimido [2,3-e] [l, 2,4] thiadigenin_7-yl] methyl} -2-hydroxyacetamidamine; 1- [ (Cyclopropylmethyl) amino] -4-hydroxy-3- {7-[(methoxymethoxy) methyl] -1, i-dioxide-4H-thieno [2,3-e ] [l, 2,4] Hydrophen-3-yl} quinoline-2 (1H) -one; 1-[(cyclopropylmethyl) amino] _4-hydroxy-3- [7- (hydroxyl Methyl) -1 , 1-dioxide-4H-pyrimido [2,3 <] [1,2,4] pyrimidin-3-yl] quinoline_2 (111) -one; Ν-[(3- {1 -[(Cyclopropylmethyl) amino] -4_peryl-2-fluorenyl-1,2-diaza p-quinolin-3-yl dioxide-4H-thieno [2,3 <] [ 1,2,4] thienone-7-yl) methyl] methanesulfonamide; N-[(3- {1-[(cyclopropylmethyl) amino] -4-hydroxy-2- Keto-1,2-dihydroquinolin-3-ylb 1,1-dioxo-4H-pyrimido [2,3 <] [1,2,4] pyrimidi-7-yl) a Yl] ethanesulfonamide; N-[(3- {l-[(cyclopropylmethyl) amino] -4_hydroxy-2-keto · 1,2-dihydroquinolin-3-yl } -1,1-dioxide-4Η-pyrimido [; 2,3 <] [1,2,4] pyrimidi-7-yl) methyl] propane-1-sulfonamide; Ν- [ (3- {1-[(Cyclopropylmethyl) amino] -4-hydroxy-2-keto-1,2-dihydroquinoline groups 89166-49- 200427678 BU1, BU-4H -p sedeno [2,3 * ^] [1,2,4] pyridine ^ 7-well-7-yl) methyl] propan-2-enamine; Ν-[(3- {1- [(Cyclopropylmethyl) amino] -4-light group_2_one group 1,2-dihydro p quelin-3-yl dioxide-4H-orthopheno [2,3-e ] [l, 2,4] Shunjijing-7-yl) methyl] benzoflavin amine; Ν-[(3- {1-[(cyclopropyl Methylmethyl) amino] -4 · boryl-2-keto · 1,2-dihydrop-quelin-3 * • yl} -1,1_dioxide-4Η-ρ thiopheno [2, 3 <] [1,2, Serpentin-2-7-yl) methyl] _1-phenylmethanesulfonic acid amine; 1-butyl-4-hydroxy-3- {7-[(methoxymethyl (Oxy) methyl] -fluorene, hydrazone-dioxidation-4pyrimido [2,3-e] [l, 2,4] pyrimidin-3-yl} -1,8-pyrimidine-2 (1Η) -one; 1-butyl-4-hydroxy-3_ [7 · (hydroxymethyl) -1,1-dioxide-4Η-pyreno [2,3_e] [l, 2,4] thi Erhuang_3_yl] -1,8-piperidine_2 (1H) _one; 3- (1-benzyl-4- # presentyl-2-keto-1,2_dihydro-1, 8-Hadian-3-yl) -4H_distenopheno [2,3-e] [l, 2,4] acetodiene-7-metanoic acid methyl ester 1,1-dioxide; 4 _Hydroxy_3- {7 _ [(methoxymethoxy) methyl] -i, i-dioxide-4H-nopheno [2,3-e] [l, 2,4] pyrimidine- 3-ylmethylbutyl) -1,8-piperidine-2 (1H) -one; 4-hydroxy-3- [7-pentylmethyl) _1,1-dioxide-4H-fluoreno [2 , 3-e] [l, 2,4] pyridine-3-yl] _1- (3-methylbutyl) -1,8-zodo_2 (1H) -pyridine; 1-pyridyl -3- (1,1- «— oxidized -4H-1,2,4-dongo-p-dihex-3-yl) -4-¾yl-2 (1H) -lipidone; 1-sheep Yl-3- (l l-dioxide-4H-1,2,4-benzodistodi-3-yl) -4- # presenting group-5,6-dimethyl-2 (1-2) -ρ-pyridone; 1- Benzyl (1,1-dioxide-4H_1,2,4-benzopyrimidin-3-yl) glacial hydroxyl-6-methyl-5-phenyl-2 (1Η) -pyridone; dioxide -4H-1,2,4-benzopyridin-3-yl) -4-meryl-5,6-dimethyl_1- 89166 -50- 200427678 (3-methylbutyl) -2 (1Η) -Erididone; 3- (1,1-dioxo-4H-1,2,4-benzothiadinyl) small (2-ethylbutyl) winter hydroxyl-5,6- Monomethyl-2 (1 H) -Edian hydrazone is the same; 1-benzyl-3- (1,1_dioxide-4H-1,2,4-benzothiadinyl group) Dong # chengji -6-phenyl-2 (1H) · eridone; 1,5-diamidino-3- (1,1 · dioxide-4H_1,2,4_benzopyrimidin-3-yl)- 4-Hydroxy-6-methyl-2 (1H) -pyridone; 3- (1,1-dioxide-42-1,2,4-benzopyrimidinyl) small (2 • ethylbutane ) _4-Hydroxy-6-methyl-5-phenyl-2 (1ΗX 酉) Same as 1-butyl-3- (1,1-dioxide-4Η1,2,4-benzopyrene ) -2 (1Η) 4-pyridone; Ν_ {3- [4-Hydroxy (3-methylbutyl) -2-one-1,2-dipyridylpyridyl] -1,1-di Oxidized-4H_1,2,4-benzopyrimidine-7- } Methanesulfonamide; N- [3- (l-benzyl-4-hydroxy-2-one-1,2-dihydropyridine_3-yl) -1,1_dioxide-4H_1,2 , 4-Benzyl eryl-7-yl] methylpyridinamine; N- [3- (4-hydroxy-2-keto_1,2_dihydro-3-pyridyl dioxide_4H- 1,2,4-benzopyrene-7-yl] methylpyridinamine; N- [3- (4-hydroxy small isoamyl-5,6-dimethyl_2_one group · di Hydrogen pyridyl) _ 1,1-dioxide-4H-1,2,4-benzopyridine-7-yl] methanesulfonamide; 3- [3- (4-hydroxy-1-isopentyl 2--2-keto-1,2-dihydro-3-pyridyl) -1,1-dioxo-4H_1,2,4-benzothiadinyl-7-yl] diazepine Acid benzyl ester 2,2-dioxide; N- [3- (4-Cycloisoisopentyl-2-one-1,2-dihydro-3-gadolide dioxide_ 4H-1, 2,4-Benzo-p-diketoporphin_7-yl] acetic acid amine; Ν- {3- [1- (ίclothbutylmethyl) -4-¾yl-2-g isopropyl-1, 2-di Nitrogen_3-p_ (pyridyl) -l, l-dioxo-4'-1,2,4, benzothiadinyl-7-yl} methanesulfonamide; 89166 -51-200427678 N- {3- [5-Bromo-1- (cyclobutylmethyl) -4-meryl-2-keto-1,2-dihydro-3-p is more oxidized than 4-H-1,2,4-dongo p Seldihu-7-yl} methanamine ; N- [3- (4-J% yl-1-isopentyl-2-fluorenyl_5_ethenyl · 1,2-digas-3-gadolide) -1,1_ dioxide- 4Η-1,2,4-benzopyrene_7-yl] methanesulfonamide; and 3- (1,1-dioxide-4pyrene-1,2,4-benzo1? Cyclodi- 3-yl) -4-^-1-propoxyp-quinolin-2 (1H) · one; or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof. In a second embodiment, the present invention provides a compound of formula (II)

Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein z R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and alkylcarbonylalkyl , Alkylthioalkyl, Alkylsulfinylalkyl, Alkylsulfonyl1: Alkyl, Block, Aryl, Diluted aryl, Aroyl, Arylthio, Alkyl Sulfonylalkyl, carboxyalkyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, methylformyl Base, 1¾oxyalkynyl, 12¾alkyl, heteroaryl, heteroaryldiluted, heteroaralkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxy Alkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RaRbNCCCOO alkyl-, RaRbNC (0) NRc alkyl-, RfRgC = N- and RkO- 89166 -52- 200427678 Where R1 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, block, keto, iS, cyano, nitro, haloalkyl, halo Alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, Aralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇RO),-(alkyl) (NR〇Re), -S &, -S (0) Rc, -S (0) 2Rc, _0 &, -NdXRe), -C (0) Rc,-(:( 0) 01 ^, and -C (0) NRcRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, and aryloxy , Halo, hydroxy, RaRbN-, N3-, ReS-, where R4 is independently substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of 1¾, nitro, cyano, -OH, -NH2 And -COOH; R5 is independently selected from each group including alkenyl, alkoxy, alkyl, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidealkyl, and methyl. Fermenting group, 1¾ group, group, S-carbon, heteroaryl group, heterocarbon group, heteroterbo, heterocyclic group, trialkyl group, cycloalkyl group, cyano group, cyano group, nitro group, heart! RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, heart (0) 8 wind center)-, RaS02N (Rf)-, Ra (0 ) SN (Rf) alkyl-, RaS02N (Rf) alkyl-, RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl-, RaRbNC (0)-, Rk0C (0)-, Rk0C (0) alkyl- , RkO alkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0- and -0Rk, where each R5 is It is substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, sulfonyl, alkynyl, Aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇R〇),-(alkylXNReRd), -SK, -S (0) Rc, -S (0) 2Rc, -0RC, -N ^ XRd), -CCCORe, -C (0) 0Rc, and -CCCONReRd; 89166 -53- 200427678 R6 is independently selected from each occurrence including Alkyl, alkenyl, alkynyl, halo, cyano, nitro, alkynyl, pyrenyloxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl ,-(Alkyl) (ORk),-(alkyl) (NRaRb), -SRa, 4 (0) ¾, -S (0) 2Ra, -ORk, -N (RJ (Rb), -C (0 ) Ra, -C (0) 0Ra and -C (0) NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, Keto, ||, haloalkyl, cyano, nitro, -〇Ra, -NRaRb, -SRa, -SOI ^, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and _NC (0) Ra; ^ and Rb are independently selected from each occurrence including hydrogen, alkenyl, Alkyl, alkylthioalkyl, aryl, arylfluorenyl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl , Methylamino, haloalkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, ReRdN -, Rk0-, Rk0 alkyl, RcRdN alkyl-, RcRdNC (0) alkyl-, R ^ SCV, RcS02 alkyl-, ReC (O), KCXO) alkyl-, Rc0C (0)-, ReOCCO) alkyl-, I ^ RdN alkyl C (0) _, RcRdNC (0)-, RcRdNC (0) 0 alkyl_, ReRdNC (0) N (Re) alkyl-, where 1 ^ and Rb are Substituted by 0, 1 or 2 substituents selected from alkyl, alkenyl, alkynyl, keto, i-, cyano, nitro, || alkyl, haloalkoxy, aryl, Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkylXNIRd), -SK, 4 (0) 1 -S (0) 2Rc, -ORe, -N ^ XRd), name (0 凡,-(:( 0) 0 & and -C (0) NRcRd; or, heart and ^ and the nitrogen atom to which they are connected Together form a three- to six-membered ring selected from the group consisting of heteroaryl and hetero Wherein the heteroaryl and heterocyclic ring systems are independently substituted with 0,89166-54-200427678, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, alkynyl, cyano Alkyl, nitro, alkynyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc) ,-(AlkylXNReRd), -alkylSC ^ NReRd, -alkylC (0) NRcRd, -SRC, -S (0) Rc, -S (0) 2Re, 0 &, -NCR ^ Rd), Seven daggers, -C (0) 0Rc and -C (0) NRcRd; R0 and Rd are independently selected from each place including hydrogen, ^! ^! ^,-. ! ^, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) 0Rf, alkenyl, alkyl, alkynyl, cycloalkyl, naphthenic Alkyl, cyclodialkyl, cycloalkenylalkyl, aryl, aralkyl, Salkyl, heteroaryl, heteroaralkyl, heterocycle, and heterocycloalkyl; each of them is ^ and! ^ Is independently substituted by 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, decanyl, keto, halo, cyano, nitro, alkalkyl, and alkoxy Aryl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORf),-(alkyl) (NRfRh), -SRf, _S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C (0 ) N (H) NRfRh, -N (Re) C (0) 0Rf, NCRJSC ^ NBfRh, -N (Re) C (0) NRfRh, -alkylN (Re) C (0) 0Rf, -alkylN (Re) S02 NRf Rh and -alkylN (Re) C (0) NRf Rh; or, R0 and Rd and the nitrogen atom to which they are attached form a three- to six-membered ring, selected from the group including heteroaryl And heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, keto, phenyl, cyano, Nitro, alkynyl, fluorenyloxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf), _ (Alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, 89166 -55- 200427678 -〇Rf, -N (Rf) (Rh), -C (0) Rf, _C (0) 0Rf and -C (0) NRfRh;

Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg, and Rh are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocycle, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, almond , Alkynyl, cyano, i-based, keto, nitro, aryl, aryl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaryl, -OH, -〇 (alkane Group), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl, -alkyl-OH , -Alkyl-O-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl),-alkylS (0) (Carbonyl), -alkyl S02 alkyl, · N (Ηχ: (0) ΝΗ2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkyl , -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, Rf and Rg and others The connected carbon atoms together form a three- to seven-membered ring selected from cycloalkyl, cycloalkenyl, and heterocyclic rings; alternatively, Rf and Rh and each other The connected nitrogen atoms together form a three- to seven-membered ring selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently substituted with 0, 1, 2 or 3 substituents, the substituents Independently selected from the group consisting of alkyl, alkenyl, block, chloro, 1¾, keto, nitro, aryl, aryl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl Group, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl), -S ( 0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS (alkyl), -alkane S (0) (alkyl), -alkylS02alkyl, -alkylN (alkyl) 2, -n (h) c (o) nh2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2 89166 -56- 200427678, -C (0) NH2, -C (0) N (H) (Tigeryl), and -C ( 0) N (carbon-based) 2;

Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aryl, cyano, alkyl, cycloalkenyl, cycloalkenyl, cycloalkyl, cycloalkyl, methylamino Group, _fe group, heteroaryl group, heteroaryl group, heterocyclic group, heterocyclic group, nitroalkyl group, RaRbN alkyl-, RaO alkyl- 'RaRbNC (0)-, RaRbNC (0) alkyl , RaS-, RaS (0)-, RaS02-, RaS alkyl_, Ra (0) S alkyl-, 114〇2 alkyl-, RaOC (0)-, Ra0C (0) alkyl-, RaC (0)-, RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, block, keto, Alkyl, cyano, nitro, alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORc ),-(Alkyl) (NRcRd), -SRC, -S (0) Re, -SCOhRe, -OK, -NdXRd), -CCO)! ^, -C (0) 0Re and -C (0) NReRd m is 0, 1, 2, 3, or 4; and n is 0, 1, 2, 3, or 4; with the proviso that when R4 is alkoxy, aryloxy, hydroxyl, or ReS-, and R5 is Hydrogen, alkenyl, alkoxy, alkyl, block, aryl, i, heteroaryl, Cycloalkyl, cycloalkyl, cyano, nitrate *, RaRbN-, RaC (0)-, RaS-, Ra (0) S-, R ^ OhS-, RaS02N (Rf)-, RaRbNC (0)-, Rk0C (0)-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa, When _S (0) Ra, -S (0) 2Ra, -0Rk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb, R1 does not Hydrogen, dilute, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, heteroaryl, heteroaryl Alkenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl. 89166-57- 200427678 For example, the present invention provides a compound of formula (π), wherein R4 is a hydroxyl group. For example, the present invention provides a compound of formula (II), wherein R4 is a hydroxy group, and R1 is selected from the group consisting of hydrogen, fluorenyl, alkynyl, alkynylcarboxyl, tiger, block, arylfluorenyl, Aralkyl, carboxyalkyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, methylaminoalkyl, i-alkyl, hetero Aryl alkenyl, heteroaralkyl, heterocyclic, heterocyclic alkyl, heterocycloalkyl, hydroxyalkyl, RaRbN-, RaRbN alkyl-, I ^ RbNqo) alkyl-, RfRgC = N_, and RkO-. For example, the present invention provides a compound of formula (II), wherein R4 is a hydroxyl group, and Ri is selected from the group consisting of C3 alkyl, C4 alkyl, C5 alkyl, C3 alkenyl, C4 fluorenyl, C5 fluorenyl, and C3 alkynyl , C4 alkynyl, C5 alkynyl, furyl (C1-C2 alkyl)-, thienyl (C1-C2 alkyl)-, phenyl (C1-C2 alkyl)-, pyridyl (C1-C2 alkyl )-, Pyrazolyl (C1-C2 alkyl)-, isoxazolyl (C1-C2 alkyl)-, naphthyl (C1-C2 alkyl), benzothienyl (C1-C2 alkyl)- , Indolyl (C1-C2 alkyl)-, (C3-C7 cycloalkyl) (C1-C2 alkyl)-, (C5-C6 cycloalkenyl) (C1-C2 alkyl)-, C3-C7 Cycloalkyl, (phenylalkyl) 0-, (C1-C6 alkyl) 0-, ((C3-C6 cycloalkyl) alkyl) 0-, phenyl CH = N ', NH2, (C1- C7 alkyl) N (H)-, (C1-C7 alkenyl) N (H)-, (C3-C7 cycloalkyl) N (Η)-, ((C3-C7cycloalkyl) alkyl) N (Η)-, (phenylalkyl) N (Η)-, (pyriminylmethyl) N (Η)-, (pyrazolylmethyl) N (Η)-, (furylmethyl) N (Η)-, (pyridylmethyl) N (Η)-, (tetrahydropiperan) N (Η)-, (benzyl) N (Η)-, (tetramethyl) N (Η )-, Wherein each R1 is substituted with 0, 1, 2 or 3 substituents, and the substituents are selected from the group consisting of alkyl, hydroxyl, keto, halide, cyano, nitro, haloalkyl, haloalkoxy , Phenyl, hexahydropyridyl, morpholinyl, carboxyl, _C (0) 0 (alkyl), -NH2, -NH (alkyl), -N (alkyl) 2, -0 alkyl, -〇-phenyl. -58- 89166 200427678 For example, the present invention provides a compound of formula (Π), wherein R4 is a hydroxyl group, and R1 is selected from the group consisting of ((1-isopropyl) butyl) MΗ)-, ((2-chloro- 1,3-pyrimazol-5-yl) methyl) N (H) ... ((2-methyl-1,3-pazet-4-4yl) methyl) N (H)-, ((3 -Methylphenphen-2-yl) methyl) N (H)-, ((3-trifluoromethyl) cyclohexyl) N (H)-, ((5-chloropyrimidin-2-yl) (Methyl) N (H)-, ((pyridine_3-yl) methyl) N (H)-, (1,2,3,4-tetrahydronaphthalen-2-yl) N (H)-, ( 1,3-thiazol-2-ylmethyl) N (H)-, (1,3-triazol-5-ylmethyl) N (; H) _, (1-cyclohexene_1_yl) Ethyl, (1-cyclopropylethyl) MΗ)-, (1-ethylbutyl) N (H)-, (1-ethylpropyl) N (H) _, (1-methylbutyl Group) NOH)-, (1-phenylethyl) N⑻, (1-propylbutyl) N (H)-, (1-pyrimidin-3-ylethyl) N (Η)-, (2- (1Η-pyridol_3-yl) ethyl, (2- (dimethylamino) ethyl) (methyl) aminopropyl, (2-bromobenzyl) N (H)- , (2-Chloro-1,3 · Hepta-5-yl) methyl, (2-Chloro-4-p-pyridyl) methyl, (2-ethyl-3-methylbutylMH) )-, 2-ethylbutyl) N (H)-, (2-creanylmethyl) N (H)-, (2-methyl-1,2-tetramethyl-4-yl) methyl, (2 -Methyl-l, 3-p-sedino-4-yl) methyl, (2-methyl-1,3-p-supposed-5-yl) methyl, ((2-methylphenyl) methyl ) n (H)-, (3,3-dimethylbutyl) n (H)-, (3,5-dimethyl-4-isoxazolyl) methyl, (3,5-dimethyl Cyclohexyl) N (H)-, (3-bromofluorenyl) N (H) _, (3-cyanobenzyl) N (H)-, (3-ethylcyclopentyl) N (h )-, (3-furylmethyl) N (H)-, ((3-methoxyphenyl) methyl) N (H) _, (3-methylbenzyl) N (H)-, (3 -Methylbut-2-fluorenyl) N (H)-, (3-methylbutyl) N (; H)-, (3-methylcyclohexyl) N (H)-, (3-methyl Cyclopentyl) N (H)-, (3-trifluoromethyl) fluorenyl, ((4-bromophenyl) methyl) N (H)-, (4-isopropylcyclohexyl) N (H )-, ((4-methoxyphenyl) fluorenyl) N (h)-, ((4-methylphenyl) methyl) N (H)-, (5-bromo-2-pyridinyl) ) Methyl, (5-bromo_3_pyridyl) methyl, (5-tertyl-2-crotyl) methyl, (5-chloro · 2 < phenenyl) methyl, (5- Ethoxyfluorenyl-2-creanyl) methyl, (5-methyl-2- ρ sephenyl) methyl, (5-methyl_3-isop-fluorenyl) methyl, (5-methyl-3-succinoyl) methyl, (5-nitro_2_sulfur) 89166 -59- 200427678 group) methyl, (5-phenyl-2-pyrimyl) methyl, (5-third butyl_2_pyrimyl) methyl, (6,6-dimethyl Bicyclo [3.1.1] heptan-2-yl) methyl, (6_ethoxy_2_pyridyl) methyl, (6-methyl-2-ρ bipyridyl) methyl, (cyclopropyl (Methyl) n (H)-, (V-Hyoden-2-ylmethyl) N (H)-, 0-pyridin-3-ylmethyl) N (H) _, (pyridin-4-ylmethyl) Group) N (H)-, (tetrahydro-2H-piperan_4-yl) N (H)-, (thiophene 2-ylmethyl) N (H)-, thiophene-3_ylmethyl Group) N (Η)-, 1, Γ-biphenylbenzylmethyl, 1,3-pyrazol-4-ylmethyl, 1-adamantylmethyl, 1-benzopyrimene-2- Methyl, 1-ethylpropyl, 1-fluorenylmethyl, i-neopentyl, 1-phenylethyl, 2- (l, 3-dioxol-2-yl) ethyl, 2- (3-pyridinyl) ethyl, 2,3-dihydroxypropyl, 2-aminoethyl, 2-cyanobenzyl, 2-cyclohexylethyl, (2-methylphenyl) Methyl, 2-methylbutyl, 2-fluorenylmethyl, 2-phenylethyl, 2-desylpropane , 2-p ratio methyl, 3- (4-methyl-1-hexachloro p ratio p-yl) propyl, 3- (4-morpholinyl) propyl, 3- (diethylamine ) Propyl, 3- (dimethylamino) propyl, 3-anilinepropyl, 3-bromobenzyl, 3-butenyl, 3-chlorobenzyl, 3-propenyl, 3 -Ethylbutyl, 3-fluoromethyl, 3-boryl, 3-protectyl, 3-alkylsulfenyl, 3-methoxyfluorenyl, 3-methoxycarbonylbenzyl, 3- Methyl-2-butylfluorenyl, 3-methylfluorenyl, 3-methylbutyl, 3-nitrofluorenyl, 3-phenoxyfluorenyl, 3-pentylmethyl,-, 3-p Phenylmethyl, sulfanyl, 4-aminobenzyl, 4-methoxyfluorenyl, 4-methyl-3-pentenyl, 4-methylbenzyl, 4-methylpentyl, 4 -Pyridylmethyl, 4-tert-butylyl, -NH2, phenylmethyl, (phenylmethyl) N (Η) · *, benzyloxy, (butyl) N (Η)-, ( (Cyclobutyl) N (Η)-, cyclobutylmethyl, cycloheptyl, (cycloheptyl) N (Η)-, cyclohexyl, (cyclohexyl) N (Η)-, cyclohexylmethyl, cyclopentyl , (Cyclopentyl) N (Ν)-, cyclopropylmethyl, cyclopropylethyl, hydrogen, isobutoxy, (isobutyl) N (Η) _, (isopropyl) N (Η )-, N-butyl, pentyl, (pentyl) N (Η)-, (phenylmethylene) N (Η)-, prop-2-enyl, prop-3-aldehyde, propoxy 89166 -60- 200427678 and (propyl) N (H)-. In a third specific embodiment, the present invention provides a compound of formula (III):

Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and alkylcarbonylalkyl , Alkylthioalkyl, alkylsulfinylalkyl, alkylsulfinylalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonyl Alkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, methylamino, 1S Alkoxyalkyl, haloalkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl , Nitroalkyl, RaRbN ·, RaRbN alkyl-, RaRbNC (0) alkyl-, RaRbNCCCOO alkyl-, RaRbNC (0) NRe alkyl-, RfRgC = N- and RkO-, where R1 is substituted by 0 , 1, 2 or 3 substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, keto, cyano, nitro, alkynyl, halooxy, aryl, heteroaryl, hetero Ring, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkane () Rc),-(alkylXNH), -SRC, -S (0) Re, -S (0) 2Rc, -OK, -N ^ XRe), -〇: 0) &, -C (0) 0Rc and -CCCONReRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, iS group, hydroxyl, RaRbN-, N3-, ReS-, wherein R4 is substituted by 0, 1 or 2 substituents -61-89166 200427678 are independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 and -COOH; R5 is independently selected from the group consisting of alkenyl, alkoxy, and Alkyl, decyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidealkyl, formamyl, selfyl, haloalkyl, functional carbon, heteroaryl, heteroaralkyl, Heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, 1C, RaC (0)-, RaS-, Ra (0) S-, Ra (0 ) 2S-, RaRbN alkyl-, Ra (0) SN (Rf) _, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl-, RaS02N (Rf) alkyl-, RaRbNS02N (Rf)- , RaRbNS02N (Rf) alkyl-, RaRbNC (0)-, Rk0C (0)-, Rk0C (0) alkyl-, RkOalkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra) P ( 0) 0- and -ORk, where each R5 is independently substituted with 0, 1, 2 or 3 substituents Independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, haloalkyl, iialkyloxy, aryl, heteroaryl, heterocycle, aralkyl, heteroaryl Alkyl, alkoxyalkoxyalkyl,-(alkyl) (ORc),-(alkylXNRcRJ, -S &, -S (0) Rc, -S (0) 2Re, -ORc, -N ^ XRd), -C (0) Re, -CCCOORe, and -C (0) NRcRd; R6 is independently selected at each occurrence from the group including alkyl, alkenyl, alkynyl, halo, cyano, nitro, S Alkyl, iS alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkyl) (11¾), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; Wherein each R6 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, 1S, haloalkyl, cyano, nitro,- ORa, -NRaRb, -SRa, -SORa, -S02Ra, _C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra;

Ra and Rb are each independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkanes 89166 -62- 200427678 thioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cyclic Alkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methylamino, haloalkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, Heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, alkoxy, RkO-, RkO alkyl-, ReRdN alkyl-, RcRdNC (0) alkyl-, RcS02 -, RcS02 alkyl-, RoC (0)-, I ^ CCO) alkyl, RcoC (0) ·, Rc0C (0) alkyl-, I ^ RdN alkyl C (0)-, RcRdNC (0)-, RcRdNC (0) 0 alkyl-, ReRdNCCCON ^) alkyl-, its center and ^ are substituted with 0, 1 or 2 substituents, the substituents are selected from the group consisting of alkyl, alkenyl, alkynyl , Keto, i-based, cyano, nitro, amidino, i-alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,- (Alkyl) (〇RO),-(alkylXNReRd), -SRC, -S (0) Re, -S (0) 2Re ..., -NdXRd), -0 (0) ~, < (0 ) 0 & and -C (0) NReRd; or, and ^ 和And other nitrogen atoms connected together to form a three to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic rings, wherein the heteroaryl and heterocyclic ring systems are independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independent Selected from the group consisting of alkyl, alkenyl, decyl, keto, alkynyl, cyano, nitro, haloalkyl, iialkyloxy, aryl, heteroaryl, heterocyclic, arylalkyl, heteroaryl Alkoxy group, alkoxy group,-(alkyl) (〇Rc), _ (alkyl XNReRd), -alkyl SC ^ NReRd, -alkyl C ^ NF ^ Rd ^ -SRC ^ -S (0 ) Rc ^ -SCO ^ R, ^ -ORc > ^) (¾) ^ -0 (0) ^,-; R0 and Rd are independently selected from each occurrence including hydrogen, ...! ^! ^, -. ! ^, -CO (Rf), -SRf, -SORf, -SC ^ Rf, -C (0) NRfRh, -SC ^ NRfRh, -C (0) 0Rf, alkenyl, alkyl, alkynyl, naphthenic Base, cycloalkylalkyl, cycloalkenyl, ring 89166 -63- 200427678 fluorenyl radical, aryl, arylalkyl, haloalkyl, heteroaryl, heteroaryl, heterocyclic and heterocycloalkyl ; Wherein each Re and Rd are independently substituted by 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, iS Aryl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl '-(alkyl) (〇Rf),-(alkyl) ( NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, _〇Rf, _N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0 ) NRfRh, -C (0) N (H) NRfRh, _N (Re) C (0) 0Rf, -N (Re) S02NRfRh, -N (Re) C (0) NRfRh, -alkylN (Re) C (0) ORf, -alkylN (Re) S02 NRf Rh, and -alkylN (Re) C (0) NRf Rh; or, R0, together with Rd and the nitrogen atom to which they are attached, form three to six Member ring, selected from the group consisting of heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently substituted with 0, 1, 2 or 3 substituents, The group is independently selected from the group consisting of an alkyl group, an alkenyl group, a decyl group, a keto group, a cyano group, a nitro group, an alkyl group, an alkyl group, an aryl group, a heteroaryl group, a heterocyclic ring, an aromatic group, an aromatic group Alkyl, alkynyl,-(alkyl) (〇Rf), -0 ^ S) (NRfRh), _SRf, -S (O) Rf, -S (O) 2Rf, -ORf,- N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf and -C (0) NRfRh;

Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg, and Rh are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocyclic, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl and alkenyl , Decyl, cyano, dentyl, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroarylalkyl, -OH, -0 (: fe group), _NH2, -N (H) (fe group), -N (alkyl group) 2, -S (alkyl group), -S (0) (-64- 89166 200427678 alkyl group), -S02 alkyl group , -Alkyl-OH, -alkyl--0-alkyl, -alkyl-NH2, -alkyl-N (H) (alkyl), -alkyl-N (alkyl), -alkyl-S (alkyl ), -Alkyl (S) (0) (alkyl), -alkylS02 alkyl, -N (H) C (0) NH2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkyl, -C (0) NH2, -C (0) NH2, _C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, Together with the carbon atoms to which they are attached form a three- to seven-membered ring selected from cycloalkyl, cycloalkenyl and heterocyclic rings; or Rf, together with Rh and the nitrogen atom to which they are attached, form a three- to seven-membered ring selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently 0, 1, 2 or 3 Substituted by substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, cyano, halide, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, hetero Aryl, heteroaralkyl, -OH, -0 (alkyl), -NΗ2, · N (Η) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl ), _S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS (alkyl ), -Alkyl S (0) (alkyl), -alkyl S02 alkyl, -alkyl N (alkyl) 2, -n (h) c (o) nh2, -C (0) 0H,- c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0 ) N (alkyl) 2;

Rk is selected from the group consisting of hydrogen, fluorenyl, alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, methylaminoalkyl , Self-alkyl, heteroaryl, heteroaryl, heterocyclic, heterocycloalkyl, nitroalkyl, RaRbN-yl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS-, RaS (0)-, RaS02-, RaS alkyl-, Ra (0) S alkyl-, 113〇2 alkyl-, RaOqO)-, Ra0C (0) alkyl-, RaC (0)- , RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from alkyl, alkenyl, alkynyl, keto, li, cyano, Nitro, fluorenyl, -65-89166 200427678 haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) ( ORc),-(alkyl) (NReRd), -SRC, 4 (0) 1 ^, -S (0) 2Rc, -ORc, -NdXRd), -C (0) Rc ,; m is 0, 1 or 2; and η is 0, 1, 2, 3, or 4; with the proviso that when R4 is alkoxy, aryloxy, hydroxyl SReS-, and R5 is fluorene, alkenyl, alkoxy, alkyl, Alkynyl, aryl, i-based, heteroaryl, heterocycloalkyl, Cycloalkyl, cyano, nitro, \ 1 ^ 1 ^, 11, (0)-, 1 ^ 8-, Ra (0) S-, Ra (0) 2S-, RaS02N (Rf)-, RaRbNC ( 0) ·, Rk0C (0)-, RaRbNS〇2- or -0¾ 'and R6 is chlorine, alkyl, allyl, block, 1¾, cyano, nitro, aryl, heteroaryl, heterocyclic Alkyl, -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, _N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) In the case of NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, Heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl. For example, the present invention provides a compound of formula (III), wherein R4 is hydroxy. For example, Benfa-Ming provides compounds of formula (III), wherein R4 is a meridian, and R1 is selected from the group consisting of hydrogen, dilute, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, and aryl. Alkenyl, aralkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, merane Group, heteroarylalkenyl, heteroaralkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, RaRbN ... RaRbN alkyl-, RaRbNC (0) alkyl-, RfRgON- & Rk 〇-. For example, the present invention provides a compound of formula (III), wherein R4 is a hydroxyl group, and R1-66- 89166 200427678 is selected from the group consisting of ((1-isopropyl) butyl) N (H)-, ((2-chloro -1,3-thiazol-5-yl) methyl) N (H)-, ((2-methyl-1,3-pyrazol-4-yl) methyl) N (H)-, (( 3-methylthien-2-yl) methyl) N (H)-, ((3-trifluoromethyl) cyclohexyl) N (H)-, ((5-chloromethylfluoren-2-yl) (Methyl) N (H)-, ((pyridin-3-yl) methyl) N (H)-, (1,2,3,4-tetrahydronaphthalen-2-yl) N (H)-, ( 1,3-thiazol-2-ylmethyl) N (H)-, (1,3-pyrazol-5-ylmethyl) N (H) ·, (1-cyclohexene small group) ethyl, (1-cyclopropylethyl) NOS) _, (1-ethylbutyl) N (H)-, (1-ethylpropyl) N (H)-, (1-methylbutyl Office ⑻-, (1-phenylethyl) N〇Η)-, (1-propylbutyl) N (H)-, (1-pyrimidine_3-ylethyl) N (Η)-, (2- (1A-earthin-3-yl) ethyl, (2- (dimethylamino) ethyl) (methyl) aminopropyl, ((2-bromophenyl) methyl) N ( H)-, (2-Chloro-1,3-thiazol-5-yl) methyl, (2-Chloropyridyl) methyl, (2-ethyl-3-methylbutylMH)- (2-ethylbutyl) N (H)-, (2-furylmethyl) N (H)-, (2-methyl_1,2-thiazol-4-yl) methyl, (2- Methyl-1,3-pyrazol-4-yl) methyl, (2-methyl-1,3-oxazol-5-yl) methyl, (2-methylbenzyl) N (H)-, (3,3-dimethylbutyl) N (H)-, (3,5-dimethyl-4-isoxazolyl) methyl, (3,5-dimethylcyclohexyl) N⑻-, (3-bromobenzyl) N (H)-, (3-cyanofluorenyl) N (H)-, (3-ethylcyclopentyl) N (H)-, (3-creanylmethyl Group) N (H)-, (3-methoxybenzyl) N (H)-, (3-methylbenzyl) N (H)-, (3-methylbut-2-enylfluorene-, (3-methylbutyl) N (H)-, (3-methylcyclohexyl) N (H)-, (3-methylcyclopentyl) N⑻-, (3-trifluoromethyl) benzyl ((4-bromophenyl) methyl) N (H)-, (4-isopropylcyclohexyl) N (H)-, ((4 • methoxyphenyl) methyl) N (H) _ ((4-methylphenyl) methyl) N (H)-, (5-bromo-2-pyridinyl) methyl, (5-bromo-3-pyridyl) methyl, (5- Stilbene-2-carbo) methyl, (5-chloro-2-fluorenyl) methyl, (5-ethoxycarbonyl-2-creanyl) methyl, (5-methyl-2 -p sephenyl) methyl, 5-methylisoisoxazolyl) methyl, (5-methyl-3-pyridyl) methyl, (5-nitrofuranyl) methyl, (5-phenyl-2 ~ cephenyl) Methyl, (5-Third-butyl-2-Fenyl) methyl, (6,6_ 89166 • 67- 200427678 dimethylbicyclo [3 · 1 · 1] hept-2-yl) methyl , (6-ethoxy-2-pyridyl) methyl, & methyl winter pyridyl) methyl, (cyclopropylmethyl) N (H) ... pyridin-2-ylmethyl) N ( H) Mono, (pyridin-3-ylmethyl) N (H)-, (pyridin-4-ylmethyl) N (H) _, (tetrahydro-2H-piperanyl) N (H)- (Remotephen-2-ylmethyl) N (H)-, (Pyrimphen-3-ylmethylketone), 1, Γ · biphenyl-4-ylmethyl, 1,3-oxazolone Methyl, 1-gold steel alkylmethyl, 1-benzopyrimin-2-ylmethyl, 1-ethylpropyl, 1-naphthylmethyl, 1-neopentyl, μphenylethyl Group, 2- (1,3-dioxofluoren-2-yl) ethyl, 2- (3-pyridinyl) ethyl, 2,3-dihydroxypropyl, 2-aminoethyl, ( 2-cyanophenyl) methyl, 2-cyclohexylethyl, (2-methylphenyl) methyl, 2-methylbutyl, 2-naphthylmethyl, 2-phenylethyl, 2 -Benzylpropyl, 2-p-pyridyl Methyl, 3- (4-methyl-1-hexazylpyridyl) propyl, 3- (4-morpholinyl) propyl, 3- (diethylamino) propyl, 3- (dimethyl Amino) propyl, 3-anilinopropyl, (3-bromophenyl) methyl, 3-butenyl, (3-chlorophenyl) methyl, (3-cyanophenyl) methyl, 3-ethylbutyl, (3-fluorophenyl) methyl, 3-hydroxybutyl, 3-hydroxypropyl, (3-iodophenyl) methyl, (3-methoxyphenyl) methyl, (3-Methoxycarbonylphenyl) methyl, 3-methyl-2-butenyl, (3-methylphenyl) methyl, 3-methylbutyl, (3-nitrophenyl) methyl Methyl, 3-phenoxybenzyl, 3-pyridylmethyl, 3-pyrimylmethyl, (4-bromophenyl) methyl, (4-cyanophenyl) methyl, (4-methyl Oxyphenyl) methyl, 4-methyl-3-pentenyl, (4-methylphenyl) methyl, 4-methylpentyl, 4-pyridylmethyl, (4-tert-butyl Phenyl) methyl, -NH2, phenylmethyl, (phenylmethyl) N (H)-, (phenylethyl) N (H)-, benzyloxy, (butyl) N (H )-, (Cyclobutyl) N (H)-, cyclobutylmethyl, cycloheptyl, (cycloheptyl) N (H)-, cyclohexyl, (cyclohexyl) N (H)-, cyclohexylmethyl Group, cyclopentyl, (cyclopentyl) N (H)-, cyclopropylethyl, cyclopropylmethyl, isobutoxy, (isobutyl) N (H)-, (isopropyl) N (H)-, n-butyl, pentyl, (pentyl) N (H)-, (phenylmethylene) N (H)-, prop-2-enyl, propyl each -68- 89166 200427678 Aldehyde, propoxy and (propyl) N (H)-. In a fourth embodiment, the present invention provides a compound of formula (IV)

Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and alkylcarbonylalkyl , Alkylthioalkyl, alkylsulfinylalkyl, alkylsulfinylalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonyl Alkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, formylalkyl, i Alkoxyalkyl, _alkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocyclic, heterocyclicfluorenyl, heterocycloalkyl, hydroxyalkyl , Nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, KRbNCXCOO alkyl-, RaRbNC (0) NfVJ ^ group-, RfRgC = N- and RkO-, where & 0, 1, 2 or 3 substituents. The substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, keto, phenyl, cyano, nitro, haloalkyl, alkoxy, and aryl , Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxy Oxyalkyl,-(alkyl) (〇Rc),-(alkylXNH), -SRC, -S (0) Rc, -S (0) 2Rc, -01 ^, -N (Rc) (Re) -C (0) Rc, -C (0) 0Rc, and -CCCONReRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, -69- 89166 200427678 halo, hydroxyl, RaRbN-, N3-, ReS-, where R4 is substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of i-group, nitro, cyano, -OH, -NH2 and -COOH; R5 is present at each occurrence Is independently selected from the group consisting of alkenyl, alkoxy, alkoxy, block, aryl, aralkyl, arylcarbonyl, aryloxy, azidoalkyl, formamyl, iyl, iialkyl, Halogenated carbon, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, 1 ^ 1 ^, RaC (0)- , RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, heart (0) 3 wind ~)-, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl- , RaS02N (Rf) alkyl-, RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl-, RaRbNC (0)-, Rk0C (0)-, Rk0C (0) alkyl-, RkOalkyl-, RaRbNS02- , RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0- and -ORk, where each R5 is independently 0, 1, 2 or 3 Substituted by a substituent, the substituent is independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, chloro, nitro, 12-alkynyl, 12-alkoxy, aryl, heteroaryl, heterocyclic, Aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORc),-(alkylXNReRd), -SRe, -S (0) Re, -S (0) 2Rc, -ORc, -N (Re) (Rd),-¢: (0) 1 ^ ,; R6 is independently selected from each occurrence including alkyl, alkenyl, alkynyl, halo, cyano, nitro , 1¾ alkyl, 1¾ alkyl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkyl) (NRaRb ), -SRa, 4 (0) ¾, -S (0) 2Ra, -ORk, collar \) team), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; each of them R6 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, self-group, haloalkyl, cyano, nitro, -0Ra, _NRaRb, -SRa, -SOi ^, -S02Ra -70- 89166 200427678, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra;

Ra and Rb are each independently selected from the group consisting of hydrogen, dilute, alkynyl, thioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cycloalkenyl, and cycloalkene Alkyl, cycloalkyl, cycloalkylalkyl, cycloalkylfluorenyl, methylaminoalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocyclic, heterocyclic Alkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, ReRdN-, RkO-, RkO alkyl-, RcRdN alkyl-, RcRdNC (0) alkyl-, RcS02-, ReS02 alkyl-, ReQO)-, Gen (:( 0) alkyl-, Rc0C (0)-, Reoc (0) alkyl-, I ^ RdN alkyl C (0)-, R ^ RdNCCO)-, ReRdNC (0 ) 0 alkyl-, ReRaNCCCONd) alkyl-, wherein 1 ^ and 1 ^ are substituted with 0, 1 or 2 substituents, and the substituents are selected from the group consisting of alkyl, fluorenyl, ethyl, keto, keto, cyano Base, nitro, iS alkyl, S alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,-(burn (^ ¾), -SRC, -S (0) Re, -S (0) 2Rc, _〇1 ^, -N ^ XRd), -C (0) Re, -C (0) 0Rc, and- C (0) NRcRd; or 'Ra with Rb and the nitrogen atom to which they are attached Forms a three- to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic rings, wherein the heteroaryl and heterocyclic ring systems are independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, olefin Base, alkynyl, keto, i-based, cyano, nitro, alkynyl, alkoxy, aryl, heteroaryl, heterocyclic, aryl, heteroaryl, aryl Alkyl,-(alkyl) (〇Rc),-(alkyl) (NRcRd), -alkyl S02NRcRd, -alkyl C ^ NR ^ Rd ^ -SR, > -8 (0) 1 ^ vS ( 0) 2Re > -ORe > > -0 (0) ^, -C (0) 0Rc and -CCC ^ NReRd; R0 and Rd are independently selected at each place where they are selected from the group consisting of hydrogen, -NRfRh,- 〇Rf, 89166 -71-200427678 -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) 0Rf, alkenyl, alkyl, alkynyl, ring Alkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, || alkyl, heteroaryl, heteroaralkyl, heterocycle, and heterocycloalkyl; each Re and Rd are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, chloro, nitro, haloalkyl, IS alkyl Oxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) (NRfRh),- SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh,- C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N (Re) S02NRfRh, -N (Re) C (0) NRfRh, -alkylNCRJCCCOORf, -alkylN (Re ) S02 NRf Rh and -alkylN (Re) C (0) NRf Rh; or, the heart and the heart and the nitrogen atom to which they are attached form a three- to six-membered ring, selected from heteroaryl and heterocyclic rings Wherein the heteroaryl group and the heterocyclic ring system are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, decanyl, keto, commercial, cyano, nitro, Alkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (QRf),-(alkyl) ( NRfRh), _SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), _C (0) Rf, -C (0) 0Rf, and -C (0) NRfRh ;

Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg & Rh are independently selected from each occurrence including fluorene, alkyl, fluorenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocyclic, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh # is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl , Alkynyl, cyano, functional, keto, nitro, aryl-72- 89166 200427678, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH -O (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl , -Alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl ), -Alkyl S (0) (alkyl), -alkyl S02 alkyl, _N (H) C (0) NH2, _C (0) 0H, -c (o) o (alkyl), -c (o) alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, Rf and Rg and the carbon atom to which they are attached together form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cyclofluorenyl, and heterocycle; or, 11 £ forms a three- to seven-membered ring with Rh and the nitrogen atom to which they are attached, selected from the group consisting of heterocyclic rings and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently 0, 1, 2 or 3 Each substituent is substituted, and the substituent is independently selected from the group consisting of alkyl, alkenyl, decyl, cyano, aryl, fluorenyl, nitro, aryl, aryl, cycloalkyl, cycloalkenyl, heterocyclic, hetero Aryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkane Group), -S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS ( Alkyl), -alkylS (0) (alkyl), -alkylS02alkyl, -alkylN (alkyl) 2, -n (h) c (o) nh2, -C (0) 0H , -C (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2;

Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methylaminoalkyl , Haloalkyl, heteroaryl, heteroaralkyl, heterocycle, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS-, RaS (0)-, RaS02-, RaS alkyl-, Ra (0) S alkyl-, heart 802 alkyl-, \ 0 (: (0)-, Ra0C (0) alkyl-, RaC (0)-, RaC (0) alkyl-, wherein 89166-73-200427678 each Rk is substituted with 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, Keto, base, cyano, nitro, alkynyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkane (ORc),-(alkyl) (NRcRd), -SRe, name (0) 1 ^, -S (0) 2Re, -ORc, -NdXRd), -C (0) Rc, -C (0 ) 0Rc and -C (0) NRcRd; m is 0, 1, 2, 3, or 4; and n is 0, 1, 2, 3, or 4; with the proviso that when R4 is alkoxy or aryloxy , Hydroxy, or Re S-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, Halo, heteroaryl, heterocycloalkyl, cycloalkyl, cyano, nitrate! , RaRbN-, RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, K ^ 02N (&)-, RaRbNC (0)-, Rk0C (0)-, RaRbNS02- Or -ORk, and R6 is hydrogen, alkyl, fluorenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra,- When S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb, R1 is not hydrogen, allyl, or Alkyl, alkynyl: aryl, aryl, aryl dilute, aryl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaryl Alkyl, heterocyclic or heterocycloalkyl. For example, the invention provides a compound of formula (IV), wherein R4 is hydroxy. For example, the present invention provides a compound of formula (IV), wherein R4 is a hydroxyl group, and R1 is selected from the group consisting of RaRbN-, RfRgC = N-, and Rko-. For example, the present invention provides a compound of formula (IV), wherein R4 is a hydroxyl group, and R1 is selected from the group consisting of alkyl groups 0-, (cycloalkyl) 0-, (aralkyl) 0-, and aryl CH = N- , -NH2, alkyl N (H)-, alkenyl N (H)-, cycloalkyl N (H)-, (cycloalkylalkyl) N (H)-, (heteroaralkyl) N ( H)-, (aralkyl) N (H)-and (heterocyclic) N (H)-. 89166 -74- 200427678 For example, the present invention provides a compound of formula (IV), wherein R4 is a hydroxyl group, and R1 is selected from the group consisting of (C3-C7 alkyl) 0-, (C3-C6 cycloalkyl) 0-, ( Phenylalkyl) 0-, phenyl CH = N-, (C3-C7 alkyl) N (H)-, (C3-C7 alkenyl) N (H)-, (C3-C7 cycloalkyl) N (H)-, ((C3-C7 cycloalkyl) C1-C2 alkyl) N (H)-, (pyriminylmethyl) N (H)-, (pyrazolylmethyl) N (H) -, (Furylmethyl) N (H)-, (pyridylmethyl) N (H)-, (tetramethyl) N (H)-, (tetrahydropiperanyl) N (H)-, and (Phenylalkyl) N (H)-, where (phenylalkyl) 0-, phenylCH = N-, (pyriminylmethyl) N (H)-, (pyrimazolylmethyl) N (H)-, (furylmethyl) N (H)-, (pyridylmethyl) N (H)-, and (phenylalkyl) N (H >) phenyl, pyrenyl, pyrazolyl , Furyl and pyridyl, each independently substituted with 0, 1 or 2 substituents, the substituents being selected from the group consisting of nitro, cyano, hydroxy, alkoxy, · ΝΗ2, -N (H) (alkyl), -N (alkyl) 2, alkyl, halo, iSalkenyl, alkyl, ethyl, and ethyl. For example, the present invention provides Formula (IV) A compound wherein R4 is a hydroxyl group, and R1 is selected from the group consisting of (phenylmethyl) N (H)-, (1-phenylethyl) N (H)-, (cycloproylmethyl) N (H)-, (Cyclohexylmethyl) N (H)-, (1-cyclopropylethyl) N (H)-, phenyl CH = N-, propyl 0-, (1-propylbutyl) N (H )-, (Isobutyl) N (H) _, (isopropyl) N (H)-, (1-ethylpropyl) N (H)-, (1-ethylbutyl) N (H )-, (2-ethylbutyl) N (H)-, (1-isopropylbutyl) N (H)-, (1-methylbutyl) N (H)-, (3-methyl Butyl) N (H)-, (3,3-dimethylbutyl) N (H)-, (propyl) N (H)-, (butyl) N (H)-, (pentyl ) N (H)-, (2-ethyl-3-methylbutyl) N (H)-, (3-methylbutyl-2-fluorenyl) N (H)-, (cyclobutyl) N (H)-, (cyclopentyl) N (H)-, (cyclohexyl) N (H)-, (cycloheptyl) N (H)-, (pyriminylmethyl) N (H)-, (Furylmethyl) N (H)-, (pyrazolylmethyl) N (H)-, (pyridylmethyl) N (H)-, (tetrahydrofluorenyl) N (H)-, and ( Tetrahydropiperanyl) N (H)-, of which (phenylmethyl) 0-, phenylCH = N-, (pyrimylmethyl) N (H)-, (thiazolylmethyl 89166 -75- 200427678 base) N (H)-, ( Pyranylmethyl) N (H)-, (pyridylmethyl) N (H)-, (phenylmethyl) N (H)-, and (1-phenylethyl) N (H) -benzene , Pyrimyl, thiazolyl, furyl and pyridyl, each independently substituted with 0, 1 or 2 substituents, the substituents being selected from the group consisting of nitro, cyano, hydroxy, methoxy, -NH2, -N (H) (carbo), -N (alkyl) 2, methyl, halo, -methyl, carboxy, ethenyl, and alkyl ester. Exemplary compounds of the fourth specific embodiment of the present invention of formula (IV) include, but are not limited to, the following: 3- (1,1-dioxide-4H-1,2,4-benzopyrimidin-3-yl 1-{{((1E) -phenylmethylene] amino}}-2 (1Η) -p-quinolone; 1-amino_3_ (1,1-dioxide_4H-1,2, 4-benzopyridine · 3_yl) -4-hydroxy_2 (1H) _quinolinone; 3 (1,1 oxidation-4H-1,2,4-Mercapron-sense * -3 -Yl) -4-meryl-1-propoxyjunlin_ 2 (1H) -one; 1- (benzylamino) each (1,1-dioxide-4H-1,2,4-benzo Pyrimidiphin-3_yl) winter quinolin-2 (1H) -one; 1-amino groups (1,1-dioxide-4H-1,2,4-benzopyrene) _4_ Hydroxyxantolin · 2 (1H) -one; MU-—oxidized-4H-1,2,4-benzopyrimidin-3-yl> 4-carboxy-1-[(1-propylbutyl ) I group] Junlin-2 (1H) -S is the same; 3- (1,1-dioxidation 4H-1,2,4-benzopyridine dihydroxymethyl (isobutylamino) quinine Porphyrin-2 (1H) -one; 3- (1,1-Monoxide-4H-1,2,4-benzothiadiphthyl) small [(1-ethylpropyl) amino] -4 -Hydroxyquinoline-2 (1-2) _one; 3- (U-Dioxide-4Η-1,2,4-benzothiadinyl_3_yl) -4-hydroxyamino) 89166 -76- 20042 7678 quinoline-2 (1H) -one; fluorene cyclohexylamino) -3- (l, l-dioxide_4H-1,2,4-benzofluorenediphine) ice-based p-quinine -2 (1 H) -one; 3- (1,1-Monoxide-4H-1,2,4-benzopyrimidin-3-yl) _4, yl · fluorene [(2_methylq, 3_ Lacquerate_4_yl) methyl] amino} p quelin_2 (ih) -one; 3- (1,1-dioxide-4H-1,2,4-benzothiine) -4-Hydroxy (isopropylamino) p-quinolin-2 (1H) -one; K-cyclobutylamino) -3- (1,1-dioxide 4H-1,2,4-benzene Pyrene—3-based) _4_hydroxyp-quine-2 (1H) -fluorene; Ηcyclopentylamino) -3- (1,1-dioxide · 4Η-1,2,4 -Benzopyridin-3-yl) -4-light quinoline-2 (1H >ketone; 3- (1,1-dioxide_4H-1,2,4-benzothiacene_3 _Yl) -4-hydroxy small {[3-methylcyclopentyl] amino} quinoline-2 (1H) -one; 3- (1,1-dioxide-4H-1,2,4-benzene And arsenic_3_yl) doujiji-1- (tetrahydro_2H-tripan-4-ylamino) > quinoplin-2 (1 H)-酉; 3- (1,1 -Dioxide-4H-1,2,4-benzobenzopyrene, each group) small {[1-ethylbutyl] amino group 4-hydroxyquinoline-2C1H) -one; 3- (1,1 _Dioxide-4Η-1,2,4-benzopyrene two farms) -4 • Hydroxy-l-{[(3R) -3-methylcyclohexyl] amino} quinolin-2 (1Η) -one; 1- (cycloheptylamino) each (1,1_dioxide-4Η- 1,2,4-benzopyridine groups, 4-quinylquinoline-2 (1H >ketone; 3 · (1,1-dioxide-4H-1,2,4-benzothiadi Phen-3-yl) small {[3-ethylcyclopentyl] amino group 4-hydroxyquinoline-2 (1Η >ketone; 3- (1,1_dioxide_4H-1,2,4- Benzopyrene diphenyl) 4-hydroxyisopropylbutyl 89166 -77- 200427678 group] amino} quinoline-2 (1H) -one; 3- (1,1-dioxide-4 氧化 · 1, 2,4-benzothiadinyl groups) -4- # 基 -1-{[1_phenylethyl] amino} Junlin_2 (1H) _Identical; 3- (1,1- Dioxide-4H-1,2,4-benzopyrimidinium_3_yl) glacial hydroxypyridinyl ethyl] amino} quinoline-2 (1H) _one; 1-{[3,5 -Dimethylcyclohexyl] amino} -3- (1,1-dioxide-4H-1,2,4-benzopyrimidin-3-yl) -4-meryl-2 H) -pyrene; 3- (1,1-dioxide-4H-1,2,4-benzopyrene diphenyl); 4-hydroxy small [(4-isopropylcyclohexyl) amino] 4 ρ 林 -2 (1Η) -one; 3- (1,1 -— ^ oxidized-4 Η-1,2,4-benzoρ plug diρ well-3-yl) -4-meryl-1- [ 1,2,3,4-tetrachloronaphthalen-2-ylamino] -2 (1 Η) _ 酉 is the same; 3- (1,1-dioxide-4Η-1,2,4-benzothiadinyl-3-yl) glacial hydroxyl-1-{[3- (trifluoro (Methyl) cyclohexyl] amino} quinolin-2 (1H) -one; fluorenylbutylamino) _3- (1,1 · dioxide-4H_1,2,4-benzopyrimidin-3-yl ) -4-Hydroxyquinone-2 (1H) -one; 3- (1,1-Dioxide_4H-1,2,4-benzothiadinyl-3-yl) -4- # fluorenyl Small [(3-methylbutyl) amino] 4 p-Lin-2 (1-Tan-one; 3- (1,1-Dioxide-4H-1,2,4-benzopyrimidine-3- Group) -1 _ [(3-furylmethyl) amino] -4-hydroxyquinoline-2 (1H) -one; 3- (1,1-dioxide-4H-1,2,4-benzo Thioroxine: yl) small [(2-furanylmethyl) amino] -4-hydroxyquinoline-2 (1Η) · one; 3- (1,1_monooxide_4Η-1,2,4 · Benzo-p-dihex-3-yl) -4-meryl-1-[(methylphen_2 · • ylmethyl) amino] quinolin-2 (1H) -one; 3- (1, 1-Dioxide-4H-1,2,4-benzothiadinyl-3-yl) -4-hydroxy-1-[(1,3-pyrimazole-2- 89166 -78- 200427678 methylmethyl) Amine] quinoline-2 (m) -one; 3- (1,1-dioxide-4H-1,2,4-benzopyrimidin-3-yl) -l-{[(2R)- 2-ethyl-3-methylbutyl] amino} -4-hydroxyquinolin-2 (1H) -one; 3- (1,1 -Oxide-4H-1,2,4-benzopyridine_3 • yl) glacial hydroxyl [(4-methylamido) amino] quinolin-2 (1H >one; 3- (1, 1-Dioxide-4Η · 1,2,4-benzothiadinyl_3-yl) -4-hydroxy small [(3_methylamido) amino] Junlin-2 (1H) -S is the same; 3- (1,1-Dioxide-4Η-1,2,4 · benzothiadinyl group) ice hydroxyl · 1-[(2-methylbenzyl) amino] quinoline-2 (1Η)- Ketone; 3- (1,1-dioxide-4Η · 1,2,4-benzopyridine), hydroxy-ΐ-{[(3-methylpyrimin-2-yl) methyl] Amine} quinoline_2 (ιη) -one; HU-dioxide-4Η-1,2,4 · benzopyrimidin-3-yl) glacial hydroxyl [(4-methoxybenzyl) amine M-line-2 (1Η) _one; 1-{[((5-Chlorofluoren-2-yl) methyl] amino] 3- (ι, ΐ-dioxide-4H-1,2,4 -Benzothiadinyl-3-yl) -4 residue p quelin-2 (1H) -pyridine; chloro-1,3-disc-5-yl) methyl] amino group 3- ( 1,1_ Dioxin Temple recognizes benzo-p-sedition-3_yl) -4 · -Jingji Junlin · 2 (ιη) _one; Η (3-bromobenzyl) amino] -3_ (1,1-Dioxo-4Η-1,2,4-benzopyridine, 4-hydroxyquinoline-2 (1Η) -one; Η (4-bromobenzyl) amine] _3- (1,1-Dioxide_4Η-1 2,4-Benzobenzoic acid) 4-Hydroxyquinoline_2 (1 酮) -one; Η (2-Bromobenzyl) amino group; | _3 · (ι, ι_Dioxide-4H4, 2,4j bispyrimidyl) _ 4-hydroxyquinoline-2 (1H) -one; HU-dioxide-4Η · 1,2,4-benzothiadinyl_3_yl) ice hydroxyl + [(Pyridine radicals 89166 -79- 200427678 methyl) amino] quinoline-2 (1H) · ketone; 3-({[3- (1,1-Dioxide-4H-1,2,4-benzene Pyrimidin-3-yl) -4-hydroxy-2-ketoquinoline-1 (2H) -yl] amino} methyl) benzonitrile; 2-({3- [1- (cyclobutane Aminoamino) -4-¾yl-2-keto-1,2-dihydroquinolin-3-yl] -1,1-dioxide-4H-1,2,4_benzothiathine- 7-yl} oxy) acetamidamine; 2-({3- [1- (cyclopentylamino) -4-hydroxy-2-one-1,2-dihydroquinolin-3-yl] -1,1-dioxide-4H-1,2,4-benzopyrimidin-7-yl} oxy) acetamidamine; 2-({3- [1_ (cyclohexylamino) -4- # Fluorenyl-2-keto-1,2_dihydrojunin-3-yl] _1,1_dioxide-4H-1,2,4-benzop-dihex-7-yl} oxy ) Acetic acid amine; 2-[(3- {1-[(? Curtain propylmethyl) amino] -4-meryl_2-fluorenyl-1,2-dihydrojunin-3-yl}- U-Dioxide-4H_1,2,4-benzopyrimidin-7-yl) oxy] ethyl Hydrazine; 2-({3- [4-benzyl-1- (isobutylamino) _2_one-1,2-dihydrojunin-3-yl] -1,1-dioxide- 4H-1,2-benzothiagen-7-yl} oxy) acetamidamine; 2-({3- [1- (butylamino) -4-meryl-2-keto-1, 2-dihydro p-quelin · 3-yl] -1,1-dioxide-4H-1,2,4-benzopyrimidin-7-yl} oxy) acetamidamine; 2-[(3 -{4-hydroxy small [(3-methylbutyl) amino] -2-keto_1,2-dihydrofluorin-3-yl} -1,1-monoxide-4E [rl, 2 , 4-Benzopyridine-7-yl) oxy] ethynylamine; 3- (8-amino-7-peryl_1,1_dioxide-4H-1,2,4-benzene 1-Pyridinyl 1-3-yl) -4-¾yl-Kisobutylamino) quinoline-2 (1H) is the same as 2-({8-amino-3- [4-hydroxy- 1- (isobutylamino) -2-one-1,2-dihydroquinoline] -1,1-dioxide_4H-1,2,4-benzopyrene_7_ Methyl} oxy) acetamidamine; 2-({3- [4-Cycyl-2-keto-1- (propylamino) -1,2-dihydrocarbin-3-yl] -U-di Oxidation of 4H-1,2,4-benzo-p-di-di-p-well · 7-yl} oxy) ethylamine; 2-({3_ [4-side group-1- (isobutylamino) -2- Keto-1,2 · dihydrorimin-3-yl] -1,1-a-200427678 oxidized-4H-1,2,4-benzopyrimidin-7-yl} oxy Promethazine; 2-({3- [4-hydroxy_1_ (isobutylamino) -2-one-1,2-dihydroquinoline each group] -1,1-dioxide-4H- 1,2,4-benzopyridine-7-yl} oxy) butanamine; 8-amino groups of methanesulfonic acid each [4-hydroxy small (isobutylamino) -2-one group-1 ， 2-dihydroquinolin-3-yl] -1,1-dioxide-4H-1,2,4-benzopyridine-7-yl ester; 1- [(? Propylpropylmethyl) Amine] -4-Cycloyl-3- (7-Cyclo-8-nitro-1,1_dioxide-4H · 1,2,4-benzopyridine_3_yl) pyridinoline- 2 (1H) _one; 3- (7- {2-[(3S) -3-aminotetrazol p-bilo-1-yl] -2-fluorenthoxy} -1,1-dioxide- 4H-1,2,4-benzopyrimidinyl) -1-[(cyclopropylmethyl) amino] -4-hydroxyquinoline-2 (1Η) -one; 2-[(3- {1-[(Phosylpropylmethyl) amino] -4-¾yl_2-fluorenyl-1,2-dichlorojunline-3-yl} _1,1 · Monoxide_4H-1, 2,4-benzopyridine_7_yl) oxy] -N-ethylethylamine; [(3- {1 _ [(cyclopropylmethyl) amino] -4-hydroxy-2- Keto-1,2-dihydroquinolin-3-yl} -1,1_monooxide-4H-1,2,4-benzyldihexyl_7_yl) oxy] acetic acid; 3- { 7- [2- (3-Aminotetrahydrop-biha-1_yl) _2_ketoethoxy] -i, i-dioxide-4h_i 2,4-xylophenorphin-3-yl} -1-[(cyclopropylmethyl) amino] _4-amyl 4 Plin_2 (1H) -one; 3- (8-amino group -7-Hydroxy-1,1-dioxide-4H-1,2,4-benzothiadinyl group) small [(cyclopropylmethyl) amino] -4-hydroxyquinoline-2 (1Η ) -Ketone; 2-[(8-amino groups {1-[(cyclopropylmethyl) amino] -4-¾yl-2-keto-i, 2-dihydrojunline_3_yl H, l_dioxide-4H_1,2,4-benzopyrimidinyl) oxy] ethenamide; [(8-amino groups {1-[(cyclopropylmethyl) amino]]- 4-hydroxy_2-keto-i, 2-dihydrop-quelin_3-yl} -1,1-monoxide-4H-1,2,4-benzo-p-diphenyl-7-yl ) Oxy] acetonitrile; H (cyclopropylamido) amino] -4-¾yl-3- [7- (2- # 圼 ethoxydioxide · 4η_1,2,4-benzoρ plug Dihu-3-yl] Junlin-2 (1Η) · one; -81-89166 200427678 1-[(cyclopropylmethyl) amino] -4-hydroxy-3- [7- (1--imidazole- 2-ylmethoxy) -i, i-dioxide-4H1,2,4-benzopyrimidin-3-yl] quinolin-2 (1H) one; 1-[(cyclopropylmethyl) Amine] -3- [l, l-dioxide-7- (l, 3-thiazol-2-ylmethoxyy 4H-1,2,4-benzopyrene-3-yl] -4 -Hydroxyphosphonium-2 (1H) _one; 1-[(cyclopropylmethyl) amine []-Each [7- (4,5-dihydro-1H-imidazol-2-ylmethoxy) 4} monoxide-4H-1,2,4-benzofurodi-3-yl] -4 -¾Jijun-2 (1H) -Identical; 2- {[((3_ {1-[(Mediumpropylmethyl) amino] -4-¾yl-2-fluorenyl-1,2-di Chlorojunline_3-yl} -1,1-dioxide_4ΙΙ-1,2,4-benzo, selegen-7-yl) oxy] methyl} -1,3-orthofluorene- 4-carbonitrile; 3- [7- (2-aminoethoxy) -1,1_dioxide-4Η1,2,4-benzothiadinyl group] + [(; cyclopropylmethyl ) Amine] -4-hydroxyquinoline · 2 (1Η) _one; Ν_ {2-[(3- {1 _ [(Cyclopropylmethyl) amino] _4_Ethyl-2-keto_1 , 2_dihydro-4lin_3_yldioxide-4Η-1,2,4 · benzothiadinyl-7-yl) oxy] ethyl} methanesulfonamide; 3- {7-[(5 -Bromopyridin-2-yl) oxy] -1,1-dioxide-4fluorene-1,2,4-benzopyrimidin-3-yl} aspartyl-1- (isobutylamino > Quinoline-2 (m) -one; 4-hydroxy small (isobutylamino) each {7-[(3-nitropyridin-2-yl) oxy] -1,1-dioxide- 4Η-1,2,4-benzopyrene-3-ylbuquinoline-2 (1Η) -one; 3- {1-[(cyclopropylmethyl) amino] -4- # i group _2 · keto-1,2-dihydroxanthroline_3_kib 1,1_ dioxide-4Η-1, Tertiary-butyl ester of 2,4-benzothiazine-7-ylaminocarboxylic acid; 3- (7-amino-1,1-dioxo-4Η-1,2,4-benzopyrimidine Each group) small [(cyclopropylmethyl) amino] -4-hydroxypyridin-2 (1Η) -one; 2-chloro-6-({3- [4-hydroxy-1- (isobutyl Amino group) _2_keto-I, dihydrofluorin-3-yl H, l-dioxo-4fluorene-1,2,4-benzothiadinyl; Ester; -82- 89166 200427678 N- {3- [1- (cyclobutylamino) -4-hydroxy-2-one-1,2-dihydroquinoline; yl] -i, i-dioxide -4H-1,2,4-benzo-p-dial-7-yl} methylpyramine; N- (3- {1-[(cyclopropylmethyl) amino] -4-hydroxy- 2-keto-1,2-dihydroxanthine, each kibole 1,1-dioxide-4, -1,2,4-benzothiadinyl-7-yl) methanesulfonamide; Ν- (3 -{1-[(Cyclopropylmethyl) amino ρμhydroxy-2-keto-1,2-dihydro-3-quinolinylubium U-dioxide-4fluorene-1,2,4-benzo Pyrimidine-7-yl) methanesulfonamide; 2-{[3- (1-amino-4_hydroxy-2-keto-1,2-dihydro · 3-quinolinyl) -1, 1-dioxide-4fluorene_1,2,4-benzoττsedendul-7-yl] oxy} acetamidamine; Ν_ {3- [1- (cyclobutylamino) -4-imyl- 2-keto-1,2-di Hydrogen-3-junlinyl] _ι-4-4, -1,2,4-benzoρ-sedul-7-yl} ethylamine; 3- {3- [1- (cyclobutyl Amino group) glacial hydroxy-2-keto-1,2-dihydro-3-quinolinyl [丨 Molybdenum Dioxide-4Η-1,2,4-benzothiadinyl_7-yl} diazepine Lupin-μ benzyl metaborate 2,2-dioxide; Ν- {3- [1- (cyclobutylamino) glacial hydroxyl-2-keto · 1,2-dihydro_3 ^ quinidine林基] -Dioxide-4H-1,2,4-benzopyrene_7_yl} _N, _methylsulfonamide, and N- {3_ [Kcyclobutylamino group> 4 _Hydroxyaspartone- 丨, 2-dihydroquinolinyl] _1, 丨 _dioxide-4H-1,2,4-benzopyrene_7_yl} sulfonamide; or its pharmacy Acceptable salt forms, stereoisomers or tautomers. In a fifth specific embodiment, the present invention provides a compound of formula (W)

89166 -83- 200427678 where: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylthioalkyl, alkylsulfinylalkyl , Alkylsulfonylalkyl, alkynyl, aryl, arylfluorenyl, aralkyl, arylthioalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloolefin Alkyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, methylaminoalkyl, haloalkoxyalkyl, alkynyl, heteroaryl, hetero Aryl alkenyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocyclic, heterocyclic alkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RaRbNCCOp alkyl-, RaRbNC (0) NRc alkyl-, RfRgC = N- and RkO_, where R1 is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group including Alkyl, alkenyl, alkynyl, keto, i-based, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, aralkyl, heteroaralkyl, alkane Oxyalkoxyalkyl,-(alkyl) (ORc),-(alkylXNH), -SRe, -S (0) R c, -S (0) 2Re, -ORc, -N (Rc) (Re), -C (0) Rc, -C (0) 0Rc, and -C (0) NRcRe; R4 is selected from the group including alkoxy , Arylalkoxy, aryloxy, halo, hydroxyl, RaRbN-, N3 ,, ReS-, where R4 is substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of halo, nitro , Cyano, -OH, -NH2, and -COOH; R5 is independently selected at each occurrence from the group including alkenyl, alkoxy, alkyl, alkynyl, aryl, aralkyl, arylcarbonyl, and aryloxy Base, azidealkyl, formamyl, dentyl, alkynyl, carbonized, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano , Cyanoalkyl, nitro, 1 ^ 1, RaC (〇)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN-*-, Ra (0) SN (Rf) _ RaS02N (Rf), Ra (0) SN (Rf) alkyl-, RaS02N (Rf) alkyl-, -84- 89166 200427678

RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl_, RaRbNC (0)-, Rk0C (0)-, Rk0C (0) alkyl-, Rk0 alkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0 ) (Ra) P (0) 0- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, Halo, cyano, nitro, Salkyl, || alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl XORJ,-(alkylXNRcRd), -S &, _S (0) Rc, -S (0) 2Rc, -ORc, -N (Rc) (Rd), -C (0) Rc ,; R6 in each An occurrence is independently selected from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, alkyl, alkoxy, aryl, heteroaryl, heterocycle, aralkyl, heteroaryl Alkyl, heterocycloalkyl,-(alkyl) (ORk), · (alkyl, -SRa, 4 (Team 0, -S (0) 2Ra, -ORk, -N (RJ (Rb), -C (0) Ra, (0) 0 and -C (0) NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, Bulk, keto, radical, haloalkyl, cyano, nitro, -〇Ra, -NRaRb, -SRa , -SORa, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; # ^ and Rb are independently selected from each occurrence including hydrogen, alkenyl, alkyl, Alkylthioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cyclofluorenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methyl Fluorenylalkyl, _alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycle, heterocyclic fluorenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, ^! ^! ^-, Rk0-, Rk0 alkyl-, ReRdN alkyl-, ReRdNC (0) alkyl-, ReS02-, RcS02 alkyl-, ReC (O)-, ReC (O) alkyl-, Rc0C ( 0)-, Rc0C (0) alkyl-, I ^ RdN alkyl C (0)-, ReRdNC (0)-, ReRdNC (0) 0 alkyl-, 89166 -85- 200427678

RcRdNC (0) N (Re) alkyl-, where Ra and Rb are substituted with 0, 1 or 2 substituents, the substituents are selected from the group consisting of alkyl, alkenyl, alkynyl, keto, fluorenyl, cyano , Nitro, haloalkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇R〇) ,-(Carbon-based XNReRd), -SRC, -S (0) Re, -S (0) 2Rc, -0 ~, -N ^ XRd), -C (0) Rc, -C (0) 0Rc, and- C (0) NRcRd; or, 1 and 1 ^ and the nitrogen atom to which they are attached form a three- to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently 0 , 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, 1S, cyano, nitro, 1¾ alkyl, alkoxy, aryl, Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkylXNi ^ Rd), -alkyl S02NRcRd, -alkane Radicals C (0) NRcRd, -SRC, -S (0) Rc, -SCC ^ Re, -ORc, -NO ^ XRd), seven (0), -C (0) 0Rc, and -C (0) NRcRd;

Rc and Rd are independently selected at each occurrence from hydrogen, -NRfRh, -ORf, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0 ) ORf, fluorenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, 1S alkyl, heteroaryl, heteroaryl Group, heterocyclic and heterocycloalkyl; wherein each Re and ^ are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, and halo , Cyano, nitro, alkynyl, i-alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORf ),-(Alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C ( 0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf -86- 89166 200427678, -N (Re) S02NRfRh, _N (Re) C (0) NRfRh, -alkylN (Re) C (0) ORf, -alkylN (Re) S02 NRf Rh, and -alkylN (Re) C (0) NRf Rh; or, And the attached nitrogen atoms together form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocyclic rings, wherein heteroaryl and heterocyclic rings Independently substituted by 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, block, keto, fluorenyl, cyano, nitro, halo, ii-alkoxy, Aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl, (alkyl) (〇Rf),-(alkyl) (^ # 11), -31 ^ , -8 (0) 1 ^, -8 (0) 2 heart, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf & -C (0) NRfRh;

Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg, and Rh are each independently selected from the group consisting of hydrogen, alkyl, fluorenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cyclodialkyl, cycloalkenylalkyl, Heterocycle, heterocycloalkyl, heteroaryl and heteroarylalkyl; wherein each of Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl , Alkynyl, cyano, i-based, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroarylalkyl, -OH, -〇 (alkane Group) \-NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S〇2alkyl, -alkyl -OH, -alkyl-O-alkyl, -alkyl-NH2, -alkyl-N (H) (alkyl), -alkyl-N (alkyl) 2, -alkyl-S (alkyl), alkyl Group S (0) (alkyl), -alkylS02 alkyl, -N (H) C (0) NH2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, Rf and Rg and the carbon atom to which they are attached together form a three to seven-membered ring selected from cycloalkyl, cycloalkenyl, and heterocyclic rings; or, Rf and Rh and their The nitrogen atoms together form a three-to-seven-membered-87- 89166 200427678 ring, selected from the group consisting of heterocyclic rings and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently substituted by 0, 1, 2 or 3 substituents Substitution, the substituent is independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkyl, heterocyclic, heteroaryl , Heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl) , -S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS (alkyl ), -AlkylS (0) (alkyl), -alkylS02alkyl, -alkylN (alkyl) 2, -N (H) C (0) NH2, -C (0) 0H,- c (o) o (alkyl), -c (o) alkyl, -c (o) nh2 _, -C (0) NH2, -C (0) N (H) (alkyl), and -C ( 0) N (alkyl) 2;

Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, methylamino , 1¾ alkyl, heteroaryl, heteroaryl, heterocyclic, heterocycloalkyl, nitroalkyl, alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS -, RaS (0)-, RaS〇2_, RaS alkyl-, Ra (0) S alkyl-, RaS (V ^-, RaOqO)-, Ra0C (0) alkyl-, RaC (0)- , RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkenyl, alkenyl: alkynyl, keto, ||, and cyano Alkyl, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇R〇 ),-(AlkylXNI ^ Rd), -SR. , 4 (0) 1, -S (0) 2Rc, -OK, -N ^ XRd), -C (0) Rc, -C (0) 0Rc, and -CXCONReRd; and m is 0, 1, 2, 3 Or 4; with the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkynyl, decyl, aryl, halo, heteroaryl 89166 -88-200427678 group, heterocycloalkyl, cycloalkyl, cyano, nitro, 11 ^ 1 ^, 11 '(0)-, ^ 8-, Ra (0) S-, Ra (0) 2S -, RaS02N (Rf)-, RaRbNC (0)-, Rk0C (0)-, RaRbNS02-, or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aromatic , Heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, _C (0 ) 0Ra and -C (0) NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, aryl dilute, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, (Cycloalkyl) alkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl. φ For example, the present invention provides a compound of formula (Va), wherein R4 is a hydroxyl group. For example, the present invention provides a compound of formula (Va), wherein R4 is a hydroxyl group, and wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, and arylalkenyl , Aralkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, Heteroarylalkenyl, heteroaralkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, RaRbN_, RaRbN alkyl, RaRbNC (〇) alkyl-, Rf Rg C = N- and Rk Ο-. For example, the present invention provides a compound of formula (Va), wherein R4 is a hydroxyl group, and wherein R1 is selected from the group consisting of C1-C7 alkyl, phenyl-C1-C2 alkyl-, heteroaryl-C1-C2 alkane -((C3-C6 cycloalkyl) C1-C2 alkyl)-, (C1-C7 alkyl) 0-, (C3-C7 cycloalkyl) 〇, phenyl-C1-C2 alkyl-0 -, -NH2, (C1-C7 alkyl) N (H)-, (C3_C7 cycloalkyl) N (H)-, ((C3-C7 cycloalkyl) C1-C2 alkyl) N (H)- (Heterocyclic) N (H)-, (heteroaralkyl) N (H)-, (aralkyl) N (H)-. For example, the present invention provides a compound of formula (Va), wherein R4 is a hydroxyl group, and wherein R1 is selected from the group consisting of isopropyl, 3-methylbutyl, butyl, isobutyl, and phenyl 89166-89- 200427678 Methyl, pyrimidinylmethyl, cyclobutylmethyl, cyclopropylethyl, -nh2, (isopropyl) N (H)-, (isobutyl) N (H)-, (3-methylbutyl ) N (H)-, (cyclobutyl) N (H)-, and (cyclopropylmethyl) N (H)-; wherein the phenylmethyl group and the pyrimidinylmethyl group are independently unsubstituted, or Substituted by 1, 2 or 3 substituents selected from alkyl, alkenyl, alkynyl, haloalkyl, halo, cyano, nitro, -NH2, -N (H) alkyl,- -N (alkyl), hydroxyl and alkoxy. In a sixth specific embodiment, the present invention provides a compound of formula (Vb)

Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and alkylcarbonylalkyl , Alkylthioalkyl, alkylsulfinylalkyl, alkylsulfinylalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonyl Alkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, formylalkyl, i Alkoxyalkyl, iS alkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl , Nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RaRbNCCOP alkyl-, RaRbNC (0) NRc alkyl-, RfRgON-, and RkO-, where R1 is 0, 1, 2 or 3 substituents, the substituents are independently selected from -90- 89166 200427678 including alkyl, fluorenyl, decyl, keto, iS, cyano, nitro, halo, alkoxy, aromatic , Heteroaryl, heterocyclic, aralkyl, heteroaralkyl Alkoxy alkoxyalkyl, - (burn-yl) (〇R〇), - (alkyl) (^ heart), - SR. , 4 (0) heart, -8 (0) 2 heart, -0 &, -N (Rc) (Re), seven (0) 1, -C (0) 0Rc and -C (0) NRcRe; R4 series Selected from alkoxy, arylalkoxy, aryloxy, i-based, hydroxy, RaRbN-, N3-, ReS-, where R4 is substituted with 0, 1 or 2 substituents, and the substituents are independently selected Includes halo, nitro, cyano, -OH, -see 12 and -COOH; R5 is independently selected from each occurrence including alkenyl, alkoxy, alkyl, decanyl, aryl, aralkyl , Arylcarbonyl, aryloxy, azidoalkyl, methylamino, i-based, fluorenyl, halogenated carbon, heteroaryl, heteroaralkyl, heterocycle, heterocycloalkyl, hydroxyalkyl, Cycloalkyl, cyano, cyanoalkyl, nitro, \ 1 ^ 乂, RaQO)-, RaS-, Ra (0) S-, Ra (0) 2S ·, RaRbN alkyl-, \ (0 is Fengxin)-, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl-; RaS02N (Rf) alkyl-, RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl-, RaRbNC (0)- , Rk0C (0)-, Rk0C (0) alkyl-, RkOalkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0-, and -ORk, where each R5 is independently 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, Keto, halo, cyano, nitro, alkynyl, || alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,- (Alkyl) (ORc),-(alkylXNReRd), -SRe, -S (0) Re, -S (0) 2Rc, -ORc, -NdXRd), -C (0) Rc, -C (0 ) 0Re and -C (0) NRcRd; R6 is independently selected from each group including alkyl, fluorenyl, alkynyl, halo, cyano, nitro, iSalkyl, ilalkoxy, aryl , Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (〇Rk),-(alkyl) (NRaRb) -91- 89166 200427678, -SRa, 4 (Team 0, -S (0) 2Ra, -ORk, -N ^ XRb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; each R6 is independently 0, 1 , 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, keto, keto, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa , -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra;

Ra and Rb are each independently selected from the group consisting of hydrogen, fluorenyl, alkyl, alkylthioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cycloalkenyl, and cycloalkene Alkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formamylalkyl, fluorenyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocyclic, heterocyclic Alkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, f ^ RdN-, RkO-, RkO alkyl-, I ^ RdN alkyl-, RcRdNC (0) alkyl-, ReS02-, ReS02 Alkyl-, RcC (0)-, ReC (O) alkyl-, Rc0C (0)-, ReOC (0) alkyl-, ReRdN alkylC (O)-, R ^ RdNCCO)-, ReRdNC (0) 0 alkyl, RcRdNC (0) N (Re) alkyl-, the center and ^ of which are substituted with 0, 1 or 2 substituents, the substituents are selected from the group consisting of alkyl, alkenyl, alkynyl, Keto, self, cyano, nitro, || alkyl, || alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl, -(Alkyl) (〇R〇),-(alkylχΝ & Ι ^), -SRe, -S (0) Re, -S (0) 2Rc, -OK, -N ^ XRd), -C ( 0) Rc, -C (0) 0Rc, and -CCCONReRd; or, the heart and ^ and their connected The atoms together form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocyclic rings, wherein the heteroaryl and heterocyclic ring systems are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group including alkyl , Alkenyl, block, keto, halo, cyano, nitro, haloalkyl, self-oxyl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxy Alkoxyalkane-92- 89166 200427678 group,-(alkyl) (〇Rc),-(alkylXNI ^ Rd), -alkyl S02NRcRd, -alkyl C (0) NRcRd, -SRC, -S (0 ) Re, -S (0) 2Rc, -ORc, -N ^ XRd), < (0) 1 ^,-;

Rc and Rd are independently selected at each occurrence from hydrogen, _NRfRh, -ORf, -CO (Rf) λ -SRf λ -SORf λ -S〇2 Rf% -C (0) NRfR ^ λ -S〇2NRfR .j1% -C (0) 0R ^, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenyl, aryl, aryl, halo , Heteroaryl, heteroaryl, heterocyclic and heterocycloalkyl; wherein each of Rc and Rd is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, Alkynyl, keto, halo, cyano, nitro, alkynyl, iSalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl ,-(Alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), C ( 0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N (Re) S02NRfRh, -N ( Re) C (0) NRfRh, -alkylN (Re) C (0) ORf, -alkylN (Re) S02 NRf Rh and -alkylN (Re) C (0) NRf Rh; or, Re and 1 ^ and the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocyclic rings, wherein heteroaryl is independent of the heterocyclic ring system 〇, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, keto, 1¾, cyano, nitro, alkyl, alkoxy, aryl, Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf), -〇 ^ *) (NRfRh), -SRf, -S (0 ) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and -C (0) NRfRh; Re is selected from the group consisting of hydrogen, Alkenyl, alkyl and cycloalkyl;

Rf, Rg, and Rh are each independently selected from the group consisting of hydrogen, alkyl, alkenyl-93-89166 200427678, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, ring Fluorenylalkyl, heterocycle, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of Alkyl, alkenyl, alkynyl, cyano, li, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH -O (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl , -Alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl ), -Alkyl S (0) (alkyl), -alkyl S02 alkyl, -N (H) C (0) NH2, -C (0) 0H, _c (o) o (alkyl),- c (〇) alkyl, -C (0) NH2, -C (0) NH2, _C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, Rf and Rg and the carbon atoms to which they are attached form a three- to seven-membered ring selected from cycloalkyl, cycloalkenyl, and heterocyclic rings; or 1 ^ forms a three- to seven-membered ring together with Rh and the nitrogen atom to which they are attached, and is selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently 0, 1, 2 or 3 Substituted by substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, IS, keto, nitro, aryl, aralkyl, cyclic > Ring, heteroaryl, heteroaryl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl),- S (alkyl), -S (0) (alkyl), -alkyl-OH, -alkyl-O-fe, -fe-NH2, -alkyl-N (H) (fe-based),- AlkylS (alkyl), -alkylS (0) (alkyl), alkylS02alkyl, -alkylN (alkyl) 2, -n (h) c (o) nh2, _C (0 ) 0H, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2;

Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, and methylamino- 94- 89166 200427678 group, haloalkyl, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC ( 0) alkyl, RaS-, RaS (0) _, RaS02-, RaS alkyl-, Ra (0) S alkyl-, RaS (VM * group-, Ra0C (0)-, Ra0C (0) alkyl -, RaC (0) ·, RaC (0) alkyl, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, and keto , IS group, cyano, nitro, 1S alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl ) (〇Rc),-(alkylXNReRd), -SRe, _S (0) Re, -8 (0) 2, -ORe, -NdXRd), -C (0) 0Rc, and -C (0) NRcRd; and m is 0, 1, 2, 3, or 4; with the proviso that when R4 is hydroxyl or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo, or -0Rk, and R6 is Hydrogen, alkyl, fluorenyl, alkynyl, halo, cyano, nitrate Group, aryl, heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra and -C (0) NRaRpf, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) Alkenyl, (cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl. For example, the present invention provides a compound of formula (Vb), wherein R4 is a hydroxyl group. For example, the present invention provides a compound of formula (Vb), wherein R4 is a hydroxyl group, and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, Aralkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, methylamino, ialkyl, heteroalkyl Aryl alkenyl, heteroaralkyl, heterocycle, heterocyclen-95- 89166 200427678 group, heterocycloalkyl, hydroxyalkyl, RaRbN-, RaRbN alkyl ·, RaRbNC (0) pit group-, RfRgC = N- and Rko-. For example, the present invention provides a compound of formula (Vb), wherein R4 is a hydroxyl group, and wherein R1 is selected from the group consisting of C1-C7 alkyl, phenyl-C1-C2 alkyl-, heteroaryl-C1-C2 alkyl- ((C3-C6 cycloalkyl) C1-C2 alkyl)-, (C1-C7 alkyl) 0-, (C3-C7 cycloalkyl) 0-, phenyl-C1-C2 alkyl-0- , -NH2, (C1-C7 alkyl) N (H)-, (C3-C7 cycloalkyl) N (H)-, ((C3-C7 cycloalkyl) C1-C2 alkyl) N (H) -, (Heterocyclic) N (H)-, (heteroaralkyl) N (H)-, (aralkyl) N (H)-. For example, the present invention provides compounds of formula (Vb), wherein R4 is a hydroxyl group, and wherein R1 is selected from the group consisting of isopropyl, 3-methylbutyl, butyl, isobutyl, phenylmethyl, and thienyl. Methyl, cyclobutylmethyl, cyclopropylethyl, -NH2, (isopropyl baitium-, (isobutyl) N (H) ·, (3-methylbutyl) N (H) ·, ( (Cyclobutyl) N (H) · and (cyclopropylmethyl) N (H) _; wherein phenylmethyl and pyrimidinylmethyl are independently unsubstituted or substituted by 1, 2 or 3 Substituents, the substituents are selected from the group consisting of alkyl, alkenyl, alkynyl, haloalkyl, halo, cyano, nitro, _Nh2, _N (H) alkyl, -N (alkyl), hydroxyl, and alkyl In the seventh specific embodiment, the present invention provides a compound of formula (Via) ° νο

Or a musically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl 89166 -96- 200427678, Alkylcarbonylalkyl, Alkylthioalkyl, Alkylsulfinamidoalkyl, Alkylsulfonate: fe, block, aryl, arylfluorenyl, aralkyl, arylthio Alkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, Formamylalkyl, alkoxyalkyl, fluorenyl, heteroaryl, heteroarylfluorenyl, heteroarylsulfonyl, heteroarylsulfonylsulfonyl, heterocycle, heterocyclyl, heterocyclic Cycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, R ^ RbNCCOp alkyl-, RaRbNC (0) NRc alkyl-, RfRgC = N- and RkO-, where R1 is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, decanyl, keto, cyano, nitro, halo, halo Alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl , Alkoxyalkoxyalkyl,-(alkyl) (0Rc),-(alkylXNH), -SRC, -S (0) Re, -S (0) 2Rc, -0RC, -N (Rc) (Re), -C (0) Re, -C (0) 0Rc and -C (0) NRcRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN -, N3-, ReS-, where R4 is substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 &-CO0H; R5 is Each occurrence is independently selected from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidoalkyl, formamyl, 1¾, Alkyl, Carbocarbon, Heteroaryl, Heteroaryl, Heterocyclic, Heterocycloalkyl, Hydroxyalkyl, Cycloalkyl, Cyano, Cyanoalkyl, Nitro, 1 ^ 1 ^ 乂, RaC ( 0)-, RaS_, Ra (〇) S ·, Ra (0) 2S-, RaRbN alkyl-, heart (0) 8 wind heart)-, RaS02N (Rf) _, Ra (0) SN (Rf) alkane Base-, RaS02N (Rf) alkyl-, RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl-, RaRbNC (0)-, Rk0C (0)-, Rk0C (0) alkyl, Rk0 alkyl-, RaRbNS02 -, RaRbNS02 alkyl-, 89166 -97- 200427678 (Rb 0) (Ra) P (0) 0- and -0¾ 'wherein each R5 is independent Substituted by 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, alkyl, i-alkoxy, aryl , Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,-(alkylXNI ^ Rd), -S &, -S (0) Re , 3 (0) 21, -0 &, -N (Rc) (Rd), -C (0) Re, -C (0) 0Re, and ((C ^ NReRd; R6) are independently selected from each occurrence Including alkenyl, dilute, block, halo, cyano, nitro, sulfonyl, sulphenyl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkane Group,-(alkyl) (ORk),-(alkyl) (NRaRb), -SRa, 4 (0) ¾, -S (0) 2Ra, -ORk, -N ^ XRb), -C (0) Ra, -C (0) 0Ra and -C (0) NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, and ketone Group, li group, haloalkyl group, cyano group, nitro group, -0Ra, -NRaRb, -SRa, -SOI ^, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0 ) Ra; \ and Rb are independently selected from each occurrence including hydrogen, fluorenyl, alkyl, alkylthioalkyl, aromatic Base, arylalkenyl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methylamino, alkenyl Base, heteroaryl, heteroarylfluorenyl, heteroarylalkyl, heterocycle, heterocyclenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, ReRdN-, Rk0-, Rk0 alkyl- , ReRdN alkyl, RcRdNC (0) alkyl-, R ^ Of, RcS02 alkyl-, RcC (O)-, ReC (O) alkyl-, Rc0C (0)-, KOCXO) alkyl-, ReRdN alkyl C (0)-, ReRdNC (0)-, RcRdNC (0) 0 alkyl-, ReRdNCXCON ^) alkyl-, where 1 ^ and & are substituted with 0, 1 or 2 substituents, and the substituents are selected Including alkyl, alkenyl, alkynyl, keto, halo, cyano-98- 89166 200427678, nitro, haloalkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl , Heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl XORJ,-(alkyl XNT ^ Rd), surface SRC, -3 (0 team, -S (0) 2Rc, _0 heart, -NdXRd ), -C (0) Rc, -C (0) 0Rc, and -C (0) NReRd; or, the heart and ^ and the nitrogen atom to which they are attached form a three- to six-membered ring, selected from the group consisting of heteroaromatics And heterocycles, where heteroaryl And heterocyclic ring systems are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, li, cyano, nitro, li alkyl, Alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkyl) (NRcRd) , -AlkylSC ^ NReRd, -alkylC (0) NRcRd, -SRe, -S (0) Rc, 4 (0) 2 ^, -ORe, -NCReXRd), < (team 0, -C ( 0) 0Re & -C (0) NRcRd;

Rc and Rd are independently selected at each occurrence from hydrogen, -NRfRh, -ORf, -C0 (Rf) > -SRf > -SORf > -S02Rf ^ -C (0) NRfRh ^ -S02NRfRh ^- C (0) 0Rf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, haloalkyl, heteroaryl, Heteroaralkyl, heterocyclic and heterocyclic docking groups; wherein each of Re and Rd is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, and keto , Halo, cyano, nitro, alkyl, halooxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl ) (0Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -〇Rf, -N (Rf) (Rh), -C (0) Rf _C (0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N ^^ C ^ NRfRh, -N (Re) C (0) NRfRh, -alkylN (Re) C (0) ORf, -alkylN (Re) S02 NRf Rh, and -alkylN (Re) C (0) NRf Rh; -99- 89166 200427678 or, The heart forms a three- to six-membered ring with Rd and the nitrogen atom to which they are attached, and is selected from the group consisting of heteroaryl and heterocycle, wherein heteroaryl And heterocyclic ring systems are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, 1S, cyano, nitro, 1S alkyl, Haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) (_ ^ 1 ^), -8 hearts, -8 (0) ^, 4 (0) 2 hearts, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and -C (0) NRfRh;

Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg and Rh are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocyclic, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and ^ is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl and alkynyl , Decyl, cyano, halo, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroarylalkyl, -OH, -〇 (alkane Group), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl, -alkyl- OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkylh, -alkylN (alkyl) 2, -alkylS (alkyl), -alkyl S (0) (alkyl), -alkyl802 alkyl, -N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -C (O) Alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, Rf and Rg and each other And the attached carbon atoms together form a three- to seven-membered ring selected from cycloalkyl, cycloalkenyl and heterocyclic rings; or & connected to Rh and their The nitrogen atoms together form a three- to seven-membered ring, selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independent Selected from the group consisting of alkyl, 89166-100-200427678 alkenyl, alkynyl, cyano, i-based, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl , Heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl) , -S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS (alkyl) ), -Alkyl (S) (O) (alkyl), -alkylS02 (alkyl), -alkylN (alkyl), -n (h) c (o) nh2, -C (0) 0H,- c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0 ) N (alkyl) 2;

Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, methylamino , Alkyl, heteroaryl, heteroaryl, heterocyclic, heterocycloalkyl, nitroalkyl, I ^ RbN alkyl-, RaO alkyl-, RaRbNC (0) _, RaRbNC (0) alkane Group, RaS-, RaS (0)-, RaS02-, RaS alkyl-, Ra (0) S alkyl- ,! ^ 802 alkyl-, RaOC (O)-, Ra0C (0) alkyl ·, RaC (0)-, ICXO) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, substituted The group is independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, alkynyl, cyano, nitro, ialkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, hetero Aralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc), · (alkyl) (^ ¾), -SRC, 4 (0) 1 ^, -S (0) 2Rc,- 0RC, -N ^ XRd), -C (0) 0Rc and -C (0) NRcRd • 'and m are 0, 1, 2, 3 or 4; with the proviso that R4 is alkoxy, aryloxy Group, hydroxy or ReS-, and R5 is hydrogen, allyl, alkoxy, alkynyl, block, aryl, fluorenyl, heteroaryl, heterocycloalkyl, cycloalkyl, cyano, nitro, !! ^! ^! ^ ,! ^^. )-,! ^ 』-, Ra (0) S-, Ra (〇) 2S ·, RaS〇2N (Rf)-, RaRbNC (0)-, Rk0C (0)-, 89166 -101-200427678

RaRbNS02- or -〇Rk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa, -S (0) When Ra, -S (0) 2Ra, -〇Rk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb, then Ri is not 氲, Alkenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) tigeryl, heteroaryl, heteroarylalkenyl , Heteroarylalkyl, heterocycloalkenyl or heterocycloalkyl. For example, the present invention provides a compound of formula (Via), wherein R4 is hydroxy. For example, the present invention provides a compound of formula (Via), wherein R4 is a hydroxyl group, and R1 is selected from the group consisting of hydrogen, alkenyl, alkynyl, alkynyl, alkynyl, alkynyl, arylalkenyl, Aralkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, methylamino, 12-alkyl Aryl alkenyl, heteroaryl, heterocyclic, heterocyclic fluorenyl, heterocycloalkyl, hydroxyalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RfRgC = N_ and RkO-. For example, the present invention provides compounds of formula (Via), wherein R4 is a radical, and R1 is selected from the group consisting of hydrogen, C1-C7 alkyl, C1-C6 fluorenyl, (C3-C7 cycloalkyl) (C1-C2 Alkyl)-, (C5-C6 cyclofluorenyl) (C1-C2 alkyl)-, C3-C7 cycloalkyl, phenyl-C1-C2 alkyl-, furyl (C1-C2 alkyl)-, Thienyl (C1-C2 alkyl)-, phenyl (C1-C2 alkyl)-, pyridyl (C1-C2 alkyl)-, pyrazolyl (C1-C2 alkyl)-, isoxazolyl ( C1-C2 alkyl)-, fluorenyl (C1-C2 alkyl), benzopyrimyl (C1-C2 alkyl)-, indolyl (C1-C2 alkyl)-, phenyl N (H) (C1-C6 alkyl)-, (C1-C7 alkyl) 0-, (C3-C6 cycloalkyl) 0-, ((phenyl) C1-C2 alkyl) 0-, phenyl CH = N- , NH2, (C1-C7 alkyl) N (H)-, (C1-C7 fluorenyl) N (H)-, (C3-C7 cycloalkyl) N (H)-, ((C3-C7 cycloalkane) Group) C1-C2 alkyl) N⑻-, ((phenyl) C1-C2 alkyl) N⑻- 89166 -102- 200427678, (far-phenylmethyl) N (H)-, (predazolylmethyl) N (H)-, (furylmethyl) N (H)-, (tonylmethyl) N (H)-, (tetrahydropiperan) N (H)-, (benzyl) N (H )-, (Tetrahydronaphthyl N (H)-, wherein each R1 is substituted with 0, 1, 2 or 3 substituents, and the substituents are selected from the group consisting of alkyl, hydroxyl, keto, halide, cyano, nitro, haloalkyl, and Base, alkoxy, alkoxy, phenyl, hexahydrotolyl, morpholinyl, carboxyl, -C (0) 0 (alkyl), -NH2, -NH (alkyl), -N (Alkyl) 2, -0, phenyl. For example, the present invention provides a compound of formula (Via), wherein R4 is a hydroxyl group, and R1 is selected from the group consisting of phenylmethyl, phenylethyl, C3 alkyl, C4 alkyl, C5 alkyl, and cyclopropylmethyl. , Cyclopropylethyl, cyclobutylmethyl, (5-chloro-pyrimphen-2-yl) methyl- (C3 alkyl) N (H)-, (C4 alkyl) N (H)-, (C5 Alkyl) N (H)-, (cyclobutyl) N (H)-and (cyclopropylmethyl) N (H)-. In an eighth embodiment, the present invention provides a compound of formula (VIb)

Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and alkylcarbonylalkyl , Alkylthioalkyl, alkylsulfinylalkyl, alkylsulfinylalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonyl Alkylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, formamyl 89166 -103- 200427678 alkyl, alkoxyalkyl, _alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkenyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkyl, heterocycloalkyl Alkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, I ^ RbNCCOp alkyl ... RaRbNC (0) NRc alkyl-, RfRgON- and RkO-, Wherein R1 is substituted by 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, alkynyl, cyano, nitro, haloalkyl, and alkoxy Aryl, heteroaryl, heteroaryl, heterocyclic, aralkyl, heteroarane , Alkoxyalkoxyalkyl,-(alkyl) (0RC),-(alkyl × ΝΤ ^ Ι), -SRc, -S (0) Rc, -S (0) 2Re, -0Rc, -NRXRJ, -. (0), -C (0) 0Rc and -C (0) NRcRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, self-group, hydroxyl, RaRbN-, N3-, and S -, Wherein R4 is substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 &-C00H; R5 is independently selected from each occurrence Including alkenyl, alkoxy, alkyl, block, aryl, aryl, arylcarbonyl, aryloxy, azido, methyl, hydrazyl, 1¾, self-fe, 1⁄2 Heteroaryl, heteroaryl, heterocycle, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, 1 ^ 1 ^, RaC (0)-, R & S-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl_, 1 ^ (〇) 3 风 1 ^)-, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl -, RaS〇2N (Rf) alkyl-, RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl-, RaRbNC (0)-, Rk0C (0)-, Rk0C (0) alkyl-, Rk0 alkyl- , RaRbNS02_, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0-, and -0Rk, wherein each R5 is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group including alkyl , Alkenyl, alkynyl, keto, halo, cyano, nitro Alkyl, oxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (0RC) 89166 -104- 200427678,-(alkyl ) (NRcRd), -SRe, -S (0) Rc, -S (0) 2Rc, -ORc, -N (Rc) (Rd), -C (0) Rc, -C (0) ORe, and -C (0) NReRd; R6 is independently selected from each group including alkyl, alkenyl, alkynyl, halo, cyano, nitro, alkyl, alkoxy, aryl, heteroaryl, heterocyclic ring , Aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkylXNf ^ Rb), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents The substituents are independently selected from the group consisting of alkynyl, fluorenyl, block, syl, alkynyl, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C (0) 0Ra, -C (0) NRaRb and _NC (0) Ra;

Ra is independently selected from each occurrence including hydrogen, alkenyl, alkyl, alkylthioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cyclofluorenyl, cycloalkenyl Alkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methylaminoalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycle, heterocycloalkene Alkyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, ReRdN-, RkO-, RkO alkyl-, RcRdN alkyl-, RcRdNC (0) alkyl-, RcS02-, 11 ^ 02 alkylΓ , ReCCO)-, ReC (O) alkyl-, & 0: 0:-, Rc0C (0) alkyl-, I ^ RdN alkyl C (O)-, ReRdNCXO)-, R ^ RdNCCOp alkyl -, KRdNCCCONd) alkyl-, the center and Rb of which are substituted by 0, 1 or 2 substituents, the substituents are selected from the group consisting of alkyl, dilute, decanyl, keto, keto, cyano, nitro, _ Alkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORc),-(alkylXNReRd), -SRC, -SCO ^, -S (0) 2Re, -ORe, -N ^ XRd), -C (0) Re, -C (0) 0Rc, and -C (0) NRcRd; 89166 -105- 200427678 or , ^ Connected to Rb and theirs The nitrogen atoms together form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocyclic rings, wherein the heteroaryl and heterocyclic ring systems are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of Alkyl, fluorenyl, alkynyl, keto, alkynyl, cyano, nitro, dentyl, #alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkane Oxyalkoxyalkyl,-(alkyl) (〇R〇),-(alkylXNReRd), -alkylSO2NReRd, -alkylC (O) cRd, -SI, -S (0) Re, 4 (0) 2 heart, -ORc, -howl) (~), -C Europe, -C (0) 0R ^ -C (0) NRcRd;

Rc and Rd are independently selected from each occurrence including hydrogen, ^? ^^,-. ! ^, -CO (Rf), _SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) 0Rf, fluorenyl, alkyl, alkynyl, cycloalkyl, cycloalkyl Alkyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, haloalkyl, heteroaryl, heteroaralkyl, heterocyclic and heterocycloalkyl; each Re and Rd are independently 0 , 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, || alkyl, haloalkoxy, aryl , Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORf),-(alkyl) (NRfRh), _SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh) ^ -C (0) Rf > -C (0) 0Rf ^ -C (0) NRfRh ^ -C (0) N ( H) NRfRh > -N (Re) C (0) 0Rf, -N (RJS02NRfRh, -N (Re) C (0) NRfRh, -alkylN (Re) C (0) 0Rf, -alkylN ( Re) S02 NRf Rh and -alkylN (Re) C (0) NRf Rh; or, the heart and ^ and the nitrogen atom to which they are attached form a three- to six-membered ring, selected from the group consisting of heteroaryl and hetero Ring, wherein heteroaryl and heterocyclic ring are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of Base, alkenyl, alkynyl, keto, alkynyl, cyano, nitro, 1⁄2 alkyl, alkoxy, 89166 -106- 200427678 aryl, heteroaryl, heterocyclic, aralkyl, heteroaryl Alkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) (see ^ 1 ^), -81 ^, name (0) 1 ^, _8 (0) 21 ^ , -ORf, -N (Rf) (Rh), -C (0) Rf, _C (0) 0Rf & -C (0) NRfRh;

Re is selected from the group consisting of hydrogen, alkyl, alkyl and cycloalkyl;

Rf, Rg and Rh are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocyclic, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group including alkenyl, alkenyl, Decanyl, random, functional, i-iso, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroarylalkyl, -OH, -〇 (alkane Group), _NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl, -alkyl-OH , -Alkyl-O-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl), -alkylS (0) (Carbonyl), -alkyl S02 alkyl, -N (H) C (0) NH2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkane -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, ^ and \ and their The connected carbon atoms together form a three- to seven-membered ring selected from cycloalkyl, cycloalkenyl, and heterocyclic rings; or, Rf and Rh and their connected The nitrogen atoms together form a three- to seven-membered ring selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from Including alkyl, dilute, decyl, cyano, fluorenyl, keto, nitro, aryl, aryl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl,- OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl), -S (0) ( (Alkyl), -alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl) 89166 -107- 200427678, -alkylS (alkyl), -Alkyl S (0) (alkyl), -alkyl S02 alkyl, -alkyl N (alkyl) 2, -n (h) c (o) nh2, -C (0) 0H, -c ( o) o (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (Alkyl) 2;

Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aralkyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methylamino , Haloalkyl, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0) _, RaRbNC (0) alkyl, RaS-, RaS (0)-, RaS02-, RaS alkyl, Ra (0) S alkyl-, 302 alkyl-, RaOC (0)-, Ra0C (0) alkyl-, RaC ( 0)-, RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, dilute, decyl, keto, halo, Cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORe) ,-(AlkylXNReRd), -SRC, -S (0) Re, -3 (0) 2 heart, -〇Rc, -N (Rc) (Rd), heart (0 where, -C (0) 0Rc And -C (0) NRcRd; and m is 0, 1, 2, 3, or 4; with the proviso that when R4 is hydroxyl or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo, or- 0Rk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro Aryl, heteroaryl, heterocycloalkyl, 41 ^, -3 (0) 1 ^, -S (0) 2Ra, -0Rk, -N (Ra) (Rb), -C (0) Ra,- C (0) 0Ra and -C (0) NRaRpf, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) association Group, (cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl. For example, the present invention provides compounds of formula (VIb), wherein R4 is Hydroxyl, and R1 89166-108- 200427678 is selected from the group consisting of hydrogen, C1-C7 alkyl, C1-C6 alkenyl, (C3-C7 cycloalkyl) (C1_C2 alkyl)-, (C5-C6 cyclofluorenyl) (C1-C2 alkyl)-, C3-C7 cycloalkyl, phenyl-Cl-C2 alkyl-, furyl (C1-C2 alkyl)-, pyrenyl (C1-C2 alkyl)-, benzene (C1-C2 alkyl)-, pyridyl (C1-C2 alkyl)-, pyrazolyl (C1-C2 alkyl)-, isoxazolyl (C1-C2 alkyl)-, fluorenyl (C1 -C2 alkyl), benzopyrimyl (C1-C2 alkyl)-, pyridoyl (C1-C2 alkyl)-, phenyl N (H) (C1-C6 alkyl)-, (C1-C7 alkyl Group) 0-, (C3-C6 cycloalkyl) 0_, ((phenyl) C1-C2 alkyl) 0-, phenyl CH = N-, NH2, (C1-C7 alkyl) N (H)-, (C1-C7 alkenyl) N (H)-, (C3-C7 cycloalkyl φ) N (Η)-, ((C3-C7 cycloalkane Group) C1-C2 alkyl) N (Η)-, (phenyl) C1-C2 alkyl) N (Η)-, (pyriminylmethyl) N (Η)-, oxazolylmethyl) Ν (Η)-, (furylmethyl) N (Η)-, (pyridylmethyl) N (Η) _, (tetrahydropiperan) N (Η)-, (fluorenyl) N (Η) -, (Tetrahydronaphthyl) N (Η)-, wherein each R1 is substituted with 0, 1, 2 or 3 substituents, and the substituents are selected from the group consisting of alkyl, hydroxy, keto, Nitro, haloalkyl, hydroxy, alkoxy, haloalkoxy, phenyl, hexahydropyridyl, morpholinyl, carboxyl, -C (0) 0 (alkyl), -NΗ2, -ΝΗ (Alkyl), -N (alkyl) 2, -0 alkyl, -0-phenyl. For example, the present invention provides a compound of formula (VIb), wherein R4 is a hydroxyl group, and R1 is selected from the group consisting of phenylmethyl, phenylethyl, C3 alkyl, C4 alkyl, C5 alkyl, and cyclopropylmethyl. , Cyclopropylethyl, cyclobutylmethyl, (5-chloro-pyrimin-2-yl) methyl- (C3 alkyl) N (H) _, (C4 alkyl) N (H)-, ( C5 alkyl) N (H)-, (cyclobutyl) N (H)-and (cyclopropylmethyl) N (H)-. In a ninth specific embodiment, the present invention provides a compound of formula (VII) 89166 -109- 200427678

Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, amidino, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and alkylcarbonylalkyl , Alkylthioalkyl, alkylsulfinylalkyl, alkylsulfinylalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonyl Alkylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, methylamino, Trisoxyl, haloalkyl, heteroaryl, heteroaryl allyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl , Nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, f ^ RbNQOP alkyl-, RaRbNC (0) NRc alkyl ·, RfRgC = N- and RkO-, where R1 is 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, haloalkyl, halooxy, aryl , Heteroaryl, heterocyclic, aralkyl, heteroaryl, alkoxyalkoxy Group,-(alkyl) (〇Rc),-(alkyl) (^ 1), -SRC, -S (0) Rc, -S (0) 2Re, -ORc, -N (Rc) (Re) , -C (0) Rc, -C (0) 0Rc, and -C (0) NRcRe; R4 is selected from alkoxy, arylalkoxy, aryloxy, fluorenyl, hydroxyl, RaRbN-, N3 -, ReS-, where R4 is substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 and-89166 -110- 200427678 cooh; R5 in Each occurrence is independently selected from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidoalkyl, formamyl, radical, S Alkyl, carbonized, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, 11C, RaC (0 )-, RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, Ra (0) SN (Rf)-, RaS02N (Rf) _, Ra (0) SN (Rf) alkane Base-, RaS02N (Rf) alkyl-, RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl-, R ^ RbNCCO)-, Rk0C (0)-, Rk0C (0) alkyl-, RkO alkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0- and -ORk, where each R5 is independently replaced by 0, 1, 2 or 3 Substitution, the substituent is independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, self-burning, self-burning oxy, aryl, heteroaryl, heterocyclic, arane , Heteroarylalkyl, alkoxyalkoxyalkyl,-(alkyl) (〇RO),-(alkyl) (NRcRd), -S &, -S (0) Rc, 4 (0) 2-He, -OR ^, -N ^ XRd), -CXO)! ^, -C (0) 0Re and ((CONReRd; R6 in each case where it is present are independently selected from the group including alkyl, alkenyl, alkynyl, Halo, cyano, nitro, iSalkenyl, D-oxyl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk) ,-(Alkyl) (^ ¾), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (RJ (Rb), -C (0) Ra, -C (0 ) 0Ra and -C (0) NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, ||, Haloalkyl, cyano, nitro, -0Ra, -NRaRb, -SRa, -SORa, -S02Ra,-(3 (0) 0¾, -C (0) NRaRb & _NC (0) Ra;

Ra and Rb are each independently selected from the group consisting of hydrogen, alkenyl, alkyl, thiol 89166 -111-200427678 thioalkyl, aryl, arylalkyl, aryl, chloro, Cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methylamino, haloalkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl , Heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitro l !, RcRdN-, RkO-, RkO alkyl-, ReRdN alkyl-, RcRdNC (0) alkyl-, RcS02- , ReS02 alkyl-, ReC (O)-, ReC (O) alkyl-, Rc0C (0)-, Rc0C (0) alkyl-, alkylC (O)-, RcRdNC (0)-, ReRdNC ( 0) 0 alkyl-, RcRdNCCCONd) alkyl-, where \ and Rb are substituted with 0, 1 or 2 substituents, the substituents are selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano Group, nitro, 1¾ alkyl, || alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORe) ,-(Synthetic radical XNi ^ Rd), -SRe, famous melons, 4 (0) 21, -0 \ "NCReXRd), -C (0) Rc, -C⑼ORc, and -C (0) NRcRd; or, Connected with ^ and them The nitrogen atoms together form a three- to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic rings, wherein the heteroaryl and heterocyclic ring systems are independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group including alkane Alkyl, alkenyl, decyl, keto, halo, cyano, nitro, pico, alkoxy, aryl, heteroaryl, heterocyclic, aryl, heteroaryl, aryl Oxygen radical,-(alkyl) (〇Rc),-(alkyl) (NReRd), -alkyl SC ^ NI ^ Rd, -alkyl CCC ^ Ni ^ Rd, -SRe, ^ (0) 1 ^, -S (0) 2 &, -ORe, -T ^ RjRd),-(:( 0) &,-(:( 0) 01 ^-(3 (0) 1 ^ ¾; R〇 And Rd are independently selected at each occurrence from the group including hydrogen, -NRfRh, -ORf, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) 0Rf, fluorenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cyclofluorenyl, ring 89166-112- 200427678 alkenylalkyl, aryl, aralkyl, fluorenyl, heteroaryl , Heteroaralkyl, heterocyclic, and heterocycloalkyl; wherein each of Re and Rd is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, block, and ketone Base, halo, cyano, nitrate Alkyl, i-alkyl, commercial alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORf),-(alkane (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf,- C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N (Re) S02NRfRh, _N (Re) C (0) NRfRh, -alkylN ( Re) C (0) 0Rf, -alkylN (Re) S02 NRf Rh and -alkylN (Re) C (0) NRf Rh; or, with! ^ Forms a three- to six-membered ring together with the nitrogen atom to which they are attached, selected from the group consisting of heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently substituted with 0, 1, 2 or 3 substituents, The substituent is independently selected from the group consisting of alkyl, fluorenyl, decyl, keto, alkynyl, cyano, nitro, iSalkenyl, iSalkenyl, aryl, heteroaryl, heterocyclic, aralkyl, Heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) ^! ^), ^! ^, ^ ...)! ^, ^ ...: ^! ^, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and -C (0) NRfRh;

Re is selected from the group consisting of hydrogen, fluorenyl, alkyl, and cycloalkyl;

Rf, Rg & Rh are independently selected from each occurrence including hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocyclic, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl and alkenyl , Decyl, random, 1¾, fluorenyl, nitro, aryl, aralkyl, cycloalkyl, cyclofluorenyl, heterocyclic, heteroaryl, heteroarylalkyl, OH, -0 (alkyl ), -NΗ2, · N (Η) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (89166 -113- 200427678 alkyl), -S02 alkyl,- Alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, · alkylS (alkyl), -Alkyl S (0) (alkyl), -alkyl S02 alkyl, -N (H) C (0) NH2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, Rf and Rg and the carbon atoms to which they are attached form a three- to seven-membered ring selected from cycloalkyl, cycloalkenyl and heterocyclic rings; Or, together with 1 ^ and the nitrogen atom to which they are connected, form a three- to seven-membered ring selected from the group consisting of heterocyclic rings and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently 0, 1 , 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, bromo, aryl, aryl, 1¾, fluorenyl, nitro, aryl, aryl, cycloalkyl, and cyclofluorene Group, heterocyclic ring, heteroaryl group, heteroaralkyl group, -OH, -0 (single group), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl ), -S (alkyl), -S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl) , -AlkylS (alkyl), -alkylS (0) (carbon), -alkylS02alkyl, -alkylN (alkyl) 2, -n (h) c (o) nh2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) ( Alkyl) and -C (0) N (alkyl) 2;

Rk is selected from the group consisting of nitrogen, dilute, alkynyl, aryl, aryl, alkynyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formamyl Alkyl, alkyl, heteroaryl, heteroaryl, heterocyclic, heterocyclic, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkane Group, RaS-, RaS (0)-, RaS02-, RaS alkyl-, Ra (0) S alkyl-, RaS02 alkyl-, Ra0C (0)-, RaOC (0) alkyl-, RaC (0)-, RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, decanyl, keto, and fluorenyl , Cyano, pinyl, alkyl, 89166 -114- 200427678 haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl, (alkane (ORc),-(alkylXNT ^ Rd), -SRC, -SCO)! ^, -S (0) 2Rc, -ORc, -N (Rc) (Rd), -C (0) Re, -C (0) 0Rc and -C (0) NRcRd; m is 0, 1, 2, 3, or 4; and n is 0, 1, 2, 3, or 4; with the proviso that when R4 is alkoxy , Aryloxy, hydroxy, or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, l i-group, heteroaryl, heterocycloalkyl, cycloalkyl, cyano *, RaRbN-, RaC (0)-, RaS- ^ Ra (0) S- ^ Ra (〇) 2S- ^ RaS02N (Rf > > RaRbNC (0 > > Rk0C (0 > ^ RaRbNS〇2-〇R-〇Rk 'and R6 is nitrogen, alkyl, dilute, decyl, halo, cyano, nitro, aryl, Heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra and -C (0) NRaRy, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, ( Cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl. For example, the present invention provides compounds of formula (VII) wherein R4 is hydroxyl. For example The present invention provides a compound of formula (VII), wherein R4 is a hydroxyl group, and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, aromatic Alkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylfluorenyl, cycloalkylalkyl, methylamino, ialkyl, heteroaryl base Group, heteroaralkyl, heterocyclyl, Xi heterocyclyl, heterocyclylalkyl, hydroxyalkyl, RaRbN-, RaRbN alkyl -, RaRbNC (0) alkyl -, RfRgC = N- & RkO-. For example, the present invention provides a compound of formula (VII), wherein R4 is a hydroxyl group, and R1 89166-115- 200427678 is selected from the group consisting of hydrogen, C1-C7 alkyl, C1-C6 alkenyl, and furanyl (C1-C2 alkyl )-, Thienyl (C1-C2 alkyl)-, phenyl (C1-C2 alkyl)-, pyridyl (C1-C2 alkyl)-, pyrazolyl (C1-C2 alkyl)-, isofluorene Oxazolyl (C1-C2 alkyl)-, naphthyl (C1-C2 alkyl), benzothienyl (C1-C2 alkyl)-, oxalyl (C1-C2 alkyl)-, (C3-C7 Cycloalkyl) (C1-C2 alkyl)-, (C5-C6 cycloalkenyl) (C1-C2 alkyl)-, C3-C7 cycloalkyl, phenyl N (H) (C1-C6 alkyl) -, (Phenylalkyl) 0-, (C1-C7 alkyl) 0-, (C3-C6 cycloalkyl) 0-, phenyl CHNN-, NH2, (C1-C7 alkyl) N (H) -, (C1-C7 alkenyl) N (H) _, (C3-C7 cycloalkyl) N (H)-, ((C3-C7 cycloalkyl) C1-C2 alkyl) N (H)-, (Pyriminylmethyl) N (H)-, (pyrimazolylmethyl) N (H)-, (furylmethyl) N (H) _, (pyridylmethyl) N (H)-, (Tetrahydropiperan) N (H)-, (phenylalkyl) N (H)-, (tetrahydrofluorenyl) N (H)-, wherein each R1 is substituted by 0, 1, 2 or 3 Base substitution The substituent is selected from the group consisting of alkyl, hydroxy, keto, halo, cyano, nitro, halo, halooxy, phenyl, hexahydrocarbyl, morpholinyl, carboxyl, -C (0) 0 (alkyl), -NH2, -NH (alkyl), -N (alkyl) 2, -0 alkyl, -0-phenyl. For example, the present invention provides a compound of formula (VII), wherein R4 is hydroxy, and R1 is selected from the group consisting of Q3 alkyl, C4 alkyl, C5 alkyl, phenylmethyl, (5-chloro-pyrimidine-2- (Methyl), -NH2, (C3 alkyl) N (H) ·, (C4 alkyl) N (H)-, (C5 alkyl) N (H)-, (cyclobutyl) N (H )-And (cyclopropylmethyl) N (H)-. In a tenth embodiment, the present invention provides a compound of formula (VIII)

R7 (VIII) 89166-116- 200427678 or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: X is NH, N (alkyl), 0 or S; R1 is selected from the group consisting of Hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, sulfanyl, alkynyl, alkynyl, alkynyl, alkynyl , Aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl , (Cycloalkyl) alkenyl, (cycloalkyl) alkyl, methylaminoalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, hetero Arylsulfonylalkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RaRbNC (0) 0 alkyl-, RaRbNC (0) NRe alkyl-, RfRgC = N- and RkO-, where R1 is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl and fine , Decyl, i-iso, 1¾, carbyl, nitro, phenyl, alkoxy, aryl Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Re),-(alkyl) (N ^), -SRC, -S ( 0) Rc, -S (0) 2Rc, -QRe, -N (Rc) (Re), -C (0) Re, -C (0) 0Rc, and -C (0) NRcRe; R2 and R3 are independently selected Including hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, aralkyl, heteroaryl, heterocyclic, heteroaralkyl, cyano, li, _N (Ra ) (Rb), RaRbNC (0)-, -SRa, -S (0) Ra, _S (0) 2Ra, and RaC (0)-; where R2 and R3 are independently 0, 1, 2, or 3 substituents Substitution, the substituent is independently selected from Ra, alkyl, fluorenyl, decyl, keto, halo, cyano, nitro, haloalkyl,-(alkyl) (〇Rk),-(alkylXNRaRb ), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 〇Ra and-89166 -117 -200427678 C (0) NRaRb; or, R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl, and heterocyclic rings, wherein Aryl, cycloalkyl, heteroaryl and heterocyclic systems are optionally substituted with (R6) m; R4 is selected from the group consisting of alkoxy and aryl. Group, aryloxy group, south group, protecting group, Ra Rb N-, N3-, Re S- 'wherein R4 is independently substituted by 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of halo, nitro , Cyano, -OH, -NH2 and -COOH; R5 is independently selected from each group including alkenyl, alkoxy, alkoxy, block, aryl, aralkyl, arylcarbonyl, aryloxy Base, azidealkyl, formamyl, haloyl, ialkyl, iS, carbon, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano , Cyanoalkyl, nitro, ^ 1 ^, RaC (0)-, RaS_, Ra (0) S_, Ra (0) 2S-, RaRbN alkyl-, ^ (0) 8 wind &)- RaS02N (Rf)-, Ra (0) SN (Rf) alkyl-, RaS02N (Rf) alkyl, RaRbNS02N (Rf) _, RaRbNS02N (Rf) alkyl-, RaRbNC (0)-, Rk0C (0 )-, Rk0C (0) alkyl-, RkOalkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) Q-, and -ORk, where each R5 is independently 0, 1, 2 or 3 substituent substitutions, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, alkyl, nitro, alkynyl, alkoxy, aryl, and heteroaryl , Heterocyclic, aralkyl, Heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORc),-(alkyl) (NRcRd), -S &, -S (0) Rc, -S (0) 2Re,- ORc, -N (Rc) (Rd), -C (0) Rc, -C (0) 0Rc & -C (0) NRcRd; R6 is independently selected from each occurrence including alkyl, alkenyl, alkyne Aryl, halo, cyano, nitro, fluorenyl, haloalkoxy, aryl, heteroaryl, heterocyclic 89166 -118- 200427678, aralkyl, heteroaralkyl, heterocycloalkyl,- (Alkyl) (ORk),-(alkyl XNT ^ Rb), -SRa, 4 (0), -S (0) 2Ra, -ORk, -N ^ XRb), -C (0) Ra,- C (0) 0Ra and _C (0) NRaRb; wherein each R6 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, decyl, keto, and Base, alkynyl, cyano, nitro, -ORa, -NI ^ Rb, -SRa, -SORa, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; R7 is independently selected from each group including fluorenyl, alkoxy, alkynyl, alkynyl, aryl, aryl, aralkyl, arylcarbonyl, aryloxy, azidoalkyl, methylamino, Fluorenyl, i-alkyl, autocarbon, heteroaryl, heteroaralkyl, heterocycle, heterocycloalkyl, hydroxyalkyl, Alkyl, cyano, cyanoalkyl, nitro, alkyl, RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, heart (0 ) 8 wind 1 ^)-, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl-, RaS02N (Rf) alkyl, RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl-, RaRbNC ( 0)-, Rk0C (0)-, Rk0C (0) alkyl-, RkOalkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0-, and -ORk, each of which is R7 Is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, autoalkyl, and alkoxy , Aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇 心),-(alkyl) (NRcRd), -S & , -S (0) Rc, -SCC ^ K, -〇RC, -N (Rc) (Rd), -Naxin, -C (0) ORc and -C (〇) NReRd;

Ra and Rb are each independently selected from the group consisting of hydrogen, alkenyl, alkyl, thioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cycloalkenyl, cycloolefin Alkylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formamidine 89166 -119- 200427678 alkylalkyl, lialkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, Heterocyclic, heterocyclic amidyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, ReRdN_, RkO-, RkOalkyl-, RcRdN alkyl-, RoRdNC (0) alkyl-, RcS02 · , RcS02 alkyl-, RcC (0)-, RcC (0) alkyl-, Rc0C (0)-, Re〇C (0) alkyl-, ReRdN alkyl C (O)-, RORdNC (0 )-, ReRdNC (0) 0 alkyl-, RcRdNC (0) N (Re) alkyl-, its center and Rb are substituted with 0, 1 or 2 substituents, the substituents are selected from the group consisting of alkyl, alkenyl , Alkynyl, keto, halo, cyano, nitro, _alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkane Group,-(alkyl) (〇Rc),-(alkylXNi ^ Rd), -SRe, -S (0) Re, 4 (0) 21, -0 ~, -NC ^ XRd), -C ( 0) Rc, -C (0) 0Rc and -C (0) NRcRd; or, Ra and Rb and The nitrogen atoms to which they are attached together form a three- to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic rings, wherein heteroaryl and heterocyclic ring systems are independently substituted with 0, 1, 2 or 3 substituents. Independently selected from the group consisting of alkyl, alkenyl, decyl, keto, dentyl, cyano, nitro, fluorenyl, sulfanyl, aryl, heteroaryl, heterocyclic, aryl, heteroaryl Alkyl, alkoxyalkyl,-(alkyl) (〇R〇),-(alkylXNReh), -alkylSC ^ NReRd, -alkylC (0) NReRd, -SRc, 4 ( 0) 1 ^, -S (0) 2Rc, -ORc, -NdXRd), < (0) 1 ^, -C (0) OR〇, and -C (0) NReRd;

Rc and Rd are independently selected from each group including hydrogen, ^! ^! ^,-. ! ^, -C〇 (Rf), -SRf, -S0Rf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) 0Rf, fluorenyl, alkyl, alkynyl, cycloalkyl, cyclo Alkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, haloalkyl, heteroaryl, heteroaralkyl, heterocyclic and heterocyclic alkyl; each of Rc and Rd is independent It is substituted by 0, 1, 2 or 3 substituents of 89166 -120- 200427678. The substituents are independently selected from the group consisting of alkyl, alkenyl, block, keto, halo, cyano, nitro, Oxyalkyl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) (NRfRh) , -SRf, -S (0) Rf, -S (0) 2Rf, _〇Rf, -N (Rf) (Rh), -C (0) Rf, -C (0) ORf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N (Re) S02NRfRh, _N (RJC (0) NRfRh, -alkylNdXXOpRf, -alkylN (Re ) S02 NRf Rh and -alkylN (Re) C (0) NRf Rh; or l forms a three- to six-membered ring together with the heart and the nitrogen atom to which they are attached, selected from the group consisting of heteroaryl and heterocyclic rings Where heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, substituents Independently selected from the group consisting of alkyl, alkenyl, decyl, keto, S, cyano, nitro, iSalkenyl, alkynyl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaryl Alkyl, alkoxyalkoxyalkyl, _ (alkyl) (〇Rf), -0 ^ *) (NRfRh), _SRf, _S (O) Rf, -S (O) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf and -C (0) NRfRh;

Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg & Rh are independently selected from each occurrence including hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocycle, heterocycloalkyl, heteroaryl and heteroaralkyl; wherein each of Rf, Rg and 1 ^ is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, Radical, decyl, cyano, alkynyl, keto, nitro, aryl, aralkyl, cycloalkyl, cyclofluorenyl, heterocyclic, heteroaryl, heteroarylalkyl, -OH, -〇 ( Alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl, -alkyl -OH, -alkyl-0-alkyl, · alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl),-alkane S (0) (alkyl) 89166 -121-200427678, -alkylS02 alkyl, -N (H) C (0) NH2, -C (0) 0H, -c (o) o (alkyl) -C (0) alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or Rf, together with Rg and the carbon atom to which they are attached, form a three- to seven-membered ring selected from cycloalkyl, cycloalkenyl, and heterocyclic rings; or Rf, together with Rh and the nitrogen atom to which they are attached, form a three- to seven-membered ring selected from heterocyclic and heteroaryl groups; wherein each heterocyclic and heteroaryl system is independently 0, 1, 2 or 3 Substituted by a substituent, the substituent is independently selected from the group consisting of alkyl, fluorenyl, block, cyano, IS, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkyl, heterocyclic, hetero Aryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkane Group), -S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS ( (Alkyl), -alkyl S (0) (alkyl), -alkyl S02alkyl, -alkyl N (alkyl) 2, -n (h) c (o) nh2, _C (0) 0H, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl), and -C ( 0) N (alkyl) 2;

Rk is selected from the group consisting of hydrogen, fluorenyl, alkyl, aryl, aralkyl, cyanoalkyl, cyclofluorenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, methylamino , Haloalkyl? Heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, nitroalkyl, i ^ RbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS-, RaS (0)-, RaS02-, RaS alkyl-, Ra (0) S alkyl-, RaS02 · yl-, & 0: 0 :), Ra0C (0) alkyl-, RaC (0)- , RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, Nitro, self-alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇R〇), -(Alkyl) (NR〇Rd), -SK, 4 (0) 1 ^, 89166 -122- 200427678 '〇) 2 K, -OK, -N (Rc) (Rd), -C (0) Re , < (0) 0 & & -C (0) NRcRd; 111 is 0, 1, 2, 3, or 4; and n is 0, 1, or 2. For example, the present invention provides compounds of formula (VIII), wherein R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl, and heterocyclic Where the aryl, cycloalkyl, heteroaryl and heterocyclic ring are optionally substituted with (R6) m. For example, the present invention provides compounds of formula (VIII), in which ^ forms a five- or six-membered ring with the carbon atom to which they are attached, selected from the group consisting of phenyl, tolyl, pyrimidinyl, and daphthyl , Pyrazolyl, cyclopentyl, cyclohexyl and fluorenyl. For example, the present invention provides a compound of formula (VIII), wherein R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, exidinyl, pyrimidinyl, and dagen , Pyrazolyl, cyclopentyl, cyclohexyl, and fluorenyl, and R4 is a hydroxyl group. For example, the present invention provides a compound of formula (VIII), wherein R2 and R3 together with the broken atom to which they are attached form a five-or: , Daphthyl, pyrazolyl, cyclopentyl, cyclohexyl, and pyrenyl, R4 is hydroxyl, and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxyalkyl, alkyl, Decanyl, arylfluorenyl, arylfluorenyl, alkylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formamidine Alkyl, self-alkyl, heteroarylalkenyl, heteroaralkyl, heterocyclic, heterocyclyl, heterocycloalkyl, hydroxyalkyl, RaRbN-, RaRbN alkyl-, R ^ RbNCXO) alkyl -, RfRgON- and RkO-. 89166 -123- 2ϋ427678 For example, the present invention provides compounds of formula (VIII), wherein R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, and pyrimidinyl , Daphnyl, pyrazolyl, cyclopentyl, cyclohexyl, and thienyl 'R4 is a hydroxyl group, and R1 is selected from the group consisting of C1-C7 alkyl, (C3-C6 cycloalkyl) C1-C2 alkyl)- , Phenyl_C1_C2 alkyl, heteroaryl_C1-C2 alkyl_, ((phenyl) C1-C2 alkyl) 0_, (C3_C7 alkyl) 0_, (C3-C6 cycloalkyl) 0_ ((Phenyl) C1_C2 alkyl) N (H)-, (C3-C6 cycloalkyl) N (H) ·, ((C3-C6 cycloalkyl) C1-C2 alkyl) N (H)- And (C1-C7 alkyl) N (H)-. For example, the present invention provides compounds of formula (VIII), wherein R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, daphthyl, Pyrazolyl, cyclopentyl, cyclohexyl, and sephenyl, R4 is hydroxyl, and R1 is selected from the group consisting of C3 alkyl, C4 alkyl, C5 alkyl, phenylmethyl, phenylethyl, (5 -Chloro-pyrimidin-2-yl) methyl, cyclobutylmethyl, cyclopropylmethyl, cyclopropylethyl, (cyclopropylmethyl) N (H)-, (cyclobutyl) N (H )-, (Cyclopentyl) N (H)-, (cyclohexyl) N (H)-, (phenylmethyl) N (H)-, (C3 alkyl) N (H)-, (C4 alkane Group) N (H)-and (C5 alkyl) N (H)-. Exemplary compounds of the tenth embodiment of the present invention of formula (VIII) include, but are not limited to, the following: 3- (1,1-dioxide_4H- [1,3] oxazolo [5,4-h] [l, 2,4] benzopyrimidin-3-yl) glacial hydroxy-ι- (isobutylamino) quinoline-2 (m) -one; 3- [8- (chloromethyldi Oxidation of 4H- [1,3] oxazolo [5,4-h] [l, 2,4] benzothiadifluorene groups] -4 residues small (isobutylamino group) quinoline- 2 (1H) -one; 3- {3- [4-hydroxy-1- (isobutylamino) -2 keto-1,2-dihydroquinolin-3-yl] _1,1_dioxide -4H- [1,3] humazolo [5,4_h] [l, 2,4] benzopyridine-8-yl} propionic acid; 89166 -124- 7678 3 · (8-{[(2 -Aminoethyl) amino] methyl} -1, l-dioxide-4H- [1,3; Kazolo [5,4-h] [l, 2,4] benzolide- 3-yl) -4-Ethyl-1- (isobutylamino) & quinine_2 (m) -one; {3- [4-Protyl-1— (isobutylamino) _2_ Fluorenyl_1,2 · dichloro? Quinolin-3-yl] -1,1-dioxide-4H- [1,3] oxazolo [5,4-11] [1,2,4] Benzopyrimidinyl} methyl methyl picrate; 4-lightyl-3_ (8-{[(3R) -3- # 里 基 Tetrahydrotantrol-1-yl] methylpyridine, pyrene-di Oxidation_4h_ [U] oxazo [5,4Hepta] [1,2,4] benzothiazine Small (isobutylamino) & quinoline 2 (1H) -one; 3- [1,1-dioxo (pyridinylmethyl) _4H- [1,3] oxazo [5, 4-h] [l, 2,4] benzopyrimidin-3-yl] small (isobutylamino) -2-one-1,2-dihydroquinolinol alcohol; 3- [ 1,1-dioxide-8- (tetrahydropyrrole-1-ylmethyl) -4）-[1,3] pyrazolo [5,4-h] [l, 2,4] benzopyrimidine Each group] -4-hydroxy_1 · (isobutylamino group> quinoline-2 (1H) -one; 3- [8 · (3-aminophenyldioxide-4H- [1,3] Azazo [5,4_h] [l, 2,4] benzopyridine-3-yl] -4-meryl_1 · (isobutylamino group) > quelin-2 (1H) · ketone ; 3- [8- (Aminomethyl) -1,1-dioxide_4Η · [1,3] azazolo [5,44ι] [1,2,4] benzopyrimidin-3- Group] * 4- # Stem group 1- (isobutylamino group) quinoplin-2 (1H) -isopropyl; 4-hydroxy-3- [8- (methyl) -1,1-di Oxidized-4H- [1,3] pyrazolo [5,4-h] [l, 2,4] benzopyrene dip-well-3-yl] small (isobutylamino group) 2 (1H) _one; 3- {8-[(butylamino) methyl] -1,1-dioxide-4H- [1,3] oxazo [5,4-11] [1, 2,4] benzopyrimidin-3-yl} -4-mercapto small (isobutylamino), quinolin-2 (1H) _one; 3- [9- (butyl Amino group) _1,1_dioxide-4H, 8H- [1,4] yin geng [2,3-h] [l, 2,4] benzopyrimidinyl] Bing Jingji-1 -(Isobutylamino) Pquinoline_2 (1H) _one; 4-hydroxy-H3-methylbutyl) _3- (8-methyl-1,1-dioxide-4H- [1, 3] oxazolo [5,4-h] [l, 2,4] benzothiadinyl groups) 4,8-pyridin-2 (1H) _one; 3- [1,1_dioxide _8_ (trifluoromethyl) _4,7_dihydroimidazo [4,5_h] [l, 2,4] benzopyrimidine 89166 -125- 200427678 digenyl-3-yl] -4-meryl-1 -(3-methylbutyl) -i, 8-pyridine-2 (1H). ; 4-hydroxy-3- (8-hydroxy-1,1-dioxide · 4,7-dihydroimidazo [4,5-h] [l, 2,4] benzopyrimidine_3_yl ) Small (3-methylbutyl) _1,8_pyridine · 2 (1 _) _ one; 4-Cyclo-1- (3-methylbutyl) _3- (8-methyl-1, l -Dioxo-4,7-dihydroimidazo [4,5_11] [1,2,4] benzopyridine_3_yl) -1,8-piperidine-2 (111) -one; 3- [1,1-Dioxide-8- (pentafluoroethyl) _4,7_dihydroimidazo [4,5_11] [1,2,4] benzopyrimidin-3-yl] -4 -# Radical-1- (3-methylbutyl) -i, 8-piperidine-2 (1H) -one; 3- [8- (chloromethyl) -1,1_dioxide_4, 7_Dipyridazole imidazo [4,5-h] [l, 2,4] benzopyrimidin-3-ylH-lightyl-1- (3-methylbutyl) 4,8_pyridine -2 (1Hy ketone; {3- [4-hydroxy-1- (3-methylbutyl) -2-keto-i, 2-dihydro-1,8-pyridine groups; μ, 1- Dioxane-4,7-dihydroimido [4,541] [1,2,4] benzo | Ergenyl} Acetonitrile; {Η4-Lightyl-K1 2-methylbutyl > 2-ketone Radical 4,2-hydrogen ―: ^ ”Naiyue; radical oxidation of 4,7-dihydroimidol [4,541] [1,2,4] benzothiadinyl radicals} methyl methyl picrate; 3 -(9,9_dioxide_6H- [1,2,5] pyrimidazole [3,4seven] [1,2,4] benzopyrimidin-7_yl) -4-hydroxy _1- (3-methylbutylH, 8-piperidine_2 (1H >ketone; -126- 1 (8-amino-1,1-dihydrodiimidazo [4,54ι] [1, 2,4] benzothiadinyl-3-yl) -4- # fluorenyl-1- (3-methylbutyl) 4,8_pyridine_2 (1H). ; And 2 hydroxyl groups each [8- (hydroxymethyl dioxide_4, 9_dihydroimidazobenzopyrimidin-3-yl H- (3-methylbutylH glucosinodin_2 (111) _one, Or a pharmaceutically acceptable salt form, Stereoisomers or tautomers.  In the eleventh specific embodiment, The present invention provides a pharmaceutical composition which comprises a therapeutically effective amount of formula (1), (II),  (III), (IV), (Va), (Vb), (via), (νι% (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, And pharmaceutically acceptable carriers.  89166 200427678 In the twelfth specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va),  (Vb), (Via), (VIb),  (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, Accompanied by one or more host immunomodulators, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (V), (VI), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, With one or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- / 5, Interferon-r, Cytokine, Vaccines and vaccines containing antigens and adjuvants, And pharmaceutically acceptable carriers.  In the thirteenth specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb),  (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, Accompanied by one or more second antiviral agents, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (ΠΙ), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, Accompanied by one or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (Π), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (vm) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, With one or 89166 -127- 200427678 multiple second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, And pharmaceutically acceptable carriers.  In a fourteenth specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb),  (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more second antiviral agents and pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (Π), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (vm) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- / 5, Interferon-τ, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (Π), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- / 5, Interferon-r, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) compound 89166 -128- 200427678 or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon-point, Interferon-r, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, And pharmaceutically acceptable carriers.  In the fifteenth specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb),  (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- / 3: Interferon-r, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  In a sixteenth specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II),  (III), (IV), (Va), (Vb), (Via), (VIb),  (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And a pharmaceutically acceptable carrier of 89166-129-200427678.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, One or more agents that treat or alleviate the symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III),  (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  In the seventeenth specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb),  (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more second antiviral agents, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), Alas, (ΙΠ), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from the group consisting of interferon- ^, PEGylated interferon-α, Interferon- / 5, Interferon-T, Cytokine, Vaccines and vaccines containing antigen and adjuvant 89166-130-200427678, One or more second antiviral agents, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  In the eighteenth specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb),  (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- / 5, Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, It contains a therapeutically effective amount of formula (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from the group consisting of interferon-〇: , PEGylated interferon-α, Interferon- / 3,  Interferon-r, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, One or more agents that treat or alleviate the symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  In the nineteenth specific embodiment, The present invention provides a pharmaceutical composition, It contains a therapeutically effective amount of formula (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more agents for treating diseases caused by hepatitis B (HBV) 89166 -131-200427678 infection in patients, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (ΙΠ), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-, Interferon-million, Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, And pharmaceutically acceptable carriers.  In the twentieth specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb),  (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, One or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, One or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (M), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It works by targeting proteins of the viral genome and 89166-132-200427678 inhibits HCV replication One or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, And pharmaceutically acceptable carriers.  In the twenty-first specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more second antiviral agents, One or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, And pharmaceutically acceptable carriers.  _ E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (M), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- / 3, Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, One or more agents for the treatment of a disease caused by a hepatitis B (HBV) infection, And pharmaceutically acceptable carriers, .  · E.g, This post, Ming Department provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vl ·), (Via), (VIb), (VII) or (vm) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon-none, Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, One or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, And medicine 89166 -133- 200427678 academically acceptable carrier.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon, Interferon-none, Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, One or more agents for treating a disease caused by a hepatitis B (HBV) infection, And pharmaceutically acceptable carriers.  In the pharmaceutical composition mentioned above, Agents for treating diseases caused by hepatitis B (HBV) infections in patients, Preferably, it may be selected from the group consisting of L-deoxythymidine, Adefovir, Lamivudine and tenfovir 〇 In the twenty-second embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (XIIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, With one or more agents to treat patients due to human immunodeficiency virus (HIV) infections, And pharmaceutically acceptable carriers.  In the twenty-third specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection, 89166 -134- 200427678 Scientifically acceptable carrier.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon-million, Interferon-r, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection in a patient, And pharmaceutically acceptable carriers.  In a twenty-fourth specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, One or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, One or more agents for treating diseases caused by human immunodeficiency virus (HIV) infection in patients, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (Π), (ΙΠ), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more of the 89166 -135- 200427678 two antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, One or more agents for treating a disease caused by a human immunodeficiency virus (HIV) infection in a patient, And pharmaceutically acceptable carriers.  In the twenty-fifth specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more second antiviral agents, One or more agents for treating diseases caused by human immunodeficiency virus (HIV) infection in patients, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- / 3, Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, One or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection, And pharmaceutically acceptable carrier.  In the twenty-sixth specific embodiment, The present invention provides a pharmaceutical composition, Which contains a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from the group consisting of interferon-α, PEGylated interferon-α, Interferon- / 5, Interferon-7, Cytokine Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits the replication of HCV by inhibiting the functions of host cells that are associated with viral replication. 89166 • 136- 200427678 One or more treatments for patients due to human immunodeficiency virus (HIV >  The agent that caused the disease, And pharmaceutically acceptable carriers.  E.g, The present invention provides a pharmaceutical composition, It contains the formula (I), (Π), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (V 叨 or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, Pegylated interferon, α, Interferon- / 5, Interferon-T, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, One or more agents for treating diseases caused by human immunodeficiency virus (HIV) infection, And pharmaceutically acceptable carriers.  In the pharmaceutical composition mentioned above, Agents for treating diseases caused by human immunodeficiency virus (HIV) infections in patients may be, for example, but not limited to, Ritonavir, Lopinavir, Indinavir, Nelfinavir, Saquinavir, Amprenavir, Atazanavir, Tipranavir,  TMC-114, _Sampnervir (fosamprenavir), Send zidovudine,  Lamivudine, 二 丹 # 辛 （didanosine） 、 Stavudine, 天 # 弗 伐 （tenofovir）, Zalcitabine, Abacavir, Efavirenz, Nevirapine, Delavirdine, TMC_125, L-870812, S-1360, EnfUvirtide (T-20) or T-1249 or any combination thereof.  In the twenty-seventh specific embodiment, The present invention provides a method for treating or preventing an infection caused by an RNA-containing virus. This includes administering to a patient in need of such treatment 89166-137-200427678 any of the pharmaceutical compositions disclosed above.  In the twenty-eighth specific embodiment, The present invention provides a method for inhibiting the replication of RNA-containing viruses, It includes bringing the virus to a therapeutically effective amount of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VI) or a pharmaceutically acceptable salt thereof.  In the twenty-ninth specific embodiment, The present invention provides a method for treating or preventing infection caused by RN A-containing virus, which comprises administering to a patient in need of such treatment a therapeutically effective amount of formula 仉 ⑼ (ΙΠ), (IV), (Va), (%), (VIa),  (Vlb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt thereof.  E.g, The present invention provides a method for treating or preventing an infection caused by an RNA-containing virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (Π), (ΠΙ), (IV), (Va), (Vb), (via), (VIb), (VII) or (VI) a substance or combination of compounds, Or a pharmaceutically acceptable salt thereof, The RNA-containing virus is hepatitis C virus.  In the thirtieth specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C disease-toxin, It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, Alas, (III), (IV), (Va), (Vb), (via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Immunomodulator with one or more hosts.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, Alas, (ΠΙ), (IV), (Va), (Vb), (VIa), (vib), (VII) or (VIII) a compound or combination of compounds, With one or more host immunomodulators, Selected from the group consisting of 89166 -138- 200427678 including interferon- ^, PEGylated interferon-α, Interferon- / 3, Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants.  In the thirty-first specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, With one or more second antiviral agents.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, With one or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication.  E.g, The invention provides a method for treating or preventing infection caused by hepatitis C virus, It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or a compound or combination of compounds, With one or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome.  In the thirty-second specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, One or more host immune modulators, And one or more second antiviral agents.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering an effective amount of formula (I) 89166 -139- 200427678 to patients in need of such treatment, Alas, (ΙΠ), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, One or more host immunomodulators, Selected from the group consisting of interferon- ^, PEGylated interferon-α, Interferon- / 3, Interferon-7,  Cytokine, Vaccines and vaccines containing antigens and adjuvants, And one or more second antiviral agents.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, Alas, (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (vm) a compound or combination of compounds, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- / 3, Interferon-r,  Cytokine, Vaccines and vaccines containing antigens and adjuvants, And one or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, Alas, (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- / 5, Interferon-r,  Cytokine, Vaccines and vaccines containing antigens and adjuvants, And one or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome.  In the thirty-third specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (Ni), (IV), (Va), (Vb), (Via),  89166 -140- 200427678 (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, Alas, (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- / 5, Interferon-r, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more agents that treat or alleviate symptoms of HCV infection, including liver sclerosis and inflammation, And pharmaceutically acceptable carriers.  In the thirty-fourth specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, Alas, (ΙΠ), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication 89166 -141-200427678, One or more agents that treat or alleviate HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (M), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  In the thirty-fifth specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III) 5 (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more second antiviral agents, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (vm ^ compounds or compound combinations, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon-, Interferon-r, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And a pharmaceutically acceptable carrier of 89166-142-200427678.  E.g, The invention provides a method for treating or preventing infection caused by hepatitis C virus, It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- /? , Interferon-r, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (a compound or a combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- ^ 5, Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, One or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, And pharmaceutically acceptable carriers.  In the thirty-sixth specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (M), (IV), (Va), (Vb), (Via),  89166 -143- 200427678 (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, And one or more agents for treating the disease caused by hepatitis B (HBV) infection in the patient, And pharmaceutically acceptable carriers.  In the thirty-seventh specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment,  (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more agents for the treatment of a disease caused by a hepatitis B (HBV) infection, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (m), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, I ^ EG-Interferon -〇: , Interferon- / 5, Interferon-T, Cytokine, Vaccines and vaccines containing antigens and adjuvants, -One or more agents for treating diseases caused by hepatitis B (HBV) infection in patients, And pharmaceutically acceptable carriers.  In the thirty-eighth specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, One or more agents for the treatment of a disease caused by a hepatitis B (HBV) infection, And pharmaceutically acceptable 89166 -144- 200427678 carrier.  E.g, The invention provides a method for treating or preventing infection caused by hepatitis C virus, It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (M), (IV), (Va), (Vb), (Via), (VIb), (VII) or a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, One or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, Alas, (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, One or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, And pharmaceutically acceptable carriers.  In the thirty-ninth specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more second antiviral agents, One or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering to a patient in need of such treatment an effective amount of formula (I) 89166 -145- 200427678, (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (vm) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from the group consisting of interferons, PEGylated interferon-, Interferon- / 5, Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, One or more agents for treating diseases caused by hepatitis B (HBV) infection in patients, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (vm ^ compound or compound combination, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon- ^, Interferon-T, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, One or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (M), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-, Interferon-point, Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the virus's 89166-146-200427678 genome, One or more agents for the treatment of a disease caused by a hepatitis B (HBV) infection, And pharmaceutically acceptable carriers.  An agent for treating diseases caused by hepatitis B (HBV) infection in patients, Can be for example, but not limited to, L_deoxythymidine, Adifovir, Lamivudine or tenfovir or any combination thereof.  In the fortieth specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus, It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection in a patient, And pharmaceutically acceptable carriers.  In the forty-first specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VID compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more -147- 89166 200427678 host immunomodulators, Selected from interferon π, PEGylated interferon-, Interferon- /? , Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection in a patient, And pharmaceutically acceptable carriers.  In the forty-second specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, One or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (V_ compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, One or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection in a patient, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (M), (IV), (Va), (Vb), (Via), (VIb), (VII) or (V 叨 compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome 89166-148-200427678, One or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection in a patient, And pharmaceutically acceptable carriers.  In the forty-third specific embodiment, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, One or more second antiviral agents, One or more agents for treating diseases caused by human immunodeficiency virus (HIV) infection in patients, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (M), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or compound combination, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon-α, Interferon-million, Interferon-7, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, One or more agents for treating diseases caused by human immunodeficiency virus (HIV) infection in patients, And pharmaceutically acceptable carriers.  E.g, The present invention provides a method for treating or preventing infection caused by hepatitis C virus. It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α, PEGylated interferon -〇: , Interferon- / 5, Interferon-τ, Cytokine, Vaccines and vaccines containing antigen and 89166 -149- 200427678 adjuvant, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, One or more pharmaceutical agents ' and pharmaceutically acceptable carriers for treating a disease caused by a human immunodeficiency virus (HIV) infection in a patient.  For example, the present invention provides a method for treating or preventing an infection caused by the hepatitis C virus, It includes administering a therapeutically effective amount of formula (I) to a patient in need of such treatment, Alas, (ΙΠ), (IV), (Va), (Vb), (Via), (vib),  Compound or combination of compounds, Or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from the group consisting of interferons, PEGylated interferon-α, Interferon-million, Interferon 1, Cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, One or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection, And pharmaceutically acceptable carriers.  An agent for treating diseases caused by human immunodeficiency virus (HIV) infection in patients, Can be for example, but not limited to, Ritonavir,  Lopinavir, Indinavir, Nelfinavir, Saquinavir, Amprenavir, Atazanavir, Tipranavir, TMC-114, Fosamprenavir, Send zidovudine, Lamivudine,  Didanosine, Stavudine, Tenofovir, Zalcitabine, Abacavir, According to efavirenz, Nevirapine, Delavirdine, TMC-125, L-870812 、 S-1360, Enfhvirtide (T-20) or T-1249 or any combination thereof.  89166 -150- 200427678 In the forty-fourth specific embodiment ten, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via), (V then, (VII) or (VI ^ composition or a therapeutically acceptable salt thereof for use in the preparation of a medicament, The agent is used to treat or prevent infections caused by human viruses containing RN in patients.  E.g, The present invention provides a formula ①, (11), (III), (IV), (Va), (Vb), (VIa),  (VIb), (VII) or (VIII) a compound or combination of compounds or a therapeutically acceptable salt thereof for use in the manufacture of a medicament, The agent treats or prevents infections caused by RNA-containing viruses in patients, The RNA-containing virus is hepatitis C virus.  In the forty-fifth specific embodiment, The present invention provides a formula (I), (II),  (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds or a therapeutically acceptable salt thereof and one or more host immunomodulating agents for use in the preparation of a medicament, The agent is used to treat or prevent infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a therapeutically acceptable salt thereof and one or more host immunomodulators, Selected from the group consisting of interferon 4, , PEGylated interferon-α, Interferon- / S, Interferon-T, Cytokine, Vaccines and vaccines containing antigens and adjuvants, Use for the preparation of a medicament ’This medicament is used to treat or prevent infections caused by hepatitis C virus in a patient. In the 46th embodiment, The present invention provides a formula (1), (11),  (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (IIIII) a compound or combination of compounds or a therapeutically acceptable salt thereof and one or more second antiviral agents for use in the preparation of a medicament, The agent is used to treat or prevent infections caused by hepatitis C virus in patients.  89166 -151- 200427678 For example, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a therapeutically acceptable salt thereof and one or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, For the preparation of medicaments, The agent is used to treat or prevent infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a therapeutically acceptable salt thereof and one or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, For the preparation of pharmaceuticals, The drug is used to treat or prevent infections caused by the hepatitis C virus in patients.  In the forty-seventh specific embodiment, The present invention provides a formula (I), (II),  (III), (R \ 〇, (Va), (Vb), (Via), (Vlb), (VII) or (νΐΙΙ) > dagger or > [A combination of compounds or a therapeutically acceptable salt thereof, The use of one or more host immunomodulators and one or more second antiviral agents for the preparation of a medicament, The agent treats or prevents infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, or a therapeutically acceptable salt thereof, one or more host immunomodulators, Selected from interferon-α, PEGylated interferon- ^, Interferon- / 3, Interferon-T, Cytokine, Vaccines and vaccines containing antigens and adjuvants, And one or more second antiviral agents, For the purpose of preparing a medicament, The agent treats or prevents infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  89166 -152- 200427678 (vib) ’(VII) 4 (VIII) compound or combination of compounds or a therapeutically acceptable salt thereof, ’One or more host immunomodulators, Selected from the group consisting of interferons, PEGylated interferon π, Interferon gamma, Interferon_r, Cytokine, Vaccines and vaccines comprising antigens and adjuvants' and one or more second antiviral agents,  It is used for the preparation of pharmaceuticals by inhibiting the function of the host cell which is associated with viral replication ', The agent treats or prevents infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (1), Alas, (111), (IV), (Va),  (VIb), (VII) or (VIII) a compound or combination of compounds or a therapeutically acceptable salt thereof, One or more host immunomodulators, Selected from the group consisting of interferon_α, PEGylated interferon-α, Interferon j, Interferon 1, Cytokine, Vaccines and vaccines containing antigens and adjuvants, And one or more second antiviral agents,  It inhibits replication by targeting proteins of the viral genome, Used for the preparation of tinctures, The agent treats or prevents infections caused by the hepatitis C virus in patients.  In the forty-eighth specific embodiment, The present invention provides a formula (1), Alas,  (ΠΙ), (IV), (Va), (yb) 5 (Via), (VIb), (VII) or (νπΐ) a compound or combination of compounds, or a therapeutically acceptable salt thereof, One or more host immunomodulators, And one or more agents that treat or alleviate the symptoms of HCV infection, including liver cirrhosis and inflammation, For the preparation of pharmaceuticals, The agent treats or prevents infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (Π), (III),  (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon_α,  89166 -153-200427678 PEGylated interferon-α, Interferon- / 3, Interferon-7, Cytokine,  Vaccines and vaccines containing antigens and adjuvants, And one or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, For the preparation of medicaments, The agent is used to treat or prevent infections caused by the hepatitis C virus in patients.  In the forty-ninth specific embodiment, The present invention provides a formula (I), (II),  (III), (1 \ 〇,  CVa), (Vb), (Via), (VIb), (VII) or (VIII) > a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents and one or more agents that treat or alleviate the symptoms of HCV infection, including cirrhosis, For the preparation of medicaments, The agent is used to treat or prevent infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, And one or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, For the preparation of pharmaceuticals, The agent is used to treat or prevent infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, And one or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, For the preparation of medicaments, The agent is used to treat or prevent the infection of 89166-154-200427678 caused by hepatitis C virus in patients.  In the fiftieth specific embodiment, The present invention provides a formula (I), (II) (III), (IV), (Va), (Vb), (VIa),  Or: Academically acceptable salt form, One or more host immunomodulators,  One or more second antiviral agents and one or more agents for treating or alleviating HCV infections, including liver cirrhosis and inflammation, For the preparation of pharmaceuticals, The agent treats or prevents infections caused by the hepatitis virus in patients.  E.g, The present invention provides a formula (1), (Π), (ΙΠ), (IV), Alas,  (Vlb) '(VII) or (VIII) compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, From the stem of Jing-Hua ... dry…, Interferon- "cytokine,  Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents and / or agents for treating or alleviating signs of HCV infection, including liver cirrhosis and inflammation, For the preparation of a medicament * 'This medicament is used to treat or prevent infections caused by the hepatitis C virus in a patient.  In another preferred embodiment, The present invention provides a formula, Alas,  (III), (IV), (Va), (Vb), (VIa), _, (VII) or a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, —Or multiple host immunomodulators,  Selected from interferons including interferon ten PEGylated, Interference ㈣, Interferon /, Cytokine, Vaccines and vaccines containing antigens and adjuvants, ―Or multiple second antiviral agents, It inhibits HCV full plate by inhibiting the function of host cells that are associated with viral replication. " , , , π I 利 稷 ι, And one or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, For the preparation of medicaments, The drug is used to treat 89166 -155- 200427678 infection caused by the hepatitis virus in patients' towels.  E.g, The present invention provides a formula (I), (Π), (III), (IV), (Va), (VbMVIa),  (VIb), (VII) or (νΠΙ) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more host immune preparations' is selected from the group including interferon J,  PEGylated interferon- ^, Interferon- / 5, Interferon_ 7 cytokine, Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents,  It inhibits HCV replication by targeting proteins of the viral genome, And one or more agents that treat or alleviate symptoms of HCV infection, including liver cirrhosis and inflammation, For the preparation of pharmaceuticals, The agent treats or prevents infections caused by the hepatitis C virus in patients.  In a fifty-first embodiment, The present invention provides a formula ①, Alas,  Alas, (IV), (Va), (Vb), (via), (VIb), (VII) or (VIII) a compound or combination of compounds, or a pharmaceutically acceptable salt form thereof, And one or more agents for treating diseases caused by hepatitis B (HBV) infection in patients, For the preparation of pharmaceuticals,  The agent is used to treat or prevent infections caused by hepatitis C virus in patients.  In a fifty-second specific embodiment, The present invention provides a formula ① (ΙΙ), (ΠΙ) (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more host immune modulators and one or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient,  For the preparation of pharmaceuticals, The agent is used to treat or prevent infections caused by hepatitis C virus in patients.  E.g, The present invention provides a formula (I), Alas, (III), (Ln (VaMvbMVIa) 5 (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof 'of one or more host immunomodulators, Selected from interferon_α,  89166 -156- 200427678 PEGylated interferon-α, Interferon_ / 3, Interferon-7, Cytokine,  Vaccines and vaccines containing antigens and adjuvants, And one or more agents for treating a disease caused by a hepatitis B (HBV) infection, For the preparation of medicaments, The agent is used to treat or prevent infections caused by the hepatitis C virus in patients.  In the fifty-third specific embodiment, The present invention provides a formula (I), (II),  (III), (IV), (Va), (Vb), (Via), (Vlb), (VII) or (VIII) a compound or combination of compounds, or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents,  And one or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, For the preparation of pharmaceuticals, The agent treats or prevents infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, And one or more drugs to treat patients with diseases caused by hepatitis B (HBV) infection, For the preparation of pharmaceuticals, The agent is used to treat or prevent infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, And one or more agents for treating the disease caused by hepatitis B (HBV) infection, For the preparation of medicaments, This agent is used to treat or prevent the infection of 89166-157-200427678 caused by hepatitis C virus in patients.  In the fifty-fourth specific embodiment, The present invention provides a formula (I), (II),  (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators,  One or more second antiviral agents, And one or more agents for treating diseases caused by hepatitis B (HBV) infection in patients, For the preparation of pharmaceuticals, The agent is used to treat or prevent infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α,  PEGylated interferon-α: , Interferon-none, Interferon-γ, Cytokine,  Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, And the use of one or more medicaments for the treatment of diseases caused by hepatitis B (HBV) infections in patients, The agent treats or prevents infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α,  PEGylated interferon-α, Interferon- / 3, Interferon-τ, Cytokine,  Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, And one or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, For the preparation of pharmaceuticals, The agent is used to treat or prevent infections caused by the hepatitis C virus in patients.  89166 -158- 200427678 For example, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α,  PEGylated interferon-α, Interferon- / 3, Interferon-7, Cytokine,  Vaccines and vaccines containing antigens and adjuvants, One or more second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome,  And one or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient, For the preparation of pharmaceuticals, The agent treats or prevents infections caused by the hepatitis C virus in patients.  An agent for treating diseases caused by hepatitis B (HBV) infection in patients, Can be for example, but not limited to, L-deoxythymidine, Adifovir, Lamivudine or tenfovir or any combination thereof.  In the fifty-fifth specific embodiment, The present invention provides a formula (I), (II),  (III), (IV), (Va), (Vb), (Via), (Vlb), (VII) or (VIII) > [A compound or combination of compounds or a pharmaceutically acceptable salt form thereof, And one or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection in a patient, For the preparation of medicinal products, The agent is used to treat or prevent infections caused by the hepatitis C virus in patients.  In the fifty-sixth specific embodiment, The present invention provides a formula (I), (II),  (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) a compound or combination of compounds, or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators,  And one or more agents for treating a disease caused by a human immunodeficiency virus (HIV) infection in a patient, For the preparation of pharmaceuticals, The agent is 89166 -159- 200427678 in patients to treat or prevent infections caused by the hepatitis C virus.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators, Selected from interferon-α,  PEGylated interferon-α, Interferon-point, Interferon-7, Cytokine,  Vaccines and vaccines containing antigens and adjuvants, And one or more agents for treating the disease caused by human immunodeficiency virus (HIV) infection, For the preparation of pharmaceuticals, The agent is used to treat or prevent infections caused by the hepatitis C virus in patients.  In the fifty-seventh specific embodiment, The present invention provides a formula (I), Alas,  (III), (Rv), (Va) 5 (Vb), (Via), 〇 / Ib), (VII) or (\ αΐΙ: A MG compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents,  And one or more agents for treating a disease caused by a human immunodeficiency virus (HIV) infection in a patient, For the preparation of pharmaceuticals, The agent is used to treat or prevent infections caused by hepatitis C virus in patients.  E.g, The present invention provides a formula (I), (II), (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds or a pharmaceutically acceptable salt form thereof, One or more second antiviral agents, It inhibits HCV replication by inhibiting host cell functions associated with viral replication, And one or more agents for treating diseases caused by human immunodeficiency virus (HIV) infection in patients, For the preparation of pharmaceuticals, The agent treats or prevents infections caused by the hepatitis C virus in patients.  E.g, The present invention provides a formula (I), Alas, (III), (IV), (Va), (Vb), (Via),  (VIb), (VII) or (VIII) a compound or combination of compounds, or a pharmaceutically acceptable salt form of 89166-160-200427678, -Or multiple second antiviral agents, It inhibits HCV replication by targeting proteins of the viral genome, And one or more agents for treating the disease caused by human immunodeficiency virus (HIV) infection, For the preparation of pharmaceuticals, The agent is used to treat or prevent infections caused by hepatitis C virus in patients.  In the fifty-eighth specific embodiment, The present invention provides a formula ①, shell),  (mMIVMVaMVbMVIa), (Vib), (Νπ) or (VIII) a compound or combination of compounds, or a pharmaceutically acceptable salt form thereof, One or more host immunomodulators,

One or more second antiviral agents, and one or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection in a patient for use in the preparation of the agent, the agent being treated or prevented in the patient Infections caused by hepatitis C virus.

For example, the present invention provides a compound of formula ①, (π), (m), (IV 乂 ⑽, state, ⑽), (VIb), (VII) or (VIII) or a combination of compounds or a pharmaceutically acceptable compound thereof. Salt form, one or more host immunomodulators, selected from the group consisting of interferon 1, pegylated interferon 1, interferon gamma, interferon 1, cytokine, vaccines and vaccines comprising antigens and adjuvants, one or A variety of second antiviral agents and / or medicaments for treating diseases caused by human immunodeficiency virus (HIV) infection in patients for the preparation of medicaments for treating or preventing type C in patients Infections caused by hepatitis virus. For example, the present invention provides a compound of formula ①, ⑼, ㈣, (ιν), ⑽, (state, (he), (VIb), (VII) or (VIII) or a combination of compounds or a pharmaceutically acceptable salt thereof) Form, one or more host immune modulators, selected from the group consisting of interferon 1,, 'diPEGylated interferon_α, interferon_々, interferon 1, cytokine, 89166-161-200427678 vaccine and antigens Adjuvanted vaccines, one or more second antiviral agents that inhibit HCV replication by inhibiting host cell functions associated with viral replication, and one or more treatments for patients due to human immunodeficiency virus (HIV) The medicament caused by the disease is used for preparing a medicament for treating or preventing infection caused by the hepatitis C virus in a patient. For example, the present invention provides a formula (I), 式, (III) , (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII) compounds or combinations of compounds or pharmaceutically acceptable salts thereof, one or more host immunomodulators , Selected from the group consisting of interferon-α, pegylated interferon- ^, interference , Interferon-T, cytokine, vaccines and vaccines containing antigens and adjuvants, 'one or more second anti-disease mothers, which inhibit HCV replication via targeting the proteins of the viral genome' and one or more An agent for treating a disease caused by a human immunodeficiency virus (HIV) infection in a patient, for the purpose of preparing a medicament for treating or preventing an infection caused by a hepatitis C virus in a patient. Agents for treating diseases caused by human immunodeficiency virus (HIV) infections may be, for example, but not limited to, ritonavir, lopinavir, indinavir , Nelfmavir, nelfmavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, Franz Fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, casitabine ( zalcitabine), abacavi r), efavirenz, nevirapine, dilaber; delavirdine, TMC-125, L-870812, S-1360, enfUvirtide (T- 20) or T-1249 or any combination thereof. 89166 -162- 200427678 In the fifty-ninth specific embodiment, the present invention provides a method for preparing a compound having formula (I)

Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cyclofluorenyl, hetero Aryl and heterocyclic ring; R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylthioalkyl, alkylsulfinylalkyl, Alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl , Cyclofluorenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, methylfluorenylfluorenyl, fluorenyloxyalkyl, fluorenyl, heteroaryl, heteroaryl Sulfonyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC ( 0) alkyl-, RaRbNC (0) 0 alkyl-, RaRbNC (0) NRc alkyl-, RfRgC = N- and Rk〇-, where R1 is independently substituted with 0, 1, 2 or 3 substituents, The substituents are independently selected from the group consisting of alkyl, fluorenyl, decyl, keto, keto, and cyano , Nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, aralkyl, heteroaryl 89166 -163-200427678 alkyl, alkoxyalkoxyalkyl,-(alkyl) (OR〇),-(alkylXNH), -SRC, -S (0) Re, -S (0) 2Rc, -OK, -NdXRe), -C (0) Rc, -C (0) 0Rc, and -C (0) NRcRe; R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxyalkyl, alkyl, aryl, aryl, heteroaryl, heterocyclic, Heteroaryl, cyano, i, -N (Ra) (Rb), RaRbNC (0)-, -SRa, -S (0) Ra, -S (0) 2Ra, and RaC (0)-; of which R2 and R3 are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from Ra, alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, and haloalkyl ,-(Alkyl) (〇Rk),-(alkylXNI ^ Rb), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb),- C (0) Ra, -C (0) 0Ra and -C (0) NRaRb; or, R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, ring Alkyl, heteroaryl and heterocyclic ring, wherein the aryl, cycloalkyl, heteroaryl and heterocyclic ring are optionally substituted by (R6: ^ R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, 1¾, hydroxy, RaRbN-, N3-, ReS-, where R4 is independently substituted with 0, 1 or 2 substituents, substituents Independently selected from the group consisting of ||, nitro, cyano, -OH, -NH2, and -COOH; R5 is independently selected from each occurrence including fluorenyl, alkoxy, alkyl, alkynyl, aryl, Aralkyl, arylcarbonyl, aryloxy, azidealkyl, methyl si, dentyl, alkyl, carbonized, heteroaryl, heteroaryl, heterocyclic, heterocycloalkyl, hydroxyalkane Group, cycloalkyl group, cyano group, cyanoalkyl group, nitro group, nitro group, RaC (0)-, RaS-, Ra (0) S-, Ra (〇) 2S-, RaRbNfei-, Ra (0 ) SN (Rf)-, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl-, RaS02N (Rf) alkyl-, 89166 -164- 200427678

RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl, RaRbNC (0)-, RkOC (0)-, Rk0C (0) alkyl-, RkO alkyl, RaRbNS02-, RaRbNS02 alkyl-, (Rb0 ) (Ra) P (0) 0- and -ORk, where each R5 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, Halo, cyano, nitro, haloalkyl, i-alkoxy, aryl, heteroaryl, heterocycle, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl, _ (alkylXORJ ,-(AlkylXNReRd), -SRc, 4 (0 team, 4 (0) 2 heart, _0 &, -N (Rc) (Rd), -C (0) Rc, -C (0) 0Rc and- C (0) NReRd; ❿ R6 is independently selected from each group including alkyl, alkyl, alkyl, halo, cyano, nitro, i-alkyl, alkoxy, aryl, heteroaryl Base, heterocycle, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkyl) (^ ¾) ... SRa, 4 (0) ¾, -S (0 ) 2Ra, -ORk, -N ^ XRb), -C (0) Ra, -C (0) 0Ra, and -CCCONF ^ Rb; wherein each R6 is independently substituted by 0, 1, 2 or 3 substituents Is independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, 1¾, haloalkyl, cyano, nitrate Base, -〇Ra, -NRaRb, -SRa, name 0 \, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; φ

Ra and Rb are each independently selected from the group consisting of hydrogen, dilute, alkynyl, thioalkyl, aryl, arylfluorenyl, aralkyl, cyanoalkyl, cycloalkenyl, and cyclo Alkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methylaminoalkyl, lialkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocyclic, hetero Cycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, ^! ^] ^, Rk0-, Rk0 alkyl-, ReRdN alkyl-, ReRdNCCO) alkyl-, ReS02-, ReS02 alkyl-, & (:( 0)-, RcC (0) alkyl-, Rc0C (0)-, Rc0C (0) alkyl-, ReRdN alkylC (O)-, I ^ RdNCCO)-, ReRdNC (0) 0 alkyl-, 89166 -165- 200427678

RcRdNC (0) N (Re) alkenyl-, its center and ^ system are substituted with 0, 1 or 2 substituents, the substituents are selected from the group consisting of alkenyl, alkenyl, decyl, keto, self-radical, cyano , Nitro, haloalkyl, iS alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,-(alkyl , -SRe, 4 (0 凡, -S (0) 2Rc, 0 &, -N ^ XRd), -C (0) Rc, -CXOPK, and -CCCONReRd; or, Ra and Rb and their connected The nitrogen atoms together form a three- to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic rings, wherein the heteroaryl and heterocyclic ring systems are independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group including alkane Base, alkenyl, alkynyl, keto, halo, cyano, nitro, alkynyl, alkoxy, aryl, heteroaryl, heterocyclic, aryl, heteroaryl, aryl Alkoxy group,-(alkyl) (〇R〇),-(alkyl) (NRcRd), -alkyl SC ^ NReRd, alkyl C (0) NReRd, -SRe, name (0), ^ (OhRe, -ORc, -NCReXRd), seven (0 team,-(3 (0) 01 ^ & -C (0) NReRd;

Rc and Rd are independently selected at each place where they are selected from the group consisting of hydrogen, -NRfRh, -0Rf, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0 ) ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenyl fe, aryl, aryl, aryl, aryl, heteroaryl, heteroaryl Alkenyl, heterocyclic and heterocycloalkyl; ^ Is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, commercial tiger, and oxo Aryl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (0Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -SCOhRf, -0Rf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C (0) N ( H) NRfRh, -N (Re) C (0) 0Rf 89166 -166- 200427678, -N (RJS02NRfRh, -N (Re) C (〇) NRfRh, -alkylN (Re) C (0) 0Rf,- Alkyl N (Re) S02 NRf Rh and -alkyl N (Re) C (0) NRf Rh; or Re forms a three- to six-membered ring together with Rd and the nitrogen atom to which they are attached, selected from the group consisting of hetero Aryl and heterocyclic, wherein heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, block, keto, 1¾, and cyano Base, nitro, haloalkyl, iSalkoxy, aryl, heteroaryl, heterocycle, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf) , -0 ^ *) (NRfRh), -SRf, -S (O) Rf, -S (O) 2Rf, -ORf, -N ( Rf) (Rh), -C (0) Rf, -C (0) 0Rf & -C (0) NRfRh;

Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg, and Rh are each independently selected from the group consisting of hydrogen, alkyl, fluorenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cyclofluorenyl, cycloalkenylalkyl, Heterocyclic, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl and alkenyl , Decyl, cyano, halo, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -〇 (alkane Group), ~ NH2, _N (H) (alkyl), · N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl, -alkyl-OH , -Alkyl-O-alkyl, -alkylNH2, -alkylN (H) hexyl), -alkylN (alkyl) 2, -alkylS (alkyl), -alkylS ( 0) (Alkyl), -alkyl S02 alkyl, -N (H) C (0) NH2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkyl , -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, Rf and Rg and others The linked carbon atoms together form a three- to seven-membered ring selected from cycloalkyl, cycloalkenyl, and heterocyclic rings; or, and ^ Together with the nitrogen atom to which they are connected to form a three- to seven-membered 89166-167-200427678 ring, selected from the group consisting of heterocyclic rings and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system is independently 0, 1, 2 Or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, hetero Ring, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl),- S (alkyl), -S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkane S (alkyl), -alkylS (0) (alkyl), -alkylS02alkyl, -alkylN (alkyl) 2, -n (h) c (o) nh2, -C ( 0) 0H, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl) And -C (0) N (alkyl) 2;

Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methylaminoalkyl , Alkyl, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS -, RaS (0)-, RaS02-, RaS alkyl-, Ra (0) S alkyl-, RaS02 alkyl-, 1 ^ 0 (3 (0)-, Ra0C (0) alkyl-, RaC ( 0)-, RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, decyl, keto, keto, Cyano, nitro, self-ignition, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇R 〇),-(alkylXNReRd), -SRe, -S (0) Re, -S (0) 2Re, -ORc, -N (Rc) (Rd), -C (0) Rc, -C (0 ) 0Rc and -C (0) NRcRd; m is 0, 1, 2, 3, or 4; and n is 0, 1, 2, 3, or 4; with the proviso that when A is a single ring other than the following Ring

89166 -168- 200427678 and R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, radical, block, aryl, halo, heteroaryl, heterocyclic Burnt, cycloalkyl, cyano, nitrate! , RaRbN-, RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaS02N (Rf)-, RaRbNC (0)-, Rk0C (0)-, RaRbNS02- or -ORk And R6 is hydrogen, alkyl, alkenyl, alkynyl, fluorenyl, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra, -S (0 ) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkyne Aryl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, hetero Cyclofluorenyl or heterocycloalkyl; and with the additional condition that when A is

And R4 is hydroxyl or Re S-, and R5 is hydrogen, unsubstituted alkyl, halo or -ORk, and R6 is hydrogen, alkyl, fluorenyl, decyl, li, cyano, nitro, Aryl, heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C < 0) 0Ra and -C (0) NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylfluorenyl, aralkyl, cycloalkyl, (cycloalkyl) Group, (cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl; including:

(26) -169- ⑻ The compound of formula (26) 89166 427678 is provided to provide formula (27) and contact with carbon disulfide and methylating agent 'in the presence of a base, and the compound and

H3SCH contacts the compound of formula (27) with the compound of formula (13) (R5) n

SO2NH2 NH, (13). In the tenth specific embodiment of 7T, φ is too high, in her example, the present invention provides a method for preparing a compound having formula ⑴ < Salt form, stereoisomer or mutual, method of laughing structure,

among them··

R1 is selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxycarbonylalkyl, alkyl 89166, 170-200427678, fe alkynyl, fethio, fe, pit, sulfanyl, Alkyl radicals, base radicals, block radicals, aryl radicals, aryl allyl radicals, aryl fe radicals, arylthio radicals, aryl sulfonyl alkyl radicals, carboxyalkyl radicals, cyanoalkyl radicals, cyclofluorenes Radical, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, methylsulfanyl, iSalkenyl, haloalkyl, heteroaryl, hetero Diluted aryl, heteroaryl, heteroarylsulfonylalkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) Alkyl-, RaRbNC (0) 0 alkyl ·, 1 ^ 111 ^ 0: (such as 11 (: alkyl, RfRgON-, and RkO-, where R1 is independently 0, 1, 2, or 3) Each substituent is substituted, and the substituent is independently selected from the group consisting of alkyl, alkenyl, block, keto, iS, cyano, nitro, haloalkyl, iS alkoxy, aryl, heteroaryl, heterocyclic , Aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkylXNI ^ Re), _SRC, -S (0) Re, -S (0) 2Re, 0 &, -NdXRe), -C (0) Rc, -C (0) 0Re and -C (0) NRcRe; R2 and R3 are independently selected Including hydrogen, alkenyl, alkyl, alkoxy, alkoxycarbonyl, alkyl, aryl, aralkyl, heteroaryl, heterocyclic, heteroaralkyl, cyano, halo, ... N ( Ra) (Rb), RaRbNC (0)-, -SRa, -S (0) Ra, -S (0) 2Ra, and RaC (0); where R2 and R3 are independently 0, 1, 2, or 3 Substituted by a substituent, the substituent is independently selected from Ra, alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, haloalkyl,-(alkyl) (〇Rk),-(alkane Base XNRaRb), _SRa, -S (0) Ra, -S (0) 2Ra, -0Rk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0 ) NRaRb; or, R2 and R3 together with the end atom to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl, and heterocyclic rings, wherein the aryl groups are 89166-171 -200427678, cycloalkyl, heteroaryl and heterocyclic systems are optionally substituted with (R6) m; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxyl, RaRbN-, N3_, ReS-, where R4 is independently substituted by 0, 1 or 2 substituents, Substituents are independently selected from the group consisting of i, nitro, cyano, -OH, -NH2, and -COOH; R5 is independently selected from each occurrence including fluorenyl, alkoxy, alkyl, alkynyl, and aryl , Aralkyl, arylcarbonyl, aryloxy, azidoalkyl, methylformyl, pico, iS alkyl, picocarbon, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl , Hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, alkyl, RaC (0) ·, RaS-, Ra (0) S ·, Ra (0) 2S-, RaRbN alkane Radical-, 1 ^ (0) 3 wind center), RaS02N (Rf)-, Ra (0) SN (Rf) alkyl, RaS02N (Rf) alkyl-, RaRbNS02N (Rf)-, RaRbNS02N (Rf) Alkyl-, RaRbNC (0)-, Rk0C (0)-, Rk0C (0) alkyl-, RkO alkyl-, I ^ RbNSCV, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0- And -〇Rk, wherein each R5 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, _Alkyl, S alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORJ,-(alkylXNReRd) , -SRe, -S⑼Rc, -S (0) 2Rc, -ORc, -N (R c) (Rd),-, -CXOpRcA-CCCONReRd; R6 is independently selected from each occurrence including alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy , Aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkylXNI ^ Rb), -SRa, 4 (0) 1 ^, -S (0) 2Ra, -ORk, -N ^ XRb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; where each R6 is independently 〇, 1, 2 or 3 substituents substituted 89166 -172- 200427678, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, i-group, haloalkyl, cyano, nitro, -〇Ra, -NRaRb , -SRa, -SOi ^, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; each of which is independently selected from the group consisting of hydrogen, alkenyl, and alkane Alkyl, alkylthio, aryl, aryl, aryl, aryl, alkynyl, aryl, alkynyl, cycloalkyl, cycloalkyl, cycloalkyl, cycloalkyl, cycloalkyl Alkenyl, methylamino, haloalkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl , RcRdN-, Rk0-, Rk0 Group-, I ^ RdN alkyl-, ReRdNC (0) alkyl-, ReS02-, ReS02 alkyl-, ReC (O), RcC (0) alkyl-, ReOCCO)-, Reoc (0) Alkyl-, ReRdN alkyl C (O)-, ReRdNCXO)-, ReRdNCCOp alkyl-, ReRdNCXCON ^) alkyl_, its center and! ^ Is substituted with 0, 1 or 2 substituents, the substituents are selected from the group consisting of alkyl, alkenyl, block, keto, 1S, cyano, nitro, alkynyl, i-alkoxy, aryl , Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,-(alkyl) (^ ¾), -SRe, 4 (0) 1 ^ , -SCOhK, -OK, -N ^ XRd), -C (0) Rc, (: (0) 0 ~ and -C (0) NReRd) Alternatively, 1 ^ is formed together with Rb and the nitrogen atom to which they are connected Three- to six-membered rings, selected from the group consisting of heteroaryl and heterocyclic rings, wherein the heteroaryl and heterocyclic ring systems are independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl , Block: base, keto, base, cyano, nitro, alkynyl, self-oxyl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkane Group,-(alkyl) (〇R〇),-(alkylXNI ^ Rd), -alkylS02NRcRd, -alkylC (0) NReRd, -SRe, -S (0) Rc, ^ (0) 21, -〇 &, -N (Re) (Rd), 89166 -173-200427678, -C (0) 0Re and -CCCONI ^ Rd;

Re and Rd are independently selected at each occurrence from the group including hydrogen, -NRfRh, -0ff, -CO (Rf), -SRf, -SORf, -S02Rf, _C (0) NRfRh, -S02NRfRh, -C (0) 0Rf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, || alkyl, heteroaryl, heteroaryl Group, heterocyclic and heterocycloalkyl; wherein each Re and Rd are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, and halo , Cyano, nitro, lialkyl, || alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) ( ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, _N (Rf) (Rh), -C (0) Rf, -C ( 0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, NCRJSC ^ NRfRh, -N (Re) C (0) NRfRh,- Alkyl N (Re) C (0) 0Rf, -alkyl N (Re) S02 NRf Rh, and -alkyl N (Re) C (0) NRf Rh; or, the heart atom and the nitrogen atom to which they are connected Together form a three- to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic rings, wherein heteroaryl and heterocyclic ring systems are independently 0, 1 2 or 3 substituents are substituted, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, decyl, -yl, halo, cyano, nitro, phenyl, D-peroxy, aryl, heteroaryl, Heterocycle, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf), -〇 ^ *) (NRfRh), -SRf, -S (0) Rf,- S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and -C (0) NRfRh;

Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg, and Rh are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocyclic, heterocycloalkyl, heteroaryl and heteroarylalkyl; each of Rf, Rg 89166-174-200427678 and Rh are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of Alkyl, alkenyl, decanyl, cyano, keto, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -〇 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S〇2 Group, -pit group-OH, -carbyl group-O-buty * group, -fe group NH2, -fe group N (H) (alkyl), -alkyl N (alkyl) 2, -alkylS ( Alkyl), -alkyl S (0) (alkyl), -alkyl so2 alkyl, -N (H) C (0) NH2, -C (0) 0H, -c (o) o (alkyl ), -C (o) alkyl, -C (0) NH2, -C (0) NH2, _C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; φ Alternatively, Rf, together with Rg and the carbon atom to which they are attached, form a three- to seven-membered ring 'selected from the group consisting of cycloalkyl, cyclocyclyl and heterocycle; or & together with 1 ^ and the nitrogen atom to which they are attached, form a three- to seven-membered ring selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently 0, 1, 2 or 3 substituents are substituted, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, decyl, cyano, functional, keto, nitro, aryl, aryl, cycloalkyl, cycloalkenyl, heterocyclic , Heteroaryl, heteroaralkyl, -OH, -0, fluorenyl, -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl),- S (alkyl), -S (0) (· alkyl), -alkyl ~ OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl),- Alkyl S (alkyl), -alkyl S (0) (alkyl), -alkyl S02 alkyl, -alkyl N (alkyl) 2, -n (h) c (o) nh2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl ) And -C (0) N (alkyl) 2;

Rk is selected from the group consisting of hydrogen, alkenyl, pentyl, aryl, aryl, chloro, pentyl, cyclofluorenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, methylamino Alkyl, aryl, heteroaryl, heteroaryl, heterocyclic, heterocyclic, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl Radical 89166 -175- 200427678, RaS-, RaS (O)-, RaS02-, RaS alkyl-, Ra (0) S alkyl-, RaS02 alkyl-, RaOCCO), RaOC (0) alkyl -, RaC (0)-, RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, block, Base, iS base, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkane () Rc),-(alkyl, -SRC, name (0) xin, -S (0) 2Re, -ORc, -NdXRd), -C (0) Re, -C (0) 0Re and- CCCONReRd; m is 0, 1, 2, 3, or 4; and n is 0, 1, 2, 3, or 4; with the proviso that when A is a monocyclic ring other than the following

And R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, fluorenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocycloalkyl, ring Alkyl, cyano, nitro, ^^ 1 ^, 11 ^ (0)-, 1 ^ 8_, 1 (0) 8_, 1 ^ (0) 28-, RaS02N (Rf)-, RaRbNCCO)-, Rk0C (0)-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, i-yl, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa,- When S (0) Ra, -S (0) 2Ra, _ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb, R1 is not Hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, heteroaryl, heteroaryl Alkenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl; and with the additional condition that when A is

89166 -176- 200427678 and R4 is hydroxy or ReS-, and R5 is hydrogen, unsubstituted alkyl, alkynyl or -0Rk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, alkynyl, cyano Group, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0 ) Ra, -C (0) 0Ra, and -C (0) NRaRb, then R1 is not hydrogen, amidino, alkyl, bulk, aryl, arylfluorenyl, arylalkyl, cycloalkyl, ( (Cycloalkyl) alkenyl, (cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycloalkenyl, or heterocycloalkyl; it includes: _ 式 Formula (26) Compound

R1 (26) is contacted with methyl (methylthio) methyl sulfate in the presence of a base to provide a compound of formula (27)

(b) contacting a compound of formula (27) with a compound of formula (13) (R5) n

89166 -177- 200427678 In a sixty-first embodiment, the present invention provides a compound having formula (IX)

(IX) or a pharmaceutically acceptable salt form, tautomer or stereoisomer thereof, wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkynyl, alkynyl, alkynyl, Carbonyl alkyl, thiothio, thioalkyl, thioalkyl, thioalkyl, alkyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, Arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, formamyl Alkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl , Hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, E ^ RbNCCCOO alkyl-, RaRbNCCCONRe alkyl-, RfRgC = N- and RkO-, where R1 is independent Substituted by 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, naphthyl, block, keto, fluorenyl, cyano, nitro, haloalkyl, fluorenyloxy, aryl Radical, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkane Alkoxyalkyl,-(alkyl) (〇Re),-(alkylXNH), -SRC, -S (0) Re, -S (0) 2Rc, -ORe, -N (Rc) (Re ), -C (0) Rc, -C (0) 0Rc, and -C ^ Nf ^ Re; R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, and alkoxy 89166 -178- 200427678 carbonyl, alkyl, aryl, aralkyl, heteroaryl, heterocyclic, heteroaralkyl, cyano, dentyl, -N (Ra) (Rb), RaRbNC (0)-, -SRa,- S (0) Ra, -S (0) 2Ra, and RaC (0)-; where R2 and R3 are independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of Ra, alkyl, and olefin Alkynyl, alkynyl, keto, halo, cyano, nitro, haloalkyl,-(alkyl) (〇Rk),-(alkylXNT ^ Rb), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), _C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; or, R2 and R3 and their connected The carbon atoms together form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl, and heterocyclic rings, wherein the aryl, cycloalkyl, heteroaryl, and heterocyclic ring are optionally (R6 ) m substitution; R6 is independently selected from the group consisting of alkyl, alkynyl, decyl, halide, cyano, nitro, and alkane , Alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkyl) (^ ¾), surface SRa , -SCCORa, -S (0) 2Ra, -ORk, -N ^ XRb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; where each R6 is independently 0, 1 , 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, li, haloalkyl, cyano, nitro, -〇Ra, -NRaRb, -SRa, -SOI ^, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; heart and Rb are independently selected at each occurrence from the group including hydrogen, alkenyl, alkyl, and alkane Thioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formamidine Alkyl, self-derived, heteroaryl, heteroaryl dilute, heteroaryl, heterocyclic, heterocyclic fluorenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, ReRdN-, RkO -, RkO alkyl-, RcRdN alkyl-, RcRdNC (0) alkyl-, ReS02- 89166 -179- 200427678, RcS02 alkyl-, RcC (0)-, ReC (O) alkyl-, Re〇C (0) ·, Rc0C (0) alkyl-, ReRdN alkyl C (O)-, ReRdNCCO)-, ReRdNCCOp alkyl-, ReRdNCCCON ^) alkyl-, wherein Ra and Rb are substituted with 0, 1, or 2 substituents, and the substituents are selected from the group consisting of alkyl, alkenyl, and alkynyl , Keto, alkynyl, cyano, nitro, alkynyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,- (Alkyl) (〇R〇),-(alkyl) (1% ¾), -SRC, -S (0) Re, -S (0) 2Re, _ORe, -N ^ XRd), -C (0 ) Rc, -C (0) 0Rc and -C (0) NReRd; or, 1 ^ and 1 ^ and the nitrogen atom to which they are attached form a three- to six-membered ring, selected from the group consisting of heteroaryl and hetero Ring, wherein heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, fluorenyl, cyano, and nitro , Alkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇R〇),-( Alkyl XNReRd), -alkyl SC ^ NI ^ Rd, -alkyl CXCONReRd, -SRe, -S (0) Re, -S (0) 2Re, -ORe, -NdXRd), -CCO)! ^,- ; # 心 and Rd are independently selected in each place of existence Including hydrogen, _NRfRh, _ORf, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) 0Rf, alkenyl, alkyl, alkynyl, cycloalkane Radical, cycloalkylalkyl, cyclofluorenyl, cycloalkenylalkyl, aryl, aralkyl, ialkyl, heteroaryl, heteroaralkyl, heterocycle, and heterocycloalkyl; each Rc and Rd is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, halo, cyano, nitro, autoalkyl, and alkoxy Aryl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORf) 89166 -180- 200427678,-(alkyl) (NRfRh ), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh) '-C (0) Rf > -C (0) 0Rf > -C ( 0) NRfRh ^ -C (0) N (H) NRfRh ^ -N (Re) C (0) 0Rf, -N (Re) S02NRfRh, -N (Re) C (0) NRfRh, -alkylN (Re ) C (0) 0Rf, -alkylN (Re) S02 NRf Rh and -alkylN (Re) C (0) NRf Rh; or, together with 11 (1 and the nitrogen atom to which they are connected, form three -To six-membered ring, selected from the group consisting of heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently 0, 1, 2 or 3 Substituent group substitution, the substituent is independently selected from the group consisting of alkyl, alkenyl, decyl, keto, ii, cyano, nitro, thio, alkoxy, aryl, heteroaryl, heterocyclic, Aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0 ) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and -C (0) NRfRh;

Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;

Rf, Rg & Rh are independently selected from each occurrence including hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocyclic, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh * is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl and alkenyl , Alkyne: yl, cyano, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -〇 (alkane Group), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl, -alkyl- OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl), -alkyl S (0) (alkyl), -alkylso2 alkyl, -N (H) C (0) NH2, -C (0) 0H, -c (o) o (alkyl), -c (o) Alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, 1 ^ and 1 ^ Together with the carbon atoms to which they are attached form a three-to-seven-membered 89166-181- 200427678 ring, selected from the group consisting of cycloalkyl, dicycloalkyl and heterocycles; or, & together with 1111 and the nitrogen atom to which they are connected, form a three- to seven-membered ring selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently 0, 1, 2 or 3 Each substituent is substituted, and the substituent is independently selected from the group consisting of alkyl, fluorenyl, block, cyano, alkynyl, keto, nitro, aryl, aryl, cycloalkyl, cycloalkenyl, heterocyclic, Heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S ( Alkyl), -S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS (Alkyl), -alkylS (0) (alkyl), -alkylS02alkyl, -alkylN (alkyl) 2, -n (h) c (o) nh2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl), and- C (0) N (alkyl) 2;

Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, methylamino , Haloalkyl, heteroaryl, heteroarylalkyl, heterocyclic, heterocycloalkyl, nitroalkyl, I ^ RbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkane Group, RaS-, RaS (0)-, RaS02-, RaS alkyl-, Ra (0) S alkyl-, RaSCVM * group-, 10 (3 (0)-, Ra0C (0) alkyl-, RaC (0)-, RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, decyl, hydrazone, 1¾ Base, amino, nitro, alkynyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaryl, alkoxyalkoxyalkyl,-(alkyl) (0RC ),-(Alkyl) (NReRd), -SRe, 4 (0) 1 ^, -S (0) 2Rc, -OR〇, -N (Rc) (Rd), -C (0) Re, -CCCOORe And -CCCONReRd; m is 0, 1, 2, 3, or 4; and R11 and R12 are independently selected from the group consisting of alkyl, alkenyl, and alkynyl groups. 89166 -182- 200427678 Formula Sixty-first of the invention (ιχ) Exemplified compounds of the specific embodiments, or pharmaceutically acceptable Accepted salt forms, tautomers or stereoisomers, including but not limited to the following: 1-fluorenyl (bis (methylthio) methylene) -1 hydrazone-quinoline-2,4 (1H, 3H ) -Dione; 3- [bis (methylthio) methylene H-butyl-1,8-naphthyridine-2,4 (1H, 3H) -dione; 3- [bis (methylthio) Methylene] small (1,3-diketo-1,3-dihydro-2H-isoearm-2-yl) quinoline-2,4 (1H, 3H) -dione; 3- [bis (Methylthio) methylene] -1-[(cyclopropylmethyl) amino] quinoline-2,4 (1Η, 3Η) -dione; 3- [bis (methylthio) methylene ] -1- (3-methylbutyl) pyridine-2,4 (1H, 3H) -dione; 1-benzyl-3- [bis (methylthio) methylene] pyridine-2,4 ( 1H, 3H) -dione; 3- [bis (methylthio) methylene] -1- (cyclobutylamino) quinoline-2,4 (1H, 3H) -dione; and 3- [ Bis (methylthio) methylene H- (cyclobutylmethyl) pyridine · 2,4 (1Η, 3Η) _diketone. The compounds of the present invention may contain asymmetrically substituted carbon atoms. Therefore, all of the compounds of the present invention Stereoisomers are intended to be included in the present invention, including racemic mixtures, mixtures of diastereomers, and mixtures of paraisomers Compounds, as well as individual optical isomers, including the paraisomers and single diastereomers of the compounds of the present invention, are substantially free of their paraisomers or other diastereomers. The so-called f ' "Substantially free" means that more than about 80% of other para-isomers or diastereomers free of this compound, more preferably more than about 90% of other para-isomers or Diastereomers, and more preferably greater than about 95% other para-isomers or diastereomers that do not contain this compound, yet more highly preferred are greater than about 98% of other compounds that do not contain this compound For 89166-183-200427678 palmar isomers or diastereomers, and more preferably more than about 99% other palmar isomers or diastereomers without this compound. In addition, compounds containing possible geometric isomers of carbon-carbon double bonds and carbon-nitrogen double bonds are also intended to be included in the present invention. The individual stereoisomers of the compounds of the present invention can be prepared by any one of a variety of methods within the knowledge of those skilled in the art. These methods include stereospecific synthesis, chromatographic separation of diastereomers, chromatographic resolution of para-isomers, conversion of para-isomers in para-isomer mixtures to diastereomers Then, the diastereoisomers are separated by chromatography, and the regeneration of individual isomers and the analysis of enzymes are performed. Stereospecific synthesis involves the appropriate use of palm starting materials and synthetic reactions, which does not cause stereochemical racemization or reversal in the center of the palm. Diastereomeric mixtures of compounds due to synthetic reactions can often be separated by chromatographic techniques known to those skilled in the art. Chromatographic analysis of palm isomers can be achieved on palm chromatography resins. Chromatographic columns containing palmitic resin are commercially available. In practice, the racemate is placed in solution and packed on a column containing a stationary phase of the palm. Then, para-isomers were separated by HPLC. The analysis of palmar isomers can also be achieved by reacting with palmar adjuvants to convert the palmar isomers in the mixture into diastereomers. The diastereomers formed can then be separated by column chromatography. This technique is particularly useful when the compound to be isolated contains a carboxyl, amine, or hydroxyl group that will form a salt or covalent bond with a paragenic adjuvant. Palm pure amino acids, organic carboxylic acids, or organic sulfonic acids are especially useful as palm auxiliaries. Once the diastereomeric 89166-184-200427678 has been chromatographed, individual palmar isomers can be regenerated. Palm auxiliaries can often be recycled and reused. Compound :: 'Di-1 enzyme, phosphatase and lipase can be used for the analysis of palm isomerized mixed materials. For example, a: * group can be prepared. Certain enzymes will selectively hydrolyze a para-isomer in the mixture. The pure acid formed can then be separated from the unhydrolyzed ester. /, The structural compound can exhibit tautomerism or structural isomerism. When this: θ drawing can only represent a possible tautomeric or structural tethered form, it should be clear that the present invention encompasses any tautomeric or degenerate tectonic forms or mixtures thereof, which have an inhibitory type c The ability of hepatitis is not limited to any of the tautomeric or structurally isomeric forms utilized in the drawings. In addition, solvates and hydrates of the compounds of the present invention are intended to be encompassed by the present invention. " " When any variable (such as Rh R2, R3, m, n, etc.) is in any substituent or in the compound of the present invention or any other chemistry herein; see more than one time, its definition in each place is related to The definition in every other place of existence is irrelevant. In addition, the combination of substituents is allowed only if such a combination would result in a stable compound. Stable compounds are compounds which can be isolated from the reaction mixture in useful purity. The compounds of the invention may be present as pharmaceutically acceptable salts. The term "musically acceptable salt" as used herein means an acid or base salt or zwitterionic form of a compound of the present invention, which is water or oil soluble or dispersible, which is suitable for the treatment of diseases without improper Toxic, irritating and allergic responses; it is 89166 -185- 200427678 accompanied by a reasonable benefit / risk ratio and is effective for its intended use. These salts can be used during the final isolation and purification of the compound, or individually Is prepared by reacting a basic group (such as a nitrogen-containing group) with an appropriate acid. Representative acid addition salts include acetate, adipic acid, alginate, citrate, aspartic acid Salt, benzoate, benzenesulfonate, acid sulfate, butyrate, camphor, camphor sulfonate, digluconate, glycerol phosphate, hemisulfate, heptanoate, hexanoate, Formate, fumarate, hydrochloride, hydrobromide, hydroiodate, 2-hydroxyethanesulfonate, lactate, maleate, 1,3,5- Xylene sulfonate, methane sulfonate, linnaphthyl sulfonate, nicotinate, 2-sulfonate Salt, oxalate, dihydroxygallate, pectinate, persulfate, 3-phenylpropionate, picrate, trimethylacetate, propionate, succinate, tartrate , Trichloroacetate, trifluoroacetate, phosphate, glutamate, bicarbonate, p-toluenesulfonate and undecanoate. The amine group in the compound of the present invention can also be the following four levels Methyl, ethyl, propyl and butyl chloride, bromide and iodide; dimethyl, diethyl, dibutyl and dipentyl sulfate; decyl, lauryl, nutmeg And stearyl chlorides, bromides and iodides; and benzyl and phenethyl bromides. Examples of acids that can be used to form pharmaceutically acceptable addition salts include inorganic acids such as hydrochloric acid, hydrogen Bromic acid, sulfuric acid, and phosphoric acid, and organic acids such as oxalic acid, maleic acid, succinic acid, and citric acid. Basic addition salts can be made during the final isolation and purification of the compound by making the acidic group (Such as benzyl or methyl alcohol) and appropriate tests, such as metal cation hydroxides, carbonic acid Salt or bicarbonate, or react with ammonia or organic primary, two 89166 -186- 200427678 or tertiary amines. The cations of pharmaceutically acceptable salts include lithium, sodium, potassium, 4 bow, 4 US and Ming, and non-toxic Quaternary amine cations, such as ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine, tributylamine, pyridine, N, N- Xylylamine, N-methylhexahydropyridine, N-methylmorpholine, dicyclohexylamine, procaine, dibenzylamine, N, N-difluorenylphenylethylamine, 1-ephedrine And N, N'-difluorethylene ethylenediamine. Other representative organic amines that can be used to form basic addition salts include ethylenediamine, ethanolamine, diethanolamine, hexahydropeptide, and hexahydropeptide. The preferred salts of the compound of the present invention include mono # 3, di-steel, triethylamine salt, trifluoroacetate and hydrochloride. The compound of the present invention may also exist as a pharmaceutically acceptable prodrug. The term `` pharmaceutically acceptable precursor drug '' means a precursor drug or zwitterion that is suitable for use in contact with a patient's tissues without undue toxicity, irritant and allergic responses, with a reasonable interest / risk Ratio, and effective for its intended use. '1 prodrug' is considered to be any covalently bound carrier, and when such a prodrug is administered to a mammalian patient, it will release formulae (I), (II) in vivo, (III), (IV), (V), (Va), (Vb), (Via), (VIb), (W-body drugs. Formulas (I), (II), (m), (IV), (V), (Va), (Vb), (Via), (VIb), (VII) or (νπ ^^ Compound precursor drugs are prepared by modifying functional groups present in a compound, which The method is to cause the modifier, whether in routine operation or in vivo, to split into the parent compound individually. Prodrugs include the following compounds, in which a hydroxyl, amine, carboxyl, or hydrogenthio group is bound to any group, when administered When administered to a mammalian patient, it will split to form free-form hydroxyl, amine, carboxy, or hydrogenthio groups individually. Examples of prodrugs include, but are not limited to, 89166 -187- 200427678 Formula (I), (II), (III), (IV), ⑺, (Va), (Vb), (Via), (VIb), hydrazine, formic acid and amine functional groups, formic acid, formic acid, and stupid Bridge creatures, etc. Treatment according to the invention Methods and pharmaceutical compositions, these compounds are administered alone or in combination with other antiviral agents. When these compounds are used, the degree of a specific pharmaceutically effective dose to any particular patient will depend on the q ' For example, the severity of the disease being treated and the severity of the disease; the activity of the specific person used; the specific composition used; the patient's age, weight,-&, general health, gender and diet; time of administration; route of administration ; Adopted

Excretion rate of the compound; duration of treatment; and drugs used with or concurrently. These compounds can be administered orally, parenterally, transdermally (nasal spray), rectal, vaginal, or topically in a unit dose formulation containing a carrier, adjuvant, diluent, vehicle, or a combination thereof. The term "parenteral" includes perfusion and subcutaneous, intravenous, intramuscular, and intrasternal injection. Aqueous or oily suspensions of the compound administered parenterally, which can be dispersed, wetted, or formulated with suspensions. Injectable preparations It can also be an injectable liquid or suspension in a diluent or solvent. The acceptable dilution or solvent used in it is water, saline, Ringer's solution, buffer, glycerol monohydrate. A cool'lipids, such as oleic acid, and non-volatile oils, such as glycerol mono- or diglycerides. The antiviral effects of compounds administered parenterally can be prolonged by slowing their absorption. One way to slow the absorption of a particular compound is to administer an injectable storage form, which contains a crystalline, amorphous, or water-insoluble form of the compound in a suspension. The absorption rate of this compound is based on its solubility 89166 -188- 427678 The solution rate is $, which in turn depends on its physical state. To make the mouth of a particular compound, tablets Xianyou <Another formula is to administer as an oily solution or suspension :: Compound <injectable storage form To slow down the absorption of specific compounds, the main alternative is to inject H in a microcapsule matrix containing the compounds. The compounds are captured in microlipids, microemulsions, or biodegradable polymers such as polymers The rate of drug release can be controlled depending on the ratio of polymer to polymer and the composition of polymer in the domestic delivery service, polyethylenic acid, polyorthoic acid or polypeptide. Controlled delivery of these compounds can be provided. The rate of absorption can be slowed by the use of rate-controlling films, or by trapping the compounds in a polymer matrix or, b $. Conversely, absorption enhancers can be used to increase absorption. Solid dosage forms, including capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active compound may optionally contain diluents such as sucrose, lactose, powder, talc, oxalic acid, aluminum hydroxide , Calcium silicate, polyamide powder, lubricants for pharmaceutical tablets, and additives for pharmaceutical tablets, such as magnesium stearate or microcrystalline cellulose. Capsules, tablets and pills can also contain buffers Tablets and pills can be made with enteric coatings or other controlled release coatings. Powders and sprays can also contain excipients such as talc, silicic acid, aluminum hydroxide, calcium silicate Polyamine powder or its w compound. Sprays may additionally contain conventional propellants, such as chlorofluorocarbons or their substitutes. Liquid dosage forms for oral administration include emulsions, microemulsions, solutions, suspensions Liquids, syrups and elixirs contain inert diluents such as water. These compositions may also contain adjuvants such as wetting, emulsifying, suspending, sweetening, 89166 -189- 200427678 flavoring and flavoring agents. Local dosage forms Includes ointments, pastes, creams, lotions, gels, liquids, wetting agents, inhalants, and transdermal patches. Mix the compound with: = the carrier and any preservatives or buffers needed Mixing: two; the form can also contain professional agents, such as animal and vegetable fats, oil waxes, stone ants, gel powder, scutellaria baicalensis gum, cellulose derivatives: one: Poly, Wei, bentonite, Materials, talc, zinc oxide, or mixtures thereof. Appropriately non-irritating ° D Cocoa butter or polyethylene glycol is made, each of which is solid at normal temperature but fluid in the rectum or vagina. Ophthalmic formulations' include eye drops, ophthalmic formulations, and "in the domain of the invention." ... and also, it is intended to encompass that the compounds of the present invention inhibit HCV face-dependent fungal polymerase, an enzyme necessary for the replication of foot viruses. It can be administered as an active agent alone, or one or more of them for treating tadpole hepatitis infection or symptoms associated with HCV salty infection. Other agents to be administered in combination with the compounds of the present invention include Q HCV, a therapeutic agent for diseases caused by infection, which suppresses HCV virus replication by a direct and indirect mechanism. It includes some agents, such as host-free modulation, such as interferon-α, clarified interferon, CpG oligonucleotide, etc., or antiviral compounds, which will inhibit host cell function, such as muscle muscle Monophosphate dearginase, such as M material. Also included are cytokines that modulate immune function. Yiming red clay ^ force a bracket is included! ^^ Antigen or vaccine against Hcy antigen adjuvant combination. Also included are the following agents, which interact with host cell components by inhibiting the internality of Hcv virus replication: the glycome 89166-190- 200427678 entry step (IRES) triggered translation steps to block viral protein synthesis, or Blocks virion maturation and releases with targeted agents such as HCVP7, which are membrane proteins. Other agents, including any agent or combination agent, to be administered in combination with a compound of the present invention inhibit HCV replication by targeting viral genomic proteins involved in viral replication. These agents include, but are not limited to, other inhibitors of HCVRNA-dependent RNA polymerase, such as nuclear: y: type polymerase inhibitors, as described in W00190121 (A2) or US6348587B1 or W00160315 or WO0132153, or non-nuclear inhibitors, For example, benzimid polymerase inhibitors are described in EP1162196A1 or WO00204425, or inhibitors of HCV proteases, such as peptidomimetic type inhibitors, such as BILN2061, etc., or inhibitors of HCV helicase. Other agents, including any agent or combination of agents, to be administered in combination with a compound of the invention are intended to inhibit the replication of other viruses in co-infected individuals. These agents include, but are not limited to, therapeutic agents for diseases caused by hepatitis B (HBV) infections, such as adefovir, lamivudine, LdT (L-deoxythymidine) And tenofovir, or therapeutics for diseases caused by human immunodeficiency virus (HIV) infections, such as protease inhibitors: ritonavir, lopinavir, indigo Indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC- 114. FosamPrenavir; reverse transcriptase inhibitors · zidovudine, lamivudine, didanosine, stavudine ), Tenofovir, zalcitabine 89166 -191- 200427678, abacavir, efavirenz, nevirapine, dilabertin (Delavirdine), TM0125; integrase inhibitors: L-870812, S-1360, Entry inhibitors: Enfu Wei too (enfUvirtide) (T-2〇), T-1249. Other agents' to be administered in combination with the compounds of the present invention include any agent or combination of agents which is used to treat or alleviate the symptoms of HCV infection, including liver sclerosis and inflammation. When administered in combination, the therapeutic agents can be formulated as individual compositions, which are administered at the same time or over a predetermined period, or the therapeutic agents can be administered in a single unit dosage form. The total daily dosage of the compound administered to the host in a single or isolated dose may be in an amount of about 0.1 to about 200 mg / kg body weight, or preferably about 0.25 to about 100 mg / kg body weight. Single dose compositions may contain such amounts or submultiples thereof to make up the daily dose. Measurement of biological activity HCV polymerase inhibition test: Biochemical IC ^: IC50 (tight binding test) will be inhibited whether it is twice the serial dilution (graded inhibition test) or a narrower range of dilution across the inhibitor's IC50. 20 mM Tris-Cl pH 7.5, 5 mM MgCl2, 50 mM NaCl, 1 mM dithiothreitol, 1 mM ethylenediamine tetraacetic acid (EDTA), 300 // MGTP and 150 to 300 nMNS5B (HCV bacteria Species IB (J4, Gene Bank Registration Number AF054247, or H77, Gene Bank Registration Number AF011751)) were incubated at room temperature for 15 minutes. The reaction was initiated by adding 20 // M CTP, 20 // M ATP, 1 / zM 3H-UTP (10 mCi / micromolar), 150 nM template RNA, and 0.4 U / microliter RNase inhibitor (RNasin, Promega). And let it run at room temperature for 2 to 4 hours. The reaction volume was 50 microliters. The reaction was terminated by adding 89166 -192- 200427678 to 1 vol of 4 mM spermine, 1 mM EDTA in 10 mM Tris-Cl pH 8.0. After incubating at room temperature for at least 15 minutes, the precipitated RNA was captured in a 96-well format by filtration through a GF / B filter (Millipore). The filter plate was washed three times with 200 μl each of 2 mM spermine, 10 mM Tris-Cl pH 8.0, 1 mMEDTA, and twice with ethanol. After air-drying, 30 microliters of Microscint20 scintillation solution (Packard) was added to each well, and the retained cpm was measured by scintillation counting. By using two variable nonlinear regression equations, an uninhibited control group and a completely inhibited control sample were used to determine the minimum and maximum values of the curve, and the IC50 value was calculated. Tight binding detection is performed on compounds that show an IC50 value below 0.15 / M in a hierarchical inhibition test to more accurately measure the IC50 value. Plot the retained cpm against inhibitor concentration and use nonlinear regression (Reference 1) to fit Equation 1 to obtain IC50 values. Reserved cpm = A [sqrt {(IC50 + It-Et) 2 + 4IC50Et}-(IC50 + It-Et)] Equation 1 · where A = Vmax [S] / 2 (Km + [S]); It = total Inhibitor concentration, and Et = total active concentration of the enzyme. Reference 1: Morrison, J.F. and S.R. Stone. 1985. By slow- and tight-combined inhibitor-agent inhibition of enzyme research and analysis. Comments Mol. Cell · Biophys. 2: 347-368. The template RNA sequence used is:

5fGGGCGAAUUGGGCCCUCUAGAUGCAUGCUCGAGCGGCCGCCAGU

GUGAUGGAUAUCUGCAGAAUUCGCCCUUGGUGGCUCCAUCUUAGC

CCUAGUCACGGCUAGCUGUGAAAGGUCCGUGAGCCGCUUGACUGC AGAGAGUGCUGAUACUGGCCUCUGCAGAUCAAGUC-31 When tested by the above method, the compound of the present invention inhibits HCV polymerase 89166 -193- 200427678 IB and has an IC50 in the range of 0.002 / zM to 500 / zM. Evaluation of HCV inhibitors in HCV replicons: Cell culture EC ^ Cell lines and detection lines According to Ikeda M, Yi M, Li K, Lemon SM ·, J virol March 2002; 76 (6): 2997- 3006, and the method described in Blight, KJ, Kolykhalov A "Rice CM ·, Science December 2000, 290: 1972-1974), performed with the following modified method: RNA detection will use replicon cells at 3xl03 per well. The cells were covered in a 96-well plate and placed in DMEM medium containing 5% bovine fetal serum. On day 1, the medium was removed and a new medium containing a 2-fold dilution of the eight sequences of the compound was used. Replacement. The final concentration of DMSO in the culture medium was 0.5%. Untreated control cultures were treated in the same manner, but no inhibitor was added to the culture medium. The plates were cultured in a CO2 incubator at 37 ° C. On day 4, after removing the culture medium, 100 microliters of lysis buffer (RTL) (Qiagen) was added to each well. RNA was purified according to the manufacturer's recommendation (Qiagen RNAeasy) and dissolved in 200 microliters of water . Using real-time RT-PCR method, Purified RNA was used to quantify HCVRNA content. Primers and probes were derived from a specific sequence in the 5TJTR region. The RT-PCR reaction was performed at 48. (30 minutes at 3, followed by 40 cycles, set to 95 ° C , 15s; 54 ° C, 30 s; and 72 ° C, 40s. Calculate the percentage reduction of HCVRNA in the presence of the compound, and calculate the 50% inhibitory concentration (IC50) using the Prism program by nonlinear regression analysis. When When tested by the above method, the compound of the present invention inhibits replicon production and has an EC50 value in the range of 0.002 / zM to &gt; 100 / zM. 89166 -194- 200427678 Cytotoxicity Cytotoxicity detection is performed in replicon cells. In brief, hcv replicon cells were covered in well plates under 3x103 cells per well and placed in DMEM medium containing 5% FCS. On day 1, 谇 j was removed to contain compounds Eight new sequences of 2 × dilutions of the new medium replacement media s0 in the media were 0.5% in final concentration. All experiments were repeated. Untreated control cultures were treated in the same manner, but without inhibitors. Add to the culture medium. Incubator at 37t. On the 4th day, a four-file salt MTT stock solution (4 mg / ml, in pBs, directory #] \ 12128) was added to each well at 25 microliters. The plate was allowed to incubate for an additional 4 hours, and the cells were lysed by treatment with 20% SDS plus 002Nα at 50 μl per well. After overnight incubation, the optical density was measured by reading the plate at a wavelength of 57/65 nm. The percentage reduction of formazan blue relative to the control group was calculated, and the cytopathic effect was described as a 50% toxic concentration (TA). The nonlinear regression analysis was performed using the phsm program. When tested by the method described above, the compounds of the present invention will exhibit a reduction in CPE with a TC50 value in the range of 6.6 / ZM to-&gt; 100. Cell culture assays for agents targeting hepatitis C have not yet been used because they are not capable of producing infectious viruses in persistent cell lines. The hepatitis C virus genome encodes a large polyprotein that, after processing, produces the necessary functional components to synthesize the offspring RN A. Alternative cell lines that produce high and long-lasting subgenomic HCV RNA (replicons) have been derived from human hepatoma cells (Huh7) as described in the references above. The mechanism of RNA complex I in these cell lines is thought to be the same as the full-length 89166-195-200427678 HCVRNA replication in infected liver cells. The compounds and methods of the present invention are inhibitors of HCVRNA replication in the above-mentioned replicon detection system. It is sufficient to form the basis of a patent application concerning its potential as a therapeutic agent in the treatment of diseases caused by hepatitis C virus infection. Synthetic methods have been used in the illustrations and examples below for abbreviations: dmf is N, N-dimethylformamide, DMSO is dimethylsulfinium, and butyl HF is tetrahydrofuran. The compounds and methods of the present invention will be made clearer with the following synthetic schemes, which illustrate the methods by which the compounds of the present invention can be prepared. The starting materials can be obtained from commercial sources or prepared by well-established literature methods known to those skilled in the art. Unless otherwise specified below, the groups A, R1, R2, R3, R4, R5 and η are as defined above. This issue of the month is a compound of formula (I) when made by a synthetic method or by a metabolic process. The compounds of the present invention are prepared by metabolic processes, including processes that occur in the human or animal body (in vivo), or processes that occur outside the body. Schema 1

As shown in formula i, a compound of formula (2) and a compound of formula (3) 'can be reacted in the presence of phosphorus phosphonium chloride under heating conditions to provide a compound of formula VII. 89166 -196- 200427678 may use a compound of formula VII with a base, such as sodium hydride, potassium hydride, lithium hexamethyldisilazide, etc., in a solvent such as, but not limited to, dimethylacetamide, dimethylformamide, THF, etc., followed by the addition of R1-X (where R1 is dilute, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylthioalkyl, alkylidene) Alkyl, alkyl, alkyl, alkyl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, Cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, haloalkoxyalkyl, alkyl, heteroarylalkenyl, heteroaralkyl, heteroarylsulfonyl Alkyl, heterocyclic alkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN alkyl-, RaRbNC (0) alkyl-, RaRbNC (0) 0 alkyl-, or RaRbNC (0) NRc alkane -, And wherein X is Br, Cl, I, CF3S (0) 2-, CH3S (0) 2-, or tosylsulfonyl) to provide a compound of formula (5). Scheme 2

Alternatively, the compound of formula IX can be a compound of formula IX (wherein R1 is an alkenyl group, an alkoxyalkyl group, an alkoxycarbonyl alkyl group, an alkyl group, an alkyl group, an alkylthio group, or an alkylidene group) Alkyl, sulfanylsulfanyl, alkyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, Cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, methylaminoalkyl, haloalkoxyalkyl, alkyl, heteroaryl, heteroarylene Radical, heteroarylalkyl, heteroarylalkyl, 89166 -197- 200427678 heterocyclic, heteroaryl, heterofluorenyl, fluorenyl, nitryl hn_, RaRbN alkyl-, RaRbNC (〇) alkane Radicals, from lancaalkyl_,

RaRbNC (〇) NRCalkyl-, ... ㈣ or）) is treated under the condition of heating under the conditions of alkali such as potassium carbonate and catalyst such as copper bromide to provide the compound of formula (I). The compound of formula (8) can be treated with a reagent, including but not limited to phosgene, diphosgene, triphosgene, in a solvent such as, but not limited to, 2-dichloroethane, carbon tetrachloride, dioxin Thorium or a mixture thereof is performed under heating to provide a compound of formula (5). ΕΛ1

Β3 ^ Λοη-w * In addition, the compound of formula ⑼ can also be reacted with a reagent, including but not limited to phosgene, diphosgene, triphosgene, carbonyl diimide 4, ethyl formic acid, etc., in the presence of the test, such as Hydroxide, hydrogen, and hydroxide materials are carried out in a solvent such as but not water, toluene, benzene, etc. under heating conditions to provide a compound of formula (5).

The compound of formula (5) can be treated with the compound of formula (10) in the presence of the test, such as 89166 -198- 200427678 sodium hydride, potassium hydride, lithium hexamethyldisilazide, etc., in a solvent such as but not limited to THF , Diethyl ether, methyl tertiary-butyl ether, and then treated with an acid such as acetic acid, dichloroacetic acid, or sulfuric acid to provide a compound of formula (11), which is a representative example of a compound of formula (I), wherein R4 is a hydroxyl group. Scheme 5

(5)

OH

SO2NH2

(RS) n

Eight compounds and ^ π worker, Α 赋 f nh2 (13)

Ethyl ester, in a solvent, such as dimethylacetamide, malonic acid ,,, π—… 丨 / yanye-T-acetamide, turpentine, THF, etc., react under heating conditions To provide formula ii): °, the compound of formula (12) can be treated with the compound of formula (13) in a solvent, such as benzene, xylene, benzene, etc., under heating. Kexian Douren, 1, ^ _ Private (14) compounds are treated with bases, such as sodium hydroxide, hydroxide, lithium oxide, etc., and are processed under heating conditions, according to ― Compounds. Rogue Confession 3 89166 -199- 200427678

OH

(12)

〇j ^ \ ^ C〇2CH2CH3 C〇2CH2CH3 (15), ^ 'The compound of formula 以 with ethyl chloromalonate, in the presence of money', such as triethylamine, diisopropylethylamine, pyridine, etc., The hydrazone solvent is treated in, for example, dichloromethane, chloroform, and carbon tetrachloride to provide a compound of formula (15). Alternatively, the compound of formula (2) may be treated with ethyl chloromalonate in a solvent such as xylylene under heating to provide a compound of formula (15). The compound of formula (15) can be treated with sodium ethoxide in ethanol to provide a compound of formula VII.

Schema J

(I) Formula 7 is an illustration of the preparation of a compound of formula ①, wherein 圮 is a drawing group. The formula (11) can be used as a test treatment for the conversion of alcohols into chlorides. For example, the compound of formula (11) can be treated with reagents, including but not limited to PCI5, PCI3, POC13, or thionyl chloride, with or without solvents. 5Ren is not limited to dichloromethane, chloroform, and benzene. A compound of formula (1) is provided, which is a representative example of the compound, wherein R4 is chlorine. Similar conversions can use PBr3 or DAST, which individually convert the alcohol to its corresponding compound of formula VII, 89166-200-200427678, where R4 is bromide and fluoride. Alternatively, a compound of formula (I), where M is an iodine group, can be obtained by mixing a compound of formula (11) with a methanesulfonyl reagent, such as methanesulfonyl chloride or methanesulfonyl anhydride, in the presence of an amine base, such as Triethylamine, pyridoxine or diisopropylethylamine is reacted in a solvent such as, but not limited to, dichloromethane, acetonitrile, carbon tetrachloride, and chloroform. Made from base permethimine. Scheme 8

As shown in Formula 8, a compound of formula (16) can be converted into a compound of formula (17), which is a representative example of a compound of formula (I), where R4ARaRbN_ is obtained by having formula RaRbNH (the center of which is equal to ~ An amine as defined herein is treated in a polar solvent such as methanol, ethanol, etc. under heating conditions to provide a compound of formula (17). Scheme 9

The compound of formula (18) (which is a representative food of the compound of formula (engineering) | J, where R1 is 89166-201-200427678 G, propyl) 3 or some other ether protecting group which can be easily removed) can be contained The fluoride reagent is treated to provide a compound of formula (19). Compounds of formula (19) can be treated by searching for amines, such as hydrogenated noodles, in solvents, such as dimethyl turpentine Hid, methyl-hard nitride surfaces, and in solvents such as, but not limited to, Oxaloxamine, etc., followed by the addition of Rk_x (where ~ is an oxyalkyl group, an oxyalkyl group, an oxocarbonyl group, an oxo group, an oxo group, an oxenyl group, an oxenyl group, an aromatic Base, arylalkyl, arylthioalkyl, arylalkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, methylamino, fluorenyl Alkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocycloalkyl, alkynyl, nitroalkyl, alkynyl, or RcWo) alkyl, where χ is Br, α, I, CF3s (〇) 2, ch or y-tol) to provide compounds of formula (I), which are representative examples of compounds of formula (ι), where R1 is defined as Rk0_. Scheme 10

The compound of formula (21) can be treated with water, such as, but not limited to, oxidizing chlorine, sodium hydroxide, etc. to provide the compound of formula (22). The compound of formula (22) can be treated with a metal hydride base, such as sodium hydride, an organolithium reagent (for example, ηϋ or s-BuLi) or hexamethyldiasparite in a suitable solvent or solvent; In the formula, it is selected from THF, DMS0, DMF, dioxolane, ether, dichloromethane 89166 -202- 200427678, and then RaX is added, among which Br, α, CF3s (0) 2-, CH3S (0 ) 2- or toluene fluorenyl to provide a compound of formula (23), which is a representative example of a compound of formula (I), wherein R1 is -NHRa.

η R5) or 'The compound of formula (22) can be treated with aldehydes or ketones of the structure RfRgC (O), without using a solvent or using a solvent, such as but not limited to dimethylacetamide, tetrahydrofuran, dioxolane Etc. under heating conditions to provide a compound of formula (24). The compound of the formula (24) is reduced by hydrogen and a catalyst such as dioxane or a metal hydride such as zeolite, sodium cyanoborohydride, etc. to provide a compound of the formula (25). Ο η

(26) (27) (R5) n

, So2nh2 nh9 (13 &gt;

89166 -203-200427678 The compound of formula (12) can be reacted with a test solution, such as oxidized chlorine and the like, under heating conditions to provide a compound of formula (26). The compound of formula (26) can be reacted in a solvent or solvent mixture, such as but not limited to ye-methylformamide, tetrahydrofuran, diethyl ether or methyl tertiary-butyl ether, and then at about room temperature. Treated with carbon disulfide to a temperature of about 1500. Prudent examples of this test include but are not limited to hydroxan, hydrogen peroxide, diisopropylamine, sodium hexamethyldisilazide and lithium hexamethyldisilazide. Subsequent treatment with a methylating agent at a temperature of about 25t provides a compound of formula (27). Examples of methylating agents include, but are not limited to, methyl iodide, methyl trifluoromethanesulfonate, dimethyl sulfate, and the like. Alternatively, the compound of formula (26) and ginsyl (methylthio) methyl sulfate can be used. Ester, in a solvent in the presence of a base, such as 1, 4, dioxolane or dimethylacetamide, etc., is about 25. (: To a temperature of about 15 ° C. to obtain a compound of formula VII. Examples of this test include, but are not limited to, organic amine bases, such as imidazole, μmethylimidazole, methylimidazole, 2-isopropylimidazole, 4 _Methylimidazole, nitronitroimidazole, pyridine, N, N-dimethylaminopyridine, 1,2,4-triazole, pyrrole, 3-methylpyrrole, triethylamine, monoisopropylethylamine or Ν-methylmorpholin, etc. The compound of formula (27) can be a compound such as (13) in a solvent or a solvent mixture such as, but not limited to, toluene, benzene, dioxolane, or tetrahydrofuran, etc. 々50 C is treated at a temperature of about 150 C to provide a compound of formula (u). Scheme 13 89166 -204- 200427678

X o2n

(R5) n (29)

PhCH2S

02N (R5) n (30)

Jb)-(R5) n o2n (31) h2n-ns o2n y ^ E)-(R5) n h2n ~ sC ^ h2n DE ^ (R5) n (32) (Π) where the compound of formula ^ is again ^^ or ^ With alkylthiofunctions, such as benzyl mercaptan, in the presence of a test, such as sodium carbonate, in a solvent, such as ethanol and the like, under heating conditions to obtain a compound of formula (30 (30) Treatment with chlorine gas in hydrochloric acid or acetic acid to provide a compound of formula ⑼. The compound of formula ⑼ is in a solvent, such as but not limited to dichloromethane, tetrachloromethane; ^ South or dioxolane can be ammonia or hydroxide Ammonium treatment to obtain formula (I). The compound of formula (32) consists of iron powder and chlorosulfonium, in an aqueous alcoholic solvent, such as methanol or ethanol, under heating conditions, H ^ $ Sight 4 ^ iron powder in vinegar 'Reduction under heating provides the compound of formula (I).

M ^ 14

89166 -205- 200427678 The compound of formula (33) can be treated with ammonium nitrate in the presence of sulfuric acid as a solvent under cold heading to obtain a compound of formula (34). The compound of formula (34) is reduced to ammonium ammonium with iron and reduced in a water-containing alcoholic solvent such as methanol or ethanol under heating conditions to provide a compound of formula (35). Alternatively, the reduction can also be achieved by treating the compound of formula (35) with iron powder in an acid such as, but not limited to, acetic acid or dilute hydrochloric acid under heating conditions. Compounds of formula (35) are treated with orthoesters of formula (36) under heating to provide compounds of formula (37). Scheme 15

R1 (35) r1 (38) NHR8

The compound of formula (35) can be treated with cyanogen bromide under heating to obtain the compound of formula (38). The compound of formula (38) is represented by R8X, wherein X is Br, C1 or R8c02C1 or R8S02Cl in the presence of an amine base such as triethylamine, pyridine or an inorganic base such as cesium carbonate or potassium carbonate. Treatment from a suitable solvent or solvent mixture such as difamylacetamide, N, N-dimethylformamide, methanol, dichloromethane, tetrahydrofuran, or acetonitrile to provide a compound of formula (39). Gang style 16 89166 -206- 200427678

The compound of formula (40) can be nitrated under cooling conditions with ammonium nitrate or potassium nitrate in the presence of an acid, such as citric acid or difluoroacetic acid in trifluoroacetic anhydride, with or without other solvents. (41) A compound. Compound K of formula (41) Iron meal and ammonium chloride can also use iron powder in aqueous alcoholic solvents such as methanol or ethanol. In acid, such as, but not limited to, cool fun ^ dilute hydrochloric acid, Achieved under heating. The compound of formula ㈣ can be converted into formula (4

It is combined with nitration and reduction of the product in step +, and it is used individually as described above. The compound of formula (44) can be a compound of formula (45) with formula (36) ^ orthobismuth phthalate under heating conditions.

89166 (48) -207- 200427678 can make the compound of formula (42) continue with donkey chlorine in the presence of the test, such as alone, Bidden, or amine test such as triethylamine 'diisopropylethylamine, etc., ^ The acidification of a term in a solvent or a combination of solvents, such as digas, tetrahydrofuran or dioxolane, to provide a compound of formula (46). Alternatively, the compound of formula (42) can be made in the presence of an amine, such as, but not limited to, triethylamine or diisopropylethylamine, etc., in a solvent or a combination of solvents, such as dichloroformamidine tetrahydrofuran or dioxygen Lu Yan et al. Continued the hydration with an amine of the compound of formula W to obtain a compound of formula (47). The compound of formula (I) can be obtained by treating isochloric acid, chloric acid and 2-chloroethanol under the conditions known in the art. The compound of formula VII can be further treated with an amine having the formula RANH (where MRb is as defined herein) in a solvent or a combination of solvents, such as dichloromethane, naphthalene, or acetonitrile, to provide the formula (48 ) 化合 #. The compound of formula VII can be used in the presence of an amine, such as triethylamine or diisopropylethylamine, etc., in a solvent or solvent combination, such as dichloromethane, tetrahydrofuran, or dioxolane, etc., with the compound of formula (54) Amine / fluorenation to obtain a compound of formula (48). &lt; (54) The compound can be obtained by treating the amine recognized by the formula thiosulfurium disulfonium or by treating the amine cis with the formula cis via hydrazine, and (b) combining the product of step VII with Chlorinating agents, such as pentachlorinated scales, are contacted under conditions known in the art. Similarly, the compound of formula ， can be converted into a compound of formula (11) with # 5 in the formula # 11, wherein the formula 5 is _ in the formula (48). Compound conditions were performed. The compound of formula ⑼ where R5 is i group nh2 ′ can be converted into a compound of formula (11), where ^ is -alkynyl NHSOA ′ can be achieved by using the conditions for conversion of formula 匕 compound to formula ⑽ compound. 89166 -208- 200427678 Figure 18

The compound of formula (42) can be treated with amine sulfonium chloride of formula ROOC (0) NHS02C1 (50) in the presence of amines, such as pyridine, triethylamine, or diisopropylethylamine, etc. Amine sulfonation in a solvent or solvent combination of chloromethane, tetrahydrofuran, ether, benzene or acetonitrile to provide a compound of formula. Compounds of formula (0)) can be prepared by treating alcohols of formula &amp; OH with chlorosulfoisocyanate in solvents such as dichloromethane, tetrachloride, ethyl, benzene or toluene. to make. The compound of formula (51) can further be an alcohol having the formula RaOH, mono-n-butylphosphine or triphenylphosphine, etc., and diisopropyl azodicarboxylate, 1,1,-(nitrodicarbonyl) ) In the presence of hexahydropyridine or diethyl azodicarboxylate, etc., in a solution such as: methyl chloride or tetrahydrofuran, or a solvent combination to provide a compound of formula (magic) or a compound of formula (52), The center is a methyl group, which can be obtained by using a methylating agent such as, but not limited to, methylated methyl sulfate, dimethyl sulfate, and tri-t-silyl diazomethane, as is known in the art. Obtained under conditions 89166 -209- 200427678 methylation. Conversion of a compound of formula (52) to a compound of formula (53) can be achieved by reaction with an acid such as trifluoroacetic acid or hydrochloric acid, or by hydrogenolysis conditions such as exemption / carbon under hydrogen. Similarly, a compound of formula (11), in which R5 is -alkylNH2, can be converted into a compound of formula (11), in which R5 is · alkylNHS02NHC00Rc, by converting a compound of formula (42) into a compound of formula (51) Condition. The compound of formula (11), in which R5 is -alkylNH2, can be converted into the compound of formula (11), in which R5 is -alkylNHS02N (Ra) C00Rc, by (51) to (52). Used condition. The compound of formula (11), in which R5 is -carbyl NH2, can be converted into a compound of formula (11), in which R5 is -alkyl NHS02NRaRb, by the conditions adopted for (52) to (53). The invention will now be described with certain preferred embodiments, which are not intended to limit its scope. On the contrary, the invention is intended to cover all alternatives, modifications and equivalents which may be included within the scope of patenting. Therefore, the following examples, which include preferred specific embodiments, will illustrate the preferred implementation of the present invention. It should be understood that the examples are for the purpose of illustrating some preferred specific embodiments, and have been proposed to provide recognition systems. The most useful and easy-to-understand description of its procedures and concepts. The compounds of the present invention are named by ACD / ChemSketch version 5.0 (developed by Advanced Chemical Development Corporation, Toronto, ON, Canada), or given names consistent with the ACD nomenclature. [Embodiment] Example 1 89166 -210- 200427678 JJ group-3: _ (1Γ1-dioxide-4H-1di 4-benzo-di-pigment-3-some) -4-benmou-1,8- 喑Pyridin-2 (1HV ketone

Example 1A and "2,3- (11" 1,3 &gt; Wugen-2,4 (1 出-二 _

The title compound was prepared according to the procedure described in No. 4, 1982, 972-973 from 2,3-Saidogan (11.4 g, 76 mmol) and trimethylsilyl azide (11.0 ml, 80 mmol) as a white solid (7.27 g, 58%). 1HNMR (300 MHz, DMSO-d6) 5 7.31 (dd, J = 7.72, 4.78 Hz, 1H), 8.31 (dd, J = 7.72, 1.84 Hz, 1H), 8.66 (dd, J = 4.78, 1.84 Hz, 1H), 12.27 (s, 1H).

Example IB Butyl-2H-pyridof2,3-dl, l, 31 Phen-2,4 (1HV diketone sodium hydride (95%, 0.96 g, 40 mmol) in dimethylacetamide (60 ml) of the suspension was reacted with the product of Example Ια (5.7 g, 34.7 mmol) at 10 ° C under nitrogen, and stirred for 1 hour, and then brominated with n-butane (5.2 g ' 38 millimoles), and stirred for another 16 hours. The reaction was partitioned between ethyl acetate and water. The organic layer was washed with water and brine, dried over sodium sulfate, filtered, and vacuumed. The crude product was purified by flash column chromatography with silica gel, and dissolved with hexane and ethyl acetate (3: 1) to give the title compound as a white solid (2.5 g, 33% yield) IHNMR (300 MHz, DMSO-d6) (5 0.92 (t, J = 7.35 Hz, 3H), 1.36 (m, 2H), 1.65 (m, 2H), 4.13 (m, 2H), 7.38 (dd, J = 7.72, 4.78 Hz, 1H), 8.39 (dd, J = 7.72, 1.84 Hz, 1H), 8.77 (dd, J = 5.15, 1.84 Hz, 1H).

Example 1C (LI-Dioxide-4H-1,2,4-benzilopyrimidine-3-yl) ethyl acetate 89166 -211-200427678 The title compound is based on # 环 灭 允 合 # 必 荸, 1998,% (7), the procedure described in 791-795, produced in two steps (46% yield) from 2-aminobenzenesulfonamide as a white solid. 1HNMR (300MHz, DMSO-d6) 5 1.21 (t, J = 7.17 Hz, 3H), 4.16 (q, J = 7.23 Hz, 2H), 7.32 (d, J = 7.35 Hz, 1H), 7.47 (m , 1H), 7.69 (m, 1H), 7_82 (dd, J = 7.91, 1.29 Hz, 1H), 12.27 (s, 1H).

Example ID 1-Butyl_3- (l, l-dioxide-4H-1,2,4-benzilopyridine-3_yl V4-chaki-i A solution of the product (0.222 g, 1.0 mmol) and the product of Example ic (0268 g, 1.0 mmol) in anhydrous THF (10 ml) under nitrogen and 0 ° C ' Sodium hydride (95%, 0.10 g, 4.0 mmol) was added. The reaction was heated to reflux for 3 hours, cooled to 0 ° C, and ice-cold acid (2 ml) was added dropwise thereto. The resulting mixture was heated to reflux for 2 hours, cooled to ambient temperature, and diluted with an aqueous hydrochloric acid solution (0.1M, 10 ml). The formed sanctuary was collected by filtration, and washed with water and ether; Strip, and dried to give the title compound (0.130 g, 33%). MS (ESI-) m / z 397 (Μ_Η) 'made the title compound (0.130 g, 0.326 mmol) in acetonitrile and water (1: 1 , 4 ml) of the certified suspension suspension 'and sodium hydroxide aqueous solution (1, 0.326 ml' 0.326 halo), when a transparent solution was found, it took about minutes. The solution was dried to obtain the sodium salt. . 1HNMR (300 MHz, DMSO-d6) 5 0.92 (t, J = 7.35 Hz, 3H), 1.35 (m, 2H), 1.58 (m, 2H), 4.28 (t, J = 7.35 Hz, 2H), 7 · 13 (dd, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 2H), 7.55 (m, 1H), 7.66 (dd, J = 7.72, 1.47 Hz, 1H), 8.37 (dd, J = 7.72, 1_84 Hz, 1H), 8.53 (dd, J = 4.60, 2.02 Hz, 1H), 15.92 (s, 1H). 89166 -212- 200427678 Example 2 Base gasification · 4H4,2,4_ 茉 # 4 Ergu

) -4_hydroxy-1,8-pyridine-2 (1HVS as in Example 2A WPU methyl 1-2H-pyrido f2.3-dlfl, 31 噚 --2.4Γ1Ην dione The title compound is according to Example 1B The procedure was prepared by substituting 2-chloro-5-chloromethylthiophene for n-butane bromide (0-195 g, 52%). IHNMR (300 MHz, DMSO-d6) 5 5 · 38 (s, 2H) , 6.98 (d, J = 4.04 Hz, 1H), 7.08 (d, J = 3.68 Hz, 1H), 7.43 (dd, J two 7.72, 4.78 Hz, 1H), 8.41 (dd, J = 7.72 , 1.84 Hz, 1H), 8.83 (dd, J = 4.78, 1.84 Ηζ, 1Ή〇.

Example 2B M (5-chlorosedenyl) methyl 1-3_ (U-digasified-4H-1,2,4-benzyl-4-diphenyl-3-yl V4-hydroxy-1,8- The pyrimidine title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 2A (0.067 g, 58%). MS (ESI-) m / z 471/473 (MH) '. Title The sodium salt of the compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) 5 5.53 (s, 2H), 6.89 (d, J = 3.68 Hz, 1Η), 7.00 (d, J = 3.68 Hz, 1H), 7.20 (dd, J = 7.72, 4.78 Hz, 1H), 7.29 (m, 2H), 7.56 (t, J = 7.72 Hz, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.40 (dd, J = 7.72, 1.84 Hz, 1H), 8.58 (dd, J = 4.78, 1.84 Hz, 1H), 15.73 (s, 1H) · Example 3 3- (1,1-digasification-4H-1,2,4-benzyl and 4 secondary farms each Vl- (2-ethylbutyl) -4-hydroxy-L84 pyridin-2aHV ketone 89166 -213 -200427678

Example 3A 2-"(2-ethylbutyl) amino 1 nicotinic _ delta ester based on 2-chloroacetic acid ethyl ester (0.664 g, 3.48 mmol) with 2-ethylbutylamine (0.74 Grams, 7.31 millimoles) in a sealed tube, reacted at i3 (TC for 2 hours. The reaction mixture was separated between dichloromethane and water. Extract with dichloromethane (2 X 50 ml) Water layer. The organic layers were combined and dried over magnesium sulfate, filtered, and concentrated. The residue was purified by column chromatography on silica gel and dissolved in hexane / ethyl acetate (19: 1) to provide the title compound. (.665 g, 76%). MS (ESI +) m / z 251.1 (M + H) +; iHNMRGOOMHz'CDCU) 5 0.93 (t5 J = 7.54 Hz, 6H), L41 (m, 7H) , 1.55 (m, 1H), 3.46 (m, 2H), 4.32 (q, J = 6.99

Hz5 2H), 6.48 (dd? J = 7.72, 4.78 Hz? 1H)? 7.99 (s5 1H)? 8.11 (dd? J = 7.72, 2.21 Hz, 1H), 8.27 (dd, J = 4.78, 1.84 Hz, 1H ).

Example 3B H2-Ethylbutanyl V2H · pyrido f2,3-dl "Ul Hengeng-2,4 (1HV dione made the product of Example 3A (0.664 g, 2.65 mmol) and diphosgene (1.57 g , 7.96 mmol) in 13 ml of 1,2-dichloroethane and 1.3 ml of 1,4 dioxopropane, and reacted at 80 ° C for 16 hours. The reaction was concentrated under vacuum and the residue was left. The material was purified on silica gel by flash column chromatography and eluted with hexane / ethyl acetate (9: 1) to provide the title compound (0.235 g, 36%). 1H NMR (300 MHz, CDC13) (50 0 · 95 (m, 6Η), 1.40 (m, 4Η), 1.52 (m, 2Η), 4.21 (m, 1Η), 7.25 (m, m), 8.41 (dd, J = 7.72, 1.84 Hz, 1H ), 8.70 (dd, J = 4.78, 1.84 Hz, 1H) ·

Example f 3C 3- (1,1-Digasification-4H-1,2,4-benzyl-2-diethyl-3-butylbutyl) -4-¾yl- 1,8_kouinai- 2 (111) -Identical 89166-214- 200427678 The title compound was prepared according to the procedure of Example ID, substituting the product of Example 3B with the product of Example 1B (0.041 g, 38%). MS (ESI +) m / z 427.1 (M + H) +, (ESI-) m / z 425.1 (MH) '; 1H NMR (300 MHz, DMSO-d6) 5 0.87 (t? J = 7.54 Hz, 6H), 1.30 (m, 4H), 1.99 (m, 1H), 4.44 (d, J = 7.35 Hz, 2H), 7.49 (dd, J = 7.72, 4.78 Hz, 1H), 7.55 (t, J = 7.35 Hz, 1H), 7.68 (d, J = 8.09 Hz, 1H), 7.77 (t, J = 7.17 Hz, 1H), 7.92 (d, J = 8.09 Hz, 1H), 8.57 (dd, J = 7.72, 1.84 Hz, 1H), 8.86 (d, J = 4.78 Hz, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI +) m / z 427 · 1 (M + H) '(ESI ·) m / z 425.1 (M-Η) ·; 1H NMR (300MHz, DMSO-d6) 3 〇.86 (t, J = 7.35 Hz, 6H), 1.28 (m, 4H), 1.91 (m5 1H), 4.25 (d, J = 7.35 Hz, 2H), 7.12 (dd, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 2H), 7.55 (m, 1H), 7.67 (dd, J = 8.09, 1.47 Hz, 1H), 8.37 (dd, J = 7.72, 1.84 Hz, 1H), 8.50 (dd, J = 4.60, 2.02 Hz, 1H ), 15.97 (s, 1H). Example 4 H (5-lacylpyridinyl) methyl 1 each (U-digas-4H-1,2,4-benzylpyridine-3-

V4-hydroxy-1,8-pyridine-2 (1HV ketone example 4A 1-"(5-bromo-2-1phenyl) methyl 1-2H-eridino" 2,3-dl "l , 31 唠 2-4 (1HV dione titled compound was prepared by substituting 2-bromo-5-chloromethylpyrimine with n-butane bromide according to the procedure of Example 1B (0.229 g, 55 %). IHNMR (300MHz, DMSO-d6) ά 5.40 (s5 2H), 7.06 (m, 2H), 7.43 (dd, J = 7.72, 4.78 Hz, 1H), 8.41 (dd, J = 7.72 , 1.84 Hz, 1H), 8.83 (dd, J = 4.78, 1.84 Hz, 1H).

Example 4B 1-1Ϊ5-bromo-2-dphenone) methyl 1-3- (1,1-dioxide-4H-1,2,4 • benzyl 4 dimer; certain V4-hydroxy-1, 8-Pyridine-2 (1HV ketone 89166 -215- 200427678) The title compound was prepared according to the procedure of Example ID, replacing the product of Example 1A with the product of Example 4A (0.208 g, 60%). MS (ESI-) / z 515/517

The (M-H) \ sodium salt of the title compound was prepared according to the procedure of Example id. iHNMR (300 MHz, DMSO-d6) 3 5.55 (s, 2H), 6.97 (d, J = 3.68 Hz, 1H), 7.00 (d, J = 3.68 Hz, 1H), 7.20 (dd, J = 7.73, 4.78 Hz, 1H), 7.29 (m, 2H), 7.56 (m, 1H), 7.68 (d, J = 7.72 Hz, 1H), 8.40 (dd, J = 7.72, 2.21 Hz, 1H) , 8.58 (dd, J = 4.78, 2.20

Hz, 1H), 15.73 (s, 1H). Example 5-Emulsification -411-1,2,4-benzobihexyl-3-yl) _4-Chrysyl-1- (3-formaldehyde: ^: yl ) _1,8-piperidine-2 (1HV ketone

Example 5A 1- (3-methylbenzyl) -2'-pyrido "2.3_dl" l, 31 Phen-2,4 (1HV dione title compound was substituted with 3-methylbenzyl bromide according to the procedure of Example 1B Made from bromo-n-butane (0.305 g, 62%). MS (DCI) m / z 269 (M + H) + ·

Example 5B _3- (l, l-dioxide-4H-1,2,4-benzopyrimidine; yl) -4-hydroxymethylfluorenyl VU- • piperidine-2 (1HV ketone title compound is based on the example The procedure of 1D was made by replacing the product of Example 1A with the product of Example 5A (2 · 2 g, 72%). MS (ESI-) m / z445 (MH)-· The sodium salt of the title compound was obtained according to Example ID. Program made. IHNMR (300 MHz, DMSO-d6) 5 2.23 (s, 3H), 5.48 (s, 2H), 7.01 (m, 3H), 7.14 (t, J = 7.35 Hz, 2H) , 7.28 (m, 2H), 7.56 (td, J = 7.72, 1.47 Hz, 1H), 7.67 (dd, J = 7.72, 1.47 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz , 1H), 8.48 (dd, J = 4.78, L84 Hz, 1H), 15.86 (s, 1H). 89166 -216- 200427678 Example 6

Benzopyrimidine, 3_some V4_hydroxy-1- (3-nitrazine, V 1.8- xanthridin-2_-one Example 6A pyridof2,3-dlfl, 31 Phenyl-2,4 ( The 1HV di-Sill title compound was prepared by substituting 3-nitrobenzyl bromide for n-β-butyrate in accordance with the procedure of Example 1B (0.147 g, 28%). MS (DCI) m / z 300 (M + H ) + ·

Example 6B Mole 4 Ergen-3-yl V4-pyridyl_M3 · nitrofluorenyl)-1.8- Xanthonyl-2 fluorenone The title compound was replaced by the product of Example 6A according to the procedure of Example 1D. Made from the product (0 032 g, 42%). MS (ESI ·) m / z 476 (M-H) 'sodium salt of the title compound was prepared according to the procedure of Example 1D. 1hnmr (300 MHz, DMSO-d6) 5 5.62 (s, 2H), 7.19 (dd, J = 7.72, 4.78 Hz, 1H), 7.29 (td5 J = 8.36, 1.29 Hz, 2H), 7.56 (t, J = 8.46 Hz, 1H), 7.58 (t, J = 7.72 Hz, 1H), 7.67 (d, J = 8.09 Hz, 1H), 7.74 (d, J = 8.09 Hz, 1H), 8.08 (m, 2H), 8.43 (dd, J = 7.54, 2_02 Hz, 1H), 8.5Ό (dd5 J = 4.60, 2.02 Hz, 1H), 15.76 (s, 1H) · Example 7 HU— :. Dioxide-4H -1,2,4-pyridine and 4-diphenyl groups (V4-hydroxyphenenylmethyl) -1,8-kounai ^^-2 (111) -same

Example 7A Methyl V2H-pyrido "2,3-dlfl, 31 Phenyl-2,4 (1HV dione titled compound was replaced with 3- (bromomethyl) fluorene in accordance with the procedure of Example 1B -Butane (0.170 g, 52%). HNMR (300 MHz, 89166 -217- 200427678 DMSO-d6) ά 5.32 (s, 2H), 7.15 (m, 1H), 7.40 (dd , J = 7.72, 4.78 Hz, 1Η), 7.48 (m, 2H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.76 (dd, J = 4.78, 1.84 Hz, 1H ) ·

Example 7B 3- (l, l-monoemulsified-4,1,2,4-benzo? Sedendol-3-yl) -4-¾yl-1- (3-0sedenylmethyl)- 1,8-4 pyridin-2 (1HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 7A (0.135 g, 48%). MS (ESI_) m / z 437. The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) 6 5 · 48 (s, 2H), 7.09 (d, J = 4.04 Hz, 1H), 7 · 16 (dd, J = 7.72, 4.78 Ηζ, 1Η), 7.27 (m, 3Η), 7.38 (dd, J = 4.96, 3 · 13 Ηζ, 1Η), 7.56 ( t, J = 7.72 Ηζ, 1Η), 7.67 (d, J = 8.09 Ηζ, 1Η), 8.39 (dd, J = 7.72, 1.66 Ηζ, 1Η), 8.53 (dd, J = 4.78, 1.66 Ηζ, 1Η), 15.85 (s, 1Η). Example 8 H3A fluorenyl digasification-4H-1,2,4-benzilopyrimidin-3-yl V4-hydroxy_1,8 -Moxa-2 (1 fluorene) -one Example 8A】-(3-chlorohydrazine V2H-pyrido | ~ 2,3-dl "Ul purin-2,4 (1HV dione title compound is based on the example Procedure 1B, made by replacing 3-n-chlorobenzyl bromide with n-butane bromide (0.405 g, 77%). MS (DCI) m / z 289 (M + H) + ·

Example 8B fluorenyl V3-rU_dioxide-4Η1,2,4, bendothiadigenol-3-some) -4-hydroxy-1,8-pyrimidine-2 (1HV ketone title compound was according to the procedure of Example 1D It was prepared by replacing the product of Example 1A with the product of Example 8A (0_050 g, 45%). MS (ESI-) m / z 465 (M-Η) · · 89166 -218-200427678 The sodium salt of the title compound is based on The program of the example ID is made. IHNMR (300 MHz, DMSO-d6) 5 5.50 (s5 2H), 7.18 (dd, J = 7.72, 4_78 Hz, 1H), 7.27 (m, 6H), 7.56 (td, J = 7.91, 1.47 Hz, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.78, 2_21 Hz , 1H), 15.78 (s, 1H) · Example 9 H3-bromofluorenyl digasification_4Η-1 · 2,4-benzyl 4 radicals V4-hydroxy · 1,8, oxaziridone Example 9A 1- (3-Bromoyl) -211- ^ Biyodo "2,3-(^" 1,31Jet-2,4 (111) -dione "The title compound was according to the procedure of Example 1B Made from 3-bromophosphonium bromide instead of n-butane bromide (0.500 g, 82%). MS (DCI) m / z 333 (Μ + Η) +. Example 9B 1- (3-bromo Gykiyl) -3- (1,1-digasified-4Η-1,2,4-benzyl and diphenylene-3-yl _4_ by-yl - 1,8-unitary with the port nalidixic -2__

The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 9A for the product of Example 1B (0.050 g, 45%). MS (ESI-) m / z 465 (Μ-Η)-The sodium salt of the title compound was prepared according to the procedure of Example ID. ifiNMR (300 MHz, DMSO-d6) (5 5.50 (s, 2H), 7.18 (dd5 J = 7.72, 4.78 Hz, 1H), 7.27 (m, 6H), 7.56 (td, J = 7.91, 1.47 Hz , 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd5 J = 4.78, 2,21 Hz, 1H), 15.78 (s, 1H ) Example 10 HO Chloro-1, H Block-5-yl) Methyl 1-3- (1,1-Dihalide-4 ^ 2,4-Benzopyrimidine

Shiji M-Light-1,8-4Bite_2HHVi Same as Example 10A 89166 -219- 200427678 H (2-chloro-1,3-pyrazol-5-yl) methyl 1-2H-pyrido f2 , 3-dlfl, 31 唠 2-2々1Ην The title compound was prepared by substituting 2-chloro-5-bromomethylpyrazole for n-butane bromide according to the procedure of Example 1B (0.360 g , 60%). MS (APCI) m / z 296 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 3 5.45 (s, 2H), 7.44 (dd, J = 7.72, 4.78 Hz, 1H), 7.76 (s5 1H), 8.42 (dd, J = 7.91, 1.65 Hz, 1H), 8.82 (dd, J = 4.78, 1.84Hz? 1H). Example 10B · L-"(2-Gas-1,3 _Pyrimazol-5-yl) methyl-1_3_n, l-digasification_4Η · 1,2,4-benzyl-4-diphenyl-3-yl V4 • hydroxy-1-1.8-4 pyridin-2 (1HV ketone title The compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 10A (0.136 g, 60%). MS (ESI ·) m / z 477 (MH)-· 1H NMR (300 MHz, DMSO -d6) 5 5.76 (s, 2H), 7.56 (m, 2H), 7.65 (d, J = 7.35 Hz? 1H) 5 7.77 (s? 1H)? 7.78 (m5 1H), 7.92 (d ? J = 8.09 Hz5 1H)? 8.59 (dd, J = 8.09, 1.84 Hz, 1H), 8.92 (dd, J = 4.78, 1.84 Hz, 1H), 13.72 (s, 1H). Example 11 ·?-(U : Oxidized _, 4H-1,2,4-benzo 4 arsen-3_yl) -1- (3-fluoromethylfluorenyl) -4-hydroxy-

1,8-Xanthonyl-2 (1HV ketone example 11A 1- (3-fluoroylpyrene V2H-pyrido [~ 2,3-dl "l, 31 Phenyl-2,4 (1HV dione title compound It was prepared by substituting 3-fluorobenzyl bromide for n-butane bromide (0.382 g, 76%) according to the procedure of Example 1B. MS (DCI) m / z 273 (M + H) + ·

Example 11B 3- (1,1.: ....... oxidized-4qin1 and 4-benzo4dioxen-3-yl) small (3-fluorofluorenyl) glacial hydroxyl-89166 -220- 200427678 1,8_-oridazin-20HV

The title compound was prepared according to the procedure of Example ID, substituting the product of Example 11A for the product of Example 1B (0.040 g, 37%). MS (ESI-) m / z 449 (M-Η) · The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMRpOO MHz, DMSO-d6) 5 5.52 (s, 2H), 7.02 (m, 2H), 7.08 (d, J = 7.72 Hz, 1H), 7.17 (dd, J = 7.72, 4 · 41 Hz, 1H), 7.29 (m, 3H), 7.56 (td, J = 7.91, 1.47 Hz, 1Η), 7.67 (d, J = 8.09 Hz, 1H), 8.41 (dd, J = 7.72 , 1.84 Hz, 1H), 8.49 (dd, J = 4.78, 1.84 Hz, 1H), 15.79 (s, 1H). Example 12 3- (1,1-Dioxide-411-1, 2, 4- Benzopyrimidin-3-yl &gt; 4-Hydroxy-1,3-methylbutyl)-

1,8-Kou Nayodo_2 (1HV) is the same as Example 12A 1- (3-methylbutyl V2H ^ pyridinium Γ2,3- (ΐπΐ, 31 hump-2.4 (ΊΗν two lions make sodium sulfide ( A suspension of 95%, 0.048 g, 2.0 mmol in dimethylacetamide (2 ml) was reacted with the product of Example 1A (0.3 g, 1.83 mmol) at 20 ° C under nitrogen. The reaction mixture was stirred for 1/2 hour, then treated with bromo-3-methylbutane (0.3 g, 2.0 mmol), and stirred for another 16 hours. The reaction was mixed with ethyl acetate and water. Intermediate liquid separation treatment. The organic layer was washed with water and brine, dried over sodium sulfate, filtered, and concentrated under vacuum. The crude product was purified by flash column chromatography on Shixi gum, and then washed with Jihu Dissolved with ethyl picrate (3: 1) to give the title compound as a white solid (0.218 g, 51%). MS (ESI-) m / z 233 (MH) \ 1H NMR (300 MHz, DMSO-d6 ) δ 0.93 (s, 3H), 0.96 (s, 3H), 1.55 (m, 2H), 1_66 (m, 1H), 4.14 (t, J = 7.72 Hz, 2H), 7.37 (dd, J = 7.91, 4.96 Hz, 1H), 8.38 (dd, J = 7.72, 1.84 Hz, 1H), 8.78 (dd, J = 4.78, 89166 -22 1-200427678 1 · 84Ηζ, 1H) · Example 12B Dioxide-4H-1,2,4-benzyl di-p-well-3-yl) -4- # 垔 基 小 (3-Methyltin 1,8- The solution of pyrimidine-2 (1HV ketone in Example 12A (0.216 g, 0.92 mmol) and the product of Example 1C (0.247 g, 0.922 mmol) in anhydrous THF (7.5 mL) under nitrogen At 20 C, sodium hydride (95%, 0.089 g, 3.7 mmol) was added. The reaction was heated at reflux for 3 hours, cooled to 20 ° C, and ice-cold acid (2.4 ml) was added dropwise. The resulting mixture was heated under reflux for 1 hour, cooled to 25 ° C., and diluted with an aqueous hydrochloric acid solution (0.5 M, 35 ml). The formed precipitate was collected by filtration, washed with water, and dried. The crude product was purified by flash column chromatography on crushed gel, and the title compound was obtained as a white solid (0.031 g, 20%) by dissolving with hexane and ethyl acetate (3: 1). MS (ESI- ) m / z411 (MH) \ The sodium salt of the title compound was prepared according to the procedure of Example id. MS (ESI-) m / z 411 (MH) _ · 1H NMR (300 MHz, DMSO-d6) 5 0 · 95 (s, 3H), 0.98 (s, 3H), 1.47 ( m, 2H), 1.64 (m, 1H), 4.30 (t5 J = 7.72 Hz, 2H), 7.13 (dd, J = 7.72, 4.78 Hz, 1H), 7.26 (d, J = 8.09 Hz, 1H), 7.30 (d, J = 7.72 Hz, 1H), 7.55 (t, J = 7.72 Hz, 1H), 7.66 (d, J = 8.09 Hz, 1H), 8.37 (dd, J = 7.72, 1.84 Hz, 1H), 8.53 (dd, J = 4.78, 2.21 Hz, 1H), 15.94 (s, 1H). Example 13 1- (cyclobutylmethyl) -3- (l, l-digasification -4Η-1 · 2,4-benzylpyridine $ -3-yl V4-light radical-

1,8-pyridine_2 (1HV ketone example 13A 1- (cyclobutylmethyl) dian "" 2,3_d ~ | "1,3p No.2,4 (1HV dione 89166 -222- 200427678 title compound Prepared according to the procedure of Example 1B, replacing n-butane bromide with bromomethylcyclobutane (.255 g, 60%). Ms (DCI) m / z233 (M + Η) + · Example 13Β J-based methyldifluoride-4Η-1.2,4-benzopyrimidine: yl) -4_Hydroxy-1,8-xanthidine-2 (1HV ketone

The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 13A with the product of Example 1B (0.120 g, 52%). ms (ESI-) m / z 409 (M-Η) · _ The sodium salt of the title compound was prepared according to the procedure of Example 1D. iHNMR (300 MHz, DMSO-d6) 6 1.83 (m, 6H), 2.79 (m, 1H), 4.38 (d, J = 6.99 Hz, 2H), 7.13 (dd, J = 7.72, 4.78 Hz, 1H), 7.29 (U = 7.54 Hz, 2H), 7.55 (t, J = 7.72 Hz, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.36 (dd, J = 7.72, 2.21 Hz, 1H), 8.51 (dd, J = 4.78, 1.84 Hz, 1H), 15.92 (S, 1H). Example 14 3- (1,1-Dioxide_4H-1,2,4-Benzapyrimidine Ergen-3-yl) -4-hydroxy small "(5-methyl-2-pyrimene

Methyl) methyl hydrazone-1,8-pyrimidine-2 (1HV ketone example 14A H (5-methyl-2-fluorenyl) methyl 1_2H-pyrido [Z3-dl 「Ul Trigon-2,4aHV di The ketone title compound was prepared according to the procedure of Example 1B, substituting 2-bromomethyl-5-methylpyridine for n-butane bromide (0.181 g, 54%). IHNMRpOOMHz, DMSO-d6) 5 2.36 (s, 3H), 5.38 (s, 2H), 6.63 (m, 1H), 6.98 (d, J = 3.68 Hz, 1H), 7.42 (dd, J = 7.72, 4.78 Hz, 1H), 8.41 ( dd, J = 7.72, 1.84 Hz, 1H), 8.82 (dd, J = 4.78, 1.84 Hz, 1H).

Example 14B 3- (1,1-Digasification_4H-1.2,4-Benzopyrimidin-3-yl V4-hydroxy_H (5-methyl-2-4phen 89166 -223-200427678 group) The methyl H, 8-pyridin-2 (1Η) -one title compound was prepared according to the procedure of Example ID, substituting the product of Example 14A with the product of Example 1B (0.172 g, 58%). MS (ESI-) m / z 451 (MH) _ · The sodium salt of the title compound was prepared according to the procedure of Example ID. 1HNMR (300 MHz, DMSO-d6) 5 2.32 (s, 3H), 5.54 (s, 2H), 6.56 (d , 1H), 6.88 (d, J = 3.31 Hz, 1H), 7.17 (dd, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 2H), 7.56 (t, J = 7.72 Hz, 1H), 7_67 (d, J = 7.72 Hz, 1H), 8.38 (dd, J = 7.72, 1.84 Hz, 1H), 8.56 (dd, J = 4.78, 1.84 Hz, 1H), 15.81 (s, 1H). · Example 15 1 Benzyl-3- (1,1-dioxide-4H_1,2,4_benzo far di-p-well-3-yl V4_jingji_1,8-peak lake_

2 (1HV ketone example 15A 1-fluorenyl-2H-pyrido "2,3- (Π" 1.31 hydrazone-2,4aHV diketone The title compound was substituted for benzyl bromide-n-bromide by the procedure of Example 1B) Made from butane (0.393 g, 51%). MS (DCI) m / z 255 (M + H) +. Example 15B · 1-benzyl digasification-4H-1,2,4-mobenazine Ergen-3-yl V4-hydroxy-1,8-4pyridinone was prepared according to the procedure of Example 1D, substituting the product of Example 15A with the product of Example 1B (0.217 g, 62%). MS ( ESI-) m / z 431 (M_H)

The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) 5 5.52 (s, 2H), 7.16 (m, 2H), 7.25 (d, J = 4.41 Hz, 4H), 7.29 (m, 2H), 7.56 (td, J = 7.91, 1.47 Hz, 1H), 7.67 (dd, J = 7.91, 1.65 Hz, 1H), 8.41 (dd, J = 7.54, 2.02 Hz, 1H), 8.48 (dd , J = 4.78, 2.21 Hz, 1H), 15.84 (s, 1H). 89166.224-200427678 Example 16 H-4H-1,2,4-pyridopyridine-3-a certain V4-hydroxy- H (5-methylearpyridyl) methyl 1-1.8- 砵 晗 -2ΠΗ &gt; Ketone Example 16A M (5-methyl-3-pyridine) methyl 1-2Η-pyrido "2.3-dl" l , 31 Sakiko-2,4aHV dione title compound was prepared according to the procedure of Example 1B, replacing 3-bromomethyl-5-methylpyridine with n-butane bromide (0.080 g, 24%). IHNMR (300MHz, DMSO-d6) 5 2.25 (s, 3H), 5.34 (s, 2H), 7.40 (dd, J = 7.72, 4.78 Hz, 1H), 7.63 (bi * s, 1H), 8 30 (br s, 1H), 8.43 (dd, J = 7.72, 1.84 Hz, 1H), 8.46 (br s, 1H), 8.73 (dd, J = 4.78, 1.84Ηζ, 1H) ·

Example 16B 3—Emulsified-4H-1,2,4-benzopyridine · -3-yl) · 4 · Ethyl-1-"(5 · methyl-3_exordinyl) methyl 1-L8_pyrimidine-2 (1HV ketone title compound was prepared according to the procedure of Example ID, substituting the product of Example 16A with the product of Example 1B (0.013 g, 13%). MS (ESI-) m / z 446 ( M_H) _ · The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) (5 2.22 (s, 3H), 5.49 (s, 2H), 7.18 (dd, J = 7.72, 4.78 Hz, 1H), 7.29 (m, 2H), 7.44 (s, 1H), 7.56 (m, 1H), 7.67 (cU = 8.09 Hz, 1H), 8.23 (d, J = 1.47 Hz, 1H), 8.36 (d, J = 1.47 Hz, 1H), 8.41 (dd, J = 7.72, L84 Hz, 1H), 8.51 (dd, J = 4.78, 1.84Hz, 1H), 15.80 (s, 1H). Example 17 Gasoyl-4-p than ydoyl) methyl 1-3- (1,1-dimulsified-4H-1,2,4-benzophenone-2 ton-3_yl • Hydroxy-1,8-pyridine-2 (1Ηketone example 17A 89166 -225-200427678 H (2-chloroglycidyl) methyl 1-2H-pyrido f2,3-dl [L31 唠 2-2, 4 (The 1HV dione title compound was substituted for 4-bromomethyl-2-chloropyridine by the procedure of Example 1B. (0.219 g, 62%). IHNMRpOOMHz, DMSO-d6) 5 5.37 (s, 2H), 7.40 (m, 1H), 7.48 (s, 1H), 7.60 (s, 1H), 8 · 34 (dd, J = 4.60, 2.39 Ηζ, 1Η), 8.45 (m, 1Η), 8.68 (m, 1Η).

Example 17B 1- "0-Chloro-4-pyridyl) methyl 1-3- (1,1-digassed benzopyridine-3-yl) _4-benzyl · 1,8-ρ-Nayodo The title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 17A (0.255 g, 73%). MS (ESI-) m / z 466/468 (MH) \ Sodium salt of the title compound Made according to the procedure of the case ID. 1H NMR (300 MHz, DMSO-d6) δ 5.52 (s, 2Η), 7.19 (m, 2Η), 7.30 (m, 3Η), 7.56 (t , J = 7.54 Ηζ, 1Η), 7.67 (d, J = 7.72 Ηζ, 1Η), 8.27 (d5 J = 5.15 Ηζ, 1Η), 8.46 (m, 2H), 15.72 (s, 1H ). Example 18 14 (5-Bromo-3-pyridyl) methylfluorene-3-CU-dioxide-4H-1,2,4-benzimidopyridine-3--a certain V4-hydroxy-1 , 8-4 pyridin-2 (1HV ketone

Example 18A (5-Bromo-pyridyl) methylphosphonium imine di-third-butyl dicarbonate 5-bromo-3-chloromethylpyridine hydrochloride (716 mg '4.189 Millimolar) in anhydrous DMF (15ml) under nitrogen and 0 ° C with triethylamine (0.65ml, 4.61 mmol), tetrabutylammonium bromide (273mg, 0.838 Millimoles) and di-tertiary-butylphosphonium imino dicarbonate (1.284 g, 5.027 millimoles). The reaction was heated to 50 ° C -55 ° C over 3.5 hours and then cooled to room temperature 89166 -226- 200427678, diluted with ethyl acetate (150 ml), and water (2 x 50 ml) with saturated sodium chloride Wash with aqueous solution. The combined extracts were dried over anhydrous Na2SO4, filtered, and concentrated by rotary evaporation. The residue was purified by flash column chromatography on silica gel and purified with 6% ethyl acetate / dichloromethane to give the title compound as a colorless oil (0.980 g, 60%). MS (ESI +) m / z387 / 389 (M + H) +; 1H NMR (300 MHz, CDC13) 51.49 (s, 18H), 4.75 (s, 2H), 7.83 (t, J = 2.02 Hz, 1H ), 8.50 (d, J = 1.84 Hz, 1H), 8.58 (d, J = 2.21 Hz, 1H) ·

Example 18B (5-Bromo-3-pyridyl) methylamine The product of Example 18A (0.98 g, 2.53 mmol) was trifluoroacetic acid and dichloromethane (1: 1 v / 1: 1) at room temperature. v, 20 ml) for 2 hours. The solvent was removed by rotary evaporation, and the formed oil was dissolved in benzene / dichloromethane (3 times) to obtain a waxy solid. The salt was dissolved in anhydrous methanol (20 ml) and stirred with Amberlite IRA-400 (OH) resin (10 g) for 2 hours. The resin was removed by vacuum filtration and washed thoroughly with anhydrous methanol. The filtrate was concentrated by rotary evaporation to obtain the title compound (0.415 g, 88%). MS (DCI / NH3) m / z 187/189 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 3.73 (s, 2H), 8.02 (t, J = 2.02 Hz, 1H) , 8.50 (d, J = 1.47 Hz, 1H), 8.53 (d, J = 2.21 Hz, 1H).

Example 18C 2- {"(5-Bromo-3-pyridyl Wyl 1 amine group ethyl nicotinic acid ethyl ester The title compound was prepared according to the procedure of Example 3A, substituting the product of Example 18B for 2-ethylbutylamine (0.116 g, 68%). MS (DCI / NH3) m / z 336/338 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 51.32 (t, J = 6.99 Hz, 3H ) 5 4.31 (q, J = 7.23 Hz, 2H), 4.71 (d, J = 5.88 Hz, 2H), 6.67 (dd, J = 7.72, 4.78 Hz, 1H), 89166 -227- 200427678 7.97 (t, J = 2.02 Hz, 1Η), 8 · 12 (dd, J = 7.72, 2.21 Hz, 1H), 8.26 (dd, J = 4.78, 1.84 Hz, 1H), 8.45 (t, J = 6.07 Hz, 1H), 8.55 (m, 2H).

Example 18D l-"(5-Bromo-3-pyridyl) methyl 1_2H-pyrido r2,3-dl" l, 31 stilbene dione The title compound was replaced by the product of Example 18C according to the procedure of Example 3B. The product of Example 3A was purified by flash column chromatography on silica gel and prepared by dissociation with 10% ethyl acetate / dichloromethane (0.057 g, 51%). WNMR (300 MHz, DMSO-d6) 5 5.38 (s, 2H), 7.41 (dd, J = 7.72, 5.15 Hz, 1H), 8.10 (t, J = 2.02 Hz, 1H), 8.43 (dd, J = 7.72, 1.84 Hz, 1H), 8.60 (d, J = 2.21 Hz, 1H), 8.66 (d, J = 1.84 Hz, 1H), 8.72 (dd, J = 5.15, 1.84 Hz, 1H) ·

Example 18E Stylo-3-exoyl) methyl 1-3- (1,1-dioxide-4H-1,2,4-benzophenone plug 2 wells 3-methyl V4-hydroxy-1,8 -Pyridine-2 (1HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 18D (0.037 g, 43%). MS (ESI-) m / z 510/512 ( MH) _. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.52 (s, 2Η), 7 · 20 (dd, J = 7.72, 4.78 Ηζ, 1HX 7.29 (m, 2H), 7.56 (t, J = 7.54 Hz, 1H), 7.68 (d, J = 7.35 Hz, 1H), 7.89 (br s, 1H), 8_42 (dd, J = 7.72, 1.84 Hz, 1H), 8.52 (dd, J = 4.78, 1.84 Hz, 1H), 8.55 (br s, 2H), 15.73 (s, 1H). Example 19 1- (cyclohexylmethyldi Gasification-4Η · 1,2,4 • Stupid pyrimidine two farming · 3-V4_ 蕤 某-

L8-4 pyridin-2 (1HV ketone example 19A 89166 -228- 200427678 M cyclohexylmethyl) -2H-pyridino The procedure of Example 1B was prepared by substituting (bromomethyl) cyclohexane for n-butane bromide (0.05 g, 11%).

Example 19B 1- (Cyclohexylmethyl V3- (l, l-dioxide-4fluorene-1,2,4-benzyl-4-dipyridyl) M-hydroxy-1,8-pyridine-2 (111 &gt; &gt; -The ketone title compound was prepared according to the procedure of Example 1D, substituting the product of Example 19A with the product of Example 1B (0.025 g, 30%). MS (ESI-) m / z 437 (M-Η) · · Title compound The sodium salt was prepared according to the procedure of the example ID. MS (ESI-) m / z 437 (MH) '. 1H NMR (300 MHz, DMSO-d6 / TFA) δ 0.99 (m? 5H)? 1.50 (m? 5H), 1.87 (m, 1H), 4.32 (d, J = 7.35 Hz, 2H), 7.23 (dd, J = 8.09, 4.78 Hz, 1H), 7.38 (m, 2H), 7.57 (m , 1H), 7.78 (d, J = 8.09 Hz, 1H), 8.40 (dd, J = 8.09, 1.84 Hz, 1H), 8.66 (dd, J = 4.78, 1.84 Hz, 1H). Example 20 3- α, 1_Dioxide-4H-1,2,4-benzopyrimidine, 3_yl V4_hydroxy-1-"(2SV2_methylbutane

Ethyl 1-1,8-pyridin-2 (1-imido-one, Example 20A 2-{"(2SV2-methylbutyl1amino) nicotinic acid ethyl ester The title compound was prepared according to the procedure of Example 3A, -(-)-2-Methylbutylamine instead of 2-ethylbutylamine (1.6 g, 77%). 1HNMR (300 MHz, DMSO-d6) ά 0.89 (t, J = 7.23, 3H), 0.91 (d, J = 6.62 Hz, 3H), 1.18 (m, 1H), 1.31 (t, J = 6.99 Hz, 3H), 1.42 (m, 1H), 1.66 (m, 1H) , 3.35 (m, 2H), 4.29 (q, J = 7.23 Hz, 2H), 6.59 (dd, J = 7.72, 4.78 Hz, 1H), 8.01 (t, J = 5.52 Hz, 1H), 8.08 (dd, J = 7.72, 1.84 Hz, 1H), 8.27 (dd, J = 4.60, 2.02 Hz, lH). 89166 -229- 200427678

Example 20B

Ir [(2S) -2-methylbutyl 1-2H-pyrido rZ3-dlfUl Phen-2,4aHV dione The title compound was prepared in accordance with the procedure of Example 3B, replacing the product of Example 3A with the product of Example 3A. Into (0.400 g, 68%). MS (DCI) m / z252 (μ + νη4) + ·

Example 20C MU-digasification_4H-U, 4-benzyl-pyridine_3_A certain V4-hydroxy small `` (2SV2-methyl some butyl 1-U-4 pyridine-2 (1HV ketone · Title compound Prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 20B (0.66 g, 43%). MS (ESI-) m / z 411 (MH) — · The sodium salt of the title compound is based on Example ID program. IHNMR (300MHz, DMSO-d6) 5 0.80 (d, J = 6.99 Hz, 3H), 0.87 (t, J = 7.54 Hz, 3H), 1.15 (m, 1H) , 1.37 (m, 1H), 2.02 (m, 1H), 4.20 (d, J = 7_35 Hz, 2H), 7.12 (dd, J = 7.72, 4.78 Hz, 1H), 7.27 (m5 2H), 7.55 (m, 1H), 7.66 (d5 J = 7.72 Hz, 1H), 8.37 (dd5 J = 7.72, 2.21 Hz, 1H), 8.51 (dd, J = 4.60, 2.02 Hz, 1H), 15.95 (s, 1H) Example 21 · 3- (l, l-digasification-4H-1? 4-moclopyridine-3-yl V4-hydroxy_M4-methylfluorenyl VU-

Example 21A H4-formamidine V2H-pyrido f2,3-dli ~ l, 31 humeng-2,4 (1HV dione title compound was replaced with 4-methylbenzyl bromide in accordance with the procedure of Example 1B -Butane (0.402 g, 82%). MS (DCI) m / z 269 (M + H) + ·

Example 21B 3- (l, l-monoemulsified · 4Η1,2,4-benzo [pi] sedi 1: 7 well-3-yl-1 · (4-methyl VU8- 89166 -230- 200427678 pyridine -2 (1Ηνketone

The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 21A for the product of Example 1B (0 099 g, 60%). MS (ESI-) m / z 445 (Μ-Η) _-The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) 6 2_22 (s, 3H), 5.47 (s, 2H), 7.04 (d, J = 7.72 Hz, 2H), 7.14 (m, 3H), 7.29 (t, J = 7.35 Hz, 2H), 7.55 (t, J = 7.72 Hz, 1H), 7.67 (d5 J = 7.72 Hz, 1H), 8.39 (dd, J = 7.72, 1.84 Hz, 1H), 8.48 (dd, J = 4.78, 1.84 Hz, 1H), 15.85 (s, 1H). Example 22 3_ (1,1-dioxide-4H-1,2,4-jamopyridine-3-yl V4-hydroxy small IY5 -Nitro-2-Wanan

Methyl) 1-U-pyridine-2 (1HV ketone example 22A 1-"(5_nitro-2-furan) methyl 1-211-pyrido" 2,3-clamp 1,31 -2,4 (The title compound was prepared by substituting 2-bromomethyl-5-nitrofuran with n-butane bromide according to the procedure of Example 1B (0.120 g, 34%). iHNMRQOOMHz, DMSO-d6) 5 5.45 (s, 2H), 6.90 (d, J = 3.68 Ηζ, 1Η), 7.44 (dd, J = 7.72, 5.15 Hz, 1H), 7.65 (d, J = 3.68 Hz, 1H), 8.45 (m, 1H), 8.77 (m, 1H).

Example 22B Digas-4,1,1,2,4-benzopepodipent-3-yl) -4-perylnitro-2-amido) methyl 1-1,8-pyridine- 2 (The title compound of 1-imide-ketone was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 21A (0.040 g, 21%). MS (DCI / NH3) m / z468 (M + Η) + · The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) 5 5 · 60 (s, 2H), 6.54 (d, J = 3.68 Hz, 1H ), 7.22 89166 -231-200427678 (dd, J = 7.72, 4.78 Hz, 1H), 7.29 (m, 2H), 7.56 (m, 1H), 7.58 (d, J = 3.68 Hz, 1H), 7.67 (d, J = 8.09 Hz, 1H), 8.43 (dd, J = 7_72, 1.84 Hz, 1H), 8.53 (dd5 J = 4.78, 1.84Ηζ, 1H), 15.68 (s, 1H) · Example 23 HI- Benzophen-2-ylmethyl V3- (l, l-dioxidation-4fluorene-1,2,4-benzophenone digeny-3-a) -4-hydroxya-L8-pyrimidine-2 ( 1HV ketone

Example 23A 1- (1. Benzopyrimidine_2_some methyl V2H_pyrido "2,3_dl" Ul Trigen-2,4 (1Ην dione titled the compound according to the procedure of Example 1B, using 2-chloro Methylmethylbenzo [b] phene substituted with n-butane bromide (0.160 g, 42%). IHNMR (300 MHz, DMSO-d6) 5 5 · 58 (s, 2H), 7.33 (m, 2H), 7.44 (dd, J = 7.72, 4.78 Hz, 1H), 7.51 (s, 1H), 7.77 (m, 1H), 7.90 (m, 1H), 8_44 (dd, J = 7.72, 1.84 Hz, 1H), 8.83 (dd, J = 4.78, 1.84 Hz, 1H) ·

Example 23B Benzophen-2-ylmethyl V3- (U · dihalide-4H-1,2,4-benzopyridine-3-yl V4-hydroxy-1.8-pyridine-2 (1HV ketone The title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 23A (0.48 g, 60%). MS (ESI-) m / z 487 (MH)- The sodium salt was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) 5 5.74 (s, 2H), 7.20 (dd, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 4H), 7.36 (s, 1H), 7.56 (m, 1H), 7.68 (dd, J = 7.72, 1.47 Hz, 1H), 7.75 (m, 1H), 7.82 (dd, J = 7.72, 1.47 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.58 (dd, J = 4.78, 1.84 Hz, lH), 15.77 (s, lH). Example 24 89166 -232 -200427678 3 -_ (LJ-—emulsified-4H-1,2,4-benzyl and far di_-3-yl) -4-lightyl-1- (3-methoxypyridine H, 8- 喳Pyridin-2HHV ketone

Example 24A

H1: methoxy) _2H_pyrido "2.3-dl" Ul 唠 2,4 [1HV diI The title compound was substituted with 3-methoxybenzyl bromide for n-butyl bromide following the procedure of Example 1B (0.446 g, 86%). MS (DCI) m / z 285 (M + H) + ·

Example 24B HU .: Dioxygen-4H-U, 4-molybdenum 4-diphenyl-3-yl M-hydroxy-1_ (3-methylpyridine, VU-pyridine_2ΠΗ &gt; ketone

The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 24A for the product of Example 1B (0-86 g, 53%). MS (ESI_) m / z 461 (Μ-Η) _ · The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) (5 3.69 (s, 3H), 5.49 (s, 2H), 6.75 (m, 3H), 7_15 (m, 2H), 7.29 (td, J = 8.46, 1.84 Hz, 2H), 7.56 (td, J = 7.72, 1.47 Hz, 1H), 7.66 (d, J = 7.72 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H ), 8.48 (dd, J = 4.78, 1.84 Hz, 1H), 15.82 (s, 1H). Example 25 i- (l, l-dioxide_4H-1,2,4_benzo 4 Erhuang-3_yl V4-Hydroxy_H3-Hydroxyfluorenyl I, 8-Xanthonyl-2 (1HV ketone

Example 25A (Analytical base) -2Η-ρ ratio and "2,3- &lt; 11" 1,3 &gt; No.-2,4 (1H) -divalent title compound was prepared according to the procedure of Example 1B, using bromine 3-Iodobenzyl was substituted by n-butane bromide (0.614 g, 88%). MS (DCI) m / z381 (M + H) +.

Example 25B 89166 -233-200427678

g- (l, l-dioxidation_4H-1,2,4-benzopyridine-3-yl V4- # yl-1- (3-Qi 芊 芊 V V 1,8_ 口 奈 淀- 2 (1H) _ 酉 The same title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 25A (0.176 g, 60%). MS (ESI-) m / z 557 (MH) ' The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) 5 5.47 (s5 2H), 7.07 (t, J = 7.72 Hz, 1H), 7.17 (dd, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 3H), 7.55 (m, 2H), 7.66 (m, 2H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd , J = 4.78, 1.84 Hz, 1H), 15.79 (s, 1H). Example 26] Di [(3,5-dimethyl-4-isoxazolyl) methyl-1-3- (l, l_Digas-4H4,2,4-benzopyrene

-3-3-yl) -4 · and a -L8_piperidine-2 (1HV ketone example 26A 1-[(3,5-dimethyl-4-isohumazolyl) methyl 1-2H-pyrido The "2,3-dl" 1,31 humeng-2,4qHV diketone title compound was substituted for 4-chloromethyl-3,5-dimethylisopurazolium bromide in accordance with the procedure of Example 1B. Butane (0.199 g, 60%). IHNMR (300 MHz, DMSO-d6) δ 2.20 (s? 3Η) 5 2.45 (s? 3Η)? 5.10 (s5 2Η)? 7.40 (dd, J = 7.72 , 4.78 Hz, 1H), 8.40 (dd? J = 7.725 1.84 Hz? 1H) 5 8.80 (dd? J = 4.78, 1.84 Hz? 1H).

Example 26B ir (3,5-dimethyl-4-isopyrazolyl) methyl 1-3- (1,1-dioxide-4Η-1,2,4-benzilopyrimidin-3-yl ) · 4-Hydroxy-1.8.4-pyridin-2 (1HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 26A (0.187 g, 63%). MS (DCI / NH3) m / z452 89166 -234- 200427678 (M + H) +; 1HNMR (300MHz, DMSO-d6) 5 2.20 (s, 3H), 2.38 (s, 3H), 5.44 (s, 2H), 7.51 (dd , J = 7.90, 4.60 Hz, 1H), 7.55 (t, J = 7.17 Hz, 1H), 7.64 (d, J = 7.72 Hz, 1H), 7.77 (t, J = 7.17 Hz, 1H), 7.92 (d, J = 7.72 Hz, 1H), 8.58 (dd, J = 7.90, 1.66 Hz, 1H), 8.88 (dd5 J = 4.60, 1_66 Hz, 1H), 13.95 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1HNMR (300MHz, DMSO-d6) 5 2.17 (s, 3H), 2.29 (s, 3H), 5.26 (s, 2H), 7.17 (dd5 J = 7.73, 4.78 Hz, 1H), 7.29 (m, 2H), 7.56 (t, J = 7.72 Hz, 1H), 7.67 (d, J = 7.72 Hz, 1H) , 8.39 (dd, J = 7.72, 1.84 Hz, 1H), 8.53 (dd, J = 4.78, 1_84 Hz, 1H), 15.78 (s, 1H). # Example 27 3- (U- 二 气Stupid and ethyl -4H-1,2,4- two farming _3- -l- hydroxy group V4- "2- (3-thienyl pyrimidinyl) acetate

1 · 1,8-pyridin-2 (1HV ketone example 27A Η2- (3-pyriminyl) ethoxy 1-2H-pyrido | ~ 2,3-dl "l, 31 唠 2-2,4 (The title compound of 1HV diketone was prepared according to the procedure of Example 1B, replacing n-butane bromide with 3- (2-bromoethyl) pyrimidine (0.156 g, 46%). IHNMRpOOMHz, DMSO- d6) 5 2.98 (t, 2H), 4.36 (t, 2H), 7.07 (d, J = 5.15 Hz, 1H), 7.31 (m, 1H), _ 7.39 (dd, J = 7.72, 5.15 Hz, 1H), 7.49 (m, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.78 (dd, J = 4.78, 1.84 Hz, lH).

Example 27B mi-—emulsification-411-1,2,4-benzyl-2-pentadienyl-3-yl) -4-rozyl-l- "2- (3-methylphenidyl) ethyl 1-1,8 -Pyrididine-2 (1 field-one title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 27A (0123 g, 48%). MS (ESI-) m / z 451 ( MH) '

The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR 89166 -235- 200427678 (300 MHz, DMSO-d6) accounts for 2.90 (t, J = 7.90 Hz, 2H), 4_51 (t, J = 7.90 Hz, 2H), 7.10 (d, J = 4.78 Hz, 1H), 7.16 (dd, J = 7.72, 4.78 Hz, 1H), 7.29 (m, 3H), 7.49 (dd, J = 4.78, 2.94 Hz, 1H), 7.56 (m, 1H) , 7.68 (d, J = 7.72 Hz, 1H), 8.39 (dd, J = 7.72, 1.84 Hz, 1H), 8.55 (dd, J = 4.78, 1.84 Hz, 1H), 15_89 (s, 1H) _ Example 28 3- (l, l-digasification-4Η-1,2,4 · benzo-p-dithiazol-3-yl) -4-yl-1- (4h? Pyridylmethyl) -1,8-pyridine_2 (1Ηνone example 28A 1- (4-pyridylmethyl) -2Η-pyrido "2,3-dl" 1,31 hump-2,4 (1HV dione title The compound was prepared according to the procedure of Example 1B by replacing 4- (chloromethylfluorenyl) pyridine with n-butane bromide (0.089 g, 29%). IHNMRpOOMHz, DMSO-d6) 5 5.37 (s5 2H)? 7.41 (m? 3H), 8.45 (dd? J = 7.72? 1.84 Hz, 1H)? 8.49 (m, 2H), 8.69 (dd, J = 4.78, 1.84 Hz, 1H).

Example 28B

Kl, l-dioxide-4H-U, 4-benzopyrimidin-3-yl V4-hydroxy-1- (4-pyridine-1) -1,8_pyridine-2 (1Ηνone title compound Made according to the procedure of Example ID, replacing the product of Example 1A with the product of Example 28A (0.034 g, 19%). MS (DCI / NH3) m / z434 (M + H) +; 1H NMR ( 300 MHz, DMSO-d6) 5 5.83 (s, 2H), 7.52 (m, 2H), 7.60 (d, J = 7.72 Hz, 1H), 7.69 (d, J = 6.25 Hz, 2H), 7.73 ( m, 1H), 7.91 (d, J = 6.99 Hz, 1H), 8_62 (dd, J = 7.72, 1.84 Hz, 1H), 8.68 (d, J = 6.25 Hz, 2H), 8.75 (dd, J = 4.78 , 1.84 Hz, 1H), 13.98 (s, 1H) —The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.56 (s, 2H), 7.22 ( m, 3H), 7.33 (m, 2H), 7.59 (m, 1H), 7_71 (m, 1H), 8.45 (m, 3H), 8.50 (dd5 J = 4.78, 200427678 1.83Ηζ, 1H ), 15.54 (s, 1H) · Example 29 l: (4-j styrenylbenzyl) _3- (U-digasification-4Η-1 · 2,4-benzyl-4-dioxo each V4-hydroxydi

1,8-pyridine-2 (1HV ketone example 29A H4-bromofluorenone) -2H_pyrido "2,3-dl" 1,3? No. 2,4 (1HV dione title compound is based on The procedure of Example 1B was prepared by replacing 4-bromobenzyl bromide with n-butane bromide (1.460 g, 72%). MS (DCI) m / z 333 (M + H) + ·

Example 29B 1- (4-Methenylbenzyl V3-rU-digasification-4H-1,2,4-jasopyridine, each V4-hydroxy-1,8-xanthrimidine 2_-one

The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 29A for the product of Example 1B (0.060 g, 59%). MS (ESI_) m / z 509 (M-Η)-The sodium salt of the title compound was prepared according to the procedure of Example 1D. iHNMR (300 MHz, DMSO-d6) δ 5.47 (s, 2H), 7_16 (dd, J = 7.72, 4.78 Hz, 1H), 7.22 (d, J = 8.46 Hz, 2H), 7.27 (t , J = 7.72 Hz, 2H), 7.44 (d5 J = 8.46 Hz, 2H), 7.56 (td, J = 7.72, 1.47 Hz, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.41 ( dd, J = 7.72, 1.84 Hz, 1H), 8.48 (dd, J = 4.78, 1.84 Hz, 1H), 15.80 (s, 1H) · Example 30 3 2 (! _, 1-Dioxide-4H_1, 2,4-benzopyrimidinium-3-some) -4-Hydroxyneopenta {heart

pNayodo-2 (1HV) Example 30A M neopentylamino group like basic acid has been prepared Matsuetsu compound According to the procedure of Example 3A, 2-89166 -237- 200427678 ethyl was replaced with 2,2-dimethylpropylamine (0.407 g, 57%). MS (ESI +) 237 (M + H) +; 1H NMR (300 MHz? CDC13) 5 1.02 (s, 9H), 1.38 (t, J = 7.17Hz, 3H), 3.36 (d, J = 5.52

Hz, 2H), 4.33 (q, J = 7.35 Hz, 2H), 6.48 (dd, J = 7.91, 4.60 Hz, 1H), 8.12 (dd, J = 7.72, 2.21 Hz, 1H), 8.16 (s, 1H ), 8 · 26 (dd, J = 4.78, 2.21 Hz, 1H) ·

Example 30B 1-neopentyl-2H-pyrido "2,3-dlfl, 31 arsen-2,4αΗ) -dione The title compound was obtained by substituting the product of Example 30A with the product of Example 3A and following the procedure of Example 3B (0.182 g, 89%). 1H NMR (300 MHz, CDC13) 61.12 (s, 9H), 4.28 (s, 2H), 7.25 (dd, J = 6.99, 4.04 Hz, 1H), 8.41 ( dd, J = 7.91, 2.02 Hz, 1H), 8.69 (dd, J = 4.78, 1.84 Hz, 1H).

Example 30C 3- (1,1-Difluoride-4H-1,2,4-benzopyridine-3_yl V4-light-based small neopentyl-U-kounanyodo-2 (1 Η) -The ketone title compound was prepared in accordance with the procedure of Example ID, replacing the product of Example 1B with the product of Example 30B (0.070 g, 22%). MS (ESI +) m / z 413 (M + H) +; iHNMRpOOMH ^ DMSOO 5 0.96 (s, 9H), 4.52 (s, 2H), 7.49 (dd, J = 8.09, 4.41 Hz, 1H), 7.56 (t, J = 7.54 Hz, 1H), 7.68 (d, J = 8.09 Hz, 1H), 7.78 (m, 1H), 7.94 (d, J = 6.99 Hz, 1H), 8.57 (dd, J = 8.09, 1.84 Hz, 1H), 8.85 ( dd, J = 4.41, 1.84 Hz, 1H), 14.11 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example IE). ] ^ 8 Gang 31+) 11 ^ 413 () \ 1 + 11) +; 111 Li 11 (3001 ^ 1 ^ ， 〇] ^ 〇-d6) 5 0.91 (s5 9H)? 4.34 (s? 2H), 7.11 (dd5 J = 7.72, 4.78 Hz5 1H)? 7.27 (m? 2H)? 7.55 (m, 1H), 7.66 (m, 1H), 8.36 (dd, J = 7.54, 2.02 Hz, 1H), 8.48 ( dd, J = 4.60, 2.02 Hz, lH), 15.95 (s, lH). Example 31 89166 -238- 200427678 1- {"(18,2gen58) -6,6-dimethylbicyclic ring" 3 丄11-gepten-2-tomb ~ | methyl on 3- (1 _ ^. Oxy .. also di 4H-1,2,4_benzoxanthorphin-3-yl V4- 蕤 -1,8- 喑 bite "

Example 31A 2-({((18,2) 58) -6,6-dimethylbicyclic `` 3 丄 11 庵 -2-some 1methyl} amino) 1-residual 1 ethyl ester The title compound is based on The procedure of Example 3A was prepared by replacing (2-)-cis-myrtanylamine with 2-ethylbutylamine (0.604 g, 40%). MS (ESI +) m / z 303 (M + H ) +. φ Example 31B 1-{((1S, 2R, 5SV6,6-Dimethylbicyclic β.1.11 庵 -2-some 1methyl 丨 -2Η-pyrido f2,3-dl [~ Ul 口Geng_2,4 (The title compound of 1HV dione was prepared according to the procedure of Example 3B, replacing the product of Example 3A with the product of Example 31A (0.570 g, 95%). IHNMRQOOMHz, DMSO-d6) 5 0 · 79 (d, J = 9.56 Hz, 1H), 1.14 (s, 3H), 1.22 (s, 3H), 1.62 (m, 1H), 1.87 (m, 5H), 2.26 (m, 1H), 2.53 (m5 1H ), 4.04 (dd, J = 13.05, 6.07 Hz, 1H), 4.28 (dd, J = 13.24, 9.19 Hz, 1H), 7.37 (dd, J = 7.72, 4.78 Hz, 1H), 8.38 ( dd, J = _ 7.72, 1.84 Hz, 1H), 8.76 (dd, J = 4.78, 1.84 Hz, 1H).

Example 31C 1- {"(18,211,58 &gt; 6,6-dimethylbicyclo" 3.1,11heptan-2-yl-1methyl [3_ (1,1_digasification-4H-1,2,4 -Benzothiagenol-3-a certain V4-hydroxy-1,8-pyridine-2 (1HV ketone title compound was prepared according to the procedure of Example ID, replacing the product of Example 1B with the product of Example 31B (0.050 g , 21%). MS (ESI-) m / z 477 (MH)-_ The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) (5 0.78 (d, J = 9.56 Hz, 1H), U5 (m, 3H), 1.30 (s, 3H), 89166-239- 200427678 1.80 (m, 6H), 2.24 (m, 1H), 2.54 (m5 1H), 4.37 (m, 2H ), 7.12 (dd, J = 7.54, 4.60 Hz, 1H), 7.27 (m, 2H), 7.55 (m, 1H), 7.67 (dd, J = 7.72, 1.47 Hz, 1H), 8.36 (dd, J = 7.54, 2.02 Hz, 1H), 8.50 (dd, J = 4.60, 2.02 Hz, 1H), 15.95 (s, 1H). Example 32

Digas-4H-1,2,4-benzyl-4-diphenyl-3-yl V4-hydroxy-2_keto-1,8_pyrimidine-1 (2HV group 1methyl} benzonitrile example 32A 34 ( The 2,4-diketo-2H-pyrido "2,3-dl" 1,31 oxo-1 (4HV group) methyl &quot; I styronitrile title compound was brominated according to the procedure of Example 1B. Made from 3-cyanobenzyl bromide instead of n-butane (0_363 g, 71%). MS (DCI) m / z 280 (M + H) +.

Example 32B 1Di {[3- (1,1-Digas-4Η-1,2ΛBenzopyrimidin-3-yl) -4-hydroxy-2-keto-1,8-pyrimidine-U2HV group The 1 methyl} jasonitrile title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 32A (0.024 g, 22%). MS (ESI-) m / z 456 (M-H) 'sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz? DMSO-d6) δ 5.54 (s? 2Η)? 7.18 (dd? J = 7.72, 4.78 Hz, 1H) 5 7.29 (m5 2H), 7.48 (t, J = 7.72 Hz, 1HX 7.56 (td, J = 7.91, 1.47 Hz, 2H), 7.68 (m, 3H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.60, 2.02 Hz, 1H), 15.77 (s, 1H) · Example 33 3- (l, l-dioxide-4H-L2,4-benzopyrimidin-3-yl V4-hydroxy-1- (3-pyridylmethyl)

-1,8-4 Pyridin-2 (1HV ketone example 33A 1- (3-pyridine a methyl V2H-pyrido Π 2.3- (ΐπΐ, 31 噚 2-2,4 (1HV dione 89166 -240- 200427678 The title compound was prepared according to the procedure of Example 1B, replacing n-butane bromide with 3- (bromomethyl) pyridine (0.153 g, 49%). IHNMR OOOMHz, DMSO-d6) δ 5.38 (s? 2H) 7.34 (dd? J = 7.72, 4.78 Hz? 1H)? 7.40 (dd5 J = 7.72, 4.78 Hz, 1H), 7.82 (m, 1H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.47 (dd, J = 4.78, UO Hz, 1H), 8.66 (d, J = 1.84 Hz, 1H), 8.74 (dd, J = 5.15, 1.84 Hz, 1H) ·

Example 33B 3- (1,1 -.— milk 4H-4H-1,2,4-benzyl p-two wells-3-yl) -4- via methyl ratio of methyl group) _1,8 _Petridine_2 (1HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 33A (0.098 g, 41%). MS (DCI / NH3) m / z434 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 5.72 (s, 2H), 7.41 (dd, J = 7.72, 4.78 Hz, 1H), 7.50 (m, 2H), 7.61 (d, J = 8.09 Hz, 1H), 7.74 (m, 1H), 7.84 (d, J = 7.72 Hz, 1H), 7.89 (d, J = 8.09 Hz, 1H), 8.50 (d, J = 4.04 Hz, 1H ), 8.58 (dd, J, 7.73, 1.84 Hz, 1H), 8.67 (s, 1H), 8.80 (dd, J = 4.78, 1.84 Hz, 1H), 14.15 (s, 1H). Sodium of the title compound The salt is prepared according to the procedure of the example ID. 1HNMR (300 MHz, DMSO-d6) 6 5 · 53 (s, 2H), 7.18 (dd, J = 7.72, 4.41 Hz, 1H), 7.29 (m , 3Η), 7.56 (m, 1Η), 7.65 (m, 2Η), 8.40 (m, 2Η), 8.51 (dd, J = 4.60, 2.02 Ηζ, 1Η), 8.57 (d, J = 1.47 Hz, 1H), 15.78 (s, 1H) · Example 34 1- (1gold-steel alkylmethyl digasification-4H-1,2,4-jamo-4-dioxen-3-yl M- hydroxyl Pyridine-1,8-2 (1Ην one instance · twitter 34Α

Mik gold steel alkylmethyl) amino 1 nicotine_ The title compound was substituted for 2- 89166 -241-200427678 ethyl chloronicotinate with 2-chloronicotinic acid according to the procedure of Example 3A, and 1 -Amantadine methylamine substituted with 2-ethylbutylamine (0.185 g, 79%). With 3 gangsters 31+) 111 ^ 287.1 () ^ + 11) +; 111 Li 11 (300) \ «12, DMSO-d6) (Π.74 (m, 12H), 2.00 (s5 3H), 3.31 (m , 2H), 6.60 (dd, J == 7.35, 5.52 Ηζ, 1Η), 7.96 (dd, J = 5.33, 2.02 Ηζ, 1Η), 8.26 (dd, J = 7.35, 1.84 Ηζ, 1Η) .

Example 34B

Ml-gold indium alkylmethyl V2H-pyrido "2,3-dl" 1,31 oxo-2,4 (1HV dione title compound was replaced by the product of Example 34A according to the procedure of Example 3B (0.025 g, 20%). 1H NMR (300 MHz, CDC13) 51.74 (m, 12H), 2.04 (s, 3H), 3.65 (d, J = 5.88 Hz, 2H), 6.91 ( dd, J = 7.72, 5.52 Hz, 1H), 8.51 (d, J = 4.78 Hz, 1H), 8.77 (d, J = 7.72 Hz, 1H).

Example 34C 1- (1-Au steel alkylmethyl) -3- (1,1-digasification-4H-1,2,4-benzopyrimidin-3-yl V4-hydroxy-1,8 -4pyridin-2 (1HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 34B (0.018 g, 47%). MS (ESI +) m / z 491.1 (M + H ) +; iHNMROOOMHz'DMSOO 5 1.59 (s, 12H), 1.90 (m, 3H), 4.41 (brs, 2H), 7.48 (m, 1H), 7.56 (t, J = 7.54 Hz, 1H), 7.69 (m, 1H), 7.77 (m, 1H), 7.94 (d, J = 7.72 Hz, 1H), 8.56 (dd, J = 8.09, 1.84 Hz, 1H), 8.85 (dd, J = 4.60 , 1.65 Hz, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI +) m / z 491.1 (M + H) +; 1HNMR (300 MHz, DMSO-d6) δ 1.56 (m? 12H), 1.87 (s, 3H), 4.21 (br s, 2H), 7.10 (dd, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 2H), 7.55 (m, 1H), 7.66 ( dd, J = 7.72, 1.47 Hz, 1H), 8.35 (dd, J = 7.72, 1.84 Hz, 1H), 8.48 (dd, J = 4.60, 2.02 Hz, 1H), 15.97 (br s, 1H ). Example 35 89166 -242- 200427678 3- (1,1-dioxide-4H-1? 4-benzopyridine_3-yl M-hydroxy-143- (trifluoromethane

Character base 1-1,8-Kona Nayodo · 2 (1 H) -pyridine 35A 1- "3- (trifluoromethyl) theyl 1-2H-pyrido" 2 &gt; dl "l, 31 噚Geng-2 · 4 "ΗνbisS with the same title compound was prepared according to the procedure of Example 1B, replacing 3- (trifluoromethyl) methyl bromide with n-butane bromide (0.250 g, 42%). 1H NMR (300 MΗζ, DMSO-d6) 5 5.43 (s, 2Η), 7.40 (dd, J = 7.72, 4.78 Ηζ, 1Η), 7.55 (m, 1Η), 7.64 (m, 1H) ), 7_73 (d, J = 7.72 Hz, 1H), 7.81 (s, 1H), 8.43 (dd, J = 7.72, 1_84 Hz, 1H), 8.72 (dd, J = 4.78, 1.84 Hz, 1H) .

Example 35B 3- (U-Digas-4H-U, 4-benzilopyridine_3-yl) -4_hydroxy-143- (trifluoromethyl) fluorenyl 1-U-4pyridine_2 (The title compound of 1Ηv ketone was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 35A (0.22 g, 57%).] ^ 3 田 81-) 111 ^ 499 () ^ 11) ·· 1H NMR (300 MHz, DMSO-d6) 6 5.77 (s, 2Η), 7.54 (m, 6Η), 7.66 (d, J = 7.72

Hz, 1Η), 7.76 (m, 2H), 7.92 (d, J = 8.09 Hz, 1Η), 8.61 (dd, J = 8.09, 1.84 Hz, 1H), 8.83 (dd, J = 4.41, 1.84 Hz, 1H), 13.91 (br s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m / z499 (M-Hy; iHNMR (300 MHz, DMSO-d6) δ 5.58 (s, 2H), 7.18 (dd, J = 7.72, 4.78 Hz, 1H), 7.29 (m, 2H) , 7.54 (m, 4H), 7.66 (m, 2H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.60, 2.02 Hz, 1H), 15.78 (m , 1H). Example 36 3- (1,1-Dioxide-4Η-1,2ΛBenzobiformin-3-yl V4-hydroxy-1-lΪ2-methyl-1,3-oroxazole_5 _Yl) 1-1,8-piperidine_2 (1HV ketone 89166 -243-200427678

Example 36A The hydrazone (2.methyl-L3-oxazol-5-yl) methyl 1-2H-pyrido f2,3-dl, 1,31 humen-2,4 fluorenedione. The title compound is based on Example 1B. A procedure was prepared by substituting 2-methyl-5-chloromethylpyrimazole for n-butane bromide (0.300 g, 54%). Example 36B

Kl, l-dioxide-4Η-1,2,4-benzyl and 4 cultivating groups V4-hydroxy-fluorene (2-methyl-U-thiazol-5-yl) a certain 1-1,8-4 Pyridine-2 (1HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 36A (0 · ΐ23 g, 25%). 8 positions 1_) 111 ^ 452 () ^ _ 11 )-· 1H NMR (300 MHz, DMSO-d6) (5 2.54 (s, 3H), 5.76 (s, 1H), 7.53 (m, 1H), 7.52 (d, J = 7.72 Hz, 1H), 7.65 ( m, 2H), 7.76 (t, J = 7.72 Hz, 1H), 7.91 (d, J = 7.72 Hz, 1H), 8.57 (d, J = 7.72 Hz, 1H), 8.90 (d, J = 4.04 Hz, 1H), 13.92 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D. Example 37 1: (2-cyclohexyl.ethylethyl-4H-1,2,4-benzene Pyridoxine-3-yl) -4 · 蕤 Mou-di 1,8-4 pyridin-2aHV ketone

Example 37A Pyrido r2,3_dirul Phenol_24 (1Hy dione title compound was prepared according to the procedure of Example 1B, substituting bromo-2-cyclohexylethane with n-butane bromide (0.196 g, 39 %). Example 37B HP oxidized 4H-U, 4-benzylpyrene-3-yl) dipper i 1L8-pyridine-2 (1HV ketone 89166 -244- 200427678 The title compound is based on the procedure of Example ID, It was prepared by substituting the product of Example 37A with the product of Example 1B (0.030 g, 18%, after column purification). MS (ESI-) m / z451 (M-Η)-sodium salt of the title compound Made according to the program of the instance ID: MS (ESI-) m / z451 (MH)-; 1HNMR (300 MHz, DMSO-d6 / TFA) δ 0.78 (m5 2Η), 0.98 (m, 3Η), 1.18 (m, 1Η), 1_40 (m, 5Η), 1.59 (d, J = 12.50 Ηζ, 2Η), 4.33 (m, 2H), 7.23 (m, 3H), 7.47 (t, J = 7.54 Hz, 1H), 7_67 (d, J = 7.72 Hz, 1H), 8.43 (m, 1H), 8.57 (dd, J = 4.78, 1.47 Hz, 1H) · Example 38 ·

Hl, l-dioxide-4H_1,2,4_benzylpyridine-3-yl) -4-hydroxy_H4-methyl gas

-1,8-pyridin-2 (1HV ketone example 38A methoxyfluorenyl V2H-pyrido [Z3_dl [~ 1,31 oxen-2,4 (1HV dione title compound was prepared according to the procedure of Example 1B, using Made from 4-methoxybenzyl chloride in place of n-butane bromide (0.364 g, 70%). MS (DCI) m / z 285 (M + H) + ·

Example 38B 3- (1,1-Dioxide-4H-U.4-jamopyridine-3-yl V4-hydroxypyridylmethylaminomethyl)---1,8-Konayodo-2 (1H) -Identical compound was prepared according to the procedure of Example 1D, substituting the product of Example 38A with the product of Example 1B (0-98 g, 51%). MS (ESI-) m / z 461 (M-H)-· The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) (5 3.68 (s, 3H), 5.45 (s, 2H), 6.80 (dt, J = 8.82, 2.21 Hz, 2H), 7.15 (dd, J = 7.72, 4.78 Hz, 1H), 7.26 (m, 4H), 7.55 (td, J = 7.72, 1.47 Hz, 1H), 7.67 (dd, J = 7.91, 1.65 Hz, 1H), 8.39 (dd5J = 7.72, 2.21 Hz, 1H), 8.50 (dd, J = 4.78, 1.84 Hz, 1H), 15.86 (s, 1H) 89166 -245- 200427678 Example 39 3- (1,1-two male 1 ^ :: ^-1 ， 2,4_benzo4 two farming-3-some) -4- Weimou_1 _ (&lt; 2-form: ^ yl) -1,8-

Pyridine-2 (1HV ketone example 39A group) -2H-pyridino "2,3-dl" 1,31 humeng-2.4ΠΗν dione The title compound was prepared according to the procedure of Example 1B, using 2-formamidine bromide Manufactured instead of n-butane bromide (0.353 g, 72%). MS (DCI) m / z 269 (M + Η) + · Example 39Β Η-4Η-1,2,4-benzophenone -3-A V4-#-1--1- (2-methylfluorenyl Vl, 8-pyridin-2 (1HV ketone title compound was prepared according to the procedure of Example 1D, substituting the product of Example 39A for the product of Example 1B (0.165 g, 62%). MS (ESI-) m / z 445 · The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz5 DMSO-d6) δ 2.44 (s5 3Η)? 5.45 (s5 2Η)? 6.59 (d? J = 7.35 Hz5 1H)? 6.96 (t, J = 7.17 Hz, 1H), 7.06 (t, J = 6.80 Hz, 1H), 7.16 (m, 2H) , 7.29 (t, J = 7.54 Hz, 2H), 7.56 (td, J = 7.72, 1.47 Hz, 1H), 7.66 (d, J = 7_72 Hz, 1H), 8_43 (d, J = 6_25Hz , 2H), 15.84 (s, 1H). Example 40 1- (Cyclopropylmethyl V3-a, l-digasified-4H-U.4-mozopyrene-3-yl) -4- Moumou-

1,8-oxanilidine-2 (1HV ketone example 40A 1'cyclopropylmethyl V2H-pyrido "2,3_dl" L31 phyto-2,4 (1HV dione title compound was according to the procedure of Example 1B, Made with (bromomethyl) cyclopropane instead of n-butane bromide (0.278 g, 70%). MS (APCI +) m / z219 89166 -246- 200427678 (M + H). 1H NMR (300 MHz , DMSO-d6) 5 0.46 (m, 4H), 1.27 (m, 1H), 4_04 (d, J = 6.99 Hz, 2H), 7.39 (dd, J = 7.91, 4.96 Hz, 1H), 8.40 (dd, J = 7.72, 1.84 Hz, 1H), 8.78 (dd, J = 4.78, 1.84 Hz, 1H).

Example 40B 1- (Cyclopropylmethyl) -3- (1,1-digasification-4Η-1,2Λbenpyrimidinium-3-yl) -4-hydroxy-1,8 · xanthidine The -2 fluorene-one title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 40A (0_06 g, 20%, after column purification). MS (ESI-) m / z 395 (Μ_Η) _. The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) mJz 395 (MH) '; 1H NMR (300 MHz, DMSO-d6) δ 0.40 (m? 4H), 1.32 (m, 1H), 4.19 (d, J = 6.99 Hz, 2H), 7.14 (dd, J = 7.54, 4.60 Hz, 1H), 7.28 (m, 2H), 7.55 (t, J = 7.35 Hz, 1H), 7.67 (dd, J = 7.72, 1.10 Hz, 1H), 8.38 (dd, J = 7.72, 1.84 Hz, 1H), 8.52 (dd, J = 4.60, 2.02 Hz, 1H), 15.93 (s, 1H). Example 41 3- (1,1- Dioxide-411_1,2,4-benzopyrimidin-3-yl) -4-hydroxy-1- (1,3-pyrazol_4-yl

A certain Vl, 8-piperidine-2 (1HV ketone-Example 41A

Hl, 3-oxazol-4-ylmethyl V2H-pyrido "2,3-dl" Ul-II-2,4 (1HV dione title compound was prepared according to the procedure of Example 1B using 4- (chloromethyl (Thiyl) thiazole substituted with n-butyl bromide (0.049 g, 15%). IHNMR (300 MHz, DMSO-d6) 5 5 · 48 (s, 2H), 7.40 (dd, J = 7.72, 4.78 Hz, 1H), 7.66 (s, 1H), 8.45 (dd, J = 7.72, 1.84 Hz, 1H), 8.72 (dd, J = 4.78, 1.84 Hz, 1H), 9.06 (d, J = 2.21 Hz? 1H).

Example 41B 89166 -247-200427678 i- (l, l-dioxide-4Η_1,2 · 4-jasomipyridin-3-yl) glacial hydroxyl_KU-pyridazol-4-ylmethyl M, 8- 4pyridin-2 (1Η) -one

The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 41A with the product of Example 1B (0.046 g, 59%). MS (ESI-) m / z 438 (M-H) _-The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300MHz, DMSO-d6) 5 5.65 (s, 2H), 7.04 (d, J = 2.21 Ηζ, 1Η), 7.16 (dd, J = 7.72, 4.78 Hz, 1H), 7.29 (m, 2H), 7.56 (m, 1H), 7.66 (d, J = 7.35 Hz, 1H), 8.42 (dd, J = 7.72, 2.21 Hz, 1H), 8.46 (dd, J = 4.78, 2 · 20 Hz, 1H), 8.98 (d, J = 1.84 Hz, 1H), 15.85 (s, 1H). Example 42 MU-Oxide-4H-L2,4-benzopyrimine-3_ V4-Leky-H (5-benzyl-2- phenylphen) methyl 1-1,8-4pyridin-2 (1HV ketone will be the product of Example 4B (100 mg, 0.19 mmol) Mol), phenyl dilight-based pentane (49 mg, 0.387 mmol), 2M Na2C03 aqueous solution (0.45 ml), absolute ethanol (0-5 ml), and triphenylphosphine (14 mg, 0.012 mmol) ) In DMF (2 ml) sprayed with n2, heat to reflux for 2.5 hours, cool to 0 ° C, dilute with H2O (13 ml), adjust to pH 3 with 1NHC1, and use ethyl acetate (3 X 25 ml) extraction. The combined extracts were washed with saturated NaC1, dried over anhydrous Na2SO4, filtered, and concentrated. The residue was subjected to flash column chromatography on silica gel with 3% vinegar Ethyl ester / dichloromethane was purified to obtain the title compound (0.039 g, 40%). MS (ESI-) m / z513 (MH) ·· The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR ( 300MHz, DMSad6) account for 5.64 (s, 2H), 7-12 (d, J = 3.68 Hz, 1H), 7.20 (dd, J = 7.72, 4.78 Hz, 1H), 7.31 (m, 6H), 7.57 (m, 3H), 7.68 (d, J = 7.72 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 89166 -248-200427678 8.60 (dd, J = 4.78, 1.84 Hz, 1H), 15.80 (s5 1H). Example 43 Dioxol_4H-U.4-benzyl 4 Ergen-3-yl M-hydroxyl · 1 · (4_ 甲某 -3 -Pentenyl VL8-pyrimidin-2HHV ketone example 43A 1: (4-methyl-3-pentenepyrene V2H-pyrido``2,3_ (11``1,31 噚 2-2,4 (1Η) _ 二The ketone title compound was prepared according to the procedure of Example 1B with 5-bromo-2-methyl-2-pentenyl substituted n-butane bromide (0.157 g, 35%). MS (DCI +) m / z247 (M + H) +; ^ NMRCSOOMHz ^ DMSO-dg) 5 1.59 (s5 3H)? 1.66 (s? 3H)? 2.35 (m, 2H), 4.09 (m, 2H), 5.18 (t, J = 7.54 Hz, 1H), 7.39 (dd5 J = 7.72, 5.15 Hz, 1H), 8.40 (dd, J = 7.72, 1.84 Hz, 1H), 8.79 (dd, J = 5.15, 1.84 Hz, 1H).

Example 43B 3- (l, l-monoemulsified-4H-1,2,4-benzop-ceedil-3-yl) -4-meryl-1_ (4-methyl-3.pentenyl M , 8-pyrimidine-2 (the title compound of 1Ηvone was prepared according to the procedure of Example ID, substituting the product of Example 43A with the product of Example 1B (0.030 g, 20%, after recrystallization). MS ( ESI-) m / z 4 ^ 3 (M-Η) 'sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI_) m / z423 (MH)-; iHNMROOOMH ^ DMSO-cy 5 1.63 (s , 3H), L67 (s, 3H), 2.26 (m, 2H), 4.23 (m, 2H), 5.21 (m5 1H), 7.14 (dd, J = 7.72, 4.78 Hz, 1H) , 7.28 (m, 2H), 7.55 (t, J = 7.35 Hz, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8_37 (dd, J = 7.72, 2.21 Hz, 1H ), 8.53 (dd, J = 4.60, 2.02 Hz, 1H), 15.92 (s, 1H). Example 44 β [3- (l, l-dioxide-4H-L2.4_benzypyrimidine-3 _ Group V4-fluorenyl-2-one group 1,8- 89166 -249- 200427678

Examples of pyridine-U2HV group 1methyl} benzonitrile 44A 44 (2,4-diketo-2pyridino "2,3_ (11 [~ 1,31 ~ | Bentamyl straight-titled compound was prepared by substituting 4-cyanobenzyl bromide for n-butane bromide according to the procedure of Example 1B (1.02 g, 60%). MS (DCI) m / z 280 ( M + H) +.

Example 44B 4-{"3- (l, l-dioxide-4H-1,2,4-benzopyrimidin-3_ylV4-hydroxy-2-one-1,8-piperidine_U2HV A 1-methyl-benzonitrile title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 44A (0J97 g, 60%). MS (ESI-) m / z 456 (MH) -· The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) δ 5.58 (s, 2H), 7.18 (dd, J = 7.54, 4.60 Hz, 1H), 7.29 (td , J = 8.46, 1.84 Hz, 2H), 7.41 (d, J = 8.46 Hz, 2H), 7.56 (td, J = 7.81, 1.65 Hz, 1H), 7.67 (dd, J = 7.91, 1.29 Hz, 1H), 7.72 (d, J = 8.46 Hz, 2H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.46 (dd, J = 4.60, 2.02 Hz, 1H) , 15.77 (s, 1H). Example 45 1 Dicyclohexene-1-yl) ethyl 1-3-Π.1-dioxo-4H-1,2,4-benzopyrimidin-3-

V4-Hydroxypyridin-2 (1H) -one Example 45A 2- {| ~ 2- (1-cyclohexen-1-yl) ethyl 1amino} Nicotinic acid ethyl ester crossover compound is based on the example The procedure of 3A was made by replacing 2-ethylbutylamine with 2- (1-cyclohexyl) ethylamine (2.2 g, 80%). MS (DCI) m / z 275 (M + H) +

Example 45B Cyclohexen-1-yl) ethyl 1-2H-pyrido | Z3-cT | "1,31 slogan Geng-2,4 (1HV dicydine 89166 -250- 200427678 The title compound was prepared according to Example 3B Procedure, replace the product of Example 3A with the product of Example 45A (0 · 493 g, 91%). MS (DCI) m / z 290 (M + NH4) +.

Example 45C l- [2- (l-cyclohexen-1-yl) ethyl 1-3- (1,1-digasification-4H-1,2,4-benzopyrimidin-3-yl V4- 羝 -1,8-pyrimidine-2 (The title compound of 1HV ketone was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 45B (0.048 g, 14%). MS (ESI-) m / z 449 (MH)-· The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) (5 1.53 (m, 4H), 1.90 (m, 2H), 2.05 ( m, 2H), 2.18 (t, J = 7.54 Hz, 2H), 4.36 (m, 2H), 5.38 (s, 1H), 7.13 (dd, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 2H ), 7.55 (td, J = 7.72, 1.47 Hz, 1H), 7.66 (dd, J = 7.72, 1.47 Hz, 1H), 8.37 (dd, J = 7.54, 2.02 Hz, 1H), 8.52 ( dd, J = 4.60, 2.02 Hz, 1H), 15.91 (s, 1H). Example 46 3_ (1,1_Oxidation_4H-1,2,4-benzyl 4 Ergen-3_base) -4 -Hydroxymethyl-1,3-pentan-4-yl) methyl 1-1.8-pyridin-2 (1HV ketone

Example 46A 1-"(2-methyl, 1,3 · pyrimazol-4-yl) methyl V2H-pyrido | ~ 2,3-dlfUl Sakken-2,4 (1HV dione title compound is based on the example The procedure of 1B was prepared by substituting 4-chloromethyl-2-methylpyrazole for n-butane bromide (0.087 g, 26%). IHNMRpOOMHz, DMSO-d6) 5 2.63 (s, 3H), 5.37 (d, J = 1.47 Hz, 2H), 7.39 (s, 1H), 7.40 (dd, J = 7.72, 4.78 Hz, 1H), 8.44 (dd, J = 7.72, 1.84 Hz, 1H) , 8.72 (dd, J = 4.78, 1.84 Hz, 1H).

Example 46B 89166 -251-200427678 i: (i J_dioxyj ^ 4H-U, 4-pyrido-4 dipyridin-3-yl &gt; 4-hydroxy-H (2-methyl-U-oxazole- 4-A, 1-1.8 ^ naphthyridine · 2 (1Η) _one The title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 46A (0.078 g, 56%). MS (DCI / NH3) m / z454 (M + Η) + · The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 2.61 (s, 3H), 5.55 (s , 2H), 6.74 (s, 1H), 7.16 (dd, J = 7.73, 4.78 Hz, 1H), 7.29 (m, 2H), 7.55 (m, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.47 (dd, J = 4.78, 2.21 Hz, 1H), 15.85 (s, 1H). Example 47 U [3- (l, l -Oxide-4H-1,2, 'benzopyrimidin-3-yl) -4-hydroxy-2-keto-1,8-

Pyridine-U2HV 1methyl} benzonitrile Example 47A g-[(2,4-diketo-2H-pyrido "2,3-dl" Ulopterin-1 (4HV group) methyl 1 The title compound was prepared according to the procedure of Example 1B, replacing 2-n-butane bromide with 2-cyanobenzyl bromide (0.332 g, 65%). MS (DCI) m / z 280 (M + H ) + ·

An example 47B 2- {"3- (1,1-Digasification_411-1.2,4-benzopyrimidin-3-yl) -4-hydrazine-2-one-one-1 each pyridine- U2HV-based 1-methyl Benzene hydrazone The title compound was prepared in accordance with the procedure of Example 1D, replacing the product of Example 1A with the product of Example 47A (0.183 g, 66%). MS (ESI-) m / z 456 ( MH), the sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) 5 5.68 (s5 2H), 7.00 (d, J = 8.09 Hz, 1H), 7.19 (dd , J = 7.35, 4_78 Hz, 1H), 7.30 (t5J = 8_09 Hz, 2H), 7.39 (t, J = 7.54 Hz, 1H), 7.56 (t, 89166 -252- 200427678 J = 7 · 85 Hz, 2H), 7.67 (d, J = 7.72 Hz, 1Η), 7.84 (d, J = 7.72 Hz, 1H), 8.44 (m, 2H), 15.75 (s, 1H). Example 48

3- (1,1 · Digas-4H-U, 4-benzilopyrimidin-3-yl V4-hydroxymethyl_3-isoxazolyl) methyl 1-1,8-4pyridine- 2 (1HV ketone example 48A HC5-methylisoxazolyl) methyl 1-2H-pyrido "2,3-dl" 1,31 噚 2 -4,4Η Η dione The title compound was according to the procedure of Example 1B , Substituted with 3-chloromethyl-5-methylisoxazole for n-butane bromide (0.047 g, 15%). IHNMR (300 MHz, DMSO-d6) (5 2 · 34 (s, 3H), 5.35 (s, 2H), 6.26 (d, J = 1.10 Hz, 1H), 7.42 (dd, J = 7.72, 4.78 Hz, 1H), 8.44 (dd, J = 7.72, 1.84 Hz, 1H), 8.75 (dd, J = 5.15, 1.84 Hz, 1H).

Example 48B — Oxidation of _4H_1,2,4-benzophenone to two wells_3_yl) -4-meryl-1 _ "(5_methyl-3_isoxazolyl) methyl 1-1,8-pyrimidine -2 (1HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 48A (0.051 g, 67%). MS (ESI-) m / z 436 (MH) 'The title compound The sodium salt was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) (5 2.29 (s5 3H), 5.50 (s, 2H), 5.94 (s, 1H), 7.18 (dd , J = 7.72, 4.78 Ηζ, 1Η), 7.29 (m, 2Η), 7.56 (t, J = 8.09 Ηζ, 1Η), 7.67 (d, J = 8.09 Ηζ, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.78, 2.21 Hz, 1H), 15.76 (s, 1H). Example 49 3- (1,1-dioxide-4H -U, 4-benzilopyrimidin-3-yl) -4-hydroxy-1- (1-stubylmethyl)-89166 -253-200427678

1,8-pyrimidine-2 "H) _one Example 49A

Jd: 2-Methylmethyl V2H-pyrido Γ2,3- (ΠΓ1,31 humphin-2,4 (1HV dione title compound was substituted with 1- (bromomethyl) naphthalene according to the procedure of Example 1B Made from bromide n-butane (.391 g, 71%). MS (DCI) m / z 305 (M + H) + ·

Example 49B

Ml, l-digas-4H-114-benzilopyryl-3-yl) glacial hydroxy-1- (1-phenylmethyl) -U-xanthridine-2 (1HV ketone The title compound is based on The procedure of Example 1D was prepared by replacing the product of Example 1A with the product of Example 49A (0.087 g, 60%). MS (ESI-) m / z 481 (MH) ·; 1HNMR (300 MHz, DMSO-d6) δ 5.88 (s, 2H), 7.45 (m, 2H), 7.54 (t, J = 7.72 Hz, 3H), 7.65 (d, J = 7.72 Hz, 1H), 7.75 (m, 2H), 7.81 ( dd, J = 6.07, 3.49 Hz, 1H), 7.86 (d, J = 8.46 Hz, 2H), 7.93 (d, J = 7.35 Hz, 1H), 8.63 (dd, J = 7.72, 1.84 Hz, 1H), 8.83 (dd, J = 4.78, 1.84 Hz, 1H), 14.04 (s, 1H) · The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMRpOOMHiDMSadJ ^ 5.69 (s, 2H), 7.16 (dd, J = 7.54, 4.60 Hz, 1H), 7.29 (t, J = 7.72 Hz, 2H), 7.43 (m, 2H), 7.49 (dd, J = 8.64 , 1.65 Hz, 1H), 7.56 (td, J = 7.72, 1.47 Hz, 1H), 7.67 (d, J = 7.35 Hz, 2H), 7.83 (m, 3H), 8.42 (dd, J = 7.54, 2.02 Hz, 1H), 8.48 (dd, J = 4.60, 2.02 Hz, 1H), 15.86 (s, 1H). Example 50 3- (1,1-two milk 4 dagger 4H-1,2,4- benzo gag two 1: _3 a well 7-yl) -4-¾-yl-1 a (side port than 2 &lt; ylmethyl

H, 8-pyridine_2 (1HV ketone example 50A 1- (2-pyridine a methyl) -2 qinpyrido "2,3-clamp 1,31 plow-2,4 (1 field-dione 89166 -254- 200427678 The title compound was prepared according to the procedure of Example 1B, substituting 2- (bromomethyl) pyridine for n-butane bromide (0.060 g, 19%). IHNMRpOOMHz, DMSO-d6) 5 5.45 ( s? 2H)? 7.26 (m? 1H), 7.39 (dd5 J = 1.12, 4.78 Hz? 1H) 9 7.45 (d, J = 8.09 Hz, 1H), 7.73 (m, 1H), 8.46 (dd, J = 7.72, 1.84 Hz, 1H), 8.47 (m, 1H), 8.68 (dd, J = 4.78, 1.47 Hz, 1H) ·

Example 50B 3- (1,1-Dioxo 4H-1,2,4-benzo 4 dipyridyl V4-hydroxy-H2-eridylmethyl) -1,8-pyridin-2 (1HV Ketone · The title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 50A (〇_〇72 g, 72%). MS (ESI-) m / z 432 (M_H) _ ·

The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) 5 5.62 (s, 2H), 6.97 (d, J = 8.09 Hz, 1H), 7.18 (m5 2H), 7.31 (m, 2H), 7.62 (m, 3H) , 8.44 (d, J = 6.62 Hz, 3H), 15.71 (s, 1H). Example 51 l- (4_Third-J benzyl dioxide_4H-1,2,4-benzyl 4 Ergeng_3_yl) _4_Hydroxy-1,8-4 pyridin-2 (1HV ketone ·

-Example 51A 1- (4_Third: Benzyl benzyl) _2Ιϋ and "2,3-dl" 1,3 ~ | Sakine-2.4 (Ί1Τ &gt;-dione title compound was according to the procedure of Example 1B, Made from 4_ (third-butyl) bromide instead of n-butane bromide (0.410 g, 72%). MS (DCI) m / z311 (M + H) + _

Example 51B Brother di-butyl + yl V3- (l, l-digasification · 4Η-1,2,4_benzopetidine_3 ~ V4-hydroxy-1,8-pyridine-2 (1HV ketone 89166 -255-200427678 The title compound was prepared according to the procedure of Example ID, replacing the product of Example 1A with the product of Example 51A (0.109 g, 70%). MS (ESI_) m / z 487 (M-Η : Γ · The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) 5 1.23 (s, 9H), 5.49 (s, 2H), 7.16 (m, 3H), 7.28 ( m, 4H), 7.55 (td, J = 7.91, 1.47 Hz, 1H), 7.66 (d, J = 6.25 Hz, 1H), 8.40 (dd, J = 7.72, 2.21 Hz, 1H), 8.49 (dd, J = 4.60, 2.02 Hz, 1H), 15.84 (s, 1H). Example 52 Digas-4H-1,2,4-benzilopyrimidin-3-yl V4-hydroxy-2-2 Keto-1,8-pyrimidine-

U2HV Example of 1 ethyl acetate 52A (2,4-diketo-211-pyrido "2,3_ (11" 1,31 Hum-1 (411) -yl) ethyl acetate The title compound is based on Example 1B The procedure was prepared by replacing ethyl bromoacetate with n-butane bromide (0.174 g, 43%). IHNMRpOOMHADMSOdg) 6 1.21 (t, J = 7.17 Hz, 3 Hz), 4 · 18 (q, J = 7 · 11 Hz, 2H), 4.92 (s, 2H), 7.45 (dd, J = 7.72, 4.78 Ηζ, 1Η), 8.47 (dd, J = 7.91, 1.65 Ηζ, 1Η), 8.77 (dd , J = 4.78, 1.84 Ηζ, 1H).

-Example 52B "3- (U-Digas-4H-1,2,4-benzopyridine-3-yl V4-hydroxy-2-keto-1,8-piperidine-U2HV-based 1 acetic acid The title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 52A (0.200 g, 52%).] \ ^ Select 81-) 111 ^ 427 (1 ^ -11)-; 1H NMR (300 MHz, DMSO-d6 / CF3 COOD) δ 1.26 (t9 J = 6.99 Hz, 3H) 5 4.22 (q, J = 7.11 Hz, 2H), 5.34 (s5 2H), 7.44 (dd, J = 7.91, 4.60 Hz, 1H), 7.54 (m, 2H), 7.74 (m, 1H), 7.96 (m5 1H), 8.63 (dd, J = 8.09, 1.84 Hz, 1H), 8.79 (dd, J = 200427678 4.78, 1.84Ηζ, 1H). Example 53 "3- (U-digasification-4H-U, 4_jamo 4 digeno-3-yl V4 · jingji_2-one-1, To a suspension of the product of 8- 喑 t U2HV 1 acetic acid in Example 52B in 1: 1 THF: methanol (6 ml), a 0-5 N lithium hydroxide aqueous solution (6 ml) was added. The mixture was stirred at room temperature for 2 After 1 hour, the pH was adjusted to 1.0 with 1.0NHC1 and filtered. The filter cake was washed with water and dried to give the title compound (0.133 g, 86%). MS (ESI-) m / z399 (M-Η) .; iHNMR (300 MHz, DMSO-d6) 5 5.16 (s, 2H) , 7.54 (m, 2H), 7.67 (d, J = 7.72 Hz, 1H), 7.77 (t5 J = 7.72 Hz, 1H), 7.92 (d, J = 7.72 H ", 1H), 8.60 (dd, J = 8.09, 1.84 Hz, 1H), 8.84 (dd, J = 4.60, 1.65 Hz, 1H), 13.11 (brs, 1H), 13.79 (brs, 1H). Example 54 j- (l , L-digassed benzopyrimidin-3-yl V4-hydroxy-U3-jamohydrogen

Vl, 8-pyridin-2 (1HV ketone example 54A ylfluorenyl V2H-pyrido [2,3-dl "l, 31 phyto-2,4 (1HV dicyline title compound is according to the procedure of Example 1B, Made with 3-phenoxybenzyl chloride in place of n-butane bromide (0.190 g, 31%). MS (DCI) m / z 347 (M + H) + ·

Example 54B HM-Oxidation of L4H-1,2,4-Benzobidi__ -3_yl) _4_ Weimou small (3_phenoxy its hydrazone) -1,8-pyridine_2 (1 The compound of the same title was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 54A (0.063 g, 52%). MS (ESI-) m / z 523 (MH) ' 89166 -257- 200427678 The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO_d6) δ 5.51 (s, 2Η), 6.77 (dd, J = 8.09, 1_47 Ηζ, 1Η), 6 · 91 (s? 1H) 5 6.99 (t5 J-8.46 Hz? 2H)? 7.10 (t5 J = 7.35 Hz? 1H)? 7.19 (m, 1H)? 7.31 (m, 6H), 7.57 (t, J = 7 72 Hz, 1H), 7_68 (d, J = 7.72 Hz, 1H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8.48 (d, J = 2.94 Hz, 1H), 15.74 (s, 1H ). Example 55 1-allyl-3-α, 1-digasification-4Η-1,2Λbenzopyrimidine-3-a certain V4-hydroxy-1,8- 4 pyridine-2 (1HV ketone φ

Example 55A 1-allyl-2H-pyrido f2,3-dl "l, 31 arsen-2,4 g HV dione The title compound was substituted for 3-bromopropanthine-n-butyl bromide by the procedure of Example 1B (5 · 12 g, 82%). MS (DCI / NH3) m / z205 (M + () + β NMR (300 M ζ, DMSO-d6) 5 4.75 (m, 2Η), 5 · 14 (dd, J = 10.66, 1.47 Ηζ, 1Η), 5.27 (dd, J = 17.28, 1.47 Hz, 1H), 5.92 (m, 1H), 7.39 (dd5J = 7.72, 4.78 Hz, 1H), 8.40 (dd, J = 7.91, 2.02 Hz, 1H), 8.75 (dd, J = 4.78, 1.84 Hz, 1H) · Example 55B · 1-allyl-3- (1,1-digasification-4H-U , 4-Benzopyrimidin-3-yl V4-hydroxy-1,8-Xiaodian-2 (The 1HV ketone title compound was prepared according to the procedure of Example 1D, substituting the product of Example 55A for the product of Example 1B ( 1.4 g, 34.5%). MS (DCI / NH3) m / z383 (M + H) +. 1HNMR (300MHz5DMSO-d6) 5 5.03 (m? 1H) 5 5.11-5.15 (m? 3H)? 5.93- 6.07 (m5 1H), 7.45-7.60 (m, 2H), 7.65-7.72 (m, J = 8.46 Hz, 1H), 7.73-7.80 (t5 J = 7.72 Hz, 1H), 7.92 (d, J = 7 · 35 Hz, 1H), 8.58 (dd, J = 8.09, 1.84 Hz, 1H), 8.85 (dd? J = 4.60, 1.65 Hz, 1H). 89166 -25 8-200427678 Example 56 3- (1,1-Dioxide-4H-1,2,4-benzyl # 4 Ergen-3-yl M-fluorene-fluorene 24-ylmethyl) -1.8-pyridine- Example 2A-Ketone 56A 1- (2-Phenylmethyl V2H-pyrido "2,3-dl" 1,31 "2,4 (1HV dione The title compound was prepared according to the procedure of Example 1B, using 2- (Bromomethyl) fluorene substituted with n-butane bromide (0.417 g, 75%). MS (DCI) m / z 305 (M + H) + ·

Example 56B 3- (1,1-Dilactate 4H-4H-1,2,4-Benzo-pi-Di-2-well-3-yl) -4-Hexyl-1 · (2-naphthylmethyl The title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 56A (0.022 g, 42%). MS (ESI-) m / z 481 (M_H) ·; ^ NMRCSOOMH ^ DMSO- ^) δ 6.18 (s5 2H)? 6.83 (d? J = 6.62 Hz, 1H)? 7.28 (m, 1H), 7.53 (t , J = 7.54 Hz, 2H), 7.68 (m, 4H), 7.81 (d, J = 8.09 Hz, 1H), 7.92 (d, J = 7.35 Hz, 1H), 8.00 (d, J = 8.09 Hz, lH), 8.32 (d, J = 8.46 Hz, 1H), 8.66 (dd, J = 8_09, 1.84 Hz, 1H), 8.74 (dd, J = 4.78, 1.84 Hz, 1H), 14.04 ( s, 1H). The title compound winter sodium salt was prepared according to the procedure of Example ID. iHNMR (300MHz, DMSO-d6) 6 6.00 (s, 2H), 6.76 (d, J = 6.25 Hz, 1H), 7.18 (dd, J = 7.54, 4.96 Hz, 1H), 7.30 (m, 3H), 7 · 63 (m, 4H), 7.75 (d, J = 8.09 Hz, 1H), 7.97 (d, J = 6.99 Hz, 1H), 8.31 (d, J = 8.46 Hz, 1H), 8.40 (d, J = 3.68 Hz, 1H), 8.47 (dd, J = 7.72, 1.84 Hz, 1H), 15.78 (s, 1H). Example 57 3- (1,1-Digas-4H- U, 4-benzyl-4-diphenyl-3-yl M-hydroxy-H (1R) -1-phenylethyl l-pyridin-2 (1ΗνONE 200427678

Example 57A HKIRVI-Phenylethyl 1 amino group 丨 Nicotinic acid ethyl ester The title compound was prepared in accordance with the procedure of Example 3A, and substituted with 2- (2-ethylbutylamine) G, 82%). MS (DCI) m / z 271 (M + H) + Example 57B 1: [(Claw) -1-phenyl-ylethyl1-2H-pyrido f2,3-dl "l , 31 Purkin · 2,4 (1Ην dione The title compound was prepared according to the procedure of Example 3B, substituting the product of Example 57A with the product of Example 3A (0.250 g, 62%). 1H NMR (300 MHz, DMSO- d6) 51.86 (d, J = 6.99 Ηζ, 3Η), 6.65 (q, J = 6.99 Ηζ, 1Η), 7.27 (m, 3Η), 7.40 (m, 3H), 8.43 (dd, J = 7.72, 1.84 Hz, 1H), 8.73 (dd, J = 4.96, 2.02 Hz, 1H).

Example 57C 3- (1,1-Difluoride · 4fluorene-1,2,4-benzo4 Diphenyl-3 · yl M-hydroxy-l-lYlRVl-phenylethyl 1-1,8-pyridine -2 (1HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 57B (0.080 g, 36%). MS (ESI-) m / z 445 (MH)-· Title The sodium salt of the compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSQ-d6) 51.90 (d, J = 7.35 Hz, 3H), 6.87 (m, 1H), 7.12 (m, 2H ), 7.25 (m5 6H), 7.55 (m, 1H), 7.65 (d, J = 7.72 Hz, 1H), 8.40 (d, J = 6.25 Hz, 2H), 15.92 (s5 1H). Examples 58

1 · "(5-Third-butyl-2-pyrimidinyl) methyl tomb 1-3- (1,1-digasified-4H-1? 4-benzyl-4-dipent-3-yl)- 4-Cetrayl-1,8-Harden-2 (1H) -Identical Example 58A 1-"" Third-butyl-2-pyrimyl) methyl] -2H-pyridino "2,3 -dl, l, 31 hump-89166 -260- 200427678 2,4 (1H) -dione The title compound was substituted with 2-bromomethyl-5_tertiary-butylfluorene according to the procedure of Example 1B. Brominated with n-butane (0.098 g '25%). 1H NMR (300 MHz, DMSO-d6) 5 1.28 (s, 9Η), 5.39 (s, 2Η), 6.71 (d, J = 3.68 Ηζ , 1Η), 7.00 (d, J = 3.68 Hz, 1H), 7.42 (dd, J = 7.72, 4.78 Hz, 1H), 8.40 (dd, J = 7.72, 1.47 Hz, 1H ), 8.83 (dd, J = 4.78, 1.84 Hz, 1H).

Example 58B 1-I Ϊ5-Third-butyl-2-remophenyl) methyl stilbene-3-Π, 1-digasification-4H-1,2,4-benzylidene diwell-3-yl ) -4-Chrysyl-1,8_Hadianpin was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 58A (0.082 g, 54%). MS (ESI-) m / z 493 (M-H)-. The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300MHz, DMSO-d6) 5 1.25 (s, 9H), 5.55 (s, 2H), 6.63 (d, J = 3.31 Ηζ, 1Η), 6.89 (d, J = 3.31 Hz, 1H), 7.18 (dd, J = 7.72, 4.78 Hz, 1H), 7.28 (m, 2H), 7.56 (m, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.39 (dd, J = 7.72 , 1.84 Hz, 1H), 8.57 (dd, J = 4.78, 1.84 Hz, 1H), 15.83 (s, 1H) ·-Example 59 The benzyl group V3_ (U-dihydro_4H-1, 2, 4-jasopyridin-3-yl M-hydroxy-U-4pyridin-2 (1Ηketone example 59A methyl V2H-pyridine # `` 2,3-dl''l, 3 The 1Ην Erli title compound was prepared according to the procedure of Example 1B, replacing n-butane bromide with 4-phenylbenzyl chloride (0.119 g, 20%). MS (DCI) nl / Z331 (M + H) + · 89166 -261- 200427678 1- (1, Γ-biphenyl) -3_ (U-dioxide · 4Η-1,2,4-phenylpyrimidinyl each hydroxyl group-1,8-pyridine- 2ilHV ketone

The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 59A for the product of Example 1B (0.061 g, 50%). MS (ESI-) m / z 507 (M-H) 'sodium salt of the title compound was prepared according to the procedure of Example ID. WNMR (300 MHz, DMSO-d6) 6 5.57 (s, 2H), 7.17 (dd, J = 7.72, 4.78 Hz, 1H), 7.31 (m, 5H), 7.42 (t, J = 7.54 Hz, 2H ), 7.57 (m, 5H), 7.67 (d, J = 8_09 Hz, 1H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.50 (dd, J = 4.60, 2.02 Hz, 1H), 15.84 (s, 1H) · Example 60 HLL · Dioxide-4H_1,2,4-benzopyrimidine

Yl) ethyl 1-1,8-pyrimidine-2 (1HV ketone example 60A 2 {{2- (1Η-β 卜 多 -3-yl) ethyl 1amino group) The title compound is based on ethyl acetate The procedure of Example 3A was made by replacing tryptamine with 2-ethylbutylamine (1.24 g, 80%). MS (DCI) m / z 310 (Μ + Η) + · Example 60B

IdUlH-indole-3_some) Ethyl 1-2'-pyrido "2,3-dl" l, 31 humeng-2,4 (1HV dione title compound according to the procedure of Example 3B, using Example 60A The product was replaced by the product of Example 3A (0.164 g, 53%). MS (DCI) m / z325 (M + nh4) +.

Example 60C Digas-4H_1,2,4-benzopyrene? Jing-3-yl) -4-Techyl 丨 Homo-3-a) Ethylpyridin-2C1HV ketone The title compound was prepared in accordance with the procedure of Example 1D, substituting the product of Example 60B for 89166 -262- 200427678 and the product of Example 1B. Into (0.140 g, 54%). MS (ESI-) m / z 484 (M-H) · The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) 5 3.09 (m, 2H), 4.75 (m, 2H), 7.08 (m, 2H), 7.27 (d, J = 2.57 Hz, 1H), 7.36 (d , J = 6.99 Hz, 1H), 7.54 (m, 2H), 7.77 (m, 3H), 7.94 (d, J = 7.72 Hz, 1H), 8.60 (dd, J = 8.09, 1.84 Hz, 1H), 8.95 (dd, J = 4.78, 1.84 Hz, 1H), 10.88 (s, 1H). Example 61 3- (U-two gasification-4H-1,2,4-stupid and second farming_ 3-yl VH (6-ethylamino-2-pyridyl)

Methylpyrene-4-hydroxy-1,8-4pyridin-2 (1HV ketone example 61A H (6-chloro-2-pyridyl) methyl 1-2H-pyrido "2,3-dlfl, 31 Sengeng-2,4 (1Ην dione title compound was prepared by substituting 2-bromofluorenyl-6-chloropyridine for n-butane bromide according to the procedure of Example 1B (0.159 g, 45%). IHNMRpOOMHz , DMSO-d6) 6 5_40 (s, 2H), 7.41 (m, 2H), 7.49 (d, J = 7.72 Hz, 1H), 7.80 (t, J 2 7.72 Hz, 1H), 8.46 ( dd, J = 7_72, 1.84 Hz, 1H), 8_68 (dd, J = 5_15, 1_84 Hz, 1H).

Example 61B 3- (l, l-dioxide r4H-1,2,4-benzyl-4-dioxen-3-yl Vl-"(6-ethoxy-2-pyridyl) methyl 1-4-hydroxyl A certain pyrimidine-2 (1Η) -one title compound was prepared according to the procedure of Example 1D, substituting the product of Example 61A with the product of Example 1B (0.109 g, 42%). MS (ESI-) m / z 476 (Μ -Η) 'The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300MHz, DMS0-d6) 5 1.19 (t, J = 6.99Ηζ, 3H), 4.17 (q, J = 6.99 Hz, 2H), 5.52 (s5 2H)? 6.45 (d5 J-7.35 Hz5 1H) 5 6.54 (d5 J = 7.72 Hz? 1H) 5 7.15 (m5 1H) 5 7 · 29 (t, J = 7.72 Hz, 2H ), 7.54 (m, 2H), 7.66 (d, J = 8.09 Hz, 1H), 8.42 (m5 2H), 200427678 15.83 (s? 1H). Example 62 1-Word Base-3 · (1, 1- 2 Gasification of -4H-1,2,4-benzo-p-chrysanthyl-3_yl) -4 · # fluorenyl-7-formamidine_ 1.8- pyridin_2_-one

Example 62A The title compound of 2-Γamidoamino V6-methyl nicotinic acid phenylmethylammonium was substituted for 2-chloro-nicotinic acid ethyl with 2-chloro-6-methyl in test acid according to the procedure of Example 3A. The ester was prepared by replacing 2-ethylbutylamine with benzylamine as a benzylamine salt (0.480 g, 46%). MS (ESI +) m / z243.03 (M + H) +; iHNMR (300MHz, CDC13) 5 2.35 (s, 3H), 3-67 (s, 2H) 54.65 (s, 2H), 5.73 (brs, 3H ), 6.16 (d, J = 7.72 Hz, 1H), 7.17 (m, 10H), 7.76 (d, J = 7.35 Hz, 1H), 8.66 (br s, 1H).

Example 62B 1-fluorenyl-7-pyrene-2H-pyrido "2,3-dlfUl-Phen-2,4 (1HV dione titled compound was prepared in accordance with the procedure of Example 3B, replacing Example 3A with the product from Example 6 (0.150 g, 50%). 1H NMR (300 MHz, CDC13) 5 2.66 (s? 3H) 5 5.47 (s5 2H) 5 7.1〇 (d? J = 8.09 Hz5 1H)? 7.31 (m5 3H) 5 7.55 (dd5 J = 7.54, 1.65 Hz, 2H), 8.26 (d, J = 8_09 Hz, 1H) _

Example 62C 1-fluorenyl-3- (l, l-digasified-4H-1,2,4-benzilopyridin-3-yl M-hydroxy-7-methyl-1.8-xanthridine- 2 (1HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 62B (0 &quot; 53 g, 51%). 1H NMR (300 MHz, DMSO-d6) 5 2.61 (s , 3H), 5.69 (s, 2H), 7.30 (m, 6H), 7.53 (m, 1H), 7.64 (m, J = 7.35 Hz, 89166 -264- 200427678 1H), 7_74 (t, J = 7 · 54 Hz, 1H), 7.90 (d, J = 8.82 Hz, 1H), 8.46 (d, J = 8.46 Hz, 1H). The sodium salt of the Vietnam compound was prepared according to the procedure of Example ID. ms (ESI +) m / z 447.0 (M + H) +; 1H NMR (300 MHz, DMSO ^ d6) 5 2.48 (s? 3H)? 5.50 (s? 2H), 7.25 (m, 7H), 7_54 (m , 1H), 7.66 (d, J = 6.25 Hz, 1H), 8.28 (d, J = 7.72 Hz, 1H), 15.95 (s, 1H). Example 63 Dioxide-4H-1,2,4-benzo Cyclo-3-yl) -4-acryl small "amethyl-2 · pyridyl) methyl 1-1,8-4pyridin-2 (1HV ketone example 63A 1 [(6-methyl- 2-pyridyl) methyl 1-2'-pyrido "2,3-dl" Ul Gin-2.4Γ1Ην diS The same title compound was according to the procedure of Example 1B It was prepared by replacing 2-bromomethyl-6-methyleridine with n-butane bromide (0.088 g, 27%). IHNMR (300 MHz, DMSO-d6) δ 2.42 (s, 3H), 5_38 ( s, 2H), 7.19 (d, J = 7.72 Hz, 1H), 7.37 (m, 2H), 7.58 (t, J = 7.72 Hz, 1H), 8.45 (dd, J = 7.72, 1.84 Hz, 1H), 8.67 (dd, J = 4.78, 1.84 Hz, 1H).

Example 63B 3- (1,1-digasification-4H-1,2,4_benzyl-4-diphenyl group V4_hydroxy-1-IT6-methylsome-2-pyridyl) methyl 1-U- The pyrimidinone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 63A (0.081 g, 40%). MS (ESI-) m / z 446 (M-Η) · The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) 5 2.45 (s, 3H), 5.54 (s, 2H), 6.57 (d, J = 7.72 Hz, 1H), 7.04 (d, J = 7.35 Hz, 1H), 7 · 16 (dd, J = 7.17, 4.96 Hz, 1H), 7.29 (t, J = 7.72 Hz, 2H), 7.47 (t, J = 7.72 Hz, 1H), 7.56 (m5 1H), 7.66 (m5 d, J = 7.72 Hz, 1H), 8.43 (m5 89166 -265-200427678 2H), 15.82 (s, 1H). Example 64 3- (U: Shi 2 4H-1,2,4-benzo Pyridoxine, ethyl, propyl, propyl, V4-hydroxy-1,8-xanthidine_2ΠΗνone Example 64A 2-"(1-ethylpropyl) amino l | f Acetylacetic acid The title compound is based on the example The procedure of 3A was made by replacing 2-ethylbutylamine with 2-ethyl-propylamine (1.45 g, 88%). MS (ESI +) 237.1 (M + H) +. IHNMR (300MHz, CDC13) 5 0.93 ( t, J = 7.35 Hz, 6H), 1.38 (t, J = 7.17 Hz, 3H), 1.60 (m, 4H), 4_17 (m, 1H), 4.32 (q, J = 7.11 Hz, 2H), 6.45 ( dd, J = 7.72, 4.78 Hz, 1H), 7.89 (br d, J = 8_09 Hz, 1H), 8.10 (dd, J = 7.72, L84 Hz, 1H), 8.24 (dd, J = 4.78, 2.21 Hz? 1H).

Example 64B 1- (1-Ethylpropyl) -2! 1-pyrido "2,3- (11" 1,31 ", 2,4 (111) -dione The title compound was according to the procedure of Example 3B It was prepared by replacing the product of Example 3A with the product of Example 64A (0.120 g, 57%). MS (ESI +) m / z 223.1 (M + H) +; 1H NMR (300JMHz, CDC13) δ 0.87 (t, J = 7.54 Hz, 6H), 1.88 (m, 2H), 2.21 (s, 2H), 5.43 (s, 1H), 7.24 (dd, J = 6.99, 4.04 Hz, 1H), 8 · 42 (dd, J = 7.72, 1.84 Hz, 1H), 8.68 (dd, J = 4.78, 1.84 Hz, 1H) ·

Example 64C 3-α, 1 · Dioxide-4H-U, 4-benzopyrimidin-3-yl H- (l-ethylpropylM-hydroxy-1,8-oxanilidine-2qHV ketone The compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 64B (0.030 g, 15%). MS (ESI +) m / z413.04 89166 -266- 200427678 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 0.76 (t, J = 7.54 Hz, 6H), 1.90 (m, 2H), 2.29 (m, 2H), 5.37 (m, 0.5H), 5.92 (m, 0 · 5Η), 7.50 (m, 1H), 7.56 (t, J = 7.54 Hz, 1H), 7.69 (m, 1H), 7.78 (t, J = 7.17 Hz, 1H), 7.93 (d, J = 7.35 Hz, 1H), 8.58 (d, J = 8.09 Hz, 1H), 8.84 (m, 1H), 14.11 (s, 1H) · The sodium salt of the title compound is based on Program made. MS (ESI +) m / z413.〇7 (M + H_Na) +; 1H NMR (300 MHz, DMSO-d6) 5 0.74 (t, J = 7.35 Hz, 6H), 1.88 (br s, 2H ), 2.30 (br s, 2H), 5.35 (br s, 0.5H), 5.78 (br s, 0.5H), 7.28 (br s, 1H), 7.42 (m, J = 7.35 Hz, 2H), 7.66 (m, 1H), 7.79 (br d, J = 7.35 Hz, 1H), 8.47 (br d, J = 7.35 Hz, φ 1H) 5 8.64 (br s? 1H). Example 65 3- (1,1 -Di-emulsified-4H-1,2,4_benzo, two plugs, two wells _3-yl) _4_Cycloyl-phenylethyl 1-1,8-pyridine-2 (1-Tan-one

Example 65A 2-misvi-benzylethyl 1 amine} The title compound of ethyl nicotinate was prepared in accordance with the procedure of Example 3A, substituting 2-ethylbutylamine with methyl benzylamine (2.2 g, 81% ). MS (DCI) m / z271 (Μ + Η) + · β-Example 65B 1_ [Y1SV1-benzylethyl 1-2Η-pyrido [2,3-dl "Ul 唠 2-2,4 (1HV dione The title compound was prepared according to the procedure of Example 3B, replacing the product of Example 3A with the product of Example 65A (0.320 g, 80%). IHNMRQOOMHz, DMSO-d6) 51 · 86 (d, J = 6.99 Hz, 3H ), 6.65 (q, J = 6.99 Hz, 1H), 7.27 (m, 3H), 7.40 (m, 3H), 8.43 (dd, J = 7.72, 1.84 Hz, 1H), 8.73 (dd, J = 4.96, 2.02 Hz, 1H).

Example 65C 3- (1,1-digasification-4H-1,2, each group of winter benign and dichotomous) 4-Hydroxy-1-"asvi- 89166 -267- 200427678 _benzene_ylethyl 1 -1,8-Mizidine-2 (1HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 65B (0_122 g, 36%). MS (ESI-) m / z 445 (MH) 'sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) 51.90 (d, J = 7.35 Hz, 3H), 6.87 (m, 1H ), 7.12 (m, 2H), 7.25 (m, 6H), 7.55 (m, 1H), 7.65 (d, J = 7.72 Hz, 1H), 8.40 (d, J = 6.25 Hz, 2H) 15.92 (s, 1H) · Example 66 2- {2- "3- (l, l-dioxide-4H-1,2,4-benzidinidine dipyridyl V4-hydroxy-2-one- 1,8-peridine-1 (2HV 1ethyl) -1Η-isoindole-1,3 (2HV dione

Example 66A 1-12- (1,3-diketo_1,3-dihydro-211-isoindol-2-yl) ethyl 1-211-pyrido "2,3- (11" 1, 31 Sengeng-2,4 (The title compound of 1HV dione was prepared by substituting N- (2-bromoethyl) phthalimide with bromo-n-butane according to the procedure of Example 1B (0.121 G, 20%). IHNMR (300 MHz, DMSO-d6) δ 4.00 (t, J = 5.52 Ηζ, 2Η), 4.46 (t, J = 5.52 Ηζ, 2Η), 7.28 (dd, J = 7.72, -4.78 Hz, lH) 57.80 (s, 4H), 8.38 (dd, J = 7.7251.84 Hz, lH), 8. 53 (dd, J = 4/78, 1.84Ηζ, 1Η).

Example 66B 2- {243- (U-Digas-4H-1,2,4-benzothiadinyl-3-yl) _4-hydroxy-2-keto_1,8-piperidine-U2HV 1ethyl} -1Η-isoamidine-1,3 (2HV dione title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 65B (0.085 g, 46%) .1 ^ 氓 81-) 111 ^ 514 (^ «1)-; 1H NMR (300 MHz, DMSO-d6 / TFA) (5 4 · 09 (t, J = 5.15 Hz, 2H), 4.87 (m, 89166 -268-200427678 2H), 7.11 (dd, J = 7.91, 4.60 Hz, 1Η), 7.19 (d, J = 8.09 Hz, 1Η), 7.44 (t, J = 7 72 Hz, 1H), 7.58 (m, 5H), 7.84 (d, J = 8.09 Hz, 1H), 8.34 (dd, J = 4.41, 1.84 Hz, 1H), 8.42 (dd, J = 7.91, 1.65 Hz, 1H). Example 67 Dioxo-4 匕 -4Ή-1,2,4 · benzobenzodi-2-well-3-yl) -4-butan-1- (3-lightpropyl) -1, 8-Petridine-2αH) -one A solution of the product of Example 73 in THF (5 ml) and sodium borohydride (0.022 g, 0.58 mmol) were reacted at 0 ° C for 30 minutes. The solution was poured into water and extracted with ethyl acetate. The extract was dried over sodium sulfate, filtered, concentrated, and purified by preparative HPLC on a Waters symmetrical C8 column (40 mm X 100 mm, 7 micron particle size) using 10% to 100% acetonitrile / 0.1% The gradient of the TFA aqueous solution over 12 minutes (15 minutes of operation time) at a flow rate of 70 ml / min yielded the title compound. MS (DCI / NH3) m / z401 (M + H) +; iHNMRpOOMHz'DMSO-A) 6 1.87 (m, 2H), 3.54 (t, J = 6.43Hz, 2H), 4.55 (m, 2H), 7.52 (dd, J = 8.09, 4.78 Hz, 1H), 7.56 (m, 1H), 7.71 (d, J = 8.09 Hz, 1H), 7.79 (m, 1H), 7.94 (d, J = 8.09 Hz, 1H), 8.58 (dd, J = 8.09, 1.84 Hz, 1H), 8.90 (dd, J 54.60, 1.65 Hz, 1H), 14.13 (s, 1H). Example 68 1 Base-emulsified-4H-1,2,4-benzo mouth plug two wells-3-yl) -4-¾yl-1,8_

Kunayodo-2 (1 HV) Example 68A 2- (Cyclopentylamino) in ethyl acetate

The title compound was prepared according to the procedure of Example 3A, replacing 2-ethylbutylamine with cyclopentylamine (0-231 g, 67%). MS (ESI +) m / z235.1 (M + H) +; iHNMR 89166 -269- 200427678 (300 MHz, CDC13) 6 1.37 (t, J = 7.17 Hz, 3H), 1.64 (m, 6H), 2.08 (m, 2H), 4.31 (q, J = 7.23 Hz, 2H), 4.45 (m, 1H), 6.48 (dd, J = 7.72, 4.78 Hz, 1H), 8.02 (d, J = 5.88 Hz, 1H), 8.10 (dd, J = 7.91, 2.002Ηζ, 1H), 8.28 (dd, J = 4.78, 1.84 Hz, 1H) ·

Example 68B 1-Cyclopentyl-2H-pyrido f2,3-dl "l, 31 Phenyl-2,4 (1HV dione title compound was replaced with the product of Example 68A according to the procedure of Example 3B (0.130 g, 56%). MS (ESI +) m / z 221.08 (M + H) +; 1H NMR (300 MHz, CDC13) 51.66 (m, 1H), 1.99 (m, 4H), 2.21 ( m, 2H), 5.79 (m, 1H), 7.25 (dd, J = 8.09, 4.78 Hz, 1H), 8.42 (dd, J = 7.72, 2.21 Hz, 1H), 8.70 (dd, J = 4.78, 1_84 Hz, 1H).

Example 68C 1-Cyclopentyl-3- (1,1-digasification_4H-U, 4-pyrene # pyrimidinium-3-yl) hydroxy-1,8-Houdian-2 (1 HV ketone The title compound was prepared according to the procedure of Example ID, replacing the product of Example 1B with the product of Example 68B (0.133 g, 60%). MS (ESI +) m / z433.06 (M + H) +; 1H NMR (300 MHz, DMSO-d6) .70 (m, 2H), 1.85 (m, 2H), 2.07 (s, 2H), 2.28 (m5 2H), 6.17 (m, J = 8.64, 8.64 Hz, 1H), 7.52 (m, 2H), 7.65 (d, J = 7.72 Hz, 1H), 7_77 (m, 1H), 7.93 (d, J = 6.99 Hz, 1H), 8.57 (dd, J = 7.91, 2.02 Hz , 1H), 8.86 (dd, J = 4.78, 1.84 Hz, 1H), 14.05 (br s, 1H) · The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) ά 1.63 (m, 2H), 1.79 (br s, 2H), 2.04 (m, 2H), 2.23 (m, 2H), 6.08 (m, 1H), 7.31 (br s, 1H), 7.43 (br s, 2H), 7_65 (d, J = 6.25 Hz, 1H), 7.80 (br s, 1H), 8.48 (d, J = 7.72 Hz, 1H), 8.69 (br s, m). Examples 69 89166 -270- 200427678 HLl · ^ Ai ^ I4ίl·l, 2,4_Benpyrimidine two farming-3-a certain Vl 『2 彳 l, 3-dioxo 圜 -2-a,

Ethyl 1-Hydroxy-1,8 · pyridine-2qHV ketone example 69A HHL · ^ dioxo-2-yl) ethyl 1-2H-pyridine # QdlfUl 唠--2,4 ⑽-dione title compound system Prepared according to the procedure of Example 1B by replacing the n-butane bromide with hydrazine (2-bromomethyl ^ dioxine) (0.86 g, 53%). MS (DCI / NH3) m / z265 (M + H) +; iHNMR (300MHz, DMSO-d6) 5 1.98 (m, 2H), 3.83 (m, 4H), 4.25 (m, 2H), 4.92 (m, 1H), 7.38 (m, 1H) , 8.39 (dd, J = 7.72, 1.84 Hz, 1H), 8.78 (dd, J = 4.96, 2.02 Hz, 1H).

Example 69B

Hl, l_dioxide-4Η_1,2,4 · benzopyrimidin-3-yl M- "2- (L3-diazine-2-yl, ethylpyridin-4-yl-1, The compound of 8-Konayodo, with the same title, was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 69A (.89 g, 62%). MS (DCI / NH3) m / z443 ( M + H) +; 1H NMR (300 MHz, DMS0-d6) 5 2_03 (m, 2H), 2.50 (m, 2H), 3_84 (m, 2H), 4.59 (nv2H), 4.97 (t, J = 4.60 Hz, 1HX 7.51 (dd, J = 7.91, 4.60 Hz, 1Η), 7.56 (m, 1H), 7.77 (m, 2H), 7.94 (m, 1H), 8.56 (dd, J = 8.09, 1.84 Hz, 1H), 8.89 (dd, J = 4.78, 1.84 Hz, 1H), 14-09 (s, 1H). Example 70 1- (2,3-dihydroxypropyl)- 3- (1,1_Oxidation-411_1,2,4-benzyl-4-digonium-3-some &gt;) _ 4-hydroxy-1,8-4pyridin-2 (1HV ketone makes the product of Example 55B (1.08 G, 0.028 mole) with iron tetroxide (0 0007 mole) and N-methylmorphine N-oxide (4.96 g, 0.043 mole) in water with Ding 89166 -271-200427678 1: 1 mixture (50 ml) and reacted at room temperature for 18 hours. The reaction mixture was treated with sodium bisulfite and water The product was precipitated from the aqueous mixture and collected by vacuum filtration to give the title compound as a white solid (1.09 g, 93%). MS (DCI / NH3) m / z 417 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 3.33 (m, 2H), 3.87 (m, 1H), 4.37 (m, 2H), 4.52 (t, J = 6.07 Hz, 1H), 4.78 (d, J = 5.52 Hz, 1H), 7.17 (dd, J = 7.72, 4.78 Hz, 1H), 7.29 (m, 2H), 7.56 (m, 1H), 7.67 (d, J = 6.99 Hz, 1H), 8.40 (dd, J = 7.72, 1.84 Hz, 1H), 8.53 (dd, J = 4.78, 1.84 Hz, 1H), 15.80 (m, 1H). Example 71 1-ring Heptyl-3_ (1,1-dioxide-4H-1,2,4-jasopylophen-3-yl M-hydroxyl

Pyridine-2 (1HV Ketone Example 71A (Cycloheptylaminoacetic Acid Acetate) The title compound was prepared by substituting cycloheptylamine for 2-ethylbutylamine according to the procedure of Example 3A (1_01 g, 83%) .MS (ESI +) m / z263.1 (M + H) + iHNMR (300 MHz, CDC13) 5 U7 (t, J = 7.17 Hz, 3H), 1.62 (m, 10H), 2.02 ( m, 2H), 4.29 (m, 1H), 4.31 (q, J = 7.35 Hz, 2H), 6.45 (dd, J = 7.72, 4.78 Hz, 1H), 8.05 (d, J = 6 · (99 Hz, 1H), 8.10 (dd, J = 7.91, 2.02 Hz, 1H), 8.26 (dd, J = 4.78, 1.84 Hz, 1H).

Example 71B 1 Dicycloheptyl-2H-pyridino, "2,3-dl" l, 31,2,2,4 (1HV diketone The title compound was replaced with the product of Example 71A according to the procedure of Example 3B.) (0.205 g, 55%). MS (ESI +) m / z 249.1 (M + H) + • '1H NMR (300 MHz, CDC13) 5 1 · 63 (m, 6H), 1.84 (m , 4H), 2.43 (m, 2H), 89166 -272- 200427678 5.39 (s, 1H), 7.24 (dd, J = 7.72, 4.78 Hz, 1H), 8.40 (m, 1H), 8.71 (dd, J = 4.78, 1.84 Hz, 1H).

Example 71C 1-Cycloheptyl_3- (U-dioxide-4H-1,2,4-jasmine # pyrimidinium-3-yl V4-hydroxy-1,8- kounandian_2 (1HV The title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 71B (0.041 g, 15%). MS (ESI +) m / z439.07 (M + H) '1H NMR (300 MHz , DMSO-d6) 3 1 · 23 (m, 6H), 1.58 (m, 4H), 1.79 (m, 2H), 5.90 (m, 1H), 7.45 (m, 1H), 7.53 (m , 1H), 7.66 (m, J = 9.56 Hz, 1H), 7.74 (d, J = 7.72 Hz, 1H), 7.90 (d, J = 6.25 Hz, 1H), 8.54 (d, J = 7.35 Hz, 1H), 8.85 (s, 1H) · The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 1.61 (m, 8H), 1.77 (m , 4H), 1.94 (m, 2H), 5.60 (m, 1H), 7.10 (dd, J = 7.54, 4.60 Hz, 1H), 7.54 (m, 1H), 7.66 (dd, J = 7.72 , 1.47 Hz, 1H), 8.36 (dd, J = 7.72, 2.21 Hz, 1H), 8.51 (dd, J = 4.78, 2.21 Hz, 1H), 15.99 (s, 1H). Example 72 propylpropyl V3 -(U-Dioxide-4H-U ♦ Benzodiazepine-3-a certain V4-Amoy I -1,8-piperidine-2 (1HV ketone will be the product of Example 73 (0.090 g, 0.23 mmol) ear And a solution of aniline (0.5 ml, 0.23 mmol) in THF (6 ml), at ambient temperature, with sodium triacetoxyborohydride (0.08 g, 0-38 mmol) and Glacial acetic acid (0.025 ml, 0.43 Emole) was treated for 24 hours. The solvent was removed under vacuum and the resulting solid was applied to a Waters symmetrical C8 column (40 mm X 100 mm, 7 micron particle size) On the other hand, a preliminary HPLC purification was performed using a gradient solution of 10% to 100% acetonitrile / 0.1% TFA water 89166 -273-200427678 solution over 12 minutes (15 minutes operation time) at a flow rate of% ml / min. 'To give the title compound. MS (DCI / NH3) m / z 476 (M + H) +. The title compound was dissolved in 1,4-dioxolane (6 ml) and 4MHC1 (2 Ml). After stirring at room temperature for 3 hours, the mixture was filtered, and the filter cake was dried to produce its hydrochloride salt. 1H NMR (300 MHz, DMSO-d6) 5 2 · 11 (m, 2H), 3.32 (m, 2H), 4.59 (t, J = 6.80 Hz, 2H), 7_18 (s, 3H), 7.34 ( d, J = 7.35 Hz, 2H), 7.52 (m, 1H), 7.57 (m, 1H), 7.67 (d, J = 7.35 Hz, 1H), 7.80 (m, 1H), 7.94 (d, J = 7.72 Hz, 1H), 8.59 (dd, J = 7.72, 1.84 Hz, 1H), 8.89 (dd, J = 4.78, 1.84 Hz, 1H), 13.96 (s, 1H). Example 73 3- "3- (l, l_dioxide-4H-1,2,4-benzopyrimidin-3_yl V4-hydroxyl-2-keto-1,8-piperidine_1 (2HV radical 1 Propionaldehyde The suspension of the product of Example 69B (0.65 g, 0.15 mmol) in water (3 ml) and glacial acetic acid (12 ml) was added dropwise with sulfuric acid (1 ml) at ambient temperature. Treatment. The mixture was heated to 60 ° C for 1 hour and then diluted with water. The mixture was filtered and the filter cake was washed with water and dried to give the title compound (0.45 · 5 g, 78%). MS ( DCI / NH3) m / z 399 (M + H) +; 1H NMR (300MHz, DMSO-d6) 5 2.72 (m, 2H), 4.59 (t, J = 6.62Hz, 2H), 7.17 (dd, J = 7.72, 4.78 Hz, 1H), 7_28 (m, 1H), 7.55 (m, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.39 (dd, J = 7.72, 1.84 Hz, 1H), 8.52 (dd, J = 4.78, 1.84 Hz, 1H), 9.76 (t5 J = 2.21 Hz, 1H), 9.76 (t, J = 2.21 Hz, lH). Example 74 4- {"3- (1,1-Dioxide-411-1,2,4-Benzodistodi-3-yl) -4-meal Methyl-2-fluorenyl-1,8- hydrazone-U2HV 1methyl} benzoic acid methyl ester 89166 -274- 200427678

Example 74A 4-"(2 + diketo-2H-pyrido f2,3-dlH, 31 pyrene-U4HV group) methyl 1 stearic acid methyl ester The title compound was prepared according to the procedure of Example 1B using 4- (bromo Methyl methyl) benzoate instead of n-butane bromide and made (1.5 grams, 75%). MS (DCI) m / z 313 (M + H) +.

Example 74B 4-{"(3- (U-Digasification_4H-1,2,4 • Benylpyridine), 1-Hydroxy-2-one, -U-4pyridine-1 (2HV group 1A The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 74A for the product of Example 1B (0.130 g, 37%). MS (ESI-) m / z 489 (MH) ·· 1H NMR (300 MHz, DMSO-d6) δ 3.82 (s, 3H), 5.76 (s, 2H), 7.42 (d, J = 8.09 Hz, 2H), 7.50 (m, 2H), 7.63 ( d, J = 7.72 Hz, 1Η), 7.74 (t, J = 7.72 Hz, 1H), 7.88 (d, J = 8.46 Hz, 2H), 7.93 (m, 1H) , 8_60 (dd, J = 8.09, 1.84 Hz, 1H), 8.78 (d, J = 3.31 Hz, 1H), 14.12 (brs, lH). Example 75 5- {Γ3-αΐ-Dioxide-4H_1,2, 4-Benzopyrimidine, each group V4-Hydroxy-2-one group 1,8-

Example of a pyridine-U2HV group 1 methyl ethyl ethyl 2-furancarboxylate 75A 54 (2,4-difluorenyl g group-2H-pyrido "2,3-din, 31 trigonol-1C4HV group) methyl V2 -The title compound of ethyl furanoate was prepared by substituting ethyl 5-chloromethyl-2-furancarboxylate for n-butane bromide according to the procedure of Example 1B (0.073 g, 19%). iHNMR (300MHz, DMSO-d6) 6 i.34 (t, J = 7.17 Hz, 3H), 4.32 (q, J = 7.35 Hz, 2H), 5.56 (s, 2H), 6.49 (d, J = 3.68 Hz , 1H), 7.09 (d, J = 3.31 Hz, 1H), 7.31 (dd, J = 89166 -275-200427678 7.72, 4.78 Hz, 1H), 8.44 (dd5 J = 7.72, 1.84 Hz , 1H), 8.76 (dd, J = 4.78, 1.84 Hz, 1H).

Example 75B 5-{"3- (l, l-dioxide-4H-1,2,4-benzodistodipent-3-yl) -4- # stemyl-2-fluorenyl-1,8- The title compound of pyrimidine-U2H) -methyl 1-methyl-2-carbamate was prepared according to the procedure of Example 1D, replacing the product of Example 1A with the product of Example 75A (0.074 g, 69%). MS ( DCI / NH3) m / z495 (M + H) +. 1H NMR (300 MHz, DMSO-d6) 6 1.26 (t, J = 7.17 Hz, 3H), 4.26 (q, J = 7.23 Hz, 2H), 5.73 (s, 2H), 6.45 (d, J = 3.68 Hz, 1H), 7.19 (d, J = 3.68 Hz, 1H), 7.55 (m, 2H), 7_75 (m, 2H), 7.93 ( d, J = 7.72 Hz, 1H), 8.60 (dd, J = 7.91, 1.83 Hz, 1H), 8.86 (dd, J = 4.78, 1.84 Hz, 1H), 13.80 (s, 1H). Title 4 Dagger The sodium salt of the compound was prepared according to the procedure of Example ID. IHNMRpOOMH ^ DMSO-ddc? 1.27 (t, J = 7.17 Hz, 3H), 4.25 (q, J = 7.23 Hz, 2H), 5.55 (s, 2H), 6.22 (d, J = 3.31 Hz, 1H), 7.14 (d, J = 3.31 Hz, 1H), 7.20 (dd5 J = 7.72, 4.60 Hz, 1H), 7 · 29 (m, 2H), 7.56 (m, 1H), 7.67 (d, J = 8.09 Hz, 1H), 8.42 (dd, J = 7.72, 2.20 Hz, 1H), 8.52 (dd, J = 4.60, 2.21 Hz, 1H), 15.73 (s, 1H). An example of 76 HH-methylaminodioxygenation_4H_1,2,4_benzylpyridine_3-a certain V4-quinyl-1,8-pyridine -2 (Ί Η,-Xitongshi the product of Example 73 (0.085 g, 0.21 mol) and dimethylamine (20 mM in thf 0.110 liters, 0.22 φ Mo Ear) solution in tetrahydrofuran (4 ml), reacted with sodium triethoxyloxyborohydride (0.6 g, 0.28 mmol) at room temperature for 1 hour. The solvent was removed under vacuum, and The resulting solid was triturated with methanol and monomethyl sulfoxide (1.1), filtered, and dried to give the title compound ⑴ 89166 200427678 g, 61%). (DCI / NH3) m / z428 (M + H ) +. The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300MHz, DMSO-d6) 5 1.72 (m, 2H), 2.15 (s, 6H), 2.29 (t, J = 7.17Hz, 2H), 4.28 (m, 2H), 7_14 (dd, J = 7.72, 4.78 Hz, 1H), 7.27 (m, 2H), 7.55 (ddd, J = 8.27, 7.17, 1.47 Hz, 1H), 7.67 (dd, J = 8.09, 1.47 Hz, 1H) , 8.37 (dd, J = 7.54, 2.02 Hz, 1H), 8.53 (dd, J = 4.78, 1.84 Hz, 1H), 15.93 (s, 1H). Example 77 l- {3- " "2- (dimethylamino) ethyl 1 (methyl) amino 1 propyl 13- (1,1-dioxide-4H-U, 4-benzo-p-diphenyl-3-yl V4-hydroxyl · 1,8-pyridine-2 (1HV ketone title compound was prepared by substituting N, N, N-trimethylethylenediamine for aniline according to the procedure of Example 72. MS (DCI / NH3) m / z485 ( M + H) +. The dihydrochloride salt of the title compound was prepared according to the procedure of Example 72. 1 ^^ "11 (30〇] \ 1, 0 ^ 180-d6) 5 2.20 (s, 2H), 2.84 (m, J = 4.41 Hz, 6H), 3.50 (m, 9H), 4.54 (m, 2H), 7_54 (m, 3H), 7.77 (m, 1H), 7.91 (d, J = 8.09 Hz, 1Η), 8.59 (dd, J = 8.09, 1.84 Hz, 1H), 8.85 (dd, J = 4.60, 1.65 Hz, 1H), 10.43 (s, 1H), 14.25 (s, 1H) Example 78 MU-Dioxide_4Η-1,2Λ · Benzene Pyridoxine-3-yl V4_hydroxy-1 · "3- (4-methyl-1-hexahydropyridine) propanone 1-1,8-pyridine-2 (1HV ketone title compound is based on The procedure of Example 72 was prepared using 4-methylhexahydropyridine in place of aniline. MS (ESI-) m / z 450 (MH)-The dihydrochloride salt of the title compound was prepared according to the procedure of Example 72. 1H NMR (300 MHz, DMSO-d6) δ 2.03 (m, 2H), 3.10 (m, 4H) 5 3.69 (m, 4H), 3_90 (m, 2H), 4.39 (s, 2H), 7.20 ( dd, J = 7.72, 4.41 Hz, 1H), 7.30 (m, 2H), 7.58 (m, 1H), 7.68 (d, J = 7.72 Hz, 1H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.55 (dd, J = 4.41, 1.84 Hz, 1H), 15.71 (s, 1H) 89166 -277- 200427678 Example 79 1- (2-aminoethyl) -3- ( l, l-di-emulsion · 4Η_1,2,4_benzyl and far diphosphine_3 · yl) -4-lightyl-1,8-pyridine_2__one Example 66 (45.0 mg, 0.087 mmol ) A solution in a mixture of absolute ethanol (1.5 ml), N, N-dimethylformamide (0.8 ml) and dimethylarsine (1.0 ml) at room temperature with hydrazine monohydrate (13.42 Mg, 0-261 millimoles). The mixture was then heated to reflux at 80 ° C for 5 hours, cooled to room temperature, and concentrated. The concentrate was purified by a C8 HPLC column and dissolved with 20% to 80% acetonitrile in water with 1% trifluoroacetic acid to obtain the TFA salt of the title compound (0.010 g, 23%). MS (APCI +) m / z386 (M + H)-; iHNMRpOOMHz, DMSO-d6) δ 3.20 (dd, J = 11.95, 6.80 Hz, 2H), 4.62 (t, J = 5.52 Hz, 2H), 7.27 (m? 1H)? 7.39 (m5 2H), 7.65 (t5 J = 7.35 Hz? 1H)? 7.75 (d5 J = 7.72 Hz? 1H) 5 7.82 (br s, 3H), 8.42 ( d, J = 9.56 Hz, 1H), 8_61 (d, J = 3.31 Hz, 1H), 15.18 (br s, 1H). Example 80 JJ3- (diethylamino) propyl tomb 1-3- (1 1,1-digasification-4H-1,2,4-benzopyrimidinium-3-a certain Vf hydroxy-L8-pyrimidine-2 (1HV ketone title compound was replaced by diethylamine in accordance with the procedure of Example 72 MS (DCI / NH3) m / z456 (M + Η) + · The hydrochloride salt of the title compound was prepared according to the procedure of Example 72. iHNMR (300MHz, DMSO-d6) 5 1.19 (t, Bu 7.17 Hz? 6H)? 2.15 (m? 2H)? 3.12 (m? 6H)? 4.55 (t? J = 6.62 Hz, 2H)? 7.57 (m? 2H) 5 7.66 (m5 1H) 5 7.8G (m5 1H) 5 7.95 (d? J = 8.09 Hz5 1H) 5 8.61 (dd5 J = 7.725 1.84 Hz, 1H), 8.90 (dd, J = 4.60, 1.65 Hz, 1H), 10.05 (s, 1H), 13.92 (s, 1H ). Example 81 1-cyclohexyl digasification-4H-1,2,4-benzopyrimidin-3-yl V4-hydroxy 89166 -278- 200427678

Pyridine-2 (1HV ketone example 81A 2- (cyclohexylamino) nicotinic acid ethyl ester The title compound was prepared according to the procedure of Example 3A, replacing cycloethylhexylamine with 2-ethylbutylamine (1.92 g, 61 %). MS (ESI +) m / z249.1 (M + H) +; iHNMR (300MHz, CDC13) (5 1.38 (m, 7H), 1.61 (m, 2H), 1/75 (m, 2H), 2.02 (m, 2H), 4.08 (m, 1H), 4.31 (q, J = 7.11 Hz, 2H), 6.46 (dd, J = 7.72, 4.78 Hz, 1H), 7.99 (d, J = 7.72 Hz, 1H), 8.10 (dd, J = 7.72, 2.21 Hz, 1H), 8.25 (dd, J = 4.78, 1.84 Hz, 1H).

Example 81B 1-Cyclohexyl-2H-pyrido, "2,3-dlfl, 31 Sakaki-2,4 (1HV dione title compound was prepared according to the procedure of Example 3B, replacing the product of Example 3A with the product of Example 3A (0.171 g, 35%). 1H NMR (300 MHz, CDC13) δ 1.37 (m, 4Η), 1.73 (m5 2Η), 1.91 (m, 2Η), 2.47 (ddd, J = 24 · 82, 12 · 32, 3.31 Ηζ, 2Η), 5.28 (tt, J = 12.27, 3.72 Ηζ, 1Η), 7.24 (dd, J = 6.99, 4.04 Ηζ, 1Η), 8.41 (dd, J = 7.72, 2.21 Hz, 1H), 8.70 (dd, J = 4.78, 2.21 Hz, 1H).

• Example 81C 1-lohexyl-3- (1,1-digasification-4H-1,2,4-benzo farepin-3-yl) -4-peryl-1,8 _2 (1HV) The compound with the same title was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 81B (0.073 g, 26%). MS (ESI +) m / z425.04 (M + H) +; iHNMRpOOMHz'DMSO-dg) (5 1.25 (m, 4H), 1.76 (m, 4H), 1.91 (s, 2H), 5.64 (s5 1H), 7.48 (dd5 J = 8.09, 4 · 78 Hz, 1H), 7.55 (t, J = 7.54 Hz, 1H), 7.69 (m, J = 8.09 Hz, 1H), 7.77 (m, 1H), 7.92 (d, J = 8.09 Hz, 1H) , 8.56 (dd, J = 200427678 8.09, 1.84 Hz, 1Η), 8.86 (d, J = 2.21 Hz, 1H), 14.12 (s, 1H). The sodium salt of the title compound is based on the procedure of Example ID Made. MS (ESI +) m / z 425.04 (M + H) +, 447.1 (M + Na) +; 1H NMR (300 MHz, DMSO-d6) 5 1 · 31 (m, 4H), 1.52 (d, J = 10.66 Hz, 2H), 1.63 (m, 2H), 1.83 (m, J = 12.50 Hz, 2H), 5.41 (t, J = 11.03 Hz, 1H), 7.11 (dd, J = 7.72, 4 78 Hz, 1H), 7.27 (m, 2H), 7.55 (m, 1H), 7.66 (d, J = 6.62 Hz, 1H), 8.37 (dd, J = 7.72, 2.21 Hz, 1H), 8.50 (dd , J = 4.60, 2.02 Hz, 1H), 15.94 (s, 1H) · Example 82 3- (l, l-dioxide-4H-1,2,4-benzopyrimidin-3-yl M-hydroxyl -l- "3- (4-morpholinoline) propyl barium hydrazone was prepared according to the procedure of Example 72, substituting morpholine for aniline (0.053 g 60%). MS ( ESI-) m / z 450 · The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300 MHz, DMSO_d6) 5 2.03 (m, 2H), 3.10 (m, 4H), 3.69 (m, 4H), 3.90 (m, 2H), 4.39 (s, 2H), 7.20 (dd, J = 7.72, 4.41 Hz, 1H), 7.30 (m, 2H), 7.58 (m, 1H), 7.68 (d, J = 7.72 Hz, 1H), 8.42 (dd, J = 7.72, 1.84 Hz, 1H), 8.55 (dd, J = 4.41, 1.84 Hz, 1H), 15.71 (s, 1H) • • Example 83 lacks- {[3- (1, Monoxide-4Η · 1,2,4-benzyl acetone · 3-pyl) -4-meryl-2-fluorinyl 1_ 丨 1 — f 7 pyridine- U2HV 1-Methyl-2-furancarboxylic acid A solution of the product of Example 75B (23 mg, 0.046 mmol) in THF (1 ml) was treated with INNaOH (0.2 ml) at room temperature. After 3 hours, the mixture was treated with H20 (5 ml), adjusted to pH 4 with 1 NHC1, and extracted with ethyl acetate (2 x 25 ml). The extract was washed with saturated NaCl, dried over anhydrous Na2S04, filtered, and concentrated. The resulting solid was purified on a Waters symmetry 89166 -280- 200427678 C8 column (25 mm x 100 mm, 7 micron particle size) and purified by preparative HPLC using 10% to 100% acetonitrile / 0.1% TFA in water. The gradient solution was passed through 8 minutes (10 minutes operation time) at a flow rate of 40 ml / min to obtain the title compound (0.039 g, 83%). MS (ESI-) m / z 465 (MH)-; 1H NMR (300 MHz, DMSO-d6) 5 5.72 (s, 2Η), 6.42 (d, J = 3.68 Ηζ, 1Η), 7. · 11 (d, J = 3.31 Hz, 1H), 7.53 (m, 2H), 7.68 (d, J = 7.72 Hz, 1H), 7.76 (m, 1H), 7.92 (d, J = 7.72 Hz , 1H), 8.60 (dd, J = 8.09, 1.84 Hz, 1H), 8.86 (dd, J = 4.78, 1.84 Hz, 1H), 13.90 (s, 1H). Example 84 Technical Base-3- (7 -Bromo-1,1-dioxide-4H_U, 4-benzopyrimidin-3-yl V4-fluorene-

1,8-xanthrimidine-2 (1HV ketone example 84A 2-amino-5- &gt; benzophenamine title compound was prepared from 4-bromo using the procedure described in JCSPerhTz 7, 1979, 1043 aniline.

Example 84B 1-fluorenyl-4-hydroxy-2-keto-1,2-dihydro-L8-piperidine-3-carboxylic acid ethyl ester in sodium hydride (60%, 0.118 g, 2-95 mmol) Diethyl malonate (0.472 g, 2-95 mmol) was added dropwise to the slurry in anhydrous dimethylacetamide (6 ml) at 0 ° C and N2 over 5 minutes. The mixture was stirred at ambient temperature for 1 hour, reacted with the product of Example 15A (0.50 g, 1.97 mmol), and heated at 120 ° C for 3 hours. The mixture was cooled to ambient temperature, and subjected to liquid separation between ethyl acetate and cold water, and the pH was adjusted to 5 with 1MHC1. The aqueous layer was extracted with ethyl acetate (2 X 100 ml), and the combined extracts were washed with brine 89166 -281-200427678, dried over magnesium sulfate, filtered, and concentrated under vacuum. The residue was recrystallized from methanol to give the title compound as a white solid (0.439 g, 68%). MS (ESI +) m / z 325.0 (M + H) +, 347.0 (M + Na) +; iHNMR (300MHz, DMSO-d6) 6 U0 (t, J = 7.17 Hz, 3H), 4.32 (q, J = 7.23 Hz, 2H), 5.55 (s, 2H), 7.23 (m, 5H), 7.37 (dd, J = 7.91, 4_60 Hz, 1H), 8.45 (dd, J = 7.91, 2.02 Hz, 1H), 8_71 (dd, J = 4.78, 1.84 Hz, 1H), 13.00 (s, 1H).

Example 84C N- "2- (Aminosulfofluorenyl V4-bromobenzyl 1-l-methylbenzyl-2-one-1,2-dihydro-1,8-piperidine-3-carboxyl The amidamine reacted the product of Example 84B (0.065 g, 0.20 mmol) with the product of Example 84A (0.050 g, 0.20 mmol) in toluene (4 ml) under reflux for 3 hours. The reaction was cooled, The precipitates formed were collected by filtration and dried to obtain the title compound as an off-white solid (0.074 g, 70%). MS (ESI +) m / z 528.9 (M + H) +? 530.9 (M + H ) +, 551.1 (M + Na) + 5 552.9 (M + Na) +; 1H NMR (300 MHz, DMSOd6) 5 5.67 (s, 2H), 7.23 (m, 2H), 7.29 (m, 3H) , 7.48 (dd? J-8.095 4.78 Hz5 1H), 7.69 (s? 2H)? 7.87 (dd? J = 8.82, 2.21 Hz, 1H)? 7.97 (m, 1H), 8.0J (d, J = 2.21 Hz , 1H), 8.55 (dd, J = 7.91, 1.65 Hz, 1H), 8.82 (dd, J = 4.60, 1.65 Hz, 1H), 12.44 (s, 1H), 16.45 (s, 1H).

Example 84D 1-Bromo-3- (7-bromo-1,1-digasification-4H_1,2,4_benzyl? Sepir-3_yl light base_ 1,8-Konai bite The mixture of the product of Example 84C (0.074 g, 0.14 mmol) in an aqueous solution of potassium hydroxide (10%, 5 ml) was heated to reflux for 16 hours, cooled to room temperature, and 6 M HC1 Adjust to pH 3. The mixture was filtered, and the filter cake was washed with 89166-282-200427678 water, triturated with tetrahydrofuran / water, filtered, and dried under vacuum to give the title compound (0.060 g, 84%). MS (ESI +) m / z 511.0 (M + H) +, 512.9 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 5.62 (s, 2H), 7.21 (m, 1H), 7.27 (m, J = 4.41 Hz, 5H), 7.36 (m, 1H), 7.50 (d, J = 8.82 Hz, 1H), 7.84 (dd, J = 8.82, 1.84 Hz, 1H) , 7.95 (s5 1H), 8_51 (dd, J = 7.91, 1_65 Hz, 1H), 8.68 (m, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI +) m / z 511.0 (M + H-Na) +5 512.9 (M + H-Na) +; 1H NMR (300 MHz, DMSO-d6) 5 5.52 (s, 2H), 7.17 (m, 2H), 7.24 (m, 5H) , 7.71 (m, 1H), 7.76 (d, J = 2.21 Hz 1H), 8.40 (dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.60, 2.02 Hz, 1H), 16.09 (s, 1H). Example 85 1 ^ yl-3- (1,1-Dioxide-7-phenyl-2H-1,2,4-benzoxanthione-3-yl) _4_ 罗 枝 基 _

1,8-kounanido-2 (1H) _Identical Example 85A N- "3- (Aminosulfofluorenyl V1J'-bibenzyl-4-ylH-fluorenyl-4-hydroxy-2-one The title compound -1,2_dihydro-1,8-Hydro-3-hexamidine was substituted for 2-amino-5 by 2-amino-5-phenylbenzenesulfonamide according to the procedure of Example 84C. -Bromosulfenylamine (0.084 g, 79%). MS (ESI +) m / z 527.1 (M + H) + 5 549.1 (M + Na) + #; 1H NMR (300 ΜΗζ5 DMSO-d6) 5 5.68 (s5 2H) 5 7.2-7.8 (m3 13H)? 7.98 (s5 1H) 5 8.09 (s? 1H) 5 8.17 (s? 1H) 5 8.54 (s, 1H), 8.81 (s, 1H), 12.49 (s, 1H), 16.67 (s, 1H).

Example 85B 1-benzyl-3- (l, l-digasified-7-benzyl-2H-1,2,4-benzilopyrimidin-3-yl) -4-hydroxy-1,8- The pyridine-2__one title compound was prepared according to the procedure of Example 84D, using the product of Example 85A and 89166 -283-200427678 of the product of Example 84C (0.055 g, 69%). MS (ESI +) m / z 509.1 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 5.71 (s, 2H), 7.24 (m, 1H), 7.30 (m, 3H), 7.49 (m, 4H), 7.79 (m, J = 7.35 Hz, 3H), 8.07 (m, J = 11.03, 2.21 Hz, 2H), 8.60 (dd, J = 7.91, 1.65 Hz, 1H), 8.81 (m, J = 3.68 Hz, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI +) m / z 531.0 (M +), 509.1 (M-Na + H) +; 1H NMR (300 MHz, DMSO-d6); 5.53 (s? 2H) 5 7.17 (m5 2H), 7.25 (m, J = 4.41 Hz, 4H), 7.39 (m, 2H), 7.49 (t, J = 7.54 Hz, 2H), 7.71 (d, J = 6.99 Hz, 2H), 7.89 (m, 2H), 8.42 ( dd, J = 7.72, 1.84 Hz, 1H), 8.49 (dd, J = 4.60, 2.02 Hz, 1H), 15.99 (s, 1H) _ Example 86 radical-3- (7_cyclohexyl-U-II Gasification -4H-1,2,4-benzilopyrimidin-3_yl V4-hydroxy-

Example of 1,8-kounanido-2 (1 H) -one 86A 2-Amino-5-¾hexylbenzyl amine makes 4-cyclohexylaniline (0.877 g, 5.0 mmol, ΐ · equivalent) The solution in nitroethane (5 * liters) was cooled to -40 ° C, and treated with chloroisocyanate (0.87 g (0.523 φ liter, $ 15 mmol, 1.23 eq)) dropwise. Heat to 0.000, treat with aluminum dichloride (0.85 g, 6.35 mmol, 1.27 eq.), Heat in an oil bath at ii ° C for 30 minutes, cool to ambient temperature, and pour 200 ml of ice The mixture was filtered, and the filter cake was rinsed with cold water, dissolved in 50% 112804 (25 ml), heated to reflux, cooled to ambient temperature over 4 hours, and poured into 200 liters of ice water. And carefully neutralized with 40% NaOH to pH 7. The reaction mixture was extracted with ethyl acetate (3 x 100 ml), and the combined extracts were washed with brine, dried (MgSOd, filtered, and concentrated, and 0.40 g of the desired product was obtained 89166 -284-200427678 (31% yield). MS (ESI +) m / z 255.0 (M + H) +, 272.1 (M + H2 0) +, 277.0 (M + Na) +; 1HNMR (300 MHz, DMSO-d6) 51.32 (m, 4H ), 1.71 (m, 6H), 2.36 (m, 1H), 5.64 (s5 2H), 6.72 (d, J = 8.09 Hz, 1H), 7.11 (dd, J = 8.46, 2.21 Hz, 1H), 7.16 (s, 2H), 7.38 (d, J = 2.21 Hz, 1H).

Example 86B N_ "2_ (Yueanji Stone Spring Awake Group) -4-Ethylhexylphenyl &quot; | _1-fluorenylzine 4-meryl_2-fluorenyl-1,2-diaza-1,8- The title compound of Naiyuan-3-Lengsheng Shengyue'an was prepared according to the procedure of Example 84C, and the product of Example 86A was taken from Lumino 2-amino-5-bromobenzenesulfonamide (0.081 g, 76%). MS ( ESI +) m / z 533 · 1 (M + H) +, 555.2 (M + Na) +; 1H NMR (300 MHz, DMSO_d6) 51.27 (m, 1H), 1.45 (m, 4H), 1.72 (m, 1H ), 1.85 (m, 4H), 2.61 (m, 1H), 5.68 (s, 2H), 7.26 (m, 4H), 7.50 (m, 4H), 7.76 (d, J = 1.84 Hz, 1H), 7.86 (d, J = 8.46 Hz, 2H), 8.54 (dd, J = 8.09, 1.47 Hz, 1H), 8.80 (s, 1H), 12.31 (s, 1H), 16.78 (s, 1H) ·

Example 86C 1 ~~ τ ^ -3- (7-¾ ^ ^ 4b ^ ^) -4-¾-1,8-4 Pyridin-2 (1HV ketone · The title compound was prepared according to the procedure of Example 84D, using Example 86B. The product was replaced by the product of Example 84C (0.040 g, 53%). MS (ESI +) m / z 533.1 (M + H + H2 0) +, 555.1 (M + H2 0 + Na) +, 515.1 ( M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 1.34 (m, 5H), 1.77 (m, 5H), 2.60 (m, 1H), 5.66 (s, 2H), 7.25 (m, 4H ), 7.51 (m, J = 9.56 Hz, 4H), 7.88 (s, 1H), 8.54 (s, 1H), 8.80 (s, 1H), 12.31 (s, 1H), 16.78 (s, 1H). The sodium salt of the compound was prepared according to the procedure of Example ID. IHNMRpOOMH ^ DMSO-A) 5 1.41 (m, 5H), 1.70 (m, 5H), 3.79 (m, 1H), 5.52 (s, 2H), 7. · 12 (dd5 J = 7.54, 4.60 Hz, 1H), 7.17 (m, 1H), 7.23 (m, 4H), 7.41 89166 -285-200427678 (dd, J = 8.64, 2 · 02 Hz, 1H ), 7.67 (d, J = 2.21 Hz, 1Η), 8.33 (d, J = 8.46 Hz, 1H), 8.38 (dd, J = 7.72, 1.84 Hz, 1H), 8.43 (dd, J = 4.60, 2.02 Hz, 1H), 11_15 (s, 1H) · Example 87 1-4yl-3_ (7-tertiary-butyl-1,1-dioxide-4H-1,2,4-benzofuran? Well-3_base Preparation -4-

-1,8-piperidine-2 (1HV ketone example 87A N- "2- (amino group S stiltyl) -4-second-butylbenzyl-1-yl-4-meryl- 2-S Iso-1,2_diazide-1,8-Tide Lake-3-Fructus hydrazine The title compound was prepared according to the procedure of Example 84C using 2-amino-5-tert-butylbenzenesulfonate Amidoamine was prepared by substituting 2-amino-5-bromobenzenesulfonamide (0.072 g, 79%). MS (ESI +) m / z 507.12 (M + H) +, 524.2 (M + H2 0) +, 529.1 (M + Na) +; 1H NMR (300 MHz, DMSO-d6) 5 1 · 33 (s, 9H), 5.68 (s, 2H), 7.22 (m, 1H), 7.29 (m, J = 3.68 Hz , 4H), 7.47 (m, 3H), 7.70 (dd, J = 8.64, 2.39 Hz, 1H), 7.88 (d, J = 8.82 Hz, 1H), 7.91 (d, J = 2.21 Hz, 1H) , 8.54 (dd, J = 8_09, 1.84 Hz, 1H), 8.81 (dd, J = 4.60, 1.65 Hz, 1H), 12.33 (s, 1H), 16.79 (s, 1H).

Example 87B 1-Benzyl-3- (7-Third-Butyl-1, l-Digas-4H-1,2,4-benzopyrimidin-3-yl) -4-hydroxy-1 The 8-piperidine-2 (1H) -one title compound was prepared according to the procedure of Example 84D, substituting the product of Example 87A with the product of Example 84C (0.040 g, 100%). MS (ESI +) m / z 489.1 (M + H) +5 511.1 (M + Na) +; 1H NMR (300 MHz? DMSO-d6) 5 1.34 (s59H)? 5.70 (s, 2H), 7.22 (m, 1H), 7.29 (m, J = 4.41 Hz, 4H), 7.48 (m, 1H), 7.59 (d, J = 8.82 Hz, 1H), 7.75 (s, 1H), 7_81 (d, J = 10.66 Hz, 1H), 8.58 (d, J = 6.62 Hz, 1H), 8.79 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example id. 89166 -286- 200427678 1 H NMR (300 MHz, DMSO-d6) δ 1 _32 (s, 9H), 5.53 (s, 2H), 7.18 (m, 2H), 7.25 (m, J = 4.41 Hz, 5H), 7.59 (s, 1H), 7.65 (m, 1H), 8.42 (d, J = 7.35 Hz, 1H), 8.50 (m, J = 3.86, 2.02 Hz, 1H) Example 88 1-fluorenyl-4-hydroxy-3-Γ7-methyl-U-dioxide-4H-1 and 4-benzylpyridine, each radical 10-pyridin-2 (1HV ketone

Example 88A N- "2- (Cycloylamino) -4-methylphenyl 1-l- + yl-4-yl, 2-pyridyl-1,2-diaza-1, The title compound of 8-Nyanodine-3-amine was prepared according to the procedure of Example 84C, substituting 2-amino-5-toluenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.075 g , 90%). MS (ESI +) m / z 465.1 (M + H) +, 482.0 (M + H2 0) +, 487.1 (M + Na) + · 1H NMR (300 MHz, DMS0-d6) 5 2.39 ( s, 3H), 5.68 (s, 2H), 7.23 (m, 1H), 7.29 (m, 4H), 7.47 (m, 4H), 7.73 (d, J = 1.47 Hz, 1H), 7.84 (d, J = 8.09 Hz, 1H), 8.54 (dd, J = 7.72, 1.84 Hz, 1H)? 8.81 (dd5 J = 4.60, 1.65 Hz? 1H)? 12.30 (s? 1H)? 16.78 (s? 1H ).

Example 88B

1-fluorenyl hydroxy-3-Γ7-methyl-1,1-digasification-4H-1,2,4-benzylpyridine, each radical V 1,8 It was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 88A (0.031 g, 42%). MS (ESI +) m / z 447.0 (M + Η) +, 469.1 (M + Na) + · 1H NMR (300 MHz, DMS0-d6) (5 2.41 (s, 3Η), 5.65 (s, 2H) , 7.24 (m, 5H), 7.45 (m, 3H), 7.66 (s, 1Η), 8.54 (d, J = 7.72 Hz, 1Η), 8.72 (s, 1H) · of the title compound The sodium salt was prepared according to the procedure of Example ID: 1H NMR (300 MHz, DMS0-d6) 5 2.37 (s, 3H), 5.55 (s, 2H), 7.21 (m, 7H), 89166 -287- 200427678 7.41 (d, J = 8.46 Hz, 1Η), 7.51 (s, 1Η), 8.43 (d, J = 8.09 Hz, 1Η), 8.53 (s, 1H) · Example 89 1- Butyl-3- (6-chloro-1,1-dioxide-4H1,2,4-benzyl-p-di ^ f-3-yl) · 4-boryl-

1,8-pyridine, 2aHVi Same as Example 89A 1-Butyl_4_starting group_2_keto_1,2_dihydro H tea appetite 3-Ethyl acetic acid is intended for NaH (95%, 0 · 44 g, 18.2 mmol) in a slurry of 15 ml of anhydrous DMA, at 10 ° C and N2, add diethyl malonate (2.9 g, 18.2 mmol) dropwise over 10 minutes ear). The mixture was stirred at ambient temperature for 30 minutes, treated with the product of Example 1B (2.0 g, 9.1 mmol), and heated at 120 ° C for 3 hours. The mixture was allowed to cool to ambient temperature, and was separated between ethyl acetate and cold water, and the pH was adjusted to 5 with 1M HC1. The organic layer was washed with 2 x 100 ml of water, 2 x 100 ml of saturated brine, dried (2, ^ 2804), filtered 'and the filtrate was concentrated under vacuum. The residue was burned / ethyl acetate and recrystallized to give the desired compound as a white solid (184 g, 70% yield). MS (APCI +) m / z 291 (M + H) '

-Example 89B M.:[2-(Aminosulfonyl)-4-chlorobenzyl~μ • Dingmou_4_iaoyl_2_ketomou-u-dihydro-M · -3- # si腙 A mixture of the product of Example 89A (87 mg, 0.3 mmol) and amidochlorosulfazone (62 mg, 0.3 mmol) in toluene (5 ml) was refluxed for 16 hours, cooled, and borrowed The formed precipitate was collected by filtration, and dried to give the desired amidine as an off-white solid (80 mg, 59% yield). MS (Apci +) m / z 451 (M + H) +. 89166 -288- 200427678

Example 89C 1-butyl-4-Ethyl-2-fluorenyl-1,2-diazonato-3-acetic acid ethyl ester The title compound was prepared in accordance with the procedure of Example 84C 'and replaced Example 84B with the product of Example 89B. Made from the product (0_037 g, 53%). MS (ESI-) m / z 431 (M-H)-· The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) 5 0.93 (t, J = 7.17 Hz, 3H), 1.34 (m, 2H), 1.58 (m, 2H), 4.27 (m, 2H), 7.14 (dd, J = 7.72, 4.78 Hz, 1H), 7.32 (dd, J = 8.27, 2.02 Hz, 1H), 7.42 (d, J = 1.84 Hz, 1H), 7.68 (d, J = 8.46 Hz, 1H), 8 37 (dd, J = 7.54, 2.02 Hz, 1H), 8_54 (dd, J = 4_78, 1.84 Hz, 1H), 16.09 (s, 1H). Example 90 1-Hanyl-3- (8-bromo -5-methyl-1,1-digasification-4H-1? 4-benzyl-p-di-di-p-well-3-yl) -4-

Hydroxyl-1,8-4pyridin-2 (1HV ketone example 90A N- "2- (amino alkalyl) Shibian j-6 · methylphenyl l_im_yl_2_ketodi &quot; nitrogen The title compound was prepared according to the procedure of Example 84C, substituting 2-amino-5-bromo and tosylsulfonamide in place of 2-amino-5-bromobenzenesulfonamide. The crude title compound was obtained (0.1 g, 98%). Example 90B Mouth opened 〇- 丞 j- 外 -1 1-fluorenyl-3- (8-bromo-5 ^^ _ U_. 1 group-1, The 8-biting title compound was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example. The crude product was purified by column chromatography with silica gel, and dichloromethane and methanol (98: 2) Dissociation to obtain the title compound, 89166 -289- 200427678 as a white solid (0.03 g, 31% yield). MS (ESI-) m / z525 (M-Η) · Sodium salt of the title compound Prepared according to the procedure of Example ID. 1 η NMR (300 MHz, DMSO-d6) δ 16.0 (br s, 1H), 8.49 (dd, J = 4.8, 1.8 Hz, 1Η), 8.44 (dd, J = 7.7, 1.8 Hz, 1H), 7_45 (br s, 1H), 7.37 (m, 1H), 7_23 (m, 3H), 7.16 (dd, J = 4.8, 3.3 Hz, 1H), 7.01 (m 1H), 6.85 (d, J = 7.7 Hz, 1H), 5.53 (br s, 2H), 2.43 (s, 3H). Example 91 Rodyl-3- (8-syl-5-methyl-1, 1-digasification-4Η-1 · 2,4_benzyl π plug diin-3-yl V4_

Base-1,8 · ^ naiki _2 (1HV ketone Example 91A

Mj2- (Amino acid group)> 3-Amino-6-methylbenzyl 1_1_fluorenyl-4_transyl-2-keto-1,2-shihydro-1, 8_ reading- 3- # The title compound was prepared according to the procedure of Example 84C by substituting 2-amino-6-fluoro-3-toluenesulfanilide for 2-amino-5-bromobenzylamine to obtain a crude product. The title compound (0.120 g, 100%). Example 91B-3- (8_-Fluoro-5-methyl_1,1-dioxide_411-1.24_benzypyrimidine-3-yl) -4 -A diphenyl-1,8-pyridine-2 (lHVi compound with the same title was prepared according to the procedure of Example 84D, replacing the product of Example 91A with the product of Example 91A. The crude product was subjected to column chromatography with silica gel. Purification, dissociation with dichloromethane and methanol (98: 2) as a white solid (0.05 g, 44/6 yield). MS (ESI-) m / z 463 (M-.). Steel of the title compound The salt was prepared according to the procedure of Example 1D. IHNMR (300 MHz, DMSO-d6) 3 16.1 (brs, 1H), 8.49 (dd, J = 4.6, 2.0 Hz, 1H), 8.44 (dd, J = 7.7, 1.8 Hz, 1H), 7.59 (m, 1H), 7.47 (dd, J = 7.3, 5.8 Hz, 1H), 7.38 (m, 1H), 7.21 (m5 3H), 7.16 (dd5 J = 7.7, 5.8 Hz, 89166 -290- 200427678 1H) 6.99 (t, J = 8.8 Hz, 1H), 5.53 (s, 2H), 2.42 (s, 3H) , 1-dioxide-4H-1,2,4-benzophenone diyl-3-yl) _ 1.8- xanazidine_2 (1HV ketone

Example 92A N- "2-(^ | AcetidineS Shengji) -6-Isopropylbenzyl-4-Centyl-2-Alkyl-1,2-diazine-1,8_Nayodo- 3-Weiyue Yuean The title compound was prepared in accordance with the procedure of Example 84C by substituting 2-amino-5-isopropylbenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide and chromatography on silica gel ( Made with 4: 1 hexane / ethyl acetate) (0.050 g, 55%). IHNMRpOOMHz, DMSO-d6) 5 ^ NMRCSOOMH ^ DMSO-dg) ά 1.12 (d5 J = 6.62 Hz, 3Η) 5 1.26 (d, J = 6.99 Hz, 3H), 3.06 (m, 1H), 5.69 (m, 2H), 7.27 (m, 5H), 7.39 (s, 2H), 7.48 (dd, J = 7.72 , 4.78 Hz, 1H), 7.55 (t, J = 7.72 Hz, 1H), 7.71 (d, J = 8.09 Hz, 1H), 7.80 (dd, J = 7.72, U0 Hz, 1H) , 8.53 (dd, J = 7.91, 1.65 Hz, 1H), 8.83 (dd, J = 4.78, 1.84 Hz, 1H), 11.75 (s, 1H), 16.83 (s, 1H).

Example 92B

1-fluorenyl-4-hydroxy-3- (5-isopropyl-U-digasified-4H-1,2,4-benzilopyridine_3_some V 1.8-piperidine-2 fluorenone The compound was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 92A (0.038 g, 75%). MS (ESI +) m / z475.1 (M + H) '492 · 1 (M + H2 0) +, 497.1 (M + Na) + · 1H NMR (300 MHz, DMSO-d6) 5 1.34 (d, J = 6.62 Hz, 6H), 3.30 (m, 1H), 5.73 (s, 2H), 7.27 (m, 5H), 7.54 (m5 2H), 7.78 (m, J = 16.18, 7.72 Hz, 2H), 8.62 (dd, J = 7.91, 1.65 Hz, 1H), 8.84 (s, 1H ), 14.64 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID 89166 -291-200427678. iHNMRpOOMHADMSOO 5 1.32 (d, J = 6.62 Hz, 6H), 3.42 (m, 1H), 5 · 53 (s, 2H), 7.15 (m, 2H), 7.25 (m, J = 4.41 Hz, 4H), 7.29 (m, 1H), 7.53 (m, J = 7.72, 1.84 Hz, 2H), 8.46 (m, 2H), 16.06 (s, 1H). Example 93

1-fluorenyl-4-hydroxy-3- (5-methyl-1,1-digasification-4H-1,2,4_jalopyridine_3_yl V

1,8-Pyridin-2 (1HV ketone example 93A N- "2- (Amino group) -6-methylphenyl &quot; | Smallyl-4-superyl-2-61¾yl-1, The title compound of 2-diazepine_1,8_naphthalene-3_phosphonate was substituted for 2-amino-5-bromobenzenesulfonylamine by 2-amino-3-toluenesulfonamide according to the procedure of Example 84C. Amine (0.059 g, 100%). IHNMR (300 MHz, DMSO-d6) δ 2.27 (s? 3Η) 5.68 (m5 2H) 7.24 (m? 5H) 7.46 (m5 4H) 7.59 (d, J = 6.99 Hz, 1H) 7.79 (d, J = 7.72 Hz, 1H) 8.54 (dd, J = 8.09, 1.84 Hz, 1H) 8.83 (dd, J = 4.78, 1.84 Hz, 1H) 11.90 (s, 1H) 16.79 (s, 1H).

Example 93B 1-fluorenyl_4-faloyl-3 · (5 · methyl_1,1-dioxo-4H-1,2,4-benzophenone plug two well_3_yl V, 1 , 8-xanthrimidine_2 (The title compound of 1Ηvone was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 93A, and then preparing it by silica gel chromatography (solved with 98: 2 dichloromethane / methanol). (0.015 g, 25%). MS (ESI +) m / z447.0 (Μ + Η) +, 469.1 (M + Na) +. 1H NMR (300 MHz? -D6) δ 2.52 (m? 3H) 5.75 (m? 2H) 7.23 (m5 1H) 7.30 (m, 4H) 7.47 (t, J = 7.72 Hz, 1H) 7.53 (dd, J = 8.09, 4.78 Hz, 1H) 7.69 (d, J = 7.35 Hz, 1H) 7.79 (d, J = 8.09 Hz, 1H) 8.63 (dd, J = 7.72, 1.84 Hz, 1H) 8.85 (dd, J = 4.78, 1.84 Hz, 1H) 14.41 (s, 1H) · Title The sodium salt of the compound was prepared according to the procedure 89166-292- 200427678 case ID. 1H NMR (300 MHz, DMSO-d6) δ 2 · 48 (s, 3H) 5.56 (s, 2H) 7.21 (m, 6H) 7.49 (d, J = 7.35 Hz, 1H) 7.56 (d, J = 7.35 Hz, 1H) 8.47 (d, J 7.72 Hz, 1H) 8.53 (s, 1H) 11.98 (s , 1H). Example 94 1-fluorenyl-3- (5-bromo-U-digasified-4H-1,2,4-benzopyrene-3-yl) -4_hydroxy - one 1,8-port nalidixic -2_-

Example 94A N- "2- (Aminosulfosulfonium V6-bromobenzyl 1-l-fluorenyl-4-hydroxy-2-keto-1,2-dihydro-1,8- The title compound of 3-Furic acid Yuet An was substituted with 2-amino-3-toluidinesulfonamide in accordance with the procedure of Example 84C, and was subjected to silica gel chromatography (2: 1 Hexane / ethyl acetate was dissolved (0.080 g, 25%). MS (ESI +) m / ζ 529 · 0 (M + H) +, 530.9 (M + H) + · 1H NMR (300 MHz, DMSO-d6) 5 5.71 (m, 2H) 7.23 (m, 1H) 7.32 (m, 4H) 7.50 (m, 2H) 7.62 (s, 2H) 7.96 (dd, J = 7.91, 1.29 Hz, 1H) 8.02 (dd, J = 7.91, 1.29 Hz, 1H) 8.55 (dd, J = 7.91, 1.65 Hz, 1H) 8.85 (dd, J = 4.78, 1.84 Hz, 1H) 11.95 (s, 1H) 16.51 (s, 1H ) · #

-f Example 94B 1-fluorenyl-3- (5-bromo-1,1-digasification-4H-1,2,4-benzylpyrene-3-yl M-hydroxy-1,8- Kou Naina_2 (1HV) The compound with the same title was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 94A (0.040 g, 54%). MS (ESI +) m / z 510.9 (M + H) +, 512.9 (M + H) VHNMR (300 MHz, DMS 0-d6) (5 5.56 (s, 2H) 7.23 (m5 8H) 7.76 (d, J = 8.46 Hz, 1H) 7.94 (d, J = 8.09 Hz, 1Η) 8.46 (dd, J = 7.72, 1.84 Hz, 1H) 8.55 (m, 1H) 16.17 (s, 1H) · The sodium salt of the title compound is based on the actual 89166 -293-200427678 cases ID program. IHNMR (300MHz, DMSO-d6) (5 5.53 (s, 2H) 7.17 (m, 2H) 7.25 (m, 5H) 7.71 (d, J = 6.99 Hz, 1H) 7.90 (m , 1H) 8.43 (dd, J = 7.72, 1_84 Hz, 1H) 8.49 (dd, J = 4.60, 2.02 Hz, 1H) 16.38 (s, 1H). Example 95 1-fluorenyl-3- ( 1,1-dihydro_5-propyl_2H_1,2,4-benzo4dioxen-3-yl) -4-hydroxy-

1,8-kounanido-2 (1H) -Identical Example 95A N- "2- (aminosulfonyl) each propylbenzyl H-fluorenyl-4-hydroxy-2-one-1 , 2-Dihydro-1,8-¾: pyridin-3-carboxamide The title compound was prepared in accordance with the procedure of Example 84C, replacing 2-amino-5-bromo with 2-amino-3-propanesulfonamide Benzsulfonamide (0.062 g, 59%). MS (DCI / NH3) m / z 493 (M + H) +. 1H NMR (300 MHz, DMSO-d6) 5 0 · 83 and 0.93 (two T, J = 7.35 Hz, 3H), 1.57 (m, 2H), 2.57 (m, 2H), 5.66 (m, 2H), 7.28 (m, 5H), 7.41 (s, 2H), 7.48 (m, 2H), 7.61 (m, 1H), 7.81 (dd, J = 7.72, 1.47 Hz, 1H), 8.53 (dd, J = 7.91, 1.65 Hz, 1H), 8.83 (dd, J = 4.78, 1.84 Hz, 1H), 11.82 (s, 1H), 16.80 (s, 1H) ·

An example 95B 1-fluorenyl-3- (1,1-dihydro-5-propyl-2H-1,2,4-benzopyrimidin-3-yl V4-hydroxy-L8-4 pyridin-2 (The 1HV ketone title compound was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 95A (0.029 g, 50%). MS (ESI-) m / z 473 (MH) ·· The title compound The sodium salt was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) δ 1.03 (t, J = 7.17 Ηζ, 3Η), 1.68 (m, 2Η), 2.83 (t, J = 7.72 Hz, 2H), 5.53 (s, 2H), 7.19 (m, 7H), 7_44 (d, J = 6.25 Hz, 1H), 7.53 (d, J = 89166 -294- 200427678 7.35 Hz, 1H) , 8.43 (dd, J = 7.54, 1.84 Hz, 1H), 8.48 (dd, J = 4.78, 1_84 Hz, 1H), 16.02 (s, 1H). Example 96 1-fluorenyl-3- (5 · "Γ" -_ U-digasification_4H-U, 4-benzylpyridine di-U-yl) + hydroxyl-

1,8-Xanthonyl-2 (1HV ketone example 96A N- "2- (amino group continued | Sheng group V6-ethylbenzyl 1-l-fluorenyl-4-j% group The 1,2-a rat- 1,8-Nayodo-3-rime Yingyuean titled the compound according to the procedure of Example 84C, replacing 2-amino-5 with 2-amino-3-ethylbenzoic acid amine -Bromosulfenylamine (0.070 g, 74%). MS (ESI-) m / z479 (M + H) +. ^ NMRCSOOMHz ^ DMSO- ^) δ 1.17 (t? J = 7.54Ηζ? 3Η ) 5 2 · 61 (q, J = 7.60 Ηζ, 2Η), 5.70 (m, 2Η), 7.27 (m, 5Η), 7.42 (s, 2Η), 7.49 (m, 2Η), 7.63 ( m, 1H), 7.81 (dd, J = 7.91, 1.29 Hz, 1H), 8.53 (dd, J = 7.91, 1.65 Hz, 1H), 8.83 (dd, J = 4.41, 1.84Ηζ, 1H ), 11.82 (s, 1H), 16.80 (s5 1H).

Example 96B 1-Ethyl- (5-ethyldigasified-4 ^, 2,4,4-benzopyridin-3-yl M-hydroxy--1,8-xanthridin-2 (1Ηνone The title compound was prepared in accordance with the procedure of Example 8 and substituting the product of Example 96A with the product of Example 84C (0.060 g, 93%). MS (ESI-) m / z459 (MH) _ · Sodium salt system of the title compound Prepared according to the procedure of the example ID. 1HNMR (300MHz, DMSO-d6) 5 1 · 30 (t, J = 7.54 Hz, 3H), 2.86 (q, J = 7.35 Hz, 2H), 5.53 (s5 2H) , 7.14 (dd, J = 7.72, 4.78 Hz, 1H), 7.22 (m, 6H), 7.46 (d, J = 7.72 Hz, 1H), 7.53 (d, J = 7.72 Hz, 1H), 8.44 ( dd, J = 7.72, 1.84 Hz, 1H), 8.48 (dd, J = 4.78, 1.83 Hz, 1H), 15.98 (s, lH) 89166 -295-200427678 ϋϋ j 土 1-; Jibinghanji-2 .. radical-1 ^^ hydrogen-u-pyridinyl radicals WH4 · 2 · 4 · phenylpyridine S-lf dioxide The product of Example 94B (0.329 g, 0.63 mmol) and CuCN (〇 • 29 g, 3.21 mmol) were heated in anhydrous DMF (5 ml) under N2 &amp; 14yc for 22 hours. The reaction was cooled to room temperature, and CH2C12 (50 ml) and 1NHC1 aqueous solution (10 ΐ) L) dilution It was stirred vigorously for 15 minutes. The layers were separated and the aqueous phase was extracted with ch2Cl2 (2x50 liters). The organic extract was washed with IN HC1 aqueous solution (20 ml) and saturated NaCl aqueous solution, and then dried over anhydrous Na2S04. After filtration and concentration by rotary evaporation, the residue was purified by silica gel flash chromatography (2.5 x 14 cm, 5% EtOAc / CH2Cl2) to obtain the title compound (0.136 g, 46%). MS ( ESI-) m / z 456 (Μ-Η) _ · 1H NMR (300 MHz, DMSO-d6) 5 5.69 (s, 2Η) 7.26 (m, 5Η) 7.47 (dd, J = 7.91 , 4.60 Ηζ, 1Η) 7.62 (t, J = 7.91 Ηζ, 1Η) 8.25 (m, 2H) 8.59 (dd, J = 7.91, 2.02 Hz, 1H) 8.80 (dd, J = 4.60, 1.65 Hz, 1H) 15.67 (s,

1H) The sodium salt of the title compound was prepared according to the procedure of Example id. 1H NMR (300 MHz, DMSO-d6) (5 5 · 53 (s, 2H) 7.20 (m, 6H) 7.41 (t, J = 7.91 Hz, 1Η) 8.00 (d, J = 7.35 Hz, 1H) 8.07 (d, J = 7.72 Hz, 1H) 8.43 (dd, J = 7.54, 1.65 Hz, 1H) 8.51 (dd, J = 4.60, L65 Hz, 1H) 17.35 (s5 1H). Example 98 1 -Butyl-3_ (1,1-digasified-4H_pyridol ~ 3,2-ell ~ L2,4 &gt; Selecyl-3-yl) -4-hydroxy-

2 [1HV quinolinone example 98A 3_nitropyridine_2-thiol 2_thiol-3-nitro p ratio lake system is prepared in the following manner, 3-nitro-2-chloro 4 ratio lake 89166 -296- 200427678 (50 g, 0.0317 mole) treated with thiourea (24 g, 0.0317 mole) in 200 ml of ethanol under reflux for several hours. After the reaction mixture was allowed to cool, 7.19 ml of a KOH solution (42.8 g in 115 ml of water) was added, and the resulting mixture was heated under reflux for 3 hours. The crude reaction mixture was cooled to room temperature and then concentrated in vacuo to 50% of its volume. After dilution with 300 ml of water, the product was isolated by vacuum filtration as an orange solid, which was used without further purification. MS (DCI / NH3) m / z 157 (Μ + Η) + · 1H NMR (300 MHz, DMSO-d6) 5 5.76 (m, 1Η), 7.67 (dd, J = 8.46, 4.78 Ηζ, 1Η) , 8.63 (dd, J = 8.46, 1.47 Ηζ, 1Η), 8.73 (dd, J = 4.60, 1.65 Ηζ, 1Η) · Example 98B 3-Aminopyridine-2 · The stilbene isoamine title compound ( According to the procedure of R. Lejeune and co-investigators, according to the price package, double 217-224, 1 ^ 34, in 3 steps (80% Yield), prepared from 2-Mirror-3-nitroρ specific bite. MS (DCI / NH3) m / z 174 (M + H) + · 1H NMR (300 MHz, DMSOd6) δ 6.00 (s? 2H) 3 7.25 (m? 2H) 5 7.34 (s, 2H), 7.82 (dd , J = 4.04, 1.47 Hz, 1H).

Example 98C N- "2- (Meananyl picolinyl group V than yodo-3-yl 1-butyl-4-j% group [yl-i, 2-dihydrocycloquinine Plin-3- The titled amidoamine compound was prepared according to the procedure of Example 89B by substituting 2-amino-4-chlorobenzene for 3-amine-bitan-2-amino acid to test amine.

Example 98D 1-Butyl-3- (1,1-dioxo-4H-4H-Hubeiyodo | ~ 3,2-e ~ 1 "1,2,4 &gt; Saixinsan"! Well-3- ) -4- # fluorenyl-2qHV quinolinone 89166 -297- 200427678 The title compound was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 98C. It was a white solid (0 065 g, 22 %). MS (ESI-) m / z 397 (MH) '; 1H NMR (300 MHz, DMSO-d6) δ 0.96 (t5 J = 7.35 Hz? 3H) 5 1.46 (m, 2H), 1.66 (m, 2H), 4_34 (m, 2H), 7.46 (t, J = 7.54 Hz, 1H), 7_82 (m, 3H), 8.23 (d, J = 6.99 Hz, 1H), 8.26 (d, J = 7 · 72 Hz, 1H), 8.70 (d, J = 3.68 Hz, 1H), 14.38 (s, 1H), 15.12 (s, 1H). Example 99 1-fluorenyl-3- (1,1-digasification- 411-Pyrido "3,2 &lt; 1" 1,2,41 succinyl-3-yl) -4- # fluorenyl_ 2 (1Η) -τ4 酉 Same as the example 99A 1-fluorenyl-4-jing The title compound was based on the procedure of Example 84B with μbenzyl-1pyrene-benzo [d] [l, 3] -2,4-dione was prepared in place of the product of Example 15A.

Example 99B N- "g: (Amine 碁 .continuyl group)> Biyodo-3-yl 1 -1-yl-4 as the base_2-one -1,2-di &amp;. 4 嗾 -3 -The title compound of the double acid amine was according to the procedure of Example 84C, replacing the product of Example 84B with the product of Example 99A and replacing 2-amino_5-bromobenzene with (3 · amino-ether) Sulfonamide was prepared to obtain the crude product as an off-white solid.

Example 99C 1-Benzene-pyrene dioxide-4H-pyrido | ~ 3,2-eiri24 &gt; t Erqian V4-Miaoqi_ 2 (1HV4 4 ketone The title compound was replaced by the product of Example 99B according to the procedure of Example 84D Example 84C (0.076 g, 38%). IHNMR (300 MHz, 89166 -298-200427678 DMSO-d6) 5 5.64 (s, 2H), 7.29 (m, 5H), 7.43 (m , J = 7.72, 7.72 Hz, 1H), 7.54 (d, J = 8.46 Hz, 1H), 7.80 (m, 2H), 8.23 (m, 2H), 8.69 (d, J = 3.31 Hz, 1H). Example 100 1-Benzyl "3- (1,1-digasification · 4Η-pyrido | ~ 3,2-el" 1,2,41 pyrimidine-3-yl V4-hydroxy-

Example of 1,8-pyridine-2 fluorenone 100A Amino stone κ group V than lake 3-yl 1- 1-fluorenyl-4- mesityl_2_fluorenyl-1,2-diaza-1,8_ The peak lake-3-leptaamine was prepared according to the procedure of Example 84C, substituting 2-amino-5-bromobenzenesulfonamide with 3-amino-pyridine-2-sulfonamide. MS (ESI-) m / z 452 (M + H) +. 1H NMR (300 MHz, DMSO-d6) 6 5.66 (s, 2H), 7.22 (m, 1H), 7.28 (m, 3H), 7.43 ( nUH), 7.70 (m, 3H), 8.52 (m, 2H), 8.77 (s, 3H), 12.56 (s, 1H), 16.34 (s, 1H).

Example 100B Budyl-3- (1,1_digasified-4spyridino | &quot; 3,2 &lt; 1 | &quot; 1,2,4 &gt; Serengeng-3_based) _4_ # Base-1, 8. The title compound of xanthridine-2_-one was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 100A, and purifying it by reverse-phase HPLC (water / acetonitrile / 0.1% NH40Ac gradient solution) The title compound was obtained as a white solid (0.053 g, 10%). MS (ESI-) m / z 432 (MH) ~; 1H NMR (300 MHz5 DMSO-d6) 5 5.70 (m, 2H), 7.25 ( m5 7H), 7.50 (dd, J = 7.91, 4.60 Hz, 1H), 7.80 (dd, J = 8.46, 4.41 Hz, 1H), 8.17 (d, J = 8.46 Hz, 1H), 8.60 ( m, J = 5.79, 1.88, 1.88 Hz, 1H), 8.68 (dd, J = 4.41, 1.10 Hz, 1H), 8.82 (dd, J = 4.78, 1.84 Hz, 1H). Example 101 89166 -299- 200427678

Dioxide-4H-pyrido "3,2-eiri'2'41 pyrimidin-3-yl) -4-kistilbyl (3-methylbutyl) -2 (lHW apricotide same as Example 101A 5-Chloro-2H-3,1-benzo $ ton-2,4 (1HV diketone will be potassium hydroxide (L68 g, 30 mmol) with 2-amino-6-chlorobenzoic acid (3.43 g A solution of 20 mol) in water (25 ml) was treated dropwise with 20% phosgene (16.8 ml, 32 mol) in toluene at 0. 0, resulting in a precipitate. The mixture was stirred for 1 hour, and the solid was collected by filtration, washed with water, and dried to give the title compound (3.6 g, 91%). 1H NMR (300 MHz, DMSO-d6) 5 7 · 11 (d, J = 7.35 Hz, 1H), 7.31 (d, J = 6.99 Hz, 1H), 7.66 (t, J = 8.09 Hz, 1H), 11.83 (s, lH).

Example 101B 5-chloro-M3-methylbutyl V2H-3,1-benzyl-2,4 (1HV dione title compound was prepared according to the procedure of Example 1B, using 1-bromo-3-methyl Butadiene was substituted for n-butane bromide, and the product of Example 101A was substituted for the product of Example 1A (0.610 g, 45%). MS (DCI) m / z285 (M + NH4) +.

101C 5-Cyl-4-j% yl-1- (3-methylbutyl) _2-pyridyl-1,2-diazine 17 Lin-3-ethionic acid ethyl ester The title compound is based on The procedure of Example 89A was prepared by substituting the product of Example 101B for the product of Example 1B (0.600 g, 80%). WNMRQOOMHz, DMSO-d6) (5 0.96 (d, J = 6.62 Hz, 6H), 1.32 (t, J = 7.17 Hz, 3H), 1.44 (m, 2H), 1.70 (m5 J = 13.24, 6.62 Hz , 1H), 4.18 (m, 2H), 4.35 (q, J = 6.99 Hz, 2H), 7.35 (d, J = 6.99 1H), 7.48 (d, J = 8.09 Hz, 1H), 7.67 (m5 1H) , 13.88 (s, 1H).

Example 101D 89166 -300- 200427678 N ~ "2- (Amino acid group) ρ ratio -3--3- 1-5 chloro- 4- 4-yl group 1- (3-methylbutyl) -2- The fluorenyl-1,2-dihydrop-quelin-3-rejuvenated amine gave the product of Example 101C (0.10 g, 0-50 mmol) and the product of Example 98A (0.086 g, 0.50 mmol) ) In toluene (6 ml) under reflux for 16 hours. The reaction was cooled and the precipitate formed was collected by filtration and dried to give the title compound (0.200 g, 86%).] ^ (0 (： 1) 111 ^ 465 (] ^ + 11) + · 1 1H NMR (300 MHz, DMSO-d6) 5 0.99 (d, J = 6.62 Hz, 6H), 1.51 (m, 2H), 1.76 (m, 1H), 4.32 (m, 2H), 7.45 (d, J = 7.35 Hz, 1H), 7.61 (d, J = 8.82 Hz, 1H), 7.71 (s, 2H), 7 77 (m, 2H), 8.45 (dd, J = 8.46, 1.47 Hz, 1H), 8.53 (dd, J = 4.60, 1.29 Hz, 1H), 12.84 (s, 1H), 17.22 (s, 1H).

Example 101E 5-Chloro_3- (1,1-dioxide-4114 than pyrido [3,241 [1,2,41 pyrimidin-3-yl) -4-hydroxy-H3-methylbutyl V2 ( The 1HV peridolinone title compound was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 101D (0.200 g, 98%). MS (ESI-) m / z445 (Μ-Η) _ · Title The sodium salt of the compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSQ-d6) 5 0.98 (d, J = 6.62 Hz, 6H), 1.45 (m, 2H), 1.71 (m, 1H) , 4.11 (m, 2H), 7.08 (d, J = 7.35 Hz, 1H), 7.23 (d, J = 8.09 Hz, 1H), 7.43 (t, J = 8.27 Hz, 1H), 7.57 (dd, J = 8.46, 4.41 Hz, 1H), 7.78 (d5 J = 8.09 Hz, 1H), 8.45 (d, J = 4.41 Hz, 1H), 15.77 (s, 1H) · Example 102 1-fluorenyl -3- (1,1-Digas-4H-pyrido "3,2-el" 1,2,4V

Examples of 5-methylquinolinone 102A 89166 -301-200427678 lyl- (4-methyl) benzyl [2,3-dlH, 31 Phenyl-2,4-dione The title compound was prepared according to the procedure of Example 1B , Replacing benzyl bromide with benzyl bromide, and (4-methyl) benzo [2,3-d] [l, 3] pyrene-2,4-dione instead of the product of Example 1A, Made (0.67 g, 60%). MS (DCI +) m / z268 (M + H) ·; iHNMR (300 MHz, DMSO_d6) 5 2.66 (s, 3H), 5.28 (s, 2H), 7.07 (d, J = 8.48 Hz, 1H), 7- 14 (d, J = 7.80 Hz, 1H), 7.33 (m, 5H), 7.57 (t, J = 7.46 Hz, 1H) ·

Example 102B Ethyl 1-fluorenyl-4-¾yl-5-methyl-2_fluorenyl_1,2-diazolium pivalin_3-ribonic acid The title compound was prepared according to the procedure of Example 84A, The product of Example 102A was used instead of the product of Example 15A (0.71 g, 89%). MS (DCI +) m / z338 (M + H) ·; ^ NMRCSOOMH ^ DMSO-dg) δ 1.33 (t? J = 7.17 Hz? 3H) 5 2.77 (s, 3H), 4.39 (q, J = 7.23 Hz, 2H), 5.47 (s, 2H), 7.05 (d, J = 7.35 Hz, 1H), 7.20 (m, 4H), 7.31 (m, 2H), 7.47 (t, J = 8.09 Hz, 1H ), 14.43 (s, 1H).

Example 102C N- 『2- (Yueanji Shishanganji) pbiyodo-3-yl1-1-fluorenyl-4-meryl-5-methyl-2-fluorenyl-1,2-bi The hydroquinoline-3-carboxamide title compound was prepared according to the procedure of Example 84C, substituting the product of Example 102B for the product of Example 84B, and substituting the product of Example 98A for 2-amino-5-bromobenzenesulfonamide. Into (0.163 g, 41%). MS (ESI +) m / z465 (M + H) ·; iHNMR (300 MHz, DMSO-d6) (5 2.82 (s, 3H), 5.59 (s, 2H), 7.15 (d, J = 7.35 Hz, 1Η), 7.24 (m, 3H), 7.33 (m, 3H), 7.56 (t, J = 7.91 Hz, 1H), 7.72 (m, 3H), 8.51 (m, 1H), 8.53 (s, 1H), 12.93 (s, 1H), 17.16 (m, 1H).

Example 102D 1-fluorenyl-3- (1,1-dioxo-4D-4H-pyridine, "3,2-61", 1,2,41 plugs, two wells-3-yl) -4- The title compound-89166 -302-200427678 5-methyl_2 (1HW apricot 4 ketone was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 102C (0.064 g, 41%). MS (ESI +) m / z447 (M + H)-· The sodium salt of the title compound was prepared according to the procedure of Example id. MS (ESI-) m / z 445 (MH)-; 1H NMR (300 MHz, DMSO-d6 ) 5 2 · 81 (s, 3H), 5.37 (dd, J = 6.07, 2.02 Hz, 2H), 6.80 (d, J = 7.35 Hz, 1H), 6.95 (d, J = 8.09 Hz, 1H), 7.20 (m, 4H), 7.29 (m, 2H), 7.57 (dd, J = 8.46, 4.41 Hz, 1H), 7.75 (dd, J = 8.46, 1.47 Hz, 1H), 8.44 (dd, J = 4.41, 1.47 Hz, 1H), 16.29 (s, 1H) · φ Example 103 3- (1,1-dioxide-4H-pyrido "3,2_elfl.2,41 Small "(2_

Methyl, 1,3-oxazole-5-some) methyl 1-2 (1HV quinolinone example 103A 140 methyl-1,3-pyrazol-5-yl) methyl 1-2H-3,1 -Benzophenone-2,4 (1Ην dione titled compound was prepared according to the procedure of Example 1B, replacing the product of Example 1A with carboxyaniline anhydride, and replacing the bromination with 2-methyl-5-chloromethylthiazole Made from n-butane to obtain (0.410 g, 73%). Example 103B 1- "(2-methyl_1,3-pyrazol-5-yl) methyl 1-2Λ · diketo -u, 3,4-Tetrahydroquinoline ethyl carboxylate title compound was prepared according to the procedure of Example 84A, replacing the product of Example 10A with the product of Example 103A (0.132 g, 25%). MS ( ESI-) m / z343 (MH)-; 1H NMR (300 MHz, CDC13) 51.49 (t, J = 6.99 Hz, 3H), 2.61 (s, 3H), 4.53 (q, J = 7.23 Hz, 2H ), 5.54 (s, 2H), 7.27 (t, J = 8.09 Hz, 1H), 7.41 (d, J = 8.46 Hz, 1H), 7.62 (s, 1H), 7.67 (m, 1H) , 8.21 (dd, J = 8.09, 1.47 Hz, 1H), 89166 -303-200427678 14.32 (s, 1H).

Meeting example 103C Ν · "2- (aminosulfonyl) pyridine-3-some 1-14 (2-methyl_1,3-pyrazol-5-yl) methyl 1-2Λ dione-1.2丄 4-Tetrahydropyridin-3-carboxamide The title compound was replaced with the product of Example 99A by the procedure described in Example 84C and replaced by the 3-amino-pyridine-2-sulfonamide Made by substituting 2-amino-5-bromobenzenesulfonamide (0.148 g, 79%). MS (APCI) m / z472 (M + H) +. 1H NMR (300 MHz, DMSO-d6) 5 2.55 (s, 3H), 5.69 (s, 2H), 7.25 (m, 1H), 7.35 (s, 1H), 7.42 (t, J = 6.62 Hz, 1H), 7.81 (m, 4H ), 8.17 (d, J = 7.72 Hz, 1H), 8.52 (d, J = 2.57 Hz, 1H), 8.54 (s, 1H), 12.67 (s, 1H), 16.28 (s, 1H).

Example 103D 3-α J-dioxide-4H-p than pyrido "3,2-el" U, 41 pyridinium-3-ylhydroxy-H (2-methylazole-5_yl) methylquine The titled porphyrinone compound was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 103C (0.033 g, 68%). MS (APCI) m / z454 (M + H) +. 1H NMR (300 MHz, DMSO-d6) 5 2.56 (s, 3H), 5.74 (s, 2H), 7.48 (t? J = 6.80 Hz? 1H)? 7.82 (s? 1H)? 7.88 (m5 4H)? 8.24 ( m? 2H) 5 8.71 (dd5 J = 4.41? 1.47 Hz, 1H), 14.01 (S, 1H). Example 104 1-benzyl-4-m _3- (7-methyl_1,1-digasification -4H_ Eridine and "2,3-el" l, 2,41

-3-yl) -2 (1 HV quinqueline, same as in Example 104A, see Chemical (2-amino-5-methyl p-pyridin-3-yl), chlorinated (2-aminomethylpyridine_ 3_yl) sulfonyl is prepared from 2-amino_5_methylpyridine by the method described by Weller, HN in 89166 -304- 200427678 US 5,378,704. IHNMR (300 MHz, DMSO-d6) 5 2 20 (s, 3H), 7.70 (broad s ”2H), 7 85 (d, j = 5 52 Hz, lH), 8.07 (d, J = 2.21 Hz, 1H).

Example 104B 2-Amino-5-methyl red 1: Yodo-3-Green Gorge The product of Example 104A was reacted with concentrated ammonium hydroxide at ambient temperature overnight. The reaction mixture was concentrated to obtain the title compound in a quantitative yield as a pale yellow solid. MS (DCI / NH3) m / z 188 (M + H) + · 1H NMR (300 MHz, DMSO-d6) 5 2 · 17 (m, 3H), 6_28 (s, 2H), 7.43 (s, 2H) , 7.70 (d, J = 1.84 Hz, 1H), 8.00 (d, J = 2.21 Hz? 1H).

Example 104C N- [3- (Aminofluorenyl V5-methylpyridin-2-yl 14-fluorene-4-fluorenyl-2-one-1,2-dihydrop-quinolin-3-carboxyl The title compound was prepared according to the procedure of Example 84C, replacing the 2-amino-5-bromobenzoic acid amine with the product of Example 104B.

Example 104D Resoryl hydroxyl 3- (7methyl_U-digasification_4Η · rpipyridinium "2,3 &lt; 1" 1,2,4 &gt; Seleton-3-yl) -2 (1Η ) -ρ Kui # The title compound was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 104C (0.20 g, 35%). iHNMRpOOMHz, DMSO-d6) 5 3.32 (m , 3H), 5.45 (s, 2H), 5.97 (s, 1H), 7.22 (m, 9H), 7.50 (m, 1Η), 7.91 (dd, J = 7.91, 1.65Ηζ, 1H), 11.50 (m, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) 5 2 · 37 (m, 3H), 5.39 (m, 2H), 7.07 (m, 1H), 7.24 (m, 6H), 7.39 (m, 1H), 7.94 (d5 J = 89166 -305-200427678 1.47 Hz, 1Η), 8.13 (dd, J = 7.91, 1.65 Hz , 1Η), 8.43 (d, J = 1.84 Hz, 1H), 16.49 (m, 1H) Example 105 1-Butylbenzyl-1,1_digasification_4H_ 2,3_ei 「L2,4i

-3-yl Vl, 8-p-naphthalmia-2 (1HV) same as Example 105A 3- {"3- (Amine group. Pyridyl-2-methylpyridine_2_some ·] amino group 丨 Ethyl ketopropionate Ester The product of Example 104B (1.0 g, 0.0053 moles) was dissolved in 10 ml of THF containing 5 ml of pyridine at ambient temperature with ethyl 3-chloro-3-propionopropionate (1.0 g). 97 grams, 0.0064 moles) for several hours. The reaction mixture was concentrated to half its original volume and then diluted with water. The precipitate formed was collected by filtration, washed with water, and dried under vacuum to give the title. Compound as an off-white solid (U9 g, 75% yield). MSCESDm / zSOiHM-HyjHNMR (300 MHz, DMSO-d6) 5 1.19 (t, J = 7.17 Hz, 3H), 2.35 (s, 3H), 3.65 (s, 2H), 4.11 (q, J = 7.23 Hz, 2H), 7.60 (s, 2H), 8.06 (d, J = 1.47 Hz, 1H), 8.41 (d, J = 1.84 Hz, 1H ), 9.79 (s, 1H).

• Example 105C (7-methyl-1,1-dioxide-4H- ^ pyridine and "2,34 ~ 1" 1,2,4 &gt; cydia-3--3-yl) acetic acid §§ Example 105A The product (0.363 g, 0.0012 mol) was reacted with sodium carbonate (0.350 g, 0.0033 mol) in 20 ml of ethanol. The reaction mixture was heated under reflux for 2 hours. After cooling, the reaction mixture was treated with chloroform Diluted, filtered to remove excess sodium carbonate, and concentrated. The residue was purified by chromatography on a second gel using ethyl acetate (1: 1) in hexane, followed by 4% methanol in dichloromethane. Mobile phase to give the title compound as a white solid (0.296 g 89166 -306- 200427678, 87% yield). MS (ESI) m / z 282 (MH)-; 1H NMR (300 MHz, DMSO-d6) δ 1.21 (t, J = 6.99 Hz, 3H), 2.40 (s, 3H), 3.73 (s, 2H), 4.15 (q, J = 7.11 Hz, 2H), 8.20 (s, 1H), 8.58 (d , J = 1.84 Hz, 1H), 12.79 (s, 1H).

Example 105D 1-Butyl-4-hydroxy-3 彳 7-methyl-U-digasified-4H-pyrido f2,3-el "l, 2,41 The pyrimidine-2ΠΗ) -one title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1C with the product of Example 105C (0.065 g, 58% yield). IHNMRpOOMHz, · DMSO-d6) 5 0.94 (t, J = 7.35 Hz, 3H), 1.40 (m, 2H), 1.67 (m, 2H), 2.44 (m, 3H), 4.46 (dd, J = 7.91, 7.17 Hz, 2H), 7.48 (dd, J = 8.09, 4.78 Hz, 1H), 8.29 (s, 1H), 8.56 (dd, J = 7.91, 1.65 Hz, 1H), 8.64 (d, J = 1.47 Hz, 1H), 8.87 (d, J = 5.52 Hz , 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) 5 0 · 93 (t, J = 7.35 Hz, 3H), 1.34 (m, 2H ), 1.58 (m, 2H), 2.36 (s, 3H), 4.26 (d, J = 7.72 Hz, 1H), 4.29 (d, J = 6.99 Hz, 1H), 7.13 (dd, J = 7.72, 4.78 Hz, 1H), 7.95 (s, 1H), 8.37 (dd, J = 7.72, 2.21 Hz, 1H), 8.42 (d, J = L84 Hz, 1H), 8.53 (dd, J = 4.60, 2.02 Hz, 1H), 16.11 (s, 1H). #, Example 106 Dioxide-4H-1,2,4-benzyl and p Two groups ^ control wells -3_ Jisai thienylmethyl)

Example of -1,8-pyridin-2 (1HV ketone 106A 1- (pyridin-2-ylmethyl V2H-pyrido "2,3-dl" l, 31,2-2,4 (1HV dione title The compound was prepared by substituting 2- (bromomethyl) -pyridine for n-butane bromide according to the procedure of Example 1B (0.165 g, 51%). 1 ^^] ^ (30〇) \ 41 ^, 01 ^ 0-d6) 5 5.48 (s, 2H), 6.97 (dd, J = 5.15, 3.31 Ηζ, 1Η), 7.21 (d, J = 3.31 Ηζ, 1Η), 89166 -307- 200427678 7.43 (m, 2H), 8.41 (dd, J = 7.72, 1.84 Hz, 1H), 8_83 (dd, J = 5.15, 1.84 Hz, 1Η) ·

Example 106B 3- (1,1-Dioxide-4H-1,2,4-benzopyrimidinium, each group V4-hydroxy small (2-telephenylmethyl) -1,8-4 pyridin-2 ( 1HV ketone

The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 106A for the product of Example 1B (0.162 g, 60%). MS (ESI ·) m / z 437 (M-Η)-. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) 5 5.64 (s, 2H), 6.90 (m, J = 5.15, 3.68 Hz, 1H), 7.11 (m, J = 3.49, 0.92 Hz, 1H), 7.18 ( dd, J = 7.72, 4.78 Hz, 1H), 7.29 (m, 3H), 7.56 (m, 1H), 7.67 (dd, J = 7.72, U0 Hz, 1H), 8.39 (dd, J = 7.72, 2.21 Hz, 1H), 8.57 (d4 J = 4.78, 1.84 Hz, 1H), 15.80 (s, 1H) · Example 107 M-oxy group) _3- (l, l_dioxide · 4Η-1,2,4 -Benzopyrimidine, each V4 hydroxyl-L8- pyridine · 2 (1Ην ketone example 107A 2_ "(word gas group) amine 1 1 nicotinic acid ethyl ester 2-chloro · terminal acid acid ethyl ester (4.55 g , 24.6 millimoles), O-Hexylamine hydrochloride (7.85 g, 49.2 millimoles) and N, N-diisopropylethylamine (6.36 g, 49.2 millimoles) in 10 ml 1 In 4-dioxolane, a sealed tube was reacted at 12.0 for 48 hours. The reaction mixture was subjected to liquid separation between ethyl acetate and 5% aqueous sodium hydrogen carbonate solution. Ethyl acetate (2 X 50 ml), and the aqueous layer was re-extracted. The organic layers were combined and dried over sodium sulfate, filtered, and concentrated. The residue was purified by column chromatography on silica gel, Ethyl acetate (9: 1) was dissolved to provide the title compound (3.5 g, 53%). MS (DCI) m / z273 (M + H) +. 89166 -308- 200427678

Example 107B: Ethyl lactyl-3-j ^ propylammonium) amine cap I. Alkaline ethyl ester The product of Example 107a (L2 g, 4.4 mmol) and triethylamine_g, 4.8 pen moles) The solution in dichloromethane (25 ml) was treated dropwise with ethyl chloromalonate (0.73 g, 4.8 mmol), stirred for 2 hours, and separated between ethyl acetate and water &lt; Process and separate liquid layers. The ethyl acetate layer was washed with brine, dried (Na2SO4), and concentrated. The residue was purified by column chromatography on silica gel, and dissolved in hexane and ethyl acetate (3: 丨) to provide the title compound (U g, 65%). MS (DCI) m / z 387 (Μ + Η) +

Example 107C

A solution of the product of Example 107b (0.386 g, 1.0 mmol) in ethanol (5 ml) was treated with 21% sodium ethoxide (0.324 g, 1.0 mmol) in ethanol, stirred for 30 minutes, and The solution was separated between ethyl acetate and 5% HC1 aqueous solution, and the liquid layer was separated. The ethyl acetate layer was washed with brine, dried, and concentrated to provide the title compound (0.28 g, 82%). MS (DCI) m / z341 (M + H) +. Is

Example 107D M2- (Aminosulfonyl) phenyl iH fluorenyl) Hydroxyl 8-gai-3-marginamine. The product of Example 107c (340 mg, 0.82 mmol) was added with 2-phenylbenzene. A mixture of 141 mg (0.82 mmol) in toluene (10 ml) was refluxed for 16 hours, cooled, and the precipitate formed was collected by trituration and dried to give the title compound (340 mg, 89%) ). MS (DCI) m / z 467 (M + H) + 89166 -309- 200427678

Example 107E Benzyl benzyl group V3- (l, l-digasified-4H-1,2,4-benzimidylpyridin-3-yl) -4-pyrene-1.8- Konato-2 (1 H) -The same title compound was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 107d to obtain the title compound (0.082 g, 87%). MS (ESI-) m / z 447 (M-H)-. The sodium salt of the title compound was prepared according to the procedure of Example id. 1 H NMR (300 MHz, DMSO-d6) 5 5.12 (s, 2H) 7.22 (dd, J = 7.72, 4.78 Hz, 1H) 7.30 (m, 2H) 7.44 (m, 3H) 7.57 (m, 1H) 7.70 (m, 3H) 8.41 (dd, J = 7.72, 1.84 Hz, 1H) 8.61 (dd, J = 4.78, 1.84 Hz, 1H) 15.70 (s, 1H) · Example 108

少 (U-Dioxide-4H-1,2,4-benzopyridinyl-3-ylethylbutanone) -5-lightyl_2_ (methylthio) pyrido "2,3_dlpyrimidine xitong Example 108A 4 _- [(2-Ethylbutyl) amino 1-((methylthio) V Mejido-5-chimic acid Formamidine § 4-Chloro-2-methylthio-5-pyrimidine Ethyl acetate (0.40 g, 1J2 mmol) with 1-amino-2-ethylbutane (0.175 g, 1.72 mmol) and triethylamine (0.60 ml, 4.32 mmol) ), Reaction at ambient temperature for 18 hours. The reaction was separated between water and methylene chloride. The organic layer was dried over sodium sulfate, filtered, and concentrated to give the title compound (0.50 g, 98 %). Example 108B 4 &quot; "0 ethylbutyl) amino 1- 2- (methylthio V analytical-5 carboxylic acid) The product of Example 108A (0.50 g, 1.68 mmol) in water and ethanol (1: 2), react with sodium hydroxide (0.22 g, 5.50 mmol) at ambient temperature for 3 hours under vacuum; shrink the reactant 'to remove ethanol' and use aqueous hydrochloric acid (1 M) 89166 -310- 200427678. The precipitate formed was collected by filtration and dried to give the title compound (0.41 G, 91%). MS (DCI / NH3) m / z 270 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 0.88 (t, J 2: 7.54Ηζ, 6Η), 1.31 (dt , J = 14.25, 7.03 Hz, 4H), 1.53 (m, 1H), 2.47 (s, 3H), 3.46 (t, J = 6.07 Hz, 2H), 8.50 (s, 1H), 13.22 (s, 1H) .

Example 108C 1- (2-Ethylbutyl) -7- (methylthio V2H-pyrimido "4,5-din, 31H2-2,4aHV dione gives the product of Example 108B (0.41 g, 1-52 Mmol) with ethyl chloroformate (0.445 ml, 4.65 mmol) and pyridine (0.405 ml, 5.56 mmol) in toluene (8 ml) at 90 ° C for 24 hours. The reactants were reacted Concentrated under vacuum. The residue was extracted with ethyl acetate and filtered. The filtrate was concentrated to give the title compound (0.394 g, 88%).

Example 108D 6- (1,1-Digas-4H-1,2,4-benzopyridine), 8_ (2-ethylbutyl V5_hydroxy-2- (methylthio) pyridine The "2,3-dl pyrimidine-7 (8HV ketone title compound was prepared according to the procedure of Example 1D, substituting the product of Example 108C with the product of Example 1B (0.153 g, 24%). MS (ESI-) m / z 472 (M-Η) ·. The title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) 5 0 · 87 (t, J = 7.54 Hz, 6H), 1.28 (m, 4H), 1.87 (ddd, J = 13.05, 6.80, 6.62 Hz, 1H), 2.56 (s, 3H), 4.15 (d, J = 7.35 Hz, 2H), 7.26 (d, J = 8.46 Hz, 1H), 7.31 (m, 1H), 7.56 (ddd, J = 8.27, 7.17, 1.47 Hz, 1H), 7.67 (dd, J = 7.72, 1.47 Hz, 1H), 8 · 89 (s, 1H), 15.52 (s, 1H) · Example 109 6- (1,1-Digas-4H_L2,4-Benzopyrimidine, 3_yl V8- (2-Ethylbutylbutylhydroxyl) Pyridine IZ3 · (ΓΙ pyrimidine-7 (8HV ketone 89166 -311-200427678) The product of Example 108D (0.15 g, 0-30 mol) was made with excess Raney nickel (slurry in water, 2 ml) in ethanol (5 ml) Medium reaction, and heating at 60 ° C for 1 hour. After silicon The mixture was filtered, washed with ethanol, and the filtrate was concentrated under vacuum to give the title compound. MS (ESI-) m / z448 (MH) _; iHNMR (300 MHz, DMSO-d6) 5 0.86 (t, J = 7 · 35 Hz, 6H), 1.28 (m, 4H), 1.87 (m, 1Η), 4.18 (d5 J = 7.35 Hz, 2H), 7.30 (m, 2H), 7.57 (ddd, J = 8.27, 7.17, 1.47 Hz, 1H), 7.68 (dd, J = 7.91, 1.29 Hz, 1H), 8.94 (s, 1H), 9.09 (s, 1H), 15.43 (s, 1H). Example 110 · Α, 1-Dioxide-4Η-1,2,4 · benzopyrimidin-3-yl) -7-hydroxypyreno

`` 3,2 Hepta-1pyridin-5 (411) _one example 110A 2 Qinidinopheno '' "3,2- (1111,31 humeng_2,4 (1out_dione titled compound according to Fabis and joint research The procedure was prepared as described in 1998, 54, 10789-10800. MS (DCI / NH3) m / z 186.9 (M + NH4) +; 1H NMR (300 MHz, DMSO_d6) δ 6.95 (d, J = 6 Hz, 1H) 8.25 (d, J = 6 Hz, 1H) 12.22 (brs, 1H) · #

• Example 110B 1-fluorenyl-2H-fluorene and "3,2-dlfl, 3 ~ | 唠 工 _2,4 (1HV dione made the product of Example 110A (0.137 g, 0.81 mmol) and brominated Benzyl (0.10 ml, 0.85 mmol) and potassium carbonate (0.134 g, 0-97 mmol) were reacted in dimethylformamide (5 ml) at ambient temperature for 20 hours. The reaction mixture was diluted with water. The resulting sundries were collected by tritium, and dried to obtain the title compound (0.165 g, 80%). MS (DCI / NH3) m / z277 (M + NH4) +; iHNMROOOMHz.DMSO-de) 5 5.21 (s, 2H) 7.25 (d, J = 5.52 Ηζ, 1Η) 7.35 89166 -312- 200427678 (m, 5H) 8.28 (d, J = 5.52 Hz, 1H).

Example HOC 4-Cryl-6- (l, l-dioxide-4H-1,2,4-benzyl-di-2--3-yl) _7-light-based diphenoP, 2 seven 1 pyridine-5 (The 4HV ketone title compound was prepared according to the procedure of Example ID, replacing the product of Example 1B with the product of Example 110B (0.137 g, 49%). MS (ESI_) m / z 438 (M-Η) ·. The title compound The sodium salt was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) 5 5.26 (s, 2H) 7.03 (d, J = 5.52 Hz, 1H) 7.21 (m, 2H) 7 · 28 (m , 5H) 7.54 (ddd, J = 8.27, 7.17, 1.47 Hz, 1H) 7.65 (dd, J = 7.91, 1.29 Hz, 1H) 7_73 (d, J = 5.52 Hz, 1H) 15.89 (s, 1H). Example 111 4-Butyl-6-a, l_dioxide-4H-1,2,4_benzylpyrene-3-yl V7_hydroxydipheno

`` 3,2-bl pyridine-5 (4HV ketone example 111A U-yl-2H-pyrimido '', `` 3,2-dl '' 1,31 Sakigen-2,4 (1HV dione title compound was according to the procedure of Example 110B , Prepared by replacing n-butane bromide with benzyl bromide (0.059 g, 22%). MS (DCI) m / z226 (M + H) +; WNMR (300 MHz, DMSO-d6) 5 0.91 (t , J = 7.17 Hz, 3H) 1.36 (dt, J = 22.70, 7.22 Hz, 2H) 1.62 (m5 2H) 3.94 (m, 2H) 7_39 (d, J = 5.52 Hz, 1H) 8.34 (d , J = 5.15 Hz, 1H).

Example 111B: Dioxin, 4'-1,2,4-benzopyridine-3-ylpyrene, "3,2,7,1,5,5 '-(4-HV), the title compound is based on the procedure of Example 1D, It was prepared by substituting the product of Example 111A with 89166 -313-200427678 of Example 1B (0.050 g, 47%). MS (DCI / NH3) m / z404 (M + H) +; 1H NMR (300 MHz, DMSO- d6) 6 0 · 93 (m, 3H) 1.40 (td, J = 14.98, 7.17 Hz, 2H) 1.67 (m, 2H) 4.27 (m, 2H) 7.54 (m, 1H) 7.60 (d, J = 5_52 Hz , 1H) 7.67 (d, J = 7.72 Hz, 1H) 7.77 (ddd, J = 8.36, 7.08, 1.47 Hz, 1H) 7.92 (d, J = 7.72 Hz, 1H) 8.39 (d, J = 5.52 Hz, 1H) 14.46 (s, 1H) 14.90 (s, 1H). Example 112

Dioxol ^ [D-4H-1,2,4-benzophenone plugs two wells-3-yl) -7_year-old sitting group-4- (4-exomethyl methyl) pyrimido f3,2 -bl pyridin-5 (4H) -one example 112A 1- (pyridinylmethyl V2H-u thiophene "3,2-dl" 1,31 噚 -2,4 (1HV dione title compound is based on The procedure of Example 1B was prepared by replacing the product of Example 1A with the product of Example 110A, and replacing the n-butane bromide with 4-bromomethylpyridine hydrobromide (0.205 g, 80%).

Example 112B 6- (1,1-Dioxide_4H_1,2,4-jasopyridine-3-yl V7-hydroxy-4_ (4-pyridylmethyl) pyrimido [~ 3,2seven1 Pyridine-5 (4HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 112A (0.155 g, 45%). MS (DCI / NH3) m / z439 (M + H) +; 1H NMR (300 MHz, DMSO-d6) δ 5.78 (s5 2H) 7.49 (d5 J = 5.52 Hz5 1H) 7.55 (t, J = 7.54 Hz, 1H) 7.62 (d, J = 7 · 35 Hz, 1H) 7.76 (m, 4H) 7.93 (d, J = 7.72 Hz, 1H) 8.38 (d, J = 5.52 Hz, 1H) 8.75 (d, J = 6.25 Hz, 1H) 14.06 (s, 1H). Example 113 1- (3-Bromobenzyl) -3- (1,1-digasification-4H-1,2,4-benzopyrimidin-3-yl) glacial hydroxyl _ 5 , 6,7,8-tetrahydrofluorene 4 ketones 89166 -314- 200427678

Example 113A ϋ7,8_tetrahydro-2H-3,1-benzohumogen-2,4 (1HV diA The title compound was prepared according to the procedure of Example 3B using 2-aminocyclohexidine Made in place of the product of Example 3A (0.960 g, 97%). MS (ESI-) m / z 166 (M-Η) +.

Example 113B 1- (3-Bromofluorenyl V5_6.7,8-tetrahydro-2fluorene-3,1 · benzylamine-2 · 4αΗ) -dione The title compound was prepared according to the procedure of Example 1B, using Example 113Α This product replaced the product of Example 1A and was prepared by substituting 3-bromobenzyl bromide for n-butane bromide (0.049 g, 46%). MS (ESI-) m / z334 (M-H) + ·

Example 113C 1- (3-bromofluorenyl dioxide-4H-U, 4-benzopyrimidinium, each group V4-hydroxy, 5,6,7,8-tetrahydrocolin The procedure of Example 1D was prepared by replacing the product of Example 1B with the product of Example 113B (0.021 g, 34%). MS (ESI-) m / z 514 (MH) +; 1H NMR (300 MHz, DMSO-d6) 5 1 · 68 (m, 4H), 2.51 (m, 2H), 2.67 (m, 2H), 5.40 (s, 2H), 7.13- (d, J = 7.72 Hz, 1H), 7_30 (t, J = 7.91 Hz, 1H), 7.51 (m, 3H), 7.61 (d, J = 8.09 Hz, 1H), 7.73 (t5 J = 7.17 Hz, 1H), 7.90 (d, J = 8.46 Hz, 1H), 14.40 (s, 1H), 14.56 (s, 1H) · The sodium salt of the title compound was prepared according to the procedure of Example ID. 1HNMR (300MHz, DMSO-d6) 5 1.59 (m, 4H ), 2.33 (t, J = 5.70 Hz, 2H), 2.41 (m, 2H), 5.14 (s, 2H), 7.11 (d, J = 8.09 Hz, 1H), 7.18 ( d, J = 8.09 Hz, 1H), 7.25 (m, 3H), 7.41 (d, J = 7.72 Hz, 1H), 7.50 (td, J = 7.72, 1.47 Hz, 1H), 7_62 (dd, J = 7.72, 1.47 Hz, 1H), 17.13 (s, 1H) · Example 114 89166 -315- 200427678 5 :. (U-Dioxide: ^ -1,2,4-benzopyrimidin-3-yl M -Hydroxy-7- (4-pyridylmethyl)

Mouth plugging and mouth splitting "2,3-bl mouth ratio-6 (7H) -synthetic example 114A neo-pyridino r2,3-diri, 31 Phenyl-2,4 (1HV dione title compound is borrowed Made by Fabis and co-researchers in 1998 M 10789-10800. MS (DCI / NH3) m / z 187 (Μ + ΝΗ4) +; iHNMRpOOMHz'DMSOO (5 7.17 (d, J = 16.8Hz, lH) 7.21 (d, J = 16.8 Hz, 1H) 12.56 (brs, 1H) _ φ

Example 114B 1+ Biyodo-4-1 Methan, -2H # Sepheno [~ 2,3-dl, l, 31 yin-2,4 (m) -dione The title compound was according to the procedure of Example 1B It was prepared by replacing the product of Example 1A with the product of Example 114A and replacing the n-butane bromide with 4-bromomethylpyridine hydrobromide (0.22 g, 95%).

Example 114C 5- (1,1-Digas-4H-U, 4-benzyl-4-diphenyl-3-yl V4-hydroxy-7- (4-pyridylmethyl) 1 Pyridine-6 (7HV ketone. The title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 114B (0.047 g, 13%). MS (DCI / NH3) m / z439 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 5.62 (s, 2H) 7.48 (m, 2H) 7.55 (t, J = 7.54 Hz, 1H) 7.62 (d, J = 7.72 Hz, 1H ) 7_68 (d, J = 6.25 Hz, 1H) 7.76 _, J = 8.55, 7.26, 1.47 Hz, 1H) 7.93 (d, J = 8.09 Hz, 1H) 8.71 (d, J = 6.62 Hz, 1H) 13.87 (s, 1H) · Example 115 6- (1,1-dioxide-4H-1,2,4-benzofluorenyldi-4--3-yl) -7- # fluorenyl-4- (3 -p than yodoyl methyl) 89166 -316- 200427678

Breaking pheno "3,2-b &gt; Biyodo-5 (4H) -one example 115A 1 heptidyl methyl groups) -2H-thieno [3,2-d] [l, 3] huming- The 2,4 (1H) -diketone title compound was prepared according to the procedure of Example 1B, replacing the product of Example 1A with the product of Example 110A, and replacing the bromo-n-butane with 3-bromomethylpyridine hydrobromide. (0.28 g, 90%). MS (DCI / NH3) m / z 261 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 5.24 (s, 2H) 7.34 (d, J = 5.52 Hz, 1H) 7.38 (m, 1H) 7.81 (dt, J = 8.00, 1.88 Hz, 1H) 8.30 (d, J = 5.15 Hz, 1H) 8.51 (dd, J = 4.78, 1.47 Hz, 1H) 8.67 (d, J = 1.84 Hz, 1H).

Example 115B 6_ (1,1-Digas-4H-1,2,4-benzopyrimidin-3-yl V7-hydroxypyridylmethyl) benzophenone "3,2-bl pyridine-5 ( The 4HV ketone title compound was prepared according to the procedure of Example 1D, substituting the product of Example 115A with the product of Example 1B (0.237 g, 50%). MS (DCI / NH3) m / z439 (M + Η) + · Title compound The sodium salt is made according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.49 (s? 2Η) 7.34 (dd5 J = 7.91, 4.60 Hz? 1H) 7.45 (m, 3H) 7.68 (m , 2H) 7 · 83 (d, J = 8_09 Hz, 1H) 8_16 (s, 1H) 8.47 (d, J = 3.68 Hz, 1H) 8.62 (s, 1H) 14.83 (br s, 1H). Example 116 7-fluorenyl-5-α, 1-digasification-4H-1,2,4-benzopyrimidin-3-yl) -4-hydroxypyrimido

`` 2,3 Hepta-1pyridin-6 (7HV ketone example 116A 1_ 芊 Mu-2H-pyrimido `` 2,3- (11``1,31 humeng-2,4 (1HV dione title compound is based on the example The procedure of 110B is based on the product of Example 114A and 89166-317-200427678 instead of the product of Example 110A (0.26 g, 100%).

Example 116B 7-fluorenyl-5- (l, l-monoxide-4H-1,2,4-benzyl and di-p-well-3-yl) 1 pyridine-6 (7HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 116A (0.144 g, 38%). MS (ESI-) m / z 436 (M-Η ) .. The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m / z 436 (Μ-IT); δ 1H NMR (300 MHz, DMSO-d6) (5 5.14 (s? 2H ) 6.90 (d5 J = 5.52 Hz, 1H) 7.20 (m, 2H) 7.30 (m, 6H) 7.54 (m, 1H) 7.65 (dd, J = 7.72, 1.47 Hz, 1H) 16.25 (s? 1H) Example 117 4- (Cyclopropylmethyl) -6- (1,1-digasification_4H-1,2,4-benzopyrimidin-3-yl V7-hydroxyl

Orthophenone `` 3,2-bl pyridine-5 (4HV ketone example 117A Η cyclopropylmethyl V2H-pyrimido r3,2-dlfl, 31 hump-2,4 (1HV dione title compound based on The procedure of Example 1B was prepared by replacing the product of Example 1A with the product of Example 110A and replacing the n-butane bromide with bromomethylcyclopropane (0.23 g, 87%). MS (DCI / NH3) m / z241 (M + NH4) +; iHNMR (300 MHz, DMSO-d6) accounts for 0.47 (m, 4H) 1.21 (m, 1H) 3.89 (d, J = 6.99 Hz, 2H) 7.45 (d, J = 5.15 Hz, 1H) 8.35 (d, J = 5.15 Hz, 1H).

Example 117B 4-Zinc-propylmethyl digasification-4Η · 1.2 · 4-benzylpyridine-3-yl V7-bythiophene `` 3.2-bl pyridine-5 (4HV ketone title compound It was prepared according to the procedure of Example 1D, using the product of Example 117A to take 89166 -318- 200427678 instead of the product of Example 1B (0.252 g, 60%). MS (ESI-) m / z 400 (MH) 'of the title compound The sodium salt was prepared according to the procedure of Example ID. IHNMR (300MHz, DMSO-d6) 5 0.41 (m, 4H) 1.20 (m, lH) 3.92 (d, J = 6.99Hz, 2H) 7.19 (m, 2H ) 7.26 (t, J = 7.54 Hz, 1H) 7.53 (m, 1H) 7.64 (d, J = 6.62 Hz, 1H) 7.79 (d, J = 5.52 Hz, 1H) 15.97 (s, 1H). Example 118 5- (l, l-Dioxide-4H-1,2,4-benzyl-2-diphenyl-3-yl) _4_hydroxy-1-7 ((3-methylbutyl) pyrimidine Example of dblpyridin-6 (7Η) -one 118A 1- (3-methylbutyl) -2Η · pyridino "2 · 3-dl" 1, 31 唠 2.4_ (1HV dione title compound is based on The procedure of Example 1B was prepared by replacing the product of Example 1A with the product of Example 114A and replacing the n-butane bromide with brominated isobutane (0.074 g, 35%).

Example 118B 5- (1,1-Dioxide-4H-1,2,4-Benzo-4 Ergen-3-3-V4-Hydroxy-7- (3-methylbutane) Pyrido "2, 3 Hepta-1pyridine-6 (7HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 118A (0_063 g, 49%). MS (ESI-) m / z 416. Title The sodium salt of the compound was prepared according to the procedure of Example ID. IHNMR (300 MHz5 DMSO-d6) δ 0.96 (s5 3Η) 0.98 (s? 3H) 1.53 (m3 2H) 1.66 (m3 1H) 3.87 (m, 2H ) 6.95 (d, J = 5.52 Hz, 1H) 7.19 (m, 2H) 7.25 (m, 1H) 7.52 (ddd, J = 8.27, 7.17, 1.47 Hz, 1H) 7.64 (dd, J = 7.72 , 1.47 Hz, 1H) 16.30 (s, 1H). Example 119 4-Methyl radicals (1,1-dioxide-4H-1,2,4_benzyl and pyrene-based cultivars V7 old radicals_2-Mo Some 4 89166 -319- 200427678 pheno | &quot; 3,2-b buck ratio lake-5 (4HV_

Example 119A The thieno "3,2- (1 ~ |" 1,31 噚 _ _ make 3-amino I phenylpyrimidine-2-carboxylic acid methyl ester (0. 25 g, ι · 07 mmol) Popular potassium oxide (0.12 g, 2.14 mmol) in water (6.1 L) was reacted at 90 ° C for 24 hours. The reaction was cooled to 0 ° C and phosgene (19 M) was added dropwise. (0.70 ml, 1.40 mmol) in toluene. After stirring at room temperature for 1 hour, the formed solid was collected by filtration, washed with excess water, and dried to give the title compound 'yellow-brown. Solid (0175 g,%). Example 119B-II-2H-pyridino [3,2-d1 "l, 31 Heng-24 (1Hv dione title compound was prepared according to the procedure of Example 1B, using Example 119A The product was replaced by the product of Example 1A (0.19 g, 80%). MS (DCI / NH3) m / z353 (M + NH4) +; 1 η NMR (300 MHz, DMSO-d6) δ 5.26 (s, 2H) 7.43 (m? 8H) 7.82 (m, 3H) ·

Example 119C 4-fluorenyldigasification-4H-1,2,4-benzo4 dipyridin-3-yl V7-hydroxy-2-benzopyrimidof3,2-bl pyridine-5 (4HV ketone title The compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 119B (0.062 g, 22%). MS (ESI-) m / z 512 (MH)-_ The sodium salt of the title compound is based on The program of the example ID is made. IHNMR (300 MHz, DMSO-d6) δ 5.34 (s5 2Η) 7.24 (m5 2H) 7.33 (m? 5H) 7.43 (m5 4H) 7.56 (t, J = 7.35 Hz, 1H) 7_71 (m, 3H) 15.82 (m, 1H). Example 120 89166 -320- 200427678 4-Cycyl-6- (l, l-; Oxidation-4H_1,2,4 • moclopyridine-3-yl) 7_Hydroxymethyl

Benzo | &quot; 3,2-bl pyridine-5 (4HV ketone Example 120A

ZiIL-2H-fluoreno- "3,2_Cyclobutadiene-1,31" Gengeng-2,4 (1HV dione title compound was prepared according to the procedure of Example 119A, using 3-amino-4-methylpyrimidine_2 -Methyl carboxylate is prepared by substituting methyl 3-amino-5-phenylpyrimidine-2-carboxylate.

Example 120B 1τ-Pingyl-7-fluorenyl-2H-pyrimido "3,2-dl" l, 31 humen-2,4 (1Ην dione The title compound was prepared according to the procedure of Example 110B, using the product of Example 120A Made in place of the product of Example 110A (0.22 g, 73%). MS (DCI / NH3) m / z291 (M + NH4) +

Example 120C 4-fluorenyl-6-α, 1_dihydro_4H_1,2,4-benzopyrimidine · 3 · yl V7-hydroxy-3_methylpyrido "3,2-bl pyridine- 5 (The 4HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 120B (0.110 g, 30%). MS (ESI-) m / z 450 (MH)-· Title compound The sodium salt was prepared according to the procedure of Example ID. NMR (300 MHz, DMSO-d6) 5 2_21 (s, 3H) 5.47 (s, 2H) 7.05 (m, 1H) 7.25 (m, 6H) 7.37 (d, J = 0.74 Hz, 1H) 7.54 (ddd, J = 8.27, 7.17, 1_47 Hz, 1H) 7.64 (dd, J = 7.91, 1.29 Hz, 1H) 15.92 (s, 1H) Example 121 1-fluorenyl-3- (1,1-dioxide-4fluorene-1 · 2 · 4-benzidopyrimidinyl-U-yl) -4-hydroxy-5,6,7,8-tetrai, -2 (1HV quinolinone example 121A 89166 -321-200427678 1-fluorenyl-5,6,7,8_tetrahydro-2qin 3,1-benzopyrene-2,4 (1in-dione The title compound was prepared according to the procedure of Example 1B, substituting the product of Example 113A with the product of Example 113A and substituting benzyl bromide for n-butane bromide (0.620 g, 67%). MS (ESI-) m / z256 (MH: Γ · 1-fluorenyl-3- (U-digasified-4H-1,2,4-benzopyrimidin-3-yl V4-hydroxyl -5,6J, 8-tetranitro, 2 (1 Η) -Koukoukoulin The compound of the same title was prepared according to the procedure of Example 1D, replacing the product of Example 121 with the product of Example 121A (0.039 g, 37% ). MS (ESI-) m / z 434 (Μ-Η) _. The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) 6 1.54 (m, 4H), 2.33 (t, J = 5.88 Hz, 2H), 2.42 (m, 2H), 5.15 (s, 2H), 7.10 (d, J = 6.99 Hz, 2H), 7.20 (m, 3H), 7.30 (t, J = 7.35 Hz, 2H), 7.50 (td, J = 7.72, 1.47 Hz, 1H), 7.61 (dd, J = 7.72, 1.10 Hz, 1H), 17.20 (s, 1H). Example 122 1-fluorenyl-3- (1,1-Dioxide-4H-1,2,4-benzopyrimidin-3-yl V4-hydroxy-2 (1H)-

Example 122A The title compound of 2H-1,3-Hengeng-2,6 (3HV diketone was prepared by the method described by Warren and co-investigators in Caishou Yunguang Office, early 1975, 743-746. MS (DCI / NH3) m / z 131 (M + NH4) +; 1H NMR (300 MHz? DMSO-d6) 5 5.61 (d5 J = 7.72 Hz? 1H) 7.65 (d, J 2 7.35 Hz, 1H) 11.55 (s, 1H).

Example 122B 3-Hexyl_2H_1,3-Hengeng-2,6 (3HV dione 89166 -322- 200427678 The title compound was prepared according to the procedure of Example 110B, substituting the product of Example 122A for the product of Example 110A (0 · 156 g, 25%). MS (DCI / NH3) m / z221 (M + NH4) +; 1H NMR (300 MHz, DMSO-d6) 5 4.89 (s, 2H) 5.78 (d, J = 7.72

Hz, 1H) 7.37 (m, 5H) 7.97 (d, J = 8.09 Hz, 1H).

Example 122C

1-fluorenyl-3- (1,1-digasified-4H-1,2,4-benzyl and 2-diphenyl-3-4-yl V4-hydroxy-2 (1HV pyridone title compound is according to the procedure of Example ID It was prepared by replacing the product of Example 1B with the product of Example 122B (0.13 g, 5%). MS (ESI-) m / z 380 (MH)-; ^ NMRCSOOMH ^ DMSO- ^) δ 4.89 (s5 2Η) 5.53 (d5 J = 7.35 Ηζ5 1Η) 7.11 (d, J = 7.72 Hz, 1H) 7.28 (m, 6H) 7.39 (d, J = 7.72 Hz, lH) 7.50 (m, 1H) 7.61 (dd, J = 7.72, 1.10 Hz, 1H) 16.83 (s, 1H). Example 123 1-fluorenyl-3-α, 1-digasification-4H-1,2,4-benzipyrimidine-3_yl V4-hydroxy_ 5,6-

Example of dimethyl-2 (1HV pyridone) 123A-4,5-dimethyl-2H-U-humogen-2,6 (3HV dione title compound was prepared by Washbume et al., Milk 1976 77 (¾) 243 Made by the method described in -246. MS (DCI / NH3) m / z 204 (M + H) +

Example 123B 3-fluorenyl-4,5-dimethyl-211_1,3-humphin-2,6 (3-imide-dione The title compound was prepared in accordance with the procedure of Example 1B, replacing the product of Example 1A with the product of Example 123A And substituted with benzyl bromide to replace n-butane bromide (0.109 g, 27%). MS (DCI / NH3) m / z249 (M + NH4) +; iHNMRpOOMHz, 89166 -323-200427678 DMSO-d6 ) 51.86 (s, 3H) 2.14 (s, 3H) 5.09 (s, 2H) 7.32 (m, 5H).

Example 123C 1-fluorenyl-3- (1,1-digasified-4H-1,2,4-benzopyrimidin-3-yl) -4-hydroxydimethyl-2 (1HV pyridone title The compound was prepared according to the procedure of Example 1D, substituting the product of Example 123B for the product of Example 1B (0.070 g, 36%). MS (ESI-) m / z 408 (MH)-· The sodium salt of the title compound was The program of the example ID is made. IHNMR (300 MHz, DMSO-d6) δ 1.88 (s, 3Η) 2.10 (s, 3Η) 5.20 (s, 2Η) 7. 13 (m, 2Η) 7.21 (m, 2H ) 7.31 (m, J = 7.17, 7.17 Hz, 3H) 7.50 (m, 1H) 7.62 (dd, J = 7.91, 1.29 Hz, 1H) 17.28 (s, 1H). Example 124 7-fluorenyl-5 -(1,1-Dioxide-4H_1,2,4-benzopyridine-3-yl V4-hydroxy_3_methylpyridine

Benzo "2,3-bl pyridine-6 (7HV ketone example 124A 5-methyl-2H-pyrimido" 2,3-dl "l, 31 Phen-2,4 (1HV dione title compound is based on Fabis and co-investigator procedures, as described in 1998, 54, 10789-! 0800. MS (ESI-) m / z 182 (MH) '

Example 124B 1-fluorenyl-5-methyl-2H-pyrimido [~ 2,3-dl "l, 31 arsen-2,4αΗ) -dione The title compound was prepared according to the procedure of Example 1B, using Example 124A The product was substituted for the product of Example 1A and replaced with n-butane bromide by benzyl bromide (0.075 g, 50%). MS (DCI / NH3) m / z 291 (M + NH4) + ·

Example 124C 7-fluorenyl dioxide-4H-1,2,4-benzopyrimidin-3-yl M-hydroxy-3-methylpyrimidine 89166 -324- 200427678 pheno "2,3-bl pyridine- 6 (7HV ketone title compound was prepared according to the procedure of Example ID, replacing the product of Example 1B with the product of Example 124B (0.025 g, 23%). MS (ESI-) m / z 450 (MH)-. The title compound The sodium salt was prepared according to the procedure of Example ID. IHNMRpOOMHz, DMSO-d6) 5 2.46 (s, 3H), 5.12 (s, 2H), 6.47 (d, J = 1.10 Hz, 1H), 7.28 (m, 7H), 7.52 (td, J = 7.72, 1.47 Hz, 1H), 7.64 (dd, J = 7.72, 1.47 Hz, 1H), 16.31 (s, 1H). Example 125

Dioxide-4H-U, 4-benzopyrimidinium_3-yl V7-hydroxy-4_ (3-methylbutane) Pyridino 1-3,2-bl pyridine_5 (4HV ketone example 125A 1 -(3-methylbutyl) _2H-pyrimidof3,2_dl [l, 31 Phen-2,4 (1HV dione titled compound was replaced with the product of Example 110A according to the procedure of Example 1B) And made with 1 · bromo_3-methylbutane instead of n-butane bromide (0.246 g, 68%). Example 125B 6- (1,1-Dioxide_4Η_1,2, 4. Benzopyrimidine_3. V7-fluorenyl-4- (3-methylbutyl) farmepheno 1 &quot; 3,2-bl pyridine-5 (4HV ketone title compound is based on Example 1D Procedure: The product of Example 125A was used instead of the product of Example 1B (0.223 g, 52%). MS (ESI-) m / z 416 (MH)-· The sodium salt of the title compound was prepared according to the procedure of Example ID IHNMR (300 MHz, DMSO-d6) 5 0.96 (d, J = 6.90 Hz, 6H) 1.45 (m, 2H) 1.67 (m, 1H) 3.99 (m, 2H) 7.09 (d, J = 5.52 Hz, 1H ) 7.19 (d, J = 7.72 Hz, 1H) 7.26 (m, 1H) 7.53 (ddd, J = 8.55, 7.26, 1.47 Hz, 1H) 7.64 (dd, J = 7.72, 1_47 Hz, 1H) 7_80 ( d, J = 5.52 Hz, lH) 15.95 (s, lH) 89166 -325-200427678 Example 126 6- (1,1-Dioxide-4H-1,2,4-benzopyrimidin-3-yl V4- (2 · ethylbutyl V7-hydroxyl 4

Example of a benzof3,2-bl pyridine-5 (4H) -one 126A W2-ethoxybutyl V2H-pyrimido "3,2-dl" 1,31 Phenyl-2,4 (1Ην dione title compound It was prepared according to the procedure of Example 1B, substituting the product of Example 110A with the product of Example 1A, and replacing the brominated n-butane with 1-bromo-2-ethylbutane (0.116 g, 31%). MS (DCI / NH3) m / z2 ^ 71 (M + NH4) + ·

Example 126B 6- (1,1-Dioxide-4H_1,2,4-benzopyridine-3-yl) -4- (2-ethylbutyl V7_hydroxysome 4 benzo "3,2- bl pyridine-5 (4HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 126A (0.052 g, 26%). MS (ESI-) m / z 430 (M_H)- · The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) 5 0.87 (t, J = 7.35 Hz, 6H) 1.29 (m, 4H) 1 · 73 (m5 J = 13.24, 6.99 Hz, 1H) 3.91 (d, J = 7.35 Hz, 2H) 7.08 (d, J = 5.52 Hz, 1H) 7.18 (d, J = 8.09 Hz, 1Η) -7 · 25 (m, J = 7.54, 7.54 Hz, 1H) 7.53 (ddd, J = 8.55, 7.26, 1.47 Hz, 1H) 7.64 (dd, J = 7.72, 1.47 Hz, 1H) 7.78 (d, J = 5.15 Hz, 1H) 15.99 (s, 1H) · Example 127 1_fluorenyl-3 · α J_digasification-4H-1,2,4-benzilopyrimidin-3-yl V4-hydroxy-6-fluorene-5 -

Examples of phenylpyridones 127A 4-methyl-5-mosyl-2H-U-Sakigen-2,6 (3HV diketone 2-phenylacetamidine ethyl acetate (ΐ · 克, 4.85 mmol) ) And carbamate 89166 -326- 200427678 (0.43 g, 4_85 millimolar) in a solvent-free and 90 ° C heat with phosphorophosphonium chloride (3 ml) for 3 hours. Move under vacuum The excess reagent was removed, and the resulting residue was triturated with benzene and filtered. This solid was triturated with ether, filtered, and dried to yield 0.818 g (83%). MS (DCI / NH3) m / z204 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 1 · 98 (s, 3H) 7.28 (m, 2H) 7.39 (m, 3H) 11.65 (s? 1H).

Example 127B 3-methyl-4-methyl-5-benzene-2H-U-Hengeng-2,6 [The title compound of 3HV dione was according to the procedure of Example 1B, replacing the product of Example 1A with the product of Example 127A And made with benzyl bromide instead of n-butane bromide (0257 g, 71%). MS (DCI / NH3) m / z311 (M + NH4) +; iHNMRpOOMHz, DMSO-d6) 6 2.03 (s, 3H) 5.16 (s, 2H) 7.34 (m5 10H) ·

Example 127C 1-benzyl oxide-4Η-1,2 · 4-benzyl and two farming_3-some) -4-Cyclo-6-methyl-5-phenyl-2 (1HV pyridone

The title compound was prepared according to the procedure of Example ID, substituting the product of Example 127B for the product of Example 1B (0.022 g, 5%). MS (ESI-) m / z 470 (M-H)-. The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300MHz, DMSO-d6) 5 1.92 (s, 3H) 5.24 (s, 2H) 7.19 (m, 10H) 7.33 (m, 2H) 7.46 (ddd, J = 8.27, 7 · 17, 1.47Ηζ, 1Η ) 7.61 (dd, J = 7.91, 1.29Ηζ, 1H) 16.97 (s, 1H). Example 128-Emulsified -4H_1,2,4-Stupid and far two-spray-3-based &gt; -5,6-dimethyl-1- (3-methylbutane V2aHV pyridone 89166 -327- 200427678

Example 128A Ethyl 5-dimethyl-3- (3-methylbutyl) -2H-1,3-Hengeng-2,6 (3HV dione title compound was obtained according to the procedure of Example 1B, using the product of Example 123A Substituted the product of Example 1A and substituted 1-bromo-3-methylbutane with n-butane bromide (0.224 g, 60%). MS (DCI / NH3) m / z 255 (M + NH4) +; 1H NMR (300 MHz, DMSO-d6) 3 0 · 92 (d, J = 6.62 Hz, 6H) 1.46 (m, 2H) 1 · 59 (dt, J = 13.14, 6.48 Hz, 1H ) 1.85 (s5 3H) 2.26 (s, 3H) 3.77 (m, 2H). Example 128B · 3- (Ll-Dioxide-4Η-1 · 2 · 4-Mamopyridine-3-yl M- 衮A certain 5,6-dimethyl-M3-methylbutyl V2 (1HV pyridone title compound was prepared by replacing the product of Example 1B with the product of Example 128A according to the procedure of Example 1D (0.132 g, 32%) MS (ESI-) m / z 388 · The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) δ 0.94 (d5 J = 2.5 Hz, 6H) 1.87 (s? 3H ) 2.24 (s? 3H) 3.84 (m, 2H) 7.16 (m, 1H) 7.21 (m, 1H) 7.49 (m, 1H) 7.61 (m, 1H) 17.41 (s, 1H). Example 129 ·

Oxidation of H.2.4-benzylpyridine-3-yl M- (2-ethylbutyl V4-hydroxy-5,6-dimethyl-2gHV pyridone Example 129 A 3- (2-ethoxybutyl I V4,5-Dimethyl-2H-1,3-Hengeng-2,6 (The 3HV diketone title compound was prepared according to the procedure of Example 1B, replacing the product of Example 1A with the product of Example 123A, and replacing it with 1 · Br It was produced by replacing 2-bromo-2-ethylbutane with n-butane bromide (0.181 g, 45%). IHNMRpOOMHADMSOO ^ O.SSCU: 7.35 Hz, 6H) 1.29 (m, 4H) 1 · 65 (m, 1H) 1.86 (s, 3H) 2.25 (s5 3H) 3.73 (d, J = 89166 -328- 200427678 7.35 Hz, 2H) _

Example 129B 3- (1,1-Dioxide-4H-1,2,4-benzilopyridine_3-yl Vl- (2-ethylm-butyl) -4-hydroxy-5,6-dimethyl The compound of the same _2 (1H) -Edianjing with the title was prepared according to the procedure of Example 1D, replacing the product of Example 129A with the product of Example 129A (0.027 g, 9%). MS (ESI-) m / z 402 (MH) 'Sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) 5 0 · 85 (t, J = 7.35 Hz, 6H) 1.25 (m, 4H) 1.62 (m , 1H) 1.88 (s, 3H) 2.22 (s, 3H) 3_82 (m, 2H) 7_14 (d, J = 7.72 Hz, 1H) 7.21 (m, 1H) 7.48 (ddd, J = 8.46, 7 · 17, 1.65 Hz, 1H) 7.60 (dd, J = 7.91, L29 Hz, 1H) 17.42 (s, 1H). Example 130 1-Narrow radical-3- (l, l-dioxide-4H-1, 2, 4-benzo-p-di-_3-yl) -4-yl-6-benzyl-2 (1HVpyridone

Example 130A 4-Benzyl-2H-U-Ringen-2,6 (3HV dione title compound_ was prepared according to the procedure of Example 127A, replacing ethyl 2-phenylacetamidine ethyl acetate with ethyl phenylhydrazone acetate , Yielding the desired product (0.99 g, 47%). MS (DCI / NH3) m / z 188 (M + Η) +; 1H NMR (300 MHz, DMSO-d6) 5 6.03 (s, 1Η) 7.56 (m, 3Η) 7.79 (m, 2Η) 11.80 (s, 1Η). Example 130B 3-Hydroxy-4-mosyl-2H-U-Hengeng-2,6 (3HV dione title compound is based on The procedure of Example 1B was prepared by replacing the product of Example 1A with the product of Example 130A and replacing the n-butane bromide with benzyl bromide (〇_223 89166 -329- 200427678 g, 78%).

Example 130C 1-benzyl_3-α, 1-digasification · 4Η-1,2,4 · benzylpyridine-3_yl V4-hydroxyglycerol-2 (lti) qi ratio &lt; 酉The compound of the same title was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 130B (0.021 g, 6%). MS (ESI-) m / z 456 (M-H) _ _ The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz? DMSO-d6) 5 4.89 (s? 2H) 5.44 (s? 1H) 6.87 (d5 J = 6.99 Hz, 1H) 7.20 (m, 9H) 7.35 (m, 2H) 7.52 (ddd, J = 8.55, 7.26, 1.47 Hz, 1H) 7.63 (dd, J = 7.72, 1.47 Hz, 1H) 16.78 (s, 1H). Example 131

5_ (1,1 · Dioxidation_4Η-1 · 2 · 4-Benzodipyridine-3_yl) -4-hydroxy-7- (3-methyl-2-butenyl V thiophene IZ3 -bl pyridine-6 (7HV ketone example 131A 1_ (3-methylbut-2-enone) _2 Qinylpyridino The compound was prepared according to the procedure of Example 1B, replacing the product of Example 1A with the product of Example 114A and substituting 1-bromomethyl-but-2-ene with n-butane bromide (0.23 g, 82% ). MS (DCI / NH3) m / z255 (M + NH4) +; iHNMR (300 MHz, DMSO-d6) 5 1.72 (d, J = UO Hz, 3H) 1.79 (d, J = 0.74 Hz, 3H) 4.50 (d, J = 6.62 Hz, 2H) 5.23 (m, 1H) 7.28 (d, J = UO Hz, 2H) ·

Example 13 IB 5- (1,1-dioxide-4H-U.4-benzopyridine_3-yl V4-hydroxy-7- (3-methyl-2-butenyl The 2,3-bV Biyodo · 6 (7Η) -one title compound was prepared according to the procedure of Example 1D, using the product of Example 131A and 89166-330- 200427678 instead of the product of Example 1B (0.178 g, 44%). MS (ESI-) m / z 414 (MH) 'Sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300MHz, DMSO-d6) δ 1.69 (s, 3Η) 1.82 (s, 3Η ) 4.51 (d, J = 6.62 Ηζ, 2Η) 5.13 (m, 1H) 6.94 (d, J = 5.52 Hz, 1H) 7.20 (m, 2H) 7.25 (m, 1H) 7.53 (ddd , J = 8.27, 7.17, 1.47 Hz, 1H) 7.64 (dd, J = 7.72, 1.47 Hz, 1H) 16.30 (s, 1H). Example 132 1,5-Diecyl-3- (l, l-di Oxidation of 4H-1,2,4-benzo far di-p-well-3-yl) -4 • Light-based-6-

Methyl-2 (1HW Bipyridone Example 132A 5-Zyl-4-Methyl Nozzle-2,6 (3HV Dipyridyl) The same title compound was prepared according to the procedure of Example 127A using ethyl 2-benzyl keto -Ethyl butyrate is substituted for ethyl 2-phenylacetamidine acetate to produce the desired product OM (DCI / NH3) m / z218 (M + H) +

Example 132B 3,5-Difluorenylmethylformate -21! -1,3-Gengeng-2,6 (311) -dione The title compound was prepared in accordance with the procedure of Example 1B, and replaced with the product of Example 132A. The product was prepared by substituting benzyl bromide for n-butane bromide (0215 g, 76%).

Example 132C L5-Dibenzyl-3- (1,1-dioxo-4H-1.2.4-benzilopyridinium-3-yl V4-hydrazone and its methyl-2aHV pyridone title compound is according to Example 1D The procedure was prepared by substituting the product of Example 132B for the product of Example 1B (0.051 g, 15%). MS (ESI-) m / z 484 (M-Hy.

The sodium salt of the title compound was prepared according to the procedure of Example ID. 1 η NMR 89166 -331- 200427678 (300 MHz, DMSO-d6) 6 2 · 05 (s, 3H) 3.84 (s, 2H) 5.21 (s, 2H) 7.21 (m, 12H) 7.49 (m, 1H ) 7.62 (dd, J = 7.91, 1.29 Hz, 1H) 17.10 (s, 1H). Example 133 3- (U-Difluoride-4H-1,2,4-benzylpyridine-3- VH2-ethylbutyl V4-hydroxy-6-

Methyl_5_benzyl-2 (1-Hydroxy-pyridinone Example 133A 3- (2-Ethylbutanyl V4-methyl-5-phenyl-2Η_1,3 · Hengeng-2,6 (3H ) -Diketone The title compound was prepared according to the procedure of Example 1B, substituting the product of Example 127A with the product of Example 1A and substituting 1-bromo-2-ethylbutane with n-butane bromide (0.145 g , 41%). MS (DCI / NH3) m / z 288 (M + H) +

Example 133B 3- (1,1-—Oxygen-4H-1,2,4-benzophenone plug two wells-3-yl) -1- (2-ethylbutyl) -4-meryl- 6_ Methyl-5-benzyl-2 (1Ην pyridone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 133A (0.09 g, 8%). MS (ESI -) m / z 464 (Μ-Η) · · The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSQ-d6) 5 0.88 (t, J = 7.35 Hz, 6H) 1.30 (m, 4H) 1.71 (m, 1H) 2.03 (s, 3H) 3.83 (m, 2H) 7.10 (m, 3H) 7.22 (m5 2H) 7.34 (t, J = 7.17 Hz, 2H) 7.45 (ddd, J =: 8.27, 7.17, 1.47 Hz, 1H) 7.60 (dd, J = 7.91, 1.29 Hz, 1H) 17.10 (s5 1H). Example 134 Dioxide-4H-U. 4-benzopyridine-3-yl V7-hydroxy-4-pentylpyridino

`` 3,2 heptylpyridin-5 (4-imide-one example 134A 89166 -332- 200427678 h pentyl-2H-pyrimido `` 3.22-〇ηΠ, 31 Sakine-2,4 (1H) -II The ketone title compound was prepared according to the procedure of Example 1B, replacing the product of Example 1A with the product of Example 110A, and replacing the brominated n-butane with n-pentane bromide (0.205 g, 72%).

Example 134B 6- (1,1-Gasification_4H-1,2,4-benzo-p-dipent-3-yl) -7 • 1 Pyridine-5 (4-out-one title compound was prepared according to the procedure of Example 1D, using the product of Example 134A and the product of Ludai Example 1B (89.89 g, 53%). MS (ESI-) m / z 416 (MH) _. The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) 5 0.88 (m, 3H) 1.33 (m, 4H) 1.57 (m, 2H) 3.97 (m, 2H) 7.14 (d, J = 5.52 Hz, 1H) 7.18 (d, J = 8.09 Hz, 1H) 7.25 (m, 1H) 7.53 (m, 1H) 7.64 (dd, J = 7.91 , 1.29 Hz, 1H) 7.79 (d, J = 5.52 Hz, 1H) 15.96 (s, 1H). Example 135 5- (U-digasification-4H-L2.4-jalopyridine-3-yl V4-Hydroxy-3-methyl-7- (3-methylbutane, V-pheno f2,3-bl pyridine-6 (7HV ketone

Example 135A 5-methyl-2H-4 Benzo Γ2,3- (Γ | "1,31 Phen-2,4 (1HV dione title compound is according to the procedure of Fabis and co-investigator, according to 1998, 54 , Described in 10789-10800, prepared from 2-amino-4-methyl-thiophene-3-carboxylic acid ethyl ester. MS (ESI) m / zl82 (MH)-; 1 HNMR (300 MHz, DMSO-d6 ) δ ppm 2.30 (d, J = 1.47 Hz, 3H), 6.78 (s, 1H), 12.51 (s, 1Η) _

f Example 135B 5 · Methyl-H3 · Memidine, Dingmou phenphenone and "2,3-dl" Ulhengen-2,4 (1HV dione 89166 -333-200427678) The title compound was prepared according to the procedure of Example 1B. The product of Example 135A was substituted for the product of Example 1A and replaced by bromide isoamyl bromide instead of n-butyl bromide (0.048 g, 30%). MS (DCI / NH3) NMR (300 MHz, DMSO-d6) 5 0 · 94 (d, J = 6.25 Hz, 6H), 1.61 (m, 3H), 2.33 (d, J = 1.10 Hz, 3H) 5 3.83 (m, 2H), 6.92 (d, J = 1.10 Hz, 1H).

Example 135C 5- (1,1-Digasification-4H-1,2,4-benzyl-p-di-well-3-yl) -4-yl-3-methyl-7- (3-methyl The title compound was prepared in accordance with the procedure of Example 1D, replacing the product of Example 1B with the product of Example 135B (0.043 g, 52% ). MS (DCI / NH3) m / z430 (M + H) +; 1H NMR (300 MHz, DMSO-d6) 5 0.98 (d, J = 6.25 Hz, 6H), 1.67 (m, 3H), 2.50 (s, 3H), 4.13 (m, 2H), 7.08 (s, 1H), 7.55 (t, J = 7.54 Hz, 1H), 7.68 (d, J = 8.46 Hz, 1H) , 7.77 (t, J = 7.17 Hz, 1H), 7.92 (d, J = 7.35 Hz, 1H), 14.30 (s, 1H), 15.22 (s, 1H) · The sodium salt of the title compound is based on The program of the example ID is made. 1 H NMR (300 MHz, DMSO-d6) δ 0.97 (d, J = 6.62 Hz, 6H), 1.56 (m, 3H), 3.89 (m, 2H), 7.53 (m ， 5H), 16.37 (bi * s, 1H) · φ • Example 136 MU-dioxide-4H-1,2,4-benzilopyridine-3-a certain V7-hydroxy-4- (4-methyl戍

Pyridino `` 3,2 heptylpyridin-5 (4HV ketone example 136A H4-methylpentyl V2H-pyridino r3.2-dl (Ul hindu-2,4 (1HV dione title compound is based on The procedure of Example 1B was prepared by replacing the product of Example 1A with the product of Example 110A and substituting bromo-n-butane bromide with 1-bromomethylmethyl-methane (0.110 g, 61%). 89166 -334- 200427678

Example 136B 6- (1,1-Dioxide-4H-1,2,4-benzopyridine-3-yl V7_leryl-4- (4methylpentyl) Orthophenone "3, 27.11 Edian-5 (The compound with the same title as 4HVi was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 136A (0.064 g, 34%). MS (ESI-) m / z 430 ( MH)-· The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300MHz, DMSO-d6) 3 0.86 (s, 3H) 0.88 (s, 3H) 1.24 (m, J = 15.81, 6.99 Hz, 2H) 1.56 (m, 3H) 3.96 (d? J = 6.99 Hz? 2H) 7.16 (m? 1H) 7.26 (t? J = 7.35 Hz? 1H) 7.53 (t? J = 7.72 Hz , 1H) 7.64 (d, J = 7.72 Hz, 1H) 7.80 (d, J = 5.15 Hz, 1H) 15.96 (s, 1H). Example 137 4- (3-butenyl) -6- (l, l -Oxide-4H-1,2,4-benzo fardihex-3-yl) -7-light-based farphene

And [3,2_blpyridin-5 (4HV ketone example 137A 1-but-3 alkenyl_2H_pyrimido "3,2_dl" 1,31 Peng-2,4 (mV dione title compound is based on the example The procedure of 1B was prepared by replacing the product of Example 1A with the product of Example 110A, and replacing the brominated n-butane with 4-bromobutene, (0.09 g, 56%). Example 137B 4- ( 3-butenyl) -6- (U_Dioxide-4Η_1,2,4-benzilopyridin-3-yl V7- 蕤 Some ants and "3,2-bl pyridine-5 (4HV ketone title The compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example Π7Α (〇62g, 38%). MS (E8Ι-) ιώ / ζ399 · 9 (M-Hy · Sodium of the title compound The salt was made according to the procedure of Example 1D. Ihnmr (300 MHz, DMSO-d6) 5 2.34 (q, J = 7.23 Hz, 2H) 4.04 (m5 2H) 5.05 (m, 2H) 89166 -335- 200427678 5.87 (m, 1H) 7.18 (m, 2H) 7.25 (t, J = 7.17 Hz, 1H) 7.53 (m, 1H) 7.64 (d, J = 6.62 Hz, 1H) 7.79 (d , J = 5.52 Hz, 1H) 15.93 (s, 1H). Example 138

7-fluorene-5- (1,1-digasification · 4fluorene-1,2,4-benzopyrimidine, each group V4-hydroxy small benzyl-1,7-difluorene-6H-pyrazolo "3,4-Heptapyridinone Example 138A 5- (Ammonium M-phenyl-1H-pyrazole-4- # acid ethyl ester The title compound was prepared according to the procedure of Example 1B, using 5-amino-1- Phenyl-4-pyrazole-carboxylic acid ethyl ester was substituted for the product of Example 1A, and n-butane bromide was replaced with benzyl bromide (0.990 g, 83%). MS (ESI-) m / z320 ( (MH)-.

Example 138B 5- "Methenyl (3-ethoxy-3 · ketopropionyl) amino 1 small benzyl-1H-pyrazole-4-carboxylic acid ethyl ester The title compound was prepared according to Rowley and co-investigators Procedure, as described in j. Met /. CAem ·, 1993, 36, 3386-3396, product from Example 138A and ethylpropanedichloride chloride (51% yield). MS (ESI-) m / z 434 (M_H) + ·

• Example 138C 7-fluorenyl-4-crosyl-6-fluorenyl-1-benzyl-6,7_diazepine-lH-p ratio and "3,4_bl 外 b 淀 -5-building acid The methyl ester title compound was prepared from the product of Example 138B and sodium methoxide according to the procedure of Rowley and co-investigators as described in CAem "1993, 36, 3386-3396. MS (ESI-) m / z374 (M-H)-·

Example 138D N- "2- (Aminophenoxy) phenyl 1-7-yl-4-yl-6-keto-1-benzyl-6,7-di 89166 -336- 200427678] H -The pyrazolo 3,4-bl pyridine-5-carboxamide title compound was prepared according to the procedure of Example 84C, replacing the product of Example 84B with the product of Example 138C, and replacing 2- with 2-aminobenzenesulfonamide. Amino-5-bromobenzenesulfonamide was prepared (0.014 g, 61%). MS (ESI +) m / z516 (M + H) +.

Example 138E

Branchy-5- (l, l-dioxide-4H-1,2,4-jasmine # pyrimidinium-3-yl V4 · hydroxy · 1_1-1-1J-dihydro-6Η-pyridine and "3, The 4-Heptapyridin-6-one title compound was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 138D (0-61 g, 84%). MS (ESI-) m / z496 ( M-i) The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300 MHz, DMSO-d6) 5 4.92 (s, 2H), 6.53 (m, 2H), 7.21 (m, 9H), 7.43 (t, J = 7.35 Hz, 1H), 7.54 (td, J = 7.81, 1_65 Hz, 1H), 7.64 (dd, J = 7.91, 1.29 Hz, 1H), 7.88 (s, 1H), 16.05 (s, 1H). Example 139 4-fluorenyl-6- (l, l-dioxide-4H-1,2,4-benzyl and far two ton_3_based V2,7_diwei Some "1.31

Pyrazolo "4,5-bl pyridin-5 (4HV ketone-Example 139A 4 Di (fluorenylamino V2- (methylthio VU-pyrazol-5-methyl acid methyl ester title compound according to the procedure of Example 1B, It was prepared by substituting methyl 4-amino-2-methylthio-5 · ^ azole carboxylic acid for Example 1A and benzyl bromide instead of n-butane bromide (0.41 g, 57% ). MS (ESI +) m / z 295 (M + H) + ·

Example 139B 4-"(3-ethoxy-3-ketopropanoate) amino 1- (methylthio VI Yuanjun_5-carboxylic acid methyl ester 89166 -337- 200427678 Prepared according to the procedure of Example 138B, replacing the product of Example 138A with the product of Example 139A (0.147 g, 30%). MS (ESI +) m / z409 (M + H) '

Example 139C 4-fluorenyl-7-hydroxy-2- (methylthio) -5-one-4,5-dihydro "1,3 &gt; sedazof4,5-blpyridine-6-carboxylic acid ethyl The ester title compound was prepared according to the procedure of Example 138C, substituting the product of Example 139B for the product of Example 138B (0.111 g, 82%). MS (ESI-) m / z375 (MH)-·

Example 139D N- "2- (Yueanji Jiyingyingji) Dongji 1_4_fluorenyl_7-year-old to radical_2- (methylthio) -5-fluorinyl-4,5-dihydro" 1,31pyrazolo | ~ 4,5-blpyridine-6-carboxamide The title compound was prepared according to the procedure of Example 84C, substituting the product of Example 139C for the product of Example 84B, and replacing the product of 2-aminobenzenesulfonamide with Made by substituting 2-amino-5-bromobenzenesulfonamide (0.114 g, 75%). MS (ESI-) m / z501 (MH) ··

Example 139E 4-fluorenyl-6- (1,1: dioxo-4H-1,2,4-benzopyridin-3-yl) -2,7-dihydroxy [1,31 pyrazolo " 4,5 heptylpyridine-5 (4HV ketone title compound was prepared according to the procedure of Example 84D, replacing the product of Example 139D with the product of Example 139D (0.108 g, 60%). MS (ESI-) m / z453 ( MH) _ · 1H NMR (300 MHz, DMSO-d6) 5 5 · 37 (s, 2H), 7.29 (m, 5H), 7.44 (t, J = 7.72 Hz, 1H), 7.50 (d, J = 7.72 Hz, 1H), 7.67 (td, J = 7.72, 1.47 Hz, 1H), 7.82 (d, J = 7.72 Hz, 1H), 14.01 (s, 1H), 14.32 (s, 1H) The sodium salt was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.13 89166 -338-200427678 (s, 2H), 7.04 (d, J = 8.09 Hz, 1H), 7.20 (m, 6H), 7.45 (t, J = 7.35 Hz, 1Η), 7.56 (d, J = 7.72 Hz, 1H), 17.25 (s, 1H). Example 140

4-[(? .-. Gas_yl-1,3-oxazole · 5-some) methyl dioxide · 4Η-1,2,4-jamotocopheryl-3-yl) _7_hydroxypyrimidine Benzo "3,2-bl pyridine-5 (4HV ketone example 140A bis !, 3 &lt; azol-5-yl) methyl 1-2H-pyrimido" 3, 2_din, 31 huming _2.4 (ΊΗΥ · The diketone title compound was prepared according to the procedure of Example 1B, substituting the product of Example 104A with the product of Example 1A and substituting 2-chloro-5-bromomethylpyrazole for n-butane bromide (0.341 g , 75%). MS (DCI / NH3) m / z 301 (M + Η) +. 1H NMR (300 MΗζ, DMSO-d6) 6 5.35 (s, 2Η), 7.60 (d, J = 5 · 15 Hz, 1Η), 7.89 (s, 1Η), 8.38 (d, J = 5.52 Hz, 1Η), Example 140B 4-"(2-chloro-1,3-pyrazol-5-yl) formaldehyde Dihydro-4Η-1 · 2 · 4-benzylpyridinyl) -7-hydroxybenzopheno | ~ 3,2-blpyridin-5 (4HV ketone title compound was prepared according to the procedure of Example 1D, using The product of Example 14A was prepared in place of the product of Example 1B (0.134 g, 40%). MS (ESI-) m / z 477.1H NMR (300 MHz, DMSO-d6) 5 5.64 (s, 2H), 7.55 (t, J = 7.17 Hz, 1H), 7.67 (d, J = 7.72 Hz, 1H), 7.78 (t, J = 7.17 Hz, 1H), 7.86 (d, J = 5.52 Hz, 1H), 7.93 (d, J = 7.72 Hz, 1H), 7.95 (s, 1H), 8.43 (d, J = 5.52 Hz, 1H ), 14.10 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. Methyl 3- 89166 -339-200427678

(Leptinyl) methyl 1-pyridino [3,2-bl pyridine-5 (4HV ketone Example 141A

(1) methylpyridin-3-yl) methyl 1-2H-pyrimidof3,2-dl, "1,31" -2,4aHV dione The title compound was replaced by the product of Example 110A according to the procedure of Example 1B. The product of Example 1A was prepared by replacing n-butane bromide with 3-methyl-5-chloromethylpyridine (0.255 g, 38%). MS (DCI / NH3) m / z 275 (M + H ) + · 1H NMR (300 MHz, DMSO-d6) 5 2.27 (s, 3H), 5.21 (s, 2H), 7.31 (d, J = 5.52 Hz, 1H), 7.63 (s, 1H) , 8.29 (d, J = 5.15 Hz, 1H), 8.34 (d, J = 1.47 Hz, 1H), 8.47 (d, J = 1.84Ηζ, 1H).

Example 141B 6-a, l-dioxide-4Η · 1,2,4-pyridopyridine_3_yl V7-hydroxy-440methyl-3-pyridyl) methyl 1pyrido [~ 3 , 2-bl pyridine-5 (4HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 141A with the product of Example 141A (0.175 g, 43%). MS (ESI-) m / z 451 (MH) _. 1H NMR (300 MHz? DMSO-d6) δ 2.25 (s, 3H), 5.54 (s5 2H), 7.53 (m, 3H),

7.64 (d, J = 7.72 Hz, 1H), 7.75 (td, J = 7.72, 1_47 Hz, 1H), 7.92 (d, J = 7.35 Hz, 1H), 8.34 (d, J = 5.15 Hz, 1H), 8.34 (s5 1H), 8.45 (d, J = 1.47 Hz, 1H), 14.30 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. Example 142 6-Γ1.1-di-emulsified-4H_1,2,4-Feng and π plug two. Well-3-yl) -7-Ethyl-4-[(2-methyl-1,3-pyrazol-5-yl) methyl 1fluoreno [3,2-blpyridine-5 (4HV ketone

Example 142A Methyl-U-pyrazol-5-yl) methyl 1-2H-P thiophene # "3,2-dl" Ultriol 2,4 (1HV dione 89166 -340- 200427678 title compound system Prepared according to the procedure of Example 1B, replacing the product of Example 1A with the product of Example 110A, and replacing the n-butane bromide with 2-methyl-5.chloromethylpyrimazole (0.308 g, 55%). MS (DCI / NH3) m / z 281 (M + H) + · 1H NMR (300 MHz, DMSO-d6) 5 2.59 (s, 3H), 5.34 (s, 2H), 7.58 (d, J = 5_52 Hz , 1H), 7.81 (s, 1H), 8.37 (d, J = 5.52 Hz, 1H).

Example 142B i (l, l-dioxide-4H-U.4-benzopyridine-3-yl V7-hydroxymethyl-1.3-pyrazol-5-yl) 2-bl pyridine-5 (4HV ketone title compound was prepared according to the procedure of Example 1D, substituting the product of Example 142A with the product of Example 1B (0.151 g, 40%). MS (DCI / NH3) m / z459 (M + H) +. 1H NMR (300 MHz, DMSO-d6) 5 2 · 56 (s, 3H), 5.65 (s, 2H), 7.56 (t5 J = 7.17 Hz, 1H), 7.68 (d, J = 7 72 Hz, 1H), 7.79 (m, 3H), 7.93 (d, J = 7.72 Hz, 1H), 8.42 (d, J = 5.52 Hz, 1H), 14.18 (s, 1H). The sodium salt was made according to the procedure of Example ID. Example 143

44 (5-Chloro-2-pyridinyl) methyl 1-6- (1,1-digasified-4H_1 and 4 · benzopyrimidin-3-yl) -7-benzyl p-phene And read; -5 (4HV, the same as in Example 143A HO chlorothiophen-2-yl) methyl 1-2H-bispheno | &quot; 3,2-dl "L31 唠 2-2,4 (1HV dione The title compound was prepared according to the procedure of Example 1B, replacing the product of Example 1A with the product of Example 110A and substituting 2-chloro-5-chloromethylthiophene for n-butane bromide (0.601 g, 100% ).

Example 143B 44 (5-Amino-2-thienyl) methyl 1-6- (1,1-digasified-4H-L2,4-benzypyrimidine, 89166 -341- 200427678 each) _7_ The title compound was prepared according to the procedure of Example ID by replacing a product of Example 143A with a product of Example 143A (0.115 g, 12%) MS ( APCI) m / z 478 (M + H) +. 1H NMR (300 MHz, DMSO-D d6) 6 5.59 (s, 2H), 6.99 (d, J = 3.68 Hz, 1H), 7.23 (d, J = 4.04 Hz, 1H), 7.56 (t, J = 7.72 Hz, 1H), 7.68 (d, J = 7.72 Hz, 1H), 7.78 (m, 1H), 7.80 (d, J = 5.88 Hz, 1H), 7.93 (d, J = 8.09 Hz, 1H), 8.41 (d, J = 5.52 Hz, 1H), 14.18 (s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. Example 144 6- (1,1-Dioxide-4H_1,2,4 • Benzopyrimidin-3-yl V7-hydroxy-4 _ "(2-methyl-U-thiazole-4_yl) methyl 1 Pyridino, 3, 2 heptyl pyridine-5 (4HV ketone

Example 144A 1-"(2-Methyl-1,3-pyrazol-4-yl) methyl 1-2H-pyrimido" 3,2-dl "Ulgen-2,4'-dione title compound It was prepared according to the procedure of Example 1B, replacing the product of Example 1A with the product of Example 110A, and replacing the n-butane bromide with 2-methyl-4-chloromethylpyrazole hydrochloride (0.0200 G, 36%).

Example 144B 6_ (U-Digas-4Η-1,2,4-benzopyrimidin-3-yl V7-hydroxy-4-"(2-methyl-1,3-pyrazol-4-yl ) Methyl 1 benzophenone "3,2-bl pyridine-5 (4HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 144A (0.127 g, 38%). MS (ESI +) m / z459 (M + H) '1H NMR (300 MHz, DMSO-d6) δ 2.60 (s, 3H), 5.55 (s, 2H), 7.54 (t, J = 6.99 Hz, 1H) , 7.54 (d, J = 5.52 Hz, 1H), 7.65 (d, J = 7.72 Hz, 1H), 7.76 (m, 89166 -342- 200427678 1Η), 7.92 (d, J = 6 62 Hz, 1H), 8.34 (d, J = 5.51 Hz, 1H), 14.30 (s, 1H), Example 145

Pyrene-6- (l, l-dioxide-4H-1,2,4-benzylpyridine-3-some V7-pyridylthio) "1,31pyrazolo" 4,5-bl pyridine -5 (4HV ketone example 145A 4-wordyl-2- (methylthio V5H_fl, 31 pyrazolo "4,5-dl" Ul 噚 5-5; 7f4HV · 酉 酉 the same title compound according to the procedure of Example 3B It was prepared by replacing the product of Example 3A with the product of Example 139A (0.048 g, 92%). MS (DCI / NH3) m / z324 (μ + νη4) + · Example 145B 4 Dipictyl-6- (1, 1-Dioxide-4Η-1,2,4-benzilopyridine_3_yl V7- and a _2 彳 methylthiothione, "1,31pyrazolo | ~ 4,5-blpyridine-5 (The 4HV ketone title compound was prepared according to the procedure of Example 1D, substituting the product of Example 145A with the product of Example 1B (0.037 g, 51%). MS (ESI) m / z 485 (M + H) + · The title compound The sodium salt was prepared according to the procedure of Example ID. IHNMRQOOMHz, DMSO-d6) δ 2.73 (s, 3H), 5.31 (s, 2H), 7.25 (m, 7H), 7.53 (td, J = 7.72, 1.47 Hz , 1H), 7.64 (dd, J = 7.91, 1_29 Hz, 1H), 15.52 (s, 1H). Example 146 4_fluorenyl-6- (l, l-dioxide-4H-1,2, 4-benzopyrimidinium-3-a certain V7-hydroxy-2_ (methylsulfonyl) 11,31 pyrazolo "4 .5 heptopyridine-5 (4HV ketone title compound was prepared according to the procedure of Leysen and co-investigator, as described in //// raqyc / ic CAem ·, 1984, 21, 401-406. Product with 3-chloroperoxybenzoic acid as a white solid. MS (ESI) m / z515 (M-Η) ·; iHNMR (300 MHz, DMSO-d6) (5 3.59 (s, 3H), 5.51 (s, 2H), 7.32 (m, 5H), 7.51 (m, 2H), 89166 -343-200427678 7.69 (m, 1Η), 7.85 (d, J = 7.72 Hz, 1H), 13.95 ( s, 1H). Example 147 g: Substrate_4_benzyl-6- (l, l-dioxide-4H_1,2,4-benzilopyrimidine_3-yl V7_ with a certain azole 4.5-bl pyridine-5 (4HV ketone made the product of Example 146 (0.011 g, 0.02 mmol) and ammonia (0.5 μ, in dioxolane, 1.3 ml, 0.64 mmol), The reaction was carried out in a pressure tube at 70 ° C. for 17 hours. The reaction was allowed to cool, and the precipitate formed was collected by filtration and dried to give the title compound as a white solid (0.009 g, 100%). MS (ESI) m / z 452 (M_H)-; 1H NMR (300 MHz, DMSO_d6) 5 5.43 (s, 2H), 6.91 (s, 1H), 7.07 (s, 1H), 7.30 (m , 4H), 7.52 (dd, J = 24.27, 8.82 Hz, 2H), 7.69 (t, J = 7.54 Hz, 1H), 7.85 (d, J = 8.82 Hz, 1H), 9.03 (br s, 1H ), 14.57 (br s, 1H) · Example 148 radical _6- (U-digasification_4Η · 1,2,4-benzopyrimidien_3-some V7- 鼗 some | Ί pyrazolo [ 4,5-bl pyridine-5 (4HV ketone made the product of Example 147 (0.0085 g, 0.019 mmol) and tertiary-butyl nitrite (5 □, 0.037 mmol) in DMF (0.3 mL) The reaction was carried out at 60 ° C for 1 hour. The reaction was cooled, and the crude mixture was purified by column chromatography with silica gel, and the title compound was obtained by dissolving with hexane and ethyl acetate (1: 1). Yellow solid (0.0045 g, 54%). MS (ESI) m / z 437 (MH) _; 1H NMR (300 ΜΗζ, DMSO-d6) 5 5.53 (s, 2Η), 7.25 (m, 1 ，), 7.31 (m, 4Η), 7.43 (m, 2Η) 5 7.66 (m, 1H) 5 7.80 (d, J = 8.46 Hz, 1H), 9.48 (s, 1H), 14.56 (br s, 1H). 759163 Examples 149 3- (1,1-Digasification-4H-1,2,4-benzopyrimidin-3-yl V4- A small i2- stupid yl-propyl) - 1,8-port nalidixic -2 (1HV one -344-200427678 89166

Example 149A The title compound of 24 (2-benzylpropyl) amine 1 nicotinic acid ethyl ester was prepared by substituting (±) -oligomethylphenethylamine for 2-ethyl-butylamine according to the procedure of Example 3A. (0.44 g, 58%). ] \ 48 (〇0: 1+) 111/2285 (^ 4 + 11)-; 1H NMR (300 MHz, DMSO-d6) 51.25 (m, 6Η), 3.07 (m, 1Η), 3.64 (m, 3Η) ), 4.22 (q, J = 6.99 Hz, 1H), 6.61 (dd, J = 7.72, 4.78 Hz, 1H), 7.21 (m, 1H), 7.30 (m, 4H), 7.87 (t, J = 5.52 Hz, 1H), 8_05 (m, 1H), 8 · 29 (m, 1H).

Example 149B l -_ (2-Phenylpropion V2H-pyrido, "2,3_dlfl, 31 Phenyl 2,4 (1HV diketone The title compound was replaced by the product of Example 149A in Example 3A according to the procedure of Example 3B. (0 · 44 *, 99%) ° MS (DCI +) m / z283 (M + H)-; 1H NMR (300 MHz, DMSO-d6) 5 1.26 (d, J = 6.99 Hz, 3H), 3.37 (m, 1H), 4.21 (dd, J = 13.24, 6.25 Hz, 1H), 4.36 (m, 1H), 7.21 (m, 1H), 7.29 (m, 4H), 7.38 (dd , J = 7.72, 4.78 Hz, 1H), 8.39 (dd, J = 7.72, 1.84 Hz, 1H), 8.77 (dd, J = 4.78, 1.84 Hz, 1H).

Example 149C 3- (1,1-Digasification: 4H-L2.4-pyrene 4 Ergo_3-yl) · 4-hydroxy-H2-benzylpropyl 1,8_kounandian_2 ( 1Η) _ 酉 The compound with the same title was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 149B (0.045 g, 62%). 1 ^ for 31-) 11 ^ 459 () \ 4-11)-; 1H NMR (300 MHz, DMSO-d6) 5 1.23 (d, J = 7.35 Ηζ, 3Η), 3.47 (m, 1Η), 4.59 ( dd, J = 12.50, 6.62 Hz, 1H), 4.75 (m, 1Η), 7.16 (m, 1Η), 7.28 (m, 4H), 7.45 (dd5 J = 7.91, 4.60 Hz, 1H ), 7.56 (t, J = 7.54 Hz, 1H), 7.69 (m, 1H), 7.78 (m, 1H), 7.93 (d, J = 8.09 Hz, 1H), 8.53 (dd, J = 8.09, 1.84 Hz, 1H), 8.80 (dd, J = 200427678 4.60, 1.65 Hz, 1H), 14.13 (br s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1HNMR (300MHz, DMSO-d6) (n.l2 (d, J = 6.99Hz, 3H), 3.42 (m, 1H), 4.30 (dd, J = 12.50, 5.52 Hz, 1H), 4.67 (dd, J = 12.32, 9.74 Hz, 1H), 7.12 (dd, J = 7.72, 4.78 Hz, 1H), 7.18 (m, 1H), 7.30 (m, 6H), 7.56 (m, 1H), 7.67 (d, J = 7.72 Hz, 1H), 8.36 (dd, J = 7.54, 2.02 Hz, 1H), 8.50 (dd, J = 4.78, 1.84 Hz, 1H), 15.92 (s, 1H). Example 150 8-fluorenyl -6- (1,1-digasification-4Η-1,2,4 · benzylpyridine-3-yl V5-hydroxy-2- (methylthio)

Exopyridinium "2,3 · (Γ | pyrimidine-7 (8H) _one Example 150A 卞月安 基) -2- (methylthio) 口 密 淀 -5- 藏 藏 酸 酉 Title compound according to Example 108A The procedure was prepared by substituting benzylamine for 1-amino-2-ethyl-butane (0.97 g, 92%). MS (DCI / NH3) m / z 304 (M + H) + 1H NMR (300 MHz , DMSO-d6) 5 L32 (q, J = 7.48 Hz, 3H) 2 · 41 (s, 3H) 4 · 30 (q5 J = 7.11 Hz, 2H) 4.73 (d? J = 5.88 Hz, 2H) 7.30 ( m? 5H) 8.58 (s, 1H) 8.89 (t? J = 5.70 Hz, 1H) Φ

An example of 150B 4-(+ amino) -2- (methylthio) oral bite-5-metanoic acid The title compound was prepared according to the procedure of Example 108B, replacing the product of Example 108A with the product of Example 150A (0.185 G, 78%).

Example 150C 1-fluorenyl-7- (methylthio V2H-pyrimido "4,5-dl" l, 31H2-2,4 (1HV diketone The title compound was according to the procedure of Example 108C, the product of Example 150B Made from the product of Example 108B (0.145 g, 72%). MS (DCI / NH3) m / z 302 89166 -346- 200427678 (M + H) +

Example 150D 8- 宇 A_-6- (l, l-dioxide · 4Η-1,2,4-benzopyridine, each group V5-hydroxy-2- (methylthio) pyrido "2,3- The dl pyrimidine-7 (8H) _one title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 150C (0.042 g, 18%). MS (ESI-) m / z 478 (MH ) _ · The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6) 5 2.48 (s, 3H) 5.41 (s, 2H) 7.26 (m, 7H) 7.57 (m, 1H) 7.67 (dd, J = 7.54, 0.92 Ηζ, 1Η) 8.91 (s, 1Η) 15.42 (s, 1Η). Example 151 Geki (U-Dioxide_4H-1,2,4-Bun Pyridoxine-3-yl V5-hydroxypyridine "2,3-dl pyrimidine-7 (8HV ketone title compound was prepared according to the procedure of Example 109, replacing the product of Example 108D with the product of Example 151D (0.019 g, 58%). MS (ESI-) m / z432 (MH)-; 1H NMR (300 MHz, DMSOd6) 5.44 (s, 2H) 7.20 (m, 1H) 7.30 (m, 7H) 7.57 (m, 1H) 7.68 (d, J = 8.09 Hz, 1H) 8.94 (s, 1H) 9.12 (s, 1H) 15.32 (s, 1H). Example 152 Oxidation of 4H_U, 4_benzyl and 4 second tiller · 3_yl V4_hydroxy _H3-Tibetan) _ 2 (1 H) -Koukoukoulin A solution of the product of Example 73 (0.12 g, 0.30 mmol) in tetrahydrofuran (6 ml) was used at -50 ° C at 3.0 M methyl bromide (0.11 ml, 0.33 mmol) and then stirred at room temperature for 1 hour. The solution was diluted with 1NHC1 and water 'followed by filtration. The solid formed was triturated with dichloromethane and filtered through 89166-347- 200427678. The filtrate was concentrated, The title compound was obtained (0.050 g, 40%). MS (DCI / NH3) m / z 415 (M + H) +; 1H NMR (300 MHz, DMSO-d6) δ 1.14 (d5 J = 6.25 Hz? 3H) 1.75 (dd, J = 9.19, 5.52 Hz, 2H) 3.78 (m, 1H) 4.57 (m, 2H) 7.54 (m, 2H) 7_77 (m, 2H) 7.94 (d, J = 7.35 Hz, 1H) 8.58 (dd, J = 7.91, 2_02 Hz, 1H) 8.90 (dd, J = 4.78, 1.84 Hz, 1H) 14.12 (s, 1H). Example 153 1-fluorenyl-3- (l, l-digasification -4H-1,2,4-Stupid and far two-cult-3-yl) -4-¾

[3,4-blpyridin-2 (1HV ketone example 153A thieno "3,4-dirUl burgen-2,4aHV dione titled compound according to the procedure of Example U9A, using 3-aminopyrimidine-5-carboxylic acid ethyl Ester hydrochloride was prepared by replacing 3-amino-5-phenylthiophene-carboxylic acid methyl ester (0.86 g, 50%). MS (DCI / NH3) m / zl87 (M + NH4) +; iHNMR (300 MHz , DMSO-d6) δ 6.90 (d, J = 9.93 Hz, 1H) 8.65 (d, J = 9_93 Hz, 1H) 11.57 (br s, 1H).

Example 153B Cepheno | 3,4-dlll, 3 卩 咢, 2,4 (1Η) _dione The title compound was prepared in accordance with the procedure of Example 1B, replacing the product of Example 1A with the product of Example 153A, and bromine Made from benzyl bromide instead of n-butane (0,33 g, 91%).

Example 153C Group_4H-1,2,4_jalopyridin-3-yl M-hydroxypyrido [~ 3,4-blpyridin-2aH) -one The title compound was prepared according to the procedure of Example 1D, with The product of Example 153B was prepared in place of the product of Example 1B (0.028 g, 5%). MS (ESI-) m / z 436 (MH) 89166 200427678; ^ NMRCSOOMH ^ DMSO- ^) δ 5.13 (s5 2H) 6.68 (d5 J = 3.31 Hz? 1H) 7.21 (m, 2H) 7.28 (m5 5H) 7_54 (m, 1H) 7.64 (m, 1H) 7.99 (d, J = 3.31 Hz, 1H) 15.83 (s, 1H). Example 154

4-[(5-Methoxy: 2-pyrimidinyl) methyl 1-6- (1,1-digasification-4H-1,2,4-benzilopyrimidin-3-yl)- 7-Hydroxypyridino "3,2-bl pyridine-5 (4HV ketone example 154A 1-[(Bromopyrimidin-2-some) methyl 1-2H-bispheno" 3,2-din, 31 噚 2,4 (1HV dione title compound was replaced by the product of Example 110A with the product of Example 110A according to the procedure of Example 1B, and the bromide was replaced with 2-bromo-5-bromomethyl-thiophene -Butane (0. 25 g, 82%). Example 154B 4 bis-bromo-2-fluorenone methyl) Digasification of 4-fluorene-1,2,4-benzopyrimidine- The 3-ylpyridine-hydroxybispheno-3,2-bl pyridine-5 (4HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 154a (0.219 g, 58%) MS (ESI ·) m / z 521. The steel salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300MHz, DMSO-d6) δ 5.28 (s? 2H) 7.02 (d? J = 3.68 Hz5 1H) 7.09 (d? J = 3.68 Hz? 1H) 7.20 (d, J = 8.09 Hz, 1H) 7.27 (m, 1H) 7.37 (d, J = 5.15 Hz, 1H) 7.54 (ddd, J = 8.55, 7.26 , L47 Hz, 1H) 7.66 (dd, J = 7.72, 1.47 Hz, 1H) 7.81 (d, J = 5.15 Hz, 1H) 15.80 (s? 1H). Example 155 liX groups (l, Ii tri-A-4H-1,2,4- japan pyridinium each) -2 (lHV Eridine

Example 155 A 89166 -349- 200427678 1-Butyl-2-keto-1,2-dihydrop-pitu-3-acid in 2-hydroxy-nicotinic acid (0.50 g, 3.59 mmol Ear) and potassium hydroxide (0.40 g, 7.13 mmol) in a 4: 1 methanol: water (6 ml) solution at room temperature was added '1-iodobutane (0.74 ml, 6.42 Mol). This solution was heated at 60 ° C for 30 minutes, then cooled to room temperature, and diluted with water and 1N HC1. The solid formed was filtered and dried to give the title compound (0.27 g, 39%). MS (DCI / NH3) m / z 196 (M + H) +; 1H NMR (300 MHz, DMSO-d6) (5 0 · 91 (m, 3H) U0 (m, 2H) 1.69 (m, 2H) 4 · 10 (m, 2H) 6.73 (m5 1H) 8.27 (dd, J = 6.62, 1.84 Hz, 1H) 8.38 (dd, J = 7.35, 2.21 Hz, 1H) 14.68 (s, 1H).

Example 155B Aminosulfosulfonium) Phenyl i small butyl-2-keto-4,2-dihydropyridine-3-carboxamidine The product of Example 155A and 2-aminobenzenesulfonamide (0.24 g, 1.39 mmol) in tetrahydrofuran (8 ml), at room temperature, with tbTU (0- (1 苯 -benzotriol-1_yl) _N, N, N ', N' · tetramethyl Pyrene tetrafluoroborate) was treated with triethylamine (0.58 ml '4.15 mmol). After 1 hour, the mixture was poured into water, extracted with ethyl acetate, dehydrated and dried over sodium sulfate, filtered, and the filtrate was evaporated under vacuum, and in a Waters symmetrical C8 column (40 mm x 100 mm, 7 micron particles) Size), purified by preparative HPLC, using a gradient of 10% to 100% acetonitrile:% TFA aqueous solution over 12 minutes (15 minutes operation time) at a flow rate of 70 ml / min to produce the title compound .

Example 155C 1: .X group_3_ (1,1_monoemulsified_4H-1,2,4_benzodiobi-3-ylpyridone.The title compound was according to the procedure of Example 84D and was symmetrical with Waters A pure C8 column (40 mm x 100 mm, 7 micron particle size) was prepared from HpLC pure 89166-350-200427678, using a gradient solution of 10% to 100% acetonitrile · 0J% TFA aqueous solution, over 12 minutes (15 Minute operating time), prepared at a flow rate of 70 ml / min. MSDCI / NH3) m / z332 (M + H) +. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 6 0 · 93 (t, J = 7.35 Hz, 3H) 1.34 (td, J = 14.89, 7.35 Hz, 2H) 1.73 (ddd, J = 14.89, 7.72, 7 · 54 Hz, 2H) 4.13 (m, 2H) 6.73 (dd, J = 7.35, 6.62 Hz, 1H) 7.50 (m, 1H) 7.59 (d, J = 7.35 Hz, 1H) 7.71 ( m, 1H) 7.85 (dd, J = 7.91, 1.29 Hz, 1H) 8.30 (dd, J = 6.43, 2.02 Hz, 1H) 8.62 (dd, J = 7.54, 2.02 Hz, 1H) 13.76 (s, 1H) · Example 156 ^ 1,1-Digasification-411-1.24-benzopyrimidinium-3-yl) -1,8-pyridine-2,4-difluorene makes the product of Example 73 (0.12 g, 0.30 mmol) in tetrahydrofuran (6 ml) and 3.0 M methylmagnesium bromide (0.11 ml, 0.33 mmol), reacted at -50 ° C, and then stirred at room temperature for 1 hour. The solution was diluted with 1NHC1 and filtered. The resulting solid was triturated with dichloromethane and filtered to give the product. MS (DCI / NH3) m / z 343 (M + H) +; 1H NMR (300 MHz, DMSO-d6) ^ 7.46 (dd, J = 7.91, 4.60 Hz, 1H) 7.57 (m, 1H) 7.64 (d , J = 7.72 Hz, 1H) 7.79 (ddd, J = 8.36, 7.26, 1.29 Hz, 1H) 7.94 (d, J = 7.35 Hz, 1H) 8.49 (dd, J = 8.09, 1.84 Hz, 1H) 8.80 (dd, J = 4.60, 1.65 Hz, 1H) 12.92 (s, 1H) 14.28 (s, 1H). Example 157-based VKU · Dihydro-4H-1,2,4 • Benzopyridine-3 -Base V4-hydroxy-U-

Pyridine-2 (1HV ketone example 157A 2-"(fluorenyl) amino 1 nicotinic acid ethyl ester 2-chloro-ethyl alkanoate (4.55 g, 24.6 mmol), 0-benzyl hydroxyl Amine salt 89166 -351-200427678 fe salt (7.85 g '49_2 hamol) and N, N-diisopropylethylamine (6.36 g, 49.2 4 moll) in 10¾ liters of 1,4-dioxolane In a sealed tube, react at 12.0 for 48 hours. The reaction mixture was separated between ethyl acetate and aqueous sodium bicarbonate solution. The aqueous layer was re-extracted with ethyl acetate (2 × 50 ml). Organic The layers were combined and dried over sodium sulfate, filtered, and concentrated. The residue was purified by column chromatography on silica gel with hexane and ethyl acetate (9: υ ^ 'to provide the title compound (3.5 g, 53 %). MS (DCI) m / z273 (M + H) +.

Example 157B M (Tyryl) (3-ethoxy-3-ketopropylamidino) amine ethyl 1 alkanoate The product of Example 157A (1.2 g, 4.4 mmol) and triethylamine ( · A solution of 49 g, 4.8 molole) in chloromethane (25 liters), treated with ethyl chloromalonate (0.73 g, 4.8 mmol), and stirred for 2 hours, The solution was separated between ethyl acetate and water, and the liquid layer was separated. The ethyl acetate layer was washed with brine, dried (Na # SO #), and concentrated. The residue was purified by 胶 chromatography on hard gelatin, and dissolved in hexane and ethyl acetate (3: 1) to provide the title compound (1.1 g, 65%). MS (DCI) m / z387 (M + H) +.

An example of the 157C group) -4- each keto-1-1,2-dihydro-1,8-fandian-3_ roll 醢 r "brewing the product of Example 157B (0.386 g, 10 millimoles ) In ethanol (5 ml) of the solution, treated with 21% sodium ethoxide (0.324 g, __0 mmol) in ethanol, stirred for 30 minutes, and mixed with ethyl acetate and 5% HC1 aqueous solution Interlayer liquid separation process' and separate liquid layer. The ethyl acetate layer was washed with brine, dehydrated and dried to dryness, and concentrated to provide the title compound (0.28 g, 82%). Ms①Insignia 341 (M + H) +. 89166 200427678

Example 157D group) Benzene 1.1- (fluorenyl group V4-Leryl-2-SI1 group-1,2-dihydro-1 · 8-yl group-3-multi acid amine The title compound is based on the formula of Example 84C. Procedure: Substituting the product of Example 157C with the product of Example 8 and replacing the product of Example 84A with 2-aminosulfamidamide (340 mg, 89% yield). MS (DCI) m / z 467 ( Μ + Η) + · Example 157E lz (fluorenyl group V3- (l, l-digasification_4Η-1,2,4-benzoxazone_3_yl) -4-¾yl-1 , 8-Pyrididine-2 (1HV ketone title compound was prepared according to the procedure of Example 84D, replacing the product of Example 8 with the product of Example 157D (0.082 g, 87%). MS (ESI-) m / z447 (M-Hy · The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 η NMR (300 MHz, DMSO-d6) 5 5 · 12 (s, 2H) 7.22 (dd, J = 7.72, 4 · 78 Hz, 1H) 7.30 (m, 2H) 7.44 (m, 3H) 7.57 (m, 1H) 7.70 (m, 3H) 8.41 (dd, J = 7.72, 1.84 Hz, 1H) 8.61 (dd, J = 4.78, 1.84 Hz, 1H) 15.70 (s, 1H) · Example 158 ML1- dioxide r4H-l, 2,4_ stupid and broken second crop_3_even) _4_ 蕤 a small isobutoxy- l, 8-

Pyridine-2 [1HV West Iϋ Example 158A Ethyl nicotinate standard compound was prepared according to the procedure of Example 157A, replacing 0-benzylhydroxylamine hydrochloride with 0-isobutyl light amine hydrochloride ( 0.372 g, 34%). MS (DCI) m / z239 (M + H) +.

Reverted to 58B 89166 -353-200427678 2-"(3-ethoxy-3-fluorenylpropanyl) (isobutoxy) amino 1 The title compound was tested according to the procedure of Example 157B, The product of Example 158A was used instead of the product of Example 157A (0.230 g, 42%). MS (DCI) m / z 353 (M + H) '

Example 158C 4-Alkyl-1-isobutyllactyl-2-fluorenyl-1,2-diazine-1,8-nanido-3-acidacetic acid The title compound was prepared according to the procedure of Example 157C, using The product of Example 158B was prepared in place of the product of 157B (0.200 g, 99%). MS (DCI) m / z 307 (M + H) +.

Example 158D N- "2_ (Yueanji luteol group) base ~] -4_Cycloyl-1-isobutoxy-2-pyridyl-1,2-diaza-1,8- Fandian -3-The title compound was prepared according to the procedure of Example 84C, replacing the product of Example 84B with the product of Example 158C, and substituting the product of Example 84A with 2-aminosulfamonium (0-225 g, 86 %). MS (DCI) m / z 433 (M + H) + ·

Example 158E 3- (1,1- ^ ^ Vg -4H-1, ^ &quot; T ^ -1,8-monopyridin-2 (1Ηνone The title compound was replaced by the product of Example 158D according to the procedure of Example 84D Example 84C (0.200 g, 93%). MS (ESI-) m / z413 (MH) _. The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6 ) 5 1.05 (d? J = 6.62 Hz5 6H) 2.08 (m? 1H) 3.88 (d? J-6.62 Hz, 2H) 7.18 (dd, J = 7.72, 4.78 Hz, 1H) 7.29 (m, 2H) 7 · 55 (m, 1H) 7.67 (d, J = 7.72 Hz, 1H) 8.37 (dd, J = 7.72, 1.84 Hz, 1H) 8.55 (dd, J = 4.78, 1.84 Hz, 1H) 15.72 (s? 1H). 89166 -354-200427678 Example 159 Digassing-4Η-1,2,4-benzoxenol-3_yl) -4-transpyridine-2 (1HV ketone example 159A 2Il · ^ pyridinyl | 3,2-dl "Ul $ Geng_2,4qHV dione title compound was prepared from 2,3-pyridine according to the procedures of Le Count, DJ and co-investigators as described in No. 4,1982, 972-973. Carboxylic anhydride (11.4 g, 76 mmol) and trimethylsilyl azide (1 L0 ml, 80 mmol) are the fewer double products (0.50 g, 4%). 1H NMR (300 MHz , DMSO-d6) 5 7.56 (dd, J = 8.46, I. 47 Hz, 1H) 7.71 (dd, J = 8.46, 4.41 Hz, 1H) 8.51 (dd, J = 4.41, 1.47 Hz, 1Η) II. 78 (s5 1H) .

Example 159B kX_ ^ -2H_pyrido "3,2-dl" U &gt; No. 2-2,4 (1HV dione title compound was prepared according to the procedure of Example IB, replacing the product of Example 1A with the product of Example 159A (0.12 g, 35%). 1H NMR (300 MHz, DMSO-d6) 5 0 · 92 (t, J = 7.35 Hz, 3H) 1.40 (m, J 2 15.26, 7.17 Hz, 2H) 1.60 (m, 2H) 3.98 (m, 2Η) 7.81 (ddj = 8_82, 4.41 Ηζ, 1Η) 7.97 (dd, J = 8.64, 1.29 Ηζ, 1Η) 8.55 (dd, J = 4.23 , 1.29 Ηζ, 1Η).

Example 159C 1-Butyl-3- (l, l_monogas-4H-1,2,4-benzyldipent-3-yl) -4-¾yl-1,5 · pyridine-2 ( 1HV ketone

The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 159B for the product of Example 1B (0.053 g, 25%). MS (ESI-) m / z 397 (M-H) · The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR 89166 -355-200427678 (300 MHz, DMSO-d6) 5 0 · 94 (t, J = 7.17 Hz, 3H) 1.39 (m, 2H) 1.54 (m, 2H) 4.07 (t, J = 7.72 Hz 2H) 7.28 (m, 2H) 7.56 (m, 2H) 7.68 (dd, J = 7.91, 1.29 Hz, 1H) 7.77 (d, J = 8.46 Hz, 1H) 8.39 (d, J = 4.04 Hz, 1H ) 16.15 (s5 1H) Example 160 1-fluorenyl-3- (1,1-dioxo-4d-4-4-1,2,4 · benzobenzodipent-3-yl V4-meryl-1, 5 ·

Pyridine-2 (1HV ketone example 160 A

1_fluorenyl_2H-pyridof3,2-dl, l, 31 Sakamoto-2,4 (1HV dione title compound was replaced with the product of Example 159A by the procedure of Example 1B, and Made from benzyl bromide instead of n-butane bromide (0.92 g, 60%). IHNMR (300 MHz, DMSO-d6) (5 5.28 (s, 2H) 7.33 (m, 3H) 7.43 (m, 2H) 7.70 (m, 2H) 8.54 (dd, J = 3.86, 1.65 Hz, 1H).

Example 160B

1-fluorenyl · 4-Domanyl-2-fluorenyl-1,2-diazide-1,5_xanthate-3-acetic acid ethyl ester The title compound was prepared according to the procedure of Example 89A, with Example 160A The product was replaced by the product of Example 1B (0.110 g, 23%) cMS (DCI) m / z325 (M + H) +.

Example 160C N- "2- (Aminosulfonyl Dphenyl 1-l-fluorenyl-4-hydroxy-2-keto-L2-difluoren-1-5 1 The title compound was prepared according to the procedure of Example 89B, replacing the product of Example 89A with the product of Example 160B, and substituting 2-amino-4-chlorobenzenesulfonamide with 2-aminobenzenesulfonamide (0.12 g , 86%). MS (ESI-) m / z 4 milk (M-Η) ··

Example 160D m each of (U-dihydro-4H-1,2,4-benzopyridine-3_yl V4- # f a -1.5- 89166 -356- 200427678. Nai-2 (1HV ketone title compound Made according to the procedure of Example 84C, replacing the product of Example 84B with the product of Example 160C (0.120 g, 99%) cMS (ESI-) m / z 431 (MH)-. The sodium salt of the title compound is based on Example ID The program is made. IHNMR (300MHz, DMSO-d6) 5 5.39 (s, 2H) 7.25 (m, 7H) 7.40 (dd, J = 8.46, 4.41Ηζ, 1Η) 7.57 (m, 2H) 7 · 68 (d, J = 8.09 Hz, 1H) 8.35 (d, J = 4.04 Hz, 1H) 16 · 11 (s, 1H) · Example 161 1-fluorenyl-4_chloro each α, 1-dioxide- 4H-1,2,4-Benzopyrimidin-3-yl-4pyridin-2 (1HV ketone title compound is based on that described in 襻 环 允 # 广 办, ϋ, 1998, 627-636, Stadlbauer, W And the procedures of the co-investigator, produced from the product of Example 15B and phosphonium chloride (2_07 g, 88%). MS (ESI-) m / z449 (MH)-; iHNMR (300 MHz, DMSO-d6) δ 5.68 (s, 2H) 7.29 (m? 6H) 7.57 (m5 2H) 7.75 (m5 1H) 7.92 (dd, J = 7.91, 1.29 Hz, 1H) 8.56 (dd, J = 8.09, 1.47 Hz, 1H) 8.87 (dd5 J = 4.60, 1.65 Hz, 1H) 12.73 ( s, 1H). Example 162 3- (U-Digas-4H-1,2,4-benzilopyrimidin-3-yl V4-hydroxy small 丨 ((1E) _ 笨 基 i

Methyl 1 amino group-2 (1HV peridolinone example 162 A 2 "" (2EV2- benzylidenehydrazino 1 benzoic acid title compound according to the description in CAem · 5er ·, M, 1902, 2318, Fischer , E. and co-investigator's procedure, made from 2-hydrazinobenzoate hydrochloride (1.89 g, lo.o mmol) and benzaldehyde (1.06 g, 10.0 mmol) ) (2.4 g, quantitative yield) MS (DCI) m / z 241 (M + H) +. 89166 -357- 200427678

Example 162B 1-{[(1E) -phenylmethylene 1 amine 2H-3,1-benzyl-2.4-1Ην 2 g Same as the product of Example 162A (1.2 g, 5.0 mmol) and A solution of potassium hydroxide (0.336 g, 6.0 mmol) in 15 ml of water was treated dropwise with 20% phosgene (3.5 ml, 6.5 mmol) in toluene at 0 ° C, and stirred for 1 hour. Treat with 1M NaOH to reach pH 10 and extract 3 × 30 ml with ethyl acetate. The ethyl acetate extracts were combined, washed with brine, dried (Na2SO4), and concentrated to provide the title compound (0.32 g, 24%). MS (DCI) m / z267 (M + H) +.

Example 162C H1-monogasified-4H-1,2,4-benzyldihex-3-yl) _4-Cyclo-1--1-[[| 1EVphenylmethylene-1amino} · 2ΠΗ &gt; quinoline The ketone title compound was prepared according to the procedure of Example 1D, substituting the product of Example 162B for the product of Example 1B (o.iog, 49%). MS (ESI-) m / z 443 (Μ-Η) _. The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz? DMSO-d6) 5 7.16 (m, 1H) 7.30 (m? 2H) 7.54 (m5 6H) 7.67 (dd5 J = 8.09, 1.47 Hz, 1H) 7.99 (m, 2H) 8.13 (dd, J = 7.91, 1.29 Hz, 1H) 9.04 (s, 1H) 16.09 (s, 1H) ·, Example 163

i = | ^ · 3_α, 1-dioxo> fh -4H4,2,4-benzylpyridine, each base) -4-hydroxy-2atiV Koukoukoulin, together with the product of Example 162C (〇 · 〇 75 g, 0-17 mol) in a 10% potassium hydroxide aqueous solution (5 ml) was refluxed for 2 hours, cooled, and treated with 12 M HC1 to a ρΗ value of 3 ', which would produce a precipitate. The solid was collected by filtration, washed repeatedly with water, and dried to constant mass to obtain the desired product (0.050 g, 83%). 89166 -358-200427678 MS (ESI-) m / z 355 (M-H) _-The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) δ 5.31 (s, 2H) 7.05 (t, J = 8.09 Hz, 1Η) 7.27 (m, 2Η) 7.53 (m, 2Η) 7.67 (m , 2Η) 8.07 (dd, J = 8.09, 1.47 Ηζ, 1Η) 16.38 (s, 1H). Example 164 HLI ^ oxidation-4H-1,2,4-benzopyrimidin-3-yl Hydroxy-1 彳 2-benzylethyl)-

1,8-xanthidine_2 (1HV ketone example 164 A 2-"(2-phenylethyl) amino acid test ethyl acetate title title compound according to the procedure of Example 3A, replacing 2-ethyl with phenethylamine -Butylamine (1 · 98 g, 73%). MS (DCI) m / z 271 (M + H) + ·

Example 164B Phenylethyl V2H-pyrido "2.3-dl" 1,31,2-2,4 (1Ην dione The title compound was prepared according to the procedure of Example 3B, replacing the product of Example 3A with the product of 164A ( 0.53 g, 99%). MS (DCI) m / z 269 (Μ + Η) + ·

Example 164C —Emulsified-4Η-1,2,4-benzo fare [3_yl) -4-pentyl-1- (2-phenylethyl) -1,8-4pyridin-2 (1HV ketone

The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 164B for the product of Example 1B (0.32 g, 59%). MS (ESl ·) m / z 445 (M-H) 'sodium salt of the title compound was prepared according to the procedure of Example 1D. iHNMR (300 MHz, DMSO-d6) (5 2.87 (m, 2H) 4.47 (m, 2H) 7.16 (dd, J = 7.72, 4.78 Hz, 1H) 7_29 (m, 7H) 7.57 (m, 1H) 7.67 (d, J = 7.72 Hz, 1H) 8.40 (dd, J = 7.72, 1.84 Hz, 1H) 8_57 (dd, J = 4.78, 1.84 Hz, 1H) 15.90 (s, 1H). 89166 -359- 200427678 Example 165 1-Butyl-4A-based digasification · 4Η · 1,2,4 · Mosinopyridine-2 (1HV ketone title compound is according to the procedure of Example 161, using Example 1D The product was prepared in place of the product of Example 15B. Example 166

4-Amine-_LJ 4_zHLJ-Dioxide-4H-1,2,4_Morocopeptide-3, a certain VH Pyridine-2 (1HV ketone will be the product of Example 165 (0.05 g, 0.24 MM) and ammonia (2 ml of 2M solution in methanol, 4.0 mM) in a sealed tube, stirred at 10 (rc for 2 hours, allowed to cool to room temperature. Collected by filtration The formed solid was washed with methanol (2 liters) to give the title compound as a brown solid (019 g, 20%). MS (ESI-) m / z 396 (MH)-; 1H NMR (300 MHz, DMSO-d6) 5 0.94 (t, J = 7.35 Hz, 3H), 1.38 (m, 2H), 1.66 (m, 2H), 4.44 (t, J = 7.35 Hz, 2H) , 7.48 (m, 2H), 7.55 (d, J = 8_09 Hz, 1H), 7.70 (t, J = 8.46 Hz, 1H), 7.84 (dd, J = 7.72, 1.10 Hz, 1H ), 8.77 (d, J = 8.09 Hz, 1H), 8.82 (dd, J = 4.78, 1.47 Hz, 1H), 9.84 (brs, 1H). Example 167 1-butyl-3- (l, l-di The oxidized-4H-1,2,4-benzylamine-di-3-yl) -4- (methylaminopyridine-2 (1HV ketone title compound was prepared according to the procedure of Example 166 using methylamine (in methanol 2M solution) instead of ammonia (2M solution in methanol) Made as a brown solid (0.023 g, 23%). MS (ESI-) m / z410 (MH)-; WNMRpOOMHADMSa ^) 5 0.91 (t, J = 7.17 Hz, 3H), 1.34 (m, 2H ), 1.60 (m, 2H), 2.95 (d, J = 5.15 Hz, 89166 -360- 200427678 3H), 4.31 (m, J = 7.36 Hz, 2H), 7.36 (dd, J = 8.09, 4.78 Hz, 1Η), 7.40 (d, J = 8.4 6 Hz, 1H), 7.49 (t, J = 8.09 Hz, 1H), 7.71 (m, 2H), 7.85 (dd, J = 7.91, 1.29 Hz , 1H), 8.56 (dd, J = 8.27, 1.29 Hz, 1H), 8.69 (dd, J = 4.60, 1.29 Hz, 1H), 12.44 (br s, 1H). Example 168

l.:XA:4-(dimethylamino V3- (l, l-digas-4H-1,2,4-benzilopyrimidine) 3_ Some L Pyridine-2 (1HV ketone title compound It was prepared according to the procedure of Example 166 by replacing dimethylamine (2M solution in methanol) with ammonia (2M solution in methanol) as a brown solid (0.015 g, 15%). MS (ESI- ) m / z 424 (MH)-; iHNMR (300 MHz, DMSO-d6) 5 0.93 (t, J = 7.35 Hz, 3H), 1.36 (m, 2H), 1.63 (m, 2H), 2.99 (s, 6H), 4.36 (t, J = 7.72 Hz, 2H), 7.38 (m, 2H), 7.51 (m, 1H), 7.73 (m, 1H), 7.88 (dd, J = 8.09, 1.47 Hz, 1H), 8.36 (dd, J = 8.09, 1.47 Hz, 1H), 8.71 (dd, J = 4.78, 1.84 Hz, 1H), 12.45 (s, 1H) · Example 169 1-butyl-3- (1,1-di Oxidation of _4H-1,2,4-benzopyridine_3-yl) -4_fluorenyl-1.8- Yikou Naiyodo-2 (1 Η)-酉 The compound with the same title was prepared according to the procedure of Example 166, with Prepared as a brown solid (0.026 g, 26%) by replacing hydrazine with a 2 M solution in methanol. MS (ESI-) m / z 411 (M-Η) ·; 1H NMR (300 MHz, DMSO -d6) 5 0.94 (t, J = 7.35 Hz, 3H), 1.39 (m, 2H), 1.64 (m, 2H), 3.35 (br s 3H), 4.41 (t, J = 7.72 Hz, 2H), 7.04 (t5 J = 7_54 Hz, 1H), 7.42 (dd, J = 7.72, 4.78 Hz, 1H), 7.57 (m, 1H), 7_83 (dd, J = 7.91, 1.65 Hz, 1H), 8.49 (dd, J = 7.72, 1.84 Hz, 1H), 8.64 (d, J = 8.46 Hz, 1H), 8.68 (dd, J = 4.78, 1.84 Hz, 1H), 9.65 (s, 1H). 89166 -361-200427678 Example 170 Butyl-3- (l, l-dioxide-4H-1,2,4-benzylidene-3-yl Vl, 8 -Houdian_2 (1HV) (the product of Example 165 (〇. 克, 〇.24mmol) and sodium azide (〇37g '〇_571mmol) in dimethylformamide The solution in amidine (2.5 ml) was stirred at 8 ° C for 1.5 hours, allowed to cool to room temperature, and concentrated under reduced pressure. The crude residue was purified by a C8 HPLC column and dissolved with 20% to 80% acetonitrile in water with 1% trifluoroacetic acid to obtain the title compound (0.25 g, 26%, after column purification). MS (ESI-) m / z 422 (MH)-; 1H NMR (300 MHz, DMSO-d6) 5 0_94 (t, J = 7.35 Hz, 3H), 1.38 (m, 2H), 1.67 (m, 2H), 4.42 (t, J = 7.54 Hz, 2H), 7.41 (d, J = 7.72 Hz, 1H), 7.46 (dd5 J = 7.91, 4.60 Hz, 1H), 7.56 (m, 1H), 7.76 (m, 1H), 7.91 (dd, J = 8.09, 1_10 Hz, 1H), 8.41 (dd, J = 8.09, 1.84 Hz, 1H), 8.84 (dd5 J = 4.41, 1.84 Hz, 1H), 12.74 (s, 1H). Example 171.! Dibutyl Dioxide-4H-1,2,4-benzyldi (3-diethyl)) Amine 1-1,8-pyrimidine -2 (The title compound of 1HV ketone was prepared according to the procedure of Example 166, replacing ethanol (2M solution in methanol) with ethanolamine (0.25 g, 4.0 mmol) and anhydrous methanol (2 ml) (0.02 g, 19 %). MS (ESI-) m / z 440 (MH)-; 1H NMR (300 MHz, DMSO-d6) 5 0 · 92 (t, J = 7.35 Hz, 3H), 1.35 (m, 2H), 1.61 (m, 2H), 2.71 (m, 1H), 3.40 (m, 1H), 3.47 (m, 2H), 3.57 (m, 2H), 4.32 (t, J = 7.36 Hz, 2H), 7.35 ( m, 1H), 7.39 (d, J = 6.99 Hz, 1H), 7.44 (t, J = 7.72 Hz, 1H), 7.51 (br s, 1H), 7.67 (m, 1H), 7. 81 (dd, J = 7.91, 1.29 Hz, 1H), 8.66 (dd, J = 8.09, 1.47 Hz, 1H), 8.69 (dd, J = 4.78, 1.47 Hz, 1H) 89166 -362- 200427678 Example 172 3_ (1,1_Digas-4H-1,2,4-benzopyrimidin-3-yl) -4-hydroxy-1-propanylpyridin-

2-ketone Example 172 A Ethyl 2- (hydroxylamino) benzoate The title compound was prepared from ethyl 2-nitrobenzoate according to the procedure of Entwistle and Gilkerson as described in 1978,213-215. Example 172B. 2- (propoxymonthlyl) benzoic acid ethyl acetate The title compound was prepared in accordance with the procedure of Example 1B, substituting the product of Example 172A for the product of Example 1A, and replacing the brominated n-butane with n-propane bromide. Made from alkane.

Example 172C 2- "〇 Ethyl-3-g isopropylpropanyl X propanyl) amino 1 ethyl benzoate The title compound was prepared according to the procedure of Example 157B, replacing the product of Example 157A with the product of Example 157B. Made

An example 172D 4-¾-2--2-Isopropyl-1 · propanoyl-1,2-dilanyl koukoulin_3-Lingyi acetic acid The title compound is according to the procedure of Example 157C, using the example of 172C The product was prepared in place of the product of Example 157B.

Example 172E N ~ "2- (Yueanji Stone Yellow Donkeyyl) phenyl" The 3-carboxamide title compound was prepared according to the procedure of Example 84C, using the product of Example 172D as the product of Example 84B in 89166 -363-200427678 and substituting the product of Example 84A with 2-aminopyridamine.

Example 172F mi-dioxide_4Η · 1,2,4-japan and 2 tons of each group) -4-Weiji small propane gas a certain peak order: 2⑽-ketone title compound is according to the procedure of Example 84D, with Example 172E The product was prepared in place of the product of Example 84C. The sodium salt of the title compound was prepared according to the procedure of Example ID. Example 173

--5- (U-dioxide_4H-U · 4-benzopyrolo_3_yl) -4_hydroxy_3- (fluorene &gt; 7,7a-dihydropyrimido "23- bl pyridine-6 (3aHV ketone example 173A _2-amino_4- (methyl methyl phen-3-carboxylate methyl cyanoacetate (1.18 ml, 13.28 mmol) and sodium sulfide nonahydrate A solution of the compound (3.20 g, 13.28 mmol) in methanol (25 ml) was treated at 1 ° C with 1-ethoxyloxychloroacetone (2.0 g, 13.28 mmol). Remove the cold bath , And triethylamine (L86 ml, 13.28 mmol) was added dropwise. The solution was stirred at room temperature for 20 hours, then diluted with water and extracted in ethyl acetate. The organic layer was dehydrated and dried over sodium sulfate , Filtered, and the solvent was removed under vacuum to provide the title compound (1.25 g, 51%). MS (DCI / NH3) m / z 188 (M + H) +; 1H NMR (300 MHz, DMSO_d6) 5 3.68 ( s, 3H) 4.45 (dd, J = 5.52, 1.47 Hz, 2H) 4.88 (t, J = 5.70 Hz, 1H) 6.12 (s, 1H) 7.28 (s, 2H)

Example 173B Group 4-({[Third-Butyl (dimethyl) supryl i-alkyl} methyl group) Benzene 89166 -364- 200427678 Methyl carboxylate The product of Example 173A (1 · 25 g, 6.70 mmol) and n, N-diisopropylethylamine (0.71 ml, 7.35 mmol) in dichloromethane at 0 ° C with trifluoromethane Treatment with tertiary-butyldimethylsilyl sulfonate (0.85 ml, 6.70 mmol). After stirring at 0 ° C for 1 hour, the solution was poured into water, extracted in dichloromethane, and dried over sodium sulfate. The solvent was removed under vacuum to provide the title compound (0.87 g, 78%). MS (DCI / NH3) m / z 302 (M + H) +; iHNMRGOOMH ^ DMSO-dd 5 0-00 (m, 6H) 0.84 (S, 9H) 3.62 (s, 3H) 4.59 (d, J = 1.47 Hz, 2H) 6.03 (m, 1H) 7.22 (s, 2H).

Example 173C 2- (Ethylamino) _4-({"Third-Butyl (dimethyl) sulphuryl 1-methyl) phenphene-3-carboxylic acid methyl ester The product of Example 173B (0.36 G, 1.20 mmol) and potassium carbonate (0.85 g, 1.30 mmol) in acetonitrile (5 ml) at 45 ° C with benzyl bromide (0.16 ml, 1.25 mmol) Ear) for 24 hours. Pour the solution into water and extract (2X) in ethyl acetate. The combined organic layers were concentrated and purified by flash chromatography, and then isolated with dichloromethane to provide the title compound ( · 17g, 36%). MS (DCI / NH3) m / z392 (M + H) +; iHNMRpOOMK ^ DMSO-c ^) 5 0 · 00 (m, 6H) 0.84 (s, 9H) 3.67 (m, 3H) 4.38 (d, J = 5.88 Hz, 2H) 4.62 (d, J = 1.47 Hz, 2H) 6.12 (s, 1H) 7.28 (m, 5H) 8.16 (t, J = 6.07 Hz , 1H).

Example 173D 1-Lymphyl_-5-({"Third-Butyl (dimethyl) sec alkyl i-amino group! Methyl; μ2Η_4" 2,3- (11 "1,31 The 4 (111) -diketone title compound was prepared according to the procedure of Example 3B, substituting the product of Example 173C for 89166 -365-200427678 of Example 3A (0.015 g, 83%). MS (DCI / NH3) m / z404 (M + H) +

Example 173E 7-fluorenyl-5- (1,1-dioxide-4H-1,2,4-benzylpyrene-3-yl M-hydroxy-3- (hydroxymethyl) -7,7A- The second compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 173D (0.013 g , 8%). MS (DCI / NH3) m / z468 (M + H) +; ^ NMRCSOOMHz ^ DMSO- ^) 5 4.78 (s? 2H) 5.42 (s? 2H) 7.13 (s? 1H) 7.32 (m , 5H) 7.53 (t, J = 7.17 Hz, 1H) 7.64 (d, J = 9.93 Hz, 1H) 7.75 (m, 1H) 7.91 (d, J = 6.99 Hz, 1H) · Example 174 1-fluorenyl-3- (6-chloro-U-digasified-4H-pyrimidof3,2-e | "1,2,41pyrimidin-3-yl) _

4-Hydroxy-1,8-pyridin-2 (1 酮) -one Example 174 A 3-Methanyl-5-Air-based Orthophenone_2_ Shizhuangyue Yuean The title compound is based on Hansen, J. and The co-investigator's procedure was prepared as described in Medicinal Chemistry 2002, 45, 4171-4187.

Example 174B N42- (Aminosulfofluorenyl V5-chloropyrimidin-3-yl-1-ylfluoren-4-hydroxy-2-keto-1,2-dihydro-1,8-pyridine- The title compound of 3-carboxamide was according to the procedure of Example 84C, replacing the product of Example 84A with the product of Example 174A, and replacing the 2-amino group with 3-amino-5-chloropyrimidine-2-sulfonamide- 5-bromobenzenesulfonamide.

Examples 174C 89166 -366- 200427678 each (Bloyl_1,1-dioxide-4H-pyrimidine 幷 "3.2 &lt; 1 ϋ, 2,41 Pyridoxine, each of which is 4- # presenting base-1,8 -The title compound of fluorenone was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example Π4B. T M 175 Techno-3- (6-1 radical oxidation of 4H-pyrimido "3,2- el, l, 2,41, Ergen-3, Xingshang 4-Hydroxyquinin-2 (1HV ketone t M 175A, 2- (aminosulfofluorenyl) -5_aminomethylphen-3-yl1- 1-: ¾: Some _4- # i-2--2-keto-L2- Yimobian 17 Lin_3_ Coupon The title compound was replaced with the product of Example π4A according to the procedure of Example 84C. The product of Example 99A was used instead of the product of Example 84B.

Example 175B 1-Yeki-3 彳 6—

The hydroxyxanthroline Matsuetsu compound was prepared according to the procedure of Example 84D, substituting the product of Example 175A for the product of Example 84C. Example 176 -4H-1,2,4_Benzocerlic, two-cooking, 3_kilo, ytyl_4_, kinaiyodo-2 (1HV) The same as the product of Example 97 (91.6 halo, 0.02 mol) and Raney nickel (0.94 g) in tetrahydrofuran (92 liters) and triethylamine (4.5 ml) at ⑹㈣% pressure and 50 C Hydrogenated for 2 days' and after 24 hours, additional Raney nickel (0.94 g) 89166 -367- 200427678

. The reaction was cooled to room temperature, filtered, and concentrated to a green-yellow solid by rotary evaporation. The residue was purified on a Waters symmetrical C8 column (40 mm X 100 mm 7 micron particle size) and purified by the prepared hplc using a gradient solution of 10% to 100% acetonitrile · 0.1% TFA in water. After 12 minutes (15 minutes operation time) at a flow rate of 70 ml / min, the title compound was obtained as a white solid (11 g, 12%). Μ8 (Ε8Ι-) _ ιώ / ζ460 (Μ-Η)-; iHNMR (300 MHz, DMSO-d6) 5 4 · 31 (s, 2H) 5.64 (s, 2H) 7.28 (m, 6H) 7.49 (m, 1H) 7.74 (d, J = 7.35 Hz, 1H) 7.85 (d, J = 7.72 Hz, 1H) 8.48 (m, 3H) 8.68 (m, 1H) · The steel salt of the title compound is based on the example ID procedures are made. IjjnMR (300 MHz, DMSO-d6) δ 4.16 (s? 2Η) 5.54 (s? 2H) 7.24 (m? 7H) 7.65 (d? J = 7.72 Hz, 2H) 8.43 (dd, J = 7.54, L65 Hz, 1H) 8.50 (dd, J = 4.41, 1.84 Hz, 1H) · Example 177 0 base-3-chloro _ ^-6- (1,1_digasification-4Η-1,2Λbenzopyrimidine two farming 4 base V5-hydroxypyridine

Pyridin-2,3-cl-daquin-7 (8HV ketone example 177A 3- (ammonium amine V6-air-based daken-4_le_) 2,5-dichloro_daquin each carboxylic acid ester (0.40 g , 2.07 mmol) in toluene (8 mL), and triethylamine (0.72 mL, 5.20 mmol) and benzylamine (0.23 mL, 2.07 mmol) were reacted at 90 ° C for 8 hours. The solution was separated between water and ethyl acetate. The organic layer was dried over sodium sulfate, filtered, and concentrated to give the title compound (0.257 g, 47%). MS (DCI / NH3) m / z 264 ( M + H +) + ·

Example 177B Amino-3-Ammonia-5H-Dagen "3,4-d] Il, 31 Phenol-5,7 (8HV dione title compound was according to the procedure of Example 108C, using the product of Example 177A to take 89166 -368-200427678 Substituted for the product of Example 108B. Example 177g Benzopyrimidine US, Shihuang-4 ·! ^ Pyridine "2,3_clda ketone-7 (8HV ketone title compound is based on the procedure of Example 1D, using The product of Examples 1 to 7B was prepared in place of the product of Example 1B. Example 178 8-benzyl-H ethoxyl_3_yl V5- 蕤 U was used as silk. IZ3-c | The product of Example 177 was reacted with methyl mercaptan in toluene at elevated temperature, and the reactant was concentrated to obtain the title compound. Example 179 Di-3--3-V5-hydroxypyridine rz3-c] Daffin-7 (8HV ketone private The Vietnam compound was prepared by the procedure of Example 109, replacing the product of Example 108D with the product of Example 178. 'Example 180 i ^^ HLL ^ JA: 4H-1, 2,4-benzopyrimidine Tweet V4- 苗 其 j 6_

Iwaddin-2 (lHVg is the same as Example 180A 4- (Ethylamino) in the formic acid test. The compound is based on the procedure of Winn et al., According to the application of &amp; CAem, sol.] [993, 2676-2688 As mentioned above, it was prepared from 3-methoxycarbonyl chlorochloropyridine and benzylamine. Example 180g 89166 -369- 200427678 Tengeng · 2,4 (1Ηνdiketone Matsuetsu compound was prepared according to the procedure of Example 3B, using Example ι80〇α The product was prepared by substituting the product of Example 3A. Example 180C The pyridine-2 (1HV ketone title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 180B. Example 181 i: l_M1 'iIzΞAί ^ Ll, 2,4_benzopyrene two ploughing 3_ 某 V4_ # f 某-; L7-

Pyridine_2 (1HV ketone Example 181A f3,4-dl'l, 31 Phenyl-2,4 (1HV diketone The title compound was prepared from 3-aminoisonicotinic acid according to the procedure of Example 110A.

Example 181B Bipyrido "3.4-dlfl, 31 huming_2,4Γ1Ην dione The title compound was based on the procedure of Example 1B, replacing the product of Example 1A with the product of Example 181A, replacing DMA with DMF, and benzyl bromide Made by replacing n-butane bromide.

Example 181C 1-Benzyl-3- (1,1-digasified-4H-1,2,4-benzo4 dipyridin-3-yl M-hydroxy_1,7-piperidine-2 (1HV ketone The title compound was prepared according to the procedure of Example 1D, substituting the product of Example 181C with the product of Example 1B. 89166 -370- 200427678 Example 182 iff amine group) each (1,1-dioxide block 1,2,4_ Mo # 4 Erqin-3-yl) _4_Light-based 4-Porphyrin-2 (1HV ketone made the product of Example 162 (.133 g, 0.3 mmol) and 10% palladium / carbon (. 〇2g 'catalytic amount] of a slurry in THF (25ml), hydrogenated under a hydrogen pressure for 4 hours', filtered through celite, and the filtrate was concentrated. The residue was taken in 1ml of DMS / 5 liter MeOH A slurry was prepared, and the solid was collected by filtration over 15 minutes and dried under vacuum to give the title compound (008 g, 60%). MS (ESI-) m / z445 (Μ-Η) _ · The sodium salt of the title compound was prepared according to the procedure of Example m. 1H NMR (300 MHz? DMSO-d6) δ 3.93 (s5 2Η) 6.09 (t? J = 6.99 Hz5 1H) 7.09 (t, J = 7.35 Hz , 1H) 7.35 (m, 5H) 7.54 (m, 4H) 7.69 (t, J = 8.82 Hz, 2H) 8.10 (dd, J = 7.91, 1.29 Hz, 1H) 16.28 (s 1H).

Example 183 Aj-Monyl-5-methoxybenzyl The title compound was prepared from 4-methoxyaniline using the procedure described in WerhVz, 7, 1979, 1043.

Example 183B (7_A ..- oxo_U_digasification-4H-1,2,4-benzopyrimidine_3_A product of a certain age Λ ester in Example 183A (0.534 g , 2.64 mmoles) and triethylamine (044 ml, 3.17 mmoles) in dry dichloromethane (8 ml) under nitrogen and 0 ° C, ethyl propyl chloride was added dropwise. Dioxane (0.39 ml, 3.04 mmol). The resulting mixture was stirred at 25 ° C for 6 hours. The reaction mixture was diluted with HC1 (30 ml) and the water was extracted with ethyl acetate (2X30 ml). The combined organic extracts were washed with brine, dried over anhydrous magnesium sulfate, and dried over 89166-371-200427678. The filtrate was reduced and the resulting brown solid was recrystallized from dichloromethane / methanol to obtain Pink solid (42 mg). The solid was treated with anhydrous sodium carbonate (700 mg, 6.65 mmol) in absolute ethanol (15 ml) and heated under reflux for 7 hours. The solid was filtered and allowed to The filtrate was concentrated to give the title compound as a white solid (420 g, 50% over two steps). MS (ESI) m / Z297 (M- H)-. IHNMR (300MHz, DMSO-d6) δ PPml.l9 (t, J = 7.17HZ, 3H) 3.23 (s, 2H) 3.75 (s, 3H) 4_07 (q, J = 6.99 Hz, 2H) 6 · 99 (m, 3H).

Example 183C 4-Hydroxy-3- (7-methyl-i_i, i_digasification-4H_i2,4_benzo4diphenyl) small (3-f-butyl) -1,8-p -2 (1HV) is the same as that of the product of Example 183B (0.5 g, ι 6 mmol) and the product of Example 12A (0.375 g, 1-6 mmol) in anhydrous THF (16 mL), Under nitrogen and 0 ° C, sodium hydride (95%, 0.162 g, 6.4 mmol) was added. The reaction was heated at reflux for 4 hours, cooled to 0 ° C, and glacial acetic acid (3 ml) was added dropwise. Treatment. The resulting mixture was heated under reflux for 2 hours, cooled to 25 ° C, and diluted with ice water (150 ml). The precipitate formed was collected by filtration, washed with water, and combined with dioxin. Recrystallized from water / water to obtain the title compound (566 mg, 80%). The sword salt of the title compound was prepared according to the procedure of the example. MS (ESI-) m / z 441 (MH)-· 1H NMR (300 MHz, DMSO-d6) 5 ppm 0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) 1.64 (m, 1H) 3.82 (s, 3H) 4.29 (m, 2H) 7.16 (m, 4H) 8.36 (dd , J = 7.54, 2.02 Hz, 1H) 8.52 (dd, J = 4.60, 2.02 Hz, 1H) 15.86 (s, lH). Example 184 4- # i-3--3- (7-Cyclo-1,1-dioxo-4H-1,2,4-benzo p-di-p--3-yl 89166 • 372- 200427678 methylbutyl ) -1,8-Hazen-2 (111) -one made the product of Example 183C (0.027 g, 0.061 mmol) in dichloromethane (0.6 ml) and boron tribromide (1.0 M, 0.37 ml, 0.37) Millimoles), in dichloromethane, for 18 hours at 25 ° C. The reaction was quenched with methanol and stirred at 25 ° C for 30 minutes. The reaction was concentrated under reduced pressure to give the title Compound as a solid (20.4 mg, 78%). The two sodium salts of the title compound were prepared according to the procedure of Example ip using two equivalents of sodium hydroxide. MS (ESI-) m / z 427 (M-Η)-. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.96 (d5 J = 6.62 Hz? 6H) 1.47 (m5 2H) 1.64 (m, 1H) 4.29 (m, 2H) 6.51 (m, 2H) 6.78 (m, 1H ) 7.09 (dd, J = 7.72, 4.78 Hz, 1H) 8.34 (dd, J = 7.35, 1.84 Hz, 1H) 8.48 (dd, J = 4.60, 2.02 Hz, 1H) 15.23 (br s, 1H). Example 185

({3-``4-Light-H3-methylbutyl V2-keto-1,2-di'-1,8-4 , 2Λbenzopyridine_7_some} oxygen, Λ eyes make the product of Example 184 (0_050 g, 0.12 mmol) in ν, N-dimethylformamide (1 ml), and 2 Bromoacetonitrile (14 μl, 0.2 mmol), potassium carbonate (0.029 g, 0.22 mmol-ear) and tetrabutylammonium iodide (catalyst) were reacted at 25 ° C for 30 hours. The reaction was reacted The mixture was diluted with water (50 ml) and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate, and the organic layer was washed with an aqueous sodium hydrogen carbonate solution, water and brine, dried over anhydrous magnesium sulfate, and filtered. And concentrated under reduced pressure. The residue was triturated with hexane and dichloromethane to give the title compound as a pale yellow solid (16.8 mg, 30%). The sodium salt of the title compound was obtained according to Example 1D. The program was made. (ESI-) m / z 466 (MH)-· 1H NMR (300 MHz, DMSO-d6) 5 ppm 0.96 (d, J = 6.62 Ηζ, 6Η) 1 · 47 (m, 2Η) 1.64 ( m, 89166 -373-200427678 1H) 4.29 (m, 2H) 5.27 (s, 2H) 7.13 (d d, J = 7.72, 4.78 Hz, 1H) 7.31 (m, 3H) 8.36 (dd, J == 7.72, 1.84 Hz, 1H) 8.53 (dd, J = 4.78, 1.84 Hz, 1H) 15.99 ( s, 1H). Example 186 3- (l, l_dioxide-7-propoxy-4Η-1,2,4 · benzimidone-3 · yl V4 · hydroxy-H3-methylbutyl VU-4 pyridine-2 (1HV ketone

The product of Example 184 (0.030 g, 0.07 mmol) was dissolved in N, N-dimethylformamide (1 ml) with 1-bromopropane (0.025 ml, 0.28 mmol) and potassium carbonate. (60 mg, 0.42 mmol) and tetrabutylammonium iodide (catalyst) were reacted at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate, and the organic layer was washed with an aqueous sodium hydrogen carbonate solution, water, and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was recrystallized from dichloromethane: hexane to obtain the title compound (14 mg, 43%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) 5 ppm 0 · 96 (d, J = 6.62 Hz, 6Η) 0 · 99 (t, J = 7.35 Ηζ, 3Η) 1 · 48 (m, 2Η) 1.75 (m, 3Η) 3.98 (t, J = 6.43 Ηζ, 2Η) 4.29 (m, 2Η) 7.16 (m, 4Η) 8 · 36 (dd5 J = 7_72, 1.84 Ηζ, 1Η) 8.52 (dd, J = 4.60, 2.02 Ηζ, 1Η) 15.85 (s, 1Η). (ESI-) m / z 469 (Μ-Η) _. Example 187 1 ΑΑζ · Η7- (曱 oxy 曱 oxo The group vu-dioxide-4H-1 · 24-xiaobangli t group H- (3-methylbutyl Vl, 8-4 ha-2 (1HV) the same as the product of Example 184 (30 mg, 0.1. 〇7mmol) in N, N-dimethylformamide (1 ha) with bromo (methoxy) methane (〇21mL, 〇28mmol), potassium carbonate ( 38 mg, 0.28 mmol) and tetrabutylammonium iodide (catalyst) were reacted at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified with concentrated acetic acid 89166-374-200427678 to pH 5. The reaction was extracted with ethyl acetate, and the organic layer was washed with an aqueous solution of sodium bicarbonate, water, and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was dissolved in δ gum Chromatography was performed at 3: 1 hexane / ethyl acetate to give the title compound. 1H NMR (300 MHz DMSO-d6) 5 ppm 0.98 (d, J = 6.62 Hz, 6H) 1.56 (m, 2H) 1.70 (m, 1H) 3.42 (s, 3H) 4.47 (m, 2H) 5.31 (s, 2H) 7.44 (m, 3H) 7.66 (m, 1H) 8.54 (d, J = 8.09 Hz, 1H ) 8 · 85 (s, 1H) · (ESI-) m / z 471 (M-Hy · The steel salt of the title compound was prepared according to the procedure of Example ID. Example 188 Hydroxy-H3-methylbutyl) _3- Example of (7-"(2-methylprop-2-ene) oxy Hi-digasification 4g-1,2,4-benzopyridine-3-yl meridine-2 The product of 184 (30 mg, 0.07 mmol) was prepared in ν, N-dimethylformamide (1 halo) with 3-bromo-2-methylpropan-1-amidine (8 Microliters, 0.077 mmoles, potassium carbonate (60 mg, 0.42 mmoles) and tetrabutylammonium iodide (catalyst) were reacted at 25 C for 24 hours. The reaction mixture was diluted with water and concentrated acetic acid Acidified to PZ5. The reaction was extracted with ethyl acetate, and the organic layer was washed with an aqueous solution of sodium bicarbonate, water, and water, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was recrystallized from dichloromethane: hexane to give the title compound (17.4 mg, 50%). The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300MHz, DMSO-d6) 5 ppm 0.96 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.64 (m, 1H) 1.78 (s, 3H) 4.29 (m, 2H ) 4.54 (s, 2H) 4.98 (s, 1H) 5.08 (s, 1H) 7_12 (m, 2H) 7.22 (m, 2H) 8.36 (dd, J = 7.54, 2.02 Hz, 1H) 8.52 (dd, J = 4.60, 2_02 Hz, 1H) 15.86 (s, 1H). (ESI_) m / z 481 (MH) \ 89166 -375- 200427678 Example 189 UH4_hydroxy small (3-methylbutyl V2-ketodione j. -1.8_ 崦 &lt; -3_Base 1_1 丄 丄 Oxidation-4H-1,2,4-benzopyrimidinium-7-based} Ga) a) cool _ pole two-Ding 艏 the product of Example 184 (30 mg, 0.07 mmol) in N, N-dimethylformamide (1 ml) and tertiary-butyl bromoacetate (0.4 ml, 0.28 mmol), Potassium carbonate (0.04 g, 0.28 mmol) and Tetrabutylammonium (catalyst) at 25 ° C. The reaction was continued for 24 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate, and the organic layer was washed with an aqueous solution of sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The formed residue was chromatographed on silica gel, and was separated with 3: 1 hexane: fe / ethyl acetate to obtain the title compound (20 mg, 53%). 1H NMR (300 MHz, DMSO-d6) δ ppm 0.97 (d, J = 6.62 Hz, 6H) 1.43 (s5 9H) 1_51 (m, 2H) 1.66 (m, 1H) 4.35 (m, 2H) 4.77 (s, 2H) 7.33 (m, 4H) 8.42 (d, J = 8.09 Hz, 1H) 8.63 (s, 1H) · (ESI_) m / z 541 (MH) _ · The sodium salt of the title compound was prepared according to the procedure of Example ID to make. Example 190 2- {j3- [4: Boom: 1- (3-methylbutyl) -2-yl di ·, -1,8-4 pyridin-3-some 1-L1-dioxide · 4Η -1,2,4-benzopyrimidinium_7_yl, a certain compound, the product of Example 184 (30 mg, 0.007 mol) in the wind: dimethylformamide ( 1 ® liter) with 2-bromoacetamide (16 mg, 012 mmol), potassium carbonate (24 mg, 0.7 mmol) and tetrabutylammonium iodide (catalyst) s25 &lt; t The reaction was continued for 48 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate, and the organic layer was washed with an aqueous solution of sodium bicarbonate, water, and brine, dried over anhydrous magnesium acetate, filtered, and concentrated under reduced pressure. 89166 -376- 200427678 Shrinkage. Triturate the resulting residue with dichloromethane: hexane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz? DMSO-d6) δ ppm 0.96 (d5 J = 6.62 Hz, 6H) 1.48 (m5 2H) 1.64 (m, 1H) 4.29 (m, 2H) 4.49 (s, 2H) 7.13 (m, 2H ) 7.24 (m, 2H) 7.40 (m, 1H) 7.62 (m, 1H) 8.36 (dd, J = 7.54, 2.02 Hz, 1H) 8.52 (dd, J = 4.60, 2.02 Hz, 1H) 15.89 (s, 1H ). (ESI-) m / z 484 (MH) _. Example 191 _3_ [7- (benzyloxy) -1,1-dioxide-4H-1,2,4-jasmine # 4 dimorphin_3- The l-4-hydroxymethylbutyl H, 8_4 pyridine was the same as the product of Example 184 (30 mg, 0.07 mmol) in n, N-dimethylformamide (1 ml), and (bromomethyl ) Benzene (0.0138 ml, 0.11 mmol), cesium carbonate (50 mg, 0.15 mmol) and tetrabutylammonium iodide (catalyst) at 25 ° C. The reaction was continued for 96 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate, and the organic layer was washed with an aqueous sodium hydrogen carbonate solution, water, and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was triturated with ethyl acetate to give the title compound (13 mg? 36%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1 H NMR (300 MHz, DMSO_d6) 6 ppm 0.96 (d, J = 6.25 Hz, 6H) 1.48 (m, 2H) 1.64 (m, 1H) 4.29 (m, 2H) 5.17 (s, 2H) 7.12 (dd, J = 7.72, 4.78 Hz, 1H) 7.23 (m, 3H) 7.41 (m, 5H) 8.36 (dd, J = 7.35, 1.84 Hz, 1H) 8.52 (dd, J = 4.78, 1.84 Hz (1H) 15.87 (s, 1H). (ESI-) m / z 517 Example 192 Dioxide-7- (2-tetrahydrohalo-1-ylethoxy) -4Η-fluorene, 2.4-benzene And two-spray 3-yl hydrazine-a few ... 碁 .ikQiJ butyl sulfonium, 8-fluorene bite-2am-xitong 89166 • 377- 200427678 The product of Example 184 (30 mg, 0.07 mmol Mol) in N, N-dimethylformamide (1 ml) with 1- (2-chloroethyl) tetrahydropyrrole hydrochloride (19 mg, 011 mmol), potassium carbonate (96 (Mg, 0.69 mmol) and tetrabutylammonium iodide (catalyst) were reacted at 25 C for 72 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate, and the organic layer was washed with an aqueous sodium hydrogen carbonate solution, water, and brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was chromatographed on silica ‘followed by 5% formaldehyde * / one gas form to obtain the title compound. The potassium salt of the title compound was prepared according to the procedure of Example 1D, replacing sodium hydroxide with potassium hydroxide. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) 1.64 (m, 1H) 1.91 (m, 4H) 3.16 (m, 4H) 3.47 ( m, 1H) 4.30 (m, 4H) 7.13 (dd, J = 7.54, 4.60 Hz, 1H) 7.24 (m, 3H) 8.36 (dd, J = 7.72, 1.84 Hz, 1H) 8.53 (dd, J = 4_60, 2.02 Hz, 1H) 15.90 (s, 1H). (ESI-) m / z 524 (MH)-Example 193 3_ [1,1_Dioxide-7_ (2_ketophenylethoxy Benzodiacryl-1-4-yl-1- (3-methylbutyl-bite_2ΠΗΥ · Xitongshi product of Example 184 (30 mg '0.07 mmol) at ν, N_dimethyl Methylamine (1 liter) with 2-bromo-1-phenylethyl ketone (30 mg, millimoles), potassium carbonate (60 mg, 0.42 millimoles) and tetrabutylammonium iodide (Catalyst) 96 hours at 25.0. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate, and the organic layer was treated with sodium bicarbonate water / valley, It was washed with water and brine ', dried with water and sulfur, dried, dried, and concentrated under reduced pressure. The resulting residue was chromatographed on silica gel and dissolved in 0.02% methanol / dichloromethane. The title compound was obtained. The steel salt of the title compound 89166 -378- 200427678 was prepared according to the procedure of Example ID. 1 η NMR (300 MHz, DMSO-d6) (5 ppm 0.96 (d, J = 6.62 Hz, 6H ) 1.48 (m, 2H) 1.65 (m, 1H) 4.31 (m, 2H) 5.70 (s, 2H) 7.14 (m, 1H) 7.24 (d, J = 9.93 Hz, 3H) 7.59 ( t, J = 7.35 Hz, 2H) 7.71 (t, J = 7.35 Hz, 1H) 8.05 (m, 2H) 8_38 (dd, J = 7.91, 1.65 Hz, 1H) 8.54 (m, 1H) 15.85 (s, 1H ). (ESI_) m / z545 (MH) ·. Example 194 M7- (allyloxy) -l, l-dioxide-4Η-1 · 2 · 4-benzylpyridine-3-yl1- 4-Hydroxy-1- (3-methylbutane) -1,8-oripizidine_2 (1HV ketone gives the product of Example 184 (30 mg, 0.07 mmol) at n, N-di Methylformamide (1 mL) with 3-methylpropylpropane (0.007 mL, 0.07 mmol), potassium carbonate (60 mg, 0.42 mmol) and tetrabutylammonium iodide (Catalyst) Reaction at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl picrate, and the organic layer was washed with an aqueous sodium bicarbonate solution, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was triturated with hexane to give the title compound. 1H NMR (300 MHz? DMSO-d6) δ ppm 0.98 (d? J = 6.25 Hz5 6H) 1.55 (m5 2H) L68 (m, 1H) 4.42 (m, 2H) 4_69 (d, J = 5.52 Hz, 2H) 5.30 (dd, J = 10.66, 1.47 Hz, 1H) 5.43 (dd, J = 17.28, L84 Hz, 1H) 6_06 (m, 1H) 7.29 (m, 3H) 7.53 (m, 1H) 8.49 (d, J = 6.62 Hz, 1H) 8.76 (m, 1H) 15.29 (br s, 1H). (ESI-) m / z 467 (MH)-· Example 195 i: Hydroxyl-3- (7-isobutoxy-1 1,1-dioxide-4Η-1 · 2 · 4-benzyl-4-diphenyl-3-yl) small (3-methylbutyl M, 8-pyrimidine-2 (ΊΗν_) The product of Example 184 (30 mg, 0.07 mmol) in v, N-dimethylformamide (1 ml), and 1.bromo-2-methylpropane (0.034 ml, 0.3 mmol), 89166- 379- 200427678 Potassium carbonate (60 mg, 0.42 mmol) and tetrabutylammonium iodide (catalyst) were reacted at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate, and the organic layer was washed with an aqueous sodium hydrogen carbonate solution, water, and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The residue formed was allowed to form Recrystallization from hexane: dichloromethane to obtain the title compound (10.5 mg, 31%). The remaining salt of the title compound was prepared according to the procedure of Example 1D. IHNMRpOOMHADMSO-c ^) δ ppm 0.96 (d, J = 6.25 Hz, 6H) 0.99 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.64 (m, 1H) 2.03 (m, 1H) 3.80 (d, J = 6.62 Hz, 2H) 4.29 (m, 2H) 7.15 (m, 4H) 8.36 (dd, J = 7.72, 1.84 Hz, 1H) 8.52 (dd, J = 4.78, 1_84 Hz, 1H) 15.85 (s, 1H) · (ESI-) m / z 483 (MH). Example 196 4-({3-``4-Cycloyl-l- (3-methylbutyl V2-keto-1,2-dioxin -3_yl 1-1,1 · Dioxo_4Η-1,2Λbenzopyridine-7-some} 氲 、, Ding Kuai the product of Example 184 (30 mg, 0.07 mmol) in Ν, Ν-dimethylformamidine 1 ml), 4-bromobutyronitrile (0.0154 ml, 0.15 mmol), potassium carbonate (60 mg, Q. 42 mmol) and iodination Tetrabutylammonium (catalyst) was reacted at 25 ° C for 96 hours. The reaction mixture was diluted with water and acidified to pH 5 with concentrated acetic acid. The reactant 'was extracted with ethyl acetate, and the organic layer was washed with an aqueous solution of nitrogen carbonate steel, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was recrystallized from hexane: dichloromethane to obtain the title compound (21.8 mg, 62%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. ΑΝΜΓίρΟΟΜΗζ, ϋΜΒΟ ^) δ ppm0.96 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.62 (m, 1H) 2.04 (m, 2H) 2.68 (t, J = 7.17 Hz, 89166 -380- 200427678 2H) 4.10 (t, J = 5_88 Hz, 2H) 4.29 (m, 2H) 7.17 (m, 4H) 8.36 (dd, J = 7.91, 1.29 Hz, 1H) 8.52 (dd, J = 4.60, 1 65 Hz, 1H) 15.88 (s, 1H). (ESI-) m / z 494 (MH)-· Example 197 ({3- 「l- (3-methylbutyl) -4-oxo-2- Keto-1,2-dihydro-1,8-kounetol-3-yl dioxide-4H-1,2,4-benzopyrimidin-7-a certain example The product of 189 (15 mg, 0.028 mmol) was stirred in a mixture of trifluoroacetic acid (0.8 ml) and dichloromethane (0_2 ml) at 25 ° C for two hours. It was moved under reduced pressure. The solvent was removed to obtain a yellow solid, which was separated between ethyl acetate and water. The aqueous layer was extracted with ethyl acetate (2 X 20 ml). The aqueous layer was acidified to pH 2 with IN HC1, and Extracted with ethyl acetate (3 X 20 mL). The combined organic extracts were washed with brine, dried over anhydrous magnesium sulfate, 'filtered', and concentrated under reduced pressure to give the title compound. As a white solid (8 mg, 62%). The disodium salt was prepared according to the procedure of Example 1D using two equivalents of sodium hydroxide. 1 H NMR (300 MHz, DMSO-d6) 6 ppm 0.99 (d, J = 6.62 Hz, 6H) 1.58 (m, 2H) 1.70 (m, 1H) 3.17 (s, 1H) 4.49 (m, 2H) 4.88 (s, 2H) 7.36 (m, 2H) 7.49 (m5 1H) 7.70 (d, J = 9.56 Hz, 1H) 8.56 (dd, J = 7.91, 1.65 Hz, 1H) 8.88 (d, J = 2.94 Hz, 1H). (ESI-) m / z 485 (MH) · · Example 198 Amine ethyl gas VU-dioxide 4H-U, 4-benzopyridine digeno-3-even] ice via keshi (3-methylbutyl VU-pyrimidine -2 (1HV ketone The solution of the product of Example 185 (21.8 halo, 62%) in anhydrous tetrahydrocondensate (0.5 ml) was treated with LiBH4 (10 mg, 0.46 mmol) It was stirred at ambient temperature for 16 hours, diluted with water (30 ml), and extracted with ethyl acetate (2 x 30 ml). The combined organic layers were washed with water and brine, and dried over anhydrous sulfuric acid 89166-381-200427678. The slurry was mashed and the solvent was removed under reduced pressure to give the title compound as a yellow solid (10.1 mg, 97%). The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMRpOOMHADMSOO (5 ppm 0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) L64 (m, 1H) 2.82 (m, 2H) 4.13 (t, J = 5.33 Hz, 2H) 4.29 (m, 2H) 5.40 (m, 2H) 7.17 (m, 4H) 8.36 (dd, J = 7.72, 1.84

Hz5 1H) 8.52 (dd? J = 4.60, 2.02 Hz, 1H) 15.88 (s? 1H). (ESI-) m / z 470 (MH) '. Example 199 2-((3-f4-hydroxy-1- (3-methyl certain butyl V2-keto · 1,2_dihydro_1 each meridin-3-some 1-L1-monoemulsified-4 fluorene-1,2,4-benzo? Saidine 7-yl} oxy VN-methylacetamide. Example 197 (4.7 mg, 0.0097 mmol), 1- (3-dimethylaminopropyl) each ethylcarbodiimide hydrochloride ( 1.4 mg, 0.01 mg mol), methylamine in tetrahydrofuran (2.0 M, 10 μl, 0.02 mmol) and 1-hydroxybenzotriazole (ι · 4 mg, 0.01 mmol) in N The mixture in N-dimethylformamide (0.2 ml) was stirred at 25 ° C for 5 hours. The reaction mixture was diluted with ethyl acetate (40 ml) and washed with saturated bicarbonate steel, water and brine. And dried over anhydrous magnesium sulfate. The desiccant was removed by filtration, and the solvent was removed under reduced pressure to obtain the title compound 1 as a pale yellow solid (4 mg, 83%). The sodium salt of the title compound was based on an example. 1D program. IHNMRpOOMHADMSOO ^ ppm 0.96 (d, J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.64 (m, 1H) 2.67 (d J = 4.78 Hz, 3H) 4.30 (m, 2H) 4.53 (s, 2H) 7_ 18 (m, 4H) 8.11 (m, 1H) 8.36 (dd, J = 7.54, 2.02 Hz, 1H) 8.52 (dd , J = 4.78, 1.84 Hz, 1H) 15.90 (s, 1H). (ESI-) m / z 498 (MH) ·. Example 200 Acetic acid 344-hydroxy-H3-methylbutyl V2-keto-1, 2_Ethyl-U-pyridine-3-A certain 1-1-89166-382- 200427678-First battle of 4H-1,2,4-Stupid and double-edged Erhu-7-Giyi will carry out Example 184 (30 mg, 0.07 mmol), triethylamine (2 μl, 0.084 mmol) and acetic anhydride (8 μl, 0.084 mmol) in anhydrous dichloromethane (1 mL), Stir at 25 ° C for 16 hours. Dilute the reaction mixture with ethyl acetate and water, acidify to pH 5 with acetic acid, and perform liquid separation. Extract the aqueous layer with ethyl acetate (2 × 20 ml). Combine the organic extracts It was washed with saturated sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and the solvent was removed under reduced pressure to give the title compound as a white solid (295 mg '89%). 1H NMR (300 MHz, DMSO-d6) 5 ppm 0.98 (d, J = 6.25 Hz, 6H) 1.56 (m, 2H) L69 (m, 1H) 2.30 (s, 3H) 4.46 (m, 2H ) 7.44 (m, 1H) 7.52 (d, J = 8.82 Hz, 1H) 7.72 (m, 2H) 8.53 (dd, J = 7.72, 1.47 Hz, 1H) 8.83 (s, 1H). (ESI ·) M / z469 (M-fluorene) '. Example 201 Di-emulsified 2-yloxy group> 4Η-1 · 2 · 4-benzodiaphthine_3_yl i_4_ huang-yl-H3-form Butylpyridine_2 (喳 ΤΠ_Shishi Example 184 (10 mg, 0.023 mmol)) and bromopyridine (2 4 μl '0.025 4: Mol), cesium carbonate (15 mg, 0.5 mg). (〇46mmol) and copper metal (40 mg) in dimethyl sulfene (0.1 mg) at a temperature of 0 ° C in a microwave reactor for 2 hours. The mixture was cooled to 25 ° C, Pour into water (20 ml) and extract with ethyl acetate (2 X 20 ml). Wash the combined organic extracts with brine 'dry over anhydrous magnesium sulfate, filter, and remove the solvent under reduced pressure, A yellow-brown solid was left. The solid was chromatographed on silica gel, firstly dissolved in dichlorodeck 'and then in 1% methanol in dichloromethane to obtain the standard. Compound as a light brown solid (5 mg, 42%). The steel salt of the title compound was 89166 -383-200427678 according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) 5 ppm 0.96 (s, 3H ) 0 · 98 (s, 3H) 1.48 (m, 2H) 1.65 (m, 1H) 4.30 (t, J = 7.50 Hz, 2H) 7.14 (m, 3H) 7_35 (s, 3H) 7.89 (m, 1H) 8.17 (m, 1H) 8 · 38 (dd, J = 7.72, 2.21 Hz, 1H) 8_53 (dd, J = 4.78, L84 Hz, 1H) 16.07 (s, 1H) · (ESI-) m / z 504 (M-fluorene) Example 202 3-``U-Digas-7- (Pyrimidin-2-ylhydrogen V4H-1,2,4-benzylpyridine-3-yl 1-4- Benzyl (3-methylbutylnaphthalene) with the product of Example 184 (10 mg, 0.023 mmol) and 2-bromopyrimidine (4.5 mg, 0.028 mmol), cesium carbonate (15 mg, 0.046) Millimolar) and tetrabutylammonium iodide (1 mg) in dimethyl sulfene (0.1 ml) in a microwave reaction apparatus at 110 ° C. for 1 hour. The mixture was cooled to 25 ° C, poured into water (20 ml) and extracted with ethyl acetate (2 X 50 ml). The combined organic extracts were washed with brine, dried over anhydrous magnesium sulfate, filtered, and the solvent was removed under reduced pressure, leaving a tan solid. The solid was chromatographed on silica gel, first eluting with dichloromethane followed by 2% methanol in dichloromethane to obtain the title compound as a white solid (6 mg, 51%). The sodium salt of the title compound was prepared according to the procedure described in Example 1P. iHNMR (300MHz, DMSO-d6) (5 ppm 0.96 (s, 3H) 0 · 98 (s, 3H) 1.48 (m, 2H) 1.65 (m, 1H) 4.30 (t, J = 7.50 Hz, 2H) 7.14 (dd, J = 7.54, 4.60 Hz, 1H) 7_30 (t, J = 4.78 Hz, 1H) 7.42 (m, 3H) 8.38 (dd, J = 7.72, 1.84 Hz, 1H) 8.54 (dd, J = 4.78 , 1.84 Hz, 1H) 8.67 (s, 1H) 8.68 (s, 1H) 16.10 (s? 1H). (ESI-) m / z 505 (MH) '. Example 203 Ηί4-hydroxy-1- (3 -Methylbutyl V2-keto-1,2-dihydro-1,8-pyridin-3-yl 1-U_ = emulsified-4H-1,2,4-benzyl-di-p-well-7- } Oxy) · ν, N-dimethylacetamide 89166 -384- 200427678 The title compound was substituted for 2-bromoacetonitrile by 2-chloro-N, N-dimethylacetamide according to the procedure of Example 185. The compound was purified by trituration with methanol. The steel salt of the Matsushi compound was prepared according to the procedure of Example 1D. 1 η NMR (300 MHz, DMSO-d6) δ ppm 0.96 (d, J = 6.62 Hz5 6H) 1.47 (m? 2H) 1.64 (m? 1H) 2.86 (s, 3H) 3.01 (s, 3H) 4.30 (m, 2H) 4.90 (s, 2H) 7.16 (m, 4H) 8.36 (dd , J = 7.72, 1.84 Hz, 1H) 8.52 (d, J = 4.78 Hz, 1H) 15.86 (s, 1H). (ESI-) m / z 512 (M-Η) '. Example 204 4A-based small (1-methylbutyl) -3 · Γ7-nitro-1,1-dioxide-4Η · 1,2,4-benzyl-4-diphenyl-3-yl) -1, The 8-peak bite-2 (111) -one kept the product of Example 12B (0.229 g, 0-56 mmol) at zero. It was reacted with ammonium nitrate (0.058 g, 0.72 mmol) in concentrated sulfuric acid (1.5 ml) and stirred for 30 minutes. The reaction mixture was poured onto crushed ice, and the pH was adjusted to 9 with an aqueous solution of steel hydroxide. The formed solid was separated by filtration to obtain the title compound (0.21 g, 81%). The sodium salt of the title compound was prepared according to the procedure of Example ID. (ESI-) m / z 456 (MH) · · 1H NMR (300 MHz, DMSO_d6) δ ppm 0.96 (d5 J = 6.62 Hz, 6H) 1.47 (m, 2H) 1.64 (m5 1H) 4.29 (m, 2H) 7.14 (m, 1H) 7.52 (m, 1H) 8.40 (m, 3H) 8.54 (m, 1H) 16.77 (s, 1H).

Example 205 RZ 3- (7-amino-1,1-dioxide-4H-1,2,4-benzopyrimidine_3-a certain V4-hydroxy-M3-methyl some butyl) -1,8 -Pyridine-2 (1 out-one) The product of Example 204 (0.198 g, 0.43 mmol), iron powder (0.121 g, 2.16 mmol) and NH4C1 (0.031 g, 0.58 mmol) ) A mixture in methanol: tetrahydrofuran: water (3: 3: 1,7 ml), stirred at reflux for nine hours. The 89166 -385-200427678 reaction mixture was cooled to 25 ° C, and iron was removed by filtration, and Washed with methanol. The filtrate was concentrated under reduced pressure, diluted with water, and extracted with ethyl acetate. The organic layer was washed with water, brine, and dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure, and The title compound was obtained as a yellow solid (0.12 g, 66%). (ESI-) m / zppm 0.98 (d, J = 6.62 Hz, 6H) 1.58 (m, 2H) 1.69 (m, 1H) 4.46 (m, 2H) 5.86 (s, 2H) 6_96 (m, 2H) 7.46 (m, 2H) 8.52 (d, J = 6.99 Hz, 1H) 8.84 (m, 1H) 13.90 (s, 1H) Example 206 ((3- [4_-Hydroxy-1- (3-methylpentylbutyl V2-one-1,2-dij '-1.8-pyridin-3-yl1-1 , 1-A oxidation-4 H-1,2,4-benzopyrimidine, amine, amine) hexanitrile from the product obtained from Example 205 (10 mg, 0.023 mmol) at N, N-dimethylformamide (0.2 ml) of the solution, bromoacetonitrile (2.5 microliters, ο.% Mmol) and potassium carbonate (5 mg, 0.035 mmol) were added. The mixture was reacted at 100 t under microwave reaction. Stir in the device for 1 hour while heating. After cooling to 25 ° C, dilute the orange solution with water, and adjust the pH of the aqueous layer to pH 5 with acetic acid. Extract the water with ethyl acetate (3 X 20 ml) The combined organic layers were washed with water and brine, 1 dried over magnesium sulfate, filtered, concentrated, and purified by flash column chromatography on silica gel, and dissolved in 1% methanol / dichloromethane to give the title compound. , As a yellow solid (6.0 mg, 55%). MS (ESI-) m / z465 (MH) · .1H NMR (300 ΜΗζ5 DMSO-d6) δ ppm 0.99 (d5 J = 6.62 Hz, 6H) 1.58 ( m, 2H) 1.68 (m, 1H) 4.46 (m, 4H) 6.92 (m, 1H) 7.16 (m, 2H) 7.49 (m, 1H) 7.61 (d, J = 9.19 Hz, 1H) 8.56 (dd , J = 7.90, 1.65 Hz, 1H) 8.89 (m, 1H) 14.00 (br s, 1H) 15. 39 (br s, 1H). The sodium salt of the title compound was prepared according to the procedure of Example 1D—1H NMR (300 MHz, DMSO-d6) (5 ppm 0.96 (d, J = 6.62 Hz, 6H) 1 · 48 ( m, 89166 -386- 200427678 2H) 1.64 (m, 1Η) 4.31 (m, 4H) 6.49 (t, J = 6.62 Hz, 1H) 6.99 (m, 2H) 7.13 (m, 2H) 8.35 ( dd5 J = 7.72, 1.84 Hz, 1H) 8.51 (dd, J = 4.41, 1.84 Hz, 1H) 15.73 (s, 1H). Example 207 7-hydroxy-6- (7-methoxy-1,1-di Gasification -4H_U, 4 · Benpyrimdi-2-yl) -4- (3-methylbutyl &gt; cepheno "3,2-bl pyridine-5 (4HV ketone title compound is based on Example 1D The procedure was prepared by replacing the product of Example 1B with the product of Example 125A and replacing the product of Example 1C with the product of Example 183B. The sodium salt was prepared according to the procedure of Example 1D. iHNMR (300MHz, DMSO-d6) (5 ppm 0.96 (d5J = 6.62 Hz, 6H) 1.44 (m? 2H) 1.66 (m5 1H) 3.81 (s5 3H) 3.99 (m, 2H) 7.09 (m, 2H) 7.16 (m, 2H) 7.79 (d, J = 5.15 Hz, 1H) 15.87 (s, 1H). (ESI-) m / z 446 (MH) '. Example 208 4-benzyl-7 · hydroxy-6- Γ7-formyl-U-digasification-4H-1.2.4-benzopyrimidine_3-yl) Pyridinof3,2-blpyridine-5 (4HV ketone title compound was according to the procedure of Example 1D The product of Example 110B was used to replace the product of Example 1B, and the product of Example 183B was used to replace the product of Example 1C. The sodium salt was prepared according to the procedure of Example 1D. IHNMR (300 MHz, DMSO-d6) 5 ppm 3.81 ( s, 3H) 5.26 (s, 2H) 7.02 (d, J = 5_15 Hz, 1H) 7.11 (m, 1H) 7.17 (m, 2H) 7.24 (m, 5H) 7.71 (d, J = 5_15 Hz, 1H) 15.80 (s, 1H) · (ESI-) m / z466 (MH) \

Example 209A 2-Amino-6-methylamino-3-tosylsulfonamide The title compound was prepared using the procedure described in 7, 1979, 1043 to make 89166 -387- 200427678 from 1-methoxymethyl groups. aniline.

Example 209B 89166 -388-1 T-hydroxy-L8-piperidine-2 (1HV ketone title compound was prepared according to the procedure of Example 84D, substituting the product of Example 209B with the product of Example 84C. Then, a 6N1α aqueous solution (10 ml ) The solution was acidified, filtered, and the solid was washed with methanol (1 () ml) to give the title compound as a white solid (0.12 g, 56% yield). MS (ESI-) ra / z477 (M -Η) +. The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300MHz, DMSO-d6) δ 2.37 (s, 3H) 3.83 (s, 3H) 5.52 (s, 2H) 6.76 ( d, J = 8.5 Hz, 1H) 7.16 (m, 2H) 7.23 (m, 4H) 7.37 (d, J = 8.9 Hz, 1H) 8.45 (m, 2H), 15.67 (s, 1H) · -Example 210 Concentrated 3- (8-Cyclo-5-methyl_1,1_dioxide-4Η_1,2 · 4_benzyl 4 Ergen-3 · even) -4_ 200427678 Concentrated to provide the title compound, It was a white solid (0.019 g, 98% yield). MS (ESI-) m / z 463 (MH). The disodium salt of the title compound was made according to the procedure of Example id 'using two equivalents of sodium hydroxide. 1HNMR (300 MHz, DMSO-d6) 5 2.16 (s, 3H) 5.52 (s, 2H) 5.92 (d, J = 8.8 Hz, 1H ) 6.79 (d, J = 8 · 8 Hz, 1H) 7 · 11 (dd, J = 7.8, 4 · 8 Hz, 1H) 7 · 17 (m, 1H) 7.23 (m, 4H) 8 · 42 (m , 2H), 14.77 (s, 1H). Example 211 _ {. 1 &gt; (1 dipicryl-yl-4-hydroxy-2-keto-1,2-dihydro_1,8-4pyridin-3- A &gt;)-5-methyl-1,1-S. · Emulsified-4H-1,2,4_benzo p 窠 two tons each of a certain gas 丨 month month 杳 the product of Example 210 (23 mg , 0.050 mmoles), bromoacetonitrile (14 μl '0.2 Emole) and carbonic acid (15 hag, ηηmoles) in n, N-dimethylformamide (1 ml) The mixture was stirred at 25 ° C. for 3 days. The reaction mixture was concentrated under reduced pressure, and the formed oil was chromatographed on silica gel and dissolved with ethyl acetate to provide the title compound as a white solid (0.00. 3 g, 12% yield). MS (ESI-) m / z 500 (MH) · The steel salt of the title compound was prepared according to the procedure of Example 1D. 11 ^] \ / 111 (30〇) \ «12 : 0 to 80- (16) 5 2.38〇, 311) 5.25 (111,211) 5.54 (s? 2H) 6.93 (m? 1H) 7.18 (m? 2H) 7.23 (m? 4H) 7.37 (m? 1H ) 8.46 (m5 2H).

Example 212A Amino-3-methylaminobenzylamine The title compound was prepared from 2-methoxy using the procedure described in permit 1979, as described in Human 1979, 1043. aniline.

Example 212B (^ 7oxydiL1-dioxide-4Η-1 · 2 · 4-jasopyridine-3-yl) ethyl acetate The title compound was obtained in accordance with the procedure of Example 1C, and the product of Example 212A replaced 2- Aminobenzenesulfonamide. MS (DCI) m / z299 (M + H) +. 89166 -389- 200427678

Example 212C 1-fluorenyl-4-foldylmethanone-u-dihydro-4H-1,2,4_benzylpyridine-3-yl) _ 1.8- xanulidine fine 2) _one The title compound was prepared according to the procedure described in Example ID, substituting the product of Example 15A for the product of Example 1B and the product of Example 212B for the product of Example 1C (187 mg, 41%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. (ESI-) m / z 461 (M-Η) · · 1H NMR (300 MHz, DMSO-d6) 5 ppm 3.98 (s, 3H) 5.52 (s, 2H) 7.18 (m, 9H) 8.42 (dd , J = 7.54, 2.02 Hz, 1H) 8.47 (dd, J = 4.78, 1.84 Hz, 1H) 15.71 (s, li) · Example 213

1-Amino-4-Hydroxy (5-Hydroxydioxo-4H-1,2,4-benzopyrimidin-3-yl V 1.8- Xanthonyl-2 (1HV Ketone Title Compound is based on the example The procedure described in 184 was prepared by substituting the product of Example 212C for the product of Example 183C. (Ε3Ι-) ιώ / ζ447 (Μ-Η) _ · The dihedral salt of the title compound was prepared according to the procedure of Example 1D, using two Made from equivalent sodium hydroxide. 1 H NMR (300 MHz, DMSO-d6) 6 ppm 5.53 (s, 2H) 6.25 (m, 2H) 6.76 (t, J = 7.91 Hz, 1H) 7.17 (m5 6H) 8.42 (dd, J = 4.78, 1.84 Hz, 1H) 8.48 (dd, J = 7.54, 2.02 Hz5 1H).

Example 214A Group-1,2-dihydro-1,8_pyrimidine-3-A Vl, l-dioxide-4H-Sedigenyl-5-yl 1yl} Acetonitrile &amp; The title compound is based on the example 丨The procedure described in 85 was prepared by replacing the product of Example 213 with the product of Example 184. ihnmr (300 MHz? DMSO-d6) δ ppm 5.51 (s? 2H) 5.72 (s? 2H) 7.24 (m5 1H) 7.28 (s5 89166 -390- 200427678 1H) 7.31 (m, 5H) 7.51 (dd, Bu 7.91 , 4.6G Hz, 1H) 7.61 (m, 1H) 8.61 (dd, J = 7.72, 1.84 Hz, 1H) 8.83 (m, 1H) 14.52 (s, 1H). Example 214g 1: [5- (2_amine Alkoxy) -l, l_dioxopyrimidopyridine_3_yl &quot; [berberylhydroxy-1,8_xanthrimidine_2 (ΊΗΥ ··· The title compound is as described in Example 198 The procedure described was prepared by replacing the product of Example 214A with the product of Example 185. (ESI_) 490 (Μ-Η)-The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMR (300 MHz, DMSO-d6 ) δ ppm 3.06 (s5 br5 2H) 4.30 (t5 J = 4.78 Hz5 2H) 5.54 (s5 2H) 5.72 (s5 br, 2H) 7.20 (m, 9H) 8.50 (dd, J = 4.78, 1.84 Hz, 1H) 8.69 (dd, J = 7.72, 2.21 Hz, 1H) 16.05 (s, 1H). Example 215 2- {P- (l-lLS -4J radian-2-one-1.2-difluorene-1, 8-fluorene Pyridin-3-yl VU-digasification-j ^ 2,4-benzopyrimidine-5-some 1-gasyl} acetamidinium The title compound was prepared according to the procedure described in Example 19, with Example 213 The product replaces the product of Example 184 (ESI-) m / z504 (MH)-. The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300MHz, DMSO-d6) 5 ppm 4.64 (s5 2H) 5.53 (s? 2H ) 7.22 (m? 9H) 7.88 (s, 1H) 8.13 (s? 1H) 8.46 (dd, J = 7.72, 1.84 Hz, 1H) 8.51 (dd, J = 4.78, 1.84 Hz, 1H) 16.15 (s ， 1H). Example 216 1-fluorenyl-4-hydroxy_3_ 丨 5 _ 『(4_Nitrogen, some nitrogen, 1-1,1-dioxo-4, -1,2 · 4-benzobenzyl Ergen-3-kib · 2 (1Η) · ketone The title compound was replaced with the product of Example 213 89166-391- 200427678 according to the procedure described in Example 185, and the product of Example 184 was replaced with brominated para-nitrate. Benzyl substituted 2-bromoacetonitrile. (ESI-) m / z582 (M-H) ... The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) δ ppm 5.54 (s, 2H) 5.55 (s, 2Η) 7 · 26 (m, 9Η) 8 · 08 (s, 1Η) 8 · 11 (s, 1Η) 8 · 28 (s, 1Η) 8.31 (s, 1Η) 8.48 (q, J = 2.08 Hz, 1H) 8.50 (s, 1H) 16.01 (s, 1H).

Example 217A N- "2- (Yueanji stilbyl) phenyl 1-l-fluorenyl-6-chloro-4-pyridyl-2-fluorenyl-1,2-diaza-1,8 -Nayodo-3-junic acid Yuean The title compound was prepared according to the procedure of Example 84C, using 1-benzyl-6-chloro-4-hydroxy-2-one-1,2-dihydro-1,8- Naphthyridine-3-carboxylic acid ethyl ester was substituted for the product of Example 84B and 2-amine-benzenesulfonamide was substituted for the product of Example 84A. 1HNMR (300 MHz5 DMSO-d6) 5 ppm 5.64 (s? 2H ) 7.25 (m? 5H) 7.44 (t5 J = 7.72 Hz5 1H) 7.52 (s, 2H) 7.67 (m, 1H) 7.93 (m, 2H) 8.56 (d, J = 2.57 Hz, 1H) 8.87 (d, J = 2.57 Hz, 1H) 12.34 (s, 1H) 16.76 (s, 1H).

Example 217B 1-fluorenyl-6-chloro-3--3- (1,1-digasification_4H-U, 4-benzyl-soul two-cultivation-3-a certain V4-a certain--1,8-kounai Pyridin-2 (1Ηvone title compound was prepared according to the procedure of Example 84D, replacing the product of Example 84C with the product of Example 217A. The sodium salt of the title compound was prepared according to the procedure described in Example 1D. MS (DCI / NH3) m / z 465 (Μ + Η) +, 483 (Μ + ΝΗ3) + · 1 HNMR (300 MHz5DMSO-d6) ά ppm5.49 (s5 2Η) 7.17 (m, 6Η) 7.48 (t? J = 7.35 Hz, 1H) 7.83 (dd, J = 7.72, 1.47 Hz, 1H) 8.32 (d, J = 2.57 Hz, 1H) 8.46 (m, 2H) 11.20 (s, 1H).

Example 218A 89166 -392- 200427678 N- "2- (Amino group continued_some) phenyl 1-major-4-yl-2-keto-6-phenyl · 1,2-dioxine t-1 , 8 · Nayodo · 3_ Lean Yue'an The title compound was prepared in accordance with the procedure of Example 84C, using 1-benzyl-6_phenylpyridinol_2_keto-1,2-dihydro-1,8- The pyridine-3-carboxylic acid ethyl ester was substituted for the product of Example 84B and 2-amine-benzenesulfonamide was substituted for the product of Example 84A. 1HNMR (300 MHz? DMSO-d6) δ ppm 5.72 (s5 2H ) 7.28 (m? 6H) 7.44 (m5 2H) 7.54 (m, 3H) 7.67 (m, 1H) 7.85 (d, J = 6.99 Hz, 2H) 7.92 (dd, J = 8.09, 1.47 Hz, 1H) 7.99 (d, J = 8.09 Hz, 1H) 8.70 (d, J = 2.21 Hz, 1H) 9.17 (d, J = 2.21 Hz, 1H) 12.41 (s, 1H) 16.80 (s, 1H) ·

Example 218B 1-fluorenyl-3- (l, l_-emulsified-4H-1,2,4-benzop-di-2-well-3-yl) -4-meryl-6-benzyl-1,8 -Pyridine_2 (1HV ketone title compound was prepared according to the procedure of Example 84D, replacing the product of Example 218A with the product of Example 218A. MS (ESI-) m / z507 (M-Hy · Sodium salt of title compound Prepared as described in Example 1D. IHNMRQOOMHz, DMSO-d6) 5 ppm 5.53 (s? 2H) 7.04 (m, 2H) 7.26 (m? 7H) 7.48 (t3 J = 7.54 Hz5 2H) 7.58 (d, J = 8.09 Hz, 1H) 7_70 (d, J = 7.35 Hz, 2H) 8.51 (d, J = 2.21 Hz, 1H) 8.65 (d5 J = 2.57 Hz, 1H)

Example 219A 2-Amine-4-methoxybenzylamidine The title compound was prepared according to the procedure described in Topliss et al., J. Med. Chem. 6,1963, 122.

Example 219B Gasification_4H-1,2,4 • Benzodimorphin-3-yl) ethyl acetate 89166 -393-200427678 The title compound was prepared in accordance with the procedure of Example lc, substituting the product of Example 219A for the 2-amino group Made from benzylsulfonamide.

Example 219C

The 4H-1,2,4-benzylpyridine dihydrogenated-ascites group dihydrogenation group Vj, 8-pyridin-2pyridone-one was prepared according to the procedure described in Example 1D. The product of Example 15A was made in place of the product of Example 1B, and the product of Example 219B was made in place of the product of Example 1C. The sodium salt of the title compound was prepared according to the procedure of Example m ° MS (ESI-) m / z 461 (MH)-· 1H NMR (300 MHz, DMSO-d6) 5 ppm 3.90 (m, 3H) 5.72 (s5 2H ) 7.08 (dd, J =: 8.82, 2.21 Hz, 1H) 7.26 (m, 6H) 7.51 (dd, J = 8.09, 4.78 Hz, 1H) 7.82 (d, J = 9.19 Hz, 1H) 8.61 (dd , J = 8.09, 1.84 Hz, 1H) 8.83 (dd, J = 4.60, 2.0 Hz, 1H) 13.97 (s, 1H).

Example 220A Aminyl) phenylphenylethylamine The title compound was prepared according to the procedure described in Topliss et al., J. Med. Chem. 6, 1963, 122.

For example 220B, the compound 4H-U, 4-pyrene # pyrimidinium_3-a certain 1 ethyl acetate title compound was replaced by the product of Example 220A according to the procedure described in Example 1C. While made. MS (DCI) m / z 326 (Μ + Η) +

Example 220C: ΗΙ- 卞 棊 diketo-1,2-di-i, l, 8-xanoridin-3-yl yu-digasified-4 Η-1A4-benzopyrimidin-6-yl-1 ethyl The amidine standard compound was prepared according to the procedure described in Example 1D, replacing the product of Example 1B with the 89166 200427678 product of Example 15A, and replacing the product of Example 1C with the product of Example 220B. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 6_82 (d5 J = 1_84 Hz, 2H) 6.95 (dd5 J = 8.64, 2.02 Hz, 2H) 7.29 (d, J = 4.04 Hz, 1H) 7.44 (dd, J = 8.09, 4.78 Hz, 2H) 7.74 (m, 2H) 8.47 (m, 1H) 8.78 (m, 1H) 10.81 (s, 1H) 12.86 (s, 1H) 14.06 (s, 1H). MS (ESI-) m / z 447 (MH) _Example 221 1-fluorenyl-4-quinyl-3- (6-boryl-1,1-dioxide-4H-1,2,4-benzyl And farinol-3-yl) -1,8-xanthidine_2 (1HV ketone will be the product of Example 219C (20 mg, 0.043 mmol) and boron tribromide (1.0 M in dichloromethane , 20 equivalents) in a mixture of 1,2 dichloroethane (5 ml), and stirred under reflux for 28 hours. The reaction mixture was cooled to 25 ° C, diluted with tetrahydrofuran and 1NHC1 aqueous solution, and refluxed for 2 hours. By filtration The solid formed was collected and dried to give the title compound (11.3 mg). The disodium salt of the title compound was prepared according to the procedure of Example 1D using two equivalents of sodium hydroxide. MS (ESI-) m / z 447 ( MH)-. 1H NMR (300 MHz, DMSO-d6) 5 ppm 6.82 (d, J = 1.84 Hz, 2H) 6.95 (dd, J = 8.64, 2.02 Hz, 2H) 7.29 (d, J = 4.04 Hz, 1H) 7_44 (dd, J = 8.09, 4.78 Hz, 2H) 7.74 (m, 2H) 8.47 (m, 1H) 8.78 (m, 1H) 10.81 (s5 1H) 12.86 (s5 1H) 14.06 (s? 1H).

Example 222A 2-Amino-6-methylbenzylamidine The title compound was prepared according to the procedure described in Topliss et al., J. Med. Chem. 6,1963, 122.

Example 222B 89166 -395-200427678 Digasification-4H-1-2.4-benzene # Ergodic groups) Cool_ Λ rabbit title compound was substituted for the 2-aminobenzenesulfonic acid with the product of Example 222A according to the procedure of Example 1C Made from amidine.

Example 222C ΙιϋHydroxy-3- (8-methyl-1_U-digas-4-4-1,2,4-benzyl 4 Ergener soil 丄 1,8 · xanthidine-2aHV ketone The title compound is based on The procedure described in Example 1D was prepared by replacing the product of Example 1A with the product of Example 15A and the product of Example lc with the product of Example 222B (35.8 mg, 10%). The sodium salt of the title compound was according to Example 1D The program was made. MS (ESI-) m / z 446 (M_H) _ · 1H NMR (300 MHz, DMSO-d6) 5ppm 2.56 (s, 3Η) 5.52 (s, 2Η) 7.06 (dd, J = 7.72, 3.31 Ηζ, 2Η) 7.13 (m? 2H) 7.23 (m5 4H) 7.41 (t? J = 7.72 Hz, 2H) 8.39 (d? J = 1.84 Hz? 1H) 8.48 (dd, J = 4.60, 2 · 02 Hz , 1H) 15.70 (s, 1H). Example 223 4-Hydroxy-3- (5-methoxy-1,1-digasification-4H_1,2,4-benzopyrimidin-3-yl V1- The title compound of G-methylbutyl V1,8-pyrimidone was prepared according to the procedure of Example ID, replacing the product of Example 1B with the product of Example 12A and replacing the product of Example 1C with the product of Example 212B. The sodium salt was prepared according to the procedure of Example 1D. MS (ESI-) m / z 441 (MH)-. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.9 5 (s5 3H) 0.98 (s5 3H) 1.47 (m, 2H) 1.64 (m, lH) 3.98 (s, 3H) 4.29 (t, J = 7.50 Hz, 2H) 7.11 (dd, J = 7.72, 4.78 Hz, 1H) 7.23 (m, 3H) 8.38 (dd, J = 7.35, 1.84 Hz, 1H) 8.51 (dd, J = 4.41, 1.84 Hz, 1H) 15.80 (s, 1H). Example 224 89166 -396- 200427678 7- Bornyl-6- (5-methoxy-1,1-dioxide-4fluorene-1,2 · 4_extracted and broken into two? Well-3-yl V4-G-methylbutyl) farbendo l & quot 3.2-bl pyridine-5 [4Η) -one The title compound was prepared according to the procedure of Example 1D, replacing the product of Example 1B with the product of Example 125A, and replacing the product of Example 1C with the product of Example 212B. The sodium salt was prepared according to the procedure described in Example 1D. (ESI-) m / z 446 (Μ-Η) '1H NMR (300 MHz, DMSO-d6) 5 ppm 0.95 (s, 3H) 0.97 (s, 3H) 1.44 (m, 2H) L67 (m, 1H) 3.99 (m, 5H) 7.08 (d, J = 5.52 Hz, 1H) 7.19 (m, 3H) 7.79 (d, J = 5.15 Hz, 1H) 15.75 (s, 1H). Example 225 4-benzyl-7-hydroxy-6- (5-methoxy-U-dioxide-4H-1,2,4-jasopyridine-3, The pyrimido l &quot; 3,2-bl pyridine-5 (4HV ketone title compound is based on Sequence, the product of Example 110B instead of the product of Example 1B, the product of Example 212B and to the substituent of the product of Example 1C made. The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) δ ppm 3.97 (s? 3H) 5.26 (s? 2H) 7.01 (d? J = 5.52 Hz, 1H) 7.25 (m, 8H) 7.70 (d, J = 5.52 Hz , 1H) 15.69 (s, 1H) · MS (ESI ·) m / z 466 (MH) '1

Example 226A 2- "2-Benzylmethylene aryl 1 benzoic acid methyl ester aims to make 2- (N, phenylmethylene-hydrazino) -benzoic acid (5.0 g, 20.81 mmol) at 1: 1 A solution of tetrahydrofuran in methanol (50 ml) and trimethylsilyldiazomethane in hexane (2.0 M, 12 ml, 25.0 mmol) was reacted at 0 ° C for 1 hour, and then Stir for 48 hours at 25 ° C. Remove the solvent under vacuum to give the title compound as a solid (6.00 g, 100%). IHNMROOOMH ^ DMSO-cy 89166 -397- 200427678 6 ppm 3.87 (s, 3H) 6.84 (td, J = 7.54, 1 · 10 Hz, 1H) 7.41 (m, 3H) 7.54 (m, 1H) 7.74 (m, 3H) 7.86 (dd, J = 8.09, 1.47 Hz, 1H) 8 · 21 ( s, 1H) 11.02 (s, 1H).

Example 226B 2- "2-Benzylidene-1- (3-ethylamino-3-ketopropanyl) oxanyl 1 benzoic acid, the product of Example 226A (5.29 g, 20.81 mmol) In toluene (80 ml), react with ethyl chloromalonate (2.68 ml, 25.0 mmol) under reflux for 4 hours. The reaction mixture was cooled to 25 ° C and concentrated under vacuum. The residue was concentrated The product was triturated with diethyl ether and hexane (3: 1) to give the title compound (5.17 g, 70%). MS (DCI) m / z 355 (M + H) + · 1H NMR (300 MHz, DMSO-d6) 5 ppm 3.32 (s, 2H) 3.69 (s, 3H) 3.73 (s, 3H) 7_16 (s, 1H) 7.32 (dd, J = 7.72, 1.10 Hz, 1H) 7.40 (m, 3H) 7.63 (m, 2H ) 7.70 (td, J = 7.63, 1.29 Hz, 1H) 7.85 (td, J = 7.72, 1.47 Hz, 1H) 8_10 (dd, J = 7.72, 1.47 Hz, 1H) ·

Example 226C 4-Hydroxy-2-keto small {"Bentyl methylene 1 amine certain 1,2-dihydrop-tazoline-3_carboxylic acid ethyl ester The product of Example 226B (5.17 g, 14 · (59 mM) in ethanol (100 ml), reacted with sodium ethoxide (21% by weight in ethanol, 5.50 ml, 14.60 mol) at 25 ° C, and then heated at 50 ° C for 1 hour. After cooling to 25 ° C, the reaction mixture was poured into water, acidified to pH 4 with 1M hydrochloric acid, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered, and the solvent was removed under vacuum. To give the title compound (4.51 g, 96%). MS (DCI) m / z 323 (M + H) +. 1H NMR (300 ΜΗζ? DMSO-d6) 5 ppm 3.73 (s? 3H) 7.21 (m? 1H) 7.56 (m, 5H) 7.95 (m, 2H) 8.03 (d, J = 7.72 Hz, 1H) 9.08 (s, 1H) ·

767087 Meeting example 226D PKD 1-Amino-3- (1,1-digas-4-4-1,2 · 4-benzopyrimidin-3-a certain V4-hydroxyquinoline-89166 -398-200427678 2 (1HV ketone) The product of Example 226C (4.51 g, 14.00 mmol) was reacted with 2-aminobenzenesulfonamide (2.41 g, 14.00 mmol) in toluene (65 ml) under reflux for 6 hours. After cooling to 25 ° C, the solid (5.52 g) was collected by filtration, and further reacted with 10% aqueous hydroxide solution (100 ml) and reacted at 130 ° C for 8 hours. After cooling to 25 ° C, the The reaction was poured into ice and acidified to pH 2 with 1 μ hydrochloric acid. The solid formed was isolated by filtration and dried to give the title compound (3.50 g '71%). The sodium salt of the title compound was according to the procedure of Example id 1HNMR (300MHZ, DMSad6) 55.31 (S, 2H) 7.05 (t, J = 8.09Hz, 1H) 7.27 (m, 2H) 7.53 (m, 2H) 7.67 (m, 2H) 8.07 (dd, J = 8.09, 1.47 Hz, 1H) 16.38 (s, 1H) ·

Example 227A Oxidation of -4H-1,2,4-benzopyrimidin_3_yl) · 4_Transmitter_i_ "ri · propylbutylene" Amino 14line-2ilHVi Same as the product of Example 226D ( 0.080 g, 0.22 mmol) with 4-heptanone (0.63 ml, 4.49 mmol) in N, N-dimethylacetamide (1 mL), in a sealed tube, at 135 At 45 ° C in a microwave reactor for 45 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ether and filtered to give the title compound as a solid (0.032 g, 32 %). MS (ESI-) m / z 453 (MH) ·.

Example 227B 1- (1-propyl · · butylamino dioxo 4H-1,2,4-benzidopyrimidin-3-yl V4-hydroxyzolin-2 (1HV ketone The product (0.032 g, 0.07 mmol) was dissolved in tetrahydrofuran (2 mmol 89166-399-200427678 liters) and methanol (0.010 liters, 0.14 mmol) at 0 ° C to Add dropwise a 20M solution of hydrogenated hydrogenated solution in tetrahydrofuran (0055 ml, 0.01 mmol). The reaction was stirred at 25 ° C for 1 hour, and acidified with 1M hydrochloric acid to a pH value of approximately 2-4, diluted with water (10 ml), and collected the precipitates by filtration, and dried. The crude product was suspended in tetrahydrofuran (2 ml), adsorbed on about 0.5 g of silicone, and evaporated. Fill the 2 g Alltech Sep-pack of the crude product and the silicone paddle liquid in dichloromethane and dissolve it in dichloromethane. Combine the products containing the dissolving fractions and concentrate under vacuum to obtain the title. Compound (0.013 g, 40%). MS (ESI-) m / z 453 (MH)-· The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300 MHz, DMSOd6) 5 ppm 0.85 (m, 6H) 1.33 (m, 8H) 3.13 (m, 1H) 5.66 (d, J = 4.04 Hz, 1H) 7.05 (m, 1H) 7.28 (m, 2H) 7.51 (m, 2H) 7.68 (m, 2H) 8.06 (dd, J = 7.72, 1.47 Hz, 1H) 16.32 (s? 1H).

Example 228A Emulsified -4H-1,2,4-benzyl hydrazone two tons · 3 · yl) -4-methylidene propylidene 1 amine certain k-setolinone to make the product of Example 226D · (〇 · 78 G, 0.50 mmol) with 2-methylpropanal (0.9 ml, 10.0 mmol) in N, N-dimethylacetamide (3 ml) in a sealed tube at 135 ° The reaction was carried out in a microwave reactor at C for 45 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated 'with ether and filtered' to give the title compound.

Example 228B Dioxide · 4Η-1,2 · 4-Benzo-4-diphenyl-3-yl) winter hydroxybutylamino) 4 Porphyrin-2 (1HV ketone 89166 -400- 200427678 The product of Example 228A (0.132 G, 0.32 mmol) in tetrahydrofuran (6 ml) and methanol (0.026 ml, 0.64 mmol), below, a dropwise addition of a 20 M solution of lithium borohydride in tetrahydrofuran (0.24 Ml, 048 mmol). The reaction was stirred at 25t for 1 hour, acidified with 1M hydrochloric acid to a pH value of about 2-4, diluted with water (12 ml), and collected by filtration. &Gt; Children's products and drying. The crude product was triturated with 1: 1 ethyl acetate · hexane (1 (ml)) and filtered to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300MHz, DMSO-d6) 3ppm 1.03 (d, J = 6.62 Hz? 6H) 1.86 (m? 1H) 2.73 (m, 2H) 5.94 (t3 J = 7.35 Hz, 1H) 7.07 (t5 J-7.35 Hz, 1H) 7.27 (m, 2H) 7.54 (m, 2H) 7.60 (d, J = 6.99 Hz, 1H) 7.66 (d, J = 6.99 Hz5 1H) 8.08 (d? J = 8.09 Hz? 1H) 16.27 (s? 1H). MS (ESI-) (MH) 'm / z 411.

Example 229A Dioxin-4H-1,2,4-benzo farepine-3-yl M-1,1-ethylpropylene) amino 1- 4-hydroxyquinoline-2 (1HV ketone makes Example 226D The product (0.178 g, 0.5 mmol) and pentanone (0.53 mL, 5.0 mmol) in N, N-dimethylacetamide (4 mL) in a sealed tube at 135 ° C Then, the reaction was carried out in a microwave reactor for 60 minutes. The reaction mixture was cooled to 25 ° C. and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Example 229B 3- (1,1-Dioxide_4H-1,2,4 Benzopyrimidin-3-yl H4 (l-ethoxypropyl) amino-4-pyridyl-4-line-2 ( 1))-Ketone The product of Example 229A (0.122 g, 0.287 mmol) was dissolved in tetrahydrofuran (8 mmol 89166 -401-200427678 liters) and methanol (0.023 mL, 0.57 mmol) at 0 ° C to Add dropwise a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.215 ml, 0.43 mmol). Treat the reaction at 25 ° C for 2 hours and acidify with 1 M hydrochloric acid to a pH of about 2-4. Dilute with water (15 ml) and collect the formed precipitate by filtration, and dry. The crude product is chromatographed on silica gel with 98: 2 dichloromethane / methanol to give the title compound. Sodium salt of the title compound Prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 ppm 0.83 (s, 3H) 0.98 (s, 3H) 1.31 (m, 2H) 1.48 (m, 2H) 2.99 ( m, 1Η) 5.70 (d, J = 4.04 Hz, 1Η) 7.05 (t, J = 7.17 Hz, 1H) 7.28 (m, 2H) 7.51 (m, 2H) 7.66 ( d, J = 8.09 Hz, 1H) 7.72 (d, J = 8.09 Hz, 1H) 8.06 (d, J = 7.72 Hz, 1H) 16.32 (s, 1H). MS (ESI-) (M-H)-m / z 425.

Example 230A 3- (1,1-Digasification_4H-1,2,4-Benzene # 4 Digap-3-yl V4-fluorenyl-14pentylamino group 1 The product of Example 226D (0.05 g 0.14 mmol) and valeraldehyde (0.015 mL, 1.4 mmol) in N, N-dimethylacetamide (2 mL) in a sealed tube at 135 ° C in the microwave In the reactor, the reaction was performed for 45 minutes. The reaction mixture was cooled to 25 ° C. and concentrated. The resulting residue was triturated with diethyl ether and filtered to obtain the title compound.

Ψ230 230B 3- (1,1-dioxide-4H-U.4-japan-di-U · yl) -4-fluorenyl small (amylamine) + IjdHV ketone The product of Example 230A (0.034 g, 0.08 mmol) in tetrahydrofuran (2 ml) and methanol (0.0064 ml, 0.16 mmol) at 0 ° C to add 89166 -402- 200427678 dropwise.

Add a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.06 ml, 0.2 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water (5 ml), and the formed precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 98: 2 dichloromethane / methanol to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) 5 ppm 0.90 (t, J = 6.99 Hz, 3H) 1.37 (m, 4H) 1.55 (m, 2H) 2.73 (m, 2H) 5.90 (t, J = 6.80 Hz, 1H) 7.07 (t, J = 7.72 Hz, 1H) 7.26 (m, 2H) 7.52 (m, 2H) 7.60 (d, J = 8.09 Hz, 1H) 7.66 (d, J = 8.09 Hz5 1H) 8.09 ( d? J = 8.09 Hz3 1H) 16.27 (s5 1H). MS (ESl ·) (MH) -m / z 425.

Example 231A Cyclohexyleneamino digasification-4H-1,2,4-benziridine digeno-3-a certain V4-myoquinoline-2 (1HV ketone made the product of Example 226D (0.155 g, 0-60 mmol) Moore) and cyclohexanone (20 mole equivalents) in N, N-dimethylacetamide (2 ml) in a sealed tube at 135 ° C in a microwave reactor for 60 minutes The reaction mixture was cooled to 25 ° C and concentrated.-The residue formed was triturated with diethyl ether and filtered to give the title compound.

Example 231B 1- (Cyclohexylamino V3- (l, l_dioxide-4H-1,2,4-pyridopyrimidin-3-yl M-hydroxysomeline-2 (1HV ketone The product (0.087 g, 0.2 mmol) in tetrahydrofuran (4 mL) and methanol (0.016 mL, 0.4 mmol) was added dropwise at 0 ° C as a 2.0 M solution of lithium borohydride in tetrahydrofuran ( 0.15 ml, 0.3 mmol), treated 89166 -403-200427678. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, and diluted with water (5 ml). The precipitate formed was collected by filtration and dried to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMRpOOMHADMSO- ^) 5ppml.l3 (m, 6H) 1.58 (m, 2H ) 1.75 (m, 2H) 2.97 (m, 1H) 5.68 (d, J = 3.68 Hz, 1H) 7.05 (t, J = 7.54 Hz, 1H) 7.27 (d5 J = 8.09 Hz , 1H) 7.30 (d, J = 8.09 Hz, 1H) 7.49 (t, J = 7.72 Hz, 1H) 7.55 (t, J = 7.72 Hz, 1H) 7.67 (d, J = 8.09 Hz , 1H) 7.76 (d, J = 8.46 Hz, 1H) 8.06 (d5 J = 7.72 Hz5 1H) 16.30 (s? 1H). MS (ESI-) (MH) 'm / z 437.

Example 232A MU-dioxide-4H-1? 4-benzopyridine-3-yl V4-hydroxy-1-{"(2-methyl-L3-thiazol-4-yl) methylene 1 amino group H-quinoline-2 (1HV ketone made the product of Example 226D (0.119 g, 0.33 mmol) with 2-methyl-1,3-oxazole · 4-carboxaldehyde (5 molar equivalents) at N, N- In dimethylacetamide (3 ml), in a sealed tube at 135 ° C in a microwave reactor for 60 minutes. The reaction mixture was cooled to 25 C 'and concentrated. The residue formed Triturate with diethyl ether and filter to give the title compound.

* Example 232B Dioxobenzoate_3_some V4- # presents a methyla certain oxazol-4-yl) methyl 1 amino group} apricot 4 lion will be the product of Example 232A (0_〇97 grams, 0.208 mmol) in tetrahydrofuran (5 ml) and methanol (0.016 ml, 0.40 mmol). Below 0 ° C, a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.15 ml, 0.3 mmol) was added dropwise. The reaction was stirred at 25 ° C for 3 hours, &amp; 1M hydrochloric acid was acidified to a positive value of about 2-4, diluted with water (10 ml), and the formed 89166-404-200427678 precipitate was collected by filtration ' And dry. The crude product was chromatographed on a reverse phase column of 018 and dissolved in water: acetonitrile 90: HM): 100 to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300MHz, DMSO-d6) 5 ppm 2.68 (s5 3H) 3.24 (m? 2H) 6.33 (m5 1H) 7.10 (m5 1H) 7.31 (m5 2H) 7.43 (s, 1H) 7.61 (m, 4H) 8.08 ( d, J = 7_72 Hz, 1H) 16.24 (s, 1H) · MS (ESI-) (MH)-m / z 466.

Example 233A Emulsified -4H-1,2,4-benzyl-2 ton-3 -yl) ice-light methylmethyl ethylene) amine group> The perazolinone was the product of Example 226D (0.080 g, 〇 · 22 mmol) with acetone (0.34 mL, 4-50 mmol) in ν, N-dimethylacetamide (1.0 mL) in a sealed tube at 125 C in a microwave reaction In the device, react for 25 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Example 233B

Peroxoline_2 (1HV ketone) The product of Example 233A (0.044 g, 0.11 mmol) was dissolved in tetrahydrofuran (20 ml) and methanol (0.0 H) ml, 0.28 mmol. A 2.0 M solution of lithium borohydride in tetrahydrofuran (0.085 ml, 017 mmol) was added dropwise. The reaction was stirred at 25t for 1 hour, acidified with 1M hydrochloric acid to a pH of about 2-4, diluted with water, and the formed precipitate was collected by tritium, and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 89166 -405-200427678 * (300 MHz, DMSO-d6) 3 ppm 0.99 (m, 6H) 3.94 (m, 1H) 5.65 (d, J = 4.41 Hz, 1H) 7.04 (t? J = 7.35 Hz? 1H) 7.28 (m5 2H) 7.51 (m5 2H) 7.66 (d5 J = 7.72 Hz? 1H) 7.75 (d, J = 8.46 Hz, 1H) 8.06 (dd, J = 8.09, 1.47 Hz, 1H) 16.28 ( s ， 1H) · (ESI-) m / z 397 ·

Example 234A H Cyclobutylamino) -3- (1,1-digasification-4H-1,2,4_benzylopyridine-3-even V4-Ethyl P chalonone makes Example 226D The product (0.080 g, 0.22 mmol) and cyclobutanone (0.50 ml '7.10 dm) in N, N-dimethylethylamine (0.50 ml), in a sealed tube, at The reaction was carried out in a microwave reactor at 125 ° C for 40 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Example 234B Amine) -3- (1,1-digasification-4Η-1 义 4_jamo 4 stilbene j-based V4- 蕤 p quelin · 2 (1HV ketone will be the product of Example 234A (0.032 g , 0.078 mmol) in tetrahydrofuran (2.0 halon) and methanol (0.010 ml, 0.28 mmol), at a temperature of 0.0, a dropwise addition of a 2.0 M solution of lithium borohydride in tetrahydrofuran was added. (0025 ml, 005 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 μ hydrochloric acid to a pH of about 2-4, diluted with water, and collected by filtration. The resulting precipitate was dried and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example m. 1H NMR (300 MHz, DMSO -d6) 5 ppm L54 (m5 1H) 1.98 (m5 4H) 3.61 (m5 2H) 6.09 (d? J = 6.25 Hz? 1H) 7.06 (td5 J = 7.355 1.10 Hz? 1H) 7.27 (m5 2H) 7.53 (m 89166 -406- 200427678 2H) 7.65 (m, 2H) 8.06 (dd, J = 7.91, 1.65 Hz, 1H) 16.28 (s, 1H) · MS (ESI-) m / z 409 (M-Η) ··

Example 235A Cyclopentylamino) -3- (1,1-digasified-4H-1,2,4-jasmine # 4 Dipyridin-3-yl M-hydroxyquinolinone gives the product of Example 226D ( 0.079 g, 0.22 mmol) with cyclopentanone (0.195 ml, 2.22 mmol) in N, N-dimethylacetamide (1.50 ml) in a sealed tube at 130 ° C In a microwave reactor, react for 30 minutes. The reaction mixture was cooled to 25 ° C. and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Example 235B Cyclopentylamino) digas-4H-U, 4-benzylpyrene-3-a certain V4-transform a certain quinoline-2 (1HV ketone the product of Example 235A (0.030 g, 0.071 mmol) Mol) in tetrahydrofuran (2.0 ml) and methanol (0.010 ml, 0.28 mmol), at 0 ° C, dropwise add a 2.0 mM solution of lithium borohydride in tetrahydrofuran (0.060 ml, 0.12 mmol). Moore) treatment. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water, and the formed sanctuary formed by filtration was collected and dried, and The title compound was obtained. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H nmR (300 MHz, DMSad6) accounts for ppm 丨 · 6 丨 (m, 8H) 3.70 (m5 1H) 5.68 (d, J = 4.41 Hz? 1H) 7.05 (t5 J = 7.35 Hz5 1H) 7.28 (t5 J = 8.27

Hz, 2H) 7.54 (m, 2H) 7.69 (dd, J = 15.81, 8.09 Hz, 2H) 8.06 (dd, J = 8.09, 1.47

Hz, 1H) 16.28 (s, 1H) · MS (ESI-) m / z 423 (M-H) '

Example 236A 89166 • 407- 200427678 Seal 14 ^ _Oxidation_4H-1,2,4_Benzodiphenone · 3 · group V4_Weiyl · 1] β-methylcyclopentylene 1 amino group quinine Porphyrin-2 (1HV ketone gives the product of Example 226D (0.080 g, 0.22 mmol) and 3-methylcyclopentanone (0.50 ml, 5.09 mmol) in N, N-dimethylacetamidine In an amine (1.0 ml), in a sealed tube, at 135 ° C, in a microwave reactor for 40 minutes. The reaction was cooled to 25 C and concentrated. The residue formed was The product was triturated with diethyl ether and filtered to give the title compound.

Example 236B ULli oxidized -4H-1,2,4-benzyl bis # -3 • yl-1] "3-methylcyclofluorenyl 1 amine h quinoline-2 (1HV ketone Example 236A The product (0.068 g, 0.16 mmol) was added in tetrahydrofuran (2.0 ml) and methanol (0.010 ml, 0.28 mmol) at 0 ° C, and lithium borohydride was added dropwise in tetrahydrofuran. 2.0M solution (0.100 ml, 0.20 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water, and borrowed. The precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300 MHz? DMSO- d6) 5 ppm 1.03 (m? 3H) 1.35 (m5 1H) 1.78 (m? 4H) 2.56 (m5 Bu 5.52 Hz, 2H) 3.69 (m, 1H) 5.78 (m, 1H) 7.05 (m, 1H) 7.27 (m, 2H) 7.52 (m, 2H) 7.69 (m, 2H) 8.06 (dd, J = 7.72, 1.47 Hz, 1H) 16.28 (s, 1H) · MS (ESI-) m / z 437 (MH) '

Example 237A 3- (U-Dioxide-4H-1,2,4-Mero-4 Digonium-3-yl V4-hydroxy-1- (tetrahydro-4H-piperidine-4-amine)> Quinoline-2 (1HV ketone 89166 -408- 200427678 makes the product of Example 226D (0.080 g, 0.22 mmol) and tetrahydro-4H · piperan_4__ (0.215 ml, 2.33 mmol) In N, N-dimethylacetamide (1.0 ml) in a sealed tube at 130 t in a microwave reactor for 35 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Example 237B MU-digasification_4H-1,2,4 Benzopyrimidin-3-yl) -4 · Hydroxy small (tetramethyl-4-ylamino group)> Set 4-2 (1HV ketone Example 237A The product (0.082 g, 0.19 mmol) in tetrahydrofuran (2.0 ml) and methanol (0.015 ml, 0.42 mmol) was added dropwise to 2 of lithium borohydride in tetrahydrofuran at 0.0%. 0 M solution (0.140 ml, 0.28 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water, and filtered by filtration. The resulting precipitate was collected and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300 MHz, DMSO-d6 ) δ ppm 0.86 (m5 1H) 1.24 (m5 2H) 1.48 (m? 2H) 3.20 (m? J = 18.02, 10.66 Hz? 2H) 3.81 (m5 2H) 5.82 (d5 J = 4.04 Hz5 1H) 7.04 (m5 J = 7.72 Hz, 1H) 7_27 (m, J = 8.46, 8.46 Hz, 2H) 7.52 (m, 2H) 7.66 (d, J = 7.72 Hz, 1H) 7.76 (d, J = 8.09 Hz , 1H) 8.04 (d, J = 1.47 Hz, 1H) · MS (ESI-) m / z 439

Example 238A ^ 1, 丨 -Dioxide-4H-1,2,4-Benzopyridine-3-yl M] "1 · Ethylene butylene 1 amino group} · 4-Hydroxy 4 4-2aHV The ketone made the product of Example 226D (0.085 g, 0.24 mmol) and hexanone (0.555 mmol 89166 -409- 200427678 liters' 4.48 mmol) in N, N-dimethylacetamide (1.0 ml) The reaction was carried out in a sealed tube at 140 ° C in a microwave reactor for 60 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.

Example 238B Oxidation of 4H-U, 4-jamopyridine-3-yl M-m-ethmidine Dingqi zu hydroxy 4line_2 (1HV ketone The product of Example 238A (0.049 g, 0 (11 mmol) in tetrahydrofuran (2.0 ml) and methanol (0.015 ml, 〇_42 mmol) at 0. (:, add lithium borohydride in tetrahydrofuran dropwise 2.0 M solution (0.152 ml, 0.30 mmol) was treated. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water, and The precipitate formed was collected by filtration, and dried to obtain the title compound. The crude product was subjected to chromatography on dichloromethane to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) (5 ppm 0.88 (m, 6H) 丨. 37 (m, 6H) 3.05 (m, 1H) 5.68 (m, 1H) 7.05 (m, 1H) 7.28 ( m, 2H) 7.52 (m, 2H) 7.66 (d, J = 7.72 Hz, 1H) 7.71 (m, 1H) 8.06 (dd, J = 7.72, 1.47 Hz, 1H) 16.32 (s, 1H) · MS (ESI -) m / z439 (MH) ·.

Example 239A 3- (l, l-dioxide-4H-1,2,4-benzop-dihex-3-yl) -4_ and a small {[Y3R) _3_methylcyclohexylene 1 amine Base VI: pLin_2 (1HV Seima Product of Example 226D (0.080 g, 0.22 mmol) and (3R) _3 · methylcyclohexanone (0.275 ml, 2.25 mmol) at N, N- Dimethylacetamide (1.0 ml), in a sealed tube, at 130 ° C, in a microwave reactor, for 35 minutes 89166-410-200427678. The reaction mixture was cooled to 25 ° C, and Concentrated. The resulting residue was triturated with Ojun and filtered to give the title compound.

Example 239B Chem-4H-1,2,4_ Benzopyridine V4 · and some hexyl 1 amine 4 4 -2 (1HV ketone will be the product of Example 239A (0.045 g, 0.10 mmol) Tetrahydrofuran (2.0 ml) and methanol (0.010 ml, 0.28 mmol) were added dropwise at 0 ° C to a 2.0 M solution of lithium hydride in tetrahydrofuran (0.075 ml, 0.15 mmol). Moore) treatment. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water, and the precipitate formed was collected by filtration and dried to obtain The title compound. The crude product was subjected to chromatography on silica gel to obtain the title compound. The steel salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.83 ( m, 3H) 1.22 (m, 3H) 1.73 (m, 3Η) 2.99 (m, 1H) 5.67 (d, J = 4.04 Hz, 1H) 7.04 (t, J = 6.99 Hz, 1H) 7.28 (t, J = 8.27 Hz, 2H) 7.53 (m, 2H) 7.66 (d, J = 7.72 Hz, 1H) 7.74 (d, J = 8.09 Hz, 1H) 8.06 (m , 1H) · MS (ESI-) m / z 451 (MH) '

^ Example 240A 2- (2-Cyclopeptahydrazine) stupic acid The title compound was prepared according to the procedure described in Example 162A, using cycloheptanone instead of benzaldehyde.

Example 240B 1- (Cycloheptylamino V2H-3,!-Suzakisaki-2,4 (1HV dione title compound was replaced with the product of Example 240A according to the procedure described in Example 162B Example 16 Made from its products. 89166 -411- 200427678

Example 240C 1: (Cycloheptylene-amino) _3_ (U-Digas-4H-1,2,4-Benzobiorco_3_yl) -4_I-quinoline-2HHV ketone title compound It was made according to the procedure described in Example 1D, replacing the product of Example 1B with the product of Example 240B.

Example 240D j_ (Cycloheptylamino) · 3-Π, 1-digasification-4H-1,2,4-benzopyrene-cooking-3-a certain V4-hydroxy4line-2ΠΗνone

The product of Example 240C (0.099 g, 0.22 mmol) was added in tetrahydrofuran (4.0 ml) and methanol (0.020 ml, 0.49 mmol) at 0 ° C, and lithium borohydride in tetrahydrofuran was added dropwise. The 2.0 M solution (0-16 ml, 0.32 mmol) was treated. The reaction was stirred at 25 ° C. for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water, and the precipitate formed was collected by filtration and dried to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) 5 ppm 1.43 (m, 11H) 1 _87 (m, 1H) 3.25 (m, 1H) 5_53 (d, J = 3.68 Hz, 1H) 7.04 (m, 1H) 7.28 (m, 2H) 7.51 (m, 2H) 7.66 (d5 Γ = 7.72 Hz, 1H) 7.73 (d, J = 8.46 Hz, 1H) 8.05 (dd5 J = 7.72, 1.47 Hz , 1H) 16.30 (s, 1H). MS (ESI-) m / z 451 (MH)-·

Example 241A Dioxane-4H-1,2,4-benzopyrene-3-yl VWD-ethoxycyclopentyl 1 amine V4-hydroxy4line-2C1HV ketone gives the product of Example 226D (0.080 g, 0.22 mmol) with 3-ethylcyclopentanone (0.380 ml, 3.30 mmol) in Ν, Ν · dimethylacetamide (ΐ · ml) in a sealed tube at 135 ° C Next, the reaction was carried out in a microwave reactor for 35 minutes. 89166 -412- 200427678 The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ether and filtered to give the title compound.

Example 241B 4 Ternylbenzopyrene _3_yl Vl_ {"3-Ethoxylamino-4--4-A quinoline-2 (1HV ketone The product of Example 241A (0.031 g, 0.068 mmol) Mol) in tetrahydrofuran (20 liters) and methanol (0.010 ml, 0.25 mmol) at 0 ° C, lithium borohydride in tetrahydrofuran was added dropwise at 2.0 ° C. Μ solution (0.055 ml, Moore). The reaction was stirred at 25 ° C for 1 hour, acidified with hydrochloric acid to a pH of about 2-4 ', diluted with water, and collected by filtration. The formed precipitate was dried and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6 ) δ ppm 0.85 (m, 3H) 1.56 (m5 8H) 3.65 (m5 2H) 5.75 (m, 1H) 7.05 (t, J = 6.99 Hz, 1H) 7.28 (m, 2H) 7.52 (m, 2H) 7.69 (m, 2H) 8.06 (dd, J = 7.90, 1.65 Hz, 1H) 16.28 (s, 1H) · MS (ESI-) m / z 451 (MH) _

Example 242A

Kl, l-digasification: 4H-1,2,4-benzyl acetone, 2-p-well_3-yl) -4-ylpropionyl butylene-1amino group, 4-line-2 (1HV ketone make example 226D The product (0.080 g, 0.22 mmol) and 2-methylhexanone (0.620 ml, 4.48 mmol) in N, N-dimethylacetamide (1.0 ml) in a sealed tube In a microwave reactor, the reaction was performed at 135 ° C for 60 minutes, and then at 145 ° C for 60 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ether, and Filter to obtain the title compound. 89166 -413- 200427678

Example 242B

MlA-Dioxide-4H-1,2,4 • Ben and 4-two-field_3-based V4- 鼗 some small ill-isopropyl 1-based 1 amino group hydrazone-2ΠΗν ketone The product of Example 242A (0.049 G, 0.11 mmol) in tetrahydrofuran (2.0 ml) and methanol (0.010 ml, 0.25 mmol) at 0 ° C, dropwise addition of borohydride in 2.0 M solution in tetrahydrofuran ( 0.085 ml, 0.17 mmol). The reaction was stirred at 25 ° C. for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water, and the formed precipitate was collected by filtration, and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz5 DMSO-d6) δ ppm0.68 (m5 1H) 1.18 (m? 9H) 2.49 (m? 4H) 3.00 (m? 44.49 Hz, 1H) 5.73 (d, J = 20 · 22 Hz, 1H ) 7.04 (m, 1H) 7.27 (m, 2H) 7.52 (m, 2H) 7.71 (m, 2H) 8.06 (dd, J = 8.09, 1.47 Hz, 1H) 16.33 (s, 1H) · MS (ESI ·) m / z 453 (M-Η) '.

Example 243A 3- (1,1-Dioxide-4H-1,2,4-benzopyrimidin-3-yl) -4-hydroxyl-m-benzene Porphyrin-2 (1HV ketone made the product of Example 226D (0.080 g, 0.22 mmol) with 1-phenylethyl ketone (0.49 ml, 4.20 mmol) in N, N-dimethylacetamide (1.0 ml ), In a sealed tube at 135 ° C for 40 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ether and filtered to obtain Title compound.

Example 243B Dioxal-4H-1,2,4-Benzo-p-diphenyl 1-3-yl) -4-ylphenyl 1-ethyl 1 89166 • 414- 200427678 amino group 4 4 -2 (1HV Ketone The product of Example 243A (0.093 g, 0.20 mmol) in tetrahydrofuran (2.0 ml) and methanol (0.015 ml, 0.42 mmol) was added dropwise with lithium borohydride in tetrahydrofuran at room temperature. 2.0M solution (0.152ml, 0.30mmol) was treated. The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of about 2-4 'diluted with water, and filtered, The precipitates formed were collected and dried. The crude product was chromatographed on syrup with dichloromethane to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300 MHz5 DMSO-d6) δ ppm 1.31 (m5 3H) 4.41 (d5 J = 68.76 Hz51H) 5.85 (m? 1H) 7.28 (m, J = 7.54, 7.54 Hz, 7H) 7.59 (m, 4H) 8.07 (m, 2H) 16.30 (s, 1H). MS (ESI-) m / z459 (MH) ·.

Example 244A

Hl, l_digasification-4H-1,2,4-benzopyrimidine_3_yl) _4-Yumiao 丨 Yi-Fenphen-3-ylethylene 1 Amine Quilin-2 (1HV) The product of Example 226D (0.080 g, 0.22 mmol) was mixed with 1-pyrimidin-3-yl ethyl ketone (0.14 g, U1 mmol) at n, N-dimethylacetamidine. Amine (0.5 ml) was reacted in a sealed tube in a microwave reactor at 135 ° C for 45 minutes. The reaction mixture was cooled to 25 C 'and concentrated. The resulting residue was treated with ether Triturated and filtered to give the title compound.

Example 244B KU-Oxide-4H-1,2,4-benziridine digonium-3-a certain V4-a certain small U1-pyrophen_3_ylethyl 1amino V quinoline_2 (1HV ketone will The product of Example 244A (0.070 g, 0-15 mmol) was added in tetrahydrofuran (2.0 ml) and methanol (0.015 ml, 0.42 mmol) at 0 ° C to add 89166 -415- 200427678 dropwise. A 2.0 M solution of lithium in tetrahydrofuran (0.090 ml, 0,18 mmol) was treated. The reaction was stirred at 25 ° C for 1 hour and acidified with 1 M hydrochloric acid to a pH of about 2-4. , Diluted with water, and collected the formed precipitate by filtration, and dried. The crude product was chromatographed on silica gel with dichloromethane to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 ppm 1.26 (m, 3Η) 4.58 (m, 1Η) 5.74 (s, 1Η) 7.07 (m, 1H) 7.18 (m, 1H) 7 · 28 ( m, 3H) 7.37 (s, 1H) 7.55 (m, 2H) 7.66 (m, 1H) 7.96 (d, J = 6.62 Hz, 1H) 8.07 (s, 1H) 16.30 (s, 1H) · MS (ESI_) m / z 465 (M_H)

Example 245A dimethylcyclohexylene 1amino} -3-α, 1-digasified-4fluorene-1 · 2 · 4_benzyl-4-diphenyl-3-yl V4-fluorenyl 4: 1HV ketone produced the product of Example 226D (0.080 g, 0.22 mmol) with 3,5-dimethylcyclohexanone (0.57 g, 4.52 mmol) in N, N-dimethylacetamide ( 1.0 ml), in a sealed tube at 135 ° C in a microwave reactor for 40 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ether and filtered To get the title compound.

-Example 245B HIM-dimethylcyclo_hexyl1amino group-3 ((1,1-digasification-4Η_1.2.4-japanopyridine)-3-yl V4-hydroxyquinoline-2 (1HV ketone The product of Example 245A (0.064 g, 0.14 mmol) was dissolved in tetrahydrofuran (2.0 ml) and methanol (0.010 ml, 0.25 mmol) at 0. (:, lithium borohydride was added dropwise at A 2.0 M solution in tetrahydrofuran (0.000 ml, 0.20 mmol) was treated. The reaction was stirred at 25 ° C for 1 hour, and acidified with 1 M hydrochloric acid to a pH of about 2 to 4 '. Dilute with water and collect the formed precipitate by filtration, 89166-416-200427678 and dry. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was according to the procedure of Example 1D. IHNMR (300 MHz, DMSO-d6) δ ppm 0.55 (m? 2H) 0.87 (m? 6H) 1.67 (m? 6H) 3.05 (m? 1H) 5.66 (dd, J = 5.70, 3.86 Hz, 1H ) 7.05 (m, 1H) 7.28 (t, J = 8.27 Hz, 2H) 7.51 (m, 2H) 7.66 (d, J = 7.72 Hz, 1H) 7.73 (t, J = 7.54 Hz, 1H) 8.06 ( dd, J = 7.91, 1 · 29 Hz, 1H) · MS (ESI-) m / z 465 (MH)-·

Example 246A

Kl, l-di-emulsified-4H-1,2,4-benzoxanthrin-3.yl) -4-ylidene isopropylcyclohexylene 1 amine certain hydrazone-2II))-one Example 226D The product (0.080 g, 0.22 mmol) was the same as 4-isopropylcyclohexane (0.63 ml, 4.11 mmol) in Ν, Ν · dimethylacetamide (1.0 ml ), In a sealed tube, in a microwave reactor at 135 ° C for 45 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Example 246B oxidized-4 · fluorene-1,2,4-benzo-p-diphenyl-2-yl) -4- # fluorenyl_l_ [Y4_isopropylcyclohexyl-amino) amino V amyline -2 (1HV ketone) The product of Example 246A (0.095 g, 0.20 mmol) was added in tetrahydrofuran (20 ml) and methanol (0.015 ml, 0.42 mmol). Next, rot hydrogen was added dropwise A 2.0 M solution of lithium in tetrahydrofuran (0.150 ml, 0.30 mmol) was treated. The reaction was stirred at 25 ° C for 1 hour, and acidified with 1M hydrochloric acid to a pH of about 2-4. It was diluted with water, and the precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1hnmr 89166 -417- 200427678 (300 MHz, DMSO-d6) 5 ppm 0 · 86 (m, 6H) 1.43 (m, 7H) 1.87 (m, 1H) 2.94 (m, 1H) 3.14 (m, 1H) 5.71 (m, 1H) 7_04 (t, J = 7.54 Hz, 1H) 7.28 (t, J = 8.46 Hz, 2H) 7.50 (m, 2H) 7.70 (m, 2H) 8.06 (m, 1H) 16.30 ( s5 1H). MS (ESI-) m / z 479 (M-Η) '

Example 247A H3,4-dihydrobenzene-2 (1HV-based amine dioxide-4H-1,2,4-benzyl-4-diphenyl-3-yl) -4-Kuikoulin-2 (per base) 1 H) -fluorene was combined with the product of Example 226D (0.080 g, 0.22 mmol) and 3,4-dihydrofluorene-2 (1 mg) -one (0.60 ml, 4.54 mmol) at Ν, Ν- 二Methylacetamide (1.0 mL) was reacted in a sealed tube in a microwave reactor at 135 ° C for 45 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ether and filtered to give the title compound.

Example 247B Digas-4H_1,2,4-benzopyrimidinium-3-yl V4-hydroxy_1- "1,2,3,4-tetrahydro: -2-ylamino &gt; 2 (1HV different

The product of Example 247A (0.070 g, 0.14 mmol) was dissolved in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.25 mmol). Below 0 ° C, a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.11 ml, 0.22 mol) was added dropwise. The reaction was stirred at 25 ° C. for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water, and the formed precipitate was collected by filtration, and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1 η NMR (300MHz, DMSO-d6) δ ppm 2.73 (s, 2H) 3.27 (d, J = 12.50 Hz, 4H) 5.93 (d, J = 3.68 Hz5 1H) 7.07 (m5 6H) 7.28 (t? J = 7.54 Hz3 3H) 7.55 (m? 2H) 7.66 (d3 89166 -418- 200427678 J = 7.72 Hz, 1H) 8.07 (dd, J = 7.72, 1.47 Hz, 1H) 16.28 (s, 1H) · MS (ESI -) m / z 485 (MH) \

Example 248A Oxidation of 4H-1,2,4-benzopyridine-3 · yl) _4_Boryl-υβ / trifluoromethyl) Cyclohexylene 1 Amine h oxoline-2 (1HV ketone make an example The product of 226D (0.080 g, 0.22 mmol) and 3- (trifluoromethyl) cyclohexanone (0.75 ml, 4.54 mmol) in n, N-dimethylacetamide (1.0. Ml) in a sealed tube at 135 ° C in a microwave reactor for 40 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ether and filtered. Thus, the title compound was obtained.

Example 248B Oxidized-4H-1,2,4-benzopyrimidi-3-yl V4-light trifluoromethyl) Cyclohexyl 1 amine Quinoline-2 (1HV ketone The product of Example 248A (0.103 G, 0.20 mmol) in tetrahydrofuran (2.0 ml) and methanol (0-015 ml, 0.42 mmol), below it, a 2.0 M solution of lithium borohydride in tetrahydrofuran ( 0.15 ml, 0.30 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water, and collected by filtration to form The precipitate was dried, and the crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300 MHz, DMSO-d6) δ ppm 1.21 (m? 4H) 1.76 (m5 2H) 2.31 (m5 1H) 3.11 (m, 2H) 3.97 (m, 1H) 5.81 (d, J = 19.85 Hz, 1H) 7.05 (m, 1H) 7.28 (m, 2H ) 7.53 (m, 2H) 7.66 (d, J = 8.09 Hz, 1H) 7.75 (d, J = 7.72 Hz, 1H) 8.06 (dd, J = 8.09, L47 Hz, 1H) · MS (ESI -) m / z 505 (MH) _ 89166 -419- 200427678

Example 249A 1-f-butyleneamino 1-3_ (1,1-dioxide · 4Η-1,2,4-benzoxanthenol_3-a certain V4- light group? Kuiping-2 (1H) The ketone made the product of Example 226D (0.060 g, 0.168 mmol) with butyric acid (0135 ml '1.50 hamol) in N, N-dimethylacetamide (1.0 ml) in a sealed tube In a microwave reactor at 110 ° C. for 35 minutes, the reaction mixture was cooled to 25 C ′ and concentrated. The resulting residue was triturated with ethyl acetate and filtered to obtain the title compound.

Example 249B Butylamino) -3_ (U-Dioxide-4fluorene-1,2,4-benzyl # 4 Ergen Erji vi hydroxy 4 morpholine-2ΠΗ) -one The product of Example 249A (0.040 g, 0.097 mmol) Mol) in tetrahydrocondensate (2.0 mL) and methanol (0.008 mL, 0.94 mol). At room temperature, a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.074 ml, 0.148 mmol) was added dropwise to treat. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4 ', diluted with water (5.0 ml), and the precipitate formed was collected by filtration, and water (2x5 .0 ml) was washed and dried. The crude product was triturated with ethyl acetate and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMRpOOMHz'DMSO-c ^) δ ppm 0.93 (t, J = 7.17 Hz, 3H) 1.48 (m, 4H) 2.77 (m, 2H) 5.90 (t, J = 6.99 Hz, 1H) 7 · 〇 7 (m, 1H) 7.27 (m, 2H) 7.58 (m, 3H) 7.66 (d, J = 8.09 Hz, 1H) 8.08 (dd, J = 8.09, 1.47 Hz, 1H) 16.28 (s? 1H) . MS (ESI-) m / z 411 (MH) &quot;.

Example 250A: Oxidation of 4H4 and 4-benzo4, and each of V4-hydroxy-1 · {"3_A certain sub-engineer 89166 -420- 200427678 group 1 amino group h mantleline-2 (1 Η ketone make Example 226D The product (0.060 g, 0.168 mmol) and 3-methylbutyraldehyde (0.161 ml, 1.50 mmol) in N, N-dimethylacetamide (1.0 ml), in a sealed tube, The reaction was carried out in a microwave reactor at 110 ° C for 35 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Example 250B Digas-4H-1,2,4 • benzopyrimidin-3-yl V4-hydroxy-1-1-IY3-methylbutanyl) Amine &gt; Quinoline-2 (1HV ketone will be an example The product of 250A (0.041 g, 0.097 mmol) was added in tetrahydrofuran (2.0 ml) and methanol (0.008 ml, 0.194 mmol) at 0 ° C to dropwise add lithium borohydride in tetrahydrofuran 2 · 0 M solution (0.074 ml, 0.148 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water (5.0 ml), and borrowed. The precipitate formed was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (3Q0 MHz, DMSO_d6) 5 ppm 0 · 92 (s, 3H) 0.94 (s, 3H) 1.45 (q, J = 7 · 11 Hz, 2H) L73 (m, 1H) 2.79 (m5 2H) 5.87 (t, J = 6.80 Hz, 1Η) 7.07 (t, J = 7.35 Hz, 1H) 7.28 (t, J = 8.46 Hz, 2H) 7.55 (m, 3H) 7.66 (d, J = 7.72 Hz , 1H) 8.08 (dd, J = 7.91, 1.29 Hz, 1H) 16.28 (s, 1H) · MS (ESI-) m / z 425 (M_H)-·

Example 251A Di-emulsified-4H-1,2,4-benzo fare? Methylene-3-aminosulfanyl methylene i amino group-4-hydroxyquinoline-2 (1HV) The product of Example 226D (0.070 g, 0.196 mmol) and 3-succinaldehyde (〇 · ΐ47 89166 -421-200427678 * liter, 1.78 mmol) in N, N-dimethylacetamide (1.2 ml), in a sealed &amp; at 110 ° C, in microwave reaction The reaction was carried out in an oven for 35 minutes. The reaction was cooled to 25 C ′ and concentrated. The resulting residue was triturated with ethyl picrate and filtered to obtain the title compound.

Example 251B -4H-1,2,4_Stupid and p plugged two? Well-3-yl M-1, 3-Cyranylmethyl, amine 1-, 4-, 4-line-2 (1HV) The same as the product of Example 251A (0.028 g, 0.064 mmol) in tetrahydrooctane (L3 ml) with methanol (0.005 ml, 0.128 mmol) at 0 ° C, dropwise add a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.05 ml, o.ioo mmol) (Ear) treatment. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 μ hydrochloric acid to a pH value of about 2-4, diluted with water (6.0 ml), and the precipitate formed was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 3.79 (m, 2H) 6 · 03 (t, J = 6.80 Hz, 1H) 6.65 (s, 1H) 7.08 (t, J = 7.35 Hz, 1H) 7.27 (m, 3H) 7.54 (m5 2H) 7.68 (m, 3H) 8.08 (d? J = 7,72 Hz5 1H) 16.26 (s? 1H). MS (ESI-) m / z 435 (MH)

Example 252A 3- (1,1-Secondary lactate_411-1,2,4-Benzoline stopper two wells-3-yl) -1-{"2-portal sulfan methylene ~ [amine Base} -4-Light Baseline-2 (1HVi with the product of Example 226D (0.070 g '0.196 dmol) and 2-p cyanuronic acid (47i, 1.78 mmol) in Ν, Ν -Dimethylacetamide (1.2 ml) in a sealed tube at 110 ° C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25 ° C and concentrated. The formed The residue was prepared with ethyl acetate 89166-422-200427678 and filtered to give the title compound.

Example 252B MLl—Oxidized-4H-1,2,4-benzofluorenedil-3-ylglutanylmethyl) amino 1-4-hydroxy4line-2 (lHVgli | The product of Example 252A ( 0.058 g, 0.134 mmol) in tetrahydrofuran (3.0 Φ liters) and methanol (0.010 ml, 0.268 mmol), at 0 ° C, the lithium borohydride in tetrahydrofuran was added dropwise. Treated with 2.0M solution (0.05ml, 0.210mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of about 2-4, and It was diluted with water (6.0 ml) and the precipitate formed was collected by filtration and dried. The crude product was triturated with ether and filtered to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) 6 ppm 4.03 (s, 2H) 6.20 (t, J = 6.07 Hz, 1H) 6.35 (m5 1H) 7.05 (t5 J = 7.72 Hz, 1H) 7.29 (t5 J = 7.72 Hz, 3H) 7.46 (t5 J = 7.72 Hz, 1H) 7.56 (m, 2H) 7.67 (d, J = 7.72 Hz, 2H) 8.06 (d, J = 8.09 Hz, 1H) 16.24 ( s ， 1H) · MS (ESI-) m / z 435 (MH) ·.

Example 253A

HkL · Dioxide-4Η-1,2,4 · Benzopyrimidin-3-yl V4-Hydroxy-1- (Bussyl ^ methylene methylene 1 amine a certain hydrazolin-2 (1HV ketone example The product of 226D (0.070 g, 0.196 mmol) and pyrimidine-2-carboxaldehyde (0.166 ml, 1-78 mmol) in N, N-dimethylacetamide (1.2 ml) in a sealed tube The reaction was carried out in a microwave reactor at 110 ° C for 35 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Example 253B 89166 -423-200427678 * Oxidized -4H-U, 4-mopropyrazine_3-yl V4-lech-1- [fluorenylmethyl) amino group> quinoline-2πτ · η- ϋϋ The product of Example 253A (0.025 g, 0.055 mmol) was added in tetrahydrofuran (1.2 ml) and methanol (0.005 ml, 0.110 mmol) at 0 r, and lithium borohydride was added dropwise. A 2.0 μ solution (0.044 ml, 0.088 mmol) in tetrahydrofuran was treated. The reaction was stirred at 25 ° C for 1 hour, acidified with 1M hydrochloric acid to a pH of about 2-4 ', diluted with water (5.0 ml), and the formed precipitate was collected by filtration, and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 11 ^^ 111 (300) \ 41 ^ ， 〇] ^ 〇- (16) (^ 卩 1114.18 (8,2 printed 6.16 (^ = 6.62 take 1H)) 7.01 (dd, J = 5.15, 3.31 Hz, 1H) 7.07 (d, J = 7.72 Hz, 1H) 7.12 (m, 1H) 7.29 (t, J = 7.54 Hz, 2H) 7.53 (m, 3H) 7.67 (d, J = 7.72 Hz, 2H) 8.08 ( d, J = 8.09 Hz, 1H) 16.24 (s, 1H) · MS (ESI-) m / z 451 (MH) _ ·

Example 254A 3- (1,1-Dioxo-411_1,2,4-benziridine digeno-3-some &gt; 4-fluorenyl-1] "1,3-pyrazol-2-ylmethylene 1Amino P-Trapolin-2 (1HV ketone makes the product of Example 226D_ (0.060 g, 0.168 mmol) and 1,3-pyrazole-2-carboxaldehyde (0.132 mL, 1.5 mmol) at N, In N-dimethylacetamide (1.0 ml), in a sealed tube at 110 ° C. in a microwave reactor for 35 minutes. The reaction mixture was cooled to 25 ° C. and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Example 254B 3- (1,1-Gasification_4H-1,2,4-benzopyridine-3-yl V4-hydroxy small [(U-pyrazoldi-2-ylmethyl) amino 1quinone Porphyrin-2 (1HV ketone 89166 -424- 200427678) The product of Example 254A (0.030 g, 0.066 mmol) was dissolved in tetrahydrofuran (1.3 ml) and methanol (0.005 ml, 0.132 mmol) at 0 ° At c, a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.050 ml, 0.100 mmol) was added dropwise to treat. The reaction was stirred at 25 ° C for 1 hour and acidified to pH with 1 M hydrochloric acid. The value is about 2-4, diluted with water (5.0 ml), and the precipitate formed is collected by filtration and dried. The crude product is triturated with ether and filtered to give the title compound. The sodium salt of the title compound is based on Example 1D was prepared by the procedure. 1 H NMR (300 MHz, DMSO-d6) 6 ppm 4.36 (m, 2H) 6.57 (t, J = 6.62 Hz, 1H) 7.09 (dd, J = 13.60, 6 · 62 Hz, 2H) 7.29 (t, J = 7.54 Hz, 2H) 7.56 (m, 2H) 7.68 (m, 2H) 7.97 (d, J = 8.46 Hz, 1H) 8.08 (d, J = 7.35 Hz , 1H) 16.20 (s, 1H). MS (ESI-) m / z452 (MH) ·.

Example 255A 3- (1,1-digasification-4Η-1,2Λ · benzothiadinyl-3-yl V14 "(2-ethyl-3-methylbutylene 1amino group-4-hydroxyl group Quinoline_2 (1HV ketone gives the product of Example 226D (0.070 g, 0.196 mmol) and 2-ethyl-3 · methylbutyraldehyde (0.110 ml, 0.733 mmol) in N, N-dimethyl Acetamide (1.2 mL) was reacted in a sealed tube in a microwave reactor at 110 ° C for 35 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was dried at Triturated with ethyl acetate and filtered to give the title compound.

Example 255B Digas-4H-1,2,4-benzopyrimidine_3-yl νΐ- (Γ2-ethyl each methylbutyl 1 amino group-4-hydroxyquinoline-2 (1HV ketone The product of Example 255A (0.031 g, 0.069 mmol) was added in tetrahydrofuran (1.5 ml) and methanol (0.006 ml, 0.138 mmol) at 0 ° C, dropwise 89166 -425-200427678 to add borohydride A 2.0 M solution of lithium in tetrahydrofuran (0.054 ml, 0.108 mmol) was treated. The reaction was stirred at 25 ° C for 1 hour, and the soil was acidified with 1 M hydrochloric acid. The pH was about 2-4 'with water. (5.0 mL) was diluted 'and the precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel and dissolved with 30% ethyl acetate / hexane to give the title compound. Sodium salt of the title compound Prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO_d6) 5 ppm 0.94 (m, 18H) L36 (dd, J = 11.58, 5.33 Hz, 2H) 1.47 (m, 4H) 1_91 (s, 2H ) 3.32 (s, 4H) 5.87 (t, J = 7_54 Hz, 2H) 6.98 (t, J = 7.54 Hz, 1H) 7.08 (m, 2H) 7.26 (m, 4H) 7.38 (t, J = 8.27 Hz, 1H) 7.56 (m, 4H) 7.66 (m, 2H). MS (ESI-) m / z 453 (M-H) _ ·

Example 256A HU-Oxide-4H-1,2,4 • benzopyrimidin-3-yl) -4_weiyl] methylbenzyl) methylene 1 amino group h mantleline-2 (1HV ketone The product of Example 226D (0.070 g, 0.196 mmol) and 4-methylbenzaldehyde (0.210 ml, 1-78 mmol) were placed in N, N-dimethylacetamide (L2 ml) in a sealed tube In a microwave reactor at 110 ° C for 35 minutes, the reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Example 256B 1τ (1,1-Dimanganized · 4Η-1,2,4-Benzobi-π-well-3_yl) -4_Weiyi-1-"(4-formyl) amino 4 -2 (1HV ketone) The product of Example 256A (0.065 g, 0.142 mmol) was added in tetrahydrofuran (3.0 ml) and methanol (0.012 ml, 0.284 mmol) at 0 ° C, and borohydride was added dropwise. A 20 mM solution of lithium in tetrahydrofuran (0.0 mL, 0.222 mmol) was treated. The reaction was stirred at 25 ° C for 1 hour, and acidified with 1M hydrochloric acid 89166 -426- 200427678 to pH About 2-4, diluted with water (8_0 ml), and the precipitate formed was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to obtain the title compound. Steel of the title compound The salt was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 ppm 2.32 (s, 3H) 3.87 (s, 2H) 6.03 (s5 1H) 7.10 (m5 1H) 7.21 (d? J = 7.72 Hz, 2H) 7.30 (t, J = 7.17 Hz5 2H) 7.42 (d, J = 7.72 Hz, 2H) 7.56 (t, J = 8.64 Hz, 2H) 7.70 (t, J = 9 · 38 Hz, 2H) 8.10 (d, J = 7.72 Hz, 1H) 16_28 (m, 1H) · MS (ESI-) m / z 4 59 (M-Η).

Example 257A j- (l, l-Monoxide-4Η · 1,2,4_benzyl-pyridine two wells-3-yl) -4-¾methylmethylphenyl) Methylene 1 amine 4 AlHV The ketone made the product of Example 226D (0.070 g, 0.196 mmol) and 3-methylbenzaldehyde (0.210 ml, 1.78 mmol) in N, N-dimethylacetamide (1.2 ml), In a sealed tube, the reaction was carried out in a microwave reactor at 110 ° C for 35 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Example 257B Η1,1 · Digas-4H-1,2,4-benzopyridine-3-ylsulfonium-14 (3-methylsulfonium-1aminoline-2 (1HV ketone The product (0.038 g, 0.083 mmol) was added in tetrahydrofuran (1β7 halo) and methanol (0.007 ml, 0.166 mmol) at 0 ° C to add borohydride dropwise. A 2.0 M solution of lithium in tetrahydrofuran (0.065 ml, 0.130 mmol) was treated. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH value of about 2-4, and water (5.0 ml ) Dilute and collect the precipitate formed by filtration, and dry. Triturate the crude product with dichloromethane / diethyl ether, and filter 427- 89166 200427678 to obtain the title compound. The sodium salt of the title compound is based on Example ID. Program made. 1H NMR (300 MHz, DMSO-d6) 6 ppm 2.35 (s5 3H) 3.87 (s, 2H) 6.05 (t, J = 6.62 Hz, 1H) 7.12 (m, 2H) 7.31 ( m, 5H) 7.56 (t, J = 7.54 Hz, 2H) 7.70 (dd, J = 11.95, 7.91 Hz, 2H) 8.10 (d, J = 7.72 Hz, 1H) 16.28 (s, 1H). MS ( ESI-) m / z 459 (MH) _.

Example 258A mi-—emulsified-4H-1,2,4-benzyl-p-di-ton-3-yl) -4-meryl-1 · {[Υ2-methylbenzyl) methylene 1 amino group h Quinoline-2 (1HV ketone. Make the product of Example 226D (0.070 g, 0.196 mmol) and 2-methylbenzoic acid (0.206 ml, 1.78 mmol) in N, N-dimethylacetamide ( 1_2 ml), in a sealed tube at 110 ° C in a microwave reactor for 35 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate, And filtered to give the title compound.

Example 258B ML1-digasification-4H-1,2,4-benzopyrimidine-3-a certain V4-hydroxy_1 彳 (2_formamidine, aminoline_2ilHV xitong · Example 258A The product (0.026 g, 0.057 mmol) was added in tetrahydrofuran (1.2 ml) and methanol (0.005 ml, 0.114 mmol) at 0 ° C, and a hydrogenated bell was added dropwise at 2.0 M in tetrahydrofuran. The solution (〇_〇45mL, 0.090mmol) was treated. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 μ hydrochloric acid to a pH of about 2-4, diluted with water (5.0mL), and The formed precipitate was collected by filtration, washed with water, and dried. The crude product was triturated with dichloromethane / ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) (5 ppm 3.29 89166 -428-200427678 (s, 3H) 3.97 (s, 2H) 6.02 (t, J = 6.62 Hz, 1H) 7.08 (t, J = 7.35 Hz, 1H) 7.23 (s, 3H) 7.29 (t? J = 7.54 Hz? 2H) 7.47 (m5 1H) 7.55 (d5 J = 7.72 Hz? 2H) 7.67 (m5 2H) 8.10 (d, J = 7_72 Hz , 1H) 16.31 (s, 1H). MS (ESI-) m / z 459 (M-Η) · ·

Example 259A ~ Emulsified-4H-1,2,4-Hydro-p-sep-di-p-well-3-yl) -4-Cyclomethyl-p-phenphen-2-yl) methyl-1amine (1HV ketone made the product of Example 226D (0.060 g, 0.168 mmol) and 3-methylpyrimidin-2-carboxamide (0.180 ml, 1.50 mmol) in N, N-dimethylacetamide ( 1.0 ml), in a sealed tube at 135 ° C, in a microwave reactor, for 45 minutes and 4 minutes. The reaction mixture was cooled to 25 C 'and concentrated. The resulting residue was ethyl acetate The ester was triturated and filtered to give the title compound.

Example 259B HM-Dioxide-4H-1,2,4_benzopyrene-3, a certain V4- # fluorenyl-HIY3-methylpyridine · 2-yl) methyl 1amino group _2 (1HV ketone

The product of Example 259A (0.020 g, 0.043 mmol) was added in tetrahydrofuran (1.0 mL) and methanol (0.04 mL, 0.086 mmol) at οχ: A 2.0 μ solution (0.033 ml, 0.065 mmol) in tetrahydrofuran was treated. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH value of about 2-4, diluted with water (5.0 ml), and the formed precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered 'to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) (5 ppm 2.42 (s, 3H) 4.10 (br s, 2H) 7.09 (d? J = 5.15 Hz? 1H) 7.19 (br s? 1H) 7.37 (m5 3H ) 7.58 (m? 2H) 7.72 (m3 2H) 8.O4 (m, ih) 8.14 (d, J = 8.09 Hz, 1H) 16.10 (br s, 1H). MS (ESI-) m / z 465 89166- 429- 200427678

Example 260A HY-4H-1,2,4-benzinofluorenyl di-U-yl) _4-hydroxy-1-1-claw 4-methylhydrofluorene, methylamino 1 amine P quinoline-2 (1 The product of Example 226D (0.070 g, 0.196 mmol) and 4-methoxybenzoic acid (0.217 mL, 1.78 mmol) in Ν, Ν-dimethylacetamide (ι · 2 mL) 'In a sealed tube at 110 ° C in a microwave reactor for 35 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered, and The title compound was obtained.

Example 260B Oxidation of 4H-U, 4_jamopyridine-3-ylsulfonium, a small sulfonyl chloride, amino group &gt; quinoline-2 (1 field-one will be the product of Example 260A (0.045 G, 0.095 mmol) in tetrahydrofuran (2.0 ml) and methanol (0.008 ml, 0.19 mmol) at 0. (:, a 2.0 mM solution of lithium borohydride in tetrahydrofuran ( 0.074 ml, 0.148 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2_4, diluted with water (5.0 ml), and the precipitate formed was collected by filtration. The crude product was triturated with methanol / ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO_d6) 5 ppm 3.77 (s , 3H) 3.82 (s, 2H) 5.98 (s, 1H) 6.95 (d, J = 8.46 Hz, 2H) 7.10 (t, J = 7.54 Hz, 1H) 7.30 (m, 2H) 7.45 (d , J = 8.46 Hz, 2H) 7.56 (s, 2H) 7.70 (t, J = 9.38 Hz, 2H) 8.10 (d, J = 7.72 Hz, 1H) 16.29 (m, 1H) · MS (ESI-) m / z 475 (MH)-·

Example 261A 89166 -430- 200427678 i: {[((5-Chlorothiophene-2-yl) methylene 1amino group} -3-jiang 1-dihydro_4Η_12 · 4-benzyldi-_3 _Gybenyl, the product of Example 226D (0.060 g, 0.168 mM) and 5-chloropyrimidine · 2-chicosan (0.160 ml, 1.50 mM) at Ν, Ν- 二Methylacetamide (1.0 ml) was reacted in a microwave reactor 'in a sealed tube' at 11 ° C in a microwave reactor for 35 minutes. The reaction mixture was cooled to 25 C 'and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound. Example 261B 1ι _ {[((5 · Chloro? Sedenyl) methyl1amino group 丨 _3-Π, 1 · dioxo _4Η-1,2,4-jamo ant; / well-3 · base) Ice hydroxyquinoline AIHVS with

The product of Example 261A (0.048 g, 0.099 mmol) was added in tetrahydrofuran (20 ml) and methanol (0.008 ml, 0.198 mmol) at (TC, lithium borohydride in tetrahydrofuran was added dropwise. 2.0 M solution (0.074 ml, 0.149 mmol) was treated. The reaction was stirred at 25 t for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4 'diluted with water (6.0 ml), and borrowed The precipitate formed was collected and dried. The crude product was triturated with dichloromethane / ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 3 ppm 4.10 (s, 2H) 6.24 (t, J = 6.43 Hz, 1H) 7.19 (m, 1H) 7.30 (m, 3H) 7.43 (d, J = 8.46 Hz, 1H) 7.56 (m, 3H) 7.67 (d, J = 8.09 Hz, 1H) 8.12 (d, J = 7.72 Hz, 1H) 15.95 (s, 1H) · MS (ESI-) m / z 485 (M -Η) '.

Example 262A M [(2-chloro-1,3-pyrazol-5-yl) methylene 1 amine 13- (1,1-digasification-4H-1.2.4-benzopyrimidine 3_yl V4-hydroxy4line_2 (1HV ketone 89166 -431-200427678) The product of Example 226D (0.070 g, 0.196 mmol) and 2-chloro-1,3-thiazole_5-carboxaldehyde (0.157 ml, 1.06 mmol) in N, N-dimethylacetamide (1.2 ml) in a sealed tube in a microwave reactor at 110 ° C for 35 minutes. The reaction was allowed to react The mixture was cooled to 250C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Example 262B

lilL (2-Chloro-U-pyrazol-5-yl) methyl 1 aminodihydro-41.2·1.2.4-benzopyrimidine_3_yl V4-hydroxyρoline-2ilHV ketone The product of 262A (0.040 g, 0.082 mmol) was added in tetrahydrofuran (1.7 ml) and methanol (0.007 ml, 0.164 mmol) at (TC, lithium borohydride in tetrahydrofuran 2 was added dropwise. 0 M solution (0.064 ml, 0.128 mmol). Stir the reaction at 25 ° C for 1 hour, dilute with 1 M hydrochloric acid to soil pH about 2-4 'diluted with water (5.0 liters), The precipitate formed was collected by filtration, and dried. The crude product was triturated with dichloromethane / ether and filtered to obtain the title compound. The steel salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 4.22 (m, 2H) 6.38 (t, J = 6.25 Hz? 1H) 7.07 (t? J = 7.54 Hz, 1H) 7.28 (t? J = 8.09 Hz5 2H) 7.59 ( m5 5H) 8.08 (dd, J = 8.09, 1.47 Hz, 1H) 16.19 (s, 1H). MS (ESI-) m / z 486 (Μ, · · ·

Example 263A Bromophenyl) methylene 1amino group-3- (l, l_digasification_4h-1,2,4-benzyl pyridine_3-yl) _4-light-based p-quinone Pour the product of Example 226D (0.059 g, 0.165 mmol) and 3-bromobenzoic acid (0.175 φ liter, 1.5 mmol) in N, N-dimethylacetamide (10 ml), The reaction was carried out in a sealed tube in a microwave reactor at 110 ° C for 35 minutes. The 89166 &gt; 432-200427678 reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Example 263B Benzyl) aminodioxide-4H-1.2.4-benzylpyridine, each group M-hydroxyp-quinoline-2 (1HV ketone The product of Example 263A (0.048 g, 0.091 mmol) ) In tetrahydrofuran (2.0 ml) and methanol (0.08 ml, _182 millimoles), the borohydride solution (0.130 in tetrahydrofuran) (0.130) was added dropwise below. Ml, 0.260 mmol). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water (8.0 ml), and collected by filtration. The formed precipitate was dried, and the crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6 ) δ ppm 3.93 (br s, 2Η) 6.17 (t, J = 6.99 Hz, 1H) 7.09 (t, J = 7.54 Hz, 1H) 7.28 (d, J = 8.09 Hz, 2H) 7.37 (d , J = 7.72 Hz, 1H) 7.54 (m, 4H) 7.68 (m, 2H) 7.74 (t, J = 1.65 Hz, 1H) 8.09 (dd, J = 7.91, 1.29 Hz, 1H) 16.26 (s, 1H). MS (ESI-) m / z 524 (MH) '

An example 264A bromophenyl) methylene 1 amine 13-α, 1 · digas-4H-U, 4-benzofluorene di ^ 3-yl) -4-hydroxyquinoline-2 (1HV ketone The product of Example 226D (0.060 g, 0-168 mmol) and 4-bromobenzaldehyde (0.278 ml, 1.50 mmol) in N, N-dimethylacetamide (1.0 ml) in a sealed tube The reaction was carried out in a microwave reactor at 110 ° C for 35 minutes. The reaction mixture was cooled to 25 ° C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound. 89166 -433-200427678

Example 264B Group) Amine group 1_3 hole 1_dioxide _4h_1,2,4 · Membo 4 diyah _3-yl) -4-Jijikouquelin-2〇H) _same

The product of Example 264A (0.049 g, 0.094 mmol) was added in tetrachlorofuran (20 ml) and methanol (0.008 ml, 0.188 mmol) at 0 ° C to add boron dropwise. A 2.0 M solution of lithium hydride in tetrahydrofuran (0.134 ml, 0.268 mmol) was treated. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water (6.0 ml), and the formed precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) 5 ppm 3.92 (br s, 2H) 7.09 (t, J = 6.99 Hz, 1H) 7.28 (m, 3H) 7.54 (m, 5H) 7.68 (d, J = 8.09 Hz, 2H) 8.09 (dd, J = 8.09, 1.47 Hz, 1H) 16.25 (br s, 1H) · MS (ESI-) m / z 524 (MH) _ ·

Example 265A Bromophenyl) methylene 1amino group} · 3- (1,1-digasification-4H-1,2,4-benzylcarbazine_3 · yl) -4-hydroxy4line -2 (1HV ketone made the product of Example 226D · (0.060 g, 0.168 mmol) and 2-bromobenzoic acid (0.175 ml, 1.50 mmol) in N, N-dimethylacetamide ( (m · ml), in a sealed tube at 110 ° C, in a microwave reactor for 35 minutes. The reaction mixture was cooled to 25 ° C, and concentrated. The resulting residue was ethyl acetate. S aims to develop 'and filter' to obtain the title compound.

Example 265B ^ fluorenyl) amino VX1,1-dioxide-4H-1,2,4-benzyl # 4 Dimethyl hydroxypyridin-2 (1HV ketone 89166 -434- 200427678

The product of Example 265A (0.068 g, 0.129 mmol) was dissolved in tetrahydrofuran (30 mL) and methanol (0.011 mL, 0.258 mmol). (: Next, a 2.0 M solution of lithium borohydride in tetrahydrofuran (.184 ml, 0.368 mmol) was added dropwise to treat. The reaction was stirred at 25 ° C for 1 hour and acidified to pH with 1 M hydrochloric acid. The value is about 2-4, diluted with water (8.0 ml), and the precipitate formed is collected by filtration and dried. The crude product is triturated with dichloromethane / diethyl ether and filtered to give the title compound. The sodium salt was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 ppm 4 · 11 (br s, 2H) 6 · 24 (t, J = 6.80 Hz, 1H) 7.06 (t , J = 7.54 Hz, 1H) 7.28 (m, 3H) 7.56 (m, 3H) 7.67 (m, 4H) 8.08 (dd, J = 7.91, 1.29 Hz, 1H) 16.27 (s, 1H). (ESI-) m / z 524 (MH)

Example 266A-Emulsified _4H-1,2,4-benzo p-Cedilphin-3-yl V4-Cyridyl-3-ylmethylene-1amino group 4-line-2 (1HV ketone makes Example 226D The product (0.070 g, 0.196 mmol) and nicotinaldehyde (0.168 ml, 1.78 mmol) in N, N-dimethylacetamide (1.2 ml) in a sealed tube The reaction was carried out in a microwave reactor at 110 ° C. for 35 minutes. The reaction mixture was cooled to 2 fC and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

Example 266B KL1-Dioxide-4Η · 1,2,4-benzopyrene, each V4_Transfer to a small "(pyridin-3-ylmethyl) amino group" Saga-2 (1HVS same as the example The product of 266A (0.062 g, 0.14 mmol) was added in tetrahydrofuran (2.5 ml) and methanol (0.012 ml, 0.280 mmol) at 0 ° C, and a 2.0 M solution of lithium hydride in tetrahydrofuran was added dropwise. (0 · 105 ml, 0.210 mmol 89166 -435-200427678 ear). The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, and water ( 8.0 ml) was diluted, and the formed precipitate was collected by filtration and dried. The crude product was triturated with methanol / ether and filtered to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) 6 ppm 3.99 (s, 2Η) 6.22 (t, J = 6.62 Ηζ, 1H) 7.08 (t, J = 7.35 Hz, 1H) 7 · 27 (m , 2H) 7.40 (dd5 J = 7.54, 4.96 Hz, 1H) 7.54 (m, 2H) 7.68 (d, J = 8.09 Hz, 2H) 7.93 (m5 1H) 8.08 (dd, J = 7.72, 1.47 Hz, 1H) 8.51 (dd, J = 4.78, 1.47 Hz) · (ESI ·) m / z 446 ( M-H) _

Example 267A 3-({"3- (l, l-dimulsified-4H-1,2,4-benzopyridin ^ -3-yl) -4-yl-2-yl U2H) _yl1imine} A)) The product of Example 226D (0.070 g, 0.196 mmol) and 3-formyl benzonitrile (0.080 ml, 0.610 mmol) at N, In N-dimethylacetamide (1.2 ml), in a sealed tube at 110 ° C. in a microwave reactor for 35 minutes. The reaction mixture was cooled to 25 ° C. and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.

An example of 267B j-({"3- (l, l-digasification-4H-1,2,4-benzo mouth plug two wells-3-yl V4-light-based hydrazone isoquinone I Di U2HV group 1 amine group} methyl) benzamidine The product of Example 267A (0.055 g, 0.117 mmol) was dissolved in tetrahydrofuran (2.0 ml) and methanol (0.010 ml, 0.234 mmol) in At 0.0, a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.088 ml, 0.176 mmol) was added dropwise to treat. The reaction was stirred at 25 ° C for 1 hour, and 1 M Hydrochloric acid was acidified to a pH of about 2-4, diluted with water (6.0 ml), and the precipitate obtained by filtration was collected by filtration from 89166-436-200427678 and dried. The crude product was triturated with dichloromethane / ether And filtered 'to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 ppm 4.01 (s, 2H) 6.25 (t, J = 6.80 Hz, 1H) 7.08 (t, J = 7.35 Hz, 1H) 7.28 (m, 2H) 7.56 (m, 3H) 7.68 (dd, J = 8.09, 2.21 Hz? 2H) 7.79 (d5 J = 8.09 Hz? 1H) 7.86 (d? J = 7.72 Hz5 1H) 7.99 (s, 1H) 8.09 (dd, J = 7.91, 1.2 9 Hz, 1H). (ESI-) m / z 470 (M-H)-·

Example 268A M (2E) -2-benzylidene 1-pyridin-2-carboxylic acid methyl ester 3-methyl hydrazinopyrimidine-2-carboxylic acid (Maybridge Industrial Grade, 2.0 g, 0.11 Mo Ear) solution in ethanol (250 ml) was reacted at 25 ° C with a solution of benzaldehyde (12.32 g '0.11 mole) in ethanol (100 ml). The mixture was stirred at 25 ° C for 1.5 hours and concentrated to give 30 g of a white solid. HPLC / MS showed a single absorption peak with a retention time of 2.35 minutes and an M + 1 absorption peak 261. 1H NMR (300 MHz, CDC13) δ ppm 3.85 (s, 3H) 7.35 (m5 4H) 7.64 (dd5 J = 8.093 1.47 Hz, 2H) 7.77 (s, 1H) 10.10 (s5 1H) ·

Example 268B M2-benzylidene-1- (3-ethoxyketopropionyl) hydrazine methyl p-phenone_2-weitate The product of Example 185A (26.4 g, 0.101 mole) was mixed with Ethyl chloromalonate (18.3 g '0.121 mole) was reacted in toluene (400 ml) and stirred at reflux for 4 hours' to bubble HC1 gas out of the condenser. The reaction was allowed to cool to 25. 〇, and concentrated under vacuum. The formed residue was chromatographed on silica gel, and the title compound (π! G, 98%) was obtained by dissolving it with 3: 1 hexane: fe / acetic acid ethyl acetate '.

Example 268C 7-Ethyl-5-keto-4:-{[N-methylidene-1amino 1-Hydroxy-4 pheno 3,2-bl pyrido- 89166 -437- 200427678 6-carboxylic acid ethyl ester A solution of the product of Example 268B (37.8 g, 0.101 mol) in ethanol (0.5 liter) was mixed with sodium ethoxide (21% by weight, 32.8 g, 0.104 mol) in ethanol under nitrogen at room temperature. Reaction. The mixture was slowly warmed to 50 ° C, stirred at 40-50 ° C for 1 hour, cooled to 25 ° C, separated into a solution between ethyl acetate and water, and treated with 1M hydrochloric acid. Acidified to pH 4. The ethyl acetate layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated to give the title compound (12.0 g, 35%). 1H NMR (300 MHz, CDC13) 5 ppm 1.47 ( t, J = 7.17 Hz, 3H) 4.52 (q, J = 7.23 Hz, 2H) 7.33 (d, J = 5.15 Hz, 1H) 7.50 (m, 3H) 7.75 (d, J = 5 · 52 Hz, 1H) 7.88 (dd, J = 7.72, 1.84 Hz, 2H) 9.44 (s, 1H) 14.16 (s, 1H).

Example 268D 4-Amino-Digas-4H-1,2,4-Benzodibenzoic acid The product (2.29 g, 6.69 mmol) was reacted with 2-aminobensulfazone (1.15 g '6.69 mmol) in toluene (60 ml) and stirred at reflux for 5 hours. The reaction was allowed to cool To 25. (:, and collect the precipitate formed by filtration 'and dry explosion (1.95 g, 62%). Make the formed solid (ι · 95 g, 4.2 Φ Mor) and 10% aqueous solution of KOΗ (60 Ml), reacted under reflux for 24 hours, cooled to 25 ° C, and acidified to pH 2 with concentrated hydrochloric acid. The formed solid was collected by filtration, washed repeatedly with water, and dried to provide the title compound (1.5 g, 98%) (Made of any sodium salt?) IHNMR (300MHz, DMSO-d6) 5 ppm 6.12 (s, 2H) 7.49 (d, J = 5.52 Hz, 1H) 7.57 (m, 2H) 7 · 79 (t5 J = 7.17 Hz, 1H) 7.93 (d, J = 7.72 Hz5 1H) 8.34 (d? J = 5.52 Hz? 1H) 14.33 (s5 1H) 14.68 (s5 1H).

Example 269A 89166 -438- 200427678 6- (l, l-dioxide-4H-1,2,4-benzo farehu-3-a certain V7_ # fluorenyl-4 _ {"2_methodinyl" Amino V sedeno f3.2_bl pyridine_5 (4HV ketone. Make the product of Example 268D (0.10 g, 0.27 mmol) and 2-methyl-propanal (0.20 g '2.77 mmol) Ear) In N, N-dimethylacetamide (3 ml), in a sealed tube 'under 135 C' in a microwave reactor, react for 40 minutes. Allow the reaction to cool to 25 ° C and place under vacuum The residue was triturated with a 25% ethyl acetate mixture in hexane and filtered to give the title compound as a solid (0.073 g, 65%). MS (APCI +) m / z 417 (M + H) + ·

Example 269B 6- (1,1 · Dioxide-4H-1,2,4-Benzo-p-di-3-yl V7-Cyclo-4_ (isobutylamino) thieno l &quot; 3,2_bl Pyridine-5 (4HV ketone) The product of Example 269A (0.073 g, 0.18 mmol) was dissolved in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0 ° C with lithium borohydride at A 2.0 M solution (0.20 ml, 0-40 mmol) in tetrahydrofuran was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, and the pH was acidified to about 2-4 with 1 M hydrochloric acid. It was diluted with water (10 ml), and the precipitate formed was collected by filtration, and dried. The crude product was suspended in tetrahydrofuran (10 ml), adsorbed on about 5 g of silicone, and evaporated. The product was dissolved in methanol in chloroform. The products containing the dissolved fractions were combined and evaporated under vacuum to give the title compound (0.032 g, 42%). MS (ESI_) m / z 417 (M_H) _ · of the title compound The sodium salt is made according to the procedure of Example ID. IHNMR (300MHz, DMSO-d6) 5 ppm 1.01 (d, J = 6_62 Hz, 6H) 1.88 (m, 1H) 2.83 (s, 2H) 6.60 (s, 1H) 7.41 (d, J = 4.04 H z, 1H) 7.55 (t, J = 7.54 Hz, 1H) 7.65 (d, J = 8.46 Hz, 1H) 7.77 (t, J = 7.91 Hz, 1H) 7.93 (d, J = 7.72 Hz, 1H) 8.35 (d, J = 4.78 Hz, 1H) 14 · 21 (s, 1H) 89166 -439- 200427678 14.82 (s, 1H).

Example 270A 6- (1,1-Dioxide-4H-1,2,4-benzylpyrene-3-yl V7_ 蕤 some-4_ {| T3SV3-methyl ^ pentyl 1 amine V plug The pheno f3,2-b bispyridine · 5 (4 酉) _ 酉 is identical to the product of Example 268D (0.065 g, 0.18 mmol) and (3S) -3-methylcyclopentane (0.54 g '5.6 Millimolar) in N, N-dimethylethylammonium amine (2 ml) in a sealed tube at 135 ° C in a microwave reactor for 90 minutes. Allow the reaction to cool to 25 ° C And concentrated under vacuum. The formed residue was triturated with ethyl acetate / hexane (2: 1) and filtered to give the title compound.

Example 270B Dioxide-4H_1,2,4-Benzodi-2-diyl V7-lightyl-4- {fT3SV3-methyl certain pentyl 1 amine V seleno [3,2_b ~ b ratio lake _5 (4HV) The product of Example 269A (0.060 g, 0.14 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.012 ml, 0.3 mmol) at 0 ° C with borohydride j in A 2.0 M solution (0.12 ml, 0.24 mmol) in tetrahydrocrack was treated dropwise. The reaction was stirred at 25 ° C for 2 hours, and the pH was acidified to about 2 with 1 M hydrochloric acid. -4, diluted with water (20 ml), and the precipitate formed was collected by filtration and dried. The crude product was purified on silica gel and chromatographed with dichloromethane to dichloromethane / methanol (99: 1). The sodium salt of the title compound was prepared according to the procedure of Example. 1H NMR (300 MHz, DMSO-d6) (5ppm 1_01 (m, 3H) 1.69 (m, 7H) 3.7 (m, 1H) 5.75 (s, 1H) 7.19 (m, 3H) 7.54 (m, 1H) 7.65 (d, J = 7.72 Hz, 1H) 7.74 (d, J = 6.25 Hz, 1H) 15.91 (s, 1H) . MS (ESI-) m / z 443 (MH) _.

Example 271A propylidene-ethyl 1amino group 丨 6 · (1,1-digasification-4H-1 and 4-duplex pi _3- 89166 -440- 200427678 group) Benzodipheno [~ 3,2VII &gt; Specific bite-5 (4HV ketone makes the product of Example 268D (0.065 g, 0.18 mmol) and 1-cyclopropyl ethyl ketone (0.54 g '6.4 mmol) In N, N-dimethylamine acetate (2 ml), in a sealed tube, in a microwave reactor at 135 ° C for 120 minutes. The reaction was cooled to 25 ° C and under vacuum Concentrated. The resulting residue was triturated with ethyl acetate / hexane (2 ·· 1) and filtered to give the title compound.

Example 271B 4 _ {"1-cyclopropylethyl1amino} _6_Π, 1-dioxide-4H-1,2,4 · phenylhydrazone far diπ well_3_yl) -7-hydroxypyrimido" 3 , 2Heptapyridine-5 (4HVi same as the product of Example 269A (0.058 g, 0.14 mmol) in tetrahydrofuran (4 ml) and methanol (0.012 ml, 0.3 mmol) at (TC, It was treated dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.12 ml, 0.24 mmol). The reaction was stirred at 25 ° C for 2 hours, and the pH was acidified to about 2-4 with 1 M hydrochloric acid. Dilute with water (20 ml) and collect the formed precipitate by filtration, and dry. The crude product is chromatographed on silica gel with dichloromethane to dichloromethane / methanol (99: 1) to obtain The title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1HNMR (300 MHz, DMSO-d6) 5 ppm 1.05 (m, 8H) 2.44 (m, 1H) 5.81 (d, J = 2.57 Hz, 1H) 7.23 (m, 3H) 7.53 (m5 1H) 7.64 (d, 1 = 7.72 Hz, 1H) 7.74 (s, br, 1H) 15.95 (s, 1H) · MS (ESI -) m / z 429 (MH) '

Example 272A M (butyleneamino 1-6- (1,1-digasification-4H-1,2,4-benzopyrimidin-3-yl V7_hydroxythieno | 3,2heptapyridine- 5 (4HV ketone made the product of Example 268D (0.10 g, 0.27 mmol) with butyraldehyde (0.5 g, 6.9 mmol) in N, N-dimethylacetamide (3 ml), In a sealed tube, the reaction was carried out in a microwave reactor at 13089166 -441-200427678 ° C for 40 minutes. The reaction was cooled to 25.0 and concentrated under vacuum. The residue formed was diethyl ether Triturate and filter to give the title compound (0.075 g, 65%).

Example 272B 4- (butylamine) -6- (1,1-digasification-4H-1,2,4_benzilopyrimidine-V whose V7 benzo [~ 3,2-bl pyridine- 5 (4HV ketone) The product of Example 269A (0.075 g, 0.18 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.029 ml, 0.5 mmol) at 0 ° C with lithium borohydride at The 2.0 M solution (0.150 ml, 0.3 mmol) in tetrahydrofuran was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, and water (15 ml ) Dilute and collect the precipitate formed by filtration and dry. The crude product is chromatographed on silica gel with 2% methanol in chloroform to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 ppm 0.90 (t, J = 7.17 Hz, 3H) 1.39 (dd, J = 15.08, 7.35 Hz, 2H) 1.50 (m, 2H) 3.02 (t , J = 6.43 Hz, 2H) 6.65 (s, 1H) 7.43 (d, J = 5.15 Hz, 1H) 7.55 (t, J = 7.72 Hz, 1H) 7.64 (d, J = 8.09 Hz, 1H) 7.77 (t, J = 7.72 Hz, 1H) 7.92 (d, J = 8.09 Hz, 1H) 8.34 (d, J = 5.15 Hz, 1H) 14.21 (s, 1H ) 14.83 (s, 1H). MS (ESI-) m / z 417 (M-H) — ·

Example 273A 6- (l, l-dioxide_4H-1,2,4-benzopyrene-3-yl V4] [~ 2-ethylbutylene-1amine} -7_ # stem base mouth plug Benzo [3,2-b &gt; Biyodo-5 (4HV) simultaneously made the product of Example 268D (0.10 g, 0.27 mmol) with 2-ethylbutyraldehyde (0.5 g '5.2 mmol) at N, N-dimethylamine acetate (3 ml) in a sealed tube at 130 ° C in a microwave reactor for 40 minutes. Allow the reaction to cool 89166 -442- 200427678 to 25 C 'and Concentrate in vacuo. Triturate the formed residue with acetic acid and filter to give the title compound (0.082 g, 68%). Example 273B Oxidation of 4 仏 1,2,4_benzopyrimidine_ 3-ethylethylbutyrate) amine and even hydroxypyrimido 3.2-hl pyridine-5 (4HV ketone will be the product of Example 269A (0.82 g, 0.18 mmol) in tetrahydrofuran (4 ml) and methanol (4 ml) 0.020 ml, 0.5 millimolar), then, dropwise with 2.0 M of lithium borohydride in tetrahydrofuran (0.150 ml, 0.3 millimolar). The reaction was Stir down for 1 hour at C 'to acidify with 1 μ hydrochloric acid to a pH of about 2-4, dilute with water (15 ml) The precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 0.90 (t, J = 7.17 Hz, 6H) 1.45 (m, 5H) 2.94 (m, J = 4.78 Hz, 2H) 6.53 (s, 1H) 7.38 (d5 J = 5.52 Hz, 1H) 7.55 (t, J = 7.54 Hz, 1H) 7.65 (d, J = 8.09 Hz, 1H) 7.77 (t, J = 8.46 Hz, 1H) 7.92 (d , J = 7.72 Hz, 1H) 8.36 (d? J = 5.52 Hz? 1H) 14.19 (s5 1H) 14.83 (s5 1H). MS (ESI-) m / z 445 (MH),

Example 274A Pan: 0., 1_Dioxide_4Η], 2 · 4-benzylpyrene-3-yl V7-guinea-methylbenzylamino) pyrimido C3,2-bl pyridine-5 (4HV ketone made the product of Example 268D (an) g, 0.27 mmol) and valeraldehyde (0.5 g, 5.04: Mol) in N, N-dimethylacetamide (3 ml) at In a sealed tube, the reaction was carried out in a microwave reactor at GO C for 40 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered through 89166-443-200427678 'to obtain the title compound (0.081 g, 70%).

Example 274B Gasification of -4H-1,2,4-benzo fare? Well-3-yl) -7 · Qingmou-4- (fluorenylamino) pyrimido "3,2-bl pyridine-5 (4HV ketone will be the product of Example 269A (0.081 g, 0.19 mmol)) Tetrahydrocran (4 ml) and methanol (0.020 ml, 0.5 mmol) were treated dropwise with a 2.0 M solution (0.150 ml, 0.3 mmol) of borohydride in tetrahydrofuran at 0 ° C. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, diluted with water (15 ml), and the formed precipitate was collected by filtration, and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 ppm 0.88 (t, J = 6.99 Hz, 3H) 1.34 (m, 4H) 1.53 (m, 2H) 3.01 (t, J = 6.62 Hz, 2H) 6.64 (s, 1H) 7.43 (d, J = 5.15 Hz, 1H ) 7.55 (t, J = 7.72 Hz, 1H) 7.64 (d, J = 8.09 Hz, 1H) 7.78 (t, J = 7.91 Hz, 1H) 7.93 (d, J = 8.09 Hz, 1H) 8 · 35 (d, J = 5.52 Hz, 1H) 14.21 (s, 1H) 14.81 (s, 1H). MS (ESI-) m / z 431 (MH) '.

Example 275A 6-(!, 1-di-modified-4H-1,2,4-benzo-p-dipent-3-yl) -7-Cyclo-4- 丨 "3-methylbutylene] Amino V sedeno 1-3.2-bl pyridine-5 (4HV ketone made the product of Example 268D (0.10 g, 0.27 mmol) and 3-methylbutyraldehyde (0.5 g, 5.8 MM) in N, N-dimethylacetamide (3 ml) in a sealed tube at 130 ° C in a microwave reactor for 40 minutes. The reaction was cooled to 25 C ' And concentrated under vacuum. The formed residue was triturated with acetic acid and filtered to give the title compound (0.083 g, 71%). 89166 -444- 200427678

Example 275B MLli! Dioxide-4H-l ^, 4-benzopyridine π_3_yl) -7- # 垔 某 -4 _ "(3-methylbutanyl, amino group &gt; sepheno [ 3,2-bl pyridine-5 (4HVS between the products of Example 269A (0.083 g, 0.19 mmol) in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol) at (TC , Dropwise treatment with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.150 ml, 0.3 mmol). Stir the reaction at 25 ° C: Stir for 1 hour and acidify to pH with 1 M hydrochloric acid. Approximately 2-4, diluted with water (15 ml), and the precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.90 (d, J = 6.62 Hz, 6H) 1.44 (q, J = 7.11 Hz, 2H) 1.70 (m, 1H) 3.03 (t, J = 6.99 Hz, 2H) 6.61 (s, 1H) 7.43 (d, J = 5.15 Hz, 1H) 7.55 (t, J = 7.54 Hz, 1H) 7.65 (d, J = 8.09 Hz, 1H) 7.77 (t, J = 7.72 Hz, 1H) 7.92 (d, J = 7.72 Hz, 1H) 8_35 (d, J = 5 52 Hz, 1H) 14.20 (s, 1H) 14.81 (s, 1H). MS (ESI_) m / z 431 (Μ · Η) \

Example 276A 4- {| ~ 3,3-Dimethylbutylene 1 amino group 丨 Digas-4Η-1,2,4-benzopyrimidin-3-yl V7-fluorenylpyrido | ~ 3,2_bl pyridine-5 (4Η) -one produced the product of Example 268D (0.10 g, 0-27 mol) with 3,3-dimethylbutyraldehyde (0.5 g, 5.0 mol) ν, N-dimethylacetamide (3 ml) in a sealed tube at 130 ° C in a microwave reactor for 40 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.072 g, 77%).

Example 276B 89166 -445- 200427678 butylbutyl) amino 1-6- (1,1-dioxide-4H-〗 2,4-benzyl-4-di-n- group) -7- 1 Eridine_5i4FTVSlil The product of Example 269A (0.072 g, 0.21 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol). Below, 2.0% lithium borohydride in tetrahydrofuran was used. M solution (0.150 ml, 0.3 mmol) was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 μ hydrochloric acid to a pH of about 24, diluted with water (15 ml), and The formed precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR ( 300 MHz, DMSO-d6) (5 ppm 0.89 (s, 9H) 1.49 (dd, J = 9.56, 6.99 Hz, 2H) 3.03 (m, 2H) 6.61 (s, 1H) 7_43 (d, J = 5.52 Hz, 1H) 7.55 (t, J = 7.54 Hz, 1H) 7.66 (d, J = 7.72 Hz, 1H) 7.77 (m, 1H) 7.92 (d, J = 8.09 Hz, 1H) 8.35 (d, J = 5.52 Hz, 1H) 14.19 (s, 1H) 14.83 (s, 1H). MS (ES I-) m / z 445 (M-H) '.

Example 277A MU-Dioxide-4H-1,2,4-Benzophthaloline f-cult-3-yl) -7-Methylbenzyl, methylene 1amino, h-phenone "3,2- bl pyridine-5 (4HV ketone made the product of Example 268D (0.10 g, 0.27 mmol) and 3-methylbenzaldehyde (0.5 g, 4.2 mmol) at Ν, Ν- 二Methylacetamide (3 ml) in a sealed tube at 130 ° C in a microwave reactor for 40 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The formed The residue was triturated with diethyl ether and filtered to give the title compound (0.092, 73%).

Example 277B 6- (1,1-Di-emulsified-4'-1,2,4, benzobenzodipent-3-ylylmethylamidino) 89166 -446- 200427678 Amino &quot; I pyrimido &quot; 3.2 -bl pyridine-5 (4H) -one The product of Example 269A (0.090 g, 0.2 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.015 ml, 0.4 mmol) at 0 ° At C, a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.150 ml, 0.3 mmol) was treated dropwise. The reaction was stirred at 25 ° C for 1 hour and acidified to pH with 1 M hydrochloric acid. About 2-4, diluted with water (15 ml), and the precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) δ ppm 2.29 (s, 3H) 4.15 (s, 2H) 6.94 (s, 1H) 7.22 (m, 4H) 7.30 ( d, J = 5.15 Hz, 1H) 7.56 (t, J = 7.72 Hz, 1H) 7.68 (d, J = 8.46 Hz, 1H) 7.79 (t, J = 6.99 Hz, 1H) 7.94 (d, J = 7.72 Hz, 1H) 8.24 (d, J = 5.15 Hz, 1H) 14.26 (s, 1H) 14.84 (s, 1H) · MS (ESI-) m / z 465 (M-H) '

Example 278A includes 1,1-dioxidation_4H-1,2,4 • benzopyridine-3_yl V7-lightyl-4] I 2 -methylbenzene) to methyl 1 amino group 1 ~ 3,2 heptopyridine-5 (4HV ketone made the product of Example 268D (0.10 g, 0.27 mmol) and 2-methylbenzaldehyde (0.5 g, 4.2 mmol) In Ν, Ν-dimethylacetamide (3 ml), in a sealed tube at 135 ° C in a microwave reactor for 60 minutes. The reaction was cooled to 25 ° C and under vacuum Concentrate. Triturate the resulting residue with diethyl ether and filter to give the title compound (0.072 g, 57%).

Example 278B f Dioxide-4H-1,2,4-benzopyrene-3_yl V7-hydroxy-1-4-IT2-methylfluorenyl) Amino 1 farpheno "3,2-bl pyridine- 5 (4H) -one The product of Example 269A (0-〇72 g, 0.15 mmol) was dissolved in tetrahydrofuran (4 mmol 89166-447-200427678 liters) and methanol (0.020 ml, 0.5 mmol). At 0 ° C, a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.150 ml, 0.3 mmol) was treated dropwise. The reaction was stirred at 25 ° C for 1 hour and acidified with 1 M hydrochloric acid to The pH was about 2-4, diluted with water (15 ml), and the precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The steel salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 ppm 2.45 (s, 3H) 4.21 (s, 2H) 6.92 (s, 1H) 7.15 (m5 5H) 7 · 56 (t, J = 7.72 Hz, 1H) 7.67 (d, J = 8.09 Hz, 1H) 7.79 (t, J = 7.72 Hz, 1H) 7.94 (d, J = 7.72 Hz, 1H) 8.17 (d, J = 5.52 Hz, 1H) 14.22 (s, 1H) 14.82 (s, 1H). MS (ESI-) m / z 465 (M-Η) · ·

Example 279A Dioxide_4H-1,2,4-benzyl bis (3-yl) -7-light methylbenzyl, methylene 1 aminothiophene "3,2-bl pyridine- 5 (4HV ketone made the product of Example 268D (0.10 g, 0.27 mmol) with 4-methylbenzoic acid (0.5 g, 4.2 mmol) in N, N-dimethylacetamide (3 ml ), In a sealed tube, in a microwave reactor at 135 ° C for 60 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The resulting residue was triturated with ether, and Filtration gave the title compound (0.10 g, 81%).

Example 279B 6- (1,1-Dioxide_4Η-1 · 2 · 4-benzilopyrimidin-3-yl V7-hydroxyl-44 (4-methylfluorenyl) amino group such as thiophene "3 , 2-b &gt; Bipyridine-5 (4HV ketone The product of Example 269A (0.10 g, 0.22 mmol) in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol), The solution was treated dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.150 ml, 0.3 mmol) at 0 ° C. 89166 -448-200427678 The reaction was stirred at 25 ° C for 1 hour. 1 M hydrochloric acid was acidified to a pH of about 2-4 'diluted with water (15 ml), and the precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform. The title compound was obtained. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 2.27 (s, 3H) 4.14 (s, 2H) 6.92 (s, 1H) 7.13 (d, J = 8.09 Hz, 2H) 7.28 (d, J = 2.94 Hz, 1H) 7.30 (d, J = 5.88 Hz, 2H) 7.56 (t, J = 7.72 Hz, 1H) 7.67 (d, J = 8.46 Hz, 1H) 7.79 (t, J = 7.72 Hz, 1H) 7.94 (d5 J = 7.72 Hz? 1H) 8.22 (d? J = 5.52 Hz? 1H) 14.21 (s5 1H) 14.82 (s? 1H). MS (ESI-) m / z465 (M-H) \

Example 280A MU-Oxidation-4,1,2,4-benzopyrimidin-3-yl V7, and radicals 4-{"3_methyl certain butan-2-enyl 1 amine h thiophene [3,2-bl pyridine-5 (4HV ketone made the product of Example 268D (0.10 g, 0.27 mmol) and 3-methylbut-2-enal (0.5 g, 5.9 mmol)) In N, N-dimethylacetamide (3 ml), in a sealed tube at 130 ° C in a microwave reactor for 40 minutes. The reaction was cooled to 25 ° C and under vacuum Concentrate. Triturate the resulting residue with diethyl ether and filter to give the title compound (0.093 g, 80%).

Example 280B 6- (1,1-Digas-4H], 2,4-benzopyrimidin-3-yl V7-hydroxy-4-IY3-methylbut-2-enyl) aminopheno 1 &quot; 3,2 VII &gt; Bite-5 (4HVffi will be the product of Example 269A (0.093 g, 0.22 mmol) in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol) at 0 ° Hydrogenated by a 2.0 M solution in tetrahydrocondensation (0. 150 ml, 0.3 mmol) dropwise at C. The reaction was stirred at 25 ° C for 1 hour and 1 M hydrochloric acid Acidify to a pH of 89166 -449- 200427678 approximately 2-4, dilute with water (15 ml), and collect the precipitate formed by filtration 'and dry. The crude product is crushed with 2% methanol in chloroform. Chromatography to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 ppm 1.51 (s, 3H) 1.61 (s, 3H) 3.64 ( d5 J = 6.99 Hz5 2H) 5.32 (t, J = 8.09 Hz, 1H) 6.65 (s? 1H) 7.43 (d? J = 5.52 Hz? 1H) 7.55 (t, J = 7.54 Hz, 1H) 7.64 ( d, J = 8.46 Hz, 1H) 7.78 (t, J = 7.17 Hz, 1H) 7.92 (d, J = 7.72 Hz, 1H) 8.32 (m, 1H) 14.21 (s, 1H) 14.82 (s, 1H) · MS (ESI-) m / z 429 (M-H) &quot;.

Example 281A G, l-monoemulsified-4H-1,2,4-benzo farebi-3-yl V7-trans--4-propylideneamine 1 thieno-3,2-bl pyridine -5 (4HV ketone made the product of Example 268D (0.10 g, 0.27 mmol) and propionaldehyde (0.5 g, 8.6 mmol) in N, N-dimethylacetamide (3 ml), In a sealed tube, react at 90 ° C in a microwave reactor for 90 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The resulting residue was triturated with ether and filtered. 'To give the title compound (0.073 g, 67%).

Example 281B _6 _- (1,1-^-emulsified-4H-1,2,4-benzo-p-dikephine · 3 · yl) -7-¾-4- (propylamine) fluorene and "3 , 2-bl pyridine-5 (4HV ketone) The product of Example 269A (0.073 g, 0.18 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol) at 0 ° C. It was treated dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.150 ml, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour and acidified with 1 M hydrochloric acid to a pH of about 2-4. , Diluted with water (15 ml), and collected the precipitate 89166 -450- 200427678 by filtration, and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The title compound. The sodium salt was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 0.95 (t, J = 7.35 Hz, 3H) 1.54 (m, 2H) 2.99 (t, J = 6 · 99 Hz, 2H) 6.66 (s, 1H) 7.44 (d, J = 5.15 Hz, 1H) 7.55 (t, J = 7.54 Hz, 1H) 7.64 (d, J = 8.09 Hz, 1H) 7.78 ( U = 7.17 Hz, 1H) 7.93 (d, J = 7.72 Hz, 1H) 8.35 (d, J = 5.15 Hz, 1H) 14.20 (s 1H) R81 (s, 1H) · MS (ESI-) m / z 403 (M-H) ~.

Example 282A -4H-1,2,4-benzo fardi- 3 -yl) -7- and base than 4_ylmethylene 1amino} pheno || quot; 3,2- bl pyridine-5 (4HVS with the product of Example 268D (0.10 g, 0.27 mmol) and isonicotinaldehyde (0.5 g'4.7 Amor) in N, N-dimethylacetic acid Amine (3 ml) was reacted in a sealed tube in a microwave reactor at 135 ° C for 60 minutes. The reaction was cooled to 25 C 'and concentrated under vacuum. The residue formed was ether. Triturate and filter to give the title compound (0.093 g, 76%).

Example 282B 6- (1,1-a ^ emulsified_4H-1,2,4-benzopfluorene dipent-3-yl) -7-acyl-4- "Q ^ ls Amino) 1 aminopyrimido, 3,2-bl pyridine-5 (4HV ketone will be the product of Example 269A, (0.093 g, 0.21 mmol) in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol) Ear), at 0. 0, with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.150 ml, 0.3 mmol) dropwise. The reaction was stirred at 25 ° C for 1 hour, and 1 M hydrochloric acid Acidify to a pH of about 2-4 'dilute with water (15 ml) and collect the precipitate formed by filtration' and dry. The crude product is chromatographed on silica gel with 2% methanol in chloroform, 89166 -451 -200427678 to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMRpOOMHz'DMSOOSppmGVsJHnJVcU ^ S.lS Hz? 1H) 7.42 (s5 1H) 7.56 (t5 J = 7.72 Hz, 1H) 7.63 (d3 J = 8.09 Hz? 1H) 7.79 (m? J = 7.72, 7.72 Hz, 3H) 7.94 (d5 J = 7.72 Hz? 1H) 8.27 (d? J = 5.15 Hz? 1H) 8.52 (d, J = 6.62 Hz, 2H) 14.15 (s, 1H) 14.87 (s, 1H) · MS (ESI-) m / z 452 (MH)- ·

Example 283A 6- (1,1-dimulsified_411-1,2,4-benzyl and two plugs-3-wells) _7-Isyl-4 _ {"Morphology-3-ylmethylene 1 Amine] ^ Sphenone "3,2_1 &gt; 1 Edianjing together with the product of Example 268D (0.10 g, 0.27 mmol) and nicotinaldehyde (0.5 g, 4 7 mmol) In Ν, Ν-dimethylacetamide (3 ml), in a sealed tube at 135 ° C in a microwave reactor for 60 minutes. The reaction was cooled to 25.0 and under vacuum. Concentrated. The resulting residue was triturated with ether and filtered to give the title compound (0.102 g, 84%).

Example 283B Oxidation of 4H-1,2,4-benzilopyrimidine-3-a V7- # fa_4-"((pyridinyl ') methyl) amino group &gt; thiophene &quot; 3,2_b minus Bite-5 (4HV ketone) The product of Example 269A · (0.102 g, 0.23 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol) at (TC, with borohydride in A 2.0 M solution (0.150 ml, 0.3 mmol) in tetrahydrofuran was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, acidified to a pH of about 2-4 with 1 μ hydrochloric acid, and water ( 15 ml), and the precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was obtained according to the procedure of Example 1D. Made. 1H NMR (300 MHz, DMSO-d6) 5 ppm 4.33 (s, 2H) 7.28 (d J = 5 52 89166 -452- 200427678

Hz, 1H) 7.36 (s, 1H) 7.61 (m, 3H) 7.79 (t, J = 7.17 Hz, 1Η) 7.94 (d, J = 8.09 Hz, 1H) 8.20 (d, J = 11.03 Hz, 1H) 8.27 (d, J = 5.51 Hz, 1H) 8.49 (d, J = 5_51 Hz, 1H) 8.64 (s, 1H) 14.14 (s, 1H) 14.83 (s, 1H) · MS ( ESI) m / z 452 (M-Η)

Example 284A 6- (1,1-digasification-4H_L2.4-benzylpyridine group) -7-hydroxy-4-("pyridin-2-ylmethylene 1 amine h thiophene" 3,2-bl pyridine-5 (4HV ketone made the product of Example 268D (0.10 g, 0.27 mmol) and 2-pyridinecarboxaldehyde (0.5 g, 4.7 mmol) at N, N-dimethyl Acetylam (3 ml) was reacted in a sealed tube in a microwave reactor at 135 ° C for 60 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The formed was The residue was triturated with diethyl ether and filtered to give the title compound (0.071 g, 58%).

Example 284B MU-Dioxide-4Η-1 · 2,4-benzilopyrimidine-3_yl) -7-hydroxy-1-4-ϊpyridin-2-ylmethyl) amino 1pyrimido | ~ 3,2-bl pyridine-5 (4HV ketone) The product of Example 269A (0.071 g, 0.16 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol) at 0 ° C. It was treated dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.150 ml, 0.3 mmol). The reaction was stirred at 25 ° C for 1 hour and acidified with 1 M hydrochloric acid to a pH of about 2-4. Dilute with water (15 ml) and collect the formed precipitate by filtration 'and dry. The crude product is chromatographed on silica gel with 5% methanol in chloroform to give the title compound. The sodium salt of the title compound is according to the example 1D program. 1H NMR (300 MHz, DMSO-d6) 5 ppm 4.65 (s, 2H) 7.25 (d, J = 5.15 Hz, 1H) 7.45 (s, 1H) 7.59 (m, 3H) 7.78 (t, J = 7.91 Hz, 1H) 7.93 (d, J = 7.72 Hz, 2H) 8.16 (t, J = 7.72 Hz, 1H) 8.24 (d, J = 5.15 Hz, 1H) 8.72 (d , J = 5.51 Hz, 1H) 89166 -453-200427678 14.10 (s? 1H) 14.87 (s3 1H). MS (ESI-) mJz 452 (M-H) &quot;.

Example 285A Dioxidation · 4_Η-1,2,4-benzidopyrimidinium · 3-based V7-light-based ice Hepta-1pyridine-5 (4HV) was combined with the product of Example 268D (0.10 g, 0.27 mmol) and 3-methoxybenzaldehyde (0.5 g, 3.7 mmol) at Ν, Ν- In dimethylacetamide (3 ml), in a sealed tube at 135 ° C in a microwave reactor for 60 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.093 g, 72%).

Example 285B 6- (1,1-Dioxide-4H_1,2,4_benzopyridine_3-yl V7-hydroxy-44 (3-methylpanwahampine) Amine 1 pyrimido D, 2 -bl pyridine-5 (4HV ketone) The product of Example 269A (0.093 g, 0.19 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol) at 0. A 2.0 M solution of lithium borohydride in tetrahydrofuran (0.150 ml, 0.3 mmol) was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, and acidified with 1 M hydrochloric acid to a pH of about 2- 4. Dilute with water (15 ml) and collect the formed precipitate by filtration and dry. The crude product is chromatographed on silica gel with 1% methanol in chloroform to give the title compound. Sodium salt of the title compound Prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 ppm 3.73 (s, 3H) 4.17 (s, 2H) 6.84 (m, 1H) 6.98 (m, 3H) 7.22 (d, J = 8.09 Hz, 1H) 7.26 (d, J = 5.15 Hz, 1H) 7.56 (t, J = 7.17 Hz, 1H) 7.67 (d, J = 8.09 Hz, 1H) 7.79 (t, J = 8.46 Hz, 1H ) 7.94 (d, J = 7.72 Hz, 1H) 8.22 (d, J = 5.15 Hz, 1H) 14.21 (s5 1H) 14.84 (s, 1H). MS (ESI-) m / z481 (M-H) · 89166 -454- 200427678

Example 286A 6-Π, 1-emulsified-4Η-1,2,4? Sediment p-well-3-yl) _4 _ {"3-p sulfanyl methylene 11 cavity group} _7-hydroxypyrophene #" 3.2 seven 1 pyridine-5 (4HV_ make the product of the example 268D (0 · 10 g 0.27 mmol) and 3-furanal (0.5 g, 5.2 mmol) in N, N-dimethylacetamide (3 ml) in a sealed tube at 135 ° C, In a microwave reactor, react for 60 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.103 g, 87%).

Example 286B 6- (1,1-Dioxide-4H-1,2,4-benzopyrimidin-3-yl) ice "(3-pyranylmethyl) amine 1-7-hydroxypyrimidine The product of Example 269A (0.103 g, 0.23 mmol) in tetrahydrofuran (4 ml) and methanol (0.030 ml, 0.8 mmol) was added at 3.2 ° C. It was treated dropwise with a 2.0 M solution (0.200 ml, 0.4 mmol) of tetrahydrofuran in tetrahydrofuran. The reaction was stirred at 25 ° C for 1 hour and acidified with 1 M hydrochloric acid to a pH of about 2-4. , Diluted with water (15 ml), and collected the precipitate formed by filtration, and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to obtain the title compound. The sodium salt of the title compound was based on Example 1D was prepared by the procedure. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 4.08 (s, 2H) 6.59 (s, 1H) 6.95 (s, 1H) 7.32 (d, J = 5.15 Hz, 1H ) 7.58 (m, 3H) 7.66 (d, J = 8.09 Hz, 1H) 7.79 (t, J = 8.46 Hz, 1H) 7.93 (d, J = 7.72 Hz, 1H) 8.24 (d, J = 5.52 Hz, 1H) 14.21 (s, 1H) 14.83 (s, 1H). MS (ESI-) m / z 441 (MH) '

Example 287A 3-({6-α J-Digas-4Η · 1,2,4-benzopyrimidin-3-yl) -7-hydroxy-5-ketopyrimine 89166 -455-200427678 And "3,2-bl command pyridin-4 (5HV, 1¾amino} methyl, 1) acetonitrile made the product of Example 268D (0.100 g, 0.27 mmol) and 3-formyl benzonitrile (0 · 362 g, 2.75 mmol) in N, N-dimethylacetamide (3 ml) in a sealed tube in a microwave reactor at 135 ° C for 60 minutes. Allow the reaction to cool To 25 ° C. and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.088 g, 69%).

Example 287B Dioxide · 4Η-1,2,4_benzyl and far di_-3-yl) -7 · boryl-5-gangyl cepheno [3,2-bl pyridine-4 (5HV certain 1 amine Benzyl) methane) acetonitrile The product of Example 269A (0.088 g, 0.19 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol). Below 0 ° C, a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.150 ml, 0.3 mmol) was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4 ', diluted with water (15 ml), and the formed precipitate was collected by filtration, and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 4.26 (s, 2H) 7.21 (s, 1H) 7.29 (d, J = 5.15 Hz, 1H) 7_55 (m, 2H) 7.65 (d, J = 8.09 Hz, 1H) 7.78 (m, 3H) 7_94 (m, 2H) 8 · 22 (d, J = 5.52 Hz, 1H) 14.19 (s, 1H) 14.83 (s, 1H). MS (ESI -) m / z 476 (mh) '

Example 288A oxidized -4H-1,2,4-jamopyridine_3_yl V7-light group. 4] 1 phenyl keto-methylene 1 amino group h thiophene "3,2-bl Pyridine-5 (4HV) same as the product of Example 268D (0.10 g, 0.27 mmol) and thiophene 3-carboxaldehyde (0.5 89166 • 456-200427678 g, 4.5 mmol) ) In N, N-dimethylacetamide (3 ml), in a sealed tube at 135 ° C in a microwave reactor for 60 minutes. The reaction was cooled to 25 ° C, and Concentrate in vacuo. Triturate the resulting residue with diethyl ether and filter to give the title compound (0.077 g, 63%).

Example 288B 6- (1,1-dioxo-4dz_4Η-1,2,4-benzoxanthyl-2-well-3-yl) -7-benzyl-4-"(orthynylmethyl) Amine 1 pyrimido "3,2 hepta-1pyridine-5 (4HV ketone will be the product of Example 269A (0_077 g, 0.17 mmol) in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol) , Dropwise treatment with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.150 ml, 0.3 mmol) at 0 ° C. The reaction was stirred at 25 ° C for 1 hour, and acidified to pH with 1 M hydrochloric acid. Value is about 2-4, diluted with water (25 ml), and the precipitate formed is collected by filtration and dried. The crude product is chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The title compound. The sodium salt was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 4.22 (s, 2H) 7.01 (s, 1H) 7.20 (dd, J = 4.96, 1.29 Hz, 1H) 7.23 (d, J = 5.52 Hz5 1H) 7.40 (d5 J = 1.84 Hz, 1H) 7.48 (dd, J = 4.78, 2.94 Hz, 1H) 7_56 (t, J = 7.17 Hz, 1H) 7.67 (d, J = 7.72 Hz, 1H) 7.79 (t? J = 7.72 Hz5 1H) 7.94 (d, J = 7.72 Hz? 1H) 8.21 (d5 J = 5.15 Hz? 1H) 14.21 (s, 1H) 14.82 (s, 1H). MS (ESI-) m / z 457 (Μ · Η) _ ·

Example 289A Cyclobutylamine amino group V6VL1-Dioxide-4H_U, 4_Mo # 4 Digonium-3-yl V7-Based pheno "3,2-bl pyridine-5 (4HV ketone makes the product of Example 268D (0.10 g, 0.27 mmol) with cyclobutanone (1.0 g, 14.3 mmol) in N, N-dimethylacetamide (2 ml), in a sealed tube, at 135 89166 -457- 200427678 ° C in a microwave reactor for 60 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The resulting residue was triturated with ether and filtered to give the title compound (0.086 g 77%).

Example 289B 4- (Cyclobutylamino) -6- (1,1-dioxide-4H-1,2,4-benzopyridino-pyrido-hydroxypyridino "3,2-blpyridine_5 [4HV ketone The product of Example 269A (0-077 g, 0.21 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.030 ml, 0.8 mmol) at (TC, borohydride A 2.0 M solution (0.200 ml, 0.4 mmol) in tetrahydrofuran was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, acidified with 1 M hydrochloric acid to a pH of about 2-4, and water. (15 ml) was diluted, and the formed precipitate was collected by filtration, and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to obtain the title compound. The sodium salt of the title compound was according to Example 1D. The program was made. 1 H NMR (300 MHz, DMSO-d6) δ ppm 1.81 (m, 6H) 3.85 (m, 1H) 6.84 (s, 1H) 7.49 (d, J = 5.15 Hz, 1H) 7.55 (t, J = 7.91 Hz, 1H) 7.62 (d5 J = 8.09 Hz, 1H) 7.78 (t, J = 7.91 Hz, 1H) 7.93 (d, J = 8.09 Hz, 1H) 8.33 (d, J = 5.15 Hz, 1H) 14.21 (s, 1H) 14.82 (s, 1H). MS (ESI-) m / z 415 (MH) '

Example 290A Di-emulsified -4H-1,2,4-Benzobi- 3 -yl) -7-weimou-4 _ {"Benzene methylene i amino V thieno [3,2-b &quot; p ratio lake_5 (4HVi with the product of Example 268D (0.115 g, 0.30 mmol) and benzoic acid (0.32 g '3.0 dmol) in Ν, Ν-dimethylacetamide (2¾ Liters), in a sealed tube, 'reacted in a microwave reactor' at 135 C for 50 minutes. The reactants were cooled to 25 C 'and concentrated under vacuum. The resulting residue was treated with o "μ HC1 ( 20 89166 -458- 200427678 ml), and filtered to give the title compound.

Example 290B acyl group) -6_ (1,1 · Dioxide · 4Η_1 · 2.4-benzyl-4-diphenyl-3-yl V7-pyridylpyrido "3,2-bl pyridine-5 (4HV ketone Example 269A The product (0.116 g, 0.257 mmol) was dissolved in tetrahydrofuran (5 ml) and methanol (0.021 ml, 0.514 mmol) at 0. (2: 2 with tetrahydrofuran in tetrahydrofuran). OM solution (0.19 ml, 0.386 mmol) was treated dropwise. The reaction was stirred at 25 ° C for 2 hours, the pH was acidified to about 2-4 with 1 M hydrochloric acid, and diluted with water (20 ml) The title compound was collected by filtration and dried to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) δ ppm 3_97 (d, J = 5.54 Hz, 2H) 6.17 (t? J = 6.43 Hz? 1H) 7.08 (d, J = 5.52 Hz, 1H) 7.21 (d5 J = 8.09 Hz, 1H) 7_33 (m, 4H) 7.47 (d, J = 6.62 Hz, 2H) 7.55 (t, J = 6.99 Hz, 1H) 7.66 (d, J = 7.35 Hz, 1H) 7.73 (d, J = 5.52 Hz, 1H) 15.92 (s, 1H). MS ( ESI-) m / z451 (MH) '

Example 291A K `` Cyclohexylmethyleneamine 6- (1,1-digas-4H-U, 4-benzyl 4-diphenylfluorenyl V7-hydroxypyrimido f3,2-bl pyridine-5 (4HV ketone made the product of Example 268D (0.115 g, 0.30 mmol) with cyclohexane metacarboxylic acid (0.336 g, 3.0 mmol) in N, N-dimethylacetamide (3 ml) at In a sealed tube, the reaction was carried out in a microwave reactor at 135 ° C for 60 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The residue formed was treated with 0.1 M HC1 (20 ml) Triturated and filtered to give the title compound.

Example 291B 89166 -459- 200427678 (Cyclohexylmethyl) amino group WU-dioxide-4Η-1,2,4-benzyl-4-dipyridyl) -7-hydroxypyrido (4HV ketone The product of Example 269A (0.12 g, 0.26 mmol) was dissolved in tetrahydrofuran (5 ml) and methanol (0.021 ml, 0.52 mmol) at (TC, lithium borohydride in tetrahydrofuran). The 2.0M solution (0.195ml, 0.39mmol) was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, the pH was acidified to about 2-4 with 1M hydrochloric acid, and water (15ml ) Dilute, and collect the precipitate formed by filtration, and dry. The crude product is chromatographed on silica gel with 97: 3 dichloromethane / methanol to obtain the title compound. The sodium salt of the title compound is according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) δ ppm 1.04 (m, 2H) 1.23 (m, 3H) 1.52 (m, 1H) 1.68 (m, 3H) 1.87 (m, 2H) 2.69 ( m, 2H) 5.95 (t, J = 7.17 Hz, 1H) 7.07 (d? J = 5.52 Hz5 1H) 7.19 (d, J = 8.09 Hz, 1H) 7.26 (t5 J = 7.72 Hz, 1H) 7.53 (t, J = 7.17 Hz, 1H) 7.65 (d, J = 6.99 Hz, 1H) 7.78 (d, J = 5.15 Hz, 1H) 15.91 (s, 1H). MS (APCI +) m / z 459 (M + H) +.

Example 292A Dioxide_4H-L2,4_Stupid and bifurcated cultivating_3_A certain V7-light-based ice 丨 "1,3-thiazole-5-ylmethylene 1amino group 2_b &quot; kk-pyridin-5 (4HV) simultaneously used the product of Example 268D (0.115 g, 0_30 mmol) and 1,3-disc-5-carboxylic acid (0.35 g, 3.0 mmol) at N, In N-dimethylacetamide (3 ml), in a sealed tube at 140 ° C. for 80 minutes in a microwave reactor. The reaction was cooled to 25 ° C. and concentrated under vacuum. The resulting residue was triturated with 0.1 μHC1 (20 ml) and filtered to give the title compound. Example 292B Benzopyrene-3-yl V7-hydroxy-44 (1,3-pyrimidine- 5-89166 -460- 200427678 ylmethyl) amino 1 pyrimido "3,2 hepta-1pyridin-5 (4HV ketone will be the product of Example 269A (0.137 g, 0.30 mol)) in tetrahydrofuran (7 ml ) And methanol (0.025 ml, 0.6 mmol) and (2,0 M solution of lithium borohydride in tetrahydrofuran (0.225 ml, 0.45 mmol)) were treated dropwise at (TC). Stir at 2 ° C for 2 hours, acidify the pH to approximately 2-4 with 1 M hydrochloric acid, and water (20 mmol) L) diluted, and the precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with 95: 5 dichloromethane / methanol to obtain the title compound. The steel salt of the title compound was obtained according to Example 1D. Program made. 1 H NMR (300 MHz, DMSO_d6) 5 ppm 4.34 (m, 2H) 6.45 (t, J = 5.52 Hz, 1H) 6.97 (d, J = 5.15 Hz, 1H) 7.20 (d, J = 8.09 Hz, 1H) 7.27 (t, J = 7.54 Hz, 1H) 7.54 (t, J = 7.17 Hz, 1H) 7.66 (d, J = 7.72 Hz, 1H) 7.70 (d, J = 5.52 Hz, m) 7.79 (s, 1H) 9.02 (s, 1H) 15 · 87 (s, 1H). MS (ESI_) m / z 458 (MH)-·

Example 293A Stinky phenyl) methylene 1 amino group 丨 -6- (1,1-dioxide · 4Η-1 · 2.4-benzyl-4-diphenyl_3-yl) _7-light-based farpheno | ~ 3 , 2-bHb Lake-5 (4HV ketone makes the product of Example 268D (0.115 g, 0.30 mmol) and 3-bromobenzoic acid (0.555 g '3.0 gomol) in N, N-dimethylacetamide (2 ml), in a sealed tube at 135 ° C in a microwave reactor for 30 minutes. The reaction was cooled to 25 ° C 'and concentrated under vacuum. The resulting residue was acetic acid Ethyl acetate (3 ml) was triturated and filtered to give the title compound.

Example 293B 4-"(3-Bromo-narrow) amino 1-6- (1,1-dioxide-4H-1,2,4-benzylpyridin-3-yl V7- leptylpyrimido "3,2 hepta-1pyridine-5 (4HVil made the product of Example 269A (0.13 g, 0.245 mmol) in tetrahydrofuran (4 mmol 89166 -461-200427678 liters) and methanol (0.015 ml, 0.36 mmol Mol), at 0 ° C, dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.15 ml, 0.30 mmol). The reaction was stirred at 25 ° C for 2 hours. The pH was acidified to about 2-4 with 1 M hydrochloric acid, diluted with water (15 ml), and the precipitate formed was collected by filtration and dried to give the title compound. The sodium salt of the title compound was according to Example 1D The program was made. 1H NMR (300 MHz, DMSO-d6) 5 ppm 4.02 (m, 2H) 6.27 (t, J = 6.25 Hz, 1H) 7.08 (d, J = 5.15 Hz, 1H) 7.20 (d , J = 8.46 Hz, 1H) 7.28 (t, J = 7.72 Hz, 1H) 7.32 (t, J = 6.99 Hz, 1H) 7.46 (d, J = 7.72 Hz, 1H) 7.54 (m, 2H ) 7.67 (m, 2H) 7.73 (d, J = 5.15 Hz, 1H) 15.90 (s, 1H). MS (ESI-) m / z 529/531 (MH) '

Example 294A K-cyclohexyleneamino) -6- (1,1-digasification-4H-1,2,4-benzopyrimidine; even V7-pyridino [3,2-bl pyridine -5 (4HV ketone made the product of Example 268D (0.054 g, 0.15 mmol) with cyclohexanone hydrazone 44 g, 4.5 mmol) in N, N-dimethylacetamide (1 ml) in a sealed In a tube, the reaction was performed in a microwave reactor at 135 C for 45 minutes. The reaction was cooled to 25 C 'and concentrated under a vacuum. The resulting residue was triturated with ether (3 ml) and filtered. Thus, the title compound was obtained.

Example 294B Hexylamino) -6- (1,1_digasified-4H-1,2,4-benzyl and far-spray-3_yl 4HV ketone The product of Example 269A (0.051 g, 0.115 mmol) was dissolved in tetrahydrofuran (5 ml) and methanol (0.01 ml, 0.23 mmol) in lithium borohydride in tetrahydrofuran at 0 r The 2.0M solution (0.090ml, 175mmol) was treated dropwise 89166 -462- 200427678. The reaction was stirred at 25 ° C for 1 hour, and the pH was acidified to about 2- with 1M hydrochloric acid. 4. Dilute with water (10 ml) and collect the precipitate formed by filtration, and dry. The crude product was chromatographed on Shi Xijiao with 97: 3 dichloromethane / methanol to obtain the title compound. The title compound The sodium salt was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 1.16 (m, 5H) 1.59 (m, 5H) 3.01 (m, 1H) 5.75 (d, J = 3.31 Hz, 1H) 7.15 (d, J = 5.52 Hz, 1H) 7.19 (d, J = 7_72 Hz, 1H) 7.26 (t, J = 7.54 Hz, 1H) 7.54 (m, 1H) 7.65 (d , J = 7.72 Hz, 1H) 7.72 (d5 J = 5.52 Hz? 1H) 15.93 (s? 1H). MS (ESI-) m / z 443 (M -H) '.

Example 295A 4- (Cyclopentylamino group V6_ (l, l-dioxide-4H-1? 4? Benzo 4 Ergen-3-a certain V7-hydroxypyrimido "3,2-bl pyridine-5 (4HV ketone made the product of Example 268D (0.054 g, 0.15 mmol) and cyclopentanone (0.95 g, 11.3 mmol) in N, N-dimethylacetamide (1 ml) at In a sealed tube, react in a microwave reactor at 135 ° C for 60 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The resulting residue was triturated with ether (3 ml) and Filter to give the title compound.

▲ Example 295B Cyclopentylamino V6- (U-digasification-4Η-1,2,4-benzilopyridine_3_a certain v / A very pyrimido `` 3,2-bl pyridine_5 (4HV ketone The product of Example 269A (0.040 g '0.09 Emoll) was dissolved in tetrahydroanthran (3 ml) and methanol (0.008 ml, 0.19 mmol) under 0 ° C under borohydride. A 2.0 M solution (0.07 ml, 0.14 mmol) in tetrahydrocrack was processed dropwise. The reaction was stirred at 25 ° C for 1 hour, and the pH was acidified to about 2-4 with 1 M hydrochloric acid. , Diluted with water (10 ml), and collected the precipitate 89166 463-200427678 and dried by filtration. The crude product was chromatographed on silica gel with 98: 2 dichloromethane / methanol to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 ppm 1.54 (m, 6H) 1.74 (m, 2H) 3.75 (m, 1H) 5.77 (d, J = 3.68 Hz, 1H) 7.12 (d, J = 5.15 Hz, 1H) 7.19 (d, J = 7.72 Hz, 1H) 7.26 (t, J = 7.17 Hz, 1H) 7.54 (m, 1H) 7.64 ( d, J = 7.72 Hz, 1H) 7.74 (d, J = 5.52 Hz, 1H) 15.91 (s, 1H) · MS (ESI-) m / z 429 (M-Η ) ...

Example 296A Diamino-4H-1,2,4-benzilopyridine-3D-7-hydroxypyridino "3,2 heptylpyridin-5 (4HV ketone makes the product of Example 268D ( .54 g, 0.15 mmol, and cycloheptanone (0.84 g, 7.5 mmol) in N, N-dimethylacetamide (1 ml) in a sealed tube at 135 C, The reaction was carried out in a microwave reactor for 45 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The resulting residue was triturated with diethyl ether (3 ml) and filtered to give the title compound.

Example 296B cycloheptylamino group) -6-Π · 1-dioxide-4H-1,2,4-benzo4dibishydroxy p-phenidene "3,2seven &gt; Biyodo-5 (4HVS the same The product of Example 269A (0.06 g, 0.13 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.011 ml, 0.26 mmol) at (TC, lithium borohydride in A 2.0M solution (0.10 ml, 0.2 mmol) in tetrahydrofuran was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, and the pH value was acidified to about 2_4 with 1M hydrochloric acid, and water was used. (10 ml) was diluted and the precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with 98: 2 dichloromethane / methanol to give the title compound. The sodium salt of the title compound was according to the example 89166 -464- 200427678 m. 1 H NMR (300 MHz, DMSO-d6) δ ppm 1.35 (m, 4H) 1 · 50 (m, 4H) 1.64 (m, 3H) 1.86 (m, 1H) 2.56 (m, 1H) 5.62 (d, J = 2.94 Hz, 1H) 7.12 (d, J = 5.52 Hz, 1H) 7.19 (d, J = 8.09 Hz, 1H) 7.26 (t, J = 7.54 Hz, 1H) 7.53 (m, 1H) 7.64 (d5 J = 7.72 Hz, 1H) 7.72 (d, J = 5.15 Hz, 1H) 15.92 (s, 1H). MS (ESI-) m / z 457 (M-Η) ··

Example 297A He- (1,1-di-emulsified-4H-1,2,4-benzo-p-dioxo-1-3-yl) -7-lightyl-4-{"3-methylcyclohexylene 1 Amino P thiophene "3,2_bl pyridine-5 (4HV ketone makes the product of Example 268D (0.054 g, 0.15 mmol) and 3-methylcyclohexanone (1.26 g, 11.25 mmol) In N, N-dimethylacetamide (1 ml), in a sealed tube at 135 ° C in a microwave reactor for 45 minutes. The reaction was cooled to 25 ° C and under vacuum Concentrated. The resulting residue was triturated with acetic acid (3 ml) and triturated to give the title compound.

Example 297B Dioxide-4H-1,2,4-benzyl-distoryl-3-ylfluorenyl-4. {"3-methylcyclohexylfluorenylamino V-spheno [3,2-bl -5 (4HV) The product of Example 269A (0.060 g, 0.13 mmol) in tetrahydrofuran ml) and methanol (0.011 ml, 0.26 mmol) in lithium hydrogen borohydride in tetrahydrofuran. The 2.0 M solution (0.1 ml, 0.20 mmol) was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, the pH was acidified to about 2-4 with 1 M hydrochloric acid, and water ( (10 ml), and the resulting precipitate was collected by drying and dried. The crude product was chromatographed on silica gel with 98-2 · dichloromethane / methanol to give the title compound. Sodium salt of the title compound Prepared according to the private sequence of Example 1D. 1 H NMR (300 MHz, DMSO-d ^) 5 ppm 0.86 (m, 4H) 1 08 (m 89166 -465-200427678 1H) 1.29 (m, 3H) L60 (m, 3H) 1.93 (m, 1H) 3.04 (m, 1Η) 5.76 (d, J = 3.31 Hz, 1H) 7.14 (d, J = 5.52 Hz, 1H) 7.19 (d, J = 8.46 Hz , 1H) 7.26 (t, J = 7.54 Hz, 1H) 7.52 (dt, J = 8.46, 1.47 Hz, 1H) 7.65 (d, J = 8.09 Hz, 1H) 7 · 73 (t, J = 5-15 Hz, 1H) 15.93 (s, 1H) · MS (ESI-) m / z 457 (M-Η) · ·

Example 298A 6- (1,1-Dioxide-4H-1,2,4-Benzene 4 Diphenyl_3_yl V7-fluorenyl-4-{"(3RV3-methylcyclohexylene 1 amine h CephenoΓ3,2-ΐ) 1pyridine-5 [4HV ketone produced the product of Example 268D (0.073 g, 0.2 mmol) and (3R) -3-methylcyclohexanone (U2 g, 10.0) Mmol) in N, N-dimethylacetamide (2 ml) in a sealed tube at 135 ° C in a microwave reactor for 45 minutes. Allow the reaction to cool to 25 ° C, And concentrated under vacuum. The resulting residue was triturated with ether (3 ml) and filtered to give the title compound.

Example 298B ML1 · Dioxide-4H_1,2,4_Morocene-4Dighen-3-yl V7-Hydroxy-4-Chuan 3RV3-methylcyclointer 1amino group pyrimido 『3,2-bl pyridine -5 (4HV ketone) The product of Example 269A (0.06 g, 0.13 mmol) was dissolved in tetrahydrofuran (6 ml) and methanol (0.011 ml, 0.26 mmol) at a temperature of 0.0 to A 2.0 M solution of lithium borohydride in tetrahydrofuran (0.1 ml, 0.2 mmol) was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, and the pH was acidified with 1 μ hydrochloric acid to Approximately 2-4 'was diluted with water (10 ml) and the precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with 98: 2 dichloromethane / methanol to give the title compound. Title The sodium salt of the compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) (5 ppm 0.86 (m, 4H) 1.08 (m, 1H) 1.29 (m5 3H) 1.60 (m5 3H) 1.93 (m5 1H) 3.04 (m5 1H) 5.76 (d? J = 3.31 Hz? 1H) 7.14 89166 -466- 200427678 (d, J = 5.52 Hz, 1H) 7.19 (d, J = 8.46 Hz, 1Η) 7 · 26 (t, J = 7.54 Hz, 1H) 7.52 (dt, J = 8.46, 1.47 Hz? 1H) 7.65 ((d, J = 8.09 Hz, 1H) 7.73 (t? J = 5.15 Hz? 1H) 15.93 (s, 1H). MS (ESI-) m / z 457 (M-H) _ ·

Example 299A 6- (1,1-Dioxide-4H_1,2,4-benzopyrimidin-3-yl M- "α-ethylpropylidene) amino 1-7- # group is pheno | 3,2-bl pyridine-5 (4HV ketone made the product of Example 268D (0_073 g, 0.2 mmol) and pentane_3_one (0.86 g, 10.0 mmol) at N, N-di Methylacetamide (2 ml) in a sealed tube at 135 ° C in a microwave reactor for 40 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The formed The residue was triturated with ether (3 ml) and filtered to give the title compound.

Example 299E MU_Dioxide-4Η-1,2,4-benzopyridine-3-yl V44 (l-ethoxypropyl) amino 1-7-carboxy farpheno | ~ 3,2 seven 1 Pyridine-5 (4HV ketone) The product of Example 269A (0.08 g, 0.18 mmol) was dissolved in tetrahydrocondensation (7 ml) and methanol (0.015 ml, 0.36 mmol) at 0.0% with boron A 2.0 M solution of lithium hydride in tetrahydrofuran (0.135 ml, 0.27 mmol) was treated dropwise. The reaction was shaken for 1 hour at 25 C. The pH was acidified to about 2-4 with 1 M hydrochloric acid, Dilute with water (10 ml) and collect the formed precipitate by filtration 'and dry. The crude product is chromatographed on silica gel with 98: 2 dichloromethane / methanol to give the title compound. Sodium of the title compound The salt was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 0.87 (m, 6H) 1.29 (m, 4H) 3.0 · 3 (m, 1H) 5.76 (d, J = 3.68 Hz, 1H) 7.12 (d, J = 5.52 Hz, 1H) 7.19 (d, J = 8.46 Hz, 1H) 7.26 (t, J = 6.99 Hz, 1H) 7.54 (m, 1H) 7.65 (m, 1H) d, J = 7.72 Hz, 1H) 89166 -467-200427678 7.74 (d, J = 5.15 Hz, 1H) 15.95 (s, 1H). MS (ESI-) m / z 431 (M-H) '

Example 300A iLl-dioxide-4H-1,2,4-benzopyrimidin-3_yl V7-hydroxyammonia ethylene 1 amino h thiophene "3.2-hl pyridine-5 (4HV ketone The product of Example 268D (0.073 g, 0.2 mmol) and 1-phenylethyl ketone (1.2 g, 10.0 mmol) were placed in N, N-dimethylacetamide (2 ml), In a sealed tube, react in a microwave reactor at 135 ° C for 75 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The resulting residue was triturated with ether (3 ml). And filtered 'to give the title compound.

Example 300B

M_U-Dioxide-4H-1,2,4-benzilopyrimidin-3-yl V7-hydroxy-4-m-mozine L even 1 Amino h thiophene "3,2-bl pyridine-5 (4HV ketone The product of Example 269A (0.046 g, 0.10 mmol) was dissolved in tetrahydrofuran (5 ml) and methanol (0.005 ml, 0.12 mmol) at 0 ° C with borohydride in tetrahydrofuran. The 2.0 M solution (0.06 ml, 0.12 mmol) was treated dropwise. The reaction was stirred at 25 ° C for 3 hours, and the pH was acidified with 1 M hydrochloric acid to about 2-4,0 water (10 ml ) Dilute and collect the formed precipitate by drying and drying. The crude product is chromatographed on silica gel with 99 ·· 1 dichloromethane / methanol to obtain the title compound. The sodium salt of the title compound is according to Example 1D. The program was made. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.26 (m, 3H) 4.49 (m, 1H) 5.90 (m, 1H) 7.20 (d, J = 8.09 Hz, 1H) 7.27 ( t, J = 8.46 Hz, 2H) 7.30 (m, 5H) 7.54 (m, 2H) 7.66 (d, J = 8.09 Hz, 1H) 15.93 (s, 1H) · MS (ESI-) m / z 465 (MH)-

Example 301A: Gasification-4Η-1 · 2 · 4-pyridobimorph-3-yl V7-hydroxymethylchizobutane 89166 -468-200427678 yl 1 amino group h thiophene "3,2-bl pyridine-5 ( 4HV ketone produced the product of Example 268D (0.073 g, 0.2 mmol) and pentane-2-one (0.9 g, 10.4 mmol) in N, N-dimethylacetamide (2 Ml), in a sealed tube at 135 ° C in a microwave reactor for 60 minutes. The reaction was cooled to 25 ° C and concentrated under vacuum. The resulting residue was ether (3 Ml) was triturated and filtered to give the title compound.

Example 301B ϋ1,1-Dioxide-4H-U, 4-Cyclopyrimidin-3-yl V7-Hydroxymethanbutin 1Amineh thiophene "3,2-bl pyridine-5 (4HV Ketone The product of Example 269A (0.070 g, 0.16 mmol) was dissolved in tetrahydrofuran (ml) and methanol (0.013 ml, 0.32 mmol) at 2.0 ° C with lithium borohydride in tetrahydrofuran. The M solution (0.12 ml, 0.24 mmol) was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, the pH was acidified to about 2-4 with 1 M hydrochloric acid, and diluted with water (10 ml). The precipitates formed were collected by filtration and dried. The crude product was chromatographed on silica gel with 99: 1 dichloromethane / methanol to obtain the title compound. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) (5 ppm 0.87 (m, 6H) 1.30 (m, 4H) 3.25 (m, 1H) 5.74 (d, J = 3.68 Hz, 1H) 7.13 (d , J = 5.15 Hz, 1H) 7.19 (d, J = 8.09 Hz, 1H) 7.26 (t, J = 7.54 Hz, 1H) 7.54 (dd, J = 8.09, 1.47 Hz, 1H) 7.65 ( d, J = 7.72 Hz5 1H) 7.73 (d, J = 5.52 Hz, 1H) 15.94 (s? 1H). MS (ESI-) m / z 431 (MH)-.

Example 303A 丙基 propyl methylene 1 amino group V6- (U_dioxide-4H-1,2,4-benzo 4 diphenyl-3-yl) -7-hydroxypyrimidine # f3,2_bl pyridine-5 (4HV ketone 89166 -469- 200427678 The product of Example 268D (0.15 g, 0.41 mmol) and cis-propanecarboxylic acid (ι0 g, 14 mmol) were added at N, N-dimethyl Acetamide (3 ml) was reacted in a sealed tube at 120 ° C in a microwave reactor for 90 minutes. The reaction was cooled to 25 ° C 'and concentrated under real cheese. The formed The residue was triturated with diethyl ether and filtered to give the title compound (0.104 g, 60%).

Example 303B Raw-Γ (cyclopropylmethyl) amino 1-6- (1,1-dioxide_4Η-1,2,4-benzylidene di-p-well_3_some V7-hydroxy 4pheno "3,2-bl pyridine-5 (4HV ketone) The product of Example 269A (0.104 g, 0.25 mmol) was dissolved in tetrahydrofuran (4 ml) and methanol (0.020 ml, 0.5 mmol) at (TC It was treated dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.200 ml, 0.4 mmol). The reaction was stirred at 25 ° C for 1 hour and acidified with 1 M hydrochloric acid to a pH of about 2- 4. Dilute with water (20 ml) and collect the precipitate formed by filtration 'and dry. The crude product is chromatographed on silica gel with 1% methanol in chloroform to give the title compound. Sodium salt of the title compound Prepared according to the procedure of Example 1D. 1HNMR (300 MHz, DMSO-d6) (5 ppm 0.06 (m, 2H) 0.36 (m, 2H) 0.96 (m, 1H) 2.92 (d, J = 6.99 Hz, 2H) 6 · 75 (s, 1H) 7.53 (d, J = 5.52 Hz, 1H) 7.55 (m, 1H) 7.63 (d, J = 8.09 Hz, 1H) 7.77 (m, 1H) 7.92 ( d, J = 7.72 Hz, 1H) 8.33 (d, J = 5.52 Hz? 1H) 14.19 (s5 1H) 14.82 (s5 1H). MS (ESI-) m / z 415 (MH) '.

Example 304A. Gas-based) · 2-Fluorine, a small perylene, 3-fluorofluoro-4-nitro (10 g, 0.064 mole), benzyl bromide (8.3 ml, 0.070 mole), and cesium carbonate ( 22.7 g, 0.07 mole) and tetrabutylammonium iodide (0.05 g) in N, N-dimethylamidamine (100 ml) were reacted at 25 ° C for 18 hours. Pour 89166-470-200427678 reaction mixture into distilled water (500 ml) and stir for 10 minutes. The reaction mixture was extracted with ethyl acetate (3 × 200 ml). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and removed under reduced pressure to give the title compound as a pale yellow solid (15 g). lHNMR (300 MHz, DMSO-d6) 5 ppm 5.27 (s? 2H) 7.06 (dd? J = 9.56, 2.57 Hz? 1H) 7.29 (dd5 J = 13.60, 2.57 Hz, m) 7.44 (m, 5H) 8.17 (t, J = 9 · 19 Hz, 1H) ESI —: 248 Examples of ethoxyl-2--2- (sulfur) will be the product of Example 304A (15 g '0.061 mole) in ethanol (1 (00 ml), treated with sodium carbonate (6.41 g, 0.061 mole) and thiol (7.5 ml, 0.0058 mole) in water (50 ml). The reaction mixture was refluxed 5 Hours, cooled to 25 ° C. and poured into distilled water (800 ml). The resulting slurry was stirred at 25 ° C. for 1 hour and filtered. The formed yellow solid was washed with water and placed in a vacuum oven. Drying at 5 ° C to give the title compound (20.53 g). 1H NMR (300 MHz? DMSO-d6) δ ppm 4.35 (s5 2H) 5.27 (s? 2H) 7.02 (dd? J = 9.19, 2.57 Hz, 1H) 7.16 (d, J = 2.57 Hz, 1H) 7.40 (m, 10H) 8.24 (d, J = 9.19 Hz, lH) .ESIm / z (M + H) +: 352

Example 304C M benzyloxy V2-nitrobenzidinesulfonamide. A slurry of the product of Example 304B (5 g, 0.004 mol) in glacial acetic acid (50 ml) and water (5.5 ml) was used. At 0 ° C, foam with chlorine for 10 minutes and stir for another 30-45 minutes. The reaction mixture was poured into ice water (200 g), stirred for 30 minutes, and extracted with dichloromethane (2 × 100 ml). The combined dichloromethane extracts 89166 -471-200427678 were cooled to about% in an ice bath, and concentrated aqueous solution of hydrogen hydroxide (40¾ liters) was added slowly, and when ammonia was added, it caused foaming and foaming. After 30 minutes, remove the organic layer and remove the organic layer with a knife, and extract the aqueous layer with dichloromethane (100 ml). The combined organic extracts were washed with phosphoric acid (50 ml), water, dried over anhydrous magnesium sulfate, filtered, and the solvent was removed under reduced pressure to obtain the title compound 'as a white solid (3.85 g). lHNMR (300MHz, DMs〇d6) (5 ppm 5.28 (s, 2H) 7.44 (m, 6H) 7.63 (d, J = 2.94 Hz, 1H) 7.79 (s, 2H) 8.01 (d, J = 8.82 Hz5 1H). ESI m / z (M + H) + 309. Example 304D Amino_5- (Word oxygen) stupid g steamed face will be the product of Example 304C (3.85 g, 0.0125 mol) with iron powder (4.3 grams, 0.077 moles, 6.15 equivalents) and ammonium chloride (4.4 grams, 0.082 moles), treated in methanol (100 ml) and water (50 haL), and refluxed It was stirred for 1 hour. The hot reaction mixture was filtered through a grooved filter paper and washed with hot methanol. The filtrate was concentrated under reduced pressure to a white semi-solid, which was subjected to liquid separation between ethyl acetate and water. Organic The layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and the solvent was removed under reduced pressure to give the title compound as an off-white solid (2.5 g). 1H NMR (300 MHz, DMSO-d6) 5 ppm 4.98 ( s, 2Η) 5.46 (s, 2Η) 6.76 (d, J = 8.82 Hz, 1H) 7.01 (dd, J = 8.82, 2.94 Hz, 1H) 7.21 (d, J = 2.94 Hz, 1H) 7.23 (s 2H) 7.37 (m? 5H). ESI m / z (M + H) +279. ESI m / z (MH) '277.

Example 304E 1-Yue Anji Yue Anji Jiyingyingji) -4- (Yuqiyl) phenyl 1-4-Chenyl-2- 酉 Same as -1.2 · Dihydrokou quinine-3- Forsamin amine reacted the product of Example 304D (4.0 g, 14.37 mmol) with Example 226C (2.42 g of 89166 -472- 200427678, 7.20 mmol) in toluene (50 ml) at 118 ° C. 4 hour. The mixture was filtered while still warm and the solid was dried to give the title compound (3.13 g, 90%). MS HNMR (300 MHz, DMSO-d6) (5 ppm 5.20 (s, 2H) 5.76 (s, 2H) 7.40 (m, 10H) 7.84 (m, 2H) 8.02 (d, J '8_46 Hz, lH) 8_10 (dd, J = 8.09, 1.47 Hz, 1H) 12.31 (s, 1H) 16.41 (s, 1H).

Example 304F 1-Amino-3- "7- (fluorenyl M, l-digasification-4H-1,2,4-benzilopyrimidin-3-yl V4- (1) ketone The product of Example 304E (3.13 g, 6.51 mmol) was suspended in a 10% potassium hydroxide solution (50 ml), heated at 125 ° C for 24 hours, and then at 140 ° C for 24 hours. Hour. The mixture was poured into ice and 1M hydrochloric acid, filtered, and dried to give the title compound (2.03 g, 67%). MS (ESI-) m / z 461 (Μ-Η) -1H NMR (300 ΜΗζ, DMSO-d6) 5 ppm 5.18 (s, 2Η) 5.33 (s, 2Η) 7.06 (m, 1Η) 7.25 (m, 3Η) 7.43 (m, 6H) 7.69 (d, J = 7.72 Hz, 1H ) 8.06 (d, J = 8.09 Hz, 1H) 16.31 (s5 1H).

Example 304G 卞 Milk-based dioxygen-4H-1,2,4-benzyl-dihex-3-yl &quot; | -1- (Cyclobutylmonoaminohydroxyquinoline-2 (1HV ketone makes Example 304F The product (0-285 g, 0.62 mmol) was sealed in N, N-dimethylacetamide (1.5 ml) with cyclobutanone (0.85 ml, 10.9 mmol) In the tube, react in a microwave reactor at 130 ° C for 45 minutes. The reactants were cooled to 25 ° C, concentrated under a stream of nitrogen warmed by a manifold heated to 165 ° C, and The resulting residue was triturated with diethyl ether to give the title compound (0178 g, 56%).

Example 304H 89166 -473-200427678 HH fluorenyloxyl> 1 upper lice% di 4H-1,2,4-benzene-pyrimidine two _3_ on the base 2_ (cyclobutanamine V4- and some 4 Say -2 (1HVS is the same as the product of Example 304G (0.178 g, 0.35 mmol) in tetrahydrofuran (3 ml), treated with methanol (0.025 ml, 0.70 mmol) at 0 C, and then dropwise addition of boron A 20M solution of lithium hydride in tetrahydrofuran (0260 ml, 0.52 hamol) was stirred at 25 ° C for one hour and diluted with 1N Ηα. The precipitate formed was filtered and dried. The solid was dissolved It was dissolved in tetrahydrofuran and evaporated to dryness and absorbed on silica gel. The formed silica gel was packed on 2 g of Alltechseppack and dissolved in dichloromethane to give the title compound (0.059 g, 33%). MS ( ESI-) m / z 515 (MH) · 1H NMR (300 MHz, DMSO-d6) 5 ppm 1.55 (m, 1H) 1.71 (m, 1H) 2.04 (m, 4H) 3.77 (m, 1H) 5.26 (s, 2H) 6.57 (d, J = 5.15 Hz, 1H) 7.45 (m, 8H) 7.64 (d, J = 9.56 Hz, 1H) 7.88 (m, 1H) 8.05 (d, J = 8.46 Hz, 1H ) 8.17 (m5 1H). Example 3041 Cyclobutylamino M- 3- (7-Hydroxy-1,1 · Dioxide-4H-1.2.4-benzilopyrimidin-3-yl> mantleline_2 (lHVi same as the product of Example 304H (0.059 g, 0.11 mmol) Mol) was reacted with platinum oxide (50 mg) in tetrahydrofuran (4 ml) under hydrogen atmosphere at 25 ° C for 20 hours. The catalyst was filtered off and the filtrate was evaporated to give the title compound (0.048 g, 100% ) 0 MS (ESI-) m / z 425 (M-Η) '.

Example 304J 2-({3-``1- (Cyclobutylamino V4-hydroxy-2-keto_1,2-dihan, 崦 4--3-yl 1-1,1-_dioxide-4Η 1,1,2,4-benzopyrimidin-7-yl} hydrogen, acetamidinate so that the product of Example 3041 (0.048 g, 0.11 mmol) was in N, N-dimethylformamidine 89166 -474- 200427678 amine (2 mL) with cesium carbonate (0.15 g, 0.45 mmol), ethamidine bromide (0.026 mL '0.18 mmol) and catalytic amounts of tetrabutylammonium iodide The reaction was performed at 25 ° C for 3 hours. The reaction was concentrated under a stream of nitrogen heated by a manifold heated to 165 ° C, and the formed residue was triturated with water, filtered, and dried. The solid formed was triturated from ethyl acetate, filtered, and dried to give the title compound (0.020 g, 37%). MS (ESI-) m / z 482 (MH)-· 1H NMR (300 MHz, DMSO-d6 ) 5 ppm 1.59 (m, 2Η) 1.99 (m, 4Η) 3.60 (m, 1Η) 4.49 (s, 2H) 6.08 (d, J = 6.62 Hz, 1H) 7.05 (t, J = 7.17 Hz , 1H) 7.20 (m, 3H) 7.40 (s, 1H) 7.50 (m, 1H) 7.65 (m, 2H) 8.05 (d, J = 7_72 Hz, 1H) 16.25 (s, 1H). sodium Made according to the procedure of the example ID. 1HNMR (300MHz, DMSα d6) δ ppml.59 (m5 1H) 1.99 (m5 4H) 3.61 (m5 2H) 4.49 (s5 2H) 6.08 (d5 J = 6.62 Hz, 1H ) 7.05 (m, 1H) 7.21 (m, 2H) 7.40 (s, 2H) 7.50 (m, 1H) 7.64 (m, 2H) 8.06 (dd, J = 7.91, 1.29 Hz, 1H) 8.32 (s, 1H) ·

Example 305A 3- "7- (Ethyloxy) -l, l-dioxo-4H-1,2,4-benzo-p-dihex-3-yl-1-(cyclopentylamino) V4 -Hydroxy4line_2 (1HV ketone made the 304F sense product (0.284 g, 0.61 mmol)) with cyclopentanone (0.80 ml, 9.04 mmol) in N, N-dimethylacetamide (2 ml) at 130 ° C in a microwave reactor in a sealed tube for 40 minutes. The reactants were concentrated under a stream of warm nitrogen gas passing through a manifold heated to 165 ° C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.210 g, 65%). 1H NMR (300 MHz, DMSO-d6) 5 ppm 1.72 (m, 2H) 1.87 (m, 2H) 2.16 ( m, 2H) 2.71 (m, 2H) 5.18 (s, 2H) 7.31 (m, 11H) 8.10 (d, J = 8.46 Hz, 1H) 16.22 (s, 1H). 89166 -475-200427678

Example 305B Oxygen dioxide-4H-1,2,4-benzopyrimidinium-3-a certain hydrazone-w is formed into an amine V4-hydroxy4 morpholine-2 (1HV ketone makes the product of Example 305A (0.21 g 0,40 mmol) in tetrahydrofuran (3 ml) and methanol (0.030 ml) at 0 ° C with lithium borohydride (2.0 M solution in tetrahydrofuran, 0.30 ml, 0.60 mmol) ) Reaction. The reaction was stirred at 25 ° C. for 1 hour, then diluted with a 1 M aqueous hydrochloric acid solution, and filtered. The product was dissolved in tetrahydrofuran, adsorbed on silica gel, packed on 2 grams of Alltech Sep-pack, and It was purified by dissociation with dichloromethane. The filtrate was evaporated to dryness under reduced pressure to give the title compound (0.124 g, 59%). 1HNMR (300 MHz, DMSO-d6) δ ppm 1.54 (m? 4H) 1.79 (m3 2H) 2.55 (m? 2H) 3.94 (m, 1H) 5.26 (s, 2H) 6.23 (m, J = 6.99, 4.04 Hz, 1H) 7.43 (m, 8H) 7.69 (d, J = 6.99 Hz, 1H) 7.87 (m, 1H) 8.09 (d, J = 8.09 Hz, 1H) 8.16 (d, J = 6.62 Hz, 1H) 14.08 (s, 1H) 15.18 (s, 1H).

Example 305C 1- (Cyclopentylamino V4-Hydroxy-3- (7-Hydroxy-U-Digas-4H-1.2.4-Benzopyrimidin. -3-yl &gt; quinoline-2 ( 1HV ketone made the product of Example 305B (0.122 g, 0.23 mmol) in tetrahydrofuran (15 ml) with a catalytic amount of palladium hydroxide / carbon, a catalytic amount of 5% palladium / carbon and ammonium formate (0.080 g , 1-27 mol), and reacted at 60 ° C for 2 hours. The warm reaction mixture was filtered through celite, and the filtrate was evaporated under reduced pressure to give the title compound (0.10 g, 100%). MS (ESI- ) m / z 439 (M_H)-. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.54 (m? 4H) 1.78 (m, J = 2.94 Hz5 2H) 2.58 (m? 2H) 3.91 (m, 1H) 6.25 (m, 1H) 7.13 (m, 2H) 7.45 (m, 1H) 7.54 (d, J = 9.19 Hz, 1H) 7.85 89166 -476- 200427678 (m, 1Η) 8.12 (m, 2H) 10.45 (s, 1H) 14.00 (s, 1H) 15.25 (s, 1H).

Example 305D 2-({3-``K Cyclopentylamino V4_ and a certain 2-keto-1,2-dij.pyridin-3-yl 1-U-digasified-4H-1, 2,4-benzopyrimidin-7-yl} a "r" _amine gives the product of Example 305C (0.10 g, 0.23 mmol) and cesium carbonate (0.30 g, 0.92 mmol), Ethyl bromide (0.050 g, 0.37 mmol) and a catalytic amount of tetrabutylammonium in N, N-dimethylformamide (5 ml) were reacted at 25 ° C for 2 hours. The reaction was concentrated to half the volume under a stream of nitrogen warmed by a manifold heated to 165 ° C. The resulting solution was diluted with water, and the precipitate was collected by filtration and dried to give the title compound (0095 g, 85%). The sodium salt of MS (ESI-) m / z 496 (M-Η) 'title compound was prepared according to the procedure of Example ID. 1 H NMR (500 MHz, DMSO-d6) (5 ppm 1.52 (m5 6H) L76 (m, 2H) 3.70 (m, 1H) 4.47 (s5 2H) 5.68 (d, J = 4.88 Hz, 1H) 7.03 (t, J = 7_63 Hz, 1H) 7.20 (m, 5H) 7.46 (t, J = 7.32 Hz, 1H) 7.70 (d, J = 8.54 Hz, 1H) 8.06 (d, J = 7.32 Hz, 1H ) 16.15 (s, 1H).

Example 306A Benzopyridylcyclohexyl aperityl) 4-hydroxyquinoline-2 (lHVi is the same as the title compound was prepared according to the procedure described in Example 304G, replacing cyclobutanone with cyclohexanone.

Example 306B Benzopyridine-Ethylpyridine-crypthexylamine) Ice # Ricyl 4Lin-2 (1 HV Xisong title compound was prepared according to the procedure described in Example 304H, using 89166-477-200427678 of Example 306A The product was replaced by the product of Example 304G (0.11 g, 78%) °

Example 306C Cyclohexylamino) -4-meryl-3- (7-¾yl_1,1_di-emulsified_4H-1,2,4-dongno? Said a well, 3-based) quinine The 2 (1H) -one title compound was prepared according to the procedure of Example 305C, replacing the product of Example 305B with the product of Example 306B (39 mg, 42%).

Example 306D 2-((3-``1'cyclohexylamino V4-hydroxyaspartone-1,2-dihydrazino-4-olin-3-yl 1-U-dihydrazone-4'1,2,4-benzo 4 Erqian-7-tomb} Qi a) Acetamide made the product of Example 306C (13 mg, 0.028 mmol) in N, N-dimethylformamide (5 ml), and cesium carbonate (0.0137 G, 0.114 mole) and 2.bromoacetamide (0.08 g, 0.058 mmol), and reacted according to the procedure described in Example 304J to obtain the title compound. The sodium salt was prepared according to the procedure of Example 1D (7 mg, 48%). 1H NMR (300 MHz, DMSO-d6) 5 ppm 1.36 (m5 10Η) 2.96 (bs, 1H) 4.49 (s, 2H) 5.67 (d, J = 4.04 Hz, 1H) 7.04 (t, J = 7.54 Hz, 1H) 7.20 (m, 3H) 7.40 (s, 1H) 7.47 (m, 1H) 7.62 (s5 1H) 7.74 (d, J = 8.46 Hz, 1H) 8 · 05 (d, J = 6.62 Hz, 1H) 16.26 (s, 1H) · (ESI-) m / z 510 (M-Η) ·, m / z 532 (M + Na-H). · Example 307 1K2- Chloro-1,3-disylmethyl 1J7- and a certain 6_ (7_hydroxy_u dioxide-4H-pyridine 4-benzobenzo-7-A-3-yl V pheneno [3,2VII 1 pyridine-5 (4HV ketone

Example 307A IHy-oxyl VU-glyoxylan 4H_U, 4_benzo4 two farming groups] The title compound of ethyl acetate was substituted with the product of Example 30D according to the procedure of Example 1C. Made of amine. 89166 200427678

Example 307R (7-Hydroxy-1,1-isopropylamine_3 ·) ethyl acetate The product of Example 307A (1.42 g, 3.79 mmol) was dissolved in tetrahydrofuran (60 ml) with ί% palladium / Carbon (0.2 g) was reacted in the hydrogen atmosphere and under the pit for 16 hours. The reaction mixture was filtered and concentrated to an oil under reduced pressure. The residue was purified on silica gel and dissolved with ethyl acetate to give the title compound as a white solid (0.8 g).

Example 307C 11.1-Dioxo-7-"((triisopropylsilyl) oxy-1_4"], 2,4_benzopyrimidin_3_yl 丨 ethyl acetate makes the product of Example 307B (0.1 g, 0.352 Mol) with 2,6-dimethylpyridine (0.045 liters '0.387 mol) and triisopropyl trifluoromethane triisopropyl ester (〇1mL' 0.387 4: mol) in dichloromethane ( (10 ml), reacted at 5.0 for 3 hours. The reaction was diluted with dichloromethane and extracted with 1 N phosphoric acid aqueous solution. The organic layer was washed with brine and dried over anhydrous magnesium sulfate, filtered, And concentrated under reduced pressure to give the title compound as a pale yellow solid (0.13 g, 84%).

Example 307D 4-"(2-Chloro-U-pyrazol_5_yl) methyll-6-Π, l-digas-7-7I triisopropylsilane 1,2,4-Benzothiine_3_yl 丨 _7_hydroxypyrimido "3,2-bl pyridine-5 (4HV ketone title compound was replaced by the product of Example 140A according to the procedure of Example 1D The product of Example 1B and the product of Example 307C were substituted for the product of Example 1C (0.29 g, 66%). MS (ESI-) m / z 649 (MH) · 1H NMR (300 MHz, DMSO- d6) 5 ppm 1.09 (d? J = 7.35 Hz? 18H) 1.28 (m5 3H) 5.63 (s5 2H) 7.22 (d5 89166 -479-200427678 J = 2.57 Hz, 1Η) 7.31 (dd, J = 8.82, 2 · 94 Hz, 1H) 7.65 (d, J = 8.82 Hz, 1H) 7.86 (d, J = 5.52 Hz, 1H) 7.95 (s, 1H) 8.42 (d, J = 5.52 Hz, 1H) 14.05 (s, 1H) 14.96 (s, 1H) ·

Example 307E 44 (2-Chloro-1,3-pyrazol-5-yl) methyl 1-7-hydroxy-6-Γ7-hydroxy-1,1-digasification_4H-U, 4-mobenzo Pyridinoline-3-yl) pyrimido | ~ 3,2-bl pyridine-5 (4HV ketone makes the product of Example 307D (0.235 g 0.36 mmol) in tetrahydrofuran (10 ml) and fluorine in tetrahydrofuran Tetrabutylammonium (1M, 0.43 ml) was reacted at 25 ° C for 2 hours. The reaction mixture was diluted with water (50 ml), adjusted to pH 2 with 1 M HC1, and extracted with ethyl acetate. The organic layer was concentrated under reduced pressure to obtain the title compound (0.15 g, 84%). MS (ESI-) m / z 493 (MH) — The sodium salt of the title compound was prepared according to the procedure of Example ID. IHNMRpOOMHz, DMSO-d6) 5 ppm 5.63 (s, 2H) 7.17 (s51H) 7.20 (d? J = 2.57 Hz, 1H) 7.57 (d, J = 8.82 Hz? 1H) 7.85 (d? J = 5.52 Hz? 1H) 7.95 (s? 1H) 8.42 (d5 J = 5.15 Hz5 1H) 10.42 (s, 1H) 13.95 (s, 1H) 15.10 (s, 1H). Example 308 M3- {4- 「C2_ 气 墓 -1,3- p-sedazole-5_yl) methyl V7_hydroxy-1-5-keto-1.4.5-thienylpyrido "3,2-blpyridin-6-yl 丨 -1,1-digasified-4H- 1,2,4-Benzo-4-diphenyl-7-yl) oxyl ethylamine The product (0.065 g, 0.13 mmol) was in N, N-dimethylformamide (5 ml) with cesium carbonate (0.171 g, 0.53 mmol) and 2-bromoacetamide (0.036 G, 0.26 mmol), and reacted at 25 ° C for 24 hours. The reaction mixture was diluted with water and the precipitate formed was collected by filtration to give the title compound (0.036 g, 50%). MS ( ESI-) m / Z550 (MH)-· Sodium of the title compound 89166 -480- 200427678 The salt was prepared according to the procedure of Example ID. IHNMR (300MHz, DMSO-d6) 6 ppm 4.60 (s, 2H) 5.63 ( s, 2H) 7.38 (t, J = 2.21 Hz, 1H) 7.42 (d, J = 2.94 Hz, 1H) 7.44 (s5 1H) 7.69 (d5 J = 8.46 Hz? 1H) 7.66 (s? 1H ) 7.85 (d5 J = 5.52 Hz? 1H) 7.95 (s, 1H) 8.42 (d, J = 5.52 Hz, 1H) 14.04 (s, 1H) 14.99 (s, 1H) ·

Example 309A The compound of the same title as 1-fluorenyl-4_year-old cylin-2-phosphonium is based on the formulae described in D.R. Buckle, BC Cantello, H. Smith, BA Spicer. Produced by the procedure described in Wind 726-732 (1975). Example 309B 1-fluorenyl groups (bis-methylthio-methylene VlH-p quinoline-2,4-dione) Sodium hydride (0.75 g, 16 mmol) was added to Ν, Ν-dimethyl A suspension in methylformamide (20 ml) was added to the product of Example 309A (2 g, 7.97 mmol) in N, N-dimethylformamide at 0 ° C over 30 minutes. (30 ml) of the solution. Warm the red-orange mixture to 25 ° C and stir for 30 minutes as it develops purple. Then, the reaction is heated at 50 ° C for 2 hours and cooled to 25 ° C. Over 30 minutes. Carbon disulfide (1.13 ml, 16 mmol) was added to the mixture. The mixture was heated at 50 ° C for 2 hours (to develop a reddish brown color) and cooled to 25 ° C. Methane iodide was added (1.2 mL, 16 mmol), and the reaction was stirred for 30 minutes at 25 ° C. The reaction was quenched with phosphate buffer (10 mL, pH = 7), and the reaction was concentrated under reduced pressure. The residue was triturated with a phosphate buffer pH 7 and ethyl acetate / hexane (1: 1), and the orange solid formed was collected by filtration, washed with hexane, and dried under reduced pressure, and Get Title compound (1.76 g, 62%). 1H NMR (300 MHz, CDC13) 6 ppm 2.65 (s5 6H) 5.43 (s5 2H) 7.06 (d, J = 8.46 Hz, 1H) 7.14 (m, 1H) 7_28 (m, 5H) 7 · 43 (m, 1H) 8 · 24 (dd, 89166 -481- 200427678 J = 7.72, 1.47Ηζ, 1H).

Example 309C (Sulfur, V54, Phenyl-3 · carboxylic acid methyl ester The title compound was prepared according to the procedure as described in Stanetty P. et al., Guanhuan Yunxueguang Office, 36, 761-765 (1999) production.

Example 309D 4- (Sulfur sulfur V5-sulfonyl phen-3-yl 1 methanol) The product of Example 309C (5 g, 16.2 mmol) was dissolved in dichloromethane (150 ml) at -40 ° C. Then, it was reacted with diisobutylaluminum trioxide (1M, 36ml, 2.2eq) in dichloromethane added dropwise. After the addition was completed, the reaction was stirred for 15 minutes to 10% potassium sodium tartrate. The solution quenched the reaction and stirred at 25 ° C for 1 hour. The organic layer was separated, filtered through Celite® (diatomaceous earth), and the filtrate was concentrated under reduced pressure. The formed oil was quenched on silica gel. Chromatography, purification on a Biotage-40s column, and dissociation with 2:98 methanol / dichloromethane gave the title compound as an oil (4.32 g, 95%). 1H NMR (300 MHz, CDC13) 5 ppm 4.21 (s, 2H), 4.39 (s, 2H), 7.11 (m, 3H), 7.23 (m, 2H), 7.40 (s, 1H).

-Example 309E 3- (octylthio V4-IY methylaminomethoxy) methyl 1- 2-nitrophene The product of Example 309D (3.9 g, 13.9 mmol) in dichloromethane (8 ml ), And react with diisopropylethylamine (7.42 ml, 3 eq) and methoxymethane chloride (2.38 ml, 2.25 eq) at 25 ° C for 16 hours. The reaction was concentrated under reduced pressure, and the residue was purified by flash chromatography on silica gel using a Biotage-40m column and dissolved in dichloromethane to give the title compound as a yellowish oil (4.32 g, 94% ). iHNMRpOOMH ^ CDCls) 5PPm3.36 (s, 3H), 4.20 (S, 2H), 89166 -482- 200427678 4.34 (s3 2H) 5 4.62 (s5 2H), 7.13 3H)? Ί1χ ^? 4〇 (s? m )

Example 309F) Methyl 1- 2-tetrakisphene-3-sulfanilamide The product of Example 309E (4 g, 12.3 mmol) in methylene chloride (70 ml) and 1 N aqueous hydrochloric acid (35 ml), under which it reacted with slowly foaming chlorine gas over a period of 0.5 hours, and then stirred for another 1 hour. The reaction mixture was purged with nitrogen 'to remove excess chlorine, and treated with solid sodium bisulfite (1 g) slowly added to the mixture, and stirred for 5 minutes. Dichloromethane (15 ml) and water (15 ml) were added, and the organic layer was separated and dissolved by 40 g of a 50:50 mixture of MgS04 / NaJO4. The filtrate was concentrated under reduced pressure. A solution of the concentrate (4.7 g) in a mouse-crust (100 ml) was bubbled with ammonia gas at _40 ° C for a period of 10 minutes. The reaction mixture was stirred for another 15 minutes, purged with nitrogen gas to dissipate excess ammonia, and concentrated under reduced pressure. The concentrate was purified by flash chromatography on silica gel using a Biotage-40s column and dissolved in 5:95 methanol / chloroform to obtain the title compound as an oil (2.3 g, 66%) . 1H NMR (300 MHz, CDC13) 5 ppm 3.31 (m, 3Η), 4.70 (s, 2Η), 4.73 (s, 2Η), 7.85 (m, 2H), 7.8S (s, 1H).

Example 309G 2-Amino-4-"[methylhydrogen methoxy) methyl 1pyrimidine-3-sulfonamide The product of Example 309F (1.8 g, 6.4 mmol) and iron powder (1.43 G, 4 eq.) In acetic acid (70 ml), reacted at 50 ° C for 7.5 hours, and then concentrated under reduced pressure. The residue was filtered through silica gel (20 g) in 5% methanol / dichloromethane (60%). Ml) and water (6 ml) and further rinsed with 5% methanol / dichloromethane (300 ml). The filtrate was concentrated under reduced pressure and the residue was concentrated on gelatin 89166 -483 -200427678 Purification by flash chromatography, using Biotage-12s column, 2.5: 97.5 methanol: dichloromethane to dissolve the title compound (1 g, 62%). IHNMR (300 MHz, DMSO-d6) 6 ppm 3.30 (s, 3H), 4.53 (s, 2H), 4.66 (s, 2H), 6.28 (s, 1H), 6.61 (s, 2H) 5 6.94 (s5 2H).

Example 309H Imidino-4-hydroxy-3- {7-"((methyla certain methylhydro)) methyl digasified-4H-P pheno [2 &gt; elH, 2,41 pyrimidine-3-yl V quinoline-2 (1HV ketone made the product of Example 309G (35 mg, 0.14 mmol) and the product of Example 309B (50 mg, 0.14 mmol) in toluene (3 ml) at i (3 hours reaction at TC. The precipitate formed was collected by filtration and washed with toluene and ether to obtain the title compound (52 mg, 73.3%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. iHNMR (300MHz, DMSO-d6) 6ppm 3.26 (s, 3H), 4.65 (s, 2H), 4.72 (s, 2H), 5.62 (s, 2H), 7.28 (m, 7H), 7.43 (s, 2H), 7.51 (d, J = 8.09 Hz, 1H), 7.75 (m, 1H), 8.22 (d, J = 8.09 Hz, 1H) _ Example 310 j-benzylglacial hydroxyl_ H7_ (After M, l_digasification, 4Η-4 pheno, "2 · 3〇Ί · 241-Lu Ergeng's &gt; Isoline-2 (lHVi same as the product of Example 309H (46 mg, 〇0909mol) in 61 ^ hydrochloric acid aqueous solution (2.5 ml) and tetrahydrofuran (5 ml) suspension at 70 t: heating for 4 hours, cooling to 25 C, and in the room Let stand for 18 hours at a temperature. The precipitate formed was collected by filtration and washed with water and diethyl ether to obtain the title compound (39 mg, 92.8%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. Ihnmr (300 MHz? DMSO-d6) 5 ppm 4.63 (s5 2H) 5 5.62 (s? 2H) 5 7.31 (m5 6H), 7.41 (t? J = 7.72 Hz, 1H), 7.53 (d, Bu 8.46 Hz , 1H), 7.76 (t, Bu 7.91 Hz, 1H), 8.22 (dd, 89166 -484- 200427678 J = 8.09, 1.47 Hz, 1H).

Example 311A Chlorobiphene-2-sulfamethoxam The compound is prepared according to the procedure described in Unterhalt, B, Moghaddam, S. 1994, Act 115-117.

Example 311B _3. Azido.N. (Third-butyl V5-pyrimidine-2-sulfonamide) Example 311A (1.01 g, 3.99 mmol) was added in tetrahydrofuran (32 (ML) in the / valley solution at -78 ° C to dropwise add a second -β · (ι · 4 Μ, in hexane, 2 1 equivalent) treatment. Warm the reaction to -20 ° C, After stirring for 30 minutes, it was treated with a solution of toluene difluorenyl azide (1.1 equivalents) in tetrahydrosulfan (7 ml) at -20 ° C, and stirred at 25 ° C for 18 hours. The reaction mixture was quenched and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by column chromatography on silica gel with 30 in hexane. A gradient of% dichloromethane to 100% dichloromethane was dissolved to give an approximately 2.1 mixture of the starting material to the title compound.

Example 311C 3-Monthyl-5-Gas-N-isopropyl p-phene-2-phen 1 blue moon tincture The product of Example 311B (0.739 g) in toluene (20 ml) and hexadecyl tributyl A solution of the bromide scale (0.128 g, 0.25 mmol) was treated dropwise with a solution of sodium borohydride (0.109 g, 2.9 mmol) in water (0.80 ml) at 0 ° C. . The reaction was stirred at 25 ° C for 18 hours and at 5 ° C for 72 hours. The reaction was extracted with ethyl acetate. The organic layer was washed with a 1 N aqueous solution of sodium hydroxide, water, and brine, and then dehydrated and dried over anhydrous sodium sulfate and concentrated. The 89166 -485-200427678 residue was purified by column chromatography on silica gel, and the gradient was dissolved in a gradient of 1: hexane / dichloromethane to 100 / chloroform to obtain the title compound (0.2% g, %) ° 1H NMR (300 MHz, CDC13) 5 ppm 6.36 (s? 1H) 4.93 (br s? 2H) 4.60 (br s? 1H) 1.30 (s, 9H).

Example 311D

Mg group-5-chloro, propyl 4 phensulfonium triazine_ 瞵 The product of Example 311C (0.0998 g) was trifluoroacetic acid (3.9 ml) and stirred at 25 C for 18 hours. The reaction was concentrated under reduced pressure and azeotroped twice with ethyl acetate 'to give the title compound as a trifluoroacetate salt (0 160 g). 1hnmr (300 MHz, CDC13) 5 ppm 6.41 (s? 1H) 5.22 (br s5 2H) 4.84 (br s5 2H).

Example 311E The group 3- (6-chloro-l, l-dioxide · 4Η_ 峻 phenopyrimidine_3_yl) · Bodyl 4 phthalate · 2 (1Ην Ketone title compound is according to the procedure of Example 309Η The product of Example 311D was used in place of the product of Example 309G and was prepared in the presence of diisopropylethylamine (3 equivalents). The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300MHz, DMSO-d6) δ ppm 16.97 (s51Η) 8.11 (d5 J = 8.09 Hz, 1Η) 7.20 (m5 9H) 5.40 (s5 2H).

Example 312A Bromo-4-nitro-1H-imidazole 4-Bromo-1H-imidazole (2.0 g, 13-6 mmol) and concentrated nitric acid (0.947 ml, 14.96 mmol) in concentrated sulfuric acid (20 ml) The reaction was carried out at 110 ° C for 1 hour. The reaction was cooled to 25 ° C and poured into 200 ml of ice water. The white precipitate formed was collected by filtration to obtain the title compound (2.3 g, 87%). MS (ESI-) 89166 -486- 200427678 m / z 191 (M-H) '1 η NMR (300 MHz, DMSO-d6) 5 ppm 7.99 (s, 1H) ·

Example 312B 1-Usyl-5-bromo-4-nitro-1H-Weijun made the product of Example 312A (2.3 g, 11.98 mmol) in anhydrous N, N-dimethylformamide (40 ml) The intermediate solution was reacted with sodium bicarbonate (2.0 g, 24 Emole) at 25 ° C, and bromide (1.58 mL, 13.17 mmol) was added dropwise. The reaction was stirred for an additional 12 hours at 25 ° C. The reaction was concentrated under reduced pressure, and the residue was separated between ethyl acetate and water. The organic layer was dried over MgS04, filtered, and concentrated under reduced pressure. The residue was purified on a c18 column by reverse phase column chromatography, and was dissolved with a gradient of acetonitrile (5:95 to 100) in water containing ai% trifluoroacetic acid to obtain the title compound (L63 g, 48% ). MS (ESI +) m / z 284 (M + H) + · 1H NMR (300 MHz, DMSO-d6) 5 ppm 5.38 (s, 2H), 7.24-7 · 42 (m, 5H), 8.28 (s5 1H).

Example 312C 1-Uki-4 · -Nitro-1H_Mittenylthiol was converted into the product of Example 312B in 5 N ammonium hydroxide (16 ml) and dioxolane (10 liters) -Liquid, foam at 35 ° C for 15 minutes with hydrogen sulfide gas. The reaction flask was then sealed and stirring was continued for one hour. The reaction was purged with nitrogen for 10 minutes and concentrated under reduced pressure to give the title compound.

Example 312D 1-Benzylbenzyl chloride-m- vermiculite was used to make a solution of the product of Example 312C in 1NHC1 (20 ml) and dioxolane (10 ml) at 30 ° C. , Foam with chlorine for 15 minutes. The reaction flask was sealed and the reaction mixture was stirred for 1 hour. Chlorine was added repeatedly as described above, and the reaction -487-200427678 mixture was stirred for an additional hour. The reaction was allowed to cool in an ice bath. Cold water was added to the reaction, and the precipitate formed was collected by filtration to obtain the title compound (1.51 g, 87%, after 2 steps). ihnmr (300 MHz, dms 0-δ ppm 5.57 (s? 2H)? 7.27-7.40 (m, 5H)? 7.74 (s, 1H).

Example 312E 1-Narrow base-4_nitro-1H-Mixia-5 · Constant neck The product of Example 312D (1.5 g '4.97 mmol) was used in dioxin (25 ml) The falling liquid was bubbled with ammonia at 10 ° C for 10 minutes. The reaction flask was sealed and the reaction mixture was stirred for another 30 minutes. Repeat the above method. The reaction mixture was concentrated under reduced pressure, and the residue was washed several times with cold water to obtain the title compound (1.27 g, 90%). MS (ESI-) m / z281 1H NMR (300 MHz, DMSO-d6) 5 ppm 5.61 (s, 2H), 7.26-7.42 (m, 5H), 8.17 (s, 1H).

Example 312F 4-Amino-1-Fatyl-1H-Weifeng_5-Sulfamethoxamine The product of Example 312E (434 mg, ΐ · 54 mmol) in acetic acid (4.3 ml) The solution in thorium (4.3 ml) was reacted with iron powder (343 mg, 6.15 mmol) at 50 ° C for 3 hours. The reaction mixture was cooled to 25 ° C, filtered through a pad of Celite® (diatomaceous earth), and the filtrate was concentrated under reduced pressure. The residue was dissolved in dichloromethane and washed with a saturated aqueous sodium bicarbonate solution. The aqueous layer was extracted (2x) with dichloromethane, and the combined organic layers were dried over magnesium sulfate, filtered, and concentrated under reduced pressure. The residue was chromatographed on silica gel using a gradient of methanol (0-5%) in dichloromethane to give the title compound (180 mg, 46%). MS (ESI +) m / z 253 (Μ + Η) + · 1H NMR (300 MHz, DMSO-d6) 5 ppm 5.24 (s, 2Η), 7.22-7 · 39 (m, 5Η), 7 43 (s, 1Η). 89166 -488- 200427678

Example 312G technology-radical-3_ (7-fluorenyl-y-dioxide and "4 ~ 1 | Ί 2 41 to break the base of each cultivator 4 4 -2ilHVg ^ make the product of Example 312F (152 mg, 602 milligrams Mol) and the product of Example 309B (214 μg, 0.602 μmol) in toluene (8 mL) and reacted at 100 ° C. for 3 hours. The reaction was cooled to 25 ° C. and Diluted with hexane. The precipitate formed was collected by filtration. The residue was chromatographed on silica gel and dissolved in a gradient of 0-2% methanol in dichloromethane to give the title compound (155 mg, 50%) .MS ^ SROm / zSWM + HyVHNMRpGGMHz'DMSO-cU dppm5.42 (s, 2H), 5.63 (s, 2H), 7.22-7.44 (m, 11H), 7.53-7.56 (m5 1H), 7.74 · 7 79 (m, 1H), 8.20-8.23 (dd, J = 8.1, 1.5 Hz, 1H), 8.32 (s, 1H). Example 313 -4,7-diimidazolium dioxide "4 5_ep 2 , 41 pyrimidine, each base) winter hydroxyl 44_2 (Ί1Τί-zein) product of Example 312 (19.35 mg, 0.3378 mmol) in anhydrous dimethylarsine (2.5 ml), and the third · Solution of potassium butoxide in tetrahydrofuran (1 M, 0.265 ^: liter '0265 halo)' at 25 The reaction was carried out at C for 12 hours. The reaction was quenched by the addition of a saturated aqueous ammonium chloride solution and extracted with dichloromethane. The aqueous layer was made basic with sodium bicarbonate solution and extracted twice with dichloromethane. The combined The organic layer was dried over magnesium sulfate, filtered, and concentrated under reduced pressure. The residue was chromatographed on a reverse phase C18 column and dissolved in 5% -100% acetonitrile in water containing ai trifluoroacetic acid to obtain the title. Compound (17 mg, 81%). MS (ESI-) m / z 420 (MH) '. 1H NMR (300 MHz? DMSO-d6) / CF3 COOD) δ ppm 5.6 (s, 2H), 7.17- 7.27 (m, 5H), 7.35-7.40 (t, J = 7.64 Hz, 1H), 7.51-7.63 (d, 89166 -489- 200427678 J = 8.3 Hz, 1H), 7.69-7.73 (t, J = 8.8 Hz , 1H), 8.0-8.01 (m, 1Η), 8.18-8.20 (dd, J = 8.3, 1.2 Hz, 1H) _ Example 314 N2] 344-Hydroxy (3-methylbutane V2-keto) · 1,2_dij, _1Zalididine dioxo-4Η-1,2,4_benzopyridine-7_some} Glyphosamine The product of Example 206 (10.8 mg, 〇 · 〇23mmol) in concentrated sulfuric acid (0.6ml), treated with slowly added water (0.1ml), and turned yellow It was granted at 25 ° C for for 18 hours. The reaction mixture was poured onto ice and the pH was adjusted to pH 9 with 50% NaOH and aqueous sodium sulphate solution. Take the mixture with ethyl acetate (3 x 20 liters) annually. The combined organic layers were washed with water and brine, dried over magnesium sulfate, and filtered. The filtrate was concentrated under reduced pressure to give the title compound as a yellow solid (9.1 mg, 83%). MS (ESI-) m / z483 (MH) '. 1H NMR (300 ΜΗζ? DMSO-d6) δ ppm 0.96 (d5 J = 6.62 Hz, 6H) 1.49 (m, 2H) 1.64 (m5 1H) 3.63 ( d, J = 5.52 Hz, 2H) 4.30 (m, 2H) 6.23 (br s, 1H) 6.69 (s, 1H) 6.87 (d, J = 7.35 Hz, 1H) 7.12 (s, 3H) 7.42 (s (1H) 8.36 (d, J = 7.35 Hz, 1H) 8.52 (s, 1H) 15.62 (br s, 1H) The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) 5 ppm 0.96 (d, J = 6.62 Hz, 6H) 1.48 (m, 2H) 1.64 (m, 1H) 3.62 (d, J = 5.88 Hz, 2H) 4.29 ( m, 2H) 6.20 (m, 1H) 6.68 (d, J = 2.57 Hz, 1H) 6.86 (m, 1H) 7.41 (m, 3H) 8.35 (dd, J = 7.72, 1.84 Hz, 1H) 8_50 ( dd, J = 4.78, 1.84 Hz, 1H) 15.63 (s, 1H).

Meeting Example 315A 1-Butan-4_Haimou-1,8 "Nidridone A slurry of the product of Example 89A (3.24 g, 11.16 mmol) in 2N sodium hydroxide (100 ml) under reflux It was heated for 3 hours, cooled to 10 ° C, and treated dropwise with concentrated 89166-490-200427678 hydrochloric acid to a constant pH value of 3. The white solid formed was collected by filtration, washed with water, and dried to give the title compound (2.47 g, quantitative). MS (APCI +) m / z 219 (M + H) +. 1H NMR (300 MHz, DMSO-d6) 5 ppm 0.90 (t, J = 7.35 Hz, 3H) 1.32 (m, 2H) 1.57 (m5 2H ) 4.31 (m, 2H) 5.89 (s, 1H) 7.27 (dd, J = 7.72, 4.78 Hz, 1H) 8.23 (dd, J = 7.72, 1.84 Hz, 1H) 8.64 (dd, J = 4.78, 1.84Ηζ , 1H) 11.61 (s, 1H).

Example 315B 3- "Bis (methylthio) methylene 1-butyl-1,8-pyridine-2,4 (1H, 3HV diketone. The title compound is based on the procedure of Example 309B, using Example 315A The product was replaced by the product of Example 309A. 1 H NMR (300 MHz, CDCC13) 6 ppm 0.97 (t, J = 7.35 Hz, 3H) 1.44 (dd, J = 15.44, 7.35 Hz, 2H) 1.69 (m, 2H) 2.64 (s, 6H) 4.39 (m, 2H) 7.10 (dd, J = 7.72, 4.78 Hz, 1H) 8.45 (dd, J = 7.72, 1.84 Hz, 1H) 8.56 (dd, J = 4.60, 2.02 Hz, 1H).

Example 315C U-yl-4-hydroxy-3- {7-"(methoxymethoxymethyl) methyl l_u_dioxide_4H-telepheno [2,3-el" l, 2,41 ^ — -3-yl} -1,8-1? Nayodo-2 (111) -Hydrogenate Example 309G (110 mg, 0.43 mmol) and Example 315B (140.6 mg, 0.43 mmol) Ear) was reacted in toluene (5 ml) at 10 ° C for 3 hours. The reaction was concentrated under reduced pressure, and the residue was purified by chromatography on silica gel using a Biotage-12m column at 1: 99 Methanol: methylene chloride was dissolved to obtain the title compound as a white solid (114 mg, 54.6%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 η NMR (300 MHz, CDCC13) δ ppm 1.00 (t, J = 7.35 Hz, 3H), 1.46 (m, 2H), 1.74 (m, 2H), 3.45 (s, 3H), 4.56 (m, 2H), 4.80 (s, 2H), 4.84 ( s, 2H), 7_09 (s, 1H), 7.26 (s5 1H), 7.36 (dd, J = 8.09, 89166 -491-200427678 4.41 Hz, 1H), 8.57 (dd, J = 8.09, 1.84 Hz, 1H), 8.81 (dd, J = 4.78, 1.84 Hz, 1H), 15.06 (s, 1H), 15.11 (s, 1H). Paste example 316 1-glycyl hydroxyl-3- "7- (and a Usurp v u_Dioxide-4H-thieno "2J-ein? Pyridoxine-3-some 1-1,8" Naphthalidine-2 (1HV ketone makes the product of Example 315C (92 mg, 0.19 mmol) It was reacted with 6 N aqueous hydrochloric acid solution (4 ml) and tetrahydrofuran (8 ml) at 70 ° C for 3 hours. The reaction was concentrated under reduced pressure to remove tetrahydrofuran and treated with methanol (5 ml). The precipitate formed was collected by filtration and washed with water and diethyl ether to give the title compound as a white solid (65 mg, 77 · 8%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300MHz, CDC13) 5 ppm 1.00 (t, J = 7.35 Hz, 3H), 1.47 (dd, J 2: 15.26, 7.54 Hz, 2H), 1.73 (m, 2H) 4.57 (m, 2H ), 4.86 (s, 2H), 7.07 (s, 1H), 7.37 (dd, J = 8.09, 4.78 Hz, 1H), 8.58 (dd, J = 8.09, 1.84 Hz, 1H), 8.82 (dd, J = 4 · 60, 2 · 02 Hz, 1H), 14.94 (s, 1H), 15.24 (s, 1H).

Example 317A Aminosulfosulfanyl V5 • Nitro 4 methyl ester of each carboxylic acid The product of Example 309A (2 g, 6.5 mmol) in dichloromethane (38 ml) and 1-5 N aqueous hydrochloric acid (21 ml) The solution was bubbled with chlorine gas at 0 ° C for 30 minutes. The reaction flask was sealed and stirred for an additional hour. Nitrogen was bubbled through the reactant &apos; to dissipate the chlorine &apos; followed by the addition of solid sodium bisulfite (5J2g) and allowed to stir for 5 minutes. Dichloromethane (10 ml) and water (10 ml) were added to the reaction. The organic layer was separated and dissolved in a 1 ·· 1 mixture of 20 g of magnesium sulfate and sodium sulfate. The filtrate was concentrated under reduced pressure, and the residue was triturated with hexane, 89166-492-200427678 to give sulfonium chloride as a white solid (1.8 g, 97%). A solution of crude sulfonium chloride (1.5 g) in dichloromethane (15 ml) was bubbled with ammonia at -4 ° C over a period of 5 minutes. The reaction flask was sealed and stirred for another 15 minutes. Nitrogen was bubbled into the reaction mixture to disperse ammonia. The reaction was concentrated under reduced pressure while maintaining the temperature at 0 ° C. The residue was chromatographed on silica gel, and a Biotage-40s column was used to dissolve it in 5:95 methanol: dichloromethane to obtain an oil. This oil was triturated with a mixture of 5% methanol: dichloromethane (20 ml) and hexane (20 ml) to give the title compound as a yellow solid (75 g, 54%). 1H NMR (300 MHz5 DMSO-d6) δ ppm 3.81 (s? 3H)? 7.88 (s5 2H) 5 8.31 (s5 1H).

Example 317B Amino 4- (Amino group) &lt; Sephine-3-zoic acid methyl ester The product of Example 317A (0.75 g, 2.86 mmol) and iron powder (0.64 g, 4 (Equivalent) in acetic acid (30 ml) and reacted at 50 ° C. for 7.5 hours. The reaction was concentrated under reduced pressure and the residue was taken up in 5% methanol: dichloromethane (20 ml) and water (2 (Ml) was prepared into a slurry, and filtered through a short silica gel (20 g) column, washed with 5% methanol: dichloromethane (200 ml). The filtrate was concentrated under reduced pressure, and the residue was placed on a hair gel. Chromatography using a Biotage-12s column and dissolving with 1: 1 ethyl acetate / hexane to give the title compound as a yellow solid (0.527 g, 78%). 1H NMR (300 MHz, DMSO-d6) 5 ppm 3.77 (s, 3H), 6.84 (s, 2H), 6.88 (s, 2H), 7.28 (s, 1H).

Example 317C 3- (1-decyl-4- # presenting-2-keto-1,2-dihydro p-quelin_3_some V4H_left pheno | &quot; 2,3-el [~ l , 2,41 Pyridoxine methyl carboxylate L1_dioxolide The product of Example 317B (180 mg, 0.76 mmol) and the product of Example 309B 89166 -493- 200427678 (270 mg, 0.776 mmol) Moore) was reacted in toluene (15 ml) at 100 ° C for 3 hours. The reaction was cooled to 25 ° C, and the precipitate formed was collected by filtration, washed with toluene and ether to obtain The title compound (302 mg, 80%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300 MHz? DMSO-d6) 5 ppm 3.85 (s5 3H)? 5.61 (s? 2H)? 7.29 ( m, 5H) 5 7.40 (m5 1H), 7.52 (m, 1H), 7.74 (m, 1H), 8.21 (d, J = 7.72 Hz, 1H), 8.26 (s, 1H) · Conference 318 lr (l -Benzyl hydroxy-2-keto-1.2-diamidino-4-olin-3-yl V4H-pyrimido [Z3-elU, 2,41 pyrimidine-7-by acid 1,1-dioxide The product of Example 317C (90 mg, 0.09 mmol) and a 1 N aqueous solution of sodium hydroxide (0.8 ml, 4.4 equivalents) in ethanol (2 ml) were reacted at 70 ° C for 1-5 hours. The reaction was filtered, and the filtrate was acidified with a 1 N aqueous hydrochloric acid solution (0.8 ml). The precipitate formed was collected by filtration and washed with water, methanol, and ether to obtain the title compound (80 mg, 91.5%) IHNMRGOOMHz, DMSO-d6) δ ppm 5.62 (s, 2H), 7.29 (m, 5H), 7.42 (t, J = 7.54 Hz, 1H), 7.53 (d, J = 8.82 Hz, 1H), 7.76 (t, J = 7.17 Hz, 1H), 8.19 (s, 1H), 8.22 (dd, J = 8.09, 1.47

Hz, 1H). The disodium salt of the title compound was prepared according to the procedure of Example ID, replacing one equivalent of sodium hydroxide with two equivalents of sodium hydroxide. Example 319 3- (1-Leptyl-2-keto-1,2-diaphthy-3-ylcepheno [2,3-el [l, 2,4 &quot; | 1,1-dioxide

The product of Example 317C (25 mg '0.05 mg) was suspended in ammonium hydroxide (Q ml) and heated at 40 ° C for 16 hours. The reaction mixture was cooled to 25 ° C, concentrated under reduced pressure to remove excess ammonia, and a solution of 1NHC1 (0.8 ml), MeOH 89166 -494- 200427678 (1 ml) and water (3 ml) was added to the reaction In the mixture. The formed precipitate was collected by filtration and washed with water, methanol and ether to obtain the title compound (19 mg, 78-4%). 1H NMR (300 MHz, DMSO-d6) 5 ppm 5.62 (s, 2H), 7.30 (m5 7H), 7.41 (t, J = 7.54 Hz, 1H), 7.53 (m, 2H), 7. · 76 (m, 2H), 7-98 (s, 1H), 8.22 (m, 1H). The sodium salt of the title compound was prepared according to the procedure of Example id.

Example 320A 3- "7- (Word oxy) -1,1-dioxide-4H-1,2,4-benzopyridine-3-ylcyclopropylmethylene 1amino group-4--4- Pyridin-4-line_2ΠΗν ketone produced the product of Example 304F (0.800 g, 1.73 mmol) and cyclopropanecarboxaldehyde (ι · 60 ml, 20.76 mmol) in N, N-dimethylacetamide ( 2 ml) at 120 ° C in a microwave reactor in a sealed tube for 60 minutes. The reactants were concentrated under a stream of warm nitrogen gas passing through a manifold heated to 165 ° C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0750 g, 84%).

Example 320B BenzyloxyΗΛ-dioxide-4H-1,2,4-benzopyrimidine ii. 3-ylcyclopropylmethyl ^ amino) amino group V4-peroxylamine The product (0.75 g '1.46 mmol) was dissolved in tetrahydrool (8 ml) and methanol (0.100 ml) at 0 ° C with lithium borohydride (2.0 M solution in tetrahydro cran). , 1.0 ml, 2.0 mmol). The reaction was stirred at 25 Ct for 1 hour, then diluted with a 1 M aqueous hydrochloric acid solution, and filtered. The product was purified by trituration with methyl sulfoxide, filtered, and dried to give the title compound (0.296 g, 40%).

Example 320C 89166 -495-200427678 1-"(Cyclo-diylmethyl) amino 1 ice transyl-1,1-dioxide-4H-1,2,4-benzylpyridine-3-some V.Porphyrin-2 (1Η &gt; · ketone) The product of Example 320B (0.296 g, 0.57 mmol) was used in tetrahydrofuran (15 ml) with a catalytic amount of palladium hydroxide / carbon and a catalytic amount of 5% palladium / carbon. And ammonium formate (0.180 g, 2.85 mmol) at 60 ° C for 2 hours. The warm reaction mixture was filtered through Celite® (diatomaceous earth), the filtrate was diluted with ether, and the precipitate was filtered and dried, and The title compound (0J27 g, 53%) was obtained.

Example 320D Cyclopropylmethyl) Amine 1-4-Chino-2-keto-1,2-dioxo. 4-Porphyrin-3-ylbutan-1 Dioxane-4Η · 1,2,4 · The molybdenum Erhuang-7-yl) amino 1 acetic acid produced the product of Example 320C (0.125 g, 0.29 mmol) with cesium carbonate (0.38 g '1.17 hamol), 2-bromoacetamide (〇 0.60 g, 0.43 mmol) and a catalytic amount of tetrabutylammonium iodide in N, N-dimethylformamide (3 ml), reacted at 25 ° C for 2 hours. The reaction was allowed to shrink to half its volume under a stream of nitrogen warmed by a manifold heated to 165 ° F. The resulting solution was diluted with water, and the precipitate was collected by filtration and dried to give the title compound (0.134 g, 95%). Μ8 (Ε8Ι-) ηι ^ 482 (M-Η: Γ. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1HNMR (300MHz, DMSO-d6) 5ppm0-21 (m, J = 3.86, 2.39 Hz, 2H) 0 · 46 (m, 2H) 0.99 (m, 1H) 2.55 (m, 2H) 4.49 (s, 2H) 5.96 (t, J = 6.43 Hz, 1H) 7.06 (m, 1H) 7_21 (m , 2H) 7.40 (m, 2H) 7.53 (m, 1H) 7.62 (m, J = 1.84 Hz, 1H) 7.67 (d, J = 8.46 Hz, 1H) 8.07 (dd , J = 8.09, 1.47 Hz, 1H) 16.25 (s, 1H).

Example 321A MK benzyloxy) -1,1-digasification-4H-U, 4-mopropyrazine-3-some Ί-4-hydroxy · Η "2-methyl propylene amine 1 amine V Quinoline-2 (1HV ketone-496- 89166 200427678) The product of Example 304F (0.150 g, 0.32 mmol) and isobutyric acid (0.44 ml, 4.84 mmol) were added in N, N-dimethylacetamide (1.5 ml) at i25 ° C in a microwave reactor in a sealed tube for 40 minutes. The reactants were concentrated under a stream of warm nitrogen gas passing through a manifold heated to 165t. The formed The residue was triturated with diethyl ether and filtered to give the title compound (0140 g, 84%).

Example 321B Ethyloxy M · 1-dioxide_4Η-1,2,4 · benzobenzoyl 1-1-4-le-1-1- (isobutylamino group)> mantleline-2 (1Ην The ketone made the product of Example 321A (0.140 g, 0.27 mmol) in tetrahydrofuran ml) and methanol (0.020 ml) at 0 ° C with lithium borohydride (2.0M solution in tetramethylene furan, 0.20 ml, 0.40 mmol). The reaction was stirred at 25 C; stirred for 1 hour 'and then diluted with 1 M aqueous hydrochloric acid, and filtered. The product was dissolved in tetrahydrofuran, adsorbed on silica gel, and packed in stone. It was purified on a moss column and dissolved with a rattan. The filtrate was evaporated to dryness under reduced pressure to give the title compound (0.081 g 58%).

^ Example 321C (7 · Cyclodigas-4Η-1,2,4-benzothiadinyl-3-yl isobutylamino group) 4 The product of Example 321B (0.081 g, · Ϊ́6mmol) in tetrahydrofuran⑼ml) 'with a catalytic amount of palladium hydroxide / carbon, a catalytic amount of 5% palladium / carbon and ammonium formate (0.040g, 0.64mmol) at 60t 3 〇minutes. The warm reaction mixture was filtered through celite® (diatomaceous earth), and the filtrate was evaporated under reduced pressure to obtain the title compound (0.048 g, 72%). 89166 -497- 200427678

Example 321D M {344-Hydroxyl-l-isobutylamine V2-keto-1,2-dioxoline_3_some 1-U-octane-4H-U, 4-benzo4 -7_yl} Qi) acetamidine produced the product of Bayi 321C (0.048 g '0.11 mol) and carbonic acid (0.11 g, 0.34 mmol), 2-bromoacetamide (0.023 g , 0.17 mmol) and a catalytic amount of tetrabutylammonium iodide in Ν, Ν-dimethylformamide (3 ml) at 25 ° C for 2 hours. The reaction was concentrated to half the volume under a stream of nitrogen warmed by a manifold heated to 165 ° C. The resulting solution was diluted with water, and the precipitate was collected by filtration and dried to give the title compound (0.042 g, 77%). MS (ESI-) m / z 484 (M-H) —The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) 5 ppm 1.03 (m, 6H) 1.86 (m, 1H) 3.25 (m, 2H) 4.50 (m, 2H) 5.94 (t, J = 7.35 Hz, 1H) 7.07 (t, J = 7.72 Hz, 1H) 7.21 (m, 2H) 7.40 (s, 1H) 7.58 (m, 2H) 8.07 (dd, J = 7.72, 1.47 Hz, 1H) 16.23 (s, 1H ).

Example 322A 3- [H-Hydroxy Vl, l-dioxide_4H-1,2,4_benzyl-4-dioxo_3-yl 1-U "butyleneamine-yl1-4-hydroxy4line- 2 (lHVi same as the product of Example 304F (0.150 g, 0.32 mmol) and butyraldehyde (0.29 ml, 3.24 mmol) in N, N-dimethylacetamide (1.5 ml), The reaction was carried out in a microwave reactor in a sealed tube at i20 ° C for 25 minutes. The reactants were concentrated under a stream of warm nitrogen gas passing through a manifold heated to 165 ° C. The residue formed was Triturate with diethyl ether and filter to give the title compound (0.134 g, 80

Example 322B 89166 -498-200427678 Heptyl) _1,1_dioxobenzopyridine each l_w butylamino group): hydroxy 4 morpholine-2 (1HV ketone is the product of Example 322A (0.45 g) 0.26 mmol) in tetrahydrofuran (3 ml) and methanol (0.020 ml) at (TC, with lithium borohydride (2.0 M in tetrahydrofuran), 0.195 ml, 0.39 mmol ) Reaction. The reaction was stirred at 25 C for 1 hour, then diluted with 1 μ hydrochloric acid aqueous solution, and filtered. The product was dissolved in tetrahydrofuran, adsorbed on silica gel, packed on a silica gel f column, and methylene chloride. It was purified by dissolution. The filtrate was evaporated to dryness under reduced pressure to give the title compound (0.045 g, 33%).

Example 322C (Pyridylamino) -4_Dangmou_3 · (7-hydroxy-1,1_digasification_4Η_1 · 2 · 4-benzilopyrimidin-3-yl) quinoline-2HHV ketone The product of Example 322B (0.045 g, 0.087 mmol) was dissolved in tetrahydrofuran (8 ml) with a catalytic amount of palladium hydroxide / carbon, a catalytic amount of 5% palladium / carbon, and ammonium formate (0.03 g, 0.48 mmol) for 4 hours at 60 ° C. The warm reaction mixture was filtered through Celite® and the filtrate was evaporated under reduced pressure to give the title compound (0.038 g, 100%).

Example 322D Amineamino V4-fluorenyl-2-keto-1,2-dihydro4-line-3--3-1-1-dihydro-4Η · 1,2-benzopyrimidin-7-yl} oxy Based) Ethyl Acetate The product of Example 322C (0.038 g, 0.089 mmol) and cesium carbonate (0.087 g '0.27 mmol), 2-bromoacetamide (0.018 g, 0.13 mmol) and catalytic amount Tetrabutylammonium iodide was reacted in N, N-dimethylformamide (3 ml) at 25 ° C for 2 hours. The reactants were concentrated to half volume under a warm nitrogen 89166 -499- 200427678 gas stream through a manifold heated to i6yc. The resulting solution was diluted with water, and the precipitate was collected by filtration, and dried to give the title compound (0.011 g, 95%). MS (ESI-) m / z 484 (M-H). The steel salt of the title compound was prepared according to the private order of Example id. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 0.93 (t, J = 7.17 Hz, 3H) 1.48 (m, 4H) 2J6 (m, 2H) 4.49 (s, 2H) 5.90 (t, J = 6.80 Hz , 1H) 7 · 06 (t, J = 6.99 Hz, 1H) 7.21 (m, 2H) 7.40 (m, 1H) 7.54 (m, 2H) 8.07 (dd, J = 8.09, 1.10 Hz, 1H) 16.24 (s ， 1H) · Example 323A · 1ι [7- (benzyloxyH, l-dioxide-4H-1,2,4-benzylpyridine · 3_Ju 1-4-hydroxy_i -_ ([ (1E) _3-Methylbutylene-1amino} ρ-L-2 (1HVS with the product of Example 304F (0.220 g, 0.48 mmol) and isoprene (0.77 ml '7.18 mmol) ) In Ν, Ν-dimethylacetamide (1.5 ml) at i30 ° C in a microwave reactor in a sealed tube for 35 minutes. The reaction was heated to 165 ° Concentrate under a stream of warm nitrogen in the manifold of C. Triturate the formed residue with diethyl ether and filter to give the title compound (0181 g, 72%).

^ Example 323B-based VU-digas-4H-1,2,4-benzopyrimidinium-3-even &gt; 4-hydroxy_1- "G-methylbutane" amino 1quinoline-2 ( 1HV: The product of Example 323A (0.061 g, 0.11 mmol) was dissolved in tetrahydrofuran (3 ml) and methanol (0.010 ml) at 0 ° C with lithium borohydride (2.0 M solution in tetrahydrofuran, 0.09 ml, 0.18 mmol). The reaction was stirred at 25 C for 1 hour, then diluted with a 1 M aqueous hydrochloric acid solution, and filtered. The product was dissolved in tetrahydrofuran, adsorbed on silica gel, and packed in 2 grams 89166 -500- 200427678

AlltechSep-pack and purified by dissociation with dichloromethane. The filtrate was evaporated to dryness under reduced pressure to obtain the title compound (0.037 g, 62%).

Example 323C 4H-1 Dimethyl 4-benzopyridine_3_M-Π3-butyl) amine Some> Apricot UnHV ketone makes the product of Example 323B (0.037 g, 0.07 mmol) Ear) in tetrahydrofuran (8 ml), reacted with a catalytic amount of palladium hydroxide / carbon, a catalytic amount of 5% palladium / carbon and ammonium formate (0.018 g, 0.29 mmol) at 60 ° C for 30 minute. The warm reaction mixture was filtered through Celite® and the filtrate was evaporated under reduced pressure to give the title compound (0.025 g, 80%).

Example 323D _2-[(3- {4_Hydroxy-HO methyl butyl amine) amine 1 _2_keto_1,2_dihydro 4 morpholine -3- 丨 -L1-methoxy-4-4-1,2 4-Benzopyrimidine-7-yl) aeroyl 1 acetamidinium The product of Example 323C (0.025 g, 0.057 mmol) and cesium carbonate (0.055 g, 0.2 mmol) , 2-bromoacetamide (0.012 g, 0.087 mmol) and a catalytic amount of tetrabutylammonium eferrate in Ν, Ν-dimethylformamide (3 ml) at 25 ° C 2 hour. The reactants were concentrated to half the volume under a stream of nitrogen warmed by a manifold heated to 165 ° C. The resulting solution was diluted with water, and the precipitate was collected by filtration and dried to give the title compound (0.020 g, 72%). MS (ESI-) m / z498 (M-Η)-The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1 H NMR (300 MHz, DMSO-d6) 5 ppm 0 · 90 (m, 3Η) 1 · 33 (m, 6H) 1.54 (m, 2H) 4_49 (s, 2H) 5.90 (m, 1H) 7.06 (m , 1H) 7 · 21 (m, 2H) 7.40 (m, 1H) 7.55 (m, 2H) 8 · 07 (dd, J = 8.27, 1 · 29 Hz, 1H) 16.23 (s, 1H).

Example 324A 89166 -501-200427678 Group -N- "2- (Aminofluorenyl M- (fluorenyl) benzyl 1-7-hydroxy-5-one · 4.5-A Hydropyrimido 1 ~ 3 , 2Heptapyridine-6-carboxamidine and aminosulfonium V4- (fluorenyloxy) phenyl 1-7-hydroxy-5-keto-4-miEVphenylmethylene 1 , 5-Dipyridinium phenoxide, "3,2Seven"> Biyodo-6-Futanylamine produced the product of Example 304D (1-55 g, 5.57 mmol) and Example 268C (1.27 g, 3.71 mmol) In toluene (100 ml), the reaction was performed at 118 ° C. for 5 hours. The cooled slurry was filtered, washed with 25 ml of toluene, and dried to obtain the title compound.

Example 324B Iamino-6-Γ7_Γ teaoxy) -1,1_dioxide-4H_1,2,4-benzyl and distant cultivating-3-1 V7-pyrimidopyrido "3,2 seven 1 pyridine -5 (4HV ketone) reacted the product of Example 324A (1.95 g, 3.7 mmol) with 10% aqueous potassium hydroxide solution (100 ml) under reflux for 24 hours, cooled to 25 ° C, and acidified with concentrated hydrochloric acid to pH 2. The formed solid was collected by filtration, washed repeatedly with water, and dried to provide the title compound (Z05 g, 100%). MS (ESI_) m / z467 (M-Η) \

'' Example 324C milk group | "3,2,7 h &lt; -5 (product of 4HV keto Example 324B (0.20 g, 0.42 mmol) and cyclohexanone (2.0 g, 20 mmol) at N , N-dimethylacetamide (4 ml) at 13 (rc, in a microwave reactor, in a sealed tube, reaction for 60 minutes. The solvent was removed under reduced pressure and the residue formed The product was triturated with ether (8 mL), filtered, and dried to give the title compound (0.167 g, 73%). 89166 -502- 200427678

Example 324D group) _1,1_: ΞΑ ^ _- 4Η_1,2,4-benzopyrimidine_3-yl1-4 彳 cyclohexylamino) ^ 2-Epi-pyrimido [~ 3,2- bl pyridine-5 (4HV ketone produced the product of Example 324C (0.067 g, 0.30 mmol) in tetrahydroanhydroxan (6 mL) and methanol (0.030 mL, 0.8 mmol). And reacted with lithium borohydride (2.0 M solution in tetrahydrofuran, 0.250 ml, 0.50 mmol) at ° C. The reaction was stirred at 25 ° C for 1.5 hours and acidified to pH 2 'with 1 M aqueous hydrochloric acid solution and Dilute with water (25 mL). Collect the formed precipitate by filtration and dry to constant weight to give the title compound (0H4 g, 69%). MS (APCI +) m / z 551 (M + H) + 1H NMR (300 MHz, DMSO-d6) 5 ppm 1.36 (m5 10H) 5.25 (s, 2H) 6.50 (s, 1H) 7.43 (m, 8H) 7.69 (d, J = 8.82 Hz, 1H) 8_29 (d , J = 5.15 Hz, 1H) 14.10 (S, 1H) 14.87 (s, lH).

Example 324E Bio- (cyclohexylamino) -7-jikyl-6- (7 • Weiji-1,1-dioxide-4H-1,2,4-benzothiamidine-3 · yl) Pyridino [~ 3,2-bl pyridine-5 (4HV ketone makes the product of Example 324D (0.114 g, 0.21 mmol) in anhydrous acetonitrile (umL) at 25 ° C and at 50 ° C Iodotrimethylsilane (0.29 ml, 2.1 mmol) was reacted for 4 hours. The reaction was cooled to 25 ° C and diluted with water (50 ml). The precipitate formed was collected by filtration and reduced in water. Dry under reduced pressure to give the title compound (0.083 g, 87% yield). MS (ESI-) m / z 459 (MH) _ · 1H NMR (300 MHz, DMSO-d6) 5 ppm 1.20 (m, 5H) 1.66 (m, 5H) 6.51 (s, 1H) 7.18 (m, 2H) 7.48 (d, J = 5.52 Hz, 1H) 7.57 (d, J =: 9.56 Hz, 1H) 8.29 (d5 J = 5.15 Hz , 1H) 10.42 (s, 1H) 14.04 (s, 1H) 14.93 (s, 1H) ·

Example 324F 89166-503-200427678 2-({3- [4- (cyclohexylamino) -7-pyridyl-5_keto-4,5-difluoreno "3.2 heptylpyridine-6- Radical] -U-digasification-4H-1,2,4-benzopyrimidinium. Some} fluorenyl) acetamidinium produced the product of Example 324E (0.209 g, 0.45 mmol) and cesium carbonate ( · 589 grams, 1.81 millimoles), 2-bromoethylammonium amine (0.125 grams, 0.91 millimoles) and a catalytic amount of tetrabutylammonium iodide in N, N-dimethylformamide (8 ml) The reaction was carried out at 25 ° C for 18 hours. The reaction was diluted with 50 ml of water and acidified to pH 2 with 1 M hydrochloric acid. The precipitate formed was collected by filtration and purified by column chromatography on silica gel. The 5% methanol in chloroform was dissolved to obtain the title compound (500 g, 21% yield). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI-) m / z 516 (MH ) *. 1H NMR (300 MHz, DMSO-d6) 5 ppm 1.48 (m? 10H) 4.59 (s, 2H) 6.50 (s5 1H) 7.39 (m, 2H) 7.44 (s, 1H) 7.48 (d5J = 5.15 Hz, 1H) 7.65 (s, 1H) 7.70 (d, J = 9.56 Hz, 1H) 8.28 (d, J = 5.15 Hz, 1H) 14.13 (s, 1H) 14.89 (s, 1H) · Example 325

On the edge, "2,3 &lt; &quot; |" 1,2,4 &gt; The bis__7_succinic acid amine 11_digas will be the product of Example 318 (20 mg, 0.042 mmol), 丨 _ (3 _Dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride ⑴ · 76 mg, 148 equivalents) and ι_hydroxybenzotriazole (8.66 mg, L54 equivalents) in% The solution in amidine (0.4 ml) was stirred at room temperature for 15 minutes. To this mixture, ethanolamine (2.8 microliters, U equivalent) was added, followed by methylmorpholine (8 microliters, [π equivalent), and the solution was stirred for 16 hours. Add Ν hydrochloric acid solution (4 ml), and collect the formed precipitate by filtration, and use water, methanol, and ethyl acetate to obtain the title compound as a white solid (187 mg, 85.8%). Heading 89166 -504- 200427678 The sodium salt of the compound was made according to the procedure of Example ID. iHNMR (300MHz,

DMSO-d6) 5 3.34 (m, 2H), 3.51 (m, 2H), 5.61 (m, 2H), 7.29 (m, 5H), 7.42 (m, 1H), 7_52 (m, 1H), 7.75 (m, 1H), 7.96 (s, 1H), 8.23 (m5 1H), 8.37 (m, 1H) _ MS (DCI +) m / z525 (M + H) +. 796523 326 3- (1-Leavyl-4-pyridyl-2_keto-1,2, dihydro-4lin-3-yl VN-"(1SV2-Ethyl-Haminocarbonyl) ethylfluorenyl-pyridine Benzo [2,3-elH, 2,41 pyridinium-7-carboxamide 1,1-digas compound The product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethyl Aminopropyl) -3 · ethylcarbodiimide hydrochloride (ιι · 76 mg, 1.48 equivalents) and 1-kisylbenzotriazole (8_66 mg, 1.54 equivalents) in N, N-dimethyl The solution in formamidine (0.4 ml) was stirred at room temperature for 15 minutes. To this mixture was added L_seramide amine hydrochloride (6.5 mg, 1.1 equivalent), followed by N-methyl Formaline (12.6 μl, 2_72 eq.), And the solution was stirred for 16 hours. 1 v hydrochloric acid was added

The solution (4 ml) was collected by filtration, and the precipitate formed was collected and washed with water, methanol and ether to obtain the title compound as a white solid (17.1 mg, 73%). The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) 5 3.69 (dd, J = 4.96, 3.13 Hz, 2H), 4.40 (m5 1H), 5.62 (s, 2H), 7.27 (m, 5H), 7.41 ( m5 1H), 7.53 (m5 1H), 7.75 (m, 1H), 8.12 (s, 1H), 8.22 (d, J = 7_72 Hz, 1H), 8.28 (d, J = 7.72 Hz, 1H). MS ( DCI +) m / z 568 (M + H) + · Example 327. (2-Amino-2-ketoethyl) -3_ (1-fluorenyl-4- and keto-2-one-1, 2-Difluorene 4 said -3-yl) -4 sulfonium benzo [2,3-61 "1,2,41 far dihuo-7_read_amine 1,1-digas will be the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (ιι_76 mg, 1.48 equivalents), and μ light group 89166 -505-200427678 A solution of benzotriazole (8.66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 ml), stirred at room temperature for 15 minutes. This mixture In this step, glycamine hydrochloride (5.1 mg, 1.1 equivalents) was added, followed by N-methylmorpholine (14 μl '3 equivalents), and the solution was stirred for 3 hours. A 1 N hydrochloric acid solution (4 Ml), and the precipitate formed was collected by filtration, Wash with alcohol and ether to give the title compound as a white solid (17 mg, 76%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 3.83 (d5 J = 5.52 Hz5 2H), 5.61 (s5 2H) 5 7.13 (s? 1H)? 7.32 (m, 6H) 5 7.51 (d, J = 8.09 Hz, 1H), 7.75 (m5 1H), 8.04 (s5 1H ), 8_21 (d, J = 6.99 Hz, 1H), 8.59 (t5 J = 5.88 Hz? 1H). MS (DCI +) m / z 538 (M + H) +. Example 328 ML-benzyl winter hydroxyl_2 -Keto-1,2-dihydroquinoline-3-a certain VN-IY1SV2-hydroxy-1-methylH1-4H-tepheno "2,3 &lt; 1" 1,2,41 -Moxifenamine 1,1-digas The product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (H.76 mg, 1.48 equivalents) and a solution of 1-benzyltriazole (8.66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 ml) at room temperature Stir and stir for 15 minutes. To this mixture, (s) _ (+) _ 2-amino small propanol (3.6 microliters, 1.1 equivalents) was added, followed by N_methylmorpholine (8 microliters, L72 equivalents), and the solution was Stir for 16 hours. 1 n hydrochloric acid solution (4 ml) was added and the precipitates collected were collected by tritium, and washed with water, methanol and ether to obtain the title compound as a white solid (18.4 mg, 82%). The sodium salt of the title compound was prepared according to the procedure of Example ID. IjjnMR (300MHz, DMSO-d6) 5 3.46 (m, 2H), 3_95 (m, 1HX 5.62 (s, 2H), 7.30 (m, 5H), 7.41 (t, J = 7.72 Hz, 1H), 7.52 (d , J = 8.82 Hz, 1H), 7.74 (d, J = 6.99 Hz, 1H), 7.96 (s, 89166 -506- 200427678 1H), 8.10 (d, J = 8.09 Hz, 1H), 8.22 (d , J = 6 · 99 Hz, 1H) · MS (DCI +) m / z 539 (M + H) 'Example 329 3- (1-Legenyl-4-boryl_2-keto-1,2-di Hydrogen 4-leaching-3-A certain VN, N-bis (2-ethyl) -4H-pyrimido "2,3-elfl, 2,41thiadigenol-7- # 醯 胸 ΐ ， ι_ 二 氲The product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and A solution of 1-chizylbenzotriazole (8.66 mg, 1-54 equivalents) in N, N-dimethylformamide (0.4 ml) was stirred at room temperature for 15 minutes. To this mixture, added Diethanolamine (4_43 microliters, 1.1 equivalents), followed by N-methylmorphine (8 microliters, 1.72 equivalents), and the solution was stirred for 16 hours. 1N hydrochloric acid solution (4 mL) was added and borrowed Collect the formed sunken objects, and , Methanol and diethyl ether to give the title compound as a white solid (6.85 mg, 29%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300 MHz, DMS 0-d6) (5 3.53 (m , 4H), 5.62 (s, 2H), 7.30 (m, 6H), 7.41 (t, J = 7.54 Hz, 1H), 7.53 (d, J = 8.46 Hz, 1H), 7.59 (s, 1H) , 7.76 (m, 1H), 8.22 (d, J = 8.09 Hz, 1H). MS (ESI +) m / z569 (M + H) +. Example 330

Ml-fecyl-4-¾lyl-2-one-l, 2-dihydropeptene_3-a certain VN42-transyl-H transmethyl, ethyl] -4H-P thiophene [2 , 3-e &quot; | "l, 2,41VCD Erhu-7- # Brewing amine 1,1-digas is the product of Example 318 (20 mg, 0.042 mmol), 1- (3 · Dimethyl Aminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-quinylbenzotriazole (8.66 mg, 1.54 equivalents) in N, N-dimethylformamidine The solution in amine (0.4 ml) was stirred at room temperature: Stir for 15 minutes. In this mixture, silk 89166 -507- 200427678 amine alcohol (4.21 mg, u equivalent) was added, followed by N_methyl Formaline (8 microliters, 172 miles) 'and stir the gluten solution for 16 hours. Add 1 n hydrochloric acid solution (4 ml), collect the precipitates formed by filtration, and use water, methanol, and ether After washing, the title compound was obtained as a white solid (18.2 mg, 79%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHnMR (300 MHz, DMSO-d6) 5 3.51 (d, J = 5.52 Hz, 4H), 3.89 (m, J = 6.25 Hz, 1H), 5.63 (s, 2H), 7.30 (m, 6H), 7.42 (t5 J = 7 .54 Hz, 1H), 7.53 (d, J = 8.82 Hz, 1H), 7.75 (d, J = 8.46 Hz, 1H), 8.02 (m, 2H), 8.22 (d, J = 8.09 Hz, 1H ). MS (DCI +) m / z 555 (M + H) +. Example 331 1-benzyl-4-hydroxy-3- (7) f (3RV3 · hydroxytetrahydropyridine small base spectrum) Hua Yuanfen "2,3-e ~ |" 1,2,4 &gt; Sai Er Geng _3_ a certain V Fen Shu -2 (1HV ketone will be the product of Example 318 (20 mg, 〇4242 mol) ), I- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, ι 48 equivalents) and μ hydroxybenzotriol (8.66 mg, 1.54 equivalents) A solution in Ν, Ν-dimethylformamide (0.4 ml) was stirred at room temperature for 15 minutes. To this mixture, ⑻-⑴tetrahydropyrrolol (184 ml, 1.1 equivalents) was added. , Followed by methylmorpholine (8 microliters, 1.72 equivalents), and the solution was stirred for 16 hours. 丨 v hydrochloric acid solution (4 halitres) was added and the formed sinks were collected by tritium, and water was used. , Methanol and acetic acid were washed to obtain the title compound as a white solid (19.8 mg, 87%).

The sodium salt of the title compound was prepared according to the procedure of Example ID. 1 η NMR (300 MHz, DMSO_d6) 5 1.89 (m, 2Η), 3.55 (m, 2Η), 4.31 (d, 1Η), 4.99 (broad s ”1H), 5.62 (s, 2H), 7.31 (m, 6H), 7.41 (t, J = 7.54 Hz, 1H), 7.53 (d, J = 8.82 Hz, 1H), 7.69 (d, J = 6.99 Hz, 1H), 7_76 (t, J = 7.35 Hz, 1H), 8.22 (d, J = 6.99 Hz, 89166-508-200427678 1H) .MS (ESI +) m / z 551 (M + H) +. f Example 332 1: (1-Cryl_-4- # yl-2-keto ::) ^ dihydro4line_3_some); ^ _ (3_publishing 141 ^ H and "2,3- e] fl, 2,4 | gl Ergon-7_carboxamidine u-dihydride The product of Example 318 (20 mg, 0.02 mmol), ^ (3-dimethylaminopropyl) -3-Ethyl-brominated diimine hydrochloride (ιι · 76 mg, ι · 48 equivalent) and ι_hydroxybenzotriazole (8_66 mg, 1.54 equivalent) in Ν, Ν-dimethylformamide (0.4 ml) and stirred at room temperature for 15 minutes. To this mixture was added 2- (methylamino) -ethanol (2.8 ml, U equivalent), followed by methylmorpholine ( 8 ml '1.72 angli)' and stir the solution for 16 hours. Add 1 v hydrochloric acid solution (4 ml) and filter by The formed precipitate was collected and washed with water, methanol and ether; the title compound was obtained as a white solid (19.2 mg, 86%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR ( 300 MHz? DMSO-d6) δ 1.67 (m5 2Η) 5 3.28 (m? 2Η) 5 3.48 (t5 J = 6.25 Hz? 2H)? 5.61 (s, 2H), 7.30 (m, 6H), 7.41 (t, J = 7.54 Hz, 1H), 7.52 (d, J = 8.46 Hz, 1H), 7.75 (t, J = 6.99 Hz, lH), 7.92 (s, lH), 8.21 (m, lH), 8.34 (t, J = 5.33Hz, lH) · MS (DCI +) m / z 539 (M + H) + · Example 333

Hl · benzyl_4-hydroxy-2-keto-1,2-dihydro strain · 3-yl vn- [Y2SV2,3-dihydroxypropyl] -4H-fluoreno "2,3-el | 1,2,41 far dispray amine 1,1_dioxide carbonized the product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3_ethyl Solution of diimine hydrochloride (1U6 mg, ι 48 equivalents) and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 ml) And stirred at room temperature for 15 minutes. To this mixture, add Panax 89166 -509- 200427678

) -3-Amino-1,2-propanediol (4.21 mg, 1.1 equivalents), followed by N • methylmorpholine (8 ml, 1.72 equivalents), and the solution was stirred for 16 hours. A 1 N hydrochloric acid solution (4 ml) was added, and the formed precipitate was collected by filtration and washed with water, methanol, and ether to give the title compound as a white solid (184 mg, 80%). The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMR (300 MHz, DMSO-d6) 5 3.15 (m, 2H), 3.60 (m, 2H), 5.62 (s, 2H), 7.30 (m, 6H), 7.41 (t, J = 7.54 Hz , 1H), 7.52 (d, J = 8.46 Hz, 1H), 7.75 (m, 1H), 7 98 (s 1H) 8.22 (d, J — 6.62 Hz, 1H), 8.32 (t, J = 5.88 Hz? 1H). MS (DCI +) rn / z 555 (M + H) + Example 334 Ethyl-4-Ethyl-2-keto · 1,2-dihydrocarbyl U-yl VN- [Y1SV1 A) Propyl 1_4! 1 ^ Sepene and "2,3-61" 1,2,4 &gt; Sepion-7- # thioface 11_dioxo compound will be the product of Example 318 (20 mg, 0.042 mmol) Ear), 丨 _ (3_dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, ι 48 equivalent) and 1-benzyltriazole (8.66 mg, 1.54 Equivalent) A solution of N, N-dimethylformamide (0.4 ml) was stirred at room temperature: stirred for 15 minutes. To this mixture, (8) ^ (+)-2-amino group was added Butanol (4.36 liters of liters '1.1 equivalents) followed by] methylmorphine (8 microliters, 1.72 equivalents-), and the solution was stirred for 16 hours. 1 n hydrochloric acid solution (4 ml) was added' The collected sunken objects were collected by filtration and washed with water, methanol and ether. The title compound was obtained as a white solid (16.5 mg, 72%). The steel salt of the title compound was prepared according to the procedure of Example 1D. 1 η NMR (300 MHz, DMSO-d6) 5 0.91 (t, J = 7.35 Hz, 3H), 1.54 (m, 2H), 3.45 (m, 2H), 3.81 (m, 1H), 5.62 (s, 2H) 7.31 (m, 6H), 7.41 (t, J = 7.72 Hz, 1H), 7.52 (d, J = 8_09 Hz, 1H), 7.76 (t, J = 7.91 Hz, 1H), 7.98 (m, 1H), 8.01 (d, J = 8.46 Hz, 1H), 8.22 (d, J = 6.99 Hz, 1H). MS (DCI +) m / z 553 (M + H) +. 89166 -510- 200427678 Example 335 light group-2_keto-1,2_heptahydroquinoline_3_yl "Shanghua" (Xiao Xiaojia a V2_m group 1-4H-telepheno f2,3-elfU, 4l succinylpyridine amine 丨 j diphosphonium compounds will only be 318 shame (20 mg ' 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (11.76 mg, L48 equivalent) and 丨 _hydroxybenzotriazole (8.66 mg, 1.54 equivalents) of the solution in N, N-dimethylformamide (0.4 ml) was stirred at room temperature for 15 minutes. To this mixture, _ (+)-2_aminomethyl-1-butanol (5.15 microliters, U equivalent) was added, followed by N-methylmorpholin (8 microliters, 1.72 equivalents), The solution was stirred for 16 hours. A 1 N hydrochloric acid solution (4 ml) was added, and the precipitate formed was collected by filtration and washed with water, methanol, and ether to give the title compound as a white solid (18.8 mg, 80%). The sodium salt of the title compound was prepared according to the procedure of Example ID. ihnmr (300 MHz, DMSO-d6) 5 0.92 (dd, J = 6.62, 5.15 Hz, 6H), 1.95 (m5 1H), 3.48 (d, J = 5.88 Hz, 2H), 3.80 (m, 1H), 5.62 (s, 2H), 7.30 (m, 6H), 7_40 (t, J = 7.72 Hz, 1H), 7.51 (d, J = 8.46 Hz, 1H), 7.75 (m5 1H), 7.95 (d , J = 8.82 Hz, 1H), 8.00 (s, 1H), 8.22 (d, J = 6.62 Hz, 1H). MS (DCI +) m / z 567 (M + H) + ·-Example 336 Grandpa. Alkyl ketone group 1,2,2, apricot-3-yl VN- "2- # 垔 丁某 1-4H-thio_pheno" 2,3-〇1 "1,2,41 pyrimidine Ergen-7-carboxamidine 1,1-diamidate The product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethyl Carbodiimide hydrochloride (11.76 mg, 1.48 equivalents) and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in n, N-dimethylformamide (0.4 ml) The solution was expanded at A temperature: 15 minutes. To this mixture, 1-amino-2-butanol (4.43 μl, L1 equivalent) was added, followed by N-methylmorpholine (8 μl 89166). -511- 200427678 1.72 ^)) and stir the valley liquid: drop for 16 hours. Add 1 N hydrochloric acid solution (4 ml) The precipitate formed was collected by filtration and washed with water, methanol and ether to obtain the title compound as a white solid (19.97 mg, 87%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300MHz, DMSO-d6) (5 0.90 (t5 J = 7.35 Hz, 3H), 1.41 (m5 2H) 5 3.14 (m, 2H) 5 3.50 (m5 1H)? 5.62 (s, 2H ), 7.29 (m, 6H), 7.41 (t, J = 7.72 Hz, 1H), 7.52 (d, J = 8.82 Hz, 1H), 7.74 (m, J = 8.09 Hz, 1H), 7.97 (s , 1H), 8.21 (m, 1H), 8.31 (t, J = 5.33 Hz, 1H). MS (DCI +) m / z 553 (M + H) +. Example 337. ML · benzylordol · Di j. P-quinoline-3-a certain VN_ "2_weiji-2_ (4 · phenylbenzene) ethyl J-4H-nopheno" 2,3-elfl, 2,41 -Carboxamide 1,1-digas. The product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride ⑴ · 76 mg, 148 equivalents ^ and hydroxybenzotrijun (8.66 mg, 1.54 equivalents) in N, N-dimethylformamide (0.4 ml), stirred at room temperature for 15 minutes . To this mixture, octopamine hydrochloride (8.6 mg, U equivalent) was added, followed by N-methylmorpholine (126 microliters, 2.72 equivalents), and the solution was stirred for 16 hours. A 1 ν hydrochloric acid solution (4 ml) was added, and the formed precipitate was collected by filtration, and washed with water, methanol, and ether to obtain the title compound as a white solid (13.58 mg, 53%). The sodium salt of the title compound was prepared according to the procedure of Example ID. iHNMRpOOMHz, DMSO-d6) (H.63 (dd, J = 7.72, 4.41 Hz, 1H), 5.62 (s, 2H), 6_72 (d, J = 8.46 Hz, 2H), 7.18 (d, J = 8.46 Hz, 2H), 7.31 (m, 6H), 7.41 (t, J = 7.54 Hz, 1H), 7.52 (d, J = 8.82 Hz, 1H), 7.74 (t5J = 6_99 Hz, 1H), 7.94 (s, 1H), 8.21 (m, 1H), 8.42 (t, J = 5.52 Hz, 1H), 9.27 (s, 1H). MS (ESr) m / z 615 (MH) · 89166 -512- 200427678 Example 338 Technical base-3- "U-Difluoride-7- (hexahydropyridine-1-yl-V4H-4pheno | ~ 2.3-e &quot; | £ 1,2,4 &gt; Sedigen-3-yl radical UriHV ketone The product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3- Ethylcarbodiimide hydrochloride (11/76 mg, .48 equivalents) and __hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N, N-dimethylformamide ( • 4 ml) of the solution, and stirred at room temperature for 15 minutes. To this mixture, hexahydroephedrine (4 mg, U equivalent) was added, followed by N-methylmorpholine (8 μl, 172 equivalent) ) 'And stir the solution for 16 hours. Water (5 ml) was added and the mixture was collected by filtration The resulting precipitate was washed with water, methanol, and ether to give the title compound as a white solid (18.3 mg, 80.16%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300 MHz, DMSO- d6) 5 3.14 (s, 4H), 3.65 (m, 4H), 5.43 (s, 2H), 7.26 (m, 8H), 7.46 (m, 2H), 8.11 (t, J = 7.72 Hz , 1H), 8.70 (broad s, 1H) · MS (DCI +) m / z 550 (M + H) +. Example 339 K ^ (Amino Group.)? 1- (1- Fluorenyl_4 · lightyl-2-S isopropylhydrogen-4-lyl-3-yl) -4fluorene_distenopheno | &quot; 2,3-elfl, 2,41pyrimidine_7_carboxamide 1. Dioxide The product of Example 318 (20 mg, 0.042 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (ιι · 76 Mg, 1-48 equivalents) and 1-benzyltriazole (8.66 mg, 1.54 equivalents) in ν, N-dimethylformamide (0.4 ml), stirred at room temperature for 15 minute. To this mixture, 6-aminonicotinamide (6.33 mg, U equivalent) was added, followed by N-methylmorpholine (8 μl, 1.72 equivalent), and the solution was heated at 70 ° C for 16 hour. A 1N hydrochloric acid solution (4 ml) was added, and the precipitate formed was collected by filtration, and washed with water and 89166-513-200427678 ether. The solid was dissolved in 5% methanol / dichloromethane with 2 drops of triethylamine and purified by flash chromatography on silica gel using a Biotage-12s column at 10:90 methanol / dichloromethane. Dissolve to give the title compound as a white solid (5.4 克 g '21.6%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1 H NMR (300 MHz, DMSO-d6) δ 5.64 (s, 2H), 7.30 (m, 6H), 7.43 (t, J = 7.54 Hz, 1Η), 7.50 (m, 1H), 7.54 (d, J = 8.46 Hz, 1H), 7.76 (m, 1H), 8.10 (s, 1H), 8.24 (m, 2H), 8.32 (m, 1H), 8.38 (s, 1H), 8.88 ( d, J = 1.84 Hz, 1H), 11.17 (s, 1H). MS (DCI +) m / z 601 (M + H) + ·

Example 340A 2- (Isoamylamino ethanoic acid ethyl acetate) 2-Chloronicotinic acid ethyl ester (3.71 g, 20 mmol), isoamylamine (3.03 ml, 26 mmol) and A mixture of triethylamine (3-62 ml, 26 mmol) was heated in a sealed tube at 140 ° C for 8 hours and cooled to 25. (:, diluted with ethyl acetate, and the mixture was washed with water. 1 The organic layer was extracted with N hydrochloric acid aqueous solution. The acidic aqueous layer was adjusted to pH 8.0 with a saturated sodium bicarbonate solution, and then extracted with ethyl acetate (2 parts). The combined organic extracts were dehydrated and dried with sulfuric acid steel, filtered, and reduced. Concentrated under reduced pressure to give the title compound (3.58 g, 76%). MS (DCI / NH3) m / z 237 (M + H) +. 1H NMR (300 ΜΗζ5 DMSO-d6) 5 ppm 0.93 (d, J = 6.25 Hz, 6H) 1.31 (t, J = 6.99 Hz, 3H) 1.47 (q, J = 6.99 Hz, 2H) 1.64 (m, 1H) 3.47 (m, 2H) 4.28 (q, J = 6.99 Hz, 2H) 6.59 (dd, J = 7.72, 4.78 Hz, 1H) 7.90 (t? J = 5.15 Hz, 1H) 8.07 (dd? J = 7.91, 2.02 Hz5 1H) 8.28 (dd5 J = 4.78, 1.84 Hz, 1H).

Example 340B 2- (isoamylamino) nicotinic acid 89166 -514- 200427678 Stir a mixture of Example 340A (1J3 g, 7.31 mmol), IN aqueous sodium hydroxide solution (14.6 ml) and methanol (7 ml) 18 hours and diluted with water. The aqueous mixture was washed with ethyl picrate, followed by dichloromethane, and adjusted to pH 7.5 with a 1 N aqueous hydrochloric acid solution. The formed precipitate was collected by vacuum filtration, washed with water, and air-dried to obtain the title compound (424.4 mg, 28%). MS (DCI / NH3) m / z 209 (M + H) +. 1H NMR (300 MHz, DMSO * d6) 5 ppm 0.91 (d, J = 6.62 Hz, 6H) 1.46 (q, J = 6.99 Hz, 2H ) 1.63 (m, 1H) 3.45 (t, J = 7.17 Hz, 2H) 6.56 (dd, J = 7.72, 4.78 Hz, 1H) 8.04 (dd, J = 7.72, 1.84 Hz, 1H) 8_05 (m, 1H) 8.25 (dd, J = 4.78, 2.21 Hz, 1H) 12.96 (s, 1H).

Example 340C 4- # Hocyl-1- (3-methylbutyl peak lake_2 (1HV Xitong Example 340B (1 g, 4.81 mmol)) Acetic anhydride (10 ml) and glacial acetic acid (i 〇mL) The mixture was heated at 130 ° C for 2 hours. The mixture was cooled to 25 ° C and concentrated under reduced pressure. The residue was separated between ethyl picrate and a saturated aqueous solution of sodium hydrogen bisulfate. The organic layer was washed with brine, dried over sodium sulfate, filtered, and concentrated under reduced pressure. The residue was chromatographed on silica gel and dissolved with a gradient gradient of 0-100% hexane in ethyl acetate, and The title compound (100 mg, 9%) was obtained. MS (DCI / NH3) m / z 233 ^ + 11) +. 1 HNMR (300 MHz, DMSO-d6) ppm 0.94 (d, J = 6.62 Hz, 6H ) 1.46 (m, 2H) 1.60 (m, 1H) 4.33 (m, 2H) 5.88 (s, 1H) 7.27 (dd, J = 7.72, 4.78 Hz, 1H) 8.22 (dd, J = 7.72, 1.84 Hz , 1H) 8.65 (dd5 J = 4-78, 1.84 Hz, 1H) 11.61 (s, 1H).

Example 340D 3_ [• Bis (methylthio) methylene 1-butane-1,8-benzopyridine-2,4 (1H, 3HV diketone) The product of Example 340C (0.2 g, 0.86 mmol) was The solution in dimethylformamide (7 89166 -515- 200427678 liters) was treated with sodium hydride (76 mg, 60% in mineral oil, 2.2 equivalents), stirred at 25 ° C for 30 minutes, and Treated with carbon disulfide (0.4 g, 2.2 eq.), Heated at 50 ° C for 6 hours, cooled to 25 ° C, and treated with trifluoride (0.27 g '2.2 d. · 5 *). The mixture was treated at 25 C The mixture was decanted for 18 hours and concentrated. The residue was triturated with water and the solid formed was filtered and dried in vacuo to give the title compound (0.23 g, crude yield 80%). 1 HNMR (300 MHz, DMSO-d6) 5 LOO (d, J = 10 Hz, 6H), 1.6 (m, 2H), 1.75 (m5 1H), 2.63 (s, 6H), 4.4 (m, 2H), 7.1 ( dd, J = 10 Hz, 7 Hz, 1H), 8.42 (dd, J = 10 Hz, 3 Hz, 1H), 8.58 (dd, J == 7 Hz, 3 Hz, 1H) · MS (DCI +) m / z 337 (M + H) +

Example 340E i-I-3--3- 7-"((methyla certain methyla)) methyl 1-U-dioxide-4H-pyrimido" 2.3-el [L2, Butylhydrazone, 8 · pyridine-2 (1HV ketone made the product of Example 309G (37.5 mg, 0.15 mmol) and the product of Example 340D (50 mg, 0.15 mmol) in toluene (5 ml) And reacted at 100 ° C for 3 hours. The reaction was concentrated under reduced pressure, and the residue was purified by chromatography on silica gel using a Biotage-12m column and dissolved in 2:98 methanol · · dichloromethane, and The title compound was obtained as a yellow solid (36 mg, 49%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMRpOOMHADMSO-c ^) 5 0.98 (d, J = 6.99 Hz, 6H), 1.57 (m, 2H), 1.66 (m, 1H), 4.45 (d, J = 7.35 Hz, 2H), 4.64 (s, 3H), 4.71 (s, 3H), 7.43 (s, 1H), 7.46 (m, 1H), 8.54 (d, J = 6.99 Hz, 1H), 8.87 (s, 1H), 14.45 (broad s, 1H). MS (DCI +) m / z 510 (M + NH4) + · Example 341 4-Hydroxy [7- (¾methyl M · 1-dihydro-4H-fluoreno l ~ 2,3-elfl, 2,41 pyridinium-3-ylmethyl Dingmou Vl, 8-pyrimidone 89166 -516- 20042767 8 The product of Example 340C (23 mg, 0.05 mmol) was reacted with 6N aqueous hydrochloric acid solution (1 ml) in tetrahydrofuran (2 ml) at 70 ° C for 3 hours. The reaction was concentrated under reduced pressure, Tetrahydrofuran was removed and treated with methanol (ml). The formed precipitate was collected by filtration and washed with water and ether to give the title compound as a white solid (13 mg, 62%). Sodium salt of the title compound Prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMS〇_d6) δ 0.98 (d, J = 6_62 Ηζ, 6Η), 1_57 (m, 2Η), 1.67 (m, 1Η), 4.46 (m, 2Η), 4.62 (s, 2Η), 7.30 (s, 1Η), 7.47 (dd, J = 8.09, 4.78 Ηζ, 1Η), 8.54 (dd, J = 7.72 , 1.84 Ηζ, 1Η), 8.86 (m, 1Η), 14.39 (broad s, ιη). MS (DCI +) m / z 466 (Μ + ΝΗ4) + · Example 342 膣 _ 基 carboxylic acid | 3- (1- 芊Hydroxy-2-keto-1,2, dihydro4line, 3-a certain Vl.l-shi 1 oxidation_4Η, thieno "Z3-el," 1,2,41 pyrimidine-7-yl-1 The product of Example 310 (40 mg, 0.086 mmol) was prepared in n, N-dimethylformamide (2 ml) and acetonitrile (0.6 ml). The liquid suspension, at _20 ° c, to an isocyanate group Sulfonic ester chloride (16.4 [mu] L, 2.2 equiv.). The mixture was stirred at -20 ° C for 0.5 hours and at 0 ° C for 2 hours, 6N hydrochloric acid (2 ml) was added, and the mixture was heated at 70 ° C for 2.5 hours. The mixture was allowed to cool and water (10 * L) was added. The precipitate formed was collected by filtration and washed with water and ether. The solid was dissolved in 5% methanol / dichloromethane with a few drops of triethylamine and purified by flash chromatography on silica gel using a Biotage-12s column at 6:94 methanol / dichloromethane Dissolve to give the title compound as a white solid (23 mg, 52.6%). The sodium salt of the title compound was prepared according to the procedure of Example ID. WNMR (300 MHz, DMSO-d6) 6 5.08 (s, 2H), 5.62 (s, 2H), 6.72 (s, 2H) 7.29 (m, 5H), 7.42 (m, 2H), 7.53 (d, J = 8.82 Hz, 1H), 7.77 (t, J = 7.35 Hz, 1H), 89166 -517- 200427678 8 · 22 (d, J = 6.99 Hz, 1H) · MS (DCI +) m / z 528 (M + NH4) + · Example 343 Substrate carbonylaminocarboxylic acid P_α_ 芊 some-4-hydroxy-2-keto-1,2-dihydropyridin-3-some V Dioxide-4H-pyrimidine The "2.3-el [1,2,41 pyrimidine-7-yl-1 methyl ester produced the product of Example 310 (40 mg, 0.086 mmol) in N, N-dimethylformamide ( 2 ml) and a suspension in a solution of acetonitrile (0.6 ml) was treated with chlorosulfoisocyanate (16.4 microliters, 2.2 equivalents) at -20 ° C. The mixture was- Stir for 0.5 hours at 20 ° C and 2 hours at 0, add 6 N hydrochloric acid (2 ml), and heat the mixture at 70 ° C for 2-5 hours. Allow the mixture to cool and add water (1. Ml), the precipitate formed was collected by filtration, and washed with water and ether. The solid was dissolved in 5% methanol / dichloromethane with a few drops of triethylamine, and the silica gel layer was borrowed. Purification was performed using a Biotage-12s column and 6:94 methanol / dichloromethane to dissolve the title compound (6 mg, 12.7%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300MΗζ, DMSO-d6) δ 5.23 (s, 2Η), 5.61 (s5 2Η), 7.28 (m, 4Η), 7.35 (m, 2Η), 7.51 (m, 1Η)? 8.20 (m? 2Η)? 10.01 (s? 1Η). MS (ESI ') m / z 552 (MH) &quot;. An example 344 HZ- (Moryl methyl thiophene and "2,3_el" L2.食 二 _ Born? Apricot 4 _2 (1HV ketone product of Example 310 (156. 4 mg, 0.33 mmol) in dichloromethane (3 ml) &lt; falling liquid, at room temperature, Add 丨, 8_diazabicyclo [5 · 4 〇] undecene-7-ene (0.37 ml, 2.47 φ mol) and diphenylphosphonium azide ① · comic, mol) The mixture was stirred; straight, stirred under a dish overnight, and concentrated in vacuo. The residue was diluted with ethanol, and aqueous hydrogen chloride solution (2 ml) was slowly added 89166 -518- 200427678, and precipitation occurred. The solid was filtered and washed with ethanol / aqueous solution (2: i) to give the title compound as a light brown solid (124.47 mg, 76%). MS (ESI ·) m / z 491 (M_H) _ · 1H NMR (300 MHz, DMSO-d6) 5 4.59 (s, 2H) 5.62 (br s, 2H) 7.30 (m, 5H) 7.41 ( t, J = 7.54 Hz, 1H) 7.52 (d, J = 8.82 Hz, 1H) 7.58 (s, 1H) 7.76 (m, 1H) 8.22 (dd, Bu 8.09, 1.47 Hz, 1H) · Example 345 (amino Methyl H, l-dioxidation_4H_pyrimido "2,3-el" l, 2,41pyrimidin-3-yl 1_1-fluorenyl_4_hydroxy4line-2nHVi Same as Example 344 Triphenylphosphine (145 mg, 0.55 mmol) was added to a solution of the product (136.2 mg, 0.28 mmol) in pyridine (L68 ml) and concentrated ammonium hydroxide (1.12 ml) at room temperature. Mol). The solution was stirred at room temperature overnight and concentrated in vacuo. The residue was diluted with toluene and the solid was filtered to give the title compound as a light brown solid (100.78 mg, 78%) .MS (ESI +) m / z 467 (M + H) +. 1H NMR (300 MHz, DMSO-d6) (5 4.10 (s? 2H) 5.41 (br s5 2H) 7.07- 7.32 (m, 8H) 7.43 ( m, 1H) 8.10 (dd, J = 7.91, 1.65 Hz, 1H). Example 346 HP-O benzyl: 4-hydroxy-2-keto-U-diamidino-4-line-3-yl VU-digasification- 4H-Lufen `` 2,3 &lt; 1 '' 1,2,41 1Am} A solution of the product of methane hydrazone in Example 345 (15 mg, 0.032 mmol) in tetrahydrofuran (0.4 ml) was added with triethylamine (0.018 ml, 0.129 mmol) Then, 疋 1,8-diazabicyclo [5.4.0] Η --- 7- 晞 (〇_〇18mL, 0.129mmol). The mixture was cooled to 0 ° C, and methyl chloride was added. Yokohama (0.003 ml, 0.032 Emole). Stir the mixture at 0 ° C for 2.5 hours, then warm to 23.0, and stir for 2.5 hours. Add additional diazabicyclo and [5.4.0] ten 1-7- 晞 89166-519- 200427678 (0-010 ml 0.064 mmol) with methanesulfonium chloride (0.003 ml, 0.0032 mmol), and the mixture was at 23 ° C Stir for 15 hours. Add a few drops of N, N_: methylformamidine to increase solubility. Add additional methane chloride acid (0.03 ml, 0.032 mmol) and stir the reaction mixture at 23t 3 hours. A few drops of N, N-dimethylformamide and methanesulfonium chloride (0.003 ml, 0.032 mmol) were added, and the reaction mixture was stirred at 23 ° C for 1 hour. Additional methanesulfonium chloride (0.006 ml, 0.064 mmol) was added, and the reaction mixture was stirred at 23 C: stirred for 72 hours. The reaction mixture was concentrated under reduced pressure. The concentrate was diluted with diethyl ether and 1 N hydrochloric acid was added until no further sinking effect was found. The sanctuary was then washed with water 'followed by ether. The solid was dissolved in 1% diethylamine / dichloromethane, and purified by preparative thin layer chromatography, and then dissolved at 5% (5% triethylamine / methanol) / dichloromethane. The silica gel was washed with 10% (5% triethylamine / methanol) / dichloromethane to obtain the title compound as a triethylamine salt (4.7 mg, 23%). iHNMRpOOMHsDMSO- ^) 5 1.16 (t, J = 6.71Hz, 9H) 2.94 (s5 3H) 3.08 (bs5 6H) 4.26 (d? 2H) 5.40 (bs5 2H) 7.06 (m5 2H) 7.12 (d5 J = 8.54 Hz, 1H) 7.23 (m, 5H) 7.40 (t5 J = 7.32 Hz, 1H) 7.50 (t, J = 6.41 Hz, 1H) 8.10 (d, J = 6.10 Hz, 1H). Example 347 y_ {"3- (l-Hanyl-2-keto-1,2-dihydro 4 plin-3-Vl, l-dioxide-4H-fluoreno [2,3 ^ 1" 1, 2. Serine dimorph-7-yl-1methyl} nicotinamide in the solution of the product of Example 345 (0.015 g, 0.032 mmol) in tetrahydrop-loss (0.4 ml), add Triethylamine (0.022 ml, 0.6 mmol) and diazabicyclo [5A0] undec-7-ene (0.020 ml, 29 mmol). The mixture was cooled to 0 ° C, and Chlorinated hydrochloride (0.007 g, 0.0035 mmol 89166-520-200427678 ears) was added. The mixture was stirred for 2.5 hours, then warmed to 23 ° C, and mixed for 2.5 hours. Add an additional 1,8-monoazabicyclo [5 · 4 · 〇] eleven_7_association (0.010 ml, 0.0068 mmol) with nicotinic chloride hydrazone hydrochloride (0.006 g, 0.005 〇32mmole), and The mixture was stirred at 23 C for 15 hours. Additional chlorinated hydrochloride (0.006 g, 0.032 mmol) was added and stirred at 23 ° C for 6 hours. A few drops of Ν, Ν_ 一 甲 were added Ammonium carbamate 'to increase solubility. Add another chlorinated salt of fei test salt (0.006 g' 0.032 mmol) and stir at 23 ° C for 72 hours. Add hydrochloric acid (4M in dioxin (Middle) (0.095 ml, 0.370 mmol), and the reaction mixture was concentrated under reduced pressure. Then, the formed solid was washed with ether and water. The solid was dissolved in 1% triethylamine / diamine. It was purified by preparative thin layer chromatography in methyl chloride and dissolved in 5% (5% triethylamine / methanol) / dichloromethane. 10% (5% triethylamine / methanol) / dichloromethane Silicone was washed to obtain the triethylamine salt of the title compound (0.0068 g, 31%). IHNMRpOOMHz'DMSC ^) δ 1.17 (t, J = 7.32 Ηζ, 9Η) 3.09 (q, J = 7.32 Ηζ, 6Η ) 4.60 (d, J = 4.88 Ηζ, 2Η) 5.44 (bs, 2Η) 7.00 (bs, 1Η) 7.12 (m, 1Η) 7.26 (m, 5Η) 7.46 (m, 1Η) 7.53 ( dd, J = 7.63, 4.58 Hz5 1H) 8.12 (d5 J = 7.32 Hz5 1H) 8.26 (m? J = 7.93 Hz, 1H) 8.72 (d5 J = 3.66 Hz, 1H) 8.86 (bs, 1H) 9.09 (s, 1H) 9.16 (bs, 1H). Example 348

N- {"3- (l-benzyl-4_lightyl-2-keto-1,2-dihydro 4 π strain_3_some νΐ, 1 · digasification_4H_ side pheno" 2,341 " 1,2,4] stilbene-7-yl-1methyl 丨 morph 4-4-carboxamide in a solution of the product of Example 345 (0.015 g, 0.032 mmol) in tetrahydrofuran (0.4 ml) , Triethylamine (0.009 ml, 0.064 mmol) was added. The mixture was cooled to 0.0%, and 4-morpholinocarbonium chloride (0.4 ml, 0.035 mmol) was added. The reaction mixture was allowed to cool. Warm to 23 ° C and stir for 15 hours. Add 1 N 89166 -521-200427678 hydrochloric acid (0.065 ml, 0.064 mmol), then concentrate the mixture under reduced pressure. Wash the product with acetic acid and water. The title compound (7.5 mg, 40%) was obtained. The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (500 MHz, DMSO-d6) δ 3.57 (t54H) 4.38 (d? J = 4.88Hz? 2H ) 5.60 (bs? 2H) 7.11 (m52H) 7.27 (m, 6H) 7.38 (m, J = 7.32, 3.05 Hz, 1H) 7_49 (m, J = 7.32 Hz, 1H) 7.73 (bs, 1Η) 8 21 (d, J = 7.32 Hz, 1H). Example 349 N- {"3- (l Hydrogen p-quelin_3-yl) -1,1-dioxide-4H-thieno f2,3-el "l, 2,41 pyrimidine-7-some 1 methyl 丨 -2 shoulder ethylacetamide To a solution of the product of Example 345 (0.0226 g, 0.048 mmol) in N, N-dimethylformamide (0.5 ml), triethylamine (0.020 ml, 0.45 mmol) was added, 4- (dimethylaminopyridine (0.018 g, 0.145 mmol), glycolic acid (0.011 g, 0.145 mmol), and 1- (3-dimethylaminopropyl) each carbodiimide Hydrochloride (0.028 g, 0.145 mmol). The mixture was stirred at 23 ° C for 15 hours, then heated to 60 ° C, and stirred for 20 hours. The reaction mixture was concentrated under reduced pressure. The concentrate was concentrated in two portions. Dichloromethane was diluted, cooled to 0 ° C, and hydrochloric acid (4 M in dioxolane) (0.037 ml, 0.145 mmol) was added. The mixture was concentrated under reduced pressure. The residue was purified by reverse phase chromatography The title compound (10.8 mg, 42%) was obtained by dissolving in a gradient solution of 0.1% trifluoroacetic acid / 10% acetonitrile in water to 0.1% trifluoroacetic acid / 95% acetonitrile in water. The sodium salt of the title compound was based on the example. Made in 1D. iHNMRpOOMHz.DMSO-de) 5 3_91 (s, 2H) 4.44 (d, J = 5.88 Hz, 2H) 5.61 (bs, 2H) 7.14 (s, 1H) 7.29 (m, 5H) 7.41 (t, J = 7.35 Hz, 1H) 7.52 (d, J = 9.19 Hz, 1H) 7.75 (t, 1H) 8_21 (dd, 1H) 8.35 (UH). 89166 -522- 200427678

Example 350A Hydroxyl p- mantleline-2HHV Sein is in a solution of 25% by weight potassium hydroxide aqueous solution (200 ml) and 1,4-dioxolane (50 ml), and two heated soil 90-100 c. The product of Example 226C (6.72 g, 20.0 mmol) was added in portions. The reaction mixture was heated at reflux for 90 minutes to allow distillation, and additional water and dioxin (30 ml each) were added to the reaction vessel to the original volume. The mixture was refluxed for another 90 minutes, boiled, cooled, washed with 200 ml of diethyl ether / ethyl acetate, acidified to pH 2 with concentrated hydrochloric acid, and the formed solid was collected by filtration, and washed with water. Dry to constant mass to give the title compound as a tan solid (3.22 g '91% yield). Hall (00 :) 177 (? ^ +: ^) +. 11 ^] \ 411 (30〇) \ 4 取 〇] \ 48〇d6) δ 5.56 (s? 2H) 5.94 (s? 1H) 7.20 ( t5 J = 7.54 Hz, 1H) 7.62 (m5 1H) 7.85 (m5 2H) 11.33 (s5 1H).

Example 350B keto-2-one, certain 4-line-U2HV, certain MΗ-isoindole], 3 (2HV diketone will be the product of Example 350A (0.54 g, 3 mmol), phthalic anhydride (1.36 g , 2.2 equivalents: a mixture of L and diisopropylethylamine (1 · 97 g, 5 equivalents) in dioxolane (20 ml), heated at 100 ° C for 2 hours, and cooled to 25 ° C And concentrated. The residue was triturated with water and ether. The solid formed was filtered and dried in vacuo to give the title compound (0.6 g, 64% crude yield), which was used directly in the next step. 1 H NMR (300 MHz, DMSO-d6) 6 5.95 (s, 1H), 7.37 (m, 1H), 7.6 (m5 2H), 7.95-8.1 (m5 5H), 12.18 (s, 1H). MS ( DCI +) m / z 306 (M + H) + ·

Example 350C 3- "Bis (methylthio) methylenediketyl-1,3-dihydro-2H-isoindol-2-yl) 89166 -523-200427678 Kuquelin-2,4 (111, 31 ~ 1) -dione A solution of the product of Example 350B (0.6 g, 1.96 mmol) in acetic acid: eridine (5: 1, 15 ml). Methyl sulfate (Use Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V.

Processed in Regondi) (1 · 6 g, 3 eq.) And heated at 10 ° C for 2 hours. The reaction mixture was treated with ice, and the solids that had been immersed in the filter were filtered, and dried in vacuum, 0.53 g (66%) of the title compound were obtained. 1H NMR (300 MHz, DMSO-d6) 5 2.63 (s, 6H), 7.34 (m, 1H), 7.55 (d, 1H) 57.61 (m, 1H), 8.08 (m, 5H). MS (DCI +) m / z 411 (M + H) +.

Example 350D St. [_4-Hydroxy-3- {7-[(methoxymethoxymethyl) methyl 1-1,1-digasified-4H-pyrimido "2.3-e &quot; | [1,2, 41 隹 一 ^ 井 -3_ 基} _2_ 酉 same base ρ Lin-1 (2H) _base 1_1H_isocyanate-1,3 (2HV second pay makes the product of Example 309G (32.6 mg, 0.13 mmol) Ear) and the product of Example 350C (53 mg, 0-13 mmol) in toluene (3 ml), reacted at i 0 (TC for 3 hours. The precipitate formed was collected by filtration, and methanol and ether were used. Wash to obtain the title compound (45 4 *, 61.5%) Q1HNMR (300 MHz, DMSO · d6) δ 3.32 (s, 3H), 4.61 (s, 2H), 4.70 (s, 2H), 7.28 (s, 1H), 7.42 (m, 1H), 7.70 (d, J = 4.04 Hz, 2H), 8.06 (m5 2H), 8.11 (m, 2H), 8.22 (d, J = 8.09 Hz, 1H) · MS (ESI ·) m / z 565 (M-Η) ·.

Example 350E Amino-4-hydroxy groups {7-"(methoxymethoxy) methyl 1-U-diazide-4H phenone" 2,3-61 "1,2,4 &quot; Two-spray-3-yl 丨 Benlin-2 (1! 1) -same as the product of Example 350D (185 mg, 0-326 mmol), methylhydrazine (43.47 μl, 2.5 equivalents) and triethylamine ( 0.126 ml, 3 equivalents) of a solution in 1,4-dioxolane (1089166-524-200427678 ml) and heated at 10 ° C for 3 hours. The reaction was concentrated under reduced pressure and Treatment with methanol solution (75 ml) and 1 N hydrochloric acid (100 ml). The precipitate formed was collected by filtration and washed with water and ether to give the title compound as a white solid (94 mg, 66%). 1H NMR (300 MHz, DMSO-d6) 5 4.65 (s, 2H), 4.71 (s, 2H), 5.84 (broad s, 1H), 7.44 (m, 2H), 7_88 (m, 1H), 8.04 (d, 1Η), 8.15 (d, 1H), 14.73 (broad s, 2H) · MS (ESI ·) m / z 435 (MH) _ ·

Example 350F HL ring ..... Ethylene methylene 1 amine group 丨 ice hydroxyl each (7-"(methylaminomethylamino) methyl lu-dioxide-4H-pyrimidine #" 2,3- el "1,2, Seramnyl-3-ylheptolin-2aHV ketone made the product of Example 350D (94 mg, 0.22 mmol) and cyclopropanecarboxaldehyde (0-162 ml, 2.2 mmol) In N, N-dimethylacetamide (1 ml), in a sealed tube, at 120 ° C, in a microwave reactor for 90 minutes. The reaction was cooled to 25 ° C, and reduced in It was concentrated under reduced pressure. The resulting residue was triturated with diethyl ether and filtered to give the title compound (78.9 mg, 75%).

Example 350G Cyclopropylmethyl) amino M-hydroxy, each methyl hydride, some methylamine, some methyl) 1-1,1-dioxide-4H-dapheno "2,3 &lt; 1" 1,2 · 41 喽Erqian each "a set of 4-2 (1HV ketone will be the product of Example 350F (78.9 mg, 0.16 mmol) in tetrahydrofuran (4 ml) and methanol (0.013 ml, 0.32 mmol), at 0 ° Under C, a 2.0 M solution of borohydride 89166 -525-200427678 lithium in tetrahydrofuran (0.131 ml, 0.24 mmol) was treated dropwise. The reaction was stirred at 25 ° C for 1 hour, and then N hydrochloric acid was acidified to about pH 2-4, diluted with water (20 ml), and the precipitate formed was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol / dichloromethane to give the title. Compound (41-6 mg, 52.5%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMRpOOMHADMSO-ddcJO.lS ^ J ^ 4.41 Hz, 2H), 0.42 (d, J = 8.09 Hz, 2H) 1.01 (m, 1H), 2.84 (d, J = 6.62 Hz, 2H), 4.64 (s5 2H), 4_71 (s, 2H), 6.36 (broad s, 1H), 7.41 (m, 2H ), 7.88 (t, J = 7.35 Hz, 1H), 8.07 (d, J = 8.46 Hz, 1H), 8.16 (d, J = 8.09 Hz, 1H) · MS (ESI-) m / z 489 (M-Η) ·. Example 351 H (cyclopropylmethyl) amino 1_4-Transfer to _ 3_ "7_ Dimethylol Vl, l-digasification_4H-p thiophene" "2,3-61" 1,2, Seraphim-3_yl &gt; Kuehlen-2 (111)- Simultaneously, the product of Example 350G (35 mg, 0.07 mmol) was treated at 0 ° C with a 4N solution (1 ml) of hydrogen chloride in 1,4-dioxolane. The reaction was performed at 0 ° C. Stir for 2 hours and test at 25 ° C for 3 hours with 10% sodium bicarbonate (3 ml) and extract with 2% methanol / dichloromethane. The solvent was concentrated and the residue was borrowed on silica gel. Purified by flash column chromatography and dissolved in 7% methanol / dichloromethane to give the title compound as a white solid (20 mg, 62.7%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. iHNMR (300MHz, DMSO-d6) 5 0.15 (d, J = 4.04 Hz, 2H), 0.42 (d, J = 8.09 Hz, 2H), 1.01 (m, 1H), 2.81 (d, 2H), 4.62 (s, 2H), 5.55 (broad s, 1H), 6.35 (broad s, 1H), 7.28 (s, 1H), 7.39 (m, 1H), 7.85 (m, 1H), 8.03 (m, 1H), 8.15 (d, J = 7 · 35 Hz, 1H) · MS (ESI ·) m / z 489 (M-H) ·. 89166 -526- 200427678

t Μ 352A H [? _- (Amino group alkoxy group oxy group 1 amine group 3_g with ethyl very propionate make the product of Example 304D (508.3 mg, 1.826 mmol) and triethylamine (0.47 Ml, 3.394 mmol) in anhydrous dichloromethane (10 ml), and cooled to 0 ° C. under a nitrogen atmosphere. Ethyl propylene dichloride (0.43 ml, 3.023 * mol), and the resulting golden solution was stirred at 00c for 15 minutes, and then at room temperature for 5 hours. The reaction was diluted with dichloromethane (5 () ml), and water (20 Ml). The aqueous washings were extracted with dichloromethane (25 ml), and the combined organic layers were washed with 1 N aqueous hydrochloric acid (20 ml), water (20 ml) and brine (20 ml). The layer was dehydrated and dried over anhydrous sodium sulfate, filtered, and the solvent was removed under reduced pressure. The yellow oil was purified by column chromatography on silica gel, and was separated with a gradient of 12% to 15% ethyl acetate / dichloromethane. The title compound was obtained as a white solid (340 mg, 47%). MS (ESr) m / z SQlCM.Hr ^ HNMRCSOOMH ^ DMSO-d,) 5 1.22 (t? J = 7.17 Hz5 3H ) 3.56 (s5 2H) 4.14 (q, J = 6.99 Hz, 2H) 5.15 (s, 2H) 7.27 (dd, J = 9.01, 3.13 Hz, 1H) 7.42 (m, 8H) 7.75 ( d, J = 8.82 Hz, 1H) 9.42 (s, 1H).

• Example 352B 17-(+ Milk Dioxide-4H-1,2,4-Benzo-4Diphenyl_3_yl i Acetate Acetate The product of Example 352A (292 mg, 0.744 mmol) and sodium carbonate (394 mg, 3.722 mol) in anhydrous ethanol (12 ml), heated to reflux under nitrogen atmosphere for 6.5 hours. The reaction was cooled to room temperature, filtered, and the filtrate was concentrated under reduced pressure. The residue was The compound was purified by column chromatography on silica gel with 3% methanol / methanol, and the title compound was obtained as a white solid (237 mg, 85%). MS (ESr) m / z 373 (MH) _ 1H NMR (300 MHz, DMSO-d6) 89166 -527- 200427678 51.21 (t, J = 6.99 Hz, 3H) 3.67 (s, 2H) 4.16 (q, J = 6.99 Hz, 2H) 5.20 (S, 2H) 7.39 (m, 8H) 12.21 (s, 1H) ·

Example 352C (7-Hydroxy-1,1-dioxo-4Η-1 · 2 · 4-benzilopyrimidin-3-yl) ethyl acetate It was hydrogenated in ethanol (20 ml) at 10% palladium / carbon (28 mg, 10% by weight) under an atmospheric hydrogen pressure (gas cylinder) for 1.25 hours. The reaction was filtered through a PTFE membrane filter (0.45 microns) and the catalyst was washed thoroughly with ethanol (50 ml). The filtrate was concentrated under reduced pressure, and the formed oil was triturated with dichloromethane / hexane (1: 1 v / v) to obtain the title compound as a crystalline white solid (194 mg, 92%). MS (ESI-) m / z 283 (M-Η) '. ^ NMRCSOOMHz.DMSO ^) δ 1.21 (t5 J = 7.17 Hz5 3H) 3.64 (s5 2H) 4.15 (q, J = 7_23 Hz, 2H) 7.06 ( d, J = 2.57 Hz, 1H) 7.11 (dd, J = 8.83, 2.57 Hz, 1H) 7.20 (d, J = 8.83 Hz, 1H) 10.21 (s, 1H) 12.11 (s, 1H).

Example 352D (ZAJ: _8-nitro-1,1-digasification-4Η · 1,2.4-jasopyridine-3-yl) ethyl acetate The product of Example 352C (100 mg, 〇 · 352 millimolar) in glacial acetic acid (3 ml), treated at room temperature with a solution of concentrated nitric acid in glacial acetic acid (1.43 M '0.305 ml, 0.436 mmol) Stir down for 19 hours. An additional 1.43 M nitric acid / acetic acid (0.020 ml, 0.029 mmol) was added and stirred for 1.5 hours. The reaction was diluted with water (30 ml) and extracted with ethyl acetate (2 x 50 ml). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel and eluted with 8% methanol / dichloromethane to obtain the title compound as a pale yellow solid (47 mg, 41%). MS (ESI ·) 89166 -528-200427678 m / z328 (MH). 1H NMR (300 MHz, -d5) δ 0.98 (t? J = 7.17 Hz5 3H) 3.86 (s, 2H) 4.01 (q5 J = 7.23 Hz , 2H) 7.11 (d, J = 8.82 Hz, 1H) 7.22 (d, J = 8.82

Hz, 1H).

Example 352E j »Gi_7 · jiji-1,1-dioxide-4H_U, 4_benzyl, Sai Ergeng each sincerely gave Λ Ship the product of Example 352D (61 mg, 0.1852 mmol) (5 ml), hydrogenated at 10% palladium / carbon (9 mg, 15% by weight) for 45 minutes under an atmospheric hydrogen pressure (cylinder). The reaction was filtered through a pTFE membrane filter (0.45 μm), and the catalyst was thoroughly washed with warm methanol (50 ml). The filtrate was concentrated under reduced pressure to obtain the title compound as a beige solid (55 mg, 99%). MS (ESr) m / z298 (MH) \ ^ NMRCSOOMHz ^ DMSO- ^) 5 1.21 (t? J = 7.17 Hz? 3H) 3.61 (s, 2H) 4.15 (q, J = 6.99 Hz, 2H) 5.22 (s , 2H) 6.40 (d, J = 8.46 Hz, 1H) 6.93 (d, J = 8.46 Hz, 1H) 9.82 (s, 1H) 11.86 (s, 1H).

Example 352F ^: · _methyl_1,1_mono-oxide_4H- "1,31 yin also [~ 5,4_h1" l, 2,41 Benzo p stope two-spray _3_yl) ethyl acetate Esters A solution of the product of Example 35 (56.3 mg, 0.188 mmol) in anhydrous N, N-dimethylmethanine (2 ml) was prepared with trimethyl orthoacetate (0.098 ml, 0752) Mol) and p-toluenesulfonic acid monohydrate 0 mg), treated at room temperature under nitrogen for 3 hours. The solvent was removed under reduced pressure, and the residue was purified by column chromatography on silica gel. It was dissolved in 4% methanol / dichloromethane to obtain the title compound as a white crystalline solid (48 mg, 79%). MS (ESI ·) m / z 322 (Μ · Η) 'iHNMRpOOMHz'DMSO-dJ 5 1.22 (t, J = 7.17 Hz, 3H) 2.69 (s, 3H) 3.71 (s, 2H) 4.17 (q, J = 7.11 Hz, 2H) 7.27 (d, J = 8.82 Hz, 1H) 8.02 ( d, J = 8 · 82 Hz, 89166 -529- 200427678 1H) 12.33 (s, 1H) ·

iH352G Tuchaji small (3 · methyl butyl roll on the two gasification-4Η _ "1 · η 谔 岫 bang" I ugly [ΙΑϋΙ 皮 ^^^ 3- 基 Vl, 84 咗 -2 (ΊΗ ,. Yu Guanyu The product of 12A (16.7 mg, 0.0714 mmol) and the product of Example 35 (23.1 * g, 0.0714 mmol) were dehydrated in anhydrous tetrahydrofuran (2 ml) at o ° c. Under a nitrogen atmosphere, sodium hydride (60%, 114 mg, 0.286 mmol) was added. The reaction was heated at reflux for 3 hours, cooled to, and treated with glacial acetic acid (0.165 ml). The formed The yellow solution was heated under reflux for 2 hours 'cooled to 0 ° C, diluted with water (5 ml), and acidified to pH 3 with 1 n aqueous hydrochloric acid. The precipitate formed was collected by filtration, washed with water, and dried' The title compound was obtained as a yellow solid (20 mg, 60%). MS (ESI-) m / z 466 (MH) · 1H NMR (300 MHz, DMSO-d6) (5 0.99 (d, J = 6.25 Hz, 6H) 1.58 (m, 2H) 1.71 (m, 1H) 2.73 (s5 3H) 4.50 (m, 2H) 7.50 (dd, J = 7.72, 4.41 Hz, 1H) 7.64 (d, J = 8.82 Hz, 1H) 8.10 (d, J = 8.82 Hz, 1H) 8.57 (dd, J = 7.91 2 · 02 Hz, 1H) 8.89 (dd, J = 4.60, 2 · 02 Hz, 1H) 14.18 (s, 1H). The product of Example 352G (14.6 mg, 0.0312 mmol) was dried in anhydrous tetrahydrofuran (3 ml). Treat with suspension in distilled water (1 ml), treat with 0.998 N aqueous sodium hydroxide solution (0.0313 ml, 0.0312 mmol) and mix the yellow solution for 15 minutes. Remove the solvent under reduced pressure and dry the residue To obtain the sodium salt of Example 352G (15 mg, 98%). 1H NMR (300 MHz, DMSO-d6) 5 0.97 (d, J = 6.25 Hz, 6H) 1.48 (m, 2H) 1.65 (m, 1H ) 2.67 (s, 3H) 4.30 (m, J = 8.82, 6.25 Hz, 2H) 7.13 (dd, J = 7.91, 4.60 Hz, 1H) 7.21 (d, J = 8.82 Hz, 1H) 7.86 (d, J = 8.82 Hz, 1H) 8.38 (dd, J-= 8.09, 1.47 Hz, 1H) 8.53 (m, J = 2.94 Hz, 1H) 16.09 (s, 1H) 89166 -530 -200427678

Example 353A 1-[(Carbopropylmethyl) amino 1-4-yl.林 p Lin-2ΠΗν was the same as the suspension of the product of Example 350A (1.033 g, 5.86 mmol) in methanol (58 ml), at room temperature, acetic acid (0.29 ml) and cyclopropyl Carboxylic acid (482 μl, 6.45 mmol) followed by sodium cyanoborohydride (744.6 mg '11 .85 mmol). This suspension was stirred at room temperature overnight, and the reaction was quenched with half-saturated saline (100 mL) and sodium bicarbonate (425 mg, 5.06 mmol). The mixture was extracted with ethyl acetate (300 ml), and the organic layer was separated and washed with half-saturated brine (2 X 50 ml). The combined aqueous layers were extracted with dichloromethane (2 X 100 ml). The combined organic solutions were dried over magnesium sulfate, filtered, and concentrated. This residue was used without any purification. 1 H NMR (300 DMSO-d6) 5 0.09 (m5 2H) 0.40 (m5 2H) 0.95 (m5 1H) 2.70 (t? J = 6.43 Hz, 2H) 5.91 (s, 1H) 6.10 (t, J = 6.07 Hz, 1H) 7.21 (m, 1H) 7.62 (t, J = 7.17 Hz, 1H) 7.87 (m, 2H) 11.42 (brs, 1H).

Example 353B 3- "Bis (methylthio) methylene l-1-l-methylpropyl amine" amine 1, 1,4-biphenyl-2,4 (1R3HV dione

In a suspension of the product of Example 353A (984.4 mg, 4.28 mmol) in 1,4-dioxolane (40 ml) at room temperature, pibilite (2.8 ml, 34.6 mmol) was added. ) And ginseng (methylthio) methyl sulfate (using synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi Into) (2.26 g, 8.55 mmol). Place this suspension at 55. (: Place in a preheated oil bath and stir for 15 minutes. In this solution, add another part of methyl sulphate (methylthio) methyl sulfate (2.26 g, 8.55 mmol) 55 ° C 89166 -531-200427678 Stir for 15 minutes and cool to room temperature. The mixture was concentrated in vacuo and the residue was diluted with dichloromethane and packed on a crushed gel column with dichloromethane, 2 % Ethyl acetate / dichloromethane, and then dissolved with 5% ethyl acetate / dichloromethane to give the title compound (852.1 mg, 60%). IHNMR (300 MHz, DMSO-d6) 5 0.15 (m, 2H) 0.42 (m, 2H) 0.98 (m, 1H) 2.61 (s, 6H) 2.73 (t5J = 6.43 Hz, 2H) 6.05 (t, J = 5.88 Hz, 1H) 7.15 (m, 1H) 7.64 (m, 1H) 7.76 (d, J = 8.09 Hz, 1H) 7_98 (m, 1H).

Example 353C l-[(Cyclopropylmethyl) amino 1-4-hydroxyl-3474 (methylaminomethyl) methyl 1-U-shihoxy-4H-pyrimidof2,3-el " Mody 41 pyridinium-3-yl h quinoline_2 (1HV ketone combines the product of Example 353B (500.3 mg, 1.5 mmol) with the product of Example 309G (377.62 mg, 1.5 mmol) The solution in osmium (15 ml) was stirred under reflux for 1.5 hours' and concentrated under reduced pressure. The residue was purified by chromatography on crushed gel and dissolved in 0% to 10% ethyl acetate / dichloromethane. To give the title compound (384.7 mg, 52%). IHNMR (300 MHz, DMSO-d6) 5 0.15 (m, 2H) 0.42 (m, 2H) 1.01 (m, 1H) 2.84 (d, J = 6 · 99 Hz, 2H) 4.64 (s, 2H) 4.71 (s5 2H) 6.36 &lt; br s? 1H) 7.42 (m? 2H) 7.86 (m? 1H) 8.07 (d? J = 8.46 Hz, 1H ) 8.16 (m3 1H).

Example 353D Azidomethyl VU-digasified-4H-pyrimido "2,3-e1" U.4V chamber dipyridyl] -H (cyclopropylmethyl) aminofluorenyl 4lin-2 (1HV ketone in the product of Example 353C (384.7 mg, 0.78 mmol) at (TC, a solution of hydrogen chloride in dioxolane (4N, 7.8 ml) was added. The solution was warmed to room temperature, and Stir for 5.5 hours and concentrate under reduced pressure. Suspend this solid 89166 -532- 200427678 in dichloromethane (7-8 ml), and in this suspension, add 1,8-diazepine at room temperature. Bicyclo [5 · 4 · 0] 11-7-pyrene (0.6 ml, 4.01 mmol) with diphenylphosphonium azide (0.85 ml, 3.94 mmol) and stirred overnight. In vacuo The solution was concentrated. The residue was purified by chromatography and dissolved in 5% triethylamine / dichloromethane to obtain the triethylamine salt of the title compound (357 mg, 79%). MS (ESI.) M / z 470 (Μ · Η) ~ · 1H NMR (300 MHz, DMSO-d6) 5 0.22 (m, 2Η) 0.46 (br d? J = 7.35 Hz5 2H) 1.01 (m? 1H) 4.52 (s5 2H) 5.98 (t? J = 6.62 Hz5 1H) 7.24 (s, 1H) 7.40 (m, 1H) 7.56 (m, 1H) 8.05 (m, 1H) ·

Example 353E 3-ΓΗAminomethyl) _1,1-dioxide_4H-pyrimidof2,3-elfl, 2,41pyrimidine each 1-[[cyclopropylmethyl] amine 1_4. A solution of the product of light oxoline_2 (1Ηνone in Example 353D (357 mg, 0.62 mmol) in pyridine (4.6 ml) and concentrated ammonium hydroxide (3 ml), at room temperature, add Triphenylphosphine (397 mg, 1.51 mmol). The solution was stirred at room temperature overnight and concentrated under reduced pressure. The residue was diluted with 30% hexane / toluene and the solid was filtered to give the title compound ( 250 mg, 90%). MS (ESr) m / z446 (M + H) +. 1H NMR (300 MHz? DMSO-d6) δ 0.21 (m? 2H) 0.46 (br d? J = 8.09 Hz, 2H) LOO (m, 1H) 4.12 (s, 2H) 5.98 (t, J = 6.43 Hz, 1H) 7.12 (m, 1H) 7.22 (s, 1H) 7.58 (m, 1H) 7.72 (d, J = 7.72 Hz, 1H) 8.04 (m, 1H) ·

Example 353F N-"(3- {l-" (Cyclopropylmethyl) amino group-4. f2,3_elfU, 4 Jian Ergeng_7_yl) Triethylamine salt of the product of 1 certain methanamine in Example 353E (85.26 mg, 0.16 mmol) in n, N-dimethylformamide (1.6 In a suspension in trichloromethane, at room temperature, add 89166-533-200427678 ethylamine (48 microliters, 0.34 mmol), followed by methanesulfonium chloride (13.3 microliters, 0.3 Mmol). The solution was stirred at room temperature for 20 minutes and concentrated in vacuo. The residue was purified by reverse phase chromatography and dissolved in 20% to 95% acetonitrile / 0.1% trifluoroacetic acid in water to obtain The title compound (39.86 mg, 49%). MS (ESI +) m / z 524 (Μ + Η) + · 1H NMR (300 MHz, DMSO-d6) 6 0 · 15 (m, 2Η) 0.42 (m, 2Η) 1.01 (m, 1Η) 2.84 (d, J = 7.35 Ηζ, 2Η) 2.99 (s, 3Η) 4 · 29 (d, J = 6.25 Hz, 2H) 6.37 (br s? 1H) 7.41 (m5 2H) 7.75 (t5 J = 6.25 Hz? 1H) 7.87 (m5 1H) 8.08 (d, J = 8.09 Hz, 1H) 8.16 (m, 1H) 14.46 (m, 1H). Example 354 3- (8-amino -7-Get Base-1,1 -Oxide-4H-1,2,4_benzyl-2-yl V4-hydroxy-1-1- (isobutylamine V-apriline-2 (1HV ketone will be the product of Example 321C (0_26 g , 0.61 mmol) in concentrated sulfuric acid (4 ml), treated with ammonium nitrate (55 mg, 0.69 mmol) at 0 ° C. After stirring at room temperature for 30 minutes, pour the solution into Iced water, and filtered the precipitate, dried, and triturated with ethyl acetate to produce a nitrated intermediate (0.23 g, 79%). This solid (0.23 g, 0.48 mmol) was dissolved in methanol: tetrahydrofuran: water The solution in (3: 3: · 1) (2.3 ml) was treated with powdered iron (0.12 g, 2.15 mmol) and ammonium chloride (0.031 g, 0.58 mmol) at 60 ° C. 1 hour. The warm solution was filtered through diatomaceous earth and rinsed with tetrahydrofuran. The filtrate was concentrated and the resulting solid was triturated with 1 ·· 1 dichloromethane ·· ethyl acetate to give the title compound (0.088 g, 42%) .MS (ESr) m / z442 (M_H) '1H NMR (300 MHz, DMSO-d6) δ1.04 (d, J = 6.62 Hz, 6H) 1.92 (m, 1H) 2.76 (m, 2H) 5.40 (s, 2H) 6.34 (m, 1H) 6.66 (d, J = 7.72 Hz, 1H) 7. 00 (d, J = 8.46 Hz, 1H) 7.44 (m, 1H) 7.94 (m, 2H) 8.17 (d, J = 6.99 Hz, 1H) 10.12 (s, 1H) 13.82 (s, 89166 -534- 200427678 1H) 15.19 (s, 1H). Example 355 3 &lt; U-digasification-4H- &quot; 1,31oxazolo &quot; 5,4 · 1ιπΐ, 2,41 4-Ethyl-1- (isobutylamine) &gt; Porphyrin-2 (1H) -one

At room temperature, a solution of Example 354 (0.036 g, 0.081 mmol) in dimethylformamide (2 ml) was prepared with trimethyl orthoformate (1 ml) and a catalytic amount of p-toluenesulfonic acid. Acid treatment for 20 hours. The solvent was removed under a stream of warm nitrogen, and the residue was triturated with ethyl acetate, tetrachloromethane, filtered, and dried to give the title compound (8 mg, 22%). MS (ESr) m / z 452 1HNMR (300 ΜΗζ, DMSO-d6) 5 1 · 05 (d, J = 6.62 Ηζ, 6Η) 1.93 (m, 1Η) 2.78 (m, 2Η) 6.33 (m? 1H) 7.45 (t? J = 7.54 Hz5 1H) 7.73 (d, J = 8.82 Hz5 1H) 7.92 (t5 J = 7.72 Hz, 1H) 8.00 (m, 1H) 8.21 (m, 2H) 9.04 (s, 1H) 14.28 (s ， 1H). Example 356 2-({8-Amino-344-hydroxy-1- (isobutylamino) -2 • one-U-dioxine, oxoline-3 · i_L1-dioxide _4H-U, 4-Benzopyrimidine-7-some} Hydroxy) ethylamine A solution of the product of Example 321C (0.49 g, 1.15 mmol) in concentrated sulfuric acid (6 ml) ' Treated with ammonium nitrate (100 mg, 1.25 mmol) at 0 ° C. After stirring at room temperature for 1 hour, the solution was poured into ice water, and the precipitate was filtered, dried, and triturated with ethyl acetate to produce a nitrated intermediate (0.27 g, 49%). A solution of the nitrated intermediate (75 mg, 016 millimoles) in N, N-dimethylformamide (3 ml), and 2-bromoacetamide (33 mg, 〇24 * Mo) Ear) and cesium carbonate (206 mg, 0.63 mmol) in the presence of a catalytic amount of degraded tetrabutylammonium at room temperature for 24 hours. The solvent was removed under a stream of warm nitrogen, and the residue was triturated with water, filtered, and dried to produce a burned 89166-535-200427678 base material (76 mg, 90%). A solution of this material in a methanol: tetrahydrofuran · water 3: 3: 1 mixture (2.3 ml) was powdered iron (36 mg, 0.04 mmol) and ammonium chloride (9 mg '0.17 mmol) It was treated at 60 ° C for 2 hours. The solution was filtered through diatomaceous earth and washed with tetrahydrofuran. The filtrate was concentrated and purified by a flash column, and was dissolved in 1% methanol in dichloromethane to give the title compound. (16 耄 g '22%). Salt is made by the procedure of example id. MS (ESI-) m / z 499 (MH)' 1H NMR (300 MHz, DMSO-d6) δ 1.03 (d, J = 6.62 Hz, 6H) 1.86 (m, 1H) 2.55 (m, 2H) 4.39 (s, 2H) 5.73 (s, 2H) 5.93 (t, J = 7.54 Hz, 1H) 6.37 (d , J = 8.46 Hz, 1H) 7.04 (m, 2H) 7.56 (m, 3H) 7_84 (s, 1H) 8.06 (d, J = 8.46 Hz, 1H) 15.91 (s, 1H). Example 357 3- "8- (Chloromethyl H, l-dioxide-4H-" 1,31 oxazomhin · 2 · 4 and boring dihex-3-yl1-4-fatyl_1_ (iso Butylamino) pyrene-Tallenone A solution of Example 354 (0.030 g, 0.067 mmol) in dimethylformamide (3 ml) with 2-chloro-1,1,1-trimethylamine oxygen Ethane (0.50 ml) was treated with a catalytic amount of p-toluenesulfonic acid at 60 ° C for 4 hours. The solvent was removed under a warm nitrogen stream, and the resulting residue was triturated with water, and filtered, It was then triturated with methanol and filtered to give the title compound (22 mg, 51%). The sodium salt was prepared by the procedure of Example 1D. MS (ESr) m / z 500 (M-Η) ·. 1H NMR (300 MHz, DMSO-d6) 5 1.04 (d, J = 6.62 Ηζ, 6Η) 1.87 (m, J = 20.04, 13.42, 6.99 Ηζ, 1Η) 2.63 (m, 2H) 5.13 (s , 2H) 5.95 (t, J = 6.99 Hz, 1H) 7.08 (t5 J = 7.54 Hz, 1H) 7.36 (d, J = 9 · 19 Hz, 1H) 7.57 (m, 2H) 7.99 (d, J = 8.82 Hz, 1H) 8.09 (dd, J = 7.91, 1.29 Hz, 1H) 16.59 (s, 1H).

Example 358A 89166 -536- 200427678 benzyloxy) _U_digasification_4H-1? 4 · benzopyrimidinium_3_yl a small product of the product of Example 304F Ear) in N, N-dimethylacetamidine; (1 halitre) with diethyl propionate (0.34 ml, 2.2 mmol) in a sealed tube, in a microwave reactor, in The reaction was performed at 100 ° C for 60 minutes. The reaction was cooled to 25 ° C, concentrated under a stream of nitrogen warmed by a manifold heated to 165 ° C, and the resulting residue was triturated with diethyl ether to give the title compound (0.045 g, 42%).

Example 358B H7_ (benzyloxydioxide-4H-1,2,4-benzyl and distant cultivating_3_yl1_4_lech-1- (propylamine, apricotyl-2, 1HV ketone, the product of Example 358A (0.045 g, 0.09 mmol) in tetrahydrofuran (2 mL) at 0 ° C, treated with methanol (0.05 mL, 0.35 mmol), followed by the dropwise addition of lithium borohydride at A 2.0μ solution in tetrahydrofuran (0.07 mL, 0-13 mmol) was stirred at 25 ° C. for one hour and diluted with 11 μ hydrochloric acid. The precipitate formed was filtered and dried. The solid was dissolved in tetrahydrofuran, and evaporated to dryness, and adsorbed on the silica gel. The formed silica gel was packed on a 2 g Alltech sep pack and dissolved in dichloromethane to give the title compound (0022). G, 44%). MS (ESr) m / z503 (M_H)-·

Example 358C

Ku Kui U1HV Xitong) in tetrahydrofuran (5 milliliter of palladium hydroxide (2 mg) The product of Example 358B (0.020 g, 0.04 millimoles) in liters), with ammonium formate (13 mg, 0.09 Millimoles), gas; 89166 -537-200427678 and 10% Pd / C (1 mg), and the resulting mixture was refluxed for 1 hour. The catalyst was filtered off and the filtrate was evaporated to give a white solid. The solid residue was partitioned between ethyl acetate (100 ml) and water (5 ml). The layers were separated and the organic solvent was removed under reduced pressure to give the title compound (0.016 g, 100%). MS (ESr) m / z413 (M-H)-·

Example 358D 2-({3-``4-Hydroxy-2-keto-K-propylamino Vl, 2-dihydro4-line-3-yl 1-U-dioxide-4H-1,2,4-benzopyrimidine Ergen-7-yloxy-1) hexamidine was used to obtain the product of Example 358C (0.016 g, 0.04 mmol) in N, N-dimethylformamide (2 ml) and cesium carbonate (0 ·· 015 g, 0.045 mmol), ethidium bromide (0.06 g, 0.18 mmol), and a catalytic amount of kilylated tetrabutylammonium were reacted at 25 ° C for 3 hours. The reactants were heated Concentrate under a stream of warm nitrogen to 165 ° C and triturate the formed residue with water, filter, and dry. Triturate the formed solid in hot ethyl acetate, filter, and dry, and The title compound (0.008 g, 37%) was obtained. The sodium salt of the title compound was prepared according to the procedure of Example 1D.] \ 48 (£ 81-) 111 ^ 470 (: ^ 11) '11 ^] \ 111 (30 ( ^ Out, 0 to 80-d6) δ 0.99 (m? 3H) 1.55 (t, 2H) 2.73 (t? 2H) 4.11 (d5 1H) 4.41 (d5 1H) 5.83 (d5 1H) 7.05 (s, 3H) 7.39 (s, 1H) 7.54 (s, 2H) 7.98 (s, 1H) 16.24 (s, 1H). Example 359 3- {3- 『4-Protein-1- (isobutylamino) -2 -酉 同 某 · 1,2 · 二 氤 p 杏 杏Some hi-chemicals-4H- "l, 3t" and "5,4411" 1,2,41 benzoficillin-8_some 丨 propionic acid will be the product of Example 354 (15 g '0 · 033 Mol) and a solution of cis-butene difiber (100 mg, ΐ mmol) in pyridine (2 ml), heated in a microwave reactor at i6 (rc) for 1 hour. The crude The mixture was cooled to 25 ° C, and at 89166-538-200427678

Waters symmetry C8 column (25 mm X excitation mm, 7 micron particle size) was purified by preparative HPLC using a gradient of 10% to 100% acetonitrile: 0.1% trifluoroacrylic acid in water to produce the title compound (5.3 mg, 30%). The dinaline was prepared by the procedure of Example 1D using 2 equivalents of sodium hydroxide. MS (ESr) m / z 524 (Μ-Η)-· 1H NMR (300 MHz, DMSO-d6) (5 1 · 〇3 (d, J = 6.25 Ηζ, 6Η) 1.86 (m, 1Η) 2 · 27 (m5 4Η) 2.66 (m, 2Η) 5.94 (t, J = 7.54 Ηζ, 1Η) 6.81 (m, 2H) 7.05 (t, J = 7.91 Hz, 1H) 7.53 (m, 2H) 8.06 (d, J = 6.62 Hz, 1H) 15.74 (s? 1H). Example 360 MH "(2-Amine-Ethyl) amino 1-Methyl Dioxide-4H_" L31 oxazolyl " Dipent-3-yl_1- (isobutylamino V quelin-2nHVi) The product from Example 357 (20 mg, 0.039 mmol) and N- (2-aminoethyl) amino Tert-butyl formate (7.7 mg, 0.046 mmol) in N, N-dimethylformamide (3 ml) as cesium carbonate (39 mg, 0.117 mmol) Ear) at 50 ° C for 2 hours. The solvent was removed under a stream of warm nitrogen, and the resulting residue was triturated with water, filtered, and dried. This solid was suspended in 丨, 4_dioxolane ( 2 ml), and treated with a 4M solution of hydrochloric acid in 14-dioxolane (2 ml), and stirred at room temperature for 20 hours. The solution was concentrated to half, filtered, and dried to produce Raw title compound bis-hydrochloride (58 mg, (24%). MS (ESr) m / z 524 (MH)-. 1H NMR (500 MHz, benzene-d6) 51.05 (d, J = 6.71 Hz , 6H) 1.93 (m, 1H) 2.60 (m, 2H) 2.81 (d, J = 6.10 Hz, 2H) 3.61 (m, 2H) 4.67 (s, 2H) 6.17 (m, 1H) 7.05 (d, J = 9 · 16 Hz, 1H) 7.20 (d, J = 8.54 Hz, 1H) 7.44 (t, J = 7.63 Hz, 1H) 7.90 (m, 1H) 7.99 (m, 2H) 8.17 (d, J = 7.93 Hz, 1H) 8.24 (m, 2H) 13.76 (s, lH). 89166-539-200427678 Example 361 2-({3- [~ 4-Gas: 1- (isobutylamino) -2 ketone -1,2-dihydropyridine, pylidine, pi, yl, &amp; _false ,: sister-1,2,4-benzo is bis_-7-some} gas some) propylamine in Example 321C The product (20 mg, 0.0467 mmol) was added to the broth in n, N-dimethylformamide (2 liters), and 2-bromopropionic acid amine (ι0.6 mg, 0.6 mg) was added. (0.70 mmol), tetra-n-butylammonium iodide (1.7 mg, 0.0047 mmol) and cesium carbonate (61 mg, 0.187 mmol). Mix the mixture at 25 ° C. (: Stirred for 72 hours. Then 'the solution was treated with a 1 N aqueous hydrochloric acid solution (10 ml) and extracted with ethyl acetate (10 ml). The organic layer was separated and dried over magnesium sulfate, filtered' and reduced Concentrated under reduced pressure to provide the title compound (18.4 mg, 79%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. MS (ESI_) m / z 498 (M-Na) _ · 1H NMR (300 MHz, DMSO-d6) 5 1.03 (d, J = 6.6 Hz, 6H), 1.45 (d, J = 6.6 Hz, 3H), 1.86 (m, 1H), 2_50 (m5 1H), 2.75 (m, 1H), 4.65 (q, J = 6.6 Hz? 1H)? 5.94 (t5 J = 7.3 Hz? 1H), 7.08 (m3 2H)? 7.17 (m? 1H) 5 7.23 (m5 1H), 7.29 (s, 1H), 7 · 58 (m, 2H), 7.64 (s, 1H), 8.07 (d, J = 6.6 Hz, 1H), 16.22 (s, 1H) · Example 362 Hydroxy-1 彳 1 Butylaminoketo-1, 2 • Dihydroquinoline_3-A product of 4-benzopyrimidine_7-yl} oxy) butanamide on Example 321C (20 mg, 0.0467 mmol) Ear) To a solution in N, N-dimethylmethanamine (2 ml), 2-chlorobutamidamine (8.5 mg, 0.070 halo), tetra-n-butylammonium iodide ( 1. 7 mg, 0.0047 mmoles) and cesium carbonate (61 mg, 0.87 mmoles). The mixture was stirred at 25 ° C for 18 hours, and then heated to 80 ° C for 3 hours. After cooling to 25 ° C, a 1 N aqueous hydrochloric acid solution (10 ml) was added, and the mixture was extracted with ethyl acetate (10 ml). The formed organic layer was separated from 89166-540-200427678, and dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title compound (24 mg, 100%). The title compound I steel salt was prepared according to the procedure of Example 1D. MS (ESr) m / z512 (M-Na)-. 1H NMR (300 MHz, DMSO-d6) 6 0 · 99 (t, J = 7.7 Hz, 3H), 1.03 (d, J = 6.3 Hz, 6H), 1.83 (m, 3H), 2.50 (m, 1H), 2.75 (m, 1H), 4.46 (m, 1H), 5.94 (m, 1H), 7.08 (m, 2H), 7.17 (m, 1H) ), 7.23 (m, 1H), 7.32 (s, 1H), 7.58 (m5 2H), 7.64 (s5 1H), 8.07 (d, J = 7.8 Hz, 1H), 16.23 (bs, 1H) Example 363 Borrowl-l- (isobutylamino group V2_g is even-U_di-f-methyl alkoxide_3 • yl i_u dihydrogenation_ group_ "1? 31 $ jun and" 5,4_111 "1,2 , 41 Benzoyl-8-yl methyl acetate. The product of Example 354 (67.5 mg, 0.015 mmol) was added to n, N-dimethylformamide (2 * L). The solution was treated with p-toluenesulfonic acid monohydrate (丨 mg) and tetramethylmonoorthomalonate (272 mg, 1.52 mol). The mixture was placed in an oil bath at 500 C and nitrogen atmosphere. Heat the solution and stir the resulting yellow solution for 3 hours. At this time, add another orthoester (272 mg, 152 mmol) and continue heating for another 5 hours. Allow the reaction to cool to room temperature and Concentrated by rotary evaporation in vacuum The residue was left to dry on a vacuum pump, then dissolved in dichloromethane (100 ml), and the strip was washed with water (2 50 ml) and brine. The organic layer was dried over anhydrous sodium sulfate and filtered And concentrated under reduced pressure. The residue was chromatographed on silica gel and dissolved with 1% methanol / dichloromethane. The impurities formed were rechromatographed on silica gel to 7% acetonitrile / dichloromethane. Gradient liquid dissolution to give the title compound (36 mg, 45%). MS (APCI) 1 ^ 526 (1 ^ + 11) +. 1 HNMR (300 MHz, DMSO-d6) 5 1.05 (d, J = 6 · 62 Hz, 6H) L91 (m5 1H) 2.77 (br m, 2H) 3.72 (s, 3H) 4.40 (s, 2H) 89166 -541- 200427678 6.36 (br m, 1H) 7.45 (t, J = 7.35 Hz, 1H) 7.70 (d, J = 9.19 Hz, 1H) 7.94 (m, 2H) 8.20 (d, J = 8.82 Hz, 2H) 14.25 (br s, 1H). The product of Example 363 (6.0 mg (0.0114 mmol) in anhydrous tetrahydrofuran (mL) and distilled water (1 mL), treated with 0.998N aqueous sodium hydroxide solution (0.0114 mL, 0.0114 mmol), and the yellow solution was mixed for 15 minutes. The solvent was removed under reduced pressure, and the residue was left to dry on a vacuum pump to obtain the sodium salt of Example 363 (6.1 mg, 98%). iHNMRpOOMHz, DMSO-d6) 5 1 · 04 (d, J = 5.15 Hz, 6H) 1.88 (m, 1H) 2.75 (m, 1H) 3.72 (s, 3H) 4.31 (s, 2H) 5.95 (m, 1H) 7.08 (m, 1H) 7.30 (m, 1H) 7.58 (m, 2H) 7.95 (m, 1H) 8.09 (m, 1H) 16.55 (s? 1H). Example 364 Each of the p-groups of the methyl group is degassed, and the t-septone-pentyl-3-yl) -1- (isobutylamino)? Tallin · 2 (1Η)-酉 will be obtained from Example 357. A solution of the product (80 mg, 0.160 mmol) and 3-hydroxytetrahydropyrrole (20 mg, 0.240 mmol) in acetonitrile (4 ml) at room temperature with diisopropylethylamine (0.115 ml) , 0.640 mmol) for 24 hours. The solvent was removed under a warm nitrogen stream, and the residue was purified on a Waters symmetrical C8 column (25 mm X 100 mm, 7 micron particle size) by preliminary HPLC using 10% to 100% acetonitrile: 0.1% A gradient of trifluoroacetic acid in water gave the title compound (16.2 mg, 18%). The sodium salt was prepared by the procedure of Example ID. MS (ESI ·) m / z 551 (MH) · · 1H NMR (300 MHz, DMSO-d6) 6 1 · 04 (d, J = 6.62 Hz, 6H) 1.58 (m, 1H) 1.88 (m5 1H ) 2 · 03 (m, 1H) 2.60 (m, 2H) 2.75 (m, 2H) 2.88 (m, J = 9.56, 6.25 Hz, 2H) 3.97 (s5 2H) 4.23 (m, 1H) 4.76 (m , 1H) 5.95 (t? J = 7.35 Hz, 1H) 7.08 (m? 1H) 7.27 (d5 J = 8.82 Hz, 1H) 7.56 (m? 2H) 89166-542- 200427678 7.92 (d, J = 8.82 Hz, 1H) 8.09 (d, J = 6.62 Hz, 1Η) 16 · 51 (s, 1H). Example 365 3- "1,1-Digas-8-pyridine-1-ylmethyl &gt; 411 -"1,31 humazolo | ~ 5,4-111" 1,2,41 jasopyridino-3-yl 1 small (isobutylamino V2-keto-U-di-j.pyridoline A solution of the product of Example 357 (16-5 mg, 0.033 mmol) in pyridine (2 ml) was heated at 45 ° C for 20 hours. The excess pyridine was removed with a stream of warm nitrogen and the residue was dried at Waters symmetrical C8 column (25 mm X 100 mm, 7 micron particle size) was purified by preparative HPLC using a gradient of 10% to 100% acetonitrile: 0.1% trifluoroacetic acid in water to produce the title compound (6 mg , 34%). MS (ESI ·) m / z 543 (MH). · 1H NMR (300 MHz, DMSO-d6) 5 1.03 (d, J = 6.62 Hz, 6H) 1.84 (m, J = 13.42, 6.43 Hz, 1H) 2.72 (m, 2H) 5.93 (t, J = 7.35 Hz, 1H) 6.39 (s5 2H) 7.07 (m, 1H) 7.36 (d, J = 8.82 Hz, 1H) 7.56 (m, 2H) 8.00 (d, J = 8.82 Hz, 1H) 8_08 ( m, 1H) 8_33 (m, 2H) 8.78 (t, J = 7_91 Hz, 1H) 9.30 (d, J = 5.52 Hz, 2H) 16_59 (s, 1H). Example 366 Dioxide-8- (IV Hydropyrrole, a certain methyl y4H_ "L3i pyrazolo r5 4_hl | ~ u, 41 stems and two farming -3- some 1_4-wei some isobutyl and some amino groups> quinoline_2 (1H) -one will get From a solution of the product of Example 357 (80 mg, 0.60 mmol) and tetrahydropyrrole (π peng '0.240 Emole) in acetonitrile (4 ml), diisopropylacetate: ft : (0.115 ml '.640 mmol) was treated at ambient temperature for 24 hours. The solvent was removed under a warm nitrogen stream, and the residue was purified on a Waters symmetrical C8 column (25 * m X 100 mm, 7 micron particle size) by using the prepared HpLc, using 10% to 100% acetonitrile: A gradient of 1% trifluoroacetic acid in water gave the title compound (12.4 mg, 15%). The sodium salt was prepared by the procedure 89166-543-200427678 of Example m. MS (ESI-) m / z 535 · 1H NMR (300 MHz, DMSO-d6) 51 · 04 (d, J = 6.62 Hz, 6H) 1.73 (m, 4H) 1.87 (m, 1H) 2.63 (q, J = 4.90 Hz, 4H) 2.75 (m, 2H) 3.99 (s5 2H) 5.95 (t? J = 7.35 Hz, 1H) 7.08 (m? 1H) 7.27 (d5 J = 8.82 Hz, 1H) 7.56 (m, 2H) 7.92 (d, J = 8.82 Hz, 1H) 8.09 (dd, J = 7.90, 1.29 Hz, 1H) 16.50 (s, 1H). Example 367 8-amino-3 · "4-hydroxy-H Isobutylamino) _2 · ketomethyldihydro-4line_3-yl1-L1-gasification-4H-1,2,4-benzo-p-di--7-ylmethanoate A solution of the product of 354 (44 mg, 0.099 mmol) and methanesulfonium chloride (0.010 ml, 0.011 mmol) in tetrahydrofuran (4 ml) at room temperature using diisopropylethylamine ( (0.075 ml, 0.040 mmol) for 2 hours. The solution was poured into water. The precipitate formed was filtered, dried, and purified by a flash column, and was dissolved in 1% methanol in dichloromethane to produce The title compound (14.2 mg, 28%). The sodium salt was prepared by the procedure of Example ID. MS (ESF) mJz 520 (MH) '. 1H NMR (300 MHz, DMSO-d6) 5 1.03 (d5 J-6.62 Hz, 6H) 1.88 (m, 1H) 2.71 (m, 2H) 3.46 (s, 3H) 5.94 (m5 1H) 6.53 (m, 1H) 7.16 (m, 1H) 7.3i (m, 1H) 7.64 (m, 2H) 8_09 (d, J = 7.35 Hz, 1H) 16.23 (s, 1H). Example 368 HM3-aminophenyl Vl, l; oxidation · 4Η41,31 hump and "5,4-hl" 1241 Benzene 4-diyl 1-4-isopropyl-1- (isobutylamine) p-quinidine, the same product of Example 354 (38 mg '0.086 mmol) and 3-aminobenzoic acid (13 mg (0.094 mmol) in polyphosphoric acid (1 ml) was heated to 190 t for 1 hour. The solution was cooled to 25 ° C and triturated with water and 10% sodium carbonate solution. The solid was filtered, dried, It was purified by flash column and dissolved in 2% methanol in dichloromethane 89166-544-200427678 to give the title compound (15 mg, 38%). The sodium salt was prepared by the procedure of Example 1D. MS (ESr) m / z543 (M_H)-· iHNMR (300 MHz? DMSO-d6) δ 1.04 (d? J = 6.62 Hz? 6H) 1.86 (m5 1H) 2.56 (m, 2H) 5.53 (s, 2H) 5.96 (t, J = 7.35 Hz, 1H) 6.82 (ddd, J = 8.09, 2.21, 1.10 Hz, 1H) 7.08 (td, J = 7.35, 1.47 Hz, 1H) 7.27 (m, 2H) 7.36 (dt, J = 7.72, 1.29 Hz, 1H) 7.57 (m, 3H) 7.96 (d, J = 8_82 Hz, 1H) 8.10 (dd, J = 8.09, 1.47 Hz, 1H) 16.51 (s, 1H). Example 369 M8- ( Aminomethyl H, l_dioxide-4Η41 · 31oxazolo f5,4-hl, 1,2,41benzobenzodiazin-3-yl1-4-hydroxy-fluorene isobutylamine &gt; Oxoline_2 (1HV ketone) a solution of the product of Example 357 (32 mg, 0.063 mmol) in tetrahydrocondensate (2 ml), methanol (1 ml) and ammonium hydroxide (1 ml) and 20% ammonia in a 1 M sodium hydroxide solution (0.063 ml, 0.063 mmol) was treated at room temperature for 16 hours. The mixture was blown dry with warm nitrogen and the resulting residue was taken up in water and ethyl acetate. The esters were separated and treated. The organic layer was concentrated and purified by flash chromatography. It was dissolved with a gradient of 100% dichloromethane to 2% methanol in dichloromethane to produce Title compound (4 mg, 13%). MS (ESr) m / z481 (MH) '1H NMR (300 MHz, DMSO-d6) δ 1.04 (d, J = 6.62 Hz, 6H) 1.91 (m, 1H ) 2.75 (m, 2H) 4.55 (s, 2H) 6_33 (m, 1H) 6_98 (d, J = 7.72 Hz, 1H) 7.16 (d, J = 8.46 Hz, 1H) 7.44 (m, 1H) 7.92 (m, 2H) 8 · 17 (d, J = 8.09 Hz, 1H) 13.65 (s, 1H) 15.60 (s, lH). Example 370 Hydroxyl di 3_ "8 sister methyl) -l, i-digas Chem-4H- "131 azazo" 5,4_hi "L2 41 Gaijing-3-yl VI: (isobutylamino group) quinoline_2QHVg same as 89166 -545-200427678 The product of Example 357 (32 mg , 0.063 mmol) in tetrahydrofuran (2 ml), methanol (1 ml) and ammonium hydroxide (1 ml), and sodium hydroxide solution (0.063 ml, 0.063 mmol) 20% ammonia, treated for 16 hours at ambient temperature. The mixture was blown dry with warm nitrogen and the resulting residue was separated between water and ethyl acetate. The aqueous layer was adjusted to pH 1 with 1 M hydrochloric acid, and extracted with ethyl acetate. The organic layer was concentrated under reduced pressure to give the title compound (5 mg, 16%). MS (ESI ·) m / z 482 (M-Η) · 1H NMR (300 MHz, DMSO-d6) 1.04 (d, J = 6.62 Ηζ, 6Η) 1.91 (m, 1Η) 2.76 (m, 2Η ) 4.82 (s, 2Η) 6.34 (d, J = 8.82 Hz, 1H) 7.31 (d, J = 8.82 Hz, 1H) 7.43 (m, 2H) 7.92 (m, 2H) 8.18 (d, J = 7.72 Hz, 1H) 9.04 (s, 1H) 14.31 (s, 1H). Example 3Ή 3- {8-"(butylamino) methyl 1-1,1-dioxide-4Η · [1,31 Saki Jun and | ~ 5 · 4-ΐν | 『1 The name is Benzo p-Cedilphin-3-yl 丨 -4- # to 1-1- (isobutylamino) ρquelin_ 2 (lHVi same as the solution of the product of Example 357 (15.5 mg, 0.031 mmol) in p-pyridine (2 ml) at room temperature with n-butylamine (0.030 ml, 0.31 mmol) Ear) for 4 hours. Remove the solvent under a warm stream of nitrogen and place the residue on a Waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size). Purify by preparative HPLC. Use 10% to 100% ethyl wax: a gradient solution of 0.1% trisgasic acid in water to produce the title compound (1.2 mg, 7.2%). MS (ESI-) m / z 537 (M-Η) · · 1H NMR (300 MHz, DMSO -d6) 5 〇 · 91 (t, J = 7.35 Hz, 3H) 1.04 (d J = 6.62 Hz, 6H) 1.36 (m, 2H) 1.64 (m, 2H) 1.87 (m, 1H) 2.66 (m, 2H) 3.05 (m, 2H) 4.62 (s, 2H) 5.96 (t, J = 7.54 Hz, 1H) 7.10 (t, J = 6.80 Hz, 1H) 7.39 (d, J = 9.19 Hz, 1H) 7.59 (m, 2H) 8.02 (d, J = 8.82 Hz, 1H) 8.09 (d, J = 8.09 Hz, 1H) 16.54 (s, 1H). 89166 -546- 200427678

Example 372 RZ N- {344-Hydroxy-M3-methyl certain butyl V2 ketodihydro-1,8-piperidine-3-even 1-U-digasification-4H-1,2,4-benzyl Pyridoxine-7-yl} acetamidine Example 205 product (0.020 g, 0.047 mmol) in pyridine (0.5 ml), acetic anhydride (0.057 g, 0.0053 ml, 0.056 mmol) was added . The reaction mixture was heated in a microwave reactor at 100 ° C for 30 minutes. The reaction was poured into 30 ml of water. The solid was collected by filtration to give the title compound (15.8 mg, 72%). 1H NMR (300 MHz, DMSO-d6) 5 0.98 (d, J = 6.62 Hz, 6H) 1.57 (m, 2H) 1.70 (m, 1H) 2.10 (s, 3H) 4.48 (m, 2H) 7.48 ( dd, J = 8.09, 4.78 Hz, 1H) 7.66 (d, J = 8.82 Hz, 1H) 7_78 (m, 1H) 8.30 (d, J = 1.84 Hz, 1H) 8.55 (dd, J = 7.72, 1.84 Hz, 1H) 8.87 (dd, J = 4.60, 1.65 Hz, 1H) 10.39 (s, 1H) 14.21 (br s, 1H). MS (ESr) m / z 468 (MH) '. Example 373 2,2,2- Trifluoro-Team {3- "4-Hydroxy-1- (3-methylbutyl) -2-one-1,2-dioxin.-] Yunkou Preparation 3-yl 1-1,1 -Oxidation of 4H-1,2,4-benzyl-digeny-7 · m}} The product of acetamidine in Example 205 (0.043 g, 0.1 mmol) in 5 ml of chloroform. Trifluoroacid (0.074 g, 0.35 mmol) was added dropwise. The reaction mixture was stirred for 30 minutes, and the solution was separated between ethyl acetate and water. The ethyl acetate layer was washed with brine and knees with sulfuric acid. The steel was dehydrated, filtered, and concentrated under reduced pressure to give the title compound (0.048 g, 92% yield). MS (ESI—) m / z 522 (MH) — · The sodium salt of the title compound was based on the example id The procedure is made. 1H NMR (300 MHz5 DMSO-d6) δ 0.96 (d5 J = 6.62 Hz? 6H) 1.48 (m5 2H) 1.65 (m, 1H) 4.30 (m, 2H) 7.14 (dd, J = 7.54, 4.60 Hz, 1H) 7.35 (d, J = 8.82 Hz, 1H) 7.83 (dd, J = 8.82, 2.57 Hz, 1H) 8_07 (d, J = 2.57 Hz, 1H) 8.37 (dd, J = 7.72, 89166 -547- 200427678 1.84 Hz, 1H) 8.54 (dd, J = 4.78, 1.84 Hz, 1H) 11.43 (s, 1H) 16.09 (s, 1H) · Example 374 2,2,2-trifluoro: y- 丄 3 two [4-guinea -Io-methylbutyl) -2-keto-1,2-dihydro-1,8-xanilidin-3-yl 1-8-nitro.yl.-1,1-digasified-4H -1,2,4-Dipyridine-Ethyl-7-yl} acetamidine in a solution of trifluoroacetic acid (2.5 ml) and trifluoroacetic anhydride (2.5 ml), at 0 ° C, The product of Example 205 (0.5 g, 1.17 mmol) was added in portions. The resulting red solution was stirred at 0 ° C for 30 minutes, cooled to -20 ° C, and treated with potassium nitrate (0.13 g, 1.3 mmol) in portions. The mixture was stirred at -20 ° C for 1 hour, poured onto ice, and the yellow-brown solid formed was collected by filtration, washed with water, and dried to constant mass to give the title compound (0.628 g, 94% yield ). Μ3 (Ε8Γ) ηι / ζ567 (Μ · Η)-· The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO_d6) (5 0.96 (d, J = 6.62 Ηζ, 6H) 1.49 (m? 2H) 1.64 (m5 1H) 4.30 (m5 2H) 7.16 (dd? J = 7.72, 4.78 Hz, 1H) 7.67 (m? 2H) 8.38 (dd3 J = 7.54, 2.02 Hz5 1H) 8.57 (dd? J = 4.41, 1.84 Hz5 1H) 11.61 (s, lH) 16.67 (s, lH) · Example 375 11 [.1 ， 1-dioxide-3- (trifluoromethyl) -4,7-dihydroimidazole # 『4,5_111「 1,2,41benzyl-4-diphenyl-3-yl 1_4-hydroxy-1- (3 -Methylbutyl VL8-4pyridine_2aHV ketone A mixture of the product of Example 374 (0.043 g, 0.075 mmol) and iron powder (0.025 g, 0.45 mmol) in acetic acid (2 ml), at 8 It was heated at 0 ° C for 1 hour, cooled, diluted with 20 ml of ethyl acetate, and filtered through a celite® packed column. The ethyl acetate filtrate was washed with water and brine, dried over sodium sulfate, filtered, and concentrated to obtain The title compound was an orange solid (0035 g, 90% yield). MS (ESr) m / z 519 (Μ-Η) — · The sodium salt of the title compound was according to the procedure of Examples 89166-548-200427678 ID 1H NMR (300MHz, DMSad6) δ〇97 (d, J = 6 25 Hz, 6H) 1.48 (m, 2H) 1.66 (m , 1H) 4.31 (m, 2H) 7.14 (m, 1H) 7.25 (d, J = 8.46 Hz, 1H) 7.96 (d? J = 9.19 Hz? 1H) 8.38 (d? J = 6.99 Hz5 1H) 8.54 (m 1H) 14.46 (s? 1H) 16.33 (s, 1H). Example 376 3-(7: abdominal shame—1,1-dioxide_4H-1,2,4 The product of Example 374 (0.500 g, 0.88 mmol) with potassium carbonate (1.4 g, 10.1 mmol) in methanol (20 ml) ), Tetrahydrofuran (8 ml) and water (8 ml), heated at 60 ° C for 4 hours, cooled, and concentrated. The resulting residue was dissolved in ethyl acetate and treated with 1 M hydrochloric acid to The pH was about 1, washed with brine, dried over sodium sulfate, filtered, and concentrated to give the title compound as a brown solid (0.4 g, 96% yield). MS (ESI-) m / z 471 (M-Η) .. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 0.96 (d? J = 6.62 Hz? 6H) 1.45 (m5 2H) 1.64 (m5 1H) 4.28 (m? 2H) 6.37 (s, 2H) 7.13 (dd, J = 7.17, 4.23 Hz, 1H) 7.16 (d, J = 9.19 Hz, 1H) 7.33 (d, J = 9.19 Hz3 1H) 8.35 (dd? J = 7.72, 1.84 Hz, 1H) 8.53 (dd5 J = 4.78, 1.84 Hz? 1H) 16.02 (s? 1H). Example 377 3- (7,8-diamino-1,1-dioxide-4H-1,2,4-benzo-p-dioxin-3 -Yl) -4-transyl small (3-methylbutyl M, 8-pyridine-2riHVS) Same product of Example 376 (2.1 g, 4.45 mmol), iron powder (1.24 g, 22.25 mmol) ) And ammonium chloride (0.29 g, 5.3 mmol) in methanol (50 ml), tetrahydrofuran (50 ml) and water (20 ml), heated at 75 ° C for 6 hours 89166 -549- 200427678 ' Cool and filter through a Celite® packed column. The filtrate was treated with 1 μ hydrochloric acid to a pH of about 2 and the solution was concentrated under vacuum. The resulting residue was stirred in 100 ml of water for 30 minutes and filtered to The solid was collected and then triturated with 50 ml of diethyl ether, filtered, and dried to give the title compound (1.72 g, 87% yield MS (ESr) m / z441 (M-Η) · The sodium salt of the title compound was prepared according to the procedure of Example 1D. 1H nmR (300 MHz, DMSad6) accounted for 0.996, j = 6 62 Hz, 6H) 1.49 (m, 2H) 1.63 (m, 1H) 4.28 (m, 2H) 4.63 (s, 2H) 5.20 (s, 2H) 6.30 (d, J = 8.09 Hz? 1H) 6.74 (d5 J = 8.46 Hz? 1H) 7.10 (dd5 J = 7.72, 4.78 Hz, 1H) 8.34 (dd, J = 7.72, 1.84 Hz, 1H) 8.50 (dd, J = 4.60, 2.02 Hz, 1H) 15.41 (s, 1H ) Example 378 Hydroxyl-U-dioxide · 4,7 · Dihydroimidazole # 「4.5-hllX2,41 茉 ## 彡 工 _3- · H- (3-methylbutyl Vl, 8-pyrimidinone A mixture of the product of Example 377 (0.022 g, 0.05 mmol) and urea (0.012 g, 0.2 mmol) in N, N-dimethylacetamide (0.5 ml) in a sealed tube by Microwave heating at 180 ° C for 60 minutes. The mixture was allowed to cool and subjected to liquid separation between ethyl acetate and water, and adjusted to pH 3 with 1M hydrochloric acid. The ethyl acetate layer was washed with water and brine, dried over sodium sulfate, filtered, and concentrated. The residue was chromatographed on silica gel, first with dichloromethane and then with 96: 4 dichloromethane / methanol to give the title compound (0.022 g, 90% yield). MS (ESI_) m / z 467 (M-Hy _ sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMRpOOMHADMSOO δ 0.97 (d, J = 6.62 Hz, 6H) 1.49 (m, 2H) 1.65 ( m, 1H) 4.29 (m, 2H) 6.69 (broad s, 1H) 7.00 (broad s., lH) 7.12 (dd, J = 7.72, 4.78 Hz, lH) 8.36 (m, lH) 8.51 ( dd, J = 4.41, 1.84 Hz, 1H) 10.66 (s, 1H) 15.76 (s, 1H). 89166 -550- 200427678 Example 379 4-alkyl-1- (3 • methylbutyl) -3_ (8-methyl-1,1-digasification_4,7-diodor 4 and "4,5-hl [1,2,41 benzopyrene-3-a certain M, 8-pyridine- 2ηΐΤ ^ ϋ | A mixture of the product of Example 377 (0.022 g, 0.05 mg of mol) and acetic acid (1 ml) was heated in a sealed tube by microwave at 160 ° C for 30 minutes, cooled, and Filtration to collect the solid, which was repeatedly washed with diethyl ether, and dried to give the title compound 'as a tan solid (0.006 g, 26% yield). MS (ESI-) m / z465 (Μ-Η) _ · Title The sodium salt of the compound was prepared according to the procedure of Example 1D. 1H NMR (300 MHz, DMSO-d6) 5 0.97 (d? J = 6.62 Hz? 6H) 1.48 (m5 2H) 1.64 (m, 1H) 2.47 (s, 3H) 4 .31 (m, 2H) 6.98 (d, J = 8.46 Hz, 1H) 7.13 (dd, J = 7.54, 4.96 Hz, 1H) 7.67 (d, J = 8.46 Hz, 1H) 8.38 (dd, J = 7.54, 2.02 Hz, 1H) 8.53 (dd, J = 4.60, 1.65 Hz, 1H) 12.57 (s, 1H) 16.04 (s, 1H). Example 380 3-Dioxide_8- (5 Fluoroethyl) -4,7 · dihydroamido [~ 4,5-hl [l, 2,41benzodiaphthin-3-yl1-4-meryl-1- (3-methyl Butyl naphthalene-2 (1HV ketone) A mixture of the product of Example 377 (0.022 g, 0.05 mmol) and pentafluoropropionic acid (0.5 ml) was heated in a sealed tube by microwave at 130 ° C After cooling for 30 minutes, and concentrating under reduced pressure, the crude material was chromatographed on silica gel, firstly dichloromethane and then 99: 1 dichloromethane / methanol were dissolved to give the title compound (0.011 g, 38% yield rate). MS (ESr) m / z 569 (M-H) ... The sodium salt of the title compound was prepared according to the procedure of Example 1D. iHNMR (300MHz, DMSO-d6) δ 0.98 (d, J = 6.25 Hz, 6H) 1.52 (m, 2H) 1.69 (m, 1Η) 4.37 (m, 2H) 7.30 (m, 2H) 7.97 (m, 1H) 8.54 (m, 2H) 14.65 (m, 1H). Example 381 89166 -551-200427678 1-Valerylmethyl) amino 1-4-benzyl-3- (7-¾ -8-nitro-1,1-dioxo-4H-1,2,4-benzilopyrimidin-3_yl> 4-line-2 (111) -one The product of Example 320C (47 mg , 〇11 mol) in concentrated sulfuric acid (2 ml), treated with ammonium nitrate (10 mg, 0.13 mol) at 0 ° C. Expanded at ambient temperature: after stirring for 25 minutes, the The solution was poured into ice water, and the precipitate was filtered, dried, and purified by flash chromatography, and dissolved in 2% methanol in dichloromethane to give the title compound (10 mg, 19%). 乂 3 (£ 81-) 111 ^ 470〇1-11) -WNMRpOOMHz.DMSO-dd 5 0.14 (d, J = 4.04Hz, 2H) 0.41 (m, 2H) 1.01 (m, 1H) 2.84 (d, J = 6.99 Hz, 2H) 7.44 (m, 2H) 7.77 (d, J = 9.56 Hz, 1H) 7.88 (t, J = 7.91 Hz, 1H) 8.08 (d, J = 8.46 Hz , 1H) 8.16 (dd, J = 8.09, 1.10 Hz, 1H) 11.83 (s? 1H). Example 382 3:. (7 _: {2-f (3S) -_ 3: Calendar Tetrahydropyrrole_i_some i_2_g | g | λ fluorenyl digasification-4H-lAii-Syridyl) -H (cyclopropylmethyl Dfe-1-4-hydroxypyridin-2 (1HV ketone The product from Example 384, 1- | &gt; (dimethylamino) propyl] Ethylcarbodiimide hydrochloride and 1-hydroxybenzotriazole in N, N-dimethylformamide Into the mixture was added tetrahydrofuran 1: l-3 (8) _amino_aminomethyl acid tert-butyl ester. The mixture was stirred for 1 day. The solution was poured into ethyl acetate and saturated sodium bicarbonate , Washed with water, brine, and dried over magnesium sulfate. The solvent was removed by vacuum. The residue was triturated with methanol / water and filtered. The solid was added to hydrochloric acid M in dioxolane, 2 ml), It was stirred overnight, filtered, and washed with ethyl acetate / hexane (1 ·· 1) to obtain the title compound. Preferable Example 383 M3- {1 _ "(cyclopropylmethyl) amine ^ _ meridyl_ 2_keto-u-dihydrazone 4. Each base of the strain [89166 -552- 200427678, 1,]: dioxide_4H-1,2,4_benzopyrimidiculture_7_even, oxygen grave __ Product of Example 384 (24 mg, 0.05) from ethyl acetamidine in N, N-dimethylformamide (2 ml) Mol), 1- [3 · (dimethylamino) propyl] each ethyl carbodiimide hydrochloride (16 g, 0.08 mmol) and 1-hydroxybenzotriazole ( Within 14 mg, 〇1 mmol, ethylamine (100 μl, 2 M in tetrahydrofuran, 0.2 mol) was added. The mixture was stirred for 1 day. The solution was poured into ethyl acetate (40 ml), washed with a saturated aqueous sodium hydrogen carbonate solution, water, brine, and dried over magnesium sulfate. The solvent was removed under reduced pressure. The residue was triturated with methanol / water and filtered to obtain the title compound (6 mg, 24%). iHNMRpOOMHz'DMSOdg) 5 0.20 (m, 2H) 0.45 (m, 2H) 1.00 (m, 1H) 1.07 (t, J = 7.08 Hz, 3H) 2.70 (s, 2H) 3.18 (m, 2Η) 4.49 (s5 2H) 5.99 (s5 br? 1H) 7.08 (s? Br5 1H) 7.23 (s? Br5 3H) 7.52 (s, br, 1H) 7.70 (s, br, 1H) 7.88 (s, br, 1H) 8.09 (d, J = 7.81 Hz, 1H) · MS (ESI >> m / z510 (MH) '

Example 384A "(3) H (Cyclopropylmethyl) amine 1-4-hydroxy-2-keto-U-di-Wei, oxoline_3_some 丨 -U-digasification · 4Η_1 · 2 · 4 • Benzobutyridine_7_Gyrosyl 1 Acetyl Alcohol Second Ding Biao Makes the product of Example 320C (400 mg, 0.94 mmol) at ν, N-dimethylformamide (10 Ml), with tert-butyl bromoacetate (0.555 ml, 3.76 mmol), potassium carbonate (1.225 g, 3.76 mmol) and tetrabutylammonium iodide (catalyst) at 25 Reaction was performed overnight at ° C. The reaction mixture was diluted with water and adjusted to pH 7 with glacial acetic acid. The reaction was extracted with ethyl acetate, and the organic layer was washed with an aqueous sodium hydrogen carbonate solution, water and brine, and dehydrated with anhydrous magnesium sulfate. Dry, filter, and concentrate under reduced pressure. Chromatograph the resulting residue on silica gel and dissolve in a gradient of 3 ·· 1 hexane ·· ethyl acetate to 1: 1 hexane ·· ethyl acetate , 89166 -553-200427678 to give the title compound (195 mg, 38%).

Example 384B cyclopropylmethyl) amino 1-4-pharmacyl-2-gangyl-1,2-dihydrobenda-3-yl 丨 digasification-4H-1,2,4-benzyl Geng-7-based) gas was mixed with the product of Example 384A (195 mg, 0.36 mmol) in a mixture of trifluoroacetic acid (5 ml) and dichloromethane (5 ml) at 25 ° C Stir for three hours. The solvent was removed under reduced pressure. The residue was triturated with hexane / ethyl acetate (1: 1) and filtered to give the title compound (114 mg, 65%). iHNMR (300MHz, DMSO-d6) 5 0_ 14 (d, J = 4.04 Hz, 2H) 0.41 (d, J = 7.35 Hz, 2H) 1.02 (m, 1H) 2.86 (d, J = 6.25 Hz, 2H ) 4.88 (s, 2H) 6.44 (s5 1H) 7.39 (m, 3H) 7.67 (d, J = 8.82 Hz, 1H) 7.89 (m, 1H) 8_10 (d, J = 8.46 Hz, 1H) 8.17 ( dd, J = 1.47 Hz, J = 6.62 Hz, 1H) 13.16 (s, 1H) 14.07 (s, 1H) 15.12 (s, 1H) MS (ESr) m / z 483 (MH) 'Example 385 Tetrahydropyrrole (Small group) -2_ketoethyl group 1-1,1-digasification_4H-U.4- group 丨 _14 (cyclopropylmethyl) amino group1-4-hydroxyquinoline-2 (1HV Keto in N, N-dimethyl-methylformamide (2 ml) Example 384B product (24 mg '0.05 hamol), dimethylamino) propyl] Ethylcarbodiimide hydrochloride Salt (16 grams g '0.08 mmol) and 1-hydroxybenzotriazole (14 mg, 0.1 mmol) added tetrahydropyrrole-yl-aminomethyl acid tert-butyl ester (19 Milligrams, μmole) The mixture was stirred for 1 day. The solution was poured into ethyl acetate (40 ml) 'and washed with a saturated sodium bicarbonate aqueous solution, water and brine, dried over magnesium sulfate', filtered, and concentrated. The residue was triturated with methanol / water and filtered. Treat the solid with hydrochloric acid (2M in dioxolane, 2 ml), stir 89166-554-200427678, stir overnight, filter, and wash with ethyl acetate / hexane (1: 1) to give the title Compound (15 mg, 51%). iHNMRGOOMHz, benzene-d6) 5.0_16 (m, 2H) 0.43 (m? 2H) 1.01 (m? 1H) 2.14 (m? 2H) 2.29 (m? 1H) 2.89 (d? J = 6.84 Hz5 2H) 3.36 (m , 2H) 3.81 (m, 2H) 4.88 (m, 2H) 7.42 (m, 3H) 7.61 (m, 1H) 7.88 (m5 1H) 8.09 (d, J = 8_30Hz, lH) 8.17 (d, J = 8.30Hz, lH) 8.28 (s, 3H) 13.99 (s, lH). MS (ESr) m / z551 (MH) &quot; .793695 Example 386 DL2 3- (8-amino-7-hydroxy-U-di Oxidation of 4H-1,2,4-benzopyrene-3_ylH _ "(cyclopropylmethyl) amino1-4-hydroxyquinoline-2 (1HV ketone product of Example 381 (10 mg , 0.021 mmoles), iron powder (5.9 mg, 0.105 mmoles) and ammonium chloride (1.3 mg, 0.024 mmoles) in methanol: tetrahydrofuran: water (2: 2: 1,2 ml) , And heated at 60 ° C for 1 hour. The solution was filtered through Celite® and washed with tetrahydrofuran. The solution was evaporated under reduced pressure, and the residue was triturated with ethyl acetate, filtered, washed with water, and dried to obtain Title compound (5 mg, 53%). IHNMRpOOMHsDMSOO 5 0.13 (d5 J = 3.68 Hz5 2H) 0.40 (d? J = 7.72 Hz, 2H) 1.02 (m5 1H) 2.85 (d? J = 5.52 Hz, 2H) 5 .40 (s, 2H) 6.46 (s, 1H) 6.65 (d, J = 8.09 Hz, 1H) 7.00 (d, J = 8.09 Hz, 1H) 7.45 (t, J = 7.35 Hz, 1H) 7.89 (t, J = 7.17 Hz, 1H) 8.10 (d, J = 8.46 Hz, 1H) 8.17 (d, J = 8.82 Hz, 1H) 10_13 (s, 1H) 13.82 (s, 1H ) 15.17 (s, 1H). MS (ESI-) m / z 440 (MH) '

Example 387A 2-ΙΤ3-Π-Ι Cyclopropylmethyl) Amine 1. · 4-hydroxy-2-keto-1,2-diip antolin-3-yl} each nitro 4,1-digas -4H-1Z4-jalopyridine-7-yl) a certain acetamide. The product of Example 381 (20 mg, 0.042 mmol) was added to N, N-dimethylformamidine-555- 89166. 200427678 Amine (2 耄 liters), 2-bromoacetamide ⑴ · 6 mg, 0.0084 mmoles, potassium carbonate (54.7 g, 0.168 mmoles), and tetrabutylammonium iodide (contact Media) under 25 it, at 25. (: Stirred for 18 hours. The solution was evaporated under reduced pressure, and the residue was triturated with ethyl acetate, filtered, and washed with water to give the title compound (12 mg '54%). The product of Example 387A (12 Mg, 0.023 mmol, iron powder (6.0 mg, 0.07 mmol) and ammonium chloride (1.4 mg, 0.0026 mmol) in methanol: tetrahydrofuran · water (2: 2: 1, 2 ml), heated at 60 ° C for 1 hour. Filtered solution through Celite (D, and washed with tetrahydrofuran. The solution was evaporated under reduced pressure, and the residue was triturated with ethyl acetate, Filtered ', washed with water, and dried to give the title compound (7 mg, 62%). Ihnmr (300 MHz, DMSO_d6) 5 〇 · 14 (d, J = 3.31 Hz, 2H) 0.41 (d, J = 6.99 Hz , 2H) L01 (m, 1H) 2.85 (d, J = 5_88 Hz, 2H) 4.49 (s, 2H) 5.98 (s, 2H) 6.46 (s, 1H) 6.73 (d, J = 8.46 Hz, 1H) 7.17 (d, J = 8.46 Hz, 1H) 7.44 (t, J = 7.54 Hz, 1H) 7.55 (s, 1H) 7.89 (t, J = 8.07, 1H) 7.92 (s5 1H) 8.10 (d, J = 8.46 Hz, 1H) 8.16 (d, J = 8.09 Hz, 1H) 13.86 (s, 1H) 15. 07 (s, 1H). MS (ESI.) M / z 497 (M-H) _ ·

Example 388A

[(3- {l-"(Cyclopropylmethyl) amino i-hydroxyl 2-keto-it dion / quinoline each nitro-1,1-dioxide-4H-1,2, 4-benzopyrimidin-7-yl) oxy] acetonitrile so that the product of Example 381 (20 mg, 0.042 mmol) was taken in n, N-dimethylformamide (2 ml), and 2- Bromoacetonitrile (6 µl, 0.086 mmol), potassium carbonate (54.7 mg, 0.168 mmol) and tetrabutylammonium iodide (catalyst) were reacted at 25 ° C for 18 hours. The solution was evaporated under reduced pressure, and the residue was triturated with ethyl acetate, filtered, and washed with water to give the title compound (13 mg, 60%).

Example 388B 89166 -556- 200427678 ΙΛΑ-3-Π-"(Cyclopropylmethyl) amino 1_4_hydroxy-2_one _1,2 • Dixin i, apricot 4 groups jl, l- Digasification-4Η1,2,4_benzypyrimidine_7_yl) 氲 ηη 杳 The product of Example 388A (13 mg, 0.025 mmol), iron powder (6.0 mg, 0.107 mmol) Ear) and ammonium chloride (ι · 5 mg, 0.028 mmol) in methanol: tetrahydrofuran: water (2: 2: 1,2 ml), heated at 60 ° C for 1 hour. Filtered through Celite® The solution was washed with tetrahydrofuran. The solution was evaporated under reduced pressure, and the residue was triturated with ethyl acetate, filtered, washed with water, and dried to give the title compound (5 mg, 41%). IHNMRpOOMHz, DMSO-d6 ) δ 0.14 (d5 J = 1.11Ηζ? 2Η) 0.41 (d5J = 5.88 Ηζ? 2Η) 1.01 (m? lH) 2.85 (d, J = 5.40 Hz, 2H) 5 · 23 (s, 2H) 5 · 80 ( s, 2H) 6.45 (s, 1H) 6.83 (d, J = 8.46 Hz, 1H) 7.38 (d, J = 8.46 Hz, 1H) 7_44 (t, J = 7.02 Hz, 1H) 7.90 (t, J = 7.02 Hz, 1H) 8.10 (d, J = 8_46 Hz, 1H) 8.16 (d, J = 7.74 Hz, 1H) 13.93 (s, 1H) 14.94 (s, 1H) MS (ESr) m / z 479 (MH) 'Example 389 1-"(Cyclopropylmethyl) amino 1Hydroxy-3--3-M2-hydroxyethylcarbyl VU-digas-4H-1,2, To the product of 4-benzylpyrene-3-ylline-2 (1HV ketone in tetrahydrofuran (10 ml) Example 384 (10 mg, 0.021 mmol)), borane (0.8 ml, 1 M, In tetrahydrofuran, 0.8 millimolar). The mixture was refluxed for 4 hours. It was then poured into ice water (20 mL) and acidified to pH 2 with 1 N hydrochloric acid. The solid was filtered and washed with water to give the title compound ( 5 mg, 51%). IHNMRpOOMHADMSOO 5 0.14 (d, J = 4.41 Hz, 2H) 0.41 (d, J = 7.72 Hz, 2H) 1.01 (m, 1H) 2.86 (d, J = 5.52 Hz, 2H) 3.74 (t, J = 4.78 Hz, 2H) 4.13 (t, J = 4_78 Hz, 2H) 4.89 (s, 1H) 6.44 (s, 1H) 7.41 (m, 3H) 7.65 (d, J = 9.84 Hz, 1H) 7.89 (t, J = 7.91 Hz, 1H) 8.10 (d, J = 8.46 Hz, 1H) 8.17 89166 -557- 200427678 (d, J = 7.35 Hz , 1H) 14.05 (s, 1H) 15.14 (s, 1H). MS (ESr) m / z 469 (MH)-

Example 390A ϋ7 _ "(1-benzyl-1H-imidyl) methoxyii, i_digasification_4η_ι · 2 · 4_benzyl-4-dihydroxy-3-yl} -1- (cyclopropyl (Methyl) amino i-4-hexylhydrazine U (1HV ketone) The product of Example 320C (20 mg, 0.047 mmol) was mixed with n, N-dimethylformamidine (1¾ liters) and 1-fluorenyl-2- (chloromethyl) -1 hydrazone-sigma hydrochloride (23 mg, 0.095 mmol), potassium carbonate (0.061 g, 0.187 mmol) and tetrabutylammonium iodide (Catalyst), heated together in a microwave reactor at 120 ° C for 2 hours. The solution was cooled to 25 ° C and concentrated. The residue was triturated with ethyl acetate, filtered, and washed with water to obtain The title compound (21 mg, 75%).

Example 390B Η (Cyclopropylmethyl) amino 1-4 • Hydroxy-3_ "7- (1Η-imidazol-2-ylmethyl) VU-dimulsified · 4 ·· 1,2,4_ stupid and far Two ton-3_yl ~ ^ Kui Lin_2 (1HV was added to the product of Example 390A (16 mg, 0.027 mmol) in N, N-dimethylformamide (1 ml), and 1,4 was added -Cyclodiene (25.5 μl, 0.27 mmol) and palladium black (16 mg). The mixture was heated at 70 ° C for 1 day. The mixture was filtered through Celite® and N, N'dimethyl It was washed with formamidine. The solution was evaporated under reduced pressure, and the residue was chromatographed on silica gel, and dissolved in dichloromethane · methanol (98 ·· 2) to give the title compound (6 mg, 44%). 1HNMR (300 MHz, DMSO-d6) 5 0.16 (d, J = 4_41 Hz, 2H) 0.43 (d, J = 7.35 Hz, 2H) 0.99 (m, 1Η) 2.78 (s, br, 2H) 5.25 ( s, 2H) 6.27 (s, br, 1H) 7.22 (s, 2H) 7.31 (m, 1H) 7.39 (dd, J = 9.01, 2.76 Hz, 1H) 7.49 (d, J = 2.57 Hz, 1H) 7.54 (d, J = 8.82 Hz, 1H) 7.77 (m, 1H) 7.95 (d, J = 8.09 Hz, 1H) 8.13 (dd, J = 8.09 Hz, 1.47 Hz, 1H) 14.83 (s, br, 1H) MS (ESI-) m / z 505 (MH) \ 89166 -5 58-200427678

Example 391A 13 ^ 1azole-2-ylmethyl _ oxazole-2-carboxaldehyde (113 mg, 1 mmol) in methanol (10.0 liters) C knife / person added · sodium hydride (41 Mg, 1.2 millimoles). Mix the mixture; stir at room temperature for 2 hours. The mixture was diluted with water and acidified to pH 3 with HCl, and extracted with ethyl picoate (2x5G ml). The organic layer was washed with I and sodium bisulfate water, osmium, and brine, dehydrated and dried over magnesium sulfate, and concentrated to give the title compound (69 mg, 60%). Example 391B 2- (Chloramine and pyrimazole) The product of Example 391A (66 mg, 0.57 mmol) was added dropwise to dithionyl chloride (0.2 mg) in dichloromethane (9 ml). Ml, 2.7 mmol), keeping the temperature at 25 ° C. The mixture was refluxed for 2 hours. The solvent was evaporated to give the title compound (quantitative yield).

Example 391C (· (cyclopropylamino 1-34U-digasification-7- (1,3-4azole-2-ylsulfonyl nitrogen V4H-pyrimidinyl-3-methylpyridin-4-hydroxypquinoline · 2 (ΊΗν Seco's product of Example 320C (15 mg, 0.035 mmol) in v, N-dimethylformamide (1 ml), and Example 391B (19 mg, 0.142 mmol), carbonic acid Potassium (68 g '0.209 mmol) and tetrabutylammonium iodide (catalyst) were heated at uot for 2 hours. The solution was evaporated under reduced pressure and the residue was ethyl acetate / hexane (1 : 1) Developed, filtered, and washed with water to give the title compound (17 mg, 92%). 1H NMR (500 MHz, DMSO-d6) 5 0.21 (d, J = 4.27 Hz, 2H) 0.46 ( d? J = 7.32 Hz3 2H) 0.99 (m5 1H) 2.67 (s? br5 2H) 5.49 (s5 2H) 5.95 (t5 J = 6.71 89166 -559- 200427678

Hz, 1H) 7.04 (m? 1H) 7.26 (m? 3H) 7.50 (m5 1H) 7.66 (d5 J = 8.54 Hz? 1H) 7.75 (d, J = 3.66 Hz, 1H) 7.84 (d, J = 3.05 Hz, 1H) 8.07 (dd, J = 7.93 Hz, 1.08 Hz, 1H) 16.19 (s? 1H). MS (ESP) m / z 522 (MH) '.

Example 392A "(3) H (Cyclopropylmethyl) amino1-4-hydroxy-2-keto-1,2-dioxoline-4-3-methyl-U-dioxide-4H-1,2 , 4-benzyl and 4 Erqian-7-based) 氲 some 1 λ make the product of Example 320C (0.050 g, 0.117 mmol) in Ν, Ν-dimethylformamide (2 ml), and 2-Bromoacetonitrile (16 µl, 0.230 mmol), potassium carbonate (0-15 g, 0.46 mmol) and tetrabutylammonium iodide (catalyst) were reacted at 25 ° C for 1 day. The solution was evaporated under reduced pressure, and the residue was triturated with ethyl acetate / hexane (1: 1), filtered, and washed with water to give the title compound (52 mg, 95%).

Example 392B 2-ΙΪ3- 丨 1-IT Cyclopropylmethyl-1) Amino1-4-hydroxy-2-ketodihydro4line-3-one f 1,1-Dioxide-4H-U, 4- Benzo-4, 2-7-based) gas, 1 methyl ethyl imidate at 0 ° C, hydrogen chloride gas was bubbled into the product of Example 392A (50 mg, 0.11 mmol) in methanol (10 Ml) until it is saturated. The reaction was stirred at room temperature for 3 hours. The solution was evaporated under reduced pressure to obtain the title compound (quantitative yield).

Example 392C HC Cyclopropylmethyl) amine 1-1-3M4,5-dihydro-1H-imidazol-2-ylmethoxy VU-digas-4H-L2.4-1 To a product of 392B (53 mg, 0.11 mmol) of Example 392B in 3 • M · Hydroxy-apriline_2 (1HV ketone in methanol (10 ml)), ethane-1,2-diamine (0.2 Ml, 3 mmol), and refluxed overnight. 89166 -560- 200427678 The solvent was removed under reduced pressure, and the residue was chromatographed on gelatine in 4: 1 dichloromethane / methanol to 3:22. Chloromethane / methanol 3: 2 was dissolved to obtain the title compound (11 mg, 20%). 1.00 (m? 1H) 2.77 (d5 J = 6.71 Hz5 2H) 3.91 (s5 4H) 5.23 (s5 2H) 6.11 (s5 1H) 7.21 (m, 1H) 7.42 (m, 3H) 7.66 (m, 1H) 7.85 ( d, J = 7.32 Hz, 1H) 8.12 (d, J = 7.93 Hz, 1H) 10.70 (s, 1H) 15.29 (s, 1H). MS (ESI +) m / z 509 (M + H) +.

Example 393A 2- (Bromomethyl Vl, 3-pyrimazole_4-carbonitrile in 2-methyl small p-acetamidine-4-carbonitrile (248 mg, 2 mmol) in benzene (20 mL) In the solution, N-bromosuccinimide (1.78 g, 10 mmol) and dibenzoyl peroxide (20 mg, 0.08 mmol) were added. The mixture was refluxed for 2 days. The solution was evaporated under reduced pressure. The residue was separated between dichloromethane and water. The organic layer was concentrated under diminution, and the residue was chromatographed on gelatin to give a 1: 1 dichloroform : Burned and dissolved to give the title compound (190 mg, 47%)

Example 393B (Cyclopropylmethyl) amino1-4-light-2 · keto-L2-diphenyl: quinine-3-ylubyl U: · dimulsified-4H-1,2,4-benzene And far di-p-well-7-yl) oxy 1methyl 丨 -13-disk 嗤 _4_carbonitrile makes the product of Example 320C (20 mg, 0.047 mmol) in n, N-dimethylformamidine Amine (2 ml) was reacted with Example 393A (20 mg, 0.099 mmol), potassium carbonate (0.070 g, 0.215 mmol) and tetrabutylammonium iodide (catalyst) and reacted at room temperature overnight. The solution was concentrated under reduced pressure, and the residue was triturated with ethyl acetate / hexane (1: 1), filtered, and washed with water to give the title compound (23 mg, 89%). 1H NMR (500 MHz, DMSO-d6) 5 0.22 (m5 2H) 0.46 (m, 2H) 1.00 89166 -561-200427678 (m, 1H) 2.69 (m, 2H) 5.54 (s, 2H) 5.96 (t, J = 6.32 Hz, 1Η) 7.04 (m, 1H) 7.28 (m, 3H) 7.49 (m, 1H) 7.67 (d, J = 8.62 Hz, 1H) 8.08 (dd, J = 8.05 Hz, 1.70 Hz, 1H) 8.81 (s, 1H) 16.15 (s, 1H), MS (ESI ·) m / z 547 (Μ · Η)-· Example 394 3- [7- (2- Aminoethoxy VU-digasification_4H-1,2,4-Benzodiazepine-3-yl H-"(cyclodiylmethyl) amino 1 ice hydroxyl 4 morpholine-2HHV ketone A solution of the product of 392A (39 mg, 0.084 mmol) in anhydrous tetrahydrofuran (2 ml), treated with LiBH4 (1 ml, 2M, 0.2 mmol in tetrahydrofuran), and stirred at ambient temperature for 30 minutes, Then 18 microliters of water was added and stirred overnight. The solution was diluted with water (20 ml) and extracted with ethyl acetate (2 x 50 ml). The combined organic layers were washed with brine and dried over anhydrous sulphate. The slurry was filtered and the solvent was removed under reduced pressure to give the title compound (38 mg, 97%). ΒΝΜΚ ^ ΟΟΜΗζ, benzene δ δ 0_20 (d, J = 3.05 Ηζ, 2Η) 0.46 (d, J = 7_32 Ηζ, 2Η) 1.01 (m, 1Η) 2.74 (s, br, 2Η) 2.86 (m3 2H) 4.19 (t5 J = 4.90 Hz? 2H) 5.21 (s? Br, 2H) 6.04 (s? Br5 1H) 7.15 (s, br5 1H) 7.24 (s5 br? 2H) 7.32 (s5 br5 1H) 7.59 (s5 br5 1H) 7.78 (s? Br5 1H) 8.11 ( d5J = 7.32 Hz, 1H) 15.65 (s, r, 1H). MS (ESI.) m / z 468 (M-Η) · Example 395 propylmethyl) amino 1-4-hydroxy-2- Keto-1,2-dixanthine A 莘 11 ^ 11 ^ 1 ^^ 1,2,4_benzopyrimidin-7-yl) oxy 1 ethyl} methane pulse in E bite (1 To the product of Example 394 (15 mg, 0.032 mmol) was added 'methanesulfonium chloride (12 µl, (U56 mmol)). The reaction mixture was placed in a microwave reactor at 20 ° C. (: Heating for 120 minutes. The reaction was cooled to 25 C 'and concentrated under reduced pressure. The residue was triturated with water (1 ml), filtered, 89166-562-200427678 and 1: 1: hexane: ethyl acetate Ester washing; strips. The crude product was purified by chromatography on Shixi gum, and was isolated with 199: 1 dichloromethane: methanol to give the title compound (5 mg, 29%). 1H NMR (300 MHz, DMSO- d6) 5 0.14 (d, J = 4.04 Hz, 2H) 0.41 (d, J = 7.72 Hz, 2H) 1.01 (m, 1H) 2.86 (d, J = 5.52 Hz, 2H) 2 · 97 (s, 3H) 3.38 (t, J = 5.33 Hz, 2H) 4 · 18 (t, J = 5.33 Hz, 2H) 6.44 (s, 1H) 7.32 (t, J = 5.88 Hz , 1H) 7.41 (m, 3H) 7.67 (d, J = 9.93 Hz, 1H) 7.89 (t, J = 7.91 Hz, 1H) 8.10 (d, J = 8.46 Hz, 1H) 8.17 (d, J = 8 · 46 Hz, 1H) 14.08 (s, 1H) 15.11 (s, 1H) · MS (ESI.) M / z546 (M-Η) '. Example 396 3-f9_ (butylamino) _1,1-dioxide _4H, 8H- "1,41 Rinko" 2 · 34ι1 [1,2,4Ί 4 # 4 Digono-3-yl1-4-hydroxy-Ηisobutylamino V apriline-2 (1HV The product of Example 357 (15.5 mg, 0.031 mmol) was dissolved in pyridine (2 ml). Solution, treated with n-butylamine (0.030 ml, 0.31 mmol) at room temperature for 4 hours. The solvent was removed under a warm nitrogen stream and the residue was placed in a waters symmetrical C8 column (25 mm X 100 mm, 7 micron particle size), purified by preparative HPLC, using a gradient of 10% to 100% acetonitrile: 0.1% trifluoroacetic acid in water to produce the title compound (3.3 mg, 20%). MS (ESI- ) mlz 537 (MH) '. 1H NMR (300 MHz5 DMSO-d6) δ 0.92 (t5 J = 7.35 Hz? 3H) 1.04 (d, J = 6.62 Hz, 6H) 1.36 (m, 2H) 1.59 (m , 2H) 1.90 (m, 1H) 2.70 (m, 2H) 3_41 (m5 2H) 4.55 (s, 2H) 6.32 (m, 1H) 6.96 (m, 1H) 7.15 (d, J = 8.46 Hz , 1H) 7.45 (m, 1H) 7.93 (m, 2H) 8.17 (d, J = 6.62 Hz, 1H) 13.66 (s, 1H) 15.69 (s, 1H). Example 397 3- {7-1ϊ5 • Bromopyridin-2-yl) oxy 1-U · digasified-4H-1,2,4-benzylpyrene-3-yl} icelhydroxy-1- (isobutylamine -2 (1HV ketone 89166 -563-200427678) The product of Example 321C (40.0 mg, 0.09 mmol), cesium carbonate (112 mg, 0.34 mmol) and 2,5-dibromopyridine (40.0 mg, 17 milli A mixture of mol) in dimethylarylene (1.2 ml) was stirred while heating in a microwave reactor at no ° C for 20 minutes. After cooling to 25 ° C, the purple mixture was separated between ethyl acetate and water. The aqueous layer was extracted with another portion of ethyl acetate. The combined organic layers were dehydrated and dried over sodium sulfate, filtered, concentrated under reduced pressure, and purified by column chromatography on silica gel with (0-100%) dichloromethane layered gradient in hexane. Dissolve to give the title compound as an off-white solid (34.0 mg, 63%). MS (ESr) HNMR (300MHz, DMSO-d6) δ 1.05 (d5 J = 6.62 Hz5 6H) 1.93 (m5 1H) 2.73 (m5 2H) 6.35 (m, 1H) 7.19 (d, J = 8.82 Hz, 1H) 7.45 (m, 1H) 7.61 (dd, J = 8.82, 2.57 Hz, 1H) 7.77 (m, 2H) 7.94 (m, 2H) 8.13 (dd, J = 8.82, 2.57 Hz, 1H) 8.19 (m , 1H) 8.31 (d, J = 2.21

Hz, 1H). Example 398 4-Hydroxy- (isobutylamino) each (7-"(3-nitropyridin-2-yl) oxydigasification-4H-1,2,4- Benzodine di-p--3-yl p-quelin-2 (1HV ketone will be the product of Example 321C (ΐ0.0 mg, 0.02 mmol), cesium carbonate (27.7 mg, 0.09 mmol) and A mixture of 2-bromo-3-nitropyridine (8.4 mg, 0.04 mmol) in dimethylarsine (0.3 ml) was stirred while heating in a microwave reactor at 110 ° C for 20 minutes After cooling to 25 ° C, the mixture was separated between ethyl acetate and water. The aqueous layer was extracted with another portion of ethyl acetate. The combined organic layers were dried over sodium sulfate, filtered, and Concentrated under reduced pressure and purified by column chromatography on silica gel, and dissolved with a gradient gradient of 0-100% dichloromethane in hexane to give the title compound as a yellow solid (8.6 mmol 89166). -564- 200427678 g, 68%). MS (ESP) m / z 549 1H NMR (300 MHz, CDC13) (51 · 13 (d, J = 6.62 Hz, 6H) 2.00 (m, 1H) 2.81 ( m, 2H) 5.73 (m, 1H) 7.23 (m, 1H) 7.40 (m, 2H) 7.50 (dd, J = 8.82, 2.57 Hz 1H) 7.82 (m, 2H) 7.97 (m, 1H) 8.27 (dd, J = 8.09, 1.10 Hz, 1H) 8.35 (dd, J = 4.78, 1.84 Hz, 1H) 8.42 (dd, J = 8.09, 1.84 Hz, 1H) 14.39 (s, 1H) 15.02 (s, 1H). Example 399 K- {3- "4-hydroxy-H3 · methylbutyl) _2-keto-1,2-dihydro Example of -1,8 ^ naphthyridin-3-yl 1-U-dioxide-4H-1,2,4-benzylidene-2-7-yl} methanesulfonamide # in pyridine (0.2 ml) To the product 205 (0.020 g, 0.047 mmol), methanesulfonium chloride (0.0064 g, 0.0043 ml, 0.056 mmol) was added. The reaction mixture was heated in a microwave reactor at 100 ° C for 38 minutes. Minutes. The reaction was diluted with ethyl acetate (40 ml), washed with 1 N hydrochloric acid, water, and brine. The organic layer was dried over magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure to obtain a yellow solid, which was Purify by chromatography on silica gel and elute with 99: 1 dichloromethane: methanol to obtain the title compound (8.3 mg, 35%). 1H NMR (300 MHz, DMSO-d6) 5 0.98 (d5 J = 6.62 Hz5 6H ) 1.57 (m5 2H) 1.70 _ (m, 1H) 3.10 (s, 3H) 4.49 (m, 2H) 7.50 (dd, J = 7.91, 4.60 Hz, 1H) 7.58 (dd, J = 8.82, 2_57 Hz, 1H) 7.64 (d5 J = 2.21 Hz, 1H) 7_75 (d, J = 8.82 Hz, 1H) 8.56 (dd, J = 8.09, 1.84 Hz, 1H) 8.89 (dd, J = 4.60, 1.65 Hz, 1H) 10.29 (s, 1H) 14.17 (s, 1H). MS (ESI ') mlz 504 (MH)'. Example 400 N -{344-Hydroxy-H3-methanylbutyl V2 · keto-1,2-dihydro-L8-pyrimidine each group -Yl} Example of bensulfenilamide in pyridine (0.2 ml) in 205 product (0.020 g, 0.047 mmol) 89166 -565-200427678 'Add benzsulfenyl chloride (0.099 g, 0.0072 ml) , 0.056 millimoles). The reaction mixture was heated in a microwave reactor at 100 C for 35 minutes. The reaction was cooled to 25 ° C, diluted with ethyl acetate (40 ml), and washed with 1 N hydrochloric acid, water, and brine. The organic layer was dried over tritium sulfate, filtered, and concentrated. The residue was chromatographed on silica gel and dissolved in 99: 1 dichloromethane · methanol to obtain the title compound (18.6 mg, 69%). iHNMRpOOMH ^ DMSOO 6 0.97 (d, J = 6.25 Hz, 6H) 1.56 (m, 2H) 1_68 (m, 1H) 4.46 (m5 2H) 7.47 (m, 3H) 7.61 (m, 4H) 7.80 ( d, J = 6.99 Hz, 2H) 8.54 (dd, J = 7.91, 1.65 Hz, 1H) 8.87 (dd, J = 4.23, 1.29 Hz, 1H) 10.85 (s, 1H) 14.08 (to s, 1H). MS (ESI ·) m / z 566 (MH) — · Example 401 Ν- {3 · | ~ 4-Hydroxy (3_methyl certain butyl V2-keto-1,2-difluorene-1 , 8-Pyridin-3-yl 1-U-—emulsified-4H-1,2,4-benzyl and 2 wells-7-yl 丨 p-phene-2_phenoxyamine in pyridine (1 ml) In the product of Example 205 (21.5 mg, 0.05 mmol), 2-thiophenesulfonium chloride (44 mg, 0.24 mmol) was added. The reaction mixture was placed in a microwave reactor at 120 ° C. Heated for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 ml), filtered, and washed with hexane: ethyl acetate (1 ·· 1). The crude product was chromatographed on silica gel and dissolved in 199: 1 dichloromethane · methanol to give the title compound (10 mg, 35%). IHNMRpOOMH ^ DMSO-A); 5 0.97 (d, J = 6.25 Hz, 6H ) 1.55 (m, 2H) 1.66 (m, 1H) 4.46 (t, J = 7.84 Hz, 2H) 7.16 (dd, J = 5.13 Hz, 3.66 Hz, 1H) 7.48 (m, 2H) 7.53 (d, J = 2.21 Hz, 1H) 7.56 (d, J = 2.55 Hz, 1H) 7.61 (dd, J = 3.68, 1.47 Hz, 1H) 7.68 (d, J = 8.82 Hz, 1H) 7.96 (dd, J = 5.13 Hz, L47 Hz, 1H ) 8.53 (dd, J = 8.09, 1.84 Hz, 1H) 8.87 (dd, J = 4.78, 1.84 Hz, 1H) 10.98 89166-566- 200427678 (s, 1H) 14.10 (s, 1H). MS (ESI-) m / z 572 (Μ · Η)-· Example 402 propyl-1- (3-methylbutyl) -2-fluorenyl-1,2-diazine-1,8-peak lake- Product of Example 205 (21.5 mg, 3-Diodine-4H-1,2,4-jasmine # pyridine-7-kibmethyl-1H-amidazole-4-carbohydrate) in pyridine (1 ml) 0.05 mol) was added to 1-methyl melamine acetic acid (44 mg, 0.24 mol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 ml), filtered, and washed with 1: 1 hexane: ethyl acetate to give the title compound (21 mg, 73%). 1H NMR (300 MHz, DMSO-d6): 0 · 98 (d, J = 6.62 Hz, 6H) 1.56 (m, 2H) 1.68 (m, 1H) 3.66 (s, 3H) 4 · 48 ( m, 2H) 7.58 (m5 5H) 7.78 (d, J = U1 Hz, 1H) 7.92 (d, J = 1.47 Hz, 1H) 8.55 (dd, J = 8.09, 1.84 Hz, 1H) 8 · 89 (dd, j = 4.78, 1.84 Hz, 1H) 10.80 (s, 1H) 13.99 (s5 1H) · MS (ESI ·) m / z 570 (Μ · Η) 'Example 403 4,5-Dichloro-N -{3- [~ 4-Hydroxymethyl butyl V2-keto-1,2-dihydro-1,8 "each of the pyridyl groups H, l-digasification-4H-1,2,4 -Product of Example 205 (0.020 g, 0.047 mmol) of 2-ton-7-yl-hsphen-2--2-pyrene in pyridine (0.2 ml) was added with 2,3-dichloro chloride Pyrimidine-5-sulfofluorene (0-15 mg, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100 ° C for 15 minutes. The reaction was diluted with ethyl acetate (40 ml) and washed with 1 N hydrochloric acid, water and brine. The organic layer was dried over magnesium sulfate, filtered, and concentrated. The residue was chromatographed on silica gel and dissolved in 99: 1 dichloromethane: methanol to give the title compound (14.8 mg, 50%). iHNMRpOOMHz'DMSO-cU (5 0.98 (d, J = 6.25 Hz, 6H) 1.56 (m, 2H) 1.69 (m, 1H) 4.47 (m5 2H) 7.50 (m, 2H) 7.56 (s5 89166- 567- 200427678 1H) 7.71 (d, J = 8.82 Hz, 1H) 7.76 (s, 1H) 8_55 (dd, J = 7.91, 2.02 Hz, 1H) 8.88 (dd, J = 4.60, 1.65 Hz, 1H) 11.28 ( s, 1H) 14.19 (br s, 1H). MS (ESI ·) m / z 640 (MH) 'Example 404 2,2,2-trigas-N- {3-``4-rokonylmethylbutane Yl) -2-pyridyl-1,2-diazine-lj-p nayodo tank 3-yl 1-U-digasification_4H-1,2,4-benzilopyridine-7-yl } The product of Example 205 (21-5 mg, 0.05 mmol) of ethanesulfonamide in pyridine (1 ml) was added with 2,2,2-trifluoroethanesulfonium chloride (28 µl, 0.25 mmol) Mol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 ml) and filtered And washed with 1: 1 hexane: ethyl acetate. The crude product was chromatographed on silica gel and eluted with 1: 1 ethyl acetate / hexane to give the title compound mg, 17%. 1H NMR (300 MHz , DMSO-d6); (5 0.97 (d , J = 6.62 Hz, 6H) 1.49 (m, 2H) 1.64 (m, 1H) 4.31 (t, J = 7.53 Hz, 2H) 4.58 (q, J = 9.93 Hz, 2H) 7.17 (dd, J = 7.35, 4.78 Hz, 1H) 7.43 (m, 4H) 8.38 (dd, J = 7.72, 1.84 Hz, 1H) 8.57 (d, J = 2.94 Hz, 1H) 10.63 (s , 1H) 15.90 (s, 1H) · MS (ESI ·) m / z 572 (MH) '.. Example 405 _1_ (β-methyl: r group V2-keto-1 · 2_dioxin_3 -Base 1_U- Phenylhydrazine-7-yl} amine, the product of Example 205 (21.5 mg, 0.05 mmol) in methylene chloride (1 ml) with methyl acetate Sulfomethyl acetate (35 mg, 0.2 mmol) and triethylamine (30 µl, 0.22 mmol), and the resulting mixture was stirred at room temperature for 3 days. When the reaction was completed, the solvent was removed under reduced pressure. The residue was chromatographed on 89166-568-200427678 silica gel, and the residue was dissolved in 199: 1 dichloromethane · methanol. The product was dissolved in dichloromethane, and two drops of acetic acid were added, followed by stirring at room temperature for 10 minutes and washing with water. The organic layer was dried over iron sulfate and evaporated in vacuo to give the title compound (2 mg, 7%). 1HNMR (300 MHz, DMSO-d6): 5 0.99 (d, J = 6.62 Hz, 6H) 1.57 (m, 2H) 1.70 (m, 1H) 3.65 (s, 3H) 4.40 (s, 2H) 4.49 (m, 2H) 7.50 (dd, J = 7.91, 4.60 Hz, 1H) 7.59 (dd, J = 8.82, 2.57 Hz, 1H) 7.66 (d, J = 2.57 Hz, 1H ) 7.76 (d, J = 8.82 Hz, 1H) 8_57 (dd, J = 8.09, 1.84 Hz, 1H) 8.90 (dd, J = 4.41, 1.84 Hz, 1H) 10.73 (s, 1H) 14 · 15 (s5 1H). MS (ESI ·) m / z562 (M_H) 'Example 406 N- {3Hydroxy-H3-methylbutyl &gt; 2-keto-1,2-dioxine.- 1 · "Nyridine_3 · • A 1-U-Dioxide_4H-1,2,4-Stupid and far two_ -7-A} Example of Ethyl Burning Spectrum Ai in Pyridine (1 ml) 205 To the product (21.5 g, 0.05 mmol), ethanesulfonium chloride (19 μl, 0.2 mmol) was added. The reaction mixture was heated in a microwave reactor at 120 ° C. for 120 minutes The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 ml), filtered, and washed with 1: 1 hexane · ethyl acetate. The crude product was put on silicone Chromatography with 199: 1 dichloroformamidine: methanol to give the title compound (3 mg , Η%). 1H NMR (300 MHz, DMSOd6): 5 0.98 (d, J = 6.62 Ηζ, 6Η) 1.22 (t, J = 7.35 Hz5 3H) 1.58 (m5 2H) 1.70 (m5 1H) 3.20 ( q, J = 7.35 Hz? 2H) 4.49 (m5 2H) 7.50 (dd, J = 7.91, 4.60 Hz, 1H) 7.58 (dd, J = 8.82, 2.57 Hz, 1H) 7.65 (d, J = 2.57 Hz , 1H) 7.74 (d, J = 9.19 Hz, 1H) 8.56 (dd5 J = 8.09, 1.84 Hz, 1H) 8.89 (dd, J = 4.60, 1.65 Hz, 1H) 10.35 (s, 1H) 14.15 (s , 1H) · MS (ESI ·) m / z 518 (MH) 'Example 407 89166 -569- 200427678 N- {3- "4-hydroxy-1--1- (3-methylbutyl V2-keto-1 , 2-di-1 _1 · 8_ 啳 冷 -3-yl 1_U-di-emulsified-4H_1,2,4-benzyl and p-di 4 _7-yl (1 ml) of the product of Example 205 (21.5 g, 0.05 mmol) was added with isopropyl chloride (22 µl, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 ml), washed with water, and washed with 1: 1 hexane: ethyl acetate. The crude product was chromatographed on silica gel and eluted with 199: 1 dichloromethane · methanol to give the title compound (2 mg, 7%). 1H NMR (300 MHz, DMSO-d6): 5 0.98 (d, J = 6.62 Hz, 6H) 1.28 (d, J = 6.99 Hz, 6H) 1.57 (m, 2H) 1.71 (m, 1H) 3.29 (m, 1H) 4.49 (m, 2H) 7.50 (dd, J = 7.91, 4.60 Hz, 1H) 7.59 (dd, J = 8.82, 2.57 Hz, 1H) 7.67 (d, J = 2.57 Hz, 1H) 7.74 (d, J = 9.18 Hz, 1H) 8.56 (dd, J = 8.09, 1.84 Hz, 1H) 8.89 (dd, J = 4.60, 1.65 Hz, 1H) 10.33 (s, 1H) 14.11 (s, 1H) · MS (ESI,) m / z 532 Example 408 N- {3- "4-Rotyl-1- (3-methylbutyl) -2- 酉Homo-1,2-difluorene · -1,8 ′ Nai-3_yl Vl, l_ Dioxane-4H-1,2,4-Benzobi_-7-kibbu 1-phenylmethyl The solution of the product of Example 205 (21.5 g, 0.05 mmol) in pyridine (1 ml) was treated with α-toluene chloride Si (38 mg, 0.2 mmol) in In a microwave reactor, heat at 120 ° C for 120 minutes, cool to 25 ° C, and concentrate under reduced pressure. Triturate the residue with water (1 mL), filter, and burn with ethyl acetate (1 : 1) Washing. The crude product is chromatographed on silica gel and dissolved in dichloromethane: methanol (399: 1) to obtain Title compound (7 mg, 24%). 1HNMR (300 MHz? DMSO-d6) δ 0.99 (d5 J = 6.62 Hz5 6H) 1.58 (m? 2H) 1.69 (m51H) 4.49 (m, 2H) 4.59 (s , 2H) 7.32 (m, 5H) 7.51 (m, 2H) 7.57 (d, J = 2.21 Hz, 1H) 89166 -570- 200427678 7.71 (d, J = 8.82 Hz, 1H) 8.57 (dd, J = 8.09, 1.84 Hz, 1H) 8.90 (dd, J = 4.78, 1.84 Hz, 1H) 10.38 (s, 1H) 14.08 (s, 1H) 15.14 (s, 1H) (ESI ·) m / z 580 (MH)-·

Example 409A N- "3- (4- # f group-1 · isopentyl-2-one group-1,2-dihydro_1 · 8-peak cold-3-yl) -1,1-digas Product of Example 205 (21.5 g, 0.05 mmol) Ear), 2-nitrobenzenesulfonium chloride (44 mg, 0.2 mmol) was added. The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with hexane: ethyl acetate (1: 1). The crude product was chromatographed on Shixi gel, and calcined with dichloromethane: methanol (399: 1). ) To give the title compound (8 mg, 26%).

Example 409B} Amine_yl-N_ [3- (4-Cyclo-iso-pentyl-2-one-1,2-dioxan, _1,8_kounanido_3 • M, 1 · r- Emulsification_4'-1,2,4-Benzo-sepodipent-7-ylpyridine amine will be the product of Example 409A (8 mg, 0.013 mmol), iron powder (5.0 mg, 0.089 Mol) and ΝββΚΙ mg, 0.019 mol) in methanol: tetrahydrofuran · water (2: 2L 1,10 ml), and heated under the conditions of 2 hours. The solution was filtered through Celite® and washed with THF. The solution was concentrated, and the residue was diluted with water and extracted with ethyl acetate. The organic layer was washed with water, dried over MgS04, filtered, and concentrated to give the title compound (7 mg '92%). 1H NMR (300 MHz, DMSO-d6) 5 0.97 (d, J = 6.62 Hz, 6H) 1.54 (m, 2H) 1.68 (m, 1H) 4.46 (m, 2H) 6.06 (s5 2H) 6.59 (t, J = 7.17 Hz, 1H) 6.78 (d5 J = 8.46 Hz, 1H) 7.23 (m, 1H) 7.46 (m, 4H) 7.63 (d5 J = 8.82 Hz, 1H) 8.53 (dd, J = 8.09, 1.84 Hz, 1H) 8.87 (dd, J = 4.41, 1.84 Hz, 1H) 10.79 (s, 1H) 14.00 (s, 89166 -571-200427678 lH). (ESr) m / z581 (Μ_Η) _ · Example 410 base Dioxol-4,7 · Dihydroazirazo 14 54 ^ 1,2,41 Benzo 4 Hepta 1.3-yl &quot; 1-4-jijishi (3-methylbutanzine_2 (1HV A mixture of the product of Example 377 (0.022 g, 0.05 mmol) and chloroacetic acid (0.06 g, 0.63 hamol) was placed in a sealed tube in a microwave reactor at 120 ° C. It was heated for 30 minutes and cooled to 25. (:, and a liquid separation treatment between ethyl acetate and water. The ethyl acetate layer was washed with brine, dried over sodium sulfate, filtered, and concentrated. The residue was dried over Chromatography on silica gel with dichloromethane followed by 98 · 2 dichloromethane: methanol to give the title compound (001 g, 40% yield). MS ( APCI +) m / z 501 (Μ + Η) + · 1H NMR (300 MHz, DMSO-d6) δ 0_99 (d5 J = 6.25 Ηζ, 6Η) 1.60 (m, 2Η) 1.71 (m, 1Η) 4.50 (m, 2Η) 5.00 (m5 2Η) 7_47 (m, 2Η) 7.95 (d, J = 8.09 Ηζ, 1Η) 8.57 (dd, J = 8.09, 1.84 Ηζ, 1Η) 8.90 (dd, J = 4.41, 1.47 Hz, 1Η). Example 411 j3- [4-Hydroxy (3-methylbutyl V2-keto-1, 2-difluorene-1.8-4 pyridine each &quot; μ "-. Oxidation-4,7, bis-imidazolo" 4,5411 [~ 1,2,41 Benzopyrimidine_8_some} Yi Yueyin will be the product of Example 377 (0.044 g, 0 · 1 millimolar) and cyanoacetic acid (0.085 g, 1Ό millimolar) in a sealed tube, heated in a microwave reactor at 120 ° C for 30 minutes, cooled, and cooled in ethyl acetate Separated with water. The ethyl acetate layer was washed with brine, dehydrated and dried over sodium sulfate, filtered, and concentrated to obtain a residue, which was chromatographed on Shixijia, first with dichloromethane and then with 98: 2 dichloride. A fe / a fresh drop off 'and Tsai title compound (0.007 g, 14% yield). MS (ESr) m / z 490 (M-Η) · · 1H NMR (300 MHz, DMSO-d6) 89166-572-200427678 5 0.99 (d, J = 6.62 Hz, 6H) 1_57 (m, 2H) 1.71 (m, 1H) 4.49 (m, 4H) 7.50 (m, 2H) 7.96 (m, 1H) 8.57 (dd, J = 7.72, 1.84 Hz, 1H) 8.89 (dd, J = 4.60, 1.29 Hz, 1H). Example 412 {3-``4-Hydroxy small (3-methylbutyl V2-keto-1,2-difluorene-1 · 8_pyrimidine dong iu-dioxide-4,7-di Dihydroimidazo f4,5-hl | 1,2,41 benzopyridine-s-based 丨 methyl acetate The product of Example 377 (0.088 g, 0.2 mmol), 3,3,3_trimethyl A mixture of oxy-propionic acid methyl ester (0.360 g, 2.0 mmol) and catalytic p-toluenesulfonic acid monohydrate in a sealed tube in a microwave reactor at 60 ° C (30 ° C). It was cooled to 25 ° C for 15 minutes, and separated between ethyl acetate and water. The ethyl acetate layer was washed with brine, dried over sodium sulfate, filtered, and concentrated. The residue was placed on the upper layer of crushed gum Analysis, first burning with dichloromethane and then dissolving with 97: 3 dichloromethane / methanol to obtain the title compound (0.051 g, 49% yield). MS (ESI-) m / z 523 (M-Η)- HN MR (300 MHz, DMSO-d6) 5 0 · 99 (d5 J = 6.25 Hz, 6H) L58 (m, 2H) 1.71 (m, 1H) 3.68 (s, 3H) 4.10 (s5 2H) 4.49 (m, 2H ) 7.45 (d, J = 8.46 Hz, 1H) 7.51 (dd, J = 7.91, 4.60 Hz, 1H) 7.92 (d, J = 8.82 Hz, 1H) 8.57 (dd, J = 7.91, 1.65 Hz , 1H) 8.90 (dd, J = 4.60, 1.65 Hz, 1H) 13.07 (broad s., 1H) 14.21 (broad s., 1H) 15.31 (broad s ·, 1H). Example 413 Dioxide- 6H41,2,51 oxadiazole "3,4411" 1,2,41 molybdenum 4 cultivating_7-a) ice M _H3_methylbutylpyridine_2ΠΗν ketone The product of Example 377 (0.044 g, A mixture of 1 millimolar) and sulfamethoxamine (0.048 g, 0.05 * mol) in a sealed tube, heated in a microwave reactor at 19 (rc for 4 minutes, cooled to 25 ° C, and concentrate. The crude product was purified by chromatography on a reverse phase gradient 89166 -573-200427678 with 0.1% trigas acetic acid in water / methanol (90/10) to 0.1% trifluoro in water / methanol (5/95). The acetic acid was isolated to give the title compound (0 005 g '11% yield). MS (ESr) m / z 469 (MH) '1H NMR (300 MHz, DMSO-d6) 5 0 · 99 (d, J = 6.25 Hz, 6H) 1.59 (m, 2H) 1.71 (m, 1H) 4_49 (m, 2H) 7.48 (dd, J = 7.91, 4.60 Hz, 1H) 7.93 (d, J = 9.56 Hz, 1H) 8.39 (d, J = 9.19 Hz, 1H) 8.57 (dd, J = 7.72 , 1.84 Hz, 1H) 8.88 (dd, J = 4.78, 1.84 Hz, 1H) 14.38 (s, 1H).

Example 414A Amino-3- (aminocontinyl) tert-butylaminocarbamate tert-butyl 2,5-diaminocontinylamine [according to CA side · Soc · 1943, (15, 738 Made by a procedure] (0.168 g, 0.896 mmol) with di-tertiary-butyl dicarbonate (0.196 g '0.896 mmol) in tetrahydrocran (10 ml) at room temperature Stir for 16 hours. The reaction was concentrated under reduced pressure, and the residue was purified by chromatography on silica gel, eluting with 3: 2 hexane / ethyl acetate to provide the title compound (0.202 g, 78% yield).

Example 414B MΗ (cyclopropylmethyl) amino 1-pyrrolyl_2_one-L2-dihydropyridinyl group 1-1,1-pyridine-4Η-1,2,4-pyrepyrimidine Ergeng_7_ylamine, a third-butyl formate, caused the product of Example 414A (78.1 mg, 0.272 mmol) and the product of Example 353B (91.0 mg, 0.272 mmol) in anhydrous dioxin The mixture in (2.7 ml) was heated under reflux for 3 hours. Then, the reaction mixture was cooled to 25 ° C 'and concentrated under reduced pressure to give an oily solid. Trituration of the solid with methanol gave the title compound (72.5 mg, 51%). iHNMRpOOMI ^ DMSO-iy 5 0.14 (d, J = 4.04 Hz, 2H) 0.42 (m, 2H) 1.00 (m5 1H) 1.51 (s, 9H) 2.85 (bd, J = 4.78 Hz, 2H ) 6_45 (bs, 1H) 7.44 (t, J = 7.54 Hz, 1H) 7.62 (d, J = 8.82 Hz, 1H) 89166 -574- 200427678 7.69 (dd, J = 8.82, 2.20 Hz, 1H ) 7.89 (m, J = 7.91, 7.91 Hz, 1H) 8.10 (d, J = 8.46 Hz, lH) 8.17 (m, 2H) 9.93 (s, lH) 14.08 (s, lH) 15.15 (d, J = 4.78 Hz, lH). The sodium salt of the MS (ESI ·) m / z 524.0 (MH) 'compound was prepared by mixing Example 414B (3.9 mg, 0.0074 mmol) with 1 N sodium hydroxide solution (0.0074 ml, 0.0074 It is prepared by reacting in 0.5 ml of water and 0.5 ml of tetrahydrofuran at room temperature for 1.2 hours. The reaction mixture was then evaporated under a stream of nitrogen to provide the sodium salt (4.1 mg, 100% yield). iHNMRpOOMHADMSO-dd δ 0.20 (m, J = 5.52 Hz, 2H) 0_46 (d, J = 8.82 Hz, 2H) 1.00 (m, 1H) 1.50 (s, 9H) 3.30 (m, φ 2H) 5.96 (t, J = 6.25 Hz, 1H) 7.06 (t, J = 7.17 Hz, 1H) 7.20 (d, J = 9 · 19 Hz, 1H) 7.52 (m, 2H) 7.67 (d, J = 8.82 Hz, 1H) 7.90 (s, 1H) 8.06 (d, J = 7.35 Hz, 1H) 9.60 (s, 1H) 16.22 (s, 1H) · MS (ESI +) m / z 543.1 (M + H + H20-Na) +, 526.1 (M-Na) +, (ESr) m / z 524 · 1 (M-Η) · Example 415 3- (7-amino-1,1-digasification-4H- U, 4-Mo # pyridine-3_ylM · "(cyclopropylmethyl) amino 1-4-technical edge leaching-2 (1Η)-酉 Same as the product of Example 414B (10.1 mg, (0.0192 mmol) in trifluoroacetic acid (0.5 # ml) and dichloroane (0.5 ml), and stirred at room temperature for 15 minutes. Then, the solvent was evaporated under a stream of nitrogen to provide the title compound (10.4 Mg, quantitative yield). 1H NMR (300 MHz, DMSO-d6) 5 0.13 (d, J = 4.04 Hz, 2H) 0.41 (d? J = 6.99 Hz3 2H) 1.01 (m51H) 2.85 (d? J = 6.99 Hz? 2H) 6.98 (m5 2H) 7.38 (d, J = 8.46 Hz, 1H) 7.44 (t, J = 7.72 Hz, 1H) 7.89 (m 1H) 8.10 (d, J = 8.46 Hz, 1H) 8.16 (d, J = 6.99 Hz, 1H) 13.87 (s, 1H) 15.40 (s, 1H). MS (ESI +) m / z 426.0 (M + H) +, 448.0 (M + Na) +, (ESI ·) m / z 424 · 1 · 89166 -575-200427678 Example 416 Small (3-Methylbutyl V2-keto-1.2-dif.- U "Nyridine each 1-1 small-monooxide-4H-1,2,4-benzo-u-di-p-well-7-yl} -4- (methylcontinyl) benzoic acid amine in pyridine ( 0.2 ml) of the product of Example 205 (0.020 g, 0.047 mmol) was added to 4-methanesulfenylbenzenesulfonyl chloride (0.4 g, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 10 ° C. for 30 minutes. The reaction was cooled to 25 ° C. and diluted with ethyl acetate (40 ml), washed with water and brine. The organic layer was washed with water. The magnesium sulfate was dehydrated, dried, filtered, and concentrated. The residue was chromatographed on silica gel and separated with 99: 1 dichloromethane: methanol to give the title compound (15 mg, 50%). 1H NMR (300 MHz, DMSO- d6) 5 0.97 (d, J = 6.25 Hz, 6H) 1.56 (m, 2H) 1.68 (m, 1H) 3.28 (s, 3H) 4.46 (m, 2H) 7.48 (m5 3H) 7.65 (d, J = 8.82 Hz, 1H) 8.04 (d, J == 8.82 Hz, 2H) 8.15 (d, J = 8.46 Hz, 2H) 8.54 (dd, J = 8.09, 1.84 Hz, lH) 8.86 (dd, J = 4.60, 1.65 Hz, 1H) 11.11 (s, 1H) 14.14 (s5 1H). MS (ESI ') m / z 644 (MH)'. Example 417 H ({3- 「4_hydroxy-H3-methyl A certain butyl) · 2-keto-U_difluorene-1,8-4 pyridin-3-yl 1-1,1-. Oxidation-4H-1,2,4-benzopyrimidine j -7- Methyl} amine) Example 205 product (0.020 g, 0.047 mmol) of methyl 1-biphenyl-2-carboxylate in pyridine (0.2 ml), 2- (methoxyl chloride) was added Carbonyl group) farphenyl sulfonium (0 014 g, 0. 056 mmol). The reaction mixture was heated in a microwave reactor at 100 ° C (3 minutes for 30 minutes. The reaction was cooled to 25 ° C, diluted with ethyl acetate (40 ml), and water and brine. Washed. The organic layer was dried over osmium sulfate, filtered, and concentrated. The residue was chromatographed on silica gel and dissolved in 99: 1 dichloromethane / methanol to give the title compound (15 mg, 50%). 1H NMR (300 MHz, DMSO-d6) 5 0.97 (d, 89166 -576- 200427678 J = 6.25 Hz, 6H) 1.56 (m, 2H) 1.69 (m, 1H) 3.89 (s, 3H) 4.46 (m, 2H) 7 · 50 (m, 4H) 7.65 (d, J = 8.82 Hz, 1H) 8.01 (d, J = 5.15 Hz, 1H) 8.54 (dd, J = 7.91, 1.65 Hz, 1H) 8.88 (dd, J = 4.60, 1.65 Hz, 1H) 10.74 (s, 1H) 14.06 (s, 1H) MS (ESI.) M / z630 (MH) 'Example 418 3- (8-amino-1,1-dioxide-4 , 7-Dioxazolo | ~ 4,5Seven 1 "1.2,41 Benzodarinyl_3-yl M-hydroxy-1- (3-methylsomebutyl Vl, 8-pyridine-2flHV ketone make The product of Example 377 (24 mg, 0.055 mmol) was suspended in water (0.1 ml) and cooled to 0 ° C in an ice bath. To this slurry, a solution of cyanogen bromide in acetonitrile (0.1 ml, 0.067 mmol) was added, and the mixture was stirred at room temperature for 42 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound (23.5 mg, 92%). The compounds were converted to sodium salts as described in Example id. MS (ESI-) m / z 466 (Μ-ΗΧ. 1Η NMR (300 MHz, DMSO-d6) ά 0.97 (d5 J = 6.62 Hz, 6Η) 1.49 (s, 2Η) 1.65 (s, 1Η ) 4.29 (d, J = 8.46 Ηζ, 2Η) 6 · 01 (s, 2Η) 6.49 (s, 1Η) 6 · 78 (d, J = 8.09 Hz, 1H) 7 · 12 (dd, J = 7.72, 4.41 Hz, 1H) 7.30 (d, J = 8.09 Hz, 1H) 8.38 (m, 1H) 8.51 (d, J = 1.47 Hz, 1H) 11.03 (s, 1H) · 'Example 419: {3 -[4-Hydroxy-1- (3-methyl-butyl-V2-ketone_U-dioxopyridine_3-some1-1] "-= emulsified-4H-1,2,4_ Two tons of -7-yl} propane glutamate gj face in eridine (1 ml) of the product of Example 205 (21.5 g, 0.05 mmol), 1-propane sulfonium chloride (22.5 ml) was added , 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C. (: 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was water (丨Ml), triturated, and washed with 1: 1 hexane: ethyl acetate. The crude product was analyzed on the upper layer of reverse phase HPLC 89166 -577- 200427678, and the solution was 0.1% trifluoroacetic acid in water / methanol (90/10) to 〇1% trifluoroacrylic acid aqueous solution / methanol (5/95) To give the title compound (3 mg, η%). 1H NMR (300 MHz, DMSO-d6) δ 0.97 (m5 9Η) 1.57 (m? 2H) 1.69 (m5 3H) 3.17 (t, J = 7 · 74 Hz, 2H) 4.49 (t, J = 7.74 Hz, 2H) 7.50 (dd, J = 7.91, 4.60 Hz, 1H) 7.58 (dd, J = 8.82, 2.57 Hz, 1H) 7.64 (d, J = 2 · 21 Hz, 1H) 7.75 (d, J = 8.82 Hz, 1H) 8.56 (dd, J = 7.72, L84 Hz, 1H) 8.90 (dd, J = 4.41, 1.84 Hz, 1H) 10.35 (s, 1H) 14.09 (s, 1H) · MS (ESr) m / z 532 (MH) _ · Example 420 g-chloro-N- {3- 「4-hydroxy-1- (3-methylbutyl) -2 -Keto-1,2-difluorene-1,8-pyrimidine-3-di-1-i_, l-monoemulsified-4H-1,2,4-benzog-sepodi-7-yl} benzite To the product of Example 205 (2 L 5 g, 0.05 mmol) in pyridine (1 mL), vaporized 2-chlorobenzenesulfonium (27 mL, 0.2 mmol) was added. The reaction mixture was heated in a microwave reactor 'at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 ml), filtered, and washed with 1: 1 hexane: ethyl acetate. The crude product was purified by chromatography on silica gel and eluted with 199: 1 dichloromethane: methanol to give the title compound (14 mg, 46%). JH NMR (300 MHz, DMSO-d6) 5 0.96 (d, J = 6.25 Hz, 6H) I. 54 (m, 2H) 1.67 (m5 1H) 4.44 (t, J = 7.71 Hz, 2H) 7_57 (m, 7H) 8_11 (d, J = 8.46 Hz? 1H) 8.52 (dd3 J = 8.09, 1.84 Hz, 1H) 8.86 (dd3 J = 4.78, 1.84 Hz5 1H) II. 24 (s, 1H) 13.99 (s, 1H) MS (ESr) m / z 600 (MH)-. Example 421 1 Dilactate-N- {3- "4-Silkyl (3-methylbutyl) -2-fluorenyl-1,2-di Nitrogen_1,8-kounai shout-3_ 莘 1: L &gt; 1-one emulsified_4H-1,2,4-benzophenone two-spray-7-yl} burned g · pyridine (1 Ml) of the product of Example 205 (21.5 g, 0.05 mmol), 89166 -578-200427678 was added chloromethanesulfonium chloride (18 ml, 0.2 mmol). The reaction mixture was placed in a microwave reactor The mixture was heated at 120 ° C for 120 minutes. The reaction was cooled to 25 C 'and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and 1: 1 hexane: ethyl acetate Wash. The crude product was purified by chromatography on a reverse phase gradient with 0.1% trifluoroacetic acid in water / methanol (90/10) to 0.1% trifluoroacetic acid in water / methanol (5/95). Dissociate to give the title compound 6 mg, 22%) ° 1H NMR (300 MHz? DMSO-d6) δ 0.99 (d? J = 6.62 Hz? 6H) 1.57 (m5 2H) 1.69 (m, 1H) 4.49 (t, J = 7.74 Hz , 2H) 5.18 (s, 2H) 7.51 (dd, J = 7.91, 4.60 Hz, 1H) 7.62 (dd, J = 8.82, 2_57 Hz, 1H) 7.67 (d, J = 2.57 Hz, 1H) 7.77 (d, J = 8.82

Hz, 1H) 8.56 (dd? J = 8.093 1.84 Hz? 1H) 8.90 (dd? J = 4.41, 1.84 Hz, 1H) 10.91 (s, 1H) 14.10 (s, 1H) · MS (ESI.) M / z 538 (MH) _ · Example 422 Hydroxy-H3-methylbutyl V2-keto-1, 2-dihydro-1. , 4-Benzodiphenone-7-yl} The product of Example 205 (21.5 g, 0.05 mmol) of butan-1-acidamine in pyridine (1 ml) was added with 1 chloride -Diced sesame oil (26 ml, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 ml), filtered, and washed with 1 ·· 1 hexane * ·· ethyl acetate. The crude product was chromatographed on Shixijiao, and the title compound (8 mg, 29%) was transferred at 199 · 1 ^-gas methyl sintering and nail freshness 〇1H NMR (300 MHz? DMSO-d6) δ 0.84 (t5 J = 7.35 Hz5 3H) 0.98 (d5 J = 6.62 Hz, 6H) 1.37 (m, 2H) 1.56 (m, 2H) 1.69 (m5 3H) 3.19 (t, J = 7.74 Hz, 2H) 4.48 (t, J = 7.74 Hz, 2H) 7.50 (dd, J = 7.91, 4.60 Hz, 1H) 7.58 (dd, J = 9.01, 2.39 Hz, 1H) 7_65 (d, J = 2.21 Hz, 1H) 7.75 (d, J = 8.82 Hz, 1H) 8.55 (dd, J = 8.09, 89166 -579- 200427678 1.84 Hz, 1H) 8.89 (dd, J = 4.41, 1.84 Hz? 1H) 10.35 (s, 1H) 14.07 (s , 1H) 15.13 (s, 1H). MS (ESI +) m / z 548 (M + H) + · Example 423 Hydroxy-M3-methylbutane) -2-one-U-dihydro-1, 8-pyrimidin-3-yldioxide-4H-1,2,4-benzyl-pyridine_7_yl} Stamping Example 205 product of donkey amine in pyridine (1 mL) Mol), 2,6-dichlorobenzenesulfenyl chloride (49, 0.2 mmol) was added. The reaction mixture was heated in a microwave reactor at 120 ° C for 120 minutes. The reaction was cooled to 25 ° C and concentrated under reduced pressure. The residue was triturated with water (1 ml), filtered, and washed with 1: 1 hexane: ethyl acetate. The crude product was chromatographed on silica gel with 399: 1 dichloromethane: methanol to give the title compound (5 mg, 16%).

1H NMR (300 MHz, DMSO-d6) 6 0.97 (d, J = 6.62 Hz, 6H) 1.54 (m, 2H) 1.67 (m, 1H) 4.46 (m5 2H) 7.47 (m, 2H ) 7.58 (m, 2H) 7.68 (m, 3H) 8.54 (dd, J = 7.72, 1_84 Hz, 1H) 8.88 (dd, J = 4.78, 1.84 Hz, 1H) 11.43 (s, 1H) 14.02 (s , 1H) · MS (E

Sr) m / z634 (MH)-· Example 424 2-Chloro-6-({3- "4-hydroxy-1- (isobutylamino) _2_keto_12_dineoxoline_3 • Some i_ dioxin, 4H-1, 2Λbenzo 4 Ergen-7-yl} gas group) isonicotinine_metamorphine Product of Example 321C (40.0 mg, 0.138 mmol), potassium carbonate (191 mg, 0.138 mmol), copper (II) oxide (18.4 mg, 0.23 mmol) and methyl 2,6-dichloroisonicotinate (28.4 mg, 0.138 mmol) ) Stir the mixture in pyridine (2 ml) while heating it in a microwave reactor at 125 ° C for 100 minutes. After cooling to 25 ° C, fill the mixture directly onto the silicone and add The 0 to 5% methanol gradient solution in methyl chloride dissolves. The fractions containing the desired product 89166 -580- 200427678 are combined and concentrated. By recrystallization of the residue, ethyl acetate / hexane (4 · 3 mg, 68%), isolated from the title compound. MS (ESI ·) m / z 596 (MH) ·. 1H NMR (300 MHz, CDC13) 51.13 (d, J = 6.62 Hz, 6H) 2.00 (m, 1H ) 2.84 (br m, 2H) 3.99 (s, 3H) 5.73 (br s, 1H) 7.43 (m, 4H) 7.62 (d, J = 8.46 Hz, 1H) 7.80 (m, 2H) 7.96 (d, J = 8_46 Hz, 1H) 8.28 (d, J = 8.09 Hz, 1H) 14.37 (s, 1H) 15.04 (s, 1H).

Example 425A 4- (fluorenylmethylbutyl &gt; pyridin-2ΠΗ) -one 4-benzyloxy-1H-pyridin-2-one (1.0 g, 4.97 mmol) and 1-bromo- A solution of 3-methylbutane (0.715 ml, 5.96 mmol) in N, N-dimethylformamide (20 ml) with 1,8-diazabicyclo [5.4.0] 11 -7-ene (1-86 ml, 12-43 mmol) was treated at 65 ° C for 5 days. The mixture was cooled to 25 ° C and separated between water and dichloromethane. The organic layer was concentrated under reduced pressure. The residue was chromatographed on silica gel and dissolved in 1% methanol in dichloromethane to give the title compound (0.57 g, 42%). MS (DCI / NH3) m / z 272 (M + H) + · 1H NMR (300 MHz, CDC13) δ 0.96 (d, J = 6.25 Ηζ, 6Η) 1.61 (m, 3H) 3.89 (m, 2H ) 4.99 (s, 2H) 5.98 (dd, J = -7 · 54, 2.76 Hz, 1H) 6.06 (d5 J = 1.84 Hz, 1H) 7.14 (d, J = 7.72 Hz, 1H) 7.39 (m, 5H).

Example 425B 4-Hydroxy-1 · (3-methyl-1,1-butyl) pyridine-2 (1HV ketone) A solution of the product of Example 425A (0.55 g, 2.03 mmol) in tetrahydrofuran (10 ml), and formic acid Ammonium (0.37 g, 5.87 mmol) was treated with a catalytic amount of 20% tritium oxide / carbon at 60 ° C for 3 hours. The solution was passed through algae soil and the filtrate was concentrated to give the title compound (0.21 g , 57%). MS (DCI / NH3) 89166 -581-200427678 m / z 182 (M + H) +. 1H NMR (300 MHz? CDC13) δ 0.95 (d5 J = 6.25 Hz, 6H) 1.60 (m, 3H) 3.90 (m, 2H) 6.09 (dd, J = 7.35, 2.57 Hz, 1H) 6.15 (d, J = 2.21 Hz, 1H) 7.17 (d, J = 7.35 Hz, 1H).

Example 425C 3- "Bis (methylthio) methylene 1-H3-methylbutyl V-pyridine-2,4 (1R3HV dione) The product of Example 425B (0.038 g, 0.21 mmol) was added to 1,4- A solution in dioxolane (3 ml), with pyridine (0.135 ml, 1.68 mmol) and ginseng (methylthio) methyl sulphamidine (Use Shek 22-25, 1988; M. Barbero, S Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi made χο.ιιgram, 0.42 mM), and processed at 40 ° C for 1 hour. Add another ginseng (曱Thio) methyl methyl sulfate (0.11 g, 0.42 mmol), and the solution was heated at 85ac for 1 hour. The reaction mixture was cooled to 25 C 'and the solvent was removed under a warm nitrogen stream. The residue was dried at Chromatography on a 1 g Alltech sep-pack cartridge with 100% dichloromethane followed by 30% ethyl acetate in dichloromethane gave the title compound (19 mg, 33%). 1H NMR (300 MHz , Chloroform-D) δ 0_96 (d, J = 6.25 Hz, 6H) 1.58 (m, 3Η) 2.66 (s, 6H) 3.78 (m, 2H) 5.99 (d, J = 7.35 Hz, 1H) 7.06 (d, J =

7.72 Hz, 1H) .- Example 425D 2_-Amino-5 _ ((methanesulfonyl) amino &quot; j-benzenesulfonylamine, 2,5-diamino-benzenesulfonylamine (0.288 g, 0.0015 Mo Ear, 1 equivalent), a mixture of dichloromethane (5 ml) and pyridine (5 ml) was stirred at (TC. Methanesulfonium chloride (119 μl, 0.0015 mol, (Equivalent). Warm the reaction mixture to 25 ° C and stir for 18 hours. Evaporate the reaction mixture under reduced pressure and chromatograph the residue on silica gel using dichloromethane 89166 -582- 200427678 0- A gradient gradient of 4% methanol yielded the title compound (68% yield). 1H NMR (300 MHz? DMSO-d6) δ 2.87 (s? 3H) 3.39 (s? 1H) 5.80 (s? 1H) 6.78 (d , J = 8.82 Hz, 1H) 7.13 (dd, J = 8.64, 2.39 Hz, 1H) 7.29 (s, 2H) 7.45 (d, J = 2.57 Hz, 1H) 9.21 (m, 1H). MS (ESI +) m / z = 266 (M + H) +.

Example 425E N- {3- "4-Phenyl-1- (3-methylbutyl) -2-fluorene isopropyl-1,2-diamino p-pyridin-3-yl digasification_4 fluorene- 1,2Λ · benzopyridine-7-yl} methanesulfonamide. The product of Example 425C (0.019 g, 0.067 mmol) and the product of Example 425D (0_018 g, 0.067 mmol) were added at 1,4. -The solution in dioxolane, heated at 10 ° C for 1 hour. The solvent was removed under a warm nitrogen stream, and the residue was placed in a Waters symmetrical C8 column (25 mm X 100 mm, 7 micron particle size) On the other hand, purification by HPLC using a gradient of 10% to 100% acetonitrile · 0.1% trifluoroacetic acid in water yielded the title compound (0.007 g, 23%). MS (ESI_) m / z 453 (MH)- · 1H NMR (300 MHz, DMSO-d6) 5 0.93 (d, J = 6.25 Hz, 6H) 1.58 (m, 3H) 3.08 (s, 3H) 3.99 (m, 2H) 6.33 (d, J = 6 62 Hz, 1H) 7.57 (m, 2H) 7.67 (d, J = 8.82 Hz, 1H) 8.07 (d, J = 6.62 Hz, 1H) 10.25 (s, 1H) 13.84 (s, 1H) 14.28 ( s? 1H).

Example 426A 1-fluorenyl-4-hydroxypyridine-2 (1HV ketone) The title compound was prepared by the method of Eschenhof et al., Tetrahedron, v. 30, P6225-6230, 1992.

Example 426B 1-fluorenyl-3- "bis (methylthio) methylene 1eridine-2,4 (1H, 3HV dione) The product of Example 426A (0.124 g, 0.62 mmol) was placed at 1,4 -Dioxolane (6 89166-583-200427678

Ml), with pyridine (0.400 ml '496 mmol) and ginseng (methylthio) methyl sulfate (using Hexian 22-25, 1988; M. BarbeiO, s. Cadamun), L Degani , R. Fochi, A. Gatti, V. Regondi (x032 g, i 24 mmol) were prepared and processed at 40 ° C for 15 minutes. Another portion of methyl sulphate (methylthio) methylsulfate (0.32 g, 1.24 mmol) was added and the solution was heated at 90 t for 1 hour. The solvent was removed under a stream of warm nitrogen, and the residue was purified using 1 gram of Alltechsei &gt; pack, 'burned at 100% in one gas, followed by 30% ethyl acetate dissolved in dichloromethane, to give the title compound ( 79 mg, 42%). 1HNMR (300 MHz, chloroform-D) 5 2.68 (s, 6s) 4.99 (s, 2Η) 6.11 (d, J = 7.72 Hz, 1Η) 7.17 (d, J = 8.09 Hz, 1H) 7.33 (m, 5H) .

Example 426C N- "3- (1-decyl-4- # xyl-2-fluorenyl-1,2-dihydro p-ratio-3-yl i-dioxide_4h_1,2,4- Benzopyridine-7-yl-1 methane sfe fe The product of Example 426B (0.028 g, 0.092 mmol) and the product of Example 425D (0.025 g, 0.092 mmol) were placed in 1,4-dioxolane. The solution in the mash was heated at 10 ° C for 40 minutes. The solvent was removed under a stream of warm nitrogen and the residue was triturated with water and ethyl acetate. The precipitate in the organic layer was filtered and dried to produce the title. Compound (0.006 g, 12%). MS (ESI—) m / z 473 (M-Η) ·· 1H NMR (500 ΜΗζ, DMSOd6) 5 3 · 06 (s, 3Η) 5 · 21 (s, 2Η) 6.38 (d5 J = 4.88 Ηζ, 1Η) 7.34 (m, 5Η) 7.55 (m, 3Η) 8.18 (d, J = 3_05 Ηζ, 1Η) 10.25 (s, 1Η) 13.87 (s, 1Η) ) 14.05 (s5 1H). Example 427 This dIHH (Cyclopropylmethyl) amine 14-hydroxy · 2-keto-1,2 · dihydro p-setoline each & oxidized-4H-4 Ridge # rZ3 -el "l, 2,41 pyrimidine-7-yl) methyl 1ethane 碏 gi 89189 -584- 200427678 The product of Example 353E (16.1 mg, 0.036 mmol) at N, N- Dimethylformamide (0.4 To the solution in liters), triethylamine (0011 ml, 0.079 mmol) was added. The mixture was cooled to 0 ° C, and ethanesulfonyl chloride (0.036 ml, 0.038 mmol) was added. (Ear). The mixture was warmed to 23.0 and stirred for 2 hours. The reaction mixture was concentrated under reduced pressure. The residue was purified by reverse phase chromatography with 10% acetonitrile in water / 0.1% trifluoroacetic acid in water. A gradient solution of 95% acetonitrile / 01% trifluoroacrylic acid was dissolved to obtain the title compound (7.7 mg, 40%). The sodium salt of the title compound was prepared in the following manner, and 1N sodium hydroxide ( 〇29 ml '0.0029 mol) was added to a solution of the title compound (7.7 mg, 001 mmol) in water (0.4 ml) and stirred for thirty minutes. Concentrated under reduced pressure. 1 H NMR (300 MHz, DMSO-d6) (5 0.21 (bs, 2Η) 0.46 (d, 2H) 0.99 (m5 1H) 1.19 (t5 3H) 3.01 (q5 2H) 4.23 (s5 2H) 5.85 (t5 J = 6.62 Hz, 1H) 6.79 (s, 1H) 6.93 (t, J = 7.54 Hz, 1H) 7.35 (t, J = 6.99 Hz, 2H) 7.59 (d, J = 8.09 Hz , 1H) 7.95 (d, J = 6.62 Hz, 1H). Example 428 (Cyclopropylmethyl) amino 1-4-hydroxy_2-keto even-1,2-dihydroquinolin-3-yl μ 1 ^ _Oxidation_4: The product of "2,3-61", 1,2,41 pyrimidine-7-yl) methyl 1 propane-1_ceramide in Example 353E (16.7 mg, 0.037 mmol) was obtained at Ν, Ν_ To a solution in dimethylformamide (0.4 ml) was added triethylamine (0.011 ml, 0.079 mmol). The mixture was cooled to 0 ° C and 1-propanesulfenium chloride (0.005 mL, 0.041 mmol) was added. The mixture was allowed to warm to 23 ° C and stirred for 1.5 hours. The reaction mixture was concentrated under reduced pressure. The residue was purified by reversed-phase chromatography and dissolved in a gradient of 10% acetonitrile / 0.1% trifluoroacetic acid in water to 95% acetonitrile / 0.1% trifluoroacetic acid in water to obtain the title compound (9.9 mg, 48%). . 89166-585-200427678 ^ NMRCSOOMH ^ DMSO-dg) δ 0.15 (d5 J = 4.04 Hz? 2H) 0.42 (d? J = 7.35 Hz, 2H) 0.99 (m, 4H) 1.69 (m, 2Η) 2.84 ( d, J = 7.35 Hz, 2H) 3.06 (m, 2H) 4.27 (d, J = 6.25 Hz, 2H) 6.35 (bs, 1H) 7.37 (s, 1H) 7.42 (t, J = 7.54 Hz, 2H) 7.75 (t, J = 6.07 Hz, 1H) 7.87 (t, J = 7.17 Hz, 1H) 8.07 (d, J = 8.46 Hz, 1H) 8.15 (dd, 1H) 14.52 (bs, 1H). Example 429 Ν-ΙΪ3-Π-ΙΤcyclopropylmethyl) amino 1_4-hydroxy-2-keto-U_dihydro4line-3-methyl 1,1-dioxide The product of -4H-pyrimidof2,3-el "1,2,41 pyrimidin-7-yl) methyl 1 propane-2-sulfonamide in Example 353E (16.2 mg, 0.036 mmol) To a solution in N, N-dimethylformamide (0.4 ml) was added triethylamine (0.00 ml, 0.079 mmol). The mixture was cooled to 0 ° C and isopropyl chloride was added. Sulfasulfonium (0.0043 ml, 0.038 mmol). Warm the mixture to 23 ° C and stir for 3 hours. Add additional isopropylsulfonium chloride (0.006 ml, 0.055 mmol), and The reaction mixture was stirred at 23 ° C for 15 hours The reaction mixture was stirred at 50 ° C for 2 hours. Additional triethylamine (0.004 ml, 0.287 mmol) and isopropylsulfonium chloride (0.010 ml, 0.091) were added. Mmol), and the reaction mixture was stirred at 50 ° C. for 1 hour. The reaction mixture was cooled to 25 ° C. and concentrated under reduced pressure. The residue was purified by reverse phase chromatography with 10% acetonitrile in water / Oj% Trifluoroacetic acid to 95% acetonitrile in water / 0.1% trifluoroacetic acid in a gradient solution to dissolve the title compound (6.7 mg, 33%). The sodium salt of the title compound was prepared according to the procedure of Example 1D. IHNMR (300MHz DMS〇_d6) 6 0.021 (bs 2H) 0.48 (d, 2H) 0.98 (m, 1H) 1.24 (d, J = 6.99 Hz, 6H) 3.19 (m, 1H) 4.25 (s, 2H) 5.85 (t, 1H) 6.76 (s, 1H) 6.92 (t, 1H) 7.34 (m, 2H) 7.57 (d, 1H) 7.96 (d, 1H). 89166 -586- 200427678 Example 430 N-"(3- {H (Cyclopropylmethyl) amino M-transyl-2-keto-U-dioxine, τχfendolin-3-yl} -1,1-dioxide- Product of 4'-pyrimido "2,3-el" U, 41pyrimidine_7_yl) methyl 1 jasamine in Example 353E (16.9 mg, 0.038 mmol) ) In N, N- dimethylformamide (0.2 mL) of was added triethylamine (0.012 mL, 0.083 mmol) and benzene sulfonic acyl chloride (0.006 ml, 0.042 mmol). The reaction mixture was stirred at 23 ° C for 0.75 hours. The reaction mixture was concentrated under reduced pressure. The residue was purified by reversed phase chromatography and dissolved in a gradient solution of 10% acetonitrile / 0.1% trifluoroacetic acid in water to 95% acetonitrile / 0.1% trifluoroacetic acid in water to obtain the title compound (10.7 mg, 48%) . ΑΝΜΙφΟΟΜΗζ, DMSO_d6) (50.14 (d, J = 4.04 Hz, 2H) 0.41 (d, J = 7.72 Hz, 2H) 1.01 (m, J = 7.54, 7.54 Hz, 1H) 2.83 ( d, J = 6.99 Hz, 2H) 4.07 (d, J = 6.25 Hz, 2H) 6.38 (bs, 1H) 7.30 (s, 1H) 7.41 (t, J = 7.54 Hz, 1H) 7.65 (m , 3H) 7.86 (m, 3H) 8.06 (d, J = 8.82 Hz, 1H) 8.15 (d, J = 6.99 Hz, 1H) 8.42 (t, J = 6.25 Hz, 1H) 14.43 ( bs, 1H). Example 431 Curcumylmethyl) amino 1-4-Cryl-2-Phenyl-1,2-diazepine-p-line-3-yl 1,1-digasified-4H- Pyrido! &Quot; 2,3-e ~ l "l, 2,4 ~ | Pyrimidine_7-yl) methyl-1_1_ Phenylmethanil cyanamide produced in Example 353E (16.5 mg, 0.037 MM) In a solution of n, N-dimethylformamidine (0.4 ml), triethylamine (0.011 ml, 0.079 mmol) was added. The mixture was cooled to 0 ° C and chlorinated α-Toluenesulfonium (0.008 g, 0-〇41 mmol). The reaction mixture was warmed to 23 ° C and stirred for 0.5 hours. Then, the reaction mixture was heated to 50 ° C and stirred for 1.75 hours. Added Triethylamine (0.010 ml, 0.074 mmol) (Ear) and α-toluenesulfonium chloride 89166 -587-200427678 (0.007 g, 0.037 mmol), and the reaction mixture was stirred at 23 ° C for 1 hour. The reaction mixture was concentrated under reduced pressure. The residue was borrowed Purified by reversed-phase chromatography and dissolved in a gradient of 10% acetonitrile / 0.1% trifluoroacetic acid in water to 95% acetonitrile / (U% trifluoroacetic acid in water) to obtain the title compound (7.7 mg, 35%). 1H NMR (300 MHz, DMSO-d6) 5 0.15 (d, J = 4.04 Hz, 2H) 0.42 (d, J = 7.72 Hz, 2H) 1.00 (m, 1H) 2.84 (d, J = 7.35 Hz, 2H) 4.23 ( d, J = 5.52 Hz, 2H) 4.44 (s, 2H) 6.37 (bs, 1H) 7.32 (s, 1H) 7.42 (m5 6H) 7.86 (m, 2H) 8.07 (d, J = 8.46 Hz , 1H) 8 · 16 (dd, 1H) 14.50 (bs, 1H).

Example 432A 1_ (Cyclobutylamino V4-hydroxypyridin-2 (111) 41¾ The product of Example 350A (0.516 g, 2.9 mmol) and cyclobutanone (1.05 g, 15.0 mmol) The solution in acetic acid (0.90 g, 15.0 mmol) and methanol (20 ml) was treated with sodium cyanoborohydride (0.94 g, 15.0 mmol) in portions, stirred for 48 hours, and concentrated. The residue was treated with a 0.5 M aqueous sodium bicarbonate solution, acidified with 1 M hydrochloric acid to pH 2, and extracted with ethyl acetate. The ethyl acetate was washed with brine, dried over sodium sulfate, filtered, and concentrated. The crude material was chromatographed on silica gel and dissolved with 3: 2 hexane / ethyl acetate to give the title compound (0.400 g, 60%). MS (ESI +) m / z 231 (M + H) +. 1H NMR ( 300 MHz, DMSO-d6) 5 1.52 (m, 1Η) 1.63 (m, 1Η) 1.96 (m, 4Η) 3.64 (m, 1Η) 5.91 (s, 1Η) 6.26 (d, J = 6.62 Hz , 1H) 7 · 20 (t, J = 8.09 Hz, 1H) 7.61 (m, 1H) 7.84 (m, 2H) 11.42 (s, 1H).

Example 432B 3_ "Alarm (methylthio) methylene 1-H cyclobutylamine a certain quinoline-2A1H, 3HV dione. ) Methyl 89166 -588- 200427678 Sulfur (formaldehyde) (using synthesis, 22-25, 1988, M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi A solution of χο · 27 grams, 〇〇mmole) in Bibidian (0.316 grams' 4.0 mmoles) and dioxolane (5.0ml) was heated at 60 ° C for 30 minutes. Add Separate ginseng (methylthio) methyl sulfate (0 27 g, 1.0 mmol), and continue heating for 30 minutes. The mixture was cooled to 25 ° C, and worked between ethyl acetate and water. Liquid separation treatment. The ethyl acetate layer was washed with water and brine, dried over sodium sulfate, filtered, and concentrated. The crude material was chromatographed on silica gel and dissolved with 95/5 dichloromethane / ethyl acetate to obtain Title compound (0.146 g, 87% yield). MS (ESI +) m / z335 (M + H) +. IHNMR (300 MHz, DMSO-d6) 5 1.54 (m5 1H) 1.66 (m, 1H) 1.99 (m , 4H) 2.61 (s, 6H) 3.62 (m , 1H) 6.18 (d, J = 6.25 Hz, 1H) 7.15 (t, J = 7.54 Hz, 1H) 7.63 (m, 1H) 7.72 (d? J = 8.09 Hz5 1H) 7.98 (dd? J = 7.91, 1.29 Hz5 1H).

Example 432C Cyclobutylamino) -4-lightyl-2-fluorenyl-1,2-dihydrop-quinolin-3-yl1-1,1-dioxide-4H-1,2,4-benzene The combination of the di--7-yl methanoic acid amine and the product of Example 425D (0.195 g, 0.585 mmol, 1.5 equivalents) and the product of Example 432B (0.100 g, 0.390 mmol, 1.5 equivalents) The mixture in anhydrous dioxan (10 ml) was heated at 120 ° C for 1 hour. After cooling to 25 ° C, the reaction mixture was treated with methanol (20 ml) and diethyl ether (20 ml), and the precipitated product was collected by vacuum filtration to give the title compound (25 mg, 12% yield). 1H NMR (300 MHz, DMSO-d6) (51.69 (m, 2H) 2,13 (m, 4H) 3.10 (s, 3H) 3.77 (m, 1H) 6.57 (s, 1H) 7.44 (t , J = 7.35 Hz, 1H) 7.65 (m, 3H) 7.89 (t, J = 7.35 Hz, 1H) 8.06 (d, J = 8.46 Hz, 1H) 8.16 (d5 J = 7.72 Hz, 1H) 10.31 (s, 1H) 14.16 (s, 1H) 15.03 (s, 1H) MS (ESI +) m / z = 504 (M + H) +. 89166 -589-200427678 Example 433 methylmethyl) amino A certain 2-keto-1,2-dihydro 4: Lin-3-kib oxide-4H4,2 &gt; Benzopyrene-7-yl) methanefluoride The product of Example 353B (0.090 g, 0.269 mmol, 1 equivalent) and the product of Example 425D (0.071 g, 0.269 mmol, 1 equivalent) in anhydrous dioxin (5 ml), heated at 120 ° C for 1 hour. After the reaction mixture was cooled to 25 ° C, methanol (20 ml) and diethyl ether (20 ml) were added, and the precipitated product was collected by vacuum filtration to obtain the title compound (21 mg, 15.5% yield). iHNMRGOOMHz'DMSO ^) 5 0 · 16 (π, 2Η) 0.41 (m, 2H) 1.07 (m, 1H) 2.85 (m, 2H) 3.10 (s, 3H) 6.44 (m, 1H) 7.44 ( t, J = 7.54 Hz, 1H) 7.62 (m, 2H) 7.71 (m, 1H) 7.90 (t, J = 7.91 Hz, 1H) 8.10 (d, J = 8.46 Hz, 1H) 8 · 17 (d, J = 6.99 Hz, 1H) 10.30 (m, 1H) 14.15 (m, 1H) · MS (ESI +) m / z = 504 (M + H) + · Example 434 j: hydroxyl-3_f8- ( Isomethyl Vl, l-digasification-4 · 9-dihydroimidazo "4,5-7 1" 1,2,41 8-4 Pyridin-2 (1HV ketone) The product of Example 377 (14 mg, 0.033 mmol) was treated with 4 N HC1 (0.5 ml) and glycolic acid (4 mg, 0.052 mmol) and the formed The mixture was heated under reflux for 24 hours. The mixture was concentrated under reduced pressure to a white paste-like solid. The solid was purified by chromatography on silica gel and dissolved in 95: 5 dichloromethane: methanol to give the title compound (10 mg, 63%). The title compound was converted to the sodium salt as described in Example 1D. MS (ESI +) m / z: 483. iHNMRpOOMHz, DMSO-d6) (5 0.97 (d, J = 6.25 Hz, 6H) 1 · 50 (s, 1H) 1.64 (d, J = 6.99 H z, 1H) 3.87 (s, 1H) 4.08 (d, J = 6.62 Hz, 1H) 4.30 (d, J = 6.99 Hz, 1H) 4.54 (s, 1H) 4.66 (d, J = 6.62 Hz , 1H) 4.73 (s, 1H) 5.33 (d, J = 6.62 Hz, 1H) 7.04 (d, J = 8.82 89166 -590- 200427678

Hz, 1H) 7.14 (dd, J = 7.35, 4.78 Hz, 1Η) 7.76 (d, J = 8.82 Hz, 1H) 8.39 (dd, J = 7.54, 2.02 Hz, 1H) 8.53 (m, 1H) 12.49 (s, 1H).

Example 435A ((3-``4-Hydroxy-1- (3-methylbutyl V2-keto-1,2-dij.-U-pyridin-3-yl M, l-difluoride-4H -1,2,4-Benzopyrimidin_7-yl} amino) sulfonyl-2-carbamic acid ethyl ester makes chlorosulfoisocyanate (33 mg, 0.23 mmol) at The solution in dichloromethane (8 ml) was cooled to 0 ° C, and 2-chloroethanol (18.8 mg, 0.23 mmol) was added dropwise. The mixture was stirred at 0 ° C for 90 minutes, and then added with A solution of the product of Example 205 (100 mg, 0.23 mmol) and triethylamine (71 mg, 0.70 mmol) in dichloromethane (2 ml). The mixture was stirred at 25 ° C for 24 hours, and then Separate the solution between dichloromethane (25 mL) and 1 N aqueous hydrochloric acid solution (20 mL). The organic layer formed is separated, dried over hydration sulfate, filtered, and concentrated under reduced pressure to provide the title compound. (96 mg, 67%). MS (ESI ·) m / z 611 (M-Η). · 1H NMR (300 MHz, DMSO-d6) 5 0.98 (d, J = 6.62 Hz, 6H) 1 · 57 (m, 2H) 1.69 (m, 1H) 3.78 (m, 2H) 4.32 (m, 2H) 4.49 (m, 2H) 7.51 (m, 2H) 7 · 63 (s, 1H) 7.77 (d, J = 9.19 Hz, 1H) 8.56 (dd, J = 7.72, 1.10 Hz, 1H) 8.90 (dd, J = 4.41, 1.47 Hz, 1H) 11.15 (s, 1H) 12.26 (s, 1H) 14.10 (s5 1H).

Example 435B

Mr. {3-``4-Ethylmethylbutyl V2-keto-1,2-di-i, _1 · 8-πnaphthalen-3-yl H, l-di jL-4-4_1,2,4 -The product of p-Diox-7-yl 丨 _2_fluorenyl-1,3-tetrazol hydrazone-3-carbamate in Example 435A (90 mg, 0.147 mmol) in dichloro To the solution in methane (10 ml) was added triethylamine (1 ml). The mixture was stirred at 25 t for 6 hours. The reaction was treated with a 1 n aqueous hydrochloric acid solution (10 ml), and two 89166- 591-200427678 Methyl chloride (20 mL) extraction. The organic layer was separated and dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title compound as a colorless solid (70 mg, 82%). 1H NMR ( 300 MHz, DMSO-d6) 5 0.98 (d, J = 6.62 Hz, 6H) 1.57 (m, 2H) 1_69 (m, 1H) 3.98 (m, 2H) 4.36 (m, 2H) 4.48 (m , 2H) 7.49 (dd, J = 7.72, 4.78 Hz, 1H) 7.60 (m, 1H) 7.62 (s, 1H) 7.75 (d, J = 8.82 Hz, 1H) 8.56 (m, 1H) 8.89 (m, 1H ) 11.59 (s, 1H) 14.15 (s, 1H) ·

Example 435C N- [3- (4-Hydroxyisopentyl-2-keto-1,2-difluoren-1,8-pyridin_3_yl VU-di f.-4H-1,2, 4-Benzopyrimidine-7-ylphenylethyl) sulfofluorene The product of Example 435B (28 mg, 0.05 mmol) and phenylethylamine (6 mg, 0.05 mmol) in acetonitrile (10 ml) and the mixture in triethylamine (0.5 ml) were heated at room temperature for 18 hours. The reaction mixture was cooled to 25 ° C, diluted with ethyl acetate, and extracted with 10 ml of 1NHC1, followed by 10 ml of brine. The organic layer was dried over anhydrous Naz SO #, filtered, and concentrated under vacuum. The product was separated on silica gel by preparative thin layer chromatography and dissolved in 25% ethyl acetate in dichloromethane to provide 2 mg of the title compound (10% yield). iHNMR (300 MHz5 DMSO-d6) 5 0.98 (d5 J = 6.62 Hz, 6H) 1.57 (m5 2H) 1.69 (m? 1H) 2.68 (m, 2H) 3_09 (m, 2H) 4.49 (m, 2H) 7.20 (m, 5H) 7.46 (m5 1H) 7.51 (m, 1H) 7.60 (d5 J = 2.21 Hz, 1H) 7.68 (d, J = 8.82 Hz, 1H) 7.97 (m5 1H) 8.56 (dd, J = 8.09, 1.84 Hz, 1H) 8.89 (nUH) 10.28 (s, 1H) 14.13 (s, 1H) 15.23 (s, 1H). Example 436 3- [3- (4- # Stem base-1-isopentyl · 2 · Keto-1,2-dihydro "1,81 Kazakhstan; _3-Based Dioxide · 4H-1,2,4-Benzoacetone di-tung-7-yl-1 diazathiolupine-1 -A solution of acid tea with 2,2-digas, a solution of chlorosulfoisocyanate (24.5 μl, 0.281 mmol) in dichloromethane (2 89166 -592- 200427678 pen liters), Treat with benzyl alcohol (29 μl, 0.281 mmol) dropwise at 25 ° C. Stir at 25 ° C for 30 minutes. Take the product of Example 205 (100 mg, 0.234 * mol) with Treated with a solution of triethylamine (130 μl, 0.936 mmol) in dichloromethane (3 ml) and stirred at 25 ° C. for 2 hours. The reaction mixture was treated with dichloromethane (10 ml) and 1 N Treatment with aqueous hydrochloric acid (10 ml). The formed organic layer was separated, dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title compound (122 mg, 81%).] ^ 阳 1-) 111/2639 (] \ 1-11) -· 1H NMR (300 MHz5 DMSO-d6) δ 0.99 (d, J = 6.6 Hz5 6H)? 1.59 (m5 2H)? 1.66 (m, 1H), 4.49 (m, 2H), 5.12 (s, 2H), 7.32 (m, 5H), 7.48 (m, 2H), 7.65 (d, J = 2_2 Hz, 1H), 7.75 (d, J = 8.8 Hz, 1H), 8.57 (dd, J = 7.7, 1 · 8 Hz, 1H), 8.90 (dd, J = .8, 1 · 8Ηζ, 1H), 11.17 (s, 1H), 12.19 (bs, 1H), 14.11 (bs, 1H) · Example 437 N- [ 3- (4-Hydroxyisopentyl_2-keto_U-diamidin-3-yl Vl, l_digasification-4H_1,2,4_benzyl? A solution of the product of Example 436 (40 mg, 0.0625 mmol) in methanol (5 ml) was treated with 10% palladium / carbon (20 mg) at 25 ° C and Stir under hydrogen atmosphere for 5 hours. Then, the resulting solution was filtered, and the filtrate was concentrated under reduced pressure to provide the title compound (25 mg, 78%). MS (ESr) m / z505 (MH) _. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.98 (d? J = 6.3 Hz? 6H) 3 1.57 (m? 2H), 1.66 (m, 1H), 4.42 (m5 2H), 7_38 (m, 1H), 7.43 (m, 2H), 7.59 (m, 1H), 8.52 (m, 1H), 8.82 (bs, 1H), 9.99 (bs, 1H). Example 438 3- "3- (4 · lightyl-1-isopentyl_2 · pyridyl", 1,2-side diazine "1,81-mouth nanocrystalline-3-yl) -l, l_ digasification-4H -U, 4-benzyl-pyridine-7-yl-1 small propyldiazepine hydrazone-1- 89166 -593-200427678 ethyl carboxylate 2.2-dioxide triphenylphosphine (1.5 equivalents A solution in methylene chloride was treated dropwise with diethyl azodicarboxylate (L5 equivalent) at 2Γ (.) This solution was stirred for 10 minutes, and then the product containing Example 436 (1 equivalent) was added dropwise. ) And n-propanol (11 equivalents) in dichloromethane. The resulting solution was stirred at 25 ° C for 20 hours, then dichloromethane and a 1 N aqueous hydrochloric acid solution were added. The formed organic layer was separated , And dried over magnesium sulfate, and filtered to provide the title compound. Example 439 Hydroxy small aspartate π, 8 &gt; Tetridine oxidized · 1,2,4-benzopyrene The basic news, Yu Mou face treatment of the product of Example 438 in methanol with 10% palladium / carbon, and stirred for 5 hours under the atmosphere of% C and hydrogen. Then the resulting solution was filtered, and under reduced pressure The filtrate was concentrated to provide the title compound. Example 440 U3 (4 I-I-1-pictyl-1,2_difluorene "1,81 pyridine_3_some V1,1_dioxide_4": 1, 2,4 · + pyridine ^ _7_yl 1diazylsulfide H-1-metanoate methyl 2,2_digasate in chlorosulfoisocyanate (4.9 μl, 0.00562 milliliter) (Mole) in dichloromethane (2 liters) &lt; In a stirred solution, 25 microliters of methanol (0.0562 mol) was added dropwise at 25 ° C. After 30 minutes, the product of Example 205 was added ( A solution of 20 mg, 0.0468 pen moles) and triethylamine (26 microliters, 0187 millimoles) in chloroform (2 ml) was stirred at 25 r for 24 hours. The reaction mixture was divided into two portions. Dichloromethane (10 ml) was diluted with aqueous hydrochloric acid solution (10 ml). The organic layer formed was separated, dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title compound (12 mg, 39 %), Which is three Amine salt. Lame 89166 -594- 200427678 (300 MHz, DMSO-d6) 5 0 · 98 (d, J = 6_3 Hz, 3H), 1_38 (m, 2H), 1.67 (m, 1H), 3.63 (s, 3H), 4.50 (m, 2H), 7.53 (m, 2H), 7.63 (d, J = 2.2 Hz, 1H), 7.77 (d, J = 8.8 Hz, 1H) , 8.57 (dd, J = 8.1, 1.8 Hz, 1H), 8.90 (dd, J = 4.4, 1.8 Hz, 1H), 11.15 (s, 1H), 12.10 (s, 1H), 14.10 (s, 1H) MS (ESI.) m / z 563 (MH)-· Example 441 3- "3- (4-hydroxy-1-isopentyl-2-one-1,2-dihydro 1X814 pyridine Each Vl.l-di-emulsified-4H-1,2,4-benzo fare 2 ton-7-yl 1_1-methyldiazathiouranyl carboxylate 2,2-digas will be described in Example 436. A solution of the product (0.032 g, 0.05 mmol) in 1: 1 tetrahydrofuran / methanol (2 ml) at -10 ° C with trimethylsilyldiazomethane (2.0 M in hexane) (50 μl, 0.1 mmol) in hexane, then stirred at 25 ° C. for 16 hours, and concentrated under reduced pressure. The residue was chromatographed on silica gel and dissolved in 3% methanol in dichloromethane to provide the title compound (mg, 15% yield). 1H NMR (300 MHz, DMSO-d6) δ 0 · 99 (d, J = 6.25 Hz, 6H) I. 58 (m, 2Η) 1.69 (m, 1Η) 3.21 (s, 3Η) 4.49 ( m, 2Η) 5.19 (s, 2Η) 7.32 (m, 5Η) 7.46 (m, 1H) 7.51 (dd, J = 7.91, 4.60 Hz, 1H) 7.58 (d, J = 2.21 Hz, 1H) 7.68 (d, J = 8.82 Hz, 1H) S.57 (dd, J = 8.09, L84 Hz, 1H) 8.90 (dd, J = 4.78, 1.47 Hz, 1H) II. 29 (s, 1H) 14.09 (s , 1H) · MS (ESI.) M / z 653 (MH) _ · Example 442 N- "3- (4-hydroxy-1-isopentyl-2-one-1,2-dihydro fl, 81 Pyrimidin-3-yl V1.1-dioxolane = 4H_1,2,4_benzobenzophenone Erqin-7-yl 1-N-methodine Saisai _ the product of Example 441 (14 mg, 0.0214 mmol) (Ear) solution in methanol (3 ml) and 10% palladium / carbon (10 mg) in hydrogen atmosphere and 25. (: reaction, and sand for 2 hours. The solution was filtered and concentrated under reduced pressure to provide the title Compound ⑺ 89166 -595-200427678 mg, 73%). WNMR (300 MHz, DMSO-d6) δ 0.94 (d, J = 6.6 Hz, 6H), 1.57 (m, 2H), 1.69 (m, 1H) , 2.49 (s, 3H), 4.45 (m, 2H), 7.50 (m, 2H), 7.62 (m, 2H), 8.57 (m, 1H), 8.84 (m5 1H), 10.1 8 (bs, 1H) · MS (ESI ·) m / z 519 (MH) _ · Example 443 3- "3- (4 • Hydroxy-1-isopentyl_2-one-1,2-dione Hydrogen "1,81 Handian-3-yl Vl.l_ Dioxide-4H_1,2,4-benzopyrimidin-7-yl 1 Dioxanthiourethane Xiaoler_ 2-Aminoethyl 2,2 -Digas in a solution of chlorosulfosulfanyl isocyanate (7-3 μl, 0.0843 mmol) in dichloromethane (2 ml) at 25 ° C, add N- (2-hydroxyl Ethyl) third-butyl carbamate (13.6 mg, 0.0843 mmol). After 30 minutes, the solution was obtained from the product of Example 205 (30 mg, 0.0703 mmol) and triethylamine (39 μm). Liter, 0.281 ¢: mol) was treated in a solution of scorch (2 ml) and stirred for 24 hours. The reaction mixture was diluted with dichloromethane (10 ml) and a 1 N aqueous hydrochloric acid solution (10 ml). The formed organic layer was separated, dried over magnesium sulfate, dried over celite, and concentrated under reduced pressure. The residue was purified on a Waters symmetrical C8 column (25 mm X 100 mm, 7 micron particle size) and purified by reverse-phase HPLC purification using U in water as a gradient of 100% acetonitrile / 10 ammonium acetate. After 8 minutes (10 minutes of operation time), at a flow rate of 40 ml / min, 8 g of solid was provided. This solid was treated with a solution of trifluoroacetic acid (1 · 6 ml) and dichloromethane (0.4 ml) at 25 ° C for 3 hours. The solvent was removed under reduced pressure to provide the F4 compound (12 g of '24%) as a trifluoroacid salt. 1h nmr (300mHz, DMSO-d6) 5 0.98 (d, J = 6.6 Hz, 6Η), 1.57 (m, 2Η), 1.68 (m, 1Η), 3.06 (m, 2Η), 4.21 ( t? J-5.1 Hz5 2H) 5 4.46 (m5 2H) 5 7.49 (m? 2H), 7.63 (d5 J = 2.2 Hz? 1H)? 7J1 (d, J — 8.8 Hz, 1H), 7.83 (bs, 2H ), 8.55 (dd, J = 7.7, 1.8 Hz, 1H), 8.86 (m, 89166 -596- 200427678 1H). MS (ESI &quot;) m / z 592 (MH) ~. Example 444

Cyclopentyl-N'-P-dU: _i_isopentyl_2_keto_u_di '"L8> Nyridinyl groups v U ^ Ai ^ 4g-1,2,4-benzopyrene Geng-7- The product of Example 435B (0_029 g, 0.05 mmol) in 1 acetamide in acetonitrile (2 ml), 1-aminocyclopentane (0.0085 g, 0.0099 ml, 0.1 millimolar). The reaction mixture was heated in a microwave reactor at 80 ° F for 2 hours and cooled to about 25 C. The solvent was removed under a warm nitrogen stream and the residue was placed in a Waters symmetrical C8 tube. On a column (25 mm x 100 mm, 7 micron particle size), purified by reverse phase-prepared HPLC using a gradient of 10% to 100% acetonitrile / 10 mM ammonium acetate in water over 8 minutes (10. Minute operating time) at a flow rate of 40 ml / min to obtain the title compound (11 mg, 38%). IHNMR (300 MHz, DMSO-d6) δ 0.97 (d, J = 6.62 Hz, 6H) 1.51 (m , 11H) 3.53 (m, 1H) 4.48 (m, 2H) 7.49 (m, 2H) 7.60 (d, J = 2.57 Hz, 1H) 7.70 (d, J = 9.19 Hz, 1H) 7.83 (d, J = 7 · 35 Hz, 1H) 8.55 (dd, J = 8.09, 1.84 Hz, 1H) 8.88 (dd, J = 4.60, 1.65 Hz 1H) 10.19 (s, 1H) 14.06 (s, 1H). (ESI-) m / z 573 (MH)-. Example 445 Cyclobutyl-N '-"3- (4. 2_keto_1,2-dihydroTL81 pyridin-3-a certain V LJ-dioxide_4H-1,2,4_mo # far-farming-7-yl-1 sulfonamide in acetonitrile (2 ml To the product of Example 435B (0.029 g, 0.05 mmol), 1-aminocyclobutane (0.0071 g, 0.0085 ml, 0.1 mmol) was added. The reaction mixture was placed in a microwave reactor at 80 ° Heat for 2 hours at C and cool to about 25 ° C. Remove the solvent under a warm nitrogen stream and place the residue on a Waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size). 89166 -597- 200427678

Phase-prepared HPLC purification, using a gradient of 10% to loo% acetonitrile / 100% ammonium acetate in water over 8 minutes (10 minutes of operation time) at a flow rate of 40 ml / min to obtain the title compound mg , 28%). iHNMR (300 MHz, DMSO-d6) 5 0.98 (d, J = 6.62 Hz, 6H) 1.64 (m, 7H) 2.05 (m, 2H) 3.68 (m, 1H) 4.49 (m, 2H) 7.50 (m, 2H) 7.59 (d, J = 2.57 Hz, 1H) 7.73 (d, J = 8.82 Hz, 1H) 8.16 (d, J = 8.46 Hz, 1H) 8.56 (dd, J = 8.09, 1.84 Hz, 1H) 8.90 (dd, J = 4.60, 1.65 Hz, 1H) 10.17 (s, 1H) 14.02 (s, 1H) · MS (ESI-) m / z 559 (MH)-·

A-825309.1 Example 446A _ [({"3_ (4_hydroxy-1-isofluorenyl_2_one ketone_i, 2_dihydro" 1,81 pyridin-3-yl VU-shi monoxide- Example of 4H-1,2,4-jasmine #pyrimidinium 7-some 1 amine} sulfofluorenyl) amino 1 hexahydropyridine #acid tert-butyl ester in acetonitrile (2 ml) (0.029 g, 0.05 mmol), Nl-Boc-4-aminohexahydropyridine (0.020 g, 0.1 mmol) was added. The reaction mixture was heated in a microwave reactor at 80 ° C. 2 hours and cooled to about 25 C. The solvent was removed under a stream of warm nitrogen and the residue was placed on a Waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size), prepared by reverse phase Purified by HPLC using a gradient of 10% to 100% acetonitrile in water / 10 g of ammonium acetate in water over 8 minutes (10 minutes of operation time) at a flow rate of 40 ml / min to obtain the title compound (12 mg , 35%).

Example 446B M · 1> (4-Cyclo-1-isopentyl-2-keto-1,2-dihydro "1,81 peak lake 3-yl digasification-Benzoblocked two? Wells -7-Based Nitrosamidine Base) Sodium Acetate Soluble the product of Example 446A (0.02 g, 0_017 mmol) in a solution of hydrogen chloride in n 89166 -598- 200427678 dioxolane (4N , 3 ml). The mixture was stirred at 25 ° C for 18 hours. The solvent was removed under reduced pressure to give the title compound as its hydrochloride salt (10 mg, 92%). 1H NMR (300 MHz, DMSO -d6) 5 0 · 99 (d, J = 6.25 Hz, 6H) 1.70 (m, 7Η) 2.95 (m, 2H) 3.16 (m, 3H) 4.49 (m, 2H) 7.50 (m, 2H ) 7.63 (d, J = 2.21 Hz, 1H) 7.73 (d, J = 9.19 Hz, 1H) 8.17 (d, J = 7.35 Hz, 1H) 8.52 (m, 1H) 8.56 (dd, J = 7.91, 1.65 Hz, 1H) 8.75 (m, 1H) 8.90 (dd, J = 4.60, 1.65 Hz, 1H) 10.34 (s, 1H) 14.08 (s, 1H) · MS (ESI-) m / z 588 (MH) _ A-825311.0 Example 447 DL2 &amp; (2-hydroxyethylhydroxy small isofluorenyl-2-keto-1,2-dihydro "U1 pyrimidine groups" -1,1-dioxide-4Η-1, 2,4-Ι # Pyridoxine-7-yl-1 sulfonamide in tetrahydrofuran (2 ml) To the product of Example 435B (0.006 g, 0.0104 mmol), water (0.1 ml) and sodium ethoxide (20% w / w, 1 ml) in ethanol were added. The mixture was stirred at 25 ° C for 24 hours. The reaction was concentrated under a stream of hot nitrogen, and the residue was treated with 1 N hydrochloric acid (2 mL) and stirred for 10 minutes. The solid formed was filtered and dried to give the title compound (4 mg, 70%). 1H NMR (300 MHz, DMSO-d6) 5 0.99 (d, J = 6.62 Hz, 6H) 1.58 (m, 2H) 1.71 (m, 1H) 2.92 (m, 2H) 3.39 (m, 2H) 4.50 ( m, 2H) 7.51 (m, 2H) 7.61 (d, J = 2.21 Hz, 1H) 7.72 (d, J = 8.82 Hz, 1H) 7.80 (t, J = 5.88 Hz, 1H) 8.56 (dd, J = 8.09, 1.84Ηζ, 1H) 8_89 (dd, J = 4.41, 1.47, 1H) 10.21 (s, 1H) 14.08 (s, 1H) · MS (ESI-) m / z 549 (MH) '. Example 448 3- "({" (3- (4- # fluorenyl-1-isopentyl-2-fluorenyl-1,2-di-i, "1,8 &gt; Nyodo_3 • yl dioxide Example of 435B product (0.029 g, 0.05 mmol) of -4H-1,2, benzothiadinyl-7-yl-1 amine} sulfo) amino 1 propanamide in acetonitrile (2 ml) ) Within 89166 -599- 2Q0427678, add Amides amine hydrochloride (0.0125 g, 0.1 mmol) and _ carbonate (1.4 square mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours' and cooled to about 25 ° C. The solvent was removed under a warm nitrogen stream, and the residue was purified on a Waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size) by reverse phase-prepared HPLC using 10% to 1 in water A gradient of 0% acetonitrile / 10 mM ammonium acetate was used to obtain the title compound (3 mg, 10%) at a flow rate of 40 ml / min over 8 minutes (10 minutes operation time). 1H NMR (300 MHz, DMSO-d6) δ 0.99 (d? J = 6.62 Hz? 6H) 1.59 (m? 2H) 1.70 (m, 1H) 2.25 (t, J = 7.54 Hz, 2H) 3.07 (m, 2H ) 4_49 (m, 2H) 6.80 (s, 1H) 7.30 (s, 1H) 7.50 (m, 2H) 7.61 (d, J = 2.21 Hz, 1H) 7.70 (d, J = 8.82 Hz, 1H ) 7.82 (t, J = 5.70 Hz, 1H) 8.56 (dd, J = 7.72, 1.84 Hz, 1H) 8.89 (dd, J = 4.41 Hz, 1.47 Hz, 1H) 10.23 (s5 1H) 14.13 ( s5 1H). MS (ESI-) m / z 576 (MH) '. A-832731.0 Example 449 Ethyl-1-isopentyl_2-keto_1,2-dihydro "1,81pyrimidine- Example of a 435B product of 3_yl Vl, l-dihydrazide_4H-1,2,4-benzodiaphthin-7-yl-l-tetramethylpyridamine in acetonitrile (2 ml) (0.029 g, 0.05 mmol), mononitrotetrahydrochloride (0.0095 g, 0.1 mmol) and potassium carbonate (0.4 mmol) were added. The reaction mixture was placed in a microwave reactor at It was heated at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a warm nitrogen stream and the residue was placed in a Waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size) For HPLC purification by reverse phase preparation, use A gradient solution of 10% to 100% acetonitrile / 10 mM ammonium acetate in water over 8 minutes (10 minutes of operation time) at a flow rate of 40 ml / minute to obtain the title compound (2 mg, 7%). 1HNMR ( 300 MHz? DMSO-d6) δ 0.99 (d? J = 6.62 Hz? 6H) 1.58 (m3 2H) 1.71 89166 -600- 200427678 (m, 1H) 2_15 (m, 2H) 3.83 (t, J = 7_54 Hz, 4H) 4.49 (m, 2H) 7.53 (m, 2H) 7.63 (d, J = 2.21 Hz, 1H) 7.72 (d, J = 9 · 19 Hz, 1H) 8.56 ( dd, J = 8.09, 1.84 Hz, 1H) 8.90 (dd, J = 4.41, 1.84Ηζ, 1H) 10.50 (s, 1H) 14.11 (s, 1H). MS (ESI-) m / z 545 (M-fluorene)-. A-832735.0 Example 450 DL2 3-Hydroxydiy_``3- (4-Hydroxyisopentyl-2_keto_1,2-dihydro``L8> Nyridine-3- Example 435B product (0.029 g, 0.001) 5 millimoles), and hydroxymonoazatetrahydrochloride (0.011 g, 0.1 millimoles) and potassium carbonate (0.4 millimoles) were added. The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a warm nitrogen stream, and the residue was purified on a Waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size) by reverse phase-prepared HPLC using 10% to 10% of water. A gradient of 0% acetonitrile / 10 mM ammonium acetate was used to obtain the title compound (3 mg, 13%) at a flow rate of 40 ml / min over 8 minutes (10 minutes of operation time). 1H NMR (300 MHz, DMSO-d6) δ 0.99 (d, J = 6.62 Hz, 6H) 1.58 (m, 2H) 1.71 (m, 1H) 3.66 (m, 2H) 3.92 (m, 2H) 4.38 ( m, 1H) 4.50 (m, 2H) 7.55 (m, 3H) 7.73 (d, J = 8.82 Hz, 1H) 8.57 (dd, J = 8.09 Hz, 1.08 Hz, 1H) 8.90 (dd5 J = 4.41, 1.84 Hz, 1H) 10.55 (s5 1H) 14.08 (s5 1H). MS (ESI-) m / z 561 (MH) ..

Example 451A l-({[3- (4-Hydroxyisoisopropyl · 2-ketone 4,2-dihydrofi, 81 pyridin-3-yl VL1-oxy. Example of 435B product of 4-Benzo-4-7-yl-1amino-sulfonyl K3-tetrahydropyrrolylaminocarboxylic acid tert-butyl ester in acetonitrile (2 ml) 0_05 millimolar) 89166 -601-200427678, N-Boc_3-aminotetrahydropyrrole (00186 g, 0.1 millimolar) was added. The reaction mixture was placed in a microwave reactor at 80 ° C Heat for 2 hours and cool to about 25 ° C. Remove the solvent under a warm stream of nitrogen and place the residue on a Waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size) using the reverse phase For preliminary HPLC purification, a gradient of 10% to 100% acetonitrile / 10 mM ammonium acetate in water was used over 8 minutes (10 minutes of operation time) at a flow rate of 40 ml / min to obtain the title compound (23 Mg, 68%).

Example 451B MU_N_``3- (4 • Hydroxy_1_Isomorphic_2_Keto-L2-dihydro``1,81Meridine-3-VU- A solution of the product of Example 446A (0.02 g, 0.001 mmol) in 1 small tetrahydropyrrolidazole (4N, 3 ml) The mixture was stirred at 25 ° C for about 18 hours. The solvent was removed under reduced pressure to give the title compound as its hydrochloride salt (16 mg, 88%). IHNMRpOOMHz'DMSO-cy 3 0.98 (d, J = 6.62 Hz, 6H) 1.54 (m, 2H) 1.67 (m, 1H) 1.91 (m, 1H) 2.18 (m, 1H) 3.26 (m5 2H) 3.50 (m, 2H) 3.79 (m, 1H) 4.43 (m, 2H) 7.40 (dd, J = 7.72, 4.78 Hz, 1H) 7.58 (m, 3H) 8.22 (s, 3H) 8.50 (dd, J 7.71 Hz, 1.47 Hz, 1H) 8.80 (d, J = 3.31 Hz, 1H) 10.52 (s, 1H) 14.55 (s, 1H) · MS (ESI-) m / z 574 (M-Η) · ·

Example 452A 1-Hexyl chloride p-pyridine spectrum B. A solution of thionine chloride (1 N in dichloromethane, 75 ml, 75 mmol) was used at -2CTC with hexahydropyridine (12.6 G, 150 mmol), dropwise, stirred at 0 ° C for 2 hours, and separated between methylene chloride and water (50 ml). The organic layer was washed with IN HC1 aqueous solution, brine, and dried over magnesium sulfate. 89166 -602- 200427678 was dried anhydrous, filtered, and concentrated under reduced pressure. The residue was distilled under reduced pressure (1 mm jjg) and 105 ° C to obtain the title compound (5 g).

Example 452B Hydroxy-1-isopentyl-2-yl-1,2-dihydro "1,81 pyridine-3-yl VI 411-1,2,4-epoxy and a well-7-kib 1 The product of Example 205 (2 mg, 0.1 ml), the product of Example 451A (17 mg, 0.1 mmol) and triethylamine (0.1 ml) in dichloromethane ( 2 ml) of the mixture 'stirred at 25 C; dropped for 18 hours, diluted with dichloromethane (25 ml) and washed with IN HC1 and brine. The organic layer was dried over anhydrous sodium sulfate' filtered 'and Concentrated under reduced pressure. The product was purified on a Waters symmetrical C8 column (25 mm x 100 ha, 7 micron particle size) and purified by reverse phase HPLC using 10% to 100% acetonitrile in water 10mM A gradient solution of ammonium acetate provided the title compound (10 mg) at a flow rate of 40 ml / min over 8 minutes (10 minutes operation time). 1H NMR (300 MHz, DMSO-d6) 3 0.98 (d, J = 6.62 Hz, 6H) 1_43 (s, 6H) 1.57 (m, 2H) 1.69 (m, 1H) 3.14 (s, 4H) 4.49 (m, 2H) 7.51 (m, 1H) 7.53 (s, 1H) 7.60 (d5 J = 2.21 Hz, 1H) 7.72 (d, J = 8.82 Hz, 1H) 8.56 (dd5 J = 8.09, 1.84 Hz, 1H) 8.90 (dd5 J = 4.78, 1.84 Hz5 1H) 10.47 (s5 1H) 14.06 (s, 1H) 15.05 (s, 1H) · MS (ESI_) m / z 573 (MH)-.

A-805330.0 Example 453 DLM group-N'43- (4-lightyl-1-isopentyl-2-one-yl-u-difluorene U, 8> naphthyridin-3-yl vu: fluorene oxide-4H- 1,2,4_Aminopyrimidine dimethanamine produced the product of Example 435E (28 mg, 0.05 mmol), benzylamine (6 mg, 0.05 mmol) and triethylamine (0.5 ml) in The mixture in acetonitrile (2 ml) was stirred at 70 ° C for 18 hours. The reaction mixture was cooled to about 25 ° C in ethyl acetate 89166 -603-200427678

Separate with IN HCl (10 mL). The organic layer was washed with brine and dried over anhydrous Na 2 SO 4, filtered, and concentrated under reduced pressure. The residue was purified on a Waters symmetrical C8 column (25 mm X 100 mm, 7 micron particle size) and purified by reverse phase HPLC using a gradient of 10% to 100% acetonitrile / 10 mM ammonium acetate in water. The solution was subjected to 8 minutes (10 minutes operation time) at a flow rate of 40 ml / min to obtain the title compound (12 mg). 1H NMR (300 MHz, DMSO-d6) 5 0.99 (d, J = 6.25 Ηζ, 6Η) 1.65 (m, 3Η) 4.08 (d, J = 6.25 Hz, 2H) 4.49 (m, 2H) 7.22 (m, 5H) 7.45 (m, 1H) 7.51 (dd, J = 8.09, 4.78 Hz, 1H) 7.61 (d, J = 2.57 Hz, 1H) 7.69 (d, J = 8.82 Hz, 1Η) 8.41 (t, J = 6.25 Hz, 1H) 8.57 (dd, J = 8.09, 1.84 Hz, 1H) 8.90 (dd, J = 4.78, 1.84 Hz, 1H) 10 · 33 (s , 1H) 14.08 (s, 1H) 15.15 (s, 1H). MS (ESI.) M / z 595 (MH) · Example 454 M (U3- (4-hydroxy-small isoamyl-2-one- 1,2-digas "U1 pyridine_3-a certain VU-digas iL-4H-1,2,4-benzo ... Geng-7-yl &quot; Iamino} Shiyan a) Amine 1 Acetyl benzate is intended to add a solution of 3-amino-benzoic acid ethyl ester (0.165 g, 1.0 mmol) in dichloromethane (6 ml) dropwise at about 0 ° C. Sulfonic acid (0.128 g, 1.1 mmol). The reaction mixture was stirred at 25 ° C. for 1 hour, then phosphorus pentachloride (0.229 g, 1.1 mmol) was added, and the reaction mixture was heated at reflux for 3.5 hours. The reaction mixture was then cooled to about 25 ° C and the solvent was evaporated under reduced pressure A solution of the residue in dichloromethane (10 ml) was treated with the product of Example 205 (0.214 g, 0.5 mmol), followed by triethylamine (0152 g, 1.5 mmol). The reaction mixture was stirred at 25 ° C. for 3 hours, and then poured into 25 ml of a 1N aqueous hydrochloric acid solution. Then, the reaction mixture was extracted with dichloromethane (3 × 25 ml). The combined organic materials were dried over anhydrous magnesium sulfate and dried. 89166 -604- 200427678 filtered and evaporated under reduced pressure. The residue was purified by chromatography on crushed gel and separated with 0-2% methanol / dichloromethane to provide the title compound (0.68 g, 48% product) Rate). 1H NMR (300 MHz, DMSO-d6) (5 0.98 (d, J = 6.25 Ηζ, 6Η) 1.30 (t, J = 7.17 Hz? 3H) 1.56 (m? 2H) 1.68 (m, 1H ) 4.29 (q? J = 6.99 Hz? 2H) 4.48 (m, 2H) 7.44 (m, 4H) 7.57 (d, J = 2.21 Hz, 1H) 7.62 (dt, J = 7.36, 1.47 Hz, 1H) 7.69 (d, J = 8.82 Hz5 1H) 7.74 (s? 1H) 8.55 (dd? J = 8.09? 1.84 Hz? 1H) 8.88 (dd? J = 4.41, 1.84 Hz? 1H) 10.80 (s? 1H) 10.88 ( s? 1H) 14.11 (s5 1H). MS (ESI4 *) m / z 655.1 (M + H) +, 672.2 (M + NH4) + 677.0 (M + Na) +, (ESI ·) m / z 653 · 1 (MH) · · A-824028.0 Example 455 3-[({“3- (4-hydroxy_1-isoamyl-2-one -1,2-dihydropyridin-3-yl M, l-digasified-4H], 2,4-benzopyrimidin-7-yl &quot; Iamino} sulfofluorenyl) amino 1 A solution of the product of Example 454 (25.5 mg, 0.389 mmol) in 1 ml of a 1N aqueous sodium hydroxide solution and 1 ml of methanol was stirred at 25 ° C for 17 hours, and concentrated under a stream of warm nitrogen. The residue was treated with 2 ml of a 1 N aqueous hydrochloric acid solution. The formed solid was isolated by vacuum filtration, washed with 10 ml of water, and dried to provide the title compound (21.4 mg, 88% yield). iHNMR (300 MHz? DMSO-d6) δ 0.98 (d? J = 6.62 Hz? 6H) 1.56 (m5 2H) 1.68 (m5 1H) 4.48 (m, 2H) 7.32-7.53 (m, 4H) 7.59 (m , 2H) 7.69 (d, J = 8.82 Hz, 1H) 7.75 (s, 1H) 8.55 (dd, J = 8.09, 1.84 Hz, 1H) 8.88 (dd, J = 4.78, 1.47 Hz, 1H) 10.79 (s, 1H) 10.88 (s, 1H) 13_01 (bs, 1H) 14.12 (bs, 1H) · MS (ESI +) m / z 627.1 (M + H) +, 649.1 (M + Na) +? (ESI ') m / z 625.1 (MH) ~. Example 456 3-「(丨「 3- (4-hydroxy-1-isoamyl-2_2-one-1,1,2-di 氤 II, 81 Pyridin-3-yl VLl-dioxide-4H-1,2,4-benzylpyridine-7-a certain amidino group} sulfofluorenyl) amino group jamonamidine 89166 -605- 200427678 Examples A solution of the product of 454 (7.6 mg, 0.012 mmol) in 1 ml of ammonium hydroxide was stirred at 25 ° C for 17 hours. The solvent was evaporated under a stream of warm nitrogen to provide the title compound (7.4 mg). 1H NMR (300 MHz, DMSO-d6) 6 0.096 (d, J = 6.62 Ηζ, 6Η) 1.47 (m, 2Η) 1_64 (m, 1Η) 4.30 (m, 2Η) 7.14 (m, 1Η) 7 · 28 (m, 6H) 7.43 (s, 1H) 7.49 (d, J = 7.72 Hz, 1H) 7.66 (s, 1H) 7.87 (s, 1H) 8.36 (dd, J = 7.54, 1.65 Hz, 1H) 8.54 (s, 1H) 10.45 (bs, 1H) 10.51 (bs, 1H) 15.89 (bs, 1H).

Example 457A 4- (fluorenyl-M-isofluorenyl-2 (1HV pyridone to 4-etooxy-IH-p than yodo-2-one (1.0 g, 4.97 mmol)) N-Bicyclo [5 · 4.0]; pinene (1.86 ml, 12.43 mmol) and 1-bromo-3-methylbutane (0.715 ml, 5.96 mmol) in N, N-di The solution in methylacetamide (20 ml) was heated at 65 ° C for 5 days. The solution was cooled to about 25 ° C and separated between 10% ammonium chloride aqueous solution and dichloromethane. The organic layer was separated and concentrated under reduced pressure. The residue was chromatographed on silica gel and dissolved in 5% methanol in dichloromethane to provide the title compound (0.569 g, 42%).

Example 457B is based on the ratio of small isoisopropyl groups. The product of Example 457A (0.452 g, 1.67 mmol) in tetrahydrofuran (20 ml) was mixed with ammonium formate (0.30 g, 5.01 mmol). The catalytic amount of 20% saturated hydrogen / carbon was treated at 60 ° C for 2 hours. The reaction was filtered through celite and the filtrate was concentrated under reduced pressure to provide the title compound (0.30 g, 100%).

Example 457C M bis (methylthio) methylene 1-U Yu AS Liao 4 (1113 out_picodione) The product of Example 457B (2.24 g, 12.37 mmol) was pyridine (8.0 ml, 89166 -606) -200427678 98.96 millimoles) and dioxolane (50 ml) at 90 τ: in excess of ginseng (methylthio) methyl sulfate (use synthesis, 22_25, 1988; M . ⑽s

Processed by Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi), stirred at 90 ° C for 1.5 hours, and cooled to about 2yc. The reaction solution was decanted from the formed solid, and the solvent was removed under reduced pressure. The residue was dissolved in hexane and packed on a silicone pad (300 mL) and hexane, then chloroform, and then dissolved with 25% ethyl acetate in dichloromethane to provide the title. Compound (2.42 g, 75%).

Example 457D Amine Dioxidation_4Η_1,2,4-jasopyridine, each group V4-Qingyi_1_ is different: 2 (1Η> Bididone will be the product of Example 45 (2.08 g, 7.29 mmol) Moore) The product of Example 414A (2.00 g, 6.96 mmol) was treated in dioxan (20 ml) at i15 ° C for 30 minutes, cooled to 25 ° C, and concentrated under reduced pressure. A solution (20 ml) of the residue in 4M hydrochloric acid in dioxetane was stirred at 25 ° C for 18 hours, and concentrated under reduced pressure. The residue was triturated with dichloromethane and filtered to obtain The title compound.-The filtrate containing the protected intermediate was concentrated and purified by chromatography on silica gel, and then dissolved in 1% methanol in methane. The protected product was subjected to the above-mentioned removal protection conditions to provide the title compound, Its hydrochloride (2.02 g, 96%). 1H NMR (300 MHz, DMSO-d6) δ 0.92 (s, 3H) 0.94 (s, 3 ，) 1.58 (m, 3 ，) 3.99 (m, 2Η) 6.31 (d, J = 7.35 Ηζ, 1Η) 6.96 (m, 2Η) 7.34 (d, J = 8.46 Ηζ, 1Η) 8 · 04 (d, J = 7.35 Ηζ, 1Η) 14.04 (s , 1Η) 14.19 (s, 1Η). MS (ESI-) m / z 375 ( M-H) '. 89166 -607- 200427678

Example 457E 3- [3- (4-Hydroxy-1-isopentyl-2-one group_1,2_dihydro-3_pyridyl groupVU-dihydro-4H-1 ^ 4 -7-yl 1-diazathiouranyl sulfonium acetoate 2.2-diamidate. Chlorosulphoisocyanate (61.8 mg, 0.436 mmol) and benzyl alcohol (47.0 mg, 0.436 mmol) Mol) in dichloromethane (7.5 ml), stirred at 25 ° C for 1 hour, then added the product of Example 457D (150 mg, 0.363 mmol) and triethylamine (183.7 mg, 1.82 mmol) Ear) in dichloromethane (14 ml), stirred at 25 ° C for 20 hours, and separated between methylene chloride (25 ml) and 1 N aqueous hydrochloric acid solution (25 ml). Separation The organic layer was dried over hydration sulfate, filtered, and concentrated under reduced pressure to provide the title compound (200 mg, 93%). 1H NMR (300 MHz, DMSO-d6) 5 0.93 (s, 3H) 0.95 ( s, 3H) 1.58 (m, 3H) 4.00 (m, 2H) 5.11 (s, 2H) 6.35 (d, J = 7.72 Hz, 1H) 7.32 (m5 5H) 7.46 (dd, J = 9.01, 2.39 Hz, 1H) 7.61 (d5 J = 2.57 Hz, 1H) 7.65 (d, J = 9.19 Hz? 1H) 8.09 (d5 J = 7.72 Hz, 1H) 11.10 (s5 1H) 12.14 (s? 1H) 13.87 (s3 1H) 14.25 (s, 1H). MS (ESI-) m / z 588 (MH) _ · Example 458 N- [3- (4- -Lr isoamyl-2-fluorenyl-1,2-diazine-3-exo-ololyl Vl, l-digasification-4H-1,2,4-benzophenone disulfide-7 -Glycoxanthine lutetium acid, solution of the product of Example 457E (40 mg, 0.068 mmol) in methanol (5 ml), hydrogen atmosphere at 25 ° C, and 10% dry / carbon (22 mg ) Stir together for 4 hours. Filter the reaction and concentrate the filtrate under reduced pressure to provide the title compound (28 mg, 99%). 1H NMR (300 MHz, DMSO-d6) 5 0.92 (s, 3H) 0.94 (s , 3H) 1.58 (m, 3H) 3.98 (m, 2H) 6.32 (d, J = 4.41 Hz, 1H) 7.36 (s, 2H) 7.47 (m. 1H) 7.60 (m, 2H) 8.06 (s5 1H) 10.00 (s5 1H) 13.97 (s, 1H) 14.23 (s, 1H). 89166 -608- 200427678 MS (ESI-) m / z 454 (MH) '.

Example 459A 2 · "({" 3_ (4- 蕤 some small I pento-2-one grave-1,2_dioxin "1,81 pyridine_3-a certain VU-dioxide-4H-1, Example of 435E product (0.029g) , 0.05 mmol), tert-butyl N- (2-aminoethyl) carbamate (0.016 g, 0.016 ml, 0.1 mmol) was added. The reaction mixture was placed in a microwave reactor at Heat at 80 ° C for 2 hours and cool to about 25 ° C. Remove the solvent under a warm nitrogen stream and place the residue on a Waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size), Purified by reverse phase HPLC purification using a gradient of 10% to 100% acetonitrile in water / 10 mM ammonium acetate in water over 8 minutes (10 minutes operation time) at a flow rate of 40 ml / min to obtain the title Compound (6.3 mg, 20%). 1H NMR (300 MHz, DMSO-d6) 5 0.99 (d, J = 6.25 Hz, 6H) 1.34 (s, 9H) 1.58 (m, 2H) 1.68 (m, 1H ) 2.88 (m, 2H) 2.97 (m, 2H) 4.50 (m, 2H) 6.75 (s, 1H) 7.50 (m, 2H) 7.60 (d, J = 2.21 Hz, 1H) 7_72 (d, J = 8.82 Hz, 1H) 7.87 (t, J = 5.70 Hz, 1H) 8.57 (dd? J = 8.09, 1.84 Hz, 1H) 8.90 (dd? J = 4.41? 1.84 Hz5 1H) 10.26 (s, 1H) 14.09 (s, 1H) · MS (ESI_) m / z 648 (MH) _ ·

Example 459B N- (2-aminoethyl) -N '-"3_ (4-hydroxy-1-isopentyl_2-one-L2-di, p SIp ·) -l, l-di Oxidation of 4H-1,2,4-benzothiamidine-II--7-a certain 1 fu_face will be the product of Example 459A (0.0053 g, 0.0082 mmol) in a solution of hydrogenated gas and dioxolane ( 4 N, 3 ml), stirred at 25 ° C. and stirred for 18 hours. The solvent was removed under reduced pressure to give the title compound as 89166 -609- 200427678 and its hydrochloride salt (4 mg, 89%). IHNMRpOOMH ^ DMSO-dd (5 0.99 (d, J = 6.62 Hz, 6H) 1.56 (m, 2H) 1.68 (m, 1H) 2.89 (m, 2H) 3.10 (m, 2H) 4.49 (m, 2H) 7.51 (m, 2H) 7.62 (d, J = 2.21 Hz, 1H) 7.74 (d, J = 8.82 Hz, 1H) 7.79 (s5 2H) 8.03 (t, J = 5.70 Hz, 1H) 8.56 (dd, J = 7.72, 1.84 Hz, 1H) 8.89 (dd, J = 4.41, 1.84 Hz, 1H) 10.37 (s5 1H) 14.16 (s, 1H). MS (ESI-) m / z 548 (MH) 'Example 460 l-(("3- (4-hydroxy-1-isopentyl-2-one-1,2-dihydro" 1,8 &gt; naphthyridin-3-yl Vl , l-Digas-4H_1,2,4-benzopyridine-7-yl-1amino} sulfofluorenyl ethyl V3-hexahydropyridinecarboxylate in acetonitrile (2 ml) The product of Example 435B (0.029 g, 0.05 mmol) was added with ethyl hexahydronicotinate (0.016 g, 0.016 ml, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C. 2 hours, and cooled to about 25 ° C. The solvent was removed under a warm nitrogen stream, and the residue was placed on a Waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size) and prepared by reverse phase. Purified by HPLC using a gradient of 10% to 100% acetonitrile / 10 mM ammonium acetate in water over 8 minutes (10 minutes of operation time) at a flow rate of 40 ml / minute to obtain the title compound (20.3 mg, 63 %). IHNMR (300 MHz, DMSO-d6) 5 0.98 (d, J = 6.62 Hz, 6H) 1.15 (t, J = 7.17 Hz, 3H) 1.45 (m, 2H) 1.56 (tn, 2H) 1.68 (m, 2H) 1.82 (m, 1H) 2.88 (m, 1H) 3.04 (m, 1H) 3.63 (m, 1H) 4.02 (m, 2H) 4.49 (m, 2H) 7.51 (dd, J = 9.01, 2.39 Hz, 2H) 7.57 (d, J = 2.21 Hz, 1H) 7.70 (d, J = 8.46 Hz, 1H) 8.56 (dd5 J = 8.09, 1.84 Hz, 1H) 8 · 88 ( d, J = 3.68 Hz? 1H) 10.52 (s31H) 14.13 (s, 1H). MS (ESI-) m / z 645 (MH) '.

Example 461A (2S) -1_ (Chlorophenyl V2-tetrahydroxide (: methyl hazelate) L-proline methyl hydrochloride (0.33 g, 0.002 mole) in toluene (5 Ml) 89166 -610- 200427678, a solution in dichloromethane (2 ml) and triethylamine (0.6 ml, 0.004 mole) was added dropwise to thionine chloride (0.32 ml, 0.0039) Mol) in a cold (-20 C) solution in toluene over a period of 3 minutes. The mixture was stirred for an additional 45 minutes at -20.0. The reaction was filtered and the solvent was removed under reduced pressure, and The title compound (0.40 g) was obtained. 1H NMR (300 MHz, CDC13) 5 2.13 (m5 2Η) 2.32 (m, 2Η) 3.58 (m, 1H) 3.75 (m, 1H) 3.79 (s, 3H) 4.40 (dd, J = 8.82, 4.04 Hz, 1H).

Example 461B (2S) -l-(("3- (4-Superyl-1_isoamyl_2-S isopropyl_1,2-difluorene" 1,81Hadian-3-yl oxide-4H -1,2,4-benzodiaphthrin-7-yl-1 amine} Sulfomethyl 2-tetrahydropyrrolecarboxylic acid methyl ester The product of Example 205 (0.030 g, 0.0703 mmol) was prepared in acetonitrile (2 Ml), treated with the product of Example 461A (0.018 g, 0.077 mmol) and triethylamine (0.011 ml, 0.077 mmol), stirred at 60 ° C for 20 hours, and cooled to about 25 ° C. The solvent was evaporated under reduced pressure, and the residue was purified on a Waters symmetrical C8 column (25 mm X 100 mm, 7 micron particle size) by reverse phase-prepared HPLC, using 10% of water A gradient solution of 100% acetonitrile / 10% ammonium acetate was used to obtain the title compound (7 mg, 16%) at a flow rate of 40 ml / min over 8 · min (10 min operation time). IHNMRGOOMHz, DMSO-d6) 5 0.99 (d? J = 6.25 Hz, 6H) 1.59 (m, 2H) 1.67 (m5 2H) 1.87 (m? 4H) 2.09 (d, J = 8.46 Hz, 1H) 3.60 (s, 3H) 4.26 (dd, J = 8.64, 3.86 Hz, 1H) 4.50 (m, 2H) 7.55 (m, 4H) 7.73 (d, J = 8.82 Hz, 1H) 8.57 (dd, J = 8.09, 1.84 Hz, 1H) 8.90 (dd, J = 4.78, 1.84 Hz, 1H) 10.53 (s, 1H) 14.07 (s, 1H) · MS (ESI-) m / z 617 (MH) '89166 -611-200427678 Example 462 1 ^ "3- (Erytyl-1-isopentyl-2-one-1,2-dihydro" 1,81 pyridinyl) -1, 1_Digas-4ff_1,2,4-Benzene plug two wells_7-based hydrazine · tetrahydropyrene acetonamine The product of Example 435B (0.029 g, 0.05 mmol) was acetonitrile (2 ml), treated with tetrahydropyrrole (0.0076 g, 0.009 ml, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80 ° C for 2 hours and cooled to about 25 ° C. The solvent was removed under a warm nitrogen stream, and the residue was purified on a waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size) by reverse phase-prepared HPLC using 10% to 100% of water A gradient solution of% acetonitrile / 10 ammonium acetate over 8 minutes (10 minutes operation time) at a flow rate of 40 ml / min to obtain the title compound (2.6 mg, 9%). iHNMRpOO MHz, DMSO-d6) 0.98 (d, J = 6.25Hz, 6H) 1.23 (S, 1H) 1.55 (S, 1H) 1.75 (m, 1H) 2.51 (m, 4H) 3.21 (t, J = 6.62 Hz, 4H) 4.48 (s, 2H) 7.60 (s, 6H) 8_53 (s, 1H) 8.87 (s, 1H) 10.35 (s, 1H) · MS (ESI-) m / z 559 (M_H) Example 463 Group_N_``3- (4-Cyclo-1-isopentyl 2-keto-1,2-difluorene [~ 1,8 &gt; r Emulsified 4HH4-Dongyuanyuan II-Well-7-yl-1-Hex's ratio of yodoamine to the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 ml), Treated with 3-hydroxyhexahydropyridine hydrochloride (0.0079 g, αmmol) and triethylamine (0.00796ml, 0.057mmol). The reaction mixture was heated in a microwave reactor at 80 ° C. 2 Hours, and cooled to about 25 ^. The solvent was removed under a stream of warm nitrogen, and the residue was placed on a Waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size) and prepared by reverse phase. Purified by HPLC using 10% to 100% acetonitrile / 10miy [ammonium acetate gradient solution in water, after 89166-612-200427678 8 minutes (10 minutes operation time) in 40 ml The title compound was obtained at a flow rate per minute (4.8 mg, 18%). 1H NMR (300 MHz, DMSO-d6) δ 0.99 (d, J = 6.62 Ηζ, 6Η) 1.18 (s, 1Η) L35 (s, 1Η) 1.59 (m, 2Η) 1.67 (d, J = 34 · 56 Ηζ, 2H) 2.71 (s, 4H) 3.51 (s, 4H) 4.50 (m, 2H) 7.51 (m , 2H) 7.58 (m, 1H) 7.72 (d, J = 8.82 Hz, 1H) 8.57 (dd, J = 8.09, 1.84 Hz, 1H) 8.90 (dd, J = 4.60, 1.65 Hz, 1H) 10.46 (s, 1H) 14.08 (s, 1H). MS (ESI ·) m / z 589 (MH) _ ·

Example 464A

Ml- (Cyclobutylamino V4-Hydroxy-2-keto-1,2-dihydrazino-3-fluorinyl 1-U-dioxide · 4H-1,2,4-benzopyrimidine- Tertiary-butyl 7-ylaminoformate The product of Example 432B (1.25 g, 3.74 mmol) and the product of Example 414A (1.06 g, 3.7 mmol) in anhydrous dioxolane (50 ml) The mixture was heated under reflux for 3 hours, cooled to 25 ° C, and concentrated under reduced pressure. The residue was triturated in hot 3: 1 hexane / ethyl acetate (30 ml), cooled, and filtered by filtration The solids were collected and dried to provide the title compound (1.5 g, 76% yield). Example 464B 1 (7-Amino-1,1-dioxo-4fluorene-1,2,4-benzopyrimidine Each of the VW's)-▲ 4-Light-based-2 (1Η)-^ 酉 酉 same as the slurry of the product of Example 464A (1.5 g, 2.85 mmol) in dichloromethane (10 ml), at 0 ° C, treated with 6 ml of trifluoroacetic acid dropwise, stirred at 25 ° C for 2 hours' and concentrated under reduced pressure. The residue was dissolved in ethyl acetate, and a 10% aqueous sodium hydrogen carbonate solution (3 X 50 Ml), washed with brine, dried over sodium sulfate, filtered, and under reduced pressure Reduced to provide the title compound (1.1 g, 91% yield). 89166 -613-200427678

Example 464C {3- "1- (Cyclobutylamino) -4_fluorenyl-2-one-1-1,2-bisfluoren-3-bendamyl-1-11-mono-oxidized-4Η · 1 A solution of the product of Example 464B (0.0425 g, 0.1 mmol) in pyridine (300 μl) , Dropwise treatment with ethanesulfonium chloride (0_26 mg, 0.2 mmol), remove at 25 C for 1 hour, and concentrate under reduced pressure. The residue was made in Wafers symmetry C8 On a column (25 mm X 100 mm, 7 micron particle size), purified by preparative HPLC using a gradient of 10% to 100% acetonitrile: 0.1% TFA in water for 8 minutes (10 Minute operating time), provided the title compound (0.020 g, 39% yield) at a flow rate of 40 ml / min. IHNMR (300 MHz, DMSO-d6) 5 1.23 (t, J = 7.17 Hz, 3H) 1.56 ( m, lH) 1.70 (m, lH) 2.05 (m, 4H) 3.19 (q5 J = 7.35 Hz, 2H) 3.77 (m, 1H) 6.56 (s, 1H) 7.44 (t, J = 7.54 Hz, 1H) 7.60 (dd, J = 8.82, 2.21 Hz, 1H) 7.67 (m, 2H) 7.89 (m, 1H) 8.06 (d5 J = 8.46 Hz? 1H) 8.17 (d5 J = 8.09 Hz? 1H) 10.33 (s? 1H) 14.16 (s? 1H) 15.03 (broad s ·, 1H) · MS (ESI ·) m / z 516 (MH)-· Example 465 Ethylamino-2-S-Iso-1- , 2_diazine-3-jun. Linji 1-1,1-dioxetine-4H_1,2,4- this is not the same as the two-spraying _7-based] ►Dilactulan hydrazone-1-complete acid word g. A solution of chlorosulfosulfanyl isocyanate (0.051 g, 0.36 mmol) in dichloromethane (2 ml) at 2,2-digas, at 0 ° C with benzyl alcohol (0.039 G, 0.36 mmol), dropwise treatment, stirring at 25 ° C for 30 minutes, and the product of Example 464B (0.127 g, 0.03 mmol) and triethylamine (0.12 g, 1.2 millimoles) in dichloromethane (4 ml). The reaction mixture was stirred at 25 ° C for 2 hours and between dichloromethane (10 ml) and 1 N aqueous hydrochloric acid (10 ml). As a liquid separation treatment 89166 -614- 200427678. The formed organic layer was separated, dehydrated and dried over sodium sulfate, filtered, and concentrated under reduced pressure. The residue was chromatographed on Shixi gel, and then dried in dichloromethane. 3% methanol was dissolved to provide the title compound (0.127 g, 66% yield). 1H NMR (300 MHz, DMSO-d6) 5 1.57 (m, 1Η) 1.70 (m, 1Η) 2.04 (m, 4Η) 3.78 (m, 1Η) 5.12 (s, 2H) 6.57 (s, 1H) 7.30 (m, 5H) 7.44 (t, J = 7.54 Hz, 1H) 7.50 (m, 1H) 7.66 (m, 2H) 7.89 (t, J = 7.91 Hz, 1H) 8.07 (d, J = 8.09 Hz, 1H) 8.17 (d, J = 8.46 Hz, 1H) 11.13 (s, 1H) 12.16 (s5 1H) 14.15 (s, 1H) 15.06 (s, 1H) · MS (ESI-) m / z 637 (MH) ' .

Example 466A Yitylamino group) -4-control group · 2-pyridyl-1,2-diaminoquinoline dioxide-4Η · 4,2 · 4-benzopyridine-7-yl M -Dimethylthiodiazepine-1-carboxylic acid ethyl ester 2,2-digas. The product of Example 465 (0.045 g, 0_07 mmol) was added at 1: 1 tetrahydrofuran / methanol (2 ml) In solution, at -10. 〇, treated with trimethylsilyldiazomethane (2.0M, 70 microliters in hexane, al4 millimoles) dropwise, stirred at 25 ° C for 16 hours, and concentrated under reduced pressure, Provided the title compound (0045 g '98% yield).

Example 466B Μ {3 "!-($ I-butylamino) -4-acryl-2-fluorenyl-1,2-diazine-3_p quinolyl ιαιΑΑ ^ Η_1,2,4-benzopyrene Geng-7-methylmethanamine A solution of the product of Example 466A (0.045 g, 0.069 mmol) in tetrahydrofuran (8 ml) and methanol (2 ml) was treated with 10% palladium / carbon (20 mg) And stirred at 25 ° C and hydrogen atmosphere for 24 hours. The solution formed was filtered through Celite® (diatomaceous earth) and the filtrate was concentrated under reduced pressure. The residue was symmetrical in Waters 89166 -615- 200427678 Column (25 Aimi X Lizhai Mi '7 micron particle size), purified by preparative HPLC, using a gradient of 10% to 100% acetonitrile: 0% TFA aqueous solution over 8 minutes (10 minutes operation Time) at a flow rate of 40 ml / min to provide the title compound (0.006 g, 17% yield). IHNMR OOO MHz, DMSO-d6) 5 1.55 (m, 1H) 1.69 (m, 1H) 2.03 (m, 4H ) 3.78 (m, 1H) 6.55 (s, 1H) 7.40 (d, J = 5.52 Hz, 1H) 7.45 (m, 1H) 7.52 (dd, J = 8.82, 2.57 Hz, 1H) 7.65 (m, 2H ) 7.88 (t? J = 7.91 Hz5 1H) 8.07 (d? J = 8.46 Hz5 1H) 8. 16 (d? J = 6.99 Hz, 1H) 10.24 (s, 1H) 14.11 (s, 1H) 15.11 (s, 1H) · MS (ESr) m / z517 (MH) · Example 467 N- {3- 「 H-Cyclobutylamine V4-Hydroxy_2-keto-1,2-dioxolinyl 1-U-dioxide-4Η · 1,2,4-benzobenzodiazepine-7_yl 丨 continued A solution of the product of Example 465 (0.790 g, 1.2 mmol) in tetrahydrofuran (80 ml) and methanol (20 ml), treated with 10% palladium / carbon (200 mg), and treated with hydrogen at 25 t and hydrogen atmosphere. Stir for 24 hours. Filter the reaction through Celite® (diatomaceous earth) and concentrate the filtrate under reduced pressure to provide the title compound (0.500 g, 83% yield). 1H NMR (300 MHz, DMSO-d6). 58 (m, 1H) 1.67 (m, 1H) 2.03 (m, 4H) 3.78 (m, 4H) 6.56 (s, 1H) 7.39 (s, 2H) 7.44 (t, J = 7.54 Hz, 1H) 7.52 (m, 1H) 7.64 (m, 2H) 7.89 (t, J = 7.91 Hz, 1H) 8.07 (d, J = 8.82 Hz, 1H) 8.17 (d, J = 8 · 46 Hz, 1H) 10.06 (s, 1H) 14.09 (s, 1H) 15.14 (s, 1H). MS (ESI ·) m / z 503 (MH) '

Example 468A 4- (fluorenylbutylmethyl V2gHV pyridone at 0 ° C, 4-benzyloxy-1H-pyridin-2-one (0.60 g, 2.98 mmol) was added to Ν, Ν -A solution in dimethylacetamide (10 ml), treated with sodium hydride (0.086 g, 3.58 89166 -616- 200427678 * mole) for 30 minutes, and then added bromomethylcyclobutane (0.40) Ml, 3.58 mmol), and the mixture was stirred at 25 ° C. for 48 hours. The solution was separated between a 10% aqueous ammonium chloride solution and methane gas, and the organic layer was separated and concentrated under reduced pressure. The residue was chromatographed on Shi Xijiao and dissolved in 1% methanol in dichloromethane to provide the title compound (0.426 g, 53%).

Example 468B Cyclobutylmethyl V4-fluorenyl-2OHV Visirion A solution of the product of Example 468A (0.426 g, 1.58 mmol) in tetrahydrofuran (20 ml) at 70 ° C with formic acid Treat ammonium (0.38 g, 6.03 mmol) with a catalytic amount of 20% hydroxide / carbon for 2 hours. The reaction mixture was cooled to about 25 ° C, filtered through celite, and the filtrate was concentrated under reduced pressure to provide the title compound (0.244 g, 86%).

Example 468C

Ml (methylthio) methylene 1-1- (cyclobutylmethyl V2, 1QH, 3HV pyridine di) was the same as the product of Example 468B (0.244 g, 1.36 mmol) and pyridine (0.88 ml '10.89 mmol) (Ear) solution in Erhuanglu (6¾ liters), with excess ginseng (methylthio) methyl sulfate (using 4,22-25, 1988; M Barbero, S. Cadamiux), I. Degani , By R. Fochi, A. Gatti, V. Regondi), at 90. Stir for 1.5 hours and cool to about 25 ° C. The reaction solution was decanted from the solid formed and the solvent was removed under a stream of warm nitrogen. The residue was dissolved in hexane and packed on 2 grams of Alltech Seppack and dissolved with hexane, followed by dichloromethane, and then 25% ethyl acetate in dichloromethane to provide the title compound (0.192 g, 50%). 89166 -617- 200427678

Example 468D N- {3-``1- (Cyclobutylmethyl) V4-hydroxy-2-keto-1,2-dihydro-3-pyridyl 1-U-digasification-4H-1.2,4 Pyridoxine-7-yl} methanesulfonamide The solution of the product of Example 468C (0.050 g, 0.176 mmol) in dioxolane (5 ml), and the product of Example 425D (0.030 g, 0.113 mmol) Mol), stirred at 110 ° C for 1 hour, and cooled to 25 ° C. The solid precipitate was collected by filtration and dried to provide the title compound (0.018 g, 35%). IHNMR (300 MHz, DMSO-d6 ) δ 1.88 (m? 6Η) 2.74 (dt? J = 15.17, 7.68 Hz, 1H) 3.08 (s5 3H) 4.03 (d, J = 7.35 Hz, 2H) 6.32 (d, J = 7.72 Hz, 1H) 7.56 ( dd, J = 8.82, 2.57 Hz, 1H) 7.62 (d, J = 2_21 Hz, 1H) 7.66 (m, 1H) 8.06 (d, J = 7.35 Hz, 1H) 10.24 (s, 1H) 13.83 (s, 1H) 14.28 (s, 1H). MS (ESI ·) m / z 451 (MH) 'Example 469 N- {3-``5-Bromo-M-cyclobutane methyl V4-hydroxy-2- Keto-1,2-dihydro-3-pyridyl 1-M-dioxide-4H-U, 4-benzopyridine-7-yl 丨 methanesulfonamide The product of Example 468D (0.030 g, 0.066 mmol) in tetrahydrofuran (2 ml) The solution was treated with 1,3-dibromo-5,5-dimethyl-hydantoin (0.015 g, 0.052 mmol) at 25 ° C for 18 hours. The reaction was concentrated under a warm nitrogen stream, The residue was purified on a Waters symmetrical C8 column (25 mm X 100 mm, 7 micron particle size) and purified by preparative HPLC using a gradient of 10% to 100% acetonitrile: 0.1% TFA aqueous solution over 8 minutes. (10 minute operation time), provided the title compound (0.008 g, 23%) at a flow rate of 40 ml / min. WNMR (300 MHz, DMSO-d6) 51 · 83 (η, 4H) 1.95 (m, 2H ) 2.75 (m5 1H) 3.08 (s, 3H) 4.03 (d, J = 6.99 Hz, 2H) 7.56 (dd, J = 9.01, 2.39 Hz, 1Η) 7.62 (d, J = 2 · 21 Hz, 1H) 7.67 (d, J = 8.82 Hz, 1H) 8.55 (s, 1H) 10.24 (s5 1H) 14.35 (s, 89166 -618- 200427678 1H). MS (ESI-) m / z 530 (MH ) '.

Conference Example 470A N- "3- (4- 蕤 -1-1 isoamyl-2.-1-U-dihydropyridyl) -1, l-digasification-4H-I · 2 · 4-benzene The solution of the product of Example 457C (0.195 g, 0.88 mol) in dioxolane (10 ml) and the product of Example 425D (0.17 g (0.64 mmol) at 115 ° C for 1 hour. After cooling to about 25 ° C, the solid precipitate was collected by filtration and dried to provide the title compound (0.258 g, 89%). IHNMR (300 MHz, DMSO -d6) 5 0.93 (d, J = 6.25 Hz, 6H) 1.58 (m, 3H) 3.08 (s, 3H) 3.99 (m, 2H) 6.33 (d5 J = 6.62 Hz, 1H ) 7.57 (m, 2H) 7.67 (d, J = 8.82 Hz, 1H) 8.07 (d, J = 6.6 2 Hz, 1H) 10.25 (s, 1H) 13.84 (s, 1H) 14.28 (s, 1H) MS (ESI-) m / z 453 (MH) \

Example 470B N- "3- (5-Bromo-4_hydroxy-1-isoamidine-2_2-keto-1,2-dihydro-3.pyridyl Vl, l-dihydro-4H-1, A solution of the product of Example 470A (0.258 g, 0.57 mmol) in tetrahydrofuran (10 ml) was added to 1,3-dibenzyl-7-yl-1 methanesulfonamide. Bromo-5,5-dimethylhydantoin (0.24 g, 0.84 mmol) was treated at 25 ° C for 18 hours. The solvent was removed under a warm nitrogen stream, and the residue was chromatographed on silica gel. , Dissolved in dichloromethane to provide the title compound (0.13 g, 43%). IHNMRpOOMH ^ DMSOO 6 0.94 (d, J = 6.25 Hz, 6H) 1.61 (m, 3H) 3.08 (s, 3H) 4.00 (m, 2H) 7.56 (dd, J = 8.82, 2.21 Hz, 1H) 7.63 (d, J = 2.21 Hz, 1H) 7.70 (m5 1H) 8.59 (s, 1H) 10.26 (s, 1H) 14.29 (s, 1H). MS (ESI-) m / z 532 (MH) '.

Example 470C N- [3- (4-Hydroxyisopentyl-2-one grave-5-vinyl-1.2-bisfluoren-3-pyridyl Vl, l- 89166 -619- 200427678 r-oxidation_4H- 1,2,4-Benzo-p-dioxine? 7-yl-l-methylpyridine_amine The product of Example 470B (0.027 g, 0.051 mmol) and tributyl (vinyl) tin (0.015 ml, 0.051 mmol) in tetrahydrofuran and a catalytic amount of dichlorobis (triphenylphosphine) palladium (II) at 75 ° C for 20 hours. The solution was cooled to about 25 ° C 'and concentrated. The residue was dried at Waters symmetrical C8 column (25 mm x 100 mm, 7 micron particle size) was purified by preparative HPLC using a gradient of 10% to 100% acetonitrile: 0.1% TFA aqueous solution over 8 minutes (10%). Minute operating time), at a flow rate of 40 ml / min, the title compound was provided (0.05 g, 21%). IHNMRpOOMHADMSO-dd ^ O ^^ Jd. SSHz / HOljl (m, 3H) 3.08 (s, 3H) 4.05 (m, 2H) 5.32 (d, J = 11.03 Hz, 1H) 5.87 (d, J = 18.02 Hz, 1H) 6_64 (m, 1H) 7.64 (m, 3H) 8.42 (s, 1H) 10.26 ( s, 1H) 14.42 (s, 1H) 14.67 (s5 1H). (ESI-) m / z 479 (MH) '. Example 471 N- (2-bit Methyl) -3- "3- (4-Rotyl-1_isoamyl-2-fluorenyl-1,2-diazepine_3-yl> 1,1_dioxide-4H -1,2,4-benzopyridine_7_yl1diazepine melamine_amine 2,2-dioxide Chlorosulfoisocyanate (4.9 μl, 0.0562 mmol) ) The solution in dichloromethane (2 ml) was treated dropwise with furanmethylamine (5 μl, 0.0562 mmol) at 25 ° C, and stirred at 25 ° C for 30 minutes. Example 205 The product (20 mg, 0.0468 mmol) was treated with a solution of triethylamine (26 µl, 0.187 mmol) in dichloromethane (2 ml) and stirred at 25 ° C for 24 hours. The reaction was allowed to proceed The mixture was separated between dichloromethane (10 ml) and 1 N aqueous hydrochloric acid solution (10 ml). The organic layer formed was separated, dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title. Compound (15%). MSm / z630 89166 -620- (Μ + Η) +. The following other compounds of the present invention, soil 々 W πη 丄, and those who use known synthetic methods, or use those contained herein Schema and ·, 、, nr 艿 丨 主 π ', only examples The synthetic methods as. The other compounds covered by the following table are not good. One R1 substituent is used from Table 2 (the complex h heart "τ and 1 represents the core ring structure), one or two Υ3 substituents are used from 4, and two western soil tables are prepared. Where necessary, descriptions are made using \ and or γ2 substituents from Table 3. Table 1: Examples of core ring structures

621-89166 200427678 9 10 11 12 \ PX Y3 ΤχΧΎ ^ Λν 人 〇Η R1 OH N ^ SY ^ V &quot; Y3 Yi ^ yV ^ n &quot; ^: nV〇H R1 yi oh Ν ^ γΝγγ3 R1 〇 ,, 々〇: Y1 OH Y ^ cX ^ R1 13 14 15 16 \ Pf Υ3 Υ1 OH N ^ Y ^ VY Y &quot; 6cX ^ Y1 OH Ν ^ Υ ^ Υ, Υ3 Υ &quot; άχ ^ 0, R1 OH Ν ^ γ ^ γ ^ γ3 〇 H / 丫 ^ 丫 3 ^ 入 ... 人 〇6, r1 17 18 19 20 a / i! &Amp; Y3 \ Pf Y3 〇HN 』Ah ^ h3c ^ A ㈡ 〇H3C Γ〇Η V OH VSV_v3 σχ« R1 21 22 23 24 〇vP V R1 wy3 Y1 OH NV \ R1 ο. Τ V VY R1 \ ρτγ3 y1 〇HNV \ Y &quot; 0cX ^ R1 25 26 27 28 v y1 OH N ^ VS \ _n / 3 R1 〇. / VC *: ^ R1 WY3 〇HN, ccX ^ R1 〇V〇X Y3 OH W, R1 29 30 31 32 owo n / OH N: SVV〇ccX ^ R1 \ pH〇 1 1 OH N Υ ^ άχ ^ R1 y 3 OH ^ SiW R1 3 3 OH ^ aY ^ S into N々〇R1 33 34 35 36 89166 -622- 200427678

89166 -623-200427678

89166 -624- 200427678 Heart palpitations jci at sa &gt; NH ^ 〇 \ PTNH t.彳 ΝΗγ〇0dH 丫 1 person N々〇OH X-,-wxj Ά〇85 86 87 88 0, / eight Y3 R, _NixiN) a "λ H R1 ohXv3 y Y1 person N person 0 OH ^ yVX ^ h 0- s9N-yv3 n °: s ^ NH &quot; Vnhr ^ Read P 〇89 90 91 92 We ιχΐχγ R1 IX HY OH Ν ^ Υ ^ Υ &quot; Υ3 \ X〇H We ^ Α) Η ν3 0... γsecret \ 93 94 95 96 \ 97 98 99 100 Table 2: Examples of R1 substituents X-CH XrCH3 tt / 1 2 3 4 tA fi k / S \ 5 6 7 8 Yi Xi / \ 9 10 11 12 V xa. V xCk 13 14 15 16 89166 -625-200427678, Ί i: Sr 17 18 19 20 ί: VV XCA 21 22 23 24 25 26 27 28 υ XCA U 29 30 31 32 1; 6 ό 33 34 35 36% 37 38 39 40 6 ό 41 42 43 44 b 45 46 47 48 X1O0 XlxO ^ Y2 Χ1γΛ U, yah 9 X1T &gt; 49 50 51 52 Y. fi 72 53 54 55 56 V Vl fi ▽ xir ^ ^ n'y2

89166 -626- 200427678 89166 57 59 60 χΌ〇 _58 ^ Χι ο

Ν 一 丫 2

Ν- 丫 2 G_

N Yaya 2 Μ 61 62 63 64

Ah 1 rN, Υι 65 66 67

Υι

69ι 69 70 71 72

Ν 73

77

Ν 81

85ι 85

S 89

Υι

74 75 76

Ν Yj

Υι Ν 78 79

Ν 82% Υι

Υι 3 627- 83 84

Yi. 87

91% Υι

92 200427678

89166 -628-200427678

89166 -629- 200427678 161 162 163 164 y / λ1τ \ X1T &gt; Υι ΧΐγΝ Τ Ν γ / 2 y1 165 166 167 168 Table 3: Substituents for y1 and Y2Η ch3 -ch2ch3 -ch (ch3) 2- F -Cl -Br No〇2 -CN -〇ch3 -NHCH3 -N (CH3) 2 -νη2 -〇Η -C (0) NH2 -NC (0) NH2 Υ2 H ch3 -ch2ch3 -ch (ch3) 2- COCH3 -C02CH3 C02CH3 -nc (〇) nh2 -nh2 OH -c (〇) nh2

Table 4: Examples of Υ3 X1-H X1-CH3 Xr〇H X1-NH2 1 2 3 4 XfNH Xf9 XfNH Xi ~ 〇V y VV nh2 nh2 ^ NH ^ NH 5 6 7 8 XfNH XN Xf〇k CN XfNH V X1 -〇V OH OH 9 10 11 12 XrCI XrF XrNHCH3 Xr〇CH3 13 14 15 16 X1 nh2 A not 1 I ην ^ Λ. 17 18 19 20 X1 nh2 6? H not 1 not 1 I 21 22 23 24 X ^ NH V '' X ^ NH ^ SrN ^ XfNH Guang NH SrN—JX ~ NH ^ γΝΗ2 〇Ϊ I 89166 -630- 200427678 25 26 27 28 nh2 X ^ NH fA VN '' o nh2 X ^ NH f- &lt; V '' 〇OH X ^ NH V '' 〇OH X ^ NH ρ-Λ V '' o 29 30 31 32 NH2 ^ h2 Γ OH Xi-NH Xi-NH Xi ~ NH fS X ^ NH ^ 0 o 0 o 33 34 35 36 x 「V 〇〇x 「v〇o Xr〇 广 NH V」 o xi \ aNH2 〇37 38 39 40 nh2 Xi ~? R \ V '' O NH2 X1 \ 0 O OH χι-? R \ \ hJ O OH O 41 42 43 44 XfNH f VH 〇x-nh ^ VH o X! -NH VH 〇Xi-NH 'VH 〇45 46 47 48 Xi_? VNH 〇VH o VNH 〇n P VH 〇49 ^ 50 51 52 Xi ~ NH ^ VNH _Q_ Xi &lt; VH OX ^ NH HH VH o Xf〇HN7 VH 〇53 54 55 56 XfNH 〇 person nh2 I o ^ nh2 X factory NH NH2 VH o Xf〇nh2 VH o 57 58 59 60

89166 -631-200427678

89166 -632- 200427678

Shu-¾ ~ —-—— It = Jing This artist will understand that the present invention is not limited to the aforementioned illustrative examples, and

/. It can be embodied in other specific forms without departing from its basic characteristics. Therefore, each &gt; y should only be considered as illustrative and not restrictive in all respects. Reference is made to the scope of the patent application attached to the + instead of the previous example, and therefore, the equivalent meaning of the scope of patent application and All changes coming from the scope are intended to be included. 89166 -633-

Claims (1)

200427678 Patent and application patent garden: 1. A compound of formula (I) Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein Iα is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and Heterocyclic ring; R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonyl, ethylthio, alkylthio, alkylsulfenyl, alkylsulfonyl Fluorenylalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloolefin Alkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, methylamino, iS alkoxyalkyl, iS alkyl, heteroaryl, heteroarylfluorenyl , Heteroaryl, Heteroaryl, Alkyl, Heterocycle, Heterocyclyl, Heterocycloalkyl, Hydroxyalkyl, Nitroalkyl, RaRbN-, RaRbN Alkyl-, I ^ RbNCCO) alkane -, RaRbNC (0) 0 alkyl-, RaRbNC (0) NRc alkyl ·, RfRgC = N- and RkO-, where R1 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected Including alkyl, fluorenyl, alkynyl, keto, dentate, cyano , Nitro, li alkyl, alkoxy, aryl, 89166 200427678 heteroaryl, heterocyclic, aryl, heteroaryl, oxyalkyl,-(alkyl) (ORc) ,-(AlkylXNH), -SRe, -S (0) Re, -S (0) 2Re, -ORe, -NdXRe), -CCO)! ^,-(:( 0) 01 ^ &amp; -C (0) NRe Re; R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, aralkyl, heteroaryl, heterocyclic, heteroaryl Alkyl, chloro, halo, _N (Ra) (Rb), RaRbNC (0)-, -SRa, name (0) 1 ^, -3 (0) 21 ^, and 1 ^ (:( 0)-; Wherein R2 and R3 are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from Ra, alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, and alkane Group,-(alkyl) (0Rk),-(alkyl XNR ^ b), -SRa, -S (0) Ra, -S (0) 2Ra, -0Rk, -N (Ra) (Rb),- C (0) Ra, -C (0) ORa and -C (0) NRaRb; or, R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, ring Alkyl, heteroaryl and heterocyclic ring, wherein the aryl, cycloalkyl, heteroaryl and heterocyclic ring are optionally substituted with (R6) m; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, i-group, hydroxy, N3-, ReS-, where R4 is independently substituted with 0, 1 or 2 substituents, and the substituents are independently selected From S, nitro, cyano, -OH, -NH2 and -C00H; R5 is independently selected at each occurrence from the group including alkenyl, alkoxy, alkyl, alkynyl, aryl, aralkyl , Arylcarbonyl, aryloxy, azidoalkyl, formamyl, halo, haloalkyl, iS-carbon, heteroaryl, heteroaralkyl, heterocycle, heterocycloalkyl, hydroxyalkyl , Cycloalkyl, cyano, cyanoalkyl, nitro, RaC (0)-, RaS_, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, Ra (〇) SN ( Rf)-, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl-, 89166-2-200427678 Heart 802 wind 11 £) alkyl-, 1 ^ 1 ^? 021 ^^)-, 1 ^ 111 ^ 802: ^ (Heart) alkyl-, RaRbNC (0)-, Rk0C (0)-, Rk0C (0) alkyl-, RkO alkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra ) P (0) 0- and _ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, li, Cyano, nitro, _alkyl, Alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkoxy XNRcRd), -SRe , 4 (0) heart, -S (0) 2 Re, -ORe, -NdXRd), -0 (0) 1, &lt; (0) 0 ~ and -C (0) NReRd; R6 in every existence Is independently selected from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl , Heterocycloalkyl,-(alkyl) (0Rk), (alkyl) (NRaRb), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb ), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; wherein each R6 is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group including alkyl, Alkenyl, alkynyl, keto, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SC ^ Ra, -C (0) 0Ra, -C (0 ) NRaRb and -NC (0) Ra; 1 ^ and Xin are independently selected at each place where they are selected from the group consisting of hydrogen, alkenyl, alkyl, alkylthioalkyl, aryl, arylalkyl, arylalkyl, Cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl , Methylamino, alkyl, heteroaryl, heteroaryl allyl, heteroaralkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, \ RdN -, Rk0-, Rk0 alkyl-, ReRdN alkyl-, ReRdNQO) alkyl-, ROS02-, ReS02 alkyl-, RcC (0) _, ReC (O) alkyl-, R ^ OCCO)- ReOC (0) alkyl-, ReRdN alkylC (O)-, R ^ RdNCCO)-, I ^ RdNCCOp 89166 -3- 200427678 alkyl-, ReRdNC (0) N (Re) alkyl, where And Rb are substituted with 0, 1 or 2 substituents, and the substituents are selected from the group consisting of alkyl, alkenyl, block, keto, phenyl, aryl, nitro, alkynyl, haloyloxy, Aryl, heteroaryl, heterocyclic, aryl, aryl, aryl, aryl, alkynyl,-(fluorenyl XORJ,-(alkyl) (NRcRd), -SK, -S (0) Re, -S (0) 2Rc, -01, -N ^ XRd), -C⑼; or Ra forms a three- to six-membered ring together with Rb and the nitrogen atom to which they are attached, selected from the group consisting of heteroaromatics And heterocycles, where heteroaryl and heterocyclic systems are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, keto, cyano Base, nitro (¾ alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,-(alkylXNI ^ Rd ), -Alkyl SC ^ NI ^ Rd, alkyl CCC ^ NReRd, -S &amp;, -8 (0) 1, -S (0) 2Re, -01, -N ^ XRd), -C (0) Re,-(3 (0) 01 ^ and xinkeke ~ xin; R0 and Rd are independently selected at each place where they are selected from the group consisting of hydrogen, -NRfRh, -0Rf, -CO (Rf), -SRf, -SORf , -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) 0Rf, fluorenyl, alkyl, bulk, cycloalkyl, cycloalkyl, alkyl, alkyl, alkyl Aryl, aryl, alkynyl, heteroaryl, heteroaralkyl, heterocyclic, and heterocycloalkyl; each of them is related to each other! ^ Is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, decyl, keto, alkynyl, cyano, nitro, alkynyl, and halogenated oxygen. Aryl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl, _ (alkyl) (〇Rf),-(alkyl) (NRfRh), -SRf , -S (0) Rf, -S (0) 2Rf, -0Rf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh 89166 -4 -200427678, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N (Re) S02NRfRh, _N (Re) C (0) NRfRh, -alkylN (Re) C (0) 0Rf, -alkylN (Re) S02NRfRh, and -alkylN (Re) C (0) NRfRh; or, together with the heart and the nitrogen atom to which they are attached, form a three- to six-membered ring Is selected from the group consisting of heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, and the substituent is independently selected from the group consisting of alkyl, alkenyl, block, and different Radical, radical, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-( (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf,- ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and -C (0) NRf ^^ Re are selected from the group consisting of hydrogen, fluorenyl, alkyl, and cycloalkyl; Rf, Rg and Rh are each independently selected from the group consisting of hydrogen, alkyl, fluorenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cyclofluorenylalkyl, Heterocycle, heterocycloalkyl, heteroaryl and heteroaralkyl; wherein each of Rf, Rg and 1 ^ is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorene Aryl, alkynyl, cyano, ||, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -0 (Alkyl), _NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), _S (0) (alkyl), -S02 alkyl, -alkyl- OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl), -alkyl S (0) (alkyl), -alkylSO2alkyl, -N (H) C (0) NH2, -c (o) oh, -c (o) o (alkyl), _c (o) alkane Group, -c (o) nh2, -c (o) nh2, -C (0) N (H) (alkyl) and -C (0) N (alkyl) 2; or, Rf and Rg and their Connected carbon atom one Form a three- to seven-89166 200427678-membered ring selected from cycloalkyl, cycloalkenyl, and heterocyclic rings; or, Rf, together with Rh and the nitrogen atom to which they are attached, form a three- to seven-membered ring, selected from Including heterocycles and heteroaryl groups; wherein each heterocycle and heteroaryl system is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, and halogen Keto, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), · N (alkyl) 2, -S (alkyl), -S (alkyl), -S (0) (alkyl), -alkyl-ΟΗ, -alkyl- 0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS (alkyl), -alkylS (0) (alkyl), -alkylS02 alkyl, -AlkylN (alkyl) 2, -N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -C (O) alkyl, _C (0 ) NH2, -C (0) NH2, -C (0) N (H) (alkyl) and -C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aromatic Alkyl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methyl Alkyl, iS alkyl, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) Alkyl, RaS-, RaS (0)-, RaS02-, RaS alkyl ·, Ra (0) S alkyl-, RaS02 alkyl-, Ra0C (0) _, Ra0C (0) alkyl-, RaC ( 0)-, RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from alkyl, alkenyl, alkynyl, keto, halo, Cyano, nitro, haloyl, halooxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇R 〇),-(alkyl) (NRcRd), -SRC, 4 (0) 1 ^, -S (0) 2Rc, -ORe, -N (Re) (Rd), -C (0) Rc, -C (0) 0Re and -C (0) NReRd; 89166-6-200427678 m is 0, 1, 2, 3, or 4; and η is 0, 1, 2, 3, or 4; with the condition that when A is Monocyclic ring other than the following And R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, radical, heteroaryl, heterocycloalkyl, cycloalkane Base, cyano, nitrate *, RaRbN-, RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaS02N (Rf)-, RaRbNC (0)-, Rk0C (0) -, RaRbNS02- or -ORk, and R6 is hydrogen, fluorenyl, fluorenyl, block, halo, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa, 4 (0) 1 ^, -S (0) 2Ra, -ORk, -N (Ra) (Rb), &lt; (0 team, -C (0) 0Ra, in time, then R1 is not hydrogen, alkenyl, alkyl, alkynyl , Aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, heteroaryl, heteroarylfluorenyl, heteroarylalkyl, heterocyclic Alkenyl or heterocycloalkyl; and with the additional condition that when A is And R4 is hydroxyl or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -0Rk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aromatic Group, heteroaryl, heterocycloalkyl, -SRa, 4 (0) \, -S (0) 2Ra, -0Rk, -N (Ra) (Rb), -C (0) Ra, -C (0 ) 0Ra and -C (0) NRaRb, then R1 is not hydrogen, dilute, alkyl, alkyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, (Cycloalkyl) alkyl, heteroaryl, hetero89166 ZU0427678 million fluorenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl. • The compound according to item 1 of the scope of patent application, wherein A is a monocyclic ring, and includes a square group and a heteroaryl group. 3. The compound according to item 2 of the scope of the patent application, wherein A is a square group; and R2 forms a five- or six-membered ring together with R3 and the carbon atom to which they are connected. _Yodo, tower P, yl, thylenyl, cromanyl, pyrazolyl, oxazolyl, pyrazolyl, imidazolyl, isoxazolyl, isopyrazolyl, triazolyl, oxadiazolyl , Tetrazolyl, cyclopentyl and cyclohexyl. 4. The compound according to item 3 of the scope of patent application, wherein a is phenyl. 5. The compound according to item 4 of the scope of the patent application, wherein R is formed with pyridine and the carbon atom to which they are attached to form a pyridyl ring. 6. Compounds of formula (π) according to item 1 of the scope of patent application Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and carbonyl Thiosulfanyl, sulfinylsulfanyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, aralkyl, aryl 89166 200427678 sulfanylthio, aryl Continued on alkyl, alkyl, cyano, cycloalkenyl, cycloalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, methylamino Alkyl, haloalkoxyalkyl, _alkyl, heteroaryl, heteroarylfluorenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, Hydroxyalkyl, nitroalkyl, RaRbN alkyl, RaRbNC (O) alkyl-, RaRbNC (0) 0 alkyl, RaRbNC (0) NRc alkyl, RfRgC = N- and RkO- R1 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, block, keto, i-based, cyano, nitro, _alkyl, _alkoxy Aryl, aryl, heteroaryl, heterocyclic, aryl, aryl , Alkoxy group, _ (alkyl) (ORc),-(alkyl XNReRe), -SK, ^ (0) 1 ^, ^ (0) 21, _〇Rc ... N ^ XRe), _C (0) Re ,; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, radical, hydroxyl, RaRfcN-, N3-, and ReS_, where R4 is independently 0, 1 or 2 Substituents are substituted, and the substituents are independently selected from the group consisting of alkynyl, nitro, cyano, _OH, -NH2 &amp;-COOH; R5 is independently selected from the group consisting of alkenyl, alkoxy, alkyl, Alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidealkyl, methylamino, liyl, haloalkyl, carbonized, heteroaryl, heteroaryl, heterocyclic , Heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC (O)-, RaS-, Ra (0) S-, Ra (〇) 2S- , RaRbN alkyl-, R ^ COSNCRf)-, RaS02N (Rf) _, Ra (〇) SN (Rf) alkyl-, RaS02N (Rf) alkyl-, RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl -, RaRbNC (0) _, Rk0C (0)-, Rk0C (0) alkyl-, RkO alkyl, RaRbNS02- 89166 -9- 200427678, RaRbNS02 alkyl-, (P ^ 0) (ΐς) P (0 ) 0- and -〇Rk, where each R5 is independent 0, 1, 2 or 3 substituents. The substituents are independently selected from the group consisting of alkyl, fluorenyl, block, keto, phenyl, cyano, nitro, fluorenyl, haloalkoxy, and aryl , Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkyl) (NRcRd), Mingxin, -S ( 0) Rc, -S (0) 2Rc, -ORe, -N ^ XRd), -C (0) Re, -C (0) 0Re, and -C (0) NReRd; R6 is independently selected for each existence Including alkyl, fluorenyl, alkynyl, halo, cyano, nitro, iSalkenyl, iisaloxy, aryl, heteroaryl, heterocyclic, arylalkenyl, heteroaryl, heterocyclic Etyl,-(fe-based) (0¾),-(alkyl) (NRaRb), -SRa, -S (0) Ra, _S (0) 2Ra, -〇Rk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra &amp; -C (0) NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group including alkyl, fluorenyl , Decyl, keto, halo, halo, cyano, nitro, -〇Ra, -NRa Rb, -SRa, -SORa, -S02Ra, _C (0) 0Ra, -C (0) NRaRb &amp; -NC (0) Ra; D and ^ are independently selected from each occurrence including hydrogen, alkenyl, alkyl, Alkylthioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methyl Fluorenylalkyl, haloalkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heterocycle, heterocyclicfluorenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, ReRdN-, RkO-, RkO alkyl-, RcRdN alkyl-, ReRdNC (0) alkyl-, ROS02-, RcS02 alkyl-, RcC (0)-, RoC (0) alkyl-, Re〇C (0)-, ReOC (0) alkyl-, RcRdN alkyl C (O)-, RcRdNC (0: h, R ^ RdNCCOp alkyl-, I ^ RdNCXCONd) alkyl-, where \ and Rb are Substituted by 0, 1 or 2 substituents, the substituents are selected from the group consisting of alkyl, fluorenyl, alkynyl, ketone 89166 -10- 200427678, halo, cyano, nitro, alkynyl, alkoxy , Aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,-(alkylXNR ^ Rd), -SK, -S (0 ) Re, -S (0) 2Rc, -ORc, -N ^ XRd), &lt; (0) 1 ^, &lt; (0) 0 heart and &lt; (0 speak ~ heart; or, heart and ^ and other Wait for the connected nitrogen atoms to form a three- to six-membered ring. Including heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, and dentate , Cyano, nitro, alkynyl, halo, aryl, heteroaryl, heterocyclic, aryl, heteroaryl, alkoxyalkoxyalkyl,-(alkyl) (ORe) ,-(Alkyl XNT ^ Rd), -alkyl SC ^ NI ^ Rd, -alkyl CCCONReRd, -SRe, -SCO)! ^, -S (0) 2Re, -0 heart, -N ^ XRd), -C (0) Re, -C (0) 0Re and -C (0) NReRd; Rc and Rd are independently selected at each place where they are selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO (Rf), -SRf , -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) 0Rf, fluorenyl, alkyl, alkyne: yl, cycloalkyl, cycloalkyl, cycloalkyl, alkyl Pit group, aryl group, aryl group, self-burning group, heteroaryl group, heteroaralkyl group, heterocyclic ring and heterocyclic alkyl group; each of which is independently substituted with 0, 1, 2 or 3 substituents Substitution, the substituent is independently selected from the group consisting of alkyl, fluorenyl, block, keto, halo, cyano, nitro, alkyl, halooxy, aryl, heteroaryl, heterocyclic, aralkyl Zafang Group, alkoxyalkoxyalkyl,-(alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, _ORf, _N (Rf ) (Rh), _C (0) Rf, _C (0) 0Rf, _C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf ^ -N (Re) S02NRfRh &gt;-N (Re) C (0) NRfRh, -alkylN (Re) C (0) 0ff, -alkylN (Re) S02NRfRh &amp; 89166 -11-200427678-alkylN (Re) C ( 0) NRfRh; or, together with ^ and the nitrogen atom to which they are attached, form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently separated by 0, 1 , 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, alkynyl, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl Group, heterocycle, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and -C (0) NRfRh; Re is selected from the group consisting of hydrogen, alkenyl, Alkyl and cycloalkyl; Rf, Rg &amp; Rh are each independently selected from the group consisting of hydrogen, alkyl, fluorenyl, aryl, aralkyl, and cycloalkane , Cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and 1 ^ is independently 0, 1, 2 Or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, cyano, li, keto, nitro, aryl, aryl, cycloalkyl, cycloalkyl, hetero Ring, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -Sj [alkyl],- S (0) (alkyl), _S02 alkyl, alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkane) Group) 2, -alkylS (alkyl), -alkylS (0) (alkyl), -alkylS02alkyl, -N (H) C (0) NH2, -c (o) oh, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -c (o) nh2, -C (0) N (H) (alkyl), and -C ( 0) N (alkyl) 2; or, Rf, together with Rg and the carbon atom to which they are attached, form a three- to seven-membered ring selected from cycloalkyl, cycloalkenyl, and heterocyclic rings; or, Rf and Rh and the nitrogen atom to which they are attached together form a three- to seven-89166-12-200427678-membered ring selected from heterocyclic and heteroaryl groups; Each heterocyclic ring and heteroaryl system is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, block, loose, 1¾, aryl, nitro, Aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroarylalkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl), -S (0) (alkyl), -fe-OH, -fe-O-0, and -fluorenyl NH2, -alkyl N (H) (alkyl), -alkyl S (alkyl), -alkyl S (0) (alkyl), -alkyl S02 alkyl, -alkyl N (alkyl) 2, -N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -C (O) alkyl, -C (0) NH2, -C (0 ) NH2, _C (0) N (H) (fluorenyl) and -C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aralkyl, cyano Alkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methylalkynyl, iSalkyl, heteroaryl, heteroaryl, heterocycle, heterocycloalkyl, Nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS-, RaS (0)-, RaS02-, RaS alkyl-, Ra (0) S Alkyl-, RaS0 2 alkyl-, Ra0C (0)-, Ra0C (0) alkyl-, RaC (0)-, RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, The substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, 1S, cyano, nitro, haloalkyl, IS alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, Heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkyl) (NRcRd), -SRe, -S (0) Rc, -S (0) 2Re,- ORe, -N (Rc) (Rd), -C (0) Re, -C (0) 0Rc, and -C (0) NRcRd; m is 0, 1, 2, 3, or 4; and n is 0, 1 , 2, 3, or 4; 89166 -13- 200427678 with the condition that 'when R4 is alkoxy, aryloxy, protecting group, or &amp; S-, and R5 is hydrogen, alkenyl, alkoxy, alkyl , Alkynyl, aryl, halo, heteroaryl, heterocycloalkyl, cycloalkyl, cyano, nitro, RaRbN-, Raq〇) _, RaS-, RaCCOS-, Ra (〇) 2S-, I ^ SC ^ NCRf)-, RaRbNC (0) ... Rk〇C (0)-, RaRbNS02_ or -0Rk, and r6 is hydrogen, alkyl, alkenyl, alkynyl, i-based, cyano, nitro, aromatic , Heteroaryl, heterocycloalkyl, _SRa, -S (0) Ra, -SCOhh, -ORK, -N (Ra) (Rb), _C (0) Ra _c (〇) 〇Ra and -CCCONRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, (Cycloalkyl) Alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocyclic amidyl or heterocycloalkyl. 7. The compound according to item 6 of the application, wherein R4 is a hydroxyl group. 8. The compound according to item 7 of the scope of patent application, wherein R1 is selected from the group consisting of hydrogen, fluorenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, aralkyl, and alkyl. Alkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, methylamino, haloalkyl? Heteroarylalkenyl, heteroaralkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, ΐ ^ N_, RaRbNalkyl_, RaRbNC (0) alkyl-, Rf Rg C = N -And Rk 0 * ». 9. The compound according to item 5 of the scope of patent application, or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, which is selected from the group consisting of: 1-0 (1-cyclohexene small group) (Ethyl) each (1,1_dioxide_4H-1,2,4-benzothiadi_-3-yl) -4_per group-1,8-philosophate-2 (1H) -same ; [3- (1,1 --- emulsification · 4Η-1,2,4-Donaldomers' p-well-3-yl) -4 · meridyl-2-pyridyl-1,8_ 89166- 14- 200427678 pyridin-1 (2H) -yl] ethyl acetate; (3 · anilinopropyl) each (1,1_dioxide-4H-1,2,4-benzopyridine-3 -Yl) -4-hydroxy-1,8-piperidine-2 (1H) -one; 3- [3 · (1,1-dioxide-4H-1,2,4-benzo fare ) -4- # presents the same term as the 2nd group — 1,8-pyridin-1 (2H) -yl] propanal; 1- [3- (dimethylamino) propyl] -3- (l, l-dioxide_4H-1,2,4-benzopyridine), 4 • boryl_1,8_peak lake_2 (1H) -one; 1- {3-[[2- (Dimethylamino) ethyl] (methyl) amino] propyl group 3, μ dioxide_ 4 Η-1, 2, 4, 4-benzyl di-well · 3_ group) _ 4_ peptyl-ΐ , 8-peak lake · 2 (ιη) · ketone; Η2-aminoethyl) -3- (1,1-dioxide-4Η-1,2,4-benzene Pyridoxine-3-yl) glaucyl-1,8π-Nayodo-2 (1Η) -one; 1- [3_ (diethylamino) propyl] _3_ (1,1_dioxide-4Η_1,2 , 4-Benzopyrene-based groups: HHt group], 8 · pyridine-2 (m) -one; fluorenyloxy) each (1,1-dioxide-4H_1,2,4-benzo, Ceediyl) -4_isopropyl_ 1,8-haridine-2 (1H) -one; fluorenyloxy) -3- (1,1-dioxide_4H-1,2,4-benzo Pyridoxine_3-yl) Bicyl_1,8-xylazine-2 (1H) -one; 3- (1,1_Dioxide-4H-1,2,4-benzopyridine (All groups) glacial hydroxy-1-isobutoxy_1,8_pyridin-2 (1H) -one; μmyl · 4-chloro-3- (1,1-dioxide-4H-1, 2,4-benzopyridine-3-ylfluorene; · Konaido-2 (1 fluorene) -one; 1 butyl-4-chloroyl-3- (1,1- monoxide-4 fluorene-1 , 2,4-Benzo [pi] -dipent-3-yl) -1,8_ Konato-2 (1Η) -one; 4-amino + butyl each (1,1-dioxide · 4Η_ΐ52,4 -Benzopyridine), 4,8_ 89166 • 15- 200427678 pyridin-2 (1H) -one; 1-butyl-3- (l, l-dioxide-4H-1,2,4- Benzopyridine groups: HK methylamino group) _ 1,8-pyridine-2 (1 mes_one; 1-butyl-4- (dimethylamino group) each (1,1-dioxide- 4H-1, 2,4-benzopyrimidinyl groups) -1,8-peak lake-2 (1H) _fluorene; butyl-3- (1,1_monooxide-4H-1,2,4-benzo p-sedioxy-3-yl) -4-gallyl-1,8-piperidine-2 (1H) -one; 4-azido-1-butyl each (1,1-dioxide-4H-1 , 2,4-benzopyrimidin-3-yl) -1,8-pyridine 4 (1H) -one; 1-butyl-3- (l, l-mono-oxide-4H-1,2 , 4-Benzopyridin-3-yl) -4-[(2-chiethyl) amino] -1,8-pyridine · 2 (1Η) -one; Ν- [3- (4 -Hydroxy-1-isopentyl_2 · keto_1,2-dihydro-1,8 · pyridin-3-yl) -1,1, dioxide-4Η · 1,2,4-benzo Pyrimidine_7_yl] -N- (2 · phenylethyl) sulfonamide; 3 · [3 · (4_hydroxy_1-isopentyl-2-one-1,2-dihydro [1,8] Pyridin-3-yl H, U dioxide -4H-1,2,4_fungo π plug di-p-well-7-yl] diazepine hydrazone-1-metanoic acid vinegar 2 , 2 «« Dioxide; Ν- [3- (4-hydroxy-1-isopentyl_2_one-l-1,2-dihydro [1,8] pyridin-3-yl H, U di Oxidized _4Η_1,2,4 · benzopyridine_7_yl] continylamine; 3- [3- (4-hydroxy_1_isopentyl-2-keto_1,2_dihydro [ 1,8] pyridin-3-yl) -1,1_dioxide-4fluorene-1,2,4-benzothiadinyl-7-yl] small propyldiazepine Lupin-1-carboxylic acid narrow ester 2,2-dioxide; Ν_ [3- (4-hydroxy-1-isopentyl_2_one-1,2-dihydro [1,8] pyridine -3-ylpyrene, 1 · dioxo-4Η-1,2,4-benzot? Azephine-7-yl] -n-propylpyramine; 3- [3- (4-fatyl "1-Isopentyl_2-S isopropyl-1,2_diazine [1,8] peak lake-3-yl) -1,1-di 89166 -16- 200427678 Oxidation-4H-1,2, 4-benzobenzodiahide-7-yl] diazepine methyl 2,2-oxide, 3- [3- (4-lightyl_1_isopentyl-2- Keto · 1,2-dihydro [l, 8] p-naphthalene-3_yl) -1,1_dioxide-4H-1,2,4-poroxino-p-dihex-7-yl] a Azathiouran-1-dimethanyl 2.2-dioxide; 3- [3- (4 · # Amino_1 · isoamyl-2-one-1-1,2-dihydro [1, 8] Bite _3_yl) -1,1_Dioxide-4H-1,2,4-Benzobenzophenone di-p-well-7-yl] diazepine-l-inoline-1-propanoic acid 2-propane Block stent 2.2- dioxide; 3- [3- (4_hydroxy_1_isopentyl_2_one-1,2-dihydro [1,8] pyridin_3_yl • dioxide _4H-1,2,4_benzo-p-diketoporphin-7-yl] diazepine uranyl picoic acid 2-cyanoethyl 2,2-dioxide; 3- [3- (4_ Hydroxy small isoamyl_2_keto_1,2 · dihydro [1 , 8] pyridine_3_yl)-丨 Shan Dioxide-4H-1,2,4_Winter and sulphone-7 · yl] diazepine uranyl small rebel acid 2_ (trimethylcholine Radical) Ethyl 2,2_dioxide; 3- [3- (4-hydroxy_1_isoamylaspartenyl-1,2-dihydro [1,8] pyrimidine_3_yl Oxidation of 4H-1,2,4-benzopyrimidine; base] diazathiourethane small carboxylic acid methyl acetate 2,2-dioxide L 3- [3- (4-pyridyl-1-isopentyl) Methyl-2-keto_1,2_dihydro [1,8] pyrimidine_3_jib 丨 fluorene dioxide-4H-1,2,4-benzopyrene-7-yl H-formyl Benzyl diazathiolupin small carboxylic acid 2,2-dioxide; N- [3- (4-Cyclo-1-isopentyl_2_one-1,2-dihydro [1, 8] Pyridine radicals oxidize -4H-1,2,4-benzothiadinyl_7_yl] _N, _methylsulfonamide; 3- [3- (4-meryl-1-isoamyl 2--2-keto-i, 2-dihydro [1,8] pyridinyl radicals and 2H2O-4H-1,2,4-benzopyrimidin-7-yl] diazepine + Carboxylic acid 2-aminoethyl 89166 -17- 200427678 酉 2,2-dimulsions; N-cyclopentyl-Nf- [3- (4- # 基 _1_isopentyl_2-one group -1,2_dihydro [1,8] pyridin-3-yl) _1,1 · dioxide-4H-1,2,4-benzopyrimidin-7-yl] sulfonamide; N- Cyclobutyl_N '-[3- (4 · Gu Diisopentyl-2-keto-1,2-dihydro [1,8] pyridin-3-yl) -1,1-dioxide-4H-1,2,4-benzopyrimidine _7_yl] sulfanilamide; N- [3- (4-hydroxy-1-isoamylaspartone · 1,2-diargon [1,8] pyridin_3_yl) -1,1 -Dioxo-4'-1,2,4-benzopyridine-7-yl] -N '-(4-hexahydropyridyl) sulfonamide; Ν- (2-hydroxyethyl) -N' _ [3- (4-Hydroxyisopentyl-2-keto_1,2_dihydro [1,8] Hydro-3--3-yl) -1,1-dioxide-4Η-1,2, 4-benzopyridine-7-yl] continylamine; 3-[({[3- (4-hydroxy small isoamyl_2_one-l-1,2-dihydro [1,8]) Pyridin-3-yl) -1,1-dioxide-4fluorene-1,2,4-benzopyrimidin-7-yl] amino} sulfofluorenyl) amino] propanilamine; Ν- [3_ (4-Hydroxy-1-isopentyl-2-one-1,2-dihydro [1,8] pyridin-3-yl) -1,1-dioxide-4, -1,2,4- Benzopyridine-7-yl] pyrazinesulfonamide; 3-hydroxy-N- [3- (4-hydroxysmall isoamyl_2_one-1,2-dihydro [1 , 8] Pyridin-3-yl) -1,1-dioxide-4pyridine-1,2,4-benzopyrimidin-7-yl] -1-monoazatetrapyridinesulfonamide; 3-amine -N- [3- (4-Leptyl small isoamyl-2-one-1,2-dihydro [1,8] pyridin-3-yl) -1 1-Dioxide-4Η-1,2,4-benzopyridine-7_yl] microtetrahydropyrrolidinesulfonamide; Ν- [3 · (4-hydroxy small isoamylaspartone_1, 2_dihydro [1,8] pyridinyl) -1,1-dioxide-4Η-1,2,4 · benzopyrimidin-7-yl] -1-hexahydropyridinesulfonamide; N-fluorenyl-N '-[3- (4-Cyclo-isopentyl-2-keto-1,2-dihydro [1,8] pyridin-3-yl) -1,1-di Oxidized-4Η-1,2,4-benzothiadinyl_7_yl] sulfonamide; 3-[({[3- (4-meryl-1_isoamyl-2-keto-1,2 -Dihydro [1,8] peak lake-3-yl) _1,1_ dioxide-4Η_1,2,4-benzopyrimidin_7-yl] amino} continylfluorenyl) amino] ethyl benzoate Esters; 89166 -18- 200427678 3-[({[3- (4-Hydroxyisopentyl-2-one-1,2-dihydro [1,8] pyridin_3_yl) _1,1 -Dioxo-4'-1,2,4-benzopyridine-7-yl] amino} sulfofluorenyl) amino] benzoic acid; 3-[({[3- (4-hydroxy-1_ Isoamyl-2-keto-1,2-dihydro [1,8] pyridinyl) · 1,1-monooxide-4H-1,2,4-benzop-ceedilphin-7_ Group] amino group} amino acid group) amino group] benzoic acid amine; N- (2-aminoethyl) _N '-[3 -_ (4-hydroxy small isopentyl-2-one group-1 ^ 2-di Hydrogen [1,8] pyridin-3-yl) -1, 1-dioxide-4H-1,2,4-benzopyrene-7-yl] sulfonamide; K {[3- (4-hydroxy-1-isopentyl-2-one-1, 2_dihydro [1,8] pyridin-3_yl) -1,1-dioxide-4pyridin-1,2,4-benzopyridine di_-7-yl] amino} pyridyl) -3-Hexahydropi ratio ethyl carboxylate; (2SH-({[3- (4-hydroxy-1-isopentyl-2-one-1,2-dihydro [1,8] pyridine Winter-based) _ 1,1_ monoxide-4 Η · 1,2,4 · benzobenzodi-p-well-7-yl] amino group} amino group) -2-tetrakis p-pyrrole methyl carboxylate; N- [3- (4-Hydroxyisopentyl-2-one-1,2-dihydro [1,8] pyridin-3-yl) -1,1-dioxide-4Η-1,2 , 4-Benzothiazepine-7-yl] small tetrahydropyrrolidinesulfonamide; group_N- [3- (4-J% group_1_isopentyl-2-pentyl-1,2- Dichloro [1,8] peak lake base) -1, L · dioxo-4Η-1,2,4-benzopyrimidine-7 · ylpyridine-hexahydropyridinesulfonamide; and N- (2 -Furylmethyl) -3- [3- (4-hydroxysmall isoamyl-2-keto_1,2_digas [1,8] pyridinyl) -1,1-dioxide- 4Η-1,2,4-benzopyrimidinium] diazathiolupin-1-fermentamine 2,2-dioxide. 10. The compound according to item 4 of the scope of the patent application, wherein R2 and R3 together with the carbon atom to which they are attached form a pyrenyl ring. 11. Compound according to formula (III) according to item 1 of the scope of patent application 89166 -19- 200427678 Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxyalkyl, alkyl, alkylcarbonylalkyl, alkylthioalkyl, alkylsulfinylalkyl, alkylsulfonyl Alkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkane Base, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkenyl, formamyl, alkynyl, alkynyl, i-alkyl, heteroaryl, heteroarylalkenyl, heteroalkyl Aryl, heteroarylsulfonylalkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, R ^ RbNCCO) alkyl- , RaRbNCCOP alkyl-, RaRbNC (0) NRc alkyl-, RfRgC = N- and RkO-, where R1 is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group including alkyl, alkenyl , Alkynyl, keto, halo, cyano, nitro, haloalkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl ,-(Alkyl) (0 &amp;),-(alkylXNRe Re), -SRe, -S (0) Re, -S (0) 2 Re, -0RC, -N (R e) (Re), -C (0) Re, -CCCOORe, and ((CONReRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, -yl, hydroxyl, I ^ RbN-, N3 -, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of i group, nitro group, cyano group, -OH, 89166 -20- 200427678 -nh2 &amp;-cooh; R5 in Each occurrence is independently selected from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidoalkyl, formamyl, dentyl, i-alkyl, autocarbon, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, I ^ RbN-, RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, Ra (〇) SN (Rf)-, RaS02N (Rf), Ra (0) SN (Rf ) Alkyl-, RaS02N (Rf &gt; ^ *-, RaRbNS02N (Rf) _, RaRbNS02N (Rf: ^ *-, RaRbNC (0)-, RkOC (0)-, Rk0C (0) alkyl-, RkO alkyl -, RaRbNS02-, R ^ bNSC ^ alkyl-, (Rb0) (Ra) P (0) 0- and -ORk, where each R5 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independent Selected from the group consisting of alkyl, alkenyl, decanyl, keto Alkyl, cyano, nitro, alkynyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORc), _ (alkyl) (1¾¾), _SRe, 4 (0) 1 ^,-, -OK '-NdXRd)' -CCCORe, &lt; (0) 0 and -0: 0). R6 is independently selected from each group including alkyl, fluorenyl, decyl, halo, cyano, nitro, Salkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl Group, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkyl) (NRaRb), -SRa, -S (0) Ra, 4 (0) 2¾, -ORk,- N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and _C (0) NRaRb; where each R6 is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independent Selected from the group consisting of alkyl, fluorenyl, decyl, Sa, 1¾, _, cyano, nitro, -〇Ra, -NRa Rb, -SRa, -SORa, -S02Ra, -〇: 0) , -C (0) NRaRb &amp; -NC (0) Ra; Ra and Rb are independently selected at each place where they are selected from the group consisting of hydrogen, fluorenyl, and alkynyl 89166-21-200427678, alkylthioalkyl, aryl, Arylalkenyl, aralkyl, cyanoalkyl, cyclofluorene , Cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methylamino, ialkyl, heteroaryl, heteroarylalkyl, heteroaralkyl, heterocyclic , Heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, f ^ RdN-, RkO-, RkOalkyl-, alkyl-, I ^ RdNCXO) alkyl-, ROS02- , 302 alkyl-, 1 &lt; 3 (0)-, ReC (O) alkyl-, Reoc (0)-, Reoc (0) alkyl-, I ^ RdN alkyl C (O) -, R ^ RdNCCO)-, Re ^ NCCOp alkyl-, ReRdNC (0) N (Re) alkyl-, where &amp; and Rb are substituted with 0, 1 or 2 substituents, and the substituents are selected from the group including alkane Alkyl, alkenyl, alkynyl, keto, i-based, cyano, nitro, i-alkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxy Alkoxyalkyl,-(alkyl XORJ, _ (alkyl XNI ^ Rd), -SRe, -S (0) Re, -S (0) 2Re, -ORe, -N ^ XRd), (:( 0) &amp;, or, Ra and Rb and the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently 1, 2, or 3 substituents, independently selected from alkyl groups Alkenyl, bulk, fluorenyl, -yl, cyano, nitro, D-filler, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkane Oxyalkyl,-(alkyl XORJ,-(alkyl XNI ^ Rd), -alkyl S02NRcRd, -alkyl C (0) NReRd, -SI ^, 4 (0) 1 ^, -S (0) 2Rc , -ORc, -Nd)%), &lt;: (0) ~, &lt; (0) 0 &amp;; Heart and Rd are independently selected at each place where they are selected from the group consisting of hydrogen, _NRfRh, -0Rf, _C0 (Rf) , -SRf, -S0Rf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, 89166 -22- 200427678 cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, iialkyl, heteroaryl, heteroaralkyl, heterocyclic, and heterocycloalkyl; each of Rc and Rd is independently 0, 1 , 2 or 3 substituents. The substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl: keto, keto, 1¾, cyano, nitro, alkyl, halooxy, aryl, hetero Aryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf , -S (0) 2Rf, -ORf, -N (Rf) (Rh) -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N (Re) S02NRfRh, -N (Re) -C (0) NRfRh, -alkylN (Re) C (0) ORf, -alkylN (Re) S02NRfRh, and -alkylN (Re) C (0) NRfRh; or, Re Forms a three- to six-membered ring with Rd and the nitrogen atom to which they are attached, selected from the group consisting of heteroaryl and heterocyclic rings, wherein heteroaryl and heterocyclic ring systems are independently substituted with 0, 1, 2 or 3 substituents The substituent is independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, dentyl, cyano, nitro, alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl , Heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf ' -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and -C (0) NRfRh; Re is selected from the group consisting of hydrogen, fluorenyl, alkyl, and cycloalkyl; Rf, 1 ^ and Rh are independently selected from each occurrence including hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl , Heterocycle, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and 1 ^ is independently 0, 1, 2, or 3 substituents are substituted, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, IS, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic , Hetero 89166 -23- 200427678 aryl, heteroaralkyl, -OH, -0 (alkyl), _NH2, -N (H) (alkyl), _N (alkyl) 2, -S (alkyl) , Name (0) (alkyl), —S02 alkyl, —alkyl—OH, —alkyl—0—alkyl, —alkyl NH2, —alkyl N (H) (alkyl), —alkyl N (Carbonyl) 2, -Carbonyl S (alkyl), -Carbonyl S (0) (Carbonyl), -Carbonyl S02 Alkyl, -N (H) C (0) NH2, -c (o) oh, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -c (o) nh2, -C (0) N (H) (alkyl), and- C (0) N (alkyl) 2; or, Rf, together with Rg and the broken atom to which they are attached, form a three- to seven-membered ring selected from cycloalkyl, cycloalkenyl, and heterocyclic rings; or, Rf, together with Rh and the nitrogen atom to which they are attached, form a three- to seven-membered ring selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently 0, 1, 2 or 3 Substituted by a substituent, the substituent is independently selected from the group consisting of alkenyl, alkenyl, block: yl, cyano, , Nitro, aryl, aryl, alkynyl, cycloalkyl, cyclofluorenyl, heterocyclic, heteroaryl, heteroaryl, -OH, _0 (alkyl), -NH2, -N (H) (carbon Group), -N (alkyl group) 2, -S (alkyl group), -S (alkyl group), -S (0) (alkyl group), _alkyl group-0H, -alkyl group -0-alkyl group , -Alkyl NH2, -alkyl N (H) (alkyl), -alkyl S (alkyl), -alkyl S (0) (alkyl), -alkyl S02 alk-yl, -alkyl N (alkyl) 2, -N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -C (O) alkyl, -C (0) NH2 -C (0) NH2, -C (0) N (H) (alkyl) and _C (0) N (alkyl) 2; Rk is selected from the group consisting of fluorene, alkenyl, alkyl, aryl, Aryl, cyanoalkyl, cyclofluorenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, methylamino, haloalkyl, heteroaryl, heteroaralkyl, heterocyclic , Heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS-, RaS (0)-, RaS02-, RaS alkyl- , Ra (0) S 89166 -24- 200427678 alkyl- 'RaS02 alkyl-, Ra0C (0)-, Ra0C (0) alkyl-, RaC (0)-, RaC (0) alkyl-, each of which Rk is substituted with 0, 1, 2 or 3 substituents. Selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, i-group, fL group, nitro, haloalkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaryl Alkyl, alkoxyalkoxyalkyl,-(alkyl XORJ,-(alkyl) (NRcRd), -SK, -8 (0fan, -SCOhK, -0RC, -N (Rc) (Rd), -C (0) Re, &lt; (0) 0 &amp; and -C (0) NReRd; m is 0, 1, or 2; and n is 0, 1, 2, 3, or 4; the condition is that when R4 Is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocycloalkyl, cycloalkyl , Cyano, nitro, hydrazine, 1 ^ (3 (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaS02N (Rf)-, RaRbNC (0)-, Rk0C (0)-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, decanyl, i-based, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa, When -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaJlb, then R1 Not hydrogen, fluorenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, hetero Group, alkenyl heteroaryl, heteroaralkyl, heterocyclyl, cycloalkyl alkenyl or heteroalkyl. 12. The compound according to item 11 of the application, wherein R4 is a hydroxyl group. 13. The compound according to item 12 of the scope of patent application, wherein R1 is selected from the group consisting of hydrogen, dilute, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, aralkyl, and carboxyl Alkyl, cyanoalkyl, cycloalkenyl, cycloalkenyl 89166 -25- 200427678 alkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, methylamino, _k, hetero Alkyl, heteroaryl, heterocyclic, dilute heterocyclic, ring 1, alkynyl, alkynyl, RaRbNC (〇) alkyl-, RfRgC = N- &amp; Rk〇-. Η · The compound according to item 10 of the scope of patent application, or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, which is selected from the group consisting of: 4-amino-6- (l, l- Dioxygen-4H-1,2,4-benzopyrene) _7_Lightylpyreno [3,2-b] pyridin-5 (4H) -one; 6- (1,1 · a Emulsification · 4Η_1,2,4-Benzopyridin-3-yl) -7-quinyl-4- (isobutylamino) &gt; Sepeno [3,2-b] pyridine-5 (4H ) · Ketone; called} Monoxide-4H-1,2,4-Benzo-farce_3_yl) -7-Ethyl-4 _ {[(3S) -3_methylcyclopentyl] amino} Pyrimido [3,2-b] pyridine-5 (4H) -one; 4-{[1-cyclopropylethyl] amino} -6_ (1,1-dioxide-4Η-1,2, 4-benzothiadihex-3-yl) _7- # 里 基 P sepheno [3,2_b &gt; bito-5 (4Η) -one; 4- (butylamino) -6 · (1, 1-Dioxide-4Η-1,2,4-benzopyridine_3_yl) -7-residue fluoreno [3,2hepta] pyridin-5 (4Η) -one; 6- 仏 1_ -4Η-1,2,4-benzopyridine-di-2-yl) -4-[(2-ethylbutyl) amino Yodo-5 (4Η) -one; one emulsified-4Η-1,2,4_benzoρ plug diρ well_3_yl) -7-pyridyl-4- (pentylamino) pyrimidine Acene [3,2-b] pyridine-5 (4H) -one; 6- (1,1-monooxide-4H-1,2,4-benzobenzopyridin-3-yl) _7-jing -4 _ [(3-methylbutyl) amino] pyrimido [3,2-b] pyridin-5 (4H) -one; 4-[(3,3-monomethylbutyl) amino] -6- (1,1-Dioxide-4H-1,2,4-benzo p-ceto-2-yl) -7-pyrimidopyrido [3,2-champiridine_5 (4H ) _Ketone; 89166 -26-200427678 6- (1,1_dioxide-4H-1,2,4-benzopyridine group) -7-hydroxy-4 _ [(3 · methylfluorenyl) Amine] pyreno [3,2-b] pyridine-5 (4Η) -one; 6- (1,1-dioxide-4Η-1,2,4-benzothiadinyl group) -7 -Hydroxy-4-[(2-methylfluorenyl) amino] pyrimido [3,2-b] pyridin-5 (4Η) __; 6- (1,1-dioxide-4Η-1,2 , 4-Benzothiine_3_yl) -7-Ethyl-4-[(4-methylmethyl) amino] tetrabenzo [3,2-b] Edian-5 (4Η) -Ketone; 6- (1,1-Dioxide-4Η1,2,4-benzopyrene-3-yl) _7_hydroxy-4-[(3-methylbut-2-fluorenyl) amino ] Thieno [3,2_b] pyridine-5 (4Η) _one; W1,1 · Dioxo-4Η-1,2,4-benzothiadinyl_3_yl) -7_jingyl-4- ( (Propylamino) thieno [3,2hepta] pyridine-5 (4H) -one; 6- (1,1-—oxidized-4 H-1,2,4-Benzo-p-di-3--3-yl) -7-Cycloyl 4-[(ρ 比比 冰 基 methyl) amino] fluoreno [3,2-b] Pyridine-5 (4Η) -one; -4Η-1,2,4-benzoporazepine-3-yl) -7-keto-4 · [(ρ 比 Lake-3_ylmethyl) amine Phenyl] pyrimido [3,2-b] pyridin-5 (4Η) -one; 6- (1,1-—oxidized-4H-1,2,4_benzo-p-di__3_yl) -7- # 成 基 -4 · [(onlinedian-2_ylmethyl) amino group; | davano [3,2 hepta] pyridine-5 (4Η) -one; 6- (1,1-—oxidized 4Η-1 , 2,4-Benzobi-di-3-yl) _7_Cycloyl-4-[(3-methoxyuryl) amino] p cepheno [3,2-b] p 5 (4Η) -one; —Oxide-4Η-1,2,4-benzobenzochrysyl-3-yl) -4-[(3-carnomethyl) amino] -7-hydroxythieno [3,2-b] pyridine_5 (4Η) .; 3-({[6 · (1,1-monooxide-4Η-1,2,4-benzolide two wells-3_yl) _7 -Ethyl-5-ketopyrimo [3,2-b] pyridin-4 (5Η) -yl] amino} methyl) benzonitrile; -4Η-1,2,4 · benzo ρSedihu-3_yl) _7_kiji · 4 _ [(Epiphen_3_ylmethyl) amino &gt; Cepheno [3,2_b] pyridin-5 (4Η) -one; 89166 -27- 200427678 4- (cyclobutylamino) -6- (1,1 · Dioxy-4H-1,2,4-benzopyrene difluorene τ well groups) -7-Hydroxythieno [3,2_b] pyridine-5 (4H) _one; 4- (Ethylamino) -6 -(1,1 · Dioxide-4H-1,2,4_benzopyrimidine_3 • yl> 7-ylpyrimido [3,2-b] pyridine-5 (4H) -one ; 4-[(Cyclohexylmethyl) amino] -6- (U_dioxide-4H-1,2,4_benzo, cyclodi-3-yl) -7-hydroxypyrimido [3 , 2_b] pyridine-5 (4H) -one; -4H-1,2,4-benzophenone di-p--3-yl) -7-lightyl-4-[(l, 3-teletonyl) Methylmethyl) amino] fluoreno [3,2-b] exo-5 (4H) -one; 4-[(3-bromobenzyl) amino] -6_ (1,1-di Oxidation of _4H_1,2,4-benzopyridinyl_3_yl) -7-¾ylρ-sedeno [3,2-b] p ratio-5 (4H) -one; 4- (cyclohexylamine) ) -6- (1,1-dioxide-4H-1,2,4-benzo far fluorenyl_3_yl) _7_transylthieno [3,2hepta] pyridine-5 (4H) _ Ketone; 4- (cyclopentylamino) _6_ (1,1_dioxide-4H_1,2,4_benzothiadinyl_3_yl) _7_ hydroxypyrimido [3,2-b] pyridine- 5 (4H) -one; 4- (cycloheptylamino) -6- (1,1-dioxide-4H-1,2,4-benzopyrene diphenyl group) _7_ hydroxypyreno [3 , 2-b] pyridine-5 (4H) -one; 6- (1,1-di ▲ oxidation-4 H-1,2,4-benzopyrimidine_3_yl> 7-hydroxy-4-{[(lR, 3R) -3-methylcyclohexyl] amino} pyrimido [3,2 Hepta] pyridine-5 (4H) -one; 6- (1,1 · Dioxide-4H-1,2,4-benzopyrimidin-3-yl V7-hydroxy_4-{[(iR, 3R ) -3-methylcyclohexyl] amino} thieno [3,2-b] pyridin-5 (4H) -one; W1,1-dioxide-4H-1,2,4-benzop-di-di P_3_yl) _4-[(1_ethylpropyl) amino] -7-fluorenylpyrido [3,2-bHpyridin_5 (4H) _one; 6- (1,1- Dioxide-4H-1,2,4_benzothiadinyl group) _7_hydroxyice {[1-phenylethyl] amino} pyreno [3,2-b] p ratio lake-5 (4H) -one; 89166 -28- 200427678 W1,1 · Dioxide-4H_1,2,4-benzopyridin-3-yl) _7_jiki-4-{[(lR) -l-form Butyl] aminobucepheno [3,2-b] pyridine-5 (4H) -one; 4- (cyclobutylamino) -6- (1,1-dioxide-4H-1, 2,4-benzoxenyl-3-yl) -7-hydroxypyrimido [3,2hepta] pyridin-5 (4H) -one; 4 _ [(cyclopropylmethyl) amino] _6_ ( 1,1_dioxide-4H_1,2,4_benzopyrimidin-3-yl) -7-acylthieno [3,2-b] pyridine · 5 (4Η) _one; and 2- ( {3- [4-(% hexylamino) -7-¾yl-5-fluorenyl-4,5-dihydroρ-pheneno [3 , 2-b] pyridin-6-yl] -1,1-dioxide-4H_1,2,4-benzopyrimidin-7-yl} oxy) acetamidamine. 15. The compound according to item 1 of the scope of patent application, which has the formula (IV) Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and alkylcarbonyl , Alkylthioalkyl, alkylsulfinylalkyl, alkylsulfonyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonyl Alkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, methylamino, _ Alkoxyalkyl, _alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocyclic, heterocyclicfluorenyl, heterocycloalkyl, hydroxyalkyl , Nitroalkyl, I ^ RhN 89166 -29- 200427678 alkyl, RaRbNC (0) alkyl-, RaRbNC (0) 0 alkyl-, RaRbNCXCONI ^ alkyl-, RfRgC = N_ and Rk0_, where R1 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, self-radical, cyano, nitro, alkynyl, and alkoxy , Aryl, heteroaryl, heterocyclic, aralkyl, hetero Alkyl, alkoxyalkoxyalkyl,-(alkyl) (ORe),-(alkyl XNReRe), -SRe, 4 (0) core, 4 (0) 21, -〇 center, -N ^ XRe ), &Lt; (0) 1 ^, -0 (0) 01 ^ AC (0) NRe Re; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxyl, RaRbN_ , N3-, ReS-, where R4 is substituted with 0, 1 or 2 substituents, the substituents are independently selected from the group consisting of _, nitro, cyano, -0H, -NH2 and -COOH; R5 is present in each The process is independently selected from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidoalkyl, methylamino, liyl, lialkyl , Autochemical carbon, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, chloroalkyl, nitro, I ^ RbN-, ίςοχο)-, RaS-, Ra (0) s-, Ra (0) 2S-, RaRbN φ alkyl-, Ra (〇) SN (Rf)-, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl- , RaS02N (Rf &gt; ^!-, RaRbNS02N (Rf)-, RaRbNS02N (Rf: ^ *-, RaRbNC (0) _, Rk0C (0) _, Rk0C (0) alkyl-, Rk0alkyl-, RaRbNS02- , RaRbNS02 alkyl_, (Rb0) (Ra) P (0) 0- and -0Rk, where each R5 is independent 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, keto, alkynyl, cyano, nitro, alkynyl, haloalkoxy, aryl Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl, (alkyl XORc),-(alkyl XNRcRd), -SRe, -S (0) Re 89166 -30- 200427678, -SCOhK, -0 &amp;, -N (Re) (Rd) '-CCCORe, -C (0) 0Rc, and -C (0) NRcRd; R6 is independently selected at each occurrence from the Base, decyl, south base, i-nitro, nitro, halide, alkynyl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(carbon (ORk), (alkyl) (NRaRb), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra and -C (0) NRaRb; wherein each R6 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, bulk, keto, 1¾, 12¾, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, 4 (¾¾, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; Ra is independently selected from each occurrence including hydrogen, alkenyl, alkane Alkyl, alkylthioalkyl, aryl, aryl allyl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl , Methylaminoalkyl, _alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, I ^ RdN-, RkO_, RkO alkyl-, ReRdN alkyl-, I ^ RdNCXO) alkyl ... RoS02-, ReS02 alkyl-, ReQP)-, ReCCO) alkyl-, Rc0C (0)-, Rc 〇C (0) alkyl-, RcRdN alkyl C (0)-, ReRdNCCO)-, ReRdNCCOP alkyl ·, RcRdNCCC ^ Nd) alkyl-, its center and Rb are substituted with 0, 1 or 2 substituents The substituent is selected from the group consisting of an alkyl group, an alkenyl group, an alkynyl group, a keto group, an iS group, a cyano group, a nitro group, a 12-alkyl group, a 12-alkyl group, an aryl group, a heteroaryl group, a heterocyclic ring, an aralkyl group, Heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkylXNRcRd), -S &amp;, -S (0) Re, name (0) 2 \, -0RC , -N ^ XRd), -C (0) Re, -C (0) 0Re, and -C (0) NRcRd; or, 1 and 1 ^ together with the nitrogen atom to which they are attached form three-to six 89166- 31-200427678-member ring, Including heteroaryl and heterocyclic ring, wherein the heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, and fluorene Alkyl, cyano, nitro, 1⁄2 alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ, -(AlkylXNI ^ Rd), -alkylSC ^ NI ^ Rd, -alkylCCC ^ NRcRd, name dagger, name dagger, -SCOhl ^, -01 ^, -N%)%), -CCO) ! ^, -C⑼; Re and Rd are independently selected at each place where they are selected from the group consisting of hydrogen, -NRfRh, -0Rf, -C0 (Rf), -SRf, -S0Rf, -S02Rf, -C (0) NRfRh,- S02NRfRh, -C (0) 0Rf, allyl, alkenyl, bulk, cycloalkyl, cycloalkyl, cycloalkyl, cycloalkyl, cycloaryl, aryl, aryl, alkynyl Aryl, heteroaralkyl, heterocycle and heterocycloalkyl; each of them ^ Is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, decanyl, keto, 1¾, cyano, nitro, 1¾, and halogenated oxygen Aryl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) (NRfRh), -SRf , -S (0) Rf, -S (0) 2Rf, -0Rf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, _N (Re) C (0) ORf, _N (Re) S02NRfRh, -N (Re) -C (〇) NRfRh, -alkylN (Re) C (0) ORF, _Alkyl N (Re) S02NRfRh and -alkyl N (Re) C (0) NRfRh; or, together with the nitrogen and the nitrogen atom to which they are attached, form a three- to six-membered ring selected from the group consisting of heteroaromatics And heterocycles, wherein heteroaryl and heterocyclic ring systems are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, li, and cyano , Nitro, _alkyl, 89166 -32- 200427678 halooxy, aryl, heteroaryl, heterocyclic, aryl, heteroaryl, alkoxyalkoxyalkyl,-(alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -O Rf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and -C (0) NRfRh; Re is selected from the group consisting of hydrogen, alkenyl, alkyl, and cycloalkyl; Rf , Rg, and Rh are independently selected from each group including nitrogen, radical, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenyl, and heterocyclic ring , Heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh is independently substituted with 0, 1, 2, or 3 substituents, and φ is independently selected from alkyl and alkenyl groups , Alkynyl, cyano, 1¾, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroarylalkyl, -OH, -0 (alkane Group), -NH2, -N (H) (alkyl), _N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl, -alkyl-OH -Alkyl-O-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl), -alkylS (0) (alkyl), -alkylS02alkyl, -n (h) c (o) nh2, -C (0) 0H'-c (o) o (alkyl), -c (o) alkane Group, -c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl) and -C (0) N (alkyl) 2; φ Alternatively, Rf &amp; Rg and each other Connected carbon Atoms together form a three- to seven-membered ring, selected from the group consisting of a cycloalkyl group, a ring dilute group, and a heterocyclic ring; or, 1 ^ together with Rh and the nitrogen atom to which they are attached form a three- to seven-membered ring. Includes heterocycles and heteroaryl groups; wherein each heterocycle and heteroaryl system is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, Funkyl, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2,- N (H) (alkyl), -N (alkyl) 2, -S (alkyl) 89166 -33- 200427678, -S (alkyl), -S (0) (alkyl), -alkyl- OH, -alkyl-O-alkyl, -alkylNΗ, -alkylN (Η) (alkyl), -alkylS (alkyl), -alkylS (0) (alkyl),- Alkyl S02 alkyl, alkyl N (alkyl) 2, _N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -C (O) alkyl -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl) and -C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen, , Alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkane Methyl, methylamino, alkyl, heteroaryl, heteroaryl, heterocyclic, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, R ^ RbNCCO)-, RaRbNC (0) alkyl, RaS-, RaS (O)-, RaS02-, RaS alkyl-, Ra (0) S alkyl-, RaS02 alkyl-, Ra0C (0)-, RaOqO) alkyl-, RaC (0)-, RaC (0) alkyl, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from alkyl, alkenyl, alkynyl, keto, and | | Yl, cyano, nitro, sulphuryl, alkynyl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇R〇),-(alkylXNReRd), -SRe, -S (0) Re, -S (0) 2Re, -ORe, -N (Rc) (Rd), -CCCORe \ -C (0) 0Re and -C (0) NReRd; m is 0, 1, 2, 3, or 4; and n is 0, 1, 2, 3, or 4; with the proviso that when R4 is alkoxy, aryloxy, Hydroxyl or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocycloalkyl, cycloalkyl, cyano, nitrate S, RaRbN- , RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaS02N (Rf)-, RaRbNC (0)-, Rk0C (0) -, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, 89166 -34- 200427678 block, ii, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa , -S (0) Ra, -S (0) 2Ra, -〇Rk, -N (Rj (Rb), .c (0) Ra, -C (0) 0Ra, and -CCCONI ^ Rb, then R1 does not Hydrogen, alkenyl, alkyl, alkynyl, aryl, arylfluorenyl, aralkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, heteroaryl, heteroaryl Amidino, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl. 16. The compound according to item 15 of the application, wherein R4 is a hydroxyl group. 17. The compound according to item 16 of the application, wherein R1 is selected from the group consisting of RaRbN-, RfRgON- &amp; Rk-0-. 18. The compound according to item 15 of the scope of patent application, or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, which is selected from the group consisting of: 3- (1,1-dioxide-4H- 1,2,4-benzopyrimidine · 3-yl) glacial hydroxy-1-{[(1E) -phenylmethylene] amino} _2 (1H) -quinolinone; 1-amino groups (1 Mountain Dioxide-4H_1,2,4-benzopyridine diphenyl group) Ice Hydroxyl-2 (111)-^ quinolinone; Η1,1 · Dioxide-4Η-1,2,4-benzo π-Secondyl, each base) Bingjiji small propoxy ρ Charin-2 (1 Η), the same; 1- (Ethylamino) _3- (1,1-dioxide-4Η-1,2, 4 · Benylpyridinyl groups) _4-Hydroxyquinyl U (1H) -one; 1-amino groups (1,1-dioxide-4H-1,2,4-benzopyrimidine | Ding Lin-2 (1H)-嗣; 3- (1,1-dioxide-4Η-1,2,4 · benzopyrimidine_3_yl) -4-hydroxypropylbutyl) amino group] Quinoline-2 (1H) _one; mono-gasified-4H-1,2,4-benzo [pi] dihydrogenyl] ice | Dong Jixiao (isobutyl 89166 -35-200427678 amino group) quinoline · 2 (1Η &gt;Ketone; 3- (1,1-Dioxide-4Η-1,2,4-benzopyridine-3_yl) small [(1-ethylpropyl) amino] icel hydroxyl Quinoline-2 (1Η) -one; 4H-1,2,4-pentanopyridine di-p-well-3-yl) -4-meryl-1_ (pentylamino) junplin-2 (1H)- The same; cyclohexylamino) -3- (1,1-dioxo-4H-1,2,4-benzopyrimidin-3-yl) -4 quinolino-2 (1H &gt;ketone; 3- (1,1_Dioxide-4H-1,2,4-benzothiadinium_3_yl) _4 side group is small {[(2_methyl-1,3-oxazole_4_ ) Methyl] amino} quinoline-2 (1H) -one; 3- (1,1-dioxide-4H-1,2,4-benzopyridin-3-yl) ascites -1- (isopropylamino &gt; quinolin-2 (1H &gt;ketone; fluorenylcyclobutylamino) each (1,1-dioxide-4H-1,2,4-benzopyrimidine- 3-yl) -4-hydroxyquinoline-2 (1H &gt;one; 1- (cyclopentylamino) -3- (1,1_dioxide-4H-1,2,4-benzopyrimidine Each group) -4-hydroxyquinoline-2 (1H &gt;ketone; 3- (1,1-dioxide_4H-1,2,4-benzo p-di-di-well_3 · yl) -4- Methylmethylcyclopentyl] amino} quinoline-2 (1H) -one; 3- (1,1-dioxide-4H-1,2,4-benzothiadinyl-3-yl) winter warp Small (tetrahydro-2H-p-diamino-4-ylamino group); quinine-2 (1H) -pyridine; 3- (1,1-dioxide-4H-1,2,4_benzo Thiodigenyl) small {[1-ethylbutyl] amino} 4-Hydroxyquinoline-2 (1H) -one; 3- (1,1-mono-gasification-4H-1,2,4-dongo-p-di-p-well_3_yl) -4-meryl_ l-{[(3R) -3_methylcyclohexyl] amino} quinoline-2 (1H) -one; 1_ (cycloheptylamino) -3- (1,1-dioxide-4H-1, 2,4-Benzothiine_3_yl) -4- 89166 -36- 200427678 Hydroxyquinoline-2 (1H &gt;one; 3_ (1,1_dioxide_4H-1,2,4-benzene Pyridoxine-3-yl) -l-{[3-ethylcyclopentyl] amino} -4-hydroxyquinolin-2 (1H &gt;one; 3- (1,1-dioxide-4H- 1,2,4-benzopyrimidine groups) 4-hydroxy small {[1 · isopropylbutyl] amino} quinoline-2 (111) -one; 3- (1,1-di Oxidized-4H-1,2,4-benzopyrimidin-3-yl) ice hydroxyl small {[1-phenylethyl] amino} quinoline-2 (1H) -one; 3_ (1,1 _Dioxide-4H-1,2,4-benzopyridine, each base) winter hydroxy-1-{[1-pyrimin-3-ylethyl] amino} quinolin-2 (1H) -one ; 1-{[3,5-dimethylcyclohexyl] amino} -3 · (1,1-dioxide-4H-1,2,4-benzopyrimidin-3-yl) · 4- Hydroxyxanthroline_2 (1H) -one; 3- (1,1 · dioxide-4H-1,2,4-benzopyrimidin-3-yl) -4_hydroxy-1-[(4- Isopropylcyclohexyl) amino] p-quelin-2 (1H) -one; 3- (1,1- Dioxide-4H-1,2,4-benzopyrimidinium, each group) ice hydroxyl small [1,2,3,4-tetrahydronaphthalen-2-ylamino] p quinolin-2 (1 H ) -Ketone; 3- (1,1- «Monoxide-4H-1,2,4_Penta-p-dihexyl_3_yl) -4-Ethyl-1 _ {[3- (trifluoromethyl ) Cyclohexyl] amino} quinoline-2 (1H) -one; fluorenylbutylamino) -3- (1,1-dioxide_4H-1,2,4-benzopyrimidine_3_ ) -4- # Althylquinoline-2 (1Η &gt;ketone; 3- (1,1-dioxide-4H-1,2,4-benzopyrimidin-3-yl) 3-Methylbutyl) amino] p-quine_2 (1H) _pyridine; 3- (1,1-monooxide · 4Η · 1,2,4_benzop-pyridyl) small [(3-Cyranylmethyl) amino] -4-hydroxypyridin-2 (1Η &gt;ketone; 3_ (1,1_dioxide-4Η · 1,2,4-benzopyrimidine_3 _Yl) small [(2-furylmethyl) 89166 -37- 200427678 amino] -4-borylquinoline-2 (1H) -one; monogasified-4H-1,2,4-benzoP Cypyl-3-yl) -4- # 里 基 _1_ [busphen-2-ylmethyl) amino group> quinoline-2 (1H) -fluorene; 3- (1,1-monoxide -4H-1,2,4-benzo-p-diaphthin-3-yl) -4- # presents a small [(ι, 3 · ττ 塞 Jun-2-ylmethyl) amino] quinoline-2 (1Η) -one; 3- (1,1_dioxide- 4H-1,2,4-benzopyrimidin-3-yl) small {[((2R) -2-ethyl-3-methylbutyl] amino} -4-hydroxypyridin-2 (1H ) -Ketone; 3- (1,1-Monoxide-4H-1,2,4-Benzoacetal di-p_3_yl) -4-Guyl_i-[(4-methylhenyl) Amine group] Junlin-2 (1H) -one; 3- (U-dioxide-4H_1,2,4-benzopyrimidin-3-yl) -4-kiyl-i-[(3-methyl Benzyl) amino] quinoline-2 (1H) -one; 3- (1,1-monooxide-4H-1,2,4-benzobenzodi-p-well_3_yl) _4 side group- i-[(2-methylfluorenyl) amino] quinolin-2 (1H) -one; 3- (1,1_dioxide_4Η-1,2,4 · benzopyrimidine_3_ ) -4-Ethyl_1 _ {[(3_methylpyridin_2yl) methyl] amino} amorphin_2 (ih) _same; 3- (1,1-dioxide-4H -1,2,4-benzopyridine, each base) -4-hydroxy small [(4-methoxybenzyl) amino] quinoline-2 (1H) -one; chloropyrimidine_2_ (Methyl) methyl] amino group 3 · (ι, ι_dioxide_4H-1,2,4-benzopyrimidin_3_yl) glacial hydroxyquinoline-2 (1H) _one; 1_ { [(2-Chloro_1,3.thiazol-5-yl) methyl] aminodioxide_4H'2,4_benzofluorenedimorphin_3_yl) -4-quinylquinoline-2 ( 1H) _one; H (3-bromobenzyl) amino] _3- (1,1-dioxide_4H-1 2,4-benzopyrimidine · 3-M-M-hydroxyquinoline_2 (1Η &gt;ketone; 4- (4-bromofluorenyl) amino] _3- (ΐ, fluorene-dioxide 4Η-1,2 , 4-benzobenzothine, each 89166 • 38- 200427678 group) -4-Jingjun-2 (111) -Identical; 1- [(2-Bromomethyl) amino] -3- ( l, l-dioxide-4H-1,2,4-benzodisorphin-3-yl) -4- meridian-2 (1H) -amorphous; dioxygen-4H-1,2 , 4-benzopyrene diP-well-3-yl) -4-lightyl-1- [〇 比比 -3-ylmethyl) amino] quinolin-2 (1H) -one; 3-({ [3- (1,1-Dioxide-4H-1,2,4-benzopyridine), winter hydroxy-2-ketoquinoline-1 (2H) -yl] amino} methyl) Benzonitrile; 2- ({3- [1_ (cyclobutylamino) _4_Cycloyl-2-keto-1,2_dihydrojunin-3-yl] -U-dioxide-4H_1, 2,4-benzopyrimidin-7-yl} oxy) acetamidamine; 2-({3_ [1- (cyclopentylamino) _4 • hydroxy-2-keto-1,2_di Hydrofluorin-3-yl] -1,1_dioxide-4H-1,2,4-benzopyrimidine; yl} oxy) acetamide; 2-({3- [1- (cyclo Hexylamino) -4-meryl-2-keto-1,2 · dihydro 4 plin-3 · yl] -1,1-dioxide · 4Η-1,2,4-benzopyrimidine -7-yl} oxy) acetamide; 2- [ (3_ {1-[(Cyclopropylmethyl) amino] _4_title group_2-keto-1,2-dihydroquinoline groups} -1,1-dioxide-4Η-1,2 , 4-Benzothiine_7_yl) oxy] ethanamine 2-({3- [4_Cyclo (isobutylamino) _2_keto-1,2-dihydro0 Quirin-3-yl] -U-dioxide-4Η-1,2-benzopyrimyl} oxy) ethenamide; 2-({3_ [1- (butylamino) _4_ Jing 2-_2-keto-1,2-dihydropyridin-3-yl] -1,1_-dioxo-4'-1,2,4-benzopyrimidin-7-yl} oxy) acetamidine Amine; 2-[(3_ {4_hydroxy small [(3-methylbutyl) amino group; μ2_keto-1,2-dihydroquinoline each group} _1,1_dioxide-4Η_1,2 , 4-Benzo-p-di-di-well_7_yl) oxy] ethynamine; 3- (8-amino-7.hydroxy-1,1-dioxide-4fluorene-1,2,4-benzothiazine Diphenyl-3-yl) -4-hydroxy small (isobutylamino) & quinoline-2 (1H) -one; 2-({8-Monthyl-3- [4-Etyl-1- (Isobutylmonthlyl) -2-Hydroxy-1,2-dihydroquinone-89166 -39- 200427678 3-yl] -1,1-dioxide-4H-1,2,4- Benzopyrimidine-7-yl} oxy) acetamidamine; 2-({3- [4-hydroxy-2 · keto small (propylamino) -1,2-dihydroquinoline_3_yl ] -1,1_Dioxide-4H-1 2,4-benzopyrimidine-7-yl} oxy) acetamidamine; 2-({3- [4-hydroxy small (isobutylamino) -2-keto-1,2-di Hydroquinolin-3-yl] -U-dioxide-4H_1,2,4-benzopyrimidin-7-yl} oxy) propanamide; 2- ({3- [4-hydroxy small (iso Butylamino) -2-keto · 1,2-dihydroquinoline groups] -1,1-dioxo-4Η-1,2,4-benzopyrene_7-yl} oxy ) Butamidine; 8-amino-3-methanesulfonic acid [4-hydroxy small (isobutylamino) -2-one-1-1,2-dihydroquinolin-3-yl] -1,1 -Dioxy-4H_1,2,4-benzopyrimidin-7-yl ester; hydrazone (cyclopropylmethyl) amino] dongqingyl-3- (7 · hydroxy_8_nitro-1, 1-Dioxide_ 4Η_1,2,4_Benzoprene. Well-3-yl) ρ Quilin-2 (1Η) · ketone; 3- (7- {2 _ [(3S) _3-aminotetrahydropyrrole small group] -2 · ketoethoxydioxide-4Η- 1,2,4 · benzothiadinyl-3-yl) small [(cyclopropylmethyl) amino] acenaphthyl_2 (1Η) _one; 2- [(3_ {1-[( Cyclopropylmethyl) amino] _4_Cycloyl_2_keto_1,2_dihydropyrene 3-ylpyrene, 1 · dioxide-4Η_1,2,4-benzopyrene-7 -Yl) oxy] -N_ethyl7, amine;-[(3- {1 _ [(cyclopropylmethyl) amino] _4_hydroxy_2_keto-fluorene, 2-dihydrofluorene ^ Gib 1,1-dioxo-4Η1,2,4-benzothiadi_7_yl) oxy] acetic acid; 3- {7- [2- (3 • aminotetrachloroepo each-1 _Yl) -2-Yan I ethoxy] -pyrene, pyrene-dioxide cut 1,2,4-benzopyrene diphthin-3-ylbu 1 _ [(cyclopropylmethyl) amino] dongji Stilbeneline 2 (1H) -one; 3- (8-amino-7-meryl-1,1_dioxide-4 ， -1,2,4 · benzo-p-di-tertene_3-meaning)! Cyclopropylmethyl) amino] -4-protector p-quelin-2 (1Η) -one; (-40- 89166 200427678 2-[(8-amino-3- {l-[(cyclopropyl (Methyl) amino] -4-hydroxy-2-keto-1,2-dihydroquinolin-3-yl} -1,1 · dioxide-4H-1di4-benzopyrimidine-7 -Yl) oxy] acetamidine; [(8-amino groups {1-[(cyclopropylmethyl) amino] -4-hydroxy-2-keto-1, dihydroquinoline groups} _1,1-dioxide-4H_1,2,4-benzopyridine-7-yl) oxy] acetonitrile; hydrazone (cyclopropylmethyl) amino] -4-hydroxy-3- [7- ( 2-hydroxyethoxy) -1,1-dioxide-4H-1,2,4-benzopyrimidin_3_yl] pyridin_2 (1H) _one; 1 _ [(cyclopropylmethyl (Amino) amino] -4-hydroxy-3- [7- (1Η-imidazol-2-ylmethoxy) -1,1 -— &quot; oxidized_4H-1,2,4-benzop-di-di Sentinyl-3-yl] pyrin-2 (1H) _; 1-[(cyclopropylmethyl) amino] -3- [l, l-dioxide-7- (l, 3-thiazole-2 · Methoxy) -4Η-1,2,4-benzopyrimidin-3-yl] -4-hydroxyquinolin-2 (1H) -one; 1-[(cyclopropylmethyl) amine Group] each [7- (4,5-dihydro-1H-imidazol-2-ylmethoxy) -1,1_dioxide-4H-1,2,4_benzopyrimidin-3-yl ] -4_ several hydrazones 2 (1Η) __; 2- {[( 3- {1 _ [(Cyclopropylmethyl) amino] glaucyl-2-keto-1,2-dihydrofluorin-3-yl} -1,1-dioxide-4fluorene-1,2 , 4-benzopyrimidin-7-yl) oxy] methylbull 1,3-tetrazole-4-carbonitrile; 3- [7- (2-aminoethoxy) _ι, ι_di Oxidized-4Η-1,2,4-benzopyrimidin-3_yl] -W (cyclopropylmethyl) amino] -4-light quinoline_2 (1Η) -one; N] 2_ [(3] l _ [(Cyclopropylmethyl) amino] icelyl group-2 · keto-1,2-dihydroquinoline group 1,1-dioxo-4Η-1,2,4 -Benzopyrimidin-7-yl) oxy] ethyl} methanesulfonamide; 3] 7-[(5-bromopyridinyl) oxy] -1,1-dioxide-4Η-1 , 2,4_benzopyrimidine groups} _4_ meridian small (isobutylamino group) quinoline_2 (m) -one; 4-hydroxy small (isobutylamino) -3- {7-[(3_nitropyridin-2_yl) oxy] -1,1-dioxide-4Η-1,2,4_benzopyrimidiyl group} quin4 _2 (1Η) -one ; 89166 -41-200427678 3- {1-[(Cyclopropylmethyl) amino] -4-¾yl-2-one-1,2-dihydroquinolin-3-yl} -1,1 -Oxidation of 4H-1,2,4-benzoxanthine, and the third purpose of 7-ylaminocarboxylic acid; 3- (7-amino-1,1 · Dioxide-4H_1,2,4 _benzene Pyrimidine-3-yl) small [(cyclopropylmethyl) amino] -4-hydroxyquinoline-2 (1H) -one; 2-rat-6-({3- [4-peryl- 1 · (isobutylamino) -2-S isopropyl-1,2-diaza p-quinolin-3-yl] -1,1-dioxide-4Η-1,2,4 · benzothiadi G7-7-yl} oxy) isonicotinic acid methyl ester; Ν- {3- [1- (cyclobutylamino) -4-hydroxy-2-one-1,2-dihydroquinoline- 3_ group; μ U-dioxide_4Η1,2,4-benzothiadinyl-7-yl} methanesulfonamide; 怵 (3_ {1-[(cyclopropylmethyl) amino] -4 -Hydroxy-2-keto-1,2-dihydroxanthenyl groups} -1,1-dioxo-4'-1,2,4-benzopyridine-7-yl) methanesulfonamide; Ν_ (3_ {Η (cyclopropylmethyl) amino] -4-hydroxy-2-one-1-1,2-dihydro-3-quinolinyl} -1,1-dioxide_4Η-1, 2,4-benzopyridine-7-yl) methanesulfonamide; 2- {[3- (1 • amino-4-acyl-2-meryl-1,2-diazine-3- Junlin group) -1,1_dioxide_ 4Η-1,2,4-Feng and 1? Plug two spray_7_yl] oxy] »ethyl amine; team {3- [1_ (cyclobutyl Amino group) -4-hydroxy-2-keto-1,2-dihydro-3-quinolinyl]-1.1- Monoxide &lt; 4Η-1,2,4-Benzobenzophenone -Yl} ethyl amine continued to be brewed; 3- {3- [1- (cyclo Amino group) _4_hydroxy-2-keto-1,2-dihydroquinolinyl] -1,1-dioxide_4Η-1,2,4-benzopyrimidin-7-yl} Diphenylthiouran-1-carboxylic acid benzyl 2.2-dioxide; Ν] 3_ [fluorenecyclobutylamino) -4 • hydroxy_2_keto-1,2-dihydro_3_quinoline Group] -U-dioxide-4fluorene-1,2,4-benzopyrimidin-7-yl} -N, _methylsulfonamide; and N · {3-〇 (cyclobutylamino) -4 _Hydroxy-2_keto-1,2-dihydro-3.quinolinyl] -1,1-dioxo-4fluorene-1,2,4_benzopyrene-7yl} sulfonamide. 89166 -42- 427678 19. The compound according to item i of the scope of patent application, wherein: A is heteroaryl; and R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of benzene , P-pyridyl, oxidyl, talyl, farphenyl, furanyl, pyrrolyl, pyrazolyl, oxazolyl, pyrazolyl, imidazolyl, isorazolyl, isopyrazolyl, Triazolyl, oxadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl. 20. The compound according to item 19 of the scope of patent application, wherein a is sulfanyl. 21. The compound according to item 20 of the scope of patent application, wherein r2 and r3 together with the carbon atom to which they are attached form a benzene ring. 22. The compound according to item 1 of the scope of patent application, which has the formula (Va) 〇W〇 Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and alkyl , Thioalkyl, thioalkylene, alkylsulfonylalkyl, alkynyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonyl Alkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, methylamino, Alkoxyalkyl, self-alkyl, heteroaryl, 89166 -43- 200427678 heteroarylalkenyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkane Alkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RaRbNC (0) 0 alkyl-, RaRbNC (0) NRe alkyl, RfRgC = N- and RkO-, wherein R1 is substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, amidino, iS alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, hetero Alkyl, alkoxyalkoxyalkyl,-(alkyl) (0),-(alkyl) (NRe Re), -SRe, -S (0) Rc, -S (0) 2 K,- ORe, -Nd) (Re), -qCORe, -C (0) 0Re, and -C (0) NRcRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, free radical, hydroxyl, RaRbN-, N3-, ReS-, where R4 is substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of halo, nitro, cyano, -OH, -Li 2 and (0011; R5 in Each occurrence is independently selected from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidealkyl, formamyl, halo, i alkyl, i carbon, heteroaryl, heteroaralkyl, heterocyclic-, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, I ^ RbN-, RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, R ^ COSN ^ Rf)-, RaS02N (Rf) _, Ra (0) SN (Rf) Alkyl-, 113〇2 wind heart) Alkyl-, 1 ^^ 02 02 wind-heart)-,: ^ 1113 milk 02 wind &amp;) alkyl-, RaRbNC (0)-, Rk0C (0)-, Rk0C (0) alkyl-, RkO alkyl-, RaRbNS02-, I ^ RbNSC ^ alkyl-, (Rb0) (Ra) P (0) 0_, and -ORk, where each R5 Is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl: keto, 1keto, cyano, nitro, keto, 89166- 44-200427678 haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkoxy XORJ, _ (alkoxy XNT ^ Rd), -S &amp;, -SCO)! ^, -S (〇) 2Rc, -ORe'-NdXRd), ((. Where, -C (0) 0Rc &amp; -C (0) NRcRd; R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, block, halo, cyano, nitro, iialkyl, iS Alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkyl) (NRaRb), -SRa,- S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -CXC ^ NRaRb; where each R6 is independently 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb,- SRa, -SORa, -SC ^ Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; Ra and Rb are independently selected at each place where they are selected from the group consisting of hydrogen, amidino, and alkane Alkyl, alkylthioalkyl, aryl, arylfluorenyl, aralkyl, cyanoalkyl, cycloalkenyl, cyclodialkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl , Methylamino, haloalkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, ReRdN -, RkO-, RkO alkyl-, ReRdWt Group-, ReRdNCCO) alkyl, ISOr, &amp; S02 alkyl-, RcC (O)-, ReCCO) alkyl-, ReOCCO)-, ReOC (0) alkyl-, alkyl C (O) -, ReRdNCCO)-, I ^ RdNCCOP alkyl-, I ^ RdNCCCONd) alkyl-, wherein 1 ^ and Rb are substituted with 0, 1, or 2 substituents, and the substituents are selected from the group consisting of alkyl, alkenyl, and alkyne Radical, keto, || yl, cyano, nitro, || alkyl, IS alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkane Group, (alkyl XORe),-(alkyl XNReRd), -SI, -S (0) Re, name (0) 2, -0, 89166 -45- 200427678, _ah) (~),- . (0) 心, _C (0) 0R ^ -C (0) NReRd; or, together with ^ and the nitrogen atom to which they are attached, form a three- to six-membered ring selected from heteroaryl and heterocyclic rings Wherein the heteroaryl and heterocyclic ring systems are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, i-, cyano, nitro, Alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl, (alkyl XORJ,-(alkyl XNI ^ Rd) , -Alkyl SC ^ NReRd, alkyl CCC ^ NReRd, -S &amp;, -SCCORe, -S (0) 2Re, -ORe, -N ^ XRd), -CCCORe, -0: 0) 0 &amp; &amp;-CCCONReRd; Rc and Rd are independently selected for each occurrence from the group including hydrogen, -NRfRh, _ORf, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C ( 0) 0Rf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, iialkyl, heteroaryl, heteroaryl Alkyl, heterocyclic and heterocycloalkyl; ^ Is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, block, keto, iS, cyano, nitro, alkanoyl, halooxy Aryl, aryl, heteroaryl, heterocyclic, aryl, aryl, heteroaryl, alkoxyalkoxyalkyl,-(alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C ( 0) N (H) NRfRh, -N (Re) C (0) 0Rf ^ -N (Re) S02NRfRh ^-N (Re) C (0) NRfRh, -alkylN (Re) C (0) ORf, -Alkyl N (Re) S02NRfRh &amp; -alkyl N (Re) C (0) NRfRh; or, l and 1 ^ and the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of hetero Aryl and heterocycle, wherein heteroaryl and heterocycle are only 89166 -46- 200427678 substituted by 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, fluorenyl, block, ketone Alkyl, alkynyl, cyano, nitro, alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl ) (〇Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf -N (Rf) (Rh), -C (0) Rf, -C (0) ORf, and -C (0) NRfRh; Re is selected from the group consisting of hydrogen, fluorenyl, alkyl, and cycloalkyl; Rf, Rg And Rh are independently selected from each occurrence including hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocyclic, Heterocycloalkyl, heteroaryl, and heteroaralkyl; each of Rf, Rg, and Rh. Is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, and alkynyl , Cyano, i-based, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroarylalkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl), -S (alkyl), -S (0) (alkyl), -S02 alkyl, -alkyl-OH,- Alkyl-O-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, alkylS (alkyl), -alkylS (0) (Alkyl), -alkyl S02 alkyl, -n (h) c (o) nh2, -C (0) 0H, -c (o) o (alkyl), -c (o) alkyl,- c (o) nh2, -C (0) NH2, -C (0) N (H) (alkyl) and -C (0) N (alkyl) 2; or, Rf and Rg and their connected Carbon atoms form together -To a seven-membered ring selected from the group consisting of cycloalkynyl, cycloalkenyl and heterocyclic rings; or, Rf together with Rh and the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocyclic rings and Heteroaryl; wherein each heterocycle and heteroaryl are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, li, and keto , Nitro, aryl, 89166 47-200427678 aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroarylalkyl, -OH, -0 (alkyl), -NH2,- N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl), -S (0) (alkyl), -alkyl-OH, -alkyl -0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS (alkyl), -alkylS (0) (alkyl), -alkylS02 alkyl , -AlkylN (alkyl) 2, -N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -C (O) alkyl, -C (0) NH2, _C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, Aryl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methylaminoalkyl 1¾ alkyl, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS -, RaS (0) _, RaS02-, RaS alkyl-, Ra (0) S alkyl-, RaS02 alkyl-, ΐς〇〇Χ〇) _, Ra0C (0) alkyl-, RaC (0) -, RaC (0) alkyl ·, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, block, keto,- , Nitro, 1¾alkyl, 12¾oxy, aryl, heteroaryl, heterocycle, arylalkyl &lt; heteroarylalkyl, alkoxyalkyl,-(alkyl) (〇 心), -(AlkylXNReRd), -SRe, -SCO)! ^, -SCC ^ Re, -OR ^, -N (Re) (Rd), -C (0) Re, -C (0) 0Rc &amp; -C (0) NRcRd; and m is 0, 1, 2, 3, or 4; with the proviso that when R4 is alkoxy, aryloxy, hydroxy, or dagger, and R5 is hydrogen, alkenyl, alkoxy , Alkyl, alkynyl, aryl, halo, heteroaryl, heterocycloalkyl, cycloalkyl, cyano, nitro, 11 ^ 1 ^, 1 ^ 0: (〇)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaS02N (Rf)-, RaRbNC (0)-, 89166 -48- 200427678 Rk0C (0 )-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, bulk, fluorenyl, cyano, nitro, aryl, heteroaryl, heterocyclic fluorenyl, -SRa, -S ( 0) When Ra, -S (0) 2Ra, -ORk, -NCRaXRb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb, R1 is not hydrogen, alkenyl, or alkane Radical, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl Group, heterocycloalkenyl or heteroalkyl. 23. The compound according to claim 22, wherein R4 is a hydroxyl group. · 24. The compound according to item 23 of the scope of patent application, wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, decanyl, arylalkenyl, aralkyl, Carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, methylaminoalkyl, sylalkyl, heteroarylalkenyl , Heteroaralkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RfRgON-, and RkO-. 25. The compound according to item 1 of the scope of patent application, which has the formula (Vb) φ Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, 89166-49- 200427678 alkyl , Alkylcarbonylalkyl, alkylthioalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, bulk, aryl, arylalkenyl, aralkyl, arylthioalkyl , Arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, formamidine Alkyl, iS alkoxyalkyl, alkenyl, heteroaryl, heteroaryl alkenyl, heteroaryl, heteroaryl, sulfosulfanyl, heterocycle, heterocycloalkyl, heterocycloalkyl Alkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, I ^ RbNCCO) alkyl-, R ^ RbNCCOp alkyl-, RaRbNC (0) NRe alkyl-, RfRgC = N-, and RkO- Where R1 is substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, ii-alkyl, and Oxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaryl , Alkoxyalkoxyalkyl,-(alkylXORe),-(alkyl) (NRC Re), -SRe, -S (0) Re, -S (0) 2 Re, -ORe, -Nd ) (Re), -C (0) Re, -CCCOORe, and -C (0) NRcRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, IS, hydroxyl, N3-, ReS-, where R4 is substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of 1¾, nitro, amino, -OH, -NH2, and -COOH; R5 is independently selected from each occurrence Including fluorenyl, alkoxy, alkynyl, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidoalkyl, methylamidino, fluorenyl, alkynyl, alkynyl, Heteroaryl, heteroaryl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, E ^ RbN-, RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, R ^ COSNCRf)-, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl-, 89166 -50- 200427678 114. 2 wind 1 ^) alkyl-, 1 ^^ milk 021 ^ (1 ^)-, 1 ^ 1113? 02 wind 1 ^) alkyl-, RaRbNC (0)-, Rk0C (0)-, Rk0C (0) Alkyl-, RkO alkyl-, RaRbNS02-, RaRbNS02l group, (Rb0) (Ra) P (0) 0, and -ORk, each of which R5 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, i-based, cyano, nitro, haloalkyl, halooxy Aryl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkylXNT ^ Rd), -SK , -SCO)! ^, -3 (0) 2 heart, -0Re'-NdXRa), -C (0) Re, -C (0) 0Re, and -C (0) NRcRd; R6 is tied to every existence Independently selected from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, i-alkyl, from alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, Heterocycloalkyl,-(alkyl) (0Rk),-(alkyl) (NRaRb), -SRa, -S (0) Ra, -S (0) 2Ra, -0Rk, -NdXRb), -C ( 0) Ra, -C (0) 0Ra &amp; -C (0) NRaRb; wherein each R6 is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, and alkynyl , Keto, halo, haloalkyl, cyano, nitro, -0Ra, -NRaRb, -SRa, -S0Ra, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0 ) Ra; Ra and Rb are independently selected from each occurrence including hydrogen, alkenyl, alkyl Alkylthioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methyl Fluorenylalkyl, bovine alkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, I ^ RdN -, Rk0-, Rk0 alkyl-, RcRdN alkyl-, ReRdNCCO) alkyl-, 802-, ReSCVJ ^-, ReC (0) _, RcC (O) alkyl_, Re〇C (0) -, Re〇C (0) alkyl-, ReRdN alkyl C (O)-, ReRdNC (0: 1. ·, ReRdNC (0) 089166 -51-200427678 alkyl-, KRdNCCCONd) alkyl-, of which And Rb are substituted with 0, 1 or 2 substituents, and the substituents are selected from the group consisting of alkyl, alkenyl, alkynyl, keto, squaryl, cyano, nitro, haloalkyl, i-alkoxy, aromatic Group, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,-(alkylXNReRd), -S &amp;, ^ (0) 1 ^, -S (0) 2Re, -0RC, -N ^ XRa), &lt; (0) 1 ^, -C (0) 0Rc, and -CCCONf ^ Rd; or, ^ Forms a three- to six-membered ring with the nitrogen atom to which they are attached, selected from the group consisting of heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently substituted with 0, 1, 2 or 3 substituents The substituent is independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, alkynyl, cyano, nitro, self-alkyl, halooxy, aryl, heteroaryl, heterocyclic, and aryl , Heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORe),-(alkylXNRcRa), -alkylSC ^ NReRd, alkyl (C) (0) NReRd, _SRe, -SCCORe , _S (0) 2Re, _0 heart, -N ^ XRd), -CCO)! ^ ,; Re and Rd are independently selected at each place where they are selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) ORr, alkenyl, alkenyl, bulk, cyclofluorenyl, cycloalkenyl, cycloalkenyl, cyclo Alkenylalkyl, aryl, aralkyl, alkenyl, heteroaryl, heteroaryl, heterocyclic, and heterocycloalkyl; each of Re and Rd is independently substituted by 0, 1, 2, or 3 Group substitution, the substituent is independently selected from the group consisting of alkyl, dilute, decyl, keto, 1¾, cyano, nitro, alkyl, halooxy, Group, heteroaryl group, heterocyclic ring, aralkyl group, heteroaralkyl group, alkoxyalkoxyalkyl group, · (alkyl) (ORf), _ (alkyl) (NRfRh), -SRf, -S ( 0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh 89166 -52- 200427678,- C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, _N (Re) S02NRfRh, -N (Re) -C (0) NRfRh, _alkylN (Re) C (0) 0Rf, alkyl N (Re) S02NRfRh and -alkyl N (Re) C (0) NRfRh; or, R0 forms a three- to six-membered ring together with Rd and the nitrogen atom to which they are attached, selected from the group consisting of Heteroaryl and heterocyclic, wherein heteroaryl and heterocyclic are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, Cyano, nitro, alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf ),-(Alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C ( 0) 0Rf and -C (0) NRfRh; Re is selected from the group consisting of hydrogen, alkenyl, alkyl, and cycloalkyl; Rf, Rg, and Rh are each independently selected from the group including hydrogen and alkyl , Alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cyclofluorenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl and heteroaralkyl; each Rf, Rg, and Rh are independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, dilute, decyl, cyano, self, keto, nitro * aryl, Aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N ( Alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02alkyl, -alkyl-OH, -alkyl-0-alkyl, · alkylNH2, alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl), -alkylS (0) (alkyl), -alkylS02alkyl, -N (H ) C (0) NH2, -c (o) oh, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -c (o) nh2, -C ( 0) N (H) (alkyl) and -C (0) N (alkyl) 2; or, 1 ^ together with \ and the carbon atom to which they are attached forms a three- to seven 89166 -53- 200427678 -member A ring selected from the group consisting of cycloalkyl, cycloalkenyl, and heterocycle; or, Rf, together with Rh and the nitrogen atom to which they are attached, form three to seven -A member ring, selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of fe, fluorenyl, and block Group, cyano, 1¾, fluorenyl, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -0 (alkyl) , -NH2, -N (H) (alkyl), -N (alkyl), -S (alkyl), -S (alkyl), -S (0) (fluorenyl), -alkyl-OH , -Alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS (alkyl), -alkylS (0) (alkyl), -alkane S02 alkyl, -alkyl N (alkyl) 2, -N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -C (O) alkane -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl) and -C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen and olefin Alkyl, alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methylsilyl, thioalkyl, heteroaryl , Heteroaryl, heterocyclic, heterocyclic, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS-, RaS (0)- Ra S02-, RaS alkyl-, Ra (0) S alkyl-, RaS02 alkyl-, RaOC (0)-, Ra0C (0) alkyl-, RaC (0)-, RaC (〇) Alkyl, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, cyano, cyano, nitro, D Alkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇R〇),-(alkylXNR ^ Rd), -SK, 4 (0) 1, -S (0) 2Rc, -ORc, -N (Rc) (Rd), -C (0) Re, -C (0) 0Rc &amp; -C (0 ) NReRd; and 89166-54-200427678 m is 0, 1, 2, 3 or 4; with the proviso that when R4 is hydroxyl or KS- and R5 is hydrogen, unsubstituted alkyl, halo or- 〇Rk, and R6 is hydrogen, alkyl, fluorenyl, alkynyl, alkynyl, cyano, nitro, aryl, heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra, -S (0) 2Ra, -〇Rk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb, then R1 is not hydrogen, alkenyl, or alkane Base, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, heteroaryl, heteroarylene Radical, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl. 26. The compound according to item 25 of the application, wherein R4 is a hydroxyl group. 27. The compound according to item 26 of the scope of patent application, wherein R1 is selected from the group consisting of wind, alkenyl, alkynyl, alkynyl, resist, decyl, arylalkenyl, and arane Alkyl, carboxyalkyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylfluorenyl, cycloalkylalkyl, methylaminoalkyl, alkyl, heteroaryl Alkenyl, heteroaralkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, R ^ N-, RaRbN alkyl-, R ^ NCXO)-, RfRgC = N- and Rk. -. 28. The compound according to item 21 of the scope of patent application, or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, which is selected from the group consisting of: Ν-({3- [1- (cyclo Butylamino to 2--2-pyridinyl-1,2-dihydro-3-oxoquinyl | yl] -U-dipheno [2,3-e] [l, 2,4] thia Erhuang_7-yl} methyl) urea; 1 · benzyl-4 · # chengyl-3- {7 _ [(fluorenylmethoxy) methyl] _1,1_dioxide-4h_ p-phene Benzo [2,3-e] [l, 2,4] pyridine-3_yl} quinoline · 2 (1Η) · one; 1-amyl-4-lightyl-3- [7 · (# Methyl) -1,1-dioxide-4Η-ρ cepheno [2,3-e] 89166 -55- 200427678 [1,2,4] pyridine-based groups] quinoline-2 (1H) -Ketone; 3- (1-Nanthyl-4 · peryl-2-fluorenyl-1,2-dichlororquine-3_yl) -4 [rho] -rterpheno [2,3-e] [ l, 2,4] pyridine-7-carboxylic acid 1,1-dioxide; 3- (1-fluorenyl_4-meryl-2-6 isopropyl-1,2-diazepine -3-yl) -4Η-ρ cepheno [2,3_ e] [l, 2,4] die Erqian-7-quinic acid amine 1,1_ dioxide; 3- (1-methylyl- 4-Cyclo-2-S isopropyl-1,2-dichlorojunin_3-yl) -N- (2-Cycloethyl) -4H-thienop, 3-e] [l, 2, 4] pyridine-7-carboxamide 1,1-dioxide; 3- (1-fluorenyl_4-mercapto-2-fluorenyl-1,2-dicarbinyl-3-yl) -N _ [(lS) _2-mercapto-1- (aminocarbonyl) ethyl ] -4H-pyrimido [2,3-e] [l, 2,4] pyridine-7-carboxamido 1,1-dioxide; N- (2-amino-2-one Ethyl) -3- (1-fluorenyl-4-hydroxy-2-keto-1,2-dihydrofluorin-3-yl) -4H-p thiopheno [2,3-e] [l , 2, saccharide, 7-metaamine 1,1-dioxide; fluorene 1-fluorenyl-4-hydroxy-2-keto-1,2-dihydroquinoline) -N_ [ (1S) _2 · hydroxy-1-methylethyl] _4H_pyrimido [2,3-e] [l, 2,4] pyrimidin-7-carboxamidine 1,1-dioxide; H1-fluorenyl-4-hydroxy-2-one-1,2-dihydroquinoline groups) -N, N-bis (2-hydroxyethylMH-thieno [2,3_e] [l, 2 , 4] thiadiagen-7-carboxamidine 1,1-dioxide; 3_ (1_fluorenyl_4_isopropyl-2-fluorenyl-1,2-diazepine-3-yl) _N_ [2-Chrysyl-1- (year-old stem methyl) ethyl] -4H-thieno [2,3-e] [l, 2,4] thienone-7-carboxamide 1,1- Dioxide; ^ benzyloxy-3- (7-{[(3R) -3-hydroxytetrahydropyrrole small group] carbonyl group 1,1_ dioxide_4H &lt; cepheno [2,3-e] [l, 2,4] thiadinogen-3-yl> quinolin-2 (1H) -one; fluorenyl-4-lightyl-2-one -1,2-dihydro4-Lyme-3_yl) -N- (3-Transpropyl) -4H-telepheno [2,34] [1,2,4] thienone_7-carboxyfluorene Amine 1,1-dioxide; 89166 -56- 200427678 3- (1-decyl_4-mercapto-2-keto-1,2-dihydrojunline-3-yl) _N-[(2S ) -2,3-dihydroxypropyl] -4H-fluoreno [2,3_e] [l, 2,4] pyrimidin-7-carboxamide 1,1-dioxide; 3- (1 -Fluorenyl-4 · mercapto-2-fluorenyl-1,2 · diazepine-3-lin) -N-[(lS) -1- (protecting methyl) propyl] -4H-fluorene Pheno p, 3-e] [l, 2,4] pyrimidin-7-carboxamide 1,1-dioxide; 3- (1-octyl-4-meryl-2-pentyl- 1,2-Difluorobutanyl-3-yl) -N-[(1S) -1_ (Bymethyl) -2-methylpropyl] -4H-pyrimido [2,3-e] [ l, 2,4] pyrimidin-7-carboxamidine 1,1-dioxide; 3_ (1-decyl-4-meryl-2-fluorenyl-1,2-dichlorojunin-3 _Yl) -N- [2-Ethylbutyl] _4H-pyrimido [2,3-e] [l, 2,4] pyrimidin-7-carboxamidine 1,1-dioxide; 3- (1-benzyloxy-2-keto-1,2-dihydroquinolin-3-yl) · N- [2-hydroxy-2- (4-hydroxyphenyl) ethyl; 1_4H_ Pyrimido [2,3-e] [l, 2,4] pyrimidin-7-carboxamidine 1,1-dioxide; 1-benzyl each [1,1_dioxide · 7_ (hexa Hydropyrine_1_ CarbonylcarbonylMH-thienoP, 3-e] [1,2,4] pyrimidin-3-yl] -4-hydroxyquinoline-2 (1Η) -one; N- [5- (amino Amidino) pyridine-2-yl] -3- (1-fluorenyl-4-¾yl-2-fluorenyl-1,2-dihydroquinolin-3-yl) -4fluorene-pyrimido [2 , 3-e] [l, 2,4] pyrimidin-7-carboxamido 1,1-dioxide; aminoformic acid [3- (1-decyl-4-pyridyl-2-amidino- 1,2-dihydrop-quelin-3-yl) -1,1_-dioxide-4H-pyrimido [2,3-ken1,2,4] pyrimidin-7-yl] methyl ester; amine Phenylaminocarboxylic acid [3- (1-fluorenyl-4-¾yl-2-fluorenyl-1,2-dichloro, p-quinolin-3-yl) -1,1_dioxide-4H- Thieno [2,3 &lt;] [1,2,4] pyrimidin-7-yl] methyl ester; 3- [7- (azidomethylH, l-dioxide-4H-diepheno [ 2,3-e] [l, 2,4] pyrimidin-3-yl] small benzyl_4-hydroxyquinoline_2 (1H) _one; 89166 -57- 200427678 H7- (aminomethyl ) _1,1_Dioxide-4H_thieno [2,3-e] [l, 2,4] pyrimidin-3-ylfluorenyl-benzyl-4-hydroxyquinoline-2 (1H) -one ; N _ {[3- (1-Legenyl-4-fatyl_2_one-l-1,2-dihydropyridin-3-yl) -1,1-dioxetano [2,3 -e] [l, 2,4] pyridine-7-yl] methyl} methylsulfanilamide; team {[3- (1 • benzyl-4-hydroxy-2-one -1,2-dihydroquinoline_3-yl) -1,1-dioxeteno [2,3_6] [1,2,4] pyrimidin-7-yl] methyl} nicotine Hydrazine; Ν-{[3- (1-decyl-4-meryl-2-keto-1,2_dihydrop-quinolin-3-yl) _1,1_dioxide • 4H-repeated Benzo [2,3 &lt;] [1,2,4 &gt; Seleton-7-yl] methyl} morpholine_4-carboxamide; N _ {[3- (1-1- 基 -4- 礼2--2-keto-1,2-dihydro-p-quinyl-3-yl) -1,1 · dioxo-pheno [2,3-e] [l, 2,4] thiadimorph- 7-yl] methylbutanyl 2-mercaptoacetamide; fluoren (cyclopropylmethyl) amino] -4-protecting group_3 · {7-[(methoxymethoxy) f group]- Oxidized-4Hw cepheno [2,3-e] [l, 2,4] fluorenedilin_3_yl} quinoline-2 (1H) _one; fluorene (cyclopropylmethyl) amino]- 4-Ethyl-3- [7_ (hydroxymethyl) -1,1-dioxide-4H-fluoreno [2,3-e] [l, 2,4] pyrimidin-3-yl] 4 : Porphyrin-2 (1Η) .; [[3- {1-[(Cyclopropylmethyl) amino] -4-hydroxy-2-keto-1,2-dihydroquinolin-3_yl Η, 1-Dioxide-4Η-pyridino p, 3_e] [1,2,4] pyrimidin-7_yl) methyl] methylpyridinamine IN [(3- {l _ [(j 衣Propylmethyl) amino] _4_benzyl_2_pyridinyl-1,2-dichlorohalin «3-yl} -1,1_dioxide-4Η-pyrimido [2, 3_e] [1,2,4] pyrimidyl) methyl] ethanesulfonamide; N [(3- {l-[(j 杲 propylmethyl) amino] _4-meryl-2- Amidinyl-1,2-dichlorojuna_ 3-yl H, l_dioxide_4H-thieno [2,3 ^] [1,2,4] pyrimidin-7-yl) methyl ] Propan-1-enamine; N _ [(3_ {1 _ [(Cyclopropylmethyl) amino] icel hydroxyl_2_keto_1,2_dihydropyridinone 89166 -58- 200427678 3 _Kib 1,1-dioxide_4H_pyrimido [2,3_61 [1,2,4] pyrimidine_7_yl) methyl] propane-2-carbamidine; ΜΑ3] 1-! ; (Cyclopropylmethyl) amino M- # yl_2_keto-1,2_dihydropyridin · 3-kib 1,1-dioxetene [2,3 &lt;] [1 , 2,4 &gt; cedarphin-7-yl) methyl] benzoylamine; and N [(3- {l-[(j-propylmethyl) amino] icelanyl-2-one ], 2_dihydroρ quelin. 3-kib 1,1_dioxidation_4H ^ Spheno [^ India to serve two farms ^ Gydyl ^ · Winter based methylamine. 29. The compound according to item 20 of the application, wherein R2 and R3 together with the carbon atom to which they are attached form a pyridyl ring. 30. The compound according to item 1 of the scope of patent application, which has the formula (Via) Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, fluorenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and alkyl , Alkylthioalkyl, alkylsulfinylalkyl, alkylsulfinylalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonyl Alkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, methylamino, alkyl Alkoxyalkyl, _alkyl, heteroaryl, 89166 -59- 200427678 heteroarylalkenyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkane Alkyl, hydroxyalkyl, nitroalkyl, R ^ RbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RaRbNC (0) 0 alkyl-, Ra ^ NCCCONI ^-, Rf Rg C = N -And Rk Ο-, wherein R1 is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, gyl, halo, chloro, nitro, Aralkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, hetero Alkyl, alkoxyalkoxyalkyl,-(alkyl) (ORc), (alkyl) (NRe Re), -SI, 4 (0) 1 ^, -S (0) 2 Re, -ORe, -N (Re) (Re), -C (0) Rc, -C (0) 0Re, and -C (0) NRcRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy,- Group, hydroxy, RaRbN-, N3-, ReS_, where R4 is substituted with 0, 1 or 2 substituents, the substituents are independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 &amp;-COOH; R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkynyl, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidoalkyl, formamyl, Radical, _alkyl, functional carbon, heteroaryl, heteroaralkyl, heterocycle, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC (0) ·, RaS-, Ra (0) S ·, Ra (0) 2S-, I ^ RbN alkyl, R ^ COSNCRf)-, RaS02N (Rf) ·, Ra (0) SN (Rf) alkyl -, Ε ^ 02Ν (Ε ^^ *-, ΐςΐ ^ N302N (Ι ^)-, ΐςΐ ^ N302N (Ι ^: ^ *-, RaRbNC (0)-, Rk0C (0)-, Rk0C (0) alkyl -, RkO alkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0- and -ORk, where each R5 is independent 0, 1, 2 or 3 substituents. The substituents are independently selected from the group consisting of alkyl, fluorenyl, block, keto, fluorenyl, cyano, nitro, self-burning, 89166 -60- 200427678 haloalkane Oxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORe),-(alkyl) 0¾¾), -SRe, -S (0) Re, -SCOhRe, -0 &amp; hN ^ XRd) '-CCCORe,-(χορκ, and CCCONReRd; R6 is independently selected from each occurrence including alkyl, alkenyl, alkynyl, halo, cyano Group, nitro, iS alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (〇Rk),-( Alkyl) (NRaRb), -SRa, 4 (0) ¾, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and- C (0) NRaRb; wherein each R6 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, haloalkyl, cyano Base, nitro, -0¾, -NRaRb, -SRa, -SORa, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; Ra and Rb are in every place where they exist Independently selected from hydrogen, Base, alkyl, alkylthioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkane Alkenyl, methylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkane Group, ReRdN-, RkO-, RkO alkyl-, RcRdN alkyl-, I ^ RdNCCO) alkyl-, KS02-, ReS02 alkyl-, ReQO)-, ReC (O) alkyl-, Rc0C (0) -, Rc0C (0) alkyl-, ReRdN alkyl C (O)-, ReRdNC (0)-, ReRdNC (0) 0 alkyl-, ReRdNCCCONd) alkyl-, whose center and Rb are 0, 1 or 2 substituents substituted, the substituents are selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, ii, cyano, nitro, s-alkyl, oxy, aryl, heteroaryl, heterocyclic , Aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,-(alkylXNReRd), -SK, -S (0) Re, -S (0) 2Rc, -01 89166 &gt; 61-200427678, -NCReXRd), -qo)! ^, -C (0) 0Rc and -C (0) NRcRd; or 'Ra together with Rb and the nitrogen atom to which they are attached form three to six -Staff ring, Including heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, block, keto, and halogen Alkyl, cyano, nitro, alkynyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ, -(Alkyl) (^ ¾), -alkyl S02NReRd, -alkyl CCCONI ^ Rd, famous name, famous name, _S (0) 2Re, -ORc, -ΝΑχΙ ^), -CCOpR ^^-CCCONReRd ; Rc and Rd are independently selected from each place including hydrogen, _NRfRh, _ORf, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) 0Rf, alkenyl, tigeryl, decyl, cycloalkenyl, cycloalkenyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, etc. | Alkyl, heteroaryl, heteroaralkyl, heterocyclic, and heterocycloalkyl; each of which is independently substituted with Rd, 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group including alkyl, Alkenyl, alkynyl, keto, dentyl, cyano, nitro, || alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxy Alkoxyalkyl,-(alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh ), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, -NCRJCCOpRf, -N (Re) S02NRfRh, -N (Re)- C (0) NRfRh, -alkylN (Re) C (0) ORf, -alkylN (Re) S02NRfRh, and -alkylN (Re) C (0) NRfRh; or 'R0 and Rd and others The connected nitrogen atoms together form a three- to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic rings, wherein heteroaryl and heterocyclic ring are only 89166 -62- 200427678 with 0, 1, 2 or 3 substituents Substitution, the substituent is independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, i-, cyano, nitro, alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl Alkyl, heteroaralkyl, alkoxyalkoxyalkyl ,-(Alkyl) (〇Rf),-(alkyl) (NRfRh), -SRf, name (0) xin, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) ORf &amp; -C (0) NRfRh; Re is selected from the group consisting of hydrogen, alkenyl, alkyl, and cycloalkyl; Rf, Rg, and Rh are independently selected from each occurrence Includes hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl, and heteroaryl Alkyl; wherein each of Rf, Rg, and Rh * is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, cyano, dentyl, keto, and nitrate Aryl, aryl, aryl, cycloalkyl, cycloalkyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl ), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), _S02 alkyl, -alkyl-OH, -alkyl-0-alkyl, -alkylNH2 , -Alkyl N (H) (alkyl), -alkyl N (alkyl) 2, -alkyl S (alkyl), -alkyl S (0) (alkyl), -alkyl S02 alkyl _N (H) C (0) NH2, -C (0) 0IL ·, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -c (o) nh2 、 -C (0) N (H) (alkane Group) and -C (0) N (alkyl) 2; or, Rf, together with Rg and the carbon atom to which they are attached, form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl, and hetero Or, together with 1 ^ and the nitrogen atom to which they are attached, form a three to seven-membered ring selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system is independently 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, dentyl, keto, nitro, aryl, 89166 -63-200427678 aralkyl, cycloalkyl , Cyclofluorenyl, heterocycle, heteroaryl, heteroaralkyl, -OH, -0 (alkyl),-· 2, -N (H) (alkyl), -N (alkyl) 2, -S (Alkyl), -S (alkyl), -S (〇) (fe), -alkyl-OH, -alkyl-0-alkyl, -alkyl NH2, -alkyl N (H) (alkyl) Group), -alkylS (fluorenyl), -alkylS (0) (alkyl), -alkylS02 alkyl, -alkylN (alkyl) 2, -N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -C (0) alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H ) (Alkyl) and -C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen, fluorenyl, alkyl, aryl, aralkyl, cyano Alkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methylamino, haloalkyl, heteroaryl, heteroaralkyl, heterocycle, heterocycloalkyl, Nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS-, RaS (0) _, RaS02-, RaS alkyl-, Ra (0) S Alkyl-, RaSO2alkyl-, RaOC (0)-, Ra0C (0) alkyl-, RaC (0)-, RaC (0) alkyl-, where each Rk is 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, -yl, cyano, nitro, li alkyl, haloalkoxy, aryl, heteroaryl , Heterocycle, aralkyl: heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl XORJ, (alkyl XNI ^ Ra), -SRC, 4 (0) 1 ^, -SCC ^ Re, -ORc, -N (Re) (Rd), -CCO)! ^, -C (0) 0Rc &amp; -C (0) NRcRd; and m is 0, 1, 2, 3, or 4; its condition is R4 Is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, aryl, heteroaryl, heterocycloalkyl, cycloalkyl , Cyano, nitro, 11 ^, 1 ^ (:( 0)-, RaS-, Ra (0) S ·, Ra (0) 2S-, RaS0 2N (Rf)-, RaRbNC (0)-, 89166 -64- 200427678 Rk0C (0) ·, RaRbNS02 or _ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro , Aryl, heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (RJ (Rb), -C (0) Ra, -C (0) 0Ra and -C (0) NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) ene Radical, (cycloalkyl) alkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heterocyclicfluorenyl or heterocycloalkyl. 31. The compound according to item 30 of the application, wherein R4 is hydroxy. _ 32. The compound according to item 31 of the scope of patent application, wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylfluorenyl, arylsulfonyl, Alkyl, cyano, alkyl, cycloalkenyl, cycloalkenyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, methylalkyl, haloalkyl, heteroarylene Alkyl, heteroaralkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RfRgON-, and Rk-. 33. The compound according to item 1 of the scope of patent application, which has the formula (VIb) φ Or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and alkyl , Thioalkyl, thioalkyl, 89166 -65- 200427678 alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl , Arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, formamidine Alkyl, iS alkoxyalkyl, alkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl , Hydroxyalkyl, nitroalkyl, I ^ RbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RaRbNC (0) 0 alkyl-, KRfcNCXCONRe alkyl-, RfRgON-, and Rk0-, where R1 Is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, haloalkyl, IS alkoxy, Aryl, heteroaryl, heterocyclic, aralkyl, heteroarane Group, alkoxyalkoxyalkyl group,-(alkyl) (ORe),-(alkyl) (NRe Re), _SRe, -S (0) Re, -S (0) 2 Rc, -0RC,- N (Re) (Re), -C (0) Re, -C (0) 0Rc, and -C (0) NReRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo , Hydroxyl, RaRbN_, N3_, ReS_, where R4 is substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of fluorenyl, nitro, cyano, -OH, NH2 and -COOH; R5 in each Where it is present is independently selected from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidoalkyl, formamyl, fluorenyl, and #alkane Alkyl, carbonized, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, \ RbN_, RaC (0)- , RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, Ra (0) SN (Rf)-, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl- , ^ 802: ^ (化) alkyl- ,: ^ 111 ^ 3021 ^ (1 ^)-, 1 ^ 111 ^ 302 wind 1 ^) alkyl-, 89166 -66- 200427678 R ^ RbNCCO)-, Rk0C (0)-, Rk0C (0) alkyl, RkOalkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0-, and _ ORk, wherein each R5 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, block, keto, fluorenyl, chloro, nitro, and 1¾ , Halooxy, aryl, heteroaryl, heterocyclic, aryl, heteroaryl, alkoxyalkoxyalkyl,-(alkyl) (OR〇),-(alkyl XNT ^ Rd ), -SRe, 4 (0) 1 ^, -3 (0) 2, -ORe "NdXRd), -C (0) Re, ((0) 01 ^, and-(: (0)? 1 ^; R6 is independently selected from each group including alkenyl, alkenyl, decyl, halo, cyano, nitro, alkane, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl Group, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkyl) (NRaRb), -SRa, -S (0) Ra, 4 ((¾¾, -0Rk, -NRXRb ), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; wherein each R6 is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group including alkyl, Alkenyl, alkynyl, keto, halo, haloalkyl, cyano, nitro, -0Ra, -NRaRb, -SRa, -S0Ra, -S02Ra, -C (0) 0Ra, -C (0) NRaRb And -NC (0) Ra; Ra and Rb are independently selected from each including hydrogen Alkenyl, alkyl, alkylthioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, cyclo Alkyl alkenyl, methylaminoalkyl, ialkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitro Alkyl, RcRdN-, Rk0-, Rk0 alkyl ·, RcRdN tiger-, ReRdNC (0) alkyl-, RcS02-, RcS02 alkyl_, ReC (O)-, ReC (O) alkyl-, Rc 〇C (0)-, ReOCCO) alkyl-, ReRdN alkyl C (0) ·, ReRdNCCO)-, ReRdNC (0) 0 alkyl-, KRdNCCCONd) alkyl ·, where 1 ^ and Rb are 0, 1 or 2 89166 -67- 200427678 substitutions, the substituents are selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, iS, cyano, nitro, alkynyl, sulfonyl, aryl , Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl, _ (alkylXORJ,-(alkylXNI ^ RJ, -S &amp;, -SCO)! ^, _3 (0) 2-heart, -01, -NdXRj),-(3 (0) 01 ^ &amp; -C (0) NReRd; or, Ra and Rb and the nitrogen atom to which they are connected form three to six -Member Ring It is selected from the group consisting of heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, and the substituent is independently selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, _Yl, cyano, nitro, _alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylX0RJ ,-(AlkylXNReRd), -alkylS02NRcRd, -alkylC (0) NReRd, -SI, -S (0) Re, -SCOhRe, -ORe, -N (Rc) (Rd), -CXO) ! ^,-(:( 0) 01 ^ &amp; _C (0) NReRd; R0 and Rd are independently selected in each place where they are selected from the group consisting of hydrogen, -NRfRh, -0Rf, -C0 (Rf), -SRf, -S0Rf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) 0Rf, fluorenyl, alkyl, alkyl, cycloalkyl, cycloalkyl, alkyl, ethyl Aryl, aryl, aryl, aryl, alkynyl, heteroaryl, heteroaryl, heterocyclic, and heterocycloalkyl; each of which is independently substituted by 0, 1, 2, or 3 substituents, The substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, keto, i-, cyano, nitro, alkyl, halooxy, aryl, heteroaryl, heterocyclic, aralkyl, Aralkyl, alkoxyalkoxyalkyl,-(alkyl) (0Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -0Rf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -NCRJSC ^ NRfRh, -N (Re)-89166 -68- 200427678 C (0) NRfRh, -alkylN (Re) C (0) 0Rf, alkylN (Re) S02NRfRh &amp;RJCCCONRfRh; or Re forms a three- to six-membered ring together with Rd and the nitrogen atom to which they are attached, selected from the group consisting of heteroaryl and heterocycle, wherein heteroaryl and heterocyclic ring are independently 0, 1, 2 or 3 substituents are substituted, and the substituents are independently selected from the group consisting of alkyl, alkenyl, block, keto, alkynyl, cyano, nitro, alkynyl, haloalkoxy, aryl, heteroaryl, hetero Ring, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) ORf &amp; _C (0), Re is selected from the group consisting of hydrogen, fluorenyl, alkyl and ring Alkyl; Rf, Rg &amp; Rh are independently selected from each occurrence including hydrogen, alkyl, alkenyl, aryl, aralkyl, naphthenic , Cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh # is independently 0, 1, 2, or 3 substituents substituted, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic , Heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), · N (alkyl) 2, -S (alkyl), -S (O) (alkyl), _S02 alkyl, -alkyl_0Η, _alkyl-0-alkyl, -alkylNΗ2, _alkylN (Η) (alkyl), -alkylN (alkane) Group) 2, -alkylS (alkyl), -alkylS (0) (alkyl), -alkylS02alkyl, -N (H) C (0) NH2, -c (o) oh, -c (o) o (alkyl), -c (o) alkyl, _c (o) nh2, -c (o) nh2, -C (0) N (H) (alkyl), and -C (0 ) N (alkyl) 2; or, Rf, together with Rg and the carbon atom to which they are attached, form a three to seven-membered ring selected from cycloalkyl, cycloalkenyl, and heterocyclic rings; 89166 -69- 200427678 Alternatively, the heart forms a three- to seven-membered ring with Rh and the nitrogen atom to which they are attached, selected from the group consisting of heterocycles and heterocycles Aryl; wherein each heterocyclic and heteroaryl system is independently substituted by 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, block, cyano, cyano, keto, Nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroarylalkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkane Group), -N (alkyl) 2, -S (alkyl), -S (alkyl), -S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, -Alkyl NH2, -alkyl N (H) (alkyl), -alkyl S (alkyl), -alkyl S (0) (alkyl), -alkyl S02 alkyl, -alkyl N ( Alkyl) 2, -N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -c (0) alkyl, -C (0) NH2,- C (0) NH2, -C (0) N (H) (alkyl) and -C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, and arane Alkyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methylamino, self-alkyl, heteroaryl, heteroaralkyl, heterocyclic, hetero Cycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS-, I ^ SCO), RaSCV, RaS alkyl-, Ra ( 0) S alkyl- , RaS02 alkyl-, lOCXO)-, Ra0C (0) alkyl-, RaC (0)-, RaC (0) alkyl-, where each Rk is substituted with 0, 1, 2 or 3 substituents, substituted The group is independently selected from the group consisting of alkyl, fluorenyl, decyl, keto, self-based, cyano, nitro, i-alkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, hetero Aralkyl, alkoxyalkoxyalkyl,-(alkyl) (0), (alkyl XNRcRd), -S &amp;, 4 (Team 0, -S (0) 2Re, -OK, -N ( Re) (Rd), -CCCORe, -C (0) 0Rc &amp; -C (0) NRcRd; and m is 0, 1, 2, 3, or 4; 89166 -70- 200427678 with the proviso that when R4 is hydroxyl Or Re S-, and R5 is hydrogen, unsubstituted alkynyl, _yl, or _QRk, and R6 is hydrogen, carbyl, fluorenyl, decyl, yl, cyano, nitro, aryl, hetero Aryl, heterocycloalkyl, _SRa Λ -S (〇) Ra-«S (0) 2Ra. .〇Rk. -N (Ra) (Rb) '-C (0) Ra &gt; -C (0) When 0Ra and -C (0) NRaRb, Ri is not hydrogen, fluorenyl, alkyl, alkynyl, aryl, aryl allyl, aryl, cycloalkyl, (cycloalkyl) fluorenyl, ( Cycloalkyl) alkyl, heteroaryl, heteroarylfluorenyl, heteroarylalkyl, heterocycloalkenyl Or heterocyclic alkyl. 34. The compound according to item 33 of the application, wherein R4 is a hydroxyl group. 35. The compound according to item 34 of the Shen Yan patent scope, wherein R1 is selected from the group consisting of hydrogen, alkenyl, oxyalkyl, oxycarbonyl, alkynyl, decyl, arylmethyl, aralkyl, Carboxyalkyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylfluorenyl, cycloalkylalkyl, methylaminoalkyl, southern alkyl, heteroarylalkenyl , Heteroaryl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, I ^ RbN ·, RaRbN alkyl-, RaRbNq) alkyl-, RfRgON-, and RkO-. 36. The compound according to item 29 of the scope of patent application, or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, which is selected from the group consisting of: [(Methoxymethoxy) methyl] -1, i_dioxide-4H-fluorenoP, 3-e] [1,2,4] pyrimidin-3-yl} -1,8 -Pyrimidine-2 (1H) -Identical; 1-Butyl-4-lightyl-3- [7- (Bylomethyl) -1,1-dioxide-4H-P thiopheno [2,3 -e] [1,2,4] thiadinyl_3_yl; μ, 8 · pyridin-2 (1H) -one; 3- (1-decyl-4-quinyl-2-one- 1,2_dihydro-1,8-hydrophilic-3-yl) _4H ~ cepheno [2,3-eJ [l, 2,4] thiathine-7-carboxylic acid methyl ester 1,1- Dioxide; 89166 -71-2 | 00427678 4 is the group _347-[(methoxymethoxy) methyl] -1,1-dioxide-4H_pyridino [2,3-e] [ l, 2,4 &gt; Cyclobis! yl} -1_ (3-methylbutyl) -i, 8-peak pyridin_2 (ih) -one; and 4-lightyl-3_ [7_demethyl Dioxidation_4 塞 &lt; Sepheno [2,3_6] [1,2, Exercene-3-yl] -1_ (3-methylbutyl) _ 丨, 8-pyridine_2 (1Η). . 37. The compound according to item 19 of the application, wherein a is pyridyl. 38. The compound according to item 1 of the patent application, which has the formula (νπ) (VII) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, and alkane Carbonylalkyl, alkylthioalkyl, alkylsulfinylalkyl, alkylsulfoalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, aryl Sulfofluorenylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, methylformane Radical, 1S alkoxyalkyl, _alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heteroarylsulfonylalkyl, heterocyclic, heterocyclicfluorenyl, heterocycloalkyl, Hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, I ^ RbNCXO) alkyl-, RaRbNC (0) 0 alkyl-, RaRbNC (0) NR0 alkyl-, RfRgC = N- and Rk0 -, Wherein R1 is substituted by 0, 1, 2 or 3 substituents 89166 -72- 200427678, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, halo, cyano, nitro, Alkyl, iS alkoxy, aryl, heteroaryl, heterocyclic, aralkyl Heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (0),-(alkyl XNRe Re), -S &amp;, -S (0) Re, -S (0) 2 Re, -ORc,) team), -C (0) Re, -CCOpRe, and -CXCONReRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, 1¾, hydroxyl, I ^ RbN-, N3 -, ReS-, in which R4 is substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2 and -COOH; R5 is at every occurrence Independently selected from the group consisting of fluorenyl, alkynyl, alkynyl, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidoalkyl, formamyl, selfyl, alkynyl, Carbon, heteroaryl, heteroaryl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaC (0)-, RaS_, Ra (0 ) S-, Ra (0) 2S-, RaRbN alkyl-, R ^ COSi ^ Rf)-, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl-, 113〇2 wind 1 ^) alkane Base-, 1 ^ 111 ^ 802 wind 1 ^) _, 1 ^ 111 ^ 302 wind center) alkyl-, RaRbNC (0: K, Rk0C (0)-, Rk0C (0) alkyl-, RkO alkyl- , I ^ RbNSCV, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0- and -ORk, where each R5 is independent It is substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkyl, alkynyl, methyl, phenyl, chloro, nitro, alkynyl, haloalkoxy , Aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (OR〇),-(alkyl) (^ ¾), -SI , 4 (0) 1 ^, -S (0) 2Re, -ORe, -wind1) team), -C (0) Re ,; R6 is independently selected at each place where it is selected from the group consisting of alkynyl, hydrazone, Decanyl, 89166 -73- 200427678 halo, cyano, nitro, iS alkyl, iS alkoxy, aryl, heteroaryl, heterocycle, aralkyl, heteroaralkyl, heterocycloalkyl, -(Alkyl) (ORk),-(alkyl XNI ^ Rb), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C ( 0) Ra, -C (0) 0Ra and -C (0) NRaRb; wherein each R6 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl , Keto, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0 ) Ra; Heart and Rb are independently selected from each occurrence including hydrogen, alkenyl, alkyl, alkane Alkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formamyl Alkyl, haloalkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, F ^ RdN-, RkO-, RkO alkyl-, ReRdN alkyl-, ReRdNCXO) alkyl-, RcS02_, ReS02 alkyl-, ReC (0) _, ReC (O) alkyl, Reoc (0)-, ReOCCO) Alkyl-, ReRdN alkyl C (0) _, ReRdNC (O) ·, ReRdNC (0) 0 alkyl-, KRdNCCCONd) alkyl-, where \ and Rb are substituted with 0, 1 or 2 substituents, Substituents are selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, 1¾, cyano, nitro, self-burning, iSalkenyl, aryl, heteroaryl, heterocyclic, aralkyl, hetero Aralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,-(alkyl) (NRcRd), -SRe, -S (0) Rc, -S (0) 2Re, -ORe, -N ^ XRd), -CCO)! ^, -C (0) 0Re and; or, together with the nitrogen atom to which they are attached, forms a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, Where heteroaryl and The ring system is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alk 89166 -74- 200427678 group, fluorenyl, decyl, keto, -yl, cyano, nitro, 1¾ Group, halofeoxy group, aryl group, heteroaryl group, heterocyclic ring, aryl group, heteroaryl group, alkoxy group,-(¾ group) (0 匕),-(alkoxy group,- Pit base SC ^ NReRd, -alkylQ ^ NReRd, -S &amp;, name (0) 1 ^, -S (0) 2Rc, -ORc, -where) team),-. (0) ~ ,; Re and Rd are independently selected from each including hydrogen, -NRfRh, -ORf, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh,- S02NRfRh, -C (0) ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, _alkyl, Heteroaryl, heteroaralkyl, heterocycle, and heterocycloalkyl; ^ Is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, decanyl, keto, ii, cyano, nitro, i-carbyl, and halooxy Group, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl, (alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, _C (0) 0Rf, -C (0) NRfRh, -C (0 ) N (H) NRfRh, -NCRJCCOPRf, -N (Re) S02NRfRh, -N (Re)-φ C (0) NRfRh, -alkyl N (Re) C (0) 0Rf, _alkyl NCRJSC ^ NRfRh and -Alkyl N (Re) C (0) NRfRh; or, the heart forms a three- to six-membered ring together with the heart and the nitrogen atom to which they are attached, selected from the group consisting of heteroaryl and heterocycle, wherein heteroaryl It is independently substituted with heterocyclic system by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group including alkyl, alkenyl, alkynyl, keto, dentyl, cyano, nitro, i-alkyl, halogen Alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf 89166 -75- 200427678, -S (0) 2Rf, -O Rf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and -C (0) NRfRh; Re is selected from the group consisting of hydrogen, alkenyl, alkyl, and cycloalkyl; Rf , Rg and Rh are independently selected from the group consisting of nitrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, Heterocyclic, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl and fluorenyl , Decyl, cyano, halo, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroφaryl, heteroaralkyl, -OH, -0 ( Alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl, -alkyl- OH, -alkyl-0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl), -alkyl S (0) (alkyl), -alkylSO2alkyl, -N (H) C (0) NH2, -c (o) oh, -c (o) o (alkyl), -c (o) Alkyl, -c (o) nh2, -c (o) nh2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; or, Rf and Rg and each other Connected carbon Atoms together form a three- to seven-membered ring, selected from the group consisting of cycloalkyl, cyclofluorenyl, and heterocyclic rings; or, Rf, together with Rh and the nitrogen atom to which they are attached, form a three- to seven-membered ring. Includes heterocycles and heteroaryl groups; wherein each heterocycle and heteroaryl system is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, cyano, i-based, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2,- N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl), -S (0) (alkyl), -alkyl-OH, -alkyl -0-alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS (alkyl), -alkylS (0) (alkyl),-89166 -76- 200427678 Alkyl S02 alkyl, -alkyl N (alkyl) 2, -N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -C (O) alkane Group, _C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl) and _C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen and fluorenyl , Alkyl, aryl, aryl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkane , Methylamino, haloalkyl, heteroaryl, heteroaralkyl, heterocycle, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS (0)-, RaS02-, I ^ S alkyl-, Ra (0) S-alkyl-, RaS02 alkyl-, Ra0C (0)-, RaOCXO) alkyl-, RaC (0)-, RaC (0) alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, and halogen Base, fluorenyl, nitro, 1⁄2 pentyl, autoxyl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,- (Alkyl XNReRd), -SRe, -SCCORc, 4 (0) 2 ^, -OK, -NdXRd), -0: 0) &amp;, -C (0) 0Rc, and -C (0) NRcRd; m is 0, 1, 2, 3, or 4; and _η is 0, J, 2, 3, or 4; with the proviso that when R4 is alkoxy, aryloxy, hydroxyl, or ^, and R5 is hydrogen, Alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocycloalkyl, cycloalkyl, cyano, nitro, hydrazone, 1 ^ (:( 0 &gt; · , RaS-, Ra (0) S-, Ra (0) 2S-, RaS02N (Rf) _, RaRbNC ( ) _, Rk〇C (0)-, RaRbNS〇2_ or -ORk 'and R6 is hydrogen, alkyl, alkynyl, alkyne: yl, 1¾yl, cyano, nitro, aryl, heteroaryl, hetero Cycloalkyl, _SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra 89166 -77- 200427678 and &lt; (〇) NRaRb, then Ri is not hydrogen, fluorenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) fluorenyl, ( Cycloalkyl) alkyl, heteroaryl, heteroarylfluorenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl. 39. The compound according to item% of the scope of application, wherein R4 is hydroxy. 40. The compound according to item 39 of the scope of patent application, wherein Ri is selected from the group consisting of gas, fluorenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl'arylalkenyl, aralkyl, Carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylfluorenyl, cycloalkylalkyl, methylaminoalkyl, alkyl, heteroarylfluorenyl , Heteroaralkyl, heterocyclic, heterocyclic alkenyl, heterocycloalkyl, hydroxyalkyl, hydrazone, RaRbN alkyl_, fluorene alkyl ... RfRgC- and Rk0-. 41. The compound according to item 37 of the application, wherein R2 and R3 together with the carbon atom to which they are attached form a pyridyl ring. 42. The compound according to item 41 of the application, wherein R4 is a hydroxyl group. 43. The compound according to item 42 of the application, wherein R1 is selected from the group consisting of hydrogen, fluorenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylfluorenyl, aralkyl, and carboxyl Alkyl, cyanoalkyl, cycloalkenyl, cycloalkenyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, methylamino, alkyl, heteroarylfluorenyl, heteroalkyl Aryl, heterocycle, heterocyclic ring, heterocycloalkyl, hydroxyalkyl, R ^ bN ·, RaRbNalkyl-, RaRbNq ()) alkyl-, RfRgON-, and Rko- 44. The compound according to item 1 of the scope of patent application, which has the formula ① 89166 -78- 200427678 or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl R1 is selected from the group consisting of hydrogen, fluorenyl, alkynyl, alkynyl, alkynyl, carbonyl, thiol, thiol, thiol, thiol, etc. Alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkyl , Cycloalkenylalkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, methylaminoalkyl, 1¾alkoxyalkyl, || alkyl, heteroaryl, hetero Aryl alkenyl, heteroaromatic, heteroarylsulfonyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, I ^ RbNCXO) alkyl-, RaRbNC (0) 0alkyl-, RaRbNC (0) NRe alkyl-, RfRgC = N- and RkO-, where R1 is independently substituted with 0, 1, 2 or 3 substituents' The substituent is independently selected from the group consisting of pit, alkenyl, decyl, keto, self-radical, Group, nitro, _alkyl, iS alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORe), -(Alkyl) (NRcRe), -SRe, -S (0) Re, -S (0) 2Rc, -ORe ... NdXRe), -C (0) Re, -C (0) 0Rc, and -C (0 ) NRcRe; 89166 -79- 200427678 R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, decanyl, alkynyl, alkoxycarbonyl, alkyl, aryl, aralkyl, heteroaryl, heterocyclic, Heteroaralkyl, cyano, halo, _N (Ra) (Rb), RaRbNC (0) ·, -SRa, _3 (0) ΐ, ((〇) 21 ^ and 1 ^ (:( 〇)-; Wherein Chi 2 and 113 are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from Ra, alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, i Alkyl,-(alkyl) (〇Rk),-(alkyl XNI ^ Rb), -SRa, ^ (0) ¾, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, i-group, hydroxyl, I ^ RbN ·, N3_, ReS-, wherein R4 is independently substituted by 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of , Cyano, -OH, -NH2, and -COOH; R5 is independently selected from each group including fluorenyl, alkoxy, alkyn, decyl, aryl, aryl, arylcarbonyl, aryloxy Base, azidoalkyl, formamyl, || yl, iS alkyl, carbonized, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano Group, cyanoalkyl, nitro, J ^ RbN-, RaC (0)-, RaS-, Ra (〇) S-, Ra (0) 2S-, RaRbN alkyl-, ΐ (0) 8N (Ι ^) _, RaSC ^ NCRf)-, Γς (〇) 3N (Ι ^) alkyl-, RaS02N (Rf) alkyl-, RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl-, I ^ RbNCCO)- , Rk0C (0) _, Rk0C (0) alkyl-, Rk0 alkyl-, RaRbNS02_, RaRbNS02 alkyl_, (Rb0) (Ra) P (0) 0-, and -0Rk, where each R5 is independent Substituted by 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, -yl, cyano, nitro, fluorenyl | alkyl, haloalkoxy, Aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, 89166 -80- 200427678 alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkyl) (1% ¾), -SRC, -S (0) Rc, -S (0) 2Re, -〇R '-N ^ XRd), -C (0) Rc, ((0) 0 &amp; and -C (0) NRcRd; the dagger and the heart are independently selected from each occurrence including hydrogen, alkenyl, alkyl, alkyl Thioalkyl, aryl, arylalkenyl, aralkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylfluorenyl, formamidine Alkyl, heteroalkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, RoRdN · , RkO-, RkO alkyl-, ReRdN alkyl-, ReRdNQO) φ alkyl-, ROS02-, ReSCV ^, R ^ CCO)-, ReC (O) alkyl-, RcOC (0 )-, ReOCCO) alkyl-, RcRdN alkyl C (O)-, ReRdNCCO)-, RcRaNCCOp alkyl-, RoRdNC (0) N (Re) alkyl-, the center and Rb of which are 0, 1 Or 2 substituents, the substituent is selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, cyano, nitro, southern alkyl, alkoxy, aryl, heteroaryl, hetero Ring, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,-(alkylXNReRd), -S &amp;, name (0) 1, -S (0) 2Re, · 0 &amp;, -N ^ XRd), _ (:( 0 , C (0) 0Rc &amp; -C (0) NRcRd; φ Alternatively, the heart and the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocyclic ring, wherein The aryl group and the heterocyclic ring system are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl: yl, keto, -yl, cyano, nitro, and D. Group, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORe),-(alkylXNH), -Alkyl S02NReRd, -alkyl C (0) NReRd ... SK, -S (0) Re, -S (0) 2Re, -ORc, -N ^ XRd),-(: (0 team, -C (0 ) 0Rc &amp; -C (0) NRcRd; 89166 -81-200427678 Rc and Rd are independently selected at each place where they are selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO (Rf), -SRf, -SORf, -S02Rf , -C (0) NRfRh, -S02NRfRh, -C (0) ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cyclofluorenyl, cyclofluorenylalkyl, aryl, Aryl, alkynyl, heteroaryl, heteroaralkyl, heterocyclic, and heterocycloalkyl; each of which is ^ and! ^ Is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, decyl, keto, i, cyano, pinyl, halo, halo Aryl, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (0Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C ( 0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N (Re) S02NRfRh, -N (Re) -C (0) NRfRh, -alkylN (Re) C (0) 0Rf , -AlkylN (Re) S02NRfRh and -alkylN (Re) C (0) NRfRh; or, together with the heart and the nitrogen atom to which they are attached, form a three- to six-membered ring selected from the group consisting of hetero Aryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, block, keto, phenyl, cyano Nitro, alkynyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf) ,-(Alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf and -C (0) NRfRh; Re is selected from the group consisting of hydrogen, alkenyl, alkyl, and cycloalkyl; Rf, Rg &amp; Rh is independently selected from each group including hydrogen and alkyl , Alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cyclofluorenyl, cyclofluorenylalkyl, heterocycle, heterocycloalkyl, heteroaryl and heteroaralkyl; 89166 -82- 200427678 Each Rf, Rg and Rh are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, IS, keto, Nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkane Group), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02alkyl, -alkyl-OH, -alkyl-0-alkyl, -alkane NH2, alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl),-alkylS (0) (alkyl),-alkylSO2alkane Group, -N (H) C (0) NH2, -c (o) oh, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -c (o ) nh2, -C (0) N (H) (alkyl) and _C (0) N (alkyl) 2; or, Rf and Rg and the carbon atom to which they are connected Forms a three- to seven-membered ring selected from the group consisting of cycloalkynyl, ring-diluted and heterocyclic; or Rf forms a three- to seven-membered ring together with Rh and the nitrogen atom to which they are attached, selected from the group consisting of hetero Ring and heteroaryl; wherein each heterocycle and heteroaryl are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, decanyl, cyano, iS, Keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), · NΗ2, -N (H ) (Alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl), -S (0) (alkyl), -alkyl-OH, -alkyl-0- Alkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylS (alkyl), -alkylS (0) (alkyl), -alkylS02 alkyl, -alkane N (alkyl) 2, -N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -C (O) alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, and aryl , Aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methyl 89166 -83- 200427678 Alkyl, alkyl, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, nitroalkyl, I ^ RbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC ( 0) alkyl, Ras-, RaS〇2-, RaS alkyl_, Ra (0) S alkyl-, i ^ so alkyl ... Ra〇c (0) _, Ra〇c alkyl_, RaC (0) ·, RaC (0) alkyl-, wherein each Rk is substituted with 0, 丨, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, and _ Group, cyano, nitro, i-alkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl, (alkyl) ( 0Rc), _ (alkylene-based XNReRd), -SK, Mingxinxin, -SCO) ^, -〇 心,,-(3 (0) 1 ^,-(:( 0) 01 ^ & -C (0 ) NReRd; and n is 0, 1, 2, 3, or 4. 45. The compound according to item 44 of the scope of patent application, or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, which is selected from the group consisting of: benzyl-3- (1,1-dioxide- 4Η-1,2,4-Benzothiine, each group) Ice hydroxy_ 2 (1Η &gt;pyridone; 1-fluorenyl-3- (1,1_dioxide-4Η · 1,2,4-benzene Pyridoxine_3 • yl) -4- mesityl_5, budimethyl-2 (1H) · pyridone; 1-fluorenyl (1,1-dioxide-4H-1,2,4 -Benzopyrimidine—3-based) ice # 里 基 _6_ methyl-5-phenyl-2 (1Η) -β is the same as ytterbium; -4Η-1,2,4-benzofuran dioxide Dihuo_3_yl) -4- # Chengyl-5,6-dimethyl small (3-methylbutyl) _2 (1Η) _ρ than dianone; 3_ (1,1_ dioxide-4Η- 1,2,4-benzopyrimidine groups) small (2-ethylbutyl) ceyl-5,6-dimethyl-2 (111) -exo 1: ketone; 1-benzyl -3- (1,1-dioxo-4Η-1,2,4-benzothiadioxoyl) Dongjiji each 89166 -84- 200427678 phenylpyridone; 1,5 · dibenzyl- 3- (1,1-Dioxo-4Η-1,2,4-benzopyrene-3-yl) -4-¾yl-6 · methyl-2 (1H) -pyridone; 3- ( 1,1_dioxide · 4Η-1,2,4-benzo Nigano-3-yl) small (2-ethylbutyl) -4-yl-6-methyl-5-phenyl-2 (1Η) -ρ is the same as that of Yodo; 1-butyl-3- (1,1-Dioxide-4Η1,2,4-benzopyridine-3-yl) -2 (1Η) -pyridone; Ν- {3_ [4-hydroxy small (3-methylbutyl) 2-keto-1,2 · dihydropyridine, hydrazone, 1-φdioxide-4, -1,2,4-benzopyridine-7-yl} methanesulfonamide; ¾l-2-fluorenyl-1,2_dihydrov than yodo-3-yl) -1,1-dioxide_ 4H-1,2,4-benzo farinol-7-yl] methylbenzene Chloramine; N- [3- (4 • hydroxy-2_one-1,2-dihydro-3-pyridyl) -1,1_dioxide_4H-1,2,4-benzopyrimidine Ergen-7-yl] methanesulfonamide; N- [3_ (4-Hydroxyisopentyl-5,6-dimethyl-2-keto_1,2_dihydropyridyl) -1 &gt; Dioxide_4H-1,2,4-benzopyrimidin-7-yl] methanesulfonamide; 3- [3- (4-hydroxy small isoamyl_2_one group_: ι, 2 -Dihydro_3_pyridyl) -U_dioxination-4H_1,2,4'benzopyrimidine_7_yl;] Benzodiazepine dicarboxylic acid benzyl 2,2 • dioxide物 ； N- [3_ (4-Hydroxyisoisopentyl_2_one group + 2-dihydro_3_pyridyl-dioxide-4Η_1,2,4 · benzothiadinyl_7-yl] Hydrazine; Ν _ {{1- (cyclobutylmethyl) -4-hydroxyaspartyl_1,2_dihydropyridyl] -U-dioxide 4H_1,2,4-benzopyrimidin-7_yl } Methanesulfonamide; N- {3_0 bromo-1- (cyclobutylmethyl) -4-hydroxy-2-one-1-1,2-dihydro_3_pyranyl H, 1 · dioxide-4H -1,2,4-benzopyridine_7-yl} methanesulfonamide; and 89166 -85- 200427678 N- [3- (4-% yl_ι_isopentyl-2-one- The 5-vinyl-1,2-dihydrogen each has a ratio of 17H-dodecyl monoxide-4H-1,2,4-benzoporylene di-7-yl] methanepic acid amine. 46. The compound according to item 1 of the scope of patent application, wherein R2 forms a cycloalkyl ring together with R3 and the carbon atom to which they are attached. 47. The compound according to item 1 of the scope of patent application, wherein the five- or six-membered ring is formed together with R3 and the carbon atom to which they are attached, and is selected from the group consisting of p-sphenyl, succinyl, and p-bylyl , Mitoki, Saki Junki, P Setoki, I $. Soryl, isolithyl, ρ-bispyridyl, erythroyl, trisynyl, far ditolyl, tetrazolyl, phenyl, pyridyl, daphnyl, and pyrimidinyl; where the ring is as appropriate Substituted by (R6) m; wherein R6 is independently selected from the group consisting of alkynyl, fluorenyl, alkynyl, halo, cyano, nitro, iialkyl, alkoxy, aryl, hetero Aryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl, _ (alkyl) (0Rk),-(k group) (NRaRb), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), _C (〇) Ra, _C (0) 0Ra, and _C (0) NRaRb; where each R6 is independently 〇, 1, 2, or 3 Substituent substitution, the substituent is independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, haloalkyl, cyano, nitro, -〇Ra, -NRaRb, -SRa, -SORa, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; and 111 are 0, 1, 2, 3, or 4. 48. The compound according to item 47 of the application, wherein R4 is a hydroxyl group. 49. The compound according to item 1 of the scope of patent application, wherein R4 is hydroxyl, _yl, -NH2, -NH (alkyl), -N (alkyl) 2, -N (H) NH2, -N3, _N ( H) (hydroxyalkyl) or! ^^ ·. 50. The compound according to item 1 of the scope of patent application, wherein A is a bicyclic ring, 89166-86-200427678 is selected from the group consisting of heterocyclic and heteroaryl. 51_ The compound according to item 50 of the scope of patent application, wherein A is selected from the group consisting of a benzoyl group, an S group, an isopropyl group, a benzoanyl group, a benzo farphenyl group, an upper group, and a benzene group. Benzimidyl stilbyl, benzoxanthenyl, benzoisoxazolyl, benzoisoxazolyl, benzopyridyl, benzo 4-diyl, 4-linyl, isophenyl L "Linji" sets of lymphyl, pyridinyl, τφlyl, and nomidyl. 52. The compound according to item 1 of the patent application, which has the formula (vm) (VIII) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: X is NH r N (alkyl), 0 or S; R1 is selected from the group consisting of hydrogen, alkenyl, Oxyalkyl, oxycarbonylalkyl, alkyl, thioalkyl, thioalkyl, thioalkyl, alkylsulfoalkyl, alkynyl, aryl, aromatic Alkenyl, aralkyl, arylthioalkyl, arylalkyl, alkynyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkane (Yl) fluorenyl, (cycloalkyl) alkenyl, methylalkenyl, alkoxyalkyl, alkynyl, heteroaryl, heteroarylfluorenyl, heteroaryl, heteroarylsulfonyl Alkyl, heterocyclic, hetero 89166 200427678 cycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, I ^ RbN-, RaRbN alkyl-, RaRbNCCO) alkyl-, RaRbNC (0) 0 alkane -, R ^ RbNCCCONRe alkyl, RfRgC = N- and RkO-, where R1 is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, ketone Radical, halo, cyano, nitro, self-alkyl, self-alkoxy, aryl, Aryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORe),-(alkylXNRe Re), -S &amp;, -S (0) Re , -S (0) 2 Re,-, -N (Re) (Re), -C (0) Rc, -0 (0) 01 ^ _C (0) NRc Re; _ R2 and R3 are independently selected from the group including Hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, aralkyl, heteroaryl, heterocyclic, heteroaralkyl, cyano, halo, -N (Ra) (Rb), RaRbNC (0) _, -SRa, 4 (0) 1 ^, -S (0) 2Ra and ΐς〇Χ〇)-; where R2 and R3 are independently replaced by 0, 1, 2 or 3 Substituent, the substituent is independently selected from Ra, alkyl, dilute, alkynyl, keto, alkynyl, cyano, nitro, fluorenyl,-(alkyl) (〇Rk),-(alkyl ) (Muscle ^), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra &amp;- C (0) NRaRb; ^ Alternatively, R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl, and heterocycle, wherein the aromatic Group, cycloalkyl group, heteroaryl group and heterocyclic ring are optionally substituted with (R6) m; R4 is selected from the group consisting of alkoxy and arylalkoxy Aryloxy, halo, hydroxy, RaRbN-, N3-, ReS_, where R4 is independently substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of cyano, nitro, cyano, -OH, -NH2 and -COOH; R5 is independently selected from each group including fluorenyl, alkoxy, alkyl 89166 -88- 200427678, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, Azidealkyl, formamyl, radical, alkyl, halocarbon, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyanoalkane Group, nitro, I ^ RbN ·, RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, R ^ COSNCRf)-, RaS02N (Rf)-, Ra (0) SN (Rf) alkyl-, ^ 802 wind heart) alkyl-, 1 ^ 111 ^ 302; ^ (1 ^)-, 1 ^ 111 ^ 302 wind 1 ^) alkyl-, RaRbNC (0 )-, Rk0C (0)-, Rk0C (0) alkyl_, RkOalkyl-, RaRbNS02_, RaRbNS02alkyl-, (Rb0) (Ra) P (0) 0-, and -ORk, where each R5 is independent Substituted by 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, block, keto, functional, cyano, nitro, halo, haloalkoxy, aromatic Heteroaryl , Heterocycle, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (OR〇),-(alkylXNR ^ Rd), -SRe, -S (0) Re, -S (0) 2Re, -ORe'-NdXRd), π (0) Γ ^ ,; R6 is independently selected from each occurrence including alkyl, alkenyl, alkynyl, halo, cyano, nitro , _Alkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkyl) (NRaRb ), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N ^ XRb), -C (0) Ra, -C (0) 0Ra &amp; -C (0) NRaRb; where Each R6 is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, haloalkyl, cyano, nitro, -ORa , -NRaRb, -SRa, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; R7 is independently selected from each occurrence including alkenyl, alkoxy, Fluorenyl, alkynyl, aryl, aralkyl, arylcarbonyl, aryloxy, azidealkyl, methylamidino, alkynyl, haloalkyl, hydrazine, heteroaryl, heteroarylalkane 89166 -89- 200427678 group, heterocyclic, heterocycloalkyl, hydroxyalkyl Cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC (0)-, RaS-, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, Ra (〇) SN (Rf)-, RaS02N (Rf)-, R ^ COSisKRf) alkyl-, heart 302 wind 11 £) alkyl-, 1 ^ 111 ^ 802 ^ [(heart)-, ^ 111 ^ 802 wind 1 ^) Alkyl-, RaRbNC (0)-, Rk0C (0) _, Rk0C (0) alkyl-, RkO alkyl ·, RaRbNS02-, R ^ RbNSC ^ alkyl-, (Rb0) (Ra) P (0) 0- and -ORk, wherein each R7 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, block, keto, halo, cyano, and nitro , Haloalkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇R〇),-( Alkyl XNReRa), -SRe, -S (0) Re, -S (0) 2Rc, -〇Re, -N (Re) (Rd), -C (0) Re, -C (0) 0Re, and- C (0) NReRd; each of which is independently selected from hydrogen, alkenyl, alkyl, alkylthioalkyl, aryl, arylfluorenyl, aralkyl, cyanoalkyl, Cycloalanyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, methylaminoalkyl, alkyl, heteroaryl, heteroaryl Alkenyl, heteroaralkyl, heterocyclic, heterocyclic fluorenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, RordN_, RkO-, RkO alkyl, RcR ^ N alkyl-, ReRaNCXO) alkyl-, ROS02-, ReS02 alkyl-, &amp; (: (0)-, ReC (O) alkyl_, I ^ OCCO)-, Rc0C (0) alkyl-, ReRdN Alkyl C (O)-, ReRaNCCO) ·, ReRdNC (0) 0 Alkyl-, RcRdNC (0) N (Re) alkyl-, where Ra and Rb are substituted with 0, 1 or 2 substituents The group is selected from the group consisting of alkyl, alkenyl, alkynyl, keto, alkynyl, cyano, nitro, s-alkyl, ii-oxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaryl Alkyl, alkoxyalkoxyalkyl,-(alkyl XORJ,-(alkyl XNReRd), -SRe, -S (0) Re, _3 (0) 2, -OK, 89166 -90- 200427678- N (RJ (Rd), -C (0) Rc, -CCOPReK-CCCONReRd; or Ra forms a three- to six-membered ring together with Rb and the nitrogen atom to which they are attached, selected from the group consisting of heteroaryl and heterocyclic rings Wherein the heteroaryl and heterocyclic ring are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, block, keto, fluorenyl, cyano, nitro, _ Burning base, Haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORc),-(alkyl) (^ ¾) , -AlkylSC ^ NReRd, -alkylCCC ^ NI ^ Rd, -SRe, -S (0) Re, -SCC ^ I ^,-, -N%)%), -C (0) Rc, ( (0) 01 ^ and -⑽ ~~; Heart and Rd are independently selected at each place where they are selected from the group consisting of hydrogen, -NRfRh, -〇Rf, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, loamyl, cycloalanyl: aryl, aryl, aryl , Self-alkyl, heteroaryl, heteroarylalkyl, heterocyclic, and heterocycloalkyl; each of which is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group including alkyl , Fluorenyl, alkynyl, keto, -yl, cyano, nitro, aralkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxy Alkoxyalkyl, (alkyl) (0Rf), _ (alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -0Rf, -N (Rf) (Rh) , -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N (Re) -C (0) NRfRh, _alkylN (Re) C (0) 0Rf, -alkyl NCRJSC ^ NRfRh, and -alkylN (Re) C (0) NRfRh; or, connected to 1 ^ and their The nitrogen atoms together form a three- to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic rings, wherein heteroaryl and heterocyclic ring are only 89166-91-200427678 substituted by 0, 1, 2 or 3 substituents, The substituent is independently selected from the group consisting of alkyl, alkenyl, decyl, keto, alkynyl, cyano, nitro, alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, hetero Aralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf &amp; -C (0) NRfRh; Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh are independently selected from each group including hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, Heterocycloalkyl, heteroaryl, and heteroaryl; each of Rf, Rg, and Rh. Is independently substituted with 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, and alkynyl , Base, halo, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2 , -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl, -alkyl-OH, -alkyl -Οalkyl, -alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl), -alkylS (0) (alkane Group), -alkylS02alkyl, -N (H) C (0) NH2, -c (o) oh ·, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -c (o) nh2, -C (0) N (H) (alkyl) and _C (0) N (alkyl) 2; or, Rf and Rg and the carbon to which they are attached Atoms together form a three- to seven-membered ring, selected from the group consisting of cycloalkyl, cyclofluorenyl, and heterocyclic rings; or &amp; together with Rh and the nitrogen atom to which they are attached, form a three- to seven-membered ring, selected Includes heterocycles and heteroaryl groups; wherein each heterocycle and heteroaryl system is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, cyano, Halo, keto, nitro, aryl, 89166 -92- 200427678 aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, hetero Aryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkane Group), -S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, · alkylNH2, -alkylN (H) (alkyl), -alkylS ( Alkyl), -alkyl S (0) (alkyl), -alkyl S02 alkyl, -alkyl N (alkyl) 2, -N (H) C (0) NH2, -C (0) 0H , -C (0) 0 (alkyl), -c (0) alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen, fluorenyl, alkyl, aryl, aryl, cyano-alkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, Cycloalkylalkyl, methylaminoalkyl, iSalkyl, heteroaryl, heteroarylalkyl, heterocyclic, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC ( 0)-, RaRbNCCO) alkyl, RaS-, RaSCO)-, RaS02-, RaS alkyl-, Ra (〇) S alkyl-, RaS02 alkyl-, Ra0C (0)-, Ra0C (0) alkyl -, RaC (0)-, RaC (0) alkyl, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, decyl, and keto , 1¾ group, cyano, nitro, haloalkane , Haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl-, heteroaryl, alkynyl,-(alkyl) (〇R〇),-(alkylXNReRd ), -S &amp;, 4 (0) 1 ^, 4 (0) 2 &amp;, -01, -N (Rc) (Rd), -CXO)! ^, -CCCOOI ^ K-CCCONI ^ Rd; m is 0 , 1, 2, 3, or 4; and η is 0, 1, or 2. 53. The compound according to item 52 of the scope of patent application, wherein R2 and R3 together with the carbon atom to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl, and heterocyclic Where the aryl, cycloalkyl, heteroaryl 89166-93-200427678 group and the heterocyclic system are optionally substituted with (R6) m. 54. The compound according to item 53 of the scope of patent application, wherein r2 forms a five- or six-membered ring together with R3 and the carbon atom to which they are attached, selected from the group consisting of benzyl, pyrimidinyl, pyrimidinyl, Pyrazolyl, cyclopentyl, cyclohexyl and pyrenyl. 55. The compound according to item% of the scope of application, wherein r4 is a light group. 56. The compound according to item 55 of the scope of patent application, or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, which is selected from the group consisting of: M1,1 · Dioxide-4H- [1, 3] oxazolo [5,4-h] [l, 2,4] benzopyrene); 4-hydroxy small (isobutylamino) quinoline d (lH) -one; 3_1 &gt; (Chloromethyl> 1,1_dioxide_4H- [1,3] oxazolo [5,4-h] [l, 2,4] benzopyrimidin-3-yl] _4_ Alkyl small (isobutylamino) & quinoline_2 (1H) -one; 3- {3- [4-hydroxy-1- (isobutylamino) -2-one-1,2- Dihydro-Fenglinjiji] -1, Bu Dioxide · 4Η- [1,3γ] [5,4_h] [l, 2,4] Benzobi__8-yl} propionic acid; 3- ( 8-{[(2_Aminoethyl) amino] methylbuil, ι_dioxide_4H_ [1,3] indazolo [5,4-1 ^ 1,2,4] Cedi-2-enyl-1- (isobutylmonthlyl). Quirin-2 (1Η &gt;one; '{3- [4-hydroxy small (isobutylamino) -2-one -1,2-dihydroquinoline, each group H, l-dioxide-4 Η · [1,3] oxazolo [5,4-h] [l, 2,4] benzopyrimine-8 -Yl} methyl acetate; 4-hydroxy_3- (8-{[(3R) -3-hydroxytetrahydropyrrole small group] methyl}-甲基, ι_ 二-4H- [1,3] pyrazolo [5,4Hepta] [1,2,4] benzopyridine-3-yl) _1- (isobutylamino) Junplin-2 ( 1 H) -Identical; 3- [1,1-Dioxide_8- (pyridine-1_ylmethyl) -4 {-[1,3] oxazolo [5,4-h] [l, 2,4] ¥ Melazone-I-π well-based] -1- (Xing butylamino) -2-fluorenyl-1,2-diazepin-4-ol 89166 -94- 200427678 compound; 3- [1,1_Dioxide (tetrahydropyrrole small methyl) -4） _ [1,3] oxazolo [5,4-h] [1,2,4] benzopyrimidine · 3 -Yl] cylamyl-1- (isobutylamino)> quinoline_2 (ih) -fluorene; 3- [8- (3-aminophenyl) -i, i-dioxide-4Eμ [ 1,3] oxazo [5,4_h] [1,2,4 ^ pyrimidiphine · 3_yl] _4_acyl_1_ (isobutylamino &gt; quinoline_2 (ih) _ Ketones; 3- [8- (aminomethyl) -1,1-dioxide 4H- [1,3] oxazo [5,4-h] [l, 2,4] benzopyrene [Iso] Iceyl is small (isobutylamino group) quinolin-2 (1H) _one; 4-hydroxy-3 · [8- (hydroxymethyl) _1,1_dioxide_4_ · [1, 3], azo [5,4-h] [l, 2,4] φ benzopyrimidin-3-yl &gt; 1- (isobutylamino) antholin_2 (m) _one; 3- {8-[(butylamino) methyl] -i, i-dioxide 4H- [1,3] 唠Oxazo [5,4 hepta] [1,2,4] benzopyrimidin-3-yl} -4-hydroxy-1- (isobutylamino)> quinolin_2 (1H) _one; 3_ [9- (butylamino) -1,1-dioxide_4H, 8H- [1,4] Pyrene [2,3 七] [1,2,4] benzopyridine_3 · H-kisyl (isobutylamino) &gt; quinolin-2 (1H) -one; 4-hydroxy · 1- (3-methylbutyl) _3- (8-methyl-l, l- Dioxide_4H- [l, 3] p azolo [5,4-h] [l, 2,4] + Biyuan "Yihu-3-yl" -1,8-Siyoto-2 (1H ) · Different; 3- [1,1-Dioxide_8- (trifluoromethyl) -4,7-dihydroimidazo [4,5-h] [l, 2,4] benzopyrimidine Ergenyl] -4- meridyl-1- (3-methylbutyl) _i, 8_pyridine_2 (1H) _one; 4-hydroxy-3- (8-hydroxy_1,1-di Oxidation of 4,7 · dihydroimidazo [4,5-h] [l, 2,4] benzopyridin-3-yl) -1- (3-methylbutyl) -i, 8- Kyodo_2 (1H) _one; 4-hydroxy-1- (3-methylbutyl) each (8-methyl-1,1-dioxide 4,7-dihydroimidazo [4,5- 11] [1,2,4] benzoxenyl dioxan-3-yl) 4,8-peak lake-2 (111) _one; 3- [1,1_dioxo (pentafluoroethyl)- 4,7-dihydroimidazo [4,5-h] [l, 2,4] benzothiacene-3_yl] -4- # yl-1_ (3-methylbutyl) _ι, 8 -dumb Pyridin_2 (1H) _one; 3- [8- (chloromethyl) -1,1-dioxide_4,7-dihydroimidazo [4,5-h] [l, 2,4] Benzene 89166 -95- 200427678 Pyridoxan-3-yl] · 4-hydroxy small (3-methylbutyl) -1,8-pyridin-2 (1H) -one; {3- [4-hydroxy -1- (3-methylbutyl) -2-one-1,2-dihydro-1,8-pyridin-3-yl] -U-dioxide-4 / 7-dihydroimidazo [ 4,5-h] [l, 2,4] benzopyridine_8-yl} acetonitrile; {3- [4-hydroxy small (3-methylbutyl) -2-one-1,2 -Dihydro-1,8-pyridin-3-yl] -U-dioxide-4,7-dihydroimidazo [4,5-h] [l, 2,4] benzopyrimidine } Methyl acetate; 3- (9,9-dioxide_6H_ [1,2,5] thiadiazole [3,4-h] [l, 2,4] benzopyrimidin-7-yl) _4_Hydroxy (3-methylbutyl) _1,8_pyridin-2 (1H) _one; 3- (8-amino_1,1_dioxide_4,7_dihydroimidazolo [4,54l] [1,2,4] benzopyrimidin-3-yl) pyridine (3-methylbutyl) -1-, 8-piperidine-2 (1H) -one; and 4 -# 翌 基 各 [8-TENmethyl] _ι, ι_dioxide_4,9_dihydroimidazo [4,5_h] [l, 2,4] benzoP-Secondyl-3_yl] _1 · (3-methylbutyl) _1,8-4pyridin-2 (1Η) -one. 57. 58. 59. 60. Species N {3- [l- (j-butylamino) dongyiji_2_fluorenyl], 2_dichlorojunyl group] _u-dioxide_ 4H_1,2,4-benzopyrimidi-7-yl} methanesulfonamide, or a pharmaceutically acceptable salt, stereoisomer or tautomer thereof. A team of [(331-[(cyclopropylmethyl) amino] -4-hydroxy-2-keto-1,2-dihydroquinoline sulphone 1,1_ on oxidized-4H_pyrimidine Pyrene, 3,1,2,4] pyrimidine_7_yl) methyl] methanesulfonamide, or a pharmaceutically acceptable salt, stereoisomer or tautomer thereof. N &lt; 3_ {le [(Cyclopropylmethyl) amino] -4-quinyl_2-keto_1,2-dihydroquinolinyl M, 1-dioxide_4M, 2,4 _Benzothiazine_7_yl) methanesulfonamide, "musically acceptable salts, stereoisomers or tautomers. A team of {3_〇 (cyclobutylamino) ice warp Ketoketanyl], 2-difluorenyl; quinolinyl &gt; oxidized-4fluorene-1,254-benzofluorenediyl-7-yl} sulfonamide, or its pharmaceutically acceptable 89166-96- 200427678 Salts, stereoisomers or tautomers. 61.-a kind of N- {3-〇 (cyclobutylamino) ice hydroxyaspartone, 2-di 1 1 4 ~ quinolinyl] -di- Monol-4H-1,2,4-benzopyrimidine_7_yl} _N-methylsulfonamide, or a musically acceptable salt, stereoisomer or tautomer thereof. 62. A pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds according to any one of claims 1,57,58,59,60 and 61 of the scope of the patent application, and a pharmaceutically acceptable carrier. 63. The pharmaceutical composition according to item 62 of the application, further comprising one or more agents selected from the group including host immunity A modulator and a second antiviral agent or a combination thereof. 64. The pharmaceutical composition according to the item of the scope of the patent application, wherein the host immune preparation is selected from the group consisting of interferon_α, stimulated interferon_ ", Interferon M, interferon-7, cytokine, vaccines and vaccines containing antigens and adjuvants. 65. Root, the second pharmaceutical composition in the scope of patent application, wherein the second anti-A mother J line I inhibits HCV depletion by inhibiting the function of host cells associated with virus replication. Six roots, which are claimed as the pharmaceutical composition under the scope of patent No. 63, in which the second anti-mother M inhibits the replication of hcv by targeting the protein of the viral genome. 67. The pharmaceutical composition according to item 62 of the Shenyang Patent Fanyuan, further comprising a combination of μ medicaments or medicaments, which are used to treat or alleviate infections including liver cirrhosis and inflammation. 68. The pharmaceutical composition according to item 62 of the patent application scope, further comprising 89166 200427678 one or more agents for treating a disease caused by a hepatitis B (HBV) infection in a patient. 69. The pharmaceutical composition according to item 68 of the scope of the patent application, wherein the agent for treating the disease caused by hepatitis B (HBV) infection in the patient is selected from the group consisting of L-deoxythymidine, adefovir ), Lamivudine, and tenfovir. 70. The pharmaceutical composition according to item 62 of the scope of patent application, further comprising one or more agents for treating a disease caused by a human immunodeficiency virus (HIV) infection in a patient. 71. The pharmaceutical composition according to item 70 of the scope of the patent application, wherein the agent for treating the disease caused by human immunodeficiency virus (HIV) infection in the patient is selected from the group consisting of ritonavir, lopinabor ( (lopinavir), indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranab ( (tipranavir), TMC-114, fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, Tiannuo Tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125 , L-870812, S-1360, enfUvirtide (T-20) and T-1249 or any combination thereof. 72. A method for treating or preventing an infection caused by an RNA-containing virus, which includes administering to a patient in need of such treatment a patent according to the scope of the patent application 62, 63, 64, 65, 66, 67, 68, 69, The pharmaceutical composition according to any one of items 70 and 71. 73. A method for inhibiting the replication of an RNA-containing virus, which comprises contacting the virus with a therapeutically effective amount of a compound or a combination of compounds according to the scope of the patent claim No .... . 74 · —A method for treating or preventing an infection caused by an RNA-containing virus, and including: administering a therapeutically effective amount of a thank you combination to a patient in need of such treatment. ^ According to the method of patent No. 72, the virus containing the virus is hepatitis C virus. 76. The method according to item 75 of the scope of patent application ', which further comprises co-administering: or a plurality of steps selected from the group consisting of a host immunomodulator and a second antiviral agent &lt; musal agent or a combination thereof. 77. According to the 76th item of the patent scope of the patent application, the eighteen hundred king immunomodulator system k includes interferon chemical I, interferon 1, interferon j, interferon_7, cell viability, cymbaltin 4 anti-field and Vaccine containing EBARA and adjuvant. 78. According to the method of the scope of patent application No. 76, ../, T. a kind of anti-disease mother agent line, riyou inhibition and virus replication have duplication: ⑷ "... cell function is inhibited = according to patent scope 76 The method of item 2, wherein the second antiviral agent inhibits HCV replication by targeting the protein of the viral genome. 80. According to the scope of the patent application, the method of currency, further including co-administration of one, to treat or alleviate HCV Step S of the agent or combination of agents for symptoms of infection include liver cirrhosis and inflammation. According to the method of patent application scope 75V, the team further includes co-administration—or multiple treatments for the patient caused by hepatitis B (HBV) infection. Disease-99-200427678 Steps of Pharmacy. 82. The method according to item 81 of the scope of patent application, wherein the agent for treating the disease caused by hepatitis B (HBV) infection is selected from the group consisting of L-deoxythymidine Nuclear tritium, adefovir, lamivudine and tenfovir or any combination thereof. 83. According to the method in the scope of patent application No. 75, It further includes the step of co-administering one or more agents for treating a disease caused by human immunodeficiency virus (HIV) infection in a patient. 84. The method according to item 83 of the scope of the patent application, wherein the patient is treated for human immunity Agents for diseases caused by infectious virus (HIV) infections are selected from the group consisting of ritonavir, lopinavir, indinavir, nelfinavir, and shakun Saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudine ), Lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacaVir, yam Efavirenz, nevirapine, delavirdine, TMC-125, L-870812, S-1360, enfUvirtide (T-20) and T -1249 or any combination thereof. 85. A method for preparing a compound of formula (I) or In the form of a pharmaceutically acceptable salt, stereoisomers or tautomers thereof the cross method 89166-100- 200427678 where: A is a monocyclic or bicyclic ring, selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl, and heterocyclic ring; R1 is selected from the group consisting of hydrogen, dilute group, alkoxy group, Carboxycarbonyl, Carbo, Carbo, Carbothio, Carbothio, Carbooxy, Alkylsulfoalkyl, Alkyl, Aryl, Arylalkenyl, Aralkyl Base, arylthioalkyl, arylthioalkyl, alkynyl, cyanoalkyl, cyclofluorenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) fluorenyl, ( (Cycloalkyl) alkyl, methylamino, alkoxyalkyl, alkyl, heteroaryl, heteroarylalkenyl, heteroaryl tigeryl, heteroarylalkyl, heterocyclic , Heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RaRbNC (0) 0 alkyl-, RaRbNC (0) NRe Alkyl-, RfRgC = N- and RkO-, where R1 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, 1¾, Cyano, nitro, haloalkyl, halooxy, aryl, heteroaryl, heterocyclic, Alkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl X0RJ,-(alkyl XNReRe), -SRC, -S (0) Re, -S (0) 2Rc, -ORe,- NdXRe), -C (0) Rc, -C (0) 0Re and -C (0) NReRe; 89166 -101- 200427678 R2 and R3 are independently selected from the group consisting of hydrogen, fluorenyl, decyl, oxyalkyl, Carbooxycarbonyl, carbo, aryl, aralkyl, heteroaryl, heterocyclic, heteroaralkyl, cyano, halo, -N (Ra) (Rb), RaRbNC (〇) ..._ SRa, _S ( 0) Ra, -S (0) 2 Ra, and Ra C (O)-; wherein R2 and R3 are independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of Ra, situ, and 晞Group, decyl group, keto group, functional group, cyano group, nitro group, self-alkyl group, _ (alkyl group) (〇 &amp;),-(alkyl) (NRaRb), -SRa, -S (0) Ra , -S (0) 2Ra, _〇Rk ... N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra &amp; -C (0) NRaRb; φ Or, R2 and R3 and their The connected carbon atom ~ starts to form a five- or six-membered ring, selected from the group consisting of aryl, cycloalkyl, heteroaryl, and heterocyclic rings, wherein the aryl, cycloalkyl, heteroaryl, and heterocyclic ring are selected Case is substituted by (R6) m; R4 is selected from the group consisting of alkoxy, arylalkoxy, aromatic Group, _ group, # to group, Ra R * b N_, N3 _, S- 'wherein R4 is independently substituted by 0, [or 2 substituents, and the substituents are independently selected from the group consisting of phenyl, nitro, cyano Group, -OH, -NH2 &amp;-COOH; R5 is independently selected from each group including alkenyl, alkoxy, alkoxy @, decyl, aryl, aryl, arylcarbonyl, aryloxy , Azide alkyl, formate, alkyl, alkyl, sulfonated carbon, heteroaryl, heteroaryl, heterocyclic, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyano Alkyl, nitro, RaRbN-, Rac (0)-, RaS_, Ra (0) S-, Ra (0) 2S-, RaRbN alkyl-, RaCCOSNCRf)-, RaSC ^ T ^ Rf), Ra ( 0) SN (Rf) alkyl-, RaS02N (Rf) alkyl-, RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl-, RaRbNC (0) _, Rk0C (0)-, Rk0C (0) alkyl -, RkO alkyl-, RaRbNS02-, RaRbNS02 alkyl-, (Rb0) (Ra) P (0) 0- and -〇Rk, where each R5 is independent 89166 -102- 200427678 is 0, 1, 2 or 3 substituents are substituted, and the substituents are independently selected from the group consisting of alkyl, alkenyl, decyl, keto, i-, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, hetero Ring, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORc),-(alkylXNReRd), -S (0) Re, -S (0) 2Re, -ORc'-NdXRd), -C (0) 0Rc, and -CCC ^ NReRd; R6 is independently selected from each group including alkyl, alkenyl, block, halo, cyano, nitro, and alkane , I-alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkyl) (NRaRb),- SRa, -S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra ,; where each R6 is independently 0, 1, 2 or 3 Substituent substitution, the substituent is independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C (0) 0Ra, ((CONRaRb and -NC (0) Ra; Ra and Rb are independently selected at each place where they are selected from the group consisting of chlorine, alkenyl, alkyl, alkylthioalkyl, aryl, and aryl Fluorenyl, aralkyl, chloroalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formamylalkyl, ialkyl, heteroaryl , Heteroarylalkenyl, heteroaralkyl, hetero , Heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, I ^ RdN-, RkO-, RkO alkyl-, ReRdN alkyl-, ReRdNC (0) alkyl, RcS02-, 11 ^ 02 alkyl, ReC (O)-, ReC (O) alkyl-, ReOC (0)-, ReOC (0) alkyl-, I ^ RdN alkylC (O)-, ReRdNQO )-, ReRdNC (0) 0 alkyl ·, ReRdNC (0) N (Re) alkyl-, where Ra and Rb are substituted with 0, 1 or 2 substituents, and the substituents are selected from the group consisting of alkyl, alkenyl , Alkynyl, keto, 1S group, cyano, nitro, oxaalkyl, 1S alkoxy, aryl, hetero 89166 -103- 200427678 aryl, heterocyclic, aralkyl, heteroaralkyl, alkyl Oxyalkoxyalkyl, _ (alkyl) (0Rc), _ (alkylXNReRd), -SRe, -S (0) Rc, _S (0) 2Rc, -0 heart, -N (IQ (Rd) ,-(:( 0) ¾, -C (0) 0Rc and -C (0) NRcRd; or 'Ra together with Rb and the nitrogen atom to which they are connected forms a three- to six-membered ring' selected from the group consisting of hetero Aryl and heterocyclic, wherein heteroaryl and heterocyclic ring are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, alkynyl, cyano Base, nitro ,! I alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkylXORJ,-(alkylXNI ^ Rd) , -Alkyl SC ^ NReRd, -alkyl cCC ^ NReRd, -SRc, -S (0) Re, -S (0) 2Re, -ORc, Dawn, -CCO)! ^, -C (0) 0Rc &amp; -C (0) NRcRd; R0 and Rd are independently selected at each occurrence from hydrogen, -NRfRh, -0Rf, -C0 (Rf), -SRf, -S0Rf, -S02Rf, -C (0) NRfRh , -S02NRfRh, -C (0) ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, alkenyl, peralkylenyl, aryl, aralkyl, alkynyl, Heteroaryl, heteroaralkyl, heterocycle, and heterocycloalkyl; each of 1 ^ and 11 (1 is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group including alkyl, 晞Alkyl, decyl, keto, i-based, cyano, nitro, alkanoyl, halooxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxy Alkyl,-(alkyl) (0Rf),-(alkyl) (NRfRh), -SRf, -S (0) Rf &gt; -S (0) 2Rf ^ -0Rf &gt; -N (Rf) (Rh ) ^ -C (0) Rf ^ -C (0) 0Rf--C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, _N ( Re) S02NRfRh, -N (Re) -C (0) NRfRh, -alkylN (Re) C (0) 0ff, -alkylN (Re) S02NRfRh and -alkylN (Re) C (0) NRfRh 89166 -104- 200427678 Alternatively, the heart and! ^ And the nitrogen atom to which they are connected form a three- to six-membered ring, selected from the group consisting of heteroaryl and heterocyclic rings, wherein heteroaryl and heterocyclic rings are independently 0, 1, 2 or 3 substituents. The substituents are independently selected from the group consisting of alkyl, fluorenyl, block, keto, i, cyano, nitro, alkanoyl, haloalkoxy, aryl , Heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0 ) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf &amp; -C (0) NRfRh; Re is selected from the group consisting of hydrogen, Fluorenyl, alkyl, and cycloalkyl; Rf, Rg, and Rh are independently selected from each occurrence including hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, and cycloalkylalkyl , Cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and Rh is independently substituted by 0, 1, 2, or 3 substituents, Substituent independent Including alkynyl, fluorenyl, alkynyl: yl, cyano, alkynyl, keto, nitro, aryl, aryl, alkynyl, cycloalkenyl, heterocyclic, heteroaryl, heteroaralkyl , -OH, -0 (alkyl), · N2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (0) (alkyl), -S02 Alkyl, -alkyl-OH, -alkane-O-alkyl; -alkylNH2, -alkylN (H) (alkyl), alkylN (alkyl) 2, -alkylS ( Alkyl), -alkyl S (0) (alkyl), -alkyl S02 alkyl, -N (H) C (0) NH2, -c (o) oh, -c (o) o (alkyl ), -C (o) alkyl, -c (o) nh2, -c (o) nh2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; Alternatively, Rf forms a three- to seven-membered ring together with Rg and the carbon atom to which they are attached, and is selected from the group consisting of cycloalkyl, dicyclo and heterocycle; or, Rf and Rh and the nitrogen atom to which they are attached Together form a three- to seven-membered ring, selected from the group consisting of heterocycles and heteroaryl groups; wherein each heterocycle and heteroaryl system is 89166-105-200427678 independently substituted by 0, 1, 2 or 3 substituents Independently selected from the group consisting of alkynyl, alkenyl, decyl, cyano, alkynyl, S, isopropyl, nitro, aryl, aryl Group, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), · N2, -N (H) (alkyl), -N (alkyl ) 2, -S (alkyl), -S (alkyl) '-S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl, -alkylNH2, -alkyl N (H) (alkyl), -alkylS (alkyl), -alkylS (0) (alkyl), -alkylS02 alkyl, alkyl N (alkyl) 2, -N ( H) C (0) NH2, -C (0) 0H, -C (0) 0 (alkyl), -C (O) alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl) and -C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aralkyl, cyanoalkyl, Cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, methylalkyl, haloalkyl, heteroaryl, heteroaralkyl, heterocycle, heterocycloalkyl, nitroalkane Group, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, RaS-, RaS (0) _, RaS02-, RaS alkyl-, Ra (0) S alkyl- , RaS〇2 alkyl-, RaOC (0)-, Ra0C (0) alkyl-, RaC (0)-, RaC (0) alkyl, wherein each Rk is 0, 1, 2 or 3 Substituents, ® substituents are independently selected from the group consisting of alkyl, fluorenyl, and alkyne Keto, keto, 1S, cyano, nitro, || alkyl, alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl ,-(Alkyl) (〇R〇),-(alkylXNRcRd), -SRe, -S (0) Re, name (0) 2, -ORe, -NdXRd),-, -C (0) 0Re and -C (0) NReRd; m is 0, 1, 2, 3, or 4; and η is 0, 1, 2, 3, or 4; with the proviso that when A is a monocyclic ring other than the following Ring 89166 -106- 200427678 and R4 is alkoxy, aryloxy, hydroxy or R ^ S-, and R5 is hydrogen, alkenyl, alkoxy, alkynyl, decyl, aryl, aryl, heteroaryl, heterocyclic alkynyl , Cycloalkyl, cyano, nitro, 1H) ^,: ^ (:( 0)-, ^ 3-, 1 (0) 8 ·, Ra (0) 2S-, RaS02N (Rf)-, RaRbNC (0)-, Rk0C (0)-, RaRbNS02-, or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocycloalkane Base, _SRa, 4 (0) ¾, -S (0) 2Ra, -ORk, -N (Ra) (Rb), _C (0) Ra, &lt; (0) 0 ^, and -C (0) NRaRb , Then R1 is not hydrogen, fluorenyl, alkyl, alkyl, aryl, arylmethyl, aryl, cycloalkyl, (cycloalkyl) alkyl, (cycloalkyl) alkyl, heteroaryl Group, heteroarylalkenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl; and with the additional condition that when A is And R4 is hydroxyl or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo, or -ORk, and R6 is hydrogen, alkyl, fluorenyl, alkyl, halo, cyano, nitro, aromatic Group, heteroaryl, heterocycloalkyl, -SRa, 4 (0) 1, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0 ) 0Ra &amp; _C (0) NRaRb, then R1 is not hydrogen, fluorenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, ( Cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl; including: 包括 compound of formula (26) 89166-107- 200427678 (26) contact with carbon dihalide and methylating agent in the presence of a base to provide a compound of formula (27) And (b) contacting a compound of formula (27) with a compound of formula (13) (R5) n s〇2nh2 NH 2 (13). 86. A method for preparing a compound of formula (I) or a pharmaceutically acceptable salt form thereof, the mutual or physical structure of the compound Γ (R 89166 108- 200427678 A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cyclofluorenyl, heteroaryl and heterocyclic ring; R1 is selected from the group consisting of hydrogen, alkenyl, Oxyalkyl, oxyalkyl, thio, thio, thio, thio, thio, thio, sulfonyl, alkyl, sulfonyl, alkynyl, aryl, aromatic Fluorenyl, aralkyl, arylthioalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl ) Fluorenyl, (cycloalkyl) alkyl, methylaminoalkyl, self-alkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonyl Alkyl, heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkyl, nitroalkyl, RaRbN alkyl-, RaRbNC (O) alkyl-, RaRbNC (0) 0 alkyl-, RaRbNCCCONI ^ Alkyl-, RfRgC = N_ and RkO-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, i, Cyano, nitro, self-alkyl, i-alkoxy, aryl, heteroaryl, heterocyclic Aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (〇Rc),-(alkylXNReRe), -SRe, -SCO)! ^, Name (0) 2, -OF ^, -NAXReO, -C (0) Re, -QPPR ^ -CXC ^ NReRe; R2 and R3 are independently selected from the group consisting of hydrogen, fluorenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, Aryl, aralkyl, heteroaryl, heterocyclic, heteroaralkyl, cyano, _, -N (Ra) (Rb), RaRbNC (0)-, -SRa, -S (0) Ra, -S (0) 2Ra and RaC (O)-; wherein R2 and R3 are independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of Ra, alkyl, fluorenyl, decyl, and ketone Radical, 1S radical, cyano, nitro, haloalkyl,-(alkyl) (ORk),-(alkyl) (NRaRb), -SRa, -S (0) Ra, 4 (0) 2, -ORk, -N (Ra) (Rb) 89166 -109- 200427678, -C (0) Ra, -C (0) 0Ra and _C (0) NRaRb; or, R2 and R3 and the carbon to which they are connected The atoms together form a five- or six-membered ring, selected from the group consisting of aryl, cycloalkyl, heteroaryl, and heterocyclic rings, wherein the aryl, cycloalkyl, heteroaryl, and heterocyclic ring are optionally (R6) m substituted; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, , Hydroxyl, RaRbN-, N3-, ReS-, where R4 is independently substituted with 0, 1 or 2 substituents, and the substituents are independently selected from the group consisting of li, nitro, cyano, -OH, -NH2 and -COOH ; R5 is independently selected from each group including alkenyl, alkoxy, alkyl, alkyl, aryl, aryl, arylcarbonyl, aryloxy, azido, and methyl , Radical, alkyl, halocarbon, heteroaryl, heteroaryl, heterocycle, heterocycloalkyl, hydroxyalkyl, cycloalkyl, cyano, cyano, nitro, RaRbN-, Rac (0)-, RaS-, Ra (0) s-, Ra (0) 2s-, RaRbN alkyl-, Ra (〇) SN (Rf)-, RaS02N (Rf)-, Ra (0) SN ( Rf) alkyl-, RaS02N (Rf) alkyl-, RaRbNS02N (Rf)-, RaRbNS02N (Rf) alkyl-, RaRbNCCO)-, Rk0C (0)-, Rk0C (0) alkyl-, RkO alkyl- , RaRbNS02-, RaRbNSO * 2 alkyl-, (Rb0) (Ra) P (0) 0 ·, and -ORk, wherein each R5 is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from Including alkyl, alkenyl, block, keto, 1¾, cyano, nitro, alkynyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, Alkoxy Alkoxyalkyl, (alkyl) (OR〇),-(alkyl XNReRd), -SRC, -S (0) Re, -8 (0) 2-core, -0 &amp; iN ^ XRd) '-QCORe R6 is independently selected at each occurrence from the group including alkyl, fluorenyl, alkynyl, halo, cyano, nitro, haloalkyl, lialkoxy, aryl, heteroaryl 89166 -110- 200427678, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (〇Rk),-(alkylXNi ^ Rb), -SRa, 4 (0) 1 ^, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, _C (0) 0Ra, and -C (0) NRaRb; each R6 is independently 0, 1, 2, or 3 Each substituent is substituted, and the substituent is independently selected from the group including alkyl, fluorenyl, alkynyl, keto, halo, haloalkyl, cyano, nitro, -〇Ra, -NRaRb, -SRa, -SORa,- S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; Ra and Rb are each independently selected from the group consisting of hydrogen, dilute group, alkyl group, alkylthioalkyl group, Aryl, arylalkenyl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl Alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, Heterocyclic, heterocycloalkenyl, heterocycloalkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, Rk0-, Rk0 alkyl-, alkyl-, ReRdNC (0) alkyl, RcSOy, E ^ 02 Alkyl-, Heart (3 (0)-, &amp; (: (0) alkyl-, Rc0C (0) _, Reoc (0) alkyl-, RcI ^ N alkyl C (0)- , I ^ RdNCCO)-, ReRdNC ^ Op alkyl-, RcRdNCCCONd) alkyl. Its center and Rb are substituted with 0, 1 or 2 substituents. The substituents are selected from the group consisting of alkyl, fluorenyl, decyl, Hydrazone, halo, cyano, nitro, self-alkyl, self-alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,- (Alkyl XORe),-(alkyl XNReRd), -S (0) Rc, -S (0) 2Rc, -ORe, -N ^ XRd), &lt; (0 凡, ^: (0) 01 ^ And _0 (0) 肌 ^; or 1 ^ forms a three- to six-membered ring with the heart and the nitrogen atom to which they are attached, and is selected from the group consisting of heteroaryl and heterocyclic ring, wherein heteroaryl and heterocyclic ring Is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, self-based, cyano, nitro, _alkyl, 89166 -111- 200427678 haloalkoxy, aryl, hetero Aryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORc),-(alkylXNI ^ Rd), -alkylSC ^ NReRd, _alkane Base CCCONReRd, _SRe, -S (0) Re, -S (0) 2Re, -ORe, -N ^ XRd), -0: 0) &amp;, -C (0) 0Re and -CCCONReRd; R0 and Rd Is independently selected at each occurrence including hydrogen, -NRfRh, -ORf, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) ORF, Fluorenyl, alkyl, alkyl, cycloalkyl, cycloalkyl, cycloalkenyl, cycloalkyl, aryl, aralkyl, haloalkyl, heteroaryl, heteroaralkyl, heteroalkyl Rings and heterocycloalkyls; each with its own heart! ^ Is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, fluorenyl, cyano, nitro, || alkyl, haloalkyl Oxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORf), _ (alkyl) (NRfRh), -SRf , -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) ORf,-^ [(RJSC ^ NRfRh, -N (Re) -C (0) NRfRh, _alkylN (Re) C (0) ) 0Rf, -alkyl NCRJSC ^ NRfRh and -alkyl N ^ KXC ^ NRfRh; or Rc forms a three- to six-membered ring together with Rd and the nitrogen atom to which they are attached, selected from the group consisting of heteroaryl and hetero Ring, wherein heteroaryl and heterocyclic ring are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, decanyl, keto, -yl, cyano, nitro , _Alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl, _ (alkyl) (ORf),-(alkyl ) (NRfRh), -SRf, _S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf And -C (0) NRfRh; 89166-112-200427678 Re is selected from the group consisting of hydrogen, fluorenyl, alkyl, and cycloalkyl; Rf, Rg, and Rh are independently selected from each group including hydrogen, alkyl, Alkenyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, cyclofluorenyl, cycloalkenylalkyl, heterocyclic, heterocycloalkyl, heteroaryl, and heteroaralkyl; each Rf , Rg, and Rh are independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, alkynyl, cyano, 1¾, keto, nitro, aryl, and aryl Alkyl, cycloalkyl, cyclofluorenyl, heterocyclic, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkane Group) 2, -S (alkyl), -S (0) (alkyl), -S02 alkyl, -alkyl-OH, -alkyl-0-alkyl, · alkyl NH2, -alkyl N (H) (alkyl), -alkylN (alkyl) 2, -alkylS (alkyl), -alkylS (0) (alkyl), -alkylS02alkyl, -N (H ) C (0) NH2, -c (o) oh, -c (o) o (alkyl), -c (o) alkyl, -c (o) nh2, -c (o) nh2, -C ( 0) N (H) (alkyl) and -C (0) N (alkyl) 2; or, ^ and \ together with the carbon atom to which they are connected form three -To seven-membered ring, selected from the group consisting of cycloalkyl, cyclofluorenyl, and heterocyclic ring; or, &amp; together with Rh and the nitrogen atom to which they are attached, form a three- to seven-membered ring, selected to include heterocyclic ring And heteroaryl; wherein each heterocycle and heteroaryl are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkyl, cyano, cyano, and ketone Group, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, heteroarylalkyl, -OH, _0 (alkyl), -NH2, -N (H) ( Alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl), -S (0) (alkyl), -alkyl-OH, -alkyl-0-alkyl , -AlkylNH2, -alkylN (H) (alkyl), -alkylS (alkyl), -alkylS (0) (alkyl), -alkylS02 alkyl, -alkylN (Alkyl) 2, -N (H) C (0) NH2, -C (0) 0H, -C (0) 0 (89166 -113- 200427678 alkyl), -C (O) alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (alkyl) 2; Rk is selected from the group consisting of hydrogen, fluorenyl, and alkyl , Aryl, aralkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl, methylamino , Alkyl, heteroaryl, heteroaralkyl, heterocyclic, heterocycloalkyl, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC (0)-, RaRbNC (0) alkyl, I ^ S-,, RaS02_, RaS alkyl-, Ra (0) S alkyl-, RaS02 alkyl-, Ra0C (0)-, Ra0C (0) alkyl-, RaC (O)-, RaC (0 ) Alkyl-, wherein each Rk is substituted with 0, 1, 2 or 3 substituents, the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, alkynyl, cyano, nitro, i Alkyl, S-alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (OR〇),-(alkylXNI ^ Rd), -S &amp;, -SCO)! ^, 4 (0) 21 ^, -ORe, -N ^ XRd), -C (0) Re, -CCOpi ^ -CCCONReRd; m is 0, 1, 2 , 3, or 4; and n is 0, 1, 2, 3, or 4; with the proviso that when A is a monocyclic ring other than the following And R4 is alkoxy, aryloxy, hydroxy or &amp; S-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, i-based, heteroaryl, heterocycloalkyl , Cycloalkyl, cyano, nitrate S, RaRbN-, RaC (0)-, RaS_, Ra (0) S-, Ra (0) 2S-, R ^ SC ^ NCRf), RaRbNC (0)-, RkOC (0)-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, fluorenyl, alkynyl, halo, cyano, 89166 -114- 200427678 nitro, aryl, heteroaryl, heterocycloalkane Base, -SRa, 4 (0) 1 ^, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) In the case of NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, aralkyl, cycloalkyl, (cycloalkyl) alkenyl, (cycloalkyl) alkyl, Heteroaryl, heteroarylfluorenyl, heteroaralkyl, heterocycloalkenyl, or heterocycloalkyl; and with the additional condition that when A is And R4 is hydroxyl or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or _ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aromatic , Heteroaryl, heterocycloalkyl, -SRa, -S (0) Ra, -S (0) 2Ra, -ORk, _N (Ra) (Rb), -C (0) Ra, -C (0 ) 0Ra &amp; -C (0) NRaRb, then R1 is not hydrogen, alkenyl, alkyl, decyl, aryl, arylmethyl, aryl, cycloalkyl, (cycloalkyl) alkenyl, (Cycloalkyl) alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycloalkenyl or heterocycloalkyl; including: ⑻ using a compound of formula (26) Contact with ginseng (methylthio) methyl sulfate in the presence of a base to provide a compound of formula (27) (27); and (b) contacting a compound of formula (27) with a compound of formula (13) (R5) n so2nh2 nh2 (13). 87. — A compound having formula (IX) (IX) or a pharmaceutically acceptable salt form, tautomer or stereoisomer thereof, wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonyl Alkyl, alkylthioalkyl, alkylsulfinamidoalkyl, alkylsulfoalkyl, alkynyl, aryl, arylalkenyl, aralkyl, arylthioalkyl, aryl Sulfoalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl) fluorenyl, (cycloalkyl) alkyl, formate, Halooxyalkyl, iSalkyl, heteroaryl, heteroarylfluorenyl, heteroarylalkyl, heteroarylcontinyl, heterocycle, heterocycloalkenyl, heterocycloalkyl, hydroxyalkane Alkyl, nitroalkyl, RaRbN-, RaRbN alkyl-, RaRbNC (0) alkyl-, RaRbNC (0) 0 alkyl-, RaRbNC (0) NRc 89166 -116- 200427678 alkyl-, RfRgON-, and RkO -, Wherein R1 is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, dentyl, cyano, nitro, alkynyl, Alkoxy, aryl, heteroaryl, heterocyclic, arane , Heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (0RC),-(alkyl) (NReRe), -SRe, _S (0) Re, -S (0) 2Re, -ORe , -N ^ XRe), -C (0) Re, -CXCOORe, and -CCCONReRe; R2 and R3 are independently selected from the group consisting of hydrogen, fluorenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, and aryl , Aralkyl, heteroaryl, heterocyclic, heteroaralkyl, cyano, halo, -N (Ra) (Rb), RaRbNC (0)-, -SRa, -S (0) Ra, -S (0) 2Ra &amp; f ^ CCO)-; wherein R2 and R3 are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from Ra, alkyl, fluorenyl, decyl, keto, Li, cyano, nitro, alkynyl,-(alkyl) (〇Rk), (alkyl) (NRaRb), -SRa, -S (0) Ra, -S (0) 2Ra, -ORk , -N (Ra) (Rb), -CCO)! ^, ((0) 01 ^ and -0: 0)? 1 ^; Or, R2 and R3 together with the carbon atom to which they are connected form a five-or A six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocyclic ring, wherein the aryl, cycloalkyl, heteroaryl and heterocyclic ring are optionally substituted by (R6) m; A presence is independently selected from the group consisting of alkyl, alkenyl, block, halo, Radical, nitro, self-alkyl, i-alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, heterocycloalkyl,-(alkyl) (ORk),-(alkane (NRaRb), -SRa, _S (0) Ra, -S (0) 2Ra, -ORk, -N (Ra) (Rb), -C (0) Ra, -C (0) 0Ra, and -C (0) NRaRb; wherein each R6 is independently substituted by 0, 1, 2, or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, block, keto, halo, alkyl, and cyano , Nitro, -ORa, -NRaRb 89166 -117- 200427678, -SRa, -SORa, -S02Ra, -C (0) 0Ra, -C (0) NRaRb, and -NC (0) Ra; heart and ^ in every An occurrence is independently selected from the group consisting of hydrogen, fluorenyl, alkyl, alkylthioalkyl, aryl, arylfluorenyl, aralkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, and cyclo Alkyl, cycloalkylalkyl, cycloalkylalkenyl, methylaminoalkyl, it alkyl, heteroaryl, heteroarylalkenyl, heteroaralkyl, heterocycle, heterocyclenyl, heterocycle Alkyl, hydroxyalkylcarbonyl, nitroalkyl, RkO-, RkOalkyl-, RcRdN alkyl-, RcRdNC (0) alkyl-, RcS02-, RcS02 alkyl_, ICXO)-, RcC (0 ) Alkyl-, ReOC (0)-, Re C (0) alkyl-, RcRdN alkyl C (0)-, ReRdNCCO)-, RcRdNC (0) 0 alkyl-, KRdNQCONd) alkyl-, the center of which is Rb with 0, 1 or 2 substituents Substitution, the substituent is selected from the group consisting of alkyl, fluorenyl, alkynyl, keto, IS, chloro, nitro, alkynyl, alkoxy, aryl, heteroaryl, heterocyclic, and aryl , Heteroarylalkyl, alkoxyalkyl,-(alkyl XORJ,-(alkylXNReRd), -S &amp;, -S (0) Rc, ^ (OhRe, -0D, -NdXR ^) , -C (0) Re, -C (0) 0Rc &amp; -C (0) NRcRd; or, Ra and Rb and the nitrogen atom to which they are connected form a three- to six-membered ring. And heterocycles, wherein heteroaryl and heterocyclic ring systems are independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, keto, li, and cyano , Nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORe),- (Alkyl XNI ^ Rd), -alkyl SC ^ NReRd, -alkyl C (0) NReRd, -SRe, 4 (0) 1, -SCOhRe, -ORe, -N ^ XRd), -CCO)! ^ , -0 (0) 01 ^ and-匸 ... don't daggerize; Rc And Rd are independently selected at each occurrence from hydrogen, -NRfRh, -Rf 89166 -118- 200427678, -CO (Rf), -SRf, -SORf, -S02Rf, -C (0) NRfRh, -S02NRfRh, -C (0) ORf, fluorenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, _alkyl, heteroaryl , Heteroaralkyl, heterocyclic and heterocycloalkyl; wherein each &amp; is independently substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, alkynyl, Keto, li, cyano, nitro, _alkyl, haloalkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-( Alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, -C (0) NRfRh, -C (0) N (H) NRfRh, -N (Re) C (0) 0Rf, -N (Re) S02NRfRh, -N (Re) -C (0) NRfRh, -alkylN (Re) C (0) 0Rf, alkylN (Re) S02NRfRh, and -alkylN (Re) C (0) NRfRh; or, \ and 1 ^ and their The connected nitrogen atoms together form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycles, where heteroaryl and The ring system is independently substituted by 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, fluorenyl, decanyl, keto, self-based, cyano, nitro, alkynyl, haloalkoxy Group, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,-(alkyl) (ORf),-(alkyl) (NRfRh), -SRf, -S (0) Rf, -S (0) 2Rf, -ORf, -N (Rf) (Rh), -C (0) Rf, -C (0) 0Rf, and _C (0) NRfRh; Re is selected Includes hydrogen, alkenyl, alkyl, and cycloalkyl; Rf, Rg & Rh are independently selected from each occurrence including hydrogen, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, and cycloalkane Alkyl, cycloalkenyl, cycloalkenylalkyl, heterocyclic, heterocycloalkyl, heteroaryl, and heteroaralkyl; wherein each of Rf, Rg, and ^ is independently substituted by 0, 1, 2, or 3 Substituted by 89166 -119- 200427678 The substituted group is independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, alkynyl, keto, nitro, aryl, aralkyl, cycloalkyl, cycloalkenyl , Heterocycle, heteroaryl, heteroaralkyl, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, _S (alkyl), _S (0) (alkyl ), —S02 alkyl, -alkyl-OH, -alkyl-0-alkyl, · alkylNH2, -alkylN (H) (alkyl), -alkylN (alkyl) 2, -alkane S (alkyl), -alkylS (0) (alkyl), -alkylS02alkyl, -N (H) C (0) NH2, -c (o) oh, -c (o) o (Alkyl), -c (o) alkyl, -c (o) nh2, -c (o) nh2, -C (0) N (H) (alkyl), and -C (0) N (alkyl ) 2; _ Alternatively, Rf and Rg and the carbon atom to which they are connected form a two- to seven-membered ring selected from cycloalkyl, cycloalkenyl, and heterocyclic rings; or, Rf and Rh and their The connected nitrogen atoms together form a two- to seven-membered ring, selected from the group consisting of heterocyclic rings and heteroaryl groups; wherein each heterocyclic ring and heteroaryl system are independently substituted with 0, 1, 2 or 3 substituents, the substituents Independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, li, keto, nitro, aryl, aralkyl, cycloalkyl, cyclofluorenyl, heterocycle, heteroaryl, heteroaryl Group, -OH, -0 (alkyl), -NH2, -N (H) (alkyl), -N (alkyl) 2, -S (alkyl), -S (alkyl), &quot; * S (0) (Carbonyl), -Carbonyl-OH, -Carbonyl · 0-Carbonyl, -Alkyl NH2, -Alkyl N (H) (alkyl), -Alkyl S (alkyl) , -AlkylS (0) (alkyl), -alkylS02alkyl, -alkylN (alkyl) 2, -N (H) C (0) NH2, · 0 (Ο) ΟΗ, _C ( 0) 0 (alkyl), -c (0) alkyl, -C (0) NH2, -C (0) NH2, -C (0) N (H) (alkyl), and -C (0) N (Alkyl) 2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, aralkyl, cyanoalkyl, cycloalkenyl, cyclofluorenylalkyl, cycloalkyl, cycloalkylalkyl , Methylamino, alkyl, heteroaryl, heteroaryl, heterocyclic, heterocyclo 89166 -120- 200427678, nitroalkyl, RaRbN alkyl-, RaO alkyl-, RaRbNC ( 0)-, RaRbNC (0) alkyl, RaS-, RaS (0)-, RaS02-, RaS alkyl ... Ra (0) S alkyl-, RaS02 alkyl-, Ra0C (0)-, Ra0C (0 ) Alkyl-, RaC (0) ·, RaC (0) alkyl-, where each Rk is substituted with 0, 1, 2 or 3 substituents, and the substituents are independently selected from the group consisting of alkyl, alkenyl, and block , Keto, halo, cyano, nitro, haloalkyl, i-alkoxy, aryl, heteroaryl, heterocyclic, aralkyl, heteroaralkyl, alkoxyalkoxyalkyl,- (Alkyl XORJ,-(alkyl XNR ^ Rd), -SRe, -S (0) Rc, 4 (0) 21, -ORe, -N ^ XRd), -0: 0) &amp;, -C ( 0) 0 Re and -CCCONReRd; m is 0, 1, 2, 3, or 4; and R11 and R12 are independently selected from the group consisting of alkyl, alkenyl, and alkynyl. 88. The compound according to item 87 of the scope of patent application, or a pharmaceutically acceptable salt form, tautomer or stereoisomer thereof, which is selected from the group consisting of: 1-benzyl-3- (bis (methylthio) (Methylene) methylene) -1'-quinoline-2,4 (1H, 3H) -dione; 3- [bis (methylthio) methylene] -1-butyl-1,8-naphthyridine- 2,4 (1H, 3H) -diketone; 3- [bis (methylthio) methylene] small (1,3-diketo-1,3-dihydro-2H-isoindole-2_yl ) Quinoline-2,4 (1Η, 3Η) _diketone; 3- [bis (methylthio) methylene] -1 _ [(cyclopropylmethyl) amino] quinoline-2,4 (1H , 3H) -dione; 3- [bis (methylthio) methylene] -1- (3-methylbutyl) pyridine-2,4 (1H, 3H) -dione; 1-benzyl- 3- [bis (methylthio) methylene] pyridine-2,4 (1H, 3H) -dione; 3- [bis (methylthio) methylene] -1- (cyclobutylamino) Quinoline-2,4 (1Η, 3Η) -dione, and 3- [bis (methylthio) methylene] -1- (cyclobutylmethyl) pyridine-2,4 (1H, 3H) -di ketone. 200427678 (1) Designated representative map: (1) The designated representative map in this case is: (). (2) Brief description of the element representative symbols of this representative map: 捌 If there is a chemical formula in this case, please disclose the chemical formula that can best show the characteristics of the invention ... 89166