PL235221B1 - Pair of oligonucleotide primers for detecting the ct2 dwarf gene and method for detecting the recessive ct2 dwarf gene in rye (Secale cereale L.) plants - Google Patents

Abstract

The subject of the application is a pair of oligonucleotide primers for detecting the ct2 dwarfing gene in rye plants with the sequences: MK61b_F1 TGTCTAAGTTGTCTTTCAGTGA MK64b_R4 GTTGCAAGTTCCCAAAGCCC. The application also includes a method for detecting the presence of the ct2 dwarfing gene in rye plants, in which polymorphic DNA fragments coupled with the tested gene are amplified in a PCR reaction using a pair of primers, followed by the detection of the amplification product, characterized in that the pair of primers is a pair of oligonucleotide primers with the sequences MK61b_F1 TGTCTAAGTTGTCTTTCAGTGA MK64b_R4 GTTGCAAGTTCCCAAAGCCC, in the case of the primer pair MK61b_F1 and MK64b_R4, the marker d508041 is used.

Description

Description of the invention

The present invention relates to a pair of oligonucleotide primers for detecting the recessive ct2 dwarf gene in rye plants and a method for detecting the presence of the ct2 dwarf gene in rye plants by means of the polymerase chain reaction (PCR).

The recessive rye dwarf gene is present in the Moskovski karlik population deposited at the Vavilov Institute of Plant Genetic Resources (VIR) Gene Bank, Saint Petersburg, Russia (accession no. K-10092) and in the MK inbred line, which was derived from the above-mentioned source population.

In the process of growing cereals, great attention is paid to lowering the height of the plants. The aim is to improve the resistance of cereals to hatching, which often occurs during unfavorable weather conditions associated with strong winds and heavy rain. Tall grasses with thin and flexible blades, which also include cereals, easily react to such conditions by bending, and in extreme cases even by turning over and breaking plants. The cause of the hatching of cereals is also insufficient lighting of the lower internodes, which causes underdevelopment of mechanical tissue. The inclination tendency increases with too dense sowing and high doses of nitrogen fertilizers. In the case of cereals, hatching results in a reduction of the yield and its worse quality, because in the hatched crop plants take up nutrients and water less well, and photosynthesis is much less intense. Moreover, in conditions of increased humidity and temperature, saprophytic fungi develop, and thus mycotoxins accumulate in the grain.

The greatest losses in grain yield (even up to 60%) occur when the grain lies in the period from full heading to the beginning of milk maturity. Then, the fertility of ears is reduced, the weight of 1000 grains (MTZ) is reduced and the share of lead residue in the total grain yield increases. Hatching of cereals in the late stages of plant development, i.e. from the final stage of milk maturity, usually results in a slight reduction in the yield (5-10%), because the grain is almost completely developed then. The hatching of plantations in this period results in a difficult harvest, as well as a reduction or complete loss of the quality of grain due to its growth. Hatching in the early stages of development (before earing) usually does not cause significant yield reductions, because plants relatively easily return to vertical.

In the case of species such as wheat, barley or triticale, the problem of hatching has already been largely solved by producing short-stem varieties with introduced dwarf genes. So far, it has not been possible to obtain semi-dwarf varieties in rye, and the varieties currently grown are still quite large, in the range of 130-160 cm. This fact may be related to the small pool of identified dwarf genes, especially dominant genes, of which only three are known to date (Dw1, Dw2 and Dw3).

Recessive rye dwarf genes have been identified so far 17. For some of them, it is not known whether they are truly distinct. It is also impossible to carry out allelicity tests that would answer this question, as most of the sources of these genes are currently unavailable. The allelicity test is based on the assessment of the splitting of the F2 population obtained as a result of crossing the sources of dwarfism with each other, separately for the dominant and recessive genes, and allows to identify genes as separate or as allelic forms.

Recessive dwarfism genes are found on all 7 chromosomes in rye (1R-7R). 14 of them were assigned to the corresponding chromosomes: on the 1R, 2R, 3R and 6R chromosomes one recessive dwarf gene was located, three on 4R, four on 5R, and two on 7R. A closer location - on the arms of the chromosomes - has been determined only for the ct1 (7RL), ct2 (5RL) and e.g. (4RL) genes. For four genes, the chromosomal location is still unknown (Borner A., Korzun V. 1998. A consensus linkage map of rye (Secale cereale L.) including 374 RFLPs, 24 isozymes and 15 gene loci. Theor. Appl. Genet. 97 : 1279-1288 and Borner A., Gale MD, Appleford NEJ, Lenton JR 1993. Gibberelin status and responsiveness in shoots of tall and dwarf genotypes of diploid rye (Secale cereale). Physiol. Plant. 89: 309-314 and Borner A ., Plaschke J., Korzun V., Worland AJ 1996. The relationships between the dwarfing genes of wheat and rye. Euphytica 89: 69-75 and Kubicka H., Kubicki B. 1990. Two types of dwarfhess in winter rye (Secale cereals L.). Gen. Pol.81: 9-19 and Melz G. Schlegel R., Sybenga J. 1988. Identification of the chromosomes in the "Esto" set of trisomics. Plant Breed. 100: 169-172).

In addition to identifying the identity and distinctiveness of individual recessive genes of rye dwarfism, their nomenclature should also be organized and systematized. Some researchers used the correct nomenclature for the genes they discovered (dw, lowercase, Pocho

PL 235 221 B1 from the English word dwarf - dwarf). In the case of three genes (ct1-ct3), the nomenclature derived from the morphological trait linked to the gene was used. The forms containing these genes are characterized by a short and compact spike with short bones, described by the Latin word compactum. The abbreviation ct comes from this word. Genes in lines: 8/40 (chromosome 4) and 2/7 (location unknown) are marked with the abbreviations ds1 and ds2, which are probably abbreviations of the English words dwarf stem. The designation of a gene, for example, from chromosome 4RL is an abbreviation from Latin, where nana means dwarf and prostratum - lowered. The designations of the other genes gr, br and ti (t) probably come from morphological features characteristic for the source line.

So far, attempts have been made to introduce into rye varieties only one recessive ct2 (5RL) dwarf gene, which is present in the Russian hybrid - "Moskovski Karlik" (Melz G. 1989. Beitrage zur Genetik des Roggens (Secale cereale L.). Dsc. Thesis, Berlin: 173 and Kubicka H., Kubicki B. 1990. Two types of dwarfhess in winter rye (Secale cereale L.). Gen. Pol.81: 9-19 and Plaschke J., Korzun V., Koebner RMD, Borner A 1995. Mapping of the GAa-insensitive dwarfing gene ct1 on chromosome 7R in rye. Plant Breed. 114: 113-116).

In culture materials, the genes of dwarfism can be tracked quickly and relatively cheaply with the help of molecular markers obtained by PCR. However, in the case of recessive rye dwarf genes, it is not possible, because for any of them there are no such markers available, sufficiently strongly linked with the target gene. The only, relatively closely linked, are the RFLP markers of the ctl genes and, for example, the production of which, however, is expensive and time-consuming. In the case of the remaining genes, only vague morphological markers are known.

The aim of the invention was to find markers that would distinguish dwarf forms from tall ones and additionally allow to confirm the source of dwarfism (here the ct2 gene).

The essence of the invention is a pair of oligonucleotide primers for detecting the ct2 dwarf gene in rye, with sequences No. 1 and 2, as shown in the sequence listing.

The essence of the method of detecting the presence of the ct2 dwarf gene in rye plants, in which the polymorphic DNA fragments linked to the studied gene are amplified by PCR using a pair of primers, followed by detection of the amplification product, is that the pair of primers is a pair of oligonucleotides primers 1 and 2 as shown in the sequence listing, using marker d508041 (Formula 1 - d508041 marker band associated with the dwarf trait of the ct2 gene, found in tall plants, no band associated with short plants).

The invention is shown in more detail in the embodiment and in the drawing, in which:

- Fig. 1 is an electrophoregram showing the segregation of the marker d508041 in the dwarf (K) and tall (W) genotypes of the hybrid mapping population F2 between the normal growth line (541) and the dwarf MK line (Formula 1 is indicated by the arrow).

- Fig. 2, consisting of 3 parts (A, B, C), shows the electrophoregrams showing the segregation of the marker d508041 among dwarf (K) and tall (W) plants of the three mapping populations with the unknown dwarf gene introduced. The mapping populations shown in Fig 2 (A, B, C) are distinct from the test population (with the ct2 gene introduced from the MK line).

- Fig. 2A is an electrophoregram showing the segregation of the marker d508041 among tall (W) and short (N) plants of the hybrid mapping population F2 between the normal growth line (541) and the dwarf OK line. The dwarf line OK was derived from the population of Omka korotkostebelnaja.

- Fig. 2B is an electrophoregram showing the segregation of the marker d508041 among tall (W) and short (N) plants of the hybrid mapping population F2 between the normal growth line (541) and the dwarf LK line. The dwarf line of the LK was derived from the population of Leningradskij karlik.

- Fig. 2C is an electrophoregram showing the segregation of the marker d508041 among tall (W) and short (N) plants of the hybrid mapping population F2 between the normal growth line (541) and the dwarf D1 line. The dwarf D1 line was derived from the Ac Rifle population.

In the first stage, a population mapping F2 of the hybrid line 541 (high line) and MK (dwarf line) consisting of 94 individuals was created. Each of the mapping population individuals was phenotypically marked (K - dwarf) or W (tall). During the research, the marker d508041 (dominant marker) was developed, which easily and quickly identifies rye plants with the ct2 gene among the genotypes of the studied population mapping with the ct2 gene, as shown in Fig. 1, and in three different mapping populations containing unknown dwarf genes as shown in Fig. 2 (A, B, C).

PL 235 221 Β1

The research on the marker d508041 has shown that it is a marker of the ct2w ry gene.

D508041 marker identification method

Material - DNA was isolated from rye leaves by known methods using commercially available kits.

Primers for the amplification of marker d508041 were designed based on the self sequences, and are primers with sequences Nos. 1 and 2 as shown in the sequence listing.

Primers were designed using the Primer-BLAST program (http://www.ncbi.nlm.nih.gov/tools/primer-blast/).

Composition of the PCR reaction mixture (Polymerase Chain Reaction) for the marker d508041:

GOUT 10 - 50 ng 10 x Taq buffer (200 mM Tris-HCI, 200 mM KCI, 50 mM (NH ₄ ) zSO4 lx dNTP 0.2 mm MgCb 2mm Taq polymerase 0.5 -1.0 U Starter F 0.1-0.5 pM Starter R 0.1-0.5 pM HzO Depending on the volume of the final PCR mixture

DNA amplification conditions for the marker d508041

The PCR reaction was performed in a Thermalcycler T1 thermal cycler (Biometra)

PCR parameters: 95 ° C - 1 - 3 min, 35 cycles (95 ° C - 45s, 58 ° C - 30s, 72 ° C - 40s), 72 ° C - 10 min.

Identification of the marker d508041

Electrophoretic separation of the amplification products was carried out on a 3.0% agarose gel with 0.01% ethidium bromide, in 1xTBE buffer pH = 8.5 at a voltage of 100 V for 2.0 h. GeneRuler Ladder 100 bp Plus (Fermentas ). After separation, the gel was highlighted on a UV transilluminator and a photo was taken, followed by computer analysis of the images.

Results

Testing of the marker d508041 on individuals of the 541 x MK hybrid mapping population showed 98% agreement of marker segregation with dwarfism for marker d508041 (Fig. 1). The results of identification obtained for 40 individuals of three different mapping populations from the studied population - 541xOK, 541xLK and 541xD1 using the marker d508041 and the method being the subject of the invention are presented in Fig. 2A (dwarf individuals and tall individuals of the population 541xOK), Fig. 2B (dwarf individuals and tall 541xLK) and Fig. 2C (dwarf and tall individuals of 541xD1 population). In the case of the 541xOK population (Fig. 2A) and the 541xD1 population (Fig. 2C), the marker d508041 was not correlated with the unknown dwarf gene present in these populations, while in the 541xLK population (Fig. 2B), the marker d508041 was clearly linked to that present in of this population with the dwarf gene. For this reason, the dwarf gene present in this population was identified as the ct2 gene (Fig. 2B).

Application of the molecular test

The use of the marker d508041 may be useful for the identification of the ct2 gene present in rye culture materials.

Sequence Listing

Sequence number 1

MK61b_F1 TGTCTAAGTTGTCTTTCAGTGA

Sequence number 2

MK64b_R4 GTTGCAAGTTCCCAAAGCCC

PL 235 221 B1

Claims (2)

1. A pair of oligonucleotide primers for detecting the ct2 dwarf gene in rye sequences No. 1 and 2 as shown in the sequence listing. 2. Method for detecting the presence of the ct2 dwarf gene in rye plants, in which the polymorphic DNA fragment linked to the tested gene is amplified by PCR using a pair of primers, followed by detection of the amplification product, characterized in that the primer pair is a pair of oligonucleotides primers 1 and 2 as shown in the sequence listing, with the marker d508041 (Formula 1) for the primer pair of sequences 1 and 2.