PL230884B1 - Helper plasmid, the strain and the system of the broad host spectrum plasmid mobilization and use thereof - Google Patents

Abstract

The invention relates to a mobilization helper plasmid which includes the mobilizing part of the pCTX-M3 conjugation system (tra and trb region genes) and a bacterial strain for efficient mobilization of broad host spectrum plasmids comprising the mobilizing part of the conjugation system (tra and trb region genes) integrated into the bacterial chromosome ). The invention also relates to systems for the efficient mobilization of plasmids with a broad spectrum of hosts comprising said plasmid or bacterial strain and a mobilized plasmid containing oriT having a nucleotide sequence compatible with said system.

Description

Description of the invention

The invention relates to helper plasmids for the efficient mobilization of plasmids with a broad host spectrum, bacterial strains for the efficient mobilization of plasmids with a broad host spectrum, containing a bacterial chromosome-integrated mobilizing part of the conjugation system, a system for efficient mobilization of broad host-spectrum plasmids including this plasmid or bacterial strain, and a mobilized plasmid containing the oriT with a nucleotide sequence interacting with this system of their use and the molecular assembly containing them.

The plasmid pCTX-M3 was isolated from the clinical strain Citrobacter freundii in Poland in 1996 as a vector carrying the blacTx-M-3 gene, encoding the newly discovered β-lactamase with an extended substrate spectrum of the CTX-M type (Gniadkowski et al., 1998, Antimicrob. Agents) Chemother., 42: 827-832). Soon it was found in 15 hospital centers in Poland in 7 different species of Enterobacteriaceae bacteria: Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, Morganella morganii, Serratia marcescens and Salmonella enterica (Baraniak et al., 2002, Antimicrob. Agents Chemothericrob. Agents. ., 46: 151-159). It has also been shown that the plasmid pCTX-M3 has a very wide host range and replicates in representatives of the α-, β- and γ- Proteobacteria (Mierzejewska et al., 2007, Plasmid, 57: 95-107). Under optimal conditions, every tenth E. coli cell carrying the pCTX-M3 plasmid can donate it during conjugation (Gołębiewski et al., 2007, Antimicrob. Agents Chemother., 51: 3789-3795), and moreover, the conjugation transfer of this plasmid it is possible, albeit with a low frequency, also from Agrobacterium tumefaciens cells (a-Proteobacteria) to E. coli (γ-Proteobacteria) (M. Gołębiewski, unpublished data).

The nucleotide sequence of the pCTX-M3 plasmid has been determined, described and deposited with the GenBank gene bank under accession number AF550415. This plasmid carries a single IncL / M type replicon and encodes a conjugation system whose genes are located in two regions of tra and trb, and their protein products show 30 to 60% similarity to the proteins encoded in the Collb-P9 plasmid from the Incll family (so far poorly examined group of T4BSS conjugation systems), characterized by a narrow host range. Conjugation transfer is a common phenomenon among bacteria, responsible for their rapid variability, and also crucial in the horizontal spread of genes in the biosphere. It consists in transferring properly prepared DNA from the donor cell to the recipient cell after direct physical contact between them occurs and a structure called a conjugation bridge is formed between them. The possession of a conjugation plasmid or a conjugation transposon is a prerequisite for a bacterial cell to donate through the conjugation process. The effect of conjugation transfer between the donor and the recipient is the formation of transconjugants, recipient cells enriched with the features encoded by the DNA obtained from the donor. It should be emphasized here that the DNA of the plasmid transferred by conjugation "escapes" by the restriction system of the recipient, and what is more, also large plasmids are very efficiently transferred in this way.

Proteins involved in the preparation of DNA and the formation of a donor-recipient conjugation pair play a key role in conjugation transfer. In the case of conjugation plasmids, DNA preparation for transfer is ensured by proteins with Dtr (Dna transfer and replication) functions: relaxase / helicase cutting one of the DNA strands in the oriT region (origin of conjugal transfer), auxiliary proteins, and a linker protein (Coupling Protein), forming the relaxosome complex. To create a conjugation pair, proteins with Mpf (Mating pair formation) functions are needed, in Gram-negative bacteria responsible for the formation of the pilus that connects the donor cell with the recipient.

The genes encoding the conjugation transfer proteins are organized into multi-gene operons, often with separation of Dtr and Mpf functions, e.g. in plasmids from the IncP or IncW group. Proteins with Dtr functions are plasmid-specific - they cut only the strand of a given plasmid, while the Mpf functions can be used by mobilizable plasmids that coexist in a bacterial cell, encoding only the functions of Dtr and oriT. The minimum requirement for a plasmid to be mobilized for transfer and donated to the recipient cell, i.e. to be a mobilized plasmid, is the presence of the oriT sequence itself. In such a situation, the helper, or mobilizing, plasmid must encode the proteins responsible for both functions: Mpf and Dtr. The interaction of these two machinery, Mpf and Dtr, provides a linker protein, which is ATPase, also encoded in the helper plasmid.

PL 230 884 Β1

As demonstrated in the studies conducted so far, the genes of the pCTX-M3 plasmid conjugation system are located in two distant regions (Gołębiewski et al., 2007, Antimicrob. Agents Chemother., 51: 3789-3795). Moreover, apart from the abovementioned Collb-P9 and R64 plasmids from the Incll family, and plasmids with an identical plasmid "skeleton" (pEL60 and pCTX360), these genes do not show significant homology to sequences with assigned functions, collected in public databases (I. Kern -Zdanowicz and M. Gołębiewski, unpublished data). While the genes encoding the pCTX-M3 and Collb-P9 (Incll) conjugation systems are similar, and most genes have a similar order in both plasmids, the entire tra and trb regions have different locations to each other. Moreover, the pCTX-M3 plasmid can, albeit with a low frequency, mobilize plasmids containing heterologous oriTcoiib-P9 and vice versa, the plasmid with oriT _P cTx-M3 is mobilized by the Collb-P9 plasmid (I. Kern-Zdanowicz and M. Gołębiewski, unpublished data). Despite the similarity of the tra and trb regions, the genes encoded in the leading region, i.e. those that enter the recipient's cells first, are different in pCTX-M3 and Collb-P9 (except for the two genes encoding Ssb - single stranded DNA binding proteins and anti-restriction proteins). The first gene in the leading region of pCTX-M3 is orf35 (Gołębiewski et al., 2007, Antimicrob. Agents Chemother., 51: 3789-3795). This gene is similar in length, location, and direction of transcription to that of several plasmids, particularly those with a broad host spectrum. According to our unpublished data, the hypothetical product of this gene shows low homology to the MobC protein from the IncQ plasmids and is a distant homologue of the TraK protein of the RP4 plasmid, encoding the accessory protein of the relaxationase complex (Ziegelin et al., 1992, J. Biol. Chem., 267: 17279-17286). In plasmids with a wide range of hosts, such as R46 from IncN, R388 from IncW, RK2 (RP4) from IncP-1, or NAH7 from IncP-9, there is a trigenic operon in their leading region, the so-called leading operon. The results of studies on the NAH7 plasmid from Pseudomonas putida show that the traDEF leader operon is involved in the modulation of the recipient range (Miyazaki et al., 2008, J Bacteriol., 190: 6281-6289). In other broad host spectrum plasmids, such as e.g. RSF1010 with IncQ, there is only one, the mobC gene (Meyer, 2009, Plasmid, 62: 57-70), as is the pCTX-M3 plasmid leader.

Conjugation transfer systems allow efficient introduction from donor cells to recipient cells of any plasmid carrying the system-specific oriT sequence.

In plasmid pCTX-M3 oriT (oriT _p ctx-m3), this is the 106 bp (bp) fragment shown in SEQ ID NO. ID. NO. 1. The sequence οπΤ _Ρ οτχ-Μ3 covers both the site of DNA cleavage by nikase, i.e. "Nick site" as well as the nic region where proteins of the Dtr complex interact. By cloning oriT _P cTx-M3 into any plasmid replicating in donor cells, a plasmid mobilized by the pCTX-M3 plasmid conjugation system can be obtained and genes encoding selected traits can be introduced into recipient cells.

Plasmids capable of conjugation transfer, the recipients of which may be bacteria belonging to various taxonomic groups, are an interesting object for the construction of biotechnological tools, for example for introducing plasmids into "difficult" strains of bacteria. The plasmid serving for this purpose is the plasmid of the IncP group - the RK2 plasmid (also called RP4), the conjugation system of which is assigned to the well-characterized T4ASS group. This plasmid is about 60 thousand. pz. and determines resistance to tetracycline, ampicillin and kanamycin. It is also capable of replication in a wide spectrum of bacteria. The RK2 plasmid is capable of mobilizing plasmids carrying oriTRK2, and the recipients of the plasmids in such a conjugation transfer or mobilization can be not only Gram negative but also Gram positive bacteria (Poyart and Trieu-Cuot, 1997, FEMS MicrobioL, 156, 193-198). Conjugation transfer by RK2 to yeast Saccharomyces cerevisiae (Bates et al., 1998, J. Bacteriol., 180: 6538-6543) and mammalian cells (Waters, Nature Genet., 2001, 29: 375-376) has also been described.

In the construction of the plasmid mobilization tool, the plasmid RK2 was completely introduced into the chromosome of E. coli bacteria, including the replicon and resistance genes, by Mu phage (Simon et al., 1983, Nature Biotechnology, 1: 784-791). This system efficiently mobilizes plasmids carrying oriTrk2 for conjugative transfer. Unfortunately, the disadvantage of this system is that the plasmid is cut from the chromosome with a certain frequency, what is more, the plasmid is capable of further conjugation. Another disadvantage of this system is the ability to mobilize a frequency of the order of 10 ^{4 of} the

PL 230 884 Β1 of the bacterial chromosome into which it has been integrated. In bacteria that are recipients of such a transfer, this can cause numerous unwanted recombination events. The modification causing damage to the nic region within ohTrk2 means that the RK2 present in the bacterial chromosome can no longer mobilize the chromosome for transfer (Babic et al. 2008, Res Microbiol, 159: 545-549). However, the disadvantage of being able to excise the plasmid from the chromosome has not been removed. Moreover, it should be emphasized that the plasmid present in the chromosome carries all of its genes, including the genes determining resistance to the above-mentioned antibiotics.

The system based on the RK2 plasmid integrated into the chromosome was used to propose an antibacterial therapy involving the mobilization of a plasmid carrying the gene encoding the E3 colicin, i.e. the 16SrRNA cutting ribonuclease, for conjugational transfer. In these studies, mice bearing burns infected with Acinetobacter baumanii were cured of infection (Shankar et al., 2007, Journal of Bum Care and Research, 28: 16-12).

The object of the invention is therefore to provide new plasmids, bacteria and systems for efficient plasmid mobilization with a broad host spectrum, free from the disadvantages of existing plasmid mobilization systems and ensuring efficient mobilization to a wide range of recipient bacteria.

The invention is based on the unexpected finding that it is possible to effectively change the construction of the known pCTX-M3 plasmid and obtain new plasmids, bacterial strains and systems based thereon for efficiently mobilizing plasmids with a broad host spectrum. Such pCTX-M3 derived plasmids are devoid of pathogenic factors and are incapable of conjugative transfer. Moreover, the invention is based on the unexpected finding that the obtained plasmids derived from pCTX-M3 lacking orf35, the presence of which, due to its position in the leader region and possible function in stabilizing the plasmid in the recipient, seemed necessary for mobilization, show an additional, increased ability to mobilize plasmids carrying oriTpcTx-M3. Such a plasmid, bacterial strain and the system based on them for efficient plasmid mobilization according to the invention are devoid of most genes determining antibiotic resistance, as well as mobile genetic elements, such as IS sequences and transposons, therefore they are structurally stable and do not lead to uncontrolled phenomena. recombinant in the bacterial host. In addition, the obtained plasmid, the bacterial strain and the system based on them according to the invention have been prepared in such a way that they contain no smaller set of genes necessary for the production of an efficient conjugation system, and the smaller size compared to the complete pCTX-M3 plasmid facilitate possible manipulations within its sequence, as well as facilitate the introduction of such a plasmid into the host cells (large plasmids are difficult to introduce by transformation). Such a plasmid, bacterial strain and the system based on them carry oriTpcTx-M3 mut, i.e. the damaged oriT site, therefore, when coding the conjugation system, it cannot be transferred to such a transfer itself, and therefore it cannot spread in an uncontrolled manner, and remains only in the donor's cells.

The invention thus relates to a mobilization helper plasmid which comprises a mobilization portion of the tra and trb conjugation system within nucleotides 34 to 23136 of SEQ ID NO. ID. 2 and SEQ. 24,740 to 29,654 ID. 2, more preferably comprises nucleotides 34 to 29,654 of SEQ ID NO. ID. NR 2, and wherein the mobilization helper plasmid does not encode a functional Orf35 protein from pCTX-M3. Such a plasmid is preferably a pMOBS plasmid, the sequence of which is shown in SEQ ID NO. ID. NO 2.

The invention also relates to a bacterial strain for efficient mobilization of plasmids with a wide host spectrum, containing a bacterial chromosome-integrated mobilizing part of the tra and trb conjugation system within nucleotides 34 to 23136 SEQ ID NO. ID. 2 and SEQ. 24,740 to 29,654 ID. No. 2, more preferably has integrated nucleotides 34 to 29,654 of SEQ ID NO. ID. NR 2, and such strain does not produce a functional Orf35 protein from pCTX-M3.

The bacterial strain is preferably a Gram negative bacterium selected from the group consisting of: Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, Morganella morganii, Serratia marcescens, Salmonella enterica.

PL 230 884 Β1

The bacterial strain is preferably an E. coli strain into which the mobilizing part of the conjugation system has been integrated into the attB site of the chromosome, more preferably it is E. coli S14 strain.

The invention also relates to a system for efficient mobilization of plasmids with a broad host spectrum comprising a plasmid according to the invention and / or a bacterial strain according to the invention and a mobilized plasmid containing an oriT having a nucleotide sequence, which nucleotide sequence ensures that the oriT interacts with the system.

In a preferred oriT system with a nucleotide sequence, which nucleotide sequence ensures that the oriT interacts with this system is οπΤ _Ρ οτχ-Μ3 or oriTcoiibP9, more preferably it is οπΤ _Ρ οτχ-Μ3 shown in SEQ. ID. NO. 1.

In a preferred system, the mobilized plasmid comprises a donor replicon, preferably ογϊ _ρ μβι from pUC19, ohra3 from pRA3, ohpisa from pACYC184, or ori _P cTx-M3 from pCTX-M3.

The invention also relates to the use of a helper plasmid according to the invention, a bacterial strain according to the invention and a system containing the plasmid mobilized according to the invention for efficient mobilization of plasmids into the recipient cells, the recipient cells being Gram negative bacteria: a-Proteobacteria, β-Proteobacteria, γ-Proteobacteria and bacteria. I play positive, especially from the Bacilli class.

Preferably, in such use, the mobilized plasmid comprises οπΤ _Ρ οτχ-Μ3 or oriTcoiibp, more preferably an oriT shown in SEQ ID NO. ID. NO. 1.

In an equally preferred use, the mobilized plasmid comprises a replicon allowing replication in the donor, preferably οπ _ρ μβι from pUC19, ohra3 from press, ohpisa from pACYC184 or Ori _P cTx-M3 from pCTX-M3.

The invention further relates to the use of the system according to the invention for introducing genes encoding a beneficial factor for a recipient bacterium under a specific environment or conditions in which in conjugation plasmids containing οπΤ _ρ οτχ-Μ3 or oriTcoiib pβ, more preferably containing the oriT shown in SEQ ID NO, are mobilized. ID. No. 1, whereby a factor enabling its development in a specific environment or conditions is introduced into the donor's cell on the mobilized plasmid, which factor is safe for the donor strain.

The invention also relates to the use of the system according to the invention for introducing into a recipient strain for integration into the recipient chromosome a nucleotide sequence introduced on a mobilized plasmid in which the mobilized plasmid does not replicate, wherein plasmids containing οπΤ _ρ οτχ-Μ3 or oriTcoiib p are mobilized in conjugation. ', more preferably containing the oriT shown in SEQ. ID. No. 1, and the mobilized plasmid includes an integrating sequence into the recipient chromosome. Preferably in such use, integration into the recipient chromosome of the nucleotide sequence is carried out to effect transposon mutagenesis, wherein the plasmid to be mobilized comprises an integrating sequence into the recipient's chromosome which is the transposon sequence.

A molecular kit comprising a plasmid according to the invention and / or a bacterial strain according to the invention and / or a system for efficient mobilization of broad-spectrum plasmids according to the invention is also within the scope of the present invention.

The term "functional equivalent of a nucleotide sequence" denotes a nucleotide sequence that encodes products that contain an amino acid or nucleotide sequence that is identical or highly similar to that encoded by the parent nucleotide sequence, the nucleotide sequence of which has been altered, for example, by substitution, replacement, deletion, or insertion such that no this substantially changes the activities of the products encoded by these nucleotide sequences.

Using the conjugation transfer genes from the pCTX-M3 plasmid, an efficient mobilization system according to the invention was created, which enables the introduction of α-, β-, or γ-Proteobacteria Gram-negative bacteria from cells, e.g. Escherichia coli, a plasmid capable of replication in donor cells and / or the recipient and containing οπΤ _Ρ οτχ-Μ3 into the recipient cells, which may be Gram negative bacteria: α-Proteobacteria, such as e.g. Agrobacterium tumefaciens, β-Proteobacteria, e.g. Ralstonia eutropha, γ-Proteobacteria, such as e.g. Pseudomonas putjak or e.g. enterobacteria E. coli and Gram positive bacteria of the Bacilli class, such as, for example, Lactococcus lactis.

PL 230 884 Β1

In one embodiment of the invention, the genes encoding the conjugation system are located on the pMOBS plasmid. It is a derivative of pCTX-M3, devoid of antibiotic resistance genes carried by this plasmid, genes for mobile genetic elements such as IS or transposons, and containing the tra and trb genes, but devoid of the orf35 and orf46 genes (Example 3). The pMOBS plasmid contains a set of genes necessary for the generation of an efficient conjugation system that spans nucleotides 34 to 23136 of SEQ. ID. 2 and SEQ. 24,740 to 29,654 ID. 2 forming modules tra and trb (Fig. 1). Due to the mutations introduced into the sequence nothing in the pMOBS plasmid (oriTpcTx-M3-mut is non-functional), this plasmid is incapable of conjugative transfer but acts as a helper plasmid in conjugation transfer. As demonstrated in Example 4, the mobilization frequency of the οπΤ _ρ οτχ-µ3 plasmid in the presence of pMOBS as a helper plasmid is 1000-fold higher than in the presence of pCTX-M3.

In another embodiment of the invention, the genes encoding the conjugation system (tra and trb modules, Fig. 1) are located on the chromosome of the bacteria. Example 4 shows the mobilization frequency of the plasmid harboring the oriT _P cTx-M3 in the E. coli S14 strain in which the tra and trb modules are located at the λ phage integration site. In this case, the mobilization frequency is about 10 times higher than in the presence of the pCTX-M3 plasmid.

In both embodiments of the system according to the invention, οπΤ _ρ οτχ-µ3 is located on the plasmid to be transferred to the recipient cells. Moreover, the genes needed for the mobilization of this plasmid remain in the donor cell and are not transferred to the recipient cell by the conjugation / mobilization process.

Genes the function of which can be tested in the host cells into which it is introduced (Examples 5 and 6) can be cloned on the mobilized plasmid carrying the cTx _{-M3 oriT P oriT.} The advantage of this system is the possibility of introducing plasmids into bacteria in a way that avoids the restriction system that works in every bacterial cell. It should be emphasized that in both embodiments of the system according to the invention, the genes encoding the elements of the conjugation transfer system cannot be transferred to the recipient cells, and the introduced plasmid carrying οπΤ _Ρ οτχ-Μ3 cannot be spread further among the bacteria on its own.

Another advantage of one version of the system according to the invention, in which the genetic information enabling conjugation is localized in the chromosome of the bacteria (chromosomal location of the conjugation transfer genes) is that the plasmid cannot be excised in the donor cells, as is the case, for example, in systems based on the integrated RK2 plasmid. The introduction of genetic information enabling conjugation to the bacterial chromosome also does not restrict the selection of the mobilized plasmid in terms of its replicon (plasmid incompatibility is avoided). In the system according to the invention with the chromosomal location of the conjugative transfer genes, during the production of bacterial strains that are part of it, only the pMOBS plasmid fragment, encoding the pCTX-M3 trb genes, and the cat gene necessary for selection are introduced into the chromosome of the bacteria that will later be the donor. integrants. Moreover, the resulting bacterial strain can be further modified by removing the cat gene from the chromosome. Thus, the resulting strain may be completely devoid of the introduced chloramphenicol resistance gene.

The prepared conjugation systems and biotechnological tools based on them can be used in many aspects, for example for: a) introduction of plasmids carrying the appropriate oriT to different recipients, which cannot be transformed for various reasons (e.g. into clinical strains or environmental strains); b) to prepare and conduct BCBT therapy, based on the phenomenon of bacterial conjugation based therapy, consisting in the introduction of a mobilized factor on a plasmid, which, being safe for the donor, leads to the death of the recipient's cell (Filutowicz et al., 2008, Plasmid 60: 38-44); such factor could be the gene encoding the poison (e.g. from the plasmid pSM19035) from the poison-antidote system, which in the recipient, in the absence of an antidote, would lead to death, while the donor would protect the introduced antidote gene from the action of the poison, c) to be introduced in an active, controlled manner genes encoding factors that may be beneficial to bacteria that are not amenable to transformation, in a specific environment or conditions, or when introducing these factors by other means may be

PL 230 884 Β1 difficult (e.g. application for the production of strains used in utilization, e.g. in wastewater treatment, introduction of heavy metal resistance genes, genes for the decomposition of toxic compounds such as phenol, toluene, dimethylformamide, etc.), d) to be introduced into the recipient, in which the mobilized plasmid does not replicate, genes that would be integrated into its chromosome, including transposon mutagenesis (Simon et al., 1983, Nature Biotechnology, 1: 784-791) using various transposons such as_Mu or Tn3 derivatives , Tn5 or Tn7 (Choi and Kim, 2009. J. Microbiol. Biotechnol., 19: 217-28).

Publications cited in this specification and references therein are hereby incorporated by reference in their entirety.

For a better understanding of the invention, it is illustrated in the exemplary embodiments and in the accompanying drawing figures, in which:

Fig. 1 shows a graphical representation of the tra i, trb modules used in the examples shown. The coordinates at the blocks illustrating the tra and trb regions correspond to those of SEQ. ID. NO 2.

Fig. 2 shows a scheme for the cloning of the terminal fragments of the tra and trb modules of the pCTX-M3 plasmid in the pLDR10 vector derivative containing the attP region (necessary for chromosomal integration) and generation of the pLDAB plasmid, the precursor of the pLMAB212 plasmid (shown in Fig. 3).

Fig. 3 is a diagram of the sequence blocks of which plasmid pLMAB212 (contains cTx _{-M3 oriT P} oriT) from which the pMOBS plasmid (contains _{cTx-M3-mut oriT P} oriTx-M3-mut) is prepared.

The following examples are provided merely to illustrate the invention and to explain its particular aspects, not to limit it, and should not be construed as being within the scope as defined in the appended claims.

Examples

In the following examples, unless otherwise indicated employs standard materials and methods described in Sambrook J. et al, "Molecular Cloning: A Laboratory Manual, 2 ^nd edition. 1989. Cold Spring Harbor, NY Cold Spring Harbor laboratory Press ”or manufacturers' recommendations for specific materials and methods have been followed. In particular, the strains of Escherichia coli DH5a [F ~ (<I> 80dlacZAlVI15) recA1 endA1 gyrA96 thi-1 hsdR17 (rk'mk ⁺ ) supE44 relA1 deoR J (/ acZYA-argF) U196] (/ acZYA-argF) U196] were used in the examples given. Escherichia coli JE2571 Rif ^R (leu thr thi lacY thy pil fla) (Bradley 1980), Pseudomonas putida KT2442 (Rif ^R ) (derived from CM Thomas, Birmingham, UK), Agrobacterium tumefaciens LBA1010 Rif ^R (obtained from D. Bartosik, Instytut Microbiology, University of Warsaw), Ralstonia eutropha 7MP228r (obtained from K. Smalli, Braunschweig, Germany). Bacterial cultures were carried out in LB medium (Kahn et al. 1979) or on LB medium solidified 1.5% agar at a temperature of 30 ° C, 37 ° C or 42 ° C (Diederich et al. 1992, Sambrook et al. 1989). In certain cases, the media was supplemented with antibiotics: chloramphenicol 10 μg ml · ¹ , kanamycin 50 μg ml · ¹ , rifampicin 100 μg ml · ¹ and tetracycline 20 μg ml · ¹ . Plasmid DNA isolation was performed using appropriate kits (A&A Biotechnology, Promega); PCR, site-directed mutagenesis and bacterial transformation were performed by standard methods (Sambrook et al. 1989). Restriction and modifying enzymes used in accordance with the manufacturers' recommendations and the products of Fermentas, Roche and Kucharczyk TE were used, respectively.

The list of plasmids used and obtained by the methods presented in the plasmid examples below is presented in Table 1.

PL 230 884 Β1

Table 1

Provides an inventory of the starting plasmids used in the embodiments and the derived plasmids derived therefrom

Plasmid Highlights Source

Vectors and other plasmids used pCTX-M3 Gołębiewski et al., 2007, Antimicrob. Agents Chemother., 51: 37893795 pCTX-M3 orf 35 :: cat the pCTX-M3 derivative contains the cat gene instead of orf35 M. Gołębiewski pCTX-M3 orf46 :: cat pUC 18 the pCΤΧ-Μ3 derivative contains the cat gene instead of orf46 M. Gołębiewski cloning vector οπ _ρ μβι, Ap ^r Vieira and Messing, 1982, Gene, 19: 259-268 pUC19 ori cloning vector _pM Bb Ap ^r Vieira and Messing, 1982, Gene, 19: 259-268 pLDRIO vector for integration into attP, Ap ^r , Cm ^r Diederich et al. 1992, Plasmid 28: 14-24 pLDR8 integration helper plasmid, Diederich et al. integrase gene 1992, Plasmid 28: 14-24 pACYC184 _{ori P} and ₅ A cloning vector, Tc ^r , Cm ^r Chang and Cohen, 1978, J Bacteriol. 134: 11411156. pET28A pOriT Cloning vector Km ^r Novagen oriTcrx-M3 (31616-31721) in the vector pMI3 - οπ _ρ μβι, Cm ^r . M. Gołębiewski pBBRlMCS-2 pABB19 cloning vector, ori _pB BRi, oriT _RK 2, Km ^r Koyach et al. 1995 vector, ori _pMB i, Ap ^r Bartosik et al. 2012 J Microbiol Methods, 158: 1183-1195 pABB20 vector, ori _R A3 _? Km ^r Bartosik et al. 2012 J Microbiol Methods, 158: 1183-1195 pBSULOO derivative pAT28, ori _pM Bi, οπ _Ρ ΛΜβΐ, Spc ^r Ap ^r Aymanns et al., 2011 PLoS One, 6: el9822 Plasmids for splicing trb PUCA0118 fr. pCTX-M3 (31285-32022) amplified with primers FtraHind and RtraPst (HindIII, Pstl), cloned into HindIII-Pstl pUC18 pUCA0218 fr. pCTX-M3 (52154-54408) amplified with primers FtraSal and RtraXba (Sal, Pstl). cloned into Sall-Xbal pUC18 pUCA0318 derivative of pUCAO118 with sequence substitutions nothing introduced with primers FnicM and RnicM pUCA3218 fr. KpnI-Sall pUCA0218 cloned into pUCA0318 KpnI-Sall pUCB0219 fr. pCTX-M3 (87807-89020) amplified with FtrbNco-RtrbEco primers (Sad, EcoRI), cloned into Sacl-EcoRT pUC19

PL 230 884 Β1

pUCB0318 fr. pCTX-M3 orf46:: cat (83021-85053) amplified with primers LtrbXba and RtrbBam, cloned into Smal pUC18 pUCB3219 pUCB32! 9B fr. SalI-KpnI pUCBO318 pUCB0219 cloned into SalI-KpnI derivative pUCB32! _9? deleted fr. Bspl407I (1543-1729) pLDl pLDB pLDAB pB $ 3-1 pLMAB2 derivative of pŁDRIO, removed fr. BsmI (1713-2120) fr. EcoRI-BamHI pUCB32I9B cloned into EcoRI-BamHI pLD1 fr HindTH-BamHI pUCA3218 cloned into HindLU-BarnHI pLDB Derivative of pCTX-M3 BstI 1071-StuI (54309-57986), minireplicon, Ap ^r fr. pBS3-1 (3624-2152) containing replica pCTX-M3, amplified with primers LRepCM and RepANB2 (NotI), cloned into Not! pLDAB pSN17 pLMAB202 pCTX-M3 derivative orf46 :: cat, fr. Ndel-SphI (53187-59797) and SphT-Ndel (80753-626) fr. Bspl407I pSN17 (11410-14854; 84420-87864 in pCTX-M3) cloned into Bspl407I pLMAB2 pSS29 pLMAB212 derivative of pCTX-M3, Swal-SalJ (30630-59552) and Sall-Swal (64145-64426) fr. AatH-Nhel pSS29 (729-21542; 31362-52175 in pCTX-M3) cloned into Aatll-Nhel pLMAB202 pAL-AS14 fr. pLMAB212 (92-359) amplified with primers FAatH and RnicSpe, cloned into Smal pAL3 pAL-SP3 fr. pLMAB212 (356-1622) amplified with FnicSpe and RPshAI primers, cloned into Smal pAL3 palap palAPKl fr. Spel-Pstl pAL-SP3 cloned into Spel-Pstl pAL-AS14 fr. pET28a + (3943-4832), contains the kanamycin resistance gene, amplified with FKanSpeż and RKanSpe (Spel) primers, cloned into Spel pALAP pMOBSK pMOBS fr. Aatll-PshAl pALAPKl cloned into pLMAB212 AatH-PshAl derivative of pMOBSK, deleted fr. Spel-Spel with the kanamycin resistance gene OriT bearing plasmids pAL3 pALoriT pBBToriT fr. BstUI pUC18 containing lacZ gene and MCS cloned into ScaI-PvuII pACYC184 fr. EcoRl-Pstl pOriT incl. OriTpcrx-M3 cloned into EcoRl-Psrl pAL3 (pl5A replicon) fr. Xbal-Pvul pALoriT contains tetracycline resistance gene and oriTpcrx-M3 cloned in Pvul-Xbal pBBRlMCS-2 (pBBRl replicon) " pToriT pToiiTB pLMKoriT2 PBBToriT derivative, deleted BSal-Bstl 1071 containing MOBro. PToriT derivative, deleted. BamHI BamHI with the kanamycin resistance gene fr. pToriTB (2310 ^ 1127) amplified with primers FKanAatH and oriTminDAatll containing the gene for kanamycin resistance and oriT _p crx-M3 (AatII) cloned in AatU pBS3-1 (replicon pCTX-M3) pABB19oriT fr. BamHI-Pstl ρΟιίΤιηίη (181-293) incl. OriTpcrx-M3 cloned into BamHI-Pstl pABB19 (replicon pMBl) pABB20oriT fr. HindIII (filled) -BaniHI pABB19oriT (417-541) cloned into PvuII-BamHI pABB20 (RA3 replicon) pBSUoriT Fr. Pael-SacI pOriTmin incl. OriTycrx-M3 cloned in Pael-SacI pBSUlOO (derivative of pAT28, replicon pMB 1 / ρΑΜβ 1)

PL 230 884 Β1

The staters used in the PCR reactions performed in the examples below are shown in Table 2.

Table 2

Shows the name, the sequence of the primers used in the PCR reactions, and the template used in the reaction

Name Sequence PCR matrix FtraHind Starters for folding tra trb CATACCCTTTCGAAGCTTTCAGC pCTX-M3 RtraPst CTCCTGCTGCAGTTTCTGTGC pCTX-M3 FnicM GTACGGGACAATATATTGGTTTTTGGAGTACCGC pCJX-M3 RnicM CTCCAAAAACCAATATTGTCCCGTACTTAAATACC pCTXM3 FtraSal GCAGGGTCGACTTCTATCTTCGCTAGCGG pCTX-M3 RtraXba ACTCTCTCTAGAACTCCGGGTTAC pCTX-M3 FrrbXba AGATCTAGAAAACGTTGCTTAACGTGAG pCTX-M3 orf46; ; cat RtrbBam TTCCAGGATCCCCTGGTACGCAGCGCAG pCTX-M3orf46 :: cat FtrbNco (Sac) CGGTTGAGCTCGTCGAGAATGGATTTAGC pCTXM3 RtrbEco AATAGAATTCCTCTGACACCCTCTC pCTX-M3 FrepCNI GTGGCGGCCGCGTAAGAAACCATTATTATC pBS3-1 RrepANB2 TAGGCGGCCGCGGTCTCGCACCCCTGCCGTCTTACG pBS3-1 FAatll Mutagenesis primers nic site TTCTGACGTCACATCAGGCAAGTCG pLMAB2! 2 RnicSpe AACCGAACTAGTCCCGTACTTAAATACCTC _P LMAB2I2 FKanSpe2 GAACTAGTCATGAACAATAAAACTGTCTGC pET28a + RKanSpe AGACTAGTATCCGCTCATGAATTAATTC pET28a + Fnic Spe GGACTAGTTCGGTTTTTGGAGTACCGCCGACAC pLMAB212 RPshAI GAAGACCGATGTCTGCAAATGTCTTATGC pLMAB212 FKanAatll Kan-oriT kioning primers ATGGACGTCAGCTACTGGGCTATCTGG pToriTB oriTminDAatll TTGGACGTCTGCAGAGATAGCTAACCTCGTTAGG pToriTB orf35uEc Starters to check the integration TCG A ATTCGAC ATTATTGGG AGGGC ybhB122 CTGGC AAGCGCCTCGATTAC ybhC159 ACCAGGCGCGGTTTGATCAG

Example 1

Preparation of plasmids for mobilization, bearing οπΤ _ρ οτχ-Μ3

A series of mobilization plasmids harboring ογϊΤ _ρ οτχ-μ3 was prepared. These plasmids differ primarily in the replicon and consequently also in the range of hosts in which these plasmids can replicate.

The EcoRI-Pstl fragment of the pOriT plasmid was cloned into the pAL3 vector to obtain the pALoriT plasmid (p15A replicon). From this plasmid, the Xbal-Pvul fragment was also transferred into a plasmid with the broad host range of pBBR1MCS-2, obtaining plasmid pBBToriT, from which the RK2 plasmid mobilization region (BsaI-Bst11O7I) was then removed, yielding the plasmid pToriT (PBBrl replicon). The pOriT plasmid also served as the source of οπΤ _ρ οτχ-μ3 for cloning in the pABB 19 vector and obtaining the plasmid pABB19oriT (replicon pMB1). From this plasmid, the HindIII (stuffed sticky ends) -BamHI fragment was also transferred into the broad host range pABB20 vector (in place of PvuII-BamHI), resulting in the plasmid pABB20oriT (RA3 replicon). To prepare the template for amplification of the cTx _{-M3 oriT P} region with a tetracycline resistance gene, the BamHI-BamHI fragment was removed from the pToriT plasmid, thereby removing the gene encoding kanamycin resistance. From the template prepared in this way, using the FKanAatII and oriTminDAatII primers, the DNA fragment was amplified, which was cloned in the AatII site of the pBS3-1 plasmid (pCTX-M3 minireplicon), resulting in the plasmid pLMKoriT2 (pCTX-M3 replicon). The pBSUoriT plasmid was obtained by cloning the Pael-SacI fragment of the pOriTmin plasmid in the Pael-SacI site of the pBSU100 plasmid.

PL 230 884 Β1

Example 2

Comparison of the mobilization efficiency of plasmids carrying οπο _ρ οτχ-Μ3

The conjugation efficiency of E. coli DH5a carrying the plasmids pCTX-M3 or pCTX-M3orf35 :: cat (plasmid derived from pCTX-M3 with the introduced cat gene in place of the orf35 gene) or pCTX-M3orf46 :: cat (plasmid derived from pCTX-M3 with the inserted gene) was compared cat in place of the orf46 gene) into recipient cells E. coli JE2571 Rif ^R. It was found that all three plasmids are transferred in the conjugation transfer with the same efficiency, ie about 10 ^L , which means that every tenth cell was donated by the plasmid.

The mobilization capacity of the pToriT plasmid (PBBR1 replicon, οπΤ _Ρ οτχ-Μ3, Tc ^R ) by E. coli cells carrying the plasmids pCTX-M3 or pCTX-M3orf35 :: cat or pCTX-M3orf46 :: cat into recipient E. coli JE2571 cells was compared RifR. It turned out that the pToriT plasmid in the presence of the helper plasmid pCTX-M3orF35 :: cat is mobilized with nearly 1000 times higher frequency than in the presence of each of the other two plasmids (more than 10 ¹ vs less than 10 ^{3, respectively} ). An increased frequency of pToriT mobilization in the presence of pCTX-M3orf35: mat as compared to pCTX-M3 was also observed when A. tumefaciens cells were recipients.

In the above example it was shown that the deprivation of the genes encoding the pCTX-M3 plasmid conjugation system of the orf46 gene is irrelevant for mobilization, while the removal of orf35 increases its efficiency 1000-fold.

Example 3

Generation of the pMOBS plasmid, preparation of the trb gene cassette for chromosome integration and generation of the E. coli S14 strain

The finally obtained plasmid pMOBS (SEQ ID No. 2), which was used to integrate the tra and trb gene regions into the bacterial chromosome, was created as a result of the cloning of its individual fragments obtained by PCR amplification or excised from pCTX-M3 derivatives (Fig. 2). The individual steps to obtain the final pMOBS plasmid are described below.

In the first stage, on the pCTX-M3 template, using primer pairs FtraHind-RtraPst, FtraSal-RtraXba, extreme fragments of the tra region were amplified, which were then cloned separately in the pUC18 vector at the HindIII-Pstl and Sall-Xbal sites, resulting in the plasmids pUCA0118 and pUCA0218 . Site-directed mutagenesis in the nic sequence in plasmid pUCA0118 using FnicM and RnicM primers introduced nucleotide substitutions rendering this sequence non-functional and plasmid pUCA0318 was obtained. Subsequently, the KpnI-SalI fragment of pUCA0218 containing part of the tra region was transferred into the KpnI-SalI site of plasmid pUCA0318, resulting in plasmid pUCA3218 containing the two extreme parts of the tra region.

At the same time, on the pCTX-M3 template, one of the extreme fragments of the trb region, which was cloned in the pUC19 vector at the SacI-EcoRI site, was amplified using the FtrbNco-RtrbEco primer pair. The second, terminal trb fragment was amplified in pCTX-M3orf46: mat template using FtrbXba-RtrbBam primers and cloned into the Smal site of plasmid pUC18. Subsequently, the Sall-KpnI fragment of plasmid pUCB0318 was transferred into the Sall-KpnI site of pUCB0219, resulting in plasmid pUCB3219 containing the two extreme parts of the trb region. In the next step, the fragment (186 bp) between the Bspl407I sites was removed from pUCB3219 to allow further cloning.

Further cloning was carried out in plasmid pLD1, a derivative of pLDR10 obtained by removing the fragment between the BsmI sites containing the gene conferring resistance to chloramphenicol. First, the EcoRI-BamHI fragment of pUCB3219 (terminal trb fragments) was cloned into pLD1, yielding plasmid pLDB into which the HindIII-BamHI fragment of pUCA3218 (terminal tra fragments) was inserted, yielding plasmid pLDAB (Fig. 2).

Before cloning large fragments of tra and trb regions in pLDAB, the NotI-Notl fragment containing the high copy Pmb1 replicon was removed from this plasmid and replaced with the low copy pCTX-M3 replicon (οπΤ _ρ οτχ-μ3) obtained by amplification with primers FrepANB2 and RrepANB2 on pCTX-M3 minireplicon template, i.e. on pBS3-1 plasmid.

PL 230 884 Β1

Thus, the plasmid pLMAB2 into which the middle fragment of the trb region, Bspl407IBspl407I was introduced, was obtained from plasmid pSN17, resulting in plasmid pLMAB202. Then, the middle AatII-NheI fragment of the tra region from pSS29 was introduced into this plasmid, resulting in plasmid pLMAB212 of 33614 bp (Fig. 3).

Since plasmid pLMAB212 contained a functional nic sequence, it was mutagenized. For this purpose, regions closely adjacent to the nic sequence were amplified on the pLMAB212 template using the FAatII-RnicSpe and FnicSpe-RPshAI primer pairs. The primers were designed such that the introduced sequence substitutions would not introduce a Spel recognition sequence at this point. The amplified fragments were cloned separately in plasmid pAL3, resulting in plasmids pAL-AS14 and pAL-SP3, respectively. Then, the Spel-Pstl fragment of plasmid pAL-SP3 was transferred into pAL-AS14, resulting in the plasmid pALAP. The gene for kanamycin resistance, obtained by amplification using the FKanSpe2 and RKanSpe primers on the pET28a + plasmid template, was introduced into this plasmid in place of the Spel (i.e. in the modified nic sequence). Thus, the plasmid pALAPKI was obtained, the AatII-PshAI fragment of which was used to replace the corresponding fragment of wpLMAB212. The introduction of the kanamycin resistance gene into the mutant sequence did not allow the selection of appropriate transformants and the isolation of the pMOBSK plasmid. In the last step, the Spel-Spel fragment (containing the kanamycin resistance gene) was removed from the pMOBSK plasmid, resulting in the plasmid pMOBS (the sequence of which is shown in SEQ ID NO: 2).

In order to introduce the conjugation transfer genes into the E. coli DH5a chromosome at the attB site, the Eco31I-Eco31I fragment containing the οπΤ _Ρ οτχ-Μ3 replicon and the gene conditioning ampicillin resistance was removed from the pMOBS plasmid. Then, the incompatible cohesive ends were filled in the molecule, ligated and transformed with such DNA containing the tra and trb gene modules necessary for mobilization to transform E. coli cells containing the pLDR8 plasmid carrying the λ phage integrase gene. Selection of transformants was performed according to the recommended procedure (Diederich et al. 1992, Plasmid, 28: 14-24). In this way, the E. coli S14 strain was obtained, and the correct integration was confirmed by PCR with primer pairs ybhC159-orf35UEc and FtrbNco-ybhB122.

Thus, a low copy plasmid pMOBS carrying tra and trb genes pctX-M3 and replicon _οπ Ρ οτχ-Μ3, a marker for selection of cells carrying the plasmid is the cat gene for chloramphenicol resistance factor, which can be removed. Starting from the E. coli DH5a strain, after introducing the tra and trb genes into its chromosome (with the cat gene as a selection marker), an E. coli S14 strain capable of mobilizing οπ pla _ρ οτχ-μ3-bearing plasmids was obtained.

Example 4

Comparison of the mobilization efficiency of the pToriT plasmid by E. coli DH5a strains carrying the pCTX-M3 plasmid or the pMOBS plasmid and the E. coli S14 strain containing the tra-trb genes in the chromosome

The mobilization efficiency of the pToriT plasmid (plasmid carrying οπΤ _ρ οτ3-μ3 with the sequence presented in SEQ ID NO. 1) was compared by E. coli DH5a strains carrying the pCTX-M3 plasmid or the pMOBS plasmid and E. coli S14 strain containing the tra-trb genes in the chromosome into recipient cells of E. coli JE2571 Rif ^R. It was established that in comparison with the pCTX-M3 carrying strain (mobilization efficiency per 1 donor cell is 10 ³ , i.e. every thousandth plasmid carrying cell is the donor of the mobilized plasmid), the pMOBS carrying strain mobilizes with an efficiency nearly 1000 times higher (nearly 10 °), and the E. coli S14 strain more than 10 times higher (10 ² ).

The example shows that the cells carrying the produced pMOBS plasmid according to the invention are able to mobilize plasmids with 1000-fold greater efficiency than pCTX-M3, while the produced E. coli S14 strain mobilizes plasmids 10 times more efficiently than pCTX-M3.

Example 5

Comparison of the mobilization efficiency of plasmids carrying οπΤ _ρ στχ-Μ3Ζ with different replicons

The mobilization efficiency of plasmids based on different replicons (ori) was compared. The results obtained for the mobilization efficiency are shown in Table 3 below.

PL 230 884 Β1

Table 3

Summary of the mobilization efficiency of different replicons by different donor strains to different recipients

plasmid pABB19oriT pABB20oriT pALoriT pLMKoriT pToriT pBSUoriT replicon pMB1 RA3 P15A incL / M pBBR1 pBBR1 / pAMp1 Recipient Giver SM E coli E.coli DH5a (pMCBS) 100-10-1 '1Óo .......... Hello Wisei β · » A. tumefaciens E. coli S14 10-2 10-3-10- ⁴ i · '. •' i r, L> -J, ®B! 'λΎ · 4®>' £ 'Ί; at 0¾ ϋβί WiS. W # w W |||| is es R. eutropha E. coli S14 10-3-10- ⁴ I8i ^ «Μ B · ® » L. lactis E. coli DH5a (pMQBS) 10-4-10-5

Thus, plasmid pLMKoriT2 carries a replicon plasmid pctX-M3 - _οπ Ρ οτχ-Μ3 plasmid pABB19oriT carries a replicon wysokokopijnego cloning vector pUC19 a narrow host range - _οπ ρ μβι plasmid pToriT carries a replicon plasmid pBBR1 broad host range - ori _P BBRI. plasmid pABB20oriT carries a replicon of the low copy number plasmid RA3 with a wide host range - ohras, and plasmid pALoriT carries the p15A ori, a medium copy number and narrow host range replicon. All these plasmids contained οπΤ _ρ οτχ-μ3, which required mobilization.

The ability to mobilize these plasmids by the E. coli S14 strain into the recipient cells of E. coli JE2571Rif ^{R was} tested. The high copy plasmid pABB19oriT was mobilized at a frequency of 10 °, that is, each cell of the S14pabbi9oht strain became a donor of this plasmid. The plasmid was mobilized pLMKoriT2 a frequency of approx. 5 χ 10 ⁴ pToriT plasmid was mobilized with a frequency of 10 ² -10 ^3, and the plasmid was mobilized pABB20oriT with a frequency that differs in the following experiments 5 χ ^{3 of} 10 to 10 °. Plasmid pALoriT in the presence of a helper plasmid was mobilized pMOBS a frequency of 10 ° -10 ^1. At the same time, when these plasmids did not carry οπΤροτχ μ3, they did not mobilize.

Plasmids into which the _{cTx-M3 oriT P} sequence has been introduced are mobilized by the E. coli S14 strain with a different frequency, depending on the replicon carried, for the high copy plasmid pABB19oriT up to 10 °.

Example 6

Study of the efficiency of mobilization of plasmids carrying οπΤ _ρ οτχ-Μ3 by E. coli S14 strain to representatives of α-, β- and γ- Proteobacteria

The E. coli S14 strain prepared in Example 3 was used to mobilize plasmids harboring _{cTx-M3 oriT P to} representatives of α-, β- and γ-Proteobacteria, Agrobacterium tumefaciens, Pseudomonas putida and Ralstonia eutropha, respectively. Plasmid pToriT (pBBR1 replicon) was mobilized into A. tumefaciens at a frequency of 10 ³ -10 ⁴ R. eutropha 10 ³ -10 ⁴ P. putida 10 ^4. The plasmid pABB20oriT (RA3 replicon) was mobilized to A. tumefaciens with a frequency of 10 ² , and to P. putida even 10 ¹ . The E. coli S14 strain and DH5a with the pMOBS plasmid were used to mobilize the pBSUoriT plasmid (pMB1 replicon in E. coli and ρΑΜβ1 in L. lactis) into L. lactis. In both cases, the plasmid was mobilized pBSUoriT a frequency of 10 ⁴ -10 ⁵ per one cell donor.

The pCTX-M3 plasmid conjugation system is capable of mobilizing the plasmids to various Gram negative bacteria belonging to the α-, β- and γ-Proteobacteria groups, but also to Gram positive bacteria such as e.g. Lactococcus lactis.

In the sequence list below:

SEQ. ID. NO: 1 shows the nucleotide sequence of the oriT _P CTX-M3

SEQ. ID. NO. 2 shows the nucleotide sequence of the resulting pMOBS plasmid

PL 230 884 Β1 <110> Institute of Biochemistry and Biophysics of the Polish Academy of Sciences <120> Helper plasmid, strain and system with a broad host spectrum for plasmid mobilization and their applications <130> PK / 1670 / AGR

<160> 2 <170> Patentln version 3.5 <210> 1 <211> 106 <212> GOUT <213> citrobacter freundii

<400> 1 agatagctaa cctcgttagg gggtgtcggg gcttgccctg accaagacgt ttttggacgg ccgccgcgtg rcggcggtac tccaaaaaca catcrtgtcc cgtact

106 <210> 2 <211> 33614 <212> DNA <213> artificail <400> 2 aattctcatg tttgacagct tatcatcgat aagctttcag cttcttaatg tcagacttaa gttcatcgag tacgtgcttt ttctcaagcc tttctgacgt cacatcaggc aagtcgtcga gaatgctttt gaattttccg atgtcctcac tgctatagaa tgctttcttt tttgcaggca tatgccctcc caataatgtc aaaatcgacc atgcctaacc ggagaaaatc ggacaaggct attcaggtga ttttacatga tgcccggcat gattcaattg ctctgcctgc caggcccttc gctgctggca ttcaaacagc gccgatggta gaattcaatg aggtatttaa gtacgggact agttcggttt ttggagtacc gccgacacgc ggcggccgtc caaaaacgtc ttggtcaggg caagccccga caccccctaa cgaggttagc tatctgatga gccgtagcga gagcagaaaa acagacgatc gaatccaggt gagatgttcc acagaagtga aagctaaact caccgaaaag gcccatgaag cagggcttag tcttagtcaa tatcttatca aatctgggct tggaaagcgc attcaatcga aaggtaatta caatgcactt gccgctcttg taaagataac agcccttcaa aaacatctgt ttaacgaagg tgccggagtt catagcaagg agtattcaga gattctgatc gaggtcaaaa aggccgcaca gaaactgcaa caggagatgg atggtgatac ctaaaatcat tgagggccga agggacaaaa agtccagctt tggtcagctg attaagtaca tggcagacaa gccgtctcag gagttg ACTG atacagttca gcctactcct gagacggctt tagctgttaa atcggatatg ttcgaagggt taaacaatta cctgacccgt aagcagaaag tgatcagcac accggtggat gttgagccag gtgtacagcg tgttgtggtt ggtgatgtta cctgccagta caataccttc tcgctcgatg gtgcagcaca ggaaatgaat tcagtttctc agcaaagcac acgctgtaaa gatccagtta tgcactatgt tctttcatgg cctgactatg aaaagccgaa tgatgatcag gttttcgatt cggtgaagtt tacactggca tcgatgggca tgtccgatca

120

180

240

300

360

420

480

540

600

660

720

780

840

900

960

1020

1080

1140

1200

PL 230 884 Β1

ccagtatgtt gctgccatcc accgggatac agataacctg catgtgcatg ttgctgttaa 1260 ccgcatcaat ccccagacat ataaagcagc ctcatcgagc tttaccaaag acactcttca 1320 tcaggcgtgc cgcttactgg aattgaagaa tggttggtcc cattcaaacg gtgcatatgt 1380 ggttaatgac cgtcaacaga ttgtccggaa ccctcacagc aagaaagagc ggggcaactg 1440 gcgctcactc gatcgcatca acaagatgga gaataaagag ggggttgaaa cgctctatcg 1500 ciaratcgtt ggigatgaac aggtaggcgg tagtcgtcaa aacttgatcc atgtttcagc 1560 tgggcttcgt gaagccaaaa gctgggatga tgtgcataag acatttgcag acatcggtct 1620 tcgtgtcgaa aaagcacagg ggaaaaaggg ctacgtcatt acccacgaac atcaaaacca 1680 gaagacggct gttaaggcga gtctggtatt taacaaggcg caatataccc tgaagtcgat 1740 ggaagagcgc tttggtgaat accagccttc acatattgaa ccggccaaag tatcggtatt 1800 taaaaccgca tatacccctg gtgcttatcg tcgagatgcc aataaacgtc tgcagcgtaa 1860 aattgagcgc gcagaagaaa gaatgctgct caaggggcgc tatcgcgcct accggaacaa 1920 tttaccggta tattctccgg ataaggatcg catcgccgat gaataccgga aaattgccca 1980 acatacccgg ttggtgaaaa ataacgtccg gcattctgtt tcagatcctc ataccagaaa 2040 gctgatgtac aacctggctg agttcaaacg cctgcaggcg gttgccaatc tgcggcttag 2100 cttgcgtgaa gaacgcaacg gtttcagagc ggctaaccca cggctttctt accgggagtg 2160 ggtcgaacag gaagcactga agggtgataa ggcagcgctc agccaaatga ggggctttgc 2220 ctattcctcc aggaagaagg agaagtataa acagcagctg gttgagcaga tcgggttcaa 2280 ccgtaccttt aacgccatca ccagtcatga tcgtgatgat gtggccgtaa tggcctcagc 2340 acgtcatggt gtcaagccac ggcttttgaa agacggtact gttatctttg agcgcgacgg 2400 taaaccggta gcggctgatc gtggtcatat tgtgctgaca gaaagtaatg gaatcgacaa 2460 agagaaaacg gctgatcttg caattgcatt aacgattgct ggtaaagcca aatctgtacg 2520 tgrcgatggt gacggcgagt itaaggaact gigctgtaat cgratcgtcg atgcagcrgt 2580 gaaccacaat caccctgtcg cgcagggcat taccttcaca gatgccgctc agcaggcgta 2640 tgctcaaaac gagaaacatc gtttgattcg tgagcaaaal aatagraaaa atgaaatgca 2700 attcagaagt gaaagagacg acaaattcaa tccgaagtaa aatggagtaa gaaatgaaaa 2760 tcaaaatgca aacggtcctc gcggccgttt ctgtgttagc tcttgccggg tgtgcctctc 2820 aaagcgaaaa ggaaaaacaa atctctgcac agcagctggt agatcaggaa ttgcgtgagc 2880 aagccattaa gataaaactc gcacaggatg agctttacca ggctggagcc attaacagga 2940 cccgttacaa attccctacc attatcaatg caaacagtca gtatgttcgt gtgagctggc 3000 agggtgatgc ttacgaatta ctggagcaac tggctaaaca gcgtggcctt caattcacca 3060 gtcaggggat taagttaccg cttccactca atatcgatgt tggtggttcg aaggttacgt 3120 ttgaacagtt gctgaccctg atccgacaac aaacgcagta ccgtgccacc atcaaccaga 3180 aacccggtga actgcagctg ctttacctca caccatcgaa gaaaggttca ttcctcagag 3240

PL 230 884 Β1

ggacccgccc atgaaactta aactgatcgt gcttctgacg ttaccgctgc ttgctgcgaa 3300 cgttgcacgc gcggacgact ccgatgttaa aggcctggat tactacatgg acccgccaag 3360 ccaaagtgac gatgaggccg atgttactgg cagtatgcta aacgacgcag cgcacaccat 3420 tggatttcgc ggcggtaagg cagaacgcgc taaagaaatt cgcgccgcgc tggaaaatca 3480 gcgcagcaac cttgattaca tgtattcgtt ccagccgctg atctcttctg aaggctacct 3540 gcctccagtc attgctgaag ctaaagacgt tgcacacatt accaatgagc aaatccgaac 3600 ggccaaccgt gcctatgaca ttgtggtgcc ggcgcgcttt gtcagtaacc caccgacatg 3660 gaaaagctat cttctgaccg ggctgatggc gcagcggatc gaattgcctg aaccggcggc 3720 aatgccgaag gacgggaaac aacgtgatat ctggaaaaaa gctgtcgcgc tgggctggtc 3780 tgacggtcgc caaaaagctg atgagatatt cactgctaat ttcaatcgcc tcacacggga 3840 ttacaccggc atgttgcgct acagcacgct actgcagcag ggcatgatta aggctccagt 3900 catcacacag cagcagcaaa cagttacagg ggataaaaac cgcctcatgc tgggcgataa 3960 aacgaaacgt atgaagcagc aagctgagtt tgacatcaac aaacgcagct ggaaaccgac 4020 catacgttaa ggggcagtag atggaagcat tcaattttgg tccaacgctg acgccccaga 4080 cgctggaacg ttttctcgta cactgctcaa acaatgaagt gtccgatatt ctgttgcagg 4140 gcggagataa aatctgggta gaacgtcatg ggcgccagtt gcccatgaca tcttacccgc 4200 tcgacaacct ggagctggaa cgtaccgttg ataaggtgtt cggtcaggag atcaaaggga 4260 cgctgaaaag tgctgcggtc gttaataccg ctatccagct aagaggtgat gaagcgggca 4320 cgattggact cggccgcggc gaaacccgcc ggttccgcgc gaactttact caggccgata 4380 tttataaaac agaagcggca atgtctctga cactccgtgt tctgaatgag gttattcctc 4440 agcttaaaca aatgggtatt gagccggacc tgtttaattc tctgttgccg gctgccggcc 4500 tcggactgat atgcggcgag acgggatcgg gcaagtcaac cttgatggcc agcatattcc 4560 agtattgcgg tgaaacgtac caggaccgga aaatcatcac ggttgaagat cccatcgagt 4620 atcgcctggg aagrcgagac tggattgcgc cggcgccggc acagtcacag attgggcgcg 4680 atattgattc cttccacaat tttatcactc tctccgggct ccgtcgttct ccgaagatta 4740 tgggggttgg tgagctcctt aaccgcctgt catttgaagc tgctgtactg gcaggtaaat 4800 ccggccactt ttgtcttggc acactgcacg tcaaaacggt cggagaagcc atttcccgat 4860 cattgcagaa ctatccgccg gaaatgcgtg aagctgccgc ctttgacctg ctgagtatcc 4920 tttcttacat catcgtgcaa cgcttgctta aaacaaaaga cggccggcgc aaggctgtcc 4980 gtgaatatct cgtcattgat aacagcctgc gccgcaaact ctatgacgtt gattacagca 5040 agtggggccg ctacatcgac gacctgttga tcgctgaaaa ccgcagtctg attcagaatg 5100 cctgggcaat gcaccaggaa ggtttgatcg acgaagcgga agtcatcgag gtcgcaggat 5160 atatggacta tctggcgtta aaagagggca agtatggaca ttaacaaatg gcgttatgcc 5220 ggccggccac tgacggtttt tggtgtgcct gttatctcgt ttcttgtgta cttcatctgg 5280 tttccgttcc cgtcagtaaa aacctttgtt atctgcacct gtgtggttct cttttacttt 5340

PL 230 884 Β1

ctgctggcca tgatgggcta cacgttaccg gtgctgtacc aggtcattct ccgggttatc 5400 cgcgggaaaa aacttaccgg gcggccgtgg tggtaccggc gctctcagcg ataacacata 5460 actacagggg tagacagtat ggcgaaacct gaaattgcaa ctgaaagaac ccgtctgagt 5520 attccctttg acgatcgcca acgtgcaata cgtgcggccg gcaaactggc tgatggcagt 5580 aatgctctgg actacgtgaa ggaagaaaag gtgtggtatg cacagccggg ggccaacctg 5640 agccggctga aagagtggat ttttgacccc aataaggtga tcgaagaacc gcccctggat 5700 attcaagcca ttgaagatga atttacggcg tggcttgaag agcgcggtgc cattatcaaa 5760 gaccccatag agttcgatgg ccagaagcat tatgtcgata cagtggacgg taaagctggt 5820 tcaagaaagg gggtgtatgc cgcctttctg gatggccgac ctgcagggtg gtacagggac 5880 tataagaacg gtggtgaaat tcagaaatgg gtatctaccg gcgcagcccc taaccctgaa 5940 caaatggcca tgctccgtgc tgatgctgcg gcaaggcgtg aacaaagagc tgcagcgcaa 6000 gcggataagt ttgatcagac cgctaaccgg ttgatggaag aatataaccg gcttccggat 6060 gccacgggag atctggcata cctgaaaaac aaacaggtca ttgccgctaa cggccttaaa 6120 gctgatgagc ggggcaacgt tgtgatccct ctgtttaatg ctgatggcga gttcaggacc 6180 cttgagcgca tctggtccga cggtagtaaa caccttgaaa aagacggcca ggcatggggg 6240 agttttttcg ttgtgggtgg ccaactgaag gatggtgaca acctgcttta tgccgaggga 6300 tatgcgacag cagccagtat cagcgaagcc atcaatcagc ctgtgatcat gacggttaat 6360 gccggcaaca tggtggaagt tgctggccgc ctgaaagaca cctttccaaa cagcactcat 6420 tacttccttg ctgacaatga catttataaa gacgagaacg ttgggctaga aaaagcgaca 6480 gaagctgcag agctgactgc cggccatgtt ctggtccctg cctttagcaa cccgaaagaa 6540 gggcttactg actacaacga tttgcatgtc tctgaagggc tggagcaagt cagattgcag 6600 gtagaaggag ccattaatca aatgaacagg gtagacacta tgccgactga taacccgaac 6660 attactgacg ttaatcacag ctcgactgac agcgctgccg ttgcagctcc tgaaaaagcc 6720 gcgccggtgg ccagcacccc tgcagctgct gaaccggtgg aagccgcgcc ggtggccagc 6780 gcccctgcag ctgctgaagc ggtggaagcc gcgccggtgg ccagcgcccc tgcagctgct 6840 gaaccggtgg aaaccgcgcc ggtggcaagc acccctgaag ctgctgaacc ggtggaagcc 6900 gcgccggtgg ccagcgcccc tgcagctgcc gaaccggaat acgtcgcacc aacagatcga 6960 gacggcgatg atgaagagag taatagcgcc agtgatcttg aggcgtatgc cgctatgatg 7020 gcctttggcg gtgaaacaac tgacactgct cagcaaaagc ctgaagggat agcgcccagc 7080 gaacctgtag ctaataccgc cccggctgaa aatgaaaccg aggagaa aaaaacaaac 7140 gaagaactgg aaaacggcat acgctgggca accaacgata atgcagaaac gccaccaaaa 7200 gaacgtatag acctggaagg gttaattgcc cggtttgggt acagagcaga gaaagactat 7260 acggcgtata cgcttgatgg gcaggatgcg ttttacgatt acggttcaca tctgcgtatg 7320 gctacccctg aagccagcca gagtgacgag atgatcctgg cggccgttct taccgcggat 7380

PL 230 884 Β1

aagcaacatc atcgtggtat tgaaatcacc ggcagtgacg aatttaaaga gcgagtgttt 7440 aaccttatca gtgaatacaa cattgaggtg aaactgacta acccagaaca aagggttaaa 7500 ttgctcgaac tcaaaaaagc aaatgaaaca gcaaaagaaa cggcaaaaga aaatgttgct 7560 gattcaaatg cgaataagca ggaaggggca aacgaaaagg caaattcatc agttcagcag 7620 aatggaatgc gctgggaaga atcggcctct gtacagccga agaagcagaa tgcatctgat 7680 actcaaaagg aagataaagc tgcgggtgaa tcctgggaga aaggcgttat cgtcgcgcat 7740 ggacgtgcta agtargagtg gaaagatgat gaarccatga actactttgt caccctcaaa 7800 aatgaacatg gagagaagac actctggggg aaagaccttg agagagcggt taaagatgct 7860 ggtgtagaca ccgaacgtct tgttacagtc agaaagctgg gatttgtgga tgttgaggtg 7920 aatgcacctg tccgtgatga aagcaacaag atcgttcgtt atgaaactat ccagaccaaa 7980 cgtaatgagt gggaagtaaa acctgtatac ccacagccaa cagcagggaa tgaacaggcc 8040 tataagcctt ctgaactggt tccgtatgat gctgcaacct tccagaagct ccgcacaaca 8100 attcagcaga ttaccggrgi tgatcrcagc cgtgaggccg rgccrgaaaa agaactgtar 8160 tggrtcctgc cgaatggraa gccagctcct gaaagcatga caaaacccac aggctataaa 8220 ctccctcaag agtcaaaaac cgcgggtaca cctttgctgg tcgcaccgca taaaaaaggc 8280 gaacgcccgg attattacct tgttgagtct cgtaaaggat tcatgcaggg gatcgcaaag 8340 gataaggaat ctggcgagta ccatagcgta attggtaaag tgaacaagcg tattgataaa 8400 gatggaaact ggaaaacgta tatgacactt tcagcaatca ataaaaatgc agaaagtgga 8460 attgttttgc acggatacgg ccatgttgat cagggaggta aaaacctgct ttacaaaaac 8520 acaattgcaa atgaaaaaca gcctcagcat ttacaaccgg cctcagatga ggtaaaaaac 8580 aaaacagtaa tgaagcagct ttttcatcct tctaatgctg caaaaagaaa agatgatgaa 8640 aggagagaac agactcatgc accagtcgca aagtcagcgc ctcggccata aaacaaaaac 8700 cctactcgta gcagtagggt tttcctgcat ttctgtgagc tcatttgcag ccacacagac 8760 ctgtgcagca tacgaactgg caaaagctgg tgctgatgct gcctataaac aggaggttga 8820 acggattaac aacgccgcta aaagtgaatc cagtacatct gattctctcg gacagtgcct 8880 ggggtcgcta tcggtatcac taaaaatccc tcaatttccg tctatcagcg acatcattga 8940 taaggtgaag gatgaggtat gcaatacggt taaatcgaag ataaatgaga agtgggggag 9000 cctgactaat acaacgcrgg acccgtggtc aacgatttca tcccgactgc cagatacgtc 9060 aggtatcctg cccaacgcat cttctaagaa tgtgcaatta aacaatccgg cagctgcgag 9120 tggaagtggt gaggatgcaa acagtgatgc attcccgttc catttgtaac taccggaaga 9180 gtcctttcgg gattttatcg aatagcttgc cggttcgtat ttcaacgcgg cggtgttccg 9240 ccgcggttag taaacgcata aattctgtgg caggtagaac atcacgtttt gagtctacat 9300 acgtatcaag cgaatcttca ttcatgaaac gtctgacagt atgcagccag tcttcagctg 9360 atttcatatt ttttgagctc atcgtcgctc atctcggcaa acgctgcagg tcggcgacct 9420 tttcctgtcc aggttatgga ctttccatca acttcgatcc ggtacttcac ttttccaaaa 9480

PL 230 884 Β1

gtggatttac ttttcgtgga cggaccaaag agattttcga agatctggag agcttcatca 9540 gccgtaatat tgtgttcttc catgaaccgc tttgtggctg cggctttctc ttcagtggcc 9600 ttctgttctt ccttaaattt ctcgatcatt ccctgtgcaa tgtcggacca catattaatg 9660 agttgctcaa ggttttctgg cggaattttg cgcaaaacgg cggtggcttt tcgtcgttcg 9720 cacatgataa ctgcacagga ttcgtaatca ttatgttcgc tcatgtatac ctcattgttc 9780 attaacgatc tgcgtgattt tctaacacaa acttttgaaa agagaaactc tatgaaaaca 9840 caaaatggtg aaaatattat ggatcaaact gactcggatc aaaactcagt cgttgatgat 9900 gacagcaacg cccttgctcc agctctggct gaagagagta accgaacggt acaagaaatc 9960 gtatcgaaac atggtttaaa agtaattttg attcaaacgc taatcatatt agtcgcaatc 10020 attatcattg gtcttcaggg ttactggctt caccagaaaa aaatcaaata tattgcaacg 10080 aatgggggca tgatcacaga agttcatcca accgatgaac ccgcttacac ggcggaagag 10140 gtgatggact ttgccaaccg tacaatgatc aaatcgcttt cactgaactt Tgtgaattac 10200 gaaaaccaat taaccagcgt ccgcggcgat tttagcgctg aagggtacgt tagtttccgt 10260 aaagcgctgt ccgatagtgg gctgctgaaa gatatcagtg aaaaacgtct gaacgtaaaa 10320 ctttccacaa ctcctggaac cctgatcacg gaaggtctta tccgtggcac caaaacctat 10380 gcctggcaat accgcattcc ggtgactgtt cagcttgttg ggcaggctca ggactacaga 10440 ccgcaacctt acgatttgat ggttcaggta cgccgcgtca aagaagacga agatccacgg 10500 ggtattcaag tagcacaggc cattctcaaa ccccggaact actgaggtca atcatgaaga 10560 ttaaactgtt aactgtactt atggccgcac tgttttcggc aaattctgta tctgcagctg 10620 atgcgccgac tggtaatgga gcgccgcagc aaacggcgcc agctgtgcct ggtggtgata 10680 ttgctcaatg gcagcaggcc agttccgggt tgcccgtaaa tcagcagtca caggtgcaac 10740 agcctccaca gcaaacagca caggaacaag gtcagcagca ggcgcaaggc caacaaccac 10800 aggcacaggc ccaacagcgg ccaacgactg cactgcctcc tgcacccatg ccgcagattc 10860 ciccaccaca gcagcaggtt actcatgtta atccgcagac actggaagag ttacctgcac 10920 ctgttctgca gcagatccag cctattaccc ctggtcaggt gcggtcggcc cgcagcgcaa 10980 tggaagatat gagcgcggcg gccaaaacct caccattaac gccgatccca cgaatttcaa 11040 gccagacggt atcactgtca gctggcgcat ccattccgca ggtacgggta tttccaaacc 11100 aggcaacgac agtgacgttt tcagatgcaa ccggacaccc ctgggtatta ggtgcccctc 11160 catataattc gagtccctgt gcttcaggtg gtgaactgtg tgttggctat attccaggat 11220 cggcggtatt cacaatccag ccgaccaatg cctatgccag cgggaacatc acagtgcttc 11280 tgaaggggct ggccacgccg gtcattatta acgtgaaggg ggcagaaccc tccgttaaat 11340 caaaaaccgt tgatgttgat tatcgtctgg atctccgtat cccgaagcgc agtcctgaca 11400 caccggttta taccgctacg cctgagaaaa aaatctcact gtatgacaag cagctgcaga 11460 gcgtgctcga tggcatcccg cctgaagatg ctcagcggtt gaaacttaaa aacgcgccag 11520

PL 230 884 Β1

ggagtaccaa agtctggcag atcggtgatg agctctacgt cagaagtaac atgcagctgc 11580 aggatgagtt tgaaaaaacg ctttccgcta tcgatggcac acatgtttac gtgctgccgg 11640 caacaccagt gctgactttt tctgttaatg gtcaggcgcg tgacgttgaa gttgagctga 11700 attaagggga acgacgatgg ctacagataa aggtaaagaa accagaaaaa tgatgcta 11760 cgtcggtggt gctgctgcag tggtggcgct tctgggaggg tactggttgt ttggctcatc 11820 agatgagccg gcaacgggcg ggtcgcaggt gaaagcccag gggctggaag ggaaaactgg 11880 cagggaaaaa gctaatgatc cccaatacaa caagctgctg aatgagtgga atgttgataa 11940 ttcagataaa gcggctctca caggggatag cttcatctcc acgttgtcag ccagtaatcc 12,000 ggtggccgtt gattacggca ccaaagcacc gccaccaaaa tattcgtggg aatcgtcagc 12060 aaagccgtcg ggcgataaca gtaaggcgaa tgatgctgag cagaaagagc gtgagcgtca 12120 ggctaaagcg gtggctacgt tactgcagaa aatagaccag gccagaacac cagttgtcac 12180 gggtgttgct cttgcaaccc ctctgggagc agaaggaaat gacaagaacg gcggtacctt 12240 ctcagggtgg accgattcgg tctatccgca gaacaaaaag ccggatgctg aaaaacaaca 12300 gggggcgaag aataaggcca aagataaagg agcccggctt gtatcggctt acacgcttgt 12360 gccggcagta atggatacgg cgatggacag tgacgatcag aacagtattg ctattgccca 12420 tgttccaact ggagcgcagg ccggcgccaa attctattct ggccaaaacc gtcttgccgg 12480 cgatggtatt cgaattcact tcaccggcat ggagctgaac ggagtgcagt gtaaggtcga 12540 tgcgtatggc gtggcttccg actcgttgcg cgcggccgtt tcctcaaatg taaataaccg 12600 ctggttcagc cgtattattc tgccggctgt cgctaacgga ttaggccgaa ctggtcagct 12660 ctatgcggac agcaattcgc agatgattat cactgacggc gggaacgcat atcgttcaac 12720 tgatacacct gatggcaaag cggtagccgg taccattatt ggcgggatgg gtgagcaagc 12780 agggcgtgtc ctggccgacg atgcagcccg cctgccgatt aagcaggtta cggttgaccg 12840 taaccaactc ataggcatcc agtttgtcgc gccagtgtat gaaagcgact gtggcgagaa 12900 tttggaaaat gcttcrgcag agcaggcgca gcagcaagca actccgacac tatctagtgt 12960 gcaacctcag cagatgcctc agcctccggc tcctaattac cctcagcaaa actttccaag 13020 ctaccccggc tacgggtatg gcaccaataa cccgtattac cgttaaggag attgataatg 13080 aatctgtttg aagatgacaa taaaaaagaa gcagctcctg cccaggaacc ggtgtctgct 13140 aagactgctg aaaagccaaa accgacagtg acgccagcag caaaagcaaa caaaaagccg 13200 cttaagatta gtgactatgc atggattggt ggtatcgctg tcatagctat cctgctttta 13260 gtctggttgt ttgggggctc cgatagtggc actgcgcctg cggccgggaa tggcacgatc 13320 cagtcttcag ggcaacgtca gaacgtacag gctgcccctg ccgggcagga ttctggtgac 13380 ttccgcgagc agatttccgg gattttgctg cagcaaaagg aacggctgga cgcgatagaa 13440 tcaacttcta aaaatggaat gatgatcctt tccagtcagt tacaaagcgc taatgagcaa 13500 atcaaaaatc tgaacaatca ggttcaggaa ctgaaaatga aagccgctgg ttatgggcct 13560 tcatttagta atcagagtgg aacaatttcg ggggcaacgt cgcaggcatt acctttgttg 13620

PL 230 884 Β1

agaggttttt caattaatga tttatctggc gatcttgctt gggtaaaata caaaaaccag 13680 acgtatgctg tgaaggtcgg tagtcaactt ggcggagtca ccattacggg tatcgatact 13740 gaaaatagaa tcgttactac aagtaaaggc cttatccgct aaacaggacc taaaaaggcg 13800 aaactatgga tttagaatcg gtattaattc aggttgctaa cggtggtcag gaaccgctga 13860 caaggctaat cataggtgtc gctgcagtcg ttgggatcat tggtgttatt ggatatctga 13920 rgagcctgcg gaagcaggcc aggcattcaa caaaaggtgr ggaagttggc agaattttrg 13980 ccggtatcat cttctgtgta tgcctcatca cgttgaaggc acagatgaac tcaggcggrg 14040 ccactttagg atttggcgat gttagcttcg gacccgtcag ttatgcgagc gaatctacgt 14100 ttggcatggg agccgcagca gtcaacgcag tgctggggat tgttagaatt ctcggcgcat 14160 acttttttta caggggtata aaggggttga aagactctta ccttgagggc catacggagc 14220 tgtcagcttc gggtacgaga ggggcatcca ttgtgaaaat tgtatgtgga ctacttctga 14280 tgttcgatac acaaacgctc gatgcgttgc agagcacatt aaacattcac tggtaatcaa 14340 aaaggatact ttatgaaaat tgttaagctt atcaaagaca aggcattatc tgcatccatc 14400 gcagcgtatc agctgcgcgg aacggtggca aaatcgttag tggtattgcc gctggcatta 14460 ctgagcaaag aggctgcggc tgaaacgact gtctgggaga aaatcaatac cttcacggaa 14520 ggtcttgcca gtacccagcc tggtctgatt accggcggta aagtcattgg tgttgtgttc 14580 tttattgtcg ggcttgtttc tcttttcctt aaaaacaaac gcgggaaaga tatcagtggc 14640 agcttcatct tctggtcaat ggttgttggt gcttgcctgg tcggcctgac cgcatggatc 14700 tcttctgttg gttcaactgt tggcgttgac gcaaccctgt aatgtccctt cggccccgcc 14760 ttgcggggcc aatatcggag ttccctcatg aaagatttta agctcaccag gaatgaacaa 14820 cctgccagat gccatgtgtg cgggataaag agcaaagatg ttttctccct cgcagaagat 14880 ggacagaaag agagaatgct ttgctctgta tgcctgtcgc tcgaacatcc ggagaaaatg 14940 aaactagaga ctcaaaccgg acttctgctg aagagaaata caaaccgaaa actctacagc 15,000 ctgcrgtTtc gttcaartgc aaaggcggaa aagtcaacgg acgartctra ccgtgaaaag 15060 gcgcagaaac ttaaacagat attgctcagc acaactgacg tagttctaaa cgaaaccggc 15120 agtgatgatg gatacgattt actgcacctg ataaaaaaac accatcagtt acttcccatg 15180 aattttgacg atgagtttgt cgcttctgtt gcagagtcag acgaattgcc ggatgtaagt 15240 gactggaatg aaatttacaa gggtaagaga ggttttaaat gatttctttc tttgaggatg 15300 tgatcgaagg tatctcacgc aatctgacat caaatgactc gttaaaatac tgtgatttga 15360 caacggttgt agggcttacg tcgcaggatc gcgttgagca tcctgaaatc agggctccgt 15420 acattctgac cactaagaac aacgattttc ttaccgttat tgaggttcag ggcgctaaat 15480 catcgtttga cgagaagtcg tttaatgact tcatcatgca cctatcaaac tccttgtcga 15540 attcctttat taacagcggc cataagttgt ctgtggtgtt cgaacgcgac tttaccaaga 15600 accaggaaga gctgaataat gtttataaac cgcaggtagc agcaatagag cgtctgcaga 15660

PL 230 884 Β1

tagacattaa agacctgatc gccgatgacg caaaaaaaat cgccgctcat tacagccgtg 15720 aacgcgctta catcgtgctg tatacctcga aggggatgat tgcgaaggat gaacttaaaa 15780 acgaacaggc aaaagctgcc ggcgtactga aggatatccc gcagacgcgc ttcagtcaga 15840 acccaatcga atttcagctt gaaggtttga agatcacgca tgacgcgatg ctgtggcgcc 15900 tgattggtat gcttcagggg gatgatgaat caggaatggg gcttctggtr gatgtcctcg 15960 atgtcaaaca cgctggcgca atgatgcgtc agatgctgtt ccggaattca acatcagaaa 16020 actggtaccc tcgcacgccg tttgaccaaa atctgcgaat ttatggcgcc ccacggaaag 16080 acaatatcga ctccgtgctg ccgccgcggc tgaatatcca gatcatggaa ggggaactgg 16140 aagaagatgg tggcctgatt tactgtgatg gtaagtatta cggctctgtt gcccttgagt 16200 taccaccact tcaccctgtc aaatttaagc agttattcaa cgcgattaac cggaaaatcc 16260 cgtaccggat aaaatatgac tttataggcg ggggcaaaaa agcactgttc tggccatcag 16320 taatcatatc tttccttcgt ttcattccct cactcggtaa tatcgcgcgt gatatggatt 16380 atgtccgggc ccagagcgaa accgatccaa cggctatcat ggccatcaac tttgccacct 16440 ggggcgacac taaggatgaa gccaaacgca acctggcggc tttaactaag gcgattgaag 16500 gctggggtgt atcaggtgtg tccaagacat atggcaatcc aggtagcgca ctgattgcat 16560 ccgtrccggg gctgacgacg gccacaccig gctcairgca ttatccgccg trgagtgaag 16620 gcttgcggat gttacctttt gaacgtccgg ccagiccctg gcatggtaaa ggcaatarca 16680 acttcatcac gctcgatggc aagctgttcc cctatcaaat cgccagtccc ctgcaggaga 16740 aatttaccga tgtcatcacc ggtgttcctg gttccggtaa aagcgtgctg gccaaccgcc 16800 ttaacctgag ttcgatttac cgggctgata aaaaactgcc ttatctgacc atcattgata 16860 agggctacag tgcaaaaggt atcgccgatc tgattagcgc tgagctgccg tcagagaaac 16920 gtcaccagat tgccagtatc accctgaaca atgacgaatc gcactgtatt aacatctgcg 16980 atacgcagtt aggttcaagg tatctgacgc agtttgagga agtattctta aagcagatgc 17040 ttaacgcatt ctgtattgat ccggcaattg gccagccgcc agatgcaatg agcgttggcc 17100 aaatcgtcag taaggttgta tcaaacgtat acaaagcaaa agcgcattca agtgctaact 17160 tgtttaagta taacgacccg gtgattaatg aagctctgaa agaatcaggt ctggataaag 17220 agcttggtga agactggttt gaaagagcta catggtggga agtcgttgat aagctgtttg 17280 ccaaaaaata tcttcatgct gcgacggttg ctcagcgtta tgctgtgcca accattcacg 17340 attttattgc tgaactacaa actgaatcat ttaaaaacca atacgctgac gtaaaagtra 17400 atgggagtga gcctgtagta ggcttcgttg cacgttgctt ccaggctgct gcagctgagt 17460 atgccatttt ctcagggata acggtttatg atttcagccc ggagactcgc attgcgatcc 17520 tggacatgca aaacgtcctc ggtgacagaa cgacacctgc aggtaagctc aagtccggca 17580 ttatgtatct ttttgcgcgc cagatggctg tgcgtaacta ctacctgcct cagtccgcag 17640 aaaccttcat tcctgcttta ccggagcagt acagggcata tcaccaggcg cgcatcaggg 17700 agctttcaga agaggttaaa catacctttt atgatgagtg tcataacttt gccggcatcg 17760

GB 230 884 Β1 actttattca aaatgcgctg aacaccgctg accttgaaga tcgtaaattc aacgtccgta 17820 ctgccttctc gtctcagtat ctgagccata tgccttcgag tgtgcttaaa accatgaaca 17880 gcctgtttat gatgcgcctg acggaagggg atgaagagta tctgaagcaa ttagagatca 17940 acatcccggc cgatatcctg cgtcgtttca gacagcttcc gcaaggggtt tatccggacg 18000 gaagtggtac tgcattcctc ggtattttta aaacaaaacg tggtcttatt tgccacattc 18060 tgaaaaacac attaggacca aaactgcttt gggctttgaa ctcatctgca aaagatagag 18120 cgctcagaga tgtgctttat gaagagctgg gaacgaaaaa agcaagggaa gaattagcaa 18180 atagattccc tatgggaagt gcatcaagta tcattgatga aatggtggtc aatcagggtg 18240 gtgagcgtga ttctgaagaa gaatcacaaa ctatggcgat gaagctcgct aaagaaatca 18300 tttctgatgt gagaagggga ttcagatgat aaaaatcgga aaagcaaaac ggtcagtgat 18360 ggccgtttca attctggcct tcagcgtaca gtcagcattt gcctatacgg tcaacgttaa 18420 cagcagcatt cccatctcaa cgcaggttat gccggcgttg agcacagcta atggcctgtt 18480 aggtaatatc caggccacgc tgattaacat tggtacggca atcagccagc agggcgatcg 18540 ccaggcagca ttaatgcagc aggtggctga aactaaccga cagttc Gaag tcgagcaaaa 18600 acgtaatgac cggctgctgc aggcacagga taagtaccgt gttccggatg atatctgtgc 18660 gcagtctatt ggcggtggcg ccgcgggggt atcctctgcg gccgctggcg gtcagcgaac 18720 gctgggaagc gccagttctg cgaaagatgt taaggctatt tttgaagtgc cggcacgcgc 18780 aaccgacgtg gatgcatctt caacggccga agttcacagc cagtactgcg acagttcgga 18840 ttatgctgca tttggtggga cttcattctg cccaagtgta tctgacatgc cgcgggcaga 18900 tacgtcgctg agctcgttgc tttatggcgc cggcaaagaa ggcaaggcac ctgatctgac 18960 gtttacagat gagcagacag atgcggcgct gcgctatatg aaaaataccg cgttgcgcag 19020 tgctggrcgt cagctgagtc gtggggaagt taaaggcgcc agcgggcgaa Tttacctggg 19080 catgattcag caataccagg cgctcaccga cgcggccgca caacctcaga tggaaatgat 19140 cgccaactcc aaaccgaacc cggccactga tgccgcgctt gcagatgcgc gcaaagtgcc 19200 ggaagtcgaa tcctatttcc aggcgacggc cagtaacagg gcgaaacagc ttaaccgtat 19260 gtctgccaga gagtttgagg aattcgaagt aggtcgccgt tacagcaacc ctgcttacca 19320 ggcgacgctg accaacaaga acaccgaaga tttgatgcgt gagcaaatca atatcgccaa 19380 tctgaacaac tggttagtgc tgaaaaccaa acagcagct g gagaaacaaa atgtgctgct 19440 tggccagatc ctggcgaacg acgcatatca aacatacaaa ccgatgctgg cagcacagct 19500 ggagagtgtg aacgcgggag tatccagaaa atgaccgacg aaaataaaac aggggataaa 19560 gacacagcca aatcagggaa attaaaaaaa ggccttgatg ttgtaacagg tgtcaatgac 19620 ctcccggaag ggaaggctaa acgaacgata tattatatta ctggcatcag cgatatatat 19680 tttattatcg cgtcagtaaa gcaaacattc agcctgctct ttcagcgggc ttcattcgtt 19740 aagaagcaaa taaaaaacct tgatggtcca cctgttgatt ctgatgcaaa tcagccgttc 19800

PL 230 884 Β1

gccgaagtta tgaaacggag caatagacct gtatcagaat tgttggataa ggccagttta 19860 tacaagaaat actggctttg ttgttttttt gcattagtcc tcattctgct ttttttaacg 19920 tctggttatg ccagattgct tctaaatggc tcaccgaaca tgagcttgtt aagagcaact 19980 ctcacctgtg gcgtcctgtt tgctgctggg atctttactt tcattaaggc tctcacatgt 20040 gagttcatgg ggtggcagtt acgaaaccag gctcactctg atgcagagca aggtacgtta 20100 cgttatttcc ttaatgatgg gggagtgcgt aatacattta atttttcgca ggctggtcaa 20160 gagcgggggc cacatgagta aattaaaaag gttgcttcta tctcttttcg ttgtggcgtc 20220 gccttcatat tcagcggatt tggggattga tggcataact gaagcggcta aacgttcagg 20280 tgacctatcg cgtcaaatgt tacataccgt ttttggtgag gtagttaata atccgtttag 20340 cccttccggc gatggcttac ttaataacgt tttcttcact gtcaacgaag ttatcgcgat 20400 tcttgccctt gtctatatgg ggataatcag cattaagaaa cttcaccagg caggtcagtt 20460 gggaagtttc attgagggtg atggcaataa cgcattcaaa attgttaaaa cgacttttgg 20520 gtggttgttg cttgtaccta ccgttgtcgg ttggtctgtg gcgcagctgc tttttctatg 20580 gtgcggttca atcattggcg taggatctgc caatgttatt gcagataaaa cggcttcgga 20640 attagcgagt ggtaaagctg tctatatagc ccctgttatg ccagaaatgg cgtctgttgc 20700 aaaagggatg tttgaaacaa acctttgtgc tttgggtgta aatcagggga ttgctcaaat 20760 ggaggcttct ggccaacatt atgagaataa cgccagaatg caataccaaa caggtgacag 20820 cacatattct atatctgtaa acaacggctc agctgtatgt gggaccgttt cgctgccaca 20880 acgtccagca ggatggactt ctatcttcgc tagcggttat gcggattccg tctacagcgt 20940 tcagcaacaa gcaacggaca cgttgtgggg aaaaatgaag actgctgcag agcagtttaa 21,000 tgcagcatat atggcaaaaa tgcgttccgg ggacggtgag ctgccagatg ttgaaagcgc 21060 gatccagact gctgcgcgtg attaccagct tcaggttcaa catgctgcta attcagcagc 21120 cggtgacgac gaaattgttc aaaaaatgga gtcggatatc aaagagaaag ggtggctata 21180 rcrrggtgrg ractarcaca cattagctac tgcgaatacc gagatgaaag argrrgctaa 21240 cctgaagccg gtagtfccag gaatgagtaa cgatggcgat atcggcta tcgartactt 21300 taaaggcttg ttccaggctt accattctca actgaaaaat agtaattata cgccgcctct 21360 tggcaccgaa tctaacgcac ttgcaaggaa cattgatcaa aaaagccttg aaaatgccgc 21420 cacaactgga gacggaacgt cccttattac aaaaattttc gacttcaacg ttacaaactg 21480 gcttgcaacg agtaactacg gcactggtga tggttacagt gacgtgacca accctttact 21540 caaaatgaaa gctatcggcg attacacgtt aggtgtagct gaggttggac tcgccagttg 21600 gaccgctatc aatgttgcag tgaaggtttc agaagggaag agtctacccg gttttgctgc 21660 gggaatgatg aacaaactta cagggattcg agatgctatt gctggcgtat tagaatcggt 21720 ttcgttcttg gtttacccgc tgttttatag cctctttggt atcggtcttg cactatctat 21780 ctggctgccg tttataccga tgatttattg gtttgttgct atggcagatt ggctggttac 21840 gcttatgaca ggtgtattgg cgtcttccct gtgggcagct acccatatca acattggcca 21900

PL 230 884 Β1

gagtaatgat gagcggagta catatggtta tgtgttcctt atcgatgtaa tgattcggcc 21960 gatgctcatg gtaatggggt ttatttttgc ttctctggcc atcgtagctt tgggaacagc 22020 gttaaacatg atgtrtaaat tcgctatgga acaggtccag tctgactctt rcactggcct 22080 gctgtcatcg atcggatttt tgatgttata tgcaaggctt tgcacaggta tggtggctcg 22140 cgtatttgca cttcctgcga ggatgccgaa ctatgttata aactggattg gacagaagat 22200 gaacgattca gtgtrgggtg atatgcagaa ccatgttcat gacatctttg ctgcgttcgg 22260 tcgtggagcc aaaaatatga accgtaacaa ccctaagcaa tttaarcctg acgcaggtgt 22320 agataagagc aaggacggca tcaaaggagc ttaaatatga atgcgttatc aaacactgac 22380 tttaagaaaa ttagtaacaa tgcgcgtcct aaaaggcttg gatactacgc atcatggctc 22440 tggatgatgt ttgtattcct ctttctgttc gttagcgctt tcgtgtttct gagcggctta 22500 tactggacgg ttagagacgg ttcaattcag gagcactggt ttagtacagt cggtatcttt 22560 gtgatcgatg cagtgctgat ctggatgttg aaaaaggact tcaggagccg caagctctac 22620 caagtaactg cttcaatgaa gaactctggt ttcttcgagc ctcataagga ctgcgagcac 22680 tatgacctgg cccggagaac ttacatcggc tttgacttca gtactggaat cataggagta 22740 gcatccctgt atgccacatc cagtattaaa cgtgagcggc tattttttga agccgaaaca 22800 gtcgagtcat gggagtcagt cggcagggag ttaatcataa acctgcgaaa tacggggctt 22860 acgacgataa cgatcacagc tccaaatatc aataaagcgt acagggatat ggaaatcatc 22920 tgcagaacgc ataaaaatag ggatgaaaac tatcagcatc tgaagagtaa actgacagac 22980 gctggatggt tcataaacag caattattga gtttaacccg ccgaatatgg cgggtttttt 23040 gtgtatactc aagtggttat agtcgtatgt tgtgggagga agtagtgaac agagttactg 2 3100 agcgccagga acagaagagt aacccggagt tctagaggat ccccagatct agaaaacgtt 2 3160 gcttaacgtg agttttcgtt ccactgagcg tcagacccct tatttgagta aatgcgattt 23220 ctgccagaag ggcggcacaa aaaaacccga ctggtgagat cgggttttta tgttttgccc 23280 cggatggagg cgggaacacc taaacaattg acggttaaat attacgccat gagtgcagta 23340 aatgcaaacc acccggaata gggtatactg cgcgggtcaa tctgttgacg ttcttctcca 2 3400 gcccccgctt acgcggcgtg aacggattaa agccctggtt gaaaaacagg tggtgctgtt 23460 tcaatgccct ggctggagtg ggaacatcta aacaattgac gtgaggtagc cgctgtgaca 23520 ggcaatgtaa gggcgatcag cggtgttcct gctctgtatg gagcaaacgg atgattaact 23580 tgttaatcgt cgttctgcgg gctgttgttg cagtgtctaa cgctgtgata gcggtcctgg 2 3640 agctgarccg gcagtatrrt gactgaccgg aaacgtaacT aaaggcgggg ggaccacrcc 23700 ccgcctttta acacaaacct tcatatatga atatcctcct tagttcctat tccgaagttc 23760 ctattctcta gaaagtatag gaacttcggc gcgcctacct gtgacggaag atcacttcgc 23820 agaataaata aatcctggtg tccctgttga taccgggaag ccctgggcca acttttggcg 23880 aaaatgagac gttgatcggc acgtaagagg ttccaacttt caccataatg aaataagatc 23940

PL 230 884 Β1

actaccgggc gtattttttg agttgtcgag attttcagga gctaaggaag ctaaaatgga 24,000 gaaaaaaatc actggatata ccaccgttga tatatcccaa tggcatcgta aagaacattt 24060 tgaggcattt cagtcagttg ctcaatgtac ctataaccag accgttcagc tggatattac 24120 ggccttttta aagaccgtaa agaaaaataa gcacaagttt tatccggcct ttattcacat 24180 tcttgcccgc ctgatgaatg ctcatccgga attacgtatg gcaatgaaag acggtgagct 24240 ggtgatatgg gatagtgttc acccttgtta caccgttttc catgagcaaa ctgaaacgtt 24300 rtcatcgctc tggagtgaat accacgacga tttccggcag trtctacaca tatattcgca 24360 agatgtggcg tgttacggtg aaaacctggc ctatttccct aaagggttta ttgagaatat 24420 gtttttcgtc tcagccaatc cctgggtgag tttcaccagt tttgatttaa acgtggccaa 24480 tatggacaac ttcttcgccc ccgttttcac catgggcaaa tattatacgc aaggcgacaa 24540 ggtgctgatg ccgctggcga ttcaggttca tcatgccgtt tgtgatggct tccatgtcgg 24600 cagaatgcrt aargaattac aacagtactg cgargagtgg cagggcgggg cgtaaggcgc 24660 gccatttaaa tgaagttcct attccgaagt tcctattctc tagaaagtat aggaacttcg 24720 aagcagctcc agcctacacc gtttggcctc ctgattaaca acgccggcaa acgccggcgt 24780 tcagggttac atctcgatca tcggaaacag atcgtcttcc tggtggtaaa gcacgtcgtc 24840 tgtgtccgtc ccatcaagcc agtcagcgaa cagttcaaac aggcacaccg acatttcctc 24900 cggtgaaatt gcgccacact gcagctcgta gaagacctca attttttcca gcaggctgtt 24960 ggccgctttg tcgtagccga acagcttgat cggcgggaag tgcattgcat ccgggttcgt 25020 ttccgccagt tcatcatcct tacgttccgg atagatgctg tacagcgtcg ccggcgatgg 2 5080 cggtaatacc tcgataaagc ggtttatccg catcggcagt tcgctggaaa acttctcatt 2 5140 gtccggaatg taaaacgctg cgctgcgtac cagggcatcc tggaaagaaa ttaccccctg 25200 accttcggtc tgctracgca gctcacgaar gttcacgcgg tccttttcac ggatttggta 25260 cagatcccct tcccggaccg ttttggaaaa cgtgccgtgt tcggcttcct gcccggagag 25320 ctctgaaraa taatcctggc cgacggtttc gcgcagtatt tcaaaggtrt tccggtcttc 25380 aatcgacrca aaatatttca cgcgggtgtt ggcgatcagc gaatccacct cgccgttcgc 2 5440 gccgcgggcg agcgacgggt gatcctggga ggaaaatacg cccattttrt ccagtgaacg 25500 catctgcgca ctcagcgtat ccataccgct ggtgaaatac tggcccagct cgtcataaat 25560 cagcccgtat ggcgcctgat tattcagcgc gtgagtgagc aggacttcct cttttttccc 25620 ttccagctgg tagcccaggt ccttactgat ggtcattcgc tgcagcgtca catataaacg 2 5680 gccaagcgtg gccgcttcac cgcgtgacag ctccagcgac gggatcatga cgatgagaat 25740 gcggtcattg tggaaaatat cgtccatccg gatatcgccg ctgtcttccg gaaaaacatg 2 5800 gccataagtt tcattgaaca gggagagcgt cttcaggaac tgacggctca tgtagttatg 25860 ctgttcgaag gcgcgggctt cccacgtttc cgggtattcc gcgttggcca gcaggaagcc 25920 tggtgtattt tccagataac tttccagcgc ggcgtaaccc tcgctgtgcc agccgttttt 25980 ctttgcctca acgtacagcg cggccattgc cggcagcgac atgtttttct gaatagtgcg 26040

PL 230 884 Β1

ctgtgacaaa agcagttcgc cgcgggcgcg cttataacac agggcattga tcagcgccga 26100 catcatggct tttgccgtat cctgccactg tgccgaatct ccgcccacct gggggagcat 26160 ggattccatc aactggatga tgaaggtcgg cggggcaacg ctgaagaggt tgactgagtt 26220 ggattgcgcg gggatgcttt cctgcttcac caggttcacg aacctgtcaa tactgccggt 26280 cagcaggttg aggacgtaat aatcatcctc acggccgaaa cggcgcgcca gcgaccaggt 26340 ggcgaaggcc agcttgttat ctgctttacc gtctgagagg cagtagccac ggcaccacag 26400 caggaagtta acgataaacc catagaaggt ttcggtttta cccgacccgg tggtaccaaa 26460 aaataccatg tggcgcagca ggtccgtcat gttcagccac agctcgcggc cgaacaggcg 26520 tccccgctca tacccgacat ataaaattcc cttcgctttc tttcgctccc ggaccttatg 26580 cgggatgcga atgggcccca gacggtattc cgcctgggtt tccgtggtca gggtgtcgtc 26640 gaacatttcg cagtctttcg gcattcgcag cggtggccgg aatttacgat ccgtgaatgc 26700 caccatcagc ggcggaagga tgaggatgct cagcagcatg gtaaagggga gaaacagacc 26760 cagcacggtc agtatggcca gcaggccaaa ctgtacgttc ggagtgagga accactccat 26820 gaacgaacca tctgggcgga tgactttttt actgtctaca gattcctgtt gcatagcggc 26880 tccgggttat tctcctattg cctgctgcag gcgggcatcg tctttgacga cggaaaccgg 26940 gatcacatca cccgaatcgg caacgatgga cggggtgccg ataaacccga atttcgcaaa 27,000 tgccatattg ttcgcgtcaa ccaggcgggc gccggtggta tccggggctg ttttcggatc 27060 gtcaattttc gggttcatgg tggtgtatcc catgttaatc gtgtcttccc agcttttcag 27120 tcgggtatct ttcccggtat cgagtacagg agcggcgcgg accatcgagc gcaggtcgcc 27180 ataaacggac acggggaaaa tctcgacgtt atagcgtttg ctcagttcct gcagccgggg 27240 ttccagcgcg cggcagtgcg ggcacatcgg atcggaaaac acatacaggg tgtgtttatg 27300 cccggttgaa agcgagatcg taaagcgtcc gctggtgacg gcatctttca gtgacagcaa 27360 gtcgttatca gccagttttt taggggcttc aggtgctgcc tgaacctgca gctgctccgg 27420 cgcagtgaca ggctgctgca gacccggcgc gggagcatac gagtttgcct gcagtggctg 27480 tgccggctga tgcatattca tcaacgcgcc gttgatggag acgataaagc ccagcgcggc 27540 gactggccag aagataaagt tagacagccg gcgcacggca ttgagtccgc gctgctgttt 27600 cagcttttta cggatattgt tcagcgcctc gatggcctga tattcgtttt caaagcggaa 27660 cagctgcacc gcttcaccag aaaacgtatt gtgcgtcagg atgtggccgc tgccggcatc 27720 atggccaagt ccaaaatgac aggctgacag ggggaaggag tgcagggctt gttcctggta 27780 gcttccgtca gcggaaagat aaagtgtgtt gcgatcggtt tttacggtga gtttcatact 27840 tcctcgctta gagttccagg tgatcgggac gggttgccgg ctgaggttta gccggcgtcg 27900 gttcatcgtc tgtcagtcgc agactgttgt tcggggtgtc gtgcggagct gcaggcggcg 27960 tagccggctc gtcttccgct tcagcgtcag attcaaatgc aaatggcggt ataacgtctt 28020 cctgccagtg agcgaccgga atggcgggat cgcggcggtc aatatggcgg taatggagca 28080

PL 230 884 Β1

gatccagctc aaggcccagc acggccgccc gcacggttgg cgggaatttc gccgcctttt 28140 cttcatcgag cgtcagccgg taactttcgc actgactcca ggcaataacg ccacctcctt 28200 caatgaagaa cttcccgcgg ccggcgcttg aaagtgcata ccataacgtg cggtccacgc 28260 ctttcagcca ccggaaattt gcggatggca gctgcaggtc atcatcgaac agcgcgtaga 28320 gtagcgaacg ggagctgcgg cgcccctttg caaattctct gaacgcttcg cactggctgg 28380 cgacggtcca gagcccggcg gccagcgaar aaicagggaa gccgtctua gtccgcaggc 28440 aggaacggtt gagarcgicg agaatggati tagccgtrgg ccggtcgccc ataaaccgca 28500 gatgtacaaa cgaggctgcg agtgcttttt cccagggtgc cagggaaagg gccgcccctt 28560 gtttacctgt gacaggaata ccttatgtgc ggctttttta cggaggcggc 28620 gtttagcggt atcaatcagg ttatgttcct gggcaaactc aacgggtgac tgcgcgctgc 28680 gtgcttcttc cggatcttca ttcagcagca gctgatcgag gtggccaaac cgggcgagga 28740 tatgggctat ccccggatag ttttttacca tcacccaggg caggttccgg atggtcagtt 28800 tacgggtcag acggtagtaa ggattgcgcg agataaccca gacgaacaac ccgatgatta 28860 aaatgaacag gggaaagagc acgctggccg tgtcgttcat cacgctgata aagtcccaca 28920 gcgaaacctg gtgattatac cgcgccgccg acagcagcat gtcccggcgc tcggtcgcat 28980 tacccggtgt aatggcgtcc ggcagtacac cgtagatcca gtaaagcagg cgacaggctc 29040 cgtaaatcac ataatcacga aagccaaacc acatcactgt gatcatgatg agaagggccc 29100 cgataatcat caggccatca tcccctcccc ctttccgttg tggctggttt tgcatcagaa 29160 cctcagagaa ttttggtaaa ccttcccgat ataccaggcc ttacgcgccg gcgtattgga 29220 gtgatagcgg ccgacaccct gccagaaatc ccccccttcg agaatgatgt tgtatttgag 29280 gatgtaggca ctggccattg cagaggcgca aaagtcgtgc tgcagctgct ccgctctcac 29340 accaaaatca gccgccagct tattcgccca gatggtgttt atctggaatg cgccgtaatc 29400 gtaagtaccg tttttgtttt tatttttcat tcccggtttc ccgccttcag tcagccacaa 29460 ggcgaggaat ccacggagag gaatgtgata aatcigtgct gcttcaacca tgcaggttgg 29520 cagcgggatt gagggcgggg catcaaccat aacaatctcc taatgatttc tatttcgagt 29580 aaaaaatata ccatcaaaag gagatttttt taaatcattt tggtgcgcat aattgagagg 29640 gtgtcagagg aattcgaagc agctttgcac tggattgcga ggctttgtgc ttctctggag 29700 tgcgacaggt ttgatgacaa aaaattagcg caagaagaca aaaatcacct tgcgctaatg 29760 ctctgttaca ggtcactaat accatctaag tagttgattc atagtgactg catatgttgt 29820 gttttacagt attatgtagt ctgtttttta tgcaaaatct aatttaatat attgatattt 29880 atatcatttt acgtttctcg ttcagctttt ttatactaag ttggcattat aaaaaagcat 29940 tgcttatcaa tttgttgcaa cgaacaggtc actatcagtc aaaataaaat cattatttga 30,000 tttcaatttt gtcccactcc ctgcctctgt catcacgata ctgtgatgcc atggtgtccg 30060 acttatgccc gagaagatgt tgagcaaact tatcgcttat ctgcttctca tagagtcttg 30120 cagacaaact gcgcaactcg tgaaaggtag gcggatctat tcrtactcct agatcttarg 30180

PL 230 884 Β1

cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct 30240 tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 30300 tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaagcggccg 30360 cggtctcgca cccctgccgt cttacggggg tgttcatagt tacaacatcc atcatgcttt 30420 tttctgccga gccgttggct cggcggggaa aagcacggtg gggcaaagaa gaatccggac 30480 tggaggtitc igctggccac ccigcccggc atitgccggg igctaacctg ggagcatagc 30540 gaccattctg gccgtcgtgc cgcgtagcgg cgctgaaagg ccaggcatat tcccataatc 30600 cacagaaaat tgagcctgaa taacagtgat ctctttattg aataaagatc tttttaaaga 30660 agttaagagt gtattgcagc ttgttttgac cacgattgca ggtgacttta tttcctcctt 30720 tgcggataac tgtggatagt ggtgatttcg ctgccggtta tccaccggcg gcgccagaac 30780 gtcaaaaaat cacgttggcc acacgttaaa actggaggaa atttgagcag gtcgcgccgg 30840 ctggccagca cgaaaaccgc caggcggcgg taagagaatt acagggggag aaaatcagtg 30900 ataatcaggg ggaccggatt ccctctccag ccccagatcg agctgataca ggtggctgcg 30960 tactcgctgg gtaaactgct caggcgacag cgcgtgcagt tcgtctttcg gcagcgtccg 31020 tatcagatga acggacatgg cgtaagcccg gtcgtcatag ggctgttctg ccagcgcttt 31080 cagcttcttc tcgcgcttac ccttcagggc ggcttcacgc cggcgaacca gcgtggcgtg 31140 catcattttt tcataccagc gccggcgcgc ggctttaaca gagatttctt ccgcctggcc 31200 atgttcatca cgggttatcc agcctgcagc ttcagcggcc acctgttcgg cctgctccgc 31260 atacagctta tcgagatcaa caccgatcat cttccagagg cgttccgtca gcaccacatg 31320 cttggggaac cacttgcggt taaacgggtc ccatgtgacg ccttcaggca gcgccagtaa 31380 cccgaattcc atcatgtgct gcagcagccg gcaaacccgc ggtaccgtca ctttccggat 31440 cacgttccct tcgctgtcct tttcgctgag ctgccacgcc attttactga ggttgatagt 31500 gtcaatatgg gtagcccggt caacggtgct gaccaggagc ggcacaatcg catcgagtaa 31560 ttrctcccgc tccgggcgga agtcgcgctg ccggccagcc tgctcgcgca gctgcacgaa 31620 gtacgggtgg cggctgatcc gcatacgcag acttaacgcg cccgttttgc gatcgcggcg 31680 aacaaggcgg ttgtaggcat ggccaagctg gccagggagc tttttgaaat tgtccggtcg 31740 gtaccagctg ggctccgggc agagacacgc cgttgagtgc gtaccgcgac gacggcgggt 31800 tttgcgcacg ggcctggtgc cttcatcgag aagcagctgc aggggcgatt ctttagggga 31860 ctggctttca agccaggaga tgaactccgg cgaaagacct tctactgact caatgtcaga 31920 aagctgtagg tatggattct tttgattcac cagcccctgc acttattggc cgggctgtat 31980 tgcaataggg tacgcatttg ctataatcct ttctgccagc aaggcagttt gcgccccctg 32040 atttcatctc tgaccggcca aagtgagagg atgaatcagg gggttttact ttttgtggct 32100 cctgccacac cccaagcggt acatctccgg gccgctcttc ccgtgctaaa Ttctgtaata 32160 accccgtaag gttatgtaaa cgccgcttaa catatcatgc gtttctaagc ggggcaatac 32220

PL 230 884 Β1

ctgcgaaccc gcttttacat agtaagatca ctcttcagaa tcgtcaaatt tcaatccgtc 32280 gtaataactt ttgacaagaa attcaatgac ttcagcctga gtgagttttt taacttttgt 32340 gatctctatc aacattcttt ttgcatcttt ggggagataa aggtttaact ggtcgtgtgt 32400 ttcccggata cggttccggt actctctctg gaactccggg ttactcttct gttcctggcg 32460 ctcagtaact ctgttcacta cttcctccca caacatacga ctataaccac ttgagtacct 32520 cgtgatacgc ctatttttat aggttaatgt catgataata atggtttctt acgcggccgc 32580 caggrggcac ttttcgggga aatgtgcgcg gaaccccdta TttgrtraTt tttctaaata 32640 cattcaaata tgtatccgct catgagacaa taaccctgat aaatgcttca ataatattga 32700 aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc ttattccctt ttttgcggca 32760 ttttgccttc ctgtttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat 32820 cagttgggtg cacgagtggg ttacatcgaa ctggatctca acagcggtaa gatccttgag 32880 agttttcgcc ccgaagaacg ttttccaatg atgagcactt ttaaagttct gctatgtggc 32940 gcggtattat cccgtgttga cgccgggcaa gagcaactcg gtcgccgcat acactattct 33,000 cagaatgact tggttgagta ctcaccagtc acagaaaagc atcttacgga tggcatgaca 33060 gtaagagaat tatgcagtgc tgccataacc atgagtgata acactgcggc caacttactt 33120 ctgacaacga tcggaggacc gaaggagcta accgcttttt tgcacaacat gggggatcat 33180 gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt 33240 gacaccacga tgcctgtagc aatggcaaca acgttgcgca aactattaac tggcgaacta 33300 cttactctag cttcccggca acaattaata gactggatgg aggcggataa agttgcagga 33360 ccacttctgc gctcggccct tccggctggc tggtttattg ctgataaatc tggagccggt 33420 gagcgtgggt ctcgcggtat cattgcagca ctggggccag atggtaagcc ctcccgtatc 33480 gtagttatct acacgacggg gagtcaggca actatggatg aacgaaatag acagatcgct 33540 gagataggtg cctcactgat taagcattgg taactgtcag accaagttta ctcatatata 33600 ctttagattg attt 33614

Patent claims

Claims (15)

Patent claims A mobilization helper plasmid that includes a mobilization portion of the tra and trb conjugation system within nucleotides 34 through 23136 of SEQ ID NO. ID. 2 and SEQ. 24,740 to 29,654 ID. 2, more preferably comprises nucleotides 34 to 29,654 of SEQ ID NO. ID. NR 2, and wherein the mobilization helper plasmid does not encode a functional Orf35 protein from pCTX-M3. 2. The helper plasmid according to claim 1, The method of claim 1, which is a pMOBS plasmid, the sequence of which is shown in SEQ. ID. NO 2. 3. A bacterial strain for efficient mobilization of plasmids with a broad host spectrum, containing a mobilizing part integrated into the bacterial chromosome of the tra and trb conjugation system within nucleotides from SEQ 34 to 23136. ID. 2 and SEQ. 24,740 to 29,654 ID. 2, more preferably having integrated nucleotides 34 to 29,654 of SEQ ID NO. ID. NR 2, and such strain does not produce a functional Orf35 protein from pCTX-M3. PL 230 884 Β1 4. The bacterial strain according to claim 1 A bacterium according to claim 3, characterized in that it is a Gram negative bacterium selected from the group consisting of: Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, Morganella morganii, Serratia marcescens, Salmonella entenca. 5. The bacterial strain according to claim 1 The strain of claim 3 or 4, characterized in that it is an E. coli strain into which the mobilizing part of the conjugation system has been integrated into the attB site of the chromosome, preferably it is E. coli S14 strain. 6. A system for the efficient mobilization of plasmids with a broad host spectrum comprising the plasmid according to claim 1. 1-2 and / or the bacterial strain according to claims 1-2 3-5 and a mobilized plasmid containing ohT with a nucleotide sequence, which mycleotide sequence ensures that ohT interacts with this system. 7. The system according to p. The method of claim 6, characterized in that the ohT with a nucleotide sequence which nucleotide sequence ensures that the ohT interacts with said system is οπΤ _Ρ οτχ-Μ3 or or / Tcoiib P9, more preferably οπΤ _Ρ οτχ-Μ3 shown in SEQ. ID. NO. 1. 8. The system according to p. 6-7, characterized in that the mobilized plasmid comprises a replicon allowing replication in the donor, preferably comprises ολ / _ρ μβι from pUC19, o / 7ra3 from pRA3, ohpisa from pACYC184 or ohT _P cn-M3Z pCTX-M3. 9. Use of a helper plasmid as defined in claim 1. 1-2, the bacterial strain according to claims 1 to 2 3-5 or a system comprising a mobilized plasmid according to claim 3, 5 or 5. 6-8 for efficient mobilization of plasmids into the recipient cells, where the recipient cells are Gram negative bacteria: α-Protcobacteria, β-Proteobacteria, γ-Proteobacteria and Gram positive bacteria, especially from the Bacilli class. Use according to claim 1 9. The method of claim 9, characterized in that the mobilized plasmid comprises oriT _P cTx-M3 or onTcoiib-P9, more preferably ohT as shown in SEQ ID NO. ID. NO. 1. 11. The use according to claim 1 The method of claim 9-10, characterized in that the mobilized plasmid comprises a replicon allowing replication in the donor, preferably comprises ολ / _ρ μβι from pUC19, ohras from pRA3, oripi5A from pACYC184 or ohT _P cn-M3Z pCTX-M3. 12. Use of the system as defined in claim 6-8 for introducing genes encoding a beneficial factor for recipient bacteria under a specific environment or conditions in which plasmids containing ohT _p ctx-m3 or onTcoiib-ps, more preferably containing ohT as shown in SEQ ID, are mobilized in conjugation. ID, NR 1, wherein an factor enabling its development in a specific environment or conditions is introduced into the donor cell on the mobilized plasmid, which factor is safe for the donor strain. 13. Use of the system as defined in claim 6-8, for introduction into a recipient strain for integration into the recipient chromosome of a nucleotide sequence introduced on a mobilized plasmid in which the mobilized plasmid does not replicate, where plasmids containing ohT _P cn-M3 or or / coiib-P9 are mobilized for conjugation, more preferably containing ohT ions are shown in SEQ ID NO. No. I. and the mobilized plasmid includes an integrating sequence into the recipient chromosome. 14. Use according to claim 1 The method of claim 13, wherein integration into the recipient chromosome of the nucleotide sequence is carried out to effect transposon mutagenesis, wherein the mobilized plasmid comprises a transposon integrating sequence into the recipient's chromosome. 15. A molecular kit comprising a plasmid as defined in any one of the preceding claims. 1-2 and / or the bacterial strain according to claims 1-2 3-5 and or the system for efficient mobilization of broad host spectrum plasmids as defined in claims 1 to 5. 6-8,