PL220347B1 - Method for DNA amplification by polymerase chain reaction using primers specifics for the thymidylate synthase gene - Google Patents

Description

The present invention relates to a method of amplifying DNA in a polymerase chain reaction with primers specific for the thymidyl synthase gene.

Thymidyl synthase is an enzyme whose gene is located on the 18p11.32 chromosome. Its function is the methylation of uracil monophosphate (dUMP) and the synthesis of thymidyl monophosphate (dTMP), which is successively phosphorylated to thymidyl triphosphate (dTTP), which is then used for DNA synthesis and repair. The role of thymidyl synthase in this process is the basis for the use of this enzyme as a target of chemotherapeutic agents. Inhibition of thymidyl synthase function causes cytotoxicity through a lack of dTTP, lack of replication and consequently cell death. The expression and efficiency of thymidyl synthase mRNA is modulated by polymorphisms within the 5 'untranslated region of the TS gene (UTR) of the nucleotide chain. This polymorphism consists of tandem repetitions of 28 base pairs (bp), which in the Caucasian population occur mainly in two (2R) or three (3R) repetitions, although cases of four, five and nine repetitions have also been described (primarily in African populations). and Asian). These polymorphisms form the following genotypes: 2R / 2R, 2R / 3R and 3R / 3R. In 3R homozygotes inside neoplastic cells, the level of thymidyl synthase is higher than in 2R homozygotes, which is a result of higher TS gene expression in these individuals. Most studies show a decreased response to chemotherapy in people with increased TS gene expression (having a 3R repeat). However, as it turned out - single nucleotide polymorphism (USF-1 G> C) inside tandem repeats can reduce the expression of the thymidyl synthase gene in 3R homozygotes, and therefore the use of chemotherapy has a greater chance of success in such people.

Methods for determining single nucleotide polymorphism in tandem 28 bp repeats in the thymidyl synthase gene are known in the patent literature. The method described in the international application WO 2004037852 / EP 03779160 relates to the determination of the discussed polymorphism, but it differs from the method described according to the invention, is more complicated and time-consuming, so its practical application is small.

The object of the invention is to determine a single nucleotide polymorphism (SNP) occurring within tandem repeated sequences of 28 base pairs located in the promoter region of the thymidyl synthase (TS) gene by means of an allele-specific polymerase chain reaction (ASPCR).

Determining SNPs inside tandem repeats with the method of the invention allows to determine whether a person, despite the apparently high TS expression, which results from having 28 bp triple repeats in the promoter region of the gene, may have this expression reduced and therefore react / fail to respond to a specific drug , be / not be susceptible to a particular cancer.

The method of amplifying DNA in a polymerase chain reaction with primers specific for a single nucleotide polymorphism in the TS gene of the invention is characterized in that primers having the following nucleotide sequences are used:

1. FG sense primer: 5 'CGTCCCGCCGCGCCACTTG 3'

2. FC sense primer: 5 'CGTCCCGCCGCGCCACTTG 3'

3. Antisense R primer (common to both sense primers):

5 'TCCGAGCCGGCCACAGGCAT 3'

The method according to the invention enables the simple determination of the polymorphism of the thymidyl synthase gene. The primers used in the method according to the invention can be used in a simple PCR reaction, as well as in its modifications: Real-time PCR or multiplex PCR.

Measurement of the expression of the thymidyl synthase gene may help in determining the susceptibility to treatment with folic acid analogues (pemetrexed) in patients with colorectal cancer and non-small cell lung cancer (NSCLC).

The determination of the expression level of the thymidyl synthase gene may also help in determining the susceptibility to malignant leukemias, as it has been shown that carriers of the 3R allele, i.e. those with higher TS expression, are less susceptible to this disease (Hishida 2003).

So far, no molecular methods have been used to qualify NSCLC and colorectal cancer patients with pemetrexed.

And adenine

C cytosine

DNA deoxyribonucleic acid

PL 220 347 B1

EGFR epithelial growth factor receptor

G guanine mRNA messenger RNA

NSCLC - non-small cell lung cancer

PCR polymerase chain reaction bbase

RNA ribonucleic acid

Single nucleotide polymorphism SNP

T thymine

TS thymidyl synthase

TTP thymine triphosphate

UMP uracil monophosphate

UTR untranslated region

The invention is explained in more detail in an example without limiting its scope.

P r z k ł a d.

Determination of a single nucleotide polymorphism in a thymidyl synthase gene by allele-specific PCR according to the invention using the three primers listed below:

1. FG sense primer: 5 'CGTCCCGCCGCGCCACTTG 3'

2. FC sense primer: 5 'CGTCCCGCCGCGCCACTTC 3'

3. Antisense R primer (common to both sense primers):

5 'TCCGAGCCGGCCACAGGCAT 3'

In order to perform the PCR reaction you need:

1. Genetic material in the form of DNA isolated from blood, other tissue or human secretion

2. Reaction mixture containing the mentioned starters and other chemical reagents in appropriate proportions

3. Thermal cycler with the possibility of setting optimal temperature conditions

Two reaction mixtures were prepared in 200 μΐ PCR tubes by adding successively: Taq buffer, a mixture of nucleotides, MgCl2 solution, thermostable Taq DNA polymerase, primers (one of the sense primers and an antisense primer were added to each mixture), isolated DNA and supplemented with water free of nuclease up to a volume of 25 μl / sample. These mixtures were put into a thermocycler and a program was set up consisting of 6 steps: initial DNA denaturation, followed by 34 cycles of specific denaturation, primer annealing and PCR product extension repeated 34 times, followed by final extension of the PCR product and final cooling of the sample. The temperature and time conditions of the thermocycler program are given in Table 2. After the reaction was completed, the PCR products were separated electrophoretically on a 2% agarose gel in TBE buffer. The resulting products are visible in UV light in the form of stripes of appropriate size assessed against the size marker placed on the gel. The result is presented as pairs of bands in two wells, since depending on the presence or absence of polymorphism, the FC or FG primer in different mixtures and applied to the gel in two adjacent wells will be attached to the DNA template.

The composition of the allele-specific PCR reaction mixture is presented in Table 1.

T a b e l a 1

Taq buffer (10x) 3 μl Nucleotide mixture (2 mmol / μΐ) 3 μl Mg ² + ions (25 mmol / μΐ) 3.6 μl Taq DNA polymerase (5 U / μΙ) 0.14 FG or FC primer (100 pmol / μθ 1 μl Starter R (100 pmol / μθ 1 μl DNA (20 or more ng / μ ^ 2 μl Nuclease-free water Top up to the desired volume Sum 5 μl

PL 220 347 B1

The thermal cycler time and temperature settings are shown in Table 2.

T a b e l a 2

Stage Temperature Time 1. Initial DNA denaturation 90 ° C 10 min 2. Proper denaturation of DNA 95 ° C 30 s 3. Connecting the primers 62 ° C 45 pp 4. Extending the PCR product 72 ° C 45 pp 5. Final product extension 72 ° C 10 min 6. Sample cooling 4 ° C X

Patent claim

Claims (3)

Patent claim A method of amplifying DNA in a polymerase chain reaction with primers specific for a single nucleotide polymorphism in the TS gene, characterized in that primers having the following nucleotide sequences are used: 1. FG sense primer: 5 'CGTCCCGCCGCGCCACTTG 3', 2. FC sense primer: 5 'CGTCCCGCCGCGCCACTTC 3', 3. Antisense R primer (common to both sense primers): 5 'TCCGAGCCGGCCACAGGCAT 3'.