KR20190056276A - Allele specific primer and method for analyzing identifying genotype of the allele using same - Google Patents

Abstract

The present invention relates to a primer set comprising a primer represented by formula 1 below. [Formula 1] 5′-X-Y-Z-3′, In the formula, X is a first binding region comprising a 15 to 25 bp hybridizing nucleotide sequence complementary to a template nucleic acid to be hybridized, Y is a 3 to 10 bp ring forming region, and Z is a second binding region comprising a 5 to 10 bp hybridizing nucleotide sequence complementary to the template nucleic acid, and nucleotides corresponding to an allele and 1 to 3 bp non-complementary nucleotides continuously binding thereto, wherein X, Y and Z are deoxyribonucleotides or ribonucleotides. The present invention aims to increase detection sensitivity of a single nucleotide polymorphism (SNP) by providing a primer which increases the hybridization specificity to a sequence having an SNP and a method for identifying genotype using the same.

Description

Allele-specific primer of nucleic acid and genotyping method using the same {ALLELE SPECIFIC PRIMER AND METHOD FOR ANALYZING IDENTIFYING GENOTYPE OF THE ALLELE USING SAME}

The present invention relates to a primer having increased hybridization specificity for a sequence having a single base polymorphism and a genotyping method using the same.

Polymorphism refers to a variation of a nucleotide sequence that occurs with a frequency of more than 1%, of which 90% is single nucleotide polymorphism (SNP). The human genetic sequence is 99.9% identical, and SNPs appear one every about 250 to 1000 bp. In the case of the human genome, there are about 2 million SNPs and about 21,000 of these genes are present. In addition, mutations of other single bases that appear with a frequency of 1% or less are commonly referred to as mutations.

Sequencing mutation analysis or SNP plays an important role as a marker capable of not only analyzing DNA sequencing but also discovering genes that cause diseases such as cancer, asthma, diabetes, or determining the association with specific diseases ( Ye S1, Dhillon S, Ke X, Collins AR, Day IN.An efficient procedure for genotyping single nucleotide polymorphisms.Nucleic Acids Res. 2001 Sep 1;29(17):E88-8; ookes AJ.The essence of SNPs.Gene 1999 Jul 8;234(2):177-86.).

Therefore, by analyzing single nucleotide sequence mutations or SNPs, in the case of humans, it can be helpful in preventing or treating congenital diseases caused by differences in base sequences by identifying the individual's susceptibility to specific diseases.

As a method of analyzing single base mutations, PCR-RFLP (PCR-restriction fragment length polymorphism), which uses a specific restriction enzyme to confirm the difference in fragment length of the amplified product after performing PCR, which is a polymerase chain reaction, is specific for alleles. SSP (Sequence-Specific Primed PCR), which is confirmed by electrophoresis after DNA amplification using an appropriate primer, Real-time PCR, which measures PCR amplified DNA in real time using a fluorescent substance, reaction with restriction enzymes at both ends of the primer A method such as SDA (Strand Displacement Amplification) is known in which a primer that has been cut off due to a restriction enzyme is used for amplification reaction after reaction of the primer by adding a possible nucleotide sequence.

However, these methods take an excessive amount of time, and have disadvantages such as possible contamination of non-specific PCR products and expensive equipment and reagents. In addition, in the case of using a specific primer for an allele, there have been attempts to improve the specificity of the primer template, but there are cases where accurate results for genotyping still cannot be obtained. Accordingly, there has been a demand for a method capable of obtaining a faster and more accurate discrimination result for single base polymorphism.

Throughout this specification, a number of papers and patent documents are referenced and citations are indicated. The disclosure contents of the cited papers and patent documents are incorporated by reference in this specification as a whole, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly described.

Republic of Korea Patent Publication No. 10-2014-0056397 (published on May 9, 2014)

An object of the present invention is to increase the sensitivity of detection of single nucleotide polymorphism by providing a primer having increased hybridization specificity for a sequence having a single nucleotide polymorphism (SNP) and a genotyping method using the same.

The technical problems of the present invention are not limited to the technical problems mentioned above, and other technical problems that are not mentioned will be clearly understood by those skilled in the art from the following description.

In order to solve the above problem, the present inventors found that by inserting a non-complementary nucleotide in front of the SNP in the conventional DPO (Dual Priming Oligonucleotide) primer, the specificity of the template containing the SNP is improved, and the present invention Completed.

One aspect of the present invention provides a primer set comprising a primer represented by the following formula 1:

[Equation 1]

5'-X-Y-Z-3'

In the above formula, X is a first binding site comprising a hybridization nucleotide sequence of 15 to 25 bp complementary to the template nucleic acid to be hybridized, Y is a ring formation site of 3 to 10 bp, and Z is 5 to complementary to the template nucleic acid. A hybridization nucleotide sequence of 10 bp, and a second binding site comprising a nucleotide corresponding to an allele and a non-complementary nucleotide of 1 to 3 bp contiguous thereto, wherein X, Y and Z are deoxyribonucleotides or ribonucleotides.

According to an embodiment of the present invention, the non-complementary nucleotide at the second binding site may be contiguous to the 5′ position of the nucleotide corresponding to the allele.

According to an embodiment of the present invention, the non-complementary nucleotide may be 1 bp.

According to an embodiment of the present invention, the ring-forming site is inosine, deoxyinosine, 7-diaza-2-dioxyinosine, 2-aza-2-dioxyinosine, 2-OMe-inosine, 2'- F-inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-OMe-3-nitropyrrole, 2'-F 3-nitropyrrole, 1-(2-deoxy-beta-D -Ribofuranosyl)-3-nitropyrrole, deoxy 5-nitropyrrole, 5-nitroindole, 2'-OMe-5-nitroindole, 2'-F-5-nitroindole, deoxy 4-nitro Benzimidazole, 4-nitrobenzimidazole, dioxy 4-aminobenzimidazole, 4-aminobenzimidazole, dioxy nebulaline, 2'-F nebulaline, 2'-F 4-nitrobenzimid Dazole, PNA-5-introindole, PNA-nebulaline, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, morpholino-5-nitroindole, morpholino-ne Bullaline, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-nebulaline, phospholipid Foramidate-inosine, phosphoramidate-4-nitrobenzimidazole, phosphoramidate-3-nitropyrrole, 2'-0-methoxyethylinosine, 2'-0-methoxyethyl nebulaline , 2'-0-methoxyethyl 5-nitroindole, 2'-0-methoxyethyl 4-nitro-benzimidazole, 2'-0-methoxyethyl 3-nitropyrrole and a combination of the base It can be selected from the group.

According to an embodiment of the present invention, the hybridized template nucleic acid may be selected from the group consisting of the SLC23A1 gene, the APOE gene, the AQP3 gene, and a combination of the genes.

According to an embodiment of the present invention, the primer set is selected from the group consisting of the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 3, the nucleotide sequence of SEQ ID NO: 4 to SEQ ID NO: 6, and the nucleotide sequence of SEQ ID NO: 7 to SEQ ID NO: 9 It may include a primer composed of an oligonucleotide having a base sequence.

One aspect of the present invention provides a composition for discriminating a single base allele comprising the primer set.

Another aspect of the present invention provides a method for determining a single base allele using the composition for determining a single base allele.

In the present invention, the primer set increases the sensitivity to detect single nucleotide polymorphism by increasing the hybridization specificity for a nucleic acid template having single nucleotide polymorphism (SNP), thereby providing more accurate results in genotyping of the target template.

A brief description of each drawing is provided in order to more fully understand the drawings cited in the detailed description of the present invention.
1 shows a primer according to the present invention.
Figure 2 shows the template-specific binding of the primer according to the present invention and whether or not replication thereby.
3 shows the concept of a method for determining genotype using a primer set according to the present invention.
4 shows genotype determination results of SNP rs11950646 of the SLC23A1 gene according to the primers according to the present invention and the primers according to a comparative example.
5 shows the result of discrimination of the genotype of SNP rs11950646 of the SLC23A1 gene using the primers according to the present invention according to temperature.
6 shows the genotype determination result of SNP rs429358 of the APOE gene according to the primer according to the present invention and the primer according to the comparative example.
7 shows the result of discrimination of the genotype of SNP rs429358 of the APOE gene using the primers according to the present invention according to temperature.
8 shows genotype determination results of SNP rs34391490 of the AQP3 gene according to the primers according to the present invention and the primers according to a comparative example.
9 shows the result of discrimination of the genotype of SNP rs34391490 of the AQP3 gene using the primers according to the present invention according to temperature.

Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings. The following description is only for easily understanding the embodiments of the present invention, and is not intended to limit the scope of protection.

The present invention is an oligonucleotide primer having a first binding site, a ring-forming site, and a second binding site, characterized in that the second binding site includes a nucleotide corresponding to an allele and a non-complementary nucleotide contiguous thereto.

Hereinafter, the present invention will be described in detail.

The present invention provides a primer set comprising a primer represented by the following formula 1:

[Equation 1]

5'-X-Y-Z-3'

In the above formula,

X is a first binding site comprising a hybridization nucleotide sequence of 15 to 25 bp, preferably 21 to 23 bp complementary to the template nucleic acid to be hybridized, Y is a ring formation site of 3 to 10 bp, preferably 5 to 7 bp, Z is a hybridization nucleotide sequence of 5 to 10 bp, preferably 6 or 7 bp complementary to the template nucleic acid, and a second binding site comprising a nucleotide corresponding to an allele and a non-complementary nucleotide of 1 to 3 bp contiguous thereto. , Wherein X, Y and Z are deoxyribonucleotides or ribonucleotides.

In the present invention, "primer" is a single-stranded oligonucleotide that is complementarily bound to a template (nucleic acid) to be replicated and serves as an initiation point for replication synthesis, and is used in a nucleic acid amplification or synthesis reaction using a synthetase (polymerase). 'Refers to a nucleic acid molecule in which a nucleotide is added to the end by covalent bonds and extended. Each nucleotide of the oligonucleotide constituting the primer may be a deoxyribonucleotide or a ribonucleotide, but a deoxyribonucleotide is preferable.

The primer according to the present invention includes a first binding site, a ring forming site, and a second binding site (FIG. 1), and the binding specificity of the primer for the binding template is double determined by the first binding site and the second binding site. do.

In the case of template replication, if both the first binding site and the second binding site linked by the ring-forming site are bound to the template, the template replication starts from the primer, but among the first and second binding sites When only one binding site is bound or when both binding sites are not bound, the template does not replicate (Fig. 2).

In the present invention, it is preferable that the second binding site excluding the first binding site and the non-complementary site have a sequence complementary to the binding target sequence of the template, but even if it contains a non-complementary sequence, the primer and the template can be combined. Non-complementary sequences may be included, if applicable. In this case, the non-complementary sequence may be 1 to 3 bp, and 1 or 2 bp, respectively, at the first binding site and the second binding site.

In the present invention, the second binding site may include a nucleotide corresponding to the allele and a non-complementary nucleotide contiguous thereto.

In the present invention, the second binding site may include a polynucleotide represented by Formula 2:

[Equation 2]

5'-Z ₁ -Z ₂ -Z ₃ -Z ₄ -3'

In the above formula,

Z ₁ is a hybridization nucleotide sequence of 2 to 5 bp, preferably 2 or 3 bp complementary to the template nucleic acid to be hybridized, Z ₂ is a non-complementary nucleotide of 1 to 3 bp, preferably 1 bp, and Z ₃ is a nucleotide corresponding to the allele. , And Z ₄ are 2 to 8 bp, preferably 3 to 5 bp, more preferably 3 bp of hybridization nucleotide sequence complementary to the template nucleic acid.

In the present invention, a "nucleotide corresponding to an allele" is a general mutation that appears in one of several DNA bases at a single site of a chromosome, and is a position where a single nucleotide polymorphism (SNP) is observed. In general, single base polymorphism by A, C, G, and T may be observed, and single base polymorphism by A and G or T and C in the present invention is observed. Accordingly, observable SNP genotypes include AA type, AG type and GG type, or TT, TC and TC type.

In the present invention, the "non-complementary nucleotide" is a site that cannot be bonded to the nucleotide of the template because it is arbitrarily altered by selection among sequences complementary to the template, and consists of 1 to 3 bp, preferably 1 bp. The non-complementary nucleotide may be contiguous to the SNP, and preferably contiguous to the 5′ position of the SNP (upstream).

The non-complementary nucleotide may be selected from three types of nucleotides except for one type of nucleotide that is complementary to the template. For example, when the base complementary to the template is A, any one of G, C, and T other than A may be selected and replaced as the non-complementary nucleotide. Even if any of the three nucleotides is selected, the primer according to the present invention can be produced.However, when a non-complementary nucleotide is selected according to the ranking shown in Table 1 below, the higher the non-complementary nucleotide with a higher ranking is selected, the more sensitive it is to detect single base polymorphism Is more improved.

Non-complementary nucleotide Existing sequence 1st priority 2nd rank Rank 3 A G C T T C G A G A T C C T A G

In the present invention, the ring-forming site connects the first and second binding sites, regardless of the type of nucleotide constituting the binding site, and forms a loop without being bound to the template. The ring-forming site is 3 to 10 bp, preferably 5 to 7 bp, more preferably 5 bp. Cyclic sites are inosine, deoxyinosine, 7-diaza-2-deoxyinosine, 2-aza-2-deoxyinosine, 2-OMe-inosine, 2'-F-inosine, deoxy 3-nitropy Roll, 3-nitropyrrole, 2'-OMe-3-nitropyrrole, 2'-F 3-nitropyrrole, 1-(2-deoxy-beta-D-ribofuranosyl)-3-nitropy Roll, deoxy 5-nitropyrrole, 5-nitroindole, 2'-OMe-5-nitroindole, 2'-F-5-nitroindole, dioxy 4-nitrobenzimidazole, 4-nitrobenzimidazole , Deoxy 4-aminobenzimidazole, 4-aminobenzimidazole, dioxy nebulaline, 2'-F nebulaline, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA -Nebulaline, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, morpholino-5-nitroindole, morpholino-nebulaline, morpholino-inosine, mo Leforino-4-nitrobenzimidazole, morpholino-3-nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-nebulaline, phosphoramidate-inosine, phosphoramidate -4-nitrobenzimidazole, phosphoramidate-3-nitropyrrole, 2'-0-methoxyethylinosine, 2'-0-methoxyethyl nebulaline, 2'-0-methoxyethyl 5 -Nitroindole, 2'-0-methoxyethyl 4-nitro-benzimidazole, 2'-0-methoxyethyl 3-nitropyrrole and may be selected from the group consisting of a combination of the base, but limited thereto Not, preferably inosine.

In the present invention, "template" refers to a DNA or RNA nucleic acid sequence to be replicated or synthesized, and single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, and the like may act as a template. When the template is double-stranded DNA or double-stranded RNA, both polynucleotide chains of two strands can serve as the template.

There is no limitation on the sequence that can be a template for replication or synthesis, but the present inventors include non-complementary nucleotides in the second binding site in SNP rs11950646 of the SLC23A1 gene, SNP rs429358 of the APOE gene, and SNP rs34391490 of the AQP3 gene. Unlike inaccurate analysis when using a primer that is not used, it was confirmed that accurate results can be obtained when using the primer according to the present invention (see FIGS. 4, 6 and 8).

The present invention provides a composition for discriminating a single base allele comprising a primer set according to the present invention. The composition for discriminating single base alleles according to the present invention may include dNTP, buffer, magnesium chloride, and DNA polymerase in addition to the primer set according to the present invention. In addition, in order to improve reactivity, substances such as betaine and DMSO may be additionally included, but the present invention is not limited thereto.

The present invention provides a method for determining a single base allele using the composition for determining a single base allele according to the present invention. In the method for discriminating a single base allele according to the present invention, the genotype can be confirmed by replicating a template in a sample using a primer in the composition for discriminating a single base allele according to the present invention, and confirming the base peak in the allele. , But is not limited thereto.

Hereinafter, it will be described in more detail through one or more embodiments. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example

Example 1. Design and preparation of primer set (SLC23A1)

To confirm whether the rs11950646 locus of the SLC23A1 gene can be specifically detected for its allele, a primer set was prepared as shown in Table 2.

In order to accurately discriminate the single base polymorphism of the rs11950646 locus of the SLC23A1 gene, the base sequence of the target gene was obtained through the SNP database of NCBI (National Center for Biotechnology Information; www.ncbi.nlm.nih.gov), and the detection primer of rs11950646 was obtained through the SNP database. It was used for production.

Based on the sequence of the rs11950646 locus of the SLC23A1 gene, it was designed so that inosine comes between bases 19 and 24 as a ring-forming site. In addition, since thymine (T) exists in the 5'direction of the rs11950646 locus of the SLC23A1 gene, it was designed so that cytosine (C) comes instead. Using the above sequence as a target nucleic acid, a primer set was completed for detection of alleles A and G.

Primer name Sequence (5'→3') Sequence number State allele
Forward primer GCTGCCGTCCTCTGGGGCTIIIIIGGC C G CAG One Minor allele
Forward primer GCTGCCGTCCTCTGGGGCTIIIIIGGC C A CAG 2 Reverse primer GCCAGGGCACTAGGACTAGCTCTG 3

**Underlined: non-complementary area; Bold: SNP

Each primer sequence designed according to an embodiment of the present application is as described in Table 2 below. In addition, each primer sequence was verified using NCBI, Genbank and Blast (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and as a result, there were no matching base sequences other than the corresponding gene.

Example 2. Design and manufacture of primer sets (APOE)

In order to confirm whether the rs429358 locus of the APOE gene can be specifically detected for its allele, a primer set was prepared as shown in Table 3.

In order to accurately discriminate single-base polymorphism for the rs429358 locus of the APOE gene, the nucleotide sequence of the target gene was obtained through NCBI's SNP database and used to prepare a detection primer for rs429358.

Based on the sequence of the rs429358 locus of the APOE gene, inosine was designed to come between bases 18 and 23 as a ring-forming site. In addition, since guanine (G) is present in the 5'direction of the rs429358 locus of the APOE gene, it was designed to come with thymine (T) instead. Using the above sequence as a target nucleic acid, a primer set was completed for detection of alleles C and T.

Primer name Sequence (5'→3') Sequence number State allele
Forward primer CGGCTGGGCGCGGACATGIIIIICGT T T GCG 4 Minor allele
Forward primer CGGCTGGGCGCGGACATGIIIIICGT T C GCG 5 Reverse primer AGGTGGGAGGCGAGGCGCAC 6

**Underlined: non-complementary area; Bold: SNP

Each primer sequence designed according to an embodiment of the present application is as described in Table 3 below. In addition, as a result of verifying each primer sequence using NCBI, Genbank, and Blast, there were no matching base sequences other than the corresponding gene.

Example 3. Design and Preparation of Primer Set (AQP3)

In order to confirm whether the rs34391490 locus of the AQP3 gene can be specifically detected for its allele, a primer set was prepared as shown in Table 4.

In order to accurately discriminate the single nucleotide polymorphism of the rs34391490 locus of the AQP3 gene, the nucleotide sequence of the target gene was obtained through NCBI's SNP database and used to prepare a detection primer for rs34391490.

Based on the sequence of the rs34391490 locus of the AQP3 gene, it was designed so that inosine comes between bases 22 and 28 as a ring-forming site. In addition, since guanine (G) exists in the 5'direction of the rs34391490 locus of the AQP3 gene, adenine (A) was designed to come instead. Using the above sequence as a target nucleic acid, a primer set was completed for detection of alleles A and G.

Primer name Sequence (5'→3') Sequence number Main allele forward primer GAGAGGAGCCACACAGATCCCTIIIIITA A G ACC 7 Minor allele forward primer GAGAGGAGCCACACAGATCCCTIIIIITA A A ACC 8 Reverse primer GTCCCCCTCAACAACCTCCCC 9

**Underlined: non-complementary area; Bold: SNP

Each primer sequence designed according to an embodiment of the present application is as described in Table 4 below. In addition, as a result of verifying each primer sequence using NCBI, Genbank, and Blast, there were no matching base sequences other than the corresponding gene.

Comparative Examples 1 to 3. Preparation of primers without non-complementary sites

Comparative Examples 1 to 3, respectively, in the same manner as described in Examples 1 to 3, except for positioning a non-complementary base to a base present in the 5'direction of the SNP complementary site in each gene when preparing the primers. The primers (Table 5) were prepared.

SNP Primer name Sequence (5'→3') Sequence number rs11950646 Main allele forward primer GCTGCCGTCCTCTGGGGCTIIIIIGGCT G CAG 10 Minor allele forward primer GCTGCCGTCCTCTGGGGCTIIIIIGGCT A CAG 11 Reverse primer GCCAGGGCACTAGGACTAGCTCTG 3 rs429358 Main allele forward primer CGGCTGGGCGCGGACATGIIIIICGTG T GCG 12 Minor allele forward primer CGGCTGGGCGCGGACATGIIIIICGTG C GCG 13 Reverse primer AGGTGGGAGGCGAGGCGCAC 6 rs34391490 Main allele forward primer GAGAGGAGCCACACAGATCCCTIIIIITAG A ACC 14 Minor allele forward primer GAGAGGAGCCACACAGATCCCTIIIIITAG G ACC 15 Reverse primer GTCCCCCTCAACAACCTCCCC 9

**Bold: SNP

Experimental Example 1. Genotype discrimination (SLC23A1)

As for the genotype for the rs11950646 locus of the SLC23A1 gene, specificity comparison of primers according to Examples and Comparative Examples was performed in all genotypes (AA/AG/GG) using samples for each genotype.

Using the primer sets according to Example 1 and Comparative Example 1, DNA samples of each genotype for the rs11950646 locus of the SLC23A1 gene were PCR amplified. According to the protocol, PCR conditions, starting at 95° C. 5 minutes (95° C. 30 seconds, 66° C. 30 seconds, and 72° C. 30 seconds) were repeated 35 times, followed by treatment at 72° C. for 5 minutes.

PCR products using the primers of Example 1 and Comparative Example 1 were sequenced in both directions, and their genotype peaks were analyzed using Lightcycler SW 1.1 (FIG. 4, red: A-peak; blue: G-peak).

4A is a chromatogram result of a PCR amplification product using the primer set of Example 1 and (b) the primer set of Comparative Example 1. In the case of Comparative Example 1, by non-specific binding of the primers, the AA and GG genotypes were also analyzed as AG type, resulting in inaccurate results, whereas in the case of Example 1, accurate results were obtained for all genotypes.

In order to determine the appropriate temperature for genotyping, the temperature of the annealing step in PCR using the AA genotype sample and the primer set prepared in Example 1 was changed to 60°C, 62°C, 64°C, 66°C and 68°C. And tested. As a result of the experiment, accurate results were confirmed at 64°C and 66°C (FIG. 5).

Experimental Example 2. Genotype discrimination (APOE)

Using the TT genotype sample for the rs429358 locus of the APOE gene, specificity comparison of the primers according to Examples and Comparative Examples at the locus was performed.

Using the primer sets according to Example 2 and Comparative Example 2, DNA samples of the AA genotype for the rs429358 locus of the APOE gene were PCR amplified. According to the protocol, PCR conditions, starting at 95° C. 5 minutes, 95° C. 30 seconds, 64° C. 30 seconds and 72° C. 30 seconds were repeated 35 times, followed by treatment at 72° C. for 5 minutes.

PCR products using the primers of Example 2 and Comparative Example 2 were sequenced in both directions, and their genotype peaks were analyzed using Lightcycler SW 1.1 (Fig. 6, red: T-peak; blue: C-peak).

6A is a result of genotyping of PCR amplification products using the primer set of Example 2, and (b) the primer set of Comparative Example 2. FIG. In the case of Comparative Example 2, by non-specific binding of the primers, the analysis was performed from the TT genotype to the TC type, resulting in an inaccurate result, whereas in the case of Example 1, the exact match with the TT genotype was obtained.

In order to determine the appropriate temperature for genotyping, in PCR using the TT genotyping sample and the primer set prepared in Example 2, the temperature of the binding step was varied to 60°C, 63°C, 66°C and 69°C. As a result of the experiment, it was possible to confirm the correct result at 63°C (FIG. 7).

Experimental Example 3. Genotype discrimination (AQP3)

Using the GG genotype sample for the rs34391490 locus of the AQP3 gene, specificity comparison of the primers according to Examples and Comparative Examples at the locus was performed.

Using the primer sets according to Example 3 and Comparative Example 3, a DNA sample of the GG genotype for the rs34391490 locus of the AQP3 gene was amplified by PCR. According to the protocol, PCR conditions, starting at 95° C. 5 minutes, 95° C. 30 seconds, 64° C. 30 seconds, and 72° C. 30 seconds were repeated 35 times, followed by treatment at 72° C. for 5 minutes.

PCR products using the primers of Example 3 and Comparative Example 3 were sequenced in both directions, and their genotype peaks were analyzed using Lightcycler SW 1.1 (Fig. 8, red: A-peak; blue: G-peak).

8A is a chromatogram result of a PCR amplification product using the primer set of Example 3 and (b) the primer set of Comparative Example 3. The correct genotype was confirmed for both the primers of Example 3 and Comparative Example 3.

However, looking at the resulting peak, it was confirmed that in Example 3, no non-specific primer attachment to genotype A was observed, whereas in Comparative Example 3, it was confirmed that the A-peak appeared by non-specifically bound primers although relatively lower than G Could.

In order to determine the appropriate temperature for genotyping, in PCR using the GG genotyping sample and the primer set prepared in Example 3, the temperature of the binding step was varied to 55°C, 58°C, 62°C and 64°C. Experimental results, 55 ℃. Accurate genotyping results were confirmed at 58°C and 62°C (FIG. 9).

So far, the present invention has been looked at around its preferred embodiments. Those of ordinary skill in the art to which the present invention pertains will be able to understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from a descriptive point of view rather than a limiting point of view. The scope of the present invention is indicated by the claims to be described later rather than the above detailed description, and all changes or modified forms derived from the meaning and scope of the claims and their equivalent concepts are interpreted as being included in the scope of the present invention. It should be.

<110> Genoplan Korea, Inc. <120> ALLELE SPECIFIC PRIMER AND METHOD FOR ANALYZING IDENTIFYING GENOTYPE OF THE ALLELE USING SAME <130> P17125 <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SLC23A1_rs11950646_primer(fwd, major) <400> 1 gctgccgtcc tctggggctg gccgcag 27 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SLC23A1_rs11950646_primer(fwd, minor) <400> 2 gctgccgtcc tctggggctg gccacag 27 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SLC23A1_rs11950646_primer(rev) <400> 3 gccagggcac taggactagc tctg 24 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> APOE_rs429358_primer(fwd, major) <400> 4 cggctgggcg cggacatgcg tttgcg 26 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> APOE_rs429358_primer(fwd, minor) <400> 5 cggctgggcg cggacatgcg ttcgcg 26 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APOE_rs429358_primer(rev) <400> 6 aggtgggagg cgaggcgcac 20 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> AQP3_rs34391490_primer(fwd, major) <400> 7 gagaggagcc acacagatcc cttaagacc 29 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> AQP3_rs34391490_primer(fwd, minor) <400> 8 gagaggagcc acacagatcc cttaaaacc 29 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> AQP3_rs34391490_primer(rev) <400> 9 gtccccctca acaacctccc c 21 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SLC23A1_rs11950646_com_primer(fwd, major) <400> 10 gctgccgtcc tctggggctg gctgcag 27 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SLC23A1_rs11950646_com_primer(fwd, minor) <400> 11 gctgccgtcc tctggggctg gctacag 27 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> APOE_rs429358_com_primer(fwd, major) <400> 12 cggctgggcg cggacatgcg tgtgcg 26 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> APOE_rs429358_com_primer(fwd, minor) <400> 13 cggctgggcg cggacatgcg tgcgcg 26 <210> 14 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> AQP3_rs34391490_com_primer(fwd, major) <400> 14 gagaggagcc acacagatcc cttaggacc 29 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> AQP3_rs34391490_com_primer(fwd, minor) <400> 15 gagaggagcc acacagatcc cttaggacc 29

Claims (8)

A primer set comprising a primer represented by the following formula (1).
[Formula 1]
5'-XYZ-3 '
In this formula,
X is a first binding site comprising a hybridized nucleotide sequence of 15 to 25 bp complementary to the template nucleic acid to be hybridized,
Y is a ring forming moiety of 3 to 10 bp,
Z is a second binding site comprising a hybridization nucleotide sequence of 5 to 10 bp complementary to the template nucleic acid, and a nucleotide corresponding to the allele and a non-complementary nucleotide sequence of 1 to 3 bp consecutively thereto,
X, Y and Z are deoxyribonucleotides or ribonucleotides. The method according to claim 1,
Wherein the non-complementary nucleotide at the second binding site is contiguous to the 5 ' position of the nucleotide corresponding to the allele. 3. The method of claim 2,
Wherein the non-complementary nucleotide is 1 bp. The method according to claim 1,
The ring-forming moiety may be selected from the group consisting of inosine, dioxyinosine, 7-diaza-2-deoxyinosine, 2-aza-2-deoxyinosine, 2-OMe-inosine, 2'- 3-nitropyrrol, 2'-OMe-3-nitropyrrol, 2'-F 3-nitropyrrol, 1- (2-deoxy-beta-D- ribofuranosyl) Nitro-indole, 2'-F-5-nitroindole, dioxy-4-nitrobenzimidazole, 4-nitrobenzimidazole, 4-aminobenzimidazole, 4-aminobenzimidazole, dioxine nebulin, 2'-F nebulanarin, 2'-F 4-nitrobenzimidazole, PNA-5-introindol, PNA-nervuline, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrol, morpholino-5-nitroindole, morpholino-nebulalin, morpholino- Morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrol, phosphoramidate-5-nitroindole, phosphoramidate- Phosphoramidate-3-nitropyrrol, 2'-O-methoxyethylinosine, 2'-O-methoxyphenylamine, phosphoramidate-inosine, phosphoramidate-4-nitrobenzimidazole, Methoxyethyl 5-nitroindole, 2'-O-methoxyethyl 4-nitro-benzimidazole, 2'-O-methoxyethyl 3-nitropyrrol and the base &Lt; / RTI &gt; or a combination thereof. The method according to claim 1,
Wherein the hybridizing template nucleic acid is selected from the group consisting of the SLC23A1 gene, the APOE gene, the AQP3 gene and a combination of the genes. The method according to claim 1,
The primer set is composed of an oligonucleotide having a base sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3, the nucleotide sequences of SEQ ID NOS: 4 to 6, and the nucleotide sequences of SEQ ID NOS: 7 to 9 &Lt; / RTI &gt; A composition for discriminating single base allelic features comprising a primer set according to any one of claims 1 to 6. A method for determining a single base allele using the composition for discriminating mononucleotide alleles according to claim 7.

Images