PL213633B1 - 7-phenyl pyrazolopyridine compounds - Google Patents

Abstract

A compound represented by the formula: <CHEM> Äwherein R<1> is methoxy, methylthio, ethyl, etc.; R<5> and R<6> are each independently cyclopropylmethyl, (4-tetrahydropyranyl)methyl, etc.; and two of R<40>, R<41> and R<42> are C1-6 alkoxy while the remaining one is methoxymethyl, etc.Ü, a salt thereof, or a hydrate of the foregoing. This compound has excellent antagonism against corticotropin-releasing factor receptor.

Description

The present invention relates to novel 7-phenylpyrazolopyridine derivatives with corticotropin releasing factor receptor antagonizing activity, their salts of a therapeutic or prophylactic agent and their use.

State of the art

[0002] Corticotropin release factor (hereinafter in abbreviated form as CRF) is a 41 amino acid neuropeptide that was first isolated from the ovine hypothalamus [Science, 213, 1394 (1981)] and its presence has also been confirmed in rats [Proc. Natl. Acad. Sci. USA, 80, 4851 (1983)] and in humans [EMBO J. 5, 775 (1983)]. CRF is most abundant in the pituitary gland and hypothalamus, and is also widely distributed in the cortex, cerebellum and other areas of the brain. Its occurrence has also been confirmed in peripheral tissues such as the placenta, adrenal gland, lung, liver, pancreas and digestive system [J. Clin. Endocrinol. Metab., 65, 176 (1987), J. Clin. Endocrinol. Metab., 67, 768 (1988), Regul. Pept., 18, 173 (1987), Peptides, 5 (Suppl. 1), 71 (1984)]. Two CRF receptor subtypes have been described, CRF1 and RF2, and the CRF1 receptor is said to be widely distributed in the cerebral cortex, cerebellum, olfactory bulb, pituitary gland, amygdala and elsewhere. Recently, 2 CRF2 receptor subtypes have been confirmed, CRF2a and CRF23, where CRF2a receptors have been found to be abundant in the hypothalamus, septal nucleus and choroid plexus, while CRF23 receptors are mainly distributed in peripheral tissue such as skeletal muscle or cerebral vessels blood vessels of the central nervous system [Ex.Clin. Endocrinol. Diabetes, 105, 65 (1997)]. The fact that each of these receptors has a different distribution profile suggests that their roles are also different. CRF is produced and secreted in the hypothalamus and stimulates the stress-induced release of adrenocorticotropic hormone (ACTH) [Recent Prog. Horm. Res., 39, 245 (1983)]. In addition to its endocrine role, CRF also functions as a neurotransmitter or neuromodulator in the brain, integrating electrophysiological, autonomic and behavioral changes in response to stress [Brain Res. Rev. 15, 71 (1990); Pharmacol. Rev., 43, 425 (1991)].

[0003] CRF has been associated with a number of diseases to date, as indicated in the following publications.

[0004] Increased levels of CRF in the cerebrospinal fluid of severely depressed patients have been reported compared with healthy controls; the levels of mRNA-CRF in the hypothalamus of depressed patients are higher than those of healthy individuals; CRF receptors in the cortex of suicide victims are reduced; plasma ACTH growth is diminished when CRF is administered to depressed patients [Journal of Endocrinology, 160, 1 (1999)]; CSF levels of CRF in some patients with anxiety disorder, obsessive-compulsive disorder, post-traumatic stress disorder or Tourette's syndrome are higher than those in healthy individuals [Journal of Endocrinology, 160, 1 (1999)]; when CRF is administered to panic disorder patients, the increase in plasma ACTH is diminished [Exp. Clin. Endocrinol. Diabetes, 105, 65, (1997)]; anxiety behavior was observed in experimental animals with the central administration of CRF. Moreover, anxiety behavior is observed more frequently in mice overexpressing CRF than in normal mice [Journal of Endocrinology, 160, 1 (1999)], and CRF levels in the bluish site are decreased with administration of anxiolytic agents [Exp.Clin. Endocrinol. Diabetes, 105, 65, (1997)]. Also, the peptide CRF antagonist α-helical CRF (9-41) shows an anxiolytic effect in animal models [Brain Res., 509, 80 (1990); Regulators Peptides, 18, 37 (1987); J. Neurosci., 14 (5), 2579 (1994)]; the abnormal behavior associated with withdrawal from alcohol or an addictive drug such as cocaine is also inhibited by the peptide CRF antagonist α-helical CRF (9-41) [Psychopharmacology, 103, 227 (1991)];

CRF inhibits sexual behavior in rats [Nature, 305, 232 (1983)]; CRF shortens sleep in rats and thus becomes involved in sleep disorders [Pharmacol. Biochem. Behav., 26, 699 (1987)]; CRF peptide antagonist α-helical CRF (9-41) suppresses brain damage or encephalogram abnormalities caused by cerebral ischemia or NMDA receptor activation [TIPS, 17, 166 (1996)]; CRF activates the electroencephalogram and causes convulsions [Brain Res., 278, 332 (1983)]; cerebrospinal CRF levels are elevated in patients with schizophrenia compared with healthy individuals [Am. J. Psychiatry, 144 (7), 873 (1987)]; in patients with Alzheimer's disease,

In patients with Parkinson's disease and in patients with progressive supranuclear palsy, the content of CRF in the cerebral cortex is reduced [Neurology, 37, 905 (1987)]; and CRF is reduced in ganglia in Huntington's disease [Brain Res., 437, 355 (1987), Neurology, 37, 905 (1987)]. Moreover, administration of CRF has been shown to promote learning and memory in rats [Exp. Clin. Endocrinol. Diabetes, 105, 65, (1997)].

[0006] In patients with amyotrophic lateral sclerosis, the levels of CRF in the cerebrospinal fluid are reduced. CRF-overexpressing mice show greater secretion of ACTH and adrenocorticosteroids, these mice exhibit Cushing-like abnormalities including muscle atrophy, alopecia, and infertility [Endocrinology, 130 (6), 3378 (1992)]; in patients with anorexia nervosa, cerebrospinal CRF levels are elevated compared with healthy subjects, and when CRF is administered to patients with anorexia nervosa, the increase in plasma ACTH is low; and in experimental animals, CRF reduces food consumption [TIPS, 17), 166 (1996)]. In addition, the CRF peptide antagonist α-helical CRF (9-41) reverses the stress-induced reduction in food consumption in experimental animals [Brain Res. Bull., 17 (3), 285 (1986)]; CRF inhibited body weight gain in genetically obese animals; a link has been suggested between low CRF levels and obesity syndrome; the anorectic effects and the weight loss effects of serotonin reabsorption inhibitors are likely to be associated with CRF release [TIPS, 17, 166 (1996)].

CRF acts centrally and peripherally in inhibiting gastric contraction and delaying gastric emptying [Annals of the New York Academy of Sciences, 697, 233 (1993)]. Moreover, decreased gastric function induced by abdominal surgery is reversed by the peptide CRF antagonist α-helical CRF (9-41) [Am. J. Physiol., 262, G616 (1992)]; and CRF stimulates the secretion of bicarbonate ion in the stomach, thereby reducing gastric acid secretion and the cold-limited acute stress ulceration [Am. J. Physiol., 258, G152 (1990)]. Also, administration of CRF increases unrestricted ulceration in stressed animals [Life Sci., 45, 907 (1989)] and CRF slows small intestine transit and accelerates colon transit and defecation is induced. Additionally, the peptide CRF antagonist α-helical CRF (9-41) has an inhibitory effect on stress-induced gastric acid secretion, delay gastric emptying, small intestinal transit, and accelerated colonic transit [Gastroenterology, 95, 1510 (1988)]; psychological stress in healthy individuals increases anxiety or bloating and abdominal pain during colonic distension, and CRF lowers the discomfort threshold [Gastroenterol., 109, 1772 (1995); Neurogastroenterol. Mot. 8, 9 (1996)]; Compared with healthy individuals, irritable bowel syndrome patients experience an intense acceleration of colon motility when administered with CRF [Gut, 42, 845 (1998)].

[0008] Administration of CRF increases blood pressure, heart rate, and temperature, although the peptide CRF antagonist α-helical CRF (9-41) reduces stress-induced increases in blood pressure, heart rate, and body temperature [J. Physiol. 460, 221 (1993)]; CRF production is increased locally at the site of inflammation in experimental animals and in the synovial fluid of rheumatoid arthritis patients [TIPS, 17, 166 (1996)]; CRF induces mast cell degranulation and promotes vascular permeability [Endocrinology, 139 (1), 403 (1998); CRF is detected in patients with autoimmune thyroiditis [Am. J. Pathol., 145, 1159 (1994)]; administration of CRF to rats with experimental encephalomyelitis significantly suppressed the progression of symptoms such as paralysis [J. Immumol. 158, 5751 (1997)]; and urocortin (a CRF analog) increased growth hormone secretion in an acromegalic pituitary adenoma culture system [Endocri. J, 44, 627 (1997)]. Furthermore, CRF stimulates the secretion of cytokines such as interleukin-1 and interleukin-2 by leukocytes [J. Neuroimmunol., 23, 256 (1989); Neurosci. Lett., 120, 151 (1990)]; CRF administration and stress suppressed both T cell proliferation and natural killer cell activity. The CRF peptide antagonist α-helical CRF (9-41) improves the decreased function of immune cells caused by CRF administration or stress [Endocrinology, 128 (3), 1329 (1991)], and with CRF administration, ventilation is significantly increased [Eur. J. Pharmacol. 182, 405 (1990)]. Finally, rapid breathing and insomnia have been observed as a consequence of administration of CRF to elderly patients undergoing chronic artificial respiration [Acta Endocrinol. Copenh. 127,200 (1992)].

[0009] The above-cited studies suggest that CRF antagonists can be expected to exert excellent effects in the treatment or prevention of depression and major depressive symptoms.

Depression, single depressive episodes, recurrent depression, depression-induced child abuse and postpartum depression, manic agitation, anxiety, generalized anxiety disorder, panic attacks, phobias, obsessive-compulsive disorder, post-traumatic stress disorder or a, autism, psychosis, mania, dysthymia, bipolar disorder, cyclophrenic personality disorder, schizophrenia, Alzheimer's disease, senile dementia of Alzheimer's type, neurodegenerative disease such as Parkinson's disease and Huntington's disease, dementia associated with multiple myocardial infarction anorexia nervosa, increased appetite and other eating disorders, obesity, diabetes, alcohol addiction, drug addiction to drugs such as cocaine, heroin or benzodiazepines, withdrawal symptoms after drug or alcohol withdrawal, m sleep, insomnia, migraine, stress-induced headache, muscle-spasm headache, ischemic neuronal damage, excitotoxic neuronal injury, stroke, progressive supernuclear palsy, amyotrophic lateral sclerosis, psychosocial multiple sclerosis, muscle spasm, chronic fatigue syndrome, chronic fatigue syndrome , epilepsy, head injury, spinal cord injury, (writing) spasm, spasmodic spasms, cervical-brachial syndrome, primary glaucoma, Maniere's syndrome, autonomic imbalance, alopecia, neuroses such as cardiac neurosis, gastric neurosis and bladder neurosis, peptic ulcer, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative intestinal obstruction, stress-induced gastrointestinal disorders, and nervous vomiting, hypertension, cardiovascular disorders, kim as nervous angina, tachycardia, congestive heart failure, hyperventilation syndrome, bronchial asthma, respiratory arrest (apnea), sudden death syndrome of newborns, inflammatory disorders (e.g. rheumatoid arthritis, osteoarthritis, lumbago etc.), pain , allergic disease (e.g. atopic dermatitis, eczema, urticaria, psoriasis, etc.), impotence, menopausal disorder, fertility disorder, infertility, cancer, immune function disorder related to HIV infection, stress-related immune function disorder, hemorrhagic shock, syndrome Cushing's, thyroid dysfunction, encephalomyelitis, acromegaly, urinary incontinence, osteoporosis and the like. As examples of CRF antagonists, CRF peptide receptors with modifications or deletions of part of the amino acid sequence of human or other mammalian CRF have been shown, and such antagonists have shown inhibitory effects on ACTH release or anxiolytic effects [Science, 224, 889 (1984), J. Pharmacol. Exp. Ther., 269, 564 (1994), Brain Research Reviews, 15, 71 (1990)]. However, peptide derivatives have low utility value as medicaments from a pharmacokinetic point of view, including their chemical stability in the body, oral absorption, bioavailability and migration to the brain.

[0010] The following non-peptide CRF antagonists are also shown.

[1] Pyrazolotriazine compounds (W00059907), pyrazolopyrimidine compounds (W00059908), imidazo [1,2-a] pyrazine compounds (W00206286, W00262800) and imidazo [1,2-a] pyridine compounds (WO9835967, W002062800); and

[2] benzimidazole compounds (EP0812831), imidazopyrimidine compounds and imidazopyridine compounds (EP0994877), imidazo [4,5-c] pyrazole compounds (W09910350), benzimidazole compounds, imidazopyridine compounds, imidazopyridazine compounds and imidazopyridazine compounds, and imidazotria97 compounds) imidazo [4,5-d] pyridazin-7-one and 3H-imidazo [4,5-c] pyridin-4-one compounds (W00039127), imidazopyrimidine compounds and imidazopyridine compounds (W00144248) and imidazole compounds (W002058704).

[0011] However, none of these compounds had a substituted amino group bound at the 3-position and a substituted phenyl group bound at the 7-position of the pyrazolo [1,5-a] pyridine, and there was no known antagonistic compound having a pyrazolo [1] skeleton. 5-a] pyridine with a substituted amino group bound at the 3-position and a substituted phenyl group bound at the 7-position.

[0012] The following compounds having a pyrazolo [1,5-a] pyridine structure are also reported in US5457200, US4925849, US5565468 and US5691347.

[0013] However, no compound described in these publications is mentioned as having CRF receptor antagonism, antidepressant or anxiolytic activity (e.g. the compounds described in US5457200 are only mentioned for their use in colorimetry. The compounds disclosed in US4925849 are only mentioned in US4925849. for use as diuretics and medicaments for hypertension The compounds described in US5565468 are only mentioned with respect to their angiotensin II antagonism and vasoconstrictor activity The compounds described in US 5,691,347 are disclosed for their use as therapeutic agents atherosclerosis and hypercholestelemia.)

[0014] Then, when the structures of the compounds described in each of the above publications are compared, none of the described compounds is a compound having a substituted amino group bound at the 3-position and a substituted phenyl group bound at the 7-position of the pyrazolo [1,5-a] pyridine. In other words, no compound having a substituted amino group bound to the 3-position and a substituted phenolic group bound to the 7-position of the pyrazolo [1,5-a] pyridine is known according to the present invention and no method of synthesizing such compounds is known.

Disclosure of the Invention

[0015] As mentioned above, it is highly desirable to provide CRF receptor antagonists that are useful as drugs, and clinically effective agents that exhibit excellent CRF receptor antagonism and meet the requirements of pharmacological activity, dosage and safety as drugs have not yet been discovered. Therefore, the object of the invention is the search and synthesis of such excellent CRF receptor antagonists.

[0016] As a result of many scrupulous studies and searches in light of the circumstances described above, the present inventors have synthesized new pyrazolo [1,5-a] pyridine compounds exhibiting excellent CRF receptor antagonism.

The present invention therefore relates to a 7-phenylpyrazolopyridine derivative or a salt thereof, represented by the formula

₁ wherein R ¹ is ethyl or methylthio.

Preferably the compound is N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N-tetrahydro-2H-4. - pyranylmethylamine or a salt thereof. Preferably the salt is a salt of inorganic acid and N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N-tetrahydro 2H-4-pyranylmethylamine, especially N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazole-1,5-a] pyridin-3-yl-N-tetrahydro hydrochloride -2H-4-pyranylmethylamine, or N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) -phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N hydrobromide -tetrahydro-2H-4-pyranylmethylamine, or N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl- sulfate N-tetrahydro-2H-4-pyranylmethylamine.

Preferably the salt is an organic acid salt of N-cyclopropyl methyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N- tetrahydro-2H-4-pyranylmethylamine, especially N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) -phenyl] -2-ethylpyrazole- [1,5-a] pyridin-3-yl benzenesulfonate -N-tetrahydro-2H-4-pyranylmethylamine, or N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3- ethanesulfonate yl-N-tetrahydro-2H-4-pyranylmethylamine, or N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3 methanesulfonate -yl-N-tetrahydro-2H-4-pyranylmethylamine, or N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) -phenyl] -2-ethyl-pyrazolo [1,5-p-toluenesulfonate - a] pyridin-3-yl-N-tetrahydro-2H-4-pyranylmethylamine.

Preferably the compound is N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methylsulfanyl) pyrazolo [1,5-a] pyridin-3-yl-N-tetrahydro- 2H-4-pyranylmethylamine or a salt thereof.

The invention also relates to a therapeutic or prophylactic agent for use in the prevention or treatment of depression, depressive symptoms, mania, anxiety, anxiety disorders, panic disorders, phobias, obsessive-compulsive disorders, post-traumatic stress disorders, Tourette's symptom, autism. , manic-depressive psychosis, disease

In terms of mental disorders, bipolar disorder, cyclophrenic personality or schizophrenia, comprising a derivative of the formula as defined above or a salt thereof.

The invention also relates to a therapeutic or prophylactic agent for use in the prevention or treatment of peptic ulcer, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, post-operative intestinal obstruction, stress-related gastrointestinal disorders, or nervous vomiting that is it contains a derivative of the formula as defined above.

The invention also relates to the use of a derivative of the formula as defined above or a salt thereof for the production of a therapeutic or prophylactic agent for the prevention or treatment of depression, depressive symptoms, mania, anxiety, anxiety disorders, panic disorders, phobias, obsessive-compulsive disorders, from post-traumatic stress disorder, Tourette's symptom, autism, manic-depressive psychosis, mental illness, bipolar disorder, cyclophrenic personality or schizophrenia.

The invention also relates to the use of a derivative of the formula as defined above or a salt thereof for the preparation of a therapeutic or prophylactic agent for the prevention or treatment of peptic ulcer, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative intestinal obstruction, gastrointestinal disorders. stress-related or nervous vomiting.

The best way to carry out the invention

[0017] Symbols and terms used throughout this specification will now be defined with the invention described in more detail.

[0018] The term CRF receptor antagonist, as used throughout this specification, refers to a substance capable of inactivating CRF receptors. Such substances also include those capable of weakening or inhibiting the physiological activity of CRF.

[0019] Among the diseases belonging to the CRF-related diseases or the CRF receptor related diseases of the present description, depression and depressive symptoms (major depression, single depressive episodes, recurrent depression, depression-induced child abuse, postpartum depression, etc.) may be mentioned, mania, anxiety, generalized anxiety disorder, panic attacks, phobias, obsessive-compulsive disorder, post-traumatic stress disorder, Tourette's syndrome, autism, manic-depressive psychosis, dysthymia, bipolar disorder, cyclophrenic personality, schizophrenia, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative intestinal obstruction, gastrointestinal disorders caused by stress, nervous vomiting, Alzheimer's disease, senile dementia of Alzheimer's type, neurodegenerative disease, dementia associated with multiple infarcts, dementia senile, anorexia nervosa ny, eating disorders, obesity, diabetes, alcohol addiction, drug addiction, withdrawal symptoms after drug or alcohol withdrawal, sleep disorders, insomnia, migraine, stress-induced headache, muscle contraction headache, neuron damage related to ischemia, excitotoxic neuronal damage, stroke, progressive supranuclear palsy, amyotrophic lateral sclerosis, multiple sclerosis, muscle spasm, chronic fatigue syndrome, psychosociological dwarfism, epilepsy, head injury, spinal cord injury, hand spasm (writing), spasmodic spasm of the neck, cervico-shoulder syndrome, primary glaucoma, Maniere's syndrome, autonomic imbalance, alopecia, neurosis, hypertension, cardiovascular disorders, tachycardia, congestive heart failure, hyperventilation syndrome, bronchial asthma, respiratory arrest (apnea), sudden neonatal death syndrome, inflammatory disorders, pain, allergic disease, impotence, menopause disorder non-fertility, infertility, cancer, HIV-related immune dysfunction, stress-related immune dysfunction, hemorrhagic shock, Cushing's syndrome, thyroid dysfunction, encephalomyelitis, acromegaly, urinary incontinence, osteoporosis, and the like. The compounds according to the invention are effective in the treatment or prevention of the above-mentioned diseases.

[0020] The term neurodegenerative disease as used throughout this specification denotes either acute or chronic degenerative disease, and specifically includes, for example, neuropathies such as subarachnoid hemorrhage, acute cerebrovascular disorder etc., and Alzheimer's disease, Parkinson's disease, Huntington's chorea. , amyotrophic lateral sclerosis, spinocerebellar degeneration, etc. As used throughout this specification, the term eating disorder means increased appetite, fear of eating or eating, and the like. The term cardiovascular disorders as used throughout this specification means nervous angina and the like. The term inflammatory disorders as used throughout this specification means, for example, rheumatoid arthritis, osteoarthritis, lumbago and the like, and the term allergic disease means, for example, atopic dermatitis, eczema, urticaria, psoriasis and the like.

[0021] Throughout this specification, n- means normal, sec- means secondary, and tert- and t- means tertiary.

[0022] The starting materials and the starting reagents used in the preparation of the compounds of the invention may also form salts which will vary depending on the starting materials and the solvent and the solvent used, and are not particularly limited as long as they do not inhibit the reaction. The solvents used will also vary depending on the starting materials and reagents, and are not particularly limited as long as they do not inhibit the reaction and dissolve the starting materials to some extent. When the compound (I) of the present invention is obtained as a free compound, a conventional method for converting it into a salt which compound (I) is able to form may be used. Various isomers (e.g., geometric, asymmetric carbon-based optical isomers, rotational isomers, stereoisomers and tautomers) obtained for compound (I) of the invention can be purified and isolated using common separation means such as recrystallization, diastereomeric salt formation methods, enzymatic separation methods, chromatographic methods (for example thin layer chromatography, column chromatography, gas chromatography, etc.).

[0023] The compounds represented by the formula (I) of the present invention and their salts can be used directly or in admixture with known pharmaceutically acceptable carriers, and formulated by conventional methods. As preferred dosage forms, there may be mentioned tablets, powders, fine particles, granules, coated tablets, capsules, syrups, lozenges, inhalants, suppositories, injections, ointments, eye lotions, eye drops, nose drops, ear drops, pulps, lotions, etc. Any conventional excipients, binders, disintegrators, lubricants, colorants, corrective coatings and, if desired, stabilizers, emulsifiers, absorbents, surfactants, pH adjusters, preservatives, antioxidants, or the like may be used in the preparations. , in combination with various components that are usually used as starting materials for pharmaceutical preparations.

[0024] As such components there may be mentioned vegetable and animal oils such as soybean oil, beef fat and synthetic glycerides; hydrocarbons such as liquid paraffin, squalane, and solid paraffin; ester oils such as octyldodecyl myristate and isopropyl myristate; higher alcohols such as cetostearyl alcohol and behenyl alcohol; silicone resins; silicone oils; surfactants such as polyoxyethylene fatty acid esters, sorbitan fatty acid esters, glycerol fatty acid esters, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene hydrogenated castor oil, and polyoxyethylene polyoxypropylene block copolymer; water-soluble polymers such as hydroxyethyl cellulose, polyacrylic acid, carboxyvinyl polymer, polyethylene glycol, polyvinylpyrrolidone and ethyl cellulose; lower alcohols such as ethanol and isopropanol; polyhydric alcohols such as glycerin, propylene glycol, dipropylene glycol and sorbitol; sugars such as glucose and sucrose; inorganic powders such as silicic anhydride, magnesium aluminum silicate and aluminum silicate, purified water and the like. Examples of excipients that may be used include lactose, corn starch, white soft sugar, glucose, mannitol, sorbitol, crystalline cellulose, and silicon dioxide; examples of binders that can be used include polyvinyl alcohol, polyvinyl ether, methyl cellulose, ethyl cellulose, acacia, tragacanth, gelatin, shellac, hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinylpyrrolidone, polyvinyl ether, polypropylene glycol and calcium carboxymethylene glycol block; examples of disintegrators that can be used include starch, agar, gelatin powder, crystalline cellulose, calcium carbonate, sodium bicarbonate, calcium citrate, dextrin, pectin and calcium carboxymethyl cellulose; examples of lubricants that can be used include magnesium stearate, talc, polyethylene glycol, silica and hydrogenated vegetable oils; examples of coloring agents that can be used include any of those approved for addition to medicaments; examples of corrective coatings that can be used include cocoa powder, menthol, flavor powders, mint oil, borneol and powdered cinnamon; and examples of antioxidants that can be used include those accepted for addition to drugs such as ascorbic acid and alpha-tocopherol.

PL 213 633 B1

An oral preparation can be prepared by combining a compound of the invention or a salt thereof with an excipient, adding a tackifier, disintegrator, lubricant, coloring agent, corrective coating or the like, if necessary, and forming a powder, fine particles, granules, tablets, coated tablets, capsules. etc. by common methods.

[0026] Tablets or granules may, of course, also be coated with a sugar, gelatin or other type of suitable coating, if necessary.

[0027] For a liquid preparation such as a syrup, injection, eye drops or the like, the conventional manufacturing method can be used with a pH adjuster, solubiliser, isotonic agent or the like, as well as a dissolution aid, stabilizer, buffering agent. , suspending agent, antioxidant, etc., as needed. In the case of a liquid preparation, it can be lyophilized and the injectable preparation can be administered intravenously, subcutaneously, or intramuscularly. Preferred examples of suspending agents include methyl cellulose, polysorbate 80, hydroxyethyl cellulose, gum arabic, tragacanth, powdered sodium carboxymethyl cellulose, polyoxyethylene sorbitan monolaurate, and the like polyoxyethylene hydrogenated monolaurate, polyoxyethylene hydrogenated sulfate, polyoxyethylene hydrogenated sorbitan, and the like may be mentioned as preferred examples of solubilizing agents. ; as preferred examples of the stabilizing agent, sodium sulfite, sodium metasulfite, ether and the like; and as preferred examples of preservatives, methyl paraoxybenzoate, ethyl paraoxybenzoate, sorbic acid, phenol, cresol, chlorocresol and the like can be mentioned.

[0028] The method of producing the external agent is not particularly limited, and any method can be used. The base materials used can be the raw materials commonly used in drugs, pseudo-drugs, cosmetics, etc., and examples include raw materials such as animal and vegetable oils, mineral oils, ester oils, waxes, higher alcohols, fatty acids, silicone oils, surfactants. , phospholipids, alcohols, polyhydric alcohols, water-soluble polymers, aluminum minerals, purified water, etc. with the addition of pH adjusting agents, antioxidants, chelating agents, antiseptics and fungicides, coloring agents, fragrances etc. as needed. Also, if necessary, differentiation-inducing ingredients or other ingredients such as circulating agents, microbicides, anti-inflammatory agents, cell activators, vitamins, amino acids, wetting agents, keratolytic agents, etc. can be included.

[0029] Medicinal preparations comprising compound (I) of the invention and a salt thereof as effective ingredients are useful for treating or preventing disease in mammals (e.g., humans, mice, rats, guinea pigs, rabbits, dogs, horses, monkeys, etc.), especially for treating or preventing disease in humans. Although dosages of the medicament according to the invention will vary depending on the patient's disease symptoms, age, sex, body weight, dosage form, salt type, drug susceptibility and the particular type of disease etc., it will generally be from about 30 pg to 10 g, preferably from about 30 pg to 10 g. 100 pg to 500 mg, more preferably 100 to 100 mg per day for adult humans when administered orally, or about 1-3000 pg / kg and preferably 3-1000 pg / kg when injected, administered once daily or in divided doses for several times a day.

[0030] EXAMPLES

The following production examples, examples and research examples are provided for illustrative purposes only and are not intended to limit the compounds of the invention. It will be apparent to those skilled in the art that various modifications may be made in addition to these examples and within the scope of the claims in the present specification to maximize the effects obtained by the invention, and such modifications are also within the scope of the invention.

[0031] The expression purified by silica gel column chromatography and the title compound obtained from the fractions in the present invention means obtaining the title compound by concentrating a solution of the fractions containing the target compound obtained by silica gel column chromatography and, if necessary, further by recrystallization.

[0032] Production example 1

2- (1-Butynyl ]pyridine

PL 213 633 B1

To a solution of 2-bromopyridine (50 g) dissolved in diethylamine (500 ml) was added dichlorobis (triphenylphosphine) palladium (II) (2.2 g) and copper iodide (0.3 g), and the reaction mixture was stirred for 4 hours at room temperature during introducing 1-butyne (100 g) in gaseous form. The resulting reaction mixture was bubbled with nitrogen, then ethyl acetate was added. After filtering the reaction mixture through celite to remove undissolved residue, the filtrate was washed with water and brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by chromatography on a silica gel column and the title compound (35 g) was obtained as a brown oil from the n-hexane: ethyl acetate (5: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.26 (t, J = 7.6 Hz, 3H), 2.45 (q, J = 7.6 Hz, 2H), 7.16-7.20 (m, 1H), 7.35-7.38 (m, 1H ), 7.59-7.63 (m, 1H), 8.53-8.54 (m, 1H).

[0033] Production example 2

2-Ethylpyrazolo [1,5-a] pyridine

To a solution of 2- (1-butynyl) pyridine (12.8 g) dissolved in dichloromethane (60 ml) was added a solution of O-mesitylenesulfonylhydroxylamine (Reference; Synthesis, 1997, 1) (20 g) in dichloromethane (132 ml) while cooling with ice, and the reaction mixture was stirred for 30 minutes. Diethyl ether (2 L) was added to the reaction mixture for the precipitated crystals, which were filtered off and dried under reduced pressure to obtain the crude product N-amino-2- (1-butynyl) pyridinium mesitylene sulfonate (12.6 g) as colorless crystals.

A portion (6.1 g) of the obtained crude product of N-amino-2- (1-butynyl) pyridinium mesitylenesulfonate was dissolved in tetrahydrofuran (600 ml), and then potassium tert-butoxide (3.55 g) was added at room temperature, and the reaction mixture was vigorously stirred for 30 minutes. minutes. After adding ice water to the obtained reaction mixture, extraction was performed with ethyl acetate. After re-extracting the aqueous layer with ethyl acetate and filtering off the undissolved residue through celite, the organic extracts were combined and washed with brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by chromatography on a silica gel column and the title compound (0.63 g) was obtained as a slightly yellow oil from the n-hexane: ethyl acetate (10: 1) fraction. .

¹ H NMR (400 MHz, CDCl 3) δ 1.36 (t, J = 7.6 Hz, 3H), 2.86 (q, J = 7.6 Hz, 2H), 6.30 (s, 1H), 6.65 (ddd, J = 1.6 , 6.8, 6.8 Hz, 1H), 7.04 (ddd, J = 1.2, 6.8, 8.8 Hz, 1H), 7.41 (ddd, J = 1.2, 1.2, 8.8 Hz, 1H), 8.37 (ddd, J = 1.2, 1.2 , 6.8 Hz, 1H).

[0034] Production example 3

7-Bromo-2-ethylpyrazolo [1,5-a] pyridine

Br

To a solution of 2-ethylpyrazolo [1,5-a] pyridine (80 mg) dissolved in tetrahydrofuran (1 ml) was added n-butyllithium (1.6 M hexane solution: 0.58 ml) dropwise at -78 ° C under a stream of nitrogen, and the mixture was the reaction was further stirred for 30 minutes at the same temperature. A solution of 1,2-dibromo-1,1,2,2-tetrachloroethane (196 mg) in tetrahydrofuran (0.5 mL) was added dropwise to the reaction mixture, and stirring was continued for 30 minutes. After the temperature was raised to room temperature and water was added to the reaction mixture, extraction was performed with ethyl acetate and the organic extract was washed with water and brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by chromatography on a silica gel column and the title compound (90 mg) was obtained as a light brown oil from the n-hexane: ethyl acetate fraction (20: 1) .

¹ H NMR (400 MHz, CDCl 3) δ 1.36 (t, J = 7.6 Hz, 3H), 2.93 (q, J = 7.6 Hz, 2H), 6.49 (s, 1H), 6.94 (dd, J = 7.2 , 8.4 Hz, 1H), 6.99 (dd, J = 1.6, 7.2 Hz, 1H), 7.44 (dd, J = 1.6, 8.4 Hz, 1H).

PL 213 633 B1

[0035] Production example 4

7-Bromo-2-ethyl-3-nitropyrazolo [1,5-a] pyridine

Nitroyl tetrafluoroborate (1.3 g) was added to a solution of 7-bromo-2-ethylpyrazolo [1,5-a] pyridine (1.1 g) dissolved in acetonitrile (20 ml) while cooling with ice, and the reaction mixture was stirred for 30 minutes. The reaction mixture was then added to ice water, extraction was performed with ethyl acetate and the organic extract was washed with water and brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography and the title compound (670 mg) was obtained as yellow crystals from the n-hexane: ethyl acetate (10: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.42 (t, J = I. 6 Hz, 3H), 3.27 (q, J = 7.6 Hz, 2H), 7.39 (dd, J = 1.2, 7.6 Hz, 1H), 7.50 (dd, J = 1.6, 8.8 Hz, 1H), 8.38 (dd, J = 1.2, 8.8 Hz, 1H).

[0036] Preparation example 5

7-Bromo-2-ethylpyrazolo [1,5-a] pyridin-3-amine

To a suspension of 7-bromo-2-ethyl-3-nitropyrazolo [1,5-a] pyridine (1.78 g) in a mixed solution of ethanol (100 ml), water (50 ml) and acetic acid (10 ml) was added zinc powder ( 1.78 g) at room temperature and the reaction mixture was stirred for 1 h at 65 ° C. The reaction mixture was filtered through celite to remove undissolved residue, and the filtrate was evaporated under reduced pressure. Water was added to the obtained residue and extraction was performed with ethyl acetate, and after washing the organic extract with water, a saturated aqueous sodium hydrogen carbonate solution and brine, the organic extract was dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (60 g) and the title compound (1.16 g) was obtained as a dark green oil from the ethyl acetate: n-hexane (4: 1) fraction.

¹ H NMR (400 MHz, CDCl3) δ 1.36 (t, J = 1.6 Hz, 3H), 2.89 (q, J = 7.6 Hz, 2H), 6.81 (dd, J = 7.1, 8.7 Hz, 1H), 6.88 ( dd, J = 1.3, 7.0 Hz, 1H), 7.34 (dd, J = 1.3, 8.6 Hz, 1H).

[0037] Preparation example 6

Tbutyl M- (7-Bramo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) carbamate

Triethylamine (1.01 ml) and di-Ye / N-butyldicarbonate (1.34 ml) were added to a solution of 7-bromo-2-ethylpyrazolo [1,5-a] pyridin-3-amine (1.16 g) in dichloromethane (50 ml). room temperature and the reaction mixture was stirred for 15 hours. After completion of the reaction, the solvent was evaporated under reduced pressure. Ethyl acetate was added to the residue, and the obtained organic extract was washed with water and brine, dried over anhydrous magnesium sulfate and filtered, then the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (60 g) and the title compound (1.09 g) was obtained as hazelnut crystals from the ethyl acetate: n-hexane (1: 3) fraction.

PL 213 633 B1 ¹ H NMR (400 MHz, CDCis) δ 1.34 (t, J = 7.6 Hz, 3H), 1.52 (br s, 9H), 2.87 (q, J = 7.6 Hz, 2H), 5.91 (br s , 1H), 6.92-7.04 (m, 2H), 7.40 (d, J = 9.0 Hz, 1H).

[0038] Preparation example 7

M- (7-Bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -M-cyclopropylmethylamine

Sodium hydride (60% by weight) was added to a solution of tert-butyl N- (7-bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) carbamate (658 mg) in N, N-dimethylformamide (15 ml). oil; 116 mg) at room temperature under a stream of nitrogen and the reaction mixture was stirred for 30 minutes. (Bromomethyl) cyclopropane (0.286 ml) was added at the same temperature and the reaction mixture was stirred for 1 h at 60 ° C. After completion of the reaction, the reaction mixture was gradually added to ice, ethyl acetate was added, and the organic extract was washed with water and brine, then dried over anhydrous magnesium sulfate, evaporated under reduced pressure to give the crude product.

Tert-Butyl N- (7-bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -N-cyclopropylmethylcarbamate.

To a solution of crude tert-butyl N- (7-bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -N-cyclopropylmethylcarbamate dissolved in ethyl acetate (10 ml) was added 4N hydrochloric acid / ethyl acetate ( 30 ml), and the reaction mixture was stirred for 2 hours at room temperature. After completion of the reaction, a 5N aqueous sodium hydroxide solution was added to the reaction mixture while cooling with ice for neutralization. The reaction mixture was extracted with ethyl acetate, and after the organic extract was washed with water and brine, it was dried with anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by chromatography on a silica gel column (20 g) and the title compound (479 mg) was obtained as a yellow oil from the ethyl acetate: n-hexane (1: 3) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 0.14-0.22 (m, 2H), 0.47-0.56 (m, 2H), 0.96-1.10 (m, 1H), 1.37 (t, J = 7.6 Hz, 3H), 2.88 (d, J = 6.8 Hz, 2H), 2.90 (q, J = 7.6 Hz, 2H), 6.83 (dd, J = 7.0, 8.8 Hz, 1H), 6.90 (dd, J = 1.3, 7.1 Hz, 1H) , 7.43 (dd, J = 1.3, 8.8 Hz, 1H).

[0039]. Manufacturing example 8

M- (7-Bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -M-cyclopropylmethyl-M4etrahydro-2H-4-pyranylmethylamine

To a solution of N- (7-bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -N-cyclopropylmethylamine (106 mg) in tetrahydrofuran (3 ml) was added tetrahydropyran-4-carbaldehyde (123 mg) in room temperature, and then sodium triacetoxyborohydride (229 mg) was gradually added. After the reaction mixture was stirred, a saturated aqueous sodium bicarbonate solution was added. After the resulting mixture was extracted with ethyl acetate, the organic extract was washed with brine and then dried over anhydrous magnesium sulfate and evaporated under reduced pressure. The residue was purified by chromatography on a silica gel column (10 g) and the title compound (120 mg) was obtained as a yellow oil from the ethyl acetate: n-hexane (1: 6) fraction.

¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.06 (m, 2H), 0.33-0.43 (m, 2H), 0.75-0.88 (m, 1H), 1.20-1.34 (m, 2H), 1.38 (t , J = 7.6 Hz, 3H), 1.48-1.62 (m, 1H), 1.69-1.78 (m, 2H), 2.88 (d, J = 6.8 Hz, 2H), 2.91 (q, J = 7.6 Hz, 2H) , 3.04 (d, J = 7.0 Hz, 2H), 3.30 (dt, J = 2.1, 12.0 Hz, 2H), 3.90-4.00 (m, 2H), 6.88 (dd, J = 7.1, 8.8 Hz, 1H), 6.96 (dd, J = 1.3, 7.1 Hz, 1H), 7.49 (dd, J = 1.3, 8.8 Hz, 1H).

PL 213 633 B1

[0040] Similar to preparation example 7 and 8, the compound of preparation example 9 was prepared.

[0041] Preparation example 9

M- (7-Bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -M-butyl-M-tetrahydro-2H-4-pyranylmethylamine

yellow oil

[0042] Preparation example 10

7- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2-ethyl-3-nitropyrazolo [1,5-a] pyridine

2,6-Dimethoxy acid was added to a solution of 7-bromo-2-ethyl-3-nitropyrazolo [1,5-a] pyridine (1.0 g) dissolved in a mixture of 1,2-dimethoxyethane (50 ml) and water (25 ml). -4- (methoxymethyl) phenylboronic acid (1.26 g), tetrakis (triphenylphosphine) palladium (0) (0.64 g) and barium hydroxide hexahydrate (1.75 g) and the reaction mixture was heated and stirred for 2 hours at 80 ° C. Water and ethyl acetate were added to the resulting reaction mixture, and the undissolved residue was removed by filtration through celite. The filtrate was extracted with ethyl acetate, the organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography and the title compound (0.77 g) was obtained as yellow crystals from the n-hexane: ethyl acetate (3: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.28 (t, J = 7.2 Hz, 3H), 3.12 (q, J = 7.2 Hz, 2H), 3.49 (s, 3H), 3.71 (s, 6H), 4.53 ( s, 2H), 6.67 (s, 2H), 7.03 (dd, J = 1.6, 7.2 Hz, 1H), 7.65 (dd, J = 7.2, 8.8 Hz, 1H), 8.34 (dd, J = 1.2, 8.8 Hz , 1H).

[0043] Preparation example 11

7-Bromo-2-methylpyrazole [1,5-a] pyridine

Br

To a solution of 2-methylpyrazolo [1,5-a] pyridine (Reference; Farm Chem. Bull., 1983, 31, 4568-5572) (1.0 g) dissolved in tetrahydrofuran (20 ml) was added n-butyl lithium (2.66 M hexane solution; 3.7 ml) dropwise at -78 ° C under a nitrogen stream and the reaction mixture was stirred for 30 minutes. A solution of 1,2-dibromo-1,1,2,2-tetrachloroethane (2.7 g) in tetrahydrofuran (5 ml) was added dropwise to the reaction mixture, and stirring was continued for 30 minutes. After adding saturated aqueous ammonium chloride solution to the obtained reaction mixture, the temperature was raised to room temperature, water was added to the reaction mixture, and extraction was performed with ethyl acetate. The organic extract was separated, then washed with brine, dried over anhydrous magnesium sulfate, and filtered. The solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound (1.34 g) was obtained as a yellow oil from the n-hexane: ethyl acetate (10: 1) fraction.

PL 213 633 B1 ¹ H NMR (400 MHz, CDCl 3) δ 2.55 (s, 3H), 6.45 (s, 1H), 6.93 (dd, J = 7.2, 8.4 Hz, 1H), 6.97 (dd, J = 1.6, 7.2 Hz, 1H), 7.41 (dd, J = 1.6, 8.4 Hz, 1H).

Preparation Example 12 7-Bromo-2-methyl-3-nitropyrazolo [1,5-a] pyridine

Nitroyl tetrafluoroborate (900 mg) was added to a solution of 7-bromo-2-methylpyrazolo [1,5-a] pyridine (1.3 g) dissolved in acetonitrile (25 ml) with stirring on ice, and the reaction mixture was stirred for 10 minutes. The resulting reaction mixture was added to ice water, and the precipitated crystals were collected by filtration, washed with water, and then dried under reduced pressure to obtain crude crystals. They were purified by silica gel column chromatography and the title compound (900 mg) was obtained as yellow crystals from the n-hexane: ethyl acetate (5: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 2.85 (s, 3H), 7.38 (dd, J = 1.2, 7.6 Hz, 1H), 7.49 (dd, J = 7.6, 8.8 Hz, 1H), 7.35 (dd, J = 1.2, 8.8 Hz, 1H).

[0045] Preparation example 13

Tbutyl M- (7-bromo-2-methylpyrazoyl [1,5-a] pyridin-3-yl) carbamate

Zinc powder was added to a suspension of 7-bromo-2-methyl-3-nitropirazolo [1,5-a] pyridine (890 mg) in a mixed solution of ethanol (20 ml), water (10 ml) and acetic acid (2 ml). (890 mg) at room temperature and the reaction mixture was heated and stirred for 30 minutes at 60 ° C. After filtering off the undissolved residue, the filtrate was extracted with ethyl acetate and the organic extract was washed with saturated sodium bicarbonate solution and brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by chromatography on a silica gel column and [7-bromo-2-methylpyrazolo [1,5-a] pyridin-3-yl] amine (371 mg ) obtained as a brown oil from the n-hexane: ethyl acetate (1: 1) fraction.

To a solution of the obtained [7-bromo-2-methylpyrazolo [1,5-a] pyridin-3-yl] amine and triethylamine (0.342 ml) dissolved in dichloromethane was added di-tert-butyldicarbonate (429 mg) under ice cooling, and the mixture was the reaction was stirred for 15 hours at room temperature. Water was added to the resulting reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with water and brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by chromatography on a silica gel column and the title compound (420 mg) was obtained as an ecru oil from the n-hexane: ethyl acetate (5: 1) fraction. ).

¹ H NMR (400 MHz, CDCl 3) δ 1.52 (br s, 9H), 2.47 (s, 3H), 5.88-5.92 (m, 1H), 6.94-7.00 (m, 2H), 7.37-7.42 (m, 1H ).

[0046] Similar to preparation example 7 and 8, the compound of preparation example 14 was prepared.

[0047] Preparation example 14

M- (7-Bromo-2-methylpyrazolo [1,5-a] pyridin-3-yl) -M-cyclopropylmethyl-M4etrahydro-2H-4-pyranylmethylamine

PL 213 633 B1

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ 0.04-0.08 (m, 2H), 0.32-0.43 (m, 2H), 0.74-0.88 (m, 1H), 1.20-1.36 (m, 2H), 1.46- 1.62 (m, 1H), 1.66-1.78 (m, 2H), 2.52 (s, 3H), 2.87 (d, J = 6.8 Hz, 2H), 3.03 (d, J = 6.8 Hz, 2H), 3.30 (dt , J = 2.0, 12.0 Hz, 2H), 3.89-3.99 (m, 2H), 6.88 (dd, J = 1.4, 6.8 Hz, 1H), 6.95 (dd, J = 6.8,

8.8 Hz, 1H), 7.47 (dd, J = 1.4, 8.8 Hz, 1H).

[0048] Preparation example 15

2- (3-Methoxy-1-propynyl) pyridine

To a solution of 2-bromopyridine (20 g) dissolved in diethylamine (100 ml) was added 3-methoxy-1-propyne (11.8 g), dichlorobis (triphenylphosphine) palladium (II) (888 mg) and copper iodide (121 mg), and the mixture was the reaction was stirred for 1 h at 40 ° C under a nitrogen stream. After filtering the reaction mixture through celite to remove undissolved residue, the filtrate was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound (16.8 g) was obtained as a light orange oil from the n-hexane: ethyl acetate (5: 1) fraction ).

¹ H NMR (400 MHz, CDCl 3) δ 3.48 (s, 3H), 4.36 (s, 2H), 7.22-7.26 (m, 1H), 7.44-7.47 (m, 1H), 7.66 (ddd, J = 1.6, 7.6, 7.6 Hz, 1H), 8.57-8.60 (m, 1H).

[0049] Preparation example 16

2- (Methoxymethyl) pyrazolo [1,5-a] pyridine

A solution of O-mesitylenesulfonylhydroxylamine (Reference; Synthesis, 1997, I) (21 g) in dichloromethane (80 ml) was added dropwise to a solution of 2- (3-methoxy-1-propynyl) pyridine (13.2 g) dissolved in dichloromethane (50 ml). ice cooling and the reaction mixture was stirred for 30 minutes. Diethyl ether (1 L) was added to the obtained reaction mixture to the precipitated crystals, which were collected by filtration and dried under reduced pressure to obtain the crude product of 1-amino-2- (3-methoxy-1-methoxy-1, 2,4,6-trimethyl-1-benzenesulfonate). -propynyl) pyridinium as ecru crystals (27.1 g).

Sodium methoxide (28%) was added dropwise to a solution of the obtained crude product of 1-amino-2- (3-methoxy-1-propynyl) -pyridinium 2,4,6-trimethyl-1-benzenesulfonate (27.1 g) dissolved in methanol (100 ml). methanol solution; 14.3 ml) while cooling with ice and the reaction mixture was stirred for 20 minutes at room temperature. After adding ice water to the obtained reaction mixture, methanol was evaporated under reduced pressure, water was added to the residue and extracted 3 times with ethyl acetate. The organic extracts were combined, washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (3.54 g) was obtained as a light orange oil from the n-hexane: ethyl acetate (5: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 3.47 (s, 3H), 4.68 (s, 2H), 6.50 (s, 1H), 6.70-6.75 (m, 1H), 7.06-7.11 (m, 1H), 7.47 -7.50 (m, 1H), 8.40-8.43 (m, 1H).

Preparation Example 17 (7-Bromopyrazolo [1,5-a] pyridin-2-yl) methylmethylether

PL 213 633 B1

Br

To a solution of 2- (methoxymethyl) pyrazolo [1,5-a] pyridine (3.5 g) dissolved in tetrahydrofuran (3 50 ml) was added n-Butyllithium (2.66M hexane solution; 10.5 ml) dropwise at -78 ° C under a stream of nitrogen and the reaction mixture was stirred for 30 minutes. 1,2-Dibromoethane (2.05 mL) was added dropwise to the resulting reaction mixture, and stirring was continued for 30 minutes. After adding saturated ammonium chloride aqueous solution to the reaction mixture, the temperature was raised to room temperature, water was added and extraction was performed with ethyl acetate. The organic extract was washed with brine, dried over anhydrous magnesium sulfate, and filtered. The solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound (2.75 g) was obtained as a slightly yellow oil from the n-hexane: ethyl acetate (10: 1) fraction.

¹ H NMR (400 MHz, CDCl ₃ ) δ 3.47 (s, 3H), 4.75 (s, 2H), 6.71 (s, 1H), 6.99 (dd, J = 7.2, 8.8 Hz, 1H), 7.05 (dd, J = 1.2, 7.2 Hz, 1H), 7.51 (dd, J = 1.2, 8.8 Hz, 1H).

[0051] Preparation example 18

(7-bromo-3-nitropirazolo [1,5-a] pyridin-2-yl) methylmethyl ether

Nitroyl tetrafluoroborate (606 mg) was added to a solution of (7-bromopyrazolo [1,5-a] pyridin-2-yl) methylmethyl ether (1.0 g) dissolved in acetonitrile (20 ml) with stirring on ice. The resulting reaction mixture was added to ice water, extracted with ethyl acetate, and then washed with water and brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by chromatography on a silica gel column and the title compound (546 mg) was obtained as slightly yellow crystals from the n-hexane: ethyl acetate (5: 1) fraction. .

¹ H NMR (400 MHz, CDCl 3) δ 3.61 (s, 3H), 5.09 (s, 2H), 7.44 (dd, J = 1.2, 7.6 Hz, 1H), 7.54 (dd, J = 7.6, 8.8 Hz, 1H ), 7.51 (dd, J = 1.2, 8.8 Hz, 1H).

[0052] Preparation example 19

Tert-Butyl M- [7-Bromo-2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] carbamate

To a solution of (7-bromo-3-nitropirazolo [1,5-a] pyridin-2-yl) methylmethylether (540 mg) in a mixed solution of ethanol (10 ml), water (5 ml) and acetic acid (1 ml) were added zinc powder (540 mg) and the reaction mixture was heated and stirred for 30 minutes at 60 ° C. After the undissolved residue was filtered off, water was added to the filtrate, extraction was performed with ethyl acetate, and the organic extract was washed with saturated sodium bicarbonate solution and brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and 7-bromo-2- (methoxymethyl) pyrazole- [1,5-a] pyridin-3-amine (371 mg) was obtained as a brown oil from the n-hexane: ethyl acetate (2: 1) fraction.

Di-tert-butyldicarbonate (380 mg) was added to a solution of the obtained 7-bromo-2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-amine dissolved in triethylamine (0.303 ml) and dichloromethane (5 ml).

While cooling with ice, the reaction mixture was further stirred overnight at room temperature. Water was added to the reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with water and brine. The obtained organic extract was dried with anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by chromatography on a silica gel column and the title compound (360 mg) was obtained as slightly yellow crystals from the n-hexane: ethyl acetate (5: 1) fraction. .

¹ H NMR (400 MHz, CDCl 3) δ 1.52 (br s, 9H), 3.42 (s, 3H), 4.77 (s, 2H), 6.50-6.62 (m, 1H), 6.97 (dd, J = 7.2, 8.8 Hz, 1H), 7.04 (dd, J = 1.2, 8.8 Hz, 1H), 7.58-7.68 (m, 1H).

[0053] Similar to preparation example 7 and 8, the compound of preparation example 20 was prepared.

[0054] Preparation example 20

M- [7-Bromo-2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] -M-cyclopropylmethyl-M-tetrahydro-2H-4-pyranylmethylamine

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.04-0.04 (m, 2H), 0.30-0.40 (m, 2H), 0.72-0.86 (m, 1H), 1.18-1.33 (m, 2H), 1.46 -1.62 (m, 1H), 1.64-1.75 (m, 2H), 2.87 (d, J = 6.8 Hz, 2H), 3.03 (d, J = 6.8 Hz, 2H), 3.27 (dt, J = 2.0, 11.2 Hz, 2H), 3.44 (s, 3H), 3.86-3.96 (m, 2H), 4.67 (s, 2H), 6.89 (dd, J = 1.4, 6.8 Hz, 1H), 7.02 (dd, J = 6.8, 8.8 Hz, 1H), 7.54 (dd, J = 1.4, 8.8 Hz, 1H).

[0055] Preparation example 21

7-Bromo-2-methoxypyrazolo [1,5-a] pyridine

A solution of 2-methoxypyrazolo [1,5-a] pyridine (Reference; Bull. Chem. Soc. Japan, vol. 49 (7), 19801984 (1976)) (7.15 g) in tetrahydrofuran (140 ml) was cooled to -78 ° C under a stream of nitrogen and after adding n-butyllithium (1.6M hexane solution: 46 ml) dropwise, the reaction mixture was stirred for 30 minutes. A solution of 1,2-dibromo-1,1,2,2-tetrachloroethane (18.9 g) in tetrahydrofuran (30 ml) was added dropwise to the reaction mixture at -78 ° C and stirring was continued for 1 h. The reaction mixture was warmed to room temperature. water was added and then extraction was performed with ethyl acetate. The organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound (7.1 g) was obtained as a yellow oil from the n-hexane: ethyl acetate fraction (50: 1) ).

¹ H NMR (400 MHz, CDCl 3) δ 4.03 (s, 3H), 6.02 (s, 1H), 6.91-6.97 (m, 2H), 7.31 (dd, J = 2.4, 7.6 Hz, 1H).

[0056] Preparation Example 22

7-Bromo-2-methoxypyrazolo [1,5-a] pyridin-3-amine

To a solution of 7-bromo-2-methoxypyrazolo [1,5-a] pyridine (1 g) dissolved in acetic acid (10 ml) was added an aqueous solution (5 ml) of sodium nitrite (334 mg) and the reaction mixture was stirred for

The reaction time was overnight at room temperature. After adding ethanol (60 ml) and water (30 ml) to the reaction mixture, zinc powder (1 g) was added and the reaction mixture was heated and stirred for 30 minutes at 60 ° C. The reaction mixture was filtered through celite to remove undissolved residue, water was added and extraction was performed with ethyl acetate. The organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography, and the title compound (750 mg) was obtained as brown crystals from the n-hexane: ethyl acetate (3: 1) fraction ).

¹ H NMR (400 MHz, CDCl3) δ 4.13 (s, 3H), 6.78 (dd, J = 1.6, 6.8 Hz, 1H), 6.81 (dd, J = 6.8, 8.4 Hz, 1H), 7.24 (dd, J = 1.6, 8.4 Hz, 1H).

[0057] Preparation Example 23

Tbutyl M- (7-bromo-2-methoxypyrazolo [1,5-a] pyridin-3-yl) carbamates

To a solution of 7-bromo-2-methoxypyrazolo [1,5-a] pyridin-3-amine (810 mg) dissolved in dichloromethane (20 ml) was added triethylamine (0.7 ml) and di-tetra / Y-butyldicarbonate (923 pL) while cooling with ice and the reaction mixture was stirred overnight at room temperature. Water was added to the resulting reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by chromatography on a silica gel column and the title compound (1.05 g) was obtained as yellow crystals from the n-hexane: ethyl acetate (10: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.49 (s, 9H), 4.12 (s, 3H), 6.89 (dd, J = 1.2, 7.6 Hz, 1H), 6.94 (dd, J = 7.6, 8.8 Hz, 1H ), 7.30-7.39 (m, 1H).

[0058] Preparation Example 24

M- (7-Bromo-2-methoxypyrazolo [1,5-a] pyridin-3-yl) -M-cyclopropylmethyl-M-tetrahydro-2H-4-pyranylmethylamine

Sodium hydride (60% in oil; 24.6 mg) was added to a solution of Ye / Y-butyl N- (7-bromo-2-methoxypyrazolo [1,5-a] pyridin-3-yl) carbamate (140 mg) in N, N-dimethylformamide (10 ml) at room temperature and the reaction mixture was stirred for 30 minutes. (Bromomethyl) cyclopropane (0.06 ml) was added at the same temperature and the reaction mixture was stirred for 1 h at 60 ° C. After completion of the reaction, the reaction mixture was gradually added to ice, extraction was performed with ethyl acetate, the organic extract was washed with water and brine, dried over anhydrous magnesium sulfate and filtered, then the solvent was evaporated under reduced pressure to give the crude product N- (7-bromo-2-methoxypyrazole). Ye (Y-butyl [1,5-a] pyridin-3-yl) -N-cyclopropylmethyl carbamate.

The obtained crude Ye / Y-butyl N- (7-bromo-2-methoxypyrazolo [1,5-a] pyridin-3-yl) -N-cyclopropylmethylcarbamate was dissolved in ethyl acetate (10 ml) without purification and then 4N hydrochloric acid was added. / ethyl acetate (15 ml) and the reaction mixture was stirred for 2 hours at room temperature. After completion of the reaction, a 5N aqueous sodium hydroxide solution was added to the reaction mixture while cooling with ice for neutralization. Ethyl acetate was added and the obtained organic extract was washed with water and brine, dried over anhydrous magnesium sulfate and filtered, then the solvent was evaporated under reduced pressure to obtain crude N- (7-bromo-2-methoxypyrazolo [1,5-a] pyridin-3-. yl) -N-cyclopropylmethylamine.

PL 213 633 B1

The obtained crude N- (7-bromo-2-methoxypyrazolo [1,5-a] pyridin-3-yl) -N-cyclopropylmethylamine was dissolved in tetrahydrofuran (10 mL) without further purification and then tetrahydropyran-4-carbaldehyde (233 mg) was added. ) at room temperature and sodium triacetoxyborohydride (433 mg) was gradually added. After the reaction mixture was stirred for 2 hours, a saturated sodium bicarbonate solution was added to the reaction mixture. After extraction with ethyl acetate, the organic extract was washed with brine and dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by chromatography on a silica gel column (10 g) and the title compound (110 mg) was obtained as a yellow oil from the ethyl acetate: n-hexane (1: 6) fraction.

¹ HNMR (400 MHz, CDCl3) δ -0.02-0.10 (m, 2H), 0.20-0.40 (m, 2H), 0.70-0.90 (m, 1H), 1.10-1.39 (m, 2H), 1.40-1.60 ( m, 1H), 1.62-1.80 (m, 2H), 2.81 (d, J = 6.4 Hz, 2H), 2.95 (d, J = 7.2 Hz, 2H), 3.27 (dt, J = 2.0, 12.0 Hz, 2H ), 3.80-4.00 (m, 2H), 4.11 (s, 3H), 6.80-6.95 (m, 2H), 7.33 (dd, J = 1.6, 8.4 Hz, 1H).

[0059] Preparation example 25

Tbutyl N- [2-methylthiopyrazolo [1,5-a] pyridin-3-yl] carbamate

For a suspension of 2-methylthio-3-nitropirazolo [1,5-a] pyridine (Reference; Heterocycles, 1977, 6, 379) (400 mg) in ethanol (20 ml), water (10 ml), acetic acid (2 ml ), zinc powder (800 mg) was added and the reaction mixture was heated and then stirred for 30 minutes at 80 ° C. The undissolved residue was filtered off, water was added to the filtrate and extraction was performed with ethyl acetate, and then the organic extract was washed with saturated sodium bicarbonate solution and brine. The organic extract was dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure to give (2-methylthiopyrazolo [1,5-a] pyridin-3-yl) amine as a crude product.

To a solution of the obtained crude (2-methylthiopyrazolo [1,5-a] pyridin-3-yl) amine dissolved in dichloromethane (5 ml) was added triethylamine (0.4 ml) and then di-Ye / Y-butyldicarbonate (625 mg) during cooling with ice and the reaction mixture was stirred overnight at room temperature. Water was added to the reaction mixture, extraction was performed twice with ethyl acetate, and the organic extract was washed with water and brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by chromatography on a silica gel column and the title compound (230 mg) was obtained as a yellow oil from the n-hexane: ethyl acetate (5: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.53 (br s, 9H), 2.60 (s, 3H), 6.00-6.15 (m, 1H), 6.69 (t, J = 6.8 Hz, 1H), 7.11 (t, J = 8.0 Hz, 1H), 7.40-7.50 (m, 1H), 8.83 (d, J = 6.8 Hz, 1H).

[0060] Preparation Example 26

Tbutyl M- [7-iodo-2-methylthiopyrazolo [1,5-a] pyridin-3-yl] carbamate

To a solution of Ye / Y-butyl N- [2-methylthiopyrazolo [1,5-a] pyridin-3-yl] carbamate (21.6 g) dissolved in tetrahydrofuran (1 L) was added dropwise n-butyllithium (1.6M hexane solution; 130 ml) at -78 ° C under a nitrogen stream and the reaction mixture was stirred for 30 minutes. A solution of 1,2-diiodoethane (24 g) in tetrahydrofuran (50 ml) was added to the obtained reaction mixture, and stirring was continued for 1 hour. After adding saturated ammonium chloride aqueous solution to the reaction mixture, the temperature was raised to room temperature, extraction was performed

With ethyl acetate and the organic extract was washed with water and brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound (21.5 g) was obtained as yellow crystals from the n-hexane: ethyl acetate (5: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.52 (s, 9H), 2.64 (s, 3H), 6.02-6.10 (m, 1H), 6.81 (dd, J = 7.2, 8.8 Hz, 1H), 7.22 (dd , J = 1.2, 7.2 Hz, 1H), 7.42-7.50 (m, 1H).

Preparation Example 27

M-Cyclopropylmethyl-M - ^ - iodo ^ -fmethylsulfanylolpyrazolone ^ -atiridin ^ -ylotin

Sodium hydride (60% by weight) was added to a solution of tert-butyl N- [7-iodo-2-methylthiopyrazolo [1,5-a] pyridin-3-yl] carbamate (600 mg) in N-dimethylformamide (6 ml). oil; 80 mg) in an ice bath and the reaction mixture was stirred for 30 minutes at room temperature. (Bromomethyl) cyclopropane (0.22 ml) was added to the reaction mixture at the same temperature, and stirring was continued for 1 h at 40 ° C. After completion of the reaction, the reaction mixture was gradually added to ice, extraction was performed with ethyl acetate, and the organic extract was washed with water and brine. The organic extract was dried over anhydrous magnesium sulfate and the solvent was evaporated under reduced pressure to obtain the crude product tert-butyl N-cyclopropylmethyl-N- [7-iodo-2- (methylsulfanyl) pyrazolo [1,5-a] pyridin-3-yl] carbamate .

To a solution of crude tert-butyl N-cyclopropylmethyl-N- [7-iodo-2- (methylsulfanyl) pyrazolo [1,5-a] pyridin-3-yl] carbamate dissolved in ethyl acetate (1 mL) was added 4N hydrochloric acid / ethyl acetate (10 ml) and the reaction mixture was stirred for 2 hours at room temperature. After completion of the reaction, a saturated sodium bicarbonate solution was added to the reaction mixture while cooling with ice for neutralization. The reaction mixture was extracted with ethyl acetate, and after washing the organic extract with water and brine, it was dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by chromatography on a silica gel column (20 g) and the title compound (506 mg) was obtained as a yellow oil from the ethyl acetate: n-hexane (1: 3) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 0.16-0.24 (m, 2H), 0.48-0.56 (m, 2H), 1.00-1.10 (m, 1H), 2.60 (s, 3H), 2.96 (d, J = 6.0 Hz, 2H), 3.00-3.24 (m, 1H), 6.68 (ddd, J = 1.2, 6.8, 8.8 Hz, 1H), 7.17 (dd, J = 1.2,

6.8 Hz, 1H), 7.43 (dd, J = 1.2, 8.8 Hz, 1H).

[0062] Preparation Example 28

M-Cyclopropylmethyl-M-r7-iodo-2- (methylsulfanyl) pyrazolo [1,5-a] pyridin-3-yl] -1- tetrahydro-2H-4-pyranylmethylamine

Tetrahydropyran-4-carbaldehyde was added to a solution of N-cyclopropylmethyl-N- [7-iodo-2- (methylsulfanyl) pyrazolo [1,5-a] pyridin-3-yl] amine (70 mg) in tetrahydrofuran (2.5 ml). (56 mg) at room temperature and then sodium triacetoxyborohydride (103 mg) was gradually added. After 1 hour, a saturated sodium bicarbonate solution was added, extraction was performed with ethyl acetate, the extract was washed with brine and dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure to give a crude product of the title compound (50 mg) as a yellow oil.

¹ H NMR (400 MHz, CDCl 3) δ -0.06-0.04 (m, 2H), 0.30-0.38 (m, 2H), 0.74-0.86 (m, 1H), 1.20-1.32 (m, 2H), 1.40-1.60 (m, 1H), 1.66-1.80 (m, 2H), 2.69 (s, 3H), 2.85 (d, J = 6.8 Hz, 2H), 3.02 (d, J = 7.2 Hz, 2H), 3.22-3.32 ( m, 2H), 3.86-3.94 (m, 2H), 6.72 (dd, J = 7.2, 8.8 Hz, 1H), 7.15 (dd, J = 1.2, 7.2 Hz, 1H), 7.40 (dd, J = 1.2, 8.8 Hz, 1H).

PL 213 633 B1

[0063] Preparation Example 29

2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid

To a solution of 3,5-dimethoxy (methoxymethyl) benzene (23.7 g) in tetrahydrofuran (500 ml) was added n-butyl lithium (1.56M hexane solution; 100 ml) at -78 ° C and the reaction mixture was stirred for 30 minutes while cooling with ice. . After the internal temperature of the resulting reaction mixture was cooled to -78 ° C, triisopropoxyborane (39 mL) was added to the reaction mixture, and the internal temperature was warmed to room temperature with stirring. After completion of the reaction, a saturated aqueous ammonium chloride solution was added to the reaction mixture while cooling with ice, then ethyl acetate was added to the reaction mixture, the organic extract was washed with brine and dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (7.5 g) was obtained as a yellow oil from the ethyl acetate fraction.

¹ H NMR (400 MHz, CDCl 3) δ 3.43 (s, 3H), 3.92 (s, 6H), 4.47 (s, 2H), 6.61 (s, 2H), 7.18 (s, 2H).

Preparation Example 30

4- (hydroxymethyl) -2,6-dimethoxyphenylboronic acid

To a solution of 3,5-dimethoxybenzyl alcohol (2.71 g) in tetrahydrofuran (50 ml) was added n-butyl lithium (1.5 6M hexane solution; 36.2 ml) while cooling in an ice bath, and the internal temperature was warmed to room temperature and stirred for 1 hour. The internal temperature was then cooled to -78 ° C, triethoxyborane (9.6 ml) was added to the mixture and the temperature was raised to room temperature with stirring. After completion of the reaction, a saturated aqueous ammonium chloride solution was added to the reaction mixture while cooling with ice, and the reaction mixture was extracted with ethyl acetate, and then, after washing the organic extract with brine, it was dried with anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by chromatography on a silica gel column (50 g) and the title compound (1.72 g) was obtained as an amorphous solid from the ethyl acetate fraction.

¹ H NMR (400 MHz, CDCl 3) δ 3.92 (s, 6H), 4.73 (s, 2H), 6.65 (s, 2H), 7.18 (s, 2H).

[0065] As in preparation example 30, the compounds of preparation example 31 and 32 were synthesized.

[0066] Preparation Example 31

4- (2-hydroxyethyl) -2,6-dimethoxyphenylboronic acid

yellow oil ¹ HNMR (400 MHz, CDCl3) δ 1.56-1.62 (m, 1H), 2.88 (t, J = 6 2H), 3.88-3.92 (m, 2H), 3.90 (s, 6H), 6.51 (s, 2H), 7.14 (s, 2H)

PL 213 633 B1

Preparation Example 32

4- (3-hydroxypropyl) -2,6-dimethoxyphenylboronic acid

¹ H NMR (400 MHz, CDCl 3) δ 1.84-1.94 (m, 2H), 2.68 2.76 (m, 2H), 3.64-3.74 (m, 2H), 3.90 (s, 6H), 6.48 (s, 2H), 7.16 (s, 2H).

[0068] The compounds of preparation example 33 to 35 were synthesized similar to preparation example 29.

[0069] Preparation Example 33

4- (ethoxymethyl) -2,6-dimethoxyphenylboronic acid

¹ H NMR (400 MHz, CDCl3) δ 1.28 (t, J = 7.1 Hz, 3H), 3.58 (q, J = 7.1 Hz, 2H), 3.92 (s, 6H), 4.51 (s, 2H), 6.63 ( s. 2H), 7.19 (s, 2Η).

[0070] Preparation Example 34

4- [1- [1- (t? -Butyl) -1,1-dimethylsilyl] oxyethyl] -2,6-dimethoxyphenylboronic acid

Colorless oil ¹ H NMR (400 MHz, CDCl 3) δ 0.01 (s, 3H), 0.08 (s, 0.92 (s, 9H), 1.41 (d, J = 6.4 Hz, 3H), 3.90 (s, 6H), 4.84 (q, J = 6.4 Hz, 1H), 6.61 (s, 2H), 7.17 (s, 2H).

Preparation Example 35

2,4-dimethoxy-6- (methoxymethyl) phenylboronic acid

White crystals ¹ H NMR (400 MHz, CDCl3) δ 3.41 (s, 3H), 3.85 (s, 3H), 3.88 (s, 3H), 4.53 (s, 2H), 6.48 (d, J = 2.4 Hz, 1H ), 6.55 (d, J = 2.4 Hz, 1H), 7.09 (br s, 2H).

Example 1

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

PL 213 633 B1

To a solution of N- (7-bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -N-cyclopropylmethyl-N-tetrahydro-2H-4-pyranylmethylamine (60 mg) dissolved in 1,2-dimethoxyethane (2 ml) and water (1 ml) were added 2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid (45 mg), tetrakis (triphenylphosphine) palladium (0) (35 mg) and barium hydroxide octahydrate (72 mg) and the reaction mixture was heated and stirred for 4 h at 90 ° C. The reaction mixture was then cooled to room temperature, water and ethyl acetate were added, the reaction mixture was filtered through celite to remove undissolved residue, and the filtrate was extracted with ethyl acetate. The combined organic extracts were washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (40 mg) was obtained as slightly yellow crystals from the n-hexane: ethyl acetate (1: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.04 (m, 2H), 0.34-0.38 (m, 2H), 0.80-0.90 (m, 1H), 1.22 (t, J = 7.6 Hz, 3H), 1.24-1.34 (m, 2H), 1-54-1.64 (m, 1H), 1.74-1.80 (m, 2H), 2.77 (q, J = 1.6 Hz, 2H), 2.88 (d, J = 6.8 Hz, 2H), 3.05 (d, J = 7.2 Hz, 2H), 3.31 (t, J- = 11.6 Hz, 2H), 3.49 (s, 3H), 3.73 (s, 6H), 3.90-4.00 (m, 2H) , 4.53 (s, 2H), 6.59 (dd, J = 1.2, 6.8 Hz, 1H), 6.67 (s, 2H), 7.00 (dd, J = 6.8, 8.8 Hz, 1H), 7.44 (dd, J = 1.2 , 8.8 Hz, 1H).

[0073] Example 1-2

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

The title compound (29 g) was recrystallized from ethanol (80 ml) to give slightly yellow crystals (27.5 g). ¹ H NMR (600 MHz, DMSO-d6) δ -0.02-0.00 (m, 2H), 0.32-0.35 (m, 2H), 0.73-0.79 (m, 1H), 1.11-1.19 (m, 5H), 1.51-1.57 (m, 1H), 1.69-1.72 (br dd, J = 2.0, 12.7 Hz, 2H), 2.65 (q, J = 7.6 Hz, 2H), 2.84 (d, J = 6.8 Hz, 2H), 3.01 (d , J = 7.1 Hz, 2H), 3.21 (ddd, J = 1.7, 11.7, 11.7 Hz, 2H), 3.39 (s, 3H), 3.63 (s, 6H), 3.82 (br dd, J = 2.4, 11.5 Hz , 2H), 4.49 (s, 2H), 6.55 (dd, J = 1.2, 6.8 Hz, 1H), 6.74 (s, 2H), 7.06 (dd, J = 6.6, 8.8 Hz, 1H), 7.51 (dd, J = 1.2, 8.8 Hz, 1H).

[0074] As in Example 1, the compounds of Examples 2 to 9 were synthesized.

[0075] Comparative example 2

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (1-methoxyethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

PL 213 633 B1

Slightly yellow crystals ¹ H NMR (400 MHz, CDCl3) δ -0.02-0.04 (m, 2H), 0.32-0.38 (m, 2H), 0.80-0.92 (m, 1H), 1.23 (t, J = 1.6 Hz, 3H), 1.22-1.34 (m, 2H), 1.52 (d, J = 6.4 Hz, 3H), 1.52-1.64 (m, 1H), 1.72-1.82 (m, 2H), 2.79 (q, J = 7.6 Hz , 2H), 2.89 (d, J = 6.4 Hz, 2H), 3.05 (d, J = 1.2 Hz, 2H), 3.26-3.34 (m, 2H), 3.36 (s, 3H), 3.73 (s, 6H) , 3.90-3.98 (m, 2H), 4.34 (q, J = 6.8 Hz, 1H), 6.61 (dd, J = 1.2, 6.8 Hz, 1H), 6.64 (d, J = 2.8 Hz, 2H), 7.01 ( dd, J = 6.8, 8.8 Hz, 1H), 7.44 (dd, J = 1.2, 8.8 Hz, 1H).

[0076] Comparative example 3

M-Cyclopropylmethyl-M-7- [4- (ethoxymethyl) -2,6-dimethoxyphenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

Yellow crystals ¹ H NMR (400 MHz, CDCl3) δ -0.02-0.06 (m, 2H), 0.34-0.43 (m, 2H), 0.80-0.94 (m, 1H), 1.24 (t, J = 7.5 Hz, 3H ), 1.33 (t, J = 7.0 Hz, 3H), 1.20-1.38 (m, 2H), 1.54-1.68 (m, 1H), 1.74-1.84 (m, 2H), 2.78 (q, J = 7.5 Hz, 2H), 2.90 (d, J = 6.6 Hz, 2H), 3.07 (d, J = 7.0 Hz, 2H), 3.33 (dt, J = 1.6, 12.0 Hz, 2H), 3.66 (q, J = 7.0 Hz, 2H), 3.75 (s, 6H), 3.92-4.02 (m, 2H), 4.59 (s, 2H), 6.61 (br d, J = 6.8 Hz, 1H), 6.71 (s, 2H), 7.0 (dd, J = 7.0, 8.8 Hz, 1H), 7.46 (br d, J = 8.8 Hz, 1H).

[0077] Comparative example 4

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-3-furanylmethylamine

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.04 (m, 2H), 0.32-0.42 (m, 2H), 0.80-0.82 (m, 1H), 1.21 (t, J = 7.6 Hz, 3H ), 1.58-1.66 (m, 1H), 1.84-1.94 (m, 1H), 2.20-2.32 (m, 1H), 2.74 (q, J = 7.6 Hz, 2H), 2.90 (d, J = 6.4 Hz, 2H), 3.40-3.50 (m, 1H), 3.18-3.26 (m, 1H), 3.47 (s, 3H), 3.58-3.70 (m, 2H), 3.71

PL 213 633 B1 (s, 6H), 3.72-3.82 (m, 2H), 4.51 (s, 2H), 6.58 (dd, J = 0.8, 6.8 Hz, 1H), 6.66 (s, 2H), 7.00 (ddd , J = 0.2, 6.8, 8.8 Hz, 1H), 7.42 (dd, J = 0.6, 8.8 Hz, 1H).

Comparative Example 5 (4-3 - [(Cyclopropylmethyl) (tetrahydro-2H-4-pyranylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxyphenyl) methanol

Slightly yellow amorphous solid product ¹ H NMR (400 MHz, CDCl 3) δ -0.03-0.05 (m, 2H), 0.32-0.40 (m, 2H), 0.80-0.90 (m, 1H), 1.22 (t, J = 7.5 Hz, 3H), 1.22-1.35 (m, 2H), 1.53-1.66 (m, 1H), 1.72-1.81 (m, 2H), 1.96 (t, J = 5.6 Hz, 1H), 2.78 (q, J = 7.5 Hz, 2H), 2.86-2.92 (m, 2H), 3.02-3.09 (m, 2H), 3.28-3.38 (m, 2H), 3.74 (s, 6H), 3.90-4.00 (m, 2H), 4.76 (d, J = 5.6 Hz, 2H), 6.61 (dd, J = 1.3, 6.8 Hz, 1H), 6.72 (s, 2H), 7.02 (dd, J = 6.8, 8.8 Hz, 1H), 7.46 (dd, J = 1.3, 8.8 Hz, 1H).

Comparative Example 6 (4-3 - [(Cyclobutylmethyl) (tetrahydro-2H-4-pyranylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxyphenyl) methanol

Slightly yellow amorphous solid product ¹ H NMR (400 MHz, CDCl 3) δ 1.19-1.32 (m, 2H), 1.21 (t, J = 7.5 Hz, 3H), 1.51-1.64 (m, 3H), 1.70-1.95 (m , 6H), 2.01 (t, J = 5.6 Hz, 1H), 2.26-2.39 (m, 1H), 2.73 (q, J = 7.5 Hz, 2H), 2.90-2.97 (m, 2H), 3.02-3.08 ( m, 2H), 3.26-3.37 (m, 2H), 3.73 (s, 6H), 3.89-3.99 (m, 2H), 4.74 (d, J = 5.6 Hz, 2H), 6.60 (dd, J = 1.3, 6.8 Hz, 1H), 6.71 (s, 2H), 7.02 (dd, J = 6.8, 8.8 Hz, 1H), 7.41 (dd, J = 1.3, 8.8 Hz, 1H).

[0080] Comparative Example 7

2- (4-3 - [(Cyclopropylmethyl) (tetrahydro-2H-4-pyanylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxyphenyl) -1-ethanol

PL 213 633 B1

Slightly green oil ¹ H NMR (400 MHz, CDCl3) δ -0.04-0.02 (m, 2H), 0.32-0.38 (m, 2H), 0.78-0.88 (m, 1H), 1.21 (t, J = 7.6 Hz, 3H), 1.22-1.32 (m, 2H), 1.52-1.65 (m, 2H), 1.72-1.80 (m, 2H), 2.75 (q, J = 7.6 Hz, 2H), 2.87 (d, J = 6.8 Hz , 2H), 2.92 (t, J = 6.4 Hz, 2H), 3.04 (d, J = 7.2 Hz, 2H), 3.26-3.34 (m, 2H), 3.70 (s, 6H), 3.90-3.98 (m, 4H), 6.55 (s, 2H), 6.58 (dd, J = 1.6, 6.8 Hz, 1H), 7.00 (dd, J = 6.8, 8.8 Hz, 1H), 7.43 (dd, J = 1.6, 8.8 Hz, 1H ).

[0081] Comparative Example 8

3- (4-3 - [(Cyclopropylmethyl) (tetrahydro-2H-4-pyanylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxyphenyl) -1-propanol

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.03-0.01 (m, 2H), 0.33-0.37 (m, 2H), 0.81-0.85 (m, 1H), 1.19-1.31 (m, 5H), 1.50 -1.57 (m, 1H), 1.72-1.77 (m, 2H), 1.95-2.04 (m, 2H), 2.73-2.80 (m, 4H), 2.87 (d, J = 6.8 Hz, 2H), 3.04 (d , J = 6.8 Hz, 2H), 3.30 (dt, J = 2.0, 12.0 Hz, 2H), 3.70 (s, 6H), 3.76 (t, J = 6.4 Hz, 2H), 3.91-3.95 (m, 2H) , 6.54 (s, 2H), 6.59 (dd, J = 1.2, 6.8 Hz, 1H), 7.00 (dd, J = 6.8, 8.8 Hz, 1H), 7.43 (dd, J = 1.6, 8.8 Hz, 1H).

[0082] Comparative Example 9

M-Cyclopropylmethyl-M-7- [2,4-dimethoxy-6- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

Slightly yellow crystals ¹ H NMR (400 MHz, CDCl3) δ -0.04-0.02 (m, 2H), 0.30-0.36 (m, 2H), 0.78-0.88 (m, 1H), 1.20 (t, J = 7.6 Hz, 3H), 1.20-1.32 (m, 2H), 1.52-1.64 (m, 1H), 1.72-1.80 (m, 2H), 2.70-2.80 (m, 2H), 2.87 (d, J = 6.8 Hz, 2H) , 3.04 (d, J = 6.8 Hz, 2H), 3.19 (s, 3H), 3.28-3.34 (m, 2H), 3.68 (s, 3H), 3.88 (s, 3H), 3.903.98 (m, 2H ), 3.98 (d, J = 12.8 Hz, 1H), 4.21 (d, J = 12.8 Hz, 1H), 6.51 (d, J = 2.4 Hz, 1H), 6.54 (dd, J = 1.6, 6.8 Hz, 1H ), 6.76 (d, J = 2.4 Hz, 1H), 6.99 (dd, J = 6.8, 8.8 Hz, 1H), 7.44 (dd, J = 1.2, 8.8 Hz, 1H).

[0083] Comparative Example 10

Tbutyl M-7- [2,6- (dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazo [1,5-a] pyridin-3-ylcarbamate

PL 213 633 B1

To a solution of te / t-butyl N- (7-bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) carbamate (100 mg) dissolved in 1,2-dimethoxyethane (6 ml) and water (3 ml) 2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid (100 mg), tetrakis- (triphenylphosphine) palladium (0) (51 mg) and barium hydroxide octahydrate (139 mg) were added and the reaction mixture was heated and stirred for 3 hours at 80 ° C under a nitrogen stream. Water was added to the obtained reaction mixture, and extraction was performed with ethyl acetate. The organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered and then the solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound (87 mg) was obtained as a slightly yellow amorphous solid from the n-hexane: ethyl acetate fraction (2: 1).

¹ H NMR (400 MHz, CDCl 3) δ 1.21 (t, J = 7.6 Hz, 3H), 1.54 (br s, 9H), 2.72 (q, J = 7.6 Hz, 2H), 3.47 (s, 3H), 3.69 (s, 6H), 4.51 (s, 2H), 5.82-5.90 (m, 1H), 6.58-6.65 (m, 1H), 6.65 (s, 2H), 7.08-7.14 (m, 1H), 7.32-7.38 (m, 1H).

[0084] Comparative Example 11

M-Cyclobutylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

To a solution of t-butyl N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-ylcarbamate (43 mg) dissolved in N, N -dimethylformamide (1 ml) was added sodium hydride (60% in oil; 6 mg) and (bromomethyl) cyclobutane (0.013 ml) and the mixture was stirred for 1 hour at room temperature. Water was added to the resulting reaction mixture, which was then extracted with ethyl acetate and washed with brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure to obtain the crude product N-cyclobutylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a t-butyl] pyridin-3-yl-carbamate.

The obtained crude product of t-butyl N-cyclobutylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-ylcarbamate was dissolved in ethyl acetate (1 ml) without further purification and then 4N hydrochloric acid (ethyl acetate solution; 2 ml) was added and the mixture was stirred for 1 h at 40 ° C. After the obtained reaction mixture was neutralized with 5N aqueous sodium hydroxide solution while cooling with ice, extraction was performed with ethyl acetate and the organic extract was washed with brine. It was then dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure to obtain the crude product N-cyclobutylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a ] pyridin-3-ylamine.

Tetrahydropyran-4-carbaldehyde (33 mg) and sodium triacetoxyborohydride (62 mg) were added to a solution of the obtained residue dissolved in tetrahydrofuran (1 mL) without further purification, and the mixture was stirred for 1 hour at room temperature. A saturated sodium bicarbonate solution was added to the resulting reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine. It was then dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound (24 mg) was obtained as a yellow oil from the n-hexane: ethyl acetate (5: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.21 (t, J = 7.6 Hz, 3H), 1.22-1.30 (m, 2H), 1.55-1.62 (m, 3H), 1.71-1.80 (m, 4H), 1.81 -1.93 (m, 2k), 2.28-2.36 (m, 1H), 2.72 (q, J = 7.6 Hz, 2H), 2.93 (d, J = 6.8 Hz, 2H), 3.04 (d, J = 7.2 Hz, 2H), 3.27-3.35 (m, 2H), 3.48 (s, 3H), 3.72 (s, 6H), 3.91-3.96 (m, 2H), 4.52 (s, 2H), 6.59 (br d, J = 6.8 Hz, 1H), 6.67 (s, 2H), 7.01 (dd, J = 6.8, 8.8 Hz, 1H), 7.40 (br d, J = 8.8 Hz, 1H).

[0085] As in Example 11, compounds of Example 12 to 14 were synthesized.

[0086] Comparative example 12

M-Butyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-Mtetrahydro-2H-4-pyranylmethylamine

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ 0.86 (t, J = 6.8 Hz, 3H), 1.22 (t, J = 7.6 Hz, 3H), 1.24-1.40 (m, 6H),

1.50-1.60 (m, 1H), 1.70-1.78 (m, 2H), 2.73 (q, J = 7.6 Hz, 2H), 2.96 (d, J = 7.2 Hz, 2H), 3.01 (t, J = 7.2 Hz , 2H), 3.26-3.35 (m, 2H), 3.49 (s, 3H), 3.73 (s, 6H), 3.90-3.97 (m, 2H), 4.53 (s, 2H), 6.60 (dd, J = 1.2 ,

6.8 Hz, 1H), 6.68 (s, 2H), 7.01 (dd, J = 6.8, 8.8 Hz, 1H), 7.42 (dd, J = 1.2, 8.8 Hz, 1H).

[0087] Comparative Example 13

M-7- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-propyl-M-tetrahydro-2H-4-pyranylmethylamine

Slightly yellow amorphous solid product ¹ H NMR (400 MHz, CDCl 3) δ 0.87 (t, J = 7.6 Hz, 3H), 1.20 (t, J = 7.2 Hz, 3H), 1.23-1.32 (m, 2H), 1.36- 1.45 (m, 2H), 1.52-1.62 (m, 1H), 1.72-1.78 (m, 2H), 2.73 (q, J = 7.2 Hz, 2H), 2.96-3.00 (m, 4H), 3.27-3.35 ( m, 2H), 3.49 (s, 3H), 3.73 (s, 6H), 3.90-3.97 (m, 2H), 4.53 (s, 2H), 6.60 (dd, J = 1.6, 6.8 Hz, 1H), 6.68 (s, 2H), 7.01 (dd, J = 6.8, 8.8 Hz, 1H), 7.42 (dd, J = 1.6, 8.8 Hz, 1H).

[0088] Comparative Example 14

M-7- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-isobutyl-M-tetrahydro-2H-4-pyranylmethylamine

PL 213 633 B1

Slightly yellow amorphous solid product ¹ H NMR (400 MHz, CDCl 3) δ 0.91 (d, J = 6.8 Hz, 6H), 1.20 (t, J = 7.6 Hz, 3H), 1.22-1.31 (m, 2H),

1.50-1.62 (m, 2H), 1.72-1.80 (m, 2H), 2.74 (q, J = 7.6 Hz, 2H), 2.82 (d, J = 7.2 Hz, 2H), 2.91 (d, J = 6.8 Hz , 2H), 3.26-3.34 (m, 2H), 3.47 (s, 3H), 3.72 (s, 6H), 3.90-3.96 (m, 2H), 4.52 (s, 2H), 6.58 (dd, J = 1.6 ,

6.8 Hz, 1H), 6.66 (s, 2H), 7.00 (dd, J = 6.8, 8.8 Hz, 1H), 7.43 (dd, J = 1.6, 8.8 Hz, 1H).

[0089] Comparative Example 15

7- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-amine

For a suspension of 7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethyl-3-nitropyrazolo [1,5-a] pyridine (0.7 g) in a mixed solvent of ethanol (35 ml), water (18 ml) and acetic acid (3.5 ml) zinc powder (0.7 g) was added at room temperature and the reaction mixture was heated and stirred for 30 minutes at 60 ° C. The reaction mixture was filtered through celite to remove undissolved residue, water was added to the filtrate, and extraction was performed with ethyl acetate. The obtained organic extract was washed with brine, a saturated sodium bicarbonate solution and then brine, and dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (0.48 g) was obtained as a yellow oil from the n-hexane-ethyl acetate (4: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.23 (t, J = 7.6 Hz, 3H), 2.60-2.98 (m, 2H), 3.47 (s, 3H), 3.70 (s, 6H), 4.51 (s, 2H ), 6.40-6.60 (m, 1H), 6.65 (s, 2H), 6.90-7.08 (m, 1H), 7.24-7.38 (m, 1H). MS (ESI) m / z 342 MH ⁺

[0090] Comparative example 16

Tert-butyl M-7- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazole [1,5-a] pyridin-3-ylcarbamate

Triethylamine (0.3 ml) was added to a solution of 7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-amine (0.48 g) dissolved in dichloromethane (4.8 ml). ) and di-tert-butyl dicarbonate (0.39 ml) at room temperature and the reaction mixture was stirred overnight at room temperature. Water was added to the obtained reaction mixture, and extraction was performed with ethyl acetate. The organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (0.54 g) was obtained as white crystals from the n-hexane: ethyl acetate (1: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.21 (t, J = 7.6 Hz, 3H), 1.54 (br s, 9H), 2.72 (q, J = 7.6 Hz, 2H), 3.47 (s, 3H), 3.69 (s, 6H), 4.51 (s, 2H), 5.86 (br s, 1H), 6.61 (d, J = 6.8 Hz, 1H), 6.65 (s, 2H), 7.10 (dd, J = 6.8, 8.8 Hz , 1H). 7.35 (d, J = 8.8 Hz, 1H).

[0091] Comparative Example 17

M-7- [4- (1- [1- (tert-Butyl) -1,1-dimethylsilyl] oxyethyl) -2,6-dimethoxyphenyl] -2-ethylpyrazolo [1,5-a] pyridin-4-yl- M-cyclopropylmethyl-M-tetrahydro-PH1 -pyranylmethylamine

To a solution of N- (7-bromo-2-methoxypyrazolo [1,5-a] pyridin-3-yl) -N-cyclopropylmethylamine (70 mg) dissolved in 1,2-dimethoxyethane (4 ml) and water (2 ml) 4- [1- [1- (tert-butyl) 1,1-dimethylsilyl] oxyethyl] -2,6-dimethoxyphenylboronic acid (92 mg), tetrakis (triphenylphosphine) palladium (0) (31 mg) and barium hydroxide octahydrate were added (85 mg) and the mixture was heated and stirred for 1 h at 80 ° C under a nitrogen stream. Ethyl acetate was added to the reaction mixture, and after the insoluble residue was filtered off, extraction was performed with ethyl acetate and the organic extract was washed with brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound (112 mg) was obtained as a yellow oil from the n-hexane: ethyl acetate (4: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ -0.07-0.03 (m, 2H), 0.07 (s, 3H), 0.12 (s, 3H), 0.32-0.38 (m, 2H), 0.79-0.88 (m, 1H) ), 0.96 (s, 9H), 1.21-1.33 (m, 2H), 1.26 (t, J = 7.2 Hz, 3H), 1.49 (d, J = 6.4 Hz, 3H),

1.51-1.63 (m, 1H), 1.70-1.80 (m, 2H), 2.77 (q, J = 7.2 Hz, 2H), 2.84-2.91 (m, 2H), 3.00-3.07 (m, 2H), 3.25- 3.35 (m, 2H), 3.70 (s, 6H), 3.89-3.97 (m, 2H), 4.92 (q, J = 6.4 Hz, 1H), 6.61 (dd, J = 1.3, 6.8 Hz, 1H), 6.67 (s, 1H), 6.68 (s, 1H), 7.00 (dd, J = 6.8, 8.8 Hz, 1H), 7.43 (dd, J = 1.3, 8.8 Hz, 1H).

Comparative Example 18

1- (4-3 - [(Cyclopropylmethyl) (tetrahydro-2H-4-pyranylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyrrole

For a solution of N- [7- [4- [1- [1- (tert-butyl) -1,1-dimethylsilyl] oxyethyl] -2,6-dimethoxyphenyl] -2-ethylpyrazolo [1,5-a] pyridin- 3-yl] -N-cyclopropylmethyl-N-tetrahydro-2H-4-pyranylmethylamine (112 mg) dissolved in tetrahydrofuran (1 ml) was added tetrabutyolammonium fluoride (1M tetrahydrofuran

Solution; 0.27 ml) at room temperature and the reaction mixture was stirred for 3 hours at the same temperature. After adding saturated ammonium chloride aqueous solution to the obtained reaction mixture, extraction was performed with ethyl acetate, the organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (66 mg) was obtained as a slightly yellow amorphous solid from the n-hexane: ethyl acetate (1: 2) fraction.

¹ H NMR (400 MHz, CDCl 3) δ -0.04-0.12 (m, 2H), 0.32-0.38 (m, 2H), 0.78-0.88 (m, 1H), 1.21 (t, J = 7.5 Hz, 3H), 1.21-1.33 (m, 2H), 1.50-1.65 (m, 4H), 1.70-1.80 (m, 2H), 2.76 (q, J = 7.5 Hz, 2H), 2.84-2.91 (m, 2H), 3.01- 3.08 (m, 2H), 3.26-3.37 (m, 2H), 3.73 (s, 6H), 3.88-3.98 (m, 2H), 4.91-4.99 (m, 1H), 6.59 (dd, J = 1.3, 6.8 Hz, 1H), 6.70 (s, 1H), 6.74 (s, 1H), 7.01 (dd, J = 6.8, 8.8 Hz, 1H), 7.45 (dd, J = 1.3,

8.8 Hz, 1H).

Comparative Example 19

4-3 - [(Cyclopropylmethyl) (tetrahydro-2H-4-pyranylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxybenzaldehyde

To a solution of (4-3 - [(cyclopropylmethyl) (tetrahydro-2H-4-pyanylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxyphenyl) methanol (50 mg ) in acetone (2 ml), activated manganese (IV) oxide (250 mg) was added at room temperature and the reaction mixture was stirred for 12 hours. Manganese oxide was filtered off from the reaction mixture and the filtrate was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (41 mg) was obtained as a yellow solid of the yellow ethyl acetate: n-hexane (1: 2) fraction.

¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.01 (m, 2H), 0.30-0.40 (m, 2H), 0.80-0.88 (m, 1H), 1.18-1.32 (m, 5H), 1.54-1.62 (m, 1H), 1.72-1.80 (m, 2H), 2.75 (q, J = 7.6 Hz, 2H), 2.88 (d, J = 6.8 Hz, 2H), 3.05 (d, J = 6.8 Hz, 2H) , 3.25-3.34 (m, 2H), 3.79 (s, 6H), 3.93-3.98 (m, 2H), 6.61 (dd, J = 1.2, 6.8 Hz, 1H), 7.03 (dd, J = 6.8, 8.8 Hz , 1H), 7.21 (s, 2H), 7.49 (dd, J = 1.2, 8.8 Hz, 1H), 10.02 (s, 1H).

[0094] Comparative example

M-Butyl-M-7- [4- (ethoxymethyl) -2,6-dimethoxyphenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

N- (7-Bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -N-butylo-N-tetrahydro-2H-4-pyranylmethylamine (150 mg) and 4- (hydroxymethyl) -2 , 6-dimethoxyphenylboronic acid (250 mg) was reacted in the same manner as in Example 1 to give (4-3- [butyl (tetrahydro-2H-4-pyranylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin- 7-yl-3,5-dimethoxyphenyl) methanol (189 mg) as yellow oil.

To a solution of the obtained (4-3- [butyl (tetrahydro-2H-4-pyranylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxyphenyl) methanol (189 mg) in Sodium hydride (60% oil; 24 mg) was added to N, N-dimethylformamide (15 ml) at room temperature and the reaction mixture was stirred for 30 minutes. Then, iodoethane (0.047 ml) was added to the resulting mixture, and the mixture was stirred for 1 h at 60 ° C. After completion of the reaction, ice was added to the reaction mixture while cooling with ice, extraction was performed with ethyl acetate, and the organic extract was washed with brine and dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by chromatography on a silica gel column (10 g) and the title compound (111 mg) was obtained as yellow crystals from the ethyl acetate: n-hexane (1: 2) fraction.

¹ H NMR (400 MHz, CDCl3) δ 0.86 (t, J = 7.0 Hz, 3H), 1.20 (t, J = 7.5 Hz, 3H), 1.31 (t, J = 7.0 Hz, 3H), 1.17-1.42 ( m, 6H), 1.50-1.64 (m, 1H), 1.70-1.79 (m, 2H), 2.73 (q, J = 7.5 Hz, 2H), 2.96 (d, J = 7.0 Hz, 2H), 3.01 (t , J = 7.0 Hz, 2H), 3.33 (dt, J = 1.6, 12.0 Hz, 2H), 3.64 (q, J = 7.0 Hz, 2H), 3.72 (s, 6H), 3.90-4.00 (m, 2H) , 4.57 (s, 2H), 6.59 (dd, J = 1.1, 6.8 Hz, 1H), 6.69 (s, 2H), 7.01 (dd, J = 6.9, 8.9 Hz, 1H), 7.42 (dd, J = 1.3 , 8.8 Hz, 1H).

[0095] As in Example 20, Compounds of Example 21 to 27 were synthesized.

[0096] Comparative Example 21

M-Cyclopropylmethyl-M- (7-2,6-dimethoxy-4 - [(2-piperidineethoxy) methyl] phenyl-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -N-tetrahydro-2H- 4-pyranylmethylamine

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.05-0.02 (m, 2H), 0.32-0.38 (m, 2H), 0.80-0.88 (m, 1H), 1.18-1.32 (m, 5H), 1.40 -1.48 (m, 2H), 1.52-1.68 (m, 5H), 1.70-1.78 (m, 2H), 2.40-2.55 (m, 4H), 2.64 (t, J = 6.0 Hz, 2H), 2.76 (q , J = 7.2 Hz, 2H), 2.87 (d, J = 6.8 Hz, 2H), 3.04 (d, J = 6.8 Hz, 2H), 3.31 (t, J = 11.2 Hz, 2H), 3.68 (t , J = 6.4 Hz, 2H), 3.71 (s, 6H), 3.90-3.97 (m, 2H), 4.59 (s, 2H), 6.58 (dd, J = 0.8, 6.8 Hz, 1H), 6.68 (s, 2H), 7.00 (dd, J = 6.8, 8.4 Hz, 1H), 7.44 (br d, J = 8.8 Hz, 1H).

[0097] Comparative Example 22

M-Cyclopropylmethyl-M- (7-2,6-dimethoxy-4 - [(2-methoxyethoxy) methyl] phenyl-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -M-fephrahydro 2H-4-pyraniumIomethylamine

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.01 (m, 2H), 0.30-0.38 (m, 2H), 0.80-0.90 (m, 1H), 1.191.30 (m, 5H), 1.50 -1.62 (m, 1H), 1.72-1.80 (m, 2H), 2.75 (q, J = 7.6 Hz, 2H), 2.87 (d, J = 6.8 Hz, 2H), 3.04 (d, J = 6.8 Hz, 2H), 3.25-3.35 (m, 2Η), 3.43 (s, 3H), 3.62-3.65 (m, 2Η), 3.71-3.73 (m, 8Η), 3.903.98 (m, 2Η), 4.64 (s, 2Η), 6.57 (dd, J = 1.6, 6.8 Hz, 1Η), 6.70 (s, 2Η), 7.00 (dd, J = 6.8, 9.2 Hz, 1Η), 7.44 (dd, J = 1.2, 8.8 Hz, 1Η ).

Comparative Example 23

M-7- [4- (Ethoxymethyl) -2,6-dimethoxyphenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-propyl-M-tetrahydro-2H-4-pyranylmethylamine

PL 213 633 B1

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ 0.87 (t, J = 7.4 Hz, 3H), 1.20 (t, J = 7.5 Hz, 3H), 1.31 (t, J = 7.0 Hz, 3H), 1.18- 1.33 (m, 2H), 1.34-1.47 (m, 2H), 1.50-1.65 (m, 1H), 1.70-1.80 (m, 2H), 2.74 (q, J = 7.5 Hz, 2H), 2.96 (d, J = 7.1 Hz, 2H), 2.93-3.02 (m, 2H), 3.31 (dt, J = 1.8, 12.0 Hz, 2H), 3.64 (q, J = 7.0 Hz, 2H), 3.72 (s, 6H), 3.90-4.98 (m, 2H), 4.57 (s, 2H), 6.59 (dd, J = 1.4, 7.0 Hz, 1H), 6.69 (s, 2H), 7.01 (dd, J = 7.0, 8.8 Hz, 1H) , 7.42 (dd, J = 1.3, 8.8 Hz, 1H).

Comparative Example 24

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (2-methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pl · ridin-3-yl-M-tetrahydro-2H-4 -pyranylmethylamine

Slightly green oil ¹ H NMR (400 MHz, CDCl3) δ -0.04-0.02 (m, 2H), 0.32-0.38 (m, 2Η), 0.78-0.88 (m, 1Η), 1.21 (t, J = 7.6 Hz, 3H), 1.22-1.32 (m, 2H), 1.52-1.65 (m, 1Η), 1.70-1.80 (m, 2H), 2.75 (q, J = 7.6 Hz, 2H), 2.87 (d, J = 6.8 Hz , 2H), 2.94 (t, J = 6.8 Hz, 2H), 3.03 (d, J = 6.8 Hz, 2H), 3.26-3.34 (m, 2Η), 3.41 (s, 3Η), 3.68 (s, 6Η) 3.66-3.78 (m, 2Η), 3.90-3.96 (m, 2Η), 6.55 (s, 2Η), 6.58 (dd, J = 1.2, 6.8 Hz, 1H), 6.99 (dd, J = 6.8, 8.8 Hz , 1H), 7.42 (dd, J = 1.2, 8.8 Hz, 1H).

[0100] Comparative example

M-Cyclopropylmethyl-M- (7-2,6-dimethoxy-4 - [(2-morpholinoethoxy) methyl] phenyl-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -M-tetrahydro-2H- 4-pyranylmethylamine

yellow crystals

PL 213 633 B1 ¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.01 (m, 2H), 0.33-0.36 (m, 2H), 0.80-0.84 (m, 1H), 1.19-1.28 (m, 5H) , 1.50-1.60 (m, 1H), 1.70-1.80 (m, 2H), 2.52-2.58 (m, 4H), 2.67 (t, J = 5.6 Hz, 2H), 2.75 (q, J = 7.6 Hz, 2H ), 2.87 (d, J = 6.8 Hz, 2H), 3.04 (d, J = 7.2 Hz, 2H), 3.30 (dt, J = 2.0, 12.0 Hz, 2H), 3.68 (t, J = 5.6 Hz, 2H ), 3.71 (s, 6H), 3.75 (t, J = 4.8 Hz, 4H), 3.91-3.95 (m, 2H), 4.60 (s, 2H), 6.58 (dd, J = 1.6, 6.8 Hz, 1H) , 6.67 (s, 2H), 7.00 (dd, J = 6.8, 8.8 Hz, 1H), 7.44 (dd, J = 1.6, 8.8 Hz, 1H).

Comparative example 26

M-Cyclopropylmethyl-M- (7-2,6-dimethoxy-4- [3- (2-morpholinoethoxy) propyl] phenyl-2-ethylpyrazole-

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.03-0.01 (m, 2H), 0.33-0.37 (m, 2H), 0.78-0.88 (m, 1H), 1.17-1.35 (m, 5H), 1.50 -1.60 (m, 1H), 1.70-1.78 (m, 2H), 1.95-2.02 (m, 2H), 2.45-2.58 (m, 6H), 2.63 (t, J = 6.0 Hz, 2H), 2.72-2.79 (m, 4H), 2.87 (d, J = 6.8 Hz, 2H), 3.04 (d, J = 6.8 Hz, 2H), 3.30 (dt, J = 2.0, 12.0 Hz, 2H), 3.54 (t, J = 6.4 Hz, 2H), 3.62 (t, J = 6.0 Hz, 2H), 3.69-3.75 (m, 8H), 3.92-3.95 (m, 2H), 6.52 (s, 2H), 6.59 (dd, J = 1.2 , 6.4 Hz, 1H), 7.00 (d, J = 6.8, 8.8 Hz, 1H), 7.43 (dd, J = 1.6, 7.8 Hz, 1H).

[0102] Comparative example 27

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (3-methoxypropyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.03-0.01 (m, 2H), 0.33-0.37 (m, 2H), 0.81-0.85 (m, 1H), 1.19-1.31 (m, 5H), 1.50 -1.60 (m, 1H), 1.72-1.80 (m, 2H), 1.94-2.01 (m, 2H), 2.73-2.79 (m, 4H), 2.87 (d, J = 6.4 Hz, 2H), 3.04 (d , J = 6.8 Hz, 2H), 3.30 (dt, J = 2.0, 11.6 Hz, 2H), 3.33 (s, 3H), 3.48 (t, J = 6.4 Hz, 2H), 3.70 (s, 6H), 3.92 -3.95 (m, 2H), 6.53 (s, 2H), 6.59 (dd, J = 1.2, 6.8 Hz, 1H), 7.00 (dd, J = 6.4, 8.8 Hz, 1H), 7.43 (dd, J = 1.2 , 8.4 Hz, 1H).

[0103] Comparative Example 28

-M-7- [4- (Chloromethyl) -2,6-dimethoxyphenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-cyclopropylmethyl-M-tetrahydro-2H-4-pyranylmethylamine

PL 213 633 B1, Ο

, OMe

Cl

To a solution of (4-3 - [(cyclopropylmethyl) (tetrahydro-2H-4-pyanylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxyphenyl) methanol (122 mg) in dichloromethane (5 ml), triethylamine (0.076 ml), methanesulfonyl chloride (0.023 ml) and 4- (dimethylamino) pyridine (0.5 mg) were added at room temperature and the reaction mixture was stirred for 2 hours. After completion of the reaction, water was added to the reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine and dried over anhydrous magnesium sulfate, then the solvent was evaporated under reduced pressure. The residue was purified by chromatography on a silica gel column (15 g) and the title compound (45 mg) was obtained as a yellow amorphous solid from the ethyl acetate: n-hexane (1: 2) fraction.

¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.04 (m, 2H), 0.33-0.41 (m, 2H), 0.79-0.92 (m, 1H), 1.23 (t, J = 7.6 Hz, 3H), 1.20-1.36 (m, 2H), 1.53-1.67 (m, 1H), 1.72-1.82 (m, 2H), 2.77 (q, J = 7.6 Hz, 2H), 2.89 (d, J = 6.8 Hz, 2H) , 3.06 (d, J = 7.0 Hz, 2H), 3.32 (dt, J = 2.0, 12.0 Hz, 2H), 3.75 (s, 6H), 3.90-4.00 (m, 2H), 4.66 (s, 2H), 6.60 (dd, J = 1.4, 6.8 Hz, 1H), 6.74 (s, 2H), 7.02 (dd, J = 6.8, 8.8 Hz, 1H), 7.47 (dd, J = 1.5, 8.8 Hz, 1H).

[0104] Comparative Example 29

M-Cyclopropylmethyl-M-2-ethyl-7- [4- (isopropoxymethyl) -2,6-dimethoxyphenyl] pyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranI-methylamine

-OMe

Sodium hydride (60% in oil; 4.3 mg) was added to a solution of 2-propanol (8 µL) in N, N-dimethylformamide (1.5 ml) at room temperature and the reaction mixture was stirred for 15 minutes. Solution of N-1- [4- (chloromethyl) -2,6-dimethoxyphenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N-cyclopropylmethyl-N-tetrahydro-2H-4-pyranylmethylamine (45 mg) in N, N-dimethylformamide (3.5 ml) and sodium iodide (0.5 mg) were added to the obtained reaction mixture, and then the reaction mixture was stirred for 20 minutes at 40 ° C and further stirred for 20 minutes at 80 ° C. Ice was added to the obtained reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine and dried over anhydrous magnesium sulfate, then the solvent was evaporated under reduced pressure. The residue was purified by chromatography on a silica gel column (10 g) and the title compound (9 mg) was obtained as a yellow oil from the ethyl acetate: n-hexane (1: 2) fraction.

¹ H NMR (400 MHz, CDCl 3) δ -0.03-0.04 (m, 2H), 0.32-0.41 (m, 2H), 0.79-0.92 (m, 1H), 1.22 (t, J = 7.6 Hz, 3H), 1.29 (d, J = 6.0 Hz, 6H), 1.20-1.36 (m, 2H), 1.53-1.67 (m, 1H), 1.72-1.82 (m, 2H), 2.77 (q, J = 7.5 Hz, 2H) , 2.89 (d, J = 6.6 Hz, 2H), 3.06 (d, J = 7.0 Hz, 2H), 3.32 (dt, J = 2.0, 12.0 Hz, 2H), 3.73 (s, 6H), 3.70-3.84 ( m, 1H), 3.90-4.00 (m, 2H), 4.59 (s, 2H), 6.59 (dd, J = 1.3, 6.8 Hz, 1H), 6.70 (s, 2H), 7.01 (dd, J = 6.8, 8.8 Hz, 1H), 7.45 (dd, J = 1.5, 8.8 Hz, 1H).

PL 213 633 B1

[0105] Comparative example

3- (4-3 - [(Cyclopropylmethyl) (tetrahydro-2H-4-pyranylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxyphenyl) propylmethanesulfonate

To a solution of 3- (4-3 - [(cyclopropylmethyl) (tetrahydro-2H-4-pyranylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxyphenyl) -1- propanol (190 mg) in dichloromethane (20 ml), triethylamine (0.062 ml), methanesulfonyl chloride (51 mg) and 4- (dimethylamino) pyridine (0.5 mg) were added at room temperature and the reaction mixture was stirred for 2 hours. After completion of the reaction, water was added to the reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine and dried over anhydrous magnesium sulfate, then the solvent was evaporated under reduced pressure. The residue was purified by chromatography on a silica gel column (15 g) and the title compound (179 mg) was obtained as a yellow oil from the ethyl acetate: n-hexane (1: 2) fraction.

¹ H NMR (400 MHz, CDCl 3) δ -0.03-0.01 (m, 2H), 0.33-0.37 (m, 2H), 0.81-0.85 (m, 1H), 1.19-1.35 (m, 5H), 1.50-1.57 (m, 1H), 1.72-1.77 (m, 2H), 1.85-2.00 (m, 2H), 2.70-2.90 (m, 6H), 3.04-3.10 (m, 5H), 3.25-3.35 (m, 2H) , 3.70 (s, 6H), 4.33 (t, J = 6.4 Hz, 2H), 3.91-3.99 (m, 2H), 6.53 (s, 2H), 6.59-6.62 (m, 1H), 6.95-7.05 (m , 1H), 7.43-7.48 (m, 1H).

[0106] Comparative Example 31

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (3-morpholinopropyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

To a solution of 3- (4-3 - [(cyclopropylmethyl) (tetrahydro-2H-4-pyanylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxyphenyl) propylmethanesulfonate (50 mg) in dichloromethane (10 ml), morpholine (60 mg) was added at room temperature and the reaction mixture was stirred for 12 hours at the same temperature. After completion of the reaction, water was added to the reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine and dried over anhydrous magnesium sulfate, then the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (10 g) and the title compound (16 mg) was obtained as a yellow oil from the ethyl acetate fraction.

¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.02 (m, 2H), 0.35-0.40 (m, 2H), 0.80-0.90 (m, 1H), 1.20-1.35 (m, 5H), 1.55-1.60 (m, 1H), 1.73-1.80 (m, 2H), 1.90-1.98 (m, 2H), 2.45-1.52 (m, 6H), 2.70-2.81 (m, 4H), 2.89 (d, J = 7.2 Hz , 2H), 3.06 (d, J = 7.2 Hz, 2H), 3.32 (br t, J = 9.6 Hz, 2H), 3.70-3.79 (m, 10H), 3.93-3.97 (m, 2H), 6.54 (s , 2H), 6.61 (dd, J = 0.8, 6.8 Hz, 1H), 7.06 (dd, J = 6.8, 8.8 Hz, 1H), 7.45 (dd, J = 1.2, 8.8 Hz, 1H).

PL 213 633 B1

[0107] Comparative Example 32

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (morpholinomethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

To a solution of 4-3 - [(cyclopropylmethyl) (tetrahydro-2H-4-pyranylmethyl) amino] -2-ethylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxybenzaldehyde (15 mg) in acetic acid (0.5 ml) and tetrahydrofuran (0.5 ml), morpholine (3.2 mg) was added with stirring at room temperature, and then sodium triacetoxyborohydride (8 mg) was added and the reaction mixture was stirred for 2 hours. Water was added to the obtained reaction mixture, and extraction was performed with ethyl acetate. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography and the title compound (8.5 mg) was obtained as a yellow oil from the ethyl acetate: n-hexane (2: 1) fraction.

¹ H NMR (400 MHz, CDCl3) δ -0.04-0.01 (m, 2H), 0.32-0.38 (m, 2H), 0.78-0.88 (m, 1H), 1.18-1.32 (m, 5H), 1.50-1.62 (m, 1H), 1.72-1.78 (m, 2H), 2.48-2.58 (m, 4H), 2.76 (q, J = 8.0 Hz, 2H), 2.87 (d, J = 6.8 Hz, 2H), 3.04 ( d, J = 7.2 Hz, 2H), 3.26-3.34 (m, 2H), 3.54 (s, 2H), 3.71 (s, 6H), 3.75-3.78 (m, 4H),

3.91-3.95 (m, 2H), 6.59 (br d, J = 6.8 Hz, 1H), 6.69 (s, 2H), 7.00 (dd, J = 6.8, 8.8 Hz, 1H), 7.44 (br d, J = 8.8 Hz, 1H).

[0108] As in Example 32, compounds of Examples 33 and 34 were synthesized.

[0109] Comparative Example 33

M3-Cyclopropylmethyl-M3-tetrahydro-2H-4-pyanylmethyl-7-4 - [(dimethylamino) methyl] -2,6-dl · methoxyphenyl-2-ethylpyrazolo [1,5-a] pyridin-3-amine

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.03-0.01 (m, 2H), 0.32-0.37 (m, 2H), 0.78-0.90 (m, 1H), 1.18-1.32 (m, 5H), 1.50 -1.62 (m, 1H), 1.70-1.78 (m, 2H), 2.34 (br s, 6H), 2.76 (q, J = 7.6 Hz, 2H), 2.87 (d, J = 6.8 Hz, 2H), 3.04 (d, J = 6.8 Hz, 2H), 3.25-3.35 (m, 2H), 3.45-3.52 (m, 2H), 3.71 (s, 6H), 3.90-3.95 (m, 2H), 6.60 (dd, J = 1.2, 6.8 Hz, 1H), 6.67 (s, 2H), 7.00 (dd, J = 7.2, 8.4 Hz, 1H), 7.44 (dd, J = 1.2, 8.8 Hz, 1H).

[0110] Comparative Example 34

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (tetrahydro-1H-1-pyrrolylmethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H -4-pyranylmethylamine

PL 213 633 B1

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.00 (m, 2H), 0.30-0.40 (m, 2H), 0.80-0.88 (m, 1H), 1.19-1.32 (m, 5H), 1.50 -1.64 (m, 1H), 1.72-1.78 (m, 2H), 1.80-1.90 (m, 4H), 2.56-2.68 (m, 4H), 2.76 (q, J = 7.6 Hz, 2H), 2.87 (d , J = 6.8 Hz, 2H), 3.04 (d, J = 6.8 Hz, 2H), 3.26-3.34 (m, 2H), 3.67 (br s, 2H), 3.71 (s, 6H),

3.92-3.95 (m, 2H), 6.59 (dd, J = 0.8, 6.8 Hz, 1H), 6.69 (s, 2H), 6.98-7.02 (m, 1H), 7.44 (br d, J = 8.8 Hz, 1H ).

[0111] Comparative Example 35

Tert-butyl M-7- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2-methylpyrazoyl [1,5-a] pyridin-3-ylcarbamate

To a solution of tert-butyl N- (7-bromo-2-methylpyrazolo [1,5-a] pyridin-3-yl) carbamate (300 mg) dissolved in a mixture of 1,2-dimethoxyethane (10 ml) and water (5 ml ) 2,6-dimethoxy-4-methoxymethylphenylboronic acid (353 mg), tetrakis- (triphenylphosphine) palladium (0) (159 mg) and barium hydroxide octahydrate (435 mg) were added and the reaction mixture was heated and stirred for 6 hours at 80 ° C. C under a stream of nitrogen. Water was added to the obtained reaction mixture, extraction was performed with ethyl acetate, the organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (176 mg) was obtained as a slightly brown oil from the n-hexane: ethyl acetate (1: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.54 (br s, 9H), 3.32 (s, 3H), 3.47 (s, 3H), 3.69 (s, 6H), 4.51 (s, 2H), 5.86-5.92 ( m, 1H), 6.56-6.61 (m, 1H), 6.65 (s, 2H), 7.11 (dd, J = 6.8, 8.8 Hz, 1H), 7.34 (dd, J = 1.2, 8.8 Hz, 1H).

[0112] Comparative Example 36

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methylpyrazolo [1,5-a] pyridin-3-ylamine

PL 213 633 B1

To a solution of t-butyl N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methylpyrazolo [1,5-a] pyridin-3-ylcarbamate (175 mg) dissolved in N, N -dimethylformamide (4 ml) was added sodium hydride (60% in oil; 25 mg) and (bromomethyl) -cyclopropane (0.047 ml) and the reaction mixture was stirred for 1 h at 40 ° C. Water was added to the resulting reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure to obtain the crude product N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (detoxymethyl) phenyl] -2-methylpyrazolo [1.5 t-butyl-a] pyridin-3-yl carbamate.

The obtained crude product of tert-butyl N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methylpyrazole- [1,5-a] pyridin-3-ylcarbamate was dissolved in ethyl acetate (5 ml) without purification, 4N hydrochloric acid (ethyl acetate solution; 10 ml) was added at room temperature and the reaction mixture was stirred for 1 h at 40 ° C. After neutralizing the reaction mixture with 5N aqueous sodium hydroxide solution while cooling with ice, extraction was performed with ethyl acetate, the organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound ( 100 mg) was obtained as a yellow oil from the n-hexane: ethyl acetate (1: 2) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 0.15-0.20 (m, 2H), 0.48-0.54 (m, 2H), 1.02-1.10 (m, 1H), 2.35 (s, 3H), 2.88 (d, J = 6.8 Hz, 2H), 3.47 (s, 3H), 3.70 (s, 6H), 4.51 (s, 2H), 6.63 (dd, J = 1.2, 6.8 Hz, 1H), 6.65 (s, 2H), 6.99 ( dd, J = 6.8, 8.8 Hz, 1H), 7.36-7.40 (m, 1H).

[0113] Comparative Example 37

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

To a solution of N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methylpyrazolo [1,5-a] pyridin-3-ylamine (60 mg) dissolved in tetrahydrofuran ( 3 mL), tetrahydropyran-4-carbaldehyde (36 mg) and sodium triacetoxyborohydride (67 mg) were added, and the reaction mixture was stirred for 1 hour at room temperature. Water was added to the obtained reaction mixture, followed by a saturated sodium bicarbonate solution, extraction was performed with ethyl acetate, the organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography, and the crystals obtained from the n-hexane: ethyl acetate (1: 1) fraction were filtered, washed with n-hexane and then dried to give the title compound (63 mg) as slightly yellow crystals.

¹ H NMR (400 MHz, CDCl 3) δ -0.05-0.02 (m, 2H), 0.31-0.36 (m, 2H), 0.78-0.88 (m, 1H), 1.20-1.32 (m, 2H), 1.54-1.64 (m, 1H), 1.72-1.78 (m, 2H), 2.34 (s, 3H), 2.85 (d, J = 7.2 Hz, 2H), 3.03 (d, J = 7.2 Hz,

PL 213 633 B1

2H), 3.26-3.34 (m, 2H), 3.47 (s, 3H), 3.71 (s, 6H), 3.90-3.96 (m, 2H), 4.51 (s, 2H), 6.53 (dd, J = 1.2, 6.8 Hz, 1H), 6.66 (s, 2H), 7.00 (dd, J = 6.8, 8.8 Hz, 1H), 7.42 (dd, J = 1.2, 8.8 Hz, 1H).

Comparative Example 38

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-3-furanylmethylamine

To a solution of N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methylpyrazolo [1,5-a] pyridin-3-ylamine (40 mg) dissolved in tetrahydrofuran ( 3 ml) tetrahydrofuran-3-carbaldehyde (50% aqueous solution; 0.064 ml), 3M aqueous sulfuric acid (0.105 ml) and sodium borohydride (8 mg) were added while cooling with ice and the reaction mixture was stirred for 1 hour. A saturated aqueous sodium bicarbonate solution was added to the resulting mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine. The obtained organic extract was dried with anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by chromatography on a silica gel column and the title compound (30 mg) was obtained as slightly yellow crystals from the n-hexane: ethyl acetate (1: 1) fraction. .

¹ H NMR (400 MHz, CDCl 3) δ -0.03-0.03 (m, 2H), 0.33-0.38 (m, 2H), 0.80-0.90 (m, 1H), 1.54-1.68 (m, 1H), 1.85-1.95 (m, 1H), 2.20-2.29 (m, 1H), 2.33 (s, 3H), 2.87-2.90 (m, 2H), 3.06 (dd, J = 8.8, 12.0 Hz, 1H), 3.22 (dd, J = 6.4, 12.0 Hz, 1H), 3.47 (s, 3H), 3.59-3.70 (m, 2H), 3.71 (s, 6H), 3.72-3.88 (m, 2H), 4.51 (s, 2H), 6.54 ( dd, J = 1.2, 6.8 Hz, 1H), 6.66 (s, 2H), 7.01 (dd, J = 6.8, 8.8 Hz, 1H), 7.41 (dd, J = 1.2, 8.8 Hz, 1H).

[0115] As in Example 20, the compounds of Examples 39 and 40 were prepared.

Comparative Example 39 (4-3 - [(Cyclopropylamino) (tetrahydro-2H-4-pyranylmethyl) amino] -2-methylpyrazolo [1,5-a] pyridin-7-yl-3,5-dimethoxyphenyl) methanol

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.04-0.06 (m, 2H), 0.34-0.42 (m, 2H), 0.80-0.94 (m, 1H), 1.23-1.38 (m, 2H), 1.54 -1.72 (m, 1H), 1.74-1.84 (m, 2H), 2.38 (s, 3H), 2.47 (br s, 1H), 2.89 (d, J = 6.8 Hz, 2H), 3.07 (d, J = 7.0 Hz, 2H), 3.34 (dt, J = 2.0, 12.0 Hz, 2H), 3.74 (s, 6H), 3.90-4.02 (m, 2H), 4.71 (s, 2H), 6.57 (dd, J = 1.4 , 6.8 Hz, 1H), 6.71 (s, 2H), 7.05 (dd, J = 6.8, 8.8 Hz, 1H), 7.52-7.60 (m, 1H).

[0117] Comparative Example 40

M-Cyclopropylamine-M-7- [4- (ethoxymethyl) -2,6-dimethoxyphenyl] -2-methylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylamine

PL 213 633 B1

yellow oil ¹ H NMR (400 MHz, CDCl ₃ ) δ -0.03-0.05 (m, 2H), 0.32-0.42 (m, 2H), 0.80-0.94 (m, 1H), 1.34 (t, J = 7.2 Hz, 3H), 1.22-1.38 (m, 2H), 1.54-1.70 (m, 1H), 1.74-1.84 (m, 2H), 2.38 (s, 3H), 2.89 (d, J = 6.8 Hz, 2H), 3.07 (d, J = 7.2 Hz, 2H), 3.34 (dt, J = 1.6, 12.0 Hz, 2H), 3.66 (q, J = 7.2 Hz, 2H), 3.75 (s, 6H),

3.92-4.02 (m, 2H), 4.59 (s, 2H), 6.57 (dd, J = 1.4, 6.8 Hz, 1H), 6.72 (s, 2H), 7.04 (dd, J = 6.8, 8.8 Hz, 1H) , 7.45 (dd, J = 1.4, 8.8 Hz, 1H).

[0118] Comparative Example 41

Fetf-butyl M- [7- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] carbamate

To a solution of tert-butyl N- [7-bromo-2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] carbamate (300 mg) dissolved in 1,2-dimethoxyethane (10 ml) and water (5 ml) 2,6-dimethoxy-4-methoxymethylphenylboronic acid (323 mg), tetrakis (triphenylphosphine) palladium (0) (146 mg) and barium hydroxide octahydrate (398 mg) were added and the reaction mixture was heated and stirred for 2 hours in 80 ° C under a nitrogen stream. To the obtained reaction mixture, water was added and the reaction mixture was extracted with ethyl acetate, and the organic extract was washed with brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (245 mg) was obtained as a slightly yellow amorphous solid from the n-hexane: ethyl acetate (1: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.55 (br s, 9H), 3.32 (s, 3H), 3.76 (s, 3H), 3.68 (s, 6H), 4.51 (s, 2H), 4.62 (s, 2H), 6.37-6.46 (m, 1H), 6.65 (s, 2H), 7.13 (dd, J = 6.8, 8.8 Hz, 1H), 7.50-7.58 (m, 1H).

[0119] Comparative Example 42

M-Cyclopropylmethyl-M- [7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] amine

PL 213 633 B1

To a solution of tert-butyl N- [7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] carbamate (170 mg) dissolved in N, N-dimethylformamide (4 ml), sodium hydride (60% in oil; 22 mg) and (bromomethyl) cyclopropane (0.043 ml) were added and the reaction mixture was stirred for 30 minutes at 40 ° C. Water was added to the obtained reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine. The obtained organic extract was dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure to obtain the crude product N-cyclopropylmethyl-N- [7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methoxymethyl) pyrazole - Ye / Y-butyl [1,5-a] pyridin-3-yl] carbamate.

Obtained N-cyclopropylmethyl-N- [7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] carbamate Ye / Y- of butyl acetate was dissolved in ethyl acetate (5 ml) without purification and then 4N hydrochloric acid (ethyl acetate solution; 10 ml) was added and the reaction mixture was stirred for 30 minutes at 40 ° C. The reaction mixture was neutralized with 5N aqueous sodium hydroxide solution while cooling with ice, and then the reaction mixture was extracted with ethyl acetate and the organic extract was washed with water and brine. The organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound (95 mg) was obtained as a yellow oil from the n-hexane: ethyl acetate (2: 3) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 0.15-0.20 (m, 2H), 0.48-0.54 (m, 2H), 1.02-1.10 (m, 1H), 1.20-1.32 (m, 2H), 2.35 (s, 3H), 2.88 (d, J = 6.8 Hz, 2H), 3.47 (s, 3H), 3.70 (s, 6H), 4.51 (s, 2H), 6.63 (dd, J = 1.2,

6.8 Hz, 1H), 6.65 (s, 2H), 6.99 (dd, J = 6.8, 8.8Hz, 1H), 7.36-7.40 (m, 1H).

[0120] Comparative Example 43

M-Cyclopropylmethyl-M- [7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] -M-tetrahydro-2H- 4-pyranylmethylamine

To a solution of N-cyclopropylmethyl-N- [7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] amine (80 mg) dissolved in tetrahydrofuran (2 ml), tetrahydropyran-4-carbaldehyde (44 mg) and sodium triacetoxyborohydride (82 mg) were added, and the mixture was stirred for 30 minutes at room temperature. Water and a saturated aqueous sodium bicarbonate solution were added to the reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine. The organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound (63 mg) was obtained as a yellow oil from the n-hexane: ethyl acetate (1: 2) fraction.

¹ H NMR (400 MHz, CDCl3) δ -0.01-0.01 (m, 2H), 0.33-0.37 (m, 2H), 0.78-0.88 (m, 1H), 1.20-1.32 (m, 2H), 1.52-1.65 (m, 1H), 1.72-1.78 (m, 2H), 2.87 (d, J = 6.8 Hz, 2H), 3.05 (d, J = 6.8 Hz, 2H), 3.26-3.33 (m, 2H), 3.29 ( s, 3H), 3.48 (s, 3H), 3.70 (s, 6H), 3.89-3.95 (m, 2H), 4.51 (s, 2H), 4.56 (s, 2H), 6.63 (dd, J = 1.2, 6.8 Hz, 1H), 6.65 (s, 2H), 7.03 (dd, J = 6.8, 8.8 Hz, 1H), 7.51 (dd, J = 1.2,

8.8 Hz, 1H).

[0121] Comparative Example 44

M-Cyclopropylmethyl-M-r7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] -M-tetrahydro-3-furanylmethylamine

PL 213 633 B1

To a solution of N-cyclopropylmethyl-N- [7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] amine (15 mg ) dissolved in tetrahydrofuran (1 ml), tetrahydrofuran-3-carbaldehyde (50% aqueous solution; 0.022 ml), 3M aqueous sulfuric acid solution (0.036 ml) and sodium borohydride (2.8 mg) were added under ice cooling and the reaction mixture was stirred for 1 hour. at the same temperature. Water and a saturated aqueous sodium hydrogen carbonate solution were added to the obtained reaction mixture, extracted with ethyl acetate, the organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (4.8 mg) was obtained as slightly yellow crystals from the n-hexane: ethyl acetate (1: 2) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 0.00-0.06 (m, 2H), 0.32-0.40 (m, 2H), 0.80-0.90 (m, 1H), 1.55-1.68 (m, 1H), 1.86-1.95 ( m, 1H), 2.21-2.32 (m, 1H), 2.88-2.92 (m, 2H), 3.08 (dd, J = 8.8, 12.0 Hz, 1H), 3.23 (dd, J = 6.8, 12.0 Hz, 1H) , 3.30 (s, 3H), 3.48 (s, 3H), 3.60-3.68 (m, 2H), 3.69 (s, 6H), 3.72-3.84 (m, 2H), 4.51 (s, 2H), 4.55 (s , 2H), 6.54 (dd, J = 1.2, 6.8 Hz, 1H), 6.66 (s, 2H), 7.01 (dd, J = 6.8, 8.8 Hz, 1H), 7.41 (dd, J = 1.2, 8.8 Hz, 1H).

[0122] As in Example 20, the compounds of Examples 45 and 46 were prepared.

[0123] Comparative Example 45

4- [3 - [(Cyclopropylamino) (tetrahydro-2H-4-pyranylmethyl) amino] -2-methoxymethyl) pyrazolo [1,5-a] pyridin-7-yl] -3,5-dimethoxyphenylmethane

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.04-0.04 (m, 2H), 0.30-0.40 (m, 2H), 0.78-0.92 (m, 1H), 1.20-1.34 (m, 2H), 1.53 -1.70 1H), 1.71-1.80 (m, 2H), 2.20 (br s, 1H), 2.88 (d, J = 6.8 2H), 3.05 (d, J = 7.2 Hz, 2H), 3.29 (s, 3H) , 3.24-3.38 2H), 3.70 (s, 6H), 3.88-3.98 (m, 2H), 4.57 (s, 2H), 4.71 2H), 6.63 (dd, J = 1.4,

6.8 Hz, 1H), 6.68 (s, 2H), 7.05 J = 6.8, 8.8 Hz, 1H), 7.49-7.57 (m, 1H).

Comparative Example 46

M-Cyclopropylamino-M- [7- [4- (ethoxymethyl) -2,6-dimethoxyphenyl] -2- (methoxymethyl) pyrazolo [1,5-a] pyridin-3-yl] -M-tetrahydro-2H-4 -pyranylmethylamine

PL 213 633 B1

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.04-0.04 (m, 2H), 0.30-0.40 (m, 2H), 0.78-0.92 (m, 1H), 1.31 (t, J = 6.8 Hz, 3H ), 1.20-1.36 (m, 2H), 1.54-1.68 (m, 1H), 1.70-1.81 (m, 2H), 2.89 (d, J = 6.8 Hz, 2H), 3.06 (d, J = 6.8 Hz, 2H), 3.30 (s, 3H), 3.26-3.36 (m, 2H), 3.64 (q, J = 6.8 Hz, 2H), 3.71 (s, 6H), 3.89-3.98 (m, 2H), 4.56 (s , 2H), 4.57 (s, 2H), 6.64 (dd, J = 1.6, 6.8 Hz, 1H), 6.68 (s, 2H), 7.05 (dd, J = 6.8, 8.8 Hz, 1H), 7.52 (dd, J = 1.6, 8.8 Hz, 1H).

[0125] Comparative Example 47

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methoxypyrazolo [1,5-a] -

To a solution of N- (7-bromo-2-methoxypyrazolo [1,5-a] pyridin-3-yl) -N-cyclopropylmethyl-N-tetrahydro-2H-4-pyranylmethylamine (48 mg) dissolved in a 1,2- dimethoxyethane (2 ml) and water (1 ml) were added 2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid (36 mg), tetrakis (triphenylphosphine) palladium (0) (28 mg) and barium hydroxide octahydrate (58 mg ) and the reaction mixture was heated and stirred for 2 hours at 85 ° C. Water and ethyl acetate were added to the obtained reaction mixture, the reaction mixture was filtered through celite to remove undissolved residue, and then the filtrate was extracted with ethyl acetate. The obtained organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography and the title compound (40 mg) was obtained as slightly yellow crystals from the n-hexane: ethyl acetate (2: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.04 (m, 2H), 0.30-0.36 (m, 2H), 0.80-0.92 (m, 1H), 1.24-1.36 (m, 2H), 1.52-1.64 (m, 1H), 1.74-1.82 (m, 2H), 2.84 (d, J = 6.8 Hz, 2H), 2.97 (d, J = 6.8 Hz, 2H), 3.32 (td, J = 2.0, 11.6 Hz, 2H), 3.51 (s, 3H), 3.76 (s, 6H), 3.87 (s, 3H), 3.90-3.98 (m, 2H), 4.55 (s, 2H), 6.51 (dd, J = 1.6, 6.8 Hz , 1H), 6.69 (s, 2H), 7.04 (dd, J = 1.2, 8.8 Hz, 1H), 7.33 (dd, J = 1.6, 8.8 Hz, 1H).

[0126] As in Example 47, the compounds of Examples 48 to 51 were synthesized.

[0127] Comparative Example 48

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (1-methoxyethyl) phenyl] -2-methoxypyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

PL 213 633 B1 ρ

PMe

OMe

Slightly yellow crystals ¹ H NMR (400 MHz, CDCl3) δ -0.02-0.04 (m, 2H), 0.30-0.38 (m, 2H), 0.80-0.92 (m, 1H), 1.22-1.34 (m, 2H), 1.55 (d, J = 1.6 Hz, 3H), 1.56-1.68 (m, 1H), 1.72-1.82 (m, 2H), 2.84 (d, J = 6.8 Hz, 2H), 2.97 (d, J = 7.2 Hz , 2H), 3.26-3.34 (m, 2H), 3.37 (s, 3H), 3.77 (s, 6H), 3.89 (s, 3H), 3.90-3.98 (m, 2H), 4.37 (q, J = 6.4 Hz, 1H), 6.53 (dd, J = 1.2, 7.2 Hz, 1H), 6.66 (d, J = 3.2 Hz, 2H), 7.04 (dd, J = 7.2, 8.8 Hz, 1H), 7.33 (dd, J = 1.6, 8.8 Hz, 1H).

Comparative Example 49 (4-3 - [(Cyclopropylmethyl) (tetrahydro-2H-4-pyranylmethyl) amino] -2-methoxypyrazolo [1,5-a] pyridine-7-yl-3,5-dimethoxyphenyl) methanol .OMe

ΌΗ yellow amorphous solid product ¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.06 (m, 2H), 0.30-0.38 (m, 2H), 0.80-0.93 (m, 1H), 1.23-1.38 (m, 2H) ), 1.53-1.67 (m, 1H), 1.74-1.88 (m, 2H), 2.84 (d, J = 6.6 Hz, 2H), 2.98 (d, J = 7.0 Hz, 2H), 3.33 (dt, J = 1.7, 12.0 Hz, 2H), 3.77 (s, 6H), 3.88 (s, 3H), 3.91-4.00 (m, 2H), 4.81 (br d, J = 4.6 Hz, 2H), 6.50-6.55 (m, 1H), 6.74 (s, 2H), 7.02-7.09 (m, 1H), 7.32-7.38 (m, 1H).

[0129] Comparative Example 50

M-Cyclopropylmethyl-M-7- [4- (ethoxymethyl) -2,6-dimethoxyphenyl] -2-methoxypyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

OMe

OEt yellow oil

PL 213 633 B1 ¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.07 (m, 2H), 0.30-0.39 (m, 2H), 0.82-0.95 (m, 1H), 1.36 (t, J = 7.0 Hz , 3H), 1.25-1.39 (m, 2H), 1.55-1.68 (m, 1H), 1.75-1.84 (m, 2H), 2.85 (d, J = 6.8 Hz, 2H), 2.99 (d, J = 7.0 Hz, 2H), 3.34 (dt, J = 1.8, 12.0 Hz, 2H), 3.69 (q, J = 7.0 Hz, 2H), 3.78 (s, 6H), 3.89 (s, 3H), 3.92-4.00 (m , 2H), 4.62 (s, 2H), 6.52 (dd, J = 1.4, 6.9 Hz, 1H), 6.72 (s, 2H), 7.06 (dd, J = 6.9, 8.9 Hz, 1H), 7.35 (dd, J = 1.4,8.9 Hz, 1H).

[0130] Comparative Example 51

M-Cyclopropylmethyl M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methoxypyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-3-furanylmethylamine

Slightly yellow crystals ¹ H NMR (400 MHz, CDCl3) δ -0.02-0.04 (m, 2H), 0.28-0.34 (m, 2H), 0.78-0.86 (m, 1H), 1.60-1.68 (m, 1H), 1.84-1.94 (m, 1H), 2.20-2.30 (m, 1H), 2.83 (d, J = 6.8 Hz, 2H), 2.92-3.00 (m, 1H), 3.10-3.14 (m, 1H), 3.48 ( s, 3H), 3.52-3.68 (m, 2H), 3.73 (s, 6H), 3.74-3.82 (m, 2H), 3.84 (s, 3H), 4.52 (s, 2H), 6.48 (dd, J = 1.2, 7.2 Hz, 1H), 6.65 (s, 2H), 7.02 (dd, J = 7.2, 8.8 Hz, 1H), 7.29 (dd, J = 1.2, 8.8 Hz, 1H).

[0131] Comparative Example 52

Tert-butyl M-1- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2-methoxypyrazolo [1,5-a] pyridin-3-ylcarbamate

To a solution of tert-butyl M- (7-bromo-2-methoxypyrazolo [1,5-a] pyridin-3-yl) carbamate (200 mg) dissolved in 1,2-dimethoxyethane (12 ml) and water (6 ml) 2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid (197 mg), tetrakis- (triphenylphosphine) palladium (0) (101 mg) and barium hydroxide octahydrate (274 mg) were added, the reaction mixture was heated and stirred for 4 hours in 80 ° C under a nitrogen stream. Ethyl acetate was added to the obtained reaction mixture, and after filtering off the undissolved residue, the reaction mixture was extracted with ethyl acetate, the organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (150 mg) was obtained as a slightly yellow oil from the n-hexane: ethyl acetate (1: 1) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 1.52 (br s, 9H), 3.48 (s, 3H), 3.70 (s, 6H), 3.87 (s, 3H), 4.51 (s, 2H), 5.82 (br s , 1H), 6.53 (d, J = 6.8 Hz, 1H), 6.64 (s, 2H), 7.10 (dd, J = 6.8, 8.8 Hz, 1H), 7.27 (d, J = 8.8 Hz, 1H).

[0132] Comparative Example 53

M-Cyclobutylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methoxypyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

PL 213 633 B1

To a solution of t-butyl N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methoxypyrazolo [1,5-a] pyridin-3-ylcarbamate (75 mg) , N-dimethylformamide (0.6 ml) was added sodium hydride (60% in oil; 10 mg) and (bromomethyl) cyclobutane (0.022 ml) and the reaction mixture was stirred for 1 hour at room temperature. Water was added to the obtained reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine. The organic extract was dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure to give the crude product N-cyclobutylmethyl-N-7- [2,6-dimethoxy-4- (detoxymethyl) phenyl] -2-methoxypyrazolo [1,5- a] tert-butyl pyridin-3-ylcarbamate.

To the obtained crude product N-cyclobutylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methoxypyrazolo [1,5-a] pyridin-3-ylcarbamate t-butyl without further After purification, 4N hydrochloric acid (ethyl acetate solution; 1 ml) was added and the reaction mixture was stirred for 1 h at 40 ° C. The resulting reaction mixture was neutralized using a 2N aqueous sodium hydroxide solution while cooling with ice, and then extraction was performed with ethyl acetate and the organic extract was washed with brine. The organic extract was dried over anhydrous magnesium sulfate and filtered, the residue was purified by silica gel column chromatography and N-cyclobutylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methoxypyrazole- [1.5- a] pyridin-3-ylamine (51 mg) was obtained as a yellow oil from the n-hexane: ethyl acetate (1: 1) fraction.

Tetrahydropyran was added to a solution of the obtained N-cyclobutylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methoxypyrazolo [1,5-a] pyridin-3-ylamine dissolved in tetrahydrofuran (0.6 ml). -4-carbaldehyde (34 mg) and sodium triacetoxyborohydride (38 mg) and the reaction mixture was stirred for 2 hours at room temperature. A saturated aqueous sodium bicarbonate solution was added to the obtained reaction mixture, extraction was performed with ethyl acetate, and the organic extract was washed with brine. The organic extract was dried over anhydrous magnesium sulfate and filtered, the solvent was evaporated under reduced pressure, the residue was purified by silica gel column chromatography and the title compound (52 mg) was obtained as a yellow oil from the n-hexane: ethyl acetate (3: 2) fraction.

¹ H NMR (400 MHz, CDCl) δ 1.17-1.30 (m, 2H), 1.48-1.63 (m, 3H), 1.69-1.89 (m, 6H), 2.26-2.39 (m, 1H), 2.82-2.87 ( m, 2H), 2.93-2.98 (m, 2H), 3.24-3.34 (m, 2H), 3.49 (s, 3H), 3.73 (s, 6H), 3.85 (s, 3H), 3.88-3.96 (m, 2H), 4.53 (s, 2H), 6.48 (dd, J = 1.3, 6.8 Hz, 1H), 6.66 (s, 2H), 7.02 (dd, J = 6.8,

8.8 Hz, 1H), 7.24 (dd, J = 1.3, 8.8 Hz, 1H).

[0133] As in Example 53, the compounds of Examples 54 to 56 were synthesized.

[0134] Comparative Example 54

M-Butyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-methoxy-pyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

PL 213 633 B1

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ 0.81-0.89 (m, 3H), 1.18-1.40 (m, 6H), 1.48-1.60 (m, 1H), 1.70-1.78 (m, 2H), 2.83- 2.98 (m, 4H), 3.24-3.34 (m, 2H), 3.49 (s, 3H), 3.74 (s, 6H), 3.85 (s, 3H), 3.88-3.97 (m, 2H), 4.53 (s, 2H), 6.49 (dd, J = 1.3, 6.8 Hz, 1H), 6.67 (s, 2H), 7.02 (dd, J = 6.8, 8.8 Hz, 1H), 7.26 (dd, J = 1.3, 8.8 Hz, 1H ).

[0135] Comparative Example 55

M-7- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2-methoxypyrazolo [1,5-a] pyridin-3-yl-M-propyl-M-tetrahydro-2H-4-pyranylmethylamine

Slightly yellow amorphous solid product ¹ H NMR (400 MHz, CDCl 3) δ 0.87 (t, J = 7.6 Hz, 3H), 1.20-1.31 (m, 2H), 1.33-1.42 (m, 2H), 1.48-1.62 (m , 1H), 1.71-1.78 (m, 2H), 2.87 (d, J = 7.2 Hz, 2H), 2.90 (d, J = 7.2 Hz, 2H), 3.25-3.34 (m, 2H), 3.48 (s, 3H), 3.73 (s, 6H), 3.84 (s, 3H), 3.88-3.95 (m, 2H), 4.52 (s, 2H), 6.47 (dd, J = 1.2, 6.8 Hz, 1H), 6.66 (s , 2H), 7.00 (dd, J = 6.8, 8.8 Hz, 1H), 7.25 (dd, J = 1.2, 8.8 Hz, 1H).

[0136] Comparative Example 56

M-7- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2-methoxypyrazolo [1,5-a] pyridin-3-yl-M-isobutyl-

Slightly yellow amorphous solid product ¹ H NMR (400 MHz, CDCl 3) δ 0.90 (d, J = 6.4 Hz, 6H), 1.19-1.30 (m, 2H), 1.48-1.60 (m, 2H), 1.74-1.81 (m , 2H), 2.72 (d, J = 7.2 Hz, 2H), 2.82 (d, J = 7.2 Hz, 2H), 3.26-3.34 (m, 2H), 3.48 (s, 3H),

PL 213 633 B1

3.73 (s, 6H), 3.84 (s, 3H), 3.89-3.95 (m, 2H), 4.52 (s, 2H), 6.47 (dd, J = 1.2, 6.8 Hz, 1H), 6.66 (s, 2H) , 7.00 (dd, J = 6.8, 8.8 Hz, 1H), 7.26 (dd, J = 1.2, 8.8 Hz, 1H).

[0137] As in Example 18, the compound of Example 57 was synthesized.

[0138] Comparative Example 57

1- (4-3 - [(Cyclopropylmethyl) (tetrahydro-2H-4-pyranylmethyl) amino] -2-methoxypyrazolo [1,5-a] pyridin-1-yl ^^ - dimethoxyphenylH-ethanol

Slightly yellow amorphous solid product ¹ H NMR (400 MHz, CDCl 3) δ -0.06-0.01 (m, 2H), 0.27-0.34 (m, 2H), 0.78-0.89 (m, 1H), 1.20-1.34 (m, 2H ), 1.49-1.63 (m, 4H), 1.71-1.80 (m, 2H), 2.78-2.84 (m, 2H), 2.91-2.99 (m, 2H), 3.24-3.35 (m, 2H), 3.74 (s , 3H), 3.75 (s, 3H), 3.86 (s, 3H), 3.88-3.97 (m, 2H), 4.93-5.01 (m, 1H), 6.49 (dd, J = 1.3, 6.8 Hz, 1H), 6.68 (s, 1H), 6.74 (s, 1H), 7.02 (dd, J = 6.8, 8.8 Hz, 1H), 7.31 (dd, J = 1.3, 8.8 Hz, 1H).

[0139] As in Example 47, the compound of Example 58 was synthesized.

[0140] Comparative Example 58

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethoxypyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

Yellow oil ¹ H NMR (400 MHz, CDCl3) δ -0.04-0.02 (m, 2H), 0.28-0.31 (m, 2H), 0.78-0.88 (m, 1H), 1.20-1.32 (m, 5H), 1.50 -1.60 (m, 1H), 1.70-1.78 (m, 2H), 2.81 (d, J = 6.4 Hz, 2H), 2.95 (d, J = 6.8 Hz, 2H), 3.29 (dt, J = 2.0, 11.6 Hz, 2H), 3.48 (s, 3H), 3.72 (s, 6H), 3.89-3.93 (m, 2H), 4.21 (q, J = 7.2 Hz, 2H), 4.52 (s, 2H), 6.47 (dd , J = 1.2, 6.8 Hz, 1H), 6.66 (s, 2H), 7.00 (dd, J = 7.2, 8.8 Hz, 1H), 7.30 (dd, J = 1.2, 8.8 Hz, 1H).

Example 59

M-Cyclopropylmethyl-M-r7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methylsulfanyl) pyrazolo [1,5-a] pyridin-3-yl] -M-tetrahydro-2H-4 -pyranylmethylamine

PL 213 633 B1

To a solution of N-cyclopropylmethyl-N- [7-iodo-2- (methylsulfanyl) pyrazolo [1,5-a] pyridin-3-yl] -N-tetrahydro-2H-4-pyranylmethylamine (50 mg) dissolved in the mixture 1 , 2-dimethoxyethane (2 ml) and water (1 ml) were added 2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid (50 mg), tetrakis- (triphenylphosphine) palladium (0) (40 mg) and barium hydroxide octahydrate (56 mg), the reaction mixture was heated and stirred for 3 hours at 80 ° C. Water and ethyl acetate were added to the obtained reaction mixture, the undissolved residue was filtered off through celite, and the filtrate was extracted with ethyl acetate. The organic extracts were combined and washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography and then by column chromatography with NH Silica (Fuji Silysia) to give the title compound (36 mg) as yellow oil.

¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.04 (m, 2H), 0.30-0.38 (m, 2H), 0.82-0.92 (m, 1H), 1.22-1.34 (m, 2H), 1.52-1.64 (m, 1H), 1.76-1.82 (m, 2H), 2.44 (s, 3H), 2.90 (d, J = 6.8 Hz, 2H), 3.06 (d, J = 7.2 Hz, 2H), 3.32 (td, J = 2.0, 12.0 Hz, 2H), 3.50 (s, 3H), 3.74 (s, 6H), 3.90-3.98 (m, 2H), 4.54 (s, 2H), 6.59 (dd, J = 1.6, 7.2 Hz , 1H), 6.67 (s, 2H), 7.05 (dd, J = 7.2, 8.8 Hz, 1H), 7.41 (dd, J = 1.6, 8.8 Hz, 1H).

[0142] As in Example 59, the compound of Example 60 was synthesized.

[0143] Comparative Example 60

M-Cyclopropylmethyl-M- [7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methylsulfanyl) pyrazole-

yellow oil ¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.04 (m, 2H), 0.28-0.38 (m, 2Η), 0.80-0.90 (m, 1Η), 1.58-1.68 (m, 1H), 1.88 -1.96 (m, 1H), 2.20-2.30 (m, 1H), 2.42 (s, 3H), 2.88-2.92 (m, 2H), 3.02-3.10 (m, 1H), 3.20-3.24 (m, 1H) , 3.47 (s, 3H), 3.58-3.82 (m, 4H), 3.71 (s, 6H), 4.52 (s, 2H), 6.57 (dd, J = 1.6, 7.2 Hz, 1H), 6.64 (s, 2H ), 7.03 (dd, J = 6.8, 8.8 Hz, 1H), 7.38 (dd, J = 1.6, 8.8 Hz, 1H).

[0144] Preparation example 1X comparative

2-Ethyl-3-iodopyrazolo [1,5-a] pyridine

AND

N-Chlorosuccinimide (411 g, 3.08 mol) was gradually added to a mixture of 2-ethylpyrazolo [1,5-a] pyridine (360 g, 2.46 mol), ethyl acetate (3600 ml), water (1800 ml) and sodium iodide (480 g, 3.20 mol, 1.3 equiv) for 30 minutes while cooling with ice, and then the reaction mixture was stirred

This was done for 2 hours and 20 minutes at room temperature. After the reaction, water and ethyl acetate were added to the reaction mixture, and extraction was performed with ethyl acetate. The organic extract was washed twice with 10% aqueous sodium thiosulfate and then concentrated. Hexane was added to the residue, the mixture was heated until dissolved, and the resulting solution was filtered to remove undissolved residue. After washing the hexane solution with water, the hexane layer was concentrated, the residue was dissolved in ethyl acetate and the solvent was evaporated to give 663 g of the title compound (98.9% yield).

¹ H NMR (400 MHz, CDCl 3) δ 1.35 (t, J = 7.7 Hz, 3H), 2.84 (q, J = 7.7 Hz, 2H), 6.72 (ddd, J = 6.8, 6.8, 1.3 Hz, 1H), 7.15 (ddd, J = 9.0, 6.8, 1.1 Hz, 1H), 7.37 (ddd, J = 9.0, 1.3 Hz, 1.3, 1H), 8.36 (ddd, J = 6.8, 1.1, 1.1 Hz, 1H).

[0145] Preparation example 2X comparative

Tetrahydro-2H-4-pyranecarboxamide

Concentrated ammonia water (50 ml) was added to methyl tetrahydro-2H-pyran-4-carboxylate (50 g, 347 mmol) and the reaction mixture was stirred for 43.5 hours at room temperature. The reaction mixture was then cooled in an ice-water bath, then the precipitate was filtered off and dried under reduced pressure at 40 ° C to give 33.4 g of the title compound (74.6% yield).

¹ H NMR (400 MHz, DMSO-d6) δ 1.45-1.62 (m, 4H), 2.28 (tt, J = 11.1, 4.4 Hz, 1H), 3.26 (ddd, J = 11.4, 11.4, 2.7 Hz, 2H) , 3.82 (br d, J = 11.4 Hz, 2H), 6.74 (br s, 1H), 7.21 (br s, 1H).

[0146] Preparation example 3X comparative

M4- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) tetrahydro-2H-4-pyranecarboxamide

A mixture of 2-ethyl-3-iodopyrazolo [1,5-a] pyridine (350 g, 1.29 mol), tetrahydro-2H-4-pyrancarboxamide (249 g, 1.93 mol), copper iodide (49.0 g, 258 mmol), phosphate tripotassium hydrate (546 g, 2.57 mol), 1,2-cyclohexanediamine (cis and trans mixture) (58.7 g, 514 mmol) and xylene (3500 ml) were stirred under heating at an external temperature of 120 ° C (oil bath) . The reaction mixture was heated and stirred for 6 hours after which heating was terminated and upon reaching an internal temperature of 61.5 ° C, hot water (58 ° C, 3500 mL) was added to the reaction mixture and stirring was continued overnight. After adding 28% ammonia water (1050 ml) to the reaction mixture and stirring for 1 hour, the precipitate was filtered off, washed with water (1750 ml) and ethyl acetate (1050 ml) and then dried by aeration at 60 ° C overnight to give 280 g of the title compound (major conformer: minor conformer = 6: 1) (79.6% yield).

Major conformer ¹ H NMR (400 MHz, CDCl 3) δ 1.33 (t, J = 1.1 Hz, 3H), 1.88-2.05 (m, 4H), 2.57-2.67 (m, 1H), 2.75 (q, J = 7.7 Hz , 2H), 3.50 (ddd, J = 11.4, 11.4, 2.9 Hz, 2H), 4.09 (ddd, J = 11.4, 4.0, 2.6 Hz, 2H), 6.68 (ddd, J = 6.8, 6.8, 1.3 Hz, 1H ), 6.82 (br s, 1H), 7.07 (ddd, J = 9.0,6.8, 1.3 Hz, 1H), 7.29 (br d, J = 9.0 Hz, 1H), 8.30 (d, J = 6.8 Hz, 1H)

¹ H NMR secondary conformer (400 MHz, CDCl 3) δ 1.34 (t, J = 1.1 Hz, 3H), 1.40-1.50 (m, 2H), 1.88-2.05 (m, 2H), 2.37-2.48 (m, 1H) , 2.78 (q, J = 1.1 Hz, 2H), 3.14 (ddd, J = 11.9, 11.9, 1.8 Hz, 2H), 3.84-3.92 (m, 2H), 6.56 (br s, 1H), 6.80 (ddd, J = 6.8,6.8,1.3 Hz, 1H), 7.20 (br dd, J = 9.0,6.8 Hz, 1H), 7.34 (br d, J = 9.0 Hz, 1H), 8.39 (d, J = 6.8 Hz, 1H )

[0147] Preparation example 4X comparative

M4-Cyclopropylmethyl-M4- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) tetrahydro-2H-4-pyranecarboxamide

PL 213 633 B1

A mixture of N4- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) tetrahydro-2H-4-pyranecarboxamide (272 g, 915 mmol), potassium tert-butoxide (144 g, 1.28 mol) and 1.2 -Dimethoxyethane (1750 ml) was heated and stirred at an external temperature of 40 ° C. (Bromomethyl) cyclopropane (161 g, 1.19 mol) was then added dropwise to the reaction mixture keeping the internal temperature below 50 ° C. After heating and stirring for 4 hours, water (1250 ml) and toluene (3750 ml) were added to the reaction mixture. The aqueous layer was removed and then the organic extract was washed with 10% brine (1250 ml) and water (1250 ml x 2 times) in that order and concentrated under reduced pressure to give 277 g of the title compound as a brown oil (92.6% yield).

¹ H NMR (400 MHz, CDCl 3) δ 0.03-0.11 (m, 1H), 0.14-0.22 (m, 1H), 0.32-0.46 (m, 2H), 0.85-0.98 (m, 1H), 1.36 (t, J = 7.6 Hz, 3H), 1.29-1.40 (m, 1H), 1.40-1.50 (m, 1H), 1.85 (ddd, J = 16.3, 11.9, 4.4 Hz, 1H), 1.97 (ddd, J = 16.5, 11.9, 4.6 Hz, 1H), 2.41 (mt, J = 11.5, 3.8 Hz, 1H), 2.66-2.84 (m, 2H), 3.03 (ddd, J = 11.9, 11.9, 2.2 Hz, 1H), 3.15 (ddd, J = 11.9, 11.9, 2.2 Hz, 1H), 3.31 (dd, J = 13.7, 7.3 Hz, 1H), 3.79 (dd, J = 13.7, 7.3 Hz, 1H), 3.76-3.86 (m, 1H ), 3.91 (ddd, J = 11.9, 4.4, 2.0 Hz, 1H), 6.79 (ddd, J = 6.8, 6.8, 1.4 Hz, 1H), 7.17 (br dd, J = 8.8, 6.8 Hz, 1H), 7.33 (br d, J = 8.8 Hz, 1H), 8.40 (d, J = 6.8 Hz, 1H).

[0148] Preparation Example 5X comparative

M-Cyclopropylmethyl-M- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) -M-tetrahydro-2H-4-pyraniumImethylamine

A solution of N4-cyclopropylmethyl-N4- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) tetrahydro-2H-4-pyranecarboxamide (220 g, 672 mmol) in tetrahydrofuran (1100 ml) was stirred at an external temperature of 55 ° C (hot water bath). Borane-tetrahydrofuran complex (1M solution, 1748 ml) was added dropwise to the reaction mixture and after heating and stirring for 2 hours, the reaction mixture was cooled in an ice bath and 2N hydrochloric acid (437 ml) was added. The reaction mixture was then stirred for 1 h at an external temperature of 50 ° C (hot water bath). After completion of the reaction, a 5N aqueous sodium hydroxide solution (299 mL) was added dropwise to the reaction mixture to adjust it to pH 8, and the aqueous layer was removed. Toluene (2200 ml) was then added to the organic extract, and after the organic extract was washed twice with water, it was concentrated under reduced pressure to give 209 g of the title compound (99.2% yield).

¹ H NMR (400 MHz, CDCl 3) δ -0.04-0.06 (m, 2H), 0.30-0.40 (m, 2H), 0.73-0.86 (m, 1H), 1.18-1.36 (m, 2H), 1.33 (t , J = 7.6 Hz, 3H), 1.46-1.60 (m, 1H), 1.72 (br d, J = 12.8 Hz, 2H), 2.82 (q, J = 7.6 Hz, 2H), 2.84 (d, J = 7.2 Hz, 2H), 3.01 (d, J = 7.2 Hz, 2H), 3.28 (ddd, J = 12.0, 12.0, 2.0 Hz, 2H), 3.92 (br dd, J = 12.0, 4.4 Hz, 2H), 6.59 ( ddd, J = 6.8, 6.8, 1.2 Hz, 1H), 6.95 (ddd, J = 8.8, 6.8, 1.2 Hz, 1H), 7.44 (ddd, J = 8.8, 1.2, 1.2 Hz, 1H), 8.29 (ddd, J = 6.8, 1.2, 1.2 Hz, 1H).

[0149] Manufacturing Example 6X comparative

M-Cyclopropylmethyl-M- (2-ethyl-7-iodopyrazolo [1,5-a] pyridin-3-yl) -M-tetrahydro-2H-4-pyranylmethylamine

A solution of N-cyclopropylmethyl-N- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) -N-tetrahydro-2H-4-pyranylmethylamine (180 g, 574 mmol) in tetrahydrofuran (1620 mL) was cooled in a bath dry ice-ethanol. 1.6M n-butyl lithium hexane solution (538 mL, 854 mmol) was added dropwise to the solution at a temperature of

The internal temperature is from -73 ° C to -64.5 ° C. After the reaction mixture was stirred for 1 hour at the same temperature, pentafluorooro-benzene (115 ml, 861 mmol) was added dropwise. The reaction mixture was further stirred for 1 hour and 20 minutes, then water / THF (1/1, v / v, 360 ml) was added. Cooling was complete, water (3600 ml) and heptane (3600 ml) were added to the reaction mixture, the aqueous layer was removed and the organic extract was washed with water (3600 ml). A 5N aqueous hydrochloric acid solution (1800 mL) was then added to the organic layer and the aqueous layer was separated. After cooling the water layer in an ice bath and adding 5N aqueous sodium hydroxide solution (1620 ml), further toluene (3600 ml) was added to the reaction mixture and the organic layer was separated. The aqueous layer was extracted with toluene (3600 ml) and both organic extracts were combined and concentrated to give 220 g of the title compound as a dark green oil (87.3% yield).

¹ H NMR (400 MHz, CDCl 3) δ -0.02-0.05 (m, 2H), 0.33-0.40 (m, 2H), 0.74-0.86 (m, 1H), 1.19-1.32 (m, 2H), 1.36 (t , J = 7.6 Hz, 3H), 1.46-1.60 (m, 1H), 1.71 (br d, J = 13.2 Hz, 2H), 2.86 (d, J = 6.8 Hz, 2H), 2.88 (q, J = 7.6 Hz, 2H), 3.02 (d, J = 6.8 Hz, 2H), 3.28 (ddd, J = 11.6, 11.6 2.0 Hz, 2H), 3.92 (br dd, J = 11.6, 2.6 Hz, 2H), 6.71 (dd , J = 8.8, 6.8 Hz, 1H), 7.2 0 (dd, J = 6.8, 1.2 Hz, 1H), 7.47 (dd, J = 8.8, 1.2 Hz, 1H).

[0150] Manufacturing Example 7X comparative

M-Cyclopropylmethyl-M- (2-ethyl-7-iodopyrazolo [1,5-a] pyridin-3-yl) -M-tetrahydro-2H-4-pyranylmethylamine hydrochloride

A solution of concentrated hydrochloric acid (48.5 ml, 575 mmol) in isopropanol (270 ml) was added dropwise to the solution of N-cyclopropylmethyl-N- (2-ethyl-7-iodopyrazolo [1,5-a] pyridin-3-yl) -N -tetrahydro-2H-4-pyranylmethylamine (220 g, 501 mmol) in dimethyl carbonate (3600 ml) over 20 minutes at room temperature and the reaction mixture was stirred for 15 hours at room temperature. The reaction mixture was then cooled in an ice water bath and dimethyl carbonate (900 ml) was added. After the reaction mixture was stirred for about 5 hours, the precipitate deposited was collected by filtration and washed with dimethyl carbonate (900 ml). Then it was dried under reduced pressure at 50 ° C to give 250 g of the title compound (93.7% yield) as a solvat with dimethyl carbonate and isopropanol.

¹ H NMR (400 MHz, CD3OD) δ 0.08-0.40 (m, 2H), 0.42-0.56 (m, 2H), 0.81-0.94 (m, 1H), 1.30-1.60 (m, 4H), 1.50 (t, J = 7.5 Hz, 3H), 1.67-1.81 (m, 1H), 3.06 (q, J = 7.5 Hz, 2H), 3.24 (ddd, J = 11.7, 11.7 2.4 Hz, 2H), 3.56-3.76 (m, 4H), 3.82-3.90 (m, 2H), 7.20 (dd, J = 8.8, 7.1 Hz, 1H), 7.66 (d, J = 7.1 Hz, 1H), 7.98 (d, J = 8.8 Hz, 1H).

[0151] Manufacturing Example 8X comparative

2-Bromo-1,3-dimethoxy-5- (methoxymethyl) benzene

Mesyl chloride (34.5 ml, 446 mmol) was added to a solution of (4-bromo-3,5-dimethoxyphenyl) methanol (100 g, 405 mmol) and triethylamine (67.5 ml, 484 mmol) in 1,2-dimethoxyethane (1000 ml) while cooling with ice and the reaction mixture was stirred for 30 minutes. After adding 28% sodium methoxide in methanol (350 ml, 1.72 mol) to the reaction mixture, it was further stirred for 3 h at room temperature. After completion of the reaction, toluene (1000 ml) and water (1000 ml) were added to the reaction mixture, the aqueous layer was removed and the organic extract was washed with water (1000 ml), 1N hydrochloric acid (500 ml) and water (500 ml) in that order and concentrated. under reduced pressure to give 105 g of the title compound as a colorless oil (99.5% yield).

[0152] Preparation Example 9X comparative

2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid

PL 213 633 B1

To a solution of 2-bromo-1,3-dimethoxy-5- (methoxymethyl) benzene (20.0 g, 76.6 mmol) in tetrahydrofuran (200 ml) which was cooled in a dry ice and acetone bath was added 1.58 M n-butyl lithium in hexane ( 50.9 ml, 80.4 mmol) under a stream of nitrogen and the reaction mixture was stirred for 30 minutes. A solution of trimethoxyborane (8.75 g, 84.2 mmol) in tetrahydrofuran (20 mL) was then added to the reaction mixture and the reaction temperature was raised to 0 ° C with stirring. After adding 1N hydrochloric acid (200 ml) to the reaction mixture, it was stirred for 30 minutes at room temperature. After completion of the reaction, toluene (200 ml) was added to the reaction mixture, the organic layer was separated and the aqueous layer was extracted with toluene (100 ml). The combined organic extracts were washed with water (100 ml) then concentrated under reduced pressure. The residue was dissolved in Ye / N -butylmethylether (75 ml) and the reaction mixture was stirred for 30 minutes, then heptane (223 ml) was added and the reaction mixture was further stirred for 2 hours. The precipitate was filtered off and washed with a mixed solution of Ye / Y-butylmethylether and heptane (1: 3, 3.75 ml) and then dried at 40 ° C for 24 hours, yielding 12.4 g of the title compound (71.8% yield).

[0153] Preparation Example 10X comparative

Methyl 4-bromo-3,5-dimethoxybenzoate

Potassium carbonate (359 g) was added to a solution of 4-bromo-3,5-dihydroxy benzoic acid (127.5 g) in N, N-dimethylformamide (1020 ml) while cooling in an ice bath, then iodomethane (143 ml) was added. After removing the ice bath and stirring at room temperature for 17 hours, the reaction mixture was poured into ice water. The precipitate was filtered off and washed with water, then the residue was dissolved in ethyl acetate and dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (133.2 g) as a white solid product.

[0154] Preparation Example 11X Comparative (4-Bromo-3,5-dimethoxyphenyl) methanol

Lithium borohydride (20.8 g) was slowly added to a solution of methyl 4-bromo-3,5-dimethoxybenzoate (133.2 g) in tetrahydrofuran (500 ml) at room temperature, and the mixture was stirred for 3 hours with heating to reflux. The reaction mixture was cooled to room temperature, ice water (1.5 L) was added, and then ethyl acetate (1.2 L) was added to perform extraction. The obtained organic extract was washed with brine and dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (118.8 g) as a white solid product.

[0155] Manufacturing Example 12X comparative

2-Bromo-1,3-dimethoxy-5- (methoxymethyl) benzene

PL 213 633 B1

Sodium hydride (60% in oil; 24.7 g) was added to a solution of (4-bromo-3,5-dimethoxyphenyl) methanol (118.8 g) in N, N-dimethylformamide (960 ml) while cooling with ice and stirring for 10 minutes. iodomethane (41.7 ml) was added dropwise, the temperature was raised to room temperature and stirring was continued for 1 hour. The resulting reaction mixture was poured into ice water (2.5 L), extraction was performed with ethyl acetate, the extract was washed with brine and dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (121.3 g) was obtained as a colorless oil from the n-hexane: ethyl acetate (4: 1) fraction.

[0156] Manufacturing Example 13X comparative

2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid

n-Butyllithium (2.64M hexane solution; 182 ml) was added dropwise to a solution of 2-bromo-1,3-dimethoxy-5- (methoxymethyl) benzene (121.3 g) in tetrahydrofuran (730 ml) at -78 ° C and the mixture was stirred for 20 minutes. A solution of trimethoxyborane (61.7 mL) in tetrahydrofuran (20 mL) was added to the reaction mixture at -78 ° C. When the internal temperature was warmed to -10 ° C, a saturated aqueous ammonium chloride solution (73.0 mL) was added to the reaction mixture, and stirring was continued for 15 minutes. The resulting reaction mixture was extracted with ethyl acetate, the extract was washed with brine and dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography and the title compound (90.4 g) was obtained as a white solid from the n-hexane: ethyl acetate (2: 3) fraction.

¹ H NMR (400 MHz, CDCl 3) δ 3.44 (s, 3H), 3.93 (s, 6H), 4.47 (s, 2H), 6.62 (s, 2H), 7.19 (s, 2H).

[0157] Preparation Example 14X comparative

2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid

About ten parts of a solution of 2-bromo-1,3-dimethoxy-5- (methoxymethyl) benzene (1.0 g, 3.82 mmol) was added to a suspension of magnesium turnings (97.5 mg, 4.01 mmol) in tetrahydrofuran (0.5 ml) containing a small amount of iodine. in tetrahydrofuran (1 mL) under nitrogen and the mixture was heated in an oil bath at 70 ° C. Heating was terminated as the reaction mixture gently refluxed and the iodine color faded. With continued reflux, the remaining solution of 2-bromo-1,3-dimethoxy-5 (methoxymethyl) benzene in tetrahydrofuran was added dropwise to the reaction mixture. After completion of the dropwise addition, the reaction mixture was further heated to reflux for 1 h and then cooled to room temperature. The reaction mixture was added dropwise to an ice-cooled solution of trimethylborate (0.57 ml, 4.97 mmol) in tetrahydrofuran (0.5 ml). After completion of dropwise addition and stirring for 40 minutes under ice-cooling, the reaction mixture was stirred overnight at room temperature. Then, an aqueous ammonium chloride solution and methanol were added to the reaction mixture. Quantitative analysis by liquid chromatography confirmed that the title compound was obtained in 89% yield.

PL 213 633 B1

[0158] Preparation example 1Y comparative

Tbutyl M- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) carbamates

O ₂ N BocHN

To a solution of 2-ethyl-3-nitropirazolo [1,5-a] pyridine (7.65 g, 40 mmol) dissolved in a mixture of isopropyl alcohol (153 ml) and acetic acid (11.5 ml) was added di-Yfe /? -Butyldicarbonate (14 g, 64 mmol) and 5% palladium on carbon (1.53 g, 50% humidity) and the reaction was carried out for 3 hours at room temperature under a hydrogen atmosphere (0.3 MPa). After completion of the reaction, the reaction mixture was filtered and the obtained filtrate was evaporated. The residue was dissolved in ethyl acetate and the ethyl acetate solution was washed with an aqueous sodium bicarbonate solution and brine. The organic extract was dried with magnesium sulfate and evaporated to dryness. Isopropyl alcohol (7.7 ml) and heptane (38.3 ml) were added and the mixture was heated to 60 ° C to dissolve. A precipitate formed on cooling slowly and then heptane (15.3 ml) was added. After the mixture was left to stand overnight and then stirred for 30 minutes in an ice bath, the precipitate deposited was collected by filtration and washed with heptane. The precipitated solid was dried under reduced pressure to obtain 7.58 g of the title compound (71% yield).

[0159] Preparation example 2Y comparative

Tbutyl A- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) -M-tetrahydro-2H-4-pyranium

To a solution of Yfe / Y-butyl N- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) carbamate (12 g, 46 mmol) and potassium Yfe / Y-butoxide (6.2 g, 55 mmol) is dissolved in N, N-dimethylformamide (120 ml), tetrahydropyran-4-ylmethylmethanesulfonate (10.7 g, 55 mmol) was added while cooling with ice, the reaction mixture was stirred for 1 hour, then tetrahydrofuran (200 ml) was added and the reaction mixture was further stirred for 18 hours . Water (200 ml) and ethyl acetate (500 ml) were added to the reaction mixture, the aqueous layer was separated and extracted with ethyl acetate (300 ml). The combined organic extracts were washed with water (300 ml, 3 times) and brine, dried with magnesium sulfate and evaporated under reduced pressure to give 18 g of the title compound as a yellow oil (> 99% yield).

¹ H NMR (CDCl3) δ 1.33 (s, 9H), 1.37 (d, J = 7.6 Hz, 3H), 1.10-1.80 (m, 5H), 2.73 (q, J = 7.6 Hz, 2H), 3.30-3.42 (m, 3H), 3.57-3.84 (m, 1H), 3.90-4.02 (m, 2H), 6.70 (dd, J = 6.8, 6.8 Hz, 1H), 7.10 (dd, J = 7.1, 6.8 Hz, 1H ), 7.23 (d, J = 7.1 Hz, 1H), 8.33 (d, J = 6.8 Hz, 1H).

[0160] Comparative Preparation Example 3Y

A- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) -N-tetrahydro-2H-4-pyranylmethylamine hydrochloride

To a solution of N- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) -N-tetrahydro-2H-4-pyranylmethylcarbamate Yfe / Y-butyl (17.5 g, 50 mmol) dissolved in 1,2-dimethoxyethane (175 ml) 4N hydrochloric acid-ethyl acetate solution (175 ml) was added and the reaction mixture was stirred for 3 hours at 45 ° C. Then the solvent was evaporated under reduced pressure, 1,2-dimethoxyethane (175 ml) and hexane (175 ml) were added to the residue, the mixture was cooled in ice and the precipitate was collected by filtration to give 11.8 g of the title compound (87% yield).

¹ H NMR (CDCl3) δ 1.26-1.35 (m, 2H), 1.40 (t, J = 8.0 Hz, 3H), 1.88 (d, J = 12.7 Hz, 2H), 2.12-2.20 (m, 1H), 3.03 (q, J = 8.0 Hz, 2H), 3.10-3.20 (m, 4H), 3.81 (dd, J = 11.5, 2.4 Hz, 2H), 6.80 (dd, J = 6.8, 6.8Hz, 1H), 7.18 ( dd, J = 9.0, 6.8 Hz, 1H), 8.09 (d, J = 9.0 Hz, 1H), 8.32 (d, J = 6.8 Hz, 1H), 11.70 (br s, 1H).

PL 213 633 B1

[0161] Preparation example 4Y comparative

M-Cyclopropylmethyl-M- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) -M-tetrahydro-2H-4-pyraniumImethylamine

A mixture of M- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) -M-tetrahydro-2H-4-pyranylmethylamine hydrochloride (10.3 g, 35 mmol) and potassium carbonate (5.8 g) in ethyl acetate (150 ml) and water (30 ml) were stirred for 8 minutes at room temperature. The organic extract was separated and then washed with brine, dried with magnesium sulfate and evaporated under reduced pressure to give N- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) -M-tetrahydro-2H-4-pyranylmethylamine (9.1 g) . This compound was dissolved in tetrahydrofuran (180 ml), cyclopropane carboxaldehyde (7.4 g, 106 mmol) and sodium triacetoxyborohydride (10.5 g, 49.7 mmol) were added and the reaction mixture was stirred for 10 minutes. After completion of the reaction, ethyl acetate (400 ml) and water (200 ml) were added to the reaction mixture, and the organic extract was separated. After extracting the aqueous layer with ethyl acetate (200 ml), the organic extracts were combined and washed with water (100 ml) and brine (100 ml). The organic extract was dried with magnesium sulfate and evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane: ethyl acetate = 6: 1) to give 11.9 g of the title compound as a yellow oil (> 99% yield).

[0162] Preparation example 5Y comparative

Tbutyl M-cyclopropylmethyl-M- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) carbamate

To a solution of tert-butyl M- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) carbamate (4.93 g, 18.0 mmol) and potassium Yfe / Y-butoxide (2.54 g, 22.6 mmol) dissolved in M, (Bromomethyl) cyclopropane (2.02 ml, 20.8 mmol) was added dropwise to M-dimethylformamide (49 ml). The reaction mixture was stirred at room temperature for 15 minutes and then ethyl acetate (50 ml), heptane (50 ml) and water (50 ml) were added and the organic layer was separated. The aqueous layer was then re-extracted with heptane (30 mL). The combined organic extracts were washed with water (25 mL x 2 times) and 10% brine (10 mL). The organic extract was dried with magnesium sulfate and evaporated under reduced pressure to give 6.5 g of the title compound (> 99% yield).

¹ H NMR (400 MHz, CDCl 3) δ 0.00-0.19 (m, 2H), 0.30-0.50 (m, 2H), 0.95 (br s, 1H), 1.20-1.60 (m, 9H), 1.34 (t, J = 7.6 Hz, 3H), 2.75 (q, J = 7.6 Hz, 2H), 3.25-3.40 (m, 1H), 3.44- 3.62 (m, 1H), 6.67 (t, J = 6.8 Hz, 1H), 7.07 (t, J = 7.2 Hz, 1H), 7.32 (d, J = 8.8 Hz, 1H), 8.31 (d, J = 7.2 Hz, 1H)

[0163] Comparative Preparation Example 6Y

Tbutyl N- (7-Bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -N-cyclopropylmethylcarbamate

A solution of n-butyllithium in hexane (1.6M, 3.88 ml, 6.18 mmol) was added dropwise to the solution of M-cyclopropylmethyl-M- (2-ethylpyrazolo [1,5-a] pyridin-3-yl) carbamate Yfe / Y-butyl (1.5 g, 4.76 mmol) in tetrahydrofuran (15 mL) at -70 ° C. After the reaction mixture was stirred for 50 minutes at the same temperature, 1,2-dibromotetrafluoroethane (1.0 mL, 8.33 mmol) was added dropwise to the reaction mixture. The temperature of the reaction mixture was slowly increased and an aqueous solution of sodium bicarbonate was added at 0 ° C. The reaction mixture was extracted with ethyl acetate and the organic extract was washed with brine, dried

With magnesium sulfate and evaporated. The residue was purified by silica gel column chromatography (hexane: ethyl acetate = 8: 1) to give 1.65 g of the title compound as a yellow oil (87.8% yield).

¹ H NMR (400 MHz, CDCl 3) δ 0.00-0.20 (m, 2H), 0.39 (m, 2H), 0.95 (m, 1H), 1.25-1.60 (m, 9H), 1.35 (t, J = 8.0 Hz , 3H), 2.56 (q, J = 8.0 Hz, 2H), 3.20-3.35 (m, 1H), 3.50-3.65 (m, 1H), 6.93-7.04 (m, 2H), 7.35 (dd, J = 1.6 , 8.4 Hz, 1H).

[0164] Preparation example 7Y comparative

Tbutyl M-cyclopropylmethyl-M-7- (2,6-dimethoxy-4- (methoxymethyl) phenyl) -2-ethylpyrazolo [1,5-a] pyridin-3-ylcarbamate

After adding 1,2-dimethoxyethane (26.7 ml) and water (13.4 ml) to a mixture of Yfe / Y-butyl-N- (7-bromo-2-ethylpyrazolo [1,5-a] pyridin-3-yl) -N-cyclopropylmethylcarbamate (422 mg, 1.34 mmol), 2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid (399 mg, 1.74 mmol), tetrakis (triphenylphosphine) palladium (0) (231 mg, 0.20 mmol) and octahydrate barium hydroxide (634 mg, 2.0 mmol), the mixture was degassed under reduced pressure at 0 ° C with stirring. The reaction mixture was heated to 90 ° C and then stirred for 90 minutes. After the reaction, water was added to the reaction mixture, and extraction was carried out with ethyl acetate. The organic extract was washed with brine, dried with magnesium sulfate and evaporated. The residue was purified by silica gel column chromatography (n-hexane: ethyl acetate = 4: 1-2: 1), then suspended and purified with heptane to give 487 mg of the title compound (yield 73%).

¹ H NMR (400 MHz, CDCl 3) δ 0.10-0.22 (m, 2H), 0.35-0.50 (m, 2H), 1.15 (m, 1H), 1.24 (t, J = 7.6 Hz, 3H), 1.20-1.68 (m, 9H), 1.62 (s, 2H), 2.70 (q, J = 7.6 Hz, 2H), 3.49 (s, 3H), 3.68-3.78 (m, 6H), 4.53 (s, 2H), 6.64- 6.73 (m, 3H), 7.11 (t, J = 8.0 Hz, 1H), 7.31 (d, J = 8.8 Hz, 1H)

[0165] Preparation Example 8Y comparative

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyr-

A mixture of Yfe / Y-butyl-N-cyclopropylmethyl-N-7- (2,6-dimethoxy-4- (methoxymethyl) phenyl) -2-ethylpyrazolo [1,5-a] pyridin-3-ylcarbamate (20 mg, 0.04 mmol) in trifluoroacetic acid (1.0 ml) was stirred for 30 minutes at room temperature. An aqueous 5N sodium hydroxide solution was added to the reaction mixture for neutralization, followed by extraction with ethyl acetate. The organic extract was washed with an aqueous sodium bicarbonate solution and brine in that order and dried with magnesium sulfate. Then it was evaporated under reduced pressure to give 13 mg of the title compound (81% yield).

¹ H NMR (400 MHz, CDCl 3) δ 0.18 (q, J = 4.4 Hz, 2H), 0.45-0.55 (m, 2H), 1.10-1.30 (m, 1H), 1.23 (t, J = 7.2 Hz, 3H ), 2.10 (br s, 1H), 2.75 (q, J = 7.2 Hz, 2H), 2.89 (d, J = 6.8 Hz, 2H), 3.47 (s, 3H), 3.70 (s, 6H), 4.51 ( s, 2H), 6.54 (dd, J = 0.8, 6.8 Hz, 1H), 6.66 (s, 2H), 7.00 (dd, J = 6.8, 9.2 Hz, 1H), 7.40 (dd, J = 0.8, 8.4 Hz , 1H)

PL 213 633 B1

Preparation example 9Y comparative 7-Bromo-2-ethylpyrazolo [1,5-a] pyridine

A solution of 2-ethylpyrazolo [1,5-a] pyridine (5.0 g, 34.2 mmol) in tetrahydrofuran (50 mL) was cooled to below -70 ° C under a nitrogen stream and then a solution of n-butyl lithium in hexane (32.5 mL, 1.58M) was added dropwise. solution, 51.4 mmol) at a temperature below -60 ° C. After stirring for 1 hour, bromopentafluorobenzene (9.3 g, 37.7 mmol) was added dropwise to the reaction mixture at a temperature below -60 ° C. The reaction mixture was stirred for 2 hours below -70 ° C and then water (50 ml) was added to the reaction mixture and the temperature was raised to room temperature. Ethyl acetate (50 ml) and water (50 ml) were added and extraction was performed with ethyl acetate. The organic extract was washed twice with 5% brine (50 ml) and dried over anhydrous magnesium sulfate, and then the solvent was evaporated under reduced pressure to give 6.9 g of the title compound.

[0167] Preparation example 10Y comparative

7-Bromo-2-ethyl-3-nitropyrazolo [1,5-a] pyridine

Fuming nitric acid (1.7 ml) was added dropwise to a solution of 7-bromo-2-ethylpyrazolo [1,5-a] pyridine (6.9 g, 34.2 mmol) in concentrated sulfuric acid (13.8 ml) with an internal temperature below 30 ° C while cooling with ice . After the reaction mixture was stirred for 30 minutes, it was added to ice water (138 ml) and the resulting precipitate was filtered off. Ethyl acetate (226 ml) and methanol (38 ml) were added to the obtained precipitate, and the mixture was heated to 70 ° C, and then the precipitate was collected by filtration while cooling with ice. The solvent was evaporated from the obtained filtrate under reduced pressure and the concentrated residue was recrystallized from heptane-ethyl acetate (1: 1) to give 2.4 g of the title compound as light brown crystals (31% yield).

[0168] Preparation example 11Y comparative

7- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2-ethyl-3-nitropyrazolo [1,5-a] pyridine

A mixture of 7-bromo-2-ethyl-3-nitropyrazolo [1,5-a] pyridine (3.0 g, 11.1 mmol), 2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid (5.0 g, 22.2 mmol), acetate palladium (125 mg, 0.55 mmol), triphenylphosphine (578 mg, 2.22 mmol), tripotassium phosphate hydrate (5.3 g, 22.2 mmol) and 1,2-dimethoxyethane (30 ml) was heated to reflux for 14 hours under nitrogen atmosphere. The reaction mixture was cooled to room temperature, ethyl acetate (100 ml) and water (50 ml) were added and the organic layer was separated. The organic extract was then washed with 10% brine (50 ml), 1N hydrochloric acid (50 ml) and 10% ammonia water (50 ml) in that order. The organic extract was dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained concentrated residue was purified by silica gel column chromatography, obtaining 3.45 g of the title compound (84% yield).

¹ H NMR (400 MHz, CDCl 3) δ 1.25 (t, J = 7.4 Hz, 3H), 3.15 (q, J = 7.4 Hz, 2H), 3.50 (s, 3H), 3.78 (s, 6H), 4.57 ( s, 2H), 6.65 (s, 2H), 7.05 (dd, J = 7.0, 1.0 Hz, 1H), 7.66 (dd, J = 9.0, 7.0 Hz, 1H), 8.36 (dd, J = 9.0, 1.0 Hz , 1H).

PL 213 633 B1

[0169] Preparation example 12Y comparative

7- [2,6-Dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-amine

A mixture of 7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethyl-3-nitropyrazolo [1,5-a] pyridine (850 mg, 2.3 mmol), 10% palladium on carbon (50% rel. ., 330 mg) and methanol (19 ml) were stirred for 13 hours at 50 ° C under an atmosphere of hydrogen at atmospheric pressure. After the reaction mixture was cooled to room temperature, the reaction mixture was filtered through celite to remove the catalyst. The solvent of the obtained filtrate was evaporated under reduced pressure to give 3.45 g of the title compound (84% of yield).

¹ H NMR (400 MHz, CDCl 3) δ 1.24 (t, J = 7.4 Hz, 3H), 1.46-1.96 (br s, 2H), 2.76 (q, J = 7.4 Hz, 2H), 3.48 (s, 3H) , 3.70 (s, 6H), 4.52 (s, 2H), 6.52 (d, J = 6.3 Hz, 1H), 6.66 (s, 2H), 6.99 (dd, J = 8.6, 6.3 Hz, 1H), 7.32 ( d, J = 8.6 Hz, 1H).

0170] Preparation Example 13Y comparative

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-ylamine

A mixture of 7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-amine (400 mg, 1.17 mmol), cyclopropanecarboxaldehyde (0.122 ml, 1.64 mmol) and tetrahydrofuran (2 ml) was heated for 1 h at 50 ° C.

The reaction mixture was added dropwise to ice-cooled diisobutylaluminum hydride (1M toluene solution, 3.51 mL, 3.51 mmol). The reaction mixture was stirred for 20 minutes, then 1N hydrochloric acid (2 ml) and ethyl acetate (20 ml) were added to the reaction mixture and extraction was performed with ethyl acetate. The organic extract was washed twice with water (10 ml) and dried over anhydrous magnesium sulfate, then the solvent was evaporated under reduced pressure. The obtained concentrated residue was recrystallized from heptane: ethyl acetate (10: 1) to give 290 mg of the title compound as white crystals (63% yield).

¹ H NMR (400 MHz, CDCl 3) δ 0.18 (q, J = 4.4 Hz, 2H), 0.45-0.55 (m, 2H), 1.10-1.30 (m, 1H), 1.23 (t, J = 7.2 Hz, 3H ), 2.10 (br s, 1H), 2.75 (q, J = 7.2 Hz, 2H), 2.89 (d, J = 6.8 Hz, 2H), 3.47 (s, 3H), 3.70 (s, 6H), 4.51 ( s, 2H), 6.54 (dd, J = 6.8, 0.8 Hz, 1H), 6.66 (s, 2H), 7.00 (dd, J = 9.2, 6.8 Hz, 1H), 7.40 (dd, J = 8.4, 0.8 Hz , 1H).

Example 1X M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro p-toluenesulfonate -2H-4-pyranylmethylamine

PL 213 633 B1

A mixture of N-cyclopropylmethyl-N- (2-ethyl-7-iodopyrazolo [1,5-a] pyridin-3-yl) -N- {tetrahydro-2H-4-pyranylmethyl) amine hydrochloride (193 g, 405 mmol), 2,6-dimethoxy-4- (methoxymethyl) phenylboronic acid (143 g, 105 mmol, 1.56 eq.), palladium acetate (4.7 g, 21 mmol, 5 mol%), triphenylphosphine (27.6 g, 105 mmol, 26 mol%) , potassium carbonate (203 g, 1.47 mmol, 3.63 eq.), 1,2-dimethoxyethane (6667 mL) and water (3333 mL) were heated in a 100 ° C oil bath in a flask, the reaction system was purged with nitrogen gas. After about 6 hours from the start of reflux, the reaction mixture was cooled to room temperature.

Then, toluene (2000 ml) was added to the reaction mixture, and the separated aqueous layer was removed. The toluene layer was extracted twice with 5N hydrochloric acid (first time: 3000 ml, second time: 1000 ml). Isopropylacetate (2000 mL) was added to the aqueous layer and a 5N aqueous sodium hydroxide solution (4200 mL) was added with cooling in an ice-water bath to adjust to pH 14, and the isopropyl acetate layer was separated. The isopropylacetate layer was washed with 10% aqueous ethylenediamine (2000 mL, 3 times) and water (2000 mL, 2 times) and after concentration, ethanol (400 mL) was added for azeotropic distillation and the reaction mixture was concentrated to give 207 g of a green solid.

The residue was dissolved in ethanol (1720 ml) with heating, and a solution of p-toluenesulfonic acid monohydrate (65.5 g, 344 mmol) in ethanol (170 ml) was added dropwise over 3 minutes at an internal temperature of 60 ° C. After the mixture was allowed to cool with stirring, seed crystals (100 mg) were added when the internal temperature reached 35 ° C. After 30 minutes, the mixture was cooled in a thermostatic bath at 7 ° C and stirred for 15 hours and 45 minutes. The precipitated crystals were then filtered off and washed with isopropanol (400 ml). The crystals were dried under reduced pressure at 60 ° C for 3.5 hours to give 214 g of the title compound as white crystals (79.5% yield).

Example 2X

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine

A mixture of N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-ylamine (20 mg, 0.05 mmol), sodium iodide (75 mg, 0.50 mmol), tetrahydro-2H-4-pyanylmethyl methanesulfonate (49 mg, 0.25 mmol), and sodium carbonate (10 mg) dissolved in dimethylformamide (0.5 ml) were stirred for 90 minutes at room temperature. Then water and ethyl acetate were added to the reaction mixture and extraction was performed with ethyl acetate. The organic extract was dried with magnesium sulfate and then evaporated. The residue was purified by silica gel column chromatography to give 21 mg of the title compound (yield 84%).

Example 3X

M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine hydrochloride

PL 213 633 B1

To the solution of N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N-tetrahydro-2H-4-pyranylmethylamine (2.2 g) dissolved in ethyl acetate (30 ml) was added a mixture of 4N hydrochloric acid-ethyl acetate (1.17 ml) at room temperature, the reaction mixture was stirred while cooling with ice, and the precipitate was collected by filtration to obtain a crude product of the title compound (2.2 g) as a white powder.

The obtained crude product (2.2 g) was recrystallized from a mixed solvent of t-butylmethylether (500 ml) and ethyl acetate (700 ml) to give the title compound (1.5 g).

¹ H NMR (400 MHz, DMSO-d6, at 100 ° C) δ -0.04-0.10 (m, 2H), 0.30-0.38 (m, 2H), 0.77-0.87 (m, 1H), 1.14-1.25 (m , 5H), 1.55-1.70 (m, 3H), 2.73 (q, J = 8 Hz, 2H), 2.99 (br s, 2H), 3.14 (br s, 2H),

3.21 (br ddd, J = 11, 11, 1 Hz, 2H), 3.41 (s, 3H), 3.64 (s, 6H), 3.80 (ddd, J = 11.6, 4 Hz, 2H), 4.50 (s , 2H), 6.59 (br d, J = 1 Hz, 1H), 6.74 (s, 2H), 7.11 (br t, J = 7 Hz, 1H), 7.59 (br s, 1H).

Example 4X

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazole-M, 5-a] -pyridin-1 -yl-M-tetrahydro-2 H 4 -pyranylmethylamine sulfate

To the solution of N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4- pyanylmethylamine (2.01 g) dissolved in 2-propanol (50 ml) was added 3M sulfuric acid (0.68 ml) while cooling with ice and the reaction mixture was stirred. The reaction mixture was then evaporated under reduced pressure to afford the crude title compound.

The obtained crude product was recrystallized from a mixture of 2-propanol (40 ml) and ethanol (20 ml) to give the title compound (1.04 g).

¹ H NMR (400 MHz, DMSO-d6, at 100 ° C) δ -0.02-0.07 (m, 2H), 0.32-0.38 (m, 2H), 0.75-0.87 (m, 1H), 1.14-1.25 (m , 5H), 1.55-1.70 (m, 3H), 2.70 (q, J = 8 Hz, 2H), 2.97 (br s, 2H), 3.12 (br s, 2H),

3.22 (br ddd, J = 11, 11.2 Hz, 2H), 3.41 (s, 3H), 3.64 (s, 6H), 3.80 (br d, J = 11 Hz, 2H), 4.50 (s, 2H) , 6.58 (br d, J = 1 Hz, 1H), 6.74 (s, 2H), 7.10 (br dd, J = 8.7 Hz, 1H), 7.54 (br d, J = 8 Hz, 1H).

Example 5X

M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1'-tetrahydridin-1-yl-M-tetrahydro-H ^ -pyranylmethylamine methanesulfonate

PL 213 633 B1

To the solution of N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N-tetrahydro-2H-4-pyranylmethylamine (1.78 g) dissolved in ethyl acetate (40 ml) was added methanesulfonic acid (234 µΊ) and the reaction mixture was stirred at room temperature and evaporated under reduced pressure. The obtained residue was washed with a mixture of n-hexane: ethyl acetate (10: 1) to obtain a crude product of the title compound (2.1 g).

The obtained crude product (2.1 g) was recrystallized from a mixture of t-butylmethylether (400 ml) and ethyl acetate (150 ml) to give the title compound (1.6 g).

¹ H NMR (400 MHz, DMSO-d6 at 100 ° C) δ -0.03-0.07 (m, 2H), 0.32-0.40 (m, 2H), 0.75-0.87 (m, 1H), 1.12-1.25 ( m, 5H), 1.53-1.70 (m, 3H), 2.41 (s, 3H), 2.70 (q, J = 8 Hz, 2H), 2.97 (br s, 2H), 3.11 (br s, 2H), 3.22 (br ddd, J = 11.11,1 Hz, 2H), 3.41 (s, 3H), 3.64 (s, 6H), 3.80 (br d, J = 11 Hz, 2H), 4.50 (s, 2H), 6.57 (br d, J = 6 Hz, 1H), 6.74 (s, 2H), 7.09 (br dd, J = 1.6 Hz, 1H), 7.53 (br d, J = 7 Hz, 1H).

Example 6X M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro p-toluenesulfonate -2H-4-pyranylmethylamine

To the solution of N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N-tetrahydro-2H-4-pyranylmethylamine (1.6 g) dissolved in ethyl acetate (25 ml) p-toluenesulfonic acid monohydrate (617 mg) was added and the reaction mixture was stirred at room temperature. The precipitated solid was filtered off to obtain a crude product of the title compound (2.18 g).

The obtained crude product (2.18 g) was recrystallized from a mixture of t-butyl methyl ether (640 ml) and ethyl acetate (770 ml) to give the title compound (1.9 g).

¹ H NMR (400 MHz, DMS0-d6 at 100 ° C) δ -0.03-0.07 (m, 2H), 0.30-0.40 (m, 2H), 0.75-0.87 (m, 1H), 1.14-1.25 ( m, 5H), 1.53-1.70 (m, 3H), 2.29 (s, 3H), 2.70 (q, J = 8 Hz, 2H), 2.97 (br s, 2H), 3.11 (br s, 2H), 3.22 (br dd, J = 11.11 Hz, 2H), 3.41 (s, 3H), 3.64 (s, 6H), 3.80 (br d, J = 11 Hz, 2H), 4.50 (s, 2H), 6.58 ( br d, J = 6 Hz, 1H), 6.74 (s, 2H), 7.06-7.14 (m, 3H), 7.49-7.58 (m, 3H).

Example 7X M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro p-toluenesulfonate -2H-4-pyranylmethylamine

PL 213 633 B1

To the solution of N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N-tetrahydro-2H-4-pyranylmethylamine (500 mg) dissolved in ethanol (5 ml) p-toluenesulfonic acid monohydrate (172 mg) in ethanol (1 ml) was added while heating to reflux and the reaction mixture was stirred while allowing it to cool to room temperature. After further cooling the reaction mixture to an internal temperature of -20 ° C, the precipitated crystals were filtered to give the title compound (629 mg).

Example 8X

M-Cyclopropylmethyl-M-742,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M4etrahydro-2H-4-pyranylmethylamine hydrobromide

After adding 48% aqueous hydrobromic acid (0.69 mL) to the solution of N-cyclopropylmethyl-W-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3 -ylο-W4etrahydro-2H-4-pyranylmethylamine (2.0 g) in ethyl acetate (20 ml), the reaction mixture was vigorously stirred at room temperature. The obtained precipitate was filtered off to obtain a crude product of the title compound (2.34 g).

The obtained crude product (2.34 g) was recrystallized from ethanol (60 ml) to give the title compound (2.14 g).

¹ H NMR (400 MHz, DMSO-d6, at 100 ° C) δ -0.03-0.07 (m, 2H), 0.30-0.40 (m, 2H), 0.75-0.87 (m, 1H), 1.14-1.24 (m , 5H), 1.55-1.70 (m, 3H), 2.71 (q, J = 8 Hz, 2H), 2.98 (br s, 2H), 3.13 (br s, 2H), 3.21 (br ddd, J = 11, 11.1 Hz, 2H), 3.41 (s, 3H), 3.64 (s, 6H), 3.80 (br d, J = 11 Hz, 2H), 4.50 (s, 2H), 6.59 (br d, J = 6 Hz, 1H), 6.74 (s, 2H), 7.10 (br s, 1H), 7.56 (br s, 1H).

Example 9X

M-cyclopropylmethyl-M-742,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazoloH, 5-alpyridin-3-yl- / V4-parahydro-2 / 7-4-pyranylmethylamine benzenesulfonate

To the solution of N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N-tetrahydro-2H-4-pyranylmethylamine (320 mg) dissolved in ethyl acetate

(10 ml) benzenesulfonic acid monohydrate (108 mg) was added and the reaction mixture was stirred at room temperature. The obtained precipitate was filtered off to yield a crude product of the title compound (330 mg).

The obtained crude product (330 mg) was recrystallized from a mixture of t-butylmethylether (70 ml) and ethyl acetate (80 ml) to give the title compound (106 mg).

¹ H NMR (400 MHz, DMSO-d6 at 100 ° C) δ -0.03-0.07 (m, 2H), 0.30-0.40 (m, 2H), 0.75-0.87 (m, 1H), 1.14-1.25 ( m, 5H), 1.55-1.70 (m, 3H), 2.70 (q, J = 8 Hz, 2H), 2.97 (br s, 2H), 3.12 (br s, 2H),

3.22 (br dd, J = 11.11 Hz, 2H), 3.41 (s, 3H), 3.64 (s, 6H), 3.80 (br d, J = 11 Hz, 2H), 4.50 (s, 2H), 6.57 (br d, J = 8 Hz, 1H), 6.74 (s, 2H), 7.10 (br dd, J = 8.8 Hz, 1H), 7.23-7.32 (m, 3H), 7.54 (br d, J = 8 Hz, 1H), 7.64 (dd, J = 8.2 Hz, 2H).

[0180] Example 10Χ

M-Cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4-pyranylmethylamine ethanesulfonate

To the solution of N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N-tetrahydro-2H-4-pyranylmethylamine (350 mg) dissolved in a mixture of ethyl acetate (5 ml) and tert-butyl methyl ether (5 ml) was added ethanesulfonic acid (83 mg) and the reaction mixture was stirred at room temperature. The obtained precipitate was filtered off to yield a crude product of the title compound (355 mg).

The obtained crude product (355 mg) was recrystallized from a mixture of t-butylmethylether (40 ml) and ethyl acetate (40 ml) to give the title compound (250 mg).

¹ H NMR (400 MHz, DMSO-d6, at 100 ° C) δ -0.03-0.07 (m, 2Η), 0.30-0.40 (m, 2H), 0.75-0.87 (m, 1H), 1.10-1.25 (m , 8H), 1.55-1.70 (m, 3H), 2.52 (q, J = 7 Hz, 2H), 2.70 (q, J = 8 Hz, 2H), 2.95 (br s, 2H), 3.11 (br s, 2H), 3.22 (br dd, J = 12.12 Hz, 2H), 3.41 (s, 3H), 3.64 (s, 6H), 3.80 (br d, J = 12 Hz, 2H), 4.50 (s, 2H ), 6.57 (br d, J = 1 Hz, 1H), 6.74 (s, 2H), 7.09 (br dd, J = 8.7 Hz, 1H), 7.53 (br d, J = 8 Hz, 1H).

[0181] [Preparation Examples]

Examples of the preparation of pharmaceutical compositions containing the compounds of the present invention are given below.

Manufacturing method

After mixing the compound of the invention (N-cyclopropylmethyl-W-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N- p-toluenesulfonate tetrahydro-2H-4-pyranylmethylamine), mannitol, crospovidone and hydroxypropyl cellulose, a sufficient amount of purified water was used for wet granulation. The granular product was dried and then the size was regulated. Crospovidone and magnesium stearate were placed with the granules, mixed and compressed into tablets. The obtained tablets were coated with a coating of an aqueous solution of a coating agent (a mixture of hydroxypropyl methylcellulose, talc, Macrogol 6000, titanium oxide and iron sesquioxide). The amount of materials used per tablet is given in Table 1.

[0182] [Table 1] Preparation Examples: Amount of materials used per tablet (mg)

Material Objective 0.5 mg tablet 5 mg tablet 25 mg tablet Compound of the invention * 1 main ingredient 0.675 6.75 33.75 Mannitol earnings 170.925 164.85 137.85 Crospovidone disintegrator 10 10 10 Hydroxypropyl cellulose binder 6 6 6 Purified water solvent q.s. q.s. q.s. In total - 187.6 187.6 187.6

PL 213 633 B1 cont. table 1

Crospovidone disintegrator 10 10 10 Magnesium stearate lubricant 2.4 2.4 2.4 In total - 200 200 200 Coating agent * 2 Coating agent 8 8 8 Purified water solvent q.s. q.s. q.s. Sum - 208 208 208

* 1: N-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N-tetrahydro-2H p-toluenesulfonate -4-pyranylmethylamine * 2: A mixture of hydroxypropyl methylcellulose, talc, Macrogol 6000, titanium oxide and iron sesquioxide

[0183] [Test examples]

The compounds of the present invention were evaluated for corticotropin releasing hormone (CRFR) receptor binding affinity, anxiolytic activity and drug metabolizing enzyme induction capacity.

The test methods and results were as follows.

[0184] Test Example 1 <CRFR binding experiment>

(1) Generation of cells expressing CRFR1

For the CRFR1 binding experiment, the cell membrane fraction with high expression of human CRFR was used as experimental material. CRFR-expressing cells were prepared as follows. From the library of the human brain cDNA to obtain full]-length CRFR1 gene (QuickClo _® AD ^®, Clontech) using PCR. The obtained DNA fragments were inserted into cloning vectors and the nucleotide sequence was determined. cDNA of the correct nucleotide sequence was inserted into wekto _® ra expression (pcDNA3.1 ^®, Invitrogen). The CRFR1 expression vector was introduced into HEK293 cells and resistant cells that had grown in G418 medium (1 mg / ml) were cloned by limiting dilution. From these cloned cells, cells with a high binding affinity between the membrane fraction per unit of protein and sauvagine were selected in the binding experiment described below and used in the final experiment.

[0185] (2) Production of the membrane fraction

Cloned cells obtained in (1) were harvested and resuspended in chilled membrane buffer (50 mM Tris-HCl, 5 mM MgCl2, 2 mM EGTA, 1 mM DTT, mixed protease inhibitor (COMPLETE®, Roche Diagnostics), pH 7.4), and then Cell disruption by Polytron (KINEMATICA) (level 5, 10 seconds, 4 times, ice-cooled), centrifuged (13,000 rpm (18,000 xg), 30 minutes, 4 ° C) to precipitate the cell membranes. Precipitated cell membranes were suspended in membrane buffer and disrupted by a Polytron (level 4, 20-30 seconds, ice-cooled) to obtain a dispersion suspension. The protein content of the dispersion suspension was calculated and diluted with membrane buffer containing 0.1% BSA to a protein concentration of 200 µg / ml, to be used as a membrane fraction.

[0186] (3) Binding experiment _®

CRF binding experiment was conducted according to the method SPA ^® (Amersham Pharmacia) using 96-well plate. The experiment was carried out according to the instructions for use of the beans

125

SPA. After leaving 5 µg of membrane fraction protein, 1 mg of SPA beans and 100 µM ¹²⁵ J-CRF (Perkin Elmer) at room temperature for 2 hours or more in the presence of test compound, the mixture was centrifuged (1200 rpm (260 xg, 5 minutes, room temperature ) the radioactivity of each _{® of the} well was measured using a TopCount ^® (Packard).

[0187] (4) Calculation of binding affinity

The radioactivity of the non-radioactive sauvagine added in a 2,000-fold excess was subtracted from each amount as non-specific binding, and the radioactivity of the sample without addition of test substance (control) was determined as 100%, each value being represented as a percentage (% of control). A plot was plotted in which the concentration of the test substance was placed on the horizontal axis and the percentage (% of control) was placed on the vertical axis, and the concentration was plotted from the plot, which gave 50% of the value for the percentage (% of control) to determine the IC50 value.

[0188] Test Example 2 <Study of inhibition of cAMP production using AtT-20 cells>

(1) Test procedure

PL 213 633 B1

AtT-20 cells were derived from a murine pituitary tumor cell line known to respond to corticotropin release factor (CRF), leading to activation of the intracellular adenylate cyclase system, cyclic AMP (cAMP) production, and adenocorticotropic hormone (ACTH) release ( Biochem. Biophys. Res. Com., 106, 1364-1371, ₅

1982). In this experiment, cells were suspended (1 x 10 ⁵ ) in D-MEM medium (0.1% FBS) and seeded in a 96-well plate, a phosphodiesterase inhibitor (IBMX, Calbiochem) was added to a final concentration of 1 mM, and cultured at 37 ° C. C for 30 minutes. Dilution of the test compound was added, the culture was continued for 30 minutes at 37 ° C, the CRF (30 nM) was added and the culture was continued for 30 minutes at 37 ° C. Cells were harvested by centrifugation (1,800 rpm (630 xg), 5 min.) And lysed with lysis buffer (0.2% dodecyltrimethylammonium bromide, and intracellular cAMP production was quantified by HTRF method. HTRF kit (Nixon Schering.) Was used for quantification.

[0189] (2) Calculation of cAMP production inhibitory activity

The obtained data was processed as follows. The cAMP production by cells to which 30 nM CRF was added was determined as 100% (control) and the value for each test sample was presented as a percentage (% of control). A plot was plotted in which the concentration of the test substance was placed on the horizontal axis and the percentage (% of control) was placed on the vertical axis, and the concentration was plotted from the plot, which gave 50% of the value for the percentage (% of control) for determining the IC50 value.

<Test results>

In Test Example 1 all compounds (Examples 1-9, 11-14, 18, 20-27, 29, 31-34, 37, 38, 40, 43, 44, 46-51, 53-60) showed excellent binding affinity for CRFR1. In test example 2, all compounds examples 1-9, 11-14, 18, 20-24, 26, 27, 29, 32-34, 37, 38, 40, 43, 44, 46- 51, 53-60) showed excellent inhibitory effects on CRF-dependent cAMP production. Some of these results are shown in Table 2 below.

T a b e l a 2

Compound No. (Example No.) CRF1 receptor IC50 binding affinity (nM) cAMP IC50 production activity (nM) Example 1 71 4 Example 3 49 5.1 Example 13 90 11 Example 23 50 6 Example 47 50 50 Example 59 52 3.5 Example 60 thirty 3.5

[0190] Test Example 3

Assessment of the anxiolytic effect in light / dark chamber mice (1) test procedure:

The light-dark chamber mouse test was performed according to the modified method of Belzung C., Misslin R., Vogel E. et al. (Reference; Behavioral effects of the benzodiazepine recep tor partial agonist R016-6028 in mice, Psychopha / macology, 97, 388-391, 1989). The test apparatus used was light / dark chambers containing a covered black acrylic chamber (dark chamber 15 x 10 x 20 cm), and an uncovered white acrylic chamber (light chamber 15 x 20 x 20) and a black acrylic tunnel (10 x 7 x 4.5 cm). ) that connects the dark chamber to the light chamber and allows mice to move freely back and forth between the dark chamber and the light chamber. In this test apparatus, a clear acrylic polymer was used on the front (20 x 20 cm) and back (20 x 20 cm) sides of the clear container to allow observation of the behavior. After setting the illumination on the floor of the bright container to a brightness of 150 Lux, 5 week old male Balb / c mice (purchased from Nihon Charles River) were placed in the dark container at the start of the test. For testing, the test compound was suspended in 0.5% aqueous methylcellulose solution and orally administered to the test animals one hour before the start of the test.

[0191] (2) Determination of the anxiolytic effect:

The behavior of the mice was monitored for 5 minutes after the start of the test. The residence time in the bright container was measured as an indicator of the anxiolytic effect "bright stay defined as."

The condition where the mouse limbs were on the floor of the clear container. The minimum dose that significantly extended the residence time in the clear container with respect to the group to which the vehicle was administered was defined as the Minimum Effective Dose (MED). The statistical significance between the vehicle-administered group and the test-compound administered group was analyzed by Dunnett's multiple-type comparison after a one-day variant analysis when multiple doses were determined for the same test and by the Mann-Whitney U test in which only one dose was established.

[0192] <Test results>

N-Cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-N-tetrahydro-2N-4-pyranylmethylamine showed excellent performance based on an anxiolytic evaluation in a light / dark chamber study of mice with an MED value of 10 mg / kg.

[0193] Test Example 4

Assessment of the ability to induce drug metabolising enzyme (CYP3A4) using freeze-preserved human hepatocytes.

(1) test procedure:

Cryopreserved hepatocytes (In Vitro Technology) were quickly thawed with agitation at 37 ° C, then ice-cooled William E (10% FBS, + PSG) was slowly added to the cells before centrifugation at 500 rpm for 5 minutes. After removal of the supernatant received ₅ mane hepatocytes were diluted with ice cold William Medium E to a concentration of 5 x 10 ₅ pho rek / ml, seeded in 48-well collagen coated plate (BD Biosciences) at 1 x 10 ⁵ ₂ cells / cm ^2, incubated for approximately 24 hours at 37 ° C, 5% CO2, after which the medium was changed to Hepato-STIM (BD Biosciences) (+ EGF, PSG, -FBS) and the culture was maintained for a further 24 hours at 37 ° C, 5 % CO2. Approximately 48 hours after seeding cells were added compound or rifampicin (SIGMA, positive control) in the form of a diluted solution (using HepatoSTIM ^® (+ EGF, PSG, FBS), hepatocyte were incubated for about 24 hours at 37 ° C, 5% CO 2 and the culture medium was changed to medium containing a freshly prepared dilution of test compound or rifampicin before further incubation for 24 hours under the same conditions After incubation, cells were washed once with PBS and total RNA was extracted using the Qiagen RNeasy Mini kit (Qiagen). cDNA was synthesized by reverse transcription of extracted using TaqMan Reverse Transcription Reagents (Applied Biosystems). The reverse transcription reaction was carried out using oligo dT as a primer, treating at 25 ° C for 10 minutes and then at 48 ° C for 60 minutes, after which the reverse transcriptase was inactivated by treatment with 95 ° C for 10 minutes The obtained cDNA was submitted to PCR using the Gene Amp PCR 9700 system. the retained cDNA was counted using the SYBR Green PCR Core Reagents kit (Applied Biosystems), and human CYP3A4 and GAPDH mRNA were counted using ABI7700 (Applied Biosystems). The primer sequences and the conditions used in the PCR are shown in Tables 3 and 4. The abbreviations used in the test example are explained below.

[0194]

FBS: Bovine fetal serum

PSG: Penicillin (100 U / ml), Streptomycin (100 ng / ml), Glutamine (2 mM)

EGF: Epidermal Growth Factor

GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenesis

[0195] [Table 3] Primer sequence

Isozym GenBank # Primer Name Sequence CYP3A4 NM017460 F. HCYP3A4_F3 TAGCTGAGGATGAAGAATGG R HCYP3A4_R3 GTGGATTGTTGAGAGAGTCG GAPDH M_3 3197 F. hGAPDH_F GAAGGTGAAGGTCGGAGTC R hGAPDH_R GAAGATGGTGATGGGATTTC

PL 213 633 B1

[0196] [Table 4] PCR conditions

Temperature Time 95 10 min 94 15s denaturation 56 15s hybridization of starter sections 72 3 people elongation (elongation)

cycles

[0197] (2) Calculation of CYP3A4 induction capacity:

The received data was processed as follows.

The value of the amount of CYP3A4 mRNA obtained by PCR was calculated divided by the amount of GAPDH mRNA and the ratio (fold) of the value obtained by adding the test compound to the negative control value (0.1% DMSO) and the ratio of the positive control value (10 μΜ rifampicin) to the value of negative control. Then, to compare each test run, the difference between the amount of CYP3A4 mRNA divided by the amount of GAPDH mRNA was calculated with the addition of test compound at different concentrations and with the addition of the negative control as a percentage, 100% being defined as the difference between the amount of CYP3A4 mRNA divided by the amount of GAPDH mRNA for positive control and negative control to determine the excitability of each test compound.

[0198] <Test results>

In Test Example 4, compounds of the invention (Examples 1, 3, 59) were evaluated for induction of a drug metabolising enzyme with cryopreserved human hepatocytes, to assess CYP induction in the liver, to predict drug interactions as side effects associated with administration in treating people. The test results for a test compound concentration of 1 μΜ showed a poor induction capacity of no more than 40%, where the fold value for the positive control was set to 100%. Some of the test results obtained with the test compounds are shown in Table 5.

[0199] [Table 5]

Test concentration Examples % positive control 0.03 μΜ 0.1 μΜ 0.3 μΜ 1 μΜ 3 μΜ 10 μΜ Example 59 2 3 11 25 49 59 Example 1 6 7 12 twenty 36 65 Example 3 3 3 7 25 23 34 Rifampicin (positive control) - - - - - 100

[0200] Various other assays were also used in Test Example 4 to evaluate the stimulating capacity of a drug metabolizing enzyme and confirmed that the compounds of the invention have low excitation capacity with respect to various drug metabolizing enzymes.

[0201] Industrial use

As explained above, the present invention provides novel pyrazolo [1,5-a] pyridine compounds with CRF receptor antagonizing activity, salts thereof, and novel pharmaceutical compositions containing them. The compounds of the invention or their salts show excellent antagonism against CRF receptors, and in particular against the CRF1 receptor, having low toxicity and high safety, therefore they are highly useful as drugs. The compounds of the invention and pharmaceutical compositions containing them are useful for the treatment or prevention of diseases associated with CRF and / or CRF receptors, and in particular they are useful as therapeutic or prophylactic agents for the treatment of depression and depressive symptoms (major depression, single depressive episodes, recurrent depression) , child abuse, postpartum depression, etc.), mania, anxiety, generalized anxiety disorder, panic attacks, phobias, obsessive-compulsive disorder, post-traumatic stress disorder, Tourette's syndrome, autism, manic-depressive psychosis , dysthymia, bipolar disorder, cyclophrenic disorder, schizophrenia, peptic ulcer, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative intestinal obstruction, stress-induced gastrointestinal disorders, nervous vomiting, and this p similar.

Claims (16)

CLAIMS 1. A 7-phenylpyrazolopyridine derivative or a salt thereof represented by the formula wherein R ¹ is ethyl or methylthio. 2. The compound or a salt thereof of claim 1 1 which is M-cyclopropylmethyl-N-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4- pyranylmethylamine or a salt thereof. 3. The salt according to claim 1 2 which is the salt of inorganic acid and M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro -2H-4-pyranylmethylamine. 4. The salt according to claim 1 3, which is M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H- hydrochloride 4-pyranylmethylamine. 5. The salt according to claim 1 3 which is M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H- hydrobromide 4-pyranylmethylamine. 6. The salt according to claim 1 3, which is M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H- sulfate 4-pyranylmethylamine. 7. The salt according to claim 1 2 which is the salt of an organic acid and M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro -2H-4-pyranylmethylamine. 8. The salt according to claim 1 7, which is M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H- benzenesulfonate 4-pyranylmethylamine. 9. The salt of claim 1 7, which is M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H- ethanesulfonate 4-pyranylmethylamine. 10. The salt according to claim 1 7 which is M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-2H-4- methanesulfonate pyranylmethylamine. 11. The salt according to claim 1 7, which is M-cyclopropylmethyl-M-7- [2,6-dimethoxy4- (methoxymethyl) phenyl] -2-ethylpyrazolo [1,5-a] pyridin-3-yl-M-tetrahydro-p-toluenesulfonate 2H-4-pyranylmethylamine. 12. The compound or a salt thereof of claim 1 1 which is M-cyclopropylmethyl-M-7- [2,6-dimethoxy-4- (methoxymethyl) phenyl] -2- (methylsulfanyl) pyrazolo] 1,5-a] pyridin-3-yl-N-tetrahydro 2H-4-pyranylmethylamine or a salt thereof. 13. A therapeutic or prophylactic agent for use in the prevention or treatment of depression, depressive symptoms, mania, anxiety, anxiety disorders, panic disorders, phobias, obsessive-compulsive disorders, post-traumatic tension disorders, Tourette's symptom, autism, psychosis Manic depressive disorder, mental illness, bipolar disorder, cyclophrenic personality disorder or schizophrenia, characterized in that it comprises a derivative as defined in any one of the preceding claims. 1 or its salt. 14. A therapeutic or prophylactic agent for use in the prevention or treatment of peptic ulcer, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative intestinal obstruction, and gastrointestinal disorders. For stress-induced or nervous vomiting, characterized in that it contains a derivative according to any one of the preceding claims. 1 or its salt. 15. Use of a derivative according to claim 1 1 or a salt thereof for the production of a therapeutic or prophylactic agent for the prevention or treatment of depression, symptoms of depression, mania, anxiety, anxiety disorders, panic disorders, phobias, obsessive-compulsive disorders, post-traumatic stress disorders, Tourette's symptom, autism, psychosis manic depression, mental illness, bipolar disorder, cyclophrenic personality or schizophrenia. 16. Use of a derivative according to claim 1 1 or a salt thereof for the manufacture of a therapeutic or prophylactic agent for the prevention or treatment of peptic ulcer, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative intestinal obstruction, stress-related gastrointestinal disorders, or nervous vomiting.