PL142369B1 - Process for manufacturing recombinated bacterial plasmid,containing nucleotides sequence coding the growth hormone - Google Patents

Description

The subject of the invention is a method for producing a recombinant bacterial plasmid containing a nucleotide sequence encoding a growth hormone in order to transfer this DNA to a microorganism and its replication. The invention therefore includes the isolation of a growth hormone gene which, after transfer and replication in a host cell, allows obtaining nucleotides of the growth hormone coding sequence. The recombinant plasmid produced according to the invention with a specific nucleotide sequence originating from a higher organism and a microorganism containing as part of its genetic equipment a specific nucleotide sequence coding for growth hormone are new. Symbols and abbreviations with the following meanings are used in this description: DNA - deoxyribonucleic acid RNA - ribonucleic acid cENA - complementary DNA (enzymatically synthesized based on mRNA sequence) mRNA - messenger RNA tRNA - transfer RNA dATP - deoxyadenosine triphosphate dGTP - deoxyguanosine triphosphate dCTP - deoxycytidine triphosphate A - adenine 142 3692 142 369 T - thymine G - guanine C - cytosine Tris - 2 -amino-2-hydroxyethylpropanediol-1,3 EDTA - ethylene diaminotetraacetic acid ATP - adenosine triphosphate TTP - thymidine triphosphate Alu site I - AG l CTf sequence undergoing specific hydrolysis in the place marked with the arrow under the influence of Alu endonuclease I Bara site HI - G l GATCCf sequence undergoing specific hydrolysis hydrolysis in the place marked by the arrow under the influence of the Barn HI endonuclease, Bgl I site - GCCNNMN Ir NGGC sequence, undergoing specific hydrolysis in the place marked by the arrow under the influence of the Bgl I endonuclease (note: N stands for any nucleotide), Eco RI site - G and AATTC sequence, undergoing specific hydrolysis in the place marked with an arrow under the influence of the Eco RI endonuclease Eco RII site - lCCAGG or iCCTGG sequence, undergoing specific hydrolysis in the place marked with the arrow under the influence of the Eco RII endonuclease Hae II site - AGGGC^ T or AGCGC I C orGGCGGiT or GGCGC lC sequence undergoing specific hydrolysis in the place marked with an arrow under the influence of the Hae II endonuclease Hinc II place - the GTTAAC or GTTGAC or GTCAAG or GTCGAC sequence, undergoing specific hydrolysis under the influence of the Hinc II endonuclease Pst I place - CTGCA l G sequence, undergoing specific hydrolysis in the place marked with the arrow under the influence of the endonuclease Pst I site Sal I - GI TCGAC sequence, undergoing specific hydrolysis in the place marked with an arrow under the influence of the Sal I endonuclease Sst I site - GAGCT4C sequence. undergoing specific hydrolysis in the place marked by the arrow under the influence of the Sst I endonuclease. The biological importance of the basic DNA sequence is that it stores genetic information. It is known that the sequence of bases in DNA serves as a code that determines the sequence of amino acids in all proteins produced by the cell. Therefore, parts of the DNA sequences function as regulators, controlling the synchronization of the production of each protein and its quantity. The nature of these regulatory elements is only partially understood. Finally, the base sequence of each strand serves as a template for DNA replication that accompanies cell division. The way that basic DNA sequence information determines the amino acid sequences in proteins is a fundamental process that occurs widely in all living organisms. It has been shown that each of the amino acids typically found in proteins is determined by one or more trinucleotide or triplet sequences. Therefore, for each protein there is a corresponding section of DNA containing a triplet sequence corresponding to the protein's amino acid sequence. The genetic code is presented below. In the biological process of processing information contained in the nucleotide sequence in the structure of the amino acid sequence, the first stage is the so-called transcription. At this stage, a given section of DNA, having a sequence specifying the protein to be produced, is first copied into RNA. RNA is a polynucleotide similar to DNA, with the difference that instead of deoxy-ribose it contains ribose, and instead of thymine - uracil. The bases in RNA are able to pair in the same way as in DNA*. As a result, as a result of transcription of the DNA nucleotide sequence into RNA, a sequence is obtained that is complementary to the copied sequence. This RNA is called messenger RNA (mRNA). because its role is to mediate between the genetic apparatus and the protein synthesizing apparatus in the cell.142 369 3 Histidine (His) Glutamine (Gin) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (cB-u) Cysteine (Cys) ) Tryptophan (Try) Arginine (Arg) Glycine (Gly) CAK CAJ AAK AAJ GAK CAJ TGK TGC WGZ CGL In the cell, mRNA serves as a template in a complex process involving many enzymes; and cell organelles, which results in the synthesis of a protein with a specific amino acid sequence* ft? this process is referred to as mRNA translation. There are often additional stages called processing, which lead to the conversion of the amino acid sequence synthesized in the translation process into a functional protein* ft*zy - an example is the formation of growth hormone* Genetic code Phenylalanine (Hie) TTK; Leucine (Leu)XTY; Isoleucine (He) ATM; Methionine (Meth) * ATG; Valine (Val) GTL; Serine (Cheese) ORS; Rroline (Pro) CCLj Threonine (Thr) ACL; Alanine (Ala) GCL; Tyrosine (Tyr) YES; TAJ completion signal; TGA completion signal; KEY: Each three-letter triplet stands for a DNA trinucleotide having a 5' end on the left and a 3' end on the right. The letters represent the purine or pyrimidine bases that make up the nucleotide sequence. adenine guanine cytosine thymine T or C if Y is A or G C if Y is C or T Y = A, G, C or T if X is C Y = A or G if X is T C or A if Z is A or G C if Z is C or T A, G, C or T if W is C Z * A or G if W is A QR» TC if S is A, G, C or T AG if S is T or C S« A, G, C or T. if QR is TC S s T or C if QR is AG A or G T or C A, T, C or G A, C or T It has been found that in the cells of higher organisms such as vertebrates, there are many proteins of medicinal and research importance or that these proteins are produced by the cells of these organisms* These proteins include, for example, growth hormone, other peptide hormones, such as the hormone insulin, proteins involved in the regulation blood pressure 1 various enzymes of industrial, medicinal or scientific importance* It is often difficult to obtain useful amounts of proteins of this type by extraction from body cells* This poultry is particularly acute in the case of proteins of human origin* HLTherefore, there is a need to have methods production of significant amounts of this type of proteins by cells outside the body* In some cases it is possible to obtain appropriate cell lines, A, Ge C* T = X* X = W: W, Z, QR J« K* L*4 142 369 which can be maintained by methods used in tissue culture. However, cell growth in tissue culture is slow, the medium is expensive, conditions must be carefully controlled, and yields are low. Moreover, it is often difficult to maintain a cultured cell line with the desired diversity of characteristics. In contrast, microorganisms such as bacteria grow relatively easily on chemically defined media. Fermentation technology is very developed and this process can be precisely controlled. The growth of organisms is rapid and high yields can be achieved. In addition, some microorganisms have been thoroughly characterized genetically and are, in fact, among the best characterized and understood organisms. Thus, a method that would ensure the transfer of a gene encoding a protein of therapeutic importance from an organism that normally produces that protein to a suitable microorganism would be highly desirable. . In this way, the protein can be produced by the microorganism under controlled growth conditions and obtained in desired amounts. Thanks to this method, it is also possible to significantly reduce the overall costs of producing a given protein. This basis, the possibility of isolating and transferring the genetic sequence determining the production of a specific protein to a microorganism with a well-known genetic apparatus, is a research tool of great cognitive value in terms of control of the synthesis of such a protein and its processing after synthesis. Also, isolated sections with a specific genetic sequence can be transformed to encode various proteins with changed medicinal or functional properties. The above goals can be achieved by using a plasmid produced by the method according to the invention, based on a complex participation of steps including reactions catalyzed by enzymes. In this description, these enzymatic reactions are characterized as they are understood so far. Reverse transcriptase catalyzes the synthesis of DNA complementary to the RNA template strand, in the presence of an RNA template, an oligodeoxyribonucleotide primer and four deoxynucleotide triphosphates, i.e. dATP, dGTP, dCTP and dTTP . The reaction is initiated by the non-covalent binding of an oligodeoxynucleotide primer to the 3' end of the mRNA, followed by the gradual addition of an elongating chain of appropriate deoxynucleotides to the 3' end, determined by base pairing with a specific mRNA nucleotide sequence. The structure of the resulting molecule can be characterized as hairpin-like. It contains the original RNA together with a complementary DNA strand bound by a single-stranded DNA loop. Reverse transcriptase is also capable of catalysing a similar reaction using single-stranded DNA as a template, and in this case the resulting product is a double-stranded hairpin DNA containing loops of single-stranded DNA connecting one set of ends. Jatrz H. Aviv. and P. Leder, Proc. Natl. Acad. Sci. USA, 69, 1^8 (1972) and A. Efstratiadis, F.C. Kafatos, A.F. Maxam and T. Maniatis, Oell, 7, 279 (1976). Restriction endonucleases are enzymes capable of hydrolyzing phosphodiester bonds in double-stranded ENA, thereby breaking the continuity of the DNA strand. When DNA is in the form of a closed loop, this loop is transformed into a linear structure. The basic characteristic of this type of enzyme is that it exhibits hydrolytic activity only in the place where a specific nucleotide sequence occurs. Such a sequence is called : recognition site for a restriction endonuclease Restriction endonucleases have been isolated from various sources and their recognition sites have been characterized in terms of nucleotide sequence. Some restriction endonucleases hydrolyze phosphodiester bonds at the same point in both strands, producing blunt ends. Eme catalyze the hydrolysis of bonds separated by several nucleotides, causing the formation of free single-stranded sections at each end of the split molecule. Such single-stranded ends are self-complementary and therefore "sticky" and can be used to reconnect hydrolyzed DNA. Moreover, each DNA is susceptible to cleavage by such action142 369 5 of the enzyme must contain the same recognition site, the same "sticky" ends are created, so that it becomes possible to connect heterologous DNA sequences, previously subjected to the action of a restriction endonuclease, with similarly treated other sequences, see: R.J. Robertsts, Crit. Rev. Blochem*, 4, 123 (1976). Recognition sites are relatively rare, but the general utility of restriction endonucleases has been greatly enhanced by the chemical synthesis of double-stranded oligonucleotides containing the recognition site sequence. Thus, virtually any segment of DNA can be coupled to any other segment by simply attaching an appropriate oligonucleotide containing the recognition site to the ends. molecules, and then subjecting the product thus obtained to the hydrolytic action of an appropriate restriction endonuclease, thus obtaining the desired "sticky" ends. See: H.L. Heyneker, J. Shine, H.N. Goodman, H.W. Boyer, J. Rosenberg, R.E. Dickerson, S.A. Narang, K. Itakura, S. Lin, and A.D. Riggs, Nature, 263, 748 (1976) and R.H. Scheller, R.E. Dickersen, H.W. Boyer, A.D. Riggs and K. Itakura, Science 196, 177 (1977). SI endonuclease is a specific enzyme capable of hydrolyzing phospho-diester bonds of single-stranded DNA and single-stranded sections or loops of essentially double-stranded DNA. Rrrrz: V.M. Vogt, Eur. J. Biochem. 33, 192 (1973). DNA ligase is an enzyme capable of catalyzing the formation of a phosphodiester bond between two sections of DNA containing a 5' phosphate and a 3' hydroxyl group, respectively. For example, it may be formed by two sections of DNA connected together by "sticky" ends. It is believed that the normal function of the enzyme is to join single-stranded strands into an essentially double-stranded DNA molecule. However, under the right conditions, DNA ligase is able to catalyze blunt-end joining, whereby two molecules that have blunt ends become covalently linked. See "V . Sgaramella, J.H. Van de Sande and H. G. Khorana, Proc. Natl. Acad. Sci. U.S. 67, 1468 (1970). Alkaline phosphatase It is an enzyme with broad specificity, capable of hydrolyzing phosphate esters including the 5' terminal phosphate bonds in DNA. The next step in the overall process is the insertion of a specific segment of DNA into a DNA transfer vector, such as a plasmid. ELasemid is a term used for any autonomously replicating DNA unit that can be detected in a microorganism cell, rather than belonging to the genome of the host cell. The plasmid is not genetically linked to the host cell's chromosome. Sections of plasmid DNA exist in the form of double-stranded circular molecules, generally with a molecular weight of several million, although some Q plasmids have a molecular weight greater than 10. They usually constitute only a small part of the total. cell DNA. Plasmid DNA can usually be separated from host cell DNA because they differ greatly in size. Plasmids can replicate independently of the rate of host cell division, and in some cases the rate of their replication can be controlled by the researcher by changing the conditions of their growth. Although the plasmid is a closed ring, it is possible to artificially introduce a segment of DNA into the plasmid to create a recombinant plasmid with increased molecular dimensions without significantly affecting its ability to replicate or express any genes it carries. The plasmid therefore serves as a useful agent for transferring a segment of DNA to a new host cell. Plasmids that are useful in recombinant EWA technology typically contain genes useful for selection purposes, such as drug resistance genes. In order to explain the practical application of the method of the invention, the isolation and transfer of the growth hormone gene are described in detail. The method described can be used by those skilled in the art to isolate the growth hormone gene from a variety of organisms, including humans. It is highly desirable to be able to produce growth hormone in quantities sufficient to meet global demand. This goal can be achieved by the production of human growth hormone in bacterial cells. However, achieving this goal has not been possible so far because the obstacle was the lack of developed methods for introducing the growth hormone gene into a bacterial cell. This possibility is provided by the plasmid produced according to the invention*6,142,369. The ability to obtain DNA with a specific sequence constituting the genetic code for a specific protein makes it possible to modify the nucleotide sequence by chemical or biological methods in such a way that the ultimately produced specific protein is also modified.* for example, modified growth hormone can be produced on special order resulting from specific treatment needs. The genetic ability to produce a growth hormone-related amino acid sequence having substantially the same properties as the growth hormone can thus be conferred on a microorganism. The ability to transfer the genetic code of a specific protein, essential for the normal metabolism of a given higher organism, to a microorganism, such as a bacterium, means significant possibilities of producing this type of protein by breeding* This, in turn, provides a clear possibility of increasing the produced amounts of such proteins or replacing them with proteins produced in microorganisms modified thanks to the plasmid produced by the method according to the invention, in those cases where the ability to function normally in relation to for the production of proteins of this type is limited. It also suggests the possibility of establishing a symbiotic relationship between modified microorganisms and a human suffering from chronic or acute diseases associated with a deficiency of a certain component or components, and these microorganisms can be implanted or otherwise associated with the human in order to compensate for the pathological deficiency. in its metabolism. This description provides a method for isolating nucleic acid with a specific nucleotide sequence containing genetic information, synthesizing DNA with a specific nucleotide sequence and transferring the DNA to a host microorganism. The invention covers the transfer of DNA with a specific sequence of the rat growth hormone gene and the human gene. growth hormone to bacteria. On this basis, it can be concluded that the plasmid according to the invention is a means for transferring DNA with a given sequence from a higher organism, such as a vertebrate, to any microorganism. In this description, a higher organism is understood to mean any eukaryotic organism with differentiated tissues, including but not limited to only, with insects, mollusks, plants, vertebrates, including mammals, the latter category including cattle, pigs, primates and humans. By microorganism is meant any living organism of microscopic dimensions, corresponding to the term protist, whether prokaryotic or eukaryotic, including, for example, bacteria, protozoa, algae and fungi, the latter category also including yeast. In the method according to the invention: a) cells isolated from an organism producing growth hormone are homogenized in the presence of a composition that inhibits RNase activity, containing a chaotropic anion and a chaotropic cation and an agent that cleaves disulfide bonds, b) polyadenylated mRNA is separated from the remaining components of the homogenized cells by extraction. ,, c) the secreted mRNA is incubated with reverse transcriptase in the presence of dATP, dCTP, dGTP and dTTP, d) the produced DNA strand encoding the growth hormone is incubated with reverse transcriptase or DNA polymerase in the presence of dATP, dCTP, dCTP and dTTP, e) the ends of the resulting double-stranded EWA are joined in a known manner with a DNA sequence complementary to the ends of the restriction enzyme created after the cleavage of the endonuclease, selected for the cleavage of the E. coli bacterial plasmid to which the double-stranded DNA is to be attached, f) the plasmid is cleaved the selected restriction endonuclease and the cleaved plasmid are treated with alkaline phosphatase and g) the double-stranded DNA containing the linking sequence is incubated and the phosphatase-treated plasmid is in the presence of DNA ligase and ATP to obtain a bacterial plasmid with a nucleotide sequence encoding the growth hormone. In the method according to the invention as a system inhibiting the activity of RNAase, a system containing a chaotropic anion and cation and an agent breaking the disulfide bond, for example ^-mercaptoethanol, is used. The chaotropic cation used is the guanidinium cation, and the chaotropic anion is the thiocyanate anion. 142 369 7 Preferably, as a system inhibiting the activity of RNAase, a system containing 4 M solution of guanidinium thiocyanate and 0.2 M (3-mercaptoethanol) is used. In step e) of the method according to the invention, it is combined a plasmid carrying DNA is combined with a double-stranded cDNA containing a nucleotide with a growth hormone coding sequence, whereby the selected active ends of the DNA molecules are protected against mutual connection by pre-treatment with a reagent capable of removing the terminal 5* phosphate groups, and the DNA molecules containing active ends subjected to pre-processing and those not subjected to pre-processing, together with the enzyme DNA ligase* This method protects the active ends subjected to pre-processing from joining together. Alkaline phosphatase is used as a factor suitable for the pre-treatment of active ends. In step g) of the method according to the invention, a microorganism is combined with a plasmid carrying DNA bound to cDNA and a microorganism with a growth hormone coding sequence is obtained. Under the described reaction conditions, the formation of viable plasmid DNA with a closed ring structure can only occur when a section of cDNA is incorporated. Then, the plasmid containing the cDNA sequence is introduced into the cell of a suitable host* Cells that have received a viable plasmid are detected by the occurrence of colonies having a genetic feature conferred by the plasmid, such as drug resistance* This is followed by the growth of pure bacterial strains containing the recombinant plasmid with the built-in cDNA sequence and re-isolation of this plasmid* In this way, it is possible to produce recombinant plasmid DNA in large quantities as well as to re-isolate cDNA sections with a specific sequence from it by endonucleolytic cleavage using an appropriate restriction enzyme. The method according to the invention is suitable for isolating and transferring to a host microorganism a segment with a given nucleotide sequence obtained from a higher organism, including a human* The method is useful in the transfer of a gene encoding a specific protein of medicinal or industrial value, and in the microbiological synthesis of a protein of this type* In the method according to according to the invention, a section of a nucleotide with a sequence coding for rat growth hormone was isolated, transferred and replicated in bacteria* This method can be used to transfer from human material a section with a specific nucleotide sequence coding for growth hormone as well as other polypeptide hormones* The subsequent stages of the method according to the invention can be divided into four general categories* 1* Isolation of a given population of cells from a higher organism* There are two potential sources of the genetic sequence coding for a specific protein: DNA, the source of which is the organism itself, and RNA transcribed from DNA. Under current safety requirements in the United States of America issued by the National Institutes of Health, human genes of any kind may be incorporated into recombinant DNA and then into bacteria only after very careful purification of the genes or under special conditions, suitable for high-risk work (F4). Efetrz: Federal Register, Vol. 41, No. 131, July 7, 1967, pp. 27 902-943» Therefore, in any method potentially useful in the production of a human protein, such as the method of the invention, it is preferable to isolate a specific mRNA having the nucleotide sequence encoding set protein. Adopting this procedure provides a further advantage in that mRNA can be purified more easily than DNA extracted from a cell. In particular, it is advantageous that in highly diverse organisms such as vertebrates, a specific population of cells with a specific location in the body can be identified, whose most important function is the production of a given protein. Alternatively, such a population may exist transiently during the development of the organism. In such cell populations, a large proportion of the mRNA isolated from the cells will contain the given nucleotide sequence. Therefore, the selection of the cell population for isolation and the isolation method used may in principle be advantageous with respect to the initial purity of the mRNA isolated from that source.8,142,369 In most tissues, glands and organs, cells are held together by a network of connective tissue , occurring essentially in the form of fibers, composed mainly of collagen, but may also contain, depending on the tissue, other structural proteins, polysaccharides or mineral deposits. Isolation of cells from a given tissue necessarily requires the use of a method of releasing cells from the connective tissue substrate. The isolation and purification of a specific type of differentiated cells therefore involves two main stages: separating the cells from the connective tissue substrate and separating the cells of a given type from all other cells present in the tissue. The working principles associated with and disclosed in the essence of the method according to the invention are suitable for the isolation of cells different types from different tissue sources. A method of isolating pituitary cells suitable for isolating growth hormone-encoding mRNA has been described below. It is often found that the proportion of a given mRNA may increase as a result of a favorable response of the cell to an external stimulus, for example, treatment with a hormone may result in increased production of the desired mRNA. Other methods include culturing at a particular temperature or using a specific nutrient or chemical. When isolating rat growth hormone mRNA, treating rat pituitary cells in culture with thyroid hormone and glucocorticoids synergistically enhances the share of growth hormone mRNA to a significant extent* 2. mRNA extraction. An important feature of the method according to the invention is the essentially complete removal of the RNAase activity in the extract cellular. The extracted mRNA is a single polynucleotide strand, unpaired with any complementary strand. Therefore, hydrolytic cleavage of a single phosphodiester bond in the sequence would render the molecule completely useless in transferring the intact genetic sequence to the microorganism. As noted above in the description, the RNAase enzyme is widespread, active and extremely stable. It has been found on the skin and withstands common glass cleaning methods and sometimes contaminates organic chemicals. These difficulties are particularly acute when processing pancreatic cell extracts, because it is a source of digestive enzymes and therefore contains a lot of RNAase. However, the problem of RNAase contamination occurs in all tissues and the method of the invention for eliminating RNAase activity is applicable to all tissues* In the method of the invention, during cell disintegration and during all operations necessary to separate RNA essentially free from protein, a chaotropic anion is used in combination chaotropic cation, and an agent that breaks disulfide bonds. The effectiveness of the combined action of the above-mentioned agents was demonstrated by their use in the isolation of substantially undegraded mRNA from isolated rat pituitary cells, with good efficiency. The selection of appropriate chaotropic ions is based on their water solubility and availability. Suitable chaotropic cations include those such as guanidinium, carbamoylguanidinium, guanylguanidinium, lithium, etc. Suitable chaotropic anions include such anions as iodine, perchlorate, triocyanate, diiodosalicylate, etc. The relative effectiveness of the salts formed by combining such anions and cations determines in part their solubility, for example, lithium diiodosalicylate is a stronger denaturing agent than guanidinium thiocyanate, but its solubility is only about 0.1 M and it is relatively expensive. Guanidinium thiocyanate is a preferred cation-anion combination because it is easily available and has high solubility in aqueous media, up to approximately 5 M. It is known to use thiol compounds, such as (i-mercaptoethanol, to break intramolecular disulfide bonds in proteins, for principle of thiol-disulfide exchange reaction. Many suitable thiol compounds are effective in this respect, in addition to thi-mercaptoethanol, dithiothreitol, cysteine, dithiopropanol, etc. Water solubility is an essential property because the thiol compound must be present in large excess142 369 9 in relation to the intramolecular disulfide bonds, so that the mutual exchange reaction is essentially complete. Fi-mercaptoethanol is preferred because of its availability and affordability. When inhibiting RNAase activity during the extraction of RNA from cells or tissues, the effectiveness of the chaotropic salt used depends on directly from its concentration. The preferred concentration is the highest concentration that can be practically used. It is believed that the effectiveness of the method of the invention in maintaining intact mRNA during extraction depends on the rate of denaturation of the RNAase and the extent of this denaturation. This can explain, for example, the superiority of guanidinium thiocyanate over hydrochloride, even though the hydrochloride is only a slightly weaker denaturing agent. The effectiveness of a denaturant is defined as the threshold concentration necessary to achieve complete denaturation of the protein. On the other hand, the rate of denaturation of many proteins depends on the denaturant concentration, with respect to the threshold value raised to the power of 5-10. See: CA. Tanford, Adv. Frot. Chem. 23, 121 (1968). Qualitatively, this ratio suggests that a denaturant only slightly stronger than guanidinium hydrochloride, used at the same concentration, can denature the protein many times faster. The relationship between the kinetics of RNAase denaturation and the preservation of intact mRNA during its extraction from cells has not yet been studied or exploited, as far as is known, and the above considerations, if correct, suggest that the preferred denaturant will be one that has a low denaturing threshold concentration and at the same time high solubility in water. For this reason, guanidinium thiocyanate is preferred over lithium diiodosalicylate, even though the latter is a stronger denaturant. However, the solubility of guanidinium thiocyanate is much greater and therefore it can be used at a concentration that allows for faster deactivation of RNAase. The above considering also explains that guanidy tiocyanate is more favorable than comparable sustainable hydrochloride, despite the fact that this first relationship is a slightly stronger denaturator. - folding of the RNAase molecule. The thiol compound is believed to increase the initial rate of denaturation by preventing the rapid renaturation that can occur when intramolecular disulfide bonds are left intact. Based on this, any amount of RNAse remaining as an impurity in the mRNA preparation will be inactive, even in the absence of a denaturant and thiol. Disulfide bond breaking agents containing thiol groups will have some activity at any concentration, although generally speaking a large excess of thiol groups relative to the intramolecular disulfide bonds is beneficial in shifting the equilibrium of the inter-exchange reaction in direction of cleavage of intramolecular disulfide bonds. On the other hand, many thiol compounds are foul-smelling and unpleasant when used at higher concentrations, so that there is virtually no upper concentration. When using &-mercaptoethanol, the effective concentration was found to be in the range of 0.05 M to 1.0 M, with a concentration of 0.2 M being considered optimal for isolating non-degradable RNA from the rat pituitary gland. The pH of the environment during mRNA extraction from cells can be anywhere in the range of 5f0-8.0. At the end of the cell disintegration stage, RNA is separated from the main amount of cellular proteins and ENA. Various methods have been developed for this purpose, each of which is useful and all of which are known. Typically, the ethanol precipitation method with selective RNA precipitation has been used so far. In the method according to the invention, the precipitation step is preferably omitted and the homogenized layer is applied directly to a 5-7 m solution of cesium chloride in a centrifuge tube and then centrifuged in the manner described by V. dislna, R. Crkvenjakov and Cm Byus in Biochemistry, 13f 2633 (197*0. This method is advantageous because the environment is still unfavorable for RNAase, and RNA is isolated with high efficiency and is devoid of ENA and protein*10 142 369 The method described above allows for the purification of all RNA from homogenized cells. However,9 only part of this RNA constitutes the desired mRNA. In order to further purify the desired mRNA, we took advantage of the fact that in the cells of higher organisms, the mRNA after transcription is further processed in the cell by the addition of polyadenylic acid. Such mRNA, containing the attached poly A sequences, can be selectively isolated on chromatographic columns containing cellulose with attached oligothymidylate, as described by H. Aviv and P. Leder above. The above method is sufficient to obtain substantially pure, intact and translatable mRNA from RNAase-rich sources. mRNA purification and subsequent in vitro processing can be performed in essentially the same manner as for any mRNA, regardless of the organism serving as the source. Under certain conditions, e.g., when tissue culture cells are used as a source of mRNA, RNAase contamination may be present. so low that the above-described method of inhibiting RNAase activity may turn out to be unnecessary. In such cases, existing methods of reducing RNAase activity are sufficient. 3. cDNA formation Figure 1 schematically shows the remaining stages of the process. The first stage of this process is the creation of a DNA sequence complementary to the purified mRNA. The enzyme of choice for this reaction is reverse transcriptase, although in principle any enzyme capable of forming a DNA strand faithfully complementary to the mRNA used as a template may be used. The reaction may be carried out under known conditions previously described using the mRNA as the template and a mixture of four deoxynucleoside triphosphates as the template. precursors for DNA strands. It is advantageous to introduce one of the ^P-labeled deoxynucleoside triphosphates at the cC position to monitor the progress of the reaction, to provide an indicator of product recovery after separation processes such as chromatography or electrophoresis, and to quantify the yield, ffetr: Efstratiadis, A. j. et al. , as above. As shown in the diagram in the figure, the product of the reaction catalyzed by reverse transcriptase has a double-stranded hairpin structure with a non-covalent bond between the RNA strand and the DNA. The product of the reaction catalyzed by reverse transcriptase is isolated from the reaction mixture using known methods. It was found that the combination of phenol extraction, chromatography on Sephadex 'G 100 and ethanol precipitation is useful. When cDNA is synthesized by the enzymatic method, the RNA templates can be removed. Various methods of selective RNA degradation in the presence of DNA are known. The preferred method is alkaline hydrolysis. It is highly selective and can be easily controlled by adjusting the pH. By carrying out the alkaline hydrolysis reaction followed by neutralization, it is possible, if desired, to concentrate the P-labeled cDNA by ethanol precipitation. Synthesis of double-stranded cDNA of the structure hair pinning is performed using an appropriate enzyme, such as DNA polyase or reverse transcriptase. The reactions are carried out under conditions similar to those previously described, including the use of P-labeled deoxynucleoside triphosphate at the cC position. Reverse transcriptase can be obtained from a variety of sources. A convenient source is avian methylblastosis virus. The virus can be obtained from Dr. D.J. Doard of Life Sciences Incorporated, St. Petersburg, Florida, which produces it under contract with the National Institutes of Health. When producing cDNA with a hairpin structure, it is convenient to isolate the DNA from the reaction mixture. As previously described, it has been found advantageous to perform phenol extraction, Sephadex G-100 chromatography and ethanol precipitation steps to obtain DNA free from protein contaminants. The hairpin structure is converted to the usual double-stranded DNA structure by removing the single-stranded loop connecting the ends of the complementary strands . For this purpose, there are a number of enzymes capable of specific hydrolytic cleavage of DNA in the single-stranded region. A convenient enzyme of this type is Si nuclease isolated from Aspergillus oryzse. This enzyme can be obtained from Miles Research Products, Elkhart, Indiana. Treating hairpin DNA with SL nuclease produces base-paired cENA molecules in high yield* followed by extraction, chromatography, and ethanol precipitation, as given above. The use of reverse transcriptase and £L nuclease in the synthesis of double-stranded cDNA transcribed from mRNA was described by Efstrafiadis et al., as above. The share of cENA molecules with free ends can be optionally increased by the action of DNA polymerase I from Escherichia coli in the presence of four deoxynucleoside triphosphates. The combined use of enzymatic exonuclease and polymerase leads to the removal of all 3' overhangs and the completion of all 5' overhangs. This ensures the maximum number of cDNA molecules in the subsequent binding reaction. The next stage of the method according to the invention involves processing the ends of the obtained cDNA in to obtain an appropriate sequence at each end containing a restriction endonuclease recognition site. The sequence of the section to be attached to the DNA ends is adjusted depending on the selected restriction endonuclease, and this choice in turn depends on the selection of the DNA transfer agent with which the cDNA is to be recombined. The selected plasmid should have at least one site sensitive to cleavage by a restriction endonuclease, e.g. plasmid pMB9 contains one recognition site for the Hind III enzyme. Hind III is isolated from Hemophllus influenzae and purified according to the method given by H.O. Snltha 1 K.W. Wllcox in J. Jfol. Biol. $51 379 (1970). The Hae III enzyme from Hemophilus aegyptious is purified using the method described by J.H. Middleton, M.H. Edgell and CA* Hutchison III in J. Virol. 10, 42 (1972). An enzyme from Hemophilus suis, designated Hsu I, catalyzes the same site-specific hydrolysis at the same recognition site as Hind III. The two enzymes are therefore functionally interchangeable. Conveniently, a chemically synthesized double-stranded decanucleotide containing the Hind III recognition site sequence is used to attach it to the ends of the double-stranded cDNA. The double-stranded decanucleotide has the sequence shown in Figure 1. See H.L. Heyneker et al., and R.H. Scheller, as above A variety of synthetic recognition site sequences are available so that it is possible to prepare the ends of the double DNA to be sensitive to any of a number of restriction endonucleases. Attachment of the recognition site sequence to the ends of the cDNA can be done in any known manner. way. The method of choice is the blunt-end reaction catalyzed by DNA ligase, purified by the method described by A. Panet et al. in Biochemistry, 12, 5045 (1973). Blunt-end binding reactions were described by V. Sgaramella et al., as above. The product of the blunt-end binding reaction between the blunt-ended cDNA and a double-stranded decanucleotide containing Hind III endonuclease recognition sites, used in large molar excess, is a cDNA having at each end a segment with the Hind III recognition site sequence. The result of the action of the endonuclease on the reaction product Hind III is cleaved at the recognition site, associated with the formation of single-stranded self-complementary 5*t ends as shown in Figure 1. 4. Preparation of a recombinant DNA-carrying plasmid. Basically, for the preparation of recombinants from cDNA produced in Many different viral and plasmid DNAs can be used as described above. The essential requirement is that the DNA transfer agent must be able to enter the host cell and then replicate within that cell. Moreover, it should have a genetic determinant thanks to which it is possible to select the host cells into which the factor has penetrated. However, for safety reasons, the scope of selection should be limited to those types of transfer agents that are considered appropriate for use in this type of experiment, in accordance with the above-mentioned N.I.H. guidelines. The list of approved DNA transfer agents continues to grow as new agents are discovered and approved by the NE! Racombinant DNA Safety Oommittee and it is clear that the invention covers the use of any viral12,142,369 and plasmid9 DNA that possesses the useful characteristics described, including those9 for which NIH approval may be granted at a later date* Suitable transfer agents that have recently been approved for use include a number of bacteriophage lambda derivatives (see e.g. F«R« ELatiner9 B«G. Williams, A.E. HLechl, K. Denniston-Thompson, H.E, Faber, L.A. Furlong, D.J. Grunwald, D.O. Kiefer, D.D. Moore, J#W. Schumm, E«L* Shelden and 0. Snithies, Science, 196, 161 (1977), and derivatives of the col EL plasmid, see, e.g., R.L. Rodriguez, S. Bolivar, H.M. Goodman, H.W. Boyer and M,N. Betlach, ICW-UCLA Symposlum on Nolecular Mechanism in the Contro1 of Gene Expression, ed. D.P. Nierlich, W.J. Rutter, C.F. Fox (Academic Press, NY, 1976) pp. 471-477 Elazmids derived from col'EL are characterized by relatively small sizes and have a molecular weight of several million 1 are characterized by the property that after treating host cells with chloramphenicol, the number of plasmid DNA copies per host cell may increase from 20-40, as is the case under normal conditions, to a thousand or more* Ability to multiply genes in allows the host cell, under appropriate conditions and control, to produce primarily proteins encoded by the genes introduced by the plasmid. For this reason, in the method according to the invention, the preferred transfer factors are col EL derivatives. Appropriate col EL derivatives include: plasmids: pMB-9 - carrying the tetracycline resistance gene and pBR-313f pBR-315f pBR-316, pBR-317 and pBR-322, which contain, in addition to the tetracycline resistance gene, also the ampicillin resistance gene The presence of drug resistance genes provides a convenient means of selecting cells successfully infected by the plasmid because colonies of such cells will grow in the presence of the drug, whereas cells that have not received the plasmid will neither grow nor form colonies. In the experiments described herein, as specific examples of the method according to the invention, a plasmid derived from col EL was used, containing, in addition to the drug resistance marker described above, also one Hind III recognition site.PLasemid pBR322 It is widely described* F* Bolivar et al. Gene 2, 95 (1977) described its synthesis and characterization. The molecular weight of plasmid pBR322 is 2.7 x 10 daltons {corrected; F. Bolivar, Gene 4, 121 (1978). it carries the ampicillin resistance gene (Ap) R R and the tetracycline resistance gene (Re). The Ap gene has one recognition site for the D Rst I endonuclease. The Tc gene has one recognition site for each of the Hind III, Sal I and Barn HI endonucleases. In addition, the pBR322 plasmid contains one Eco RI recognition site, two Hino II recognition sites, and five Eco recognition sites. RII, three Bgl I recognition sites, twelve Alu I recognition sites, twelve Hae II recognition sites, and seventeen Hae III recognition sites. A circular map of the recognition sites of the pBR322 plasmid is given on page 103 of the article by Bolivar et al. Ampicillin resistance disappears if pBR322 is cleaved at the Pst I site and DNA is incorporated there. Similarly, tetracycline resistance disappears if pBR322 is cleaved with Hind III, Sal I or Barn III endonuclease and incorporates ENA. After incorporation of DNA into the Ffct I site, recombinant molecules are isolated by p culture in ampicillin-sensitive (Ap) and tetracycline-resistant (Tc) colonies. Similarly, after incorporation of DNA into one of the Hind III, Sal I or Barn HI sites, the recombinant molecules are secreted by culturing in ampicillin-resistant but tetracycline-susceptible colonies. A transfer vector containing foreign DNA incorporated at one of these four sites may be described by p RS in terms of its drug resistance properties as Ap Tc" or Ap Tc. The transfer vector may be further characterized by removing the incorporated DNA and determining the molecular weights of both products compared to the molecular weights of the starting substances. Further characterization includes mapping the recognition sites of the transfer vector* In addition, the sequence of the incorporated IMA can be determined. An equally well-known plasmid is the pBR313 plasmid. Its synthesis and characterization were described by F. Bolivar 1 co., in Gene, 2, 73 (1977)* Plasmid pBR313 has a molecular weight of 5.8 x 10 daltons and carries the ampicillin resistance gene (Ap) and the totracycline resistance gene (Tc). pBR313 contains one the recognition site of Hind III, Sal I and Barn HI nucleases within the TcR gene. A thorough analysis of pBR313 using restriction endonucleases allowed for the preparation of a map of recognition sites, which is presented on page 84 of the article by Bolivar et al. as above. Incorporation of foreign DNA into any of the Hind III, Sal I or Barn HI sites causes the disappearance of Tc. Recombinant molecules are isolated by selecting ampicillin-resistant and tetracycline-sensitive strains. The drug resistance properties of the transfer vector as well as the sequence of the incorporated DNA recognition sites and the molecular weights can be determined as above. A third well-known plasmid is pMB9. It is obtained by the method given by R.L. Rodriguez et al.f. as above and F. Bolivar et al., Gene, 2, 75 (1977). ELazmid pMB9 has a molecular weight of 3.5 x 10 daltons, it carries the tetracycline resistance gene Tc Eb - it has one endonuclease recognition site for Eco RI, Hind III, Sal I and Barn HI. The last three recognition sites are located within the Tc gene. Incorporation of foreign DNA at any of the Hind III, Sal I or Bam Hi sites causes the disappearance of TcR. A transfer vector containing foreign DNA at one of these sites can be described in terms of this property. The vector can be further described by analyzing the sequence of the incorporated DNA, comparing molecular weights, and analyzing recognition sites, as above. The ELasemid pSClOl has been extensively described. Its synthesis and preliminary characterization are given by S. H. Cohen et al., Proc. Nat. Acad. Sci. USA, 70, 1293 (1973). Additional information can be found in S. N. Cohen et al., Iroc. Nat. Acad. Sci. USA, 70, 3240 (1973), H.W. Boyer et al., Recombinant Molecules, edited by R.F. Beers and E.G. Basset, Raven Fress, New York, p. 13 (1977) and S«N. Cohen et al., Recombinant Molecules, p. 91 pSClOl has a molecular weight of 5.8 x 10 Daltons and is the carrier of the tetracycline resistance gene (Tc). Within this gene there are single recognition sites for Hind III, Sal I and Bam HI endonucleases. .Rmadto pSClOl contains one Eco RI recognition site, one Hpa I site, one ana I site, and four Hinc II sites. Cleavage of pSClOl by Hind III, Sal I or Bam HI and incorporation at these DNA sites causes the disappearance of Tc Ib. By incorporation of DNA at one of the Hind III, Sal I or Bam HI sites, recombinant molecules are isolated by culturing in colonies sensitive to tetracycline. A transfer vector containing foreign DNA incorporated at one of these three sites can be characterized for drug resistance. This vector can be further characterized by a) removing the incorporated DNA, determining and comparing molecular weights, b) mapping the recognition sites, and c) determining the sequence of the incorporated DNA as given above. Bacteriophages useful in transfer vectors are a class of lamba phage derivatives called Charon, and especially Charon 3A, Charon 4A and Charon 16A. These phages have been well studied. HLatner et al., as above. described their synthesis and properties. On page 161 there is a physical map of them, including endonuclease recognition sites. The genotype of each of them is given on page 164, along with the results of cleavage with a given restriction endonuclease and the method of checking the effectiveness of cloning foreign DNA in them. For example, the incorporation of foreign DNA at the Eco Ri site of Charon 16A is manifested by the loss of the lac 5 gene. A solution of recombinant Lac bacterial phage produces colorless plaques. Thus, a transfer vector containing foreign DNA incorporated at the appropriate site can be characterized with respect to the genetic properties of the vector carrying, e.g. colorless plaques on the Lac bacteria. The transfer vector can be further characterized by removing the incorporated DNA and determining the molecular weights of the two products compared to the molecular weights of the starting elements. It is then possible to map the recognition sites of the transfer vector, as well as determine the sequence of the incorporated DNA.Redobnie-A gtWEs. and preliminary characterization described by Tremeier et al., Nature, 263, 526 (1976). Further characterization can be found in P. Lader et al., Science, 196, 173 (1977). In both of the above works, the genotype of this phage was determined. The second article also gives the positions of two Eco RI recognition sites and two Sst I sites. This phage also contains four Bam HI sites; 14,142,369 after hydrolysis, fragments with a length of 5.4 x 10, 19.3 x 10, 3 are obtained, 8 x 10 and 11.4 x 10 base pairs* Restriction endonuclease analysis is described on page 527 of the article by Tiemeier et al. Fragment A B It is removed by digestion with Eco RI and cleavage with Sst I. This procedure prevents recombination with the yL fragment B. Foreign DNA containing unpaired bases at the Eco RI site is incorporated into the phage at the Eco RI sites. The occurrence of recombinant clones in phages was examined by in situ hybridization, described by W.D. Benton and R.W. Davls, Science, 196, 180 (1977). The transfer vector can be characterized by a) removal of the incorporated DNA, determination and comparison of molecular weights, b) analysis using restriction endonucleases, and c) determination of the sequence of the incorporated DNA as above. Similar to the choice of plasmid, the choice of a suitable host is generally very wide, but significantly narrowed for safety reasons. The use of the E. coli strain designated X-1776 has become widespread and has been approved by the NIH for use in the described type of processes, provided that appropriate limiting conditions are ensured (E2). ferz: R. Curtiss III, Ann. Rev. Microbiol. 30, 507 (1976), E.coli RR-1 is suitable in this case where the limiting conditions (P3) can be maintained. As with plasmids, the invention covers all host cell strains that can be modified with the selected transfer agent, including protists other than bacteria, e.g., yeast, provided these strains have been approved for use in accordance with the guidelines. NIH* Recombinant plasmids are prepared by mixing plasmid DNA previously treated with a restriction endonuclease with cDNA with similarly treated end groups. In order to minimize the possibility of recombining the cDNA segments with each other, the plasmid DNA is introduced in a molar excess relative to the cDNA. In the case of previous methods, this resulted in most plasmids closing in a circular manner without the inclusion of the cDNA segment. As a result, the transformed cells contained mainly the plasmid rather than plasmids that had recombined with the cDNA, leading to a very tedious and time-consuming selection process. So far, this problem has been solved by trying to invent DNA transfer factors containing endonuclease recognition sites in the environment of the appropriate gene - marker, so that after the recombinant is incorporated, the gene is divided, thus causing the loss of the function encoded by the gene. Preferably, a method is used that allows for reducing the amount colonies, for screening of recombinant plasmids. This method involves treating the nicked restriction endonuclease of the plasmid DNA with alkaline phosphatase, an enzyme commercially available from various sources such as Worthigton Biochemical Corporation, Freehold, New Jersey. By the action of alkaline phosphatase, it is removed from the ends of the plasmid formed by endonucleases, 5' phosphate end groups, thus protecting the plasmid DNA from joining together. As a result, the formation of a circular structure, and hence the transformation, will result from the introduction of a DNA section containing terminal 5' phosphate groups. The described method allows to reduce the relative frequency of transformation without recombination to less than 1 in 10. The basis of the invention is the fact that a DNA ligase-catalyzed reaction occurs between the terminal 5' phosphate group of CNA and the terminal 3' hydroxyl group of DNA. If the terminal 5' phosphate group is removed, the coupling reaction will not occur. In case double-stranded DNA is to be joined, three situations are possible. As shown in Table 1.142 369 15 Table 1 I- case i.- Reagents ftroduct of the reaction catalyzed by DNA ligase 5' 5' -OH H^O^PO -options^ ho y -O-P-O— -O-P-O— 5' 3'/ -OH ¥3 P-0-- 5' II 5' -OH"1 OH- 3' -O-P-0 -OH HO— Y fiy iii y -OH - OH HO- HO - no reaction 3' l V of table 19, double-stranded DNA is schematically shown in parallel lines, while its end groups, 5' and 3'f, respectively, are marked as hydroxyl (OH) or phosphate (OPOA). In case I, 5# phosphates are present at both ends of the reactants, resulting in covalent bonding of both strands. In case II, only one strand to be bonded contains the terminal 5* phosphate, resulting in only one strand becoming covalently bonded, leaving the other strand discontinuous * Nothing covalently bonded remains connected to the bonded molecule thanks to hydrogen bonds between the complementary base pairs of opposite strands. This is a known phenomenon. In case III, none of the ends of the reactants contain phosphate, so the combination reaction cannot take place. Undesirable binding reactions can be prevented by removing the terminal phosphate groups from the appropriate ends of the reactants that we do not want to allow to join. Any suitable a method of removing 5* phosphate groups that does not damage the DNA structure. Hydrolysis catalyzed by the enzyme alkaline phosphatase is preferably used. To illustrate the methods described above, the isolated cDNA encoding rat growth hormone 1 was recombinant with a plasmid. DNA molecules were used to modify E. coli X-1776. Transformants were selected by growth on a medium containing tetracycline. It was found that the recombinant plasmid DNA obtained from cells modified by transformation contained an incorporated DNA segment of approximately 600 nucleotides. Other recombinant plasmids obtained by similar methods were also tested. The introduced sections were released from the plasmid by digestion with Hind III or HSU I endonuclease and subjected to DNA sequence analysis using the method described by A.M. Maxam and W. Gilbert in Proc, Nat. Acad. Sci. USA 7k9 5ft) (1977). The nucleotide sequence of the incorporated DNA segments was found to overlap with the entire RGH (rat growth hormone) coding region, as well as with part of the precursor peptide and part of the 5* untranslated region. The process described is generally useful for isolating and purifying the genes of a higher organism, including human genes, and transferring them to microorganisms and replicating them therein. New recombinant plasmids have been described, containing all or part of an isolated gene. New microorganisms, previously unknown in nature, have also been described, containing as part of their genetic equipment a gene from a higher organism.* The following part of the description contains examples describing each in detail stage of the process of isolating, purifying and transferring the gene to E. coli. The examples characterize recombinant plasmids containing the rat growth hormone gene and the human growth hormone gene, as well as new microorganisms containing the above genes. Example I. Synthesis and characterization of double-stranded cDNA containing the rat hormone sequence growth* The single-stranded cDNA is subjected to the action of reverse transcriptase to synthesize the complementary strand* The reaction mixture contains 50 mmol Tris-HCl, pH 8.3, 9 mmol FfeCl2, 10 mmol dithiothreitol, 50 mmol each of three unlabeled deoxyribonucleoside triphosphates, 1 mmol of nucleoside triphosphate labeled * P in the ot position with a specific activity of 1-10 Ci per millimol, 50 [mu]g/ml cDNA and 220 units/ml reverse transcriptase* The reaction mixture is incubated at 45°C for 120 minutes* The reaction is stopped by the addition EDTA-Na2 to a concentration of 25 millmol, the mixture is extracted with phenol and chromatographed on a Sephadex G-100 column, and then precipitated with ethanol* Samples of the obtained product with an activity of 500-1000 pulses/min. are analyzed by gel electrophoresis* The presence of a heterodisperse band with a length of about 450 nucleotides is confirmed by comparison with standard samples* DNA samples are digested separately with the participation of an excess of Hae III restriction endonuclease and analyzed similarly by electrophoresis on the gel* Both products are cleaved with an endonuclease so that in electrophoresis two bands of radioactivity are detected on the gel* The bands formed as a result of cleavage of double-stranded cDNA are cleavage products of essentially the same length as the products obtained as a result of cleavage of single-stranded cDNA. Example II. Hind III decanucleotide binding with the blunt end of double-stranded cDNA obtained as described in Example I above. The double-stranded reaction product obtained as described in Example I above, at a concentration of 2-5 [mu]g/ml, is treated with 30 units of SI nuclease activity 1200 U/ml manufactured by Miles Laboratories, ELkhart, Indiana, in a medium containing 0.03 m sodium acetate, pH 4.6, 0.3 m sodium chloride and 4.5 mmol ZnCl2 for 30 minutes, at 22° C, and then for 15 minutes at 10°C* Digestion is stopped by adding Tris-base to a final concentration of 0.1 m, EDTA to 25 mmol and tRNA from E. coli, obtained by the method of C. von Ehrenstein in Methods in Bizymology, ed* S.P. Oolowick and E*0* Kaplan, vol. 12 A, p. 558 (1967), to a concentration of 4Q ug/ml* R, extracted with phenol, the reaction mixture is chromatographed on a Sephadex G-100 column, and then * P-cDNA eluted in volume dead is precipitated with ethanol. As a result of this procedure, cDNA molecules with paired bases are obtained in high yield, which is necessary to attach a blunt end to chemically synthesized decanucleotides. Hind III decamers are obtained by the method described by R.H* Scheller, R.E. Dickerson, H.W. Boyer, A.D. Riggs and K. Itakure in Science 196, 177 (1977). The attachment of Hind III decamers to cDNA is carried out by incubation at 14°C for 1 hour in a medium containing 66 mmol Tris-HCl, pH 7.6, 6.6 mmol Hgd2, and mmol ATP, 10 mmol dithiothreitol, 3 mmol Hind III decamers. with activity of 10 pulses/min/pmol of 1 T4 DNA ligase, approximately 500 units/ml. The reaction mixture is then heated to 65°C for 5 minutes to activate the ligase. KCl is added to a final concentration of 50 mmol, 3-mercaptoethanol to a final concentration of 1 mmol, EDTA to a final concentration of 0.1 mmol, and digested with Hsu I or Hind III endonuclease at a concentration of 150 U/ml for 2 hours at 37°C. . Hind III and Hae III endonucleases are commercially available from New Bigland Bio-Labs, Beverly, Mass. The product is analyzed by gel electrophoresis and a peak corresponding to a sequence of approximately 600 nucleotides, plus fragments of cleaved Hind III decamers, is observed.142 369 17 Example III . Using the method given in Example III, Eco RI decanucleotides are combined with the blunt end of cDNA from Example I. Eco RI decamers are obtained according to the method given by Schneller et al. as above. They have the following sequence: 5-CCGAATTCGC-3' R connected to the blunt end, the product is digested with the Eco RIf endonuclease under reaction conditions the same as those given for Hsu I or Hind III. Eco RI is commercially available; it is also manufactured by New England Biolabs. The reaction product was analyzed by gel electrophoresis, observing a peak corresponding to the sequence of approximately 800 nucleotides, as well as fragments of cleaved Eco RI decamers. Example IV. Preparation of the recombinant plasmid and its characterization after replication. The pMB-9 DNA plasmid is prepared as described by R.L. Rodriguez, F. Bolivar, H.M. Goodman, H.W. Boyer and M. Betlach in 1CN-UCLA Symposium on Molecular and Cellular Biology, ed. D.F.Wierlich, W.J. Rutter and C.F. Pox (Academic Press, New York 1976) pages 471-477 and cleaves in the Hind III recognition site by the Hsu,I endonuclease, then alkaline phosphatase, BAPP type, Worthington Biochemical Corporation, Freehold, New Jersey, is used. The enzyme is included in the mixture reaction at a concentration of 0.1 U/microgram of DNA. These mixtures are incubated in the presence of 25 mmol of Tris-HCL, pH 8.0 for 30 minutes at 65°C, and then extracted with phenol to remove the phosphatase, R) ethanol precipitation, the DNA of the plasmid treated with phosphatase is introduced into the cDNA containing " sticky" Hind III ends in a molar ratio: 3 moles of plasmid per 1 mole of cDNA. The reaction mixture containing 66 mmol of Tris, pH 7.6, 6.6 mmol of Mg&2t, 10 mmol of dithiothreitol and 1 mmol of ATP is incubated for 1 hour at 14°C in the presence of T4 DNA ligase at a concentration of 50 U/ml. This mixture is then added directly to a suspension of E. coli X-1776 cells prepared for transformation as follows: the cells are grown at 37°C until approximately 2 x 10 cells are obtained/ ml, in 50 ml of medium containing: Tryptone 10 g/l, yeast extract 5 g/l, NaCl 10 g/l, NaCH 2 mmol, diaminopimelic acid 100 μg/ml and thymine 40 Alg/ml. The cells are separated by centrifugation at 5°C for 5 minutes at 5,000 x 6, resuspended in 20 ml of cold 10 mmol NaCl, centrifuged as before and resuspended in 20 ml of transformation buffer which contains 75 mmol CaCl2. 140 mmol NaCl and 10 mmol Tris, pH 7.59, leaving them on ice for 5 minutes. The cells are then centrifuged and resuspended in 0.5 ml of transformation buffer, which occurs after mixing 100 AL/L of the cell suspension with 50 AL of recombinant DNA (1 /Ug/ml). The mixture is incubated at 0°C for 15 minutes, transferred to 25°C for 4 minutes, and then incubated at 0°C for 30 minutes. The cells are then transferred to agar plates for growth under selective conditions. Recombinant plasmids are screened in the presence of tetracycline at a concentration of 5 micrograms/ml to detect the transformation of Hind III recognition sites. The selected recombinant plasmid, designated pAU-1, is isolated. Crude plasmid preparations, isolated from pAU-1 and containing 2-5 MB of DNA, are digested with excess Hsu I endonuclease. EDTA-Na2 up to 10 mmol (final concentration) and sucrose 1096 (weight/volume) (final concentration) are added and the mixture is separated on a Q% polyacrylamide gel. The presence of DNA is found in a place corresponding to DNA approximately 800 base pairs long. In a similar experiment, the plasmid pBR-322 is used as the transfer agent. All conditions are the same as described, except that the final selection of recombinant clones is carried out on plates containing ampicillin at a concentration of 20 Alg/ml. Example V. Isolation and purification of DNA containing the complete sequence of the structural RGH gene encoding rat growth hormone and the synthesis of a transfer agent containing the complete RGH structural gene and a method of modifying a strain of a microorganism so that it contains the RGH gene as part of its genetic makeup.18,142,369 In the event that non-human genes are used, U.S. Federal Safety Regulations do not require cDNA isolation with such a high degree of purity as required for human cDNA. Therefore, it is possible to isolate cDNA containing the complete RGH structural gene by isolating electrophoretically separated DNA of the expected length of approximately 800 base pairs, which was determined on the basis of the known length of the RGH amino acid chain. Rat pituitary cells in cell culture, a subclone of the GH-1 cell line, which can be obtained from American Type Culture Gollection, are used as the source of RGH mRNA* See A.H. Tashjian et al. Endochrinology 82, 342 (1968). In such cells growing under normal conditions, growth hormone mRNA constitutes only a small fraction, on the order of 1-3%, of the total poly-A-containing RNA. However, as a result of the synergistic action of thyroid hormone and glucocorticoids, the level of growth hormone mRNA increases above the level of other cellular mRNAs. RNA is obtained from 5 x 10 cells grown in suspension and induced to produce growth hormone by adding 1 mmol of dexamethasone and 10 mmol of L-triiodothyronine to the medium, 4 days before harvesting the cells. Lyadenylated RNA is isolated from the cytoplasmic membrane fraction of cultured cells in a known manner. See J.A. Martial, J.D. Baxter, H.M. Godman and P.H. Seeburg, Iroc. Nat. Acad. Sci. USA 74, 1816 (1977), and F.G. Bancroft, G.Wu and G. Zubay, Proc. Nat. Acad. Sci. U.S. 70, 3646 (1973). The mRNA is further purified and transcribed into double-stranded cDNA Essentially as described above in Examples I, II. After fractionation by gel electrophoresis, a faint but distinguishable band corresponding to DNA of approximately 800 base pairs is observed. The total amount of cDNA transcribed from the mRNA of cultured pituitary cells is subjected to the action of Hha I endonuclease, obtaining, after separation by electrophoresis, two large DNA fragments corresponding to approximately 320 nucleotides (fragment A) and 2^0 nucleotides (fragment B). Nucleotide sequence analysis of fragments A and B confirms that these fragments are indeed part of the RGH coding region, based on the published amino acid sequence of RGH and by comparison with the sequence of other known growth hormones, M. Wallis and R.V.N. Davies, Growth Hormone and Related Peptides, ed. A. Copecile and E.E. Muller, pages 1-14 (ELsevier, New York, 1976), and M.O. Dayhoff, Atlas of Protein Settlement and Structure, ,5, Suppl. 2, pp. 120-121 (National Biomedical Research Foundation, Washington, D.C. £197). Double-stranded cDNA with a length of 800 base pairs, isolated by the electrophoretic method as described above, is similarly subjected to the action of the Hha I endonuclease. Among the cleavage products, the presence of two fragments corresponding to the length of fragments A and B. Ebniewaz RGH cDNA with a length of approximately 800 base pairs has not been purified by restriction endonuclease treatment, treatment of the DNA to remove any unpaired single-stranded ends is necessary. In practice, the treatment aimed at removing such unpaired ends is carried out before the electrophoretic separation in a medium containing 25/Ul, 60 mmol of Tris-HCL, pH 7.5, 8 mmol of tfeClpt, 10 mmol of p-mercaptoethanol, 1 mmol of ATP and 200 dATP, dTTP, dGTP and dCTP. The mixture is incubated with 1 unit of E. coli DNA polymerase I at 10°C for 10 minutes, exonucleolytically removing all 3* overhangs and filling in all 5* overhangs. DNA Iblimerase I is commercially available from Boehringer-Mannheim Biochemicals, Indianapolis, Indiana. cDNA with a length of approximately 800 base pairs is processed by adding chemically synthesized Hind III decapeptides in the manner described above in Example II. FLazmid pBR-322 having an ampicillin resistance gene and single Hind III recognition sites located within the ampicillin resistance gene. tetracycline, is pretreated with Hind III endonuclease and alkaline phosphatase as described above in Example IV. The plasmid treated in this way is joined to the RGH cDNA of approximately 800 base pairs in a reaction mixture containing DNA ligase as described above in example II. The reaction mixture containing the ligase is used to transform a suspension of E. coli X-1776,142 369 19 cells treated as described in Example II above. Colonies of recombinants are selected by growth on plates with a medium containing ampicillin, taking advantage of the inability to grow on a medium containing tetracycline at a concentration of 20 µg/ml. Ten such colonies are obtained and all of them carry a plasmid with a segment of approximately 800 base pairs, which is released by cleavage with Hind III. RGH DNA of 800 base pairs is isolated in preparative quantities from the recombinant clone pRGH- 1. In this case, the nucleotide sequence includes part of the RGH untranslated region at the 5'f end as well as the sequence of 26 amino acids found in the growth hormone precursor protein by secretion. The mRNA sequence deduced from the gene sequence is shown in Table 2. The predicted amino acid sequence agrees well, with the exception of positions 1 and 8, with the partial amino acid sequence of rat growth hormone reported by Wallis and Davies, J.W. including residues 1-43, 65-69, 108-113, 133-143 and 150-190. Table 2 H -26 ^ Met Ala Ala Asp Ser Gin Thr Pro Trp Leu Leu Thr Phe Ser Leu Leu 5 GTGGACAGA TCACTGAGTGGCC ATG GCT GCA CAC TCT CAG ACT CCC TCG CTC CIG ACC TTC ACC CTG CTC 1 Cys Leu Leu Trp Pro Gin Glu Ala Gly Ala Leu Prc Ala Met Pro Leu Ser Ser Leu Phe Ala Asn Ala Val Leu TGC CTG CTG TGG CCT CAA GAG GCT GCT GCT TTA CCI GGC ATG CCG TTG TCC AGT CUG TTT GCC AAT GCT GTC CTC 20 40 Arg Ala Gin His Leu His Gin Leu Ala Ala Asp Thr Tyr Lys Olu Phe Glu Arg Ala Tyr Ile Pro Glu Gly Gin CGA GCC CAG CAC CTG CAC CAG CTG GCT GCT GAC ACC TAC AAA GAC TTC CAG CGT GCC TAC ATT GCC GAG GGA CAG 60 Arg Tyr Ser Ile Oln Asn Ala Gin Ala Ala Phe Cys Phe Ser Glu thr Ile Pro Ala Pro Thr Gly Lys Glu Glu CGC TAT TCC ATT GAG AAT GCC CAC CCT GCT TTC TGC TTC TGA GAC ACC ATC GCA GCC CCC ACG GGC AAC GAG GAG 80 Ala Gin Gin Arg Thr Asp Met Glu Leu Leu Arg Phe Ser Leu Leu Leu Ile Gin Ser Trp Leu Gly Pro Val Gin GCC GAG GAG AGA ACT GAC ATG GAA TTG GTT CGC TTC TCG GTG CTG CTC ATC GAG TGA TGG CTG GGG CCC GTG CAG 100 Phe Leu Ser Arg Ile Phe Thr Asn Ser Leu Met Phe Gly Thr Ser Asp Arg Val Tyr Glu Lys Leu Lys Asp Leu TTT GTC AGC AGG ATC TTT AGC AAC AGC CTG ATG TTT GCT ACC TGG GAC CGC GTC TAT GAG AAA CTG AAC GAC CTG 120 140 Glu Glu Gly How Much Gin Ala Leu Met Gin Glu Leu Glu Asp Gly Ser Pro Arg How Much Gly Gin How Much Leu Lys Gin Thr GAA GAG GGC ATC CAG GCT CTG ATG GAG CAG CTG GAA CAC GGC AGC CCC CGT ATT GCG CAC ATC CTC AAG CAA ACC 160 Tyr Asp Lys Phe Asp Ala Asn Met Arg Ser Asp Asp Ala Leu Leu Lys Asn Tyr Gly Leu Leu Ser Cys Phe Lys TAT GAC AAG TTT GAC CCC AAC ATG CGC AGC GAT GAC GCT CTG CTC AAA AAC TAT GGG CTG CTC TCC TGC TTC AAG 180 Lys Asp Leu His Lys Ala Glu Thr Tyr Leu Arg Val Met Lys Cys Arg Arg Phe Ala Glu Ser Ser Cys Ala Phe AAG GAC CTG CAC AAG GCA GAG ACC TAC CTG CGG GTC ATC AAG TGT CGC CCC TTT GCG GAA AGC AGC TCT GCT TTC TAG GCACACACTGGTGTCTCTGCGGCACTCCCCCGTO^ ATCATATC poly/A/ 3*20 142 369 Table 2 gives the sequence of one DNA strand containing the complete RGH coding sequence. The appropriate amino acids are shown along with numbers indicating their positions relative to the amino terminus. Amino acids numbered with a negative number represent the pre-growth hormone sequence. The corresponding mRNA sequence is the same, with the difference that in the case of mRNA, instead of T, there is U*. Example 1* a) The procedure from Example Vt is repeated using the pMB-9 DNA plasmid, obtained by the method of Rodriguez et al., in site of the pBR322 DNA plasmid. Conditions apply as described above, except that selection and screening are carried out as given in Example IV. The incorporated fragment is removed as indicated above, obtaining DNA of approximately 600 base pairs in length and with the sequence given in Table 2. b) The procedure from Example V is repeated, using the pSClOl DNA plasmid, obtained by the method of Cohen et al. , Iroc. Natl. Acad. Sci., USA 70, 1293 (1973), in place of the pBR322 DNA plasmid. The above-mentioned conditions apply and selection and screening are performed as in the case of pMB-9. The incorporated fragment is removed according to the above method, obtaining DNA with a length of about 800 base pairs and with the sequence given in Table 2. c) The procedure from Example V is repeated using the pBR313 DNA plasmid, obtained by the method given by Bolivar et al., Gena 2, 75 (1977) in place of the pBR322 DNA plasmid. The incorporated fragment is removed as indicated, obtaining a DNA of approximately 800 base pairs in length and with the sequence given in Table 2#. Example VII. The procedure of Examples V and VI is repeated, using E. coli HU and E. coli HB101 in place of E. coli X-1776. Applying the same conditions and obtaining the same results. Example VIII. The RGH-cDNA produced in Example V is treated with synthetically prepared fragments containing the Eco RI cleavage grinder as described in Example II. a) Charon 16A EWA prepared by the method of Blattner et al. is used as a transfer vector. Eco RI-treated RGH-cDNA is incorporated into the Eco RI site of Charon 16A. Recombinant phages are isolated and screened. The incorporated fragment is removed to obtain DNA with a length of approximately 800 base pairs and the sequence given in Table 2. b) Charon 3A phage is used as the transfer vector. DNA obtained by the method described by Blattner et al. RGH-cDNA treated with Eco RI is incorporated into Charon 3A , recombinant phages are isolated, screened and the incorporated fragment is removed. The DNA obtained is approximately 800 base pairs long and has the sequence given in Table 2. c) A gtWES is used as the transfer vector. A B DNA prepared according to the method given by TLemeier et al. RGH-cDNA treated with Eco RI is incorporated into this vector, recombinant phages are isolated, screened and the incorporated fragment is removed. DNA is obtained with a length of about 800 base pairs and with the sequence given in table 2. Example IX. The procedure of Example VIII is repeated, using E. coli RR1, E. coli HB101, E. coli DF50 and E. coli DF50SupF in place of E. coli X-1776. The same conditions are used and the same results are obtained. Example genetic. Isolation of HGH mRNA is basically carried out as described above in Example V, with the difference that human pituitary tumor tissue is used as the source of biological material. Five human pituitary tumors, snap-frozen in liquid nitrogen after surgical removal, each weighing 0.4 to 1.5 g, are thawed and homogenized in 4 m guanidinium cyanate containing 1 m mercaptoethanol, buffered to pG 5.0 and temperature 4°C. The obtained homogeneous mixture is applied to a layer of 1.2 ml of 5*7 m CSCL containing 1^2 369 21 or 100 mmol of EDTA and centrifuged for 18 hours at 15° (at 37,000 rpm, using a Beckman ultracentrifuge). SW50, 1 (Beckman Instrument Company, Fullerton, California). RNA moves to the bottom of the tube. Further purification using an oligo-dT column and sucrose gradient sedimentation is performed as described above in Examples I and II. Approximately 10# yes The isolated RNA encodes growth hormone as judged by the incorporation of precursor radioactive amino acids into the antigrowth hormone precipitated material in a cell-free translation system obtained from wheat germ. Ffetrz: B. E. Roberts and B. M. ftitterson. Proc. Nat. Acad Sci. USA 70, 2330 (1973) HGH cDNA extraction is carried out essentially as described above in Example V. HGH cDNA is fractionated by gel electrophoresis and the material migrates over a distance corresponding to a length of approximately 800 nucleotides. is isolated for cloning. The isolated fraction is treated with polymerase I ENA as described below in the example of human insulin. Human islet cells are separated from human pancreatic tissue. The source of pancreatic tissue may be donated pancreas, fresh cadavers, or human islet tumor. Islet cells isolated from several pancreases are homogenized in 0.2 mL guanidinium thiocyanate solution containing 0.2 mL of 5-mercaptoethanol, pH = 5.0, as described in Example I. Baliadenylated RNA is isolated chromatographically according to the method of Aviv and Leder. , as above Single-stranded DNA is obtained using reverse transcriptase and hydrolyzed mRNA. IX*unit cDNA is obtained using transcriptase as described in Example I and digested with SI nukelase as described in Example II. Fragments containing Hind III cleavage sites are added to double-stranded human insulin cDNA, as indicated in Example III. The product is digested with Hind III or Hsu I endonuclease and analyzed according to the method given in Example II. A peak corresponding to a sequence of approximately 450 nucleotides is observed, as well as fragments of cleaved Hind III decamers. Human insulin cDNA containing sticky ends at the Hind III site is incorporated into the pMB-9 plasmid as described in Example IV. E. coli X-1776 is transformed and recombinant plasmids are screened as described in Example IV. The incorporated fragment is removed using Hsu I and analyzed as in Example IV. DNA containing approximately 450 nucleotides is recovered. The cloned human insulin is found to contain nucleotides encoding the complete amino acid sequence of human insulin. The known amino acid sequence of the A chain of human insulin is as follows: 1 10 GLy-He- Val-GLu-Gln-Cys-Cys-Thr-Ser-ILe-Cys-Ser-Leu-Tyr- 2o Glu-Leu-du-Asn- iyr-cys-Asn. The known amino acid sequence of the B chain of human insulin is as follows: 1 10 Rie-Val-Asn-Glu-His-Leu-Cys-cay-Ser-His-Leu-Val-GIu-Ala- 20 Leu-Tyr-Leu-Yal-Cys-GaLy-ca-U-Arg-Gly-Rie-Hie-Tyr-lhr-Pro- 30 Lys-TJir. The numbering of the amino acid sequence starts from the end with a free amino group. Then it is rotation consisting in the addition of Hind III decapeptides to its ends, and then the cDNA is recombined with the pBR-322 plasmid, previously treated with alkaline phosphatase, using DNA enzyme. E.coli X-1776 cells are transformed with recombinant DNA and a strain containing ENA HGH is isolated. The strain containing ENA HGH grows in active quantities of 22,142,369. HGH DNA is isolated from it and its nucleotide sequence is determined. it is found that the HGH DNA after cloning contains nucleotides encoding the complete amino acid sequence of HGH. The first 23 amino acids of HGH are: HgN-Rie-fro-ltir-rLe-Pro-Leu-Ser-Arg-Leu-Hie-Asp-Asn-Ala- 20 Met-Leu-Arg-Ala-His-Arg-Leu-His -Gln-Leu- Ri The remaining part of the sequence is shown in Table 3, which gives the nucleotide sequence of one strand of HGH DNA. The numbers refer to the HGH amino acid sequence starting from the amino end. mRNA instead of I there is U.Table 3 24 34 40 43 Ala Phe Asp Thr Tyr Gin Glu Phe Glu Glu Ala Tyr How much Pro Lys Glu Gin Lys Tyr Ser Phe Leu 5? -G CCC TTT GAC ACC TAG CAG GAC TTT GAA GAA GCC TAT ATC CCA AAG GAA GAG AAG TAT TCA TTG CTG 60 Gin Asn Pro Gin Thr Ser Leu Cys Phe Ser Glu Ser Ile Pro Thr Pro Ser Asn Arg Glu Glu Thr CAG AAC CCC GAG ACC TCC CTC TGT TTC TGA GAG TCT ATT CCG ACA CCC TCC AAC AGG GAG GAA ACA 80 Gin Gin Lys Ser Asn Leu Glu Leu Leu Arg Ile Ser Leu Leu Leu Ile Gin Ser Trp Leu Glu Pro CAA CAG AAA TCC AAC CTA GAG GTG CTC CGC ATC TGC CTG CTG CTC ATC CAG TGC TGG CTC GAC CCC 100 Val Gin Phe Leu Arg Ser Val Phe Ala Asn Ser Leu Val Tyr Gly Ala Ser Asp Ser Asn Val Tyr GTG CAG TTC CTC AGG AGT GTC TIC CCC AAC AGC CTG GTG TAC GCC GCC TCT GAC AGC AAC GTC TAT 120 Asp Leu Leu Lys Asp Leu Glu Olu Gly Ile Gin Thr Leu Met Gly Arg Leu Glu Asp Gly Ser Pro GAC CTG CTA AAG GAC CTA GAG GAA GGC ATC CAA ACC CTG ATG GCG AGG CTG GAA GAC GGC AGC CCC 140 Arg Thr Gly Gin How much Phe Lys Gin Thr Tyr Ser Lys Phe Asp Thr Asn Ser His Asn Asp Asp Ala CCG ACT GGC CAC ATC TTC AAG CAG ACC TAC ACC AAG TTC GAC AGA AAC TCA CAC AAC GAT GAC GCA 160 Leu Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe Arg Lys Asp Met Asp Lys Val Glu Thr Phe Leu . CTA CTC AAG AAC TAC GGG CTG CTC TAC TGO TTC AGG AAG GAC ATG GAC AAG GTC GAG ACA TTC CTC 180 191 Arg Ile Yal Gin Cys Arg Ser Val Glu Gly Ser Cys Gly Phe CGC ATC GTG GAC TGC GGC TCT GTG GAG GGC AGC TCT GGC TTC TAG CTGCCCGGGTGGCATCCCTGTGACCCC TCCCCAGTGGCTCTCCTGGCC 3* Example XI# a) The procedure of Example that the final selection and screening is carried out as described in Example IV. The incorporated fragment is removed as described, obtaining a DNA of approximately 800 base pairs in length and with the sequence given in Example X.142 369 23 b) The procedure of Example .tFroc. Natl. Acad. Sci USA, 70, 1293 (1973), in place of the pBR322 DNA plasmid. The conditions given above apply, and selection and screening are carried out as described for pMB-9. The incorporated fragment is removed as described, obtaining DNA of approximately 800 base pairs in length and with the sequence given in Example X. c) The procedure is repeated with of Example All conditions including final selection are as stated. The incorporated fragment is removed as described, giving an ENA of approximately 800 base pairs in length, with the sequence given in Example X. Example XII. The procedure of Examples X and XI is repeated, using E. coli BR1 and E. coli HB 101 in place of E. coli X-1776. The same conditions apply and the same results are obtained. Example XIII. HGH-cDNA prepared as in Example X is treated with chemically prepared fragments containing Eco RI cleavage sites as described in Example III. a) HGH-cDNA treated with Eco RI is incorporated into Charon 16A DNA as described in Example 8. Recombinant phages are isolated and screened, the incorporated fragment is removed, obtaining DNA of approximately 800 base pairs in length and with the sequence given in example ). Recombinant phages are isolated and screened, and the incorporated fragment is removed according to the method given in Example VIII bj. A DNA of approximately 800 base pairs is obtained with the sequence given in Example X. c) HGH-cDNA treated with Eco Rl is incorporated into the 7L gtWES DNA. Ji B according to the method given in Example VIII (c). Recombinant phages are isolated and screened according to the method given in Example VIII c). The incorporated fragment is removed according to the method given in Example VIII c), obtaining a DNA of approximately 800 base pairs in length and with the sequence given in Example X. Example XIV. The procedure of Example XI is repeated, using E. coli RFfl., E. coli HB101. E.coli PD50 and Eicoli DDP50SupF in place of E.coli X-1776. The same conditions are used and the same results are obtained. Carrying out the process according to the invention makes it possible, first of all, to isolate a nucleotide with a sequence coding specific regulatory proteins of higher organisms such as vertebrates and to transfer the genetic information regarding these proteins to microorganisms in which it can be it can be replicated without restrictions. The method according to the invention can be used to isolate and purify the human growth hormone gene and transfer it to a microorganism. Similarly, genes for other proteins can be isolated, transferred and replicated in microorganisms. The practical application of the method according to the invention is illustrated by demonstrating the transfer of a rat growth hormone gene to an E. coli strain. In each case, the sequence of the main part of the transferred gene was determined and it was found to encode the complete amino acid sequence of rat growth hormone, as determined on the basis of the known genetic code existing in all forms of life. Patent claims 1. Method of producing a bacterial plasmid containing a nucleotide sequence coding for growth hormone , by extraction of the mRNA encoding the given peptide from cells isolated from the hormone-producing organism, isolating the mRNA, synthesizing the first strand of cDNA with the nucleotide sequence encoding! this peptide on mRNA as a template, synthesis of the second strand of cDNA on the first strand as a template to produce double-stranded DNA and attachment of this DNA to a bacterial plasmid, characterized in that a) cells isolated from an organism producing growth hormone are homogenized in the presence of an RNAase-inhibiting composition containing a chaotropic anion and a chaotropic cation and an agent that cleaves disulfide bonds, b) polyadenylated mRNA is separated by extraction from the remaining components of homogenized cells, c) the isolated mRNA is incubated with reverse transcriptase in the presence of dATP, dCTP, dGTP and dTTP, d) the produced cDNA strand encoding the growth hormone is incubated with reverse transcriptase or DNA polymerase in the presence of dATP, dCTP, dGTP and dTTP, e) the ends of the resulting double-stranded DNA are joined in a known manner by joining sequences complementary to the ends remaining after cleavage, the restriction endonuclease selected for cleaving the E. coli bacterial plasmid to which the double-stranded DNA is to be attached, f) the bacterial plasmid is cleaved, the selected restriction endonuclease and the split plasmid are subjected to the action of alkaline phosphatase, and g ) the double-stranded DNA containing the linking sequence is incubated and the alkaline phosphatase-treated plasmid is incubated in the presence of DNA ligase and ATP to produce a bacterial plasmid with a nucleotide sequence encoding the growth hormone, 2. The method according to claim 2. 1, characterized in that the E. coli bacterial plasmid is cleaved with the restriction endonuclease Hind III, Hsu I or EcoRl at a temperature of 37°C and a pH value of 7.6. 3. The method according to claim 1, characterized in that the 5'-terminal phosphorus groups of the split E. coli bacterial plasmid are removed by treating it with an alkaline phosphatase. 4. The method according to claim 1 or 2, the plasmid pBR322 is used from E. coli. 5. The method according to claim 1 or 2, the plasmid pMB9 is used for E. coli. c, mRNA alternating in that As a plasmid bacte- (A) 3' ( (A) 3' ( IT)5' and -3' T SCCAAGCTTGG JGGTTCGAACC 5'pAGCTTTGG- 3'ACC- ITI5 ' ls: -|A)3' -IT)5' 5ohAGCTT 37V UDNA .5CCAAGCTTGG3' l 3'GGTTCGAACC5' {A)0CAAGC^GG3, lT)uGTTCGAACC5, (AICCA3* (TIGGTTCGApS' -TTCGAoh5' AAGCTTGG TTCGAACC cONA (AICCAAGCTT (T)GGTTCGAA DNA Pncownia Poligraficzna UP PRL. Edition 100 copies. Price PLN 400 PL PL PL PL

Claims (5)

1. Patent claims 1. Method of producing a bacterial plasmid containing a nucleotide sequence encoding a growth hormone by extracting the mRNA encoding a given peptide from cells isolated from an organism producing the hormone, isolating the mRNA, synthesizing the first strand of cDNA with the nucleotide sequence encoding it! this peptide on mRNA as a template, synthesis of the second strand of cDNA on the first strand as a template to produce double-stranded DNA and attachment of this DNA to a bacterial plasmid, characterized in that a) cells isolated from an organism producing growth hormone are homogenized in the presence of an RNAase-inhibiting composition containing a chaotropic anion and a chaotropic cation and an agent that cleaves disulfide bonds, b) polyadenylated mRNA is separated by extraction from the remaining components of homogenized cells, c) the isolated mRNA is incubated with reverse transcriptase in the presence of dATP, dCTP, dGTP and dTTP, d) the produced cDNA strand encoding the growth hormone is incubated with reverse transcriptase or DNA polymerase in the presence of dATP, dCTP, dGTP and dTTP, e) the ends of the resulting double-stranded DNA are joined in a known manner by joining sequences complementary to the ends remaining after cleavage, the restriction endonuclease selected for cleaving the E. coli bacterial plasmid to which the double-stranded DNA is to be attached, f) the bacterial plasmid is cleaved, the selected restriction endonuclease and the split plasmid are subjected to the action of alkaline phosphatase, and g ) the double-stranded DNA containing the connecting sequence is incubated and the plasmid treated with alkaline phosphatase in the presence of DNA ligase and ATP to produce a bacterial plasmid with a nucleotide sequence encoding the growth hormone, 2. The method according to claim 1, characterized in that the E. coli bacterial plasmid is cleaved with the restriction endonuclease Hind III, Hsu I or EcoRl at a temperature of 37°C and a pH value of 7.6. 3. The method according to claim 1, characterized in that the 5'-terminal phosphorus groups of the split E. coli bacterial plasmid are removed by treating it with an alkaline phosphatase. 4. The method according to claim 1 or 2, the plasmid pBR322 is used from E. coli. 5. The method according to claim 1 or 2, the plasmid pMB9 is used for E. coli. c, mRNA alternating in that As a plasmid bacte- (A) 3' ( (A) 3' ( IT)5' and -3' T SCCAAGCTTGG JGGTTCGAACC 5'pAGCTTTGG- 3'ACC- ITI5 ' ls: -|A)3' -IT)5' 5ohAGCTT 37V UDNA .5CCAAGCTTGG3' l 3'GGTTCGAACC5' {A)0CAAGC^GG3, lT)uGTTCGAACC5, (AICCA3* (TIGGTTCGApS' -TTCGAoh5' AAGCTTGG TTCGAACC cONA (AICCAAGCTT (T)GGTTCGAA DNA Pncownia Poligraficzna UP PRL. Edition 100 copies. Price PLN 400 PL PL PL PL