OA20986A

OA20986A - Salivary biomarkers of brain injury.

Info

Publication number: OA20986A
Application number: OA1202100373
Authority: OA
Inventors: Antonio BELLI; Valentina Di Pietro
Original assignee: Marker Diagnostics Uk Limited
Priority date: 2019-02-14
Filing date: 2020-02-14
Publication date: 2023-08-24

Abstract

Methods of diagnosing, monitoring, treating, and predicting the course of traumatic brain injury (TBI), including mild traumatic brain injury (mTBI), include determining a level of at least one RNA biomarker (e.g., miRNA) in a saliva sample from a subject. Also described are sensor elements, detection systems, compositions, and kits for diagnosing, monitoring, treating, and predicting the course of TBI.

Description

SALIVARY BIOMARKERS OF BRAIN INJURY

FIELD

The présent invention relates to compositions, kits, Systems and methods for diagnosing and/or monitoring brain injury, including, without limitation, traumatic b ram injury (TBI). More particuiarly, the présent invention relates to the diagnosis and monitoring of TBI using RNA biomarkers.

BACKGRÛUND

Traumatic brain injury (TBI) is the leading cause of death and disability under the âge of 45 years in Western countries. Its healthcare burden and social costs are expected to continue to rise and, by 2020, the World Health Organization projects TBI to become the third leading cause of disability worldwide.

Despîte many studies, no reliable biomarkers hâve been found to assess the severity of TBI and predict recovery. This is especially true for mild TBI (mTBI), which remains currently dîfficult to assess in clinical practice. Although TBI patients are initially assessed by the Glasgow Coma Score (GCS) and neuroimaging techniques, which requîre costly equipment, the current diagnostic tools are lacking in the ability to precisely defîne and quantify the actual severity of the brain injury, thus leading to an easy détection of severe but not of mTBI, which represents the vast majority of cases (75-90%).

The correct diagnosis of mTBI is particuiarly important in patients, such as athlètes, soldiers and children, who are at greater risk of répétitive mTBI and a catastrophic form of brain injury known as second impact syndrome (SIS) where the synergistic effects of repeated TBI resuit in profound damage and even death. Early diagnosis and évaluation of the severity of TBI thus becomes crucial for patients' wellbeing and ultimately saving their life.

The subject technology was devised with these issues in mind.

SUMMARY

The disclosure provides methods and détection Systems relating to diagnosing, monitoring, and treating traumatic brain injury (TBI) including mild traumatic brain injury (mTBI) in a human subject who has suffered an injury to the head by detecting one or more miRNA molécules in a bioiogical sample from the subject. In the context of the foliowing disclosure, the tenus Tevel’ and ‘amount’ in référencé to the level or amount of an miRNA molécule or molécules in a bioiogical sample are used interchangeably.

In one aspect, the disclosure relates to a method of diagnosing and treating traumatic brain injury (TBI) in a human subject in need thereof. The method involves: obtaining a saliva

- 1 20986 sample from the subject; contacting the saliva sample with a probe comprising a nucleic acid able to bind to ai least one RNA biomarker: (a) selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-16-l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, put-miR-323, put-miR-325, put-mîR-444, put-miR-465, put-miR-469, put-miR-594, put-miR-856, put-miR893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNAl 20-AlaAGC, tRNAl 8-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJGI, YRNA-245, and YRNA-684, or any combination thereof; and/or (b) selected from the group consisting of put-miR-1003, put-miR-1080, putmiR-1084, put-miR-1 146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, putmiR-468, put-miR-476, put-miR-6, put-miR-71, put-miR-742, put-miR-806, put-miR-92_s putmiR-961, RNLJ6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof; determinîng an amount of the at least one RNA biomarker ip the saliva sample; identifying the subject as having TBI where the amount of the at least one RNA biomarker is increased or decreased relative to a predetermined threshold value or relative to the amount of the RNA biomarker in a control sample; and treatîng the|subject identified as having TBI according to one or more of thefollowing: subjecting the subject to a verbal, cognitive, motor, or optical test, or any combination of the foregoing; subjecting the subject to diagnostic imaging in the form of a CT or MRI, or a combination thereof; and/or administering to the subject one or more neuroprotective thérapies.

In certain embodiments of this method, the at least one RNA biomarker further comprises one or more miRNA: (a) selected from the group consisting of hsa-let-7î-5p, hsa-mîR-107, hsamiR-126-5pl(=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-1433p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b-3p, hsa-miR425-5p, hsa-miR-449a, hsa-miR-671 -3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or (b) selected from the group consisting of hsa-let-7a-5p, hsa-let-7b5p, hsa-let-7f-5p, hsa-miR-103a-3p, hsa-miR-21-5p, and hsa-miR-92a-3p, or any combination thereof.

In another aspect, the présent disclosure relates to a method of diagnosing and/or monitoring traumatic brain injury (TBI) in a subject. This method involves: determinîng a level of at least one RNA biomarker in a saliva sample obtained from the subject, wherein the at least one RNA biomarker: (a) selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-16-l-3p, hsamiR-339-5p; hsa-miR-497-5p, put-mîR-1204, put-mîR-323, put-miR-325, put-miR-444, put

-220986 miR-465, put-miR-469, put-miR-594, put-miR-856, put-miR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNA120-AlaAGC, tRNA18-ArgCCT, tRNA27-MetCAT, tRNA2LeuTAA, tRNA73-ArgCCG, tRNAS-ThrAGT, tRNA9-TyrGTA, U2.3,U4.64,U6.168,U6.601, UC022CJG1, YRNA-245, and YRNA-684, or any combination thereof; and/or (b) selected from the group consisting of put-miR-1003, put-miR-1080, put-miR-1084, put-miR-1146 (2), put-miR-1207, put-miR4306, put-miR-188, put-miR-209, put-miR-468, put-miR-476, put-miR6, put-miR-71, put-miR-742, pLit-miR-806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, R^U6-7, RNU6-73, U6.1249, U6.375, U6.428, and YRNA-255, or any combination thereof.

In one embodiment of this method, the at least one RNA biomarker further comprises one or more miRNA: (a) selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsa-miR126-5p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-143-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b-3p, hsa-miR-4255p, hsa-miR-449a, hsa-miR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or (b) selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f5p, hsa-miR-103a-3p, hsa-miR-21-5p, and hsa-miR-92a-3p, or any combination thereof.

In another aspect, the présent disclosure relates to a sensor element for a détection System for diagnosing and/or monitoring TBI, the sensor element comprising a substrate functionalized with a probe: spécifie for at least one RNA biomarker: (a) selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5 p (=miR-144*), hsa-miR-16-l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, put-miR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-469, put-miR-594, put-miR-856, put-mîR893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNA120-AlaAGC, tRNA18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNAS-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA-245, and YRNA-684, or any combination thereof; and/or (b) selected from the group consisting of put-miR-1003, put-miR-1080, putmiR-1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-mîR-209, putmiR-468, put-miR-476, put-miR-6, put-miR-71, put-miR-742, put-miR-806, put-miR-92, putmîR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof.

In one embodiment of the sensor element, the at least one RNA biomarker further comprises one or more miRNA: (a) selected from the group consisting of hsa-let-7i-5p, hsamiR-107, hsa-miR-126-5p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-143-3p (^:=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b3p, hsa-miR-425-5p, hsa-miR-449a, hsa-miR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or

-3 I any combination thereof; and/or (b) selected from the group consisting of hsa-let~7a-5p, hsa-let7b-5p, hsa-let-7f-5p, hsa-miR-103a-3p, hsa-miR-21-5p, and hsa-mîR-92a-3p, or any combination thereof.

In another aspect, the présent disclosure relates to a détection System for diagnosing and/or monitoring TB1, comprising: a sensor element according to the présent disclosure, and a détection device capable of detecting the binding of a target RNA biomarker to the probe.

In another aspect, the présent disclosure relates to a method for determining a course of action for a subject suspected of having TB1, comprising applyîng a saliva sample obtaincd from the subject to a détection system according to the présent disclosure, and if an upregulated level or a downregulated level of the at least one RNA biomarker is detected, providing a treatment for TBI.

In another aspect, the présent disclosure relates to a method of treating a subject with suspected TBI. This method in volves: determining wh ether an upregulated level or a downregulated level of at least one RNA biomarker: (a) selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-16-l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, put-miR-323, put-miR-325, put-miR-444, put-miR-465, put-mîR-469, put-miR-594, put-miR-856, put-miR893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNA 120-AlaAGC, tRNA18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA-245, and YRNA-684, or any combination thereof; and/or (b) selected from the group consisting of put-miR-1003, put-miR-1080, putmiR-1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, putmiR-468, put-miR-476, put-miR-6, put-miR-71, put-miR-742, put-miR-806, put-miR-92, putmiR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof, is détectable in a saliva sample obtained from the subject, and if an upregulated level or a downregulated level of at least one RNA biomarker is detected, providing treatment for TBI to the subject.

In one embodiment of this method, the at least one RNA biomarker further comprises one or more miRNA: (a) selected from the group consisting of hsa-let-7i-5p, hsa-mîR-107, hsa-miR126-5p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-143-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b-3p, hsa-miR-4255p, hsa-miR-449a, hsa-miR-671-3p, hsa-miR-6748-3p, and hsa-mîR-934, or any combination thereof; and/or (b) selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f5p, hsa-miR-103a-3p, hsa-miR-21-5p, and hsa-miR-92a-3p, or any combination thereof.

-420986

In another aspect, the présent disclosure relates to a method of detecting an RNA biomarker in a saliva sample. This method involves: obtaining a saliva sample from a human subject, contacting the saliva sample with at least one oligonucleotide primer complementary to at least one RNA biomarker: (a) selected from the group consisting of hsa-miR-1246, hsa-miR126Ap (miR-126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5 p (=miR-144*), hsa-miR-16-13p, hsa-miR4339-5p, hsa-miR-497-5p, put-miR-1204, put-miR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-469, put-miR-594, put-miR-856, put-miR-893, put-mîR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNAI20-AlaAGC, tRNA18-ArgCCT, tRNA27-MetCAT, tRNA2LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA-245, and YRNA-684, or any combination thereof; and/or (b) selected from the group consisting of put-miR-1003, put-miR-1080, put-miR-1084, put-miR-1146 (2), put-miR-1207, p ut-mi R-1306, put-miR-188, put-miR-209, put-miR-468, put-miR-476, put-miR6, put-miR-71, put-miR-742, put-miR-806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, Ü6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof; amplifying the at least one RNA biomarker using a polymerase chaîn reaction; and detecting the amplified RNA biomarker.

In one embodiment of this method, the at least one RNA biomarker further comprises one or more miRNA: (a) selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsa-miR126-5p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-143-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b-3p, hsa-miR-4255p, hsa-miR-449a. hsa-mîR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or (b) selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f5p, hsa-miR-103 a-3p, hsa-miR-21-5p, and hsa-miR-92a-3p, or any combination thereof.

In another aspect, the présent disclosure relates to a kit for use in a method of diagnosing and/or monîtoring traumatîc brain injury (TB1) in saliva from a human subject, the kit comprising at least one probe spécifie for ai least one RNA biomarker: (a) selected from the group consisting of hsa-miR-1246, hsa-miR-I26-3p (miR-126*), hsa-miR-144-3p (miR-144*), hsa-miR- 144-5p (=mîR-144*), hsa-miR-16-l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR1204, put-miR-323, put-mîR-325, put-miR-444, put-miR-465, put-miR-469, put-miR-594, putmiR-856, put-miR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNA120-AlaAGC, tRNA18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA-245, and YRNA-684, or any combination thereof; and/or (b) selected from the group consisting of put-miR-1003, putmiR-1080, put-miR-1084, put-miR-l 146 (2), put-miR-1207, put-miR-1306, put-miR-188, putmiR-209, put-miR-468, put-miR-476, put-miR-6, put-miR-71, put-miR-742, put-miR-806, put

-5I miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof.

In one embodiment of this kit, the at least one RNA biomarker further comprises one or more miRNA: (a) selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsa-miR126-5p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-143-3 p (=miR-143); hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b-3p, hsa-miR-4255p, hsa-miR-449a, hsa-miR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or (b) selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7t5p, hsa-miR-103a-3p, hsa-miR-21 -5p, and hsa-miR-92a-3p, or any combination thereof

In another aspect, the présent disclosure relates to a composition for use in a method of diagnosing and/or monitoring traumatic brain injury (TBI) in saliva from a human subject, the composition comprising at least one probe spécifie for at least one RNA biomarker: (a) selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (mîR-126*), hsa-miR- 144-3p (miR-144*),hsa-miR-144-5p (=miR-144*), hsa-miR-16-1-3p, hsa-miR-339-5p, hsa-miR-4975p, put-miR-1204, put-miR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-469, putmiR-594, put-miR-856, put-miR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNA120-AlaAGC, tRNA18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA-245, and YRNA-684, or any combination thereof; and/or (b) selected from the group consisting of put-miR-1003, put-miR-1080, put-mîR-1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-468, put-mîR-476, put-miR-6, put-miR-71, put-miR-742, put-miR-806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, LJ6,1249, U6.375, U6.428, andYRNA-255, or any combination thereof.

In one embodiment of this composition, the at least one RNA biomarker further comprises one or more miRNA: (a) selected from the group consisting of hsa-let-7i-5p, hsamiR-107, hsa-miR-126-5p (=miR-126*), hsa-miR-13 5b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR- 143-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b3p, hsa-miR-425-5p, hsa-miR-449a, hsa-miR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or (b) selected from the group consisting of hsa-let-7a-5p, hsa-let7b-5p, hsa-let-7f-5p, hsa-miR-103a-3p, hsa-miR-2 l-5p, and hsa-miR-92a-3p, or any combination thereof.

I

DETAILED DESCRIPTION

The présent invention provides methods of diagnosing or monitoring traumatic brain injury (TBI) in a subject, as well as methods for treating a subject identified as suffering from

TBI.

The quest for TBI biomarkers lias received significant impetus by the increased profile of sport concussion in the media. In the last few y cars many studies hâve focused on biomarkers that can support clinical decision making pitch-side or in a sports clinic. However, protein biomarkers reported in the 1 iterature lack specificity or sensitivîty, or are not détectable for some time after injury. This may be due to the fact that foliowing concussion, which is a form of TBI, I brain-derived compounds are only released in very small amounts and the blood-brain barrier remains mostly closed.

MicroRNAs (miRNAs) are an abundant class of hîghly conserved, non-codîng RNA molécules of approximately 22 nucléotides in length that induce mRNA dégradation, translational repression or both via pairing with partîally complementary sites in the 3'UTR of target genes. The human genome encodes over 2,000 miRNAs, which may target about 60% of ail genes. However, despite the abundance of miRNAs, their biomolecular functions and involvement in pathology remain to be fùlly eiucidated. They play a central rôle in many biologîcal processes including cell cycle, cell metabolism, apoptosis and immune responses, and are attracting increasîng interest in clinical research as potential biomarkers for the détection, identification and classification of cancers and other disease States including neurodegenerative diseases.

For the avoîdance of doubt, it will be understood that “the at least one miRNA is selected from a group of miRNAs”, as used herein, means that the method in question, whether camed out for a diagnostic, prognostic, or therapeutic purpose, can be carried out with any one of the listed miRNAs or with any plurality of the listed miRNAs (e.g., two, three, four, or more of the listed miRNAs). It follows that any one or more of the listed miRNAs may be explicitly excluded.

Traumatic brain injury occurs when an extemal force traumatically injures the brain. There are different Systems for classifying TBI based on, for example, severity, type of injury and prognosis. The most commonly used System for classifying TBI is the Glasgow Coma Scale (GCS), which grades a person's level of consciousness on a scale of 3-15 based on verbal, motor, and eye-openîng reactions to stimuli. In general, a TBI with a GCS score of 13 or above is defined as mild, 9-12 as moderate and 8 or below as severe. Another System, the Mayo Classification System, has three main classifications including definite moderate-severe TBI, probable mild TBI, and possible TBI. Multiple criteria are used in each diagnosis including loss

-7 20986 of consciousness, post-traumatic amnesia, skull fracture, and évidence of neuroradiological abnonnalities including subdural haematoma, cérébral contusion, and hémorrhagie contusion. The classification ofTBI using the GCS or Mayo Systems will be known to those skilled in the art.

As used herein, references to mild, “moderate” and “severe” TBI are made in accordance with the GCS. References herein to “moderate-to-severe” TBI encompass both moderate and severe TBI in accordance with the GCS.

As used herein, a reference to mild TBI (mTBI) is also a reference to concussion.

The diagnosis and/or monitoring of TBI using the biomarkers of the présent invention is expected to support clinical decision making and treatment régi mens in a variety of contexts, including the following situations: as part of the initial assessment by paramedics to détermine whether patients should be transported to a facility with neurosurgical expertise, a major trauma centre or a local trauma unit; in the emergency department of hospitals to détermine appropriate treatment, including the need for a CT braîn scan; pitch-side, to assist decision making as to the removal of a player from play and assessment of the need to take a player to hospital; in sports clinics, to confinn a concussive event and enable decision making with regard to retuming to play; in combat situations, to détermine the need to dispatch a rescue team and evacuate a victim. Thus, subjects for whom the présent invention provides particular benefit can include, without limitation, accident victims, sports players, and military personnel.

In any case, but perhaps particularly where the subject is at greater risk for a TBI (e.g., where the subject îs a professîonal athlete or enlisted in the military), a sample may be obtained from the subject at a time prior to any known or recent trauma (e.g., near the beginning of a sporting career or prior to a military deployment) and any miRNAs of interest can be assessed at that time or later, when the subject has experienced a possible

TBI. Such samples may thereby provide an internai reference standard.

In some embodiments, the subject is human.

The TBI may be mild TBI (mTBI), moderate TBI or severe TBI (sTBI). In some embodiments, the TBI is moderate-to-severe TBI (m-sTBI).

The level of the miRNA or of each miRNA in the sample may be determined quantitatively or semi-quantitatively. By “quantitative!y”, it will be understood that the absolute amount or concentration of the miRNA or of each miRNA in the sample is determined. The absolute amount of the miRNA or of each miRNA in the sample can then be compared to a predetermined threshold (e.g. a published literature value for expected normal levels), a known level of the same or a reference miRNA in a control sample taken from a healthy subject, or the amount of a reference miRNA in the sample taken from the subject. In some embodiments, the

I

-S20986 subject is diagnosed as having a TBI when the level of the miRNA is below the predetermined threshold, or decreased relative to a reference or control sample. In other embodiments, the subject is diagnosed as having a TBI when the level of the miRNA is increased compared to the predetennined threshold.

B y “semi-quantitatively”, it will be understood that the level of the or each miRNA of interest is measured relative to a reference.

The reference may be an invariant miRNA, i.e. a miRNA having an expression level that remains substantially unchanged between healthy subjects and those having a TBI. A subject may be diagnosed as suffering from a TBI if the level of the miRNA or of each miRNA of interest is increased or decreased relative to that of an invariant miRNA.

In some embodiments, the level of the miRNA or of each miRNA in the sample obtained from the subject maybe about 0.01 tîmes to about 100 times, about 0.05 times to about 50 times, about 0.1 times to about 10 times, about 0.5 times to about 5 times, about 1.0 to about 3 times, or about 1.5 times to about 2.0 times lower or hîgher than the level in the control sample, the reference level or the published value.

Where a device or method is employed to generate a value, we may qualify that value with the tenu “about” in order to capture the stated value and any variation of that value inhérent to the device or method employed, Where values or ranges of values are specifically dîsclosed, “about” may mean plus-or-minus 10% of the stated value or range. For example, about 10 minutes may mean 9-11 minutes.

The level of the miRNA or of each miRNA of interest can be determined using methods known to those skîlled in the art. In some embodiments, determining the level of the miRNA or of each miRNA of interest comprises amplifying the miRNA. In some embodiments, total miRNA ma^ be first isolated from the sample using standard techniques, for example using the miRNeasy mini kit (Qiagen). The amount of the miRNA of interest can then be determined. In some embodiments, the level of the miRNA or of each miRNA of interest in the sample is determined using PCR (polymerase chain reaction). For example, quantitative PCR may be used for quantitative détermination of the level of the miRNA or of each miRNA of interest. PCR may also be used for semi-quantitative détermination, by comparing the level of the miRNA or of each miRNA of interest în the sample with that of a reference (e.g. an invariant miRNA).

Suitable techniques for miRNA détection and/or quantification, which will be known to those skilled in the art, include qPCR, miRNA assays, next-generation sequencing (NGS), and multiplex miRNA profiling assays.

-920986

In sonie embodiments, the level of the miRNA or of each miRNA of interest is determined using in-situ hybridization, for example using a probe (e.g,, a labelled probe) spécifie for the miRNA.

The level of miRNA may be determined in a s amp le which was obtained from the s abject immediately after injury (le. less than 1 hour after injury), and/or in a sample obtained at one or more time points a few hours or days after injury. Thus, changes in the miRNA level can be detected over time to enable monitoring of a TBI. In the event miRNA levels change over time, the methods_;described herein for monitoring TBI can be expanded to include maintaining or adjusiing the subjeefs treatment regimen accordingly.

Depending on the spécifie miRNA and the type of TBI, the level of miRNA in the subject may change significantly over time. In some embodiments, it may therefore be advantageous to measure the miRNA relatively soon after injury to enable an accurate diagnosis. In some embodiments, the level of miRNA is determined in a sample obtained from the subject no more than 72 hours, no more than 48 hours, no more than 36 hours, no more than 24 hours, no more than 12 hours, no more than 6 hours, no more than 4 hours, no more than 2 hours or no more than 1 hour after injury.

The level of some miRNAs is substantially stable over time, thus allowing a diagnosis to be made a few hours, days or even weeks after injury. In some embodiments, the level of miRNA is determined in a sample obtained from the subject up to 20, 18, 15, 12, 10, 8, 5 or 2 days from injury.

In some embodiments, the level of miRNA is determined in a sample obtained from the subject immediately after injury (e.g. at T=0 h), at 4-12 hours after injury, at 48-72 hours after injury, or at 15 days after injury.

In some embodiments, the level of miRNA is determined in a sample obtained from the subject at least 24 hours after injury. In some embodiments, the level of miRNA is determined in a sample obtained from the subject 15 days or fewer after injury. In some embodiments, the level of miRNA is determined in a sample obtained from the subject between 24 hours and 15 days after injury, or between 24 hours and 10 days after injury, or between 24 hours and 7 days after injury, or between 48 hours and 5 days after injury.

In some embodiments, the TBI is mild TBI (mTBI) or modérâte-to-severe TBI (m-sTBI). In some embodiments, the TBI is mild TBI (mTBI).

Converti en tly the sample may be any appropriai e fluid or tissue sample obtained from the subject. For example, the biological sample may comprise at least one of the group consîstîng of: urine, saliva, whole blood, plasma, sérum, sputum, semen, faeces, a nasal swab, tears, a vaginal swab, a rectal swab, a cervical smear, a tissue biopsy, and a uréthral swab. In some embodiments

-1020986 the sample is a fluid sample. Suitably, the sample is one that can be readily obtained from the individual, such as urine, saliva, blood and sputum. In some embodiments, the sample comprises saliva, blood, plasma or sérum. It will be appreciated that in some embodiments the process of obtaining the sample does not form part of the invention described herein.

In some embodiments, the sample comprises or is constituted by sérum. Not only does sérum hâve practical advantages, but it is also free of anticoagulants such as heparin, a potential inhibitor of PCR. reactions. Sérum may also be less affected b y haemolysis, compared to plasma.

In some embodiments, the sample is saliva. Saliva can be easily obtained from the patient (e.g. pitch-side, or in the field), without specialist training or medical equipment.

The diagnosis of a subject as suffering from a TBI, and in particular diagnosis of mild TBI or modérâte-to-severe TBI, may facilitate in the détermination of an appropriate treatment. The présent invention thus provides a test that enables healthcare workers, such as physicians, clinîcians, paramedics, and even non-medical personnel (e.g. teachers, sports coaches, military personnel) to décidé on appropriate action for a subject suspected of having a TBI. A subject determined as having a TBI may therefore receive the most appropriate treatment as a resuit of a diagnosis being made. The method of the invention may thus further comprise directing appropriate therapy to a subject diagnosed with a TBI.

A subject diagnosed with TBI may be further evaluated, e.g. by CT scanning. In some embodiments, the subject is admitted to hospital. In some embodiments, if moderate-to-severe TBI can be ruled out, the subject may not need to be admitted to hospital for évaluation. A subject diagnosed with moderate-to-severe TBI may be admitted to hospital, or a specialist centre with neurotrauma expertise.

A subject diagnosed with a TBI (particularly mTBI) outside a hospital environment, for example, at a sporting event, during combat or during play, may be removed from play or combat immediately. The subject may subsequently be started on a graduated retum to play or combat.

In a further aspect, there is provided a method for determining whether it is appropriate to administer to a subject a therapy for alleviating TBI, the method comprising: determining a level of at least one miRNA in a sample from the subject; and determining whether or not it is appropriate to administer a therapy for alleviating TBI, based on the level of the at least one miRNA.

It will be appreciated that the step of administerîng the therapy to the subject does not form a part of the claimed method, unless specifically stated.

In some embodiments the method may further comprise administerîng to the subject an appropriate treatment. In some embodiments, the treatment may comprise a therapy for

I

- Il I alleviating TBI. Accordingly, the invention features methods of diagnosing and treating TB1 in a subject, the method comprising the steps of (a) obtaining a sample (e.g., a sample of blood, plasma, urine, or saliva) from the subject; (b) detecting one or more miRNAs (selected from those described herein); diagnosing the patient as having a TBI when the level(s) of the miRNA(s) differ from a reference standard (as described herein); and administering a treatment for the TBI.

In a further aspect, the invention provides a method of determining an appropriate treatment to a subject suspected of suffering from a TBI, the method comprising identifying whether or not the subject has a TBI by determining a level of at least one miRNA in a sample from the subject.

If a subject is identified as having a TBI, an appropriate treatment may include one or more of the following: further evaluating the subject, for example by further tests (e.g. verbal, cognitive, motor and/or optical tests), CT and/or Mill scanning; removing the subject from activity (e.g. the activity during which the TBI was incurred); admitting the subject to hospital or a specialist clinic; surgery; and administering a therapy for alleviating TBI to the subject.

The therapy for alleviating TBI may include neuroprotective drugs, e.g. drugs to treat cérébral swelling such as mannitol and hypertonie saline, and/or other neuroprotective measures, such as avoidance of hypertensive resuscitation and the use of sédation.

In some embodiments, the subject may be subsequently monitored to track their recovery, for example in a hospital or clinic setting.

According to a further aspect of the invention, there is provided a method of detecting and/or determining a level of a target miRNA in a subject, the method comprising the steps of (a) obtaining a sample from the subject; and (b) detecting and/or determining the level of the target miRNA in the sample by contacting the sample with a probe that is spécifie for the target miRNA.

The sample may be any appropriate fluid or tissue sample obtained from the subject, as defined above. In some embodiments, the sample is blood, sérum, plasma, urine or saliva.

In some embodiments, the method may comprise determining the level of two or more target miRNAs in the sample.

According to a further aspect of the invention, there is provided a therapy for alleviating TBI for use in a method of treating a subject in need thereof, wherein said subject is identified as having a TBI by determining a level of at least one miRNA in a sample from the subject.

The step of determining the level of the target miRNA may comprise contacting the sample with a substrate functionalized with the probe, for example a chip comprising the probe.

- 12 20986

The substrate or chip may conveniently include multiple probes, each spécifie for a different target miRNA.

The subject may hâve suffered an injury, in partie ular a head injury. The subject may be suspected as having a TBI. The subject may be suspected of having mTBI or concussion. In some embodiments, the sample is obtained no more than 72 hours, no more than 4S hours, no more than 36 hours, no more than 24 hours, no more than 12 hours, no more than 6 hours, no more than 4 hours, no more than 2 hours or no more than 1 hour after injury. In some embodiments the sample is obtained 24 hours or more after the injury. In further embodiments the sample is obtained from the subject 15 days or fewer after injury. In some embodiments the sample is obtained from the subject between 24 hours and 15 days after injury, or between 24 hours and 10 days after injury, or between 24 hours and 7 days after injury, or between 48 hours and 5 days after injury.

In some embodiments, the method further comprises treatîng the subject. The treatment may include one or more of the following: further evaluating the subject, for ex ample by further tests (e.g. verbal, cognitive, motor and/or optical tests), CT and/or MRI scanning; removing the subject from activity (e.g. the activity during which the TBI was incurred); admitting the subject to hospital or a specialist clinic; and administering a therapy for alleviating TBI to the subject. In some embodiments, the treatment comprises administering an effective amount of a neuroprotective drug.

Thus, in yet a further aspect the invention provides a method of treating TBI, the method comprising: determining a level of at least one miRNA in a sample from the subject; and if the level of the at least one miRNA is indicative of mTBI, administering a treatment appropriate for mTBI; or if the level of the at least one miRNA is indicative of m-sTBl, administering a treatment appropriate for m-sTBI.

It will be appréciaied by those skilled in the art that different treatment pathways may be used for mTBI and m-sTBI.

A subject with mTBI may be treated as foliows:

An athlete diagnosed with mTBI would typically be started on a graduaied retum to play protocol (as defined by the Berlin Consensus Conférence on Concussion and individual sport authorities, e.g. RFU, IRB, NFL, NHL, NBA, IMMAF). This would involve aperiod ofrest followed by a graduai increase in level of exertion and exposure to contact. An athlete with mTBI would typically not be able to play for a period that varies between 6 and 23 days, dependtng on level of medical supervision and âge. Conversely, if mTBI was excluded, the athlete would not hâve any restrictions and co'uld train as normal the following day. If diagnosed in a pre-hospital setting, mTBI would be an indication for a patient to seek medical attention

I

- 13 20986 (e.g. in hospital or in primary care), whereas, if mTBI was excluded no medical review would be indieated.

A person with mTBI must not be left unsupervised for 24-48 hours and must not drive or operate a fork lift or open machinery until recovered.

Military personnel diagnosed with mTBI would be removed from the operational theatre and would bc rested. whereas, if mTBI could be excluded, that person would continue on active duties.

In thç NHS, a person with mTBI may be kept in hospital for observation or may hâve a CT scan according to the guidance issued by NICE, whereas if mTBI could be excluded, that patient could be discharged straightaway.

A person diagnosed with mTBI would typically be asked not to retum to work or study for a certain period of time.

A person diagnosed with mTBI may be referred to a mild TB1 clinic or a neurology clinic or a neurosurgery clinic. Typical interventions for mTBI consist of éducation, advice in regard to work, study and driving, medical management of typical sequelae such as headache or anxiety or mood disorder or post-traumatic stress disorder with médication and/or psychological intervention if necessary, and referra] to other services as indieated, e.g. neuropsychology, neurovestibular or ophthalmology.

A patient with mTBI would need to be monitored for delayed post-traumatic pituitary dysfunction according to the guidance issued by the Society of British Neurological Surgeons.

In the medico-legal context, the diagnosis of mTBI is often unclear and spéculative, as the radiological investigations are typically normal and symptoms are non-specitic. Objective confirmation of mTBI may lead to an award for damages and care needs. An appropriais treatment for mTBI may include: removing the subject from activity; treatment in situ or in the cotnmunity; further evaluating the subject in hospital without ovemight admission (typically mTBI patients are discharged with promptly with head injury advice); or admission to hospital for a period of observation (typically 1-2 days). The subject may be further evaluated using tests (e.g. verbal, cognitive, motor and/or optical tests). CT scanning is generally only required if certain indications are présent, including suspected skull fracture, post-traumatic seizure, focal neurological defecit, repeated vomiting, a GCS score of less than 13 on initial assessment (less than 14 for children, or less than 15 for infants under 1 year), in accordance with NICE guidelines.

An appropriate treatment for m-sTBI may include: MRI or CT scanning (particularly within 1 hour of injury); admission to hospital (which may include admission to intensive care and/or transfer to a specialîst clinic or major trauma centre with neurosurgical facilities);

- 14I neuromonitoring; surgery; administering a therapy for alleviating TBI, such as administering neuroprotective drugs, e.g. drugs to treat cérébral swelling such as mannitol and hypertonie saline, and/or other neuroprotective measures, such as avoidance of hypertensive resuscitation and the use of sédation.

Thus, the présent invention enables s abjects with a TBI to be clinically and quickly stratified into mTBl or m-sTBL so that they may receive the most appropriate treatment.

According to a further aspect of the invention, there is provided a détection System for diagnosing and/or monitoring TBI, the détection System comprising a sensor element comprising a substrate functionalized with a probe spécifie for a target miRNA The détection System can further comprise a détection device that is capable of detecting the binding of a target miRNA to the probe.

According to a yet further aspect of the invention, there is provided a sensor element for use in a détection System for diagnosing and/or monitoring TBI, the sensor element comprising a substrate functionalized with a probe spécifie for a target miRNA.

The sensor element may further comprise a sample addition zone for receiving a sample (e.g. a fluid sample) thereon.

The probe is capable of selectively binding the miRNA of interest. The substrate may be functionalized with a pluralîty of probes. The probes may ail be the saine, or two or more different probes may be provided. For example, in some embodiments, the substrate may be functionalized with a first probe spécifie for a first miRNA, and a second probe spécifie for a second miRNA. The first and second probes may be grouped together, for ex ample on different portions of the sensor element.

In a further aspect of the invention, there is provided a composition for use in a method of diagnosing and/or monitoring traumatic brain injury (TBI) in a subject, the composition comprising a probe spécifie for a target miRNA. The composition may comprise any one of the listed miRNAs or with any pluralîty of the listed miRNAs (e.g., two, three, four, or more of the listed miRNAs).

The probe may comprise a biological molécule such as a protein (e.g. an antibody) or a nucleic acid. In some embodiments, the probe comprises a nucleîc acid. The nucleic acid may comprise a sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to a sequence which is the complément of the full-length sequence of the target miRNA. In some embodiments, the nucleic acid comprises a sequence which is 100% identical to a sequence which is the complément of the sequence of the target miRNA (i.e. the receptor comprises a nucleic acid sequence which is the exact complément of the target miRNA sequence).

- 15 20986

The probes may be attached to a surface of the substrate b y any sui table means, such as by coupling chemistry known to those skilled in the art. In some embodiments, each probe is attached to a surface of the substrate via a linker. In some embodiments, the probe comprises a moiety for immobilizing the probe on the substrate, or for attaching the probe to a linker immobilized on the substrate.

Alternatively or in addition, the probe may comprise a détectable label. The détectable label may be, for ex ample, radioactive, fluorescent, luminescent, or antibody-based (e.g., it may constitute a conventional tetrameric antibody or a détectable fragment thereof).

The substrate of the sensor élément may be formed from any suitable material. In some embodiments, the substrate comprises or is formed from métal, plastic, glass, silîca, Silicon, graphite, graphene, or any combination thereof. In some embodiments, the substrate comprises multiple layers. For example, a substrate may be prepared by forming a surface or layer of graphene on a layer of Silicon Carbide or silica. The graphene surface may be chemically modified, for example to graphene-oxide (GO) or graphene-amine (GA). Methods for forming graphene layers, such as épitaxial growth and sublimation growth, wîll be known to those skilled in the art.

Conveniently, probes comprising or constituted by a nucleic acid can be attached to a GO surface via a linker, using an amide coupling reagent (e.g. (0-(7-azabenzotriazole-l-yl)Ν,Ν,Ν,Ν'-tetramethyluiOnium hexafluorophosphate (HATU)). A sensor element comprising a surface functionalized with a nucleic acid probe can then be used to selectively detect its complementary miRNA.

Suitable linkers may comprise an aniline moiety (or a dérivative thereof), a benzoic acid moiety (or a dérivative thereof) or an ethendi amine moiety (or a dérivative thereof). An aniline linker may be formed b y attaching a nitrobenzene molécule (or dérivative) to a graphene surface (e.g. using a diazonium sait), and reducing the nitrobenzene to aniline. The amîne group of the aniline may then be used to attach to the probe. Sîmilarly, a diazonium sait (e.g. 4-benzoic acid diazonium tetrafluoroborate) can be used to attach a benzoic acid or benzoic acid dérivative to a graphene surface. An ethanediamine moiety may be attached to carboxylated graphene or graphene oxide.

The sensor element may be comprised within a test strip. The test strip may be disposable.

The détection device may be configured to detect the binding of a target miRNA to the receptor by any suitable means known to those skilled in the art, for example by detecting changes in electrical impédance, hydrogen ion concentration, or conformât!onal changes resulting from hybridisation.

- 1620986

The détection device may further include a user interface to output data to a user.

In some embodiments, the détection device includes a database of treatment infonnation. The device may be capable of îdentifying suitabîe treatment options from the database depending on the levels of the miRNA of interest. The treatment infonnation may be provided to the user via the user interface.

Conveniently, the détection device may be portable, e.g. hand-held. The détection device may comprise a data storage unit for storing miRNA levels and other infonnation rclating to the subject. In some embodiments, the device comprises a data communication means for communicating data to other devices. For example, the device may communicate data wirelessly through WiFi, 3G, 4G, Bluetooth, or through a mobile app. This may conveniently enable the data to be easily accessed by medical professionals if necessary.

It is thus envîsaged that the détection device of the invention provides an affordable, portable, point of care means for diagnosing and monitoring TBI non-invasively. The device may be used by ambulance crews, the military, schools, sports clubs and healthcare professionals, enabling the correct assessment and triage of patients suspected to hâve a TBI.

A further aspect of the présent invention is a System for detecting and/or monitoring mTBI in a subject.

A type of détection System is based on complementarity between a target miRNA and a nucleic acid probe, generally an oligonucleotide probe. The complementary or base pairing région can be 7 or 8 or more nucléotides in length. In embodiments the complementary or base pairing région can be 9, 10, 12, 15 or more nucléotides in length or the complementary or base pairing région can be the full length of the miRNA. The substrate functionalised with an oligonucleotide can be a bead or a nanoparticle. The détection System can hâve further components capable of converting bound nucleic acid probe-miRNA into a détectable signal.

Another type of détection System is based on RT-PCT. Therefore the présent invention embraces a détection System for detecting and/or monitoring mTBI in a subject comprising a primer pair designed for amplification of a cDNA complément of at least one miRNA described herein,

L

In a further aspect there is provided a kit for use in the présent methods. The kit may comprise at least probe (e.g. a protein, such as an antibody, or a nucleic acid) which is capable of selectively binding the miRNA of interest. In some embodiments, the kit comprises an array comprising a plurality of probes. In some embodiments, the at least one probe is a primer for carryîng out PCR. The kit may further comprise instructions for use, for example instructions for use in the diagnosis and/or monitoring of TBI. The kit may further comprise suitabîe buffers and

I

- 17 20986 reagents, such as amplification primers and enzymes (e.g. DNA polymerase, reverse transcriptase for conversion of miRNA to cDNA).

Additional Aspects and Embodiments

In further aspects, the présent disclosure provides, inter alia, inethods, sensor éléments, détection Systems, kits, and compositions invol ving varions différent! ail y expressed RNA biomarkers suitable for use m diagnosing, monitoring, and treating traumatic bram injury (TB), including mild traumatic brain injury (mTBl), in a hum an subject.

The sequences and accession numbers for these RNA biomarkers are provided in Table 1 below:

Table 1

RNA Bïomarker	Sequence	Accession No.
put-miR-410	ggagaatagaacatgctgatt (SEQ 1D No. 70)
put-miR-1306	ataacgtcatctagtgtg (SEQ ID No. 71)
put-miR-806	cacgagagaacgcacacc (SEQ ID No. 72)
put-miR-71	gaccttgggttgggtcgtggt (SEQ ID No. 73)
put-miR-468	ataaggaactgctctctc (SEQ ID No. 74)
put-miR-476	gtggtcaggtagagaa (SEQ ID No. 75)
put-miR-293	gggtaaaactgcagtgggcgttggtag (SEQ ID No. 76)
put-miR-742	cagggctgtgctaact (SEQ ID No. 77)
put-miR-6	gcggaccttgctcaagg (SEQ ID No. 78)
put-miR-1207	gtgaaaagacataggggg (SEQ ID No. 79)
put-miR-1084	aggaccattgcgttgcc (SEQ ID No. 80)
put-miR-92	agagactgactttgagta (SEQ ID No. 81)
put-miR-188	aaatggcgatactcagg (SEQ ID No. 82)
put-miR-1352	tggattgtgggggaacc (SEQ ID No. 83)
put-miR-1146	caactgtaagtccatt (SEQ ID No. 84)
put-miR-209	ggtcctcggatcggcc (SEQ ID No. 85)
put-miR-961	tagcttgatccagttg (SEQ ID No. 86)
put-miR-1080	tgtggattgatgctct (SEQ ID No. 87)
put-miR-750	caagagatgaggaatg (SEQ ID No. 88)
put-miR-1003	tggacttcagaacagc (SEQ ID No. 89)
put-miR-1098	aaggcgaaggatatgttg (SEQ ID No. 90)
hsa-miR-934	tgtctactactggagacactgg (SEQ ID No. 91)
hsa-miR-142-5p	cataaagtagaaagcactact (SEQ ID No. 92)
hsa-miR-6748-3p	tcctgtccctgtctcctacag (SEQ ID No. 93)	MIMAT0027397
hsa-miR-1271-5p	cttggcacctagcaagcactca (SEQ ID No. 94)	MIMAT0005796
hsa-miR-34b-3p	caatcactaactccactgccat (SEQ ID No. 95)	MIMAT0004676
hsa-miR-449a	tggcagtgtattgttagctggt (SEQ ID No. 96)	MIMAT0001541
hsa-miR-143-3p	tgagatgaagcactgtagctc (SEQ ID No. 48)	MIMAT0Û0Û435
hsa-miR-135b-5p	tatggcttttcattcctatgtga (SEQ ID No. 40)	MIMAT0000758
U6.428	aagattagcatgaggatgacacgcaaattcgtgaagcgttccatttc ttt (SEQ ID No. 97)	-

I

- 18I

RNA Biomarker	Sequence	Accession No.
RNU6-4	ggcccctgcacagggatgacacgcaaattcgtgaagcgttccatat tttt (SEQ IDNo. 98)
RNU6-7	ggcccctgcgcaaggatgacatgcaaattcgtgaagcgttccatatt ttt (SEQ ID No. 99)
RNU6-6	ggcccctgtgcaaggatgacacgcaaattcgtgaagcgttccatatt tll (SEçTlD No?100)
RNU6-45	ggcccttgtgcaaggatgacacgcaaattcgtgaagcgttccatatt ttt (SEQ ID No. 101)
RNU6-73	ggcccctgtgcaaggatgacatgcaaattcgtgaagcgttccatatt ttt (SEQID No. 102)
Y_RNA.255	gugucaccaacguugguauacaaccccccacaacuaaauuug acuggcuu (SEQ ID No. 103)
U6.375	ggcccctgtgcaagaatgactcgcaaattcgtgaagcgttccatatt ttt (SEQ ID No. 104)
U6.1249	gatggcatgacccctgatcaaggacggcatgcaaatttgtgaagta tttc(SEQ IDNo. 105)

According to an aspect of the présent disclosure, there is provided a method of diagnosing and treating traumatîc brain injury (TBI) in a human subject in need thereof, the method comprising: obtaining a saliva sample from the subject; contacting the saliva sample with a probe comprising a nucleic acid able to bind to at least one RNA biomarker selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU645, U6.375, put-miR-1207, U6.428, put-miR-742, hsa-miR-6748-3p, put-miR-6, put-miR410, put-miR-476, put-miR-293, hsa-miR-34b-3p, hsa-miR-1271-5p, hsa-miR-449a, putmiR-806, put-miR-71, put-miR-468, put-miR-1306, put-miR-1146, put-miR-1084, put-miR92, put-miR-209, put-miR-961, U6.1249, put-miR-188, put-miR-1352, put-miR-1080, putmiR-750, put-miR-1003, put-miR-1098, hsa-miR-934, and hsa-miR-I42-5p; determining an amount of the at least one RNA biomarker in the saliva sample; identifying the subject as having TBI where the amount of the at least one RNA biomarker is increased or decreased relative to a predetermined threshold value or relative to the amount of the RNA biomarker in a control sample; and treating the subject identified as having TBI according to one or more of thefoilowing: subjecting the subject to a verbal, cognitive, motor, or optical test, or any combination of the foregoing; subjecting the subject to diagnostic imaging in the form of a CT or MRI, or a combination thereof; and/or admînistering to the subject one or more neuroprotective thérapies.

Examples of neuroprotective thérapies that may be chosen by a clînîcian for treating TBI can include, without limitation, statîns, progestérone, corticosteroids, cell cycle inhibitors (such as flavopîridol, a semi-synthetic flavonoid, and purine analogs roscovitine and olomoucine), autophagy inhibitors including caspase inhibitors (such as the tetrapeptide caspase-3 inhibitor (z

- 1920986

DEVD-ftnk), the pan-caspase peptide inhibitor Boc-aspartyl fluoromethylketone, and Bocaspartyl fluoromethylketone), inhibitors of poly (ADP-ribose) polymerase (PARP), antiinflammatory agents (such as minocycline and anti-inflammatory cytokines (e.g., IL-10) or interleukin-1 rcceptor antagonist (IL-lra)), sulfonylurea receptor 1 (SURl)-reguIated calcium channel inhibitors (such as glibenclamide). Substance P (SP) antagonists, diketopiperazines, and cyclosporine A.

In some embodiments, the saliva sample is obtained during a period of time after injury selected from immediately after the injury to any period post-injury.

In some embodiments, the saliva sample is obtained during a period of time after injury selected from immediately after the injury until the expression level of at least one of the RNA biomarkers retums to the predetermined threshold value or to the amount of the RNA biomarker in the control sample.

In some embodiments, the saliva sample is obtained during a period of time after injury selected from immediately after the injury to up to 1 year, up to 10 months, up to 8 months, up to 6 months, up to 5 months, up to 4 months, up to 3 months, up to 2 months, up to 1 month, up to 25 days, up to 20 days, up to 15 days, up to 7 days, up to 5 days, up to 3 days, up to 2 days, and/or up to 24 hours post-injury.

In some embodiments, the saliva sample is obtained during a period of time after injury selected from immediately after the injury to 15 days, from 1 hour to 15 days, from 24 hours to 15 days, from 24 hours to 7 days, and from 2 to 5 days.

In some embodiments, the method further comprises obtaining one or more additional saliva samples from the subject at one or more additional times after the injury and repeating the detecting and amplifying steps for each additional sample.

In some embodiments, the one or more additional saliva sample is obtained during a period of time after înjury selected from immediately after the injury to any period post-injury.

In some embodiments, the one or more additional saliva sample is obtained during a period of time after injury selected from immediately after the injury until the expression level of at least one of the RNA biomarkers retums to the predetermined threshold value or to the amount of the RNA biomarker in the control sample.

In some embodiments, the one or more additional saliva sample is obtained during a period of time after injury selected from immediately after the injury to up to 1 year, up to 10 months, up to 8 months, up to 6 months, up to 5 months, up to 4 months, up to 3 months, up to 2 months, up to 1 month, up to 25 days, up to 20 days, up to 15 days, up to 7 days, up to 5 days, up to 3 days, up to 2 days, and/or up to 24 hours post-injury.

-2020986

In soine embodiments, the one or more additional saliva sample is obtained during a period of time after injury selected from immediately after the injury to 15 days, from I hour to 15 days, from 24 hours to 15 days, from 24 hours to 7 days, and from 2 to 5 days.

In some embodiments, the one or more additional saliva samples is obtained at day 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, II, 12, 13, 14, or 15 after the injury.

Lu some embodiments, the detecting an amount of the at least one RNA biomarker is performed using a PCR-based assay, a light array assay, a laminar flow chip assay, or any assay suitable for detecting that at least one RNA biomarker.

In some embodiments, when using the PCR-based assay the predetennined threshold is équivalent to a fold change of 1.5 or more using the 2-delta delta CT (2-AACT) method.

In some embodiments, the predetermined threshold is équivalent to a fold change of 2 or more using the 2-delta delta CT (2-AACT) method.

In some embodiments, the at least one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR-143-3p and hsa-miR-135b-5p.

In some embodiments, the method further comprises identifying the hum an subject as being fit for normal activity after undergoing successful trcatment for TBI.

In another aspect of the présent disclosure, there is provded a method of diagnosing and/or monitoring traumatic brain injury (TBI) in a subject, the method comprising determining a level of at least one RNA biomarker in a saliva sample obtained from the subject, wherein the at least one RNA biomarker is selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, put-miR-1207, U6.428, put-miR-742, hsa-miR-6748-3p, put-miR-6, put-mîR-410, put-miR-476, put-miR-293, hsa-miR-34b-3p, hsa-miR-1271-5p, hsa-miR-449a, put-miR-806, put-miR-71, put-miR-468, put-miR-1306, put-miR-1146, put-miR-1084, put-miR-92, put-miR-209, put-miR-961, U6.1249, put-miR188, put-miR-1352, put-miR-1080, put-miR-750, put-miR-1003, put-mîR-1098, hsa-miR934, and hsa-miR-142-5p, or any combination thereof.

In some embodiments, either an upregulated level or a downregulated level of the at least one RNA biomarker is indicative of TBI.

In some embodiments, the subject is diagnosed as having TBI if the level of the at least one RNA biomarker is either above or below a predetermined threshold or increased or decreased relative to a control.

In some embodiments, the method further comprises identifying the human subject as being fit for normal activity after undergoing successful treatment for TBI.

In some embodiments, the at least one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR-143-3p and hsa-miR-13 5b-5p.

-21 20986

In another aspect of the présent disclosure, there is provided a sensor élément for a détection system for diagnosing and/or monitoring TBI, the sensor element comprising a substrate functionalized with a probe spécifie tor at least one RNA biomarker selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.o75, put-miR-1207, U6.428, put-miR-742, hsa-miR-6748-3p, put-miR-6, put-miR-410, put-miR476, put-miR-293, hsa-miR-34b-3p, hsa-miR-1271-5p, hsa-miR-449a, put-miR-806, putmiR-71, put-miR-468, put-miR-1306, put-miR-1146, put-miR-1084, put-miR-92, put-miR209, put-miR-961, U6.1249, put-miR-188, put-miR-1352, put-miR-1080, put-miR-750, putmiR-1003, put-miR-1098, hsa-miR-934, and hsa-miR-142-5p,

In some embodiments, the probe comprises a nucleîc acid able to bind to the at least one RNA biomarker.

In some embodiments, the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of the sequence of the target RNA biomarker.

In some embodiments, the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ ID NO: 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, and 105.

In another aspect of the présent disclosure, there is provided a détection System for diagnosing and/or monitoring TBI, comprising a sensor element according to the présent disclosure, and a détection device capable of detecting the binding of a target RNA biomarker to the probe.

In some embodiments, the détection System further comprises means to détermine whether the target RNA biomarker is upregulated or downregulated.

In another aspect of the présent disclosure, there is provided a method for determining a course of action for a subject suspected of having TBI, comprising applying a saliva sample obtained from the subject to a détection system according to the présent disclosure, and if an upregulated level or a downregulated level of the at least one RNA biomarker is detected, providing a treatment for TBI.

In another aspect of the présent disclosure, there is provided a method of treatîng a subject with suspected TBI, the method comprising determining whether an upregulated level or a downregulated level of at least one RNA biomarker selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, put-miR-1207, U6.428, put-miR-742, hsa-mîR-6748-3p, put-miR-6, put-miR-410, put-miR-476, put-miR-22 I

293, hsa-miR-34b-3p, hsa-miR-1271-5p, hsa-miR-449a, put-miR-806, put-miR-71, putmiR-468, put-miR-1306, put-miR-1146, put-miR-1084, put-miR-92, put-miR-209, put-miR961, U6.1249, put-miR-188, put-miR-1352, put-miR-1080, put-miR-750, put-miR-1003, put-miR-1098, hsa-miR-934, and hsa-miR-142-5p is détectable in a saliva sample obtained 5 from the subject, and if an upregulated level or a downregulated level of at least one RNA biomarker is detected, providing treatment for TBI to the subject.

In some embodiments, the at least one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR-143-3 p and hsa-miR-135b-5p.

In another aspect of the présent disclosure, there is provided a method of detecting an 10 RNA biomarker in a saliva sample, the method comprising obtaining a saliva sample from a human subject, contacting the saliva sample with at least one oligonucleotide primer complementary to at least one RNA biomarker selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, put-miR-1207, U6.428, put-miR-742, hsa-miR-6748-3p, put-miR-6, put-miR-410, put-miR-476, put-miR15 293, hsa-miR-34b-3p, hsa-miR-1271-5p, hsa-mîR-449a, put-miR-806, put-miR-71, putmiR-468, put-miR-1306, put-miR-1146, put-miR-1084, put-miR-92, put-miR-209, put-miR961, U6.1249, put-miR-188, put-miR-1352, put-miR-1080, put-miR-750, put-miR-1003, put-miR-1098, hsa-miR-934, and hsa-miR-142-5p; amplifyîng the at least one RNA biomarker using a polymerase chain reaction; and detecting the amplified RNA biomarker.

In some embodiments, the at least one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR-143-3 p and hsa-miR-I35b-5p.

In another aspect of the présent disclosure, there is provided a kit for use in a method of diagnosing and/or monitoring traumatic brain injury (TBI) in saliva from a human subject, the kit comprising at least one probe spécifie for at least one RNA biomarker selected from the group 25 consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, putmiR-1207, U6.428, put-miR-742, hsa-miR-6748-3p, put-miR-6, put-miR-410, put-mîR-476, put-miR-293, hsa-mîR-34b-3p, hsa-miR-1271-5p, hsa-mîR-449a, put-miR-806, put-miR-71, put-miR-468, put-miR-1306, put-miR-1146, put-miR-1084, put-miR-92, put-miR-209, putmiR-961, U6.1249, put-miR-188, put-miR-1352, put-miR-1080, put-miR-750, put-miR30 1003, put-miR-1098, hsa-miR-934, and hsa-miR-I42-5p.

In some embodiments, the probe comprises a nucleic acid able to bind to the at least one RNA biomarker.

-2320986

I

In some embodiments, the at least one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR-143-3 p and hsa-miR-13 5b-5p.

In another aspect of the présent diselosure, there is provided a composition for use in a method of diagnosing and/or monitoring traumatic brain injury (TBI) in saliva from a hum an subject, the composition comprising at least one probe spécifie for at least one RNA biomarker selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, put-miR-1207, U6.428, put-miR-742, hsa-miR-6748-3p, put-miR-6, putmiR-410, put-miR-476, put-miR-293, hsa-miR-34b-3p, hsa-miR-127 l-5p, hsa-miR-449a, put-miR-806, put-miR-71, put-miR-468, put-miR-1306, put-miR-1146, put-miR-1084, putmiR-92, put-miR-209, put-miR-961, U6.1249, put-miR-188, put-miR-1352, put-miR-1080, put-miR-750, put-miR-1003, put-miR-1098, hsa-mîR-934, and hsa-miR-142-5p.

It will be appreciated that statements made herein in relation to any aspect of the invention may equally apply to any other aspect of the invention, as appropriate. Furthennore, the various aspects and embodiments of the présent disclosure can also be used in combination with various techniques, methods, Systems, compositions, devices, and/or dîsclosures as described in WO2017/153710A1 and WO2018/138468A1, the entire disclosures of which are hereby incorporated by reference herein.

| Further Additional Aspects and Embodiments

In further aspects, the présent disclosure provides, inter alia, methods, sensor éléments, détection Systems, kits, and compositions involving various differentially expressed RNA

-24I biomarkers suitable for use in diagnosing, monitoring, and treating traumatic brain injury (TB), including mild traumatic brain injury (mTBI), in a human subject.

As shown in Ex ample I (below), in certain embodiments, the suitable RNA biomarkers were idcntifîed according to an MiRNA qPCR validation study performed in 176 saliva baseline 5 sam pl es (B); 42 samplcs form concussed players after injury (group Ca); 52 sam pies from concussed players post-match (group Cb) and 54 concussed players after 36-48h (group Ce); 61 uninjured players post-match (group Ub); 45 uninjured players 36-48h (group Uc); 30 musculoskeletal injury players post-match (group Mb); 24 musculoskeletal injury players 36-4811 (group Mc).

The sequences and accession numbers for these RNA biomarkers are provided in Table 2 below:

Table 2

RNA Biomarker	Sequence	miRBase Accession No.	SEQ ID NO.
hsa-let-7a-5p	ugagguaguagguuguauaguu	MIMAT0000062	106
hsa-Iet-7b-5p	ugagguaguagguugugugguu	MIMAT0000063	107
hsa-let-7f-5p	ugagguaguagauuguauaguu	MIMAT0000067	108
hsa-let-7i-5p	ugagguaguaguuugugcuguu	MIMAT0000415	29
hsa-miR-I03a-3p	agcagcauuguacagggcuauga	MIMATO000101	109
hsa-mîR-107	agcagcauuguacagggcuauca	MIMAT0000104	39
hsa-miR-1246	aauggauuuuuggagcagg	MIMAT0005898	110
hsa-miR-126-3p (miR-126*)	ucguaccgugaguaauaaugcg	MIMAT0000445	111
hsa-m iR-12 6-5p (=miR-126*)	cauuauuacuuuugguacgcg	MIMAT0000444	14
hsa-miR-135b-5p	uauggcuuuucauuccuauguga	MIMAT00Ü0758	40
hsa-m iR-142-3p	uguaguguuuccuacuuuaugga	MIMAT0000434	26
hsa-miR-142-5p	cauaaaguagaaagcacuacu	MIMAT0000433	112
hsa-miR-143-3p (=miR-143)	ugagaugaagcacuguagcuc	MIMAT0000435	48
hsa-miR-144-3p (miR-144*)	uacaguauagaugauguacu	MIMAT0000436	113
hsa-miR-144-5p (=miR-144*)	ggauaucaucauauacuguaag	MIMAT0004600	16
hsa-miR-148a-3p	ucagugcacuacagaacuuugu	MIMAT0000243	27
hsa-miR-16-l-3p	ccaguauuaacugugcugcuga	MIMAT0004489	114
hsa-miR-206	uggaauguaaggaagugugugg	MIMAT0000462	115
hsa-miR-21-5p	uagcuuaucagacugauguuga	MIMAT0000076	I
hsa-miR-29c-3p	uagcaccauuugaaaucgguua	MIMAT000Û681	116
hsa-miR-339-5p	ucccuguccuccaggagcucacg	MIMAT0000764	117
hsa-mîR-34b-3p	caaucacuaacuccacugccau	MIMAT0004676	118
hsa-miR-425-5p	aaugacacgaucacucccguuga	M1MAT0003393	2
hsa-miR-449a	uggcaguguauuguuagcuggu	MIMAT0001541	119

-25 20986

RNA Biomarker	Sequcnce	miRBase Accession No.	SEQ ID NO.
hsa-miR-497-5p	cagcagcacacugugguuugu	MIMAT00Ü2820	120
hsa-miR-671-3p	uccgguucucagggcuccacc	MIMAT0004819	23
hsa-miR-6748-3p	uccugucccugucuccuacag	M1MAT0027397	121
hsa-miR-92a-3p	uauugcacuugiicccggccugu	MIMAT0000092	122
hsa-miR.-934	ugucuacuaciiggagacacugg	MIMAT0004977	123
put-miR-1003	tggacttcagaacagc		89
put-miR-1080	tgtggattgatgctct		87
put-miR-1084	aggaccattgcgttgcc		80
put-miR-1146	caactgtaagtccatt		84
put-miR-1204	agggctgggcacggggg		124
put-miR-1207	gtgaaaagacataggggg		79
put-miR-1306	ataacgtcatctagtgtg		71
put-miR-1 88	aaatggcgatactcagg		82
put-miR-209	ggtcctcggatcggcc		85
put-miR-323	ataaaatgggcgttgagg		125
put-miR-325	ttcaaatcccacttctgacacca		126
put-miR-444	ctgaaaaggggacggattgggaa		127
put-mîR-465	ccagttgtcgtgggttttt		128
put-mîR-468	ataaggaactgctctctc		74
put-iniR-469	gcgggggattagctcagctggg		129
put-miR-476	gtggtcaggtagagaa		75
put-miR-594	tgattttttttggcgaa		130
put-miR-6	gcggaccttgctcaagg		78
put-miR-71	gaccttgggttgggtcgtggt		73
put-miR-742	cagggctgtgctaact		77
puÎ-miR-806	cacgagagaacgcacacc		72
put-miR-856	aaggatagggaggtattt		131
put-miR-893	accatcctctgctacca		132
put-miR-92	agagactgactttgagta		81
put-miR-958	acagggctgtgcaaaaa		133
put-miR-961	tagcttgatccagttg		86
RNU4-6p	tatcgtagccaaÏgaggtttatccgaggc gtgattattgctaattgaaaa		134
RNU6-4	ggcccctgcacagggatgacacgcaaa ttcgtgaagcgttccatattttt		98
RNU6-45	ggcccttgtgcaaggatgacacgcaaat tcgtgaagcgttccatattttt		101
RNU6-6	ggcccctgtgcaaggatgacacgcaaat tcgtgaagcgttccatattttt		100
RNU6-7	ggcccctgcgcaaggatgacatgcaaat tcgtgaagcgttccatattttt		99
RNU6-73	ggcccctgtgcaaggatgacatgcaaat tcgtgaagcgttccatattttt		102
SNORA57	tgctggcggcttcccatccgctggttctat cctcaaacgccgggacaccg		135
SNORD3B-2	cttctctccgtattggggagtgagaggga gagaacgcggtctgagtggtt		136
tRNA120-AlaAGC	gcgcatgcttagcatgcatgaggtcccg ggttcgatccccagcatctcca		137

-26I

RNA Biomarker	c Sequence	miRBase Accession No.	SEQ ID NO.
tRNA18-ArgCCT	gcactggcctcctaagccagggattgtg ggttcgagtcccacctggggta		138
tRNA27-MetCAT	gcgtcagtctcataatctgaaggtcctga gtt cgagcct cagagagggca		139
l tRNA2-LeuTAA	gcataaaacttaaaattttataatcagagg ttcaactcctcttcttaaca		140
tRNA73-ArgCCG	gcgtctgattccggatcagaagattgag ggttcgagtcccttcgtggtcg		141
tRNA8-ThrAGT	gcgcctgtctagtaaacaggagatcctg ggttcgaatcccagcggtgcct		142
tRNA9-TyrGTA	ctttttgactgtagagcaagaggtccctg gttcaaatccaggttctccct		143
U2.3	tcacttcacgcatcgatctggtattgcagt acctccaggaacagtgcacc		144
U4.64	gtatcgtagccaatgaggtttatccaagg tgcgattattgctaattgaaa		145
U6.1249	gatggcatgacccctgatcaaggacgg catgcaaatttgtgaagtatttc		105
U6.168	atggcccctgcgcaaggatgacacgca aatttgtgaaggattccatattt		146
U6.375	ggcccctgtgcaagaatgactcgcaaat tcgtgaagcgttccatattttt		104
U6.428	aagattagcatgaggatgacacgcaaat tcgtgaagcgttccatttcttt		97
U6.601	ggcccctgcgcaaggatgacatgcaaat ttgtgaagtgttccatattttt		147
UC022CJG1	cattgatcatcgacacttcgaacgcactt g		148
YRNA-245	gtctttgttgaactctttccctccttctcatta ctgtacttgaccagtct		149
YRNA-255	gugucaccaacguugguauacaaccc cccacaacuaaauuugacuggcuu		103
YRNA-684	gcttcttttactctttcccttcattctcactac tgtacctgattcgtctt		150

As discussed in more detail in Example 1 (below), these biomarkers were found to be differentially expressed and statistically significant between the different group comparisons and the different time points (Ca vs Ub; Cb vs Ub; Ce vs Uc; Ca vs Mb; Cb vs Mb; Ce vs Mc; Ca vs 5 U+M b; Cb vs U+M b; Ce vs U+M c; Ca vs B; Cb vs B; Ce vs B).

According to an aspect of the présent disclosure, there is provided a method of diagnosing and treating traumatic brain injury (TBI) in a human subject in need thereof, the method comprising: obtaining a saliva sample from the subject; contacting the saliva sample with a probe comprising a nucleic acid able to bind to at least one RNA biomarker selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f-5p, hsa-let-7i-5p, hsa-miR103a-3p, hsa-miR-107, hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-126-5p (=miR-27I ι

126*). hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-143-3p (=miR-143), hsamiR-144-3p (miR-144*), hsa-miR-l44-5p (=miR-144*), hsa-miR-148a-3p, hsa-miR-16-l-3p, hsa-miR-206, hsa-miR-21-5p, hsa-miR-29c-3p, hsa-miR-339-5p, hsa-miR-34b-3p, hsa-miR-4255p, hsa-miR-449a, hsa-miR-497-5p, hsa-miR-671-3p, hsa-miR-6748-3p, hsa-miR-92a-3p, hsamiR-934, put-miR-1003, put-miR-1080, put-miR-1084, put-miR-1146 (2), put-miR-1204, putmiR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-468, put-miR-469, put-miR-476, put-miR-594, put-miR-6, put-miR-71, put-miR-742, put-miR-806, put-miR-856, put-miR-893, put-miR-92, put-miR-958, put-miR-961, RNU4-6p, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, SNORA57, SNORD3B-2, tRNA120-AlaAGC, tRNA 18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.1249, U6.168, U6.375, U6.428, U6.601, UC022CJG1, YRNA-245, YRNA-255, and YRNA-684; determining an amount of the at least one RNA biomarker in the saliva sample; identifying the subject as having TBI where the amount of the at least one RNA biomarker is increased or decreased relative to a predetermined threshold value or relative to the amount of the RNA biomarker in a control sample; and treating the subject identified as having TBI according to one or more of the following: administering to the subject one or more neuroprotective thérapies.

Examples of neuroprotective thérapies that may be chosen by a clinician for treating TBI can inciude,|without limitation, statins, progestérone, corticosteroids, cell cycle inhibitors (such as flavopirîdol, a semi-synthetic flavonoîd, and purine analogs roscovitine and olomoucine), autophagy inhibitors including caspase inhibitors (such as the tetrapeptide caspase-3 inhibitor (zDEVD-fmk), the pan-caspase peptide inhibitor Boc-aspartyl fluoromethylketone, and Bocaspartyl fluoromethylketone), inhibitors of poly (ADP-ribose) polymerase (PARP), antiinflammatory agents (such as minocycline and anti-in fl ammatory cytokines (e.g., IL-10) or interleukin-1 receptor antagonist (IL-Ira)), sulfonylurea receptor I (SURl)-regulated calcium channel inhibitors (such as glibenclamîde), Substance P (SP) antagoniste, diketopiperazines, and cyclosporine A,

In some embodiments, the method further comprises identifying the human subject as being fit for normal activity after undergoing successftil treatment for TBI.

In another aspect of the présent disclosure, there is provded a method of diagnosing and/or monitoring traumatic brain injury (TBI) in a subject, the method comprising determining a level of at least one RNA biomarker in a saliva sample obtained from the subject, wherein the at least one RNA biomarker is selected from the group consisting of hsa-iet-7a-5p, hsa-let-7b-5p, hsa-let-7f-5p, hsa-let-7i-5p, hsa-miR-103a-3p, hsa-miR-107, hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-126-5p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR-142

I -28ι

5p, hsa-miR-143-3p (=miR-143), hsa-mîR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-148a-3p. hsa-miR-16-l-3p, hsa-miR-206, hsa-miR-21-5p, hsa-miR-29c-3p, hsa-miR339-5p, hsa-miR-34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsa-miR-497-5p, hsa-miR-671-3p, hsa-miR-6748-3p, hsa-miR-92a-3p, hsa-miR-934, put-miR-1003, put-miR-1080, put-miR-1084, put-miR-1 146 (2), put-miR-1204, put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-468, put-miR-469, put-miR476, put-miR-594, put-miR-6, put-miR-71, put-miR-742, put-miR-806, put-miR-856, put-miR893, put-miR-92, put-miR-958, put-miR-961, RNU4-6p, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, SNORA57, SNORD3B-2, tRNA120-AlaAGC, tRNAl 8-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG SNORD3B-2, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.1249, U6.168, U6.375, U6.428, U6.601, UC022CJG1, YRNA-245, YRNA-255, and YRNA-684, or any combination thereof.

In so^ne embodiments, the method further comprises identifying the human subject as being fit for normal activity after undergoing successfüi treatment for TBI.

In some embodiments, the at least one RNA biomarker further comprises one or more miRNA selected from the group consîsting of hsa-miR-143-3p and hsa-miR-135b-5p.

In another aspect of the présent disclosure, there is provided a sensor element for a détection system for diagnosing and/or monitoring TBI, the sensor element comprising a substrate functionalized with a probe spécifie for at least one RNA biomarker selected from the group consîsting of hsa-let-7a-5p, hsa-Iet-7b-5p, hsa-let-7f-5p, hsa-Iet-7i-5p, hsa-miR-103a-3p, hsa-miR-107, hsa-miR-1246, hsa-mîR-126-3p (miR-126*), hsa-miR-126-5p (=miR-126*), hsamiR-135b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-143-3p (=miR-143), hsa-miR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-148a-3p, hsa-miR-16-I-3p, hsa-miR-206, hsa-miR-21-5p, hsa-miR-29c-3p, hsa-miR-339-5p, hsa-miR-34b-3p, hsa-mîR-425-5p, hsa-miR449a, hsa-miR-497-5p, hsa-mîR-67I-3p, hsa-miR-6748-3p, hsa-miR-92a-3p, hsa-miR-934, putmiR-1003, put-miR-1080, put-miR-1084, put-miR-1146 (2), put-miR-1204, put-miR-1207, putmiR-1306, put-miR-188, put-miR-209, put-miR-323, put-mîR-325, put-miR-444, put-miR-465, put-miR-468, put-miR-469, put-miR-476, put-miR-594, put-miR-6, put-miR-71, put-miR-742, put-miR-806, put-miR-856, put-miR-893, put-miR-92, put-miR-958, put-miR-961, RNU4-6p, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, SNORA57, SNORD3B-2, tRNA120-29I

AlaAGC. tRNAl 8-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.1249, U6.168, U6.375, U6.428, U6.601, UC022CJG1, YRNA-245, YRNA-255, and YRNA-684.

In some embodiments, the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ ID NO: 1,2, 14, 16, 23, 26, 27, 29, 39, 40, 48, 71, 72, 73, 74, 75, 77, 78, 79, 80, 81, 82, 84, 85, 86, 87, 89, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, and 150.

In another aspect of the présent dîsciosure, there is provided a détection System for diagnosing and/or monitoring TBI, comprising a sensor element according to the présent disclosure, and a détection device capable of detecting the binding of a target RNA biomarker to the probe.

In another aspect of the présent disclosure, there is provided a method for determining a course of action for a subject suspected of having TBI, comprising applying a saliva sample obtained from the subject to a détection System according to the présent disclosure, and if an upregulated level or a downregulated level ofthe at least one RNA biomarker is detected, providing a treatment for TBI.

In another aspect of the présent disclosure, there is provided a method of treating a subject with suspected TBI, the method comprising determining whether an upregulated level or a downregulated level of at least one RNA biomarker selected from the group consisting of hsalet-7a-5p, hsa-let-7b-5p, hsa-let-7f-5p, hsa-let-7î-5p, hsa-miR-103a-3p, hsa-miR-107, hsa-miR1246, hsa-miR-126-3p (miR-126*), hsa-miR-126-5p (=mîR-126*), hsa-miR-135b-5p, hsa-miR142-3p, hsa-miR-142-5p, hsa-miR-143-3p (=miR-143), hsa-miR-144-3p (miR-144*), hsa-miR144-5p (=miR-144*), hsa-miR-148a-3p, hsa-miR-16-l-3p, hsa-miR-206, hsa-miR-2l-5p, hsamiR-29c-3p,|hsa-miR-339-5p, hsa-miR-34b-3p, hsa-mîR-425-5p, hsa-miR-449a, hsa-miR-4975p, hsa-miR-671-3p, hsa-miR-6748-3p, hsa-miR-92a-3p, hsa-miR-934, put-miR-1003, put-miR

- 3020986

1080, put-miR-1084, put-miR-1146 (2), put-miR-1204, put-miR-1207, put-miR-1306, put-miR188, put-miR-209, put-miR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-468, putmiR-469, put-miR-476, put-miR-594, put-miR-6, put-miR-71, put-miR-742, put-miR-806, putmiR-856, put-miR-893, put-miR-92, put-miR-958, put-miR-961, RNU4-6p, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, SNORA57, SNORD3B-2, tRNAl 20-AlaAGC, tRNAl 8-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA. tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, LJ2.3, U4.64, U6.I249, U6.168, U6.375, U6.428, U6.601, UC022CJG1, YRNA-245, YRNA255, and YRNA-684 is détectable in a saliva sample obtained from the subject, and if an upregulated level or a downregulated level of at least one RNA biomarker is detected, providing treatment for TBI to the subject.

In some embodiments, the at least one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR-143-3p and hsa-miR-135b-5p,

In another aspect of the présent disclosure, there is provided a method of detecting an RNA biomarker in a saliva sample, the method comprising obtainîng a saliva sample from a human subject, contacting the saliva sample with at least one oligonucleotide primer complementary to at least one RNA biomarker selected from the group consisting of hsa-let-7a5p, hsa-let-7b-5p, hsa-let-7f-5p, hsa-let-7i-5p, hsa-miR- 103a-3p, hsa-miR-107, hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-126-5p (=miR-126*), hsa-miR- 135b-5p, hsa-miR- 142-3p, hsa-miR-l42-5p, hsa-miR-143-3p (=miR-143), hsa-miR- 144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-148a-3p, hsa-miR-16-l-3p, hsa-miR-206, hsa-miR-21-5p, hsa-miR-29c3p, hsa-mîR-339-5p, hsa-miR-34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsa-miR-497-5p, hsamiR-671-3pl hsa-miR-6748-3p, hsa-miR-92a-3p, hsa-miR-934, put-miR-1003, put-miR-1080, put-miR-1084, put-miR-1146 (2), put-miR-1204, put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-468, put-miR469, put-miR-476, put-miR-594, put-miR-6, put-miR-71, put-miR-742, put-miR-806, put-miR856, put-miR-893, put-miR-92, put-miR-958, put-miR-961, RNU4-6p, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, SNORA57, SNORD3B-2, tRNAl 20-AlaAGC, tRNA 18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.1249, U6.168, U6.375, U6.428, U6.601, UC022CJGI, YRNA-245, YRNA255, and YRNA-684; ampkfying the at least one RNA biomarker using a polymerase chain reaction; and detecting the amplified RNA biomarker.

In another aspect of the présent disclosure, there is provided a kit for use in a method of diagnosing and/or monitoring traumatic brain injury (TBI) in saliva from a human subject, the kit

-31 20986 comprising at least one probe spécifie for at least one RNA biomarker selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f-5p, hsa-let-7i-5p, hsa-miR-103a-3p, hsamiR-107, hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-12 6-5p (=miR-126*), hsa-miR135b-5p, hsa-miR-142-3 p, hsa-miR-142-5 p, hsa-miR-143-3p (=miR-143), hsa-miR-144-3 p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-148a-3p, hsa-miR-16-l-3p, hsa-miR-206, hsa-miR-21-5p, hsa-miR-29c-3p, hsa-miR-339-5p, hsa-miR-34b-3p, hsa-miR-425-5p, hsa-miR449a, hsa-miR-497-5p, hsa-miR-671-3p, hsa-miR-6748-3p, hsa-miR-92a-3p, hsa-miR-934, putmiR-1003, put-miR-1080, put-miR-1084, put-miR-1146 (2), put-miR-1204, put-miR-1207, putmiR-1306, put-miR-188, put-miR-209, put-miR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-468, put-miR-469, put-miR-476, put-miR-594, put-miR-6, put-miR-71, put-miR-742, put-miR-806, put-mîR-856, put-miR-893, put-miR-92, put-miR-958, put-miR-961, RNU4-6p, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, SNORA57, SNORD3B-2, ÎRNA120AlaAGC, tRNAl8-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.1249, U6.168, U6.375, U6.428, U6.601, UC022CJG1, YRNA-245, YRNA-255, and YRNA-684.

In some embodiments, the probe comprises a nucleic acid able to bînd to the at least one RNA biomarker.

In some embodiments, tire probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of the sequence of the target RNA biomarker.

In some embodiments, the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ ID NO: 1,2, 14, 16, 23, 26, 27, 29, 39, 40, 48, 71,72, 73,74,75,77, 78, 79, 80,81,82, 84,85, 86, 87, 89,97, 98,99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, [43, 144, 145, 146, 147, 148, 149, and 150.

In another aspect of the présent disclosure, there is provided a composition for use in a method of diagnosing and/or monitoring traumatic brain injury (TBI) in saliva from a human subject, the composition comprising at least one probe spécifie for at least one RNA biomarker selected from the group consisting of hsa-let-7a-5p, hsa-Iet-7b-5p, hsa-let-7f-5p, hsa-let-7i-5p, hsa-miR-103a-3p, hsa-miR-107, hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-126-5p (=miR-126*), hsa-miR-13 5b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-143-3p (=miR143), hsa-miR-144-3p (miR-144*), hsa-miR- 144-5p (-miR-144*), hsa-miR-148a-3p, hsa-miR16-1 -3p, hsa-miR-206, hsa-miR-21-5p, hsa-mîR-29c-3p, hsa-miR-339-5p, hsa-miR-34b-3p, hsa

-32 I miR-425-5p, hsa-miR-449a, hsa-miR-497-5p, hsa-miR-671-3p, hsa-miR-6748-3p, hsa-miR-92a3p, hsa-miR-934, put-miR-1003, put-miR-1080, put-miR-1084, put-miR-1146 (2), put-miR1204, put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-468, put-miR-469, put-miR-476, put-miR-594, put-miR-6, put-miR-71 _Ί put-miR-742, put-miR-806, put-miR-856, put-miR-893, put-miR-92, put-miR-958, put-miR-961, RNU4-6p, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, SNORA57, SNORD3B-2, tRNAl 20-AlaAGC, tRNA 18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.1249, U6.168, U6.375, U6.428, U6.601, UC022CJG1, YRNA-245, YRNA-255, and YRNA-684.

It will be appreciated that statements made herein in relation to any aspect of the invention may equally apply to any other aspect of the invention, as appropriate.

| EXAMPLES

Embodiments of the invention will now be described by way of example.

Example 1 Salivary Non-Coding RNA: Next Génération Biomarkers in Concusscd Rugby Football Union Players

I Study design

The Study of Concussion in Rugby Union through MicroRNAs (SCRUM study) is a prospective observational study of players (up to 1100) in the two highest tiers of senior professional domestic rugby compétition in England, the Premiership and Championship. The

- 33 I study is embedded within the ongoing RFU Injury Surveillance Programme for the 2017-2018 seasons.

Ail players, previous written consent, were asked to provide a single baseline samples of approximately 2mL of saliva during the preseason préparations (group B), before the training sessions if possible, at their clubs as well as completing a consent fonu detail ing the processing and handling of their samples, the anonymisation of their data and their right to withdraw their \ oluntary consent at any time. The investigators recorded the timing of these baseline extractions în relation to preseason training sessions, other injuries, or supplement/medication use,

During the season each time a player entered the Head Injury Assessment (HIA) process (group C), he was asked to provide a saliva sample. Players who had been removed during the match for a pitch side assessment, provided a sample during this medical évaluation, called H1A1, and consti tuted group Ca. If players exhibited clear sîgns of concussion, also known as category 1 sîgns, no pitch side évaluation was necessary - in accordance with World Rugby guidance - and the player was immediately and permanently removed from the match. These players formed the “Immédiate Permanent Removal” group (IPR). Ail players evaluated pitchside or immediately and permanently removed for concussion were subsequently assessed immediately after the match (HIA2) and at 36-481; post-match (HIA3). Samples were collected at each of these assessments. Therefore, we obtained saliva samples for groups C and IPR immediately post-match (group Cb and IPRb respectively) and 36h-48h HIA (group Ce and IPRc respective! y).

The HIAs at each time point take the form of a modified Sport Concussion Assessment Tool 5th Edition (SCAT5) which has been well studied as a diagnostic tool in the context of sports-related concussion and is complemented by baseline performance data in these assessments collected by the clubs during their preseason préparations. In this way, we investigated the presence of concussion diagnostic miRNAs noninvasîvely at multiple time points, which were matched to a standardised ciinical assessment and diagnostic threshold for concussion performed by a clinician with expérience in rugby head injuries. Ail IPR players were deemed to hâve been concussed. Group C players were deemed to be concussed if they faîled the HIA at any time point (HIA1, HIA2 or HIA3); otherwise they were cleared of concussion. Players who entered the HIA process for suspected concussion but were cleared were analysed separately.

Players diagnosed with concussion were also asked for a sample of saliva at the point at which they were cleared by their team physician to retum to compétitive play (Stage VI) (group Cd and IPRd), as per the Berlin Consensus Graduated Retum-to-Play (GRTP) protocol.

-34I

Whcnever a player was removed for an H IA, club medical teams also approached an “uninjured control’(group U) player for saliva samples after the game (group Ub) and at 36-48 hours later (group Uc). An “uninjured control” is a non-concussed player who has played approximately a match ed number of minutes în the same game and same playing position of the concussed player whenever possible. This allows for the description of miRNA profiles in response to the physical stress of athletic activity and exposure to the likely subconcussive blows, which corne from participation in a collision sport.

To rule out contamination from non-neurological injuries and musculoskeletal trauma, club medics collected samples from players removed from the field of play due to musculoskeletal injuries (orthopaedic Controls) (group M) at the same time points as the “uninjured control” group (group Mb and group Mc).

Ethics and dissémination

The SCRUM study runs under Unîversity of Birmingham (UoB) ethics (ERN_110429AP28) as part of the Répétitive Concussion in Sport (RECOS) study. This study was approved by the East of England - Essex Research Ethics Committee (REC) on 22 September 2017-REC I7/EE/0275; IRAS 216703.

Saliva collection

The samples were collected în Oragene®-RNA RE-100 saliva self-collection kit (DNA Genotek) which contains a RNA stabilîzing solution for a total of 8 weeks. Saliva was collected from each participant at enrollment followîng orally rinsing with tap water. The samples were then transported to the Unîversity of Birmingham where they were processed in line with the sample pot manufacturer’s guidance to allow freezing and storage.

Materials and Methods Next Génération Sequencing- discovery phase

Ail experiments were conducted at QIAGEN Genomic Services, Germany.

RNA préparation

RNA préparation was perfonned according to Oragene recommendations, except the use of the miRNeasy kit (Qiagen, Germany) instead of the RNeasy kit.

Next Génération Sequencing

Librarv préparation and sequencing

-35 20986

The ibrarv préparation was done using the QIAseq miRNA Lîbrary Kit (QIAGEN). A total of 5ul total RNA was converted into microRNA NGS libranes, Adapters containing UMIs were ligated to the RNA. Then RNA was converted to cDNA. The cDNA as ampli fied using PCR (22 cycles) and during the PCR indices were added. After PCR the samples were purified. Library préparation QC was performed using either Bioanalyzer 2100 (Agilent) or TapeStation4200 (Agilent). Based on quality ofthe inserts and the concentration measurements the libraries were pooled in equimolar ratios. The library pools were quantified using the qPCR ExiSEQ LNA™ Quant kit (Exiqon). The library pools were then sequenced on a NextSeq500 sequencing instrument according to the manufacturer instructions (NEBNext Multiplex Small RNA Library Prep Set for Illumina) to make approximately 163-175 base-pair sized libraries. Raw data as demultiplexed and FASTQ files for each sample were generated using the bcl2fastq software (Illumina inc.). FASTQ data were checked using the FastQC tool (www.bioinformatics.babraham.ac.uk/proeects/fastqc/).

_T. . I

Trimming

Cutadapt was used to extract information of adapter and UMI in raw reads, and output from cutadapt was used to remove adapter sequences and to collapse reads by UMI with inhouse script. |

UMI correction

According to the experiment protocol, each raw read was expected to contain, starting from 5’end, an insert sequence, the adapter sequence, 12nt-long UMI sequence, and other ligated sequence. Depending on the read length and insert length, not ail parts were présent in ail reads. To correct PCR bias with UMI information, raw reads were processed as described below:

1. Use cutadapt on raw reads with provided adapter sequence to acquire output with information about the presence of adapter for each read.

2. Parse cutadapt output and keep only reads that fulfil ail of the following requirements: - Reads contain adapters.

| - Insert sequence should be equal or larger than minimal insert length (default 16nt).

- UMI sequence should be equal or longer than minimal UMI length (default lOnt).

3. Extract insert sequences from reads which do not contain fiill length UMI sequence from step 2 output as partial-UMI reads.

-3620986

4. Examine reads with full length UMI in step 2 output and identify ail unique insert+UMI combinations. Extract insert sequences from unique insert + UMI combinations as full-UMI reads.

5. Combine partial-UMI reads and full-UMI reads as output of UMI correction.

Mapping

A référencé profile of sequencing data for each sample was obtained using the whole human genome sequencc GRCh37, downloaded from the Genome Référencé Consortium and mirbase_20 as annotation reference. Reads were aligned to the miRbase using Bowtie2. The mapping criteria for alîgning reads to spike-ins, abundant sequence and miRBase were the reads hâve to bave perfect match to the reference sequences. For mapping to the genome the restriction of one mîsmatch was allowed in the first 32 bases of the read. No indels were allowed in mapping. Unaligned reads were mapped against the host reference genome and used as input for mirPara and miRbase to predict putative miRNAs.

Differentiai Expression

Aligned reads were counted and differentiai expression analysis, p-values for significanily differentially expressed microRNAs and false discovery rate according to Benjamini-Hochberg were performed with EdgeR. For normalisation, the trimmed mean of Mvalues (TMM) method based on log-fold and absolute gene-wise changes in expression levels between samples was used.

Unsupervised analysis

Principal component analysis is performed with R using TMM-normalized quantifications from defmed collections of samples as input.

MiRNA qPCR Data analysis - validation study

Ail experiments were conducted at QIAGEN Genoinic Services, Germany.

MiRNA qPCR validation was performed in 176 saliva baseline samples (B); 42 samples form concussed players after injury (group Ca); 52 samples from concussed players post-match (group Cb) and 54 concussed players after 36-48h (group Ce); 61 uninjured players post-match (group Ub); 45 uninjured players 36-48h (group Uc); 30 musculoskeietal injury players postmatch (group Mb); 24 musculoskeietal injury players 36-48h (group Mc).

RNA extraction and qPCR

-3720986

Total RNA was extracted from the samples using miRNeasy SerumTlasma kit (QIAGEN) after manufacturer’s instructions. The purified total RNA was ehited in a final volume of 32 μΐ. 14 μΐ RNA was reverse transcribed in 70 μΐ reactions using the miRCURY LNA RT Kit (QIAGEN). cDNA was diluted 50 x and assaycd m 10 μΙ PCR reactions according to the protocol for miRCURY LNA miRNA PCR; each miRNA was assayed once by qPCR on the miRNA Ready-to-Use PCR, Custom panel using miRCURY LNA SYBR Green master mix. Négative Controls excluding template from the reverse transcription reaction was performed and profil ed like the samples. The amplification was performed in a LightCyclcrp 480 Real-Time PCR System (Roche) in 384 well plates. The amplification curves were analyzed using the Roche LC software, both for détermination of Cq (by the 2nd dérivative method) and for melting curve analysis. The amplification efficiency was calculated using algorithms similar to the LinReg software. Ail assays were inspected for distinct melting curves and the Tm was checked to be within known spécifications for the assay. Furthermore assays must be detected with 0 Cq less than the négative control, and with Cq<37 to be included in the data analysis. Data that did not pass these criteria were omitted from any further analysis. Cq was calculated as the 2nd dérivative. Nonnalization was performed based on the average of hsa-miR-29c-3p and hsa-let7b-5p (custom normalîzer assays), the two more stable miRs identified across ail samples by Normofinder software (33). The formula used to calculate the normalized Cq values is the différence between the custom normalîzer assays mean Cq and the assay Cq (miRNA of interest). A higher value indicates that the miRNA is more abundant in that sample.

Statistical Analyses

Ail analyses were carried out using SPSS 20.0 (SPSS Inc., Chicago, IL, USA).

Group comparisons

We used the two-tailed Independent-Samples T Test procedure to compare means for two groups of cases. The two-tailed P ai red-Samples T Test procedure compares the means of two variables for a single group. The procedure computes the différences between values of the two variables for each case and tests whether the average dîffers from 0. Bootstrapping is a method for deriving robust estimâtes of standard errors and confidence intervals for estimâtes. Bootstrapping is most useful as an alternative to parametric estimâtes when the parametric inference is impossible.

The One-Way ANOVA procedure produces a one-way analysis of variance for a quantitative dépendent variable by a single factor (îndependent) variable. Analysis of variance is used to test the hypothesis that several means are equal. This technique is an extension of the

-38 20986 two-sample / test. In addition to determinîng that différences exist among the means, you may want to know which means differ. There are two types of tests for comparing means: a priori contrasts and post hoc tests. Contrasts are tests set up before running the experiment, and post hoc tests are run after the experiment lias been conducted.

General Linear Model Repcatcd Measures analyzes groups of related dépendent variables that represent different measurements of the same attribute. It is possible defme oné or more within-subjects factors for use in GLM Repeated Measures.

Discriminant A nalysis

The Discriminant analysis (DA) was applied to the Cq values provided by Qîagen.

The main purpose of DA was to fmd the dimension(s) along which groups differ and to fmd classification function(s) to predict group membership from a combination of variables (predictors). In the présent case, the two groups were concussed (group C+IPR) and uninjured subjects (group U), and the predictors were a set of biomarkers selected from the NGS study.

DA works with data that is already classified into groups to dérivé rules for classifying new (and as yet unclassified) individuals on the basis of their observed variable values.

In univariate tenus (t-test, Oneway Anova) a significant différence among groups implies that, given a score, you can predict which group it cornes from. In DA, there is often an effort to interpret the pattern of différences among the predictors as a whole in an attempt to understand the dimensions along which groups differ reliably.

With only two groups, there is only one linear combination of predictors that best séparâtes thein. The séparation of two group centroids (multivariate version of means), represents the best linear combination of predictors that separate the groups 1 and 2. A line parai lel that connects the two centroids represents the linear combination or discriminant fonction, a pattern of scores that discriminâtes between the two groups.

There are two facets of DA, and one or both may be emphasized in any given research application. The researcher may be înterested in a decision rule for classifying cases where the number of dimensions and their meaning is irrelevant. Or the emphasîs may be on interpreting the results of DA in terms of the combinations of predictors (discriminant fonctions) that separate various groups from each other.

Classification functions are used to predict group membership for new cases and to check the adequacy of classification for cases in the same sample through cross-validation.

The canonical corrélation explains the percent of variance accounted by the scores for the discriminant function between these groups. A canonical corrélation is a multiple-multiple corrélation because there are multiple variables on both sîdes of the régression équation, and for

-3920986 each discriminant function, when squared. indicates the proportion of variance shared between groups and predictors on that function.

In Standard (direct) DA, like standard multiple régression, ail predictors enter the équations at once and each predictor is assigned only the unique association it lias with groups. Variance shared among predictors contributes to the total rclationship, but not to any one predictor.

In Stepwise DA statistical criteria can be used to produce a reduced set of predictors.

Ail analyses were carried ont using SPSS 20.0 (SPSS Inc., Chicago, IL, USA).

ROC curve analyses

The diagnostic performance of a test, or the accuracy of a test to discriminate experimental cases from normal cases is evaluated using Receiver Operating Characteristic (ROC) curve analysis. ROC curves can also be used to compare the diagnostic performance of two diagnostic tests.

When one considers the results of a particular test in two populations, one population with a characteristic and the other population without the characteristic, you wîll rarely observe a perfect séparation between the two groups. Indeed, the distribution of the test results wîll overlap.

In a ROC curve the true positive rate (Sensitivity) is plotted in function of the false positive rate (100-Specificity) for different cut-off points of a parameter. Each point (cut-off) on the ROC curve represents a sensitivity/specifîcity pair corresponding to a particular decision threshold. The area under the ROC curve (AUC) is a measure of how well a parameter can distinguish between two diagnostic groups (experimental/normal). A test with perfect discrimination (no overlap in the two distributions) has a ROC curve that passes through the upper left corner (100% sensitivity, 100% specificity). Therefore the doser the ROC curve is to the upper left corner, the higher the overall accuracy of the test.

ROC statistics

Sensitivity: probability that a test resuit will be positive when the characteristic is présent (true positive rate, expressed as a percentage). I

Specificity: probability that a test resuit wîll be négative when the characteristic is not présent (true négative rate, expressed as a percentage).

Positive likelihood ratio: ratio between the probability of a positive test resuit given the presence of the characteristic and the probability of a positive test resuit given the absence of the characteristic, i.e. = True positive rate / False positive rate = Sensitivity / (1-Specificity)

-4020986

Négative likelihood ratio', ratio between the probabil ity of a négative test resuit given the presence of the characteristic and the probability of a négative test resuit given the absence ofthe characteristic, i.e. = Faise négative rate / True négative rate = ( 1 -Sensitivity) / Specificity

Results |

Sample size

A total of 906 players were recruited to the study between July 2017 and April 2018. This included players from 11 clubs playing in The Premiership and 11 clubs playing in the IP A Championship. One club in The Premiership chose not to take part after consultation with the RFU as they were already participating in a concussion research project involving saliva sampling for different purposes run by another organisation. One club in the IPA Championship chose not to take part as they felt they would struggle to fùlfil the requirements of the study due to limited numbers of medical staff while another club in the IPA Championship felt decided to withdraw from the study for similar reasons but after their players had provided baseline samples. This made a total of 11 clubs in The Premiership and 10 clubs in the IPA Championship participating in collecting samples through the season from head injury events.

Overall, a total of 229 head injury incidents took place across both compétitions. This figure is an amalgamation of incidents in which the player was immediately and permanently removed from play due to exhîbiting “Category 1” sîgns and symptoms, as well as ail ofthe incidents in which players were temporarily removed from play for an off field HIA1 assessment. Samples were received from a total of 129 of these incidents making overall compliance 56%.

Samples were received from 73 of a possible 120 incidents in which the on field or subséquent diagnosis was concussion (61%). Within this group 26 (36%) were incidents in which the player was immediately and permanently removed from play due to exhîbiting “Category 1” signs and symptoms, Samples were received from 42 of a possible 109 incidents in which the on field or subséquent diagnosis excluded concussion (39%).

Matched uninjured control samples were received in 71 cases (55%). Matched musculoskeletal injury control samples were received in 39 cases (30%).

Next génération sequencing - discovery phase

MicroRNA/small RNA Next Génération Sequencing (NGS) was performed in the initial discovery phase using 15 saliva baseline samples (B), 15 samples from concussed players (consisting of 10 concussed (C) and 5 IPR) and 20 Controls (consisting of 10 musculoskeletal i

-41 20986 injuries (M) and 10 uninjured players (U)). Ail samples analysed in this phase were collected post-match (time point b).

On average 16.3 million reads were obtained per sample. A detailed microRNA/small RNA NGS data analysis report was obtained. The differential expression analysis step attempts to distinguish biological variation from technical variation within the experiment, assuming that this varies amongst microRNAs.

P-val u es for significantly differentially expressed microRNAs are estimated by an exact test on the négative binomial distribution. A list of microRNAs predicted to be differentially expressed between the given experimental conditions was created. This list inchides different RNA fragments, among these known microRNA, other small non-coding RNAs, and predicted microRNA (described as put-miR) differentially expressed between groups C+IP and M+U, B and C+IPR, and B and M+U.

Sélection for validation

A panel of microRNA/smalI RNA/put microRNA, differetially expressed in NGS analysis was selected in the group C+IPR and M+U according the following paramenters: FDR<0.5 or p-value <0.05. The Panel consisting of 168 small RNAs, 38 known microRNAs and 233 put-miRs was used for the validation study by qPCR. Following this test, the most significantly altered bîomarkers were reduced to 30 known microRNAs; 34 putative miRs; 28 small non-codingRNA, which were then analysed in a further 405 samples. The Cq values obtained from the 2 qPCR validation sets were finally merged and collected in a total of 598 samples.

Statistical analysis - validation study

SncRNAs differentially expressed in group C vs U+M

Concussion samples were compared to uninjured and musculoskeletal injury at different time points. Table 5 shows the sncRNAs survived to a p value <0.05 among the different comparisons: Ca vs U+M b (no samples were collected at time point a for the category U and M, for this reason the group Ca was compared to the closest time point, U+M b), Cb vs U+M b; Ce vs U+M c. The table also includes: AUC, CI, count, CT average, SD, ddcq, fold change and power analysis for each individuai biomarker.

The bîomarkers selected from the STEPWISE analysis are shown in grey cells of Table 5 and presented an AUC of 0.86; 0.86 and 0.97 in Ca vs U+M b; Cb vs U+M b; Ce vs U+M c comparisons respectively.

-4220986

SncRNAs differentially expressed in group C vs U

Concussion samples were comparer! to uninjured control group only at different time points. Table 6 shows the sncRNAs survived to a p value <0.05 among the different comparisons: C’a vs Ub; Cb vs Ub; Ce vs Uc. The table also includes: AUC, Cl, count. CT 5 average, SD, ddeq, fold change and power analysis for each individual biomarker. The biomarkers selected from the STEPW1SE analysis are shown in grey cells of Table 6 and présentée! an AUC of 0.S3; 0.91 and 0.97 in the following comparisons Ca vs Ub; Cb vs Ub; Ce vs Uc respectively.

SncRNAs differentiaUv expressed in group C vs B

Concussion samples were compared to the baseline data of the saine subjects. Table 7 shows the sncRNAs survived to a p value <0.05 in the different comparisons: Ca vs B Cb vs B; Ce vs B. The table also includes: count, CT average, SD, ddeq, fold change and power analysis for each individual biomarker.

SncRNAs differentially expressed in group C m M

Concussion samples were compared to musculoskeletal injury control group only at different time points. Table 8 shows the sncRNAs survived to a p value <0.05 among the different comparisons: Ca vs Mb; Cb vs Mb; Ce vs Mc. The table also includes: AUC, CI, count, 20 CT average, SD, ddeq, fold change and power analysis for each individual biomarker. The biomarkers selected from the STEPWISE analysis are shown in grey cells of Table 8 and presented an AUC 0.96; 0.83 and 0.94 in the following comparisons Ca vs Mb; Cb vs Mb; Ce vs Mc respectively.

MicroRNAs differentially expressed between Cb and U+M b groups (FDR<0.5 or p25 value <0.05), selected by NGS analysis and used for the first qPCR validation step are shown in Table 3A, below.

Table 3A

micro RIN As	logFC	logC PM	p-Valuc	FDR
hsa-miR-199a-5p	-3.79380184	5.744164606	8.15823E-06	0.004797041
hsa-miR-133a-3p	-4.95698696	10.40020121	7.04586E-05	0.020714819
hsa-miR-206	-4.6959152	9.788488822	0.000180043	0.03528849
hsa-miR-1273h-3p	2.629420889	3.481729832	0.001297451	0.190725263
hsa-miR-133b	-4.20181151	6.465178373	0.002184888	0.256942851
hsa-miR-561-5p	1.579551555	4.525850808	0.003970504	0.348018465
hsa-miR-126-3 p	-1.41838668	8.449681001	0.004143077	0.348018465
hsa-niiR-16-l-3p	1.43849327	4.458454478	0.005764959	0.352449414

-43 20986

microRNAs	logFC	logCPM	p-Val ne	FDR
hsa-miR-449b-3p	3.467958972	3.218975	0.005920497	0.352449414
hsa-miR-449c-5p	2.749952622	5.534179256	0.006033974	0.352449414
hsa-miR-6748-3p	4.143101791	3.188086662	0.007073212	0.352449414
hsa-miR-133a-5p	-3.92797466	4.752927061	0.008472679	0.352449414
hsa-miR-34b-3p	2.1437498	4.339967792	0.008637^15	0.352449414
hsa-miR-6824-3p	2.731145621	3.076936275	0.008970282	0.352449414
hsa-miR-5195-5p	5.376105018	4.09767258	0.009313959	0.352449414
hsa-miR-5096	2.906908779	4.723794715	0.00959046	0.352449414
hsa-mtR-4488	3.491520052	3.097320079	0.012515423	0.409279535
hsa-miR-92a-3p	-0.60902412	10.49283489	0.012885103	0.409279535
hsa-miR-1	-2.36876254	10.80951287	0.013692259	0.409279535
hsa-miR-885-5p	1.507019382	4.182851751	0.013921073	0.409279535
hsa-miR-548h-5p	2.055544755	3.480848725	0.015148132	0.42414769
hsa-miR-1246	0.980484408	14.78271469	0.017085283	0.445746733
hsa-miR-4492	-3.18487947	3.53612341	0.017435672	0.445746733
hsa-miR-484	1.274418725	6.148369199	0.019071294	0.449461809
hsa-miR-449a	2.203777576	6.338766334	0.019109771	0.449461809
hsa-miR-3122	3.142476669	3.078975177	0.02000366	0.452390465
hsa-miR-Ι 180-3p	1.165471248	3.889331639	0.021316281	0.457201951
hsa-miR-619-5p	2.792045377	3.207604869	0.021771521	0.457201951
hsa-miR-2277-5p	1.067026052	4.057818901	0.023836409	0.474930011
hsa-miR-5699-3p	1.876788488	2.955683933	0.024231123	0.474930011
hsa-miR-125b-2-3p	-0.96587973	4.933520984	0.025679562	0.487083301
hsa-miR-4449	2.06863176	3.047374886	0.027679506	0.503997815
hsa-miR-67I-3p	1.125735449	3.934232773	0.02867908	0.503997815
hsa-niiR-33a-3p	0.959071217	4.091785492	0.029142731	0.503997815
hsa-miR-193b-5p	-1.14025756	4.138245693	0.031271072	0.522692794
hsa-miR-34c-3p	1.690242737	4.489423918	0.0320016	0.522692794
hsa-miR-339-5p	1.057419584	7.902671962	0.034354837	0.545963351
hsa-miR-6813-3p	2.813650185	2.933287004	0.035310016	0.546376034
hsa-miR-671-5p	0.838663749	5.600518309	0.047339286	0.598988904
hsa-miR-1537-5p	1.129462606	4.117629615	0.048138455	0.598988904
hsa-miR-193a-3p	-1.5845588	3.995294293	0.048897053	0.598988904
hsa-miR- 130a-3p	-0.88824466	6.580760266	0.051263632	0.604409433
hsa-miR-126-5p	-1.22112275	8.006357503	0.051621005	0.604409433

Other sncRNAs dîfferentially expressed between Cb and U+M b groups (FDR<0.5 or pvalue <0.05), selected by NGS analysis and used for the First qPCR validation step are shown in

Table 3B, below.

Table 3B

sniall non-coding RNAs	JogFC	logCPM	p-Value	FDR
tRNA138-ArgACG	-2.27538237	7.674009775	0.000243882	0.204980883
RNU6-11	-1.67718785	4.732492163	0.000245185	0.204980883
tRNAll-ArgACG	-2.21044709	7.59261144	0.000408122	0.204980883
RNU6-36	-1.84798113	4.63862015	0.000436362	0.204980883
tRNA175-SerGCT	-1.84762954	8.390549302	0.001054009	0.290869197
U3.39	4.655316415	4.424357984	0.001147835	0.290869197

-4420986

small non-coding RNAs	lugFC	logC PM	p-Val ne	FDR
RNU4-6P	-1.71160894	4.864935322	0.001317818	0.290869197
U6.375	-1.86391998	4.231358228	0.001366655	0.290869197
snoU 13.63	4.286830869	4.29762358	0.001552935	0.290869197
t RN A 8 -T lu AG T	-1.65324248	9.428427256	0.001556007	0.290869197
RNU6-1	-1.37118776	4.843026936	0.001713194	0.290869197
RNU6-31	-1.53604238	4.741724921	0.002351551	0.290869197
tRNA4-ArgTCG	-1.70070174	10.2139807	0.002452994	0.290869197
tRNAl 30-ValCAC	-2.21562973	4.853113645	0.002797565	0.290869197
U3.3	-1.72401526	5.267608648	0.002991025	0.290869197
U4.57	-1.55456476	4.807782758	0.003084965	0.290869197
tRNA84-GluTTC	-1.39818637	10.32369425	0.003223874	0.290869197
U6.428	-1.83108856	4.169870903	0.003289229	। 0.290869197
U3.4	-1.80036039	5.421618508	0.00346512	0.290869197
tRNA95-AsnGTT	-2.24304788	4.752212371	0.003469246	0.290869197
uc003oif.3	-2.59243747	4.028384043	0.003838286	0.290869197
U3.2	-1.73251154	5.414684824	0.003880282	0.290869197
U3.42	2.126244843	4.003126274	0.003910676	0.290869197
uc002tgp. 1	2.810368883	4.510093789	0.004221387	0.290869197
tRNAl 05-Pseudo TTC	-1.59015632	7.983774255	0.004475105	0.290869197
tRNA4-GluCTC	-1.60952388	8.107675756	0.00453217	0.290869197
RNU6-14	-1.86375965	4.058373711	0.004721183	0.290869197
tRNA4-ThrAGT	-1.34446936	8.68050744	0.004730298	0.290869197
U6.97	-2.76317407	3.745083257	0.004815026	0.290869197
tRNAl 20-AlaAGC	-1.31815493	9.587766586	0.004875694	0.290869197
snoU 13.348	2.256666202	4.075754187	0.005036202	0.290869197
U1.105	-2.32216301	4.207692971	0.005058512	0.290869197
tRNA27-MetCAT	-2.34782418	6.706470837	0.0051084	0.290869197
U1.10	-2.59329176	4.816351388	0.005540106	0.306172302
tRNAl 34-GluTTC	-1.3431528	10.39664851	0.006091168	0.32697053
RNU6-6	-1.54430018	4.19348578	0.00626447	0.32697053
Y_RNA.75	1.904869354	5.50161645	0.006713926	0.340251318
tRNA8-Undet	1.964251986	4.197405842	0.006905386	0.340251318
SNORA25	-2.35025006	3.740784336	0.007062161	0.340251318
RNU6-39	-1.60601357	4.333253034	0.007621329	0.3538182
tRNAl 19-AlaCGC	-1.25397272	9.514833568	0.007808074	। 0.3538182
tRNA85-PseudoTTC	1.126764653	5.8624175	0.008322426	0.3538182
U6.254	-1.80163898	3.954386151	0.008365638	0.3538182
tRNA3-ArgCCT	-1.40848109	10.46544955	0.008483646	0.3538182
SNORD114-2	-3.1187271	3.929437693	0.008576479	0.3538182
tRNAl 62-MetCAT	-2.31337858	6.829504657	0.008700411	0.3538182
Y_RNA.661	-2.13613309	3.924521406	0.008896949	0.3538182
tRNA8-AlaTGC	-1.03417608	10.23229845	0.009262877	0.3538182
tRNA56-ThrTGT	-1.43137722	10.38511882	0.009580922	0.3538182
tRNA26-AsnGTT	-1.2260783	8.800207822	0.009587969	¹ 0.3538182
tRNA73-ArgCCG	-0.87676773	7.646480047	0.009603368	0.3538182
tRNAl 56-ArgACG	-1.38659506	6.417990561	0.009974671	0.36043089
tRNA28-IleAAT	-0.96475102	8.290575814	0.010463073	0.370945534
RNU6-33	-1.41177741	4.713635974	0.010694162	0.372117242
tRNA3-ProTGG	2.564031745	13.63247318	0.01106572	0.37247176
tRNA19-ArgTCG	-1.57386692	9.439040466	0.011100808 .	0.37247176

-45 20986

smal! non-coding RNAs	iogFC	logCPM	p-Vahie	FDR
tRNA164-MetCAT	-2.24158666	6.824859219	0.01 1731788	0.372701442
tRNA13-AlaCGC	-1.05980195	9.619304583	0.01 1862589	0.372701442
U6atac.4	-2.29659983	4.169967341	0.012205483	0.372701442
tRNA9-A!aAGC	-1.76859219	4.913678407	0.01220683^	0.372701442
tRNA132-PseudoCAC	-2.28282945	4.122549605	0.01224905 1	0.372701442
RNU6-7	-1.54429239	4.25135459	0.012297759	0.372701442
tRNA20-MetCAT	-1.09889413	8.557399735	0.012787128	0.376829052
U3.24	-1.49142526	5.576968961	0.01283505	0.376829052
U6atac.29	-2.38352866	3.785989635	0.013059629	0.377523747
tRNA2-LeuTAA	-1.66936742	3.974107686	0.013474016	0.383601 155
tRNAl-AsnGTT	-0.93147558	7.962088764	0.014090452	0.39410967
tRNA40-ThrAGT	-1.20252417	8.00746198	0.014483817	0.39410967
Y_RNA.684	2.380168702	3.849210771	0.014510103	0.39410967
snoU 13.86	3.047260829	3.887450563	0.014700195	0,39410967
uc021qtn. 1	-2.42558461	4.054546636	0.015164662	0.39410967
RNU6-9	-1.27226823	4.707463894	0.01590456	0.39410967
tRNA13-AlaTGC	-1.07694323	9.510390292	0.016125256	0.39410967
tRNA36-ArgACG	-1.42222279	6.510745574	0.016234233	0.39410967
Y_RNA.719	-1.87621292	4.049552581	0.016340695	0.39410967
RNU6-10	-1.35736219	4.333057065	0.016389921	0.39410967
SCARNA4	0.900162218	5.772147414	0.016691546	0.39410967
tRNAlO-AlaCGC	-1.08617369	9.364295675	0.016698714	0.39410967
tRNA12-SerAGA	-2.17129695	3.960150632	0.016746309	0.39410967
ucO 11 ley.2	-1.1603733	7.787151849	0.01677955	0.39410967
Ul.l 16	-2.53057666	4.143384152	0.017351703	0.3975759
tRNA7-SerGCT	-1.22744148	8.048077286	0.017683906	0.3975759
U6.266	-1.68215765	4.162672228	0.018006863	0.3975759
tRNA136-AsnGTT	-1.18546894	6.252578135	0.018057145	0.3975759
ucO3 1 qaf. 1	3.07982529	4.21672176	0.018100789	0.3975759
RNU4-9P	1.971224737	3.892961999	0.018196662	0.3975759
RNU6-48	-1.41494718	4.179417866	0.018610429	0.40194249
U4.64-201	-1.46842052	4.573943777	0.019052174	0.405290215
SNORA70.5	-2.3066839	3.705457206	0.019552672	0.405290215
tRNA83-AsnGTT	-0.95893311	7.650753844	0.019695599	0.405290215
tRNA21-ArgCCT	-1.3243702	9.463647642	0.019740822	0.405290215
RNU6-26	-1.26772628	4.674223977	0.019843906	0.405290215
tRNA4-AsnGTT	-0.95216219	7.630343605	0.020477143	0.409060595
U1.28	-1.66671858	4.666167958	0.020920233	0.409060595
U6.168	-1.75957771	3.988195609	0.021394709	0.409060595
RNU6-41-201	-1.2429829	4.599263654	0.021413125	1 0.409060595
tRNA!5-ThrCGT	-0.94643604	8.011751983	0.021715336	0.409060595
tRNA88-PseudoCCT	1.406009411	4.775992477	0.021727046	0.409060595
SN0RJD116-19-201	-2.08108498	3.769046556	0.022072958	0.409060595
ucO31qtw. 1	-1.59586877	3.698957807	0.0221 11714	0.409060595
U6.422-201	-2.18510267	3.771206474	0.022136152	0.409060595
U2.3-201	-1.09052752	5.567176812	0.022205525	0.409060595
U3.20-2 01	-1.55295135	5.225744713	0.022487766	0.410237987
tRNA165-IleAAT	-0.81674152	8.525161575	0.023067622	0.416176914
snoU13.160-201	-1.88380693	3.690235583	0.023604159	0.416176914
lRNA36-ThrAGT	-1.09203025	7.99788872	0.023653935	0.416176914

small noii-coding RNAs	logFC	logC PM	p-Vu lue	FDR
tRNA6-TrpCCA	-1.06582891	10.59444161	0.023699271	0.416176914
SNORA57-201	-1.08263716	5.14915277	0.024108905	0.416665441
tRNAlO-PseudoTGA	-1.42087364	5.662435588	0.02417328^	0.416665441
uc001mni.3	-2.42408101	4.681561536	0.02449142	0.416665441
Y_RNA.428-20l	-1.2545658	6.369684888	0.024614084	0.416665441
SCARNA1-201	-1.61719768	3.852134167	0.025631096	0.427567583
tRNA95-AlaAGC	-1.73027899	5.825175769	0.02592783	0,427567583
RNU6-27-201	-1.6140049	3.926299889	0.025940769	0,427567583
SNORA79.1-201	-1.15165538	4.196182085	0.026538748	0.433620064
tRNA9-IleAAT	-0.73350055	8.536774944	0.027547951	0.446033785
tRNA9-TyrGTA	-1.6487492	3.959996969	0.027773259	0.446033785
tRNA23-ArgCCG	-1.31033598	11.27930104	0.029044541	0.450180862
snoU13.318-201	-1.91587082	3.698261411	0.029045067	0.450180862
snoU13.328-201	2.684496203	4.280709032	0.029064976	0.450180862
RNU4-4P-201	-1.2311376	4.615863264	0.029137817	0.450180862
Y_RNA.633-201	-1.30999509	4.118055921	0.029229412	0.450180862
RNU5F-4P-201	-1.48557387	4.239223966	0.03016703	0.460844298
tRNA7-AsnGTT	-0.88097126	7.861805832	0.031177808	0.472444358
tRNA2-ArgCCT	-1.14460252	9.768619156	0.031689267	0.476353057
tRNA18-ArgCCT	-1.24884324	9.421599432	0.032541851	0.484021239
SNORD116-25-201	1.724675764	6.034751745	0.032861609	0.484021239
uc021ybm.l	-0.9249247	7.924193472	0.033450576	0.484021239
tRNA8-SerGCT	-0.98753133	8.589816708	0.033481121	0.484021239
tRNAl 1-IleAAT	-0.72451906	8.545784821	0.033487366	0.484021239
Y_RNA. 597-201	1.732733959	3.760735382	0.034265836	0.491492414
snoU13.120-201	2.312826375	3.740373282	0.034550843	0.491826017
uc031qpu. 1	2.324532842	3.768342356	0.035349099	0.49676233
RNU6-32-201	-1.18812391	4.327815738	0.035426372	0.49676233
tRNAl OO-PseiidoG AA	-1.02843913	9.329302032	0.036035102	0.501555229
SNORD116-21-201	2.33201432	3.747426753	0.039146195	0.532853476
tRNA5-IleTAT	-1.08777911	7.207879458	0.039415342	0.532853476
Y_RNA. 522-201	-1.81515534	4.101934504	0.039799275	0.532853476
tRNA12-ArgCCT	-1.27295081	9.216801318	0,039946538	0.532853476
U6atac.20-201	-1.94596283	4.036085302	0.040551585	0.532853476
RNU6-4-201	-1.52406279	4.105411071	0.040667896	0.532853476
SNORD3B-2-201	-0.79576357	8.540015612	0.040838684	0.532853476
tRNAl 1-AsnGTT	-1.30462038	4.970141103	0.040850618	0.532853476
tRN A31-AsnGTT	-0.87710624	7.603607761	0.041107699	0.532853476
Y_RNA.727-201	-1.25639747	4.115195415	0.041225337	0.532853476
RNU6-73-201	-1.46456929	4.007858615	0.042069664	0.532853476
SNORA65-201	-0.88817274	4.89950806	0.042220138	0.532853476
tRNA7-LeuAAG	-0.71492427	8,880350642	0.042319347	0.532853476
tRNAl 44-AspGTC	-0.82964134	11.54055138	0.042320413	0.532853476
U6atac.25-201	-1.77774451	3.762252674	0.042537531	0.532853476
tRNAl-ArgCCG	-0.76847131	7.276226466	0.043525106	0.535998445
SNORA7.4-201	-1.13362614	3.738511771	0,043665668	I 0,535998445
tRNAl 25-ThrCGT	-1.08045128	5.458664529	0.043842913	0.535998445
RNU6-45-201	-1.22266691	4.217769003	0.043929622	0.535998445
tRNA131-GlnCTG	-1.07262477	7.700551934	0.04461864	0.538855811
U6.1249-201	1.668615649	3.756761746	0.044737364	0.538855811

-4720986

small non-coding RNAs	logFC	logCPM	p-Value	FDR
Y_RNA.245	2.25187274	3.754483152	0.045943642	0.545496798
U6.601	-1.35324491	3.970443965	0.046003943	0.545496798
RNU5E-4P	-1.0837447	5.498269856	0.046159655	0.545496798
tRNA66-AlaTGC	-0.81125784	9.226831102	0.046988475	0.545729532
tRNA32-MetCAT	-0.82679514	8.99856138	0.047086999	0.545729532
U4.79	-1.25353509	4.433132105	0.047164353	0.545729532
tRNA4-HisGTG	-1.61899083	3.790696889	0.047553836	0.545729532
U3. ! 3	-1.51261982	3.797771351	0.047790048	0.545729532
RNU6-5	-1.02972321	4.777615387	0.048416122	0.545729532
SNORD36A	-1.75616298	3.84054929	0.048459133	0.545729532
tRNAl-LeuAAG	-0.6699966	8.883794181	0.048648388	0.545729532
RNU6-29	-1.13048434	4.36662749	0.048793274	0.545729532

Putative microRNAs differentially expressed between Cb and U+M b groups (FDR<0.5 or p-value <0.05), selected by NGS analysis and used for the fisrt qPCR validation step are shown in Table 3C, below.

Table 3C

putative microRNAs	Sequences	iogFC	iogCPM	PValue	FDR
put-miR-718	TTCAGGTTACCGCAGG	6.82525 5	9.00908 9	1.21E- 05	0.01609
put-miR-594	TGATTTTTTTTGGCGAA	8.12208 9	13.6218 4	4.24E- 05	0.02819 7
put-miR-703	GACTGCTCGAGCTGCTT	4.58270 6	9.34009 1	0.00017 7	0.06527 6
put-miR-477	TGGGCAGCAAGAATGG	6.35030 8	8.65459	0.00021	0.06527 6
put-miR-727	GGAGGATTTCAATTGG	4.94423 9	7.84831 6	0.00024 6	0.06527 6
put-miR-646	TCTGTCATGGCTGAGC	6.55105 6	8.80897 9	0.00032 2	0.06527 6
put-miR-675	TACCTCAATTCTCTAGG	5.75609 5	8.53108 8	0.00038 7	0.06527 6
put-miR-319	TGTCGGCGGGGGCCCCGGAC	3.55792 1	10.2193 7	0.00040 9	0.06527 6
put-miR-327	CATTCTCTGAAACTACA	6.06230 1	8.47382 1	0.00044 1	0.06527 6
put-miR-3 3 8	GACTTGTGATTAGCGG	5.01397 8	10.5988 7	0.00057 1	0.06766 1
put-niiR-1187	GAGCATGTTGACTGGAGA	6.15080 7	8.51476 4	0.00063 4	0.06766 1
put-miR-6	GCGGACCTTGCTCAAGG	8.83050 3	11.1095 1	0.00065 9	0.06766 1

-48 20986

putative microRNAs	Sequences	logFC	logCPM	P Value	FDR
put-miR-341	TGAGAAAACATTTGAGG	5.70994 3	8.26064	0.00066 1	0.06766 1
pLit-miR-750	CAAGAGATGAGGAATG	5.58509 8	8.18431 4	0.00081 4	0.07204
put-miR-183	CCAGGCTGGTCGTGATGA	5.71686 7	8.80691 9	0,00085 5	0.07204
put-miR-980	TCGGAAGAAGAAGCTGACCCA	5.53353 1	8.15897 8	0.00086 6	0.07204
put-niiR-798	TAACTCTTGGAAATCTTGG	3.42259 3	9.96253 6	0.00101 6	0.07564 5
put-miR-765	AAAAAAGAGGGACAGAAATG	5.17307 3	7.96360 8	0.00112 3	0.07564 5
put-imR-71	GACCTTGGGTTGGGTCGTGGT	3.98979 6	8.73231 5	0.00113 \|1	0.07564 5
put-miR-1327	GAAAAGCAATCGTCACAG	7.09352 4	9.88753 5	0.00115 8	0.07564 5
put-miR-371	AATATTCAGCAGTCAGACTGG	6.77831 1	9.76818 6	0.00122 4	0.07564 5
put-miR-354	CAGGGTGATGACTTCTG	4.79512 8	7.78181 3	0.00130 2	0.07564 5
put-miR-688	GTGATGTCGGCTCATCGCAACCT	2.19918 5	10.6661 2	0.00130 7	0.07564 5
put-miR-756	TGAGGGATGTTTGGATGCTCGCTTTGA	2.03242 6	8.60355 3	0.00142 8	0.07921 5
put-miR-1146	CAACTGTAAGTCCATT	4.77083 2	9.19625 2	0.00158	0.07964 5
put-miR-1333	TAATTGTCCTCTTGGGG	4.79411 2	7.78617 1	0.00161 9	0.07964 5
put-miR-511	AAGCAGGCGTTACAATG	7.08963 2	9.54354	0.00163 1	0.07964 5
put-miR-1199	TGAACTCGGGAGAAGGAAGT	2.99405 1	11.9462 1	0.00170 2	0.07964 5
put-miR-705	CCTGTCTGACTGGGTCTCC	6.09735 6	9.46085 7	0.00175	0.07964 5
put-miR-1275	AAGAAGTAGACTGGATTGG	4.17564 3	7.54171 1	0.00181 7	0.07964 5
put-miR-1204	AGGGCTGGGCACGGGGG	3.32921 9	8.43806	0.00195	0.07964 5
put-miR-857	TAAGTGGGAGTGCTCATG	5.51977 5	8.38926 9	0.00195 7	0.07964 5
put-miR-806	CACGAGAGAACGCACACC	7.04401 6	9.99692 8	0.00204 8	0.07964 5
put-miR-680	GTTAAGTATGCACAGG	6.20766 9	9.29379 9	0.00204 8	0.07964 5
put-miR-5 76	TGGCATCCTGTCTCTTGC	5.45507 4	8.34397	0.00209 4	0.07964 5

-4920986

putative microRNAs	Seq uences	logFC	logC PM	P Value	F DR
put-miR-444	CTGAAAAGGGGACGGATTGGGAA	4.48146 5	8.25447 9	0.00232 7	0.08395 1
put-miR-1 132	CACGCTGTCTTTTGTTTCTCT	5.50560 9	1 1.5441	0.00235 7	0.08395 1
put-miR-1025	TGGAAGAGGGGAAAGGAGA	4.49262 8	7.66065 7	0.00241 8	0.08395 1
put-miR-496	CTAAGAGTATGAGTAGC	8.32090 3	10.6346 9	0.00246	0.08395 1
put-miR-657	TCAGGACATTGGACTCT	4.87542 2	9.30141 9	0.00263 3	0.08760 4
put-miR-625	GAGAAGACTGAATGCTCTTCTC	5.98826 2	8.70287 1	0.00269 9	0.08760 4
put-miR-40	GCTGGAATAGCTCAGTTGC	4.33971 3	10.8214 3	0.00295	0.09347 4
put-miR-666	C AGCATCATGATCATTATGG	6.35154 1	8.96772 l	0.00307 7	0.09525 9
put-miR-1098	AAGGCGAAGGATATGTTG	7.11729 8	9.56365 1	0.00317 1	0.09591 6
put-miR-538	CATTGTGCTTCGTGGGAGAGTAGGGC A	1.61443 1	8.76757 6	0.00342 2	0.10120 5
put-miR-952	GCCGACAGGTCCGGGTAA	5.04873 6	10.0986 4	0.00355 6	0.10150 6
put-miR-572	TAGATTCAGGAACTGCCA	7.28051 7	9.71535 3	0.00359 8	0.10150 6
put-miR-972	TTTAGTAGAATTGTGTTGGGT	3.27755 7	9.43030 8	0.00366 1	0.10150 6
put-miR-650	AAAAGCAAGGCGAAGAGG	2.91247 3	9.27815 7	0.00377 5	0.10253 8
put-miR-134	CAGACTGCTCGAGCTGCTGC	3.33926 7	9.21885 1	0.00386 6	0.10290 8
put-miR-975	TTTGCAGACTGGAAACT	5.62543 5	8.45131 6	0.00425 2	0.10935 6
put-miR-161	TGTCTGTAGCAATGTGCT	6.21420 5	9.44922 4	0.00455 3	0.10935 6
put-miR-1265	TGGGGATAAAGTTAGGT	3.43306 6	12.5513 5	0.00455 9	0.10935 6
put-miR-968	TGGCTGTTGCACTTCT	8.03171	10.3638 4	0.00466 1	0.10935 6
put-miR-1125	TTGAAGACTGGCTCTCA	4.53073 4	8.35528 6	0.00501	0.10935 6
put-miR-892	CAACGGTCTTGAAAACA	3.23972 3	8.81171	0.00501 5	0.10935 6
put-miR-1306	ATAACGTCATCTAGTGTG	4.74422 1	10.5601 6	0.00506 5	0.10935 6
put-miR-948	TGGAAGAAAACGAGGAG	5.80702 3	8.56985 8	0.00520 4	0.10935 6

-5020986

putative microRÏNAs	Sequences	logFC	logC PM	PVakie	FDR
put-miR-925	ATTTTGGTCTGTTGGTT	4.38433 8	8.64365 9	0.00534 2	0.10935 6
put-miR-259	ATGTAACCG GG CTTTTGTGCT	1.78660 l	8.59884 8	0.00537 8	0.10935 6
put-miR-209	GGTCCTCGGATCGGCC	4.05342 7	9.54215 5	0.00541 7	0.10935 6
put-miR-773	CAGGC AGAAGGGAGCTTGT	-2.64537	7.45467	0.00551 4	0.10935 6
put-miR-910	CACGTTCTTCTCATGGT	3.44974 7	7.34067	0.00564	0.10935 6
put-miR-664	AAAGTTGTGTTAGCTGA	5.71921 2	8.51182	0.00578 6	0.10935 6
put-miR-1068	TATGATTGTAAACTCTGA	5.89086 6	8.62272 5	0.00584 3	0.10935 6
put-miR-265	CACATGGGGGTAGAGCACTGACTGGG	2.11074 2	12.5411 3	0.00587 6	0.10935 6
put-miR-490	CTGCAGGAGTGTTTGAGA	2.05793 2	1 1.0763 9	0.00596 9	0.10935 6
put-miR-1155	CAAATGATCAAAGCAGG	2.49417 3	8.35413 7	0.00600 8	0.10935 6
put-rmR-893	ACCATCCTCTGCTACCA	2.57515 2	8.35830 9	0.00607 5	0.10935 6
put-miR-1342	ATC G G AAAATGTGGG AA	5.58546 8	8.41865 7	0.00622 6	0.10935 6
put-miR-967	AAATGCATTGGATATGG	7.08561 5	9.54959 1	0.00635 5	0.10935 6
put-miR-811	GTTGTAAAGCTCTGTTG	1.99226	9.06317 3	0.00636 2	0.10935 6
put-miR-812	GTTCTGAGTTCTTTGGTTGGA	7.52334 4	9.90715 8	0.00648 4	0.10935 6
put-miR-1084	AGGACCATTGCGTTGCC	6.45487 1	9.04042	0.00657 7	0.10935 6
put-miR-626	TTCACTACTTTATCTCTTTT	2.84980 1	9.70657 2	0.00657 7	0.10935 6
put-miR-127	AGACTGTGATGACTGGGAGAGCGGGC T	2.25174 5	7.71941 5	0.00658 15	0.10935 6
put-miR-219	GAGGCTCGAGAGCAATGGC	4.97287 2	8.41070 8	0.00660 4	0.10935 6
put-miR-863	AAGTTGGAGTATGTTTTAGG	4.17418 4	8.27004 6	0.00662 6	0.10935 6
put-mi R-3 3	CCATGACTGCAGATGG	4.43731 8	8.06201 8	0.00667 1	0.10935 6
put-miR-1246	CTGGAGATCTGTTTGGGC	6.38953 5	8.99351 2	0.00675	0.10935 6
put-miR-126	GTGGGGCTTAGTGCTGA	4.16008 6	8.05272	0.00684 9	0.10935 6
put-miR-459	GGGATCAACCTGACAA	7.00545	9.47012	0.00689	0.10935 6
put-miR-907	CCAACAGCTTCTGAGTTG	5.59966 4	9.28021	0.00692 3	0.10935 6
put-miR-171	GTCCTGTGTCTTGTACGG	2.35994 8	10.8634 1	0.00694 12	0.10935 6

- 51 20986

putative microRNAs	Sequences	logFC	logC PM	PValue	FDR
put-miR-1163	AGAGGACAGGGAAGCTT	6.42053 8	9.01706 9	0.00699 6	0.10935 6
put-miR-204	AGAAGTCAGAACCTCTAT	6.61011 1	9.1541 7 7	0.00713 8	0.10935 6
put-miR-498	G AC AG ATTTTAGCTTGTCC	2.21452 7	8.621 15 3	0.00714 8	0.10935 ' 6 :
put-miR-286	TAACAGGCGTTGAAATTGT	6.75407 1	9.26698 9	0.00746 8	0.11295 1
put-miR-223	GATGGGGGTAGAGCACTGC	2.25836	12.0739 9	0.00760 1	0.11367 1
put-mi R-7 5	TGGGGATTGTGGGTTCTC	2.00928 7	9.59807 5	0.00774	0.11417 4
put-miR-548	AGAGGACAGGGAAGCT	6.10486 6	8.78413 6	0.00792 3	0.11417 4
put-miR-l 118	AGAGGGTTCCTGTAGACCTAGGGAGG A	2.05377 7	10.2269 3	0.00792 5	0.11417 4
put-miR-943	AGCCAGAGTTCTGATTGTGAGTG	4.95465 2	9.72714 1	0.00797 8	0.11417 4
put-miR-313	TGAGTTCTTTGGTCAGAA	6.69372 3	9.21148 6	0.00821	0.11428 9
put-miR-659	AGTAGCTGGTCGATTTGGC	6.99638 3	11.7943 1	0.00841 6	0.11428 9
put-miR-210	CTTCAGACTGTGAAACTGA	2.99777 6	9.52277 9	0.00848 1	0.11428 9
put-miR-144	TAGAGATAGAGCTTATG	5.52926 7	8.37611 7	0.00848 9	0.11428 9
put-miR-563	TGGAGACATTAAC'fATGA	5.91579 1	8.64349 ]	0.00860 4	0.11428 9
put-miR-1140	TGGGAAGGGCTGCCGG	5.14578 8	9.31060 3	0.00860 6	0.11428 9
put-miR-497	TTGGTAGACTCTCACTT	4.01460 5	9.04369	0.00866 4	0.11428 9
put-miR-573	TGGATAACTCTTTTTGTA	6.44089 5	9.02150 7	0.00878 8	0.11428 9
put-miR-906	TATGGGAAGAATCTGGG	6.05455 9	8.74788 3	0.00879 3	0.11428 9
put-miR-231	TATGTCATGGTGGCTTTGG	-2.9467	8.39848	0.00891 8	0.11428 9
put-miR-85	GAATCCCACTTCTGACACCA	2.95262 6	7.66308 3	0.00901	0.11428 9
put-miR-884	ATGGTCTAGAGCTACAGGT	5.87047 7	8.62819 9	0.00911	0.11428 9
put-miR-918	CAGCTTCTTCCGCTTCTT	5.86005 1	8.60284	0.00917 4	0.11428 9
put-miR-985	GTACTGCATCTCTGCA	5.89860 7	8.62854 5	0.00918 8	0.11428 9
put-miR-3 20	ACTGGATCCAAGAAAAG	2.92015 6	8.22653 6	0.00957 1	0.11795
put-mi R-67	AGGACGTTGGTCAGAGC	2.89546 7	7.63679 9	0.00985 7	0.11941 9

- 52 20986

putative microRNAs	Séquences	logFC	F logCPM	PValue	FDR
put-miR-221	TCTCTCAATCCTCTTGG	5.95416 3	8.65865 1	0.00986 9	0.11941 9
put-miR-471	AGAAGCAGAGAACGAGG	3.98779 5	8.44957	0,00997 3	0.1 1958 5
put-miR-1352	TGGATTGTGGGGGAACC	5.47895 8	8.36409	0.01008 6	0.11985 7
put-nnR-610	AGGAGATATAGCTCTTGT	5.72207 9	8.51813 7	0.01039 2	0.12240 8
put-miR-48	AAAATGGATTCGAACCA	5.63244 3	8.45013 6	0.01060 2	0.12378 5
put-miR-529	TGACCTTTTGCCTTCTGC	5.42641 9	8.33857 2	0.01080 2	0.12501 8
put-miR-424	TAAAAAGTTCTCTGTTTTTC	-2.78953	7.20874 8	0.01093 7	0.12549
p ut-mi R-24	TTGGTGCATCTGTAGTCCAAC	4.93282 4	10.2404 5	0.01111 3	0.12641 8
put-miR-164	TGAAATTCTAAATATTGCA	5.72556 1	8.51014	0.01137 2	0.12695 7
put-miR-229	TGGGATTTAGCTCAGC	3.79960 9	8.12666	0.01142 4	0.12695 7
put-miR-525	AAGTGGGAAGGCCCAGA	3.72386 2	8.31762 9	0.01144 6	0.12695 7
put-miR-325	TTCAAATCCCACTTCTGACACCA	2.92709 4	7.78112 5	0.01244 3	0.13669 1
put-miR-188	AAATGGCGATACTCAGG	6.33528 6	9.48101 4	0.01255 9	0.13669 1
put-miR-1066	TGCTTTGATCGTAGCCC	3.20546 1	7.44767 5	0.01263 2	0.13669 1
put-miR-129 5	GAGGTTAGGATATCTGGCT	3.32406 9	7.58085 7	0.01289 3	0.13839
put-miR-588	TTTTGAACGTTCTTTCTT	1.98556 3	8.91029 8	0.01332 8	0.14168 3
put-miR-1273	AAGGGGAGGAATTTCACGTG	4.84532 4	8.57974 9	0.01341 3	0.14168 3
put-miR-783	AAGGAAAAAGCGGATA	3.72255 5	7.55942 7	0.01362 1	0.14275
put-miR-37	TGGTGGAGTGAAGACG	4.83626 1	8.54759 1	0.01417 4	0.14647
put-miR-1317	TGGAGTGTGGATTGGGG	1.62550 7	8.87036 5	0.01419 6	0.14647
put-miR-97	CTGCGTGGCTCTGACAC	3.27664	9.29695 6	0.01434 7	0.14688 9
put-miR-1016	AGGTAAAGCTCATGAGG	2.14100 9	9.30430 3	0.01456 7	0.14800 3
put-miR-546	CCAAGGGGTTGTAGGGCCACT	3.88001 8	10.6481 5	0.01502 7	0.15152
put-miR-1099	AG ACTCCTTTATCGTA	4.88126 5	8.35967 3	0.01517 8	0.15189 4
put-miR-874	ATGAGCATTGATTTAGG	4.13356 3	8.48184 7	0.01574 2	0.15277

-5320986

putative micro RN As	Sequences	logFC	logCPM	PValuc	FDR
pul-miR-701	TTGAGATTTGAGGGGGCCT	2.36116 5	8.44693 5	0.01578	0.15277
pm-miR-279	CTGTGAAGCCTGTTGGTTTGCTGCTG	2.00278 /	8.03642	0.01578 3	0.15277
put-miR-184	TGCTGAACCTCTGTATGT	5.6241 1 3	9.59809 7	0.01579 8	0.15277
put-miR-495	CAGGGAGTGAAAGAGAATT	2.79141 1	9.97348 4	0.01592 3	0.15277
put-miR-90	GAAGTTAAATCCTTGGG	3.64392 9	8.88668 4	0.01604 7	0.15277
put-miR-468	ATAAGGAACTGCTCTCTC	4.93694 2	8.33336 1	0.01609 9	0.15277
put-miR-469	GCGGGGGATTAGCTCAGCTGGG	1.22315 6	14.1057 5	0.01618 6	0.15277
put-miR-1195	ATTCTTTGACATGCAGAT	2.56111 4	9.28622 1	0.01629 9	0.15277
put-miR-250	CTGGTGTAGAATTGAGG	4.41103 7	8.16663 5	0.01673 3	0.15340 8
put-miR-1264	CAGGTTTCAGACTTTAGG	2.45298 9	9.27102 7	0.0168	0.15340 8
put-miR-465	CCAGTTGTCGTGGGTTTTT	2.03024 2	8.96297 2	0.01686 7	0.15340 8
put-miR-1243	TGTGGATTTTTGTCATGT	4.74325 2	8.63908 4	0.01687 1	0.15340 8
put-miR-771	CCTTGATCTGACTGGGGGCC	1.88681 2	8.60215 9	0.01694 3	0.15340 8
put-miR-534	CTGTTGGAGAATTTGGAATATTAGGT	-4.34848	8.65853 6	0.01741	0.15556 3
put-miR-80	GAAGAGGGAGTGGTCTGTAAATGCG	6.38069 3	9.53309 6	0.01741 5	0.15556 3
put-miR-347	AAAGGGAAACAAGAATTCTT	1.93702 6	10.5728 4	0.01774 8	0.15692 7
put-miR-410	GGAGAATAGAACATGCTGATT	6.65271 5	9.66618 7	0.01782 4	0.15692 7
put-miR-891	TAAATGTTGGTTTGTTTGT	1.85883 6	8.36957 3	0.01792 1	0.15692 7
put-miR-189	GAGCGAAACGGCAGGAT	2.36825 7	8.30564 3	0.01842 3	0.16026 6
put-miR-842	ACCCGGAGAACTGAACT	2.04506 8	9.28035 9	0.01862	0.16051 4
put-miR-81	ATTTGAAAGAATGCTTG	2.46871 1	8.29672 1	0.01869 3	0.16051 4
put-miR-824	CTAGCTGAACCTCTGTAT	5.27776 1	8.80593 3	0.01893 5	0.16155 4
put-miR-958	ACAGGGCTGTGCAAAAA	3.47524 5	8.12104 4	0.01933 2	0.16389 1
put-miR-742	CAGGGCTGTGCTAACT	2.25505 5	7.79426 9	0.02041 4	0.17126 6
put-miR-605	TGAGCTTTGGAAGAAGGACCA	2.30364 6	8.01664 4	0.02045 9	0.17126 6
put-miR-374	TGTGAGGATGTTCTGTAAGGAGTGTT	4.60762 6	8.64475 6	0.02084 8	0.17342 8

- 5420986

putative microRNAs	Sequences	logFC	logC PM	PValue	FDR
put-miR-135	TGAATTACGGAAGTGTTGGTTAAT	3.31 181 3	7.40402 2	0.02175 6	0.17985 9
pm-miR-323	ATAAAATGGGCGTTGAGG	3.26232 5	8.71569	0.02248 9	0.18477 1
put-miR-506	AAGAGGGGCTTTTAGAACC	6.17405 9	11.2295 5	0.02288 \|4	0.18685 9
put-miR-293	GGGTAAAACTGCAGTGGGCGTTGGTA G	1.80063 6	10.9933 9	0.02336	0.18958 4
put-miR-524	CGTGGTGATGCTCTGACA	2.43492 4	7.97326 2	0.02356 1	0.18963 2
put-miR-517	TTGGGAAGGGCTGCCGGA	4.20699 3	8.77492 6	0.02365 1	0.18963 2
put-miR-391	ATCTCGATCCAGTAGTC	1.80190 9	7.88466 7	0.02445 4	0.19489 7
put-miR-92	AGAGACTGACTTTGAGTA	5.75564 3	9.03030 6	0.02507 5	0.19865 8
put-miR-435	TTTAGACCGTTTTTATGTC	3.73569 6	9.20230 1	0.02703 3	0.21276 7
put-miR-1080	TGTGGATTGATGCTCT	1.70763 4	8.54984 5	0.02717 5	0.21276 7
put-miR-587	TTTGTAGAAGAGGAAGCG	2.49780 2	8.42128 4	0.02978 1	0.23180 7
put-miR-1220	TAGAATGGGGCTTGTTGC	3.98080 5	8.44650 5	0.03029 6	0.23345 9
put-miR-1134	AAAGAATGAAGTTGGTCTGG	1.68410 2	8.84813 5	1 0.03034 4	0.23345 9
put-miR-352	TAATGAATGACTGTTTG	1.77484 1	8.08011 9	0.03075 3	0.23524
put-miR-1162	AAAGAACGTTCAAAGG	2.80735 2	8.47640 3	0.03099 4	0.23573 1
put-miR-377	AAAGGGCTTTGACTATTT	1.68147 9	13.0561 7	0.03148 8	0.23791 8
put-miR-294	TGCTTCCTCAATCGGT	3.60327 9	8.46672 8	0.03163 9	0.23791 8
put-miR-1229	ACAGTAGCAATGTTCTGC	3.27847 2	7.88184	0.03209 1	0.23809 5
put-miR-1091	GATTATGATTGTGATTGTAGC	4.96464 2	9.49387 3	0.03214 4	0.23809 5
put-miR-419	AAAAAGTTAGACTTAGG	1.43745 7	9.01569 3	0.03219 9	0.23809 5
put-miR-249	GCCAGGATGTTGGCTTA	1.61768 8	9.17312 5	0.03244	0.23844 2
put-miR-122	GGAACTCATGATTGTTGACTTTGG	1.81481 1	8.35392 7	0.03268 7	0.23844 2
put-miR-1320	TTAGAGGCCACTCAAT	4.82036 5	8.33184 7	0.03299 4	0.23844 2
put-miR-335	TATTTAAATGAGAACTTTGAAGC	2.14736 1	9.04300 8	0.03306 11	0.23844 2
put-miR-166	CGTTTTGGTGTTGGTTG	-3.72297	8.05279 5	0.03314 2	0.23844 2

-55 20986

putative microRNAs	Seqtiences	logFC	logCPM	PVahie	FDR
put-miR-1172	AGAACCAAGAAGCTCTGG	2.61281 8	8.38416 6	0.03473 3	0.24667 7
put-miR-1207	GTGAAAAGACATAGGGGG	1.88273 5	9.81782 7	0.03476 P	0.24667 7
put-miR-1 130	TAGAAGAGGGAGCTTCTTT	2.42934 9	9.71776 I	0,03484 2	0.24667 7
put-miR-247	AGAGCTAGAATCCAGG	1.99024 7	8.78635 6	0.03546 9	0.24978 4
put-miR-246	TTTATTAGAGACGGGACTTT	4.83870 1	8.30995	0.03578 9	0.25037 9
put-miR-870	AAAGGATGTAGACAAGGGA	1.48044 2	8.13079	0.03593	0.25037 9
put-miR-704	CAAATGAATATCTGGGA	2.58211 4	8.28210 7	0.03736 6	0.25879 9
put-miR-266	TTTAGGTACTCTGAACAA	2.50524 4	8.58108 2	0.03758 6	0.25879 9
put-miR-928	CACAGAAGGAACGTTTAGA	2.53981 4	8.53077 9	0.03786 2	0.25879 9
put-miR-959	GAAAGAGAGTGAGACTCA	2.35945 1	8.45133 4	0.03806 2	0.25879 9
put-miR-676	TGGTGGTTGGTTTTGGG	1.24772 8	9.50427 9	0.03818	0.25879 9
put-miR-1095	ATTGTGAATGATCTGG	4.00658 6	8.69173 9	0.03840 3	0.25879 9
put-miR-550	GCACTCTGGACTCTGAATCC	1.46070 4	9.78229 8	0.03850 I	0.25879 9
put-miR-835	TTAGGAGTAGGTTACT	1.88817 7	8.67421 9	0.03869 3	0.25879 9
put-miR-686	TGACTGTTTTATATGAGTAA	1.69338 5	10.4228 7	0.03891 7	0.25899 3
put-miR-32	ATCCCGGACGAGCCCCCATTA	1.87860 8	11.0305 9	0.03945 6	0.26036 8
put-miR-151	TTGAAACTGATATACTGTCTTAGG	2.78141 6	7.30838 2	0.03951 5	0.26036 8
put-miR-726	GATGGGCTGATTGAGGGAT	3.11700 5	10.4905 9	0.03981 6	0.26105 8
put-miR-256	ATGAGGCTGAGATTGTCC	1.96253 5	8.27248 9	0.04059 5	0.26486 3
put-miR-368	AATGAGAACTTTGAAGGCCGAAG	2.36304 8	14.3576 2	0.04109 7	0.26631 4
put-miR-1232	ACAGACTGTCTTTGGG	2.16542 8	8.62052 6	0.04126 3	0.26631 4
put-miR-1219	GAAATTATTGATCCAGTCACGA	1.29880 3	9.72014 5	0.04141 8	0.26631 4
put-miR-1276	GAAGAGTTGATCCATG	1.90727 7	9.30929 8	0.04168 2	0.26672 5
put-miR-1119	GTTTTGGGTTGAGTGAGGA	2.45564 2	8.62987 5	0.04205 2	0.26780 7
put-miR-901	GTCTATTTGGATTATCGTC	1.72848 3	8.11300 2	0.04225 5	0.26781 6
put-miR-356	GTTTGAATTGGGAAGCTGGGGG	1.75002 2	8.00700 3	0.04323 2	0.27270 7

- 5620986

putative microRNAs	Séquences	logFC	logCPM	PValue	FDR
put-miR-856	AAGG ATAG GG AGGTATTT	2J8206 2	8.40066 5	0.04408 6	0.27678 7
p ut-mi R-1244	C AG'I TGGTAGAGCACCTGAC	-1.24774	10.4665 8	0.04501 9	0.28131 7
put-miR-476	GTGGTCAGGTAGAGAA	1.91955 1	8.04720 7	0.04661 8	0.28824 1
put-miR-142	CAGTATAATTAGGGGTTAATTGTGGG A	1.24901 6	8.70991	0.04668 4	0.28824 1
put-miR-639	TGGAGTGTGGATTGGG	1.47483 5	8.94546 7	0.04677 7	0.28824 1
put-miR-622	TGAGTGGTCAATGGGGG	1.33625 5	8.59078 4	0.04759 7	0.29193 1
put-miR-337	TGGGCTCAAGCTTTCTCT	2.37413 9	8.27944	0.04799 9	0.29193 1
put-miR-422	TTTAGGGTTTTAAGGTGTTA	1.29052 5	11.9896 3	0.04803 4	0.29193 1
put-miR-1339	GGACTGAGAGCTCTTTCTG	3.09157 3	10.6044 9	0.04844 8	0.29311 3
put-miR-1356	GTGCTGCATGGCTGTCA	1.34535 8	8.82082 2	0.04904 4	0.29523 7
put-miR-29	GAGAT'ITACGACCTAGG	1.33794 2	9.63023	0.04924 3	0.29523 7
put-miR-128	TGGCTCTGACACTAGTA	2.16595 5	8.27295 5	0.04952 5	0.29559 3
put-miR-359	G AAGT G G AAGG ACT AT G AA	2.15280 9	8.47568 5	0.05066 6	0.30105 6
put-miR-1003	TGGACTTCAGAACAGC	4.02977 1	7.87431 8	0.05092 4	0.30124 2
put-miR-238	AGAGACAGGAACTTTGATTTT	3.69063 7	8.38361 5	0.05131 6	0.30221 7
put-miR-961	TAGCTTGATCCAGTTG	2.18110 9	9.76078 9	0.05244 5	0.30750 7
put-miR-751	AG G CTG AG AC TGG AC AG A A AG ACCT	1.31747 9	8.02276 1	0.05348 6	0.31223 9
put-miR-1184	GCCTGCCCGGTGCTGGT	1.70730 5	8.99990 9	0.05382 5	0.31284 5
put-miR-379	GCGTGTGCGCGGGAGG	2.35286 9	7.58447 4	0.05424 6	0.31392 1
put-miR-361	CAGGTGAAATCGTGGATGT	2.22401 7	10.3479 3	0.05535	0.31889 6
put-miR-1111	TGATGCGTTGGGATGTAGC	1.42410 5	8.54329 4	0.05571 7	0.31889 6
put-miR-938	TTAGGAAGCTGCTGATT	1.31701 9	9.28186 9	0.05582 5	0.31889 6

MicroRNAs ID selected for the second qPCR validation step are shown in Table 4A, below.

Table 4A

- 5720986

microRNAs	Gene Nuniber
hsa-let-7f-5p	MÎMAT0000067
hsa-miR-1246	MIMAT0005898
hsa-miR-126-5p	MIMAT0000444
hsa-miR-135b-5p	MIMAT0000758
hsa-miR-21-5p	MIMATO0O0O76
hsa-miR-425-5p	MIMAT0003393
hsa-miR-497-5p	MIMAT0002820
hsa-miR-148a-3p	Μ1ΜΑΊΌ000243
hsa-let-7a-5p	MIMAT0000062
hsa-let-7i-5p	MIMAT0O0O415
hsa-miR-143-3p	MIMAT0000435
hsa-miR-34b-3p	MIMAT0004676
hsa-miR-449a	MIMAT0001541
hsa-miR-144-3p	MIMAT0000436
hsa-miR-144-5p	MIMAT0004600
hsa-miR-16-l-3p	MIMAT0004489
has-miR-934	MIMAT0004977
hsa-miR-206	MIMAT0000462
hsa-miR-103a-3p	MIMAT0000101
bsa-miR-671-3p	M1MAT0004819
hsa-miR-92a-3p	MIMAT0000092
hsa-let-7b-5p	MIMAT0000063
hsa-miR-142-3 p	MIMAT0000434
hsa-miR-142-5p	MIMAT0000433
bsa-mi R-29c-3p	MIMAT000043 3
hsa-miR-6748-3p	M1MAT0027397
has-miR-339-5p	MIMAT00007 64
has-miR-107	MIMAT0000104
hsa-miR-126-3 p	MIMAT0000445

Genome position and sequence of putative microRNAs selected for the second qPCR validation step are shown in Table 4B, below.

Table 4B

putative microRNAs	Chr	Strand	Start	Stop	Sequence
put-miR-1204	4	H-	1661740	1661756	AGGGCTGGGCACGGGGG
put-miR-1207	X	H-	12647513	12647530	GTGAAAAGACATAGGGGG
put-miR-444	6	H-	20984875	20984897	CTGAAAAGGGGACGGATTGGGA A
put-miR-465	2	4-	29475435	29475453	CCAGTTGTCGTGGGTTTTT
put-miR-468	5	+	62391321	62391338	ATAAGGAACTGCTCTCTC
put-niiR-6	16	+	67911172	67911188	GCGGACCTTGCTCAAGG
put-miR-958	16	+	51873548	51873564	ACAGGGCTGTGCAAAAA
put miR-71	10	4	13235141 2	13235143 2	GACCTTGGGTTGGGTCGTGGT
put-miR-1003	X	H-	96505351	96505366	TGGACTTCAGAACAGC

-58 20986

putative inicroRXÂs	Chr	Strand	Start	Stop	Sequence
put-miR-1080	12	—	13156293	13156294 8	TGTGGATTGATGCTCT
put-miR-188	2	4-	96290475	96290491	AAATGGCGATACTCAGG
put-miR-323	12	-r	54420991	54421008	ATAAAATGGGCGTTGAGG
put-miR-92	13	-r	28849073	28849090	AGAGACTGACT'nGAGTA
put-miR-209	18	-Γ	13603389	13603404	GGTCCTCGGATCGGCC
put-miR-1084	14	+	51649977	51649993	AGG ACCATI GCGJ! GCC
put-miR-1306	13	T	10000000 4	10000002 I	ATAACGTC AlCTAGTGTG
put-miR-325	3	-h	19333082 1	19333084 3	TTCAAATCCCACTTCTGACACCA
put-tniR-l 146	5	+	67892184	67892199	ATAGGAGACTTCTATC
put-miR-594	17	+	46822348	46822364	TGATTTTTTTTGGCGAA
put-miR-961	7	+	15035293 7	15035295 2	TAGCTTGATCCAGTTG
put-miR-742	16	+	49579869	49579884	CAGGGCTGTGCTAACT
put-iniR-469	1	4-	22441119	22441140	GCGGGGGATTAGCTCAGCTGGG
put-miR-806	16	+	964420	964437	CACGAGAGAACGCACACC
put-miR-476	4	+	10024453 4	10024454 9	GTGGTCAGGTAGAGAA
put-miR-856	16		50873777	50873794	AAGGATAGGGAGGTATTT
put-mir-893	5	+	58317814	58317830	ACCATCCTCTGCTACCA

Genome position and sequence of other sncRNAs selected for the second qPCR validation step are shown in Table 4C, below.

Table 4C

small noneoding RNAs	Chr	Strand	Start	Stop	Sequence
RNU4-6p	X	-	16893269	16893390	TATCGTAGCCAATGAGGTTTATCCGA GGCGTGATTATTGCTAATTGAAAA
tRNA18Arg CCT	17		73030001	73030073	GCACTGGCCTCCTAAGCCAGGGATTG TGGGTTCGAGTCCCACCTGGGGTA
U6.428	1		180727858	180727953	AAGATTAGCATGAGGATGACACGCA AATTCGTGAAGCGTTCCATTTCTTT
RNU6-45	11	_1_	63737942	63738048	GGCCCTTGTGCAAGGATGACACGCA AATTCGTGAAGCGTTCCATATTTTT
RNU6-4	1		31970419	31970525	GGCCCCTGCACAGGGATGACACGCA AATTCGTGAAGCGTTCCATATTTTT
RNU6-6	2	+	201694732	201694839	GGCCCCTGTGCAAGGATGACACGCA AATTCGTGAAGCGTTCCATATTTTT
RNU6-7	3	+	194935516	194935622	GGCCCCTGCGCAAGGATGACATGCA AATTCGTGAAGCGTTCCATATTTTT
RNU6-73	13	+	28402900	28403006	GGCCCCTGTGCAAGGATGACATGCA AATTCGTGAAGCGTTCCATATTTTT
SNORD3B	17	+	18965225	18965440	CTTCTCTCCGTATTGGGGAGTGAGAG GGAGAGAACGCGGTCTGAGTGGTT
tRNAl 20AlaAGC	6	-	28626014	28626085	GCGCATGCTTAGCATGCATGAGGTCC CGGGTTCGATCCCCAGCATCTCCA
tRNA73Arg CCG	6	-H	28849165	28849237	GCGTCTGATTCCGGATCAGAAGATTG AGGGTTCGAGTCCCTTCGTGGTCG

- 5920986

s ni il H noncoding RNAs	Chr	Stratid	Start	Stop	1 Sequence
U6.168	6	-	18307204	18307310	ATGGCCCCTGCGCAAGGATGACACG CAAATTTGTG AAGG ATTCCΑΤΑ Π T
U6.375	4	—	109573306	109573412	GGCCCCTGTGCAAGAATGACTCGCA AATTCGTGAAGCGTTCCATATTTTT
YRNA-684	18	—	20604559	20604666	GCTTCTTTTACTCTTTCCCTTCATTCT CACTACTGTACCTGATTCGTCTT
U6.601	19	-	39287642	39287749	GGCCCCTG C G C AAGG ATGACATGCΛ AATTTGTGAAGTGTTCCATATTTTT
YRNA-255	17	—	80375102	80375197	G UG UC AC C AAC’G U U GG U AU AC A AC C CCCCACAACUAAAUUUGACUGGCUU
tRNA9- TyrGTA	7	-F-	149255133	149255205	CTTTTTGACTGTAGAGCAAGAGGTCC CTGGTTC AAA TCC AGGTTCTCCCT
U2.3	1	4-	150209315	150209504	TCACTTCACGCATCGATCTGGTATTG CAGTACCTCCAGGAACAGTGCACC
U4.64	9	-r	36267780	36267919	GTATCGTAGCCAATGAGGTTTATCCA AGGTGCGATTATTGCTAATTGAAA
SNORA57	10	T	27077946	27078086	TGCTGGCGGCTTCCCATCCGCTGGTT CTATCCTCAAACGCCGGGACACCG
UC022CJG 1	Y	_1_	10037846	10037870	CATTGATCATCGACACTTCGAACGCA CTTG
tRNA27MetCAT	6	4-	26766444	26766516	GCGTCAGTCTCATAATCTGAAGGTCC TGAGTTCGAGCCTCAGAGAGGGCA
tRNA8- ThrAGT	17	4-	8090478	8090551	GCGCCTGTCTAGTAAACAGGAGATCC TGGGTTCGAATCCCAGCGGTGCCT
tRNA2- LeuTAA	4	-	156384978	156385052	GC ATAAAACTT AAA ATTTTAT AATCA GAGGTTCAACTCCTCTTCTTAACA
tRNA9- TyrGTA	7	-f-	149255133	149255205	_{CTTTTTGACTGTAGAGCAAGAGGTCC}CTGGTTCAAATCCAGGTTCTCCCT
YRNA-245	2		25919945	25920057	GTCTTTGTTG AACTCTTTCCC TCCTTC TCATTACTGTACTTGACCAGTCT
U6.1249	1	-J-	67661823	67661926	GATGGCATGACCCCTGATCAAGGAC GGCATGCAAATTTGTGAAGTATTTC

SncRNAs differentially expressed in group C vs U+M at the 3 time points are shown in Table 5, below. This table also includes: AUC, CI, count, CT average, SD, ddcq, fold change and power analysis for each individual biomarker and STEPWISE analysis.

Table 5

Ca vs U+M b	AUC	95% Coniî dente interv ai	Count	Ave. dcq Ca	Ave. dcq U+M b	SD Ca	SD U+M b	ddcq Ca U+M b	Fold change Ca/U+M b	t-tcst P' valu c	Power analysis (p = Ô.05)
hsa-let-7f5p	0.71	0.630.79	134	18.01	-16.95	0.74	1.47	-1 07	-2.09	0.00	78
hsa-mi ΚΙ 246	0.69	0.61- 0.77	135	21.66	-21.17	0.75	Il 1	-049	-1.41	0.00	221
hsa-nüR135b-5p	0.66	0.580.75	133	15.34	-14.68	0.64	1.06	-0.66	-1.58	0.00	111
hsa-miR-2l- 5p	0.66	0.57- 0.74	135	22.44	-22.00	0.66	0.87	-0.43	-1.35	0.00	183
RNU4-6p	0.67	0.590.75	135	17.44	-16.78	1.12	1.35	-0.66	-1.58	0.00	200
hsa-iniR126-5p	0.76	0.680.83	76	-8.25	-9.12	1.23	2.02	0.87	1.83	0.01 1	231
pin-ini ΚΙ 207	0.66	0.570.74	132	15 59	-13.83	3.27	2.68	-1.76	-3.39	0.01	141
put-inîR-444	0.70	0.61-	100		-11.06	1.70	1.84	-0.99	-1.98	0.01	174

- 6020986

Ca vs U+M b	AUC	95% Cou fi dente i il te iv al	Cou nt	Ave. (Icq Ca	Ave. dcq U+M b	SD Ca	SD U+M b	ddcq Ca U+M b	Fold change Ca/U + M b	t-tcst pvahi c	Power analysis (p = (1.05)
		0.77		12.05
U6.428	0.68	0.59- 0.76	122	12.69	-13.43	1.51	1.60	0.74	1.67	0.01	237
hsa-miR4^LJ7-5p	0.71	0.63- 0.79	99	15.22	-14.69	1.09	1.14	-0.52	-1.44	0.02	243
p ut -mi R-46 5	0.81	0.73- 0.87	67	[ 6.09	-14 64	2.07	2.28	-1.45	-2.74	0.02	125
put-iniRï 204	0.63	0.54- 0.71	132	18.25	-17.26	2.39	2.37	-0.99	-1.98	0.03	305
hsa-iniR425-5p	0.63	0.54071	135	18.65	-18.93	0.83	0.82	0.28	1.21	0.05	457
lRNA18Arg CCT	0.62	0.59- 0.75	135	22.56	-23.05	1.67	1.63	0.50	1.41	0.05	571
put-miR-468	0.84	0.77- 0.90	50	14.10	-13.02	1.33	1.77	-1 08	-2.12	0.07	129
has-iniR148a-3p *	0.61	0.52- 0.69	135	19.97	-19.55	0.88	1.08	-0.41	-1.33	0.08	323
STEPW1SE	0.86
Cb vs U+M 1)	AUC	95% Cûnfi dente interv al	Coitnt	Aver âge dcq Ch	Averag e dcq U+M b	SD Cb	SD U+M b	ddcq Cb- U+M b	Fold change Cb / U+M b	t-tcst I pvalu e	Power analysis (p = 0.05)
tRNAlSArg CCT	0.66	0.573- 0.736	145	22.31	-23.05	1.80	1.63	0.74	1.67	0.00	273
hsa-let-7a-5p	0.68	0.591- 0.751	145	20.09	-20.33	0.49	0.51	0.23	1.18	0.00	244
RNU6-45	0.67	0.584- 0.745	145	18.86	-20.02	2.19	2.20	1.16	2.23	0.00	189
RNUM	0.68	0.593- 0.753	144	19.90	-21.05	2 19	1.89	1.15	2.22	0.00	161
RNU6-6	0.66	0.5800.741	144	19.79	-20.79	2.01	1.90	1.01	2.01	o.oo ।	194
RNU6-7	0.66	0.576- 0.738	145	19.82	-20.85	2.01	1.78	1.02	2.03	1 0.00	175
RNU6-73	0.66	0.577- 0.739	145	19.76	-20.72	1.87	1.86	0.96	1.95	0.00	197
hsa-let-7f5p	0.65	0.556- 0.720	144	16.24	-16.95	1.30	1.47	0.71	1.64	0.01	207
h sa-mi R135b-5p	0.64	0.555- 0.719	141	14.17	-14.68	0.90	1.06	0.51	1.43	0.01	205
hsa-let-7i-5p	0.64	0.558- 0.722	145	18.49	-18.69	0.42	0.54	0.20	1.15	0.01	328
hsa-miR34b-3p	0.71	0.630- 0.785	102	12.33	-13.57	2.02	2.26	1.24	2.36	0.01	164
tRNAlZOAlaAGC	0.76	0.6770,824	99	16.28	-17.76	2.95	2.61	1.48	2.79	0.01	179
U6.601	0.65	0.560- 0.724	145	18.17	-19.01	1.96	1.86	0.83	1.79	0.01	268
YRNA 255	0.64	0.558- 0.722	145	23.71	-24.55	1.77	1.65	0.84	1.79	0.01	214
U6.168	0.63	0.542- 0.707	143	16.74	-17.36	1.67	1.59	0.62	1.54	0.02	361
hsa-miR143-3p	0.62	0.529- 0.695	145	18.17	-17.88	0.92	1.01	-0.29	-1.22	0.03	612
pul+miR-6	0.90	0.839- 0.944	46	14.02	-15.23	1.82	2.12	1.21	2.31	0.03	142
SN0RD3B	0.63	0.544- 0.709	145	19.25	-19.79	1.62	1.33	0.53	1.45	0.03	383
uc022cjgl	0.61	0.524- 0.690	145	22.04	-22.40	1.05	1 00	0.36	1.28	0.03	421
tRNA73Aig CCG	0.60	0.516- 0.683	145	16.65	-17.20	2.31	1.69	0.56	1.47	0.04	634
pul-miR-958	0.73	0.650- 0.802	73	10.56	-H.37	2.04	1.75	0.81	1.76	0.05	273
U6.375	0.65	0.560- 0.724	144	16.38	-17.13	1.77	1.49	0.75	1.68	0.05	237
put mïR-71	0.81	0.730- 0.867	49	-8.76	-9.86	1.97	2.19	1.09	2.13	0.05	196
YRNA-684	0.61	0.520-	126	-	-11.25	2.68	2.76	-1.05	-2.07	0.08	355

- 61 20986

Ca 5sU+M b	AUC	95% C ο ;i fi dence interv a!	Count	Ave. deq Ca	Ave. deq U+M b	SD Ca	SD U+M b	ddcq Ca U+M b	Fold change Ca/U+M h	r-test pvaki e	Power analysis (p = 0.05)
*		0.687		12.30
STEPWISE	0.86
Ce vs U+M c	Alt	95% Cou fi douce interv al	Cou nt	Avcr age deq Ch	Avcrag e deq l+Mh	SD Ch	SD U+M b	ddcq Cb U+M h	Fold change Cb / VtM b	t-test P’ valu e	Pou er analvsis (P = 0.05)
lisLi-iriiRl44-3p	0.75	0.659- 0.821	98	12.54	-14.12	1.94	2.52	1.59	3.00	0.00	110
put-iniR1084	0.85	0.770- 0.906	53	-8.30	-10.33	1.87	2.70	2.03	4.07	0.00	73
hsa-miR144-5p	0.89	0.821- 0.940	50	10.11	-12.06	2.34	2.15	1.95	3.87	0.01	70
put-miR-188	0.87	0.796- 0.924	41	11.85	-10.13	2.23	i .91	-1 72	-3.31	0.01	80
put-miR-323	0.93	0 8630.965	27	-6.46	-7.95	1.37	1.44	1.49	2.81	0.01	49
hsa-miR-16l-3p	0.63	0.540- 0.718	124	13.80	-14.45	1.59	1.46	0.65	1.57	0.02	281
put-miR-92	0.88	0.809- 0.932	35	-7.25	-9.07	1.94	2.98	1.82	3.53	0.02	98
put-miR- 1003	0.88	0.7970.925	41	-8.33	-9.96	1.79	2.36	1.64	3 11	0.03	92
put-miR- 1080	0.84	0.765- 0.902	45	-9.87	11.22	2.42	2.20	1.35	2.55	0.04	152
RNU6-4	0.61	0.515- 0.695	125	20.26	-20.92	1.88	J.99	0.66	1.58	0.05	453
(RNA! 20AlaAGC	0.67	0 5760.751	97	17.21	-18.21	2.63	2.52	1.00	2.00	0.05	343
hsa-miR-206 £	0.79	0.701- 0.854	51	12.09	-10.79	3.41	3.02	-1.30	-2.46	0.06	321
put-miR-6 *	0.84	0.7630.901	39	13.85	-15.03	1.71	2.37	1.17	2.26	0.08	168
STEPWISE	0.97

SncRNAs différent! ally expressed in group C vs U at the 3 time points are shown in Table 6, below. This table also includes: AUC, CI, count, CT average, SD, ddcq, fold change and power analysis for each individual biomarker and STEPWISE analysis.

Table 6

Ca vs Ub	AUC	95% Confidence intcrval	Count	Average deq Ca	Average deq Ub	SD Ca	SD Ub	ddcq Ca-Ub	Fold change Ca / l b	t-test p-value	Power analysis (p = 0.05)
hsa-let-7f-5p	0.66	0.56-0.75	104	-18.01	-17.22	0.74	1.32	-0.80	-1.74	0.00	105
hsa-mi R-1246	0.69	0.59-0.78	104	-21.66	-21.17	0.75	1.04	-0.49	-1.41	0.00	189
h sa- mi R-135b-5 p	0.65	0.55-0.74	102	-15.34	-14.79	0.64	0.97	-0.55	-1.47	0.00	126
put-miR-465	0.84	0.75-0.90	48	-16.09	-14.27	2.07	2.37	-1.82	-3.53	0.01	83
put-iTiiR“444	0.69	0.58-0.77	79	12.05	-11.06	1.70	1.88	-0.99	-1.98	0.02	177
RNU4-6P	0.65	0.55-0.74	104	-17.44	-16.90	1.12	1.37	-0.54	-1.46	0.02	287
U6.428	0.67	0.57-0.76	93	-12.69	-13.33	1.51	1.56	0.64	J.56	0.02	298
hsa-iTiiR-497-5p	0.71	0.61-0.79	80	-15.22	-14.70	1.09	J.28	-0.52	-1.44	0.03	280

- 6220986

Ca vs U b	AUC	95% Confidence inlerval	Count	Average deq Ca	Average deq U b	SDCa	SD Ub	ddeq Ca - Ub	Fold change Ca / U h	î-iest p-vahie	Power a il η 1 y sis (p = 11.05)
put-miR-1204	0.64	0.53-0.73	101	-18.25	-17.26	2.39	2.35	-0.99	J.9S	0.03	301
bsa-mi R-2 l -5p	0.63	0.52-0.72	104	-22.44	-22.09	0.66	0.84	-0.35	-1.27	0.(14	256
put-miR-742 *	0.79	0.69-0.86	46	21.16	20.30	1.62	1 27	-0.86	-1.82	0.06	144
hsa-miR-126-5p *	0.74	0.65-0.83	60	-8.25	-9.06	1.23	2.05	0.81	1.76	0.07	254
put-iniR-468 *	0.83	0.74-0.89	38	-14.10	-12.93	1.33	1.89	-1.17	-2.26	0.07	118
STEPW1SE	0.83
Ch vs Ub	AUC	95% Confidence interval	Count	Average deq Ub	Average deq Cb	SD Ub	SDCb	ddeq Ub-Cb	Fold change Ub / Cb	t-test p*valuc	Power analysis (p - O.fl5)
hsa-let-7f-5p	0.69	0.60-0.78	114	-17.22	-16.24	1.32	1.30	-0.98	-1.97	0.00	96
hsa-Iet-7a-5p	0.70	0.59-0.77	J14	-20.36	-20.09	0.37	049	-0.27	-1.20	0.00	139
hsa-let-7i-5p	0.65	0.55-0.73	114	-18.71	-18.49	0.49	042	-0.22	-1.16	0.00	234
hsa-miR-l35b-5p	0.68	0.58-0.76	110	-14.79	-14.17	0.97	0.90	-0.62	-1.53	0.00	122
hsa-ιηί R-34b-3p	0.75	0.66-0.83	78	-13.97	-12.33	2.48	2.02	-1 64	-3.12	0.00	104
RNU6-4	067	0.57-0.76	113	-20.97	-19.90	1.78	2 19	-1.07	-2.10	0.00	181
RNU6U5	0.66	0.56-0.75	114	-19.86	-18.86	2.20	2 19	-1.00	-2.01	0.01	250
RNU6-6	0.65	0.56-0.74	113	-20.70	-19.79	1.79	2.01	-091	-1 88	0.01	228
RNU6-7	0.64	0.55-0.73	114	-20.72	-19.82	1.78	2.01	-0.89	-1.85	0.01	236
RNU6-73	0.65	0.55-0.73	114	-20.62	-19.76	1.80	1.87	-0.86	-1 82	0.01	238
SNORD3B-2	0.65	0.55-0.74	114	-19.83	-19.25	1.25	1.62	-0.58	-1.49	0 01	321
YRMA-255	0.63	0.53-0.72	114	-24.44	-23.71	1.65	1.77	-0.73	-1.66	0.01	287
hsa-miR-103a-3p	0.61	0.52-0.70	112	-20.08	-19.70	0.77	0.88	-0.37	-1.30	0.02	255
U6.375	0.63	0.53-0.72	114	-17.01	-16.38	1.47	1.77	-0.63	-1.54	0.02	349
U6.601	0.62	0.53-0.72	114	-18.91	-18.17	1.75	1.96	-0.74	-1.67	0.02	329
hsa-miR-449a	0.74	0.65-0.82	65	-13.41	-11.88	3.01	2.60	-1.53	-2.89	0.03	181
hsa-miR-671-3p	0.67	0.58-0.76	78	-11.81	-12.62	1.57	1.83	0.82	1.76	003	222
YRNA-684	063	0.53-0.72	101	-11.07	-12.30	2.73	2 68	1.23	2.35	0.04	254
put-miR-1306	0.90	0.83-0.95	27	-7.93	-10.51	2.29	3.34	2 58	5 99	0.05	65
put-miR-958	0.73	0.64-0.81	59	-11.49	-10.56	1.73	2.04	-0.94	-191	0.05	211

-63 20986

Ca vs Ub	AUC	95% Confidence inierval	Couitt	Average deq Ca	Average deq Ub	SD Ca	SD Ub	ddcq Ca - Ub	Fold change Ca / Ub	t-test p'vahie	Power au ah sis (p = 0.05)
lRNAI20-AlaAGC	0.72	0.62-0.79	80	-17.35	-16.28	2.66	2.95	-1.07	-2.10	0.05	355
put-miR-6 *	0.90	0.82-0.95	39	-15.14	-14.02	2.21	1.82	-1.12	-2 1“	0.06	169
pul-miR—169 *	0.85	0.77-0.91	23	-7.16	-9.23	1.72	2.39	2.06	4.18	0.06	61
put-miR-806 *	0.82	0.73-0.8	38	-9.55	-8.60	1 49	1.81	-0.95	-1.93	0.08	159
STEPWISE	0.91
Ce vs Ue	AUC	95% Confidence interval	Count	Average deq Uc	Average deq Ce	SD Uc	SD Ce	ddcq Uc - Ce	Fold change Uc/ Ce	t-lest p-valuc	Power analysis (p = 11.05)
bsa-mi R-144-3p	0.72	0.62-0.80	83	-13.95	-12.54	2.54	1.94	-1.41	-2.66	0.00	133
pul-miR-J084	0.83	0.74-0.89	45	-10.29	-8.30	2.54	1.87	-1.99	-3.97	0.01	67
put-miR-188	0.87	0.79-0.93	38	-10.50	-11.85	1.36	2.23	1.35	2.55	0.01	110
püL“iTiiR-323	0.95	0.88-0.98	23	-8.07	-6.46	1.27	1.37	-1.61	-3.04	0.01	37
hsftJet-7f-5p	0.63	Ü.52-0.72	101	-16.95	-16.33	1.41	1 44	-0.62	-1.54	0.03	279
hsa-miR-144-5 p	0.88	0.79-0.94	39	-11.85	-10.11	2.36	2.34	-1.74	-3.34	0.03	97
put-miR-92	0.96	0.89-0.99	28	-9.86	-7.25	3.06	1.94	-2.61	-6.11	0.03	44
hsa-rniR-206 *	0.78	0.69-0.86	45	-10.74	-12.09	3.03	3.41	1.34	2.54	0.07	306
put-miR-476 *	0.84	0.75-0.91	37	-15.04	-16.43	1.79	2.45	1.38	2 60	0.08	131
STEPWISE	0.97

SncRNAs differentially expressed in group C vs B at the 3 time ponts are shown in Table

7, below. This table also includes; count, CT average, SD, ddcq, fold change and power analysis 5 for each individual biomarker.

Table 7

Ca vs B	Count	Average deq Ca	Average deq B	SDCa	SD B	ddcq Ca - B	Fold change Ca/ B	Pair sample test Sig. (2-tailed)	Power analysis (p = 0.05)
hsa-miR-1246	219	-21.66	-20.79	0.75	1.04	-0.87	-1.83	0.00	69
put-mîR-1207	207	-15.59	-12.28	3.27	2.22	-3.30	-9.88	0.00	îi
RNU4-6p	219	-17.44	-16.85	1.12	1.09	-0.59	-1.51	0.00	178
h sa-mi R-143-3 p	114	-18.00	-18.17	0 99	0.92	0 16	1.12	Ü.ÛO	1821
hs a-m iR-34 b-3p	182	-13.93	-12.33	1.51	1.87	-1 60	-3.04	0.00	69
hsa-miR-449a	155	-13.48	-11.38	1 89	2.62	-2.10	-4.28	0.00	75
U4.64	107	-11.33	-11.90	2.36	2.64	0.57	1.49	0.00	991

-6420986

C'a vs B	Counl	Ave rage deq Ca	Average deq B	SD Ca	SD B	ddeq Ca - B	Fold change Ca/ B	Pair sample test Sig. (2-tailed)	Power analysis (p = 0.05J
hsa-let-7b-5p	219	-20.07	-20.26	0.58	0.58	0.19	1.14	0.00	480
1isa-miR-142-3p	1 14	-23.48	-23.56	0.77	0.87	0.08	1.06	0.00	5191
hsa-miR-142-5 p	219	-20.83	-20.14	0.90	1.03	-0.69	-1.61	0.00	1 14
h s îi’in i R’29 C’3 p	219	-19.93	-19.74	0.58	0.58	-0.19	-1.14	0.00	480
put-miR-l 146	] 7Ί	-12.59	-11.17	2.39	2.97	-1.43	-2.69	0.00	210
tRNA9-TyrGTA	206	-13.04	-11.65	242	2.07	-1.39	-2.61	0.00	127
put-miR-444	133	-12.05	-10.06	1.70	2.27	-1.99	-3.96	0.01	64
has-mi R-148a-3p	2 [9	-19.97	-19.67	0.88	066	-0.29	U 22	0.01	305
U2.3	219	-27.18	-27.13	1.32	131	-0.05	-1.03	0.01	43231
tRN A27-MetCAT	112	-18 60	-18.36	1.48	1.88	-0.24	-1.18	0.01	2548
tRNA2-LeuTAA	219	-16.87	-17.65	1.30	1.47	0.78	1.71	0.01	181
YRNA-245	219	-15.50	-14.70	1.42	1.36	-0.80	-1.74	0.01	155
hsa-kt-7f-5p	219	-18.01	-17.67	0.74	1.27	-0.35	-1.27	0.02	598
hsa-iniR-6748-3p	94	-14.95	-12.10	3.29	3.04	-2.85	-7.20	0.02	64
put-mi R-468	64	-14.10	-12.25	1.33	1.70	-1.85	-3.60	0.05	44
put-miR-594	190	-15.15	-13.30	4.79	3.42	-1.85	-3.61	0.05		212
Cb vs B	Count	Average deq Cb	Average deq B	SD Cb	SD B	ddeq Cb - B	Fold change Cb ! B	Pair sample test Sig* (2-tailed)	Power analysis (p = 0.05)
hsa-miR-135b-5p	226	-14.17	-15.45	0.90	0.96	1.28	2.43	0.00	31
hsa-iniR-425-5p	229	-18.87	-18.37	0.71	0.86	-0.50	-1.41	0.00	146
hsa-let-7a-5p	229	-20.09	-2065	0.49	0.41	0.56	1.47	0.00		33
hsa-miR-143-3 p	229	-18.17	-17.60	0.92	1.18	-0.57	-1.48	0.00	206
YRNA-684	196	-12.30	-10.58	2.68	2.12	-1.72	-3.29	0.00		93
U4.64	221	-11.90	-10.76	2.64	1.89	-1.14	-2.20	0.00	176
hsamiR-142-3p	229	-23.56	-22.94	0.87	Il 1	-0.63	-1.55	0.00	151
h sa -mi R-142-5 p	229	-20.82	-20.14	0.97	1.03	-0.68	-1.61	0.00		117
tRNA9-TyrGTA	213	-13.06	-11.65	2.84	2.07	-1.41	-2.65	0.00		137
YRNA-245	229	-15.18	-14.70	1.83	1.36	-048	-1.40	0.00	493
put-miR-961	144	-12.72	-11.03	3.34	2.55	-1.68	-3.21	0.00	143
hsa-let-7f-5p	229	-16.24	-17.67	1.30	1.27	1.43	2.69	0.01	44
li sa-mi R-1246	229	-21.39	-20.79	1.33	1.04	-0.60	-1.52	0.01	179
hsa-miR-126-5p	144	-9.35	-8.15	1.87	1.60	-1.20	-2.30	0.01	101
hsa-miR-144-3p	208	-14.19	-13.70	2.60	2.06	-0.49	-1.41	0.01	1021
hsa-let-7b-5p	229	-20.21	-20.26	0.90	0.58	0.05	1.04	0.01	8840
hsa-miR-29c-3p	229	-19.79	-19.74	0.90	0.58	-0.05	-1.04	0.01	8840
SN0RD3B	229	-19.25	-20.20	1.62	1.03	0.94	1.92	0.02	86
lisa-miR-671-3p	157	-12.62	-11.09	1.83	1.35	-1.53	-2.89	0.02	49
UC022CJG1	229	-22.04	-22.64	1.05	0.94	0.60	1.51	0.02	139
tRNA2-LeuTAA	227	-16.87	-17.65	1.99	1.47	0.78	1.72	0.02	220
hsa-miR-339-5p	229	-15.89	-15.50	1.60	1.30	-0 39	-1.31	0.02	639
hsa-miR-21-5p	229	-21.86	-22.45	0.99	0.74	0.59	1.51	0.03	98

- 65 20986

Ca vs B	Count	Average deq Ca	Average deq B	SD Ca	SD B	ddcq Ca - B	Fold change Ca/ B	Pair sample test Sig. (2-tailcd)	Pü^ er analysis (P = 0-05)
hsa-miR’34b-3p	180	-12.33	-12.33	2Ό2	1.87	0.00	-1.00	0.03	11336078
U6.168	22X	-16.74	-16.82	1.67	1.56	0.07	1.05	0.03	25072
lisu-mi R-1 ô-1 -3p	226	-14.16	-13.71	1.41	1.49	0.45	1.36	0.03 '	564
put-niÎR'1207	217	-13.48	-12.28	3.36	2.22	1.20	-2.30	0.04	234
put-inÎRU6£	69	-13.67	-12.25	1.68	1.70	1.42	-2.67	0.04	77
pul-iniR-893	229	-28.04	-27.27	2.65	1.94	-0.77	-171	0,04	396
SNORA57	229	-20.82	-20.63	1.15	1.06	-0.20	-115	0.04	1593
Ce vs B	Count	Average deq Ce	Average deq B	SD Ce	SD B	ddcq Ce - B	Fold change Ce / B	Pair sample test Sig. (2-tailed)	Power analysis (p = Ô.O5)
li 5 n-m i R-13 5b-5 p	228	-14.95	-15.45	0.96	0.96	0.50	1.41	0.00	194
lisa-miR-1 246	231	-21.19	-20.79	1.21	1.04	-0.40	-1.32	0.01	378
hsa-mi R-21-5p	231	-21.88	-22.45	0.92	0.74	0.57	1.48	0.01	101
hsa-let-7f-5p	231	-16.33	-17.67	1.44	1.27	1.34	2.52	0.02	52
U6.428	215	-13.10	-12.76	1.53	1.69	-0.34	-1.26	0.02	1253
YRNA-684	201	-11.24	-10.58	3.03	2.12	-0.66	-1.58	0.02	681
IJ4.64	231	-16.98	-16.85	1.49	1.09	-0.13	-1.09	0.02	4432
U6.I249	160	-10.16	-8.96	3.17	2.18	-1.20	-2.30	0.02	223
RNU4-6P	231	-16.98	-16.85	1.49	1.08	-0.13	-1.09	0.03	4432
U6.I68	231	-16.78	-16.82	1.57	1.56	0.04	1.03	0.04	84454
hsa-iniR.-92a-3p	231	-20.47	-20.50	0.68	0.46	0.03	1.02	0.04 1	11846
put-miR-209	97	-8.94	-8.42	2.79	2.89	-0.52	-1.43	0.04	1580

SncRNAs differentially expressed in group C vs M at the 3 time points are shown in

Table 8, below. This table also includes: AUC, CI, count, CT average, SD, ddcq, fold change 5 and power analysis for each individual biomarker and STEPWISE analysis.

Table 8

Ca vs Mb	AUC	95% Confidence Interval	Count	Average deq Ca	Average deq Mb	SD Ca	SD Mb	ddcq Ca - ML	Fold change Ca/ Mb	t-test p-value	Power analysis (p = 0.05)
hsa-let-7f-5p	0.81	0.69-0.92	63	-17.93	-16.40	0.763	1.62	-1.53	-2.89	0.00	37
hsa-ntiR-135b-5p	0.71	0.58-0.84	63	-15.26	-14.48	0.63	1.22	-0.78	-1.72	0.00	81
hsa-mi R-21-5p	0.71	0.59-0.83	64	-22.36	-21.84	0.69	0.90	-0.52	-1.43	0.00	127
put-miR-1207	0.74	0.63-0.86	62	-15.73	-13.08	3.33	2.63	-2.66	-6.26	0.00	69
RNU4-6P	0.71	0.58-0.84	64	-17.37	-16.56	0.94	1.32	-0.81	-1.75	0.00	105
hsa-tniR-l48a-3p	0.70	0.58-0.82	64	-19.90	-19.31	0.93	1.06	-0.59	-1.50	1 0.01	151
hsa-mi R-3 4b-3 p	0.72	0.60-0.84	52	-14.01	-12.84	1.49	1.58	-1.18	-2.26	0.01	90
tRNA18-ArgCCT	0.68	0.55-0.80	64	-22.65	-23.57	1.69	1.45	0.92	1.89	0.01	157

- 6620986

Ca vs Mb	AUC	95% Co nfidence Interval	Cou nt	Average deq Ca	Average deq Mb	SD Ca	SD Mb	ddeq Ca - Mb	F<ild change Ca, Mb	rtest p-valne	Power analysis (P = 0.115)
U6.428	0.67	0.54-0.79	58	-12.61	-13.60	1.39	1.69	0.99	1 99	0.01	128
hsa-iniR-425-5p	0.66	0.53-0.79	64	-18.68	-19.09	0.83	0.81	0.41	! 33	0.02	208
U6.168	0.65	0.52-0.78	63	-17.03	-17.78	1.30	1.62	0.75	1.68	0.03	201
hsa-miR-103a-3p	0.65	0.51-0.78	63	-20.05	-19.82	0.597	0.79	-0.23	-1 17	0.04	490
hsa-miR-1246	0.68	0.55-0.82	64	-21 64	-21.17	0.72	1.24	-0.47	-l 38	\| 0.04	242
lisa-miR-16-l-3p	0.65	0.53-0.79	63	14.44	-14.94	1.26	1 36	0.50	1.41	0.04	362
put-miR-323	0.91	0.82-0.99	15	-8.42	-6.72	1.85	l 66	-1.70	-3.25	0.04	58
put-miR-594	0.71	0.59-0.84	54	-15.24	-12.40	4.90	3.97	-2.84	-7 18	0.04	131
hsa-miR-12 6-5 p	0.80	0.68-0.92	34	-8.18	-9.25	1.12	1.99	1.06	2.09	0.05	119
hsa-iniR-143-3p	0.64	0.50-0.78	64	-17.96	-17.63	0.86	1.03	-0.32	-1.25	0.05	445
h sa-mi R-497-5p	0.68	0.55-0.80	42	-15.28	-14.69	1.22	0.72	-0.59	-1.50	0.05	161
put-miR-444*	0.72	0.59-0.84	44	-12.21	-11.06	1.71	1.78	-1.15	-2.21	0.06	123
STEPWISE	0.96
Cb vs Mb	AUC	95% Confidence Inter val	Count	Average deq Cb	Average deq Mb	SD Cb	SD Mb	ddeq Cb - Mb	Fold change Cb/ Mb	p-value	Power analysis (p = 0.05)
tRNA18ArgCCT	0.73	0.62-0.83	64	-22.54	-23.57	1.66	1.45	1.03	2.04	0.00	123
RNU6-7	0.69	0.57-0.81	64	-20.44	-21.11	1.54	1.77	0.67	1.59	0.00	322
tRNA120-AJaAGC	0.84	0.74-0.93	42	-16.44	-18.71	2.90	2.27	2.27	4.83	0.00	72
U6.168	0.69	0.57-0.81	63	-17.17	-17.78	1.46	1.62	0.61	1.52	0.00	335
hsa-miR-143-3 p	0.68	0.56-0 81	64	-18.25	-17.64	0.87	1.03	-0.61	-1 53	0.01	128
RNU6-45	0.69	0.57-0.81	64	-19.49	-20.32	1.68	2.21	0.83	1.78	0.01	290
RNU6-4	0.69	0.57-0.86	64	-20.55	-21.20	1.47	2.09	0.65	1.57	I o.oi	396
RNU6-73	0.69	0.57-0.82	64	-20.34	-20.93	1.45	2.01	0.59	1.50	0.01	458
U6.375	0.67	0.55-0.79	63	-16.88	-17.39	1.43	1.50	0.51	1.42	0.01	433
hsa-miR-16-1-3 p	0.68	0.56-0.79	62	-14.19	-14.94	1.28	1.36	0.75	1.68	0.01	166
YRNA-255	0.67	0.55-0.79	64	-24.05	-24.77	1.52	1.67	0.71	1.64	0ΌΙ	260
RNU6-6	0.69	0.57-0.8 J	64	-20.40	-20.98	1.48	2.10	0.59	l 50	0.02	499
tRINA73ArgCCG	0.63	0.51-0.75	64	-16.84	-17.44	2.15	1.42	0.60	1,51	0.02	495
U6.601	0.69	0.56-0.81	64	-18.76	-19.21	1.62	2.07	0.45	1.37	0.02	868
UC022CJG1	0.66	0.54-0.78	64	-22.05	-22.65	0.84	0.99	0.59	1.51	I 0.02	127
SNORA57	0.63	0.50-0.76	64	-20.98	-21.33	1.13	1.13	0.36	1.28	0.05	516
put-miR-6 *	0.91	0.82-0.99	22	-13.78	-15.46	1.62	203	1.68	3.21	0.06	59
put-rniR-856 *	0.81	0.71-0.92	24	-12.97	-14.65	1.46	1.65	1.68	3.21	0.08	46
STEPWISE	0.83

-67 20986

Ca vs Mb	AUC	95% Confidence Interval	Cou ut	Average deq Ca	Average deq Mb	SD Ca	SD Mb	ddeq Ca - Mb	Fald change Ca/ Mb	t4est p-value	Power analysis (p = 0.05)
Ce vs Mc	AUC	95% Confidence Interval	Count	Average deq Ce	Average deq Me	SD Ce	SD Mc	ddeq Ce - Mc	Foid change Ce Mc	t-test p-value	Power analysis (p = 0.05)
hsa-lct-7t-5p	0.71	0.59-0.83	61	-16.44	-15.49	J .51	1.06	-0.95	-1 93	0.00	107
hsa-πύ R- Î35b-5p	0.73	0.61-0.86	58	-15.06	-14.08	0.99	1.30	-0.99	-1	0.00	72
hsa-iui R-425-5p	0.71	0.53-0.85	61	18.60	-19.20	0.84	l .09	0.60	151	0.00	134
hsa-tni R-l6-l-3p	0.74	0.63-0.86	60	-13.75	-15.06	1.68	1.33	1.30	2.47	0.00
U6.428	0.71	0.58-0.83	53	-13.29	-14.26	1.64	1.59	0.97	1.96	0.01	147
tRNA120-AiaAGC	0.76	0.64-0.87	46	-17.20	-19.02	2.30	2.47	1.82	3.54	0.01	90
hsa-TiiÎR-144-3p	0.80	0.69-0.91	45	-12.65	-14.57	2.17	2.49	1.92	3.80	0.01	75
put-miR-1003	095	0.89-1.00	17	-8.45	-1 1.23	2.00	1.74	2.78	6.86	0.01	28
YRNA-255	0 70	0.58-0.82	61	-24.38	-25.06	1.71	1.47	0.69	1.61	0.01	292
SNORA57	0.68	0.55-0.81	61	-20.75	-21.42	1.25	1.05	0.68	1.60	0.01	159
h sa-nu R-21-5p	0.67	0.53-0.80	61	-21.96	-21.40	0.87	1.03	0.56	-1.47	0.02	151
hsa-miR-144-5p	0.91	0.83-1.00	22	-11.26	-12.45	2.21	1.73	1.19	2.28	0.02	148
put-miR-1080	0.86	0.75-0.96	24	-10.51	-12.11	2.45	2.06	1.60	3.04	0.02	108
tRNA27-MetCAT	0.65	0.53-0.78	61	-18.80	-19.42	1 66	1.53	0.63	1.54	0.02	346
tRNAlSArgCCT	0.64	0.52-0.77	61	-23.00	-23.74	2.12	1.60	0.74	1.67	0.03	358
tRNA8-ThrAGT	0.64	0.5 1-0.76	61	-24.04	-24.37	2.50	2.31	0.33	1.26	0.03	2778
tRNA73ArgCCG	0.63	0.51-0 76	61	-17.19	-17.74	2.32	1.66	0.54	1.46	0.04	758
put-miR-325	0.63	0.51-0.76	61	-18.96	-19.78	2.67	1.98	0.82	1.77	0.04	448
RNU4-6P	0.61	0.47-0.74	61	-17.00	-16.23	1.57	1.09	-0.77	-1.71	0.05	173
U6.168	0.64	0.49-0.78	61	-17.09	-17 60	l 64	1.92	0.51	1.42	0.05	619
bsa-miR-671-3p	0.76	0.64-0.87	37	-1 1.40	-12.77	1.74	1.50	1.38	2.60	0.05	76
YRNA-245	0.62	0.49-0.74	61	-14.91	-15 30	1 79	1.07	0.39	1.31	0.05	801
put-miR-6	0.86	0.75-0.96	17	14.22	-15.33	1.78	2.15	1 10	2.15	0.07	167
STEPWISE	0.94

First Set of Examples of Embodiments of the Présent Disclosure

Al. A method of diagnosing and treatîng traumatic brain injury (TBI) in a human subject in need thereof, the method comprising:

obtaining a saliva sample from the subject;

contacting the saliva sample with a probe comprising a nucleic acid able to bind to at least one RNA biomarker selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, put-miR1207, U6.42S, put-miR-742, hsa-miR-6748-3p, put-miR-6, put-miR-410, put-miR- 68 20986

476, put-miR-293, hsa-miR-34b-3p, hsa-miR-1271-5p, hsa-miR-449a, put-miR-806, put-miR-71, put-miR-468, put-miR-1306, put-miR-1146, put-miR-10 84_p put-miR-92, put-miR-209, put-miR-961, U6.1249, put-miR-188, and put-miR-1352;

determining an amount ofthe at least one RNA biomarker in the saliva sample;

identifying the subject as having TBI where the amount ofthe at least one

RNA biomarker is increased or decreased relative to a predetermined threshold value or relative to the amount of the RNA biomarker in a control sample; and treating the subject îdentified as having TBI according to one or more of the following:

subjecting the subject to a verbal, cognitive, motor, or optical test, or any combination of the foregoing;

subjecting the subject to diagnostic imaging in the form of a CT or MRI, or a combination thereof; and/or administering to the subject one or more neuroprotective thérapies.

A2. The method according to claim Al further comprising identifying the human subject as being fit for normal activity after undergoing successful treatment for TBI.

B1. A method of diagnosing and/or monitoring traumatic brain injury (TBI) in a subject, the method comprising determining a level of at least one RNA biomarker in a saliva sample obtained from the subject, wherein the at least one RNA biomarker is selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, put-miR-1207, U6.428, put-miR-742, hsa-miR-6748-3p, put-miR-6, put-miR-410, put-miR476, put-miR-293, hsa-miR-34b-3p, hsa-miR-1271-5p, hsa-miR-449a, put-miR-806, putmiR-71, put-miR-468, put-miR-1306, put-miR-1146, put-miR-1084, put-miR-92, put-miR209, put-mîR-961, U6.1249, put-miR-188, and put-miR-1352, or any combination thereof.

B2. The method of claim B1, wherein either an upregulated level or a downregulated level of the at least one RNA biomarker is indicative of TBI.

B3. The method of claim B1, wherein the subject is diagnosed as having TBI if the level of the at least one RNA biomarker is either above or below a predetermined threshold or increased or decreased relative to a control.

B4. The method according to claim B1 further comprising identifying the human subject as being fit for normal activity after undergoing successful treatment for TBI.

B5. The method of any one of daims B1-B4, wherein the at least one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR-143-3p and hsa-miR-l35b-5p.

-69 20986

Cl. A sensor element for a détection System for diagnosing and/or monitoring TBI. the sensor element comprising a substrate functionalîzed with a probe spécifie for at least one RNA biomarker selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, put-miR-1207, U6.428, put-miR-742, hsa-miR6748-3p, put-miR-6, put-miR-410, put-miR-476, put-miR-293, hsa-miR-34b-3p, hsa-miR1271 -5p, hsa-miR-449a, put-miR-806, put-miR-71, put-miR-468, put-miR-1306, put-mîR1146, put-miR-1084, put-miR-92, put-miR-209, put-miR-961, U6.1249, put-miR-188, and put-miR-1352.

C2. The sensor element of daim Cl, wherein the probe comprises a nucleic acid able to bind to the at least one RNA biomarker.

C3. The sensor element of claim Cl or C2, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of the sequence of the target RNA biomarker.

C4. The sensor element of claim Cl or C2, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ ID NO: 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99.

C5. The sensor element of any one of daims C1-C4, wherein the at leas^ one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR143-3p and hsa-miR-135b-5p.

DI. A détection System for diagnosing and/or monitoring TBI, comprising a sensor element according to the présent disclosure, and a détection device capable of detecting the binding of a target RNA biomarker to the probe.

D2. The détection System according to daim D1, further comprising means to détermine whetber the target RNA biomarker is upregulated or downregulated.

El. A method for determining a course of action for a subject suspected of having TBI, comprising applying a saliva sample obtained from the subject to a détection System according to the présent disclosure , and if an upregulated level or a downregulated level of the at least one RNA biomarker is detected, providing a treatment for TBI.

Fl. A method of treating a subject with suspected TBI, the method comprising determining whether an upregulated level or a downregulated level of at least one RNA biomarker selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, put-miR-1207, U6.428, put-miR-742, hsamiR-6748-3p, put-miR-6, put-miR-410, put-miR-476, put-miR-293, hsa-miR-34b3p, hsa-miR-127l-5p, hsa-miR-449a, put-miR-806, put-miR-71, put-miR-468, put

-7020986 miR-1306, put-miR-1146, put-miR-1084, put-miR-92, put-miR-209, put-miR-961, U6.1249, put-miR- ] 88, and put-miR-1352 is détectable in a saliva sample obtained from the subject, and if an upregulated level or a downregulated level of at least one RNA biomarker is detected, providing treatment for TBI to the subject.

F2. The method of claim Fl, wherein the at least one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR-143-3p and hsamiR-135b-5p.

GI. A method of detecting an RNA biomarker in a saliva sample, the method comprising obtaining a saliva sample from a human subject, contacting the saliva sample with at least one oligonucleotide primer complementary to at least one RNA biomarker selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, put-miR1207, U6.428, put-miR-742, hsa-miR-6748-3p, put-miR-6, put-miR-410, put-mîR476, put-miR-293, hsa-miR-34b-3p, hsa-miR-127 l-5p, hsa-miR-449a, put-miR-806, put-miR-71, put-miR-468, put-miR-1306, put-miR-1146, put-miR-1084, put-miR-92, put-miR-209, put-miR-961, U6.1249, put-miR-188, and put-miR-1352;

amplifyîng the at least one RNA biomarker using a polymerase chain reaction; and detecting the amplified RNA biomarker.

G2 . The method of ciaim G1, wherein the at least one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR-143-3p and hsamiR-135b-5p.

Fil. A kit for use in a method of diagnosing and/or monitoring traumatic brain injury (TBI) in saliva from a human subject, the kit comprising at least one probe spécifie for at least one RNA biomarker selected from the group consisting of Y RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, put-miR-1207, U6.428, put-miR-742, hsa-miR6748-3p, put-miR-6, put-miR-410, put-miR-476, put-miR-293, hsa-miR-34b-3p, hsa-miR1271-5p, hsa-miR-449a, put-miR-806, put-miR-71, put-miR-468, put-miR-1306, put-miR1146, put-miR-1084, put-miR-92, put-miR-209, put-miR-961, U6.1249, put-miR-188, and put-miR-1352.

H2 . The kit of claim Hl, wherein the probe comprises a nucleîc acid ablé to bînd to the at least one RNA biomarker.

- 71 20986

H3 . The kit of claim H1 or H2, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of the sequence of thebarget RNA biomarker,

H4 . The kit of claim H1 or H2, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ 1D NO: 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99.

H5 . The kit of any one of daims H1-H4, wherein the at least one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR-143-3p and hsa-miR-135b-5p.

Il. A composition for use in a method of diagnosing and/or monitoring traumatic brain injury (TBI) in saliva from a human subject, the composition comprising at least one probe spécifie for at least one RNA biomarker selected from the group consisting of Y_RNA.255, RNU6-7, RNU6-4, RNU6-6, RNU6-73, RNU6-45, U6.375, put-miR-1207, U6.428, putmiR-742, hsa-miR-6748-3p, put-miR-6, put-miR-410, put-miR-476, put-miR-293, hsa-miR34b-3p, hsa-miR-1271-5p, hsa-miR-449a, put-miR-806, put-miR-71, put-miR-468, putmiR-1306, put-miR-1146, put-miR-1084, put-miR-92, put-miR-209, put-miR-961, U6.1249, put-miR-188, and put-miR-1352.

12. The composition of claim II, wherein the probe comprises a nucleic acid able to bind to the at least one RNA biomarker.

13. The composition of claim II or 12, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of the sequence of the target RNA biomarker.

14. The composition of claim II or 12, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ ID NO: 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99.

15. The composition of any one of claims 11-14, wherein the at least one RNA biomarker further comprises one or more miRNA selected from the group consisting of hsa-miR143-3p and hsa-miR-135b-5p.

Second Set of Examples of Embodiments of the Présent Disclosure

Al. A method of diagnosing and treating traumatic brain injury (TBI) in a human subject in need thereof, the method comprising:

obtaining a saliva sample from the subject;

-7220986 contacting the saliva sample with a probe comprising a nucleic acid able to bind to at least one RNA biomarker:

a. selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-144-3 p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-16-l-3p, hsa-mîR-339-5p, hsa-miR-497-5p, put-miR-1 204, putmiR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-469. putmiR-594, put-miR-856, put-miR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNA120-AlaAGC, tRNA18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA245, and YRNA-684, or any combination thereof; and/or

b. selected from the group consisting of put-miR-1003, put-miR-1080, putmîR-1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-468, put-miR-476, put-miR-6, put-miR-71, putmiR-742, put-miR-806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, U6.I249, U6.375, U6.428, andYRNA-255, or any combination thereof;

determining an amount of the at least one RNA biomarker in the saliva sample;

identifying the subject as having TBI where the amount of the at least one RNA biomarker is increased or decreased relative to a predetermined threshold value or relative to the amount of the RNA biomarker in a control sample; and treating the subject identified as having TBI according to one or more of the following:

subjecting the subject to diagnostic imaging in the form of a CT or MRI, or a combination thereof; and/or administerîng to the subject one or more neuroprotective thérapies.

A2. The method of claim A1, wherein the at least one RNA biomarker further comprises one or more miRNA:

a. selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsamiR- 126-5p (=miR-126*), hsa-miR-13 5b-5p, hsa-miR-I42-3p, hsa-miR142-5p, hsa-miR-143-3p (=miR-I43), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsa

- 73 20986 ι

miR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or

b. selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-Iet7f-5p, hsa-miR-103a-3p, hsa-miR-2 1 -5p, and hsa-miR-92a-3p, or any combination thereof.

A3 . The method according to claim Al further comprising identifying the human subject as being fit for normal activity after undergoing successful treatment for TBI.

Bl. A method of diagnosing and/or monitoring traumatic brain injury (TBI) in a subject, the method comprising determining a level of at least one RNA biomarker in a saliva sample obtained from the subject, wherein the at least one RNA biomarker is:

a. selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-144-3p (miR-144*), hsa-miR- 144-5p (=miR-144*), hsa-miR-16-I-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, putmiR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-469, putmiR-594, put-miR-856, put-miR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNAl20-AlaAGC, tRNAl 8-ArgC CT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA245, and YRNA-684, or any combination thereof; and/or

b. selected from the group consisting of put-miR-1003, put-miR-1080, putmiR-1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-468, put-miR-476, put-mîR-6, put-miR-71, putmiR-742, put-iniR-806, put-mîR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof.

B2. The method of claim Bl, wherein either an upregulated level or a downregulated level of the at least one RNA biomarker is indicative of TBI.

B3. The method of claim B1, wherein the subject is diagnosed as having TBI if the level of the at least one RNA biomarker is either above or below a predetermined threshold or increased or decreased relative to a control,

B4. The method of any one of daims B1-B3, wherein the at least one RNA biomarker further comprises one or more miRNA:

a. selected from the group consisting of hsa-Iet-7i-5p, hsa-miR-107, hsamiR- 126-5p (=miR-126*), hsa-miR-13 5b-5p, hsa-miR-142-3p, hsa-miR142-5p, hsa-miR-143-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206,

- 7420986 hsa-miR~29c-3p, hsa-miR-34b-3p, hsa-miR-425~5p, hsa-miR-449a, hsamiR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or

b. selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let7f-5p, hsa-miR-103 a-3p, hsa-miR-2 l-5p, and hsa-miR-92a-3p, or any combination thereof.

B5. The method according to claim BI further comprising identifying the human subject as being fit for normal activity after undergoing successful treatment for TBI.

B6. The method of any one of claims B1-B7, wherein the at least one RNA biomarker further comprises one or more miRNA:

a. selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsamiR-126-5p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR142-5p, hsa-mîR-143-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsamiR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or

b. selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let7f-5p, hsa-miR-103a-3p, hsa-miR-21-5p, and hsa-miR-92a-3p, or any combination thereof.

Cl. A sensor element for a détection System for diagnosing and/or monitoring TBI, the sensor element comprising a substrate functionalized with a probe spécifie for at least one RNA biomarker:

a. selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-16-l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, putmiR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-469, putmiR-594, put-miR-856, put-miR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNA120-AlaAGC, tRNAl 8-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA245, and YRNA-684, or any combination thereof; and/or

b. selected from the group consisting of put-miR-1003, put-miR-1080, putmiR-1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-468, put-miR-476, put-miR-6, put-miR-7I, putmiR-742, put-miR-806, put-miR-92, put-miR-961, RNU6-4, RNU6-45,

-75 20986

RNU6-6, RNU6-7, RNU6-73, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof.

C2. | The sensor element of claim Cl, wherein the probe comprises a nucleic acid able to bmd to the at least one RNA biomarker.

C3. The sensor element of claim Cl or C2, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément ofthe sequence of the target RNA biomarker.

C4, The sensor element of claim Cl or C2, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ ID NO: 1,2, 14, 16, 23, 26, 27, 29, 39, 40, 48, 71, 72, 73, 74, 75, 77, 78, 79, 80, 81, 82, 84, 85, 86, 87, 89, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, and 150.

C5. The sensor element of any one of daims Cl-C4, wherein the at least one RNA biomarker further comprises one or more miRNA:

a. selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsamiR-126-5p (=miR-126*)> hsa-miR-135b-5p, hsa-miR- 142-3p, hsa-miR142-5p, hsa-miR-143-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b-3p, hsa-mîR-425-5p, hsa-miR-449a, hsamiR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination I thereof; and/or

b. selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let7f-5p, hsa-miR-103 a-3p, hsa-miR-21-5p, and hsa-miR-92a-3p, or any

I combination thereof.

D1. A détection System for diagnosing and/or monitoring TBI, comprising a sensor element according to the présent disclosure, and a détection device capable of detecting the binding of a target RNA biomarker to the probe.

D2. The détection system according to claim Dl, further comprising means to détermine whether the target RNA biomarker is upregulated or downregulated.

El. A method for determining a course of action for a subject suspected of having TBI, comprising applying a saliva sample obtaîned from the subject to a détection system according to the présent disclosure, and if an upregulated level or a downregulated level of the at least one RNA biomarker is detected, providing a treatment for TBI.

Fl. A method of treating a subject with suspected TBI, the method comprising

- 7620986 determining whether an upregulated level or a downregulated level of at least one RNA biomarker:

a. selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-144-3p (mi R-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-16-l-3p, bsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, putmiR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-469, putmiR-594, put-miR-856, put-miR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNAl 20-AlaAGC, tRNAl 8-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA245, and YRNA-684, or any combination thereof; and/or

b. selected from the group consisting of put-miR-1 003, put-miR-1080, putmiR-1084, put-miR-1146 (2), put-mîR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-468, put-miR-476, put-miR-6, put-miR-71, putmiR-742, put-miR-806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof, is détectable in a saliva sample obtained from the subject, and if an upregulated level or a downregulated level of at least one RNA biomarker is detected, providing treatment for TBI to the subject.

F2. The method of claim Fl, wherein the at least one RNA biomarker further comprises one or more miRNA:

a. selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsamîR-126-5p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR142-5p, hsa-miR-143-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b-3p, hsa-mîR-425-5p, hsa-miR-449a, hsamiR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or

G1. A method of detecting an RNA biomarker in a saliva sample, the method comprising obtaining a saliva sample from a human subject,

-7720986 contacting the saliva sample with at least one oligonucleotide primer i

complementary to at least one RNA biomarker;

a. selected from the group consisting of hsa-miR-1246, hsa-miR- I26-3p (miR-126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-mîR-16-l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, putmiR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-469, putI miR-594, put-miR-856, put-miR-893, put-miR-958, RNU4-6p,

SNORA57, SNORD3B-2, tRNAl20-AlaAGC, tRNAl 8-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA| 245, and YRNA-684, or any combination thereof; and/or

b. selected from the group consisting of put-miR-1003, put-miR-1080, putmiR-1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-468, put-miR-476, put-miR-6, put-miR-71, putmîR-742, put-miR-806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof;

amplifying the at least one RNA biomarker using a polymerase chain reaction; and | detecting the amplified RNA biomarker.

G2. The method of claim Gl, wherein the at least one RNA biomarker further comprises one or more miRNA:

a. selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsamiR- 126-5p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR142-5p, hsa-miR-143-3p (=miR-143), hsa-miR- 148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-mîR-34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsamiR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or

b. selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let7f-5p, hsa-miR-Ι 03a-3p, hsa-miR-21-5p, and hsa-miR-92a-3p, or any combination thereof.

H1. । A kit for use in a method of diagnosing and/or monitoring traumatic brain injury (TBI) in saliva from a human subject, the kit comprising at least one probe spécifie for at least one RNA biomarker:

-7820986

I a. selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (mîR-126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-16-l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, putmiR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-469, put- | miR-594, put-miR-856, put-miR-893, put-miR-958, RNU'4-όρ,

SNORA57, SNORD3B-2, tRNA120-AlaAGC, tRNA18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA245, and YRNA-684, or any combination thereof; and/or

b. selected from the group consisting of put-miR-1003, put-niiR-1080, putmiR-1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-468, put-mîR-476, put-miR-6, put-miR-71, putmiR-742, put-miR-806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, | RNU6-6, RNU6-7, RNU6-73, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof.

H2. The kit of claim HI, wherein the probe comprises a nucleic acid able to bind to the at least one RNA biomarker.

H3. The kit of claim H1 or H2, wherein the probe comprises a nucleic acid having at least 70% îdentity with a sequence which is the complément of the sequence of the target RNA biomarker.

H4. The kit of claim H1 or H2, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ ID NO: 1, 2, 14, 16, 23, 26, 27, 29, 39, 40, 48, 71, 72, 73, 74, 75, 77, 78, 79, 80, 81, 82, 84, 85, 86, 87, 89, 97, 98, 99, 100,

101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118,119,

120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137,138,

139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, and150.

H5. The kit of any one of daims H1-H4, wherein the at least one RNA biomarker further comprises one or more miRNA:

a. selected from the group consisting ofhsa-let-7i-5p, hsa-miR-107, hsami R-12 6-5 p (=miR-I26*), hsa-miR-135b-5p, hsa-mi R-142-3 p, hsa-mi R142-5p, hsa-miR-I43-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsamiR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or

-79 20986

b. selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-

7f-5p, hsa-miR-I03a-3p, hsa-miR-2I-5p, and hsa-mîR-92a-3p, or any combination thereof.

II. A composition for use in a method of diagnosîng and/or monitoring traumatic brain injury (TBI) in saliva from a hum an subject, the composition comprising at least one probe spécifie for at least one RNA biomarker:

12.

a. selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*)_shsa-miR-16-l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, putmiR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-469, putmiR-594, put-miR-856, put-miR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNAl20-AlaAGC, tRNAl 8-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.I68, U6.601, UC022CJG1, YRNA245, and YRNA-684, or any combination thereof; and/or

b. selected from the group consisting of put-miR-1003, put-miR-1080, putmiR-1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-468, put-miR-476, put-miR-6, put-miR-71, putmiR-742, put-miR-806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU6-73, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof.

The composition of claim fl, wherein the probe comprises a nucleic acid able to bind to the at least one RNA biomarker.

14. The composition of claim II or 12, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ ID NO: 1,2, 14, 16, 23, 26, 27, 29, 39, 40, 48, 71, 72, 73, 74, 75, 77, 78, 79, 80, 81, 82, 84, 85, 86, 87, 89, 97, 98, 30 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117,

118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, and 150.

15. The composition of any one of daims 11-14, wherein the at least one RNA biomarker further comprises one or more miRNA:

-8020986

a. selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsamiR-126-5p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-mîRI42-5p, hsa-miR-143-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR-34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsa- miR-671 -3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or

Other advantages that are obvious and/or inhérent to the disclosure will be évident to one ski lied in the ail, It will be understood that certain features and sub-combinations are of utility and may be employed wîthout reference to other features and sub-combinations. This is contemplated by and is within the scope of the daims. Since many possible embodiments may be made of the disclosure without departing from the scope thereof, it is to be understood that ail inatter herein set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense.

Claims

A method of diagnosing and/or monitoring traumatic brain injury (TBI) in a subject, the method comprising determining a level of at least one RNA biomarker in a saliva sample obtained from the subject. wherein the at least one RNA biomarker is:

b.

selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*). hsa-miR-161 -3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, put-miR-323, put-miR325, put-miR-444, put-miR-465, put-miR-469, put-miR-594, put-miR-856, putmiR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNA120-AlaAGC, tRNA18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA. U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA-245, and YRNA-684, or any combination thereof; and/or selected from the group consisting of put-miR-1003, put-miR-1080, put-miR1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR209, put-miR-468, put-miR-476, put-miR-6. put-miR-71, put-miR-742, put-miR806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU673, U6.1249, U6.375, U6.428, and YRNA-255, or any combination thereof.
2. The^ethod of claim 1, wherein eîther an upregulated level or a downregulated level of the at least one RNA biomarker is indicative of TBI.

I
3. Theimethod of claim 1, wherein the subject is diagnosed as having TBI if the level of the at least one RNA biomarker is either above or below a predetermîned threshold or increased or decreased relative to a control.
4. The method of claim 1, wherein the saliva sample is obtained during a period of time after injury selected from immediately after the injury to any period post-injury.

I
5. The;method of claim 4, wherein the saliva sample is obtained during a period of time after injury selected from immediately after the injury untîl the expression level of at least oneuf the RNA biomarkers returns to a predetermîned threshold value or to the amount of the RNA biomarker in a control sample.

- 8220986
6. The method of claim 4, wherein the saliva sample is obtained during a period of time after injury selected from immediately after the injury to up to 1 year, up to 10 months, up to 8 months, up to 6 months, up to 5 months, up to 4 months, up to 3 months, up to 2 months, up to 1 month, up to 25 days, up to 20 days, up to 15 days, up to 7 days, up to 5 days, up to 3 days, up to 2 days, and/or up to 24 hours post-injury.
7. The method of claim 6, wherein the saliva sample is obtained during a period of time after injury selected from immediately after the injury to 1 5 days, from 1 hour to 15 days, from 24 hours to 15 days, from 24 hours to 7 days, and from 2 to 5 days.
8. The method of claim 1, further comprising determining the level of the at least one RNA biomarker in one or more additional saliva samples obtained from the subject at one or more additional times after the injury and repeating the detecting and amplifying steps for each additional sample.
9. The method of claim 8, wherein the one or more additional saliva sample is obtained during a period of time after injury selected from immediately after the injury to any period post-injury.
10. The method of claim 8, wherein the one or more additional saliva sample is obtained during a period of time after injury selected from immediately after the injury until the expression level of at least one of the RNA biomarkers retums to a predetermined threshold value or to the amount of the RNA biomarker in a control sample.
11. The method of claim 8, wherein the one or more additional saliva sample is obtained during a period of time after injury selected from immediately after the injury to up to 1 year, up to 10 months, up to 8 months, up to 6 months, up to 5 months, up to 4 months, up to 3 months, up to 2 months, up to 1 month, up to 25 days, up to 20 days, up to 15 days, up to 7 days, up to 5 days, up to 3 days, up to 2 days, and/or up to 24 hours postinjury.
12. The method of claim 11, wherein the one or more additional saliva sample is obtained during a period of time after injury selected from immediately after the injury to 15 days, from 1 hour to 15 days, from 24 hours to 15 days, from 24 hours to 7 days, and from 2 to 5 days.

-83 20986
13. The method of daim 8, wherein the one or more additîonal saliva samples is obtained at day 1, 1.5, 2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 after the injury.
14. The|method of any one of daims 1-13, wherein the determining a level of the at least one RNA biomarker is performed using a PCR-based assay, a light array assay, a laminar flow chip assay, or any assay suitable for detecting that at least one RNA biomarker.
15. The method of claim 14, wherein when using the PCR-based assay a predetermined threshold is équivalent to a fold change of 1.5 or more using the 2-delta delta CT (2AACT) method.
16. The method of claim 14, wherein a predetermined threshold is équivalent to a fold change of 2 or more using the 2-delta delta CT (2-AACT) method.
17. The|method of any one of daims 1-16, wherein the at least one RNA biomarker further comprises one or more miRNA:

a.

b.

sdected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsa-miR-1265p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3 p, hsa-miR-142-5p, hsa-miR143-3 p (=miR-143), hsa-miR-14 8a~3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsa-miR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or sdected from the group consisting of hsa-let-7a-5p, hsa-Iet-7b-5p, hsa-let-7f-5p, hsa-miR-103a-3p, hsa-miR-21-5p, and hsa-mîR-92a-3p, or any combination thereof.
18. The method according to claim 1 further comprising identifyîng the human subject as being fit for normal actîvity after undergoing successful treatment for TBI.
19. The method of any one of daims 1-18, wherein the at least one RNA biomarker further comprises one or more miRNA:

a. sdected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsa-miR-1265p (=miR-126*), hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR143-3p (=miR-143), hsa-miR-I48a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR

- 8420986

b.

34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsa-miR-671-3p, hsa-mîR-6748-3p, and hsa-miR-934, or any combination thereof; and/or selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f-5p, hsa-miR-103a-3p, hsa-miR-21-5p, and hsa-miR-92a-3p, or any combination thereof.
20. A sensor element for a détection System for diagnosing and/or monitoring TBI, the sensor element comprising a substrate functionalîzed with a probe spécifie for at least one RNA biomarker:

a.

b.

selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR126*), hsa-mîR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-16l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-J204, put-miR-323, put-miR325, put-miR-444, put-miR-465, put-miR-469, put-miR-594, put-miR-856, putmiR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNA120-AlaAGC, tRNA18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA-245, and YRNA-684, or any combination thereof; and/or selected from the group consisting of put-miR-1003, put-miR-1080, put-miR1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR209, put-miR-468, put-miR-476, put-miR-6, put-miR-71, put-miR-742, put-miR806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU673, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof.
21. The sensor element of claim 20, wherein the probe comprises a nucleic acid able to bind to the at least one RNA biomarker.
22. The sensor element of claim 20 or 21, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of the sequence of the target RNA biomarker.
23. The' sensor element of claim 20 or 21, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ ID NO: 1, 2, 14, 16, 23, 26, 27, 29, 39, 40, 48, 71, 72, 73, 74, 75, 77, 78, 79, 80, 81, 82, 84, 85, 86, 87, 89, 97,98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132,

-8520986

133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, and 150.
24. The sensor element of any one of daims 21-23, wherein the at least one RNA biomarker further comprises one or more miRNA:

a. selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsa-miR-1265p (=miR-126*), hsa-mîR-135b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR143-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsa-miR-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or

b. selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f-5p, hsa-miR-103a-3p, hsa-miR-21-5p, and hsa-miR-92a-3p, or any combination thereof.
25. A détection System for diagnosing and/or monitoring TBI, comprising a sensor element according to any one of daims 20-24, and a détection de vice capable of detecting the binding of a target RNA biomarker to the probe.

I
26. The détection System according to daim 25, further comprising means to détermine whether the target RNA biomarker is upregulated or downregulated.
27. A method for determining a course of action for a subject suspected of having TBI, comprising applying a saliva sample obtained from the subject to a détection System according to daim 25 or 26, and if an upregulated level or a downregulated level of the at least one RNA biomarker is detected, providîng a treatment for TBI.
28. A method of detecting an RNA biomarker în a saliva sample, the method comprising providing a saliva sample obtained from a human subject, contacting the saliva sample with at least one oligonucleotide primer complementary to at least one RNA biomarker:

a. selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR-126*), hsa-miR- 144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-16-l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, putmiR-323, put-miR-325, put-miR-444, put-miR-465, put-miR-469, put

-8620986 miR-594, put-miR-856, put-miR-893, put-miR-958. RNU4-6p. SNORA57, SNORD3B-2, tRNAl 20-AlaAGC, tRNA18-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG, tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6J68, U6.601, UC022CJGI, YRNA245, and YRNA-684, or any combination thereof; and/or

b. selected from the group consisting of put-miR-1003, put-miR-1080, putmiR-1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR-209, put-miR-468, put-miR-476, put-miR-6, put-miR-71, putmiR-742, put-miR-806, put-miR-92, put-mîR-961, RNU6-4, RNLJ6-45, RNU6-6, RNU6-7, RNU6-73, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof;

amplifying the at least one RNA biomarker using a polymerase chain reaction; and detecting the amplified RNA biomarker.
29. The method of claim 28, wherein the at least one RNA biomarker further comprises one or more miRNA:

a. selected from the group consisting of has-let-7î-5hashsa-miR-l 07, hsa-miR-] 265p (=miR-126*), hsa-miR-Ι 35hasp, hsa-miR-142-3p, hsa-miR- 142-5p, hsa-miR143-3p (=mhasl43), hsa-mhasl48a-3phassa-miR-206hassa-miR-29chas. hsamiR-has-3p, hsahasR-425-5p, has-miR-449a, hsa-has-671-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or

b. selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-has hsa-let-7f5hashsa-miR-103a-3p, hsa-miR-21-5p, and hsa-mîR-92a-3p, or any combination thereof.
30. A kit for use in a method of diagnosing and/or monitoring traumatic brain injury (TBI) in saliva from a human subject, the kit comprising at least one probe spécifie for at least one RNA biomarker:

a. selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-16l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-iniR-1204, put-miR-323, put-miR325, put-miR-444, put-mîR-465, put-miR-469, put-miR-594, put-miR-856, putmiR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNAl 20-AlaAGC, tRNAl 8-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG,

- 87 20986

b.

tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1,

YRNA-245. and YRNA-684, or any combination thereof; and/or selected from the group consisting of put-miR-1003, put-miR-1080, put-miR1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR209, put-miR-468, put-miR-476, put-miR-6, put-miR-71, put-miR-742, put-miR806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU673, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof.
31. The kit of claim 30, wherein the probe comprises a nucleic acid able to bind to the at least one RNA biomarker.
32. The kit of claim 30 or 31, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of the sequence of the target RNA biomarker.
33. The|kit of claim 30 or 31, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ ID NO: 1, 2, 14, 16, 23, 26, 27, 29, 39, 40, 48, 71, 72, 73, 74, 75, 77, 78, 79, 80, 81, 82, 84, 85, 86, 87, 89, 97, 98, 99,

100; 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117,

118^ 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135,

136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, and 150.
34. The।kit of any one of claims 30-33, wherein the at least one RNA biomarker further comprises one or more mîRNA:

a. selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsa-miR-1265p (=miR-126*), hsa-miR-Ι 35b-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR143-3p (=miR-143), hsa-miR-I48a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsa-miR-67I-3p, hsa-miR-6748-3p, and hsa-miR-934, or any combination thereof; and/or

b. selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f-5p, hsa-miR-103a-3p, hsa-miR-21-5p, and hsa-miR-92a-3p, or any combination thereof.

- 88 20986
35. A composition for use in a method of diagnosing and/or monitoring traumatic brain inju|ry (TBI) in saliva from a human subject, the composition comprising at least one probe spécifie for at least one RNA biomarker:

a. selected from the group consisting of hsa-miR-1246, hsa-miR-126-3p (miR126*), hsa-miR-144-3p (miR-144*), hsa-miR-144-5p (=miR-144*), hsa-miR-16l-3p, hsa-miR-339-5p, hsa-miR-497-5p, put-miR-1204, put-miR-323, put-miR325, put-miR-444, put-miR-465, put-miR-469, put-miR-594, put-mîR-856, putmiR-893, put-miR-958, RNU4-6p, SNORA57, SNORD3B-2, tRNA120-AIaAGC, tRNAl 8-ArgCCT, tRNA27-MetCAT, tRNA2-LeuTAA, tRNA73-ArgCCG. tRNA8-ThrAGT, tRNA9-TyrGTA, U2.3, U4.64, U6.168, U6.601, UC022CJG1, YRNA-245, and YRNA-684, or any combination thereof; and/or

b. selected from the group consisting of put-miR-1003, put-miR-1080, put-miR1084, put-miR-1146 (2), put-miR-1207, put-miR-1306, put-miR-188, put-miR209, put-miR-468, put-miR-476, put-miR-6, put-miR-71, put-miR-742, put-miR806, put-miR-92, put-miR-961, RNU6-4, RNU6-45, RNU6-6, RNU6-7, RNU673, U6.1249, U6.375, U6.428, andYRNA-255, or any combination thereof.
36. Thei composition for use of claim 35, wherein the probe comprises a nucleic acid able to bind to the at least one RNA biomarker.
37. The composition for use of claim 35 or 36, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence whîch is the complément of the sequence of the target RNA biomarker.
38. The composition for use of claim 35 or 36, wherein the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complément of SEQ ID NO: 1, 2, 14, 16, 23,26,27, 29,39,40,48, 71,72,73, 74, 75, 77, 78, 79, 80, 81, 82, 84, 85, 86, 87,89, 97,98,99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, and 150.
39. The composition for use of any one of claims 35-38, wherein the at least one RNA biomarker further comprises one or more miRNA:

-8920986

a. selected from the group consisting of hsa-let-7i-5p, hsa-miR-107, hsa-miR-1265p (=miR-126*), hsa-miR-135b-5p_} hsa-miR-Ι 42-3p, hsa-miR-142-5p, hsa-miR143-3p (=miR-143), hsa-miR-148a-3p, hsa-miR-206, hsa-miR-29c-3p, hsa-miR34b-3p, hsa-miR-425-5p, hsa-miR-449a, hsa-miR-671-3p, hsa-miR-6748-3p, and

5 hsa-miR-934, or any combination thereof; and/or

b. selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f-5p, hsa-miR-103a-3p, hsa-miR-21 -5p, and hsa-miR-92a-3p, or any combination thereof.