OA20592A - S-antigen transport inhibiting oligonucleotide polymers and methods - Google Patents

S-antigen transport inhibiting oligonucleotide polymers and methods Download PDF

Info

Publication number
OA20592A
OA20592A OA1202100203 OA20592A OA 20592 A OA20592 A OA 20592A OA 1202100203 OA1202100203 OA 1202100203 OA 20592 A OA20592 A OA 20592A
Authority
OA
OAPI
Prior art keywords
complex
modified oligonucleotide
units
oligonucleotide
lna
Prior art date
Application number
OA1202100203
Inventor
Leonid Beigelman
David Bernard Smith
Rajendra Pandey
Vivek Kumar Rajwanshi
Lawrence M. Blatt
Jin Hong
Original Assignee
Aligos Therapeutics, Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aligos Therapeutics, Inc filed Critical Aligos Therapeutics, Inc
Publication of OA20592A publication Critical patent/OA20592A/en

Links

Abstract

Various embodiments provide STOPS™ polymers that are S-antigen transport inhibiting oligonucleotide polymers, processes for making them and methods of using them to treat diseases and conditions. In some embodiments the STOPS™ modified oligonucleotides include an at least partially phosphorothioated sequence of alternating A and C units having modifications as described herein. The sequence independent antiviral activity against hepatitis B of embodiments of STOPS™ modified oligonucleotides, as determined by HBsAg Secretion Assay, is greater than that of a reference compound.

Description

S-ANTIGEN TRANSPORT INHIBITING OLIGONUCLEOTIDE POLYMERS AND METHODS
RELATED APPLICATION INFORMATION
[0001] This application claims priority to U.S. Serial No. 62/757,632, filed November 8, 2018; U.S. Serial No. 62/855,323, filed May 31, 2019; and to U.S. Serial No. 62/907,845, filed September 30, 2019. Each of the foregoing is incorporated herein by reference in îts entirety.
BACKGROUND
Field
[0002] This application relates to STOPS™ antiviral compounds that are S-antigen transport inhibiting oligonucleotide polymers, processes for making them and methods of using them to treat dîseases and conditions.
Description
[0003] The STOPS™ compounds described herein are antiviral oligonucleotides that can be at least partially phosphorothioated and exert theîr anti viral activity by a nonsequence dépendent mode of action. See A. Vaillant, “Nucleic acid polymers: Broad spectrum antiviral activity, antiviral mechanisms and optimizalion for the treatment of hepatitis B and hepatitis D infection”, Antlviral Research 133, 32-40 (2016). The term “Nucleic Acid Polymer” (NAP) has been used in the literature to refer to such oligonucleotides, although that term does not necessarily connotate antiviral activity. A number of patent applications filed in the early 2000s disclosed the structures of certain spécifie compounds and identified various structural options as potential areas for future expérimentation. See, e.g., U.S. Patent Nos. 7,358,068; 8,008,269; 8,008,270 and 8,067,385. These efforts resulted in the identification of the compound known to those skilled in the art as REP 2139, a phosphorothioated 40-mer having repeating adenosine-cytidine (AC) units with 5-methylation of ail cytosines and 2’-0 methy] modification of ali riboses, along with the compound known as its clinical progenitor, REP 2055. See 1. Roehl et al., “Nucleic Acid Polymers with Accelerated Plasma and Tissue Clearance for Chrome Hepatitis B Therapy”, Molecular Therapy: Nucleic Acids Vol. 8, 1-12 (2017). The authors of that publication îndicated that the structural features of these compounds had been optimized for the treatment of hepatitis B (HBV) and hepatitis D (HBD). See also A. Vaillant. “Nucleic acid polymers: Broad spectrum antiviral activity, antiviral mechanisms and optimization for the treatment of hepatitis B and hepatitis D infection”, Antiviral Research 133 (2016) 32-40. According to these authors and related li te rature, such 5 compounds preserve antiviral activity against HBV while preventing récognition by the innate immune response to allow their safe use with immunothérapies such as pegylated interferon. However, there remains a long-felt need for more effective compounds in this class.
SUMMARY
[0004] It has now been discovered that, contrary to the teachings in the art 10 regarding the optimum combination of désirable structural features for antiviral compounds, significantly improved properties can be obtained by modîfying them to provide STOPS™ compounds as described herein. For example, in some embodîments the sequence independent antiviral activity of the new STOPS™ compounds against HBV, as determined by HBsAg Sécrétion Assay, is greater than that of a reference compound. In view of the many years of 15 research culminatîng in the art-recognized optimized structure of REP 2139, there had been little expectation by those skilled in the art that embodîments of the modified STOPS™ compounds described herein would be reasonably likely to display such improvements in potency. Tlius, the structures of the new STOPS™ compounds and methods of using them to treat HBV and HBD are surprising and unexpected.
[0005] Some embodîments described herein relate to a modified oligonucleotide or compiex thereof having sequence independent antiviral activity against hepatitis B, that can include an at least partially phosphorothioated sequence of alternating A and C units, wherein:
the A units comprise one or more selected from:
2'-OMe-A
2'-O-MOE-A
LNA-A
scp-BNA-A
nmLNA-A the C units comprise one or more selected from
2'-O-Butynyi- (5m)C
Ribo-C
Ribo-(5m)C nmLNA-(5m)C
[0006] each terminal is independently hydroxyl, an O,O-dihydrogen phosphorothioate, a dihydrogen phosphate, an endcap or a linking group;
[0007] each internai θ is a phosphorus-containing linkage to a neighboring A or C unît, the phosphorus-containing linkage being a phosphorothioate linkage or a modified linkage selected from phosphodiester, phosphorodithioate, methylphosphonate, diphosphorothioate, 5’-phosphoramidate, 3’,5’-phosphordiamidate, 5’-thiophosphoramidate, 3’,5’-throphosphordiamidate or diphosphodiester; and
[0008] the sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, is greater than that of a reference compound;
[0009] with the proviso that, when the sequence of altemating A and C units comprises a Ribo-A unit, the sequence further comprises at least one A unit that is not a RiboA unit; and
[0010] with the proviso that, when the sequence of altemating A and C units comprises a Ribo-C unit, the sequence further comprises at least one C unit that is not a RiboC unit.
[0011] Some embodiments described herein relate to a method of trcating a HBV and/or HDV infection that can include administering to a subject identified as suffering from the HBV and/or HDV infection an effective amount of a modified oligonucleotide modified oligonucleotide as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide as described herein.
[0012] Some embodiments disclosed herein relate to a method of inhibiting réplication of HBV and/or HDV that can include contacting a cell infected with the HBV and/or HDV with an effective amount of a modified oligonucleotide modified oligonucleotide as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide as described herein.
[0013] These are other embodiments are described in greater detail below
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1 illustrâtes an embodiment of a modified oligonucleotide that comprises a C2.f,alkyiene linkage.
[0015] FIG. 2 illustrâtes an embodiment of a modified oligonucleotide that comprises a propylene oxide linkage.
[0016] FIG. 3A illustrâtes an embodiment of a modified oligonucleotide having cholestérol attached via a 5’ tetraethylene glycol (TEG) linkage.
[0017] FIG. 3B illustrâtes an embodiment of a modified oligonucleotide having cholestérol attached via a 3’ TEG linkage.
[0018] FIG. 3C illustrâtes an embodiment of a modified oligonucleotide having a tocopherol (Vitamin E) attached via a 5’ TEG linkage.
[0019] FIG. 3D illustrâtes an embodiment of a modified oligonucleotide having a tocopherol (Vitamin E) attached via a 3’ TEG linkage.
[0020] FIGS. 4A and 4B illustrate embodiments of modified oligonucleotides having GalNac attached via a linking group.
[0021] FIG. 5 illustrâtes an embodiment of a reaction scheme for preparing a5’EP building block.
[0022] FIG. 6A illustrâtes embodiments of modified oligonucleotides and corresponding values of sequence independent antiviral activity against hepatitis B (as determined by HBsAg Sécrétion Assay) and cytotoxicity.
[0023] FIG. 6B illustrâtes embodiments of modified oligonucleotides and corresponding values of sequence independent anliviral activity against hepatitis B (as determined by HBsAg Sécrétion Assay) and cytotoxicity.
[0024] FIG. 7 illustrâtes . an embodiment of a reaction scheme for preparing
compound 5’-VP. [0025] FIG. 8 illustrâtes ; an embodiment of a reaction scheme for preparing
compounds 8-5 and 8-6. [0026] FIG. 9A illustrâtes an embodiment of a reaction scheme for preparing
compound 9R. [0027] FIG. 9B illustrâtes an embodiment of a reaction scheme for preparing
compound 9S. [0028] FIG. 10 illustrâtes an embodiment of a reaction scheme for preparing
compounds 10-5 and 10-6.
[0029] FIG. 11A illustrâtes an embodiment of a reaction scheme for preparing
compound 11 R.
[0030] FIG. 11B illustrâtes an embodiment of a réaction scheme for preparing
compound 11 S.
[0031] FIG. 12 illustrâtes liver exposure results following subcutaneous
administration to non-human primates of embodiments of modified oligonucleotide
compounds.
[0032] FIG. 13 illustrâtes PBMC assay results illustrating the immune reaction of
embodiments of modified oligonucleotide compounds.
[0033] FIG. 14 Illustrâtes PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.
[0034] FIG. 15 illustrâtes PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.
[0035] FIG. 16 illustrâtes PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.
[0036] FIG. 17 illustrâtes PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.
[0037] FIG. 18 illustrâtes PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.
[0038] FIG. 19 illustrâtes PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.
[0039] FIG. 20 illustrâtes PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.
[0040] FIG. 21 illustrâtes PBMC assay results illustrating the immune réaction of embodiments of modified oligonucleotide compounds.
[0041] FIG. 22 illustrâtes PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.
[0042] FIG. 23 illustrâtes a graph that is utilized in connection with the HBsAg Sécrétion Assay s described in Ex amples B3 and B4.
DETA1LED DESCRIPTION
Définitions
[0043] Unless defined otherwise, ail technical and scientific terms used herein hâve the same meaning as is commonly understood by one of ordinary skill in the art. Ail patents, applications, published applications and other publications referenced herein are incorporated by reference in their entirety unless stated otherwise. In the event that there are a plurality of définitions for a term herein, those in this section prevail unless stated otherwise.
[0044] The hepatitis B virus (HBV) is a DNA virus and a member of the Hepadnaviridae family. HBV infects more than 300 million worldwide and is a causative agent of liver cancer and lîver dîsease such as chronic hepatitis, cirrhosis, and hepatocelluîar carcinoma. HBV can be acute and/or chronic. Acute HBV infection can be either asymptomatic or présent with symptomatic acute hepatitis. HBV is classified into eight génotypes, A to H.
[0045] HBV îs a partially double-stranded circulai DNA of about 3.2 kilobase (kb) pairs. The HBV réplication pathway has been studied in great detail. T.J. Liang, Heptaology (2009) 49(5 Suppl):S13-S21. One part of réplication includes the formation of the covalentîy closed circular (cccDNA) form. The présence of the cccDNA gives rise to the risk of viral reemergence throughout the life of the host orgatiism. HBV carriers can transmit the dîsease for many years. An estimated 257 million people are living with hepatitis B virus infection, and it is estimated that over 750,000 people worldwide die of hepatitis B each year. In addition, immunosuppressed individuals or individuals undergoing chemotherapy are especially at risk for réactivation of an HBV infection.
[0046] HBV can be transmitted by blood, semen, and/or another body fluid. This can occur through direct blood-to-blood contact, unprotected sex, sharing of needles, and from an infected mother to lier baby during the delivery process. The HBV surface antigen (HBsAg) is most frequent)y used to screen for the presence of this infection. Currently available médications do not cure an HBV and/or HDV infection. Radier, the médications supprcss réplication of the virus.
[0047] The hepatitis D virus (HDV) is a DNA virus, also in the Hepadnaviridae family of viruses. HDV can propagate only in the presence of HBV. The routes of transmission of HDV are similar to those for HBV. Transmission of HDV can occur either via simultaneous infection with HBV (coinfection) or in addition to chronic hepalilis B or hepatitis B carrier state (superinfection). Both superinfection and coinfection with HDV results in more severe complications compared to infection with HBV alone. These complications include a greater likelihood of experiencing liver failure in acute infections and a rapid progression to liver cirrhosis, with an increased risk of developing liver cancer in chronic infections. In combination with hepatitis B, hepatitis D has the highest fatality rate of ali the hepatitis infections, at 20%. There is currenlly no cure or vaccine for hepatitis D.
[0048] As used herein in the context of oligonucleotides or other materials, the term “antiviral” has ils usual meaning as understood by those skilled in the art and thus includes an effect of the presence of the oligonucleotides or other material that inhibits production of viral particles, typically by reducing the number of infections viral parti clés formed in a System otherwise suitable for formation of infectious virai particles for at least one virus. In certain embodiments, the antiviral oligonucleotide has antiviral activity against multiple different virus, e.g., both HBV and HDV.
[0049] As used herein the term “oligonucleotide” (or “oligo”) has its usual meaning as understood by those skilled in the art and thus refers to a class of compounds that includes oligodeoxy nucléotides, oligodeoxyribonucleotides and oligoribonucleotides. Thus, “oligonucleotide” refers to an oligomer or poiymer of rîbonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof, including reference to oligonucleotides composed of naturally-occurring nucleobases, sugars and phosphodiester (PO) internucleoside (backbone) linkages as well as “modified” or substituted oligonucleotides having nonnaturally-occurring portions which fonction similarly. Thus, the term “modified” (or “substituted”) oligonucleotide has its usual meaning as understood by those skilled in the art and includes oligonucleotides having one or more of various modifications, e.g., stabilizing modifications, and thus can include at least one modification în the internucleoside linkage and/or on the ribose, and/or on the base. For example, a modified oligonucleotide can include modifications at the 2'-position of the ribose, acyclic nucléotide analogs, méthylation of the base, phosphorothioaled (PS) linkages, phosphorodithioate linkages, methylphosphonate linkages, linkages that connect to the sugar ring via sulfur or nitrogen, and/or other modifications as described elsewhere herein. Thus, a modified oligonucleotide can include one or more phosphorothioaled (PS) linkages, instead of or in addition to PO linkages. Like unmodihed oligonucleotides, modified oligonucleotides that include such PS linkages are considered to be in the same class of compounds because even though the PS linkage contains a phosphorous-sulfur double bond instead of the phosphorous-oxygen double bond of a PO linkage, both PS and PO linkages connect to the sugar rings through oxygen atoms.
[0050] As used herein in the context of modified oligonucleotides, the term “phosphorothioated” oligonucleotide has its usual meaning as understood by those skilled in the art and thus refers to a modified oligonucleotide in which ali of the phosphodiester internucleoside linkages hâve been replaced by phosphorothioate linkages. Those skilled in the art thus understand that the term “phosphorothioated” oligonucleotide is synonymous with “fully phosphorothioated” oligonucleotide. A phosphorothioated oligonucleotide (or a sequence of phosphorothioated oligonucleotides within a partially phosphorothioated oligonucleotide) can be modified analogously, including (for example) by repiacing one or more phosphorothioated internucleoside linkages by phosphodiester linkages. Thus, the term “modified phosphorothioated” oligonucleotide refers to a phosphorothioated oligonucleotide that has been modified in the tnanner analogous to that described herein with respect to oligonucleotides, e.g., by repiacing a phosphorothioated linkage with a modified linkage such as phosphodiester, phosphorodithioate, methylphosphonate, diphosphorothioate, 5’phospho ram i date, 3’,5’-phosphordiamidate, 5’-thiophosphoramidate, 3’,5’thiophosphordiamidate or diphosphodiester. An at least partially phosphorothioated sequence of a modified oligonucleotide can be modified similarly, and thus, for example, can be modified to contain a non-phosphorothioated linkage such as phosphodiester, phosphorodithioate, methylphosphonate, diphosphorothioate î’-phosphoramidate, 3’,5’phosphordiamidate, 5’-thiophosphoramidate, 3’,5’-thiophosphordiainidate or diphosphodiester. In the context of descri bing modifications to a phosphorothioated oligonucleotide, or to an at least partially phosphorothioated sequence of a modified oligonucleotide, modification by inclusion of a phosphodiester linkage may be considered to resuit in a modified phosphorothioated oligonucleotide, or to a modified phosphorothioated sequence, respectively. Analogously, in the context of describing modifications to an oligonucleotide, or to an at least partially phosphodiesterified sequence of a modified oligonucleotide, the inclusion of a phosphorothioated linkage may be considered to resuit in a modified oligonucleotide or a modified phosphodiesterified sequence, respectively.
100511 As used herein in the context of dinucleotides or oligonucleotides, the term “stereochemically defined phosphorothioate linkage” has its usual meaning as understood by those skilled in the art and thus refers to a phosphorothioate linkage having a phosphorus stereocenter with a selected chirality (R or S configuration). A composition containing such a 5 di nucieotide or oligonucleotide can be enrichcd in molécules having the selected chirality. The stereopurity of such a composition can vary over a broad range, e.g. from about 51% to about 100% stereopure. In various embodiments, the stereopurity is greater than 55%, 65%, 75%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%; or in a range defined as having any two of the foregoing stereopurity values as endpoints.
[0052] The term “sequence independent” and viral activity has its usual meaning as understood by those skilled in the art and thus refers to an antîviral activity of an oligonucleotide (e.g., a modified oligonucleotide) that is independent of the sequence of the oligonucleotide. Methods for determining whether the antiviral activity of an oligonucleotide is sequence independent are known to those skilled in the art and include the tests for 15 determining if an oligonucleotide acts prédominantly by a non-scquence complementary mode of action as disclosed in Example 10 of U.S. Patent Nos. 7,358,068; 8,008,269; 8,008,270 and 8,067,385, which is hereby incorporated herein by reference and particularly for the purpose of describing such tests.
[0053] In the context of describing modified oligonucleotides having sequence 20 independent antiviral activity and comprising a sequence (e.g., an at least partially phosphorothioated sequence) of A and C units (e.g., alternating A and C units, or AC units), the terms “A” and “C” refer to the modified adenosine-containing (A) units and modified cystosine-containing (C) units set forth in Tables 1 and 2 below, respectively.
Abbreviation (A Unit) Structure (A Unît)
2'-0-M0E-A nh2 < 1 j % N N och3
LNA-A nh2 N pU LNA-A
2'-O-Propargyl-A nh2 <-νΔ N
2’-F-A nh2 < 1 j ° F
Abbreviation (A Unit) Structure (A Unit)
2'-araF-A c/ A. Tl \__J -Z M
3’-0Me-A nh2 <zZO Y h3co i
UNA-A O —z'^'z z Λ— z \\ i S—2 w
2'-NH2-A nh2 <Xn 1 N V^°\ O NHZ 2
GNA-A 5 nh3 X n-X>n χ, ? < Ί J
Abbreviation (A Unit) Structure (A Unit)
ENA-A nh2 N N JJ o —o
2’-0-Butynyl-A / T / HJ /1 ° o J-O
scp-BNA-A £ z—? z ζχ z--X x/ /y—o Jk
AmNA(NMe)-A nh2 J ---NCH3 o
Abbreviation (C Unit) Structure (C Unit)
2'-O-MOE-(5m)C νηξ il h A'AD OC H 3
LNA-(5m)C nh2 Va N^O °^ni LNA-5mC
2'-O-Propargyl-(5in)C nh2 Va N^o o A
2'-F-(5m)C nh2 Va A N^O ““V?1 f F
Abbreviation (C Unit) Structure (C Unît)
2’-araF-(5m)C nh2 h N
°^-O.
V ΧΙ- Ο
3'-OMe-(5m)C O—·, \.o h3co o ? ίη2
UNA-(5m)C t % r °~Ύ°7 / 0 jh2 J^O H
2'-NH2~(5m)C Γ % / N JH2 Ao H2
GNA-(5m)C A. w NHS N^O
Abbreviation (C Unit) Structure (C Unit)
ENA-(5m)C nh2 N N^O 0 '— O
2'-O-Butynyl-(5m)C νπ2 VI V. N^O θ
scp-BNA-(5m)C nh2 XX /2v°
AmNA-(NMe)-(5m)C nh2 Υχ Û----\ V —NCH3
Abbreviation (C Unit) Structure (C Unit)
4etl-(5m)C nh2 Va A Ν Ό o—vV WO-0
nmLNA-(5m)C nh2 Va A N^O °
Ribo-C nh2 V A N^O °-yj OH
Ribo-(5m)C nh2 Va A N^O V f OH
Modified Oligonucleotide Compounds
[0054] An embodiment provides a STOPS™ modified oligonucleotide compound having sequence independent antiviral activity against hepatitis B, comprising an at least partially phosphorothioated sequence of alternating A and C units, wherein the A uoîts are any one or more selected from those set forth in Table 1 and the C units are any one or more selected from those set forth in Table 2. Varions combinations of A and C units can be included in the at least partially phosphorothioated AC sequence, including the combinations described in 5 Table 3 below.
TABLE 3 - EXAMPLES OF AC UNITS
No. A Unit CUnit
1 2’-0Me-A 2'-OMe-(5m)C
2 2’-0Me-A 2'-O-MOE-(5m)C
3 2'-OMe-A LNA-(5m)C
4 2'-OMe-A ENA-(5m)C
5 2’-0Me-A scp-BNA-(5m)C
6 2’-OMe-A AmNA-(NMe)-(5m)C
7 2'-0Me-A 2'-O-Propargyl-(5m)C
8 2’-OMe-A 2'-O-ButynyL(5m)C
9 2'OMe-A 2'-F-(5m)C
10 2-0 Me-A 2'-araF-(5m)C
11 2'-OMe-A 3'-OMe-(5m)C
12 2'-0Me-A UNA-(5m)C
13 2'-0Me-A 2'-NH2-(5m)C
14 2'-0Me-A GNA-(5m)C
15 2'-0Me-A 4etL(5m)C
16 2'-0Me-A nmLNA-(5m)C
17 2'-O-MOE-A 2'-OMe-(5m)C
18 2-0-M0E-A 2'-O-MOE-(5m)C
19 2'-0-M0E-A LNA-(5m)C
20 2'-0-M0E-A ENA-(5m)C
No. A Unît C Unit
21 2-O-MOE-A scp-BNA-(5m)C
22 2-O-MOE-A AmNA-(NMe)-(5m)C
23 2-O-MOE-A 2'-O-Propargyl-(5m)C
24 2-O-MOE-A 2’-O-ButynyJ-(5m)C
25 2’-O-MOE-A 2’-F-(5m)C
26 2’-O-MOE-A 2'-araF-(5m)C
27 2-O-MOE-A 3'-OMe-(5m)C
28 2-O-MOE-A UNA-(5m)C
29 2-O-MOE-A 2'-NH2-(5m)C
30 2'- O-MOE-A GNA-(5m)C
31 2-O-MOE-A 4etl-(5m)C
32 2'-O-MOE-A nmLNA-(5m)C
33 LNA-A 2’-OMe-(5m)C
34 LNA-A 2’-O-MOE-(5m)C
35 LNA-A LNA-(5m)C
36 LNA-A ENA-(5m)C
37 LNA-A scp-BNA-(5m)C
38 LNA-A AmNA-(NMe)-(5m)C
39 LNA-A 2'-O-Propargyi-(5in)C
40 LNA-A 2'-O-Butyny[-(5m)C
41 LNA-A 2'-F-(5m)C
42 LNA-A 2’-araF-(5m)C
43 LNA-A 3'-OMe-(5m)C
44 LNA-A UNA-(5m)C
45 LNA-A 2'-NH2-(5m)C
46 LNA-A GNA-(5m)C
No. A Unit C Unit
47 LNA-A 4etl-(5m)C
48 LNA-A nmLNA-(5m)C
49 ENA-A 2’-OMe-(5m)C
50 ENA-A 2'- O-MOE-(5m)C
51 ENA-A LNA-(5m)C
52 ENA-A ENA-(5m)C
53 ENA-A scp-BNA-(5in)C
54 ENA-A AmNA-(NMe)-(5m)C
55 ENA-A 2'-O-Propargyi-(5m)C
56 ENA-A 2'-O-Butynyl-(5m)C
57 ENA-A 2'-F-(5m)C
58 ENA-A 2'-araF-(5m)C
59 ENA-A 3’-OMe-(5m)C
60 ENA-A UNA-(5in)C
61 ENA-A 2’-NH2-(5m)C
62 ENA-A GNA-(5in)C
63 ENA-A 4etl-(5m)C
64 ENA-A nmLNA-(5m)C
65 scp-BNA-A 2'-OMe-(5m)C
66 scp-BNA-A 2'- O-MOE-(5m)C
67 scp-BNA-A LNA-(5m)C
68 scp-BNA-A ENA-(5m)C
69 scp-BNA-A scp-BNA-(5m)C
70 scp-BNA-A AmNA-(NMe)-(5m)C
71 scp-BNA-A 2’-O-Propargyl-(5m)C
72 scp-BNA-A 2'-O-Butynyl-(5in)C
No. A Unit C Unit
73 scp-BNA-A 2’-F-(5m)C
74 scp-BNA-A 2'-araF-(5m)C
75 scp-BNA-A 3'-OMe-(5m)C
76 scp-BNA-A UNA-(5m)C
77 scp-BNA-A 2'-NH2-(5m)C
78 scp-BNA-A GNA-(5m)C
79 scp-BNA-A 4etl-(5m)C
80 scp-BNA-A nmLNA-(5m)C
81 AmNA(N-Me)-A 2'-OMc-(5m)C
82 AmNA(N-Me)-A 2'- 0-M0E-(5m)C
83 AmNA(N-Me)-A LNA-(5m)C
84 AmNA(N-Me)-A ENA-(5m)C
85 AmNA(N-Me)-A scp-BNA-(5m)C
86 AmNA(N-Me)-A AmNA-(NMe)-(5m)C
87 AmNA(N-Me)-A 2'-O-Propargy l-(5 m)C
88 AmNA(N-Me)-A 2’-O-Butynyl-(5m)C
89 AmNA(N-Me)-A 2'-F-(5m)C
90 AinNA(N-Me)-A 2’-ara-F-(5m)C
91 AmNA(N-Me)-A 3’-OMe-(5m)C
92 AmNA(N-Me)-A UNA-(5m)C
93 AmNA(N-Me)-A 2'-NH2-(5m)C
94 AmNA(N-Me)-A GNA-(5m)C
95 AmNA(N-Me)-A 4etl-(5m)C
96 AmNA(N-Me)-A nmLNA-(5m)C
97 2-0-Propargyl-A 2’-OMe-(5m)C
98 2'-O-Propargyl-A 2’- O-MOE-(5m)C
No. A Unit CUnit
99 2'-O-Propargyl-A LNA-(5m)C
100 2'-O-Propargyl-A ENA-(5m)C
101 2 '-O-Propargy 1-A scp-BNA-(5m)C
102 2'-O-Propargyl-A AmNA-(NMe)-(5m)C
103 2'-O-Propargyl-A 2 ’-O-Propargy 1 -(5 m)C
104 2-0-Propargyl-A 2'-O-Butyne-(5m)C
105 2-0-Propargyl-A 2'-F-(5m)C
106 2'-O-Propargyl-A 2'-araF-(5m)C
107 2-0-Propargyl-A 3’-OMe-(5m)C
108 2-0-Propargyl-A UNA-(5m)C
109 2'-O-Propargyl-A 2'-NH2-(5m)C
110 2'-O-Propargyl-A GNA-(5m)C
111 2'-O-Propargyl-A 4etl-(5m)C
112 2-0-Propargyl-A nmLNA-(5m)C
113 2'-0-Butynyl-A 2'-OMe-(5m)C
114 2-O-Butynyl-A 2'- 0-M0E-(5m)C
115 2'-O-Butynyl-A LNA-(5m)C
116 2'-O-Butyny^-A ENA-(5m)C
117 2'-O-Butynyl-A scp-BNA-(5m)C
118 2'-O-Butynyl-A AmNA-(NMe)-(5m)C
119 2-O-Butynyl-A 2'-O-Propargyl-(5m)C
120 2-O-Butynyl-A 2,-O-Bulynyl-(5ra)C
121 2-O-Butynyl-A 2’-F-(5m)C
122 2’-0-Butynyl-A 2,-araF-(5m)C
123 2-O-Butynyl-A 3’-OMe-(5m)C
124 2-O-Butynyl-A UNA-(5m)C
No. A Unit C Unit
125 2'-0-ButynyFA 2’-NH2-(5m)C
126 2’-0-Butynyl-A GNA-(5m)C
127 2’-0-Butynyl-A 4etl-(5m)C
128 2'-0-Butynyl-A nmLNA-(5m)C
129 2’-FA 2'-OMe-(5m)C
130 2'-FA 2’- O-MOE-(5m)C
131 2'-FA LNA-(5m)C
132 2’-F A ENA-(5m)C
133 2’-F A scp-BNA-(5m)C
134 2'-FA AmNA-(NMe)-(5m)C
135 2'-FA 2'-O-Propargyl“(5m)C
136 2'-FA 2’-O-Butynyl-(5m)C
137 2'-FA 2'-F-(5m)C
138 2'-FA 2'-ara-F-(5m)C
139 2'-FA 3'-OMe-(5m)C
140 2'-FA UNA-(5m)C
141 2'-FA 2'-NH2-(5m)C
142 2'-FA GNA-(5m)C
143 2'-FA 4etI-(5m)C
144 2'-FA nmLNA-(5m)C
145 2'-araF A 2'-OMe-(5m)C
146 2'-araF A 2'- O-MOE-(5m)C
147 2'-araF A LNA-(5m)C
148 2'-araF A ENA-(5m)C
149 2'-araF A scp-BNA-(5ra)C
150 2'-araF A AmNA-(NMe)-(5m)C
No. A Unit CUnit
151 2'-araF A 2’-O-Propargyl-(5m)C
152 2'-araF A 2'-O-Butynyl-(5m)C
153 2'-araF A 2’-F-(5m)C
154 2'-araF A 2'-araF-(5m)C
155 2'-araF A 3'-OMe-(5m)C
159 2'-araF A UNA-(5m)C
157 2'-araF A 2’-NH2-(5m)C
158 2'-araF A GNA-(5m)C
159 2'-araF A 4ell-(5m)C
160 2'-araF A mnLNA-(5m)C
161 3'-OMe-A 2'-OMe-(5m)C
162 3’-OMe-A 2'- O-MOE-(5m)C
163 3’-OMe-A LNA-(5m)C
164 3'-OMe-A ENA-(5m)C
165 3'-OMe-A scp-BNA-(5m)C
166 3'-OMe-A AmNA-(NMe)-(5m)C
167 3'OMe-A 2'-O-Propargyl-(5m)C
168 3'-OMe-A 2'-O-Butynyl-(5m)C
169 3-OMe-A 2’-F-(5m)C
170 3'-OMe-A 2'-ara-F-(5m)C
171 3-OMe-A 3'-OMe-(5m)C
172 3'-OMe-A UNA-(5m)C
173 3'-OMe-A 2'-NH2-(5m)C
174 3-OMe-A GNA-(5m)C
175 3'-OMe-A 4etl-(5m)C
176 3'-OMe-A nmLNA-(5m)C
No. A Unit C Unit
177 UNA-A 2'-OMe-(5m)C
178 UNA-A 2'- 0-M0E-(5m)C
179 UNA-A LNA-(5m)C
180 UNA-A ENA-(5m)C
181 UNA-A scp-BNA-(5m)C
182 UNA-A AmNA-(NMe)-(5m)C
183 UNA-A 2'-O-Propargyl-(5m)C
184 UNA-A 2'-O-Butynyi-(5m)C
185 UNA-A 2’-F-(5m)C
186 UNA-A 2’-araF-(5m)C
187 UNA-A 3'-OMe-(5m)C
188 UNA-A UNA-(5m)C
189 UNA-A 2'-NH2-(5m)C
190 UNA-A GNA-(5m)C
191 UNA-A 4etl-(5m)C
192 UNA-A mnLNA-(5m)C
193 2’-NH2-A 2’-OMe-(5m)C
194 2-NH2-A 2'-O-MOE-(5m)C
195 2'-NH2-A LNA-(5m)C
196 2’-NH2-A ENA-(5m)C
197 2’-NH2-A scp-BNA-(5m)C
198 2'-NH2-A AmNA-(NMe)-(5m)C
199 2-NH2-A 2-0-Propargy 1-(5 m)C
200 2’-NH2-A 2'-O-Butynyl-(5m)C
201 2'-NH2-A 2'-F-(5m)C
202 2'-NH2-A 2’-ara-F-(5m)C
No. A Unit C Unit
203 2-NH2-A 3'-OMe-(5m)C
204 2'-NH2-A UNA-(5m)C
205 2-NH2-A 2'-NH2-(5m)C
206 2-NH2-A GNA-(5m)C
207 2-NH2-A 4etl-(5m)C
208 2'-N Ha-A nmLNA-(5m)C
209 GNA-A 2'-OMe-(5m)C
210 GNA-A 2'-O-MOE-(5m)C
211 GNA-A LNA-(5m)C
212 GNA-A ENA-(5m)C
213 GNA-A scp-BNA-(5m)C
214 GNA-A AmNA-(NMe)-(5m)C
215 GNA-A 2'-O-PropargyL(5m)C
216 GNA-A 2'-O-ButynyI-(5m)C
217 GNA-A 2’-F-(5m)C
218 GNA-A 2'-ara-F-(5m)C
219 GNA-A 3'-OMe-(5m)C
220 GNA-A UNA-(5m)C
221 GNA-A 2'-NH2-(5m)C
222 GNA-A GNA-(5m)C
223 GNA-A 4etl-(5m)C
224 GNA-A nmLNA-(5m)C
225 nmLNA-A 2’-OMe-(5m)C
226 nmLNA-A 2'-O-MOE-(5m)C
227 rimLNA-A LNA-(5m)C
228 nmLNA-A ENA-(5m)C
No. A Unit C Unit
229 nmLNA-A scp-BNA-(5m)C
230 nmLNA-A AmNA-(NMe)-(5m)C
231 nmLNA-A 2'-O-Propargyl-(5m)C
232 nmLNA-A 2'-O-Butynyl-(5m)C
233 nmLNA-A 2-F-(5m)C
234 nmLNA-A 2’-ara-F-(5m)C
235 mnLNA-A 3'-OMe-(5m)C
236 nmLNA-A UNA-(5m)C
237 nmLNA -A 2'-NH2-(5m)C
238 nmLNA-A GNA-(5m)C
239 nmLNA-A 4etl-(5m)C
240 nmLNA-A nmLNA-(5m)C
241 4etI-A 2'-OMe-(5m)C
242 4etl-A 2’-O-MOE-(5m)C
243 4etl-A LNA~(5m)C
244 4etl-A ENA-(5m)C
245 4etl-A scp~BNA-(5m)C
246 4etl-A AmNA-(NMe)-(5m)C
247 4etl-A 2’-O-Propargyl-(5m)C
248 4etl-A 2'-O-Butynyl-(5m)C
249 4etl-A 2’-F-(5m)C
250 4etl-A 2'-ara-F-(5m)C
251 4etl-A 3'-OMe-(5m)C
252 4etl-A UNA-(5m)C
253 4etl-A 2'-NH2-(5m)C
254 4etLA GNA-(5m)C
No. A Unit C Unit
255 4etl-A 4etl-(5m)C
256 4etl-A nmLNA-(5m)C
[0055] The length of a modified oligonucleotide as described herein can vary over a broad range. In various embodiments, a modified oligonucleotide as described herein comprises an at least partially phosphorothioated sequence of alternating A and C units that has a sequence length of about 8 units, about 10 units, about 12 units, about 14 units, about 16 units, about 18 units, about 20 units, about 24 units, about 30 units, about 34 units, about 36 units, about 38 units, about 40 units, about 44 units, about 50 units, about 60 units, about 76 units, about 100 units, about 122 units, about 124 units, about 150 units, about 172 units, about 200 units, or a sequence length in a range between any two of the aforementîoned values. For example, in an embodiment, the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 8 units to 200 units. In another embodiment, the at least partially phosphorothioated sequence of alternating A and C units has a sequence length that is in any one or more (as applicable) of the following ranges: about 8 units to about 36 units; about 16 units to about 36 units; 20 units to 36 units; 16 units to 30 units; 18 units to 60 units; 20 units to 30 units; 30 units to 50 units; 34 units to 46 units, 36 units to 44 units; 44 units to 200 units; 44 units to 150 units; 44 units to 120 units; 50 units to 200 units; 50 units to 150 units; 50 units lo 120 units; 60 units to 200 units; 60 units to 150 units; and/or 60 units to 120 units.
[0056] As described elsewhere herein, a modified oligonucleotide can comprise a single at least partially phosphorothioated sequence of alternating A and C units in some embodiments, or in other embodiments the modified oligonucleotide can comprise a plurality of at least partially phosphorothioated sequences of alternating A and C units that are linked together. Thus, a modified oligonucleotide that conlains a single at least partially phosphorothioated sequence of alternating A and C units can hâve the same sequence length as that sequence. Examples of such sequence lengths are described elsewhere herein. Similarly, a modified oligonucleotide that contains a plurality of at least partially phosphorothioated sequences of alternating A and C units can hâve sequence length that is the resuit of linking those sequences as described elsewhere herein. Examples of sequence lengths for a modified oligonucleotide that contains a pluralîty of at least partially phosphorothioated sequences of alternating A and C units are expressed elsewhere herein in terms of the lengths of the individual sequences, and also taking into account the length of the linking group.
[0057] A modified oligonucleotide as described herein can comprises a pluralîty of at least partially phosphorothioated sequences of alternating A and C units. In an embodiment, when the sequence of alternating A and C units comprises a Ribo-A unit, the sequence further comprises at least one A unit that is not a Ribo-A unit. Similarly, in an embodiment, when the sequence of alternating A and C units comprises a Ribo-C unit, the sequence further comprises at least one C unit that is not a Ribo-C unît. In an embodiment, the modified oligonucleotide can contain one or more of various nucléotide units (known to those skilled in the art, e.g., thymine, cytosine, adenine, guanine and modified versions thereof) that are not A or C units, e.g., as an end group(s) and/or as a linking group(s) between two or more at least partially phosphorothioated sequences of alternating A and C units. For example, in an embodiment, the modified oligonucleotide comprises one or more cytosine units that link together at least two or more of the at least partially phosphorothioated sequences of alternating A and C units. In an embodiment, the two or more at least partially phosphorothioated sequences of alternating A and C units, which are linked together by a non-A/non-C linking group, are identical to one another. An example of such a modified oligonucleotide is (AC)3-cytosine(AC)e. Such a modified oligonucleotide that comprises a pluralîty of identical sequences that are joined together may be referred to herein as a concatemer. The two or more at least partially phosphorothioated sequences of alternating A and C units that are linked together can also be different from one another. An example of such a modified oligonucleotide is (AQs-cytosine(AC)jê.
[0058] The modified oligonucleotide can contain two or more different A groups and/or two or more different C groups. When an A or C group is replaced by a different A or C group, such a replacement is not ordinarily considered to interrupt the alternating sequence of A and C units. For example, in an embodiment, at least some of the A units are not 2’0methylated on the ribose ring and/or at least some of the C units are not 2’O-methylated on the ribose ring. However, in some embodiments the group linking the two at least partially phosphorothioated sequences of alternating A and C units is itself an A or C unit that interrupts the alternating sequence of A and C units. For example, an at least partially phosphorothioated
16-mer of alternating A and C units may be linked by an A unit to another such 16-mer to form (AC)s-A-(AC)y. Similarly, such a 16-mer may be linked by a C unit to another such 16-mer to form (AC)h-C-(AC)8. As noted above, when a plurality of at least partially phosphorothioated sequences of alternating A and C units that are identical to one another arc joined together by a linking group, the modified oligonucleotide may be referred to herein as a concatemer. As noted above, the two or more at least partially phosphorothioated sequences of alternating A and C units that are linked together can also be different from one another. Examples of such modified oligonucleotides include (AC)s-A-(AC)i6 and (AC)s-C-(AC)j6.
[0059] In an embodiment, the modified oligonucleotide comprises a 5’ endcap. In
O
OHO-^'
HO-P—CR1—CR2“|- HO various embodiments, the 5’ endcap is selected from OH,
Ο
HO- ''\ ,P\ 'M and V . in an embodiment, R1 and R2 are each individually selected from hydrogcn, deuterium, phosphate, thioCj-ftalkyl, and cyano. For example, in an embodiment, R1 and R2 are both hydrogen and the modified oligonucleotide comprises a vinyl phosphonate endcap. In other embodiments, R1 and R2 are not both hydrogen. In some embodiments, the 5 endcap is selected from
O
HO-p'
HO
O O HO^' D HOHO J. HO
O -N
SCH3 HO-^Qy^ „ HO \\ ,
O Η0-β'
HO
O
HO- D
HO ü (
HO./ ÿt HO
O HO-p'
HO VQ and
[0060] In other embodiments, the modified oligonucleotide comprises a 3’ and/or 5’ linking group. For example, with respect to modified oligonucleotide compounds comprising A and C units as described herein, such as the A and C units of Tables 1 and 2 respectively, at least one terminal υ can be a linking group. Various linking groups known to those skilled in the art can be used to Hnk the modified oligonucleotide to another moiety (such as one or more second oligonucleotides and/or targetîng ligands). In an embodiment, the linking group comprises a non-A/non-C linking group or an A or C unit that interrupts the alternating sequence of A and C units as discussed above, or the linking group comprises a Czôalkylene linkage (FIG. 1), a Cs-ôalkylene oxide linkage, such as a propylene oxide linkage (FIG. 2), or a tetraethylene glycol (TEG) linkage (FIGS. 3A-D).
[0061] In various embodiments, two, three, four or more of the modified oligonucleotides can be connected to each other in various ways. For example, the modified oligonucleotides can be connected end-to-end via 3’ and/or 5’ linking groups. and/or a linking group can be connected to a one 3’ or 5’ end of multiple modified oligonucleotides, e.g., as illustrated in FIGS. 1 and 2.
[0062] In various embodiments, the modified oligonucleotide further comprises a targetîng ligand that is attached to the modified oligonucleotide via the linking group. For example, in various embodiments the targetîng ligand is, or comprises, a Nacetylgalactosamine (GalNac) (e.g., triantennary-GalNAc), a tocopherol or cholestérol. FIGS. 3A and 3B illustrate embodiments of modified oligonucleotides having cholestérol attached via a 5’ TEG linking group and a 3’TEG linking group, respectively. FIGS. 3C and 3D illustrate embodiments of modified oligonucleotides having a tocopherol (Vitamin E) attached via a 5’ TEG linking group and a 3’TEG linking group, respectively. FIGS. 4A and 4B illustrate embodiments of modified oligonucleotides having GalNac attached via a linking group. In an embodiment, the GalNac is a triantennary GalNac.
[0063] In various embodiments, the at least partially phosphorothioaled sequence of alternating A and C units can include modification(s) to one or more phosphorothioaled linkages. The inclusion of such a modified linkage is not ordinarily considered to interrupt the alternating sequence of A and C units because those skilled in the art understand that such a sequence may be only partially phosphorothioaled and thus may comprise one or more modifications to a phosphorothioate linkage. In various embodiments, the modification to the phosphorothioate linkage is a modified linkage selected from phosphodiester, phosphorodithioate, methylphosphonate, diphosphorothioate and diphosphodiesler. For example, in an embodiment, the modified linkage is a phosphodiester linkage.
[0064] In various embodiments, the at least partially phosphorothioated sequence of akernating A and C units can hâve various degrees of phosphorothioation. For example, in an embodiment, the at least partially phosphorothioated sequence of akernating A and C units is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% phosphorothioated. In an embodiment, the at least partially phosphorothioated sequence of akernating A and C units is at least 85% phosphorothioated. In an embodiment, the at least partially phosphorothioated sequence of alternating A and C units is fully phosphorothioated.
[0065] In various embodiments, the at least partially phosphorothioated sequence of alternating A and C units can include stereochemical modification(s) to one or more phosphorothioated linkages. In an embodiment, the modified oligonucleotides described herein can comprise at least one stereochemicalîy defined phosphorothioate linkage. In various embodiments, the stereochemicalîy defined phosphorothioate linkage has an R configuration. In various embodiments, the stereochemicalîy defined phosphorothioate linkage has an S configuration.
[0066] Those skilled in the art will recognize that modified oligonucleotide compounds comprising A and C units as described herein, such as the A and C units of Tables 1 and 2, respectively, contain internai linkages between the A and C units as well as terminal groups at the 3’ and 5’ ends. Thus, with respect to the A and C units described herein, such as , O 'w'O the A and C umts of Tables 1 and 2, respectively, each represents an internai or a
Λ/V* Q λ11/ θ terminal . In various embodiments, each terminal is îndependently hydroxyl, an Ο,Ο-dihydrogen phosphorothioate, a dihydrogen phosphate, an endcap or a linking group. in various embodiments, each internai θ is a phosphorus-containing linkage to a neighboring A or C unit, the phosphorus-containing linkage being a phosphorothioate linkage or a modified linkage selected from phosphodiester, phosphorodithioate, methylphosphonate, diphosphorothioate 5’-phosphoramidaÎe, 3’,5’-phosphordiamîdate, 5’-thiophosphoramidate, 3’,5’-thiophosphordiamidate or diphosphodiester,
[0067] As noted above, the STOPS™ compounds described herein are antiviral oligonucleotides. In various embodiments, a modified oligonucleotide as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, has sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion
Assay, that is greater than that of a reference compound. For example, in an embodiment, the sequence independent antivîral activity against hepatitis B is at least 2-fold greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is in the range of from 2-fold greater than a reference compound to 5-fold 5 greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is at least 5-fold greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is in the range of from 5-fold greater than a reference compound to 10-fold greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is at
1Ü least 10-fold greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is in the range of from 10-fold greater than a reference compound to 25-fold greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is at least 25-fold greater than a reference compound. In this context, the aforementioned terms 2-fold, 5-fold, 10-fold and 25- fold refer to the increased potency of a modified oligonucleotide as described herein as compared to another compound in HBsAg Sécrétion Assay, as îndicated by an ECsü value that is one-half, one-fifth, one-tenth or one-twenty-fifth that of a reference compound, respectively. For example, a modified oligonucleotide having a potency that is two-fokl greater than a reference compound has an EC50 value in HBsAg Sécrétion Assay that is one-half that of the
EC50 value of a reference compound. Likewise, a modified oligonucleotide having a potency that is five-fold greater than a reference compound has an EC50 value in HBsAg Sécrétion Assay that is one-fifth that of a reference compound. Similarly, a modified oligonucleotide having a potency that is ten-fold greater than a reference compound has an EC50 value in HBsAg Sécrétion Assay that is one-tenth that of a reference compound. Likewise, a modified oligonucleotide having a potency that is twentyfive-fold greater than a reference compound has an EC50 value in HBsAg Sécrétion Assay that is one-twenty-fifth that of a reference compound. in some embodiments, the reference compound can be the phosphorothioated AC 40-mer oligonucleotide known as REP 2139 discussed above. In some embodiments, the reference compound can be the AC 40-mer oligonucleotide having the structure
5’mApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsinCpsmApsm
CpsmApsmCpsmApsmCpsmApsinCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsrnAps mCpsmApsmCpsmApsmCpsmApsmCpsmApsmC 3’ (2’-OMe-A, 2’-OMe-C).
[0068] In various embodiments, a modified oligonucleotide as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, has 5 sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, that is in an “A” activity range of less than 30 nanomolar (nM); in a “B” activity range of 30 nM to less than 100 nM; in a “C” activity' range of 100 nM to less than 300 nM; or in a “D” activity range of greater than 300 nM. In some embodiments, a modified oligonucleotide as described herein, comprising an at least partially phosphorothioated sequence of alternating 10 A and C units, has sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, that is less than 50 nM.
[0069] The modified oligonucleotides described herein can be prepared in the form of various complexes. Thus, an embodiment provides a chelate complex of a modified oligonucleotide as described herein. For example, in an embodiment such a chelate complex 15 comprises a calcium, magnésium or zinc chelate complex of the modified oligonucleotide. The modified oligonucleotides described herein can also be prepared in the form of various monovalent counterion complexes. For example, in an embodiment such a counterion complex comprises a lithium, sodium or potassium complex of the modified oligonucleotide.
[0070] An embodiment provides a modified oligonucleotide or complex thereof 20 having sequence independent antiviral activity against hepatitis B, comprising an at least partially phosphorothioated sequence of alternating A and C units as described herein, wherein;
[0071] the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;
[0072] the at least partially phosphorothioated sequence of alternating A and C 25 units has a sequence length in the range of 36 units to 44 units;
[0073] the A units comprise at least 12 2’-0Me-A units (e.g., at least 15 2’-0MeA units) and at least 1 Ribo-A unit (e.g., at least 2 Ribo-A units);
[0074] the C units comprise at least 15 LNA-5mC units; and
[0075] the modified oligonucleotide has an ECho value, as determined by HBsAg 30 Sécrétion Assay, that is less than 100 nM (e.g., less than 50 nM or less than 30 nM).
[0076] An embodiment provides a modified oligonucleotide or complex thereof having sequence independent antiviral activity against hepatitis B, comprising an at least partially phosphorothioated sequence of alternating A and C units as described herein, wherein;
[0077] the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;
[0078] the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units;
[0079] the A units comprise at least 15 2’OMe-A units;
[0080] the C units comprise at least 7 LNA-5mC units; and
[0081] the modified oligonucleotide has an EC50 value, as determined by HBsAg Sécrétion Assay, that is less than 100 nM (e.g., less than 50 nM or less than 30 nM).
[0082] An embodiment provides a modified oligonucleotide or complex thereof having sequence independent antiviral activity against hepatitis B, comprising an at least partially phosphorothioated sequence of alternating A and C units as described herein, wherein;
[0083] the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;
[0084] the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units;
[0085] the A units comprise at least 15 2’-OMe-A units;
[0086] the C units comprise at least 3 LNA-5mC units; and
[0087] the modified oligonucleotide has an EC50 value, as determined by HBsAg Sécrétion Assay, that is less than 100 nM (e.g., less than 50 nM or less than 30 nM).
[0088] An embodiment provides a modified oligonucleotide or complex thereof having sequence independent antiviral activity against hepatitis B, comprising an at least partially phosphorothioated sequence of alternating A and C units as described herein, wherein;
[0089] the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;
[0090] the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units;
[0091] the A units comprise at least 18 2’-0Me-A units;
[0092] the C units comprise at least 15 LNA-5mC units; and
[0093] the modified oligonucleotide has an EC50 value, as determined by HBsAg Sécrétion Assay, that is less than 100 nM (e.g., less than 50 nM or less than 30 nM). Synthesis
[0094] The modified oligonucleotides described herein can be prepared in various 5 ways. In an embodiment, the building block monomers described in Tables 4 and 5 are employed to make the modified oligonucleotides described herein by applying standard phosphoramidite chemistry. The building blocks described in Tables 4 and 5 and other building block phosphoramidite monomers can be prepared by known methods or obtained from commercial sources (Thermo Fischer Scientific US, Hongene Biotechnology USA Inc., 10 Chemgenes Corporation). Exemplary procedures for making modified oligonucleotides are set forth in the Examples below.
TABLE 4 - BUILDING BLOCKS FOR “A” UNITS
Abbreviation Structure
2’-OMe-A PHOSPHORAMIDITE NHBz 1 J DMTO—N 7 OCH3 „PX S NC
2-F-A PHOSPHORAMIDITE σ s —1 z 0 1 \ J Ύ 4L. z Λ—Z VL Œ '—z CO N
Abbre via don Structure
2’-O-MOE-A PHOSPHORAMIDITE NHBz <' I j DMTO—s, Q 7 N ? 0'%^· OCHj NC
LNA-A PHOSPHORAMIDITE NHBz O J DMTO--< N î ° S NC
ENA-A PHOSPHORAMIDITE NHBz N-^A., O J DMTO—\^0 ï N 0X--o -Pv S NC
2'-O-Butyne-A PHOSPHORAMIDITE NHBz N DMTO---J \^°\/ NC
Abbreviatîon Structure
2--NH2-A PHOSPHORAMIDITE NHBz DMTO n ? NHTFA ,P. S NC
2’-F-Ara-A PHOSPHORAMIDITE NHBz < J Jj DMTO—< 0 ï N X-F 0 t $ NC
2-0-Propargyl-A PHOSPHORAMIDITE NHBz < X jN DMTO---î /1 N O\ S NC
UNA-A PHOSPHORAMIDITE r= N DMTrO \ Y / \ ν^,ν q obz \ y-—n \__ ) CM
Abbreviation Structure
GNA-A PHOSPHORAMIDITE 0 0 NHBz D M TrO N \ N N=/
3'-0-Methyl-A PHOSPHORAMIDITE NHBZ c Y J N M DMTO---y i \ .O. / H3CO 0 S NC
scp-BNA-A PHOSPHORAMIDITE t r DMTrO---K ^· π A A· NHBz 'tS
AmNA-(N-Me)-A PHOSPHORAMIDITE h < h DMTrO---\ \^-O^ NC /P ----nc -rî / Λ ° NHBz 'x5 h3
Abbreviation Structure
ninLNA-A PHOSPHORAMIDITE NHBz ( II 'N DMTrO—\ n N—\ M XX-y l\r p--O'^^CN \-N
4etl-A PHOSPHORAMIDITE NHBz N^J^ V _JXN DMTO—\ n N—\ M d z P'-nX /~° \ NC^Z
Ribo-A PHOSPHORAMIDITE NHBz DMTrO-VoJ N °x OBz \ P-0 / N CN
Abbreviation Structure
LNA-(5m)C PHOSPHORAMIDITE NHBz Vx DMTO---< | p—° ,p. S 2^^ NC
ENA-(5m)C PHOSPHORAMIDITE NHBz Vx DMTO---. I —O / x S NC
2'-O-Butyne-(5m)C PHOSPHORAMIDITE NHBz ύΗ DMTO---< ; \ / NC
2'-NH2-(5m)C PHOSPHORAMIDITE NHBZ N^O DMTO— θ NHTFA -Pv S NC
Abbreviation Structure
2’-F-Ara-(5m)C PHOSPHORAMIDITE NHBZ N^O DMTO—y Q 1 '>L-f 0 1 P S /Y^ NC
2'-O-Propargyl-(5m)C PHOSPHORAMIDITE NHBz Υχ 'O DMTO---v Λ i °\ °X^ ,P. S NC
UNA-(5m)C PHOSPHORAMIDITE NHBz DMTrO^Y Y 0 OBz \ Yo y—n \ CN
GNA-(5m)C PHOSPHORAMIDITE i NC^ ^NHBz O 0 X |T D MTrO N N T 0
Abbreviation
3'-O-Methyl-(5m)C
PHOSPHORAMIDITE scp-BNA-(5m)C
PHOSPHORAMIDITE
AmNA-(NMe)-(5m)C
PHOSPHORAMIDITE
4eti-(5m)C
PHOSPHORAMIDITE
Structure
Abbreviation Structure
mnLNA-(5m)C PHOSPHORAMIDITE \ NHBz H DMTrO-* o NX y y ° X b d \ \—N
Ribo-C PHOSPHORAMIDITE NHBz ù N^O DMTO---< 1 ’j’ OBz P S NC
Ribo-(5m)C PHOSPHORAMIDITE NHBz N^O DMTO--Q θ OBz _P. NC
(0095] In varions einbodiments, the STOPS™ modified oligonucleotides described herein can also be prepared using dinucleotîdes that comprise or consist of any two of the building block monomers described in Tables 4 and 5. Exemplary procedures for making 5 dinucleotîdes and the corresponding modified oligonucleotides are set forth in the Examples below.
[0096] An embodiment provides a dinucleotide comprising, or consisting of, an A unit and a C unit connected by a stereochemically defined phosphorothioate linkage, wherein
the A unit is selected from any of the building block monomers described in Table 4 and the C unit is selected from any of the building block monomers described in Table 5, and wherein wQ each is independcntly hydroxyl, an Ο,Ο-dihydrogen phosphorothioate, an 0,0dihydrogen phosphate, a phosphoramidite, a dimethoxytrityl ether, or the stereochemically 'w'Q defined phosphorothioate linkage. In an embodiment, the is a phosphoramidite of the following formula (A):
R1 । 2 N—R2
-1-0—R.
O—R3 (A)
[0097] In varions embodiments R1 and R2 of formula (A) are each individu ally a
Ci-r,alkyl, and R3 is a Ci.6alkyl or a cyanoCi-t,alkyL For example, in an embodiment the phosphoramidite of the formula (A) is a phosphoramidite of the following formula (Al):
N/
HpO—Ρ(ζ\
O-\CN (Al)
-w'Q
Γ0098] In another embodiment, the is a stereochemically defined phosphorothioate linkage that is a phosphorothioate. For example, in an embodiment, the stereochemically defined phosphorothioate linkage is a phosphorothioate of the following Formula (Bl) or (B2):
(Bl) (B2)
[0099] In varions embodiments R4 of formulae (Bl) and (B2) is a Cj.6 alkyl or a cyanoCj-6 alkyl. For exampie, in an embodiment, the phosphorothioates of the formulae (Bl) and (B2) are phosphorothioates of the following Formulae (B3) or (B4), respectively:
(B3) (B4)
[0100] Varions embodiments provide methods of making a modified oligonucleotide as described herein, comprising coupling one or more dînucleotides as described herein. Exemplary methods of carrying ont such coupling are illustrated in the Examples below.
Pharmaceutical Compositions
[0101] Some embodiments described herein relate to a pharmaceutical composition, that can include an effective amount of a compound described herein (e.g., a STOPS™ modified oligonucleotide compound or complex thereof as described herein) and a pharmacentically acceptable carrier, excipient or combination thereof. A pharmaceutical composition described herein is suitable for human and/or veterinary applications.
[0102] As used herein, a “carrier” refers to a compound that facilitâtes the incorporation of a compound into cells or tissues. For example, without limitation, dîmethyl sulfoxide (DMSO) is a commonly utilized carrier that facilitâtes the uptake of many organic compounds into cells or tissues of a subject.
[0103] As used herein, a “diluent” refers to an ingrédient in a pharmaceutical composition that lacks pharmacological activity but may be pharmacentically necessary or désirable. For example, a diluent may be used to increase the bulk of a potent drug whose mass is too smail for manufacture and/or administration. It may also be a liquid for the dissolution of a drug to be administered by injection, ingestion or inhalation. A common form of diluent in the art is a buffered aqueous solution such as, without limitation, phosphate buffered saline that mimics the composition of human blood.
[0104] As used herein, an “excipient” refers to an inert substance that is added to a pharmaceutical composition to provide, without limitation, bulk, consistency, stability, binding 5 abilîty, lubrication, disintegrating ability etc., to the composition. A “diluent” is a type of excipient.
[0105] Proper formulation is dépendent upon the route of administration chosen. Techniques for formulation and administration of the compounds described herein are known to those skilled in the art. Multiple techniques of administering a compound exist in the art 10 including, but not limited to, oral, rectal, topical, aérosol, injection and parentéral dclivery, including intramuscular, subcutaneous, intravenous, intramedullary injections, intrathecal, direct intraventricular, intraperitoneal, intranasal and intraocular injections. Pharmaceutical compositions wîll generally be tailored to the spécifie intended route of administration.
10106] One may also administer the compound in a local rather than systemic 15 manner, for example, via injection of the compound directly into the infected area, optîonally in a depot or sustained release formulation. Furthermore, one may administer the compound in a targeted drug delivery System, for example, in a liposome coated with a tissue-spécifie antibody. The liposomes may be targeted to and taken up selectively by the organ.
[0107] The pharmaceutical compositions disclosed herein may be manufactured in 20 a manner that is itself known, e.g., by means of convention al mixing, dissol ving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or tableting processes. As described herein, compounds used in a pharmaceutical composition may be provided as salis with pharmaceutically compatible cou nierions.
Methods of Use
[0108] Some embodiments described herein relate to a method of treatîng a HBV and/or HDV infection that can include administering to a subject identified as suffering from the HBV and/or HDV infection an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. Other embodiments 30 described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a médicament for treatîng a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein or a pharmaceutical composition diat includes a modified oligonucleotide as described herein for treating a HBV and/or HDV infection.
[0109] Varions routes may be used to adminîster a modified oligonucleotide or 5 complex thereof to a subject in need thereof as îndicated elsewhere herein. In an embodiment, the modified oligonucleotide or complex thereof is administered to the subject by a parentéral route. For example, in an embodiment, the modified oligonucleotide or complex thereof is administered to the subject intravenously. In another embodiment, the modified oligonucleotide or complex thereof is administered to the subject subcutaneously.
Surprisingly, it has now been found that embodiments of a modified oligonucleotide or complex thereof as described herein can be subcutaneously administered to a primate in an amount that is both safe and effective for treatment. Previously, subcutaneous administration of a modified oligonucleotide or complex thereof (such as REP 2139, REP 2055 or those described in U.S. Patent Nos. 7,358,068; 8,008,269; 8,008,270 and 8,067,385) to a primate 15 was consi de red unlikely to be safe and effective because of the relatively high dosages believed required to achieve efficacy and the concomitant increase in the potential risk of safety concerns such as undesirable injection site reactions. Thus, for example, prior clinical studies involving die administration of REP 2139 to humans are believed to hâve utilized only intravenous routes. At the dosage levels that were believed to be necessary for efficacy, it is 20 believed that safety concerns such as undesirable injection site reactions would hâve precluded subcutaneous administration.
[0110] Unexpectedly, as illustrated in FIG. 12 and Example B5 below, it has now been found that liver exposure following subcutaneous administration to non-lwman primates is much higher than expected based on liver exposure levels resulting from otherwîse 25 comparable intravenous dosing. This finding means that embodiments of modified oligonucleotides or complexes thereof as described herein, and particularly embodiments of highly potent STOPS™ compounds or complexes as described herein, can be safely and effectively administered to primates via subcutaneous administration at dosages lower than previously consîdered likely to be effective. These lower dosages reduce the risk profile (e.g., 30 reduce risk of injection site reactions) and thus provide a clinîcally acceptable safety profile for human use.
[OUI] Some embodiments disclosed herein relate to a method of treating a HBV and/or HDV infection that can include contacting a cell infected with the HBV and/or HDV with an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. In an embodiment, such a method of treating a HBV and/or HDV infection comprises safe and effective subeutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage tower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof as described herein. For example, in an embodiment, the STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of allernating A and C units, having sequence independent antiviral activity against hepatitis B, as déterminée! by HBsAg Sécrétion Assay, that is in an “A” activity range of less than 30 nM.
[0112] Other embodiments described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a médicament for treating a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein for treating a HBV and/or HDV infection. In an embodiment, such uses comprise safe and effective subeutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof as described herein. For example, in an embodiment, the STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, that is in an “A” activity range of less than 30 nM.
[0113] Some embodiments dîsclosed herein relate to a method of inhibiting réplication of HBV and/or HDV that can include contacting a cell infected with the HBV and/or HDV with an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. In an embodiment, such a method of inhibiting réplication of HBV and/or HDV comprises safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof as described herein. For example, in an embodiment, the STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, that is in an “A” activity range of less than 30 nM.
[0114] Other embodiments described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a médicament for inhibiting réplication of HBV and/or HDV. Stili other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein, for inhibiting réplication of HBV and/or HDV. In an embodiment, such uses for inhibiting réplication of HBV and/or HDV comprise safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof as described herein. For example, in an embodiment, the STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, that is in an “A” activity range of less than 30 nM.
[0115] In some embodiments, the HBV infection can be an acute HBV infection.
In some embodiments, the HBV infection can be a chronic HBV infection.
[0116] Some embodiments disclosed herein relate to a method of treating liver cirrhosîs that is developed because of a HBV and/or HDV infection that can include administerîng to a subject suffering from liver cirrhosîs and/or contactîng a cell infected with the HBV and/or HDV in a subject suffering from liver cirrhosîs with an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. In an embodiment, such a method of treating liver cirrhosîs that is developed because of a HBV and/or HDV infection comprises safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof as described herein. For example, in an embodiment, the STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising au at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, that is in an “A” activity range of less than 30 nM.
[0117] Other embodiments described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a médicament for treating liver cirrhosîs that is developed because of a HBV and/or HDV infection, with an effective amount of the modified oligonucleotide(s). Stîll other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein for treating liver cirrhosîs that is developed because of a HBV and/or HDV infection. In an embodiment, such uses for treating liver cirrhosis comprise safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof lo a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an 5 embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof as described herein. For example, in an embodiment, the STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated 10 sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, that is in an “A” activity range of less than 30 nM.
[0Π8] Some embodiments disclosed herein relate to a method of treating liver cancer (such as hepatocellular carcînoma) that is developed because of a HBV and/or HDV 15 infection that can include administering to a subject suffering from the liver cancer and/or contacting a cell infected with the HBV and/or HDV in a subject suffering from the liver cancer with an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. In an embodiment, such a method of 20 treating liver cancer (such as hepatocellular carcînoma) that is developed because of a HBV and/or HDV infection comprises safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex 25 thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof as described herein. For example, in an embodiment, the STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, 30 having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, that îs in an “A” activity range of less than 30 nM.
[0119] Other embodiments described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a médicament for treating liver cancer (such as hepatocellular carcinoma) that is developed because of a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein for treating liver cancer (such as hepatocellular carcinoma) that is developed because of a HBV and/or HDV infection. In an embodiment, such uses for treating liver cancer (such as hepatocellular carcinoma) comprise safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. in another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof as described herein. For example, in an embodiment, the STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of altemating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, that is in an “A” activity range of less than 30 nM.
[0120] Some embodiments disclosed herein relate to a method of treating liver failure that is developed because of a HBV and/or HDV infection that can include administering to a subject suffering from liver failure and/or contacting a cell infected with the HBV and/or HDV in a subject suffering from liver failure with an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. In an embodiment, such a method of treating liver failure that is developed because of a HBV and/or HDV infection comprises safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a liighly potent STOPS™ compound or complex thereof as described herein. For example, in an embodiment, the STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent anliviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, that is in an “A” activity range of less than 30 nM.
[0121] Other embodiments described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a médicament for treating liver failure that is developed because of a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amounl of a modified oligonucleotide or complex thereof as described herein for treating liver failure that is developed because of a HBV and/or HDV infection. In an embodiment, such uses for treating liver failure comprise safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof as described herein. For exaniple, in an embodiment, the STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Sécrétion Assay, that is in an “A” activity range of less than 30 nM.
[0122] Various indicators for determining the effectiveness of a method for treating an HBV and/or HDV infection are also known to those skilled in the art. Examples of suitable indicators include, but are not limited to, a réduction in viral load indicated by réduction in HBV DNA (or load), HBV surface antigen (HBsAg) and HBV e-antigen (HBeAg), a réduction in plasma viral load, a réduction in viral réplication, a réduction in time to séroconversion (virus undetectable in patient sérum), an increase in the rate of sustained viral response to therapy, an improvement in hepatic fonction, and/or a réduction of morbidity or mortality in clinical outcomes.
[0123] In some embodiments, an effective amount of a modified oligonucleotide or complex thereof as described herein is an amount thaï is effective to achieve a sustained 5 virologie response, for example, a sustained viral response 12 month after completion of treatment.
[0124] Subjects who are clinically diagnosed with an HBV and/or HDV infection include “naïve” subjects (e.g., subjects not previously treated for HBV and/or HDV) and subjects who hâve faîled prior treatment for HBV and/or HDV (“treatment failure” subjects).
Treatment failure subjects include “non-responders” (subjects who did not achieve sufficient réduction in ALT levels, for example, subject who failed to achieve more than 1 loglO decrease from base-line within 6 months of starting an anti-HBV and/or anlï-HDV therapy) and “relapsers” (subjects who were previously treated for HBV and/or HDV whose ALT levels hâve increased, for ex ample, ALT > twice the upper normal limit and détectable sérum HBV 15 DNA by hybridization assays). Further examples of subjects include subjects with a HBV and/or HDV infection who are asymptomatic.
[0125] In some embodiments, a modified oligonucleotide or complex thereof as described herein can be provided to a treatment failure subject suffering from HBV and/or HDV. In some embodiments, a modified oligonucleotide or complex thereof as described 20 herein can be provided to a non-responder subject suffering from HBV and/or HDV. In some embodiments, a modified oligonucleotide or complex thereof as described herein can be provided to a relapser subject suffering from HBV and/or HDV. In some embodiments, the subject can hâve HBeAg positive chronic hepatitis B. In some embodiments, the subject can hâve HBeAg négative chronic hepatitis B. In some embodiments, the subject can hâve liver 25 cirrhosis. In some embodiments, the subject can be asymptomatic, for ex ample, the subject can be infected with HBV and/or HDV but does not exhibit any symptoms of the viral infection. In some embodiments, the subject can be immunocompromised. In some embodiments, the subject can be undergoing chemotherapy.
[0126] Examples of agents that hâve been used to treat HBV and/or HDV include 30 interferons (such as IFN-α and pegylated interferons that include PEG-IFN-a-2a), and nucleosides/micleotides (such as lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil). However, some of the drawbacks associated with interferon treatment are the adverse side effects, the need for subcutaneous administration and high cost. A drawback with nucleoside/nucleotide treatment can be the development of résistance.
[0127] Résistance can be a cause for treatment failure. The term “résistance” as used herein refers to a viral strain displaying a delayed, lessened and/or null response to an anti-viral agent. In some embodiments, a modified oligonucleotide or complex thereof as described herein can be provided to a subject infected with an HBV and/or HDV strain that is résistant to one or more anti-HBV and/or anti-HDV agents. Examples of anti-viral agents 10 wherein résistance can develop include lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil. In some embodiments, development of résistant HBV and/or HDV strains is delayed when a subject is treated with a modified oligonucleotide as described herein compared to the development of HBV and/or HDV strains résistant to other HBV and/or HDV anti-viral agents, such as those described.
Combination Thérapies
[0128] ïn some embodiments, a modified oligonucleotide or complex thereof as described herein can be used in combination with one or more additional agent(s) for treating and/or inhibiting réplication HBV and/or HDV. Additional agents include, but are not limited to, an interferon, nucleoside/nucleotide analogs, a capsid assembly modulator, a sequence 20 spécifie oligonucleotide (such as anti-sense oligonucleotide and/or siRNA), an entry inhibitor and/or a small molécule immunomodulator. For example, in an embodiment, a modified oligonucleotide or complex thereof as described herein can be used as a first treatment în combination with one or more second treatment(s) for HBV, wherein the second treatment comprises a second oligonucleotide having sequence independent antiviral activity against 25 hepatitis B, an siRNA oligonucleotide (or nucléotides), an anti-sense oligonucleotide, a nucleoside, an interferon, an immunomodulator, a capsid assembly modulator, or a combination thereof. Ex amples of additional agents include recombinant interferon alpha 2b, IFN-α, PEG-IFN-a-2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, tenofovir disoproxil, JNJ-3989 (ARO-HBV), RG6004, GSK3228836, 30 AB-729, VIR-2218, DCR-HBVS, JNJ-6379, GLS4, ABI-HO731, JNJ-440, NZ-4, RG7907,
AB-423, AB-506 and ABI-H2158. In an embodiment, the additional agent is a capsid assembly modulator (CAM). In an embodiment, the additional agent is an anti-sense oligonucleotide (ASO).
[0129] In some embodiments, a modified oligonucleotide or complex thereof as described herein can be administered with one or more additional agent(s) together in a single 5 pharmaceutical composition. In some embodiments, a modified oligonucleotide or complex thereof as described herein can be administered with one or more additional agent(s) as two or more separate pharmaceutical compositions. Further, the order of administration of a modified oligonucleotide or complex thereof as described herein with one or more additional agent(s) can vary.
EXAMPLES
[0130] Additional embodiments are disclosed in further detail in the following examples, which are not in any way intended to lirait the scope of the daims.
EXAMPLES 1-116
[0131] A sériés of modified oligonucleotides containing phosphorothioated 15 sequences of alternating A and C units were synthesized on an ABI 394 synthesizer using standard phosphoramidite chemistry. The solid support was controlled pore glass (CPG, 1000A, Glen Research, Sterling VA) and the building block monomers are described in Tables 4 and 5. The reagent (dimethylamino-methylîdene) amino)-3H-l,2,4-dithiazaoline-3-thione (DDTT) was used as the sulfur-transfer agent for the synthesis of oligoribonucleotide 20 phospliorothioates (PS linkages). An extended coupling of 0.1 M solution of phosphoramidite in CH3CN in the presence of 5-(ethylthio)-lH-tetrazole activator to a solid boimd oligonucleotide followed by standard capping, oxidation and deprotectîon afforded modified oligonucleotides. The stepwise coupling efficiency of ail modified phosphoramidites was more than 95%. Several modified oligonucleotides containing sequences of alternating A and C 25 units but having phosphodiester (PO) linkages instead of phosphorothioate (PS) linkages were also made.
Deprotectîon
[0132] After completion of synthesis the controlled pore glass (CPG) was transferred to a screw cap vial or screw caps RNase free microfuge tube. The oligonucleotide 30 was cieaved from the support with simultaneous deprotectîon of base and phosphate groups with 1.0 mL of a mixture of éthanolic ammonia (ammonia: éthanol (3:1)) for 5-15 hr at 55°C.
The vial was cooled briefly on ice and then the ethanolîc ammonia mixture was transferred to a new microfuge tube. The CPG was washed with 2 x 0.1 mL portions of deionized water, put in dry ice for 10 min then dried in speed vac.
Ouantitation of Crude Oligomer or Raw Analysis
[0133] Samples were dissolved in deionized water (1.0 mL) and quantitated as follows: Blanking was first performed with water alone (1 mL). 20 ul of sample and 980 uL of water were mixed well in a microfuge tube, transferred to cuvette and absorbance reading obtained at 260 nm. The crude material is dried down and stored at -20°C.
HPLC Purification of Oligomer
[0134] The crude oligomers were analyzed and purified by HPLC (Dionex PA 100). The buffer System is A = Water B = 0.25 M Tris-HCl pH 8, C: 0.375 M Sodium per chlorate, flow 5.0 mL/min, wavelength 260 nm. First inject a small amount of material (-5 OD) and analyze by LC-MS. Once the identity of this material is confirmed the crude oligomer can then be purified using a larger amount of material, e.g., 60 OD’s per run, flow rate of 5mL/mjn. Fractions containing the full-length oligonucleotides are then pooled together, evaporated and finally desalted as described below.
Desalting of Purified Oligomer
[0135] The purified dry oligomer was then desalted using Sephadex G-25M (Amersham Biosciences). The cartridge was conditioned with 10 mL of water. The purified oligomer dissolved thoroughly in 2.5 mL RNAse free water was applied to the cartridge with very slow dropwise elution. The sait free oligomer was eluted with 3.5 ml water directly into a screw cap vial.
HPLC Analysis and Electrospray LC/Ms
[0136] Approximately 0.2 OD oligomer is first dried down, redissolved in water (5 Oui) and then pipetted in spécial vials for HPLC and LC-MS analysis.
[0137] Table 6 summarizes the sequence length, alternating A and C units and whether the backbone is phosphorothioate (PS) or phosphodiester (PO) for the resulting exemplîfied modified oligonucleotides.
TABLE 6
No. Length A modification C modification Backbone
i (AC)20 2’-0Me 2’-OMe PS
2 (AC) 15 2’-OMe 2’-OMe PS
No. Length A modification C modification Backbone
3 (AC)25 2’-OMe 2’-OMe PS
4 (AC)30 2’-OMe 2’-OMe PS
5 (AC)20 2'-O-MOE 2'-O-MOE PS
6 (AC)20 LNA LNA PS
7 (AC)20 2'-F 2'-F PS
8 (AC)20 2'-O-Propargyl 2'-O-Propargyl PS
9 (AC)20 2'-O-butyne 2'-O-butyne PS
10 (AC)20 2’-F-Ara 2'-F-Ara PS
H (AC)20 UNA UNA PS
12 (AC)20 ENA ENA PS
13 (AC)20 2’-OMe 2’-O-MOE PS
14 (AC)20 2’-OMe LNA PS
15 (AC)20 2’-OMe 2'-F PS
16 (AC)20 2’-OMe 2'-O-Propargyl PS
17 (AC)20 2’-OMe 2'-0-butyne PS
18 (AC)2Û 2’-OMe 2'-F-Ara PS
19 (AC)20 2’-OMe UNA PS
20 (AC)20 2’-OMe ENA PS
21 (AC)20 2’-OMe 2'-NHt PS
22 (AC)20 2'-O-MOE 2’-OMe PS
23 (AC)20 2'-O-MOE LNA PS
24 (AC)20 2'-O-MOE 2'-F PS
25 (AC)20 2-O-MOE 2’-O-Propargyl PS
26 (AC)20 2-O-MOE 2’-O-butyne PS
27 (AC)20 2-O-MOE 2’-F-Ara PS
28 (AC)20 2’-O-MOE UNA PS
29 (AC)20 2'-O-MOE ENA PS
30 (AC)20 2'-O-MOE 2'-NH2 PS
31 (AC)20 LNA 2’-OMe PS
32 (AC)20 LNA 2'-O-MOE PS
33 (AC)20 LNA 2’-F PS
34 (AC)20 LNA 2’-O-Propargyl PS
35 (AC)20 LNA 2’-O-butyne PS
36 (AC)20 LNA 2’-F-Ara PS
37 (AC)20 LNA UNA PS
38 (AC)20 LNA ENA PS
39 (AC)20 LNA 2'-NH: PS
40 (AC)20 2’-F LNA PS
No. Length A modification C modification Backbone
41 (AC)20 2'-F 2’-OMe PS
42 (AC)20 2-F 2-O-MOE PS
43 (AC)20 2'-F 2’-O-Propargyl PS
44 (AC)20 2'-F 2’-O-butyne PS
45 (AC)20 2*-F 2’-F-Ara PS
46 (AC)20 2’-F UNA PS
47 (AC)20 2'-F ENA PS
48 (AC)20 2'-F 2’-NH2 PS
49 (AC)20 2’-O-Propargyl 2’-OMe PS
50 (AC)20 2’-O-Propargyl 2'-O-MOE PS
51 (AC)20 2’-O-Propargyl LNA PS
52 (AC)20 2’-O-Propargyl 2'-F PS
53 (AC)20 2’-O-Propargyl 2’-0-butyne PS
54 (AC)20 2’-O-Propargyl 2’-F-Ara PS
55 (AC)20 2’-O-Propargyl UNA PS
56 (AC)20 2’-O-Propargyl ENA PS
57 (AC)20 2’-O-Propargyl 2'-NH2 PS
58 (AC)20 2’-O-butyne 2’-OMe PS
59 (AC)20 2’-0-butyne 2’-O-MOE PS
60 (AC)20 2’-O-butyne LNA PS
61 (AC)20 2’-O-butyne 2'-F PS
62 (AC)20 2’-0-butyne 2’-O-Propargyl PS
63 (AC)20 2’-0-butyne 2’-F-Ara PS
64 (AC)20 2’-0-butyne UNA PS
65 (AC)20 2’-O-butyne ENA PS
66 (AC)20 2’-O-butyne 2-NH2 PS
67 (AC)20 2’-F-Ara 2’-OMe PS
68 (AC)20 2’-F-Ara 2'-O-MOE PS
69 (AC)20 2’-F-Ara LNA PS
70 (AC)20 2’-F-Ara 2'-F PS
71 (AC)20 2’-F-Ara 2’-O-Propargyl PS
72 (AC)20 2’-F-Ara 2’-0-butyne PS
73 (AC)20 2’-F-Ara UNA PS
74 (AC)20 2’-F-Ara ENA PS
75 (AC)20 2’-F-Ara 2-NI-I2 PS
76 (AC)20 UNA 2’-OMc PS
77 (AC)20 UN A 2’-O-MOE PS
78 (AC)20 UN A LNA PS
No. Length A modification C modification Backbone
79 (AC)20 UNA 2'-F PS
80 (AC)20 UNA 2’-O-Propaigyl PS
81 (AC)20 UNA 2’-0-butyne PS
82 (AC)20 UNA 2’-F-Ara PS
83 (AC)20 UNA ENA PS
84 (AC)20 UNA 2'-NH2 PS
85 (AC)20 ENA 2’-OMe PS
86 (AC)20 ENA 2-O-MOE PS
87 (AC)20 ENA LNA PS
88 (AC)20 ENA 2’-F PS
89 (AC)20 ENA 2’-O-Propargy! PS
90 (AC)20 ENA 2’-0-butyne PS
91 (AC)20 ENA 2’-F-Ara PS
92 (AC)20 ENA UNA PS
93 (AC)20 ENA 2-NH2 PS
94 (AC)20 LNA 2’-O-MOE PS
95 (AC)20 2’-F LNA PS
96 (AC)25 2’-OMe 2’-OMe PO
97 (AC)25 2’-OMe 2’-OMe PS
98 (AC)20 2’-F 2’-OMe PS
99 (AC)20 LNA 2’-O-Me PS
100 (AC)20 2’-OMe 2'-F PS
101 (AC)20 2’-OMe 2’-OMe PO
102 (AC)20 2'-F 2'-O-MOE PS
103 (AC)30 2'-OMe 2'-OMe PS
104 (AC)! 5 2'-OMe 2'-OMe PS
105 (AC)20 2'-OMe LNA PS
106 (AC)20 LNA LNA PS
107 (AC)20 2’-OMe 2’-O’MOE PS
108 (AC)20 2’-O-MOE 2’-OMe PS
109 (AC)20 2’-OMe 2'-OMe PS
110 (AC)30 2’-OMe 2’-O-butyne PO
111 (AC)20 2'-F 2'-F PS
112 (AC)20 2’-OMe 2’-OMe PS
113 (AC) 15 2’-OMe 2’-OMe PO
114 (AC)20 2’-O-MOE 2’-O-MOE PS
115 (AC)20 2'-O-MOE 2’-F PS
116 (AC)20 LNA 2'-F PS
EXAMPLES 117-130
[0138] The effect of 5’ modification was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with the methods described above in Examples 1-116. End capped oligonucleotides were made by using a 5’-vinyi phosphonate building block to incorporate 5’-vinyl phosphonate endcaps:
5’-vinyl phosphonate building block (5’-VP)
Modified oligo with 5’-vinyl phosphonate endcap
[0139] With reference to FIG. 7, the 5’-vinyl phosphonate building block (5’-VP) was prepared as follows:
[0140] Préparation of compound 7-2: To a solution of 7-1 (15.0 g, 53.3 mmol) in dry pyridine (150 mL) was added TBSC1 (20.0 g, 133.3 mmol) and Imidazole (10.8 g, 159.9 mmol). The mixture was stirred at r.t. for 15h. TLC showed 7-1 was consumed completel y. The reaction mixture was concentrated in vacuo to give residue. The residue was quenched with DCM (500 mL). The DCM layer was washed with H2O (1 L*2) 2 times and brine. The DCM layer concentrated in vacuo to give crude 7-2 (27.2 g, 53.3 mmol) as a yellow oil. The crude 7-2 was used in next step directly. ESI-LCMS m/z 510.5 [M+H]+.
[0141] Préparation of compound 7-3: To a solution of 7-2 (26.2 g, 51.3 mmol) in pyridine (183 mL) was added dropwise the benzoyl chloride (15.8 g, 113.0 mmol) at 5°C. The réaction mixture was stirred at r.t. for 2 hours. TLC showed the 7-2 was consumed completely. The reaction mixture was quenched with H2O (4 mL). Then NH3.T-I2O (20 mL) was added to the reaction mixture and stirred at r.t for 30 min. Then the Pyridine was removed from the mixture by concentration under reduced pressure. The residue was added to H2O (100 mL) and extracted with EA (150 mL*3) and the EA layers combined. The EA layer was washed with brine and dried over Na2SO4. Filtered and concentrated to gîve the crude 7-3 (45.0 g). ESILCMS m/z = 614.5 [M+H]+.
[0142] Préparation of compound 7-4: To a mixture solution of 7-3 (44.0 g, crude) in THF (440 mL) was added the H2O (220 mL) and TFA (220 mL) at 0°C. Then the reaction mixture was stirred at 0°C for 1.5 h. TLC showed the 7-3 was consumed completely. The reaction mixture pH was adjusted to 7-8 with ΝΗ3.Η2Ο. Then the mixture was extracted with EA (300 mL*7). The combined EA layer was washed with brine and concentrated in vacuo to give crude. The crude was purified by column chromatography (EA: PE = 1:5-1:1) to give compound 7-4 (15.8 g) as a white solid. ‘H-NMR (400 MHz,DMSO-d6): δ - 11.24 (s, 1H, exchanged with D2O), 8.77 (s, 2H), 8.04-8.06 (m, 2H), 7.64-7.66 (m, 2H), 7.54-7.58 (m, 2H), 6.14-6.16 (d, J = 5.9 Hz, 1H), 5.20-5.23 (m, 1H),4.58-4.60 (m, 1H), 4.52-4.55 (m,lH), 3.994.01 (m, 1H), 3.69-3.75 (m, 1H), 3.57-3.61 (m, 1H), 3.34 (s, 4H), 0.93 (s, 9H), 0.14-0.15 (d, J - 1.44 Hz, 6H). ESI-LCMS m/z = 500.3 [M+Hf.
[0143] Préparation of compound 7-5: To a 500 mL round-bottom ilask was added the DMSO (132 mL) and 7-4 (13.2 g, 26.4 mmol), EDCI (15.19 g, 79.2 mmol) in turn at r.t. Then the Pyridine (2.09 g, 26.4 mmol, 2.1 mL) was added to the reaction mixture. After stirring 5 min, the TFA (1.51 g, 13.2 mmol) was added to the reaction mixture. Then reaction mixture was stirred at r.t for 3 hrs. LC-MS showed the 7-4 was consumed completely. The réaction mixture was added to the ice water (500 mL) and extracted with EA (300 mL*3) 3 times. The combined EA layer was washed with H2O 2 times and brine 1 time. Dried over Na2SO4 and filtered. The filtrate was concentrated to get crude 7-5 (14.6 g) as a white solid. ESI-LCMS m/z - 516.3 [M+H]+.
[0144] Préparation of compound 7-6: The 5A (24.4 g, 38.5 mmol) was added to a mixture solution of NaH (2.5 g, 64.3 mmol, 60% purity) in THF (50 mL) at 0°C. After stirring 15 min, the 7-5 (16.0 g, 32.1 mmol) in THF (60 mL) was added to the reaction mixture. Then the reaction mixture was stirred at r.t for 1 hr. LC-MS showed the 7-5 was consumed completely. Then the reaction mixture was quenched with sat. NH4CI (500 mL) and extracted with EA (400 mL*3) 3 times. The combined EA layer was washed with brine, dried over NasSCL and filtered. The filtrate was concentrated in vacuo to get crude. The crude was purified by c.c (EA: PE = 1:5 ~ 1:1) to give 7-6 (10.0 g, 12.4 mmol, 38.6% yieid) as a white solid. ESI-LCMS m/z = 804.4 [M+H]+; 3iP NMR (162 MHz, DMSO-cL) δ 17.01.
[0145] Préparation of compound 7-7: To a 500 mL round-bottom flask was added the 7-6 (9.0 g, 11.2 mmol) and H2O (225 mL), HCOOH (225 mL) in turn. The reaction mixture was stirred at 26°C for 15 h. LC-MS showed the 7-6 was consumed completely. The reaction mixture was adjusted the pH = 6-7 with NH3.H2O. Then the mixture was extracted with EA (300 mL*3) 3 times. The combined EA layer was dried over Na2SO4, filtered and filtrate was concentrated to get crude. The crude was purified by column chromatography (DCM/ MeOH = 100:1 ~ 60:1) to give product 7-7 (7.0 g, 10.1 mmol, 90.6% yieid). LH-NMR (400 MHz,DMSO-d6): 5 = 11.11 (s, 1H, exchanged with D2O),8.71 -8.75 (d, 7=14.4, 2H), 8.04-8.06 (m, 2H), 7.64-7.65 (m, 1H), 7.54-7.58 (m, 2H), 6.88-7.00 (m, 1H), 6.20-6.22 (d, 7=5.4, 2H),
6.06-6.16 (m, 1H), 5.74-5.75 (d, 7=5.72, 2H), 5.56-5.64 (m, 4H), 4.64-4.67 (m, 1H), 4.584.59(m, 1H), 4.49-4.52 (m, 1H), 3.37 (s, 3H), 1.09-1.10 (d, 7=1.96,18H). 31P NMR (162 MHz, DMS O-i/n) ô 17.45. ESI-LCMS m/z = 690.4 [M+Hp.
[0146] Préparation of compound 5’-VP: To a solution of 7-7 (5.5 g, 7.9 mmol) in DCM (55 mL) was added the DCI (750 mg, 6.3 mmol), then CEP[N(iPr)2]î (3.1 g, 10.3 mmol) was added. The mixture was stirred at r.t. for 2 h. TLC showed 3.5% of 7.7 remained. The reaction mixture was washed with H2O (40 mL*2) and brine (50 mL*2), dried over Na2SO4 and concentrated to give crude. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/5 increasing to CH3CN/ H2O (0.5% NH4HCO3) = 1/0 within 30 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 3/1; Detector, UV 254 nm. The product was concentrated and extracted with EA (50 mL* 3). The combined EA layer was washed with brine and dried over NasSO^ filtered and filtrate was concentrated to get resulting 5’-VP (6.0 g, 98% purity) as a white solid. ‘H-NMR (400 MHz, DMSO-d6): δ = 11.27 (s, 1H, exchanged with D2O), 8.72-8.75 (m, 2H), 8.04-8.06 (m, 2H), 7.54-7.68 (m, 3H) , 6.85-7.05 (m, 1H),6.09-6.26 (m, 2H), 5.57-5.64 (m, 4H), 4.70-4.87 (m, 3H), 3.66-3.88 (m, 4H), 3.3720592
3.41 (m, 3H),2.82-2.86 (m, 2H), 1.20-1.21 (m, 12H), 1.08-1.09 (m, 18H). 31PNMR (162 MHz, DMSO-dfi):149.99, 149.16, 17.05, 16.81. ESI-LCMS m/z = 890.8 [M+H]+.
[0147] Table 7 summarizes the sequence length, alternating A and C units, and 5’ modification for the resulting exemplified modified phosphorothioated oligonucleotides.
TABLE 7
No. Length A C 5’-Modification
117 (AC) 17 LNA-A LNA-(5m)C OH
118 (AC) 18 LNA-A LNA-(5m)C OH
119 (AC)19 LNA-A LNA-(5m)C OH
120 (AC) 17 LNA-A LNA-(5m)C Vinyl-phosphonate-A
121 (AC) 18 LNA-A LNA-(5m)C Vinyl-phosphonate-A
122 (AC) 19 LNA-A LNA-(5m)C Vinyl-phosphonate-A
123 (AC)20 LNA-A LNA-(5m)C Vinyl-phosphonate-A
124 (AC) 17 2’-OMe-A 2’-OMe-(5m)C OH
125 (AC) 18 2’-0Me-A 2’-OMe-(5m)C OH
126 (AC) 19 2’-OMe-A 2’-OMe-(5m)C OH
127 (AC) 17 2’-OMe-A 2’-OMe-(5m)C Vinyl-phosphonate-A
128 (AC) 18 2’-OMe-A 2’-OMe-(5m)C Vinyl-phosphonate-A
129 (AC) 19 2’-OMe-A 2’-OMe-(5m)C Vinyl-phosphonate-A
130 (AC)20 2!-OMe-A 2’-OMe-(5m)C Vinyl-phosphonate-A
EXAMPLES 131-174
[0148] The effect of sequence length, LNA incorporation and 5’- modification was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with the 10 methods described above în Examples 1-116. Table 8 summarizes the sequence length, alternating A and C units, 5’ modification, and length and position of LNA units for the resulting exemplified modified phosphorothioated oligonucleotides.
TABLE 8
No. Length A C 5’-Modificatioii LNA Modification
131 (AC) 17 2’-0Me-A LNA-(5m)C OH
132 (AC) 18 2’-OMe-A LNA-(5m)C OH
133 (AC)19 2’-OMe-A LNA-(5m)C OH
134 (AC)20 2’-0Me-A LNA-(5m)C OH
135 (AC)17 2’-0Me-A LNA-(5m)C Vi ny 1 -pho spho n a te - A
136 (AC) 18 2’-0Me-A LNA-(5m)C Vinyl-phosphonate-A
137 (AC) 19 2’-OMe-A LNA-(5m)C Vinyl-phosphonate-A
No. Length A C 5’-Modification LNA Modification
138 (AC)20 2’-OMe-A LNA-(5m)C Vi ny 1 -phosphon a le - A
139 (AC) 17 LNA-A 2’-OMe-(5m)C OH
140 (AC)18 LNA-A 2’-OMe-(5m)C OH
141 (AC) 19 LNA-A 2’-OMe-(5m)C OH
142 (AC)20 LNA-A 2’-OMe-(5m)C OH
143 (AC)17 LNA-A 2’-OMe-(5m)C Vinyl-phosphonate-A
144 (AC)18 LNA-A 2’-OMe-(5m)C Vinyl-phosphonate-A
145 (AC) 19 LNA-A 2’-OMe-(5m)C Vinyl-phosphonate-A
146 (AC)20 LNA-A 2’-OMe-(5m)C Vinyl-phosphonate-A
147 (AC) 17 UNA-A LNA-(5m)C OH
148 (AC)18 UNA-A LNA-(5m)C OH
149 (AC)19 UNA-A LNA-(5m)C OH
150 (AC)20 UNA-A LNA-(5m)C OH
151 (AC)17 UNA-A LNA-(5m)C Vinyl-phosphonate-A
152 (AC) 18 UNA-A LNA-(5m)C Vinyl-phosphonate-A
153 (AC)19 UNA-A LNA-(5m)C Vinyl-phosphonate-A
154 (AC)20 UNA-A LNA-(5m)C Vinyl-phosphonate-A
155 (AC) 17 LNA-A UNA-(5m)C OH
156 (AC) 18 LNA-A UNA-(5m)C OH
157 (AC) 19 LNA-A UNA-(5m)C OH
158 (AC)20 LNA-A UNA-(5m)C OH
159 (AC)20 LNA-A UNA-(5m)C OH Block of4LNA
160 (AC) 17 LNA-A UNA-(5m)C Vinyl-phosphonatc-A
161 (AC) 18 LNA-A UNA-(5m)C Vinyl-phosphonatc-A
162 (AC) 19 LNA-A UNA-(5m)C Vinyl-phosphonate-A
163 (AC)20 LNA-A UNA-(5m)C Vinyl-phosphonate-A
164 (AC)20 2’-OMe-A LNA-A 2’-OMe-(5m)C LNA-(5m)C OH Every 3rd base is LNA
165 (AC)20 2’-OMe-A LNA-A 2’-OMe-(5m)C LNA-(5m)C Vinyl-phosphonate-A Every 3rd base is LNA
166 (AC)20 2’-OMe-A 2’-OMe-(5m)C LNA-(5m)C OH Every 4th base is LNA
167 (AC)20 2’-OMe-A 2’-OMe-(5m)C LNA-(5m)C Vinyl-phosphonate-A Every 4th base is LNA
168 (AC) 17 2’-OMe-A 2’-OMe-(5m)C LNA(5m)C Vinyl-phosphonate-A 5 (5m)lnC in the middle
169 (AQ18 2’-OMe-A 2’-OMe-(5m)C Vinyl-phosphonate-A 6 lnAps(5m)C in the middle
170 (AC) 19 2’-OMe-A 2’-OMe-(5m)C LNA(5m)C Vinyl-phosphonate-A 6 lnAps(5m)C in the middle
No. Length A C 5’-Modificatioii LNA Modification
171 (AC)20 2’-0Me-A 2’-OMe-(5m)C LNA(5m)C OH 5 (5m)lnC in the middle
172 (AC)20 LNA-A 2’-OMe-A 2’-OMe-(5m)C LNA(5m)C OH 10 lnAps(5m)C in the middle
173 (AC)20 2’-OMe-A 2’-OMe-(5m)C LNA(5m)C Vi n y 1 -p hosphon ate -A 5 (5m)inC ïn the middie
174 (AC)20 2’-0Mc-A LNA-A 2’-OMe-(5m)C LNA-(5m)C Vi ny 1 -p hospho n ate -A 10 JnAps(5m)C in the middle
EXAMPLES 175-216
[0149] The effect of sequence length, LNA incorporation, stereochemical modification and 5’ modification was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with the methods described above in Examplcs 1-116, except that the oligonucleotides were prepared by a modified method using a dinucleotide building block consisting of an A unit and a C unit connected by a stereocheimcally defined phosphorothioate linkage as follows:
2'-OMeApsR(5m)mC phosphoramidîte (9R) 2’-OMeApsS(5m)mC phosphoramidite (9S)
[0150] With reference to FIGS. 8, 9A and 9B, the dinucleotide building blocks 9R and 9S were prepared as follows:
[0151] Préparation of compound 8-2: To a solution of 8-1 (300.0 g, 445.1 mmol) in 3000 mL of dry dioxane with an iiiert atmosphère of nitrogen was added levulinic acid 15 (309.3 g, 2.67 mol) dropwise at room température. Then the dicyclohexyicarbodîimide (274.6 g, 1.33 mol) and 4-dîmethylaminopyridine (27.1 g, 222.0 mmol) were added in order at room température. The resulting solution was stirred at room température for 5 h and diluted with 5000 mL of dichloromethane and filtered. The organic phase was washed with 2 x 3000 mL of 2% aqueous sodium bicarbonate and 1 x 3000 mL of water respectively. The organic phase was dried over anliydrous sodium sulfate, filtered and concentrated under reduced pressure.
345.0 g (crude) of 8-2 was obtained as a white solid and used for next step without further purification. ESI-LCMS: m/z 774 [M+H]+.
[0152] Préparation of compound 8-3: To a solution of 8-2 (345 g, 445.1 mmol) was dissolved in 3000 mL dichloromethane with an inert atmosphère of nitrogen was added ptoiuenesulfonic acid (84.6 g, 445.1 mmol) dropwise at 0 “C. The resulting solution was stirred at 0 °C for 0.5 h and diluted with 3000 mL of dichloromethane and washed with 2 x 2000 mL of saturated aqueous sodium bicarbonate and 1 x 2000 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anliydrous sodium sulfate, and concentrated under reduced pressure and the residue was purified by silica gel column chromatography (SiCh, dichloromethane: methanol = 30:1) to give 8-3 (210.0 g, 90% over two steps) as a white solid. JH-NMR (400 MHz, DMSO-cL) δ -12.88 (s, 1H), 8.17-8.10 (m, 3H), 7.62-7.60 (m, 1H), 7.58-7.48 (m, , 2H), 5.97-5.91 (m, 1H), 5.42 (d, J - 5.9 Hz, 1H), 5.25 (s, 1H), 4.21-4.08 (m, 2H), 3.78-3.59 (m, 2H), 2.75-2.74 (m, 2H), 2.57 (m, 2H), 2.13 (d, J = 2.3 Hz, 3H), 2.02 (s, 3H), 1.81 (m, 1H), 1.77-1.56 (m, 1H), 1.33-0.98 (m, 1H). ESI-LCMS: m/z 474 [M+H]+.
[0153] Préparation of compound 8-4: To a solution of 8-3 (210.0 g, 444.9 mmol) în 2000 mL of acetonitriie with an inert atmosphère of nitrogen was added 8-3a (360.0 g, 405.4 mmol) and ETT (58.0 g, 445.9 mmol) in order at 0°C. The resulting solution was stirred for 2 h at room température. The» the mixture was filtered and used for next step without further purification. ESI-LCMS: m/z 1258 [M+H]+.
[0154] Préparation of compounds 8-5 and 8-6: To a solution of 8-4 (509.9 g, 405.4 mmol) in 2000 mL of acetonitriie with an inert atmosphère of nitrogen was added pyridine (128.0 g, 1.62 mol) and 5-amino-3H-l,2,4-dithiazole-3-thione (121.8 g, 810.9 mmol) in order at room température. The reaction solution was stirred for 30 minutes at room température. The resulting solution was filtered and concentrated under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlasb-l): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) - 1/1 increasing to CH3CN/H2O (0.5%
NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in a mixture of 8-5 and 8-6 (430.0 g, 90% over two steps) as a white solid. The fractions were diluted with 3000 mL of dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by SFC with the following conditions: CHIRALPAK IB N-5(IB50CD-VD008)/SFC 0.46 cm LD. x 25 cm L lO.Oul Mobile phase: (DCM/EtOAc=80/20(V/V)), Detector, UV 254 nm. The fractions were concentrated until no residual solvent left under reduced pressure. 105.0 g (35.0%) of 8-5 were obtained as a white solid and used to make 9R as described below. 'H-NMR (400 MHz, DMSO-dr,) δ = 12.88 (s, 1H), 11.26 (s, 1H), 8.62 (d, J - 8.06 Hz, 2H), 8.18 (m, 2H), 8.05 (d, J = 7.2 Hz, 2H), 7.79 (s, 1H), 7.67-7.48 (m, 6H), 7.40 (d, J - 7.2 Hz, 2H), 7.28-7.18 (m, 7H), 6.86-6.83 (m, 4H), 6.21 (d, J - 6.6 Hz, 1H), 5.91 (d, J = 5.0 Hz, 1H), 5.44-5.41 (m, 1H),5.285.26 (m, 1H), 5.06 (m, 1H), 4.45-4.24 (m, 7H), 3.71 (s, 6H), 3.39 (s, 4H), 3.31 (s, 3H), 2.98 (m, 2H), 2.75 (m, 2H), 2.56 (m, 2H), 2.01 (s, 3H). 31P-NMR (162 MHz, DMSO-dr,) δ - 67.17. ESI-LCMS: m/z 1292 [M+H]+ ; 170.0 g (56.6%) of 8-6 were obtained as a white solid and used to make 9S as described below. ^-NMR (400 MHz, DMSO-ds) S = 12.86 (s, 1H), 11.25 (s, 1H), 8.62 (d, J = 16.6 Hz, 2H), 8.18 (d, J = 7.2 Hz, 2H), 8.05 (m, 2H), 7.78 (s, 1H), 7.677.48 (m, 6H), 7.40 (d, J - 7.2 Hz, 2H), 7.28-7.18 (m, 7H), 6.87-6.85 (m, 4H), 6.21 (d, J - 6.8 Hz, 1H), 5.91 (d, J - 5.2 Hz, 1H), 5.43-5.39 (m, 1H), 5.28-5.26 (m, 1H), 5.06 (m, 1H), 4.484.21 (m, 7H), 3.72 (s, 6H), 3.36 (s, 4FI), 3.26 (s, 3H), 2.95 (m, 2H), 2.73 (m, 2H), 2.55 (m, 2H), 2.04 (s, 3H); 31P-NMR (162 MHz, DMSO-dfi) δ = 66.84; ESI-LCMS: m/z 1292 [M+H]+.
[0155] Préparation of compound 9-1: To a solution of 8-5 (100.0 g, 77.4 mmol) in 700 mL acetonitrile with an inert atmosphère of nitrogen was added 0.5 M hydrazine hydrate (20.0 g, 0.4 mol) in pyridine/acetic acid (3:2) at 0’C. The resulting solution was stirred for 0.5 h at 0°C. Then the reaction was added 2,4-pentanedione at once, the mixture was allowed to warm to room température and stirred for additional 15 min. The solution was diluted with DCM (20ÜÜ mL) and washed with sat. aq. NH4CI twice and washed with brine and dried over Na2SÛ4. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5%
NH4HCO3) = 1/0; Detector, UV 254 nm. This résultée! in 9-1 (67.0 g, 80%) as a white solid. 'H-NMR (400 MHz, DMSO-dr,) δ = 12.97 (s, 1H), 11.26 (s, 1H), 8.62 (d, J = 11.2 Hz, 2H), 8.19 (d, J = 7.2 Hz, 2H), 8.05 (m, 2H), 7.74 (s, 1H), 7.67-7.48. (m, 6H), 7.40 (d, J = 7.2 Hz, 2H), 7.28-7.18 (m, 7H), 6.85 (m, 4H), 6.21 (m, 1H), 5.90 (d, J= 3.2 Hz, 1H), 5.49-5.43 (m, 5 2H), 5.05 (m, 1H), 4.45 (m, 1H), 4.40-4.30 (m, 4H), 4.18-4.11 (m, 2H), 3.93 (m, 1H), 3.71 (s,
6H), 3.40-3.32 (m, 8H), 2.98 (m, 2H), 2.04 (s, 3H). 3lP-NMR (162 MHz, DMSO-d6) δ = 67.30. ESI-LCMS: m/z 1194 [M+H]+.
[0156] Préparation of compound 9R: To a solution of 9-1 (58.0 g, 48.6 mmol) in 600 mL of dichloromethane with an inert atmosphère of nitrogen was added CEP[N(ÎPr)2]2 10 (18.7 g, 62.1 mmol) and DCI (5.1 g, 43.7 mmol) in order at room température. The resulting solution was stirred for 1 hour at room température and diluted with 1000 mL dichloromethane and washed with 2 x 1000 mL of saturated aqueous sodium bicarbonate and 1 x 1000 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until no residual solvent left under reduced pressure.
The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in 9R (51.2 g, 70%) as a white solid. lH-NMR (400 MHz, DMSO-d6) δ = 12.94 (m, 1H), 11.26 (s, 1H), 8.62 (m, 2H), 8.19 (d, J = 7.2 Hz, 2H), 8.05 (m, 2H), 7.77 (m, 1H), 7.69-7.46 (m, 6H), 7.39 (d, J =
6.6 Hz, 2H), 7.26-7.20 (m, 7H), 6.84 (m, 4H), 6.20 (m, 1H), 5.90 (m, 1H), 5.43 (m, 1H), 5.06 (s, 1H), 4.46-4.17 (m, 7H), 4.12 (m, 1H), 3.82-3.80 (m, 2H), 3.73-3.66 (s, 6H), 3.64-3.58 (m, 2H), 3.48-3.29 (m, 8H), 2.98 (s, 2H), 2.82-2.77 (m, 2H), 2.03 (s, 3H), 1.24-1.15 (m, 12H). 31PNMR (162 MHz, DMSO-dfi) δ = 149.87,149.80,67.43, 67.33. ESI-LCMS: in/z 1394 [M+H]*.
[0157] Préparation of compound 9-2: To a solution of 8-6 (110.0 g, 85.1 mmol) in
700 mL acetonitrile with an inert atmosphère of nitrogen was added 0.5 M hydrazine hydrate (21.1 g, 423.6 mmol) in pyridine/acetic acid (3:2) at 0°C. The resulting solution was stirred for 0.5 h at OC. Then the reaction was added 2,4-pentanedione at once, the mixture was allowed to warm to room température and stirred for additional 15 min, The solution was diluted with
DCM (2000 mL) and washed with sat. aq. NH4C1 twice and washed with brine and dried over Na2SO4.Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) - 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ HzO (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in 9-2 (72.0 g, 80%) as a white solid. ]H-NMR (400 MHz, DMSO-dft) δ - 12.94 (s, 1H), 11.24 (s, 1H), 8.61-8.57 (m, 2H), 8.18 (d, J = 7.6 Hz, 2H), 8.03 (d, J = 7.6 Hz, 2H), 7.74 (s, 1H), 7.66-7.47 (m, 6H), 7.40 (d, J- 7.1 Hz, 2H), 7.27-7.20 (m, 7H), 6.86 (m, 4H), 6.20 (d, J - 6.6 Hz, 1H), 5.87 (d, 4.0 Hz, 1H), 5.42 (m, 2H), 5.05 (m, 1H), 4.45 (m, 2H), 4.40-4.24 (m, 1H), 4.22-4.06 (m, 4H), 3.92 (m, 1H), 3.71 (s, 6H), 3.40-3.32 (m, 8H), 2.94 (m, 2H), 2.03 (m, 3H). 31P-NMR (162 MHz, DMSO-dfl) δ = 66.87. ESI-LCMS: m/z 1194 [M+H]+ .
[01581 Préparation of compound 9S: To a solution of 9-2 (62.0 g, 51.9 mmol) in 600 mL of dichloro methane with an inert atmosphère of nîtrogen was added CEP[N(iPr)2]2 (19.0 g, 63.1 mmol) and DCI (5.55 g, 47.0 mmol) in order at room température. The resulting solution was stirred for 1 hour at room température and diluted with 1000 mL dichloromethane and washed with 2 x 1000 mL of saturated aqueous sodium bicarbonate and 1 x 1000 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until no residual solvent left under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in 9S (51.5 g, 70%) as a white solid. 'H-NMR (400 MHz, DMSO-dr,) 5 = 12.90 (s, 1H), 11.25 (s, 1H), 8.60 (m, 2H), 8.19 (d, J = 6.6 Hz, 2H), 8.04 (m, 2H), 7.77 (s, 1H), 7.67-7.48 (m, 6H), 7.41 (d, J = 8.0 Hz, 2H), 7.29-7.19 (m, 7H), 6.85 (m, 4H), 6.21 (d, J = 6.8 Hz, 1H), 5.91-5.87 (m, 1H), 5.41 (m, 1H), 5.06 (m, 1H), 4.46-4.21 (m, 7H), 4.10 (m, 1H), 3.83-3.75 (m, 2H), 3.73-3.68 (s, 6H), 3.68-3.59 (m, 2H), 3.40-3.32 (m, 8H), 2.93 (m, 2H), 2.80 (m, 2H), 2.02 (s, 3H), 1.18-1.13 (m, 12H). 31P-NMR (162 MHz, DMSO-d6) δ = 149.96,149.73,66.99,66.86. ESI-LCMS: m/z 1394 [M+H]+ .
[0159] The modified method also used a longer coupling time (8 min) and a greater number of équivalents of amidites (8 équivalents). Table 9 summarizes the sequence length, alternating A and C units, the number and type (R or S) of stereochemically defined phosphorothioate (PS) linkages, and 5’-modification for the resulting exemplified modified phosphorothioated oligonucleotides.
TABLE 9
No. Le agi II A C PS Modification 5'-Modification
175 (AC)17 2’-0Me-A 2’-OMe-(5m)C 5 R isomer OH
176 (AC) 18 2’-0Me-A 2’-OMe-(5m)C 6 R isomer OH
177 (AC) 19 2’-OMe-A 2’-OMe-(5m)C 4 R isomer OH
178 (AC)20 2’-0Me-A 2’-OMe-(5m)C 4 R isomer OH
179 (AC)20 2’-O Me-A 2’-OMc-(5m)C 5 R isomer OH
180 (AC)20 2’-0Me-A 2’-OMe-(5m)C 6 R isomer OH
181 (AC)20 2’-OMe-A 2’-OMe-(5m)C 6 R isomer Vinyl-phosphonale-A
182 (AC)20 2’-0Me-A 2’-OMe-(5m)C 7 R isomer OH
183 (AC)20 2’-OMe-A 2’-OMe-(5m)C 13 R isomer OH
184 (AC)20 2’-0Mc-A 2’-OMe-(5m)C 20 R isomer OH
185 (AC)20 2’-0Mc-A 2’-OMe-(5m)C 20 R isomer Vinyl-phosphonate-A
186 (AC)20 2’-0Me-A 2’-OMe-(5m)C 19 R isomer Vinyl-phosphonale-A
187 (AC) 17 LNA-A LNA-(5m)C 5 R isomer OH
188 (AC)18 LNA-A LNA-(5m)C 6 R isomer OH
189 (AC)19 LNA-A LNA-(5m)C 6 R isomer OH
190 (AC)20 LNA-A LNA-(5m)C 4 R isomer OH
191 (AC)20 LNA-A LNA-(5m)C 5 R isomer OH
192 (AC)20 LNA-A LNA-(5m)C 6 R isomer OH
193 (AC)20 LNA-A LNA-(5m)C 6 R isomer. Vinyl-phosphonatc-A
194 (AC)20 LNA-A LNA-(5m)C 13 R isomer OH
195 (AC)20 LNA-A LNA-(5m)C 20 R isomer OH
196 (AC)20 LNA-A LNA-(5m)C 20 R isomer Vinyl-phosphonale-A
197 (AC)17 2’-0Mc-A 2’-OMe-(5m)C 5 S isomer OH
198 (AC) 18 2’-0Me-A 2’-OMe-(5m)C 6 S isomer OH
199 (AC) 19 2’-0Me-A 2’-OMe-(5m)C 6 S isomer OH
200 (AC)20 2’-0Mc-A 2’-OMe-(5m)C 4 S isomer OH
201 (AC)20 2’-0Me-A 2’-OMe-(5m)C 5 S isomer OH
202 (AC)20 2’-0Me-A 2’-OMe-(5m)C 6 S isomer OH
203 (AC)20 2’-OMe-A 2’-OMe-(5m)C 7 S isomer OH
204 (AC)20 2’-OMe-A 2’-OMe-(5m)C 13 S isomer OH
205 (AC)20 2’-0Me-A 2’-OMe-(5m)C 20 S isomer OH
206 (AC)20 2’-0Me-A 2’-OMe-(5m)C 20 S isomer Vinyl-phosphonaie-A
207 (AC) 17 LNA-A LNA-(5m)C 5 S isomer OH
208 (AC)18 LNA-A LNA-(5m)C 6 S isomer OH
209 (AC)19 LNA-A LNA-(5m)C 6 S isomer OH
No. Length A C PS Modification 5’-Modification
210 (AC)20 LNA-A LNA-(5m)C 4 S isomer OH
211 (AC)20 LNA-A LNA-(5m)C 5 S isomer OH
212 (AC)20 LNA-A LNA-(5m)C 6 S isomer OH
213 (AC)20 LNA-A LNA-(5m)C 6 S isomer Vinyl-phosphonatc-A
214 (AC)20 LNA-A LNA-(5m)C 13 S isomer OH
215 (AC)20 LNA-A LNA-(5m)C 20 S isomer OH
216 (AC)20 LNA-A LNA-(5m)C 20 S isomer Vinyl-phosphonale-A
EXAMPLES 217-234
[0160] The effect of sequence length, LNA incorporation, stereochemical modification and 5’ modification was evaluated by preparing a sériés of phosphorothioated 5 oligonucleotides in accordance with the methods described above in Examples 175-216, except that the oligonucleotides were prepared by a modified method using a dinucleotide building block consisting of an A unit and a C unit connected by a stereochemicalîy defined phosphorothioate linkage as follows:
2’-OMeApsR(5m)lnC phosphoramidite (11R) 2’-OMeApsS(5m)lnC phosphoramidite (US) [0161] With reference to FIGS. 10, 11A and 11B, the dinucleotide building blocks
HR and 11S were prepared as follows:
[0162] Préparation of compound 10-2: To a solution of 10-1 (50.0 g, 74.0 mmol) in 500 mL of dry dioxane with an inert atmosphère of nitrogen was added levulinic acid (51.5 g, 44.4 mol) dropwise at room température. Then the dicyclohexylcarbodiimide (45.7 g, 0.2 mol) and 4-dimethylaminopyridine (4.6 g, 37.0 mmol) were added in order at room température. The resulting solution was stirred at room température for 5 h and diluted with 3000 mL of dichloromethane and filtered. The organic phase was washed with 2 x 1000 mL of 2% aqueous sodium bicarbonate and 1 x 1000 mL of water respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure.
52.0 g (crude) of 10-2 was obtained as a white solîd and used for next step without further purification. ESI-LCMS: m/z 774 [M+H]+.
[0163] Préparation of compound 10-3: To a solution of 10-2 (52.0 g, 67.0 mmol) was dîssolved in 400 mL dichloromethane with an inert atmosphère of nitrogen was added ptoluenesulfonic acid (51.5 g, 0.4 mol) dropwise at 0 °C. The resulting solution was stirred at lü 0 °C for 0.5 h and diluted with 2000 mL of dichloromethane and washed with 2 x 1000 mL of saturated aqueous sodium bicarbonate and 1 x 1000 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure and the residue was purified by silîca gel column chromatography (S1O2, dichloromethane: methanol = 30:1) to give 10-3 (32.0 g, 80% over two steps) as a white 15 solid. 'H-NMR (400 MHz, DMSO-d6) δ = 13.05 (s, 1H), 8.20-7.91 (m, 4H), 7.60-7.49 (m, 4H), 5.57 (m, 2H), 5.32 (d, J- 10.8 Hz, 1H), 4.88 (s, 1H), 4.49 (s, 1H), 4.18 (s, 1H), 3.91-3.78 (m, 5H), 2.74-2.69 (m, 4H), 2.59-2.49 (m, 7H), 2.10 (s, 5H), 2.06 (s, 4H), 1.74-1.49 (m, 3H), 1.261.02 (m, 3H). ESI-LCMS: m/z 472 [M+H]+.
[0164] Préparation of compound 10-4: To a solution of 10-3 (28.0 g, 59.4 mmol) 20 in 300 mL of acetonitrile with an inert atmosphère of nitrogen was added 8-3a (50.0 g, 56.3 mmol) and ETT (7.9 g, 59.4 mmol) in order at 0°C. The resulting solution was stirred for 2 h at room température. Then the mixture was filtered and used for next step without further purification. ESI-LCMS: m/z 1258 [M+H]*.
[0165] Préparation of compounds 10-5 and 10-6; To a solution of 10-4 (70.9 g, 25 56.3 mmol) in 300 mL of acetonitrile with an inert atmosphère of nitrogen was added pyridine (17.8 g, 225.2 mmol) and 5-amino-3H-l,2,4-dithiazole-3-thione (16.9 g, 112.6 mmol) in order at room température. The reaction solution was stirred for 30 minutes at room température. The resulting solution was filtered and concentrated under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica 30 gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) - 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collecter! at CH3CN/ H2O (0.5%
NH4HCO3) = 1/0; Detector, UV 254 nm. This résultée! in a mixture of 10-5 and 10-6. The fractions were diiuted with 3000 mL of dichloromethane. The organic phase was dried over an hydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by SFC with the following conditions: CHIRAL CEL OD-H/SFC 20mm*250mmL 5 5um (Phase A: CO2; Phase B: 50% ethanol-50% acetonitrile), Detector, UV 220 nm. The fractions were concentrated until no residual solvent left under reduced pressure. 9.0 g (25.7%) of 10-5 were obtained as a white solid and used to make 11R as described below. Td-NMR (400 MHz, DMSO-dâ) δ = 13.06 (s, 1H), 11.28 (s, 1H), 8.63 (d,J = 20 Hz, 2H), 8.20 (m, 2H), 8.05 (d, 7 = 8 Hz, 2H), 7.84 (s, 1H), 7.67-7.39 (m, 8H), 7.28-7.19 (m, 7H), 6.86-6.83 (m, 4H), 10 6.24 (d, J = 6.6 Hz, 1H), 5.66 (s, 2H), 5.45-5-43(m, 1H), 5.10-5.03(m, 2H), 4.82-4.76(m, 1H),
4.6Ü (s, 1H), 4.50-4.33 (m, 4H), 4.03-3.96 (m, 2H), 3.72 (s, 6H), 3.41-3.35 (m, 7H), 3.03-3.0Ü (m, 2H), 2.75-2.72 (m, 2H), 2.56-2.53 (m, 2H),2.08-2.05 (m, 6H). 31P-NMR (162 MHz, DMSO-dt,) δ = 67.Û2. ES1-LCMS: m/z 1290 [M+H]+. 15.0 g (42.8%) of 10-6 were obtained as a white solid and used to make 11S as described below. V-NMR (400 MHz, DMSO-dc,) δ 15 13.05 (s, 1H), 11.26 (s, 1H), 8.63 (d, J = 24 Hz, 2H), 8.-7.96(m, 4H), 7.76 (s, 1H), 7.67-7.39 (m, 8H), 7.28-7.19 (m, 7H), 6.86 (d, J = 7.2 Hz, 4H), 6.24 (d, J = 6.4 Hz, 1H), 5.76 (s, 1H), 5.63 (s, 1H), 5.43-5.41(m, 1H), 5.12(m, 1H), 4.97(s, 1H), 4.82-4.79(m, 1H), 4.57-4.49 (m, 3H), 4.27-4.25 (m, 2H), 4.07-4.03 (m, 2H), 3.72 (s, 6H), 3.44-3.36 (m, 6H), 2.96 (m, 2H), 2.74-2.71 (m, 2H), 2.55-2.53 (m, 2H),2.08 (s, 3H), 1.94 (s, 3H). 31P-NMR (162 MHz, DMSO-d6) δ = 20 66.58. ES1-LCMS: m/z 1290 [M+H]+.
[0166] Préparation of compound 11-1: To a solution of 10-5 (10.0 g, 7.7 mmol) in 100 mL acetonitrile with an inert atmosphère of nitrogen was added 0.5 M hydrazine hydrate (1.8 g, 37.5 mmol) in pyridine/acetic acid (3:2) at 0°C. The resulting solution was stirred for 0.5 h at 0Ό. Then the reaction was added 2,4-pentanedione at once, the mixture was allowed 25 to warm to room température and stirred for additional 15 min. The solution was diiuted with DCM (500 mL) and washed with sat. aq. NH4CI twice and washed with brine and dried over Na2SÛ4. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-l): Coiumn, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH2CN/H2O (0.5% 30 NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5%
NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in 11-1 (6.0 g, 65%) as a white solid.
‘H-NMR (400 MHz, DMSO-d6) δ = 13.13 (s, 1H), 11.28 (s, 1H), 8.63 (d, J - 20 Hz, 2H), 8.21 (d, J = 8 Hz, 2H), 8.06-7.95 (m, 3H), 7.80 (s, 1H), 7.67-7.48. (m, 8H), 7.40 (d, J = 7.6 Hz, 2H), 7.32-7.19 (m, 10H), 6.85 (m, 5H), 6.24 (d, J = 8 Hz, 1H), 6.04 (d, J = 4.0 Hz, 1H), 5.57 (s, 2H), 5.44-5.42(111,1H), 5.19-5.17(m, 2H), 5.10-5.08(m, 1H), 4.80-4.76(m, 2H), 4.50 (d, J= 5.6
Hz, 1H), 4.37-4.32 (m, 4H), 4.06-3.99 (m, 2H), 3.81 (m, 1H), 3.72 (s, 7H), 3.40-3.36 (m, 8H), 3.03-3.00 (m, 2H), 2.05 (m, 3H). 31P-NMR (162 MHz, DMSO-d6) δ = 67.21. ESI-LCMS: m/z 1192 [M+H]+.
[0167] Préparation of compound UR: To a solution of 11-1 (6.0 g, 5.0 mmol) in 60 mL of dichloromethane with an inert atmosphère of nitrogen was added CEP[N(iPr)2]2 (1.9 g, 6.5 mmol) and DCI (0.6 g, 5.0 mmol,) in order at room température. The resulting solution was stirred for 1 hours at room température and diluted with 1000 mL dichloromethane and washed with 2 x 250 mL of saturated aqueous sodium bicarbonate and 1 x 250 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until no residuai solvent left under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-l); Colutrin, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) - 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) =1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in HR (5.0 g, 70%) as a white solid. ’H-NMR (400 MHz, DMSO-d6) δ = 13.10 (s, 1H), 11.28 (s, 1H), 8.20 (d, J = 8.0 Hz, 2H), 8.04 (d, J = 7.2 Hz, 2H), 7.79 (d, J = 14 Hz, 2H), 7.67-7.48 (m, 6H), 7.39 (d, J = 7.2 Hz, 2H), 7.27-7.18 (m, 7H), 6.85-6.82 (m, 4H), 6.23-6.20 (m, 1H), 5.64 (d, J = 6.0 Hz, 1H), 5.44-5.41 (m, 1H), 5.08-5.07 (m, 1H), 4.82-4.77 (m, 1H), 4.56-4.46 (m, 3H), 4.364.30 (m, 2H), 4.22 (d, J = 7.2 Hz, 1H),3.98 (m, 1H), 3.89 (m, 1H), 3.71 (s, 7H), 3.59-3.55 (m, 2H), 3.40-3.34 (m, 10H), 3.02-2.98 (m, 2H), 2.77-2.72 (m, 2H), 2.08-2.05 (ni, 3H), 1.13-1.08 (m, 12H). 31P-NMR (162 MHz, DMSO-de) δ = 148.71, 148.11,67.51,67.44. ESI-LCMS: m/z
1392 [M+H]+.
[01681 Préparation of compound 11-2: To a solution of 10-6 (10.0 g, 7.7 mmol) in 100 mL acetonitrile with an inert atmosphère of nitrogen was added 0.5 M hydrazine hydrate (1.8 g, 37.5 mmol) in pyridine/acetic acid (3:2) at 0°C. The resulting solution was stirred for
0.5 h at 0°C. Then the reaction was added 2,4-pentanedione at once, the mixture was allowed to warm to room température and stirred for additional 15 min. The solution was diluted with
DCM (500 mL) and washed with sat. aq. NH4CI twice and washed with brine and dried over Na2SO4-Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silîca gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) - I/O; Detector, UV 254 nm. This resulted in 11-2 (7.5 g, 80%) as a white solid. ‘H-NMR (400 MHz, DMSO-dft) δ = 13.11 (s, 1H), 11.26 (s, 1H), 8.63 (d, J = 20 Hz, 2H), 8.20 (d, J = 7.2 Hz, 2H), 8.15 (m, 3H), 7.73 (s, 1H), 7.66-7.47. (m, 8H), 7.41 (d, J = 7.6 Hz, 2H), 7.32-7.19 (m, 10H), 6.85 (m, 5H), 6.24 (m, 1H), 5.99 (s, 1H), 5.54 (s, H), 5.41(m, 1H), 5.10(m, 1H), 4.79-4.75(m, 1H), 4.57-4.49 (m, 3H), 4.30-4.24 (m, 4H), 4.02 (m, 2H), 3.85 (m, 1H), 3.72 (s, 7H), 3.38-3.35 (m, 7H), 2.95 (m, 2H), 1.98 (m, 3H). 3IP-NMR (162 MHz, DMSO-d6) S = 66.79. ESI-LCMS: m/z 1192 [M+H]+.
[0169] Préparation of compound 11S: To a solution of 11-2 (7.0 g, 5.0 mmol) in 70 mL of dichloromethane with an inert atmosphère of nitrogen was added CEP[N(iPr)2]2 (2.0 g, 6.5 mmol) and DCI (0.6 g, 5.0 mmol) in order at room température. The resulting solution was stirred for 1 hours at room température and diluted with 1000 mL dichloromethane and washed with 2 x 250 mL of saturated aqueous sodium bicarbonate and 1 x 250 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until no residual solvent left under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) - 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (ü.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in 11S (6.3 g, 70%) as a white solid. ’H-NMR (400 MHz, DMSO-df)) δ = 13.10 (s, 1H), 11.27 (s, 1H), 8.65(s, 1H), 8.61(s, 1H), 8.19 (m, 2H),8.02(d, J = 7.2Hz,2H), 7.76-7.73 (m, 1H), 7.66-7.47 (m, 6H), 7.40 (d, J = 7.2 Hz, 2H), 7.28-7.19 (m, 7H), 6.86-6.85 (m, 4H), 6.24 (d, J = 6.8 Hz, 1H), 5.62 (m, 1H), 5.43-5.41 (m, 1H), 5.10 (s, 1H), 4.84-4.78 (m, 1H), 4.66-4.49 (m, 3H), 4.30-4.18 (m, 3H), 4.04-3.95 (m, 2H), 3.83-3.77 (m, 1H), 3.72 (s, 7H), 3.62-3.54 (m, 2H), 3.44-3.32 (m, 6H), 2.96-2.92 (m, 2H), 2.77-2.72 (m, 2H), 1.98-1.97 (m, 3H), 1.12-1.11 (m, 12H). 31P-NMR (162 MHz, DMSO-d6) δ = 148.53, 148.09, 67.04. ESI-LCMS: m/z 1392 [M+H]+.
[0170] As in Examples 175-216, the modified method also used a longer coupling time (8 min) and a greater number of équivalents of amidites (8 équivalents). Table 10 summarizes the sequence length, alternating A and C units, the number and type (R or S) of stereochemically defined phosphorothioate (PS) linkages, and 5’ modification for the resulting exemplified modified phosphorothioated oligonucleotides.
TABLE 10
No. Length A C PS Modification 5'-Modification
217 (AQ17 2’-OMe-A 2’-OMe-(5m)C 5; 2’-OMcApsR(5m)lnC OH
218 (AC) 18 2’-OMe-A 2’-OMe-(5m)C 6; 2’-OMeApsR(5m)lnC OH
219 (AC) 19 2’-OMe-A 2’-OMe-(5m)C 6; 2’-OMcApsR(5m)lnC OH
220 (AC)20 2’-0Me-A 2’-OMe-(5m)C 6; 2'-OMeApsR(5m)lnC OH
221 (AC)20 2’-OMe-A 2’-OMe-(5m)C 20; 2’-OMeApsR(5m)lnC OH
222 (AC) 17 2’-0Me-A 2’-OMe-(5m)C 5; 2’-OMeApsR(5m)lnC Vinylphosphonate-A
223 (AC)18 2’-OMe-A 2’-OMe-(5m)C 6; 2'-OMeApsR(5m)lnC Vinylp hosphon a te-A
224 (AC) 19 2’-0Me-A 2’-OMe-(5m)C 6; 2'-OMeApsR(5m)lnC Vinylphosphonate-A
225 (AC)20 2’-0Me-A 2’-OMe-(5m)C 6; 2'-OMcApsR(5m)hiC Vînylphosphonate-A
22(5 (AC)20 2’-0Me-A 2’-OMe-(5m)C 20; 2’-OMeApsR(5m)lnC Vinylphosphonate-A
227 (AC)17 2’-OMc-A 2’-OMe-(5m)C 5; 2’-OMeApsS(5m)inC OU
228 (AQ18 2’-0Me-A 2’-OMe-(5m)C 6; 2’-OMeApsS(5m)lnC OH
229 (AC)19 2’-OMe-A 2’-OMe-(5m)C 6; 2’-OMeApsS(5m)lnC OH
230 (AC)20 2’-0Me-A 2’-OMe-(5m)C 6; 2'-OMeApsS(5m)lnC OH
231 (AC)20 2’-OMe-A 2’-OMe-(5m)C 20; 2 ’ - OMe Aps S(5 m) 1 nC OH
232 (AC)17 2’-0Me-A 2’-OMc-(5m)C 5; 2’-OMcApsS(5m)!nC Vinylphosphonate-A
233 (AC)18 2’-0Me-A 2’-OMe-(5m)C 6; 2’-OMeApsS(5m)lnC Vinylp hospho n a te-A
234 (AC) 19 2’-OMe-A 2’-OMe-(5m)C 6; 2’-OMcApsS(5m)lnC Vinylphosphonate-A
EXAMPLES 235-240
[0171] The effect of branching was evaîuated by preparing a sériés of 10 phosphorothioated oligonucleotides having a branched doubler design in which two of the oligonucleotides are attached to one another via a linking group. An example of a phosphorothioated oligonucleotide having a doubler design îs illustrated in FIG. 1. Table 11 summarizes the sequence length, alternating A and C units, and 5’ modification for the resulting exemplified phosphorothioated oligonucleotides.
TABLE 11
No. Length A C 5 ’-Mod i fi c ati on
235 (AC)9-(5m)lnC LNA-A LNA-(5m)C 5’ OH, I9mer
236 (AC) 15-(5 in)lnC LNA-A LNA-(5m)C 5’ OH, 31mer
237 (AC)20-(5m)lnC LNA-A LNA-(5m)C 5’ OH, 4lmer
238 (AC)9-(5m)mC 2’-OMe-A 2’-OMe-(5m)C 5’ OH, 19mer
239 (AC)15-(5m)mC 2’-OMe-A 2’-OMe-(5m)C 5’ OH, 31mer
240 (AC)20-(5m)mC 2’-0Me-A 2’-OMe-(5m)C 5’ OH, 41mer
EXAMPLES 241-246
[0172] The effect of branching was evaluated by preparing a sériés of phosphorothioated oligonucleotides having a branched trebler design in which three phosphorothioated oligonucleotides are attached to one another via a linking group. An example of a phosphorothioated oligonucleotide having a trebler design is illustrated in FIG.
2. Table 12 summarizes the sequence length, alternating A and C units, and 5’ modification for the resulting exemplified phosphorothioated oligonucleotides.
TABLE 12
No. Length A C 5’-Modification
241 (AC)10-TREB-(5m)mC LNA-A LNA-(5m)C 5’ OH, 31 mer
242 (AC)13-TREB-(5m)mC LNA-A LNA-(5m)C 5’ OH, 40mer
243 (AC)15-TREB- (5m)mC LNA-A LNA-(5m)C 5’ OH, 46mer
244 (AC)10-TREB-(5m)mC 2’-OMe-A 2’-OMe-(5m)C 5’ OH, 31 mer
245 (AC) 13- TREB- (5m)mC 2’-OMe-A 2’-OMe-(5m)C 5’ OH, 40mer
246 (AC) 15- TREB- (5m)mC 2’-OMe-A 2’-OMe-(5m)C 5’ OH, 46mer
EXAMPLES 247-252
[0173] The effect of ami do-bridge nucleic acid (AmNA-(N-Me)) modification and spirocyclopropyiene-bridged nucleic acid (scp-BNA) modification was evaluated by preparing a sériés of modified phosphorothioated oligonucleotides. The AmNA-N-Me 6-Nbenzoyladenosine (ABz), 4-N-benzoyl -5-methyl cytidine were obtained from Luxna Biotech Co, Ltd and scp-BNA phosphoramidite monomers with 6-jV-benzoyIadenosine (ABz), 4-N20 benzoyl -5-methyl cytidine were synthesized by using the procedure described in the référencés Takao Yamaguchi, Masahiko Horiba and Satoslii Obika; Chem. Commun. 2015,51, 9737-9740, and Masahiko Horiba, Takao Yamaguchi, and Satoshi Obika; Journal of Organic Chemistry, 2016, 81, 11000-11008. The monomers were dried in a vacuum desiccator with desiccant (P2O5, at room température for 24 hours). For the AmNA and scp-BNA 5 modifications, the synthesis was carried out on a i μΜ scale in a 3’ to 5’ direction with the phosphoramidite monomers diluted to a concentration of 0.12 M in anhydrous CH3CN in the presence of 0.3 M 5-(benzylthio)-lH-tetrazole activator (coupling time 16-20 min) to a solid bound oligonucleotide followed by modified capping, oxidation and deprotection to afford the modified oligonucleotides. The stepwise coupling efficiency of ail modified phosphoramidites 10 was more than 97%. The DDTT (dimethylamino-methylidene) amino)-3H-l, 2, 4dithîazaoline-3-thione was used as the sulfur-transfer agent for the synthesis of the oligoribonucleotide phosphorothioates. Olîgonucleotide-bearing solid supports were washed with 20 % DEA solution in acetonitrile for 15 min then the column was washed thoroughly with AcCN. The support was heated at 65 nC with diisopropylamine:water:methanol (1:1:2) 15 for 5 h in a heat block to cleave from the support and deprotect the base labile protecting groups. Table 13 summarizes the sequence length, alternating A and C units, and 5’ modification for the resulting exemplified modified phosphorothioated oligonucleotides.
TABLE 13
No. Length A C 5’Modîfîcation
247 (AmAps(5m)AmC)2O AmNA(NMe)-A AmNA(NMe)-(5m)C 5’ OH, 40mer, Ail AmNA
248 (ScpAps(5m)scpC)20 Scp-BNA-A Scp-BNA-(5m)C 5’ OH, 4Ümer, Ali Scp-BNA
249 AmAps(5m)mC (AC)19 2’-0Me-A 2’-OMe-(5m)C One AmNA at 5’-end, 40mer
250 (AC) 19 -mAps(5m)AmC 2’-0Me-A 2’-OMe-(5m)C One AmNA at 3’-end, 40mer
251 ScpAps(5m)mC (AC)19 2’-OMe-A 2’-OMe-(5m)C One ScpA at 5’end, 40mer
252 (AC)19-mAps(5m)ScpC 2’-OMe-A 2’-OMe-(5m)C One ScpC at 3’end, 40mer
EXAMPLES 253-256
[0174] The effect of attaching a targeting ligand was evaluated by preparing a sériés of modified phosphorothioated oligonucleotides. The targeting ligands, cholestérol and a tocopherol (vitamin E), were attached to phosphorothioated oligonucleotides via an alkylene oxide linking group (tetraethylene glycol, TEG) in accordance with the methods described above in Examples 1-116 except that solid phase synthesis was conducted on cholestérol and tocopherol supports with attachment by a TEG linker for 3’-conjugation while final coupling of the phosphoramidite provided the 5’-conjugated oligonucleotides. FIGS. 3A-D and Table 14 illustrate the structures and summarize the sequence length, alternating A and C units, and targeting ligands for the resulting exemplified modified phosphorothioated oligonucleotides.
TABLE 14
No. Length A C Targeting Ligand
253 Chol-(AC)20 2’-OMe-A 2’-OMe-(5m)C 5’-ChoIesterol, 40mer
254 (AC)20- Chol 2’-OMe-A 2’-OMe-(5m)C 3’-Cholestérol, 40mer
255 Toco-(AC)20 2’-OMe-A 2’-OMe-(5m)C 5’-Tocopherol, 40mer
256 (AC)20-Toco 2’-OMe-A 2’-OMe-(5m)C 3’-Tocopherol, 40mer
EXAMPLES 257-268
[0175] The effect of attaching a targeting ligand was evaluated by preparing a 15 sériés of modified phosphorothioated oligonucleotides. N-acetylgalactosamine (GaiNac) was attached to phosphorothioated oligonucleotides via various linking groups by reacting with a GalNAc building block as illustrated in FIG. 4A. GalNAc-3 and GalNAc-5 amidites were purchased from AM Chemicals LLC and Glen Research respectively. GalNAc-4 and GalNAc6 were obtaîned from AM Chemicals LLC. Table 15 illustrâtes the structures and summarizes the sequence length, alternating A and C units, and targeting ligands for the resulting exemplified modified phosphorothioated oligonucleotides.
TABLE 15
No. Length A C Targeting Ligand
257 GalNAc3ps-GalNAc3ps- GalNAc3po-(AC)20 2’-0Me-A 2’-OMe-(5m)C 5’-GalNAc-3; 40mer
258 (AC)20-po-GalNAc3ps- GalNAc3ps-GalNAc3 2’-0Me-A 2’-OMe-(5m)C 3’-GalNAc-3; 40mer
No. Length A C Targeting Ligand
259 GalN Ac3ps -G al N Ac3 psGalNAc3po-(AC)20 LNA-A LNA-(5m)C 5’-GalNAc-3; 40mer
260 (AC)20-po-GalNAc3ps- GaJNAc3ps-GalNAc3 LNA-A LNA-(5m)C 3’-GalNAc-3; 40mer
261 Ga IN Ac4ps -G alN Ac4ps GalNAc4po-(AC)20 2’-O Me-A 2’-OMe-(5m)C 5’-GalNAc-4; 40mer
262 (AC)20-po-GalNAc4psGalNAc4ps-GalNAc4 2’-0Me-A 2’-OMe-(5m)C 3’-GalNAc-4; 40mer
263 G al N Ac4ps- Ga i N Ac4ps GalNAc4po(AC)20 LNA-A LNA-(5m)C 5’-GalNAc-4; 40mer
264 (AC)20-po-GalNAc4psG al N Ac4ps -Gai N Ac4 LNA-A LNA-(5m)C 3’-GalNAc-4; 40mer
265 Ga 1N Ac5 ps -Gai N Ac5ps- GalNAc5po-(AC)20 2’-0Me-A 2’-OMe-(5m)C 5’-GalNAc-5; 40mer
266 (AC)20-po-GalNAc5ps- GalNAc5ps-GalNAc5 2’-O Me-A 2’-OMe-(5m)C 3’-GalNAc-5; 40mer
267 G a 1N Ac5ps- Gai NAc5 psGalNAc5po-(AC)20 LNA-A LNA-(5m)C 5’-GalNAc-5; 40mer
268 (AC)20-po-GalNAc5psGalNAc5ps-GalNAc5 LNA-A LNA-(5m)C 3’-GalNAc-5; 40mer
EXAMPLES 269-272
[0176] The effect of attaching a targcting ligand was evaluated by preparing a sériés of modified phosphorothioated oligonucleotides. N-acetylgalactosamine (GalNAc) was 5 attached to phosphorothioated oligonucleotides via a linking group by preparing the starting oligonucleotides, forming a precursor by attaching a C6-NH2 linking group at the 5’-terminal, and then reacting the precursor with a GalNAc ester. The sequences were synthesized at 1Ü μιηοΐ scale using universal support (Loading 65 μιηοΐ/g). The C6-NH2 linker was attached to the 5’-terminal to form the precursor by reacting with 6-(4-monomethoxytritylamino)hexyΙΙΟ (2-cyanoethyl)-(N, N-diisopropyl)-phosphoramidite in 0.1 M acetonitrile was a coupling time of 10 min. The phosphorothioated oligonucleotide-bearing solid supports were heated at room température with aqueous ammonia/methy lamine (1;1) solution for 3 h in a shaker to cleave from the support and deprotect the base labile protecting groups.
[0177] After IEX purification and desalting, the precursors were dissolved in 0.2 15 M sodium bicarbonate buffer, pH 8.5 (0.015 mM) and 5-7 mol équivalent of GalNAc ester dissolved in DMSO was added. The structures of the GalNAc esters are rllustrated în FIG. 4B, The reaction mixture was stirred at room température for 4 h. The sample was analyzed to confirm the absence of precursor. To this aqueous ammonia (28 wt. %) was added (5x reaction volume) and stirred at room température for 2-3 h. The reaction mixture was concentrated 5 under reduced pressure and the resulting residue was dissolved in water and purified by HPLC on a strong anion exchange column.
[0178] Table 16 illustrâtes the structures and suinmarizes the sequence length, altemating A and C units, and targeting ligands for the resulting exemplified modified phosphorothioated oligonucleotides. GalNAc-1 and GalNAc-2 were prepared in accordance 10 with procedures described in J. Med. Chem. 2016 59(6) 2718-2733 and WO 2017/021385A1, respectively
TABLE 16
No. Length A C Targeting Ligand
269 Ga1NAcLNH-C6-po-(AC)20 2’-OMc-A 2’-OMc-(5m)C 5’-GalNAc-1; 4()mer
270 GalNAcl-NH-C6-po-(AC)20 LNA-A LNA-(5m)C 5’-GalNAc-l; 40iner
271 GalNAc2-NH-C6-po-(AC)20 2’-0Mc-A 2’-OMc-(5m)C 5VGaINAc-2; 40mer
272 GalNAc2-NH-C6-po-(AC)20 LNA-A LNA-(5m)C 5’-GalNAc-2; 40mer
EXAMPLES 273-281
[0179] The effect of 5’ modification was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with the methods described above, except that the following 5’-ethyl phosphonate (EP) building block was utilized to incorporate 5’ethyl phosphonate endcaps:
5’-Ethyl phosphonate (5’-EP) building block
5’-Ethyl phosphonate endcap
[0180] With reference to FIG. 5, the 5’-Ethyl phosphonate building block was prepared as follows:
[0181] To a mixture of 5-1 (3.0 g, 4.35 mmol, 1 eq) in MeOH (5 mL) was added Pd/C (900 mg, 72.50 umol, 10% purity) under N2. The suspension was degassed under 5 vacuum and purged with H 2 for several times. The mixture was stirred under H2 (15 psi) at 20 °C for 12 hr. *H NMR and 31P NMR showed 5-1 was consumed completely to form desired product. The reaction mixture was filtered and concentrated to give [2[(2R,3R,4R,5R)-5-(6-benzamidopuiin-9-yl)-3-hydroxy-4-methoxy-tetrahydrofuran-2yl]ethyl-(2,2-dimethylpropanoyloxymethoxy)phosphoryl]oxymethyl 2,2-dimethylpropanoate, 10 compound 5-2, (2.8 g, 4.05 mmol, 93.06% yield) as a white solid.*H NMR (400 MHz, CD^OD) δ = 8.75 (s, 1H), 8.53 (s, 1H), 8.08 (d,7=7.5 Hz, 2H), 7.68 - 7.61 (m, 1H), 7.59 - 7.5Ü (m, 2H), 7.23 - 7.17 (m, 1H), 7.15 - 7.10 (m, 1H), 6.15 (d, 7=4.2 Hz, 1H), 5.71 - 5.61 (m, 4H), 4.57 (t, 7=4.7 Hz, 1H), 4.41 (t, 7=5.3 Hz, 1H), 4.09 - 3.99 (m, 1H), 3.49 (s, 3H), 2.16-1.97 (m, 4H), 1.17 (d, 7=3.5 Hz, 18 H); 3IP NMR (162 MHz, CDjCN) δ = 32.91 (s, IP).
[0182] To a solution of 5-2 (2.3 g, 3.33 mmol, 1 eq) in DCM (30 mL) was added lH-îmidazole-4,5-dicarbonitrile (589.06 mg, 4.99 mmol, 1.5 eq) followed by 3bis(diisopropylamino)phosphanyloxypropaneiiitrile (2.00 g, 6.65 mmol, 2. Tl mL, 2.0 eq), and the mixture was stirred at 25 °C for 2 hr. TLC indicated that majority of 5-2 was consumed and one major new spot was formed. The reaction mixture was washed with H2O (50 mL*2) 20 and brine (50 mL*2), dried over Na2SOi, and concentrated to give a residue. The residue was purified by Flash-C-18 column using the following conditions: Column, C18 silica gel; mobile phase, water and acetonitrile (0%-70% acetonitrile) to give [2-[(2R,3R,4R,5R)-5-(6benzamidopurin-9-yl)-3-[2-cyanoethoxy-(diisopropylamino)phosphanyl]oxy-4-methoxytetrahydrofuran-2-yl]ethyl-(2,2-dimethylpropanoyloxymethoxy)phosphoryl]oxymethyl 2,225 dimethylpropanoate, (5’-EP building block), (1.4 g, 1.53 mmol, 45.88% yield, 97.2% purity) as a light yellow solid. LCMS (ESI): RT = 3.785 min, m/z calcd. for C40H6ÜN7O12P2 892.37 [M+H]+, found 892.0. HPLC: Mobile Phase: WmMol NH4Ac in water (solvent C) and acetonitrile (solvent D), sing the elution gradient 80%-100% (solvent D) over 10 minutes and holding at 100% for 5 minutes at a flow rate of 1.0 mL/minute; Column30: Waters Xbridge 30 C18 3.5um,150*4.6mm; Tl NMR (400MHz, CD3CN) δ = S = 9.4Û (s, 1H), 8.67 (s, 1H), 8.27 (d, 7=1.8 Hz, 1H), 8.01 (d, 7=7.5 Hz, 2H), 7.68 - 7.60 (m, 1H), 7.58 - 7.52 (m, 2H), 6.05 (dd, /=5.1, 8.4 Hz, 1H), 5.62 - 5.54 (m, 4H), 4.68 (t, J=1.8,5.0 Hz, 1H), 4.64 - 4.55 (m, 1H), 4.25 - 4.11 (m, 1H), 3.93 - 3.66 (m, 4H), 3.40 (d,/=19.2 Hz, 3H), 2.75 - 2.67 (m, 2H), 2.14 - 1.95 (m, 4H), 1.25 - 1.20 (m, 12H), 1.15 - 1.11 (m, 18H); 31P NMR (162MHz, CD3CN) δ = 149.95 , 149.27, 32.29,32.05.
[0183] Table 17 summarîzes the sequence length, alternating A and C units, the number and type (R or S) of stereochemically defined phosphorothîoate (PS) linkages and LNA modification for the resulting exemplified 5’-EP endcapped modified phosphorothioated oligonucleotides.
TABLE 17
No. Length A C PS Modification Comments
273 (AC)20 2'O-Me-A 2’-OMe-(5m)C PS 40 mer
274 (AC)20 LNA-A LNA-(5m)C PS 40 mer
275 (AC)20 2’-0Me-A 2’-OMe-(5m)C 20; 2’-OMeApsR(5m)lnC 20 R isomer, 4tmer
276 (AC)20 2’-0Me-A 2’-OMe-(5m)C 19; 2’-OMcApsR(5ni)lnC 19 R îsomer, 40mer
277 (AC)20 2’-OMe-A LNA-(5m)C PS 40m er Alternate 2’-OMe/LNA
278 (AC)20 2’-0Mc-A LNA-A 2’-OMe-(5m)C LNA-(5m)C PS Every 3rd base is LNA
279 (AC)20 2’-0Me-A 2’-OMe-(5m)C LNA-(5m)C PS Every 4ih base is LNA
280 (AC)20 2’-OMc-A 2’-OMe-(5m)C LNA-(5m)C PS 5 LNA in the middle
281 (AC)20 2?-OMe-A LNA-A 2’-OMe-(5m)C LNA-(5m)C PS 10 LNA in the middle
EXAMPLES 282-298
[0184] FIG.- 6A describes compound nos. 282-295, which were prepared in accordance with the methods described above.
EXAMPLES 296-304
[0185] The effect of sequence length, LNA incorporation, and RNA incorporation was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 18.
TABLE 18
No. Length A C RNA Modification
296 (AC)20 2’-OMe-A LNA-(5m)C 5 RNA
297 (AC)20 2’-OMe-A 2’-OMe-(5m)C 7 RNA
298 (AC)20 2’-OMe-A 2’-OMe-(5m)C 14 RNA
299 (AC) 15 2’-OMe-A 2’-OMe-(5m)C 5 RNA
300 (AC) 15 2’-0Me-A 2’-OMe-(5m)C 10 RNA
301 (AC)20 LNA-A LNA-(5m)C 7 RNA
302 (AC)20 LNA-A LNA-(5m)C 14 RNA
303 (AC) 15 LNA-A LNA-(5m)C 5 RNA
304 (AC) 15 LNA-A LNA-(5m)C 10 RNA
EXAMPLES 305-313
[0186] The effect of sequence length, LNA incorporation, and backbone was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with the 5 methods described above. The results are summarized in Table 19.
TABLE 19
No. Length A C Backbone
305 (AC)20 LNA-A LNA-(5m)C 40mer; 20 PO; 19 PS
306 (AC)20 LNA-A LNA-(5m)C 40mer; 7 PO; 32 PS
307 (AC)20 LNA-A LNA-(5m)C 40mer; 14 PO; 25 PS
308 (AC)15 LNA-A LNA-(5m)C 30mcr; 5 PO; 24 PS
309 (AC)15 LNA-A LNA-(5m)C 30mcr; 10 PO; 19 PS
310 (AC)20 2’-OMe-A 2’-OMe-(5m)C 40mcr; 7 PO; 32 PS
311 (AC)20 2’-OMe-A 2’-OMe-(5m)C 40mer; 14 PO; 25 PS
312 (AC) 15 2’-0Me-A 2’-OMe-(5m)C 30mer; 5 PO; 24 PS
313 (AC) 15 2’-OMe-A 2’-OMe-(5m)C 30mcr; 10 PO; 19 PS
EXAMPLES 314-322 (0187] The effect of sequence length, LNA incorporation, and ethyl phosphonate 10 endcap was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 20.
TABLE 20
No. Length A C Modification
314 (AC)20 2’-0Me-A LNA-(5m)C Ethyl-phosphonate-A
315 (AC)20 2’-OMe-A 2’-OMe-(5m)C 19 R dimer block; E Lh y Lp h os p h 0 nate-A
316 (AC)20 2’-OMc-A 2’-OMe-(5m)C 5 LNA, Ethyl-phosphonate-A
317 (AC)20 2’-OMc-A 2’-OMe-(5m)C LNA-(5m)C 40mer; Every 4lh base is LNA Ethyl-phosphonate-A
318 (AC)20 2’-0Me-A 2’-OMe-(5m)C LNA-(5m)C 40mer; Every 3rd base is LNA Ethyl-phosphonate-A
319 (AC)20 2’-0Mc-A 2’-OMe-(5m)C 4ümer; Ethyl-phosphonate-A
320 (AC) 18 2’-0Me-A LNA-(5m)C 36mer; Alternate 2’-0Me and LNA
321 (AC)20 2’-0Me-A LNA-A 2’-OMe-(5m)C LNA-(5m)C 36mer; Every 3rd base is LNA
322 (AC)20 2’-0Me-A LNA-(5m)C 36mcr; Every 4lh base is LNA
EXAMPLES 323-324
[0188] The effect of LNA incorporation and phosphate endcap was evaluated by preparing phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 21.
TABLE 21
No. Length A C Endcap
323 (AC)20 LNA-A LNA-(5m)C 5’-Phosphate
324 (AC)20 2’-OMe-A 2’-OMe-(5m)C 5’-Phosphate
EXAMPLES 325-338
[0189] The effect of level of LNA incorporation was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with lhe methods described above. The results are summarized în Table 22.
TABLE 22
No. Length A c Modification
325 (AC)20 2’-0Me-A LNA-A 2’-OMe-(5m)C LNA-(5m)C 40mer; 75% 2’-O Me, 25% LNA
326 (AC)20 2’-0Me-A LNA-A 2'-OMe-(5m)C LNA-(5m)C 40mer; 67.5% 2’-0Me 37.5% LNA
327 (AC)20 2’-O-MOE-A LNA-A 2’-O-MOE-(5m)C LNA-(5m)C 40mer; 75% 2’-O-MOE, 25% LNA
No. Length A C Modification
328 (AC)20 2’-0-M0E-A LNA-A 2’-O-MOE-(5m)C LNA-(5m)C 40mer; 67.5% 2’-0-M0E 37.5% LNA
329 (AC)20 2’-0Me-A LNA-A 2’-OMe-(5m)C LNA-(5m)C 40mer; 75% LNA, 25% 2’-0Me (lOmer block)
330 (AC)20 2’-0Me-A LNA-A 2’-OMe-(5m)C LNA-(5m)C 40mer; 50% LNA; 50% 2’-OMe(20mer block)
331 (AC)20 2’-O-MOE-A LNA-A 2’-O-MOE-(5m)C LNA-(5m)C 40mer; 75% LNA, 25% 2’-O-MOE (lOmer block)
332 (AC)20 2’-O-MOE-A LNA-A 2’-O-MOE-(5m)C LNA-(5m)C 40mer; 50% LNA; 50% 2’-O-MOE (2Ümer block)
333 (AC)20 LNA-A DNA-A LNA-(5m)C DNA-(5m)C 40mer; 7 DNA
334 (AC)20 LNA-A DNA-A LNA-(5m)C DNA-(5m)C 40mer; 14 DNA
335 (AC)20 LNA-A DNA-A LNA-(5m)C DNA-(5m)C 30mer; 5 DNA
336 (AC)20 LNA-A DNA-A LNA-(5m)C DNA-(5m)C 30mer; 10 DNA
337 (AC)20 LNA-A DNA-A LNA-(5m)C DNA-(5m)C 40mer; 50% LNA; 50% DNA (lOmer DNA block)
338 (AC)20 LNA-A DNA-A LNA-(5m)C DNA-(5m)C 40mer; 50% LNA; 50% DNA (20mer DNA block)
EXAMPLES 339-340
[0190] The effect of ScpA and AmNA incorporation was evaluated by preparing phosphorothioated oligonucleotides in accordance with the methods described above. The resuïts are summarized in Table 23.
TABLE 23
No. Length A C Modification
339 (AC)20 2’-OMe-A LNA-(5m)C One ScpA at 3’-end, 40mer
340 (AC)20 2’-OMe-A LNA-(5m)C One AmNA at 3’-end, 40mer
EXAMPLES 341-346
[0191] The effect of GNA and UNA incorporation was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 24.
TABLE 24
No. Length A C
341 (AC)20 LNA-A GNA-(5m)C
342 (AC)20 GNA-A 2’-OMe-(5m)C
343 (AC)20 2’-OMe-A GNA-(5m)C
345 (AC)20 UNA-A UNA-(5m)C
346 (AC)20 UNA-A UNA-(5m)C
EXAMPLES 347-350
[0192] The effect of attachîng a targeting ligand was evaluated by preparing a sériés of modified phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 25.
TABLE 25
No. Length A C Modification
347 GalNAc5ps-GalNAc5psGalNAc5po-(AC)20 2’-OMe-A LNA-(5m)C 40mer, alternats 2’-OMe-LNA; 5’-GalNac
348 GalNAc5ps-GalNAc5ps- GalNAc5po-(AC)2O 2’-0Me-A 2’-OMc-(5m)C LNA-(5m)C 40111 er, every 41 base is LNA; 5’-GalNac
349 GalNAc5ps-GalNAc5psGalNAc5po-(AC)20 2’-0Me-A 2’-OMe-(5m)C LNA-A 40mer, 5 LNA; 5’-GalNac
350 GalNAc5ps-GalNAc5ps- GalNAc5po-(AC)20 2'-0Me-A LNA-(5m)C 40mer, alternate 2’-0Me-LNA 5 RNA; 5’-GalNac
EXAMPLES 351-355
[0193] The effect of attaching a cholestérol or tocopherol targeting ligand was evaluated by preparing a sériés of modified phosphorothioated oligonucleotides in accordance 15 with the methods described above. The results are summarized in Table 26.
TABLE 26
No. Length A C Targeting Ligand
351 Chol-(AC)20 2’-OMe-A (5m)-Propargyl-C 3’-Cholesterol, 40mer
352 (AC)20- Chol 2’-0Me-A (5m)-Propargyl-C 3’-Palmitoyl, 40mer
353 (AC)20 3’-OMe-A 3’-OMe-(5m)C 3’-OMes 40mer
354 (AC)20- Chol 3’-0Me-A 3’-OMe-(5m)C 3’-cholesterol, 40mer
No. Length A C Targeting Ligand
355 (AC)20- Toco 3’-OMe-A 3’-OMe-(5m)C 3’-Tocopherol, 40mer
EXAMPLES 356-358
[0194] The effect of endcap structure (methyl, allyl, cytosine) was evaluated by preparing phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 27.
TABLE 27
No. Length A C Endcap
356 (AC)20 2’-OMe-A LNA-(5m)C 40mer, 4’-Me at 5’end
357 (AC)20 2’-OMe-A 3’-C-allyl-A LNA-A LNA-(5m)C 40mer, 5 3’-C-allyl-A
358 (AC)20 LNA-A LNA-(5m)C 40mer, Cy-5 at 3’-end
EXAMPLES 359-362
[0195] The effect of including G and U bases was evaluated by preparing phosphorothioated oligonucleotides in accordance with the methods described above. The compounds are summarized in Table 28.
TABLE 28
No. Length Base 1 Base 2 Modification
359 (AG)20 2’-OMe-A 2’-OMe-G AG repeat
360 (GA)20 2’-OMe-G 2’-OMe-A GA repeat
361 (CA)20 2’-OMe-(5m)C 2’-OMe-A CA repeat
362 (AU)20 2’-OMe-A 2’-OMe-U AU repeat
EXAMPLES 363-376
[0196] The effect of sequence length was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with the methods described above. The compounds are summarized in Table 29.
TABLE 29
No. Length A C Modification
363 (AC) 14 2’-OMe-A 2’-OMe-C 28mer
364 (AC)I5-A 2’-OMe-A 2’-OMe-(5m)C 31 mer
No. Length A C Modification
365 (AC) 17 2’-OMe-A 2’-OMe-(5m)C 34mer
366 (AC)18-A 2’-OMe-A 2’-OMe-(5m)C 37mer
367 (AC)20 2’-OMe-A 2’-OMe-C 20mer
368 (AC)9 2’-OMe-A 2’-OMe-(5m)C 18mer
369 (AC)9-A 2’-OMe-A 2’-OMe-(5m)C 19mer
370 (AC) 10 2’-0Me-A 2’-OMe-(5m)C 20mer
371 (AC)9-A LNA-A LNA-(5m)C 19mer
372 (AC)9 LNA-A LNA-(5m)C ISmer
373 (AC) 15 LNA-A LNA-(5m)C 30mer
374 (AC)12-A 2’-OMe-A 2’-OMe-(5m)C 25mer
375 (AC)20 2’-OMe-A 2’-OMe-(5m)C 40mer, 5 S isomers
376 (AC) 10 LNA-A LNA-(5m)C 20 mer
EXAMPLES 377-380 AND 384
[0197] The effect of RNA incorporation was evaluated by preparing a séries of phosphorothioated oligonucleotides in accordance with the methods described above. The 5 results are summarized in Table 30.
TABLE 30
No. Length A C Modification
377 (AC)20 2’-OMe-A Ribo-A LNA-(5m)C 40mer, 4 RNA
378 (AC)20 2’-OMe-A Ribo-A LNA-(5m)C 40mer, 3 RNA
379 (AC)20 2’-OMe-A Ribo-A LNA-(5m)C 40mer, 2 RNA
380 (AC)20 2’-OMe-A UN A-A 2’-OMe-(5m)C UNA-(5m)C 40mer, 4mer blocks of 2’-OMe and UNA
384 (AC)20 2’-OMe-A Ribo-A LNA-(5m)C 40mer, 1 RNA
EXAMPLES 381-383
[0198) The effect of 4etl (4-ethyl-LNA) incorporation was evaluated by preparing 10 a sériés of phosphorothioated oligonucleotides in accordance with the methods described above. The 4etl monomers were prepared in accordance with known methods (Seth, P.P., J. Org, Chem. 2010, 75, (5), 1569—1581). The results are summarized in Table 31.
TABLE 31
No. Length A C Modification
381 (AC)20 4etl-A 4etl-(5m)C 40mer, 100% 4etl
382 (AC)20 2’-O Me-A 4etl-(5m)C 40mer, 50% 4etl
383 (AC)20 2’-0Me-A 2’-OMe-(5m)C 4etl-(5m)C 40mer, 25% 4etl
EXAMPLES 385-389
[0199] The effect of nmLNA (N-methyl LNA) A and C incorporation was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with the 5 methods described above. The nmLNA monomers were obtained from commercial sources (Βίο-Synthesis Inc., Lewisville, TX). The results are summarized in Table 32.
TABLE 32
No. Length A C Modification
385 (AC)20 2’-OMe-A nmLNA-A LNA-(5m)C 40mer, 1 nmLNA
386 (AC)20 2’-0Me-A nmLNA-A LNA-(5m)C 40mer, 3 nmLNA
387 (AC)20 2’-OMe-A nmLNA-A LNA-(5m)C nmLNA (5m)-C 40mer, 3 nmLNA
388 (AC)20 2’-OMe-A LNA-(5m)C nmLNA (5m)-C 40mer, 3 nmLNA
389 (AC)20 2’-0Me-A nmLNA-A LNA-(5m)C nmLNA (5m)-C 40mer, 4 nmLNA
EXAMPLES 39Ü-392
[0200] The effect of AmNA and Scp-BNA A and C incorporation was evaluated by preparing a sériés of phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 33 (also see Table 23).
TABLE 33
No. Length A C Modification
390 (AC)20 2’-OMe-A AmNA-(5m)C 40mer, 20 AmNA(50%)
No. Length A C Modification
391 (AC)20 2’-OMe-A 2’-OMe-(5m)C Scp-(5m)C 40mer, 10 scp-BNA (25%)
392 (AC)20 2’-OMe-A Scp-A 2’-OMe-(5m)C 40mer, 5 scp-BNA (12.5%)
EXAMPLE B1
HBSAG SECRETION ASSAY AND CYTOTOXICTY ASSAY
[0201] The sequence independent antiviral activity against hepatitis B (as determined by HBsAg Sécrétion Assay) and the cytotoxicity of a number of exemplified modified oligonucleotide compounds was determined as described below and summarized in Tables 34-35 and FIGS. 6A and 6B.
HBsAg Release Assay Protocol
Cell Culture
[0202] HepG2.2.15 cells were maintained in DMEM medium with 10% fêtai bovine sérum (FBS) and 1% penicillin/streptomycm, 1% Glutamine, 1% non-essential amino acids, 1% Sodium Pyruvate and 3S0 ug/ml G418. Cells were maintained at 37°C in a 5% CO2 atmosphère.
HBsAg Sécrétion Assay
[0203] HepG2.2.15 cells were grown in DMEM medium as described above. Cells were plated at a concentration of 45,000 cells/well in collagen-I coated 96 well plates. Immediately after addition of the cells, test compounds are added.
[0204] Selected compounds may also be tested following Lipofectamine® RNAiMAX transfection. Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher) is used following the manufacturées instructions.
[0205] The 50% inhibitory concentration (EC50) and 50% cytotoxic concentration (CCîû; below) were assessed by solubilizing in 1 X PBS to 100 X the desired final testing concentration. Each compound was then serially diluted (1:3) up to 8 distinct concentrations to 10X the desired final testing concentration in DMEM medium with 10% FBS. A 10 pL sample of the 10X compounds in cell culture media was used to treat the HepG2.2.15 cells in a 96-well format. Cells were initially incubated with compounds for 3 days at 37°C in a 5% COj atmosphère.
[0206] Three days post compound addition/transfection replace media and compound with fresh media/compound with RNAiMax and incubate for a further 3 days for a total incubation lime of 6 days. Collect both the cellular supernatant and cell lysate (see below) for quantification of HBsAg.
[0207] Secreled HBsAg was measured quantitatively using HBsAg ELIS A kit (Autobio-CL0310).
[0208] The EC50, the concentration of the drug required for reducing HBsAg sécrétion by 50% in relation to the untreated cell control value was calculated from the plot of the percentage réduction of the HBsAg level against the drug concentrations using Microsoft 10 Excel (forecast function).
[02091 Set up a parallel set of plates that are to be used for testing compound induced cellular cytotoxicity (see below).
Cytotoxicity Assay
[02101 HepG2.2.15 cells were cultured and treated as above. At Day 6, cellular cytotoxicity was assessed using a cell prolifération assay (CelITiter-Glo Luminescent Cell Viability Assay; Promega) according to the manufacturer’s instructions or a suitable alternative.
[0211] The CCso, the concentration of the drug required for reducing cell viability by 50% in relation to the untreated cell control value was calculated from the plot of the 20 percentage réduction of viable cells against the drug concentrations using Microsoft Excel (forecast function).
TABLE 34 - POTENCY AND CYTOTOXICITY
Compound No· ECsü (μΜ) CC50 (μΜ)
3 B A
6 A B
8 B A
9 A A
10 A A
12 A A
13 B A
18 C A
20 B B
23 B B
26 C A
34 B A
Compound No. ECsü (μΜ) CCso (μΜ)
36 B A
38 A A
39 B C
44 A A
45 A A
63 B A
97 B A
98 B A
99 B A
105 B A
106 B A
120 C A
121 B A
122 B A
127 B A
128 D A
129 D A
130 B A
134 A A
142 C A
147 D A
148 D A
149 B A
150 A A
151 D A
152 D A
153 B A
158 B A
159 C A
178 A A
179 A A
180 A A
182 A A
183 A A
184 A A
190 B A
191 B A
192 A A
199 B A
200 C A
201 B A
202 B A
204 B A
205 B A
100
Compound No. ECso (μΜ) CCso (μΜ)
220 C A
221 A A
223 C A
235 D B
236 D B
237 A B
238 D A
239 D A
240 B A
241 B A
242 A A
243 A A
244 C A
245 D A
[0212] Potency: A; > 5~fold higher than (2’-0Me-A; 2’-OMe-C); B: > 2-fold higher than (2’-OMe-A; 2’-0Me-C) and < 5-fold higher than (2’-0Me-A; 2’-0Me-C); C: higher than or equal to (2’-OMe-A; 2’-0Me-C) and < 2-fold higher than (2’-0Me-A; 2’-0MeC); D: lower than (2’-OMe-A; 2’-OMe-C).
[0213] Cytotoxicity; A: > 2 μΜ; B; < 2 μΜ
TABLE 35 - POTENCY AND CYTOTOXICITY
Compound No.1 ECso CCso
6, 274, 283 A B
376 D A
371 D A
372 D A
273, 282 D A
367 C A
368 D A
369 D A
370 D A
345 B A
346 A A
351 D B
352 D B
373 B B
308 C A
239 D A
235 D B
236 D B
101
Compound No.1 ECso CC5y
237 A B
3Ü1 A B
303 B B
305 C A
315 C A
309 D B
297 C A
298 D A
300 D A
312 D A
313 D A
299 D A
304 D A
302 D A
307 D A
375 B A
201 C A
202 C A
203 B A
204 D A
205 D A
353 B A
351 D A
352 D A
178 A A
179 A A
180 C A
182 A A
183 D A
184,290 A A
177 B A
374 D A
363 D A
364 D A
365 D A
366 D A
238 D A
240 B A
241 B A
242 A A
102
Compound No? ECse CCso
243 A A
130 A A
380 D A
310 D A
311 D A
254 D A
325 D A
326 D A
327 D A
328 D A
158 B A
150 A A
159 C A
341 D A
342 B A
244 C A
245 C A
343 B A
329 C A
330 B B
331 D A
332 D A
333 B A
334 B A
335 C A
336 C A
337 A B
338 B B
117 B A
118 B A
134,277, 284 A A
142 C A
190 B A
191 B A
192 B A
210 B A
211 B A
212 B A
218 C A
223 C A
103
Compound No? ECso CC50
221 A A
127 D A
128 C A
129 C A
120 B A
121 B A
122 A A
181 C A
147 D A
148 D A
149 B A
151 D A
152 D A
153 B A
294 B A
276,291 A A
275, 295 A B
173, 293 A A
165, 287 B A
167, 289 B A
164,286 C A
166,288 A A
171,280, 292 B A
314 A B
281, 316 A A
296 A A
285 A B
251 A A
356 A A
320 A A
321 A B
322 B A
317 A B
318 B B
319 A B
357 A A
339 A A
252 A A
340 A A
250 A A
104
Compound No.1 ECîo CC5W
359 D A
360 D A
361 D A
362 D A
12 A A
20 B A
38 A A
385 A A
386 A A
387 A A
388 A A
389 A A
376 A A
377 A A
378 A A
379 A A
384 A A
381 A A
382 A A
383 B A
390 A B
391 A B
392 B B
[0214] 1 A number of compounds described herein are referred to by more than a single compound no. as indicated here and elsewhere throughout the disciosure.
[0215] Potency: A: EC50 < 30 nM; B: ECso^O nM and EC5o < 100 nM; C: EC5o>
100 nM and EC50 < 300 nM; D: EC50 > 300 nM.
[0216] Cytotoxicity: A: CC50 > 1000 nM; B: CC5Ü < 1000 nM
EXAMPLE B2
L1VE INFECTION ASSAY
[0217] HepG2-NTCP cells were maintained in DMEM/F12 medium with 10% fêtai bovine sérum (FBS) and 1% penicillin/streptomycin, 1% Glutamine, 1% non-essential amino acids, 1% Sodium Pyruvate. Cells were maintained at 37°C in a 5% CO2 atmosphère.
105
[0218] HepG2-NTCP cells were resuspended with above mentioned medium and plated at a concentration of 15,000 cells/well in collagen-1 coated 96 well plates. On the second day (day 0), the cells were infected with HBV (purifieci HBV from HepAD38 cells) at 200 moi (ge) in the presence of 4% PEG8000 and 2% DMSO and incubated at 37°C overnight. The 5 inoculum was vacuumed and cells were washed three limes with DMEM/F12 with 2% FBS before replacing with the HepG2~NTCP culture medium.
[0219] Treat the cells on day 5. On Day 5, the test compounds were diluted 3-fold with Opti-MEM I media and mixed with Lipofectamine® RNAiMAX transfection reagent following the manufacturer's instructions. After media replacement on Day 8, the test 10 compounds were transfected as described. After incubation for an additional 3 days, the supernatant was harvested and HBsAg was measured by ELISA (Diasino). The cell viability was measured with CellTiter-Glo (Promega).
[0220] The EC50, the concentration of the drug required for reducing HBsAg sécrétion by 50% in relation to the untreated cell control value, was calculated from the plot of 15 the percent réduction of the HBsAg level against the drug concentrations using the Microsoft Excel forecast function or GraphPad Prism and summarized in Table 36.
TABLE 36 - POTENCY AND CYTOTOXICITY
Compound No. ECso CCso
6,274, 283 A A
273, 282 C A
315 D A
290 184 A A
134,277, 284 A A
192 A A
221 A A
294 C A
291 276 A A
295 275 B A
173,293 B A
165, 287 A A
167,289 B A
164, 286 B A
106
Compound No. ECso CC50
166, 288 B A
171,280, 292 B A
314 A A
281,316 C A
296 A A
285 A A
251 B A
356 A A
320 A A
[0221] Potency: A: EC50 < 30 nM; B: EC5o >.30 nM and EQo < 100 nM; C: EC50 ^100 nM and ECSÜ< 300 nM; D: EC50 > 300 nM.
[0222] Cytotoxicity: A: CC5o> 1000 nM; B: CC50 < 1000 nM
EXAMPLE B3
HBSAG SECRETION ASSAY FOR COMBINATIONS
[0223] The sequence independent antiviral activity against hepatitis B (as determined by HBsAg Sécrétion Assay) of exemplified modified oligonucleotide compounds 10 in combination with antisense oligonucleotides (ASOs) was determined as described below and summarized in Table 37.
Cell Culture
[0224] HepG2.2.15 cells were maintained in DMEM/F12 medium with 10% fêtai bovine sérum (FBS) and 1% penicillin/streptomycin, 1% Glutamine, 1% non-essential amino 15 acids, 1% Sodium Pyruvate. Cells were maintained at 37°C in a 5% CO2 atmosphère.
HBsAg Sécrétion Assay
[0225] HepG2.2.15 cells were grown in DMEM/F12 medium as described above.
Cells were seeded at a concentration of 35,000 ceils/well in collagen-I coatcd 96-well plates. Immediately after addition of the cells, add test compounds. Do double transfections on day 0 20 and 3.
Transfection method
[0226] Lipofectamine® RNAiMAX transfection. Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher, cat#: 13778-150) is used following the manufacturer’s instructions.
107
[0227] A: mix RNAiMAX (0.3ul/well for 96-well plate) with Opti-MEM I (make 20% extra), incubate for 5 min at RT.
[0228] B: dilute combinations of ASOs and modified oligonucleotides in OptiMEM I to make 40x of final concentration (8-point, 3-fold dilution, include concentration 5 OnM). The top concentration is about 100 - 200 folds of EC50 value. Then mix equal volume dilutions from both compound ! and compound2 at opposite direction as indicated in the graph shown in FIG. 23.
[0229] Mix A and B at equal volume (make 20% extra volume), incubate another 5-10 min. Then add mixture of A and B at 1/10 of the final culture volume to each well, swirl lü the plates for 10 seconds by hand. There should be at least triplicate for the plates. Incubate at 37oC for 3 days, refresh medium, repeat the transfection process. On day 6 upon treatment, harvest supernatant for ELISA assay, measure cell viability with CellTiter-Glo (Promega). Data analysis
[0230] To analyze the synergism, the percentage of HBsAg (or DNA) réduction is calculated for each well. Percentage of réduction = (1-well/average of no drug control)*100.
These numbers are input to MacSynergy II software and the synergism/antagonism volume is obtained following the instruction of the software.
[0231] Synergy volume <25 indicates no synergism/antagonism.
[0232] Synergy volume 25-50 indicates minor synergism/antagonism.
20 [0233] Synergy volume 50-100 indicates mode rate synergism/antagonism.
[0234] Synergy volume >100 indicates strong synergism/antagonism.
[0235] Synergy volume >1,000 indicates possible errors, check the data.
[0236] Percentage of cell viability = (well/average of no drug control)* 100.
Monitor cytotoxicity as previously described.
HBsAg Quantification
[0237] Secreted HBsAg was measured quantitatively using HBsAg ELISA kit (Autobio-CL0310). Synergy values for combinations of modified oligonucleotides with ASOs are provided in Table 37.
TABLE 37 - SYNERGY OF COMBINATIONS
Compound No. ASO1 HBsAg 95% Synergy Volume
166,288 ASO-i 335.08
108
Compound No. ASO1 HBsAg 95% Synergy Volume
134,277,284 ASO-2 52.98
296 ASO-2 43.05
^SO-l is an unconjugated HBV ASO SSO-1 as disclosed in in Javanbakht, H. et al.
Molecular Therapy: Nucleic Acids Vol. 11 June 2018, having the following structure: 5lnApslnGpsln(5m)CpsGpsApsApsGpsTpsGps(5m)CpsAps(5m)CpsApsln(5m)CpslnGpsl nG-3. ASO-2 is an ASO having a structure as described for the ASO referred to as
Sequence #9 in U.S. application serial number 62/855,793, which is hereby incorporated herein by reference and particularly for the purpose of describing the structure of the Sequence #9.
EXAMPLE B4
HBSAG SECRETION ASSAY FOR COMBINATIONS
IÜ [0238] The sequence independent antiviral activity against hepatitis B (as determined by HBsAg Sécrétion Assay) of exemplified modified oligonucleotide compounds in combination with an ASO, capsid assembly modulators (CAM compound 1 or CAM compound 2), or nucleosîde analog (Entecavir, ETV) was determined as described below and summarized in Table 38.
Cell Culture
[0239] The following assay procedure describes the HBV antiviral assay. This assay uses HepG2.2.15 cells, which hâve been transfected with HBV genome, and extracellular HBV DNA quantification as endpoint. Cell viability is assessed in parallel by measuring the intracellular ATP content using the CellTiter-Glo® reagent from Promega.
HBsAg Sécrétion Assay
[0240] HepG2.2.15 cells were grown in DMEM/F12 medium as described above.
Cells were seeded at a concentration of 35,000 cells/well in collagen-I coated 96-weil plates. Immediately after addition of the cells, add test compounds. Do double transfections on day 0 and 3.
HBV DNA quantification assay
[0241] Extracelluiar DNA was isolated with QIAamp 96 DNA Blood Kit per the manufacturer’s manual. HBV DNA was then quantified by qPCR with HBV spécifie primers and probes as specified below using the FastStart Universal MasterMix from Roche on an AB120592
109
7900HT. The PCR cycle program consisted of 95“C for 10 min, followed by 40 cycles at 95 °C for 15 sec and 60°C for 1 min.
Items Name Sequence <5’—>3’)
HBV Primer HBVforward GTGTCTGCGGCGTTTTATCA
HBVreverse GACAAACGGG CAACATACCTT
HBV Probe HBV probe FAM-CCTCTKCATCCTGCTGCTATGCCTCATC- TAMRA
Transfection method
[0242] Lipofectamine® RNAiMAX transfection. Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher, cat#: 13778-150) is used following the manufacturées instructions.
[0243] A: mix RNAiMAX (0.3ul/well for 96-well plate) with Opti-MEM I (make 20% extra), incubate for 5 min at RT
[0244] B: dilute combinations of a CAM, ASO or ETV with modified oligonucleotides in Opti-MEM I to make 40x of final concentration (8-point, 3-fold dilution, include concentration OnM). The top concentration is about 100 — 200 folds of ECso value. Then mix equal volume dilutions from both compoundl and compound2 at opposite direction as îndicated in the graph shown in FIG. 23.
[0245] Mix A and B at equal volume (make 20% extra volume), incubate another 5-10 min. Then add mixture of A and B al 1/10 of the final culture volume to each well, swirl the plates for 10 seconds by hands. There should be at least triplicate for the plates. Incubate at 37°C for 4-hrs before adding the ASO, ETV or CAMs to let the cells recover from tranfection. On day 3 upon treatment, harvest supernatant for ELIS A assay, measure cell viability with CellTiter-Glo (Promega).
Data analysis
[0246] The synergism data was analyzed as described in Example B3 above.
HBsAg Quantification
110
[0247] Secreted HBsAg was measured quantitative ly using HBsAg ELISA kit (Autobîo-CL0310). Synergy values for combi nations of modified oligonucleotides with ASOs are provided in Table 38.
TABLE 38 - SYNERGY OF COMBINATIONS
Compound No. ASO, CAM or ETV1 HBV DNA HBV DNA 95% Synergy Volume
166, 288 ASO-1 Additive 23.99
134, 277, 284 ETV Synergy 25.91
134,277, 284 CAM compound 1 Additive 1.35
134,277, 284 CAM compound 2 Synergy 41.86
'CAM compound 1 is a CAM having a structure as described for the CAM compound referred to as compound 3 in WO2017/181141, which is hereby incorporated herein by reference and particularly for the purpose of describing the structure of the compound 3. CAM compound 2 is a CAM having a structure as described for the CAM compound referred to as compound 1 in U.S. serial no. 62/805,725, which is hereby incorporated herein by reference and particularly for the purpose of describing the structure of the compound 1. ASO-1 is as described above for Table 37.
EXAMPLE B5
LIVER EXPOSURE IN NON-HUMAN PRIMATES
[0248] Terminal liver exposures in non-human primates were evaluated by dosing exemplified modified oligonucleotide compounds to female cynomolgus monkeys by either the intravenous (IV) or subeutaneous (SC) route. For the IV route, the compound was administered in stérile phosphate-buffered saline (PBS) vehicle and infused over a 2-hr period at 1 mL/kg. For subeutaneous dosing, the vehicle was also stérile PBS and the compound was administered as a single bolus at 1 mL/kg. There were two animais per dose group, and the data shown is the average of the two animais. Liver levels were determined at the 24-hour timepoint. The doses utilized for this study and the data obtained is shown in FIG. 12. Unexpectedly, liver exposure following subeutaneous administration to non-human primates is much higher than expected based on liver exposure levels resulting from otherwise comparable intravenous dosing.
111
EXAMPLE B6
PBMC ASSAY
[0249] The effect of exemplified modified oligonucleotide compounds on the release of cytokines from peripberal blood mononuclear cells (PBMC) was evaluated as 5 described below and summarized in Table 39 and FIGS. 13-22.
[0250] Buffy coats (N=3) were obtained from Stanford Blood Center and processed to isolate PBMC as per Aragen’s standard protocol usingFicol! density gradient centrifugation. PBMC (1 million/mL) were suspended in complété culture (RPMI supplemented with 10% heat inactivated-low IgG FBS and PSG) and plated at 100 pL/well in a 96-well round bottom 10 plate. PBMC were treated with test articles (list on next slide) (concentration range: 10 μΜ to 0 μΜ -3 fold dilution) and PHA and Poly IC (concentration range: 10 pg/mL to 0 pg/mL -3 fold dilution). Ail was set up in triplicates. After 24 hours incubation at 37°C/5%CO2 humîdified standard cell culture incubator, supernatants were harvested and stored at -80ûC untii assayed for cytokines. Cytokines (GM-CSF, IL-lb, IL-2, IL-6, IL-10, IL-8, IL-12p70, 15 IFNg, TNFa) were tested on Inteliicyt iQue Screener and analyzed using ForeCyt analysis software. Cytokine (IFNa) was tested by standard EL1SA. Results are expressed as pg/ml calculated based on the standard curve.
TABLE 39
Compound No. FIG. No. Immune Réaction1
PHA Control 13 Strong
REP-2139 14 Weak
171,280, 292 15 Weak
296 16 None
134,277, 284 17 Weak
166,288 18 None
167,289 19 None
281, 316 20 None
294 21 Weak
276, 291 22 Weak
'Slrong: significant induction observed in more than two types of cytokines in the panel tested; Weak: induction observed in one or two types of cytokines in the panel tested;
Noue: no induction observed in any cytokine in the panel tested.

Claims (5)

1. A modified oligonucleotide or compiex thereof having sequence independent antiviral activity against hepatitîs B, comprising an at least partially phosphorothioated sequence of alternating A and C units, wherein:
5 the A units comprise one or more selected from:
113
and
the C units comprise one or more selected from
nmLNA-(5m)C Ribo-C Ribo-(5m)C ? 1 i
ΛΑΤθ each terminal is independently hydroxyl, an Ο,Ο-dihydrogen phosphorothioate, a dihydrogen phosphate, an endcap or a linking group;
wQ ... „
5 each internai is a phosphorus-containing linkage to a neighbormg A or C unit, the phosphorus-containing linkage being a phosphorothioate linkage or a modified linkage selected from phosphodiester, phosphorodithioate, methy (phosphonate, diphosphorothioate 5’phosphoramîdate, 3’55’-phosphordîamidate, 5’-thiophosphoramidate, 3’,5’thiophosphordiamidate or diphosphodiester; and
10 the sequence independent antiviral activity against hepatitis B, as determined by
HBsAg Sécrétion Assay, is greater than that of a reference compound, wherein the reference compound is the phosphorothioated AC 40-mer oligonucleotide known as REP 2139;
with the proviso that, when the sequence of altemating A and C units comprises a RiboA unit, the sequence further comprises at least one A unit that is not a Ribo-A unit; and
15 with the proviso that, when the sequence of altemating A and C units comprises a Ribo-
C unit, the sequence further comprises at least one C unit that is not a Ribo-C unit.
116
The modified oligonucleotide or complex thereof of claim 1, wherein the A unit
2’-0Me-A
2'-O-MOE-A is one or more selected from
3. The modified oligonucleotide or complex thereof of claim 1, wherein the A unit is one or more selected from
5 4. The modified oligonucleotide or complex thereof of claim 1, wherein lhe A unit
AmNA-(NMe)-A is one or more selected from scp-BNA-A
5. The modified oligonucleotide or complex thereof of claim 1, wherein the A unit
is one or more selected from 2-0-Propargyl-A anc] 2-O-Butynyl-A
is one or more selected from 2 -F A an(j 2 -araF A
7. The modified oligonucleotide or complex thereof of claim 1, wherein the A unit
is 3'-OMe-A
5 8. The modified oligonucleotide or complex thereof of claim 1, wherein the A unit
9. The modified oligonucleotide or complex thereof of claim 1, wherein the A unit
2'-NH2-A
118
10. The modified oligonucleotide or compiex thereof of claim 1, wherein the A unit is
GNA-A
11. The modified oligonucleotide or compiex thereof of ciaîm 1, wherein the A unit
4etl-A
119
12. The modified oligonucleotide or compiex thereof of any one of claims 1 to 11,
wherein the C unit is one or more selected from 2-OMe-(5m)C an(j
13. The modified oligonucleotide or compiex thereof of any one of claims 1 to 11,
5 wherein the C unit is one or more selected from LNA-(5m)C
, and
4etl-(5m)C nmLNA-(5m)C
120
14. The modified oligonucleotide or complex thereof of any one of daims 1 to 11, wherein the C unit is
15. The modified oligonucleotide or complex thereof of any one of daims 1 to 11, wherein the C unit is
5 16. The modified oligonucleotide or complex thereof of any one of daims 1 to 11,
2'-O-Propargyl· (5m)C ant|
2’-0-Butynyf- (5m)C
121
17, The modified oligonucleotide or complex thereof of any one of claims 1 to 11, wherein the C unit is one or more selected from
2'-araF(5m)C
and
18. The modified oligonucleotide or complex thereof of any one of claims 1 to 11, wherein the C unit is
19. The modified oligonucleotide or complex thereof of any one of claims 1 to 11,
UNA-(5m)C wherein the C unit is
122
20. The modified oligonucleotide or complex thereof of any one of claims 1 to 11, wherein the C unit is
21. The modified oligonucleotide or complex thereof of any one of claims 1 to 11,
wherein the C unit is GNA-(5m)C
5 22. The modified oligonucleotide or complex thereof of any one of claims 1 to 11, wherein the C unit is
23. The modified oligonucleotide or complex thereof of any one of claims 1 to 22 that is partially phosphorothioated.
24. The modified oligonucleotide or complex thereof of claim 23 that is at least 10 about 85% phosphorothioated.
25. The modified oligonucleotide or complex thereof of any one of claims 1 to 22 that is fully phosphorothioated.
26. The modified oligonucleotide or complex thereof of any one of claims 23 to 25, comprising at least one stereochemicalty defined phosphorothioate linkage.
15 27· The modified oligonucleotide or complex thereof of claim 26, comprising at least 6 stereocheraically defined phosphorothioate linkages.
123
28. The modified oligonucleotide or complex thereof of claim 26 or 27, wherein the at least one stereochermcally defined phosphorothioate linkage has an R configuration.
29. The modified oligonucleotide or complex thereof of claim 26 or 27, wherein the at least one stereochermcally defined phosphorothioate linkage has an S configuration.
30. The modified oligonucleotide or complex thereof of any one of daims 1 to 29, comprising a 5’ endcap.
31. The modified oligonucleotide or complex thereof of claim 30, wherein the 5’
O HO-P—CR1“CR2 endcap is selected from °H
HO^'
HO Η°^'
HO and
HO^'
HO VQ , wherein R1 and R2 are each indîvidually selected from hydrogen, deuterium, phosphate, thîoCbôalkyl, and cyano.
32. The modified oligonucleotide or complex thereof of claim 31, wherein R1 and R2 are both hydrogen.
33. The modified oligonucleotide or complex thereof of daim 31, wherein R1 and R2 are not both hydrogen.
34. The modified oligonucleotide or complex thereof of daim 31, wherein the 5’ o
HO-,ί sch3
HO ü t endcap is selected from p , N O
Ho.^ // Hoy p(O)(oh)2 hq O
35. The modified oligonucleotide or complex thereof of claim 31, wherein the 5’ O
HO endcap is
36. The modified oligonucleotide or complex thereof of any one of daims 1 to 35, wherein the al least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of about 8 units to about 200 units.
124
37. The modified oligonucleotide or compiex thereof of any one of claims 1 to 35, wherein the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 18 units to 60 units.
38. The modified oligonucleotide or compiex thereof of any one of claims 1 to 35, wherein the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 30 units to 50 units.
39. The modified oligonucleotide or compiex thereof of any one of claims 1 to 35, wherein the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 34 units to 46 units.
40. The modified oligonucleotide or compiex thereof of any one of claims 1 to 35, wherein the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units.
41. The modified oligonucleotide or compiex thereof of any one of claims 1 to 40, wherein at least one terminal is a linking group.
42. The modified oligonucleotide or compiex thereof of claim 41, further comprising at least one second oligonucleotide that is attached to the modified oligonucleotide via the linking group.
43. The modified oligonucleotide or compiex thereof of claim 41, further comprising a targeting ligand that is attached to the modified oligonucleotide via the linking group.
44. The modified oligonucleotide or compiex thereof of claim 43, wherein the targeting ligand comprises N-acetylgalactosamine (GaiNac), triantennary-GalNAc, a tocopherol or cholestérol.
45. The modified oligonucleotide or compiex thereof of any one of claims 1 to 44, wherein at least some of the A units are not 2’O-methylated on the ribose ring.
46. The modified oligonucleotide or compiex thereof of any one of claims 1 to 45, wherein at least some of the C units are not 2’O-methylated on the ribose ring.
47. The modified oligonucleotide or compiex thereof of any one of claims 1 to 46, wherein the al least partially phosphorothioated sequence of alternating A and C unils further comprises one or more modifications to a phosphorothioate linkage.
48. The modified oligonucleotide or compiex thereof of claim 47, wherein the modification to the phosphorothioate linkage is a modified linkage selected from phosphodiester, phosphorodithioate, methyl phosphonate, diphosphorothioate 5’
125 phosphoramidate, 3 ,5 -phosphordiamidate, 5 -thiophosphoramidate, 3’,5’thiophosphordiamidate or diphosphodiester.
49. The modified oligonucleotide or complex thereof of daim 48, wherein the modified iinkage is a phosphodiester linkage.
50. The modified oligonucleotide or complex thereof of any one of claims 1 to 46, further comprising at least two partially phosphorothioated sequences of alternating A and C units linked together to form a concatemer.
51. The modified oligonucleotide or complex thereof of any one of daims 1 to 50, wherein the sequence independent antiviral activity against hepatitis B is at least 2-fold greater than the reference compound.
52. The modified oligonucleotide or complex thereof of daim 51, wherein the sequence independent antiviral activity against hepatitis B is al least 5-fold greaier than the reference compound.
53. The modified oligonucleotide or complex thereof of any one of daims 1 to 52, wherein the modified oligonucleotide has an ECso value, as determined by HBsAg Sécrétion Assay, that is less than 30 nM.
54. The modified oligonucleotide or complex thereof of any one of daims 1 to 52, wherein the modified oligonucleotide has an ECso value, as determined by HBsAg Sécrétion Assay, that is in the range of 30 nM to less than 100 nM.
55. The modified oligonucleotide or complex thereof of any one of claims 1 to 52, wherein the modified oligonucleotide has an ECso value, as determined by HBsAg Sécrétion Assay, that is in the range of 100 nM to less than 300 nM.
56. The modified oligonucleotide or complex thereof of any one of daims 1 to 52, wherein the modified oligonucleotide has an ECso value, as determined by HBsAg Sécrétion Assay, that is greater than 300 nM.
57. The modified oligonucleotide or complex thereof of daim 1, wherein the at least partially phosphorothioated sequence has a sequence length and alternating A and C units as set forth in Tables 6-33 and FIGS. 6A-6B.
58. The complex of the modified oligonucleotide of any one of daims 1 to 57, wherein the complex is a chelate complex.
59. The complex of claim 58, wherein the complex is a calcium, magnésium or zinc chelate complex of the modified oligonucleotide.
60. The complex of the modified oligonucleotide of any one of daims 1 to 57, wherein the complex is a monovalent counterion complex.
126
61. The complex of claim 60, wherein the complex is a lithium, sodium or potassium complex ofthe modified oligonucleotide.
62. The modified oligonucleotide or complex thereof of claim 1, wherein:
the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;
the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units;
the A units comprise at least 12 2’-0Me-A units and al least 1 Ribo-A unit;
the C units comprise at least 15 LNA-5mC units; and the modified oligonucleotide has an ECso value, as determined by HBsAg Sécrétion Assay, that is less than 30 nM.
63. The modified oligonucleotide or complex thereof of claim 1, wherein:
the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;
the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units;
the A units comprise at least 15 2’-0Me-A units;
the C units comprise at least 7 LNA-5mC units; and the modified oligonucleotide has an ECso value, as determined by HBsAg Secrétion Assay, that is less than 50 nM.
64. The modified oligonucleotide or complex thereof of claim 1, wherein:
the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;
the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units;
the A units comprise at least 15-2’-OMe-A units;
the C units comprise at least 3 LNA-5mC units; and the modified oligonucleotide has an ECso value, as determined by HBsAg Sécrétion Assay, that is less than 100 nM.
65. The modified oligonucleotide or complex thereof of claim 1, wherein:
the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;
the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units;
127 the A units comprise at least I 8 2 -OMe-A umts;
the C units comprise at least 15 LNA-5mC units; and the modified oligonucleotide has an ECso value, as determined by HBsAg Sécrétion Assay, that is less than 30 nM.
66. The complex of the modified oligonucleotide of any one of ciaims 62 to 65, wherein the complex is a monovalent counterion complex that comprises a sodium or potassium complex of the modified oligonucleotide.
67. A pharmaceutical composition, comprising an amount of the modified oligonucleotide or complex thereof of any one of ciaims 1 to 66, that is effective for treating a subject infected with hepatitis B; and a pharmaceutically acceptable carrier.
68. A pharmaceutical composition, comprising an amount of the modified oligonucleotide or complex thereof of any one of ciaims 1 to 66, that is effective for treating a subject infected with hepatitis D; and a pharmaceutically acceptable carrier.
69. A treatment for hepatitis B, hepatitis D or both, comprising an effective amount of the modified oligonucleotide or complex thereof of any one of ciaims 1 to 66, or the pharmaceutical composition of claim 67 or 68.
70. An antiviral oligonucleotide or complex thereof for use in a method of treating hepatitis B or hepatitis D, wherein the antiviral activity of the oligonucleotide occurs principally by a sequence independent mode of action and wherein the oligonucleotide is for subcutaneous administration.
71. Use of an antiviral oligonucleotide or complex thereof in the préparation of a médicament for treating hepatitis B or hepatitis D, wherein the antiviral activity of the oligonucleotide occurs principally by a sequence independent mode of action and wherein the oligonucleotide is for subcutaneous administration
72. The antiviral oligonucleotide or complex thereof for use of claim 70 or the use of claim 71, wherein the antiviral oligonucleotide is REP 2139, REP 2055, REP 2165 or a chelate complex thereof.
73. The antiviral oligonucleotide or complex thereof for use of claim 70 or the use of claim 71, wherein the antiviral oligonucleotide is the modified oligonucleotide or complex thereof of any one of ciaims 1 to 66, the pharmaceutical composition of claim 67 or 68, or the treatment of claim 69.
74. The oligonucleotide or complex thereof for use or the use of any one of ciaims 70 to 73, wherein the antiviral oligonucleotide or complex thereof is for subcutaneous administration in a safe and effective amount to a human subject in need thereof, at a dosage
128 lower than otherwise expected based on hver levels observed following otherwise comparable intravenous administration.
75. The modified oligonucleotide or complex thereof of any one of claims 1 to 66 for use in the treatment of hepatitis B in a subject in need thereof.
76. Use of the modified oligonucleotide or complex thereof of any one of claims 1 to 66 in the préparation of a médicament for the treatment of hepatitis B in a subject in need thereof.
77. The modified oligonucleotide or complex thereof for use of claim 75 or the use of claim 76, wherein the modified oligonucleotide or complex thereof is for administration to the subject by a parentéral route.
78. The modified oligonucleotide or complex thereof for use of claim 75 or the use of claim 76, wherein the modified oligonucleotide or complex thereof for administration to the subject intravenously.
79. The modified oligonucleotide or complex thereof for use of claim 75 or the use of claim 76, wherein the modified oligonucleotide or complex thereof is for administration to the subject subcutaneously.
80. The modified oligonucleotide or complex thereof for use or the use of any one of claims 75 to 79, wherein the modified oligonucleotide or complex thereof is for administration to a subject in combination with an effective amount of a second treatment for hepatitis B.
81. The modified oligonucleotide or complex thereof for use or the use of claim 80, wherein the second treatment for hepatitis B comprises a second oligonucleotide having sequence independent antiviral activity against hepatitis B, an siRNA oligonucleotide, an antisense oligonucleotide, a nucleoside, an interferon, an immunomodulator, a capsid assembly modulator, or a combination thereof.
82. The modified oligonucleotide or complex thereof for use or the use of claim 81, wherein the second treatment for hepatitis B comprises an anti-sense oligonucleotide.
83. The modified oligonucleotide or complex thereof for use or the use of claim 81, wherein the second treatment for hepatitis B comprises a capsid assembly modulator.
84. The modified oligonucleotide or complex thereof of any one of claims 1 to 66 for use in die treatment of hepatitis D in a subject in need thereof.
85. Use of the modified oligonucleotide or complex thereof of any one of claims 1 to 66 in the préparation of a médicament for the treatment of hepatitis D in a subject in need thereof.
129
86. The modifiée! oligonucleotide or complex thereof for use of claim 84 or the use of claim 85, wherein the modified oligonucleotide or complex thereof is for administration to the subject by a parentéral route.
87. The modified oligonucleotide or complex thereof for use of claim 84 or the use of claîm 85, wherein the modified oligonucleotide or complex thereof is for administration to the subject intravenously.
88. The modified oligonucleotide or complex thereof for use of claim 84 or the use of claim 85, wherein the modified oligonucleotide or complex thereof is for administration to the subject subcutaneously.
89. The modified oligonucleotide or complex thereof for use or the use of any one of daims 84 to 88, wherein the modified oligonucleotide or complex thereof is for administration to a subject in combination with an effective amount of a second treatment for hepatitis D.
90. The modified oligonucleotide or complex thereof for use or the use of claim 89, wherein the second treatment for hepatitis D comprises a second oligonucleotide having sequence independent antiviral activity against hepatitis D, an anti-sense oligonucleotide, a nucleoside, an interferon, a capsid assembly modulator, or a combination thereof.
91. The modified oligonucleotide or complex thereof for use or the use of claim 90, wherein the second treatment for hepatitis D comprises an anti-sense oligonucleotide.
92. The modified oligonucleotide or complex thereof for use or the use of claîm 90, wherein the second treatment for hepatitis D comprises a capsid assembly modulator.
93. The modified oligonucleotide or complex thereof for use or the use of any of daims 75 to 92, wherein the antiviral oligonucleotide or complex thereof is for subeutaneous administration to a human subject in need thereof in a safe and effective amount, at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration.
94. A dinucleotide consisting of an A unît and a C unit connected by a stereochemically defined phosphorothioate linkage, wherein:
the A units comprise one or more selected from:
2'-araF(5m)C
132
each is independently hydroxyl.
an Ο,Ο-dihydrogen phosphorothioate, a phosphoramidite, a dimethoxytrityl ether, or the stereochemically defined phosphorothioate linkage.
133
95. The dinucleotide of claim 94, with the proviso that the dinucleotide does not comprise both the Ribo-A unit and the Ribo-C unit.
96. The dinucleotide of claim 94 selected from the dinucleotides that comprise or consist of any two of the building block monomers described in Tables 4 and 5.
wQ
97. The dinucleotide of claim 94 or 95, wherein an is a phosphoramidite of the following formula (A):
R1
I 2
N—R2
4-0—
O—R3 (A) wherein:
RL and R2 are each individually a Ci-6alkyl; and
R3 is a Cj-6alkyl or a cyanoCJ alkyl.
98. The dinucleotide of claim 97, wherein the phosphoramidite of the formula (A) is a phosphoramidite of the following formula (Al):
99. The dinucleotide of any one of claims 94 to 98, wherein the stereochcmically defined phosphorothioate linkage is a phosphorothioate of the following Formulae (Bl) or (B2):
S=P-*OR:
S—P-mOR4
(B2) wherein R4 is a Ci-β alkyl or a cyanoCi-6 alkyl.
-134-
100. The dinucleotide ofclaim 99, wherein the phosphorothioate ofthe formula (Bl) is a phosphorothioate of the formula (B3), or the phosphorothioate of the formula (B2) is a phosphorothioate of the formula (B4), as follows:
(B3) (B4).
101. A method for making the modified oligonucleotide of any one of daims 1 to 66, comprising coupiing the dinucleotide of any one of daims 94 to 100.
102. A modified oligonucleotide or complex thereof, wherein the modified oligonucleotide is represented by the following formula:
5’mApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsmApsln(5 m)CpsrApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsrApsln(5m)CpsmApsl n(5m)CpsmApsln(5m)CpsrApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsrA psln(5m)CpsmApsln(5m)CpsmAps]n(5m)CpsrApsln(5m)CpsinApsln(5m)Cps mApsln(5tn)C 3’, wherein mA is 2’-O-methyladenosine, ps is phosphorothioate, ln(5m)C is locked 5-methylcytidine, and rA is ribo-adenosine.
103. The complex of the modified oligonucleotide of daim 102, wherein the complex is a chdate complex.
104. The complex of the modified oligonucleotide of daim 102, wherein the complex is a monovalent counterion complex.
105. The complex of daim 102, wherein the complex is a lithium, sodium or potassium complex of the modified oligonucleotide.
106. A pharmaceutical composition, comprising an amount of the modified oligonucleotide or complex thereof of daim 102, that is effective for treating a subject infected with hepatitis B and/or hepatitis D; and a pharmaceutically acceptable carrier.
107. The pharmaceutical composition of daim 106, wherein the pharmaceutical composition is formulated for subcutaneous delivery.
- 135-
108. Use of the modified oligonucleotide or complex thereof of any one of claims 102 to 105 in the préparation of a médicament for the treatment of hepatitis B in a subject in need thereof.
109. The use of daim
108, wherein the médicament is for administration to the subject by a parentéral route.
110. The use of claim
108, wherein the médicament is for administration to the subject intravenously.
111. The use of claim
108, wherein the médicament is for administration to the subject subcutaneously.
] 12. The use of claim
108, wherein the médicament is for administration with an effective amount of one or more of a second treatment for hepatitis B to the subject.
113. The use of claim 112, wherein the second treatment for hepatitis B comprises an siRNA oligonucleotide, an anti-sense oligonucleotide, a nucleoside, an interferon, an immunomodulator, a capsid assembly modulator, or a combination thereof.
114. The use of claim 113, wherein the second treatment for hepatitis B comprises an anti-sense oligonucleotide.
115. The use of claim 113, wherein the second treatment for hepatitis B comprises a capsid assembly modulator.
116. The use of claim 108, wherein the médicament is for subcutaneous administration to a human subject in need thereof, at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration.
OA1202100203 2018-11-08 2019-11-07 S-antigen transport inhibiting oligonucleotide polymers and methods OA20592A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US62/757,632 2018-11-08
US62/855,323 2019-05-31
US62/907,845 2019-09-30

Publications (1)

Publication Number Publication Date
OA20592A true OA20592A (en) 2022-11-29

Family

ID=

Similar Documents

Publication Publication Date Title
US20200147124A1 (en) S-antigen transport inhibiting oligonucleotide polymers and methods
CN109890207B (en) Compositions comprising reversibly modified oligonucleotides and uses thereof
CN108137492B (en) Oligonucleotide compositions and methods thereof
US20040132684A1 (en) Polymeric nucleoside prodrugs
EP4022059A1 (en) Oligonucleotide compositions and methods of use thereof
US20220125825A1 (en) S-antigen transport inhibiting oligonucleotide polymers and methods
SG177564A1 (en) Novel nucleic acid prodrugs and methods of use thereof
EP2845607A1 (en) Antisense oligonucleotides with improved pharmacokinetic properties
EP3682007A2 (en) Galnac derivatives
AU2017368283B2 (en) Novel bicyclic nucleosides and oligomers prepared therefrom
OA20592A (en) S-antigen transport inhibiting oligonucleotide polymers and methods
JPWO2018110678A1 (en) Nucleoside derivatives and uses thereof
EA045960B1 (en) OLIGONUCLEOTIDE POLYMERS AND METHODS FOR INHIBITION OF S-ANTIGEN TRANSPORT
WO2024002007A1 (en) Double-stranded rna comprising nucleotide analog capable of reducing off-target toxicity
RU2797833C1 (en) Oligonucleotide compositions and methods related to them
WO2023177808A1 (en) Modified gapmer oligomers and methods of use thereof
CN116615542A (en) Systemic delivery of oligonucleotides
JPWO2006043521A1 (en) Optically active oligonucleic acid compound having phosphorothioate bond