EA045960B1 - OLIGONUCLEOTIDE POLYMERS AND METHODS FOR INHIBITION OF S-ANTIGEN TRANSPORT - Google Patents

Description

Information about related applications

This application claims priority to US Patent Application No. 62/757632, filed November 8, 2018; US Patent Application No. 62/855323, filed May 31, 2019; and US Patent Application No. 62/907845, filed September 30, 2019. Each of the above references is incorporated herein by reference in its entirety.

State of the art

Field of invention.

The invention relates to STOPS™ antiviral compounds, which are oligonucleotide polymers that inhibit S-antigen transport, methods for their preparation and methods for their use for the treatment of diseases and pathological conditions.

Description.

The STOPS™ compounds described herein are antiviral oligonucleotides that can be at least partially thiophosphated and exert their antiviral activity using a sequence-independent mechanism. See A. Vaillant, Nucleic acid polymers: Broad spectrum antiviral activity, antiviral mechanisms and optimization for the treatment of hepatitis B and hepatitis D infection, Antiviral Research 133, 32-40 (2016). The term nucleotide polymer (NAP) is used in the literature to refer to such oligonucleotides, although this term does not necessarily imply antiviral activity. A number of patent applications filed in the early 2000s described the structures of some specific compounds and identified various structural variants as potential areas for future experimentation. See, for example, US Pat. No. 7,358,068; 8008269; 8008270 and 8067385. These efforts led to the identification of a compound known to those skilled in the art as REP 2139, a thiophosphated 40-membered polymer containing adenosine-cysteine (AC) repeat units with 5-methylation of all cytosine bases and 2'-O-methylation of all molecules ribose, as well as a compound known as its clinical precursor, REP 2055. See I. Roehl et al., Nucleic Acid Polymers with Accelerated Plasma and Tissue Clearance for Chronic Hepatitis In Therapy, Molecular Therapy: Nucleic Acids Vol. 8, 1-12 (2017). The authors of this publication showed that the structural features of these compounds are optimized for the treatment of hepatitis B (HBV) and hepatitis D (HD). See also A. Vaillant, Nucleic acid polymers: Broad spectrum antiviral activity, antiviral mechanisms and optimization for the treatment of hepatitis B and hepatitis D infection, Antiviral Research 133 (2016) 32-40. According to these authors and similar literature, such compounds retain antiviral activity against HBV by preventing recognition by the innate immune response mechanisms, allowing for safe use with immunotherapies such as pegylated interferon. At the same time, there has been a need for more effective compounds of this class for a long time.

Brief description of the invention

Contrary to existing ideas about the optimal combination of desirable structural features of antiviral compounds, there is now evidence that their properties can be significantly improved by modifying and producing the STOPS™ compounds described herein. For example, in some embodiments, the sequence-independent antiviral activity of the novel STOPS™ compounds against HBV, as determined by an HBsAg secretion assay, is greater than that of the reference compound. Given the many years of research resulting in the development of the industry-recognized optimized structure of REP 2139, those skilled in the art do not have high expectations that the embodiments of the modified STOPS™ compounds described herein will have such improved performance. Thus, the structures of the new STOPS™ compounds and the methods of their use for the treatment of HBV and VGO are unexpected and original.

Certain embodiments described herein provide a modified oligonucleotide or complex thereof having sequence-independent activity against hepatitis B virus, which may comprise at least a partially thiophosphate sequence of alternating fragments A and C, wherein fragments A comprise one or more from compounds selected from

- 1 045960

fragments C contain one or more of compounds selected from

- 2 045960

each ^W O end group is independently a hydroxyl, O,O-dihydrothiophosphate, dihydrogen phosphate, end cap or linking group;

each internal ^W O group is a phosphorus-containing bond to an adjacent moiety A or C, wherein said phosphorus-containing bond is a thiophosphate bond or a modified bond selected from phosphodiester, dithiophosphate, methylphosphonate, thiodiphosphate, 5'-phosphoramidate, 3',5'-phosphorodiamidate , 5'-thiophosphoramidate, 3',5'-thiophosphorus

- 3 045960 diamidate or diphosphodiester linkage; and sequence-independent activity against hepatitis B virus, determined by HBsAg secretion assay, is superior to that of the reference compound;

with the proviso that if a sequence of alternating fragments A and C contains a ribo-A fragment, then the specified sequence additionally contains at least one fragment A that is not a ribo-A fragment; and provided that if a sequence of alternating fragments A and C contains a fragment of ribo-C, then the specified sequence additionally contains at least one fragment C that is not a fragment of ribo-C.

Certain embodiments described herein relate to a method of treating HBV and/or HGO infection, which may include administering to a subject found to be suffering from HBV and/or HGO infection an effective amount of a modified oligonucleotide described herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide described herein.

Certain embodiments described herein relate to a method of inhibiting the replication of HBV and/or RGO, which may include contacting a cell infected with HBV and/or RGO in contact with an effective amount of a modified oligonucleotide described herein or a pharmaceutical composition, containing an effective amount of a modified oligonucleotide described herein.

Other embodiments are described in detail below.

Brief description of drawings

In fig. 1 shows an embodiment of a modified oligonucleotide containing a C _2-6 alkylene linking group.

In fig. 2 shows an embodiment of a modified oligonucleotide containing a propylene oxide linking group.

In fig. 3A shows an embodiment of a modified oligonucleotide containing cholesterol linked via a 5'-tetraethylene glycol (TEG) linking group.

In fig. 3B shows an embodiment of a modified oligonucleotide containing a 3'-TEG binding group.

In fig. 3C shows an embodiment of a modified oligonucleotide containing tocopherol (vitamin E) linked through a 5'-TEG linking group.

In fig. 3D shows an embodiment of a modified oligonucleotide containing tocopherol (vitamin E) linked via a 3'-TEG linking group.

In fig. 4A and 4B show embodiments of modified oligonucleotides containing GalNac attached via a linking group.

In fig. Figure 5 shows an embodiment of the reaction scheme for obtaining the 5'-EP structural element.

In fig. 6A shows embodiments of the modified oligonucleotides and the corresponding sequence-independent activity against the hepatitis B virus (determined by HBsAg secretion assay) and cytotoxicity.

In fig. 6B shows embodiments of the modified oligonucleotides and the corresponding sequence-independent anti-hepatitis B virus activity (determined by HBsAg secretion assay) and cytotoxicity values.

In fig. 7 shows an embodiment of the reaction scheme for preparing the 5'-VP compound.

In fig. Figure 8 shows an embodiment of the reaction scheme for the preparation of compounds 8-5 and 8-6.

In fig. 9A shows an embodiment of the reaction scheme for the preparation of compound 9R.

In fig. 9B shows an embodiment of the reaction scheme for producing compound 9S.

In fig. Figure 10 shows an embodiment of the reaction scheme for the preparation of compounds 10-5 and 10-6.

In fig. 11A shows an embodiment of the reaction scheme for preparing compound 11R.

In fig. 11B shows an embodiment of the reaction scheme for preparing compound 11S.

In fig. 12 shows liver effects following subcutaneous administration of modified oligonucleotide compound embodiments to non-human primates.

In fig. 13 shows the results of the MIC analysis demonstrating the immune response to embodiments of the modified oligonucleotide compounds.

In fig. 14 shows the results of the MIC analysis demonstrating the immune response to embodiments of the modified oligonucleotide compounds.

In fig. 15 shows the results of the MIC analysis demonstrating the immune response to embodiments of the modified oligonucleotide compounds.

In fig. 16 shows the results of the MIC analysis demonstrating the immune response to embodiments of the modified oligonucleotide compounds.

In fig. 17 shows the results of the MIC analysis demonstrating the immune response to embodiments of the modified oligonucleotide compounds.

In fig. Figure 18 shows the results of MIC analysis demonstrating the immune response to re variants

- 4 045960 implementation of modified oligonucleotide compounds.

In fig. 19 shows the results of the MIC analysis demonstrating the immune response to embodiments of the modified oligonucleotide compounds.

In fig. 20 shows the results of the MIC analysis demonstrating the immune response to embodiments of the modified oligonucleotide compounds.

In fig. 21 shows the results of the MIC analysis demonstrating the immune response to embodiments of the modified oligonucleotide compounds.

In fig. 22 shows the results of the MIC analysis demonstrating the immune response to embodiments of the modified oligonucleotide compounds.

In fig. 23 shows a graph used in connection with the HBsAg secretion assay described in Examples B3 and B4.

Detailed Description of the Invention

Definitions.

Unless otherwise specified, all technical and scientific terms used herein have the meaning commonly accepted by those skilled in the art. Unless otherwise indicated, all patents, applications, published applications and other publications referenced herein are incorporated herein by reference in their entirety. If there are multiple definitions for a term in this document, the definitions in this section take precedence unless otherwise noted.

Hepatitis B virus (HBV) is a DNA virus and is a member of the Hepadnaviridae family. HBV infects more than 300 million people worldwide and is the cause of liver cancer and liver diseases such as chronic hepatitis, cirrhosis and hepatocellular carcinoma. HBV can be acute and/or chronic. Acute HBV infection may be asymptomatic or manifest as symptomatic acute hepatitis. HBV is divided into eight genotypes - from A to H.

HBV contains partially double-stranded circular DNA of approximately 3.2 kilobase pairs (kb). The HBV replication pathway has been studied in detail. T.J. Liang, Heptaology (2009) 49 (5 Suppl):S13S21. One step of replication involves the formation of a covalently closed circular form (cccDNA). The presence of cccDNA leads to the risk of re-emergence of the virus throughout the life of the host. HBV carriers can transmit the disease for many years. An estimated 257 million people are living with hepatitis B virus infection, and more than 750,000 people worldwide die from hepatitis B each year. In addition, immunosuppressed individuals or those undergoing chemotherapy are at particular risk for reactivation of HBV infection.

HBV can be transmitted through blood, semen and/or other body fluids. This can happen through direct blood-to-blood contact, unprotected sex, sharing needles, and from an infected mother to her baby during childbirth. HBV surface antigen (HBsAg) is most commonly used to screen for this infection. Currently available medications do not cure HBV and/or HBV infection. Instead, these drugs inhibit viral replication.

Hepatitis D virus (HDV) is a DNA virus and also belongs to the Hepadnaviridae family of viruses. HBV can only reproduce in the presence of HBV. The transmission routes for VGO and HBV are similar. Transmission of HBV can occur through concurrent infection with HBV (co-infection) or in addition to chronic hepatitis B or hepatitis B carrier status (superinfection). Both superinfection and coinfection with HBV lead to more severe complications compared to infection with HBV alone. These complications include an increased likelihood of liver failure with acute infections and rapid progression to cirrhosis, as well as an increased risk of liver cancer with chronic infections. Hepatitis D in combination with hepatitis B has the highest mortality rate among all infectious hepatitis, amounting to 20%. There is currently no vaccine or cure for hepatitis D.

The term antiviral in the context of oligonucleotides or other substances has its usual meaning accepted among those skilled in the art, and thus includes the effect of the presence of oligonucleotides or other substances inhibiting the production of viral particles, usually by reducing the number of infectious viral particles produced in the system , otherwise suitable for producing infectious viral particles of at least one virus. In some embodiments, the antiviral oligonucleotide has antiviral activity against a variety of different viruses, such as both HBV and RGO.

As used herein, the term oligonucleotide (or oligo) has its common meaning among those skilled in the art, and thus refers to the class of compounds including oligodeoxynucleotides, oligodeoxyribonucleotides, and oligoribonucleotides. Thus, the term oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or substances that mimic them, including reference to oligo

- 5,045,960 nucleotides consisting of natural nucleotide bases, carbohydrates and phosphodiester (PO) internucleoside (framework) bonds, as well as modified or substituted oligonucleotides containing non-natural fragments that function in a similar way. Thus, the term modified (or substituted) oligonucleotide has its usual meaning accepted among those skilled in the art and includes oligonucleotides containing one or more of various modifications, for example, stabilizing modifications, and thus may contain at least one modification internucleoside linkage and/or ribose and/or base. For example, the modified oligonucleotide may contain modifications at the 2' position of ribose, acyl analogues of nucleotides, base methylation, phosphorothiophosphate (PS) bonds, dithiophosphate bonds, methylphosphonate bonds, bonds connecting to the carbohydrate ring through a sulfur or nitrogen atom and/or other modifications, described in other sections of this document. Thus, the modified oligonucleotide may contain one or more phosphorothiophosphate (PS) linkages instead of or in addition to PO linkages. Like unmodified oligonucleotides, modified oligonucleotides containing such PS bonds are considered to belong to the same class of compounds because even if the PS bond contains a phosphorus-sulfur double bond instead of a phosphorus-oxygen double bond in the PO bond, both PS and PO bonds connect to carbohydrate rings through oxygen atoms.

As used herein, in the context of modified oligonucleotides, the term phosphorothiophosphate oligonucleotide has its common meaning among those skilled in the art, and thus refers to a modified oligonucleotide in which all phosphodiester internucleoside linkages have been replaced by thiophosphate linkages. Those skilled in the art will therefore understand that the term thiophosphate oligonucleotide is synonymous with a fully thiophosphate oligonucleotide. A thiophosphated oligonucleotide (or a sequence of thiophosphated oligonucleotides within a partially thiophosphated oligonucleotide) can be similarly modified, including (for example) replacing one or more of the thiophosphated internucleoside linkages with phosphodiester linkages. Thus, the term modified thiophosphate oligonucleotide refers to a thiophosphate oligonucleotide modified in a manner similar to the modifications of the oligonucleotides described herein, e.g., by replacing the thiophosphate linkage with a modified linkage, e.g., phosphodiester, dithiophosphate, methylphosphonate, thiodiphosphate, 5'phosphoramidate, 3',5' -phosphorodiamidate, 5'-thiophosphoramidate, 3',5'-thiophosphoriamidate or diphosphodiester. The at least partially thiophosphate sequence of the modified oligonucleotide can be modified in a similar manner and thus can be modified to contain a non-thiophosphate linkage, e.g., phosphodiester, dithiophosphate, methylphosphonate, thiodiphosphate, 5'-phosphoramidate, 3',5'-phosphorodiamidate, 5'thiophosphoramidate, 3',5'-thiophosphoriamidate or diphosphodiester linkage. In the context of describing modifications of a thiophosphated oligonucleotide or at least partially thiophosphated sequence of a modified oligonucleotide, modification by inclusion of a phosphodiester linkage can be considered to result in a modified thiophosphated oligonucleotide or a modified thiophosphated sequence, respectively. Likewise, in the context of describing modifications to an oligonucleotide or at least a partially phosphodiesterified sequence of a modified oligonucleotide, modification by inclusion of a thiophosphate linkage may be considered to result in a modified oligonucleotide or a modified phosphodiesterified sequence, respectively.

In the context of dinucleotides or oligonucleotides, the term stereochemically specified thiophosphate linkage has its usual meaning accepted among those skilled in the art, and thus refers to a thiophosphate linkage containing a phosphorus stereocenter with a selected chirality (R- or S-configuration). A composition containing a dinucleotide or oligonucleotide can be enriched with molecules of selected chirality. The stereo purity of such a composition can vary widely, for example, from about 51% to about 100% stereo purity. In various embodiments, the stereo purity is greater than 55, 65, 75, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%; or is in a range whose endpoints are any two of the above stereo purity values.

The term sequence-independent antiviral activity has its common meaning among those skilled in the art, and thus refers to the antiviral activity of an oligonucleotide (eg, a modified oligonucleotide) independent of the sequence of that oligonucleotide. Methods for determining whether the antiviral activity of an oligonucleotide is sequence independent are known to those skilled in the art and include tests to determine whether an oligonucleotide may preferentially act through a mechanism of action that does not rely on sequence complementarity, as described in Example 10 of US Pat. No. 7,358,068; 8008269; 8008270 and 8067385 included in

- 6 045960 standing document as references and for the specific purpose of describing such tests.

In the context of describing modified oligonucleotides having sequence-independent antiviral activity and containing a sequence (for example, at least partially a thiophosphate sequence) of fragments A and C (for example, alternating fragments A and C or fragments AC), the terms A and C refer to modified adenosine-containing (A) fragments and modified cytosine-containing (C) fragments, given below in table. 1 and 2, respectively.

Table 1. Fragments A

- 7 045960

2'-F-A ^% o- o ^z J ^0. nh ₂ N- N' F O N nh ₂ 2'-araF-A V o ^z 4? /0 N- N' Λ ^ν N nh ₂ 3'-OMe-A ^o. N- N' ό N HzCO ⁷ ABOUT 5 nh ₂ UNA-A V ^0. N- < Ν' ό N OH nh ₂ 2'-NH ₂ -A V ^0. N- <'N' ό N — o ^z <r nh ₂ nh ₂ GNA-A A N 0 < N Λ N nh ₂ ENA-A % 0 ^0. N- N ό N ^oA \ 0 2'-O-butynyl-A o- Ν' ⁴ nh ₂ n' ^j o ^z s ⁵ 0 nh ₂ scp-BNA-A V fl < l\r ό N

- 8 045960

Table 2. Fragments C

Reduction (fragment C) Structure (fragment C) 2'-ОМе-(5ш)С nh ₂ % Ν^Ο / OCH ₃ 2'-O-MOE- (5sh)S νη ₂ ύΗ % Ν'Ύ) °^oJ θ OCH ₃ LNA- (5sh)S νη ₂ Ύα. 4 Ν^Ο °^oj Λί LNA-5mC 2'-O-propargyl-(5sh)C νη ₂ ⁰ J? ⁰

- 9 045960

2'-F- (5m)C nh ₂ yS _% N^O ° ^F 2'-araF- (5m)C nh ₂ yS % N^O x_iZF o ^z J Z'-OMe- (5m)C nh ₂ yS \ NV Η,Οο' o UNA-(5m)C nh ₂ yS t, Y O he 2'-NH ₂ - (5m)C GNA- (5m)C ENA- (5m)C 2'-O-butynyl- (5m)C νη ₂ YS 'g, \ V / ΝΗ ₂ νη ₂ ⁴ »Vx νη ₂ Ύα. _% Ν^Ο ⁰ ο ^/ ^—ο % νη ₂ ^Λ ° ° --5=5 scp-BNA- (5m)C νη ₂ yS g, 5— _ν 1

- 10 045960

AmNA- (NMe)- (5m)C nh ₂ yS ,--0. 1 4etl- (5m)C ^% o- 1 i----NCH ₃ nh ₂ N^O -oU <W*O ) -0 nmLNA-(5m)C ^% o- p za ^z —7\ / ° 1 -WQ ^/X 'N'° 1 Ribo-S ^% o- nh ₂ (4 N^O .oJ Ribo-(5m)C ^% o- o' OH nh ₂ γ\ _x oJ o ^z 3 ⁵ OH

Modified oligonucleotide compounds.

In one embodiment, a modified STOPS™ oligonucleotide compound is provided having sequence-independent activity against the hepatitis B virus, comprising an at least partially thiophosphate sequence of alternating fragments A and C, wherein fragments A are any or any compounds selected from the compounds listed in table 1, and fragments C represent any or any compounds selected from the compounds listed in table. 2. Various combinations of fragments A and C, including the combinations described below in table. 3 may be included in at least a partially thiophosphated AC sequence.

- 11 045960

Table 3. Examples f AS fragments No. Fragment A Fragment C 1 2'-OMe-A 2'-ОМе-(5ш)С 2 2'-OMe-A 2'-O-MOE- (5sh)S 3 2'-OMe-A LNA- (5sh)S 4 2'-OMe-A ENA-(5m)C 5 2'-OMe-A scp-BNA- (5m)C 6 2'-OMe-A AmNA- (NMe)- (5m)C 7 2'-OMe-A 2'-O-propargyl- (5m)C 8 2'-OMe-A 2'-O-butynyl-(5m)C

- 12 045960

9 2'-OMe-A 2'-F- (5sh)S 10 2'-OMe-A 2'-araF- (5ш)С AND 2'-OMe-A Z'-ОМе- (5ш)С 12 2'-OMe-A UNA- (5sh)S 13 2'-OMe-A 2'-NH ₂ - (5ш)С 14 2'-OMe-A GNA- (5sh)S 15 2'-OMe-A 4etl- (5sh)S 16 2'-OMe-A nmLNA- (5ш)С 17 2'-O-MOE-A 2'-ОМе-(5ш)С 18 2'-O-MOE-A 2'-O-MOE- (5sh)S 19 2'-O-MOE-A LNA- (5sh)S 20 2'-O-MOE-A ΕΝΑ- (5sh)S 21 2'-O-MOE-A scp-BNA- (5sh)S 22 2'-O-MOE-A AmNA- (NMe)- (5m)C 23 2'-O-MOE-A 2'-O-propargyl- (5m)C 24 2'-O-MOE-A 2'-O-butynyl-(5m)C 25 2'-O-MOE-A 2'-F- (5m)C 26 2'-O-MOE-A 2'-araF- (5m)C 27 2'-O-MOE-A Z'-OMe- (5m)C 28 2'-O-MOE-A UNA-(5m)C 29 2'-O-MOE-A 2'-NH ₂ - (5m)C thirty 2'- O-MOE-A GNA-(5m)C 31 2'-O-MOE-A 4etl- (5m)C 32 2'-O-MOE-A nmLNA-(5m)C 33 LNA-A 2'-OMe- (5m)C 34 LNA-A 2'-O-MOE- (5m)C

- 13 045960

35 LNA-A LNA-(5m)C 36 LNA-A ENA-(5m)C 37 LNA-A scp-BNA- (5m)C 38 LNA-A AmNA- (NMe)- (5m)C 39 LNA-A 2'-O-propargyl- (5m)C 40 LNA-A 2'-O-butynyl-(5m)C 41 LNA-A 2'-F- (5m)C 42 LNA-A 2'-araF- (5m)C 43 LNA-A Z'-OMe- (5m)C 44 LNA-A UNA-(5m)C 45 LNA-A 2'-NH ₂ - (5m)C 46 LNA-A GNA-(5m)C 47 LNA-A 4etl- (5m)C 48 LNA-A nmLNA-(5m)C 49 ENA-A 2'-OMe- (5m)C 50 ENA-A 2'- O-MOE- (5m)C 51 ENA-A LNA-(5m)C 52 ENA-A ENA-(5m)C 53 ENA-A scp-BNA- (5m)C 54 ENA-A AmNA- (NMe)- (5m)C 55 ENA-A 2'-O-propargyl- (5m)C 56 ENA-A 2'-O-butynyl-(5m)C 57 ENA-A 2'-F- (5m)C 58 ENA-A 2'-araF- (5m)C 59 ENA-A Z'-OMe- (5m)C 60 ENA-A UNA-(5m)C

- 14 045960

61 ENA-A 2'-NH ₂ - (5m)C 62 ENA-A GNA-(5m)C 63 ENA-A 4etl- (5m)C 64 ENA-A nmLNA-(5m)C 65 scp-BNA-A 2'-OMe- (5m)C 66 scp-BNA-A 2'- O-MOE- (5m)C 67 scp-BNA-A LNA-(5m)C 68 scp-BNA-A ENA-(5m)C 69 scp-BNA-A scp-BNA- (5m)C 70 scp-BNA-A AmNA- (NMe)- (5m)C 71 scp-BNA-A 2'-O-propargyl- (5m)C 72 scp-BNA-A 2'-O-butynyl-(5m)C 73 scp-BNA-A 2'-F- (5m)C 74 scp-BNA-A 2'-araF- (5m)C 75 scp-BNA-A Z'-OMe- (5m)C 76 scp-BNA-A UNA-(5m)C 77 scp-BNA-A 2'-NH ₂ - (5m)C 78 scp-BNA-A GNA-(5m)C 79 scp-BNA-A 4etl- (5m)C 80 scp-BNA-A nmLNA-(5m)C 81 AmNA (N-Me)-A 2'-OMe- (5m)C 82 AmNA (N-Me)-A 2'- O-MOE- (5m)C 83 AmNA (N-Me)-A LNA-(5m)C 84 AmNA (N-Me)-A ENA-(5m)C 85 AmNA (N-Me)-A scp-BNA- (5m)C 86 AmNA (N-Me)-A AmNA- (NMe)- (5m)C

- 15 045960

87 AmNA (N-Me)-A 2'-O-propargyl-(5t)C 88 AmNA (N-Me)-A 2'-0-butynyl-(5t)C 89 AmNA (N-Me)-A 2'-F- (5t)С 90 AmNA (N-Me)-A 2'-ara-F- (5t)С 91 AmNA (N-Me)-A Z'-ОМе- (5т)С 92 AmNA (N-Me)-A UNA- (5t)S 93 AmNA (N-Me)-A 2'-NH ₂ - (5t)С 94 AmNA (N-Me)-A GNA- (5t)С 95 AmNA (N-Me)-A 4etl- (5t)С 96 AmNA (N-Me)-A nmLNA- (5t)С 97 2'-O-propargyl-A 2'-ОМе-(5т)С 98 2'-O-propargyl-A 2'- O-MOE- (5t)S 99 2'-O-propargyl-A LNA- (5t)С 100 2'-O-propargyl-A ΕΝΑ- (5t)С 101 2'-O-propargyl-A scp-BNA- (5t)С 102 2'-O-propargyl-A AmNA- (NMe)- (5t)С 103 2'-O-propargyl-A 2'-O-propargyl-(5t)C 104 2'-O-propargyl-A 2'-O-butyn-(5t)C 105 2'-O-propargyl-A 2'-F- (5t)С 106 2'-O-propargyl-A 2'-araF- (5t)С 107 2'-O-propargyl-A Z'-ОМе- (5т)С 108 2'-O-propargyl-A UNA- (5t)S 109 2'-O-propargyl-A 2'-NH ₂ - (5t)С BY 2'-O-propargyl-A GNA- (5t)С 111 2'-O-propargyl-A 4etl- (5t)С 112 2'-O-propargyl-A nmLNA- (5t)С

- 16 045960

FROM 2'-O-butynyl-A 2'-ОМе-(5ш)С 114 2'-O-butynyl-A 2'- O-MOE- (5sh)S 115 2'-O-butynyl-A LNA- (5sh)S 116 2'-O-butynyl-A ΕΝΑ- (5sh)S 117 2'-O-butynyl-A scp-BNA- (5sh)S 118 2'-O-butynyl-A AmNA- (NMe)- (5m)C 119 2'-O-butynyl-A 2'-O-propargyl- (5m)C 120 2'-O-butynyl-A 2'-O-butynyl-(5m)C 121 2'-O-butynyl-A 2'-F- (5m)C 122 2'-O-butynyl-A 2'-araF- (5m)C 123 2'-O-butynyl-A Z'-OMe- (5m)C 124 2'-O-butynyl-A UNA-(5m)C 125 2'-O-butynyl-A 2'-NH ₂ - (5m)C 126 2'-O-butynyl-A GNA-(5m)C 127 2'-O-butynyl-A 4etl- (5m)C 128 2'-O-butynyl-A nmLNA-(5m)C 129 2'-F A 2'-OMe- (5m)C 130 2'-F A 2'- O-MOE- (5m)C 131 2'-F A LNA-(5m)C 132 2'-F A ENA-(5m)C 133 2'-F A scp-BNA- (5m)C 134 2'-F A AmNA- (NMe)- (5m)C 135 2'-F A 2'-O-propargyl- (5m)C 136 2'-F A 2'-O-butynyl-(5m)C 137 2'-FA 2'-F- (5m)C 138 2'-FA 2’-ara-F- (5m)C

- 17 045960

139 2'-F A Z'-OMe- (5m)C 140 2'-F A UNA-(5m)C 141 2'-F A 2'-NH ₂ - (5m)C 142 2'-F A GNA-(5m)C 143 2'-F A 4etl- (5m)C 144 2'-F A nmLNA-(5m)C 145 2'-araF A 2'-OMe- (5m)C 146 2'-araF A 2'- O-MOE- (5m)C 147 2'-araF A LNA-(5m)C 148 2'-araF A ENA-(5m)C 149 2'-araF A scp-BNA- (5m)C 150 2'-araF A AmNA- (NMe)- (5m)C 151 2'-araF A 2'-O-propargyl- (5m)C 152 2'-araF A 2'-O-butynyl-(5m)C 153 2'-araF A 2'-F- (5m)C 154 2'-araF A 2'-araF- (5m)C 155 2'-araF A Z'-OMe- (5m)C 159 2'-araF A UNA-(5m)C 157 2'-araF A 2'-NH ₂ - (5m)C 158 2'-araF A GNA-(5m)C 159 2'-araF A 4etl- (5m)C 160 2'-araF A nmLNA-(5m)C 161 3'-OMe-A 2'-OMe- (5m)C 162 3'-OMe-A 2'- O-MOE- (5m)C 163 3'-OMe-A LNA-(5m)C 164 3'-OMe-A ENA-(5m)C

- 18 045960

165 Z'-OMe-A scp-BNA- (5m)C 166 Z'-OMe-A AmNA- (NMe)- (5m)C 167 Z'-OMe-A 2'-O-propargyl- (5m)C 168 Z'-OMe-A 2'-O-butynyl-(5m)C 169 Z'-OMe-A 2'-F- (5m)C 170 Z'-OMe-A 2'-ara-F- (5m)C 171 Z'-OMe-A Z'-OMe- (5m)C 172 Z'-OMe-A UNA-(5m)C 173 Z'-OMe-A 2'-NH ₂ - (5m)C 174 Z'-OMe-A GNA-(5m)C 175 Z'-OMe-A 4etl- (5m)C 176 Z'-OMe-A nmLNA-(5m)C 177 UNA-A 2'-OMe- (5m)C 178 UNA-A 2'- O-MOE- (5m)C 179 UNA-A LNA-(5m)C 180 UNA-A ENA-(5m)C 181 UNA-A scp-BNA- (5m)C 182 UNA-A AmNA- (NMe)- (5m)C 183 UNA-A 2'-O-propargyl- (5m)C 184 UNA-A 2'-O-butynyl-(5m)C 185 UNA-A 2'-F- (5m)C 186 UNA-A 2'-araF- (5m)C 187 UNA-A Z'-OMe- (5m)C 188 UNA-A UNA-(5m)C 189 UNA-A 2'-NH ₂ - (5m)C 190 UNA-A GNA-(5m)C

- 19 045960

191 UNA-A 4etl- (5m)C 192 UNA-A nmLNA-(5m)C 193 2'-NH ₂ -A 2'-OMe- (5m)C 194 2'-NH ₂ -A 2'-O-MOE- (5m)C 195 2'-NH ₂ -A LNA-(5m)C 196 2'-NH ₂ -A ENA-(5m)C 197 2'-NH ₂ -A scp-BNA- (5m)C 198 2'-NH ₂ -A AmNA- (NMe)- (5m)C 199 2'-NH ₂ -A 2'-O-propargyl- (5m)C 200 2'-NH ₂ -A 2'-O-butynyl-(5m)C 201 2'-NH ₂ -A 2'-F- (5m)C 202 2'-NH ₂ -A 2'-ara-F- (5m)C 203 2'-NH ₂ -A Z'-OMe- (5m)C 204 2'-NH ₂ -A UNA-(5m)C 205 2'-NH ₂ -A 2'-NH ₂ - (5m)C 206 2'-NH ₂ -A GNA-(5m)C 207 2'-NH ₂ -A 4etl- (5m)C 208 2'-NH ₂ -A nmLNA-(5m)C 209 GNA-A 2'-OMe- (5m)C 210 GNA-A 2'-O-MOE- (5m)C 211 GNA-A LNA-(5m)C 212 GNA-A ENA-(5m)C 213 GNA-A scp-BNA- (5m)C 214 GNA-A AmNA- (NMe)- (5m)C 215 GNA-A 2'-O-propargyl- (5m)C 216 GNA-A 2'-O-butynyl-(5m)C

- 20 045960

217 GNA-A 2'-F- (5m)C 218 GNA-A 2'-ara-F- (5m)C 219 GNA-A Z'-OMe- (5m)C 220 GNA-A UNA-(5m)C 221 GNA-A 2'-NH ₂ - (5m)C 222 GNA-A GNA-(5m)C 223 GNA-A 4etl- (5m)C 224 GNA-A nmLNA-(5m)C 225 nmLNA-A 2'-OMe- (5m)C 226 nmLNA-A 2'-O-MOE- (5m)C 227 nmLNA-A LNA-(5m)C 228 nmLNA-A ENA-(5m)C 229 nmLNA-A scp-BNA- (5m)C 230 nmLNA-A AmNA- (NMe)- (5m)C 231 nmLNA-A 2'-O-propargyl- (5m)C 232 nmLNA-A 2'-O-butynyl-(5m)C 233 nmLNA-A 2'-F- (5m)C 234 nmLNA-A 2'-ara-F- (5m)C 235 nmLNA-A Z'-OMe- (5m)C 236 nmLNA-A UNA-(5m)C 237 nmLNA-A 2'-NH ₂ - (5m)C 238 nmLNA-A GNA-(5m)C 239 nmLNA-A 4etl- (5m)C 240 nmLNA-A nmLNA-(5m)C 241 4etl-A 2'-OMe- (5m)C 242 4etl-A 2'-O-MOE- (5m)C

- 21 045960

243 4etl-A LNA-(5m)C 244 4etl-A ENA-(5m)C 245 4etl-A scp-BNA- (5m)C 246 4etl-A AmNA- (NMe)- (5m)C 247 4etl-A 2'-O-propargyl- (5m)C 248 4etl-A 2'-O-butynyl-(5m)C 249 4etl-A 2'-F- (5m)C 250 4etl-A 2'-ara-F- (5m)C 251 4etl-A Z'-OMe- (5m)C 252 4etl-A UNA-(5m)C 253 4etl-A 2'-NH ₂ - (5m)C 254 4etl-A GNA-(5m)C 255 4etl-A 4etl- (5m)C 256 4etl-A nmLNA-(5m)C

The length of the modified oligonucleotide described herein can vary over a wide range. In various embodiments, the modified oligonucleotide described herein comprises at least a partially thiophosphate sequence of alternating fragments A and C, the length of which is about 8 fragments, about 10 fragments, about 12 fragments, about 14 fragments, about 16 fragments, about 18 fragments, approximately 20 fragments, approximately 24 fragments, approximately 30 fragments, approximately 34 fragments, approximately 36 fragments, approximately 38 fragments, approximately 40 fragments, approximately 44 fragments, approximately 50 fragments, approximately 60 fragments, approximately 76 fragments, approximately 100 fragments , approximately 122 fragments, approximately 124 fragments, approximately 150 fragments, approximately 172 fragments, approximately 200 fragments, or ranges between any two of the above values. For example, in one embodiment, the length of the at least partially thiophosphate sequence of alternating fragments A and C is in the range of 8 fragments to 200 fragments. In yet another embodiment, the length of the at least partially thiophosphated sequence of alternating fragments A and C is in any one or more, as appropriate, of the following ranges: from about 8 fragments to about 36 fragments; from about 16 fragments to about 36 fragments; from 20 fragments to 36 fragments; from 16 fragments to 30 fragments; from 18 fragments to 60 fragments; from 20 fragments to 30 fragments; from 30 fragments to 50 fragments; from 34 fragments to 46 fragments, from 36 fragments to 44 fragments; from 44 fragments to 200 fragments; from 44 fragments to 150 fragments; from 44 fragments to 120 fragments; from 50 fragments to 200 fragments; from 50 fragments to 150 fragments; from 50 fragments to 120 fragments; from 60 fragments to 200 fragments; from 60 fragments to 150 fragments; and/or from 60 fragments to 120 fragments.

As described elsewhere herein, in some embodiments, the modified oligonucleotide may comprise one at least partially thiophosphated sequence of alternating fragments A and C, or in other embodiments, the modified oligonucleotide may contain multiple partially thiophosphated sequences of alternating fragments A and C, connected to each other. Thus, the sequence length of a modified oligonucleotide containing at least partially a thiophosphate sequence of alternating fragments A and C may be the same as that of the specified sequence. Examples of such sequence lengths are described elsewhere in this document. Likewise, the length of a modified oligonucleotide containing a plurality of at least partially thiophosphate sequences of alternating fragments A and C can be obtained by connecting these sequences described elsewhere in this document. Examples of sequence lengths of a modified oligonucleotide containing a plurality of at least partially thiophosphated sequences from

- 22 045960 pout fragments A and C, expressed elsewhere in this document in relation to the lengths of the individual sequences, and also taking into account the length of the linking group.

A modified oligonucleotide described herein may comprise a plurality of at least partially thiophosphate sequences of alternating A and C fragments. In one embodiment, if the sequence of alternating A and C fragments contains a ribo-A fragment, then the sequence further comprises at least at least one A fragment that is not a ribo-A fragment. Likewise, in one embodiment, if a sequence of alternating fragments A and C contains a ribo-C fragment, then the sequence further contains at least one fragment C that is not a ribo-C fragment. In one embodiment, the modified oligonucleotide may contain one or more of various nucleotide fragments (known to those skilled in the art, e.g., thymine, cytosine, adenine, guanine, and modified versions thereof) that are not A or C fragments, for example, as terminal (th) group(s) and/or as linking group(s) between two or more of at least partially thiophosphate sequences of alternating fragments A and C. For example, in one embodiment, the modified oligonucleotide comprises one or more of cytosine moieties connecting at least two or more of the at least partially thiophosphated sequences of alternating fragments A and C. In one embodiment, two or more of the at least partially thiophosphated sequences of alternating fragments A and C joined to each other linking group different from A/C are identical to each other. An example of such a modified oligonucleotide is (AC) ₈ -cytosine- (AC) ₈ . Such a modified oligonucleotide containing multiple identical sequences linked together may be referred to herein as a concatemer. Two or more of the at least partially thiophosphated sequences of alternating fragments A and C connected to each other may also differ from each other. An example of such a modified oligonucleotide is (AC) ₈ cytosine-(AC) ₁₆ .

The modified oligonucleotide may contain two or more of different A groups and/or two or more of different C groups. If a group A or C is replaced by another group A or C, it is generally assumed that such substitution does not interrupt the sequence of alternating A and C fragments. For example, in one embodiment, at least some of the A fragments are not 2'Omethylated on the ribose ring and/or at least some of the C fragments are not 2'Omethylated on the ribose ring. However, in some embodiments, the group linking two at least partially thiophosphated sequences of alternating fragments A and C is itself a fragment A or C that interrupts the sequence of alternating fragments A and C. For example, the at least partially thiophosphated 16- A mer of alternating fragments A and C can be combined by fragment A with another such 16mer to form (AC) ₈ -A-(AC) ₈ . Likewise, such a 16-mer can be joined by fragment C to another such 16-mer to form (AC) ₈ -A-(AC) ₈ . As noted above, if a plurality of at least partially thiophosphated sequences of alternating fragments A and C, identical to each other, are connected to each other by a linking group, the modified oligonucleotide may be referred to herein as a concatemer. As stated above, two or more of the at least partially thiophosphated sequences of alternating fragments A and C connected to each other may also differ from each other. Examples of such modified oligonucleotides include (AC) ₈ -A-(AC) ₁₆ and (AC) ₈ -C-(AC) ₁₆ .

In one embodiment, the modified oligonucleotide contains a 5' terminal cap. In various embodiments, said 5'-terminal cap is selected from

In one embodiment, each of the R ¹ and R ² groups is individually selected from hydrogen, deuterium, phosphate, thioC _1-6 alkyl, and cyano; for example, in one embodiment, both R ¹ and R ² are hydrogen atoms and the modified oligonucleotide contains a vinyl phosphonate terminal cap. In other embodiments, both R ¹ and R ² are not hydrogen atoms. In some embodiments, the 5' end cap is selected from

- 23 045960

In other embodiments, the modified oligonucleotide contains a 3' and/or 5' binding group. For example, with respect to modified oligonucleotide compounds containing fragments A and C described herein, for example, fragments A and C from table. 1 and 2, respectively, at least one end group '^νν'θ may be a linking group. Various linking groups known to those skilled in the art can be used to link the modified oligonucleotide to another group (eg, one or more of the second oligonucleotides and/or targeting ligands). In one embodiment, the linking group includes a non-A/C linking group, or a moiety of A or C interrupting the sequence of alternating moieties A and C, as discussed above, or the linking group contains a C _2-6 alkylene linking group (FIG. 1). ), a C _2-6 alkylene oxide linking group, such as a propylene oxide linking group (FIG. 2), or a tetraethylene glycol (TEG) linking group (FIG. 3A-D).

In various embodiments, two, three, four, or more of the modified oligonucleotides may be linked to each other in various ways. For example, modified oligonucleotides can be end-joined through 3' and/or 5' linking groups, and/or linking groups can be linked to one of the 3' or 5' ends of multiple modified oligonucleotides, for example, as shown in FIG. 1 and 2.

In various embodiments, the modified oligonucleotide further comprises a targeting ligand attached to the modified oligonucleotide via a linking group. For example, in various embodiments, the targeting ligand is or contains N-acetylgalactosamine (GalNac) (eg, three-antennary GalNAc), tocopherol, or cholesterol. In fig. 3A and 3B show embodiments of modified oligonucleotides containing cholesterol linked via a 5'-TEG linking group and a 3'-TEG linking group, respectively. In fig. 3C and 3D show embodiments of modified oligonucleotides containing tocopherol (vitamin E) linked via a 5'-TEG linking group and a 3'-TEG linking group, respectively. In fig. 4A and 4B show embodiments of modified oligonucleotides containing GalNac attached via a linking group. In one embodiment, the GalNAc is a three-antenna GalNAc.

In various embodiments, said at least partially thiophosphated sequence of alternating fragments A and C may contain modification(s) of one or more of the thiophosphated bonds. It is generally believed that the inclusion of such a modified linkage does not interrupt the sequence of alternating units A and C, as those skilled in the art appreciate that such a sequence may be only partially thiophosphate and thus may contain one or more modifications of the thiophosphate linkage. In various embodiments, the thiophosphate linkage modification is a modified linkage selected from phosphodiester, dithiophosphate, methylphosphonate, thiodiphosphate, and diphosphodiester linkages. For example, in one embodiment, the modified linkage is a phosphodiester linkage.

In various embodiments, the at least partially thiophosphated sequence of alternating fragments A and C may be characterized by varying degrees of thiophosphate. For example, in one embodiment, said at least partially thiophosphated sequence of alternating fragments A and C is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95% thiophosphated. In one embodiment, said at least partially thiophosphated sequence of alternating fragments A and C is at least 85% thiophosphated. In one embodiment, said at least partially thiophosphated sequence of alternating fragments A and C is completely thiophosphated.

In various embodiments, said at least partially thiophosphated

- 24 045960 a sequence of alternating fragments A and C may contain stereochemical modification(s) of one or more of the thiophosphate bonds. In one embodiment, the modified oligonucleotides described herein may contain at least one stereochemically defined thiophosphate linkage. In various embodiments, the stereochemically defined thiophosphate bond is characterized by the R configuration. In various embodiments, the stereochemically defined thiophosphate bond is characterized by the S configuration.

Those skilled in the art will understand that modified oligonucleotide compounds containing fragments A and C described herein, for example, fragments A and C from table. 1 and 2, respectively, contain internal bonds between fragments A and C, as well as terminal groups at the 3' and 5' ends. Thus, with respect to fragments A and C described in this document, for example fragments A and C from table. 1 and 2, respectively, each group represents an inner group '“‘θ or a terminal group θ

In various embodiments, each end group is independently a hydroxyl, O,O-dihydrothiophosphate, dihydrogen phosphate, end cap, or linking group. In various embodiments, each internal group is a phosphorus-containing bond to an adjacent moiety A or C, wherein said phosphorus-containing bond is a thiophosphate bond or a modified bond selected from phosphodiester, dithiophosphate, methylphosphonate, thiodiphosphate, 5'-phosphoramidate, 3',5' -phosphorodiamidate, 5'-thiophosphoramidate, 3',5'-thiophosphoriamidate or diphosphodiester linkage.

As noted above, the STOPS™ compounds described herein are antiviral oligonucleotides. In various embodiments, a modified oligonucleotide described herein comprising an at least partially thiophosphated sequence of alternating A and C fragments has sequence-independent activity against hepatitis B virus, as determined by an HBsAg secretion assay, that is superior to that of a reference compound. For example, in one embodiment, the sequence-independent activity against hepatitis B virus is at least 2-fold greater than the activity of the reference compound. In yet another embodiment, the sequence-independent activity against hepatitis B virus exceeds the activity of the reference compound in the range of 2 to 5 times. In yet another embodiment, the sequence-independent activity against hepatitis B virus is at least 5 times greater than the activity of the reference compound. In yet another embodiment, the sequence-independent activity against hepatitis B virus exceeds the activity of the reference compound in the range of 5 to 10 times. In yet another embodiment, the sequence-independent activity against hepatitis B virus is at least 10 times greater than the activity of the reference compound. In yet another embodiment, the sequence-independent activity against hepatitis B virus exceeds the activity of the reference compound in the range of 10 to 25 times. In yet another embodiment, the sequence-independent activity against hepatitis B virus is at least 25 times greater than the activity of the reference compound. As used herein, the above terms 2-fold, 5-fold, 10-fold and 25-fold refer to the increased efficiency of the modified oligonucleotide described herein, compared to another compound, in an HBsAg secretion assay, as indicated by the EC ₅₀ value. one-half, one-fifth, one-tenth, or one-twenty-fifth the corresponding value of the reference compound, respectively. For example, a modified oligonucleotide that is twice as potent as the reference compound has an EC ₅₀ in the HBsAg secretion assay that is one-half the EC ₅₀ of the reference compound. Similarly, a modified oligonucleotide that is five times more potent than the reference compound has an EC ₅₀ value in the HBsAg secretion assay that is one-fifth that of the reference compound. Similarly, a modified oligonucleotide that is ten times more potent than the reference compound has an EC ₅₀ value in the HBsAg secretion assay that is one tenth that of the reference compound. Likewise, a modified oligonucleotide that is twenty-five times more potent than the reference compound has an EC ₅₀ value in the HBsAg secretion assay that is one twenty-fifth that of the reference compound. In some embodiments, the reference compound may be a thiophosphated AC 40-mer oligonucleotide known as REP 2139, discussed above. In some embodiments, the reference compound may be an AC 40-mer oligonucleotide having the structure

5’mApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsm

CpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmAps mCpsmApsmCpsmApsmCpsmApsmCpsmApsmC 3’ (2’-OME-A, 2’-OME-C).

- 25 045960

In various embodiments, a modified oligonucleotide described herein comprising an at least partially thiophosphated sequence of alternating A and C fragments has sequence-independent activity against the hepatitis B virus, as determined by an HBsAg secretion assay, and is within the A activity range of less than 30 nM (nM); being in the activity range B from 30 nM to less than 100 nM; in the activity range C from 100 nM to less than 300 nM; or in the D activity range greater than 300 nM. In some embodiments, a modified oligonucleotide described herein comprising an at least partially thiophosphate sequence of alternating A and C fragments has sequence-independent activity against hepatitis B virus, as determined by an HBsAg secretion assay, of less than 50 nM.

The modified oligonucleotides described herein can be prepared in the form of various complexes. Thus, in one embodiment, a chelate complex of a modified oligonucleotide described herein is provided. For example, in one embodiment, such a chelate complex includes a chelate complex of calcium, magnesium, or zinc and a modified oligonucleotide. The modified oligonucleotides described herein can also be prepared in the form of various monovalent counterion complexes. For example, in one embodiment, such a counterion complex includes a complex of lithium, sodium or potassium and a modified oligonucleotide.

In one embodiment, a modified oligonucleotide or complex thereof is provided having sequence-independent activity against the hepatitis B virus, comprising at least a partially thiophosphated sequence of alternating fragments A and C described herein, wherein said at least partially thiophosphated sequence of alternating fragments fragments A and C are at least 85% thiophosphated;

the length of said at least partially thiophosphated sequence of alternating fragments A and C is in the range from 36 fragments to 44 fragments;

fragments A contain at least 12 2'-OMe-A fragments (e.g., at least 15 2'-OMe-A fragments) and at least 1 ribo-A fragment (e.g., at least 2 ribo-A fragments) ;

fragments C contain at least 15 LNA-5mC fragments; and said modified oligonucleotide has an EC ₅₀ value determined by the HBsAg secretion assay of less than 100 nM (eg, less than 50 nM or less than 30 nM).

In one embodiment, a modified oligonucleotide or complex thereof is provided having sequence-independent activity against the hepatitis B virus, comprising at least a partially thiophosphated sequence of alternating fragments A and C described herein, wherein said at least partially thiophosphated sequence of alternating fragments fragments A and C are at least 85% thiophosphated;

the length of said at least partially thiophosphated sequence of alternating fragments A and C is in the range from 36 fragments to 44 fragments;

fragments A contain at least 15 fragments of 2'-OMe-A;

fragments C contain at least 7 fragments of LNA-5mC; and said modified oligonucleotide has an EC50 value determined by an HBsAg secretion assay of less than 100 nM (eg, less than 50 nM or less than 30 nM).

In one embodiment, a modified oligonucleotide or complex thereof is provided having sequence-independent activity against the hepatitis B virus, comprising at least a partially thiophosphated sequence of alternating fragments A and C described herein, wherein said at least partially thiophosphated sequence of alternating fragments fragments A and C are at least 85% thiophosphated;

the length of said at least partially thiophosphated sequence of alternating fragments A and C is in the range from 36 fragments to 44 fragments;

fragments A contain at least 15 fragments of 2'-OMe-A;

fragments C contain at least 3 fragments of LNA-5mC; and said modified oligonucleotide has an EC ₅₀ value determined by the HBsAg secretion assay of less than 100 nM (eg, less than 50 nM or less than 30 nM).

In one embodiment, a modified oligonucleotide or complex thereof is provided that has sequence-independent activity against the hepatitis B virus, containing at least partially a thiophosphate sequence of alternating fragments A and

- 26 045960

C as described herein, wherein said at least partially thiophosphated sequence of alternating fragments A and C is at least 85% thiophosphated;

the length of said at least partially thiophosphated sequence of alternating fragments A and C is in the range from 36 fragments to 44 fragments;

fragments A contain at least 18 fragments of 2'-OMe-A;

fragments C contain at least 15 LNA-5mC fragments; and said modified oligonucleotide has an EC ₅₀ value determined by the HBsAg secretion assay of less than 100 nM (eg, less than 50 nM or less than 30 nM).

Synthesis.

The modified oligonucleotides described herein can be prepared in a variety of ways. In one embodiment, the building block monomers described in Table. 4 and 5 are used to prepare the modified oligonucleotides described herein using standard phosphoramidite chemistry. The building blocks described in table. 4 and 5, and other phosphoramidite monomer building blocks can be prepared by known methods or obtained from commercial sources (Thermo Fischer Scientific US, Hongene Biotechnology USA Inc., Chemgenes Corporation).

Typical procedures for preparing modified oligonucleotides are given below in the Examples section.

Table 4. Building blocks for fragments A

Reduction Structure 2'-ОМе-А PHOSPHORUS AMIDITE NHBz n~A _n T J? DMTO— ^N ° mains F NC 2'-F-A PHOSPHORAMIDITE NHBz N^zA-N < ^Z 1 Jj DMTO--\, ₀ Ϊ ? F. p. NC 2'-O-MOE-A PHOSPHORUS AMIDITE NHBz < I Jj DMTO—v _o 7 ^N ? C>* ^OSN with NC

- 27 045960

- 28 045960

2'-F-Ara-A PHOSPHORAMIDITE NHBz ⁿ An < I j DMTO—s. 0 Ϊ ^N 0 1 ,P. NC 2'-O-propargyl-A PHOSPHORAMIDITE NHBz ν^Α _ν X j DMTO---< / ^N °\ ,P. SNC UNA-A PHOSPHORAMIDITE /= ^N . DMTrO \ / |f ) \ Nx/N 0 OBz \ D-ο N \___ CN GNA-A PHOSPHORAMIDITE O O C \ NHBz DMTrO^A^ N \NN^/

- 29 045960

- 30 045960

Table 5. Building blocks for fragments C

- 31 045960

- 32 045960

2'-O-butyne- (5m)C PHOSPHORAMIDITE NHBz O^X) DMTO---k / \^O _> / ,P. S NO 2'-NH ₂ - (5m)C PHOSPHORAMIDITE NHBZ NX) dmto^^q^i θ NHTFA _P _S S NC 2’-F-Ara- (5m)C PHOSPHORAMIDITE NHBZ Yi NX) DMTO—v _o I V ^Lf o 1 X S NC 2'-O-propargyl- (5m)C PHOSPHORAMIDITE NHBz Vx ⁴ NO DMTO---k ₀ I °\ P ₄ S NC

- 33 045960

UNA- (5m)C PHOSPHORAMIDITE ^X^NHBz DMTro'*'^ 0 OBz \ ,' ^p -o y—N \__ } CN GNA- (5m)C PHOSPHORAMIDITE I N.C. .NHBz 0 0 DMTrO^X^ N N 0 3'-O-methyl-(5m)C PHOSPHORAMIDITE NHBz yS Υ'Ύ} DMTO-- H ₃ CO 0 \ ,P. SNC scp-BNA- (5m)C PHOSPHORAMIDITE NHBz yS DMTrO----у I ^ν0 Ύ^° ⁴ rA I TA ² ^

- 34 045960

In various embodiments, the modified STOPS™ oligonucleotides described herein can also be prepared using dinucleotides containing or consisting of any two monomer building blocks described in Table. 4 and 5. Typical procedures for preparing dinucleotides and corresponding modified oligonucleotides are given below in the Examples section.

In one embodiment, a dinucleotide is provided containing or consisting of fragment A or fragment C linked by a stereochemically defined thiophosphate bond, wherein fragment A

- 35 045960 is selected from any of the monomer building blocks described in table. 4, and fragment C is selected from any of the monomer building blocks described in table. 5, each group independently represents hydroxyl, O,O-dihydrothiophosphate, Ο,Ο-dihydrogen phosphate, phosphoramidite, dimethoxytrityl ether, or a stereochemically specified thiophosphate bond. In one embodiment, the group is phosphoramidite according to the following formula (A):

R ¹

N—R ²

-4-0—P<

* o—R ³ (A)

In various embodiments, each of the R ¹ and R ² groups of formula (A) is individually C1-6 alkyl, and R ³ is C1-6 alkyl or cyanoC _1-6 alkyl. For example, in one embodiment, phosphoramidite according to formula (A) is phosphoramidite according to the following formula (A1):

—P<\* ^xo— <

\--CN (A1)

In various embodiments, the group is a stereochemically defined thiophosphate bond, which is a thiophosphate. For example, in one embodiment, said stereochemically specified thiophosphate bond is a thiophosphate according to the following formulas (B1) or (B2):

Uo Uo f 4I

S=P—OR ⁴ ...OR

II (Bl)(B2)

In various embodiments, the group R ⁴ according to formulas (B1) and (B2) represents C _1-6 -alkyl or cyanoC _1-6 -alkyl. For example, in one embodiment, thiophosphates of formulas (B1) and (B2) are thiophosphates of formulas (B3) and (B4), respectively:

Various embodiments provide methods for preparing a modified oligonucleotide described herein, including the addition of one or more of the dinucleotides described herein. Typical methods for making this connection are described below in the Examples section.

Pharmaceutical compositions.

Certain embodiments described herein relate to a pharmaceutical composition that may comprise a compound described herein (e.g., a modified STOPS™ oligonucleotide compound or complex thereof described herein) and a pharmaceutically acceptable carrier, excipient, or the same. combination. The pharmaceutical composition described herein is suitable for medical and/or veterinary use.

As used herein, the term carrier refers to a compound that facilitates the introduction of the compound into cells or tissues. For example, without limitation, dimethyl sulfoxide (DMSO) is a commonly used vehicle to facilitate the uptake of many organic compounds into cells or tissues of a subject.

As used herein, the term diluent refers to an ingredient in a pharmaceutical composition that has no pharmacological activity but is pharmaceutically necessary.

- 36 045960 we or as desired. For example, a diluent can be used to increase the volume of a potent drug that is too small to produce and/or administer. It may also be a liquid for dissolving a drug administered by injection, ingestion or inhalation. A common form of diluent in the art is a buffered aqueous solution, such as, but not limited to, phosphate buffered saline, which mimics the composition of human blood.

As used herein, the term excipient refers to an inert substance added to a pharmaceutical composition for the purpose of imparting, without limitation, desired volume, consistency, stability, binding stability, glidibility, disintegrability, etc. to the composition. A diluent is a type of excipient.

The appropriate formulation depends on the route of administration chosen. Methods for formulating and administering the compounds described herein are known to those skilled in the art. Various routes of administration of a compound exist in the art, including oral, rectal, topical, aerosol, injection, and parenteral delivery, including intramuscular, subcutaneous, intravenous, intramedullary, intrathecal, direct intraventricular, intraperitoneal, intranasal, and intraocular injection, but not limiting ourselves to them. Pharmaceutical compositions are typically tailored to a specific, predetermined route of administration.

It is possible to administer the compound locally rather than systemically, for example by injecting the compound directly into the infected area, optionally in a sustained or delayed release formulation. In addition, the compound can be administered as part of a targeted drug delivery system, for example, in a liposome coated with a tissue-specific antibody. It is possible to provide targeted delivery of liposomes that are selectively absorbed by a specific organ.

The pharmaceutical compositions described herein can be produced in a manner that is per se known, for example, through conventional mixing, dissolving, granulating, dragee-making, elutriating, emulsifying, encapsulating, encapsulating, or tableting processes. As used herein, the compounds used in the pharmaceutical composition may be presented as salts with pharmaceutically compatible counterions.

Methods of application.

Certain embodiments described herein relate to a method of treating HBV and/or HGO infection, which may include administering to a subject found to be suffering from HBV and/or HGO infection an effective amount of a modified oligonucleotide or complex thereof described in herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide or complex thereof described herein. Other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof described herein in the manufacture of a medicament for the treatment of HBV or HBV infection. Other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof described herein, or a pharmaceutical composition containing a modified oligonucleotide described herein, for the treatment of HBV or HBV infection.

Various routes can be used to administer the modified oligonucleotide or complex thereof to a subject in need thereof, as discussed elsewhere herein. In one embodiment, the modified oligonucleotide or complex thereof is administered to a subject by parenteral route. For example, in one embodiment, the modified oligonucleotide or complex thereof is administered intravenously to a subject. In yet another embodiment, the modified oligonucleotide or complex thereof is administered to a subject subcutaneously. Surprisingly, embodiments of the modified oligonucleotide or complex thereof described herein can be administered subcutaneously to a primate in an amount that provides safe and effective treatment. It was previously considered unlikely that subcutaneous administration of a modified oligonucleotide or complex thereof (e.g., REP 2139, REP 2055, or the compounds described in U.S. Pat. Nos. 7,358,068; 8008269; 8008270 and 8067385) to a primate was safe and effective because it was believed that it required relatively high dosages, and because of the concomitant increase in possible risk of safety problems, such as adverse reactions at the injection site. For example, previous clinical studies involving the administration of REP 2139 to humans were considered to have used only intravenous administration. It was believed that safety concerns, such as injection site adverse reactions at dosage levels considered necessary to achieve efficacy, would preclude the use of subcutaneous administration.

Surprisingly, as shown in FIG. 12 and Example B5 below, hepatic exposure following subcutaneous administration to non-human primates was found to be significantly higher than expected based on hepatic exposure levels following intravenous administration of an otherwise comparable dosage. This result means that implementations of modified oli

- 37 045960 gonucleotides or complexes thereof described herein, and in particular, embodiments of the highly potent STOPS™ compounds or complexes described herein can be safely and effectively administered to primates via subcutaneous administration at lower dosages than dosages previously considered potentially effective. These lower dosages reduce the risk profile (eg, reduce the risk of injection site reactions) and thus have a clinically acceptable safety profile for medical use.

Certain embodiments described herein relate to a method of treating HBV and/or RGO infection, which may include contacting a cell infected with HBV and/or RGO in contact with an effective amount of a modified oligonucleotide or complex thereof described herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide or complex thereof described herein. In one embodiment, such a method of treating HBV and/or HGO infection comprises safe and effective subcutaneous administration of a modified oligonucleotide or complex thereof to a human at a dosage reduced from the expected dosage based on observed liver levels following otherwise comparable intravenous administration. For example, in one embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In yet another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof described herein. For example, in one embodiment, a STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof described herein containing at least partially a thiophosphate sequence of alternating A and C fragments and having sequence-independent activity against hepatitis B virus as determined by by HBsAg secretion assay and within the activity range A of less than 30 nM.

Other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof described herein in the manufacture of a medicament for the treatment of HBV and/or HBV infection. Other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof described herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide or complex thereof described herein, for the treatment of HBV and/or HSV infection. In one embodiment, such use includes the safe and effective subcutaneous administration of a modified oligonucleotide or complex thereof to a human at a dosage reduced from the expected dosage based on observed liver levels following otherwise comparable intravenous administration. For example, in one embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In yet another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof described herein. For example, in one embodiment, a STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof described herein containing at least partially a thiophosphate sequence of alternating A and C fragments and having sequence-independent activity against hepatitis B virus as determined by by HBsAg secretion assay and within the activity range A of less than 30 nM.

Certain embodiments described herein relate to a method of inhibiting the replication of HBV and/or RGO, which may include contacting a cell infected with HBV and/or RGO in contact with an effective amount of a modified oligonucleotide or complex thereof described herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide or complex thereof described herein. In one embodiment, such a method of inhibiting the replication of HBV and/or HGO involves the safe and effective subcutaneous administration of a modified oligonucleotide or complex thereof to a human at a dosage reduced from the expected dosage based on observed levels in the liver after an otherwise comparable intravenous administration. For example, in one embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In yet another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof described herein. For example, in one embodiment, a STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof described herein containing at least partially a thiophosphate sequence of alternating A and C fragments and having sequence-independent activity against hepatitis B virus as determined by by HBsAg secretion assay and within the activity range A of less than 30 nM.

Other embodiments described herein relate to the use of modi

- 38 045960 of a modified oligonucleotide or complex thereof described herein, in the production of a medicinal product for inhibiting the replication of HBV and/or HBV. Other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof described herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide or complex thereof described herein, to inhibit the replication of HBV and/or VGO. In one embodiment, such use for inhibiting the replication of HBV and/or HBV involves the safe and effective subcutaneous administration of a modified oligonucleotide or complex thereof to a human subject compared to the expected dosage based on observed liver levels following otherwise comparable intravenous administration. For example, in one embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In yet another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof described herein. For example, in one embodiment, a STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof described herein containing at least partially a thiophosphate sequence of alternating A and C fragments and having sequence-independent activity against hepatitis B virus as determined by by HBsAg secretion assay and within the activity range A of less than 30 nM.

In some embodiments, the HBV infection may be an acute HBV infection. In some embodiments, the HBV infection may be a chronic HBV infection.

Certain embodiments described herein relate to a method of treating cirrhosis of the liver resulting from HBV and/or VGO infection, which may include administering to a subject suffering from liver cirrhosis and/or introducing a cell infected with HBV and/or VGO, in the body of a subject suffering from cirrhosis of the liver, into contact with an effective amount of a modified oligonucleotide or complex thereof described herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide or complex thereof described herein. In one embodiment, such a method of treating liver cirrhosis resulting from HBV and/or HBV infection comprises the safe and effective subcutaneous administration of a modified oligonucleotide or complex thereof to a human subject at a dosage reduced from the expected dosage based on observed levels in the liver after comparable in other respects intravenous administration. For example, in one embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In yet another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof described herein. For example, in one embodiment, a STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof described herein containing at least partially a thiophosphate sequence of alternating A and C fragments and having sequence-independent activity against hepatitis B virus as determined by by HBsAg secretion assay and within the activity range A of less than 30 nM.

Other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof described herein in the manufacture of a medicament for the treatment of liver cirrhosis resulting from HBV and/or HBV infection using an effective amount of the modified oligonucleotide(s). oligonucleotide(s). Other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof described herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide or complex thereof described herein, for the treatment of cirrhosis of the liver resulting from infection HBV and/or VGO. In one embodiment, such use for the treatment of cirrhosis of the liver includes the safe and effective subcutaneous administration of a modified oligonucleotide or complex thereof to a human at a dosage reduced from the expected dosage based on observed levels in the liver after an otherwise comparable intravenous administration. For example, in one embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In yet another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof described herein. For example, in one embodiment, a STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof described herein containing at least partially a thiophosphate sequence of alternating A and C fragments and having sequence-independent activity against hepatitis B virus as determined by by HBsAg secretion assay and within the activity range A of less than 30 nM.

Certain embodiments described herein relate to a method of treating

- 39 045960 liver cancer (for example, hepatocellular carcinoma) resulting from infection with HBV and/or VGO, which may involve administering to a subject suffering from liver cancer and/or introducing a cell infected with HBV and/or VGO into the subject's body, suffering from liver cancer in contact with an effective amount of a modified oligonucleotide or complex thereof described herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide or complex thereof described herein. In one embodiment, such a method of treating liver cancer (e.g., hepatocellular carcinoma) resulting from HBV and/or HBV infection comprises safe and effective subcutaneous administration of a modified oligonucleotide or complex thereof to a human subject at a dosage reduced from the expected dosage based on observed levels in the liver after otherwise comparable intravenous administration. For example, in one embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In yet another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof described herein. For example, in one embodiment, the STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof described herein containing at least a partially thiophosphate sequence of alternating A and C fragments and having sequence-independent activity against hepatitis virus

B, determined by HBsAg secretion assay and falling within the A activity range of less than 30 nM.

Other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof described herein in the manufacture of a medicament for the treatment of liver cancer (eg, hepatocellular carcinoma) resulting from HBV and/or HBV infection. Other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof described herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide or complex thereof described herein, for the treatment of liver cancer (e.g., hepatocellular carcinoma ), developed as a result of infection with HBV and/or VGO. In one embodiment, such use for the treatment of liver cancer (eg, hepatocellular carcinoma) includes the safe and effective subcutaneous administration of a modified oligonucleotide or complex thereof to a human subject at a dosage reduced from the expected dosage based on observed levels in the liver after otherwise comparable intravenous administration . For example, in one embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In yet another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof described herein. For example, in one embodiment, a STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof described herein containing at least partially a thiophosphate sequence of alternating A and C fragments and having sequence-independent activity against hepatitis B virus as determined by by HBsAg secretion assay and within the activity range A of less than 30 nM.

Certain embodiments described herein relate to a method of treating liver failure resulting from HBV and/or VGO infection, which may include administering to a subject suffering from liver failure and/or introducing a cell infected with HBV and/or VGO, in the body of a subject suffering from liver failure, into contact with an effective amount of a modified oligonucleotide or complex thereof described herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide or complex thereof described herein. In one embodiment, such a method of treating liver failure resulting from HBV and/or HBV infection comprises the safe and effective subcutaneous administration of a modified oligonucleotide or complex thereof to a human subject at a dosage reduced from the expected dosage based on observed liver levels after comparable in other respects intravenous administration. For example, in one embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In yet another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof described herein. For example, in one embodiment, a STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof described herein containing at least partially a thiophosphate sequence of alternating A and C fragments and having sequence-independent activity against hepatitis B virus as determined by by HBsAg secretion assay and within the activity range A of less than 30 nM.

- 40 045960

Other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof described herein in the manufacture of a medicament for the treatment of liver failure resulting from HBV and/or HBV infection. Other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof described herein, or a pharmaceutical composition containing an effective amount of a modified oligonucleotide or complex thereof described herein, for the treatment of liver failure resulting from an infection HBV and/or VGO. In one embodiment, such use for the treatment of liver failure involves the safe and effective subcutaneous administration of a modified oligonucleotide or complex thereof to a human subject at a dosage reduced from the expected dosage based on observed liver levels following otherwise comparable intravenous administration. For example, in one embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In yet another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS™ compound or complex thereof described herein. For example, in one embodiment, a STOPS™ compound or complex thereof is a modified oligonucleotide or complex thereof described herein containing at least partially a thiophosphate sequence of alternating A and C fragments and having sequence-independent activity against hepatitis B virus as determined by by HBsAg secretion assay and within the activity range A of less than 30 nM.

Various indicators are also known to those skilled in the art to determine the effectiveness of a method of treating HBV and/or HBV infection. Examples of suitable indicators include a decrease in viral load, as indicated by a decrease in HBV DNA (or load), HBV surface antigen (HBsAg) and HBV e antigen (HBeAg), a decrease in plasma viral load, a decrease in the intensity of viral replication, a decrease in time to seroconversion (the virus is not detectable in the patient's serum), but is not limited to, increasing the incidence of sustained viral response to treatment, improving liver function, and/or reducing morbidity or mortality as a disease outcome.

In some embodiments, an effective amount of a modified oligonucleotide or complex thereof described herein is an amount that effectively achieves a sustained virologic response, such as a sustained virologic response 12 months after completion of treatment.

Subjects with an overt diagnosis of HBV and/or HGE infection include naïve subjects (i.e., subjects not previously treated for HBV and/or HGE) and subjects with previous treatment failure for HBV and/or HGE (treatment failure subjects). . Treatment failure subjects include non-responders (subjects who do not achieve a sufficient reduction in ALT levels, e.g., a subject who, within 6 months of starting anti-HBV and/or HGO therapy, has failed to achieve a reduction of more than 1 lg compared with baseline) and relapsed subjects (subjects previously treated for HBV and/or HBV who exhibit an increase in ALT level, e.g. > twice the ALT level at the upper limit of the normal range, and detectable by HBV DNA hybridization assay serum). Additional examples of subjects include subjects with HBV and/or RGO infection and no symptoms.

In some embodiments, a modified oligonucleotide or complex thereof described herein can be administered to a treatment-failed subject suffering from HBV and/or HBV. In some embodiments, a modified oligonucleotide or complex thereof described herein can be administered to an unresponsive subject suffering from HBV and/or HBV. In some embodiments, a modified oligonucleotide or complex thereof described herein can be administered to a relapsed subject suffering from HBV or HBV. In some embodiments, the subject may have HBeAg-positive chronic hepatitis B. In some embodiments, the subject may have HBeAg-negative chronic hepatitis B. In some embodiments, the subject may have cirrhosis of the liver. In some embodiments, the subject may be asymptomatic, e.g., the subject may be infected with HBV and/or VGO but may not exhibit symptoms of the viral infection. In some embodiments, the subject may be immunocompromised. In some embodiments, the subject may undergo chemotherapy.

Examples of agents used to treat HBV and/or HBV include interferons (eg, IFN-α, and pegylated interferons, including PEG-IFN-α-2a), and nucleosides/nucleotides (eg, lamivudine, telbivudine, adefovir dipivoxil, clevudine , entecavir, tenofovir alafenamide and tenofovir disoproxil). However, some disadvantages associated with interferon-based drugs are unwanted side effects, the need for subcutaneous administration, and high cost. The disadvantage of nucleoside/nucleotide treatment is the development

- 41 045960 stability.

Resistance may be a reason for treatment failure. As used herein, the term resistance refers to a viral strain characterized by a delayed, weakened and/or absent response to an antiviral agent. In some embodiments, a modified oligonucleotide or complex thereof described herein can be administered to a subject infected with a strain of HBV and/or VGO that is resistant to one or more of the anti-HBV and/or VGO agents. Examples of antiviral agents to which resistance may develop include lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, and tenofovir disoproxil. In some embodiments, there is a delay in the development of resistant strains of HBV and/or HGE if a subject is treated with a modified oligonucleotide described herein, compared to the development of strains of HBV and/or HGE that are resistant to other anti-HBV and/or HGE agents , such as those described herein.

Combined therapeutic agents.

In some embodiments, a modified oligonucleotide or complex thereof described herein can be used in combination with one or more additional agents to treat and/or inhibit the replication of HBV and/or HBV. Additional agents include, but are not limited to, interferon, nucleoside/nucleotide analogs, capsid assembly modulator, sequence-specific oligonucleotide (eg, antisense oligonucleotide and/or siRNA), cell entry inhibitor, and/or small molecule immunomodulator. For example, in one embodiment, a modified oligonucleotide or complex thereof described herein can be used as a first drug in combination with one or more second drugs for treating HBV, wherein said second drug comprises a second oligonucleotide having sequence-independent activity anti-hepatitis B virus, siRNA oligonucleotide (or nucleotides), antisense oligonucleotide, nucleoside, interferon, immunomodulator, capsid assembly modulator, or a combination thereof. Examples of additional agents include recombinant interferon-alpha 2b, IFN-α, PEGIFN-a-2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, tenofovir disoproxil, JNJ-3989 (ARO-HBV), RG6004, GSK3228836 , AB-729, VIR-2218, DCR-HBVS, JNJ-6379, GLS4, ABI-HO731, JNJ-440, NZ-4, RG7907, AB-423, AB-506 and ABI-H2158. In one embodiment, the additional agent is a capsid assembly modulator (CAM). In one embodiment, the additional agent is an antisense oligonucleotide (ASO).

In some embodiments, a modified oligonucleotide or complex thereof described herein may be administered along with one or more additional agents as part of a single pharmaceutical composition. In some embodiments, a modified oligonucleotide or complex thereof described herein can be administered with one or more additional agents in the form of two or more separate pharmaceutical compositions. In addition, the order of administration of the modified oligonucleotide or complex thereof described herein with one or more additional agents may vary.

Examples

Additional embodiments are described in more detail in the following examples, which in no way limit the essence of the claims.

Examples 1-116.

A series of modified oligonucleotides containing thiophosphate sequences of alternating fragments A and C were synthesized on an ABI 394 synthesizer using standard chemical reactions characteristic of phosphoramidites. The solid support was controlled pore glass (CPG, 1000A, Glen Research, Sterling, VA, USA), and the monomer building blocks are described in Table. 4 and 5. The reagent (dimethylaminomethylidene)amino)-3H1,2,4-dithiazoline-3-thione (DDTT) was used as a sulfur transfer agent for the synthesis of oligonucleotide thiophosphate (PS-linkages). Intensive addition of a 0.1 M solution of phosphoramidite in CH ₃ CN in the presence of the activator -5-(ethylthio)-III-tetrazole to an oligonucleotide bound to a solid support, followed by capping, oxidation and deprotection made it possible to obtain modified oligonucleotides. The efficiency of the step-by-step addition of all modified phosphoramidites was more than 95%. In addition, several modified oligonucleotides were obtained that contained sequences of alternating fragments A and C, but bearing phosphodiester (PO) bonds instead of thiophosphate (PS) bonds.

Removing protection.

Once synthesis was complete, the controlled pore glass (CPG) was transferred to a screw cap vial or an RNase-free screw cap microcentrifuge tube. The oligonucleotide was cleaved from the support simultaneously with deprotection of the base and phosphate groups using 1.0 ml of a mixture of ammonia and ethanol (ammonia: ethanol (3:1) for 5-15 hours at 55°C. The vial was briefly cooled on ice, and then the mixture of ammonia and ethanol was transferred to

- 42 045960 new microcentrifuge tube. The CPG was washed with 2 x 0.1 mL deionized water, placed in dry ice for 10 min, and then dried in a vacuum evaporator.

Quantification of crude oligomer or analysis of raw material.

Samples were dissolved in deionized water (1.0 mL) and quantitated as follows: First, a blank sample of water (1 mL) was analyzed. 20 μL of sample and 980 μL of water were thoroughly mixed in a microcentrifuge tube, transferred to a cuvette, and absorbance values at 260 nm were obtained. The crude material was dried and stored at -20°C.

HPLC purification of oligomer.

Crude oligomers were analyzed and purified by HPLC (Dionex PA 100). The buffer system was: A = water, B = 0.25 M Tris-HCl pH 8, C: 0.375 M sodium perchlorate, flow rate 5.0 ml/min, wavelength 260 nm. Initially, a small amount of material (~5 OD) was injected and analysis was performed by LC-MS. Once the authenticity of this material was confirmed, the crude oligomer could be purified using more material, for example, 60 OD per cycle, flow rate 5 ml/min. Fractions containing full-length oligonucleotides were pooled, evaporated, and ultimately desalted as described below.

Desalting of purified oligomer.

The purified dry oligomer was then desalted using Sephadex G-25M (Amersham Biosciences). The cartridge was conditioned in 10 ml of water. The purified oligomer was thoroughly dissolved in 2.5 ml of RNase-free water and then applied to the cartridge with very slow dropwise elution. The salt-free oligomer was eluted using 3.5 ml of water into a screw cap vial.

HPLC analysis and electrospray LC/MS.

Approximately 0.2 OD of the oligomer was dried, redissolved in water (50 μL), and then pipetted into special vials for HPLC and LC-MS analysis.

In table 6 provides a summary of the sequence length of alternating A and C fragments and the phosphorothiophosphate (PS) or phosphodiester (PO) backbone nature of the resulting typical modified oligonucleotides.

Table 6

No. Length Modification A Modification C Frame 1 (AS)20 2'-ОМе 2'-ОМе PS 2 (AS) 15 2'-ОМе 2'-ОМе PS 3 (AS)25 2'-ОМе 2'-ОМе PS 4 (AS)ZO 2'-ОМе 2'-ОМе PS 5 (AS)20 2'-OH-MY 2'-OH-MY PS

- 43 045960

6 (AS)20 LNA LNA PS 7 (AS)20 2'-F 2'-F PS 8 (AS)20 2'-O-propargyl 2'-O-propargyl PS 9 (AS)20 2'-O-butine 2'-O-butine PS 10 (AS)20 2'-F-Ara 2'-F-Ara PS AND (AS)20 UNA UNA PS 12 (AS)20 ΕΝΑ ENA PS 13 (AS)20 2'-ОМе 2'-O-MOE PS 14 (AS)20 2'-ОМе LNA PS 15 (AS)20 2'-ОМе 2'-F PS 16 (AS)20 2'-ОМе 2'-O-propargyl PS 17 (AS)20 2'-ОМе 2'-O-butine PS 18 (AS)20 2'-ОМе 2'-F-Ara PS 19 (AS)20 2'-ОМе UNA PS 20 (AS)20 2'-ОМе ENA PS 21 (AS)20 2'-ОМе 2'-NH ₂ PS 22 (AS)20 2'-OH-MY 2'-OMe PS 23 (AS)20 2'-OH-MY LNA PS 24 (AS)20 2'-OH-MY 2'-F PS 25 (AS)20 2'-OH-MY 2'-O-propargyl PS 26 (AS)20 2'-OH-MY 2'-O-butine PS 27 (AS)20 2'-OH-MY 2'-F-Ara PS 28 (AS)20 2'-OH-MY UNA PS 29 (AS)20 2'-OH-MY ENA PS thirty (AS)20 2'-OH-MY 2'-NH ₂ PS 31 (AS)20 LNA 2'-OMe PS 32 (AS)20 LNA 2'-O-MOE PS 33 (AS)20 LNA 2'-F PS 34 (AS)20 LNA 2'-O-propargyl PS 35 (AS)20 LNA 2'-O-butine PS 36 (AS)20 LNA 2'-F-Ara PS 37 (AS)20 LNA UNA PS 38 (AS)20 LNA ENA PS 39 (AS)20 LNA 2'-NH ₂ PS 40 (AS)20 2'-F LNA PS 41 (AS)20 2'-F 2'-OMe PS 42 (AS)20 2'-F 2'-O-MOE PS 43 (AS)20 2'-F 2'-O-propargyl PS

- 44 045960

44 (AC)20 2'-F 2'-O-butine PS 45 (AC)20 2'-F 2'-F-Ara PS 46 (AC)20 2'-F UNA PS 47 (AC)20 2'-F ENA PS 48 (AC)20 2'-F 2'-NH ₂ PS 49 (AC)20 2'-O-propargyl 2'-OMe PS 50 (AC)20 2'-O-propargyl 2'-O-MOE PS 51 (AC)20 2'-O-propargyl LNA PS 52 (AC)20 2'-O-propargyl 2'-F PS 53 (AC)20 2'-O-propargyl 2'-O-butine PS 54 (AC)20 2'-O-propargyl 2'-F-Ara PS 55 (AC)20 2'-O-propargyl UNA PS 56 (AC)20 2'-O-propargyl ENA PS 57 (AC)20 2'-O-propargyl 2'-NH ₂ PS 58 (AC)20 2'-O-butine 2'-OMe PS 59 (AC)20 2'-O-butine 2'-O-MOE PS 60 (AC)20 2'-O-butine LNA PS 61 (AC)20 2'-O-butine 2'-F PS 62 (AC)20 2'-O-butine 2'-O-propargyl PS 63 (AC)20 2'-O-butine 2'-F-Ara PS 64 (AC)20 2'-O-butine UNA PS 65 (AC)20 2'-O-butine ENA PS 66 (AC)20 2'-O-butine 2'-NH ₂ PS 67 (AC)20 2'-F-Ara 2'-OMe PS 68 (AC)20 2'-F-Ara 2'-O-MOE PS 69 (AC)20 2'-F-Ara LNA PS 70 (AC)20 2'-F-Ara 2'-F PS 71 (AC)20 2'-F-Ara 2'-O-propargyl PS 72 (AC)20 2'-F-Ara 2'-O-butine PS 73 (AC)20 2'-F-Ara UNA PS 74 (AC)20 2'-F-Ara ENA PS 75 (AC)20 2'-F-Ara 2'-NH ₂ PS 76 (AC)20 UNA 2'-OMe PS 77 (AC)20 UNA 2'-O-MOE PS 78 (AC)20 UNA LNA PS 79 (AC)20 UNA 2'-F PS 80 (AC)20 UNA 2'-O-propargyl PS 81 (AC)20 UNA 2'-O-butine PS

- 45 045960

82 (AS)20 UNA 2'-F-Ara PS 83 (AS)20 UNA ENA PS 84 (AS)20 UNA 2'-NH ₂ PS 85 (AS)20 ΕΝΑ 2'-OMe PS 86 (AS)20 ΕΝΑ 2'-O-MOE PS 87 (AS)20 ΕΝΑ LNA PS 88 (AS)20 ΕΝΑ 2'-F PS 89 (AS)20 ΕΝΑ 2'-O-propargyl PS 90 (AS)20 ΕΝΑ 2'-O-butine PS 91 (AS)20 ΕΝΑ 2'-F-Ara PS 92 (AS)20 ΕΝΑ UNA PS 93 (AS)20 ΕΝΑ 2'-NH ₂ PS 94 (AS)20 LNA 2'-O-MOE PS 95 (AS)20 2'-F LNA PS 96 (AS)25 2'-OMe 2'-OMe P.O. 97 (AS)25 2'-ОМе 2'-OMe PS 98 (AS)20 2'-F 2'-OMe PS 99 (AS)20 LNA 2'-O-Me PS 100 (AS)20 2'-OMe 2'-F PS 101 (AS)20 2'-OMe 2'-OMe P.O. 102 (AS)20 2'-F 2'-O-MOE PS 103 (AS)ZO 2'-OMe 2'-OMe PS 104 (AS) 15 2'-OMe 2'-OMe PS 105 (AS)20 2'-OMe LNA PS 106 (AS)20 LNA LNA PS 107 (AS)20 2'-OMe 2'-O'MOE PS 108 (AS)20 2'-O-MOE 2'-OMe PS 109 (AS)20 2'-OMe 2'-OMe PS BY (AS)ZO 2'-OMe 2'-O-butine P.O. 111 (AS)20 2'-F 2'-F PS 112 (AS)20 2'-OMe 2'-OMe PS FROM (AS) 15 2'-OMe 2'-OMe P.O. 114 (AS)20 2'-O-MOE 2'-O-MOE PS 115 (AS)20 2'-O-MOE 2'-F PS 116 (AS)20 LNA 2'-F PS

Examples 117-130.

The effect of the 5' modification was assessed by preparing a series of thiophosphate oligonucleotides in accordance with the methods described above in examples 1-116. Terminal-capped oligonucleotides were prepared using 5'-vinylphosphonate building blocks to incorporate 5'-vinylphosphonate terminal caps:

5'-5'-vinylphosphonate building block (5'-VP)

- 46 045960

Modified oligonucleotide with a 5'-vinylphosphonate terminal cap.

Referring to FIG. The 7,5'-vinylphosphonate building block (5'-VP) was prepared as follows.

Preparation of compound 7-2. To a solution of compound 7-1 (15.0 g, 53.3 mmol) in dry pyridine (150 ml) was added TBSCl (20.0 g, 133.3 mmol) and imidazole (10.8 g, 159.9 mmol) . The mixture was stirred at room temperature. within 15 hours, TLC showed complete consumption of compound 7-1. The reaction mixture was concentrated in vacuo to give a residue. The residue was blocked with DCM (500 ml). The DCM layer was washed twice with H ₂ O (1 lx2) and a saturated NaCl solution. The DCM layer was concentrated in vacuo to give crude 7-2 (27.2 g, 53.3 mmol) as a yellow oil. The crude compound 7-2 was directly used in the next step. ER-LC/MS m/z 510.5 [M+H]+.

Preparation of compound 7-3. To a solution of compound 7-2 (26.2 g, 51.3 mmol) in pyridine (183 ml) was added benzoyl chloride (15.8 g, 113.0 mmol) dropwise at 5°C. The reaction mixture was stirred at room temperature. within 2 hours. TLC showed complete consumption of compound 7-2. The reaction in the mixture was stopped with H2O (4 ml). Then NH3-H2O (20 ml) was added to the reaction mixture and stirred at room temperature. within 30 min. Pyridine was then removed from the mixture by concentration under reduced pressure. The residue was added to H2O (100 ml), extracted with EA (150 mlx3) and the EA layers were combined. The EA layer was washed with a saturated NaCl solution and dried over Na ₂ SO ₄ . Filter and concentrate to give crude compound 7-3 (45.0 g). ER LC/MS m/z=614.5 [M+H]+.

Preparation of compound 7-4. To a solution of mixture 7-3 (44.0 g, crude) in THF (440 ml) was added H ₂ O (220 ml) and TFA (220 ml) at 0°C. The reaction mixture was then stirred at 0°C for 1.5 hours. TLC showed complete consumption of compound 7-3. The pH of the reaction mixture was adjusted to 7-8 using NH3-H2O. The mixture was then extracted with EA (300 mlx7). The combined EtOAc layer was washed with saturated NaCl solution and concentrated in vacuo to give the crude product. The crude product was purified by column chromatography (EA: PE=1:5~1:1) to obtain compound 7-4 (15.8 g) as a white solid. ¹ H-NMR (400 MHz, DMSOD ₆ ): δ=11.24 (s, 1H, exchanged with D ₂ O), 8.77 (s, 2H), 8.04-8.06 (m, 2H) , 7.64-7.66 (m, 2H), 7.54-7.58 (m, 2H), 6.14-6.16 (d, J=5.9 Hz, 1H), 5.20 -5.23 (m, 1H), 4.58-4.60 (m, 1H), 4.52-4.55 (m, 1H), 3.99-4.01 (m, 1H), 3 .69-3.75 (m, 1H), 3.573.61 (m, 1H), 3.34 (s, 4H), 0.93 (s, 9H), 0.14-0.15 (d, J =1.44 Hz, 6H). ER-LC/MS m/z=500.3 [M+H]+.

Preparation of compound 7-5. DMSO (132 mL) and 7-4 (13.2 g, 26.4 mmol), EDCI (15.19 g, 79.2 mmol) were added in turn to a 500 mL round bottom flask at RT. Pyridine (2.09 g, 26.4 mmol, 2.1 ml) was then added to the reaction mixture. After stirring for 5 min, TFA (1.51 g, 13.2 mmol) was added to the reaction mixture. The reaction mixture was stirred at room temperature. within 3 hours, LC-MS showed complete consumption of compound 7-4. The reaction mixture was added to ice water (500 ml) and extracted three times with EA (300 mlx3). The combined EA layer was washed twice with H2O and once with a saturated NaCl solution. The product was dried over Na ₂ SO ₄ and filtered. The filtrate was concentrated to give crude compound 7-5 (14.6 g) as a white solid. ERLC/MS m/z=516.3 [M+H]+.

Preparation of compound 7-6. Compound 5A (24.4 g, 38.5 mmol) was added to a solution of NaH (2.5 g, 64.3 mmol, 60% pure) in THF (50 ml) at 0°C. After stirring for 15 minutes, compound 7-5 (16.0 g, 32.1 mmol) in THF (60 ml) was added to the reaction mixture. The reaction mixture was then stirred at room temperature. within 1 h. LC-MS showed complete consumption of compound 7-5. Then the reaction in the mixture was stopped with saturated NH4Cl (500 ml) and extracted three times with EA (400 mlx3). The combined EA layer was washed with saturated NaCl solution, dried over Na ₂ SO ₄ and filtered. The filtrate was concentrated in vacuo to give the crude product. The crude product was purified by column chromatography (EA: PE=1:5~1:1) to give compound 7-6 (10.0 g, 12.4 mmol, 38.6% yield) as a white solid. ER-LC/MS m/z=804.4 [M+H]+; ³¹ P NMR (162 MHz, DMSOD ₆ ) δ 17.01.

Preparation of compound 7-7. Compound 7-6 (9.0 g, 11.2 mmol), H2O (225 ml) and HCOOH (225 ml) were added in turn to a 500 ml round bottom flask. The reaction mixture was stirred at 26°C for 15 hours. LC- MS showed complete consumption of compound 7-6. The pH of the reaction mixture was adjusted to 6-7 using NH3-H2O. The mixture was then extracted three times with EA (300 mlx3). The combined EA layer was dried over Na ₂ SO ₄ , filtered and the filtrate was concentrated to give the crude product. The crude product was purified by column chromatography (DCM/MeOH=100:1 ~ 60:1) to give product 7-7 (7.0 g, 10.1 mmol, 90.6% yield). 1H-NMR (400 MHz, DMSOD ₆ ): δ=11.11 (s, 1H, exchanged with D2O), 8.71-8.75 (d, J=14.4, 2H), 8.04-8 .06 (m, 2H), 7.64-7.65 (m, 1H), 7.54-7.58 (m, 2H), 6.88-7.00 (m, 1H), 6.20 -6.22 (d, J=5.4, 2H), 6.06-6.16 (m, 1H), 5.74-5.75 (d, J=5.72, 2H), 5, 56-5.64 (m, 4H), 4.64-4.67 (m, 1H), 4.58-4.59 (m, 1H), 4.49-4.52 (m, 1H), 3.37 (s, 3H), 1.09-1.10 (d, J=1.96, 18H). ³¹ P NMR (162 MHz, DMSO<) δ 17.45. ER-LC/MS m/z=690.4 [M+H]+.

Preparation of the 5'-VP compound. To a solution of compound 7-7 (5.5 g, 7.9 mmol) was added DCI (750 mg, 6.3 mmol) and then CEP[N(iPr) ₂ ] ₂ (3.1 g, 10.3 mmol). The mixture was stirred at room temperature. for 2 hours. TLC showed that 3.5% of compound 7.7 remained. The reaction mixture was washed with H2O (40 mlx2) and

- 47 045960 saturated NaCl solution (50 mlx2), dried over Na ₂ SO ₄ and concentrated to obtain the crude product. The residue was purified by preparative flash HPLC under the following conditions (IntelFlash-1): Column: C18 silica gel; mobile phase: CH3CN/H2O (0.5% NH4HCO3)=1/5, increase to CH3CN/H2O (0.5% NH4HCO3)=1/0 for 30 min, eluted product collected at CH3CN/H2O ratio (0. 5% NH4HCO ₃ )=3/1; detector: UV 254 nm. The product was concentrated and extracted with EA (50 mlx3). The combined EA layer was washed with saturated NaCl and dried over Na ₂ SO ₄ , filtered and concentrated the filtrate to give the final compound 5'-VP (6.0 g, 98% pure) as a white solid. ¹ H-NMR (400 MHz, DMSOM6): δ=11.27 (s, 1H, exchanged with D2O), 8.72-8.75 (m, 2H), 8.04-8.06 (m, 2H ), 7.54-7.68 (m, 3H), 6.85-7.05 (m, 1H), 6.09-6.26 (m, 2H), 5.57-5.64 (m , 4H), 4.70-4.87 (m, 3H), 3.66-3.88 (m, 4H), 3.37-3.41 (m, 3H), 2.82-2.86 (m, 2H), 1.20-1.21 (m, 12H), 1.08-1.09 (m, 18H). ³¹ RNMR (162 MHz, DMSO-06): 149.99, 149.16, 17.05, 16.81. ER-LC/MS m/z=890.8 [M+H]+.

In table 7 provides a summary of the sequence length, alternating fragments A and C, and the 5' modification of the resulting modified thiophosphate oligonucleotides.

Table 7

No. Length A WITH 5’ modification 117 (AS) 17 LNA-A LNA- (5sh)S HE 118 (AS) 18 LNA-A LNA- (5sh)S HE 119 (AS) 19 LNA-A LNA- (5sh)S He 120 (AS) 17 LNA-A LNA- (5sh)S Vinylphosphonate-A 121 (AS) 18 LNA-A LNA- (5sh)S Vinylphosphonate-A 122 (AS) 19 LNA-A LNA- (5sh)S Vinylphosphonate-A 123 (AS)20 LNA-A LNA- (5sh)S Vinylphosphonate-A 124 (AS) 17 2'-OMe-A 2'-ОМе- (5ш)С HE 125 (AS) 18 2'-OMe-A 2'-ОМе- (5ш)С HE 126 (AS) 19 2'-OMe-A 2'-ОМе- (5ш)С He 127 (AS) 17 2'-OMe-A 2'-ОМе- (5ш)С Vinylphosphonate-A 128 (AS) 18 2'-OMe-A 2'-ОМе- (5ш)С Vinylphosphonate-A 129 (AS) 19 2'-OMe-A 2'-ОМе- (5ш)С Vinylphosphonate-A 130 (AS)20 2'-OMe-A 2'-ОМе- (5ш)С Vinylphosphonate-A

Examples 131-174.

The effects of sequence length, LNA insertion, and 5' modification were assessed by preparing a series of thiophosphate oligonucleotides according to the methods described above in Examples 1-116. In table 8 provides a summary of the sequence length, alternating fragments A and C, 5' modification, and length and position of LNA fragments for the resulting modified thiophosphate oligonucleotides.

- 48 045960

Table 8

No. Length A WITH S'modification LNA modification 131 (AS) 17 2'-OMe-A LNA- (5sh)S HE 132 (AS) 18 2'-OMe-A LNA- (5sh)S He 133 (AS) 19 2'-OMe-A LNA- (5sh)S He 134 (AS)20 2'-OMe-A LNA- (5sh)S He 135 (AS) 17 2'-OMe-A LNA- (5sh)S Vinylphos phonat-A 136 (AS) 18 2'-OMe-A LNA- (5sh)S Vinylphos phonat-A 137 (AS) 19 2'-OMe-A LNA- (5sh)S Vinylphos phonat-A 138 (AS)20 2'-OMe-A LNA- (5sh)S Vinylphos phonat-A 139 (AS) 17 LNA-A 2'-ОМе- (5ш)С HE 140 (AS) 18 LNA-A 2'-ОМе- (5ш)С HE 141 (AS) 19 LNA-A 2'-ОМе- (5ш)С HE 142 (AS)20 LNA-A 2'-ОМе- (5ш)С HE 143 (AS) 17 LNA-A 2'-ОМе- (5ш)С Vinylphos phonat-A 144 (AS) 18 LNA-A 2'-ОМе- (5ш)С Vinylphos phonat-A 145 (AS) 19 LNA-A 2'-ОМе- (5ш)С Vinylphos phonat-A 146 (AS)20 LNA-A 2'-ОМе- (5ш)С Vinylphos phonat-A 147 (AS) 17 UNA-A LNA- (5sh)S HE 148 (AS) 18 UNA-A LNA- (5sh)S HE 149 (AS) 19 UNA-A LNA- (5sh)S HE 150 (AS)20 UNA-A LNA- (5sh)S HE 151 (AS) 17 UNA-A LNA- (5sh)S Vinylphos phonat-A 152 (AS) 18 UNA-A LNA- (5sh)S Vinylphos phonat-A 153 (AS) 19 UNA-A LNA- (5sh)S Vinylphos phonat-A 154 (AS)20 UNA-A LNA- (5sh)S Vinylphos phonat-A 155 (AS) 17 LNA-A UNA- (5sh)S HE 156 (AS) 18 LNA-A UNA- (5sh)S He 157 (AS) 19 LNA-A UNA- (5sh)S HE 158 (AS)20 LNA-A UNA- (5sh)S HE

- 49 045960

159 (AS)20 LNA-A UNA- (5sh)S HE Block of 4 LNAs 160 (AS) 17 LNA-A UNA- (5sh)S Vinylphos phonat-A 161 (AS) 18 LNA-A UNA- (5t)S Vinylphos phonat-A 162 (AS) 19 LNA-A UNA- (5t)S Vinylphos phonat-A 163 (AS)20 LNA-A UNA- (5t)S Vinylphos phonat-A 164 (AS)20 2'-ОМе-А LNA-A 2'-ОМе-(5т)С LNA- (5t)С HE Every 3rd base represents an LNA 165 (AS)20 2'-OMe-A LNA-A 2'-ОМе-(5т)С LNA- (5t)С Vinylphos phonat-A Every 3rd base represents an LNA 166 (AS)20 2'-OMe-A 2'-ОМе-(5т)С LNA- (5t)С HE Every 4th base represents an LNA 167 (AS)20 2'-OMe-A 2'-ОМе-(5т)С LNA- (5t)С Vinylphos phonat-A Every 4th base represents an LNA 168 (AS) 17 2'-OMe-A 2'-ОМе-(5т)С LNA (5t)S Vinylphos phonat-A 5 (5m)lnC in the middle 169 (AS) 18 2'-OMe-A 2'-ОМе-(5т)С Vinylphos phonat-A 6 InAps (5sh)S in the middle 170 (AS) 19 2'-OMe-A 2'-ОМе-(5т)С LNA (5t)S Vinylphos phonat-A 6 InAps (5sh)S in the middle 171 (AS)20 2'-OMe-A 2'-ОМе-(5т)С LNA (5t)S HE 5 (5m)lnC in the middle 172 (AS)20 LNA-A 2'-ОМе-А 2'-ОМе-(5т)С LNA (5t)S HE 10 InAps (5sh)S in the middle 173 (AS)20 2'-OMe-A 2'-ОМе-(5т)С LNA (5t)S Vinylphos phonat-A 5 (5m)lnC in the middle 174 (AS)20 2'-OMe-A LNA-A 2'-ОМе-(5т)С LNA- (5t)С Vinylphos phonat-A 10 InAps (5sh)S in the middle Examples 175-216.

The effects of sequence length, LNA insertion, stereochemical modification, and 5' modification were assessed by preparing a series of thiophosphate oligonucleotides in accordance with the methods described above in Examples 1-116, except that these oligonucleotides were prepared by a modified method using a dinucleotide building block consisting from fragment A and fragment C, connected by a stereochemically defined thiophosphate bond, as follows:

2'-OMeApsR (5m)mC phosphoramidite (9R) 2'-OMeApsS (5m)mC phosphoramidite (9S) Referring to FIG. 8, 9A and 9B dinucleotide building blocks 9R and 9S were prepared as follows.

Preparation of compound 8-2. To a solution of compound 8-1 (300.0 g, 445.1 mmol) in 3000 ml of anhydrous dioxane under an inert nitrogen atmosphere, levulinic acid (309.3 g, 2.67 mol) was added dropwise at room temperature. Dicyclohexylcarbodiimide (274.6 g, 1.33 mol) and 4-dimethylaminopyridine (27.1 g, 222.0 mmol) were then added in turn at room temperature. The resulting solution was stirred at room temperature for 5 hours, diluted with 5000 ml of dichloromethane and filtered.

The organic phase was washed with 2x3000 ml of 2% aqueous sodium bicarbonate solution and 1x3000 ml of water, respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and condensed

- 50 045960 was centered under reduced pressure. 345.0 g (crude) of 8-2 were obtained as a white solid, which was used without further purification in the next step. ER-LC/MS: m/z 774 [M+H]+.

Preparation of Compound 8-3. To a solution of compound 8-2 (345 g, 445.1 mmol) in 3000 ml of dichloromethane under an inert nitrogen atmosphere, p-toluenesulfonic acid (84.6 g, 445.1 mmol) was added dropwise at 0°C. The resulting solution was stirred at 0°C for 0.5 h, diluted with 3000 ml dichloromethane and washed with 2x2000 ml saturated aqueous sodium bicarbonate solution and 1x2000 ml saturated aqueous sodium chloride solution, respectively. The organic phase was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (SiO ₂ , dichloromethane/methanol=30:1) to give compound 8-3 (210.0 g, 90% in two steps) as a white solid. ¹ H-NMR (400 MHz, DMSOD ₆ ) δ=12.88 (s, 1H), 8.178.10 (m, 3H), 7.62-7.60 (m, 1H), 7.58-7, 48 (m, 2H), 5.97-5.91 (m, 1H), 5.42 (d, J=5.9 Hz, 1H), 5.25 (s, 1H), 4.21-4 .08 (m, 2H), 3.78-3.59 (m, 2H), 2.75-2.74 (m, 2H), 2.57 (m, 2H), 2.13 (d, J =2.3 Hz, 3H), 2.02 (s, 3H), 1.81 (m, 1H), 1.77-1.56 (m, 1H), 1.33-0.98 (m, 1H). ER-LC/MS: m/z 474 [M+H]+.

Preparation of compound 8-4. To a solution of compound 8-3 (210.0 g, 444.9 mmol) in 2000 ml of acetonitrile under an inert nitrogen atmosphere, compound 8-3a (360.0 g, 405.4 mmol) and ETT (58.0 g) were added in turn , 445.9 mmol) at 0°C. The resulting solution was stirred for 2 hours at room temperature. The mixture was then filtered and used without further purification in the next step. ERLC/MS: m/z 1258 [M+H]+.

Preparation of compounds 8-5 and 8-6. To a solution of compound 8-4 (509.9 g, 405.4 mmol) in 2000 ml of acetonitrile under an inert nitrogen atmosphere, pyridine (128.0 g, 1.62 mol) and 5-amino-3H1,2,4 were added in turn -dithiazole-3-thione (121.8 g, 810.9 mmol) at room temperature. The reaction solution was stirred for 30 minutes at room temperature. The resulting solution was filtered and concentrated under reduced pressure. The residue was purified by preparative flash HPLC under the following conditions (IntelFlash-1): Column: C18 silica gel; mobile phase: CH ₃ CN/H ₂ O (0.5% NH4HCO ₃ )=1/1, increase to CH3CN/H2O (0.5% NH4HCO ₃ )=1/0 for 20 min, the eluted product was collected at the ratio CH3CN/H2O (0.5% NH ₄ HCO ₃ )=3/1; detector: UV 254 nm. This resulted in a mixture of compounds 8-5 and 8-6 (430.0 g, 90% in two steps) as a white solid. The fractions were diluted with 3000 ml of dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by SFC under the following conditions: CHIRALPAK IB N-5 (IB50CD-VD008)/SFC 0.46 cm ID x 25 cm L 10.0 μl; mobile phase: (DCM/EAAc=80/20 (v/v)); detector: UV 254 nm. The fractions were concentrated until the residual solvent completely disappeared under reduced pressure. 105.0 g (35.0%) of compound 8-5 was obtained as a white solid, which was used to prepare compound 9R as described below. ¹ H-NMR (400 MHz, DMSOD ₆ ) δ=12.88 (s, 1H), 11.26 (s, 1H), 8.62 (d, J=8.06 Hz, 2H), 8.18 (m, 2H), 8.05 (d, J=7.2 Hz, 2H), 7.79 (s, 1H), 7.677.48 (m, 6H), 7.40 (d, J=7, 2 Hz, 2H), 7.28-7.18 (m, 7H), 6.86-6.83 (m, 4H), 6.21 (d, J=6.6 Hz, 1H), 5, 91 (d, J=5.0 Hz, 1H), 5.44-5.41 (m, 1H), 5.28-5.26 (m, 1H), 5.06 (m, 1H), 4 .45-4.24 (m, 7H), 3.71 (s, 6H), 3.39 (s, 4H), 3.31 (s, 3H), 2.98 (m, 2H), 2. 75 (m, 2H), 2.56 (m, 2H), 2.01 (s, 3H). 31P-NMR (162 MHz, DMSO-de) δ=67.17. ER-LC/MS: m/z 1292 [M+H]+; obtained 170.0 g (56.6%) of compound 8-6 as a white solid and used to prepare compound 9S as described below. 1H-NMR (400 MHz, DMSOD ₆ ) δ=12.86 (s, 1H), 11.25 (s, 1H), 8.62 (d, J=16.6 Hz, 2H), 8.18 ( d, J=7.2 Hz, 2H), 8.05 (m, 2H), 7.78 (s, 1H), 7.67-7.48 (m, 6H), 7.40 (d, J =7.2 Hz, 2H), 7.28-7.18 (m, 7H), 6.87-6.85 (m, 4H), 6.21 (d, J=6.8 Hz, 1H) , 5.91 (d, J=5.2 Hz, 1H), 5.43-5.39 (m, 1H), 5.28-5.26 (m, 1H), 5.06 (m, 1H ), 4.48-4.21 (m, 7H), 3.72 (s, 6H), 3.36 (s, 4H), 3.26 (s, 3H), 2.95 (m, 2H) , 2.73 (m, 2H), 2.55 (m, 2H), 2.04 (s, 3H); 31P-NMR (162 MHz, DMSOD ₆ ) δ=66.84; ERLC/MS: m/z 1292 [M+H]+.

Preparation of Compound 9-1. To a solution of compound 8-5 (100.0 g, 77.4 mmol) in 700 ml of acetonitrile under an inert nitrogen atmosphere was added 0.5 M hydrazine hydrate (20.0 g, 0.4 mol) in pyridine/acetic acid (3: 2) at a temperature of 0°C. The resulting solution was stirred for 0.5 h at a temperature of 0°C. 2,4-pentanedione was then added to the reaction mixture once, and the mixture was allowed to warm to room temperature and stirred for an additional 15 minutes. The solution was diluted with DCM (2000 ml) and washed twice with saturated aqueous NH ₄ Cl, then with saturated NaCl and dried over Na ₂ SO ₄ . Then the solution was concentrated under reduced pressure, the residue was purified by preparative flash HPLC under the following conditions (IntelFlash-1): Column: C18 silica gel; mobile phase: CH3CN/H2O (0.5% NH4HCO ₃ )=1/1, increase to CH3CN/H2O (0.5% NH ₄ HCO ₃ )=1/0 for 20 min, the eluted product was collected at the ratio CH3CN/ H2O (0.5% NH4HCO ₃ )=3/1; detector: UV 254 nm. This resulted in 9-1 (67.0 g, 80%) as a white solid. 1H-NMR (400 MHz, DMSOD ₆ ) δ=12.97 (s, 1H), 11.26 (s, 1H), 8.62 (d, J=11.2 Hz, 2H), 8.19 ( d, J=7.2 Hz, 2H), 8.05 (m, 2H), 7.74 (s, 1H), 7.67-7.48, (m, 6H), 7.40 (d, J=7.2 Hz, 2H), 7.28-7.18 (m, 7H), 6.85 (m, 4H), 6.21 (m, 1H), 5.90 (d, J=3 .2 Hz, 1H), 5.49-5.43 (m, 2H), 5.05 (m, 1H), 4.45 (m, 1H), 4.40-4.30 (m, 4H) , 4.18-4.11 (m, 2H), 3.93 (m, 1H), 3.71 (s, 6H), 3.40-3.32 (m, 8H), 2.98 (m , 2H), 2.04 (s, 3H). 31P-NMR (162 MHz, DMSOD ₆ ) δ=67.30. ERLC/MS: m/z 1194 [M+H]+.

- 51 045960

Preparation of compound 9R. To a solution of compound 9-1 (58.0 g, 48.6 mmol) in 600 ml of dichloromethane under an inert nitrogen atmosphere, CEP[N (iPr) ₂ ] ₂ (18.7 g, 62.1 mmol) and DCI were added in turn (5.1 g, 43.7 mmol) at room temperature. The resulting solution was stirred for 1 hour at room temperature, diluted with 1000 ml dichloromethane and washed with 2x1000 ml saturated aqueous sodium bicarbonate solution and 1x1000 ml saturated aqueous sodium chloride solution, respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until the residual solvent disappeared completely under reduced pressure. The residue was purified by preparative flash HPLC under the following conditions (IntelFlash-1): Column: C18 silica gel; mobile phase: CH ₃ CN/H2O (0.5% NH ₄ HCO ₃ )=1/1, increase to CH3CN/H2O (0.5% NH ₄ HCO ₃ )=1/0 for 20 min, eluted product collected at a ratio of CH3CN/H2O (0.5% NH ₄ HCO ₃ )=3/1; detector: UV 254 nm. This resulted in compound 9R (51.2 g, 70%) as a white solid. ¹ H-NMR (400 MHz, DMSOL) δ=12.94 (m, 1H), 11.26 (s, 1H), 8.62 (m, 2H), 8.19 (d, J=7.2 Hz, 2H), 8.05 (m, 2H), 7.77 (m, 1H), 7.69-7.46 (m, 6H), 7.39 (d, J=6.6 Hz, 2H ), 7.26-7.20 (m, 7H), 6.84 (m, 4H), 6.20 (m, 1H), 5.90 (m, 1H), 5.43 (m, 1H) , 5.06 (s, 1H), 4.46-4.17 (m, 7H), 4.12 (m, 1H), 3.82-3.80 (m, 2H), 3.73-3 .66 (s, 6H), 3.643.58 (m, 2H), 3.48-3.29 (m, 8H), 2.98 (s, 2H), 2.82-2.77 (m, 2H ), 2.03 (s, 3H), 1.24-1.15 (m, 12H). 31P-NMR (162 MHz, DMSO-de) δ=149.87, 149.80, 67.43, 67.33. ER-LC/MS: m/z 1394 [M+H]+.

Preparation of Compound 9-2. To a solution of compound 8-6 (110.0 g, 85.1 mmol) in 700 ml of acetonitrile under an inert nitrogen atmosphere was added 0.5 M hydrazine hydrate (21.1 g, 423.6 mmol) in pyridine/acetic acid (3: 2) at a temperature of 0°C. The resulting solution was stirred for 0.5 h at a temperature of 0°C. 2,4-pentanedione was then added to the reaction mixture once, and the mixture was allowed to warm to room temperature and stirred for an additional 15 minutes. The solution was diluted with DCM (2000 ml) and washed twice with saturated aqueous NH ₄ Cl and then with saturated NaCl and dried over Na ₂ SO ₄ . Then the solution was concentrated under reduced pressure, the residue was purified by preparative flash HPLC under the following conditions (IntelFlash-1): Column: C18 silica gel; mobile phase: CH3CN/H2O (0.5% NH ₄ HCO ₃ )=1/1, increase to CH3CN/H2O (0.5% NH ₄ HCO ₃ )=1/0 for 20 min, the eluted product was collected at the ratio CH3CN/H2O (0.5% NH ₄ HCO ₃ )=3/1; detector: UV 254 nm. This resulted in compound 9-2 (72.0 g, 80%) as a white solid. 1H-NMR (400 MHz, DMSO-de) δ=12.94 (s, 1H), 11.24 (s, 1H), 8.61-8.57 (m, 2H), 8.18 (d, J= 7.6 Hz, 2H), 8.03 (d, J=7.6 Hz, 2H), 7.74 (s, 1H), 7.66-7.47 (m, 6H), 7.40 ( d, J=7.1 Hz, 2H), 7.27-7.20 (m, 7H), 6.86 (m, 4H), 6.20 (d, J=6.6 Hz, 1H), 5.87 (d, J=4.0 Hz, 1H), 5.42 (m, 2H), 5.05 (m, 1H), 4.45 (m, 2H), 4.40-4.24 (m, 1H), 4.22-4.06 (m, 4H), 3.92 (m, 1H), 3.71 (s, 6H), 3.40-3.32 (m, 8H), 2.94 (m, 2H), 2.03 (m, 3H). 31P-NMR (162 MHz, DMSO-de) δ=66.87. ER-LC/MS: m/z 1194 [M+H]+.

Receiving connection 9S. To a solution of compound 9-2 (62.0 g, 51.9 mmol) in 600 ml of dichloromethane under an inert nitrogen atmosphere, CEP[N (iPr) ₂ ] ₂ (19.0 g, 63.1 mmol) and DCI were added in turn (5.55 g, 47.0 mmol) at room temperature. The resulting solution was stirred for 1 hour at room temperature, diluted with 1000 ml dichloromethane and washed with 2x1000 ml saturated aqueous sodium bicarbonate solution and 1x1000 ml saturated aqueous sodium chloride solution, respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until the residual solvent disappeared completely under reduced pressure. The residue was purified by preparative flash HPLC under the following conditions (IntelFlash-1): Column: C18 silica gel; mobile phase: CH3CN/H2O (0.5% NH ₄ HCO ₃ )=1/1, increase to CH3CN/H2O (0.5% NH ₄ HCO ₃ )=1/0 for 20 min, the eluted product was collected at the ratio CH3CN/H2O (0.5% NH ₄ HCO ₃ )=3/1; detector: UV 254 nm. This resulted in 9S (51.5 g, 70%) as a white solid. 1H-NMR (400 MHz, DMSOO δ=12.90 (s, 1H), 11.25 (s, 1H), 8.60 (m, 2H), 8.19 (d, J=6.6 Hz, 2H) , 8.04 (m, 2H), 7.77 (s, 1H), 7.67-7.48 (m, 6H), 7.41 (d, J=8.0 Hz, 2H), 7, 29-7.19 (m, 7H), 6.85 (m, 4H), 6.21 (d, J=6.8 Hz, 1H), 5.91-5.87 (m, 1H), 5 .41 (m, 1H), 5.06 (m, 1H), 4.46-4.21 (m, 7H), 4.10 (m, 1H), 3.83-3.75 (m, 2H ), 3.73-3.68 (s, 6H), 3.68-3.59 (m, 2H), 3.40-3.32 (m, 8H), 2.93 (m, 2H), 2.80 (m, 2H), 2.02 (s, 3H), 1.18-1.13 (m, 12H) ³¹ RNMR (162 MHz, DMSO^ ₆ ) δ=149.96, 149.73 , 66.99, 66.86 ER-LC/MS: m/z 1394 [M+H]+.

The modified method also used a longer addition time (8 min) and a larger number of amidite equivalents (8 equivalents). In table 9 provides a summary of the sequence length of alternating fragments A and C, the number and type (R or S) of stereochemically specified thiophosphate (PS) linkages, and 5' modification for the resulting modified thiophosphate oligonucleotides.

- 52 045960

Table 9

No. Length A WITH Modification PS 5’ modification 175 (AS) 17 2'-OMe-A 2'-ОМе- (5ш)С 5 R-isomer HE 176 (AS) 18 2'-OMe-A 2'-ОМе-(5т)С 6 R-isomer He 177 (AS) 19 2'-OMe-A 2'-ОМе-(5т)С 4 R-isomer He 178 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 4 R-isomer He 179 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 5 R-isomer He 180 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 6 R-isomer He 181 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 6 R-isomer Vinylphosphonate-A 182 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 7 R-isomer HE 183 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 13 R-isomer HE 184 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 20 R-isomer HE 185 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 20 R-isomer Vinylphosphonate-A 186 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 19 R-isomer Vinylphosphonate-A 187 (AS) 17 LNA-A LNA- (5t)С 5 R-isomer HE 188 (AS) 18 LNA-A LNA- (5t)С 6 R-isomer HE 189 (AS) 19 LNA-A LNA- (5t)С 6 R-isomer HE 190 (AS)20 LNA-A LNA- (5t)С 4 R-isomer HE 191 (AS)20 LNA-A LNA- (5t)С 5 R-isomer HE 192 (AS)20 LNA-A LNA- (5t)С 6 R-isomer HE 193 (AS)20 LNA-A LNA- (5t)С 6 R-isomer, Vinylphosphonate-A 194 (AS)20 LNA-A LNA- (5t)С 13 R-isomer HE 195 (AS)20 LNA-A LNA- (5t)С 20 R-isomer HE 196 (AS)20 LNA-A LNA- (5t)С 20 R-isomer Vinylphosphonate-A 197 (AS) 17 2'-OMe-A 2'-ОМе-(5т)С 5 S-isomer HE 198 (AS) 18 2'-OMe-A 2'-ОМе-(5т)С 6 S-isomer HE 199 (AS) 19 2'-OMe-A 2'-ОМе-(5т)С 6 S-isomer HE 200 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 4 S-isomer HE 201 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 5 S-isomer HE 202 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 6 S-isomer HE 203 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 7 S-isomer HE 204 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 13 S-isomer HE 205 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 20 S-isomer HE 206 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 20 S-isomer Vinylphosphonate-A 207 (AS) 17 LNA-A LNA- (5t)С 5 S-isomer HE 208 (AS) 18 LNA-A LNA- (5t)С 6 S-isomer HE 209 (AS) 19 LNA-A LNA- (5t)С 6 S-isomer HE 210 (AS)20 LNA-A LNA- (5t)С 4 S-isomer HE 211 (AS)20 LNA-A LNA- (5t)С 5 S-isomer HE 212 (AS)20 LNA-A LNA- (5t)С 6 S-isomer HE 213 (AS)20 LNA-A LNA- (5t)С 6 S-isomer Vinylphosphonate-A 214 (AS)20 LNA-A LNA- (5t)С 13 S-isomer HE 215 (AS)20 LNA-A LNA- (5t)С 20 S-isomer HE 216 (AS)20 LNA-A LNA- (5t)С 20 S-isomer Vinylphosphonate-A

Examples 217-234.

The effects of sequence length, LNA insertion, stereochemical modification, and 5' modification were assessed by preparing a series of thiophosphate oligonucleotides in accordance with the methods described above in Examples 175-216, except that these oligonucleotides were prepared by a modified method using a dinucleotide building block consisting of fragment A and fragment C, connected by a stereochemically specified thiophosphate bond, as follows:

- 53 045960

2'-OMeApsR (5m)lnC phosphoramidite (11R) 2'-OMeApsS (5m)lnC phosphoramidite (US).

With respect to FIG. 10, 11A and 11B 11R and 11S dinucleotide building blocks were prepared as follows.

Preparation of compound 10-2. To a solution of compound 10-1 (50.0 g, 74.0 mmol) in 500 ml of anhydrous dioxane under an inert nitrogen atmosphere, levulinic acid (51.5 g, 44.4 mol) was added dropwise at room temperature. Dicyclohexylcarbodiimide (45.7 g, 0.2 mol) and 4dimethylaminopyridine (4.6 g, 37.0 mmol) were then added in turn at room temperature. The resulting solution was stirred at room temperature for 5 hours, diluted with 3000 ml of dichloromethane and filtered. The organic phase was washed with 2x1000 ml of 2% aqueous sodium bicarbonate solution and 1x1000 ml of water, respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. 53.0 g (crude) of compound 10-2 were obtained as a white solid, which was used without further purification in the next step. ER-LC/MS: m/z 774 [M+H]+.

Preparation of compound 10-3. To a solution of compound 10-2 (52.0 g, 67.0 mmol) in 400 ml of dichloromethane under an inert nitrogen atmosphere, p-toluenesulfonic acid (51.5 g, 0.4 mol) was added dropwise at 0°C. The resulting solution was stirred at 0°C for 0.5 h, diluted with 2000 ml dichloromethane and washed with 2x1000 ml saturated aqueous sodium bicarbonate solution and 1x1000 ml saturated aqueous sodium chloride solution, respectively. The organic phase was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (SiO ₂ , dichloromethane/methanol=30:1) to give compound 10-3 (32.0 g, 80% in two steps) as a white solid. ¹ H-NMR (400 MHz, DMSO-de) δ=13.05 (s, 1H), 8.20-7.91 (m, 4H), 7.60-7.49 (m, 4H), 5 .57 (m, 2H), 5.32 (d, J=10.8 Hz, 1H), 4.88 (s, 1H), 4.49 (s, 1H), 4.18 (s, 1H) , 3.91-3.78 (m, 5H), 2.74-2.69 (m, 4H), 2.59-2.49 (m, 7H), 2.10 (s, 5H), 2 .06 (s, 4H), 1.74-1.49 (m, 3H), 1.26-1.02 (m, 3H). ER-LC/MS: m/z 472 [M+H] ⁺ .

Preparation of compound 10-4. To a solution of compound 10-3 (28.0 g, 59.4 mmol) in 300 ml of acetonitrile under an inert nitrogen atmosphere, compound 8-3a (50.0 g, 56.3 mmol) and ETT (7.9 g) were added in turn , 59.4 mmol) at 0°C. The resulting solution was stirred for 2 hours at room temperature. The mixture was then filtered and used without further purification in the next step. ERLC/MS: m/z 1258 [M+H] ⁺ .

Preparation of compounds 10-5 and 10-6. To a solution of compound 10-4 (70.9 g, 56.3 mmol) in 300 ml of acetonitrile under an inert nitrogen atmosphere, pyridine (17.8 g, 225.2 mmol) and 5-amino-3H1,2,4 were added in turn -dithiazole-3-thione (16.9 g, 112.6 mmol) at room temperature. The reaction solution was stirred for 30 minutes at room temperature. The resulting solution was filtered and concentrated under reduced pressure. The residue was purified by preparative flash HPLC under the following conditions (IntelFlash-1): Column: C18 silica gel; mobile phase: CH3CN/H2O (0.5% NH ₄ HCO ₃ )=1/1, increase to CH3CN/H2O (0.5% NH ₄ HCO ₃ )=1/0 for 20 min, the eluted product was collected at the ratio CH3CN/H2O (0.5% NH ₄ HCO ₃ )=3/1; detector: UV 254 nm. This resulted in a mixture of compounds 10-5 and 10-6. The fractions were diluted with 3000 ml of dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by SFC under the following conditions: CHIRAL CEL OD-H/SFC 20 mm x 250 mm L 5 µm (phase A: CO2; phase B: 50% ethanol-50% acetonitrile), detector: UV 220 nm. The fractions were concentrated until the residual solvent completely disappeared under reduced pressure. 9.0 g (25.7%) of compound 10-5 was obtained as a white solid, which was used to prepare compound 11R as described below. ¹ NMR (400 MHz, DMSO-de) δ=13.06 (s, 1H), 11.28 (s, 1H), 8.63 (d, J=20 Hz, 2H), 8.20 (m, 2H), 8.05 (d, J=8 Hz, 2H), 7.84 (s, 1H), 7.67-7.39 (m, 8H), 7.28-7.19 (m, 7H ), 6.86-6.83 (m, 4H), 6.24 (d, J=6.6 Hz, 1H), 5.66 (s, 2H), 5.45-5.43 (m, 1H), 5.10-5.03 (m, 2H), 4.82-4.76 (m, 1H), 4.60 (s, 1H), 4.50-4.33 (m, 4H) , 4.03-3.96 (m, 2H), 3.72 (s, 6H), 3.41-3.35 (m, 7H), 3.03-3.00 (m, 2H), 2 .75-2.72 (m, 2H), 2.56-2.53 (m, 2H), 2.08-2.05 (m, 6H). ³¹ P-NMR (162 MHz, DMSO-do) δ=67.02. ER-LC/MS: m/z 1290 [M+H] ⁺ . We received 15.0 g (42.8%) from

- 54 045960 compound 10-6 as a white solid, which was used to prepare compound 11S as described below. 1H-NMR (400 MHz, DMSO-06) δ=13.05 (s, 1H), 11.26 (s, 1H), 8.63 (d, J=24 Hz, 2H), 8.7.96 (m , 4H), 7.76 (s, 1H), 7.67-7.39 (m, 8H), 7.28-7.19 (m, 7H), 6.86 (d, J=7.2 Hz, 4H), 6.24 (d, J=6.4 Hz, 1H), 5.76 (s, 1H), 5.63 (s, 1H), 5.43-5.41 (m, 1H ), 5.12 (m, 1H), 4.97 (s, 1H), 4.82-4.79 (m, 1H), 4.57-4.49 (m, 3H), 4.27- 4.25 (m, 2H), 4.07-4.03 (m, 2H), 3.72 (s, 6H), 3.44-3.36 (m, 6H), 2.96 (m, 2H), 2.74-2.71 (m, 2H), 2.552.53 (m, 2H), 2.08 (s, 3H), 1.94 (s, 3H). ³¹ P-NMR (162 MHz, DMSO<) δ=66.58. ER-LC/MS: m/z 1290 [M+H]+.

Preparation of connection 11-1. To a solution of compound 10-5 (10.0 g, 7.7 mmol) in 100 ml of acetonitrile under an inert nitrogen atmosphere was added 0.5 M hydrazine hydrate (1.8 g, 37.5 mmol) in pyridine/acetic acid (3: 2) at a temperature of 0°C. The resulting solution was stirred for 0.5 h at a temperature of 0°C. 2,4-pentanedione was then added to the reaction mixture once, and the mixture was allowed to warm to room temperature and stirred for an additional 15 minutes. The solution was diluted with DCM (500 ml) and washed twice with saturated aqueous NH ₄ Cl, then with saturated NaCl and dried over Na ₂ SO ₄ . Then the solution was concentrated under reduced pressure, the residue was purified by preparative flash HPLC under the following conditions (IntelFlash-1): Column: C18 silica gel; mobile phase: CH ₃ CN/H ₂ O (0.5% NH4HCO ₃ )=1/1, increase to CH3CN/H2O (0.5% NH ₄ HCO ₃ )=1/0 for 20 min, eluted product collected at a ratio of CH3CN/H2O (0.5% NH4HCO ₃ )=3/1; detector: UV 254 nm. This resulted in compound 11-1 (6.0 g, 65%) as a white solid. ¹ H-NMR (400 MHz, DMSO-06) δ=13.13 (s, 1H), 11.28 (s, 1H), 8.63 (d, J=20 Hz, 2H), 8.21 ( d, J=8 Hz, 2H), 8.06-7.95 (m, 3H), 7.80 (s, 1H), 7.67-7.48. (m, 8H), 7.40 (d, J=7.6 Hz, 2H), 7.32-7.19 (m, 10H), 6.85 (m, 5H), 6.24 (d, J=8 Hz, 1H), 6.04 (d, J=4.0 Hz, 1H), 5.57 (s, 2H), 5.44-5.42 (m, 1H), 5.19- 5.17 (m, 2H), 5.10-5.08 (m, 1H), 4.80-4.76 (m, 2H), 4.50 (d, J=5.6 Hz, 1H) , 4.37-4.32 (m, 4H), 4.06-3.99 (m, 2H), 3.81 (m, 1H), 3.72 (s, 7H), 3.40-3 .36 (m, 8H), 3.03-3.00 (m, 2H), 2.05 (m, 3H). ³¹ P-NMR (162 MHz, DMSOD ₆ ) δ=67.21. ER-LC/MS: m/z 1192 [M+H]+.

Preparation of compound 11R. To a solution of compound 11-1 (6.0 g, 5.0 mmol) in 60 ml of dichloromethane under an inert nitrogen atmosphere, CEP[N (iPr) ₂ ] ₂ (1.9 g, 6.5 mmol) and DCI were added in turn (0.6 g, 5.0 mmol) at room temperature. The resulting solution was stirred for 1 hour at room temperature, diluted with 1000 ml dichloromethane and washed with 2x250 ml saturated aqueous sodium bicarbonate solution and 1x250 ml saturated aqueous sodium chloride solution, respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until the residual solvent disappeared completely under reduced pressure. The residue was purified by preparative flash HPLC under the following conditions (IntelFlash-1): Column: C18 silica gel; mobile phase: CH3CN/H2O (0.5% NH4HCO ₃ )=1/1, increase to CH3CN/H2O (0.5% NH4HCO ₃ )=1/0 for 20 min, the eluted product was collected at the ratio CH3CN/H2O ( 0.5% NH4HCO ₃ )=3/1; detector: UV 254 nm. This resulted in 11R (5.0 g, 70%) as a white solid. 1H-NMR (400 MHz, DMSOO δ=13.10 (s, 1H), 11.28 (s, 1H), 8.20 (d, J=8.0 Hz, 2H), 8.04 (d, J=7.2 Hz, 2H), 7.79 (d, J=14 Hz, 2H), 7.67-7.48 (m, 6H), 7.39 (d, J=7.2 Hz, 2H), 7.27-7.18 (m, 7H), 6.85-6.82 (m, 4H), 6.23-6.20 (m, 1H), 5.64 (d, J= 6.0 Hz, 1H), 5.44-5.41 (m, 1H), 5.08-5.07 (m, 1H), 4.82-4.77 (m, 1H), 4.56 -4.46 (m, 3H), 4.36-4.30 (m, 2H), 4.22 (d, J=7.2 Hz, 1H), 3.98 (m, 1H), 3, 89 (m, 1H), 3.71 (s, 7H), 3.59-3.55 (m, 2H), 3.40-3.34 (m, 10H), 3.022.98 (m, 2H) , 2.77-2.72 (m, 2H), 2.08-2.05 (m, 3H), 1.13-1.08 (m, 12H) 31P-NMR (162 MHz, DMSOO δ= 148.71, 148.11, 67.51, 67.44 ER-LC/MS: m/z 1392 [M+H]+.

Preparation of Compound 11-2. To a solution of compound 10-6 (10.0 g, 7.7 mmol) in 100 ml of acetonitrile under an inert nitrogen atmosphere was added 0.5 M hydrazine hydrate (1.8 g, 37.5 mmol) in pyridine/acetic acid (3: 2) at a temperature of 0°C. The resulting solution was stirred for 0.5 h at a temperature of 0°C. 2,4-pentanedione was then added to the reaction mixture once, and the mixture was allowed to warm to room temperature and stirred for an additional 15 minutes. The solution was diluted with DCM (500 ml) and washed twice with saturated aqueous NH4Cl and then with saturated NaCl and dried over Na2SO4. Then the solution was concentrated under reduced pressure, the residue was purified by preparative flash HPLC under the following conditions (IntelFlash-1): Column: C18 silica gel; mobile phase: CH3CN/H2O (0.5% NH ₄ HCO ₃ )=1/1, increase to CH3CN/H2O (0.5% NH ₄ HCO ₃ )=1/0 for 20 min, the eluted product was collected at the ratio CH3CN/H2O (0.5% NH ₄ HCO ₃ )=3/1; detector: UV 254 nm. This resulted in compound 11-2 (7.5 g, 80%) as a white solid. 1H-NMR (400 MHz, DMSO-06) δ=13.11 (s, 1H), 11.26 (s, 1H), 8.63 (d, J=20 Hz, 2H), 8.20 (d , J=7.2 Hz, 2H), 8.15 (m, 3H), 7.73 (s, 1H), 7.66-7.47. (m, 8H), 7.41 (d, J=7.6 Hz, 2H), 7.32-7.19 (m, 10H), 6.85 (m, 5H), 6.24 (m, 1H), 5.99 (s, 1H), 5.54 (s, H), 5.41 (m, 1H), 5.10 (m, 1H), 4.79-4.75 (m, 1H ), 4.57-4.49 (m, 3H), 4.30-4.24 (m, 4H), 4.02 (m, 2H), 3.85 (m, 1H), 3.72 ( s, 7H), 3.38-3.35 (m, 7H), 2.95 (m, 2H), 1.98 (m, 3H). 31P-NMR (162 MHz, DMSOD ₆ ) δ=66.79. ER-LC/MS: m/z 1192 [M+H]+.

Obtaining 11S compound. To a solution of compound 11-2 (7.0 g, 5.0 mmol) in 70 ml of dichloromethane under an inert nitrogen atmosphere, CEP[N (iPr)2]2 (2.0 g, 6.5 mmol) and DCI were added in turn (0.6 g, 5.0 mmol) at room temperature. The resulting solution was stirred for 1 hour at room temperature, diluted with 1000 ml dichloromethane and washed with 2x250 ml saturated aqueous bicarbo solution

- 55 045960 sodium hydroxide and 1x250 ml saturated aqueous sodium chloride solution, respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until the residual solvent disappeared completely under reduced pressure. The residue was purified by preparative flash HPLC under the following conditions (IntelFlash-1): Column: C18 silica gel; mobile phase: CH3CN/ _H2O (0.5% NH4HCO3)=1/1, increase to CH3CN/H2O (0.5% NH4HCO3)=1/0 for 20 min, the eluted product was collected at the ratio CH3CN/H2O ( 0.5% NH4HCO3)=3/1; detector: UV 254 nm. This resulted in compound 11S (6.3 g, 70%) as a white solid. 1H-NMR (400 MHz, DMSO-de) δ=13.10 (s, 1H), 11.27 (s, 1H), 8.65 (s, 1H), 8.61 (s, 1H), 8 .19 (m, 2H), 8.02 (d, J=7.2 Hz, 2H), 7.767.73 (m, 1H), 7.66-7.47 (m, 6H), 7.40 ( d, J=7.2 Hz, 2H), 7.28-7.19 (m, 7H), 6.86-6.85 (m, 4H), 6.24 (d, J=6.8 Hz , 1H), 5.62 (m, 1H), 5.43-5.41 (m, 1H), 5.10 (s, 1H), 4.84-4.78 (m, 1H), 4, 66-4.49 (m, 3H), 4.30-4.18 (m, 3H), 4.04-3.95 (m, 2H), 3.83-3.77 (m, 1H), 3.72 (s, 7H), 3.62-3.54 (m, 2H), 3.44-3.32 (m, 6H), 2.96-2.92 (m, 2H), 2. 77-2.72 (m, 2H), 1.98-1.97 (m, 3H), 1.12-1.11 (m, 12H). 31P-NMR (162 MHz, DMSO^) δ=148.53, 148.09, 67.04. ER-LC/MS: m/z 1392 [M+H]+.

As in Examples 175-216, the modified process also used longer addition times (8 min) and more amidite equivalents (8 equivalents). In table 10 provides a summary of the sequence length of alternating fragments A and C, the number and type (R or S) of stereochemically specified thiophosphate (PS) bonds, and 5' modification for the resulting modified thiophosphate oligonucleotides.

Table 10

No. Length A WITH Modification PS 5’ modification 217 (AS) 17 2'-OMe-A 2'-ОМе-(5т)С 5; 2’-OMeApsR (5t)1nS HE 218 (AS) 18 2'-OMe-A 2'-ОМе-(5т)С 6; 2’-OMeApsR (5t)1iS HE 219 (AS) 19 2'-OMe-A 2'-ОМе-(5т)С 6; 2’-OMeApsR (5t)1iS He 220 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 6; 2’-OMeApsR (5t)1iS He 221 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 20; 2’-OMeApsR (5t)1pS He 222 (AS) 17 2'-OMe-A 2'-ОМе-(5т)С 5; 2’-OMeApsR (5t)1iS Vinyl phosphonate-A 223 (AS) 18 2'-OMe-A 2'-ОМе-(5т)С 6; 2’-OMeApsR (5t)1iS Vinyl phosphonate-A 224 (AS) 19 2'-OMe-A 2'-ОМе-(5т)С 6; 2’-OMeApsR (5t)1iS Vinyl phosphonate-A 225 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 6; 2’-OMeApsR (5t)1iS Vinyl phosphonate-A 226 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 20; 2’-OMeApsR (5t)1pS Vinyl phosphonate-A 227 (AS) 17 2'-OMe-A 2'-ОМе-(5т)С 5; 2’-OMeApsS (5t)1iS HE 228 (AS) 18 2'-OMe-A 2'-ОМе-(5т)С 6; 2’-OMeApsS (5t)1pS HE 229 (AS) 19 2'-OMe-A 2'-ОМе-(5т)С 6; 2’-OMeApsS (5t)1pS HE 230 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 6; 2’-OMeApsS (5t)1pS HE 231 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 20; 2’-OMeApsS (5t)1iS HE 232 (AS) 17 2'-OMe-A 2'-ОМе-(5т)С 5; 2’-OMeApsS (5t)1pS Vinyl phosphonate-A 233 (AS) 18 2'-OMe-A 2'-ОМе-(5т)С 6; 2’-OMeApsS (5t)1pS Vinyl phosphonate-A 234 (AS) 19 2'-OMe-A 2'-ОМе-(5т)С 6; 2’-OMeApsS (5t)1pS Vinyl phosphonate-A

Examples 235-240.

The effect of branching was assessed by preparing a series of thiophosphated oligonucleotides having a branched, duplicate structure in which two of the oligonucleotides are attached to each other through a linking group. An example of a thiophosphate oligonucleotide with a duplicate structure is shown in FIG. 1. In table. 11 provides a summary of the sequence length of alternating fragments A and C and the 5' modification of typical thiophosphate oligonucleotides obtained.

Table 11

No. Length A WITH 5’ modification 235 (AS)9- (5sh)1pS LNA-A LNA- (5sh)S 5' OH, 19-membered 236 (AS)15- (5sh)1pS LNA-A LNA- (5sh)S 5' OH, 31-membered 237 (AS)20- (5sh)1pS LNA-A LNA- (5t)С 5' OH, 41-membered 238 (AC)9- (5m)mC 2'-OMe-A 2'-ОМе-(5т)С 5' OH, 19-membered 239 (AC)15- (5m)mC 2'-OMe-A 2'-ОМе-(5т)С 5' OH, 31-membered 240 (AC)20- (5m)mC 2'-OMe-A 2'-ОМе-(5т)С 5' OH, 41-membered

Examples 241-246.

The effect of branching was assessed by obtaining a series of thiophosphate oligonucleotides having a branched ternary structure, in which three oligonucleotides are attached to each other

- 56 045960 res linking group. An example of a thiophosphate oligonucleotide with a ternary structure is shown in FIG. 2. In table. 12 provides a summary of the sequence length, alternating fragments A and C, and the 5' modification of the resulting typical thiophosphate oligonucleotides.

Table 12

No. Length A C S'modification 241 (AC)IO-TREB- (5m)mC LNA-A LNA-(5m)C 5' OH, 31-membered 242 (AC)13- TREB(5m)mC LNA-A LNA-(5m)C 5' OH, 40-membered 243 (AC) 15- TREB(5m)mC LNA-A LNA-(5m)C 5' OH, 46-membered 244 (AC)IO-TREB- (5m)mC 2'-OMe-A 2’-OMe- (5m)C 5' OH, 31-membered 245 (AC)13-TREB(5m)mC 2'-OMe-A 2’-OMe- (5m)C 5' OH, 40-membered 246 (AC) 15- TREB(5m)mC 2'-OMe-A 2’-OMe- (5m)C 5' OH, 46-membered

Examples 247-252.

The effects of amino-bridged nucleic acid modification (AmNA-(N-Me)) and spirocyclopropylene-bridged nucleic acid modification (scp-BNA) were assessed by preparing a series of modified thiophosphate oligonucleotides. AmNA-N-Me 6-N-benzoyl-adenosine (A ^Bz ), 4-N-benzoyl-5-methylcytidine was obtained from Luxna Biotech Co, Ltd, and scp-BNA-phosphoramidite monomers with 6-N-benzoyl adenosine (A ^Bz ), 4 -N-benzoyl-5-methylcytidine was synthesized using the procedure described in Takao Yamaguchi, Masahiko Horiba and Satoshi Obika; Chem. Commun. 2015, 51, 9737-9740, and Masahiko Horiba, Takao Yamaguchi, and Satoshi Obika; Journal of Organic Chemistry, 2016, 81, 11000-11008. The monomers were dried in a vacuum desiccator with a drying agent (P ₂ O ₅ at room temperature for 24 hours). The synthesis of AmNA and scp-BNA modifications was performed on a 1 μM scale in the 3' to 5' direction by attaching phosphoramidite monomers diluted to a concentration of 0.12 M in anhydrous CH3CN in the presence of 0.3 M activator 5-(benzylthio)-III-tetrazole ( attachment time 16-20 min) to the oligonucleotide bound to a solid support, followed by capping, oxidation and deprotection, which made it possible to obtain modified oligonucleotides. The efficiency of the step-by-step addition of all modified phosphoramidites was more than 97%. DDTT (dimethylaminomethylidene)amino)-3H-1,2,4-dithiazoline-3-thione was used as a sulfur transfer agent for the synthesis of oligonucleotide thiophosphates. The solid support material carrying the oligonucleotides was washed with a 20% solution of DEA in acetonitrile for 15 min, and then the column was thoroughly washed with AcCN. The substrate was heated to 65°C in a mixture of diisopropylamine:water:methanol (1:1:2) for 5 hours in a thermoblock to cleave the product from the substrate and remove labile protecting groups from the base. In table 13 provides a summary of the sequence length of alternating A and C fragments and the 5' modification of typical modified thiophosphate oligonucleotides obtained.

Table 13

No. Length A C S'modification 247 (AmAps (5m)AmC)20 AmNA(NMe)A AmNA(NMe)(5m)C 5' OH, 40-membered, completely AmNA 248 (ScpAps (5m)scpC)20 Scp-BNA-A Scp-BNA- (5m)C 5' OH, 40-membered, completely ScpBNA 249 AmAps (5m)mC (AC) 19 2'-OMe-A 2’-OMe- (5m)C One AmNA at the 5' end, 40-membered 250 (AC)19-mAps (5m)AmC 2'-OMe-A 2’-OMe- (5m)C One AmNA at the 3' end, 40-membered 251 ScpAps (5m)mC (AC) 19 2'-OMe-A 2’-OMe- (5m)C One ScpA at the 5' end, 40-membered 252 (AC)19-mAps (5m)ScpC 2'-OMe-A 2’-OMe- (5m)C One ScpC at the 3' end, 40-membered

- 57 045960

Examples 253-256.

The effect of attaching a targeting ligand was assessed by obtaining a series of modified thiophosphate oligonucleotides. The targeting ligands, cholesterol and tocopherol (vitamin E), were attached to the thiophosphate oligonucleotides via an alkylene oxide linking group (tetraethylene glycol, TEG) in accordance with the methods described above in Examples 1-116, except that solid phase synthesis was performed on supports from cholesterol and tocopherol with the addition of a TEG linker for 3'-conjugation, while the final addition of phosphoramidite allowed for 5'-conjugated oligonucleotides. In fig. 3A-D and in table. Figure 14 shows the structures and summary of sequence length, alternating fragments A and C, and targeting ligands for the resulting modified thiophosphate oligonucleotides.

Table 14

No. Length A WITH Targeted ligand 253 Choi- (AC)20 2'-OMe-A 2'-ОМе- (5ш)С 5'-cholesterol, 40-membered 254 (AC)20- Choi 2'-OMe-A 2'-ОМе- (5ш)С 3 '-cholesterol, 40-membered 255 Toso- (AS)20 2'-OMe-A 2'-ОМе- (5ш)С 5'-tocopherol, 40-membered 256 (AS)20-Toso 2'-OMe-A 2'-ОМе- (5ш)С 3'-tocopherol, 40-membered

Examples 257-268.

The effect of attaching a targeting ligand was assessed by obtaining a series of modified thiophosphate oligonucleotides. N-acetylgalactosamine (GalNac) was attached to thiophosphate oligonucleotides through various linking groups by reaction with the GalNAc building block, as shown in FIG. 4A. GalNAc-3 and GalNAc-5 amidites were purchased from AM Chemicals LLC and Glen Research, respectively. GalNAc-4 and GalNAc-6 were obtained from AM Chemicals LLC. In table Figure 15 shows the structures and summary of sequence length, alternating fragments A and C, and targeting ligands for the resulting modified thiophosphate oligonucleotides.

Table 15

No. Length A WITH Targeted ligand 257 GalNAc3ps-GalNAc3psGalNAc3po- (AC)20 2'-OMe-A 2'-ОМе- (5ш)С 5'-GalNAc-3; 40members 258 (AC)20-po-GalNAc3psGalNAc3ps-GalNAc3 2'-OMe-A 2'-ОМе- (5ш)С 3'-GalNAc-3; 40members

- 58 045960

259 GalNAc3ps-GalNAc3psGalNAc3po- (AC)20 LNA-A LNA-(5m)C 5'-GalNAc-3; 40members 260 (AC)20-po-GalNAc3psGalNAc3ps-GalNAc3 LNA-A LNA-(5m)C 3'-GalNAc-3; 40members 261 GalNAc4ps-GalNAc4psGalNAc4po- (AC)20 2'-OMe-A 2’-OMe- (5m)C 5'-GalNAc-4; 40members 262 (AC)20-po-GalNAc4psGalNAc4ps-GalNAc4 2'-OMe-A 2’-OMe- (5m)C 3'-GalNAc-4; 40members 263 GalNAc4ps-GalNAc4psGalNAc4po- (AC)20 LNA-A LNA-(5m)C 5'-GalNAc-4; 40members 264 (AC)20-po-GalNAc4psGalNAc4ps-GalNAc4 LNA-A LNA-(5m)C 3'-GalNAc-4; 40members 265 GalNAc5ps-GalNAc5psGalNAc5po- (AC)20 2'-OMe-A 2’-OMe- (5m)C 5'-GalNAc-5; 40members 266 (AC)20-po-GalNAc5psGalNAc5ps-GalNAc5 2'-OMe-A 2’-OMe- (5m)C 3'-GalNAc-5; 40members 267 GalNAc5ps-GalNAc5psGalNAc5po- (AC)20 LNA-A LNA-(5m)C 5'-GalNAc-5; 40members 268 (AC)20-po-GalNAc5psGalNAc5ps-GalNAc5 LNA-A LNA-(5m)C 3'-GalNAc-5; 40members

Examples 269-272.

The effect of attaching a targeting ligand was assessed by obtaining a series of modified thiophosphate oligonucleotides. N-acetylgalactosamine (GalNAc) was attached to thiophosphate oligonucleotides via a linking group, generating initial oligonucleotides and forming a precursor by attaching a C'6-NI 12-linking group to the 5' end and then reacting the precursor with a GalNAc ester. Sequences were synthesized at 10 μmol scale using a universal support (65 μmol/g loading). The C6-NH2 linker was added to the 5' end to form the precursor by reaction with 6-(4monomethoxytritylamino)hexyl(2-cyanoethyl)(Ndiisopropyl)phosphoramidite in 0.1 M acetonitrile with an addition time of 10 min. Solid supports bearing thiophosphate oligonucleotides were heated to room temperature in aqueous ammonia/methylamine (1:1) solution for 3 h on a shaker to cleave the product from the support and remove labile protecting groups from the base.

After ion exchange purification and desalting, the precursors were dissolved in 0.2 M sodium bicarbonate buffer, pH 8.5 (0.015 mM), and 5-7 mol equivalents of GalNAc ester dissolved in DMSO were added. The structures of GalNAc esters are shown in FIG. 4B. The reaction mixture was stirred at room temperature for 4 hours. The sample was analyzed to confirm the absence of the precursor. To do this, a solution of ammonia in water (28 wt %) was added (5x reaction volume) and stirred at room temperature for 2-3 hours. The reaction mixture was concentrated under reduced pressure, the resulting residue was dissolved in water and purified by HPLC on an anion exchange column at based on a strong anion.

In table Figure 16 shows the structures and summary of sequence length, alternating fragments A and C, and targeting ligands for the resulting modified thiophosphate oligonucleotides. GalNAc-1 and GalNAc-2 were prepared according to the procedures described in J. Med. Chem. 2016 59 (6) 2718-2733 and WO 2017/021385A1, respectively.

Table16

No. Length A c Targeted ligand 269 GalNAc l-NH-Sb-ro- (AC)20 2'-OMe-A 2’-OMe- (5m)C 5'-GalNAc-l; 40members 270 GalNAc l-NH-Sb-ro- (AC)20 LNA-A LNA-(5m)C 5'-GalNAc-l; 40members 271 GalNAc2-NH-C6-po-(AC)20 2'-OMe-A 2’-OMe- (5m)C 5'-GalNAc-2; 40members 272 GalNAc2-NH-C6-po-(AC)20 LNA-A LNA-(5m)C 5'-GalNAc-2; 40- member

- 59 045960

Examples 273-281.

The effect of 5' modification was assessed by preparing a series of phosphorothiophosphate oligonucleotides according to the methods described above, except that the following 5'-ethylphosphonate (EP) building block was used to incorporate the 5'-ethylphosphonate end caps:

5'-Ethylphosphonate (5'-EP) building block 5'-ethylphosphonate end cap.

Referring to FIG. The 5,5'-ethylphosphonate building block was prepared as follows.

To a mixture of compound 5-1 (3.0 g, 4.35 mmol, 1 eq.) in MeOH (5 ml) was added Pd/C (900 mg, 72.50 µmol, 10% purity) under N2 atmosphere. The suspension was degassed under vacuum and purged with H2 several times. The mixture was stirred under H2 (15 psi) at 20° C. for 12 hours. ¹ H-NMR and ³¹ P-NMR demonstrated complete consumption of compound 5-1 to form the desired product. The reaction mixture was filtered and concentrated to give [2-[(2K,3K,4K,5K)-5-(6-benzamidopurin-9-yl)-3-hydroxy-4-methoxytetrahydrofuran-2-yl]ethyl -(2,2-dimethylpropanoyloxymethoxy)phosphoryl]oxymethyl-2,2-dimethylpropanoate, compound 5-2, (2.8 g, 4.05 mmol, 93.06% yield) as a white solid. ^1H NMR (400 MHz, CD3OD) δ=8.75 (s, 1H), 8.53 (s, 1H), 8.08 (d, J=7.5 Hz, 2H), 7.68 7, 61 (m, 1H), 7.59 - 7.50 (m, 2H), 7.23 - 7.17 (m, 1H), 7.15 - 7.10 (m, 1H), 6.15 ( d, J=4.2 Hz, 1H), 5.71 - 5.61 (m, 4H), 4.57 (t, J=4.7 Hz, 1H), 4.41 (t, J=5 .3 Hz, 1H), 4.09 - 3.99 (m, 1H), 3.49 (s, 3H), 2.16 - 1.97 (m, 4H), 1.17 (d, J= 3.5 Hz, 18 H); ³¹ P NMR (162 MHz, CD3CN) δ=32.91 (s, 1P).

To a solution of compound 5-2 (2.3 g, 3.33 mmol, 1 eq.) in DCM (30 ml) was added 1H-imidazole-4,5dicarbonitrile (589.06 mg, 4.99 mmol, 1.5 eq. .), and then 3-bis(diisopropylamino)phosphanoyloxypropanenitrile (2.00 g, 6.65 mmol, 2.11 ml, 2.0 eq.), and stirred the mixture at 25°C for 2 hours. TLC showed consuming most of the 5-2 compound and forming one large new spot. The reaction mixture was washed with H2O (50 ml x 2) and saturated NaCl solution (50 ml x 2), dried over Na ₂ SO ₄ and concentrated to give a residue. The residue was purified on a Flash-C-18 column under the following conditions: Column: silica gel C18; mobile phase: water and acetonitrile (0%-70% acetonitrile), which made it possible to obtain [2-[(2K.,3K.,4K.,5K.)-5-(6-benzamidopurin-9-yl)-3- [2-cyanoethoxy(diisopropylamino)phosphanyl]oxy-4-methoxytetrahydrofuran-2-yl]ethyl-(2,2-dimethylpropanoyloxymethoxy)phosphoryl]oxymethyl-2,2-dimethylpropanoate building block (5'-EP), (1, 4 g, 1.53 mmol, 45.88% yield, 97.2% purity) as a light yellow solid. LC/MS (ER): RT=3.785 min, m/z calc. for C ₄₀ H ₆ o^0 ₁₂ P ₂ 892.37 [M+H]+, found 892.0. HPLC: Mobile phase: 10 mmol NH ₄ Ac in water (solvent C) and acetonitrile (solvent D), form an elution gradient of 80%-100% (solvent D) for 10 min and hold at 100% for 5 min at flow rate 1.0 ml/min; column 30: Waters Xbridge C18 3.5 µm, 150x4.6 mm; 1H NMR (400 MHz, CD ₃ CN) δ=δ=9.40 (s, 1H), 8.67 (s, 1H), 8.27 (d, J=1.8 Hz, 1H), 8, 01 (d, J=7.5 Hz, 2H), 7.68 - 7.60 (m, 1H), 7.58 - 7.52 (m, 2H), 6.05 (dd, J=5, 1, 8.4 Hz, 1H), 5.62 - 5.54 (m, 4H), 4.68 (t, J=1.8, 5.0 Hz, 1H), 4.64 - 4.55 (m, 1H), 4.25 -4.11 (m, 1H), 3.93 - 3.66 (m, 4H), 3.40 (d, J=19.2 Hz, 3H), 2, 75 - 2.67 (m, 2H), 2.14 - 1.95 (m, 4H), 1.25 - 1.20 (m, 12H), 1.15 - 1.11 (m, 18H); ³¹ P NMR (162 MHz, CD ₃ CN) δ=149.95, 149.27, 32.29, 32.05.

In table 17 provides a summary of the sequence length of alternating fragments A and C, the number and type (R or S) of stereochemically specified thiophosphate (PS) bonds, and LNA modification for the resulting modified 5' EP-terminal capped oligonucleotides.

_________________________________________________________________________Table 17

No. Length A WITH Modification PS Comments 273 (AS)20 2'O-Me-A 2'-ОМе- (5ш)С PS 40-member 274 (AS)20 LNA-A LNA- (5sh)S PS 40-member

- 60 045960

275 (AS)20 2'-OMe-A 2'-ОМе- (5ш)С 20; 2’-OMeApsR (5t)1pS 20 R-isomer, 41 members 276 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 19; 2’-OMeApsR (5t)1pS 19 R-isomer, 40-membered 277 (AS)20 2'-OMe-A LNA- (5t)С PS 40-member Alternating 2'OMe/LNA 278 (AS)20 2'-ОМе-А LNA-A 2'-ОМе-(5т)С LNA- (5t)С PS Every 3rd base represents an LNA 279 (AQ20 2'-OMe-A 2'-ОМе-(5т)С LNA- (5t)С PS Every 4th base represents an LNA 280 (AS)20 2'-OMe-A 2'-ОМе-(5т)С LNA- (5t)С PS 5 LNA in the middle 281 (AS)20 2'-ОМе-А LNA-A 2’-ОМе- (5т)С LNA- (5т)С PS 10 LNA in the middle

Examples 282-298.

In fig. 6A describes compounds Nos. 282-295 prepared in accordance with the above methods.

Examples 296-304.

The effects of sequence length, LNA insertion, and RNA insertion were assessed by preparing a series of thiophosphate oligonucleotides according to the methods described above. Summary results are shown in table. 18.

Table 18

No. Length A WITH RNA modification 296 (AS)20 2'-OMe-A LNA- (5sh)S 5 RNA 297 (AS)20 2'-OMe-A 2'-ОМе- (5ш)С 7 RNA 298 (AS)20 2'-OMe-A 2'-ОМе- (5ш)С 14 RNA 299 (AS) 15 2'-OMe-A 2'-ОМе- (5ш)С 5 RNA 300 (AS) 15 2'-OMe-A 2'-ОМе- (5ш)С 10 RNA 301 (AS)20 LNA-A LNA- (5sh)S 7 RNA 302 (AS)20 LNA-A LNA- (5sh)S 14 RNA 303 (AS) 15 LNA-A LNA- (5sh)S 5 RNA 304 (AS) 15 LNA-A LNA- (5sh)S 10 RNA

Examples 305-313.

The effects of sequence length, LNA insertion, and scaffold were assessed by preparing a series of thiophosphate oligonucleotides according to the methods described above. Summary results are shown in table. 19.

Table 19

No. Length A WITH Frame 305 (AS)20 LNA-A LNA- (5sh)S 40-membered; 20 RO; 19 PS 306 (AS)20 LNA-A LNA- (5t)С 40-membered; 7 RO; 32 PS 307 (AS)20 LNA-A LNA- (5t)С 40-membered; 14 RO; 25 PS 308 (AS) 15 LNA-A LNA- (5t)С 30-membered; 5 RO; 24 PS 309 (AS) 15 LNA-A LNA- (5t)С 30-membered; 10 RO; 19 PS 310 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 40-membered; 7 RO; 32 PS 311 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 40-membered; 14 RO; 25 PS 312 (AS) 15 2'-OMe-A 2'-ОМе-(5т)С 30-membered; 5 RO; 24 PS 313 (AS) 15 2'-OMe-A 2'-ОМе-(5т)С 30-membered; 10 RO; 19 PS

- 61 045960

Examples 314-322.

The effects of sequence length, LNA insertion, and ethylphosphonate terminal cap were assessed by preparing a series of thiophosphate oligonucleotides according to the methods described above. Summary results are given in table. 20.

Table 20

No. Length A WITH Modification 314 (AS)20 2'-OMe-A LNA- (5t)С Ethylphosphonate-A 315 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 19 R-dimer block; Ethylphosphonate-A 316 (AS)20 2'-OMe-A 2'-ОМе-(5т)С 5 LNA, ethylphosphonate-A 317 318 319 (AS)20 (AS)20 (AS)20 2'-OMe-A 2'-OMe-A 2'-OMe-A 2’-ОМе- (5т)С LNA- (5т)С 2'-ОМе-(5т)С LNA- (5t)С 2'-ОМе-(5т)С 40-membered; every 4th base is a 40-membered LNA Ethylphosphonate-A; every 3rd base is a 40-membered LNA Ethylphosphonate-A; ethylphosphonate-A 320 (AS) 18 2'-OMe-A LNA- (5t)С 36-membered; alternating 2'-OMenLNA 321 (AS)20 2'-ОМе-А LNA-A 2’-ОМе- (5т)С LNA- (5т)С 36-membered; every 3rd base represents LNA 322 (AQ20 2'-OMe-A LNA- (5t)С 36-membered; every 4th base represents an LNA

Examples 323-324.

The effect of LNA and phosphate tail cap insertion was assessed by preparing thiophosphate oligonucleotides according to the methods described above. Summary results are given in table. 21.

Table 21

No. Length A WITH End cap 323 (AS)20 LNA-A LNA- (5sh)S 5'-phosphate 324 (AS)20 2'-OMe-A 2'-ОМе- (5ш)С 5'-phosphate

Examples 325-338.

The effect of LNA insertion level was assessed by preparing a series of thiophosphate oligonucleotides according to the methods described above. Summary results are given in table. 22.

Table 22

No. Length A WITH Modification 325 (AS)20 2'-ОМе-А LNA-A 2'-ОМе- (5ш)С LNA- (5ш)С 40-membered; 75% 2'-OMe, 25% LNA

- 62 045960

326 (AS)20 2'-ОМе-А LNA-A 2'-ОМе- (5ш)С LNA- (5ш)С 40-membered; 67.5% 2'ОМе 37.5% LNA 327 (AS)20 2'-O-MOE-A LNA-A 2’-O-MOE- (5sh)S LNA- (5sh)S 40-membered; 75% 2'-OMOE, 25% LNA 328 (AS)20 2'-O-MOE-A LNA-A 2’-O-MOE- (5sh)S LNA- (5sh)S 40-membered; 67.5% 2'-OMOE 37.5% LNA 329 (AS)20 2'-ОМе-А LNA-A 2'-ОМе- (5ш)С LNA- (5ш)С 40-membered; 75% LNA, 25% 2'-OMe (10-member block) 330 (AS)20 2'-ОМе-А LNA-A 2'-ОМе- (5ш)С LNA- (5ш)С 40-membered; 50% LNA; 50% 2'-ОМе (20-member block) 331 (AS)20 2'-O-MOE-A LNA-A 2’-O-MOE- (5sh)S LNA- (5sh)S 40-membered; 75% LNA, 25% 2'-O-MOE (10-member block) 332 (AS)20 2'-O-MOE-A LNA-A 2’-O-MOE- (5sh)S LNA- (5sh)S 40-membered; 50% LNA; 50% 2'-O-MOE (20-member block) 333 (AS)20 LNA-A DNA-A LNA- (5sh)S DNA- (5sh)S 40-membered; 7 DNA 334 (AS)20 LNA-A DNA-A LNA- (5sh)S DNA- (5sh)S 40-membered; 14 DNA 335 (AS)20 LNA-A DNA-A LNA- (5sh)S DNA- (5sh)S 30-membered; 5 DNA 336 (AS)20 LNA-A DNA-A LNA- (5sh)S DNA- (5sh)S 30-membered; 10 DNA 337 (AS)20 LNA-A DNA-A LNA- (5sh)S DNA- (5sh)S 40-membered; 50% LNA; 50% DNA (10-mer DNA block) 338 (AS)20 LNA-A DNA-A LNA- (5sh)S DNA- (5sh)S 40-membered; 50% LNA; 50% DNA (20-mer DNA block)

Examples 339-340.

The effect of ScpA and AmNA incorporation was assessed by preparing thiophosphate oligonucleotides according to the methods described above. Summary results are given in table. 23.

Table 23

No. Length A WITH Modification 339 (AS)20 2'-OMe-A LNA- (5t)С One ScpA at the 3' end, 40-membered 340 (AS)20 2'-OMe-A LNA- (5t)С One AmNA at the 3' end, 40-membered

Examples 341-346.

The effect of GNA and UNA incorporation was assessed by preparing a series of thiophosphate oligonucleotides according to the methods described above. Summary results are given in table. 24.

Table 24

No. Length A WITH 341 (AS)20 LNA-A GNA- (5t)С 342 (AS)20 GNA-A 2'-ОМе-(5т)С 343 (AS)20 2'-OMe-A GNA- (5t)С 345 (AS)20 UNA-A UNA- (5t)S 346 (AS)20 UNA-A UNA- (5t)S

Examples 347-350.

The effect of attaching a targeting ligand was assessed by obtaining a series of modified thiophosphate oligonucleotides in accordance with the methods described

- 63 045960 nom above. Summary results are given in table. 25.

Table 25

No. Length GalNAc5ps-GalNAc5psGalNAc5po- (AC)20 A C Modification 40-membered, alternating 2’OMe-LNA; 347 348 GalNAc5ps-GalNAc5psGalNAc5po- (AC)20 2'-OMe-A 2'-OMe-A LNA-(5m)C 2’-OMe-(5m)C LNA- (5m)C 5'-GalNac 40-membered, each 4th base is an LNA; 5'-GalNac 349 GalNAc5ps-GalNAc5psGalNAc5po- (AC)20 2'-OMe-A 2’-OMe-(5m)C LNA-A 40-membered, 5 LNA; 5'-GalNac 350 GalNAc5ps-GalNAc5psGalNAc5po- (AC)20 2'-OMe-A LNA-(5m)C 40-membered, alternating 2'OMe-LNA 5 RNA; 5'-GalNac

Examples 351-355.

The effect of adding a targeting ligand, cholesterol or tocopherol, was assessed by preparing a series of modified thiophosphate oligonucleotides according to the methods described above. Summary results are given in table. 26.

Table 26

No. Length A WITH Targeted ligand 351 Choi- (AC)20 2'-OMe-A (5m)propargyl-S 3'-cholesterol, 40-membered 352 (AC)20- Choi 2'-OMe-A (5m)propargyl-S 3'-palmitoyl, 40-membered 353 (AS)20 Z'-OMe-A Z'-ОМе- (5т)С Z'-OMe, 40-membered 354 (AC)20- Choi Z'-OMe-A Z'-ОМе- (5т)С 3'-cholesterol, 40-membered 355 (AS)20- Toso Z'-OMe-A Z'-ОМе- (5т)С 3'-tocopherol, 40-membered

Examples 356-358.

The effect of the terminal cap structure (methyl, allyl, cytosine) was assessed by preparing thiophosphate oligonucleotides according to the methods described above. Summary results are shown in table. 27.

Table 27

No. Length A WITH End cap 356 (AS)20 2'-OMe-A LNA- (5sh)S 40-membered, 4'-Me at 5' end 357 (AS)20 2'-OMe-A LNA-A LNA- (5sh)S 40-membered, 5 3'-C-allylA Z'-C-allylA 358 (AS)20 LNA-A LNA- (5sh)S 40-member, Su-5 at 3’end

Examples 359-362.

The effect of G and U base incorporation was assessed by preparing thiophosphate oligonucleotides according to the methods described above. A summary of the connections is given in Table. 28.

Table 28

No. Length Base 1 Base 2 Modification 359 (AG)20 2'-OMe-A 2'-OMe-G Repeat AG 360 (GA)20 2'-OMe-G 2'-OMe-A Repeat GA 361 (SA)20 2'-ОМе- (5ш)С 2'-OMe-A Repeat SA 362 (AU)20 2'-OMe-A 2'-OMe-U Repeat AU

Examples 363-376.

The effect of sequence length was assessed by preparing a series of thiophosphate oligonucleotides according to the methods described above. A summary of the connections is given in Table. 29.

- 64 045960

Table 29

No. Length A WITH Modification 363 (AS)14 2'-OMe-A 2'-OMe-C 28 member 364 (AQ15-A 2’-000-A 2'-ОМе- (5ш)С 31 members 365 (AS)17 2'-OMe-A 2'-ОМе- (5ш)С 34-member 366 (AQ18-A 2’-000-A 2'-ОМе- (5ш)С 37-membered 367 (AS)20 2'-OMe-A 2'-OMe-C 20 member 368 (AS)9 2'-OMe-A 2'-ОМе- (5ш)С 18-member 369 (AS)9-A 2’-000-A 2'-ОМе- (5ш)С 19-member 370 (AS)10 2'-OMe-A 2'-ОМе- (5ш)С 20 member 371 (AS)9-A LNA-A LNA- (5sh)S 19-member 372 (AS)9 LNA-A LNA- (5sh)S 18-member 373 (AS)15 LNA-A LNA- (5sh)S 30-member 374 (AC) 12-A 2’-000-A 2'-ОМе- (5ш)С 25-member 2'-ОМе- (5ш)С 40-membered, 5 S- 375 (AS)20 2'-OMe-A isomers 376 (AS)10 LNA-A LNA- (5sh)S 20 member

Examples 377-380 and 384.

The effect of RNA insertion was assessed by preparing a series of thiophosphate oligonucleotides according to the methods described above. Summary results are shown in table. thirty.

Table 30

No. Length A WITH Modification 377 (AS)20 2'-OMe-A Ribo-A LNA- (5sh)S 40-mer, 4 RNA 378 (AS)20 2'-OMe-A Ribo-A LNA- (5sh)S 40-mer, 3 RNA 379 (AS)20 2'-OMe-A Ribo-A LNA- (5sh)S 40-mer, 2 RNA 380 (AS)20 2'-ОМе-А UNA-A 2’-ОМе- (5ш)С UNA- (5ш)С 40-membered, 4-membered blocks of 2’ OMe and UNA 384 (AS)20 2'-OMe-A Ribo-A LNA- (5sh)S 40-mer, 1 RNA

Examples 381-383.

The effect of 4etl (4οτηλ-ΕΝΑ) insertion was assessed by preparing a series of thiophosphate oligonucleotides according to the methods described above. 4etl monomers were prepared according to known methods (Seth, P.P., J. Org. Chem. 2010, 75, (5), 1569-1581). Summary results are shown in table. 31.

Table 31

No. Length A WITH Modification 381 (AS)20 4etl-A 4etl- (5m)C 40 member, 100% 4etl 382 (AS)20 2'-OMe-A 4etl- (5m)C 40 member, 50% 4etl 383 (AS)20 2'-OMe-A 2’-ОМе- (5m)C 4etl- (5m)C 40-member, 25% 4etl

Examples 385-389.

The effect of incorporating nmLNA (N-methyl-LNA) A and C was assessed by preparing a series of thiophosphate oligonucleotides according to the methods described above. nmLNA monomers were obtained from commercial sources (Bio-Synthesis Inc., Lewisville, TX, USA). Summary results are shown in table. 32.

- 65 045960

Table 32

No. Length A WITH Modification 385 (AS)20 2'-ОМе-А nmLNA-А LNA- (5t)С 40-mer, 1 nmLNA 386 (AS)20 2'-ОМе-А nmLNA-А LNA- (5t)С 40-mer, 3 nmLNA 387 (AS)20 2'-ОМе-А nmLNA-А LNA- (5t)С nmLNA (5t)-С 40-mer, 3 nmLNA 388 (AS)20 2'-OMe-A LNA- (5t)С nmLNA (5t)-С 40-mer, 3 nmLNA 389 (AS)20 2'-ОМе-А nmLNA-А LNA- (5t)С nmLNA (5t)-С 40-mer, 4 nmLNA

Examples 390-392.

The effect of AmNA and Scp-BNA A and C incorporation was assessed by preparing a series of thiophosphate oligonucleotides according to the methods described above. Summary results are shown in table. 33 (also see table 23).

Table 33

No. Length A WITH Modification 390 (AS)20 2'-OMe-A AmNA- (5t)С 40-membered, 20 AmNA (50%) 391 (AS)20 2'-OMe-A 2’-ОМе- (5т)С Sep- (5т)С 40-mer, 10 scpBNA (25%) 392 (AS)20 2'-ОМе-А Sep-А 2'-ОМе-(5т)С 40-mer, 5 scpBNA (12.5%)

Example B1.

hbsag secretion assay and cytotoxicity assay.

The sequence-independent activity against hepatitis B virus (determined by HBsAg secretion assay) and cytotoxicity of a number of representative modified oligonucleotides were determined as described below; summary data about them is given in table. 34-35 and in fig. 6A and 6B.

HBsAg release assay protocol.

Cell culture.

HepG2.2.15 cells were maintained in DMEM with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, 1% glutamine, 1% non-essential amino acids, 1% sodium pyruvate, and 380 μg/ml G418. Cells were maintained at 37°C in an atmosphere of 5% CO ₂ .

HBsAg secretion assay.

HepG2.2.15 cells were grown in DMEM as described above. Cells were seeded at a concentration of 45,000 cells/well in 96-well plates coated with collagen-I. Immediately after adding cells, test compounds were added.

Selected compounds could also be tested after transfection with Lipofectamine® RNAiMAX. Lipofectamine® RNAiMAX transfection reagent (Thermo Fisher) was used according to the manufacturer's instructions.

The 50% inhibitory concentration (EC ₅₀ ) and 50% cytotoxic concentration (CC ₅₀ ; see below) were assessed by dissolving in 1x PBS to 100x the desired final test concentration. Each compound was serially diluted (1:3) to give up to 8 different concentrations up to 10x the desired final test concentration in DMEM with 10% FBS. A 10-μl sample of compounds at 10x concentration in cell culture medium was used to treat HepG2.2.15 cells in a 96-well format. Cells were first incubated with the compounds for 3 days at 37°C in an atmosphere of 5% CO ₂ .

Three days after addition of compound/transfection, the medium and compound were replaced with fresh medium/compound with RNAiMax and incubated for another 3 days; the total incubation time was 6 days. For HBsAg quantification, both supernatant and cell lysate were collected (see below).

Secreted HBsAg was quantified using an HBsAg ELISA kit (Autobio-CL0310).

EC ₅₀ , the drug concentration required to reduce HBsAg secretion by 50% compared to the value for untreated control cells, was calculated by plotting the percentage reduction in HBsAg level versus drug concentration using Microsoft Excel (prediction function).

- 66 045960

A parallel set of plates was prepared and planned to be used to test compound-induced cytotoxicity (see below).

Cytotoxicity assay.

HepG2.2.15 cells were cultured and treated as above. On day 6, cytotoxicity was measured using a cell proliferation assay (CellTiter-Glo Luminescent Cell Viability Assay; Promega) according to the manufacturer's instructions or a suitable alternative method.

_CC50 , the drug concentration required to reduce cell viability by 50% compared to the value for untreated control cells, was calculated by plotting the percentage reduction in the number of viable cells versus drug concentration using Microsoft Excel (prediction function).

Table 34. Efficacy and cytotoxicity

Connection no. ESeo (µM) CCso (µM) 3 IN A 6 A IN 8 IN A 9 A A 10 A A 12 A A 13 IN A 18 WITH A

- 67 045960

20 IN IN 23 IN V 26 With A 34 V A 36 V A 38 A A 39 IN WITH 44 A A 45 A A 63 IN A 97 IN A 98 V A 99 V A 105 V A 106 V A 120 With A 121 V A 122 V A 127 V A 128 D A 129 D A 130 IN A 134 A A 142 WITH A 147 D A 148 D A 149 IN A 150 A A 151 D A 152 D A 153 IN A 158 IN A 159 WITH A 178 A A 179 A A 180 A A 182 A A 183 A A 184 A A 190 IN A 191 IN A 192 A A 199 IN A 200 WITH A

- 68 045960

201 IN A 202 IN A 204 IN A 205 V A 220 With A 221 A A 223 WITH A 235 D IN 236 D IN 237 A IN 238 D A 239 D A 240 IN A 241 IN A 242 A A 243 A A 244 WITH A 245 D A

Efficiency: A: > 5-fold higher compared to (2'-ОМе-А; 2'-ОМе-С); B: > 2-fold higher compared to (2'-OMe-A; 2'-OMe-C) and < 5-fold higher compared to (2'OMe-A; 2'-OMe-C) ; C: higher or equal to (2'-ОМе-А; 2'-ОМе-С) and < 2-fold higher than (2'-ОМе-А; 2'-ОМе-С); D: lower compared to (2'-ОМе-А; 2'-ОМеС).

Cytotoxicity: A: > 2 µM; B: < 2 µM.

Table 35. Efficacy and cytotoxicity

Connection No. ¹ eu ₅₀ ss ₅₀ 6, 274, 283 A IN 376 D A 371 D A 372 D A 273, 282 D A 367 WITH A 368 D A 369 D A 370 D A 345 IN A 346 A A 351 D IN

- 69 045960

352 D IN 373 IN IN 308 WITH A 239 D A 235 D IN 236 D IN 237 A IN 301 A V 303 IN V 305 C A 315 c A 309 D IN 297 C A 298 D A 300 D A 312 D A 313 D A 299 D A 304 D A 302 D A 307 D A 375 IN A 201 C A 202 C A 203 IN A 204 D A 205 D A 353 IN A 351 D A 352 D A 178 A A 179 A A 180 C A 182 A A 183 D A 184, 290 A A 177 IN A 374 D A 363 D A 364 D A

- 70 045960

365 D A 366 D A 238 D A 240 IN A 241 IN A 242 A A 243 A A 130 A A 380 D A 310 D A 311 D A 254 D A 325 D A 326 D A 327 D A 328 D A 158 IN A 150 A A 159 C A 341 D A 342 IN A 244 C A 245 C A 343 IN A 329 C A 330 IN IN 331 D A 332 D A 333 IN A 334 IN A 335 WITH A 336 WITH A 337 A IN 338 IN IN 117 IN A 118 IN A 134, 277, 284 A A 142 WITH A 190 V A 191 V A

- 71 045960

192 IN A 210 IN A 211 V A 212 V A 218 With A 223 With A 221 A A 127 D A 128 WITH A 129 WITH A 120 IN A 121 IN A 122 A A 181 WITH A 147 D A 148 D A 149 IN A 151 D A 152 D A 153 IN A 294 IN A 276, 291 A A 275, 295 A IN 173, 293 A A 165, 287 IN A 167, 289 IN A 164, 286 WITH A 166, 288 A A 171, 280, 292 IN A 314 A IN 281, 316 A A 296 A A 285 A IN 251 A A 356 A A 320 A A 321 A IN 322 IN A 317 A IN 318 IN IN

- 72 045960

319 A IN 357 A A 339 A A 252 A A 340 A A 250 A A 359 D A 360 D A 361 D A 362 D A 12 A A 20 IN A 38 A A 385 A A 386 A A 387 A A 388 A A 389 A A 376 A A 377 A A 378 A A 379 A A 384 A A 381 A A 382 A A 383 IN A 390 A IN 391 A IN 392 IN IN

¹ A number of compounds described in this document are assigned more than one connection number as described in this document.

Efficacy: A: EC50 < 30 nM; B: EC50 > 30 nM and EC50 < 100 nM; C: EC50 > 100 nM and EC50 < 300 nM; D: EC50 > 300 nM.

Cytotoxicity: A: CC ₅₀ > 1000 nM; B: CC ₅₀ < 1000 nM.

Example B2.

Analysis of a real infection.

HepG2-NTCP cells were maintained in DMEM/F12 medium with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, 1% glutamine, 1% non-essential amino acids, 1% sodium pyruvate. Cells were maintained at 37°C in a 5% CO ₂ atmosphere.

HepG2-NTCP cells were resuspended in the above medium and seeded at a concentration of 15,000 cells/well in 96-well collagen-I-coated plates. On the second day (day 0), cells were infected with HBV (purified HBV from HepAD38 cells) at a multiplicity of infection (MOI) of 200 in the presence of 4% PEG8000 and 2% DMSO and incubated at 37°C overnight. The inoculum was vacuum treated, the cells were washed three times with DMEM/F12 with 2% FBS, and then the medium was replaced with HepG2-NTCP medium.

Cells were treated on day 5. On day 5, test compounds were diluted 3-fold with Opti-MEM I medium and mixed with Lipofectamine® RNAiMAX transfection reagent, following the manufacturer's instructions. After replacing the medium on day 8, transfection of the test compounds was performed as described. After incubation for another 3 days, the supernatant was collected and HBsAg was measured by ELISA (Diasino). Cell viability was measured using CellTiter-Glo (Promega).

EC ₅₀ , the drug concentration required to reduce HBsAg secretion by 50% compared to the value for untreated control cells, was calculated by plotting the percentage reduction in HBsAg level versus drug concentration using the Microsoft Excel or GraphPad Prism prediction function; summary data about it are given in table. 36.

- 73 045960

Table 36. Efficacy and cytotoxicity

Connection no. eu ₅₀ ss ₅₀ 6, 274, 283 A A 273, 282 WITH A 315 D A 290 A A 184 134, 277, 284 A A 192 A A 221 A A 294 WITH A 291 276 A A 295 275 IN A 173, 293 IN A 165, 287 A A 167, 289 IN A 164, 286 IN A 166, 288 IN A 171,280, 292 V A 314 A A 281, 316 WITH A 296 A A 285 A A 251 IN A 356 A A 320 A A

Efficacy: A: EC50 < 30 nM; B: EC50 > 30 iM and EC50 < 100 nM; C: EC50 > 100 nM and EC50 < 300 nM; D: EC50 > 300 nM.

Cytotoxicity: A: CC ₅₀ > 1000 nM; B: CC ₅₀ < 1000 nM.

Example B3.

HBSAG secretion assay for combinations.

The sequence-independent activity against hepatitis B virus (determined by HBsAg secretion assay) of representative modified oligonucleotide compounds in combinations with antisense oligonucleotides (ASO) was determined as described below; summary data is given in table. 37.

Cell culture.

HepG2 2.15 cells were maintained in DMEM/F12 medium with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, 1% glutamine, 1% non-essential amino acids, 1% sodium pyruvate. Cells were maintained at 37°C in an atmosphere of 5% CO2.

HBsAg secretion assay.

HepG2.2.15 cells were grown in DMEM/F12 as described above. Cells were seeded at a concentration of 35,000 cells/well in 96-well plates coated with collagen-I. Immediately after adding cells, test compounds were added. Double transfections were performed on days 0 and 3.

Transfection method.

Transfection with Lipofectamine® RNAiMAX. Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher, Cat#: 13778-150) was used according to the manufacturer's instructions.

A: Mix RNAiMAX (0.3 µl/well for 96-well plates) with Opti-MEM I (20% excess), incubate for 5 min at RT.

B: ASO and modified oligonucleotide combinations were diluted in Opti-MEM I to give 40x final concentration (8 points, 3x dilution including 0 nM concentrations). The maximum concentration was approximately 100-200 times the EC50 value. Equal volumes of diluted Compound 1 and Compound 2 were then mixed in the opposite direction as shown in the graph shown in FIG. 23.

A and B were mixed in equal volumes (with a 20% excess volume) and incubated for another 5-10 minutes. Then, mixture A and B were added at a ratio of 1/10 of the final culture volume to each well and the plate was manually rotated for 10 s. Plates were prepared in at least triplicate. They were incubated at 37°C for 3 days, the medium was changed to fresh, and the transfection process was repeated. On day 6 after treatment, the supernatant was collected for solid-phase ELISA, viability was measured

- 74,045,960 cells using CellTiter-Glo (Promega).

Data analysis.

For synergy analysis, the percentage reduction in HBsAg (or DNA) was calculated for each well. Percentage reduction = (1-well/average for control without drug) x 100. These numbers were entered into MacSynergy II software and the amount of synergy/antagonism was obtained by following the software instructions.

A synergism volume <25 indicated no synergism/antagonism.

A synergism volume of 25–50 indicated little synergism/antagonism.

A synergism volume of 50–100 indicated moderate synergism/antagonism.

A synergism volume >100 indicated strong synergism/antagonism.

A synergism volume > 1000 indicated a possible error (data verification required).

Percentage of cell viability = (well/average for control without drug) x 100.

Cytotoxicity was monitored as previously described. Quantitative determination of HBsAg.

Secreted HBsAg was quantified using an HBsAg ELISA kit (Autobio-CL0310). The synergy values for combinations of modified oligonucleotides with ASO are given in table. 37.

Table 37. Combination synergy

Connection no. ASO ¹ 95% volume of HBsAg synergy 166, 288 ASO-1 335.08 134, 277, 284 ASO-2 52.98 296 ASO-2 43.05

¹ ASO-1 was the unconjugated HBV SS0-1 ASO described in Javanbakht, H. et al. Molecular Therapy: Nucleic Acids Vol. 11 June 2018, which had the following structure: 5-lnApslnGpsln (5m)CpsGpsApsApsGpsTpsGps (5m)CpsAps (5m)CpsApsln (5m)CpslnGpslnG-3. ASO-2 was an ASO having the structure described for the ASO designated sequence No. 9 in US application serial number 62/855793, incorporated herein by reference in its entirety, in particular for the purpose of describing the structure of sequence No. 9.

Example B4.

HBSAG secretion assay for combinations.

Sequence-independent activity against hepatitis B virus (determined by HBsAg secretion assay) of representative modified oligonucleotide compounds in combinations with ASO, capsid assembly modulators (CAM compound 1 or CAM compound 2) or nucleoside analog (entecavir, ETV) was determined as described below ; summary data is given in table. 38.

Cell culture.

The following assay procedure describes anti-HBV activity. This assay used HepG2.2.15 cells transfected with the HBV genome and quantification of cell-free HBV DNA as an end point. Cell viability was assessed in parallel with intracellular ATP measurements using CellTiter-Glo® reagent from Promega.

HBsAg secretion assay.

HepG2.2.15 cells were grown in DMEM/F12 as described above. Cells were seeded at a concentration of 35,000 cells/well in 96-well plates coated with collagen-I. Immediately after adding cells, test compounds were added. Double transfections were performed on days 0 and 3.

Quantitative analysis of HBV DNA.

Cell-free DNA was isolated using the QIAamp 96 DNA Blood Kit according to the manufacturer's manual. HBV DNA was then quantitatively analyzed by qPCR with the HBV-specific primers and probes listed below using Roche's FastStart Universal Master Mix on an ABI-7900HT. The PCR cycle program consisted of 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min.

Elements Name Sequence (5’ —> 3’) HBV primer HBV forward primer GTGTCTGCGGCGTTTTATCA HBV reverse primer GACAAACGGGCAACATACCTT HBV probe HBV probe FAM-CCTCTKCATCCTGCTGCTATGCCTCATCTAMRA

Transfection method.

Transfection with Lipofectamine® RNAiMAX. Lipofectamine® RNAiMAX transfection reagent (Thermo Fisher, Cat#: 13778-150) was used according to the manufacturer's instructions.

A: Mix RNAiMAX (0.3 µl/well for 96-well plates) with Opti-MEM I (20% excess

- 75 045960 com), incubated for 5 minutes at room temperature.

B: diluted combinations of CAM, ASO and ETV with modified oligonucleotides in OptiMEM I to give 40x final concentration (8 points, 3x dilution including 0 nM concentrations). The maximum concentration was approximately 100-200 times the EC ₅₀ value. Equal volumes of diluted Compound 1 and Compound 2 were then mixed in the opposite direction as shown in the graph shown in FIG. 23.

A and B were mixed in equal volumes (with a 20% excess volume) and incubated for another 5-10 minutes. Then, mixture A and B were added at a ratio of 1/10 of the final culture volume to each well and the plate was manually rotated for 10 s. Plates were prepared in at least triplicate. Incubate at 37°C for 4 h and then add ASO, ETV, or CAM and allow cells to recover from transfection. On day 3 after treatment, the supernatant was collected for solid-phase ELISA, and cell viability was measured using CellTiter-Glo (Promega).

Data analysis.

Synergy data were analyzed as described above in Example B3.

Quantitative determination of HBsAg.

Secreted HBsAg was quantified using an HBsAg ELISA kit (Autobio-CL0310). The synergy values for combinations of modified oligonucleotides with ASO are given in table. 38.

Table 38. Synergy of combinations

Connection no. ASO, CAM or ETV ¹ dnkvgv 95% volume synergism of DNAVHB 166, 288 ASO-1 Additivity 23.99 134, 277, 284 ETV Synergy 25.91 134, 277, 284 Connection CAM 1 Additivity 1.35 134, 277, 284 Connection CAM 2 Synergy 41.86

Compound CAM 1 was a CAM having the structure described for the CAM compound referred to as compound 3 in WO 2017/181141, incorporated herein by reference in its entirety, in particular for the purpose of describing the structure of compound 3. Compound CAM 2 was a CAM having the structure described for compound CAM, designated compound 1 in US application serial number 62/805725, incorporated herein by reference in its entirety, in particular for the purpose of describing the structure of compound 1. ASO-1 is described above in table. 37.

Example B5. Liver effects in non-human primates.

Liver endpoints in non-human primates were assessed by administering representative modified oligonucleotide compounds to female cynomolgus monkeys by the intravenous (IV) or subcutaneous (SC) route. For the IV route, the compound was administered in a carrier medium of sterile phosphate buffered saline (PBS) and infused over 2 hours at a dosage of 1 ml/kg. For subcutaneous administration, the vehicle medium was also sterile PBS, and the compound was administered by a single bolus at a dosage of 1 ml/kg. There were two animals in each dose group, and the data shown is the average of the two animals. Liver levels were determined at the 24 hour time point. The doses used for this study and the data obtained are shown in FIG. 12. Surprisingly, hepatic exposure following subcutaneous administration to non-human primates was found to be significantly higher than expected based on hepatic exposure levels following intravenous administration of an otherwise comparable dosage.

Example B6.

MIC analysis.

The effects of typical modified oligonucleotide compounds on the release of cytokines from peripheral blood mononuclear cells (PBMCs) were assessed as described below; summary information is given in table. 39 and FIG. 13-22.

Buffy cells (N=3) were obtained from the Stanford Blood Center and processed for PBMC isolation according to the standard Aragen protocol using Ficoll density gradient centrifugation. PBMCs (1 million/ml) were suspended in complete culture medium (RPMI supplemented with 10% heat-inactivated FBS low in IgG and PSG) and plated in a 96-well round bottom plate at 100 μl/well. MPU was treated with test compounds (listed on the next slide) (concentration range: 10 to 0 μM -3-fold dilution) and PHA and poly1C (concentration range: 10 to 0 μM -3-fold dilution). All experiments were performed in triplicate. After 24 hours incubation at temperature

-

Claims (101)

Supernatants were collected at 37°C/5% CO2 in a humidified standard cell culture incubator and stored at -80°C until cytokine analysis. Cytokines (GM-CSF, IL-lb, IL-2, IL-6, IL-10, IL-8, IL-12p70, IF11g. TNFa) were tested on Intellicyt iQue Screener and analyzed using ForeCyt analytical software. Cytokine (IFNa) was analyzed using standard ELISA. Results are expressed as pg/mL values calculated from the standard curve. Table 39 Connection No. Fig. No. Immune reaction ¹ RHA control 13 Strong REP-2139 14 Weak 171,280, 292 15 Weak 296 16 Absent 134, 277, 284 17 Weak 166, 288 18 Absent 167, 289 19 Absent 281,316 20 Absent 294 21 Weak 276.291 22 Weak Strong: significant induction observed for more than two types of cytokines in the tested panel; weak: induction was observed for one or two types of cytokines in the tested panel; absent: no induction was observed for any cytokine in the tested panel. CLAIM 1. A modified oligonucleotide or complex thereof having sequence-independent activity against the hepatitis B virus, containing at least partially a thiophosphate sequence of alternating fragments A and C, wherein fragments A contain one or more of compounds selected from - 77 045960 4etl-A _and Ribo-A. fragments C contain one or more of compounds selected from - 78 045960 volume A or C, wherein said phosphorus-containing linkage is a thiophosphate linkage or a modified linkage selected from phosphodiester, dithiophosphate, methylphosphonate, thiodiphosphate, 5'-phosphoramidate, 3',5'-phosphorodiamidate, 5'-thiophosphoramidate, 3',5' -thiophosphordiamidate or diphosphodiester linkage; and the sequence-independent activity against hepatitis B virus, determined by an HBsAg secretion assay, is superior to that of a reference compound, said reference compound being a thiophosphate 40-mer AC oligonucleotide known as REP 2139; with the proviso that if a sequence of alternating fragments A and C contains a fragment of ribo-A, then the specified sequence additionally contains at least one fragment A that is not a fragment of ribo-A; And - 79 045960 with the proviso that if a sequence of alternating fragments A and C contains a ribo-C fragment, then said sequence additionally contains at least one fragment C that is not a ribo-C fragment; and wherein said sequence of alternating fragments A and C has a sequence length ranging from 36 fragments to 44 fragments; fragments A contain at least 15 fragments of 2'-OMe-A; and fragments C contain at least 3 fragments of LNA-5mC. 2. A modified oligonucleotide or its complex according to claim 1, characterized in that fragment A is one or more compounds selected from 3. Modified oligonucleotide or its complex according to claim 1, characterized in that the fragment A is one or more compounds selected from 4. Modified oligonucleotide or its complex according to claim 1, characterized in that the fragment A is one or more compounds selected from 5. A modified oligonucleotide or its complex according to claim 1, characterized in that fragment A is one or more compounds selected from 2'-O-propargyl-A _and 2'-O-butynyl-A 6. Modified oligonucleotide or its complex according to claim 1, characterized in that the fragment A is one or more compounds selected from 7. A modified oligonucleotide or its complex according to claim 1, characterized in that at least one of the fragments A is - 80 045960 8. A modified oligonucleotide or its complex according to claim 1, characterized in that at least one of the fragments A is a smaller 9. A modified oligonucleotide or its complex according to claim 1, characterized in that at least one of the fragments A is a smaller 10. A modified oligonucleotide or its complex according to claim 1, characterized in that at least one of the fragments A is a smaller 11. A modified oligonucleotide or its complex according to claim 1, characterized in that fragment A is one or more compounds selected from 12. A modified oligonucleotide or its complex according to any one of claims 1 to 11, characterized in that fragment C is one or more compounds selected from 13. A modified oligonucleotide or its complex according to any one of claims 1 to 11, characterized in that fragment C is one or more compounds selected from - 81 045960 nmLNA-(5m)C 14. Modified oligonucleotide or its complex according to any one of claims 1-11, characterized in that at least one of the fragments C is scp-BNA-(5m)C 15. Modified oligonucleotide or its complex according to any one of claims 1-11, characterized in that at least one of the fragments C is AmNA-(NMe)-(5m)C 16. A modified oligonucleotide or its complex according to any one of claims 1 to 11, characterized in that fragment C is one or more compounds selected from 2'-O-propargyl-(5t)C _and 2'-O-butynyl-(5t)C 17. A modified oligonucleotide or its complex according to any one of claims 1 to 11, characterized in that fragment C is one or more compounds selected from - 82 045960 2'-F(5m)C _and 2'-araF(5m)C 18. A modified oligonucleotide or its complex according to any one of claims 1-11, characterized in that at least one of the fragments C is n ₃ co o Z'-OMe- (5t)S 19. Modified oligonucleotide or its complex according to any one of claims 1-11, characterized in that at least one of the fragments C is UNA-(5m)C 20. A modified oligonucleotide or its complex according to any one of claims 1-11, characterized in that at least one of the fragments C is 2'-NH ₂ (5m)C 21. A modified oligonucleotide or its complex according to any one of claims 1-11, characterized in that at least one of the fragments C is GNA-(5m)C 22. A modified oligonucleotide or its complex according to any one of claims 1-11, characterized in that at least one of the fragments C is ENA-5mC 23. Modified oligonucleotide or complex thereof according to any one of claims 1 to 22, which is partially thiophosphated. - 83 045960 24. The modified oligonucleotide or complex thereof according to claim 23, which is at least about 85% thiophosphate. 25. A modified oligonucleotide or complex thereof according to any one of claims 1 to 22, which is completely thiophosphated. 26. A modified oligonucleotide or its complex according to any one of claims 23-25, containing at least one stereochemically specified thiophosphate bond. 27. Modified oligonucleotide or its complex according to claim 26, containing at least 6 stereochemically specified thiophosphate bonds. 28. A modified oligonucleotide or complex thereof according to claim 26 or 27, characterized in that said at least one stereochemically specified thiophosphate bond is in the R configuration. 29. A modified oligonucleotide or complex thereof according to claim 26 or 27, characterized in that said at least one stereochemically specified thiophosphate bond is in the S configuration. 30. Modified oligonucleotide or its complex according to any one of claims 1 to 29, containing a 5' terminal cap. 31. Modified oligonucleotide or its complex according to claim 30, characterized in that the 5' terminal cap is selected from ,0 IT.'' Oh BUT.,'' _about HO-p—CR ¹ =CR ² -|- HO Ί = ^HO p' ^but ° _v OH, V HO V _and Y, each of the groups R ¹ and R ² being independently selected from a hydrogen atom, a deuterium atom, a phosphate, a thioC1 _-6 -alkyl and a cyano group. 32. A modified oligonucleotide or its complex according to claim 31, characterized in that both the R ¹ group and the R ² group are hydrogen atoms. 33. A modified oligonucleotide or its complex according to claim 31, characterized in that both the R ¹ group and the R ² group are not hydrogen atoms. 34. Modified oligonucleotide or its complex according to claim 31, characterized in that the 5' terminal cap is selected from OOO NO.,'' NO.,'' D NO.r' But but but o no.,'' but V _o and V. 35. Modified oligonucleotide or its complex according to claim 31, characterized in that the 5' terminal cap is 36. A modified oligonucleotide or complex thereof according to any one of claims 1 to 35, characterized in that at least one terminal group is a linking group. 37. A modified oligonucleotide or a complex thereof according to claim 36, further comprising at least one second oligonucleotide attached to the modified oligonucleotide via a linking group. 38. A modified oligonucleotide or its complex according to claim 36, additionally containing a targeting ligand attached to the modified oligonucleotide via a linking group. 39. A modified oligonucleotide or its complex according to claim 38, characterized in that the specified ligand for targeted action contains N-acetylgalactosamine (GalNac), three-antennary GalNac, tocopherol or cholesterol. - 84 045960 40. A modified oligonucleotide or complex thereof according to any one of claims 1 to 39, characterized in that at least some of the fragments A are not 2'O-methylated at the ribose ring. 41. A modified oligonucleotide or complex thereof according to any one of claims 1 to 40, characterized in that at least some of the C fragments are not 2'O-methylated at the ribose ring. 42. A modified oligonucleotide or complex thereof according to any one of claims 1 to 41, characterized in that said at least partially thiophosphated sequence of alternating fragments A and C additionally contains one or more modifications of the thiophosphate bond. 43. A modified oligonucleotide or its complex according to claim 42, characterized in that the modification of the thiophosphate bond is a modified bond selected from phosphodiester, dithiophosphate, methylphosphonate, thiodiphosphate, 5'-phosphoramidate, 3',5'-phosphorodiamidate, 5'- thiophosphoramidate, 3',5'-thiophosphorodiamidate or diphosphodiester linkage. 44. A modified oligonucleotide or a complex thereof according to claim 43, characterized in that said modified bond is a phosphodiester bond. 45. A modified oligonucleotide or complex thereof according to any one of claims 1 to 41, additionally containing at least two partially thiophosphated sequences of alternating fragments A and C, connected to each other to form a concatemer. 46. A modified oligonucleotide or complex thereof according to any one of claims 1 to 45, characterized in that the sequence-independent activity against the hepatitis B virus is at least 2 times higher than the activity of the reference compound. 47. A modified oligonucleotide or complex thereof according to claim 46, characterized in that the sequence-independent activity against the hepatitis B virus is at least 5 times higher than the activity of the reference compound. 48. A modified oligonucleotide or a complex thereof according to any one of claims 1 to 47, characterized in that said modified oligonucleotide is characterized by an EC ₅₀ value of less than 30 nM, determined using an HBsAg secretion assay. 49. A modified oligonucleotide or a complex thereof according to any one of claims 1 to 47, characterized in that said modified oligonucleotide is characterized by an EC ₅₀ value determined using an HBsAg secretion assay and ranging from 30 nM to less than 100 nM. 50. A modified oligonucleotide or complex thereof according to any one of claims 1 to 47, characterized in that said modified oligonucleotide has an EC50 value determined by an HBsAg secretion assay and is in the range of 100 nM to less than 300 nM. 51. A modified oligonucleotide or its complex according to claim 1, characterized in that the length of said at least partially thiophosphated sequence and alternating fragments A and C are selected from any of SEQ ID NO: 6, 201-205, 210-212, 218, 221, 223, 235-245, 250-252, 254, 273-277, 281-320, 322-343, 345-353, 356-357, 359-392; and/or wherein said sequence has a sequence length selected from the group consisting of: (AC)20, (AC)15, (AC)25, (AC)30, (AC)17, (AC)18, (AC) 19, (AC)9-(5m)lnC, (AQ15-(5m)lnC, (AC)20-(5m)lnC, (AC)9-(5m)mC, (AC)15(5m)mC, ( AC)20-(5m)mC, (AC)10-TREB-(5m)mC, (AC)13-TREB-(5m)mC, (AC)15-TREB-(5m)mC, (AmAps(5m) AmC)20, (ScpAps(5m)scpC)20, AmAps(5m)mC(AC)19, (AC)19-mAps(5m)AmC, ScpAps(5m)mC(AC)19, (AC)19-mAps (5m)ScpC, Chol-(AC)20, (AC)20-Chol, Toco-(AC)20, (AC)20-Toco, GalNAc3ps-GalNAc3ps-GalNAc3po-(AC)20, (AC)20-po -GalNAc3ps-GalNAc3ps-GalNAc3, GalNAc4psGalNAc4ps-GalNAc4po-(AC)20, (AC)20-po-GalNAc4ps-GalNAc4ps-GalNAc4, GalNAc5ps-GalNAc5psGalNAc5po-(AC)20, (AC)20-po-GalNAc5ps-GalNAc5ps-GalNA c5 , GalNAcl-NH-C6-po-(AC)20, GalNAc2NH-C6-po-(AC)20, (CA)20, (AC)14, (AC)15-A, (AC)18-A, ( AC)9, (AC)9-A, (AC)10 and (AC)12-A; and/or where the alternating fragments A and C contain any of fragments A and C selected from the group consisting of: 2'- OME, 2'-O-MOE, LNA, 2'-F, 2'-O-propargyl, 2'-O-butyne, 2'-F-Ara, UNA, ENA, LNA-A, 2'-OMe- A, UNA-A, 2'-OMe-ALNA-A, LNA-A, AmNA(NMe)-A, Scp-BNA-A, 2'O-Me-A, 2'-O-MOE-A, DNA -A, GNAA, 3'-OMe-A, 3'-C-allyl-A, 2'-OMe-G, 2'-OMe-(5m)C, Ribo-A, 4etl-A, nmLNA-A, Scp-A, 2'-NH2, LNA(5m)C, UNA-(5m)C, AmNA(NMe)-(5m)C, Scp-BNA-(5m)C, 2'-OMe-(5m)C , 2'-O-MOE-(5m)C, DNA-(5m)C, GNA-(5m)C, (5m)-propargyl-C, 3'-OMe-(5m)C, 2'-OMe- U, 2'-OMe-C, 4etl-(5m)C, nmLNA(5m)-C, AmNA(5m)C and Scp-(5m)C. 52. The modified oligonucleotide complex according to any one of claims 1 to 51, characterized in that said complex is a chelate complex. 53. The complex according to claim 52, characterized in that said complex is a chelate complex of calcium, magnesium or zinc and a modified oligonucleotide. 54. The modified oligonucleotide complex according to any one of claims 1 to 52, characterized in that said complex is a monovalent counterion complex. 55. The complex according to claim 54, characterized in that said complex is a complex of lithium, sodium or potassium and a modified oligonucleotide. 56. Modified oligonucleotide or its complex according to claim 1, characterized in that - 85 045960 said at least partially thiophosphated sequence of alternating fragments A and C is at least 85% thiophosphated; the length of said at least partially thiophosphated sequence of alternating fragments A and C is in the range from 36 fragments to 44 fragments; fragments A contain at least 15 fragments of 2'-OMe-A and at least 1 fragment of ribo-A; fragments C contain at least 15 LNA-5mC fragments; and said modified oligonucleotide has an EC ₅₀ value of less than 30 nM, determined by an HBsAg secretion assay. 57. A modified oligonucleotide or its complex according to claim 1, characterized in that said at least partially thiophosphated sequence of alternating fragments A and C is thiophosphated by at least 85%; the length of said at least partially thiophosphated sequence of alternating fragments A and C is in the range from 36 fragments to 44 fragments; fragments A contain at least 15 fragments of 2'-OMe-A; fragments C contain at least 7 fragments of LNA-5mC; and said modified oligonucleotide has an EC50 value of less than 50 nM determined by an HBsAg secretion assay. 58. A modified oligonucleotide or its complex according to claim 1, characterized in that said at least partially thiophosphated sequence of alternating fragments A and C is thiophosphated by at least 85%; and said modified oligonucleotide has an EC50 value of less than 100 nM determined by an HBsAg secretion assay. 59. A modified oligonucleotide or its complex according to claim 1, characterized in that said at least partially thiophosphated sequence of alternating fragments A and C is thiophosphated by at least 85%; the length of said at least partially thiophosphated sequence of alternating fragments A and C is in the range from 36 fragments to 44 fragments; fragments A contain at least 18 fragments of 2'-OMe-A; fragments C contain at least 15 LNA-5mC fragments; and said modified oligonucleotide has an EC ₅₀ value of less than 30 nM, determined by an HBsAg secretion assay. 60. The complex of a modified oligonucleotide according to any one of claims 57-59, characterized in that said complex is a complex of a monovalent counterion containing a complex of sodium or potassium and a modified oligonucleotide. 61. A pharmaceutical composition comprising an amount of a modified oligonucleotide or complex thereof according to any one of claims 1 to 60, effective for treating a subject infected with hepatitis B, and a pharmaceutically acceptable carrier. 62. A pharmaceutical composition comprising an amount of a modified oligonucleotide or complex thereof according to any one of claims 1 to 60, effective for treating a subject infected with hepatitis D, and a pharmaceutically acceptable carrier. 63. An agent for the treatment of hepatitis B and/or hepatitis D, containing an effective amount of a modified oligonucleotide or its complex according to any one of claims 1 to 60 or a pharmaceutical composition according to claim 61 or 62. 64. A method of treating hepatitis B, comprising administering to the body of a subject in need thereof an effective amount of a modified oligonucleotide or complex thereof according to any one of claims 160 or a pharmaceutical composition according to claim 61 or 62 or a treatment agent according to claim 63. 65. The method according to claim 64, characterized in that the modified oligonucleotide or complex thereof is administered to the subject by parenteral route. 66. The method according to claim 64, characterized in that the modified oligonucleotide or complex thereof is administered to the subject intravenously. 67. The method according to claim 64, characterized in that the modified oligonucleotide or complex thereof is administered to the subject subcutaneously. 68. The method of any one of claims 64 to 67, further comprising administering to the subject an effective amount of a second hepatitis B treatment agent. 69. The method of claim 68, wherein said second agent for treating hepatitis B comprises a second oligonucleotide having sequence-independent activity against the hepatitis B virus, an siRNA oligonucleotide, an antisense oligonucleotide, a nucleoside, an interferon, an immunomodulator, a capsid assembly modulator, or their combination. 70. The method according to claim 69, characterized in that said second agent for treating hepatitis B contains an antisense oligonucleotide. 71. The method according to claim 69, characterized in that said second agent for the treatment of hepatitis B with - 86 045960 holds the capsid assembly modulator. 72. A method of treating hepatitis D, comprising administering to the body of a subject in need thereof an effective amount of a modified oligonucleotide or complex thereof according to any one of claims 160 or a pharmaceutical composition according to claim 61 or 62 or a treatment agent according to claim 63. 73. The method according to claim 72, characterized in that the modified oligonucleotide or complex thereof is administered to the subject by parenteral route. 74. The method according to claim 72, characterized in that the modified oligonucleotide or complex thereof is administered to the subject intravenously. 75. The method according to claim 72, characterized in that the modified oligonucleotide or complex thereof is administered to the subject subcutaneously. 76. The method of any one of claims 72 to 78, further comprising administering to the subject an effective amount of a second hepatitis D treatment agent. 77. The method of claim 76, wherein said second hepatitis D treatment agent comprises a second oligonucleotide having sequence-independent activity against the hepatitis D virus, an antisense oligonucleotide, a nucleoside, an interferon, a capsid assembly modulator, or a combination thereof. 78. The method according to claim 77, characterized in that said second agent for treating hepatitis D contains an antisense oligonucleotide. 79. The method according to claim 77, characterized in that said second agent for treating hepatitis D contains a capsid assembly modulator. 80. A method of treating hepatitis B or hepatitis D, comprising subcutaneously administering an effective amount of an antiviral oligonucleotide or complex thereof to a subject in need thereof, wherein the mechanism of antiviral activity of said oligonucleotide is substantially independent of sequence, and wherein said antiviral oligonucleotide is a modified oligonucleotide or a complex according to any one of claims 1 to 60, a pharmaceutical composition according to claim 61 or 62 or a treatment agent according to claim 63; and at the same time, the sequence-independent antiviral activity is higher compared to the reference oligonucleotide. 81. The method according to claim 80, characterized in that the reference oligonucleotide is REP 2139, REP 2055, REP 2165 or a chelate complex thereof. 82. The method of claim 81, comprising subcutaneously administering a safe and effective amount of an antiviral oligonucleotide or complex thereof to a human subject in need thereof, at a dosage reduced from the expected dosage based on observed liver levels following otherwise comparable intravenous administration. , and at the same time, the sequence-independent antiviral activity is higher compared to the reference oligonucleotide. 83. The use of a modified oligonucleotide or its complex according to any of claims 1-60 in the treatment of hepatitis B. 84. The use of a modified oligonucleotide or its complex according to any of claims 1-60 in the treatment of hepatitis D. 85. The use of a modified oligonucleotide or its complex according to any of claims 1-60 in the preparation of a medicinal product for the treatment of hepatitis B. 86. The use of a modified oligonucleotide or its complex according to any of claims 1-60 in the preparation of a medicinal product for the treatment of hepatitis D. 87. Use according to any one of claims 85-86, wherein said use comprises subcutaneous administration of a safe and effective amount of an antiviral oligonucleotide or complex thereof to a human subject in need thereof, at a dosage reduced from the expected dosage based on observed levels in the liver after otherwise comparable intravenous administration. 88. A dinucleotide consisting of fragment A and fragment C, connected by a stereochemically specified thiophosphate bond, and fragments A contain one or more of compounds selected from - 87 045960 fragments C contain one or more of compounds selected from - 88 045960 89. The dinucleotide according to claim 88, provided that said dinucleotide contains neither a riboA fragment nor a ribo-C fragment. 90. The dinucleotide according to claim 89, characterized in that the ^w ° group is phosphoramidite according to the following formula (A): - 89 045960 R ¹ N—R ² -j-°—P< * O—R ³ (A) and each of the groups R ¹ and R ² individually represents C _1-6 alkyl; and the group R ³ represents C _1-6 -alkyl or cyanoC _1-6 -alkyl. 91. The dinucleotide according to claim 90, characterized in that said phosphoramidite according to formula (A) is a phosphoramidite according to the following formula (A1): 92. A dinucleotide according to any one of claims 88-91, characterized in that said stereochemically specified thiophosphate bond is a thiophosphate according to the following formulas (B1) or (B2): wherein the group R ⁴ represents C _1-6 -alkyl or cyanoC _1-6 -alkyl. 93. The dinucleotide according to claim 92, characterized in that the thiophosphate according to formula (B1) is a thiophosphate according to formula (B3), or the thiophosphate according to formula (B2) is a thiophosphate according to formula (B4) as follows: 94. A modified oligonucleotide or a complex thereof, wherein said modified oligonucleotide is represented by the following formula: 5'mApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsmApsln(5m)Cpsr Apsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsrApsln(5m)CpsmApsln(5m)CpsmAps ln(5m)Cps rApsln( 5m)CpsmApsln(5m)CpsmApsln(5m)CpsrApsln(5m)CpsmApsln(5 m)CpsmApsln(5m)CpsrApsln(5m)CpsmApsln(5m)CpsmApsln(5m)C 3', where mA is 2'-O-methyladenosine, ps is thiophosphate, ln(5m)C is blocked 5-methylcytidine and rA is riboadenosine. 95. The modified oligonucleotide complex according to claim 94, characterized in that said complex is a chelate complex. 96. The modified oligonucleotide complex according to claim 94, characterized in that said complex is a complex of a monovalent counterion. 97. The complex according to claim 94, characterized in that said complex is a complex of lithium, sodium or potassium and a modified oligonucleotide. 98. A pharmaceutical composition containing an amount of a modified oligonucleotide or complex thereof according to claim 97, effective for treating a subject infected with hepatitis B and/or hepatitis D; and a pharmaceutically acceptable carrier. 99. The pharmaceutical composition according to claim 97, where the pharmaceutical composition is presented in the form of a dosage form for subcutaneous delivery. 100. A method of treating hepatitis B, comprising administering to a subject in need thereof an effective amount of a modified oligonucleotide or a complex thereof according to claim 94. 101. The method according to claim 100, characterized in that the modified oligonucleotide or complex thereof is administered to the subject by parenteral route. -