OA20585A

OA20585A - Mono-or di-substituted indole derivatives as dengue viral replication inhibitors.

Info

Publication number: OA20585A
Application number: OA1201900207
Authority: OA
Inventors: Jean-François BONFANTI; Tim Hugo Maria Jonckers; Bart Rudolf Romanie Kesteleyn; Pierre Jean-Marie Bernard Raboisson; Dorothée Alice Marie-Eve BARDIOT; Arnaud Didier M MARCHAND
Original assignee: Janssen Pharmaceuticals, Inc; Katholieke Universiteit Leuven
Priority date: 2015-05-08
Filing date: 2016-05-04
Publication date: 2022-11-29

Abstract

The present invention relates to mono- or disubstituted indole compounds, methods to prevent or treat dengue viral infections by using said compounds and also relates to said compounds for use as a medicine, more preferably for use as a medicine to treat or prevent dengue viral infections. The present invention furthermore relates to pharmaceutical compositions or combination preparations of the compounds, to the compositions or preparations for use as a medicine, more preferably for the prevention or treatment of dengue viral infections. The invention also relates to processes for preparation of the compounds.

Description

Titre : Mono-or di-substituted indole dérivatives as dengue viral réplication inhibitors.

& Abrégé :

The présent invention relates to mono- or disubstituted indole compounds, methods to prevent or treat dengue viral infections by using said compounds and also relates to said compounds for use as a medicine, more preferably for use as a medicine to treat or prevent dengue viral infections. The présent invention furthermore relates to pharmaceutical compositions or combination préparations of the compounds, to the compositions or préparations for use as a medicine, more preferably for the prévention or treatment of dengue viral infections. The invention also relates to processes for préparation ofthe compounds.

Formula I

O.A.P.I. - B.P. 887, YAOUNDE (Cameroun) - Tel. (237) 222 20 57 00-Site web: http:/www.oapi.int- Email: oapi@oapi.int

Mono- or di-substituted indole dérivatives as dengue viral réplication înhlbitors

The présent invention relates to mono- or di-substituted indole compounds, methods to prevent or treat dengue viral infections by using said compounds and 5 also relates to said compounds for use as a medicine, more preferably for use as a medicine to treat or prevent dengue viral infections. The présent invention furthermore relates to pharmaceutical compositions or combination préparations of the compounds, to the compositions or préparations for use as a medicine, more preferably for the prévention or treatment of dengue viral infections. The invention 10 also relates to processes for préparation of the compounds.

BACKGROUND OF THE INVENTION

Flaviviruses, which are transmitted by mosquitoes orticks, cause life-threatening infections in man, such as encephalitis and hémorrhagie fever. Four distinct, but closely related serotypes of the flavivirus dengue are known, so-calied is DENV-1, -2, -3, and -4. Dengue is endemic in most tropical and sub-tropical régions around theworld, predominantly in urban and semi-urban areas. According to the World Health Organization (WHO), 2.5 billion people of which 1 billion children are at risk of DENV infection (WHO, 2002). An estimated 50 to 100 million cases of dengue fever [DF], half a million cases of severe dengue disease (i.e. dengue hémorrhagie fever [DHF] and dengue shock syndrome [DSS]), and more than 20,000 deaths occur worldwide each year. DHF has become a leading cause of hospitalization and death amongst children in endemic régions. Altogether, dengue represents the most common cause of arboviral disease. Because of recent large outbreaks in countries situated in Latin America, 25 South-East Asia and the Western Pacific (including Brazil, Puerto Rico, Venezuela, Cambodia, Indonesia, Vietnam, Thailand), numbers of dengue cases hâve risen dramatically over the past years. Not only is the number of dengue cases increasing as the disease is spreading to new areas, but the outbreaks tend to be more severe.

To prevent and/or control the disease associated with dengue viral infection, the only available methods at présent are mosquito éradication strategies to control the vector. Atthough progress is being made in the development of vaccines against dengue, many difficulties are encountered. These include the existence of a phenomenon referred to as antibody-dependent enhancement (ADE). Recovery 35 from an infection by one serotype provides lifelong immunity against that serotype but confers only partial and transient protection against a subséquent infection by

-2one of the other three serotypes. Following infection with another serotype, preexisting heterologous antibodies form complexes with the newly infecting dengue virus serotype but do not neuiralize the pathogen. Instead, virus entry into cells is believed to be facilitated, resulting in uncontrolled virus réplication and higher peak viral titers. in both primary and secondary infections, higher viral titers are associated with more severe dengue disease. Since maternai antibodies can easiiy pass on to infants by breastfeeding, this might be one of the reasons that children are more affected by severe dengue disease than adults.

In locations with two or more serotypes circulating simultaneously, also referred to as hyper endemic régions, the risk of serious dengue disease is significantly higher due to an increased risk of experiencing a secondary, more severe infection. Moreover, in a situation of hyper-endemicity, the probabilîty ofthe emergence of more virulent strains is increased, which in turn augments the probabilîty of dengue hemorrhagic fever (DHF) or dengue shock syndrome.

The mosquitoes that carry dengue, including Aedes aegypti and Aedes albopictus (tiger mosquito), are moving north on the globe. According to the United States (US) Centers for Disease Control and Prévention (CDC), both mosquitoes are currently omniprésent in Southern Texas. The spread north of dengue-carrying mosquitoes is not confined to the US, but has also been observed in Europe.

Recently (December 2015), the dengue vaccine produced by Sanofi Pasteur was first approved ïn Mexico. The vaccine has also been approved in Brazil, The Philippines and El Salvador. Regulatory review processes are continuing in other countries where dengue is a public health priority. Nevertheless, the vaccine leaves considérable room for improvement due to limited efficacy, especially against DENV-1 and -2, low efficacy in flavivirus-naïve subjects and the lengthy dosing schedule.

Despite these shortcomings, the vaccine is a game changer in endemic settings as it will offer protection to a large part of the population, but likely not to very young infants, who beat the largest burden of dengue. In addition, the dosing schedule and very limited efficacy in flavivirus-naïve subjects make it unsuitable and likely not worthwhile/cost-effective for travelers from non-endemic areas to dengue-endemic areas. The above mentioned shortcomings ofthe dengue vaccines are the reason why there is a need for a pre-exposure prophylactic dengue antiviral.

-3Furthermore, today, spécifie antiviral drugs for the treatment or prévention of dengue fever virus infection are not available. Clearly, there is still a great unmet medical need for therapeutics for the prévention or treatment of viral infections in animais, more in particular in humans and especially for viral infections caused by 5 Flaviviruses, more in particular Dengue virus. Compounds with good anti-viral potency, no or low levels of side-effects, a broad spectrum activity against multiple Dengue virus serotypes, a low toxicity and/or good pharmacokinetic or -dynamic properties are highly needed.

The présent invention now provides compounds, mono- or di-substituted indole 10 dérivatives, which show high potent activity against ali four (4) serotypes ofthe

Dengue virus. Also the compounds according to the invention possess a good pharmacokinetic profile and surprisingly these spécifie compounds show an improved chiral stability.

SUMMARY OF THE INVENTION

The présent invention is based on the unexpected finding that at least one of the above-mentioned problems can be solved by the current compounds of the invention.

The présent invention provides compounds which hâve been shown to possess potent antiviral activity against ail four (4) serotypes currently known. The présent 20 invention furthermore demonstrates that these compounds efficiently inhibit prolifération of Dengue virus (DENV). Therefore, these compounds constitute a useful class of potent compounds that can be used in the treatment and/or prévention of viral infections in animais, mammals and humans, more specifically for the treatment and/or prévention of infections with Dengue viruses.

The présent invention furthermore relates to the use of such compounds as medicines and to their use for the manufacture of médicaments for treating and/or preventing viral infections, in particular with viruses belonging to the family of the Dengue viruses in animais or mammals, more in particular in humans. The invention also relates to methods for the préparation of ail such compounds and to 30 pharmaceutical compositions comprising them in an effective amount.

The présent invention also relates to a method of treatment or prévention of dengue viral infections in humans by the administration of an effective amount of one or more such compounds, or a pharmaceutically acceptable sait thereof optionaliy in combination with one or more other medicines, like another antiviral 35 agent or dengue vaccine or both, to a patient in need thereof.

One aspect of the invention is the provision of compounds of formula (I)

Cl

a stereo-isomeric form, a pharmaceufically acceptable sait, solvaté or polymorph thereof comprising a mono- or di-substituted indole group; said compound is selected from the group wherein:

Ri is H, R₂ is F and R3 is H or CH₃,

Ri is H, CH₃ or F, R₂ is OCH₃ and R3 is H, Ri is H, R₂ is OCH₃ and R₃ is CH₃,

R-i is CH₃, R₂ is F and R₃ is H,

Ri is CF₃ or OCF₃, R₂ is H and R₃ is H, Ri is OCF_3] R₂ is OCH₃ and R₃ is H and Ri is OCF3, R₂ is H and R₃ is CH₃.

In particuiar the compounds of the invention or their stereo-isomeric form, a pharmaceutically acceptable sait, solvaté or polymorph thereof are selected from the group:

Cl

-6Another aspect of the invention is the use ofa compound represented by the following structural formula (I)

a stereo-isomeric form, a pharmaceutically acceptable sait, solvaté or polymorph thereof comprising a mono- or di-substituted indole group; said compound is selected from the group wherein:

R! is H, R₂ is F and R₃ is H or CH3,

Ri is H, CH₃ or F, R₂ is OCH₃ and R₃ is H and

Ri is H, R₂ is OCH₃ and R₃ is CH₃,

Ri is CH₃, R₂ is F and R₃ is H,

R₁ is CF₃ or OCF₃, R₂ is H and R₃ is H,

Ri is OCF₃, R₂ is OCH₃ and R₃ is H and

Ri is OCF₃, R₂ is H and R₃ is CH₃ for inhibiting the réplication of dengue virus(es) in a biological sample or patient.

Part of the current invention is also a pharmaceutical composition comprising a compound of formula (I) or a stereo- isomeric form , a pharmaceutically acceptable sait, solvaté or polymorph thereof together with one or more pharmaceutically acceptable excipients, diluents or carriers.

Pharmaceutically acceptable saits of the compounds of formula (!) include the acid addition and base salts thereof. Suitable acid addition salts are formed from acids which form non-toxic salts. Suitable base salts are formed from bases which form non-toxic salts.

The compounds of the invention may also exist in un-solvated and solvated forms. The term “solvaté” is used herein to describe a molecular complex comprising the compound of the invention and one or more pharmaceutically acceptable solvent molécules, for example, éthanol.

The term “polymorph” refers to the ability of the compound of the invention to exist in more than one form or crystal structure.

The compounds ofthe présent invention may be administered as crystalline or amorphous products. They may be obtained for example as solid plugs, powders, or films by methods such as précipitation, crystallization, freeze drying, spray drying, or evaporative drying. They may be administered alone or in combination with one or more other compounds ofthe invention or in combination with one or io more other drugs. Generally, they will be administered as a formulation in association with one or more pharmaceutically acceptable excipients. The term “excipient” is used herein to describe any ingrédient other than the compound(s) of the invention. The choice of excipient dépends largely on factors such as the particular mode of administration, the effect ofthe excipient on solubility and stability, and the nature of the dosage form.

The compounds of the présent invention or any subgroup thereof may be formulated into various pharmaceutical forms for administration purposes. As appropriate compositions there may be cited ail compositions usually employed for systemically administering drugs. To préparé the pharmaceutical compositions of 20 this invention, an effective amount of the particular compound, optionally in addition sait form, as the active ingrédient is combined in intimate admixture with a pharmaceutically acceptable carrier, which carrier may take a wide variety of forms depending on the form of préparation desired for administration. These pharmaceutical compositions are desirably in unitary dosage form suitable, for 25 example, for oral or rectal administration. For example, in preparing the compositions in oral dosage form, any of the usua! pharmaceutical media may be employed such as, for example, water, glycols, oils, alcohols and the like in the case of oral liquid préparations such as suspensions, syrups, élixirs, émulsions, and solutions; or solid carriers such as starches, sugars, kaolin, diluents, 30 lubricants, binders, disintegrating agents and the like in the case of powders, pills, capsules, and tablets. Because of their ease in administration, tablets and capsules represent the most advantageous oral dosage unit forms, in which case solid pharmaceutical carriers are obviously employed. Also included are solid form préparations that can be converted, shortly before use, to liquid forms.

It is especially advantageous to formulate the aforementioned pharmaceutical compositions in unit dosage form for ease of administration and uniformity of

-8dosage. Unit dosage form as used herein refers to physically discrète units suitabîe as unitary dosages, each unit containing a predetermined quantity of active ingrédient calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. Examples of such unit 5 dosage forms are tablets (including scored or coated tablets), capsules, pills, powder packets, wafers, suppositories, injectable solutions or suspensions and the like, and segregated multiples thereof.

Those of skill in the treatment of infectious diseases will be able to détermine the effective amount from the test results presented hereinafter. In general it is contemplated that an effective daily amount would be from 0.01 mg/kg to mg/kg body weight, more preferably from 0.1 mg/kg to 10 mg/kg body weight. It may be appropriate to administer the required dose as two, three, four or more sub-doses at appropriate intervals throughout the day. Said sub-doses may be formulated as unit dosage forms, for example, containing 1 to 1000 mg, and in 15 particular 5 to 200 mg of active ingrédient per unit dosage form.

The exact dosage and frequency of administration dépends on the particular compound of formula (I) used, the particular condition being treated, the severity of the condition being treated, the âge, weight and general physical condition of the particular patient as well as other médication the individual may be taking, as 20 is well known to those skilled in the art. Furthermore, it is évident that the effective amount may be lowered or increased depending on the response of the treated subject and/or depending on the évaluation of the physician prescribing the compounds of the instant invention. The effective amount ranges mentioned above are therefore only guidelines and are not intended to limit the scope or use 25 of the invention to any extent.

The présent disclosure is also intended to include any isotopes of atoms présent in the compounds ofthe invention. For example, isotopes of hydrogen include tritium and deuterium and isotopes of carbon include C-13 and C-14.

The présent compounds used in the current invention may also exist in their so stereo-chemically isomeric form, defining al! possible compounds made up of the same atoms bonded by the same sequence of bonds but having different threedimensional structures, which are not interchangeable. Unless otherwise mentioned or indicated, the Chemical désignation of compounds encompasses the mixture of ail possible stereo-chemically isomeric forms, which said compounds 35 might possess.

Said mixture may contaîn ail dia-stereomers and/or enantiomers of the basic molecular structure of said compound. Ail stereo-chemically isomeric forms of the compounds used in the présent invention either in pure form or in admixture with each other are intended to be embraced within the scope ofthe présent invention 5 including any racemic mixtures or racemates.

Pure stereoisomeric forms ofthe compounds and intermediates as mentioned herein are defined as isomers substantially free of other enantiomeric or diastereomeric forms of the same basic molecular structure of said compounds or io intermediates. In particular, the term 'stereoisomerically pure' concerns compounds or intermediates having a stereoisomeric excess of at least 80% (i. e. minimum 90% of one isomer and maximum 10% of the other possible isomers) up to a stereoisomeric excess of 100% (i.e. 100% of one isomer and none of the other), more in particular, compounds or intermediates having a stereoisomeric is excess of 90% up to 100%, even more in particular having a stereoisomeric excess of 94% up to 100% and most in particular having a stereoisomeric excess of 97% up to 100%. The terms 'enantiomerically pure' and 'diastereomerically pure' should be understood in a similar way, but then having regard to the enantiomeric excess, respectively the diastereomeric excess of the mixture in 20 question.

Pure stereoisomeric forms of compounds and intermediates used in this invention may be obtained by the application of art-known procedures. For instance, enantiomers may be separated from each other by the sélective crystallization of 25 their diastereomeric salts with optically active acids or bases. Examples thereof are tartaric acid, dibenzoyltartaric acid, ditoluoyltartaric acid and camphosulfonic acid. Altematively, enantiomers may be separated by chromatographie techniques using chiral stationary phases. Said pure stereochemically isomeric forms may also be derived from the corresponding pure stereochemically isomeric forms of 30 the appropriate starting materials, provided that the reaction occurs stereospecifically. Preferably, if a spécifie stereoisomer is desired, said compound will be synthesized by stereospecific methods of préparation. These methods will advantageously employ enantiomerically pure starting materials.

³⁵ General synthetic approaches

The synthesis of compounds of general formula I can be performed as outlined in Scheme 1.2-(4-Chloro-2-methoxyphenyl)acetic acid (II) can be converted to the corresponding 2-(4-chloro-2-methoxyphenyl)acetyl chloride (III) with a chlorination

-10reagent like for example thionyl chloride. The Friedel-Crafts réaction of the acid chloride III with a substituted indole of general formula IV can be performed using a Lewis acid reagent like for example Et₂AICI or TiCI₄ in a suitable solvent like for example CH₂CI₃ or 1,2-dichloroethane, and under suitable reaction conditions that s typically (but not exclusively) involve cooling, to provide the 3-acylated indole of general formula V. The introduction of an aniline moiety in alpha position to the carbonyl moiety of the compounds of general formula V can be accomplished by a reaction sequence that involves for example bromination οΐ V with a reagent like for example phenyltrimethylammonium tribromide in a suitable solvent like for io example THF, to provide the compounds of general formula VI, and subséquent reaction of the compounds of general formula VI with 3-methoxy-5-(methylsulfonyl)aniline (VII) in a suitable solvent like for example CH₃CN, and typically using a base like for example TEA or DIPEA, to provide the compounds of general formula I as racemic mixtures. Chiral séparation of the compounds of general formula I can be performed by for example chiral chromatography to provide the Enantiomers A and B of general formula I.

Chiral séparation

Enantiomers l(A) and l(B)

Scheme 1

-11In some cases, the synthesis of the intermediate of general formula V via the Friedel-Crafts synthesis approach, benefits from the presence ofa protecting group (PG) at the indole-N during the Friedel-Crafts reaction step, as outlined in Scheme 2. To this end, the substituted indole of general formula IV can be converted first to an N-protected intermediate of general formula VIII, such as for example an N-Tosylated intermediate of general formula VIH (PG = Ts), using a reagent like for example tosyl chloride, in the presence of a base like for example sodium hydride. The Friedel-Crafts reaction of the substituted indole of general formula IV with acid chloride III can be performed using a Lewis acid reagent like 10 for example Et₂AICI or TiCU in a suitable solvent like for example CH2CI2 or

1,2-dichloroethane, and under suitable reaction conditions that typically (but not exclusively) involve cooling, to provide the 3-acylated N-protected indole of general formula IX. Removal of the indoie-N protecting group PG of the intermediate of general formula IX can be accomplished with a reagent like for 15 example LIOH (for PG = Ts) in a solvent mixture like for example THF/water an at a suitable reaction température, to provide the 3-acylated indole of general formula V.

Scheme 2

As an alternative approach, the intermediate of general formula V can also be prepared as outlined in Scheme 3: The A/-Boc-protected substituted indole3-carbaldehyde of general formula X can be converted to the corresponding Strecker-type of intermediate of general formula XI by reaction with morpholine in 25 the presence of reagents like for example sodium cyanide and sodium bisulfite and in a suitable solvent like for example a mixture of water and a water-mixable organic solvent like for example dioxane. Alkylation of the compound of general formula XI with 4-chloro-2-methoxy-benzylchloride can be accomplished in the presence of a base like for example potassium hexamethyldisilazane and in a suitable solvent like for example DMF to provide the compound of general formula XII. Submission of the compound of general formula XII to a suitable aqueous

-12acidic hydrolytic condition Iike for example by treatment with an aqueous hydrochloric acid solution at elevated température, provides the intermediate of general formula V.

Scheme 3

Examples

LC/MS methods

The High Performance Liquid Chromatography (HPLC) measurement was performed using a LC pump, a diode-array (DAD) or a UV détecter and a column as specified in the respective methods. If necessary, additional detectors were included (see table of methods below).

Flow from the column was brought te the Mass Spectrometer (MS) which was configured with an atmospheric pressure ion source. It is within the knowledge of the skilled person to set the tune parameters (e.g. scanning range, dwell time...) in order to obtain ions allowing the identification of the compound’s nominal monoisotopic molecular weight (MW). Data acquisition was performed with appropriate software.

Compounds are described by theîr experimental rétention fîmes (Rt) and ions. If not specified differentiy in the table of data, the reported molecular ion corresponds to the [M+H]⁺ (protonated molécule) and/or [Μ-Ηβ (deprotonated molécule). In case the compound was not directly ionizable the type of adduct is specified (i.e. [M+NH₄]⁺, [M+HCOO]', etc...). For molécules with multiple isotopic

-13patterns (Br, Cl), the reported value is the one obtained for the lowest isotope mass. AH results were obtained with experimental uncertainties that are commonly associated with the method used.

Hereinafter, “SQD” means Single Quadrupole Detector, “MSD” Mass Sélective 5 Detector, “RT” room température, “BEH” bridged ethylsiloxane/silica hybrid, “DAD

Diode Array Detector, ”HSS High Strength silica.

LCMS Method codes (Flow expressed in mL/min; column température (T) in ’C; Run time in minutes)

Method code	Instrument	Column	Mobile phase	Gradient	Flow Col T	Run time (min)
LC-A	Waters: Acquity® UPLC DAD-SQD	Waters: BEH C18 (1.7pm, 2.1x50mm)	A: 10mM CH₃COONH₄in 95% H₂O + 5% CH₃CN B: CH₃CN	From 95% A to 5% A în 1.3 min, held for 0.7 min	0.8 mL/min 55°C	2
LC-B	Waters: Acquity® UPLC DAD-SQD	Waters: HSST3 (1.8pm, 2.1x100m m)	A: 10mM CH3COONH4 in 95% H₂O + 5% CH₃CN B: CH₃CN	From 100% A to 5% A in 2.10 min, to 0% A in 0.90 min, to 5% A in 0.5 min	0.7 mL/min 55°C	3.5
LC-C	Waters: Acquit/’ UPLC®-DADQuattro Micro™	Waters: BEH C18(1.7pm, 2.1x100mm)	A: 95% CH₃COONH₄7mM /5% CH3CN, B; CH₃CN	84.2% A for 0.49 min, to 10.5% A in 2.18 min, held for 1.94 min, back to 84.2% A in 0.73 min, held for 0.73 min	0.343 mL/min 40°C	6.2
LC-D	Waters: Acquit/* UPLC?¹- DADAcquit/¹ TQ detector	Waters: BEH C18 (1.7pm, 2.1x50mm)	A: 10mM CH3COONH4 (adjusted at pH 10) B: CH₃CN	From 50% A to 10% A in 3.5 min, held for 1.5 min	0.5 mL/min 40°C	5

-14SFC-MS methods

The SFC measurement was performed using an Analytical Supercritical fluid chromatography (SFC) System composed by a binary pump for delivering carbon dioxide (CO2) and modifier, an autosampler, a column oven, a diode array detector equipped with a high-pressure flow cell standing up to 400 bars. If configured with a Mass Spectrometer (MS) the flow from the column was brought to the (MS). It is within the knowledge ofthe skilled person to set the tune parameters (e.g. scanning range, dwell time...) in order to obtain ions allowing the identification of the compound’s nominal monoisotopic molecular weight (MW).

ίο Data acquisition was performed with appropriate software.

Analytical SFC-MS Methods (Flow expressed in mL/min; column température (T) in ’C; Run time in minutes, Backpressure (BPR) in bars.

Method code	column	mobile phase	gradient	Flow	Run time
Col T	BPR
SFC-A	WHELK-O1 (S,S) 5 pm 250 x 4.6 mm Regis	A: CO₂ B: MeOH	50% B hold 7 min,	3 35	7 100
SFC-B	Daicel Chiralpak® ICH column (5 pm, 150 x 4.6 mm)	A: CO₂ B: MeOH	40% B hold 7 min,	3 35	7 100
SFC-C	WHELK-O1 (S,S) 5 pm 250 x 4.6 mm Regis	A: CO₂ B: MeOH	60% B hold 9 min,	3 35	9 100
SFC-D	Daicel Chiralpak® IA-H column (5 pm, 250 x 4.6 mm)	A: CO₂ B: MeOH	50% B hold 7 min,	3 35	7 100
SFC-E	Daicel Chiralpak® AS3 column (3.0 pm, 150 x 4.6 mm)	A:CO₂B: EtOH +0.2% iPrNH₂ +3% H₂O	10%-50% B in 6 min, hold 3.5 min	2.5 40	9.5 110

Method code	column	mobile phase	gradient	Flow Col T	Run time
BPR
SFC-F	Daicel Chiralpak® ADH column (5.0 pm, 150 x4.6 mm)	A: CO₂ B: IPrOH 4-0.3% iPrNH₂	30% B hold 7 min	3 35	7 100

Meltïnq Points

Values are either peak values or melt ranges, and are obtained with experimental uncertainties that are commonly associated with this analytîcal method.

DSC823e (indicated as DSC)

For a number of compounds, melting points were determined with a DSC823e (Metfler-Toledo). Melting points were measured with a température gradient of 10°C/minute. Maximum température was 300°C.

Ootical Rotations:

Optical rotations were measured on a Perkin-Elmer 341 polarimeter with a sodium Iamp and reported as follows: [α]° (λ, c g/100ml, solvent, T°C).

[α]_λ ^τ = (100a) / (/ x c) : where I is the path Iength in dm and c is the concentration in g/100 ml for a sample at a temperature T (°C) and a wavelength λ (in nm). If the wavelength of light used is 589 nm (the sodium D line), then the Symbol D might be used instead. The sign of the rotation (+ or -) should always be given. When using this équation the concentration and solvent are always provided in parenthèses after the rotation. The rotation is reported using degrees and no units of concentration are given (it is assumed to be g/100 ml).

Examp!e 1 : Synthesis of 2-(4-chloro-2~methoxyphenyl)-1 -(6-fluoro-1 H-indoî-3-yl)2-((3-methoxy-5-(methylsulfonyi)phenyl)amino)ethanone (Compound 1) and chiral séparation into Enantiomers 1Aand 1B.

(ÏPrJjEtN

CHjCN/THF, 70°C, 24h

Chiral séparation

Enantlomers IA and IB

Synthesis of întermediate 1a:

2-(4-Chloro-2-methoxyphenyl)acetic acid [CAS 170737-95-8] (5.8 g, 28.9 mmol) 5 was added in small portions to thionyl chloride (50 mL) and the resulting solution was stirred overnight at 60°C. The solvent was concentrated under reduced pressure and co-evaporated with toluene to give 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (6.5 g) as an oily resîdue that was used without further purification in the next step.

Synthesis of întermediate 1b:

Diethylaluminum chloride 1M in hexane (37.1 mL, 37.1 mmol) was added dropwîse at 0°C to a solution of 6-fluoro-1 H-indole [CAS 399-51 -9] (3.34 g, 24,76 mmol) in CH₂CI₂ (100 mL). After 30 min at 0°C, a solution of 2-(4-chloro15 2-methoxyphenyl)acetyl chloride 1a (6.3 g, 28.76 mmol) in CH2CI2 (100 mL) was added slowly at 0°C. The réaction was stirred at 0°C for 3 h. Ice-water was added and the precipitate was filtered off, washed with water and a small amount of CH2CI2· The solids were dried under vacuum at 70°C overnight to give 2-(4-chloro2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)ethanone 1b (4.9 g).

Synthesis of întermediate 1c:

At 0°C, a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (5.8 g, 15.4 mmol) in THF (65 mL) was added dropwise to a mixture of 2-(4-chloro2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)ethanone 1b (4.9 g, 15.4 mmol) in 25 THF (60 mL). The mixture was stirred at 0°C for 1 h and at room température for

2.5 h. The precipitate was filtered off and washed with EtOAc. The combined filtrâtes were concentrated under reduced pressure. The residue was taken up with EtOAc and washed with water. A precipitate appeared in the organic layer

-17and was filtered off and dried to provide a first batch of 2-bromo-2-(4-chloro2-methoxyphenyl)-1-(6-fluoro-1/7-indol-3-yl)ethanone 1c (4.6 g). Theorganic layer was separated, dried over MgSO₄, fiitered and the solvent was evaporated under reduced pressure. The residue was crystallized from EtOAc, the precipitate was s filtered off, washed with Et₂O and dried under vacuum to provide a second fraction of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1/-/-indol-3-yl)ethanone 1c (1.6 g).

Synthesis of Compound 1 and chiral séparation of Enantiomers 1A and 1B: io A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1 -(6-fluoro-1 /7-indol-3-yl)ethanone 1c (3 g, 7.56 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 6260602-4] (2.28 g, 11.35 mmol) and diisopropylethylamine (1.95 mL, 11.35 mmol) in CH₃CN (60 mL) and THF (30 mL) was stirred at 70°C for 24 h. The reaction was diluted with EtOAc. The organîc layer was washed with 1N HCl (twice) and water, 15 dried over MgSO₄, filtered and the solvent was concentrated under reduced pressure. The residue was purified by flash chromatography on sïlica gel (1540 pm, 80 g, Mobile phase: CH₂CI₂/MeOH 99.5/0.5). A second purification was carried out by flash chromatography on sïlica gel (15-40 pm, 80 g, Mobile phase: CH₂CI₂/MeOH 99.7/0.3). The pure fractions were combined and concentrated under reduced pressure to give 2-(4-chloro-2-methoxyphenyi)-1-(6-fluoro-1Hindol-3-yl)-2-((3-methoxy-5-(methylsuifonyl)phenyl)amino)ethanone (Compound 1, 2 g) as a racemic mixture.

The enantiomers of Compound 1 were separated via Chiral SFC (Stationary phase: Chiralpak® AD-H 5 pm 20 x 250 mm, Mobile phase: 50% CO₂, 50% MeOH) 25 yielding 740 mg of the first eluted enantiomer and 720 mg of the second eluted enantiomer. The first eluted enantiomer was crystallized from CH₃CN/Et₂O. The precipitate was filtered off and dried to give Enantiomer 1A (645 mg). The second eluted enantiomer was crystallized from CH3CN/Et₂O. The precipitate was filtered off and dried to give Enantiomer 1B (632 mg).

Compound 1:

¹H NMR (500 MHz, DMSO-d₆) δ ppm 3.09 (s, 3 H) 3.72 (s, 3 H) 4.00 (s, 3 H) 6.24 (d, J=7.9 Hz, 1 H) 6.58 (s, 2 H) 6.91 (s, 1 H) 6.97 (dd, J=8.7, 1.9 Hz, 1 H) 7.02 7.09 (m, 2 H) 7.12 (d, J=1.9 Hz, 1 H) 7.27 (dd, J=9.5, 1.9 Hz, 1 H) 7.35 (d, 35 J=8.5 Hz, 1 H) 8.14 (dd, J=8.7, 5.5 Hz, 1 H) 8.44 (s, 1 H) 12.10 (br. s., 1 H)

LC/MS (method LC-C): R_t 3.08 min, MH* 517

Melting point: 174°C

-18Enantiomer 1A:

NMR (500 MHz, DMSO-cfe) δ ppm 3.09 (s, 3 H) 3.72 (s, 3 H) 4.00 (s, 3 H) 6.24 (d, J=7.9 Hz, 1 H) 6.59 (s, 2 H) 6.91 (s, 1 H) 6.97 (dd. J=8.8, 2.2 Hz, 1 H) 7.02 7.10 (m, 2 H) 7.12 (d, J=2.2 Hz, 1 H) 7.27 (dd, J=9.6, 2.2 Hz, 1 H) 7.35 (d, J=8.2 Hz, 1 H) 8.14 (dd, J=8.8, 5.7 Hz, 1 H) 8.44 (s, 1 H) 12.10 (br. s., 1 H) LC/MS (method LC-C): R_t 3.09 min, MH* 517 [a]_D ²⁰: +130.3° (c 0.277, DMF)

Chiral SFC (method SFC-D): R_t 3.41 min, MH* 517, chiral purity 100%.

Melting point: 220°C

Enantiomer IB:

¹H NMR (400 MHz, DMSO-d₆) δ ppm 3.09 (s, 3 H) 3.72 (s, 3 H) 4.00 (s, 3 H) 6.24 (d, J=7.6 Hz, 1 H) 6.53 - 6.65 (m, 2 H) 6.91 (S, 1 H) 6.97 (dd, 2.0 Hz, 1 H) 7.01 - 7.09 (m, 2 H) 7.12 (d, J=2.0 Hz, 1 H) 7.27 (dd, J=9.6, 2.0 Hz, 1 H) 7.35 (d, J=8.1 Hz, 1 H) 8.14 (dd, J=8.6, 5.6 Hz, 1 H) 8.43 (s, 1 H) 12.09 (br. s., 1 H) LC/MS (method LC-C): R_t 3.09 min, MH* 517 [o.]_D ²⁰:-135.3° (c 0.283, DMF)

Chiral SFC (method SFC-D): R_t4.89 min, MH* 517, chiral purity 99.35%.

Melting point: 218°C

Example 1.1 : Chiral stability of Enantiomer IA at pH 7.4

The chiral stability of Enantiomer IA (R = OMe) was evaluated by détermination of the enantiomeric excess (ee%) after incubation for 24 h and 48 h in a buffered solution at pH 7.4 at 40°C and 60°C. To assess the influence ofthe methoxysubstituent of Enantiomer 1A (R = OMe) on the stability against racemization, the chiral stability of Enantiomer l’A (R = H) was tested under the same conditions. To this end, 5 μΜ buffered (pH = 7.4) solutions of 1A and TA were prepared by mixing 25 pL of a 100 pM solution of 1A or TA in DMSO with 475 pL aqueous buffer pH 7.4. Samples were taken 24 h and 48 h after incubation at 40°C and 60°C. The analyticai samples were analyzed by Chiral SFC (MS détection) and the chiral purity was expressed as the enantiomeric excess (ee% = %enantiomer A - %enantiomer B). Both Enantiomers 1A and TA had a chiral purity of 100% prior to their incubation.

ee%

Compound	Température	Sampling timepoints (h)
24	48
1A	40°C	100	100
	60°C	95	88
TA	40°C	21	10
	60°C	0	0

Exemple 2: synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(6-Îïuoro-7-methyl-1/7indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 2) and chiral séparation into Enantiomers 2A and 2B.

-20Synthesis of intermediate 2a:

Diethylaluminum chloride 1M in hexane (20 mL, 20,0 mmol) was added dropwise at 0°C to a solution of 6-fluoro-7-methyl-1H-indole [CAS 57817-10-4] (1.50 g, 10.1 mmol) in CH2CI2 (45 mL). After 30 min at 0°C, a solution of 2-(4-chloro2-methoxyphenyl)acetyl chloride (3.30 g, 15.1 mmol, synthesis: see Example 1) in dichloromethane (30 mL) was added slowly. The reaction mixture was stirred at 0°C for 3 h. 1M Rochelle sait solution (50 mL) was added and the reaction mixture was stirred at room température for 1 h. The solids were filtered off and partitioned between EtOAc and IN HCl. The phases were separated. The aqueous phase was extracted with EtOAc. The organic phases were combined, washed with brine, dried over MgSO4, filtered and concentrated under reduced pressure. The residue was triturated with EtOAc and heptane. The precipitate was filtered off to give 2-(4-chloro-2-methoxyphenyl)-1 -(6fluoro-7-methyl-1 H-indol-3-yl)ethanone 2a (2.00 g).

Synthesis of intermediate 2b:

A solution of phenyltrimethylammonïum tribromide [CAS 4207-56-1] (2.49 g, 6.6 mmol) in THF (45 mL) was added dropwise at 0°C to a solution of 2-(4-chloro2-methoxyphenyl)-1-(6-fluoro-7-methyl-1/-/-indol-3-yl)ethanone 2a (2.00 g, 6.0 mmol) in THF (65 mL). The mixture was stirred at room température overnight. The precipitate was filtered off and washed with EtOAc. The combined filtrâtes were concentrated under reduced pressure. The residue was taken up with a minimum of acetonitrile. The precipitate was filtered off, washed with acetonitrile and dried under vacuum to give a first batch of 2-bromo-2-(4-chlora-2-methoxyphenyl)-1 -(6-fluoro-7-methyl-1 F/-indol-3-yl)ethanone 2b (1.51 g). The filtrate was concentrated under reduced pressure. The residue was taken up with a minimum of acetonitrile. The precipitate was filtered off, washed with acetonitrile and dried under vacuum to give a second fraction of 2-bromo-2-(4-chloro-2-methoxyphenyl)1-(6-fluoro-7-methyl-1H-indol-3-yl)ethanone 2b (0.70 g).

Synthesis of Compound 2 and chiral séparation of Enantiomers 2A and 2B: A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluûro-7-methyl-1/-/-indol3-yl)ethanone 2b (1,8 g, 4.36 mmol) and 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.6 g, 13.0 mmol) in THF (9 mL) and CH₃CN (9 mL) was heated at 100°C under microwave irradiation for 50 min. The reaction mixture was diluted with EtOAc and washed with 1N HCl. The phases were separated. The organic phase was washed with an aqueous saturated NaHCO₃ solution and brine, dried over MgSO4, filtered and concentrated under reduced pressure. The residue

-21was taken up with a minimum of acetonitrile. The precipitate was filtered off, washed with acetonitrile and dried under vacuum to give 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-fndol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 2, 1.7 g) as a racemic mixture.

& The chiral séparation of the enantiomers of Compound 2 (1.59 g) was performed via Préparative SFC (Stationary phase: (S,S)-Whe!k-01 5 pm 250 x 21.1 mm, Mobiie phase: 50% CO2, 50% MeOH). The product fractions were combinée! and evaporated under reduced pressure. The first eluted enantiomer (746 mg) was further purified by coiumn chromatography on silica gel (15-40 pm, 24 g, Mobile phase: C^Ch/MeOH 99.5/0.5). The pure fractions were combined and evaporated under reduced pressure (560 mg). The residue was soiidified by trituration with a mixture of Et₂O and a few drops of CH₃CN. The solids were fîitered off and dried under vacuum to give Enantiomer 2A (473 mg). The second eiuted enantiomer (732 mg) was further purified by coiumn chromatography over silica gel (15-40 pm, 24 g, Mobile phase: CH₂Cl2/MeOH 99.5/0.5). The pure fractions were combined and evaporated under reduced pressure (550 mg). The residue was solidified by trituration with a mixture of Et₂O and a few drops of CH₃CN. The solids were filtered off and dried under vacuum to give of Enantiomer 2B (457 mg).

Compound 2:

¹H NMR (300 MHz, DMSO-d₀) δ ppm 2.38 (d, 7=1.5 Hz, 3 H) 3.10 (s, 3 H) 3.73 (s, 3 H) 4.01 (s, 3 H) 6.27 (d, 7=7.9 Hz, 1 H) 6.55 - 6.63 (m, 2 H) 6.93 (m, 1 H) 6.94 7.09 (m, 3 H) 7.13 (d, 7=1.9 Hz, 1 H) 7.35 (d, 7=8.3 Hz, 1 H) 7.97 (dd, 7=8.7,

5.3 Hz, 1 H) 8.45 (s, 1H) 12.23 (br. s, 1 H)

LC/MS (method LC-D): R_t 1.68 min, MH* 531

Enantiomer 2A:

¹H NMR (500 MHz, DMSO-d₆) δ ppm 2.37 - 2.39 (m, 3 H) 3.09 (s, 3 H) 3.72 (s, 3 30 H) 4.01 (s, 3 H) 6.26 (d, 7=7.9 Hz, 1 H) 6.54 - 6.63 (m, 2 H) 6.92 (s, 1 H) 6.97 (dd, 7=8.4, 1.9 Hz, 1 H) 7.02 (dd, 7=9.9, 9.0 Hz, 1 H) 7.07 (d, 7=7.9 Hz, 1 H) 7.13 (d, 7=1.9 Hz, 1 H) 7.35 (d, 7=8.4 Hz, 1 H) 7.96 (dd, 7=8.5, 5.4 Hz, 1 H) 8.45 (s, 1 H) 12.24 (br. s„ 1 H)

LC/MS (method LC-C): R_t 3.20 min, MH* 531

[g.]d²°: +104.5° (c 0.2545, DMF)

Chiral SFC (method SFC-A): R_t 4.22 min, MH* 531, chiral purity 100%.

-22Enantiomer 2B:

¹H NMR (500 MHz, DMSO-d₀) δ ppm 2.36 - 2.41 (m, 3 H) 3.09 (s, 3 H) 3.72 (s, 3 H) 4.01 (s, 3 H) 6.26 (d, J=7.9 Hz, 1 H) 6.57 - 6.64 (m, 2 H) 6.92 (s, 1 H) 6.97 (dd, J=8.2, 1.9 Hz, 1 H) 6.99 - 7.04 (m, 1 H) 7.07 (d, J=7.Q Hz, 1 H) 7.13 (d,

J=1.9 Hz, 1 H) 7.35 (d, J=8.2 Hz, 1 H) 7.96 (dd, J=8.7, 5.2 Hz, 1 H) 8.45 (s, 1 H)

12.24 (br. s., 1 H)

LC/MS (method LC-C): R_t 3.20 min, MH⁺ 531

[ah²⁰:-104.Γ (c 0.2536, DMF)

Chiral SFC (method SFC-A): R_t 5.12 min, MH⁺ 531, chiral purity 99.53%.

Example 3: synthesis 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy~1/-Lindol~3-yl)2-((3-methoxy-5~(methylsulfonyl)phenyl)amino)ethanone (Compound 3) and chiral séparation into Enantiomers 3Aand 3B.

ci

Synthesis of intermediate 3a:

A solution of NaHSO₃ (5.7 g, 54.5 mmol) in water (45 mL) was added to a stirring solution of tert-butyl 3-formyl-6-methoxy-1H-indole-1-carboxylate [CAS 84744820 73-1] (10 g, 36.3 mmol) in dioxane (45 mL). After 15 min, morpholine (4.8 mL,

4.5 mmol) was added and 35 min later, sodium cyanide (NaCN) (1.96 g, 40 mmol) was added. The resulting suspension was stirred at room température for 3 days, until completion of the reaction. The product was filtered off and washed with a 1/1 mixture of dioxane/water (3x 35 mL), and subsequently with water (3x 45 mL) and dried under vacuum at 60°C. The solids were stirred up in Et₂O (125 mL), filtered off, washed with Et₂O (3x) and dried under vacuum at 50°C to provide tert-butyl 3-(cyano(morpholino)methyI)-6-methoxy-1H-indole-1-carboxylate 3a (12.3 g).

Synthesis of intermediate 3b:

A mixture of tert-butyl 3-(cyano(morpholino)methyl)-6-methoxy-1H-indoie-1carboxylate 3a (6.0 g, 16.2 mmol) in dry DMF (80 mL) was stirred under N₂-atmosphere while cooling on an ice-bath. A solution of KHMDS 0.5 M in toluene (35.5 mL, 17.8 mmol) was added dropwise over 10 min. After stirring for an additional 10 min, 4-chloro-1-(chforomethyl)-2-methoxybenzene [CAS 10107984-9] (3.09 g, 16.2 mmol) was added and the resulting mixture was stirred at room température for 20 h. The reaction mixture was poured out into cold water (400 mL) and the product was extra et ed with Et₂O (2x). The combined organic layers were washed with brine, dried over MgSO₄, filtered, evaporated under reduced pressure and co-evaporated with xylene. The residue was purified by flash chromatography (Stationary phase: Grâce Reveierîs® silica 120 g, Mobile phase: heptane/EtOAc gradient 100/0 to 20/80). The desired fractions were combined, evaporated under reduced pressure and co-evaporated with dioxane to give tert-butyl 3-(2-(4-chloro2-methoxyphenyl)-1 -cyano-1 -morpholinoethyl)-6-methoxy-1 H-indole-1 -carboxylate 3b (7.75 g).

Synthesis of intermediate 3c:

To a stirred suspension of tert-butyl 3-(2-(4-chloro-2-methoxyphenyl)-1-cyano-1morpholinoethyl)-6-methoxy-1/-/-indole-1-carboxylate 3b (7.75 g, 14.7 mmol) in dioxane (40 mL) and water (20 mL) was added a solution of HCl 6 M in isopropanol (36.8 mL, 220 mmol). The resulting mixture was stirred at 60°C for 4 h and subsequently at 80°C for 1 h. After cooling to room température, the mixture was left standing for 20 h to allow crystallization of the reaction product. The product was filtered off, washed with a 1/1/1 mixture of /PrOH/H₂O/dioxane (2x 15 mL) and dried under vacuum at 50°C to give 2-(4-chloro-2-methoxyphenyl)-1 (6-methoxy-1H-indol-3-yl)ethanone 3c (3.67 g).

-24Synthesis of Compound 3 and chiral séparation of Enantiomers 3A and 3B:

A stirred mixture of 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-1H-indol-3-yl)ethanone 3c (2 g, 6.07 mmol) in THF (80 mL) was cooled on an ice-bath under N₂-atm. Phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.39 g, 6.37 mmol) 5 was added and the réaction mixture was stirred at 0°C for 1 h and subsequently at room température for 1.5 h. 3-Methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (3.66 g, 18.2 mmol) was added and the solvent was evaporated under reduced pressure. The residue was dissolved in CH₃CN (100 mL). Diisopropylethylamine (2.09 mL, 12.1 mmol) was added and the reaction mixture was heated at 55°C for îo 27 h. The reaction mixture was allowed to cool to room température and poured out into stirring water (400 mL). The product was extracted with 2-MeTHF (2x). The combined organic layers were washed with brine, dried over MgSO4, filtered and evaporated under reduced pressure. The residue (8 g) was purified by flash chromatography (stationary phase: Grâce Reveleris® silica 120 g, Mobile phase: 15 heptane/EtOAc gradient from 100/0 to 0/100). The desired fractions were combined and evaporated under reduced pressure. The residue (5.4 g) was further purified by Préparative HPLC (Stationary phase: RP XBridge® Prep C18 OBD -10 pm, 50 x 150 mm, Mobile phase: 0.25% NH4HCO3 solution in water, CH3CN). The product fractions were combined and evaporated under reduced 20 pressure and subsequently co-evaporated with MeOH. The residue was crystallized from a mixture of EtOAc (15 mL), CH₃CN (2 mL) and MeOH (2 mL). The solids were filtered off, washed with EtOAc (3x) and dried under vacuum at 50°C to provide 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-1H-indol-3~yl)-2~ ((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 3, 681 mg) as 25 a racemic mixture.

The chiral séparation of the enantiomers of Compound 3 (0.63 g) was performed via Normal Phase Chiral séparation (Stationary phase: AS 20 pM, Mobile phase; 100% methanol). The product fractions were combined and evaporated under reduced pressure. The first eluted enantiomer was purified by flash chromatography (Stationary phase: Grâce Reveleris® silica 12 g, Mobile phase: heptane/EtOAc/EtOH gradient from 100/0/0 to 40/45/15). The desired fractions were combined and evaporated, and co-evaporated with EtOAc. The remaining oil was solidified by stirring up in H₂O (4 mL) and slow addition of MeOH (1.6 mL). After stirring for 20 minutes, the product was filtered off, washed (3x) with a 1/2 mixture of MeOH/H₂O and dried under vacuum at 50°C to provide Enantiomer 3A (168 mg) as an amorphous solid. The second eluted enantiomer was purified by flash chromatography (Stationary phase: Grâce Reveleris® silica 12 g, Mobile phase: heptane/EtOAc/EtOH gradient from 100/0/0 to 40/45/15). The desired

-25fractions were combinée!, evaporated under reduced pressure and co-evaporated with EtOAc. The remaining foam was solidified by stirring up in H2O (4 mL) and slow addition of MeOH (2 mL). After stirring for 15 minutes, the product was filtered off, washed (3x) with a 1/2 mixture of MeOH/H₂O and dried at 50°C under 5 vacuum to provide Enantiomer 3B (146 mg) as an amorphous solid.

Compound 3:

¹H NMR (400 MHz, DMSO-d₆) δ ppm 3.09 (s, 3 H) 3.72 (s, 3 H) 3.77 (s, 3 H) 4.01 (s, 3 H) 6.21 (d, J-7.9 Hz, 1 H) 6.54 - 6.64 (m, 2 H) 6.83 (dd, J^.7, 2.3 Hz, 1 H)

6.91 (t, J=1.4 Hz, 1 H) 6.94 - 6.99 (m, 2 H) 7.04 (d, J=7.7 Hz, 1 H) 7.12 (d,

J=2.0 Hz, 1 H) 7.35 (d, J=8.1 Hz, 1 H) 8.02 (d, J=8.8 Hz, 1 H) 8.30 (s, 1 H) 11.84 (s, 1 H) LC/MS (method LC-A): R_t 1.20 min, MH⁺ 529

Enantiomer 3A:

¹H NMR (360 MHz, DMSO-d₆) δ ppm 3.09 (s, 3 H) 3.72 (s, 3 H) 3.77 (s, 3 H) 4.01 (S, 3 H) 6.22 (d, J=8.1 Hz, 1 H) 6.55 - 6.61 (m, 2 H) 6.84 (dd, J=8.8, 2.2 Hz, 1 H) 6.91 (t, J=1.8 Hz, 1 H) 6.94 - 7.00 (m, 2 H) 7.07 (d, J=7.0 Hz, 1 H) 7.13 (d, J=1.8 Hz, 1 H) 7.35 (d, J=8A Hz, 1 H) 8.02 (d, J-8.8 Hz, 1 H) 8.32 (d, J=2.9 Hz, 1 H) 11.87 (d, J=2.6 Hz, 1 H)

LC/MS (method LC-A): R_t 1.08 min, MH⁺ 529

Hd²⁰: +134.9° (c 0.545, DMF)

Chiral SFC (method SFC-E): R_t 4.31 min, MH⁺ 529, chiral purity 100%.

Enantiomer 3B:

¹H NMR (360 MHz, DMSO-d₆) δ ppm 3.09 (s, 3 H) 3.72 (s, 3 H) 3.77 (s, 3 H) 4.01 (s, 3 H) 6.21 (d, J=8.1 Hz, 1 H) 6.54 - 6.62 (m, 2 H) 6.83 (dd, J=8.6, 2.4 Hz, 1 H) 6.91 (t, J=) .5 Hz, 1 H) 6.94 - 6.99 (m, 2 H) 7.07 (d, J=7.0 Hz, 1 H) 7.13 (d, J=1.8 Hz, 1 H) 7.35 (d, J=8.1 Hz, 1 H) 8.02 (d, J=8.8 Hz, 1 H) 8.32 (d, J-2.9 Hz, 1 H) 11.87 (brd, J=2.2 Hz, 1 H)

LC/MS (method LC-A): R_t 1.08 min, MH⁺ 529

[a]_D ²⁰:-116.7° (c 0.51, DMF)

Chiral SFC (method SFC-E): R_t 4.63 min, MH* 529, chiral purity 94.7%.

Example 4: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methyl· 35 sulfonyl)phenyl)amino)-1 -(6-methoxy-5-methyl-1 H-indol-3-yl)ethanone (Compound ) and chiral séparation into Enantiomers 4A and 4B.

Synthesis of intermediate 4a:

Diethylaluminum chloride 1M in hexane (13.5 mL, 13.5 mmol) was added dropwise at 0°C to a solution of 6-methoxy-5-methyl-1/7-indole [CAS 107197395-9] (1.45 g, 9 mmol) in CH₂CI₂ (45 mL). After 30 min ai 0°C, a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride la (2.4 g, 10.9 mmol) in CH₂CI₂(45 mL) was added slowly at 0°C. The reaction was stirred at 0°C for 3 h. lœwater was added and the precipitate was filtered off and washed with water. The ίο solid was dried under vacuum to give 2-(4-chloro-2-methoxyphenyl)-1 -(6-methoxy5-methyL1H-indol-3-yl)ethanone 4a (2.1 g).

Synthesis of intermediate 4b:

At 0°C, a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.4 g, 15 6.4 mmol) in THF (65 mL) was added dropwise to a mixture of 2-(4-chloro2-methoxyphenyl)-1-(6-methoxy-5-methyl-1/-/-indol-3-yl)ethanone 4a (2.1 g, 6.1 mmol) in THF (60 mL). The mixture was stirred at 0°C for 1 h and at room température for 2.5 h. The precipitate was filtered off and washed with EtOAc. The filtrate was concentrated under reduced pressure. The residue was taken up with 20 the minimum of diisopropylether. The precipitate was filtered off and dried under vacuum to give 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-methyl-1/7indol-3-yl)ethanone 4b (2.36 g).

-27Synthesis of Compound 4 and chiral séparation of Enantiomers 4A and 4B:

A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-methyl-1Hindol-3-yl)ethanone 4b (4.0 g, 9.46 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.86 g, 14.2 mmol) and diisopropylethylamine (2.44 mL, 5 14.2 mmol) in CH₃CN/THF (1/1)(100 mL) was stirred at45°Cfor72 h. The solvents were removed under reduced pressure. The residue was dissolved in EtOAc. The organic layer was washed twice with 1N HCl, washed with water, dried over MgSO₄, filtered and concentrated under reduced pressure. The compound was crystallized from CH₃CN/diisopropylether to give 2-(4-chloro10 2-methoxyphenyl)-2-((3-meÎhoxy-5-(methylsulfonyl)phenyl)amino)-1-(6-methoxy5-methyl-1H-indol-3-yl)ethanone (Compound 4,1.1 g) as a racemic mixture.

The chiral séparation of the enantiomers of Compound 4 was performed via Préparative Chiral SFC (Stationary phase: (S,S)-Whelk-O1 5 pm 250 x 21.1 mm, Mobile phase: 45% CO₂, 55% MeOH) yielding 500 mg of the first eluted enantiomer and 531 mg of the second eluted enantiomer. The first eluted enantiomer was crystallized from CH₃CN/Et₂O to afford Enantiomer 4A (401 mg).

The second eluted was crystallized from CH₃CN/Et₂O to afford Enantiomer 4B (396 mg).

Compound 4:

NMR (500 MHz, DMSO-d₆) δ ppm 2.21 (s, 3 H) 3.09 (S, 3 H) 3.72 (s, 3 H) 3.79 (S, 3 H) 4.01 (s, 3 H) 6.20 (d, >7.9 Hz, 1 H) 6.58 (s, 2 H) 6.88 - 6.93 (m, 2 H) 6.96 (dd, >8.5,1.9 Hz, 1 H) 7.02 (d, >7.9 Hz, 1 H) 7.12 (d, >1.9 Hz, 1 H) 7.34 (d, >8.5 Hz, 1 H) 7.89 (s, 1 H) 8.24 (s, 1 H) 11.78 (br. s., 1 H)

LC/MS (method LC-C): R_t 3.16 min, MH* 543

Melting point: 208°C

Enantiomer 4A:

¹H NMR (500 MHz, DMSO-d₆) δ ppm 2.21 (s, 3 H) 3.09 (s, 3 H) 3.72 (s, 3 H) 3.79 30 (s, 3 H) 4.01 (s, 3 H) 6.20 (d, >7.6 Hz, 1 H) 6.58 (d, >1.6 Hz, 2 H) 6.87 - 6.93 (m,

H) 6.96 (dd, >8.2, 1.9 Hz, 1 H) 7.02 (d, >7.6 Hz, 1 H) 7.12 (d, >1.9 Hz, 1 H)

7.34 (d, >8.2 Hz, 1 H) 7.89 (s, 1 H) 8.25 (s, 1 H) 11.78 (br. s., 1 H)

LC/MS (method LC-C): R_t 3.15 min, MH⁺ 543

[a]_D ²⁰: +141.8° (c 0.3936, DMF)

Chiral SFC (method SFC-C): R_t 4.95 min, MH⁺ 543, chiral purity 100%.

Melting point: 173°C

-28Enantiomer 4B:

NMR (500 MHz, DMSO-ofe) δ ppm 2.21 (s, 3 H) 3.09 (s, 3 H) 3.72 (s, 3 H) 3.79 (s, 3 H) 4.01 (s, 3 H) 6.20 (d, J=7.9 Hz, 1 H) 6.58 (s, 2 H) 6.88 - 6.93 (m, 2 H) 6.96 (dd, J=8.2, 1.9 Hz, 1 H) 7.02 (d, J=7.9 Hz, 1 H) 7.12 (d, J=1.9 Hz, 1 H) 7.34 (d, J-8.2 Hz, 1 H) 7.90 (s, 1 H) 8.25 (s, 1 H) 11.79 (br. s., 1 H) LC/MS (method LC-C): R_t 3.15 min, MH⁺ 543 [a]_D ²°: -142.2° (c 0.3909, DMF)

Chiral SFC (method SFC-C): R_t 6.84 min, MH⁺ 543, chiral purity 100%.

Melting point: 174°C

Example 5: Synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1Hindol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 5) and chiral séparation Info Enantiomers 5A and 5B.

Synthesis of intermediate 5a:

Diethylaluminum chloride 1M in hexane (15.7 mL, 15.7 mmol) was added dropwise at 0°C to a solution of 5-fluoro-6-methoxy-1 H-indole [CAS 1211595-72-0] (2 g, 12.1 mmol) in CH₂CI₂ (50 mL). After 30 min at 0°C, a solution of 2-(4-chloro2-methoxyphenyl)acetyl chloride la (3.2 g, 14.6 mmol) in CH2CI2 (50 mL) was added slowly at 0°C. The reaction was stirred at 0°C for 3 h. Ice-water was added and the precipitate was filtered off, washed with water and the minimum of CH2CI2· The solid was dried under vacuum to give 2-(4-chloro-2-methoxyphenyl)1-(5-fluoro-6-methoxy-1/-f-indol-3-yl)ethanone 5a (2.82 g).

-29Synthesis of intermediate 5b:

At 0°C, a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (3.5 g, 8.1 mmol) in THF (20 mL) was added dropwise to a solution of 2-(4-chloro2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1H-indol-3-yl)ethanone 5a (2.82 g, 5 8.1 mmol) in THF (46 mL). The mixture was stirred at 0°C for 1 h and at room température for 4 h. The precipitate was filtered off and washed with EtOAc. The filtrate was concentrated under reduced pressure. The residue was dissolved in EtOAc and washed with water. The organic phase was dried over MgSOz, filtered and the solvent was evaporated under reduced pressure. The residue was taken ίο up with the minimum of EtOAc. The precipitate was filtered off and dried under vacuum to give 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1Hindol-3-yl)ethanone 5b (2.5 g).

Synthesis of Compound 5 and chiral séparation of Enantiomers 5A and 5B: 15 A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1 -(5-fluoro-6-methoxy-1 Hindol-3-yl)ethanone 5b (2.5 g, 5.86 mmol), 3-methoxy-5-(methylsulfonyi)aniline [CAS 62606-02-4] (1.415 g, 7.03 mmol) and diisopropylethylamine (1.515 mL, 8.79 mmol) in CH₃CN (55 mL) and THF (100 mL) was stirred at 50°C for 10 days. The solvents were removed under reduced pressure. The residue was purified by 20 flash chromatography on silica gel (15-40 pm, 80 g, Mobile phase: CH2CI2/CH3OH 99.25/0.75). The pure fractions were combined and evaporated. The compound was dissolved in EtOAc and stirred with HCl IN for 15 min. A precipitate appeared, and was filtered off and dried under vacuum to give 2-(4-chloro-2-methoxyphenyl)1-(5-fluora-6-methoxy-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)25 amino)ethanone (Compound 5,1.3 g) as a racemic mixture.

The chiral séparation of the enantiomers of Compound 5 was performed via Preparative Chiral SFC (Stationary phase: Chiralpak® IC 5 pm 250 x 20 mm, Mobile phase: 55% CO₂, 45% MeOH). The product fractions were combined and evaporated. The first eluted enantiomer was solidified by trituration with heptane/dfisopropylether. The solids were filtered off and dried under vacuum to provide Enantiomer 5A (502 mg) as an amorphous white powder. The second eluted enantiomer was solidified by trituration with heptane/diisopropylether. The solids were filtered off and dried under vacuum to provide Enantiomer 5B (490 mg) as an amorphous white powder.

-30Compound 5:

¹H NMR (500 MHz, DMSO-cf_s) δ ppm 3.09 (s, 3 H) 3.72 (s, 3 H) 3.85 (s, 3 H) 4.00 (s, 3 H) 6.21 (d, J=7.9 Hz, 1 H) 6.58 (d, J=1.3 Hz, 2 H) 6.90 (s, 1 H) 6.97 (dd, J=8.2,1.9 Hz, 1 H) 7.06 (d, J=7.9 Hz, 1 H) 7.10 - 7.18 (m, 2 H) 7.34 (d, J=8.2 Hz, 5 1 H) 7.82 (d, J-12.0 Hz, 1 H) 8.35 (s, 1 H) 11.98 (br. s., 1 H)

LC/MS (method LC-C): R_t 3.01 min, MH* 547

Melting point: 182°C

Enantiomer 5A:

¹H NMR (500 MHz, DMSO-d₆) δ ppm 3.09 (s, 3 H) 3.72 (s, 3 H) 3.85 (s, 3 H) 4.00 (s, 3 H) 6.21 (d, J=7.9 Hz, 1 H) 6.58 (d, J=1.3 Hz, 2 H) 6.90 (s, 1 H) 6.97 (dd, J=8.2, 2.0 Hz, 1 H) 7.07 (d, J=7.9 Hz, 1 H) 7.11-7.17 (m, 2 H) 7.34 (d, J=8.2 Hz, 1 H) 7.82 (d, J=11.7 Hz, 1 H) 8.35 (s, 1 H) 11.98 (br. s., 1 H) LC/MS (method LC-C): R_t 3.00 min, MH* 547

[a]_D ²⁰: +136.4° (c 0.28, DMF)

Chiral SFC (method SFC-B): R_t 3.43 min, MH* 547, chiral purity 100%.

Enantiomer 5B:

¹H NMR (500 MHz, DMSO-d₆) δ ppm 3.09 (s, 3 H) 3.72 (s, 3 H) 3.85 (s, 3 H) 4.00 20 (s, 3 H) 6.21 (d, J=7.9 Hz, 1 H) 6.58 (d, J=1.3 Hz, 2 H) 6.90 (s, 1 H) 6.97 (dd,

J=8.2, 2.0 Hz, 1 H) 7.07 (d, J=7.9 Hz, 1 H) 7.11 - 7.19 (m, 2 H) 7.34 (d, J=8.2 Hz, 1 H) 7.82 (d, J=11.7 Hz, 1 H) 8.35 (S, 1 H) 11.95 (br. s., 1 H) LC/MS (method LC-C): R_t 3.00 min, MH* 547

Md²⁰: -126.3° (c 0.2755, DMF)

Chiral SFC (method SFC-B): R_t4.80 min, MH* 547, chiral purity 98.06%.

Example 6: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1 -(6-methoxy-7-methyl-1 H-indol-3-yl)ethanone (Compound 6) and chiral séparation into Enantiomers 6A and 6B.

Synthesis of intermediate 6a:

Diethylaluminum chloride 1M in hexane (32.8 mL, 32.8 mmol) was added dropwise to a cooled (-30°C) solution of 6-methoxy-7-methyl-1 H-indole [CAS 19500-05-1] (3.53 g, 21.9 mmoi) in CH₂CI₂ (150 mL). After stirring for 15 min at -30°C, a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride la (6.71 g, 30.6 mmol) in CH₂CI₂ (150 mL) was added slowly at -30°C. The reaction was io stirred at -30°C for 1 h and was allowed to warm to room température while stirring for 2 h. The réaction mixture was poured oui in ice-water/Rochelle sait. The mixture was filtered over a short pad of dicalite® and the filter cake was rinsed several times with THF. The layers were separated. The aqueous layer was extracted with THF. The combined organic layers were washed with brine, water, dried over MgSOi, filtered, and evaporated under reduced pressure. The solid residue was suspended in CH₂CI₂ (50 mL) and the solids were filtered off and washed with a small amount of CH₂CI₂ and dried under vacuum at 50°C to give 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-7-methyl-1H-indol-3-yl)ethanone 6a (6.85 g) as an off-white solid.

Synthesis of intermediate 6b:

At 0°C, a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (8.2 g, 21.8 mmol) in THF (150 mL) was added dropwise to a solution of 2-(4-chloro2-methoxyphenyl)-1-(6-methoxy-7-methyl-1H-indol-3-yl)ethanone 6a (6.8 g,

19.8 mmol) in THF (250 mL). The mixture was stirred at room température for 2 h.

-32The precipitate was filtered off and washed with THF. The filtrate was concentrated under reduced pressure. The residue was crystallized from CH2CI2. The precipitate was filtered off, wash with CH₂CI₂ (2x) and dried under vacuum at 50°C to give 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-7-methyl-1H5 lndol-3-yl)ethanone 6b (5.38 g).

Synthesis of Compound 6 and chiral séparation of Enantiomers 6A and 6B:

A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-7-rnethyl-1Hindol-3-yl)ethanone 6b (1.96 g, 4.65 mmol), 3-methoxy-5-(methylsulfonyl)aniline 10 [CAS 62606-02-4] (1.40 g, 6.97 mmol) and düsopropylethylamine (1.20 mL, 6.97 mmol) in CH3CN (50 mL) was heated overnight under reflux. The solvents were removed under reduced pressure. The residue was dissolved in CH2CI2 and washed with 0.5N HCl and water, dried over MgSO4, filtered and evaporated under reduced pressure. The residue was purified by flash chromatography on 15 silica gel (Stationary phase: Biotage® SNAP Ultra 100 g, Mobile phase:

EtOAc:EtOH(3:1 )/heptane gradient 0/100 to 50/50). The pure fractions were combined and evaporated under reduced pressure to give 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)pheny!)amino)-1-(6-methoxy-7-methyl1H-indol-3-yl)ethanone (Compound 6, 1.0 g) as a racemic mixture.

The chiral séparation of the enantiomers of Compound 6 (1.0 g) was performed via Préparative Chiral SFC (Stationary phase: Chiralcel® Diacel OD 20 x 250 mm, Mobile phase: CO2, EtOH containing 0.2% /PrNH₂). The product fractions were combined and evaporated. The first eluted enantiomer was solidîfied by trituration with a MeOH/water (1/1 ) mixture. The solids were filtered off and dried under vacuum at 50°C to provide Enantiomer 6A (368 mg) as an amorphous white powder. The second eluted enantiomer was solidified by trituration with a MeOH/water (1/1 ) mixture. The solids were filtered off and dried under vacuum at 50°C to provide Enantiomer 6B (303 mg) as an amorphous white powder.

Enantiomer 6A:

^ηΗ NMR(360 MHz, DMSO-d₆)ô ppm 2.29 (s, 3 H) 3.10 (s, 3 H) 3.72 (s, 3 H) 3.80 (s, 3 H) 4.02 (s, 3 H) 6.24 (d, J~71 Hz, 1 H) 6.56 - 6.59 (m, 1 H) 6.59 - 6.62 (m, 1 H) 6.92 (t, J=1.6 Hz, 1 H) 6.93-6.99 (m, 2 H) 7.06 (d, J=7.7 Hz, 1 H) 7.13 (d, .8 Hz, 1 H) 7.35 (d, J=8.4 Hz, 1 H) 7.94 (d, J=8.4 Hz, 1 H) 8.35 (s, 1 H) 11.91 35 (brs, 1 H)

LC/MS (method LC-A); R_t 1.18 min, MH*543

[a]_D ²⁰:+122.9° (c 0.48, DMF)

Chiral SFC (method SFC-E): R_t 4.15 min MH⁺543, chiral purity 100%.

-33Enantiomer 6B:

NMR (360 MHz, DMSO-cfe) δ ppm 2.29 (s, 3 H) 3.10 (s, 3 H) 3.72 (s, 3 H) 3.80 (s, 3 H) 4.02 (s, 3 H) 6.24 (d, J=7.7 Hz, 1 H) 6.57 - 6.59 (m, 1 H) 6.59 - 6.62 (m, 1 H) 6.92 (t, J=1.8 Hz, 1 H) 6.93 - 7.00 (m, 2 H) 7.06 (d, J=7.7 Hz, 1 H) 7.13 (d, J=1.8 Hz, 1 H) 7.35 (d, J=8.1 Hz, 1 H) 7.94 (d, J=8.8 Hz, 1 H) 8.35 (d, J=2.2 Hz, 1 H) 11.91 (brs, 1 H)

LC/MS (method LC-A): R_t 1.22 min, MH⁺ 543 [a]_D ²⁰: -120.6° (c 0.2755, DMF)

Chiral SFC (method SFC-E): R_t4.50 min, MH* 543, chiral purity 99.35%.

Example 7: Synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1Hindol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 7) and chiral séparation into Enantiomers 7A and 7B.

o

DIPEA

CH₃CN, 85°C ovemight

Chiral séparation

Enantiomers 7 A and 7B

Synthesis of intermediate 7a:

A solution of 6-fluoro-5-methyl-1H-indole [CAS 162100-95-0] (1.7 g, 11.4 mmol) in CH2CI2 (100 mL) was cooled to 0’C under ^-atmosphère. A solution of diethylaluminum chloride 1M in hexane (17.1 mL, 17.1 mmol) was added dropwise and the resulting mixture was kept at 0°C for 15 min. A solution of 2-(4-chloro2-methoxyphenyl)acetyl chloride 1a (3.50 g, 16 mmol) in ΟΗ₂ΟΙ₂ (50 mL) was added dropwise. Stirring was continued at 0°C for 1 h and at room température for 2 h. The reaction mixture was poured out in a stirring ice/Rochelle sait solution.

-34After the ice had melted, the mixture was filtered over dicalite® and the filter cake was washed several times with THF. The filtrâtes were combined. The layers were separated and the organic layer was washed with brine, dried over MgSO₄, filtered and evaporated under reduced pressure. The solid residue was suspended in

CH₂CI₂ (30 mL), the precipitate was filtered off and dried under vacuum at 50°C to provide 2-(4-chloro-2-methoxyphenyl)-1 -(6-fluoro-5-methyl-1 H-indol-3-yl)ethanone 7a (2.76 g).

Synthesis of intermediate 7b:

A stirred solution of 2-(4-chloro-2-methoxyphenyl)-1 -(6-fluoro-5-methyl-1 H-indol3-yl)ethanone 7a (2.76 g, 8.32 mmol) in THF (350 mL) was cooled to 0°C. A solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (3.44 g, 9.15 mmol) in THF (50 mL) was added dropwise. The reaction mixture was stirred at 0°C for 2 h and at room température for 2 h. The solids were removed by filtration and washed with THF. The combined filtrâtes were evaporated under reduced pressure. The residue was mixed with EtOAc (50 mL). The solids were isolated by filtration, washed with a small amount of EtOAc and dried under vacuum at 50°C to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1 -(6-fluoro5-methyl-1H-indol-3-yl)ethanone 7b (3.21 g) as a white solid, which was used without further purification in the next step.

Synthesis of Compound 7 and chiral séparation of Enantiomers 7A and 7B: A mixture 2-bromo-2-(4-chloro-2-methoxyphenyl)-1 -(6-fluoro-5-methyl-1 H-indol3-yl)ethanone 7b (1.6 g, 3.90 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS

62606-02-4] (1.18 g, 5.84 mmol) and diisopropylethylamine (671 pL, 3.90 mmol) in

CH₃CN (100 mL) was stirred overnight at 85°C. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in CH₂CI₂(100 mL), washed with 1N HCl (100 mL) and water (100 mL), dried over MgSO₄, filtered and evaporated under reduced pressure. The residue was purified by column chromatograph (Stationary phase: Grâce Reveleris® silica 120 g, Mobile phase: EtOAc:EtOH(3:1 )/heptane gradient 0/100 to 50/50). The desired fractions were combined and evaporated under reduced pressure. The residue was precipitated from CH₂CI₂/heptane. The solids were isolated by filtration and washed with CH₂Cl2/heptane (1/1). The crude product was further purified by

Préparative HPLC (Stationary phase: Uptisphere® C18 ODB - 10 pm, 200 g, cm, Mobile phase: 0.25% NH4HCO3 solution in water, CH3CN). The product fractions were combined and evaporated under reduced pressure. The solid residue was mixed with EtOAc (20 mL) and the solids were isolated by filtration

-35and washed with a small amount of EtOAc to provide 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 7, 341 mg) as a racemic mixture. The filtrate was evaporated under reduced pressure and the residue was taken up with MeOH. s After stirring for 30 min, the solids were isolated by filtration to provide a second crop of Compound 7 (92 mg).

The chiral séparation ofthe enantiomers ofCompound 7 (402 mg)was performed via Normal Phase Chiral séparation (Stationary phase: (S,S)-Whelk-O1, Mobile phase: 100% methanol). The product fractions were combined and evaporated to îo provide Enantiomer 7A as the first eiuted product and Enantiomer 7B as the second eiuted product. Enantiomer 7A was further purified by flash chromatography on silica gel (Stationary phase: Grace Reveleris® silica 12 g, Mobile phase: heptane/EtOAc/EtOH 100/0/0 to 40/45/15). The desired fractions were combined and evaporated under reduced pressure. The residue was 15 triturated with H₂O (1.75 mL) and MeOH (0.75 mL). The solids were filtered off, washed (2x) with H₂O/MeOH 7/3, and dried under vacuum at 50°C to provide Enantiomer 7A (48 mg). Enantiomer 7B was further purified by flash chromatography on silica gel (Stationary phase: Grace Reveleris® silica 12 g, Mobile phase: heptane/EtOAc/EtOH 100/0/0 to 40/45/15). The desired fractions 20 were combined and evaporated under reduced pressure. The residue was triturated with H₂O (1.75 mL) and MeOH (0.75 mL). The solids were filtered off, washed (2x) with H₂O/MeOH 7/3, and dried under vacuum at 50°C to provide Enantiomer 7B (43 mg).

Compound 7:

NMR (400 MHz, DMSO-c/₆) δ ppm 2.30 (d, >0.9 Hz, 3 H) 3.09 (s, 3 H) 3.72 (s, 3 H) 4.00 (s, 3 H) 6.22 (d, J=7.7 Hz, 1 H) 6.54 - 6.63 (m, 2 H) 6.92 (t, >1.5 Hz, 1 H) 6.97 (dd, >8.3, 1.9 Hz, 1 H) 7.01 (d, >7.7 Hz, 1 H) 7.12 (d, >1.8 Hz, 1 H) 7.22 (d, >10.2 Hz, 1 H) 7.35 (d, >8.4 Hz, 1 H) 8.02 (d, >7.7 Hz, 1 H) 8.37 (s, 30 1 H) 11.97 (brs, 1 H)

LC/MS (method LC-A): R_t 1.19 min, MH⁺531

Enantiomer 7A:

¹H NMR (400 MHz, DMSO-dg) δ ppm 2.30 (d, >1.5 Hz, 3 H) 3.09 (s, 3 H) 3.72 (s, 35 3 H) 4.00 (s, 3 H) 6.22 (d, >7.9 Hz, 1 H) 6.56 - 6.60 (m, 2 H) 6.91 (t, >1.7 Hz,

H) 6.97 (dd, >8.3, 2.1 Hz, 1 H) 7.01 (d, >7.7 Hz, 1 H) 7.12 (d, >2.0 Hz, 1 H) 7.22 (d, >10.1 Hz, 1 H) 7.34 (d, >8.1 Hz, 1 H) 8.02 (d, >7.7 Hz, 1 H) 8.37 (s, 1 H) 11.96(5,1 H)

-36LC/MS (method LC-A): R_t 1.15 min, MH⁺ 531

[a]D20: -163.2° (c 0.435, DMF)

Chiral SFC (method SFC-E): R_t4.26 min, MH⁺ 531, chiral purity 100%.

Enantiomer 7B:

¹H NMR (400 MHz, DMSO-d₆) δ ppm 2.30 (d, >1.5 Hz, 3 H) 3.09 (s, 3 H) 3.72 (s, 3 H) 4.00 (s, 3 H) 6.22 (d, 7=7.7 Hz, 1 H) 6.57 - 6.61 (m, 2 H) 6.92 (t, 7=1.8 Hz, 1 H) 6.97 (dd, 7=8.1,2.0 Hz, 1 H) 7.01 (d, 7=7.7 Hz, 1 H) 7.12 (d, 7=2.0 Hz, 1 H) 7.22 (d, 7=10.0 Hz, 1 H) 7.35 (d, 7=8.4 Hz, 1 H) 8.02 (d, 7=7.9 Hz, 1 H) 8.37 (d,

7=2.4 Hz, 1 H) 11.97 (S, 1 H)

LC/MS (method LC-A): R_t 1.15 min, MH⁺ 531

[a]_D ²⁰: +166.6° (c0.5, DMF)

Chiral SFC (method SFC-E): R_t 3.78 min, MH⁺ 531, chiral purity 100%.

Example 8: synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1 -(5-(trifluoromethyl)-1 H-indol-3-yl)ethanone (Compound 8) and chiral séparation into Enantiomers 8Aand 8B.

-37Synthesis of intermediate 8a:

At 0°C, under a N₂-flow, sodium hydride (2.48 g, 64.8 mmol) was added portionwise to a mixture of 5-(trifluoromethyl)-1H-indole [CAS 100846-24-0] (10 g, 5 54.0 mmol) in DMF (150 mL) and the reaction mixture was stirred at 0°C for min. A solution of tosyl chloride (11.3 g, 59.4 mmol) in DMF (50 mL) was added dropwise and the resulting mixture was stirred at room température for 3 h. At 0°C, the mixture was quenched by the addition of water. The precipitate was filtered off and dried overnight under vacuum at 70°C to give 1 -tosyl-5-(trifluoromethyl)-1Hîo indole 8a (18.4 g).

Synthesis of intermediate 8b:

Titanium(IV) chloride (2.4 mL, 21.9 mmol) was added dropwise at room température to a solution of 1-tosyl-5-(trifluoromethyl)-1H-indole 8a (3.7 g,

10.95 mmol) and 2-(4-ch!oro-2-methoxyphenyl)acetyl chloride 1a (4.8 g,

21.9 mmol, synthesis: see Example 1) in 1,2-dichloroethane (120 mL). The reaction was stirred at room température for 2 h. Ice-water was added. The reaction mixture was extracted with EtOAc. The organic layer was dried over

MgSO4, filtered, and the solvent was concentrated under reduced pressure. The 20 residue was purified by column chromatography on silica gel (15-40 pm, 80 g,

Mobile phase: CH₂CI₂/MeOH 99.5/0.5). The fractions containing Compound 8b were combined and the solvent was evaporated under reduced pressure. The compound was taken up with CHsCN/dÎisopropylether. The precipitate was filtered off and dried to give 2-(4-chloro-2-methoxyphenyl)-1 -(1 -tosyl-5-(trifluoromethyl)25 1H-indol-3-yl)ethanone 8b (2.8 g).

Synthesis of intermediate 8c:

Lithium hydroxide (0.64 g, 15.3 mmol) was added to a solution of 2-(4-chloro2-methoxyphenyl)-1-(1-tosyl-5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8b (3.2 g, 30 6.13 mmol) in THF (18 mL) and water (6 mL). The mixture was stirred at 30°C for

h. Water and EtOAc were added. The organic layer was separated, dried over MgSO₄, filtered, and the solvent was evaporated under reduced pressure. The solid was taken up with diisopropylether. The precipitate was filtered off and dried to give 2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethyl)-1/7-indol-3-yl)ethanone 35 8c (2.1 g).

Synthesis of intermediate 8d:

Ai 0°C, a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.1 g, 5.7 mmol) in THF (60 mL) was added dropwise to a mixture of 2-(4-chloro2-methoxyphenyl)-1-(5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8c (2.15 g, 5 5.7 mmol) in THF (60 mL). The mixture was stirred at 0°C for 1 h and at room température for 4 h. The precipitate was filtered off and washed with EtOAc. The combined filtrâtes were concentrated under reduced pressure. The residue was dissolved in EtOAc. The organic layer was washed with water, dried over MgSO₄, filtered and the solvent was evaporated under reduced pressure. The residue was 10 ta ken up with diisopropylether. The precipitate was filtered off and dried to give

2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8d (2.5 g).

Synthesis of Compound 8 and chiral séparation into Enantiomers 8A and 8B: 15 A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1 -(5-(trifluoromethyl)-1 Hindol-3-yl)ethanone 8d (1 g, 2.24 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (496 mg, 2.46 mmol) and diisopropylethylamine (0.38 mL, 2.24 mmol) in CH₃CN (50 mL) and THF (25 mL) was stirred at 70°C for 24 h. The solution was concentrated under reduced pressure. The residue was dissolved in EtOAc and 20 the solution was washed with IN HCl. The organic layer was separated, dried over

MgSO₄, filtered and the solvent was evaporated under reduced pressure. The compound was crystallized from diisopropylether/CH₃CN to give 2-(4-chloro2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(5-(trifluoromethyl)-1H-indol-3-yl)ethanone (Compound 8, 310 mg) as a racemic mixture.

The Enantiomers of Compound 8 were separated via preparative Chiral SFC (Stationary phase: Chiralpak® AD-H 5 pm 250 x 20 mm, Mobile phase: 70% CO₂, 30% /PrOH +0.3% /ΡγΝΗ₂) to give, after crystallization in petroleum ether/diisopropylether, 122 mg of the first eluted Enantiomer 8A and 128 mg of the second eluted Enantiomer 8B.

Compound 3:

¹H NMR (500 MHz, DMSO-d₆) δ ppm 3.10 (s, 3 H) 3.72 (s, 3 H) 3.99 (S, 3 H) 6.29 (d, 7=7.9 Hz, 1 H) 6.56 - 6.62 (m, 2 H) 6.92 (s, 1 H) 6.98 (dd, 7=8.4, 2.0 Hz, 1 H) 7.09 (d, 7=7.9 Hz, 1 H) 7.13 (d, 7=1.9 Hz, 1 H) 7.36 (d, 7=8.5 Hz, 1 H) 7.54 (dd, 35 7=8.5, 1.6 Hz, 1 H) 7.69 (d, 7=8.5 Hz, 1 H) 8.48 (s, 1 H) 8.61 (s, 1 H) 12.45 (br S,

H)

LC/MS (method LC-C): R_t 3.19 min, MH⁺ 567

Melting point: 168°C

-39Enantiomer 8A:

¹H NMR (400 MHz, DMSO-d₆) δ ppm 3.09 (S, 3 H) 3.73 (s, 3 H) 3.99 (s, 3 H) 6.29 (d, J=7.6 Hz, 1 H) 6.60 (br s, 2 H) 6.92 (s, 1 H) 6.98 (dd, J=8.3, 1.8 Hz, 1 H) 7.07 (d, J=8A Hz, 1 H) 7.13 (d, J=1.5 Hz, 1 H) 7.36 (d, J=8.1 Hz, 1 H) 7.54 (d, Hz,

H) 7.69 (d, J=8.6 Hz, 1 H) 8.49 (S, 1 H) 8.60 (s, 1 H) 12.41 (br s, 1 H) LC/MS (method LC-C): R₍ 3.25 min, MH* 567 [a]_D ²⁰:-119.2° (c 0.2727, DMF)

Chiral SFC (method SFC-F): R_t 2.64 min, MH* 567, chiral purity 100%.

Enantiomer 8B:

¹ H NMR (400 MHz, DMSO-cfe) δ ppm 3.09 (s, 3 H) 3.73 (s, 3 H) 3.99 (s, 3 H) 6.29 (d, J-SA Hz, 1 H) 6.60 (s, 2 H) 6.92 (s, 1 H) 6.98 (dd, J=8.6, 2.0 Hz, 1 H) 7.07 (d, J=8.1 Hz, 1 H) 7.13 (d, J=2.0 Hz, 1 H) 7.36 (d, J=8.6 Hz, 1 H) 7.54 (dd, J=8.6,

1.5 Hz,1 H) 7.69 (d, J=8.6 Hz, 1 H) 8.49 (s, 1 H) 8.60 (s, 1 H) 12.40 (br s, 1 H)

LC/MS (method LC-C): R_t 3.25 min, MH* 567 Md^2C: +125.1 ° (c 0.2455, DMF)

Chiral SFC (method SFC-F); R_t 3.44 min, MH* 567, chiral purity 100%.

Example 9: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(5-(trifluoromethoxy)-1H-indol-3-yl)ethanone (Compound 9) and chiral séparation into Enantiomers 9A and 9B.

-40Synthesis of intermediate 9a:

A solution of 5-(trifluoromethoxy)-1H-indoIe [CAS 262593-63-5] (3 g, 14.9 mmol) in

CH2CI2 (150 mL) was cooled to 0°C under ^-atmosphère. A solution of diethylaluminum chloride IM in hexane (22.4 mL, 22.4 mmol) was added dropwise 5 and the resulting mixture was kept at 0°C for 15 min. A solution of 2-(4-chloro2-methoxyphenyl)acetyl chloride 1a (4.57 g, 20.9 mmol) in CH2CI2 (100 mL) was added dropwise. Stirring was continued at 0°C for 1 h and the reaction mixture was subsequently stirred at room température for 4 h. The reaction mixture was poured ouf in a stirring ice/Rochelle sait solution. After the ice had melted, the 10 mixture was filtered over dicaliîe® and the filter cake was washed several fîmes with THF. The filtrâtes were combined. The layers were separated and the organic layer washed with brine, dried over MgSO₄, filtered and evaporated under reduced pressure. The residue was triturated with CH₂CI₂ (50 mL). The resulting precipitate was filtered off and dried under vacuum at 50°C to provide 2-(4-chloro-2-methoxy15 ρhenyl)-1-(5-(triΐluoromethoxy)-1/7-indol·3-yl)ethanone 9a (4.39 g).

Synthesis of intermediate 9b:

A stirred solution of 2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethoxy)-1Hindol-3-yl)ethanone 9a (4.39 g, 11.4 mmol) in THF (200 mL) was cooled to 0°C.

A solution of phenyltrimethyiammonium tribromide [CAS 4207-56-1] (4.73 g,

2.6 mmol) in THF (100 mL) was added dropwise. The resulting suspension was stirred at room température for 2 h. The solids were removed by filtration and washed with THF. The combined filtrâtes were evaporated under reduced pressure. The residue was mixed with EtOAc (30 mL). The solids were isolated by 25 filtration, washed with a small amount of EtOAc and dried under vacuum at 50°C to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethoxy)-1H-indol3-yl)ethanone 9b (5.0 g) as a white solid, which was used without further purification in the next step.

Synthesis of Compound 9 and chiral séparation of Enantiomers 9A and 9B:

A mixture 2-bromo-2-(4-chloro-2-methoxyphenyl)-1 -(5-(trifluoromethoxy)-1 H-indol3-yl)ethanone 9b (2.5 g, 5.40 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (1.49 g, 7.38 mmol) and diisopropylethylamine (931 pL, 5.40 mmol) in CH₃CN (100 mL) was stirred overnight at 90°C. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in CH2CI2 (100 mL), washed with 1N HCl (100 mL) and water (100 mL), dried over MgSO₄, filtered and evaporated under reduced pressure. The residue was purified by column chromatograph (Stationary phase: Grâce Reveleris® silica 120 g, Mobile

-41phase: EtOAc:EtOH(3;1)/heptane gradient 0/100 to 50/50). The desired fractions were combined and evaporated under reduced pressure. The residue was precipitated from EtOAc (10 mL) while stirring. The solids were isolated by filtration and washed with a small amount of EtOAc to provide 2-(4-chloros 2-methoxyphenyl)-2-((3-methoxy-5-(meÎhylsulfonyl)phenyl)amino)-1-(5-(trifluoromethoxy)-1 H-indol-3-yl)eihanone (Compound 9, 477 mg) as a racemic mixture. The filtrats was evaporated under reduced pressure and the residue was taken up with EtOAc (5 mL). After overnight stirring, the solids were isolated by filtration and washed with EtOAc to provide a second crop of Compound 9 (216 mg).

io The chiral séparation of the enantiomers of Compound 9 (663 mg) was performed via Normal Phase Chiral séparation (Stationary phase: AS 20 pm, Mobile phase: 100% methanol). The product fractions were combined and evaporated to provide Enantiomer 9A as the first eluted product and Enantiomer 9B as the second eluted product. Enantiomer 9A was stirred up in H₂O (2 mL) and MeOH (3 mL) at

40°C. The solids were filtered off, washed (3x) with H₂O/MeOH 1/1, and dried under vacuum at 45°C to provide Enantiomer 9A (151 mg). Enantiomer 9B was Îurther purified by flash chromatography on silica gel (Stationary phase: Grâce Reveleris® silica 12 g, Mobile phase: heptane/EtOAc/EtOH 100/0/0 to 40/45/15). The desired fractions were combined, evaporated under reduced pressure and co20 evaporated with EtOAc. The residue was stirred up in MeOH (5 mL) and precipitated by the slow addition of H₂O (4 mL). The solids were filtered off, washed (3x) with H₂O/MeOH 1/1, and dried under vacuum at 50°C to provide Enantiomer 9B (132 mg).

Compound 9:

^dH NMR (400 MHz, DMSO-de) δ ppm 3.09 (s, 3 H) 3.73 (s, 3 H) 3.99 (s, 3 H) 6.26 (d, >7.9 Hz, 1 H) 6.57 - 6.62 (m, 2 H) 6.91 (t, >1.9 Hz, 1 H) 6.98 (dd, >8.4, 2.0 Hz, 1 H) 7.07 (d, >7.9 Hz, 1 H) 7.13 (d, >2.0 Hz, 1 H) 7.22 (dd, >8.6, 2.2 Hz, 1 H) 7.36 (d, J=8A Hz, 1 H) 7.59 (d, >8.8 Hz, 1 H) 8.06 (d, >0.9 Hz, 1 H) 8.55 (s, 30 1 H) 12.28 (brs, 1 H)

LC/MS (method LC-A): R_t 1.31 min, MH⁺ 583

Enantiomer 9A:

^ήΗ NMR (400 MHz, DMSO-d₆) δ ppm 3.09 (s, 3 H) 3.73 (s, 3 H) 3.99 (s, 3 H) 6.26 35 (d, >7.9 Hz, 1 H) 6.55 - 6.62 (m, 2 H) 6.91 (t, >1.5 Hz, 1 H) 6.98 (dd, >8.4, .0 Hz, 1 H) 7.07 (d, >7.9 Hz, 1 H) 7.13 (d, >2.0 Hz, 1 H) 7.21 (dd, >8.8, 1.8 Hz, 1 H) 7.36 (d, >8.4 Hz, 1 H) 7.59 (d, >8.8 Hz, 1 H) 8.07 (d, >0.9 Hz, 1 H) 8.55 (s, 1 H) 12.29 (brs, 1 H)

-42LC/MS (method LC-A): R_t 1.20 min, MH* 583 [a]_D ²⁰: +130.3° (c 0.555, DMF)

Chiral SFC (method SFC-E); R_t3.10 min, MH* 583, chiral purity 100%.

Enantiomer 9B:

NMR (400 MHz, DMSO-d₆) δ ppm 3.09 (s, 3 H) 3.73 (s, 3 H) 3.99 (s, 3 H) 6.26 (d, J=7.9 Hz, 1 H) 6.56 - 6.62 (m, 2 H) 6.92 (t, J=2.0 Hz, 1 H) 6.98 (dd, J=8.1, 2Ό Hz, 1 H) 7.07 (d, J=7.9 Hz, 1 H) 7.13 (d, J=2.0 Hz, 1 H) 7.22 (dd, J=8.8, 1.8 Hz, 1 H) 7.36 (d, J=8.4 Hz, 1 H) 7.59 (d, J=8.8 Hz, 1 H) 8.07 (d, J=0.9 Hz, 1 H) 8.55 (s, io 1 H) 12.30 (brs, 1 H)

LC/MS (method LC-A); R_t 1.20 min, MH* 583

Mo²⁰: -133.2° (cO.5, DMF)

Chiral SFC (method SFC-E): R_t3.50 min, MH* 583, chiral purity 100%.

Example 10: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy5-(methylsulfonyl)phenyl)amino)-1-(6-methoxy-5-(trifluoromethoxy)-1H-Îndol-3-yl)ethanone (Compound 10) and chiral séparation into Enantiomers 10A and 10B.

O F₃CO^^ N'nïnJnT' XXo---— X EiOH, NaOEt, ^MeO -15’C 2h, rt 12h - CO O Cu. quinoline Y pH----* J. OH 220-230C 12h 1θ/ ,^CI OMe ^Br___° ° , f₃cc XX ^{DlpEA Me(} 10f CH₃CN. rt 2 days

_ __ _Λ NaOH xylene -----------— 1 J? n ’ Y. J-- ' — MeOWHjO reflux 12h ⁰ 10a ^{0 10b} Cl H M ³ 'F ( Y* _ ^1a _____^B'³ H Ët₂AlCI THF, 0“C to rt 1 5h d CHjCh.O’Ctortlh _1()e Cl \ jfA O-\Z ^0Me O. / æY γΆ J. rf Chiral Enantiomers 10A and 10B T T> ₀Γ 10

-43Synthesis of intermediate 10a:

To a cooled (-15°C) solution of 3-methoxy-4-(tnfluoromethoxy)benzaldehyde [CAS 853771-90-1] (50 g, 230 mmol) and ethyl azidoacetate (89 g, 690 mmol) in EtOH (400 mL) was added dropwise, over a period of 2 h, a solution of NaOEt (0.69 mol, s prepared from 15.9 g of Na and 700 mL of EtOH). The reaction mixture was stirred at room température overnight. After cooling on an ice-bath, the reaction was quenched with a saturated NH₄CI solution (1.2 L), and stirred for 10 min. The precipitate was filtered off, washed with water, and dried to give (Z)-ethyl 2-azido3-(3-methoxy-4-(thfluoromethoxy)phenyl)acrylate 10a (32 g) as a yellowish solid.

Synthesis of intermediate 10b:

A solution of (Z)-ethyl 2-azido-3-(3-methoxy-4-(trifluoromethoxy)phenyl)acrylate 10a (3 g, 10 mmol) in xylene (40 mL) was heated under reflux overnight. After cooling to room température, the solvent was evaporated to dryness. The residue 15 was triturated with hexane (50 mL) and the precipitate was filtered off to afford methyl 6-methoxy-5-(thfluoromethoxy)-1/-/-indole-2-carboxylate 10b (yield: 1.4-1.6 g) as a yellow solid.

Synthesis of intermediate 10c:

To a mixture of methyl 6-methoxy-5-(trifluoromethoxy)-1 H-indole-2-carboxylate 10b (25 g, 87 mmol) in MeOH/H₂O (2/1,300 mL) was added NaOH (7 g, 175 mmol) and the mixture was heated under reflux until a clear solution was obtained. After cooling to room température, most of the methanol was removed under reduced pressure and the remaining aqueous solution was acidified with 25 conc. HCl to pH 3-4. The product was extracted with EtOAc (2x 250 mL). The combined organic layers were washed with brine, dried, and evaporated under reduced pressure to give 6-methoxy-5-(trifluoromethoxy)-1H-indole-2-carboxylic acid 10c (22.7 g) as a grey solid.

Synthesis of intermediate 10d:

A suspension of 6-methoxy-5-(trifluoromethoxy)-1H-indole-2-carboxylic acid 10c (7.5 g, 27 mmol) and Cu (1.22 g, 0.7 equiv.) in quinoline (150 mL) was heated to 220-230°C under inert atmosphère for 12 h. After cooling to room température, the mixture was diluted with methyl fert-butyl ether (MTBE, 400 mL) and washed with 35 a saturated aqueous NaHSO₄ solution (2x 500 mL). The organic layer was dried over MgSO₄, filtered through short pad of silica gel, and evaporated under reduced pressure. The residue was purified by column chromatography to afford 6-methoxy-5-(trifluoromethoxy)-1H-indole 10d (3.75 g) as a yellow solid.

-44Synthesis of intermediate 10e:

A solution of 6-methoxy-5-(trifiuoromethoxy)-1 H-indole 10d (1.61 g, 6.96 mmol) in CH₂CI₂ (150 mL) was cooled to 0^ûC under N₂-atmosphere. A solution of diethylaluminum chloride IM in hexane (10.4 mL, 10.4 mmol) was added dropwise and the resulting mixture was kept at 0°C for 30 min. A solution of 2-(4-chloro2-methoxyphenyl)acetyl chloride 1a (2.28 g, 10.4 mmol) in CH2CI2 (75 mL) was added dropwise. Stirring was continued at 0°C for 1 h and at room température for 1 h. The reaction mixture was cooled to 0°C and a solution of potassium sodium tartrate tetrahydrate (Rochelle sait, 3.93 g, 13.9 mmol) in water (6 mL) was added dropwise. The réaction mixture was stirred for 30 min at 0°C. THF (200 mL) was added and the reaction mixture was stirred at room température for 20 min.

Na₂SO₄ (25g) was added, the mixture was stirred overnight, filtered over dicalite® and the filter cake was washed several times with THF (4x 150 mL). The filtrâtes 15 were combined and evaporated under reduced pressure. The solid residue was stirred up in a mixture of diisopropyl ether (25 mL) and EtOAc (2 mL). The solids were filtered off, washed with DIPE (3x) and dried under vacuum at 50°C to provide 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-(trifluoromeÎhoxy)-1H-indol3-yl)ethanone 10e (3.6 g).

Synthesis of intermediate 10f:

A stirred solution of 2-(4-chloro-2-methoxyphenyl)-1 -(6-methoxy-5-(trrfluoromethoxy)-1 H-indol-3-yl)ethanone 10e (3.6 g, 6.53 mmol) in THF (130 mL) was cooled to 0°C, under N₂-atmosphere. Phenyltrimethylammonïum tribromide [CAS 25 4207-56-1] (2.58 g, 6.85 mmol) was added and the reaction mixture was stirred at

0°C for 45 min and at room température for 1.5 h. The solids were removed by filtration and washed with THF (2x). The combined filtrâtes were evaporated under reduced pressure to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 10f (4.16 g), which was used without 30 further purification in the next step.

Synthesis of Compound 10 and chiral séparation of Enantiomers 10A and 10B:

A mixture 2-bromo-2-(4-chloro-2-methoxyphenyl)-1 -(6-methoxy-5-(trifluoro35 methoxy)-1H-indol-3-yl)ethanone 10f (4.16 g, 6.50 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.62 g, 13.0 mmol) and diisopropylethylamine (2.24 mL, 13.0 mmol) in CH₃CN was stirred at room température for 2 days under N₂-atmosphere. Water (250 mL) was added and the product was extracted with

-45Et₂O (2x). The combined organic layers were dried over MgSO4, filtered and evaporated under reduced pressure. The residue was purified by column chromatography (Stationary phase: Grâce Reveleris® silica 100 g, Mobile phase: heptane/EtOAc/EtOH gradient 100/0/0 to 40/45/15). The desired fractions were combined and evaporated under reduced pressure. The residue was further purified via préparative HPLC (Stationary phase: RP XBridge® Prep C18 OBD 10 pm, 50 x 150 mm, Mobile phase: 0.25% NH4HCO3 solution in water, CH₃CN). The desired fractions were combined and evaporated under reduced pressure. The residue, containing racemtc 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy10 5-(methylsulfonyl)phenyl)amino)-1 -(6-methoxy-5-(trifluoromethoxy)-1 H-indol3-yl)ethanone (Compound 10, 380 mg), was submitted to chiral séparation by préparative SFC (Stationary phase: Chiralpak® Diacel AS 20 x 250 mm, Mobile phase: CO₂, EtOH + 0.4% iPrNH₂). The product fractions were combined, evaporated under reduced pressure and co-evaporated with MeOH to provide

Enantiomer 10A as the first eluted product and Enantiomer 10B as the second eluted product. Both enantiomers were precipitated from a solvent mixture of MeOH and water, filtered off and dried at 50 ’C under vacuum to provide Enantiomer 10A (135 mg) and Enantiomer 10B (144 mg).

Enantiomer 10 A:

NMR (360 MHz, DMSO-de) δ ppm 3.09 (s, 3 H) 3.72 (s, 3 H) 3.87 (s, 3 H) 3.99 (s, 3 H) 6.22 (d, >7.7 Hz, 1 H) 6.55 - 6.59 (m, 2 H) 6.88 - 6.91 (m, 1 H) 6.98 (dd, >8.1, 1.8 Hz, 1 H) 7.08 (d, >7.7 Hz, 1 H) 7.13 (d, >2.2 Hz, 1 H) 7.21 (s, 1 H) 7.34 (d, >8.1 Hz, 1 H) 8.02 (d, >1.5 Hz, 1 H) 8.41 (S, 1 H) 12.05 (br s, 1 H)

LC/MS (method method LC-A): R_t 1.20 min, MH⁺ 613

[al_D ²⁰: +81.4° (C 0.29, DMF)

Chiral SFC (method SFC-E): R_t 3.34 min, MH⁺ 613, chiral purity 100%.

Enantiomer 10B:

¹H NMR (360 MHz, DMSO-de) δ ppm 3.09 (s, 3 H) 3.72 (S, 3 H) 3.87 (s, 3 H) 3.99 (S, 3 H) 6.22 (d, >7.7 Hz, 1 H) 6.55 - 6.60 (m, 2 H) 6.90 (t, >1.6 Hz, 1 H) 6.98 (dd, >8.2, 2.0 Hz, 1 H) 7.08 (d, >7.8 Hz, 1 H) 7.13 (d, >2.2 Hz, 1 H) 7.21 (s, 1 H) 7.34 (d, >8.4 Hz, 1 H) 8.01 (d, >1.1 Hz, 1 H) 8.41 (s, 1 H) 12.08 (br s, 1 H) LC/MS (method method LC-A): R_t 1.20 min, MH⁺ 613

[a]_D ²⁰: -99.6° (c 0.261, DMF)

Chiral SFC (method SFC-E): R_t3.69 min, MH⁺ 613, chiral purity 100%.

Example 11 : Synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)Ί-(7-meΐhyl-5-(trifluoromethoxy)-1H-^ndol·3-yl)ethanone (Compound 11) and chiral séparation into Enantiomers 11A and 11 B.

Et₂AIC1

CH₂CI₂ 0°Ctort 1h

Chiral séparation

Enantiomers 11A and 11B

Synthesis of intermediate 11a:

A mixture of boron(III) chloride 1M in CH₂Cl2 (25.5 mL, 25.5 mmol) and aluminum(lll) chloride (3.40 g, 25.5 mmol) was diluted with CH₂CI₂ (20 mL) and cooled on an ice-bath under N₂-atmosphere. A solution of 2-m ethyl-4-(tr if! uoro10 methoxy)aniline [CAS 86256-59-9] (4.88 g, 25.5 mmol) and chloroacetonÎtrile (3.24 mL, 51.0 mmol) in CH₂CI₂ (7.5 mL) was added dropwise. After addition, the ice-bath was removed and the mixture was heated under reflux for 8 h. The mixture was cooled again to 0°C using an ice-bath. 2N HCl (75 mL) was added dropwise, causing heavy précipitation. The resulting suspension was heated under reflux for 90 min, and cooled to room température. The solids were removed by filtration. The filter cake was washed with CH₂CI₂ (4x). The filtrâtes were combined and the phases were separated. The organic layer was isolated, washed with an aqueous NaHCO₃ solution, dried over MgSO₄, filtered and evaporated under reduced pressure. The residue was purified by flash chromatography (Stationary phase: Biotage® SNAP Ultra Silica 100 g, Mobile phase: heptane/CH₂CI₂ gradient 100/0 to 0/100). The desired fractions were combined and concentrated to a residual volume of 30 mL. The precipitate was filtered off, washed with heptane and CH₂CI₂, and dried under vacuum at 50°C to provide 1-(2-amino-3-methyl20585

-475-(trifluoromethoxy)phenyl)-2-chloroethanone 11a (1.37 g). The filtrate was concentrated under reduced pressure. The solid residue was stirred up in a mixture of heptane (20 mL) and diisopropyl ether (3 mL), filtered off, washed with heptane (3x) and dried under vacuum at 50°C to provide a second fraction of 11a 5 (0.24 g).

Synthesis of intermediate 11b:

Sodium borohydride (326 mg, 8.61 mmol) was added to a stirred solution of 1-(2-amino-3-methyl-5-(trifluoromethoxy)phenyl)-2-chloroethanone 11a (1.92 g, îo 7.17 mmol) in tert-butanol (50 mL) and water (5 mL). The réaction mixture was stirred at room température for 30 min and at 90°C for 2.5 h. Water (50 mL) was added and the product was extracted with diethyl ether (2x). The combined organic layers were washed with brine, dried over MgSO4, filtered and evaporated under reduced pressure. The residue was purified by flash chromatography (Stationary phase: Biotage® SNAP Ultra Silica 25 g, Mobile phase: heptane/EtOAc gradient 100/0 to 20/80). The desired fractions were combined, concentrated under reduced pressure, co-evaporated with heptane and dried under vacuum at 50°C to provide 7-methyl·5-(trifluoromethoxy)-1H-indole 11b (1-2 g).

Synthesis of intermediate 11c:

A mechanically stirred solution of 7-methyl-5-(trifluoromethoxy)-1 H-indole 11 b (1.5 g, 6.97 mmol) in CH₂CI₂ (100 mL) was cooled to 0°C under N₂-atmosphere. A solution of diethyîaluminum chloride 1M in hexane (10.5 mL, 10.5 mmol) was added dropwise and the resulting mixture was kept at 0°C for 25 min. A solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (2.29 g, 10.5 mmol) in CH2CI2 (40 mL) was added dropwise while keeping the reaction température below 6°C. Stirring was continued at 0°C for 1 h and the reaction mixture was subsequently stirred at room température for 1 h. The reaction mixture was cooled to 0°C and a solution of Rochelle sait [CAS 6100-16-9] (3.94 g, 13.9 mmol) in water (4 mL) was added dropwise. After stirring for 1 h, the reaction mixture was filtered over dicalite® and the filter cake was washed with THF (5x 100 mL). The combined filtrâtes were evaporated under reduced pressure. The residue solidified upon standing overnight. The solids were stirred up in CH₃CN (5 mL), filtered off, washed with CH₃CN (3x 1.5 mL) and dried under vacuum at 50°C to provide 2-(4-chloro-2-methoxyphenyl)-1-(7-methyl-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 11c (1.9 g).

-48Synthesis of intermediate 11d:

A stirred solution 2-(4-chloro-2-methoxyphenyl)-1-(7-methyl-5-(trifluororriethoxy)1H-indol-3-yl)ethanone 11c (2.13 g, 5.35 mmol) in THF (80 mL) was cooled to O’C, under N₂-atmosphere. Phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.11g, 5.62 mmol) was added and the reaction mixture was stirred at 0°C for min and at room température for 2 h. The solids were removed by filtration and washed with THF (2x). The combined filtrâtes were evaporated under reduced pressure to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(7-methyl5-(trifluoromethoxy)-1 H-indol-3-yl)ethanone 11d (3.45 g), which was used without ίο further purification in the next step.

Synthesis of Compound 11 and chiral séparation of Enantiomers 11A and 11B:

A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(7-methyl-5-(trifluoro15 methoxy)-1H-indol-3-yl)ethanone 11d (3.45 g, 6.87 mmol), 3-methoxy5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.76 g, 13.7 mmol) and diisopropylethylamine (2.37 mL, 13.7 mmol) in CH₃CN (60 mL) was stirred at room température for 2 days under N₂-atmosphere. Water (125 mL) was added and the product was extracted with Et₂O (2x). The combined organic layers were washed with brine, dried over MgSO₄, filtered and evaporated under reduced pressure. The residue was purified via préparative HPLC (Stafionary phase: RP XBridge® Prep C18 OBD - 10 pm, 50 x 150 mm, Mobile phase: 0.25% NH4HCO3 solution in water, CH₃CN). The fractions containing product were combined and evaporated under reduced pressure to provide racemic 2-(4-chloro-2-methoxyphenyl)25 2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(7-methyl-5-(trifluoromethoxy)1H-indol-3-yl)ethanone (Compound 11, 1.74 g). The chiral séparation ofthe enantiomers of Compound 11 (1.74 g) was performed via Préparative SPC (Stafionary phase: Chiralpak® Diacel AS 20 x 250 mm, Mobile phase: CO2, EtOH + 0.4% iPrNH₂). The product fractions were combined and evaporated under reduced pressure to provide Enantiomer 11A as the first eluted product and Enantiomer 11B as the second eluted product. Both enantiomers were precipitated from a solvent mixture of MeOH and water, filtered off and dried at 50°C under vacuum to provide Enantiomer 11A (777 mg) and Enantiomer 11B (712 mg).

Enantiomer 11A:

¹H NMR (600 MHz, DMSO-cfe) δ ppm 2.50 (s, 3 H) 3.09 (s, 3 H) 3.72 (s, 3 H) 4.00 (s, 3 H) 6.28 (d, J-7.8 Hz, 1 H) 6.56 - 6.63 (m, 2 H) 6.92 (br s, 1 H) 6.97 (dd, J=8.4,

1.9 Hz, 1 H) 7.05 (br s, 1 H) 7.07 (d, J=7.Q Hz, 1 H) 7.13 (d, >1.9 Hz, 1 H) 7.35 (d, >8.4 Hz, 1 H) 7.90 (br s, 1 H) 8.53 (s, 1 H) 12.41 (br s, 1 H)

LC/MS (method method LC-A): R_t 1.26 min, MH⁺ 597 [a]_D ²⁰: +81.3° (c 0.3455, DMF)

Chiral SFC (method SFC-E): R_t2.96 min, MH⁺ 597, chiral purity 100%.

Enantiomer 11B:

¹H NMR (600 MHz, DMSO-d₆) δ ppm 2.51 (s, 3 H) 3.09 (s, 3 H) 3.72 (s, 3 H) 4.00 (s, 3 H) 6.28 (d, >7.9 Hz, 1 H) 6.58 - 6.60 (m, 2 H) 6.92 (t, >1.8 Hz, 1 H) 6.97 10 (dd, >8.4, 1.9 Hz, 1 H) 7.05 (br s, 1 H) 7.06 (d, >7.9 Hz, 1 H) 7.13 (d, >2.1 Hz,

H) 7.35 (d, >8.2 Hz, 1 H) 7.89 (br s, 1 H) 8.53 (s, 1 H) 12.37 (br s, 1 H)

LC/MS (method LC-A): R_t 1.26 min, MH⁺ 597

[a]_D ²⁰; *87.4° (c 0.342, DMF)

Chiral SFC (method SFC-E); R_t 3.44 min, MH⁺ 597, chiral purity 100%. 15

ANTIVIRAL ACTIVITY OF THE CQMPOUNDS OF THE INVENTION

DENV-2 antiviral assay

The antiviral activity of ail the compounds of the invention was tested against the DENV-2 16681 strain which was labeled with enhanced green fluorescent protein 20 (eGPF; Table 1 ). The culture medium consists of minimal essentiel medium supplemented with 2% of heat-inactivated fêtai calf sérum, 0.04% gentamycin (50mg/mL) and 2mM of L-glutamine. Veto cells, obtained from ECACC, were suspended in culture medium and 25pL was added to 384-well plates (2500 cells/well), which already contain the antiviral compounds. Typically, these 25 plates contain a 5-fold serial dilution of 9 dilution steps of the test compound at 200 times the final concentration in 100% DMSO (200nL). In addition, each compound concentration is tested in quadruplicate (final concentration range: 25μΜ - 0.000064μΜ or 2.5μΜ - 0.0000064μΜ for the most active compounds). Finally, each plate contains wells which are assigned as virus Controls (containing 30 cells and virus in the absence of compound), cell Controls (containing cells in the absence of virus and compound) and medium Controls (containing medium in the absence of cells, virus and compounds). To the wells assigned as medium contrai, 25pL of culture medium was added instead of Vero cells. Once the cells were added to the plates, the plates were incubated for 30 minutes at room température 35 to allow the cells to distribute evenly within the wells. Next, the plates were incubated in a fully humidified incubator (37°C, 5%CO₂) until the next day. Then, DENV-2 strain 16681, labeled with eGFP, was added at a multiplicity of infection (MOI) of 0.5. Therefore, 15 pL of virus suspension was added to ail the wells

contaîning test compound and to the wells assigned as virus control. In parallel, 15pL of culture medium was added to the medium and cell Controls. Next, the plates were incubated for 3 days in a fully humidified incubator (37°C_! 5%CO₂). At the day of the read out, the eGFP fluorescence was measured using an automated fluorescence microscope at 488 nm (blue laser). Using an in-house LIMS System, inhibition dose response curves for each compound were calculated and the half maximal effective concentration (EC50) was determined. Therefore, the percent inhibition (I) for every test concentration is calculated using the following formula: I = 100*(St-Scc)/(Svg-Scc); St, Sec and Svc are the amount of îo eGFP signal in the test compound, cell control and virus control wells, respectively. The EC_5Q represents the concentration of a compound at which the virus réplication is in h i bited with 50%, as measured by a 50% réduction of the eGFP fluorescent intensity compared to the virus control. The EC₅o is calculated using linear interpolation.

In parallel, the toxicity of the compounds was assessed on the same plates. Once the read-out for the eGFP signal was done, 40pL of ATPIite, a cell viability stain, was added to ail wells of the 384-well plates. ATP is présent in ail metabolically active cells and the concentration déclinés very rapidly when the cells undergo necrosis or apoptosis. The ATPLite assay System is based on the production of light caused by the reaction of ATP with added luciferase and D-luciferin. The plates were incubated for 10 minutes ai room température. Next, the plates were measured on a ViewLux. The half maximal cytotoxic concentration (CC₅o) was also determined, defined as the concentration required to reduce the luminescent signal by 50% compared to that of the cell control wells. Finally, the selectivity index (SI) was determined for the compounds, which was calculated as followed: SI = CC50/EC50·

Table 1 : ECso, CÇ50, and SI for the compounds of the invention in the DENV-2 antiviral assav

compound#	ECso (μΜ)	N	CCso (μΜ)	N	SI	N
1	0.00052	5	5.5	4	11500	4
1A	0.00026	8	4.3	8	19700	8
1B	0.012	6	6.5	6	530	6
2	0.00060	4	5.0	4	8410	4

compound#	EC₅₀ (μΜ)	N	CC50 (μΜ)	N	SI	N __
2A	0.00026	4	4.8	4	22000	4
2B	0.026	4	7.4	4	285	4
3	0.00058	4	>11	6	37700	4
3A	0.00025	5	7.2	5	29800	5
3B	0.0038	3	>9.7	5	2480	3
4	0.00039	4	5.9	4	14900	4
4A	0.00027	11	4.2	13	16900	11
4B	0.036	5	12	5	341	5
5	0.00062	4	5.5	4	8780	4
5A	0.00041	5	5.0	5	12900	5
5B	0.068	4	13	4	206	4
6A	0.000068	8	>25	8	>65500	8
6B	0.019	4	11	4	603	4
7	0.00047	4	3.2	3	>7040	3
7A	0.013	3	6.8	3	538	3
7B	0.00020	5	3.2	5	18500	5
8	0.00013	6	2.9	7	30400	6
8A	0.0030	3	7.4	3	2510	3
8B	0.000069	5	3.4	5	>40900	5
9	0.000074	6	3.1	8	>39100	6
9A	0.000067	9	2.9	9	>37500	9
9B	0.0038	5	6.2	6	1480	5
10A	0.00012	3	2.6	3	22600	3
10B	0.0039	3	9.8	3	2530	3
11A	0.000085	3	2.6	3	30100	3
11B	0.0041	3_______	9.2	3	2220	3_____

N= the number of independent experiments in which the compounds were tested.

-52Tetravalent reverse transcriptase quantitative-PCR (RT-qPCR) assay: Protocol A. The antiviral activity of the compounds of the invention was tested against DENV-1 strain TC974#666 (NCPV; Table 6), DENV-2 strain 16681 (Table 7), 5 DENV-3 strain H87 (NCPV; Table 8) and DENV-4 strains H241 (NCPV; Table 9A) and SG/06K2270DK1/2005 (Eden; Table 9B) in a RT-qPCR assay. Therefore, Vero cells were infected with either DENV-1, or -2, or -3, or -4 in the presence or absence of test compounds. At day 3 post-infection, the cells were lysed and cell lysâtes were used to préparé cDNA of both a viral target (the 3’UTR of DENV;

ίο Table 2) and a cellular reference gene (β-actin, Table 2). Subsequently, a duplex real time PCR was performed on a Lighlcycler480 instrument. The generated Cp value is inversely proportional to the amount of RNA expression of these targets. Inhibition of DENV réplication by test compound results in a shift of Cp’s for the 3’UTR gene. On the other hand, if a test compound is toxic to the cells, a similar is effect on β-actin expression will be observed. The comparative AACp method is used to calculate EC₅o, which is based on the relative gene expression of the target gene (3'UTR) normalized with the cellular housekeeping gene (β-actin).

Table 2: Primera and probes used for the real-time, quantitative RT-PCR.

Primer/probe	Target	Sequence^a’^b
F3utr258	DENV 3’-UTR	5'-CGGTTAGAGGAGACCCCTC-3'
R3utr425	DENV 3'-UTR	5'-GAGACAGCAGGATCTCTGGTC-3'
P3utr343	DENV 3'-UTR	FA M-5'-AAG GACTAG -ZE N- AGGTTA GAG GAGACCCCCC-3'-/A BfcFQ
Factin743	β-actin	5'-GGCCAGGTCATCACCATT-3'
Ractin876	β-actin	5'-ATGTCCACGTCACACTTCATG-3'
Pactin773	β-actin	HEX-5'-TTCCGCTGC-ZE/V-CCTGAGGCTCTC-3'lABkFQ

^a Reporter dyes (FAM, HEX) and quenchers (ZEN and lABkFQ) éléments are indicated in bold and italics.

^b The nucléotide sequence of the primers and probes were selected from the conserved région in the 3’UTR région of the dengue virus genome, based on the alignment of 300 nucléotide sequences of the four dengue serotypes deposited in Genbank (Gong et al., 2013, Methods Mol Biol, Chapter 16).

The culture medium consisted of minimal essential medium supplemented with

2% of heat-inactivated fêtai calf sérum, 0.04% gentamycin (50mg/mL) and 2mM of

L-glutamine. Vero cells, obtained from ECACC, were suspended in culture medium and 75pL/well was added in 96-well plates (10000 cells/well), which aiready contain the antiviral compounds. Typically, these plates contain a 5-fold serial dilution of 9 dilution steps of the test compound at 200 times the final concentration in 100% DMSO (500nL; final concentration range: 25μΜ 0.000064μΜ or 2.5μΜ - 0.0000064μΜ for the most active compounds). In addition, each plate contains wells which are assigned as virus contrais (containing cells and virus in the absence of compound) and cell contrais (containing cells in the absence of virus and compound). Once the cells were îo added in the plates, the plates were incubated in a fully humidified incubator (37°C, 5%CO₂) until the next day. Dengue viruses serotype-1,2, 3 and 4 were diluted in order to obtain a Cp of -22-24 in the assay. Therefore, 25pL of virus suspension was added to ail the wells containing test compound and to the welis assigned as virus control. In parallei, 25pL of culture medium was added to the cell Controls. Next, the plates were incubated for 3 days in a fully humidified incubator (37°C, 5%CO₂). After 3 days, the supernatant was removed from the wells and the ceils were washed twice with ice-cold PBS (-100pL). The cell pellets within the 96-weil plates were stored at -80°C for at least 1 day. Next, RNA was extracted using the Cells-to-CT™ lysis kit, according to the manufacturées guideline (Life Technologies). The cell lysâtes can be stored at -80°C or immediately used in the reverse transcription step.

In préparation of the reverse transcription step, mix A (table 3A) was prepared and 7.57pL/well was dispensed in a 96-well plate. After addition of 5pL of the cell lysâtes, a five minute dénaturation step at 75°C was performed (table 3B).

Afterwards, 7.43pL of mix B was added (table 3C) and the reverse transcription step was initiated (table 3D) to generate cDNA.

Finally, a RT-qPCR mix was prepared, mix C (table 4A), and 22.02 pL/well was dispensed in 96-well LightCycler qPCR plates to which 3pL of cDNA was added and the qPCR was performed according to the conditions in table 4B on a

LightCycler 480.

Using the LightCycler software and an in-house LIMS System, dose response curves for each compound were calculated and the half maximal effective concentration (EC₅₀) and the half maximal cytotoxic concentration (CC₅o) were determined.

Table 3: cDNA synthesis using Mix A, dénaturation, Mix B and reverse transcription.

A Mix A ______________

Plates	8
Sam pies	828		Reaction Vol. (Ml)	20
Mix Item	Concentration	Volume for (Ml)
Unît	Stock	Final	1 sample___	x samples
Milli-Q HjO				7.27	6019.56
R3utr425	μΜ	20	0.27	0.15	124.20
Ractin876	uM	20	0.27	0.15	124.20
	Volume mix/well (μΐ)_________________________	7.57
Cell lysâtes	5.00__

Dénaturation

Step____________	Temp	Time
Dénaturation	75°C	5'
Hold	4°C	hold

G Mix B

Samples	864
Mix Item	Concentration	Volume for (pi) ___
Unit	Stock Final	1 sample	x samples
Expand HIFI buffer 2	X	10.00	1.00	2.00	1728.0
MgCb	mM	25.00	3.50	2.80	2419.2
dNTPs	mM	10.00	1.00	2.00	1728.0
Rnase inhibitor	U/pl	40.00	1.00	0.50	432.0
Expand RT	i U/ul	50.00	0.33	0.13	112.3
	Total Volume Mix (pi)	7.43

-55Protocol cDNA synthesis

Step	Temp	Time
Rev transe	42’C	30’
Dénaturation	99°C	5’
Hold	4°C	hold

Table 4: qPCR mix and protocol.

Samples	833		Reaction Vol. fol)	25
Mix Item	Concentration	Volume for fol)
Unit	Stock	Final	1 sam pie	x samples
H₂O PCR grade Roche				7.74	6447.42
Roche 2xMM mix	X	2	1	12.50	10412.50
F3utr258	μΜ	20	0.3	0.38	316.54
R3utr425	μΜ	20	0.3	0.38	316.54
P3utr343	μΜ	20	0.1	0.13	108.29
Factin743	μΜ	20	0.3	0.38	316.54
Ractin876	μΜ	20	0.3	0.38	316.54
Pactin773	μΜ	20	0.1	0.13	108.29
	Volume Mix / Tube (μΐ)	22.02
cDNA	3.00

Step	Temp	Time	Ramp rate
preincub/denat	95°C	10 min	4.4
Dénaturation	95°C	10 sec	4.4	40 cycles
annealing	58°C	1 min	2.2
Elongation	72°C	1 sec	4.4
Cooling	40°G	10 sec	1.5

Tetravalent quantitative reverse transcnptase-PCR (RT-qPCR) assay: Protocol B.

The antivira! activity of the compounds of the invention was tested against

DENV-1 strain Djibouti strain (D1/H/IMTSSA/98/606; Table 6), DENV-2 strain

-56NGC (Table 7), DENV-3 strain H87 (Table 8) and DENV-4 strain SG/06K2270DK1/2005 (Table 9B) in a RT-qPCR assay. Vero-B or Vero-M cells (5 * 10⁴) were seeded in 96-well plates. One day later, culture medium was replaced with 100 pL assay medium containing a 2*, 3* or 5* serial dilution of the 5 compound (concentration range: 50 pg/mL - 0.00038 pg/mL, 50 pg/mL 0.0076 pg/mL, and 50 pg/mL - 0.00013 pg/mL, respectively) and 100 pL of dengue virus inoculum (DENV). Following a 2 hour incubation period, the cell monolayer was washed 3 times with assay medium to remove residual, nonadsorbed virus and cultures were further incubated for either 4 days (DENV-2 îo NGC) or 7 days (DENV-1 Djibouti strain D1/H/IMTSSA/98/606, DENV-3 strain H87 prototype, DENV-4 strain H241 ,and DENV-4 strain EDEN) in the presence ofthe inhibitor. Supernatant was harvested and viral RNA load was determined by realtime quantitative RT-PCR. The 50% effective concentration (ECso), which is defined as the compound concentration that is required to inhibit viral RNA réplication by 50%, was determined using logarithmic interpolation.

RNA was isolated from 100 pL (or in some circumstances 150 pL) supernatant with the NucleoSpin 96 Virus kit (Filter Service, Düren, Germany) as described by the manufacturer. The sequences of the TaqMan primers (DENV-For, DENV-Rev; Table 5) and TaqMan probes (DENV-Probe Table 5) were selected from non20 structural gene 3 (NS3) or NS5, ofthe respective flaviviruses using Primer Express software (version 2.0; Applied Biosystems, Lennik, Belgium). The TaqMan probe was fluorescently labelled with 6-carboxyfluorescein (FAM) at the 5’ end as the reporter dye, and with minor groove binder (MGB) at the 3’ end as the quencher (Table 5). One-step, quantitative RT-PCR was performed in a total volume of 25 pL, containing 13.9375 pL H₂O, 6.25 pL master mix (Eurogentec, Seraing, Belgium), 0.375 pLforward primer, 0.375 pL reverse primer, 1 pL probe, 0.0625 pL reverse transcriptase (Eurogentec) and 3 pL sample. RT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Branchburg, New Jersey, USA) using the following conditions: 30 min at 48 °C and 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C.

The data was analyzed using the ABI PRISM 7500 SDS software (version 1.3.1 ;

Applied Biosystems). Forabsolute quantification, standard curves were generated using 10-fold dilutions of template préparations of known concentrations.

-57Table 5: Primers and probes used for real-time, quantitative RT-PCR.

Primer/Probe	Sequence (5* —> 3’)^a	Source ^b	Target
DENV-For	TCGGAGCCGGAGTTTACAAA (SEQ ID N.1)	DENV 2 NGC	NS3
DENV-Rev	TCTTAACGTCCGCCCATGAT (SEQ ID N.2)
DENV-Probe	FAM-ATTCCACACAATGTGGCAT-MGfi (SEQ ID N.3)
DenS	GGATAGACCAGAGATCCTGCTGT (SEQ ID N.4)	DENV-1, -3, -4	NS5
DenAS1-3	CATTCCATTTTCTGGCGTTC (SEQ ID N.5)	DENV-1, -3
DenAS4	CAATCCATCTTGCGGCGCTC (SEQ ID N.6)	DENV-4
DEN_1-3 probe	FA/W-CAGCATCATTCCAGGCACAG-MGB (SEQ ID N.7)	DENV-1, -3
DEN_4 probe	FA/W-CAACATCAATCCAGGCACAG-MG8 (SEQ ID ____N.8)_________________________	□ ENV-4

^a Reporter dye (FAM) and quencher (MGB/TAMRA) eiements are indîcated in bold and italics.

^b The nucléotide sequence and position of the primers and probes within the genome were deduced from the nucléotide sequence of DENV 2 NGC (GenBank accession no. M29095; Irie et al., 1989), dengue virus serotype 1 Djibouti strain D1/H/IMTSSA98/606 (Genbank Accession Number AF298808), dengue virus serotype 3 strain H87 prototype (c93130), dengue virus serotype 4 strain H241 (no sequences availabie), dengue virus serotype 4 strain EDEN (no sequences availabie)

Cytotoxic âssay

Potential cytotoxic effects of the compounds were evaluated in uninfected quiescent Vera-B or Vero-M cells. Cells were seeded at 5 * 10⁴ cells/well in a 96well plate in the présence of two-, three- or five-fold serial dilutions (ranging from

50 pg/mL - 0.0038 pg/mL, 50 pg/mL - 0.0076 pg/mL, and 50 pg/mL 0.00013 pg/mL, respectively) of compound and incubated for 4 to 7 days. Culture medium was discarded and 100 pL 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium/phenazinemethosulfate (MTS/PMS; Promega, Leiden, The Netherlands) in PBS was added to each well.

Following a 2-hour incubation period at 37 °C, the opfical density was determined at 498 nm. Cytotoxic activity was calculated using the following formula: % cell viability = 100 χ (OD_COmpound/ODcc), where OD_Compound and OD_CC correspond tothe optical density at 498 nm of the uninfected cell cultures treated with compound and that of uninfected, untreated cell cultures, respectively. The 50% cytotoxic concentration (i.e., the concentration that reduces the total cell number with 50%; CC50) was calculated using linear interpolation.

-58Table 6: EC_m. CCsn, and SI for the compounds against serotype 1 in the RT-gPCR assays

-59Table 7: ECm, CC50, and SI for the compounds against serotype 2 in the RT-qPCR assays

-60Table 8: EC₅q, CCab and SI for the compounds against serotype 3 in the RT-gPCR assays

_______________Protocol B____________________________	RT-qPCR serotype 3 H87	Z w	Λ Λ Λ Λ
CC50 (μΜ) N	- F»i^ CcnQrncMSjQQOOO cg r- S σί _Λ H S H 2 2*
EC50 (μΜ) N	la tf _N ·7Τ V V V v
Protocol A	RT-qPCR serotype 3 H87 _____	z ω	uArCrn^^JrnçOrA'—frorc _ Q d^^LA^OOOCh'sf-Orr} H -J “ r- ^ N ω V Μ N Λ
1 CC50 (uM) N	r'-ro^w'e^iqT-juoo^ mrfrirôsridv-iiRT-ii-i'^
EC50 (pM) N	Γ^Ό-ΦίΟ^^πιΌοηΟηΟ SSSSSo⁰⁰⁰⁰⁰ HHHHHHOOOOC¹OOOOOQqqqqq
	com pound#	<<<<<<CQÇQ<g2 ^Hr'jOOoikar-'COcn^^

Ό <D Ç

E

Φ ω Ό

O C

Q Z

Table 9: EC^o, CC50, and SI for the compounds aqainst serotype 4 in the RTqPCR assays

A ____________________

	Protocol A
RT-qPCR serotype	4 H241
	EC50		CC50
compound#	(pM)	N	(pM)	N	SI	N
IA	0.093	10	3.0	9	30	9
2A	0.083	6	3.7	6	42	6
3A	0.11	6	3.8	4	37	4
4A	0.053	11	2.5	11	54	11
5A	0.10	6	4.0	6	39	6
6A	0.095	7	7.7	5	69	5
7B	0.044	5	2.2	5	53	5
8B	0.015	5	1.7	3	122	3
9A	0.012	5	1.5	5	121	5
10A	0.011	3	1.6	2	127	2
1 HA	0.011 _	3	3.1	3	>250	3

N= the number of independent experiments in which the compounds were 5 tested.

B

	Protocol A
RT-qPCR serotype	4 EDEN
compound#	EC50 (pM)	N	CC50 (PM)	N	SI	N
1A	0.0024	5	4.6	5	1927	5
2A	0.0013	2	5.0	2	3913	2
3A	0.0030	2	5.4	2	1802	2
4A	0.00055	2	> 2.5	1	> 4520	1
5A	0.0029	2	5.5	2	1878	2
6A	0.00042	2	> 10	2	> 24085	2

N= the number of independent experiments in which the compounds were tested.

-62Claims

Claims

A compound of formula (I) h₃co o.

a stereo-isomeric form, a pharmaceutically acceptable sait, solvaté or polymorph thereof comprising a mono- or di-substituted indole group; said compound is selected from the group wherein:

Ri is H, R2 is F and R3 is H or CH3,

Ri is H, CH3 or F, R₂ is OCH3 and R3 is H and

Ri is H, R2 is OCH3 and R3 is CH3,

Ri is CH3, R2 is F and R3 is H,

Ri is CF3 or OCF3, R2 is H and R3 is H,

Ri is OCF3, R2 is OCH3 and R3 is H and

Ri is OCF3, R2 is H and R3 is CH3.
2. A compound or its stereo-isomeric form, a pharmaceutically acceptable sait, solvaté or polymorph thereof according to claim 1 wherein said compound is selected from the group:

MeO

o.

MeO O,
3. A compound of formula 9

or its stereo-isomeric form, a pharmaceutically acceptable sait, solvaté or polymorph thereof.
4. A compound, a pharmaceutically acceptable sait, solvaté or polymorph thereof according to any one of daims 1 to 3, wherein said compound is: Enantiomer 9A, wherein ¹H NMR (400 MHz, DMSO-de) δ ppm 3.09 (s, 3 H) 3.73 (s, 3 H) 3.99 (s, 3 H)

6.26 (d, 4=7.9 Hz, 1 H) 6.55 -6.62 (m, 2 H) 6.91 (t, 4=1.5 Hz, 1 H) 6.98 (dd,

4=8.4, 2.0 Hz, 1 H) 7.07 (d, J=7.9 Hz, 1 H) 7.13 (d, 4=2.0 Hz, 1 H) 7.21 (dd,

4=8.8, 1.8 Hz, 1 H) 7.36 (d, 4=8.4 Hz, 1 H) 7.59 (d, 4=8.8 Hz, 1 H) 8.07 (d,

4=0.9 Hz, 1 H) 8.55 (s, 1 H) 12.29 (br s, 1 H) LC/MS (method LC-A): Rt 1.20 min, MH⁺ 583 [a]_D ²⁰: +130.3° (c 0.555, DMF)

Chiral SFC (method SFC-E): Rt 3.10 min, MH⁺ 583, chiral purity 100%.
5. A compound, a pharmaceutically acceptable sait, solvaté or polymorph thereof according to any one of daims 1 to 3, wherein said compound is: Enantiomer 9B, wherein ¹H NMR (400 MHz, DMSO-cfe) δ ppm 3.09 (s, 3 H) 3.73 (s, 3 H) 3.99 (s,3 H)

6.26 (d, 4=7.9 Hz, 1 H) 6.56 - 6.62 (m, 2 H) 6.92 (t, 4=2.0 Hz, 1 H) 6.98(dd,

4=8.1, 2.0 Hz, 1 H) 7.07 (d, 4=7.9 Hz, 1 H) 7.13 (d, 4=2.0 Hz, 1 H) 7.22(dd,

4=8.8, 18 Hz, 1 H) 7.36 (d, 4=8.4 Hz, 1 H) 7.59 (d, 4=8.8 Hz, 1 H) 8.07(d,

4=0.9 Hz, 1 H) 8.55 (s, 1 H) 12.30 (br s, 1 H) LC/MS (method LC-A): Rt 1.20 min, MH⁺ 583 [a]D²⁰: -133.2° (c 0.5, DMF)

Chiral SFC (method SFC-E): Rt 3.50 min, MH⁺ 583, chiral purity 100%.
6. A compound, a pharmaceutically acceptable sait, or solvaté thereof according to any one of daims 1 to 5, wherein said compound is in a crystalline form.
7. A compound, a pharmaceutically acceptable sait, or solvaté thereof according to any one of daims 1 to 5, wherein said compound is in an amorphous form.
8. A compound, a pharmaceutically acceptable sait, or solvaté thereof according to any one of daims 1 to 7, wherein said compound is in an un-solvated form.
9. A pharmaceutical composition comprising a compound according to any one of daims 1 to 8 or a stéréo- isomeric form, a pharmaceutically acceptable sait, solvaté or polymorph thereof together with one or more pharmaceutically acceptable excipients, diluents or carriers.
10. A compound according to any one of daims 1 to 8 or a stéréo- isomeric form, a pharmaceutically acceptable sait, solvaté or polymorph thereof or a pharmaceutical composition according to daim 9 for use as a médicament.
11. A compound according to any one of daims 1 to 8 or a stéréo- isomeric form, a pharmaceutically acceptable sait, solvaté or polymorph thereof or a pharmaceutical composition according to daim 9 for use in the treatment of dengue.
12. A use of a compound represented by the following structural formula (I) a stereo-isomeric form, a pharmaceutically acceptable sait, solvaté or polymorph thereof comprising a mono- or di-substituted indole group; said compound is selected from the group wherein:

Ri is H, R2 is F and R3 is H or CH3,

Ri is H, CH3 or F, R2 is OCH3 and R3 is H and

Ri is H, R2 is OCH3 and R3 is CH3,

Ri is CH3, R2 is F and R3 is H,

-66Ri is CF₃ or OCFs, R2 is H and R3 is H,

Ri is OCF3, R2 is OCH3 and R3 is H and

Ri is OCF3, R2 is H and R3 is CH3 in the manufacture of a médicament for inhibiting the réplication of dengue virus(es) in a patient.
13. The use of a compound according to claim 12 further comprising an additional therapeutic agent.
14. The use ofclaim 13 wherein said additional therapeutic agent is selected from an antiviral agent or dengue vaccine, or both.
15. A use of a compound represented by the following structural formula (I) a stereo-isomeric form, a pharmaceutically acceptable sait, solvaté or polymorph thereof comprising a mono- or di-substituted indole group; said compound is selected from the group wherein:

Ri is H, R2 îs F and R3 is H or CH₃,

Ri is H, CH₃ or F, R2 is OCH3 and R₃ is H and

Ri is H, R2 is OCH3 and R3 is CH3,

Ri is CH₃, R2 is F and R3 is H,

Ri is CF3 or OCF3, R2 is H and R₃ is H,

Ri is OCF₃, R2 is OCH3 and R₃ is H and

Ri is OCF3, R2 is H and R3 is CH3 for inhibiting the réplication of dengue virus(es) in a biological sample.
16. The use according to any one ofclaims 12-15, wherein said compound is Compound 9:

or its stereo-isomeric form, a pharmaceutically acceptable sait, solvaté or polymorph thereof.
17. The use according to any one of daims 12-15, wherein said compound is: Enantiomer 9A, wherein ¹H NMR (400 MHz, DMSO-d₆) 5 ppm 3.09 (s, 3 H) 3.73 (s, 3 H) 3.99 (s,3 H)

6.26 (d, J=7.9 Hz, 1 H) 6.55-6.62 (m, 2 H) 6.91 (t, J=1.5 Hz, 1 H) 6.98(dd,

J=8.4, 2.0 Hz, 1 H) 7.07 (d, J=7.9 Hz, 1 H) 7.13 (d, J=2.Q Hz, 1 H) 7.21(dd,

J=8.8, 1.8 Hz, 1 H) 7.36 (d, J=8.4 Hz, 1 H) 7.59 (d, J-8.8 Hz, 1 H) 8.07(d,

J=0.9 Hz, 1 H) 8.55 (s, 1 H) 12.29 (br s, 1 H) LC/MS (method LC-A): Rt 1.20 min, MH⁺ 583 [a]_D ²⁰: +130.3° (c 0.555, DMF)

Chiral SFC (method SFC-E): Rt 3.10 min, MH⁺ 583, chiral purity 100%.
18. The use according to any one of daims 12-15, wherein said compound is: Enantiomer 9B, wherein ïH NMR (400 MHz, DMSO-d₆) δ ppm 3.09 (s, 3 H) 3.73 (s, 3 H) 3.99 (s, 3 H) 6.26 (d, J=7.9 Hz, 1 H) 6.56 - 6.62 (m, 2 H) 6.92 (t, J-2.0 Hz, 1 H) 6.98 (dd, J=8.1, 2.0 Hz, 1 H) 7.07 (d, J=7.9 Hz, 1 H) 7.13 (d, J=2.0 Hz, 1 H) 7.22 (dd, J=8.8, 1.8 Hz, 1 H) 7.36 (d, J=8.4 Hz, 1 H) 7.59 (d, J=8.8 Hz, 1 H) 8.07 (d, J=0.9 Hz, 1 H) 8.55 (s, 1 H) 12.30 (br s, 1 H) LC/MS (method LC-A): Rt 1.20 min, MH⁺ 583 [a]_D ²⁰: -133.2° (c 0.5, DMF)

Chiral SFC (method SFC-E): Rt 3.50 min, MH⁺ 583, chiral purity 100%.
19. The use according to any one of daims 12 to 18, wherein said compound is in a crystalline form.
20. The use according to any one of daims 12 to 18, wherein said compound is in an amorphous form.
21. The use according to any one of daims 12 to 20, wherein said compound is in an un-solvated form.