OA18875A - Conjugate of finasteride with peptide - Google Patents

Abstract

The present invention relates to a composition for preventing hair loss and, more specifically, to a compound having a structure in which finasteride and a peptide are linked through a covalent bond and a pharmaceutical composition or a cosmetic composition for preventing hair loss or promoting hair growth comprising the same. The compound of the present invention having a structure in which finasteride and a peptide are linked through a covalent bond is excellent in physiological activities such as hair loss improvement, hair growth promotion, cell growth promotion, etc., is excellent in stability in water and skin permeation, and thus can be effectively used as a composition for preventing hair loss and promoting hair growth.

Description

CONJUGATE OF FINASTERIDE WITH PEPTIDE

TECHNICAL FIELD

The présent invention relates to a compound having a structure conjugating finasterîde and peptide with a covalent bond, and its use for preventing hair loss or promoting hair growth.

BACKGROUND ART

Hair follicle is an organ unique to mammalian skin. The hair follicle is a down10 growth of the primitive epidermis, extending into deeper layers of the skin. At the base of the hair follicle résides a plug of cells known as the follicular or dermal papilla. The papilla is essential in normal cycle of the hair follicle and in growth of the haïr shaft. The hair shaft is a thread-shaped structure made of tightly cohérent épithélial cells filled with keratin filaments and filament aggregating proteins.

Human hair periodically repeats the cycle of anagen, categen and telogen phases, and goes through the process of hair fall and régénération. The hair growth cycle is regulated by hormones or many growth factors. Severe stress or malnutrition may advance the catagen and telogen phases, leading to severe hair loss.

Hair falling out from the scalp îs called hair loss. Hair loss may be caused by 20 various factors including environmental factors such as exposure to weather, light or heat.

etc., and internai factors such as diseases, child bîrth, hormonal sécrétion and change, intake of drugs, nutritive conditions, etc. 5-alpha reductase is a main hormone intervening with the hair loss mechanism (Korean Patent Laid-Open No. 10-2008-0077762). 5-alpha reductase is an enzyme increasing sébum sécrétion by converting testosterone which is a type of androgen into dihydrotestosterone (DHT). Among the various products for preventing hair loss and promoting hair growth in the hair loss market, there are many products aiming at inhibiting the effect of the 5-alpha reductase. Hair loss may also be caused by malnutrition, dry scalp, stress, etc., in addition to enzymatîc reactions (Eunju Ryu, et al., The Journal of Korean Society of Design Culture, 18(2), p. 89-100, 2012). In case of hair loss due to these reasons, hair loss may be prevented and hair growth may be promoted by supplying sufficient nutrition, performing scalp treatment and intaking or administering antioxidant substances.

Regardless of its cause, in the end, hair loss may resuit in exercising a great mental, social and sexual influence, together with loss of pride and self-esteem. In order to treat haîr loss, until now, various substances were used as drugs. but they had disadvantages that they were too expensive or they showed a great individual différence in effect. In addition, as for cosmetic products, plant extracts which are cheaper but hâve a lower effect has been used, but the effect was insignificant.

Treatments and solutions for hair loss hâve remarkably changed over a long period of time. It became possible to hide baldness with wigs, partial wigs and hair extension, but this could not create new hair. Also, the two available drugs (minoxidil and finasteride) known up to date could delay additional hair loss, but could not be actually used for the purpose of inducing the régénération of hair fol lie le. Also, as hair cosmetic products, many hair loss prévention products using plant extracts, etc. hâve been developed, but it has been difficult to find products that hâve an effect on generating new hair growth.

Varions factors are linked together in the progress of hair growth and degeneration. For example, there hâve been many reports using a sériés of growth factors for promoting kératinocyte growth factors, promoting the activity of vascular endothélial growth factors, and promoting the growth of hair by inhibiting the activity of BMP type proteins. However, although such growth factors show excellent effects, an additional process of refolding and more time are required to obtain natural growth factors, and a complex purifying process for removing the pollution source originated from colon bacîllus is required in the purification process. Also, due to its stability and high molecular weight, it could not easily surpass the protective coat of hair, and thus this together with its expensive cost deteriorated its usage.

Also, there is a method which prevents the thinning of hair and makes thinned hair thick again by the antagonism of finasteride against 5a-reductase based on the action of finasteride to androgens. As a représentative example, there is Propecia (Merck U.S.A.) which was approved for its effect and stability by the U.S. Food and Drug Administration (FDA) on December I997 as the first edible hair loss treatment and entered the market as a hair loss treatment the following year. Finasteride is a drug that inhibits 5a-reductase enzyme which converts testosterone, a type of androgen, into DHT causing hair loss. As

DHT génération is inhibited by taking the drug, it plays the rôle of making thinned bald hair thick and long again. However, it takes months for fïnasterîde to exert the effect of preventing hair loss. Also, as for women, there is a high possîbilîty of congénital deformity to occur in the fétus when taking drugs, and as for men, there are fear of side effects such as loss of libido, erectile dysfonction, éjaculation disorder, etc., and pressure that the effect of preventing hair loss can be maintained only when taking the drugs for a lifetime. Thus, there are a lot of limitations for actual clinical use (Korean Patent Laid-Open No. 10-20120I20912).

In this regard, the présent inventors developed Nokkin peptide (Korean Patent LaidOpen No. 10-2010-0085407) composed of amîno acid sequence of SEQ ID No. 3, Keramin2 peptide (Korean Patent Laid-Open No. 10-2009- 0108323) composed of amino acid sequence of SEQ ID No. 2. and WINT peptide (Korean Patent Laid-Open No. 10-2011-0023991) composed of amino acid sequence of SEQ ID No. 1 as peptides that hâve more excellent stability than natural growth factors and may improve the problems caused by the large molecular weight of natural growth factors while having fonctions or effects the same as or similar to natural growth factors. However, the conventîonally used finasteride or peptides composed of amino acid sequences SEQ ID Nos. 1 to 3 still need to be improved in the aspects of improving the effect of preventing hair loss and promoting hair growth, reducing side effects and increasing solubility in water.

DETAILED DESCRIPTION OF INVENTION

TECHNICALTASK

The présent invention aims to improve the problems of the conventional haïr growth solution. It is the technica! task of the présent invention to provide a substance for preventing hair loss and/or promoting haïr growth that has the same or more excellent functions as compared with the conventional hair growth solutions such as natural growth factors or peptides composed of amino acid sequences of SEQ ID Nos. I to 3 or finesteride, and has excellent physiological properties such as skin permeability and stability in water.

TECHNICAL MEANS FOR ACHIEVING TECHNICAL TESK

In order to achieve the above technical task, the présent invention provides a compound having a structure conjugating finasteride and peptide with a covalent bond.

According to an embodiment of the présent invention, the peptide may be composed of 2 to 30 amino acids, preferably 5 to 20 amino acids, more preferably 8 to 15 amino acids, and more preferably 10 to 12 amino acids, but is not limited thereto.

According to an embodiment of the présent invention, preferably, the peptide is a water soluble peptide, but is not limited thereto. According to a préférable embodiment of the présent invention, the water soluble peptide has at least 50%, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, and most preferably 100% of the amino acid having a hydrophilic side chain, and thus ît is préférable to be high. According to an embodiment of the présent invention, the amino acid having a hydrophilic side chain may be an amino acid with an electric charge, for example, arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp) or glutamic acid (Glu), but is not limited thereto, According to an embodiment of the présent invention, the water soluble 5 peptide may comprise at least 3 amino acids with an electric charge, preferably at least 5 amino acids with an electric charge, and more preferably at least 7 amino acids with an electric charge, but is not limited thereto.

According to a préférable embodiment of the présent invention, the water soluble peptide has five or less amino acids having a hydrophobie side chain, preferably four or less, 10 more preferably three or less, more preferably two or less, more preferably one or less, and most preferably no amino acid having a hydrophilic side chain.

According to an embodiment of the présent invention, the peptide may be a Nokkin peptide composed of an amino acid sequence of SEQ ID No. I, a Keramin2 peptide composed of an amino acid sequence of SEQ ID No. 2, or a WINT peptide composed of an 15 amino acid sequence of SEQ ID No. 3, but is not limited thereto.

Also, the présent invention provides a pharmaceutical composition for preventing haïr loss or promoting hair growth comprising any one of the compounds disclosed in the above.

Also, the présent invention provides a cosmetic composition for preventing haïr loss 20 or promoting hair growth comprising any one of the compounds disclosed in the above.

According to an embodiment of the présent invention, the cosmetic composition may hâve a formulation such as softening lotion, milk lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, powder, hair tonie, hear cream, lair lotion, haïr shampoo, hair rinse, hair conditioner, haïr spray, haïr aérosol, pomade, solgel, émulsion, oil, wax and aérosol, but is not limited thereto.

ADVANTAGEOUS EFFECT

The compound of the présent invention having a structure conjugating finasteride and peptide with a covalent bond not only has excellent physîological activities such as preventing hair loss, promoting hair growth, promoting cell growth, etc., but also has excellent stability in water and skin permeability, and thus can be usefully used as a composition for preventing hair loss and promoting haïr growth.

BRIEF DESCRIPTION OF DRAWINGS

Fig. I is a photograph showing the solubilîty of the compound of the présent invention and finasteride in water.

Figs. 2a and 2b are graphs showing the eflfect of the compound of the présent invention and finasteride on 5a reductase activity. Figs. 2a and 2b respectively show the relative concentration of DHT and testosterone after treatment with the compound of the présent invention and finasteride.

Fig. 3a is an immunostaining photograph showing the shape and number of kératinocytes after treatment with the compound of the présent invention and finasteride, and Fig. 3b is a graph showing the relative number of kératinocytes according to the concentration of the compound treated.

Fig. 4a is an immunostaining photograph showing the shape and number of human haïr dermai papîlla cells (HHDPC) after treatment with the compound of the présent invention and finasteride, and Fig. 4b is a graph showing the relative number of kératinocytes according to the concentration of the compound treated.

Fig. 5a is a Western blot photograph showing the translocation of beta-catenin into nucléus in HHDPC cells after treatment with the compound of the présent invention and finasteride, and Fig. 5b is a graph converting this into relative ntimerical values with respect to the négative control.

Fig. 6a is a Western blot photograph showing the expression of phospho-Smadl/5/8 in HHDPC cells after treatment with the compound of the présent invention and finasteride, and Fig. 6b is a graph converting this into relative numerical values with respect to BMP2.

Fig. 7a îs an electrophoretic photograph showing the expression of DKK-l mRNA in HHDPC cells after treatment with the compound of the présent invention and finasteride, and Fig. 7b is a graph converting this into relative numerical values with respect to the négative control.

Figs. 8a and 8b are photographs confirming the effect of the compound of the présent invention on haïr growth through animal tests. Fig. 8a compares the growth rate of mice hair applîed with finasteride and the compound of the présent invention, and Fig. 8b confirms the number of hair follicle by H&E staining of the hair of the back skin of mice applied with finasteride and the compound of the présent invention with H&E.

Figs. 9a and 9b are graphs showing the skin permeability test resuit of the compound of the présent invention.

BEST MODE FOR CARRYING OUT THE INVENTION

In order to achieve the technical task, the présent invention provides a compound 10 having a structure conjugating finasteride and peptide with a covalent bond.

The finasteride is N-(l,l-dimethylethyl)-3-oxo-(5a, l7p)-4-azaandrost-l-ene-l7carboxamide, and has a formula represented by the following formula I.

[Formula l]

In the présent invention, the term “peptide” means a linear molécule formed via peptide bond of the amino acid residues. The peptide may be prepared by biological or

Chemical synthesis methods generally known in the art, in particular by solid-phase synthesis

ΙΟ techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pîerce Chem. Co.: Rockford, 111(1984)).

The peptide is to increase the water solubîlîty of finasteride. In this aspect, preferably, the peptide is a water soluble peptide, but is not limited thereto. According to an embodiment of the présent invention, the peptide may be composed of 2 to 30 amino acids, preferably 5 to 20 amino acids, more preferably 8 to 15 amino acids, and more preferably 10 to 12 amino acids. According to a préférable embodiment of the présent invention, the peptide has at least 50%, preferably at least 60%, more preferably at least 70%, more preferably at least 80%. more preferably at least 90%, and most preferably 100% of the amino acid having a hydrophilic side chain, and thus it is préférable to be high. On the other hand, the peptide has 50% or less, preferably 40% or less, more preferably 30% or less, more preferably 20% or less, more preferably 10% or less, and most preferably 0% of the amino acid having a hydrophobie side chain, and thus it is préférable to be low. In the présent invention, “amino acid having a hydrophilic side chain” refers to arginine (Arg), histidine (His), lysine (Lys), aspartîc acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gin), cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro), and “amino acid having a hydrophobie side chain” refers to alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), méthionine (Met), phenylalantne (Phe), tyrosine (Tyr) and tryptophane (Trp), but is not limited thereto. In addition to the amino acids présent in the natural world, variants thereof may be used without limitation. According to

H an embodiment of the présent invention, the amino acid having a hydrophilic side chain is preferably an amino acid with an electric charge, such as arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp) or glutamic acid (Glu), but is not limited thereto. According to an embodiment of the présent invention, the water soluble peptide may comprise at least 3 amino acids with an electric charge, preferably at least 5 amino acids with an electric charge, and more preferably at least 7 amino acids with an electric charge, but is not limited thereto.

According to a préférable embodiment of the présent invention, the peptide comprises five or iess, preferably four or less, more preferably three or less, more preferably two or less, more preferably one or less, and most preferably no amino acid having a hydrophobie side chain. According to an embodiment of the présent invention, the peptide may be a Nokkin peptide composed of an amino acid sequence of SEQ ID No. I, a Keramin2 peptide composed of an amino acid sequence of SEQ ID No. 2, or a WINT peptide composed of an amino acid sequence of SEQ ID No. 3, but is not limited thereto.

According to an embodiment of the présent invention, the compound of the présent invention has the function of promoting growth of kératinocytes and HHDPC cells. According to an embodiment of the présent invention, the compound of the présent invention has the function of activating the WNT signaling pathway. According to an embodiment of the présent invention, the compound of the présent invention translocates beta-catenin into the nucléus.

The compound of the présent invention has excellent stability by itself, but its stabîlity may be further improved by modifying any amino acid composing the peptide conjugated to the compound. According to an embodiment of the présent invention, the Ntcrminal of the peptide may be conjugated with a protecting group selected from the group consisting of an acetyl group, fluorenyl methoxy carbonyï group, formyl group, palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG), to further improve the stability. According to an embodiment of the présent invention, the peptide may be conjugated with a protecting group selected from the group consisting of an acetyl group, fluorenyl methoxy carbonyï group, formyl group, palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG), to further improve the stability.

The modification of amino acid as mentioned above greatly împroves the stability of the compound of the présent invention. In the présent invention, the term “stability” is used to encompass not only “in vivo” stability, but also “in vitro” stability such as storage stability (e.g„ storage stability at room température). Also, the protecting group mentioned in the above protects the compound of the présent invention from in vivo and in vitro attack of the proteolytic enzyme.

Also, the présent invention provides a composition for treating or improving haïr loss comprising the compound as an active ingrédient. According to an embodiment of the présent invention, the présent invention provides a composition for improving skin condition comprising the peptide as an active ingrédient, in the présent invention, the composition may be in the form of a pharmaceutîcal composition or a health food, but is not limited thereto.

Since the composition of the présent invention comprises the compound of the présent invention as an active ingrédient, common descriptions between them are omitted in 5 order to avoid undue redundancy leading to the complexity of the spécification.

According to an embodiment of the présent invention, treating or improving haïr loss by the compound of the présent invention is promoting hair growth or growing hair. According to a préférable embodiment of the présent invention, the compound of the présent invention has the ability to promote the growth of kératinocytes and HHDPC cells, and

I0 promote the beta-catenin signaiing pathway, which is a représentative signaling pathway of WNT protein. Through animal tests carried out based on the results, it can be found that the compound of the présent invention remarkably promotes hair growth. Thus, the composition of the présent invention is very effective in improving hair growth and skin condition.

Also, according to an embodiment of the présent invention, improving skin condition by the compound of the présent invention includes improving wrinkles, improving skin elasticity, preventing skin aging, improving skin moîsturizatîon, removing scars or regenerating skin.

Since the composition of the présent invention comprises the compound of the présent invention as an active ingrédient, common descriptions between them are omitted in order to avoid undue redundancy leading to the complexity of the spécification.

According to a préférable embodiment of the présent invention, the composition of the présent invention is a pharmaceutical composition comprising (a) a pharmaceuticaily effective amount of the compound of the présent invention; and (b) a pharmaceuticaily 5 acceptable carrier.

In the présent spécification, the term “pharmaceuticaily effective amount” means an amount sufficient to achieve the efficacy or activity of the compound of the présent invention.

The pharmaceuticaily acceptable carrier of the pharmaceutical composition of the présent invention which is generally used for préparation may include lactose, dextrose, 10 sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnésium stéarate and minerai oil, but ts not limited thereto. In addition to the above ingrédients, the pharmaceutical composition of the présent invention may further include a lubricant, wetting

I5 agent, sweetener, flavoring agent, emulsifier, suspending agent, preservative, etc. Suitable pharmaceuticaily acceptable carriers and préparations are described in detail in Remington’s Pharmaceutical Sciences (I9th ed., 1995).

The pharmaceutical composition of the présent invention may be prepared in a unit dosage or multiple dosage form usîng a pharmaceuticaily acceptable carrier and/or excipient 20 according to a method that may be easily carried out by a person having ordînary skill in the

I5 art. In this case, the formulation may be in the form of a solution in oily or aqueous medium, suspension or émulsion, or may be in the form of an extract, powder, granule, tablet, capsule or gel (e.g., hydrogel), and may further include a dispersant or a stabilizer.

The pharmaceutical composition according to the présent invention may be administered orally or parenterally in clinical administration and may be used in general forms of pharmaceutical préparations. That is, the pharmaceutical composition of the present invention may be administered in various oral and parentéral dosage forms during actual clinical administration. When being fbrmulated, a diluent or excipient such as a filler, thickening agent, binder, wetting agent, disintergrant, surfactant, etc. generally used may be used. Solid préparations for oral administration include tablets, pills, powder, granules, capsules, etc., and such soiîd préparations are prepared by mixing at least one excipients such as starch, calcium carbonate, sucrose or lactose, geiatin, etc. with an herbal extract or herbal fermented product. Also, in addition to simple excipients, lubricants such as magnésium stéarate or talc may be used. Liquid préparations for oral administration include suspensions, solutions, émulsions, syrup, etc., and may include various excipients such as wetting agents, flavoring agents, aromatics, preservatives, etc., in addition to water and liquid paraffin, which are frequently used simple diluents. Préparations for parentéral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, émulsions, freeze-dried préparations, and supposîtories. As non-aqueous solvents or suspensions, propylene glycol, polyethylene glycol, plant oils such as olive oil, injectable

I6 esters such as ethyl oleate, etc. may be used. As the base of suppositories, witepsol, Macrogol, Tween 61, cacao butter, laurïn fat. glycerol, gelatin, etc. may be used.

The unit dosage form may contain, for example, l, 2, 3 or 4 individual doses or l/2, l/3 or l/4 of an individual dose. An individual dose contains the amount of active drug which is administered in one application and this usually corresponds to a whole, l/2, l/3 or l/4 of a daily dose.

The pharmaceutical composition of the présent invention may be prepared in a unit dosage or multiple dosage form using a pharmaceutically acceptable carrier and/or excipient according to a method that may be easily carried out by a person having ordinary skill in the art. In this case, the formulation may be in the form of a solution in oily or aqueous medium, suspension or émulsion, or may be in the form of an extract, powder, granule, tablet, capsule or gel (e.g., hydrogel), and may further include a dispersant or a stabilizer.

According to a préférable embodiment of the présent invention, the composition of the présent invention is a cosmetic composition comprising (a) a cosmetically effective amount of the compound of the présent invention; and (b) a cosmetically acceptable carrier.

In the présent spécification, the term “'cosmetically effective amount” means an amount sufficient to achieve the efficacy of improving skin of the composition of the présent invention.

The cosmetic composition of the présent invention may be prepared în any formulation generally prepared in the art. For example, it may be formulated into a solution,

I7 suspension, émulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder Foundation, émulsion Foundation, wax Foundation and spray, etc., but is not limited thereto. More specifically, it may be prepared in various Forms such as skin lotion, milk lotion, nourîshing cream, massage cream, essence, eye cream. cleansing cream, cleansing Foam, cleansing water, pack, spray, powder, hair tonie, hear cream, hair lotion, hair shampoo, hair rinse, hair conditioner, hair spray, hair aérosol, pomade, solution such as gel, etc., solgel, émulsion, oil, wax, aérosol, etc., but is not limited thereto.

When the Formulation oF the présent invention is paste, cream or gel, animal oil, vegetable oil, wax, parafFin, starch, tragacanth, cellulose dérivative, polyethylene glycol, Silicon, bentonite, silica, talc or zinc oxide, etc. may be used as a carrier ingrédient.

When the Formulation oFthe présent invention is powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier ingrédient, and especially, the spray Formulation may Further include a propellant such as chloro Flouro hydrocarbon, propane/butane or dimethyl ether, but it is not limited thereto.

When the Formulation oF the présent invention is a solution or émulsion, a solvent, solubilizer or emulsifier may be used as a carrier ingrédient. For example, water, éthanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, l ,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan Fatty acid ester may be used, but it is not limited thereto.

When the Formulation oF the présent invention is a suspension, a liquid diluent such as water, éthanol or propylene glycoi, a suspension such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbîtan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. may be used as a carrier ingrédient, but it is not limited thereto.

When the formulation of the présent invention is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium dérivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkyl amido betaîne, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin dérivative, or ethoxylated glycerol fatty acid ester, etc. may be used as a carrier ingrédient, but it is not limited thereto.

When the formulation of the présent invention is hair shampoo, base ingrédients for composing shampoo such as a thickening agent, surfactant, vîscosity control agent, moisturizer, pH control agent, preservative, essential oil, etc. are mixed with the compound of the présent invention. As a thickening agent, CDE may be used. As a surfactant, an anionic surfactant such as LES and an amphoteric surfactant such as coco betaine may be used. As a vîscosity control agent, polyquater may be used. As a moisturizer, glycerin may be used. As a pH control agent, citric acid and sodium hydroxide may be used. As a preservative, grapefruk extract may be used. In addition thereto, essential oil such as cedarwood, peppermint, rosemary, etc., and silk amino acid, pentaol, vitamin E, etc. may be added. According to an embodiment of the présent invention, with respect to 100 parts by

I9 weight of the compound of the présent invention, 5 to 10 parts by weight of CDE, 30 to 40 parts by weight of LES, 10 to 20 parts by weight of coco betaine, 0.1 to 0.2 parts by weight of polyquater, 5 to 10 parts by weight of glycerin, 0.1 to l.Ol parts by weight of grapefruit extract, 0.5 to l parts by weight of silk amino acid, 0.5 to l parts by weight of pintail, 0.5 to 2 parts by weight of vitamin E, and 0.01 to 0.1 parts by weight of any one of cedarwood, peppermint, rosemary as essential oil, may be mixed, but it is not limited thereto.

The ingrédients included in the cosmetic composition of the présent invention include ingrédients commonly used in cosmetic compositions, in addition to the compound of the présent invention and the carrier ingrédients as active ingrédients. For example, it may further include a conventional adjuvant such as a stabîlîzer, solubilizer, vitamin, pigment and fragrance, but is not limited thereto.

Hereinafter, the présent invention will be explained in detail with référencé to the examples.

However, the following examples are provided only to illustrate the présent invention, and the scope of the présent invention is not limited thereby.

Example l. Synthesis of the compound of the présent invention <!-]> Synthesis of peptide <l-l-l> Synthesis ofthe peptide of SEQ ID No, 3

700 mg of chlorotrityl chloride resin (CTL resin; Nova biochem [0064] Cat No. Ol64-0021) was put in a reactor and stirred for 3 minutes after adding 10 ml of methylene chloride (MC). After removing the solution, 10 ml of dimethylformamide (DMF) was added. Then, after stirring for 3 minutes, the solvent was removed again. After adding 10 ml of dichloromethane (DCM) to the reactor, 200 mmole of Fmoc-Cys(trt)-OH (Bachem, Swiss) and 400 mmole of diisopropylethylamine (DlEA) were added and dissolved well by stirring. After reacting for I hour with stirring, the mixture was washed and dissolved with methanol and DlEA (2:l) in DCM. After reacting for 10 minutes, the mixture was washed with excess DCM/DMF (l : l). After removing the solution, followed by addition of 10 ml of DMF and stirring for 3 minutes, the solvent was removed again. After adding 10 ml of a deprotecting solution (20% piperidine/DMF) to the reactor, the mixture was stirred for I0 minutes at room température and then the solution was removed. After adding again the same amount of the deprotecting solution and performing reaction for I0 minutes, the solution was removed and Cys(trt)-CTL resin was prepared by washing twice with DMF, once with MC, and once with DMF, for 3 minutes, respectively.

After adding 10 ml of DMF to another reactor, 200 mmole of Fmoc-His(trt)-OH (Bachem, Swiss) and 200 mmole of Bop were added and dissolved well by stirring. After adding 400 mmole of DlEA to the reactor in two fractions, the mixture was stirred for at least 5 minutes until ail the solid was dissolved. The resuiting amino acid mixture solution was added to the reactor containing the deprotected resin and reacted for l hour at room température with stirring. After removing the reaction solution, followed by stirring with DMF solution 3 times, 5 minutes, respectively, the solution was removed. A small amount of the reacted resin was taken and subjected to Kaiser test (Nihydrine Test) to détermine the extent of reaction. His(trt)-Cys(trt)-CTL resin was prepared in the same way as described above by deprotecting 2 times with the deprotecting solution. After sufTiciently washing with DMF and MC and carrying out Kaiser test once again, amino acid attachment was carried out as follows in the same way as described above.

According to the selected amino acid sequence, chain reaction was carried out în the order of Fmoc-Cys(trt), Fmoc-Arg, Fmoc-Gln(trt), Fmoc-Val, Fmoc-Arg, Fmoc-Thr, FmocGln(trt) and Fmoc-Arg(pbf). After reacting the Fmoc-protecting group with the deprotecting solution twice for 10 minutes, respectively, the solution was removed by washing well. After performing acétylation for an hour by adding acetic anhydride, DIEA and HoBt. the prepared peptidyl resin was washed 3 times, each with DMF, MC and methanol, dried by slowly flowing nitrogen gas, completely dried in the presence of P2O5 under reduced pressure, reacted with 30 ml of a leaving solution (containing trifluoroacetic acid 95%, distilled water 2.5% and thioanisole 2.5%) for 2 hours at room température upon intermittent agitation. The resin was filtered and washed with a small amount of TFA solution, after which the filtrate was combined with the mother liquor. After distillation under reduced pressure to reduce the total volume to about half, précipitation was înduced by adding 50 ml of cold ether and the formed précipitâtes were collected by centrifugation, followed by washing twice with cold ether. After removing the mother liquor, the résultant was dried sufficiently under nitrogen atmosphère to obtaîn 0.65 g of unpurified NH2-ArgGln-Thr-Arg-Val-Gln-Arg-Cys-His-Cys-OH peptide (SEQ ID No. 3) (yield: 92,6%), The molecular weight was measured as 1287.1 (theoretical value: 1286.5) using a molecular weîght analyzer.

< l -1 -2> Synthesis of the peptide of SEQ ID No. I and SEQ ID No. 2

The peptide of SEQ ID No, l (Glu- Leu-Ile-Glu-His-Gly-Gly-Gly-Arg-Pro-Ala-Asp: ELIEHGGGRPAD) and the peptide of SEQ ID No. 2 (Ac-Tyr-Lys-Ser-Lys-Lys-Gly-Gly-Trp10 Thr-His: Ac-YKSKKGGWTH) were synthesized using the same method as in Example <l-ll>.

[Table l]

SEQ ID No.	amino acid sequence	measured value (molecular weight analyzer)
measured value	theoretical value
I	ELIEHGGGRPAD	I250.9	1250.35
2	Ac-YKSKKGGWTH	1233.8	1233.4
3	RQTRVERCHC	I287.I	1286.5

<l-2> Synthesis of the compound of the présent invention l mmol of peptidyl resin and 10 ml of I-methyl-2-pyrrolidone (NMP) are put in a peptide reactor and reacted for 30 minutes after adding 270 mg (2.0 equiv.) of lhydroxybenzotriazole (HOBt) and 759 mg (2.0 equiv.) of N,N,N',N'-tetramethyl-O-(lHbenzotriazole-l-yl) uronium hexafluorophosphate, 0-(benzotriazole-l-yl)-N,N,N’,N'tetramethyl uronium hexafluorophosphate. After adding 388 mg (3 equiv.) of N,N5 diisopropylethylamine (DIEA) and 624 mg (2.0 equiv.) of finasteride analogue, the mixture was reacted for 24 to 72 hours at room température to obtain a peptidyl resin reacted by filtering. After reacting the obtained resin for 2 hours at room température usîng a cleavage solution, the resin and protecting group were removed. After recrystallizing using I0 ml (10 mmol) of diethyl ether, hybrid peptide was obtained. The reaction schemes of the 10 compound having a structure conjugating finasteride and peptide with a covalent bond are described in detail in the following.

[Reaction scheme l ] Reaction scheme of CG-peptide-finasteride hybrid peptide ο 11 HOBt (2 O eqpA I OH . y’³¹ naut2.o«Mii v-N

ClEA |3 0 «fltv I f J PtptisS»

Js. J 2)Cleovigf «iuttçnA f T H T H ° B H Ί-³¹ 0' Nil

5 [Reaction scheme 2] Reaction scheme of CG-Nokkin-finasteride hybrid peptide

1]K06l|2.0equrv.}

DIEA(3 Ooquv.) ΜΛΡ. ri. 24h

2)Oeerr3Qe edu4cn A rt 2h

[Reaction scheme 3] Reaction scheme of CG-Keramîn2-finasteride hybrid peptide

UHOBtOO eflptv > HBIU (2 0 eqùv i DlEA(3 0ecpry| MMP. rt. 72h

2) «tiitjçn B rt 2h

[Reaction scheme 4] Reaction scheme of CG-WlNT-finasteride hybrid peptide

t)HOB'(2.0equlv.>

HOUllO

DIEA 43.0 ec|uiv |

IMF. Π, 73Ί

2) Ctaevege takibcn A rt. 3)

Experimental Example l. Solubilitv test of the compound of the présent invention

Finasteride-CG-Nokkin compound (compound l), finasteride-CG-Keramin2 compound (compound 2), finasteride-CG-WINT compound (compound 3) prepared in I0 Example <l-2>, and finasterîde are respectively dissolved in distilled water each in a concentration of 10 mg/ml.

As a resuit, it was confirmed that finasterîde itself was hardly dissolved in water, whereas compounds l to 3 of the présent invention were ail completely dissolved in water (Fig- I)

Experimental Example 2. Analysis on the effect of the compound of the présent invention on 5α reductase activity

In order to confirm the effect of the compound of the présent invention on 5a reductase activity, first, liver cell extracts known to hâve a large amount of 5a reductase were collected through a protein extraction method. After reacting testosterone with finasteride or compounds l to 3 of the présent invention, liver cell extracts were put in the corresponding solution and reacted for l hour at 37°C. The reactant of putting the liver cell extracts in testosterone and reacting it for l hour at 37°C is the control. After the reaction is completed, the amount of testosterone and DHT were confirmed through HPLC. The HPLC analysis was carried out under the following conditions.

- Cl8 column

- UV 240 nm

- flow rate: l ml/mînute

- mobile phase: A: 0.1% Formic acid in water

B: 0.1% Formic acid in acetonitrile

- gradient: 0 min B 5% — 30 min B 80%

As a resuit, when compared with the control, the concentration of testosterone was increased when treated with finasteride and the compounds of the présent invention, and the concentration of DHT was decreased in proportion thereto. Also, when compared with the case treated with finasteride, it was confirmed that the increase of testosterone concentration and decrease of DHT concentration were more remarkable when treated with the compound of the présent invention (see Figs. 2a and 2b).

Experimental Example 3. Effect of the compound of the présent invention on the growth of kératinocytes

In order to analyze the similar effects and inhîbitory effects of growth factors with respect to the compound synthesized in Example <I -2>, sulfohodomine B (SRB) calorimetric assay was carrîed out using HaCaT kératinocytes (Korean Cell Line Bank) according to the method of Rizzino et aL (Rizzino, et al. Cancer Res. 48:4266(1988)).

HaCaT kératinocytes were cultured under 5% CO2 for 24 hours at 37°C in Dulbecco's modified Eagle's medium (DMEM, Gibco, U.S.A.) containing 10% fêtai bovine sérum (FBS; Sigma) after inoculatîng each well of a 96-well plate with 3,000 cells. The cultured cell lines were treated with 1% trypsin solution to detach the cultured cell lines from the bottom of the culture flask and centrifuged to collect cell pellets. They were resuspended in FBS-free DMEM culture medium and cultured under 5% CO2 for 24 hours at 37°C. After 24 hours later, the medium was changed with the same serum-free culture medium, and the cells were cultured for 72 hours under the same conditions as described above with a blank sample dissolved in 10% DMSO in sterilized condition as reference, compounds of formulae 1 to 3 of the présent invention (50 μΜ), finasteride (50 μΜ), and EGF (100 nM) used as a positive reference. After removing the supernatant and fixing the cells using éthanol, the cells were washed three times with phosphate buffer saline (PBS).

After removing the washing solution, and treating with calorimetric SRB solution, followed by sufficient washing with l% acetic acid, the cells were observed under a microscope to evaluate cell viability. In addition, absorbance was measured at ultraviolet rays of 560 nm to analyze cell prolifération.

After treating the kératinocytes with the compound of the présent invention and observing the morphological change in cells 72 hours later, it was confirmed that the compound of the présent invention changed the growth and morphological shape of kératinocytes (Fig. 3a). Also, it was confirmed that the growth of kératinocytes was greatly increased when treated with the compound of the présent invention as compared with the case treated with finasteride (Fig. 3b).

Experimental Example 4. Effect of the compound of the présent invention on the growth of HHDPC cells

The effect of the compounds of the présent invention on the growth of HHDPC cells (ATCC/U.S.A.) was confirmed in the same manner as in Experimental Example 3. In this case, MNX (10 uM) and IGF-I (luM) were used as positive control.

As a resuit, it was confirmed that the compound of the présent invention changed the growth and morphological shape of HHDPC cells (Fig. 4a). Also, it was confirmed that the growth of HHDPC cells was greatly increased when treated with the compound of the présent invention as compared with the case treated with Finasteride (Fig. 4b).

Experimental Example 5. Analysis on the efFect of the compound of the présent invention on translocation of beta-catenin into the nucléus hours after treating HHDPC cells cultured for 48 hours with the compounds of the present invention synthesized in Example <1 -2>, the effect of the compound of the présent invention on the translocation of beta-catenin, which is a signal substance essential for promoting hair growth, into the nucléus by the représentative signaling pathway of WNT protein was measured. The expression of beta-catenin was observed through Western blot using an antibody against beta-catenin (SantaCruz, U.S.A.), and it was confîrmed whether beta-catenin was translocated into the nucléus by immunohistochemistry using the same antibody. In particular, HHDPC cells were cultured in a CO? incubator for 24 hours at 37°C after inoculating each well of a 6-well plate with 100,000 cells. The medium was changed into a serum-free DMEM medium, and then after treating the cells with finasteride, finasteride-WINT compound, WfNT respectively in concentrations of 5 and 50 pM, the cells were cultured for 24 hours. After extracting the nuclear and cytoplasmic protein using a protein extraction kit. Western blot was carried out under the following conditions.

- préparation of 12% SDS-PAGE

- ioading with 15 pg of protein to SDS-PAGE

- transfer to PVDF membrane

- blocking with 5% dried skim milk solution for 1 hour at room température

- reaction of Ist antibody (anti-beta-catenin antibody, anti-HDAC, anti-alpha tubulin antibody) at room température for 2 hours in a concentration of 1/3000

- washing three times with PBST for 10 minutes

- reaction of 2nd antibody at room température for I hour in a concentration of 1/5000

- washing three times with PBST for 15 minutes

- détection

As a resuit, it was confirmed that when treated with the compound of the présent invention, the expression of beta-catenin increased. Also, it was confirmed that beta-catenin is translocated from the cytoplasm to the nucléus by the compound of the présent invention even when measuring whether beta-catenin is translocated into nucléus using immunehistochemistry in HHDPC cells, and that the compound of the présent invention still exists in the cytoplasm and has activity (Figs. 5a and 5b).

Experimental Example 6. Analysis on the efïect of the compound of the présent invention on inhibition of BMP signal translocation hours after treating HHDPC cells cultured for 48 hours with the compounds of the présent invention synthesized in Example <l-2>, the effect of the compound of the présent invention on the activity of phospho-Smad I/5/8, which is a signal substance essential for inhibiting hair loss, by the représentative signaling pathway of BMP protein was measured.

The expression of phospho-Smadl/5/8 was confîrmed through Western blot using an antibody against phospho-Smadl/5/8. In particular, HHDPC cells were cultured in a CO? incubator for 24 hours at 37°C after inoculating each well of a 6-well plate with 100,000 cells. The medium was changed into a serum-free DMEM medium, and then after treating the cells with finasteride and finasteride-Nokkin compound, respectîvely in concentrations of 0.5, 5 and 50 pM, the cells were cultured for 24 hours. After extracting the nuclear and cytoplasmîc protein using a protein extraction kit, Western blot was carried out under the following conditions.

- préparation of 12% SDS-PAGE

- loading with 15 pg of protein to SDS-PAGE

- transfer to PVDF membrane

- blocking with 5% dried skim milk solution for 1 hourat room température

- reaction of Ist antibody (anti-phospho-Smad 1/5/8 antibody, anti-HDAC, anti-alpha tubulin antibody) at room température for 2 hours in a concentration of 1/3000

- washîng three times with PBST for 10 minutes

- reaction of 2nd antibody at room température for 1 hour in a concentration of 1/5000

- washing three times with PBST for 15 minutes

- détection

As a resuit, it was confîrmed that when treated with the compound of the présent

3I invention, the expression of phospho-Smadl/5/8 in the nucléus decreased (Figs. 6a and 6b).

Experimental Example 7. Analysis on the effect of the compound of the présent invention on the expression of DKK-l

The effect of the compound of the présent invention on mRNA expression of DKK-l, which is a représentative hair loss protein expressed by DHT was confirmed. In particular, HHDPC cells were cultured in a CO₂ incubator for 24 hours at 37°C after inoculating each well of a 6-well plate with 100,000 cells. After reacting testosterone with finasteride or the finasteride-Nokkin compound of compounds 1 to 3 of the présent invention, finasterideKeramin2 compound and fmasteride-WINT compound, liver cell extracts were put in the corresponding solution and reacted for 1 hour at 37°C. The reactant of putting the liver cell extracts in testosterone and reacting it for I hour at 37°C was used as a positive control. The medium was changed into a serum-free DMEM medium, and then after treating the cells with finasteride and finasteride-Nokkin compound, finasteride-Keramine2 compound and finasteride-WINT compound, respectively in a concentration 50 μΜ, the cells were cultured for 24 hours. After extracting the RNA of the cells using an RNA extraction kit, RT-PCR was carried out using the following primers.

I. DKK-l

- forward primer: (5') TGATGAGTACTGCGCTAGTC (3’) (SEQ ID No. 4)

- reverse primer: (5') CTCCTATGCTTGGTACACAC (3') (SEQ ID No. 5)

2. GAPDH

- forward primer: (5¹) GGAGCCAAAAGGGTCATCAT (3') (SEQ ID No. 6)

- reverse primer: (5') GTGATGGCATGGACTGTGGT (3') (SEQ ID No. 7)

As a resuit, it was confirmed that the compound of the présent invention further inhibited the expression of increased DKK-1 in the positive control more than the case treated with finasteride, and in particular, it could inhîbit the expression of DK.K-1 to a level even lower than the négative control, which was not treated with anything (Figs. 7a and 7b).

Experimental Example 8. Hair growth test

The effect of the compound of the présent invention on hair growth was confirmed through animal tests. In particular, the hair on the back of a 7-week old male C57BL/6 mouse was removed using hair removal cream. After preparing PBS, finasteride and the finasteridc-WINT compound of the présent invention in concentrations of 100 pg/ml, they were evenly applied on the back skin of mice once every day, and the color of the back skin of mice was observed by taking photographs from the point the color started to turn black.

Then, the mice were killed, and the hair on the back skin was observed through H&E staining. To this end, after collecting the back skin of mice and fixing it in 4% paraformaldéhyde (PFA), paraftin embedding was carried out. After cutting the back skin of the embedded mice in a thickness of 4 pm, the number of hair follicles was confirmed through H&E staining.

As a resuit, it was confirmed that mice applied with the finasteride-WINT compound of the présent invention clearly presented a faster rate of hair growth of the mice as compared with the mice applied with PBS or finasteride (Fig. 8a), and that the number of hair follicles increased remarkably as compared with the control and group administered with finasteride (Fig. 8b).

Experimental Example 9. Skin permeabilîtv test

Since finasteride is a drug controlling steroid type hormones, when it is orally administered, there may be side effects such as causing systemic toxicity by spreading through blood. Thus, if it penetrates the skin even when applied on the skin, there is a possibility for it to penetrate into the entire body and cause toxicity and if it does not penetrate the skin, since it is left in the scalp and does not spread into the entire body, the side effects of finasteride may be inhibited. In this regard, after applying finasteride and the finasteride-WINT compound of the présent invention on three dimensional artificial skin, the présent inventors confirmed whether it penetrates into the skin.

To this end, finasteride and the finasteride-WINT compound of the présent invention are respectively mixed in a mixed solvent of éthanol 10%, propylene glycol 40% and purified water 50%. Franz expansion cell test was carried oui using three dimensional artificial skin. Finasteride and finasteride-WINT compound solution were applied on the three dimensional artificial skin l ml, respectively, and left for 24 hours. After sampling the receptor chamber solution, finasterîde and finasteride-WINT compound permeating the skin were detected usîng HPLC. The finasterîde détection condition of HPLC is Cl8 column, UV 210 nm, fiow speed 1.6 ml/min, acetonitrile:water = 45:55, and the détection R.T. was 9 to 10 minutes. In order to detect the finasteride-WINT compound of the présent invention, multiple reaction monitoring (MRM) assay, which is a method for detectîng the corresponding molecular weight was carried out using LC-MS/MS (3200 Qtrap) equipment.

As a resuit, it was confirmed that the drug treated only with finasterîde permeates the skin and thus was detected, and that the drug treated with the finasteride-WINT compound of the présent invention was not detected with a substance permeating the skin and was left in 10 the skin (Figs. 9a and 9b).

Summing up the experimental results of Experimental Examples l to 9, it can be found that the compound of the présent invention exerts the functions of promoting haïr growth and inhibiting haïr loss very excellently and exerts the fonction of anti-aging.

Formulation Example l: Softenîng lotion

The softenîng lotion comprising the compound of the présent invention prepared in Example <l-2> and consisting of the following composition was prepared according to a general method for preparing lotion.

[Table 2]

Ingrédients	Content (weight%)
compound of the présent invention	2.5
l,3-butylene glycol	6
glycerin	4
PEG 1500	l
sodium hyaluronate	l
polysorbate 20	0.5
éthanol	8
preservative, pigment	q.s.
benzopenone-9	0.05
fragrance	trace
purified water	balance
Total	100

Formulation Example 2. Nourishing cream

The nourishing cream comprising the compound of the présent invention prepared in

Example <l-2> and consisting of the following composition was prepared according to a 5 general method for preparing nourishing cream.

[Table 3]

Ingrédients	Content (weight%)
compound of the présent invention	2.5
meadow foam oil	3
cetearyl alcohol	1.5
stearîc acid	1.5
glyceryl stéarate	1.5
lîquid paraffin	10
beewax	2
polysorbate 60	0.6
sorbitan sesquîoleate	2.5
squalane	3
l,3-butylene glycol	3
gylcerin	5
triethanolamine	0.5
tocopheryl acetate	0.5
preservative, pigment	q.s.
fragrance	q.s.
purified water	balance
Total	I00

Formulation Example 3. Milk lotion

The milk lotion comprising the compound of the présent invention prepared in

Example <l-2> and consisting of the following composition was prepared according to a 5 general method for preparing lotion.

[Table 4]

Ingrédients	Content (weight%)
compound of the présent invention	2.5
l,3-butylene glycol	4
gylcerîn	4
cetearyl alcohol	0.8
glyceryl stéarate	l
triethanolamine	0.13
tocopheryl acetate	0.3
liquid paraffin	5
squalane	3
macadamia nut oil	2
polysorbate 60	1.5
sorbitan sesquioleate	0.5

carboxyvinylpolymer	l
preservative, pigment	q.s.
fragrance	q.s.
purified water	balance
Total	100

Formulation Exampie4. Essence

The essence comprising the compound of the présent invention prepared in Example <l-2> and consisting of the following composition was prepared according to a general method for preparîng essence.

[Table 5]

Ingrédients	Content (weight%)
compound of the présent invention	2.5
glycerin	10
l,3-butylene glycol	5
PEG 1500	2
allantoin	0.I
DL-panthenol	0.3
EDTA-2Na	0.02

hydroxyethyl cellulose	O.l
sodium hyaluronate	8
carboxyvinylpolymer	0.2
triethanolamîne	O.l 8
octyldodeceth-16	0.4
éthanol	6
fragrance, preservative, pigment	q.s.
purified water	balance
Total	10Û

Formulation Example 5. Hair sérum

The hair sérum comprising the compound of the présent invention prepared in

Example <l-2> and consisting of the following composition was prepared according to a 5 general method for preparing haïr sérum.

[Table 6]

Ingrédients	Content (weight%)
compound of the présent invention	l
gylcerin	10
l,3-butylene glycol	5

PEG 1500	2
allantoin	O.l
DL-panthenol	0.3
EDTA-2Na	0.02
hydroxyethyl cellulose	O.l
sodium hyaluronate	8
carboxyvinylpolymer	0.2
triethanolamine	O.l 8
octyldodeceth-I6	0.4
éthanol	6
fragrance, preservative, pigment	q.s.
purified water	balance
Total	100

Formulation Example 6, Hair toner

The hair toner comprising the compound of the présent invention prepared in

Example <l-2> and consisting of the following composition was prepared according to a general method for preparing hair toner.

[Table 7]

4I

Ingrédients	Content (weight%)
compound of the présent invention	l
gylcerin	2
l,3-butylene glycol	2
PEG 1500	2
allantoin	O.l
DL-panthenoI	0.3
EDTA-2Na	0.02
sodium hyaluronate	8
carboxyvinylpolymer	0.2
triethanolamine	0.18
éthanol	10
fragrance, preservative, pigment	q.S.
purified water	balance
Total	100

Claims (10)

WHAT IS CLAIMED IS:

1. A compound having a structure conjugating finasteride and peptide with a covalent bond.

2. The compound of claim I, wherein the peptide is composed of 2 to 30 amino acids.

3. The compound of claim 2, wherein the peptide is composed of 8 to 15 amino acids.

4. The compound of claim l, wherein the peptide is a water soluble peptide.

5. The compound of claim 4, wherein the water soluble peptide has at least 70% of an amino acid having a hydrophilic side chain.

6. The compound of claim 5, wherein the amino acid having a hydrophilic side chain is selected from the group consisting of arginine (Arg), histidine (Hîs), lysine (Lys), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gin), cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro).

7. The compound of claim 5, wherein the amino acid having a hydrophilic side chain is an amino acid with an electric charge selected from the group consisting of arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp) and glutamic acid (Glu).

8. The compound of claim 4, wherein the water soluble peptide has at least three amino acids with an electric charge selected from the group consisting of arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp) and glutamic acid (Glu).

9. The compound of claim 4, wherein the water soluble peptide has five or less amino acids having a hydrophobie side chain.

10. The compound of claim 9, wherein the water soluble peptide has three or less amino acids having a hydrophobie side chain.

IL The compound of claim 9, wherein the amino acid having a hydrophobie side chain is selected from the group consisting of alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionîne (Met), phenylalanine (Phe), tyrosine (Tyr) and tryptophane (Trp).

12. The compound of claim I, wherein the peptide is selected from the group consisting of a Nokkin peptide composed of an amino acid sequence of SEQ ID No. L a Keramin2 peptide composed of an amino acid sequence of SEQ ID No. 2, and a WINT peptide composed of an amino acid sequence of SEQ ID No. 3.

13. A pharmaceutical composition for preventing hair loss or promoting hair growth comprising the compound of any one of daims l to 12.

5

14. A cosmetic composition for preventing hair loss or promoting hair growth comprising the compound of any one of daims I to I2.

15. The cosmetic composition of daim 14, which has a formulation selected from the group consisting of skin lotion, milk lotion, nourishing cream, massage cream, essence, eye cream,

10 deansîng cream, cleansing foam, cleansing water, pack, spray, powder, hair tonie, hear cream, lair lotion, hair shampoo, hair rinse, hair conditioner, hair spray, hair aérosol, pomade, solgel, émulsion, oil, wax and aérosol.