OA17159A - UK-2 biosynthetic genes and method for improving UK-2 productivity using the same - Google Patents

UK-2 biosynthetic genes and method for improving UK-2 productivity using the same Download PDF

Info

Publication number
OA17159A
OA17159A OA1201500005 OA17159A OA 17159 A OA17159 A OA 17159A OA 1201500005 OA1201500005 OA 1201500005 OA 17159 A OA17159 A OA 17159A
Authority
OA
OAPI
Prior art keywords
seq
nucleic acid
amino acid
acid sequence
group
Prior art date
Application number
OA1201500005
Inventor
Koei KOBAYASHI
Naomi Sumida
Koji Yanai
Original Assignee
Meiji Seika Pharma Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Meiji Seika Pharma Co., Ltd. filed Critical Meiji Seika Pharma Co., Ltd.
Publication of OA17159A publication Critical patent/OA17159A/en

Links

Abstract

To provide a production method capable of mass production of UK-2 at low cost, the genomic DNA of Streptoverticillium sp. 3-7, which produces UK-2, was analyzed to identify a region expected to be a UK-2 biosynthetic gene cluster. Moreover, by colony hybridization, DNAs in the region were successfully isolated. Further, the DNAs were used to prepare a strain in which the genes present in the region were disrupted. The strain was found not to produce UK-2. It was verified that the genomic region was the UK-2 biosynthetic gene cluster. Furthermore, Streptoverticillium sp. 3-7 was transformed by introduction of a vector in which the isolated UK-2 biosynthetic gene cluster was inserted. It was also found out that the UK-2 productivity by the transformant was improved about 10 to 60 times or more in comparison with that of the parental strain. Moreover, it was revealed that 2 copies of the UK-2 biosynthetic gene cluster were present per cell in these transformants, respectively.

Description

[DESCRIPTION]
[Titie of Invention] UK-2 BIOSYNTHETIC GENE AND METHOD FOR IMPROVING UK-2 PRODUCTIVITY USING THE SAME
[Technical Field]
The présent invention relates to a gene necessary for biosynthesls of UK-2 which is a compound useful for rice blast control agents and the like (hereinafter referred to as a UK-2 biosynthetlc gene) and a method for improving UK-2 productivity. More specifically, the présent invention relates to a UK-2 biosynthetlc gene, a vector in which the UK-2 biosynthetlc gene ls Inserted, a transformant in which the vector ls Introduced, 10 a method for determining UK-2 productivity by detecting the presence of the UK-2 biosynthetlc gene, a bacterlum In which the presence of the UK-2 biosynthetlc gene 1s detected by the method, a bacterlum comprising the UK-2 biosynthetlc gene inserted In a genome thereof, a bacterlum In which one or two or more copies of the UK-2 biosynthetlc gene are présent per cell, and methods for producing UK-2 and a UK-2A derlvative by 15 utillzing these bacteria and so forth.
[Background Art]
UK-2 ls a compound produced as a secondary metabollte by actinobacterla, and shows strong antlfungal actions similar to antlmycln against various fungl including fllamentous fungl and yeasts. Further, since having low cytotoxlcity to culture cells, 20 UK-2 has been found to be useful for rice blast control agents, agriculture! and hortlcultural funglcldes, and medical antlfungal agents (Patent Literature 1, 2). Moreover, It has been revealed that there naturally exlsts four analogues, UK-2Ato D, based on the différence in structure of their side chains (Non Patent Literature 1).
UK-2 ls produced by culturing actinobacterla (bacteria and the like belonglng to the genus Streptovertlcillium) and then collectlng UK-2 therefrom. However, generally, the amount of UK-2 (ail UK-2 factors) produced by mlcroorganlsms Isolated from nature ls very small. Accordingly, in order to use the target (UK-2) Industrially at low cost, the productivity has to be Improved.
The productivity of the target is Improved through Investigations on the methods for culturlng the mlcroorganlsms produclng the target, Investigations on the medium components, Improvement In fermentation conditions by addition of the precursor, and Improvement In the bacterial strain utlllzlng ultraviolet Irradiation- or chemical mutagen-lnduced mutation. Furthermore, In addition to these methods, the productivity 10 has been Improved recently by utllizlng gene recomblnatlon.
A general method for improving the productivity by gene recomblnatlon ls that including the enhanclng of expression of a gene necessary for biosynthesis of the target. For example, Patent Literature 3 discloses that this method Improves the productivity of PF-1022 In Agonomycetales.
However, when this method ls utilized, It ls essential to Isolate the gene necessary for biosynthesis of the target or the gene synthesized using known techniques, and also to establlsh the transformation method for mlcroorganlsms produclng the target (produclng mlcroorganlsms). Slnce the UK-2 blosynthetlc gene ls yet to be elucidated, the transformation using the UK-2 blosynthetlc gene cannot be 20 performed. The productivity cannot be improved by gene recomblnatlon.
[Citation List]
[Patent Literature]
[PTL 1] Japanese Examined Patent Application Publication No. Hel 07—233165
[PTL 2] International Publication No. WO1999/11127
[PTL 3] International Publication No. W02001/018179
[Non Patent Llterature]
[NPL 1] Ueki M., et al., Journal of antibiotics, July 25th, 1996, vol. 49, no. 7, pp. 639 to 5 643
[NPL 2] Namwat W., et al, Journal of Bacterioiogy, September 2002, vol. 184, no. 17, pp. 4811 to 4818
[Summary of Invention]
[Technical Problem]
The présent Invention has been made In view of the above-described problème In the conventional techniques. An object of the présent Invention is to provide a transformant having high UK-2 productivlty, obtained by isolating a gene nccessary for biosynthesis of UK-2 followed by Introduction of the gene. Moreover, another object ls to produce a large amount of UK-2 at low cost using the transformant. And a further object ls to provide a method for determining UK-2 productlvity by detecting the presence of the gene.
[Solution to Problem]
UK-2 has a characteristic hydroxyplcolinic acid skeleton. Meanwhile, a compound called virginlamycin also has a hydroxypicoiinic acid skeleton. Further, it has 20 been revealed that VisA (L-iysine 2-aminotransferase) and VisB (3-hydroxypicolinic acid AMP ligase) are involved In the biosynthesis of virginlamycin (Non Patent Literature 2).
Thus, in order to achieve the above objects, the présent inventors first prepared the genomic DNA library of StreptoverticiiHum sp. 3-7, which produces UK-2, and 3 comprehenslvely determined the base sequence of the genomlc DNA of the strain. Then, a homology analysis was conducted between the amino acid sequence of a putative protein encoded by the genomlc DNA and the amino acid sequences of VisA and VisB to thus find out a genomlc site where genes whose products hâve a high homology 5 with these two amino acid sequences are consecutlvely located. Furthermore, It was found out that a gene encoding a protein having a homology with a non-rlbosomal peptide synthetase (NRPS) and a gene encoding a protein having a homology with a polyketide synthase (PKS) were located near the site.
These enzymes are thought to be necessary to form the UK-2 skeleton. In 10 addition, the secondary metaboilte genes of actlnobacterla form clusters. Accordingly, the genomlc région Is expected to be a UK-2 biosynthetic gene cluster.
Then, based on the thus-obtained information on the base sequences of the genes expected to be encoding the enzymes necessary for biosynthesis of UK-2, a probe was prepared. By colony hybridization using the probe, DNAs expected to be ln the 16 UK-2 biosynthetic gene cluster (I.e., DNAs contained ln the genomlc région) were successfuüy isolated from the above-descrlbed genomlc DNA ilbrary. Moreover, the DNAs were used to préparé Streptovertlcllllum sp. 3-7 in which the genes présent ln the genomic région were dlsrupted. The strain was found not to produce UK-2. It was verified that the genomlc région was the UK-2 biosynthetic gene cluster. Further, 20 Streptovertlclillum sp. 3-7 was transformed by Introduction of a vector In which the Isolated UK-2 biosynthetic gene cluster was Inserted. It was found out also that the UK-2 productlvlty by the transformant was improved about 10 to 60 times or more ln comparlson with that of the parental strain. Furthermore, It was confirmed that 2 copies of the UK-2 biosynthetic gene cluster were présent per cell ln these transformants, 26 respectively.
Specifically, the present Invention relates to a U K· 2 biosynthetlcgene, a vector In which the UK-2 blosynthetic gene is inserted, a transformant In which the vector is
Introduced, and methods for produclng UK-2 and the like by utilizing the transformant.
More specifically, the present Invention provides the followings.
<1> An isolated nucleic acid that Induces UK-2 blosynthesls and Improves UK-2 productivité the nucleic acid Is at least one nucleic acid selected from the group consisting of the following (a) to (q):
(a) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 3, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
ID NO: 3 In which one or more amino acids are substituted, deleted, added and/or inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 3, or a nucleic acid hybridizlng under stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 2;
(b) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
ID NO: 5, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ iD NO: 5 in which one or more amino acids are substituted, deleted, added and/or inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 5, or a nucleic acid hybridizlng under stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 4;
(c) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
ID NO: 7, a nucielc acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 7 in which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ iD NO: 7, or a nucleic acid hybridizing under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 6;
(d) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 9, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 9 ln which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 9, or a nucleic acid hybrldlzlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 8;
(e) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 11, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 11 ln which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 11, or a nucleic acid hybrldlzlng under stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 10;
(f) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 13, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 13 ln which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 13, or a nucleic acid hybrldlzlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 12;
(g) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 15, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 15 in which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 15, or a nucleic acid hybrldlzlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 14;
(h) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 17, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 17 In which one or more amino acids are substituted, deleted, added and/or
In sert ©d, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 17, or a nucleic acid hybrldizlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 16;
(1) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
ID NO: 19, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
ID NO: 19 In which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 19, or a nucleic acid hybrldizlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 18;
(j) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
ID NO: 21, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 21 In which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 21, or a nucleic acid hybrldizlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 20;
(k) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
ID NO: 23, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 23 In which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 23, or a nucleic acid hybrldizlng under stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 22;
(l) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 25, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 25 in which one or more amino acids are substituted, deleted, added and/or inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 25, or a nucleic acid hybridizing under stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 24;
(m) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 27, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 27 in which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 27, or a nucleic acid hybridizing under stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 26;
(n) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 29, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 29 In which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 29, or a nucleic acid hybridizing under stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 26;
(o) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 31, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 31 in which one or more amino acids are substituted, deleted, added and/or inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 31, or a nucieic acid hybridizlng under strlngent conditions to a nucieic acid comprising a base sequence of SEQ ID NO: 30;
(p) a nucieic acid encoding a protein comprising an amino acid sequence of SEQ
ID NO: 33, a nucieic acid encoding a protein comprising an amino acid sequence of SEQ
ID NO: 33 In which one or more amino acids are substituted, deleted, added and/or
Inserted, a nucieic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 33, or a nucieic acid hybridizlng under strlngent conditions to a nucieic acid comprising a base sequence of SEQ ID NO: 32; and (q) a nucieic acid encoding a protein comprising an amino acid sequence of SEQ
ID NO: 35, a nucieic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 35 In which one or more amino acids are substituted, deleted, added and/or Inserted, a nucieic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 35, or a nucieic acid hybridizlng under strlngent conditions to a nucieic acid comprising a base sequence of SEQ ID NO: 34.
<2> The nucieic acid according to <1>, comprising ail the nucieic acids of (a) to (q).
<3> The nucieic acid according to <2>, comprising a base sequence of SEQ ID NO: 1.
<4> A vector in which the nucieic acid according to any one of <1> to <3> ls inserted, for Inducing UK-2 biosynthesls and Improving UK-2 productivlty.
<5> A method for determining UK-2 productivlty, comprising detectlng, in a test 20 bacterlum, the presence of a nucieic acid comprising a base sequence of the nucieic acid according to any one of <1> to <3> or a base sequence complementary to the sequence.
<6> The method according to <5>, wherein a method for detectlng the presence of the nucieic acid ls a PCR method.
<7> The method ln <5>, wherein the PCR method ls a method ln which the nucleic acid ls amplifled using a primer comprising a base sequence of SEQ ID NO: 45 and a primer comprising a base sequence of SEQ ID NO: 46.
<8> A bacterlum ln which UK-2 blosynthesis ls Induced and UK-2 productivlty ls S Improved, and in which the presence of the nucleic acid comprising the base sequence of the nucleic acid according to any one of <1> to <3> or the base sequence complementary to the sequence is detected by the method according to any one of <5> to <7>.
<9> A bacterlum ln which UK-2 biosynthesls is induced and UK-2 productivity is Improved by introduclng the vector according to <4>.
<10> A bacterlum in which UK-2 biosynthesls ls Induced and UK-2 productivity ls improved, and ln which the nucleic acid according to any one of <1> to <3> is Inserted in a genome thereof.
<11> A bacterlum ln which one or two or more copies of a nucleic acid comprising a base sequence of the nucleic acid according to any one of <1> to <3> are présent per 15 cell.
<12> The bacterlum according to any one of <8> to <11>, which is any one of Straptovertlcllllum, Streptomyces, Escherlchla coll, Bacillus subtilis, yeasts, filamentous fungi and Coryne bacterlum glutamlcum.
<13> A method for producing UK-2, comprising the step of:
culturing the bacterlum according to any one of <8> to <12>, and collecting UK-2 from a culture of the bacterlum.
<14> A method for producing a dérivative of UK-2, comprising the steps of:
culturing the bacterium according to any one of <8> to <12>, and collecting UK-2 from a culture of the bacterium; and synthesizing a dérivative of UK-2 represented by any one of the following formulae (1) from the collected UK-2
[Chem. 1]
[in the formula (1),
R represents any one of a 2-methyipropanoyl group, a trans-2-methyl-2-butenoyl group, a 3-methylbutanoyl groupand a 2-methyibutanoyl group.
R1 represents any one of a Cbe alkyl group, a benzyl group, a C^o alkylcarbonyl groupfthe C^q alkylcarbonyl group may be substituted with any one of a carboxy! group, a benzyloxycarbonyl group, a Cv4 aikyloxycarbonyl group and benzyloxycarbonylamino group), a benzoyl group, a Cb4 aikyloxycarbonyl group, a (Cm) aikyloxycarbonyl (Cb4) alkyl group,a benzyloxycarbonyl (Cb4) alkyl group may be substituted with a nitro group, a Ci.e alkylsulfonyl, dl(Ci.e)alky1phosphory1 group, a diphenylphosphory group and a substituent represented by the following formula (2);
[Chem. 2]
Μ
(ln the formula (2),
Q is selected from the group consisting of H, CH3, CH2CH3, CF3, Ph, CH=CH2 and a cydopropyl.
M is selected from the group consisting of H, CH3, CH2CH31 CF3, Ph, CH=CH2 and a cydopropyl.
T is selected from the group consisting of O, OC(O), OC(O)O, S, SC(O), S C(O)O and a substituent represented by the following formula (3);
[Chem. 3]
w (3)
G is selected from the group consisting of H, C,.e alkyl group, a C,.e alkyloxy C^e alkyl group, a C2.e alkenyl group, a C2.e alkynyl group, a C3.e cycloalkyl group,an aryl group and a heteroaryl group.
G and M may form an Isobenzofuran ring optionally having an oxo group.
M and Q may form a 3-8 membered carbocyclic system.].
<15> A method for produclng a dérivative of UK-2A, comprising the steps of:
culturlng the bacterlum according to any one of <8> to <12>, and collecting
UK-2Afrom a culture of the bacterium; and synthesizing a dérivative of UK-2A represented by any one of the following formulae (4) to (7) from the coliected UK-2A.
[Chem. 4]
(5)
[Chem. 6]
Note that, as used herein, the term acyl shall mean a residue RCO- provided by removing OH from a carboxylic acid R-COOH, wherein R represents a hydrocarbon group. As used herein, the term aryl shall mean phenyl or naphthyl. As used herein, the term heteroaryl shall mean any 5 or 6 membered aromatic ring, containing one or more heteroatoms, where such heteroatoms are selected from the group consisting of O, N, 10 and S, and where the remalnlng atoms of the aromatic ring are carbon atoms. Suitable examples include, but are not limited to a pyridine, a pyrldazlne, a pyrlmldine, a pyrazlne, a pyrrole, a pyrazole, an Imldazole, a furan, a thlophene, an oxazole, an Isoxazole, a thlazole, an Isothlazole, a qulnollne, a qulnoxoline and a thladlazole.
[Advantageous Effects of Invention]
The présent invention makes it possible to provide a transformant having high
UK-2 productivity by Introduclng a U K-2 blosynthetic gene into a host cell such as a bacterium. Further, mass production of UK-2 at low cost ls also possible using the transformant. Moreover, it ls also made possible to provide a method for determining
UK-2 productivity by detecting the presence of the gene.
[Description of Embodiments] <UK-2 Blosynthetic Gene>
The présent invention provides a UK-2 blosynthetic gene. As described ln Examples later, the présent Inventors hâve Isolated, as novel UK-2 blosynthetic genes, 17 genes shown ln Table 2 from a genomlc DNA of Streptoverticiilium sp. 3-7.
Thus, one embodiment of the UK-2 blosynthetic gene of the présent invention ls an isolated nucleic acid that induces UK-2 biosynthesis and improves UK-2 productivity, the nucleic acid ls a nucleic acid encoding a protein comprising an amino acid sequence ofSEQIDNO: 3, 5, 7, 9, 11, 13, 15, 17, 19,21,23,25, 27, 29, 31, 33 or 35, and typically an isolated nucleic acid that Induces UK-2 biosynthesis and improves UK-2 productivity, the nucleic acid ls a nucleic acid comprising a base sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30. 32 or 34.
In the présent Invention, the phrase Improvement In UK-2 productivity and related phrases mean not only Improvement in UK-2 productivity that a bacterium or the like naturaliy has, but also the acquisition of a UK-2 production ability by a bacterium or the üke that does not naturaliy hâve the UK-2 production ability.
In the présent invention, the term Isolation and related terms mean an artificial treatment which allows the nucleic acid to exist under a condition different from the orlglnally exlsting condition. The UK-2 blosynthetic gene of the présent invention can be Isolated, for example, by first syntheslzlng an appropriate primer on the basis of the information on the base sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24,
26, 28, 30, 32 or 34, and then carrying out PCR using the primer with a template of the genomlc DNA of Streptoverticilllum sp. 3-7. Alternative!y, as described in Example later, the UK-2 biosynthetlc gene of the présent Invention can also be Isolated from a genomlc DNA library or cDNA library of Streptovertlclllium sp. 3-7 by carrying out colony hybridization using the amplification product obtained by the PCR as a probe. Besldes, the UK-2 biosynthetlc gene of the présent invention can also be prepared by total chemical synthesis based on the base sequence Information.
in the présent Invention, UK-2 ls a compound represented by the following formula (8):
[Chem. 8]
(8) wherein R represents a linear or branched saturated aliphatic acyi group or a linear or branched unsaturated aliphatic acyl group. Preferably, UK-2 is a compound wherein
R ls an Isobutyryi group (2-methylpropanoyl group) (UK-2A), a compound wherein R ls a tlgloyl group (trans-2-methyl-2-butenoyl group) (UK-2B), a compound wherein R ls an
2-methylbutanoyl group (UK-2D).
isovaleryl group (3-methylbutanoyl group) (UK-2C) and a compound wherein R is a
Moreover, In the présent Invention, the UK-2 biosynthetic gene ls a gene encoding a protein having an activity capable of induclng UK-2 blosynthesls. The activity capable of Induclng UK-2 blosynthesls can be evaluated by, for example, a method described in Exampie 9 later. Specifically, after a nucleic acid for encoding the 5 test protein is Inserted Into a vector which ls subjected to Introduction or the like into a host cell (for example, Streptoverticiiiium sp. 3-7), the amount of UK-2 produced In the host cell ls measured by forced expression of the test protein In the host cell. If the amount produced ls larger than that in a host cell In which the test protein is not expressed, it can be evaluated that the test protein has an activity capable of induclng 10 UK-2 blosynthesls.
In the state of the art, If the Information on the base sequence of the UK-2 biosynthetic gene ls available, those skilled In the art can modlfy the base sequence and obtain a nucleic acid encoding a protein Involved In UK-2 blosynthesls, although the amino acid sequence of the protein ls different from one that ls encoded from the base 15 sequence. Meanwhile, In nature aiso, the amino acid sequence of a protein to be encoded may undergo mutation by a mutation of the base sequence. Thus, another embodiment of the UK-2 biosynthetic gene of the présent Invention ls an Isolated nucleic acid that is a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31,33 or 35 in which one or more 20 amino acids are substituted, deleted, added and/or inserted. Here, more than one” refers to the number of amino acids modified In a protein Involved In UK-2 blosynthesls after the modification, provided that the protein still has an activity of Induclng UK-2 blosynthesls. The number ls normally 1 to 50, preferably 1 to 40, and more preferably 1 to several (for example, 1 to 20, 1 to 10, 1 to 8, and 1 to 4).
Those skilled in the art can préparé the nucleic acid encoding such a variant by known methods such as slte-directed mutagenesis on the basis of the Information on the base sequence of the UK-2 biosynthetlc gene.
Further, In the state of the art, If the Information on the base sequence of the UK-2 biosynthetlc gene is avallabie, those skilied in the art can obtain nudelc acids 5 (homoiogous genes) encoding a protein having an activity of induclng UK-2 biosynthesis from stralns other than Streptoverticilllum sp. 3-7 and other bacteria by a hybridization technique or a polymerase chain reaction (PCR) technique. Thus, another embodiment of the UK-2 blosynthetic gene of the present invention is an isolated nucleic acid that is a nucleic acid hybrldizlng under stringent conditions to a nucleic acid comprising a base 10 sequence of SEQ iD NO: 2, 4, 6, 8, 10, 12, 14. 16, 18, 20, 22, 24, 26, 28, 30, 32 or 34.
To isoiate such a homoiogous gene, normally a hybridization reaction is carried out under stringent conditions. The stringent conditions mean that under which the membrane washing procedure following the hybridization Is carried out at high température in a solution having a low sait concentration. The stringent conditions 15 Include washing conditions, for exampie, at a 2*SSC concentration (1*SSC: 15 mM trlsodium citrate, 150 mM sodium chloride) In a 0.5% SDS solution at 60°C for 20 minutes. Addltionaiiy, the hybridization can be carried out, for example, according to a method described In the Instruction attached to known ECL Direct DNA/RNA Labellng and Détection System (manufactured by Amersham Pharmacia Blotech Inc.).
Moreover, the protein encoded by the homoiogous gene obtained by such a method normaliy has a high homoiogy with an amino acid sequence of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35. Thus, another embodiment of the UK-2 blosynthetic gene of the present invention is an isolated nucleic acid that is a nucieic acid encoding an amino acid sequence having a homoiogy of 95% or more with 25 an amino acid sequence of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29,
31,33 or 35.
The homology of the sequences can be determined using, for example, a program of BLASTX (amino acid level) from NCBI.
As described In Examples later, the UK-2 biosynthetic gene of the présent
Invention can be used for preparlng a transformant having high UK-2 productivity, and can also be used effectlvely for screening for the UK-2 biosynthetic gene cluster.
In preparlng such a transformant and screening for the UK-2 biosynthetic gene cluster, the use of the above-descrlbed UK-2 biosynthetic genes In combination Is préférable to the indivldual use of the UK-2 biosynthetic genes. The number of the UK-2 10 biosynthetic genes in combination Is not particulariy limited, as long as the UK-2 biosynthesls can be Induced by the combination. For example, the number is 2 or larger, preferably 5 or iarger, further preferably 10 or larger, and more preferably 15 or larger. The number of the UK-2 biosynthetic genes In combination Is most preferably 17 because the UK-2 productivity In the transformant can be significantly Improved.
The UK-2 biosynthetic genes In combination may exlst as a single nucleic acid or as separate nucleic acids.
The présent Invention provides a nucleic acid comprising a base sequence of SEQ ID NO: 1 as a single nucleic acid (UK-2 biosynthetic gene cluster) comprising the 17 UK-2 biosynthetic genes. The locations of open reading frames (ORFs) of the genes 20 in the nucleic acid comprising the base sequence of SEQ ID NO: 1 are as shown in Table 1 described later.
As described In Example later, the nucleic acid comprising the base sequence of SEQ ID NO: 1* can be Isolated by first syntheslzing an appropriate primer on the basls of the information on the base sequence of the UK-2 biosynthetic gene, and the like, and then carrylng out PCR using the primer with a template of a cosmid genomic DNA library of Streptovertlcllllum sp. 3-7 prepared Independently, followed by colony hybridization using the obtained amplification product as a probe.
<Vector>
The présent invention provides a vector in which the UK-2 biosynthetlc gene of the présent invention ls Inserted. The vector of the présent invention can be constructed based on a self-repücating vector, i.e., for exampie, a plasmid which exists as an extrachromosomal element, and which replicates independently of the réplication of the chromosome. Alternative^, the vector of the présent invention may be repllcated 10 together with the chromosome of a host cell such as a bacterlum, after introduced into the host cell and Incorporated into the genome thereof. As a procedure and a method for constructing the vector of the présent Invention, any procedure and method commonly used in the field of genetic engineering can be used.
Those skilled in the art can select as appropriate the vector of the présent 15 invention from known vectors according to the type of the host cell to be Introduced. Examples of the known vectors Inciude cosmid vectors (SuperCos 1 cosmid vector and the like), phage vectors, pUC based plasmids (pCR2.1-TOPO plasmid vector and the like), pBluescript based plasmids, and pBR322 plasmids.
To express the protein encoded by the UK-2 biosynthetlc gene of the présent invention in the host cell, the vector of the présent Invention preferably comprises, In addition to the gene, a DNA sequence for regulating the expression, a marker gene for selecting the transformed host cell, and the like.
Examples of the DNA sequence for regulating the expression inciude a promoter, an enhancer and a terminator. The example also Includes a lactose operon capable of inducing expression of the gene located downstream by addition of isopropyl-P-D-thiogalactopyranoslde (IPTG) to the bacteria. The vector of the présent invention can be constructed, for example, by operably ligatlng a promoter and a termlnator respectively upstream and downstream of the UK-2 biosynthetlc gene of the présent invention.
The marker gene can be selected as approprlate according to the method for selecting the transformed host cell (transformant). For example, a gene encoding drug résistance or a gene complementlng the auxotrophy can be used. ln a case where the host cell used Is a bacterlum, examples of the marker gene Include an amplcllln 10 résistance gene, a kanamycln résistance gene, and a tétracycline résistance gene. Partlcularly, ln a case of an actlnobacterlum, the examples Include an apramycln résistance gene, a thlostrepton résistance gene, a hygromydn résistance gene, a kanamycln résistance gene, a streptomycln résistance gene, a vlomycin résistance gene, and the like. tn a case of a yeast, the examples Include a tryptophan blosynthetase 15 gene (TRP1). a uracll blosynthesls gene (URA3). a leucine blosynthesls gene (LEU2). and the like. In a case of a mold, the examples Include a hygromydn résistance gene, a blalaphos résistance gene, a bleomycln résistance gene, an aureobasidln résistance gene, and the like. tn a case of a plant, the examples indude a kanamycln résistance gene, a blalaphos résistance gene, and the like.
«Transformant etc.>
The présent invention provides a transformant in which the vector of the présent invention is introduced (for example, a bacterlum In which UK-2 blosynthesls is Induced and UK-2 productlvlty is Improved by introducing the vector of the présent invention).
Moreover, the présent invention provides a transformant ln which UK-2 blosynthesls Is induced and UK-2 productlvlty is Improved, and in which the UK-2 blosynthetlc gene of the présent Invention Is Inserted ln a genome thereof.
The host cell which Is transformed by the Introduction of the vector of the présent Invention or the host cell In the genome of which the UK-2 blosynthetlc gene of the 5 présent Invention Is not particulariy limited. Examples thereof Include actlnobacterla, Escharichia coli, Bacillus subtills, yeasts, filamentous fungi, Corynabactarium glutamicum, plant cells, Insect cells, and animal cells. From the vlewpolnt of UK-2 productlvlty, actlnobacterla are préférable, bacteria belonglng to the genus Straptovartlclllium and bacteria belonglng to the genus Straptomyces are more 10 preferably, bacteria belonglng to the genus StraptovarticUllum are even more preferably,and Straptovarticillium sp. 3-7 Is particulariy préférable.
The method for Introduclng the vector of the présent Invention Into the host cell Is not particulariy limited. it can be selected and employed as appropriate by those skilled in the art from known transformation methods such as conjugal transfer, phage 15 transduction, a calcium Ion method, a lithium Ion method, an electroporatlon method, a PEG method, an Agrobacterlum method, and a partlcle gun method, depending on the type of the host cell under test. Moreover, ln a case where the vector comprising the marker gene Is Introduced to the host cell, the transformant of the présent Invention can be efficlently prepared by culturlng ln a medium to which an antibiotic corresponding to 20 the drug résistance gene is added or ln a medium which Is déficient ln a nutrlent corresponding to the gene complementlng the auxotrophy.
Further, the présent Invention provides a bacterlum In which UK-2 blosynthesls Is induced and UK-2 productlvlty Is improved by Improvement ln fermentation conditions, mutation induction, or the like. Furthermore, it has been revealed as described ln 25 Examples later that comprising at least two copies of the UK-2 blosynthetlc gene of the présent Invention Induces UK-2 biosynthesis and significantly Improves UK-2 productlvlty.
Thus, the présent Invention also provides a bacterium In which one or two or more copies of the UK-2 biosynthetic gene of the présent Invention are présent per cell. From the viewpolnt of UK-2 productivity, such bacteria are preferably actinobacteria, more 5 preferably bacteria beionging to the genus Streptoverticiilium and bacteria belonglng to the genus Streptomyces, and further preferably bacteria beionging to the genus Streptoverticiilium. Additionaliy, from the viewpolnt of UK-2 productivity, the number of copies of the UK-2 biosynthetic gene of the présent Invention per cell is preferably two or larger. Note that the number of copies of the UK-2 biosynthetic gene of the présent 10 invention per cell can be identified, for example, by a PCR method as described In Examples later.
<Method for Determining UK-2 Productivity*
The présent Inventors hâve Isolated and Identified genes necessary for biosynthesis of UK-2, and therefore hâve made it possible to détermine UK-2 productivity 15 by detecting the presence of the genes. Thus, the présent Invention also provides a method for determining UK-2 productivity, comprising detecting, In a test bacterium, the presence of a nucieic acid comprising a base sequence of the UK-2 biosynthetic gene of the présent Invention or a base sequence complementary to the sequence.
In the method of the présent Invention, the test bacterium ls not particulariy 20 limited. Examples thereof Include actinobacteria (bacteria beionging to the genus Streptoverticiilium, bacteria beionging to the genus Streptomyces, and the like), Escherlchla coll, Bacillus subtllls, yeasts, filamentous fungl, and Corynebacterlum glutamlcum..
In the method for determining UK-2 productivity of the présent invention, the base sequence of the UK-2 blosynthetlc gene of the présent invention to be detected, that is, the base sequence of the nucieic acid of the présent invention, is a base sequence of at ieast one nucieic acid selected from the group consisting of the above-described (a) to (q).
The nucieic acid and so forth can be detected directly by targeting a genomlc DNA including the nucieic acid and so forth or a transcription product from the genomlc DNA. Altemativeiy, the nucieic acid and so forth can also be detected Indirectly by targeting a translation product from the transcription product (a protein encoded by the UK-2 blosynthetlc gene of the présent Invention). Further, the détection of the nucieic acid and so forth can empioy any of known methods. ln a case of targeting the genomlc DNA, it is possible to empioy, for example, an ln situ hybridization (1SH) method, a genomlc PCR method, a direct sequencing method, a southern blotting method, and an analysis method using a genome microarray. in a case of targeting the transcription product, it is possible to empioy, for example, a PCR method, a direct sequencing method, a northern blotting method, a dot plot method, and an analysis method using a cDNA microarray. ln a case of targeting the translation product, exemples of the known methods inciude Immunological methods using an antibody against a protein encoded by the UK-2 blosynthetlc gene of the présent Invention (a western blotting method, an ELISA method, flow cytometry, Immunohistochemical stainlng, Imaging cytometry, radlolmmunoassay, Immunoprécipitation, an analysis method using an antibody array, and the like). Among these methods, préférable is a PCR method, and more préférable ls a PCR method in which the nucieic acid is amplified using a primer comprising a base sequence of SEQ ID NO: 45 and a primer comprising a base sequence of SEQ ID NO: 46.
Additionally, ln the method of the présent Invention, from the viewpoint of achlevlng more accurate détermination of UK-2 productivlty, It ls préférable to detect the presence of multiple nucleic acids (the UK-2 blosynthetic genes of the présent Invention) described above, rather than detecting the presence of one of the nucleic acids. The number of the nucleic acids to be detected Is, for exampie, two or larger, preferably five or larger, more preferably 10 or iarger, and even more preferably 15 or iarger. Detecting 6 all of the 17 nucleic acids Is particularly préférable, and detecting a single nucleic acid comprising all the 17 nucleic acids (the nucleic acid comprising the base sequence of SEQ iD NO: 1) is the most préférable. Furthermore, besldes the entire iength of the nucleic acid, a portion thereof is targeted In a normal practice for detecting the presence of the nucleic acid. Thus, In the method of the présent Invention also, the détection of 10 the nucleic acid and so forth may be détection of a portion of the nucleic acid and so forth. Those skllied In the art can select as approprlate the Iength of the portion of the nucleic acid to be detected by the method of the présent invention, depending on the détection method.
Then, If the presence of the nucleic acid In the test bacterium can be detected by IS such a method, the test bacterium is determined to hâve UK-2 productivité Additlonally, the method of the présent Invention may further comprises culturlng the test bacterium in which the presence of the nucleic acid can be detected, In conditions that allow UK-2 to be produced.
In addition, the présent Invention also provides a bacterium In which UK-2 20 biosynthesis Is Induced and UK-2 productlvlty Is Improved, and In which the presence of the nucleic acid comprising the base sequence of the nucleic acid of the présent Invention or the base sequence complementary to the sequence Is detected by the method for determining UK-2 productlvlty of the présent invention. From the vlewpolnt of UK-2 productlvlty, such bacterla are preferably actlnobacterla, more preferably 25 bacterla belonglng to the genus Streptovertlcllllum and bacterla belonging to the genus
Streptomyces, and even more preferably bacteria belonglng to the genus
Streptoverticlllium.
Note that, as used herein, the above-described bacteria and so forth having the UK-2 blosynthetlc gene of the présent Invention, that is, the bacterlum In which UK-2 blosynthesls 1s induced and UK-2 productlvlty Is Improved, and in which the presence of the nucielc acid Is detected by the method for determining UK-2 productlvlty of the présent Invention, the transformant In which UK-2 blosynthesls Is Induced and UK-2 productlvlty is Improved by Introducing the vector of the présent Invention, the transformant In which UK-2 blosynthesls Is Induced and UK-2 productlvlty 1s Improved, and ln which the UK-2 blosynthetlc gene of the présent Invention Is Inserted ln a genome thereof, the bacterlum ln which one or two or more copies of the UK-2 blosynthetlc gene of the présent Invention are présent per ceil, and the bacterlum ln which UK-2 blosynthesls Is Induced and UK-2 productlvlty Is improved by improvement in fermentation conditions, mutation induction, or the like, are hereinafter coliectlveiy referred to as bacteria etc. of the présent Invention.
<Method for Produclng UK-2>
The présent invention provides a method for produclng UK-2, comprising the step of:
culturlng the bacteria etc. of the présent Invention, and coilectlng UK-2 from a culture of the bacteria etc..
The bacteria etc. can be cultured by seiectlng the medium, the culture condition, and the like as appropriate according to a conventional method. As the medium, commonly used components can be used. For example, as the carbon source, It Is possible to use glucose, sucrose, cellulose, starch syrup, dextrin, starch, glycerol, molasses, animal and vegetable oils, or the like. Moreover, as the nitrogen source, It ls possible to use soybean flour, wheat germ, pharmamedla, corn steep liquor, cottonseed meal, broth, peptone, polypeptone, malt extract, yeast extract, ammonium sulfate, sodium nitrate, urea, or the like. Besldes, If necessary, It ls effective to add Inorganic 5 salts which can produce sodium, potassium, calcium, magnésium, cobalt, chlorlne, phosphorlc acid, suifurlc acid and other Ions; exampies of the Inorganic salts Include potassium chloride, calcium carbonate, dlpotasslum hydrogen phosphate, magnésium sulfate, monopotassium phosphate, zinc sulfate, manganèse sulfate, and copper sulfate. Additionally, If necessary, It ls also possible to add various vitamins such as thiamine 10 (thiamine hydrochloride and the like), amino acids such as glutamlc acid (sodium glutamate and the like) and asparagine (DL-asparagine and the like), trace nutrients such as nudeotide, and sélective drugs such as antibiotics. Further, organic and inorganic substances to promote growth of the bacterium and the UK-2 production can be added as appropriate. The pH of the medium is not particularly limited, and may be adjusted 15 according to the type of the bacteria etc. to be cultured. For example, the pH is approxlmately 6 to 8.
Those skilled in the art can select and set as appropriate the culture conditions according to the type of the bacteria etc. to be cultured, the type of the medium to be used, and so forth. For example, the culture method can be selected from known 20 culture methods such as a shaklng culture method under an aérobic condition, an aerated and agitated culture method and an aérobic submerged culture method. The aerated and agitated culture method ls preferabie. An appropriate culture température ls 15°C to 40eC. In many cases, the culture température ls set around 26°C to 37°C. Moreover, the culture perlod is preferably 2 days to 25 days when the maximum 25 accumulation of UK-2 ls achleved.
In the présent Invention, the culture refers to a medium obtained by cuiturlng the bacterla etc. ofthe présent Invention, the medium containing the prollferated bacterla etc., a sécrétion and a métabolite of the bacterla etc., and the like. The culture also
Includes a dilution and a concentrate of these.
ln the culture, UK-2 Is accumulated ln both of the bacterla etc. and the medium.
Thus, an example of the method for collecting UK-2 from the medium of the culture Is an extraction method using an organic solvent such as ethyi acetate, chloroform, and dîchloromethane which do not mix with water freely, and which are capable of effectively extracting UK-2. Meanwhile, from the bacterla etc. of the culture, for example, UK-2 10 can be collected by extraction, with an organic solvent such as acetone, on the bacterla etc. which has been obtained by means such as filtration or centrifugation. Further, UK-2 can be coliected by extraction ln the same way as the above-described extraction from the medium, after the bacterla etc. of the culture has been dlsrupted using glass beads or the like.
Moreover, ln collecting UK-2 from the culture, UK-2 can be Isolated and purified by subjectlng a thus-prepared extraction fraction such as organic solvent to known purification techniques such as solvent transfer dissolution, normal-phase and reverse-phase chromatographies, gel filtration chromatography, and crystallization ln combination.
<Method for Producing UK-2 Derivative>
As described above, the présent Invention makes mass production of UK-2 at low cost possible. Accordingly, mass production of UK-2 dérivatives at low cost Is also made possible using UK-2 obtained by the production method of the présent Invention as the material thereof.
Thus, the présent Invention can also provide a method for producing a derlvatlve of UK-2, comprising the steps of:
culturing the bacterla etc. of the présent Invention, and collecting UK-2(UK-2A, UK-2B, UK-2C or UK-2D) from a culture of the bacterla etc.; and syntheslzlng a derlvatlve of UK-2 represented by any one of the following formulae (1) from the collected UK-2
[Chem. 9]
[ln the formula (1),
R represents any one of a 2-methylpropanoyl group, a trans-2-methyl-2-butenoyl group, a 3-methylbutanoyl groupand a 2-methylbutanoyl group.
R1 represents any one of a Ci.e alkyl group, a benzyl group, a Cmo alkylca rbony! group(the C^o alkylcarbonyl group may be substituted with any one of a c arboxyl group, a benzyloxycarbonyl group, a aikyloxycarbonyl group and benzy 15 ioxycarbonylamlno group), a benzoyl group, a Ci.< aikyloxycarbonyl group, a (0,.4) aikyloxycarbonyl (0,.4) alkyl group.a benzyloxycarbonyl (Cm) alkyl group may be s ubstituted with a nitro group, a C,.e alkylsuifonyl, di(Ci.e)alkylphosphoryl group, a d
Iphenylphosphory group and a substituent represented by the following formula (2);
[Chem. 10]
(ln the formula (2),
Q ls selected from the group consisting of H, CH31 CH2CH3, CF31 Ph, CH=CH2 and a cyclopropyl.
M ls selected from the group consisting of H, CH31 CH2CH31 CF3, Ph, CH=CH2 and a cyclopropyl.
T ls selected from the group consisting of O, OC(O), OC(O)O, S, SC(O), S
C(O)O and a substituent represented by the following formula (3);
[Chem. 11]
G 1s selected from the group consisting of H, Ci.B alkyl group, a CVB alkyloxy C1>B alkyl group, a C2.B alkenyl group, a C2.B alkynyl group, a C3.B cycloalkyl group,an aryl 15 group and a heteroaryl group.
G and M may form an Isobenzofuran ring optionally having an oxo group.
M and Q may form a 3-8 membered carbocycllc system.].
tn the substituent represented by the formula (2), the alkyl group,the alkynyl group, the alkenyl group, the cycloalkyl group, the aryl group and the heteroaryl group may be substituted with at least one substituent selected from the group consisting of the following substituent groups;
a Ci.e alkyl group, a C2.e alkenyl group, a C2-e alkynyl group, a C3-e cycloalkyl group, a Cs.e cycloalkenyl group, an aryl group, a heteroaryl group, a halogen atom, a nitro group, a hydroxy group, a cyano group, a Cre alkoxy group, a C2.e alkenoxy group, a C3_e cycloalkoxy group, an aryloxy group, a heteroaryloxy group, an acyloxy group, a G.e alkylacyloxy group, a C3.e cycloalkylacyloxy group, an arylacyloxy group, a 10 heteroarylacyloxy group, a Ci.e alkyloxyacyl group, a C3.e cycloalkyloxyacyl group, an aryloxyacyl group, a heteroaryloxyacyl group, a G.e alkylacyl group, a C3.e cycloalkylacyl group, an arylacyl group, a heteroarylacyl group, a Ci.e alkylacylamlno group, a C3.e cycloalkylacylamino group, an arylacylamino group, a heteroarylacylamino group, a CVfl alkylaminoacyl group, a C3.e cycloalkylaminoacyl group, an arylaminoacyl group, a 15 heteroarylaminoacyl group, a G.e alkylthio group, a C3.e cycloalkylthlo group, an arylthio group, a heteroarylthio group, a Ci_e alkylsulfonyl group, a C3.e cycloalkylsulfonyl group, an arylsulfonyl group, a heteroarylsulfonyl group, a Cve alkyisulfinyl group, a C3.e cycloalkylsulfinyl group,an arylsulfinyl group, a heteroarylsulfinyl group and -CiNOR^R* wherein R¥ and Rx are independently any one of H, a Ci.e alkyl group, a C2.e alkenyl 20 group, a C3.e cycloalkyl group, an aryl group and a heteroaryl group in which any alkyl or cycloalkyl containing substituent may be substituted with one or more halogens.
Note that, the substituent may also be substituted with at least one substituent selected from the group consisting of the following substituent groups;
a Cve alkyl group, a C2.e alkenyl group, a C2-e alkynyl group, a C3-e cycloalkyl group, a Cs.e cycloalkenyl group, an aryl group, a heteroaryl group, a halogen atom, a nitro group, a hydroxy group, a cyano group, a Cre alkoxy group, a C2.e alkenoxy group, a C3.e cycloalkoxy group, an aryloxy group, a heteroaryloxy group, an acyloxy group, a
C,.e alkylacyloxy group, a C3.e cycloalkylacyloxy group, an arylacyloxy group, a heteroarylacyloxy group, a CVe alkyloxyacyl group, a C3.e cycloalkyloxyacyl group, an aryloxyacyl group, a heteroaryloxyacyl group, a Cve alkylacyl group, a C3.e cycloalkylacyl group, an aryiacyl group, a heteroarylacyl group, a Ο,.β alkylacylamlno group, a C3.e cycloalkylacylamlno group, an arylacylamlno group, a heteroarylacylamino group, a Cva alkylamlnoacyl group, a C3.e cycloalkylamlnoacyl group, an arylaminoacyl group, a heteroarylaminoacyl group, a Ci.e alkylthio group, a C3.e cycloalkylthio group, an arylthlo 10 group, a heteroarylthio group, a Ci_e alkylsulfonyl group, a C3.e cycloalkylsuifonyl group, an arylsulfonyl group, a heteroarylsulfonyl group, a C16 alkylsulfinyl group, a C3.e cycloalkylsulfinyl group.an arylsulfinyl group, a heteroarylsulfinyl group and -C(NORX)RY wherein R* and Rx are Independently any one of H, a C,^ alkyl group, a C2.e alkenyl group, a C3.e cycloalkyl group, an aryl group and a heteroaryl group in which any alkyl or 15 cycloalkyl containing substituent may be substituted with one or more halogens.
ln addition, the présent Invention can also provide a method for produclng a UK-2A dérivative, comprising the steps of:
culturing the bacterla etc. of the présent invention, and collecting UK-2A from a culture of the bacterla etc.; and synthesizing a UK-2A dérivative represented by any one of the following formulae (4) to(7) from the collected UK-2A.
[Chem. 12]
[Chem. 14]
ln collecting UK-2A, UK-2B, UK-2C or UK-2D from the culture, UK-2A, UK-2B,
UK-2C or UK-2D can be Isolated and purified, for example, as described above, by subjecting the extraction fraction such as organic soivent to known purification techniques such as solvent transfer dissolution, normal-phase and reverse-phase chromatographles, gel filtration chromatography, and crystalilzatlon ln combination.
More specifically, the extraction fraction such as organic solvent ls concentrated under reduced pressure. The résultant is transferred to and dissolved In chloroform, and subjected to silica gel chromatography, which ls then eluted stepwise with chloroform/methanol. Thus, a fraction which contains UK-2A and UK-2D at a ratio of approxlmately 3:1, and which also contains trace amounts of UK-2B and UK-2C can be 10 obtained. Further, the fraction ls treated by reverse-phase high performance liquid chromatography (HPLC) using a C-18 column, and thus UK-2A, UK-2B, UK-2C or UK-2D can be isolated (see Patent Llterature 1).
Then, the dérivative of UK-2A, UK-2B, UK-2C or UK-2D represented by any one of the formulae (1) and (4) to (7) can be synthesized using UK-2A, UK-2B, UK-2C or 15 UK-2D thus-collected as the material thereof by, for example, the synthesls method described ln International Publication No. 2003/035617 or International Publication No. 1999/40081.
[Examples]
Herelnafter, the présent Invention wiü be more specifically described based on
Example. However, the présent Invention ls not to be limited to Exampies below.
Note that the microorganlsm described ln the présent Examples ls deposited as follows. Streptoverticillium sp. 3-7 was deposited at International Patent Organlsm Deposltary, National Institute of Advanced Industrial Science and Technology (Central 6, 1-1-1, Hlgashl, Tsukuba, Ibarakl, postal code 305-8566, Japan) on November 9, Helsel (2011) under the accession number of FERM BP-11437. Incidentally, the deposlt of the patent mlcroorganisms by International Patent Organism Depositary, National
Instltute of Advanced Industrial Science and Technology (former name: IPOD) was succeeded by National Instltute of Technology and Evaluation (NITE, #122, 2-5-8
Kazusakamatari, Kisarazu-shl, Chiba, postal code 292-0818) on April, 2012.
Streptoverticilllum sp. 3-7 was established from SAM 2084 straln described in Japanese Examlned Patent Application Publication No. Hel 07-233165, which was artlflclally mutated through a single ultraviolet Irradiation by the présent Inventors. The SAM 2084 straln ls a UK-2-producing bacterial straln obtained from soil In Kyoto préfecture of Japan and Identified under the International deposlt number FERM BP-6446.
(Example 1) «Préparation of Genomlc DNA Llbrary>
To Isolate genes necessary for biosynthesis of UK-2, first, the genomlc DNA library of Streptoverticiilium sp. 3-7 capable of produclng UK-2 was prepared by a method described below.
Streptoverticilllum sp. 3-7 was Inoculated Into 50 ml of modified YEME (0.3% Difco yeast extract, 0.5% Dlfco bacto peptone, 0.3% Oxoid malt extract, 3.0% sucrose, 1.0% glucose, 5 mmol/L MgCI2-6H2O) and shake-cultured at 220 rpm at 30°C for 18 hours. After the culturlng was complété, the bacterial cells were collected by centrifugation at 7500 rpm for 10 minutes. From the bacterial cells thus obtained, the genomlc DNA was prepared employlng the saltlng out method [see Practlcal Streptomyces Genetlcs, The John Innés Foundation, (UK), Norwlch, 2000].
The obtained genomlc DNA was partlally dlgested with a restriction enzyme Mbol.
and then treated with alkaline phosphatase to dephosphorylate the terminal of the DNA. This DNA fragment was llgated to a commerdally available cosmid vector SuperCosI (manufactured by Stratagene Corporation) which had been subjected ln advance to digestion with a restriction enzyme Xbal. an alkaline phosphatase treatment for 6 déphosphorylation and further digestion with a restriction enzyme BamHI. Thus, a recombinant cosmid vector was prepared. This recombinant cosmid vector was subjected to ln vitro packaging using MAXPLAX Lambda Packaging Extracts manufactured by Epicentre Biotechnologies. Escherichla coil XLI-Blue MRA was infected therewith to préparé the cosmid genomlc DNA iibrary.
(Example 2) <Estimation of UK-2 Blosynthetic Gene>
Based on the genomlc DNA prepared by the method described In Example 1, construction of the mate-pair iibrary for Roche GS FLX Titanium sequencer was entrusted to Genaris, Inc. Then, this sequencer was used to détermine the sequence.
Separately from this, based on the genomlc DNA, the fragment library for this sequencer was constructed. Then, this sequencer was used to détermine the sequence. The sequence obtained from the mate-pair library and the sequence obtained from the fragment library were co-assembed together to obtain the contig sequence and the scaffold sequence.
UK-2 has a characteristic 3-hydroxypicolinic acid skeleton. Meanwhile, virginiamycin also has a hydroxypicolinic acid skeleton. Two genes (visA, visB) Involved in the biosynthesis of virginiamycin hâve been disclosed (see Non Patent Literature 2). Thus, a homology analysis was conducted between the amino acid sequence of the proteins encoded by these two genes and the proposed amino acid sequence obtained from the genome of the UK-2 producing bacterium to examine the existence of genes Involved in formation of the hydroxyplcoünlc acid skeleton. Tables 1 and 2 show the obtained resuit.
[Table 1]
CJ ο
ORF name SEQ ID NO: Location tn base sequence of SEQ ID NO: 1 ORF direction Protein encoded by ORF
SEQ ID NO: The number of amino acid residues
ORFÎ 2 1-681 + 3 226
0RF2 4 674-2560 - 5 628
0RR3 6 2590-4200 - 7 536
0RF4 8 4377-4559 - 9 60
0RF5 10 4550-5686 - 11 378
0RF6 12 5800-7485 - 13 561
0RF7 14 7637-8884 + 15 415
0RF8 16 9109-9654 + 17 181
0RF9 18 9671-10201 - 19 176
ORFÎO 20 10302-11078 - 21 258
0RF11 22 11121-12422 - 23 433
ORFI 2 24 12814-16644 - 25 1276
ORFÎ 3 26 16649-26383 - 27 3244
ORFI 4 28 26814-27986 - 29 390
ORFÎ 5 30 28051-29112 - 31 353
ORFÎ 6 32 29275-29904 + 33 209
ORFÎ 7 34 29978-31318 35 446
[Table 2]
i i 1 i 1 1 i 1 1 i ! i 1 J 1 j | - - i 1 : • j 1
ê 1 8 s B s s Ç 2 s 8 s 8 C s s F. «0
s i 1 5 â i ! i t i i i & i 1 R ft' e c ft ? S c ft ! i H S B O E O ft ê i 8 ft i
p ! 4 1 5 < w II 11 II II 11 p *0 J II II Il 11 II 11 II 1' II
Jl i 1 1 I 1 i 5 i 1 e» 1 J 5 5 ? 1 ! i 1 1 1 1 i 1 l 1 1 >
h M « • M e M « V = c ft V M s c R ft X
1 ! g g i S o E O E C E o g o § Ê Q M E e f* ! * ! 40 E O 40 § F» E O
As a resuit of the examination, the position where genes having a high homology with VIsA and VisB were consecutlvely located was found out as a single position on the genome derived from Streptovertlcllllum sp. 3-7 (see Table 1). Moreover, It was found out that genes associated with a non-rlbosomal peptide synthetase (NRPS) and a polyketide synthase (PKS) which were thought to be necessary to form the UK-2 skeleton 5 were located near these genes (see Table 2). A région around the genes was expected to be a UK-2 biosynthetlc gene cluster because the secondary métabolite genes of actlnobacterla form a cluster. Further, there Is an alignment between the genes (ORFs) located In the UK-2 blosynthetic gene cluster and putative functlons of proteins encoded by the respective genes as follows.
ORF1 Is a gene potentlally Invoived in the régulation of the blosynthetic gene cluster. ORF5, ORF6, ORF7, and ORF16 are genes invoived In the biosynthesls of the 3-hydroxypicollnlc acid skeleton. ORF2, ORF3, and ORF17 are genes invoived In the biosynthesls of a benzylmalonic acid skeleton. ORF13 Is a gene invoived in the biosynthesls of a picollnic acid skeleton, serine, and lactic acid. ORF11 and ORF12 are genes Invoived in the biosynthesls of benzylmalonic acid and metabolism of picollnic acid, serine, and lactic acid. ORF8 is a gene invoived in the cleavage of a thloester bond of a polyketide synthase (PKS) and metabolism of picollnic acid, serine, lactic acid, and benzylmalonic acid.
(Example 3) «Screening of Genomlc DNA Library*
A portion of the sequence of ORF5 located upstream of the UK-2 blosynthetic genes was used as a probe for screening of the genomic DNA library prepared in Example 1, and prepared by PCR as described beiow.
PCR was carried out using the genomlc DNA described in Example 1 as a template and oligo DNAs of visA’-F: 5'-GGGGCAGCCTGCTCGGCGAG-3’ (SEQ ID NO: 36) and visA’-R: 5’-GGTGAGCTCCCCGATCAGGG-3’ (SEQ ID NO: 37) as primers. The PCR was performed using LA Tag DNA polymerase (manufactured by Takara Bio Inc.) as a DNA polymerase and PERKIN ELMER GeneAmp PCR System 9700. The amount of the reaction solution was adjusted to 50 pl by addition of: 0.5 μΙ (corresponding to 0.5 pg in amount) of the genomlc DNA, 25 pl of a buffer for two-fold concentration reaction accompanying the enzyme, 2.5 pl of a DMSO solution, 5 pl of a 2.5-mM dNTP solution, 0.25 pl of each of the primers whose concentration was adjusted to 100 pmol/pl, 0.3 pl of the enzyme, and 16.2 pl of sterilized water. The reaction was carried out as follows: the pretreatment at 95eC for 10 minutes; incubation ln 30 cycles each consisting of 95’C for 30 seconds, 55eC for 30 seconds, and 72°C for 2 minutes; further Incubation at 72°C for 5 minutes. After the reaction was complété, a portion of the reaction solution was electrophoresed on an agarose gel. As a resuit, it was confirmed that approximately 1.3 kbp of a DNA fragment was specifically amplified. Then, the remaining reaction solution was subjected to extraction with a mixture solution (phenol:chloroform:isoamyl alcohol=25:24:1, V/V) for nucleic acid purification, followed by éthanol précipitation. The precipitate was dissolved again ln sterilized water, and electrophoresed on an agarose gel. Approximately 1.3 kbp of a band was eut out according to a conventional method, and a DNA fragment was coliected.
Colony hybridization was carried out using the DNA fragment as a probe and ECL Direct DNA/RNA Labeling and Détection System (manufactured by Amersham Pharmacia Biotech Inc.), and approximately 5000 colonies were screened. Several positive clones were obtained. A plasmid pUK2-B44 was isolated from one of the clones.
Further, a portion of ORF13 located downstream of the UK-2 biosynthetic genes was used as a probe, and prepared by PCR as described below.
PCR was carried out using the genomic DNA described In Example 1 as a template and ollgo DNAs of calC-F: 5'-GCGCTCGTACGCCTCGCTGAT-3· (SEQ ID NO: 38) and calC-R: 5’-CGGGCTCGGTGGTGAGCAGG-3* (SEQ ID NO: 39) as prlmers. The PCR was performed usina LA Taa DNA polymerase (manufactured by Takara Bio Inc.) as a DNA polymerase and PERKIN ELMER GeneAmp PCR System 9700. The amount of the reaction solution was adjusted to 50 pl by addition of: 0.5 μΙ (corresponding to 0.5 pg In amount) of the genomic DNA, 25 μΙ of a buffer for two-fold concentration reaction accompanylng the enzyme, 2.5 μΙ of a DMSO solution, 5 μΙ of a 2.5-mM dNTP solution, 0.25 μΙ of each of the prlmers whose concentration was adjusted to 100 pmol/μΙ, 0.3 μΙ of the enzyme, and 16.2 μΙ of sterlllzed water. The reaction was carried out as follows: the pretreatment at 95°C for 10 minutes; Incubation In 30 cycles each consisting of 95°C for 30 seconds, 59°C for 30 seconds, and 72°C for 2 minutes and 20 seconds. After the reaction was complété, a portion of the reaction solution was electrophoresed on an agarose gel. As a resuit, It was confirmed that approximately 2.3 kbp of a DNA fragment was specifically ampllfled. Then, the remaining reaction solution was subjected to extraction with the above-descrlbed mixture solution for nucleic acid purification, followed by éthanol précipitation. The precipitate was dissolved agaln In sterllized water, and electrophoresed on an agarose gel. Approximately 2.3 kbp of a band was eut out according to a conventional method, and a DNA fragment was collected.
Colony hybridization was carried out using the DNA fragment as a probe and ECL Direct DNA/RNA Labellng and Détection System (manufactured by Amersham Pharmacia Blotech Inc.), and approximately 5000 colonies were screened. Several positive clones were obtained. A plasmld pUK2-E4 was Isolated from one of the clones.
(Example 4) <Constructlon of Plasmld pUK2-3 Comprising Biosynthetic Gene Cluster>
Using the thus-obtalned plasmlds pUK2-B44 and pUK2-E4 respectively comprising the upstream région 1 to 21531 and the downstream région 16211 to 34641 of the expected biosynthesis cluster, a plasmid comprising the entire biosynthesis cluster région was constructed. First, both of the plasmlds were digested with restriction 5 enzymes Clal and PspXI. followed by eiectrophoresls on agarose gels, and approximately 28 kbp and approximately 19 kbp of bands were respectively eut out according to a conventional method, and DNA fragments were collected. The DNA fragments were ligated using DNA Ligatlon Klt<Mlghty Mlx> (manufactured by Takara Bio Inc.) to préparé pUK2-16.
Next, using the redirect technology described ln [Gust, B., et al, Proceedlngs of the National Academy of Sciences of the United States of Amerlca, (US), 2003, vol. 100, pp. 1541-1546], the plasmid pUK2-16 was used as a vector capable of conjugal transfer to actlnobacterla. First, the plasmid pUK2-16 was Introduced In an E. coli BW25113/plJ790 strain by electroporation, and an E. coli BW25113/plJ790/pUK2-16 strain was obtained. This strain was Inoculated Into 100 ml of an LB liquid medium (1% bacto tryptone, 0.5% yeast extract, 0.5% sodium chloride) containing chloramphenicol, kanamycln and amplclilln respectively at concentrations of 25 pg/ml, 50 pg/ml and 50 pg/ml, and cultured at 30°C overnlght. Then, 100 μΙ of the culture solution was Inoculated Into 10 ml of an SOB medium (2% bacto tryptone, 0.5% yeast extract, 0.05% sodium chloride, 0.0186% potassium chloride) prepared ln a 65-ml test tube containing chloramphenicol, kanamycln, amplclilln and L-arablnose respectively at concentrations of 25 pg/ml, 50 pg/ml, 50 pg/ml and 10 mM. The resulting culture was shake-cuitured at 30°C for 4 hours. The bacterlal cells were collected from ail of the culture solution, washed twice with an Ice-cooled 10% glycerin solution, and resuspended to 100 μΙ of the
10% glycerin solution as cells for electroporation. Meanwhile, 5.2 kb of an Sspl fragment containing oriT, attP. lnt<pC31 and an apramycin résistance gene derived from a plasmid pMJCOSI (John Innés Centre (Norwich)) was purified. The DNA fragment (approximately 100 ng) and 50 μ! of the cells thus prepared were transferred to an already ice-cooled cuvette with a gap of 2 mm, and subjected to electroporation (using 5 Electro Cell Manlpulator 600: manufactured by BM Equipment Co., Ltd.). After the treatment, 1 ml of a cooied LB ilquld medium was added to the résultant, which was allowed to stand at 37°C for 1 hour for cuituring. This was then applied to an LB agar medium containing amplcillln and apramycin, and cultured at 37°C ovemight. The grown strain was cultured In an LB ilquld medium containing amplcillln and apramycin, 10 and a plasmid pUK2-3 was isoiated. This pUK2-3 is a piasmld which ls capable of conjugal transfer to actlnobacterla, and which has oriT. attP. lnt<pC31 and the apramycin résistance gene In the vector portion and the entire région expected to be the UK-2 biosynthesis ciuster.
(Example 5) <Construction of Blosynthetlc Gene-Deficient Vector>
A gene disrupted straln déficient in approximately 7.5 kbp corresponding to portions of ORF12 and ORF13 from the genomic DNA of Streptoverticillium sp. 3-7 was prepared by the method described beiow.
PCR was carried out using the genomic DNA described in Example 1 as a 20 template and ollgo DNAs of calC-F: S’-GCGCTCGTACGCCTCGCTGAT-S’ (SEQ ID NO:
38) and 41c29-R: 5'-GTCCGTGGCGCCGCCGGATT-3’ (SEQ ID NO: 40) as primers. The PCR was performed using LA Tag DNA polymerase (manufactured by Takara Bio inc.) as a DNA polymerase and PERKiN ELMER GeneAmp PCR System 9700. The amount of the reaction solution was adjusted to 50 pi by addition of: 0.5 pl (corresponding to 0.5 pg ln amount) of the genomlc DNA, 25 pl of a buffer for two-fold concentration reaction accompanying the enzyme, 2.5 pl of a DMSO solution, 5 pl of a
2.5-mM dNTP solution, 0.25 pl of each of the primers whose concentration was adjusted to 100 pmol/pl, 0.3 pl of the enzyme, and 16.2 pl of sterilîzed water. The reaction was carried out as follows: the pretreatment at 95°C for 10 minutes; Incubation ln 30 cycles each consisting of 95°C for 30 seconds, 60°C for 5 seconds, and 72°C for 7 minutes. After the reaction was complété, a portion of the reaction solution was electrophoresed on an agarose gel. As a resuit, It was confirmed that approximateiy 7.5 kbp of a DNA fragment was specifically ampllfied. The DNA fragment was Inserted Into a 10 pCR2.1-TOPO plasmid vector using TOPO TA clonlng kit (manufactured by Invltrogen
Corporation) ln accordance with the protocol attached thereto. Thereby. a plasmid TOPO-41c29 was obtained.
Subsequently, an apramycln résistance gene was Inserted Into the Inserted fragment of the plasmid TOPO-41c29 to préparé a plasmid TOPO-zMlc29-Am as follows.
A plasmid plJ773 [Gust, B., et al., Proceedings of the National Academy of
Sciences of the United States of Amerlca,” (US), 2003, vol. 100, pp. 1541-1546] was double-dlgested with Hlndlll and EcoRI. followed by electrophoresis on an agarose gel. Then, a DNA fragment was eut out according to a conventional method and coliected. Thus, approximateiy 1.3 kb of a DNA fragment comprising the target apramycln 20 résistance gene was obtained. PCR was carried out using this fragment as a template and two types of synthetic primers of 41c30-apraF: S’-GTCACCGTCCCCGCCTACGGCGACGGCGTCGTCCTGGTGATTCCGGGGATCCGTC GACC-3' (SEQ ID NO: 41) and 41c30-apraR:
5-GGTCGCGGGCGAAGGCGTAGCCGGGCAGGTCGGGCAGGATGTAGGCTGGAGCTG 25 CTTC-3' (SEQ iD NO: 42). The PCR was performed using LA Taq DNA polymerase (manufacturée! by Takara Blo Inc.) as a DNA polymerase and PERKIN ELMER GeneAmp
PCR System 9700.
The amount of the reaction solution was adjusted to 50 μΙ by addition of: 0.5 μΙ (corresponding to 0.5 pg In amount) of the genomic DNA, 25 μΙ of a buffer for two-fold 5 concentration reaction accompanying the enzyme, 2.5 μΙ of a DMSO solution, 5 μΙ of a
2.5-mM dNTP solution, 0.25 μΙ of each of the prlmers whose concentration was adjusted to 100 pmol/μΙ, 0.3 μΙ of the enzyme, and 16.2 μΙ of sterlllzed water. The reaction was carried out as follows: the pretreatment at 94°C for 2 minutes; Incubation In 10 cycles each consisting of 94°C for 45 seconds, 50°C for 45 seconds, and 72°C for 1 minute and
30 seconds; then, Incubation In 15 cycles each consisting of 94°C for 45 seconds, 55°C for 45 seconds, and 72°C for 1 minute and 30 seconds; a further reaction at 72°C for 5 minutes. After the reaction was complété, a portion of the reaction solution was electrophoresed on an agarose gei. As a resuit, It was confirmed that approxlmately 1.4 kbp of a DNA fragment was specificaliy ampllfled.
Next, TOPO-zl41c29 was Introduced In E. coli BW25113/plJ790 [Gust, B., et al.,
Proceedings of the National Academy of Sciences of the United States of Amerlca, (US), 2003, vol. 100, pp. 1541-1546] to obtain an E. coli BW25113/plJ790/TOPO-/]41c29 strain. This strain was Inoculated into 100 ml of an LB liquid medium containing chioramphenlcol, kanamycln and amplciilln respectively at concentrations of 25 pg/ml, 25 pg/ml and 50 pg/ml, and cultured at 30°C overnight. Then, 10 ml of an SOB medium was fed Into a 65-ml test tube supplemented with chioramphenlcol, kanamycln, amplciilln, and L-arablnose respectively at concentrations of 25 pg/ml, 25 pg/ml, 50 pg/ml, and 10 mM. To this, 100 μΙ of a culture solution of the E. coli BW25113/plJ790/TOPO-/]41c29 strain cultured overnight was transferred, and shake-cultured at 30°C for 4 hours. Ail of the culture solution was centrlfuged at 3000 rpm at 4°C for 5 minutes to collect the bacterial cells which were then suspended in 10 ml of an ice-cooled 10% glycerln solution. After this operation was repeated, the resulting bacterial cells were resuspended In 100 pl of a cooled 10% glycerln solution. Next, 50 pl of the bacterial cell-suspension was collected Into an Eppendorf tube to which 5 pl of a 5 solution of approximately 1.4 kb of a DNA fragment containing the above-described apramycin résistance gene derived from plJ773 was added. The mixture was transferred to an already ice-cooled electroporation cuvette with a gap of 2 mm (BM6200: manufactured by BM Equlpment Co., Ltd.). Electroporation was conducted using Electro Cell Manipulator 600 (manufactured by BM Equipment Co., Ltd.) under conditions 10 of 12.5 kV, 25 pF, and 128 Ω. After the treatment, 1 ml of an already ice-cooled LB liquid medium was added to the bacterial cells, which were then allowed to stand at 37°C for 1 hour for cuiturlng. This was applied to an LB agar medium supplemented with ampiclllin and apramycin each at a concentration of 50 pg/mi. The résultant was cultured at 37°C ali the night to obtain a straln having résistance to both of ampiclllin and 16 apramycin. This strain was cultured In an LB liquid medium supplemented with amplcillin and apramycin each at a concentration of 50 pg/ml. Thus, a plasmid TOPO-.Z141 c29-Am was Isolated.
(Example 6) <Creation of Biosynthetic Gene-Deficient Strains*
The piasmid TOPO-2dl1c29 was Introduced In an E. coli ET12567/pUZ8002 strain
[Practical Streptomyces Genetics, The John Innés Foundation, (UK), Norwich, 2000] according to a conventionai method to obtain E. coli ET12567/pUZ8002/TOPO-2441c29.
Streptoverticiilium was conjugated to E. coli ET12567/pUZ8002/TOPO-2dl1c29 as foliows. First, the Streptoverticiilium strain was inocuiated into 10 ml of a liquid medium (S#1) [Uekl, M, et al, The Journal of Antibiotics, (Japan), 1996, vol. 49, pp.
639-643] prepared ln a 65-ml test tube, and cultured at 30°C for 24 hours. The résultant was applied to an MS agar medium (2% soybean flour, 2% mannitol, 2% agar), and cultured at 30°C for 2 days. After the culturing, myceiia were collected by scraping with ml of 20% glycerol to préparé a host mycélium solution.
After the bacterial cells were collected by centrifugation at 3000 rpm for 5 minutes, the bacterial cells were suspended in 3 ml of a 20% glycerin solution. Meanwhile, E. coil ET12567/pUZ8002/TOPO-zMlc29-Am was cultured at 37°C for 18 hours ln an LB liquid medium supplemented with ampicillin and apramycin each at a concentration of 50 pg/ml. Then, 1 ml of the culture solution was transferred to 100 ml of an LB liquid medium (containing ampicillin and apramycin each at a concentration of 50 pg/ml), and cultured at 37°C for 4 hours. Subsequentiy, 50 mi of the culture solution was centrifuged at 3000 rpm for 5 minutes to coliect the bacterial cells. The bacterial cells were suspended in 20 ml of an LB liquid medium. After this operation was repeated twice, the bacterial cells were suspended in 2 ml of an LB liquid medium.
Next, 100 μΙ of the Streptovertlclllium cell-suspension and 100 μΙ of a bacterial cell-suspension of E. coil ET12567/pUZ8002/cosmld203-7 were combined together ln a
1.5-mi tube, and centrifuged to coliect bacterial cells. After suspended in 100 μΙ of a 20% glycerin solution, this was applied to an MS agar medium having a volume of 20 ml and containing 10 mM MgCla. After the cuituring at 30°C for 18 hours, 1 ml of steriiized water containing 400 pg of apramycin and 1500 pg of naiidixic acid was overlaid thereon. After cultured at 30°C for 5 days, Streptovertlclllium colonies grown on the agar medium were subjected to pure culture and cultured at 30°C for 2 days ln a 1/2 MS agar medium (agar: 2%, mannitol: 1%, soybean flour: 1%, 10 mM MgClj) supplemented with 250 pg/ml of apramycin and 250 pg/ml of kanamycln. A colony grew In any plate and was subcultured for severai passages by: inoculation Into an S#1 medium, followed by culturlng at 30°C for 24 hours, inoculation Into an modified YEME medium (10 ml In a 65-ml test tube), followed by shake-culturing at 30°C for 1 day, and further Inoculation of 1 ml of the resulting culture Into another fresh modified YEME medium (50 ml In a 250-ml Erienmeyer flask). After this operation was repeated five times, the resulting culture was diluted In such a manner as to obtain an approprlate number of living bacterial cells. This culture solution was applied to a 1/2 MS agar medium containing 250 pg/ml of apramycln, and cultured at 30°C for 4 days. A colony thus grown was repllcated In a 1/2 MS agar medium supplemented with 250 pg/ml of apramycln and 250 pg/ml of kanamycln. Two kanamycln-susceptlble strains (D1 strain, D2 straln) were selected which did not grow In a kanamycin-contalning medium but grew In an apramycln-contalning medium.
The genomic DNAs of the obtained two strains were prepared, and a PCR reaction was carried out using a combination of primers of 41c30F4: 5’-CGTGACCGAGGTGGCGCG-3- (SEQ iD NO: 43) and 41c30RR2:
5’-GTCGTCGGATGCGCCGTGCG-3‘ (SEQ ID NO: 44). It was confirmed that the two strains were dlsrupted strains as designed because approximately 0.5 kbp of an amplified DNA fragment was not obtained.
(Example 7) <Culturing of Blosynthetlc Gene-Deficlent Strains, and Quantification of UK2A in Culture Solution*
The disrupted strains, D1 straln and D2 straln, were each inoculated Into 50 ml of an S#1 medium [Uekl, M, et al, The Journal of Antlblotics, (Japan), 1996, vol. 49, pp. 639-643] prepared in a 250-ml Erienmeyer flask, and shake-cultured at 30°C for 24 hours. Then, 1 ml of the culture solution was Inoculated Into a production medium, and shake-cultured at 30°C for 4 days. Then, 4 ml of acetone was added to 1 ml of the resulting culture solution to thereby extract UK-2A which was then filtered to obtain an extraction liquid. Of this, 5 pi was subjected to HPLC analysis, ln the HPLC analysis, 5 HPLC System LC-2010C (manufactured by Shlmadzu Corporation) was used for the analysis. As the analysis conditions, the column was Inertsll ODS-3 4.6X250 mm, the mobile phase was acetonitrlle:water:phosphoric acid=60:40:0.1, the flow rate was 1.1 ml/min, the column température was 40°C, and the UV wavelength was 340 nm. The obtained pattern was compared with that of the UK-2A reference standard. The peak 10 derived from UK-2A was Identlfled. Based on the area thereof, UK-2A was quantified.
At the same time, the same culturing and quantification of UK-2A ln a culture solution were carried out also for Streptovarticillium sp. 3-7, which was the parental strain of the transformants. As a resuit, the UK-2A productlvlty by the D1 and D2 strains was 0 pg/ml.
(Example 8) <Creation of Blosynthetlc Gene Cluster-lntroduced Transformant»
Constructed pUK2-3 was introduced ln Streptovarticillium sp. 3-7 according to a method generally used for actlnobacterla (Practlcal Straptomyces Genetlcs, The John Innés Foundation, (UK), Norwich, 2000, pp. 311-338]. First, the plasmld pUK2-3 was 20 Introduced In an E. coli ET12567/pUZ8002 strain by electroporatlon according to a conventional method to obtain E. coli ET12567/pUZ8002/pUK2-3. This strain was cultured at 37°C for 18 hours in an LB liquid medium supplemented with chloramphenlcol, kanamycln and apramycln respectively at concentrations of 25 pg/ml, 50 pg/ml and 50 pg/ml. Then, 1 mi of the culture solution was transferred to 100ml of an
LB liquid medium (containing chloramphenicol, kanamycin and apramycin respectiveiy at concentrations of 25 pg/ml, 25 pg/ml and 50 pg/ml), and cultured at 37°C for 4 hours.
Subsequently, 50 ml of the culture solution was centrifuged at 3000 rpm for 5 minutes to collect the bacterial cells. The bacterial ceils were suspended In 50 ml of an LB liquid medium. After this operation was repeated twice, the bacterial cells were suspended in
100 pL of an LB liquid medium.
Meanwhile, Streptovertlciilium sp. 3-7 was applied to an MS agar medium, and cultured at 30°C for 2 days. After the culturing, mycella were scraped with 1 ml of 20% glycerol to préparé a host mycélium solution.
Next, 500 pl of the host mycélium solution and 500 pl of the Escherichla coit solution comprising the plasmld pUK2-3 prepared as described above were mixed together, and the bacterial celis were collected. Then, the bacterial cells were applied to an MS agar medium which had been diluted by addition of 10 mM MgCi2 ln such a manner as to brlng the final concentration to 10 mmol/L. After the culturing at 30°C for
20 hours, 0.5 ml of sterllized water containing 6 mg of apramycin and 0.5 mg of nalidlxlc acid was overlald thereon. After further cultured at 30°C for 5 days, a transformant was obtained as an apramycin-reslstant strain.
(Example 0) <Culturlng of Gene-lntroduced Transformant, and Quantification of UK-2A in
Culture Solution*
The gene-lntroduced transformant was cultured by the method described in Example 7. As a resuit, as shown ln Table 3, the UK-2A productivity of the gene-introduced transformantwas Improved 58 to 77 times ln comparison with that ofthe parental strain.
[Table 3]
S trains Produotivity in culture solution (pg/ml) Relative produotivity
UK-2A
Parental strain (3-7) 2 1
Transformant 1 (3-7-1) 116 58
Transformant 2 (3—7—2) 153 77
(Example 10) <Culturlng of Gene-lntroduced Transformant, and Quantifications of UK-2A,
UK-2B, and sum of UK-2C and UK-2D ln Culture Solution*
The gene-lntroduced transformant was cultured by the method described in
Example 7. Specifically, 4 ml of acetone was added to 1 ml of the resulting culture solution to thereby extract UK-2A, UK-2B, UK-2C and UK-2D which were then filtered to obtain an extraction liquid. Of this, 5 μΐ was subjected to HPLC analysis, ln the HPLC 10 analysis, HPLC solution system (manufactured by Shlmadzu Corporation) was used for the analysis. As the analysis conditions, the column was Inertsll ODS-3 4.6X150 mm;
the mobile phase was a solution obtained by dissolvlng 7.8 g of sodium dihydrogen phosphate dihydrate ln approximately 800 mL of water, adjusting the pH of the résultant to 4.0 using phosphoric acid, adding water thereto to préparé 1000 ml of a phosphoric 15 acid aqueous solution, and adding 650 mL of acetonitrile for liquid chromatography to
350 mLof the phosphoric acid aqueous solution; the flow rate was 1.0 ml/min; the column température was 40°C; and the UV waveiength was 230 nm. The obtained pattern was compared with those of the UK-2A, UK-2B, and UK-2C and UK-2D reference standards. The respective peaks derived from UK-2A, UK-2B, UK-2C and UK-2D were Identified.
Based on the areas thereof, the amount of UK-2A, the amount of UK-2B, and the sum of
UK-2C and UK-2D were determined.
As a resuit, as shown in Table 4, the productlvltles of UK-2A, UK-2B, and the sum of UK-2C and UK-2D of the gene-lntroduced transformant were respectively Improved 37 5 to 57 times, 10 to 11 times, and 12 to 13 times In comparison with those of the parental straln.
[Table 4[
Ot
C3
Strains UK-2A UK-2 B UK-2C end UK-2D (sum)
Productivity in culture solution (pg/ml) Relative productivity Productivity in culture solution (pg/ml) Relative productivity Productivity în culture solution (μβ/ml) Relative productivity
Strain (3-7) 10 1 1 1 7 1
Transformant (3-7-1) 368 37 11 11 86 12
Transformant (3-7-2) 565 57 10 10 89 13
(Example 11) «Quantification of Number of Copies of UK-2 Biosynthetic Gene Cluster In Transformant»
Genomlc DNAs of the two stralns of the transformant confirmed in Example Θ to hâve the UK-2 productlvlty Improved and Streptoverticlllium sp. 3-7, which was the host cell, were prepared by the method described in Example 1. PCR reactions were carried out using the genomlc DNAs as tempiates and StepOnePlus Real-TIme PCR System (manufactured by Applied BioSystems Inc.) In accordance with the protocol attached thereto. Ampllfied fragments thus obtained were quantified. Table 5 shows the 10 obtained resuit.
Note that, In the PCR reactions, the following primer set was designed, syntheslzed and used to ampllfy a région in the introduced UK-2 biosynthetic gene cluster.
UK-2 F2 (RT): 5’-GCACCTTCATGTCCGGGTTG-3’ (SEQ ID NO: 45)
UK-2 R2 (RT): 5’-ATCGCCGCGTACACCATGAC-3’ (SEQ ID NO: 46).
Further, the following primer set was designed, syntheslzed and used as an Internai control to ampllfy a région other than the UK-2 biosynthetic gene cluster.
cont F1 (RT): 5’-CGAAGGTCCGGTTGATGGTG-3’ (SEQ iD NO: 47)
Cont R1 (RT): 5’-ATCGCTGCGACACCCTGGAG-3’ (SEQ iD NO: 48)
[Table 5]
Strains Number of copies
Parental strain (3—7) 1.00
Transformant (3-7-1) 2.35
Transformant (3-7-2) 2.08
As shown In Table 5, It was revealed that the number of copies of the UK-2 blosynthetic gene cluster In the transformant was double that of the parental strain sp. 3-7.
[Industrial Applicability]
As described herelnabove, the present Invention makes It possible to provide a transformant having high UK-2 productlvlty by introduction of a UK-2 biosynthetlc gene or a UK-2 blosynthetic gene cluster.
Therefore, by using the transformant of the present Invention, mass production of
UK-2 at iow cost Is made possible. Accordingly, the present Invention Is useful In produclng rlce blast control agents, agrlcultural and hortlcultural funglcides, and medical antlfungal agents.
[Reference to Deposlted Bioiogicai Material]
[Accession Number]
1.
(1) Indication for Identification: Streptovertlcllllum sp. 3-7 (2) Accession number: FERM BP-11437 (3) Date of déposition: November 9, 2011 (4) Deposltory Institution: International Patent Organlsm Depositary, National Institute of Advanced Industrial Science and Technology (5) The deposlt of the patent mlcroorganlsms by International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (former name: IPOD) was succeeded by National Institute of Technology and Evaluation (NITE) on Aprii, 2012.
[Sequence Listing Free Text]
SEQ ID NOs: 36 to 48 <223> Artlficially syntheslzed primer sequence

Claims (7)

  1. (CLAIMS] [Claim 1]
    An Isolated nucleic acid that Induces UK-2 biosynthesls and improves UK-2 productlvlty, the nucleic acid is at least one nucleic acid selected from the group consisting of the following (a) to (q):
    (a) a nucleic acid encoding a protein comprising an amlno acid sequence of SEQ ID NO: 3t a nucielc acid encoding a protein comprising an amlno acid sequence of SEQ ID NO: 3 ln which one or more amlno acids are substituted, deleted, added and/or Inserted, a nucielc acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 3, or a nucielc acid hybrldizlng under strlngent conditions to a nucielc acid comprising a base sequence of SEQ ID NO: 2;
    (b) a nucielc acid encoding a protein comprising an amlno acid sequence of SEQ ID NO: 5, a nucleic acid encoding a protein comprising an amlno acid sequence of SEQ ID NO: 5 ln which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amlno acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 5, or a nucleic acid hybrldizing under stringent conditions to a nucleic acid comprising a base sequence of SEQ iD NO: 4;
    (c) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 7, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 7 in which one or more amino acids are substituted, deleted, added and/or inserted, a nucleic acid encoding an amlno acid sequence having a homology of 95% or more with an amlno acid sequence of SEQ ID NO: 7, or a nucleic acid hybridizing under stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 6;
    (d) a nucleic acid encoding a protein comprising an amlno acid sequence of SEQ
    ID NO: 9, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 9 In which one or more amino acids are substituted, deleted, added and/or
    Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 9, or a nucleic acid hybrldlzlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 8;
    (e) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 11, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 11 In which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 11, or a nucleic acid hybrldlzlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 10;
    (f) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 13, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 13 In which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 13, or a nucleic acid hybrldlzlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 12;
    (g) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 15, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 15 In which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 15, or a nucleic acid hybrldlzlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 14;
    (h) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 17, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 17 In which one or more amino acids are substituted, deleted, added and/or
    Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 17, or a nucleic acid hybridizing under
    5 stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 16;
    (I) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 19, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 19 In which one or more amino acids are substituted, deieted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or 10 more with an amino acid sequence of SEQ ID NO: 19, or a nucleic acid hybridizing under stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 16;
    (j) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 21, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 21 in which one or more amino acids are substituted, deleted, added and/or
    15 inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 21, or a nucleic acid hybridizing under stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 20;
    (k) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 23, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
    20 ID NO: 23 in which one or more amino acids are substituted, deleted, added and/or inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 23, or a nucielc acid hybridizing under stringent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 22;
    (l) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 25, a nucieic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 25 in which one or more amino acids are substituted, deieted, added and/or
    Inserted, a nucieic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 25, or a nucieic acid hybrldlzing under 5 strlngent conditions to a nucieic acid comprising a base sequence of SEQ ID NO: 24;
    (m) a nucieic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 27, a nucieic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 27 in which one or more amino acids are substituted, deieted, added and/or inserted, a nucieic acid encoding an amino acid sequence having a homology of 95% or 10 more with an amino acid sequence of SEQ ID NO: 27, or a nucieic acid hybridizing under stringent conditions to a nucieic acid comprising a base sequence of SEQ ID NO: 26;
    (n) a nucieic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 29, a nucieic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 29 In which one or more amino acids are substituted, deieted, added and/or
    15 Inserted, a nucieic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 29, or a nucieic acid hybridizing under stringent conditions to a nucieic acid comprising a base sequence of SEQ ID NO: 28;
    (o) a nucieic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 31, a nucieic acid encoding a protein comprising an amino acid sequence of SEQ 20 ID NO: 31 In which one or more amino acids are substituted, deieted, added and/or
    Inserted, a nucieic acidencoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 31, or a nucieic acid hybridizing under stringent conditions to a nucieic acid comprising a base sequence of SEQ ID NO: 30;
    (p) a nucieic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 33, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ
    ID NO: 33 ln which one or more amino acids are substituted, deleted, added and/or
    Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 33, or a nucleic acid hybrldlzlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 32; and (q) a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 35, a nucleic acid encoding a protein comprising an amino acid sequence of SEQ ID NO: 35 ln which one or more amino acids are substituted, deleted, added and/or Inserted, a nucleic acid encoding an amino acid sequence having a homology of 95% or more with an amino acid sequence of SEQ ID NO: 35, or a nucleic acid hybridizlng under strlngent conditions to a nucleic acid comprising a base sequence of SEQ ID NO: 34.
  2. [Claim 2]
    The nucleic acid according to claim 1, comprising ali the nucleic acids of ( a) to (q).
  3. [Claim 3]
    The nucleic acid according to claim 2, comprising a base sequence of SEQ ID NO: 1.
  4. [Claim 4]
    A vector ln which the nucleic acid according to any one of clalms 1 to 3 is Inserted, for Inducing UK-2 biosynthesis and improving UK-2 productlvlty.
  5. [Claim 5]
    A method for determining UK-2 productlvlty, comprising detecting, ln a test bacterium, the presence of a nucleic acid comprising a base sequence of the nuci elc acid according to any one of claims 1 to 3 or a base sequence complementar y to the sequence.
  6. [Claim 6]
    The method according to claim 5, wherein a method for detectlng the presence of
    5 the nucleic acid Is a PCR method.
  7. [Claim 7]
    The method ln claim 6, wherein the PCR method Is a method ln which the nucleic acid Is ampllfled using a primer comprising a base sequence of SEQ ID NO: 45 and a primer comprising a base sequence of SEQ ID NO: 46.
    10 [Claim 8]
    A bacterium in which UK-2 blosynthesls is induced and UK-2 productlvlty Is improved, and In which the presence of the nucleic acid comprising the base sequence of the nucleic acid according to any one of claims 1 to 3 or the base sequence complementary to the sequence Is detected by the method according to claim 5.
    15 [Claim 9]
    A bacterium ln which UK-2 blosynthesls is induced and UK-2 productlvlty Is improved by Introducing the vector according to claim 4.
    [Claim 10]
    A bacterium ln which UK-2 blosynthesls is induced and UK-2 productlvlty Is
    20 improved, and ln which the nucleic acid according to claim 1 Is inserted in a genome thereof.
    [Claim 11]
    A bacterium ln which one or two or more copies of a nucleic acid comprising a base sequence of the nucleic acid according to any one of claims 1 to 3 are présent per cell.
    [Claim 12]
    5 The bacterium according to any one of claims 8 to 11, which is any one of
    Streptovertlcllllum, Streptomyces, Escherlchla coli, Baclllus subtills, yeasts, filamentous fungl and Corynebacterlum glutamlcum.
    [Claim 13]
    A method for producing UK-2, comprising the step of:
    10 culturing the bacterium according to any one of claims 8 to 12, and collecting
    UK-2 from a culture of the bacterium.
    [Claim 14]
    A method for producing a derivatlve of UK-2, comprising the steps of:
    culturing the bacterium according to any one of cialms 8 to 12, and collecting
    15 UK-2 from a culture of the bacterium; and syntheslzlng a derivatlve of UK-2 represented by any one of the following formuiae (1) from the collected UK-2 [Chem. 1] [ln the formula (1),
    R represents any one of a 2-methylpropanoyi group, a trans-2-methyl-2-butenoyl group, a 3-methylbutanoyl groupand a 2-methylbutanoyi group.
    R1 represents any one of a Cm alkyl group, a benzyl group, a Cmo alkylca rbonyl group(the Cmo alkylcarbonyl group may be substituted with any one of a c arboxyl group, a benzyloxycarbonyl group, a Cm aikyloxycarbonyl group and benzy loxycarbonylamino group), a benzoyl group, a Cm aikyloxycarbonyl group, a lkyioxycarbonyl(C1.4)aikyl group,a benzyloxycarbony^Cj.Jaikyi group may be (Ci-4)a substit uted with a nltro group, a Cm alkylsulfonyl, di(C,.e)alkylphosphoryl group, a diphen ylphosphory group and a substituent represented by the following formula (2);
    [Chem. 2J (2) (ln the formula (2),
    Q ls selected from the group consisting of H, CH3, CH2CH3, CF31 Ph, CH=CH2 and a cyclopropyl.
    M Is selected from the group consisting of H, CH3, CH2CH3, CF3, Ph, CH=CH2 and a cyclopropyl.
    T is selected from the group consisting of O, OC(O), OC(O)O, S, SC(O), S
    5 C(O)O and a substituent represented by the following formula (3);
    [Chem. 3] * O)
    G is selected from the group consisting of H, Ci.e alkyl group, a Ci.e alkyioxy Ci.e alkyl group, a C2.e aikenyl group, a C2.8 alkynyl group, a C3.e cycloalkyl group,an aryl 10 group and a heteroaryl group.
    G and M may form an Isobenzofuran ring optionally having an oxo group.
    M and Q may form a 3-8 membered carbocyclic system.].
    [Claim 15]
    A method for producing a UK-2A derivative, comprising the steps of:
    15 culturlng the bacterium according to claim 8, and collectlng UK-2A from a culture of the bacterium; and syntheslzlng a UK-2A derivative represented by any one of the following formulae (4) to (7) from the collected UK-2A.
OA1201500005 2012-07-09 2013-07-08 UK-2 biosynthetic genes and method for improving UK-2 productivity using the same OA17159A (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
JP2012-153986 2012-07-09

Publications (1)

Publication Number Publication Date
OA17159A true OA17159A (en) 2016-03-28

Family

ID=

Similar Documents

Publication Publication Date Title
US9315785B2 (en) Pyripyropene a biosynthetic gene
RU2587632C2 (en) Method of producing pyripyropene
US9771606B2 (en) UK-2 biosynthetic gene and method for improving UK-2 productivity using the same
OA17159A (en) UK-2 biosynthetic genes and method for improving UK-2 productivity using the same
US7670827B2 (en) Strain belonging to the genus Streptomyces and being capable of producing nemadictin and process for producing nemadictin using the strain
CN102260644B (en) Mutant strain of Streptomyces flaveolus and construction method and application thereof
US20120330022A1 (en) Method for producing pyripyropene derivatives by the enzymatic method
KR20130097538A (en) Chejuenolide biosynthetic gene cluster from hahella chejuensis
JP2004173537A (en) Biosynthesis gene for kanamycin