NZ793522A - Human antibodies from transgenic rodents with multiple heavy chain immunoglobulin loci - Google Patents

Abstract

The invention relates to transgenic animals useful for optimal production of functional immunoglobulins with human idiotypes.

Description

The invention relates to transgenic animals useful for optimal tion of functional immunoglobulins with human idiotypes.

NZ 793522 HUMAN ANTIBODIES FROM TRANSGENIC RODENTS WITH MULTIPLE HEAVY CHAIN IMMUNOGLOBULIN LOCI This application is a onal of New Zealand patent application 755816, which is the national phase entry in New Zealand of PCT international application (published as are incorporated herein by reference.

FIELD OF INVENTION The invention relates to transgenic s useful for the production of immunoglobulins with human idiotypes in rodents, and methods for making the same. The invention r relates to compositions and s for the production of humanized and fully human dies using polynucleotides derived from modified large regions on bacterial artificial chromosomes and their ed tandem integration. Crossbreeding of independently obtained transgenic animals allowed the sion of highly e human antibody repertoires using many different, potentially all, human VH, D and JH ts.

Expression is managed in vivo by regulating separate integration sites in unison such as to obtain VH gene diversity and choice without interference.

BACKGROUND OF THE INVENTION Human monoclonal antibodies have proven to be invaluable in therapeutic applications, either as IgG of conventional size, single chains or domain modules (Chan & Carter Nature reviews. Immunology 10, 6 (2010); Enever et al. Current opinion in hnology 20, 405-411 (2009)). Despite the successes there are still major shortcomings in their production, which relies either on specificity selection of available human material and subsequent modification of individual products, or the immunization of the limited availability of transgenic animals (Brüggemann et al. Part I: Selecting and shaping the dy molecule, Selection Strategies III: Transgenic mice, in ok of Therapeutic Antibodies.

Ed. Dübel, S. Wiley-VHC, 69-93 (2007)).

DNA rearrangement and expression of human immunoglobulin (Ig) genes in transgenic s was pioneered over 20 years ago by stably inserting heavy-chain genes in germline configuration (Bruggemann, M. et al. PNAS 86, 6709-6713 (1989)). One problem associated with the therapeutic application of non-human immunoglobulins is the potential immunogenicity of the same in human patients. In order to reduce the immunogenicity of such preparations, various strategies for the production of chimeric, partially human (humanized) and fully human antibodies have been developed. Chimeric dies comprise a human constant region and a binding region encoded by non-human V-genes. The ability to produce transgenic antibodies having a human pe in nonhuman s is particularly desirable as n binding determinants lie within the idiotype region, and man idiotypes are thought to contribute to the immunogenicity of current antibody therapeutics. Human idiotype is an ally important consideration in respect of monoclonal antibody therapeutics, which consist of a single idiotype delivered at relatively high concentration as opposed to the variety of idiotypes delivered at lower concentrations by a onal antibody mixture.

Major improvements resulting in higher expression levels and exclusive production of human Ig, combined two new strategies: gene knock-out in nic stem (ES) cells (Kitamura et al.

Nature 350, 423-426 (1991)) and locus extension on artificial chromosomes (Davies et al. Nucleic acids research 21, 767-768 (1993)). Silencing of the endogenous Ig genes by gene targeting in ES cells produced several inactive mouse lines without the ability to rearrange their IgH and lgL locus or without ing fully functional IgH, IgK or IgL products. More recently zinc finger nucleases (ZFNs) were designed to te pecific double-strand breaks in Ig genes, which allowed gene disruption by on and non-homologous DNA repair. Injection of ZFN plasmids into fertilized eggs produced Ig silenced rats and rabbits with IgH and IgL disruptions(Geurts, A.M. et al. Science 325, 433 ; t, S. et al. European l of immunology 40, 2932-2941 (2010); Flisikowska, T. et al. PloS one 6, e21045 (2011)).

A significant technical challenge encountered with many prior art approaches to producing humanized transgenic dies in non-human animals relates to the apparent competition between duplicate Ig loci in the same animal, e.g, an existing or endogenous Ig locus and an exogenous or artificial locus introduced into the transgenic animal. Historically, in the absence of effective knock-out the endogenous locus outcompetes the exogenous locus for antibody production, such that the duplicate locus is effectively silenced (Lonberg et al., Nat Bio, 23, 1117, 2005; Nicholson et al. J Immunol, 163, 6898, 1999; Brüggemann et al., AITE 63, 101, 2015). In this regard, therefore, the prior art does not address or resolve whether duplicate Ig loci integrated at different chromosomal sites can act cooperatively in the production of transgenic antibodies in the same host animal, and in fact would reasonably suggest to the d artisan that the opposite is true.

Another technical challenge encountered with the tion of transgenic antibodies having a human idiotype in non-human animals is the difficulty with ing the full complement of human immunoglobulin VDJ or VJ gene-segments used to generate the human dies. Some have attempted to address the problem by introducing megabase-sized fragments from the human heavy and kappa light chain loci.

However, this approach has only proven sful with roughly 80% of the human immunoglobin gene included in the germ-line configuration and has relied on the use of protoplasts to deliver the large fragments of the relevant chromosomes with a yeast artificial chromosome (YAC) system (US 5,939,598).

While integration of ive overlapping VH D JH s, such as to maintain the full functionality of the IgH locus and essential for DNA rearrangement, have been utilized in transgenic animals in order to maximize antibody diversity, the overlapping integration had primarily been reported for much smaller regions (<100 kb) (Wagner et al.

Genomics 35, 4 (1996); Bruggemann et al. European journal of immunology 21, 1323- 1326 (1991)) or with larger regions but still having a d repertoire at a single integration site 4/093908; Bruggemann et al.). At the time of filing, the common understanding in the art was that spreading or multiple integration of BAC or YAC mixtures were rare and would be a disadvantage for breeding to homozygosity. Moreover, laborious integration of large YACs into stem cells and subsequent animal derivation therefrom was more commonly performed (Mendez et al. Nature genetics 15, 146-156 (1997); Davies et al. Biotechnology (N Y) 11, 911-914 (1993)).

Optimal production of immunoglobulins or antibodies maximizing the diversity of antibodies with human idiotypes using transgenic animals with the full complement of human V-genes remains a nge for the generation of novel specificities for therapeutic applications in a broad range of disease areas.

SUMMARY OF INVENTION The current invention resolves the foregoing uncertainties in the art with the provision of a transgenic animal comprising a plurality of artificial Ig heavy chain loci comprising duplicate/overlapping human immunoglobulin VDJ or VJ gene segments integrated at ent chromosomal sites, and lacking the capacity to produce endogenous globulin. The method used to te these enic animals comprising the insertion of two different loci in two different locations on two different chromosomes surprisingly produced functional B cells that advantageously avoids allelic exclusion and provides increased antibody diversity as a result of the full complement of human immunoglobulin VDJ heavy chain gene segments integrated into the genome of the transgenic animal.

In one aspect of the invention, novel polynucleotides are disclosed comprising nucleic acid ces encoding chimeric immunoglobulin chains, particularly ic heavy chains for use in creating enic animals. The polynucleotides of the present invention advantageously provide optimal expression due, at least in part, to the inclusion of a 3' enhancer since transloci lacking this 3' er result in impaired isotype switching and low lgG expression. ingly, in preferred embodiments the invention provides chimeric polynucleotides comprising a rat 3' enhancer sequence, an Ig constant region gene and at least one human glubulin (Ig) joining (J) region gene. In a preferred embodiment, the rat 3' enhancer sequence comprises the ce set forth as SEQ ID NO:1, or a portion thereof.

In one embodiment, the chimeric polynucleotides set forth herein may further comprise at least one human variable (V) gene, at least one diversity (D) gene, or a combination thereof. In one embodiment, the constant region gene of the ic cleotide is selected from the group consisting of a human constant region gene and a rat constant region gene. In a preferred embodiment, the constant region gene is a rat constant region gene. In another preferred embodiment, the constant region gene is ed from the group consisting of Cµ and Cγ.

In one embodiment, the chimeric polynucleotide comprises a nucleic acid ce substantially homologous to the bacterial artificial chromosome (BAC) Annabel disclosed herein (e.g., SEQ ID NO:10, or a portion thereof), and may optionally further comprise at least one human variable Ig gene able from a BAC6-VH3-11 and BAC3 construct and/or from a BAC9 and 5 construct. In a preferred embodiment, the chimeric polynucleotides contemplated herein comprise nucleic acid sequences (a) and (b) in 5' to 3' order: (a) a human Ig variable region comprising human V genes in natural configuration isolatable from a BAC6-VH3-11 and BAC3 construct and/or a BAC9 and BAC14/5 construct, and (b) a human Ig joining region comprising human J genes in natural configuration isolatable from the BAC Annabel. In another embodiment, each of the human Ig variable region, human Ig ity region, human Ig joining region, the Ig constant region and the rat 3' er region of a chimeric polynucleotide as disclosed herein are in the relative positions as shown in . In another embodiment, a chimeric polynucleotide as disclosed has a sequence comprising or substantially homologous to the ce set forth as SEQ ID NO:2 or a portion thereof. In another embodiment, a ic polynucleotide as disclosed has a sequence comprising or substantially homologous to the sequence set forth as SEQ ID NO:11, or a portion thereof.

In a further embodiment, a chimeric polynucleotide as disclosed herein ses a rearranged V-D-J s, wherein said rearranged V-D-J s encode a heavy chain le domain exon.

In one embodiment, the transgenic animal further comprises a chimeric polynucleotide wherein said human Ig V region comprises at least one human V region gene isolatable from BAC9 and/or BAC14/5. In a preferred embodiment, the chimeric polynucleotides comprise nucleic acid sequences (a) and (b) in 5’ to 3’ order: (a) a human Ig variable region comprising human V region genes in natural configuration used (or rearranged) from BAC9 and/or BAC14/5; and (b) a human Ig joining region comprising human J region genes in natural configuration used (or rearranged) from the bacterial artificial chromosome (BAC) Annabel. In r embodiment, each of the human immunoglobulin variable region (gene), the human immunoglobulin diversity region (segment), the human immunoglobulin joining region (segment), the immunoglobulin constant region gene, and the rat 3’ enhancer are in the positions shown in . In another embodiment, a chimeric polynucleotide as disclosed has a ce sing or substantially homologous to the sequence set forth in In another embodiment, a chimeric polynucleotide as disclosed has a sequence comprising or substantially homologous to the sequence set forth in or a portion f. In a r embodiment, chimeric polynucleotides as disclosed herein may comprise rearranged V-DJ , wherein said rearranged gene ts are derived from the above SEQ ID NOs and Figures.

Also disclosed herein are polynucleotides encoding human kappa light chain genes. In one embodiment, a polynucleotide as disclosed herein has a nucleic acid sequence comprising or substantially homologous to a nucleic acid sequence selected from the group consisting of RP11-1156D9 (set forth as SEQ ID NO:3) and RP11-1134E24 (set forth as SEQ ID NO:4). In another embodiment, the isolated cleotide comprises nucleic acid sequences (a) and (b) in 5' to 3' order: (a) a human Ig variable region sing human V genes in natural configuration isolatable from bacterial artificial chromosomes (BAC) RP11-156D9 and/or RP11-1134E24; (b) a human Ig g region comprising human J genes in natural configuration isolatable from the bacterial artificial chromosomes (BAC) 134E24 and/or RP11-344F17 (set forth as SEQ ID NO:5). In a preferred embodiment, each of the human Ig variable region, the human Ig joining region, and the human Ig constant region are in ve position as shown in In another embodiment, a chimeric polynucleotide as disclosed has a sequence comprising or ntially homologous to the sequence set forth as SEQ ID NO:6 or a portion thereof.

Also provided herein is a rodent cell comprising one or more polynucleotides of the invention. For e, provided herein is a rodent cell comprising a polynucleotide as sed , preferably comprising a nucleic acid sequence encoding for a chimeric heavy chain, e.g., a nucleic acid ce encoding a rat 3' enhancer sequence, an Ig constant region gene and at least one human J region gene, and optionally, comprising a nucleic acid sequence substantially homologous to the nucleic acid ce selected from the group consisting of RP11-1156D9, RP11-1134E24 and ns thereof. The rodent cell contemplated herein may further comprise a polynucleotide encoding a functional light chain, e.g., having a nucleic acid sequence comprising or substantially homologous to a nucleic acid sequence selected from the group consisting of the sequence shown in (set forth as SEQ ID NO:6), the sequence shown in (set forth as SEQ ID NO:7), and portions thereof. In one embodiment, one or more of the polynucleotides are integrated into the rodent cell genome.

In another aspect of the invention, a transgenic animal is provided which comprises at least one inactivated endogenous Ig locus and a plurality of artificial transgenic Ig heavy chain loci integrated in the animal’s genome at different chromosomal sites. In one embodiment, the transgenic animal having a plurality of artificial Ig heavy chain loci comprises (i) a V-region having at least one human V gene segment encoding a ne or hypermutated human V-region amino acid sequence; (ii) one or more J gene segments; and (iii) one or more constant region gene segments, wherein said artificial Ig heavy chain loci are functional and e of undergoing gene rearrangement and act cooperatively to produce a oire of artificial immunoglobulins. In another ment, the transgenic animal comprises the full complement of human variable heavy chain regions. In other various embodiments, the transgenic animal i) has an artificial heavy chain loci which comprises overlapping heavy chain gene segments, ii) lacks a functional endogenous Ig light chain locus and/or iii) lacks a onal endogenous Ig heavy chain locus. In yet another embodiment, the transgenic animal expresses a diverse repertoire of antibodies encoded by V-genes from transgenic immunoglobulin loci located at different chromosomal sites.

In some embodiments, the transgenic animal lacks a onal Ig light chain locus and is capable of producing heavy chain-only antibodies.

In another embodiment, the transgenic animal with at least two artificial Ig heavy chain loci has at least one artificial Ig heavy chain loci which comprises at least one human immunoglobulin (Ig) joining (J) region gene, an Ig constant region gene, and a rat 3’ enhancer. In these transgenic s the rat 3’ enhancer may comprise the sequence set forth as SEQ ID NO:1. The transgenic animal described in the above embodiments which may further comprise at least one human Ig le (V) region gene and/or a human Ig diversity (D) region gene. In other embodiments of the invention the constant region gene is selected from the group consisting of a human constant region gene and a rat constant region gene. In certain embodiments the constant region gene comprises a constant region gene ed from the group consisting of Cμ and Cγ. In s embodiments the transgenic animal comprises a nucleic acid sequence substantially homologous to bacterial artificial chromosome (BAC) Annabel, or a n thereof.

In certain embodiments, the human Ig V region of the transgenic animal comprises at least one human V region gene isolatable from BAC6-VH3-11 and/or BAC3. In a specific embodiment the transgenic animal comprises nucleic acids with (a) a human Ig variable region comprising human V region genes in natural configuration isolatable from BAC6-VH3-11 and/or BAC3; and (b) a human Ig joining region comprising human J region genes in natural configuration able from the bacterial artificial chromosome (BAC) Annabel, in 5’ to 3’ order. In one embodiment each of the human immunoglobulin variable region, the human immunoglobulin diversity region, the human immunoglobulin joining , the globulin constant region, and the rat 3’ enhancer are in the relative positions shown in . In another embodiment the transgenic animal has a nucleic acid sequence substantially homologous to the c acid sequence set forth as SEQ ID NO:2.

In yet another embodiment he enic animal has a nucleic acid sequence ntially homologous to the nucleic acid sequence set forth as SEQ ID NO:11. In some embodiments he transgenic animal has V-D-J regions which are rearranged and form a complete exon encoding a heavy chain variable domain.

In n other embodiments, the transgenic animal has an human Ig V region which comprises at least one human V region gene isolatable from BAC9-VH3-53 and/or BAC14/5. In a specific embodiment these transgenic animals comprises nucleic acids with (a) a human Ig variable region comprising human V region genes in natural uration isolatable from BAC9-VH3-53 and/or BAC14/5; and (b) a human Ig g region comprising human J region genes in natural uration isolatable from the bacterial artificial chromosome (BAC) Annabel, in 5’ to 3’ order. In one embodiment each of the human immunoglobulin variable region, the human immunoglobulin diversity region, the human immunoglobulin joining region, the immunoglobulin nt region, and the rat 3’ enhancer are in the relative positions shown in . In another embodiment the transgenic animal has a nucleic acid sequence substantially homologous to the nucleic acid sequence set forth in In yet another embodiment he enic animal has a nucleic acid sequence substantially homologous to the nucleic acid sequence set forth in In another aspect of the invention, a method for producing antibodies is provided which comprises immunizing the transgenic animal as described above with an immunogen. In one embodiment a onal antisera composition is produced wherein said antisera comprise antigen-specific antibodies encoded by V-genes encoded by transgenic immunoglobulin loci located at different somal sites. In another embodiment the method for producing a monoclonal antibody comprises (i) immunizing the transgenic animal described above with an immunogen, (ii) ing a monoclonal antibody producing cell from said transgenic animal wherein said monoclonal antibody producing cell es a monoclonal antibody that specifically binds to said immunogen; and (iii) using said monoclonal antibody producing cell to e said monoclonal antibody that specifically binds to said immunogen, or using said monoclonal antibody ing cell to produce a hybridoma cell that produces said monoclonal antibody and using said hybridoma cell to produce said monoclonal antibody.

In another ment, the method for producing a monoclonal antibody, ses (i) immunizing the transgenic animal as described above with an immunogen, (ii) isolating a monoclonal antibody producing cell from said enic animal wherein said onal antibody ing cell es a monoclonal dy that specifically binds to said immunogen; (iii) isolating from said monoclonal antibody ing cell a monoclonal antibody nucleic acid which encodes said monoclonal antibody that specifically binds to said immunogen; and (iv) using said monoclonal antibody nucleic acid to produce said monoclonal antibody that specifically binds to said immunogen. In certain embodiment the monoclonal antibody has a human idiotype.

In yet another embodiment the method for producing a fully human monoclonal antibody comprises (i) immunizing the transgenic animal as described above with an immunogen, (ii) isolating a monoclonal antibody producing cell from said transgenic animal wherein said onal antibody producing cell produces a monoclonal antibody that specifically binds to said immunogen; (iii) isolating from said monoclonal antibody producing cell a monoclonal antibody c acid which encodes said monoclonal antibody that specifically binds to said immunogen; (iv) modifying said monoclonal antibody nucleic acid to produce a recombinant nucleic acid encoding a fully human monoclonal dy; and (v) using said recombinant nucleic acid encoding a fully human monoclonal antibody to produce the encoded fully human monoclonal antibody.

Another aspect of the present invention is a monoclonal antibody produced by the method described above.

In yet another aspect a method for neutralizing an antigenic entity in a human body component is ed which comprises contacting said body component with a polyclonal antisera composition as described above, wherein said onal antisera composition comprises immunoglobulin molecules that specifically bind and neutralize said antigenic entity. In one embodiment the method for neutralizing an antigenic entity in a human body component comprises contacting a body component with the monoclonal antibody according to the above, wherein said onal antibody specifically binds to and neutralizes said antigenic entity.

BRIEF DESCRIPTION OF THE DRAWINGS A summary of the integrated chimeric (human, rat) and fully human Ig loci. The 2 chimeric human-rat IgH regions (HC14 and HC30) contain each 3 overlapping BACs with >22 different and potentially onal human VH segments. In HC14 BAC6-3 has been extended with VH3-11 to provide a 10.6 kb overlap to BAC3, which overlaps 11.3 kb via VH6-1 with the C region BAC Hu-Rat Annabel (A) and in HC30 BAC9 provides an overlap of 4.6 kb to BAC14/5, which was ed by adding VH3-43 followed by part of BAC5 and equipped with an overlap of 6.1 kb to Hu-Rat Annabel (B). The latter is chimeric and ns all human D and JH segments followed by the rat C region with full enhancer sequences. Arrows indicate the VH gene usage in HC14, HC30 and HC14/HC30 combined. Fainter bands indicate less ntly sed VH genes. Sequences were obtained by unbiased RT-PCR and NGS.

(A) The human Igk BACs with 12 Vks and all Jks provide a ~14 kb overlap in the Vk region and ~40 kb in Ck to include the KDE. (B) The human Igl region with 17 Vls and all J-Cls, including the 3’ enhancer, is from a YAC (Vincent-Fabert, C. et al.

Blood 116, 1895-1898 (2010)).

Depicts HC14 locus integration into chromosome 6 and HC30 locus ation into chromosome 15.

Analysis by ELISA of IgM and IgG concentration in serum from HC30 and HC14/HC30 animals. Each dot (HC30) or square (HC14/HC30) represents the titre (µg/ml) of one animal. IgG is further analysed for the t of IgG1 and IgG2b.

Analysis by ELISA of anti-β-gal specific antibodies from HC30 and HC14/HC30. Each dot (HC30) or square (HC14/HC30) ents the serum titre (in comparative dilution) from one animal.

BAC 9 sequence.

BAC 14/5 sequence.

DETAILED DESCRIPTION Provided herein are chimeric polynucleotides encoding a recombinant or artificial immunoglobulin chain or loci. As described above, the chimeric polynucleotides sed herein are useful for the transformation of rodents to include human Ig genes and for the production of immunoglobulins or antibodies having human idiotypes using such rodents. As further ed herein, transgenic animals are generated that comprise at least three distinct transgene constructs harboring the full complement of human immunoglobulin VDJ heavy chain gene segments ly integrated into the genome of the transgenic animal, thereby ensuring the availability of the entire human immunoglobulin genes in germline configuration in a background of te inactivation of endogenous immunoglobulin genes or locus. Unexpectedly, as demonstrated herein for the first time, a plurality of transgenic loci comprising different V-genes can act cooperatively in the expression of humanized and fully human transgenic antibodies.

DEFINITIONS Immunoglobulin refers to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes. The recognized human immunoglobulin genes include the kappa, lambda, alpha (IgA1 and IgA2), gamma (IgG1, IgG2, IgG3, IgG4), delta, n and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Full-length globulin "light chains" (about 25 Kd, or 214 amino acids) generally comprise a variable domain encoded by an exon comprising one or more variable region gene(s) and one or more g region ) at the NH2-terminus (about 110 amino acids) and constant domain encoded by a kappa or lambda constant region gene at the COOH-terminus. Full-length immunoglobulin "heavy chains" (about 50 Kd, or 446 amino acids), similarly comprise (1) a variable domain (about 116 amino acids) encoded by an exon comprising one or more variable region genes, one or more diversity region genes and one or more joining region genes, and (2) one of the aforementioned nt s comprising one or more constant region genes, e.g., alpha, gamma, delta, epsilon or mu (encoding about 330 amino acids). The immunoglobulin heavy chain constant region genes encode for the antibody class, i.e., e (e.g., IgM or IgG1).

As used herein, the term ody" refers to a protein comprising at least one, and preferably two, heavy (H) chain variable domains (abbreviated herein as VH), and at least one and preferably two light (L) chain variable domains (abbreviated herein as VL). An ordinarily skilled artisan will recognize that the variable domain of an immunological chain is encoded in gene segments that must first undergo somatic recombination to form a complete exon encoding the variable domain. There are three types of regions or gene segments that undergo rearrangement to form the variable domain: the variable region comprising variable genes, the diversity region comprising diversity genes (in the case of an immunoglobulin heavy chain), and the joining region comprising g genes. The VH and VL domains can be further subdivided into regions of hypervariability, termed "complementarity determining regions" ("CDRs") interspersed with regions that are more conserved, termed "framework regions" ("FRs"). The extent of the FRs and CDRs has been precisely defined (see, Kabat et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242; and Chothia et al. (1987) J.

Mol. Biol. 196:901-17, which are hereby incorporated by reference). Each VH and VL domain is generally composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The antigen binding fragment of an dy (or simply "antibody n," or "fragment"), as used herein, refers to one or more fragments of a full-length antibody that retain the ability to specifically bind to an n (e.g., CD3).

Examples of binding fragments encompassed within the term "antigen binding nt" of an antibody include (i) an Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) an F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) an Fd fragment consisting of the VH and CH1 domains; (iv) an Fv fragment consisting of the VL and VH s of a single arm of an antibody, (v) a dAb fragment (Ward et al. (1989) Nature 4-46), which consists of a VH domain; and (vi) an isolated complementarity ining region (CDR). Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they may be joined, using inant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH s pair to form monovalent molecules (known as single chain Fv (scFv); see, e.g., Bird et al. (1988) e 242:423-26; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-83). Such single chain antibodies are also intended to be encompassed within the term "antigen g fragment" of an antibody. These antibody fragments are obtained using tional techniques known to those skilled in the art, and the fragments are ed for utility in the same manner as are intact antibodies.

An antibody may further include a heavy and/or light chain constant domain to thereby form a heavy and light immunoglobulin chain, respectively. In one embodiment, the antibody is a tetramer of two heavy immunoglobulin chains and two light immunoglobulin chains, wherein the heavy and light immunoglobulin chains are interconnected, e.g., by ide bonds. The heavy chain constant domain is comprised of three gene ts, CH1, CH2 and CH3. The light chain constant domain is comprised of one gene, CL. The variable domains of the heavy and/or light chains contain a binding domain that interacts with an antigen. The constant domains of the antibodies typically mediate the binding of the antibody to host tissues or factors, including various cells of the immune system (e.g., or cells) and the first component (C1q) of the classical complement system.

By polynucleotide encoding an artificial immunoglobulin locus or artificial immunoglobulin chain is meant an recombinant polynucleotide sing multiple globulin regions, e.g., a variable (V) region or gene segment comprising V genes, a joining (J) gene region or gene segment comprising J genes, a diversity (D) region or gene segment comprising D genes in the case of a heavy chain locus and/or at least one nt (C) region comprising at least one C gene. Preferably, each region of the variable domain, e.g., V, D, or J region, comprises or spans at least two genes of the same type. For example a variable region as used herein comprises at least two variable genes, a g region comprises at least two joining genes and a diversity region comprises two diversity genes. A constant region may comprise only one constant gene, e.g. a κ gene or λ gene, or multiple genes, e.g., CH1, CH2, and CH3.

”Enhancer sequences” or “enhancer” as used herein refers to sequences that have been identified near many active genes by nuclease digest and hypersensitivity to degradation. Hypersensitive sites may e er sequences and the th of their activity was correlated with the DNA sequence. e to reporter genes showed elevated transcription if er function was present (Mundt et al., J. Immunol., 166, 3315[2001]).

In the IgH locus two important transcription or expression regulators have been identified, Eµ and the 3’E at the end of the locus (Pettersson et al., Nature, 344, 165 [1990]). In the mouse the removal of the whole 3’ regulatory region (containing hs3a, hs1,2, hs3b and hs4) allows normal early B-cell development but abrogates class-switch recombination (Vincent-Fabert et al., Blood, 116, 1895 [2010]) and possibly prevents the optimization of somatic hypermutation (Pruzina et al., Protein Engineering, Design and Selection, 1, [2011]). The regulatory function to achieve optimal isotype expression is particularly desirable when transgenic human IgH genes are being used. ene ucts with incomplete 3’E region, usually only providing the hs1,2 element, led to disappointing expression levels in transgenic mice even when the nous IgH locus was knocked-out. As a consequence, only few antigen-specific fully human IgGs have been isolated from constructs produced in the last 20 years (Lonberg et al., Nature 368, 856 [1994]; Nicholson et al., J. Immunol., 163, 6898 [1999]; Davis et al., Cancer Metastasis Rev. 18, 421 [1999]; Pruzina et al., Protein Engineering, Design and ion, 1, [2011]). In the rat IgH locus, the 3’E region has only been poorly ed. A comparison of mouse and rat sequences did not allow identification of hs4, the crucial 4th element with additional important regulatory sequences further downstream (Chatterjee et al., J. Biol. Chem., 286,29303 [2011]). The polynucleotides of the present invention advantageously provide optimal expression due, at least in part, to the inclusion of a rat 3’ enhancer since chimeric polynucleotides lacking this 3’ enhancer result in impaired isotype switching and low IgG expression. In one embodiment, the rat 3’ enhancer has a sequence comprising or substantially homologous to the sequence set forth as SEQ ID NO:1 or a n thereof.

As used herein, a cleotide having a sequence comprising or substantially homologous to a portion, e.g., less than the entirety, of second sequence (e.g., SEQ ID NO:1, SEQ ID NO:2, etc.) preferably retains the biological activity of the second sequence (e.g., retains the ical activity of a 3’ enhancer to provide optimal expression and/or isotype ing of immunoglobulins, is capable of rearrangement to provide a humanized chimeric heavy chain, etc.) . In one embodiment, a nucleic acid comprising a ce comprising or substantially homologous to a portion of SEQ ID NO:1 comprise at least 8 kB, preferably at least 10 kB of continuous nucleic acids that are ntially homologous to SEQ ID NO:1. In another embodiment, a second nucleic acid comprising a ce comprising or ntially homologous to a portion of SEQ ID NOs:59 or 60 comprise at least 8 kB, preferably at least 10 kB of continuous nucleic acids that are substantially homologous to SEQ ID NOs:59 or 60.

“Artificial Ig locus” as used herein may refer to polynucleotides that (e.g., a sequence comprising V-,D-, and/or J regions in the case of heavy chain, or V- and/or J regions in the case of light chain, and ally a constant region for either or both a heavy and light chain) that are ranged, partially rearranged, or rearranged. Artificial Ig loci include artificial Ig light chain loci and artificial Ig heavy chain loci. In one embodiment, an artificial immunoglobulin locus of the invention is functional and capable of rearrangement and ing a repertoire of immunoglobulin chains. In a preferred embodiment, the variable domain or portion thereof of a polynucleotide disclosed herein comprises genes in l configuration, i.e., naturally occurring sequences of an human Ig gene segment, degenerate forms of naturally occurring sequences of a human Ig gene segment, as well as tic sequences that encode a polypeptide sequence substantially identical to the polypeptide encoded by a lly occurring sequence of a human Ig gene t. In r preferred embodiment, the polynucleotide comprises a variable domain or portion thereof in a natural uration found in humans. For example, a cleotide encoding an cial Ig heavy chain as disclosed herein may comprise in natural configuration at least two human V genes, at least two D genes, at least two J genes or a combination thereof.

In a preferred embodiment, an artificial Ig locus comprises a non-human C region gene and is capable of producing a repertoire of globulins including chimeric immunoglobulins having a non-human C region. In one embodiment, an artificial Ig locus comprises a human C region gene and is capable of producing a repertoire of immunoglobulins including immunoglobulins having a human C region. In one embodiment, an artificial Ig locus comprises an ”artificial constant region gene”, by which is meant a constant region gene comprising nucleotide sequences derived from human and non-human nt regions genes. For example, an exemplary artificial C constant region gene is a constant region gene encoding a human IgG CH1 domain and rat IgG CH2 and CH3 domain.

In some embodiments, an artificial Ig heavy chain locus lacks CH1, or an equivalent sequence that allows the resultant immunoglobulin to circumvent the typical immunoglobulin: chaperone association. Such artificial loci provide for the production of heavy chain-only antibodies in transgenic animals which lack a functional Ig light chain locus and hence do not express functional Ig light chain. Such artificial Ig heavy chain loci are used in methods contemplated herein to produce transgenic animals lacking a functional Ig light chain locus, and comprising an artificial Ig heavy chain locus, which s are capable of producing heavy chain-only antibodies. Alternatively, an artificial Ig locus may be manipulated in situ to disrupt CH1 or an equivalent region and generate an artificial Ig heavy chain locus that provides for the production of heavy only antibodies. Regarding the production of heavy chain-only antibodies in light chain-deficient mice, see for example Zou et al., JEM, 204:3271-3283, 2007.

By “human idiotype” is meant a polypeptide sequence present on a human antibody encoded by an immunoglobulin V-gene segment. The term “human idiotype” as used herein includes both naturally ing ces of a human antibody, as well as synthetic sequences substantially identical to the polypeptide found in naturally occurring human antibodies. By “substantially” is meant that the degree of amino acid sequence identity is at least about 85%-95%. Preferably, the degree of amino acid sequence identity is greater than 90%, more preferably greater than 95%.

By a “chimeric antibody” or a “chimeric immunoglobulin” is meant an immunoglobulin molecule comprising a portion of a human immunoglobulin polypeptide sequence (or a polypeptide ce encoded by a human Ig gene segment) and a portion of a non-human immunoglobulin polypeptide ce. The chimeric immunoglobulin molecules of the present invention are immunoglobulins with non-human Fc-regions or artificial Fc-regions, and human idiotypes. Such immunoglobulins can be isolated from animals of the invention that have been engineered to produce chimeric immunoglobulin molecules.

By icial Fc-region” is meant an Fc-region encoded by an artificial constant region gene.

The term “Ig gene segment” as used herein refers to s of DNA encoding various portions of an Ig molecule, which are present in the germline of non-human s and humans, and which are t together in B cells to form rearranged Ig genes. Thus, Ig gene segments as used herein include V gene segments, D gene segments, J gene segments and C gene segments.

The term “human Ig gene segment” as used herein includes both naturally ing ces of a human Ig gene t, degenerate forms of lly occurring sequences of a human Ig gene segment, as well as synthetic sequences that encode a polypeptide sequence substantially identical to the polypeptide encoded by a naturally occurring sequence of a human Ig gene segment. By “substantially” is meant that the degree of amino acid sequence identity is at least about 85%-95%. Preferably, the degree of amino acid sequence identity is greater than 90%, more preferably greater than 95% Polynucleotides related to the present invention may comprise DNA or RNA and may be wholly or partially tic. Reference to a nucleotide sequence as set out herein encompasses a DNA molecule with the specified sequence, and encompasses an RNA molecule with the specified sequence in which U is substituted for T, unless context requires Calculations of ogy" or nce identity" between two sequences (the terms are used interchangeably herein) are performed as follows. The sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a red embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 80%, 90%, 100% of the length of the reference ce. The amino acid residues or nucleotides at corresponding amino acid ons or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or tide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal ent of the two sequences.

The comparison of sequences and determination of percent sequence identity between two sequences may be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch ((1970) J. Mol. Biol. -53) algorithm, which has been incorporated into the GAP program in the GCG software package (available online at m), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In yet r preferred embodiment, the t identity between two nucleotide ces is determined using the GAP program in the GCG software package (available at www.gcg.com), using a NWSgapdna. CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the one that should be used if the practitioner is uncertain about what parameters should be applied to determine if a molecule is within a ce identity or homology limitation of the invention) is a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. The percent identity between two amino acid or nucleotide sequences can also be determined using the algorithm of Meyers and Miller ) CABIOS 4:11-17), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.

ARTIFICIAL Ig LOCI The present invention is further directed to artificial Ig loci and their use in making enic animals capable of producing immunoglobulins having a human idiotype.

Each artificial Ig locus comprises multiple immunoglobulin gene segments, which include at least one V region gene segment, one or more J gene segments, one or more D gene segments in the case of a heavy chain locus, and one or more constant region genes. In the present invention, at least one of the V gene segments encodes a germline or utated human V- region amino acid ce. Accordingly, such transgenic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which include antibodies having a human idiotype. In heavy chain loci human or non-human-derived D-gene segments may be ed in the artificial Ig loci. The gene segments in such loci are juxtaposed with respect to each other in an unrearranged uration (or “the ne configuration”), or in a partially or fully nged configuration. The artificial Ig loci have the capacity to undergo gene rearrangement (if the gene segments are not fully rearranged) in the subject animal thereby ing a ified repertoire of immunoglobulins having human idiotypes.

Regulatory elements, like promoters, enhancers, switch s, recombination signals, and the like, may be of human or non-human origin. What is required is that the elements be operable in the animal species concerned, in order to render the artificial loci functional. Preferred regulatory elements are bed in more detail herein.

In one aspect, the invention provides transgenic ucts containing an artificial heavy chain locus capable of undergoing gene rearrangement in the host animal thereby producing a diversified repertoire of heavy chains having human idiotypes. An artificial heavy chain locus of the transgene contains a V-region with at least one human V gene segment. ably, the V-region includes at least about 5-100 human heavy chain V (or “VH”) gene ts. In a preferred embodiments, the V-region includes r than , greater than 25, greater than 30, greater than 35, or greater than 40 VH gene segments.

As described above, a human VH segment encompasses naturally occurring ces of a human VH gene segment, degenerate forms of naturally occurring sequences of a human VH gene t, as well as synthetic sequences that encode a polypeptide sequence substantially (i.e., at least about 85%-95%) identical to a human heavy chain V domain polypeptide.

In a preferred embodiment, the artificial heavy chain locus contains at least one or l rat constant region genes, e.g., Cδ, Cμ and Cγ (including any of the Cγ subclasses).

In another preferred embodiment, the artificial heavy chain locus contains artificial constant region genes. In a preferred embodiment, such artificial constant region genes encode a human CH1 domain and rat CH2 CH3 domains, or a human CH1 and rat CH2, CH3 and CH4 domains. A hybrid heavy chain with a human CH1 domain pairs effectively with a fully human light chain.

In a preferred embodiment, an artificial Ig locus comprises 3’ enhancer sequences, including hs1,2, hs3a, hs3b and sequences between rat Calpha and 3’hs3b.

In another preferred embodiment, the artificial heavy chain locus ns artificial constant region genes g CH1 domains In a preferred embodiment, such artificial constant region genes encode truncated IgM and/or IgG lacking the CH1 domain but comprising CH2, and CH3, or CH1, CH2, CH3 and CH4 s. Heavy chains lacking CH1 domains cannot pair effectively with Ig light chains and form heavy chain only antibodies.

In another aspect, the invention es transgenic constructs ning an artificial light chain locus capable of undergoing gene rearrangement in the host animal thereby producing a diversified repertoire of light chains having human idiotypes. An artificial light chain locus of the transgene contains a V-region with at least one human V gene segment, e.g., a V-region having at least one human VL gene and/or at least one rearranged human VJ segment. Preferably, the V-region includes at least about 5-100 human light chain V (or “VL”) gene segments. Consistently, a human VL segment encompasses naturally occurring sequences of a human VL gene segment, degenerate forms of naturally occurring sequences of a human VL gene segment, as well as synthetic sequences that encode a polypeptide sequence substantially (i.e., at least about %) identical to a human light chain V domain polypeptide. In one embodiment, the artificial light chain Ig locus has a C- region having at least one rat C gene (e.g., rat Cλ or Cκ).

Another aspect of the present invention is directed to methods of making a transgenic vector containing an artificial Ig locus. Such methods e isolating Ig loci or fragments thereof, and combining the same, with one or several DNA nts comprising sequences encoding human V region elements. The Ig gene t(s) are inserted into the artificial Ig locus or a portion thereof by ligation or homologous ination in such a way as to retain the capacity of the locus to undergo effective gene rearrangement in the subject animal.

Preferably, a non-human Ig locus is isolated by screening a library of ds, cosmids, YACs or BACs, and the like, prepared from the genomic DNA of the same. YAC clones can carry DNA nts of up to 2 megabases, thus an entire animal heavy chain locus or a large portion thereof can be isolated in one YAC clone, or reconstructed to be contained in one YAC clone. BAC clones are capable of ng DNA fragments of smaller sizes (about 50-500 kb). However, multiple BAC clones ning overlapping fragments of an Ig locus can be separately altered and subsequently injected together into an animal recipient cell, wherein the overlapping fragments ine in the recipient animal cell to generate a uous Ig locus.

Human Ig gene segments can be integrated into the Ig locus on a vector (e.g., a BAC clone) by a variety of methods, including ligation of DNA fragments, or insertion of DNA fragments by homologous recombination. Integration of the human Ig gene segments is done in such a way that the human Ig gene segment is ly linked to the host animal sequence in the transgene to produce a onal humanized Ig locus, i.e., an Ig locus capable of gene rearrangement which lead to the production of a diversified repertoire of antibodies with human idiotypes. Homologous recombination can be performed in bacteria, yeast and other cells with a high frequency of homologous recombination . Engineered YACs and BACs can be readily isolated from the cells and used in making transgenic Transgenic animals comprising artificial Ig loci and capable of producing antibodies having human idiotypes In one aspect, the invention provides transgenic animals capable of producing immunoglobulins having human idiotypes, as well as methods of making the same. The transgenic animals used are selected from rodents (e.g., rats, hamsters, mice and guinea pigs).

The transgenic animals used for zed antibody production in the invention carry ne mutations in endogenous Ig loci. In a preferred embodiment, the transgenic animals are homozygous for mutated nous Ig heavy chain and/or endogenous Ig light chain genes. Further, these animals carry at least two artificial heavy chain loc Ig loci that are functional and capable of ing a repertoire of immunoglobulin molecules in the transgenic animal. The artificial Ig loci used in the invention include at least one human V gene segment.

In a preferred embodiment, the transgenic animals carry at least two artificial Ig heavy chain locus and at least one artificial Ig light chain locus that are each functional and capable of producing a repertoire of immunoglobulin les in the enic animal, which repertoire of immunoglobulin molecules includes antibodies having a human idiotype.

In one embodiment, artificial loci including at least one non-human C gene are used, and animals capable of ing chimeric antibodies having a human idiotype and non-human constant region are provided. In one embodiment, artificial loci including at least one human C gene are used, and animals capable of producing antibodies having a human pe and human constant region are provided.

In another preferred embodiment, the transgenic animals carry at least two artificial Ig heavy chain loci, and lack a functional Ig light chain locus. Such animals find use in the production of heavy only antibodies.

Production of such transgenic animals involves the integration of at least two artificial heavy chain Ig loci and one or more artificial light chain Ig loci into the genome of a enic animal having at least one endogenous Ig locus that has been or will be inactivated by the action of one or more meganucleases. Preferably, the transgenic animals are nullizygous for endogenous Ig heavy chain and/or endogenous Ig light chain and, accordingly, incapable of producing endogenous immunoglobulins. Regardless of the chromosomal location, an cial Ig locus of the present invention has the capacity to undergo gene rearrangement and thereby produce a diversified oire of globulin molecules. An Ig locus having the capacity to undergo gene rearrangement is also ed to herein as a “functional” Ig locus, and the antibodies with a diversity generated by a functional Ig locus are also referred to herein as “functional” antibodies or a “functional” repertoire of antibodies.

The artificial loci used to generate such transgenic animals each include multiple immunoglobulin gene segments, which include at least one V region gene segment, one or more J gene segments, one or more D gene segments in the case of a heavy chain locus, and one or more constant region genes. In the present ion, at least one of the V gene segments encodes a germline or hypermutated human V-region amino acid ce.

Accordingly, such transgenic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which include antibodies having a human idiotype.

In one embodiment, the artificial loci used comprise at least one non-human C region gene t. Accordingly, such transgenic animals have the capacity to e a diversified repertoire of immunoglobulin molecules, which include chimeric antibodies having a human idiotype.

In one embodiment, the artificial loci used comprise at least one human C region gene t. Accordingly, such transgenic animals have the capacity to e a diversified repertoire of immunoglobulin molecules, which e antibodies having a human idiotype and a human constant region.

In one embodiment, the artificial loci used comprise at least one artificial constant region gene. For example, an exemplary artificial C constant region gene is a constant region gene ng a human IgG CH1 domain and rat IgG CH2 and CH3 domain.

Accordingly, such transgenic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which include dies having a human idiotype and an artificial constant region comprising both human and non-human components.

The transgenic vector containing an artificial Ig locus is introduced into the ent cell or cells and then integrated into the genome of the recipient cell or cells by random ation or by targeted integration.

For random integration, a transgenic vector containing an artificial Ig locus can be introduced into a recipient cell by standard transgenic technology. For example, a transgenic vector can be directly injected into the pronucleus of a fertilized oocyte. A transgenic vector can also be introduced by co-incubation of sperm with the transgenic vector before fertilization of the oocyte. Transgenic animals can be developed from fertilized s. r way to introduce a transgenic vector is by transfecting embryonic stem cells or other pluripotent cells (for example primordial germ cells) and subsequently injecting the genetically modified cells into ping embryos. Alternatively, a transgenic vector (naked or in combination with facilitating ts) can be directly injected into a developing embryo. tely, chimeric enic animals are produced from the embryos which contain the artificial Ig transgene integrated in the genome of at least some somatic cells of the transgenic . In another embodiment, the transgenic vector is introduced into the genome of a cell and an animal is derived from the transfected cell by nuclear transfer cloning.

In a preferred embodiment, a transgene containing an cial Ig locus is randomly integrated into the genome of recipient cells (such as fertilized oocyte or developing embryos). In a preferred embodiment, offspring that are nullizygous for endogenous Ig heavy chain and/or Ig light chain and, accordingly, ble of producing endogenous immunoglobulins and capable of producing transgenic immunoglobulins are obtained.

For targeted integration, a transgenic vector can be introduced into appropriate recipient cells such as nic stem cells, other pluripotent cells or already differentiated somatic cells. Afterwards, cells in which the transgene has integrated into the animal genome can be selected by rd methods. The ed cells may then be fused with enucleated nuclear er unit cells, e.g. oocytes or embryonic stem cells, cells which are totipotent and capable of forming a functional neonate. Fusion is performed in ance with conventional techniques which are well established. See, for example, Cibelli et al., Science (1998) 280:1256; Zhou et al. Science (2003) 301: 1179. Enucleation of oocytes and nuclear transfer can also be performed by microsurgery using injection pipettes. (See, for example, Wakayama et al., Nature (1998) 394:369.) The resulting cells are then ated in an appropriate medium, and transferred into synchronized recipients for ting transgenic animals. Alternatively, the selected cally modified cells can be injected into developing embryos which are subsequently ped into chimeric animals.

In one embodiment, a meganuclease is used to se the frequency of homologous recombination at a target site through -strand DNA cleavage. For integration into a specific site, a site specific meganuclease may be used. In one ment, a meganuclease targeting an endogenous Ig locus is used to increase the frequency of homologous recombination and replacement of an endogenous Ig locus, or parts thereof with an artificial Ig locus, or parts thereof. In one embodiment, the transgenic animal lacks a functional Ig light chain locus and comprises an artificial Ig heavy chain locus.

The preferred embodiments for integration of the human Ig gene segments using YACs and BACs, and interchanging between the two, has the advantage of both, speed and the ability to check integrity when making constructs of large s by overlapping homology. The tandem integration of the constructs with overlapping regions have the ability to integrate, such as to maintain the full functionality, which is essential for DNA rearrangement. The preferred embodiments of the ion not only have the desired integration by homology but also produce tandem integration as a frequent event. This eases the transgenic technology substantially as no laborious integration of large YACs into stem cells and subsequent animal tion therefrom has to be performed. In addition, ZFN technology, also performed via DNA injection (Geurts et al. Science 325, 433 (2009); Menoret et al. European journal of immunology 40, 2932-2941 (2010)), produced Ig KO strains easily and may well be the future technology of choice for gene disruptions and replacement. Silenced endogenous Ig gene expression in OmniRats™, containing human-rat IgH and human IgL loci, has the advantage that no interfering or undesired rat Ig could give rise to mixed products.

In the mouse an enhancer region downstream of Cα plays a vital role in classswitch recombination (Vincent-Fabert et al. Blood 116, 898 (2010)) and it is likely that elements in that region may facilitate hypermutation (Pruzina et al. n engineering, design & selection : PEDS 24, 791-799 (2011)). This may be the reason why immune responses and generation of diverse omas at high ncy may be difficult in mice carrying even a large fully human locus (Davis et al. Cancer metastasis reviews 18, 421-425 (1999); Lonberg Current opinion in immunology 20, 450-459 (2008)). As the chimeric human-rat IgH locus facilitates near wt differentiation and sion levels in OmniRats, it can be concluded that the endogenous rat C region and indeed the ~30 kb enhancer sequence 3’ of Cα are providing l locus control to express and mature human VH genes. Another region, Cδ with its 3’ control motif cluster (Mundt et al. J Immunol 166, 3315-3323 (2001)), has been removed from the chimeric C-region BAC since silencing or a lack of IgD did not appear to reduce immune on (Chen l Rev 237, 160-179 (2010)). Normally, mature IgM+IgD+ B-cells egulate IgD upon antigen contact, which initiates classswitch recombination (Id). Thus, switching may be increased without IgD control, which is supported by our finding that IgG transcripts and serum levels are significantly lower when the Cδ region is retained in transgenic constructs (data not shown).

The production of specific IgG in OmniRats™ is ularly encouraging as we found that in various immunizations mAbs with ity in sequence and epitope, comparable to what was produced in wt controls, could be isolated via spleen and lymph node fusion. V-gene, D and J diversity was as expected and nearly all segments were found to be used productively as predicted (Lefranc & Lefranc The immunoglobulin factsbook.

FactsBook Series, Academic Press, GB, 45-68 (2001)). This was in stark contrast to mice carrying fully human transloci where clonal expansion from a few precursor B-cells produced little diversity (Pruzina et al. n engineering, design & selection : PEDS 24, 9 (2011)). Since the number of transplanted V-genes is only about half of what is used in humans we anticipated to find restricted immune responses and limited diversity when comparing OmniRats with wt s. However, this was not the case and a comparison of CDR3 diversity in over 1000 clones (sequences can be ed) revealed the same extensive junctional differences in OmniRats as in wt animals. The few identical gene-segment combinations were further diversified by ence additions or deletion at the VH to D and/or D to JH junctions and also by hypermutation. Thus, it is clear that the rat C region sequence is highly efficient in lling DNA rearrangement and expression of human VHDJH. Extensive diversity was also seen for the introduced human Igκ and Igλ loci, similar to what has previously been shown in mice (Nicholson et al. J Immunol 163, 6898-6906 (1999); Pruzina et al. Protein engineering, design & selection : PEDS 24, 791-799 (2011); Popov et al. The l of experimental medicine 189, 1611-1620 (1999)). Hence, substantially reduced efficiency in the production of human antibodies from mice rg, N. Nature biotechnology 23, 1117-1125 (2005)) has been overcome in OmniRats™, which diversify rearranged H-chains reliably and extensively by class-switch and hypermutation to yield high affinity antibodies in bulk rather than occasionally. The yield of transgenic IgG and the level of hypermutation, impressively ed in antigen-specific mAbs, showed that clonal diversification and production level are similar between OmniRats™ and wt animals.

Routine generation of high affinity specificities in the subnanomolar range was even accomplished by different single immunizations and again compares favorably with wt animals; results that have not been shown in transgenic mice producing human antibody repertoires from entirely human loci (Mendez et al. Nature genetics 15, 146-156 (1997)).

In summary, to maximize human antibody production an IgH locus that uses human genes for dy specificity but rodent genes for control of differentiation and high expression should be regarded ial. L-chain flexibility is a bonus as it permits highly efficient human IgH/IgL assembly even when wt Ig is t. For therapeutic applications chimeric H-chains can be easily converted into fully human Abs by C-gene replacement without mising the specificity. globulins having a human idiotype Once a transgenic animal capable of producing immunoglobulins having a human idiotype is made, immunoglobulins and antibody preparations t an antigen can be readily obtained by immunizing the animal with the antigen. lonal ra composition” as used herein includes affinity purified polyclonal antibody preparations.

A variety of antigens can be used to immunize a transgenic animal. Such antigens include but are not limited to, microorganisms, e.g. viruses and unicellular organisms (such as bacteria and , alive, attenuated or dead, fragments of the microorganisms, or antigenic molecules isolated from the rganisms.

Preferred bacterial antigens for use in immunizing an animal include purified antigens from Staphylococcus aureus such as capsular polysaccharides type 5 and 8, recombinant versions of virulence factors such as toxin, adhesin binding proteins, collagen binding proteins, and fibronectin binding proteins. Preferred bacterial antigens also include an attenuated version of S. aureus, monas aeruginosa, enterococcus, enterobacter, and Klebsiella pneumoniae, or culture supernatant from these bacteria cells.

Other bacterial antigens which can be used in immunization include ed lipopolysaccharide (LPS), capsular antigens, capsular polysaccharides and/or recombinant versions of the outer membrane proteins, fibronectin binding proteins, endotoxin, and exotoxin from Pseudomonas nosa, enterococcus, bacter, and Klebsiella pneumoniae.

Preferred antigens for the generation of antibodies against fungi include attenuated version of fungi or outer membrane proteins thereof, which fungi include, but are not limited to, Candida albicans, Candida parapsilosis, Candida tropicalis, and coccus neoformans.

Preferred antigens for use in immunization in order to generate antibodies against viruses include the envelop proteins and attenuated ns of viruses which include, but are not d to respiratory synctial virus (RSV) (particularly the F-Protein), tis C virus (HCV), Hepatits B virus (HBV), cytomegalovirus (CMV), EBV, and HSV.

Antibodies specific for cancer can be generated by immunizing transgenic animals with isolated tumor cells or tumor cell lines as well as tumor-associated antigens which include, but are not limited to, Herneu antigen (antibodies against which are useful for the ent of breast cancer); CD20, CD22 and CD53 antigens (antibodies against which are useful for the treatment of B cell lymphomas), prostate specific membrane n (PMSA) (antibodies against which are useful for the treatment of prostate cancer), and 17-1A molecule (antibodies t which are useful for the treatment of colon cancer).

The ns can be administered to a transgenic animal in any convenient manner, with or without an nt, and can be administered in accordance with a ermined schedule.

For making a onal antibody, spleen cells are isolated from the immunized transgenic animal and used either in cell fusion with transformed cell lines for the production of hybridomas, or cDNAs encoding antibodies are cloned by standard molecular biology techniques and expressed in transfected cells. The procedures for making monoclonal antibodies are well established in the art. See, e.g., European Patent Application 0 583 980 A1 (“Method For Generating onal Antibodies From Rabbits”), U.S. Patent No. 4,977,081 (“Stable Rabbit-Mouse Hybridomas And Secretion Products Thereof”), WO 97/16537 (“Stable Chicken B-cell Line And Method of Use Thereof”), and EP 0 491 057 B1 (“Hybridoma Which Produces Avian Specific Immunoglobulin G”), the disclosures of which are incorporated herein by reference. In vitro production of monoclonal antibodies from cloned cDNA molecules has been described by Andris-Widhopf et al. J Immunol s 242:159 (2000), and by Burton Immunotechnology 1:87 (1995).

Once ic monoclonal antibodies with human idiotypes have been generated, such chimeric antibodies can be easily converted into fully human antibodies using standard molecular biology ques. Fully human onal antibodies are not immunogenic in humans and are appropriate for use in the therapeutic treatment of human subjects.

Antibodies of the invention include heavy chain-only antibodies In one embodiment, transgenic animals which lack a functional Ig light chain locus, and comprising at least two artificial heavy chain loci, are immunized with n to produce heavy chain-only antibodies that specifically bind to antigen.

In one embodiment, the invention provides monoclonal antibody producing cells derived from such animals, as well as nucleic acids derived therefrom. Also provided are hybridomas derived rom. Also provided are fully human heavy chain-only antibodies, as well as encoding nucleic acids, derived therefrom.

Teachings on heavy chain-only dies are found in the art. For example, see PCT publications WO02085944, WO02085945, WO2006008548, and 096779.

See also US 526; US 541; US 6,005,079; US 6,765,087; US 5,800,988; EP 7; WO 9734103; and US 6,015,695.

Pharmaceutical Compositions In a further embodiment of the present invention, purified monoclonal or polyclonal antibodies are admixed with an appropriate pharmaceutical r suitable for administration to patients, to provide ceutical compositions.

Patients treated with the pharmaceutical compositions of the invention are preferably mammals, more preferably humans, though veterinary uses are also contemplated.

Pharmaceutically acceptable carriers which can be employed in the t pharmaceutical compositions can be any and all solvents, dispersion media, isotonic agents and the like. Except insofar as any conventional media, agent, diluent or carrier is ental to the recipient or to the therapeutic effectiveness of the antibodies contained therein, its use in the pharmaceutical compositions of the present invention is appropriate.

The carrier can be liquid, semi-solid, e.g. pastes, or solid rs. Examples of carriers include oils, water, saline solutions, alcohol, sugar, gel, lipids, liposomes, resins, porous matrices, binders, fillers, coatings, preservatives and the like, or combinations f.

Methods of Treatment In a further aspect of the present invention, methods are provided for treating a disease in a vertebrate, preferably a mammal, preferably a primate, with human subjects being an especially preferred embodiment, by administering a purified antibody composition of the invention desirable for treating such disease.

The antibody compositions can be used to bind and neutralize or modulate an antigenic entity in human body tissues that causes or contributes to disease or that elicits red or abnormal immune responses. An "antigenic entity" is herein d to encompass any soluble or cell surface bound molecules including proteins, as well as cells or infectious disease-causing organisms or agents that are at least capable of binding to an antibody and preferably are also e of ating an immune response.

Administration of an antibody composition against an infectious agent as a monotherapy or in combination with chemotherapy results in elimination of infectious particles. A single stration of antibodies decreases the number of infectious particles generally 10 to 100 fold, more commonly more than 1000-fold. Similarly, antibody therapy in patients with a malignant disease employed as a monotherapy or in combination with chemotherapy reduces the number of ant cells generally 10 to 100 fold, or more than 1000-fold. Therapy may be repeated over an extended amount of time to assure the te elimination of infectious particles, malignant cells, etc. In some ces, therapy with antibody preparations will be continued for extended periods of time in the absence of detectable amounts of infectious particles or undesirable cells.

Similarly, the use of antibody therapy for the modulation of immune responses may t of single or multiple administrations of therapeutic antibodies. Therapy may be continued for extended periods of time in the absence of any disease symptoms.

The subject treatment may be ed in conjunction with chemotherapy at dosages sufficient to inhibit ious disease or malignancies. In autoimmune disease patients or transplant recipients, antibody therapy may be employed in conjunction with immunosuppressive therapy at dosages sufficient to inhibit immune reactions.

EXAMPLES In mice transgenic for human immunoglobulin (Ig) loci, suboptimal cy in delivery of fully human antibodies has been attributed to imperfect interaction between the constant regions of human membrane IgH chains and the mouse cellular signaling machinery.

To obviate this problem, we here describe a zed rat strain (OmniRatTM) carrying chimeric human/rat IgH loci [comprising 22 human VHs, all human D and JH segments with germline gene spacing but linked to the rat CH locus] together with fully human chain loci [12 Vκs linked to Jκ-Cκ and 16 Vλs linked to Jλ-Cλ]. The endogenous rat Ig loci were silenced by designer zinc finger nucleases. Following immunization, OmniRats perform as efficiently as normal rats in yielding high affinity serum IgG. Monoclonal antibodies, comprising fully human variable s with sub-nanomolar antigen affinity and carrying extensive somatic mutations, are readily obtainable – similarly to the yield of conventional antibodies from normal rats.

MATERIALS AND METHODS Construction of modified human Ig loci on YACs and BACs a) IgH loci The human IgH V genes were covered by 2 BACs: BAC6-VH3-11 containing the authentic region spanning from VH4-39 to VH3-23 followed by VH3-11 ied from a commercially available BAC clone 3054M17 CITB) and BAC3 containing the authentic region spanning from VH3-11 to VH6-1 (811L16 RPCI-11). A BAC termed Annabel was constructed by joining rat CH region genes immediately downstream of the human VH6 Ds-JHs region (Figure 1). All BAC clones containing part of the human or rat IgH locus were purchased from Invitrogen.

Both BAC6-VH3-11 and Annabel were initially constructed in S. siae as circular YACs ) and further checked and maintained in E. coli as BACs. .

Unlike YACs, BAC plasmid preps yield large quantities of the desired DNA.

To convert a linear YAC into a cYAC or to assemble DNA fragments with overlapping ends into a single cYAC in S. cerevisiae, which can also be maintained as a BAC in E. coli, two self-replicating S. cerevisiae/E. coli shuttle vectors, pBelo-CEN-URA, and pBelo-CEN-HYG were constructed. Briefly, S. cerevisiae CEN4 was cut out as an AvrII fragment from pYACRC (Marchuk & s Nucleic acids research 16, 7743 (1988)) and d to SpeI – linearised pAP599 (Kaur & Cormack PNAS 104, 7628-7633 (2007)). The resulting d contains CEN4 cloned in between S. cerevisiae URA3 and a hygromycin-resistance sion cassette (HygR). From this plasmid, an ApaLI–BamHI fragment ning URA3 followed by CEN4 or a PmlI–SphI fragment containing CEN4 ed by HygR was cut out, and ligated to ApaLI and BamHI or HpaI and SphI doubly digested pBACBelo11 (New England Biolabs) to yield pBelo-CEN-URA and pBelo-CEN-HYG.

To construct BAC6-VH3-11, initially two fragments, a 115 kb NotI-PmeI and a 110 kb RsrII-SgrAI, were cut out from the BAC clone 7 CITB. The 3’ end of the former fragment ps 22 kb with the 5’ end of the . The NotI-PmeI fragment was ligated to a amHI YAC arm containing S. cerevisiae CEN4 as well as RS1 from pYAC-RC, and the RsrII-SgrAI fragment was ligated to a SgrAI-BamHI YAC arm containing S. cerevisiae URA3, also from pYAC-RC. Subsequently, the ligation mixture was transformed into S. cerevisiae AB1380 cells via spheroplast ormation41, and URA+TRP+ yeast clones were selected. Clones, termed YAC6, containing the linear region from human VH4-39 to VH3-23 were confirmed by Southern blot analysis. YAC6 was further extended by addition of a 10.6 kb fragment 3’ of VH3-23, and conversion to a cYAC.

The 10.6 kb extension contains the human VH3-11 and also occurs at the 5’ end of BAC3.

We constructed pBeloHYG-YAC6+BAC3(5’) for the modification of YAC6. Briefly, 3 fragments with overlapping ends were ed by PCR: 1) a ‘stuff’ fragment containing S. cerevisiae TRP1-ARS1 flanked by HpaI sites with 5’ tail matching the sequence upstream of VH4-39 and 3’ tail matching downstream of VH3-23 in YAC6 (using long oligoes 561 and 562, and pYAC-RC as template), 2) the 10.6 kb extension fragment with a 5’ tail matching the sequence ream of VH3-23 as described above and a unique AscI site at its 3’ end (using long oligoes 570 and 412, and human genomic DNA as template), and 3) pBelo-CENHYG vector with the CEN4 joined downstream with a homology tail matching the 3’ end of the 10.6 extension fragment and the HygR joined upstream with a tail matching the sequence upstream of VH4-39 as described above (using long oligoes 414 and 566, and pBelo-CENHYG as template). uently, the 3 PCR fragments were assembled into a small cYAC conferring HYGR and TRP+ in S. cerevisiae via homologous recombination associated with spheroplast transformation, and this cYAC was further converted into the BAC pBeloHYGYAC6 +BAC3(5’). Finally, the HpaI-digested pBeloHYG-YAC6+BAC3(5’) was used to transform yeast cells carrying YAC6, and through homologous recombination cYAC BAC6- VH3-11 conferring only HYGR was generated. Via transformation, see below, this cYAC was uced as a BAC in E. coli. The human VH genes in BAC6-VH3-11 were cut out as a ~ 182 kb AsiSI (occurring naturally in the HygR) – AscI fragment, and the VH genes in BAC3 were cut out as a ~173 kb NotI- fragment (Figure 1 top).

A self-replicating shuttle vector, termed pCAU, efficiently working in both Saccharomyces cerevisiae and E. coli, was constructed based on CEN-URA published previously. (Osborn et al. J Immunol 2013; 190:1481-1490) In brief, ARSH4 was amplified from S. cerevisiae genomic DNA using primers 878 and 879 (all primer sequences are listed below), with an ApaLI site followed by AsiSI and a SexAI introduced into either end. The fragment was digested with ApaLI and SexAI, and ligated with pBelo-CEN-URA digested with the same restriction enzymes to yield pCAU. This vector contains S. cerevisiae CEN4, URA3 and ARSH4 in the pBeloBAC11 backbone (New England BioLabs).

Three BACs derived from human chromosome 14 - CTD-2011A5 (BAC9), CTD-3148C6 (BAC14), CTD-2548B8 (BAC5) were purchased from Invitrogen/Thermo Fisher. The human genomic region assing IgHV3-74 to IgHV1-58 in BAC9 was isolated as a 185 kb NotI – fragment. BAC(14+5) was constructed from BAC14 and BAC5.

The combined genomic regions in this BAC was isolated as a 210 kb BsiwI - fragment including from 5’ to 3’: a 90.6 kb region derived from BAC14 containing 4.6 kb sequence overlapping with the 3’ of the NotI –fragment from BAC9 ed by a 86 kb region encompassing IgHV5-51 to IgHV1-45, a 1.7 kb synthetic region joining BAC14 and BAC5 with IgHV3-43 located in the centre, a 111.7 kb region derived from BAC5 encompassing IgHV3-21 to IgHV3-13, and a 6.1 kb region providing an overlap with the 5’ of Anabel (the BAC carrying human Ig constant regions).

BAC(14+5, also referenced as 14/5) was constructed in three steps all ing generating a circular YAC (cYAC) via gous ination in yeast and converting the cYAC to BAC as described previously. Firstly, a BAC vector - pCAU+GAPBAC14 ,5, was generated by assembling the following 3 overlapping fragments in yeast: a 1.9 kb synthetic DNA (ordered from ThermoFisher) containing from 5’ to 3’: 116 bp ce pping with the 5’ as well as 3’ end of the desired region in BAC14 with an unique RsrII site in the centre, 1.6 kb IgHV3-43 gene [including 1.0 kb 5’ untranslated region (UTR) and 0.2 kb 3’ UTR], 106 bp sequence overlapping with the 5’ as well as 3’ end of the desired region in BAC5 with an unique PmeI site in the , and 38 bp sequence overlapping with the 5’ end of Anabel, a 6.1 kb PCR fragment ponding to the 5’ of Anabel using primers 383 and 384, and an amplified pCAU vector using primers 1066 and 1088. Secondly, the pCAU+GAP-BAC14,5 vector was linearized with PmeI, and co-transformed with a 154 kb NotI – fragment isolated from BAC5 into yeast strain AB1380. The resulting BAC (~ 128 kb in length) had the d region of BAC5 incorporated into the BAC vector via homologous recombination mediated by the homology ends to BAC5 exposed in the PmeI – ized vector. Thirdly, the BAC carrying BAC5 from the second step was linearized with RsrII to expose the homology ends to the desired region in BAC14, and co-transformed with a 114 kb SnaBI – fragment isolated from BAC14 to yield BAC(14+5).

For the assembly of the C region with the VH p, the human VH6Ds- JHs region had to be joined with the rat genomic sequence immediately downstream of the last JH followed by rat Cs to yield a AC. To achieve this, 5 overlapping restriction as well as PCR fragments were prepared; a 6.1 kb fragment 5’ of human VH6-1 (using oligos 383 and 384, and human c DNA as template), an ~78 kb PvuI-PacI fragment containing the human VH6Ds-JHs region cut out from BAC1 (RP11645E6), a 8.7 kb fragment joining the human JH6 with the rat genomic sequence immediately downstream of the last JH and containing part of rat µ coding ce (using oligos 488 and 346, and rat genomic DNA as template), an ~ 52 kb NotI-PmeI fragment containing the authentic rat µ, δ and γ2c region cut out from BAC M5 (CH230-408M5) and the pBelo-CEN-URA vector with the URA3 joined ream with a gy tail matching the 3’ end of the rat γ2c region and the CEN4 joined upstream with a tail matching the 5’ region of human VH6-1 as described (using long oligoes 385 and 550, and pBelo-CEN-URA as template). Correct assembly via homologous recombination in S. cerevisiae was analyzed by PCR and purified cYAC from the correct clones was converted into a BAC in E. coli.

For the assembly of Annabel parts of the above cYAC/BAC containing humanVH6Ds-JHs followed by the tic rat µ, δ and γ2c region, as well as PCR fragments were used. Five overlapping fragments contained the 6.1 kb fragment at the 5’ end of human VH6-1 as described above, an ~83 kb SpeI nt comprising human VH6Ds- JHs immediately followed by the rat genomic sequence downstream of the last JH and ning part of rat Cµ, a 5.2 kb fragment joining the 3’ end of rat µ with the 5’ end of rat γ1 (using oligos 490 and 534, and rat genomic DNA as template), an ~118 kb NotI-SgrAI fragment containing the authentic rat γ1, γ2b, ε, α and 3’E IgH enhancer region cut out from BAC I8 (CH230-162I08), and the pBelo-CEN-URA vector with the URA3 joined downstream with a homology tail matching the 3’ end of rat 3’E and the CEN4 joined upstream with a tail matching the 5’ end of human VH6-1 as described above. There is a 10.3 kb overlap between the human VH6-1 s in both the BAC3 and Annabel. The human VH6-1 -Ds - JHs followed by the rat CH region together with the S. cerevisiae URA3 in Annabel can be cut out as a single ~183 kb NotI-fragment (see Figure 1).

BAC6-VH3-11, BAC3, BAC9 and BAC (14+5) and Annabel were checked extensively by restriction analysis and partial sequencing for their authenticity. b) IgL loci The human Igλ locus on a ~410 kb YAC was obtained by recombination assembly of a Vλ YAC with 3 Cλ containing cosmids (Popov et al. Gene 177, 195-201 (1996)). ngement and expression was verified in transgenic mice derived from ES cells containing one copy of a complete human Igλ YAC (Popov et al. The Journal of experimental medicine 189, 1611-1620 (1999)). This Igλ YAC was shortened by the generation of a circular YAC removing ~100kb of the region 5’ of Vλ3-27. The vector C was ed with ClaI and BspEI to remove URA3 and ligated with a ClaI/NgoMIV fragment from pAP 599 containing HYG. PCR of the region containing the yeast centromere and hygromycin marker gene from the new vector (pYAC-RC-HYG) was carried out with primers with 5’ ends homologous to a region 5’ of Vλ3-27 (primer 276) and within the ADE2 marker gene in the YAC arm (primer 275). The PCR fragment (3.8 kb) was integrated into the Igλ YAC using a high ency lithium e transformation method (Gietz & Woods Methods in Microbiology 26, 53-66 (1998)) and selection on hygromycin containing YPD . DNA was prepared from the clones (Epicentre MasterPure Yeast DNA purification kit) and analysed for the correct junctions by PCR using the following oligos: 243 + 278 and Hyg end R + 238. Plugs were made (Peterson Nature protocols 2, 3009-3015 (2007)) and yeast chromosomes removed by PFGE (0.8% agarose (PFC) d) gel [6V/cm, pulse times of 60s for 10hr and 10s for 10hr, 8˚C) leaving the circular yeast artificial chromosome caught in the agarose block (Beverly, Nucleic acids research 16, 925- 939 (1988)). The blocks were d and digested with NruI. Briefly, blocks were preincubated with restriction enzyme buffer in excess at a 1X final concentration for 1 hr on ice. Excess buffer was removed leaving just enough to cover the plugs, restriction enzyme was added to a final concentration of 100U/ml and the tube incubated at 37˚C for 4-5hrs. The ized YAC was ran out of the blocks by PFGE, cut out from the gel as a strip and purified as described below.

For the human Igκ locus 3 BACs were chosen (RP11-344F17, RP11-1134E24 and RP11-156D9, Invitrogen), which covered a region over 300 kb from 5’ Vκ1-17 to 3’ KDE (Kawasaki et al. European journal of immunology 31, 1017-1028 (2001)). In digests and ce analyses three pping nts were identified: from Vκ1-17 to Vκ3-7 (150 kb NotI with ~14 kb overlap), from Vκ3-7 to 3’ of Cκ (158 kb NotI with ~40 kb overlap) and from Cκ to 3’ of the KDE (55 kb PacI with 40 kb overlap). Overlapping regions may generally favour joint integration when co-injected into oocytes (Wagner et al.

Genomics 35, 405-414 (1996)).

Gel analyses and DNA purification Purified YAC and BAC DNA was analysed by restriction digest and separation on conventional 0.7% agarose gels (Sambrook & Russell Molecular Cloning. A laboratory Manual. . Cold Spring Harbor Laboratory Press, NY (2001)). Larger fragments, 50-200 kb, were separated by PFGE (Biorad Chef MapperTM) at 80C, using 0.8% PFC se in 0.5% TBE, at 2-20 sec switch time for 16 h, 6V/cm, 10mA. cation d a direct comparison of the resulting fragments with the predicted size obtained from the sequence analysis. Alterations were analysed by PCR and cing.

Linear YACs, circular YACs and BAC fragments after digests, were purified by electro-elution using ElutrapTM (Schleicher and Schuell) (Gu et al. Journal of biochemical and biophysical methods 24, 45-50 (1992)) from strips cut from 0.8% agarose gels run conventionally or from pulsed-field-gel electrophoresis (PFGE). The DNA tration was usually several ng/µl in a volume of ~100µl. For fragments up to ~200 kb the DNA was precipitated and re-dissolved in injection buffer (10 mM Cl pH 7.5, 100 mM EDTA pH 8 and 100 mM NaCl but without Spermine/Spermidine) to the desired concentration.

The purification of circular YACs from yeast was carried out using Nucleobond AX silica-based anion-exchange resin (Macherey-Nagel, Germany). Briefly, spheroplasts were made using zymolyase or lyticase and pelleted (Davies et al. Human antibody repertoires in enic mice: Manipulation and transfer of YACs. . IRL Oxford, 59-76 ). The cells then underwent alkaline lysis, binding to AX100 column and n as described in the Nucleobond method for a low-copy plasmid. Contaminating yeast chromosomal DNA was hydolyzed using Plamid –Safe™ ATP-Dependent DNase (Epicentre Biotechnologies) followed by a final cleanup step using SureClean (Bioline). An aliquot of DH10 electrocompetent cells rogen) was then transformed with the circular YAC to obtain BAC colonies. For microinjection, the insert DNA (150-200 kb), was separated from BAC vector DNA(~10 kb) using a filtration step with sepharose 4B-CL (Yang et al. Nature biotechnology 15, 859-865 (1997)).

Derivation of rats and breeding Purified DNA encoding recombinant immunoglobulin loci was resuspended in microinjection buffer with 10 mM Spermine and 10 mM Spermidine. The DNA was injected into ized oocytes at various concentrations from 0.5 to 3 ng/µl.

Plasmid DNA or mRNA ng ZFNs specific for rat immunoglobulin genes were injected into fertilized oocytes at various concentrations from 0.5 to 10 ng/ul. njections were performed at Caliper Life Sciences ty. Outbred SD/Hsd (WT) strain animals were housed in standard microisolator cages under approved animal care protocols in animal facility that is accredited by the Association for the Assessment and itation for Laboratory Animal Care (AAALAC). The rats were maintained on a 14-10 h light/dark cycle with ad libitum access to food and water. Four to five week old SD/Hsd female rats were injected with 20-25 IU PMSG (Sigma-Aldrich) followed 48 hours later with 20-25 IU hCG (Sigma-Aldrich) before ng to outbred SD/Hsd males. Fertilized 1-cell stage s were collected for subsequent microinjection.

Manipulated embryos were transferred to pseudopregnant SD/Hsd female rats to be carried to parturition.

Multi-feature human Ig rats (human IgH, Igκ and Igλ in combination with rat J KO, κ KO and λ KO) and WT, as control, were analyzed at 10–18 weeks of age. The animals were bred at Charles River under specific pathogen-free ions.

The procedure of introducing multiple different VH region on separate loci can be implemented through the insertion of these ent loci into separate transgenic rats (preferably with a defective rat IgH locus) as described in the example above. These separate loci are used to generate separate transgenic rat lines, which are subsequently crossed to obtain double transgenic rats that would have all of the VHregions used available for the recombination process. Crossing these rats to homozygosity for both loci would double the number of VH regions available for recombination (see karyogram with one locus integrated on chromosome 6 and one locus on chromosome 15). Having multiple copies of an integrated locus would increase this number yet further.

The procedure of introducing distinct loci separately, by the transfer of multiple different VH regions in conjunction with one constant region array, allowed unconnected and le translocus integration. This was followed by breeding to generate an animal that expresses antibodies from both separately integrated loci.

The same procedure is also d for the light chains, where one line of animals is made with a kappa locus and r line is made with a lambda locus. The loci are combined in s by crossbreeding.

PCR and RT-PCR Transgenic rats were identified by PCR from tail or ear clip DNA using a Genomic DNA Mini Kid (Bioline). For IgH PCRs < 1kb GoTaq Green Master mix was used (Promega) under the following conditions: 94°C 2 mins, 32 x (94°C 30 secs, 54-67°C (see Table 1 for primers and ic annealing temperatures) 30 secs, 72°C 1 min), 72°C 2 mins.

For IgH PCRs >1kb KOD polymerase (Novagen) was used under the ing conditions: 95°C 2 mins, 32 x (95°C 20 secs, 56-62°C, Table 1) 20 secs, 70°C 90 secs), 70°C 2 mins. For Igκ and Igλ PCR, all <1kb, the above condition were used except extension at 72°C for 50 secs.

RNA was extracted from Blood using the RiboPure Blood Kit n) and RNA extraction from spleen, bone marrow or lymph nodes used RNASpin mini kit. (GE Healthcare). cDNA was made using Oligo dT and Promega Reverse Transcriptase at 42°C for 1 hour. GAPDH PCR reactions (oligos 429-430) determined the concentration.

RT-PCRs were set up using VH leader s with rat µCH2 or rat γCH2 primers (Table 2). Amplification with GoTaq Green Master mix were 94°C 2 mins, 34 x (94°C 30 secs, 55-65oC 30 secs, 72°C 50-60 secs), 72°C 2 mins. PCR products of the expected size were either ed by gel or QuickClean (Bioline) and sequenced directly or cloned into pGemT (Promega).

The sequences of the primers used in the PCR and RT-PCR assays to detect human IgH and IgL integration and expression are provided in Table 3.

Characterization of antibodies in immunized OmniRat animals by next generation sequencing A total of 6 OmniRat2 animals were immunized with al and B-cells were isolated from draining lymph nodes. After pelleting the B-cells and removing atant, total RNA was prepared from lymph node derived B-cells. RNA was e transcribed, and the resulting cDNA was used as template to amplify the full variable region of the Ig heavy chain rearranged locus (the VH region). This amplified product was then prepared for next-generation sequencing (NGS) and the full VH oire of each animal was determined by NGS.

After post-processing and quality control of the raw NGS reads, the V-gene usage of each animal was determined by aligning each unique VH sequence to the germline V-gene reference sequence. The percent V-gene usage was calculated as the number of VH sequences using a ular V-gene divided by the total number of VH sequences in that animal. n purification IgM was purified on anti-IgM affinity matrix (BAC B.V., Netherlands, CaptureSelect #2890.05) as described in the protocol. Similarly, human Igκ and Igλ was purified on anti-L chain affinity matrix (CaptureSelect anti-Igκ #0833 and anti-Igλ # 0849) according to the protocol.

For rat IgG purification (Bruggemann et al. J Immunol 142, 3145-3150 (1989)) n A and protein G agarose was used (Innova, Cambridge, UK, 024 and #895- 0024). Serum was incubated with the resin and binding facilitated at 0.1 M sodium phosphate pH 7 for protein G and pH 8 for protein A under gentle mixing. Poly-prep columns (Bio-Rad) were packed with the mixture and washed extensively with PBS pH7.4. Elution buffer was 0.1 M Sodium Citrate pH 2.5 and neutralization buffer was 1 M Tris-HCl pH 9.

Electrophoresis was performed on 4-15% SDS-PAGE and Coomassie brilliant blue was used for staining. MW standards were HyperPage Prestained Protein Marker (#BIO- 33066, Bioline).

Flow cytometry analysis and FISH Cell suspensions were washed and adjusted to 5x105 cells/100 µl in PBS-1% BSA-0.1% Azide. Different B-cell subsets were identified using mouse anti-rat IgM FITC- labelled mAb (MARM 4, Jackson Immunoresearch tories) in combination with anti-B cell CD45R (rat B220)-PE-conjugated mAb (His 24, BD ences) or anti-IgD-PE- conjugated mAb (MARD-3, Abd Serotec). A FACS I flow cytometer and FlowJo software (Becton Dickinson, Pont de Claix, France) was used for the analysis. scence in situ hybridisation was carried out on fixed blood lymphocytes using purified IgH and IgL C-region BACs as described. (Meisner & Johnson Methods 45, 133-141 ) Immunization, cell fusion and affinity ement Immunizations were performed with 125 µg PG in CFA, 150 µg hGHR in CFA, 200 µg Tau/KLH in CFA, 150 µg HEL in CFA, 150 µg OVA in CFA at the base of the tail and medial iliac lymph node cells were fused with mouse P3X63Ag8.653 myeloma cells 22 days later as described ro et al. Cell structure and on 20, 151-156 (1995)). For multiple immunizations protein, 125 µg PG or HEL, or 100 µg hGHR or CD14 in GERBU adjuvant (www.Gerbu.com), was administered intraperitoneally as follows: day 0, day 14, day 28 and day 41 without adjuvant, followed by spleen cell fusion with P3x63Ag8.653 cells 4 days later (Meisner & Johnson Methods 45, 133-141 (2008)).

Binding kinetics were analyzed by surface Plasmon resonance using a e 2000 with the antigens directly immobilized as described (Pruzina et al. Protein engineering, design & selection : PEDS 24, 791-799 (2011)).

Detection of antigen-specific antibodies by ELISA Rat serum samples were analysed for B-Gal IgG and IgM antibody and antigen titers using an n-coat, anti-IgG or IgM reporter ELISA. 96-well plates were coated with B-Gal overnight at 2-6 oC, blocked with PBS-Casein-Blocker/Diluent 1 X, washed with ELISA Wash Buffer, incubated with serum, washed with ELISA Wash Buffer, incubated with either a mixture of goat anti-rat IgG1-HRP, goat anti-rat IgG2a-HRP, and goat at IgG2b-HRP (each at a 1/5,000 dilution) or goat anti-rat IgM (1/5,000 on), washed with ELISA Wash Buffer, ted with TMB Substrate Solution for 30 minutes and ELISA Stop Solution was added to the wells. Absorbance in the plate wells was measured at 450 nm. Except where noted above, incubations were for 1.5 to 2 hours at ambient temperature.

Determination of IgM and IgG concentration in rat serum.

Rat serum s were also analysed for the tration of Total Rat IgG1, Rat IgG2b, and Rat IgM using a Double Antibody ELISA Sandwich assay format. Total Rat IgG1, Rat IgG2b, and Rat IgM concentrations were calculated using standard curves generated individually for each isotype. 96-well plated were coated with the respective isotype specific e antibody (either mouse anti-rat IgG1, mouse anti-rat IgG2b, or goat anti-rat IgM) overnight at 2-6 oC, blocked with PBS-Casein-Blocker/Diluent 1 X, washed with ELISA Wash Buffer, incubated with serum, washed with ELISA Wash Buffer, incubated with the respective detecting antibody (either mouse anti-rat IgG or goat anti-rat IgM), washed with ELISA Wash Buffer, incubated with TMB Substrate Solution for 30 minutes and ELISA Stop on was added to the wells. Absorbance in the plate wells was measured at 450 nm. Except where noted above, incubations were for 1.5 to 2 hours at ambient temperature.

Table 1 PCR* conditions to detect human IgH and IgL integration and sion IgH Primers Annealing Temp (Tm-5) Fragment size Hyg (5’ BAC6) Hyg 3’ F -459 54°C ~400bp V4-34 (BAC6) 205-206 65°C ~1kb V4-28 (BAC6) 203-204 65°C ~1kb V3-11 (overlap BAC6- 448-461 60°C ~500bp BAC3) V1-8 (BAC3) 371-372 60°C ~300bp V4-4 (BAC3) 393-396 60°C ~750bp V6-1 (BAC3- 359-360 65°C ~350bp Annabel) JH (Annabel) 368-369 62°C ~250bp µ-γ1 (Annabel) 583-535 62°C ~3kb Ura (3’ Annabel) 241-253 56°C ~3kb Igκ Primers Annealing Temp (Tm-5) nt size KDE 313-314 66°C ~600bp cKappa 307-308 64°C ~600bp V4-1 4 60°C ~300bp V1-5 329-330 64°C ~400bp V1-6 331-332 60°C ~300bp V3-7 309-310 66°C ~700bp V3-15 311-312 66°C ~500bp Igλ Primers Annealing Temp (Tm-5) Fragment size V3-27 215-216 67°C ~400bp V3-19 213-214 67°C ~700bp V2-14 211-212 67°C ~400bp V middle 168-169 65°C ~500bp JLambda 162-163 67°C ~800bp cLambda 170-171 67°C ~500bp er 172-173 67°C ~400bp *For DNA extraction from ear and tail clips the Genomic DNA Mini Kit (Bioline) was used. For PCRs 1kb or less in size GoTaq Green Master mix (Promega) was used under the ing conditions: 94°C 2 mins, 32 x (94°C 30 secs, Tm-5 (below) 30 secs, 72°C 1 min [50 sec for Igκ/λ]), 72°C 2 mins. Annealing temperatures were set at the lowest primer Tm– 50C (www.sigmagenosys.com/calc/DNACalc.asp). For PCRs >1kb KOD polymerase (Novagen) was used under the following conditions: 95°C 2 mins, 32 x (95°C 20 secs, Tm-5 20 secs, 70°C 90 secs), 70°C 2mins.

Table 2 RT-PCR** conditions to detect human IgH and IgL integration and expression IgH Primer Annealing Temp (Tm-5) Fragment size VH1 Leader 390 65°C VH2 Leader 391 65°C VH3 Leader 392 65°C VH4 Leader 393 60°C VH6 Leader 394 65°C VH4-39 Leader 761 55°C Rat µCH2 345 ~1kb Rat γCH2 682 ~800bp Igκ Primer Annealing Temp (Tm-5) Fragment size HuVK1 Leader 400/474 63°C HuVK3 Leader 401/475 63°C HuVK4 Leader 476 63°C HuVK5 Leader 477 63°C Hu κ C region 402 ~600bp Igλ Primer Annealing Temp (Tm-5) Fragment size HuVL2 Leader 388/478 58°C HuVL3 Leader 398/479/480/482/483/481/484 58°C HuVL4 Leader 485 58°C Hu λ C region 387 ~600bp **RNA was extracted from Blood using the RiboPure Blood Kit (Ambion). RNA extracted from , bone marrow or lymph nodes used the RNASpin mini kit (GE Healthcare). cDNA was made using Oligo dT and Promega Reverse riptase at 42°C 1 hour. PCRs using the GoTaq Green Master mix were set up as follows: 94°C 2 mins, 34 x (94°C 30 secs, Tm-5 30 secs, 72°C 1 min [50 sec for Igκ/λ]), 72°C 2 mins.

Table 3 Primer Sequences Number Oligonucleotide sequence 5'-3' 162 GGGGCCAAGGCCCCGAGAGATCTCAGG 163 CACTGGGTTCAGGGTTCTTTCCACC 168 GTGGTACAGAAGTTAGAGGGGATGTTGTTCC 169 TCTTCTACAAGCCCTTCTAAGAACACCTGG 170 AGCACAATGCTGAGGATGTTGCTCC 171 ACTGACCCTGATCCTGACCCTACTGC 172 AAACACCCCTCTTCTCCCACCAGC 173 TGGTGAACCAGTGCTCTG 203 GCTATTTAAGACCCACTCCCTGGCA 204 AAAACCTGCAGCAAGGATGTGAGG 205 GCTCCTTCAGCACATTTCCTACCTGGA 206 CCATATATGGCAAAATGAGTCATGCAGG 211 CTCTGCTGCTCCTCACCCTCCTCACTCAGG 212 GAGAGTGCTGCTGCTTGTATATGAGCTGCA 213 TGGCTCACTCTCCTCACTCTTTGCATAGGTT 214 GATGGTTACCACTGCTGTCCCGGGAGTTAC 215 ATCCCTCTCCTGCTCCCCCTCCTCATTCTCTG 216 TGATGGTCAAGGTGACTGTGGTCCCTGAGCTG 238 AACAAGTGCGTGGAGCAG 241 TTGACATTGCGAAGAGC 243 TGGTTGACATGCTGGCTAGTC 253 TGTCTGGCTGGAATACACTC 275 AAATGAGCTTCAAATTGAGAAGTGACGCAAGCATCAATGGTATAATGTCCAGAGTTGTGAGGC CTTGGGGACTGTGTGCCGAACATGCTC 276 CTGTTCAATCACAGTATGATGAGCCTAATGGGAATCCCACTAGGCTAGTCTAGTCACC ACATTAAAGCACGTGGCCTCTTATCG 278 TGACCATTGCTTCCAAGTCC Number Oligonucleotide sequence 5'-3' 307 GAGGAAAGAGAGAAACCACAGGTGC 308 CACCCAAGGGCAGAACTTTGTTACT 309 TGTCCAGGTATGTTGAAGAATGTCCTCC 310 TGGACTCTGTTCAACTGAGGCACCAG 311 GGCCTTCATGCTGTGTGCAGACTA 312 CAGGTCGCACTGATTCAAGAAGTGAGT 313 TTCAGGCAGGCTCTTACCAGGACTCA 314 TGCTCTGACCTCTGAGGACCTGTCTGTA 329 TCACGTGACTGTGATCCCTAGAA 330 CACTGTTATGCCAACTGAACAGC 331 CGTAGCAGTCCCCATCTGTAATC 332 ATGTCAGAGGAGCAGGAGAGAGA 333 TCACATCCAATATGTTA 334 ATACCCTCCTGACATCTGGTGAA 345 AGTGATGGTCAGTGTGCTTATGAC 346 TGGAAGACCAGGAGATATTCAGGGTGTC 359 TTGCTTAACTCCACACCTGCTCCTG 360 TGCTTGGAACTGGATCAGGCAGTC 368 CACCCTGGTCACCGTCTCC 369 AGACAGTGACCAGGGTGCCAC 371 TGAGGAACGGATCCTGGTTCAGTC 372 ATCTCCTCAGCCCAGCACAGC 383 ATGATTCCAACACTG 384 CTCACCGTCCACCACTGCTG 385 CTGTGCCACAAACATGCAAAGATAAGTTCCATGTGACAAGTCTGAACTCAGTGTTGGAATCATG GGAGGCGGCCGCGTTATCTATGCTGTCTCACCATAG 387 TGCTCAGGCGTCAGGCTCAG 388 TGCTCAGGCGTCAGGCTCAG 390 ATGGACTGGACCTGGAGGATCC 391 TCCACGCTCCTGCTGCTGAC 392 ATGGAGTTTGGGCTGAGCTGG Number ucleotide sequence 5'-3' 393 TGAAACACCTGTGGTTCTTCC 394 TCCTGCCCGTGCTGG 396 GACTCGACTCTTGAGGGACG 398 ATGTGGCCACAGGCTAGCTC 400 ATGAGGGTCCCCGCTCAG 401 ATGGAAGCCCCAGCTCAGC 402 CCTGGGAGTTACCCGATTGG 412 GGCGCGCCAAGCATCATGTCCTACCTGGCTG 414 CAAAGTACGTGGCACCTCCCTCGTCTTTCTTCCTCCTGCTCCAGCCAGGTAGGACATGATGCTTG GCGCGCCGTTATCTATGCTGTCTCACCATAG 429 CAGTGCCAGCCTCGTCTCAT 430 AGGGGCCATCCACAGTCTTC 448 CTTCACTGTGTGTTCTTGGGATAC 459 GTGTAATGCTTTGGACGGTGTGTTAGTCTC 461 GCATAGCGGCGCGCCAAGCATCATGTCCTACCTGGCTG 474 GACATGAGAGTCCTCGCTCAGC 475 CAGCGCAGCTTC 476 ATGGTGTTGCAGACCCAGGTC 477 GTCCCAGGTTCACCTCCTCAG 478 TCCTCASYCTCCTCACTCAGG 479 CGTCCTTGCTTACTGCACAG 480 AGCCTCCTTGCTCACTTTACAG 481 CCTCCTCAYTYTCTGCACAG 482 GCTCACTCTCCTCACTCTTTGC 483 CCTCCTCTCTCACTGCACAG 484 GCCACACTCCTGCTCCCACT 485 ATGGCCTGGGTCTCCTTCTAC 488 ATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGG AAGAATGGCCTCTCCAGGTC 490 CTGTCGTTGAGATGAACCCCAATGTGAG 534 GGAACTGATGTGATCTCAGTCACACAGCTAATGCAAAGGTCAGCAGGCTGTTTACTGCCTGGAG Number ucleotide sequence 5'-3' GTTCATCGCCCAATTCCAAAGTCAC 535 CTAGTCTGCATGGGTCTCCGCAAAC 550 CTGGTATAATCATAAGTCTCCACTTAATAGTTCTGTAGACAGAATCTTCATTTAGACTTACAGAC CGCGGCCGCACCGCAGGGTAATAACTG 561 GCAACCCTTCTTGCCACTCATGTCCCAGCTCTCACCATGTGACATAGCCTGTTAACAATTCGGTCG AAAAAAGAAAAGGAGAG 562 AATGTTCTTAGTATATATAAACAAGCTACTCCCAATTCATAGTCAACTAAGTTAACATTCCACATG TTAAAATAGTGAAGGAG 566 TTAACAGGCTATGTCACATGGTGAGAGCTGGGACATGAGTGGCAAGAAGGGTTGCCAGACTCCCC CTTTACCTCTATATCGTGTTC 570 CTTAGTTGACTATGAATTGGGAGTAGCTTGTTTATATATACTAAGAACATTTGTCAGAAGCTCTTT CTTGTTTATTCCCAGTTTGC 583 CGTATGTTGCATCTGC 682 GGGAAGATGAAGACAGATG 761 TGGAGTGGATTGGGAGT 878 GCGATCGCAAAGACGAAAGGGCCTCGTG 879 ACCTGGTGATCGCCAACAAATACTACC 1066 GCGGTGGGTCTCCCACGGGGGCAAACAGCAGTGGTGGACGGTGAGCGTACGGTTATCTATGCTGTCTCACCATAG 1088 CTGTCAGCTGGAAGCAGTTAAGGTTGGCCTTTGTCTGTATTCGTACGCACACGCTTTTCAATTCAATTCATC RESULTS The human IgH and IgL loci Construction of the human Ig loci employed established technologies to assemble large DNA segments using YACs and BACs (Davies et al. Nucleic acids research , 2693-2698 ; Davies et al. Biotechnology (N Y) 11, 911-914 (1993); Wagner et al.

Genomics 35, 405-414 (1996); Popov et al. Gene 177, 195-201 ; Mundt et al. J Immunol 166, 3315-3323 (2001)). As multiple BAC modifications in E. coli frequently deleted repetitive regions such as switch sequences and enhancers, a method was developed to assemble sequences with overlapping ends in S. cerevisiae as circular YAC (cYAC) and, subsequently, converting such a cYAC into a BAC. Advantages of YACs include their large size, the ease of homologous alterations in the yeast host and the sequence stability, while BACs propagated in E. coli offer the advantages of easy preparation and large yield.

Additionally, detailed restriction mapping and sequencing analysis can be better achieved in BACs than in YACs.

Sequence analysis and digests identified gene clusters of st and ensured locus integrity and functionality to secure DNA rearrangement and switching over a wide region as shown in Figure 1. As shown previously, overlapping regions may generally favor joint ation when co-injected into oocytes (Wagner et al. Genomics 35, 405-414 (1996)).

Thereby, insertion of BAC6-VH3-11, a 182 kb AsiSI-AscI nt, with BAC3, a 173 kb NotI nt, and BAC3-1N12M5I8 (Hu-Rat l), a 193 kb NotI fragment, led to the reconstitution of a fully onal transgenic IgH locus (HC14) in the rat genome. Similarly, ion of BAC9, BAC (14+5) and BAC3-1N12M5I8, led to the reconstitution of a fully functional transgenic IgH locus (HC30) in the rat genome.

Similarly, the human Igκ locus was integrated by homologous overlaps. The human Igλ locus was isolated intact as a ~300 kb YAC and also fully ed into a rat chromosome. The integration success was fied by transcript is which showed V(D)J-C recombinations from the most 5’ to the most 3’ end of the locus injected. Multiple copies were identified by qPCR (not shown) and it is likely that head to tail integrations occurred. In all cases, transgenic animals with single-site integrations were generated by breeding.

Breeding to gosity The derivation of transgenic rats by DNA microinjection into oocytes, their breeding and immunization is comparable to the mouse. r, ZFN technology to obtain gene knock-outs has only been reported recently (Geurts et al. Science 325, 433 (2009); owska et al. PloS one 6, e21045 (2011)). Silencing of the rat IgH locus by JH deletion using ZFN KO technology has been described (Menoret et al. European journal of immunology 40, 2932-2941 (2010)) and a manuscript describing silencing of the rat IgL loci, targeting of Cκ and deletion of J-Cλ genes, is in ation. We derived multiple founders with ated human Ig loci and silenced endogenous Ig production; all analyzed by PCR and FISH with complete trans-locus integration selected and interbred (Table 4). Several founder rats carried low translocus copy s; with the rat C-gene BAC in OmniRat™ likely to be fully ated in 5 copies as determined by qPCR of Cµ and Cα products (not shown). Identification by FISH of single position insertion in many lines confirmed that spreading or le integration of BAC mixtures were rare; an advantage for breeding to homozygosity, which was achieved.

Table 4: Generated rat lines: transgenic integration, knock-out and gene usage human human human VH rat CH ZFN KO FISH Igk Igl VH BACs (Annabel) BACs Igl YAC Igκ Igγ rat rat line about 400 JH KO 193 kb 300 kb 300 kb KO KO chromosome HC14 √ √ 5q22 HC30 √ √ 15q24 homozygous OmniRat √ √ √ √ √ √ √ LC#79 √ 17 LC#6.2 √ 6q23 #117 √ 6q32 #23 √ 4 #35 √ 11 Rats carrying the individual human transloci - IgH, Igκ and Igλ - were crossbred successfully to gosity with Ig locus KO rats. This produced a highly efficient new multi-feature line (OmniRats™) with human VH-D-JH regions of over 400 kb containing 22 functional VHs and a rat C region of ~116 kb. DNA ngement, expression levels, class-switching and hypermutation was very similar between the different founders and able to wt rats. This is probably the result of the associated rat constant region accommodating several Cs and with the 3’E (enhancer control) region in authentic configuration. OmniRat animals carrying the HC14 heavy chain locus were bred with t animals carrying the HC30 locus to generate OmniRat2. t2 animals contain two heavy chain loci containing 43 functional VHs.

B-cell development in the knock-out background To assess whether the introduced human Ig loci were capable of reconstituting normal B-cell pment flow cytometric analyses were performed. Particular differentiation stages were analyzed in spleen and bone marrow lymphocytes (Osborn et al. J Immunol 2013; 190:1481-1490), which previously showed a lack of B-cell development in JKO/JKO rats (Menoret et al. European l of immunology 40, 2932-2941 (2010)), and no corresponding IgL expression in κKO/κKO as well as in O animals (data not . Most striking was the complete recovery of B-cell development in OmniRats compared to wt animals, with similar numbers of B220(CD45R)+ lymphocytes in bone marrow and spleen. IgM expression in a large proportion of CD45R+ B-cells marked a fully reconstituted immune system. Size and shape separation of spleen cells was indistinguishable between ts™ and wt animals and thus successfully restored in the transgenic rats expressing human idiotypes with rat C region. Moreover, the small sIgG+ lymphocyte population was present in OmniRats (Osborn et al. J Immunol 2013; 190:1481-1490).

The analysis of other OmniRat lymphocyte tissues showed that they were inguishable from wt ls and, for example, T-cell subsets were fully retained (data not shown), which further supports the notion that optimal immune function has been completely restored.

Ig levels in serum To gain unambiguous ation about antibody tion we ed y and ty of serum Ig from HC30 and HC14/HC30 animals ( The results demonstrated that animals with one Ig locus (HC30) expressed similar amounts of IgM and IgG in serum compared to animals with two heavy chain loci (HC14 and HC30).

ELISA analysis of serum from immunized OmniRat animals with one HC locus (HC30) or two HC loci (HC14 and HC30) revealed similar titers of anti-beta gal IgM and IgG in such animals (.

Diverse human H- and L-chain transcripts Extensive transcriptional analysis was carried out using blood lymphocytes or spleen cells from transgenic rats with onal endogenous Ig loci. RT-PCR from specific human VH group forward to Cµ or Cγ reverse s, showed human VHDJH usage. For L- chain analysis group specific human Vκ or Vλ forward primers were used with Cκ or Cλ reverse s.

In addition, B-cells from animals were collected, RNA was prepared and reverse transcribed, and the resulting cDNA was used as template to amplify the full le region of the Ig heavy chain rearranged locus (the VH region). This amplified t was then prepared for next-generation sequencing (NGS) and the full VH repertoire of each animal was determined by NGS. After post-processing and quality control of the raw NGS reads, the V-gene usage of each animal was determined by aligning each unique VH sequence to the germline V-gene reference sequence. The percent V-gene usage was calculated as the number of VH sequences using a particular V-gene divided by the total number of VH sequences in that animal. Of the 43 total human V-genes introduced on the transgenes in OmniRat2, we detect 33 V-genes expressed at a level greater than 0.1% in a rearranged IgG transcript.

The results of the RT-PCR VH-gene expression analysis and NGS repertoire analysis are summarized in Figure 1. These result showed the use of all ated human VH genes regarded as functional (Lefranc & Lefranc The immunoglobulin factsbook. FactsBook Series, Academic Press, GB, 45-68 (2001)) in combination with diverse use of D segments and all JH segments.

The results clearly demonstrate that addition of more variable regions provided by the two loci (HC14+HC30) leads to an even broader antibody repertoire. In conclusion, we have demonstrated that antigen specific high affinity Abs of potentially any class can be produced in transgenic animals with one or two Ig heavy chain loci. This technology will allow the production of fully human Abs of any class or fragments thereof in response to antigen challenge for use as therapeutic or diagnostic agents in man. By using different loci our technology also allows for the production of high affinity matured antibodies from rodents for use as reagents, diagnostics or for the treatment of humans.

DISCUSSION A combination of human and rat genes to le a novel IgH locus has resulted in highly efficient near normal expression of dies with human idiotypes. er, ation of the human Igκ and Igγ loci ed that chimeric Ig with fully human specificity is readily produced and that association of rat C-regions with human L- chains is not detrimental. Advantages of using part of the rat IgH locus are that speciesspecific C regions and er control elements are kept in their natural configuration, with essentially only the diverse human VH D JH region being transplanted. Furthermore, sion of antibodies with rat Fc-regions allow normal B-cell receptor assembly and optimal activation of the downstream signalling pathway essential for the initiation of highly efficient immune responses. In particular, the quality of an immune response to antigen challenge relies on combined actions of many receptor associated signalling and modifier components (see: www.biocarta.com/pathfiles/h bcrpathway.asp).

The approach of using YACs and BACs, and interchanging between the two, has the advantage of both, speed and the ability to check ity when making constructs of large regions by overlapping homology. Several founder rats carried low ocus copy numbers; with the rat C-gene BAC in OmniRat likely to be fully integrated in 5 copies as determined by qPCR of Cμ and Cα products (not shown). Identification by FISH of single position insertion in many lines confirmed that spreading or le integration of BAC es were rare; an advantage for breeding to homozygosity, which was achieved. Little was known whether extensive overlapping regions would integrate, such as to maintain the full functionality, essential for DNA rearrangement. Previously, overlapping integration has been reported but for much smaller regions (<100 kb) (Wagner et al. Genomics 35, 405-414 (1996); mann et al. European journal of immunology 21, 1323-1326 (1991)) and our results suggest that desired integration by homology or in tandem is a frequent event. This eases the transgenic technology ntially as no laborious integration of large YACs into stem cells and subsequent animal derivation therefrom has to be performed. z et al.

Nature genetics 15, 146-156 (1997); Davies et al. Biotechnology (N Y) 11, 911-914 (1993)) In addition, ZFN technology, also performed via DNA injection (Geurts et al. Science 325, 433 (2009); Menoret et al. European journal of logy 40, 2932-2941 (2010)), produced Ig KO strains easily and may well be the future technology of choice for gene disruptions and replacement. Silenced endogenous Ig gene expression in OmniRats, containing human-rat IgH and human IgL loci, has the age that no interfering or undesired rat Ig could give rise to mixed products. Interestingly, immunization and hybridoma generation in OmniRats still producing wt Ig revealed that many products were fully human, human-rat IgH and human IgL, despite lete Ig KOs. Here, despite the extensive number of wt V genes, it was remarkable that the introduced human genes amplified readily and thus showed to be efficient expression competitors. This is in line with the ation of generally good expression levels of all our integrated transgenes, which favorably compete with the endogenous loci. Previously in mice sing a human antibody repertoire, Ig KOs were essential as little expression of human ts was found when wt Ig is ed (Bruggemann et al. PNAS 86, 6709-6713 (1989); Mendez et al. Nature genetics 15, 146-156 (1997)).

It is possible that the production of fully human Ig loci even in Ig KO mice is suboptimal as strain specific cis-acting sequences are required for evel expression. In the mouse an er region downstream of Cα plays a vital role in class-switch recombination (Vincent-Fabert et al. Blood 116, 1895-1898 (2010)) and it is likely that ts in that region may facilitate hypermutation (Pruzina et al. n engineering, design & selection : PEDS 24, 791-799 (2011)). This may be the reason why immune responses and generation of diverse hybridomas at high frequency may be difficult in mice carrying even a large fully human locus (Davis et al. Cancer metastasis reviews 18, 421-425 (1999); Lonberg Current opinion in immunology 20, 450-459 (2008)). As the chimeric human-rat IgH locus facilitates near wt differentiation and expression levels in OmniRats, it can be concluded that the endogenous rat C region and indeed the —30 kb enhancer sequence 3' of Cα are ing optimal locus control to express and mature human VH genes.

Another region, Cδ with its 3' control motif cluster (Mundt et al. J Immunol 166, 3315-3323 (2001)), has been removed from the chimeric C-region BAC since silencing or a lack of IgD did not appear to reduce immune function 37. Normally, mature IgM+IgD+ B-cells downregulate IgD upon antigen contact, which initiates class-switch recombination (Chen Immunol Rev 237, 160-179 (2010)). Thus, ing may be increased without IgD control, which is supported by our finding that IgG transcripts and serum levels are significantly lower when the Cδ region is retained in transgenic constructs (data not shown).

The production of specific IgG in OmniRats is particularly encouraging as we found that in s immunizations mAbs with diversity in sequence and epitope, comparable to what was ed in wt controls, could be ed via spleen and lymph node fusion. V-gene, D and J ity was as expected and nearly all segments were found to be used productively as predicted (Lefranc & Lefranc The immunoglobulin factsbook.

FactsBook , Academic Press, GB, 45-68 ). This was in stark contrast to mice carrying fully human transloci where clonal ion from a few precursor B-cells produced little diversity (Pruzina et al. Protein engineering, design & selection : PEDS 24, 9 (2011)). Since the number of transplanted V-genes is only about half of what is used in humans we anticipated to find restricted immune responses and limited diversity when comparing ts with wt animals. However, this was not the case and a comparison of CDR3 diversity in over 1000 clones revealed the same extensive junctional differences in OmniRats as in wt animals. The few identical gene-segment combinations were further diversified by N-sequence ons or deletion at the VH to D and/or D to JH junctions and also by hypermutation. Thus, it is clear that the rat C region sequence is highly efficient in controlling DNA rearrangement and expression of human VHDJH. Extensive diversity was also seen for the introduced human Igκ and Igγ loci, similar to what has previously been shown in mice (Nicholson et al. J Immunol 163, 6898-6906 (1999); Pruzina et al. Protein engineering, design & selection : PEDS 24, 791-799 (2011); Popov et al. The Journal of mental medicine 189, 1611-1620 (1999)). Hence, ntially reduced efficiency in the production of human antibodies from mice (Lonberg Nature biotechnology 23, 1117-1125 (2005)) has been overcome in OmniRats, which diversify rearranged H-chains reliably and ively by class-switch and hypermutation to yield high ty antibodies in bulk rather than onally. The yield of transgenic IgG and the level of hypermutation, impressively utilized in antigen-specific mAbs, showed that clonal diversification and production level are similar between OmniRats and wt animals. Routine tion of high affinity icities in the omolar range was even accomplished by different single immunizations and again compares favorably with wt s; results that have not been shown in transgenic mice producing human antibody repertoires from ly human loci. (Mendez et al. Nature genetics 15, 146-156 (1997)) In summary, to maximize human antibody production an IgH locus that uses human genes for antibody specificity but rodent genes for control of differentiation and high expression should be regarded essential. L-chain flexibility is a bonus as it permits highly efficient human IgH/IgL assembly even when wt Ig is present. For therapeutic applications chimeric H-chains can be easily converted into fully human Abs by C-gene replacement without compromising the specificity.

All patents and patent publications referred to herein are hereby incorporated by reference.

Certain modifications and improvements will occur to those skilled in the art upon a reading of the foregoing ption. It should be tood that all such modifications and improvements have been deleted herein for the sake of conciseness and readability but are properly within the scope of the following claims.

Claims (22)

Claims:

1. A transgenic animal comprising at least one inactivated endogenous Ig locus and a plurality of artificial transgenic Ig heavy chain loci integrated in the animal’s genome at different chromosomal sites.

2. The transgenic animal according to claim 1, wherein the plurality of artificial Ig heavy chain loci comprise (i) a V-region having at least one human V gene t encoding a germline or hypermutated human V-region amino acid sequence; (ii) one or more J gene segments; and (iii) one or more nt region gene ts, wherein said artificial Ig heavy chain loci are onal and capable of undergoing gene rearrangement and act cooperatively to produce a repertoire of artificial immunoglobulins.

3. The transgenic animal of claim 2, n the at least two artificial Ig heavy chain loci comprise the full complement of human variable heavy chain s between them.

4. The transgenic animal of claim 1, wherein said artificial heavy chain loci comprise overlapping heavy chain gene segments.

5. The transgenic animal according to claim 1, wherein said transgenic animal lacks a functional endogenous Ig light chain locus.

6. The transgenic animal according to claim 1, wherein said transgenic animal lacks a functional endogenous Ig heavy chain locus.

7. The transgenic animal according to claim 1, wherein said transgenic animal expresses a diverse repertoire of antibodies encoded by V-genes from transgenic immunoglobulin loci located at different somal sites.

8. The transgenic animal of claim 7, wherein said enic animal lacks a functional Ig light chain locus and is capable of producing heavy chain-only antibodies.

9. The transgenic animal of claim 2, wherein at least one of the artificial Ig heavy chain loci ses at least one human immunoglobulin (Ig) joining (J) region gene, an Ig constant region gene, and a rat 3’ enhancer.

10. The transgenic animal of claim 9, wherein said rat 3’ er comprises the sequence set forth as SEQ ID NO:1.

11. The transgenic animal as in any of the preceding claims, further comprising at least one human Ig le (V) region gene and/or a human Ig diversity (D) region gene.

12. The transgenic animal of claim 2 or 9, wherein the constant region gene is selected from the group ting of a human constant region gene and a rat constant region gene.

13. The transgenic animal of claim 12, wherein the constant region gene comprises a rat constant region gene.

14. The transgenic animal of claim 2 or 9, wherein the nt region gene comprises a constant region gene selected from the group consisting of Cμ and Cγ.

15. The transgenic animal as in any of the preceding claims, comprising a nucleic acid sequence substantially homologous to bacterial artificial chromosome (BAC) Annabel, or a portion thereof.

16. The enic animal as in any of claims 11-15 wherein said human Ig V region comprises at least one human V region gene isolatable from BAC6-VH3-11 and/or BAC3.

17. The transgenic animal as in any of the preceding claims comprising nucleic acid sequences (a) and (b) in 5’ to 3’ order: (a) a human Ig variable region comprising human V region genes in l configuration isolatable from H3-11 and/or BAC3; and (b) a human Ig joining region comprising human J region genes in natural configuration isolatable from the bacterial artificial chromosome (BAC) Annabel.

18. The transgenic animal as in any of claims 11-17, wherein each of the human immunoglobulin variable region, the human immunoglobulin diversity region, the human immunoglobulin joining region, the immunoglobulin constant , and the rat 3’ enhancer are in the relative positions shown in .

19. The transgenic animal as in claim 18, comprising a nucleic acid sequence substantially homologous to the c acid ce set forth as SEQ ID NO:2.

20. The transgenic animal as in claim 18, comprising a nucleic acid sequence substantially homologous to the nucleic acid sequence set forth as SEQ ID NO:11.

21. The transgenic animal as in any of claims 11-18, wherein said V-D-J regions are rearranged and form a complete exon encoding a heavy chain variable .

22. The transgenic animal as in any of claims 11-15 n said human Ig V region comprises at least one human V region gene isolatable from BAC9-VH3-53 and/or BAC